#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PTCHD2	57540	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	11561526	11561526	+	Silent	SNP	G	G	A			TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr1:11561526G>A	ENST00000294484.6	+	2	615	c.477G>A	c.(475-477)ctG>ctA	p.L159L	PTCHD2_ENST00000389575.3_Silent_p.L159L	NM_020780.1	NP_065831.1	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	159					cholesterol homeostasis (GO:0042632)|regulation of lipid transport (GO:0032368)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	hedgehog receptor activity (GO:0008158)			NS(3)|breast(2)|endometrium(9)|kidney(4)|large_intestine(5)|lung(34)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	76	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		TGCAGCAGCTGCATCTCGGCA	0.672																																					p.L159L		.											.	PTCHD2-209	0			c.G477A						.						15.0	18.0	17.0					1																	11561526		1941	4135	6076	SO:0001819	synonymous_variant	57540	exon2			GCAGCTGCATCTC	AB037758	CCDS41247.1	1p36.22	2010-02-17			ENSG00000204624	ENSG00000204624			29251	protein-coding gene	gene with protein product		611251				15738394	Standard	NM_020780		Approved	KIAA1337, DISP3	uc001ash.4	Q9P2K9	OTTHUMG00000002074	ENST00000294484.6:c.477G>A	1.37:g.11561526G>A		Somatic	38	0		WXS	Illumina GAIIx	Phase_I	22	8	NM_020780	0	0	0	0	0	Q5VTU9|Q9UJD6	Silent	SNP	ENST00000294484.6	37	CCDS41247.1																																																																																			.		0.672	PTCHD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000005770.2	XM_052561	
VPS13D	55187	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	12309384	12309384	+	Silent	SNP	T	T	G			TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr1:12309384T>G	ENST00000358136.3	+	6	682	c.552T>G	c.(550-552)gcT>gcG	p.A184A	VPS13D_ENST00000356315.4_Silent_p.A184A	NM_015378.2	NP_056193.2			vacuolar protein sorting 13 homolog D (S. cerevisiae)											NS(1)|breast(6)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(28)|lung(44)|ovary(5)|pancreas(1)|prostate(8)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(4)	130	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		TGCAAAATGCTGTGAATGAGC	0.418																																					p.A184A		.											.	VPS13D-95	0			c.T552G						.						146.0	120.0	129.0					1																	12309384		2203	4300	6503	SO:0001819	synonymous_variant	55187	exon6			AAATGCTGTGAAT	AJ608774	CCDS30588.1, CCDS30589.1	1p36.21	2008-02-05	2006-04-04		ENSG00000048707	ENSG00000048707			23595	protein-coding gene	gene with protein product		608877	"""vacuolar protein sorting 13D (yeast)"""				Standard	NM_015378		Approved	FLJ10619, KIAA0453	uc001atv.3	Q5THJ4	OTTHUMG00000013155	ENST00000358136.3:c.552T>G	1.37:g.12309384T>G		Somatic	65	0		WXS	Illumina GAIIx	Phase_I	127	48	NM_015378	0	0	0	0	0		Silent	SNP	ENST00000358136.3	37	CCDS30588.1																																																																																			.		0.418	VPS13D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000036897.2	NM_015378	
PHC2	1912	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	33820015	33820015	+	Silent	SNP	C	C	T	rs557095087		TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr1:33820015C>T	ENST00000257118.5	-	8	1595	c.1542G>A	c.(1540-1542)ccG>ccA	p.P514P	PHC2_ENST00000373422.3_Silent_p.P120P|PHC2_ENST00000431992.1_Silent_p.P485P|PHC2_ENST00000419414.2_Silent_p.P515P|RP11-415J8.5_ENST00000432703.1_RNA|PHC2_ENST00000373416.1_5'UTR	NM_198040.2	NP_932157.1	Q8IXK0	PHC2_HUMAN	polyhomeotic homolog 2 (Drosophila)	514					multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	heterochromatin (GO:0000792)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				GAGCTGGGGACGGCTGGATGT	0.607																																					p.P514P		.											.	PHC2-227	0			c.G1542A						.						98.0	88.0	91.0					1																	33820015		2203	4300	6503	SO:0001819	synonymous_variant	1912	exon8			TGGGGACGGCTGG	AJ419231	CCDS378.1, CCDS379.1	1p34.3	2013-01-10	2006-09-12	2002-11-15	ENSG00000134686	ENSG00000134686		"""Sterile alpha motif (SAM) domain containing"""	3183	protein-coding gene	gene with protein product		602979	"""early development regulator 2 (homolog of polyhomeotic 2)"", ""polyhomeotic-like 2 (Drosophila)"""	EDR2		9121482, 12384788	Standard	NM_198040		Approved	HPH2	uc001bxg.1	Q8IXK0	OTTHUMG00000004133	ENST00000257118.5:c.1542G>A	1.37:g.33820015C>T		Somatic	81	0		WXS	Illumina GAIIx	Phase_I	123	55	NM_198040	0	0	1	1	0	A1L4Q1|A8KA40|D3DPR2|Q2TAL3|Q5T0C1|Q6NUJ6|Q6ZQR1|Q8N306|Q8TAG8|Q96BL4|Q9Y4Y7	Silent	SNP	ENST00000257118.5	37	CCDS378.1																																																																																			.		0.607	PHC2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000011895.1	NM_198040	
LCE1B	353132	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	152785074	152785097	+	In_Frame_Del	DEL	GCTGTGGCTCCAGCTCTGGGGGAA	GCTGTGGCTCCAGCTCTGGGGGAA	-	rs200498928|rs558857952|rs371726318|rs79241619	byFrequency	TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10	GCTGTGGCTCCAGCTCTGGGGGAA	GCTGTGGCTCCAGCTCTGGGGGAA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr1:152785074_152785097delGCTGTGGCTCCAGCTCTGGGGGAA	ENST00000360090.3	+	1	628_651	c.152_175delGCTGTGGCTCCAGCTCTGGGGGAA	c.(151-177)tgctgtggctccagctctgggggaagc>tgc	p.CGSSSGGS52del		NM_178349.1	NP_848126.1	Q5T7P3	LCE1B_HUMAN	late cornified envelope 1B	52	Gly-rich.				keratinization (GO:0031424)			p.C51F(1)|p.S56C(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(5)|skin(2)	18	Lung NSC(65;9.06e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			TCCGGAGGCTGCTGTGGCTCCAGCTCTGGGGGAAGCTGTGGCTC	0.652																																					p.51_59del		.											.	LCE1B-68	2	Substitution - Missense(2)	cervix(1)|breast(1)	c.152_175del						.																																			SO:0001651	inframe_deletion	353132	exon1			GAGGCTGCTGTGG	BI670515	CCDS1027.1	1q21.3	2008-02-05	2004-10-11	2004-10-15	ENSG00000196734	ENSG00000196734		"""Late cornified envelopes"""	16611	protein-coding gene	gene with protein product		612604	"""small proline rich-like (epidermal differentiation complex) 2A"""	SPRL2A		11698679	Standard	NM_178349		Approved	LEP2	uc001faq.3	Q5T7P3	OTTHUMG00000014402	ENST00000360090.3:c.152_175delGCTGTGGCTCCAGCTCTGGGGGAA	1.37:g.152785074_152785097delGCTGTGGCTCCAGCTCTGGGGGAA	ENSP00000353203:p.Cys52_Ser59del	Somatic	105	0		WXS	Illumina GAIIx	Phase_I	105	22	NM_178349	0	0	0	0	0	A4IF40	In_Frame_Del	DEL	ENST00000360090.3	37	CCDS1027.1																																																																																			.		0.652	LCE1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040060.1	NM_178349	
LCE1A	353131	hgsc.bcm.edu	37	1	152800122	152800122	+	Silent	SNP	C	C	T	rs148143373	byFrequency	TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr1:152800122C>T	ENST00000335123.2	+	1	174	c.174C>T	c.(172-174)ggC>ggT	p.G58G		NM_178348.2	NP_848125.1	Q5T7P2	LCE1A_HUMAN	late cornified envelope 1A	58	Cys-rich.				keratinization (GO:0031424)					endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|prostate(1)|skin(1)	8	Lung NSC(65;9.06e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			GCTCTGGGGGCGGCTGCAGCT	0.667													C|||	3	0.000599042	0.0015	0.0	5008	,	,		13217	0.0		0.001	False		,,,				2504	0.0				p.G58G		.											.	LCE1A-70	0			c.C174T						.	C		0,4406		0,0,2203	36.0	42.0	40.0		174	-0.7	0.7	1	dbSNP_134	40	1,8599		0,1,4299	no	coding-synonymous	LCE1A	NM_178348.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		58/111	152800122	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	353131	exon1			TGGGGGCGGCTGC		CCDS1028.1	1q21.3	2011-01-28			ENSG00000186844	ENSG00000186844		"""Late cornified envelopes"""	29459	protein-coding gene	gene with protein product		612603				11698679	Standard	NM_178348		Approved	LEP1	uc010pdw.2	Q5T7P2	OTTHUMG00000012447	ENST00000335123.2:c.174C>T	1.37:g.152800122C>T		Somatic	73	0		WXS	Illumina GAIIx	Phase_I	73	8	NM_178348	0	0	0	0	0		Silent	SNP	ENST00000335123.2	37	CCDS1028.1																																																																																			C|1.000;T|0.000		0.667	LCE1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034660.2	NM_178348	
LCE1A	353131	bcgsc.ca	37	1	152800131	152800131	+	Silent	SNP	C	C	T			TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr1:152800131C>T	ENST00000335123.2	+	1	183	c.183C>T	c.(181-183)agC>agT	p.S61S		NM_178348.2	NP_848125.1	Q5T7P2	LCE1A_HUMAN	late cornified envelope 1A	61	Cys-rich.				keratinization (GO:0031424)					endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|prostate(1)|skin(1)	8	Lung NSC(65;9.06e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			GCGGCTGCAGCTCTGGGGGAG	0.677																																					p.S61S		.											.	LCE1A-70	0			c.C183T						.						34.0	40.0	38.0					1																	152800131		2203	4300	6503	SO:0001819	synonymous_variant	353131	exon1			CTGCAGCTCTGGG		CCDS1028.1	1q21.3	2011-01-28			ENSG00000186844	ENSG00000186844		"""Late cornified envelopes"""	29459	protein-coding gene	gene with protein product		612603				11698679	Standard	NM_178348		Approved	LEP1	uc010pdw.2	Q5T7P2	OTTHUMG00000012447	ENST00000335123.2:c.183C>T	1.37:g.152800131C>T		Somatic	78	1		WXS	Illumina GAIIx	Phase_I	73	11	NM_178348	0	0	0	0	0		Silent	SNP	ENST00000335123.2	37	CCDS1028.1																																																																																			.		0.677	LCE1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034660.2	NM_178348	
SLC9C2	284525	broad.mit.edu;bcgsc.ca	37	1	173499091	173499091	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr1:173499091C>A	ENST00000367714.3	-	18	2688	c.2266G>T	c.(2266-2268)Gcc>Tcc	p.A756S	SLC9C2_ENST00000536496.1_3'UTR|SLC9C2_ENST00000466087.1_5'UTR	NM_178527.3	NP_848622.2	Q5TAH2	SL9C2_HUMAN	solute carrier family 9, member C2 (putative)	756					sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)	solute:proton antiporter activity (GO:0015299)										AGAAGTTTGGCATCTTCTTGA	0.358																																					p.A756S		.											.	.	0			c.G2266T						.						165.0	154.0	158.0					1																	173499091		2203	4300	6503	SO:0001583	missense	284525	exon18			GTTTGGCATCTTC	AK128104	CCDS1308.1	1q25.1	2013-07-18	2013-07-18	2012-03-22	ENSG00000162753	ENSG00000162753		"""Solute carriers"""	28664	protein-coding gene	gene with protein product			"""solute carrier family 9, isoform 11"", ""solute carrier family 9, member 11"", ""solute carrier family 9, member C2"""	SLC9A11			Standard	NM_178527		Approved	MGC43026	uc001giz.2	Q5TAH2	OTTHUMG00000034800	ENST00000367714.3:c.2266G>T	1.37:g.173499091C>A	ENSP00000356687:p.Ala756Ser	Somatic	61	0		WXS	Illumina GAIIx	Phase_I	75	6	NM_178527	0	0	0	0	0	Q86UF3	Missense_Mutation	SNP	ENST00000367714.3	37	CCDS1308.1	.	.	.	.	.	.	.	.	.	.	C	14.89	2.671007	0.47781	.	.	ENSG00000162753	ENST00000367714	T	0.04654	3.58	5.08	-0.989	0.10242	.	0.763835	0.11350	N	0.573045	T	0.01661	0.0053	L	0.40543	1.245	0.80722	D	1	B	0.30406	0.278	B	0.27887	0.084	T	0.48043	-0.9069	10	0.54805	T	0.06	-5.9354	9.22	0.37370	0.0:0.5839:0.0:0.4161	.	756	Q5TAH2	S9A11_HUMAN	S	756	ENSP00000356687:A756S	ENSP00000356687:A756S	A	-	1	0	SLC9A11	171765714	0.987000	0.35691	0.814000	0.32528	0.982000	0.71751	-0.077000	0.11394	-0.458000	0.07023	0.609000	0.83330	GCC	.		0.358	SLC9C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084205.1	NM_178527	
DNAH14	127602	broad.mit.edu	37	1	225569241	225569241	+	Missense_Mutation	SNP	T	T	G	rs950210	byFrequency	TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr1:225569241T>G	ENST00000445597.2	+	56	9707	c.9707T>G	c.(9706-9708)tTt>tGt	p.F3236C	DNAH14_ENST00000439375.2_Missense_Mutation_p.F4244C|DNAH14_ENST00000430092.1_Missense_Mutation_p.F4244C			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14	3236					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						GAGGAAATATTTAACTCTTTT	0.313													T|||	2646	0.528355	0.1936	0.7435	5008	,	,		19810	0.7639		0.6561	False		,,,				2504	0.454				p.F4244C		.											.	DNAH14-23	0			c.T12731G						.	T	CYS/PHE	339,1045		46,247,399	112.0	99.0	103.0		12731	1.2	0.0	1	dbSNP_86	103	2090,1092		681,728,182	yes	missense	DNAH14	NM_001373.1	205	727,975,581	GG,GT,TT		34.318,24.4942,46.8025	probably-damaging	4244/4516	225569241	2429,2137	692	1591	2283	SO:0001583	missense	127602	exon79			AAATATTTAACTC	U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.9707T>G	1.37:g.225569241T>G	ENSP00000409472:p.Phe3236Cys	Somatic	109	0		WXS	Illumina GAIIx	Phase_I	159	5	NM_001373	0	0	1	1	0	A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Missense_Mutation	SNP	ENST00000445597.2	37		1319	0.6039377289377289	104	0.21138211382113822	266	0.7348066298342542	459	0.8024475524475524	490	0.6464379947229552	T	8.539	0.872719	0.17322	0.244942	0.65682	ENSG00000185842	ENST00000445597;ENST00000430092;ENST00000439375	T;T;T	0.08807	3.05;3.05;3.05	4.87	1.16	0.20824	.	.	.	.	.	T	0.00012	0.0000	L	0.42632	1.34	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.06285	-1.0835	8	0.40728	T	0.16	.	2.9207	0.05768	0.634:0.132:0.0827:0.1513	rs950210;rs17523206;rs52794520;rs60079724;rs950210	4244	Q0VDD8-4	.	C	3236;4244;4244	ENSP00000409472:F3236C;ENSP00000414402:F4244C;ENSP00000392061:F4244C	ENSP00000414402:F4244C	F	+	2	0	DNAH14	223635864	0.136000	0.22515	0.000000	0.03702	0.003000	0.03518	2.893000	0.48633	0.225000	0.20959	-0.323000	0.08544	TTT	T|0.433;G|0.566		0.313	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000331217.3	XM_059166	
OPN4	94233	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	88419681	88419681	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr10:88419681G>A	ENST00000241891.5	+	6	997	c.830G>A	c.(829-831)gGc>gAc	p.G277D	OPN4_ENST00000372071.2_Missense_Mutation_p.G288D	NM_033282.3	NP_150598.1	Q9UHM6	OPN4_HUMAN	opsin 4	277					phototransduction (GO:0007602)|protein-chromophore linkage (GO:0018298)|regulation of circadian rhythm (GO:0042752)|rhodopsin mediated signaling pathway (GO:0016056)|rhythmic process (GO:0048511)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	11-cis retinal binding (GO:0005502)|G-protein coupled photoreceptor activity (GO:0008020)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|liver(2)|lung(5)|ovary(3)	18						GCCTGCAAGGGCAATGGCGAG	0.632																																					p.G288D		.											.	OPN4-69	0			c.G863A						.						104.0	77.0	86.0					10																	88419681		2203	4300	6503	SO:0001583	missense	94233	exon7			GCAAGGGCAATGG	AF147788	CCDS7376.1, CCDS31237.1	10q22	2012-08-08	2008-04-16		ENSG00000122375	ENSG00000122375		"""GPCR / Class A : Opsin receptors"""	14449	protein-coding gene	gene with protein product	"""melanopsin"""	606665	"""opsin 4 (melanopsin)"""			10632589	Standard	NM_001030015		Approved	MOP, melanopsin	uc001kdp.3	Q9UHM6	OTTHUMG00000018654	ENST00000241891.5:c.830G>A	10.37:g.88419681G>A	ENSP00000241891:p.Gly277Asp	Somatic	163	0		WXS	Illumina GAIIx	Phase_I	174	12	NM_001030015	0	0	0	0	0	B7ZLB3|Q14D01|Q2PP22|Q8NGQ9	Missense_Mutation	SNP	ENST00000241891.5	37	CCDS7376.1	.	.	.	.	.	.	.	.	.	.	G	5.864	0.343624	0.11126	.	.	ENSG00000122375	ENST00000372071;ENST00000241891;ENST00000443292	T;T;T	0.70631	-0.46;-0.07;-0.5	5.16	2.27	0.28462	GPCR, rhodopsin-like superfamily (1);	0.674330	0.14623	N	0.308312	T	0.51160	0.1658	N	0.20881	0.62	0.09310	N	0.999991	B;B;B	0.16802	0.009;0.005;0.019	B;B;B	0.21360	0.034;0.02;0.026	T	0.30650	-0.9971	10	0.12430	T	0.62	.	8.0831	0.30756	0.3807:0.0:0.6193:0.0	.	288;277;288	C9JWU6;Q9UHM6;Q9UHM6-2	.;OPN4_HUMAN;.	D	288;277;288	ENSP00000361141:G288D;ENSP00000241891:G277D;ENSP00000393132:G288D	ENSP00000241891:G277D	G	+	2	0	OPN4	88409661	0.798000	0.28890	0.033000	0.17914	0.095000	0.18619	1.989000	0.40707	0.579000	0.29504	-0.142000	0.14014	GGC	.		0.632	OPN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049158.2	NM_033282	
DNAJC4	3338	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	64001585	64001585	+	Missense_Mutation	SNP	G	G	T	rs568199754	byFrequency	TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr11:64001585G>T	ENST00000321685.3	+	7	1120	c.655G>T	c.(655-657)Ggg>Tgg	p.G219W	DNAJC4_ENST00000355040.4_3'UTR|RP11-783K16.14_ENST00000534988.1_RNA|DNAJC4_ENST00000321460.5_Nonstop_Mutation_p.*250Y|VEGFB_ENST00000309422.2_5'Flank|RP11-783K16.14_ENST00000539963.1_RNA|VEGFB_ENST00000426086.2_5'Flank	NM_005528.3	NP_005519.2	Q9NNZ3	DNJC4_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 4	219					protein folding (GO:0006457)|response to unfolded protein (GO:0006986)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)	unfolded protein binding (GO:0051082)			endometrium(1)|lung(1)|prostate(1)	3						ACAACGGCTAGGGCAGCGGCA	0.687																																					p.G219W		.											.	DNAJC4-226	0			c.G655T						.						11.0	17.0	15.0					11																	64001585		1978	4153	6131	SO:0001583	missense	3338	exon7			CGGCTAGGGCAGC	AF012106	CCDS41666.1	11q13	2011-09-02			ENSG00000110011	ENSG00000110011		"""Heat shock proteins / DNAJ (HSP40)"""	5271	protein-coding gene	gene with protein product		604189		HSPF2		9473517, 11147971	Standard	NM_005528		Approved	MCG18	uc001nys.3	Q9NNZ3	OTTHUMG00000167792	ENST00000321685.3:c.655G>T	11.37:g.64001585G>T	ENSP00000396896:p.Gly219Trp	Somatic	60	0		WXS	Illumina GAIIx	Phase_I	54	7	NM_005528	0	0	125	151	26	O14716	Missense_Mutation	SNP	ENST00000321685.3	37	CCDS41666.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	9.227|9.227	1.034849|1.034849	0.19590|0.19590	.|.	.|.	ENSG00000110011|ENSG00000110011	ENST00000321685|ENST00000321460;ENST00000535246	T|.	0.23147|.	1.92|.	4.86|4.86	1.29|1.29	0.21616|0.21616	.|.	2.152570|.	0.03691|.	N|.	0.247058|.	T|.	0.16514|.	0.0397|.	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	P|.	0.38788|.	0.647|.	B|.	0.33295|.	0.161|.	T|.	0.27806|.	-1.0063|.	10|.	0.66056|.	D|.	0.02|.	-1.9692|-1.9692	6.1863|6.1863	0.20500|0.20500	0.6925:0.0:0.3075:0.0|0.6925:0.0:0.3075:0.0	.|.	219|.	Q9NNZ3|.	DNJC4_HUMAN|.	W|Y	219|250;156	ENSP00000396896:G219W|.	ENSP00000396896:G219W|.	G|X	+|+	1|3	0|2	DNAJC4|DNAJC4	63758161|63758161	0.008000|0.008000	0.16893|0.16893	0.009000|0.009000	0.14445|0.14445	0.002000|0.002000	0.02628|0.02628	0.145000|0.145000	0.16157|0.16157	0.318000|0.318000	0.23185|0.23185	-0.372000|-0.372000	0.07161|0.07161	GGG|TAG	.		0.687	DNAJC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396305.1		
KLRB1	3820	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	9760409	9760409	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr12:9760409C>G	ENST00000229402.3	-	1	73	c.27G>C	c.(25-27)gaG>gaC	p.E9D		NM_002258.2	NP_002249.1	Q12918	KLRB1_HUMAN	killer cell lectin-like receptor subfamily B, member 1	9					cell surface receptor signaling pathway (GO:0007166)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			endometrium(2)|large_intestine(6)|lung(4)	12						GTAAGTTTAACTCAGCATATA	0.428																																					p.E9D		.											.	KLRB1-90	0			c.G27C						.						221.0	174.0	190.0					12																	9760409		2203	4300	6503	SO:0001583	missense	3820	exon1			GTTTAACTCAGCA	U11276	CCDS8601.1	12p13	2014-05-22			ENSG00000111796	ENSG00000111796		"""Killer cell lectin-like receptors"", ""CD molecules"", ""C-type lectin domain containing"""	6373	protein-coding gene	gene with protein product		602890		NKR		8077657	Standard	NM_002258		Approved	CD161, NKR-P1, NKR-P1A, hNKR-P1A, CLEC5B	uc010sgt.2	Q12918	OTTHUMG00000168581	ENST00000229402.3:c.27G>C	12.37:g.9760409C>G	ENSP00000229402:p.Glu9Asp	Somatic	214	1		WXS	Illumina GAIIx	Phase_I	312	127	NM_002258	0	0	0	0	0	Q24K24	Missense_Mutation	SNP	ENST00000229402.3	37	CCDS8601.1	.	.	.	.	.	.	.	.	.	.	C	0.015	-1.549865	0.00926	.	.	ENSG00000111796	ENST00000229402	T	0.25085	1.82	2.89	-1.41	0.08941	.	0.633204	0.13071	N	0.416118	T	0.05868	0.0153	N	0.01352	-0.895	0.19300	N	0.999977	B	0.06786	0.001	B	0.01281	0.0	T	0.38067	-0.9678	10	0.07644	T	0.81	-0.6787	4.3058	0.10946	0.3843:0.4208:0.0:0.1949	.	9	Q12918	KLRB1_HUMAN	D	9	ENSP00000229402:E9D	ENSP00000229402:E9D	E	-	3	2	KLRB1	9651676	0.623000	0.27094	0.485000	0.27403	0.018000	0.09664	-0.512000	0.06313	-0.260000	0.09418	-0.362000	0.07510	GAG	.		0.428	KLRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400280.1	NM_002258	
TAS2R20	259295	bcgsc.ca	37	12	11150319	11150319	+	Silent	SNP	T	T	C	rs11054143	byFrequency	TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr12:11150319T>C	ENST00000538986.1	-	1	155	c.156A>G	c.(154-156)gcA>gcG	p.A52A	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_176889.2	NP_795370.2	P59543	T2R20_HUMAN	taste receptor, type 2, member 20	52					sensory perception of taste (GO:0050909)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	13						CTCTGGAGACTGCCAGAGCAG	0.343													C|||	2118	0.422923	0.0651	0.3847	5008	,	,		18136	0.755		0.3817	False		,,,				2504	0.6339				p.A52A		.											.	TAS2R20-90	0			c.A156G						.	C		433,3971	729.6+/-410.1	18,397,1787	40.0	46.0	44.0		156	-5.5	0.0	12	dbSNP_120	44	3001,5597	650.8+/-400.8	539,1923,1837	no	coding-synonymous	TAS2R20	NM_176889.2		557,2320,3624	CC,CT,TT		34.9035,9.832,26.4113		52/310	11150319	3434,9568	2202	4299	6501	SO:0001819	synonymous_variant	259295	exon1			GGAGACTGCCAGA	AX097732, AF494236	CCDS8639.1	12p13.2	2012-08-22			ENSG00000255837	ENSG00000255837		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	19109	protein-coding gene	gene with protein product		613962	"""taste receptor, type 2, member 49"""	TAS2R49			Standard	NM_176889		Approved	T2R20, T2R56	uc001qzm.2	P59543	OTTHUMG00000162695	ENST00000538986.1:c.156A>G	12.37:g.11150319T>C		Somatic	143	0		WXS	Illumina GAIIx	Phase_I	143	6	NM_176889	0	0	1	1	0	P59549|Q2HIZ4|Q496D8|Q645X9	Silent	SNP	ENST00000538986.1	37	CCDS8639.1																																																																																			T|0.678;C|0.322		0.343	TAS2R20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370130.2	NM_176889	
TUBA1C	84790	ucsc.edu	37	12	49666152	49666152	+	Silent	SNP	G	G	A	rs199599214	byFrequency	TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr12:49666152G>A	ENST00000301072.6	+	4	767	c.492G>A	c.(490-492)aaG>aaA	p.K164K	TUBA1C_ENST00000541364.1_Silent_p.K234K|RP11-161H23.5_ENST00000550468.2_RNA	NM_032704.3	NP_116093.1	Q9BQE3	TBA1C_HUMAN	tubulin, alpha 1c	164					'de novo' posttranslational protein folding (GO:0051084)|cell division (GO:0051301)|cellular protein metabolic process (GO:0044267)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasmic microtubule (GO:0005881)|microtubule (GO:0005874)|nucleus (GO:0005634)|vesicle (GO:0031982)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.K164K(1)		endometrium(1)|large_intestine(3)|liver(1)|lung(7)|skin(1)	13						ATGGCAAGAAGTCCAAGCTGG	0.547																																					p.K164K		.											.	TUBA1C-90	1	Substitution - coding silent(1)	large_intestine(1)	c.G492A						.						56.0	58.0	57.0					12																	49666152		2203	4300	6503	SO:0001819	synonymous_variant	84790	exon4			CAAGAAGTCCAAG	BC004949	CCDS8782.1	12q13.12	2007-03-16	2007-02-12	2007-02-12		ENSG00000167553		"""Tubulins"""	20768	protein-coding gene	gene with protein product			"""tubulin, alpha 6"""	TUBA6		7821789	Standard	NM_032704		Approved	MGC14580, MGC10851, bcm948	uc001rtt.1	Q9BQE3		ENST00000301072.6:c.492G>A	12.37:g.49666152G>A		Somatic	352	33		WXS	Illumina GAIIx	Phase_I	323	29	NM_032704	0	0	130	405	275		Silent	SNP	ENST00000301072.6	37	CCDS8782.1																																																																																			G|0.998;A|0.002		0.547	TUBA1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404424.1	NM_032704	
KRT8	3856	broad.mit.edu	37	12	53298675	53298675	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr12:53298675A>C	ENST00000552551.1	-	2	523	c.91T>G	c.(91-93)Tcc>Gcc	p.S31A	KRT8_ENST00000546897.1_Missense_Mutation_p.S31A|KRT8_ENST00000552150.1_Missense_Mutation_p.S59A|KRT8_ENST00000293308.6_Missense_Mutation_p.S31A			P05787	K2C8_HUMAN	keratin 8	31	Head.|Ser-rich.				cell differentiation involved in embryonic placenta development (GO:0060706)|extrinsic apoptotic signaling pathway (GO:0097191)|hepatocyte apoptotic process (GO:0097284)|response to hydrostatic pressure (GO:0051599)|response to other organism (GO:0051707)|sarcomere organization (GO:0045214)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|viral process (GO:0016032)	cell-cell junction (GO:0005911)|costamere (GO:0043034)|cytoplasm (GO:0005737)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)|sarcolemma (GO:0042383)|Z disc (GO:0030018)	scaffold protein binding (GO:0097110)|structural molecule activity (GO:0005198)	p.S31A(4)		endometrium(5)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|prostate(1)|skin(1)	13				BRCA - Breast invasive adenocarcinoma(357;0.108)	Tenecteplase(DB00031)	CTGATGCGGGAACCGGGCCCA	0.662																																					p.S59A		.											.	KRT8-92	4	Substitution - Missense(4)	endometrium(2)|prostate(1)|liver(1)	c.T175G						.						12.0	14.0	13.0					12																	53298675		2120	4158	6278	SO:0001583	missense	3856	exon2			TGCGGGAACCGGG	BC000654	CCDS8841.1, CCDS58234.1	12q13.13	2013-01-16			ENSG00000170421	ENSG00000170421		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6446	protein-coding gene	gene with protein product		148060				2434381, 1705144, 16831889	Standard	NM_002273		Approved	CARD2, K8, CK8, CYK8, K2C8, KO	uc009zmk.1	P05787	OTTHUMG00000169881	ENST00000552551.1:c.91T>G	12.37:g.53298675A>C	ENSP00000447566:p.Ser31Ala	Somatic	118	1		WXS	Illumina GAIIx	Phase_I	65	5	NM_001256282	0	0	0	0	0	A8K4H3|B0AZN5|F8VXB4|Q14099|Q14716|Q14717|Q53GJ0|Q6DHW5|Q6GMY0|Q6P4C7|Q96J60	Missense_Mutation	SNP	ENST00000552551.1	37	CCDS8841.1	.	.	.	.	.	.	.	.	.	.	-	0.012	-1.651707	0.00785	.	.	ENSG00000170421	ENST00000552551;ENST00000293308;ENST00000547916;ENST00000546897;ENST00000552150;ENST00000546826;ENST00000548998;ENST00000547413;ENST00000546542	T;T;T;T;T;T;T;T	0.80393	-1.37;-1.37;-1.37;-1.37;-1.37;-1.37;-1.37;-1.37	4.05	-8.11	0.01082	.	0.706613	0.13676	N	0.370518	T	0.40619	0.1124	N	0.01197	-0.965	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.0	T	0.43589	-0.9382	10	0.05351	T	0.99	.	6.5956	0.22672	0.4212:0.312:0.0:0.2668	.	59;31;31	F8VXB4;F8VU64;P05787	.;.;K2C8_HUMAN	A	31;31;31;31;59;31;71;31;109	ENSP00000447566:S31A;ENSP00000293308:S31A;ENSP00000447402:S31A;ENSP00000449404:S59A;ENSP00000447881:S31A;ENSP00000447040:S71A;ENSP00000448681:S31A;ENSP00000450228:S109A	ENSP00000293308:S31A	S	-	1	0	KRT8	51584942	0.005000	0.15991	0.000000	0.03702	0.065000	0.16274	-0.018000	0.12568	-3.264000	0.00201	-0.290000	0.09829	TCC	.		0.662	KRT8-001	KNOWN	alternative_5_UTR|overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406385.1	NM_002273	
EP400	57634	bcgsc.ca	37	12	132547096	132547096	+	Silent	SNP	G	G	A	rs74479394|rs113304321	byFrequency	TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr12:132547096G>A	ENST00000333577.4	+	48	8401	c.8292G>A	c.(8290-8292)caG>caA	p.Q2764Q	EP400_ENST00000332482.4_Silent_p.Q2691Q|EP400_ENST00000389561.2_Silent_p.Q2728Q|EP400_ENST00000389562.2_Silent_p.Q2727Q|EP400_ENST00000330386.6_Silent_p.Q2647Q			Q96L91	EP400_HUMAN	E1A binding protein p400	2764	Interaction with ZNF42. {ECO:0000250}.|Poly-Gln.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		agcaacaacagcagcagcagc	0.567													G|||	734	0.146565	0.3215	0.0432	5008	,	,		15582	0.1111		0.0417	False		,,,				2504	0.1278				p.Q2728Q		.											.	EP400-520	0			c.G8184A						.	G		0,4324		0,0,2162	24.0	29.0	27.0		8184	0.5	0.9	12	dbSNP_131	27	1,8349		0,1,4174	no	coding-synonymous	EP400	NM_015409.4		0,1,6336	AA,AG,GG		0.012,0.0,0.0079		2728/3124	132547096	1,12673	2162	4175	6337	SO:0001819	synonymous_variant	57634	exon47			ACAACAGCAGCAG	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.8292G>A	12.37:g.132547096G>A		Somatic	168	3		WXS	Illumina GAIIx	Phase_I	282	12	NM_015409	0	0	4	17	13	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Silent	SNP	ENST00000333577.4	37																																																																																				.		0.567	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409	
SALL2	6297	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	21991730	21991730	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr14:21991730C>T	ENST00000327430.3	-	2	2426	c.2132G>A	c.(2131-2133)cGg>cAg	p.R711Q	SALL2_ENST00000450879.2_Missense_Mutation_p.R574Q|SALL2_ENST00000317492.5_Intron|AE000658.22_ENST00000535893.1_RNA|SALL2_ENST00000538754.1_Intron	NM_005407.1	NP_005398.1	Q9Y467	SALL2_HUMAN	spalt-like transcription factor 2	711					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(12)|lung(12)|ovary(2)|skin(6)|urinary_tract(2)	43	all_cancers(95;0.000662)			GBM - Glioblastoma multiforme(265;0.0151)		CAGGTGCATCCGGACATGCTG	0.607																																					p.R711Q		.											.	SALL2-92	0			c.G2132A						.						67.0	62.0	64.0					14																	21991730		2203	4300	6503	SO:0001583	missense	6297	exon2			TGCATCCGGACAT	AB002358	CCDS32045.1	14q11.1-q12.1	2013-10-17	2013-10-17		ENSG00000165821	ENSG00000165821		"""Zinc fingers, C2H2-type"""	10526	protein-coding gene	gene with protein product		602219	"""sal (Drosophila)-like 2"", ""sal-like 2 (Drosophila)"""			8975705	Standard	XM_005267983		Approved	KIAA0360, Hsal2, ZNF795	uc001wbe.3	Q9Y467	OTTHUMG00000168826	ENST00000327430.3:c.2132G>A	14.37:g.21991730C>T	ENSP00000333537:p.Arg711Gln	Somatic	90	1		WXS	Illumina GAIIx	Phase_I	114	53	NM_005407	0	0	0	0	0	B2RMX6|B9EGK8|Q8N656|Q9Y4G1	Missense_Mutation	SNP	ENST00000327430.3	37	CCDS32045.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.70|18.70	3.679767|3.679767	0.68042|0.68042	.|.	.|.	ENSG00000165821|ENSG00000165821	ENST00000546363|ENST00000327430;ENST00000450879	.|T;T	.|0.77877	.|-1.13;-1.13	4.76|4.76	4.76|4.76	0.60689|0.60689	.|Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.|0.000000	.|0.36409	.|N	.|0.002608	D|D	0.84288|0.84288	0.5439|0.5439	L|L	0.49350|0.49350	1.555|1.555	0.58432|0.58432	D|D	0.999996|0.999996	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;0.999	.|D;D;D;P	.|0.70935	.|0.971;0.971;0.958;0.904	D|D	0.85926|0.85926	0.1449|0.1449	5|10	.|0.87932	.|D	.|0	-29.9935|-29.9935	15.3161|15.3161	0.74078|0.74078	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|574;574;472;711	.|B4DK65;E7EW59;B4DFD9;Q9Y467	.|.;.;.;SALL2_HUMAN	R|Q	570|711;574	.|ENSP00000333537:R711Q;ENSP00000396773:R574Q	.|ENSP00000333537:R711Q	G|R	-|-	1|2	0|0	SALL2|SALL2	21061570|21061570	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.522000|0.522000	0.34438|0.34438	5.912000|5.912000	0.69948|0.69948	2.468000|2.468000	0.83385|0.83385	0.563000|0.563000	0.77884|0.77884	GGA|CGG	.		0.607	SALL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401242.1	NM_005407	
ABHD4	63874	hgsc.bcm.edu	37	14	23078809	23078809	+	Missense_Mutation	SNP	G	G	A	rs376211452		TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr14:23078809G>A	ENST00000428304.2	+	6	1002	c.932G>A	c.(931-933)cGa>cAa	p.R311Q		NM_022060.2	NP_071343.2	Q8TB40	ABHD4_HUMAN	abhydrolase domain containing 4	311					lipid catabolic process (GO:0016042)		hydrolase activity (GO:0016787)			breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(3)|lung(3)|prostate(1)	14	all_cancers(95;5.49e-05)			GBM - Glioblastoma multiforme(265;0.0153)		TCCTATGTCCGAGACATGGTA	0.498																																					p.R311Q		.											.	ABHD4-90	0			c.G932A						.						69.0	63.0	65.0					14																	23078809		2203	4300	6503	SO:0001583	missense	63874	exon6			ATGTCCGAGACAT	AK022878	CCDS9572.1	14q11.1	2006-10-06			ENSG00000100439	ENSG00000100439		"""Abhydrolase domain containing"""	20154	protein-coding gene	gene with protein product							Standard	NM_022060		Approved	FLJ12816	uc001wgm.3	Q8TB40	OTTHUMG00000028686	ENST00000428304.2:c.932G>A	14.37:g.23078809G>A	ENSP00000414558:p.Arg311Gln	Somatic	40	0		WXS	Illumina GAIIx	Phase_I	80	4	NM_022060	0	0	0	0	0	B4DDH7|Q9H9E0	Missense_Mutation	SNP	ENST00000428304.2	37	CCDS9572.1	.	.	.	.	.	.	.	.	.	.	G	14.97	2.694772	0.48202	.	.	ENSG00000100439	ENST00000428304	T	0.66280	-0.2	5.49	5.49	0.81192	.	0.251787	0.37955	N	0.001862	T	0.43678	0.1258	N	0.17631	0.505	0.33585	D	0.600424	B	0.30114	0.269	B	0.26202	0.067	T	0.54912	-0.8222	10	0.28530	T	0.3	-7.2413	10.3285	0.43807	0.0891:0.0:0.9109:0.0	.	311	Q8TB40	ABHD4_HUMAN	Q	311	ENSP00000414558:R311Q	ENSP00000414558:R311Q	R	+	2	0	ABHD4	22148649	0.999000	0.42202	1.000000	0.80357	0.284000	0.27059	3.013000	0.49582	2.570000	0.86706	0.643000	0.83706	CGA	.		0.498	ABHD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071623.3		
PLCB2	5330	broad.mit.edu;bcgsc.ca	37	15	40587141	40587141	+	Silent	SNP	C	C	T	rs201613773		TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr15:40587141C>T	ENST00000260402.3	-	18	2151	c.1902G>A	c.(1900-1902)acG>acA	p.T634T	PLCB2_ENST00000456256.2_Silent_p.T634T|PLCB2_ENST00000557821.1_Silent_p.T630T	NM_001284297.1|NM_004573.2	NP_001271226.1|NP_004564.2	Q00722	PLCB2_HUMAN	phospholipase C, beta 2	634	PI-PLC Y-box. {ECO:0000255|PROSITE- ProRule:PRU00271}.				activation of phospholipase C activity (GO:0007202)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)|sensory perception of bitter taste (GO:0050913)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(4)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(3)	39		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;9.38e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0508)		CCTCACCCATCGTCTGGAAGT	0.587													C|||	1	0.000199681	0.0	0.0	5008	,	,		18671	0.0		0.001	False		,,,				2504	0.0				p.T634T		.											.	PLCB2-275	0			c.G1902A						.						84.0	89.0	88.0					15																	40587141		2187	4299	6486	SO:0001819	synonymous_variant	5330	exon18			ACCCATCGTCTGG		CCDS42020.1, CCDS61591.1, CCDS61592.1, CCDS73704.1	15q15.1	2012-01-23			ENSG00000137841	ENSG00000137841	3.1.4.11		9055	protein-coding gene	gene with protein product		604114				1644792, 9925923	Standard	XM_005254448		Approved	FLJ38135	uc001zld.3	Q00722	OTTHUMG00000172412	ENST00000260402.3:c.1902G>A	15.37:g.40587141C>T		Somatic	95	2		WXS	Illumina GAIIx	Phase_I	92	41	NM_004573	0	0	1	1	0	A8K6J2|B9EGH5	Silent	SNP	ENST00000260402.3	37	CCDS42020.1																																																																																			C|1.000;T|0.000		0.587	PLCB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000418430.1		
C15orf27	123591	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	76467904	76467904	+	Frame_Shift_Del	DEL	C	C	-	rs200737085		TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr15:76467904delC	ENST00000388942.3	+	8	933	c.657delC	c.(655-657)tacfs	p.Y219fs	RP11-593F23.1_ENST00000558424.1_RNA	NM_152335.2	NP_689548.2	Q2M3C6	CO027_HUMAN	chromosome 15 open reading frame 27	219					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|membrane depolarization during action potential (GO:0086010)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	voltage-gated calcium channel activity (GO:0005245)			endometrium(1)|large_intestine(1)|lung(10)|pancreas(1)	13						TTCCAGCCTACGTCCTGCCAG	0.577																																					p.Y219X		.											.	C15orf27-90	0			c.657delC						.						85.0	72.0	76.0					15																	76467904		2197	4294	6491	SO:0001589	frameshift_variant	123591	exon8			AGCCTACGTCCTG	AK095509	CCDS10289.2	15q23-q24.1	2012-09-27			ENSG00000169758	ENSG00000169758			26763	protein-coding gene	gene with protein product						14702039, 22020278	Standard	NM_152335		Approved	FLJ38190	uc002bbq.3	Q2M3C6	OTTHUMG00000142918	ENST00000388942.3:c.657delC	15.37:g.76467904delC	ENSP00000373594:p.Tyr219fs	Somatic	170	0		WXS	Illumina GAIIx	Phase_I	192	76	NM_152335	0	0	0	0	0	Q8N993|Q96LL5	Nonsense_Mutation	DEL	ENST00000388942.3	37	CCDS10289.2																																																																																			.		0.577	C15orf27-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000286637.2	NM_152335	
KLHDC4	54758	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	87742934	87742934	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr16:87742934C>T	ENST00000270583.5	-	10	1442	c.1384G>A	c.(1384-1386)Gac>Aac	p.D462N	KLHDC4_ENST00000566349.1_5'UTR|KLHDC4_ENST00000353170.5_Missense_Mutation_p.D405N|KLHDC4_ENST00000347925.5_Missense_Mutation_p.D431N	NM_017566.3	NP_060036.2	Q8TBB5	KLDC4_HUMAN	kelch domain containing 4	462										breast(2)|endometrium(3)|lung(10)|pancreas(2)|prostate(1)|skin(1)|urinary_tract(2)	21				BRCA - Breast invasive adenocarcinoma(80;0.0283)		CAGTGCAGGTCGCTGAGGGTG	0.662																																					p.D462N		.											.	KLHDC4-182	0			c.G1384A						.						86.0	79.0	81.0					16																	87742934		2198	4300	6498	SO:0001583	missense	54758	exon10			GCAGGTCGCTGAG	AK001742	CCDS10963.1, CCDS54050.1, CCDS54051.1	16q24	2008-02-05			ENSG00000104731	ENSG00000104731			25272	protein-coding gene	gene with protein product							Standard	NM_001184854		Approved	DKFZp434G0522	uc002fki.3	Q8TBB5	OTTHUMG00000137657	ENST00000270583.5:c.1384G>A	16.37:g.87742934C>T	ENSP00000270583:p.Asp462Asn	Somatic	127	1		WXS	Illumina GAIIx	Phase_I	201	53	NM_017566	0	0	49	65	16	D3DUN3|D3DUN4|D3DUN5|Q96F29|Q9BVN3	Missense_Mutation	SNP	ENST00000270583.5	37	CCDS10963.1	.	.	.	.	.	.	.	.	.	.	C	33	5.216636	0.95104	.	.	ENSG00000104731	ENST00000270583;ENST00000347925;ENST00000353170	T;T;T	0.69306	-0.39;-0.39;-0.39	5.27	5.27	0.74061	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	D	0.83566	0.5282	M	0.82823	2.61	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.86120	0.1568	10	0.87932	D	0	-11.1429	17.8669	0.88797	0.0:1.0:0.0:0.0	.	405;431;462	Q8TBB5-2;Q8TBB5-3;Q8TBB5	.;.;KLDC4_HUMAN	N	462;431;405	ENSP00000270583:D462N;ENSP00000325717:D431N;ENSP00000262530:D405N	ENSP00000270583:D462N	D	-	1	0	KLHDC4	86300435	1.000000	0.71417	0.754000	0.31244	0.927000	0.56198	7.192000	0.77771	2.467000	0.83353	0.313000	0.20887	GAC	.		0.662	KLHDC4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000269109.2	NM_017566	
SCARF1	8578	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	1543262	1543262	+	Silent	SNP	C	C	T			TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr17:1543262C>T	ENST00000263071.4	-	6	1132	c.1083G>A	c.(1081-1083)ggG>ggA	p.G361G	SCARF1_ENST00000574545.1_5'Flank|SCARF1_ENST00000571272.1_Silent_p.G361G|SCARF1_ENST00000348987.3_Intron	NM_003693.2|NM_145350.1	NP_003684.2|NP_663325.1	Q14162	SREC_HUMAN	scavenger receptor class F, member 1	361	EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell adhesion (GO:0007155)|cholesterol catabolic process (GO:0006707)|dendrite development (GO:0016358)|neuron remodeling (GO:0016322)|positive regulation of axon regeneration (GO:0048680)|positive regulation of neuron projection development (GO:0010976)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	endocytic vesicle membrane (GO:0030666)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	low-density lipoprotein particle binding (GO:0030169)|scavenger receptor activity (GO:0005044)|transmembrane signaling receptor activity (GO:0004888)			cervix(1)|endometrium(3)|kidney(2)|lung(9)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	20				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		TATCACAGGACCCCTGAACAC	0.647																																					p.G361G		.											.	SCARF1-91	0			c.G1083A						.						70.0	72.0	71.0					17																	1543262		2203	4300	6503	SO:0001819	synonymous_variant	8578	exon6			ACAGGACCCCTGA	D63483	CCDS11007.1, CCDS45564.1	17p13.3	2008-07-18			ENSG00000074660	ENSG00000074660			16820	protein-coding gene	gene with protein product	"""scavenger receptor expressed by endothelial cells"", ""acetyl LDL receptor"""	607873				9395444, 8590280	Standard	NM_003693		Approved	SREC, KIAA0149	uc002fsz.2	Q14162	OTTHUMG00000090555	ENST00000263071.4:c.1083G>A	17.37:g.1543262C>T		Somatic	133	0		WXS	Illumina GAIIx	Phase_I	195	64	NM_145350	0	0	1	1	0	A8MQ05|O43701|Q8NHD2|Q8NHD3|Q8NHD4|Q8NHD5	Silent	SNP	ENST00000263071.4	37	CCDS11007.1																																																																																			.		0.647	SCARF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207081.4	NM_003693	
NOL11	25926	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	65734087	65734087	+	Splice_Site	SNP	A	A	C			TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr17:65734087A>C	ENST00000253247.4	+	13	1643	c.1528A>C	c.(1528-1530)Agc>Cgc	p.S510R	SNORA38B_ENST00000363524.1_RNA|NOL11_ENST00000535137.1_Splice_Site_p.S328R	NM_015462.3	NP_056277.2	Q9H8H0	NOL11_HUMAN	nucleolar protein 11	510					maturation of SSU-rRNA (GO:0030490)|positive regulation of transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:1901838)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|t-UTP complex (GO:0034455)	poly(A) RNA binding (GO:0044822)			haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)	11	all_cancers(12;1.54e-10)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0518)|COAD - Colon adenocarcinoma(4;0.0977)|LUSC - Lung squamous cell carcinoma(166;0.24)			AATTTTCTTGAGGTAAGTTAG	0.333																																					p.S510R		.											.	NOL11-90	0			c.A1528C						.						87.0	91.0	90.0					17																	65734087		2203	4300	6503	SO:0001630	splice_region_variant	25926	exon13			TTCTTGAGGTAAG	AK023702	CCDS11671.1	17q24.2	2005-08-08							24557	protein-coding gene	gene with protein product		615366				12477932	Standard	NM_015462		Approved	DKFZP586L0724	uc002jgd.1	Q9H8H0		ENST00000253247.4:c.1529+1A>C	17.37:g.65734087A>C		Somatic	52	0		WXS	Illumina GAIIx	Phase_I	58	26	NM_015462	0	0	0	1	1	B7Z5V9|Q7L5S1|Q9UG18	Missense_Mutation	SNP	ENST00000253247.4	37	CCDS11671.1	.	.	.	.	.	.	.	.	.	.	A	10.55	1.382066	0.24944	.	.	ENSG00000130935	ENST00000253247;ENST00000535137	T	0.48836	0.8	5.11	4.03	0.46877	.	0.042248	0.85682	D	0.000000	T	0.47930	0.1472	M	0.77103	2.36	0.58432	D	0.99999	B	0.15719	0.014	B	0.17433	0.018	T	0.43196	-0.9406	10	0.39692	T	0.17	-2.784	10.1593	0.42842	0.919:0.0:0.081:0.0	.	510	Q9H8H0	NOL11_HUMAN	R	510;328	ENSP00000253247:S510R	ENSP00000253247:S510R	S	+	1	0	NOL11	63164549	1.000000	0.71417	0.990000	0.47175	0.068000	0.16541	4.172000	0.58243	0.888000	0.36160	0.528000	0.53228	AGC	.		0.333	NOL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448074.1	NM_015462	Missense_Mutation
CD7	924	broad.mit.edu	37	17	80274162	80274162	+	Frame_Shift_Del	DEL	G	G	-	rs201027731|rs555569626	byFrequency	TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr17:80274162delG	ENST00000312648.3	-	3	627	c.521delC	c.(520-522)ccafs	p.P174fs	CD7_ENST00000578509.1_Frame_Shift_Del_p.P74fs|CD7_ENST00000584284.1_Frame_Shift_Del_p.P174fs|CD7_ENST00000583376.1_Frame_Shift_Del_p.P74fs	NM_006137.6	NP_006128.1	P09564	CD7_HUMAN	CD7 molecule	174	4 X 9 AA tandem repeats, potential spacer function.				homeostasis of number of cells within a tissue (GO:0048873)|immune response (GO:0006955)|T cell activation (GO:0042110)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			endometrium(1)|large_intestine(1)|lung(3)|skin(2)|upper_aerodigestive_tract(1)	8	Breast(20;0.000675)|all_neural(118;0.0804)|Lung NSC(278;0.128)|all_lung(278;0.145)|Ovarian(332;0.249)		OV - Ovarian serous cystadenocarcinoma(97;0.00463)|BRCA - Breast invasive adenocarcinoma(99;0.0667)			AGAGGCTGCTGGCGGGTCAGG	0.716													?|GG|G|unsure	60	0.0119808	0.0008	0.0274	5008	,	,		11833	0.001		0.0338	False		,,,				2504	0.0051				p.P174fs	Pancreas(45;804 1068 19702 28207 28798)	.											.	CD7-90	0			c.521delC						.						11.0	14.0	13.0					17																	80274162		2162	4241	6403	SO:0001589	frameshift_variant	924	exon3			GCTGCTGGCGGGT	X06180	CCDS11807.1	17q25.2-q25.3	2013-01-11	2006-03-28			ENSG00000173762		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1695	protein-coding gene	gene with protein product	"""p41 protein"", ""T-cell antigen CD7"", ""T-cell leukemia antigen"""	186820	"""CD7 antigen (p41)"""			1695199, 3501369	Standard	NM_006137		Approved	GP40, LEU-9, TP41, Tp40	uc002kel.1	P09564		ENST00000312648.3:c.521delC	17.37:g.80274162delG	ENSP00000312027:p.Pro174fs	Somatic	50	0		WXS	Illumina GAIIx	Phase_I	23	7	NM_006137	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000312648.3	37	CCDS11807.1																																																																																			.		0.716	CD7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000442826.1	NM_006137	
LAMA3	3909	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	21461949	21461949	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr18:21461949G>A	ENST00000313654.9	+	40	5403	c.5162G>A	c.(5161-5163)gGc>gAc	p.G1721D	LAMA3_ENST00000587184.1_Missense_Mutation_p.G112D|LAMA3_ENST00000269217.6_Missense_Mutation_p.G112D|LAMA3_ENST00000399516.3_Missense_Mutation_p.G1721D	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	1721	Domain III A.|Laminin EGF-like 13. {ECO:0000255|PROSITE-ProRule:PRU00460}.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					TGCCAGGAGGGCTACTATGGC	0.567																																					p.G1721D		.											.	LAMA3-100	0			c.G5162A	GRCh37	CD951762	LAMA3	D		.						92.0	69.0	77.0					18																	21461949		2203	4299	6502	SO:0001583	missense	3909	exon40			AGGAGGGCTACTA	L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.5162G>A	18.37:g.21461949G>A	ENSP00000324532:p.Gly1721Asp	Somatic	142	0		WXS	Illumina GAIIx	Phase_I	189	82	NM_001127717	0	0	0	0	0	B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Missense_Mutation	SNP	ENST00000313654.9	37	CCDS42419.1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.596456	0.86953	.	.	ENSG00000053747	ENST00000313654;ENST00000399516;ENST00000269217	T;T;T	0.66995	-0.24;-0.24;-0.24	5.61	5.61	0.85477	EGF-like, laminin (4);Growth factor, receptor (1);	.	.	.	.	D	0.88325	0.6406	H	0.96208	3.785	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.91575	0.5274	9	0.87932	D	0	.	19.2248	0.93814	0.0:0.0:1.0:0.0	.	112;112;1721;1721	Q6VU69;B0YJ33;Q6VU67;Q16787	.;.;.;LAMA3_HUMAN	D	1721;1721;112	ENSP00000324532:G1721D;ENSP00000382432:G1721D;ENSP00000269217:G112D	ENSP00000269217:G112D	G	+	2	0	LAMA3	19715947	1.000000	0.71417	0.997000	0.53966	0.516000	0.34256	8.593000	0.90832	2.660000	0.90430	0.655000	0.94253	GGC	.		0.567	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254824.3	NM_000227, NM_198129	
WDR7	23335	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	54348602	54348602	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr18:54348602T>C	ENST00000254442.3	+	4	536	c.325T>C	c.(325-327)Tgc>Cgc	p.C109R	WDR7_ENST00000589935.1_Intron|WDR7_ENST00000357574.3_Missense_Mutation_p.C109R	NM_015285.2	NP_056100.2	Q9Y4E6	WDR7_HUMAN	WD repeat domain 7	109					hematopoietic progenitor cell differentiation (GO:0002244)					NS(1)|breast(5)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(37)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	78				Lung(128;0.0238)|Colorectal(16;0.0296)		AAAATTAGCTTGCACACATAC	0.308																																					p.C109R		.											.	WDR7-93	0			c.T325C						.						169.0	161.0	164.0					18																	54348602		2203	4300	6503	SO:0001583	missense	23335	exon4			TTAGCTTGCACAC	AB011113	CCDS11962.1, CCDS11963.1	18q21.31	2013-01-09			ENSG00000091157	ENSG00000091157		"""WD repeat domain containing"""	13490	protein-coding gene	gene with protein product		613473				10828621	Standard	XM_005266674		Approved	KIAA0541, TRAG	uc002lgk.1	Q9Y4E6	OTTHUMG00000132721	ENST00000254442.3:c.325T>C	18.37:g.54348602T>C	ENSP00000254442:p.Cys109Arg	Somatic	156	0		WXS	Illumina GAIIx	Phase_I	196	49	NM_052834	0	0	1	1	0	A7E2C8|Q86UX5|Q86VP2|Q96PS7	Missense_Mutation	SNP	ENST00000254442.3	37	CCDS11962.1	.	.	.	.	.	.	.	.	.	.	T	14.60	2.584478	0.46110	.	.	ENSG00000091157	ENST00000254442;ENST00000357574;ENST00000398311	T;T	0.61274	0.12;0.12	5.65	4.47	0.54385	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);	0.046346	0.85682	D	0.000000	T	0.61324	0.2338	L	0.51422	1.61	0.80722	D	1	P;D	0.60160	0.864;0.987	P;P	0.56278	0.514;0.795	T	0.56463	-0.7975	10	0.13108	T	0.6	.	12.5473	0.56208	0.0:0.0:0.1395:0.8605	.	109;109	Q9Y4E6-2;Q9Y4E6	.;WDR7_HUMAN	R	109	ENSP00000254442:C109R;ENSP00000350187:C109R	ENSP00000254442:C109R	C	+	1	0	WDR7	52499600	1.000000	0.71417	0.992000	0.48379	0.996000	0.88848	7.936000	0.87665	0.952000	0.37798	0.397000	0.26171	TGC	.		0.308	WDR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256062.1		
ZNF516	9658	ucsc.edu	37	18	74154244	74154244	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr18:74154244G>T	ENST00000443185.2	-	3	1084	c.767C>A	c.(766-768)gCc>gAc	p.A256D	ZNF516_ENST00000524431.2_5'UTR	NM_014643.3	NP_055458.1	Q92618	ZN516_HUMAN	zinc finger protein 516	256					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A256D(2)		central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		Prostate(75;0.0869)|Esophageal squamous(42;0.129)		OV - Ovarian serous cystadenocarcinoma(15;7.64e-06)|BRCA - Breast invasive adenocarcinoma(31;0.238)		CTGGCTGAAGGCCTGGCCACA	0.687																																					p.A256D		.											.	ZNF516-69	2	Substitution - Missense(2)	kidney(2)	c.C767A						.						17.0	20.0	19.0					18																	74154244		2007	4189	6196	SO:0001583	missense	9658	exon3			CTGAAGGCCTGGC	D86975	CCDS74234.1	18q23	2013-01-08				ENSG00000101493		"""Zinc fingers, C2H2-type"""	28990	protein-coding gene	gene with protein product		615114				9039502	Standard	NM_014643		Approved	HsT287, KIAA0222	uc021ulp.1	Q92618		ENST00000443185.2:c.767C>A	18.37:g.74154244G>T	ENSP00000394757:p.Ala256Asp	Somatic	79	6		WXS	Illumina GAIIx	Phase_I	85	10	NM_014643	0	0	2	2	0		Missense_Mutation	SNP	ENST00000443185.2	37		.	.	.	.	.	.	.	.	.	.	G	18.16	3.562224	0.65538	.	.	ENSG00000101493	ENST00000443185	T	0.52295	0.67	4.52	4.52	0.55395	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.074994	0.53938	D	0.000047	T	0.65637	0.2710	.	.	.	0.37315	D	0.909299	D	0.76494	0.999	D	0.73708	0.981	T	0.72924	-0.4144	9	0.87932	D	0	-8.9982	11.3066	0.49338	0.084:0.0:0.916:0.0	.	256	Q92618	ZN516_HUMAN	D	256	ENSP00000394757:A256D	ENSP00000394757:A256D	A	-	2	0	ZNF516	72283232	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.515000	0.67049	2.508000	0.84585	0.650000	0.86243	GCC	.		0.687	ZNF516-201	KNOWN	basic|appris_principal|exp_conf	protein_coding	protein_coding		NM_014643	
THOP1	7064	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	2790453	2790453	+	Silent	SNP	G	G	A			TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr19:2790453G>A	ENST00000307741.6	+	2	254	c.51G>A	c.(49-51)ccG>ccA	p.P17P		NM_003249.3	NP_003240.1	P52888	THOP1_HUMAN	thimet oligopeptidase 1	17					intracellular signal transduction (GO:0035556)|peptide metabolic process (GO:0006518)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)			NS(1)|central_nervous_system(1)|endometrium(1)|lung(8)|ovary(2)|skin(1)	14				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CAGCATCTCCGTGCTCTGTGG	0.597																																					p.P17P		.											.	THOP1-92	0			c.G51A						.						101.0	91.0	95.0					19																	2790453		2203	4300	6503	SO:0001819	synonymous_variant	7064	exon2			ATCTCCGTGCTCT		CCDS12095.1	19p13.3	2008-02-05				ENSG00000172009	3.4.24.15		11793	protein-coding gene	gene with protein product		601117				9790774	Standard	NM_003249		Approved		uc002lwj.3	P52888		ENST00000307741.6:c.51G>A	19.37:g.2790453G>A		Somatic	100	0		WXS	Illumina GAIIx	Phase_I	93	50	NM_003249	0	0	0	1	1	B3KSE2|Q9UCB3	Silent	SNP	ENST00000307741.6	37	CCDS12095.1																																																																																			.		0.597	THOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451587.2		
ANKRD24	170961	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	4210319	4210319	+	Silent	SNP	C	C	T			TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr19:4210319C>T	ENST00000600132.1	+	13	1285	c.1009C>T	c.(1009-1011)Ctg>Ttg	p.L337L	ANKRD24_ENST00000262970.5_Silent_p.L427L|RN7SL84P_ENST00000578969.1_RNA|ANKRD24_ENST00000318934.4_Silent_p.L337L|ANKRD24_ENST00000595096.1_3'UTR	NM_133475.1	NP_597732.1	Q8TF21	ANR24_HUMAN	ankyrin repeat domain 24	337										endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)	21				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0233)|STAD - Stomach adenocarcinoma(1328;0.181)		GGGCCGCCTCCTGCAGAAGAT	0.627																																					p.L337L		.											.	ANKRD24-68	0			c.C1009T						.						30.0	45.0	40.0					19																	4210319		2030	4157	6187	SO:0001819	synonymous_variant	170961	exon13			CGCCTCCTGCAGA	AB075861	CCDS45925.1	19p13.3	2013-01-10				ENSG00000089847		"""Ankyrin repeat domain containing"""	29424	protein-coding gene	gene with protein product						11853319	Standard	NM_133475		Approved	KIAA1981	uc010dtt.1	Q8TF21		ENST00000600132.1:c.1009C>T	19.37:g.4210319C>T		Somatic	426	0		WXS	Illumina GAIIx	Phase_I	411	171	NM_133475	0	0	1	1	0	O75268|O95781	Silent	SNP	ENST00000600132.1	37	CCDS45925.1																																																																																			.		0.627	ANKRD24-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458188.1	XM_114000	
LYPD3	27076	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	43968541	43968541	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr19:43968541C>A	ENST00000244333.3	-	2	235	c.147G>T	c.(145-147)atG>atT	p.M49I		NM_014400.2	NP_055215.2	O95274	LYPD3_HUMAN	LY6/PLAUR domain containing 3	49	UPAR/Ly6 1.				cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)	anchored component of plasma membrane (GO:0046658)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(1)|pancreas(1)|upper_aerodigestive_tract(2)	11		Prostate(69;0.0153)				TCACTGTCTTCATCTTGTTCG	0.667																																					p.M49I		.											.	LYPD3-91	0			c.G147T						.						62.0	50.0	54.0					19																	43968541		2203	4300	6503	SO:0001583	missense	27076	exon2			TGTCTTCATCTTG	AF082889	CCDS12620.1	19q13.31	2008-02-05				ENSG00000124466			24880	protein-coding gene	gene with protein product		609484				11179665, 11245483	Standard	NM_014400		Approved	C4.4A	uc002owl.1	O95274		ENST00000244333.3:c.147G>T	19.37:g.43968541C>A	ENSP00000244333:p.Met49Ile	Somatic	99	0		WXS	Illumina GAIIx	Phase_I	207	29	NM_014400	0	0	0	0	0	Q9UJ74	Missense_Mutation	SNP	ENST00000244333.3	37	CCDS12620.1	.	.	.	.	.	.	.	.	.	.	C	12.03	1.814616	0.32053	.	.	ENSG00000124466	ENST00000244333;ENST00000377995	T	0.28255	1.62	4.62	1.05	0.20165	Ly-6 antigen / uPA receptor -like (1);CD59 antigen (1);	0.638796	0.13866	N	0.357331	T	0.14442	0.0349	N	0.08118	0	0.29336	N	0.866337	B;B	0.14805	0.011;0.011	B;B	0.16722	0.016;0.016	T	0.24764	-1.0151	10	0.27082	T	0.32	.	8.4372	0.32795	0.1575:0.507:0.3356:0.0	.	49;49	B2RBR3;O95274	.;LYPD3_HUMAN	I	49	ENSP00000244333:M49I	ENSP00000244333:M49I	M	-	3	0	LYPD3	48660381	0.847000	0.29606	0.889000	0.34880	0.780000	0.44128	0.357000	0.20199	0.110000	0.17919	0.456000	0.33151	ATG	.		0.667	LYPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463177.1	NM_014400	
LYPD3	27076	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	43968550	43968550	+	Silent	SNP	C	C	T			TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr19:43968550C>T	ENST00000244333.3	-	2	226	c.138G>A	c.(136-138)ccG>ccA	p.P46P		NM_014400.2	NP_055215.2	O95274	LYPD3_HUMAN	LY6/PLAUR domain containing 3	46	UPAR/Ly6 1.				cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)	anchored component of plasma membrane (GO:0046658)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(1)|pancreas(1)|upper_aerodigestive_tract(2)	11		Prostate(69;0.0153)				TCATCTTGTTCGGGGAGCATC	0.662																																					p.P46P		.											.	LYPD3-91	0			c.G138A						.						64.0	51.0	56.0					19																	43968550		2203	4300	6503	SO:0001819	synonymous_variant	27076	exon2			CTTGTTCGGGGAG	AF082889	CCDS12620.1	19q13.31	2008-02-05				ENSG00000124466			24880	protein-coding gene	gene with protein product		609484				11179665, 11245483	Standard	NM_014400		Approved	C4.4A	uc002owl.1	O95274		ENST00000244333.3:c.138G>A	19.37:g.43968550C>T		Somatic	112	1		WXS	Illumina GAIIx	Phase_I	219	29	NM_014400	0	0	0	0	0	Q9UJ74	Silent	SNP	ENST00000244333.3	37	CCDS12620.1																																																																																			.		0.662	LYPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463177.1	NM_014400	
PVRL2	5819	broad.mit.edu	37	19	45381598	45381600	+	Intron	DEL	GAG	GAG	-	rs375813744		TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr19:45381598_45381600delGAG	ENST00000252483.5	+	5	1042				PVRL2_ENST00000252485.4_In_Frame_Del_p.R391del	NM_001042724.1	NP_001036189.1	Q92692	PVRL2_HUMAN	poliovirus receptor-related 2 (herpesvirus entry mediator B)						acrosome assembly (GO:0001675)|adherens junction organization (GO:0034332)|adhesion of symbiont to host (GO:0044406)|cell junction assembly (GO:0034329)|cell part morphogenesis (GO:0032990)|cell-cell junction organization (GO:0045216)|cilium organization (GO:0044782)|coreceptor-mediated virion attachment to host cell (GO:0046814)|cytoskeleton organization (GO:0007010)|establishment of mitochondrion localization (GO:0051654)|fertilization (GO:0009566)|fusion of virus membrane with host plasma membrane (GO:0019064)|homophilic cell adhesion (GO:0007156)|positive regulation of immunoglobulin mediated immune response (GO:0002891)|positive regulation of mast cell activation (GO:0033005)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target (GO:0002860)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|sperm mitochondrion organization (GO:0030382)|spermatid development (GO:0007286)|spermatid nucleus differentiation (GO:0007289)|susceptibility to natural killer cell mediated cytotoxicity (GO:0042271)|susceptibility to T cell mediated cytotoxicity (GO:0060370)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|zonula adherens (GO:0005915)	cell adhesion molecule binding (GO:0050839)|coreceptor activity (GO:0015026)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|virus receptor activity (GO:0001618)			breast(1)|endometrium(1)|large_intestine(6)|lung(5)	13	Lung NSC(12;0.00195)|all_lung(12;0.00522)	Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0143)		TGCTgagggtgaggaggaggagg	0.665																																					p.387_388del		.											.	PVRL2-90	0			c.1161_1163del						.		,	4,172,3746		0,0,4,17,138,1802					,	-2.1	1.0			26	34,410,7168		2,1,29,23,363,3388	no	codingComplex,intron	PVRL2	NM_002856.2,NM_001042724.1	,	2,1,33,40,501,5190	A1A1,A1A2,A1R,A2A2,A2R,RR		5.8329,4.4875,5.3754	,	,		38,582,10914				SO:0001627	intron_variant	5819	exon6			GAGGGTGAGGAGG	X80038	CCDS12645.1, CCDS42576.1	19q13.32	2013-01-29			ENSG00000130202	ENSG00000130202		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9707	protein-coding gene	gene with protein product		600798		HVEB		7622062, 10196354	Standard	NM_001042724		Approved	PVRR2, PRR2, CD112	uc002ozw.1	Q92692	OTTHUMG00000180839	ENST00000252483.5:c.1042+3863GAG>-	19.37:g.45381607_45381609delGAG		Somatic	49	0		WXS	Illumina GAIIx	Phase_I	200	10	NM_002856	0	0	0	0	0	A8K5L5|O75455|Q6IBI6|Q96J29	In_Frame_Del	DEL	ENST00000252483.5	37	CCDS42576.1																																																																																			.		0.665	PVRL2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453231.1	NM_002856	
DNMT3A	1788	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	25505395	25505395	+	Silent	SNP	T	T	A			TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr2:25505395T>A	ENST00000264709.3	-	4	700	c.363A>T	c.(361-363)gcA>gcT	p.A121A	DNMT3A_ENST00000406659.3_Silent_p.A121A|DNMT3A_ENST00000321117.5_Silent_p.A121A	NM_175629.2	NP_783328.1	Q9Y6K1	DNM3A_HUMAN	DNA (cytosine-5-)-methyltransferase 3 alpha	121					C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation involved in gamete generation (GO:0043046)|DNA methylation on cytosine within a CG sequence (GO:0010424)|hypermethylation of CpG island (GO:0044027)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of gene expression by genetic imprinting (GO:0006349)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)|spermatogenesis (GO:0007283)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|euchromatin (GO:0000791)|nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|unmethylated CpG binding (GO:0045322)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(964)|kidney(3)|large_intestine(10)|lung(29)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	1021	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGGTCTCAGCTGCACCCTCTC	0.667			"""Mis, F, N, S"""		AML																																p.A121A		.		Rec	yes		2	2p23	1788	DNA (cytosine-5-)-methyltransferase 3 alpha		L	.	DNMT3A-1924	0			c.A363T						.						34.0	39.0	37.0					2																	25505395		2202	4299	6501	SO:0001819	synonymous_variant	1788	exon4			CTCAGCTGCACCC		CCDS1718.2, CCDS33157.1, CCDS46232.1	2p23	2014-09-17			ENSG00000119772	ENSG00000119772			2978	protein-coding gene	gene with protein product		602769				9662389, 10433969	Standard	NM_175630		Approved		uc002rgc.4	Q9Y6K1	OTTHUMG00000094777	ENST00000264709.3:c.363A>T	2.37:g.25505395T>A		Somatic	71	0		WXS	Illumina GAIIx	Phase_I	61	27	NM_175630	0	0	1	2	1	E9PEB8|Q86TE8|Q86XF5|Q8IZV0|Q8WXU9	Silent	SNP	ENST00000264709.3	37	CCDS33157.1																																																																																			.		0.667	DNMT3A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000211587.1	NM_022552	
TTN	7273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	179501161	179501161	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr2:179501161T>C	ENST00000591111.1	-	175	36594	c.36370A>G	c.(36370-36372)Aaa>Gaa	p.K12124E	TTN_ENST00000342992.6_Missense_Mutation_p.K11197E|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000418062.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.K13765E|TTN_ENST00000359218.5_Missense_Mutation_p.K4825E|TTN_ENST00000460472.2_Missense_Mutation_p.K4700E|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.K4892E			Q8WZ42	TITIN_HUMAN	titin	12124	Ig-like 80.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTCTTTTCTTTGTTTCCCAAA	0.368																																					p.K13765E		.											.	TTN-636	0			c.A41293G						.						50.0	49.0	49.0					2																	179501161		1826	4089	5915	SO:0001583	missense	7273	exon225			TTTCTTTGTTTCC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.36370A>G	2.37:g.179501161T>C	ENSP00000465570:p.Lys12124Glu	Somatic	112	0		WXS	Illumina GAIIx	Phase_I	105	49	NM_001267550	0	0	0	0	0	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	T	16.00	2.999742	0.54147	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.64991	-0.13;-0.13;-0.13;-0.13	5.76	5.76	0.90799	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.62938	0.2469	N	0.12502	0.225	0.54753	D	0.999986	D;D;D;D	0.67145	0.992;0.992;0.992;0.996	P;P;P;P	0.62298	0.829;0.829;0.829;0.9	T	0.70605	-0.4826	9	0.87932	D	0	.	16.0718	0.80941	0.0:0.0:0.0:1.0	.	4700;4825;4892;12124	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	E	11197;4700;4892;4825;4700	ENSP00000343764:K11197E;ENSP00000434586:K4700E;ENSP00000340554:K4892E;ENSP00000352154:K4825E	ENSP00000340554:K4892E	K	-	1	0	TTN	179209406	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.991000	0.88244	2.195000	0.70347	0.528000	0.53228	AAA	.		0.368	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
SMOX	54498	hgsc.bcm.edu	37	20	4162847	4162847	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr20:4162847C>T	ENST00000305958.4	+	5	946	c.721C>T	c.(721-723)Cgg>Tgg	p.R241W	SMOX_ENST00000278795.3_Missense_Mutation_p.R241W|SMOX_ENST00000379460.2_Missense_Mutation_p.R241W|SMOX_ENST00000346595.2_Intron|SMOX_ENST00000339123.6_Missense_Mutation_p.R241W	NM_175839.2	NP_787033.1	Q9NWM0	SMOX_HUMAN	spermine oxidase	241					cellular nitrogen compound metabolic process (GO:0034641)|oxidation-reduction process (GO:0055114)|polyamine biosynthetic process (GO:0006596)|polyamine catabolic process (GO:0006598)|polyamine metabolic process (GO:0006595)|small molecule metabolic process (GO:0044281)|spermine catabolic process (GO:0046208)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	N1-acetylspermine:oxygen oxidoreductase (N1-acetylspermidine-forming) activity (GO:0052895)|norspermine:oxygen oxidoreductase activity (GO:0052894)|polyamine oxidase activity (GO:0046592)|spermine:oxygen oxidoreductase (spermidine-forming) activity (GO:0052901)			breast(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(7)|lung(5)|skin(2)|urinary_tract(1)	26					Spermine(DB00127)	GGGCTTCATGCGGGTTGTGGA	0.657																																					p.R241W		.											.	SMOX-153	0			c.C721T						.						35.0	36.0	36.0					20																	4162847		2203	4300	6503	SO:0001583	missense	54498	exon5			TTCATGCGGGTTG	AK000753	CCDS13075.1, CCDS13076.1, CCDS13077.1, CCDS13078.1, CCDS74702.1	20p13	2003-10-15	2003-10-15	2003-10-15	ENSG00000088826	ENSG00000088826			15862	protein-coding gene	gene with protein product		615854	"""chromosome 20 open reading frame 16"""	C20orf16		11454677, 12398765	Standard	NM_175839		Approved	FLJ20746, dJ779E11.1, PAO, PAOh1, MGC1010, SMO	uc002wkp.3	Q9NWM0	OTTHUMG00000031777	ENST00000305958.4:c.721C>T	20.37:g.4162847C>T	ENSP00000307252:p.Arg241Trp	Somatic	63	0		WXS	Illumina GAIIx	Phase_I	65	4	NM_175839	0	0	0	0	0	A2A2P5|A2A2P6|A8BE87|D3DVZ4|Q5TE26|Q5TE27|Q6UY28|Q8IX00|Q96LC3|Q96LC4|Q96QT3|Q9BW38|Q9H6H1|Q9NP51|Q9NPY1|Q9NPY2	Missense_Mutation	SNP	ENST00000305958.4	37	CCDS13075.1	.	.	.	.	.	.	.	.	.	.	C	15.55	2.867770	0.51588	.	.	ENSG00000088826	ENST00000339123;ENST00000305958;ENST00000278795;ENST00000379460;ENST00000457205	D;D;D;D;T	0.92595	-3.07;-3.07;-3.07;-3.07;2.9	5.17	3.19	0.36642	Amine oxidase (1);	0.175907	0.47093	D	0.000259	D	0.92782	0.7705	L	0.56199	1.76	0.36966	D	0.8936	D;D;D;D;D	0.71674	0.99;0.998;0.996;0.991;0.997	P;P;P;B;P	0.56474	0.567;0.799;0.659;0.409;0.711	D	0.93426	0.6781	10	0.66056	D	0.02	-13.4298	12.2078	0.54363	0.3104:0.6896:0.0:0.0	.	218;241;241;241;241	B4DE63;Q9NWM0-6;Q9NWM0;Q9NWM0-2;Q9NWM0-4	.;.;SMOX_HUMAN;.;.	W	241;241;241;241;98	ENSP00000344595:R241W;ENSP00000307252:R241W;ENSP00000278795:R241W;ENSP00000368773:R241W;ENSP00000407269:R98W	ENSP00000278795:R241W	R	+	1	2	SMOX	4110847	1.000000	0.71417	1.000000	0.80357	0.761000	0.43186	2.858000	0.48356	0.551000	0.29008	-0.320000	0.08662	CGG	.		0.657	SMOX-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077806.1	NM_175842	
GPCPD1	56261	broad.mit.edu	37	20	5556163	5556163	+	Silent	SNP	T	T	A			TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr20:5556163T>A	ENST00000379019.4	-	10	1109	c.897A>T	c.(895-897)ccA>ccT	p.P299P	GPCPD1_ENST00000481038.1_5'UTR	NM_019593.3	NP_062539.1	Q9NPB8	GPCP1_HUMAN	glycerophosphocholine phosphodiesterase GDE1 homolog (S. cerevisiae)	299					glycerophospholipid biosynthetic process (GO:0046474)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)	glycerophosphocholine phosphodiesterase activity (GO:0047389)|starch binding (GO:2001070)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(4)|ovary(2)|skin(1)	16						AACTGTATCCTGGTAATGGCT	0.348																																					p.P299P		.											.	GPCPD1-90	0			c.A897T						.						87.0	79.0	81.0					20																	5556163		2203	4300	6503	SO:0001819	synonymous_variant	56261	exon10			GTATCCTGGTAAT		CCDS13090.1	20p12.3	2011-01-25			ENSG00000125772	ENSG00000125772			26957	protein-coding gene	gene with protein product		614124				10718198, 20576599	Standard	NM_019593		Approved	KIAA1434, GDE5, GDPD6	uc002wme.4	Q9NPB8	OTTHUMG00000031806	ENST00000379019.4:c.897A>T	20.37:g.5556163T>A		Somatic	83	0		WXS	Illumina GAIIx	Phase_I	112	6	NM_019593	0	0	5	5	0	D3DW06|Q9BQL8|Q9NUX0	Silent	SNP	ENST00000379019.4	37	CCDS13090.1																																																																																			.		0.348	GPCPD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077869.1	NM_019593	
CST1	1469	broad.mit.edu	37	20	23728528	23728528	+	Silent	SNP	C	C	T			TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr20:23728528C>T	ENST00000304749.2	-	3	421	c.351G>A	c.(349-351)ttG>ttA	p.L117L	CST1_ENST00000398402.1_Silent_p.L117L	NM_001898.2	NP_001889.2	P01037	CYTN_HUMAN	cystatin SN	117					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|negative regulation of endopeptidase activity (GO:0010951)	extracellular space (GO:0005615)	cysteine-type endopeptidase inhibitor activity (GO:0004869)	p.L117L(1)		kidney(1)|large_intestine(1)|lung(8)|ovary(1)|stomach(1)|urinary_tract(1)	13	Lung NSC(19;0.0676)|all_lung(19;0.148)					CGAAAGAGCACAACTGTTTCT	0.527																																					p.L117L		.											.	CST1-91	1	Substitution - coding silent(1)	lung(1)	c.G351A						.						93.0	81.0	85.0					20																	23728528		2203	4300	6503	SO:0001819	synonymous_variant	1469	exon3			AGAGCACAACTGT	M19169	CCDS13160.1	20p11.2	2008-04-15			ENSG00000170373	ENSG00000170373			2473	protein-coding gene	gene with protein product		123855					Standard	NM_001898		Approved		uc002wtp.3	P01037	OTTHUMG00000032085	ENST00000304749.2:c.351G>A	20.37:g.23728528C>T		Somatic	113	1		WXS	Illumina GAIIx	Phase_I	190	6	NM_001898	0	0	0	0	0	Q96LE6|Q9UCQ6	Silent	SNP	ENST00000304749.2	37	CCDS13160.1																																																																																			.		0.527	CST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078351.2	NM_001898	
RBL1	5933	hgsc.bcm.edu;bcgsc.ca	37	20	35696518	35696518	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr20:35696518C>T	ENST00000373664.3	-	3	428	c.362G>A	c.(361-363)cGt>cAt	p.R121H	RBL1_ENST00000344359.3_Missense_Mutation_p.R121H	NM_002895.2	NP_002886.2	P28749	RBL1_HUMAN	retinoblastoma-like 1	121					chromatin modification (GO:0016568)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|regulation of lipid kinase activity (GO:0043550)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	transcription factor binding (GO:0008134)			NS(1)|breast(1)|endometrium(7)|large_intestine(6)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	42		Myeloproliferative disorder(115;0.00878)				CCTTTCTATACGTTCACGAAA	0.284																																					p.R121H		.											.	RBL1-419	0			c.G362A						.						43.0	43.0	43.0					20																	35696518		2203	4300	6503	SO:0001583	missense	5933	exon3			TCTATACGTTCAC	L14812	CCDS13289.1, CCDS13290.1	20q11.23	2014-03-11	2014-03-11		ENSG00000080839	ENSG00000080839			9893	protein-coding gene	gene with protein product		116957				1833063	Standard	NM_183404		Approved	p107, cp107, PRB1	uc002xgi.3	P28749	OTTHUMG00000032406	ENST00000373664.3:c.362G>A	20.37:g.35696518C>T	ENSP00000362768:p.Arg121His	Somatic	51	0		WXS	Illumina GAIIx	Phase_I	51	4	NM_183404	0	0	0	0	0	A8K2W5|Q4VXA0|Q8N5K6|Q9H1L5|Q9H1M1	Missense_Mutation	SNP	ENST00000373664.3	37	CCDS13289.1	.	.	.	.	.	.	.	.	.	.	C	28.1	4.893361	0.91889	.	.	ENSG00000080839	ENST00000373664;ENST00000344359	T;T	0.74737	-0.87;-0.87	5.1	5.1	0.69264	Domain of unknown function DUF3452, retinoblastoma-associated (1);	0.000000	0.85682	D	0.000000	D	0.84428	0.5470	M	0.61703	1.905	0.80722	D	1	D;D	0.89917	1.0;0.996	D;P	0.78314	0.991;0.817	T	0.82810	-0.0273	10	0.37606	T	0.19	-2.577	18.7028	0.91627	0.0:1.0:0.0:0.0	.	121;121	P28749-2;P28749	.;RBL1_HUMAN	H	121	ENSP00000362768:R121H;ENSP00000343646:R121H	ENSP00000343646:R121H	R	-	2	0	RBL1	35129932	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.615000	0.83006	2.663000	0.90544	0.591000	0.81541	CGT	.		0.284	RBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079067.2	NM_002895	
ZBP1	81030	broad.mit.edu	37	20	56185352	56185352	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr20:56185352C>A	ENST00000371173.3	-	7	1123	c.946G>T	c.(946-948)Ggg>Tgg	p.G316W	ZBP1_ENST00000340462.4_Missense_Mutation_p.G293W|ZBP1_ENST00000343535.4_Missense_Mutation_p.G316W|ZBP1_ENST00000395822.3_Missense_Mutation_p.G241W	NM_001160417.1|NM_030776.2	NP_001153889.1|NP_110403.2	Q9H171	ZBP1_HUMAN	Z-DNA binding protein 1	316					innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded RNA adenosine deaminase activity (GO:0003726)|left-handed Z-DNA binding (GO:0003692)|RNA binding (GO:0003723)			large_intestine(11)|lung(8)|ovary(4)|prostate(1)|skin(2)|urinary_tract(1)	27	Lung NSC(12;0.000545)|all_lung(29;0.00195)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;7.87e-13)|Epithelial(14;3.26e-09)|all cancers(14;3.62e-08)			GCGGCTTCCCCCTCAGGGTGA	0.582																																					p.G316W		.											.	ZBP1-228	0			c.G946T						.						189.0	204.0	199.0					20																	56185352		2203	4300	6503	SO:0001583	missense	81030	exon7			CTTCCCCCTCAGG	AJ300575	CCDS13461.1, CCDS54477.1, CCDS54478.1	20q13.31	2009-08-21	2002-07-25	2002-07-26	ENSG00000124256	ENSG00000124256			16176	protein-coding gene	gene with protein product	"""DNA-dependent activator of IRFs"""	606750	"""chromosome 20 open reading frame 183"""	C20orf183		11842111	Standard	NM_030776		Approved	dJ718J7.3, DLM1, DLM-1, DAI	uc002xyo.3	Q9H171	OTTHUMG00000032824	ENST00000371173.3:c.946G>T	20.37:g.56185352C>A	ENSP00000360215:p.Gly316Trp	Somatic	160	2		WXS	Illumina GAIIx	Phase_I	133	4	NM_030776	0	0	0	0	0	A2A2F7|B3KVA1|F5GYT1|Q5JY39|Q9BYW4	Missense_Mutation	SNP	ENST00000371173.3	37	CCDS13461.1	.	.	.	.	.	.	.	.	.	.	C	15.09	2.729552	0.48833	.	.	ENSG00000124256	ENST00000371173;ENST00000395822;ENST00000340462;ENST00000357677;ENST00000343535	T;T;T;T	0.15487	2.79;2.42;2.79;2.77	4.03	4.03	0.46877	.	0.343394	0.21366	N	0.075701	T	0.33789	0.0875	L	0.52573	1.65	0.09310	N	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.74674	0.984;0.984;0.984	T	0.03374	-1.1043	10	0.87932	D	0	-20.689	12.3898	0.55352	0.0:1.0:0.0:0.0	.	316;241;316	A2RRL9;A2A2F7;Q9H171	.;.;ZBP1_HUMAN	W	316;241;293;316;316	ENSP00000360215:G316W;ENSP00000379167:G241W;ENSP00000344954:G293W;ENSP00000340584:G316W	ENSP00000344954:G293W	G	-	1	0	ZBP1	55618758	0.001000	0.12720	0.004000	0.12327	0.013000	0.08279	0.984000	0.29565	2.186000	0.69663	0.491000	0.48974	GGG	.		0.582	ZBP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079849.1	NM_030776	
TNFRSF6B	8771	bcgsc.ca	37	20	62328267	62328267	+	Silent	SNP	C	C	T	rs2257440	byFrequency	TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr20:62328267C>T	ENST00000369996.1	+	1	247	c.147C>T	c.(145-147)tgC>tgT	p.C49C	RTEL1-TNFRSF6B_ENST00000482936.1_Missense_Mutation_p.R1352C|ARFRP1_ENST00000485858.1_5'Flank|RTEL1_ENST00000318100.4_Missense_Mutation_p.R1352C	NM_003823.3	NP_003814.1	O95407	TNF6B_HUMAN	tumor necrosis factor receptor superfamily, member 6b, decoy	49					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)	extracellular space (GO:0005615)	receptor activity (GO:0004872)			central_nervous_system(1)|lung(2)|skin(1)	4	all_cancers(38;4.66e-12)|all_epithelial(29;2.56e-13)|Lung NSC(23;1.06e-08)|all_lung(23;3.34e-08)		Epithelial(9;1.78e-08)|all cancers(9;7.89e-08)|OV - Ovarian serous cystadenocarcinoma(5;0.00504)			GGCTGGTGTGCGCCCAGTGCC	0.711													C|||	1321	0.263778	0.0242	0.2637	5008	,	,		10794	0.6478		0.2038	False		,,,				2504	0.2536				p.C49C		.											.	TNFRSF6B-651	0			c.C147T						.	C		298,4042		14,270,1886	15.0	18.0	17.0		147	-8.1	0.0	20	dbSNP_100	17	1903,6643		226,1451,2596	no	coding-synonymous	TNFRSF6B	NM_003823.3		240,1721,4482	TT,TC,CC		22.2677,6.8664,17.0806		49/301	62328267	2201,10685	2170	4273	6443	SO:0001819	synonymous_variant	8771	exon1			GGTGTGCGCCCAG	AF104419	CCDS13532.1	20q13.33	2012-06-27						"""Tumor necrosis factor receptor superfamily"""	11921	protein-coding gene	gene with protein product		603361				9872321, 10318773	Standard	NM_003823		Approved	DcR3, DCR3, TR6, M68	uc002yfz.3	O95407	OTTHUMG00000143724	ENST00000369996.1:c.147C>T	20.37:g.62328267C>T		Somatic	69	0		WXS	Illumina GAIIx	Phase_I	47	4	NM_003823	0	0	1	1	0		Silent	SNP	ENST00000369996.1	37	CCDS13532.1	623	0.28525641025641024	14	0.028455284552845527	71	0.19613259668508287	371	0.6486013986013986	167	0.22031662269129287	C	9.458	1.092457	0.20471	0.068664	0.222677	ENSG00000258366	ENST00000318100	D	0.83335	-1.71	4.06	-8.12	0.01078	.	4.628610	0.00921	N	0.002584	T	0.00012	0.0000	.	.	.	0.33623	P	0.39491299999999996	.	.	.	.	.	.	T	0.49072	-0.8977	6	0.72032	D	0.01	-21.338	18.8802	0.92353	0.0:0.8572:0.0:0.1428	rs2257440;rs3787087	.	.	.	C	1352	ENSP00000322287:R1352C	ENSP00000322287:R1352C	R	+	1	0	AL353715.1	61798711	0.000000	0.05858	0.000000	0.03702	0.152000	0.21847	-1.308000	0.02730	-1.993000	0.00974	-1.327000	0.01280	CGC	C|0.779;T|0.221		0.711	TNFRSF6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080182.1		
TMEM40	55287	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	12779634	12779634	+	Splice_Site	SNP	C	C	G			TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr3:12779634C>G	ENST00000314124.7	-	7	781		c.e7+1		TMEM40_ENST00000435218.2_Splice_Site|TMEM40_ENST00000431022.2_Splice_Site|TMEM40_ENST00000435575.1_Splice_Site|TMEM40_ENST00000476331.1_Splice_Site|TMEM40_ENST00000264728.8_Splice_Site	NM_001284406.1|NM_018306.2	NP_001271335.1|NP_060776.2	Q8WWA1	TMM40_HUMAN	transmembrane protein 40							integral component of membrane (GO:0016021)				breast(1)|large_intestine(3)|lung(5)|urinary_tract(1)	10						TGTGTATTTACCACTTGCTGG	0.557																																					.		.											.	TMEM40-90	0			c.424+1G>C						.						93.0	85.0	88.0					3																	12779634		2203	4300	6503	SO:0001630	splice_region_variant	55287	exon8			TATTTACCACTTG	BC020658	CCDS2613.1, CCDS68347.1, CCDS68348.1	3p25.2	2005-01-10			ENSG00000088726	ENSG00000088726			25620	protein-coding gene	gene with protein product						12477932	Standard	NM_018306		Approved	FLJ11036	uc003bxg.1	Q8WWA1	OTTHUMG00000129801	ENST00000314124.7:c.424+1G>C	3.37:g.12779634C>G		Somatic	127	0		WXS	Illumina GAIIx	Phase_I	147	60	NM_018306	0	0	0	0	0	C9JID5|Q8NAL4|Q9NUZ4	Splice_Site	SNP	ENST00000314124.7	37	CCDS2613.1	.	.	.	.	.	.	.	.	.	.	C	15.12	2.739932	0.49045	.	.	ENSG00000088726	ENST00000314124;ENST00000435575;ENST00000435218;ENST00000264728;ENST00000431022	.	.	.	5.09	5.09	0.68999	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.3624	0.66782	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TMEM40	12754634	1.000000	0.71417	0.741000	0.31004	0.679000	0.39708	3.252000	0.51461	2.515000	0.84797	0.655000	0.94253	.	.		0.557	TMEM40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252029.2	NM_018306	Intron
TRAK1	22906	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	42265106	42265106	+	Silent	SNP	C	C	T			TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr3:42265106C>T	ENST00000327628.5	+	16	3139	c.2739C>T	c.(2737-2739)ggC>ggT	p.G913G	TRAK1_ENST00000396175.1_Silent_p.G855G|RNU4-78P_ENST00000410940.1_RNA|TRAK1_ENST00000487159.1_3'UTR	NM_001042646.2	NP_001036111.1	Q9UPV9	TRAK1_HUMAN	trafficking protein, kinesin binding 1	913					endosome to lysosome transport (GO:0008333)|protein O-linked glycosylation (GO:0006493)|protein targeting (GO:0006605)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(8)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	22						TCAATAGTGGCATCCGGCGGA	0.602																																					p.G913G	GBM(44;195 884 22595 31865 41850)	.											.	TRAK1-91	0			c.C2739T						.						46.0	51.0	49.0					3																	42265106		2031	4187	6218	SO:0001819	synonymous_variant	22906	exon16			TAGTGGCATCCGG		CCDS2695.1, CCDS43072.1, CCDS58826.1, CCDS74922.1	3p22.1	2012-03-05			ENSG00000182606	ENSG00000182606			29947	protein-coding gene	gene with protein product	"""OGT(O Glc NAc transferase) interacting protein 106 KDa"", ""O-linked N-acetylglucosamine transferase interacting protein 106"", ""milton homolog 1 (Drosophila)"""	608112				10470851, 12435728, 16380713, 20230862	Standard	NM_014965		Approved	OIP106, KIAA1042, MILT1	uc003cky.4	Q9UPV9	OTTHUMG00000131795	ENST00000327628.5:c.2739C>T	3.37:g.42265106C>T		Somatic	188	0		WXS	Illumina GAIIx	Phase_I	161	72	NM_001042646	0	0	4	9	5	E9PDS2|J3KNT7|Q63HR0|Q659B5|Q96B69	Silent	SNP	ENST00000327628.5	37	CCDS43072.1																																																																																			.		0.602	TRAK1-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343413.1	NM_014965	
CACNA1D	776	broad.mit.edu	37	3	53529193	53529195	+	Start_Codon_Del	DEL	GAT	GAT	-			TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr3:53529193_53529195delGAT	ENST00000350061.5	+	0	511_513				CACNA1D_ENST00000422281.2_Start_Codon_Del|CACNA1D_ENST00000288139.4_Start_Codon_Del	NM_001128840.1	NP_001122312.1	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type, alpha 1D subunit						adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|energy reserve metabolic process (GO:0006112)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during SA node cell action potential (GO:0086052)|positive regulation of calcium ion transport (GO:0051928)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|ankyrin binding (GO:0030506)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)|voltage-gated calcium channel activity involved in cardiac muscle cell action potential (GO:0086007)|voltage-gated calcium channel activity involved SA node cell action potential (GO:0086059)			breast(3)|central_nervous_system(9)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(13)|liver(1)|lung(29)|ovary(6)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	90				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	aatgttcgtGgatgatgatgatg	0.581																																							.											.	CACNA1D-100	0									.																																			SO:0001582	initiator_codon_variant	776	wholegene			TTCGTGGATGATG	AB209171	CCDS2872.1, CCDS46848.1, CCDS46849.1	3p14.3	2012-03-07			ENSG00000157388	ENSG00000157388		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1391	protein-coding gene	gene with protein product		114206		CCHL1A2, CACNL1A2		1664412	Standard	NM_000720		Approved	Cav1.3, CACH3, CACN4	uc003dgu.5	Q01668	OTTHUMG00000158278		3.37:g.53529202_53529204delGAT		Somatic	394	0		WXS	Illumina GAIIx	Phase_I	463	7	NM_001128840	0	0	0	0	0	B0FYA3|Q13916|Q13931|Q71UT1|Q9UDC3	Frame_Shift_Del	DEL	ENST00000350061.5	37	CCDS46848.1																																																																																			.		0.581	CACNA1D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350557.1	NM_000720	
ZIC4	84107	bcgsc.ca	37	3	147108756	147108756	+	Silent	SNP	C	C	G	rs17509456	byFrequency	TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr3:147108756C>G	ENST00000383075.3	-	4	1478	c.966G>C	c.(964-966)tcG>tcC	p.S322S	ZIC4_ENST00000491672.1_Silent_p.S116S|ZIC4_ENST00000473123.1_Silent_p.S322S|ZIC4_ENST00000472749.2_5'UTR|ZIC4_ENST00000525172.2_Silent_p.S372S|ZIC4_ENST00000484399.1_Silent_p.S322S|ZIC4_ENST00000425731.3_Silent_p.S360S	NM_032153.5	NP_115529.2	Q8N9L1	ZIC4_HUMAN	Zic family member 4	322						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S322S(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(34)|upper_aerodigestive_tract(4)	57						CCACCGCCGCCGAGGAGGCCA	0.721													C|||	87	0.0173722	0.0038	0.0245	5008	,	,		14138	0.0		0.0577	False		,,,				2504	0.0072				p.S372S		.											.	ZIC4-91	1	Substitution - coding silent(1)	lung(1)	c.G1116C						.	C	,,	30,4006		0,30,1988	16.0	20.0	18.0		1116,1080,966	-2.5	0.9	3	dbSNP_123	18	369,7951		7,355,3798	no	coding-synonymous,coding-synonymous,coding-synonymous	ZIC4	NM_001168378.1,NM_001168379.1,NM_032153.5	,,	7,385,5786	GG,GC,CC		4.4351,0.7433,3.2292	,,	372/385,360/373,322/335	147108756	399,11957	2018	4160	6178	SO:0001819	synonymous_variant	84107	exon4			CGCCGCCGAGGAG	AF332509	CCDS43160.1, CCDS54652.1, CCDS54653.1, CCDS58857.1	3q24	2013-01-08	2003-02-21		ENSG00000174963	ENSG00000174963		"""Zinc fingers, C2H2-type"""	20393	protein-coding gene	gene with protein product		608948	"""zinc finger protein of the cerebellum 4"""				Standard	NM_001168378		Approved		uc011bno.2	Q8N9L1	OTTHUMG00000037281	ENST00000383075.3:c.966G>C	3.37:g.147108756C>G		Somatic	54	0		WXS	Illumina GAIIx	Phase_I	10	3	NM_001168378	0	0	0	0	0	A0AVA2|B2RMQ8|B4DF89|B7Z2L2|C9J7D5|J3KQG1|Q4G157|Q9BZ94	Silent	SNP	ENST00000383075.3	37	CCDS43160.1																																																																																			C|0.975;G|0.025		0.721	ZIC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355504.1		
LXN	56925	broad.mit.edu	37	3	158388792	158388792	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr3:158388792C>T	ENST00000264265.3	-	2	360	c.146G>A	c.(145-147)gGa>gAa	p.G49E	GFM1_ENST00000486715.1_Intron|GFM1_ENST00000478576.1_Intron|GFM1_ENST00000264263.5_Intron	NM_020169.3	NP_064554.3	Q9BS40	LXN_HUMAN	latexin	49	Cystatin-like fold 1. {ECO:0000250}.				detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|inflammatory response (GO:0006954)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	heparin binding (GO:0008201)|metalloendopeptidase inhibitor activity (GO:0008191)			breast(2)|endometrium(1)|kidney(2)	5			Lung(72;0.00309)|LUSC - Lung squamous cell carcinoma(72;0.0043)			ATACTTATGTCCTCTTCCTGG	0.313																																					p.G49E		.											.	LXN-90	0			c.G146A						.						36.0	41.0	40.0					3																	158388792		2183	4297	6480	SO:0001583	missense	56925	exon2			TTATGTCCTCTTC	AF087851	CCDS3183.1	3q25.32	2004-05-10			ENSG00000079257	ENSG00000079257			13347	protein-coding gene	gene with protein product		609305					Standard	NM_020169		Approved		uc003fch.3	Q9BS40	OTTHUMG00000158807	ENST00000264265.3:c.146G>A	3.37:g.158388792C>T	ENSP00000264265:p.Gly49Glu	Somatic	376	0		WXS	Illumina GAIIx	Phase_I	356	4	NM_020169	0	0	10	10	0	Q96PN2|Q9NQS6	Missense_Mutation	SNP	ENST00000264265.3	37	CCDS3183.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.293376	0.80914	.	.	ENSG00000079257	ENST00000264265	T	0.52754	0.65	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	T	0.67906	0.2943	M	0.66939	2.045	0.58432	D	0.999995	D	0.89917	1.0	D	0.97110	1.0	T	0.69379	-0.5161	10	0.72032	D	0.01	-22.8528	17.1084	0.86669	0.0:1.0:0.0:0.0	.	49	Q9BS40	LXN_HUMAN	E	49	ENSP00000264265:G49E	ENSP00000264265:G49E	G	-	2	0	LXN	159871486	0.967000	0.33354	0.997000	0.53966	0.990000	0.78478	3.330000	0.52068	2.801000	0.96364	0.650000	0.86243	GGA	.		0.313	LXN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352284.1	NM_020169	
MUC4	4585	bcgsc.ca	37	3	195509383	195509383	+	Missense_Mutation	SNP	G	G	T	rs559708827	byFrequency	TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr3:195509383G>T	ENST00000463781.3	-	2	9527	c.9068C>A	c.(9067-9069)aCc>aAc	p.T3023N	MUC4_ENST00000475231.1_Missense_Mutation_p.T3023N|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.T3023N(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ATGAAGAGGGGTGGCGTGACC	0.592													.|||	58	0.0115815	0.0091	0.0043	5008	,	,		10271	0.0357		0.004	False		,,,				2504	0.0031				p.T3023N		.											.	MUC4-90	1	Substitution - Missense(1)	endometrium(1)	c.C9068A						.						27.0	20.0	22.0					3																	195509383		669	1569	2238	SO:0001583	missense	4585	exon2			AGAGGGGTGGCGT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.9068C>A	3.37:g.195509383G>T	ENSP00000417498:p.Thr3023Asn	Somatic	489	5		WXS	Illumina GAIIx	Phase_I	155	11	NM_018406	0	0	0	0	0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	6.525	0.465067	0.12402	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.32272	1.46;1.52	.	.	.	.	.	.	.	.	T	0.23846	0.0577	N	0.08118	0	0.19775	N	0.999958	P	0.51653	0.947	P	0.55965	0.788	T	0.17048	-1.0382	7	.	.	.	.	7.5518	0.27802	0.0:0.0:1.0:0.0	.	2895	E7ESK3	.	N	3023	ENSP00000417498:T3023N;ENSP00000420243:T3023N	.	T	-	2	0	MUC4	196994162	0.013000	0.17824	0.041000	0.18516	0.000000	0.00434	0.698000	0.25571	0.482000	0.27582	0.000000	0.15137	ACC	.		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
SCFD2	152579	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	54231383	54231383	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr4:54231383T>G	ENST00000401642.3	-	1	859	c.726A>C	c.(724-726)ttA>ttC	p.L242F	SCFD2_ENST00000388940.4_Missense_Mutation_p.L242F	NM_152540.3	NP_689753.2	Q8WU76	SCFD2_HUMAN	sec1 family domain containing 2	242					protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)					breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	30			GBM - Glioblastoma multiforme(3;1.07e-26)|LUSC - Lung squamous cell carcinoma(32;0.0134)			TGACCTGACTTAAGGAACCTA	0.527																																					p.L242F		.											.	SCFD2-93	0			c.A726C						.						142.0	132.0	136.0					4																	54231383		2203	4300	6503	SO:0001583	missense	152579	exon1			CTGACTTAAGGAA	AY299407	CCDS33984.1	4q12	2004-01-15			ENSG00000184178	ENSG00000184178			30676	protein-coding gene	gene with protein product						12477932	Standard	NM_152540		Approved	STXBP1L1, FLJ39514	uc003gzu.3	Q8WU76	OTTHUMG00000160588	ENST00000401642.3:c.726A>C	4.37:g.54231383T>G	ENSP00000384182:p.Leu242Phe	Somatic	144	0		WXS	Illumina GAIIx	Phase_I	159	76	NM_152540	0	0	3	5	2	Q8N5F3|Q8N8H0|Q96ED3	Missense_Mutation	SNP	ENST00000401642.3	37	CCDS33984.1	.	.	.	.	.	.	.	.	.	.	T	5.196	0.221783	0.09863	.	.	ENSG00000184178	ENST00000401642;ENST00000388940	T;T	0.79247	-1.25;-1.25	5.25	3.43	0.39272	.	0.168843	0.52532	N	0.000080	T	0.65668	0.2713	L	0.28608	0.87	0.39173	D	0.962627	B;B	0.17667	0.023;0.013	B;B	0.16722	0.016;0.007	T	0.66106	-0.6006	10	0.62326	D	0.03	.	10.03	0.42094	0.0:0.1421:0.6985:0.1594	.	242;242	Q8WU76-2;Q8WU76	.;SCFD2_HUMAN	F	242	ENSP00000384182:L242F;ENSP00000373592:L242F	ENSP00000373592:L242F	L	-	3	2	SCFD2	53926140	1.000000	0.71417	0.995000	0.50966	0.016000	0.09150	1.998000	0.40796	1.424000	0.47217	0.260000	0.18958	TTA	.		0.527	SCFD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361311.3	NM_152540	
FRAS1	80144	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	79399070	79399070	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr4:79399070G>A	ENST00000264895.6	+	55	8393	c.7953G>A	c.(7951-7953)atG>atA	p.M2651I		NM_025074.6	NP_079350.5	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	2647					cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						AGCTCAGCATGCCAGCTTATG	0.473																																					p.M2651I		.											.	FRAS1-68	0			c.G7953A						.						83.0	82.0	82.0					4																	79399070		2020	4181	6201	SO:0001583	missense	80144	exon55			CAGCATGCCAGCT	AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000264895.6:c.7953G>A	4.37:g.79399070G>A	ENSP00000264895:p.Met2651Ile	Somatic	241	2		WXS	Illumina GAIIx	Phase_I	267	113	NM_025074	0	0	0	0	0	A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Missense_Mutation	SNP	ENST00000264895.6	37	CCDS54771.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.72|15.72	2.916400|2.916400	0.52546|0.52546	.|.	.|.	ENSG00000138759|ENSG00000138759	ENST00000512123|ENST00000264895	.|T	.|0.27104	.|1.69	5.69|5.69	4.84|4.84	0.62591|0.62591	.|.	.|0.040345	.|0.85682	.|D	.|0.000000	T|T	0.50718|0.50718	0.1632|0.1632	M|M	0.74881|0.74881	2.28|2.28	0.80722|0.80722	D|D	1|1	.|D	.|0.76494	.|0.999	.|D	.|0.65684	.|0.937	T|T	0.55127|0.55127	-0.8189|-0.8189	5|10	.|0.51188	.|T	.|0.08	.|.	17.1187|17.1187	0.86696|0.86696	0.0:0.1266:0.8734:0.0|0.0:0.1266:0.8734:0.0	.|.	.|2651	.|E9PHH6	.|.	T|I	880|2651	.|ENSP00000264895:M2651I	.|ENSP00000264895:M2651I	A|M	+|+	1|3	0|0	FRAS1|FRAS1	79618094|79618094	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.361000|0.361000	0.29550|0.29550	7.471000|7.471000	0.80985|0.80985	1.530000|1.530000	0.49136|0.49136	-0.165000|-0.165000	0.13383|0.13383	GCC|ATG	.		0.473	FRAS1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
TACR3	6870	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	104640739	104640739	+	Frame_Shift_Del	DEL	C	C	-			TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr4:104640739delC	ENST00000304883.2	-	1	234	c.94delG	c.(94-96)gcgfs	p.A33fs		NM_001059.2	NP_001050.1	P29371	NK3R_HUMAN	tachykinin receptor 3	33					aging (GO:0007568)|hyperosmotic salinity response (GO:0042538)|positive regulation of blood pressure (GO:0045777)|positive regulation of heart rate (GO:0010460)|positive regulation of uterine smooth muscle contraction (GO:0070474)|regulation of dopamine metabolic process (GO:0042053)|regulation of feeding behavior (GO:0060259)|response to cocaine (GO:0042220)|response to estradiol (GO:0032355)|response to morphine (GO:0043278)|tachykinin receptor signaling pathway (GO:0007217)	cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|integral component of plasma membrane (GO:0005887)|neuronal cell body membrane (GO:0032809)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	tachykinin receptor activity (GO:0004995)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(19)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	51		Hepatocellular(203;0.217)		UCEC - Uterine corpus endometrioid carcinoma (10;0.22)|OV - Ovarian serous cystadenocarcinoma(123;3.4e-08)		CCCGTGGCCGCCCCGGCAGCT	0.682																																					p.A32fs		.											.	TACR3-525	0			c.94delG						.						33.0	40.0	38.0					4																	104640739		2202	4297	6499	SO:0001589	frameshift_variant	6870	exon1			TGGCCGCCCCGGC	M89473	CCDS3664.1	4q25	2012-08-08			ENSG00000169836	ENSG00000169836		"""GPCR / Class A : Tachykinin receptors"""	11528	protein-coding gene	gene with protein product	"""neurokinin beta receptor"""	162332				1374246	Standard	NM_001059		Approved	NK3R	uc003hxe.1	P29371	OTTHUMG00000131124	ENST00000304883.2:c.94delG	4.37:g.104640739delC	ENSP00000303325:p.Ala33fs	Somatic	88	0		WXS	Illumina GAIIx	Phase_I	40	14	NM_001059	0	0	0	0	0	Q0P510	Frame_Shift_Del	DEL	ENST00000304883.2	37	CCDS3664.1																																																																																			.		0.682	TACR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253804.1	NM_001059	
ANK2	287	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	114277261	114277261	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr4:114277261C>G	ENST00000357077.4	+	38	7540	c.7487C>G	c.(7486-7488)aCa>aGa	p.T2496R	ANK2_ENST00000264366.6_Missense_Mutation_p.T2463R|ANK2_ENST00000509550.1_Intron|ANK2_ENST00000510275.2_Intron|ANK2_ENST00000394537.3_Intron|ANK2_ENST00000506722.1_Intron	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	2496					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		GTTGCCAAAACAGAACTCTTG	0.537																																					p.T2496R		.											.	ANK2-583	0			c.C7487G						.						71.0	73.0	72.0					4																	114277261		2203	4300	6503	SO:0001583	missense	287	exon38			CCAAAACAGAACT	M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.7487C>G	4.37:g.114277261C>G	ENSP00000349588:p.Thr2496Arg	Somatic	70	0		WXS	Illumina GAIIx	Phase_I	75	28	NM_001148	0	0	0	0	0	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	37	CCDS3702.1	.	.	.	.	.	.	.	.	.	.	C	16.49	3.137681	0.56936	.	.	ENSG00000145362	ENST00000357077;ENST00000264366	T;T	0.69435	-0.38;-0.4	5.99	5.99	0.97316	.	0.638936	0.14607	N	0.309282	T	0.66848	0.2831	L	0.60455	1.87	0.80722	D	1	B;P	0.45827	0.257;0.867	B;B	0.41619	0.063;0.361	T	0.66360	-0.5943	9	.	.	.	.	17.4037	0.87467	0.0:0.8758:0.1242:0.0	.	2463;2496	Q01484;Q01484-4	ANK2_HUMAN;.	R	2496;2463	ENSP00000349588:T2496R;ENSP00000264366:T2463R	.	T	+	2	0	ANK2	114496710	0.999000	0.42202	0.971000	0.41717	0.864000	0.49448	2.348000	0.44045	2.847000	0.97988	0.655000	0.94253	ACA	.		0.537	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148	
TRAM1L1	133022	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	118006510	118006519	+	Frame_Shift_Del	DEL	GAACGGGGGG	GAACGGGGGG	-	rs113650718|rs139767798	byFrequency	TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10	GAACGGGGGG	GAACGGGGGG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr4:118006510_118006519delGAACGGGGGG	ENST00000310754.4	-	1	217_226	c.31_40delCCCCCCGTTC	c.(31-42)ccccccgttctcfs	p.PPVL11fs		NM_152402.2	NP_689615.2	Q8N609	TR1L1_HUMAN	translocation associated membrane protein 1-like 1	11					protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22						TCCTGGCTGAGAACGGGGGGGTTCTTGGTG	0.624																																					p.11_14del		.											.	TRAM1L1-90	0			c.31_40del						.																																			SO:0001589	frameshift_variant	133022	exon1			GGCTGAGAACGGG	AK074617	CCDS3707.1	4q26	2008-02-05			ENSG00000174599	ENSG00000174599			28371	protein-coding gene	gene with protein product						12477932	Standard	NM_152402		Approved	MGC26568	uc003ibv.4	Q8N609	OTTHUMG00000132956	ENST00000310754.4:c.31_40delCCCCCCGTTC	4.37:g.118006510_118006519delGAACGGGGGG	ENSP00000309402:p.Pro11fs	Somatic	108	0		WXS	Illumina GAIIx	Phase_I	109	29	NM_152402	0	0	0	0	0	Q8N2L7	Frame_Shift_Del	DEL	ENST00000310754.4	37	CCDS3707.1																																																																																			.		0.624	TRAM1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256513.1	NM_152402	
KLHL3	26249	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	136973018	136973018	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr5:136973018G>A	ENST00000309755.4	-	11	1729	c.1286C>T	c.(1285-1287)aCg>aTg	p.T429M	KLHL3_ENST00000541417.1_Intron|KLHL3_ENST00000506873.1_Intron|KLHL3_ENST00000508657.1_Missense_Mutation_p.T397M|KLHL3_ENST00000506491.1_Missense_Mutation_p.T347M	NM_017415.2	NP_059111.2	Q9UH77	KLHL3_HUMAN	kelch-like family member 3	429					distal tubule morphogenesis (GO:0072156)|ion homeostasis (GO:0050801)|protein K48-linked ubiquitination (GO:0070936)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|renal sodium ion absorption (GO:0070294)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)	structural molecule activity (GO:0005198)			breast(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|stomach(1)|upper_aerodigestive_tract(1)	21		all_hematologic(541;3.67e-07)|Breast(839;7.61e-05)|Prostate(281;0.000825)|Ovarian(839;0.0481)|all_lung(232;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)	GBM - Glioblastoma multiforme(465;0.0223)		GCTCCGCCGCGTGTTCATCGG	0.632																																					p.T429M		.											.	KLHL3-90	0			c.C1286T						.						99.0	88.0	92.0					5																	136973018		2203	4300	6503	SO:0001583	missense	26249	exon11			CGCCGCGTGTTCA	AB032955	CCDS4192.1, CCDS58969.1, CCDS58970.1	5q31	2013-01-30	2013-01-30		ENSG00000146021	ENSG00000146021		"""Kelch-like"", ""BTB/POZ domain containing"""	6354	protein-coding gene	gene with protein product		605775	"""kelch (Drosophila)-like 3"", ""kelch-like 3 (Drosophila)"""			10843806	Standard	NM_017415		Approved	KIAA1129	uc010jek.3	Q9UH77	OTTHUMG00000129155	ENST00000309755.4:c.1286C>T	5.37:g.136973018G>A	ENSP00000312397:p.Thr429Met	Somatic	142	0		WXS	Illumina GAIIx	Phase_I	178	82	NM_017415	0	0	0	0	0	B2RBK7|Q9UH75|Q9UH76|Q9ULU0|Q9Y6V6	Missense_Mutation	SNP	ENST00000309755.4	37	CCDS4192.1	.	.	.	.	.	.	.	.	.	.	G	34	5.324381	0.95708	.	.	ENSG00000146021	ENST00000506491;ENST00000508657;ENST00000309755;ENST00000505853	T;T;T;T	0.68025	-0.3;-0.3;-0.3;-0.3	4.94	4.94	0.65067	Galactose oxidase, beta-propeller (1);	0.000000	0.85682	D	0.000000	D	0.82540	0.5059	M	0.77406	2.37	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.77557	0.982;0.99	D	0.84626	0.0687	10	0.87932	D	0	.	18.7263	0.91714	0.0:0.0:1.0:0.0	.	389;429	D6RH21;Q9UH77	.;KLHL3_HUMAN	M	347;397;429;389	ENSP00000424828:T347M;ENSP00000422099:T397M;ENSP00000312397:T429M;ENSP00000426173:T389M	ENSP00000312397:T429M	T	-	2	0	KLHL3	137000917	1.000000	0.71417	0.971000	0.41717	0.997000	0.91878	9.601000	0.98297	2.723000	0.93209	0.655000	0.94253	ACG	.		0.632	KLHL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251220.2		
GABRA1	2554	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	161300197	161300197	+	Silent	SNP	C	C	T			TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr5:161300197C>T	ENST00000428797.2	+	6	685	c.330C>T	c.(328-330)gtC>gtT	p.V110V	GABRA1_ENST00000420560.1_Silent_p.V110V|GABRA1_ENST00000437025.2_Silent_p.V110V|GABRA1_ENST00000023897.6_Silent_p.V110V|GABRA1_ENST00000444819.1_Silent_p.V110V|GABRA1_ENST00000393943.4_Silent_p.V110V	NM_001127643.1	NP_001121115.1	P14867	GBRA1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 1	110					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|drug binding (GO:0008144)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|endometrium(2)|kidney(3)|large_intestine(4)|liver(1)|lung(22)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(1)	42	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.228)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethanol(DB00898)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methohexital(DB00474)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Prazepam(DB01588)|Primidone(DB00794)|Progabide(DB00837)|Propofol(DB00818)|Quazepam(DB01589)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiamylal(DB01154)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zaleplon(DB00962)|Zolpidem(DB00425)|Zopiclone(DB01198)	CTATGACAGTCCTCCGGTTAA	0.393																																					p.V110V		.											.	GABRA1-93	0			c.C330T						.						83.0	85.0	85.0					5																	161300197		2203	4300	6503	SO:0001819	synonymous_variant	2554	exon5			GACAGTCCTCCGG		CCDS4357.1	5q34	2012-06-22			ENSG00000022355	ENSG00000022355		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4075	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 1"""	137160				1330891	Standard	NM_000806		Approved	EJM5	uc003lyx.4	P14867	OTTHUMG00000163586	ENST00000428797.2:c.330C>T	5.37:g.161300197C>T		Somatic	90	0		WXS	Illumina GAIIx	Phase_I	72	8	NM_001127644	0	0	0	0	0	D3DQK6|Q8N629	Silent	SNP	ENST00000428797.2	37	CCDS4357.1																																																																																			.		0.393	GABRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252702.2	NM_000806.5	
HIST1H3B	8358	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	26031919	26031919	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr6:26031919C>G	ENST00000244661.2	-	1	369	c.370G>C	c.(370-372)Gac>Cac	p.D124H		NM_003537.3	NP_003528.1	P68431	H31_HUMAN	histone cluster 1, H3b	124					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			breast(3)|central_nervous_system(10)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)|skin(1)	25						AGCTGGATGTCTTTGGGCATA	0.507																																					p.D124H		.											.	HIST1H3B-92	0			c.G370C						.						72.0	74.0	73.0					6																	26031919		2203	4300	6503	SO:0001583	missense	8358	exon1			GGATGTCTTTGGG	X00090	CCDS4573.1	6p22.1	2011-01-27	2006-10-11	2003-03-14	ENSG00000124693	ENSG00000274267		"""Histones / Replication-dependent"""	4776	protein-coding gene	gene with protein product		602819	"""H3 histone family, member L"", ""histone 1, H3b"""	H3FL		6647026, 9119399, 12408966	Standard	NM_003537		Approved	H3/l	uc003nfs.1	P68431	OTTHUMG00000014415	ENST00000244661.2:c.370G>C	6.37:g.26031919C>G	ENSP00000244661:p.Asp124His	Somatic	111	0		WXS	Illumina GAIIx	Phase_I	128	51	NM_003537	0	0	0	0	0	A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	ENST00000244661.2	37	CCDS4573.1	.	.	.	.	.	.	.	.	.	.	c	10.74	1.435317	0.25813	.	.	ENSG00000124693	ENST00000244661	T	0.71222	-0.55	5.17	5.17	0.71159	.	.	.	.	.	T	0.80380	0.4612	.	.	.	0.50632	D	0.999883	.	.	.	.	.	.	T	0.82916	-0.0220	6	0.87932	D	0	.	18.0207	0.89253	0.0:1.0:0.0:0.0	.	.	.	.	H	124	ENSP00000244661:D124H	ENSP00000244661:D124H	D	-	1	0	HIST1H3B	26139898	1.000000	0.71417	0.989000	0.46669	0.011000	0.07611	7.492000	0.81482	2.545000	0.85829	0.561000	0.74099	GAC	.		0.507	HIST1H3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040077.1	NM_003537	
MICA	100507436	broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	31378525	31378525	+	Silent	SNP	C	C	T	rs17206561	byFrequency	TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr6:31378525C>T	ENST00000449934.2	+	2	330	c.276C>T	c.(274-276)aaC>aaT	p.N92N	HCP5_ENST00000414046.2_RNA	NM_001177519.1	NP_001170990.1			MHC class I polypeptide-related sequence A											breast(1)|endometrium(3)|kidney(1)	5		Ovarian(999;0.0253)				TGACAGGGAACGGAAAGGACC	0.537																																					p.N92N		.											.	.	0			c.C276T						.	C		0,1384		0,0,692	79.0	87.0	84.0		276	-4.2	0.0	6	dbSNP_123	84	1,3181		0,1,1590	no	coding-synonymous	MICA	NM_001177519.1		0,1,2282	TT,TC,CC		0.0314,0.0,0.0219		92/333	31378525	1,4565	692	1591	2283	SO:0001819	synonymous_variant	100507436	exon2			AGGGAACGGAAAG	L14848	CCDS56412.1, CCDS75421.1	6p21.3	2013-01-11			ENSG00000204520	ENSG00000204520		"""Immunoglobulin superfamily / C1-set domain containing"""	7090	protein-coding gene	gene with protein product		600169				8022771	Standard	NM_000247		Approved	PERB11.1	uc003ntk.1	Q29983	OTTHUMG00000031073	ENST00000449934.2:c.276C>T	6.37:g.31378525C>T		Somatic	196	1		WXS	Illumina GAIIx	Phase_I	232	108	NM_001177519	0	0	16	25	9		Silent	SNP	ENST00000449934.2	37	CCDS56412.1	.	.	.	.	.	.	.	.	.	.	N	0.838	-0.742760	0.03088	0.0	3.14E-4	ENSG00000204520	ENST00000376222	.	.	.	2.12	-4.24	0.03777	.	.	.	.	.	T	0.02083	0.0065	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.26052	-1.0114	7	0.02654	T	1	.	0.5287	0.00624	0.2873:0.2415:0.2887:0.1825	rs17206561	12	Q5SS58	.	W	12	.	ENSP00000365396:R12W	R	+	1	2	MICA	31486504	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-7.223000	0.00041	-4.071000	0.00076	-0.818000	0.03119	CGG	C|0.765;T|0.235		0.537	MICA-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076101.7	NM_001177519	
PRIM2	5558	bcgsc.ca	37	6	57393112	57393112	+	Splice_Site	SNP	T	T	C	rs11964288	byFrequency	TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr6:57393112T>C	ENST00000607273.1	+	9	849	c.762T>C	c.(760-762)agT>agC	p.S254S	PRIM2_ENST00000389488.2_3'UTR	NM_000947.3	NP_000938.2	P49643	PRI2_HUMAN	primase, DNA, polypeptide 2 (58kDa)	254					DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	nucleoplasm (GO:0005654)|primosome complex (GO:1990077)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA primase activity (GO:0003896)|metal ion binding (GO:0046872)	p.S254S(2)		NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(34)|prostate(6)|stomach(4)|upper_aerodigestive_tract(1)	59				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		ttttttaaaGTCATTCCTACA	0.264																																					.		.											.	PRIM2-227	2	Substitution - coding silent(2)	prostate(1)|stomach(1)	.						.	T		47,3541		0,47,1747	62.0	55.0	57.0		762	3.5	1.0	6	dbSNP_120	57	391,7735		0,391,3672	yes	coding-synonymous-near-splice	PRIM2	XM_003403439.1		0,438,5419	CC,CT,TT		4.8117,1.3099,3.7391		254/510	57393112	438,11276	1794	4063	5857	SO:0001630	splice_region_variant	5558	.			TTAAAGTCATTCC		CCDS75476.1, CCDS75477.1	6p12-p11.1	2013-01-31	2007-06-19	2007-06-19	ENSG00000146143	ENSG00000146143			9370	protein-coding gene	gene with protein product		176636	"""primase, polypeptide 2A (58kD)"", ""primase, polypeptide 2A, 58kDa"""	PRIM2A		8530050, 20675616	Standard	NM_001282487		Approved		uc003pdx.3	P49643	OTTHUMG00000016190	ENST00000607273.1:c.762-1T>C	6.37:g.57393112T>C		Somatic	31	0		WXS	Illumina GAIIx	Phase_I	33	9	.	0	0	0	0	0	Q53FJ8|Q6P1Q7|Q8WVL2|Q9H413	RNA	SNP	ENST00000607273.1	37																																																																																				T|0.985;C|0.015		0.264	PRIM2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_000947	Silent
DDO	8528	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	110714258	110714258	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr6:110714258T>G	ENST00000368924.3	-	5	845	c.830A>C	c.(829-831)gAa>gCa	p.E277A	DDO_ENST00000368923.3_Missense_Mutation_p.E218A	NM_003649.2	NP_003640.2	Q99489	OXDD_HUMAN	D-aspartate oxidase	249					aspartate catabolic process (GO:0006533)|aspartate metabolic process (GO:0006531)|D-amino acid catabolic process (GO:0019478)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insemination (GO:0007320)|oxidation-reduction process (GO:0055114)	peroxisome (GO:0005777)	cofactor binding (GO:0048037)|D-aspartate oxidase activity (GO:0008445)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(4)|pancreas(1)|skin(3)	24		all_cancers(87;3.47e-21)|all_epithelial(87;9.03e-20)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_lung(197;2.98e-05)|Lung NSC(302;3.25e-05)|Colorectal(196;3.46e-05)|Ovarian(999;0.00327)		all cancers(137;2.54e-48)|Epithelial(106;3.11e-44)|OV - Ovarian serous cystadenocarcinoma(136;2.08e-24)|BRCA - Breast invasive adenocarcinoma(108;0.000141)|GBM - Glioblastoma multiforme(226;0.00046)		TCTGCTATTTTCTGCATCCGG	0.542																																					p.E277A		.											.	DDO-155	0			c.A830C						.						147.0	154.0	152.0					6																	110714258		2203	4300	6503	SO:0001583	missense	8528	exon5			CTATTTTCTGCAT	D89858	CCDS5082.1, CCDS5083.1	6q22.1	2008-02-05			ENSG00000203797	ENSG00000203797	1.4.3.1		2727	protein-coding gene	gene with protein product		124450				9163533	Standard	NM_003649		Approved		uc003puc.3	Q99489	OTTHUMG00000015360	ENST00000368924.3:c.830A>C	6.37:g.110714258T>G	ENSP00000357920:p.Glu277Ala	Somatic	98	0		WXS	Illumina GAIIx	Phase_I	100	50	NM_003649	0	0	8	13	5	A8KAG4|Q5JXM4|Q5JXM5|Q5JXM6|Q8N552	Missense_Mutation	SNP	ENST00000368924.3	37	CCDS5082.1	.	.	.	.	.	.	.	.	.	.	T	8.849	0.944057	0.18281	.	.	ENSG00000203797	ENST00000368924;ENST00000368923;ENST00000368925	T;T;T	0.56275	0.47;0.47;0.47	5.84	4.69	0.59074	.	0.520384	0.21773	N	0.069336	T	0.22044	0.0531	L	0.43701	1.375	0.09310	N	1	B;B	0.24368	0.098;0.102	B;B	0.27380	0.048;0.079	T	0.15037	-1.0451	10	0.17369	T	0.5	-8.7248	9.4042	0.38451	0.0:0.192:0.0:0.808	.	218;277	Q99489-4;Q99489-3	.;.	A	277;218;249	ENSP00000357920:E277A;ENSP00000357919:E218A;ENSP00000357921:E249A	ENSP00000357919:E218A	E	-	2	0	DDO	110820951	0.000000	0.05858	0.702000	0.30337	0.740000	0.42216	0.119000	0.15626	1.052000	0.40392	0.460000	0.39030	GAA	.		0.542	DDO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041796.1		
DNAJB9	4189	bcgsc.ca	37	7	108212353	108212353	+	Silent	SNP	G	G	A	rs1043615	byFrequency	TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr7:108212353G>A	ENST00000249356.3	+	2	729	c.183G>A	c.(181-183)ccG>ccA	p.P61P	THAP5_ENST00000493722.1_5'Flank|THAP5_ENST00000415914.3_5'Flank|THAP5_ENST00000438865.1_5'Flank|DNAJB9_ENST00000465725.1_3'UTR|THAP5_ENST00000313516.5_5'Flank	NM_012328.2	NP_036460.1	Q9UBS3	DNJB9_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 9	61	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)	misfolded protein binding (GO:0051787)			central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|urinary_tract(1)	13						ATAAGAGCCCGGATGCTGAAG	0.413													G|||	2396	0.478435	0.2648	0.5836	5008	,	,		15419	0.6369		0.497	False		,,,				2504	0.5102				p.P61P		.											.	DNAJB9-226	0			c.G183A						.	G		1313,3093	439.4+/-345.7	214,885,1104	75.0	82.0	80.0		183	-1.5	1.0	7	dbSNP_86	80	4526,4074	591.3+/-392.8	1181,2164,955	yes	coding-synonymous	DNAJB9	NM_012328.2		1395,3049,2059	AA,AG,GG		47.3721,29.8003,44.8947		61/224	108212353	5839,7167	2203	4300	6503	SO:0001819	synonymous_variant	4189	exon2			GAGCCCGGATGCT	AB026908	CCDS5752.1	7q31	2011-09-02			ENSG00000128590	ENSG00000128590		"""Heat shock proteins / DNAJ (HSP40)"""	6968	protein-coding gene	gene with protein product		602634		MDG1		9533036, 11147971	Standard	NM_012328		Approved		uc003vfn.3	Q9UBS3	OTTHUMG00000154866	ENST00000249356.3:c.183G>A	7.37:g.108212353G>A		Somatic	139	1		WXS	Illumina GAIIx	Phase_I	127	5	NM_012328	0	0	11	11	0		Silent	SNP	ENST00000249356.3	37	CCDS5752.1																																																																																			G|0.543;A|0.457		0.413	DNAJB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337414.1		
RBM28	55131	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	127954955	127954955	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr7:127954955G>A	ENST00000223073.2	-	17	2021	c.1907C>T	c.(1906-1908)cCa>cTa	p.P636L	RBM28_ENST00000481788.1_5'UTR|RBM28_ENST00000415472.2_Missense_Mutation_p.P495L	NM_018077.2	NP_060547.2	Q9NW13	RBM28_HUMAN	RNA binding motif protein 28	636					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleolus (GO:0005730)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|kidney(7)|large_intestine(3)|lung(8)|ovary(2)	21						CTTCTGCTCTGGGGGCACCTT	0.562																																					p.P636L		.											.	RBM28-92	0			c.C1907T						.						193.0	185.0	188.0					7																	127954955		2203	4300	6503	SO:0001583	missense	55131	exon17			TGCTCTGGGGGCA	AK001239	CCDS5801.1, CCDS55159.1	7q32.2	2013-02-12			ENSG00000106344	ENSG00000106344		"""RNA binding motif (RRM) containing"""	21863	protein-coding gene	gene with protein product		612074					Standard	NM_018077		Approved	FLJ10377	uc003vmp.2	Q9NW13	OTTHUMG00000157711	ENST00000223073.2:c.1907C>T	7.37:g.127954955G>A	ENSP00000223073:p.Pro636Leu	Somatic	153	0		WXS	Illumina GAIIx	Phase_I	178	63	NM_018077	0	0	10	15	5	A4D100|B4DU52|E9PDD9|Q53H65|Q96CV3	Missense_Mutation	SNP	ENST00000223073.2	37	CCDS5801.1	.	.	.	.	.	.	.	.	.	.	G	10.33	1.321431	0.23994	.	.	ENSG00000106344	ENST00000223073;ENST00000415472	T;T	0.20069	3.0;2.1	6.17	-3.52	0.04682	.	1.166910	0.06045	N	0.655546	T	0.09291	0.0229	N	0.12182	0.205	0.09310	N	1	B;B;B	0.06786	0.001;0.0;0.001	B;B;B	0.06405	0.002;0.0;0.002	T	0.31558	-0.9939	10	0.25106	T	0.35	4.0142	3.1349	0.06436	0.1623:0.1886:0.4668:0.1822	.	495;636;495	E9PDD9;Q9NW13;B4DU52	.;RBM28_HUMAN;.	L	636;495	ENSP00000223073:P636L;ENSP00000390517:P495L	ENSP00000223073:P636L	P	-	2	0	RBM28	127742191	0.000000	0.05858	0.000000	0.03702	0.288000	0.27193	-1.392000	0.02523	-0.703000	0.05049	0.655000	0.94253	CCA	.		0.562	RBM28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349442.2	NM_018077	
KCNH2	3757	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	150647026	150647026	+	Intron	SNP	C	C	G			TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr7:150647026C>G	ENST00000262186.5	-	9	2800				KCNH2_ENST00000330883.4_Intron|KCNH2_ENST00000392968.2_Intron|KCNH2_ENST00000430723.3_Missense_Mutation_p.R876S	NM_000238.3	NP_000229.1	Q12809	KCNH2_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 2						cardiac muscle contraction (GO:0060048)|cellular response to drug (GO:0035690)|membrane depolarization during action potential (GO:0086010)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of potassium ion export (GO:1902303)|negative regulation of potassium ion transmembrane transport (GO:1901380)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of heart rate by hormone (GO:0003064)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|identical protein binding (GO:0042802)|inward rectifier potassium channel activity (GO:0005242)|phosphorelay sensor kinase activity (GO:0000155)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)			NS(1)|cervix(1)|endometrium(10)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	42	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Alfuzosin(DB00346)|Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Cisapride(DB00604)|Dofetilide(DB00204)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Halofantrine(DB01218)|Ibutilide(DB00308)|Imipramine(DB00458)|Miconazole(DB01110)|Pimozide(DB01100)|Prazosin(DB00457)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terazosin(DB01162)|Thioridazine(DB00679)|Verapamil(DB00661)	TGTGGCGGATCCTGAAGGGAA	0.542																																					p.R876S	GBM(137;110 1844 13671 20123 45161)	.											.	KCNH2-94	0			c.G2628C						.						26.0	37.0	34.0					7																	150647026		1118	2193	3311	SO:0001627	intron_variant	3757	exon9			GCGGATCCTGAAG	U04270	CCDS5910.1, CCDS5911.1	7q36.1	2014-09-17			ENSG00000055118	ENSG00000055118		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6251	protein-coding gene	gene with protein product		152427		LQT2		18616963, 7842012, 8159766, 16382104	Standard	NM_000238		Approved	Kv11.1, HERG, erg1	uc003wic.3	Q12809	OTTHUMG00000158341	ENST00000262186.5:c.2398+229G>C	7.37:g.150647026C>G		Somatic	152	0		WXS	Illumina GAIIx	Phase_I	107	34	NM_172056	0	0	9	23	14	A5H1P7|C4PFH9|D3DX04|O75418|O75680|Q708S9|Q9BT72|Q9BUT7|Q9H3P0	Missense_Mutation	SNP	ENST00000262186.5	37	CCDS5910.1	.	.	.	.	.	.	.	.	.	.	C	15.32	2.799387	0.50208	.	.	ENSG00000055118	ENST00000430723	D	0.99214	-5.57	2.83	1.9	0.25705	.	.	.	.	.	D	0.95739	0.8614	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	D	0.93211	0.6600	9	0.72032	D	0.01	.	6.9067	0.24313	0.2741:0.7259:0.0:0.0	.	876;536	G5E9I0;Q708S9	.;.	S	876	ENSP00000387657:R876S	ENSP00000387657:R876S	R	-	3	2	KCNH2	150277959	0.000000	0.05858	0.056000	0.19401	0.461000	0.32589	0.256000	0.18351	0.727000	0.32360	0.462000	0.41574	AGG	.		0.542	KCNH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350741.2	NM_000238	
GPR124	25960	broad.mit.edu	37	8	37697097	37697097	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr8:37697097C>T	ENST00000412232.2	+	16	2481	c.2468C>T	c.(2467-2469)gCg>gTg	p.A823V	GPR124_ENST00000315215.7_Missense_Mutation_p.A606V	NM_032777.9	NP_116166.9	Q96PE1	GP124_HUMAN	G protein-coupled receptor 124	823					central nervous system development (GO:0007417)|endothelial cell migration (GO:0043542)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuropeptide signaling pathway (GO:0007218)|positive regulation of endothelial cell migration (GO:0010595)|regulation of angiogenesis (GO:0045765)|regulation of chemotaxis (GO:0050920)|regulation of establishment of blood-brain barrier (GO:0090210)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(16)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			GCTGTCTTTGCGGGGGGCATC	0.597																																					p.A823V		.											.	GPR124-157	0			c.C2468T						.						82.0	70.0	74.0					8																	37697097		2203	4300	6503	SO:0001583	missense	25960	exon16			TCTTTGCGGGGGG	AB040964	CCDS6097.2	8p11.22	2014-08-08			ENSG00000020181	ENSG00000020181		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17849	protein-coding gene	gene with protein product	"""tumor endothelial marker 5"""	606823				11559528, 12565841	Standard	NM_032777		Approved	TEM5, DKFZp434C211, DKFZp434J0911, KIAA1531, FLJ14390	uc003xkj.3	Q96PE1	OTTHUMG00000156182	ENST00000412232.2:c.2468C>T	8.37:g.37697097C>T	ENSP00000406367:p.Ala823Val	Somatic	109	0		WXS	Illumina GAIIx	Phase_I	160	6	NM_032777	0	0	0	0	0	A6H8W3|D3DSW4|Q8N3R1|Q8TEM3|Q96KB2|Q9P1Z7|Q9UFY4	Missense_Mutation	SNP	ENST00000412232.2	37	CCDS6097.2	.	.	.	.	.	.	.	.	.	.	C	9.846	1.192372	0.21954	.	.	ENSG00000020181	ENST00000416514;ENST00000315215;ENST00000412232	T;T	0.34859	1.34;1.34	4.73	2.9	0.33743	GPCR, family 2-like (1);	0.117834	0.56097	N	0.000025	T	0.18676	0.0448	L	0.36672	1.1	0.53688	D	0.999972	P;B	0.44090	0.826;0.343	B;B	0.32393	0.142;0.145	T	0.12400	-1.0549	10	0.06494	T	0.89	-15.8472	10.0349	0.42122	0.0:0.8341:0.0:0.1659	.	606;823	Q96PE1-2;Q96PE1	.;GP124_HUMAN	V	816;606;823	ENSP00000323508:A606V;ENSP00000406367:A823V	ENSP00000323508:A606V	A	+	2	0	GPR124	37816255	0.998000	0.40836	0.677000	0.29947	0.144000	0.21451	3.918000	0.56432	0.579000	0.29504	0.655000	0.94253	GCG	.		0.597	GPR124-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343331.2		
MEGF9	1955	bcgsc.ca	37	9	123421744	123421744	+	Silent	SNP	G	G	T			TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr9:123421744G>T	ENST00000373930.3	-	2	822	c.711C>A	c.(709-711)acC>acA	p.T237T	MEGF9_ENST00000426959.1_Silent_p.T274T	NM_001080497.2	NP_001073966.2	Q9H1U4	MEGF9_HUMAN	multiple EGF-like-domains 9	237	Laminin EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00460}.					integral component of membrane (GO:0016021)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(9)|upper_aerodigestive_tract(1)	16						CCTCTTTGCAGGTTTCACAGT	0.512																																					p.T237T		.											.	.	0			c.C711A						.						62.0	62.0	62.0					9																	123421744		1907	4128	6035	SO:0001819	synonymous_variant	1955	exon2			TTTGCAGGTTTCA	AB011542	CCDS48010.1, CCDS48010.2	9q32-q33.3	2008-07-21	2006-03-31	2006-03-31	ENSG00000106780	ENSG00000106780			3234	protein-coding gene	gene with protein product		604268	"""EGF-like-domain, multiple 5"""	EGFL5		9693030	Standard	NM_001080497		Approved		uc022bms.1	Q9H1U4	OTTHUMG00000021039	ENST00000373930.3:c.711C>A	9.37:g.123421744G>T		Somatic	103	0		WXS	Illumina GAIIx	Phase_I	94	4	NM_001080497	0	0	1	1	0	B7Z315|O75098	Silent	SNP	ENST00000373930.3	37	CCDS48010.2																																																																																			.		0.512	MEGF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055513.1	NM_001080497	
NTMT1	28989	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	132395087	132395087	+	Silent	SNP	C	C	T			TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr9:132395087C>T	ENST00000372486.1	+	2	454	c.105C>T	c.(103-105)ggC>ggT	p.G35G	NTMT1_ENST00000372481.3_Silent_p.G35G|NTMT1_ENST00000372483.4_Silent_p.G35G|NTMT1_ENST00000372480.1_Silent_p.G35G|NTMT1_ENST00000459968.2_Silent_p.G35G|NTMT1_ENST00000482347.1_Intron|NTMT1_ENST00000486391.2_Intron			Q9BV86	NTM1A_HUMAN	N-terminal Xaa-Pro-Lys N-methyltransferase 1	35					chromosome segregation (GO:0007059)|N-terminal peptidyl-proline dimethylation (GO:0018016)|N-terminal peptidyl-serine dimethylation (GO:0035572)|N-terminal peptidyl-serine trimethylation (GO:0035573)|spindle organization (GO:0007051)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein methyltransferase activity (GO:0008276)										GGGGGTATGGCCACATCTCCA	0.557																																					p.G35G		.											.	.	0			c.C105T						.						168.0	142.0	150.0					9																	132395087		2203	4300	6503	SO:0001819	synonymous_variant	28989	exon2			GTATGGCCACATC	AF110776	CCDS35160.1, CCDS69682.1, CCDS75918.1	9q34.2	2012-11-05	2012-06-12	2012-06-12	ENSG00000148335	ENSG00000148335	2.1.1.n5		23373	protein-coding gene	gene with protein product		613560	"""chromosome 9 open reading frame 32"", ""methyltransferase like 11A"""	C9orf32, METTL11A		20481588	Standard	XM_005251939		Approved	AD-003, HOMT1A	uc004byd.1	Q9BV86	OTTHUMG00000020785	ENST00000372486.1:c.105C>T	9.37:g.132395087C>T		Somatic	178	0		WXS	Illumina GAIIx	Phase_I	175	71	NM_014064	0	0	65	99	34	A8K4J2|A8K8G7|Q5SZB9|Q9UI28	Silent	SNP	ENST00000372486.1	37	CCDS35160.1																																																																																			.		0.557	NTMT1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054589.1	NM_014064	
SNAPC4	6621	broad.mit.edu;bcgsc.ca	37	9	139272547	139272547	+	Silent	SNP	C	C	T	rs547438767	byFrequency	TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr9:139272547C>T	ENST00000298532.2	-	21	4100	c.3732G>A	c.(3730-3732)caG>caA	p.Q1244Q		NM_003086.2	NP_003077.2			small nuclear RNA activating complex, polypeptide 4, 190kDa											biliary_tract(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(3)|skin(2)|urinary_tract(1)	33		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.31e-06)|Epithelial(140;7.13e-06)		CAGGCCCAGGCTGGCGCAGGG	0.721																																					p.Q1244Q		.											.	SNAPC4-90	0			c.G3732A						.						5.0	5.0	5.0					9																	139272547		2017	4003	6020	SO:0001819	synonymous_variant	6621	exon21			CCCAGGCTGGCGC	AF032387	CCDS6998.1	9q34.3	2008-07-21	2002-08-29		ENSG00000165684	ENSG00000165684			11137	protein-coding gene	gene with protein product		602777	"""small nuclear RNA activating complex, polypeptide 4, 190kD"""			9418884	Standard	XM_005266096		Approved	SNAP190, PTFalpha, FLJ13451	uc004chh.3	Q5SXM2	OTTHUMG00000020929	ENST00000298532.2:c.3732G>A	9.37:g.139272547C>T		Somatic	36	0		WXS	Illumina GAIIx	Phase_I	19	5	NM_003086	0	0	6	9	3		Silent	SNP	ENST00000298532.2	37	CCDS6998.1																																																																																			.		0.721	SNAPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055071.1	NM_003086	
BEX5	340542	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	101409174	101409174	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chrX:101409174C>T	ENST00000543160.1	-	3	365	c.64G>A	c.(64-66)Gct>Act	p.A22T	BEX5_ENST00000484837.1_5'Flank|BEX5_ENST00000333643.3_Missense_Mutation_p.A22T	NM_001159560.1	NP_001153032.1	Q5H9J7	BEX5_HUMAN	brain expressed, X-linked 5	22						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	4						CCTCCTAAAGCGGGGGCTTCA	0.473																																					p.A22T		.											.	BEX5-86	0			c.G64A						.						90.0	89.0	89.0					X																	101409174		2203	4300	6503	SO:0001583	missense	340542	exon3			CTAAAGCGGGGGC	BC042818	CCDS35350.1	Xq22.1	2014-03-21	2008-11-04	2007-08-24	ENSG00000184515	ENSG00000184515			27990	protein-coding gene	gene with protein product		300693	"""NGFRAP1-like 1"", ""BEX family member 5"""	NGFRAP1L1		16221301	Standard	NM_001012978		Approved		uc004eir.3	Q5H9J7	OTTHUMG00000022049	ENST00000543160.1:c.64G>A	X.37:g.101409174C>T	ENSP00000446054:p.Ala22Thr	Somatic	52	0		WXS	Illumina GAIIx	Phase_I	31	27	NM_001012978	0	0	7	7	0	Q569J0|Q56A74	Missense_Mutation	SNP	ENST00000543160.1	37	CCDS35350.1	.	.	.	.	.	.	.	.	.	.	C	1.267	-0.614175	0.03690	.	.	ENSG00000184515	ENST00000543160;ENST00000333643	T;T	0.09817	2.94;2.94	4.0	0.202	0.15190	.	0.775846	0.10584	N	0.657610	T	0.03095	0.0091	N	0.02011	-0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.42155	-0.9468	10	0.32370	T	0.25	.	0.6749	0.00865	0.2342:0.1888:0.3832:0.1938	.	22	Q5H9J7	BEX5_HUMAN	T	22	ENSP00000446054:A22T;ENSP00000328030:A22T	ENSP00000328030:A22T	A	-	1	0	BEX5	101295830	0.001000	0.12720	0.002000	0.10522	0.013000	0.08279	0.018000	0.13422	-0.087000	0.12528	-2.707000	0.00135	GCT	.		0.473	BEX5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057607.1	XM_291335	
F8	2157	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	154157135	154157135	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chrX:154157135T>C	ENST00000360256.4	-	14	5130	c.4930A>G	c.(4930-4932)Acc>Gcc	p.T1644A		NM_000132.3	NP_000123.1	P00451	FA8_HUMAN	coagulation factor VIII, procoagulant component	1644	B.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	copper ion binding (GO:0005507)|oxidoreductase activity (GO:0016491)|serine-type endopeptidase activity (GO:0004252)	p.T1644S(2)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(27)|liver(1)|lung(47)|ovary(5)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(5)|urinary_tract(2)	120	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	TTTGCCCAGGTGACTTCTATT	0.428																																					p.T1644A		.											.	F8-182	2	Substitution - Missense(2)	lung(2)	c.A4930G						.						137.0	122.0	127.0					X																	154157135		2203	4300	6503	SO:0001583	missense	2157	exon14			CCCAGGTGACTTC	M90707	CCDS35457.1, CCDS44026.1	Xq28	2014-09-17	2008-07-29		ENSG00000185010	ENSG00000185010			3546	protein-coding gene	gene with protein product	"""Factor VIIIF8B"", ""hemophilia A"""	300841		F8C		6438528, 3935400	Standard	NM_000132		Approved	FVIII, DXS1253E, HEMA	uc004fmt.3	P00451	OTTHUMG00000022688	ENST00000360256.4:c.4930A>G	X.37:g.154157135T>C	ENSP00000353393:p.Thr1644Ala	Somatic	66	0		WXS	Illumina GAIIx	Phase_I	55	5	NM_000132	0	0	0	0	0	Q14286|Q5HY69	Missense_Mutation	SNP	ENST00000360256.4	37	CCDS35457.1	.	.	.	.	.	.	.	.	.	.	t	8.226	0.803603	0.16467	.	.	ENSG00000185010	ENST00000360256	D	0.99220	-5.58	5.22	-2.82	0.05787	.	1.329350	0.04612	N	0.400551	D	0.97306	0.9119	L	0.47716	1.5	0.09310	N	1	B	0.22346	0.068	B	0.14023	0.01	D	0.94239	0.7483	10	0.29301	T	0.29	0.4778	7.7142	0.28694	0.0:0.0949:0.5619:0.3433	.	1644	P00451	FA8_HUMAN	A	1644	ENSP00000353393:T1644A	ENSP00000353393:T1644A	T	-	1	0	F8	153810329	0.001000	0.12720	0.002000	0.10522	0.408000	0.30992	0.024000	0.13555	-0.117000	0.11872	0.438000	0.28831	ACC	.		0.428	F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058869.4		
CD7	924	broad.mit.edu	37	17	80274159	80274160	+	Frame_Shift_Ins	INS	-	-	T	rs569923406|rs200504177	byFrequency	TCGA-OR-A5J1-01A-11D-A29I-10	TCGA-OR-A5J1-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	352062e7-9b06-41cd-880c-38fe268c9bf3	1d288ab9-ab2d-4483-af84-f5d0f5837cda	g.chr17:80274159_80274160insT	ENST00000312648.3	-	3	629_630	c.523_524insA	c.(523-525)gcafs	p.A175fs	CD7_ENST00000578509.1_Frame_Shift_Ins_p.A75fs|CD7_ENST00000584284.1_Frame_Shift_Ins_p.A175fs|CD7_ENST00000583376.1_Frame_Shift_Ins_p.A75fs	NM_006137.6	NP_006128.1	P09564	CD7_HUMAN	CD7 molecule	175	4 X 9 AA tandem repeats, potential spacer function.				homeostasis of number of cells within a tissue (GO:0048873)|immune response (GO:0006955)|T cell activation (GO:0042110)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			endometrium(1)|large_intestine(1)|lung(3)|skin(2)|upper_aerodigestive_tract(1)	8	Breast(20;0.000675)|all_neural(118;0.0804)|Lung NSC(278;0.128)|all_lung(278;0.145)|Ovarian(332;0.249)		OV - Ovarian serous cystadenocarcinoma(97;0.00463)|BRCA - Breast invasive adenocarcinoma(99;0.0667)			GGCAGAGGCTGCTGGCGGGTCA	0.718													?|-|T|unsure	60	0.0119808	0.0008	0.0274	5008	,	,		11744	0.001		0.0338	False		,,,				2504	0.0051				p.A175fs	Pancreas(45;804 1068 19702 28207 28798)	.											.	CD7-90	0			c.524_525insA						.																																			SO:0001589	frameshift_variant	924	exon3			GAGGCTGCTGGCG	X06180	CCDS11807.1	17q25.2-q25.3	2013-01-11	2006-03-28			ENSG00000173762		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1695	protein-coding gene	gene with protein product	"""p41 protein"", ""T-cell antigen CD7"", ""T-cell leukemia antigen"""	186820	"""CD7 antigen (p41)"""			1695199, 3501369	Standard	NM_006137		Approved	GP40, LEU-9, TP41, Tp40	uc002kel.1	P09564		ENST00000312648.3:c.523_524insA	17.37:g.80274159_80274160insT	ENSP00000312027:p.Ala175fs	Somatic	57	0		WXS	Illumina GAIIx	Phase_I	26	8	NM_006137	0	0	0	0	0		Frame_Shift_Ins	INS	ENST00000312648.3	37	CCDS11807.1																																																																																			.		0.718	CD7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000442826.1	NM_006137	
