#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PTCHD2	57540	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	11561189	11561189	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr1:11561189G>A	ENST00000294484.6	+	2	278	c.140G>A	c.(139-141)cGg>cAg	p.R47Q	PTCHD2_ENST00000389575.3_Missense_Mutation_p.R47Q	NM_020780.1	NP_065831.1	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	47					cholesterol homeostasis (GO:0042632)|regulation of lipid transport (GO:0032368)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	hedgehog receptor activity (GO:0008158)	p.R264Q(1)		NS(3)|breast(2)|endometrium(9)|kidney(4)|large_intestine(5)|lung(34)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	76	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		TGTTGCTGGCGGCACTGGCCC	0.647																																					p.R47Q		.											.	PTCHD2-209	1	Substitution - Missense(1)	prostate(1)	c.G140A						.						35.0	42.0	40.0					1																	11561189		1898	4099	5997	SO:0001583	missense	57540	exon2			GCTGGCGGCACTG	AB037758	CCDS41247.1	1p36.22	2010-02-17			ENSG00000204624	ENSG00000204624			29251	protein-coding gene	gene with protein product		611251				15738394	Standard	NM_020780		Approved	KIAA1337, DISP3	uc001ash.4	Q9P2K9	OTTHUMG00000002074	ENST00000294484.6:c.140G>A	1.37:g.11561189G>A	ENSP00000294484:p.Arg47Gln	Somatic	51	0		WXS	Illumina GAIIx	Phase_I	64	57	NM_020780	0	0	0	2	2	Q5VTU9|Q9UJD6	Missense_Mutation	SNP	ENST00000294484.6	37	CCDS41247.1	.	.	.	.	.	.	.	.	.	.	G	9.218	1.032547	0.19590	.	.	ENSG00000204624	ENST00000294484;ENST00000389575	T;T	0.26373	1.74;1.74	5.5	3.65	0.41850	.	0.272238	0.23910	U	0.043342	T	0.12732	0.0309	N	0.19112	0.55	0.09310	N	1	P	0.41710	0.76	B	0.28011	0.085	T	0.09796	-1.0658	10	0.54805	T	0.06	-28.1166	9.8928	0.41300	0.1564:0.0:0.8436:0.0	.	47	Q9P2K9	PTHD2_HUMAN	Q	47	ENSP00000294484:R47Q;ENSP00000374226:R47Q	ENSP00000294484:R47Q	R	+	2	0	PTCHD2	11483776	0.612000	0.27000	0.277000	0.24703	0.085000	0.17905	2.015000	0.40961	0.707000	0.31934	-0.244000	0.11960	CGG	.		0.647	PTCHD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000005770.2	XM_052561	
MRPL37	51253	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	54678298	54678298	+	Silent	SNP	C	C	T			TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr1:54678298C>T	ENST00000360840.5	+	5	1034	c.957C>T	c.(955-957)ggC>ggT	p.G319G	MRPL37_ENST00000336230.6_Silent_p.G188G|MRPL37_ENST00000605337.1_Silent_p.G319G	NM_016491.3	NP_057575.2	Q9BZE1	RM37_HUMAN	mitochondrial ribosomal protein L37	319					translation (GO:0006412)	mitochondrial ribosome (GO:0005761)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			NS(1)|endometrium(3)|kidney(1)|large_intestine(6)|liver(2)|lung(4)|skin(2)	19						TTGCTTTTGGCAGTGCCCTGG	0.537																																					p.G319G		.											.	MRPL37-90	0			c.C957T						.						131.0	127.0	129.0					1																	54678298		2203	4300	6503	SO:0001819	synonymous_variant	51253	exon5			TTTTGGCAGTGCC	AB051344	CCDS589.1	1p32.1	2012-09-13			ENSG00000116221	ENSG00000116221		"""Mitochondrial ribosomal proteins / large subunits"""	14034	protein-coding gene	gene with protein product		611843				10600119	Standard	NM_016491		Approved	RPML2, MRP-L2	uc001cxa.4	Q9BZE1	OTTHUMG00000008118	ENST00000360840.5:c.957C>T	1.37:g.54678298C>T		Somatic	95	0		WXS	Illumina GAIIx	Phase_I	91	78	NM_016491	0	0	5	45	40	Q96Q67|Q9BWR1|Q9P0P3	Silent	SNP	ENST00000360840.5	37	CCDS589.1	.	.	.	.	.	.	.	.	.	.	C	10.81	1.456811	0.26161	.	.	ENSG00000116221	ENST00000398219	.	.	.	5.39	2.24	0.28232	.	.	.	.	.	T	0.52025	0.1709	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.41378	-0.9512	4	.	.	.	-9.2912	5.2338	0.15436	0.265:0.5418:0.1219:0.0713	.	.	.	.	V	104	.	.	A	+	2	0	MRPL37	54450886	0.995000	0.38212	0.926000	0.36857	0.974000	0.67602	0.408000	0.21065	0.604000	0.29930	-0.150000	0.13652	GCA	.		0.537	MRPL37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022224.1	NM_016491	
IGSF3	3321	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	117150771	117150771	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr1:117150771C>T	ENST00000369486.3	-	5	1780	c.1015G>A	c.(1015-1017)Gaa>Aaa	p.E339K	IGSF3_ENST00000318837.6_Missense_Mutation_p.E339K|IGSF3_ENST00000369483.1_Missense_Mutation_p.E339K	NM_001007237.1	NP_001007238.1	O75054	IGSF3_HUMAN	immunoglobulin superfamily, member 3	339	Ig-like C2-type 3.				lacrimal gland development (GO:0032808)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	62	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)		TGAGCAAATTCGCTGTTGAGG	0.567																																					p.E339K		.											.	IGSF3-92	0			c.G1015A						.						43.0	41.0	41.0					1																	117150771		2202	4300	6502	SO:0001583	missense	3321	exon5			CAAATTCGCTGTT	AF031174	CCDS30813.1, CCDS30814.1	1p13	2013-01-29			ENSG00000143061	ENSG00000143061		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5950	protein-coding gene	gene with protein product		603491				9790749	Standard	NM_001007237		Approved	V8, EWI-3, MGC117164	uc031pnr.1	O75054	OTTHUMG00000022751	ENST00000369486.3:c.1015G>A	1.37:g.117150771C>T	ENSP00000358498:p.Glu339Lys	Somatic	186	0		WXS	Illumina GAIIx	Phase_I	162	120	NM_001007237	0	0	0	3	3	A6NJZ6|A6NMC7	Missense_Mutation	SNP	ENST00000369486.3	37	CCDS30813.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.359704	0.82353	.	.	ENSG00000143061	ENST00000369486;ENST00000369483;ENST00000318837	T;T;T	0.02682	4.2;4.2;4.2	4.67	4.67	0.58626	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.145920	0.49305	D	0.000144	T	0.02970	0.0088	L	0.27053	0.805	0.46416	D	0.999037	P;P;D	0.53462	0.951;0.956;0.96	P;P;P	0.54431	0.638;0.565;0.752	T	0.60657	-0.7220	10	0.51188	T	0.08	-16.6011	15.4322	0.75108	0.0:1.0:0.0:0.0	.	339;339;339	O75054-2;O75054;A6NJZ6	.;IGSF3_HUMAN;.	K	339	ENSP00000358498:E339K;ENSP00000358495:E339K;ENSP00000321184:E339K	ENSP00000321184:E339K	E	-	1	0	IGSF3	116952294	1.000000	0.71417	0.308000	0.25141	0.956000	0.61745	5.049000	0.64244	2.571000	0.86741	0.557000	0.71058	GAA	.		0.567	IGSF3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000059040.1	NM_001542	
HRNR	388697	bcgsc.ca	37	1	152188999	152188999	+	Silent	SNP	G	G	A	rs149648668	byFrequency	TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr1:152188999G>A	ENST00000368801.2	-	3	5181	c.5106C>T	c.(5104-5106)caC>caT	p.H1702H	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	1702					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.H1702H(1)		autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTTGTCGGCCGTGGCCCGAAG	0.632																																					p.H1702H		.											.	HRNR-93	1	Substitution - coding silent(1)	upper_aerodigestive_tract(1)	c.C5106T						.	G		87,3097		0,87,1505	50.0	74.0	66.0		5106	-6.0	0.0	1	dbSNP_134	66	354,5964		0,354,2805	no	coding-synonymous	HRNR	NM_001009931.1		0,441,4310	AA,AG,GG		5.603,2.7324,4.6411		1702/2851	152188999	441,9061	1592	3159	4751	SO:0001819	synonymous_variant	388697	exon3			TCGGCCGTGGCCC	AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.5106C>T	1.37:g.152188999G>A		Somatic	402	24		WXS	Illumina GAIIx	Phase_I	231	66	NM_001009931	0	0	0	0	0	Q5DT20|Q5U1F4	Silent	SNP	ENST00000368801.2	37	CCDS30859.1																																																																																			G|0.947;A|0.053		0.632	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034016.1	XM_373868	
HRNR	388697	bcgsc.ca	37	1	152189038	152189038	+	Silent	SNP	A	A	G	rs145118416	byFrequency	TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr1:152189038A>G	ENST00000368801.2	-	3	5142	c.5067T>C	c.(5065-5067)taT>taC	p.Y1689Y	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	1689					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CATGCTGACCATAGCGGGAAG	0.617																																					p.Y1689Y		.											.	HRNR-93	0			c.T5067C						.	A		321,2979		2,317,1331	67.0	73.0	71.0		5067	-0.7	0.0	1	dbSNP_134	71	363,6063		1,361,2851	no	coding-synonymous	HRNR	NM_001009931.1		3,678,4182	GG,GA,AA		5.6489,9.7273,7.0327		1689/2851	152189038	684,9042	1650	3213	4863	SO:0001819	synonymous_variant	388697	exon3			CTGACCATAGCGG	AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.5067T>C	1.37:g.152189038A>G		Somatic	272	15		WXS	Illumina GAIIx	Phase_I	157	53	NM_001009931	0	0	0	0	0	Q5DT20|Q5U1F4	Silent	SNP	ENST00000368801.2	37	CCDS30859.1																																																																																			A|0.968;G|0.032		0.617	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034016.1	XM_373868	
CD1A	909	broad.mit.edu	37	1	158224501	158224501	+	Silent	SNP	T	T	G			TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr1:158224501T>G	ENST00000289429.5	+	1	575	c.42T>G	c.(40-42)ggT>ggG	p.G14G		NM_001763.2	NP_001754.2	P06126	CD1A_HUMAN	CD1a molecule	14					antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)				NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(14)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(1)	32	all_hematologic(112;0.0378)				Antithymocyte globulin(DB00098)	TTCTCCCAGGTGATGGCAATG	0.448																																					p.G14G		.											.	CD1A-93	0			c.T42G						.						202.0	174.0	183.0					1																	158224501		2203	4300	6503	SO:0001819	synonymous_variant	909	exon1			CCCAGGTGATGGC	M28825	CCDS1174.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158477	ENSG00000158477		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1634	protein-coding gene	gene with protein product		188370	"""CD1A antigen, a polypeptide"", ""CD1a antigen"""	CD1		2447586, 2784820	Standard	NM_001763		Approved		uc001frt.3	P06126	OTTHUMG00000017512	ENST00000289429.5:c.42T>G	1.37:g.158224501T>G		Somatic	124	3		WXS	Illumina GAIIx	Phase_I	155	5	NM_001763	0	0	0	0	0	D3DVD7|Q13962|Q5TDJ8|Q9UMM4|Q9Y5M5	Silent	SNP	ENST00000289429.5	37	CCDS1174.1																																																																																			.		0.448	CD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046349.2	NM_001763	
CR1	1378	broad.mit.edu	37	1	207787753	207787753	+	Nonsense_Mutation	SNP	C	C	T	rs55749440		TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr1:207787753C>T	ENST00000367049.4	+	40	6580	c.6580C>T	c.(6580-6582)Cga>Tga	p.R2194*	CR1_ENST00000367053.1_Nonsense_Mutation_p.R1744*|CR1_ENST00000367051.1_Nonsense_Mutation_p.R1744*|CR1_ENST00000400960.2_Nonsense_Mutation_p.R1744*|CR1_ENST00000367052.1_Nonsense_Mutation_p.R1744*	NM_000651.4	NP_000642.3	P17927	CR1_HUMAN	complement component (3b/4b) receptor 1 (Knops blood group)	1744					complement activation, classical pathway (GO:0006958)|complement receptor mediated signaling pathway (GO:0002430)|innate immune response (GO:0045087)|negative regulation of complement activation, alternative pathway (GO:0045957)|negative regulation of complement activation, classical pathway (GO:0045959)|negative regulation of serine-type endopeptidase activity (GO:1900004)|positive regulation of serine-type endopeptidase activity (GO:1900005)|regulation of complement activation (GO:0030449)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	complement component C3b binding (GO:0001851)|complement component C3b receptor activity (GO:0004877)|complement component C4b binding (GO:0001855)|complement component C4b receptor activity (GO:0001861)	p.R1749*(9)|p.R2194*(9)|p.R1744*(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(9)|kidney(11)|large_intestine(13)|lung(33)|ovary(3)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						CTTTAGGTTCCGATTAAAAGG	0.423																																					p.R2194X		.											.	CR1-93	19	Substitution - Nonsense(19)	lung(6)|endometrium(6)|prostate(3)|kidney(2)|central_nervous_system(2)	c.C6580T						.						103.0	94.0	97.0					1																	207787753		1868	4107	5975	SO:0001587	stop_gained	1378	exon40			AGGTTCCGATTAA	Y00816	CCDS44308.1, CCDS44309.1	1q32	2014-07-19	2006-01-12		ENSG00000203710	ENSG00000203710		"""CD molecules"", ""Blood group antigens"", ""Complement system"""	2334	protein-coding gene	gene with protein product		120620	"""complement component (3b/4b) receptor 1, including Knops blood group system"""			1708809	Standard	XM_005273064		Approved	CD35, KN	uc001hfx.3	P17927	OTTHUMG00000036311	ENST00000367049.4:c.6580C>T	1.37:g.207787753C>T	ENSP00000356016:p.Arg2194*	Somatic	167	0		WXS	Illumina GAIIx	Phase_I	247	11	NM_000651	0	0	0	0	0	Q16744|Q16745|Q5SR43|Q5SR45|Q9UQV2	Nonsense_Mutation	SNP	ENST00000367049.4	37	CCDS44308.1	.	.	.	.	.	.	.	.	.	.	C	44	11.182593	0.99528	.	.	ENSG00000203710	ENST00000367052;ENST00000367051;ENST00000367053;ENST00000400960;ENST00000367049	.	.	.	4.29	2.39	0.29439	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.5152	0.27596	0.0:0.7891:0.0:0.2109	rs55749440	.	.	.	X	1744;1744;1744;1744;2194	.	ENSP00000356016:R2194X	R	+	1	2	CR1	205854376	0.129000	0.22400	0.370000	0.25965	0.352000	0.29268	0.213000	0.17521	0.518000	0.28383	0.436000	0.28706	CGA	.		0.423	CR1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382527.1	NM_000573	
NEK2	4751	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	211846871	211846871	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr1:211846871G>A	ENST00000366999.4	-	3	647	c.509C>T	c.(508-510)aCg>aTg	p.T170M	NEK2_ENST00000540251.1_Missense_Mutation_p.T127M|NEK2_ENST00000366998.3_Missense_Mutation_p.T170M|NEK2_ENST00000462283.1_5'Flank|RP11-122M14.1_ENST00000415202.1_RNA	NM_002497.3	NP_002488.1	P51955	NEK2_HUMAN	NIMA-related kinase 2	170	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				blastocyst development (GO:0001824)|centrosome separation (GO:0051299)|chromosome segregation (GO:0007059)|G2/M transition of mitotic cell cycle (GO:0000086)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of centriole-centriole cohesion (GO:1903126)|negative regulation of DNA binding (GO:0043392)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of mitosis (GO:0007088)|regulation of mitotic centrosome separation (GO:0046602)|spindle assembly (GO:0051225)|spindle assembly involved in mitosis (GO:0090307)	centrosome (GO:0005813)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|kinetochore (GO:0000776)|microtubule (GO:0005874)|midbody (GO:0030496)|nucleus (GO:0005634)|protein complex (GO:0043234)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|stomach(1)	3				OV - Ovarian serous cystadenocarcinoma(81;0.00203)|all cancers(67;0.0339)|Epithelial(68;0.0546)		TGCAAAACTCGTGTCATGGTT	0.363																																					p.T170M		.											.	NEK2-765	0			c.C509T						.						82.0	84.0	83.0					1																	211846871		2203	4300	6503	SO:0001583	missense	4751	exon3			AAACTCGTGTCAT	U11050	CCDS1500.1, CCDS55682.1, CCDS73024.1	1q32.3	2014-06-12	2012-11-15		ENSG00000117650	ENSG00000117650			7745	protein-coding gene	gene with protein product	"""HsPK 21"", ""protein phosphatase 1, regulatory subunit 111"""	604043	"""NIMA (never in mitosis gene a)-related kinase 2"""			8274451, 24043777	Standard	NM_002497		Approved	NLK1, NEK2A, RP67, PPP1R111	uc001hir.2	P51955	OTTHUMG00000037121	ENST00000366999.4:c.509C>T	1.37:g.211846871G>A	ENSP00000355966:p.Thr170Met	Somatic	154	0		WXS	Illumina GAIIx	Phase_I	205	43	NM_001204183	0	0	0	0	0	Q53FD6|Q5I1Z9|Q5VXZ1|Q6NZX8|Q7Z634|Q86XH2|Q96QN9	Missense_Mutation	SNP	ENST00000366999.4	37	CCDS1500.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.306947	0.81247	.	.	ENSG00000117650	ENST00000366999;ENST00000540251;ENST00000366998	T;T;T	0.66099	-0.19;-0.19;-0.19	5.23	5.23	0.72850	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.047778	0.85682	D	0.000000	T	0.66327	0.2778	N	0.21282	0.65	0.80722	D	1	D;D;D	0.64830	0.993;0.994;0.987	D;D;P	0.64237	0.911;0.923;0.873	T	0.62105	-0.6924	10	0.23302	T	0.38	.	19.1585	0.93522	0.0:0.0:1.0:0.0	.	170;170;170	P51955-2;P51955;P51955-4	.;NEK2_HUMAN;.	M	170;127;170	ENSP00000355966:T170M;ENSP00000440237:T127M;ENSP00000355965:T170M	ENSP00000355965:T170M	T	-	2	0	NEK2	209913494	1.000000	0.71417	0.829000	0.32907	0.797000	0.45037	7.552000	0.82192	2.591000	0.87537	0.563000	0.77884	ACG	.		0.363	NEK2-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090154.1	NM_002497	
IBA57	200205	broad.mit.edu	37	1	228362441	228362441	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr1:228362441C>A	ENST00000366711.3	+	2	392	c.390C>A	c.(388-390)agC>agA	p.S130R	IBA57_ENST00000546123.1_5'UTR|IBA57_ENST00000484749.1_3'UTR	NM_001010867.2	NP_001010867.1	Q5T440	CAF17_HUMAN	IBA57, iron-sulfur cluster assembly homolog (S. cerevisiae)	130					glycine catabolic process (GO:0006546)|heme biosynthetic process (GO:0006783)	mitochondrion (GO:0005739)	aminomethyltransferase activity (GO:0004047)|poly(A) RNA binding (GO:0044822)	p.S130R(2)		central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(7)|prostate(1)	11						AGTGTGACAGCTCGGTGCAGG	0.662																																					p.S130R		.											.	IBA57-90	2	Substitution - Missense(2)	prostate(1)|central_nervous_system(1)	c.C390A						.						24.0	24.0	24.0					1																	228362441		2199	4296	6495	SO:0001583	missense	200205	exon2			TGACAGCTCGGTG	AK022796	CCDS31046.1	1q42.13	2011-03-11	2011-03-11	2011-03-11	ENSG00000181873	ENSG00000181873			27302	protein-coding gene	gene with protein product	"""iron-sulfur cluster assembly factor for biotin synthase- and aconitase-like mitochondrial proteins, with a mass of 57kDa"""	615316	"""chromosome 1 open reading frame 69"""	C1orf69			Standard	NM_001010867		Approved	FLJ12734	uc001hsl.4	Q5T440	OTTHUMG00000039769	ENST00000366711.3:c.390C>A	1.37:g.228362441C>A	ENSP00000355672:p.Ser130Arg	Somatic	18	1		WXS	Illumina GAIIx	Phase_I	80	13	NM_001010867	0	0	5	5	0		Missense_Mutation	SNP	ENST00000366711.3	37	CCDS31046.1	.	.	.	.	.	.	.	.	.	.	C	7.793	0.711906	0.15306	.	.	ENSG00000181873	ENST00000366711	T	0.75154	-0.91	4.65	0.706	0.18133	Glycine cleavage T-protein, N-terminal (1);	0.591122	0.18565	N	0.137486	T	0.57651	0.2068	N	0.25647	0.755	0.20307	N	0.999915	B	0.12013	0.005	B	0.20384	0.029	T	0.42582	-0.9443	10	0.28530	T	0.3	-8.2527	8.9387	0.35715	0.0:0.6235:0.0:0.3765	.	130	Q5T440	CAF17_HUMAN	R	130	ENSP00000355672:S130R	ENSP00000355672:S130R	S	+	3	2	IBA57	226429064	0.000000	0.05858	0.001000	0.08648	0.127000	0.20565	-0.053000	0.11846	-0.022000	0.13986	0.655000	0.94253	AGC	.		0.662	IBA57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095980.1	NM_001010867	
NFKB2	4791	hgsc.bcm.edu	37	10	104159196	104159196	+	Silent	SNP	A	A	G	rs4919633	byFrequency	TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr10:104159196A>G	ENST00000369966.3	+	13	1519	c.1269A>G	c.(1267-1269)ccA>ccG	p.P423P	NFKB2_ENST00000189444.6_Silent_p.P423P|NFKB2_ENST00000336486.5_3'UTR|NFKB2_ENST00000428099.1_Silent_p.P423P	NM_001077494.2	NP_001070962.1	Q00653	NFKB2_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)	423					extracellular matrix organization (GO:0030198)|follicular dendritic cell differentiation (GO:0002268)|germinal center formation (GO:0002467)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|spleen development (GO:0048536)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	Bcl3/NF-kappaB2 complex (GO:0033257)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(10)|skin(2)	23		Colorectal(252;0.00957)		Epithelial(162;3.4e-08)|all cancers(201;6.41e-07)	Acetylsalicylic acid(DB00945)|Glucosamine(DB01296)	CCGCGGAGCCAAGCGCCCCCT	0.786			T	IGH@	B-NHL								G|||	4942	0.986821	0.9539	0.9942	5008	,	,		10589	1.0		0.999	False		,,,				2504	1.0				p.P423P		.		Dom	yes		10	10q24	4791	nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)		L	.	NFKB2-522	0			c.A1269G						.	G	,,	2876,76		1401,74,1	3.0	5.0	4.0		1269,1269,1269	-4.9	0.0	10	dbSNP_111	4	6622,2		3310,2,0	no	coding-synonymous,coding-synonymous,coding-synonymous	NFKB2	NM_001077493.1,NM_001077494.1,NM_002502.3	,,	4711,76,1	GG,GA,AA		0.0302,2.5745,0.8145	,,	423/900,423/901,423/900	104159196	9498,78	1476	3312	4788	SO:0001819	synonymous_variant	4791	exon13			GGAGCCAAGCGCC	X61498	CCDS41564.1, CCDS41565.1	10q24	2013-01-10			ENSG00000077150	ENSG00000077150		"""Ankyrin repeat domain containing"""	7795	protein-coding gene	gene with protein product		164012				1876189	Standard	XM_005269860		Approved	LYT-10, p52, p105, NF-kB2	uc001kvb.4	Q00653	OTTHUMG00000018962	ENST00000369966.3:c.1269A>G	10.37:g.104159196A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	14	14	NM_001077494	0	0	0	23	23	A8K9D9|D3DR83|Q04860|Q9BU75|Q9H471|Q9H472	Silent	SNP	ENST00000369966.3	37	CCDS41564.1																																																																																			A|0.009;G|0.991		0.786	NFKB2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050080.2		
TAF5	6877	hgsc.bcm.edu	37	10	105128134	105128134	+	Missense_Mutation	SNP	T	T	G	rs10883859	byFrequency	TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr10:105128134T>G	ENST00000369839.3	+	1	411	c.388T>G	c.(388-390)Tcc>Gcc	p.S130A	TAF5_ENST00000351396.4_Missense_Mutation_p.S130A	NM_006951.3	NP_008882.2	Q15542	TAF5_HUMAN	TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 100kDa	130			S -> A (in dbSNP:rs10883859). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:8758937, ECO:0000269|PubMed:9045704, ECO:0000269|Ref.5}.		chromatin modification (GO:0016568)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	protein dimerization activity (GO:0046983)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)	15		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;1.83e-09)|all cancers(201;1.4e-08)|BRCA - Breast invasive adenocarcinoma(275;0.198)		AGTGGCGGGCTCCGGAGCCCC	0.741													T|||	1553	0.310104	0.1952	0.4078	5008	,	,		9029	0.4206		0.329	False		,,,				2504	0.2628				p.S130A		.											.	TAF5-92	0			c.T388G						.	T	ALA/SER	635,2955		63,509,1223	3.0	5.0	4.0		388	1.9	1.0	10	dbSNP_120	4	2122,5176		327,1468,1854	no	missense	TAF5	NM_006951.3	99	390,1977,3077	GG,GT,TT		29.0765,17.688,25.3215	benign	130/801	105128134	2757,8131	1795	3649	5444	SO:0001583	missense	6877	exon1			GCGGGCTCCGGAG	X95525	CCDS7547.1	10q24-q25.2	2013-01-10	2002-08-29	2001-12-07	ENSG00000148835	ENSG00000148835		"""WD repeat domain containing"""	11539	protein-coding gene	gene with protein product		601787	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, D, 100kD"""	TAF2D		8884287, 8942982	Standard	NM_006951		Approved	TAFII100	uc001kwv.3	Q15542	OTTHUMG00000018985	ENST00000369839.3:c.388T>G	10.37:g.105128134T>G	ENSP00000358854:p.Ser130Ala	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	24	8	NM_006951	0	0	0	0	0	A8K5B4|B2RMR0|B7ZKJ6|Q53EM4|Q5SYD5|Q86UZ7|Q9Y4K5	Missense_Mutation	SNP	ENST00000369839.3	37	CCDS7547.1	821	0.3759157509157509	127	0.258130081300813	150	0.4143646408839779	277	0.48426573426573427	267	0.35224274406332456	T	12.78	2.040311	0.35989	0.17688	0.290765	ENSG00000148835	ENST00000369839;ENST00000351396	T;T	0.55930	0.73;0.49	4.45	1.88	0.25563	.	0.435426	0.24978	N	0.034100	T	0.00012	0.0000	N	0.04508	-0.205	0.41867	P	0.009742999999999946	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.46373	-0.9196	9	0.09338	T	0.73	-0.0936	6.2404	0.20787	0.1492:0.0:0.2595:0.5913	rs10883859	130;130	Q15542-2;Q15542	.;TAF5_HUMAN	A	130	ENSP00000358854:S130A;ENSP00000311024:S130A	ENSP00000311024:S130A	S	+	1	0	TAF5	105118124	0.988000	0.35896	1.000000	0.80357	0.948000	0.59901	0.932000	0.28884	0.814000	0.34374	0.459000	0.35465	TCC	T|0.623;G|0.377		0.741	TAF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050144.1		
GFRA1	2674	broad.mit.edu;bcgsc.ca	37	10	117884831	117884831	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr10:117884831C>T	ENST00000355422.6	-	6	1221	c.671G>A	c.(670-672)cGg>cAg	p.R224Q	GFRA1_ENST00000369236.1_Missense_Mutation_p.R219Q|GFRA1_ENST00000439649.3_Missense_Mutation_p.R219Q|GFRA1_ENST00000544592.1_Missense_Mutation_p.R103Q	NM_005264.4	NP_005255.1	P56159	GFRA1_HUMAN	GDNF family receptor alpha 1	224					axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	glial cell-derived neurotrophic factor receptor activity (GO:0016167)|receptor binding (GO:0005102)			endometrium(2)|large_intestine(10)|liver(1)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)	26		Lung NSC(174;0.21)		all cancers(201;0.0337)		CTGTCGCCTCCGCTCTGTGCA	0.567																																					p.R224Q	Ovarian(128;329 1725 45498 46808 50759)	.											.	GFRA1-93	0			c.G671A						.						80.0	68.0	72.0					10																	117884831		2203	4300	6503	SO:0001583	missense	2674	exon6			CGCCTCCGCTCTG	AF038421	CCDS7593.1, CCDS44481.1	10q25-q26	2011-01-25			ENSG00000151892	ENSG00000151892			4243	protein-coding gene	gene with protein product		601496		GDNFRA		9465905, 9545641	Standard	NM_005264		Approved	RETL1, GDNFR, GFR-ALPHA-1, RET1L, TRNR1	uc001lcj.3	P56159	OTTHUMG00000019097	ENST00000355422.6:c.671G>A	10.37:g.117884831C>T	ENSP00000347591:p.Arg224Gln	Somatic	140	0		WXS	Illumina GAIIx	Phase_I	228	10	NM_005264	0	0	0	0	0	A8KA21|O15507|O43912	Missense_Mutation	SNP	ENST00000355422.6	37	CCDS44481.1	.	.	.	.	.	.	.	.	.	.	C	37	5.987554	0.97173	.	.	ENSG00000151892	ENST00000439649;ENST00000369236;ENST00000355422;ENST00000544592;ENST00000369234	T;T	0.63744	-0.06;-0.06	5.99	5.99	0.97316	GDNF/GAS1 (2);	0.109281	0.64402	D	0.000014	D	0.83229	0.5209	M	0.88906	2.99	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.71414	0.973;0.937	D	0.84106	0.0398	10	0.54805	T	0.06	-8.0016	20.4777	0.99188	0.0:1.0:0.0:0.0	.	224;219	P56159;P56159-2	GFRA1_HUMAN;.	Q	224;219;219;103;219	ENSP00000358239:R219Q;ENSP00000442179:R103Q	ENSP00000347591:R219Q	R	-	2	0	GFRA1	117874821	1.000000	0.71417	0.987000	0.45799	0.997000	0.91878	7.818000	0.86416	2.840000	0.97914	0.655000	0.94253	CGG	.		0.567	GFRA1-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050512.2	NM_145793	
MUC6	4588	bcgsc.ca	37	11	1016835	1016835	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr11:1016835A>G	ENST00000421673.2	-	31	6016	c.5966T>C	c.(5965-5967)tTc>tCc	p.F1989S		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1989	Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)	p.F1989Y(2)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGTGGTCTGGAAGGATGTTGC	0.567																																					p.F1989S		.											.	MUC6-23	2	Substitution - Missense(2)	lung(2)	c.T5966C						.						1541.0	1526.0	1531.0					11																	1016835		2203	4299	6502	SO:0001583	missense	4588	exon31			GTCTGGAAGGATG	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5966T>C	11.37:g.1016835A>G	ENSP00000406861:p.Phe1989Ser	Somatic	2602	38		WXS	Illumina GAIIx	Phase_I	2350	73	NM_005961	0	0	3	3	0	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	A	12.65	2.002866	0.35320	.	.	ENSG00000184956	ENST00000421673	T	0.18657	2.2	3.08	-0.788	0.10939	.	.	.	.	.	T	0.12390	0.0301	L	0.38531	1.155	0.09310	N	1	B	0.15930	0.015	B	0.14578	0.011	T	0.41106	-0.9527	9	0.07644	T	0.81	.	6.7728	0.23602	0.4725:0.0:0.5275:0.0	.	1989	Q6W4X9	MUC6_HUMAN	S	1989	ENSP00000406861:F1989S	ENSP00000406861:F1989S	F	-	2	0	MUC6	1006835	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-0.386000	0.07370	-0.019000	0.14055	0.254000	0.18369	TTC	.		0.567	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
MUC2	4583	broad.mit.edu	37	11	1092940	1092940	+	Missense_Mutation	SNP	A	A	T			TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr11:1092940A>T	ENST00000441003.2	+	30	4786	c.4759A>T	c.(4759-4761)Acc>Tcc	p.T1587S	MUC2_ENST00000359061.5_Missense_Mutation_p.T1588S|MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000361558.6_Intron	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	gacacccatcaccaccaccac	0.632																																					p.T1587S		.											.	MUC2-90	0			c.A4759T						.						62.0	99.0	86.0					11																	1092940		1889	3458	5347	SO:0001583	missense	4583	exon30			CCCATCACCACCA	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4759A>T	11.37:g.1092940A>T	ENSP00000415183:p.Thr1587Ser	Somatic	99	0		WXS	Illumina GAIIx	Phase_I	97	7	NM_002457	0	0	0	0	0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	A	3.953	-0.011850	0.07727	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.14391	2.51;3.14	1.75	-1.38	0.09027	.	0.548751	0.14783	N	0.298682	T	0.04952	0.0133	.	.	.	0.09310	N	1	B	0.10296	0.003	B	0.12156	0.007	T	0.41288	-0.9517	9	0.11182	T	0.66	.	2.851	0.05558	0.5312:0.0:0.274:0.1948	.	1587	E7EUV1	.	S	1587;1588	ENSP00000415183:T1587S;ENSP00000351956:T1588S	ENSP00000351956:T1588S	T	+	1	0	MUC2	1082940	0.000000	0.05858	0.000000	0.03702	0.110000	0.19582	-5.082000	0.00153	-0.456000	0.07043	-1.550000	0.00899	ACC	.		0.632	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MUC5B	727897	bcgsc.ca	37	11	1266716	1266716	+	Missense_Mutation	SNP	T	T	C	rs200243273	byFrequency	TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr11:1266716T>C	ENST00000529681.1	+	31	8664	c.8606T>C	c.(8605-8607)aTg>aCg	p.M2869T	MUC5B_ENST00000447027.1_Missense_Mutation_p.M2872T|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	2869	7 X Cys-rich subdomain repeats.|Thr-rich.			Missing (in Ref. 6; AAB61398). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GTGGTGACCATGGGCTGTGAG	0.657													-|||	1477	0.294928	0.2284	0.2752	5008	,	,		10473	0.4812		0.2266	False		,,,				2504	0.2771				p.M2869T		.											.	.	0			c.T8606C						.						43.0	51.0	49.0					11																	1266716		1683	3765	5448	SO:0001583	missense	727897	exon31			TGACCATGGGCTG	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.8606T>C	11.37:g.1266716T>C	ENSP00000436812:p.Met2869Thr	Somatic	136	0		WXS	Illumina GAIIx	Phase_I	92	36	NM_002458	0	0	0	0	0	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	-	1.479	-0.557829	0.03967	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.15718	2.4;2.59	1.67	-1.74	0.08056	.	.	.	.	.	T	0.05686	0.0149	N	0.02539	-0.55	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.29882	-0.9997	8	0.87932	D	0	.	3.4419	0.07466	0.1749:0.468:0.0:0.3571	rs2860626;rs2943499;rs2943524;rs3965637	3452;2872	A7Y9J9;E9PBJ0	.;.	T	2869;2872;2841;2829	ENSP00000436812:M2869T;ENSP00000415793:M2872T	ENSP00000343037:M2841T	M	+	2	0	MUC5B	1223292	0.003000	0.15002	0.000000	0.03702	0.007000	0.05969	0.117000	0.15583	-1.035000	0.03291	-0.471000	0.05019	ATG	C|1.000;|0.000		0.657	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
OR8H2	390151	broad.mit.edu	37	11	55872537	55872537	+	Missense_Mutation	SNP	A	A	G	rs61746549	byFrequency	TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr11:55872537A>G	ENST00000313503.1	+	1	19	c.19A>G	c.(19-21)Aac>Gac	p.N7D		NM_001005200.1	NP_001005200.1	Q8N162	OR8H2_HUMAN	olfactory receptor, family 8, subfamily H, member 2	7						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.N7D(1)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(38)|ovary(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	61	Esophageal squamous(21;0.00693)					TAGAAGGAATAACACAAATGT	0.438										HNSCC(53;0.14)			N|||	4	0.000798722	0.0008	0.0014	5008	,	,		18426	0.0		0.0	False		,,,				2504	0.002				p.N7D		.											.	OR8H2-70	1	Substitution - Missense(1)	kidney(1)	c.A19G						.						196.0	187.0	190.0					11																	55872537		2201	4296	6497	SO:0001583	missense	390151	exon1			AGGAATAACACAA	AB065657	CCDS31518.1	11q11	2012-08-09			ENSG00000181767	ENSG00000181767		"""GPCR / Class A : Olfactory receptors"""	15308	protein-coding gene	gene with protein product							Standard	NM_001005200		Approved		uc010riy.2	Q8N162	OTTHUMG00000166832	ENST00000313503.1:c.19A>G	11.37:g.55872537A>G	ENSP00000323982:p.Asn7Asp	Somatic	129	1		WXS	Illumina GAIIx	Phase_I	110	6	NM_001005200	0	0	0	0	0	Q6IFC1	Missense_Mutation	SNP	ENST00000313503.1	37	CCDS31518.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	N	7.027	0.559788	0.13436	.	.	ENSG00000181767	ENST00000313503	T	0.00509	6.91	3.74	-2.34	0.06704	.	1.169330	0.06223	N	0.687064	T	0.00300	0.0009	N	0.17723	0.515	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.41805	-0.9488	10	0.30854	T	0.27	.	0.2174	0.00164	0.3775:0.1477:0.1868:0.288	rs61746549	7	Q8N162	OR8H2_HUMAN	D	7	ENSP00000323982:N7D	ENSP00000323982:N7D	N	+	1	0	OR8H2	55629113	0.000000	0.05858	0.001000	0.08648	0.011000	0.07611	-1.679000	0.01940	-0.566000	0.06054	-1.639000	0.00775	AAC	A|0.999;G|0.001		0.438	OR8H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391540.1	NM_001005200	
GAL3ST3	89792	hgsc.bcm.edu	37	11	65810209	65810209	+	Silent	SNP	C	C	T	rs61895584	byFrequency	TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr11:65810209C>T	ENST00000312006.4	-	3	1346	c.1065G>A	c.(1063-1065)ccG>ccA	p.P355P	GAL3ST3_ENST00000527878.1_Silent_p.P355P	NM_033036.2	NP_149025.1	Q96A11	G3ST3_HUMAN	galactose-3-O-sulfotransferase 3	355					monosaccharide metabolic process (GO:0005996)|oligosaccharide metabolic process (GO:0009311)|poly-N-acetyllactosamine metabolic process (GO:0030309)|proteoglycan biosynthetic process (GO:0030166)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|carbohydrate binding (GO:0030246)|galactose 3-O-sulfotransferase activity (GO:0050694)|galactosylceramide sulfotransferase activity (GO:0001733)|proteoglycan sulfotransferase activity (GO:0050698)			kidney(1)|lung(9)|ovary(2)|skin(2)	14						TGGGCTGCCACGGCTGCAGCT	0.741													C|||	3763	0.751398	0.5408	0.8746	5008	,	,		7225	0.7649		0.8549	False		,,,				2504	0.8282				p.P355P		.											.	GAL3ST3-91	0			c.G1065A						.	C		1752,666		619,514,76	3.0	2.0	2.0		1065	-9.2	0.7	11	dbSNP_129	2	4565,363		2119,327,18	no	coding-synonymous	GAL3ST3	NM_033036.2		2738,841,94	TT,TC,CC		7.3661,27.5434,14.0076		355/432	65810209	6317,1029	1209	2464	3673	SO:0001819	synonymous_variant	89792	exon3			CTGCCACGGCTGC	AY026481	CCDS8128.1	11q13.1	2014-08-12			ENSG00000175229	ENSG00000175229		"""Sulfotransferases, membrane-bound"""	24144	protein-coding gene	gene with protein product		608234				11323440, 11356829	Standard	NM_033036		Approved	GAL3ST2	uc001ogw.3	Q96A11	OTTHUMG00000166667	ENST00000312006.4:c.1065G>A	11.37:g.65810209C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_033036	0	0	0	0	0	Q14D05	Silent	SNP	ENST00000312006.4	37	CCDS8128.1																																																																																			C|0.233;T|0.767		0.741	GAL3ST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391052.1	NM_033036	
KLC2	64837	broad.mit.edu	37	11	66033423	66033423	+	Silent	SNP	T	T	G			TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr11:66033423T>G	ENST00000417856.1	+	13	1785	c.1542T>G	c.(1540-1542)ggT>ggG	p.G514G	KLC2_ENST00000394066.2_Silent_p.G437G|KLC2_ENST00000394067.2_Silent_p.G514G|KLC2_ENST00000421552.1_Silent_p.G437G|RP11-867G23.2_ENST00000533287.1_RNA|KLC2_ENST00000394078.1_Intron|RAB1B_ENST00000527397.1_5'Flank|RAB1B_ENST00000311481.6_5'Flank|KLC2_ENST00000394065.2_Silent_p.G375G|KLC2_ENST00000316924.5_Silent_p.G514G|RP11-867G23.1_ENST00000530805.1_RNA	NM_001134775.1	NP_001128247.1	Q9H0B6	KLC2_HUMAN	kinesin light chain 2	514					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon cargo transport (GO:0008088)|blood coagulation (GO:0007596)|microtubule-based movement (GO:0007018)	ciliary rootlet (GO:0035253)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinesin I complex (GO:0016938)|membrane (GO:0016020)|microtubule (GO:0005874)|neuron projection (GO:0043005)|protein complex (GO:0043234)	kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)			breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|prostate(5)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	24						TGGCTGGGGGTGCCGGGCCTC	0.672																																					p.G514G		.											.	KLC2-90	0			c.T1542G						.						34.0	41.0	39.0					11																	66033423		2197	4290	6487	SO:0001819	synonymous_variant	64837	exon13			TGGGGGTGCCGGG	AK022449	CCDS8130.1, CCDS44653.1	11q13.1	2013-01-10			ENSG00000174996	ENSG00000174996		"""Tetratricopeptide (TTC) repeat domain containing"""	20716	protein-coding gene	gene with protein product		611729				9624122	Standard	NM_022822		Approved	FLJ12387	uc001ohb.2	Q9H0B6	OTTHUMG00000133757	ENST00000417856.1:c.1542T>G	11.37:g.66033423T>G		Somatic	143	11		WXS	Illumina GAIIx	Phase_I	127	24	NM_022822	0	0	43	44	1	A8MXL7|B2RDY4|Q9H9C8|Q9HA20	Silent	SNP	ENST00000417856.1	37	CCDS8130.1																																																																																			.		0.672	KLC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258200.1	NM_022822	
B3GNT6	192134	hgsc.bcm.edu	37	11	76751542	76751542	+	Frame_Shift_Del	DEL	T	T	-	rs11292198		TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr11:76751542delT	ENST00000533140.1	+	2	1085	c.947delT	c.(946-948)cttfs	p.L316fs	B3GNT6_ENST00000354301.5_Splice_Site_p.L316fs|B3GNT6_ENST00000421061.1_Intron			O43505	B3GN1_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (core 3 synthase)	0					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|poly-N-acetyllactosamine biosynthetic process (GO:0030311)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	N-acetyllactosaminide beta-1,3-N-acetylglucosaminyltransferase activity (GO:0008532)			central_nervous_system(1)|kidney(2)|lung(4)|prostate(1)	8						GGCATGTGTCTTGGAGCGCGC	0.741													T|TT|T|insertion	5008	1.0	1.0	1.0	5008	,	,		12582	1.0		1.0	False		,,,				2504	1.0				.		.											.	.	0			c.946+1T>-						.						1.0	1.0	1.0					11																	76751542		431	917	1348	SO:0001589	frameshift_variant	192134	exon2			TGTGTCTTGGAGC	AB073740	CCDS53681.1	11q13.4	2013-02-19			ENSG00000198488	ENSG00000198488		"""Beta 3-glycosyltransferases"""	24141	protein-coding gene	gene with protein product		615315				11821425	Standard	NM_138706		Approved	B3Gn-T6	uc021qnp.1	Q6ZMB0		ENST00000533140.1:c.947delT	11.37:g.76751542delT	ENSP00000435352:p.Leu316fs	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	12	12	NM_138706	0	0	0	0	0	Q4TTN0	Splice_Site	DEL	ENST00000533140.1	37	CCDS53681.1																																																																																			.		0.741	B3GNT6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000382740.2	NM_138706	
LRP6	4040	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	12301919	12301919	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr12:12301919C>T	ENST00000261349.4	-	14	3239	c.3163G>A	c.(3163-3165)Gag>Aag	p.E1055K	LRP6_ENST00000543091.1_Missense_Mutation_p.E1055K	NM_002336.2	NP_002327.2	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein 6	1055	Beta-propeller 4.				anterior/posterior pattern specification (GO:0009952)|axis elongation involved in somitogenesis (GO:0090245)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in cardiac neural crest cell differentiation involved in heart development (GO:0061310)|canonical Wnt signaling pathway involved in neural crest cell differentiation (GO:0044335)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in regulation of cell proliferation (GO:0044340)|cell migration involved in gastrulation (GO:0042074)|cellular response to cholesterol (GO:0071397)|cerebellum morphogenesis (GO:0021587)|cerebral cortex cell migration (GO:0021795)|cerebral cortex development (GO:0021987)|convergent extension (GO:0060026)|dopaminergic neuron differentiation (GO:0071542)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic pattern specification (GO:0009880)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|external genitalia morphogenesis (GO:0035261)|face morphogenesis (GO:0060325)|forebrain radial glial cell differentiation (GO:0021861)|formation of radial glial scaffolds (GO:0021943)|gastrulation with mouth forming second (GO:0001702)|heart looping (GO:0001947)|mammary placode formation (GO:0060596)|midbrain development (GO:0030901)|midbrain-hindbrain boundary development (GO:0030917)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of planar cell polarity pathway involved in cardiac muscle tissue morphogenesis (GO:2000151)|negative regulation of planar cell polarity pathway involved in cardiac right atrium morphogenesis (GO:2000162)|negative regulation of planar cell polarity pathway involved in neural tube closure (GO:2000168)|negative regulation of planar cell polarity pathway involved in outflow tract morphogenesis (GO:2000164)|negative regulation of planar cell polarity pathway involved in pericardium morphogenesis (GO:2000166)|negative regulation of planar cell polarity pathway involved in ventricular septum morphogenesis (GO:2000149)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of smooth muscle cell apoptotic process (GO:0034392)|neural crest cell differentiation (GO:0014033)|neural crest formation (GO:0014029)|neural tube closure (GO:0001843)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone resorption (GO:0045780)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell cycle (GO:0045787)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of ossification (GO:0045778)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway involved in dorsal/ventral axis specification (GO:2000055)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|receptor-mediated endocytosis of low-density lipoprotein particle involved in cholesterol transport (GO:0090118)|regulation of cell development (GO:0060284)|regulation of fat cell differentiation (GO:0045598)|regulation of ossification (GO:0030278)|response to folic acid (GO:0051593)|response to peptide hormone (GO:0043434)|single organismal cell-cell adhesion (GO:0016337)|synaptic transmission (GO:0007268)|thalamus development (GO:0021794)|toxin transport (GO:1901998)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)|Wnt signaling pathway involved in forebrain neuroblast division (GO:0021874)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	apolipoprotein binding (GO:0034185)|coreceptor activity involved in Wnt signaling pathway (GO:0071936)|frizzled binding (GO:0005109)|identical protein binding (GO:0042802)|kinase inhibitor activity (GO:0019210)|low-density lipoprotein receptor activity (GO:0005041)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|toxin transporter activity (GO:0019534)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.E1055*(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(28)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	85		Prostate(47;0.0865)				CTGTCCTGCTCGCCTTTCAGC	0.478																																					p.E1055K		.											.	LRP6-661	1	Substitution - Nonsense(1)	lung(1)	c.G3163A						.						224.0	204.0	211.0					12																	12301919		2203	4300	6503	SO:0001583	missense	4040	exon14			CCTGCTCGCCTTT	AF074264	CCDS8647.1	12p13.2	2013-05-29			ENSG00000070018	ENSG00000070018		"""Low density lipoprotein receptors"""	6698	protein-coding gene	gene with protein product		603507				9704021	Standard	NM_002336		Approved	ADCAD2	uc001rah.4	O75581	OTTHUMG00000168540	ENST00000261349.4:c.3163G>A	12.37:g.12301919C>T	ENSP00000261349:p.Glu1055Lys	Somatic	150	0		WXS	Illumina GAIIx	Phase_I	205	12	NM_002336	0	0	11	12	1	Q17RZ2	Missense_Mutation	SNP	ENST00000261349.4	37	CCDS8647.1	.	.	.	.	.	.	.	.	.	.	C	17.68	3.448274	0.63178	.	.	ENSG00000070018	ENST00000261349;ENST00000543091	D;D	0.91351	-2.83;-2.83	5.15	5.15	0.70609	Six-bladed beta-propeller, TolB-like (1);	0.345909	0.23631	U	0.046132	D	0.82287	0.5004	N	0.20685	0.6	0.80722	D	1	B;B	0.31680	0.335;0.004	B;B	0.12156	0.007;0.001	T	0.79780	-0.1659	10	0.16420	T	0.52	.	18.9829	0.92761	0.0:1.0:0.0:0.0	.	1055;1055	F5H7J9;O75581	.;LRP6_HUMAN	K	1055	ENSP00000261349:E1055K;ENSP00000442472:E1055K	ENSP00000261349:E1055K	E	-	1	0	LRP6	12193186	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.445000	0.80570	2.549000	0.85964	0.650000	0.86243	GAG	.		0.478	LRP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400137.1		
KIF5A	3798	broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	57957244	57957244	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr12:57957244G>A	ENST00000455537.2	+	2	426	c.152G>A	c.(151-153)cGt>cAt	p.R51H	KIF5A_ENST00000286452.5_Intron	NM_004984.2	NP_004975.2	Q12840	KIF5A_HUMAN	kinesin family member 5A	51	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|protein localization (GO:0008104)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|liver(1)|lung(32)|ovary(2)|prostate(2)|skin(2)	62						GTTTTTGACCGTGTATTCCCC	0.418																																					p.R51H		.											.	KIF5A-517	0			c.G152A						.						92.0	84.0	87.0					12																	57957244		2203	4300	6503	SO:0001583	missense	3798	exon2			TTGACCGTGTATT	U06698	CCDS8945.1	12q13.13	2011-07-15	2004-02-13			ENSG00000155980		"""Kinesins"""	6323	protein-coding gene	gene with protein product		602821	"""spastic paraplegia 10 (autosomal dominant)"""	SPG10		9858832, 10441583, 16489470	Standard	NM_004984		Approved	D12S1889, NKHC, MY050	uc001sor.1	Q12840	OTTHUMG00000170143	ENST00000455537.2:c.152G>A	12.37:g.57957244G>A	ENSP00000408979:p.Arg51His	Somatic	170	1		WXS	Illumina GAIIx	Phase_I	256	32	NM_004984	0	0	0	0	0	A6H8M5|Q4LE26	Missense_Mutation	SNP	ENST00000455537.2	37	CCDS8945.1	.	.	.	.	.	.	.	.	.	.	G	15.71	2.913099	0.52439	.	.	ENSG00000155980	ENST00000455537	T	0.75154	-0.91	4.59	4.59	0.56863	Kinesin, motor domain (4);	0.055168	0.64402	D	0.000001	T	0.66528	0.2798	L	0.37697	1.125	0.80722	D	1	B	0.33477	0.413	B	0.31337	0.128	T	0.68815	-0.5309	10	0.51188	T	0.08	.	17.3911	0.87431	0.0:0.0:1.0:0.0	.	51	Q12840	KIF5A_HUMAN	H	51	ENSP00000408979:R51H	ENSP00000408979:R51H	R	+	2	0	KIF5A	56243511	0.999000	0.42202	0.996000	0.52242	0.995000	0.86356	3.876000	0.56115	2.835000	0.97688	0.650000	0.86243	CGT	.		0.418	KIF5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407634.1	NM_004984	
RAB21	23011	ucsc.edu	37	12	72164383	72164383	+	Silent	SNP	T	T	G	rs201148269	byFrequency	TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr12:72164383T>G	ENST00000261263.3	+	3	487	c.231T>G	c.(229-231)ggT>ggG	p.G77G		NM_014999.2	NP_055814.1	Q9UL25	RAB21_HUMAN	RAB21, member RAS oncogene family	77					GTP catabolic process (GO:0006184)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			large_intestine(1)|lung(4)|prostate(1)	6						ATACGGCAGGTCAAGAGAGAT	0.338																																					p.G77G		.											.	RAB21-227	0			c.T231G						.						72.0	76.0	75.0					12																	72164383		2203	4299	6502	SO:0001819	synonymous_variant	23011	exon3			GGCAGGTCAAGAG	AF091035	CCDS9003.1	12q21.1	2014-09-04			ENSG00000080371	ENSG00000080371		"""RAB, member RAS oncogene"""	18263	protein-coding gene	gene with protein product		612398				10887961, 11697911, 16754960	Standard	NM_014999		Approved	KIAA0118	uc001swt.3	Q9UL25	OTTHUMG00000169572	ENST00000261263.3:c.231T>G	12.37:g.72164383T>G		Somatic	47	5		WXS	Illumina GAIIx	Phase_I	81	21	NM_014999	0	0	0	0	0	Q14466|Q569H3	Silent	SNP	ENST00000261263.3	37	CCDS9003.1																																																																																			T|0.962;G|0.038		0.338	RAB21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404855.1		
BBS10	79738	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	76741456	76741459	+	Frame_Shift_Del	DEL	TCTG	TCTG	-			TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	TCTG	TCTG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr12:76741456_76741459delTCTG	ENST00000393262.3	-	2	389_392	c.306_309delCAGA	c.(304-309)gacagafs	p.DR102fs		NM_024685.3	NP_078961.3	Q8TAM1	BBS10_HUMAN	Bardet-Biedl syndrome 10	102					cellular protein metabolic process (GO:0044267)|chaperone-mediated protein complex assembly (GO:0051131)|nonmotile primary cilium assembly (GO:0035058)|photoreceptor cell maintenance (GO:0045494)|regulation of protein complex assembly (GO:0043254)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|visual perception (GO:0007601)	cell projection (GO:0042995)	ATP binding (GO:0005524)|RNA polymerase II repressing transcription factor binding (GO:0001103)			endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(1)	19						GATCCTTTTCTCTGTCTGTGATTG	0.387									Bardet-Biedl syndrome																												p.102_103del		.											.	BBS10-92	0			c.306_309del						.			40,4224		20,0,2112						4.3	0.1			91	89,8165		43,3,4081	no	frameshift	BBS10	NM_024685.3		63,3,6193	A1A1,A1R,RR		1.0783,0.9381,1.0305				129,12389				SO:0001589	frameshift_variant	79738	exon2	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	CTTTTCTCTGTCT	BC026355	CCDS9014.2	12q21.2	2014-06-17	2006-04-28	2006-04-28	ENSG00000179941	ENSG00000179941		"""Heat Shock Proteins / Chaperonins"""	26291	protein-coding gene	gene with protein product		610148	"""chromosome 12 open reading frame 58"""	C12orf58		16582908	Standard	NM_024685		Approved	FLJ23560	uc001syd.1	Q8TAM1	OTTHUMG00000147352	ENST00000393262.3:c.306_309delCAGA	12.37:g.76741460_76741463delTCTG	ENSP00000376946:p.Asp102fs	Somatic	58	0		WXS	Illumina GAIIx	Phase_I	110	48	NM_024685	0	0	0	0	0	Q96CW2|Q9H5D2	Frame_Shift_Del	DEL	ENST00000393262.3	37	CCDS9014.2																																																																																			.		0.387	BBS10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000303983.2	NM_024685	
RNFT2	84900	hgsc.bcm.edu	37	12	117187907	117187907	+	Silent	SNP	T	T	C	rs111256849	byFrequency	TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr12:117187907T>C	ENST00000257575.4	+	4	578	c.345T>C	c.(343-345)caT>caC	p.H115H	RNFT2_ENST00000392549.2_Silent_p.H115H|RNFT2_ENST00000319176.7_Silent_p.H115H|RNFT2_ENST00000407967.3_Silent_p.H115H			Q96EX2	RNFT2_HUMAN	ring finger protein, transmembrane 2	115	His-rich.					integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(1)|urinary_tract(1)	6	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.034)		CCCACCACCATTTCCACCATG	0.746													C|||	1284	0.25639	0.4826	0.1326	5008	,	,		12011	0.1786		0.166	False		,,,				2504	0.2117				p.H115H		.											.	.	0			c.T345C						.	C	,	1295,2539		234,827,856	3.0	4.0	4.0		345,345	3.2	1.0	12	dbSNP_132	4	888,6786		67,754,3016	no	coding-synonymous,coding-synonymous	RNFT2	NM_001109903.1,NM_032814.3	,	301,1581,3872	CC,CT,TT		11.5715,33.7767,18.9694	,	115/445,115/421	117187907	2183,9325	1917	3837	5754	SO:0001819	synonymous_variant	84900	exon4			CCACCATTTCCAC	AK027533	CCDS9180.2, CCDS44987.1	12q24.22	2013-01-09	2008-02-26	2008-02-26	ENSG00000135119	ENSG00000135119		"""RING-type (C3HC4) zinc fingers"""	25905	protein-coding gene	gene with protein product			"""transmembrane protein 118"""	TMEM118		12477932	Standard	NM_032814		Approved	FLJ14627	uc009zwn.3	Q96EX2	OTTHUMG00000150882	ENST00000257575.4:c.345T>C	12.37:g.117187907T>C		Somatic	3	0		WXS	Illumina GAIIx	Phase_I	24	9	NM_001109903	0	0	1	1	0	E9PAM7|Q96SU5	Silent	SNP	ENST00000257575.4	37	CCDS44987.1																																																																																			T|0.767;C|0.233		0.746	RNFT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320417.1	NM_032814	
SUGT1	10910	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	53237236	53237236	+	Nonsense_Mutation	SNP	G	G	T			TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr13:53237236G>T	ENST00000343788.6	+	8	566	c.484G>T	c.(484-486)Gaa>Taa	p.E162*	SUGT1_ENST00000310528.8_Nonsense_Mutation_p.E130*|SUGT1_ENST00000535397.1_Nonsense_Mutation_p.E74*|SUGT1_ENST00000483074.1_3'UTR	NM_001130912.1	NP_001124384.1	Q9Y2Z0	SUGT1_HUMAN	SGT1, suppressor of G2 allele of SKP1 (S. cerevisiae)	162					innate immune response (GO:0045087)|mitotic nuclear division (GO:0007067)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)				kidney(3)|large_intestine(3)|lung(2)	8		Lung NSC(96;0.00212)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.25e-08)		AATAGGCTCAGAATCTGAGGT	0.308																																					p.E162X		.											.	SUGT1-226	0			c.G484T						.						110.0	107.0	108.0					13																	53237236		2203	4298	6501	SO:0001587	stop_gained	10910	exon8			GGCTCAGAATCTG	AF068289	CCDS9436.1, CCDS45050.1	13q14.3	2014-03-20			ENSG00000165416	ENSG00000165416			16987	protein-coding gene	gene with protein product		604098				10445024	Standard	NM_006704		Approved	SGT1	uc001vhc.2	Q9Y2Z0	OTTHUMG00000016977	ENST00000343788.6:c.484G>T	13.37:g.53237236G>T	ENSP00000367208:p.Glu162*	Somatic	54	0		WXS	Illumina GAIIx	Phase_I	45	13	NM_001130912	0	0	0	0	0	A2A303|Q5JAK5|Q5TAM6|Q6VXY6	Nonsense_Mutation	SNP	ENST00000343788.6	37	CCDS45050.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.392535	0.83011	.	.	ENSG00000165416	ENST00000343788;ENST00000535397;ENST00000310528	.	.	.	4.92	3.05	0.35203	.	1.827130	0.02099	N	0.053737	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07030	T	0.85	-0.9452	11.0187	0.47705	0.0:0.4929:0.5071:0.0	.	.	.	.	X	162;74;130	.	ENSP00000308067:E130X	E	+	1	0	SUGT1	52135237	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	1.613000	0.36900	1.193000	0.43086	0.555000	0.69702	GAA	.		0.308	SUGT1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045104.2		
OR10G3	26533	bcgsc.ca	37	14	22038525	22038525	+	Silent	SNP	G	G	T	rs11626693	byFrequency	TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr14:22038525G>T	ENST00000303532.1	-	1	350	c.351C>A	c.(349-351)acC>acA	p.T117T		NM_001005465.1	NP_001005465.1	Q8NGC4	O10G3_HUMAN	olfactory receptor, family 10, subfamily G, member 3	117						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)	15	all_cancers(95;0.000987)			GBM - Glioblastoma multiforme(265;0.0139)		AGGCCATTAGGGTGTAGAGGA	0.527													G|||	1822	0.363818	0.5371	0.2277	5008	,	,		21719	0.2966		0.3072	False		,,,				2504	0.3538				p.T117T		.											.	OR10G3-68	0			c.C351A						.	G		2158,2248	583.6+/-385.9	549,1060,594	58.0	56.0	56.0		351	-3.3	0.1	14	dbSNP_120	56	2429,6171	401.1+/-347.0	347,1735,2218	no	coding-synonymous	OR10G3	NM_001005465.1		896,2795,2812	TT,TG,GG		28.2442,48.9787,35.2683		117/314	22038525	4587,8419	2203	4300	6503	SO:0001819	synonymous_variant	26533	exon1			CATTAGGGTGTAG		CCDS32046.1	14q11.2	2013-09-24			ENSG00000169208	ENSG00000169208		"""GPCR / Class A : Olfactory receptors"""	8171	protein-coding gene	gene with protein product						8188290	Standard	NM_001005465		Approved		uc010tmb.2	Q8NGC4	OTTHUMG00000168886	ENST00000303532.1:c.351C>A	14.37:g.22038525G>T		Somatic	205	2		WXS	Illumina GAIIx	Phase_I	215	9	NM_001005465	0	0	0	0	0	Q6IET7|Q96R77	Silent	SNP	ENST00000303532.1	37	CCDS32046.1																																																																																			G|0.656;T|0.344		0.527	OR10G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401521.1		
HECTD1	25831	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	31598273	31598273	+	Missense_Mutation	SNP	A	A	T			TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr14:31598273A>T	ENST00000399332.1	-	25	4792	c.4304T>A	c.(4303-4305)gTc>gAc	p.V1435D	HECTD1_ENST00000553700.1_Missense_Mutation_p.V1435D	NM_015382.2	NP_056197.2	Q9ULT8	HECD1_HUMAN	HECT domain containing E3 ubiquitin protein ligase 1	1435	Ser-rich.				neural tube closure (GO:0001843)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)			breast(10)|endometrium(7)|kidney(5)|large_intestine(12)|lung(23)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	70	Hepatocellular(127;0.0877)|Breast(36;0.176)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00617)		TGTTTGAGGGACGTTTTCAGC	0.443																																					p.V1435D		.											.	HECTD1-570	0			c.T4304A						.						145.0	130.0	135.0					14																	31598273		1967	4165	6132	SO:0001583	missense	25831	exon25			TGAGGGACGTTTT	AB032957	CCDS41939.1	14q12	2013-01-10	2012-02-23		ENSG00000092148	ENSG00000092148		"""Ankyrin repeat domain containing"""	20157	protein-coding gene	gene with protein product			"""HECT domain containing 1"""			10574461	Standard	XM_005267502		Approved	KIAA1131	uc001wrc.1	Q9ULT8	OTTHUMG00000170670	ENST00000399332.1:c.4304T>A	14.37:g.31598273A>T	ENSP00000382269:p.Val1435Asp	Somatic	261	1		WXS	Illumina GAIIx	Phase_I	217	167	NM_015382	0	0	5	22	17	D3DS86|Q6P445|Q86VJ1|Q96F34|Q9UFZ7	Missense_Mutation	SNP	ENST00000399332.1	37	CCDS41939.1	.	.	.	.	.	.	.	.	.	.	A	11.99	1.804318	0.31869	.	.	ENSG00000092148	ENST00000553700;ENST00000261312;ENST00000399332;ENST00000553957	T;T;T	0.41758	0.99;0.99;1.24	5.86	5.86	0.93980	.	0.212263	0.28365	U	0.015605	T	0.24005	0.0581	N	0.08118	0	0.53005	D	0.999967	B;B	0.32693	0.145;0.38	B;B	0.31869	0.058;0.137	T	0.14309	-1.0477	10	0.14656	T	0.56	-5.3826	15.1308	0.72520	1.0:0.0:0.0:0.0	.	1435;1435	D3DS86;Q9ULT8	.;HECD1_HUMAN	D	1435;1437;1435;862	ENSP00000450697:V1435D;ENSP00000382269:V1435D;ENSP00000451860:V862D	ENSP00000261312:V1437D	V	-	2	0	HECTD1	30668024	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.236000	0.58675	2.367000	0.80283	0.528000	0.53228	GTC	.		0.443	HECTD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409942.1		
PLEK2	26499	bcgsc.ca	37	14	67878765	67878765	+	Silent	SNP	G	G	A	rs115017102	byFrequency	TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr14:67878765G>A	ENST00000216446.4	-	1	152	c.12C>T	c.(10-12)ggC>ggT	p.G4G	PLEK2_ENST00000557388.1_5'UTR	NM_016445.1	NP_057529.1	Q9NYT0	PLEK2_HUMAN	pleckstrin 2	4	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton organization (GO:0030036)|intracellular signal transduction (GO:0035556)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)	15				all cancers(60;0.000728)|OV - Ovarian serous cystadenocarcinoma(108;0.00593)|BRCA - Breast invasive adenocarcinoma(234;0.00953)		CCTTGAGCACGCCGTCCTCCA	0.761													G|||	95	0.0189696	0.0287	0.0144	5008	,	,		12537	0.0		0.0278	False		,,,				2504	0.0194				p.G4G		.											.	PLEK2-92	0			c.C12T						.	G		120,4238		0,120,2059	23.0	16.0	18.0		12	0.6	1.0	14	dbSNP_132	18	271,8281		5,261,4010	no	coding-synonymous	PLEK2	NM_016445.1		5,381,6069	AA,AG,GG		3.1688,2.7536,3.0287		4/354	67878765	391,12519	2179	4276	6455	SO:0001819	synonymous_variant	26499	exon1			GAGCACGCCGTCC	AF228603	CCDS9782.1	14q23.3	2014-08-12			ENSG00000100558	ENSG00000100558		"""Pleckstrin homology (PH) domain containing"""	19238	protein-coding gene	gene with protein product		608007				11911883, 17658464	Standard	NM_016445		Approved		uc001xjh.1	Q9NYT0	OTTHUMG00000171247	ENST00000216446.4:c.12C>T	14.37:g.67878765G>A		Somatic	11	1		WXS	Illumina GAIIx	Phase_I	27	25	NM_016445	0	0	0	12	12	Q96JT0	Silent	SNP	ENST00000216446.4	37	CCDS9782.1																																																																																			G|0.976;A|0.024		0.761	PLEK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412547.2		
SEMA6D	80031	bcgsc.ca	37	15	48053888	48053888	+	Missense_Mutation	SNP	A	A	G	rs544873011		TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr15:48053888A>G	ENST00000316364.5	+	7	917	c.478A>G	c.(478-480)Att>Gtt	p.I160V	SEMA6D_ENST00000537942.1_Missense_Mutation_p.I160V|SEMA6D_ENST00000558014.1_Missense_Mutation_p.I160V|SEMA6D_ENST00000355997.3_Missense_Mutation_p.I160V|SEMA6D_ENST00000389425.3_Missense_Mutation_p.I160V|SEMA6D_ENST00000389433.2_Missense_Mutation_p.I160V|SEMA6D_ENST00000358066.4_Missense_Mutation_p.I160V|SEMA6D_ENST00000354744.4_Missense_Mutation_p.I160V|SEMA6D_ENST00000389432.2_Missense_Mutation_p.I160V|SEMA6D_ENST00000536845.2_Missense_Mutation_p.I160V|SEMA6D_ENST00000558816.1_Missense_Mutation_p.I160V|SEMA6D_ENST00000389428.3_Missense_Mutation_p.I160V	NM_153618.1	NP_705871.1	Q8NFY4	SEM6D_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D	160	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|negative regulation of smooth muscle cell migration (GO:0014912)|positive regulation of smooth muscle cell migration (GO:0014911)|ventricular system development (GO:0021591)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			biliary_tract(1)|breast(4)|endometrium(4)|kidney(5)|large_intestine(10)|lung(42)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	77		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		TGGGGAAGAAATTAGTGGCCT	0.378																																					p.I160V		.											.	SEMA6D-138	0			c.A478G						.						114.0	119.0	117.0					15																	48053888		2198	4297	6495	SO:0001583	missense	80031	exon7			GAAGAAATTAGTG	AF389430	CCDS32224.1, CCDS32225.1, CCDS32226.1, CCDS32227.1, CCDS32228.1, CCDS32229.1	15q21.1	2006-09-18				ENSG00000137872		"""Semaphorins"""	16770	protein-coding gene	gene with protein product		609295				12110693, 14977921	Standard	NM_020858		Approved	KIAA1479, FLJ11598	uc001zvy.3	Q8NFY4		ENST00000316364.5:c.478A>G	15.37:g.48053888A>G	ENSP00000324857:p.Ile160Val	Somatic	93	0		WXS	Illumina GAIIx	Phase_I	77	4	NM_153617	0	0	1	1	0	A6NF10|A6NM95|A6NNK1|A7E2A0|Q8NFY3|Q8NFY5|Q8NFY6|Q8NFY7|Q9P249	Missense_Mutation	SNP	ENST00000316364.5	37	CCDS32225.1	.	.	.	.	.	.	.	.	.	.	A	11.75	1.730514	0.30684	.	.	ENSG00000137872	ENST00000537942;ENST00000536845;ENST00000316364;ENST00000389433;ENST00000389432;ENST00000354744;ENST00000358066;ENST00000389428;ENST00000355997;ENST00000389425	T;T;T;T;T;T;T;T;T;T	0.10382	2.88;2.88;2.88;2.88;2.88;2.88;2.88;2.88;2.88;2.88	5.85	5.85	0.93711	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	T	0.11879	0.0289	N	0.11313	0.125	0.80722	D	1	B;B;B;B;B	0.28880	0.178;0.015;0.178;0.226;0.178	B;B;B;P;B	0.46917	0.076;0.027;0.076;0.531;0.076	T	0.33879	-0.9851	10	0.08381	T	0.77	.	16.2355	0.82371	1.0:0.0:0.0:0.0	.	160;160;160;160;160	Q8NFY4-3;A6NM95;Q8NFY4-4;Q8NFY4;Q8NFY4-2	.;.;.;SEM6D_HUMAN;.	V	160	ENSP00000442040:I160V;ENSP00000446152:I160V;ENSP00000324857:I160V;ENSP00000374084:I160V;ENSP00000374083:I160V;ENSP00000346786:I160V;ENSP00000350770:I160V;ENSP00000374079:I160V;ENSP00000348276:I160V;ENSP00000374076:I160V	ENSP00000324857:I160V	I	+	1	0	SEMA6D	45841180	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.962000	0.93254	2.238000	0.73509	0.533000	0.62120	ATT	.		0.378	SEMA6D-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416868.1	NM_024966	
TLN2	83660	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	63017231	63017231	+	Silent	SNP	G	G	A			TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr15:63017231G>A	ENST00000561311.1	+	26	3413	c.3183G>A	c.(3181-3183)acG>acA	p.T1061T	TLN2_ENST00000306829.6_Silent_p.T1061T			Q9Y4G6	TLN2_HUMAN	talin 2	1061	Ala-rich.				cell adhesion (GO:0007155)|cell-cell junction assembly (GO:0007043)|cytoskeletal anchoring at plasma membrane (GO:0007016)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99						CGGTGCAGACGCTTAAGAATG	0.537																																					p.T1061T		.											.	TLN2-573	0			c.G3183A						.						69.0	66.0	67.0					15																	63017231		2203	4300	6503	SO:0001819	synonymous_variant	83660	exon24			GCAGACGCTTAAG	AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914			15447	protein-coding gene	gene with protein product		607349				9205841, 11527381	Standard	NM_015059		Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.3183G>A	15.37:g.63017231G>A		Somatic	45	0		WXS	Illumina GAIIx	Phase_I	43	7	NM_015059	0	0	3	3	0	A6NLB8	Silent	SNP	ENST00000561311.1	37	CCDS32261.1																																																																																			.		0.537	TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257878.2		
KBTBD13	390594	hgsc.bcm.edu	37	15	65369395	65369395	+	Missense_Mutation	SNP	C	C	T	rs2919358	byFrequency	TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr15:65369395C>T	ENST00000432196.2	+	1	242	c.242C>T	c.(241-243)gCc>gTc	p.A81V	RASL12_ENST00000434605.2_5'Flank	NM_001101362.2	NP_001094832.1	C9JR72	KBTBD_HUMAN	kelch repeat and BTB (POZ) domain containing 13	81					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				lung(1)|prostate(1)|skin(1)	3						CTGCTGCAGGCCGTGGAGTGC	0.736													C|||	2613	0.521765	0.6036	0.5447	5008	,	,		9840	0.7312		0.3887	False		,,,				2504	0.316				p.A81V		.											.	.	0			c.C242T						.	C	VAL/ALA	1463,1441		405,653,394	2.0	3.0	2.0		242	4.6	1.0	15	dbSNP_101	2	2172,4110		500,1172,1469	no	missense	KBTBD13	NM_001101362.2	64	905,1825,1863	TT,TC,CC		34.575,49.6212,39.5711	possibly-damaging	81/459	65369395	3635,5551	1452	3141	4593	SO:0001583	missense	390594	exon1			TGCAGGCCGTGGA		CCDS45281.1	15q22.31	2014-09-17			ENSG00000234438	ENSG00000234438		"""BTB/POZ domain containing"""	37227	protein-coding gene	gene with protein product	"""nemaline myopathy type 6"""	613727				21109227, 22542517	Standard	NM_001101362		Approved	hCG_1645727, NEM6	uc010uis.2	C9JR72		ENST00000432196.2:c.242C>T	15.37:g.65369395C>T	ENSP00000388723:p.Ala81Val	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_001101362	0	0	0	0	0		Missense_Mutation	SNP	ENST00000432196.2	37	CCDS45281.1	1197	0.5480769230769231	302	0.6138211382113821	191	0.5276243093922652	410	0.7167832167832168	294	0.38786279683377306	C	20.9	4.061996	0.76187	0.503788	0.34575	ENSG00000234438	ENST00000432196	T	0.67865	-0.29	4.6	4.6	0.57074	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (2);	.	.	.	.	T	0.00012	0.0000	N	0.21324	0.655	0.22629	P	0.99891774	P	0.47034	0.889	P	0.50896	0.653	T	0.37753	-0.9692	8	0.26408	T	0.33	.	17.2241	0.86964	0.0:1.0:0.0:0.0	rs2919358	81	C9JR72	KBTBD_HUMAN	V	81	ENSP00000388723:A81V	ENSP00000388723:A81V	A	+	2	0	KBTBD13	63156448	1.000000	0.71417	0.996000	0.52242	0.931000	0.56810	7.251000	0.78297	2.390000	0.81377	0.650000	0.86243	GCC	C|0.452;T|0.548		0.736	KBTBD13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418468.2	NM_001101362	
FAM173A	65990	broad.mit.edu	37	16	771612	771612	+	Silent	SNP	C	C	A			TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr16:771612C>A	ENST00000569529.1	+	2	477	c.177C>A	c.(175-177)ggC>ggA	p.G59G	FAM173A_ENST00000564000.1_Silent_p.G59G|FAM173A_ENST00000219535.3_Silent_p.G59G	NM_023933.2	NP_076422.1	Q9BQD7	F173A_HUMAN	family with sequence similarity 173, member A	59						integral component of membrane (GO:0016021)				pancreas(1)	1						CCTACGTCGGCGCGAGCGCGC	0.726																																					p.G59G		.											.	FAM173A-91	0			c.C177A						.						10.0	12.0	11.0					16																	771612		2030	4025	6055	SO:0001819	synonymous_variant	65990	exon2			CGTCGGCGCGAGC	BC002624	CCDS10423.1, CCDS59254.1	16p13.3	2008-06-19	2008-06-19	2008-06-19	ENSG00000103254	ENSG00000103254			14152	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 24"""	C16orf24			Standard	NM_023933		Approved	MGC2494	uc002cje.4	Q9BQD7	OTTHUMG00000121177	ENST00000569529.1:c.177C>A	16.37:g.771612C>A		Somatic	24	1		WXS	Illumina GAIIx	Phase_I	57	8	NM_001271285	0	0	3	3	0	A2IDD4	Silent	SNP	ENST00000569529.1	37	CCDS10423.1																																																																																			.		0.726	FAM173A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000241667.2	NM_023933	
NDUFB10	4716	broad.mit.edu	37	16	2011627	2011645	+	Splice_Site	DEL	CCAGGACCGCTGTGCGTGC	CCAGGACCGCTGTGCGTGC	-	rs553213731|rs375783041		TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr16:2011627_2011645delCCAGGACCGCTGTGCGTGC	ENST00000268668.6	+	3	516_526	c.399_409delCCAGGACCGCTGTGCGTGC	c.(397-411)taccaggaccgctgt>tagt	p.YQDRC133fs	SNORA10_ENST00000384084.1_RNA|NDUFB10_ENST00000543683.2_Frame_Shift_Del_p.YQDRCAC133fs|NDUFB10_ENST00000569148.1_Splice_Site_p.YQDRC122fs|SNORA64_ENST00000384674.1_RNA	NM_004548.2	NP_004539.1	O96000	NDUBA_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10, 22kDa	133					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			lung(1)|urinary_tract(1)	2						CCAAGGCCTACCAGGACCGCTGTGCGTGCCCCACCCACC	0.607																																					p.133_137del		.											.	NDUFB10-90	0			c.399_409del						.																																			SO:0001630	splice_region_variant	4716	exon3			GGCCTACCAGGAC	AF044954	CCDS10451.1	16p13.3	2011-07-04	2002-08-29		ENSG00000140990	ENSG00000140990		"""Mitochondrial respiratory chain complex / Complex I"""	7696	protein-coding gene	gene with protein product	"""complex I PDSW subunit"""	603843	"""NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10 (22kD, PDSW)"""			9763677, 9878551	Standard	NM_004548		Approved	PDSW	uc002cni.2	O96000	OTTHUMG00000128709	ENST00000268668.6:c.409+1CCAGGACCGCTGTGCGTGC>-	16.37:g.2011627_2011645delCCAGGACCGCTGTGCGTGC		Somatic	16	0		WXS	Illumina GAIIx	Phase_I	15	4	NM_004548	0	0	0	0	0	Q96II6	Frame_Shift_Del	DEL	ENST00000268668.6	37	CCDS10451.1																																																																																			.		0.607	NDUFB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250614.2	NM_004548	Frame_Shift_Del
SLC9A3R2	9351	broad.mit.edu	37	16	2086730	2086730	+	Splice_Site	SNP	T	T	G			TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr16:2086730T>G	ENST00000424542.2	+	4	734	c.596T>G	c.(595-597)gTg>gGg	p.V199G	SLC9A3R2_ENST00000565086.1_3'UTR|SLC9A3R2_ENST00000432365.2_Splice_Site_p.V199G|SLC9A3R2_ENST00000566198.1_Splice_Site_p.V88G|SLC9A3R2_ENST00000563587.1_Splice_Site_p.V93G	NM_001130012.2|NM_004785.5	NP_001123484.1|NP_004776.3	Q15599	NHRF2_HUMAN	solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3 regulator 2	199	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|protein complex assembly (GO:0006461)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|phosphatase binding (GO:0019902)|protein C-terminus binding (GO:0008022)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(1)	2						TGGCGGCAGGTGAACGGGCAG	0.662																																					p.V199G	Ovarian(69;105 1552 17724 23473)	.											.	SLC9A3R2-23	0			c.T596G						.						33.0	43.0	39.0					16																	2086730		2165	4274	6439	SO:0001630	splice_region_variant	9351	exon4			GGCAGGTGAACGG	AF004900	CCDS45382.1, CCDS45383.1, CCDS58407.1	16p13.3	2014-09-04	2012-03-22		ENSG00000065054	ENSG00000065054			11076	protein-coding gene	gene with protein product		606553	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 3 regulatory factor 2"", ""solute carrier family 9 (sodium/hydrogen exchanger), isoform 3 regulator 2"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 2"""			9054412, 9671706	Standard	NM_001130012		Approved	SIP-1, TKA-1, NHERF-2, E3KARP	uc002coi.3	Q15599	OTTHUMG00000176956	ENST00000424542.2:c.595-1T>G	16.37:g.2086730T>G		Somatic	56	10		WXS	Illumina GAIIx	Phase_I	70	24	NM_004785	0	0	0	0	0	D3DU84|D3DU85|H3BSV6|O00272|O00556|Q3KQY7	Missense_Mutation	SNP	ENST00000424542.2	37	CCDS45382.1	.	.	.	.	.	.	.	.	.	.	t	17.64	3.440155	0.63067	.	.	ENSG00000065054	ENST00000424542;ENST00000432365	T;T	0.40225	1.04;1.04	4.85	4.85	0.62838	PDZ/DHR/GLGF (4);	0.000000	0.85682	D	0.000000	T	0.75265	0.3826	H	0.96889	3.9	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.84054	0.0371	10	0.87932	D	0	-15.7272	13.6345	0.62215	0.0:0.0:0.0:1.0	.	234;199;199	Q6NTG0;D3DU85;Q15599	.;.;NHRF2_HUMAN	G	199	ENSP00000408005:V199G;ENSP00000402857:V199G	ENSP00000408005:V199G	V	+	2	0	SLC9A3R2	2026731	1.000000	0.71417	1.000000	0.80357	0.825000	0.46686	7.929000	0.87595	1.815000	0.52974	0.375000	0.23000	GTG	.		0.662	SLC9A3R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434448.1		Missense_Mutation
ANKS3	124401	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	4747041	4747041	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr16:4747041C>G	ENST00000304283.4	-	17	2253	c.1959G>C	c.(1957-1959)tgG>tgC	p.W653C	ANKS3_ENST00000446014.2_Missense_Mutation_p.W524C|ANKS3_ENST00000585773.1_Missense_Mutation_p.W580C	NM_133450.3	NP_597707.1	Q6ZW76	ANKS3_HUMAN	ankyrin repeat and sterile alpha motif domain containing 3	653										endometrium(5)|kidney(4)|large_intestine(3)|lung(5)|prostate(1)|stomach(1)	19						AGGTCTCCCGCCACTTCTTCC	0.647																																					p.W653C		.											.	ANKS3-90	0			c.G1959C						.						76.0	60.0	65.0					16																	4747041		2196	4300	6496	SO:0001583	missense	124401	exon17			CTCCCGCCACTTC	AK057329	CCDS10520.1, CCDS73820.1	16p13.3	2013-01-10			ENSG00000168096	ENSG00000168096		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	29422	protein-coding gene	gene with protein product						11853319	Standard	NM_133450		Approved	KIAA1977, FLJ32345, FLJ32767	uc002cxj.2	Q6ZW76	OTTHUMG00000129478	ENST00000304283.4:c.1959G>C	16.37:g.4747041C>G	ENSP00000304586:p.Trp653Cys	Somatic	96	1		WXS	Illumina GAIIx	Phase_I	69	48	NM_133450	0	0	1	12	11	B4DWU4|D3DUE2|Q8TF25	Missense_Mutation	SNP	ENST00000304283.4	37	CCDS10520.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.959362	0.74016	.	.	ENSG00000168096	ENST00000304283;ENST00000446014	T;T	0.47869	0.83;2.52	5.49	4.52	0.55395	.	0.282115	0.37136	N	0.002229	T	0.64962	0.2646	M	0.74881	2.28	0.80722	D	1	D	0.71674	0.998	P	0.60173	0.87	T	0.70561	-0.4838	10	0.87932	D	0	10.7502	14.6428	0.68737	0.1464:0.8536:0.0:0.0	.	653	Q6ZW76	ANKS3_HUMAN	C	653;524	ENSP00000304586:W653C;ENSP00000406796:W524C	ENSP00000304586:W653C	W	-	3	0	ANKS3	4687042	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	2.452000	0.44961	1.274000	0.44362	0.655000	0.94253	TGG	.		0.647	ANKS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251642.3	NM_133450	
CLEC16A	23274	hgsc.bcm.edu	37	16	11272460	11272460	+	Silent	SNP	C	C	T			TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr16:11272460C>T	ENST00000409790.1	+	24	3305	c.3075C>T	c.(3073-3075)ccC>ccT	p.P1025P	CLEC16A_ENST00000381822.2_Silent_p.P112P	NM_015226.2	NP_056041.1			C-type lectin domain family 16, member A									p.0?(1)		breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37						CCGGCATGCCCCCGCTGTCCA	0.697																																					p.P1025P		.											.	CLEC16A-92	1	Whole gene deletion(1)	haematopoietic_and_lymphoid_tissue(1)	c.C3075T						.						12.0	17.0	15.0					16																	11272460		2061	4191	6252	SO:0001819	synonymous_variant	23274	exon23			CATGCCCCCGCTG	AB002348	CCDS45409.1, CCDS58423.1	16p13.13	2010-04-27	2007-07-17	2007-07-17	ENSG00000038532	ENSG00000038532		"""C-type lectin domain containing"""	29013	protein-coding gene	gene with protein product		611303	"""KIAA0350"""	KIAA0350		9205841, 17632545	Standard	NM_015226		Approved	Gop-1	uc002dao.3	Q2KHT3	OTTHUMG00000152915	ENST00000409790.1:c.3075C>T	16.37:g.11272460C>T		Somatic	2	0		WXS	Illumina GAIIx	Phase_I	29	22	NM_015226	0	0	1	18	17		Silent	SNP	ENST00000409790.1	37	CCDS45409.1																																																																																			.		0.697	CLEC16A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328540.2	NM_015226	
CCDC102A	92922	hgsc.bcm.edu	37	16	57562804	57562804	+	Missense_Mutation	SNP	G	G	A	rs12935069		TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr16:57562804G>A	ENST00000258214.2	-	2	532	c.286C>T	c.(286-288)Cgg>Tgg	p.R96W		NM_033212.3	NP_149989.2	Q96A19	C102A_HUMAN	coiled-coil domain containing 102A	96				R -> W (in Ref. 2; AAH08285/AAH09941). {ECO:0000305}.						endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)	8						TCCGACCACCGGCGCATGGTC	0.731													A|||	5008	1.0	1.0	1.0	5008	,	,		3757	1.0		1.0	False		,,,				2504	1.0				p.R96W		.											.	CCDC102A-91	0			c.C286T						.						8.0	10.0	9.0					16																	57562804		1834	3717	5551	SO:0001583	missense	92922	exon2			ACCACCGGCGCAT	BC008285	CCDS10784.1	16q13	2008-02-05			ENSG00000135736	ENSG00000135736			28097	protein-coding gene	gene with protein product						12477932	Standard	NM_033212		Approved	MGC10992	uc002elw.3	Q96A19	OTTHUMG00000133472	ENST00000258214.2:c.286C>T	16.37:g.57562804G>A	ENSP00000258214:p.Arg96Trp	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	9	NM_033212	0	0	0	1	1	Q9BT74	Missense_Mutation	SNP	ENST00000258214.2	37	CCDS10784.1	2180	0.9981684981684982	492	1.0	360	0.994475138121547	570	0.9965034965034965	758	1.0	A	10.17	1.277909	0.23307	.	.	ENSG00000135736	ENST00000258214	T	0.37752	1.18	4.82	4.82	0.62117	.	0.000000	0.64402	N	0.000001	T	0.00012	0.0000	N	0.00049	-2.415	0.40217	P	0.022302999999999962	B	0.02656	0.0	B	0.01281	0.0	T	0.44787	-0.9305	9	0.33141	T	0.24	-23.2491	9.5348	0.39216	0.9152:0.0:0.0848:0.0	rs12935069;rs12935069	96	Q96A19	C102A_HUMAN	W	96	ENSP00000258214:R96W	ENSP00000258214:R96W	R	-	1	2	CCDC102A	56120305	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	6.801000	0.75170	0.698000	0.31739	-0.556000	0.04195	CGG	G|0.001;A|0.999		0.731	CCDC102A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257348.1	NM_033212	
ZFPM1	161882	hgsc.bcm.edu	37	16	88599696	88599697	+	Frame_Shift_Del	DEL	GA	GA	-	rs368520732|rs67712719	byFrequency	TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	GA	GA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr16:88599696_88599697delGA	ENST00000319555.3	+	10	1652_1653	c.1330_1331delGA	c.(1330-1332)gagfs	p.E444fs	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	444				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GGCCAGAGCGGAGCCTCTGGCC	0.743														4881	0.974641	0.9138	0.9914	5008	,	,		7261	0.996		1.0	False		,,,				2504	0.9969				p.444_444del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1330_1331del						.			2219,383		1063,93,145						-6.5	0.0		dbSNP_130	3	4709,133		2339,31,51	no	frameshift	ZFPM1	NM_153813.2		3402,124,196	A1A1,A1R,RR		2.7468,14.7194,6.9318				6928,516				SO:0001589	frameshift_variant	161882	exon10			AGAGCGGAGCCTC	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1330_1331delGA	16.37:g.88599696_88599697delGA	ENSP00000326630:p.Glu444fs	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	19	13	NM_153813	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.743	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
ZFPM1	161882	hgsc.bcm.edu	37	16	88599697	88599705	+	In_Frame_Del	DEL	AGCCTCTGG	AGCCTCTGG	-	rs67873604|rs149145771|rs368520732|rs67322929|rs201915453|rs67712719	byFrequency	TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	AGCCTCTGG	AGCCTCTGG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr16:88599697_88599705delAGCCTCTGG	ENST00000319555.3	+	10	1653_1661	c.1331_1339delAGCCTCTGG	c.(1330-1341)gagcctctggcc>gcc	p.EPL444del	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	444				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GCCAGAGCGGAGCCTCTGGCCCAGAATGG	0.746																																					p.444_447del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1331_1339del						.																																			SO:0001651	inframe_deletion	161882	exon10			GAGCGGAGCCTCT	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1331_1339delAGCCTCTGG	16.37:g.88599697_88599705delAGCCTCTGG	ENSP00000326630:p.Glu444_Leu446del	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	18	0	NM_153813	0	0	0	0	0		In_Frame_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.746	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
ZFPM1	161882	hgsc.bcm.edu	37	16	88599701	88599701	+	Frame_Shift_Del	DEL	T	T	-	rs67322929|rs149145771	byFrequency	TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr16:88599701delT	ENST00000319555.3	+	10	1657	c.1335delT	c.(1333-1335)cctfs	p.P445fs	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	445				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GAGCGGAGCCTCTGGCCCAGA	0.746													-|T|-|insertion	4871	0.972644	0.9145	0.9899	5008	,	,		7405	0.995		0.994	False		,,,				2504	0.9939				p.P445fs	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1335delT						.						1.0	1.0	1.0					16																	88599701		392	657	1049	SO:0001589	frameshift_variant	161882	exon10			GGAGCCTCTGGCC	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1335delT	16.37:g.88599701delT	ENSP00000326630:p.Pro445fs	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	17	14	NM_153813	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.746	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
ZFPM1	161882	hgsc.bcm.edu	37	16	88599703	88599705	+	In_Frame_Del	DEL	TGG	TGG	-	rs149145771|rs67873604	byFrequency	TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	TGG	TGG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr16:88599703_88599705delTGG	ENST00000319555.3	+	10	1659_1661	c.1337_1339delTGG	c.(1336-1341)ctggcc>ccc	p.446_447LA>P	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	446				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GCGGAGCCTCTGGCCCAGAATGG	0.739														4871	0.972644	0.9145	0.9899	5008	,	,		7191	0.995		0.994	False		,,,				2504	0.9939				p.446_447del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1337_1339del						.																																			SO:0001651	inframe_deletion	161882	exon10			AGCCTCTGGCCCA	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1337_1339delTGG	16.37:g.88599703_88599705delTGG	ENSP00000326630:p.Leu446_Ala447delinsPro	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	17	14	NM_153813	0	0	0	0	0		In_Frame_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.739	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
GAS8	2622	bcgsc.ca	37	16	90095573	90095573	+	Intron	SNP	C	C	T	rs77382359		TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr16:90095573C>T	ENST00000268699.4	+	2	212				C16orf3_ENST00000408886.2_Missense_Mutation_p.V60I|GAS8_ENST00000536122.1_Intron|GAS8_ENST00000540721.1_Intron	NM_001481.2	NP_001472.1	O95995	GAS8_HUMAN	growth arrest-specific 8						cellular protein localization (GO:0034613)|negative regulation of cell proliferation (GO:0008285)|sperm motility (GO:0030317)	Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile cilium (GO:0031514)				endometrium(3)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	14		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.029)		gggcaggctacggggcagctt	0.672																																					p.V60I		.											.	C16orf3-90	0			c.G178A						.						22.0	20.0	21.0					16																	90095573		2194	4299	6493	SO:0001627	intron_variant	750	exon1			AGGCTACGGGGCA	AF050079	CCDS10992.1, CCDS67101.1, CCDS73932.1	16q24.3	2014-07-18	2003-01-16	2003-01-17	ENSG00000141013	ENSG00000141013			4166	protein-coding gene	gene with protein product		605178	"""growth arrest-specific 11"""	GAS11		9790751	Standard	NM_001481		Approved		uc002fqi.1	O95995	OTTHUMG00000138988	ENST00000268699.4:c.90+1443C>T	16.37:g.90095573C>T		Somatic	59	0		WXS	Illumina GAIIx	Phase_I	48	13	NM_001214	0	0	0	0	0	B2RCT1|B7Z4U1|G3V1L5|Q2M234	Missense_Mutation	SNP	ENST00000268699.4	37	CCDS10992.1	.	.	.	.	.	.	.	.	.	.	c	0.708	-0.788068	0.02884	.	.	ENSG00000221819	ENST00000408886	T	0.47177	0.85	.	.	.	.	.	.	.	.	T	0.22244	0.0536	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.22208	-1.0223	4	.	.	.	.	.	.	.	.	68	O95177	CP003_HUMAN	I	60	ENSP00000386218:V60I	.	V	-	1	0	C16orf3	88623074	0.031000	0.19500	0.015000	0.15790	0.017000	0.09413	0.000000	0.12993	0.000000	0.14550	0.000000	0.15137	GTA	C|0.500;T|0.500		0.672	GAS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000272877.2		
TP53	7157	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	7578415	7578428	+	Frame_Shift_Del	DEL	ACCTCCGTCATGTG	ACCTCCGTCATGTG	-	rs587781845|rs587780729		TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	ACCTCCGTCATGTG	ACCTCCGTCATGTG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr17:7578415_7578428delACCTCCGTCATGTG	ENST00000269305.4	-	5	691_704	c.502_515delCACATGACGGAGGT	c.(502-516)cacatgacggaggttfs	p.HMTEV168fs	TP53_ENST00000445888.2_Frame_Shift_Del_p.HMTEV168fs|TP53_ENST00000359597.4_Frame_Shift_Del_p.HMTEV168fs|TP53_ENST00000413465.2_Frame_Shift_Del_p.HMTEV168fs|TP53_ENST00000420246.2_Frame_Shift_Del_p.HMTEV168fs|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000455263.2_Frame_Shift_Del_p.HMTEV168fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	168	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		H -> D (in sporadic cancers; somatic mutation).|H -> L (in sporadic cancers; somatic mutation).|H -> N (in sporadic cancers; somatic mutation).|H -> P (in sporadic cancers; somatic mutation).|H -> Q (in sporadic cancers; somatic mutation).|H -> R (in sporadic cancers; somatic mutation).|H -> V (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|H -> Y (in sporadic cancers; somatic mutation).|HM -> LI (in a sporadic cancer; somatic mutation).|QH -> HD (in a sporadic cancer; somatic mutation).|QH -> YL (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.V172F(14)|p.H168R(12)|p.E171K(11)|p.E171*(10)|p.H168P(10)|p.H168Y(9)|p.H168L(8)|p.M169I(8)|p.V172D(8)|p.0?(8)|p.V172I(7)|p.T170M(7)|p.T170T(7)|p.V172G(6)|p.V172fs*2(4)|p.E171Q(4)|p.V172A(4)|p.H168H(4)|p.E171fs*2(3)|p.E171G(3)|p.E171fs*10(3)|p.M169V(3)|p.M169T(3)|p.E171D(2)|p.E171fs*3(2)|p.H168fs*2(2)|p.E171V(2)|p.V173fs*59(2)|p.V157_C176del20(1)|p.V172_R174delVVR(1)|p.H36L(1)|p.H75L(1)|p.Y163fs*1(1)|p.T170A(1)|p.P151_V173del23(1)|p.S149fs*72(1)|p.E171fs*61(1)|p.Q167_H168>HD(1)|p.H168fs*5(1)|p.V172_E180delVVRRCPHHE(1)|p.V40F(1)|p.V40G(1)|p.T170fs*5(1)|p.E171fs*1(1)|p.T170fs*8(1)|p.E78fs*2(1)|p.H168fs*3(1)|p.H168D(1)|p.E171A(1)|p.H168_M169>LI(1)|p.H168fs*4(1)|p.E171fs*9(1)|p.V172fs*9(1)|p.H168fs*69(1)|p.T170fs*2(1)|p.M169fs*2(1)|p.Q167fs*12(1)|p.Q167_H168>YL(1)|p.T170_E171insXX(1)|p.E171_H179delEVVRRCPHH(1)|p.H168N(1)|p.E39fs*2(1)|p.V79F(1)|p.V79G(1)|p.M169_T170insX(1)|p.H168fs*13(1)|p.H168Q(1)|p.Q165_M169delQSQHM(1)|p.T170P(1)|p.T170S(1)|p.E171_V172delEV(1)|p.E39K(1)|p.M169fs*12(1)|p.E78K(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCGCCTCACAACCTCCGTCATGTGCTGTGACTGC	0.654		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.168_172del	Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	.	TP53-70225	212	Substitution - Missense(136)|Deletion - Frameshift(26)|Substitution - coding silent(11)|Substitution - Nonsense(10)|Insertion - Frameshift(9)|Whole gene deletion(8)|Deletion - In frame(7)|Complex - compound substitution(3)|Insertion - In frame(2)	lung(35)|breast(32)|large_intestine(27)|oesophagus(17)|haematopoietic_and_lymphoid_tissue(14)|skin(11)|upper_aerodigestive_tract(11)|urinary_tract(10)|stomach(9)|ovary(9)|liver(8)|central_nervous_system(6)|prostate(5)|bone(5)|cervix(3)|vulva(2)|endometrium(2)|soft_tissue(2)|kidney(1)|thyroid(1)|biliary_tract(1)|pancreas(1)	c.502_515del						.																																			SO:0001589	frameshift_variant	7157	exon5	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	CTCACAACCTCCG	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.502_515delCACATGACGGAGGT	17.37:g.7578415_7578428delACCTCCGTCATGTG	ENSP00000269305:p.His168fs	Somatic	111	0		WXS	Illumina GAIIx	Phase_I	55	26	NM_000546	0	0	0	0	0	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	ENST00000269305.4	37	CCDS11118.1																																																																																			.		0.654	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
TVP23C	201158	ucsc.edu	37	17	15457087	15457087	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr17:15457087C>T	ENST00000225576.3	-	3	247	c.152G>A	c.(151-153)tGt>tAt	p.C51Y	TVP23C_ENST00000584811.1_5'UTR|TVP23C_ENST00000428082.2_Missense_Mutation_p.C51Y|TVP23C_ENST00000518321.1_Missense_Mutation_p.C51Y|TVP23C_ENST00000519970.1_Intron|TVP23C-CDRT4_ENST00000522212.2_Missense_Mutation_p.C51Y|TVP23C_ENST00000438826.3_Missense_Mutation_p.C51Y	NM_145301.2	NP_660344.2	Q96ET8	TV23C_HUMAN	trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)	51						integral component of membrane (GO:0016021)											ACAGAGAAGACAGACGATGAT	0.373																																					p.C51Y		.											.	.	0			c.G152A						.						274.0	265.0	268.0					17																	15457087		2203	4300	6503	SO:0001583	missense	201158	exon3			AGAAGACAGACGA	BC011952	CCDS11170.1, CCDS45617.1	17p12	2012-11-29	2012-11-29	2012-11-29	ENSG00000175106	ENSG00000175106			30453	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B2"""	FAM18B2			Standard	NM_001135036		Approved	MGC8763	uc002goq.2	Q96ET8	OTTHUMG00000171461	ENST00000225576.3:c.152G>A	17.37:g.15457087C>T	ENSP00000225576:p.Cys51Tyr	Somatic	293	10		WXS	Illumina GAIIx	Phase_I	239	10	NM_145301	0	0	13	111	98	Q3LIC7	Missense_Mutation	SNP	ENST00000225576.3	37	CCDS11170.1	.	.	.	.	.	.	.	.	.	.	.	2.368	-0.344949	0.05208	.	.	ENSG00000259024;ENSG00000175106;ENSG00000175106;ENSG00000175106	ENST00000522212;ENST00000225576;ENST00000428082;ENST00000438826	T;T;T;T	0.25749	1.78;1.78;1.78;1.78	4.47	4.47	0.54385	.	0.000000	0.85682	N	0.000000	T	0.02571	0.0078	N	0.00004	-3.335	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.0;0.0;0.002	T	0.38457	-0.9660	10	0.02654	T	1	-3.8701	9.492	0.38965	0.0:0.0877:0.0:0.9123	.	51;51;51	Q96ET8-2;Q96ET8-3;Q96ET8	.;.;F18B2_HUMAN	Y	51	ENSP00000429865:C51Y;ENSP00000225576:C51Y;ENSP00000406387:C51Y;ENSP00000413355:C51Y	ENSP00000225576:C51Y	C	-	2	0	RP11-726O12.1;FAM18B2	15397812	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	6.178000	0.71968	0.670000	0.31165	-0.442000	0.05670	TGT	.		0.373	TVP23C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000130705.2	NM_145301	
VTN	7448	hgsc.bcm.edu	37	17	26699121	26699121	+	5'Flank	SNP	G	G	C	rs7212814		TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr17:26699121G>C	ENST00000226218.4	-	0	0				VTN_ENST00000536498.1_5'Flank|TMEM199_ENST00000509083.1_Intron|SARM1_ENST00000457710.3_5'UTR|CTB-96E2.3_ENST00000591482.1_RNA|SARM1_ENST00000379061.4_Intron	NM_000638.3	NP_000629.3	P04004	VTNC_HUMAN	vitronectin						cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|immune response (GO:0006955)|innate immune response (GO:0045087)|negative regulation of blood coagulation (GO:0030195)|negative regulation of endopeptidase activity (GO:0010951)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein binding (GO:0032092)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation of wound healing (GO:0090303)|regulation of complement activation (GO:0030449)|smooth muscle cell-matrix adhesion (GO:0061302)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|blood microparticle (GO:0072562)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			kidney(2)|large_intestine(7)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	13	all_lung(13;0.000533)|Lung NSC(42;0.00171)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)	Abciximab(DB00054)	GGCCCACGGCGGGGCGCCGAG	0.761													C|||	5008	1.0	1.0	1.0	5008	,	,		9002	1.0		1.0	False		,,,				2504	1.0				p.R23P		.											.	.	0			c.G68C						.						2.0	2.0	2.0					17																	26699121		1378	3066	4444	SO:0001631	upstream_gene_variant	23098	exon1			CACGGCGGGGCGC	BC005046	CCDS11229.1	17q11.2	2014-08-08	2006-02-10		ENSG00000109072	ENSG00000109072		"""Endogenous ligands"""	12724	protein-coding gene	gene with protein product	"""serum spreading factor"", ""somatomedin B"", ""complement S-protein"""	193190	"""vitronectin (serum spreading factor, somatomedin B, complement S-protein)"""			2447940	Standard	NM_000638		Approved	VN	uc002hbc.3	P04004	OTTHUMG00000132500		17.37:g.26699121G>C	Exception_encountered	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_015077	0	0	0	4	4	B2R7G0|P01141|Q9BSH7	Missense_Mutation	SNP	ENST00000226218.4	37	CCDS11229.1	2181	0.9986263736263736	490	0.9959349593495935	362	1.0	571	0.9982517482517482	758	1.0	C	4.627	0.116613	0.08881	.	.	ENSG00000004139	ENST00000457710	.	.	.	4.93	3.94	0.45596	.	1.216040	0.06217	N	0.686070	T	0.00012	0.0000	.	.	.	0.45837	P	0.0012929999999999886	.	.	.	.	.	.	T	0.38757	-0.9646	5	0.02654	T	1	0.2642	5.2918	0.15731	0.1514:0.6261:0.1455:0.077	rs7212814	.	.	.	P	23	.	ENSP00000406738:R23P	R	+	2	0	SARM1	23723248	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	1.263000	0.33004	0.497000	0.27926	-1.514000	0.00941	CGG	G|0.001;C|0.999		0.761	VTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255680.2	NM_000638	
FAM222B	55731	broad.mit.edu	37	17	27085450	27085450	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr17:27085450G>T	ENST00000341217.5	-	3	1742	c.1527C>A	c.(1525-1527)agC>agA	p.S509R	FAM222B_ENST00000581407.1_Missense_Mutation_p.S509R|FAM222B_ENST00000582266.1_3'UTR|FAM222B_ENST00000452648.3_Missense_Mutation_p.S509R	NM_018182.2	NP_060652.2	Q8WU58	F222B_HUMAN	family with sequence similarity 222, member B	509																	TTTGCATCAAGCTGTTCTGGC	0.647																																					p.S509R		.											.	.	0			c.C1527A						.						52.0	57.0	55.0					17																	27085450		1993	4152	6145	SO:0001583	missense	55731	exon4			CATCAAGCTGTTC	AK001562	CCDS45637.1, CCDS74022.1	17q11.2	2012-04-27	2012-04-27	2012-04-27	ENSG00000173065	ENSG00000173065			25563	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 63"""	C17orf63			Standard	NM_001288631		Approved	FLJ10700	uc010way.1	Q8WU58		ENST00000341217.5:c.1527C>A	17.37:g.27085450G>T	ENSP00000343115:p.Ser509Arg	Somatic	61	0		WXS	Illumina GAIIx	Phase_I	58	3	NM_018182	0	0	21	21	0	Q9H6F3|Q9NVJ4|Q9NXN6	Missense_Mutation	SNP	ENST00000341217.5	37	CCDS45637.1	.	.	.	.	.	.	.	.	.	.	G	10.26	1.301824	0.23736	.	.	ENSG00000173065	ENST00000341217;ENST00000452648	T;T	0.33654	1.4;1.4	4.76	3.79	0.43588	.	0.090227	0.85682	D	0.000000	T	0.24392	0.0591	L	0.29908	0.895	0.32633	N	0.521693	B	0.30281	0.275	B	0.24269	0.052	T	0.31641	-0.9936	10	0.46703	T	0.11	-5.0388	10.4235	0.44365	0.1641:0.0:0.8359:0.0	.	509	Q8WU58	CQ063_HUMAN	R	509	ENSP00000343115:S509R;ENSP00000413645:S509R	ENSP00000343115:S509R	S	-	3	2	C17orf63	24109577	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	2.252000	0.43196	1.219000	0.43474	-0.258000	0.10820	AGC	.		0.647	FAM222B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446703.1	NM_018182	
SEZ6	124925	ucsc.edu	37	17	27286750	27286750	+	Silent	SNP	G	G	A	rs9907950	byFrequency	TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr17:27286750G>A	ENST00000317338.12	-	8	2165	c.1737C>T	c.(1735-1737)gaC>gaT	p.D579D	SEZ6_ENST00000360295.9_Silent_p.D579D|PIPOX_ENST00000583215.1_Intron|SEZ6_ENST00000442608.3_Silent_p.D579D|SEZ6_ENST00000335960.6_Intron			Q53EL9	SEZ6_HUMAN	seizure related 6 homolog (mouse)	579	Sushi 2. {ECO:0000255|PROSITE- ProRule:PRU00302}.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|negative regulation of dendrite development (GO:2000171)|positive regulation of dendrite development (GO:1900006)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	apical dendrite (GO:0097440)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(4)|lung(11)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	29	Lung NSC(42;0.0137)		Epithelial(11;4.73e-06)|all cancers(11;2.91e-05)|BRCA - Breast invasive adenocarcinoma(11;8.06e-05)|OV - Ovarian serous cystadenocarcinoma(11;0.111)			TCCACTGGGGGTCGTGGGGGT	0.602													G|||	709	0.141573	0.2632	0.1268	5008	,	,		18719	0.0506		0.1402	False		,,,				2504	0.0828				p.D579D		.											.	SEZ6-90	0			c.C1737T						.	G	,	933,3183		106,721,1231	50.0	53.0	52.0		1737,1737	-2.8	0.9	17	dbSNP_119	52	1159,7293		80,999,3147	no	coding-synonymous,coding-synonymous	SEZ6	NM_001098635.1,NM_178860.4	,	186,1720,4378	AA,AG,GG		13.7127,22.6676,16.6454	,	579/994,579/995	27286750	2092,10476	2058	4226	6284	SO:0001819	synonymous_variant	124925	exon8			CTGGGGGTCGTGG	AY038048	CCDS45638.1, CCDS45639.1	17q11.2	2008-03-06	2001-11-28		ENSG00000063015	ENSG00000063015			15955	protein-coding gene	gene with protein product			"""seizure related gene 6 (mouse) homolog"""			17086543	Standard	NM_178860		Approved		uc002hdp.2	Q53EL9	OTTHUMG00000168010	ENST00000317338.12:c.1737C>T	17.37:g.27286750G>A		Somatic	70	1		WXS	Illumina GAIIx	Phase_I	47	4	NM_001098635	0	0	0	0	0	B6ZDN1|Q8N701|Q8NB57|Q8ND50|Q8TD25|Q96NI5|Q96NQ3	Silent	SNP	ENST00000317338.12	37	CCDS45639.1																																																																																			G|0.841;A|0.159		0.602	SEZ6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397475.3		
LAMA3	3909	ucsc.edu;bcgsc.ca	37	18	21464756	21464756	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr18:21464756G>T	ENST00000313654.9	+	41	5483	c.5242G>T	c.(5242-5244)Gtg>Ttg	p.V1748L	LAMA3_ENST00000269217.6_Missense_Mutation_p.V139L|LAMA3_ENST00000587184.1_Missense_Mutation_p.V139L|LAMA3_ENST00000399516.3_Missense_Mutation_p.V1748L	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	1748	Domain III A.|Laminin EGF-like 14. {ECO:0000255|PROSITE-ProRule:PRU00460}.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					TGGCTGTGTGGTGAATGGGGG	0.527																																					p.V1748L		.											.	LAMA3-100	0			c.G5242T						.						176.0	168.0	171.0					18																	21464756		2203	4300	6503	SO:0001583	missense	3909	exon41			TGTGTGGTGAATG	L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.5242G>T	18.37:g.21464756G>T	ENSP00000324532:p.Val1748Leu	Somatic	46	0		WXS	Illumina GAIIx	Phase_I	43	4	NM_001127717	0	0	0	0	0	B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Missense_Mutation	SNP	ENST00000313654.9	37	CCDS42419.1	.	.	.	.	.	.	.	.	.	.	G	14.16	2.453987	0.43634	.	.	ENSG00000053747	ENST00000313654;ENST00000399516;ENST00000269217	T;T;T	0.60548	0.18;0.18;0.18	6.06	6.06	0.98353	EGF-like, laminin (3);Growth factor, receptor (1);	.	.	.	.	T	0.51432	0.1674	N	0.08118	0	0.48452	D	0.999658	P;P;P;P	0.51147	0.928;0.942;0.802;0.881	P;P;P;P	0.53518	0.645;0.716;0.659;0.728	T	0.48433	-0.9036	9	0.19590	T	0.45	.	19.4116	0.94675	0.0:0.0:1.0:0.0	.	139;139;1748;1748	Q6VU69;B0YJ33;Q6VU67;Q16787	.;.;.;LAMA3_HUMAN	L	1748;1748;139	ENSP00000324532:V1748L;ENSP00000382432:V1748L;ENSP00000269217:V139L	ENSP00000269217:V139L	V	+	1	0	LAMA3	19718754	1.000000	0.71417	0.980000	0.43619	0.533000	0.34776	5.009000	0.63998	2.885000	0.99019	0.655000	0.94253	GTG	.		0.527	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254824.3	NM_000227, NM_198129	
ARID3A	1820	hgsc.bcm.edu	37	19	929678	929678	+	Silent	SNP	G	G	A	rs3826948	byFrequency	TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr19:929678G>A	ENST00000263620.3	+	2	477	c.150G>A	c.(148-150)gaG>gaA	p.E50E	AC005391.2_ENST00000585647.1_RNA	NM_005224.2	NP_005215.1	Q99856	ARI3A_HUMAN	AT rich interactive domain 3A (BRIGHT-like)	50						cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|ovary(1)	10		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GAGAGCCCGAGAGTGCCCGGA	0.766													g|||	2308	0.460863	0.1112	0.487	5008	,	,		7932	0.6756		0.6223	False		,,,				2504	0.5276				p.E50E	Pancreas(29;54 1022 32760 50921)	.											.	ARID3A-90	0			c.G150A						.	G		470,2552		61,348,1102	3.0	4.0	3.0		150	1.1	0.4	19	dbSNP_107	3	3721,3153		1076,1569,792	no	coding-synonymous	ARID3A	NM_005224.2		1137,1917,1894	AA,AG,GG		45.8685,15.5526,42.3504		50/594	929678	4191,5705	1511	3437	4948	SO:0001819	synonymous_variant	1820	exon2			GCCCGAGAGTGCC	U88047	CCDS12050.1	19p13.3	2013-02-07	2006-11-08	2004-01-30		ENSG00000116017		"""-"""	3031	protein-coding gene	gene with protein product		603265	"""dead ringer-like 1 (Drosophila)"", ""AT rich interactive domain 3A (BRIGHT- like)"""	DRIL1		9722953	Standard	NM_005224		Approved	BRIGHT	uc002lql.3	Q99856		ENST00000263620.3:c.150G>A	19.37:g.929678G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_005224	0	0	0	1	1	Q5I858|Q6P9C6|Q8IZA7|Q8N4Z3	Silent	SNP	ENST00000263620.3	37	CCDS12050.1																																																																																			T|0.495;C|0.504		0.766	ARID3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458219.1	NM_005224	
ARID3A	1820	hgsc.bcm.edu	37	19	929753	929753	+	Silent	SNP	A	A	G	rs1799595	byFrequency	TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr19:929753A>G	ENST00000263620.3	+	2	552	c.225A>G	c.(223-225)ccA>ccG	p.P75P	AC005391.2_ENST00000585647.1_RNA	NM_005224.2	NP_005215.1	Q99856	ARI3A_HUMAN	AT rich interactive domain 3A (BRIGHT-like)	75						cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|ovary(1)	10		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGGACACCCAGCCAGCCCCG	0.751													t|||	4428	0.884185	0.9062	0.804	5008	,	,		8534	0.998		0.836	False		,,,				2504	0.8436				p.P75P	Pancreas(29;54 1022 32760 50921)	.											.	ARID3A-90	0			c.A225G						.	G		3389,305		1555,279,13	4.0	5.0	5.0		225	-6.8	0.0	19	dbSNP_89	5	6619,1123		2834,951,86	no	coding-synonymous	ARID3A	NM_005224.2		4389,1230,99	GG,GA,AA		14.5053,8.2566,12.4869		75/594	929753	10008,1428	1847	3871	5718	SO:0001819	synonymous_variant	1820	exon2			ACACCCAGCCAGC	U88047	CCDS12050.1	19p13.3	2013-02-07	2006-11-08	2004-01-30		ENSG00000116017		"""-"""	3031	protein-coding gene	gene with protein product		603265	"""dead ringer-like 1 (Drosophila)"", ""AT rich interactive domain 3A (BRIGHT- like)"""	DRIL1		9722953	Standard	NM_005224		Approved	BRIGHT	uc002lql.3	Q99856		ENST00000263620.3:c.225A>G	19.37:g.929753A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	12	12	NM_005224	0	0	0	2	2	Q5I858|Q6P9C6|Q8IZA7|Q8N4Z3	Silent	SNP	ENST00000263620.3	37	CCDS12050.1																																																																																			A|0.114;G|0.886		0.751	ARID3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458219.1	NM_005224	
PDE4C	5143	ucsc.edu	37	19	18331699	18331699	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr19:18331699G>T	ENST00000355502.3	-	9	1451	c.580C>A	c.(580-582)Cag>Aag	p.Q194K	PDE4C_ENST00000594617.3_Missense_Mutation_p.Q194K|PDE4C_ENST00000597297.1_Intron|PDE4C_ENST00000594465.3_Missense_Mutation_p.Q194K|PDE4C_ENST00000262805.12_Missense_Mutation_p.Q162K|PDE4C_ENST00000447275.3_Missense_Mutation_p.Q88K|AC068499.10_ENST00000594805.3_RNA|PDE4C_ENST00000598111.2_Intron|PDE4C_ENST00000539010.1_Intron			Q08493	PDE4C_HUMAN	phosphodiesterase 4C, cAMP-specific	194					cAMP catabolic process (GO:0006198)|signal transduction (GO:0007165)	cytosol (GO:0005829)|extracellular space (GO:0005615)|primary cilium (GO:0072372)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(2)|lung(9)|ovary(2)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	33					Caffeine(DB00201)|Dyphylline(DB00651)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Roflumilast(DB01656)	GGAGGGAGCTGATTGCTGGAT	0.637																																					p.Q194K		.											.	PDE4C-94	0			c.C580A						.						72.0	56.0	61.0					19																	18331699		2203	4300	6503	SO:0001583	missense	5143	exon6			GGAGCTGATTGCT		CCDS12373.1, CCDS42523.1, CCDS46016.1	19p13.11	2010-06-24	2010-06-24			ENSG00000105650	3.1.4.17	"""Phosphodiesterases"""	8782	protein-coding gene	gene with protein product	"""phosphodiesterase E1 dunce homolog (Drosophila)"""	600128	"""phosphodiesterase 4C, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E1)"""	DPDE1			Standard	NM_001098818		Approved		uc002nik.4	Q08493		ENST00000355502.3:c.580C>A	19.37:g.18331699G>T	ENSP00000347689:p.Gln194Lys	Somatic	68	0		WXS	Illumina GAIIx	Phase_I	41	4	NM_000923	0	0	0	0	0	B3KTC4|Q9UN44|Q9UN45|Q9UN46|Q9UPJ6	Missense_Mutation	SNP	ENST00000355502.3	37	CCDS12373.1	.	.	.	.	.	.	.	.	.	.	G	0.522	-0.861617	0.02610	.	.	ENSG00000105650	ENST00000536045;ENST00000355502;ENST00000536507;ENST00000262805;ENST00000447275;ENST00000543547	T;T;T	0.69306	-0.37;-0.39;-0.39	3.46	2.41	0.29592	.	0.864106	0.10113	N	0.714399	T	0.41465	0.1160	N	0.11756	0.17	0.32291	N	0.566245	B;B	0.06786	0.001;0.001	B;B	0.09377	0.001;0.004	T	0.42413	-0.9453	10	0.02654	T	1	.	7.9364	0.29933	0.1212:0.0:0.8788:0.0	.	194;162	Q08493;Q08493-3	PDE4C_HUMAN;.	K	273;194;182;162;88;303	ENSP00000347689:Q194K;ENSP00000262805:Q162K;ENSP00000402091:Q88K	ENSP00000262805:Q162K	Q	-	1	0	PDE4C	18192699	0.000000	0.05858	0.003000	0.11579	0.051000	0.14879	-0.022000	0.12480	0.810000	0.34279	0.486000	0.48141	CAG	.		0.637	PDE4C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466295.1		
RINL	126432	hgsc.bcm.edu	37	19	39360720	39360720	+	Missense_Mutation	SNP	G	G	A	rs8110393	byFrequency	TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr19:39360720G>A	ENST00000591812.1	-	9	1291	c.1205C>T	c.(1204-1206)cCc>cTc	p.P402L	RINL_ENST00000598904.1_Missense_Mutation_p.P288L|CTC-360G5.6_ENST00000593830.1_RNA|RINL_ENST00000340740.3_Missense_Mutation_p.P288L|RINL_ENST00000602238.1_5'Flank			Q6ZS11	RINL_HUMAN	Ras and Rab interactor-like	402	VPS9. {ECO:0000255|PROSITE- ProRule:PRU00550}.		P -> L (in dbSNP:rs8110393).		endocytosis (GO:0006897)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)	actin cytoskeleton (GO:0015629)|cytoplasmic vesicle (GO:0031410)|ruffle (GO:0001726)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(3)|kidney(4)|large_intestine(2)|lung(4)|pancreas(1)|skin(1)|urinary_tract(2)	17						GGCGGGGGCGGGGCTCTGCCC	0.781													G|||	3477	0.694289	0.9289	0.6153	5008	,	,		10275	0.7619		0.4642	False		,,,				2504	0.6002				p.P402L		.											.	RINL-91	0			c.C1205T						.	G	LEU/PRO,LEU/PRO	3328,464		1489,350,57	4.0	4.0	4.0		1205,863	3.5	1.0	19	dbSNP_116	4	4059,3433		1245,1569,932	no	missense,missense	RINL	NM_001195833.1,NM_198445.3	98,98	2734,1919,989	AA,AG,GG		45.8222,12.2363,34.5356	probably-damaging,probably-damaging	402/567,288/453	39360720	7387,3897	1896	3746	5642	SO:0001583	missense	126432	exon9			GGGGCGGGGCTCT	AK127808	CCDS12522.1, CCDS59386.1	19q13.2	2010-07-13			ENSG00000187994	ENSG00000187994			24795	protein-coding gene	gene with protein product							Standard	NM_001195833		Approved	FLJ45909	uc010xuo.2	Q6ZS11		ENST00000591812.1:c.1205C>T	19.37:g.39360720G>A	ENSP00000467107:p.Pro402Leu	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	13	12	NM_001195833	0	0	0	0	0	B4DPG5	Missense_Mutation	SNP	ENST00000591812.1	37	CCDS59386.1	1421	0.6506410256410257	458	0.9308943089430894	225	0.6215469613259669	401	0.701048951048951	337	0.4445910290237467	G	17.17	3.320891	0.60634	0.877637	0.541778	ENSG00000187994	ENST00000340740;ENST00000536520	T	0.28454	1.61	4.57	3.53	0.40419	Vacuolar sorting protein 9 (1);	0.269737	0.35235	N	0.003350	T	0.00012	0.0000	M	0.67700	2.07	0.21553	P	0.999649277	B;B	0.21225	0.053;0.053	B;B	0.22152	0.038;0.038	T	0.17776	-1.0358	9	0.72032	D	0.01	-26.0247	8.5759	0.33598	0.1063:0.0:0.8937:0.0	rs8110393;rs61482706	402;288	B4DPG5;Q6ZS11	.;RINL_HUMAN	L	288	ENSP00000340369:P288L	ENSP00000340369:P288L	P	-	2	0	RINL	44052560	1.000000	0.71417	0.987000	0.45799	0.313000	0.28021	4.771000	0.62318	1.273000	0.44346	0.407000	0.27541	CCC	G|0.349;A|0.651		0.781	RINL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460433.1	NM_198445	
ZNF230	7773	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	19	44515611	44515611	+	Missense_Mutation	SNP	A	A	T			TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr19:44515611A>T	ENST00000429154.2	+	5	1648	c.1420A>T	c.(1420-1422)Atg>Ttg	p.M474L		NM_006300.3	NP_006291.2	Q9UIE0	ZN230_HUMAN	zinc finger protein 230	474					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(10)|skin(1)|stomach(3)|urinary_tract(2)	22		Prostate(69;0.0352)				tttaaatgatatgtaagttgt	0.299																																					p.M474L	GBM(175;914 2069 22996 47111 52600)	.											.	ZNF230-90	0			c.A1420T						.						12.0	14.0	13.0					19																	44515611		2152	4249	6401	SO:0001583	missense	7773	exon5			AATGATATGTAAG	U95044	CCDS33044.1	19q13.31	2013-01-08				ENSG00000159882		"""Zinc fingers, C2H2-type"", ""-"""	13024	protein-coding gene	gene with protein product							Standard	NM_006300		Approved	FDZF2	uc002oyb.1	Q9UIE0		ENST00000429154.2:c.1420A>T	19.37:g.44515611A>T	ENSP00000409318:p.Met474Leu	Somatic	15	0		WXS	Illumina GAIIx	Phase_I	18	6	NM_006300	0	0	4	4	0	O15322|Q504X7|Q86W84|Q9P1U6	Missense_Mutation	SNP	ENST00000429154.2	37	CCDS33044.1	.	.	.	.	.	.	.	.	.	.	A	2.699	-0.271507	0.05716	.	.	ENSG00000159882	ENST00000429154	T	0.04049	3.72	1.32	-1.01	0.10169	.	.	.	.	.	T	0.02193	0.0068	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.01281	0.0	T	0.47548	-0.9109	9	0.23891	T	0.37	.	4.2333	0.10613	0.496:0.0:0.504:0.0	.	474	Q9UIE0	ZN230_HUMAN	L	474	ENSP00000409318:M474L	ENSP00000409318:M474L	M	+	1	0	ZNF230	49207451	0.000000	0.05858	0.000000	0.03702	0.077000	0.17291	-0.095000	0.11077	-0.420000	0.07427	0.358000	0.22013	ATG	.		0.299	ZNF230-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460456.1		
TPRX1	284355	broad.mit.edu	37	19	48305622	48305622	+	Missense_Mutation	SNP	A	A	G	rs201007421		TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr19:48305622A>G	ENST00000322175.3	-	2	801	c.646T>C	c.(646-648)Tca>Cca	p.S216P	TPRX1_ENST00000543508.1_Missense_Mutation_p.S206P|TPRX1_ENST00000535759.1_Missense_Mutation_p.S313P	NM_198479.2	NP_940881.2	Q8N7U7	TPRX1_HUMAN	tetra-peptide repeat homeobox 1	216	Gly-rich.					nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(5)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)|skin(1)	18		all_cancers(25;3.02e-09)|all_epithelial(76;7e-07)|all_lung(116;2.48e-06)|Lung NSC(112;5.15e-06)|Ovarian(192;0.0139)|all_neural(266;0.0146)|Breast(70;0.133)		OV - Ovarian serous cystadenocarcinoma(262;0.000241)|all cancers(93;0.00036)|Epithelial(262;0.0127)|GBM - Glioblastoma multiforme(486;0.048)		tttgggcctgagattgggcct	0.667																																					p.S216P	Esophageal Squamous(123;175 2281 3051 32395)	.											.	TPRX1-90	0			c.T646C						.																																			SO:0001583	missense	284355	exon2			GGCCTGAGATTGG		CCDS33066.1	19q13.33	2011-07-08			ENSG00000178928	ENSG00000178928		"""Homeoboxes / PRD class"""	32174	protein-coding gene	gene with protein product		611166					Standard	XM_005258788		Approved	FLJ40321	uc002php.2	Q8N7U7		ENST00000322175.3:c.646T>C	19.37:g.48305622A>G	ENSP00000323455:p.Ser216Pro	Somatic	26	2		WXS	Illumina GAIIx	Phase_I	25	4	NM_198479	0	0	1	1	0	A5D8Y3|B2RPL5	Missense_Mutation	SNP	ENST00000322175.3	37	CCDS33066.1	.	.	.	.	.	.	.	.	.	.	g	0.006	-2.036234	0.00406	.	.	ENSG00000178928	ENST00000322175;ENST00000535759;ENST00000543508	T;T;T	0.19250	2.16;2.16;2.16	0.365	-0.73	0.11154	.	.	.	.	.	T	0.07324	0.0185	N	0.14661	0.345	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.40701	-0.9549	8	0.02654	T	1	.	.	.	.	.	216	Q8N7U7	TPRX1_HUMAN	P	216;313;206	ENSP00000323455:S216P;ENSP00000438832:S313P;ENSP00000438712:S206P	ENSP00000323455:S216P	S	-	1	0	TPRX1	52997434	0.003000	0.15002	0.000000	0.03702	0.000000	0.00434	0.826000	0.27407	-2.735000	0.00382	-2.728000	0.00130	TCA	.		0.667	TPRX1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409868.1	NM_198479	
NTN5	126147	hgsc.bcm.edu	37	19	49164952	49164952	+	Silent	SNP	A	A	G	rs281392	byFrequency	TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr19:49164952A>G	ENST00000270235.4	-	7	1547	c.1452T>C	c.(1450-1452)agT>agC	p.S484S	SEC1P_ENST00000430145.2_RNA	NM_145807.1	NP_665806.1	Q8WTR8	NET5_HUMAN	netrin 5	484						extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|pancreas(1)|prostate(1)	10						CCGGCCTGGGACTGGGTGTGG	0.687													G|||	2669	0.532947	0.351	0.4669	5008	,	,		9559	0.5625		0.6421	False		,,,				2504	0.683				p.S484S		.											.	NTN5-136	0			c.T1452C						.	G		1663,2349		390,883,733	9.0	9.0	9.0		1452	2.2	0.0	19	dbSNP_79	9	5217,2785		1816,1585,600	no	coding-synonymous	NTN5	NM_145807.1		2206,2468,1333	GG,GA,AA		34.8038,41.4506,42.7335		484/490	49164952	6880,5134	2006	4001	6007	SO:0001819	synonymous_variant	126147	exon7			CCTGGGACTGGGT		CCDS33068.1	19q13.33	2013-03-01			ENSG00000142233	ENSG00000142233		"""Netrins"""	25208	protein-coding gene	gene with protein product	"""Netrin-5"""					12477932	Standard	NM_145807		Approved		uc002pkb.3	Q8WTR8		ENST00000270235.4:c.1452T>C	19.37:g.49164952A>G		Somatic	2	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_145807	0	0	0	0	0	Q8N4X9|Q8WU63	Silent	SNP	ENST00000270235.4	37	CCDS33068.1																																																																																			A|0.464;G|0.536		0.687	NTN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466176.1	NM_145807	
IZUMO1	284359	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	49245556	49245556	+	Silent	SNP	C	C	T			TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr19:49245556C>T	ENST00000332955.2	-	7	1057	c.510G>A	c.(508-510)gtG>gtA	p.V170V	RASIP1_ENST00000222145.4_5'Flank	NM_182575.2	NP_872381.2	Q8IYV9	IZUM1_HUMAN	izumo sperm-egg fusion 1	170	Ig-like C2-type.				cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	acrosomal membrane (GO:0002080)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			endometrium(4)|kidney(3)|large_intestine(4)|lung(2)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	17		all_lung(116;0.000156)|Lung NSC(112;0.000251)|all_epithelial(76;0.000761)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000134)|all cancers(93;0.000348)|Epithelial(262;0.019)|GBM - Glioblastoma multiforme(486;0.022)		GAGGAACTTCCACATTCCGCT	0.502																																					p.V170V		.											.	IZUMO1-91	0			c.G510A						.						139.0	128.0	132.0					19																	49245556		2203	4300	6503	SO:0001819	synonymous_variant	284359	exon7			AACTTCCACATTC	BC034769	CCDS12732.1	19q13.33	2014-07-23			ENSG00000182264	ENSG00000182264		"""-"""	28539	protein-coding gene	gene with protein product	"""oocyte binding/fusion factor"""	609278				15759005, 18952059, 19658160, 22957301	Standard	NM_182575		Approved	IZUMO, MGC34799, OBF	uc002pkj.3	Q8IYV9	OTTHUMG00000183324	ENST00000332955.2:c.510G>A	19.37:g.49245556C>T		Somatic	99	0		WXS	Illumina GAIIx	Phase_I	94	75	NM_182575	0	0	0	5	5	Q6Q8P6|Q6Q8P7	Silent	SNP	ENST00000332955.2	37	CCDS12732.1																																																																																			.		0.502	IZUMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466189.1	NM_182575	
ZNF628	89887	hgsc.bcm.edu	37	19	55993260	55993260	+	Missense_Mutation	SNP	A	A	G	rs34864744	byFrequency	TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr19:55993260A>G	ENST00000598519.1	+	3	1253	c.700A>G	c.(700-702)Acc>Gcc	p.T234A	ZNF628_ENST00000391718.2_Missense_Mutation_p.T230A			Q5EBL2	ZN628_HUMAN	zinc finger protein 628	234	Pro-rich.			T -> A (in Ref. 2; AAH89449). {ECO:0000305}.	transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(1)|lung(2)	7	Breast(117;0.155)		BRCA - Breast invasive adenocarcinoma(297;0.18)|LUSC - Lung squamous cell carcinoma(43;0.193)	GBM - Glioblastoma multiforme(193;0.0531)		cgccccgggtaccgcctccgc	0.766													N|||	3815	0.761781	0.9387	0.732	5008	,	,		4719	0.4395		0.837	False		,,,				2504	0.7986				p.T234A		.											.	ZNF628-22	0			c.A700G						.						3.0	4.0	4.0					19																	55993260		1771	3509	5280	SO:0001583	missense	89887	exon3			CCGGGTACCGCCT	AF367249	CCDS33116.3	19q13.43	2013-01-08			ENSG00000197483	ENSG00000197483		"""Zinc fingers, C2H2-type"""	28054	protein-coding gene	gene with protein product	"""Zinc finger expressed in Embryonal cells and Certain adult organs"""	610671					Standard	NM_033113		Approved	ZEC, Zfp628	uc002qld.3	Q5EBL2	OTTHUMG00000150396	ENST00000598519.1:c.700A>G	19.37:g.55993260A>G	ENSP00000469591:p.Thr234Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_033113	0	0	0	1	1	Q86X34	Missense_Mutation	SNP	ENST00000598519.1	37	CCDS33116.3	1594	0.7298534798534798	448	0.9105691056910569	272	0.7513812154696132	259	0.4527972027972028	615	0.8113456464379947	.	0.001	-2.964343	0.00049	.	.	ENSG00000197483	ENST00000391718	T	0.08193	3.12	3.0	-0.723	0.11181	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.05852	-1.0860	8	0.25106	T	0.35	0.0335	6.0751	0.19911	0.3452:0.3167:0.3381:0.0	rs34864744	230	Q5EBL2	ZN628_HUMAN	A	230	ENSP00000375598:T230A	ENSP00000375598:T230A	T	+	1	0	ZNF628	60685072	0.324000	0.24652	0.001000	0.08648	0.007000	0.05969	-0.265000	0.08644	-0.261000	0.09405	-2.335000	0.00248	ACC	A|0.270;G|0.730		0.766	ZNF628-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317934.2	XM_058964	
ZNF787	126208	hgsc.bcm.edu	37	19	56599438	56599440	+	In_Frame_Del	DEL	TCG	TCG	-	rs5828672|rs71696054	byFrequency	TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	TCG	TCG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr19:56599438_56599440delTCG	ENST00000270459.3	-	3	1219_1221	c.1101_1103delCGA	c.(1099-1104)gacgag>gag	p.D367del		NM_001002836.2	NP_001002836	Q6DD87	ZN787_HUMAN	zinc finger protein 787	367					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|lung(2)|pancreas(1)	5		Colorectal(82;3.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0559)		GCCCGCGGCCTCGTCGTCGTCGT	0.778														4509	0.900359	0.9939	0.732	5008	,	,		3238	0.7252		0.9821	False		,,,				2504	0.9898				p.367_368del		.											.	ZNF787-69	0			c.1101_1103del						.																																			SO:0001651	inframe_deletion	126208	exon3			GCGGCCTCGTCGT	BC077728, AF000560	CCDS42634.1	19q13.42	2013-01-08				ENSG00000142409		"""Zinc fingers, C2H2-type"""	26998	protein-coding gene	gene with protein product							Standard	NM_001002836		Approved		uc010eth.1	Q6DD87		ENST00000270459.3:c.1101_1103delCGA	19.37:g.56599447_56599449delTCG	ENSP00000270459:p.Asp367del	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	10	NM_001002836	0	0	0	0	0	O00455	In_Frame_Del	DEL	ENST00000270459.3	37	CCDS42634.1																																																																																			.		0.778	ZNF787-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457498.1	NM_001002836	
ZNF814	730051	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	58385748	58385748	+	Missense_Mutation	SNP	G	G	A	rs145250945		TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr19:58385748G>A	ENST00000435989.2	-	3	1244	c.1010C>T	c.(1009-1011)gCt>gTt	p.A337V	ZNF814_ENST00000600634.1_Intron|ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000597832.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	337					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A337V(2)		NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						ACTGAAGCTAGCATATTTGCT	0.353																																					p.A337V		.											.	.	2	Substitution - Missense(2)	prostate(2)	c.C1010T						.						58.0	51.0	53.0					19																	58385748		692	1591	2283	SO:0001583	missense	730051	exon3			AAGCTAGCATATT		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.1010C>T	19.37:g.58385748G>A	ENSP00000410545:p.Ala337Val	Somatic	85	0		WXS	Illumina GAIIx	Phase_I	175	66	NM_001144989	0	0	3	3	0	A6NF35	Missense_Mutation	SNP	ENST00000435989.2	37	CCDS46212.1	.	.	.	.	.	.	.	.	.	.	.	3.777	-0.046344	0.07407	.	.	ENSG00000204514	ENST00000435989	T	0.15372	2.43	2.11	-4.21	0.03812	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.07728	0.0194	N	0.21142	0.635	0.09310	N	1	B	0.32781	0.384	B	0.18561	0.022	T	0.05649	-1.0872	9	0.66056	D	0.02	.	3.5015	0.07674	0.0936:0.1206:0.3016:0.4843	.	337	B7Z6K7	ZN814_HUMAN	V	337	ENSP00000410545:A337V	ENSP00000410545:A337V	A	-	2	0	ZNF814	63077560	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-2.230000	0.01207	-3.525000	0.00147	-3.867000	0.00017	GCT	.		0.353	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
ZNF814	730051	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	58385762	58385762	+	Silent	SNP	C	C	G	rs199732634		TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr19:58385762C>G	ENST00000435989.2	-	3	1230	c.996G>C	c.(994-996)tcG>tcC	p.S332S	ZNF814_ENST00000600634.1_Intron|ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000597832.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	332					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S332S(2)		NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						ATTTGCTAAACGATTTCCCAC	0.358																																					p.S332S		.											.	.	2	Substitution - coding silent(2)	kidney(2)	c.G996C						.						25.0	25.0	25.0					19																	58385762		692	1589	2281	SO:0001819	synonymous_variant	730051	exon3			GCTAAACGATTTC		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.996G>C	19.37:g.58385762C>G		Somatic	80	1		WXS	Illumina GAIIx	Phase_I	158	52	NM_001144989	0	0	3	3	0	A6NF35	Silent	SNP	ENST00000435989.2	37	CCDS46212.1																																																																																			.		0.358	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
ATL2	64225	bcgsc.ca;mdanderson.org	37	2	38604351	38604351	+	Missense_Mutation	SNP	A	A	G	rs3731847	byFrequency	TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr2:38604351A>G	ENST00000378954.4	-	1	53	c.52T>C	c.(52-54)Tgg>Cgg	p.W18R	ATL2_ENST00000452935.2_5'Flank|ATL2_ENST00000332337.4_5'Flank|ATL2_ENST00000402054.1_5'Flank|ATL2_ENST00000406122.1_5'UTR|ATL2_ENST00000546051.1_5'Flank|ATL2_ENST00000419554.2_Missense_Mutation_p.W18R|ATL2_ENST00000539122.1_5'UTR	NM_001135673.1|NM_022374.2	NP_001129145.1|NP_071769.2	Q8NHH9	ATLA2_HUMAN	atlastin GTPase 2	18			W -> R (in dbSNP:rs3731847). {ECO:0000269|Ref.1}.		endoplasmic reticulum organization (GO:0007029)|Golgi organization (GO:0007030)|GTP catabolic process (GO:0006184)|protein homooligomerization (GO:0051260)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	22						CGCCGGCGCCACAGCCCCTGG	0.682													G|||	2472	0.49361	0.82	0.3934	5008	,	,		7916	0.1974		0.4056	False		,,,				2504	0.5194				p.W18R		.											.	ATL2-228	0			c.T52C						.	G	ARG/TRP,ARG/TRP	3238,1160		1209,820,170	18.0	23.0	22.0		52,52	0.4	1.0	2	dbSNP_107	22	3347,5239		606,2135,1552	no	missense,missense	ATL2	NM_001135673.1,NM_022374.2	101,101	1815,2955,1722	GG,GA,AA		38.9821,26.3756,49.2837	benign,benign	18/584,18/580	38604351	6585,6399	2199	4293	6492	SO:0001583	missense	64225	exon1			GGCGCCACAGCCC		CCDS1795.1, CCDS46260.1	2p22.3	2008-09-17	2008-09-17	2008-09-17	ENSG00000119787	ENSG00000119787			24047	protein-coding gene	gene with protein product		609368	"""ADP-ribosylation factor-like 6 interacting protein 2"""	ARL6IP2		10508919, 18270207	Standard	NM_022374		Approved		uc002rqq.3	Q8NHH9	OTTHUMG00000102074	ENST00000378954.4:c.52T>C	2.37:g.38604351A>G	ENSP00000368237:p.Trp18Arg	Somatic	24	1		WXS	Illumina GAIIx	Phase_I	116	103	NM_001135673	0	0	0	38	38	B7Z1X2|B7Z7X8|Q4ZG30|Q7Z630|Q8NHH8|Q9H5M7	Missense_Mutation	SNP	ENST00000378954.4	37	CCDS46260.1	963	0.4409340659340659	398	0.8089430894308943	148	0.4088397790055249	113	0.19755244755244755	304	0.40105540897097625	G	2.842	-0.240149	0.05944	0.736244	0.389821	ENSG00000119787	ENST00000378954;ENST00000419554;ENST00000449130;ENST00000451483	T;T;D;T	0.84070	-1.19;-1.23;-1.8;2.58	3.78	0.417	0.16421	.	0.332033	0.20851	N	0.084527	T	0.00012	0.0000	N	0.02916	-0.46	0.09310	P	0.9999999999927123	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.38650	-0.9651	9	0.20046	T	0.44	-1.5765	0.6089	0.00757	0.2367:0.1829:0.3778:0.2026	rs3731847;rs59791873	18;18	Q8NHH9-2;Q8NHH9	.;ATLA2_HUMAN	R	18	ENSP00000368237:W18R;ENSP00000415336:W18R;ENSP00000409811:W18R;ENSP00000404921:W18R	ENSP00000368237:W18R	W	-	1	0	ATL2	38457855	1.000000	0.71417	0.998000	0.56505	0.029000	0.11900	1.309000	0.33539	0.006000	0.14734	-0.755000	0.03482	TGG	A|0.523;G|0.477		0.682	ATL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219886.2	NM_022374	
WDPCP	51057	broad.mit.edu	37	2	63631285	63631285	+	Missense_Mutation	SNP	C	C	G	rs61734466	byFrequency	TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr2:63631285C>G	ENST00000272321.7	-	10	1860	c.1333G>C	c.(1333-1335)Gct>Cct	p.A445P	WDPCP_ENST00000409120.1_Missense_Mutation_p.A253P|WDPCP_ENST00000409199.1_Missense_Mutation_p.A253P|WDPCP_ENST00000409562.3_Missense_Mutation_p.A445P|WDPCP_ENST00000409835.1_5'UTR|WDPCP_ENST00000398544.3_Missense_Mutation_p.A286P	NM_015910.5	NP_056994.3	O95876	FRITZ_HUMAN	WD repeat containing planar cell polarity effector	445					auditory receptor cell morphogenesis (GO:0002093)|camera-type eye development (GO:0043010)|cardiovascular system development (GO:0072358)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|digestive system development (GO:0055123)|embryonic digit morphogenesis (GO:0042733)|establishment of protein localization (GO:0045184)|glomerular visceral epithelial cell migration (GO:0090521)|kidney development (GO:0001822)|palate development (GO:0060021)|regulation of embryonic cell shape (GO:0016476)|regulation of establishment of cell polarity (GO:2000114)|regulation of fibroblast migration (GO:0010762)|regulation of focal adhesion assembly (GO:0051893)|regulation of protein localization (GO:0032880)|regulation of ruffle assembly (GO:1900027)|respiratory system development (GO:0060541)|septin cytoskeleton organization (GO:0032185)|smoothened signaling pathway (GO:0007224)	axonemal basal plate (GO:0097541)|axoneme (GO:0005930)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(19)|ovary(1)|skin(1)	35						ACCTGAGGAGCTATCCATTGC	0.438													C|||	11	0.00219649	0.0008	0.0	5008	,	,		18565	0.0		0.0099	False		,,,				2504	0.0				p.A445P		.											.	WDPCP-91	0			c.G1333C						.	C	PRO/ALA	6,3816		0,6,1905	102.0	98.0	99.0		1333	4.7	1.0	2	dbSNP_129	99	81,8185		0,81,4052	yes	missense	WDPCP	NM_015910.5	27	0,87,5957	GG,GC,CC		0.9799,0.157,0.7197	benign	445/747	63631285	87,12001	1911	4133	6044	SO:0001583	missense	51057	exon10			GAGGAGCTATCCA		CCDS42688.1, CCDS46301.1	2p15	2014-04-24	2011-02-01	2011-02-01	ENSG00000143951	ENSG00000143951			28027	protein-coding gene	gene with protein product		613580	"""chromosome 2 open reading frame 86"""	C2orf86		15654087, 20671153	Standard	NM_015910		Approved	hFrtz, fritz, BBS15	uc002sch.3	O95876	OTTHUMG00000152566	ENST00000272321.7:c.1333G>C	2.37:g.63631285C>G	ENSP00000272321:p.Ala445Pro	Somatic	115	0		WXS	Illumina GAIIx	Phase_I	128	4	NM_015910	0	0	6	6	0	Q53RW4|Q7Z2Z3	Missense_Mutation	SNP	ENST00000272321.7	37	CCDS42688.1	9	0.004120879120879121	0	0.0	0	0.0	0	0.0	9	0.011873350923482849	C	13.25	2.181795	0.38511	0.00157	0.009799	ENSG00000143951	ENST00000272321;ENST00000409199;ENST00000409120;ENST00000398544;ENST00000409562	T;T;T;T;T	0.46819	0.86;0.86;0.86;0.86;0.86	5.52	4.65	0.58169	.	0.077685	0.53938	D	0.000056	T	0.47488	0.1448	L	0.45137	1.4	0.45025	D	0.998049	B;D;B;B	0.57571	0.015;0.98;0.076;0.012	B;P;B;B	0.58331	0.028;0.837;0.047;0.005	T	0.50676	-0.8800	10	0.38643	T	0.18	-2.9295	14.6453	0.68756	0.0:0.9297:0.0:0.0703	rs61734466	253;445;445;286	E9PFG9;O95876-2;O95876;O95876-3	.;.;FRITZ_HUMAN;.	P	445;253;253;286;445	ENSP00000272321:A445P;ENSP00000386592:A253P;ENSP00000386769:A253P;ENSP00000381552:A286P;ENSP00000387222:A445P	ENSP00000272321:A445P	A	-	1	0	WDPCP	63484789	1.000000	0.71417	0.999000	0.59377	0.852000	0.48524	2.209000	0.42806	1.466000	0.48025	0.591000	0.81541	GCT	C|0.975;G|0.025		0.438	WDPCP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326820.1	NM_015910	
SOWAHC	65124	hgsc.bcm.edu	37	2	110372192	110372192	+	Silent	SNP	A	A	G	rs6594048		TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr2:110372192A>G	ENST00000356454.3	+	1	282	c.126A>G	c.(124-126)ctA>ctG	p.L42L	SEPT10_ENST00000397714.2_5'Flank|SEPT10_ENST00000334001.6_5'Flank|SEPT10_ENST00000397712.2_5'Flank|SEPT10_ENST00000415095.1_5'Flank|SEPT10_ENST00000437928.1_5'Flank|SEPT10_ENST00000545389.1_5'Flank|SEPT10_ENST00000356688.4_5'Flank	NM_023016.3	NP_075392.2	Q53LP3	SWAHC_HUMAN	sosondowah ankyrin repeat domain family member C	42																	GGGGCGCCCTAGGCGGCGAAC	0.771													G|||	5008	1.0	1.0	1.0	5008	,	,		6158	1.0		1.0	False		,,,				2504	1.0				p.L42L		.											.	.	0			c.A126G						.						1.0	2.0	2.0					2																	110372192		1239	2477	3716	SO:0001819	synonymous_variant	65124	exon1			CGCCCTAGGCGGC	AK023346	CCDS33270.1	2q13	2013-01-10	2012-01-12	2012-01-12	ENSG00000198142	ENSG00000198142		"""Ankyrin repeat domain containing"""	26149	protein-coding gene	gene with protein product			"""ankyrin repeat domain 57"""	C2orf26, ANKRD57		22234889	Standard	NM_023016		Approved	FLJ21870	uc002tfb.3	Q53LP3	OTTHUMG00000153219	ENST00000356454.3:c.126A>G	2.37:g.110372192A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_023016	0	0	0	1	1	Q8NE15|Q9H6U1	Silent	SNP	ENST00000356454.3	37	CCDS33270.1																																																																																			A|0.029;G|0.971		0.771	SOWAHC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330168.1	NM_023016	
LRP1B	53353	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	141298589	141298589	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr2:141298589C>A	ENST00000389484.3	-	45	8437	c.7466G>T	c.(7465-7467)tGt>tTt	p.C2489F		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	2489	EGF-like 10. {ECO:0000255|PROSITE- ProRule:PRU00076}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TCTGCAGGAACAATTCACTCT	0.413										TSP Lung(27;0.18)																											p.C2489F	Colon(99;50 2074 2507 20106)	.											.	LRP1B-311	0			c.G7466T						.						158.0	146.0	150.0					2																	141298589		2203	4300	6503	SO:0001583	missense	53353	exon45			CAGGAACAATTCA	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.7466G>T	2.37:g.141298589C>A	ENSP00000374135:p.Cys2489Phe	Somatic	115	2		WXS	Illumina GAIIx	Phase_I	77	62	NM_018557	0	0	0	0	0	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.251318	0.80135	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.93247	-3.19	5.93	5.93	0.95920	Epidermal growth factor-like (1);	0.000000	0.85682	D	0.000000	D	0.98040	0.9354	H	0.96142	3.775	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	D	0.98512	1.0619	10	0.87932	D	0	.	20.3409	0.98764	0.0:1.0:0.0:0.0	.	2489	Q9NZR2	LRP1B_HUMAN	F	2489;2427	ENSP00000374135:C2489F	ENSP00000374135:C2489F	C	-	2	0	LRP1B	141015059	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.697000	0.84279	2.814000	0.96858	0.655000	0.94253	TGT	.		0.413	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
SP5	389058	hgsc.bcm.edu	37	2	171573185	171573185	+	Silent	SNP	G	G	T	rs1134626	byFrequency	TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr2:171573185G>T	ENST00000375281.3	+	2	630	c.468G>T	c.(466-468)ccG>ccT	p.P156P	AC007405.2_ENST00000409786.1_5'Flank	NM_001003845.2	NP_001003845.1	Q6BEB4	SP5_HUMAN	Sp5 transcription factor	156					bone morphogenesis (GO:0060349)|post-anal tail morphogenesis (GO:0036342)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)	p.P156P(1)		NS(1)|endometrium(2)|lung(1)|prostate(1)	5						CCGCGCTGCCGCCAGGCTACT	0.751													G|||	1034	0.20647	0.0242	0.2017	5008	,	,		6711	0.1815		0.3579	False		,,,				2504	0.3262				p.P156P		.											.	SP5-90	1	Substitution - coding silent(1)	NS(1)	c.G468T						.	G		219,2535		16,187,1174	5.0	6.0	6.0		468	-7.5	0.4	2	dbSNP_86	6	2090,4520		318,1454,1533	no	coding-synonymous	SP5	NM_001003845.2		334,1641,2707	TT,TG,GG		31.6188,7.9521,24.6583		156/399	171573185	2309,7055	1377	3305	4682	SO:0001819	synonymous_variant	389058	exon2			GCTGCCGCCAGGC		CCDS33322.1	2q31	2013-01-08			ENSG00000204335	ENSG00000204335		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	14529	protein-coding gene	gene with protein product		609391					Standard	NM_001003845		Approved		uc002uge.3	Q6BEB4	OTTHUMG00000154053	ENST00000375281.3:c.468G>T	2.37:g.171573185G>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	10	NM_001003845	0	0	0	1	1		Silent	SNP	ENST00000375281.3	37	CCDS33322.1																																																																																			G|0.766;T|0.234		0.751	SP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333670.1	XM_371581	
UNC80	285175	broad.mit.edu	37	2	210683895	210683895	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr2:210683895C>A	ENST00000439458.1	+	12	1952	c.1872C>A	c.(1870-1872)gaC>gaA	p.D624E	UNC80_ENST00000272845.6_Missense_Mutation_p.D624E	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	624					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						GCCTCACAGACTCCTGCATAA	0.458																																					p.D624E		.											.	UNC80-90	0			c.C1872A						.						93.0	77.0	82.0					2																	210683895		692	1591	2283	SO:0001583	missense	285175	exon12			CACAGACTCCTGC	AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.1872C>A	2.37:g.210683895C>A	ENSP00000391088:p.Asp624Glu	Somatic	160	0		WXS	Illumina GAIIx	Phase_I	155	3	NM_182587	0	0	0	0	0	B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Missense_Mutation	SNP	ENST00000439458.1	37	CCDS46504.1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.593008	0.86953	.	.	ENSG00000144406	ENST00000439458;ENST00000272845	T;T	0.51574	0.7;0.7	5.76	5.76	0.90799	.	.	.	.	.	T	0.53674	0.1811	L	0.27053	0.805	0.80722	D	1	D	0.61697	0.99	D	0.75484	0.986	T	0.56032	-0.8046	9	0.72032	D	0.01	-8.1448	10.3866	0.44143	0.0:0.8552:0.0:0.1448	.	624	Q8N2C7	UNC80_HUMAN	E	624	ENSP00000391088:D624E;ENSP00000272845:D624E	ENSP00000272845:D624E	D	+	3	2	UNC80	210392140	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.730000	0.47335	2.715000	0.92844	0.563000	0.77884	GAC	.		0.458	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_182587	
AGXT	189	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	241812461	241812461	+	Missense_Mutation	SNP	G	G	A	rs34664134	byFrequency	TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr2:241812461G>A	ENST00000307503.3	+	5	977	c.590G>A	c.(589-591)cGg>cAg	p.R197Q		NM_000030.2	NP_000021.1	P21549	SPYA_HUMAN	alanine-glyoxylate aminotransferase	197					cellular nitrogen compound metabolic process (GO:0034641)|glycine biosynthetic process, by transamination of glyoxylate (GO:0019265)|glyoxylate catabolic process (GO:0009436)|glyoxylate metabolic process (GO:0046487)|L-alanine catabolic process (GO:0042853)|L-cysteine catabolic process (GO:0019448)|oxalic acid secretion (GO:0046724)|pyruvate biosynthetic process (GO:0042866)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	alanine-glyoxylate transaminase activity (GO:0008453)|amino acid binding (GO:0016597)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)|receptor binding (GO:0005102)|serine-pyruvate transaminase activity (GO:0004760)|transaminase activity (GO:0008483)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)	18		all_epithelial(40;1.61e-15)|Breast(86;2.35e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;8.14e-32)|all cancers(36;4.77e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;4.88e-06)|Lung(119;0.000452)|LUSC - Lung squamous cell carcinoma(224;0.00415)|Colorectal(34;0.021)|COAD - Colon adenocarcinoma(134;0.15)	Glycine(DB00145)|L-Alanine(DB00160)|L-Serine(DB00133)	TACATGGACCGGCAAGGTAAG	0.657													A|||	130	0.0259585	0.0	0.0	5008	,	,		17204	0.0843		0.001	False		,,,				2504	0.045				p.R197Q		.											.	AGXT-90	0			c.G590A						.	A	GLN/ARG	3,4403	825.4+/-416.5	0,3,2200	71.0	69.0	70.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	590	4.1	1.0	2	dbSNP_126	70	6,8594	818.9+/-406.8	0,6,4294	yes	missense	AGXT	NM_000030.2	43	0,9,6494	AA,AG,GG		0.0698,0.0681,0.0692	benign	197/393	241812461	9,12997	2203	4300	6503	SO:0001583	missense	189	exon5			TGGACCGGCAAGG	D13368	CCDS2543.1	2q37.3	2008-02-05	2007-04-13		ENSG00000172482	ENSG00000172482	2.6.1.44, 2.6.1.51		341	protein-coding gene	gene with protein product	"""oxalosis I"", ""primary hyperoxaluria type 1"", ""L-alanine: glyoxylate aminotransferase 1"", ""serine:pyruvate aminotransferase"", ""glycolicaciduria"""	604285		SPAT		2039493, 2045108	Standard	NM_000030		Approved	AGXT1, PH1, AGT, SPT, AGT1	uc002waa.4	P21549	OTTHUMG00000133354	ENST00000307503.3:c.590G>A	2.37:g.241812461G>A	ENSP00000302620:p.Arg197Gln	Somatic	72	0		WXS	Illumina GAIIx	Phase_I	45	37	NM_000030	0	0	0	0	0	Q53QU6	Missense_Mutation	SNP	ENST00000307503.3	37	CCDS2543.1	51	0.023351648351648352	0	0.0	0	0.0	50	0.08741258741258741	1	0.0013192612137203166	A	9.321	1.058142	0.19987	6.81E-4	6.98E-4	ENSG00000172482	ENST00000307503	D	0.90788	-2.73	4.14	4.14	0.48551	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);Aminotransferase, class V/Cysteine desulfurase (1);	0.536026	0.20684	N	0.087595	T	0.09379	0.0231	N	0.01009	-1.055	0.09310	N	0.999993	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.0	T	0.35051	-0.9804	10	0.23302	T	0.38	-17.0156	9.2238	0.37393	0.9108:0.0:0.0892:0.0	rs34664134	197;197	B7Z548;P21549	.;SPYA_HUMAN	Q	197	ENSP00000302620:R197Q	ENSP00000302620:R197Q	R	+	2	0	AGXT	241461134	1.000000	0.71417	1.000000	0.80357	0.694000	0.40290	3.540000	0.53611	0.471000	0.27319	-0.351000	0.07748	CGG	G|0.993;A|0.007		0.657	AGXT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257186.1	NM_000030	
FAM182B	728882	ucsc.edu	37	20	25755562	25755562	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr20:25755562A>C	ENST00000376403.1	-	3	772	c.394T>G	c.(394-396)Tgg>Ggg	p.W132G	FAM182B_ENST00000376404.2_Intron|FAM182B_ENST00000478164.1_Intron			Q5T319	F182B_HUMAN	family with sequence similarity 182, member B	132										lung(1)	1						TCCTGGGACCACTCCGGCCCC	0.716																																					.		.											.	.	0			.						.																																			SO:0001583	missense	728882	.			GGGACCACTCCGG			20p11.1	2010-07-14			ENSG00000175170	ENSG00000175170			34503	pseudogene	pseudogene							Standard	NR_027061		Approved			Q5T319	OTTHUMG00000032136	ENST00000376403.1:c.394T>G	20.37:g.25755562A>C	ENSP00000365585:p.Trp132Gly	Somatic	19	0		WXS	Illumina GAIIx	Phase_I	67	8	.	0	0	0	0	0	Q4G0Q1	RNA	SNP	ENST00000376403.1	37		.	.	.	.	.	.	.	.	.	.	.	0.433	-0.902472	0.02453	.	.	ENSG00000175170	ENST00000376403	.	.	.	.	.	.	.	.	.	.	.	T	0.39036	0.1063	.	.	.	0.09310	N	0.999997	.	.	.	.	.	.	T	0.39210	-0.9625	3	0.87932	D	0	.	.	.	.	.	.	.	.	G	132	.	ENSP00000365585:W132G	W	-	1	0	FAM182B	25703562	0.019000	0.18553	0.149000	0.22428	0.150000	0.21749	-1.161000	0.03144	0.056000	0.16144	0.055000	0.15244	TGG	.		0.716	FAM182B-003	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000078463.2	NR_026714	
DNTTIP1	116092	hgsc.bcm.edu	37	20	44420682	44420682	+	Silent	SNP	T	T	C	rs2664591	byFrequency	TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr20:44420682T>C	ENST00000372622.3	+	1	107	c.39T>C	c.(37-39)ccT>ccC	p.P13P	WFDC3_ENST00000372632.2_5'Flank|WFDC3_ENST00000481847.1_5'Flank|WFDC3_ENST00000372630.2_5'Flank|WFDC3_ENST00000243938.4_5'Flank	NM_052951.2	NP_443183.1	Q9H147	TDIF1_HUMAN	deoxynucleotidyltransferase, terminal, interacting protein 1	13						nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)	9		Myeloproliferative disorder(115;0.0122)				CGCGGGGACCTAGCGGGGCCG	0.746													C|||	3358	0.670527	0.6952	0.7968	5008	,	,		12080	0.6458		0.7058	False		,,,				2504	0.5368				p.P13P		.											.	DNTTIP1-91	0			c.T39C						.	C		2483,791		949,585,103	4.0	6.0	5.0		39	1.1	0.9	20	dbSNP_100	5	5222,1736		1983,1256,240	no	coding-synonymous	DNTTIP1	NM_052951.2		2932,1841,343	CC,CT,TT		24.9497,24.16,24.697		13/330	44420682	7705,2527	1637	3479	5116	SO:0001819	synonymous_variant	116092	exon1			GGGACCTAGCGGG	AB035676	CCDS13369.1	20q13.12	2003-09-10	2003-09-10	2003-09-12	ENSG00000101457	ENSG00000101457			16160	protein-coding gene	gene with protein product	"""novel protein similar to synaptotagmin 1 (SYT1, P65) (isoform 1)"", ""TdT binding protein"""	611388	"""chromosome 20 open reading frame 167"""	C20orf167		11473582	Standard	NM_052951		Approved	dJ447F3.4, Tdif1	uc002xpk.3	Q9H147	OTTHUMG00000032610	ENST00000372622.3:c.39T>C	20.37:g.44420682T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	6	NM_052951	0	0	5	5	0	B2RA18|Q96DE3|Q9BQP2|Q9H148	Silent	SNP	ENST00000372622.3	37	CCDS13369.1																																																																																			T|0.311;C|0.689		0.746	DNTTIP1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079502.1	NM_052951	
RNF114	55905	bcgsc.ca	37	20	48562681	48562681	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr20:48562681C>T	ENST00000244061.2	+	4	409	c.407C>T	c.(406-408)cCa>cTa	p.P136L		NM_018683.3	NP_061153.1	Q9Y508	RN114_HUMAN	ring finger protein 114	136					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|protein ubiquitination (GO:0016567)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(1)|ovary(1)	5						AGGAATGTTCCAAACCGTTAC	0.408																																					p.P136L		.											.	RNF114-91	0			c.C407T						.						86.0	75.0	79.0					20																	48562681		2203	4300	6503	SO:0001583	missense	55905	exon4			ATGTTCCAAACCG	AF265215	CCDS33482.1	20q13	2013-01-09	2008-06-16	2008-06-16	ENSG00000124226	ENSG00000124226		"""RING-type (C3HC4) zinc fingers"""	13094	protein-coding gene	gene with protein product		612451	"""zinc finger protein 313"""	ZNF313		18364390	Standard	NM_018683		Approved	PSORS12	uc002xux.3	Q9Y508	OTTHUMG00000032709	ENST00000244061.2:c.407C>T	20.37:g.48562681C>T	ENSP00000244061:p.Pro136Leu	Somatic	84	2		WXS	Illumina GAIIx	Phase_I	127	56	NM_018683	0	0	0	0	0	B2RDQ9|B4DWY5|E1P627|Q6N0B0	Missense_Mutation	SNP	ENST00000244061.2	37	CCDS33482.1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.636682	0.87760	.	.	ENSG00000124226	ENST00000449816;ENST00000244061	T	0.81163	-1.46	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	D	0.90414	0.6999	M	0.82823	2.61	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.87949	0.2722	10	0.30078	T	0.28	-22.6498	19.1953	0.93686	0.0:1.0:0.0:0.0	.	136;136	Q9Y508-2;Q9Y508	.;RN114_HUMAN	L	136	ENSP00000244061:P136L	ENSP00000244061:P136L	P	+	2	0	RNF114	47996088	1.000000	0.71417	1.000000	0.80357	0.665000	0.39181	7.133000	0.77259	2.828000	0.97474	0.655000	0.94253	CCA	.		0.408	RNF114-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079663.1	NM_018683	
TMEM189-UBE2V1	387522	hgsc.bcm.edu	37	20	48770159	48770159	+	Missense_Mutation	SNP	T	T	C	rs232733		TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr20:48770159T>C	ENST00000341698.2	-	1	15	c.16A>G	c.(16-18)Aac>Gac	p.N6D	TMEM189_ENST00000371652.4_Missense_Mutation_p.N6D|TMEM189_ENST00000557021.1_Missense_Mutation_p.N6D|TMEM189_ENST00000371650.5_Missense_Mutation_p.N6D	NM_001257399.1	NP_001244328.1			TMEM189-UBE2V1 readthrough											breast(1)|endometrium(4)|large_intestine(6)|lung(6)	17			BRCA - Breast invasive adenocarcinoma(9;8.29e-07)			CCCGGCCAGTTCTCGGCGCCC	0.766													C|||	5008	1.0	1.0	1.0	5008	,	,		6103	1.0		1.0	False		,,,				2504	1.0				p.N6D		.											.	TMEM189-22	0			c.A16G						.						2.0	2.0	2.0					20																	48770159		1101	2248	3349	SO:0001583	missense	387521	exon1			GCCAGTTCTCGGC	U39361	CCDS13424.1	20q13.13	2011-05-31			ENSG00000124208	ENSG00000124208			33521	other	readthrough						11076860	Standard	NM_199203		Approved	Kua-UEV, CROC-1B	uc002xvf.3		OTTHUMG00000033085	ENST00000341698.2:c.16A>G	20.37:g.48770159T>C	ENSP00000344166:p.Asn6Asp	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_199129	0	0	0	12	12		Missense_Mutation	SNP	ENST00000341698.2	37	CCDS13424.1	2182	0.9990842490842491	492	1.0	360	0.994475138121547	572	1.0	758	1.0	C	0.054	-1.242740	0.01481	.	.	ENSG00000124208;ENSG00000240849;ENSG00000240849;ENSG00000240849	ENST00000341698;ENST00000557021;ENST00000371650;ENST00000371652	T;T;T;T	0.46819	0.86;0.86;1.11;1.11	3.81	0.707	0.18139	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.40757	-0.9546	8	0.02654	T	1	.	3.4688	0.07559	0.1731:0.5239:0.0:0.303	rs232733;rs674252;rs56654084	6;6;6	Q5TGE1;A5PLL7;G3V2F7	.;TM189_HUMAN;.	D	6	ENSP00000344166:N6D;ENSP00000450635:N6D;ENSP00000360713:N6D;ENSP00000360715:N6D	ENSP00000360713:N6D	N	-	1	0	TMEM189-UBE2V1;TMEM189	48203566	1.000000	0.71417	0.503000	0.27626	0.073000	0.16967	0.497000	0.22514	-0.274000	0.09232	-2.268000	0.00277	AAC	C|0.999;T|0.001		0.766	TMEM189-UBE2V1-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000080532.5		
COL9A3	1299	broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	61470085	61470085	+	Silent	SNP	C	C	T	rs376259511	byFrequency	TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr20:61470085C>T	ENST00000343916.3	+	31	1839	c.1836C>T	c.(1834-1836)gaC>gaT	p.D612D	COL9A3_ENST00000462700.1_3'UTR	NM_001853.3	NP_001844.3	Q14050	CO9A3_HUMAN	collagen, type IX, alpha 3	612	Triple-helical region 2 (COL2).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female gonad development (GO:0008585)|male gonad development (GO:0008584)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(1)|endometrium(3)|large_intestine(1)|lung(18)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	28	Breast(26;5.68e-08)					CAGGGCTGGACGGGCCTGAAG	0.587													C|||	2	0.000399361	0.0	0.0	5008	,	,		15584	0.0		0.0	False		,,,				2504	0.002				p.D612D		.											.	COL9A3-514	0			c.C1836T						.	C		0,4242		0,0,2121	48.0	37.0	41.0		1836	-3.7	1.0	20		41	1,8317		0,1,4158	no	coding-synonymous	COL9A3	NM_001853.3		0,1,6279	TT,TC,CC		0.012,0.0,0.0080		612/685	61470085	1,12559	2121	4159	6280	SO:0001819	synonymous_variant	1299	exon31			GCTGGACGGGCCT	AK075240	CCDS13505.1	20q13.3	2013-01-16			ENSG00000092758	ENSG00000092758		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2219	protein-coding gene	gene with protein product	"""collagen type IX proteoglycan"""	120270				8586434, 1429648	Standard	NM_001853		Approved	IDD, MED, EDM3, FLJ90759, DJ885L7.4.1	uc002ydm.3	Q14050	OTTHUMG00000032938	ENST00000343916.3:c.1836C>T	20.37:g.61470085C>T		Somatic	205	0		WXS	Illumina GAIIx	Phase_I	325	13	NM_001853	0	0	17	20	3	Q13681|Q9H4G9|Q9UPE2	Silent	SNP	ENST00000343916.3	37	CCDS13505.1																																																																																			.		0.587	COL9A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080071.2	NM_001853	
RTEL1	51750	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	62303930	62303930	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr20:62303930G>T	ENST00000360203.5	+	9	1046	c.721G>T	c.(721-723)Gac>Tac	p.D241Y	RTEL1_ENST00000508582.2_Missense_Mutation_p.D265Y|RTEL1_ENST00000318100.4_Missense_Mutation_p.D241Y|RTEL1_ENST00000370018.3_Missense_Mutation_p.D241Y|RTEL1-TNFRSF6B_ENST00000482936.1_Missense_Mutation_p.D241Y					regulator of telomere elongation helicase 1											NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_cancers(38;6.47e-12)|all_epithelial(29;3.75e-13)		Epithelial(9;1.25e-09)|all cancers(9;5.13e-09)|BRCA - Breast invasive adenocarcinoma(10;7.26e-05)|OV - Ovarian serous cystadenocarcinoma(5;0.00223)|Colorectal(105;0.107)			ACACAACATTGACCTGAAGGG	0.557																																					p.D265Y		.											.	RTEL1-44	0			c.G793T						.						87.0	63.0	71.0					20																	62303930		2203	4299	6502	SO:0001583	missense	51750	exon9			AACATTGACCTGA	AB029011	CCDS13530.2, CCDS13531.1, CCDS13530.3, CCDS63331.1, CCDS74751.1	20q13.3	2012-06-27	2004-10-29	2004-10-29	ENSG00000258366	ENSG00000258366			15888	protein-coding gene	gene with protein product		608833	"""chromosome 20 open reading frame 41"""	C20orf41		10655513, 15210109	Standard	NM_016434		Approved	bK3184A7.3, NHL, DKFZP434C013, KIAA1088, RTEL	uc011abd.2	Q9NZ71	OTTHUMG00000032992	ENST00000360203.5:c.721G>T	20.37:g.62303930G>T	ENSP00000353332:p.Asp241Tyr	Somatic	107	1		WXS	Illumina GAIIx	Phase_I	143	36	NM_032957	0	0	12	18	6		Missense_Mutation	SNP	ENST00000360203.5	37		.	.	.	.	.	.	.	.	.	.	g	17.62	3.434783	0.62955	.	.	ENSG00000258366	ENST00000370018;ENST00000318100;ENST00000508582;ENST00000360203;ENST00000356810	T;T;T;T;T	0.72725	-0.68;-0.68;-0.68;-0.68;-0.57	4.44	4.44	0.53790	DEAD2 (1);Helicase-like, DEXD box c2 type (1);Helicase, superfamily 1/2, ATP-binding domain, DinG/Rad3-type (1);	0.057183	0.64402	D	0.000001	D	0.87188	0.6115	M	0.91972	3.26	0.58432	D	0.999998	D;D;D;D	0.89917	1.0;0.994;0.999;0.997	D;D;D;D	0.76071	0.987;0.942;0.981;0.973	D	0.90565	0.4518	10	0.72032	D	0.01	-29.6548	17.0938	0.86628	0.0:0.0:1.0:0.0	.	265;265;241;241	Q9NZ71-7;D6RBA3;Q9NZ71;Q9NZ71-6	.;.;RTEL1_HUMAN;.	Y	241;241;265;241;291	ENSP00000359035:D241Y;ENSP00000322287:D241Y;ENSP00000424307:D265Y;ENSP00000353332:D241Y;ENSP00000349265:D291Y	ENSP00000349265:D291Y	D	+	1	0	AL353715.1	61774374	1.000000	0.71417	0.920000	0.36463	0.186000	0.23388	8.143000	0.89621	2.189000	0.69895	0.645000	0.84053	GAC	.		0.557	RTEL1-011	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000289781.1	NM_032957	
SLC5A3	6526	broad.mit.edu	37	21	35468284	35468284	+	Nonsense_Mutation	SNP	G	G	T			TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr21:35468284G>T	ENST00000381151.3	+	2	1299	c.787G>T	c.(787-789)Gga>Tga	p.G263*	AP000320.7_ENST00000362077.4_RNA|MRPS6_ENST00000399312.2_Intron|SLC5A3_ENST00000608209.1_Nonsense_Mutation_p.G263*			P53794	SC5A3_HUMAN	solute carrier family 5 (sodium/myo-inositol cotransporter), member 3	263					inositol metabolic process (GO:0006020)|peripheral nervous system development (GO:0007422)|regulation of respiratory gaseous exchange (GO:0043576)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	myo-inositol:sodium symporter activity (GO:0005367)			breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	20						TCCTTGGCCTGGATTCATTCT	0.473																																					p.G263X		.											.	SLC5A3-92	0			c.G787T						.						111.0	105.0	107.0					21																	35468284		2203	4300	6503	SO:0001587	stop_gained	6526	exon2			TGGCCTGGATTCA		CCDS33549.1	21q22.11	2013-05-22	2008-09-02		ENSG00000198743	ENSG00000198743		"""Solute carriers"""	11038	protein-coding gene	gene with protein product		600444	"""solute carrier family 5 (inositol transporter), member 3"""			7789985	Standard	NM_006933		Approved	SMIT, SMIT1	uc002yto.3	P53794	OTTHUMG00000065821	ENST00000381151.3:c.787G>T	21.37:g.35468284G>T	ENSP00000370543:p.Gly263*	Somatic	154	0		WXS	Illumina GAIIx	Phase_I	127	5	NM_006933	0	0	12	12	0	O43489	Nonsense_Mutation	SNP	ENST00000381151.3	37	CCDS33549.1	.	.	.	.	.	.	.	.	.	.	G	40	8.316016	0.98757	.	.	ENSG00000198743	ENST00000381151	.	.	.	5.72	5.72	0.89469	.	0.057455	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	18.663	0.91478	0.0:0.0:1.0:0.0	.	.	.	.	X	263	.	ENSP00000370543:G263X	G	+	1	0	SLC5A3	34390154	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.699000	0.92147	0.609000	0.83330	GGA	.		0.473	SLC5A3-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000141037.1		
KRTAP10-4	386672	ucsc.edu	37	21	45993851	45993851	+	Silent	SNP	C	C	T	rs201895065		TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr21:45993851C>T	ENST00000400374.3	+	1	246	c.216C>T	c.(214-216)tgC>tgT	p.C72C	TSPEAR_ENST00000397916.1_5'Flank|TSPEAR_ENST00000323084.4_Intron	NM_198687.1	NP_941960.1	P60372	KR104_HUMAN	keratin associated protein 10-4	72	36 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				NS(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(9)|pancreas(1)|prostate(1)	18						CAGTGACCTGCGAGCCCAGCC	0.721																																					p.C72C		.											.	KRTAP10-4-90	0			c.C216T						.						20.0	38.0	32.0					21																	45993851		1993	4191	6184	SO:0001819	synonymous_variant	386672	exon1			GACCTGCGAGCCC	AB076351	CCDS42957.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000215454	ENSG00000215454		"""Keratin associated proteins"""	20521	protein-coding gene	gene with protein product			"""keratin associated protein 18-4"""	KRTAP18-4			Standard	NM_198687		Approved	KRTAP18.4, KAP10.4	uc002zfk.1	P60372	OTTHUMG00000057641	ENST00000400374.3:c.216C>T	21.37:g.45993851C>T		Somatic	14	2		WXS	Illumina GAIIx	Phase_I	26	16	NM_198687	0	0	0	0	0	Q08AS0	Silent	SNP	ENST00000400374.3	37	CCDS42957.1																																																																																			C|1.000;|0.000		0.721	KRTAP10-4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128045.1	NM_198687	
PCNT	5116	ucsc.edu	37	21	47848459	47848459	+	Missense_Mutation	SNP	G	G	A	rs2839256	byFrequency	TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr21:47848459G>A	ENST00000359568.5	+	35	7752	c.7645G>A	c.(7645-7647)Gca>Aca	p.A2549T	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	2549			A -> T (in dbSNP:rs2839256). {ECO:0000269|PubMed:11171385}.		brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)				NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					GCTGACAAGCGCAGAGGCGCG	0.697													G|||	890	0.177716	0.4856	0.0937	5008	,	,		16663	0.004		0.0924	False		,,,				2504	0.0879				p.A2549T		.											.	PCNT-141	0			c.G7645A						.	G	THR/ALA	1879,2513		406,1067,723	16.0	16.0	16.0		7645	0.7	0.0	21	dbSNP_100	16	654,7932		18,618,3657	yes	missense	PCNT	NM_006031.5	58	424,1685,4380	AA,AG,GG		7.6171,42.7823,19.5176	possibly-damaging	2549/3337	47848459	2533,10445	2196	4293	6489	SO:0001583	missense	5116	exon35			ACAAGCGCAGAGG	AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.7645G>A	21.37:g.47848459G>A	ENSP00000352572:p.Ala2549Thr	Somatic	21	0		WXS	Illumina GAIIx	Phase_I	44	5	NM_006031	0	0	5	5	0	O43152|Q7Z7C9	Missense_Mutation	SNP	ENST00000359568.5	37	CCDS33592.1	345	0.15796703296703296	233	0.4735772357723577	37	0.10220994475138122	2	0.0034965034965034965	73	0.09630606860158311	G	2.165	-0.391218	0.04932	0.427823	0.076171	ENSG00000160299	ENST00000359568	T	0.01388	4.95	4.51	0.662	0.17880	.	0.846706	0.09636	N	0.775640	T	0.00012	0.0000	L	0.28274	0.84	0.80722	P	0.0	B;P	0.34662	0.226;0.462	B;B	0.21151	0.031;0.033	T	0.08166	-1.0735	9	0.14656	T	0.56	.	4.0409	0.09751	0.331:0.0:0.5134:0.1556	rs2839256;rs59202831;rs2839256	2431;2549	O95613-2;O95613	.;PCNT_HUMAN	T	2549	ENSP00000352572:A2549T	ENSP00000352572:A2549T	A	+	1	0	PCNT	46672887	0.001000	0.12720	0.009000	0.14445	0.015000	0.08874	0.705000	0.25675	-0.005000	0.14395	0.563000	0.77884	GCA	A|0.200;C|0.007		0.697	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207336.1	NM_006031	
ZDHHC8	29801	bcgsc.ca	37	22	20131116	20131116	+	Missense_Mutation	SNP	G	G	A	rs80226867	byFrequency	TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr22:20131116G>A	ENST00000334554.7	+	10	2104	c.1963G>A	c.(1963-1965)Gcc>Acc	p.A655T	ZDHHC8_ENST00000320602.7_Missense_Mutation_p.A563T|ZDHHC8_ENST00000405930.3_Missense_Mutation_p.A655T	NM_013373.3	NP_037505.1	Q9ULC8	ZDHC8_HUMAN	zinc finger, DHHC-type containing 8	655					locomotory behavior (GO:0007626)|protein palmitoylation (GO:0018345)	cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(3)|endometrium(1)|kidney(3)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)	20	Colorectal(54;0.0993)					CAGCAGCAACGCCCCGGGGCC	0.726													G|||	252	0.0503195	0.0045	0.0101	5008	,	,		14224	0.0823		0.0527	False		,,,				2504	0.1053				p.A655T		.											.	ZDHHC8-91	0			c.G1963A						.	G	THR/ALA,THR/ALA	51,4313		0,51,2131	17.0	18.0	18.0		1963,1963	2.4	0.9	22	dbSNP_131	18	453,8131		15,423,3854	no	missense,missense	ZDHHC8	NM_001185024.1,NM_013373.3	58,58	15,474,5985	AA,AG,GG		5.2773,1.1687,3.8925	benign,benign	655/779,655/766	20131116	504,12444	2182	4292	6474	SO:0001583	missense	29801	exon10			AGCAACGCCCCGG	AB033118	CCDS13776.1, CCDS54502.1	22q11.21	2009-10-06		2003-02-28	ENSG00000099904	ENSG00000099904		"""Zinc fingers, DHHC-type"""	18474	protein-coding gene	gene with protein product		608784				10574462, 15184899	Standard	NM_013373		Approved	ZNF378, KIAA1292	uc002zrr.2	Q9ULC8	OTTHUMG00000150499	ENST00000334554.7:c.1963G>A	22.37:g.20131116G>A	ENSP00000334490:p.Ala655Thr	Somatic	8	0		WXS	Illumina GAIIx	Phase_I	47	39	NM_001185024	0	0	0	11	11	Q2TGE9|Q6ICL1|Q6ZNF5|Q7Z6L9	Missense_Mutation	SNP	ENST00000334554.7	37	CCDS13776.1	93	0.042582417582417584	2	0.0040650406504065045	4	0.011049723756906077	42	0.07342657342657342	45	0.059366754617414245	.	10.53	1.376581	0.24857	0.011687	0.052773	ENSG00000099904	ENST00000334554;ENST00000320602;ENST00000405930	T;T;T	0.71934	1.4;-0.61;1.31	4.57	2.4	0.29515	.	0.643418	0.15734	N	0.247275	T	0.14485	0.0350	L	0.51422	1.61	0.33178	D	0.549168	P;B;B	0.44044	0.825;0.133;0.103	P;B;B	0.49502	0.613;0.026;0.017	T	0.53114	-0.8484	10	0.23302	T	0.38	.	6.5739	0.22553	0.1598:0.1473:0.6929:0.0	.	563;655;655	Q9ULC8-2;Q9ULC8-3;Q9ULC8	.;.;ZDHC8_HUMAN	T	655;563;655	ENSP00000334490:A655T;ENSP00000317804:A563T;ENSP00000384716:A655T	ENSP00000317804:A563T	A	+	1	0	ZDHHC8	18511116	0.999000	0.42202	0.882000	0.34594	0.104000	0.19210	4.203000	0.58453	0.893000	0.36288	0.313000	0.20887	GCC	G|0.962;A|0.038		0.726	ZDHHC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318564.1	NM_013373	
PI4KA	5297	bcgsc.ca	37	22	21065645	21065645	+	Silent	SNP	A	A	G	rs444310		TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr22:21065645A>G	ENST00000572273.1	-	51	5963	c.5733T>C	c.(5731-5733)ggT>ggC	p.G1911G	PI4KA_ENST00000414196.3_Silent_p.G721G|PI4KA_ENST00000255882.6_Silent_p.G1969G			P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase, catalytic, alpha	1911	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi-associated vesicle membrane (GO:0030660)|membrane (GO:0016020)|plasma membrane (GO:0005886)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)	p.G1911G(1)		breast(3)|endometrium(8)|kidney(9)|large_intestine(19)|lung(29)|ovary(1)|pancreas(1)|prostate(3)|salivary_gland(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	79	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)			GGATGATATGACCCTTCTTGT	0.587																																					p.G1969G	GBM(136;1332 1831 3115 23601 50806)	.											.	PI4KA-454	1	Substitution - coding silent(1)	stomach(1)	c.T5907C						.	G	,	1543,2565		564,415,1075	105.0	128.0	120.0		2163,5733	1.5	1.0	22	dbSNP_80	120	936,7236		280,376,3430	no	coding-synonymous,coding-synonymous	PI4KA	NM_002650.2,NM_058004.3	,	844,791,4505	GG,GA,AA		11.4537,37.5609,20.1873	,	721/855,1911/2045	21065645	2479,9801	2054	4086	6140	SO:0001819	synonymous_variant	5297	exon51			GATATGACCCTTC	L36151	CCDS33603.1, CCDS33603.2	22q11.21	2011-05-25	2007-08-14	2007-08-02	ENSG00000241973	ENSG00000241973			8983	protein-coding gene	gene with protein product		600286		PIK4CA		7961848, 8662589	Standard	NM_002650		Approved	PI4K-ALPHA, pi4K230	uc002zsz.5	P42356	OTTHUMG00000167440	ENST00000572273.1:c.5733T>C	22.37:g.21065645A>G		Somatic	150	3		WXS	Illumina GAIIx	Phase_I	29	15	NM_058004	0	0	3	58	55	Q7Z625|Q9UPG2	Silent	SNP	ENST00000572273.1	37																																																																																				A|1.000;|0.000		0.587	PI4KA-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_058004	
UPK3A	7380	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	45691450	45691450	+	Silent	SNP	G	G	A			TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr22:45691450G>A	ENST00000216211.4	+	6	746	c.714G>A	c.(712-714)ggG>ggA	p.G238G	UPK3A_ENST00000396082.2_Silent_p.G117G	NM_006953.3	NP_008884.1	O75631	UPK3A_HUMAN	uroplakin 3A	238					cell morphogenesis (GO:0000902)|epithelial cell differentiation (GO:0030855)|kidney development (GO:0001822)|potassium ion homeostasis (GO:0055075)|sodium ion homeostasis (GO:0055078)|urea transport (GO:0015840)|urinary bladder development (GO:0060157)|water transport (GO:0006833)	apical plasma membrane (GO:0016324)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				kidney(1)|large_intestine(1)|lung(2)|skin(1)	5		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)		GGGACATGGGGAGTTCTGATG	0.562																																					p.G238G		.											.	UPK3A-90	0			c.G714A						.						130.0	134.0	132.0					22																	45691450		2203	4300	6503	SO:0001819	synonymous_variant	7380	exon6			CATGGGGAGTTCT	AB010637	CCDS14064.1, CCDS54539.1	22q13.31	2005-11-14	2003-07-29	2003-07-30	ENSG00000100373	ENSG00000100373			12580	protein-coding gene	gene with protein product		611559	"""uroplakin 3"""	UPK3		9818021	Standard	NM_006953		Approved		uc003bfy.3	O75631	OTTHUMG00000151339	ENST00000216211.4:c.714G>A	22.37:g.45691450G>A		Somatic	73	0		WXS	Illumina GAIIx	Phase_I	55	45	NM_006953	0	0	0	0	0	B0QY25|O60261|Q32N05|Q5TII6	Silent	SNP	ENST00000216211.4	37	CCDS14064.1																																																																																			.		0.562	UPK3A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000322276.1	NM_006953	
CDCP1	64866	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	45135039	45135039	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr3:45135039G>A	ENST00000296129.1	-	6	1491	c.1357C>T	c.(1357-1359)Ccc>Tcc	p.P453S		NM_022842.3	NP_073753.3	Q9H5V8	CDCP1_HUMAN	CUB domain containing protein 1	453	CUB.					extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|skin(4)|urinary_tract(1)	29				BRCA - Breast invasive adenocarcinoma(193;0.00928)|KIRC - Kidney renal clear cell carcinoma(197;0.0519)|Kidney(197;0.0651)		CTGTCCTTGGGCACCAGCAGC	0.602																																					p.P453S		.											.	CDCP1-117	0			c.C1357T						.						98.0	91.0	93.0					3																	45135039		2203	4300	6503	SO:0001583	missense	64866	exon6			CCTTGGGCACCAG	AF468010	CCDS2727.1, CCDS46812.1	3p21.3	2006-03-28			ENSG00000163814	ENSG00000163814		"""CD molecules"""	24357	protein-coding gene	gene with protein product		611735				11466621	Standard	NM_022842		Approved	CD318, SIMA135	uc003com.3	Q9H5V8	OTTHUMG00000133090	ENST00000296129.1:c.1357C>T	3.37:g.45135039G>A	ENSP00000296129:p.Pro453Ser	Somatic	94	0		WXS	Illumina GAIIx	Phase_I	146	69	NM_022842	0	0	0	0	0	Q49UB4|Q6NT71|Q6U9Y2|Q8WU91|Q96QU7|Q9H676|Q9H8C2	Missense_Mutation	SNP	ENST00000296129.1	37	CCDS2727.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.024130	0.75390	.	.	ENSG00000163814	ENST00000296129	T	0.67345	-0.26	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	T	0.80025	0.4548	M	0.72894	2.215	0.80722	D	1	D	0.76494	0.999	D	0.68621	0.959	T	0.80854	-0.1196	10	0.62326	D	0.03	.	14.7945	0.69868	0.0:0.0:0.8566:0.1434	.	453	Q9H5V8	CDCP1_HUMAN	S	453	ENSP00000296129:P453S	ENSP00000296129:P453S	P	-	1	0	CDCP1	45110043	1.000000	0.71417	1.000000	0.80357	0.866000	0.49608	4.666000	0.61554	2.771000	0.95319	0.561000	0.74099	CCC	.		0.602	CDCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256748.3	NM_022842	
FBXW12	285231	bcgsc.ca	37	3	48422235	48422235	+	Missense_Mutation	SNP	T	T	A	rs6784322	byFrequency	TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr3:48422235T>A	ENST00000296438.5	+	8	1004	c.818T>A	c.(817-819)gTt>gAt	p.V273D	RN7SL321P_ENST00000581742.1_RNA|FBXW12_ENST00000436231.1_Missense_Mutation_p.V116D|FBXW12_ENST00000468158.1_3'UTR|FBXW12_ENST00000415155.1_Missense_Mutation_p.V203D|FBXW12_ENST00000445170.1_Missense_Mutation_p.V254D	NM_207102.2	NP_996985.2	Q6X9E4	FBW12_HUMAN	F-box and WD repeat domain containing 12	273			V -> D (in dbSNP:rs6784322). {ECO:0000269|PubMed:15040455, ECO:0000269|PubMed:15489334}.							breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	16				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		GAAGGCAGTGTTCCTCTGTCT	0.488													t|||	1772	0.353834	0.3018	0.3703	5008	,	,		19337	0.3373		0.4702	False		,,,				2504	0.3098				p.V273D		.											.	FBXW12-226	0			c.T818A						.	T	ASP/VAL,ASP/VAL,ASP/VAL	1465,2941	473.0+/-356.5	237,991,975	102.0	99.0	100.0		608,761,818	-6.8	0.0	3	dbSNP_116	100	4066,4534	558.7+/-387.3	966,2134,1200	yes	missense,missense,missense	FBXW12	NM_001159927.1,NM_001159929.1,NM_207102.2	152,152,152	1203,3125,2175	AA,AT,TT		47.2791,33.2501,42.5265	benign,benign,benign	203/395,254/446,273/465	48422235	5531,7475	2203	4300	6503	SO:0001583	missense	285231	exon8			GCAGTGTTCCTCT	AK097594, AY247969	CCDS2764.1, CCDS54577.1, CCDS54578.1	3p21.31	2011-07-01	2007-02-08	2004-07-21	ENSG00000164049	ENSG00000164049		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	20729	protein-coding gene	gene with protein product		609075	"""F-box only protein 35"", ""F-box and WD-40 domain protein 12"""	FBXO35		15040455	Standard	NM_207102		Approved	Fbw12	uc010hjv.3	Q6X9E4	OTTHUMG00000133530	ENST00000296438.5:c.818T>A	3.37:g.48422235T>A	ENSP00000296438:p.Val273Asp	Somatic	172	0		WXS	Illumina GAIIx	Phase_I	242	8	NM_207102	0	0	0	0	0	E9PG36|Q494Y9|Q494Z0	Missense_Mutation	SNP	ENST00000296438.5	37	CCDS2764.1	803	0.3676739926739927	135	0.27439024390243905	135	0.3729281767955801	186	0.32517482517482516	347	0.4577836411609499	t	8.943	0.966403	0.18659	0.332501	0.472791	ENSG00000164049	ENST00000458736;ENST00000296438;ENST00000436231;ENST00000445170;ENST00000415155	T;T;T;T	0.63096	2.05;-0.02;1.63;3.5	4.38	-6.75	0.01738	Quinoprotein amine dehydrogenase, beta chain-like (1);	1.814540	0.02661	N	0.107520	T	0.00012	0.0000	N	0.01874	-0.695	0.80722	P	0.0	B;B;B;B	0.19817	0.039;0.039;0.023;0.023	B;B;B;B	0.23716	0.048;0.029;0.013;0.021	T	0.13388	-1.0511	9	0.22706	T	0.39	-0.7478	2.7167	0.05189	0.1117:0.1654:0.2368:0.4861	rs6784322;rs56511515;rs6784322	172;254;203;273	E9PCA2;E9PG36;Q494Z0;Q6X9E4	.;.;.;FBW12_HUMAN	D	172;273;116;254;203	ENSP00000296438:V273D;ENSP00000413866:V116D;ENSP00000406139:V254D;ENSP00000414683:V203D	ENSP00000296438:V273D	V	+	2	0	FBXW12	48397239	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.749000	0.04813	-1.581000	0.01642	-0.821000	0.03111	GTT	T|0.600;A|0.400		0.488	FBXW12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257505.1	NM_207102	
RHOA	387	broad.mit.edu	37	3	49395674	49395679	+	IGR	DEL	GCCGCC	GCCGCC	-	rs71077799|rs56041243|rs139760138|rs17838762	byFrequency	TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr3:49395674_49395679delGCCGCC	ENST00000418115.1	-	0	2031				GPX1_ENST00000496791.1_5'UTR|GPX1_ENST00000419783.1_In_Frame_Del_p.11_13AAA>A|GPX1_ENST00000419349.1_In_Frame_Del_p.11_13AAA>A	NM_001664.2	NP_001655.1	P61586	RHOA_HUMAN	ras homolog family member A						actin cytoskeleton organization (GO:0030036)|androgen receptor signaling pathway (GO:0030521)|apical junction assembly (GO:0043297)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cerebral cortex cell migration (GO:0021795)|cleavage furrow formation (GO:0036089)|forebrain radial glial cell differentiation (GO:0021861)|negative chemotaxis (GO:0050919)|negative regulation of axonogenesis (GO:0050771)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron differentiation (GO:0045665)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification involved in bone maturation (GO:0043931)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of axonogenesis (GO:0050772)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytokinesis (GO:0032467)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of podosome assembly (GO:0071803)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of translation (GO:0045727)|positive regulation of vasoconstriction (GO:0045907)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion transport (GO:0051924)|regulation of cell migration (GO:0030334)|regulation of dendrite development (GO:0050773)|regulation of neural precursor cell proliferation (GO:2000177)|regulation of osteoblast proliferation (GO:0033688)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to glucocorticoid (GO:0051384)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|Rho protein signal transduction (GO:0007266)|skeletal muscle tissue development (GO:0007519)|small GTPase mediated signal transduction (GO:0007264)|spindle assembly involved in mitosis (GO:0090307)|stress fiber assembly (GO:0043149)|stress-activated protein kinase signaling cascade (GO:0031098)|substantia nigra development (GO:0021762)|trabecula morphogenesis (GO:0061383)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	apical junction complex (GO:0043296)|axon (GO:0030424)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin binding (GO:0017022)	p.A12_A13delAA(1)		cervix(1)|kidney(1)|large_intestine(5)|lung(1)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	12				BRCA - Breast invasive adenocarcinoma(193;8.58e-05)|Kidney(197;0.0023)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		CACCGACTGGgccgccgccgccgccg	0.694																																					.		.											.	GPX1-68	1	Deletion - In frame(1)	breast(1)	.						.		,	23,168,347		11,0,1,79,10,168					,	-0.2	0.0		dbSNP_123	2	116,720,1030		46,10,14,333,44,486	no	codingComplex,codingComplex	GPX1	NM_201397.1,NM_000581.2	,	57,10,15,412,54,654	A1A1,A1A2,A1R,A2A2,A2R,RR		44.8017,35.5019,42.7205	,	,		139,888,1377				SO:0001628	intergenic_variant	2876	.			GACTGGGCCGCCG	BC001360	CCDS2795.1	3p21.3	2012-02-27	2012-02-27	2004-03-23	ENSG00000067560	ENSG00000067560			667	protein-coding gene	gene with protein product		165390	"""ras homolog gene family, member A"""	ARH12, ARHA		9605859	Standard	NM_001664		Approved	RhoA, Rho12, RHOH12	uc003cwu.3	P61586	OTTHUMG00000156838		3.37:g.49395680_49395685delGCCGCC		Somatic	13	0		WXS	Illumina GAIIx	Phase_I	56	14	.	0	0	0	0	0	P06749|Q53HM4|Q5U024|Q9UDJ0|Q9UEJ4	In_Frame_Del	DEL	ENST00000418115.1	37	CCDS2795.1																																																																																			.		0.694	RHOA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346157.3	NM_001664	
CNTN3	5067	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	74316498	74316498	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr3:74316498C>A	ENST00000263665.6	-	20	2763	c.2736G>T	c.(2734-2736)tgG>tgT	p.W912C	CNTN3_ENST00000477856.1_5'UTR	NM_020872.1	NP_065923.1	Q9P232	CNTN3_HUMAN	contactin 3 (plasmacytoma associated)	912	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|nervous system development (GO:0007399)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(39)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	83		Lung NSC(201;0.138)|Lung SC(41;0.21)		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)		CTGTGGCATTCCAAACAACAT	0.378																																					p.W912C		.											.	CNTN3-137	0			c.G2736T						.						140.0	138.0	139.0					3																	74316498		2203	4300	6503	SO:0001583	missense	5067	exon20			GGCATTCCAAACA	AB040929	CCDS33790.1	3p12.3	2013-02-11			ENSG00000113805	ENSG00000113805		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2173	protein-coding gene	gene with protein product		601325		PANG		8661054, 8586965	Standard	XM_005264757		Approved	BIG-1	uc003dpm.1	Q9P232	OTTHUMG00000158813	ENST00000263665.6:c.2736G>T	3.37:g.74316498C>A	ENSP00000263665:p.Trp912Cys	Somatic	94	0		WXS	Illumina GAIIx	Phase_I	137	23	NM_020872	0	0	0	0	0	B9EK50|Q9H039	Missense_Mutation	SNP	ENST00000263665.6	37	CCDS33790.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.067064	0.76301	.	.	ENSG00000113805	ENST00000263665	T	0.48836	0.8	5.14	5.14	0.70334	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.060479	0.64402	D	0.000001	T	0.72574	0.3477	M	0.86178	2.8	0.80722	D	1	D	0.71674	0.998	D	0.74348	0.983	T	0.76077	-0.3091	10	0.49607	T	0.09	.	18.6207	0.91319	0.0:1.0:0.0:0.0	.	912	Q9P232	CNTN3_HUMAN	C	912	ENSP00000263665:W912C	ENSP00000263665:W912C	W	-	3	0	CNTN3	74399188	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.185000	0.77714	2.374000	0.81015	0.655000	0.94253	TGG	.		0.378	CNTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352306.1	NM_020872	
PARP14	54625	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	122418659	122418659	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr3:122418659G>A	ENST00000474629.2	+	6	1524	c.1258G>A	c.(1258-1260)Gac>Aac	p.D420N		NM_017554.2	NP_060024.2	Q460N5	PAR14_HUMAN	poly (ADP-ribose) polymerase family, member 14	420					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			NS(2)|breast(5)|cervix(2)|endometrium(7)|kidney(5)|large_intestine(8)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	50				GBM - Glioblastoma multiforme(114;0.0531)		TGTGAAAGATGACAGGATTTT	0.378																																					p.D420N		.											.	PARP14-525	0			c.G1258A						.						128.0	123.0	125.0					3																	122418659		1893	4116	6009	SO:0001583	missense	54625	exon6			AAAGATGACAGGA	AB033094	CCDS46894.1	3q21	2010-02-16			ENSG00000173193	ENSG00000173193		"""Poly (ADP-ribose) polymerases"""	29232	protein-coding gene	gene with protein product		610028				15273990	Standard	NM_017554		Approved	KIAA1268, pART8	uc003efq.4	Q460N5	OTTHUMG00000159552	ENST00000474629.2:c.1258G>A	3.37:g.122418659G>A	ENSP00000418194:p.Asp420Asn	Somatic	88	0		WXS	Illumina GAIIx	Phase_I	176	28	NM_017554	0	0	3	4	1	B4E2H0|Q460N4|Q8J027|Q9H9X9|Q9NV60|Q9ULF2	Missense_Mutation	SNP	ENST00000474629.2	37	CCDS46894.1	.	.	.	.	.	.	.	.	.	.	G	13.73	2.325534	0.41197	.	.	ENSG00000173193	ENST00000474629;ENST00000398162	T	0.11277	2.79	5.19	2.36	0.29203	.	0.512963	0.18630	N	0.135619	T	0.10937	0.0267	M	0.65975	2.015	0.18873	N	0.999984	B;P	0.37441	0.169;0.595	B;B	0.31016	0.063;0.123	T	0.13656	-1.0501	10	0.41790	T	0.15	.	9.2246	0.37398	0.304:0.0:0.696:0.0	.	420;420	Q460N5-4;Q460N5	.;PAR14_HUMAN	N	420;339	ENSP00000418194:D420N	ENSP00000381228:D339N	D	+	1	0	PARP14	123901349	0.098000	0.21812	0.300000	0.25030	0.353000	0.29299	1.113000	0.31184	0.758000	0.33059	0.563000	0.77884	GAC	.		0.378	PARP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356173.2	NM_017554	
SEMA5B	54437	hgsc.bcm.edu	37	3	122631896	122631896	+	Missense_Mutation	SNP	A	A	T	rs2276782	byFrequency	TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr3:122631896A>T	ENST00000357599.3	-	18	2905	c.2519T>A	c.(2518-2520)gTc>gAc	p.V840D	SEMA5B_ENST00000451055.2_Missense_Mutation_p.V894D|SEMA5B_ENST00000195173.4_Missense_Mutation_p.V839D	NM_001031702.3|NM_001256348.1	NP_001026872.2|NP_001243277.1	Q9P283	SEM5B_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B	840			V -> D (in dbSNP:rs2276782). {ECO:0000269|PubMed:10819331, ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(13)|lung(26)|ovary(2)|pancreas(3)|skin(2)|upper_aerodigestive_tract(3)	55				GBM - Glioblastoma multiforme(114;0.0367)		GCGCAGGAGGACCTCCACCAG	0.791													T|||	3010	0.601038	0.5348	0.621	5008	,	,		11243	0.3522		0.8082	False		,,,				2504	0.7198				p.V894D		.											.	SEMA5B-157	0			c.T2681A						.	T	ASP/VAL	2573,1477		827,919,279	4.0	5.0	5.0		2519	5.0	1.0	3	dbSNP_100	5	6625,1195		2828,969,113	no	missense	SEMA5B	NM_001031702.2	152	3655,1888,392	TT,TA,AA		15.2813,36.4691,22.5105	benign	840/1152	122631896	9198,2672	2025	3910	5935	SO:0001583	missense	54437	exon18			AGGAGGACCTCCA	AB040878	CCDS35491.1, CCDS58848.1, CCDS74995.1	3q21.1	2008-07-18			ENSG00000082684	ENSG00000082684		"""Semaphorins"""	10737	protein-coding gene	gene with protein product		609298		SEMAG		8817451	Standard	NM_001256346		Approved	SemG, KIAA1445, FLJ10372	uc031sbm.1	Q9P283	OTTHUMG00000140392	ENST00000357599.3:c.2519T>A	3.37:g.122631896A>T	ENSP00000350215:p.Val840Asp	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	11	11	NM_001256347	0	0	0	0	0	A8K5U2|B7Z393|F8W9U8|Q6DD89|Q6UY12|Q9NW17	Missense_Mutation	SNP	ENST00000357599.3	37	CCDS35491.1	1286	0.5888278388278388	247	0.5020325203252033	243	0.6712707182320442	193	0.3374125874125874	603	0.7955145118733509	T	5.344	0.248763	0.10130	0.635309	0.847187	ENSG00000082684	ENST00000357599;ENST00000195173;ENST00000418793;ENST00000451055;ENST00000393583	T;T;T;T	0.34072	1.43;1.38;1.48;1.5	5.01	5.01	0.66863	.	0.161766	0.52532	N	0.000069	T	0.00012	0.0000	N	0.00246	-1.78	0.30182	P	0.8002819999999999	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.39354	-0.9618	9	0.02654	T	1	.	10.6514	0.45651	0.1435:0.0:0.0:0.8565	rs2276782	782;840	D3YTI7;Q9P283	.;SEM5B_HUMAN	D	840;839;782;894;840	ENSP00000350215:V840D;ENSP00000195173:V839D;ENSP00000389588:V894D;ENSP00000377208:V840D	ENSP00000195173:V839D	V	-	2	0	SEMA5B	124114586	1.000000	0.71417	0.990000	0.47175	0.785000	0.44390	4.886000	0.63149	0.945000	0.37605	-0.257000	0.10917	GTC	T|0.412;A|0.588		0.791	SEMA5B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000277165.1	NM_001031702	
CLDN1	9076	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	190030751	190030751	+	Missense_Mutation	SNP	C	C	T	rs373107390		TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr3:190030751C>T	ENST00000295522.3	-	2	566	c.298G>A	c.(298-300)Gtt>Att	p.V100I		NM_021101.4	NP_066924.1	O95832	CLD1_HUMAN	claudin 1	100					calcium-independent cell-cell adhesion (GO:0016338)|cell adhesion (GO:0007155)|cell-cell junction organization (GO:0045216)|establishment of skin barrier (GO:0061436)|viral process (GO:0016032)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			lung(9)	9	all_cancers(143;2.95e-10)|Ovarian(172;0.0512)		Lung(62;2.23e-05)|LUSC - Lung squamous cell carcinoma(58;3.15e-05)	GBM - Glioblastoma multiforme(93;0.015)		TTCATGCCAACGGTGGCCACA	0.483																																					p.V100I		.											.	CLDN1-91	0			c.G298A						.	C	ILE/VAL	0,4406		0,0,2203	258.0	230.0	239.0		298	-7.0	0.0	3		239	1,8599	1.2+/-3.3	0,1,4299	no	missense	CLDN1	NM_021101.4	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	100/212	190030751	1,13005	2203	4300	6503	SO:0001583	missense	9076	exon2			TGCCAACGGTGGC	AF101051	CCDS3295.1	3q28-q29	2008-07-18			ENSG00000163347	ENSG00000163347		"""Claudins"""	2032	protein-coding gene	gene with protein product	"""senescence-associated epithelial membrane protein 1"""	603718				10828592, 9892664	Standard	NM_021101		Approved	SEMP1, ILVASC	uc003fsh.3	O95832	OTTHUMG00000156214	ENST00000295522.3:c.298G>A	3.37:g.190030751C>T	ENSP00000295522:p.Val100Ile	Somatic	176	0		WXS	Illumina GAIIx	Phase_I	235	44	NM_021101	0	0	160	181	21		Missense_Mutation	SNP	ENST00000295522.3	37	CCDS3295.1	.	.	.	.	.	.	.	.	.	.	C	14.05	2.420567	0.42918	0.0	1.16E-4	ENSG00000163347	ENST00000295522;ENST00000545382	D	0.88354	-2.37	6.04	-6.98	0.01611	.	0.758950	0.13104	N	0.413538	T	0.79341	0.4429	L	0.37507	1.11	0.24052	N	0.996048	B	0.27951	0.195	B	0.25884	0.064	T	0.61501	-0.7050	10	0.36615	T	0.2	.	11.4508	0.50151	0.0906:0.2615:0.0:0.6479	.	100	O95832	CLD1_HUMAN	I	100;55	ENSP00000295522:V100I	ENSP00000295522:V100I	V	-	1	0	CLDN1	191513445	0.000000	0.05858	0.002000	0.10522	0.979000	0.70002	-3.235000	0.00546	-1.685000	0.01441	-0.367000	0.07326	GTT	.		0.483	CLDN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343516.2	NM_021101	
DSPP	1834	bcgsc.ca	37	4	88536999	88536999	+	Missense_Mutation	SNP	A	A	G	rs202222170		TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr4:88536999A>G	ENST00000282478.7	+	4	3218	c.3185A>G	c.(3184-3186)gAc>gGc	p.D1062G	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Missense_Mutation_p.D1062G			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1062	Asp/Ser-rich.			D -> G (in Ref. 1; AAF42472). {ECO:0000305}.	biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gacagcagtgacagcagcgac	0.532																																					p.D1062G		.											.	DSPP-90	0			c.A3185G						.						48.0	61.0	56.0					4																	88536999		1554	2803	4357	SO:0001583	missense	1834	exon5			GCAGTGACAGCAG	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3185A>G	4.37:g.88536999A>G	ENSP00000282478:p.Asp1062Gly	Somatic	354	0		WXS	Illumina GAIIx	Phase_I	276	16	NM_014208	0	0	0	0	0	A8MUI0|O95815	Missense_Mutation	SNP	ENST00000282478.7	37	CCDS43248.1	.	.	.	.	.	.	.	.	.	.	a	6.732	0.503863	0.12822	.	.	ENSG00000152591	ENST00000399271;ENST00000282478	D;D	0.88975	-2.45;-2.45	1.51	1.51	0.23008	.	.	.	.	.	D	0.87716	0.6247	L	0.29908	0.895	0.21762	N	0.99955	D	0.76494	0.999	D	0.74023	0.982	T	0.76072	-0.3093	9	0.24483	T	0.36	.	5.1866	0.15187	1.0:0.0:0.0:0.0	.	1062	Q9NZW4	DSPP_HUMAN	G	1062	ENSP00000382213:D1062G;ENSP00000282478:D1062G	ENSP00000282478:D1062G	D	+	2	0	DSPP	88756023	0.386000	0.25180	0.936000	0.37596	0.006000	0.05464	2.307000	0.43682	0.963000	0.38082	0.242000	0.17961	GAC	.		0.532	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
SMAD1	4086	broad.mit.edu	37	4	146435774	146435774	+	Silent	SNP	G	G	A			TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr4:146435774G>A	ENST00000515385.1	+	2	551	c.9G>A	c.(7-9)gtG>gtA	p.V3V	SMAD1_ENST00000515527.1_3'UTR|SMAD1_ENST00000302085.4_Silent_p.V3V|SMAD1_ENST00000394092.2_Silent_p.V3V|RP11-301H24.4_ENST00000513542.1_RNA			Q15797	SMAD1_HUMAN	SMAD family member 1	3			V -> A (found in a patient with primary pulmonary hypertension; unknown pathological significance; affects SMAD- mediated signaling). {ECO:0000269|PubMed:21898662}.		BMP signaling pathway (GO:0030509)|bone development (GO:0060348)|cardiac muscle cell proliferation (GO:0060038)|cartilage development (GO:0051216)|cellular response to BMP stimulus (GO:0071773)|embryonic pattern specification (GO:0009880)|gamete generation (GO:0007276)|hindbrain development (GO:0030902)|homeostatic process (GO:0042592)|inflammatory response (GO:0006954)|MAPK cascade (GO:0000165)|mesodermal cell fate commitment (GO:0001710)|midbrain development (GO:0030901)|negative regulation of cell proliferation (GO:0008285)|negative regulation of muscle cell apoptotic process (GO:0010656)|osteoblast fate commitment (GO:0002051)|positive regulation of cartilage development (GO:0061036)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of gene expression (GO:0010628)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|primary miRNA processing (GO:0031053)|protein phosphorylation (GO:0006468)|response to drug (GO:0042493)|response to organonitrogen compound (GO:0010243)|signal transduction (GO:0007165)|SMAD protein complex assembly (GO:0007183)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|mitochondrion (GO:0005739)|nuclear inner membrane (GO:0005637)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	co-SMAD binding (GO:0070410)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|receptor signaling protein activity (GO:0005057)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity (GO:0030618)			endometrium(2)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	17	all_hematologic(180;0.151)					TTATGAATGTGACAAGTTTAT	0.388																																					p.V3V	Pancreas(182;1287 2092 10326 35158 50562)	.											.	SMAD1-415	0			c.G9A						.						94.0	90.0	91.0					4																	146435774		2203	4300	6503	SO:0001819	synonymous_variant	4086	exon2			GAATGTGACAAGT	U59423	CCDS3765.1	4q31.21	2013-10-22	2006-11-06	2004-05-26	ENSG00000170365	ENSG00000170365		"""SMADs"""	6767	protein-coding gene	gene with protein product		601595	"""MAD, mothers against decapentaplegic homolog 1 (Drosophila)"", ""SMAD, mothers against DPP homolog 1 (Drosophila)"""	MADH1		8653785, 8673135	Standard	NM_005900		Approved	MADR1, JV4-1	uc003ikc.3	Q15797	OTTHUMG00000161592	ENST00000515385.1:c.9G>A	4.37:g.146435774G>A		Somatic	154	0		WXS	Illumina GAIIx	Phase_I	121	5	NM_005900	0	0	9	9	0	A8KAJ0|D3DNZ9|Q16636|Q9UFT8	Silent	SNP	ENST00000515385.1	37	CCDS3765.1																																																																																			.		0.388	SMAD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365467.1	NM_005900	
FAT1	2195	broad.mit.edu	37	4	187522507	187522507	+	Missense_Mutation	SNP	C	C	G	rs202035728		TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr4:187522507C>G	ENST00000441802.2	-	21	11765	c.11556G>C	c.(11554-11556)gaG>gaC	p.E3852D	FAT1_ENST00000512347.1_5'Flank	NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	3852	Laminin G-like. {ECO:0000255|PROSITE- ProRule:PRU00122}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						TCAGTTTCATCTCTAATTTGT	0.423										HNSCC(5;0.00058)																											p.E3852D	Colon(197;1040 2055 4143 4984 49344)	.											.	FAT1-34	0			c.G11556C						.	C	ASP/GLU	1,3837		0,1,1918	154.0	153.0	153.0		11556	4.4	1.0	4		153	4,8244		0,4,4120	yes	missense	FAT1	NM_005245.3	45	0,5,6038	GG,GC,CC		0.0485,0.0261,0.0414	benign	3852/4589	187522507	5,12081	1919	4124	6043	SO:0001583	missense	2195	exon21			TTTCATCTCTAAT	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.11556G>C	4.37:g.187522507C>G	ENSP00000406229:p.Glu3852Asp	Somatic	110	0		WXS	Illumina GAIIx	Phase_I	97	4	NM_005245	0	0	25	25	0		Missense_Mutation	SNP	ENST00000441802.2	37	CCDS47177.1	.	.	.	.	.	.	.	.	.	.	C	14.06	2.423641	0.43020	2.61E-4	4.85E-4	ENSG00000083857	ENST00000441802;ENST00000260147	T	0.68624	-0.34	5.5	4.43	0.53597	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);	0.116944	0.56097	D	0.000036	T	0.59155	0.2173	L	0.47716	1.5	0.48288	D	0.999625	D	0.56287	0.975	P	0.49799	0.622	T	0.56062	-0.8041	10	0.21014	T	0.42	.	4.0431	0.09760	0.0:0.6803:0.0:0.3197	.	3852	Q14517	FAT1_HUMAN	D	3852;3854	ENSP00000406229:E3852D	ENSP00000260147:E3854D	E	-	3	2	FAT1	187759501	1.000000	0.71417	1.000000	0.80357	0.772000	0.43724	1.894000	0.39768	2.758000	0.94735	0.563000	0.77884	GAG	.		0.423	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245	
PAPD7	11044	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	6753081	6753081	+	Silent	SNP	C	C	T			TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr5:6753081C>T	ENST00000230859.6	+	12	1494	c.1365C>T	c.(1363-1365)caC>caT	p.H455H		NM_001171805.1|NM_001171806.1|NM_006999.4	NP_001165276.1|NP_001165277.1|NP_008930.1	Q5XG87	PAPD7_HUMAN	PAP associated domain containing 7	685	PAP-associated.				double-strand break repair (GO:0006302)|mitotic chromosome condensation (GO:0007076)|response to drug (GO:0042493)|sister chromatid cohesion (GO:0007062)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|polynucleotide adenylyltransferase activity (GO:0004652)|SMC family protein binding (GO:0043221)			cervix(1)|endometrium(2)|large_intestine(8)|lung(10)|ovary(2)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27						AAGCCGTCCACCACATGTCTT	0.552																																					p.H455H	NSCLC(7;212 333 5667 23379 46547)	.											.	PAPD7-69	0			c.C1365T						.						162.0	147.0	152.0					5																	6753081		2203	4300	6503	SO:0001819	synonymous_variant	11044	exon12			CGTCCACCACATG	AF089896	CCDS3871.1	5p15	2010-11-18	2010-01-19	2010-01-19	ENSG00000112941	ENSG00000112941			16705	protein-coding gene	gene with protein product	"""topoisomerase-related function protein 4-1"", ""polymerase (DNA-directed) sigma"", ""DNA polymerase kappa"", ""TUTase5"""	605198	"""polymerase (DNA directed) sigma"""	POLS		10066793, 10926539	Standard	NM_006999		Approved	POLK, TRF4, LAK-1, TRF4-1	uc003jdx.1	Q5XG87	OTTHUMG00000090457	ENST00000230859.6:c.1365C>T	5.37:g.6753081C>T		Somatic	110	0		WXS	Illumina GAIIx	Phase_I	99	81	NM_001171805	0	0	1	19	18	A8K1E2|M1JCE6|O43289|Q17RZ1|Q9Y6C1	Silent	SNP	ENST00000230859.6	37	CCDS3871.1																																																																																			.		0.552	PAPD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206904.1	NM_006999	
ADCY2	108	bcgsc.ca	37	5	7520881	7520881	+	Missense_Mutation	SNP	G	G	T	rs13166360	byFrequency	TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr5:7520881G>T	ENST00000338316.4	+	3	528	c.439G>T	c.(439-441)Gtg>Ttg	p.V147L		NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	147			V -> L (in dbSNP:rs13166360). {ECO:0000269|PubMed:15489334}.		activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						CATCTTCGTGGTGTACACCAT	0.507													G|||	459	0.0916534	0.0545	0.0994	5008	,	,		21118	0.0		0.2117	False		,,,				2504	0.1074				p.V147L		.											.	ADCY2-97	0			c.G439T						.	G	LEU/VAL	390,4016	194.7+/-219.5	22,346,1835	179.0	124.0	143.0		439	5.4	1.0	5	dbSNP_121	143	2139,6461	367.0+/-334.5	269,1601,2430	yes	missense	ADCY2	NM_020546.2	32	291,1947,4265	TT,TG,GG		24.8721,8.8516,19.4449	possibly-damaging	147/1092	7520881	2529,10477	2203	4300	6503	SO:0001583	missense	108	exon3			TTCGTGGTGTACA	AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	ENST00000338316.4:c.439G>T	5.37:g.7520881G>T	ENSP00000342952:p.Val147Leu	Somatic	148	0		WXS	Illumina GAIIx	Phase_I	88	6	NM_020546	0	0	1	1	0	B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Missense_Mutation	SNP	ENST00000338316.4	37	CCDS3872.2	236	0.10805860805860806	30	0.06097560975609756	41	0.1132596685082873	0	0.0	165	0.21767810026385223	G	20.9	4.072518	0.76415	0.088516	0.248721	ENSG00000078295	ENST00000338316	T	0.76186	-1.0	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	T	0.00039	0.0001	M	0.64997	1.995	0.09310	P	1.0	P	0.37525	0.598	B	0.37888	0.26	T	0.01652	-1.1303	9	0.54805	T	0.06	.	16.4516	0.83993	0.0:0.0:1.0:0.0	rs13166360;rs17826984;rs60134556;rs13166360	147	Q08462	ADCY2_HUMAN	L	147	ENSP00000342952:V147L	ENSP00000342952:V147L	V	+	1	0	ADCY2	7573881	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.996000	0.70639	2.545000	0.85829	0.650000	0.86243	GTG	G|0.850;T|0.150		0.507	ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206930.2	NM_020546	
PCDHGA4	56111	broad.mit.edu	37	5	140736327	140736327	+	Silent	SNP	C	C	T			TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr5:140736327C>T	ENST00000571252.1	+	1	1560	c.1560C>T	c.(1558-1560)ttC>ttT	p.F520F	PCDHGB1_ENST00000523390.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018917.2	NP_061740	Q9Y5G9	PCDG4_HUMAN	protocadherin gamma subfamily A, 4	520	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTTGCTCCTTCGACTATGAGC	0.527																																					p.F520F		.											.	.	0			c.C1560T						.						130.0	138.0	135.0					5																	140736327		2112	4265	6377	SO:0001819	synonymous_variant	56111	exon1			CTCCTTCGACTAT	AF152511	CCDS58979.1, CCDS58979.2, CCDS75331.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8702	other	protocadherin		606291				10380929	Standard	NM_018917		Approved	PCDH-GAMMA-A4		Q9Y5G9		ENST00000571252.1:c.1560C>T	5.37:g.140736327C>T		Somatic	114	0		WXS	Illumina GAIIx	Phase_I	110	4	NM_018917	0	0	8	8	0	Q9Y5D3	Silent	SNP	ENST00000571252.1	37	CCDS58979.1																																																																																			.		0.527	PCDHGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437959.1	NM_018917	
RNF39	80352	hgsc.bcm.edu	37	6	30039364	30039364	+	Missense_Mutation	SNP	C	C	A	rs11753382	byFrequency	TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr6:30039364C>A	ENST00000244360.6	-	4	884	c.787G>T	c.(787-789)Ggc>Tgc	p.G263C	RNF39_ENST00000376751.3_Missense_Mutation_p.G263C	NM_025236.3	NP_079512.2	Q9H2S5	RNF39_HUMAN	ring finger protein 39	263	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)										CGCTTGGGGCCGTCAGGGGGC	0.741													c|||	749	0.149561	0.2489	0.134	5008	,	,		10967	0.1528		0.0447	False		,,,				2504	0.1309				p.G263C	NSCLC(8;188 360 1520 20207 31481)	.											.	RNF39-226	0			c.G787T						.		CYS/GLY,CYS/GLY	414,2026		21,372,827	3.0	2.0	2.0		787,787	0.5	0.1	6	dbSNP_120	2	229,4029		6,217,1906	yes	missense,missense	RNF39	NM_025236.3,NM_170769.2	159,159	27,589,2733	AA,AC,CC		5.3781,16.9672,9.5999	benign,benign	263/421,263/355	30039364	643,6055	1220	2129	3349	SO:0001583	missense	80352	exon4			TGGGGCCGTCAGG	AF238315	CCDS4673.1, CCDS4674.1	6p21.3	2013-01-09			ENSG00000204618	ENSG00000204618		"""RING-type (C3HC4) zinc fingers"""	18064	protein-coding gene	gene with protein product		607524				11130983, 11716498	Standard	NM_170769		Approved	HZFw1, LIRF	uc003npe.3	Q9H2S5	OTTHUMG00000031288	ENST00000244360.6:c.787G>T	6.37:g.30039364C>A	ENSP00000244360:p.Gly263Cys	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	13	12	NM_025236	0	0	0	2	2	A2BEK3|A6NCD6|B0S858|Q5SPM8|Q5SPM9|Q5SPN0|Q5SRJ9|Q5SRK1|Q5SS29|Q9H2S3|Q9H2S4	Missense_Mutation	SNP	ENST00000244360.6	37	CCDS4673.1	299	0.13690476190476192	120	0.24390243902439024	56	0.15469613259668508	90	0.15734265734265734	33	0.04353562005277045	c	11.55	1.672102	0.29693	0.169672	0.053781	ENSG00000204618	ENST00000376751;ENST00000244360	T;T	0.10382	2.88;2.88	4.7	0.543	0.17179	Concanavalin A-like lectin/glucanase (1);SPRY-associated (1);B30.2/SPRY domain (1);	0.296117	0.23738	N	0.045041	T	0.03348	0.0097	N	0.19112	0.55	0.48696	P	3.009999999999957E-4	B;P	0.48407	0.06;0.91	B;P	0.47626	0.092;0.552	T	0.41305	-0.9516	9	0.56958	D	0.05	-19.3451	7.7639	0.28968	0.0:0.4441:0.0:0.5559	rs11753382	263;263	Q9H2S5;Q9H2S5-2	RNF39_HUMAN;.	C	263	ENSP00000365942:G263C;ENSP00000244360:G263C	ENSP00000244360:G263C	G	-	1	0	RNF39	30147343	0.003000	0.15002	0.059000	0.19551	0.050000	0.14768	0.158000	0.16422	-0.104000	0.12154	0.466000	0.42574	GGC	C|0.862;A|0.138		0.741	RNF39-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076625.3	NM_170769	
NFKBIE	4794	hgsc.bcm.edu	37	6	44233372	44233372	+	Silent	SNP	G	G	A	rs189481001	byFrequency	TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr6:44233372G>A	ENST00000275015.5	-	1	128	c.129C>T	c.(127-129)ggC>ggT	p.G43G		NM_004556.2	NP_004547.2	O00221	IKBE_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon	43					cytoplasmic sequestering of transcription factor (GO:0042994)|D-serine transport (GO:0042942)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)				breast(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)|urinary_tract(1)	10	all_cancers(18;2e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			GGATggccccgccccctcccc	0.741													G|||	11	0.00219649	0.0008	0.0014	5008	,	,		6411	0.0		0.0089	False		,,,				2504	0.0				p.G43G		.											.	NFKBIE-135	0			c.C129T						.	G		4,2954		0,4,1475	2.0	2.0	2.0		129	3.9	1.0	6		2	25,5827		0,25,2901	no	coding-synonymous	NFKBIE	NM_004556.2		0,29,4376	AA,AG,GG		0.4272,0.1352,0.3292		43/501	44233372	29,8781	1479	2926	4405	SO:0001819	synonymous_variant	4794	exon1			GGCCCCGCCCCCT	U91616	CCDS34463.1	6p21.1	2013-01-10			ENSG00000146232	ENSG00000146232		"""Ankyrin repeat domain containing"""	7799	protein-coding gene	gene with protein product		604548				9135156	Standard	NM_004556		Approved	IKBE	uc003oxe.1	O00221	OTTHUMG00000014762	ENST00000275015.5:c.129C>T	6.37:g.44233372G>A		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_004556	0	0	0	0	0	Q5T9V9	Silent	SNP	ENST00000275015.5	37	CCDS34463.1																																																																																			G|0.995;A|0.005		0.741	NFKBIE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040733.2		
TRAM2	9697	hgsc.bcm.edu	37	6	52380882	52380882	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr6:52380882G>T	ENST00000182527.3	-	4	332	c.333C>A	c.(331-333)caC>caA	p.H111Q	EFHC1_ENST00000433625.2_Intron	NM_012288.3	NP_036420.1	Q15035	TRAM2_HUMAN	translocation associated membrane protein 2	111					collagen biosynthetic process (GO:0032964)|protein transport (GO:0015031)	integral component of membrane (GO:0016021)				endometrium(3)|large_intestine(1)|lung(7)|prostate(1)|skin(1)	13	Lung NSC(77;0.109)					TGAACTTGCTGTGTTTGACTT	0.423																																					p.H111Q		.											.	TRAM2-90	0			c.C333A						.						179.0	168.0	172.0					6																	52380882		2203	4300	6503	SO:0001583	missense	9697	exon4			CTTGCTGTGTTTG	D31762	CCDS34477.1	6p21.1-p12	2008-02-05			ENSG00000065308	ENSG00000065308			16855	protein-coding gene	gene with protein product		608485				7584044, 10594243	Standard	NM_012288		Approved	KIAA0057	uc003paq.3	Q15035	OTTHUMG00000014850	ENST00000182527.3:c.333C>A	6.37:g.52380882G>T	ENSP00000182527:p.His111Gln	Somatic	96	0		WXS	Illumina GAIIx	Phase_I	80	4	NM_012288	0	0	11	11	0	A8K6T6	Missense_Mutation	SNP	ENST00000182527.3	37	CCDS34477.1	.	.	.	.	.	.	.	.	.	.	G	12.28	1.889326	0.33348	.	.	ENSG00000065308	ENST00000182527	.	.	.	5.47	4.6	0.57074	TRAM1-like protein (1);	0.141037	0.64402	D	0.000005	T	0.18964	0.0455	N	0.14661	0.345	0.47065	D	0.999301	B	0.14438	0.01	B	0.15052	0.012	T	0.09207	-1.0685	9	0.17832	T	0.49	.	9.518	0.39117	0.0759:0.1428:0.7814:0.0	.	111	Q15035	TRAM2_HUMAN	Q	111	.	ENSP00000182527:H111Q	H	-	3	2	TRAM2	52488841	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.063000	0.49978	1.291000	0.44653	0.655000	0.94253	CAC	.		0.423	TRAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040910.1	NM_012288	
COL21A1	81578	bcgsc.ca	37	6	56044578	56044578	+	Silent	SNP	T	T	C	rs2038149	byFrequency	TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr6:56044578T>C	ENST00000244728.5	-	3	835	c.438A>G	c.(436-438)aaA>aaG	p.K146K	COL21A1_ENST00000535941.1_Silent_p.K146K|COL21A1_ENST00000370819.1_Silent_p.K146K	NM_030820.3	NP_110447.2	Q96P44	COLA1_HUMAN	collagen, type XXI, alpha 1	146	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(1)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|prostate(2)	41	Lung NSC(77;0.0483)		LUSC - Lung squamous cell carcinoma(124;0.181)			CATCTTGGGATTTGCCATCCG	0.438													T|||	3460	0.690895	0.6225	0.5677	5008	,	,		21148	0.8631		0.6272	False		,,,				2504	0.7587				p.K146K		.											.	COL21A1-24	0			c.A438G						.	T		2568,1448		815,938,255	100.0	95.0	97.0		438	4.8	1.0	6	dbSNP_94	97	5406,2944		1767,1872,536	no	coding-synonymous	COL21A1	NM_030820.3		2582,2810,791	CC,CT,TT		35.2575,36.0558,35.5167		146/958	56044578	7974,4392	2008	4175	6183	SO:0001819	synonymous_variant	81578	exon3			TTGGGATTTGCCA	AF330693	CCDS55025.1	6p12.3-p11.2	2013-01-16			ENSG00000124749	ENSG00000124749		"""Collagens"""	17025	protein-coding gene	gene with protein product		610002				11566190	Standard	XR_241922		Approved		uc003pcs.3	Q96P44	OTTHUMG00000014907	ENST00000244728.5:c.438A>G	6.37:g.56044578T>C		Somatic	270	1		WXS	Illumina GAIIx	Phase_I	217	7	NM_030820	0	0	0	0	0	A6NIX5|B2R8J9|Q49A51|Q71RF4|Q8WXV8|Q9H0V3	Silent	SNP	ENST00000244728.5	37	CCDS55025.1																																																																																			T|0.330;C|0.670		0.438	COL21A1-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041004.2		
EEF1A1	1915	bcgsc.ca	37	6	74227973	74227973	+	Missense_Mutation	SNP	G	G	T	rs190893068		TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr6:74227973G>T	ENST00000316292.9	-	6	2035	c.1044C>A	c.(1042-1044)aaC>aaA	p.N348K	EEF1A1_ENST00000331523.2_Missense_Mutation_p.N348K|EEF1A1_ENST00000309268.6_Missense_Mutation_p.N348K|EEF1A1_ENST00000491404.1_Intron	NM_001402.5	NP_001393.1	P68104	EF1A1_HUMAN	eukaryotic translation elongation factor 1 alpha 1	348					cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|translation elongation factor activity (GO:0003746)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(6)|prostate(2)|skin(3)	18						GGCCTGGATGGTTCAGGATAA	0.423																																					p.N348K		.											.	EEF1A1-226	0			c.C1044A						.						45.0	49.0	47.0					6																	74227973		2199	4298	6497	SO:0001583	missense	1915	exon7			TGGATGGTTCAGG	BC019669	CCDS4980.1	6q14.1	2010-06-30	2004-11-19		ENSG00000156508	ENSG00000156508			3189	protein-coding gene	gene with protein product		130590	"""leukocyte receptor cluster (LRC) member 7"""	EF1A, EEF1A, LENG7		8812466, 10941842	Standard	NM_001402		Approved	EE1A1	uc003phj.3	P68104	OTTHUMG00000015031	ENST00000316292.9:c.1044C>A	6.37:g.74227973G>T	ENSP00000339063:p.Asn348Lys	Somatic	249	5		WXS	Illumina GAIIx	Phase_I	233	14	NM_001402	5	4	16376	16393	8	P04719|P04720|Q6IQ15	Missense_Mutation	SNP	ENST00000316292.9	37	CCDS4980.1	.	.	.	.	.	.	.	.	.	.	G	13.71	2.319688	0.41096	.	.	ENSG00000156508	ENST00000316292;ENST00000358190;ENST00000309268;ENST00000331523;ENST00000391977	T;T;T	0.43688	0.94;0.94;0.94	4.71	3.84	0.44239	Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (2);Translation elongation factor EFTu/EF1A, C-terminal (2);	0.000000	0.85682	U	0.000000	T	0.52354	0.1729	H	0.98866	4.355	0.80722	D	1	B;B;B	0.26483	0.027;0.027;0.15	B;B;B	0.30316	0.074;0.074;0.114	T	0.65533	-0.6145	10	0.87932	D	0	.	13.2814	0.60216	0.0779:0.0:0.9221:0.0	.	348;348;348	P68104;Q6IPS9;Q5VTE0	EF1A1_HUMAN;.;EF1A3_HUMAN	K	348;346;348;348;327	ENSP00000339063:N348K;ENSP00000339053:N348K;ENSP00000330054:N348K	ENSP00000339053:N348K	N	-	3	2	EEF1A1	74284694	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.738000	0.55067	1.107000	0.41642	0.556000	0.70494	AAC	G|0.999;T|0.001		0.423	EEF1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041210.2	NM_001402	
POU3F2	5454	hgsc.bcm.edu	37	6	99283376	99283376	+	Silent	SNP	T	T	G	rs195860	byFrequency	TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr6:99283376T>G	ENST00000328345.5	+	1	797	c.627T>G	c.(625-627)ggT>ggG	p.G209G		NM_005604.3	NP_005595.2	P20265	PO3F2_HUMAN	POU class 3 homeobox 2	209					astrocyte development (GO:0014002)|cellular response to organic substance (GO:0071310)|cerebral cortex radially oriented cell migration (GO:0021799)|epidermis development (GO:0008544)|forebrain ventricular zone progenitor cell division (GO:0021869)|hypothalamus cell differentiation (GO:0021979)|myelination in peripheral nervous system (GO:0022011)|neurohypophysis development (GO:0021985)|neuron differentiation (GO:0030182)|positive regulation of cell proliferation (GO:0008284)|positive regulation of multicellular organism growth (GO:0040018)|regulation of axonogenesis (GO:0050770)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	identical protein binding (GO:0042802)|RNA polymerase II transcription coactivator activity (GO:0001105)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|large_intestine(3)|lung(5)	10		all_cancers(76;1.56e-06)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00893)|Colorectal(196;0.069)|Lung NSC(302;0.197)		BRCA - Breast invasive adenocarcinoma(108;0.0355)		AGCCGGCCGGTCTGCACCACC	0.736													G|||	4460	0.890575	0.8994	0.9121	5008	,	,		6412	0.9544		0.8598	False		,,,				2504	0.8292				p.G209G		.											.	POU3F2-90	0			c.T627G						.	G		3186,306		1453,280,13	4.0	4.0	4.0		627	3.1	1.0	6	dbSNP_79	4	6282,930		2738,806,62	no	coding-synonymous	POU3F2	NM_005604.2		4191,1086,75	GG,GT,TT		12.8952,8.7629,11.5471		209/444	99283376	9468,1236	1746	3606	5352	SO:0001819	synonymous_variant	5454	exon1			GGCCGGTCTGCAC	Z11933	CCDS5040.1	6q16.2	2011-06-20	2007-07-13		ENSG00000184486	ENSG00000184486		"""Homeoboxes / POU class"""	9215	protein-coding gene	gene with protein product		600494	"""POU domain class 3, transcription factor 2"""	OTF7		8441633	Standard	NM_005604		Approved	POUF3, BRN2, OCT7	uc003ppe.3	P20265	OTTHUMG00000015258	ENST00000328345.5:c.627T>G	6.37:g.99283376T>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_005604	0	0	0	0	0	Q14960|Q86V54|Q9UJL0	Silent	SNP	ENST00000328345.5	37	CCDS5040.1																																																																																			T|0.089;G|0.911		0.736	POU3F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041586.2		
HIVEP2	3097	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	143095218	143095218	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr6:143095218T>C	ENST00000367604.1	-	4	1297	c.658A>G	c.(658-660)Ata>Gta	p.I220V	HIVEP2_ENST00000367603.2_Missense_Mutation_p.I220V|HIVEP2_ENST00000012134.2_Missense_Mutation_p.I220V			P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer binding protein 2	220					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(19)|lung(35)|ovary(4)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	100				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		CCACAAGGTATACATGGATAT	0.458																																					p.I220V	Esophageal Squamous(107;843 1510 13293 16805 42198)	.											.	HIVEP2-95	0			c.A658G						.						116.0	114.0	115.0					6																	143095218		1925	4145	6070	SO:0001583	missense	3097	exon5			AAGGTATACATGG	M60119	CCDS43510.1	6q23-q24	2013-01-08	2001-11-28		ENSG00000010818	ENSG00000010818		"""Zinc fingers, C2H2-type"""	4921	protein-coding gene	gene with protein product	"""c-myc intron binding protein 1"""	143054	"""human immunodeficiency virus type I enhancer-binding protein 2"""			1733857, 2022670	Standard	NM_006734		Approved	MBP-2, HIV-EP2, MIBP1, ZAS2, Schnurri-2, ZNF40B	uc003qjd.3	P31629	OTTHUMG00000015713	ENST00000367604.1:c.658A>G	6.37:g.143095218T>C	ENSP00000356576:p.Ile220Val	Somatic	139	0		WXS	Illumina GAIIx	Phase_I	118	82	NM_006734	0	0	0	1	1	Q02646|Q5THT5|Q9NS05	Missense_Mutation	SNP	ENST00000367604.1	37	CCDS43510.1	.	.	.	.	.	.	.	.	.	.	T	1.772	-0.484010	0.04383	.	.	ENSG00000010818	ENST00000367604;ENST00000367603;ENST00000012134	T;T;T	0.17691	2.26;2.26;2.26	5.98	2.36	0.29203	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.215030	0.47093	N	0.000259	T	0.01523	0.0049	N	0.05510	-0.035	0.25137	N	0.990525	B	0.02656	0.0	B	0.08055	0.003	T	0.47235	-0.9133	10	0.05620	T	0.96	-14.6477	6.265	0.20922	0.0:0.5315:0.0:0.4685	.	220	P31629	ZEP2_HUMAN	V	220	ENSP00000356576:I220V;ENSP00000356575:I220V;ENSP00000012134:I220V	ENSP00000012134:I220V	I	-	1	0	HIVEP2	143136911	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	2.715000	0.47210	0.517000	0.28361	0.533000	0.62120	ATA	.		0.458	HIVEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042495.1		
SASH1	23328	bcgsc.ca	37	6	148792617	148792617	+	Silent	SNP	A	A	G	rs1883625	byFrequency	TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr6:148792617A>G	ENST00000367467.3	+	6	967	c.492A>G	c.(490-492)ggA>ggG	p.G164G		NM_015278.3	NP_056093.3	O94885	SASH1_HUMAN	SAM and SH3 domain containing 1	164					positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|positive regulation of p38MAPK cascade (GO:1900745)|protein polyubiquitination (GO:0000209)|regulation of protein autoubiquitination (GO:1902498)|regulation of protein K63-linked ubiquitination (GO:1900044)	membrane (GO:0016020)|protein complex (GO:0043234)	mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein C-terminus binding (GO:0008022)|protein complex scaffold (GO:0032947)|protein kinase binding (GO:0019901)			breast(4)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(11)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Ovarian(120;0.0169)		OV - Ovarian serous cystadenocarcinoma(155;5.63e-11)|GBM - Glioblastoma multiforme(68;0.0701)		ACCAGAAAGGAATAATGAGAC	0.368													A|||	1088	0.217252	0.4017	0.0965	5008	,	,		16207	0.1389		0.1402	False		,,,				2504	0.2137				p.G164G		.											.	SASH1-90	0			c.A492G						.	A		1511,2895	476.4+/-357.6	250,1011,942	58.0	57.0	58.0		492	3.3	1.0	6	dbSNP_92	58	1022,7578	213.5+/-253.4	56,910,3334	no	coding-synonymous	SASH1	NM_015278.3		306,1921,4276	GG,GA,AA		11.8837,34.2941,19.4756		164/1248	148792617	2533,10473	2203	4300	6503	SO:0001819	synonymous_variant	23328	exon6			GAAAGGAATAATG	AB018333	CCDS5212.1	6q24.3	2013-01-10			ENSG00000111961	ENSG00000111961		"""SAM and SH3 domain containing"", ""Sterile alpha motif (SAM) domain containing"""	19182	protein-coding gene	gene with protein product		607955				9872452, 12771949	Standard	NM_015278		Approved	KIAA0790, dJ323M4.1, SH3D6A	uc003qme.1	O94885	OTTHUMG00000015773	ENST00000367467.3:c.492A>G	6.37:g.148792617A>G		Somatic	257	1		WXS	Illumina GAIIx	Phase_I	246	7	NM_015278	0	0	5	5	0	Q5TGN5|Q8TAI0|Q9H7R7	Silent	SNP	ENST00000367467.3	37	CCDS5212.1																																																																																			A|0.811;G|0.189		0.368	SASH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042619.1	NM_015278	
GSAP	54103	broad.mit.edu	37	7	77011934	77011934	+	Silent	SNP	A	A	G	rs386714856|rs112297229	byFrequency	TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr7:77011934A>G	ENST00000257626.7	-	7	561	c.483T>C	c.(481-483)caT>caC	p.H161H		NM_017439.3	NP_059135.2	A4D1B5	GSAP_HUMAN	gamma-secretase activating protein	161					positive regulation of beta-amyloid formation (GO:1902004)|regulation of proteolysis (GO:0030162)	trans-Golgi network (GO:0005802)	beta-amyloid binding (GO:0001540)										CTGGAAGAGGATGACTTTCAA	0.338																																					p.H161H		.											.	PION-514	0			c.T483C						.						87.0	82.0	84.0					7																	77011934		1831	4081	5912	SO:0001819	synonymous_variant	54103	exon7			AAGAGGATGACTT		CCDS34672.2	7q11.23	2013-04-05	2013-04-05	2013-04-05	ENSG00000186088	ENSG00000186088			28042	protein-coding gene	gene with protein product		613552	"""pigeon homolog (Drosophila)"""	PION		20811458	Standard	NM_017439		Approved	LOC54103	uc003ugf.3	A4D1B5	OTTHUMG00000150504	ENST00000257626.7:c.483T>C	7.37:g.77011934A>G		Somatic	96	1		WXS	Illumina GAIIx	Phase_I	121	4	NM_017439	0	0	4	4	0	A4D1B6|Q3MJC0|Q8ND73|Q9UMH3|Q9Y4L9	Silent	SNP	ENST00000257626.7	37	CCDS34672.2																																																																																			A|0.999;T|0.001		0.338	GSAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318672.2	NM_017439	
SEMA3E	9723	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	83032010	83032010	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr7:83032010C>T	ENST00000307792.3	-	10	1548	c.1081G>A	c.(1081-1083)Gaa>Aaa	p.E361K	SEMA3E_ENST00000427262.1_Missense_Mutation_p.E301K	NM_012431.2	NP_036563.1	O15041	SEM3E_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E	361	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell-matrix adhesion (GO:0001953)|patterning of blood vessels (GO:0001569)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of cell shape (GO:0008360)|semaphorin-plexin signaling pathway (GO:0071526)|sprouting angiogenesis (GO:0002040)|synapse organization (GO:0050808)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(19)|ovary(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	51		Medulloblastoma(109;0.109)				TCAGGTCCTTCCTTATGTGCA	0.368																																					p.E361K		.											.	SEMA3E-93	0			c.G1081A						.						99.0	88.0	92.0					7																	83032010		2203	4300	6503	SO:0001583	missense	9723	exon10			GTCCTTCCTTATG	AB002329	CCDS34674.1, CCDS55121.1	7q21.11	2013-01-11			ENSG00000170381	ENSG00000170381		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10727	protein-coding gene	gene with protein product	"""M-sema H"""	608166		SEMAH		9205841, 9515811	Standard	NM_012431		Approved	M-SemaK, KIAA0331, coll-5	uc003uhy.2	O15041	OTTHUMG00000154693	ENST00000307792.3:c.1081G>A	7.37:g.83032010C>T	ENSP00000303212:p.Glu361Lys	Somatic	117	1		WXS	Illumina GAIIx	Phase_I	169	25	NM_012431	0	0	0	0	0	B4E1P1|Q75M94|Q75M97	Missense_Mutation	SNP	ENST00000307792.3	37	CCDS34674.1	.	.	.	.	.	.	.	.	.	.	C	35	5.596468	0.96602	.	.	ENSG00000170381	ENST00000307792;ENST00000427262;ENST00000541514	T;T	0.12255	2.7;2.7	5.41	5.41	0.78517	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	T	0.31009	0.0783	L	0.41824	1.3	0.80722	D	1	D	0.76494	0.999	D	0.77557	0.99	T	0.00855	-1.1539	10	0.46703	T	0.11	.	19.1854	0.93641	0.0:1.0:0.0:0.0	.	361	O15041	SEM3E_HUMAN	K	361;301;361	ENSP00000303212:E361K;ENSP00000405052:E301K	ENSP00000303212:E361K	E	-	1	0	SEMA3E	82869946	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.792000	0.85828	2.536000	0.85505	0.585000	0.79938	GAA	.		0.368	SEMA3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336606.1	NM_012431	
GAL3ST4	79690	broad.mit.edu	37	7	99757680	99757680	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr7:99757680G>T	ENST00000360039.4	-	4	1724	c.1332C>A	c.(1330-1332)agC>agA	p.S444R	C7orf43_ENST00000457641.1_5'Flank|C7orf43_ENST00000419841.1_5'Flank|C7orf43_ENST00000316937.3_5'Flank|GAL3ST4_ENST00000411994.1_3'UTR|C7orf43_ENST00000498638.1_5'Flank|GAL3ST4_ENST00000423751.1_3'UTR|GAL3ST4_ENST00000426974.2_Missense_Mutation_p.S382R|GAL3ST4_ENST00000413800.1_Missense_Mutation_p.S444R	NM_024637.4	NP_078913.3	Q96RP7	G3ST4_HUMAN	galactose-3-O-sulfotransferase 4	444					cell-cell signaling (GO:0007267)|glycoprotein metabolic process (GO:0009100)|oligosaccharide metabolic process (GO:0009311)|proteoglycan biosynthetic process (GO:0030166)|sulfur compound metabolic process (GO:0006790)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|galactose 3-O-sulfotransferase activity (GO:0050694)|galactosylceramide sulfotransferase activity (GO:0001733)|proteoglycan sulfotransferase activity (GO:0050698)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(8)|ovary(5)|prostate(1)|upper_aerodigestive_tract(1)	26	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GGTCTTGGGGGCTCAATCCAC	0.562																																					p.S444R		.											.	GAL3ST4-47	0			c.C1332A						.						99.0	84.0	89.0					7																	99757680		2203	4300	6503	SO:0001583	missense	79690	exon4			TTGGGGGCTCAAT	AF316113	CCDS5688.1	7q22.1	2007-04-02			ENSG00000197093	ENSG00000197093		"""Sulfotransferases, membrane-bound"""	24145	protein-coding gene	gene with protein product		608235				11333265	Standard	NM_024637		Approved	FLJ12116	uc003utu.3	Q96RP7	OTTHUMG00000154885	ENST00000360039.4:c.1332C>A	7.37:g.99757680G>T	ENSP00000353142:p.Ser444Arg	Somatic	116	1		WXS	Illumina GAIIx	Phase_I	123	10	NM_024637	0	0	0	0	0	A4D2A8|B4DWL8|D6W5U5|Q8N3P7|Q8WZ17|Q96E33|Q9HA78	Missense_Mutation	SNP	ENST00000360039.4	37	CCDS5688.1	.	.	.	.	.	.	.	.	.	.	G	9.837	1.189969	0.21954	.	.	ENSG00000197093	ENST00000413800;ENST00000360039;ENST00000426974	T;T;T	0.14022	2.54;2.54;2.54	5.92	5.04	0.67666	.	0.396572	0.24506	U	0.037935	T	0.17023	0.0409	L	0.29908	0.895	0.29294	N	0.869174	D;B	0.54772	0.968;0.099	P;B	0.56960	0.81;0.035	T	0.05435	-1.0885	10	0.23891	T	0.37	-5.8643	8.1364	0.31056	0.0795:0.0:0.7656:0.1549	.	382;444	B4DWL8;Q96RP7	.;G3ST4_HUMAN	R	444;444;382	ENSP00000400451:S444R;ENSP00000353142:S444R;ENSP00000398304:S382R	ENSP00000353142:S444R	S	-	3	2	GAL3ST4	99595616	0.904000	0.30761	0.990000	0.47175	0.703000	0.40648	2.094000	0.41719	1.517000	0.48917	0.561000	0.74099	AGC	.		0.562	GAL3ST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337495.2	NM_024637	
SPDYE3	441272	bcgsc.ca	37	7	99917416	99917416	+	Silent	SNP	G	G	A	rs112622797	byFrequency	TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr7:99917416G>A	ENST00000332397.6	+	9	1759	c.1575G>A	c.(1573-1575)ccG>ccA	p.P525P	SPDYE3_ENST00000437326.2_Silent_p.P148P	NM_001004351.4	NP_001004351.3	A6NKU9	SPDE3_HUMAN	speedy/RINGO cell cycle regulator family member E3	525										endometrium(10)|kidney(1)|lung(8)|urinary_tract(1)	20						GGGTTTCCCCGGAGGAGTTGG	0.627													.|||	389	0.0776757	0.0136	0.0879	5008	,	,		14174	0.0278		0.174	False		,,,				2504	0.1094				p.P525P		.											.	SPDYE3-22	0			c.G1575A						.	G		184,4222	109.9+/-148.2	4,176,2023	47.0	56.0	53.0		1575	0.2	0.0	7	dbSNP_132	53	1635,6963	289.3+/-299.2	149,1337,2813	no	coding-synonymous	SPDYE3	NM_001004351.4		153,1513,4836	AA,AG,GG		19.0161,4.1761,13.988		525/550	99917416	1819,11185	2203	4299	6502	SO:0001819	synonymous_variant	441272	exon9			TTCCCCGGAGGAG	BC056606	CCDS47658.1, CCDS47658.2	7q22.1	2013-05-08	2013-05-08		ENSG00000214300	ENSG00000214300		"""Speedy homologs"""	35462	protein-coding gene	gene with protein product			"""speedy homolog E3 (Xenopus laevis)"""				Standard	NM_001004351		Approved		uc022aij.1	A6NKU9	OTTHUMG00000155462	ENST00000332397.6:c.1575G>A	7.37:g.99917416G>A		Somatic	75	1		WXS	Illumina GAIIx	Phase_I	113	7	NM_001004351	0	0	21	32	11	Q495Y9|Q6PHC4	Silent	SNP	ENST00000332397.6	37	CCDS47658.2																																																																																			G|0.905;A|0.095		0.627	SPDYE3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000340224.2	NM_001004351	
RELN	5649	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	103276868	103276868	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr7:103276868G>A	ENST00000428762.1	-	18	2276	c.2117C>T	c.(2116-2118)aCa>aTa	p.T706I	RELN_ENST00000424685.2_Missense_Mutation_p.T706I|RELN_ENST00000343529.5_Missense_Mutation_p.T706I	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	706					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		CATTGGGAATGTCTGGGATGC	0.433																																					p.T706I	NSCLC(146;835 1944 15585 22231 52158)	.											.	RELN-574	0			c.C2117T						.						50.0	53.0	52.0					7																	103276868		2203	4300	6503	SO:0001583	missense	5649	exon18			GGGAATGTCTGGG		CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.2117C>T	7.37:g.103276868G>A	ENSP00000392423:p.Thr706Ile	Somatic	219	0		WXS	Illumina GAIIx	Phase_I	276	45	NM_173054	0	0	0	0	0	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	ENST00000428762.1	37	CCDS47680.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.550491	0.86127	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	T;T;T	0.23552	1.9;1.9;1.9	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.39462	0.1079	N	0.19112	0.55	0.58432	D	0.999999	D;D	0.89917	1.0;0.998	D;D	0.85130	0.997;0.986	T	0.20638	-1.0269	10	0.46703	T	0.11	.	19.9658	0.97266	0.0:0.0:1.0:0.0	.	706;706	P78509-2;P78509	.;RELN_HUMAN	I	706	ENSP00000392423:T706I;ENSP00000345694:T706I;ENSP00000388446:T706I	ENSP00000345694:T706I	T	-	2	0	RELN	103064104	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.224000	0.95209	2.721000	0.93114	0.591000	0.81541	ACA	.		0.433	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045	
PODXL	5420	hgsc.bcm.edu	37	7	131241055	131241055	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr7:131241055A>G	ENST00000378555.3	-	1	311	c.64T>C	c.(64-66)Tcg>Ccg	p.S22P	PODXL_ENST00000322985.9_Missense_Mutation_p.S22P|PODXL_ENST00000465001.1_Intron|PODXL_ENST00000541194.1_Missense_Mutation_p.S22P|PODXL_ENST00000537928.1_Missense_Mutation_p.S22P			O00592	PODXL_HUMAN	podocalyxin-like	22					cell adhesion (GO:0007155)|cell migration (GO:0016477)|epithelial tube formation (GO:0072175)|glomerular visceral epithelial cell development (GO:0072015)|leukocyte migration (GO:0050900)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-cell adhesion (GO:0022408)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|regulation of microvillus assembly (GO:0032534)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|slit diaphragm (GO:0036057)				NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24	Melanoma(18;0.162)					gacggcgacgacggcagcagc	0.741																																					p.S22P		.											.	PODXL-136	0			c.T64C						.						5.0	8.0	7.0					7																	131241055		1914	3836	5750	SO:0001583	missense	5420	exon1			GCGACGACGGCAG		CCDS34755.1, CCDS47714.1	7q32-q33	2008-07-18			ENSG00000128567	ENSG00000128567			9171	protein-coding gene	gene with protein product		602632					Standard	NM_001018111		Approved	PCLP, Gp200, PC	uc003vqx.4	O00592	OTTHUMG00000154918	ENST00000378555.3:c.64T>C	7.37:g.131241055A>G	ENSP00000367817:p.Ser22Pro	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	21	5	NM_001018111	0	0	10	10	0	A6NHX8|Q52LZ7|Q53ER6	Missense_Mutation	SNP	ENST00000378555.3	37	CCDS34755.1	.	.	.	.	.	.	.	.	.	.	A	10.93	1.488975	0.26686	.	.	ENSG00000128567	ENST00000541194;ENST00000537928;ENST00000378555;ENST00000322985	T;T;T;T	0.12774	2.82;2.65;2.82;2.85	.	.	.	.	7739.210000	0.00166	U	0.000000	T	0.08670	0.0215	N	0.14661	0.345	0.09310	N	0.999994	.	.	.	.	.	.	T	0.24728	-1.0152	6	0.29301	T	0.29	.	.	.	.	.	22;22	O00592-2;O00592	.;PODXL_HUMAN	P	22	ENSP00000440518:S22P;ENSP00000442655:S22P;ENSP00000367817:S22P;ENSP00000319782:S22P	ENSP00000319782:S22P	S	-	1	0	PODXL	130891595	0.001000	0.12720	0.027000	0.17364	0.027000	0.11550	0.743000	0.26231	0.056000	0.16144	0.055000	0.15244	TCG	.		0.741	PODXL-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000337627.2	NM_001018111	
DLGAP2	9228	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	1645390	1645390	+	Silent	SNP	C	C	T	rs576181056		TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr8:1645390C>T	ENST00000421627.2	+	11	2768	c.2634C>T	c.(2632-2634)gaC>gaT	p.D878D		NM_004745.3	NP_004736.2	Q9P1A6	DLGP2_HUMAN	discs, large (Drosophila) homolog-associated protein 2	957					neuron-neuron synaptic transmission (GO:0007270)	cell junction (GO:0030054)|neurofilament (GO:0005883)|postsynaptic membrane (GO:0045211)				breast(1)|endometrium(6)|lung(31)|prostate(3)	41		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		CCATTGAGGACGTCAGCATGA	0.632													C|||	1	0.000199681	0.0	0.0	5008	,	,		17922	0.001		0.0	False		,,,				2504	0.0				p.D878D		.											.	DLGAP2-22	0			c.C2634T						.						45.0	52.0	50.0					8																	1645390		2009	4170	6179	SO:0001819	synonymous_variant	9228	exon11			TGAGGACGTCAGC	AB000275	CCDS47760.1, CCDS75689.1	8p23	2007-12-06	2001-11-28		ENSG00000198010	ENSG00000198010			2906	protein-coding gene	gene with protein product		605438	"""discs, large (Drosophila) homolog-associated protein 2"""			9286858, 10854099	Standard	NM_004745		Approved	DAP-2	uc003wpl.4	Q9P1A6	OTTHUMG00000163599	ENST00000421627.2:c.2634C>T	8.37:g.1645390C>T		Somatic	152	0		WXS	Illumina GAIIx	Phase_I	107	92	NM_004745	0	0	0	0	0	A1QCF8|A1QCF9|A5D8Y2|O14488|O14664|Q9P1A7	Silent	SNP	ENST00000421627.2	37	CCDS47760.1	.	.	.	.	.	.	.	.	.	.	C	8.234	0.805387	0.16467	.	.	ENSG00000198010	ENST00000520901	.	.	.	5.06	-0.873	0.10635	.	.	.	.	.	T	0.58366	0.2117	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53287	-0.8460	4	.	.	.	-12.7986	11.7631	0.51914	0.0:0.2556:0.0:0.7444	.	.	.	.	M	881	.	.	T	+	2	0	DLGAP2	1632797	0.038000	0.19896	0.989000	0.46669	0.761000	0.43186	-0.926000	0.03988	-0.412000	0.07519	-0.258000	0.10820	ACG	.		0.632	DLGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374478.1	NM_004745	
BHLHE22	27319	bcgsc.ca	37	8	65493429	65493429	+	Missense_Mutation	SNP	T	T	G	rs7016250	byFrequency	TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr8:65493429T>G	ENST00000321870.1	+	1	616	c.82T>G	c.(82-84)Tcc>Gcc	p.S28A	RP11-21C4.1_ENST00000517909.1_RNA	NM_152414.4	NP_689627.1	Q8NFJ8	BHE22_HUMAN	basic helix-loop-helix family, member e22	28			S -> A (in dbSNP:rs7016250).		anterior commissure morphogenesis (GO:0021960)|cerebral cortex regionalization (GO:0021796)|corpus callosum morphogenesis (GO:0021540)|corticospinal tract morphogenesis (GO:0021957)|negative regulation of transcription, DNA-templated (GO:0045892)|retinal bipolar neuron differentiation (GO:0060040)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|central_nervous_system(1)|lung(1)|prostate(1)|skin(1)	5						CGCCTCCACCTCCAAGCGCTT	0.741													G|||	2648	0.528754	0.77	0.4452	5008	,	,		7262	0.5546		0.326	False		,,,				2504	0.4438				p.S28A	Colon(113;104 1586 2865 9855 18065)	.											.	BHLHE22-90	0			c.T82G						.	G	ALA/SER	2630,1430		896,838,296	8.0	8.0	8.0		82	2.5	1.0	8	dbSNP_116	8	2053,6051		317,1419,2316	yes	missense	BHLHE22	NM_152414.4	99	1213,2257,2612	GG,GT,TT		25.3332,35.2217,38.4988	benign	28/382	65493429	4683,7481	2030	4052	6082	SO:0001583	missense	27319	exon1			TCCACCTCCAAGC	U80755	CCDS6179.1	8q12.1	2009-01-12	2009-01-12	2009-01-12		ENSG00000180828		"""Basic helix-loop-helix proteins"""	11963	protein-coding gene	gene with protein product		613483	"""trinucleotide repeat containing 20"", ""basic helix-loop-helix domain containing, class B, 5"""	TNRC20, BHLHB5		9225980, 12213201, 18557763	Standard	NM_152414		Approved	CAGL85, Beta3, bHLHe22	uc003xvi.3	Q8NFJ8		ENST00000321870.1:c.82T>G	8.37:g.65493429T>G	ENSP00000318799:p.Ser28Ala	Somatic	6	0		WXS	Illumina GAIIx	Phase_I	26	26	NM_152414	0	0	0	0	0		Missense_Mutation	SNP	ENST00000321870.1	37	CCDS6179.1	1097	0.5022893772893773	369	0.75	153	0.42265193370165743	335	0.5856643356643356	240	0.316622691292876	t	0.020	-1.436684	0.01108	0.647783	0.253332	ENSG00000180828	ENST00000321870	D	0.94537	-3.45	3.39	2.5	0.30297	.	0.179067	0.36374	N	0.002635	T	0.00012	0.0000	N	0.04880	-0.145	0.49051	P	2.590000000000092E-4	B	0.02656	0.0	B	0.01281	0.0	T	0.42649	-0.9439	9	0.02654	T	1	-14.5881	7.3158	0.26499	0.0929:0.0:0.7396:0.1674	rs7016250	28	Q8NFJ8	BHE22_HUMAN	A	28	ENSP00000318799:S28A	ENSP00000318799:S28A	S	+	1	0	BHLHE22	65655983	1.000000	0.71417	0.993000	0.49108	0.580000	0.36256	3.146000	0.50631	0.272000	0.22027	-0.399000	0.06403	TCC	T|0.528;G|0.472		0.741	BHLHE22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378549.1	NM_152414	
SPATA31D1	389763	broad.mit.edu;bcgsc.ca	37	9	84605762	84605762	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr9:84605762C>T	ENST00000344803.2	+	4	424	c.377C>T	c.(376-378)cCa>cTa	p.P126L		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	126					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											CTGTTATGCCCAGACCCCGTC	0.542																																					p.P126L		.											.	.	0			c.C377T						.						107.0	98.0	101.0					9																	84605762		1980	4156	6136	SO:0001583	missense	389763	exon4			TATGCCCAGACCC		CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.377C>T	9.37:g.84605762C>T	ENSP00000341988:p.Pro126Leu	Somatic	139	0		WXS	Illumina GAIIx	Phase_I	88	4	NM_001001670	0	0	0	0	0		Missense_Mutation	SNP	ENST00000344803.2	37	CCDS47986.1	.	.	.	.	.	.	.	.	.	.	C	17.19	3.325873	0.60743	.	.	ENSG00000214929	ENST00000344803	T	0.05786	3.39	2.98	2.98	0.34508	.	0.290510	0.25151	N	0.032742	T	0.19604	0.0471	M	0.68952	2.095	0.41608	D	0.988893	D	0.89917	1.0	D	0.91635	0.999	T	0.00607	-1.1647	10	0.87932	D	0	-21.193	9.7439	0.40435	0.0:1.0:0.0:0.0	.	126	Q6ZQQ2	F75D1_HUMAN	L	126	ENSP00000341988:P126L	ENSP00000341988:P126L	P	+	2	0	FAM75D1	83795582	1.000000	0.71417	0.940000	0.37924	0.024000	0.10985	2.359000	0.44142	2.000000	0.58554	0.644000	0.83932	CCA	.		0.542	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402325.1	NM_001001670	
FAM9A	171482	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	8763159	8763159	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chrX:8763159T>A	ENST00000543214.1	-	7	926	c.791A>T	c.(790-792)gAg>gTg	p.E264V	FAM9A_ENST00000381003.3_Missense_Mutation_p.E264V	NM_001171186.1	NP_001164657.1	Q8IZU1	FAM9A_HUMAN	family with sequence similarity 9, member A	264	Glu-rich.					nucleus (GO:0005634)				endometrium(11)|kidney(2)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)	18		Hepatocellular(5;0.219)				ttcctcttcctcttcttctgt	0.423																																					p.E264V		.											.	FAM9A-130	0			c.A791T						.						57.0	51.0	53.0					X																	8763159		2200	4299	6499	SO:0001583	missense	171482	exon7			TCTTCCTCTTCTT		CCDS14131.1	Xp22.32	2012-11-29			ENSG00000183304	ENSG00000183304			18403	protein-coding gene	gene with protein product	"""testis expressed 39A"""	300477					Standard	NM_174951		Approved	TEX39A	uc004csg.3	Q8IZU1	OTTHUMG00000021110	ENST00000543214.1:c.791A>T	X.37:g.8763159T>A	ENSP00000440163:p.Glu264Val	Somatic	84	0		WXS	Illumina GAIIx	Phase_I	48	7	NM_174951	0	0	0	0	0	B7ZLH5|Q2M2D1	Missense_Mutation	SNP	ENST00000543214.1	37	CCDS14131.1	.	.	.	.	.	.	.	.	.	.	t	4.453	0.083901	0.08583	.	.	ENSG00000183304	ENST00000381003;ENST00000543214	.	.	.	.	.	.	.	.	.	.	.	T	0.20088	0.0483	N	0.08118	0	0.09310	N	1	P	0.47106	0.89	P	0.49332	0.607	T	0.14008	-1.0488	6	0.66056	D	0.02	.	.	.	.	.	264	Q8IZU1	FAM9A_HUMAN	V	264	.	ENSP00000370391:E264V	E	-	2	0	FAM9A	8723159	0.015000	0.18098	0.026000	0.17262	0.026000	0.11368	0.280000	0.18790	0.085000	0.17107	0.084000	0.15446	GAG	.		0.423	FAM9A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055697.1	NM_174951	
SRPX	8406	broad.mit.edu	37	X	38079976	38079978	+	In_Frame_Del	DEL	GCA	GCA	-	rs35523939|rs72249350|rs139109693		TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chrX:38079976_38079978delGCA	ENST00000378533.3	-	1	174_176	c.68_70delTGC	c.(67-72)ctgcgc>cgc	p.L23del	RP13-43E11.1_ENST00000423919.1_RNA|SRPX_ENST00000544439.1_In_Frame_Del_p.L23del|TM4SF2_ENST00000465127.1_Intron|SRPX_ENST00000343800.6_Intron|SRPX_ENST00000538295.1_In_Frame_Del_p.L23del|SRPX_ENST00000432886.2_In_Frame_Del_p.L23del	NM_006307.4	NP_006298.1	P78539	SRPX_HUMAN	sushi-repeat containing protein, X-linked	23			Missing. {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:8634709, ECO:0000269|PubMed:9162095}.		autophagy (GO:0006914)|cell adhesion (GO:0007155)|negative regulation of cell proliferation involved in contact inhibition (GO:0060244)|phagolysosome assembly (GO:0001845)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|response to endoplasmic reticulum stress (GO:0034976)	autophagic vacuole (GO:0005776)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)		p.L23delL(2)		autonomic_ganglia(1)|breast(2)|endometrium(5)|large_intestine(5)|lung(10)|prostate(2)	25						GGCGGGACGCgcagcagcagcag	0.729											OREG0019726	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)		636	0.168477	0.1657	0.1398	3775	,	,		8591	0.0129		0.2028	False		,,,				2504	0.1053				p.23_24del		.											.	SRPX-130	2	Deletion - In frame(2)	prostate(2)	c.68_70del						.																																			SO:0001651	inframe_deletion	8406	exon1			GGACGCGCAGCAG	U78093	CCDS14245.1, CCDS55400.1, CCDS55401.1, CCDS55402.1	Xp21.1	2011-01-25	2011-01-25		ENSG00000101955	ENSG00000101955			11309	protein-coding gene	gene with protein product		300187	"""sushi-repeat-containing protein, X chromosome"", ""sushi-repeat-containing protein, X-linked"""			8634708, 8634709	Standard	NM_006307		Approved	ETX1	uc004ddy.2	P78539	OTTHUMG00000021362	ENST00000378533.3:c.68_70delTGC	X.37:g.38079985_38079987delGCA	ENSP00000367794:p.Leu23del	Somatic	9	0	875	WXS	Illumina GAIIx	Phase_I	25	7	NM_001170751	0	0	0	0	0	A8K065|B3KWP8|B4DDB8|B4DQH5|F5H4D7|G3V1L0|Q4VX66|Q99652|Q99913	In_Frame_Del	DEL	ENST00000378533.3	37	CCDS14245.1																																																																																			-|1.000;|0.000		0.729	SRPX-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056243.1	NM_006307	
BCOR	54880	broad.mit.edu;bcgsc.ca	37	X	39913284	39913284	+	Nonsense_Mutation	SNP	C	C	A			TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chrX:39913284C>A	ENST00000378444.4	-	14	5059	c.4831G>T	c.(4831-4833)Gaa>Taa	p.E1611*	BCOR_ENST00000378463.1_Nonsense_Mutation_p.E454*|BCOR_ENST00000378455.4_Nonsense_Mutation_p.E1559*|BCOR_ENST00000397354.3_Nonsense_Mutation_p.E1577*|BCOR_ENST00000342274.4_Nonsense_Mutation_p.E1577*	NM_001123385.1	NP_001116857.1	Q6W2J9	BCOR_HUMAN	BCL6 corepressor	1611					heart development (GO:0007507)|histone H2A monoubiquitination (GO:0035518)|negative regulation of bone mineralization (GO:0030502)|negative regulation of histone H3-K36 methylation (GO:0000415)|negative regulation of histone H3-K4 methylation (GO:0051572)|negative regulation of tooth mineralization (GO:0070171)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis (GO:0042476)|palate development (GO:0060021)|specification of axis polarity (GO:0065001)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	heat shock protein binding (GO:0031072)|histone deacetylase binding (GO:0042826)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(4)|central_nervous_system(11)|cervix(1)|endometrium(24)|eye(6)|haematopoietic_and_lymphoid_tissue(33)|kidney(2)|large_intestine(11)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	126						TAGCCACTTTCATCATCTGGT	0.413			"""F, N, S, T"""	RARA	"""retinoblastoma, AML, APL(translocation)"""		oculo-facio-cardio-dental genetic																														p.E1611X		.		Rec	yes		X	Xp11.4	54880	BCL6 corepressor	yes		.	BCOR-229	0			c.G4831T						.						58.0	44.0	49.0					X																	39913284		2202	4300	6502	SO:0001587	stop_gained	54880	exon14			CACTTTCATCATC	AF317391	CCDS14250.1, CCDS48092.1, CCDS48093.1	Xp11.4	2014-09-17	2010-06-10		ENSG00000183337	ENSG00000183337		"""Ankyrin repeat domain containing"""	20893	protein-coding gene	gene with protein product		300485	"""BCL6 co-repressor"""			10898795	Standard	NM_017745		Approved	FLJ20285, KIAA1575	uc004den.4	Q6W2J9	OTTHUMG00000024100	ENST00000378444.4:c.4831G>T	X.37:g.39913284C>A	ENSP00000367705:p.Glu1611*	Somatic	158	1		WXS	Illumina GAIIx	Phase_I	125	11	NM_001123385	0	0	0	0	0	D3DWB3|D3DWB4|Q29RF6|Q6P4B6|Q7Z2K7|Q8TEB4|Q96DB3|Q9H232|Q9H233|Q9HCJ7|Q9NXF2	Nonsense_Mutation	SNP	ENST00000378444.4	37	CCDS48093.1	.	.	.	.	.	.	.	.	.	.	C	47	13.331146	0.99735	.	.	ENSG00000183337	ENST00000413905;ENST00000378463;ENST00000378455;ENST00000397354;ENST00000378444;ENST00000342274;ENST00000442018	.	.	.	5.52	5.52	0.82312	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	-21.9491	18.515	0.90933	0.0:1.0:0.0:0.0	.	.	.	.	X	481;454;1559;1577;1611;1577;284	.	ENSP00000345923:E1577X	E	-	1	0	BCOR	39798228	1.000000	0.71417	0.975000	0.42487	0.974000	0.67602	7.267000	0.78462	2.314000	0.78098	0.600000	0.82982	GAA	.		0.413	BCOR-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060666.2	NM_017745	
NUDT10	170685	broad.mit.edu	37	X	51076024	51076024	+	Silent	SNP	G	G	A	rs143435240		TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chrX:51076024G>A	ENST00000376006.3	+	2	427	c.207G>A	c.(205-207)gaG>gaA	p.E69E	NUDT10_ENST00000356450.2_Silent_p.E69E	NM_153183.2	NP_694853.1	Q9BW91	NUDT9_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 10	234					ADP catabolic process (GO:0046032)|IDP catabolic process (GO:0046709)|nucleobase-containing small molecule catabolic process (GO:0034656)|nucleobase-containing small molecule metabolic process (GO:0055086)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|mitochondrial matrix (GO:0005759)	adenosine-diphosphatase activity (GO:0043262)|ADP-ribose diphosphatase activity (GO:0047631)|ADP-sugar diphosphatase activity (GO:0019144)	p.E69E(8)		cervix(1)|endometrium(8)|kidney(1)|large_intestine(1)|lung(1)|prostate(3)|upper_aerodigestive_tract(1)	16	Ovarian(276;0.236)					TGTACGAAGAGGCGGGAGTCA	0.657																																					p.E69E	NSCLC(90;1817 2035 37909 38249)	.											.	NUDT10-90	8	Substitution - coding silent(8)	endometrium(5)|cervix(1)|prostate(1)|lung(1)	c.G207A						.						52.0	62.0	59.0					X																	51076024		2203	4300	6503	SO:0001819	synonymous_variant	170685	exon2			CGAAGAGGCGGGA	AF469196	CCDS35278.1	Xp11.22-p11.1	2014-05-20			ENSG00000122824	ENSG00000122824		"""Nudix motif containing"""	17621	protein-coding gene	gene with protein product		300527				12105228	Standard	NM_153183		Approved	DIPP3a, hDIPP3alpha	uc004dph.3	Q8NFP7	OTTHUMG00000021530	ENST00000376006.3:c.207G>A	X.37:g.51076024G>A		Somatic	180	1		WXS	Illumina GAIIx	Phase_I	194	4	NM_153183	0	0	0	1	1	Q8NBN1|Q8NCB9|Q8NG25	Silent	SNP	ENST00000376006.3	37	CCDS35278.1																																																																																			.		0.657	NUDT10-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056578.1	NM_153183	
TGIF2LX	90316	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	89177681	89177681	+	Silent	SNP	C	C	A			TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chrX:89177681C>A	ENST00000561129.2	+	1	727	c.597C>A	c.(595-597)tcC>tcA	p.S199S	TGIF2LX_ENST00000283891.5_Silent_p.S199S			Q8IUE1	TF2LX_HUMAN	TGFB-induced factor homeobox 2-like, X-linked	199					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(29)|ovary(1)|skin(3)|urinary_tract(1)	40						CTGTCACATCCCCGTCTTCTC	0.562																																					p.S199S		.											.	TGIF2LX-92	0			c.C597A						.						74.0	78.0	77.0					X																	89177681		2203	4300	6503	SO:0001819	synonymous_variant	90316	exon2			CACATCCCCGTCT	AF497480	CCDS14459.1	Xq21.31	2014-05-14	2007-02-07		ENSG00000153779	ENSG00000153779		"""Homeoboxes / TALE class"""	18570	protein-coding gene	gene with protein product		300411	"""TGFB-induced factor 2-like, X-linked"""				Standard	NM_138960		Approved		uc004efe.3	Q8IUE1	OTTHUMG00000021954	ENST00000561129.2:c.597C>A	X.37:g.89177681C>A		Somatic	354	0		WXS	Illumina GAIIx	Phase_I	348	132	NM_138960	0	0	0	0	0	Q5JRM9|Q8TD48	Silent	SNP	ENST00000561129.2	37	CCDS14459.1																																																																																			.		0.562	TGIF2LX-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417911.2	NM_138960	
TENM1	10178	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	123787622	123787622	+	Nonsense_Mutation	SNP	C	C	A			TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chrX:123787622C>A	ENST00000371130.3	-	7	1243	c.1180G>T	c.(1180-1182)Gga>Tga	p.G394*	TENM1_ENST00000422452.2_Nonsense_Mutation_p.G394*	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	394					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										ATCGCCCGTCCCTTCTGAAAC	0.388																																					p.G394X		.											.	.	0			c.G1180T						.						91.0	78.0	82.0					X																	123787622		2203	4300	6503	SO:0001587	stop_gained	10178	exon7			CCCGTCCCTTCTG	AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.1180G>T	X.37:g.123787622C>A	ENSP00000360171:p.Gly394*	Somatic	111	0		WXS	Illumina GAIIx	Phase_I	74	33	NM_001163278	0	0	0	0	0	B2RTR5|Q5JZ17	Nonsense_Mutation	SNP	ENST00000371130.3	37	CCDS14609.1	.	.	.	.	.	.	.	.	.	.	C	39	7.608140	0.98387	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	.	.	.	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.16420	T	0.52	.	18.6615	0.91473	0.0:1.0:0.0:0.0	.	.	.	.	X	394	.	ENSP00000360171:G394X	G	-	1	0	ODZ1	123615303	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.855000	0.75445	2.351000	0.79841	0.529000	0.55759	GGA	.		0.388	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058985.1	NM_014253	
FLNA	2316	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	153577797	153577797	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chrX:153577797C>A	ENST00000369850.3	-	47	7925	c.7689G>T	c.(7687-7689)aaG>aaT	p.K2563N	FLNA_ENST00000369856.3_Missense_Mutation_p.K696N|FLNA_ENST00000422373.1_Missense_Mutation_p.K2555N|FLNA_ENST00000360319.4_Missense_Mutation_p.K2555N|FLNA_ENST00000344736.4_Missense_Mutation_p.K2523N|FLNA_ENST00000498491.1_5'UTR	NM_001110556.1	NP_001104026.1	P21333	FLNA_HUMAN	filamin A, alpha	2563	Self-association site, tail.				actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|blood coagulation (GO:0007596)|cell junction assembly (GO:0034329)|cilium assembly (GO:0042384)|cytoplasmic sequestering of protein (GO:0051220)|early endosome to late endosome transport (GO:0045022)|epithelial to mesenchymal transition (GO:0001837)|establishment of protein localization (GO:0045184)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription factor import into nucleus (GO:0042993)|protein localization to cell surface (GO:0034394)|protein stabilization (GO:0050821)|receptor clustering (GO:0043113)|spindle assembly involved in mitosis (GO:0090307)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical dendrite (GO:0097440)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|Myb complex (GO:0031523)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|Fc-gamma receptor I complex binding (GO:0034988)|glycoprotein binding (GO:0001948)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|Rac GTPase binding (GO:0048365)|Ral GTPase binding (GO:0017160)|Rho GTPase binding (GO:0017048)|signal transducer activity (GO:0004871)|small GTPase binding (GO:0031267)|transcription factor binding (GO:0008134)			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GCCCCAGGCCCTTGGCCACCA	0.652																																					p.K2563N		.											.	FLNA-599	0			c.G7689T						.						50.0	54.0	52.0					X																	153577797		1926	4114	6040	SO:0001583	missense	2316	exon47			CAGGCCCTTGGCC	X70082	CCDS44021.1, CCDS48194.1	Xq28	2009-07-23	2009-07-23		ENSG00000196924	ENSG00000196924			3754	protein-coding gene	gene with protein product	"""actin binding protein 280"""	300017	"""filamin A, alpha (actin binding protein 280)"""	FLN1, FLN, OPD2, OPD1		8406501, 12612583	Standard	NM_001456		Approved	ABP-280	uc004fkk.2	P21333	OTTHUMG00000022712	ENST00000369850.3:c.7689G>T	X.37:g.153577797C>A	ENSP00000358866:p.Lys2563Asn	Somatic	129	1		WXS	Illumina GAIIx	Phase_I	102	39	NM_001110556	0	0	102	102	0	E9KL45|Q5HY53|Q5HY55|Q8NF52	Missense_Mutation	SNP	ENST00000369850.3	37	CCDS48194.1	.	.	.	.	.	.	.	.	.	.	C	12.16	1.855069	0.32791	.	.	ENSG00000196924	ENST00000360319;ENST00000369852;ENST00000422373;ENST00000369850;ENST00000369856;ENST00000344736	D;D;D;D;D	0.84146	-1.81;-1.81;-1.81;-1.81;-1.81	5.92	5.04	0.67666	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.89181	0.6642	L	0.56124	1.755	0.49389	D	0.999783	D;P;D;D	0.76494	0.999;0.692;0.984;0.984	D;P;P;P	0.78314	0.991;0.457;0.87;0.87	D	0.88649	0.3181	10	0.54805	T	0.06	.	9.969	0.41743	0.0:0.8413:0.0:0.1587	.	696;2555;2563;2563	E9PHF0;P21333-2;P21333;E9KL45	.;.;FLNA_HUMAN;.	N	2555;2231;2555;2563;696;2523	ENSP00000353467:K2555N;ENSP00000416926:K2555N;ENSP00000358866:K2563N;ENSP00000358872:K696N;ENSP00000358863:K2523N	ENSP00000358863:K2523N	K	-	3	2	FLNA	153230991	0.969000	0.33509	1.000000	0.80357	0.146000	0.21551	0.180000	0.16860	1.242000	0.43836	0.529000	0.55759	AAG	.		0.652	FLNA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058942.3		
CELSR2	1952	broad.mit.edu	37	1	109792735	109792736	+	In_Frame_Ins	INS	-	-	CGC	rs377757908|rs59201433|rs144034706	byFrequency	TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr1:109792735_109792736insCGC	ENST00000271332.3	+	1	95_96	c.34_35insCGC	c.(34-36)acg>aCGCcg	p.16_17insP		NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	16					cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		CCCCCTCCCAACgccgccgccg	0.752														2846	0.568291	0.4198	0.6311	5008	,	,		10222	0.5298		0.7276	False		,,,				2504	0.6002				p.T12delinsTP	NSCLC(158;1285 2011 34800 34852 42084)	.											.	CELSR2-526	0			c.34_35insCGC						.			1363,1439		473,417,511						3.0	0.1		dbSNP_130	6	4135,1897		1679,777,560	no	coding	CELSR2	NM_001408.2		2152,1194,1071	A1A1,A1R,RR		31.4489,48.6438,37.7632				5498,3336				SO:0001652	inframe_insertion	1952	exon1			CTCCCAACGCCGC	D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.47_49dupCGC	1.37:g.109792742_109792744dupCGC	ENSP00000271332:p.Pro16_Pro16dup	Somatic	4	0		WXS	Illumina GAIIx	Phase_I	9	7	NM_001408	0	0	0	0	0	Q5T2Y7|Q92566	In_Frame_Ins	INS	ENST00000271332.3	37	CCDS796.1																																																																																			-|0.389;CGC|0.611		0.752	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033200.1	NM_001408	
KRT2	3849	hgsc.bcm.edu	37	12	53045640	53045641	+	In_Frame_Ins	INS	-	-	AGCCGCTGCCGCCTCCAA			TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr12:53045640_53045641insAGCCGCTGCCGCCTCCAA	ENST00000309680.3	-	1	307_308	c.286_287insTTGGAGGCGGCAGCGGCT	c.(286-288)ttt>tTTGGAGGCGGCAGCGGCTtt	p.96_96F>FGGGSGF		NM_000423.2	NP_000414.2	P35908	K22E_HUMAN	keratin 2	96	Head.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte activation (GO:0032980)|keratinocyte migration (GO:0051546)|keratinocyte proliferation (GO:0043616)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(18)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32				BRCA - Breast invasive adenocarcinoma(357;0.19)		gccgcctccaaaaccacctcct	0.614																																					p.F96delinsFGGGSGF		.											.	KRT2-92	0			c.287_288insTTGGAGGCGGCAGCGGCT						.																																			SO:0001652	inframe_insertion	3849	exon1			CCTCCAAAACCAC		CCDS8835.1	12q13.13	2013-01-16	2008-08-01	2006-07-17	ENSG00000172867	ENSG00000172867		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6439	protein-coding gene	gene with protein product	"""epidermal ichthyosis bullosa of Siemens"""	600194	"""keratin 2A (epidermal ichthyosis bullosa of Siemens)"""	KRT2A		7524919, 16831889	Standard	NM_000423		Approved	KRTE	uc001sat.3	P35908	OTTHUMG00000169748	ENST00000309680.3:c.286_287insTTGGAGGCGGCAGCGGCT	12.37:g.53045640_53045641insAGCCGCTGCCGCCTCCAA	Exception_encountered	Somatic	76	0		WXS	Illumina GAIIx	Phase_I	161	54	NM_000423	0	0	0	0	0	Q4VAQ2	In_Frame_Ins	INS	ENST00000309680.3	37	CCDS8835.1																																																																																			.		0.614	KRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405704.1	NM_000423	
CTNNB1	1499	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	41266091	41266092	+	Frame_Shift_Ins	INS	-	-	A	rs121913416|rs121913417		TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr3:41266091_41266092insA	ENST00000349496.5	+	3	368_369	c.88_89insA	c.(88-90)tacfs	p.Y30fs	CTNNB1_ENST00000453024.1_Frame_Shift_Ins_p.Y23fs|CTNNB1_ENST00000405570.1_Frame_Shift_Ins_p.Y30fs|CTNNB1_ENST00000396183.3_Frame_Shift_Ins_p.Y30fs|CTNNB1_ENST00000396185.3_Frame_Shift_Ins_p.Y30fs	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	30			Missing (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.A5_A80del(53)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.WQQQSYLD25?(5)|p.W25_D32del(4)|p.?(4)|p.V22_G38del(3)|p.W25_I140del(3)|p.T3_A126del(2)|p.S23_S33del(2)|p.V22_S33del(2)|p.A5fs*7(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.Y30_S33del(2)|p.A5_Q143>E(1)|p.A13_R151del(1)|p.S29_H36del(1)|p.M14_S45del(1)|p.Q28_D32>H(1)|p.Q28fs*20(1)|p.A20_N141del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.H24_G38del(1)|p.S23_I35del(1)|p.H24_L31del(1)|p.Y30_A97del(1)|p.W25_S33del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.Y30C(1)|p.A20_I35del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.S23_A39del(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.Y30_A80del(1)|p.A5_T40del(1)|p.A5_E54del(1)|p.W25_I35del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.Y30_T40del(1)|p.A5_I35del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		GCAACAGTCTTACCTGGACTCT	0.48		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.Y30_L31delinsX	Colon(6;3 56 14213 18255)	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	.	CTNNB1-24361	144	Deletion - In frame(117)|Complex - deletion inframe(16)|Unknown(7)|Deletion - Frameshift(2)|Complex - frameshift(1)|Substitution - Missense(1)	liver(108)|large_intestine(20)|stomach(8)|small_intestine(2)|skin(2)|pancreas(2)|adrenal_gland(1)|haematopoietic_and_lymphoid_tissue(1)	c.88_89insA						.																																			SO:0001589	frameshift_variant	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	CAGTCTTACCTGG	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.89dupA	3.37:g.41266092_41266092dupA	ENSP00000344456:p.Tyr30fs	Somatic	170	0		WXS	Illumina GAIIx	Phase_I	258	119	NM_001098210	0	0	0	0	0	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Nonsense_Mutation	INS	ENST00000349496.5	37	CCDS2694.1																																																																																			.		0.480	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
TBP	6908	broad.mit.edu	37	6	170871013	170871014	+	In_Frame_Ins	INS	-	-	CAG	rs201732168|rs113202486|rs574714675|rs71010672	byFrequency	TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr6:170871013_170871014insCAG	ENST00000392092.2	+	3	468_469	c.189_190insCAG	c.(190-192)cag>CAGcag	p.64_64Q>QQ	TBP_ENST00000540980.1_In_Frame_Ins_p.44_44Q>QQ|TBP_ENST00000230354.6_In_Frame_Ins_p.64_64Q>QQ	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	64	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.Q63_Q64insQ(1)|p.Q63Q(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		agcaacaacaacagcagcagca	0.55																																					p.Q63delinsQQ		.											.	TBP-91	2	Insertion - In frame(1)|Substitution - coding silent(1)	prostate(1)|breast(1)	c.189_190insCAG						.																																			SO:0001652	inframe_insertion	6908	exon3			ACAACAACAGCAG	M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.211_213dupCAG	6.37:g.170871020_170871022dupCAG	ENSP00000375942:p.Gln95dup	Somatic	54	0		WXS	Illumina GAIIx	Phase_I	38	19	NM_003194	0	0	0	0	0	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	In_Frame_Ins	INS	ENST00000392092.2	37	CCDS5315.1																																																																																			-|0.138;CAG|0.862		0.550	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043271.2	NM_003194	
PODXL	5420	hgsc.bcm.edu	37	7	131241029	131241030	+	In_Frame_Ins	INS	-	-	GGCGAC	rs11277659|rs547816245|rs532078953|rs79759078|rs571821675	byFrequency	TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr7:131241029_131241030insGGCGAC	ENST00000378555.3	-	1	336_337	c.89_90insGTCGCC	c.(88-90)ccc>ccGTCGCCc	p.30_30P>PSP	PODXL_ENST00000322985.9_In_Frame_Ins_p.30_30P>PSP|PODXL_ENST00000465001.1_Intron|PODXL_ENST00000541194.1_In_Frame_Ins_p.30_30P>PSP|PODXL_ENST00000537928.1_In_Frame_Ins_p.30_30P>PSP			O00592	PODXL_HUMAN	podocalyxin-like	30					cell adhesion (GO:0007155)|cell migration (GO:0016477)|epithelial tube formation (GO:0072175)|glomerular visceral epithelial cell development (GO:0072015)|leukocyte migration (GO:0050900)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-cell adhesion (GO:0022408)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|regulation of microvillus assembly (GO:0032534)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|slit diaphragm (GO:0036057)		p.P30_S31delPS(2)		NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24	Melanoma(18;0.162)					CATTCTGGGAGggcgacggcga	0.752																																					p.P30delinsPSP		.											.	PODXL-136	2	Deletion - In frame(2)	prostate(2)	c.90_91insGTCGCC						.																																			SO:0001652	inframe_insertion	5420	exon1			CTGGGAGGGCGAC		CCDS34755.1, CCDS47714.1	7q32-q33	2008-07-18			ENSG00000128567	ENSG00000128567			9171	protein-coding gene	gene with protein product		602632					Standard	NM_001018111		Approved	PCLP, Gp200, PC	uc003vqx.4	O00592	OTTHUMG00000154918	ENST00000378555.3:c.84_89dupGTCGCC	7.37:g.131241030_131241035dupGGCGAC	ENSP00000367817:p.SerPro30dup	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	18	0	NM_005397	0	0	0	0	0	A6NHX8|Q52LZ7|Q53ER6	In_Frame_Ins	INS	ENST00000378555.3	37	CCDS34755.1																																																																																			.		0.752	PODXL-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000337627.2	NM_001018111	
CYP4A22	284541	bcgsc.ca	37	1	47610300	47610301	+	Nonsense_Mutation	DNP	AC	AC	TA			TCGA-OR-A5J2-01A-11D-A29I-10	TCGA-OR-A5J2-10A-01D-A29L-10	AC	AC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d97c6076-7e4f-4dbe-85de-12bc0d84d8e8	367617cb-2dce-4769-bd48-49d49dd3d93a	g.chr1:47610300_47610301AC>TA	ENST00000371891.3	+	8	1007_1008	c.976_977AC>TA	c.(976-978)ACa>TAa	p.T326*	CYP4A22_ENST00000294337.3_Nonsense_Mutation_p.T326*|CYP4A22_ENST00000485117.1_Intron|CYP4A22-AS1_ENST00000444042.2_lincRNA|CYP4A22_ENST00000371890.3_Intron	NM_001010969.2	NP_001010969.2	Q5TCH4	CP4AM_HUMAN	cytochrome P450, family 4, subfamily A, polypeptide 22	326						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	alkane 1-monooxygenase activity (GO:0018685)|arachidonic acid omega-hydroxylase activity (GO:0052869)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						CCACGACACCACAGCCAGTGGG	0.584																																					p.T326*	Pancreas(88;1240 1470 2099 14214 37557)	.											.	CYP4A22-139	0			c.C977A						.																																			SO:0001587	stop_gained	284541	exon8			ACACCACAGCCAG		CCDS30707.1	1p33	2007-12-14			ENSG00000162365	ENSG00000162365		"""Cytochrome P450s"""	20575	protein-coding gene	gene with protein product		615341					Standard	XM_005270768		Approved		uc001cqv.1	Q5TCH4	OTTHUMG00000007845	Exception_encountered	1.37:g.47610300_47610301delinsTA	ENSP00000360958:p.Thr326*	Somatic	548	0		WXS	Illumina GAIIx	Phase_I	440	0	NM_001010969	0	0	0	0	0	Q5TCH3|Q6JXK7|Q6JXK8|Q9NRM4	Nonsense_Mutation	DNP	ENST00000371891.3	37	CCDS30707.1																																																																																			.		0.584	CYP4A22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021635.1	XM_208213	
