#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PRDM2	7799	hgsc.bcm.edu	37	1	14105142	14105142	+	Missense_Mutation	SNP	T	T	A	rs151133690	byFrequency	TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr1:14105142T>A	ENST00000235372.7	+	8	1708	c.852T>A	c.(850-852)gaT>gaA	p.D284E	PRDM2_ENST00000503842.1_Intron|PRDM2_ENST00000343137.4_Missense_Mutation_p.D83E|PRDM2_ENST00000311066.5_Missense_Mutation_p.D284E|PRDM2_ENST00000505823.1_Intron|PRDM2_ENST00000376048.5_Intron|PRDM2_ENST00000413440.1_Missense_Mutation_p.D83E	NM_012231.4	NP_036363.2	Q13029	PRDM2_HUMAN	PR domain containing 2, with ZNF domain	284	Asp/Glu-rich (acidic).			EDEEEEEDDDDDELEDEG -> VGGGGGVVVVVSWKARGE (in Ref. 6; AAA87023). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(16)|lung(20)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	55	Ovarian(185;0.249)	all_lung(284;2.56e-05)|Lung NSC(185;4.94e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00224)|Colorectal(212;3.23e-08)|BRCA - Breast invasive adenocarcinoma(304;2.16e-05)|COAD - Colon adenocarcinoma(227;2.53e-05)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00446)|READ - Rectum adenocarcinoma(331;0.0276)|Lung(427;0.145)		aagaagatgatgatgatgatg	0.478																																					p.D284E		.											.	PRDM2-116	0			c.T852A						.	A	GLU/ASP,,GLU/ASP,GLU/ASP	0,4406		0,0,2203	65.0	65.0	65.0		249,,852,852	-10.8	0.1	1	dbSNP_134	65	1,8599	819.1+/-406.8	0,1,4299	yes	missense,intron,missense,missense	PRDM2	NM_001007257.2,NM_001135610.1,NM_012231.4,NM_015866.4	45,,45,45	0,1,6502	AA,AT,TT		0.0116,0.0,0.0077	benign,,benign,benign	83/1482,,284/1719,284/1683	14105142	1,13005	2203	4300	6503	SO:0001583	missense	7799	exon8			AGATGATGATGAT	U17838	CCDS150.1, CCDS151.1, CCDS30603.1, CCDS44061.1	1p36	2011-07-01			ENSG00000116731	ENSG00000116731		"""Chromatin-modifying enzymes / K-methyltransferases"""	9347	protein-coding gene	gene with protein product	"""retinoblastoma protein-binding zinc finger protein"", ""retinoblastoma protein-interacting zinc finger protein"", ""MTE-binding protein"", ""zinc-finger DNA-binding protein"", ""GATA-3 binding protein G3B"""	601196				7538672	Standard	NM_012231		Approved	RIZ, RIZ1, RIZ2, KMT8, MTB-ZF, HUMHOXY1	uc001avi.3	Q13029	OTTHUMG00000007917	ENST00000235372.7:c.852T>A	1.37:g.14105142T>A	ENSP00000235372:p.Asp284Glu	Somatic	60	0		WXS	Illumina GAIIx	Phase_I	67	13	NM_015866	0	0	0	0	0	B1AJZ4|B5MC68|Q13149|Q14550|Q5THJ1|Q5VUL9	Missense_Mutation	SNP	ENST00000235372.7	37	CCDS150.1	.	.	.	.	.	.	.	.	.	.	A	0.015	-1.545517	0.00926	0.0	1.16E-4	ENSG00000116731	ENST00000235372;ENST00000311066;ENST00000400800;ENST00000413440;ENST00000343137	T;T;T;T	0.01527	4.93;4.8;4.86;4.86	5.4	-10.8	0.00216	.	0.350509	0.23949	N	0.042979	T	0.00637	0.0021	N	0.08118	0	0.09310	N	0.999996	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.0;0.0;0.001	T	0.40608	-0.9554	10	0.02654	T	1	.	8.7593	0.34665	0.3639:0.0:0.4346:0.2015	rs62641612	284;142;284;284	A8MW16;Q5THJ0;Q13029;Q13029-2	.;.;PRDM2_HUMAN;.	E	284;284;284;83;83	ENSP00000235372:D284E;ENSP00000312352:D284E;ENSP00000411103:D83E;ENSP00000341621:D83E	ENSP00000235372:D284E	D	+	3	2	PRDM2	13977729	0.005000	0.15991	0.066000	0.19879	0.053000	0.15095	-5.963000	0.00088	-2.129000	0.00817	-4.500000	0.00005	GAT	T|0.997;A|0.003		0.478	PRDM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000021792.2	NM_012231	
FHAD1	114827	broad.mit.edu	37	1	15635136	15635136	+	Missense_Mutation	SNP	A	A	C	rs201389821	byFrequency	TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr1:15635136A>C	ENST00000375998.4	+	6	943	c.943A>C	c.(943-945)Aag>Cag	p.K315Q	FHAD1_ENST00000417793.1_Missense_Mutation_p.K315Q|FHAD1_ENST00000358897.4_Missense_Mutation_p.K315Q|FHAD1_ENST00000375995.3_Missense_Mutation_p.K21Q|FHAD1_ENST00000401090.2_Missense_Mutation_p.K21Q|FHAD1_ENST00000375999.3_Missense_Mutation_p.K315Q			B1AJZ9	FHAD1_HUMAN	forkhead-associated (FHA) phosphopeptide binding domain 1	315										skin(1)|stomach(1)	2						AGGCTACAGCAAGGTGCTGTG	0.547													C|||	5	0.000998403	0.003	0.0014	5008	,	,		21112	0.0		0.0	False		,,,				2504	0.0				p.K315Q		.											.	FHAD1-69	0			c.A943C						.	C	GLN/LYS	18,1366		0,18,674	67.0	60.0	62.0		943	1.0	1.0	1		62	0,3182		0,0,1591	yes	missense	FHAD1	NM_052929.1	53	0,18,2265	CC,CA,AA		0.0,1.3006,0.3942	benign	315/1413	15635136	18,4548	692	1591	2283	SO:0001583	missense	114827	exon7			TACAGCAAGGTGC	AK093300		1p36.21	2012-04-19			ENSG00000142621	ENSG00000142621			29408	protein-coding gene	gene with protein product						11572484	Standard	NM_052929		Approved	KIAA1937	uc001awb.2	B1AJZ9	OTTHUMG00000002088	ENST00000375998.4:c.943A>C	1.37:g.15635136A>C	ENSP00000365166:p.Lys315Gln	Somatic	181	1		WXS	Illumina GAIIx	Phase_I	143	5	NM_052929	0	0	0	0	0	Q0P6F5|Q8N8D3|Q8N9T6|Q8NA05	Missense_Mutation	SNP	ENST00000375998.4	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	1.369|1.369	-0.586736|-0.586736	0.03827|0.03827	0.013006|0.013006	0.0|0.0	ENSG00000142621|ENSG00000142621	ENST00000358897;ENST00000417793;ENST00000375999;ENST00000375998;ENST00000375995;ENST00000401090|ENST00000375997	T;T;T;T;T|.	0.42131|.	0.99;0.99;0.98;0.99;0.98|.	4.32|4.32	0.971|0.971	0.19698|0.19698	.|.	0.333953|.	0.21205|.	N|.	0.078411|.	T|T	0.05914|0.05914	0.0154|0.0154	N|N	0.00162|0.00162	-1.95|-1.95	0.80722|0.80722	D|D	1|1	B;B|.	0.02656|.	0.0;0.0|.	B;B|.	0.01281|.	0.0;0.0|.	T|T	0.18713|0.18713	-1.0328|-1.0328	10|5	0.06365|.	T|.	0.9|.	-12.6176|-12.6176	8.476|8.476	0.33014|0.33014	0.1671:0.3432:0.4897:0.0|0.1671:0.3432:0.4897:0.0	.|.	315;42|.	B1AJZ9;B1AJZ8|.	FHAD1_HUMAN;.|.	Q|P	315;315;315;315;21;21|29	ENSP00000351770:K315Q;ENSP00000407615:K315Q;ENSP00000365167:K315Q;ENSP00000365166:K315Q;ENSP00000365163:K21Q|.	ENSP00000351770:K315Q|.	K|Q	+|+	1|2	0|0	FHAD1|FHAD1	15507723|15507723	0.986000|0.986000	0.35501|0.35501	0.999000|0.999000	0.59377|0.59377	0.842000|0.842000	0.47809|0.47809	0.178000|0.178000	0.16820|0.16820	0.149000|0.149000	0.19098|0.19098	-1.109000|-1.109000	0.02080|0.02080	AAG|CAA	.		0.547	FHAD1-026	PUTATIVE	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000393400.2	NM_052929	
CLCNKA	1187	bcgsc.ca	37	1	16357147	16357147	+	Missense_Mutation	SNP	C	C	T	rs12140223	byFrequency	TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr1:16357147C>T	ENST00000331433.4	+	15	1619	c.1600C>T	c.(1600-1602)Cgg>Tgg	p.R534W	CLCNKA_ENST00000375692.1_Missense_Mutation_p.R534W|CLCNKA_ENST00000439316.2_Missense_Mutation_p.R491W|CLCNKA_ENST00000464764.1_3'UTR|CLCNKA_ENST00000420078.1_Missense_Mutation_p.R534W			P51800	CLCKA_HUMAN	chloride channel, voltage-sensitive Ka	534			R -> W (in dbSNP:rs12140223).		excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)|metal ion binding (GO:0046872)|voltage-gated chloride channel activity (GO:0005247)			breast(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|skin(1)	19		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)	Niflumic Acid(DB04552)	ATACCTGCCACGGATTCTGGG	0.607													C|||	268	0.0535144	0.0802	0.0447	5008	,	,		20348	0.006		0.0775	False		,,,				2504	0.0481				p.R534W		.											.	CLCNKA-91	0			c.C1600T						.	C	TRP/ARG,TRP/ARG	378,4026	186.7+/-213.5	10,358,1834	42.0	37.0	39.0		1600,1600	-2.6	0.2	1	dbSNP_120	39	805,7791	182.3+/-230.8	35,735,3528	no	missense,missense	CLCNKA	NM_001042704.1,NM_004070.3	101,101	45,1093,5362	TT,TC,CC		9.3648,8.5831,9.1	benign,benign	534/687,534/688	16357147	1183,11817	2202	4298	6500	SO:0001583	missense	1187	exon15			CTGCCACGGATTC		CCDS167.1, CCDS41269.1, CCDS57973.1	1p36	2012-09-26	2012-02-23		ENSG00000186510	ENSG00000186510		"""Ion channels / Chloride channels : Voltage-sensitive"""	2026	protein-coding gene	gene with protein product		602024	"""chloride channel Ka"""			8544406	Standard	NM_004070		Approved	hClC-Ka	uc001axu.3	P51800	OTTHUMG00000009529	ENST00000331433.4:c.1600C>T	1.37:g.16357147C>T	ENSP00000332771:p.Arg534Trp	Somatic	175	0		WXS	Illumina GAIIx	Phase_I	163	6	NM_004070	0	0	0	0	0	B4DPD3|E7EPH6|Q5T5P8|Q5T5Q4|Q7Z6D1|Q86VT1	Missense_Mutation	SNP	ENST00000331433.4	37	CCDS167.1	116	0.05311355311355311	38	0.07723577235772358	18	0.049723756906077346	4	0.006993006993006993	56	0.07387862796833773	C	4.728	0.135402	0.09032	0.085831	0.093648	ENSG00000186510	ENST00000375692;ENST00000420078;ENST00000439316;ENST00000331433	D;D;D;D	0.92858	-3.12;-3.12;-3.12;-3.12	3.89	-2.57	0.06248	Chloride channel, core (2);	0.563319	0.19723	N	0.107547	T	0.11580	0.0282	N	0.03948	-0.315	0.09310	N	1	B;B;B;B	0.18741	0.03;0.001;0.001;0.001	B;B;B;B	0.19666	0.026;0.001;0.001;0.001	T	0.53500	-0.8430	10	0.38643	T	0.18	.	5.0883	0.14694	0.3097:0.4793:0.0:0.211	rs12140223	270;491;534;534	B4DE56;E7EPH6;Q5T5Q4;P51800	.;.;.;CLCKA_HUMAN	W	534;534;491;534	ENSP00000364844:R534W;ENSP00000410353:R534W;ENSP00000414445:R491W;ENSP00000332771:R534W	ENSP00000332771:R534W	R	+	1	2	CLCNKA	16229734	0.000000	0.05858	0.250000	0.24296	0.109000	0.19521	-1.349000	0.02627	-0.379000	0.07906	0.313000	0.20887	CGG	.		0.607	CLCNKA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000026326.1		
PINK1	65018	hgsc.bcm.edu	37	1	20960230	20960230	+	Silent	SNP	C	C	T	rs45540544|rs45630563|rs45530340	byFrequency	TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr1:20960230C>T	ENST00000321556.4	+	1	283	c.189C>T	c.(187-189)ctC>ctT	p.L63L		NM_032409.2	NP_115785.1	Q9BXM7	PINK1_HUMAN	PTEN induced putative kinase 1	63					activation of protein kinase B activity (GO:0032148)|cell death (GO:0008219)|cellular response to hypoxia (GO:0071456)|cellular response to toxic substance (GO:0097237)|intracellular signal transduction (GO:0035556)|mitochondrion degradation (GO:0000422)|mitochondrion organization (GO:0007005)|negative regulation of gene expression (GO:0010629)|negative regulation of hydrogen peroxide-induced neuron intrinsic apoptotic signaling pathway (GO:1903384)|negative regulation of JNK cascade (GO:0046329)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of oxidative stress-induced cell death (GO:1903202)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|negative regulation of oxidative stress-induced neuron death (GO:1903204)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|peptidyl-serine autophosphorylation (GO:0036289)|peptidyl-serine phosphorylation (GO:0018105)|phosphorylation (GO:0016310)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of mitochondrial electron transport, NADH to ubiquinone (GO:1902958)|positive regulation of peptidase activity (GO:0010952)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of synaptic transmission, dopaminergic (GO:0032226)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of mitochondrion degradation (GO:1903146)|regulation of protein complex assembly (GO:0043254)|regulation of protein ubiquitination (GO:0031396)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|TORC2 signaling (GO:0038203)|ubiquitin-dependent protein catabolic process (GO:0006511)	astrocyte projection (GO:0097449)|axon (GO:0030424)|cell body (GO:0044297)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of mitochondrial outer membrane (GO:0031307)|Lewy body (GO:0097413)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|C3HC4-type RING finger domain binding (GO:0055131)|calcium-dependent protein kinase activity (GO:0010857)|kinase activity (GO:0016301)|magnesium ion binding (GO:0000287)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)|protein kinase B binding (GO:0043422)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(4)|ovary(2)	14		all_lung(284;2.72e-05)|Lung NSC(340;2.94e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000147)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(152;1.21e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000146)|Kidney(64;0.000182)|GBM - Glioblastoma multiforme(114;0.000497)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(196;0.00308)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		GGCTCGGGCTCCCTAACCGTC	0.791													C|||	644	0.128594	0.053	0.1571	5008	,	,		6081	0.127		0.1938	False		,,,				2504	0.1452				p.L63L	Esophageal Squamous(145;853 1803 8146 34412 35011)	.											.	PINK1-380	0			c.C189T						.	C		165,3267		4,157,1555	3.0	4.0	3.0		189	0.4	0.9	1	dbSNP_127	3	1114,5976		93,928,2524	no	coding-synonymous	PINK1	NM_032409.2		97,1085,4079	TT,TC,CC		15.7123,4.8077,12.1555		63/582	20960230	1279,9243	1716	3545	5261	SO:0001819	synonymous_variant	65018	exon1			CGGGCTCCCTAAC	AB053323	CCDS211.1	1p36.12	2011-07-21			ENSG00000158828	ENSG00000158828		"""Parkinson disease"""	14581	protein-coding gene	gene with protein product		608309	"""Parkinson disease (autosomal recessive) 6"""	PARK6		11494141, 15349860	Standard	NM_032409		Approved		uc001bdm.3	Q9BXM7	OTTHUMG00000002841	ENST00000321556.4:c.189C>T	1.37:g.20960230C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	4	NM_032409	0	0	0	0	0	Q8N6T9|Q8NBU3|Q96DE4	Silent	SNP	ENST00000321556.4	37	CCDS211.1																																																																																			C|0.868;T|0.132		0.791	PINK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007954.1	NM_032409	
AKR1A1	10327	broad.mit.edu	37	1	46032652	46032652	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr1:46032652T>G	ENST00000372070.3	+	5	1063	c.316T>G	c.(316-318)Tat>Gat	p.Y106D	AKR1A1_ENST00000471651.1_Missense_Mutation_p.Y106D|AKR1A1_ENST00000351829.4_Missense_Mutation_p.Y106D	NM_001202413.1|NM_001202414.1|NM_006066.3	NP_001189342.1|NP_001189343.1|NP_006057.1	P14550	AK1A1_HUMAN	aldo-keto reductase family 1, member A1 (aldehyde reductase)	106					aldehyde catabolic process (GO:0046185)|cellular aldehyde metabolic process (GO:0006081)|D-glucuronate catabolic process (GO:0042840)|glucose metabolic process (GO:0006006)|L-ascorbic acid biosynthetic process (GO:0019853)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|electron carrier activity (GO:0009055)|L-glucuronate reductase activity (GO:0047939)			lung(3)|prostate(1)|urinary_tract(1)	5	Acute lymphoblastic leukemia(166;0.155)				Doxorubicin(DB00997)	CCAGCTGGAGTATCTGGACCT	0.567																																					p.Y106D		.											.	AKR1A1-226	0			c.T316G						.						121.0	103.0	109.0					1																	46032652		2203	4300	6503	SO:0001583	missense	10327	exon5			CTGGAGTATCTGG	J04794	CCDS523.1	1p33-p32	2010-04-08			ENSG00000117448	ENSG00000117448	1.1.1.2	"""Aldo-keto reductases"""	380	protein-coding gene	gene with protein product	"""dihydrodiol dehydrogenase 3"""	103830				2498333, 10393438	Standard	NM_001202414		Approved	ALR, DD3	uc001coe.3	P14550	OTTHUMG00000007740	ENST00000372070.3:c.316T>G	1.37:g.46032652T>G	ENSP00000361140:p.Tyr106Asp	Somatic	104	2		WXS	Illumina GAIIx	Phase_I	78	3	NM_006066	0	0	0	0	0	A8KAL8|D3DQ04|Q6IAZ4	Missense_Mutation	SNP	ENST00000372070.3	37	CCDS523.1	.	.	.	.	.	.	.	.	.	.	T	27.1	4.796481	0.90453	.	.	ENSG00000117448	ENST00000372070;ENST00000434299;ENST00000351829	T;T;T	0.39997	1.05;1.05;1.05	6.01	6.01	0.97437	NADP-dependent oxidoreductase domain (3);	0.109676	0.64402	D	0.000004	T	0.77103	0.4081	H	0.96777	3.88	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.85204	0.1017	10	0.87932	D	0	.	16.5769	0.84704	0.0:0.0:0.0:1.0	.	106	P14550	AK1A1_HUMAN	D	106	ENSP00000361140:Y106D;ENSP00000398414:Y106D;ENSP00000312606:Y106D	ENSP00000312606:Y106D	Y	+	1	0	AKR1A1	45805239	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	7.965000	0.87945	2.317000	0.78254	0.524000	0.50904	TAT	.		0.567	AKR1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020851.1	NM_006066	
SLC44A5	204962	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	75684227	75684227	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr1:75684227G>A	ENST00000370855.5	-	17	1590	c.1477C>T	c.(1477-1479)Cct>Tct	p.P493S	SLC44A5_ENST00000370859.3_Missense_Mutation_p.P493S|SLC44A5_ENST00000535611.1_Missense_Mutation_p.P363S	NM_152697.4	NP_689910.2	Q8NCS7	CTL5_HUMAN	solute carrier family 44, member 5	493					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				kidney(1)|large_intestine(13)|lung(35)|ovary(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	61						ATGTCATCAGGTTTTTTCATG	0.418																																					p.P493S		.											.	SLC44A5-95	0			c.C1477T						.						175.0	162.0	167.0					1																	75684227		2203	4300	6503	SO:0001583	missense	204962	exon17			CATCAGGTTTTTT	BC034580	CCDS667.1, CCDS44164.1	1p31.1	2013-05-22			ENSG00000137968	ENSG00000137968		"""Solute carriers"""	28524	protein-coding gene	gene with protein product						15715662	Standard	NM_152697		Approved	MGC34032, CTL5	uc001dgu.3	Q8NCS7	OTTHUMG00000009721	ENST00000370855.5:c.1477C>T	1.37:g.75684227G>A	ENSP00000359892:p.Pro493Ser	Somatic	177	0		WXS	Illumina GAIIx	Phase_I	171	50	NM_001130058	0	0	0	0	0	B5MCU3|Q4G0K0|Q8NA44|Q8NB86	Missense_Mutation	SNP	ENST00000370855.5	37	CCDS667.1	.	.	.	.	.	.	.	.	.	.	G	16.86	3.239557	0.58995	.	.	ENSG00000137968	ENST00000370859;ENST00000536707;ENST00000370855;ENST00000535611;ENST00000535790	T;T;T	0.21361	2.01;2.01;2.01	5.6	4.69	0.59074	.	0.201274	0.53938	D	0.000057	T	0.25044	0.0608	L	0.60012	1.86	0.80722	D	1	D;P;D;D;D	0.60160	0.975;0.933;0.975;0.987;0.969	P;P;P;D;P	0.62955	0.893;0.838;0.893;0.909;0.868	T	0.03576	-1.1023	10	0.18276	T	0.48	-13.3811	14.7469	0.69494	0.0699:0.0:0.9301:0.0	.	487;532;493;493;532	B7Z5Y4;B7Z470;Q8NCS7;Q8NCS7-2;F5GYS0	.;.;CTL5_HUMAN;.;.	S	493;532;493;363;486	ENSP00000359896:P493S;ENSP00000359892:P493S;ENSP00000443090:P363S	ENSP00000359892:P493S	P	-	1	0	SLC44A5	75456815	1.000000	0.71417	0.993000	0.49108	0.064000	0.16182	7.979000	0.88103	1.511000	0.48818	0.655000	0.94253	CCT	.		0.418	SLC44A5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000026921.1	NM_152697	
DPYD	1806	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	97564178	97564178	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr1:97564178C>T	ENST00000370192.3	-	21	2733	c.2633G>A	c.(2632-2634)aGt>aAt	p.S878N	DPYD-AS1_ENST00000422980.1_RNA	NM_000110.3	NP_000101	Q12882	DPYD_HUMAN	dihydropyrimidine dehydrogenase	878					beta-alanine biosynthetic process (GO:0019483)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase catabolic process (GO:0006145)|pyrimidine nucleobase catabolic process (GO:0006208)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)|thymidine catabolic process (GO:0006214)|thymine catabolic process (GO:0006210)|UMP biosynthetic process (GO:0006222)|uracil catabolic process (GO:0006212)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	4 iron, 4 sulfur cluster binding (GO:0051539)|dihydroorotate dehydrogenase activity (GO:0004152)|dihydropyrimidine dehydrogenase (NADP+) activity (GO:0017113)|flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(18)|lung(30)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(1)	83		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	Capecitabine(DB01101)|Flavin adenine dinucleotide(DB03147)|Fluorouracil(DB00544)	AGGTCCAAAACTTGGCAGTTT	0.328																																					p.S878N		.											.	DPYD-278	0			c.G2633A						.						86.0	84.0	85.0					1																	97564178		2203	4300	6503	SO:0001583	missense	1806	exon21			CCAAAACTTGGCA	U20938	CCDS30777.1, CCDS53346.1	1p22	2014-09-17			ENSG00000188641	ENSG00000188641	1.3.1.2		3012	protein-coding gene	gene with protein product		612779				7713523	Standard	NM_000110		Approved	DPD	uc001drv.3	Q12882	OTTHUMG00000039683	ENST00000370192.3:c.2633G>A	1.37:g.97564178C>T	ENSP00000359211:p.Ser878Asn	Somatic	60	0		WXS	Illumina GAIIx	Phase_I	64	31	NM_000110	0	0	0	0	0	A2RRQ2|A2RRQ3|A8K5A2|A8MWG9|B1AN21|E9PFN1|Q16694|Q16761|Q32NB0|Q96HL6|Q96TH1	Missense_Mutation	SNP	ENST00000370192.3	37	CCDS30777.1	.	.	.	.	.	.	.	.	.	.	C	11.86	1.763404	0.31228	.	.	ENSG00000188641	ENST00000370192	D	0.90069	-2.61	5.66	4.75	0.60458	.	0.000000	0.85682	D	0.000000	T	0.77061	0.4075	L	0.48935	1.535	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.73811	-0.3865	10	0.27082	T	0.32	-12.1033	13.0916	0.59169	0.0:0.9257:0.0:0.0743	.	878	Q12882	DPYD_HUMAN	N	878	ENSP00000359211:S878N	ENSP00000359211:S878N	S	-	2	0	DPYD	97336766	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.113000	0.31184	1.534000	0.49203	0.591000	0.81541	AGT	.		0.328	DPYD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095698.3	NM_000110	
KCND3	3752	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	112329612	112329612	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr1:112329612C>T	ENST00000315987.2	-	3	1702	c.1223G>A	c.(1222-1224)cGg>cAg	p.R408Q	KCND3_ENST00000369697.1_Missense_Mutation_p.R408Q|KCND3_ENST00000302127.4_Missense_Mutation_p.R408Q	NM_004980.4	NP_004971.2	Q9UK17	KCND3_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 3	408				R -> G (in Ref. 2; AAF01044/AAF01045). {ECO:0000305}.	cell death (GO:0008219)|membrane repolarization (GO:0086009)|potassium ion export (GO:0071435)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)	p.R408L(1)		NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(16)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	49		all_cancers(81;8.52e-06)|all_epithelial(167;5.65e-06)|all_lung(203;2.72e-05)|Lung NSC(69;4.56e-05)		all cancers(265;0.056)|Lung(183;0.0576)|Colorectal(144;0.1)|Epithelial(280;0.104)|COAD - Colon adenocarcinoma(174;0.222)|LUSC - Lung squamous cell carcinoma(189;0.231)	Amitriptyline(DB00321)|Dalfampridine(DB06637)|Disopyramide(DB00280)|Imipramine(DB00458)	GTGGTAAATCCGGCTAAAGTT	0.552																																					p.R408Q		.											.	KCND3-155	1	Substitution - Missense(1)	NS(1)	c.G1223A						.						134.0	122.0	126.0					1																	112329612		2203	4300	6503	SO:0001583	missense	3752	exon3			TAAATCCGGCTAA	AF048713	CCDS843.1, CCDS844.1	1p13.2	2014-09-17			ENSG00000171385	ENSG00000171385		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6239	protein-coding gene	gene with protein product		605411	"""spinocerebellar ataxia 22"", ""spinocerebellar ataxia 19"""	SCA22, SCA19		10942109, 16382104, 23280837	Standard	NM_172198		Approved	Kv4.3, KSHIVB	uc001ebu.1	Q9UK17	OTTHUMG00000011989	ENST00000315987.2:c.1223G>A	1.37:g.112329612C>T	ENSP00000319591:p.Arg408Gln	Somatic	157	0		WXS	Illumina GAIIx	Phase_I	203	44	NM_004980	0	0	0	0	0	O60576|O60577|Q14D71|Q5T0M0|Q9UH85|Q9UH86|Q9UK16	Missense_Mutation	SNP	ENST00000315987.2	37	CCDS843.1	.	.	.	.	.	.	.	.	.	.	C	36	5.640958	0.96693	.	.	ENSG00000171385	ENST00000369697;ENST00000315987;ENST00000302127	D;D;D	0.97811	-4.55;-4.55;-4.55	4.84	4.84	0.62591	.	0.000000	0.85682	D	0.000000	D	0.98513	0.9504	M	0.79123	2.44	0.80722	D	1	D;D	0.89917	1.0;0.995	D;P	0.73380	0.98;0.701	D	0.99719	1.1009	10	0.72032	D	0.01	.	17.8944	0.88883	0.0:1.0:0.0:0.0	.	408;408	Q14D71;Q9UK17	.;KCND3_HUMAN	Q	408	ENSP00000358711:R408Q;ENSP00000319591:R408Q;ENSP00000306923:R408Q	ENSP00000306923:R408Q	R	-	2	0	KCND3	112131135	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.818000	0.86416	2.398000	0.81561	0.561000	0.74099	CGG	.		0.552	KCND3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000033144.1	NM_172198	
SPTA1	6708	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	158641930	158641930	+	Silent	SNP	A	A	G			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr1:158641930A>G	ENST00000368147.4	-	11	1587	c.1407T>C	c.(1405-1407)caT>caC	p.H469H		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	469			H -> P (in EL2; Barcelona). {ECO:0000269|PubMed:8364215}.|Missing (in EL2; Alexandria).		actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					CATACTGACGATGACGCTCGT	0.443																																					p.H469H		.											.	SPTA1-142	0			c.T1407C						.						112.0	109.0	110.0					1																	158641930		1965	4161	6126	SO:0001819	synonymous_variant	6708	exon11			CTGACGATGACGC	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.1407T>C	1.37:g.158641930A>G		Somatic	92	0		WXS	Illumina GAIIx	Phase_I	78	25	NM_003126	0	0	0	0	0	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Silent	SNP	ENST00000368147.4	37	CCDS41423.1																																																																																			.		0.443	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126	
C1orf226	400793	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	162353216	162353216	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr1:162353216A>G	ENST00000458626.2	+	2	734	c.562A>G	c.(562-564)Aaa>Gaa	p.K188E	C1orf226_ENST00000426197.2_Missense_Mutation_p.K231E	NM_001085375.1	NP_001078844.1	A1L170	CA226_HUMAN	chromosome 1 open reading frame 226	188										central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	12						AGAGAGAGGCAAAGTTCTGCC	0.567																																					p.K231E		.											.	C1orf226-1	0			c.A691G						.						26.0	30.0	28.0					1																	162353216		2027	4197	6224	SO:0001583	missense	400793	exon3			AGAGGCAAAGTTC	AI480219, AK023199, AK125122, AL512785, BC127743	CCDS44268.1, CCDS53422.1	1q23.3	2013-10-11			ENSG00000239887	ENSG00000239887			34351	protein-coding gene	gene with protein product						14702039	Standard	NM_001085375		Approved	FLJ13137	uc010pkt.1	A1L170	OTTHUMG00000031376	ENST00000458626.2:c.562A>G	1.37:g.162353216A>G	ENSP00000437071:p.Lys188Glu	Somatic	293	0		WXS	Illumina GAIIx	Phase_I	245	99	NM_001135240	0	0	0	0	0	B4DF31	Missense_Mutation	SNP	ENST00000458626.2	37	CCDS53422.1	.	.	.	.	.	.	.	.	.	.	A	0.009	-1.826202	0.00589	.	.	ENSG00000239887	ENST00000426197;ENST00000458626	.	.	.	5.73	0.142	0.14816	.	.	.	.	.	T	0.03871	0.0109	N	0.02539	-0.55	.	.	.	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.42716	-0.9435	7	0.02654	T	1	0.1173	7.5995	0.28067	0.1498:0.3818:0.4685:0.0	.	231;188	A1L170-2;A1L170	.;CA226_HUMAN	E	231;188	.	ENSP00000413150:K231E	K	+	1	0	C1orf226	160619840	0.909000	0.30893	0.000000	0.03702	0.002000	0.02628	2.458000	0.45014	0.043000	0.15746	-0.146000	0.13790	AAA	.		0.567	C1orf226-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076793.2	NM_001085375	
GPR161	23432	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	168059902	168059902	+	Silent	SNP	C	C	G			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr1:168059902C>G	ENST00000367838.1	-	6	1417	c.1104G>C	c.(1102-1104)ctG>ctC	p.L368L	GPR161_ENST00000367836.1_Silent_p.L236L|GPR161_ENST00000361697.2_Silent_p.L368L|GPR161_ENST00000271357.5_Silent_p.L368L|GPR161_ENST00000537209.1_Silent_p.L388L|GPR161_ENST00000539777.1_Silent_p.L290L|GPR161_ENST00000367835.1_Silent_p.L368L|GPR161_ENST00000546300.1_Silent_p.L254L	NM_001267611.1|NM_153832.2	NP_001254540.1|NP_722561.1	Q8N6U8	GP161_HUMAN	G protein-coupled receptor 161	368					G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|positive regulation of cAMP biosynthetic process (GO:0030819)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)|recycling endosome (GO:0055037)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(3)|large_intestine(8)|lung(10)|ovary(1)|prostate(2)|skin(1)	26	all_hematologic(923;0.215)					GGGACAGGCCCAGGTCTGAAA	0.607																																					p.L388L		.											.	GPR161-90	0			c.G1164C						.						37.0	38.0	38.0					1																	168059902		2203	4300	6503	SO:0001819	synonymous_variant	23432	exon5			CAGGCCCAGGTCT	AF091890	CCDS1268.1, CCDS58042.1, CCDS58043.1, CCDS58044.1, CCDS58045.1, CCDS72978.1	1q23.3	2012-08-21			ENSG00000143147	ENSG00000143147		"""GPCR / Class A : Orphans"""	23694	protein-coding gene	gene with protein product		612250				11959142	Standard	NM_153832		Approved	RE2	uc009wvo.4	Q8N6U8	OTTHUMG00000034651	ENST00000367838.1:c.1104G>C	1.37:g.168059902C>G		Somatic	79	0		WXS	Illumina GAIIx	Phase_I	69	28	NM_001267609	0	0	0	0	0	B3KV34|B7Z5D7|B7Z5E8|B7Z5Z6|F5GXD6|F5H6J7|O75963|Q5TGK0|Q5TGK1|Q5TGK2	Silent	SNP	ENST00000367838.1	37	CCDS1268.1																																																																																			.		0.607	GPR161-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083829.1	NM_007369	
CDC73	79577	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	193111054	193111054	+	Missense_Mutation	SNP	C	C	A	rs587778168		TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr1:193111054C>A	ENST00000367435.3	+	7	771	c.587C>A	c.(586-588)aCt>aAt	p.T196N		NM_024529.4	NP_078805.3	Q6P1J9	CDC73_HUMAN	cell division cycle 73	196					cell cycle (GO:0007049)|cellular response to lipopolysaccharide (GO:0071222)|endodermal cell fate commitment (GO:0001711)|histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|mRNA polyadenylation (GO:0006378)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of mRNA 3'-end processing (GO:0031442)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|protein destabilization (GO:0031648)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)|nucleus (GO:0005634)	RNA polymerase II core binding (GO:0000993)			breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(14)|ovary(1)|pancreas(1)|parathyroid(51)|skin(1)|upper_aerodigestive_tract(1)	87						AAAAGATCTACTATCAAGACT	0.368																																					p.T196N		.											.	CDC73-1009	0			c.C587A						.						71.0	64.0	66.0					1																	193111054		2203	4300	6503	SO:0001583	missense	79577	exon7			GATCTACTATCAA	AF312865	CCDS1382.1	1q25	2014-09-17	2013-01-17	2005-07-20	ENSG00000134371	ENSG00000134371			16783	protein-coding gene	gene with protein product	"""Paf1/RNA polymerase II complex component"""	607393	"""chromosome 1 open reading frame 28"", ""hyperparathyroidism 2 (with jaw tumor)"", ""cell division cycle 73, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)"", ""hyperparathyroidism 1"""	C1orf28, HRPT2, HRPT1		11318611, 15632063, 18755853	Standard	NM_024529		Approved	parafibromin, FIHP	uc001gtb.3	Q6P1J9	OTTHUMG00000035676	ENST00000367435.3:c.587C>A	1.37:g.193111054C>A	ENSP00000356405:p.Thr196Asn	Somatic	337	0		WXS	Illumina GAIIx	Phase_I	213	80	NM_024529	0	0	0	0	0	A6NLZ8|B2RBR2|Q6PK51|Q96A07|Q9H245|Q9H5L7	Missense_Mutation	SNP	ENST00000367435.3	37	CCDS1382.1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.784611	0.90282	.	.	ENSG00000134371	ENST00000367435;ENST00000445394	D	0.85955	-2.05	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	D	0.89136	0.6629	L	0.58302	1.8	0.80722	D	1	D	0.65815	0.995	P	0.55965	0.788	D	0.85239	0.1037	10	0.23302	T	0.38	-17.4699	20.5568	0.99304	0.0:1.0:0.0:0.0	.	196	Q6P1J9	CDC73_HUMAN	N	196	ENSP00000356405:T196N	ENSP00000356405:T196N	T	+	2	0	CDC73	191377677	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.629000	0.83207	2.861000	0.98227	0.655000	0.94253	ACT	.		0.368	CDC73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086696.2	NM_024529	
ASPM	259266	bcgsc.ca	37	1	197112533	197112533	+	Silent	SNP	G	G	A	rs6677082	byFrequency	TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr1:197112533G>A	ENST00000367409.4	-	3	1105	c.849C>T	c.(847-849)tcC>tcT	p.S283S	ASPM_ENST00000294732.7_Silent_p.S283S	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	283					developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)				breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						TAACATTTACGGAATTAAAGG	0.333													.|||	3784	0.755591	0.295	0.8746	5008	,	,		18038	0.9831		0.9095	False		,,,				2504	0.9008				p.S283S		.											.	ASPM-615	0			c.C849T						.	G	,	1706,2700	502.4+/-365.2	345,1016,842	82.0	80.0	81.0		849,849	-2.4	0.0	1	dbSNP_116	81	7797,801	777.7+/-407.7	3536,725,38	no	coding-synonymous,coding-synonymous	ASPM	NM_001206846.1,NM_018136.4	,	3881,1741,880	AA,AG,GG		9.3161,38.7199,26.9225	,	283/1893,283/3478	197112533	9503,3501	2203	4299	6502	SO:0001819	synonymous_variant	259266	exon3			ATTTACGGAATTA	AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.849C>T	1.37:g.197112533G>A		Somatic	107	0		WXS	Illumina GAIIx	Phase_I	125	5	NM_001206846	0	0	0	0	0	Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Silent	SNP	ENST00000367409.4	37	CCDS1389.1																																																																																			G|0.240;A|0.760		0.333	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000088256.1	NM_018136	
USH2A	7399	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	216062269	216062269	+	Silent	SNP	T	T	C			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr1:216062269T>C	ENST00000307340.3	-	41	8108	c.7722A>G	c.(7720-7722)ctA>ctG	p.L2574L	RP5-1111A8.3_ENST00000414995.1_RNA|USH2A_ENST00000366943.2_Silent_p.L2574L	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	2574	Fibronectin type-III 12. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TTCTCAAGTATAGACGGCCAT	0.408										HNSCC(13;0.011)																											p.L2574L		.											.	USH2A-115	0			c.A7722G						.						144.0	141.0	142.0					1																	216062269		2203	4300	6503	SO:0001819	synonymous_variant	7399	exon41			CAAGTATAGACGG	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.7722A>G	1.37:g.216062269T>C		Somatic	66	0		WXS	Illumina GAIIx	Phase_I	62	26	NM_206933	0	0	0	0	0	Q5VVM9|Q6S362|Q9NS27	Silent	SNP	ENST00000307340.3	37	CCDS31025.1																																																																																			.		0.408	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
SKIDA1	387640	hgsc.bcm.edu	37	10	21805480	21805480	+	Silent	SNP	T	T	C	rs201836118		TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr10:21805480T>C	ENST00000449193.2	-	4	3524	c.1272A>G	c.(1270-1272)gaA>gaG	p.E424E	SKIDA1_ENST00000487107.1_5'Flank|SKIDA1_ENST00000444772.3_Silent_p.E345E	NM_207371.3	NP_997254.3	Q1XH10	SKDA1_HUMAN	SKI/DACH domain containing 1	343						nucleus (GO:0005634)											cctcctcctcttcctcctcct	0.632																																					p.E424E		.											.	.	0			c.A1272G						.						5.0	6.0	6.0					10																	21805480		2001	4121	6122	SO:0001819	synonymous_variant	387640	exon4			CTCCTCTTCCTCC	AK131456	CCDS44363.1	10p12.31	2012-06-13	2012-06-13	2012-06-13	ENSG00000180592	ENSG00000180592			32697	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 140"""	C10orf140			Standard	NM_207371		Approved	FLJ45187	uc021pnx.1	Q1XH10	OTTHUMG00000017797	ENST00000449193.2:c.1272A>G	10.37:g.21805480T>C		Somatic	64	0		WXS	Illumina GAIIx	Phase_I	46	4	NM_207371	0	0	0	0	0	B1ANA5|Q6ZMX4|Q8N3C3	Silent	SNP	ENST00000449193.2	37	CCDS44363.1																																																																																			.		0.632	SKIDA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286950.2	NM_207371	
SKIDA1	387640	hgsc.bcm.edu	37	10	21805486	21805486	+	Silent	SNP	C	C	T			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr10:21805486C>T	ENST00000449193.2	-	4	3518	c.1266G>A	c.(1264-1266)gaG>gaA	p.E422E	SKIDA1_ENST00000487107.1_5'Flank|SKIDA1_ENST00000444772.3_Silent_p.E343E	NM_207371.3	NP_997254.3	Q1XH10	SKDA1_HUMAN	SKI/DACH domain containing 1	341						nucleus (GO:0005634)		p.E422E(2)									cctcttcctcctcctcctcct	0.632																																					p.E422E		.											.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G1266A						.						5.0	6.0	6.0					10																	21805486		1988	4108	6096	SO:0001819	synonymous_variant	387640	exon4			TTCCTCCTCCTCC	AK131456	CCDS44363.1	10p12.31	2012-06-13	2012-06-13	2012-06-13	ENSG00000180592	ENSG00000180592			32697	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 140"""	C10orf140			Standard	NM_207371		Approved	FLJ45187	uc021pnx.1	Q1XH10	OTTHUMG00000017797	ENST00000449193.2:c.1266G>A	10.37:g.21805486C>T		Somatic	66	0		WXS	Illumina GAIIx	Phase_I	46	4	NM_207371	0	0	0	0	0	B1ANA5|Q6ZMX4|Q8N3C3	Silent	SNP	ENST00000449193.2	37	CCDS44363.1																																																																																			.		0.632	SKIDA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286950.2	NM_207371	
RET	5979	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	43606665	43606665	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr10:43606665T>C	ENST00000355710.3	+	7	1506	c.1274T>C	c.(1273-1275)gTc>gCc	p.V425A	RET_ENST00000340058.5_Missense_Mutation_p.V425A	NM_020975.4	NP_066124.1	P07949	RET_HUMAN	ret proto-oncogene	425					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to retinoic acid (GO:0071300)|embryonic epithelial tube formation (GO:0001838)|enteric nervous system development (GO:0048484)|homophilic cell adhesion (GO:0007156)|innervation (GO:0060384)|lymphocyte migration into lymphoid organs (GO:0097021)|MAPK cascade (GO:0000165)|membrane protein proteolysis (GO:0033619)|neural crest cell migration (GO:0001755)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|peptidyl-tyrosine phosphorylation (GO:0018108)|Peyer's patch morphogenesis (GO:0061146)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell migration (GO:0030335)|positive regulation of cell size (GO:0045793)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of metanephric glomerulus development (GO:0072300)|positive regulation of neuron maturation (GO:0014042)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior midgut development (GO:0007497)|protein phosphorylation (GO:0006468)|regulation of axonogenesis (GO:0050770)|regulation of cell adhesion (GO:0030155)|response to drug (GO:0042493)|response to pain (GO:0048265)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ureter maturation (GO:0035799)|ureteric bud development (GO:0001657)	endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		CCDC6/RET(4)|KIF5B/RET(79)	NS(2)|adrenal_gland(26)|breast(5)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|lung(27)|ovary(5)|prostate(3)|skin(1)|thyroid(504)|upper_aerodigestive_tract(1)|urinary_tract(1)	607		Ovarian(717;0.0423)			Cabozantinib(DB08875)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)	ATCGGGAAAGTCTGTGTGGAA	0.582		1	"""T, Mis, N, F"""	"""H4, PRKAR1A, NCOA4, PCM1, GOLGA5, TRIM33, KTN1, TRIM27, HOOK3, KIF5B, CCDC6"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma, NSCLC"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma"""	Hirschsprung disease		Multiple Endocrine Neoplasia, type 2B;Multiple Endocrine Neoplasia, type 2A;Familial Medullary Thyroid Carcinoma																												p.V425A	Melanoma(102;360 522 3376 9752 9881 14372 17251 18341 20876 24662 34807 43144 48149)	.	yes	Dom	yes	Multiple endocrine neoplasia 2A/2B	10	10q11.2	5979	ret proto-oncogene	yes	"""E, O"""	.	RET-4507	0			c.T1274C						.						96.0	89.0	92.0					10																	43606665		2203	4300	6503	SO:0001583	missense	5979	exon7	Familial Cancer Database	MEN2B, Wagenmann-Froboese s.;MEN2A, Sipple disease, incl MEN2C;FMTC	GGAAAGTCTGTGT	BC004257	CCDS7200.1, CCDS53525.1	10q11.2	2014-09-17	2007-02-16		ENSG00000165731	ENSG00000165731		"""Cadherins / Cadherin-related"""	9967	protein-coding gene	gene with protein product	"""cadherin-related family member 16"""	164761	"""multiple endocrine neoplasia and medullary thyroid carcinoma 1"", ""Hirschsprung disease 1"""	HSCR1, MEN2A, MTC1, MEN2B		2687772, 1611909	Standard	NM_020975		Approved	PTC, CDHF12, RET51, CDHR16	uc001jal.3	P07949	OTTHUMG00000018024	ENST00000355710.3:c.1274T>C	10.37:g.43606665T>C	ENSP00000347942:p.Val425Ala	Somatic	79	0		WXS	Illumina GAIIx	Phase_I	100	28	NM_020630	0	0	0	0	0	A8K6Z2|Q15250|Q9BTB0|Q9H4A2	Missense_Mutation	SNP	ENST00000355710.3	37	CCDS7200.1	.	.	.	.	.	.	.	.	.	.	T	25.5	4.647816	0.87958	.	.	ENSG00000165731	ENST00000355710;ENST00000340058;ENST00000535749	T;T	0.81247	-1.35;-1.47	5.34	5.34	0.76211	.	0.299436	0.36972	N	0.002303	D	0.84056	0.5388	L	0.59436	1.845	0.45015	D	0.998038	P;P;D	0.58268	0.72;0.917;0.982	B;P;P	0.55391	0.278;0.497;0.775	T	0.82131	-0.0609	10	0.25751	T	0.34	.	15.3223	0.74132	0.0:0.0:0.0:1.0	.	171;425;425	B4DGX8;P07949;P07949-2	.;RET_HUMAN;.	A	425	ENSP00000347942:V425A;ENSP00000344798:V425A	ENSP00000344798:V425A	V	+	2	0	RET	42926671	1.000000	0.71417	0.820000	0.32676	0.971000	0.66376	7.035000	0.76517	2.020000	0.59435	0.459000	0.35465	GTC	.		0.582	RET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047694.2	NM_020975	
NPFFR1	64106	hgsc.bcm.edu	37	10	72014863	72014863	+	Silent	SNP	G	G	A	rs60225321	byFrequency	TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr10:72014863G>A	ENST00000277942.6	-	4	1142	c.1143C>T	c.(1141-1143)tcC>tcT	p.S381S		NM_022146.4	NP_071429.1	Q9GZQ6	NPFF1_HUMAN	neuropeptide FF receptor 1	381					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide receptor activity (GO:0008188)			endometrium(2)|lung(1)	3						AGGGCAGCCCGGAGTCGCTGG	0.751													G|||	392	0.0782748	0.1165	0.0303	5008	,	,		10955	0.0942		0.0487	False		,,,				2504	0.0746				p.S381S		.											.	NPFFR1-22	0			c.C1143T						.	G		209,2965		3,203,1381	3.0	5.0	4.0		1143	-9.4	0.2	10	dbSNP_129	4	215,6851		0,215,3318	no	coding-synonymous	NPFFR1	NM_022146.4		3,418,4699	AA,AG,GG		3.0427,6.5848,4.1406		381/431	72014863	424,9816	1587	3533	5120	SO:0001819	synonymous_variant	64106	exon4			CAGCCCGGAGTCG	AB040104	CCDS53539.1	10q21-q22	2012-08-10	2006-02-15	2006-02-15	ENSG00000148734	ENSG00000148734		"""GPCR / Class A :  Neuropeptide receptors : FF/AF"", ""GPCR / Class A : RF amide peptide receptors"""	17425	protein-coding gene	gene with protein product	"""neuropeptide FF 1"""	607448	"""G protein-coupled receptor 147"""	GPR147		11024015	Standard	NM_022146		Approved	OT7T022, NPFF1R1	uc021psj.1	Q9GZQ6	OTTHUMG00000018404	ENST00000277942.6:c.1143C>T	10.37:g.72014863G>A		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	11	11	NM_022146	0	0	0	0	0	A2RRF0|Q8NGR0|Q96RN3	Silent	SNP	ENST00000277942.6	37	CCDS53539.1																																																																																			G|0.929;A|0.071		0.751	NPFFR1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048504.2	NM_022146	
ZNF503	84858	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	77160944	77160944	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr10:77160944C>A	ENST00000372524.4	-	1	720	c.234G>T	c.(232-234)aaG>aaT	p.K78N	RP11-399K21.11_ENST00000418818.2_lincRNA|ZNF503-AS2_ENST00000425916.3_RNA|ZNF503_ENST00000535216.1_Missense_Mutation_p.K78N|ZNF503-AS2_ENST00000466942.2_RNA|ZNF503-AS2_ENST00000486015.1_RNA	NM_032772.4	NP_116161.2	Q96F45	ZN503_HUMAN	zinc finger protein 503	78					G1 to G0 transition involved in cell differentiation (GO:0070315)|negative regulation of cell proliferation (GO:0008285)|negative regulation of gene expression (GO:0010629)|neural precursor cell proliferation (GO:0061351)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			lung(4)|ovary(1)|skin(1)	6	all_cancers(46;0.105)|all_epithelial(25;0.00449)|Prostate(51;0.0112)|Ovarian(15;0.088)					CCGTCAGCATCTTCAGCACCT	0.662																																					p.K78N		.											.	ZNF503-91	0			c.G234T						.						76.0	60.0	65.0					10																	77160944		2203	4300	6503	SO:0001583	missense	84858	exon1			CAGCATCTTCAGC	AK127647	CCDS7350.1	10q22.3	2011-02-09			ENSG00000165655	ENSG00000165655		"""Zinc fingers, C2H2-type"""	23589	protein-coding gene	gene with protein product		613902				12477932	Standard	NM_032772		Approved	FLJ45745, MGC2555	uc001jxg.3	Q96F45	OTTHUMG00000018526	ENST00000372524.4:c.234G>T	10.37:g.77160944C>A	ENSP00000361602:p.Lys78Asn	Somatic	53	0		WXS	Illumina GAIIx	Phase_I	42	12	NM_032772	0	0	0	0	0	Q8NAC5|Q96E25|Q96IJ0	Missense_Mutation	SNP	ENST00000372524.4	37	CCDS7350.1	.	.	.	.	.	.	.	.	.	.	C	15.92	2.975594	0.53720	.	.	ENSG00000165655	ENST00000372524;ENST00000535216;ENST00000372516	T;T	0.59083	0.29;0.29	4.75	4.75	0.60458	.	0.000000	0.85682	D	0.000000	T	0.44932	0.1317	N	0.24115	0.695	0.47547	D	0.999455	D	0.54964	0.969	P	0.46144	0.505	T	0.35624	-0.9781	10	0.38643	T	0.18	-10.2823	9.0487	0.36363	0.0:0.8659:0.0:0.1341	.	78	Q96F45	ZN503_HUMAN	N	78	ENSP00000361602:K78N;ENSP00000438988:K78N	ENSP00000361594:K78N	K	-	3	2	ZNF503	76830950	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.878000	0.56130	2.460000	0.83146	0.448000	0.29417	AAG	.		0.662	ZNF503-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048826.1	NM_032772	
RBM20	282996	hgsc.bcm.edu	37	10	112404302	112404302	+	Silent	SNP	G	G	A	rs35141404	byFrequency	TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr10:112404302G>A	ENST00000369519.3	+	1	148	c.90G>A	c.(88-90)cgG>cgA	p.R30R	Y_RNA_ENST00000411370.1_RNA	NM_001134363.1	NP_001127835.1	Q5T481	RBM20_HUMAN	RNA binding motif protein 20	30	Pro-rich.				heart development (GO:0007507)|mRNA processing (GO:0006397)|positive regulation of RNA splicing (GO:0033120)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(4)|kidney(3)|large_intestine(1)|ovary(1)|skin(2)	12						CTGGTGCCCGGGCGTCCCCGG	0.746													G|||	1113	0.222244	0.4206	0.1354	5008	,	,		7996	0.1617		0.1392	False		,,,				2504	0.1636				p.R30R		.											.	.	0			c.G90A						.						4.0	9.0	7.0					10																	112404302		625	1495	2120	SO:0001819	synonymous_variant	282996	exon1			TGCCCGGGCGTCC	BX648563	CCDS44477.1	10q25.3	2014-09-17			ENSG00000203867	ENSG00000203867		"""RNA binding motif (RRM) containing"""	27424	protein-coding gene	gene with protein product		613171					Standard	NM_001134363		Approved		uc001kzf.2	Q5T481	OTTHUMG00000019043	ENST00000369519.3:c.90G>A	10.37:g.112404302G>A		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	13	12	NM_001134363	0	0	0	0	0	A6NIP5|B5A868|Q5JVI1	Silent	SNP	ENST00000369519.3	37	CCDS44477.1																																																																																			G|0.808;A|0.192		0.746	RBM20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050339.2	NM_001134363	
PNLIPRP1	5407	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	118354303	118354303	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr10:118354303C>A	ENST00000528052.1	+	5	463	c.392C>A	c.(391-393)gCc>gAc	p.A131D	PNLIPRP1_ENST00000534537.1_Missense_Mutation_p.A131D|PNLIPRP1_ENST00000358834.4_Missense_Mutation_p.A131D			P54315	LIPR1_HUMAN	pancreatic lipase-related protein 1	131					lipid metabolic process (GO:0006629)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|triglyceride lipase activity (GO:0004806)			breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(1)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	38				all cancers(201;0.0161)		GGCTCCCAAGCCACCTACACA	0.592																																					p.A131D		.											.	PNLIPRP1-154	0			c.C392A						.						111.0	92.0	99.0					10																	118354303		2203	4300	6503	SO:0001583	missense	5407	exon5			CCCAAGCCACCTA	BC025784	CCDS7595.1	10q26.12	2006-07-04			ENSG00000187021	ENSG00000187021			9156	protein-coding gene	gene with protein product		604422				1379598	Standard	NM_006229		Approved	PLRP1	uc001lco.1	P54315	OTTHUMG00000019109	ENST00000528052.1:c.392C>A	10.37:g.118354303C>A	ENSP00000433933:p.Ala131Asp	Somatic	111	0		WXS	Illumina GAIIx	Phase_I	123	45	NM_006229	0	0	0	0	0	Q68D83|Q68DR6|Q8TAU2|Q9BS82	Missense_Mutation	SNP	ENST00000528052.1	37	CCDS7595.1	.	.	.	.	.	.	.	.	.	.	C	17.64	3.440916	0.63067	.	.	ENSG00000187021	ENST00000531984;ENST00000358834;ENST00000528052;ENST00000471549;ENST00000534537	D;D;D;D;D	0.91011	-2.77;-2.77;-2.77;-2.63;-2.77	5.31	5.31	0.75309	Lipase, N-terminal (1);	0.149740	0.45361	D	0.000366	D	0.85031	0.5604	L	0.28344	0.845	0.80722	D	1	B	0.16396	0.017	B	0.23150	0.044	T	0.80320	-0.1432	10	0.38643	T	0.18	-15.9764	14.4137	0.67135	0.0:0.8513:0.1487:0.0	.	131	P54315	LIPR1_HUMAN	D	131	ENSP00000436123:A131D;ENSP00000351695:A131D;ENSP00000433933:A131D;ENSP00000431207:A131D;ENSP00000434159:A131D	ENSP00000351695:A131D	A	+	2	0	PNLIPRP1	118344293	0.075000	0.21258	1.000000	0.80357	0.994000	0.84299	2.655000	0.46707	2.650000	0.89964	0.655000	0.94253	GCC	.		0.592	PNLIPRP1-011	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000384633.1	NM_006229	
FANK1	92565	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	127693588	127693588	+	Silent	SNP	G	G	A			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr10:127693588G>A	ENST00000368693.1	+	7	779	c.675G>A	c.(673-675)gtG>gtA	p.V225V	FANK1_ENST00000477963.1_3'UTR|FANK1_ENST00000368695.1_Silent_p.V219V			Q8TC84	FANK1_HUMAN	fibronectin type III and ankyrin repeat domains 1	225						cytoplasm (GO:0005737)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(10)|ovary(1)|urinary_tract(1)	21		all_lung(145;0.00752)|Lung NSC(174;0.0115)|Colorectal(57;0.0847)|all_neural(114;0.0936)				ACTGCAGTGTGATTGAGTGGA	0.527																																					p.V225V		.											.	FANK1-91	0			c.G675A						.						174.0	158.0	163.0					10																	127693588		2203	4300	6503	SO:0001819	synonymous_variant	92565	exon7			CAGTGTGATTGAG	BC024189	CCDS31309.1	10q26.2	2013-02-11	2005-03-01		ENSG00000203780	ENSG00000203780		"""Ankyrin repeat domain containing"", ""Fibronectin type III domain containing"""	23527	protein-coding gene	gene with protein product		611640	"""fibronectin type 3 and ankyrin repeat domains 1"""			12477932	Standard	NM_145235		Approved		uc001ljh.4	Q8TC84	OTTHUMG00000019241	ENST00000368693.1:c.675G>A	10.37:g.127693588G>A		Somatic	167	1		WXS	Illumina GAIIx	Phase_I	159	49	NM_145235	0	0	0	0	0	Q6UXY9|Q6X7T6	Silent	SNP	ENST00000368693.1	37	CCDS31309.1																																																																																			.		0.527	FANK1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_145235	
TH	7054	bcgsc.ca	37	11	2188688	2188688	+	Nonsense_Mutation	SNP	G	G	T			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr11:2188688G>T	ENST00000381178.1	-	7	783	c.765C>A	c.(763-765)taC>taA	p.Y255*	TH_ENST00000333684.5_Nonsense_Mutation_p.Y228*|TH_ENST00000352909.3_Nonsense_Mutation_p.Y224*|TH_ENST00000381175.1_Nonsense_Mutation_p.Y251*	NM_199292.2	NP_954986.2	P07101	TY3H_HUMAN	tyrosine hydroxylase	255					anatomical structure morphogenesis (GO:0009653)|catecholamine biosynthetic process (GO:0042423)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to drug (GO:0035690)|cellular response to glucose stimulus (GO:0071333)|cellular response to growth factor stimulus (GO:0071363)|cellular response to manganese ion (GO:0071287)|cellular response to nicotine (GO:0071316)|cerebral cortex development (GO:0021987)|circadian sleep/wake cycle (GO:0042745)|dopamine biosynthetic process (GO:0042416)|dopamine biosynthetic process from tyrosine (GO:0006585)|eating behavior (GO:0042755)|embryonic camera-type eye morphogenesis (GO:0048596)|epinephrine biosynthetic process (GO:0042418)|eye photoreceptor cell development (GO:0042462)|fatty acid metabolic process (GO:0006631)|glycoside metabolic process (GO:0016137)|heart development (GO:0007507)|heart morphogenesis (GO:0003007)|isoquinoline alkaloid metabolic process (GO:0033076)|learning (GO:0007612)|locomotory behavior (GO:0007626)|mating behavior (GO:0007617)|memory (GO:0007613)|multicellular organismal aging (GO:0010259)|neurotransmitter biosynthetic process (GO:0042136)|norepinephrine biosynthetic process (GO:0042421)|organ morphogenesis (GO:0009887)|phthalate metabolic process (GO:0018963)|phytoalexin metabolic process (GO:0052314)|pigmentation (GO:0043473)|regulation of heart contraction (GO:0008016)|response to activity (GO:0014823)|response to amphetamine (GO:0001975)|response to corticosterone (GO:0051412)|response to electrical stimulus (GO:0051602)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to ether (GO:0045472)|response to herbicide (GO:0009635)|response to hypoxia (GO:0001666)|response to light stimulus (GO:0009416)|response to lipopolysaccharide (GO:0032496)|response to nutrient levels (GO:0031667)|response to peptide hormone (GO:0043434)|response to pyrethroid (GO:0046684)|response to salt stress (GO:0009651)|response to water deprivation (GO:0009414)|response to zinc ion (GO:0010043)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|sphingolipid metabolic process (GO:0006665)|synaptic transmission, dopaminergic (GO:0001963)|synaptic vesicle amine transport (GO:0015842)|terpene metabolic process (GO:0042214)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|melanosome membrane (GO:0033162)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|perikaryon (GO:0043204)|smooth endoplasmic reticulum (GO:0005790)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)	amino acid binding (GO:0016597)|dopamine binding (GO:0035240)|enzyme binding (GO:0019899)|ferric iron binding (GO:0008199)|ferrous iron binding (GO:0008198)|oxygen binding (GO:0019825)|tetrahydrobiopterin binding (GO:0034617)|tyrosine 3-monooxygenase activity (GO:0004511)			NS(1)|endometrium(1)|large_intestine(1)|lung(7)|skin(1)	11		all_epithelial(84;1.46e-23)|Lung NSC(207;4.44e-11)|all_lung(207;1.11e-09)|Ovarian(85;1.78e-06)|Breast(177;1.78e-05)|Medulloblastoma(188;0.0208)|all_neural(188;0.0416)	Colorectal(5;0.00245)|COAD - Colon adenocarcinoma(6;0.0239)	BRCA - Breast invasive adenocarcinoma(625;8.45e-09)|Lung(200;0.000152)|LUSC - Lung squamous cell carcinoma(625;0.00154)	L-Phenylalanine(DB00120)|L-Tyrosine(DB00135)|Metyrosine(DB00765)|Tetrahydrobiopterin(DB00360)	CCTCGGCGGTGTACTCCACAC	0.697																																					p.Y255X		.											.	TH-90	0			c.C765A						.						16.0	16.0	16.0					11																	2188688		2163	4256	6419	SO:0001587	stop_gained	7054	exon7			GGCGGTGTACTCC	X05290	CCDS7730.1, CCDS7731.1, CCDS31338.1	11p15.5	2013-06-03			ENSG00000180176	ENSG00000180176	1.14.16.2		11782	protein-coding gene	gene with protein product	"""tyrosine 3-monooxygenase"""	191290					Standard	NM_199292		Approved	DYT5b	uc001lvq.3	P07101	OTTHUMG00000009559	ENST00000381178.1:c.765C>A	11.37:g.2188688G>T	ENSP00000370571:p.Tyr255*	Somatic	72	0		WXS	Illumina GAIIx	Phase_I	69	4	NM_199292	0	0	0	0	0	B7ZL70|B7ZL73|Q0PWM2|Q0PWM3|Q15585|Q15588|Q15589|Q2M3B4	Nonsense_Mutation	SNP	ENST00000381178.1	37	CCDS7731.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.6|26.6	4.751688|4.751688	0.89753|0.89753	.|.	.|.	ENSG00000180176|ENSG00000180176	ENST00000412076|ENST00000381178;ENST00000381175;ENST00000352909;ENST00000333684	.|.	.|.	.|.	3.4|3.4	2.46|2.46	0.29980|0.29980	.|.	.|0.000000	.|0.85682	.|U	.|0.000000	T|.	0.37265|.	0.0997|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.44329|.	-0.9335|.	3|.	.|0.17369	.|T	.|0.5	-25.5221|-25.5221	9.3424|9.3424	0.38087|0.38087	0.1098:0.0:0.8902:0.0|0.1098:0.0:0.8902:0.0	.|.	.|.	.|.	.|.	N|X	38|255;251;224;228	.|.	.|ENSP00000328814:Y228X	H|Y	-|-	1|3	0|2	TH|TH	2145264|2145264	1.000000|1.000000	0.71417|0.71417	0.991000|0.991000	0.47740|0.47740	0.334000|0.334000	0.28698|0.28698	3.955000|3.955000	0.56715|0.56715	1.607000|1.607000	0.50170|0.50170	0.313000|0.313000	0.20887|0.20887	CAC|TAC	.		0.697	TH-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000026597.1	NM_000360	
OR52N1	79473	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	5809714	5809714	+	Silent	SNP	C	C	G			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr11:5809714C>G	ENST00000317078.1	-	1	332	c.333G>C	c.(331-333)ggG>ggC	p.G111G	TRIM5_ENST00000380027.1_Intron	NM_001001913.1	NP_001001913.1	Q8NH53	O52N1_HUMAN	olfactory receptor, family 52, subfamily N, member 1	111						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(6)|lung(15)|prostate(2)|skin(3)	31		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.05e-11)|LUSC - Lung squamous cell carcinoma(625;0.112)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.195)		CAGACTCCATCCCTGTGAAGG	0.502																																					p.G111G		.											.	OR52N1-69	0			c.G333C						.						158.0	141.0	147.0					11																	5809714		2201	4296	6497	SO:0001819	synonymous_variant	79473	exon1			CTCCATCCCTGTG	AB065538	CCDS31398.1	11p15.4	2012-08-09			ENSG00000181001	ENSG00000181001		"""GPCR / Class A : Olfactory receptors"""	14853	protein-coding gene	gene with protein product							Standard	NM_001001913		Approved		uc010qzo.2	Q8NH53	OTTHUMG00000168800	ENST00000317078.1:c.333G>C	11.37:g.5809714C>G		Somatic	197	0		WXS	Illumina GAIIx	Phase_I	79	57	NM_001001913	0	0	0	0	0	Q6IFF6	Silent	SNP	ENST00000317078.1	37	CCDS31398.1																																																																																			.		0.502	OR52N1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401142.1	NM_001001913	
EML3	256364	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	62376216	62376216	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr11:62376216C>T	ENST00000394773.2	-	8	1298	c.991G>A	c.(991-993)Gat>Aat	p.D331N	RP11-831H9.3_ENST00000532626.1_RNA|EML3_ENST00000494176.2_Missense_Mutation_p.D303N|EML3_ENST00000529309.1_Missense_Mutation_p.D331N|EML3_ENST00000531557.1_Missense_Mutation_p.D114N|EML3_ENST00000438258.1_5'Flank|EML3_ENST00000278845.4_Missense_Mutation_p.D332N	NM_153265.2	NP_694997.2	Q32P44	EMAL3_HUMAN	echinoderm microtubule associated protein like 3	331						cytoplasm (GO:0005737)|microtubule (GO:0005874)				biliary_tract(1)|breast(3)|endometrium(4)|kidney(2)|large_intestine(1)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26						ACCTTTCCATCCTTATCCACT	0.547																																					p.D331N		.											.	EML3-91	0			c.G991A						.						166.0	146.0	153.0					11																	62376216		2202	4299	6501	SO:0001583	missense	256364	exon8			TTCCATCCTTATC	AK093146	CCDS8023.2	11q12.3	2013-01-10			ENSG00000149499	ENSG00000149499		"""WD repeat domain containing"""	26666	protein-coding gene	gene with protein product						15225882, 14744259	Standard	NM_153265		Approved	FLJ35827, ELP95	uc001ntu.1	Q32P44	OTTHUMG00000149817	ENST00000394773.2:c.991G>A	11.37:g.62376216C>T	ENSP00000378254:p.Asp331Asn	Somatic	233	0		WXS	Illumina GAIIx	Phase_I	359	69	NM_153265	0	0	0	0	0	Q6ZQW7|Q8NA55	Missense_Mutation	SNP	ENST00000394773.2	37	CCDS8023.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.27|19.27	3.795493|3.795493	0.70452|0.70452	.|.	.|.	ENSG00000149499|ENSG00000149499	ENST00000394773;ENST00000278845;ENST00000531557;ENST00000494176;ENST00000529309|ENST00000394776	T;T;T;T;T|.	0.55052|.	0.56;0.56;0.54;0.54;0.54|.	5.55|5.55	4.58|4.58	0.56647|0.56647	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);|.	0.052862|.	0.64402|.	D|.	0.000001|.	T|T	0.64789|0.64789	0.2630|0.2630	L|L	0.57536|0.57536	1.79|1.79	0.49915|0.49915	D|D	0.999833|0.999833	D;D;B;P;D|.	0.64830|.	0.994;0.991;0.051;0.877;0.992|.	D;P;B;B;P|.	0.64776|.	0.929;0.839;0.081;0.265;0.755|.	T|T	0.62450|0.62450	-0.6852|-0.6852	10|5	0.87932|.	D|.	0|.	-21.0427|-21.0427	13.5909|13.5909	0.61959|0.61959	0.0:0.8432:0.1568:0.0|0.0:0.8432:0.1568:0.0	.|.	331;331;114;332;303|.	Q32P44-2;Q32P44;G3V195;B7WPE2;G3V1D0|.	.;EMAL3_HUMAN;.;.;.|.	N|E	331;332;114;303;331|325	ENSP00000378254:D331N;ENSP00000278845:D332N;ENSP00000433417:D114N;ENSP00000435064:D303N;ENSP00000434513:D331N|.	ENSP00000278845:D332N|.	D|G	-|-	1|2	0|0	EML3|EML3	62132792|62132792	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.404000|0.404000	0.30871|0.30871	5.604000|5.604000	0.67626|0.67626	2.618000|2.618000	0.88619|0.88619	0.655000|0.655000	0.94253|0.94253	GAT|GGA	.		0.547	EML3-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000313432.1	NM_153265	
CCDC88B	283234	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	64111938	64111938	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr11:64111938G>C	ENST00000356786.5	+	14	1969	c.1925G>C	c.(1924-1926)aGa>aCa	p.R642T	CCDC88B_ENST00000301897.4_5'UTR|CCDC88B_ENST00000463837.1_3'UTR	NM_032251.5	NP_115627.6	A6NC98	CC88B_HUMAN	coiled-coil domain containing 88B	642						membrane (GO:0016020)				endometrium(1)|kidney(2)|large_intestine(1)|lung(12)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						TGGGGGTTGAGACAGGAGGGC	0.662																																					p.R642T		.											.	CCDC88B-94	0			c.G1925C						.						23.0	28.0	26.0					11																	64111938		2197	4296	6493	SO:0001583	missense	283234	exon14			GGTTGAGACAGGA	AK090436	CCDS8072.2	11q13.1	2013-03-13	2007-05-31	2007-05-31	ENSG00000168071	ENSG00000168071			26757	protein-coding gene	gene with protein product	"""brain leucine zipper protein"", ""GRP78-interacting protein induced by ER stress"""	611205	"""coiled-coil domain containing 88"""	CCDC88		15882442, 21289099	Standard	NM_032251		Approved	FLJ37970, BRLZ, HkRP3, FLJ00354, GIPIE	uc001nzy.3	A6NC98	OTTHUMG00000045419	ENST00000356786.5:c.1925G>C	11.37:g.64111938G>C	ENSP00000349238:p.Arg642Thr	Somatic	76	0		WXS	Illumina GAIIx	Phase_I	157	50	NM_032251	0	0	0	0	0	A5D8Y5|B5MDM2|Q05BL2|Q6RUV3|Q8N1Q6|Q8NF44|Q9H0H1	Missense_Mutation	SNP	ENST00000356786.5	37	CCDS8072.2	.	.	.	.	.	.	.	.	.	.	g	12.41	1.930880	0.34096	.	.	ENSG00000168071	ENST00000377638;ENST00000356786	T	0.24908	1.83	3.02	0.996	0.19844	.	.	.	.	.	T	0.12987	0.0315	N	0.24115	0.695	0.09310	N	0.999995	P;P;P	0.46512	0.608;0.879;0.608	B;B;B	0.37943	0.261;0.242;0.261	T	0.13629	-1.0502	9	0.44086	T	0.13	.	3.6002	0.08021	0.2779:0.2106:0.5114:0.0	.	642;291;642	B2RTU8;A6NC98-3;A6NC98	.;.;CC88B_HUMAN	T	642	ENSP00000349238:R642T	ENSP00000349238:R642T	R	+	2	0	CCDC88B	63868514	0.002000	0.14202	0.038000	0.18304	0.241000	0.25554	0.350000	0.20079	0.090000	0.17273	0.299000	0.19835	AGA	.		0.662	CCDC88B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104845.1	NM_032251	
DPP3	10072	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	66272099	66272099	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr11:66272099G>A	ENST00000360510.2	+	17	1960	c.1895G>A	c.(1894-1896)gGg>gAg	p.G632E	DPP3_ENST00000541961.1_Missense_Mutation_p.G632E|DPP3_ENST00000530165.1_Missense_Mutation_p.G602E|DPP3_ENST00000453114.1_Missense_Mutation_p.G632E|DPP3_ENST00000531863.1_Missense_Mutation_p.G652E|DPP3_ENST00000532677.1_Missense_Mutation_p.G651E			Q9NY33	DPP3_HUMAN	dipeptidyl-peptidase 3	632					proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dipeptidyl-peptidase activity (GO:0008239)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(2)|stomach(1)	23						AAGTCCACAGGGGATGTGGCC	0.612																																					p.G632E		.											.	DPP3-46	0			c.G1895A						.						81.0	75.0	77.0					11																	66272099		2200	4295	6495	SO:0001583	missense	10072	exon17			CCACAGGGGATGT	AB017970	CCDS8141.1, CCDS58147.1	11q12-q13.1	2008-02-05	2006-01-12		ENSG00000254986	ENSG00000254986	3.4.14.4		3008	protein-coding gene	gene with protein product		606818	"""dipeptidylpeptidase III"", ""dipeptidylpeptidase 3"""			10773679	Standard	NM_005700		Approved		uc001oif.2	Q9NY33	OTTHUMG00000167143	ENST00000360510.2:c.1895G>A	11.37:g.66272099G>A	ENSP00000353701:p.Gly632Glu	Somatic	51	0		WXS	Illumina GAIIx	Phase_I	52	21	NM_130443	0	0	0	0	0	B2RDB5|B4DLX4|F5H8L6|O95748|Q969H2|Q9BV67|Q9HAL6	Missense_Mutation	SNP	ENST00000360510.2	37	CCDS8141.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.058096	0.76074	.	.	ENSG00000254986	ENST00000531863;ENST00000532677;ENST00000360510;ENST00000453114;ENST00000541961;ENST00000530165;ENST00000543807;ENST00000347422	T;T;T;T;T;T	0.26660	1.72;1.72;1.72;1.72;1.72;1.72	5.57	5.57	0.84162	.	0.057703	0.64402	D	0.000003	T	0.49643	0.1569	M	0.74467	2.265	0.46298	D	0.998971	D;D	0.89917	1.0;0.998	D;D	0.91635	0.999;0.999	T	0.42137	-0.9469	10	0.41790	T	0.15	.	12.8963	0.58101	0.0:0.1632:0.8367:0.0	.	651;632	G3V1D3;Q9NY33	.;DPP3_HUMAN	E	652;651;632;632;632;602;530;212	ENSP00000432782:G652E;ENSP00000435284:G651E;ENSP00000353701:G632E;ENSP00000389943:G632E;ENSP00000440502:G632E;ENSP00000436941:G602E	ENSP00000309957:G212E	G	+	2	0	DPP3	66028675	1.000000	0.71417	0.989000	0.46669	0.718000	0.41266	4.486000	0.60286	2.685000	0.91497	0.543000	0.68304	GGG	.		0.612	DPP3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393424.2		
RBM14	10432	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	66384417	66384417	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr11:66384417C>G	ENST00000310137.4	+	1	365	c.226C>G	c.(226-228)Ctt>Gtt	p.L76V	RBM4_ENST00000503028.2_5'UTR|RNU4-39P_ENST00000362455.1_RNA|RBM14-RBM4_ENST00000500635.2_Missense_Mutation_p.L76V|RBM14_ENST00000409372.1_Missense_Mutation_p.L76V|RBM4_ENST00000514361.3_Missense_Mutation_p.L76V|RBM14_ENST00000409738.4_Missense_Mutation_p.L76V|RBM14-RBM4_ENST00000412278.2_Missense_Mutation_p.L76V|RBM14-RBM4_ENST00000511114.1_3'UTR|RBM14_ENST00000443702.1_Missense_Mutation_p.L76V|RBM14_ENST00000393979.3_Missense_Mutation_p.L76V	NM_006328.3	NP_006319.1	Q96PK6	RBM14_HUMAN	RNA binding motif protein 14	76					DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|glucocorticoid receptor signaling pathway (GO:0042921)|histone deacetylation (GO:0016575)|intracellular estrogen receptor signaling pathway (GO:0030520)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to hormone (GO:0009725)|transcription from RNA polymerase II promoter (GO:0006366)	mediator complex (GO:0016592)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor complex (GO:0005667)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)		RBM14/PACS1(2)	breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	17						CCCAAGGCCTCTTAATACTTG	0.672																																					p.L76V		.											.	RBM14-92	0			c.C226G						.						50.0	61.0	57.0					11																	66384417		2178	4254	6432	SO:0001583	missense	10432	exon1			AGGCCTCTTAATA	AF080561	CCDS8147.1, CCDS55772.1, CCDS55773.1	11q13.2	2013-02-12			ENSG00000239306	ENSG00000239306		"""RNA binding motif (RRM) containing"""	14219	protein-coding gene	gene with protein product	"""coactivator activator"", ""SYT interacting protein"""	612409				9285794	Standard	NM_006328		Approved	SIP, SYTIP1, COAA, DKFZp779J0927	uc001oit.3	Q96PK6	OTTHUMG00000140380	ENST00000310137.4:c.226C>G	11.37:g.66384417C>G	ENSP00000311747:p.Leu76Val	Somatic	66	0		WXS	Illumina GAIIx	Phase_I	122	11	NM_001198837	0	0	0	0	0	B0LM41|B3KMN4|D6RGD8|O75932|Q2PYN1|Q53GV1|Q68DQ9|Q96PK5	Missense_Mutation	SNP	ENST00000310137.4	37	CCDS8147.1	.	.	.	.	.	.	.	.	.	.	C	16.52	3.144943	0.57044	.	.	ENSG00000239306;ENSG00000239306;ENSG00000239306;ENSG00000239306;ENSG00000239306;ENSG00000248643;ENSG00000248643	ENST00000310137;ENST00000393979;ENST00000409372;ENST00000443702;ENST00000409738;ENST00000412278;ENST00000500635	T;T;T;T;T;T;T	0.74002	-0.8;-0.8;3.36;3.36;3.36;3.36;3.36	5.06	3.19	0.36642	Nucleotide-binding, alpha-beta plait (1);	0.000000	0.37623	N	0.002014	T	0.60689	0.2288	L	0.28400	0.85	0.80722	D	1	P;P;P;P	0.44946	0.846;0.759;0.478;0.549	B;B;B;B	0.42062	0.374;0.256;0.109;0.082	T	0.53920	-0.8370	10	0.29301	T	0.29	-0.4428	9.128	0.36828	0.0:0.8193:0.0:0.1807	.	76;76;76;76	B0LM41;Q96PK6-2;Q2PYN1;Q96PK6	.;.;.;RBM14_HUMAN	V	76	ENSP00000311747:L76V;ENSP00000377548:L76V;ENSP00000386518:L76V;ENSP00000414650:L76V;ENSP00000386995:L76V;ENSP00000388552:L76V;ENSP00000421279:L76V	ENSP00000311747:L76V	L	+	1	0	RBM14;RBM14-RBM4	66140993	0.985000	0.35326	0.892000	0.35008	0.983000	0.72400	2.070000	0.41491	0.547000	0.28938	0.462000	0.41574	CTT	.		0.672	RBM14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277128.1	NM_006328	
CORO1B	57175	hgsc.bcm.edu	37	11	67206163	67206163	+	Silent	SNP	G	G	A	rs148492786	byFrequency	TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr11:67206163G>A	ENST00000341356.5	-	10	1433	c.1323C>T	c.(1321-1323)agC>agT	p.S441S	PTPRCAP_ENST00000326294.3_5'Flank|CORO1B_ENST00000539724.1_5'UTR|CORO1B_ENST00000393893.1_Silent_p.S441S	NM_020441.2	NP_065174.1	Q9BR76	COR1B_HUMAN	coronin, actin binding protein, 1B	441					actin cytoskeleton organization (GO:0030036)|actin filament branching (GO:0090135)|actin filament bundle assembly (GO:0051017)|cell migration (GO:0016477)|endothelial cell chemotaxis (GO:0035767)|negative regulation of Arp2/3 complex-mediated actin nucleation (GO:0034316)|positive regulation of lamellipodium morphogenesis (GO:2000394)|protein localization to cell leading edge (GO:1902463)|ruffle organization (GO:0031529)|wound healing (GO:0042060)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)|Arp2/3 complex binding (GO:0071933)|identical protein binding (GO:0042802)			cervix(1)|endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)	13			BRCA - Breast invasive adenocarcinoma(15;3.26e-06)			CCAGGCTGCCGCTGGGGGTGG	0.721													G|||	4	0.000798722	0.0008	0.0	5008	,	,		14898	0.0		0.003	False		,,,				2504	0.0				p.S441S		.											.	CORO1B-108	0			c.C1323T						.						3.0	4.0	3.0					11																	67206163		1791	3801	5592	SO:0001819	synonymous_variant	57175	exon10			GCTGCCGCTGGGG	AK000860	CCDS8164.1	11q13.1	2013-01-10	2001-11-28		ENSG00000172725	ENSG00000172725		"""Coronins"", ""WD repeat domain containing"""	2253	protein-coding gene	gene with protein product		609849	"""coronin, actin-binding protein, 1B"""			9778037	Standard	NM_001018070		Approved	coronin-2	uc001olk.1	Q9BR76	OTTHUMG00000167775	ENST00000341356.5:c.1323C>T	11.37:g.67206163G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	12	8	NM_020441	0	0	0	0	0	B2RD45	Silent	SNP	ENST00000341356.5	37	CCDS8164.1																																																																																			G|0.997;A|0.003		0.721	CORO1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396220.1	NM_020441	
OR2AT4	341152	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	74800245	74800245	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr11:74800245C>G	ENST00000305159.3	-	1	554	c.514G>C	c.(514-516)Gca>Cca	p.A172P		NM_001005285.1	NP_001005285.1	A6NND4	O2AT4_HUMAN	olfactory receptor, family 2, subfamily AT, member 4	172						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(2)	12						CTGTTATATGCCATCTGGGAG	0.567																																					p.A172P		.											.	OR2AT4-69	0			c.G514C						.						98.0	88.0	92.0					11																	74800245		2200	4293	6493	SO:0001583	missense	341152	exon1			TATATGCCATCTG	BK004820	CCDS31639.1	11q13.4	2012-08-09			ENSG00000171561	ENSG00000171561		"""GPCR / Class A : Olfactory receptors"""	19620	protein-coding gene	gene with protein product							Standard	NM_001005285		Approved		uc010rro.2	A6NND4	OTTHUMG00000165370	ENST00000305159.3:c.514G>C	11.37:g.74800245C>G	ENSP00000304846:p.Ala172Pro	Somatic	144	0		WXS	Illumina GAIIx	Phase_I	103	43	NM_001005285	0	0	0	0	0	B9EGZ8	Missense_Mutation	SNP	ENST00000305159.3	37	CCDS31639.1	.	.	.	.	.	.	.	.	.	.	C	0.929	-0.713439	0.03206	.	.	ENSG00000171561	ENST00000305159	T	0.34859	1.34	4.73	2.84	0.33178	GPCR, rhodopsin-like superfamily (1);	0.950518	0.08500	U	0.936669	T	0.20210	0.0486	N	0.00389	-1.56	0.09310	N	1	P	0.50066	0.931	P	0.54401	0.751	T	0.33523	-0.9865	10	0.42905	T	0.14	.	9.3636	0.38210	0.0:0.7436:0.0:0.2564	.	172	A6NND4	O2AT4_HUMAN	P	172	ENSP00000304846:A172P	ENSP00000304846:A172P	A	-	1	0	OR2AT4	74477893	0.001000	0.12720	0.187000	0.23214	0.034000	0.12701	-0.365000	0.07573	0.316000	0.23135	-0.813000	0.03139	GCA	.		0.567	OR2AT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383734.1	NM_001005285	
KMT2A	4297	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	118344503	118344503	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr11:118344503G>C	ENST00000389506.5	+	3	2629	c.2629G>C	c.(2629-2631)Gac>Cac	p.D877H	KMT2A_ENST00000534358.1_Missense_Mutation_p.D877H|KMT2A_ENST00000354520.4_Missense_Mutation_p.D877H			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	877					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										tagagagagagaccgggagag	0.473																																					p.D877H		.											.	MLL-1255	0			c.G2629C						.						46.0	45.0	45.0					11																	118344503		2200	4296	6496	SO:0001583	missense	4297	exon3			GAGAGAGACCGGG	L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.2629G>C	11.37:g.118344503G>C	ENSP00000374157:p.Asp877His	Somatic	49	0		WXS	Illumina GAIIx	Phase_I	49	18	NM_001197104	0	0	0	0	0	E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Missense_Mutation	SNP	ENST00000389506.5	37	CCDS31686.1	.	.	.	.	.	.	.	.	.	.	G	12.69	2.014563	0.35511	.	.	ENSG00000118058	ENST00000534358;ENST00000531904;ENST00000389506;ENST00000354520	D;T;D;D	0.83673	-1.75;0.36;-1.75;-1.72	5.56	5.56	0.83823	.	0.106294	0.64402	D	0.000005	D	0.84620	0.5512	N	0.24115	0.695	0.43885	D	0.996506	D;D;D	0.67145	0.996;0.996;0.996	P;P;P	0.61800	0.894;0.894;0.894	D	0.84377	0.0547	10	0.41790	T	0.15	.	19.503	0.95104	0.0:0.0:1.0:0.0	.	877;877;910	E9PQG7;Q03164;E9PR05	.;MLL1_HUMAN;.	H	877;910;877;877	ENSP00000436786:D877H;ENSP00000432391:D910H;ENSP00000374157:D877H;ENSP00000346516:D877H	ENSP00000346516:D877H	D	+	1	0	MLL	117849713	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.633000	0.67825	2.781000	0.95711	0.591000	0.81541	GAC	.		0.473	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399085.2	NM_005933	
HMBS	3145	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	118963200	118963200	+	Silent	SNP	C	C	T			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr11:118963200C>T	ENST00000278715.3	+	11	889	c.738C>T	c.(736-738)cgC>cgT	p.R246R	HMBS_ENST00000542729.1_Intron|HMBS_ENST00000392841.1_Silent_p.R229R|HMBS_ENST00000537841.1_Silent_p.R229R|HMBS_ENST00000544387.1_Intron|HMBS_ENST00000543090.1_Silent_p.R215R|HMBS_ENST00000442944.2_Silent_p.R229R	NM_000190.3	NP_000181.2	P08397	HEM3_HUMAN	hydroxymethylbilane synthase	246					heme biosynthetic process (GO:0006783)|peptidyl-pyrromethane cofactor linkage (GO:0018160)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	hydroxymethylbilane synthase activity (GO:0004418)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|urinary_tract(1)	15	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.72e-05)		CTCTGCTTCGCTGCATCGCTG	0.607																																					p.R246R		.											.	HMBS-90	0			c.C738T						.						112.0	107.0	108.0					11																	118963200		2200	4295	6495	SO:0001819	synonymous_variant	3145	exon11			GCTTCGCTGCATC	X04808	CCDS8409.1, CCDS41726.1, CCDS58186.1, CCDS58187.1	11q23.3	2013-07-10			ENSG00000256269	ENSG00000256269	2.5.1.61		4982	protein-coding gene	gene with protein product		609806	"""uroporphyrinogen I synthase"", ""porphobilinogen deaminase"", ""porphyria, acute; Chester type"""	PBGD, UPS, PORC		8432552, 17298217	Standard	NM_001258208		Approved		uc001puz.1	P08397	OTTHUMG00000168295	ENST00000278715.3:c.738C>T	11.37:g.118963200C>T		Somatic	85	0		WXS	Illumina GAIIx	Phase_I	75	6	NM_000190	0	0	0	0	0	A8K2L0|G3V1P4|G5EA58|P08396|Q16012	Silent	SNP	ENST00000278715.3	37	CCDS8409.1																																																																																			.		0.607	HMBS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399188.1	NM_000190	
FLI1	2313	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	128677078	128677078	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr11:128677078C>A	ENST00000527786.2	+	7	1214	c.725C>A	c.(724-726)cCt>cAt	p.P242H	FLI1_ENST00000534087.2_Missense_Mutation_p.P209H|FLI1_ENST00000344954.6_Missense_Mutation_p.P209H|FLI1_ENST00000525560.1_Missense_Mutation_p.P49H|FLI1_ENST00000281428.8_Missense_Mutation_p.P176H	NM_001271010.1|NM_002017.4	NP_001257939.1|NP_002008.2	Q01543	FLI1_HUMAN	Fli-1 proto-oncogene, ETS transcription factor	242					blood circulation (GO:0008015)|cell differentiation (GO:0030154)|hemostasis (GO:0007599)|megakaryocyte development (GO:0035855)|organ morphogenesis (GO:0009887)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)		EWSR1/FLI1(2569)	NS(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(14)|ovary(3)|prostate(2)	31	all_hematologic(175;0.0641)	Lung NSC(97;0.00588)|all_lung(97;0.00764)|Breast(109;0.0115)|Medulloblastoma(222;0.0523)|all_neural(223;0.0862)|all_hematologic(192;0.182)		OV - Ovarian serous cystadenocarcinoma(99;0.01)|LUSC - Lung squamous cell carcinoma(976;0.0324)|Lung(977;0.0327)		GCCACAGGTCCTCCCCTTGGA	0.547			T	EWSR1	Ewing sarcoma																																p.P242H		.		Dom	yes		11	11q24	2313	Friend leukemia virus integration 1		M	.	FLI1-1084	0			c.C725A						.						53.0	55.0	55.0					11																	128677078		1905	4124	6029	SO:0001583	missense	2313	exon7			CAGGTCCTCCCCT	M98833	CCDS44768.1, CCDS53725.1, CCDS59230.1, CCDS59231.1	11q24.1-q24.3	2014-09-17	2013-08-07		ENSG00000151702	ENSG00000151702			3749	protein-coding gene	gene with protein product		193067	"""Friend leukemia virus integration 1"""			1765382	Standard	NM_001167681		Approved	SIC-1, EWSR2	uc010sbu.2	Q01543	OTTHUMG00000165792	ENST00000527786.2:c.725C>A	11.37:g.128677078C>A	ENSP00000433488:p.Pro242His	Somatic	88	0		WXS	Illumina GAIIx	Phase_I	76	30	NM_002017	0	0	0	0	0	B2R8H2|B4DFV4|B4DTC6|G3V183|Q14319|Q92480|Q9UE07	Missense_Mutation	SNP	ENST00000527786.2	37	CCDS44768.1	.	.	.	.	.	.	.	.	.	.	C	15.15	2.747469	0.49257	.	.	ENSG00000151702	ENST00000525560;ENST00000344954;ENST00000429175;ENST00000534087;ENST00000281428	T;T;T;T;T	0.23950	1.88;2.46;2.45;2.46;2.47	5.38	4.46	0.54185	.	0.702895	0.14201	N	0.334719	T	0.28267	0.0698	N	0.24115	0.695	0.48632	D	0.99968	B;B;B	0.32031	0.004;0.009;0.352	B;B;B	0.42916	0.002;0.003;0.402	T	0.17623	-1.0363	10	0.66056	D	0.02	.	15.1767	0.72916	0.0:0.8582:0.1418:0.0	.	242;49;176	Q01543;B4DFV4;Q01543-2	FLI1_HUMAN;.;.	H	49;209;242;209;176	ENSP00000437124:P49H;ENSP00000339627:P209H;ENSP00000399985:P242H;ENSP00000432950:P209H;ENSP00000281428:P176H	ENSP00000281428:P176H	P	+	2	0	FLI1	128182288	1.000000	0.71417	0.982000	0.44146	0.270000	0.26580	4.768000	0.62293	1.371000	0.46172	0.650000	0.86243	CCT	.		0.547	FLI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386226.2	NM_002017	
IGSF9B	22997	hgsc.bcm.edu	37	11	133790390	133790390	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr11:133790390G>T	ENST00000321016.8	-	18	3460	c.3230C>A	c.(3229-3231)cCc>cAc	p.P1077H	IGSF9B_ENST00000533871.2_Missense_Mutation_p.P1077H			Q9UPX0	TUTLB_HUMAN	immunoglobulin superfamily, member 9B	1077	Pro-rich.				homophilic cell adhesion (GO:0007156)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)	dendrite (GO:0030425)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)		CAGTCCTCGGGGGAGGCCGGC	0.701																																					p.P1077H		.											.	IGSF9B-68	0			c.C3230A						.						22.0	28.0	26.0					11																	133790390		1933	4112	6045	SO:0001583	missense	22997	exon18			CCTCGGGGGAGGC	AK097578	CCDS61010.1	11q25	2013-02-11	2005-10-12	2005-11-20				"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	32326	protein-coding gene	gene with protein product		613773					Standard	NM_001277285		Approved	KIAA1030	uc031qfh.1	Q9UPX0		ENST00000321016.8:c.3230C>A	11.37:g.133790390G>T	ENSP00000317980:p.Pro1077His	Somatic	7	0		WXS	Illumina GAIIx	Phase_I	27	14	NM_014987	0	0	0	0	0	G5EA26	Missense_Mutation	SNP	ENST00000321016.8	37		.	.	.	.	.	.	.	.	.	.	G	14.76	2.630151	0.46944	.	.	ENSG00000080854	ENST00000321016;ENST00000533871	T;T	0.70516	-0.18;-0.49	4.82	4.82	0.62117	.	0.000000	0.44285	D	0.000464	T	0.55130	0.1901	N	0.14661	0.345	0.29740	N	0.83721	P	0.46277	0.875	B	0.43783	0.431	T	0.57100	-0.7869	10	0.38643	T	0.18	.	11.1106	0.48230	0.0861:0.0:0.9139:0.0	.	1077	Q9UPX0	TUTLB_HUMAN	H	1077;919	ENSP00000317980:P1077H;ENSP00000436552:P919H	ENSP00000317980:P1077H	P	-	2	0	IGSF9B	133295600	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.573000	0.82421	2.220000	0.72140	0.455000	0.32223	CCC	.		0.701	IGSF9B-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		XM_290502	
CACNA1C	775	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	2614015	2614015	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr12:2614015A>G	ENST00000347598.4	+	8	1121	c.1121A>G	c.(1120-1122)gAt>gGt	p.D374G	CACNA1C_ENST00000399634.1_Intron|CACNA1C_ENST00000399621.1_Missense_Mutation_p.D374G|CACNA1C_ENST00000399637.1_Missense_Mutation_p.D374G|CACNA1C_ENST00000491104.1_Intron|CACNA1C_ENST00000399617.1_Intron|CACNA1C_ENST00000399644.1_Missense_Mutation_p.D374G|CACNA1C_ENST00000399649.1_Missense_Mutation_p.D374G|CACNA1C_ENST00000399601.1_Missense_Mutation_p.D374G|CACNA1C_ENST00000399629.1_Missense_Mutation_p.D374G|CACNA1C_ENST00000480911.1_Missense_Mutation_p.D374G|CACNA1C_ENST00000402845.3_Missense_Mutation_p.D374G|CACNA1C_ENST00000327702.7_Missense_Mutation_p.D374G|CACNA1C_ENST00000406454.3_Intron|CACNA1C_ENST00000399655.1_Missense_Mutation_p.D374G|CACNA1C_ENST00000399603.1_Intron|CACNA1C_ENST00000399641.1_Intron|CACNA1C_ENST00000344100.3_Missense_Mutation_p.D374G|CACNA1C_ENST00000399606.1_Missense_Mutation_p.D374G|CACNA1C_ENST00000335762.5_Missense_Mutation_p.D374G|CACNA1C_ENST00000399597.1_Missense_Mutation_p.D374G|CACNA1C_ENST00000399638.1_Missense_Mutation_p.D374G|CACNA1C_ENST00000399591.1_Missense_Mutation_p.D374G|CACNA1C_ENST00000399595.1_Missense_Mutation_p.D374G	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	374					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	CAGGTCAATGATGCCGTAGGA	0.522																																					p.D374G		.											.	CACNA1C-34	0			c.A1121G						.						100.0	101.0	100.0					12																	2614015		1983	4173	6156	SO:0001583	missense	775	exon8			TCAATGATGCCGT	AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.1121A>G	12.37:g.2614015A>G	ENSP00000266376:p.Asp374Gly	Somatic	180	0		WXS	Illumina GAIIx	Phase_I	245	47	NM_001129831	0	0	0	0	0	B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Missense_Mutation	SNP	ENST00000347598.4	37	CCDS44788.1	.	.	.	.	.	.	.	.	.	.	A	22.4	4.280909	0.80692	.	.	ENSG00000151067	ENST00000335762;ENST00000399655;ENST00000480911;ENST00000399644;ENST00000399638;ENST00000399597;ENST00000399621;ENST00000399637;ENST00000399591;ENST00000347598;ENST00000399606;ENST00000399601;ENST00000344100;ENST00000399629;ENST00000327702;ENST00000399649;ENST00000402845;ENST00000399595	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.97455	-4.34;-4.33;-4.3;-4.32;-4.31;-4.32;-4.34;-4.24;-4.29;-4.25;-4.26;-4.33;-4.37;-4.25;-4.18;-4.38;-4.34;-4.39	5.17	5.17	0.71159	Ion transport (1);	.	.	.	.	D	0.98940	0.9640	H	0.96547	3.84	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	0.999;0.998;1.0;0.999;0.999;0.998;0.999;1.0;1.0;0.999;0.998;1.0;0.999;1.0;0.998;0.999;0.999;0.998;0.998	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.97110	0.996;0.995;0.996;0.996;0.998;0.995;0.998;0.996;1.0;0.998;0.998;0.992;0.998;0.995;0.991;0.998;0.998;0.991;0.995	D	0.99560	1.0968	9	0.87932	D	0	.	15.178	0.72931	1.0:0.0:0.0:0.0	.	374;371;374;374;374;374;374;374;374;374;374;374;374;374;374;374;374;374;374	Q13936-14;Q13936-35;Q13936;Q13936-33;Q13936-13;Q13936-22;Q13936-32;Q13936-31;Q13936-21;Q13936-30;Q13936-11;Q13936-25;Q13936-15;Q13936-29;Q13936-19;Q13936-24;Q13936-27;Q13936-20;Q13936-12	.;.;CAC1C_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	G	374	ENSP00000336982:D374G;ENSP00000382563:D374G;ENSP00000437936:D374G;ENSP00000382552:D374G;ENSP00000382547:D374G;ENSP00000382506:D374G;ENSP00000382530:D374G;ENSP00000382546:D374G;ENSP00000382500:D374G;ENSP00000266376:D374G;ENSP00000382515:D374G;ENSP00000382510:D374G;ENSP00000341092:D374G;ENSP00000382537:D374G;ENSP00000329877:D374G;ENSP00000382557:D374G;ENSP00000385724:D374G;ENSP00000382504:D374G	ENSP00000329877:D374G	D	+	2	0	CACNA1C	2484276	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.139000	0.94554	2.168000	0.68352	0.528000	0.53228	GAT	.		0.522	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317035.1	NM_000719	
CLEC4C	170482	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	7882323	7882323	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr12:7882323C>A	ENST00000542353.1	-	7	1001	c.511G>T	c.(511-513)Ggt>Tgt	p.G171C	CLEC4C_ENST00000540085.1_Missense_Mutation_p.G140C|CLEC4C_ENST00000354629.5_Missense_Mutation_p.G140C|CLEC4C_ENST00000360345.3_Missense_Mutation_p.G171C	NM_130441.2	NP_569708.1	Q8WTT0	CLC4C_HUMAN	C-type lectin domain family 4, member C	171	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				innate immune response (GO:0045087)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			autonomic_ganglia(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25				Kidney(36;0.0915)		TTGGGTTCACCTGAGTGCCAG	0.448																																					p.G171C		.											.	CLEC4C-93	0			c.G511T						.						138.0	129.0	132.0					12																	7882323		2203	4300	6503	SO:0001583	missense	170482	exon7			GTTCACCTGAGTG	AF325460	CCDS8583.1, CCDS8584.1	12p13.2-p12.3	2008-02-05	2004-02-13	2005-02-11	ENSG00000198178	ENSG00000198178		"""C-type lectin domain containing"", ""CD molecules"""	13258	protein-coding gene	gene with protein product		606677	"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 7"""	CLECSF11, CLECSF7		11031109, 11536172	Standard	NM_130441		Approved	HECL, DLEC, BDCA2, CD303	uc001qth.1	Q8WTT0	OTTHUMG00000168441	ENST00000542353.1:c.511G>T	12.37:g.7882323C>A	ENSP00000440428:p.Gly171Cys	Somatic	92	0		WXS	Illumina GAIIx	Phase_I	127	25	NM_130441	0	0	0	0	0	D3DUU3|Q3T1C3|Q6UXS8|Q8WXX8	Missense_Mutation	SNP	ENST00000542353.1	37	CCDS8583.1	.	.	.	.	.	.	.	.	.	.	C	12.83	2.054095	0.36277	.	.	ENSG00000198178	ENST00000542353;ENST00000354629;ENST00000540085;ENST00000360345;ENST00000543765	T;T;T;T;T	0.26373	1.74;1.74;1.74;1.74;1.74	1.73	1.73	0.24493	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	.	.	.	.	T	0.55924	0.1951	M	0.93420	3.415	0.21822	N	0.999529	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.995	T	0.38714	-0.9648	9	0.87932	D	0	.	6.9111	0.24335	0.0:1.0:0.0:0.0	.	140;171	Q8WTT0-2;Q8WTT0	.;CLC4C_HUMAN	C	171;140;140;171;131	ENSP00000440428:G171C;ENSP00000346648:G140C;ENSP00000445338:G140C;ENSP00000353500:G171C;ENSP00000442457:G131C	ENSP00000346648:G140C	G	-	1	0	CLEC4C	7773590	0.125000	0.22332	0.431000	0.26735	0.043000	0.13939	0.582000	0.23834	1.280000	0.44463	0.561000	0.74099	GGT	.		0.448	CLEC4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399750.1	NM_203503	
A2ML1	144568	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	8995922	8995922	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr12:8995922G>A	ENST00000299698.7	+	12	1621	c.1441G>A	c.(1441-1443)Gca>Aca	p.A481T	A2ML1_ENST00000539547.1_5'Flank	NM_001282424.1|NM_144670.4	NP_001269353.1|NP_653271			alpha-2-macroglobulin-like 1											NS(2)|breast(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(2)|lung(36)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	80						CCCGGCCGATGCAAGCCCTGA	0.562																																					p.A481T		.											.	A2ML1-93	0			c.G1441A						.						54.0	54.0	54.0					12																	8995922		1946	4133	6079	SO:0001583	missense	144568	exon12			GCCGATGCAAGCC	AK057908	CCDS8596.2, CCDS73439.1	12p13	2010-12-14	2005-09-01	2005-09-01	ENSG00000166535	ENSG00000166535			23336	protein-coding gene	gene with protein product		610627	"""C3 and PZP-like, alpha-2-macroglobulin domain containing 9"""	CPAMD9		16298998	Standard	NM_144670		Approved	FLJ25179	uc001quz.5	A8K2U0	OTTHUMG00000128499	ENST00000299698.7:c.1441G>A	12.37:g.8995922G>A	ENSP00000299698:p.Ala481Thr	Somatic	83	0		WXS	Illumina GAIIx	Phase_I	151	35	NM_144670	0	0	0	0	0		Missense_Mutation	SNP	ENST00000299698.7	37	CCDS8596.2	.	.	.	.	.	.	.	.	.	.	G	8.774	0.926547	0.18056	.	.	ENSG00000166535	ENST00000299698;ENST00000539161;ENST00000541459	T;T	0.30981	1.51;1.64	4.24	1.43	0.22495	Alpha-2-macroglobulin, N-terminal 2 (1);	0.679722	0.12903	N	0.429640	T	0.23014	0.0556	L	0.38838	1.175	0.09310	N	0.999999	P	0.37731	0.607	B	0.43155	0.41	T	0.14282	-1.0478	10	0.33940	T	0.23	.	1.4929	0.02460	0.1884:0.168:0.4705:0.1731	.	481	A8K2U0	A2ML1_HUMAN	T	481;481;31	ENSP00000299698:A481T;ENSP00000443174:A31T	ENSP00000299698:A481T	A	+	1	0	A2ML1	8887189	0.002000	0.14202	0.065000	0.19835	0.001000	0.01503	0.795000	0.26972	0.331000	0.23511	-0.258000	0.10820	GCA	.		0.562	A2ML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250304.3	NM_144670	
KLRK1	22914	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	10541381	10541381	+	Missense_Mutation	SNP	C	C	G	rs375696662		TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr12:10541381C>G	ENST00000240618.6	-	2	169	c.29G>C	c.(28-30)cGa>cCa	p.R10P	KLRK1_ENST00000540818.1_Missense_Mutation_p.R10P|RP11-277P12.20_ENST00000500682.1_RNA|KLRC4-KLRK1_ENST00000539300.1_3'UTR	NM_001199805.1|NM_007360.3	NP_001186734.1|NP_031386.2	P26718	NKG2D_HUMAN	killer cell lectin-like receptor subfamily K, member 1	10					cell differentiation (GO:0030154)|innate immune response (GO:0045087)|natural killer cell activation (GO:0030101)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|skin(1)	9						CCAGCTGTGTCGAGACCTCCG	0.388																																					p.R10P		.											.	.	0			c.G29C						.						98.0	89.0	92.0					12																	10541381		2203	4300	6503	SO:0001583	missense	0	exon7			CTGTGTCGAGACC	AJ001687	CCDS8623.1	12p13.2-p12.3	2010-02-17	2003-02-19		ENSG00000213809	ENSG00000213809		"""Killer cell lectin-like receptors"", ""CD molecules"""	18788	protein-coding gene	gene with protein product		611817	"""DNA segment on chromosome 12 (unique) 2489 expressed sequence"""	D12S2489E		9683661, 2007850	Standard	NM_007360		Approved	NKG2D, KLR, NKG2-D, CD314	uc009zhj.3	P26718	OTTHUMG00000168574	ENST00000240618.6:c.29G>C	12.37:g.10541381C>G	ENSP00000240618:p.Arg10Pro	Somatic	58	0		WXS	Illumina GAIIx	Phase_I	87	7	NM_001199805	0	0	0	0	0	A8K7K5|A8K7P4|Q9NR41	Missense_Mutation	SNP	ENST00000240618.6	37	CCDS8623.1	.	.	.	.	.	.	.	.	.	.	C	10.12	1.262839	0.23051	.	.	ENSG00000213809	ENST00000240618;ENST00000540818	T;T	0.01474	4.85;4.85	3.92	0.0572	0.14322	.	1.508560	0.03947	N	0.287889	T	0.01765	0.0056	N	0.25647	0.755	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.47355	-0.9124	10	0.39692	T	0.17	.	4.4228	0.11488	0.0:0.1157:0.4049:0.4794	.	10;10	Q8WZ67;P26718	.;NKG2D_HUMAN	P	10	ENSP00000240618:R10P;ENSP00000446003:R10P	ENSP00000240618:R10P	R	-	2	0	KLRK1	10432648	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-0.105000	0.10907	0.001000	0.14605	-0.334000	0.08254	CGA	.		0.388	KLRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400269.1	NM_007360	
BCAT1	586	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	25002802	25002802	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr12:25002802T>G	ENST00000261192.7	-	6	1118	c.592A>C	c.(592-594)Acc>Ccc	p.T198P	BCAT1_ENST00000539780.1_Missense_Mutation_p.T161P|BCAT1_ENST00000539282.1_Missense_Mutation_p.T210P|BCAT1_ENST00000538118.1_Missense_Mutation_p.T197P|BCAT1_ENST00000342945.5_Missense_Mutation_p.T137P|BCAT1_ENST00000544418.1_5'UTR	NM_001178091.1|NM_005504.6	NP_001171562.1|NP_005495.2	P54687	BCAT1_HUMAN	branched chain amino-acid transaminase 1, cytosolic	198					branched-chain amino acid biosynthetic process (GO:0009082)|branched-chain amino acid catabolic process (GO:0009083)|cell proliferation (GO:0008283)|cellular nitrogen compound metabolic process (GO:0034641)|G1/S transition of mitotic cell cycle (GO:0000082)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	branched-chain-amino-acid transaminase activity (GO:0004084)|L-isoleucine transaminase activity (GO:0052656)|L-leucine transaminase activity (GO:0052654)|L-valine transaminase activity (GO:0052655)			breast(1)|large_intestine(1)|lung(3)|prostate(2)	7	Acute lymphoblastic leukemia(6;0.00112)|all_hematologic(7;0.00152)|Ovarian(17;0.107)|Colorectal(261;0.196)				Gabapentin(DB00996)|L-Isoleucine(DB00167)|L-Leucine(DB00149)|L-Valine(DB00161)	GGATTAAAGGTTCCACTTGAA	0.478																																					p.T210P		.											.	BCAT1-522	0			c.A628C						.						127.0	122.0	123.0					12																	25002802		1839	4081	5920	SO:0001583	missense	586	exon6			TAAAGGTTCCACT		CCDS44845.1, CCDS53760.1, CCDS53761.1, CCDS53762.1, CCDS53763.1	12p12.1	2012-10-02	2010-05-07		ENSG00000060982	ENSG00000060982	2.6.1.42		976	protein-coding gene	gene with protein product		113520	"""branched chain aminotransferase 1, cytosolic"""	BCT1		9165094	Standard	NM_005504		Approved		uc010six.2	P54687	OTTHUMG00000169053	ENST00000261192.7:c.592A>C	12.37:g.25002802T>G	ENSP00000261192:p.Thr198Pro	Somatic	97	1		WXS	Illumina GAIIx	Phase_I	99	37	NM_001178093	0	0	0	0	0	B3KY27|B7Z2M5|B7Z5L0|F5H5E4|Q68DQ7|Q96MY9	Missense_Mutation	SNP	ENST00000261192.7	37	CCDS44845.1	.	.	.	.	.	.	.	.	.	.	T	13.04	2.119533	0.37436	.	.	ENSG00000060982	ENST00000261192;ENST00000538118;ENST00000342945;ENST00000539282;ENST00000539780	T;T;T;T;T	0.22134	1.97;1.97;1.97;1.97;1.97	5.33	1.35	0.21983	.	0.807722	0.11659	N	0.542036	T	0.18341	0.0440	N	0.25647	0.755	0.09310	N	1	B;B;B;B;B	0.33318	0.408;0.125;0.254;0.033;0.02	B;B;B;B;B	0.43783	0.431;0.101;0.431;0.162;0.079	T	0.34900	-0.9810	10	0.51188	T	0.08	-18.5331	4.251	0.10695	0.3508:0.1359:0.0:0.5133	.	161;210;137;198;197	B7Z5L0;F5H5E4;B3KY27;P54687;Q68DQ7	.;.;.;BCAT1_HUMAN;.	P	198;197;137;210;161	ENSP00000261192:T198P;ENSP00000440817:T197P;ENSP00000339805:T137P;ENSP00000443459:T210P;ENSP00000440827:T161P	ENSP00000261192:T198P	T	-	1	0	BCAT1	24894069	0.154000	0.22792	0.016000	0.15963	0.983000	0.72400	0.414000	0.21164	-0.022000	0.13986	0.533000	0.62120	ACC	.		0.478	BCAT1-001	KNOWN	upstream_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402080.1	NM_005504	
ITPR2	3709	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	26809287	26809287	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr12:26809287A>C	ENST00000381340.3	-	19	2803	c.2387T>G	c.(2386-2388)gTg>gGg	p.V796G		NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	796					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)		ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	GCGAACAGGCACCACGGACTC	0.537																																					p.V796G		.											.	ITPR2-542	0			c.T2387G						.						72.0	74.0	74.0					12																	26809287		1987	4183	6170	SO:0001583	missense	3709	exon19			ACAGGCACCACGG	D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.2387T>G	12.37:g.26809287A>C	ENSP00000370744:p.Val796Gly	Somatic	129	1		WXS	Illumina GAIIx	Phase_I	137	40	NM_002223	0	0	0	0	0	O94773	Missense_Mutation	SNP	ENST00000381340.3	37	CCDS41764.1	.	.	.	.	.	.	.	.	.	.	A	15.04	2.714281	0.48622	.	.	ENSG00000123104	ENST00000381340	D	0.91792	-2.91	4.62	3.5	0.40072	.	0.000000	0.85682	D	0.000000	D	0.88876	0.6556	L	0.36672	1.1	0.80722	D	1	P	0.43885	0.82	P	0.47626	0.552	D	0.88299	0.2948	10	0.62326	D	0.03	.	8.0852	0.30769	0.8421:0.0:0.1579:0.0	.	796	Q14571	ITPR2_HUMAN	G	796	ENSP00000370744:V796G	ENSP00000370744:V796G	V	-	2	0	ITPR2	26700554	0.995000	0.38212	1.000000	0.80357	0.912000	0.54170	3.665000	0.54532	2.059000	0.61396	0.533000	0.62120	GTG	.		0.537	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402732.1	NM_002223	
KIAA1551	55196	broad.mit.edu	37	12	32135980	32135980	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr12:32135980A>C	ENST00000312561.4	+	4	2505	c.2091A>C	c.(2089-2091)agA>agC	p.R697S	KIAA1551_ENST00000535596.1_Intron	NM_018169.3	NP_060639	Q9HCM1	K1551_HUMAN	KIAA1551	697																	ATAAACTCAGAACAAACACAA	0.398																																					p.R697S		.											.	.	0			c.A2091C						.						61.0	55.0	57.0					12																	32135980		2203	4300	6503	SO:0001583	missense	55196	exon4			ACTCAGAACAAAC	AK001514	CCDS8725.2	12p11.21	2012-08-14	2012-08-14	2012-08-14	ENSG00000174718	ENSG00000174718			25559	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 35"""	C12orf35		10997877	Standard	NM_018169		Approved	FLJ20696, FLJ10652	uc001rks.3	Q9HCM1	OTTHUMG00000128501	ENST00000312561.4:c.2091A>C	12.37:g.32135980A>C	ENSP00000310338:p.Arg697Ser	Somatic	41	1		WXS	Illumina GAIIx	Phase_I	56	6	NM_018169	0	0	0	0	0	B2RTU5|Q4KN17|Q9NVL6|Q9NWP9	Missense_Mutation	SNP	ENST00000312561.4	37	CCDS8725.2	.	.	.	.	.	.	.	.	.	.	A	8.632	0.893958	0.17613	.	.	ENSG00000174718	ENST00000312561	T	0.12361	2.69	4.89	-0.396	0.12427	.	1.328980	0.04640	N	0.405129	T	0.11750	0.0286	L	0.43152	1.355	0.09310	N	1	B	0.13145	0.007	B	0.13407	0.009	T	0.34477	-0.9827	9	.	.	.	.	4.2939	0.10892	0.4757:0.3396:0.1847:0.0	.	697	Q9HCM1	CL035_HUMAN	S	697	ENSP00000310338:R697S	.	R	+	3	2	C12orf35	32027247	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.449000	0.21744	-0.219000	0.10003	-0.472000	0.04984	AGA	.		0.398	KIAA1551-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250307.2	NM_018169	
KIAA1551	55196	broad.mit.edu	37	12	32136103	32136103	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr12:32136103G>C	ENST00000312561.4	+	4	2628	c.2214G>C	c.(2212-2214)ttG>ttC	p.L738F	KIAA1551_ENST00000535596.1_Intron	NM_018169.3	NP_060639	Q9HCM1	K1551_HUMAN	KIAA1551	738																	AGACAGCTTTGTCGATGGTAA	0.388																																					p.L738F		.											.	.	0			c.G2214C						.						70.0	70.0	70.0					12																	32136103		2203	4300	6503	SO:0001583	missense	55196	exon4			AGCTTTGTCGATG	AK001514	CCDS8725.2	12p11.21	2012-08-14	2012-08-14	2012-08-14	ENSG00000174718	ENSG00000174718			25559	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 35"""	C12orf35		10997877	Standard	NM_018169		Approved	FLJ20696, FLJ10652	uc001rks.3	Q9HCM1	OTTHUMG00000128501	ENST00000312561.4:c.2214G>C	12.37:g.32136103G>C	ENSP00000310338:p.Leu738Phe	Somatic	58	0		WXS	Illumina GAIIx	Phase_I	69	3	NM_018169	0	0	0	0	0	B2RTU5|Q4KN17|Q9NVL6|Q9NWP9	Missense_Mutation	SNP	ENST00000312561.4	37	CCDS8725.2	.	.	.	.	.	.	.	.	.	.	G	12.87	2.066665	0.36470	.	.	ENSG00000174718	ENST00000312561	T	0.19250	2.16	5.35	-0.454	0.12197	.	0.338259	0.21728	N	0.070012	T	0.18800	0.0451	L	0.59436	1.845	0.09310	N	1	P	0.51240	0.943	P	0.45310	0.476	T	0.11792	-1.0573	9	.	.	.	.	3.4385	0.07454	0.1383:0.1006:0.4536:0.3075	.	738	Q9HCM1	CL035_HUMAN	F	738	ENSP00000310338:L738F	.	L	+	3	2	C12orf35	32027370	0.096000	0.21769	0.000000	0.03702	0.001000	0.01503	0.848000	0.27710	-0.323000	0.08602	-2.684000	0.00141	TTG	.		0.388	KIAA1551-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250307.2	NM_018169	
ANO6	196527	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	45833607	45833607	+	Silent	SNP	C	C	G			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr12:45833607C>G	ENST00000425752.2	+	20	2978	c.2676C>G	c.(2674-2676)ctC>ctG	p.L892L	ANO6_ENST00000435642.1_Silent_p.L892L	NM_001142679.1	NP_001136151.1	Q4KMQ2	ANO6_HUMAN	anoctamin 6	0					activation of blood coagulation via clotting cascade (GO:0002543)|blood coagulation (GO:0007596)|bone mineralization involved in bone maturation (GO:0035630)|calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|calcium activated phosphatidylserine scrambling (GO:0061589)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|dendritic cell chemotaxis (GO:0002407)|ion transmembrane transport (GO:0034220)|phosphatidylserine exposure on blood platelet (GO:0097045)|phospholipid scrambling (GO:0017121)|positive regulation of endothelial cell apoptotic process (GO:2000353)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)	cell surface (GO:0009986)|chloride channel complex (GO:0034707)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|intracellular calcium activated chloride channel activity (GO:0005229)|phospholipid scramblase activity (GO:0017128)|voltage-gated chloride channel activity (GO:0005247)|voltage-gated ion channel activity (GO:0005244)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(23)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	46						ttgactccctctattatatat	0.353																																					p.L892L		.											.	ANO6-516	0			c.C2676G						.						114.0	93.0	99.0					12																	45833607		692	1591	2283	SO:0001819	synonymous_variant	196527	exon20			CTCCCTCTATTAT	AL832340	CCDS31782.1, CCDS44865.1, CCDS44866.1, CCDS55819.1	12q12-q13.11	2014-09-17	2008-08-28	2008-08-28				"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	25240	protein-coding gene	gene with protein product		608663	"""transmembrane protein 16F"""	TMEM16F		15067359, 24692353	Standard	NM_001025356		Approved	DKFZp313M0720	uc010slf.2	Q4KMQ2	OTTHUMG00000169564	ENST00000425752.2:c.2676C>G	12.37:g.45833607C>G		Somatic	29	0		WXS	Illumina GAIIx	Phase_I	56	5	NM_001142679	0	0	0	0	0	A6NNM6|B9EGG0|E7ENK4|E9PB30|E9PCT2|Q8N3Q2	Silent	SNP	ENST00000425752.2	37	CCDS44865.1																																																																																			.		0.353	ANO6-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000404819.1	XM_113743	
KMT2D	8085	hgsc.bcm.edu;broad.mit.edu	37	12	49445206	49445206	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr12:49445206G>C	ENST00000301067.7	-	10	2259	c.2260C>G	c.(2260-2262)Ccc>Gcc	p.P754A		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	754	Pro-rich.			Missing (in Ref. 1; AAC51734). {ECO:0000305}.	chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										TCAGGCCGGGGGGACAGGTGC	0.692																																					p.P754A		.											.	MLL2-612	0			c.C2260G						.						21.0	24.0	23.0					12																	49445206		1760	3797	5557	SO:0001583	missense	8085	exon10			GCCGGGGGGACAG	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.2260C>G	12.37:g.49445206G>C	ENSP00000301067:p.Pro754Ala	Somatic	10	0		WXS	Illumina GAIIx	Phase_I	46	12	NM_003482	0	0	0	0	0	O14687	Missense_Mutation	SNP	ENST00000301067.7	37	CCDS44873.1	.	.	.	.	.	.	.	.	.	.	G	14.93	2.681895	0.47991	.	.	ENSG00000167548	ENST00000301067	T	0.38077	1.16	3.68	2.77	0.32553	.	.	.	.	.	T	0.26011	0.0634	N	0.24115	0.695	0.24821	N	0.992589	B	0.29531	0.247	B	0.31191	0.125	T	0.24835	-1.0149	9	0.87932	D	0	.	9.8739	0.41191	0.1057:0.0:0.8942:0.0	.	754	O14686	MLL2_HUMAN	A	754	ENSP00000301067:P754A	ENSP00000301067:P754A	P	-	1	0	MLL2	47731473	0.190000	0.23276	0.008000	0.14137	0.167000	0.22549	0.513000	0.22770	1.109000	0.41680	0.563000	0.77884	CCC	.		0.692	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
AQP2	359	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	50344855	50344855	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr12:50344855T>A	ENST00000199280.3	+	1	327	c.242T>A	c.(241-243)gTc>gAc	p.V81D	RP11-469H8.6_ENST00000552379.1_RNA|RP11-469H8.6_ENST00000550530.1_RNA	NM_000486.5	NP_000477.1	P41181	AQP2_HUMAN	aquaporin 2 (collecting duct)	81					actin filament depolymerization (GO:0030042)|aging (GO:0007568)|apoptotic process (GO:0006915)|cell volume homeostasis (GO:0006884)|cellular response to copper ion (GO:0071280)|cellular response to mercury ion (GO:0071288)|cellular response to water deprivation (GO:0042631)|excretion (GO:0007588)|female pregnancy (GO:0007565)|glycerol transport (GO:0015793)|hyperosmotic response (GO:0006972)|metanephric collecting duct development (GO:0072205)|positive regulation of calcium ion transport (GO:0051928)|renal water transport (GO:0003097)|response to calcium ion (GO:0051592)|response to glucagon (GO:0033762)|response to lipopolysaccharide (GO:0032496)|response to lithium ion (GO:0010226)|response to salt stress (GO:0009651)|response to starvation (GO:0042594)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|clathrin-coated vesicle (GO:0030136)|early endosome (GO:0005769)|exocytic vesicle (GO:0070382)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|recycling endosome (GO:0055037)|rough endoplasmic reticulum (GO:0005791)|trans-Golgi network (GO:0005802)|transport vesicle membrane (GO:0030658)	glycerol transmembrane transporter activity (GO:0015168)|water channel activity (GO:0015250)|water transmembrane transporter activity (GO:0005372)			breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(1)|lung(4)|ovary(2)	10						GGCTGCCACGTCTCCGTTCTC	0.662																																					p.V81D		.											.	AQP2-92	0			c.T242A						.						33.0	32.0	32.0					12																	50344855		2203	4300	6503	SO:0001583	missense	359	exon1			GCCACGTCTCCGT		CCDS8792.1	12q12-q13	2014-09-17				ENSG00000167580		"""Ion channels / Aquaporins"""	634	protein-coding gene	gene with protein product		107777				7512890	Standard	NM_000486		Approved		uc001rvn.3	P41181		ENST00000199280.3:c.242T>A	12.37:g.50344855T>A	ENSP00000199280:p.Val81Asp	Somatic	40	0		WXS	Illumina GAIIx	Phase_I	131	37	NM_000486	0	0	0	0	0	Q9UD68	Missense_Mutation	SNP	ENST00000199280.3	37	CCDS8792.1	.	.	.	.	.	.	.	.	.	.	T	19.09	3.760747	0.69763	.	.	ENSG00000167580	ENST00000199280;ENST00000550862	D;D	0.87103	-2.21;-2.21	4.46	4.46	0.54185	Aquaporin-like (2);	0.121611	0.35378	N	0.003246	D	0.92120	0.7502	M	0.87180	2.865	0.53688	D	0.99997	D	0.56746	0.977	P	0.56398	0.797	D	0.93231	0.6617	10	0.87932	D	0	-37.5479	12.0247	0.53362	0.0:0.0:0.0:1.0	.	81	P41181	AQP2_HUMAN	D	81	ENSP00000199280:V81D;ENSP00000450022:V81D	ENSP00000199280:V81D	V	+	2	0	AQP2	48631122	1.000000	0.71417	0.830000	0.32933	0.875000	0.50365	8.040000	0.89188	1.796000	0.52611	0.533000	0.62120	GTC	.		0.662	AQP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405540.1	NM_000486	
CNPY2	10330	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	56705180	56705180	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr12:56705180C>G	ENST00000273308.4	-	4	763	c.223G>C	c.(223-225)Gag>Cag	p.E75Q	CNPY2_ENST00000551720.1_Splice_Site|RP11-977G19.10_ENST00000549318.1_Missense_Mutation_p.E75Q|RP11-977G19.11_ENST00000549565.1_RNA|RP11-977G19.12_ENST00000546789.1_RNA|RP11-977G19.11_ENST00000549860.1_RNA	NM_014255.5	NP_055070.1	Q9Y2B0	CNPY2_HUMAN	canopy FGF signaling regulator 2	75	Saposin B-type. {ECO:0000255|PROSITE- ProRule:PRU00415}.				negative regulation of gene expression (GO:0010629)|positive regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045716)|regulation of low-density lipoprotein particle clearance (GO:0010988)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)				large_intestine(2)|lung(2)	4						AGGTGGGCCTCTGAGCGGGCA	0.473																																					p.E75Q		.											.	CNPY2-68	0			c.G223C						.						118.0	116.0	116.0					12																	56705180		2203	4300	6503	SO:0001583	missense	10330	exon4			GGGCCTCTGAGCG	AB015631	CCDS8914.1	12q15	2013-07-23	2013-07-23	2007-10-22		ENSG00000257727			13529	protein-coding gene	gene with protein product		605861	"""transmembrane protein 4"", ""canopy 2 homolog (zebrafish)"""	TMEM4		10072769, 15905959	Standard	NM_001190991		Approved	HP10390, ZSIG9, Cnpy2	uc001sku.2	Q9Y2B0	OTTHUMG00000170330	ENST00000273308.4:c.223G>C	12.37:g.56705180C>G	ENSP00000273308:p.Glu75Gln	Somatic	85	0		WXS	Illumina GAIIx	Phase_I	89	26	NM_014255	0	0	0	0	0	B2R7B9|Q9UHE9	Missense_Mutation	SNP	ENST00000273308.4	37	CCDS8914.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.040270	0.75732	.	.	ENSG00000144785;ENSG00000257727;ENSG00000257727;ENSG00000257727	ENST00000549318;ENST00000273308;ENST00000551475;ENST00000551286	T;T;T;T	0.58358	0.34;0.34;0.34;0.34	5.38	5.38	0.77491	Saposin B (1);	0.000000	0.85682	D	0.000000	T	0.71367	0.3331	M	0.64567	1.98	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.73366	-0.4005	10	0.87932	D	0	-15.5197	18.277	0.90087	0.0:1.0:0.0:0.0	.	75	Q9Y2B0	CNPY2_HUMAN	Q	75;75;75;23	ENSP00000446743:E75Q;ENSP00000273308:E75Q;ENSP00000448809:E75Q;ENSP00000446784:E23Q	ENSP00000273308:E75Q	E	-	1	0	RP11-977G19.10;CNPY2	54991447	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.667000	0.83888	2.695000	0.91970	0.561000	0.74099	GAG	.		0.473	CNPY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408546.1	NM_014255	
NAB2	4665	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	57486328	57486329	+	Frame_Shift_Del	DEL	GA	GA	-			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	GA	GA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr12:57486328_57486329delGA	ENST00000300131.3	+	3	1433_1434	c.1055_1056delGA	c.(1054-1056)cgafs	p.R352fs	NAB2_ENST00000342556.6_Frame_Shift_Del_p.R352fs|NAB2_ENST00000357680.4_Intron	NM_005967.3	NP_005958.1	Q15742	NAB2_HUMAN	NGFI-A binding protein 2 (EGR1 binding protein 2)	352	NCD2.				cell proliferation (GO:0008283)|endochondral ossification (GO:0001958)|myelination (GO:0042552)|negative regulation of transcription from RNA polymerase III promoter (GO:0016480)|nervous system development (GO:0007399)|regulation of epidermis development (GO:0045682)|Schwann cell differentiation (GO:0014037)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	20						CAAGTAGCCCGAGAGAGCACCT	0.55																																					p.352_352del		.											.	NAB2-92	0			c.1055_1056del						.																																			SO:0001589	frameshift_variant	4665	exon3			TAGCCCGAGAGAG	BC065931	CCDS8930.1	12q13.3	2008-05-14				ENSG00000166886			7627	protein-coding gene	gene with protein product		602381				8668170, 8649813	Standard	XM_005268894		Approved	MADER	uc001smz.3	Q15742		ENST00000300131.3:c.1055_1056delGA	12.37:g.57486332_57486333delGA	ENSP00000300131:p.Arg352fs	Somatic	168	0		WXS	Illumina GAIIx	Phase_I	189	52	NM_005967	0	0	0	0	0	B2RAK3|O76006|Q14797	Frame_Shift_Del	DEL	ENST00000300131.3	37	CCDS8930.1																																																																																			.		0.550	NAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412222.1	NM_005967	
LRP1	4035	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	57577207	57577207	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr12:57577207G>T	ENST00000243077.3	+	35	6174	c.5708G>T	c.(5707-5709)gGa>gTa	p.G1903V		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	1903					aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	GGAATCAGGGGAATTCCCCTG	0.542											OREG0021938	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G1903V		.											.	LRP1-596	0			c.G5708T						.						127.0	118.0	121.0					12																	57577207		2203	4300	6503	SO:0001583	missense	4035	exon35			TCAGGGGAATTCC	X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.5708G>T	12.37:g.57577207G>T	ENSP00000243077:p.Gly1903Val	Somatic	135	0	1024	WXS	Illumina GAIIx	Phase_I	139	26	NM_002332	0	0	0	0	0	Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	ENST00000243077.3	37	CCDS8932.1	.	.	.	.	.	.	.	.	.	.	G	17.30	3.355536	0.61293	.	.	ENSG00000123384	ENST00000243077	T	0.70631	-0.5	4.68	4.68	0.58851	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.64402	D	0.000002	D	0.82806	0.5117	M	0.74258	2.255	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.81111	-0.1081	10	0.29301	T	0.29	.	16.5142	0.84295	0.0:0.0:1.0:0.0	.	1903	Q07954	LRP1_HUMAN	V	1903	ENSP00000243077:G1903V	ENSP00000243077:G1903V	G	+	2	0	LRP1	55863474	1.000000	0.71417	1.000000	0.80357	0.701000	0.40568	9.657000	0.98554	2.430000	0.82344	0.561000	0.74099	GGA	.		0.542	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2	NM_002332	
OTOGL	283310	broad.mit.edu;bcgsc.ca	37	12	80717566	80717566	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr12:80717566C>G	ENST00000547103.1	+	34	4124	c.4118C>G	c.(4117-4119)cCc>cGc	p.P1373R	OTOGL_ENST00000458043.2_Missense_Mutation_p.P1373R			Q3ZCN5	OTOGL_HUMAN	otogelin-like	1373					L-arabinose metabolic process (GO:0046373)	extracellular region (GO:0005576)	alpha-L-arabinofuranosidase activity (GO:0046556)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(14)|prostate(1)	23						TGTGCTACACCCTGTTTTAAA	0.388																																					p.P1373R		.											.	.	0			c.C4118G						.						122.0	122.0	122.0					12																	80717566		1893	4118	6011	SO:0001583	missense	283310	exon34			CTACACCCTGTTT	AK096852		12q21.31	2011-02-11	2011-02-11	2011-02-11	ENSG00000165899	ENSG00000165899			26901	protein-coding gene	gene with protein product		614925	"""chromosome 12 open reading frame 64"""	C12orf64			Standard	NM_173591		Approved	FLJ90579	uc001szd.3	Q3ZCN5	OTTHUMG00000150509	ENST00000547103.1:c.4118C>G	12.37:g.80717566C>G	ENSP00000447211:p.Pro1373Arg	Somatic	164	0		WXS	Illumina GAIIx	Phase_I	301	9	NM_173591	0	0	0	0	0	F8W0C3|Q495U8|Q8N8G5|Q8NC28	Missense_Mutation	SNP	ENST00000547103.1	37		.	.	.	.	.	.	.	.	.	.	C	20.7	4.030376	0.75504	.	.	ENSG00000165899	ENST00000547103;ENST00000458043	T;T	0.54866	0.55;0.55	5.55	5.55	0.83447	.	.	.	.	.	T	0.71854	0.3389	M	0.75085	2.285	0.80722	D	1	.	.	.	.	.	.	T	0.74765	-0.3554	7	0.87932	D	0	.	19.4782	0.94998	0.0:1.0:0.0:0.0	.	.	.	.	R	1373	ENSP00000447211:P1373R;ENSP00000400895:P1373R	ENSP00000400895:P1373R	P	+	2	0	OTOGL	79241697	1.000000	0.71417	1.000000	0.80357	0.658000	0.38924	7.184000	0.77705	2.610000	0.88304	0.591000	0.81541	CCC	.		0.388	OTOGL-001	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000407438.1	NM_173591	
SLC6A15	55117	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	85257275	85257275	+	Silent	SNP	A	A	T			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr12:85257275A>T	ENST00000266682.5	-	11	2302	c.1761T>A	c.(1759-1761)gcT>gcA	p.A587A	SLC6A15_ENST00000309283.7_Silent_p.A295A|SLC6A15_ENST00000552192.1_Silent_p.A480A	NM_182767.5	NP_877499.1	Q9H2J7	S6A15_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 15	587					amino acid transport (GO:0006865)|ion transport (GO:0006811)|leucine transport (GO:0015820)|neurotransmitter transport (GO:0006836)|neutral amino acid transport (GO:0015804)|proline transport (GO:0015824)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter transporter activity (GO:0005326)|neurotransmitter:sodium symporter activity (GO:0005328)|proline:sodium symporter activity (GO:0005298)			kidney(1)|large_intestine(18)|lung(15)|ovary(1)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	44						TCACAACACTAGCTATTAGCA	0.328																																					p.A587A		.											.	SLC6A15-93	0			c.T1761A						.						86.0	92.0	90.0					12																	85257275		2203	4297	6500	SO:0001819	synonymous_variant	55117	exon11			AACACTAGCTATT	AF265577	CCDS9026.1, CCDS9027.1, CCDS53816.1	12q21.31	2013-07-15	2008-09-02		ENSG00000072041	ENSG00000072041		"""Solute carriers"""	13621	protein-coding gene	gene with protein product	"""homolog of rat orphan transporter v7-3"", ""sodium/chloride dependent neurotransmitter transporter Homo sapiens orphan neurotransmitter transporter NTT7"""	607971	"""solute carrier family 6 (neurotransmitter transporter), member 15"""			10471414, 11112352, 16185194	Standard	NM_182767		Approved	hv7-3, NTT73, FLJ10316, V7-3, SBAT1	uc001szv.4	Q9H2J7	OTTHUMG00000169742	ENST00000266682.5:c.1761T>A	12.37:g.85257275A>T		Somatic	191	0		WXS	Illumina GAIIx	Phase_I	328	153	NM_182767	0	0	0	0	0	A8K592|B7Z2P7|E7ESJ5|Q9H9F5	Silent	SNP	ENST00000266682.5	37	CCDS9026.1																																																																																			.		0.328	SLC6A15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405678.1	NM_018057, NM_182767	
EEA1	8411	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	93202827	93202827	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr12:93202827C>T	ENST00000322349.8	-	18	2569	c.2305G>A	c.(2305-2307)Gaa>Aaa	p.E769K		NM_003566.3	NP_003557	Q15075	EEA1_HUMAN	early endosome antigen 1	769					early endosome to late endosome transport (GO:0045022)|endocytosis (GO:0006897)|synaptic vesicle to endosome fusion (GO:0016189)|vesicle fusion (GO:0006906)	axonal spine (GO:0044308)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|membrane (GO:0016020)|recycling endosome (GO:0055037)|serine-pyruvate aminotransferase complex (GO:0005969)	1-phosphatidylinositol binding (GO:0005545)|calmodulin binding (GO:0005516)|GTP-dependent protein binding (GO:0030742)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(5)|large_intestine(11)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	36						TTACTCAATTCTGTGGCTCTG	0.363																																					p.E769K		.											.	EEA1-229	0			c.G2305A						.						136.0	120.0	125.0					12																	93202827		2203	4299	6502	SO:0001583	missense	8411	exon18			TCAATTCTGTGGC	L40157	CCDS31874.1	12q22	2007-02-23	2007-02-23			ENSG00000102189		"""Zinc fingers, FYVE domain containing"""	3185	protein-coding gene	gene with protein product		605070	"""early endosome antigen 1, 162kD"""			7768953, 9697774	Standard	NM_003566		Approved	ZFYVE2	uc001tck.3	Q15075	OTTHUMG00000170110	ENST00000322349.8:c.2305G>A	12.37:g.93202827C>T	ENSP00000317955:p.Glu769Lys	Somatic	65	1		WXS	Illumina GAIIx	Phase_I	62	17	NM_003566	0	0	0	0	0	Q14221	Missense_Mutation	SNP	ENST00000322349.8	37	CCDS31874.1	.	.	.	.	.	.	.	.	.	.	C	19.38	3.816034	0.70912	.	.	ENSG00000102189	ENST00000322349	D	0.84070	-1.8	5.84	5.84	0.93424	.	0.000000	0.51477	D	0.000096	T	0.76969	0.4062	L	0.36672	1.1	0.80722	D	1	P	0.39665	0.682	B	0.35182	0.197	T	0.74315	-0.3705	10	0.24483	T	0.36	.	20.1344	0.98019	0.0:1.0:0.0:0.0	.	769	Q15075	EEA1_HUMAN	K	769	ENSP00000317955:E769K	ENSP00000317955:E769K	E	-	1	0	EEA1	91726958	1.000000	0.71417	0.925000	0.36789	0.512000	0.34134	5.999000	0.70665	2.761000	0.94854	0.655000	0.94253	GAA	.		0.363	EEA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407304.1	NM_003566	
AMDHD1	144193	hgsc.bcm.edu	37	12	96337225	96337225	+	Silent	SNP	C	C	T	rs1436121	byFrequency	TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr12:96337225C>T	ENST00000266736.2	+	1	155	c.49C>T	c.(49-51)Ctg>Ttg	p.L17L	CCDC38_ENST00000549752.1_5'Flank|CCDC38_ENST00000546386.1_5'Flank|CCDC38_ENST00000344280.3_5'Flank	NM_152435.2	NP_689648.2	Q96NU7	HUTI_HUMAN	amidohydrolase domain containing 1	17					cellular nitrogen compound metabolic process (GO:0034641)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	imidazolonepropionase activity (GO:0050480)|metal ion binding (GO:0046872)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|skin(1)	22						GCAAGTGGTGCTGGTGTGCGC	0.741													C|||	1276	0.254792	0.09	0.1297	5008	,	,		11076	0.4732		0.2445	False		,,,				2504	0.3517				p.L17L		.											.	AMDHD1-90	0			c.C49T						.	C		259,2703		9,241,1231	3.0	4.0	4.0		49	1.4	1.0	12	dbSNP_88	4	983,4553		75,833,1860	no	coding-synonymous	AMDHD1	NM_152435.2		84,1074,3091	TT,TC,CC		17.7565,8.7441,14.6152		17/427	96337225	1242,7256	1481	2768	4249	SO:0001819	synonymous_variant	144193	exon1			GTGGTGCTGGTGT	AB075878	CCDS9057.1	12q23.1	2006-02-02				ENSG00000139344			28577	protein-coding gene	gene with protein product							Standard	NM_152435		Approved	MGC35366	uc001tel.2	Q96NU7	OTTHUMG00000170353	ENST00000266736.2:c.49C>T	12.37:g.96337225C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_152435	0	0	0	0	0	A8K463|Q68CI8	Silent	SNP	ENST00000266736.2	37	CCDS9057.1																																																																																			C|0.752;T|0.248		0.741	AMDHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408640.1	NM_152435	
GPR133	283383	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	131593280	131593280	+	Missense_Mutation	SNP	A	A	T			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr12:131593280A>T	ENST00000261654.5	+	18	2458	c.1899A>T	c.(1897-1899)caA>caT	p.Q633H	GPR133_ENST00000543617.1_Missense_Mutation_p.Q152H|GPR133_ENST00000376682.4_Missense_Mutation_p.Q319H|GPR133_ENST00000535015.1_Missense_Mutation_p.Q665H	NM_198827.3	NP_942122.2	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133	633					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(2)|endometrium(6)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|pancreas(6)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	67	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		CCCCCTGCCAAGTGATGGCCG	0.572																																					p.Q633H		.											.	GPR133-191	0			c.A1899T						.						216.0	201.0	206.0					12																	131593280		2203	4300	6503	SO:0001583	missense	283383	exon18			CTGCCAAGTGATG	AY278561	CCDS9272.1	12q24.33	2014-08-08			ENSG00000111452	ENSG00000111452		"""-"", ""GPCR / Class B : Orphans"""	19893	protein-coding gene	gene with protein product		613639					Standard	NM_198827		Approved	DKFZp434B1272, PGR25	uc001uit.4	Q6QNK2	OTTHUMG00000168339	ENST00000261654.5:c.1899A>T	12.37:g.131593280A>T	ENSP00000261654:p.Gln633His	Somatic	121	0		WXS	Illumina GAIIx	Phase_I	85	68	NM_198827	0	0	0	0	0	B2CKK9|B7ZLF7|Q2M1L3|Q6ZMQ1|Q7Z7M2|Q86SM4	Missense_Mutation	SNP	ENST00000261654.5	37	CCDS9272.1	.	.	.	.	.	.	.	.	.	.	G	11.87	1.766747	0.31320	.	.	ENSG00000111452	ENST00000261654;ENST00000535015;ENST00000376682;ENST00000543617	T;T;T;T	0.44881	0.91;0.91;0.91;0.91	4.82	0.605	0.17553	GPCR, family 2-like (1);	0.255887	0.36066	N	0.002815	T	0.41994	0.1183	L	0.45352	1.415	0.27590	N	0.9493	B;B;P	0.38370	0.089;0.127;0.628	B;B;P	0.50314	0.389;0.357;0.637	T	0.33548	-0.9864	10	0.56958	D	0.05	.	6.1768	0.20449	0.2141:0.2521:0.5338:0.0	.	665;152;633	B7ZLF7;Q6QNK2-3;Q6QNK2	.;.;GP133_HUMAN	H	633;665;319;152	ENSP00000261654:Q633H;ENSP00000444425:Q665H;ENSP00000365872:Q319H;ENSP00000438021:Q152H	ENSP00000261654:Q633H	Q	+	3	2	GPR133	130159233	1.000000	0.71417	0.349000	0.25694	0.072000	0.16883	1.378000	0.34328	0.068000	0.16574	-0.186000	0.12905	CAA	.		0.572	GPR133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399356.1	NM_198827	
SUPT16H	11198	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	21840079	21840079	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr14:21840079T>C	ENST00000216297.2	-	3	622	c.284A>G	c.(283-285)gAg>gGg	p.E95G		NM_007192.3	NP_009123.1	Q9Y5B9	SP16H_HUMAN	suppressor of Ty 16 homolog (S. cerevisiae)	95					DNA repair (GO:0006281)|DNA replication (GO:0006260)|gene expression (GO:0010467)|nucleosome disassembly (GO:0006337)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27	all_cancers(95;0.00115)		Epithelial(56;1.62e-06)|all cancers(55;1.49e-05)	GBM - Glioblastoma multiforme(265;0.0159)		ATTAGCATTCTCATTGCCCTT	0.388																																					p.E95G		.											.	SUPT16H-90	0			c.A284G						.						150.0	127.0	135.0					14																	21840079		2203	4300	6503	SO:0001583	missense	11198	exon3			GCATTCTCATTGC	AF152961	CCDS9569.1	14q11.1	2008-08-13	2001-11-28		ENSG00000092201	ENSG00000092201			11465	protein-coding gene	gene with protein product	"""facilitates chromatin remodeling 140 kDa subunit"""	605012	"""suppressor of Ty (S.cerevisiae) 16 homolog"""			9489704, 11239457	Standard	NM_007192		Approved	FACT, FACTP140, SPT16/CDC68, FLJ14010, FLJ10857, CDC68	uc001wao.2	Q9Y5B9	OTTHUMG00000029685	ENST00000216297.2:c.284A>G	14.37:g.21840079T>C	ENSP00000216297:p.Glu95Gly	Somatic	122	0		WXS	Illumina GAIIx	Phase_I	110	39	NM_007192	0	0	0	0	0	Q6GMT8|Q6P2F1|Q6PJM1|Q9NRX0	Missense_Mutation	SNP	ENST00000216297.2	37	CCDS9569.1	.	.	.	.	.	.	.	.	.	.	T	32	5.133448	0.94517	.	.	ENSG00000092201	ENST00000216297;ENST00000538230	.	.	.	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.58264	0.2110	M	0.63428	1.95	0.80722	D	1	P	0.51351	0.944	B	0.43680	0.427	T	0.60627	-0.7226	9	0.38643	T	0.18	-23.588	15.1087	0.72338	0.0:0.0:0.0:1.0	.	95	Q9Y5B9	SP16H_HUMAN	G	95	.	ENSP00000216297:E95G	E	-	2	0	SUPT16H	20909919	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.414000	0.80117	2.273000	0.75805	0.482000	0.46254	GAG	.		0.388	SUPT16H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000074025.2		
LRRC16B	90668	broad.mit.edu;bcgsc.ca	37	14	24524508	24524508	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr14:24524508C>A	ENST00000342740.5	+	8	748	c.594C>A	c.(592-594)caC>caA	p.H198Q	LRRC16B_ENST00000334420.7_De_novo_Start_InFrame	NM_138360.3	NP_612369.3	Q8ND23	LR16B_HUMAN	leucine rich repeat containing 16B	198						cytoplasm (GO:0005737)				breast(3)|central_nervous_system(2)|cervix(3)|endometrium(7)|kidney(1)|large_intestine(9)|liver(1)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	52				GBM - Glioblastoma multiforme(265;0.019)		ATTTCAGCCACTTGGAGAGCC	0.552																																					p.H198Q		.											.	LRRC16B-139	0			c.C594A						.						119.0	121.0	120.0					14																	24524508		2203	4300	6503	SO:0001583	missense	90668	exon8			CAGCCACTTGGAG	AI017934	CCDS32054.1	14q11.2-q12	2010-09-10	2008-02-12	2008-02-12					20272	protein-coding gene	gene with protein product		614716	"""chromosome 14 open reading frame 121"""	C14orf121		19846667	Standard	NM_138360		Approved	BC008134, crml-1, CARMIL3	uc001wlj.2	Q8ND23		ENST00000342740.5:c.594C>A	14.37:g.24524508C>A	ENSP00000340467:p.His198Gln	Somatic	149	0		WXS	Illumina GAIIx	Phase_I	193	9	NM_138360	0	0	0	0	0	Q8TEF7|Q96HS9	Missense_Mutation	SNP	ENST00000342740.5	37	CCDS32054.1	.	.	.	.	.	.	.	.	.	.	C	13.36	2.214244	0.39102	.	.	ENSG00000186648	ENST00000342740	T	0.18810	2.19	4.64	4.64	0.57946	.	0.000000	0.85682	D	0.000000	T	0.43100	0.1232	M	0.74881	2.28	0.80722	D	1	D	0.65815	0.995	D	0.70487	0.969	T	0.18085	-1.0348	10	0.30078	T	0.28	-4.9421	12.873	0.57975	0.0:1.0:0.0:0.0	.	198	Q8ND23	LR16B_HUMAN	Q	198	ENSP00000340467:H198Q	ENSP00000340467:H198Q	H	+	3	2	LRRC16B	23594348	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	4.306000	0.59117	2.405000	0.81733	0.313000	0.20887	CAC	.		0.552	LRRC16B-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416527.1	NM_138360	
CPNE6	9362	broad.mit.edu	37	14	24545620	24545620	+	Silent	SNP	C	C	T	rs139035718		TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr14:24545620C>T	ENST00000397016.2	+	13	1421	c.1110C>T	c.(1108-1110)ttC>ttT	p.F370F	CPNE6_ENST00000216775.2_Silent_p.F370F|CPNE6_ENST00000537691.1_Silent_p.F425F	NM_001280558.1	NP_001267487.1	O95741	CPNE6_HUMAN	copine VI (neuronal)	370	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				lipid metabolic process (GO:0006629)|nervous system development (GO:0007399)|synaptic transmission (GO:0007268)|vesicle-mediated transport (GO:0016192)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			endometrium(4)|large_intestine(3)|liver(2)|lung(5)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	22				GBM - Glioblastoma multiforme(265;0.0184)		CCCCCAACTTCGAGGTAGGCT	0.597																																					p.F370F		.											.	CPNE6-93	0			c.C1110T						.	C		1,4405	2.1+/-5.4	0,1,2202	110.0	118.0	115.0		1110	-4.4	1.0	14	dbSNP_134	115	0,8600		0,0,4300	no	coding-synonymous	CPNE6	NM_006032.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		370/558	24545620	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	9362	exon12			CAACTTCGAGGTA	AB009288	CCDS9607.1, CCDS61413.1	14q11.2	2008-07-09			ENSG00000100884	ENSG00000100884			2319	protein-coding gene	gene with protein product		605688				9645480	Standard	NM_001280558		Approved		uc001wll.3	O95741	OTTHUMG00000028781	ENST00000397016.2:c.1110C>T	14.37:g.24545620C>T		Somatic	88	0		WXS	Illumina GAIIx	Phase_I	106	4	NM_006032	0	0	0	0	0	B2RAG6|B7Z1M3|D3DS55|F5GXN1|Q53HA6|Q8WVG1	Silent	SNP	ENST00000397016.2	37	CCDS9607.1																																																																																			C|1.000;T|0.000		0.597	CPNE6-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071869.5		
AKAP6	9472	broad.mit.edu	37	14	33004880	33004880	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr14:33004880C>A	ENST00000280979.4	+	3	615	c.445C>A	c.(445-447)Ctc>Atc	p.L149I	AKAP6_ENST00000557354.1_Missense_Mutation_p.L149I|AKAP6_ENST00000557272.1_Missense_Mutation_p.L149I	NM_004274.4	NP_004265.3	Q13023	AKAP6_HUMAN	A kinase (PRKA) anchor protein 6	149					action potential (GO:0001508)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cAMP biosynthetic process (GO:0030818)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell growth (GO:0030307)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of delayed rectifier potassium channel activity (GO:1902261)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of potassium ion transmembrane transport (GO:1901381)|positive regulation of protein phosphatase type 2B activity (GO:0032514)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|protein targeting (GO:0006605)|regulation of membrane repolarization (GO:0060306)|regulation of protein kinase A signaling (GO:0010738)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	calcium channel complex (GO:0034704)|caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|junctional sarcoplasmic reticulum membrane (GO:0014701)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	adenylate cyclase binding (GO:0008179)|ion channel binding (GO:0044325)|protein anchor (GO:0043495)|protein complex scaffold (GO:0032947)|protein kinase A binding (GO:0051018)|protein kinase A regulatory subunit binding (GO:0034237)			NS(2)|breast(10)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(25)|lung(42)|ovary(5)|pancreas(2)|prostate(3)|skin(9)|urinary_tract(2)	122	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		CGCAGTGCAGCTCCTCTGGCA	0.532																																					p.L149I	Melanoma(49;821 1200 7288 13647 42351)	.											.	AKAP6-733	0			c.C445A						.						122.0	102.0	109.0					14																	33004880		2203	4300	6503	SO:0001583	missense	9472	exon3			GTGCAGCTCCTCT	AB002309	CCDS9644.1	14q12	2008-08-11			ENSG00000151320	ENSG00000151320		"""A-kinase anchor proteins"""	376	protein-coding gene	gene with protein product	"""protein kinase A anchoring protein 6"""	604691				7721854, 9205841	Standard	NM_004274		Approved	KIAA0311, mAKAP, AKAP100, PRKA6, ADAP6	uc001wrq.3	Q13023	OTTHUMG00000140207	ENST00000280979.4:c.445C>A	14.37:g.33004880C>A	ENSP00000280979:p.Leu149Ile	Somatic	107	1		WXS	Illumina GAIIx	Phase_I	210	8	NM_004274	0	0	0	0	0	A7E242|A7E2D4|O15028	Missense_Mutation	SNP	ENST00000280979.4	37	CCDS9644.1	.	.	.	.	.	.	.	.	.	.	C	29.0	4.964725	0.92791	.	.	ENSG00000151320	ENST00000280979;ENST00000557354;ENST00000557272	T;T;T	0.37058	2.48;1.24;1.22	5.8	4.89	0.63831	.	0.090014	0.48286	N	0.000200	T	0.59101	0.2169	M	0.66939	2.045	0.50632	D	0.99988	D;D	0.69078	0.997;0.997	D;D	0.78314	0.991;0.991	T	0.64097	-0.6487	10	0.87932	D	0	-3.4668	16.0172	0.80450	0.1356:0.8644:0.0:0.0	.	149;149	A7E242;Q13023	.;AKAP6_HUMAN	I	149	ENSP00000280979:L149I;ENSP00000450531:L149I;ENSP00000451247:L149I	ENSP00000280979:L149I	L	+	1	0	AKAP6	32074631	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.755000	0.62198	1.407000	0.46875	0.591000	0.81541	CTC	.		0.532	AKAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276617.2	NM_004274	
MIPOL1	145282	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	37736243	37736243	+	Silent	SNP	G	G	T			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr14:37736243G>T	ENST00000327441.7	+	5	586	c.120G>T	c.(118-120)cgG>cgT	p.R40R	MIPOL1_ENST00000396294.2_Silent_p.R40R|MIPOL1_ENST00000537471.1_Silent_p.R40R|MIPOL1_ENST00000556451.1_Silent_p.R9R|MIPOL1_ENST00000545536.1_Silent_p.R9R|MIPOL1_ENST00000539062.2_Silent_p.R9R|MIPOL1_ENST00000536774.1_Intron	NM_001195296.1|NM_001195297.1|NM_138731.6	NP_001182225.1|NP_001182226.1|NP_620059.1	Q8TD10	MIPO1_HUMAN	mirror-image polydactyly 1	40						nucleus (GO:0005634)				breast(2)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	23	Breast(36;0.119)|Esophageal squamous(585;0.164)|Hepatocellular(127;0.213)		Lung(238;6.03e-07)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.047)|all cancers(34;0.0953)|LUSC - Lung squamous cell carcinoma(13;0.0975)|BRCA - Breast invasive adenocarcinoma(188;0.196)	GBM - Glioblastoma multiforme(112;0.0358)		GTATGCATCGGAAATCCACTG	0.383																																					p.R40R		.											.	MIPOL1-91	0			c.G120T						.						104.0	100.0	101.0					14																	37736243		2203	4300	6503	SO:0001819	synonymous_variant	145282	exon6			GCATCGGAAATCC	AY059470	CCDS9664.1	14q13.3	2010-05-25			ENSG00000151338	ENSG00000151338			21460	protein-coding gene	gene with protein product		606850				11954550, 19667180	Standard	NM_001195296		Approved		uc001wuc.3	Q8TD10	OTTHUMG00000140252	ENST00000327441.7:c.120G>T	14.37:g.37736243G>T		Somatic	178	0		WXS	Illumina GAIIx	Phase_I	208	68	NM_001195296	0	0	0	0	0	D3DSA4|Q7Z3J0|Q8IV14	Silent	SNP	ENST00000327441.7	37	CCDS9664.1																																																																																			.		0.383	MIPOL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276734.1	NM_138731	
FRMD6	122786	broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	52187025	52187025	+	Nonsense_Mutation	SNP	C	C	G			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr14:52187025C>G	ENST00000344768.5	+	11	1473	c.1277C>G	c.(1276-1278)tCa>tGa	p.S426*	FRMD6_ENST00000356218.4_Nonsense_Mutation_p.S418*|FRMD6_ENST00000553556.1_Nonsense_Mutation_p.S68*|FRMD6_ENST00000554167.1_Nonsense_Mutation_p.S349*|FRMD6_ENST00000395718.2_Nonsense_Mutation_p.S418*			Q96NE9	FRMD6_HUMAN	FERM domain containing 6	426					apical constriction (GO:0003383)|cellular protein localization (GO:0034613)|regulation of actin filament-based process (GO:0032970)	apical junction complex (GO:0043296)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)		p.S418L(1)		breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(7)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	all_epithelial(31;0.0163)|Breast(41;0.089)					ACCTGCAGCTCAATGACCAGT	0.602																																					p.S426X		.											.	FRMD6-524	1	Substitution - Missense(1)	pancreas(1)	c.C1277G						.						52.0	51.0	51.0					14																	52187025		2203	4300	6503	SO:0001587	stop_gained	122786	exon11			GCAGCTCAATGAC	BI465118	CCDS9704.1, CCDS58318.1, CCDS58319.1	14q22.1	2011-06-22	2005-07-20	2005-07-20	ENSG00000139926	ENSG00000139926			19839	protein-coding gene	gene with protein product	"""expanded homolog"""	614555	"""chromosome 14 open reading frame 31"""	C14orf31			Standard	NM_152330		Approved	MGC17921, willin, EX1	uc001wzd.3	Q96NE9	OTTHUMG00000140294	ENST00000344768.5:c.1277C>G	14.37:g.52187025C>G	ENSP00000343899:p.Ser426*	Somatic	146	2		WXS	Illumina GAIIx	Phase_I	128	37	NM_001267046	0	0	0	0	0	D3DSB9|Q5HYF2|Q8N2X1|Q8WUH7	Nonsense_Mutation	SNP	ENST00000344768.5	37	CCDS58318.1	.	.	.	.	.	.	.	.	.	.	C	38	7.217961	0.98143	.	.	ENSG00000139926	ENST00000356218;ENST00000395718;ENST00000344768;ENST00000554167;ENST00000555197;ENST00000555703;ENST00000553556	.	.	.	5.98	5.98	0.97165	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	.	20.452	0.99131	0.0:1.0:0.0:0.0	.	.	.	.	X	418;418;426;349;156;68;68	.	ENSP00000343899:S426X	S	+	2	0	FRMD6	51256775	1.000000	0.71417	0.998000	0.56505	0.977000	0.68977	6.066000	0.71185	2.838000	0.97847	0.591000	0.81541	TCA	.		0.602	FRMD6-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276881.1	NM_152330	
SLC38A6	145389	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	61446459	61446459	+	5'Flank	SNP	G	G	C	rs188092813		TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr14:61446459G>C	ENST00000267488.4	+	0	0				RP11-193F5.1_ENST00000553946.1_RNA|SLC38A6_ENST00000456840.2_5'Flank|SLC38A6_ENST00000354886.2_5'Flank|TRMT5_ENST00000261249.6_Missense_Mutation_p.Q53E	NM_153811.2	NP_722518.2	Q8IZM9	S38A6_HUMAN	solute carrier family 38, member 6						amino acid transport (GO:0006865)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(2)|lung(5)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	21				OV - Ovarian serous cystadenocarcinoma(108;0.0981)		CTTTTTCTTTGACCCAATAAG	0.413													G|||	1	0.000199681	0.0	0.0014	5008	,	,		17425	0.0		0.0	False		,,,				2504	0.0				p.Q53E		.											.	TRMT5-91	0			c.C157G						.						114.0	112.0	113.0					14																	61446459		2203	4300	6503	SO:0001631	upstream_gene_variant	57570	exon2			TTCTTTGACCCAA	AF070578	CCDS9751.1, CCDS53900.1	14q23.1	2013-05-22			ENSG00000139974	ENSG00000139974		"""Solute carriers"""	19863	protein-coding gene	gene with protein product							Standard	NM_153811		Approved	NAT-1	uc001xfh.2	Q8IZM9	OTTHUMG00000140335		14.37:g.61446459G>C	Exception_encountered	Somatic	74	0		WXS	Illumina GAIIx	Phase_I	116	7	NM_020810	0	0	0	0	0	C9JWA6|Q86SY5	Missense_Mutation	SNP	ENST00000267488.4	37	CCDS9751.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	8.597	0.885961	0.17540	.	.	ENSG00000126814	ENST00000261249;ENST00000553903;ENST00000555420	T	0.22336	1.96	4.59	3.68	0.42216	.	0.156231	0.43110	N	0.000619	T	0.20251	0.0487	L	0.57536	1.79	0.30776	N	0.742507	B	0.15473	0.013	B	0.11329	0.006	T	0.09122	-1.0689	10	0.34782	T	0.22	-18.8881	9.4552	0.38750	0.0:0.1371:0.5837:0.2792	.	53	Q32P41	TRM5_HUMAN	E	53;81;80	ENSP00000261249:Q53E	ENSP00000261249:Q53E	Q	-	1	0	TRMT5	60516212	1.000000	0.71417	0.906000	0.35671	0.123000	0.20343	1.202000	0.32271	1.254000	0.44035	0.655000	0.94253	CAA	G|0.999;C|0.000		0.413	SLC38A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276957.1		
YLPM1	56252	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	75265522	75265522	+	Silent	SNP	A	A	G			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr14:75265522A>G	ENST00000325680.7	+	5	3646	c.3522A>G	c.(3520-3522)ggA>ggG	p.G1174G	YLPM1_ENST00000238571.3_Silent_p.G979G|YLPM1_ENST00000552421.1_Intron	NM_019589.2	NP_062535.2	P49750	YLPM1_HUMAN	YLP motif containing 1	979	Arg-rich.				regulation of telomere maintenance (GO:0032204)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	62			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		CAGAACCAGGAGATGGTGGGG	0.532																																					p.G1174G		.											.	YLPM1-71	0			c.A3522G						.						67.0	68.0	68.0					14																	75265522		1914	4124	6038	SO:0001819	synonymous_variant	56252	exon5			ACCAGGAGATGGT	AK090435	CCDS45135.1	14q24.3	2014-06-13	2004-07-15	2004-07-15	ENSG00000119596	ENSG00000119596			17798	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 169"""		"""chromosome 14 open reading frame 170"""	C14orf170		7596406	Standard	NM_019589		Approved	ZAP, PPP1R169	uc001xqj.4	P49750	OTTHUMG00000172503	ENST00000325680.7:c.3522A>G	14.37:g.75265522A>G		Somatic	97	0		WXS	Illumina GAIIx	Phase_I	115	31	NM_019589	0	0	0	0	0	P49752|Q96I64|Q9P1V7	Silent	SNP	ENST00000325680.7	37	CCDS45135.1																																																																																			.		0.532	YLPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404451.1	NM_019589	
IFT43	112752	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	76452154	76452154	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr14:76452154G>C	ENST00000314067.6	+	1	59	c.25G>C	c.(25-27)Gag>Cag	p.E9Q	IFT43_ENST00000556742.1_Missense_Mutation_p.E9Q|IFT43_ENST00000553338.1_3'UTR|TGFB3_ENST00000556674.1_5'Flank|IFT43_ENST00000238628.6_Missense_Mutation_p.E9Q	NM_001102564.1	NP_001096034.1	Q96FT9	IFT43_HUMAN	intraflagellar transport 43	9					cilium morphogenesis (GO:0060271)|intraciliary retrograde transport (GO:0035721)	cytoplasm (GO:0005737)|intraciliary transport particle A (GO:0030991)|microtubule cytoskeleton (GO:0015630)|microtubule organizing center (GO:0005815)		p.E9Q(2)		endometrium(1)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15						CGACTTGGACGAGGAGCTTCG	0.672																																					p.E9Q		.											.	IFT43-90	2	Substitution - Missense(2)	lung(2)	c.G25C						.						60.0	50.0	54.0					14																	76452154		2203	4300	6503	SO:0001583	missense	112752	exon1			TTGGACGAGGAGC	BC010436	CCDS9847.1, CCDS41973.1, CCDS58330.1	14q24.3	2014-07-03	2014-07-03	2011-06-09				"""Intraflagellar transport homologs"""	29669	protein-coding gene	gene with protein product		614068	"""chromosome 14 open reading frame 179"", ""intraflagellar transport 43 homolog (Chlamydomonas)"""	C14orf179		21378380	Standard	NM_052873		Approved	FLJ32173, MGC16028	uc010asm.1	Q96FT9		ENST00000314067.6:c.25G>C	14.37:g.76452154G>C	ENSP00000324177:p.Glu9Gln	Somatic	100	0		WXS	Illumina GAIIx	Phase_I	109	27	NM_001102564	0	0	0	0	0	B3KPT6|B4DZI9|G3V385|O95418|Q9ULA9	Missense_Mutation	SNP	ENST00000314067.6	37	CCDS41973.1	.	.	.	.	.	.	.	.	.	.	G	11.73	1.725640	0.30593	.	.	ENSG00000119650	ENST00000314067;ENST00000238628;ENST00000556742	T;T	0.55234	0.58;0.53	4.04	4.04	0.47022	.	0.257343	0.30901	N	0.008660	T	0.65954	0.2741	M	0.78049	2.395	0.37552	D	0.918735	D;D;D;D	0.76494	0.977;0.989;0.989;0.999	P;P;P;D	0.66351	0.673;0.811;0.755;0.943	T	0.68387	-0.5422	10	0.33141	T	0.24	0.0183	7.8262	0.29315	0.112:0.0:0.888:0.0	.	9;9;9;9	Q96FT9;Q96FT9-3;Q96FT9-2;G3V385	IFT43_HUMAN;.;.;.	Q	9	ENSP00000324177:E9Q;ENSP00000238628:E9Q	ENSP00000238628:E9Q	E	+	1	0	IFT43	75521907	1.000000	0.71417	0.995000	0.50966	0.090000	0.18270	4.599000	0.61076	2.241000	0.73720	0.591000	0.81541	GAG	.		0.672	IFT43-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_052873	
ISM2	145501	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	77951057	77951057	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr14:77951057G>A	ENST00000342219.4	-	2	403	c.347C>T	c.(346-348)gCc>gTc	p.A116V	ISM2_ENST00000412904.1_Missense_Mutation_p.A116V|ISM2_ENST00000429906.1_Intron|ISM2_ENST00000493585.1_Missense_Mutation_p.A116V|ISM2_ENST00000393684.3_Missense_Mutation_p.A28V	NM_199296.2	NP_954993.1	Q6H9L7	ISM2_HUMAN	isthmin 2	116						extracellular region (GO:0005576)				endometrium(3)|large_intestine(4)|lung(11)|prostate(1)|skin(1)|urinary_tract(1)	21						GGTTGTGTTGGCCAATCCCGG	0.627																																					p.A116V		.											.	ISM2-91	0			c.C347T						.						74.0	71.0	72.0					14																	77951057		2203	4300	6503	SO:0001583	missense	145501	exon2			GTGTTGGCCAATC	AK056709	CCDS9864.1, CCDS45143.1	14q24.3	2013-05-15	2013-05-15	2008-12-23	ENSG00000100593	ENSG00000100593			23176	protein-coding gene	gene with protein product	"""thrombospondin and AMOP containing isthmin-like 1"""	612684	"""thrombospondin, type I domain-containing 3"", ""thrombospondin, type I, domain containing 3"", ""isthmin 2 homolog (zebrafish)"""	THSD3		15194193	Standard	NM_199296		Approved	FLJ32147, TAIL1	uc001xtz.3	Q6H9L7	OTTHUMG00000158563	ENST00000342219.4:c.347C>T	14.37:g.77951057G>A	ENSP00000341490:p.Ala116Val	Somatic	177	0		WXS	Illumina GAIIx	Phase_I	196	50	NM_199296	0	0	0	0	0	A8K6D5|O95432|Q495U5|Q68CN3|Q86TQ7|Q86TW3|Q86TW4|Q8N501|Q8NBL0	Missense_Mutation	SNP	ENST00000342219.4	37	CCDS9864.1	.	.	.	.	.	.	.	.	.	.	G	14.01	2.408379	0.42715	.	.	ENSG00000100593	ENST00000342219;ENST00000412904;ENST00000393684;ENST00000493585	T;T;T;T	0.36157	1.76;1.73;2.21;1.27	2.58	2.58	0.30949	.	.	.	.	.	T	0.38054	0.1026	L	0.40543	1.245	0.27909	N	0.938681	D;B;P	0.56035	0.974;0.376;0.956	P;B;B	0.51385	0.668;0.104;0.314	T	0.13818	-1.0495	9	0.39692	T	0.17	.	10.8062	0.46518	0.0:0.0:1.0:0.0	.	116;116;116	Q6H9L7-5;Q6H9L7-2;Q6H9L7	.;.;ISM2_HUMAN	V	116;116;28;116	ENSP00000341490:A116V;ENSP00000416773:A116V;ENSP00000377289:A28V;ENSP00000420452:A116V	ENSP00000341490:A116V	A	-	2	0	ISM2	77020810	1.000000	0.71417	0.983000	0.44433	0.119000	0.20118	2.777000	0.47717	1.734000	0.51633	0.549000	0.68633	GCC	.		0.627	ISM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000351309.1	NM_182509	
SNW1	22938	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	78203387	78203387	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr14:78203387T>A	ENST00000261531.7	-	6	627	c.565A>T	c.(565-567)Aac>Tac	p.N189Y	SNW1_ENST00000555761.1_Missense_Mutation_p.N189Y|SLIRP_ENST00000557431.1_Intron|SNW1_ENST00000554775.1_Missense_Mutation_p.N27Y	NM_012245.2	NP_036377.1	Q13573	SNW1_HUMAN	SNW domain containing 1	189	SNW.				cellular response to retinoic acid (GO:0071300)|gene expression (GO:0010467)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of vitamin D receptor signaling pathway (GO:0070564)|regulation of retinoic acid receptor signaling pathway (GO:0048385)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of vitamin D receptor signaling pathway (GO:0070562)|retinoic acid receptor signaling pathway (GO:0048384)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|chromatin (GO:0000785)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	Notch binding (GO:0005112)|nuclear hormone receptor binding (GO:0035257)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)|SMAD binding (GO:0046332)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|vitamin D receptor binding (GO:0042809)			NS(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0291)		GCTCCAGAGTTGAATGCCACT	0.388																																					p.N189Y		.											.	SNW1-187	0			c.A565T						.						154.0	138.0	144.0					14																	78203387		2203	4300	6503	SO:0001583	missense	22938	exon6			CAGAGTTGAATGC	AF045184	CCDS9867.1	14q22.1-q22.3	2005-09-13	2005-09-13	2005-09-13		ENSG00000100603			16696	protein-coding gene	gene with protein product		603055	"""SKI interacting protein"""	SKIIP		8973337, 9632709	Standard	NM_012245		Approved	NCoA-62, SKIP, Prp45, PRPF45, Bx42	uc001xuf.3	Q13573		ENST00000261531.7:c.565A>T	14.37:g.78203387T>A	ENSP00000261531:p.Asn189Tyr	Somatic	46	0		WXS	Illumina GAIIx	Phase_I	55	38	NM_012245	0	0	0	0	0	A8K8A9|Q13483|Q32N03|Q5D0D6	Missense_Mutation	SNP	ENST00000261531.7	37	CCDS9867.1	.	.	.	.	.	.	.	.	.	.	T	27.9	4.868993	0.91587	.	.	ENSG00000100603	ENST00000261531;ENST00000554775;ENST00000555761;ENST00000416259	.	.	.	5.98	5.98	0.97165	SKI-interacting protein SKIP, SNW domain (1);	0.000000	0.85682	D	0.000000	D	0.85779	0.5776	M	0.91510	3.215	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.985	D	0.88873	0.3334	9	0.87932	D	0	.	16.4566	0.84019	0.0:0.0:0.0:1.0	.	189;189	G3V3A4;Q13573	.;SNW1_HUMAN	Y	189;27;189;189	.	ENSP00000261531:N189Y	N	-	1	0	SNW1	77273140	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.993000	0.88291	2.293000	0.77203	0.477000	0.44152	AAC	.		0.388	SNW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413912.1	NM_012245	
ZNF770	54989	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	35275401	35275401	+	Silent	SNP	G	G	A			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr15:35275401G>A	ENST00000356321.4	-	3	579	c.235C>T	c.(235-237)Ctg>Ttg	p.L79L		NM_014106.3	NP_054825.2	Q6IQ21	ZN770_HUMAN	zinc finger protein 770	79					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)	29		Lung NSC(122;4.59e-10)|all_lung(180;8.78e-09)		all cancers(64;1.97e-18)|GBM - Glioblastoma multiforme(113;2.11e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0643)		TTAAAAGGCAGACTATGAGTT	0.348																																					p.L79L		.											.	ZNF770-91	0			c.C235T						.						86.0	86.0	86.0					15																	35275401		2201	4298	6499	SO:0001819	synonymous_variant	54989	exon3			AAGGCAGACTATG	BC071603	CCDS10042.1	15q14	2013-01-08			ENSG00000198146	ENSG00000198146		"""Zinc fingers, C2H2-type"""	26061	protein-coding gene	gene with protein product							Standard	NM_014106		Approved	FLJ20582, PRO1914	uc001ziw.3	Q6IQ21	OTTHUMG00000129689	ENST00000356321.4:c.235C>T	15.37:g.35275401G>A		Somatic	48	1		WXS	Illumina GAIIx	Phase_I	37	19	NM_014106	0	0	0	0	0	Q6ZMZ6|Q9NWV2	Silent	SNP	ENST00000356321.4	37	CCDS10042.1																																																																																			.		0.348	ZNF770-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251896.2	NM_014106	
DISP2	85455	hgsc.bcm.edu	37	15	40660192	40660192	+	Silent	SNP	C	C	T	rs8040755	byFrequency	TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr15:40660192C>T	ENST00000267889.3	+	8	1966	c.1879C>T	c.(1879-1881)Ctg>Ttg	p.L627L	RP11-64K12.4_ENST00000558421.1_RNA	NM_033510.1	NP_277045.1	A7MBM2	DISP2_HUMAN	dispatched homolog 2 (Drosophila)	627	SSD. {ECO:0000255|PROSITE- ProRule:PRU00199}.				smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)				breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(12)|ovary(4)	30		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.39e-06)|Colorectal(105;0.0114)|READ - Rectum adenocarcinoma(2;0.0649)|BRCA - Breast invasive adenocarcinoma(123;0.0798)|Lung(196;0.15)|LUAD - Lung adenocarcinoma(183;0.247)		CACGGCTGTGCTGGTGCACCT	0.746													C|||	218	0.0435304	0.0038	0.1066	5008	,	,		10666	0.0179		0.0984	False		,,,				2504	0.0225				p.L627L		.											.	DISP2-92	0			c.C1879T						.	C		81,4189		0,81,2054	5.0	5.0	5.0		1879	5.6	1.0	15	dbSNP_116	5	887,7489		41,805,3342	no	coding-synonymous	DISP2	NM_033510.1		41,886,5396	TT,TC,CC		10.5898,1.897,7.6546		627/1402	40660192	968,11678	2135	4188	6323	SO:0001819	synonymous_variant	85455	exon8			GCTGTGCTGGTGC	AB051529	CCDS10056.1	15q14	2004-01-15			ENSG00000140323	ENSG00000140323			19712	protein-coding gene	gene with protein product		607503				11214970, 10619433	Standard	NM_033510		Approved	DISPB, KIAA1742, HsT16908	uc001zlk.1	A7MBM2	OTTHUMG00000129983	ENST00000267889.3:c.1879C>T	15.37:g.40660192C>T		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_033510	0	0	0	0	0	Q6AHW3|Q9C0C1	Silent	SNP	ENST00000267889.3	37	CCDS10056.1																																																																																			C|0.941;T|0.059		0.746	DISP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252249.1	NM_033510	
AKAP13	11214	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	86286897	86286897	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr15:86286897C>A	ENST00000394518.2	+	36	8328	c.8233C>A	c.(8233-8235)Cac>Aac	p.H2745N	AKAP13_ENST00000560579.1_3'UTR|AKAP13_ENST00000394510.2_Missense_Mutation_p.H990N|RP11-158M2.3_ENST00000558375.1_RNA|AKAP13_ENST00000361243.2_Missense_Mutation_p.H2749N	NM_001270546.1|NM_007200.4	NP_001257475.1|NP_009131.2	Q12802	AKP13_HUMAN	A kinase (PRKA) anchor protein 13	2745	Interaction with ESR1.				apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nuclear export (GO:0051168)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle hypertrophy (GO:0010611)|regulation of glucocorticoid mediated signaling pathway (GO:1900169)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cAMP-dependent protein kinase activity (GO:0004691)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|central_nervous_system(4)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(13)|liver(1)|lung(43)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	98						GGGGCCTTTTCACATACTGAG	0.512																																					p.H2749N	Melanoma(94;603 1453 3280 32295 32951)	.											.	AKAP13-258	0			c.C8245A						.						122.0	123.0	123.0					15																	86286897		2202	4299	6501	SO:0001583	missense	11214	exon36			CCTTTTCACATAC	M90360	CCDS32319.1, CCDS32320.1, CCDS73778.1	15q24-q25	2013-01-10	2002-06-13			ENSG00000170776		"""A-kinase anchor proteins"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	371	protein-coding gene	gene with protein product		604686	"""lymphoid blast crisis oncogene"""	LBC		9627117, 1860836	Standard	NM_007200		Approved	Ht31, BRX, AKAP-Lbc, c-lbc, PROTO-LB, HA-3, ARHGEF13	uc002blu.2	Q12802		ENST00000394518.2:c.8233C>A	15.37:g.86286897C>A	ENSP00000378026:p.His2745Asn	Somatic	99	0		WXS	Illumina GAIIx	Phase_I	103	40	NM_006738	0	0	0	0	0	Q14572|Q59FP6|Q86W90|Q8WXQ6|Q96JP6|Q96P79|Q9Y5T0|Q9Y5T6	Missense_Mutation	SNP	ENST00000394518.2	37	CCDS32319.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.185435	0.78677	.	.	ENSG00000170776	ENST00000361243;ENST00000394518;ENST00000394516;ENST00000458540;ENST00000394510	T;T;T	0.27402	2.67;2.7;1.67	5.63	5.63	0.86233	.	.	.	.	.	T	0.55816	0.1944	M	0.65498	2.005	0.44668	D	0.997655	D;D	0.89917	1.0;1.0	D;D	0.79108	0.981;0.992	T	0.52961	-0.8505	9	0.49607	T	0.09	.	18.6746	0.91524	0.0:1.0:0.0:0.0	.	2745;2749	Q12802;Q12802-2	AKP13_HUMAN;.	N	2749;2745;2748;2724;990	ENSP00000354718:H2749N;ENSP00000378026:H2745N;ENSP00000378018:H990N	ENSP00000354718:H2749N	H	+	1	0	AKAP13	84087901	1.000000	0.71417	1.000000	0.80357	0.666000	0.39218	3.035000	0.49759	2.669000	0.90835	0.585000	0.79938	CAC	.		0.512	AKAP13-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417318.1	NM_007200	
MAN2A2	4122	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	91450636	91450636	+	Silent	SNP	A	A	G			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr15:91450636A>G	ENST00000559717.1	+	8	1566	c.1107A>G	c.(1105-1107)caA>caG	p.Q369Q	MAN2A2_ENST00000431652.2_5'UTR|MAN2A2_ENST00000360468.3_Silent_p.Q369Q			P49641	MA2A2_HUMAN	mannosidase, alpha, class 2A, member 2	369					cellular protein metabolic process (GO:0044267)|mannose metabolic process (GO:0006013)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|hydrolase activity, hydrolyzing N-glycosyl compounds (GO:0016799)|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity (GO:0004572)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|lung(13)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.229)			TCTGCTGCCAATTTGATTTCA	0.567																																					p.Q369Q		.											.	MAN2A2-136	0			c.A1107G						.						86.0	85.0	85.0					15																	91450636		2198	4298	6496	SO:0001819	synonymous_variant	4122	exon7			CTGCCAATTTGAT	L28821	CCDS32332.1	15q25	2011-06-30			ENSG00000196547	ENSG00000196547			6825	protein-coding gene	gene with protein product		600988				8524845	Standard	NM_006122		Approved	MANA2X, HsT19662	uc002bqc.3	P49641		ENST00000559717.1:c.1107A>G	15.37:g.91450636A>G		Somatic	73	0		WXS	Illumina GAIIx	Phase_I	61	28	NM_006122	0	0	0	0	0	A6NH12|A8K1E8|Q13754	Silent	SNP	ENST00000559717.1	37	CCDS32332.1																																																																																			.		0.567	MAN2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418246.5	NM_006122	
PKD1	5310	broad.mit.edu	37	16	2154573	2154573	+	Missense_Mutation	SNP	A	A	C	rs201238819		TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr16:2154573A>C	ENST00000262304.4	-	22	8295	c.8087T>G	c.(8086-8088)cTc>cGc	p.L2696R	PKD1_ENST00000561991.1_5'UTR|PKD1_ENST00000423118.1_Missense_Mutation_p.L2696R	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	2696	REJ. {ECO:0000255|PROSITE- ProRule:PRU00511}.		L -> R (in PKD1). {ECO:0000269|PubMed:11316854}.		anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)	p.L2696R(3)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						CTGCAGGATGAGCATCATGGC	0.677																																					p.L2696R		.											.	PKD1-91	3	Substitution - Missense(3)	skin(2)|endometrium(1)	c.T8087G	GRCh37	CM014074	PKD1	M		.						16.0	12.0	13.0					16																	2154573		2107	4184	6291	SO:0001583	missense	5310	exon22			AGGATGAGCATCA	L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.8087T>G	16.37:g.2154573A>C	ENSP00000262304:p.Leu2696Arg	Somatic	105	0		WXS	Illumina GAIIx	Phase_I	142	4	NM_000296	0	0	0	0	0	Q15140|Q15141	Missense_Mutation	SNP	ENST00000262304.4	37	CCDS32369.1	.	.	.	.	.	.	.	.	.	.	-	0.355	-0.942715	0.02322	.	.	ENSG00000008710	ENST00000262304;ENST00000423118;ENST00000306101;ENST00000382481	T;T	0.32988	1.43;1.43	4.37	-1.71	0.08133	Egg jelly receptor, REJ-like (1);Polycystin cation channel (1);	0.646468	0.16090	N	0.230081	T	0.05181	0.0138	N	0.00347	-1.61	0.20873	N	0.99984	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.35500	-0.9786	10	0.12430	T	0.62	.	2.3268	0.04224	0.102:0.2587:0.2052:0.4341	.	2696;2696	P98161-3;P98161	.;PKD1_HUMAN	R	2696;2696;2031;975	ENSP00000262304:L2696R;ENSP00000399501:L2696R	ENSP00000262304:L2696R	L	-	2	0	PKD1	2094574	0.916000	0.31088	0.097000	0.21041	0.126000	0.20510	0.857000	0.27831	-0.349000	0.08274	-0.335000	0.08231	CTC	.		0.677	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341688.1		
MMP25	64386	hgsc.bcm.edu	37	16	3108863	3108863	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr16:3108863C>A	ENST00000336577.4	+	10	1690	c.1453C>A	c.(1453-1455)Cgc>Agc	p.R485S	RP11-473M20.7_ENST00000573130.1_RNA|RP11-473M20.7_ENST00000572222.1_RNA|RP11-473M20.7_ENST00000572930.1_RNA|RP11-473M20.7_ENST00000570949.1_RNA|RP11-473M20.7_ENST00000576250.1_RNA|RP11-473M20.7_ENST00000573953.1_RNA|RP11-473M20.7_ENST00000572574.1_RNA|RP11-473M20.7_ENST00000573878.1_RNA|RP11-473M20.7_ENST00000572427.1_RNA	NM_022468.4	NP_071913.1	Q9H239	MMP28_HUMAN	matrix metallopeptidase 25	487					negative regulation of macrophage chemotaxis (GO:0010760)	cytoplasm (GO:0005737)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|prostate(1)|skin(1)	14					Marimastat(DB00786)	CCACTACTGGCGCTTCCCCAA	0.701																																					p.R485S	NSCLC(147;665 1067 3888 6863 19894 30469 40247 45633 51336)	.											.	MMP25-226	0			c.C1453A						.						15.0	18.0	17.0					16																	3108863		2182	4288	6470	SO:0001583	missense	64386	exon10			TACTGGCGCTTCC	AF145442	CCDS10492.1	16p13.3	2008-02-05	2005-08-08			ENSG00000008516			14246	protein-coding gene	gene with protein product		608482	"""matrix metalloproteinase 25"", ""matrix metallopeptidase-like 1"""	MMPL1, MMP20		10628838, 10706098	Standard	NM_022468		Approved	MT6-MMP	uc002cth.3	Q9NPA2		ENST00000336577.4:c.1453C>A	16.37:g.3108863C>A	ENSP00000337816:p.Arg485Ser	Somatic	86	0		WXS	Illumina GAIIx	Phase_I	69	4	NM_022468	0	0	0	0	0	Q96F04|Q96TE2	Missense_Mutation	SNP	ENST00000336577.4	37	CCDS10492.1	.	.	.	.	.	.	.	.	.	.	c	14.58	2.578322	0.45902	.	.	ENSG00000008516	ENST00000336577	T	0.04360	3.64	4.22	4.22	0.49857	Hemopexin/matrixin (2);	0.140381	0.32852	N	0.005570	T	0.24470	0.0593	M	0.93507	3.425	0.42812	D	0.993967	D	0.65815	0.995	D	0.64321	0.924	T	0.05354	-1.0890	10	0.62326	D	0.03	.	9.5529	0.39321	0.2103:0.7897:0.0:0.0	.	485	Q9NPA2	MMP25_HUMAN	S	485	ENSP00000337816:R485S	ENSP00000337816:R485S	R	+	1	0	MMP25	3048864	0.004000	0.15560	0.999000	0.59377	0.086000	0.17979	-0.040000	0.12104	1.899000	0.54978	0.454000	0.30748	CGC	.		0.701	MMP25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437116.1	NM_022468	
PPL	5493	bcgsc.ca	37	16	4935146	4935146	+	Silent	SNP	C	C	T	rs1049206	byFrequency	TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr16:4935146C>T	ENST00000345988.2	-	22	3599	c.3510G>A	c.(3508-3510)gtG>gtA	p.V1170V	PPL_ENST00000590782.2_Silent_p.V1168V	NM_002705.4	NP_002696	O60437	PEPL_HUMAN	periplakin	1170					keratinization (GO:0031424)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)	p.V1170V(1)		breast(6)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(12)|lung(12)|ovary(4)|prostate(5)|skin(3)|stomach(1)|urinary_tract(2)	62						CCTTCTCCTGCACCACCACTT	0.622													C|||	1841	0.367612	0.3359	0.4135	5008	,	,		18711	0.2907		0.3241	False		,,,				2504	0.502				p.V1170V		.											.	PPL-95	1	Substitution - coding silent(1)	stomach(1)	c.G3510A						.	C		1539,2855	487.3+/-360.9	274,991,932	120.0	110.0	113.0		3510	2.1	1.0	16	dbSNP_86	113	2550,6050	414.9+/-351.6	376,1798,2126	no	coding-synonymous	PPL	NM_002705.4		650,2789,3058	TT,TC,CC		29.6512,35.025,31.4684		1170/1757	4935146	4089,8905	2197	4300	6497	SO:0001819	synonymous_variant	5493	exon22			CTCCTGCACCACC	AF013717	CCDS10526.1	16p13.3	2008-02-05			ENSG00000118898	ENSG00000118898			9273	protein-coding gene	gene with protein product		602871				9570964, 9521878	Standard	NM_002705		Approved		uc002cyd.1	O60437	OTTHUMG00000129528	ENST00000345988.2:c.3510G>A	16.37:g.4935146C>T		Somatic	128	0		WXS	Illumina GAIIx	Phase_I	100	5	NM_002705	0	0	0	0	0	O60314|O60454|Q14C98	Silent	SNP	ENST00000345988.2	37	CCDS10526.1																																																																																			C|0.673;T|0.327		0.622	PPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251715.1	NM_002705	
TMC7	79905	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	19056276	19056276	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr16:19056276G>C	ENST00000304381.5	+	10	1538	c.1408G>C	c.(1408-1410)Gat>Cat	p.D470H	TMC7_ENST00000569532.1_Missense_Mutation_p.D470H|TMC7_ENST00000421369.3_Missense_Mutation_p.D360H	NM_024847.3	NP_079123.3	Q7Z402	TMC7_HUMAN	transmembrane channel-like 7	470					ion transport (GO:0006811)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	28						CACATCCTGTGATGATGACAC	0.567																																					p.D470H		.											.	TMC7-93	0			c.G1408C						.						122.0	111.0	114.0					16																	19056276		2197	4300	6497	SO:0001583	missense	79905	exon10			TCCTGTGATGATG	AY263165	CCDS10573.1, CCDS53992.1, CCDS73837.1	16p13.11	2008-02-05			ENSG00000170537	ENSG00000170537			23000	protein-coding gene	gene with protein product						12812529, 12906855	Standard	XM_005255597		Approved	FLJ21240	uc002dfq.3	Q7Z402	OTTHUMG00000131456	ENST00000304381.5:c.1408G>C	16.37:g.19056276G>C	ENSP00000304710:p.Asp470His	Somatic	126	0		WXS	Illumina GAIIx	Phase_I	67	27	NM_024847	0	0	0	0	0	E7ERB6|Q5H9Q8|Q7Z5M4|Q86WX0|Q9H766	Missense_Mutation	SNP	ENST00000304381.5	37	CCDS10573.1	.	.	.	.	.	.	.	.	.	.	G	10.78	1.445646	0.25987	.	.	ENSG00000170537	ENST00000304381;ENST00000421369	T;T	0.52526	0.66;0.66	5.41	4.45	0.53987	.	0.826679	0.11221	N	0.586753	T	0.40171	0.1106	L	0.40543	1.245	0.19775	N	0.999954	B;B	0.14805	0.009;0.011	B;B	0.23275	0.028;0.045	T	0.17048	-1.0382	10	0.45353	T	0.12	.	9.2769	0.37705	0.0763:0.1463:0.7774:0.0	.	470;470	Q7Z402;B3KSZ3	TMC7_HUMAN;.	H	470;360	ENSP00000304710:D470H;ENSP00000397081:D360H	ENSP00000304710:D470H	D	+	1	0	TMC7	18963777	0.771000	0.28555	0.832000	0.32986	0.288000	0.27193	2.016000	0.40971	2.525000	0.85131	0.555000	0.69702	GAT	.		0.567	TMC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254276.3	NM_024847	
SCNN1B	6338	broad.mit.edu	37	16	23360165	23360165	+	Missense_Mutation	SNP	C	C	G	rs35731153	byFrequency	TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr16:23360165C>G	ENST00000343070.2	+	2	421	c.245C>G	c.(244-246)tCc>tGc	p.S82C	SCNN1B_ENST00000568085.1_Missense_Mutation_p.S82C|SCNN1B_ENST00000569789.1_3'UTR|SCNN1B_ENST00000307331.5_Missense_Mutation_p.S127C|SCNN1B_ENST00000568923.1_Missense_Mutation_p.S82C	NM_000336.2	NP_000327.2	P51168	SCNNB_HUMAN	sodium channel, non-voltage-gated 1, beta subunit	82			S -> C (in BESC1; dbSNP:rs35731153). {ECO:0000269|PubMed:16207733, ECO:0000269|PubMed:18507830}.		excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|multicellular organismal water homeostasis (GO:0050891)|response to stimulus (GO:0050896)|sensory perception of taste (GO:0050909)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)	ligand-gated sodium channel activity (GO:0015280)|WW domain binding (GO:0050699)			breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|liver(2)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	32				GBM - Glioblastoma multiforme(48;0.0465)	Amiloride(DB00594)|Triamterene(DB00384)	GTCAGCGTCTCCCTCTCCGTA	0.607													C|||	4	0.000798722	0.0	0.0029	5008	,	,		15592	0.0		0.001	False		,,,				2504	0.001				p.S82C		.											.	SCNN1B-157	0			c.C245G	GRCh37	CM055537	SCNN1B	M	rs35731153	.	C	CYS/SER	14,4380	20.2+/-43.8	0,14,2183	85.0	71.0	76.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	245	5.0	1.0	16	dbSNP_126	76	69,8531	41.7+/-99.0	0,69,4231	yes	missense	SCNN1B	NM_000336.2	112	0,83,6414	GG,GC,CC		0.8023,0.3186,0.6388	probably-damaging	82/641	23360165	83,12911	2197	4300	6497	SO:0001583	missense	6338	exon2			GCGTCTCCCTCTC	X87159	CCDS10609.1	16p12.2-p12.1	2012-02-28	2012-02-28		ENSG00000168447	ENSG00000168447		"""Ion channels / Sodium channel, nonvoltage-gated"", ""Sodium channels"""	10600	protein-coding gene	gene with protein product	"""Liddle syndrome"""	600760	"""sodium channel, nonvoltage-gated 1, beta"", ""sodium channel, non-voltage-gated 1, beta"""				Standard	NM_000336		Approved	ENaCbeta	uc002dln.3	P51168	OTTHUMG00000131608	ENST00000343070.2:c.245C>G	16.37:g.23360165C>G	ENSP00000345751:p.Ser82Cys	Somatic	174	1		WXS	Illumina GAIIx	Phase_I	125	3	NM_000336	0	0	0	0	0	C5HTZ2|O60891|Q96KG2|Q9UJ32|Q9UMU5	Missense_Mutation	SNP	ENST00000343070.2	37	CCDS10609.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	20.8	4.050778	0.75960	0.003186	0.008023	ENSG00000168447	ENST00000343070;ENST00000307331	T;T	0.65916	-0.18;-0.18	5.01	5.01	0.66863	.	0.251063	0.33610	N	0.004723	T	0.72399	0.3455	M	0.79475	2.455	0.45762	A	0.998652	D	0.69078	0.997	P	0.62649	0.905	T	0.80663	-0.1282	9	0.87932	D	0	-5.1436	17.3103	0.87207	0.0:1.0:0.0:0.0	rs35731153;rs61729787	82	P51168	SCNNB_HUMAN	C	82;127	ENSP00000345751:S82C;ENSP00000302874:S127C	ENSP00000302874:S127C	S	+	2	0	SCNN1B	23267666	0.997000	0.39634	1.000000	0.80357	0.949000	0.60115	5.745000	0.68672	2.315000	0.78130	0.561000	0.74099	TCC	C|0.995;G|0.005		0.607	SCNN1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254495.2		
ALDOA	226	bcgsc.ca	37	16	30081476	30081476	+	Silent	SNP	C	C	T	rs77290575	byFrequency	TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr16:30081476C>T	ENST00000566897.1	+	12	2190	c.1038C>T	c.(1036-1038)agC>agT	p.S346S	ALDOA_ENST00000395240.3_Silent_p.S350S|ALDOA_ENST00000569545.1_Silent_p.S346S|ALDOA_ENST00000563060.2_Silent_p.S346S|ALDOA_ENST00000564546.1_Silent_p.S346S|ALDOA_ENST00000569798.1_3'UTR|ALDOA_ENST00000395248.1_Silent_p.S400S|ALDOA_ENST00000412304.2_Silent_p.S346S|ALDOA_ENST00000338110.5_Silent_p.S346S|ALDOA_ENST00000564595.2_Silent_p.S400S			P04075	ALDOA_HUMAN	aldolase A, fructose-bisphosphate	346					actin filament organization (GO:0007015)|ATP biosynthetic process (GO:0006754)|blood coagulation (GO:0007596)|carbohydrate metabolic process (GO:0005975)|fructose 1,6-bisphosphate metabolic process (GO:0030388)|fructose metabolic process (GO:0006000)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|muscle cell cellular homeostasis (GO:0046716)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homotetramerization (GO:0051289)|regulation of cell shape (GO:0008360)|small molecule metabolic process (GO:0044281)|striated muscle contraction (GO:0006941)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|membrane (GO:0016020)|nucleus (GO:0005634)|platelet alpha granule lumen (GO:0031093)	actin binding (GO:0003779)|cytoskeletal protein binding (GO:0008092)|fructose binding (GO:0070061)|fructose-bisphosphate aldolase activity (GO:0004332)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|tubulin binding (GO:0015631)			breast(2)|cervix(1)|endometrium(4)|large_intestine(1)|lung(6)|prostate(2)|upper_aerodigestive_tract(1)	17						ACACTCCGAGCGGTCAGGCTG	0.627													C|||	106	0.0211661	0.0015	0.1412	5008	,	,		17315	0.006		0.0	False		,,,				2504	0.0				p.S400S		.											.	ALDOA-226	0			c.C1200T						.	C	,,,	6,4388	11.4+/-27.6	0,6,2191	75.0	67.0	70.0		1038,1038,1038,1038	-0.3	1.0	16	dbSNP_132	70	3,8597	3.0+/-9.4	0,3,4297	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	ALDOA	NM_000034.3,NM_001127617.2,NM_184041.2,NM_184043.2	,,,	0,9,6488	TT,TC,CC		0.0349,0.1365,0.0693	,,,	346/365,346/365,346/365,346/365	30081476	9,12985	2197	4300	6497	SO:0001819	synonymous_variant	226	exon10			TCCGAGCGGTCAG	X05236	CCDS10668.1, CCDS58450.1	16p11.2	2008-03-06			ENSG00000149925	ENSG00000149925	4.1.2.13		414	protein-coding gene	gene with protein product		103850				3570299	Standard	NM_000034		Approved		uc010veg.2	P04075	OTTHUMG00000132107	ENST00000566897.1:c.1038C>T	16.37:g.30081476C>T		Somatic	127	0		WXS	Illumina GAIIx	Phase_I	110	5	NM_001243177	0	0	0	0	0	B4DXI7|Q6FH76|Q6FI10|Q96B15|Q9BWD9|Q9UCN2	Silent	SNP	ENST00000566897.1	37	CCDS10668.1																																																																																			C|0.994;T|0.006		0.627	ALDOA-004	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000435360.1	NM_000034	
CTRL	1506	ucsc.edu;bcgsc.ca	37	16	67965099	67965099	+	Missense_Mutation	SNP	C	C	T	rs140026167	byFrequency	TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr16:67965099C>T	ENST00000574481.1	-	2	619	c.58G>A	c.(58-60)Ggc>Agc	p.G20S	CTC-479C5.12_ENST00000573493.1_Intron|CTRL_ENST00000576408.1_Intron	NM_001907.2	NP_001898.1	P40313	CTRL_HUMAN	chymotrypsin-like	20					digestion (GO:0007586)|proteolysis (GO:0006508)	extracellular space (GO:0005615)	serine-type endopeptidase activity (GO:0004252)			kidney(1)|large_intestine(2)|urinary_tract(1)	4		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.00412)|Epithelial(162;0.018)|all cancers(182;0.118)		GCAGGAATGCCGCAGCCTGGC	0.612													C|||	42	0.00838658	0.0295	0.0043	5008	,	,		19226	0.0		0.0	False		,,,				2504	0.0				p.G20S		.											.	CTRL-90	0			c.G58A						.	C	SER/GLY	84,4312	72.0+/-110.0	1,82,2115	63.0	49.0	54.0		58	2.9	0.1	16	dbSNP_134	54	2,8598	2.2+/-6.3	0,2,4298	yes	missense	CTRL	NM_001907.2	56	1,84,6413	TT,TC,CC		0.0233,1.9108,0.6617	probably-damaging	20/265	67965099	86,12910	2198	4300	6498	SO:0001583	missense	1506	exon2			GAATGCCGCAGCC		CCDS10852.1	16q22.1	2008-02-05			ENSG00000141086	ENSG00000141086			2524	protein-coding gene	gene with protein product		118888				8268911	Standard	NM_001907		Approved		uc002euw.3	P40313	OTTHUMG00000137552	ENST00000574481.1:c.58G>A	16.37:g.67965099C>T	ENSP00000458537:p.Gly20Ser	Somatic	95	0		WXS	Illumina GAIIx	Phase_I	147	37	NM_001907	0	0	0	0	0		Missense_Mutation	SNP	ENST00000574481.1	37	CCDS10852.1	12	0.005494505494505495	12	0.024390243902439025	0	0.0	0	0.0	0	0.0	C	23.0	4.365655	0.82463	0.019108	2.33E-4	ENSG00000141086	ENST00000319955	.	.	.	4.86	2.88	0.33553	Peptidase cysteine/serine, trypsin-like (1);	0.415493	0.25472	N	0.030421	T	0.28101	0.0693	N	0.08118	0	0.58432	D	0.999997	D	0.53462	0.96	P	0.56751	0.805	T	0.36866	-0.9730	9	0.72032	D	0.01	.	9.3066	0.37878	0.1448:0.7792:0.0:0.076	.	20	P40313	CTRL_HUMAN	S	20	.	ENSP00000322629:G20S	G	-	1	0	CTRL	66522600	0.986000	0.35501	0.076000	0.20297	0.048000	0.14542	2.919000	0.48836	0.465000	0.27167	0.655000	0.94253	GGC	C|0.994;T|0.006		0.612	CTRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268886.3		
RPL13	6137	hgsc.bcm.edu	37	16	89627671	89627671	+	Silent	SNP	C	C	T	rs174035	byFrequency	TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr16:89627671C>T	ENST00000393099.3	+	2	390	c.141C>T	c.(139-141)gcC>gcT	p.A47A	RPL13_ENST00000311528.5_Silent_p.A47A|RPL13_ENST00000452368.3_Silent_p.A47A|RPL13_ENST00000567815.1_Silent_p.A47A|SNORD68_ENST00000363214.1_RNA	NM_033251.2	NP_150254.1	P26373	RL13_HUMAN	ribosomal protein L13	47					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|cytosolic ribosome (GO:0022626)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			lung(3)|skin(1)|upper_aerodigestive_tract(2)	6		all_hematologic(23;0.0748)		all cancers(4;1.15e-07)|OV - Ovarian serous cystadenocarcinoma(4;7.8e-06)|BRCA - Breast invasive adenocarcinoma(80;0.0139)		GCCGCATCGCCCCGCGCCCCG	0.741													C|||	720	0.14377	0.1256	0.1282	5008	,	,		12083	0.13		0.1839	False		,,,				2504	0.1524				p.A47A		.											.	RPL13-90	0			c.C141T						.	C	,	382,2954		24,334,1310	3.0	4.0	3.0		141,141	0.9	1.0	16	dbSNP_79	3	1125,5851		71,983,2434	no	coding-synonymous,coding-synonymous	RPL13	NM_000977.3,NM_033251.2	,	95,1317,3744	TT,TC,CC		16.1267,11.4508,14.614	,	47/212,47/212	89627671	1507,8805	1668	3488	5156	SO:0001819	synonymous_variant	6137	exon3			CATCGCCCCGCGC	AB007172	CCDS10979.1, CCDS58492.1	16q24.3	2011-04-06			ENSG00000167526	ENSG00000167526		"""L ribosomal proteins"""	10303	protein-coding gene	gene with protein product		113703				9582194	Standard	NM_000977		Approved	D16S444E, BBC1, L13	uc002fnm.2	P26373	OTTHUMG00000133770	ENST00000393099.3:c.141C>T	16.37:g.89627671C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_001243131	0	0	0	0	0	B4DLX3|F5H1S2|Q3KQT8|Q567Q8|Q9BPX0	Silent	SNP	ENST00000393099.3	37	CCDS10979.1																																																																																			C|0.846;T|0.154		0.741	RPL13-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258294.2	NM_000977	
MC1R	4157	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	89985902	89985902	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr16:89985902G>A	ENST00000555147.1	+	1	1616	c.236G>A	c.(235-237)tGc>tAc	p.C79Y	TUBB3_ENST00000554444.1_5'Flank|RP11-566K11.7_ENST00000570217.1_RNA|MC1R_ENST00000555427.1_Missense_Mutation_p.C79Y|TUBB3_ENST00000556922.1_Missense_Mutation_p.C79Y|RP11-566K11.4_ENST00000554623.1_RNA	NM_002386.3	NP_002377.4	Q01726	MSHR_HUMAN	melanocortin 1 receptor (alpha melanocyte stimulating hormone receptor)	79					G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|intracellular signal transduction (GO:0035556)|melanin biosynthetic process (GO:0042438)|multicellular organismal development (GO:0007275)|negative regulation of tumor necrosis factor production (GO:0032720)|pigmentation (GO:0043473)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of protein kinase A signaling (GO:0010739)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sensory perception of pain (GO:0019233)|UV protection (GO:0009650)|UV-damage excision repair (GO:0070914)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled peptide receptor activity (GO:0008528)|melanocortin receptor activity (GO:0004977)|melanocyte-stimulating hormone receptor activity (GO:0004980)|ubiquitin protein ligase binding (GO:0031625)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	11		all_cancers(9;1.69e-11)|Lung NSC(15;8.94e-06)|all_lung(18;1.39e-05)|all_neural(9;0.00581)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0273)		TTCATCTGCTGCCTGGCCTTG	0.662									Melanoma, Familial Clustering of																												p.C79Y		.											.	.	0			c.G236A						.						59.0	70.0	66.0					16																	89985902		2190	4281	6471	SO:0001583	missense	4157	exon1	Familial Cancer Database		TCTGCTGCCTGGC		CCDS56011.1	16q24.3	2012-10-05			ENSG00000258839	ENSG00000258839		"""GPCR / Class A : Melanocortin receptors"""	6929	protein-coding gene	gene with protein product		155555				8458079	Standard	NM_002386		Approved	MSH-R		Q01726		ENST00000555147.1:c.236G>A	16.37:g.89985902G>A	ENSP00000451605:p.Cys79Tyr	Somatic	113	0		WXS	Illumina GAIIx	Phase_I	123	57	NM_002386	0	0	0	0	0	Q66K38|Q6UR93|Q8WWX6|Q8WWX7|Q96I33|Q96RU4|Q9UBF7|Q9UN58|Q9UN59|Q9UN60|Q9UN61|Q9UN62	Missense_Mutation	SNP	ENST00000555147.1	37	CCDS56011.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.582047	0.86748	.	.	ENSG00000258947;ENSG00000258947;ENSG00000258839	ENST00000555427;ENST00000556922;ENST00000555147	T;T;T	0.02944	4.1;4.1;4.1	4.86	4.86	0.63082	GPCR, rhodopsin-like superfamily (1);	0.000000	0.41712	U	0.000825	T	0.21347	0.0514	M	0.91717	3.235	0.58432	D	0.999997	D	0.89917	1.0	D	0.85130	0.997	T	0.06917	-1.0800	9	.	.	.	.	16.9746	0.86309	0.0:0.0:1.0:0.0	.	79	Q01726	MSHR_HUMAN	Y	79	ENSP00000451760:C79Y;ENSP00000451560:C79Y;ENSP00000451605:C79Y	.	C	+	2	0	MC1R;RP11-566K11.2	88513403	1.000000	0.71417	1.000000	0.80357	0.893000	0.52053	7.759000	0.85235	2.255000	0.74692	0.455000	0.32223	TGC	.		0.662	MC1R-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412014.1	NM_002386	
FXR2	9513	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	7499311	7499311	+	Splice_Site	SNP	G	G	T			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr17:7499311G>T	ENST00000250113.7	-	8	996	c.662C>A	c.(661-663)aCa>aAa	p.T221K		NM_004860.3	NP_004851.2	P51116	FXR2_HUMAN	fragile X mental retardation, autosomal homolog 2	221						cytoplasm (GO:0005737)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(7)|lung(8)|prostate(1)	26				READ - Rectum adenocarcinoma(115;0.17)		CTGCTTGCTTGTCTGAAAGGA	0.498																																					p.T221K		.											.	.	0			c.C662A						.						128.0	123.0	125.0					17																	7499311		2033	4187	6220	SO:0001630	splice_region_variant	9513	exon8			TTGCTTGTCTGAA	U31501	CCDS45604.1	17p13.3	2014-09-17				ENSG00000129245			4024	protein-coding gene	gene with protein product		605339		FMR1L2		7489725, 9259278	Standard	NM_004860		Approved		uc002gia.2	P51116		ENST00000250113.7:c.661-1C>A	17.37:g.7499311G>T		Somatic	103	0		WXS	Illumina GAIIx	Phase_I	99	40	NM_004860	0	0	0	0	0	B2R9M2|D3DTQ1|Q86V09|Q8WUM2	Missense_Mutation	SNP	ENST00000250113.7	37	CCDS45604.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.025929	0.75390	.	.	ENSG00000129245	ENST00000250113	T	0.37235	1.21	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.28499	0.0705	L	0.36672	1.1	0.58432	D	0.999994	B;B	0.25390	0.125;0.077	B;B	0.20955	0.032;0.032	T	0.06770	-1.0808	10	0.56958	D	0.05	6.4649	10.5922	0.45316	0.0875:0.0:0.9125:0.0	.	221;221	Q86V09;P51116	.;FXR2_HUMAN	K	221	ENSP00000250113:T221K	ENSP00000250113:T221K	T	-	2	0	FXR2	7440036	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.684000	0.54671	2.719000	0.93026	0.555000	0.69702	ACA	.		0.498	FXR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441084.1		Missense_Mutation
RNF222	643904	hgsc.bcm.edu	37	17	8296383	8296383	+	Missense_Mutation	SNP	C	C	T	rs12601362	byFrequency	TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr17:8296383C>T	ENST00000399398.2	-	3	705	c.397G>A	c.(397-399)Gcc>Acc	p.A133T	RNF222_ENST00000344001.3_Missense_Mutation_p.A133T	NM_001146684.2	NP_001140156.1	A6NCQ9	RN222_HUMAN	ring finger protein 222	133						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			breast(1)	1						GGGAGCTGGGCGCTctggccc	0.721													C|||	918	0.183307	0.118	0.1657	5008	,	,		14126	0.1954		0.2346	False		,,,				2504	0.2188				p.A133T		.											.	RNF222-68	0			c.G397A						.	C	THR/ALA	123,941		12,99,421	2.0	4.0	3.0		397	-3.4	0.0	17	dbSNP_120	3	556,2088		72,412,838	no	missense	RNF222	NM_001146684.2	58	84,511,1259	TT,TC,CC		21.0287,11.5602,18.3118	benign	133/221	8296383	679,3029	532	1322	1854	SO:0001583	missense	643904	exon3			GCTGGGCGCTCTG		CCDS45608.1	17p13.1	2013-01-09			ENSG00000189051	ENSG00000189051		"""RING-type (C3HC4) zinc fingers"""	34517	protein-coding gene	gene with protein product							Standard	NM_001146684		Approved		uc010vuy.1	A6NCQ9	OTTHUMG00000132049	ENST00000399398.2:c.397G>A	17.37:g.8296383C>T	ENSP00000382330:p.Ala133Thr	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_001146684	0	0	0	0	0		Missense_Mutation	SNP	ENST00000399398.2	37	CCDS45608.1	416	0.19047619047619047	69	0.1402439024390244	68	0.1878453038674033	102	0.17832167832167833	177	0.23350923482849603	C	2.546	-0.305162	0.05495	0.115602	0.210287	ENSG00000189051	ENST00000344001;ENST00000399398	.	.	.	4.22	-3.43	0.04810	.	1.112540	0.06977	N	0.819153	T	0.00012	0.0000	N	0.14661	0.345	0.80722	P	0.0	B	0.06786	0.001	B	0.01281	0.0	T	0.34254	-0.9836	8	0.52906	T	0.07	-18.9555	2.2125	0.03951	0.1223:0.447:0.1198:0.3109	rs12601362	133	A6NCQ9	RN222_HUMAN	T	133	.	ENSP00000343799:A133T	A	-	1	0	RNF222	8237108	0.001000	0.12720	0.000000	0.03702	0.224000	0.24922	-0.068000	0.11561	-0.331000	0.08501	0.549000	0.68633	GCC	C|0.808;T|0.192		0.721	RNF222-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255072.2	NM_001146684.2	
CDC27	996	hgsc.bcm.edu;bcgsc.ca	37	17	45234300	45234300	+	Missense_Mutation	SNP	G	G	T	rs199588670		TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr17:45234300G>T	ENST00000066544.3	-	7	914	c.821C>A	c.(820-822)gCt>gAt	p.A274D	CDC27_ENST00000531206.1_Missense_Mutation_p.A274D|CDC27_ENST00000446365.2_Missense_Mutation_p.A213D|CDC27_ENST00000527547.1_Missense_Mutation_p.A274D|CDC27_ENST00000528748.1_5'Flank	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	274					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)	p.A274D(11)		NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						TGGACTAAGAGCTGCTGGTCC	0.363																																					p.A274D		.											.	CDC27-291	11	Substitution - Missense(11)	prostate(9)|skin(2)	c.C821A						.						61.0	65.0	63.0					17																	45234300		2201	4292	6493	SO:0001583	missense	996	exon7			CTAAGAGCTGCTG	U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.821C>A	17.37:g.45234300G>T	ENSP00000066544:p.Ala274Asp	Somatic	32	0		WXS	Illumina GAIIx	Phase_I	38	6	NM_001114091	0	0	0	0	0	G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	ENST00000066544.3	37	CCDS11509.1	.	.	.	.	.	.	.	.	.	.	G	18.35	3.604295	0.66445	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547;ENST00000526866	T;T;T;T;T	0.69175	-0.38;-0.38;-0.13;-0.38;0.68	5.64	5.64	0.86602	.	0.058237	0.64402	D	0.000002	T	0.64735	0.2625	N	0.24115	0.695	0.58432	D	0.999999	P;P;P;B	0.51351	0.704;0.886;0.944;0.363	B;P;P;B	0.51615	0.216;0.495;0.675;0.143	T	0.64685	-0.6349	10	0.40728	T	0.16	-20.3108	17.2083	0.86924	0.0:0.0:1.0:0.0	.	213;274;274;274	B4DL80;G5EA36;G3V1C4;P30260	.;.;.;CDC27_HUMAN	D	274;274;213;274;274	ENSP00000066544:A274D;ENSP00000434614:A274D;ENSP00000392802:A213D;ENSP00000437339:A274D;ENSP00000432105:A274D	ENSP00000066544:A274D	A	-	2	0	CDC27	42589299	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.260000	0.95568	2.665000	0.90641	0.460000	0.39030	GCT	.		0.363	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2		
SPHK1	8877	hgsc.bcm.edu;bcgsc.ca	37	17	74383432	74383434	+	In_Frame_Del	DEL	AGA	AGA	-			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	AGA	AGA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr17:74383432_74383434delAGA	ENST00000545180.1	+	8	1729_1731	c.920_922delAGA	c.(919-924)gagaag>gag	p.K308del	SPHK1_ENST00000592299.1_In_Frame_Del_p.K308del|SPHK1_ENST00000323374.4_In_Frame_Del_p.K394del|SPHK1_ENST00000590959.1_In_Frame_Del_p.K322del|SPHK1_ENST00000392496.3_In_Frame_Del_p.K308del			Q9NYA1	SPHK1_HUMAN	sphingosine kinase 1	308					'de novo' posttranslational protein folding (GO:0051084)|blood vessel development (GO:0001568)|brain development (GO:0007420)|calcium-mediated signaling (GO:0019722)|cellular protein metabolic process (GO:0044267)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to starvation (GO:0009267)|cyclooxygenase pathway (GO:0019371)|female pregnancy (GO:0007565)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|lipid phosphorylation (GO:0046834)|negative regulation of apoptotic process (GO:0043066)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of neuron projection development (GO:0010976)|positive regulation of neurotransmitter secretion (GO:0001956)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of smooth muscle contraction (GO:0045987)|protein folding (GO:0006457)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of interleukin-1 beta production (GO:0032651)|regulation of tumor necrosis factor-mediated signaling pathway (GO:0010803)|response to amine (GO:0014075)|response to ATP (GO:0033198)|response to interleukin-1 (GO:0070555)|response to magnesium ion (GO:0032026)|response to progesterone (GO:0032570)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingoid catabolic process (GO:0046521)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingosine metabolic process (GO:0006670)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|D-erythro-sphingosine kinase activity (GO:0017050)|diacylglycerol kinase activity (GO:0004143)|DNA binding (GO:0003677)|magnesium ion binding (GO:0000287)|NAD+ kinase activity (GO:0003951)|protein phosphatase 2A binding (GO:0051721)|sphinganine kinase activity (GO:0008481)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)	11					Fingolimod(DB08868)	CTGGCCATGGAGAAGGGCAGGCA	0.601																																					p.393_394del	GBM(90;966 1307 27369 33775 44498)	.											.	SPHK1-1107	0			c.1178_1180del						.																																			SO:0001651	inframe_deletion	8877	exon6			CCATGGAGAAGGG	BC030553	CCDS11744.1, CCDS45785.1, CCDS59297.1	17q25.2	2004-02-18				ENSG00000176170			11240	protein-coding gene	gene with protein product		603730				9726979	Standard	NM_182965		Approved	SPHK	uc002jrj.2	Q9NYA1		ENST00000545180.1:c.920_922delAGA	17.37:g.74383432_74383434delAGA	ENSP00000440970:p.Lys308del	Somatic	231	1		WXS	Illumina GAIIx	Phase_I	163	0	NM_182965	0	0	0	0	0	Q8N632|Q96GK1|Q9HD92|Q9NY70|Q9NYL3	In_Frame_Del	DEL	ENST00000545180.1	37	CCDS45785.1																																																																																			.		0.601	SPHK1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450113.1	NM_182965, NM_021972	
MYADML2	255275	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	79899111	79899111	+	Silent	SNP	G	G	A	rs569090810	byFrequency	TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr17:79899111G>A	ENST00000409745.2	-	3	861	c.507C>T	c.(505-507)atC>atT	p.I169I	AC137723.5_ENST00000415556.1_RNA|MYADML2_ENST00000330655.3_Silent_p.I169I	NM_001145113.2	NP_001138585.2	A6NDP7	MADL2_HUMAN	myeloid-associated differentiation marker-like 2	169	MARVEL 2. {ECO:0000255|PROSITE- ProRule:PRU00581}.					cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				endometrium(1)	1						AGGCCTGGACGATCTTGAGGA	0.687																																					p.I169I		.											.	MYADML2-68	0			c.C507T						.						18.0	28.0	25.0					17																	79899111		691	1590	2281	SO:0001819	synonymous_variant	255275	exon3			CTGGACGATCTTG	AC137723, BC029306	CCDS45815.1	17q25.3	2008-10-15			ENSG00000185105	ENSG00000185105			34548	protein-coding gene	gene with protein product							Standard	NM_001145113		Approved	LOC255275	uc010wvf.1	A6NDP7	OTTHUMG00000154388	ENST00000409745.2:c.507C>T	17.37:g.79899111G>A		Somatic	62	0		WXS	Illumina GAIIx	Phase_I	107	37	NM_001145113	0	0	0	0	0		Silent	SNP	ENST00000409745.2	37	CCDS45815.1																																																																																			.		0.687	MYADML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335008.2	XR_041347	
OSBPL1A	114876	ucsc.edu	37	18	21883679	21883679	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr18:21883679C>A	ENST00000319481.3	-	14	1302	c.1096G>T	c.(1096-1098)Gca>Tca	p.A366S	OSBPL1A_ENST00000357041.4_5'UTR	NM_080597.3	NP_542164.2	Q9BXW6	OSBL1_HUMAN	oxysterol binding protein-like 1A	366					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)	cholesterol binding (GO:0015485)|phospholipid binding (GO:0005543)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	36	all_cancers(21;0.000396)|all_epithelial(16;4.36e-06)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0505)|Ovarian(20;0.17)					CATGACTGTGCTTTCTGCAAA	0.318																																					p.A366S		.											.	OSBPL1A-94	0			c.G1096T						.						126.0	122.0	123.0					18																	21883679		2203	4300	6503	SO:0001583	missense	114876	exon14			ACTGTGCTTTCTG	AF392449, AF274714	CCDS11884.1, CCDS11885.1, CCDS56056.1	18q11.2	2014-06-03	2014-06-03	2014-06-03	ENSG00000141447	ENSG00000141447		"""Oxysterol binding proteins"", ""Ankyrin repeat domain containing"""	16398	protein-coding gene	gene with protein product		606730	"""oxysterol binding protein-like 1B"""	OSBPL1B		11279184, 10588946	Standard	NM_080597		Approved	ORP-1, ORP1	uc002kve.3	Q9BXW6	OTTHUMG00000131944	ENST00000319481.3:c.1096G>T	18.37:g.21883679C>A	ENSP00000320291:p.Ala366Ser	Somatic	59	0		WXS	Illumina GAIIx	Phase_I	39	4	NM_080597	0	0	0	0	0	B7Z7D3|Q9BZF5|Q9NW87	Missense_Mutation	SNP	ENST00000319481.3	37	CCDS11884.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.563390	0.86335	.	.	ENSG00000141447	ENST00000319481	T	0.47869	0.83	5.63	5.63	0.86233	.	0.427194	0.26594	N	0.023504	T	0.65481	0.2695	L	0.49455	1.56	0.80722	D	1	D;D	0.63880	0.978;0.993	P;D	0.72625	0.649;0.978	T	0.65734	-0.6096	10	0.66056	D	0.02	-12.2	19.2513	0.93926	0.0:1.0:0.0:0.0	.	366;366	B0YJ56;Q9BXW6	.;OSBL1_HUMAN	S	366	ENSP00000320291:A366S	ENSP00000320291:A366S	A	-	1	0	OSBPL1A	20137677	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	4.881000	0.63114	2.647000	0.89833	0.591000	0.81541	GCA	.		0.318	OSBPL1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254902.1	NM_080597	
EPG5	57724	hgsc.bcm.edu;broad.mit.edu	37	18	43508849	43508849	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr18:43508849C>T	ENST00000282041.5	-	13	2573	c.2539G>A	c.(2539-2541)Gac>Aac	p.D847N		NM_020964.2	NP_066015.2	Q9HCE0	EPG5_HUMAN	ectopic P-granules autophagy protein 5 homolog (C. elegans)	847					autophagic vacuole maturation (GO:0097352)|autophagy (GO:0006914)|endocytic recycling (GO:0032456)					NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(35)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	95						CCAACCTGGTCAATGGTCTCT	0.398																																					p.D847N		.											.	EPG5-580	0			c.G2539A						.						104.0	96.0	98.0					18																	43508849		1845	4099	5944	SO:0001583	missense	57724	exon13			CCTGGTCAATGGT	AK023817	CCDS11926.2	18q12.3	2011-03-02	2011-03-02	2011-03-02	ENSG00000152223	ENSG00000152223			29331	protein-coding gene	gene with protein product		615068	"""KIAA1632"""	KIAA1632		10997877, 20550938	Standard	XM_005258323		Approved	hEPG5	uc002lbm.3	Q9HCE0	OTTHUMG00000132626	ENST00000282041.5:c.2539G>A	18.37:g.43508849C>T	ENSP00000282041:p.Asp847Asn	Somatic	49	0		WXS	Illumina GAIIx	Phase_I	43	4	NM_020964	0	0	0	0	0	A2BDF3|Q9H8C8	Missense_Mutation	SNP	ENST00000282041.5	37	CCDS11926.2	.	.	.	.	.	.	.	.	.	.	C	18.22	3.576242	0.65878	.	.	ENSG00000152223	ENST00000282041	T	0.11495	2.77	6.17	6.17	0.99709	.	1.026280	0.07656	N	0.932774	T	0.20414	0.0491	L	0.38531	1.155	0.45194	D	0.9982	P;P	0.46142	0.873;0.873	P;P	0.47346	0.544;0.544	T	0.21552	-1.0242	10	0.52906	T	0.07	-20.6854	20.8794	0.99867	0.0:1.0:0.0:0.0	.	847;847	Q9HCE0-2;Q9HCE0	.;EPG5_HUMAN	N	847	ENSP00000282041:D847N	ENSP00000282041:D847N	D	-	1	0	EPG5	41762847	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.832000	0.62759	2.941000	0.99782	0.655000	0.94253	GAC	.		0.398	EPG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445081.1	NM_020964	
POLI	11201	broad.mit.edu	37	18	51795958	51795960	+	In_Frame_Del	DEL	CGA	CGA	-	rs78943519|rs10584411|rs3729509	byFrequency	TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr18:51795958_51795960delCGA	ENST00000579534.1	+	1	185_187	c.42_44delCGA	c.(40-45)ggcgac>ggc	p.D17del	POLI_ENST00000406285.3_In_Frame_Del_p.D17del|POLI_ENST00000579434.1_5'UTR|POLI_ENST00000217800.5_5'Flank	NM_007195.2	NP_009126.2	Q9UNA4	POLI_HUMAN	polymerase (DNA directed) iota	17					DNA repair (GO:0006281)|DNA-dependent DNA replication (GO:0006261)	intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)	p.D17delD(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(10)|lung(5)|ovary(3)|urinary_tract(1)	26				Colorectal(16;0.0234)|READ - Rectum adenocarcinoma(59;0.197)		AAGGCGGCGGCGACGACGACGAG	0.729								DNA polymerases (catalytic subunits)						3926	0.783946	0.9705	0.6427	5008	,	,		12312	0.7054		0.7078	False		,,,				2504	0.7914				p.14_15del		.											.	POLI-229	1	Deletion - In frame(1)	large_intestine(1)	c.42_44del						.			3523,343		1644,235,54						1.5	0.0		dbSNP_119	14	5235,2405		1985,1265,570	no	coding	POLI	NM_007195.2		3629,1500,624	A1A1,A1R,RR		31.4791,8.8722,23.8832				8758,2748				SO:0001651	inframe_deletion	11201	exon1			CGGCGGCGACGAC		CCDS11954.2	18q21.1	2012-05-18			ENSG00000101751	ENSG00000101751		"""DNA polymerases"""	9182	protein-coding gene	gene with protein product		605252		RAD3OB, RAD30B		17609217	Standard	NM_007195		Approved		uc002lfj.4	Q9UNA4	OTTHUMG00000132704	ENST00000579534.1:c.42_44delCGA	18.37:g.51795967_51795969delCGA	ENSP00000462664:p.Asp17del	Somatic	4	0		WXS	Illumina GAIIx	Phase_I	46	17	NM_007195	0	0	0	0	0	Q8N590|Q9H0S1|Q9NYH6	In_Frame_Del	DEL	ENST00000579534.1	37	CCDS11954.2																																																																																			.		0.729	POLI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256002.3	NM_007195	
MADCAM1	8174	bcgsc.ca	37	19	501714	501714	+	Missense_Mutation	SNP	C	C	A	rs78071082	byFrequency	TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr19:501714C>A	ENST00000215637.3	+	4	759	c.713C>A	c.(712-714)cCg>cAg	p.P238Q	MADCAM1_ENST00000382683.4_Intron|AC005775.2_ENST00000592413.1_RNA|MADCAM1_ENST00000346144.4_Intron|MADCAM1_ENST00000587541.1_Missense_Mutation_p.P19Q	NM_130760.2	NP_570116.2	Q13477	MADCA_HUMAN	mucosal vascular addressin cell adhesion molecule 1	238	5.5 X 8 AA tandem repeats of [PS]-P-D-T- T-S-[QP]-E.|Mucin-like.				aging (GO:0007568)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|embryo development (GO:0009790)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|immune response (GO:0006955)|integrin-mediated signaling pathway (GO:0007229)|keratinocyte differentiation (GO:0030216)|leukocyte tethering or rolling (GO:0050901)|positive regulation of leukocyte migration (GO:0002687)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	integrin binding involved in cell-matrix adhesion (GO:0098640)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(4)|prostate(1)|skin(2)	10		all_cancers(10;4.25e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACCACCTCCCCGGAGTCTCCC	0.667																																					p.P238Q		.											.	MADCAM1-90	0			c.C713A						.						27.0	42.0	37.0					19																	501714		2202	4299	6501	SO:0001583	missense	8174	exon4			CCTCCCCGGAGTC	U43628	CCDS12028.1, CCDS12029.1	19p13.3	2013-01-11			ENSG00000099866	ENSG00000099866		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6765	protein-coding gene	gene with protein product	"""mucosal addressin cell adhesion molecule-1"""	102670				9162097, 8609404	Standard	NM_130762		Approved	MACAM1	uc002los.3	Q13477	OTTHUMG00000180548	ENST00000215637.3:c.713C>A	19.37:g.501714C>A	ENSP00000215637:p.Pro238Gln	Somatic	122	1		WXS	Illumina GAIIx	Phase_I	233	16	NM_130760	0	0	0	0	0	A5PKV4|B2RPL9|O60222|O75867|Q5UGI7	Missense_Mutation	SNP	ENST00000215637.3	37	CCDS12028.1	.	.	.	.	.	.	.	.	.	.	c	9.846	1.192318	0.21954	.	.	ENSG00000099866	ENST00000537731;ENST00000542525;ENST00000543297;ENST00000215637	T	0.11495	2.77	3.69	-3.39	0.04868	.	.	.	.	.	T	0.05181	0.0138	N	0.24115	0.695	0.09310	N	1	P	0.45078	0.85	B	0.40134	0.32	T	0.23084	-1.0198	9	0.34782	T	0.22	.	1.1525	0.01789	0.1428:0.3186:0.2805:0.2581	.	238	Q13477	MADCA_HUMAN	Q	262;254;246;238	ENSP00000215637:P238Q	ENSP00000215637:P238Q	P	+	2	0	MADCAM1	452714	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.794000	0.04584	-0.567000	0.06046	-0.145000	0.13849	CCG	A|0.000;C|1.000;T|0.000		0.667	MADCAM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451884.1	NM_130760	
MYO1F	4542	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	8604874	8604874	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr19:8604874C>T	ENST00000338257.8	-	16	1916	c.1649G>A	c.(1648-1650)gGa>gAa	p.G550E		NM_012335.3	NP_036467.2	O00160	MYO1F_HUMAN	myosin IF	550	Myosin motor.				defense response to Gram-positive bacterium (GO:0050830)|negative regulation of cell adhesion (GO:0007162)|neutrophil degranulation (GO:0043312)|positive regulation of cell migration (GO:0030335)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of innate immune response (GO:0045088)	cortical actin cytoskeleton (GO:0030864)|filamentous actin (GO:0031941)|unconventional myosin complex (GO:0016461)	actin binding (GO:0003779)|ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(7)|lung(13)|ovary(3)|prostate(3)|skin(3)|urinary_tract(1)	42						CTTCTTGTCTCCATCCAGCTT	0.622																																					p.G550E		.											.	MYO1F-93	0			c.G1649A						.						40.0	43.0	42.0					19																	8604874		1904	4119	6023	SO:0001583	missense	4542	exon16			TTGTCTCCATCCA	X98411	CCDS42494.1	19p13.3-p13.2	2011-09-27			ENSG00000142347	ENSG00000142347		"""Myosins / Myosin superfamily : Class I"""	7600	protein-coding gene	gene with protein product		601480				9119401, 8884266	Standard	NM_012335		Approved		uc002mkg.3	O00160	OTTHUMG00000156005	ENST00000338257.8:c.1649G>A	19.37:g.8604874C>T	ENSP00000344871:p.Gly550Glu	Somatic	52	0		WXS	Illumina GAIIx	Phase_I	69	12	NM_012335	0	0	0	0	0	Q8WWN7	Missense_Mutation	SNP	ENST00000338257.8	37	CCDS42494.1	.	.	.	.	.	.	.	.	.	.	C	8.260	0.811026	0.16537	.	.	ENSG00000142347	ENST00000305795;ENST00000338257	D	0.86432	-2.12	5.01	-4.21	0.03812	Myosin head, motor domain (2);	0.547159	0.17443	N	0.174047	T	0.68943	0.3056	N	0.20483	0.58	0.09310	N	1	B	0.06786	0.001	B	0.10450	0.005	T	0.59354	-0.7470	10	0.06099	T	0.92	.	8.469	0.32973	0.137:0.472:0.3911:0.0	.	550	O00160	MYO1F_HUMAN	E	595;550	ENSP00000344871:G550E	ENSP00000304899:G595E	G	-	2	0	MYO1F	8510874	0.000000	0.05858	0.085000	0.20634	0.917000	0.54804	0.379000	0.20585	-0.706000	0.05028	-1.058000	0.02302	GGA	.		0.622	MYO1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342716.2		
CACNA1A	773	hgsc.bcm.edu	37	19	13319693	13319693	+	Silent	SNP	A	A	G	rs16051	byFrequency	TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr19:13319693A>G	ENST00000360228.5	-	46	6656	c.6657T>C	c.(6655-6657)caT>caC	p.H2219H	CACNA1A_ENST00000573710.2_Silent_p.H2220H	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	2220	Poly-His.				adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	GGGGCGGGGGAtggtggtggt	0.731													g|||	3440	0.686901	0.7874	0.6081	5008	,	,		6615	0.7897		0.6252	False		,,,				2504	0.5644				p.H2220H		.											.	CACNA1A-67	0			c.T6660C						.		,,,,	2283,905		898,487,209	3.0	4.0	3.0		6675,6660,6657,6666,6675		1.0	19	dbSNP_54	3	3993,3127		1321,1351,888	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	CACNA1A	NM_000068.3,NM_001127221.1,NM_001127222.1,NM_001174080.1,NM_023035.2	,,,,	2219,1838,1097	GG,GA,AA		43.9185,28.3877,39.1153	,,,,	2225/2267,2220/2262,2219/2507,2222/2264,2225/2513	13319693	6276,4032	1594	3560	5154	SO:0001819	synonymous_variant	773	exon46			CGGGGGATGGTGG	U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.6657T>C	19.37:g.13319693A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	6	NM_001127221	0	0	0	0	0	J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Silent	SNP	ENST00000360228.5	37	CCDS45998.1																																																																																			A|0.360;G|0.640		0.731	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104062.2	NM_000068	
UQCRFS1	7386	hgsc.bcm.edu	37	19	29704002	29704002	+	Silent	SNP	T	T	C	rs11666764	byFrequency	TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr19:29704002T>C	ENST00000304863.4	-	1	446	c.24A>G	c.(22-24)tcA>tcG	p.S8S	CTB-32O4.2_ENST00000587859.1_lincRNA	NM_006003.2	NP_005994.2	P47985	UCRI_HUMAN	ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1	8					cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|response to antibiotic (GO:0046677)|response to drug (GO:0042493)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	2 iron, 2 sulfur cluster binding (GO:0051537)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			endometrium(4)|kidney(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Breast(6;0.0545)|Esophageal squamous(110;0.239)		Lung(7;0.092)			CGAACGGGCCTGAGCGGGATG	0.751													C|||	4781	0.954673	0.9433	0.9294	5008	,	,		9645	0.999		0.9195	False		,,,				2504	0.9785				p.S8S		.											.	UQCRFS1-226	0			c.A24G						.						1.0	2.0	2.0					19																	29704002		760	1811	2571	SO:0001819	synonymous_variant	7386	exon1			CGGGCCTGAGCGG	BC010035	CCDS12415.1	19q12	2011-07-04			ENSG00000169021	ENSG00000169021	1.10.2.2	"""Mitochondrial respiratory chain complex / Complex III"""	12587	protein-coding gene	gene with protein product	"""cytochrome b-c1 complex subunit 5"""	191327				8088805	Standard	NM_006003		Approved	RIS1, RIP1, UQCR5, RISP	uc002nsd.2	P47985		ENST00000304863.4:c.24A>G	19.37:g.29704002T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_006003	0	0	0	0	0	A8K519|Q6NVX5|Q9UPH2	Silent	SNP	ENST00000304863.4	37	CCDS12415.1																																																																																			T|0.072;C|0.928		0.751	UQCRFS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458563.1	NM_006003	
UQCRFS1	7386	hgsc.bcm.edu	37	19	29704010	29704010	+	Missense_Mutation	SNP	A	A	C	rs8100724	byFrequency	TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr19:29704010A>C	ENST00000304863.4	-	1	438	c.16T>G	c.(16-18)Tcc>Gcc	p.S6A	CTB-32O4.2_ENST00000587859.1_lincRNA	NM_006003.2	NP_005994.2	P47985	UCRI_HUMAN	ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1	6			S -> A (in dbSNP:rs8100724). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:2158323, ECO:0000269|PubMed:7721092}.		cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|response to antibiotic (GO:0046677)|response to drug (GO:0042493)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	2 iron, 2 sulfur cluster binding (GO:0051537)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			endometrium(4)|kidney(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Breast(6;0.0545)|Esophageal squamous(110;0.239)		Lung(7;0.092)			CCTGAGCGGGATGCTACCGAC	0.746													C|||	4777	0.953874	0.944	0.9265	5008	,	,		9603	0.999		0.9165	False		,,,				2504	0.9785				p.S6A		.											.	UQCRFS1-226	0			c.T16G						.						1.0	2.0	2.0					19																	29704010		816	1888	2704	SO:0001583	missense	7386	exon1			AGCGGGATGCTAC	BC010035	CCDS12415.1	19q12	2011-07-04			ENSG00000169021	ENSG00000169021	1.10.2.2	"""Mitochondrial respiratory chain complex / Complex III"""	12587	protein-coding gene	gene with protein product	"""cytochrome b-c1 complex subunit 5"""	191327				8088805	Standard	NM_006003		Approved	RIS1, RIP1, UQCR5, RISP	uc002nsd.2	P47985		ENST00000304863.4:c.16T>G	19.37:g.29704010A>C	ENSP00000306397:p.Ser6Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_006003	0	0	0	0	0	A8K519|Q6NVX5|Q9UPH2	Missense_Mutation	SNP	ENST00000304863.4	37	CCDS12415.1	2044	0.9358974358974359	461	0.9369918699186992	326	0.9005524861878453	569	0.9947552447552448	688	0.9076517150395779	C	0.037	-1.301919	0.01353	.	.	ENSG00000169021	ENST00000304863	T	0.36520	1.25	4.42	-0.0799	0.13708	Ubiquinol-cytochrome c reductase 8kDa, N-terminal (1);Globular protein, non-globular alpha/beta subunit (1);	0.198900	0.43579	N	0.000544	T	0.00012	0.0000	N	0.00707	-1.245	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.31696	-0.9934	9	0.02654	T	1	.	4.4059	0.11409	0.1479:0.436:0.0:0.4161	rs8100724;rs17856012;rs17856322;rs60176823;rs8100724	6	P47985	UCRI_HUMAN	A	6	ENSP00000306397:S6A	ENSP00000306397:S6A	S	-	1	0	UQCRFS1	34395850	0.363000	0.24989	0.510000	0.27712	0.005000	0.04900	0.594000	0.24014	-0.304000	0.08843	-1.900000	0.00529	TCC	A|0.065;C|0.935		0.746	UQCRFS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458563.1	NM_006003	
RGS9BP	388531	hgsc.bcm.edu	37	19	33167455	33167455	+	Missense_Mutation	SNP	G	G	T	rs259290	byFrequency	TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr19:33167455G>T	ENST00000334176.3	+	1	1143	c.286G>T	c.(286-288)Gcg>Tcg	p.A96S	ANKRD27_ENST00000306065.4_5'Flank|ANKRD27_ENST00000587352.1_5'Flank	NM_207391.2	NP_997274.2	Q6ZS82	R9BP_HUMAN	regulator of G protein signaling 9 binding protein	96			A -> S (in dbSNP:rs259290). {ECO:0000269|PubMed:14702039}.		detection of light stimulus involved in visual perception (GO:0050908)|negative regulation of signal transduction (GO:0009968)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)	integral component of membrane (GO:0016021)				central_nervous_system(1)|lung(2)	3	Esophageal squamous(110;0.137)					CATGCGACGCGCGCTGGAGCT	0.786													G|||	2178	0.434904	0.3805	0.4856	5008	,	,		10415	0.2579		0.6233	False		,,,				2504	0.4611				p.A96S		.											.	RGS9BP-90	0			c.G286T						.	G	SER/ALA	1584,1384		459,666,359	2.0	2.0	2.0		286	3.5	1.0	19	dbSNP_79	2	4397,1763		1670,1057,353	yes	missense	RGS9BP	NM_207391.2	99	2129,1723,712	TT,TG,GG		28.6201,46.6307,34.4763	possibly-damaging	96/236	33167455	5981,3147	1484	3080	4564	SO:0001583	missense	388531	exon1			CGACGCGCGCTGG	AW302149	CCDS12424.1	19q13.11	2008-02-05	2007-08-14			ENSG00000186326			30304	protein-coding gene	gene with protein product		607814	"""regulator of G protein signalling 9 binding protein"""			12119397, 8889548	Standard	NM_207391		Approved	FLJ45744, PERRS, R9AP, RGS9	uc002ntp.1	Q6ZS82		ENST00000334176.3:c.286G>T	19.37:g.33167455G>T	ENSP00000334134:p.Ala96Ser	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_207391	0	0	0	0	0	Q6ZVJ6	Missense_Mutation	SNP	ENST00000334176.3	37	CCDS12424.1	1007	0.4610805860805861	184	0.37398373983739835	188	0.5193370165745856	161	0.28146853146853146	474	0.6253298153034301	G	15.38	2.815844	0.50527	0.533693	0.713799	ENSG00000186326	ENST00000334176	T	0.33654	1.4	4.57	3.5	0.40072	.	0.065802	0.64402	U	0.000009	T	0.00012	0.0000	L	0.28115	0.83	0.20873	P	0.999831543	P	0.52170	0.951	P	0.50352	0.638	T	0.12528	-1.0544	9	0.35671	T	0.21	-21.6697	13.7833	0.63094	0.0:0.0:0.8453:0.1547	rs259290	96	Q6ZS82	R9BP_HUMAN	S	96	ENSP00000334134:A96S	ENSP00000334134:A96S	A	+	1	0	RGS9BP	37859295	1.000000	0.71417	1.000000	0.80357	0.125000	0.20455	4.816000	0.62642	1.092000	0.41356	0.313000	0.20887	GCG	G|0.540;T|0.460		0.786	RGS9BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450337.1	NM_207391	
ZNF296	162979	hgsc.bcm.edu	37	19	45579614	45579614	+	Silent	SNP	G	G	C			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr19:45579614G>C	ENST00000303809.2	-	1	232	c.18C>G	c.(16-18)gcC>gcG	p.A6A	GEMIN7_ENST00000591607.1_5'Flank|CTB-179K24.3_ENST00000586744.1_RNA|GEMIN7_ENST00000591747.1_5'Flank|GEMIN7_ENST00000270257.4_5'Flank|GEMIN7_ENST00000391951.2_5'Flank	NM_145288.1	NP_660331.1	Q8WUU4	ZN296_HUMAN	zinc finger protein 296	6					regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|lung(3)|prostate(1)|urinary_tract(2)	7						GCGCGCTGCCGGCCTTGCGGC	0.751																																					p.A6A		.											.	ZNF296-90	0			c.C18G						.						12.0	15.0	14.0					19																	45579614		1890	3737	5627	SO:0001819	synonymous_variant	162979	exon1			GCTGCCGGCCTTG	BC019352	CCDS12653.1	19q13.32	2013-01-08	2008-06-24	2008-06-24		ENSG00000170684		"""Zinc fingers, C2H2-type"""	15981	protein-coding gene	gene with protein product		613226	"""zinc finger protein 342"""	ZNF342		11063263, 14633674	Standard	NM_145288		Approved		uc002pao.3	Q8WUU4		ENST00000303809.2:c.18C>G	19.37:g.45579614G>C		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	9	8	NM_145288	0	0	0	0	0		Silent	SNP	ENST00000303809.2	37	CCDS12653.1																																																																																			.		0.751	ZNF296-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457529.1	NM_145288	
SYMPK	8189	broad.mit.edu	37	19	46321272	46321272	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr19:46321272T>G	ENST00000245934.7	-	23	3270	c.3026A>C	c.(3025-3027)tAc>tCc	p.Y1009S	SYMPK_ENST00000598155.1_5'UTR|RSPH6A_ENST00000221538.3_5'Flank|RSPH6A_ENST00000597055.1_5'Flank	NM_004819.2	NP_004810.2	Q92797	SYMPK_HUMAN	symplekin	1009					cell adhesion (GO:0007155)|mRNA polyadenylation (GO:0006378)|positive regulation of protein dephosphorylation (GO:0035307)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(25)|ovary(1)|urinary_tract(1)	45		all_neural(266;0.0299)|Ovarian(192;0.0308)		OV - Ovarian serous cystadenocarcinoma(262;0.00509)|GBM - Glioblastoma multiforme(486;0.0593)		CAGGCGGGGGTACATGGTCAG	0.637																																					p.Y1009S		.											.	SYMPK-91	0			c.A3026C						.						46.0	38.0	41.0					19																	46321272		2196	4295	6491	SO:0001583	missense	8189	exon23			CGGGGGTACATGG	U49240	CCDS12676.2	19q13.3	2008-02-05			ENSG00000125755	ENSG00000125755			22935	protein-coding gene	gene with protein product		602388				9330635	Standard	NM_004819		Approved	SYM, SPK	uc002pdn.3	Q92797	OTTHUMG00000150151	ENST00000245934.7:c.3026A>C	19.37:g.46321272T>G	ENSP00000245934:p.Tyr1009Ser	Somatic	85	9		WXS	Illumina GAIIx	Phase_I	118	23	NM_004819	0	0	0	0	0	O00521|O00689|O00733|Q59GT5|Q8N2U5	Missense_Mutation	SNP	ENST00000245934.7	37	CCDS12676.2	.	.	.	.	.	.	.	.	.	.	T	25.9	4.683927	0.88639	.	.	ENSG00000125755	ENST00000245934	T	0.65916	-0.18	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	T	0.80325	0.4602	M	0.85041	2.73	0.80722	D	1	D	0.76494	0.999	D	0.77557	0.99	D	0.83582	0.0118	10	0.72032	D	0.01	.	13.295	0.60292	0.0:0.0:0.0:1.0	.	1009	Q92797	SYMPK_HUMAN	S	1009	ENSP00000245934:Y1009S	ENSP00000245934:Y1009S	Y	-	2	0	SYMPK	51013112	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.467000	0.80930	2.039000	0.60335	0.454000	0.30748	TAC	.		0.637	SYMPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316581.1	NM_004819	
SPHK2	56848	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	49131974	49131974	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr19:49131974C>G	ENST00000245222.4	+	7	1275	c.909C>G	c.(907-909)aaC>aaG	p.N303K	SPHK2_ENST00000598088.1_Missense_Mutation_p.N303K|SPHK2_ENST00000600537.1_Missense_Mutation_p.N244K|SPHK2_ENST00000443164.1_Missense_Mutation_p.N365K|SPHK2_ENST00000340932.3_Intron|SPHK2_ENST00000599029.1_Missense_Mutation_p.N267K|SPHK2_ENST00000599748.1_Missense_Mutation_p.N267K	NM_001204158.2|NM_001243876.1|NM_020126.4	NP_001191087.1|NP_001230805.1|NP_064511.2	Q9NRA0	SPHK2_HUMAN	sphingosine kinase 2	303	DAGKc. {ECO:0000255|PROSITE- ProRule:PRU00783}.				blood vessel development (GO:0001568)|brain development (GO:0007420)|cell proliferation (GO:0008283)|lipid phosphorylation (GO:0046834)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell proliferation (GO:0008284)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|small molecule metabolic process (GO:0044281)|sphinganine-1-phosphate biosynthetic process (GO:0006669)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingosine metabolic process (GO:0006670)	cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	ATP binding (GO:0005524)|D-erythro-sphingosine kinase activity (GO:0017050)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)|Ras GTPase binding (GO:0017016)|sphinganine kinase activity (GO:0008481)			NS(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(4)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	19		all_lung(116;0.000125)|Lung NSC(112;0.000202)|all_epithelial(76;0.000283)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000102)|all cancers(93;0.000117)|GBM - Glioblastoma multiforme(486;0.00627)|Epithelial(262;0.0158)		TGTTGCTCAACTGCTCACTGT	0.617																																					p.N303K		.											.	SPHK2-658	0			c.C909G						.						81.0	77.0	78.0					19																	49131974		2203	4300	6503	SO:0001583	missense	56848	exon7			GCTCAACTGCTCA	AF245447	CCDS12727.1, CCDS59404.1, CCDS59405.1, CCDS74414.1	19q13.33	2013-09-20			ENSG00000063176	ENSG00000063176			18859	protein-coding gene	gene with protein product		607092				10751414, 17895250	Standard	NM_020126		Approved		uc002pjs.3	Q9NRA0	OTTHUMG00000183318	ENST00000245222.4:c.909C>G	19.37:g.49131974C>G	ENSP00000245222:p.Asn303Lys	Somatic	102	0		WXS	Illumina GAIIx	Phase_I	161	39	NM_020126	0	0	0	0	0	A0T4C8|B4DU87|Q9BRN1|Q9H0Q2|Q9NWU7	Missense_Mutation	SNP	ENST00000245222.4	37	CCDS12727.1	.	.	.	.	.	.	.	.	.	.	C	15.24	2.773470	0.49786	.	.	ENSG00000063176	ENST00000245222;ENST00000406269;ENST00000443164	T;T	0.12672	2.66;2.66	4.13	-0.434	0.12283	Diacylglycerol kinase, catalytic domain (2);	0.000000	0.85682	D	0.000000	T	0.17109	0.0411	L	0.56280	1.765	0.80722	D	1	B;D;D	0.56746	0.004;0.977;0.958	B;P;P	0.51324	0.027;0.666;0.575	T	0.02797	-1.1109	10	0.42905	T	0.14	-24.1036	8.0298	0.30459	0.0:0.6128:0.0:0.3872	.	244;365;303	B4DU87;A0T4C8;Q9NRA0	.;.;SPHK2_HUMAN	K	303;276;365	ENSP00000245222:N303K;ENSP00000413369:N365K	ENSP00000245222:N303K	N	+	3	2	SPHK2	53823786	1.000000	0.71417	0.999000	0.59377	0.984000	0.73092	1.437000	0.34991	0.160000	0.19432	-0.140000	0.14226	AAC	.		0.617	SPHK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466153.1		
NTN5	126147	hgsc.bcm.edu	37	19	49164952	49164952	+	Silent	SNP	A	A	G	rs281392	byFrequency	TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr19:49164952A>G	ENST00000270235.4	-	7	1547	c.1452T>C	c.(1450-1452)agT>agC	p.S484S	SEC1P_ENST00000430145.2_RNA	NM_145807.1	NP_665806.1	Q8WTR8	NET5_HUMAN	netrin 5	484						extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|pancreas(1)|prostate(1)	10						CCGGCCTGGGACTGGGTGTGG	0.687													G|||	2669	0.532947	0.351	0.4669	5008	,	,		9559	0.5625		0.6421	False		,,,				2504	0.683				p.S484S		.											.	NTN5-136	0			c.T1452C						.	G		1663,2349		390,883,733	9.0	9.0	9.0		1452	2.2	0.0	19	dbSNP_79	9	5217,2785		1816,1585,600	no	coding-synonymous	NTN5	NM_145807.1		2206,2468,1333	GG,GA,AA		34.8038,41.4506,42.7335		484/490	49164952	6880,5134	2006	4001	6007	SO:0001819	synonymous_variant	126147	exon7			CCTGGGACTGGGT		CCDS33068.1	19q13.33	2013-03-01			ENSG00000142233	ENSG00000142233		"""Netrins"""	25208	protein-coding gene	gene with protein product	"""Netrin-5"""					12477932	Standard	NM_145807		Approved		uc002pkb.3	Q8WTR8		ENST00000270235.4:c.1452T>C	19.37:g.49164952A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_145807	0	0	0	0	0	Q8N4X9|Q8WU63	Silent	SNP	ENST00000270235.4	37	CCDS33068.1																																																																																			A|0.464;G|0.536		0.687	NTN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466176.1	NM_145807	
KCNA7	3743	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	49573389	49573389	+	Silent	SNP	G	G	A	rs145070146		TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr19:49573389G>A	ENST00000221444.1	-	2	1657	c.1302C>T	c.(1300-1302)gaC>gaT	p.D434D		NM_031886.2	NP_114092.2	Q96RP8	KCNA7_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 7	434					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(4)|skin(2)	11		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_epithelial(76;3.83e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000397)|OV - Ovarian serous cystadenocarcinoma(262;0.000519)|GBM - Glioblastoma multiforme(486;0.00541)|Epithelial(262;0.0441)	Dalfampridine(DB06637)	GTACCTCCCCGTCCACCAGCC	0.622																																					p.D434D	Colon(74;686 1235 3793 23366 48562)	.											.	KCNA7-90	0			c.C1302T						.	G		0,4406		0,0,2203	75.0	71.0	72.0		1302	-0.8	0.0	19	dbSNP_134	72	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	KCNA7	NM_031886.2		0,2,6501	AA,AG,GG		0.0233,0.0,0.0154		434/457	49573389	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	3743	exon2			CTCCCCGTCCACC	AF315818	CCDS12755.1	19q13.3	2012-07-05				ENSG00000104848		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6226	protein-coding gene	gene with protein product		176268				16382104	Standard	NM_031886		Approved	Kv1.7, HAK6	uc002pmg.3	Q96RP8		ENST00000221444.1:c.1302C>T	19.37:g.49573389G>A		Somatic	145	0		WXS	Illumina GAIIx	Phase_I	192	39	NM_031886	0	0	0	0	0	A1KYX7|Q9BYS4	Silent	SNP	ENST00000221444.1	37	CCDS12755.1																																																																																			G|1.000;A|0.000		0.622	KCNA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466263.1	NM_031886	
KLK7	5650	hgsc.bcm.edu;bcgsc.ca	37	19	51485656	51485656	+	5'UTR	SNP	G	G	T			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr19:51485656G>T	ENST00000391807.1	-	0	101				KLK7_ENST00000595638.1_5'UTR|KLK7_ENST00000597707.1_Intron|KLK7_ENST00000336317.4_5'UTR|KLK7_ENST00000595820.1_5'UTR|CTB-147C22.9_ENST00000594512.1_RNA	NM_139277.2	NP_644806.1	P49862	KLK7_HUMAN	kallikrein-related peptidase 7						epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	epidermal lamellar body (GO:0097209)|extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(11)|ovary(2)	19		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00382)|GBM - Glioblastoma multiforme(134;0.00895)		ATCTTGCCATGGTGCCCTGCT	0.597																																					p.H43N		.											.	KLK7-650	0			c.C127A						.						45.0	36.0	39.0					19																	51485656		2203	4298	6501	SO:0001623	5_prime_UTR_variant	5650	exon2			TGCCATGGTGCCC	L33404	CCDS12812.1, CCDS59414.1	19q13.33	2011-09-07	2006-10-27			ENSG00000169035		"""Kallikreins"", ""Serine peptidases / Serine peptidases"""	6368	protein-coding gene	gene with protein product		604438	"""kallikrein 7 (chymotryptic, stratum corneum)"""	PRSS6		8034709, 16800724, 16800723	Standard	NM_005046		Approved	SCCE	uc021uyj.1	P49862		ENST00000391807.1:c.-1C>A	19.37:g.51485656G>T		Somatic	63	0		WXS	Illumina GAIIx	Phase_I	65	4	NM_001243126	0	0	0	0	0	A8K0U5|Q8N5N9|Q8NFV7	Missense_Mutation	SNP	ENST00000391807.1	37	CCDS12812.1																																																																																			.		0.597	KLK7-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464344.1	NM_005046	
LILRA1	11024	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	55105904	55105904	+	Splice_Site	SNP	A	A	G			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr19:55105904A>G	ENST00000251372.3	+	3	216		c.e3-1		LILRB1_ENST00000396321.2_Intron|LILRB1_ENST00000448689.1_Intron|LILRB1_ENST00000418536.2_Intron|LILRA1_ENST00000473156.1_Splice_Site|LILRA1_ENST00000453777.1_Splice_Site	NM_006863.2	NP_006854.1	O75019	LIRA1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 1						cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)|regulation of immune response (GO:0050776)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|liver(1)|lung(23)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	47				GBM - Glioblastoma multiforme(193;0.0348)		ACTCTCTTCCAGGGCTGAGTC	0.652																																					.		.											.	LILRA1-93	0			c.35-2A>G						.						69.0	82.0	77.0					19																	55105904		2203	4300	6503	SO:0001630	splice_region_variant	11024	exon3			TCTTCCAGGGCTG	AF025530	CCDS12901.1, CCDS62802.1	19q13.4	2013-01-11			ENSG00000104974	ENSG00000104974		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6602	protein-coding gene	gene with protein product		604810				9548455	Standard	NM_006863		Approved	LIR-6, CD85i, LIR6	uc002qgh.2	O75019	OTTHUMG00000065701	ENST00000251372.3:c.35-1A>G	19.37:g.55105904A>G		Somatic	111	0		WXS	Illumina GAIIx	Phase_I	188	27	NM_006863	0	0	0	0	0	O75018|Q3MJA6	Splice_Site	SNP	ENST00000251372.3	37	CCDS12901.1	.	.	.	.	.	.	.	.	.	.	A	5.267	0.234711	0.09969	.	.	ENSG00000104974	ENST00000251372;ENST00000453777	.	.	.	2.42	2.42	0.29668	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.0728	0.25187	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	LILRA1	59797716	1.000000	0.71417	1.000000	0.80357	0.176000	0.22953	1.233000	0.32648	1.082000	0.41137	0.163000	0.16589	.	.		0.652	LILRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140807.2	NM_006863	Intron
LILRB1	10859	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	55144484	55144484	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr19:55144484G>T	ENST00000396331.1	+	8	1333	c.976G>T	c.(976-978)Gtc>Ttc	p.V326F	LILRB1_ENST00000396321.2_Missense_Mutation_p.V326F|LILRB1_ENST00000448689.1_Missense_Mutation_p.V326F|LILRB1_ENST00000418536.2_Missense_Mutation_p.V326F|LILRB1_ENST00000396327.3_Missense_Mutation_p.V326F|LILRB1_ENST00000396315.1_Missense_Mutation_p.V326F|LILRB1_ENST00000427581.2_Missense_Mutation_p.V362F|LILRB1_ENST00000324602.7_Missense_Mutation_p.V326F|LILRB1_ENST00000396317.1_Missense_Mutation_p.V326F|LILRB1_ENST00000434867.2_Missense_Mutation_p.V326F|LILRB1_ENST00000396332.4_Missense_Mutation_p.V326F	NM_006669.3	NP_006660.3	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1	326	Ig-like C2-type 4.				cellular response to lipopolysaccharide (GO:0071222)|defense response to virus (GO:0051607)|dendritic cell differentiation (GO:0097028)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|interferon-gamma production (GO:0032609)|interferon-gamma secretion (GO:0072643)|negative regulation of alpha-beta T cell activation (GO:0046636)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of CD8-positive, alpha-beta T cell activation (GO:2001186)|negative regulation of cell cycle (GO:0045786)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of endocytosis (GO:0045806)|negative regulation of interferon-beta secretion (GO:0035548)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-12 secretion (GO:2001183)|negative regulation of mononuclear cell proliferation (GO:0032945)|negative regulation of natural killer cell mediated cytotoxicity (GO:0045953)|negative regulation of osteoclast development (GO:2001205)|negative regulation of serotonin secretion (GO:0014063)|negative regulation of T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:2001189)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transforming growth factor-beta secretion (GO:2001202)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytolysis (GO:0045919)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of gamma-delta T cell activation involved in immune response (GO:2001193)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor internalization (GO:0031623)|regulation of immune response (GO:0050776)|response to virus (GO:0009615)|signal transduction (GO:0007165)|T cell proliferation involved in immune response (GO:0002309)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	HLA-A specific inhibitory MHC class I receptor activity (GO:0030107)|HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)|MHC class I protein binding (GO:0042288)|MHC class I receptor activity (GO:0032393)|protein homodimerization activity (GO:0042803)|protein phosphatase 1 binding (GO:0008157)|SH2 domain binding (GO:0042169)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(38)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	74				GBM - Glioblastoma multiforme(193;0.0188)		CTATGACAGAGTCTCCCTCTC	0.607										HNSCC(37;0.09)																											p.V326F		.											.	LILRB1-137	0			c.G976T						.						54.0	57.0	56.0					19																	55144484		2203	4300	6503	SO:0001583	missense	10859	exon7			GACAGAGTCTCCC	AF009220	CCDS42614.1, CCDS42615.1, CCDS42616.1, CCDS42617.1, CCDS62803.1	19q13.4	2013-01-11						"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6605	protein-coding gene	gene with protein product		604811				9285411, 9382880	Standard	XM_006726246		Approved	LIR-1, ILT2, MIR-7, CD85, LIR1, CD85j	uc002qgm.3	Q8NHL6		ENST00000396331.1:c.976G>T	19.37:g.55144484G>T	ENSP00000379622:p.Val326Phe	Somatic	102	0		WXS	Illumina GAIIx	Phase_I	184	41	NM_001081637	0	0	0	0	0	A2IXV4|A8MXT0|O75024|O75025|Q8NHJ9|Q8NHK0	Missense_Mutation	SNP	ENST00000396331.1	37	CCDS42617.1	.	.	.	.	.	.	.	.	.	.	C	6.207	0.406391	0.11754	.	.	ENSG00000104972	ENST00000396321;ENST00000418536;ENST00000448689;ENST00000396331;ENST00000396327;ENST00000324602;ENST00000434867;ENST00000396332;ENST00000427581;ENST00000396317;ENST00000396315	T;T;T;T;T;T;T;T;T;T;T	0.00745	5.75;5.75;5.75;5.75;5.75;5.75;5.75;5.75;5.75;5.75;5.75	2.25	2.25	0.28309	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.35040	N	0.003485	T	0.01287	0.0042	L	0.38531	1.155	0.09310	N	1	P;P;P;B;P	0.37083	0.581;0.481;0.581;0.352;0.537	B;B;B;B;P	0.47705	0.436;0.309;0.436;0.309;0.555	T	0.44544	-0.9321	10	0.87932	D	0	.	6.8213	0.23859	0.0:0.7058:0.2942:0.0	.	326;326;326;326;326	A8MVE2;Q8NHL6-3;A2IXV4;Q8NHL6-2;Q8NHL6	.;.;.;.;LIRB1_HUMAN	F	326;326;326;326;326;326;326;326;362;326;326	ENSP00000379614:V326F;ENSP00000391514:V326F;ENSP00000409968:V326F;ENSP00000379622:V326F;ENSP00000379618:V326F;ENSP00000315997:V326F;ENSP00000405243:V326F;ENSP00000379623:V326F;ENSP00000395004:V362F;ENSP00000379610:V326F;ENSP00000379608:V326F	ENSP00000315997:V326F	V	+	1	0	LILRB1	59836296	0.000000	0.05858	0.042000	0.18584	0.006000	0.05464	-0.934000	0.03955	0.291000	0.22468	-0.980000	0.02579	GTC	.		0.607	LILRB1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000140796.4		
KIR3DL1	3811	broad.mit.edu;ucsc.edu	37	19	55286648	55286648	+	Intron	SNP	G	G	T			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr19:55286648G>T	ENST00000538269.1	+	2	61				KIR3DL1_ENST00000541392.1_Intron|KIR2DL4_ENST00000396284.2_Intron|KIR3DL1_ENST00000402254.2_Intron|KIR2DL3_ENST00000434419.2_Intron|KIR2DL1_ENST00000336077.6_Missense_Mutation_p.Q134H|KIR2DL1_ENST00000291633.7_Missense_Mutation_p.Q134H|CTB-61M7.1_ENST00000400864.3_RNA			P43629	KI3L1_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1						immune response (GO:0006955)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	11				GBM - Glioblastoma multiforme(193;0.0192)		TCTCAGCCCAGCTGGGCCCCA	0.557																																					p.Q134H		.											.	KIR2DL1-90	0			c.G402T						.						71.0	59.0	63.0					19																	55286648		1942	3923	5865	SO:0001627	intron_variant	3802	exon4			AGCCCAGCTGGGC	L41269	CCDS42621.1	19q13.4	2014-05-22			ENSG00000167633	ENSG00000167633		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6338	protein-coding gene	gene with protein product		604946		KIR		7716543, 7749980	Standard	NM_013289		Approved	cl-2, NKB1, cl-11, nkat3, NKB1B, AMB11, CD158e1/2, CD158E1, CD158e2		P43629	OTTHUMG00000065933	ENST00000538269.1:c.35-42341G>T	19.37:g.55286648G>T		Somatic	48	0		WXS	Illumina GAIIx	Phase_I	60	9	NM_014218	0	0	0	0	0	O43473|Q14946|Q16541	Missense_Mutation	SNP	ENST00000538269.1	37		.	.	.	.	.	.	.	.	.	.	G	11.64	1.697492	0.30142	.	.	ENSG00000125498	ENST00000336077;ENST00000291633	T;T	0.00753	5.74;5.74	0.929	0.929	0.19449	.	.	.	.	.	T	0.01976	0.0062	M	0.64404	1.975	0.09310	N	1	B;D	0.71674	0.09;0.998	B;P	0.57204	0.034;0.815	T	0.48896	-0.8994	9	0.87932	D	0	.	5.2086	0.15304	0.0:0.0:1.0:0.0	.	134;134	Q6IST4;Q6H2H3	.;.	H	134	ENSP00000336769:Q134H;ENSP00000291633:Q134H	ENSP00000291633:Q134H	Q	+	3	2	KIR2DL1	59978460	0.002000	0.14202	0.004000	0.12327	0.112000	0.19704	1.069000	0.30641	0.795000	0.33922	0.184000	0.17185	CAG	.		0.557	KIR3DL1-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_013289	
ZNF671	79891	broad.mit.edu	37	19	58232936	58232936	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr19:58232936A>C	ENST00000317398.6	-	4	613	c.518T>G	c.(517-519)tTg>tGg	p.L173W	ZNF671_ENST00000335820.3_Missense_Mutation_p.L75W|AC003006.7_ENST00000599221.1_Intron|AC003006.7_ENST00000594684.1_Intron|ZNF671_ENST00000594803.1_5'Flank	NM_024833.2	NP_079109.2	Q8TAW3	ZN671_HUMAN	zinc finger protein 671	173					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(6)|liver(1)|lung(7)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	22		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		GGTATCTTTCAATATTGGGCC	0.478																																					p.L173W		.											.	ZNF671-91	0			c.T518G						.						147.0	141.0	143.0					19																	58232936		2203	4300	6503	SO:0001583	missense	79891	exon4			TCTTTCAATATTG		CCDS12961.1	19q13.43	2013-01-08				ENSG00000083814		"""Zinc fingers, C2H2-type"", ""-"""	26279	protein-coding gene	gene with protein product	"""hypothetical protein FLJ23506"""					12477932	Standard	NM_024833		Approved	FLJ23506	uc002qpz.4	Q8TAW3		ENST00000317398.6:c.518T>G	19.37:g.58232936A>C	ENSP00000321848:p.Leu173Trp	Somatic	178	0		WXS	Illumina GAIIx	Phase_I	238	4	NM_024833	0	0	0	0	0	A6NF07|Q9H5E9	Missense_Mutation	SNP	ENST00000317398.6	37	CCDS12961.1	.	.	.	.	.	.	.	.	.	.	A	12.24	1.879201	0.33162	.	.	ENSG00000083814	ENST00000317398;ENST00000335820	T;T	0.30448	1.53;1.53	1.79	1.79	0.24919	.	.	.	.	.	T	0.28566	0.0707	L	0.61036	1.89	0.09310	N	1	B	0.12630	0.006	B	0.16289	0.015	T	0.30475	-0.9977	9	0.72032	D	0.01	.	5.6205	0.17455	1.0:0.0:0.0:0.0	.	173	Q8TAW3	ZN671_HUMAN	W	173;75	ENSP00000321848:L173W;ENSP00000338670:L75W	ENSP00000321848:L173W	L	-	2	0	ZNF671	62924748	0.001000	0.12720	0.022000	0.16811	0.717000	0.41224	0.634000	0.24614	1.076000	0.40961	0.383000	0.25322	TTG	.		0.478	ZNF671-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466817.1	NM_024833	
ATAD2B	54454	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	24086377	24086377	+	Silent	SNP	G	G	C			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr2:24086377G>C	ENST00000238789.5	-	12	1696	c.1353C>G	c.(1351-1353)gcC>gcG	p.A451A		NM_001242338.1|NM_017552.2	NP_001229267.1|NP_060022.1	Q9ULI0	ATD2B_HUMAN	ATPase family, AAA domain containing 2B	451						nucleus (GO:0005634)	ATP binding (GO:0005524)|lysine-acetylated histone binding (GO:0070577)			central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTAATGCTCTGGCAACCAAGG	0.393																																					p.A451A		.											.	ATAD2B-68	0			c.C1353G						.						32.0	30.0	31.0					2																	24086377		1835	4085	5920	SO:0001819	synonymous_variant	54454	exon12			TGCTCTGGCAACC	AB033066	CCDS46227.1	2p24.1-p23.3	2010-04-21		2007-02-08	ENSG00000119778	ENSG00000119778		"""ATPases / AAA-type"""	29230	protein-coding gene	gene with protein product		615347					Standard	XM_005264372		Approved	KIAA1240	uc002rek.4	Q9ULI0	OTTHUMG00000151902	ENST00000238789.5:c.1353C>G	2.37:g.24086377G>C		Somatic	113	0		WXS	Illumina GAIIx	Phase_I	99	49	NM_001242338	0	0	0	0	0	B9ZVQ5|Q6ZNA6|Q8N9E7	Silent	SNP	ENST00000238789.5	37	CCDS46227.1	.	.	.	.	.	.	.	.	.	.	G	9.099	1.003717	0.19121	.	.	ENSG00000119778	ENST00000366438	.	.	.	5.35	4.46	0.54185	.	.	.	.	.	T	0.53126	0.1777	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51474	-0.8701	4	.	.	.	.	4.7375	0.12995	0.2073:0.0:0.625:0.1677	.	.	.	.	R	73	.	.	P	-	2	0	ATAD2B	23939881	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	1.246000	0.32803	1.369000	0.46134	0.563000	0.77884	CCA	.		0.393	ATAD2B-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324333.1	NM_017552	
ALK	238	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	29445209	29445209	+	Splice_Site	SNP	C	C	T			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr2:29445209C>T	ENST00000389048.3	-	22	4422		c.e22+1		ALK_ENST00000431873.1_Intron	NM_004304.4	NP_004295.2	Q9UM73	ALK_HUMAN	anaplastic lymphoma receptor tyrosine kinase						activation of MAPK activity (GO:0000187)|cell proliferation (GO:0008283)|neuron development (GO:0048666)|NIK/NF-kappaB signaling (GO:0038061)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|protein complex (GO:0043234)	ATP binding (GO:0005524)|NF-kappaB-inducing kinase activity (GO:0004704)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ATIC/ALK(24)|FN1/ALK(2)|C2orf44/ALK(2)|TPM3/ALK(33)|KLC1/ALK(2)|VCL/ALK(4)|TPM4/ALK(12)|KIF5B/ALK(8)|RANBP2/ALK(34)|SQSTM1/ALK(2)|EML4/ALK(543)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|NPM1/ALK(632)|CLTC/ALK(44)|CARS/ALK(5)|MSN/ALK(6)|TFG/ALK(9)	NS(2)|autonomic_ganglia(198)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(4)|large_intestine(25)|lung(61)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|soft_tissue(3)|stomach(2)|thyroid(2)	340	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)|Crizotinib(DB08865)	TGTGGCTTTACCTGATGATCA	0.547			"""T, Mis, A"""	"""NPM1, TPM3, TFG, TPM4, ATIC, CLTC, MSN, ALO17, CARS, EML4, KIF5B, C2orf22"""	"""ALCL, NSCLC, Neuroblastoma"""	neuroblastoma			Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																												.		.	yes	Dom	yes	Familial neuroblastoma	2	2p23	238	anaplastic lymphoma kinase (Ki-1)		"""L, E, M"""	.	ALK-3833	0			c.3515+1G>A						.						85.0	93.0	90.0					2																	29445209		2203	4300	6503	SO:0001630	splice_region_variant	238	exon23	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	GCTTTACCTGATG	D45915	CCDS33172.1	2p23	2014-09-17	2008-01-23		ENSG00000171094	ENSG00000171094		"""CD molecules"""	427	protein-coding gene	gene with protein product		105590	"""anaplastic lymphoma kinase (Ki-1)"""			8122112	Standard	NM_004304		Approved	CD246	uc002rmy.3	Q9UM73	OTTHUMG00000152034	ENST00000389048.3:c.3515+1G>A	2.37:g.29445209C>T		Somatic	69	0		WXS	Illumina GAIIx	Phase_I	48	15	NM_004304	0	0	0	0	0	Q4ZFX9|Q53QQ6|Q53RZ4|Q59FI3|Q9Y4K6	Splice_Site	SNP	ENST00000389048.3	37	CCDS33172.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.415475	0.83449	.	.	ENSG00000171094	ENST00000389048;ENST00000453137	.	.	.	5.39	5.39	0.77823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.1739	0.93594	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ALK	29298713	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	7.810000	0.86072	2.532000	0.85374	0.555000	0.69702	.	.		0.547	ALK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324994.1	NM_004304	Intron
POLR1A	25885	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	86315734	86315734	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr2:86315734C>T	ENST00000263857.6	-	6	1063	c.685G>A	c.(685-687)Gcc>Acc	p.A229T	POLR1A_ENST00000409681.1_Missense_Mutation_p.A229T			O95602	RPA1_HUMAN	polymerase (RNA) I polypeptide A, 194kDa	229					gene expression (GO:0010467)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase I complex (GO:0005736)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	63						TGCACCATGGCTGGAAACGTG	0.557																																					p.A229T		.											.	POLR1A-93	0			c.G685A						.						126.0	119.0	121.0					2																	86315734		2041	4190	6231	SO:0001583	missense	25885	exon6			CCATGGCTGGAAA	AK025568	CCDS42706.1	2p11.2	2013-01-21			ENSG00000068654	ENSG00000068654		"""RNA polymerase subunits"""	17264	protein-coding gene	gene with protein product						9236775	Standard	NM_015425		Approved	DKFZP586M0122, FLJ21915, RPO1-4, RPA1	uc002sqs.3	O95602	OTTHUMG00000153165	ENST00000263857.6:c.685G>A	2.37:g.86315734C>T	ENSP00000263857:p.Ala229Thr	Somatic	95	1		WXS	Illumina GAIIx	Phase_I	125	37	NM_015425	0	0	0	0	0	B7Z7T0|D6W5M0|Q0VG05|Q9UEH0|Q9UFT9	Missense_Mutation	SNP	ENST00000263857.6	37	CCDS42706.1	.	.	.	.	.	.	.	.	.	.	C	15.19	2.761154	0.49468	.	.	ENSG00000068654	ENST00000263857;ENST00000409681	T;T	0.22336	1.96;1.96	6.17	3.39	0.38822	RNA polymerase Rpb1, domain 1 (1);	0.476807	0.24962	N	0.034213	T	0.15392	0.0371	L	0.38531	1.155	0.09310	N	1	B;B	0.25206	0.12;0.001	B;B	0.33196	0.159;0.006	T	0.28618	-1.0038	10	0.23302	T	0.38	-14.0917	4.2497	0.10689	0.2776:0.5052:0.0:0.2172	.	229;229	B9ZVN9;O95602	.;RPA1_HUMAN	T	229	ENSP00000263857:A229T;ENSP00000386300:A229T	ENSP00000263857:A229T	A	-	1	0	POLR1A	86169245	.	.	0.821000	0.32701	0.946000	0.59487	.	.	0.464000	0.27142	-0.140000	0.14226	GCC	.		0.557	POLR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329830.2	NM_015425	
GPAT2	150763	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	96697819	96697819	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr2:96697819C>G	ENST00000434632.1	-	4	598	c.139G>C	c.(139-141)Gtg>Ctg	p.V47L	GPAT2_ENST00000453542.1_Missense_Mutation_p.V47L|GPAT2_ENST00000359548.4_Missense_Mutation_p.V47L|GPAT2_ENST00000377137.3_Missense_Mutation_p.V47L|GPAT2_ENST00000488515.1_5'Flank			Q6NUI2	GPAT2_HUMAN	glycerol-3-phosphate acyltransferase 2, mitochondrial	47					CDP-diacylglycerol biosynthetic process (GO:0016024)|glycerol-3-phosphate metabolic process (GO:0006072)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)			NS(1)|breast(1)|cervix(1)|endometrium(4)|large_intestine(1)|lung(5)|skin(3)	16						CAGCGACCCACAAAGGGGCGA	0.607																																					p.V47L		.											.	GPAT2-90	0			c.G139C						.						47.0	61.0	57.0					2																	96697819		1798	3956	5754	SO:0001583	missense	150763	exon3			GACCCACAAAGGG	BC042847	CCDS42714.1	2q11.2	2010-05-04			ENSG00000186281	ENSG00000186281			27168	protein-coding gene	gene with protein product	"""cancer/testis antigen 123"""					12477932	Standard	NM_207328		Approved	CT123	uc010yuf.1	Q6NUI2	OTTHUMG00000155208	ENST00000434632.1:c.139G>C	2.37:g.96697819C>G	ENSP00000389395:p.Val47Leu	Somatic	505	1		WXS	Illumina GAIIx	Phase_I	692	133	NM_207328	0	0	0	0	0	Q6P2E4|Q6ZNI3|Q6ZNI5|Q6ZWJ4	Missense_Mutation	SNP	ENST00000434632.1	37	CCDS42714.1	.	.	.	.	.	.	.	.	.	.	C	14.87	2.664453	0.47572	.	.	ENSG00000186281	ENST00000359548;ENST00000434632;ENST00000453542;ENST00000377137;ENST00000439254	T;T;T;T;T	0.41758	0.99;0.99;0.99;0.99;0.99	4.32	3.42	0.39159	.	0.140682	0.47852	D	0.000206	T	0.36276	0.0961	M	0.69358	2.11	0.25123	N	0.990622	B;P;B	0.34724	0.043;0.465;0.208	B;B;B	0.29716	0.031;0.106;0.106	T	0.38607	-0.9653	10	0.62326	D	0.03	-7.5468	7.5108	0.27573	0.0:0.8786:0.0:0.1214	.	47;47;47	E9PE95;Q6NUI2-3;Q6NUI2	.;.;GPAT2_HUMAN	L	47	ENSP00000352547:V47L;ENSP00000389395:V47L;ENSP00000393770:V47L;ENSP00000366341:V47L;ENSP00000401334:V47L	ENSP00000352547:V47L	V	-	1	0	GPAT2	96061546	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.578000	0.36525	1.154000	0.42482	0.546000	0.68486	GTG	.		0.607	GPAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338786.1	NM_207328	
AFF3	3899	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	100210195	100210195	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr2:100210195G>C	ENST00000409236.2	-	13	2040	c.1928C>G	c.(1927-1929)tCc>tGc	p.S643C	AFF3_ENST00000317233.4_Missense_Mutation_p.S643C|AFF3_ENST00000356421.2_Missense_Mutation_p.S668C|AFF3_ENST00000409579.1_Missense_Mutation_p.S668C			P51826	AFF3_HUMAN	AF4/FMR2 family, member 3	643					embryonic hindlimb morphogenesis (GO:0035116)|regulation of transcription, DNA-templated (GO:0006355)|response to tumor necrosis factor (GO:0034612)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)			NS(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(9)|kidney(4)|large_intestine(20)|liver(1)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(3)	86						GGTCACGGAGGAGCGCAGCTC	0.652																																					p.S668C		.											.	AFF3-230	0			c.C2003G						.						47.0	51.0	50.0					2																	100210195		2203	4300	6503	SO:0001583	missense	3899	exon14			ACGGAGGAGCGCA	U34360	CCDS33258.1, CCDS42723.1	2q11.2-q12	2008-02-05	2005-06-27	2005-06-27	ENSG00000144218	ENSG00000144218			6473	protein-coding gene	gene with protein product		601464	"""lymphoid nuclear protein related to AF4"""	LAF4		8662235, 8555498	Standard	XM_005263945		Approved	MLLT2-like	uc002taf.3	P51826	OTTHUMG00000153011	ENST00000409236.2:c.1928C>G	2.37:g.100210195G>C	ENSP00000387207:p.Ser643Cys	Somatic	60	1		WXS	Illumina GAIIx	Phase_I	92	18	NM_001025108	0	0	0	0	0	B7ZM46|B9EGL9|D3DVI6|Q53RD6|Q53S47|Q53SI6|Q53TB9|Q59F27|Q8IWJ5	Missense_Mutation	SNP	ENST00000409236.2	37	CCDS42723.1	.	.	.	.	.	.	.	.	.	.	G	12.06	1.823753	0.32237	.	.	ENSG00000144218	ENST00000317233;ENST00000356421;ENST00000409579;ENST00000409236;ENST00000433370;ENST00000444786;ENST00000432288	T;T;T;T	0.69306	-0.39;-0.39;-0.39;-0.39	4.87	3.99	0.46301	.	0.266584	0.26680	N	0.023047	T	0.59293	0.2183	L	0.55743	1.74	0.09310	N	1	B;B;B	0.16166	0.016;0.002;0.0	B;B;B	0.17433	0.018;0.003;0.003	T	0.56396	-0.7986	10	0.66056	D	0.02	.	8.4379	0.32797	0.0832:0.1538:0.7629:0.0	.	796;643;668	B7Z4I6;P51826;P51826-2	.;AFF3_HUMAN;.	C	643;668;668;643;643;796;668	ENSP00000317421:S643C;ENSP00000348793:S668C;ENSP00000386834:S668C;ENSP00000387207:S643C	ENSP00000317421:S643C	S	-	2	0	AFF3	99576627	.	.	0.394000	0.26270	0.927000	0.56198	.	.	1.196000	0.43129	0.561000	0.74099	TCC	.		0.652	AFF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328982.3	NM_002285	
IL18R1	8809	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	103006523	103006523	+	Missense_Mutation	SNP	G	G	T	rs149204147		TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr2:103006523G>T	ENST00000409599.1	+	10	1313	c.957G>T	c.(955-957)atG>atT	p.M319I	IL18R1_ENST00000233957.1_Missense_Mutation_p.M319I			Q13478	IL18R_HUMAN	interleukin 18 receptor 1	319					immune response (GO:0006955)|natural killer cell activation (GO:0030101)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|signal transduction (GO:0007165)|T-helper 1 cell differentiation (GO:0045063)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-1 receptor activity (GO:0004908)|interleukin-18 receptor activity (GO:0042008)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|large_intestine(11)|lung(12)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34						TAGCAGACATGGCTGATATCC	0.408																																					p.M319I		.											.	IL18R1-93	0			c.G957T						.						154.0	132.0	140.0					2																	103006523		2203	4300	6503	SO:0001583	missense	8809	exon8			AGACATGGCTGAT	U43672	CCDS2060.1	2q12	2013-01-29			ENSG00000115604	ENSG00000115604		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5988	protein-coding gene	gene with protein product		604494				8626725, 10191101	Standard	NM_003855		Approved	IL1RRP, IL-1Rrp, CD218a	uc010fiy.3	Q13478	OTTHUMG00000130780	ENST00000409599.1:c.957G>T	2.37:g.103006523G>T	ENSP00000387211:p.Met319Ile	Somatic	116	0		WXS	Illumina GAIIx	Phase_I	113	34	NM_003855	0	0	0	0	0	B2R9Y5|Q52LC9	Missense_Mutation	SNP	ENST00000409599.1	37	CCDS2060.1	.	.	.	.	.	.	.	.	.	.	G	9.602	1.128940	0.21041	.	.	ENSG00000115604	ENST00000410040;ENST00000409599;ENST00000233957	T;T;T	0.01414	4.92;4.92;4.92	5.78	0.829	0.18847	.	1.813580	0.02739	N	0.116068	T	0.01353	0.0044	L	0.31752	0.955	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.49551	-0.8928	10	0.20519	T	0.43	.	1.2668	0.02013	0.4294:0.1047:0.2564:0.2095	.	318;319	B7ZKV7;Q13478	.;IL18R_HUMAN	I	319	ENSP00000386663:M319I;ENSP00000387211:M319I;ENSP00000233957:M319I	ENSP00000233957:M319I	M	+	3	0	IL18R1	102372955	0.000000	0.05858	0.000000	0.03702	0.320000	0.28249	0.007000	0.13174	-0.076000	0.12775	0.655000	0.94253	ATG	G|1.000;A|0.000		0.408	IL18R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253294.2	NM_003855	
FBLN7	129804	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	112944994	112944994	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr2:112944994G>C	ENST00000331203.2	+	8	1502	c.1231G>C	c.(1231-1233)Gac>Cac	p.D411H	FBLN7_ENST00000409450.3_Missense_Mutation_p.D365H|FBLN7_ENST00000409903.1_Missense_Mutation_p.W326C|FBLN7_ENST00000409667.3_Missense_Mutation_p.D277H	NM_001128165.1|NM_153214.2	NP_001121637.1|NP_694946.2	Q53RD9	FBLN7_HUMAN	fibulin 7	411					cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17						GCTGGAGGTGGACGTCGACAT	0.587																																					p.D411H		.											.	FBLN7-69	0			c.G1231C						.						117.0	109.0	112.0					2																	112944994		2203	4300	6503	SO:0001583	missense	129804	exon8			GAGGTGGACGTCG		CCDS2095.1, CCDS46391.1	2q13	2010-06-15			ENSG00000144152	ENSG00000144152		"""Fibulins"""	26740	protein-coding gene	gene with protein product		611551				17699513	Standard	NM_153214		Approved	FLJ37440, TM14	uc002tho.1	Q53RD9	OTTHUMG00000153267	ENST00000331203.2:c.1231G>C	2.37:g.112944994G>C	ENSP00000331411:p.Asp411His	Somatic	56	1		WXS	Illumina GAIIx	Phase_I	88	30	NM_153214	0	0	0	0	0	A0JNV1|A0JNV2|Q5H9P5|Q8N9G0	Missense_Mutation	SNP	ENST00000331203.2	37	CCDS2095.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	32|32	5.119626|5.119626	0.94385|0.94385	.|.	.|.	ENSG00000144152|ENSG00000144152	ENST00000331203;ENST00000409667;ENST00000409450;ENST00000272559|ENST00000409903	T;T;T;T|T	0.44881|0.79845	0.91;0.91;0.91;0.91|-1.31	5.16|5.16	5.16|5.16	0.70880|0.70880	.|.	0.048364|.	0.85682|.	D|.	0.000000|.	D|D	0.83275|0.83275	0.5219|0.5219	L|L	0.49126|0.49126	1.545|1.545	0.80722|0.80722	D|D	1|1	D;D;D|D	0.71674|0.69078	0.99;0.997;0.998|0.997	P;D;P|P	0.65987|0.52710	0.875;0.94;0.868|0.707	T|T	0.82812|0.82812	-0.0272|-0.0272	10|9	0.87932|0.38643	D|T	0|0.18	-27.2086|-27.2086	18.645|18.645	0.91407|0.91407	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	277;365;411|326	Q53RD9-4;Q53RD9-2;Q53RD9|B8ZZC1	.;.;FBLN7_HUMAN|.	H|C	411;277;365;233|326	ENSP00000331411:D411H;ENSP00000386822:D277H;ENSP00000387000:D365H;ENSP00000272559:D233H|ENSP00000386295:W326C	ENSP00000272559:D233H|ENSP00000386295:W326C	D|W	+|+	1|3	0|0	FBLN7|FBLN7	112661465|112661465	1.000000|1.000000	0.71417|0.71417	0.988000|0.988000	0.46212|0.46212	0.991000|0.991000	0.79684|0.79684	7.529000|7.529000	0.81952|0.81952	2.396000|2.396000	0.81511|0.81511	0.561000|0.561000	0.74099|0.74099	GAC|TGG	.		0.587	FBLN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330505.1	NM_153214	
CLASP1	23332	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	122205879	122205879	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr2:122205879T>A	ENST00000263710.4	-	18	2103	c.1714A>T	c.(1714-1716)Agt>Tgt	p.S572C	CLASP1_ENST00000455322.2_Missense_Mutation_p.S572C|CLASP1_ENST00000409078.3_Missense_Mutation_p.S572C|CLASP1_ENST00000545861.1_Missense_Mutation_p.S340C|CLASP1_ENST00000397587.3_Missense_Mutation_p.S572C|CLASP1_ENST00000541377.1_Missense_Mutation_p.S572C|CLASP1_ENST00000541859.1_Missense_Mutation_p.S341C	NM_015282.2	NP_056097.1	Q7Z460	CLAP1_HUMAN	cytoplasmic linker associated protein 1	572	Ser-rich.				axon guidance (GO:0007411)|cell division (GO:0051301)|establishment of spindle orientation (GO:0051294)|establishment or maintenance of cell polarity (GO:0007163)|exit from mitosis (GO:0010458)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule anchoring (GO:0034453)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|microtubule nucleation (GO:0007020)|microtubule organizing center organization (GO:0031023)|mitotic cell cycle (GO:0000278)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of microtubule polymerization or depolymerization (GO:0031111)	cell cortex (GO:0005938)|centrosomal corona (GO:0031592)|centrosome (GO:0005813)|cortical microtubule cytoskeleton (GO:0030981)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|membrane (GO:0016020)|spindle microtubule (GO:0005876)	kinetochore binding (GO:0043515)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)			NS(2)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(1)	47	Renal(3;0.0496)					CCAGTAGGACTTCTTTTGGCA	0.443																																					p.S572C		.											.	CLASP1-91	0			c.A1714T						.						100.0	103.0	102.0					2																	122205879		1940	4130	6070	SO:0001583	missense	23332	exon18			TAGGACTTCTTTT	AB014522		2q14.2-q14.3	2013-01-18			ENSG00000074054	ENSG00000074054			17088	protein-coding gene	gene with protein product	"""multiple asters 1"""	605852				9734811, 10899121, 16914514	Standard	NM_015282		Approved	KIAA0622, MAST1	uc002tnc.3	Q7Z460	OTTHUMG00000153331	ENST00000263710.4:c.1714A>T	2.37:g.122205879T>A	ENSP00000263710:p.Ser572Cys	Somatic	59	0		WXS	Illumina GAIIx	Phase_I	43	17	NM_001207051	0	0	0	0	0	B7ZLX3|O75118|Q2KHQ9|Q5H9P0|Q8N5B8|Q9BQT5	Missense_Mutation	SNP	ENST00000263710.4	37		.	.	.	.	.	.	.	.	.	.	T	29.1	4.974317	0.92919	.	.	ENSG00000074054	ENST00000263710;ENST00000455322;ENST00000397587;ENST00000541377;ENST00000541859;ENST00000409078;ENST00000545861	T;T;T;T;T;T	0.52754	1.95;1.98;1.97;1.97;0.65;1.99	6.16	6.16	0.99307	Armadillo-type fold (1);	0.149917	0.85682	D	0.000000	T	0.60051	0.2239	M	0.62723	1.935	0.58432	D	0.999994	D;D;D;P	0.63880	0.988;0.993;0.993;0.938	P;P;P;P	0.53360	0.533;0.724;0.533;0.619	T	0.63607	-0.6599	10	0.87932	D	0	-17.4911	16.8061	0.85666	0.0:0.0:0.0:1.0	.	572;572;572;572	E7EUA5;F5GWS0;B7ZLX3;Q7Z460	.;.;.;CLAP1_HUMAN	C	572;572;572;572;341;572;340	ENSP00000263710:S572C;ENSP00000389372:S572C;ENSP00000380717:S572C;ENSP00000441625:S572C;ENSP00000441770:S341C;ENSP00000386442:S572C	ENSP00000263710:S572C	S	-	1	0	CLASP1	121922349	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.814000	0.69208	2.367000	0.80283	0.528000	0.53228	AGT	.		0.443	CLASP1-201	KNOWN	basic	protein_coding	protein_coding		NM_015282	
MYO7B	4648	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	128347750	128347750	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr2:128347750C>A	ENST00000409816.2	+	15	1970	c.1938C>A	c.(1936-1938)aaC>aaA	p.N646K	MYO7B_ENST00000389524.4_Missense_Mutation_p.N646K|MYO7B_ENST00000428314.1_Missense_Mutation_p.N646K			Q6PIF6	MYO7B_HUMAN	myosin VIIB	646	Myosin motor.					extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(46)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	75	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		TCCTGACCAACTGCCAGCCTT	0.517																																					p.N646K		.											.	MYO7B-47	0			c.C1938A						.						61.0	61.0	61.0					2																	128347750		1945	4147	6092	SO:0001583	missense	4648	exon16			GACCAACTGCCAG		CCDS46405.1	2q21.1	2011-09-27			ENSG00000169994	ENSG00000169994		"""Myosins / Myosin superfamily : Class VII"""	7607	protein-coding gene	gene with protein product		606541				8022818, 8884266	Standard	NM_001080527		Approved		uc002top.3	Q6PIF6	OTTHUMG00000153419	ENST00000409816.2:c.1938C>A	2.37:g.128347750C>A	ENSP00000386461:p.Asn646Lys	Somatic	141	0		WXS	Illumina GAIIx	Phase_I	168	38	NM_001080527	0	0	0	0	0	Q14786|Q8TEE1	Missense_Mutation	SNP	ENST00000409816.2	37	CCDS46405.1	.	.	.	.	.	.	.	.	.	.	c	5.098	0.203637	0.09704	.	.	ENSG00000169994	ENST00000389524;ENST00000428314;ENST00000409816	D;D;D	0.86694	-2.16;-2.16;-2.16	5.39	-1.01	0.10169	Myosin head, motor domain (2);	1.167850	0.06134	N	0.671191	T	0.71333	0.3327	N	0.10874	0.06	0.09310	N	0.99999	B	0.18741	0.03	B	0.20577	0.03	T	0.55854	-0.8075	10	0.24483	T	0.36	.	3.0594	0.06195	0.0999:0.4704:0.1072:0.3225	.	646	Q6PIF6	MYO7B_HUMAN	K	646	ENSP00000374175:N646K;ENSP00000415090:N646K;ENSP00000386461:N646K	ENSP00000374175:N646K	N	+	3	2	MYO7B	128064220	0.003000	0.15002	0.227000	0.23927	0.985000	0.73830	0.030000	0.13688	-0.218000	0.10018	0.550000	0.68814	AAC	.		0.517	MYO7B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000331124.3	XM_291001	
TTN	7273	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	179621430	179621430	+	Intron	SNP	G	G	T			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr2:179621430G>T	ENST00000591111.1	-	44	10528				TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Intron|TTN_ENST00000342175.6_Missense_Mutation_p.S3420R|TTN_ENST00000589042.1_Missense_Mutation_p.S3591R|TTN-AS1_ENST00000578746.1_RNA|TTN_ENST00000360870.5_Intron|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000610005.1_RNA|TTN-AS1_ENST00000590773.1_RNA			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GAGATATTTTGCTCTCCTCCT	0.418																																					p.S3591R		.											.	TTN-636	0			c.C10773A						.						87.0	84.0	85.0					2																	179621430		1890	4112	6002	SO:0001627	intron_variant	7273	exon46			TATTTTGCTCTCC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10303+2280C>A	2.37:g.179621430G>T		Somatic	63	0		WXS	Illumina GAIIx	Phase_I	96	7	NM_001267550	0	0	0	0	0	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	G	4.969	0.179953	0.09443	.	.	ENSG00000155657	ENST00000342175	T	0.59364	0.27	6.02	4.13	0.48395	.	.	.	.	.	T	0.42921	0.1224	.	.	.	0.09310	N	0.999996	B	0.18166	0.026	B	0.15484	0.013	T	0.36890	-0.9729	8	0.87932	D	0	.	3.8761	0.09058	0.1439:0.1306:0.5904:0.1351	.	3420	E7ET18	.	R	3420	ENSP00000340554:S3420R	ENSP00000340554:S3420R	S	-	3	2	TTN	179329675	0.060000	0.20803	0.149000	0.22428	0.274000	0.26718	0.427000	0.21379	1.555000	0.49500	0.655000	0.94253	AGC	.		0.418	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
PARD3B	117583	bcgsc.ca	37	2	206364737	206364737	+	Silent	SNP	T	T	C	rs10197347	byFrequency	TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr2:206364737T>C	ENST00000406610.2	+	21	3369	c.3162T>C	c.(3160-3162)tcT>tcC	p.S1054S	PARD3B_ENST00000358768.2_Silent_p.S992S|PARD3B_ENST00000488622.1_3'UTR|PARD3B_ENST00000351153.1_Silent_p.S985S|PARD3B_ENST00000349953.3_Silent_p.S953S	NM_057177.6|NM_152526.5|NM_205863.3	NP_476518.4|NP_689739.4|NP_995585.2	Q8TEW8	PAR3L_HUMAN	par-3 family cell polarity regulator beta	1054					cell cycle (GO:0007049)|cell division (GO:0051301)	membrane (GO:0016020)|tight junction (GO:0005923)				breast(1)|endometrium(9)|kidney(2)|large_intestine(6)|liver(4)|lung(33)|ovary(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)	65		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)		Epithelial(149;0.0739)		CAAGGCCATCTGAGTATGACC	0.438													T|||	2246	0.448482	0.3601	0.5692	5008	,	,		21928	0.4871		0.4115	False		,,,				2504	0.4806				p.S992S		.											.	PARD3B-140	0			c.T2976C						.	T	,,	1436,2416		266,904,756	216.0	198.0	203.0		2955,2976,2859	2.5	1.0	2	dbSNP_119	203	3152,5096		639,1874,1611	yes	coding-synonymous,coding-synonymous,coding-synonymous	PARD3B	NM_057177.6,NM_152526.5,NM_205863.3	,,	905,2778,2367	CC,CT,TT		38.2153,37.2793,37.9174	,,	985/1137,992/1144,953/1105	206364737	4588,7512	1926	4124	6050	SO:0001819	synonymous_variant	117583	exon20			GCCATCTGAGTAT	AB053321	CCDS42804.1, CCDS42805.1, CCDS42806.1	2q33.3	2013-08-28	2013-08-28	2006-09-28	ENSG00000116117	ENSG00000116117			14446	protein-coding gene	gene with protein product			"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 19"", ""par-3 partitioning defective 3 homolog B (C. elegans)"""	ALS2CR19		11586298, 12459187	Standard	NM_057177		Approved	Par3L, PAR3beta	uc002vap.2	Q8TEW8	OTTHUMG00000154562	ENST00000406610.2:c.3162T>C	2.37:g.206364737T>C		Somatic	155	1		WXS	Illumina GAIIx	Phase_I	110	5	NM_152526	0	0	0	0	0	E9PE87|Q8IUC7|Q8IUC9|Q96DK9|Q96N09|Q96NX6|Q96NX7|Q96Q29	Silent	SNP	ENST00000406610.2	37																																																																																				T|0.587;C|0.413		0.438	PARD3B-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000335992.1	NM_057177	
CRYGB	1419	bcgsc.ca	37	2	209007559	209007559	+	Missense_Mutation	SNP	T	T	G	rs796287	byFrequency	TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr2:209007559T>G	ENST00000260988.4	-	3	378	c.331A>C	c.(331-333)Atc>Ctc	p.I111L		NM_005210.3	NP_005201.2	P07316	CRGB_HUMAN	crystallin, gamma B	111	Beta/gamma crystallin 'Greek key' 3. {ECO:0000255|PROSITE-ProRule:PRU00028}.		I -> L (in dbSNP:rs796287). {ECO:0000269|PubMed:12011157, ECO:0000269|PubMed:12676897, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:2777080, ECO:0000269|PubMed:4065573}.		lens fiber cell morphogenesis (GO:0070309)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	structural constituent of eye lens (GO:0005212)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)|skin(1)|stomach(1)	14				Epithelial(149;0.0641)|LUSC - Lung squamous cell carcinoma(261;0.0703)|Lung(261;0.132)		TGAACAGAGATACAGTCGTCT	0.517													G|||	3228	0.644569	0.6203	0.5447	5008	,	,		17939	0.5952		0.7326	False		,,,				2504	0.7086				p.I111L		.											.	CRYGB-90	0			c.A331C						.	G	LEU/ILE	2978,1428	465.9+/-354.3	1033,912,258	145.0	145.0	145.0		331	0.5	0.1	2	dbSNP_86	145	6334,2266	384.1+/-341.0	2333,1668,299	yes	missense	CRYGB	NM_005210.3	5	3366,2580,557	GG,GT,TT		26.3488,32.4103,28.4023	benign	111/176	209007559	9312,3694	2203	4300	6503	SO:0001583	missense	1419	exon3			CAGAGATACAGTC		CCDS2380.1	2q34	2013-02-14			ENSG00000182187	ENSG00000182187			2409	protein-coding gene	gene with protein product		123670	"""crystallin, gamma 1-2"""	CRYG2			Standard	NM_005210		Approved		uc002vcp.4	P07316	OTTHUMG00000132941	ENST00000260988.4:c.331A>C	2.37:g.209007559T>G	ENSP00000260988:p.Ile111Leu	Somatic	195	0		WXS	Illumina GAIIx	Phase_I	151	6	NM_005210	0	0	0	0	0	Q17RB5|Q53ST2	Missense_Mutation	SNP	ENST00000260988.4	37	CCDS2380.1	1385	0.6341575091575091	319	0.6483739837398373	206	0.569060773480663	315	0.5506993006993007	545	0.7189973614775725	G	10.87	1.474126	0.26423	0.675897	0.736512	ENSG00000182187	ENST00000260988	T	0.75589	-0.95	4.64	0.468	0.16732	Beta/gamma crystallin (4);Gamma-crystallin-related (1);	0.463806	0.25377	N	0.031104	T	0.00012	0.0000	N	0.01668	-0.77	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.44559	-0.9320	9	0.54805	T	0.06	.	9.4649	0.38806	0.0:0.128:0.3464:0.5255	rs796287;rs17641392;rs58328262;rs796287	111	P07316	CRGB_HUMAN	L	111	ENSP00000260988:I111L	ENSP00000260988:I111L	I	-	1	0	CRYGB	208715804	0.005000	0.15991	0.102000	0.21198	0.613000	0.37349	0.827000	0.27421	-0.247000	0.09597	-0.217000	0.12591	ATC	G|0.655;N|0.000		0.517	CRYGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256473.2	NM_005210	
PIKFYVE	200576	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	209216103	209216103	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr2:209216103C>G	ENST00000264380.4	+	38	5797	c.5639C>G	c.(5638-5640)cCt>cGt	p.P1880R		NM_015040.3	NP_055855.2	Q9Y2I7	FYV1_HUMAN	phosphoinositide kinase, FYVE finger containing	1880	Catalytic.|PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.				cellular protein metabolic process (GO:0044267)|intracellular signal transduction (GO:0035556)|myelin assembly (GO:0032288)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|protein localization to nucleus (GO:0034504)|retrograde transport, endosome to Golgi (GO:0042147)|small molecule metabolic process (GO:0044281)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|vesicle membrane (GO:0012506)	1-phosphatidylinositol-3-phosphate 5-kinase activity (GO:0000285)|1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)|phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(14)|kidney(6)|large_intestine(25)|lung(40)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	107						AAGCAAATGCCTCGTCTGGAA	0.333																																					p.P1880R		.											.	PIKFYVE-583	0			c.C5639G						.						136.0	140.0	139.0					2																	209216103		2203	4300	6503	SO:0001583	missense	200576	exon38			AAATGCCTCGTCT	AB023198	CCDS2382.1, CCDS33368.1, CCDS54431.1	2q34	2014-01-15	2009-04-17	2009-04-17	ENSG00000115020	ENSG00000115020		"""Zinc fingers, FYVE domain containing"""	23785	protein-coding gene	gene with protein product	"""zinc finger, FYVE domain containing 29"""	609414	"""phosphatidylinositol-3-phosphate/phosphatidylinositol 5-kinase, type III"""	PIP5K3		9858586, 12270933	Standard	NM_015040		Approved	MGC40423, KIAA0981, PIKfyve, PIP5K, p235, ZFYVE29, FAB1	uc002vcz.3	Q9Y2I7	OTTHUMG00000132945	ENST00000264380.4:c.5639C>G	2.37:g.209216103C>G	ENSP00000264380:p.Pro1880Arg	Somatic	79	0		WXS	Illumina GAIIx	Phase_I	49	18	NM_015040	0	0	0	0	0	Q08AR7|Q08AR8|Q53ST3|Q53T36|Q8N5H0|Q8NB67	Missense_Mutation	SNP	ENST00000264380.4	37	CCDS2382.1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.533808	0.85812	.	.	ENSG00000115020	ENST00000264380	T	0.32753	1.44	5.91	5.91	0.95273	Phosphatidylinositol-4-phosphate 5-kinase, core (2);Phosphatidylinositol-4-phosphate 5-kinase, core, subgroup (1);	0.000000	0.85682	D	0.000000	T	0.41880	0.1178	N	0.12637	0.245	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.48917	-0.8992	10	0.72032	D	0.01	-18.8868	20.2896	0.98541	0.0:1.0:0.0:0.0	.	1880	Q9Y2I7	FYV1_HUMAN	R	1880	ENSP00000264380:P1880R	ENSP00000264380:P1880R	P	+	2	0	PIKFYVE	208924348	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.616000	0.83018	2.794000	0.96219	0.655000	0.94253	CCT	.		0.333	PIKFYVE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256477.2	NM_015040	
TMEM169	92691	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	216960742	216960742	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr2:216960742G>A	ENST00000295658.4	+	2	263	c.56G>A	c.(55-57)gGc>gAc	p.G19D	TMEM169_ENST00000437356.2_Missense_Mutation_p.G19D|TMEM169_ENST00000454545.1_Missense_Mutation_p.G19D|TMEM169_ENST00000406027.2_Missense_Mutation_p.G19D	NM_001142311.1|NM_001142312.1|NM_138390.3	NP_001135783.1|NP_001135784.1|NP_612399.1	Q96HH4	TM169_HUMAN	transmembrane protein 169	19						integral component of membrane (GO:0016021)				breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(2)	13		Renal(323;0.0651)		Epithelial(149;6.44e-06)|all cancers(144;0.000398)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CCCCACCAGGGCTCTCTCAGG	0.547																																					p.G19D		.											.	TMEM169-69	0			c.G56A						.						49.0	54.0	52.0					2																	216960742		2203	4300	6503	SO:0001583	missense	92691	exon3			ACCAGGGCTCTCT	AK091582	CCDS2401.1	2q35	2008-02-05			ENSG00000163449	ENSG00000163449			25130	protein-coding gene	gene with protein product						12477932	Standard	NM_001142310		Approved	FLJ34263	uc002vfv.4	Q96HH4	OTTHUMG00000133053	ENST00000295658.4:c.56G>A	2.37:g.216960742G>A	ENSP00000295658:p.Gly19Asp	Somatic	63	0		WXS	Illumina GAIIx	Phase_I	72	32	NM_001142310	0	0	0	0	0	B2R8W6	Missense_Mutation	SNP	ENST00000295658.4	37	CCDS2401.1	.	.	.	.	.	.	.	.	.	.	G	9.066	0.995697	0.19043	.	.	ENSG00000163449	ENST00000433112;ENST00000454545;ENST00000437356;ENST00000295658;ENST00000455479;ENST00000406027	.	.	.	5.04	4.16	0.48862	.	0.306710	0.36268	N	0.002698	T	0.41627	0.1167	L	0.56769	1.78	0.23816	N	0.996762	B	0.06786	0.001	B	0.09377	0.004	T	0.25984	-1.0116	9	0.15066	T	0.55	-21.7381	12.7333	0.57210	0.0788:0.0:0.9212:0.0	.	19	Q96HH4	TM169_HUMAN	D	19	.	ENSP00000295658:G19D	G	+	2	0	TMEM169	216668987	0.999000	0.42202	0.895000	0.35142	0.207000	0.24258	2.074000	0.41529	1.372000	0.46190	0.306000	0.20318	GGC	.		0.547	TMEM169-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256666.2	NM_138390	
EPB41L1	2036	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	34776286	34776286	+	Silent	SNP	C	C	T			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr20:34776286C>T	ENST00000338074.2	+	9	1052	c.891C>T	c.(889-891)gaC>gaT	p.D297D	EPB41L1_ENST00000373941.1_Silent_p.D297D|EPB41L1_ENST00000373946.3_Silent_p.D266D|EPB41L1_ENST00000441639.1_Silent_p.D235D|EPB41L1_ENST00000373950.2_Silent_p.D200D|EPB41L1_ENST00000202028.5_Silent_p.D235D	NM_001258329.1|NM_012156.2	NP_001245258.1|NP_036288.2	Q9H4G0	E41L1_HUMAN	erythrocyte membrane protein band 4.1-like 1	297	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				cortical actin cytoskeleton organization (GO:0030866)|synaptic transmission (GO:0007268)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(10)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	37	Breast(12;0.0239)					AGGGCATCGACATCATGTTAG	0.577																																					p.D297D		.											.	EPB41L1-93	0			c.C891T						.						150.0	140.0	143.0					20																	34776286		2203	4300	6503	SO:0001819	synonymous_variant	2036	exon10			CATCGACATCATG	AB002336	CCDS13271.1, CCDS13272.1, CCDS58771.1	20q11.2-q12	2003-03-17			ENSG00000088367	ENSG00000088367			3378	protein-coding gene	gene with protein product		602879				9570967, 9828140	Standard	NM_012156		Approved	KIAA0338	uc002xfb.3	Q9H4G0	OTTHUMG00000032378	ENST00000338074.2:c.891C>T	20.37:g.34776286C>T		Somatic	128	1		WXS	Illumina GAIIx	Phase_I	180	43	NM_001258329	0	0	0	0	0	O15046|Q4VXM6|Q4VXM7|Q4VXM8|Q4VXN4|Q6ZT61|Q8IUU7|Q96CV5|Q96L65	Silent	SNP	ENST00000338074.2	37	CCDS13271.1																																																																																			.		0.577	EPB41L1-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078978.3	NM_012156	
SLA2	84174	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	35242711	35242711	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr20:35242711T>C	ENST00000262866.4	-	7	1084	c.662A>G	c.(661-663)gAc>gGc	p.D221G	SLA2_ENST00000360672.2_Silent_p.G204G	NM_032214.3|NM_175077.2	NP_115590.1|NP_778252.1	Q9H6Q3	SLAP2_HUMAN	Src-like-adaptor 2	221	SLA C-terminal.				antigen receptor-mediated signaling pathway (GO:0050851)|B cell mediated immunity (GO:0019724)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of B cell activation (GO:0050869)|negative regulation of calcium-mediated signaling (GO:0050849)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of signal transduction (GO:0009967)|regulation of immune response (GO:0050776)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome membrane (GO:0010008)|late endosome (GO:0005770)|plasma membrane (GO:0005886)	protein N-terminus binding (GO:0047485)|SH3/SH2 adaptor activity (GO:0005070)			endometrium(1)|lung(2)|skin(2)	5	Breast(12;0.114)	Myeloproliferative disorder(115;0.00878)				ACTTTACCTGTCCAGCTCTTT	0.562																																					p.D221G	Ovarian(59;720 1165 26994 46188 51693)	.											.	SLA2-90	0			c.A662G						.						139.0	135.0	137.0					20																	35242711		2203	4300	6503	SO:0001583	missense	84174	exon7			TACCTGTCCAGCT	AF326353	CCDS13282.1, CCDS13283.1	20q11.23	2013-02-14			ENSG00000101082	ENSG00000101082		"""SH2 domain containing"""	17329	protein-coding gene	gene with protein product		606577		C20orf156		11696592	Standard	NM_032214		Approved	FLJ21992, SLAP-2	uc002xfv.3	Q9H6Q3	OTTHUMG00000032393	ENST00000262866.4:c.662A>G	20.37:g.35242711T>C	ENSP00000262866:p.Asp221Gly	Somatic	114	0		WXS	Illumina GAIIx	Phase_I	190	33	NM_032214	0	0	0	0	0	A8K648|E1P5U1|E1P5U2|Q5TH27|Q5TH28|Q8WY18|Q96QI4|Q9H135	Missense_Mutation	SNP	ENST00000262866.4	37	CCDS13282.1	.	.	.	.	.	.	.	.	.	.	T	23.8	4.461913	0.84425	.	.	ENSG00000101082	ENST00000262866	T	0.78816	-1.21	5.43	5.43	0.79202	.	0.164121	0.53938	D	0.000054	D	0.82641	0.5081	.	.	.	0.80722	D	1	D	0.63046	0.992	P	0.55055	0.767	T	0.82733	-0.0311	9	0.41790	T	0.15	.	13.4753	0.61306	0.0:0.0:0.0:1.0	.	221	Q9H6Q3	SLAP2_HUMAN	G	221	ENSP00000262866:D221G	ENSP00000262866:D221G	D	-	2	0	SLA2	34676125	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.137000	0.64789	2.279000	0.76181	0.533000	0.62120	GAC	.		0.562	SLA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079037.2	NM_175077	
KIAA1755	85449	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	36869832	36869832	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr20:36869832G>T	ENST00000279024.4	-	3	972	c.701C>A	c.(700-702)gCc>gAc	p.A234D		NM_001029864.1	NP_001025035.1	Q5JYT7	K1755_HUMAN	KIAA1755	234										breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(5)|pancreas(2)|skin(4)|stomach(1)	54		Myeloproliferative disorder(115;0.00874)				CTTACCCTTGGCCAAACTCTG	0.592																																					p.A234D		.											.	KIAA1755-95	0			c.C701A						.						113.0	102.0	106.0					20																	36869832		2203	4300	6503	SO:0001583	missense	85449	exon3			CCCTTGGCCAAAC	AB051542	CCDS33467.1	20q11.23	2007-12-07			ENSG00000149633	ENSG00000149633			29372	protein-coding gene	gene with protein product						11214970	Standard	NM_001029864		Approved	RP5-1054A22.3	uc002xhy.1	Q5JYT7	OTTHUMG00000032436	ENST00000279024.4:c.701C>A	20.37:g.36869832G>T	ENSP00000279024:p.Ala234Asp	Somatic	105	1		WXS	Illumina GAIIx	Phase_I	105	35	NM_001029864	0	0	0	0	0	Q9C0A8	Missense_Mutation	SNP	ENST00000279024.4	37	CCDS33467.1	.	.	.	.	.	.	.	.	.	.	G	2.171	-0.389911	0.04932	.	.	ENSG00000149633	ENST00000279024	T	0.05855	3.38	4.75	-3.15	0.05233	.	0.807218	0.10707	N	0.643268	T	0.03915	0.0110	L	0.39898	1.24	0.09310	N	1	B	0.12013	0.005	B	0.08055	0.003	T	0.46638	-0.9177	10	0.16896	T	0.51	.	1.9728	0.03409	0.4078:0.1222:0.3386:0.1314	.	234	Q5JYT7	K1755_HUMAN	D	234	ENSP00000279024:A234D	ENSP00000279024:A234D	A	-	2	0	KIAA1755	36303246	0.000000	0.05858	0.000000	0.03702	0.229000	0.25112	0.465000	0.22004	-0.441000	0.07201	0.655000	0.94253	GCC	.		0.592	KIAA1755-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079144.3	NM_001029864	
CTSA	5476	hgsc.bcm.edu;broad.mit.edu	37	20	44520258	44520258	+	Frame_Shift_Del	DEL	G	G	-	rs576896599|rs564815597	byFrequency	TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr20:44520258delG	ENST00000372459.2	+	1	244	c.51delG	c.(49-51)ctgfs	p.L19fs	CTSA_ENST00000354880.5_Frame_Shift_Del_p.L37fs|CTSA_ENST00000191018.5_Frame_Shift_Del_p.L19fs|RP3-337O18.9_ENST00000607703.1_RNA|NEURL2_ENST00000372518.4_5'Flank|CTSA_ENST00000372484.3_Frame_Shift_Del_p.L37fs			P10619	PPGB_HUMAN	cathepsin A	19				Missing (in Ref. 4; AAH00597). {ECO:0000305}.	glycosphingolipid metabolic process (GO:0006687)|intracellular protein transport (GO:0006886)|positive regulation of catalytic activity (GO:0043085)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|membrane (GO:0016020)|nucleus (GO:0005634)	carboxypeptidase activity (GO:0004180)|enzyme activator activity (GO:0008047)|serine-type carboxypeptidase activity (GO:0004185)			breast(1)|endometrium(5)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|skin(2)|urinary_tract(1)	21		Myeloproliferative disorder(115;0.0122)				tgctgctgctgctgctAGTGT	0.692																																					p.L35fs		.											.	CTSA-91	0			c.105delG						.						17.0	20.0	19.0					20																	44520258		2138	4184	6322	SO:0001589	frameshift_variant	5476	exon2			GCTGCTGCTGCTA	M22960	CCDS13385.2, CCDS46609.1, CCDS54467.1	20q13.12	2012-02-10	2006-12-05	2006-12-05	ENSG00000064601	ENSG00000064601	3.4.16.5	"""Cathepsins"""	9251	protein-coding gene	gene with protein product	"""carboxypeptidase C"", ""lysosomal protective protein"", ""carboxypeptidase-L"", ""carboxypeptidase Y-like kininase"", ""deamidase"", ""lysosomal carboxypeptidase A"", ""urinary kininase"""	613111	"""protective protein for beta-galactosidase (galactosialidosis)"""	GSL, PPGB		2071143	Standard	NM_000308		Approved		uc002xqh.3	P10619	OTTHUMG00000033078	ENST00000372459.2:c.51delG	20.37:g.44520258delG	ENSP00000361537:p.Leu19fs	Somatic	8	0		WXS	Illumina GAIIx	Phase_I	71	19	NM_000308	0	0	0	0	0	B2R798|Q561W6|Q5JZH1|Q96KJ2|Q9BR08|Q9BW68	Frame_Shift_Del	DEL	ENST00000372459.2	37	CCDS46609.1																																																																																			-|0.668;CTG|0.332		0.692	CTSA-012	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000471297.2	NM_000308	
CTSA	5476	hgsc.bcm.edu;broad.mit.edu	37	20	44520260	44520261	+	Frame_Shift_Del	DEL	TG	TG	-	rs544157818|rs530287837|rs181943893|rs562182818	byFrequency	TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	TG	TG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr20:44520260_44520261delTG	ENST00000372459.2	+	1	246_247	c.53_54delTG	c.(52-54)ctgfs	p.L19fs	CTSA_ENST00000354880.5_Frame_Shift_Del_p.L37fs|CTSA_ENST00000191018.5_Frame_Shift_Del_p.L19fs|RP3-337O18.9_ENST00000607703.1_RNA|NEURL2_ENST00000372518.4_5'Flank|CTSA_ENST00000372484.3_Frame_Shift_Del_p.L37fs			P10619	PPGB_HUMAN	cathepsin A	19				Missing (in Ref. 4; AAH00597). {ECO:0000305}.	glycosphingolipid metabolic process (GO:0006687)|intracellular protein transport (GO:0006886)|positive regulation of catalytic activity (GO:0043085)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|membrane (GO:0016020)|nucleus (GO:0005634)	carboxypeptidase activity (GO:0004180)|enzyme activator activity (GO:0008047)|serine-type carboxypeptidase activity (GO:0004185)	p.L36fs*121(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|skin(2)|urinary_tract(1)	21		Myeloproliferative disorder(115;0.0122)				ctgctgctgctgctAGTGTCCT	0.698														215	0.0429313	0.0106	0.0303	5008	,	,		13385	0.129		0.007	False		,,,				2504	0.044				p.36_36del		.											.	CTSA-91	1	Deletion - Frameshift(1)	large_intestine(1)	c.107_108del						.																																			SO:0001589	frameshift_variant	5476	exon2			TGCTGCTGCTAGT	M22960	CCDS13385.2, CCDS46609.1, CCDS54467.1	20q13.12	2012-02-10	2006-12-05	2006-12-05	ENSG00000064601	ENSG00000064601	3.4.16.5	"""Cathepsins"""	9251	protein-coding gene	gene with protein product	"""carboxypeptidase C"", ""lysosomal protective protein"", ""carboxypeptidase-L"", ""carboxypeptidase Y-like kininase"", ""deamidase"", ""lysosomal carboxypeptidase A"", ""urinary kininase"""	613111	"""protective protein for beta-galactosidase (galactosialidosis)"""	GSL, PPGB		2071143	Standard	NM_000308		Approved		uc002xqh.3	P10619	OTTHUMG00000033078	ENST00000372459.2:c.53_54delTG	20.37:g.44520260_44520261delTG	ENSP00000361537:p.Leu19fs	Somatic	9	0		WXS	Illumina GAIIx	Phase_I	71	18	NM_000308	0	0	0	0	0	B2R798|Q561W6|Q5JZH1|Q96KJ2|Q9BR08|Q9BW68	Frame_Shift_Del	DEL	ENST00000372459.2	37	CCDS46609.1																																																																																			.		0.698	CTSA-012	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000471297.2	NM_000308	
ETS2	2114	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	40188949	40188949	+	Nonsense_Mutation	SNP	G	G	T			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr21:40188949G>T	ENST00000360214.3	+	7	983	c.523G>T	c.(523-525)Gaa>Taa	p.E175*	ETS2_ENST00000360938.3_Nonsense_Mutation_p.E175*	NM_001256295.1	NP_001243224.1	P15036	ETS2_HUMAN	v-ets avian erythroblastosis virus E26 oncogene homolog 2	175					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	18		Prostate(19;6.33e-08)|all_epithelial(19;0.123)				AGAAAAGACAGAAGATCAATA	0.393																																					p.E315X		.											.	ETS2-849	0			c.G943T						.						133.0	115.0	121.0					21																	40188949		2203	4300	6503	SO:0001587	stop_gained	2114	exon7			AAGACAGAAGATC		CCDS13659.1	21q22.3	2013-07-09	2013-07-09		ENSG00000157557	ENSG00000157557			3489	protein-coding gene	gene with protein product		164740	"""v-ets erythroblastosis virus E26 oncogene homolog 2 (avian)"""			17986575	Standard	NM_001256295		Approved		uc002yxf.3	P15036	OTTHUMG00000090769	ENST00000360214.3:c.523G>T	21.37:g.40188949G>T	ENSP00000353344:p.Glu175*	Somatic	104	0		WXS	Illumina GAIIx	Phase_I	66	24	NM_001256295	0	0	0	0	0	A6NM68|D3DSH6|Q53Y89	Nonsense_Mutation	SNP	ENST00000360214.3	37	CCDS13659.1	.	.	.	.	.	.	.	.	.	.	G	37	6.476303	0.97598	.	.	ENSG00000157557	ENST00000360214;ENST00000360938;ENST00000456966	.	.	.	5.61	4.67	0.58626	.	0.361080	0.32218	N	0.006409	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.13108	T	0.6	.	13.7856	0.63108	0.0:0.3173:0.6827:0.0	.	.	.	.	X	175	.	ENSP00000353344:E175X	E	+	1	0	ETS2	39110819	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.238000	0.58688	2.793000	0.96121	0.655000	0.94253	GAA	.		0.393	ETS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207544.1		
GNB1L	54584	broad.mit.edu	37	22	19808792	19808792	+	Silent	SNP	G	G	A	rs115309470	byFrequency	TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr22:19808792G>A	ENST00000329517.6	-	3	323	c.87C>T	c.(85-87)tgC>tgT	p.C29C	GNB1L_ENST00000405009.1_Silent_p.C29C|GNB1L_ENST00000403325.1_Silent_p.C29C|GNB1L_ENST00000460402.1_Intron	NM_053004.2	NP_443730.1	Q9BYB4	GNB1L_HUMAN	guanine nucleotide binding protein (G protein), beta polypeptide 1-like	29					G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|social behavior (GO:0035176)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)				breast(1)|kidney(1)|large_intestine(2)|lung(4)|prostate(3)|skin(1)	12	Colorectal(54;0.0993)					GGGCTCCTTCGCAGAAGTGCA	0.692													g|||	4	0.000798722	0.003	0.0	5008	,	,		17626	0.0		0.0	False		,,,				2504	0.0				p.C29C		.											.	GNB1L-290	0			c.C87T						.	A		20,4386	28.1+/-56.4	0,20,2183	51.0	62.0	59.0		87	-3.0	0.0	22	dbSNP_132	59	0,8600		0,0,4300	no	coding-synonymous	GNB1L	NM_053004.2		0,20,6483	AA,AG,GG		0.0,0.4539,0.1538		29/328	19808792	20,12986	2203	4300	6503	SO:0001819	synonymous_variant	54584	exon3			TCCTTCGCAGAAG	AF238328	CCDS13768.1	22q11.2	2013-05-21			ENSG00000185838	ENSG00000185838		"""WD repeat domain containing"""	4397	protein-coding gene	gene with protein product		610778				11072084	Standard	NM_053004		Approved	GY2, WDR14	uc002zqf.1	Q9BYB4	OTTHUMG00000150279	ENST00000329517.6:c.87C>T	22.37:g.19808792G>A		Somatic	97	0		WXS	Illumina GAIIx	Phase_I	93	3	NM_053004	0	0	0	0	0	Q9H2S2|Q9H4M4	Silent	SNP	ENST00000329517.6	37	CCDS13768.1																																																																																			G|0.998;A|0.002		0.692	GNB1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075202.1		
SCARF2	91179	hgsc.bcm.edu	37	22	20780296	20780296	+	Missense_Mutation	SNP	G	G	A	rs9680797	byFrequency	TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr22:20780296G>A	ENST00000266214.5	-	11	2086	c.1982C>T	c.(1981-1983)cCa>cTa	p.P661L	SCARF2_ENST00000405555.3_Missense_Mutation_p.P656L	NM_153334.4	NP_699165.2	Q96GP6	SREC2_HUMAN	scavenger receptor class F, member 2	661	Pro-rich.				cell adhesion (GO:0007155)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|skin(2)	10	Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			GGGGTCAGGTGGCGGCGGTTT	0.756													g|||	68	0.0135783	0.0008	0.0303	5008	,	,		7971	0.0		0.0398	False		,,,				2504	0.0061				p.P661L		.											.	SCARF2-341	0			c.C1982T						.		LEU/PRO,LEU/PRO	27,4371		0,27,2172	16.0	20.0	19.0		1982,1967	3.4	0.9	22	dbSNP_119	19	316,8274		10,296,3989	yes	missense,missense	SCARF2	NM_153334.4,NM_182895.2	98,98	10,323,6161	AA,AG,GG		3.6787,0.6139,2.6409	probably-damaging,probably-damaging	661/871,656/866	20780296	343,12645	2199	4295	6494	SO:0001583	missense	91179	exon11			TCAGGTGGCGGCG	AF522196	CCDS13779.1, CCDS46666.1	22q11.21	2011-10-10			ENSG00000244486	ENSG00000244486			19869	protein-coding gene	gene with protein product		613619				12154095	Standard	XM_006724364		Approved	SREC-II, SREC2, HUMZD58C02	uc002zsk.2	Q96GP6	OTTHUMG00000150779	ENST00000266214.5:c.1982C>T	22.37:g.20780296G>A	ENSP00000266214:p.Pro661Leu	Somatic	3	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_153334	0	0	0	0	0	E5RFB8|Q58A83|Q8IXF3|Q9BW74	Missense_Mutation	SNP	ENST00000266214.5	37	CCDS13779.1	43	0.019688644688644688	4	0.008130081300813009	9	0.024861878453038673	0	0.0	30	0.0395778364116095	g	15.57	2.873045	0.51695	0.006139	0.036787	ENSG00000244486	ENST00000405555;ENST00000341328;ENST00000266214	T;T	0.22539	2.01;1.95	3.38	3.38	0.38709	.	0.084416	0.47093	U	0.000259	T	0.07458	0.0188	L	0.29908	0.895	0.49299	D	0.999771	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.994	T	0.01405	-1.1363	10	0.11485	T	0.65	.	12.6984	0.57018	0.0:0.0:1.0:0.0	rs9680797	656;656	E5RFB8;Q96GP6	.;SREC2_HUMAN	L	656;656;661	ENSP00000385589:P656L;ENSP00000266214:P661L	ENSP00000266214:P661L	P	-	2	0	SCARF2	19110296	1.000000	0.71417	0.865000	0.33974	0.132000	0.20833	8.286000	0.89916	1.917000	0.55516	0.441000	0.28932	CCA	G|0.977;A|0.023		0.756	SCARF2-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320047.1		
NEFH	4744	bcgsc.ca	37	22	29886043	29886043	+	Missense_Mutation	SNP	A	A	C	rs165602	byFrequency	TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr22:29886043A>C	ENST00000310624.6	+	4	2447	c.2414A>C	c.(2413-2415)gAg>gCg	p.E805A		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	811	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						CCCCTGAAGGAGGATGCCAAG	0.552													A|||	600	0.119808	0.1135	0.1297	5008	,	,		18679	0.0526		0.1421	False		,,,				2504	0.1677				p.E805A		.											.	NEFH-90	0			c.A2414C						.	A	ALA/GLU	567,3839	241.5+/-251.9	42,483,1678	41.0	44.0	43.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	2414	5.4	1.0	22	dbSNP_79	43	1313,7285	247.6+/-275.6	86,1141,3072	yes	missense	NEFH	NM_021076.3	107	128,1624,4750	CC,CA,AA		15.271,12.8688,14.4571	probably-damaging	805/1021	29886043	1880,11124	2203	4299	6502	SO:0001583	missense	4744	exon4			TGAAGGAGGATGC		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.2414A>C	22.37:g.29886043A>C	ENSP00000311997:p.Glu805Ala	Somatic	79	0		WXS	Illumina GAIIx	Phase_I	81	5	NM_021076	0	0	0	0	0	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Missense_Mutation	SNP	ENST00000310624.6	37	CCDS13858.1	252	0.11538461538461539	59	0.11991869918699187	54	0.14917127071823205	25	0.043706293706293704	114	0.1503957783641161	A	16.98	3.271851	0.59649	0.128688	0.15271	ENSG00000100285	ENST00000328842;ENST00000310624	D	0.86164	-2.08	5.42	5.42	0.78866	.	0.129681	0.34932	N	0.003568	T	0.03651	0.0104	L	0.55834	1.745	0.09310	P	0.999999213389	D	0.56035	0.974	P	0.50352	0.638	T	0.52208	-0.8606	9	0.87932	D	0	.	15.4256	0.75048	1.0:0.0:0.0:0.0	rs165602;rs695847;rs16987680;rs52801416;rs58898655;rs165602	811	P12036	NFH_HUMAN	A	756;805	ENSP00000311997:E805A	ENSP00000311997:E805A	E	+	2	0	NEFH	28216043	0.995000	0.38212	0.988000	0.46212	0.657000	0.38888	3.316000	0.51960	2.190000	0.69967	0.533000	0.62120	GAG	A|0.871;C|0.129		0.552	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
TRIOBP	11078	hgsc.bcm.edu	37	22	38122462	38122462	+	Missense_Mutation	SNP	A	A	G	rs739138	byFrequency	TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr22:38122462A>G	ENST00000406386.3	+	7	4154	c.3899A>G	c.(3898-3900)cAc>cGc	p.H1300R		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	1300			H -> R (in dbSNP:rs739138).		actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					GGCCGCACCCACAGCCCTGGC	0.741													G|||	3010	0.601038	0.1944	0.5836	5008	,	,		13399	0.8859		0.7157	False		,,,				2504	0.7515				p.H1300R		.											.	TRIOBP-136	0			c.A3899G						.	G	ARG/HIS	1221,2235		265,691,772	4.0	6.0	5.0		3899	3.9	1.0	22	dbSNP_86	5	5694,1808		2238,1218,295	yes	missense	TRIOBP	NM_001039141.2	29	2503,1909,1067	GG,GA,AA		24.1002,35.3299,36.8954	benign	1300/2366	38122462	6915,4043	1728	3751	5479	SO:0001583	missense	11078	exon7			GCACCCACAGCCC	AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.3899A>G	22.37:g.38122462A>G	ENSP00000384312:p.His1300Arg	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	5	NM_001039141	0	0	0	0	0	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Missense_Mutation	SNP	ENST00000406386.3	37	CCDS43015.1	1409	0.6451465201465202	110	0.22357723577235772	222	0.6132596685082873	531	0.9283216783216783	546	0.7203166226912929	G	12.86	2.065195	0.36470	0.353299	0.758998	ENSG00000100106	ENST00000406386;ENST00000417174	T	0.11063	2.81	4.93	3.9	0.45041	.	.	.	.	.	T	0.00012	0.0000	N	0.01576	-0.805	0.09310	P	0.999999999370294	B	0.02656	0.0	B	0.01281	0.0	T	0.29671	-1.0004	8	0.02654	T	1	.	4.383	0.11304	0.2555:0.0:0.5874:0.1571	rs739138	1300	Q9H2D6	TARA_HUMAN	R	1300	ENSP00000384312:H1300R	ENSP00000384312:H1300R	H	+	2	0	TRIOBP	36452408	1.000000	0.71417	1.000000	0.80357	0.841000	0.47740	1.338000	0.33873	0.503000	0.28060	-0.366000	0.07423	CAC	A|0.354;G|0.646		0.741	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319439.2		
TRIOBP	11078	broad.mit.edu	37	22	38131006	38131006	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr22:38131006C>A	ENST00000406386.3	+	9	4918	c.4663C>A	c.(4663-4665)Ccc>Acc	p.P1555T		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	1555					actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					TGAGAGGCGACCCGAGCTTGA	0.677											OREG0026548	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P1555T		.											.	TRIOBP-136	0			c.C4663A						.						55.0	64.0	61.0					22																	38131006		2032	4174	6206	SO:0001583	missense	11078	exon9			AGGCGACCCGAGC	AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.4663C>A	22.37:g.38131006C>A	ENSP00000384312:p.Pro1555Thr	Somatic	46	2	875	WXS	Illumina GAIIx	Phase_I	59	12	NM_001039141	0	0	0	0	0	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Missense_Mutation	SNP	ENST00000406386.3	37	CCDS43015.1	.	.	.	.	.	.	.	.	.	.	C	14.56	2.572139	0.45798	.	.	ENSG00000100106	ENST00000406386;ENST00000417174	T	0.21543	2.0	5.75	-0.478	0.12093	.	.	.	.	.	T	0.11793	0.0287	L	0.27053	0.805	0.09310	N	1	B	0.27229	0.172	B	0.25614	0.062	T	0.31110	-0.9955	9	0.62326	D	0.03	.	2.2167	0.03962	0.1457:0.4074:0.2834:0.1635	.	1555	Q9H2D6	TARA_HUMAN	T	1555;1516	ENSP00000384312:P1555T	ENSP00000384312:P1555T	P	+	1	0	TRIOBP	36460952	0.000000	0.05858	0.001000	0.08648	0.138000	0.21146	-0.242000	0.08928	0.331000	0.23511	0.563000	0.77884	CCC	.		0.677	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319439.2		
MCHR1	2847	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	41075522	41075522	+	Missense_Mutation	SNP	A	A	G	rs147389509	byFrequency	TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr22:41075522A>G	ENST00000249016.4	+	1	769	c.73A>G	c.(73-75)Acg>Gcg	p.T25A	MCHR1_ENST00000381433.2_Missense_Mutation_p.T25A|MCHR1_ENST00000498400.1_Intron	NM_005297.3	NP_005288.3	Q99705	MCHR1_HUMAN	melanin-concentrating hormone receptor 1	25			T -> M (in dbSNP:rs117372135). {ECO:0000269|PubMed:15941924}.		adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|feeding behavior (GO:0007631)|G-protein coupled receptor signaling pathway (GO:0007186)|generation of precursor metabolites and energy (GO:0006091)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cytosolic calcium ion concentration (GO:0007204)	integral component of plasma membrane (GO:0005887)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|hormone binding (GO:0042562)|melanin-concentrating hormone receptor activity (GO:0030273)|neuropeptide receptor activity (GO:0008188)			endometrium(5)|large_intestine(7)|lung(6)|pancreas(1)|urinary_tract(1)	20						CTGCCAGGCTACGGAGGAAGA	0.657																																					p.T25A		.											.	MCHR1-90	0			c.A73G						.	A	ALA/THR	2,4404	4.2+/-10.8	0,2,2201	31.0	37.0	35.0		73	3.8	0.3	22	dbSNP_134	35	1,8599	1.2+/-3.3	0,1,4299	no	missense	MCHR1	NM_005297.3	58	0,3,6500	GG,GA,AA		0.0116,0.0454,0.0231	benign	25/423	41075522	3,13003	2203	4300	6503	SO:0001583	missense	2847	exon1			CAGGCTACGGAGG		CCDS14004.1	22q13.3	2014-06-05	2006-02-15	2006-02-15	ENSG00000128285	ENSG00000128285		"""GPCR / Class A : MCH receptors"""	4479	protein-coding gene	gene with protein product		601751	"""G protein-coupled receptor 24"""	GPR24			Standard	XM_005261581		Approved	SLC1, MCH1R	uc003ayz.3	Q99705	OTTHUMG00000150256	ENST00000249016.4:c.73A>G	22.37:g.41075522A>G	ENSP00000249016:p.Thr25Ala	Somatic	111	0		WXS	Illumina GAIIx	Phase_I	145	40	NM_005297	0	0	0	0	0	B2RBX6|Q5R3J1|Q96S47|Q9BV08	Missense_Mutation	SNP	ENST00000249016.4	37	CCDS14004.1	.	.	.	.	.	.	.	.	.	.	A	0.043	-1.276496	0.01410	4.54E-4	1.16E-4	ENSG00000128285	ENST00000249016;ENST00000381433	T;T	0.62232	0.04;0.58	4.86	3.84	0.44239	.	1.193210	0.06392	N	0.717233	T	0.41328	0.1154	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.24083	-1.0170	10	0.13470	T	0.59	.	9.0699	0.36486	0.103:0.0:0.897:0.0	.	25	Q99705	MCHR1_HUMAN	A	25	ENSP00000249016:T25A;ENSP00000370841:T25A	ENSP00000249016:T25A	T	+	1	0	MCHR1	39405468	0.001000	0.12720	0.344000	0.25628	0.289000	0.27227	0.889000	0.28282	1.054000	0.40438	-0.344000	0.07964	ACG	A|1.000;G|0.000		0.657	MCHR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317142.1	NM_005297	
BRD1	23774	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	50198009	50198009	+	Splice_Site	SNP	C	C	A			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr22:50198009C>A	ENST00000216267.8	-	2	1854		c.e2-1		BRD1_ENST00000404034.1_Splice_Site|BRD1_ENST00000457780.2_Splice_Site|BRD1_ENST00000342989.5_Splice_Site|BRD1_ENST00000542442.1_Splice_Site|BRD1_ENST00000404760.1_Splice_Site	NM_014577.1	NP_055392.1	O95696	BRD1_HUMAN	bromodomain containing 1						histone H3 acetylation (GO:0043966)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleus (GO:0005634)	histone binding (GO:0042393)|zinc ion binding (GO:0008270)			endometrium(6)|kidney(3)|large_intestine(5)|lung(17)|ovary(1)|pancreas(1)|prostate(3)|skin(1)	37		all_cancers(38;6.11e-10)|all_epithelial(38;8.06e-09)|all_lung(38;6.64e-05)|Lung NSC(38;0.0011)|Breast(42;0.00235)|Ovarian(80;0.0139)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0369)|BRCA - Breast invasive adenocarcinoma(115;0.21)		CCTATTTAACCTAAAACACAA	0.448																																					.		.											.	BRD1-91	0			c.1368-1G>T						.						73.0	76.0	75.0					22																	50198009		2203	4300	6503	SO:0001630	splice_region_variant	23774	exon3			TTTAACCTAAAAC	AF005067	CCDS14080.1	22q13.33	2008-07-01	2002-01-14		ENSG00000100425	ENSG00000100425			1102	protein-coding gene	gene with protein product	"""BR140-like"""	604589	"""bromodomain-containing 1"""			10591208, 10602503	Standard	NM_014577		Approved	BRL, BRPF2	uc003biv.3	O95696	OTTHUMG00000150288	ENST00000216267.8:c.1368-1G>T	22.37:g.50198009C>A		Somatic	189	0		WXS	Illumina GAIIx	Phase_I	150	55	NM_014577	0	0	0	0	0	A6ZJA4	Splice_Site	SNP	ENST00000216267.8	37	CCDS14080.1	.	.	.	.	.	.	.	.	.	.	C	17.25	3.340960	0.60963	.	.	ENSG00000100425	ENST00000216267;ENST00000404034;ENST00000404760;ENST00000457780;ENST00000542442;ENST00000342989	.	.	.	5.05	5.05	0.67936	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.3901	0.90479	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	BRD1	48584013	1.000000	0.71417	0.998000	0.56505	0.519000	0.34347	7.591000	0.82666	2.366000	0.80165	0.655000	0.94253	.	.		0.448	BRD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317402.1	NM_014577	Intron
CHKB	1120	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	51019907	51019907	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr22:51019907G>T	ENST00000406938.2	-	4	740	c.523C>A	c.(523-525)Cat>Aat	p.H175N	CPT1B_ENST00000440709.1_5'Flank|CPT1B_ENST00000457250.1_5'Flank|CHKB_ENST00000463053.1_5'UTR|CHKB-CPT1B_ENST00000452668.1_5'Flank|CPT1B_ENST00000434492.2_5'Flank|CPT1B_ENST00000360719.2_5'Flank|CHKB-AS1_ENST00000380711.3_RNA|CHKB-CPT1B_ENST00000453634.1_5'Flank	NM_005198.4	NP_005189.2	Q9Y259	CHKB_HUMAN	choline kinase beta	175					CDP-choline pathway (GO:0006657)|glycerophospholipid biosynthetic process (GO:0046474)|muscle organ development (GO:0007517)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|choline kinase activity (GO:0004103)|ethanolamine kinase activity (GO:0004305)			NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(5)|ovary(3)|skin(1)|urinary_tract(1)	15		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		all cancers(3;4.04e-77)|OV - Ovarian serous cystadenocarcinoma(4;5.79e-74)|Epithelial(4;6.17e-70)|GBM - Glioblastoma multiforme(4;5.68e-08)|LUAD - Lung adenocarcinoma(64;0.0016)|Lung(4;0.00942)|BRCA - Breast invasive adenocarcinoma(115;0.205)	Choline(DB00122)	TCCATGCCATGAAATTGCGCC	0.567																																					p.H175N		.											.	CHKB-90	0			c.C523A						.						64.0	54.0	57.0					22																	51019907		2203	4300	6503	SO:0001583	missense	1120	exon4			TGCCATGAAATTG	AB029886	CCDS14099.1	22q13.33	2011-02-16	2004-04-19	2004-04-19	ENSG00000100288	ENSG00000100288			1938	protein-coding gene	gene with protein product		612395	"""choline kinase-like"""	CHKL		9224698, 15003397	Standard	NM_005198		Approved	CHETK	uc003bmv.3	Q9Y259	OTTHUMG00000150275	ENST00000406938.2:c.523C>A	22.37:g.51019907G>T	ENSP00000384400:p.His175Asn	Somatic	105	0		WXS	Illumina GAIIx	Phase_I	79	42	NM_005198	0	0	0	0	0	A0PJM6|Q13388	Missense_Mutation	SNP	ENST00000406938.2	37	CCDS14099.1	.	.	.	.	.	.	.	.	.	.	G	29.6	5.019583	0.93462	.	.	ENSG00000100288	ENST00000406938	T	0.81163	-1.46	4.94	4.94	0.65067	Protein kinase-like domain (1);Choline/ethanolamine kinase (1);	0.000000	0.85682	D	0.000000	D	0.93058	0.7790	H	0.97158	3.95	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95082	0.8214	10	0.87932	D	0	-12.3199	15.6847	0.77400	0.0:0.0:1.0:0.0	.	175	Q9Y259	CHKB_HUMAN	N	175	ENSP00000384400:H175N	ENSP00000384400:H175N	H	-	1	0	CHKB	49366773	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	9.293000	0.96082	2.552000	0.86080	0.561000	0.74099	CAT	.		0.567	CHKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317267.3	NM_005198	
SETMAR	6419	broad.mit.edu	37	3	4355141	4355141	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr3:4355141C>T	ENST00000358065.4	+	2	783	c.716C>T	c.(715-717)tCa>tTa	p.S239L	SUMF1_ENST00000534863.1_Intron|SETMAR_ENST00000425863.1_Intron|SETMAR_ENST00000430981.1_Missense_Mutation_p.S239L	NM_006515.3	NP_006506.3	Q53H47	SETMR_HUMAN	SET domain and mariner transposase fusion gene	239	Histone-lysine N-methyltransferase.|SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing (GO:0000729)|DNA integration (GO:0015074)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of chromosome organization (GO:2001251)|positive regulation of double-strand break repair via nonhomologous end joining (GO:2001034)|transposition, DNA-mediated (GO:0006313)	chromosome (GO:0005694)|nucleus (GO:0005634)	endonuclease activity (GO:0004519)|histone-lysine N-methyltransferase activity (GO:0018024)|protein homodimerization activity (GO:0042803)|structure-specific DNA binding (GO:0043566)|transposase activity (GO:0004803)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|large_intestine(2)|lung(1)|ovary(1)	9		Melanoma(143;0.0657)		Epithelial(13;0.0025)|OV - Ovarian serous cystadenocarcinoma(96;0.011)|all cancers(10;0.0114)		CGAATTGACTCAATGGTACCT	0.358								Chromatin Structure																													p.S239L		.											.	SETMAR-91	0			c.C716T						.						78.0	79.0	79.0					3																	4355141		2203	4300	6503	SO:0001583	missense	6419	exon2			TTGACTCAATGGT	U80776	CCDS2563.2, CCDS58814.1, CCDS63528.1	3p26.2	2013-01-31			ENSG00000170364	ENSG00000170364			10762	protein-coding gene	gene with protein product		609834				9461395	Standard	NM_006515		Approved	metnase	uc011asp.2	Q53H47	OTTHUMG00000090265	ENST00000358065.4:c.716C>T	3.37:g.4355141C>T	ENSP00000373354:p.Ser239Leu	Somatic	227	0		WXS	Illumina GAIIx	Phase_I	206	5	NM_006515	0	0	0	0	0	B4DY74|E7EN68|Q13579|Q1G668|Q96F41	Missense_Mutation	SNP	ENST00000358065.4	37	CCDS2563.2	.	.	.	.	.	.	.	.	.	.	C	20.5	4.005441	0.74932	.	.	ENSG00000170364	ENST00000358065;ENST00000430981	D;D	0.89939	-2.59;-2.59	5.18	4.31	0.51392	SET domain (3);	.	.	.	.	D	0.92169	0.7517	L	0.50919	1.6	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.78314	0.991;0.987	D	0.92641	0.6124	9	0.87932	D	0	.	13.7272	0.62765	0.0:0.9258:0.0:0.0742	.	226;239	Q53H47;C9JHK2	SETMR_HUMAN;.	L	239	ENSP00000373354:S239L;ENSP00000403000:S239L	ENSP00000373354:S239L	S	+	2	0	SETMAR	4330141	1.000000	0.71417	0.988000	0.46212	0.717000	0.41224	7.337000	0.79256	1.172000	0.42781	-0.140000	0.14226	TCA	.		0.358	SETMAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206587.4	NM_006515	
KCNH8	131096	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	19554465	19554465	+	Nonsense_Mutation	SNP	G	G	T			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr3:19554465G>T	ENST00000328405.2	+	13	2349	c.2083G>T	c.(2083-2085)Gag>Tag	p.E695*		NM_144633.2	NP_653234.2	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 8	695					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(3)|lung(37)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	77						GATTTAGTCAGAGCCCAAGGG	0.448																																					p.E695X	NSCLC(124;1625 1765 8018 24930 42026)	.											.	KCNH8-524	0			c.G2083T						.						38.0	38.0	38.0					3																	19554465		2203	4300	6503	SO:0001587	stop_gained	131096	exon13			TAGTCAGAGCCCA	AY053503	CCDS2632.1	3p24.3	2012-07-05			ENSG00000183960	ENSG00000183960		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18864	protein-coding gene	gene with protein product		608260				16382104	Standard	NM_144633		Approved	Kv12.1, elk3	uc003cbk.1	Q96L42	OTTHUMG00000129891	ENST00000328405.2:c.2083G>T	3.37:g.19554465G>T	ENSP00000328813:p.Glu695*	Somatic	171	1		WXS	Illumina GAIIx	Phase_I	141	51	NM_144633	0	0	0	0	0	B7Z2I7|Q59GQ6	Nonsense_Mutation	SNP	ENST00000328405.2	37	CCDS2632.1	.	.	.	.	.	.	.	.	.	.	G	41	8.667986	0.98908	.	.	ENSG00000183960	ENST00000328405	.	.	.	5.44	5.44	0.79542	.	0.000000	0.31821	U	0.007019	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.4503	0.87590	0.0:0.0:1.0:0.0	.	.	.	.	X	695	.	.	E	+	1	0	KCNH8	19529469	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	6.394000	0.73223	2.559000	0.86315	0.585000	0.79938	GAG	.		0.448	KCNH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252139.2	NM_144633	
SCN11A	11280	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	38966970	38966970	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr3:38966970G>C	ENST00000302328.3	-	5	846	c.648C>G	c.(646-648)atC>atG	p.I216M	SCN11A_ENST00000450244.1_Missense_Mutation_p.I216M|SCN11A_ENST00000456224.3_Missense_Mutation_p.I216M|SCN11A_ENST00000444237.2_Missense_Mutation_p.I216M	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit	216					cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GCAATAGTTTGATGGTGATTC	0.468																																					p.I216M		.											.	SCN11A-99	0			c.C648G						.						164.0	138.0	147.0					3																	38966970		2203	4300	6503	SO:0001583	missense	11280	exon5			TAGTTTGATGGTG	AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.648C>G	3.37:g.38966970G>C	ENSP00000307599:p.Ile216Met	Somatic	240	0		WXS	Illumina GAIIx	Phase_I	177	85	NM_014139	0	0	0	0	0	A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Missense_Mutation	SNP	ENST00000302328.3	37	CCDS33737.1	.	.	.	.	.	.	.	.	.	.	G	12.33	1.904631	0.33628	.	.	ENSG00000168356	ENST00000302328;ENST00000450244;ENST00000456224;ENST00000444237	D;D;D;D	0.98455	-4.94;-4.94;-4.94;-4.94	4.79	3.9	0.45041	Ion transport (1);	0.471650	0.23095	N	0.051983	D	0.95379	0.8500	L	0.41906	1.305	0.23930	N	0.996432	B	0.19073	0.033	B	0.17098	0.017	D	0.88861	0.3326	10	0.34782	T	0.22	.	10.3596	0.43984	0.097:0.0:0.903:0.0	.	216	Q9UI33	SCNBA_HUMAN	M	216	ENSP00000307599:I216M;ENSP00000400945:I216M;ENSP00000416757:I216M;ENSP00000408028:I216M	ENSP00000307599:I216M	I	-	3	3	SCN11A	38941974	0.022000	0.18835	0.520000	0.27837	0.049000	0.14656	0.211000	0.17474	2.367000	0.80283	0.467000	0.42956	ATC	.		0.468	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109746.4	NM_014139	
LRIG1	26018	hgsc.bcm.edu	37	3	66550762	66550762	+	Missense_Mutation	SNP	G	G	C	rs1403626	byFrequency	TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr3:66550762G>C	ENST00000273261.3	-	1	594	c.70C>G	c.(70-72)Ctt>Gtt	p.L24V	LRIG1_ENST00000383703.3_Missense_Mutation_p.L24V	NM_015541.2	NP_056356.2	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like domains 1	24			L -> V (in dbSNP:rs1403626).	LLL -> VLV (in Ref. 1; AAK62357 and 3; AAH71561). {ECO:0000305}.	innervation (GO:0060384)|otolith morphogenesis (GO:0032474)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)				NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(4)|stomach(4)|urinary_tract(1)	42		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		CGAAGCAAAAGCAGCCAGAGA	0.766													g|||	3605	0.719848	0.1808	0.8833	5008	,	,		8368	0.8284		0.9732	False		,,,				2504	0.9601				p.L24V		.											.	LRIG1-230	0			c.C70G						.		VAL/LEU	1309,1447		265,779,334	3.0	4.0	4.0		70	3.1	0.5	3	dbSNP_88	4	5325,93		2620,85,4	no	missense	LRIG1	NM_015541.2	32	2885,864,338	CC,CG,GG		1.7165,47.4964,18.8402	benign	24/1094	66550762	6634,1540	1378	2709	4087	SO:0001583	missense	26018	exon1			GCAAAAGCAGCCA	AB050468	CCDS33783.1	3p14	2013-01-14			ENSG00000144749	ENSG00000144749		"""Immunoglobulin superfamily / I-set domain containing"""	17360	protein-coding gene	gene with protein product	"""ortholog of mouse integral membrane glycoprotein LIG-1"", ""leucine-rich repeat protein LRIG1"""	608868				11414704, 12234026	Standard	NM_015541		Approved	LIG-1, DKFZP586O1624, LIG1	uc003dmx.3	Q96JA1	OTTHUMG00000158727	ENST00000273261.3:c.70C>G	3.37:g.66550762G>C	ENSP00000273261:p.Leu24Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_015541	0	0	0	0	0	Q6IQ51|Q96CF9|Q9BYB8|Q9UFI4	Missense_Mutation	SNP	ENST00000273261.3	37	CCDS33783.1	1670	0.7646520146520146	119	0.241869918699187	326	0.9005524861878453	488	0.8531468531468531	737	0.9722955145118733	g	9.592	1.126319	0.20959	0.474964	0.982835	ENSG00000144749	ENST00000273261;ENST00000383703	T;T	0.68765	-0.35;-0.2	3.11	3.11	0.35812	.	0.429988	0.15146	U	0.278020	T	0.00012	0.0000	N	0.19112	0.55	0.39998	P	0.024872000000000005	P;B	0.36282	0.546;0.282	B;B	0.32465	0.146;0.069	T	0.40572	-0.9556	9	0.23891	T	0.37	.	12.0321	0.53403	0.0:0.0:1.0:0.0	rs1403626;rs13083630;rs1403626	24;24	Q96JA1-2;Q96JA1	.;LRIG1_HUMAN	V	24	ENSP00000273261:L24V;ENSP00000373208:L24V	ENSP00000273261:L24V	L	-	1	0	LRIG1	66633452	.	.	0.546000	0.28166	0.017000	0.09413	.	.	1.734000	0.51633	0.472000	0.43445	CTT	G|0.252;C|0.748		0.766	LRIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351930.1	NM_015541	
CHMP2B	25978	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	87294944	87294944	+	Silent	SNP	G	G	A			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr3:87294944G>A	ENST00000263780.4	+	3	445	c.207G>A	c.(205-207)cgG>cgA	p.R69R	CHMP2B_ENST00000472024.1_3'UTR|CHMP2B_ENST00000471660.1_Silent_p.R28R|CHMP2B_ENST00000494980.1_Silent_p.R69R	NM_014043.3	NP_054762.2	Q9UQN3	CHM2B_HUMAN	charged multivesicular body protein 2B	69					cell death (GO:0008219)|endosomal transport (GO:0016197)|membrane organization (GO:0061024)|protein transport (GO:0015031)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	protein domain specific binding (GO:0019904)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(1)|ovary(1)|skin(2)	12	all_cancers(8;0.104)|Lung SC(3;0.184)	Lung NSC(201;0.0777)		LUSC - Lung squamous cell carcinoma(29;0.00241)|Lung(72;0.00712)		TGCATCTACGGAAACAGAAGA	0.353																																					p.R69R		.											.	CHMP2B-229	0			c.G207A						.						82.0	86.0	85.0					3																	87294944		2203	4300	6503	SO:0001819	synonymous_variant	25978	exon3			TCTACGGAAACAG	BC001553	CCDS2918.1, CCDS58840.1	3p12.1	2011-09-21	2011-09-21		ENSG00000083937	ENSG00000083937		"""Charged multivesicular body proteins"""	24537	protein-coding gene	gene with protein product	"""VPS2 homolog B (S. cerevisiae)"""	609512	"""chromatin modifying protein 2B"""			11559748	Standard	NM_014043		Approved	DKFZP564O123, CHMP2.5, VPS2B	uc003dqp.4	Q9UQN3	OTTHUMG00000158982	ENST00000263780.4:c.207G>A	3.37:g.87294944G>A		Somatic	263	0		WXS	Illumina GAIIx	Phase_I	303	109	NM_014043	0	0	0	0	0	B4DJG8|Q53HC7|Q9Y4U6	Silent	SNP	ENST00000263780.4	37	CCDS2918.1																																																																																			.		0.353	CHMP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352779.2	NM_014043	
MYLK	4638	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	123419214	123419214	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr3:123419214G>T	ENST00000475616.1	-	15	3100	c.3101C>A	c.(3100-3102)aCc>aAc	p.T1034N	MYLK_ENST00000360772.3_Missense_Mutation_p.T1034N|MYLK_ENST00000510775.1_5'Flank|MYLK_ENST00000359169.1_Missense_Mutation_p.T1034N|MYLK_ENST00000346322.5_Missense_Mutation_p.T965N|MYLK_ENST00000360304.3_Missense_Mutation_p.T1034N			Q15746	MYLK_HUMAN	myosin light chain kinase	1034	6 X 12 AA approximate tandem repeats.				actin filament organization (GO:0007015)|aorta smooth muscle tissue morphogenesis (GO:0060414)|bleb assembly (GO:0032060)|cellular hypotonic response (GO:0071476)|muscle contraction (GO:0006936)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell migration (GO:0030335)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|smooth muscle contraction (GO:0006939)|tonic smooth muscle contraction (GO:0014820)	cell-cell junction (GO:0005911)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|metal ion binding (GO:0046872)|myosin light chain kinase activity (GO:0004687)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(37)|ovary(7)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	113		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)		TGGCTTCAGGGTCTCAGCAGG	0.582																																					p.T1034N		.											.	MYLK-365	0			c.C3101A						.						141.0	147.0	145.0					3																	123419214		2203	4300	6503	SO:0001583	missense	4638	exon18			TTCAGGGTCTCAG	X85337	CCDS3023.1, CCDS43141.1, CCDS46896.1, CCDS46897.1, CCDS58849.1	3q21	2013-02-11	2008-01-23		ENSG00000065534	ENSG00000065534	2.7.11.18	"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7590	protein-coding gene	gene with protein product	"""smooth muscle myosin light chain kinase"""	600922	"""myosin, light polypeptide kinase"""			8575746	Standard	NM_053026		Approved	MLCK, smMLCK, MYLK1, MLCK1	uc003ego.3	Q15746	OTTHUMG00000141304	ENST00000475616.1:c.3101C>A	3.37:g.123419214G>T	ENSP00000418335:p.Thr1034Asn	Somatic	144	2		WXS	Illumina GAIIx	Phase_I	151	33	NM_053025	0	0	0	0	0	B4DUE3|D3DN97|O95796|O95797|O95798|O95799|Q14844|Q16794|Q17S15|Q3ZCP9|Q5MY99|Q5MYA0|Q6P2N0|Q7Z4J0|Q9C0L5|Q9UBG5|Q9UBY6|Q9UIT9	Missense_Mutation	SNP	ENST00000475616.1	37	CCDS46896.1	.	.	.	.	.	.	.	.	.	.	G	9.886	1.202804	0.22121	.	.	ENSG00000065534	ENST00000360772;ENST00000360304;ENST00000359169;ENST00000346322;ENST00000475616	T;T;T;T;T	0.68331	-0.32;-0.25;-0.32;-0.32;-0.25	5.53	3.74	0.42951	.	.	.	.	.	T	0.69797	0.3151	M	0.72894	2.215	0.80722	D	1	P;P;P;P;D;B	0.58970	0.898;0.741;0.893;0.57;0.984;0.434	P;P;P;B;P;B	0.56788	0.595;0.448;0.568;0.367;0.806;0.166	T	0.66666	-0.5866	9	0.15499	T	0.54	.	5.318	0.15866	0.1693:0.0:0.6268:0.2038	.	1034;112;965;1034;965;1034	Q15746-6;Q15746-7;Q15746-4;Q15746-3;Q15746-2;Q15746	.;.;.;.;.;MYLK_HUMAN	N	1034;1034;1034;965;1034	ENSP00000354004:T1034N;ENSP00000353452:T1034N;ENSP00000352088:T1034N;ENSP00000320622:T965N;ENSP00000418335:T1034N	ENSP00000320622:T965N	T	-	2	0	MYLK	124901904	0.819000	0.29175	1.000000	0.80357	0.295000	0.27426	1.207000	0.32333	0.702000	0.31825	0.455000	0.32223	ACC	.		0.582	MYLK-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356464.1	NM_053025	
SMC4	10051	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	160148934	160148934	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr3:160148934G>C	ENST00000357388.3	+	20	3506	c.3055G>C	c.(3055-3057)Gaa>Caa	p.E1019Q	SMC4_ENST00000462787.1_Intron|SMC4_ENST00000360111.2_Intron|SMC4_ENST00000469762.1_Missense_Mutation_p.E994Q|SMC4_ENST00000344722.5_Missense_Mutation_p.E1019Q|RP11-432B6.3_ENST00000483754.1_Intron	NM_001002800.1	NP_001002800.1	Q9NTJ3	SMC4_HUMAN	structural maintenance of chromosomes 4	1019					kinetochore organization (GO:0051383)|meiotic chromosome condensation (GO:0010032)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)|mitotic sister chromatid segregation (GO:0000070)	condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(15)|lung(20)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			GTTGAAACTTGAACAAATAGA	0.294																																					p.E1019Q		.											.	SMC4-291	0			c.G3055C						.						45.0	46.0	46.0					3																	160148934		2203	4298	6501	SO:0001583	missense	10051	exon19			AAACTTGAACAAA	AF092564	CCDS3189.1, CCDS75046.1	3q26.1	2006-07-06	2006-07-06	2006-07-06	ENSG00000113810	ENSG00000113810		"""Structural maintenance of chromosomes proteins"""	14013	protein-coding gene	gene with protein product		605575	"""SMC4 (structural maintenance of chromosomes 4, yeast)-like 1"", ""SMC4 structural maintenance of chromosomes 4-like 1 (yeast)"""	SMC4L1		9789013, 10319587	Standard	NM_005496		Approved	hCAP-C, CAP-C	uc003fdh.3	Q9NTJ3	OTTHUMG00000159006	ENST00000357388.3:c.3055G>C	3.37:g.160148934G>C	ENSP00000349961:p.Glu1019Gln	Somatic	192	0		WXS	Illumina GAIIx	Phase_I	227	54	NM_005496	0	0	0	0	0	A6NLT9|D3DNL8|O95752|Q8NDL4|Q9UNT9	Missense_Mutation	SNP	ENST00000357388.3	37	CCDS3189.1	.	.	.	.	.	.	.	.	.	.	G	19.51	3.841770	0.71488	.	.	ENSG00000113810	ENST00000357388;ENST00000469762;ENST00000344722;ENST00000545277	T;T;T	0.76839	-1.05;-1.01;-1.05	5.95	5.95	0.96441	RecF/RecN/SMC (1);	0.000000	0.85682	D	0.000000	D	0.86527	0.5954	L	0.60957	1.885	0.80722	D	1	B;D;D	0.89917	0.41;1.0;0.993	P;D;D	0.87578	0.45;0.998;0.914	T	0.82333	-0.0509	10	0.27785	T	0.31	-26.7875	20.3967	0.98985	0.0:0.0:1.0:0.0	.	994;994;1019	B3KXX5;E9PD53;Q9NTJ3	.;.;SMC4_HUMAN	Q	1019;994;1019;613	ENSP00000349961:E1019Q;ENSP00000417964:E994Q;ENSP00000341382:E1019Q	ENSP00000341382:E1019Q	E	+	1	0	SMC4	161631628	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.192000	0.94947	2.829000	0.97493	0.655000	0.94253	GAA	.		0.294	SMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352862.1		
FXR1	8087	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	180687983	180687983	+	Silent	SNP	T	T	A			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr3:180687983T>A	ENST00000357559.4	+	15	1824	c.1440T>A	c.(1438-1440)ctT>ctA	p.L480L	FXR1_ENST00000445140.2_Silent_p.L480L|FXR1_ENST00000491062.1_Silent_p.L431L|FXR1_ENST00000468861.1_Silent_p.L395L|FXR1_ENST00000480918.1_Silent_p.L467L|FXR1_ENST00000305586.7_Silent_p.L395L	NM_001013438.2|NM_005087.3	NP_001013456.1|NP_005078.2	P51114	FXR1_HUMAN	fragile X mental retardation, autosomal homolog 1	480					apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|muscle organ development (GO:0007517)|negative regulation of translation (GO:0017148)	costamere (GO:0043034)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|polysome (GO:0005844)	G-quadruplex RNA binding (GO:0002151)|mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|endometrium(4)|large_intestine(5)|lung(12)|skin(2)	26	all_cancers(143;6.07e-14)|Ovarian(172;0.0212)		Epithelial(37;3.05e-35)|OV - Ovarian serous cystadenocarcinoma(80;2.4e-22)			ACAGCTTACTTGATAATACAG	0.418																																					p.L480L		.											.	FXR1-153	0			c.T1440A						.						104.0	94.0	98.0					3																	180687983		2203	4300	6503	SO:0001819	synonymous_variant	8087	exon15			CTTACTTGATAAT	M67468	CCDS3238.1, CCDS33894.1, CCDS46965.1	3q28	2014-01-28			ENSG00000114416	ENSG00000114416			4023	protein-coding gene	gene with protein product		600819				7781595, 9642279	Standard	NM_005087		Approved		uc003fkq.3	P51114	OTTHUMG00000158138	ENST00000357559.4:c.1440T>A	3.37:g.180687983T>A		Somatic	224	0		WXS	Illumina GAIIx	Phase_I	232	26	NM_001013438	0	0	0	0	0	A8K9B8|Q7Z450|Q8N6R8	Silent	SNP	ENST00000357559.4	37	CCDS3238.1	.	.	.	.	.	.	.	.	.	.	T	10.64	1.407968	0.25378	.	.	ENSG00000114416	ENST00000482125	.	.	.	5.91	4.77	0.60923	.	0.114678	0.64402	D	0.000012	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-20.0485	8.5286	0.33319	0.0:0.0683:0.1316:0.8001	.	.	.	.	X	81	.	.	L	+	2	0	FXR1	182170677	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.622000	0.36997	2.263000	0.75096	0.528000	0.53228	TTG	.		0.418	FXR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350265.5		
DGKG	1608	hgsc.bcm.edu	37	3	185985480	185985480	+	Silent	SNP	G	G	T			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr3:185985480G>T	ENST00000265022.3	-	13	1742	c.1203C>A	c.(1201-1203)atC>atA	p.I401I	DGKG_ENST00000382164.4_Silent_p.I362I|DGKG_ENST00000544847.1_Silent_p.I362I|DGKG_ENST00000344484.4_Silent_p.I401I	NM_001080744.1|NM_001080745.1|NM_001346.2	NP_001074213.1|NP_001074214.1|NP_001337.2	P49619	DGKG_HUMAN	diacylglycerol kinase, gamma 90kDa	401					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|neuron development (GO:0048666)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(17)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	42	all_cancers(143;3.26e-12)|Ovarian(172;0.0315)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)	GBM - Glioblastoma multiforme(93;0.0657)	Phosphatidylserine(DB00144)	TTACCCGGGTGATGGGGCATA	0.542																																					p.I401I		.											.	DGKG-714	0			c.C1203A						.						108.0	107.0	107.0					3																	185985480		2203	4300	6503	SO:0001819	synonymous_variant	1608	exon13			CCGGGTGATGGGG	AF020945	CCDS3274.1, CCDS43181.1, CCDS43182.1	3q27-q28	2013-01-10	2002-08-29		ENSG00000058866	ENSG00000058866	2.7.1.107	"""EF-hand domain containing"""	2853	protein-coding gene	gene with protein product		601854	"""diacylglycerol kinase, gamma (90kD)"""	DAGK3		8034597	Standard	NM_001080744		Approved		uc003fqa.3	P49619	OTTHUMG00000156617	ENST00000265022.3:c.1203C>A	3.37:g.185985480G>T		Somatic	61	0		WXS	Illumina GAIIx	Phase_I	63	4	NM_001346	0	0	0	0	0	B2RAH4|Q2M1H4|Q5FWG1	Silent	SNP	ENST00000265022.3	37	CCDS3274.1																																																																																			.		0.542	DGKG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344800.3		
ATP13A5	344905	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	193032830	193032830	+	Silent	SNP	A	A	G			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr3:193032830A>G	ENST00000342358.4	-	18	2206	c.2089T>C	c.(2089-2091)Ttg>Ctg	p.L697L	ATP13A5-AS1_ENST00000414634.1_RNA|ATP13A5_ENST00000495496.1_5'Flank	NM_198505.2	NP_940907.2	Q4VNC0	AT135_HUMAN	ATPase type 13A5	697						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(2)|breast(1)|endometrium(6)|kidney(4)|large_intestine(15)|liver(2)|lung(26)|ovary(5)|prostate(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)		TCTTTTTTCAAGCGATTCTCC	0.398																																					p.L697L		.											.	ATP13A5-144	0			c.T2089C						.						137.0	131.0	133.0					3																	193032830		2203	4300	6503	SO:0001819	synonymous_variant	344905	exon18			TTTTCAAGCGATT	AK122613	CCDS33914.1	3q29	2010-04-20			ENSG00000187527	ENSG00000187527		"""ATPases / P-type"""	31789	protein-coding gene	gene with protein product							Standard	NM_198505		Approved	FLJ16025	uc011bsq.2	Q4VNC0	OTTHUMG00000156101	ENST00000342358.4:c.2089T>C	3.37:g.193032830A>G		Somatic	41	0		WXS	Illumina GAIIx	Phase_I	68	23	NM_198505	0	0	0	0	0	Q6UWS4|Q6ZWL0	Silent	SNP	ENST00000342358.4	37	CCDS33914.1																																																																																			.		0.398	ATP13A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343012.1	NM_198505	
MUC4	4585	broad.mit.edu	37	3	195511814	195511814	+	Missense_Mutation	SNP	T	T	C	rs72499650|rs71291864	byFrequency	TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr3:195511814T>C	ENST00000463781.3	-	2	7096	c.6637A>G	c.(6637-6639)Agc>Ggc	p.S2213G	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.S2213G	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAGGAAGGGCTGGTGACAGGA	0.602													.|||	229	0.0457268	0.0431	0.0187	5008	,	,		15270	0.0813		0.0358	False		,,,				2504	0.0419				p.S2213G		.											.	MUC4-90	0			c.A6637G						.						39.0	32.0	34.0					3																	195511814		690	1590	2280	SO:0001583	missense	4585	exon2			AAGGGCTGGTGAC	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.6637A>G	3.37:g.195511814T>C	ENSP00000417498:p.Ser2213Gly	Somatic	202	2		WXS	Illumina GAIIx	Phase_I	214	7	NM_018406	0	0	0	0	0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	T	5.271	0.235382	0.10023	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.32988	1.43;1.48	.	.	.	.	.	.	.	.	T	0.18130	0.0435	N	0.19112	0.55	0.22457	N	0.999084	P	0.47302	0.893	B	0.42319	0.383	T	0.11372	-1.0590	6	.	.	.	.	.	.	.	.	2213	E7ESK3	.	G	2213	ENSP00000417498:S2213G;ENSP00000420243:S2213G	.	S	-	1	0	MUC4	196996209	0.000000	0.05858	0.077000	0.20336	0.022000	0.10575	-2.924000	0.00692	0.408000	0.25621	0.055000	0.15244	AGC	T|0.500;C|0.500		0.602	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
PIGG	54872	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	517287	517289	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	CTT	CTT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr4:517287_517289delCTT	ENST00000453061.2	+	9	1760_1762	c.1654_1656delCTT	c.(1654-1656)cttdel	p.L553del	PIGG_ENST00000383028.4_In_Frame_Del_p.L420del|PIGG_ENST00000296306.7_3'UTR|PIGG_ENST00000310340.5_In_Frame_Del_p.L545del|PIGG_ENST00000504346.1_In_Frame_Del_p.L464del	NM_001127178.1	NP_001120650.1	Q5H8A4	PIGG_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class G	553					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	CP2 mannose-ethanolamine phosphotransferase activity (GO:0051267)|phosphotransferase activity, for other substituted phosphate groups (GO:0016780)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	39						AGAGCTAGACCTTCTTATTCTGT	0.547																																					p.552_552del		.											.	PIGG-92	0			c.1654_1656del						.		,	0,4250		0,0,2125					,	-8.5	0.0			210	4,8240		1,2,4119	no	coding,coding	PIGG	NM_017733.3,NM_001127178.1	,	1,2,6244	A1A1,A1R,RR		0.0485,0.0,0.032	,	,		4,12490				SO:0001651	inframe_deletion	54872	exon9			CTAGACCTTCTTA		CCDS3336.1, CCDS46992.1, CCDS75080.1, CCDS75081.1, CCDS75082.1, CCDS75083.1	4p16.3	2013-02-26	2006-06-28		ENSG00000174227	ENSG00000174227		"""Phosphatidylinositol glycan anchor biosynthesis"""	25985	protein-coding gene	gene with protein product			"""phosphatidylinositol glycan, class G"""			15632136	Standard	XM_005272287		Approved	FLJ20265, GPI7, LAS21	uc003gak.4	Q5H8A4	OTTHUMG00000112457	ENST00000453061.2:c.1654_1656delCTT	4.37:g.517290_517292delCTT	ENSP00000415203:p.Leu553del	Somatic	212	0		WXS	Illumina GAIIx	Phase_I	248	64	NM_001127178	0	0	0	0	0	B4DKC7|Q2TAK5|Q6UX31|Q7L5Y4|Q8N866|Q8NCC9|Q96SY9|Q9BVT7|Q9NXG5	In_Frame_Del	DEL	ENST00000453061.2	37	CCDS46992.1																																																																																			.		0.547	PIGG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000357494.1	NM_017733	
NMU	10874	hgsc.bcm.edu	37	4	56502307	56502307	+	Missense_Mutation	SNP	G	G	T	rs3828555	byFrequency	TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr4:56502307G>T	ENST00000264218.3	-	1	158	c.53C>A	c.(52-54)gCg>gAg	p.A18E	NMU_ENST00000511469.1_Missense_Mutation_p.A18E|NMU_ENST00000505262.1_Missense_Mutation_p.A18E|NMU_ENST00000507338.1_Missense_Mutation_p.A18E|NMU_ENST00000515325.1_Intron	NM_006681.2	NP_006672.1	P48645	NMU_HUMAN	neuromedin U	18					digestion (GO:0007586)|eating behavior (GO:0042755)|G-protein coupled receptor signaling pathway (GO:0007186)|gastric acid secretion (GO:0001696)|neuropeptide signaling pathway (GO:0007218)|photoperiodism (GO:0009648)|positive regulation of hormone secretion (GO:0046887)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of synaptic transmission (GO:0050806)|regulation of smooth muscle contraction (GO:0006940)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|terminal bouton (GO:0043195)	receptor binding (GO:0005102)			lung(3)|ovary(1)|urinary_tract(1)	5	Lung NSC(11;0.00256)|all_epithelial(27;0.075)|Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.103)	LUSC - Lung squamous cell carcinoma(4;6.72e-08)|Lung(4;6.22e-07)|Epithelial(7;0.00559)	LUSC - Lung squamous cell carcinoma(721;0.0115)		cGGGGACGCCGCGGCCACCTG	0.761													G|||	730	0.145767	0.0764	0.2003	5008	,	,		10197	0.3343		0.0199	False		,,,				2504	0.136				p.A18E		.											.	NMU-650	0			c.C53A						.	G	GLU/ALA	168,3058		3,162,1448	5.0	7.0	6.0		53	0.1	0.0	4	dbSNP_107	6	138,5846		0,138,2854	no	missense	NMU	NM_006681.2	107	3,300,4302	TT,TG,GG		2.3061,5.2077,3.3225	probably-damaging	18/175	56502307	306,8904	1613	2992	4605	SO:0001583	missense	10874	exon1			GACGCCGCGGCCA	X76029	CCDS3501.1, CCDS75125.1	4q12	2013-02-26			ENSG00000109255	ENSG00000109255		"""Endogenous ligands"""	7859	protein-coding gene	gene with protein product	"""prepro-NMU"""	605103				7619205	Standard	XM_005265713		Approved		uc003hbc.3	P48645	OTTHUMG00000102161	ENST00000264218.3:c.53C>A	4.37:g.56502307G>T	ENSP00000264218:p.Ala18Glu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_006681	0	0	0	0	0		Missense_Mutation	SNP	ENST00000264218.3	37	CCDS3501.1	315	0.14423076923076922	55	0.11178861788617886	55	0.15193370165745856	187	0.3269230769230769	18	0.023746701846965697	G	17.40	3.379938	0.61845	0.052077	0.023061	ENSG00000109255	ENST00000511469;ENST00000264218;ENST00000505262;ENST00000541393;ENST00000507338	T;T;T;T	0.35973	1.28;1.42;1.4;1.39	2.89	0.0796	0.14417	.	1.355690	0.05554	U	0.568010	T	0.00012	0.0000	N	0.22421	0.69	0.80722	P	0.0	P	0.38827	0.649	B	0.37015	0.239	T	0.31110	-0.9955	9	0.62326	D	0.03	-4.4644	5.3309	0.15932	0.4241:0.0:0.5759:0.0	rs3828555	18	P48645	NMU_HUMAN	E	18	ENSP00000422399:A18E;ENSP00000264218:A18E;ENSP00000424246:A18E;ENSP00000422870:A18E	ENSP00000264218:A18E	A	-	2	0	NMU	56197064	0.000000	0.05858	0.003000	0.11579	0.256000	0.26092	0.190000	0.17057	-0.022000	0.13986	0.195000	0.17529	GCG	G|0.853;T|0.147		0.761	NMU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220006.2		
DSPP	1834	bcgsc.ca	37	4	88537294	88537294	+	Silent	SNP	T	T	C	rs111216206		TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr4:88537294T>C	ENST00000282478.7	+	4	3513	c.3480T>C	c.(3478-3480)agT>agC	p.S1160S	DSPP_ENST00000399271.1_Silent_p.S1160S|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1160	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gcgacagcagtgacagcagcg	0.567																																					p.S1160S		.											.	DSPP-90	0			c.T3480C						.						43.0	58.0	53.0					4																	88537294		1580	2849	4429	SO:0001819	synonymous_variant	1834	exon5			CAGCAGTGACAGC	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3480T>C	4.37:g.88537294T>C		Somatic	782	16		WXS	Illumina GAIIx	Phase_I	569	157	NM_014208	0	0	0	0	0	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	37	CCDS43248.1																																																																																			.		0.567	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
SH3D19	152503	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	152043252	152043252	+	Missense_Mutation	SNP	C	C	G	rs199694166		TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr4:152043252C>G	ENST00000409252.2	-	20	3071	c.2364G>C	c.(2362-2364)caG>caC	p.Q788H	SH3D19_ENST00000514152.1_Missense_Mutation_p.Q765H|SH3D19_ENST00000409598.4_Missense_Mutation_p.Q765H|SH3D19_ENST00000427414.2_Missense_Mutation_p.Q729H|SH3D19_ENST00000304527.4_Missense_Mutation_p.Q788H|SH3D19_ENST00000455740.1_Missense_Mutation_p.Q765H|SH3D19_ENST00000424281.1_Missense_Mutation_p.Q729H			Q5HYK7	SH319_HUMAN	SH3 domain containing 19	788	SH3 5. {ECO:0000255|PROSITE- ProRule:PRU00192}.				cytoskeleton organization (GO:0007010)|membrane organization (GO:0061024)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of cell morphogenesis (GO:0022604)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	proline-rich region binding (GO:0070064)			autonomic_ganglia(1)|endometrium(1)|large_intestine(3)|lung(10)|ovary(1)|skin(3)|urinary_tract(1)	20	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.138)				TCTAGCTGATCTGTAGAAACT	0.363																																					p.Q788H		.											.	SH3D19-92	0			c.G2364C						.						130.0	128.0	129.0					4																	152043252		2203	4300	6503	SO:0001583	missense	152503	exon21			GCTGATCTGTAGA	BX647422	CCDS34077.2, CCDS47143.1, CCDS47144.1	4q31.3	2009-03-05	2009-03-05	2009-03-05	ENSG00000109686	ENSG00000109686			30418	protein-coding gene	gene with protein product	"""EEN binding protein"""	608674				12477932	Standard	NM_001009555		Approved	DKFZp434D0215, EVE1, EBP, Kryn, SH3P19	uc010ipl.1	Q5HYK7	OTTHUMG00000154051	ENST00000409252.2:c.2364G>C	4.37:g.152043252C>G	ENSP00000386848:p.Gln788His	Somatic	77	0		WXS	Illumina GAIIx	Phase_I	49	19	NM_001009555	0	0	0	0	0	B7Z296|Q08EK1|Q32N10|Q5U3B8|Q86XB3|Q8N5E7|Q9UFC8	Missense_Mutation	SNP	ENST00000409252.2	37	CCDS34077.2	.	.	.	.	.	.	.	.	.	.	c	9.357	1.066901	0.20067	.	.	ENSG00000109686	ENST00000409598;ENST00000304527;ENST00000455740;ENST00000424281;ENST00000427414;ENST00000409252;ENST00000514152	T;T;T;T;T;T;T	0.30182	1.54;1.54;1.54;1.54;1.54;1.54;1.54	5.44	-0.483	0.12075	Src homology-3 domain (3);	0.528865	0.17331	N	0.178115	T	0.30070	0.0753	N	0.25094	0.71	0.09310	N	0.999995	D;D;D;D	0.67145	0.993;0.996;0.988;0.993	P;D;P;P	0.63597	0.758;0.916;0.816;0.825	T	0.11941	-1.0567	10	0.62326	D	0.03	-3.2055	4.1919	0.10424	0.1202:0.0668:0.3747:0.4383	.	788;765;729;543	Q5HYK7;Q5HYK7-2;Q5HYK7-3;B3KY23	SH319_HUMAN;.;.;.	H	765;788;765;729;729;788;765	ENSP00000387030:Q765H;ENSP00000302913:Q788H;ENSP00000416708:Q765H;ENSP00000404542:Q729H;ENSP00000415694:Q729H;ENSP00000386848:Q788H;ENSP00000423449:Q765H	ENSP00000302913:Q788H	Q	-	3	2	SH3D19	152262702	0.997000	0.39634	0.990000	0.47175	0.019000	0.09904	0.880000	0.28159	-0.227000	0.09884	-1.372000	0.01188	CAG	C|0.999;A|0.001		0.363	SH3D19-002	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000335132.3	NM_001009555	
DCHS2	54798	broad.mit.edu	37	4	155411939	155411939	+	Missense_Mutation	SNP	A	A	C	rs17373874	byFrequency	TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr4:155411939A>C	ENST00000339452.1	-	1	929	c.569T>G	c.(568-570)gTt>gGt	p.V190G	DCHS2_ENST00000456341.2_Missense_Mutation_p.V183G|DCHS2_ENST00000443500.1_Missense_Mutation_p.V190G	NM_001142552.1	NP_001136024.1	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	1396	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		ATCGTGGGCAACTGGCAGGCG	0.662													C|||	2034	0.40615	0.466	0.4986	5008	,	,		15381	0.1667		0.4632	False		,,,				2504	0.4479				p.V190G		.											.	DCHS2-94	0			c.T569G						.	C	GLY/VAL,GLY/VAL	695,689		176,343,173	25.0	33.0	31.0		569,569	3.8	0.4	4	dbSNP_123	31	1428,1754		333,762,496	yes	missense,missense	DCHS2	NM_001142552.1,NM_001142553.1	109,109	509,1105,669	CC,CA,AA		44.8774,49.7832,46.4958	,	190/1370,190/710	155411939	2123,2443	692	1591	2283	SO:0001583	missense	54798	exon1			TGGGCAACTGGCA	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000339452.1:c.569T>G	4.37:g.155411939A>C	ENSP00000345062:p.Val190Gly	Somatic	111	1		WXS	Illumina GAIIx	Phase_I	147	4	NM_001142552	0	0	0	0	0	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	ENST00000339452.1	37	CCDS47150.1	829	0.37957875457875456	219	0.4451219512195122	175	0.48342541436464087	82	0.14335664335664336	353	0.4656992084432718	C	0.010	-1.759958	0.00657	0.502168	0.448774	ENSG00000197410	ENST00000339452;ENST00000544161;ENST00000456341;ENST00000443500	T;T;T	0.59906	0.23;0.23;0.23	4.72	3.81	0.43845	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.27730	P	0.9448348	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.41466	-0.9507	7	0.06757	T	0.87	.	8.3588	0.32346	0.1347:0.4827:0.3826:0.0	rs17373874;rs17373874	190;190	E9PG03;E9PC11	.;.	G	190;190;183;190	ENSP00000345062:V190G;ENSP00000408543:V183G;ENSP00000395539:V190G	ENSP00000345062:V190G	V	-	2	0	DCHS2	155631389	0.480000	0.25933	0.436000	0.26797	0.097000	0.18754	2.713000	0.47194	0.988000	0.38734	-0.358000	0.07595	GTT	A|0.633;C|0.367		0.662	DCHS2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000365282.1	NM_001142552	
DCHS2	54798	broad.mit.edu	37	4	155411948	155411948	+	Missense_Mutation	SNP	C	C	A	rs184619033	byFrequency	TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr4:155411948C>A	ENST00000339452.1	-	1	920	c.560G>T	c.(559-561)cGc>cTc	p.R187L	DCHS2_ENST00000456341.2_Missense_Mutation_p.R180L|DCHS2_ENST00000443500.1_Missense_Mutation_p.R187L	NM_001142552.1	NP_001136024.1	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	1394	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		AACTGGCAGGCGGAAGGCGGT	0.667													C|||	9	0.00179712	0.0	0.0043	5008	,	,		15164	0.0		0.005	False		,,,				2504	0.001				p.R187L		.											.	DCHS2-94	0			c.G560T						.	C	LEU/ARG,LEU/ARG	1,1383		0,1,691	22.0	30.0	28.0		560,560	4.7	1.0	4		28	20,3162		0,20,1571	yes	missense,missense	DCHS2	NM_001142552.1,NM_001142553.1	102,102	0,21,2262	AA,AC,CC		0.6285,0.0723,0.4599	,	187/1370,187/710	155411948	21,4545	692	1591	2283	SO:0001583	missense	54798	exon1			GGCAGGCGGAAGG	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000339452.1:c.560G>T	4.37:g.155411948C>A	ENSP00000345062:p.Arg187Leu	Somatic	112	0		WXS	Illumina GAIIx	Phase_I	152	3	NM_001142552	0	0	0	0	0	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	ENST00000339452.1	37	CCDS47150.1	6	0.0027472527472527475	0	0.0	3	0.008287292817679558	0	0.0	3	0.00395778364116095	C	14.58	2.577376	0.45902	7.23E-4	0.006285	ENSG00000197410	ENST00000339452;ENST00000544161;ENST00000456341;ENST00000443500	T;T;T	0.63417	-0.04;-0.04;-0.04	4.72	4.72	0.59763	.	.	.	.	.	T	0.53094	0.1775	N	0.11131	0.1	0.21445	N	0.999689	B;D	0.64830	0.158;0.994	B;P	0.62560	0.094;0.904	T	0.56402	-0.7985	9	0.27082	T	0.32	.	17.2923	0.87160	0.0:1.0:0.0:0.0	.	187;187	E9PG03;E9PC11	.;.	L	187;187;180;187	ENSP00000345062:R187L;ENSP00000408543:R180L;ENSP00000395539:R187L	ENSP00000345062:R187L	R	-	2	0	DCHS2	155631398	0.984000	0.35163	1.000000	0.80357	0.273000	0.26683	0.206000	0.17375	2.162000	0.67917	0.462000	0.41574	CGC	C|0.997;A|0.003		0.667	DCHS2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000365282.1	NM_001142552	
PDCD6	10016	broad.mit.edu	37	5	311455	311455	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr5:311455G>C	ENST00000264933.4	+	5	515	c.415G>C	c.(415-417)Gac>Cac	p.D139H	AHRR_ENST00000316418.5_Intron|PDCD6_ENST00000511482.1_3'UTR|PDCD6_ENST00000505221.1_Intron|AHRR_ENST00000505113.1_Intron|PDCD6_ENST00000507528.1_Missense_Mutation_p.D137H|AHRR_ENST00000512529.1_Intron	NM_001267556.1|NM_001267558.1|NM_013232.3	NP_001254485.1|NP_001254487.1|NP_037364.1	O75340	PDCD6_HUMAN	programmed cell death 6	139	EF-hand 4. {ECO:0000255|PROSITE- ProRule:PRU00448}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|cellular response to heat (GO:0034605)|intracellular protein transport (GO:0006886)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|proteolysis (GO:0006508)|response to calcium ion (GO:0051592)|vascular endothelial growth factor receptor-2 signaling pathway (GO:0036324)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	binding, bridging (GO:0060090)|calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|calcium-dependent protein binding (GO:0048306)|protein dimerization activity (GO:0046983)			breast(2)|endometrium(1)|large_intestine(4)|lung(1)	8			Epithelial(17;0.00193)|OV - Ovarian serous cystadenocarcinoma(19;0.00489)|all cancers(22;0.00511)|Lung(60;0.113)			TCGAAAGTTTGACAGGCAGGG	0.567																																					p.D139H		.											.	PDCD6-290	0			c.G415C						.						107.0	88.0	94.0					5																	311455		2203	4299	6502	SO:0001583	missense	10016	exon5			AAGTTTGACAGGC	AF035606	CCDS3854.1, CCDS58940.1, CCDS58941.1, CCDS75222.1, CCDS75223.1	5p15.33	2013-01-10			ENSG00000249915	ENSG00000249915		"""EF-hand domain containing"""	8765	protein-coding gene	gene with protein product	"""apoptosis-linked gene-2"""	601057				8560270	Standard	NM_013232		Approved	ALG-2, PEF1B	uc003jat.1	O75340	OTTHUMG00000090283	ENST00000264933.4:c.415G>C	5.37:g.311455G>C	ENSP00000264933:p.Asp139His	Somatic	176	0		WXS	Illumina GAIIx	Phase_I	157	5	NM_013232	0	0	0	0	0	B2RD16|E7ESR3|Q2YDC2|Q5TZS0	Missense_Mutation	SNP	ENST00000264933.4	37	CCDS3854.1	.	.	.	.	.	.	.	.	.	.	g	19.59	3.855789	0.71834	.	.	ENSG00000249915	ENST00000264933;ENST00000507528;ENST00000507473	D;D;D	0.96073	-2.83;-2.83;-3.9	5.83	5.83	0.93111	EF-hand-like domain (1);	.	.	.	.	D	0.98789	0.9592	H	0.98426	4.23	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.99;0.997	D	0.99466	1.0944	9	0.87932	D	0	.	17.6162	0.88068	0.0:0.0:1.0:0.0	.	137;139	Q2YDC2;O75340	.;PDCD6_HUMAN	H	139;137;52	ENSP00000264933:D139H;ENSP00000423815:D137H;ENSP00000425370:D52H	ENSP00000264933:D139H	D	+	1	0	PDCD6	364455	1.000000	0.71417	0.992000	0.48379	0.265000	0.26407	9.352000	0.97076	2.763000	0.94921	0.655000	0.94253	GAC	.		0.567	PDCD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206609.2	NM_013232	
RAD1	5810	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	34913589	34913589	+	Nonsense_Mutation	SNP	G	G	C			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr5:34913589G>C	ENST00000382038.2	-	3	1712	c.293C>G	c.(292-294)tCa>tGa	p.S98*	RAD1_ENST00000341754.4_Nonsense_Mutation_p.S98*|BRIX1_ENST00000336767.5_5'Flank	NM_002853.3	NP_002844.1	O60671	RAD1_HUMAN	RAD1 checkpoint DNA exonuclease	98					cellular response to DNA damage stimulus (GO:0006974)|cellular response to ionizing radiation (GO:0071479)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|meiotic recombination checkpoint (GO:0051598)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|substantia nigra development (GO:0021762)	chromosome (GO:0005694)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|damaged DNA binding (GO:0003684)|exodeoxyribonuclease III activity (GO:0008853)			endometrium(3)|large_intestine(1)|lung(5)|urinary_tract(1)	10	all_lung(31;0.000107)	Lung NSC(810;5.19e-05)|Ovarian(839;0.0448)|Breast(839;0.198)	COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)			CATAGGACTTGATCCAAAAAT	0.318								Other conserved DNA damage response genes																													p.S98X		.											.	RAD1-227	0			c.C293G						.						40.0	42.0	41.0					5																	34913589		2203	4289	6492	SO:0001587	stop_gained	5810	exon3			GGACTTGATCCAA	AF074717	CCDS3905.1	5p13	2014-08-08	2014-08-08		ENSG00000113456	ENSG00000113456	3.1.11.2		9806	protein-coding gene	gene with protein product	"""exonuclease homolog RAD1"", ""checkpoint control protein HRAD1"", ""cell cycle checkpoint protein Hrad1"", ""Rad1-like DNA damage checkpoint"", ""DNA repair exonuclease REC1"""	603153	"""RAD1 (S. pombe) homolog"", ""RAD1 homolog (S. pombe)"""			9716408, 9828137	Standard	NR_026591		Approved	HRAD1, REC1	uc003jix.3	O60671	OTTHUMG00000090783	ENST00000382038.2:c.293C>G	5.37:g.34913589G>C	ENSP00000371469:p.Ser98*	Somatic	195	0		WXS	Illumina GAIIx	Phase_I	232	52	NM_002853	0	0	0	0	0	O75572|O95304|Q1W161|Q5KSM0|Q5KSM1|Q9UEP1	Nonsense_Mutation	SNP	ENST00000382038.2	37	CCDS3905.1	.	.	.	.	.	.	.	.	.	.	G	44	11.127349	0.99519	.	.	ENSG00000113456	ENST00000382038;ENST00000341754	.	.	.	5.34	5.34	0.76211	.	0.142714	0.47093	D	0.000256	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	.	19.4219	0.94725	0.0:0.0:1.0:0.0	.	.	.	.	X	98	.	ENSP00000340879:S98X	S	-	2	0	RAD1	34949346	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	6.126000	0.71635	2.659000	0.90383	0.655000	0.94253	TCA	.		0.318	RAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207567.1	NM_002853	
EGFLAM	133584	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	38427121	38427121	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr5:38427121G>C	ENST00000354891.3	+	14	2167	c.1821G>C	c.(1819-1821)ttG>ttC	p.L607F	EGFLAM_ENST00000336740.6_Missense_Mutation_p.L373F|EGFLAM_ENST00000322350.5_Missense_Mutation_p.L607F|EGFLAM-AS1_ENST00000508986.1_RNA|EGFLAM_ENST00000397202.2_5'UTR	NM_001205301.1	NP_001192230.1	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G domains	607					extracellular matrix organization (GO:0030198)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|cell junction (GO:0030054)|interstitial matrix (GO:0005614)|synapse (GO:0045202)	glycosaminoglycan binding (GO:0005539)			NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(43)|ovary(1)|pancreas(3)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	85	all_lung(31;0.000385)					CTTTCACCTTGACCATTCCTC	0.488																																					p.L607F	Colon(62;485 1295 3347 17454)	.											.	EGFLAM-187	0			c.G1821C						.						185.0	181.0	182.0					5																	38427121		2203	4300	6503	SO:0001583	missense	133584	exon14			CACCTTGACCATT	AK097549	CCDS3924.1, CCDS3925.1, CCDS47199.1, CCDS56363.1	5p13.2-p13.1	2014-04-03			ENSG00000164318	ENSG00000164318		"""Fibronectin type III domain containing"""	26810	protein-coding gene	gene with protein product	"""pikachurin"", ""agrin-like"""					18641643, 20078962, 22760553	Standard	NM_182801		Approved	FLJ39155, AGRINL, AGRNL, PIKA	uc003jlc.2	Q63HQ2	OTTHUMG00000131139	ENST00000354891.3:c.1821G>C	5.37:g.38427121G>C	ENSP00000346964:p.Leu607Phe	Somatic	46	0		WXS	Illumina GAIIx	Phase_I	61	27	NM_001205301	0	0	0	0	0	A8K6D7|Q5U643|Q6P3V1|Q8N124|Q8N197|Q8N7Y0|Q8N8N5|Q8NAL2	Missense_Mutation	SNP	ENST00000354891.3	37	CCDS56363.1	.	.	.	.	.	.	.	.	.	.	G	13.80	2.346662	0.41599	.	.	ENSG00000164318	ENST00000354891;ENST00000322350;ENST00000336740;ENST00000339580	T;T;T	0.80653	0.69;0.53;-1.4	5.76	5.76	0.90799	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.000000	0.64402	D	0.000001	D	0.84768	0.5545	L	0.34521	1.04	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.998	D;D;D	0.76575	0.988;0.981;0.986	D	0.85323	0.1085	10	0.56958	D	0.05	-1.0748	16.2433	0.82426	0.0:0.1326:0.8674:0.0	.	373;607;607	Q63HQ2-4;Q63HQ2;Q63HQ2-2	.;EGFLA_HUMAN;.	F	607;607;373;373	ENSP00000346964:L607F;ENSP00000313084:L607F;ENSP00000337607:L373F	ENSP00000313084:L607F	L	+	3	2	EGFLAM	38462878	1.000000	0.71417	0.417000	0.26559	0.050000	0.14768	5.096000	0.64535	2.732000	0.93576	0.655000	0.94253	TTG	.		0.488	EGFLAM-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367323.1	NM_152403	
CARD6	84674	hgsc.bcm.edu;broad.mit.edu	37	5	40843294	40843294	+	Frame_Shift_Del	DEL	G	G	-	rs149693777		TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr5:40843294delG	ENST00000254691.5	+	2	523	c.324delG	c.(322-324)atgfs	p.M108fs	CARD6_ENST00000381677.3_Frame_Shift_Del_p.M108fs	NM_032587.3	NP_115976.2	Q9BX69	CARD6_HUMAN	caspase recruitment domain family, member 6	108					apoptotic process (GO:0006915)|regulation of apoptotic process (GO:0042981)					NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(2)|lung(29)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	62						CTCAATCTATGGGGGCAAGCA	0.383																																					p.M108fs		.											.	CARD6-230	0			c.324delG						.						56.0	63.0	61.0					5																	40843294		2203	4300	6503	SO:0001589	frameshift_variant	84674	exon2			ATCTATGGGGGCA	AF356193	CCDS3935.1	5p13.1	2008-05-23			ENSG00000132357	ENSG00000132357			16394	protein-coding gene	gene with protein product		609986				12775719	Standard	NM_032587		Approved	CINCIN1	uc003jmg.3	Q9BX69	OTTHUMG00000094775	ENST00000254691.5:c.324delG	5.37:g.40843294delG	ENSP00000254691:p.Met108fs	Somatic	28	0		WXS	Illumina GAIIx	Phase_I	54	13	NM_032587	0	0	0	0	0	Q52LR2	Frame_Shift_Del	DEL	ENST00000254691.5	37	CCDS3935.1																																																																																			.		0.383	CARD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211584.3		
ELOVL7	79993	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	60067796	60067796	+	Silent	SNP	T	T	C			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr5:60067796T>C	ENST00000508821.1	-	4	503	c.189A>G	c.(187-189)gaA>gaG	p.E63E	ELOVL7_ENST00000425382.1_Silent_p.E63E|ELOVL7_ENST00000438340.1_Silent_p.E63E|ELOVL7_ENST00000505959.1_Silent_p.E50E	NM_024930.2	NP_079206.2	A1L3X0	ELOV7_HUMAN	ELOVL fatty acid elongase 7	63					cellular lipid metabolic process (GO:0044255)|fatty acid elongation, polyunsaturated fatty acid (GO:0034626)|fatty acid elongation, saturated fatty acid (GO:0019367)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|very long-chain fatty acid biosynthetic process (GO:0042761)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	transferase activity (GO:0016740)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|skin(1)|urinary_tract(1)	9		Lung NSC(810;2.56e-06)|Prostate(74;0.0115)|Breast(144;0.0244)|Ovarian(174;0.0481)				CTTTCTTGAGTTCAAAGGGCT	0.398																																					p.E63E		.											.	ELOVL7-90	0			c.A189G						.						88.0	83.0	85.0					5																	60067796		2203	4300	6503	SO:0001819	synonymous_variant	79993	exon3			CTTGAGTTCAAAG	AK027216	CCDS34164.1	5q12	2011-05-25	2011-05-25			ENSG00000164181			26292	protein-coding gene	gene with protein product		614451	"""ELOVL family member 7, elongation of long chain fatty acids (yeast)"""			19826053	Standard	NM_024930		Approved	FLJ23563	uc010iwk.3	A1L3X0		ENST00000508821.1:c.189A>G	5.37:g.60067796T>C		Somatic	176	0		WXS	Illumina GAIIx	Phase_I	219	61	NM_001104558	0	0	0	0	0	Q589T3|Q9H5D0|Q9NT66	Silent	SNP	ENST00000508821.1	37	CCDS34164.1																																																																																			.		0.398	ELOVL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368195.1		
MAP1B	4131	hgsc.bcm.edu;bcgsc.ca	37	5	71492991	71492991	+	Frame_Shift_Del	DEL	C	C	-			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr5:71492991delC	ENST00000296755.7	+	5	4107	c.3809delC	c.(3808-3810)accfs	p.T1270fs		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	1270					axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		TTAGAAAAGACCCCCCTGGGT	0.517																																					p.T1270fs	Melanoma(17;367 822 11631 31730 47712)	.											.	MAP1B-155	0			c.3809delC						.						71.0	71.0	71.0					5																	71492991		2203	4300	6503	SO:0001589	frameshift_variant	4131	exon5			AAAAGACCCCCCT	L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.3809delC	5.37:g.71492991delC	ENSP00000296755:p.Thr1270fs	Somatic	99	1		WXS	Illumina GAIIx	Phase_I	104	35	NM_005909	0	0	0	0	0	A2BDK5	Frame_Shift_Del	DEL	ENST00000296755.7	37	CCDS4012.1																																																																																			.		0.517	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218561.6	NM_005909	
MAP1B	4131	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	71495181	71495181	+	Missense_Mutation	SNP	C	C	A	rs113459978		TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr5:71495181C>A	ENST00000296755.7	+	5	6297	c.5999C>A	c.(5998-6000)aCa>aAa	p.T2000K		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	2000					axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		GGTGGCCACACACTTGGGGAC	0.463																																					p.T2000K	Melanoma(17;367 822 11631 31730 47712)	.											.	MAP1B-155	0			c.C5999A						.						138.0	147.0	144.0					5																	71495181		2203	4300	6503	SO:0001583	missense	4131	exon5			GCCACACACTTGG	L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.5999C>A	5.37:g.71495181C>A	ENSP00000296755:p.Thr2000Lys	Somatic	77	0		WXS	Illumina GAIIx	Phase_I	61	21	NM_005909	0	0	0	0	0	A2BDK5	Missense_Mutation	SNP	ENST00000296755.7	37	CCDS4012.1	.	.	.	.	.	.	.	.	.	.	C	12.93	2.084941	0.36758	.	.	ENSG00000131711	ENST00000296755	T	0.03212	4.01	5.51	4.65	0.58169	.	0.283692	0.30911	N	0.008637	T	0.02418	0.0074	N	0.08118	0	0.30850	N	0.734717	B;B	0.22909	0.077;0.077	B;B	0.22880	0.042;0.025	T	0.17289	-1.0374	10	0.45353	T	0.12	-4.0629	9.7659	0.40561	0.0:0.8439:0.0:0.1561	.	1874;2000	A2BDK6;P46821	.;MAP1B_HUMAN	K	2000	ENSP00000296755:T2000K	ENSP00000296755:T2000K	T	+	2	0	MAP1B	71530937	0.086000	0.21541	0.999000	0.59377	0.978000	0.69477	2.433000	0.44793	1.345000	0.45676	0.643000	0.83706	ACA	C|0.500;T|0.500		0.463	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218561.6	NM_005909	
HOMER1	9456	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	78671991	78671991	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr5:78671991C>G	ENST00000334082.6	-	9	2348	c.906G>C	c.(904-906)gaG>gaC	p.E302D	HOMER1_ENST00000282260.6_Missense_Mutation_p.E172D|HOMER1_ENST00000535690.1_Missense_Mutation_p.E128D|HOMER1_ENST00000508576.1_3'UTR	NM_004272.3	NP_004263.1	Q86YM7	HOME1_HUMAN	homer homolog 1 (Drosophila)	302					behavioral response to cocaine (GO:0048148)|chemical homeostasis within a tissue (GO:0048875)|circadian rhythm (GO:0007623)|phospholipase C-activating G-protein coupled glutamate receptor signaling pathway (GO:0007206)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of signal transduction (GO:0009967)|protein localization to synapse (GO:0035418)|regulation of calcium ion import (GO:0090279)|regulation of cation channel activity (GO:2001257)|regulation of store-operated calcium entry (GO:2001256)|response to calcium ion (GO:0051592)|response to nicotine (GO:0035094)|skeletal muscle contraction (GO:0003009)|skeletal muscle fiber development (GO:0048741)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|axon (GO:0030424)|cell junction (GO:0030054)|costamere (GO:0043034)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|Z disc (GO:0030018)	ion channel binding (GO:0044325)|signaling adaptor activity (GO:0035591)			endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|prostate(2)|skin(1)	14		Lung NSC(167;0.00131)|all_lung(232;0.00151)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;1.87e-44)|Epithelial(54;7.07e-41)|all cancers(79;5.5e-36)		ACAGTTGTCCCTCCAGGTCTT	0.368																																					p.L302L		.											.	HOMER1-90	0			c.C906C						.						127.0	117.0	120.0					5																	78671991		1831	4083	5914	SO:0001583	missense	9456	exon9			TTGTCCCTCCAGG	BC015502	CCDS43335.1, CCDS64188.1, CCDS64189.1	5q14.2	2008-02-05			ENSG00000152413	ENSG00000152413			17512	protein-coding gene	gene with protein product		604798				9808459, 9808458	Standard	NM_004272		Approved	Ves-1, SYN47, HOMER-1B	uc003kfy.4	Q86YM7	OTTHUMG00000134278	ENST00000334082.6:c.906G>C	5.37:g.78671991C>G	ENSP00000334382:p.Glu302Asp	Somatic	93	0		WXS	Illumina GAIIx	Phase_I	88	20	NM_004272	0	0	0	0	0	B2R688|O96003|Q86YM5	Silent	SNP	ENST00000334082.6	37	CCDS43335.1	.	.	.	.	.	.	.	.	.	.	C	14.83	2.652355	0.47362	.	.	ENSG00000152413	ENST00000334082;ENST00000282260;ENST00000535690	D;T;D	0.84660	-1.88;1.2;-1.88	5.7	0.161	0.14977	.	0.000000	0.85682	D	0.000000	D	0.88273	0.6392	L	0.61036	1.89	0.51482	D	0.999926	D;D;D	0.71674	0.998;0.974;0.998	P;D;D	0.72075	0.875;0.953;0.976	D	0.85194	0.1011	10	0.52906	T	0.07	-21.5359	8.4868	0.33076	0.0:0.2924:0.0:0.7076	.	128;172;302	Q86YM6;Q86YM7-2;Q86YM7	.;.;HOME1_HUMAN	D	302;172;128	ENSP00000334382:E302D;ENSP00000282260:E172D;ENSP00000441587:E128D	ENSP00000282260:E172D	E	-	3	2	HOMER1	78707747	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	1.476000	0.35420	0.069000	0.16605	0.591000	0.81541	GAG	.		0.368	HOMER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258856.1	NM_004272	
HSD17B4	3295	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	118844896	118844896	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr5:118844896G>A	ENST00000256216.6	+	16	1527	c.1394G>A	c.(1393-1395)gGc>gAc	p.G465D	HSD17B4_ENST00000509514.1_Missense_Mutation_p.G203D|HSD17B4_ENST00000504811.1_Missense_Mutation_p.G490D|HSD17B4_ENST00000513628.1_Missense_Mutation_p.G328D|HSD17B4_ENST00000510025.1_Missense_Mutation_p.G441D|HSD17B4_ENST00000414835.2_Missense_Mutation_p.G325D|HSD17B4_ENST00000515320.1_Missense_Mutation_p.G447D|HSD17B4_ENST00000522415.1_3'UTR	NM_000414.3	NP_000405.1	P51659	DHB4_HUMAN	hydroxysteroid (17-beta) dehydrogenase 4	465	Enoyl-CoA hydratase 2.				alpha-linolenic acid metabolic process (GO:0036109)|androgen metabolic process (GO:0008209)|bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|estrogen metabolic process (GO:0008210)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|medium-chain fatty-acyl-CoA metabolic process (GO:0036112)|metabolic process (GO:0008152)|osteoblast differentiation (GO:0001649)|oxidation-reduction process (GO:0055114)|Sertoli cell development (GO:0060009)|small molecule metabolic process (GO:0044281)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid metabolic process (GO:0000038)|very long-chain fatty-acyl-CoA metabolic process (GO:0036111)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	17-beta-hydroxysteroid dehydrogenase (NAD+) activity (GO:0044594)|3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|3alpha,7alpha,12alpha-trihydroxy-5beta-cholest-24-enoyl-CoA hydratase activity (GO:0033989)|isomerase activity (GO:0016853)|long-chain-enoyl-CoA hydratase activity (GO:0016508)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			breast(2)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|urinary_tract(2)	25		all_cancers(142;0.0206)|Prostate(80;0.0322)		OV - Ovarian serous cystadenocarcinoma(64;0.000247)|Epithelial(69;0.000849)|all cancers(49;0.0122)		TTTCTTGTTGGCTCTGGAGGC	0.348																																					p.G490D	Colon(35;490 801 34689 41394 43344)	.											.	HSD17B4-92	0			c.G1469A						.						151.0	155.0	154.0					5																	118844896		2202	4300	6502	SO:0001583	missense	3295	exon17			TTGTTGGCTCTGG		CCDS4126.1, CCDS56378.1, CCDS56379.1	5q2	2011-09-20			ENSG00000133835	ENSG00000133835	4.2.1.107, 1.1.1.35	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	5213	protein-coding gene	gene with protein product	"""17beta-estradiol dehydrogenase type IV"", ""peroxisomal multifunctional protein 2"", ""17-beta-HSD IV"", ""17-beta-hydroxysteroid dehydrogenase 4"", ""D-bifunctional protein, peroxisomal"", ""D-3-hydroxyacyl-CoA dehydratase"", ""3-alpha,7-alpha,12-alpha-trihydroxy-5-beta-cholest-24-enoyl-CoA hydratase"", ""beta-keto-reductase"", ""beta-hydroxyacyl dehydrogenase"", ""short chain dehydrogenase/reductase family 8C, member 1"""	601860				8938456, 19027726	Standard	NM_000414		Approved	MFE-2, DBP, SDR8C1	uc003ksj.3	P51659	OTTHUMG00000128899	ENST00000256216.6:c.1394G>A	5.37:g.118844896G>A	ENSP00000256216:p.Gly465Asp	Somatic	40	0		WXS	Illumina GAIIx	Phase_I	50	4	NM_001199291	0	0	0	0	0	B4DNV1|B4DVS5|E9PB82|F5HE57	Missense_Mutation	SNP	ENST00000256216.6	37	CCDS4126.1	.	.	.	.	.	.	.	.	.	.	G	24.7	4.560059	0.86335	.	.	ENSG00000133835	ENST00000256216;ENST00000515320;ENST00000510025;ENST00000504811;ENST00000414835;ENST00000513628;ENST00000509514	D;D;D;D;D;D;D	0.87966	-2.32;-2.32;-2.32;-2.32;-2.32;-2.32;-2.32	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	D	0.96040	0.8710	H	0.96805	3.885	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.999;0.996;0.999;0.998	D;D;P;D;D	0.91635	0.999;0.984;0.737;0.988;0.95	D	0.97374	0.9978	10	0.72032	D	0.01	-13.6078	18.535	0.91008	0.0:0.0:1.0:0.0	.	490;447;441;203;465	F5HE57;E9PB82;E7EWE5;E7EPL9;P51659	.;.;.;.;DHB4_HUMAN	D	465;447;441;490;325;328;203	ENSP00000256216:G465D;ENSP00000424613:G447D;ENSP00000424940:G441D;ENSP00000420914:G490D;ENSP00000411960:G325D;ENSP00000425993:G328D;ENSP00000426272:G203D	ENSP00000256216:G465D	G	+	2	0	HSD17B4	118872795	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	8.217000	0.89766	2.464000	0.83262	0.561000	0.74099	GGC	.		0.348	HSD17B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250863.3	NM_000414	
SOWAHA	134548	hgsc.bcm.edu	37	5	132149684	132149684	+	Missense_Mutation	SNP	G	G	C	rs40274	byFrequency	TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr5:132149684G>C	ENST00000378693.2	+	1	652	c.371G>C	c.(370-372)cGg>cCg	p.R124P		NM_175873.4	NP_787069.3	Q2M3V2	SWAHA_HUMAN	sosondowah ankyrin repeat domain family member A	124	Pro-rich.		R -> P (in dbSNP:rs40274).														CCCTTGGTCCGGGTGCCGCGG	0.776																																					p.R124P		.											.	.	0			c.G371C						.	C	PRO/ARG	2599,13		1293,13,0	2.0	3.0	3.0		371	-0.3	0.0	5	dbSNP_76	3	6177,193		2993,191,1	no	missense	ANKRD43	NM_175873.4	103	4286,204,1	CC,CG,GG		3.0298,0.4977,2.2935	benign	124/550	132149684	8776,206	1306	3185	4491	SO:0001583	missense	134548	exon1			TGGTCCGGGTGCC	AK090823	CCDS43361.1	5q23.3	2013-01-10	2012-01-12	2012-01-12	ENSG00000198944	ENSG00000198944		"""Ankyrin repeat domain containing"""	27033	protein-coding gene	gene with protein product			"""ankyrin repeat domain 43"""	ANKRD43		22234889	Standard	NM_175873		Approved		uc003kxw.3	Q2M3V2	OTTHUMG00000059844	ENST00000378693.2:c.371G>C	5.37:g.132149684G>C	ENSP00000367965:p.Arg124Pro	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_175873	0	0	0	0	0	Q8NAE7	Missense_Mutation	SNP	ENST00000378693.2	37	CCDS43361.1	2142	0.9807692307692307	482	0.9796747967479674	357	0.9861878453038674	562	0.9825174825174825	741	0.9775725593667546	c	9.833	1.188835	0.21954	0.995023	0.969702	ENSG00000198944	ENST00000378693	T	0.38077	1.16	4.27	-0.265	0.12946	.	2.345400	0.02245	N	0.066177	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.36261	-0.9755	9	0.30078	T	0.28	-5.2019	3.6102	0.08057	0.2245:0.4439:0.2467:0.085	rs40274	124	Q2M3V2	ANR43_HUMAN	P	124	ENSP00000367965:R124P	ENSP00000367965:R124P	R	+	2	0	ANKRD43	132177583	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.768000	0.01794	-0.003000	0.14444	-3.153000	0.00058	CGG	G|0.980;C|0.020		0.776	SOWAHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133062.1	NM_175873	
PCDHB6	56130	hgsc.bcm.edu	37	5	140531553	140531553	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr5:140531553A>G	ENST00000231136.1	+	1	1715	c.1715A>G	c.(1714-1716)gAg>gGg	p.E572G	PCDHB6_ENST00000543635.1_Missense_Mutation_p.E436G	NM_018939.2	NP_061762.1	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6	572	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			cervix(1)|endometrium(14)|kidney(6)|large_intestine(16)|liver(1)|lung(33)|ovary(1)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	84			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCCTGCACCGAGCTGGTGCCC	0.697																																					p.E572G		.											.	PCDHB6-91	0			c.A1715G						.						11.0	16.0	14.0					5																	140531553		2068	4158	6226	SO:0001583	missense	56130	exon1			GCACCGAGCTGGT	AF152499	CCDS4248.1	5q31	2010-01-26			ENSG00000113211	ENSG00000113211		"""Cadherins / Protocadherins : Clustered"""	8691	other	protocadherin		606332				10380929	Standard	NM_018939		Approved	PCDH-BETA6	uc003lir.3	Q9Y5E3	OTTHUMG00000129623	ENST00000231136.1:c.1715A>G	5.37:g.140531553A>G	ENSP00000231136:p.Glu572Gly	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	17	7	NM_018939	0	0	0	0	0	B2R8R9	Missense_Mutation	SNP	ENST00000231136.1	37	CCDS4248.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	19.23|19.23	3.786671|3.786671	0.70337|0.70337	.|.	.|.	ENSG00000113211|ENSG00000113211	ENST00000543635;ENST00000231136|ENST00000542861	T;T|.	0.19532|.	2.14;2.14|.	4.19|4.19	4.19|4.19	0.49359|0.49359	Cadherin-like (1);|.	.|.	.|.	.|.	.|.	T|T	0.69079|0.69079	0.3071|0.3071	M|M	0.64080|0.64080	1.96|1.96	0.40260|0.40260	D|D	0.978166|0.978166	D|.	0.69078|.	0.997|.	P|.	0.62435|.	0.902|.	T|T	0.70212|0.70212	-0.4934|-0.4934	9|5	0.87932|.	D|.	0|.	.|.	13.2863|13.2863	0.60245|0.60245	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	572|.	Q9Y5E3|.	PCDB6_HUMAN|.	G|G	436;572|357	ENSP00000438466:E436G;ENSP00000231136:E572G|.	ENSP00000231136:E572G|.	E|S	+|+	2|1	0|0	PCDHB6|PCDHB6	140511737|140511737	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.973000|0.973000	0.67179|0.67179	6.048000|6.048000	0.71046|0.71046	1.666000|1.666000	0.50821|0.50821	0.454000|0.454000	0.30748|0.30748	GAG|AGC	.		0.697	PCDHB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251818.2	NM_018939	
PCDHB11	56125	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140579540	140579540	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr5:140579540C>T	ENST00000354757.3	+	1	193	c.193C>T	c.(193-195)Cgg>Tgg	p.R65W	PCDHB11_ENST00000536699.1_Intron	NM_018931.2	NP_061754.1	Q9Y5F2	PCDBB_HUMAN	protocadherin beta 11	65	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(23)|ovary(4)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ACGGGGGGCTCGGGTGGTCTC	0.517																																					p.R65W		.											.	PCDHB11-96	0			c.C193T						.						88.0	101.0	96.0					5																	140579540		2203	4300	6503	SO:0001583	missense	56125	exon1			GGGGCTCGGGTGG	AF152490	CCDS4253.1	5q31	2010-01-26			ENSG00000197479	ENSG00000197479		"""Cadherins / Protocadherins : Clustered"""	8682	other	protocadherin	"""cadherin ME2"""	606337				10380929	Standard	NM_018931		Approved	PCDH-BETA11, ME2	uc003liy.3	Q9Y5F2	OTTHUMG00000129618	ENST00000354757.3:c.193C>T	5.37:g.140579540C>T	ENSP00000346802:p.Arg65Trp	Somatic	33	0		WXS	Illumina GAIIx	Phase_I	62	17	NM_018931	0	0	0	0	0	B4DSF7|Q2M223	Missense_Mutation	SNP	ENST00000354757.3	37	CCDS4253.1	.	.	.	.	.	.	.	.	.	.	C	15.40	2.822420	0.50739	.	.	ENSG00000197479	ENST00000354757	T	0.38887	1.11	2.8	0.651	0.17817	Cadherin, N-terminal (1);Cadherin (2);Cadherin-like (1);	.	.	.	.	T	0.73976	0.3656	H	0.97918	4.105	0.09310	N	0.999997	D	0.89917	1.0	D	0.78314	0.991	T	0.63079	-0.6717	9	0.87932	D	0	.	10.083	0.42401	0.4811:0.5189:0.0:0.0	.	65	Q9Y5F2	PCDBB_HUMAN	W	65	ENSP00000346802:R65W	ENSP00000346802:R65W	R	+	1	2	PCDHB11	140559724	0.001000	0.12720	0.001000	0.08648	0.108000	0.19459	1.738000	0.38207	0.479000	0.27511	0.467000	0.42956	CGG	.		0.517	PCDHB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251813.1	NM_018931	
PCDHGA5	56110	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140746167	140746167	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr5:140746167T>G	ENST00000518069.1	+	1	2270	c.2270T>G	c.(2269-2271)gTc>gGc	p.V757G	PCDHGA4_ENST00000571252.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018918.2|NM_032054.1	NP_061741.1|NP_114443.1	Q9Y5G8	PCDG5_HUMAN	protocadherin gamma subfamily A, 5	757					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(5)|upper_aerodigestive_tract(3)	18			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCCCACGAGGTCTCCCTCACC	0.602																																					p.V757G		.											.	PCDHGA5-35	0			c.T2270G						.						111.0	119.0	116.0					5																	140746167		2203	4300	6503	SO:0001583	missense	56110	exon1			ACGAGGTCTCCCT	AF152512	CCDS54925.1, CCDS75333.1	5q31	2010-01-26				ENSG00000253485		"""Cadherins / Protocadherins : Clustered"""	8703	other	protocadherin	"""cadherin ME3"""	606292				10380929	Standard	NM_018918		Approved	CDH-GAMMA-A5, ME3, PCDH-GAMMA-A5		Q9Y5G8		ENST00000518069.1:c.2270T>G	5.37:g.140746167T>G	ENSP00000429834:p.Val757Gly	Somatic	168	4		WXS	Illumina GAIIx	Phase_I	169	48	NM_032054	0	0	0	0	0	Q2M3F5|Q9Y5D2	Missense_Mutation	SNP	ENST00000518069.1	37	CCDS54925.1	.	.	.	.	.	.	.	.	.	.	.	20.5	3.998501	0.74818	.	.	ENSG00000253485	ENST00000518069	T	0.54675	0.56	5.17	3.98	0.46160	.	.	.	.	.	T	0.78136	0.4236	H	0.95712	3.71	0.41284	D	0.986939	D;D	0.58620	0.982;0.983	D;D	0.68621	0.959;0.912	T	0.82719	-0.0318	9	0.87932	D	0	.	11.0924	0.48123	0.0:0.0749:0.0:0.9251	.	757;757	Q9Y5G8-2;Q9Y5G8	.;PCDG5_HUMAN	G	757	ENSP00000429834:V757G	ENSP00000429834:V757G	V	+	2	0	PCDHGA5	140726351	0.783000	0.28701	0.816000	0.32577	0.887000	0.51463	1.109000	0.31135	0.884000	0.36064	0.460000	0.39030	GTC	.		0.602	PCDHGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374742.1	NM_018918	
COL23A1	91522	broad.mit.edu	37	5	177673297	177673297	+	Silent	SNP	G	G	T			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr5:177673297G>T	ENST00000390654.3	-	24	1728	c.1371C>A	c.(1369-1371)ggC>ggA	p.G457G		NM_173465.3	NP_775736.2	Q86Y22	CONA1_HUMAN	collagen, type XXIII, alpha 1	457	Collagen-like 4.|Gly-rich.				collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	19	all_cancers(89;0.00188)|Renal(175;0.000159)|Lung NSC(126;0.00814)|all_lung(126;0.0129)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.153)|all cancers(165;0.172)		GGCCCGGTGGGCCAACTGGCC	0.552																																					p.G457G		.											.	COL23A1-91	0			c.C1371A						.						33.0	39.0	37.0					5																	177673297		1856	4055	5911	SO:0001819	synonymous_variant	91522	exon24			CGGTGGGCCAACT	AL137461	CCDS4436.1	5q35.3	2013-01-16			ENSG00000050767	ENSG00000050767		"""Collagens"""	22990	protein-coding gene	gene with protein product		610043				12644459	Standard	NM_173465		Approved	DKFZp434K0621	uc021yiz.1	Q86Y22	OTTHUMG00000130890	ENST00000390654.3:c.1371C>A	5.37:g.177673297G>T		Somatic	110	0		WXS	Illumina GAIIx	Phase_I	112	4	NM_173465	0	0	0	0	0	Q8IVR4|Q9NT93	Silent	SNP	ENST00000390654.3	37	CCDS4436.1																																																																																			.		0.552	COL23A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253475.1	NM_173465	
FLT4	2324	ucsc.edu;bcgsc.ca	37	5	180048131	180048131	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr5:180048131G>T	ENST00000261937.6	-	14	2220	c.2142C>A	c.(2140-2142)gaC>gaA	p.D714E	FLT4_ENST00000393347.3_Missense_Mutation_p.D714E|FLT4_ENST00000502649.1_Missense_Mutation_p.D714E|FLT4_ENST00000424276.2_5'UTR	NM_182925.4	NP_891555.2	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4	714	Ig-like C2-type 7.				blood vessel morphogenesis (GO:0048514)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|lymph vessel development (GO:0001945)|lymphangiogenesis (GO:0001946)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation vascular endothelial growth factor production (GO:0010575)|protein autophosphorylation (GO:0046777)|regulation of blood vessel remodeling (GO:0060312)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(6)|large_intestine(5)|liver(2)|lung(37)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	GCAGCCTCTCGTCTTTGTACC	0.657																																					p.D714E	Colon(97;1075 1466 27033 27547 35871)	.											.	FLT4-1490	0			c.C2142A						.						29.0	30.0	29.0					5																	180048131		2200	4290	6490	SO:0001583	missense	2324	exon14			CCTCTCGTCTTTG	X68203	CCDS4457.1, CCDS43412.1	5q34-q35	2013-01-29			ENSG00000037280	ENSG00000037280	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3767	protein-coding gene	gene with protein product		136352				1319394	Standard	NM_002020		Approved	VEGFR3, PCL	uc003mlz.4	P35916	OTTHUMG00000130931	ENST00000261937.6:c.2142C>A	5.37:g.180048131G>T	ENSP00000261937:p.Asp714Glu	Somatic	200	3		WXS	Illumina GAIIx	Phase_I	290	71	NM_182925	0	0	0	0	0	A8K6L4|B5A926|Q16067|Q86W07|Q86W08	Missense_Mutation	SNP	ENST00000261937.6	37	CCDS4457.1	.	.	.	.	.	.	.	.	.	.	G	19.40	3.821293	0.71028	.	.	ENSG00000037280	ENST00000261937;ENST00000393347;ENST00000502649;ENST00000376868	D;D;D	0.83591	-1.74;-1.74;-1.74	4.4	-5.16	0.02857	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.88262	0.6389	M	0.68317	2.08	0.43545	D	0.995843	D;D;D;D	0.89917	1.0;0.999;0.99;0.99	D;D;D;D	0.97110	1.0;0.993;0.963;0.963	D	0.87239	0.2265	9	0.87932	D	0	.	15.6779	0.77341	0.7209:0.0:0.2791:0.0	.	714;524;714;714	P35916-3;E9PFB0;E9PD35;P35916	.;.;.;VGFR3_HUMAN	E	714;714;714;524	ENSP00000261937:D714E;ENSP00000377016:D714E;ENSP00000426057:D714E	ENSP00000261937:D714E	D	-	3	2	FLT4	179980737	0.007000	0.16637	0.758000	0.31321	0.936000	0.57629	-1.024000	0.03603	-1.638000	0.01529	-0.448000	0.05591	GAC	.		0.657	FLT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253527.4		
FOXC1	2296	broad.mit.edu	37	6	1612237	1612237	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr6:1612237C>A	ENST00000380874.2	+	1	1557	c.1557C>A	c.(1555-1557)aaC>aaA	p.N519K		NM_001453.2	NP_001444.2	Q12948	FOXC1_HUMAN	forkhead box C1	519					artery morphogenesis (GO:0048844)|blood vessel remodeling (GO:0001974)|brain development (GO:0007420)|camera-type eye development (GO:0043010)|cardiac muscle cell proliferation (GO:0060038)|collagen fibril organization (GO:0030199)|embryonic heart tube development (GO:0035050)|eye development (GO:0001654)|germ cell migration (GO:0008354)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|lacrimal gland development (GO:0032808)|lymph vessel development (GO:0001945)|negative regulation of apoptotic process involved in outflow tract morphogenesis (GO:1902257)|negative regulation of mitotic cell cycle (GO:0045930)|neural crest cell development (GO:0014032)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|ovarian follicle development (GO:0001541)|paraxial mesoderm formation (GO:0048341)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of blood vessel size (GO:0050880)|regulation of organ growth (GO:0046620)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system development (GO:0001501)|somitogenesis (GO:0001756)|ureteric bud development (GO:0001657)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(1)	8	Ovarian(93;0.0733)	all_cancers(2;4.45e-07)|all_epithelial(2;4.33e-05)|all_lung(73;0.0713)|all_hematologic(90;0.0895)		Epithelial(2;0.0904)|OV - Ovarian serous cystadenocarcinoma(45;0.095)|all cancers(2;0.168)		TCGGCTTGAACAACTCTCCAG	0.617																																					p.N519K	Pancreas(133;719 1821 3197 26645 35015)	.											.	FOXC1-227	0			c.C1557A						.						59.0	43.0	48.0					6																	1612237		2202	4299	6501	SO:0001583	missense	2296	exon1			CTTGAACAACTCT	AF048693	CCDS4473.1	6p25	2008-04-10			ENSG00000054598	ENSG00000054598		"""Forkhead boxes"""	3800	protein-coding gene	gene with protein product		601090		FKHL7, IRID1		7957066, 9620769	Standard	NM_001453		Approved	FREAC3, ARA, IGDA, IHG1	uc003mtp.3	Q12948	OTTHUMG00000016182	ENST00000380874.2:c.1557C>A	6.37:g.1612237C>A	ENSP00000370256:p.Asn519Lys	Somatic	141	8		WXS	Illumina GAIIx	Phase_I	159	14	NM_001453	0	0	0	0	0	Q86UP7|Q9BYM1|Q9NUE5|Q9UDD0|Q9UP06	Missense_Mutation	SNP	ENST00000380874.2	37	CCDS4473.1	.	.	.	.	.	.	.	.	.	.	C	16.23	3.065073	0.55432	.	.	ENSG00000054598	ENST00000380874	D	0.81579	-1.51	3.52	3.52	0.40303	.	0.224065	0.32952	U	0.005451	T	0.78817	0.4343	L	0.32530	0.975	0.49483	D	0.999794	D	0.63880	0.993	D	0.72982	0.979	T	0.79152	-0.1921	10	0.39692	T	0.17	.	14.0047	0.64456	0.0:1.0:0.0:0.0	.	519	Q12948	FOXC1_HUMAN	K	519	ENSP00000370256:N519K	ENSP00000370256:N519K	N	+	3	2	FOXC1	1557236	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	0.761000	0.26489	1.828000	0.53243	0.448000	0.29417	AAC	.		0.617	FOXC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043450.1		
RREB1	6239	hgsc.bcm.edu	37	6	7230680	7230680	+	Missense_Mutation	SNP	G	G	T	rs9502564	byFrequency	TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr6:7230680G>T	ENST00000349384.6	+	10	2662	c.2348G>T	c.(2347-2349)gGc>gTc	p.G783V	RREB1_ENST00000334984.6_Missense_Mutation_p.G783V|RREB1_ENST00000379933.3_Missense_Mutation_p.G783V|RREB1_ENST00000379938.2_Missense_Mutation_p.G783V	NM_001003698.3	NP_001003698.1	Q92766	RREB1_HUMAN	ras responsive element binding protein 1	783			G -> V (in dbSNP:rs9502564). {ECO:0000269|PubMed:15067362, ECO:0000269|PubMed:21703425}.		multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|Ras protein signal transduction (GO:0007265)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear body (GO:0016604)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(18)|ovary(5)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)				CTGGGCGGGGGCCACAAGGGC	0.697													G|||	2678	0.534744	0.5333	0.4063	5008	,	,		15583	0.7411		0.2893	False		,,,				2504	0.6677				p.G783V		.											.	RREB1-144	0			c.G2348T						.	G	VAL/GLY,VAL/GLY,VAL/GLY,VAL/GLY	2083,2197		552,979,609	9.0	9.0	9.0		2348,2348,2348,2348	5.3	1.0	6	dbSNP_119	9	2599,5719		488,1623,2048	yes	missense,missense,missense,missense	RREB1	NM_001003698.3,NM_001003699.3,NM_001003700.1,NM_001168344.1	109,109,109,109	1040,2602,2657	TT,TG,GG		31.2455,48.6682,37.1646	benign,benign,benign,benign	783/1688,783/1743,783/1477,783/1688	7230680	4682,7916	2140	4159	6299	SO:0001583	missense	6239	exon10			GCGGGGGCCACAA	U26914	CCDS34335.1, CCDS34336.1, CCDS54963.1	6p25	2013-01-08			ENSG00000124782	ENSG00000124782		"""Zinc fingers, C2H2-type"""	10449	protein-coding gene	gene with protein product	"""hindsight homolog (drosophila)"""	602209				9367691, 18394891	Standard	NM_001003698		Approved	HNT	uc003mxb.3	Q92766	OTTHUMG00000014201	ENST00000349384.6:c.2348G>T	6.37:g.7230680G>T	ENSP00000305560:p.Gly783Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	7	NM_001003700	0	0	0	0	0	A2RRF5|E2GM80|E2GM81|O75567|O75568|Q5VYB2|Q6BEP5|Q6BEP6|Q6BEP8|Q86SU2|Q9Y474	Missense_Mutation	SNP	ENST00000349384.6	37	CCDS34336.1	1014	0.4642857142857143	249	0.5060975609756098	148	0.4088397790055249	412	0.7202797202797203	205	0.2704485488126649	G	11.15	1.553554	0.27739	0.486682	0.312455	ENSG00000124782	ENST00000379933;ENST00000379938;ENST00000349384;ENST00000334984	T;T;T;T	0.09163	3.07;3.07;3.07;3.01	5.32	5.32	0.75619	.	0.278837	0.31370	N	0.007766	T	0.02533	0.0077	N	0.14661	0.345	0.21915	P	0.999474401	B;B;B	0.32653	0.161;0.379;0.328	B;B;B	0.35182	0.079;0.197;0.178	T	0.45512	-0.9256	9	0.13108	T	0.6	-17.3998	11.4207	0.49980	0.0:0.0:0.8202:0.1797	rs9502564	783;783;783	Q92766-3;Q92766;Q92766-2	.;RREB1_HUMAN;.	V	783	ENSP00000369265:G783V;ENSP00000369270:G783V;ENSP00000305560:G783V;ENSP00000335574:G783V	ENSP00000335574:G783V	G	+	2	0	RREB1	7175679	1.000000	0.71417	0.996000	0.52242	0.833000	0.47200	5.477000	0.66799	2.760000	0.94817	0.655000	0.94253	GGC	G|0.546;T|0.454		0.697	RREB1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352985.1		
NEDD9	4739	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	11185653	11185653	+	Silent	SNP	G	G	T			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr6:11185653G>T	ENST00000379446.5	-	7	2413	c.2247C>A	c.(2245-2247)gtC>gtA	p.V749V	NEDD9_ENST00000504387.1_Silent_p.V749V|RP3-510L9.1_ENST00000500636.2_RNA	NM_001271033.1|NM_006403.3	NP_001257962.1|NP_006394.1	Q14511	CASL_HUMAN	neural precursor cell expressed, developmentally down-regulated 9	749	Divergent helix-loop-helix motif.				actin filament bundle assembly (GO:0051017)|cell adhesion (GO:0007155)|cytoskeleton organization (GO:0007010)|integrin-mediated signaling pathway (GO:0007229)|mitotic nuclear division (GO:0007067)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle pole (GO:0000922)				endometrium(3)|kidney(2)|large_intestine(8)|liver(1)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	Breast(50;0.0768)|Ovarian(93;0.152)	all_hematologic(90;0.135)	Epithelial(50;0.0647)|all cancers(50;0.179)			CACTGAGGATGACAAACTTGC	0.532																																					p.V749V		.											.	NEDD9-226	0			c.C2247A						.						202.0	162.0	176.0					6																	11185653		2203	4300	6503	SO:0001819	synonymous_variant	4739	exon8			GAGGATGACAAAC	L43821	CCDS4520.1, CCDS34340.1, CCDS47373.1, CCDS75400.1	6p25-p24	2011-04-13			ENSG00000111859	ENSG00000111859		"""Cas scaffolding proteins"""	7733	protein-coding gene	gene with protein product	"""Cas scaffolding protein family member 2"", ""Cas-like"""	602265					Standard	NM_182966		Approved	HEF1, CAS-L, CASS2	uc003mzv.2	Q14511	OTTHUMG00000014255	ENST00000379446.5:c.2247C>A	6.37:g.11185653G>T		Somatic	227	0		WXS	Illumina GAIIx	Phase_I	201	71	NM_001142393	0	0	0	0	0	A8K9G7|A8MSJ9|G5E9Y9|Q5T9R4|Q5XKI0	Silent	SNP	ENST00000379446.5	37	CCDS4520.1																																																																																			.		0.532	NEDD9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039853.2	NM_006403	
TRIM39	56658	broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	30303702	30303702	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr6:30303702G>C	ENST00000396547.1	+	4	890	c.730G>C	c.(730-732)Gct>Cct	p.A244P	TRIM39_ENST00000396548.1_Missense_Mutation_p.A244P|TRIM39_ENST00000376656.4_Missense_Mutation_p.A244P|TRIM39_ENST00000540416.1_Missense_Mutation_p.A244P|TRIM39_ENST00000376659.5_Missense_Mutation_p.A244P|TRIM39_ENST00000396551.3_Missense_Mutation_p.A244P|TRIM39-RPP21_ENST00000513556.1_Missense_Mutation_p.A156P			Q9HCM9	TRI39_HUMAN	tripartite motif containing 39	244					apoptotic process (GO:0006915)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|positive regulation of apoptotic signaling pathway (GO:2001235)|protein ubiquitination (GO:0016567)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	identical protein binding (GO:0042802)|ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			ovary(3)	3						GGCCCACTTGGCTGCCGAGGT	0.577																																					p.A244P		.											.	TRIM39-161	0			c.G730C						.						79.0	68.0	72.0					6																	30303702		1508	2709	4217	SO:0001583	missense	56658	exon5			CACTTGGCTGCCG	BC034985	CCDS34377.1, CCDS34378.1	6p22.1	2013-01-09	2011-01-25	2002-06-07	ENSG00000204599	ENSG00000204599		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10065	protein-coding gene	gene with protein product		605700	"""ring finger protein 23"", ""tripartite motif-containing 39"""	RNF23		11006080	Standard	NM_021253		Approved			Q9HCM9	OTTHUMG00000031066	ENST00000396547.1:c.730G>C	6.37:g.30303702G>C	ENSP00000379796:p.Ala244Pro	Somatic	98	1		WXS	Illumina GAIIx	Phase_I	123	15	NM_021253	0	0	0	0	0	Q5STG3|Q5STG4|Q76BL3|Q8IYT9|Q96IB6	Missense_Mutation	SNP	ENST00000396547.1	37	CCDS34377.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.54|19.54	3.846748|3.846748	0.71603|0.71603	.|.	.|.	ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000248167|ENSG00000204599	ENST00000396551;ENST00000376656;ENST00000545104;ENST00000540416;ENST00000449040;ENST00000412529;ENST00000428728;ENST00000396548;ENST00000376659;ENST00000396547;ENST00000513556|ENST00000420746	T;T;T;T;T;T;T;T|.	0.65732|.	3.55;0.09;3.55;-0.17;3.55;3.55;0.09;3.55|.	5.11|5.11	4.22|4.22	0.49857|0.49857	.|.	0.197600|.	0.35262|.	N|.	0.003332|.	T|T	0.51278|0.51278	0.1665|0.1665	L|L	0.58101|0.58101	1.795|1.795	0.37764|0.37764	D|D	0.926421|0.926421	D;P;B|.	0.64830|.	0.994;0.939;0.385|.	P;P;B|.	0.56960|.	0.81;0.616;0.3|.	T|T	0.50833|0.50833	-0.8781|-0.8781	10|5	0.72032|.	D|.	0.01|.	.|.	9.7486|9.7486	0.40462|0.40462	0.0964:0.0:0.9036:0.0|0.0964:0.0:0.9036:0.0	.|.	158;244;244|.	F5H2V3;Q9HCM9;Q9HCM9-2|.	.;TRI39_HUMAN;.|.	P|C	244;244;244;244;244;158;244;244;244;244;156|173	ENSP00000379800:A244P;ENSP00000365844:A244P;ENSP00000439400:A244P;ENSP00000406019:A244P;ENSP00000379797:A244P;ENSP00000365847:A244P;ENSP00000379796:A244P;ENSP00000424048:A156P|.	ENSP00000365844:A244P|.	A|W	+|+	1|3	0|0	TRIM39-RPP21;TRIM39|TRIM39	30411681|30411681	0.993000|0.993000	0.37304|0.37304	1.000000|1.000000	0.80357|0.80357	0.965000|0.965000	0.64279|0.64279	2.790000|2.790000	0.47821|0.47821	2.649000|2.649000	0.89929|0.89929	0.650000|0.650000	0.86243|0.86243	GCT|TGG	.		0.577	TRIM39-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076086.2	NM_172016	
FKBPL	63943	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	32096557	32096557	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr6:32096557T>A	ENST00000375156.3	-	2	1271	c.1001A>T	c.(1000-1002)aAg>aTg	p.K334M	ATF6B_ENST00000375201.4_5'Flank|ATF6B_ENST00000468502.1_5'Flank|ATF6B_ENST00000375203.3_5'Flank	NM_022110.3	NP_071393.2	Q9UIM3	FKBPL_HUMAN	FK506 binding protein like	334					chaperone-mediated protein folding (GO:0061077)|protein peptidyl-prolyl isomerization (GO:0000413)|response to radiation (GO:0009314)	endoplasmic reticulum membrane (GO:0005789)	FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)										ATCCTGGTTCTTCCCCTGAAT	0.507																																					p.K334M		.											.	FKBPL-204	0			c.A1001T						.						174.0	184.0	181.0					6																	32096557		2203	4300	6503	SO:0001583	missense	63943	exon2			TGGTTCTTCCCCT	AF139374	CCDS4738.1	6p21.3	2013-12-13	2001-11-28		ENSG00000204315	ENSG00000204315		"""Tetratricopeptide (TTC) repeat domain containing"""	13949	protein-coding gene	gene with protein product	"""WAF-1/CIP1 stabilizing protein 39"""		"""FK506-binding protein like"""			9056895	Standard	NM_022110		Approved	DIR1, NG7, WISp39	uc003nzr.3	Q9UIM3	OTTHUMG00000031129	ENST00000375156.3:c.1001A>T	6.37:g.32096557T>A	ENSP00000364298:p.Lys334Met	Somatic	130	0		WXS	Illumina GAIIx	Phase_I	213	40	NM_022110	0	0	0	0	0	A8K5V3|B0UYX8|Q9H5G3	Missense_Mutation	SNP	ENST00000375156.3	37	CCDS4738.1	.	.	.	.	.	.	.	.	.	.	T	18.43	3.621766	0.66787	.	.	ENSG00000204315	ENST00000375156	T	0.75821	-0.97	5.75	1.99	0.26369	Tetratricopeptide-like helical (1);	0.144593	0.42964	D	0.000629	T	0.52208	0.1720	N	0.08118	0	0.32472	N	0.542659	D	0.71674	0.998	P	0.60789	0.879	T	0.58713	-0.7588	10	0.59425	D	0.04	-8.7637	7.4459	0.27211	0.0:0.3229:0.0:0.6771	.	334	Q9UIM3	FKBPL_HUMAN	M	334	ENSP00000364298:K334M	ENSP00000364298:K334M	K	-	2	0	FKBPL	32204535	0.729000	0.28090	0.997000	0.53966	0.828000	0.46876	0.349000	0.20055	0.425000	0.26087	0.459000	0.35465	AAG	.		0.507	FKBPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076221.2		
GLP1R	2740	bcgsc.ca	37	6	39033549	39033549	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr6:39033549T>A	ENST00000373256.4	+	4	389	c.346T>A	c.(346-348)Tcc>Acc	p.S116T		NM_002062.3	NP_002053.3	P43220	GLP1R_HUMAN	glucagon-like peptide 1 receptor	116					activation of adenylate cyclase activity (GO:0007190)|cAMP-mediated signaling (GO:0019933)|energy reserve metabolic process (GO:0006112)|learning or memory (GO:0007611)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of heart contraction (GO:0008016)|regulation of insulin secretion (GO:0050796)|response to stress (GO:0006950)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glucagon receptor activity (GO:0004967)|transmembrane signaling receptor activity (GO:0004888)			breast(5)|endometrium(3)|kidney(1)|large_intestine(8)|lung(9)|pancreas(1)|prostate(1)|skin(1)|stomach(2)	31					Exenatide(DB01276)|Glucagon recombinant(DB00040)|Liraglutide(DB06655)	GAAGGACAACTCCAGCCTGCC	0.652																																					p.S116T		.											.	GLP1R-659	0			c.T346A						.						44.0	40.0	41.0					6																	39033549		2201	4299	6500	SO:0001583	missense	2740	exon4			GACAACTCCAGCC		CCDS4839.1	6p21	2012-08-10			ENSG00000112164	ENSG00000112164		"""GPCR / Class B : Glucagon receptors"""	4324	protein-coding gene	gene with protein product		138032					Standard	NM_002062		Approved		uc003ooj.4	P43220	OTTHUMG00000014638	ENST00000373256.4:c.346T>A	6.37:g.39033549T>A	ENSP00000362353:p.Ser116Thr	Somatic	134	0		WXS	Illumina GAIIx	Phase_I	203	6	NM_002062	0	0	0	0	0	Q2M229|Q99669	Missense_Mutation	SNP	ENST00000373256.4	37	CCDS4839.1	.	.	.	.	.	.	.	.	.	.	T	12.13	1.845266	0.32606	.	.	ENSG00000112164	ENST00000373256	T	0.49720	0.77	4.86	3.62	0.41486	GPCR, family 2, extracellular hormone receptor domain (3);	0.212975	0.33534	N	0.004804	T	0.21631	0.0521	L	0.49350	1.555	0.37078	D	0.89883	B	0.10296	0.003	B	0.10450	0.005	T	0.06899	-1.0801	10	0.20046	T	0.44	.	9.333	0.38034	0.0:0.0:0.1803:0.8197	.	116	P43220	GLP1R_HUMAN	T	116	ENSP00000362353:S116T	ENSP00000362353:S116T	S	+	1	0	GLP1R	39141527	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.890000	0.48609	1.841000	0.53522	0.374000	0.22700	TCC	.		0.652	GLP1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040443.1		
LRFN2	57497	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	40399886	40399886	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr6:40399886C>G	ENST00000338305.6	-	2	1509	c.967G>C	c.(967-969)Gta>Cta	p.V323L		NM_020737.1	NP_065788.1	Q9ULH4	LRFN2_HUMAN	leucine rich repeat and fibronectin type III domain containing 2	323	Ig-like.					cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	58	Ovarian(28;0.0418)|Colorectal(47;0.196)					TCGGGGGCTACCCAGTGGATA	0.587																																					p.V323L		.											.	LRFN2-93	0			c.G967C						.						42.0	41.0	41.0					6																	40399886		2203	4299	6502	SO:0001583	missense	57497	exon2			GGGCTACCCAGTG	AB033072	CCDS34443.1	6p21.2-p21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000156564	ENSG00000156564		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	21226	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 2"""	612808	"""KIAA1246"""	KIAA1246, SALM1		16495444, 16828986	Standard	NM_020737		Approved	FIGLER2	uc003oph.1	Q9ULH4	OTTHUMG00000014662	ENST00000338305.6:c.967G>C	6.37:g.40399886C>G	ENSP00000345985:p.Val323Leu	Somatic	43	0		WXS	Illumina GAIIx	Phase_I	75	6	NM_020737	0	0	0	0	0	A5PKU3|Q5SYP9	Missense_Mutation	SNP	ENST00000338305.6	37	CCDS34443.1	.	.	.	.	.	.	.	.	.	.	C	16.80	3.222658	0.58668	.	.	ENSG00000156564	ENST00000338305	T	0.73258	-0.73	5.43	5.43	0.79202	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.113360	0.64402	D	0.000012	T	0.50120	0.1597	N	0.17248	0.465	0.80722	D	1	B	0.24618	0.107	B	0.35278	0.199	T	0.52487	-0.8569	10	0.38643	T	0.18	.	17.8027	0.88592	0.0:1.0:0.0:0.0	.	323	Q9ULH4	LRFN2_HUMAN	L	323	ENSP00000345985:V323L	ENSP00000345985:V323L	V	-	1	0	LRFN2	40507864	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.734000	0.47368	2.555000	0.86185	0.655000	0.94253	GTA	.		0.587	LRFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040488.1	XM_166372	
PTCRA	171558	hgsc.bcm.edu	37	6	42893140	42893140	+	Missense_Mutation	SNP	G	G	A	rs111782749	byFrequency	TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr6:42893140G>A	ENST00000304672.1	+	4	647	c.566G>A	c.(565-567)cGa>cAa	p.R189Q	PTCRA_ENST00000441198.1_Missense_Mutation_p.R164Q|PTCRA_ENST00000446507.1_Missense_Mutation_p.R82Q	NM_001243168.1|NM_138296.2	NP_001230097.1|NP_612153.2	Q6ISU1	PTCRA_HUMAN	pre T-cell antigen receptor alpha	189					negative regulation of thymocyte apoptotic process (GO:0070244)	integral component of membrane (GO:0016021)				large_intestine(2)|lung(4)|ovary(2)	8	Colorectal(47;0.196)		all cancers(41;0.000731)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|OV - Ovarian serous cystadenocarcinoma(102;0.0218)|Kidney(15;0.0388)			ACCCGCCTGCGAGCCCTCGGC	0.711													G|||	35	0.00698882	0.0242	0.0043	5008	,	,		14178	0.0		0.0	False		,,,				2504	0.0				p.R204Q		.											.	PTCRA-92	0			c.G611A						.	G	GLN/ARG	63,4125		0,63,2031	10.0	8.0	9.0		566	-5.7	0.0	6	dbSNP_132	9	0,8100		0,0,4050	no	missense	PTCRA	NM_138296.2	43	0,63,6081	AA,AG,GG		0.0,1.5043,0.5127	possibly-damaging	189/282	42893140	63,12225	2094	4050	6144	SO:0001583	missense	171558	exon4			GCCTGCGAGCCCT	AF084941	CCDS4874.1, CCDS59019.1, CCDS59020.1, CCDS75457.1	6p21.3	2008-02-05			ENSG00000171611	ENSG00000171611			21290	protein-coding gene	gene with protein product		606817				8618853, 9842925	Standard	NM_138296		Approved	PTA, PT-ALPHA	uc021yzp.1	Q6ISU1	OTTHUMG00000014709	ENST00000304672.1:c.566G>A	6.37:g.42893140G>A	ENSP00000304447:p.Arg189Gln	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	41	24	NM_001243168	0	0	0	0	0	Q5TFZ7	Missense_Mutation	SNP	ENST00000304672.1	37	CCDS4874.1	9	0.004120879120879121	7	0.014227642276422764	2	0.0055248618784530384	0	0.0	0	0.0	G	13.10	2.135919	0.37728	0.015043	0.0	ENSG00000171611	ENST00000304672;ENST00000441198;ENST00000446507	T;T;T	0.55234	1.21;1.18;0.53	3.47	-5.72	0.02406	.	1.721110	0.04086	N	0.310576	T	0.10852	0.0265	N	0.19112	0.55	0.09310	N	1	B;B;B	0.25521	0.0;0.017;0.128	B;B;B	0.12156	0.0;0.004;0.007	T	0.04005	-1.0985	10	0.39692	T	0.17	10.5378	1.3101	0.02096	0.4087:0.2741:0.1789:0.1383	.	82;164;189	Q6ISU1-2;Q6ISU1-3;Q6ISU1	.;.;PTCRA_HUMAN	Q	189;164;82	ENSP00000304447:R189Q;ENSP00000409550:R164Q;ENSP00000392288:R82Q	ENSP00000304447:R189Q	R	+	2	0	PTCRA	43001118	0.000000	0.05858	0.000000	0.03702	0.092000	0.18411	-0.961000	0.03845	-1.300000	0.02341	-0.813000	0.03139	CGA	G|0.995;A|0.005		0.711	PTCRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040565.2	NM_138296	
KLHDC3	116138	broad.mit.edu;bcgsc.ca	37	6	42985302	42985302	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr6:42985302G>A	ENST00000326974.4	+	3	395	c.200G>A	c.(199-201)cGt>cAt	p.R67H	KLHDC3_ENST00000332245.8_Intron|KLHDC3_ENST00000244670.8_5'UTR	NM_057161.3	NP_476502.1	Q9BQ90	KLDC3_HUMAN	kelch domain containing 3	67					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|reciprocal meiotic recombination (GO:0007131)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)	chromatin binding (GO:0003682)			cervix(1)|endometrium(1)|large_intestine(1)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	9			Colorectal(64;0.00237)|all cancers(41;0.0034)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0539)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			TCTGCCATCCGTGGGCAAGCT	0.607																																					p.R67H		.											.	KLHDC3-91	0			c.G200A						.						73.0	64.0	67.0					6																	42985302		2203	4300	6503	SO:0001583	missense	116138	exon3			CCATCCGTGGGCA	AB055925	CCDS4880.1	6p21.1	2003-06-12			ENSG00000124702	ENSG00000124702			20704	protein-coding gene	gene with protein product		611248				12444059, 12606021	Standard	NM_057161		Approved	PEAS, hPeas, dJ20C7.3	uc003otl.3	Q9BQ90	OTTHUMG00000014714	ENST00000326974.4:c.200G>A	6.37:g.42985302G>A	ENSP00000313995:p.Arg67His	Somatic	203	1		WXS	Illumina GAIIx	Phase_I	258	13	NM_057161	0	0	0	0	0	A8K2W9	Missense_Mutation	SNP	ENST00000326974.4	37	CCDS4880.1	.	.	.	.	.	.	.	.	.	.	G	16.89	3.248210	0.59103	.	.	ENSG00000124702	ENST00000326974;ENST00000432243;ENST00000394096;ENST00000426116	T	0.66460	-0.21	5.4	5.4	0.78164	Kelch-type beta propeller (1);	0.682753	0.15219	N	0.274037	T	0.52322	0.1727	L	0.47716	1.5	0.80722	D	1	B;B	0.12013	0.003;0.005	B;B	0.08055	0.003;0.001	T	0.45731	-0.9241	10	0.44086	T	0.13	.	19.5531	0.95330	0.0:0.0:1.0:0.0	.	67;67	E7ENU0;Q9BQ90	.;KLDC3_HUMAN	H	67;67;67;40	ENSP00000313995:R67H	ENSP00000313995:R67H	R	+	2	0	KLHDC3	43093280	0.996000	0.38824	0.911000	0.35937	0.885000	0.51271	3.494000	0.53273	2.701000	0.92244	0.655000	0.94253	CGT	.		0.607	KLHDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040570.1	NM_057161	
PGK2	5232	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	49754247	49754247	+	Silent	SNP	T	T	C			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr6:49754247T>C	ENST00000304801.3	-	1	806	c.654A>G	c.(652-654)gcA>gcG	p.A218A		NM_138733.4	NP_620061.2	P07205	PGK2_HUMAN	phosphoglycerate kinase 2	218					glycolytic process (GO:0006096)|phosphorylation (GO:0016310)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)	ATP binding (GO:0005524)|phosphoglycerate kinase activity (GO:0004618)			autonomic_ganglia(1)|endometrium(3)|large_intestine(12)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	47	Lung NSC(77;0.0402)					GGATCTTGTCTGCCACTTTGG	0.418																																					p.A218A		.											.	PGK2-91	0			c.A654G						.						138.0	129.0	132.0					6																	49754247		2203	4300	6503	SO:0001819	synonymous_variant	5232	exon1			CTTGTCTGCCACT	K03019	CCDS4930.1	6p12.3	2012-09-20		2002-04-19	ENSG00000170950	ENSG00000170950			8898	protein-coding gene	gene with protein product		172270				3839763, 3453121	Standard	NM_138733		Approved	PGKPS, PGK-2	uc003ozu.3	P07205	OTTHUMG00000014824	ENST00000304801.3:c.654A>G	6.37:g.49754247T>C		Somatic	241	0		WXS	Illumina GAIIx	Phase_I	356	71	NM_138733	0	0	0	0	0	B2R6Y8|Q9H107	Silent	SNP	ENST00000304801.3	37	CCDS4930.1																																																																																			.		0.418	PGK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040872.1		
HMGCLL1	54511	broad.mit.edu	37	6	55300530	55300530	+	Missense_Mutation	SNP	C	C	A	rs373467937		TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr6:55300530C>A	ENST00000398661.2	-	10	1174	c.1043G>T	c.(1042-1044)gGt>gTt	p.G348V	HMGCLL1_ENST00000508459.1_Missense_Mutation_p.G152V|HMGCLL1_ENST00000274901.4_Missense_Mutation_p.G318V|HMGCLL1_ENST00000370850.2_Missense_Mutation_p.G215V|HMGCLL1_ENST00000308161.4_Missense_Mutation_p.G286V|HMGCLL1_ENST00000507223.1_5'UTR	NM_019036.2	NP_061909.2	Q8TB92	HMGC2_HUMAN	3-hydroxymethyl-3-methylglutaryl-CoA lyase-like 1	348					ketone body biosynthetic process (GO:0046951)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	hydroxymethylglutaryl-CoA lyase activity (GO:0004419)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	31	Lung NSC(77;0.0875)		LUSC - Lung squamous cell carcinoma(124;0.23)			AATAAAGTCACCAGCTTCCAT	0.393																																					p.G348V	Ovarian(35;840 893 7837 15538 42887)	.											.	HMGCLL1-94	0			c.G1043T						.	C	VAL/GLY,VAL/GLY	1,3699		0,1,1849	122.0	121.0	121.0		953,1043	5.4	1.0	6		121	0,8166		0,0,4083	no	missense,missense	HMGCLL1	NM_001042406.1,NM_019036.2	109,109	0,1,5932	AA,AC,CC		0.0,0.027,0.0084	probably-damaging,probably-damaging	318/341,348/371	55300530	1,11865	1850	4083	5933	SO:0001583	missense	54511	exon10			AAGTCACCAGCTT	AK055075	CCDS43474.1, CCDS43475.1, CCDS75472.1, CCDS75473.1	6p12.1	2010-04-30	2010-04-30		ENSG00000146151	ENSG00000146151			21359	protein-coding gene	gene with protein product			"""3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase-like 1"""			8619474, 9110174	Standard	NM_001042406		Approved	DKFZP434G1411, bA418P12.1	uc003pcn.3	Q8TB92	OTTHUMG00000014902	ENST00000398661.2:c.1043G>T	6.37:g.55300530C>A	ENSP00000381654:p.Gly348Val	Somatic	74	0		WXS	Illumina GAIIx	Phase_I	126	3	NM_019036	0	0	0	0	0	B1AQ42|B3KNV0|B7Z1S7|F8W793|Q6ZSA9	Missense_Mutation	SNP	ENST00000398661.2	37	CCDS43475.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.479565	0.84747	2.7E-4	0.0	ENSG00000146151	ENST00000274901;ENST00000398661;ENST00000370850;ENST00000508459;ENST00000308161	D;D;D;D;D	0.98280	-4.84;-4.84;-4.51;-4.84;-4.84	5.36	5.36	0.76844	Aldolase-type TIM barrel (1);	0.000000	0.85682	D	0.000000	D	0.99290	0.9752	M	0.93328	3.405	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;1.0;0.99;0.999;0.999	D	0.99136	1.0854	10	0.87932	D	0	-23.1639	19.0955	0.93249	0.0:1.0:0.0:0.0	.	152;215;286;318;348	B7Z4D4;B7Z212;F8W793;Q8TB92-2;Q8TB92	.;.;.;.;HMGC2_HUMAN	V	318;348;215;152;286	ENSP00000274901:G318V;ENSP00000381654:G348V;ENSP00000359887:G215V;ENSP00000424309:G152V;ENSP00000309737:G286V	ENSP00000274901:G318V	G	-	2	0	HMGCLL1	55408489	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.952000	0.63618	2.511000	0.84671	0.655000	0.94253	GGT	.		0.393	HMGCLL1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000360290.1	XM_166383	
DST	667	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	56434803	56434805	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	CTT	CTT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr6:56434803_56434805delCTT	ENST00000361203.3	-	50	13101_13103	c.13094_13096delAAG	c.(13093-13098)gaagct>gct	p.E4365del	DST_ENST00000421834.2_In_Frame_Del_p.E2279del|DST_ENST00000370788.2_In_Frame_Del_p.E2279del|DST_ENST00000446842.2_In_Frame_Del_p.E4041del|DST_ENST00000312431.6_3'UTR|DST_ENST00000370769.4_In_Frame_Del_p.E4367del|DST_ENST00000370754.5_In_Frame_Del_p.E4545del|DST_ENST00000244364.6_In_Frame_Del_p.E1953del			Q03001	DYST_HUMAN	dystonin	4365					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			GAAGTTACAGCTTCTTTTCTACA	0.296																																					p.1953_1954del		.											.	DST-523	0			c.5858_5860del						.																																			SO:0001651	inframe_deletion	667	exon35			TTACAGCTTCTTT	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.13094_13096delAAG	6.37:g.56434806_56434808delCTT	ENSP00000354508:p.Glu4365del	Somatic	39	0		WXS	Illumina GAIIx	Phase_I	36	11	NM_015548	0	0	0	0	0	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	In_Frame_Del	DEL	ENST00000361203.3	37																																																																																				.		0.296	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723	
FILIP1	27145	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	76022190	76022190	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr6:76022190G>C	ENST00000237172.7	-	5	3688	c.3358C>G	c.(3358-3360)Cct>Gct	p.P1120A	FILIP1_ENST00000498523.1_5'UTR|FILIP1_ENST00000370020.1_Missense_Mutation_p.P1021A|FILIP1_ENST00000393004.2_Missense_Mutation_p.P1120A	NM_015687.2	NP_056502.1	Q7Z7B0	FLIP1_HUMAN	filamin A interacting protein 1	1120										breast(3)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)	80						CTTGCACCAGGCCGTGAGGAG	0.542																																					p.P1120A		.											.	FILIP1-94	0			c.C3358G						.						210.0	165.0	180.0					6																	76022190		2203	4300	6503	SO:0001583	missense	27145	exon5			CACCAGGCCGTGA	AB033101	CCDS4984.1, CCDS75480.1	6q14.1	2008-02-05			ENSG00000118407	ENSG00000118407			21015	protein-coding gene	gene with protein product		607307				10574462	Standard	XM_005248713		Approved	FILIP, KIAA1275	uc003pia.3	Q7Z7B0	OTTHUMG00000015056	ENST00000237172.7:c.3358C>G	6.37:g.76022190G>C	ENSP00000237172:p.Pro1120Ala	Somatic	302	0		WXS	Illumina GAIIx	Phase_I	435	83	NM_015687	0	0	0	0	0	B2RMU6|Q5VUL6|Q86TC3|Q8N8B9|Q96SK6|Q9NVI8|Q9ULE5	Missense_Mutation	SNP	ENST00000237172.7	37	CCDS4984.1	.	.	.	.	.	.	.	.	.	.	G	9.022	0.985236	0.18889	.	.	ENSG00000118407	ENST00000393004;ENST00000237172;ENST00000370020	T;T;T	0.17528	2.28;2.27;2.27	5.76	5.76	0.90799	.	0.099239	0.64402	D	0.000001	T	0.10208	0.0250	L	0.51422	1.61	0.43808	D	0.996367	B;P;P	0.38370	0.013;0.495;0.628	B;B;B	0.34489	0.002;0.119;0.184	T	0.09862	-1.0655	10	0.22706	T	0.39	-12.5256	19.9705	0.97284	0.0:0.0:1.0:0.0	.	1120;1120;1120	A8K2G7;Q7Z7B0;Q7Z7B0-2	.;FLIP1_HUMAN;.	A	1120;1120;1021	ENSP00000376728:P1120A;ENSP00000237172:P1120A;ENSP00000359037:P1021A	ENSP00000237172:P1120A	P	-	1	0	FILIP1	76078910	0.992000	0.36948	0.936000	0.37596	0.105000	0.19272	2.044000	0.41241	2.728000	0.93425	0.655000	0.94253	CCT	.		0.542	FILIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041263.1	XM_029179	
HACE1	57531	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	105219214	105219214	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr6:105219214T>G	ENST00000262903.4	-	19	2341	c.2065A>C	c.(2065-2067)Aaa>Caa	p.K689Q	HACE1_ENST00000369125.2_Intron|HACE1_ENST00000517995.1_5'UTR	NM_020771.3	NP_065822.2	Q8IYU2	HACE1_HUMAN	HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1	689	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				cell cycle (GO:0007049)|Golgi organization (GO:0007030)|membrane fusion (GO:0061025)|protein K48-linked ubiquitination (GO:0070936)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|Rac protein signal transduction (GO:0016601)|regulation of cell migration (GO:0030334)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	ligase activity (GO:0016874)|Rab GTPase binding (GO:0017137)|Rac GTPase binding (GO:0048365)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(17)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	44		all_cancers(87;6.89e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0216)|Colorectal(196;0.202)		BRCA - Breast invasive adenocarcinoma(108;0.122)|Epithelial(106;0.204)		TGCAAATTTTTCGCATATTCT	0.368																																					p.K689Q		.											.	HACE1-663	0			c.A2065C						.						75.0	75.0	75.0					6																	105219214		2203	4300	6503	SO:0001583	missense	57531	exon19			AATTTTTCGCATA	BC034982	CCDS5050.1	6q21	2013-01-10	2012-02-23		ENSG00000085382	ENSG00000085382		"""Ankyrin repeat domain containing"""	21033	protein-coding gene	gene with protein product		610876				10718198	Standard	NM_020771		Approved	KIAA1320	uc003pqu.1	Q8IYU2	OTTHUMG00000015287	ENST00000262903.4:c.2065A>C	6.37:g.105219214T>G	ENSP00000262903:p.Lys689Gln	Somatic	69	0		WXS	Illumina GAIIx	Phase_I	89	36	NM_020771	0	0	0	0	0	A8K6U5|B3KY89|B4DFM6|B4DTQ4|B7Z9X6|E9PGP0|Q5VU99|Q5VUA0|Q8ND12|Q9P2M6	Missense_Mutation	SNP	ENST00000262903.4	37	CCDS5050.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.20|16.20	3.056607|3.056607	0.55325|0.55325	.|.	.|.	ENSG00000085382|ENSG00000085382	ENST00000518503;ENST00000518402|ENST00000262903	.|T	.|0.58060	.|0.36	5.53|5.53	5.53|5.53	0.82687|0.82687	.|HECT (4);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.51193|0.51193	0.1660|0.1660	N|N	0.25825|0.25825	0.765|0.765	0.80722|0.80722	D|D	1|1	.|P;D;D	.|0.76494	.|0.476;0.999;0.999	.|B;D;D	.|0.87578	.|0.158;0.998;0.961	T|T	0.54840|0.54840	-0.8233|-0.8233	5|10	.|0.40728	.|T	.|0.16	.|.	15.6565|15.6565	0.77140|0.77140	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|178;689;342	.|B4DFM6;Q8IYU2;Q8IYU2-3	.|.;HACE1_HUMAN;.	A|Q	171;123|689	.|ENSP00000262903:K689Q	.|ENSP00000262903:K689Q	E|K	-|-	2|1	0|0	HACE1|HACE1	105325907|105325907	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.959000|0.959000	0.62525|0.62525	7.676000|7.676000	0.84012|0.84012	2.085000|2.085000	0.62840|0.62840	0.482000|0.482000	0.46254|0.46254	GAA|AAA	.		0.368	HACE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041643.2	XM_045095	
RSPO3	84870	broad.mit.edu	37	6	127516969	127516969	+	Splice_Site	DEL	A	A	-			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr6:127516969delA	ENST00000356698.4	+	5	1225	c.636delA	c.(634-636)gga>gg	p.G212fs	RSPO3_ENST00000368317.3_Splice_Site_p.G212fs	NM_032784.3	NP_116173.2	Q9BXY4	RSPO3_HUMAN	R-spondin 3	212					branching involved in labyrinthine layer morphogenesis (GO:0060670)|canonical Wnt signaling pathway (GO:0060070)	extracellular region (GO:0005576)	heparin binding (GO:0008201)|receptor binding (GO:0005102)		PTPRK/RSPO3(10)	breast(1)|cervix(1)|endometrium(3)|large_intestine(3)|lung(8)|skin(1)	17				GBM - Glioblastoma multiforme(226;0.0555)		TCATTTCaggaaaaaaaggaa	0.274																																					p.G212fs		.											.	RSPO3-90	0			c.636delA						.						31.0	30.0	30.0					6																	127516969		2192	4276	6468	SO:0001630	splice_region_variant	84870	exon5			TTCAGGAAAAAAA	BC022367	CCDS5135.1	6q22.33	2013-02-28	2011-06-29	2005-08-08	ENSG00000146374	ENSG00000146374		"""Endogenous ligands"""	20866	protein-coding gene	gene with protein product		610574	"""thrombospondin, type I, domain containing 2"", ""R-spondin 3 homolog (Xenopus laevis)"""	THSD2		10842357, 15469841	Standard	NM_032784		Approved	FLJ14440	uc003qar.3	Q9BXY4	OTTHUMG00000015521	ENST00000356698.4:c.635-1A>-	6.37:g.127516969delA		Somatic	5	0		WXS	Illumina GAIIx	Phase_I	5	2	NM_032784	0	0	0	0	0	B2RC27|Q5VTV4|Q96K87	Frame_Shift_Del	DEL	ENST00000356698.4	37	CCDS5135.1																																																																																			.		0.274	RSPO3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042111.1	NM_032784	Frame_Shift_Del
AHI1	54806	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	135726087	135726087	+	Splice_Site	SNP	A	A	C			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr6:135726087A>C	ENST00000367800.4	-	20	3205		c.e20+1		AHI1_ENST00000457866.2_Splice_Site|AHI1_ENST00000327035.6_Splice_Site|AHI1_ENST00000417892.2_Splice_Site	NM_001134830.1	NP_001128302.1	Q8N157	AHI1_HUMAN	Abelson helper integration site 1						cellular protein localization (GO:0034613)|central nervous system development (GO:0007417)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|cloaca development (GO:0035844)|heart looping (GO:0001947)|hindbrain development (GO:0030902)|Kupffer's vesicle development (GO:0070121)|left/right axis specification (GO:0070986)|morphogenesis of a polarized epithelium (GO:0001738)|negative regulation of apoptotic process (GO:0043066)|otic vesicle development (GO:0071599)|photoreceptor cell outer segment organization (GO:0035845)|positive regulation of polarized epithelial cell differentiation (GO:0030862)|positive regulation of receptor internalization (GO:0002092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pronephric duct morphogenesis (GO:0039023)|pronephric nephron tubule morphogenesis (GO:0039008)|protein localization to organelle (GO:0033365)|regulation of behavior (GO:0050795)|retina layer formation (GO:0010842)|specification of axis polarity (GO:0065001)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vesicle targeting (GO:0006903)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|cell-cell junction (GO:0005911)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|nonmotile primary cilium (GO:0031513)|photoreceptor outer segment (GO:0001750)|primary cilium (GO:0072372)|TCTN-B9D complex (GO:0036038)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(18)|ovary(1)	37	Breast(56;0.239)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00904)|OV - Ovarian serous cystadenocarcinoma(155;0.00991)		AAAACTACTTACTTTTGCAGC	0.323																																					.		.											.	AHI1-227	0			c.2988+2T>G						.						90.0	86.0	87.0					6																	135726087		1825	4082	5907	SO:0001630	splice_region_variant	54806	exon21			CTACTTACTTTTG	AJ459824	CCDS47483.1, CCDS47484.1	6q23.2	2013-01-10	2005-11-29		ENSG00000135541	ENSG00000135541		"""WD repeat domain containing"""	21575	protein-coding gene	gene with protein product	"""Jouberin"""	608894	"""Abelson helper integration site"""			15060101, 16240161	Standard	NM_017651		Approved	FLJ20069, ORF1, JBTS3	uc003qgj.3	Q8N157	OTTHUMG00000015631	ENST00000367800.4:c.2988+1T>G	6.37:g.135726087A>C		Somatic	54	0		WXS	Illumina GAIIx	Phase_I	49	14	NM_001134830	0	0	0	0	0	E1P584|Q4FD35|Q504T3|Q5TCP9|Q6P098|Q6PIT6|Q8NDX0|Q9H0H2	Splice_Site	SNP	ENST00000367800.4	37	CCDS47483.1	.	.	.	.	.	.	.	.	.	.	A	15.19	2.758882	0.49468	.	.	ENSG00000135541	ENST00000367800;ENST00000457866;ENST00000417892;ENST00000367799;ENST00000265602;ENST00000327035;ENST00000367801;ENST00000529865	.	.	.	4.04	4.04	0.47022	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.6707	0.40011	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	AHI1	135767780	0.996000	0.38824	0.999000	0.59377	0.782000	0.44232	3.331000	0.52075	2.056000	0.61249	0.533000	0.62120	.	.		0.323	AHI1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391948.1	NM_017651	Intron
MAP3K4	4216	broad.mit.edu;bcgsc.ca	37	6	161527654	161527654	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr6:161527654G>A	ENST00000392142.4	+	20	4113	c.3965G>A	c.(3964-3966)tGt>tAt	p.C1322Y	MAP3K4_ENST00000348824.7_Missense_Mutation_p.C1268Y|MAP3K4_ENST00000366919.2_Missense_Mutation_p.C1272Y|MAP3K4_ENST00000366920.2_Missense_Mutation_p.C1318Y	NM_005922.2	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	1322					activation of MAPKK activity (GO:0000186)|chorionic trophoblast cell differentiation (GO:0060718)|intracellular signal transduction (GO:0035556)|male germ-line sex determination (GO:0019100)|MAPK cascade (GO:0000165)|placenta development (GO:0001890)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of p38MAPK cascade (GO:1900745)|regulation of gene expression (GO:0010468)|response to UV-C (GO:0010225)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)			breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|lung(28)|ovary(3)|skin(2)|stomach(1)	77		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		GGTCAAGTTTGTGATACGCCT	0.398																																					p.C1322Y		.											.	MAP3K4-548	0			c.G3965A						.						173.0	158.0	163.0					6																	161527654		2203	4300	6503	SO:0001583	missense	4216	exon20			AAGTTTGTGATAC	AF002715	CCDS34565.1, CCDS34566.1, CCDS75544.1	6q26	2012-10-02			ENSG00000085511	ENSG00000085511		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6856	protein-coding gene	gene with protein product		602425		MEKK4		9305639	Standard	XM_005266988		Approved	MTK1, MAPKKK4, KIAA0213	uc003qtn.3	Q9Y6R4	OTTHUMG00000015968	ENST00000392142.4:c.3965G>A	6.37:g.161527654G>A	ENSP00000375986:p.Cys1322Tyr	Somatic	255	0		WXS	Illumina GAIIx	Phase_I	176	8	NM_005922	0	0	0	0	0	A6H8W0|B7ZLD3|B9EG75|Q5VTT8|Q5VTT9|Q92612|Q9H408	Missense_Mutation	SNP	ENST00000392142.4	37	CCDS34565.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.422804	0.83559	.	.	ENSG00000085511	ENST00000366919;ENST00000392142;ENST00000540111;ENST00000366920;ENST00000348824	T;T;T;T	0.71222	-0.51;-0.54;-0.55;-0.5	4.85	4.85	0.62838	.	0.000000	0.85682	D	0.000000	T	0.70029	0.3177	N	0.24115	0.695	0.80722	D	1	D;D;D;D	0.71674	0.989;0.958;0.998;0.998	D;P;D;D	0.80764	0.915;0.51;0.994;0.992	T	0.75175	-0.3410	10	0.54805	T	0.06	-16.0942	17.9942	0.89177	0.0:0.0:1.0:0.0	.	1318;258;1272;1322	F5H538;Q9P1M2;Q9Y6R4-2;Q9Y6R4	.;.;.;M3K4_HUMAN	Y	1272;1322;1272;1318;1268	ENSP00000355886:C1272Y;ENSP00000375986:C1322Y;ENSP00000355887:C1318Y;ENSP00000297332:C1268Y	ENSP00000297332:C1268Y	C	+	2	0	MAP3K4	161447644	1.000000	0.71417	0.997000	0.53966	0.993000	0.82548	9.476000	0.97823	2.223000	0.72356	0.585000	0.79938	TGT	.		0.398	MAP3K4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042988.3		
TNRC18	84629	hgsc.bcm.edu	37	7	5410916	5410916	+	Silent	SNP	G	G	C	rs10215902	byFrequency	TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr7:5410916G>C	ENST00000430969.1	-	11	3657	c.3309C>G	c.(3307-3309)gcC>gcG	p.A1103A	TNRC18_ENST00000399537.4_Silent_p.A1103A	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	1103	Pro-rich.						chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		CGTCGGCGGCGGCCGTGGGCT	0.692													C|||	622	0.124201	0.2723	0.0288	5008	,	,		13291	0.0476		0.0606	False		,,,				2504	0.136				p.A1103A		.											.	TNRC18-46	0			c.C3309G						.	C		626,3208		50,526,1341	11.0	13.0	12.0		3309	-8.3	0.0	7	dbSNP_119	12	384,7814		14,356,3729	no	coding-synonymous	TNRC18	NM_001080495.2		64,882,5070	CC,CG,GG		4.6841,16.3276,8.3943		1103/2969	5410916	1010,11022	1917	4099	6016	SO:0001819	synonymous_variant	84629	exon11			GGCGGCGGCCGTG	U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.3309C>G	7.37:g.5410916G>C		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_001080495	0	0	0	0	0	A8MX41|Q96JH1|Q96K91	Silent	SNP	ENST00000430969.1	37	CCDS47534.1																																																																																			G|0.900;C|0.100		0.692	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
TNRC18	84629	hgsc.bcm.edu	37	7	5427517	5427517	+	Silent	SNP	G	G	A	rs34693947	byFrequency	TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr7:5427517G>A	ENST00000430969.1	-	5	2286	c.1938C>T	c.(1936-1938)ggC>ggT	p.G646G	TNRC18_ENST00000399537.4_Silent_p.G646G	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	646							chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		GCCGGCCGCCGCCCGCTGCAG	0.716													G|||	998	0.199281	0.0552	0.0908	5008	,	,		13710	0.6597		0.0437	False		,,,				2504	0.1564				p.G646G		.											.	TNRC18-46	0			c.C1938T						.	G		141,3189		2,137,1526	4.0	6.0	5.0		1938	-5.6	0.0	7	dbSNP_126	5	219,7185		3,213,3486	no	coding-synonymous	TNRC18	NM_001080495.2		5,350,5012	AA,AG,GG		2.9579,4.2342,3.3538		646/2969	5427517	360,10374	1665	3702	5367	SO:0001819	synonymous_variant	84629	exon5			GCCGCCGCCCGCT	U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.1938C>T	7.37:g.5427517G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	11	11	NM_001080495	0	0	0	0	0	A8MX41|Q96JH1|Q96K91	Silent	SNP	ENST00000430969.1	37	CCDS47534.1																																																																																			G|0.797;A|0.203		0.716	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
GARS	2617	hgsc.bcm.edu	37	7	30634630	30634630	+	Silent	SNP	G	G	C	rs2529438	byFrequency	TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr7:30634630G>C	ENST00000389266.3	+	1	334	c.93G>C	c.(91-93)ctG>ctC	p.L31L	AC005154.6_ENST00000580440.1_RNA|AC005154.6_ENST00000578994.1_RNA|AC005154.6_ENST00000579174.1_RNA|AC005154.6_ENST00000583664.1_RNA|AC005154.6_ENST00000584372.1_RNA|AC005154.6_ENST00000582549.1_RNA|AC005154.6_ENST00000584199.1_RNA|AC005154.6_ENST00000581665.1_RNA	NM_002047.2	NP_002038.2	P41250	SYG_HUMAN	glycyl-tRNA synthetase	31					cell death (GO:0008219)|diadenosine tetraphosphate biosynthetic process (GO:0015966)|gene expression (GO:0010467)|glycyl-tRNA aminoacylation (GO:0006426)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|secretory granule (GO:0030141)	ATP binding (GO:0005524)|glycine-tRNA ligase activity (GO:0004820)|protein dimerization activity (GO:0046983)			breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|skin(3)|urinary_tract(1)	24					Glycine(DB00145)	CCTCGCTCCTGCTCCGCCGGT	0.741													G|||	705	0.140775	0.1218	0.0994	5008	,	,		12290	0.1776		0.0726	False		,,,				2504	0.228				p.L31L		.											.	GARS-91	0			c.G93C						.	G		360,3594		14,332,1631	6.0	8.0	7.0		93	2.7	0.0	7	dbSNP_100	7	669,7413		24,621,3396	no	coding-synonymous	GARS	NM_002047.2		38,953,5027	CC,CG,GG		8.2777,9.1047,8.5494		31/740	30634630	1029,11007	1977	4041	6018	SO:0001819	synonymous_variant	2617	exon1			GCTCCTGCTCCGC	AK074524	CCDS43564.1	7p15	2014-09-17	2004-02-13		ENSG00000106105	ENSG00000106105	6.1.1.14	"""Aminoacyl tRNA synthetases / Class II"""	4162	protein-coding gene	gene with protein product	"""glycine tRNA ligase"""	600287	"""Charcot-Marie-Tooth neuropathy 2D"""	CMT2D		8595897, 8872480	Standard	NM_002047		Approved	GlyRS, DSMAV, SMAD1	uc003tbm.3	P41250	OTTHUMG00000152769	ENST00000389266.3:c.93G>C	7.37:g.30634630G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	9	NM_002047	0	0	0	0	0	B3KQA2|B4DIA0|Q969Y1	Silent	SNP	ENST00000389266.3	37	CCDS43564.1																																																																																			G|0.889;C|0.111		0.741	GARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327735.1	NM_002047	
NT5C3A	51251	ucsc.edu;bcgsc.ca	37	7	33054388	33054388	+	Missense_Mutation	SNP	T	T	C	rs79747830	byFrequency	TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr7:33054388T>C	ENST00000242210.7	-	9	1041	c.965A>G	c.(964-966)gAt>gGt	p.D322G	NT5C3A_ENST00000381626.2_Missense_Mutation_p.D271G|AVL9_ENST00000404479.1_Intron|NT5C3A_ENST00000610140.1_Missense_Mutation_p.D317G|NT5C3A_ENST00000396152.2_Missense_Mutation_p.D283G|NT5C3A_ENST00000405342.1_Missense_Mutation_p.D283G|NT5C3A_ENST00000409467.1_Missense_Mutation_p.D271G	NM_001002009.2|NM_001002010.2	NP_001002009.1|NP_001002010.1	Q9H0P0	5NT3A_HUMAN	5'-nucleotidase, cytosolic IIIA	322					dephosphorylation (GO:0016311)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide metabolic process (GO:0009117)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|pyrimidine nucleoside metabolic process (GO:0006213)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)	2'-phosphotransferase activity (GO:0008665)|5'-nucleotidase activity (GO:0008253)|magnesium ion binding (GO:0000287)|nucleotide binding (GO:0000166)	p.D322G(1)									TAATGATTCATCTTGTACTAA	0.353																																					p.D322G		.											.	.	1	Substitution - Missense(1)	skin(1)	c.A965G						.						103.0	105.0	104.0					7																	33054388		2203	4298	6501	SO:0001583	missense	0	exon9			GATTCATCTTGTA	AF312735	CCDS34616.1, CCDS34617.1, CCDS55101.1	7p14.3	2013-03-06	2013-03-06	2013-03-06	ENSG00000122643	ENSG00000122643	3.1.3.5		17820	protein-coding gene	gene with protein product	"""lupin"""	606224	"""5'-nucleotidase, cytosolic III"""	NT5C3		11042152, 10942414	Standard	NM_001002010		Approved	UMPH1, PSN1, PN-I, UMPH, P5'N-1, cN-III, p36, POMP, hUMP1	uc003tdk.4	Q9H0P0	OTTHUMG00000152983	ENST00000242210.7:c.965A>G	7.37:g.33054388T>C	ENSP00000242210:p.Asp322Gly	Somatic	45	0		WXS	Illumina GAIIx	Phase_I	34	8	NM_001002010	0	0	0	0	0	A8K253|B2RAA5|B8ZZC4|Q6IPZ1|Q6NXS6|Q7L3G6|Q9P0P5|Q9UC42|Q9UC43|Q9UC44|Q9UC45	Missense_Mutation	SNP	ENST00000242210.7	37	CCDS34616.1	.	.	.	.	.	.	.	.	.	.	T	26.2	4.714928	0.89112	.	.	ENSG00000122643	ENST00000381626;ENST00000396152;ENST00000242210;ENST00000405342;ENST00000409467	D;D;D;D;D	0.89343	-2.5;-2.5;-2.5;-2.5;-2.5	5.94	5.94	0.96194	HAD-like domain (1);	0.323125	0.35646	N	0.003065	D	0.95564	0.8558	M	0.93197	3.39	0.80722	D	1	P;P	0.50369	0.934;0.553	P;P	0.60949	0.881;0.531	D	0.96469	0.9347	10	0.87932	D	0	.	16.4075	0.83691	0.0:0.0:0.0:1.0	.	322;283	Q9H0P0;Q9H0P0-1	5NT3_HUMAN;.	G	271;283;322;283;271	ENSP00000371039:D271G;ENSP00000379456:D283G;ENSP00000242210:D322G;ENSP00000385261:D283G;ENSP00000387166:D271G	ENSP00000242210:D322G	D	-	2	0	NT5C3	33020913	1.000000	0.71417	0.960000	0.40013	0.989000	0.77384	8.040000	0.89188	2.275000	0.75901	0.528000	0.53228	GAT	T|0.969;C|0.031		0.353	NT5C3A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000328880.1	NM_016489	
OGDH	4967	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	44714133	44714133	+	Silent	SNP	C	C	T			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr7:44714133C>T	ENST00000222673.5	+	7	954	c.912C>T	c.(910-912)taC>taT	p.Y304Y	OGDH_ENST00000543843.1_Silent_p.Y255Y|OGDH_ENST00000447398.1_Silent_p.Y315Y|OGDH_ENST00000443864.2_Silent_p.Y304Y|OGDH_ENST00000449767.1_Silent_p.Y300Y|OGDH_ENST00000439616.2_Silent_p.Y154Y|OGDH_ENST00000444676.1_Silent_p.Y319Y|OGDH_ENST00000459672.1_3'UTR	NM_002541.3	NP_002532.2	Q02218	ODO1_HUMAN	oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)	304					2-oxoglutarate metabolic process (GO:0006103)|cellular metabolic process (GO:0044237)|cellular nitrogen compound metabolic process (GO:0034641)|cerebellar cortex development (GO:0021695)|generation of precursor metabolites and energy (GO:0006091)|glycolytic process (GO:0006096)|hippocampus development (GO:0021766)|lysine catabolic process (GO:0006554)|NADH metabolic process (GO:0006734)|olfactory bulb mitral cell layer development (GO:0061034)|pyramidal neuron development (GO:0021860)|small molecule metabolic process (GO:0044281)|striatum development (GO:0021756)|succinyl-CoA metabolic process (GO:0006104)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)|thalamus development (GO:0021794)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrion (GO:0005739)|oxoglutarate dehydrogenase complex (GO:0045252)	metal ion binding (GO:0046872)|oxoglutarate dehydrogenase (NAD+) activity (GO:0034602)|oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)			breast(2)|endometrium(5)|kidney(2)|large_intestine(6)|lung(13)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	36					Valproic Acid(DB00313)	GCGTGGACTACGTGATCATGG	0.562																																					p.Y304Y		.											.	OGDH-228	0			c.C912T						.						129.0	104.0	112.0					7																	44714133		2203	4300	6503	SO:0001819	synonymous_variant	4967	exon7			GGACTACGTGATC	D10523	CCDS34627.1, CCDS47580.1, CCDS55107.1	7p13-p11.2	2010-11-23			ENSG00000105953	ENSG00000105953	1.2.4.2		8124	protein-coding gene	gene with protein product		613022				8020988, 1542694	Standard	NM_002541		Approved	E1k	uc003tln.3	Q02218	OTTHUMG00000155304	ENST00000222673.5:c.912C>T	7.37:g.44714133C>T		Somatic	279	0		WXS	Illumina GAIIx	Phase_I	172	63	NM_002541	0	0	0	0	0	B4E2U9|D3DVL0|E9PBM1|Q96DD3|Q9UDX0	Silent	SNP	ENST00000222673.5	37	CCDS34627.1																																																																																			.		0.562	OGDH-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000339391.1		
LRRD1	401387	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	91793258	91793258	+	Nonsense_Mutation	SNP	A	A	C			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr7:91793258A>C	ENST00000458448.1	-	2	1459	c.1259T>G	c.(1258-1260)tTa>tGa	p.L420*	LRRD1_ENST00000343318.5_Intron|CTB-161K23.1_ENST00000453068.1_RNA|LRRD1_ENST00000454089.2_5'UTR|LRRD1_ENST00000422722.1_Intron|LRRD1_ENST00000430130.2_Nonsense_Mutation_p.L420*			A4D1F6	LRRD1_HUMAN	leucine-rich repeats and death domain containing 1	420					signal transduction (GO:0007165)					breast(4)|endometrium(1)	5						GAGTTTTCTTAAATTGTTAAG	0.303																																					p.L420X		.											.	.	0			c.T1259G						.						62.0	53.0	56.0					7																	91793258		692	1571	2263	SO:0001587	stop_gained	401387	exon1			TTTCTTAAATTGT	BC026112	CCDS55124.1	7q21.2	2011-05-23			ENSG00000240720	ENSG00000240720			34300	protein-coding gene	gene with protein product							Standard	NM_001161528		Approved	IMAGE:4798971	uc011khp.1	A4D1F6	OTTHUMG00000155861	ENST00000458448.1:c.1259T>G	7.37:g.91793258A>C	ENSP00000405987:p.Leu420*	Somatic	49	0		WXS	Illumina GAIIx	Phase_I	61	31	NM_001161528	0	0	0	0	0	B7ZMM9|Q49AT9	Nonsense_Mutation	SNP	ENST00000458448.1	37	CCDS55124.1	.	.	.	.	.	.	.	.	.	.	A	38	6.793629	0.97841	.	.	ENSG00000240720	ENST00000458448;ENST00000430130	.	.	.	5.56	5.56	0.83823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.7062	0.77583	1.0:0.0:0.0:0.0	.	.	.	.	X	420	.	ENSP00000411568:L420X	L	-	2	0	LRRD1	91631194	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.421000	0.73353	2.109000	0.64355	0.477000	0.44152	TTA	.		0.303	LRRD1-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342027.2	NM_001045475	
ASB4	51666	broad.mit.edu;bcgsc.ca	37	7	95157438	95157438	+	Silent	SNP	C	C	G			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr7:95157438C>G	ENST00000325885.5	+	3	872	c.801C>G	c.(799-801)ctC>ctG	p.L267L	ASB4_ENST00000428113.1_Silent_p.L267L	NM_016116.2	NP_057200.1	Q9Y574	ASB4_HUMAN	ankyrin repeat and SOCS box containing 4	267					intracellular signal transduction (GO:0035556)|positive regulation of vasculogenesis (GO:2001214)|protein autoubiquitination (GO:0051865)	Cul2-RING ubiquitin ligase complex (GO:0031462)|Cul5-RING ubiquitin ligase complex (GO:0031466)	ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(8)|pancreas(1)|prostate(1)|skin(2)	20	all_cancers(62;2.27e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.218)|all_lung(186;0.246)		STAD - Stomach adenocarcinoma(171;0.0151)			ACCACGTGCTCATGCACATGA	0.562											OREG0018172	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L267L		.											.	ASB4-226	0			c.C801G						.						82.0	66.0	72.0					7																	95157438		2203	4300	6503	SO:0001819	synonymous_variant	51666	exon3			CGTGCTCATGCAC	AF156779	CCDS5641.1, CCDS5642.1	7q21-q22	2013-01-10	2011-01-25		ENSG00000005981	ENSG00000005981		"""Ankyrin repeat domain containing"""	16009	protein-coding gene	gene with protein product		605761	"""ankyrin repeat and SOCS box-containing 4"""				Standard	NM_145872		Approved	ASB-4	uc011kij.2	Q9Y574	OTTHUMG00000153960	ENST00000325885.5:c.801C>G	7.37:g.95157438C>G		Somatic	194	0	1310	WXS	Illumina GAIIx	Phase_I	212	10	NM_016116	0	0	0	0	0	A4D1H6|O14586|Q14D68|Q8TBT2	Silent	SNP	ENST00000325885.5	37	CCDS5641.1																																																																																			C|1.000;T|0.000		0.562	ASB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333225.2	NM_016116	
PARP12	64761	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	139737565	139737565	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr7:139737565G>A	ENST00000263549.3	-	7	2147	c.1274C>T	c.(1273-1275)gCc>gTc	p.A425V	PARP12_ENST00000470515.1_5'UTR	NM_022750.2	NP_073587.1	Q9H0J9	PAR12_HUMAN	poly (ADP-ribose) polymerase family, member 12	425	WWE 2. {ECO:0000255|PROSITE- ProRule:PRU00248}.					nucleus (GO:0005634)	metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|skin(1)	19	Melanoma(164;0.0142)					CTTCAAGGTGGCTGCCTGGCC	0.607																																					p.A425V		.											.	PARP12-525	0			c.C1274T						.						101.0	76.0	84.0					7																	139737565		2203	4300	6503	SO:0001583	missense	64761	exon7			AAGGTGGCTGCCT	AL136766	CCDS5857.1	7q34	2014-01-28	2005-06-02	2005-06-02	ENSG00000059378	ENSG00000059378		"""Zinc fingers, CCCH-type domain containing"", ""Poly (ADP-ribose) polymerases"""	21919	protein-coding gene	gene with protein product		612481	"""zinc finger CCCH-type domain containing 1"""	ZC3HDC1		11230166, 12851707	Standard	NM_022750		Approved	FLJ22693, PARP-12, ZC3H1	uc003vvl.1	Q9H0J9	OTTHUMG00000157315	ENST00000263549.3:c.1274C>T	7.37:g.139737565G>A	ENSP00000263549:p.Ala425Val	Somatic	186	0		WXS	Illumina GAIIx	Phase_I	68	49	NM_022750	0	0	0	0	0	Q9H610|Q9NP36|Q9NTI3	Missense_Mutation	SNP	ENST00000263549.3	37	CCDS5857.1	.	.	.	.	.	.	.	.	.	.	G	16.89	3.247213	0.59103	.	.	ENSG00000059378	ENST00000263549	T	0.30448	1.53	5.7	5.7	0.88788	WWE domain (1);	0.480144	0.23209	N	0.050690	T	0.39627	0.1085	M	0.78637	2.42	0.18873	N	0.999981	B	0.24533	0.105	B	0.23275	0.045	T	0.23940	-1.0174	10	0.32370	T	0.25	.	18.6103	0.91283	0.0:0.0:1.0:0.0	.	425	Q9H0J9	PAR12_HUMAN	V	425	ENSP00000263549:A425V	ENSP00000263549:A425V	A	-	2	0	PARP12	139384034	0.294000	0.24380	0.056000	0.19401	0.765000	0.43378	4.927000	0.63440	2.695000	0.91970	0.561000	0.74099	GCC	.		0.607	PARP12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348413.1	NM_022750	
NOS3	4846	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	150698393	150698393	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr7:150698393G>T	ENST00000484524.1	+	10	1308	c.1308G>T	c.(1306-1308)aaG>aaT	p.K436N	NOS3_ENST00000461406.1_Missense_Mutation_p.K230N|NOS3_ENST00000297494.3_Missense_Mutation_p.K436N|NOS3_ENST00000467517.1_Missense_Mutation_p.K436N	NM_001160111.1	NP_001153583.1	P60323	NANO3_HUMAN	nitric oxide synthase 3 (endothelial cell)	0					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic signaling pathway (GO:2001234)|oogenesis (GO:0048477)|regulation of cell cycle (GO:0051726)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(5)|endometrium(1)|kidney(4)|large_intestine(6)|liver(2)|lung(11)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	50	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		ATGAGCAGAAGGCCAGGGGGG	0.607																																					p.K436N		.											.	NOS3-1011	0			c.G1308T						.						62.0	64.0	63.0					7																	150698393		2203	4300	6503	SO:0001583	missense	4846	exon10			GCAGAAGGCCAGG		CCDS5912.1, CCDS55182.1, CCDS55183.1	7q36	2007-02-15			ENSG00000164867	ENSG00000164867	1.14.13.39		7876	protein-coding gene	gene with protein product	"""endothelial nitric oxide synthase"""	163729				1379542	Standard	NM_000603		Approved	ECNOS, eNOS	uc003wif.3	P29474	OTTHUMG00000158343	ENST00000484524.1:c.1308G>T	7.37:g.150698393G>T	ENSP00000420215:p.Lys436Asn	Somatic	45	0		WXS	Illumina GAIIx	Phase_I	19	12	NM_001160111	0	0	0	0	0	Q495E5	Missense_Mutation	SNP	ENST00000484524.1	37	CCDS55182.1	.	.	.	.	.	.	.	.	.	.	G	15.00	2.701900	0.48307	.	.	ENSG00000164867	ENST00000297494;ENST00000461406;ENST00000484524;ENST00000467517	T;T;T;T	0.27402	1.67;1.67;1.67;1.67	5.13	4.24	0.50183	Nitric oxide synthase, oxygenase domain (2);	0.095197	0.38959	N	0.001501	T	0.36193	0.0958	M	0.62209	1.925	0.42790	D	0.993898	B;B;P;B;B	0.37158	0.031;0.031;0.585;0.076;0.293	B;B;B;B;B	0.43916	0.037;0.059;0.436;0.07;0.059	T	0.25222	-1.0138	10	0.87932	D	0	-14.6207	7.8491	0.29444	0.1876:0.0:0.8124:0.0	.	436;436;436;230;436	A0S0A6;E9PFR2;A0S0A8;E7ESA7;P29474	.;.;.;.;NOS3_HUMAN	N	436;230;436;436	ENSP00000297494:K436N;ENSP00000417143:K230N;ENSP00000420215:K436N;ENSP00000420551:K436N	ENSP00000297494:K436N	K	+	3	2	NOS3	150329326	0.282000	0.24268	1.000000	0.80357	0.987000	0.75469	0.409000	0.21082	1.140000	0.42260	0.561000	0.74099	AAG	.		0.607	NOS3-004	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000351550.1	NM_000603	
KMT2C	58508	bcgsc.ca	37	7	151932990	151932990	+	Missense_Mutation	SNP	C	C	T	rs76844681		TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr7:151932990C>T	ENST00000262189.6	-	16	2899	c.2681G>A	c.(2680-2682)cGg>cAg	p.R894Q	KMT2C_ENST00000355193.2_Missense_Mutation_p.R894Q	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	894					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										TCGAGGTCTCCGCTTTCCTGG	0.502																																					p.R894Q		.											.	MLL3-1398	0			c.G2681A						.						33.0	34.0	33.0					7																	151932990		2202	4295	6497	SO:0001583	missense	58508	exon16			GGTCTCCGCTTTC	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.2681G>A	7.37:g.151932990C>T	ENSP00000262189:p.Arg894Gln	Somatic	186	1		WXS	Illumina GAIIx	Phase_I	103	12	NM_170606	0	0	0	0	0	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.710284	0.89018	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	D;D	0.89485	-2.5;-2.52	5.1	5.1	0.69264	.	0.000000	0.42294	D	0.000721	D	0.93314	0.7869	M	0.63843	1.955	0.80722	D	1	D	0.76494	0.999	D	0.72625	0.978	D	0.93742	0.7051	10	0.66056	D	0.02	.	17.0444	0.86498	0.0:1.0:0.0:0.0	.	894	Q8NEZ4	MLL3_HUMAN	Q	894	ENSP00000262189:R894Q;ENSP00000347325:R894Q	ENSP00000262189:R894Q	R	-	2	0	MLL3	151563923	1.000000	0.71417	0.996000	0.52242	0.951000	0.60555	7.268000	0.78473	2.530000	0.85305	0.650000	0.86243	CGG	C|0.999;T|0.001		0.502	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
HTR5A	3361	broad.mit.edu	37	7	154862947	154862947	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr7:154862947T>G	ENST00000287907.2	+	1	914	c.338T>G	c.(337-339)cTg>cGg	p.L113R	HTR5A-AS1_ENST00000493904.1_5'UTR|HTR5A-AS1_ENST00000543018.1_Missense_Mutation_p.S23R|HTR5A-AS1_ENST00000395731.2_Missense_Mutation_p.S23R	NM_024012.3	NP_076917.1	P47898	5HT5A_HUMAN	5-hydroxytryptamine (serotonin) receptor 5A, G protein-coupled	113					cAMP-mediated signaling (GO:0019933)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|hippocampus development (GO:0021766)|response to estradiol (GO:0032355)|serotonin receptor signaling pathway (GO:0007210)	dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	serotonin receptor activity (GO:0004993)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(22)|ovary(2)|prostate(3)|stomach(1)	48	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0238)	UCEC - Uterine corpus endometrioid carcinoma (81;0.171)	Asenapine(DB06216)|Loxapine(DB00408)|Olanzapine(DB00334)	GGTCGGAGGCTGTGCCAGCTT	0.672																																					p.L113R		.											.	HTR5A-155	0			c.T338G						.						55.0	45.0	48.0					7																	154862947		2203	4300	6503	SO:0001583	missense	3361	exon1			GGAGGCTGTGCCA		CCDS5936.1	7q36.1	2012-08-08	2012-02-03		ENSG00000157219	ENSG00000157219		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5300	protein-coding gene	gene with protein product		601305	"""5-hydroxytryptamine (serotonin) receptor 5A"""			7988681	Standard	NM_024012		Approved	5-HT5A	uc003wlu.2	P47898	OTTHUMG00000151327	ENST00000287907.2:c.338T>G	7.37:g.154862947T>G	ENSP00000287907:p.Leu113Arg	Somatic	8	0		WXS	Illumina GAIIx	Phase_I	17	2	NM_024012	0	0	0	0	0	Q2M2D2	Missense_Mutation	SNP	ENST00000287907.2	37	CCDS5936.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	21.4|21.4	4.141596|4.141596	0.77775|0.77775	.|.	.|.	ENSG00000157219|ENSG00000220575	ENST00000287907|ENST00000395731;ENST00000543018	T|.	0.42513|.	0.97|.	4.52|4.52	4.52|4.52	0.55395|0.55395	GPCR, rhodopsin-like superfamily (1);|.	0.000000|.	0.64402|.	D|.	0.000001|.	T|T	0.72953|0.72953	0.3525|0.3525	M|M	0.89904|0.89904	3.07|3.07	0.80722|0.80722	D|D	1|1	D|B	0.89917|0.11235	1.0|0.004	D|B	0.97110|0.13407	1.0|0.009	T|T	0.75545|0.75545	-0.3280|-0.3280	10|8	0.87932|0.87932	D|D	0|0	.|.	14.0258|14.0258	0.64584|0.64584	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	113|23	P47898|B7Z8E6	5HT5A_HUMAN|.	R|R	113|23	ENSP00000287907:L113R|.	ENSP00000287907:L113R|ENSP00000379080:S23R	L|S	+|-	2|1	0|0	HTR5A|AC093726.4	154493880|154493880	0.998000|0.998000	0.40836|0.40836	0.983000|0.983000	0.44433|0.44433	0.753000|0.753000	0.42808|0.42808	7.523000|7.523000	0.81856|0.81856	1.896000|1.896000	0.54893|0.54893	0.460000|0.460000	0.39030|0.39030	CTG|AGC	.		0.672	HTR5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322240.1	NM_024012	
SLC20A2	6575	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	42294695	42294695	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr8:42294695G>C	ENST00000342228.3	-	8	1704	c.1335C>G	c.(1333-1335)atC>atG	p.I445M	SLC20A2_ENST00000520179.1_Missense_Mutation_p.I445M|SLC20A2_ENST00000520262.1_Missense_Mutation_p.I445M	NM_006749.4	NP_006740.1	Q08357	S20A2_HUMAN	solute carrier family 20 (phosphate transporter), member 2	445					ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	inorganic phosphate transmembrane transporter activity (GO:0005315)|receptor activity (GO:0004872)|sodium:phosphate symporter activity (GO:0005436)|virus receptor activity (GO:0001618)			breast(1)|endometrium(6)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|stomach(1)	26	all_lung(13;8.33e-12)|Lung NSC(13;1.41e-10)|Ovarian(28;0.00579)|Prostate(17;0.0119)|Lung SC(25;0.211)	all_lung(54;0.00671)|Lung NSC(58;0.0184)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	BRCA - Breast invasive adenocarcinoma(8;5.73e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00419)|Lung(22;0.0302)|LUSC - Lung squamous cell carcinoma(45;0.0869)			CCTCCGCCTCGATCTCCGCCT	0.642																																					p.I445M		.											.	SLC20A2-92	0			c.C1335G						.						63.0	57.0	59.0					8																	42294695		2203	4299	6502	SO:0001583	missense	6575	exon8			CGCCTCGATCTCC		CCDS6132.1	8p11.21	2013-05-22			ENSG00000168575	ENSG00000168575		"""Solute carriers"""	10947	protein-coding gene	gene with protein product		158378		MLVAR, GLVR2		7745689, 16790504	Standard	NM_001257180		Approved	PiT-2, Glvr-2	uc010lxm.4	Q08357	OTTHUMG00000164169	ENST00000342228.3:c.1335C>G	8.37:g.42294695G>C	ENSP00000340465:p.Ile445Met	Somatic	37	0		WXS	Illumina GAIIx	Phase_I	104	17	NM_001257181	0	0	0	0	0		Missense_Mutation	SNP	ENST00000342228.3	37	CCDS6132.1	.	.	.	.	.	.	.	.	.	.	G	14.99	2.701439	0.48307	.	.	ENSG00000168575	ENST00000342228;ENST00000520262;ENST00000520179	D;D;D	0.90732	-2.72;-2.72;-2.72	5.73	-4.42	0.03579	.	0.000000	0.85682	D	0.000000	D	0.90683	0.7077	L	0.56769	1.78	0.52501	D	0.999954	D	0.76494	0.999	D	0.72338	0.977	D	0.86412	0.1749	10	0.38643	T	0.18	-33.4398	6.8325	0.23917	0.204:0.0:0.2337:0.5623	.	445	Q08357	S20A2_HUMAN	M	445	ENSP00000340465:I445M;ENSP00000429754:I445M;ENSP00000429712:I445M	ENSP00000340465:I445M	I	-	3	3	SLC20A2	42413852	0.014000	0.17966	0.977000	0.42913	0.483000	0.33249	-0.876000	0.04201	-0.603000	0.05767	0.585000	0.79938	ATC	.		0.642	SLC20A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377578.1		
CRH	1392	hgsc.bcm.edu	37	8	67089425	67089425	+	Silent	SNP	T	T	G	rs6159	byFrequency	TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr8:67089425T>G	ENST00000276571.3	-	2	734	c.288A>C	c.(286-288)ggA>ggC	p.G96G		NM_000756.2	NP_000747.1	P06850	CRF_HUMAN	corticotropin releasing hormone	96					adrenal gland development (GO:0030325)|associative learning (GO:0008306)|cellular response to cocaine (GO:0071314)|cellular response to dexamethasone stimulus (GO:0071549)|diterpenoid metabolic process (GO:0016101)|feeding behavior (GO:0007631)|female pregnancy (GO:0007565)|ferulate metabolic process (GO:0033494)|glucocorticoid biosynthetic process (GO:0006704)|hormone-mediated apoptotic signaling pathway (GO:0008628)|hypothalamus development (GO:0021854)|inflammatory response (GO:0006954)|ion homeostasis (GO:0050801)|learning or memory (GO:0007611)|locomotory exploration behavior (GO:0035641)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|lung development (GO:0030324)|negative regulation of blood pressure (GO:0045776)|negative regulation of cell death (GO:0060548)|negative regulation of circadian sleep/wake cycle, REM sleep (GO:0042322)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of gene expression (GO:0010629)|negative regulation of glucagon secretion (GO:0070093)|negative regulation of luteinizing hormone secretion (GO:0033685)|negative regulation of norepinephrine secretion (GO:0010700)|parturition (GO:0007567)|positive regulation of behavioral fear response (GO:2000987)|positive regulation of calcium ion import (GO:0090280)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cell death (GO:0010942)|positive regulation of cell proliferation (GO:0008284)|positive regulation of circadian sleep/wake cycle, wakefulness (GO:0010841)|positive regulation of corticosterone secretion (GO:2000854)|positive regulation of corticotropin secretion (GO:0051461)|positive regulation of cortisol secretion (GO:0051464)|positive regulation of digestive system process (GO:0060456)|positive regulation of gene expression (GO:0010628)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of protein phosphorylation (GO:0001934)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of serotonin secretion (GO:0014062)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to ether (GO:0045472)|response to immobilization stress (GO:0035902)|response to pain (GO:0048265)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, dopaminergic (GO:0001963)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|perikaryon (GO:0043204)|varicosity (GO:0043196)	hormone activity (GO:0005179)|neuropeptide hormone activity (GO:0005184)|receptor binding (GO:0005102)			breast(1)|endometrium(1)|lung(2)|urinary_tract(1)	5		all_cancers(86;2.58e-06)|all_epithelial(80;6.27e-09)|all_lung(136;0.000414)|Lung NSC(129;0.0011)	Epithelial(68;0.0136)|all cancers(69;0.0507)|BRCA - Breast invasive adenocarcinoma(89;0.0628)|OV - Ovarian serous cystadenocarcinoma(28;0.0904)		Corticotropin(DB01285)	TGCCGCTGCCTCCGGCGAGGA	0.701											OREG0018805	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	1938	0.386981	0.7557	0.3646	5008	,	,		12753	0.3433		0.1392	False		,,,				2504	0.2045				p.G96G		.											.	CRH-90	0			c.A288C						.	G		1011,1897		182,647,625	2.0	3.0	3.0		288	-2.7	0.0	8	dbSNP_52	3	578,6556		47,484,3036	no	coding-synonymous	CRH	NM_000756.2		229,1131,3661	GG,GT,TT		8.102,34.7662,15.8235		96/197	67089425	1589,8453	1454	3567	5021	SO:0001819	synonymous_variant	1392	exon2			GCTGCCTCCGGCG		CCDS6188.1	8q13	2013-02-25				ENSG00000147571		"""Endogenous ligands"""	2355	protein-coding gene	gene with protein product	"""corticotropin-releasing factor"", ""corticoliberin"""	122560					Standard	NM_000756		Approved	CRF	uc003xvy.2	P06850		ENST00000276571.3:c.288A>C	8.37:g.67089425T>G		Somatic	3	0	1096	WXS	Illumina GAIIx	Phase_I	18	4	NM_000756	0	0	0	0	0	B3KQS4	Silent	SNP	ENST00000276571.3	37	CCDS6188.1																																																																																			T|0.642;G|0.358		0.701	CRH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378926.1	NM_000756	
ZNF704	619279	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	81553604	81553604	+	Silent	SNP	G	G	A			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr8:81553604G>A	ENST00000327835.3	-	9	1467	c.1236C>T	c.(1234-1236)gaC>gaT	p.D412D		NM_001033723.2	NP_001028895.1	Q6ZNC4	ZN704_HUMAN	zinc finger protein 704	412							metal ion binding (GO:0046872)			lung(9)|skin(1)|upper_aerodigestive_tract(1)	11	all_cancers(3;8.53e-08)|all_epithelial(4;4.59e-10)|Breast(3;2.56e-06)|Lung NSC(7;2.58e-06)|all_lung(9;9.4e-06)		BRCA - Breast invasive adenocarcinoma(6;0.00401)|Epithelial(68;0.00448)|all cancers(69;0.0277)			GGGTCTCTCAGTCGAGGAACC	0.602																																					p.D412D		.											.	ZNF704-90	0			c.C1236T						.						48.0	40.0	43.0					8																	81553604		2203	4300	6503	SO:0001819	synonymous_variant	619279	exon9			CTCTCAGTCGAGG	AK131274	CCDS34913.1	8q21.13	2008-05-02			ENSG00000164684	ENSG00000164684			32291	protein-coding gene	gene with protein product							Standard	NM_001033723		Approved	FLJ16218, Gig1	uc003yby.2	Q6ZNC4	OTTHUMG00000164733	ENST00000327835.3:c.1236C>T	8.37:g.81553604G>A		Somatic	43	0		WXS	Illumina GAIIx	Phase_I	118	27	NM_001033723	0	0	0	0	0	B2RNE6|B9EGW6	Silent	SNP	ENST00000327835.3	37	CCDS34913.1																																																																																			.		0.602	ZNF704-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379964.2	NM_001033723	
CHMP4C	92421	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	82670423	82670423	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr8:82670423A>G	ENST00000297265.4	+	4	723	c.530A>G	c.(529-531)aAt>aGt	p.N177S		NM_152284.3	NP_689497.1	Q96CF2	CHM4C_HUMAN	charged multivesicular body protein 4C	177	Intramolecular interaction with N- terminus. {ECO:0000250}.				abscission (GO:0009838)|cytokinesis checkpoint (GO:0031565)|endosomal transport (GO:0016197)|membrane organization (GO:0061024)|negative regulation of cytokinesis (GO:0032466)|positive regulation of viral release from host cell (GO:1902188)|protein transport (GO:0015031)|regulation of viral process (GO:0050792)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Flemming body (GO:0090543)|membrane (GO:0016020)|midbody (GO:0030496)	protein homodimerization activity (GO:0042803)			NS(1)|breast(2)|endometrium(2)|large_intestine(1)|lung(1)|ovary(2)|skin(1)	10						GAGGAATTAAATAAGAAGATG	0.438																																					p.N177S		.											.	CHMP4C-92	0			c.A530G						.						110.0	107.0	108.0					8																	82670423		2203	4300	6503	SO:0001583	missense	92421	exon4			AATTAAATAAGAA	AK000049	CCDS6233.1	8q21.13	2011-09-21	2011-09-21		ENSG00000164695	ENSG00000164695		"""Charged multivesicular body proteins"""	30599	protein-coding gene	gene with protein product	"""Snf7 homologue associated with Alix 3"""	610899	"""chromatin modifying protein 4C"""			12860994 , 14678797	Standard	NM_152284		Approved	MGC22825, Shax3, VPS32C	uc003ycl.3	Q96CF2	OTTHUMG00000164726	ENST00000297265.4:c.530A>G	8.37:g.82670423A>G	ENSP00000297265:p.Asn177Ser	Somatic	114	0		WXS	Illumina GAIIx	Phase_I	177	39	NM_152284	0	0	0	0	0	B2RBZ1	Missense_Mutation	SNP	ENST00000297265.4	37	CCDS6233.1	.	.	.	.	.	.	.	.	.	.	A	17.04	3.288571	0.59976	.	.	ENSG00000164695	ENST00000297265	T	0.72505	-0.66	6.17	6.17	0.99709	.	0.087405	0.85682	D	0.000000	T	0.68778	0.3038	L	0.54323	1.7	0.54753	D	0.999986	B	0.25719	0.132	B	0.25987	0.065	T	0.65207	-0.6224	10	0.45353	T	0.12	-31.0278	16.8222	0.85835	1.0:0.0:0.0:0.0	.	177	Q96CF2	CHM4C_HUMAN	S	177	ENSP00000297265:N177S	ENSP00000297265:N177S	N	+	2	0	CHMP4C	82832978	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.997000	0.93544	2.371000	0.80710	0.533000	0.62120	AAT	.		0.438	CHMP4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379927.1	NM_152284	
MTSS1	9788	broad.mit.edu	37	8	125568471	125568471	+	Splice_Site	SNP	A	A	C			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr8:125568471A>C	ENST00000518547.1	-	12	1878		c.e12+1		MTSS1_ENST00000395508.2_Splice_Site|MTSS1_ENST00000354184.4_Splice_Site|MTSS1_ENST00000431961.2_Splice_Site|MTSS1_ENST00000524090.1_Splice_Site|MTSS1_ENST00000523587.1_Splice_Site|MTSS1_ENST00000325064.5_Splice_Site|NDUFB9_ENST00000522532.1_Intron|MTSS1_ENST00000378017.3_Splice_Site	NM_001282971.1|NM_014751.4	NP_001269900.1|NP_055566.3	O43312	MTSS1_HUMAN	metastasis suppressor 1						actin cytoskeleton organization (GO:0030036)|actin filament polymerization (GO:0030041)|adherens junction maintenance (GO:0034334)|bone mineralization (GO:0030282)|cell adhesion (GO:0007155)|cellular component movement (GO:0006928)|cellular response to fluid shear stress (GO:0071498)|epithelial cell proliferation involved in renal tubule morphogenesis (GO:2001013)|filopodium assembly (GO:0046847)|glomerulus morphogenesis (GO:0072102)|in utero embryonic development (GO:0001701)|magnesium ion homeostasis (GO:0010960)|microspike assembly (GO:0030035)|negative regulation of epithelial cell proliferation (GO:0050680)|nephron tubule epithelial cell differentiation (GO:0072160)|positive regulation of actin filament bundle assembly (GO:0032233)|renal tubule morphogenesis (GO:0061333)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|ruffle (GO:0001726)	actin monomer binding (GO:0003785)|identical protein binding (GO:0042802)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	37	Ovarian(258;0.00438)|all_neural(195;0.00459)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			CAAGAGCATCACCCTGGTGGC	0.647																																					.	Esophageal Squamous(160;622 1893 3862 8546 12509)	.											.	MTSS1-91	0			c.1404+2T>G						.						74.0	63.0	67.0					8																	125568471		2203	4300	6503	SO:0001630	splice_region_variant	9788	exon13			AGCATCACCCTGG	AF086645	CCDS6353.1, CCDS64968.1, CCDS64969.1	8p22	2008-02-05			ENSG00000170873	ENSG00000170873			20443	protein-coding gene	gene with protein product		608486				12482861, 12082544	Standard	XM_005251111		Approved	KIAA0429, MIMA, MIMB, MIM	uc003yrk.2	O43312	OTTHUMG00000048189	ENST00000518547.1:c.1404+1T>G	8.37:g.125568471A>C		Somatic	106	6		WXS	Illumina GAIIx	Phase_I	100	11	NM_014751	0	0	0	0	0	J3KNK6|Q8TCA2|Q96RX2	Splice_Site	SNP	ENST00000518547.1	37	CCDS6353.1	.	.	.	.	.	.	.	.	.	.	A	16.89	3.248298	0.59103	.	.	ENSG00000170873	ENST00000378017;ENST00000518547;ENST00000354184;ENST00000519168;ENST00000395508;ENST00000325064;ENST00000431961;ENST00000524090;ENST00000523179	.	.	.	4.65	4.65	0.58169	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.0885	0.64975	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MTSS1	125637652	1.000000	0.71417	0.965000	0.40720	0.918000	0.54935	7.603000	0.82811	1.733000	0.51620	0.374000	0.22700	.	.		0.647	MTSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109625.3	NM_014751	Intron
MROH5	389690	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	142506432	142506432	+	RNA	SNP	C	C	T			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr8:142506432C>T	ENST00000430863.1	-	0	330					NM_207414.2	NP_997297.2	Q6ZUA9	MROH5_HUMAN	maestro heat-like repeat family member 5																		GCACTGTAGGCTTCCCCCATG	0.632																																					.		.											.	.	0			.						.						88.0	89.0	88.0					8																	142506432		2158	4241	6399			389690	.			TGTAGGCTTCCCC			8q24.3	2012-12-20			ENSG00000226807	ENSG00000226807		"""maestro heat-like repeat containing"""	42976	protein-coding gene	gene with protein product							Standard	NM_207414		Approved	FLJ43860	uc003ywi.2	Q6ZUA9	OTTHUMG00000155944		8.37:g.142506432C>T		Somatic	144	0		WXS	Illumina GAIIx	Phase_I	167	47	.	0	0	0	0	0		RNA	SNP	ENST00000430863.1	37		.	.	.	.	.	.	.	.	.	.	C	9.808	1.182389	0.21870	.	.	ENSG00000226807	ENST00000521161	.	.	.	4.37	4.37	0.52481	.	.	.	.	.	T	0.58032	0.2094	N	0.24115	0.695	.	.	.	D	0.89917	1.0	D	0.83275	0.996	T	0.68838	-0.5303	7	0.72032	D	0.01	.	12.2669	0.54683	0.0:1.0:0.0:0.0	.	84	Q6ZUA9	.	T	49	.	ENSP00000431031:A84T	A	-	1	0	AC100803.1	142575614	0.895000	0.30542	0.949000	0.38748	0.015000	0.08874	0.630000	0.24553	2.252000	0.74401	0.561000	0.74099	GCC	.		0.632	MROH5-001	KNOWN	non_canonical_polymorphism|basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000342412.4	NM_207414	
RHPN1	114822	broad.mit.edu	37	8	144459625	144459625	+	Splice_Site	SNP	G	G	T			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr8:144459625G>T	ENST00000289013.6	+	4	482	c.381G>T	c.(379-381)aaG>aaT	p.K127N		NM_052924.2	NP_443156.2	Q8TCX5	RHPN1_HUMAN	rhophilin, Rho GTPase binding protein 1	127	BRO1. {ECO:0000255|PROSITE- ProRule:PRU00526}.				signal transduction (GO:0007165)		small GTPase regulator activity (GO:0005083)			endometrium(1)|large_intestine(1)|lung(7)	9	all_cancers(97;7.39e-11)|all_epithelial(106;5.44e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.156)			CACCGCTGAAGGTAGGTACTG	0.582																																					p.K127N		.											.	RHPN1-67	0			c.G381T						.						77.0	80.0	79.0					8																	144459625		2008	4176	6184	SO:0001630	splice_region_variant	114822	exon4			GCTGAAGGTAGGT	AB067516	CCDS47927.1	8q24.3	2003-02-06			ENSG00000158106	ENSG00000158106			19973	protein-coding gene	gene with protein product		601031				11572484	Standard	NM_052924		Approved	KIAA1929, RHPN, ODF5	uc003yyb.3	Q8TCX5	OTTHUMG00000165006	ENST00000289013.6:c.381+1G>T	8.37:g.144459625G>T		Somatic	103	0		WXS	Illumina GAIIx	Phase_I	95	4	NM_052924	0	0	0	0	0	Q8TAV1|Q96PV9	Missense_Mutation	SNP	ENST00000289013.6	37	CCDS47927.1	.	.	.	.	.	.	.	.	.	.	G	15.63	2.889891	0.52014	.	.	ENSG00000158106	ENST00000289013	T	0.18810	2.19	4.22	4.22	0.49857	.	0.316966	0.34386	N	0.004010	T	0.26231	0.0640	M	0.62016	1.91	0.58432	D	0.999994	P	0.43352	0.804	P	0.44897	0.463	T	0.03750	-1.1007	10	0.87932	D	0	-29.9128	9.0868	0.36586	0.1047:0.0:0.8953:0.0	.	127	Q8TCX5-2	.	N	127	ENSP00000289013:K127N	ENSP00000289013:K127N	K	+	3	2	RHPN1	144530768	1.000000	0.71417	0.990000	0.47175	0.229000	0.25112	5.352000	0.66028	1.882000	0.54519	0.313000	0.20887	AAG	.		0.582	RHPN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381417.1		Missense_Mutation
PLEC	5339	hgsc.bcm.edu	37	8	144990528	144990528	+	Silent	SNP	A	A	G	rs7014582	byFrequency	TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr8:144990528A>G	ENST00000322810.4	-	32	14041	c.13872T>C	c.(13870-13872)gcT>gcC	p.A4624A	PLEC_ENST00000354958.2_Silent_p.A4465A|PLEC_ENST00000356346.3_Silent_p.A4473A|PLEC_ENST00000354589.3_Silent_p.A4487A|PLEC_ENST00000527096.1_Silent_p.A4510A|PLEC_ENST00000345136.3_Silent_p.A4487A|PLEC_ENST00000357649.2_Silent_p.A4491A|PLEC_ENST00000436759.2_Silent_p.A4514A|PLEC_ENST00000398774.2_Silent_p.A4455A	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	4624	Globular 2.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						TGCGGGAGCCAGCGGTAGAGC	0.716													G|||	2389	0.477037	0.8979	0.3746	5008	,	,		8857	0.1508		0.4404	False		,,,				2504	0.3548				p.A4624A		.											.	PLEC-141	0			c.T13872C						.	G	,,,,,,,	2833,621		1197,439,91	12.0	16.0	15.0		13542,13419,13395,13872,13365,13461,13473,13461	-8.1	0.0	8	dbSNP_116	15	3324,4610		785,1754,1428	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	,,,,,,,	1982,2193,1519	GG,GA,AA		41.8956,17.9792,45.9343	,,,,,,,	4514/4575,4473/4534,4465/4526,4624/4685,4455/4516,4487/4548,4491/4552,4487/4548	144990528	6157,5231	1727	3967	5694	SO:0001819	synonymous_variant	5339	exon32			GGAGCCAGCGGTA	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.13872T>C	8.37:g.144990528A>G		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	10	5	NM_201380	0	0	0	0	0	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																			A|0.536;G|0.464		0.716	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
MPDZ	8777	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	13192144	13192144	+	Nonsense_Mutation	SNP	C	C	A			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr9:13192144C>A	ENST00000319217.7	-	15	2201	c.1954G>T	c.(1954-1956)Gag>Tag	p.E652*	MPDZ_ENST00000447879.1_Nonsense_Mutation_p.E652*|MPDZ_ENST00000381022.2_Nonsense_Mutation_p.E652*|MPDZ_ENST00000541718.1_Nonsense_Mutation_p.E652*|MPDZ_ENST00000536827.1_Nonsense_Mutation_p.E652*|MPDZ_ENST00000381015.4_Nonsense_Mutation_p.E652*|MPDZ_ENST00000546205.1_Nonsense_Mutation_p.E652*	NM_001261406.1	NP_001248335.1	O75970	MPDZ_HUMAN	multiple PDZ domain protein	652					cell adhesion (GO:0007155)|myelination (GO:0042552)|viral process (GO:0016032)	apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|neuron projection (GO:0043005)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	protein C-terminus binding (GO:0008022)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(15)|ovary(5)|prostate(7)|stomach(1)|urinary_tract(2)	61				GBM - Glioblastoma multiforme(50;2.03e-06)		TCTGTTAGCTCAATATCACAT	0.378																																					p.E652X		.											.	MPDZ-231	0			c.G1954T						.						120.0	112.0	114.0					9																	13192144		1913	4136	6049	SO:0001587	stop_gained	8777	exon15			TTAGCTCAATATC	AF093419	CCDS47951.1, CCDS59119.1, CCDS59120.1	9p23	2008-05-15			ENSG00000107186	ENSG00000107186			7208	protein-coding gene	gene with protein product		603785					Standard	NM_003829		Approved	MUPP1	uc003zlb.4	O75970	OTTHUMG00000021031	ENST00000319217.7:c.1954G>T	9.37:g.13192144C>A	ENSP00000320006:p.Glu652*	Somatic	72	0		WXS	Illumina GAIIx	Phase_I	110	21	NM_003829	0	0	0	0	0	A6NLC2|B2RTS3|B7ZMI4|O43798|Q4LE30|Q5CZ80|Q5JTX3|Q5JTX6|Q5JTX7|Q5JUC3|Q5JUC4|Q5VZ62|Q8N790	Nonsense_Mutation	SNP	ENST00000319217.7	37		.	.	.	.	.	.	.	.	.	.	C	41	8.874584	0.98986	.	.	ENSG00000107186	ENST00000319217;ENST00000541718;ENST00000381022;ENST00000536827;ENST00000447879;ENST00000381015;ENST00000546205	.	.	.	5.77	4.85	0.62838	.	0.312973	0.22962	N	0.053540	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.23891	T	0.37	.	12.3233	0.54997	0.0:0.6949:0.3051:0.0	.	.	.	.	X	652	.	ENSP00000320006:E652X	E	-	1	0	MPDZ	13182144	1.000000	0.71417	0.998000	0.56505	0.832000	0.47134	2.625000	0.46452	2.723000	0.93209	0.655000	0.94253	GAG	.		0.378	MPDZ-001	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000055485.2	NM_003829	
SH3GL2	6456	broad.mit.edu;bcgsc.ca	37	9	17795615	17795615	+	Silent	SNP	T	T	C			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr9:17795615T>C	ENST00000380607.4	+	9	1053	c.933T>C	c.(931-933)ttT>ttC	p.F311F	SH3GL2_ENST00000537391.1_Silent_p.F264F	NM_003026.2	NP_003017.1	Q99962	SH3G2_HUMAN	SH3-domain GRB2-like 2	311	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|central nervous system development (GO:0007417)|epidermal growth factor receptor signaling pathway (GO:0007173)|membrane organization (GO:0061024)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of receptor internalization (GO:0002090)|signal transduction (GO:0007165)|synaptic vesicle endocytosis (GO:0048488)	clathrin-coated endocytic vesicle membrane (GO:0030669)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)			NS(1)|breast(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(11)|skin(3)|upper_aerodigestive_tract(1)	26				GBM - Glioblastoma multiforme(50;2.71e-10)|Lung(42;0.203)		AGTTGGGATTTAAAGAGGGCG	0.483																																					p.F311F		.											.	SH3GL2-91	0			c.T933C						.						120.0	110.0	114.0					9																	17795615		2203	4300	6503	SO:0001819	synonymous_variant	6456	exon9			GGGATTTAAAGAG	X99657	CCDS6483.1	9p22	2008-02-05			ENSG00000107295	ENSG00000107295			10831	protein-coding gene	gene with protein product		604465				9169142	Standard	XM_005251549		Approved	SH3P4, SH3D2A, CNSA2, EEN-B1	uc003zna.3	Q99962	OTTHUMG00000019601	ENST00000380607.4:c.933T>C	9.37:g.17795615T>C		Somatic	227	0		WXS	Illumina GAIIx	Phase_I	309	12	NM_003026	0	0	0	0	0	B2R618|Q9NQK5	Silent	SNP	ENST00000380607.4	37	CCDS6483.1																																																																																			.		0.483	SH3GL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051796.1	NM_003026	
IFNA8	3445	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	21409580	21409580	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr9:21409580G>A	ENST00000380205.1	+	1	435	c.405G>A	c.(403-405)atG>atA	p.M135I		NM_002170.3	NP_002161.2	P32881	IFNA8_HUMAN	interferon, alpha 8	135					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|cytokine receptor binding (GO:0005126)|type I interferon receptor binding (GO:0005132)			endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)	9				Lung(24;7.66e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.0174)		CTCCCCTGATGTACGAGGACT	0.483																																					p.M135I		.											.	IFNA8-90	0			c.G405A						.						162.0	159.0	160.0					9																	21409580		2203	4300	6503	SO:0001583	missense	3445	exon1			CCTGATGTACGAG		CCDS6507.1	9p22	2010-08-24			ENSG00000120242	ENSG00000120242		"""Interferons"""	5429	protein-coding gene	gene with protein product	"""interferon alpha-B''"", ""interferon alpha type 201"""	147568				1385305	Standard	NM_002170		Approved	IFN-alphaB	uc003zpc.1	P32881	OTTHUMG00000019677	ENST00000380205.1:c.405G>A	9.37:g.21409580G>A	ENSP00000369553:p.Met135Ile	Somatic	110	0		WXS	Illumina GAIIx	Phase_I	215	47	NM_002170	0	0	0	0	0	P01565|P09236|Q5VWV7|Q5VYQ3	Missense_Mutation	SNP	ENST00000380205.1	37	CCDS6507.1	.	.	.	.	.	.	.	.	.	.	G	7.394	0.631401	0.14322	.	.	ENSG00000120242	ENST00000380205	T	0.05258	3.47	3.33	-2.55	0.06288	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.935009	0.08898	N	0.877648	T	0.08582	0.0213	M	0.77820	2.39	0.09310	N	1	B	0.02656	0.0	B	0.12156	0.007	T	0.38929	-0.9638	10	0.29301	T	0.29	.	6.3681	0.21465	0.1845:0.4747:0.3408:0.0	.	135	P32881	IFNA8_HUMAN	I	135	ENSP00000369553:M135I	ENSP00000369553:M135I	M	+	3	0	IFNA8	21399580	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.166000	0.09954	-0.460000	0.07003	0.491000	0.48974	ATG	.		0.483	IFNA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051906.1	NM_002170	
PRSS3	5646	broad.mit.edu	37	9	33794840	33794840	+	Intron	SNP	G	G	A	rs10117993	byFrequency	TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr9:33794840G>A	ENST00000361005.5	+	2	211				RP11-133O22.6_ENST00000454429.2_RNA|PRSS3_ENST00000379405.3_5'Flank|PRSS3_ENST00000429677.3_Intron|PRSS3_ENST00000342836.4_Silent_p.A17A	NM_007343.3	NP_031369	P35030	TRY3_HUMAN	protease, serine, 3						cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|endothelial cell migration (GO:0043542)|innate immune response (GO:0045087)|proteolysis (GO:0006508)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|zymogen activation (GO:0031638)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	13			LUSC - Lung squamous cell carcinoma(29;0.0176)			GGAGGAGTGCGCCATTGGTTT	0.498													G|||	318	0.0634984	0.2337	0.013	5008	,	,		20986	0.0		0.0	False		,,,				2504	0.0				p.A17A		.											.	PRSS3-90	0			c.G51A						.																																			SO:0001627	intron_variant	5646	exon2			GAGTGCGCCATTG		CCDS6545.1, CCDS47958.1, CCDS56570.1, CCDS56571.1	9p13	2010-05-07	2008-03-11		ENSG00000010438	ENSG00000010438	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9486	protein-coding gene	gene with protein product	"""mesotrypsin"""	613578	"""protease, serine, 4 (trypsin 4, brain)"", ""protease, serine, 3 (mesotrypsin)"""	PRSS4		2326201, 8294000	Standard	NM_002771		Approved	TRY3, TRY4	uc003ztj.4	P35030	OTTHUMG00000019798	ENST00000361005.5:c.212-1801G>A	9.37:g.33794840G>A		Somatic	138	2		WXS	Illumina GAIIx	Phase_I	184	7	NM_001197097	0	0	0	0	0	A8CED1|A8CED3|A9Z1Y4|E7ES07|F8W7P3|P15951|Q15665|Q5VXV0|Q6ISJ4|Q9UQV3	Silent	SNP	ENST00000361005.5	37	CCDS47958.1																																																																																			G|0.995;A|0.005		0.498	PRSS3-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052121.1	NM_002771	
FAM205A	259308	broad.mit.edu	37	9	34725742	34725742	+	Missense_Mutation	SNP	T	T	C	rs62547039	byFrequency	TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr9:34725742T>C	ENST00000378788.3	-	4	1534	c.1495A>G	c.(1495-1497)Atg>Gtg	p.M499V		NM_001141917.1	NP_001135389.1	Q6ZU69	F205A_HUMAN	family with sequence similarity 205, member A	499				M -> V (in Ref. 1; BAC86357). {ECO:0000305}.		integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(1)	4						GATGGAGACATCCAGTTTGGG	0.522													C|||	3282	0.655351	0.5522	0.6023	5008	,	,		17881	0.6994		0.66	False		,,,				2504	0.7822				p.M499V		.											.	.	0			c.A1495G						.						11.0	10.0	10.0					9																	34725742		692	1588	2280	SO:0001583	missense	259308	exon4			GAGACATCCAGTT		CCDS55305.1	9p13.3	2014-05-16			ENSG00000205108	ENSG00000205108			41911	protein-coding gene	gene with protein product							Standard	NM_001141917		Approved	C9orf144B	uc011lor.2	Q6ZU69	OTTHUMG00000000448	ENST00000378788.3:c.1495A>G	9.37:g.34725742T>C	ENSP00000417711:p.Met499Val	Somatic	71	1		WXS	Illumina GAIIx	Phase_I	105	4	NM_001141917	0	0	0	0	0	A8MVW7	Missense_Mutation	SNP	ENST00000378788.3	37	CCDS55305.1	.	.	.	.	.	.	.	.	.	.	C	0.013	-1.645525	0.00792	.	.	ENSG00000205108	ENST00000378788	T	0.05580	3.42	3.8	-1.25	0.09405	.	.	.	.	.	T	0.01730	0.0055	N	0.01576	-0.805	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.46569	-0.9182	8	0.08179	T	0.78	.	4.0301	0.09705	0.1751:0.2904:0.0:0.5345	rs62547039	499	Q6ZU69	F205A_HUMAN	V	499	ENSP00000417711:M499V	ENSP00000417711:M499V	M	-	1	0	RP11-195F19.10	34715742	0.000000	0.05858	0.000000	0.03702	0.208000	0.24298	-0.459000	0.06728	-0.758000	0.04690	-0.215000	0.12644	ATG	T|0.296;C|0.704		0.522	FAM205A-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001150.2	NM_001141917	
PIGO	84720	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	35092629	35092629	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr9:35092629C>T	ENST00000378617.3	-	7	1649	c.1255G>A	c.(1255-1257)Gcg>Acg	p.A419T	PIGO_ENST00000298004.5_Missense_Mutation_p.A419T|PIGO_ENST00000341666.3_Missense_Mutation_p.A419T|PIGO_ENST00000492770.1_5'Flank|PIGO_ENST00000361778.2_Missense_Mutation_p.A419T	NM_032634.3	NP_116023.2	Q8TEQ8	PIGO_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class O	419					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity (GO:0016740)			endometrium(3)|kidney(2)|large_intestine(8)|lung(13)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)	38			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			GGCAGTGTCGCCTCAGCCCCC	0.597																																					p.A419T		.											.	PIGO-290	0			c.G1255A						.						55.0	60.0	58.0					9																	35092629		2190	4285	6475	SO:0001583	missense	84720	exon8			GTGTCGCCTCAGC	AB083625	CCDS6575.1, CCDS6576.1	9p13.2	2013-02-26	2006-06-28		ENSG00000165282	ENSG00000165282		"""Phosphatidylinositol glycan anchor biosynthesis"""	23215	protein-coding gene	gene with protein product		614730	"""phosphatidylinositol glycan, class O"""			10781593	Standard	NM_032634		Approved	DKFZp434M222, FLJ00135	uc003zwd.3	Q8TEQ8	OTTHUMG00000019854	ENST00000378617.3:c.1255G>A	9.37:g.35092629C>T	ENSP00000367880:p.Ala419Thr	Somatic	88	0		WXS	Illumina GAIIx	Phase_I	81	21	NM_001201484	0	0	0	0	0	B1AML3|Q6P154|Q6UX80|Q8TDS8|Q96CS9|Q9BVN9|Q9Y4B0	Missense_Mutation	SNP	ENST00000378617.3	37	CCDS6575.1	.	.	.	.	.	.	.	.	.	.	C	0.464	-0.887886	0.02511	.	.	ENSG00000165282	ENST00000298004;ENST00000378617;ENST00000341666;ENST00000361778	T;T;T;T	0.56611	0.51;0.45;0.45;0.51	5.38	4.49	0.54785	.	0.613824	0.18174	N	0.149342	T	0.41743	0.1172	L	0.55743	1.74	0.09310	N	1	B;B	0.11235	0.001;0.004	B;B	0.08055	0.002;0.003	T	0.26538	-1.0100	10	0.14252	T	0.57	-22.6414	6.3464	0.21351	0.1493:0.6955:0.0:0.1552	.	419;419	Q8TEQ8-2;Q8TEQ8	.;PIGO_HUMAN	T	419	ENSP00000298004:A419T;ENSP00000367880:A419T;ENSP00000339382:A419T;ENSP00000354678:A419T	ENSP00000298004:A419T	A	-	1	0	PIGO	35082629	0.168000	0.22989	0.625000	0.29200	0.212000	0.24457	0.154000	0.16343	1.516000	0.48900	0.655000	0.94253	GCG	.		0.597	PIGO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052284.1	NM_032634	
PCSK5	5125	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	78910311	78910311	+	Silent	SNP	G	G	A			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr9:78910311G>A	ENST00000545128.1	+	26	3844	c.3306G>A	c.(3304-3306)gaG>gaA	p.E1102E		NM_001190482.1	NP_001177411.1	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5	1102	CRM (Cys-rich motif).				anterior/posterior pattern specification (GO:0009952)|cell-cell signaling (GO:0007267)|cytokine biosynthetic process (GO:0042089)|embryo implantation (GO:0007566)|embryonic digestive tract development (GO:0048566)|embryonic skeletal system development (GO:0048706)|heart development (GO:0007507)|kidney development (GO:0001822)|limb morphogenesis (GO:0035108)|nerve growth factor processing (GO:0032455)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|renin secretion into blood stream (GO:0002001)|respiratory tube development (GO:0030323)|signal peptide processing (GO:0006465)|viral life cycle (GO:0019058)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|secretory granule (GO:0030141)	peptidase activity (GO:0008233)|peptide binding (GO:0042277)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(7)|liver(2)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55						GGTGTGAAGAGGGCTTCTTTC	0.507																																					p.E1102E		.											.	PCSK5-93	0			c.G3306A						.						53.0	47.0	49.0					9																	78910311		876	1991	2867	SO:0001819	synonymous_variant	5125	exon26			TGAAGAGGGCTTC		CCDS6652.1, CCDS55320.1	9q21.13	2013-09-24			ENSG00000099139	ENSG00000099139			8747	protein-coding gene	gene with protein product		600488				7782070	Standard	NM_001190482		Approved	PC5, PC6, SPC6	uc004akc.2	Q92824	OTTHUMG00000020039	ENST00000545128.1:c.3306G>A	9.37:g.78910311G>A		Somatic	267	0		WXS	Illumina GAIIx	Phase_I	266	82	NM_001190482	0	0	0	0	0	F5H2G7|Q13527|Q96EP4	Silent	SNP	ENST00000545128.1	37	CCDS55320.1																																																																																			.		0.507	PCSK5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
SHC3	53358	hgsc.bcm.edu	37	9	91793225	91793225	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr9:91793225C>T	ENST00000375835.4	-	1	457	c.151G>A	c.(151-153)Gag>Aag	p.E51K	SHC3_ENST00000375830.1_5'UTR	NM_016848.5	NP_058544.3	Q92529	SHC3_HUMAN	SHC (Src homology 2 domain containing) transforming protein 3	51					central nervous system development (GO:0007417)|epidermal growth factor receptor signaling pathway (GO:0007173)|insulin receptor signaling pathway (GO:0008286)|learning or memory (GO:0007611)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Ras protein signal transduction (GO:0007265)|synaptic transmission, glutamatergic (GO:0035249)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)	signal transducer activity (GO:0004871)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|skin(3)	28						CGCAGCGCCTCGCCGGACACC	0.726																																					p.E51K		.											.	SHC3-415	0			c.G151A						.						4.0	6.0	5.0					9																	91793225		1791	3751	5542	SO:0001583	missense	53358	exon1			GCGCCTCGCCGGA	D84361	CCDS6681.1	9q22.1	2013-02-14	2005-05-24		ENSG00000148082	ENSG00000148082		"""SH2 domain containing"""	18181	protein-coding gene	gene with protein product		605263	"""src homology 2 domain containing transforming protein C3"""			8808684	Standard	NM_016848		Approved	N-Shc, NSHC, SHCC	uc004aqf.2	Q92529	OTTHUMG00000020179	ENST00000375835.4:c.151G>A	9.37:g.91793225C>T	ENSP00000364995:p.Glu51Lys	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	19	14	NM_016848	0	0	0	0	0	Q5T7I7|Q8TAP2|Q9UCX5	Missense_Mutation	SNP	ENST00000375835.4	37	CCDS6681.1	.	.	.	.	.	.	.	.	.	.	C	5.586	0.292896	0.10567	.	.	ENSG00000148082	ENST00000375835	T	0.28666	1.6	2.85	-0.275	0.12906	.	0.893878	0.09388	U	0.809007	T	0.18173	0.0436	N	0.22421	0.69	0.32475	N	0.542304	B	0.17852	0.024	B	0.04013	0.001	T	0.25537	-1.0129	10	0.38643	T	0.18	.	6.2794	0.20999	0.0:0.6501:0.155:0.1949	.	51	Q92529	SHC3_HUMAN	K	51	ENSP00000364995:E51K	ENSP00000364995:E51K	E	-	1	0	SHC3	90983045	0.988000	0.35896	0.236000	0.24074	0.072000	0.16883	0.942000	0.29017	0.060000	0.16281	-0.529000	0.04317	GAG	.		0.726	SHC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052986.1	NM_016848	
OR1K1	392392	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	125562456	125562458	+	In_Frame_Del	DEL	ACA	ACA	-	rs201520967		TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	ACA	ACA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr9:125562456_125562458delACA	ENST00000277309.2	+	1	87_89	c.55_57delACA	c.(55-57)acadel	p.T20del		NM_080859.1	NP_543135.1	Q8NGR3	OR1K1_HUMAN	olfactory receptor, family 1, subfamily K, member 1	20						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(8)|lung(2)|ovary(1)|skin(4)|stomach(1)	17						ATTGGGACTGACAACAAGTCCTG	0.527																																					p.19_19del		.											.	OR1K1-69	0			c.55_57del						.																																			SO:0001651	inframe_deletion	392392	exon1			GGACTGACAACAA	AL359512	CCDS35132.1	9q33	2013-09-20			ENSG00000165204	ENSG00000165204		"""GPCR / Class A : Olfactory receptors"""	8212	protein-coding gene	gene with protein product							Standard	NM_080859		Approved	hg99, MNAB	uc011lze.2	Q8NGR3	OTTHUMG00000020625	ENST00000277309.2:c.55_57delACA	9.37:g.125562459_125562461delACA	ENSP00000277309:p.Thr20del	Somatic	125	0		WXS	Illumina GAIIx	Phase_I	196	42	NM_080859	0	0	0	0	0	B9EH41|Q4VXB7|Q96R23	In_Frame_Del	DEL	ENST00000277309.2	37	CCDS35132.1																																																																																			.		0.527	OR1K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053958.1		
PRDM12	59335	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	9	133556750	133556750	+	Silent	SNP	G	G	A			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr9:133556750G>A	ENST00000253008.2	+	5	858	c.798G>A	c.(796-798)acG>acA	p.T266T		NM_021619.2	NP_067632.2	Q9H4Q4	PRD12_HUMAN	PR domain containing 12	266					neurogenesis (GO:0022008)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			kidney(2)|large_intestine(3)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	11		all_hematologic(13;0.0433)|Acute lymphoblastic leukemia(5;0.0534)		OV - Ovarian serous cystadenocarcinoma(145;0.000344)		GCATCCACACGCTGGACAAGC	0.697																																					p.T266T		.											.	PRDM12-90	0			c.G798A						.						11.0	13.0	12.0					9																	133556750		2191	4273	6464	SO:0001819	synonymous_variant	59335	exon5			CCACACGCTGGAC	AY004252	CCDS6934.1	9q33-q34	2013-01-08			ENSG00000130711	ENSG00000130711		"""Zinc fingers, C2H2-type"""	13997	protein-coding gene	gene with protein product	"""PR-domain containing protein 12"", ""PR-domain zinc finger protein 12"""					14523459	Standard	NM_021619		Approved		uc004bzt.1	Q9H4Q4	OTTHUMG00000020808	ENST00000253008.2:c.798G>A	9.37:g.133556750G>A		Somatic	27	0		WXS	Illumina GAIIx	Phase_I	122	27	NM_021619	0	0	0	0	0	A3KFK9	Silent	SNP	ENST00000253008.2	37	CCDS6934.1																																																																																			.		0.697	PRDM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054664.1	NM_021619	
SLC2A6	11182	broad.mit.edu;bcgsc.ca	37	9	136337148	136337148	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr9:136337148G>A	ENST00000371899.4	-	10	1596	c.1519C>T	c.(1519-1521)Cgc>Tgc	p.R507C	SLC2A6_ENST00000485978.1_5'UTR|SLC2A6_ENST00000371897.4_Missense_Mutation_p.R445C	NM_017585.3	NP_060055.2	Q9UGQ3	GTR6_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 6	507					glucose transport (GO:0015758)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glucose transmembrane transporter activity (GO:0005355)			cervix(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(3)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(145;8.47e-08)|Epithelial(140;9.37e-07)|all cancers(34;1.03e-05)		TTGACCTAGCGCAAGAAGGAC	0.632																																					p.R507C		.											.	SLC2A6-90	0			c.C1519T						.						87.0	72.0	77.0					9																	136337148		2203	4300	6503	SO:0001583	missense	11182	exon10			CCTAGCGCAAGAA	AJ011372	CCDS6975.1, CCDS48052.1	9q34	2013-05-22			ENSG00000160326	ENSG00000160326		"""Solute carriers"""	11011	protein-coding gene	gene with protein product		606813				10970791	Standard	NM_001145099		Approved	GLUT9, GLUT6, HSA011372	uc004cee.3	Q9UGQ3	OTTHUMG00000020874	ENST00000371899.4:c.1519C>T	9.37:g.136337148G>A	ENSP00000360966:p.Arg507Cys	Somatic	65	0		WXS	Illumina GAIIx	Phase_I	135	6	NM_017585	0	0	0	0	0	A6NNU6|Q5SXD7|Q8NCC2	Missense_Mutation	SNP	ENST00000371899.4	37	CCDS6975.1	.	.	.	.	.	.	.	.	.	.	G	11.96	1.795090	0.31777	.	.	ENSG00000160326	ENST00000371897;ENST00000371899	D;D	0.82893	-1.56;-1.66	4.78	3.81	0.43845	.	1.447100	0.04402	N	0.364393	T	0.74869	0.3773	N	0.08118	0	0.21386	N	0.999704	D;P	0.54772	0.968;0.946	P;B	0.47015	0.534;0.333	T	0.68322	-0.5439	10	0.87932	D	0	.	9.714	0.40263	0.0:0.0:0.7213:0.2787	.	445;507	Q9UGQ3-2;Q9UGQ3	.;GTR6_HUMAN	C	445;507	ENSP00000360964:R445C;ENSP00000360966:R507C	ENSP00000360964:R445C	R	-	1	0	SLC2A6	135326969	0.988000	0.35896	0.410000	0.26471	0.307000	0.27823	2.689000	0.46993	2.514000	0.84764	0.650000	0.86243	CGC	.		0.632	SLC2A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054909.1	NM_017585	
PAEP	5047	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	138453660	138453660	+	Silent	SNP	C	C	T			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr9:138453660C>T	ENST00000479141.1	+	1	57	c.13C>T	c.(13-15)Ctg>Ttg	p.L5L	PAEP_ENST00000371766.2_Silent_p.L5L|PAEP_ENST00000277508.5_Silent_p.L5L	NM_002571.2	NP_002562.2	P09466	PAEP_HUMAN	progestagen-associated endometrial protein	5					multicellular organismal development (GO:0007275)|transport (GO:0006810)	extracellular region (GO:0005576)	small molecule binding (GO:0036094)			cervix(1)|endometrium(1)|lung(1)|prostate(1)|skin(1)|stomach(1)	6				OV - Ovarian serous cystadenocarcinoma(145;3.39e-07)|Epithelial(140;1.11e-06)|all cancers(34;2.04e-05)		GCTGTGCCTCCTGCTCACCCT	0.657																																					p.L5L		.											.	PAEP-68	0			c.C13T						.						17.0	16.0	16.0					9																	138453660		2189	4258	6447	SO:0001819	synonymous_variant	5047	exon1			TGCCTCCTGCTCA		CCDS35173.1	9q34	2011-11-15	2008-07-31		ENSG00000122133	ENSG00000122133		"""Lipocalins"""	8573	protein-coding gene	gene with protein product	"""glycodelin-A"", ""glycodelin-S"", ""glycodelin-F"", ""progesterone-associated endometrial protein"", ""glycodelin"", ""PP14 protein (placental protein 14)"", ""pregnancy-associated endometrial alpha-2-globulin"", ""alpha uterine protein"""	173310				3320533, 2016092	Standard	XM_005263405		Approved	PEP, PP14, GdA, GdS, GdF, PAEG, GD, MGC138509, MGC142288	uc004cgd.1	P09466	OTTHUMG00000020914	ENST00000479141.1:c.13C>T	9.37:g.138453660C>T		Somatic	115	0		WXS	Illumina GAIIx	Phase_I	205	45	NM_002571	0	0	0	0	0	Q5T6T1|Q9UG92	Silent	SNP	ENST00000479141.1	37	CCDS35173.1																																																																																			.		0.657	PAEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055010.1	NM_001018049	
WWC3	55841	broad.mit.edu	37	X	10035510	10035510	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chrX:10035510A>G	ENST00000380861.4	+	3	591	c.200A>G	c.(199-201)gAc>gGc	p.D67G	WWC3_ENST00000454666.1_Missense_Mutation_p.D67G	NM_015691.3	NP_056506.2	Q9ULE0	WWC3_HUMAN	WWC family member 3	67					negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytosol (GO:0005829)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)			NS(1)|breast(3)|endometrium(10)|kidney(1)|large_intestine(11)|lung(17)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	52						TGTGAGGATGACAGCCGCTCG	0.488																																					p.D67G		.											.	WWC3-134	0			c.A200G						.						64.0	54.0	58.0					X																	10035510		2203	4300	6503	SO:0001583	missense	55841	exon3			AGGATGACAGCCG	AK091936	CCDS14136.1	Xp22.32	2008-02-05			ENSG00000047644	ENSG00000047644		"""WW, C2 and coiled-coil domain containing"""	29237	protein-coding gene	gene with protein product						10574462	Standard	NM_015691		Approved	KIAA1280, BM042	uc004csx.4	Q9ULE0	OTTHUMG00000021123	ENST00000380861.4:c.200A>G	X.37:g.10035510A>G	ENSP00000370242:p.Asp67Gly	Somatic	317	0		WXS	Illumina GAIIx	Phase_I	350	7	NM_015691	0	0	0	0	0	A8KA96|Q659C1|Q9BTQ1	Missense_Mutation	SNP	ENST00000380861.4	37	CCDS14136.1	.	.	.	.	.	.	.	.	.	.	A	22.8	4.334941	0.81801	.	.	ENSG00000047644	ENST00000380861;ENST00000454666;ENST00000398613	T;T	0.05081	3.5;3.5	5.31	5.31	0.75309	.	0.097116	0.64402	D	0.000001	T	0.10465	0.0256	M	0.63428	1.95	0.58432	D	0.999997	P	0.36789	0.57	B	0.39217	0.294	T	0.14035	-1.0487	10	0.25751	T	0.34	-27.4572	14.3611	0.66771	1.0:0.0:0.0:0.0	.	67	Q9ULE0	WWC3_HUMAN	G	67	ENSP00000370242:D67G;ENSP00000399584:D67G	ENSP00000370242:D67G	D	+	2	0	WWC3	9995510	1.000000	0.71417	0.973000	0.42090	0.972000	0.66771	7.269000	0.78482	1.770000	0.52166	0.412000	0.27726	GAC	.		0.488	WWC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055725.1	NM_015691	
MAP3K15	389840	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	19425347	19425347	+	Missense_Mutation	SNP	A	A	T			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chrX:19425347A>T	ENST00000338883.4	-	13	1802	c.1803T>A	c.(1801-1803)gaT>gaA	p.D601E	MAP3K15_ENST00000359173.3_Missense_Mutation_p.D36E|MAP3K15_ENST00000518578.1_5'UTR|MAP3K15_ENST00000469203.2_Missense_Mutation_p.D433E	NM_001001671.3	NP_001001671.3	Q6ZN16	M3K15_HUMAN	mitogen-activated protein kinase kinase kinase 15	601							ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)			NS(2)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(13)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	42	Hepatocellular(33;0.183)					TTTGAAAGTCATCAGAATTAT	0.338																																					p.D601E		.											.	MAP3K15-335	0			c.T1803A						.						113.0	96.0	102.0					X																	19425347		2203	4300	6503	SO:0001583	missense	389840	exon13			AAAGTCATCAGAA	AK131412		Xp22.12	2011-06-09			ENSG00000180815	ENSG00000180815		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	31689	protein-coding gene	gene with protein product		300820					Standard	NM_001001671		Approved	bA723P2.3, FLJ16518	uc022btq.1	Q6ZN16	OTTHUMG00000022724	ENST00000338883.4:c.1803T>A	X.37:g.19425347A>T	ENSP00000345629:p.Asp601Glu	Somatic	164	0		WXS	Illumina GAIIx	Phase_I	251	21	NM_001001671	0	0	0	0	0	A2AI49|A2AI50|A6NJ61|Q5JPR4|Q6ZMV3	Missense_Mutation	SNP	ENST00000338883.4	37		.	.	.	.	.	.	.	.	.	.	A	19.35	3.811221	0.70797	.	.	ENSG00000180815	ENST00000338883;ENST00000359173;ENST00000469203	T;T;T	0.73469	-0.74;-0.75;-0.7	4.6	4.6	0.57074	.	0.092857	0.64402	D	0.000001	T	0.74015	0.3661	M	0.69463	2.115	0.58432	D	0.999999	B;D	0.54207	0.421;0.965	B;P	0.44518	0.247;0.452	T	0.77744	-0.2473	10	0.54805	T	0.06	.	13.3862	0.60797	1.0:0.0:0.0:0.0	.	76;601	Q6ZN16-3;Q6ZN16	.;M3K15_HUMAN	E	601;36;433	ENSP00000345629:D601E;ENSP00000352093:D36E;ENSP00000428356:D433E	ENSP00000345629:D601E	D	-	3	2	MAP3K15	19335268	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.773000	0.55333	1.802000	0.52723	0.486000	0.48141	GAT	.		0.338	MAP3K15-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001001671	
PHEX	5251	broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	22117127	22117127	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chrX:22117127G>C	ENST00000379374.4	+	9	1502	c.937G>C	c.(937-939)Gac>Cac	p.D313H	PHEX_ENST00000418858.3_Missense_Mutation_p.D16H|PHEX_ENST00000475778.1_3'UTR|PHEX_ENST00000537599.1_Missense_Mutation_p.D313H|PHEX_ENST00000535894.1_Missense_Mutation_p.D216H	NM_000444.4	NP_000435.3	P78562	PHEX_HUMAN	phosphate regulating endopeptidase homolog, X-linked	313					bone mineralization (GO:0030282)|cell-cell signaling (GO:0007267)|cellular protein modification process (GO:0006464)|organophosphate metabolic process (GO:0019637)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|cervix(2)|endometrium(2)|large_intestine(12)|liver(1)|lung(19)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	42						CCCTCAGTTCGACTGGCTGGG	0.483																																					p.D313H		.											.	PHEX-132	0			c.G937C	GRCh37	CI001586	PHEX	I		.						133.0	115.0	121.0					X																	22117127		2203	4300	6503	SO:0001583	missense	5251	exon9			CAGTTCGACTGGC	U82970	CCDS14204.1	Xp22.2-p22.1	2008-07-31	2008-07-31		ENSG00000102174	ENSG00000102174			8918	protein-coding gene	gene with protein product		300550	"""phosphate regulating gene with homologies to endopeptidases on the X chromosome (hypophosphatemia, vitamin D resistant rickets)"""	HYP, HPDR		7550339, 9070861	Standard	NM_000444		Approved	PEX, HPDR1, HYP1, XLH	uc004dah.3	P78562	OTTHUMG00000021241	ENST00000379374.4:c.937G>C	X.37:g.22117127G>C	ENSP00000368682:p.Asp313His	Somatic	59	0		WXS	Illumina GAIIx	Phase_I	76	21	NM_000444	0	0	0	0	0	O00678|Q13646|Q2M325|Q93032|Q99827	Missense_Mutation	SNP	ENST00000379374.4	37	CCDS14204.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.119211	0.77323	.	.	ENSG00000102174	ENST00000379374;ENST00000537599;ENST00000535894;ENST00000418858	D;D;D;D	0.84873	-1.91;-1.91;-1.91;-1.91	5.46	5.46	0.80206	Peptidase M13 (1);	0.043010	0.85682	D	0.000000	D	0.92776	0.7703	M	0.81802	2.56	0.50632	D	0.999885	D;D	0.89917	1.0;1.0	D;D	0.79108	0.987;0.992	D	0.93658	0.6979	10	0.87932	D	0	.	18.3838	0.90459	0.0:0.0:1.0:0.0	.	313;313	F5GXU4;P78562	.;PHEX_HUMAN	H	313;313;216;16	ENSP00000368682:D313H;ENSP00000440362:D313H;ENSP00000439418:D216H;ENSP00000443531:D16H	ENSP00000368682:D313H	D	+	1	0	PHEX	22027048	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	5.567000	0.67378	2.282000	0.76494	0.529000	0.55759	GAC	.		0.483	PHEX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056035.1	NM_000444	
KLHL15	80311	broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	24006591	24006591	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chrX:24006591C>A	ENST00000328046.8	-	4	1517	c.1262G>T	c.(1261-1263)gGg>gTg	p.G421V		NM_030624.2	NP_085127.2	Q96M94	KLH15_HUMAN	kelch-like family member 15	421					protein ubiquitination (GO:0016567)					autonomic_ganglia(1)|breast(1)|endometrium(8)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)	22						GAGCACTGTCCCCTCATGTCC	0.428																																					p.G421V		.											.	KLHL15-131	0			c.G1262T						.						177.0	144.0	155.0					X																	24006591		2203	4300	6503	SO:0001583	missense	80311	exon4			ACTGTCCCCTCAT	AB051464	CCDS35217.1	Xp22.1-p21	2013-01-30	2013-01-30		ENSG00000174010	ENSG00000174010		"""Kelch-like"", ""BTB/POZ domain containing"""	29347	protein-coding gene	gene with protein product			"""kelch-like 15 (Drosophila)"""			11214970, 14702039	Standard	NM_030624		Approved	KIAA1677	uc004dba.4	Q96M94	OTTHUMG00000021261	ENST00000328046.8:c.1262G>T	X.37:g.24006591C>A	ENSP00000332791:p.Gly421Val	Somatic	228	1		WXS	Illumina GAIIx	Phase_I	272	72	NM_030624	0	0	0	0	0	Q32MN3|Q8NDA3|Q96BM6|Q9C0I6	Missense_Mutation	SNP	ENST00000328046.8	37	CCDS35217.1	.	.	.	.	.	.	.	.	.	.	C	13.52	2.261034	0.39995	.	.	ENSG00000174010	ENST00000328046	T	0.64085	-0.08	5.49	5.49	0.81192	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	T	0.48021	0.1477	N	0.21583	0.68	0.80722	D	1	P	0.44090	0.826	B	0.36567	0.228	T	0.46582	-0.9181	10	0.25751	T	0.34	.	18.6167	0.91305	0.0:1.0:0.0:0.0	.	421	Q96M94	KLH15_HUMAN	V	421	ENSP00000332791:G421V	ENSP00000332791:G421V	G	-	2	0	KLHL15	23916512	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	7.132000	0.77251	2.426000	0.82243	0.506000	0.49869	GGG	.		0.428	KLHL15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056078.1	XM_040383	
FAM47C	442444	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	37026574	37026574	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chrX:37026574G>A	ENST00000358047.3	+	1	143	c.91G>A	c.(91-93)Gcg>Acg	p.A31T		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	31										breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						CAAGTACTTCGCGAAGCGCAA	0.642																																					p.A31T		.											.	FAM47C-111	0			c.G91A						.						27.0	25.0	26.0					X																	37026574		2202	4299	6501	SO:0001583	missense	442444	exon1			TACTTCGCGAAGC	AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.91G>A	X.37:g.37026574G>A	ENSP00000367913:p.Ala31Thr	Somatic	368	0		WXS	Illumina GAIIx	Phase_I	423	28	NM_001013736	0	0	0	0	0	Q6ZU46	Missense_Mutation	SNP	ENST00000358047.3	37	CCDS35227.1	.	.	.	.	.	.	.	.	.	.	G	10.49	1.364786	0.24684	.	.	ENSG00000198173	ENST00000358047	T	0.20069	2.1	0.462	-0.871	0.10642	.	.	.	.	.	T	0.13372	0.0324	L	0.39898	1.24	0.09310	N	1	P	0.44241	0.829	B	0.39706	0.307	T	0.19745	-1.0296	8	0.23302	T	0.38	.	.	.	.	.	31	Q5HY64	FA47C_HUMAN	T	31	ENSP00000367913:A31T	ENSP00000367913:A31T	A	+	1	0	FAM47C	36936495	0.001000	0.12720	0.002000	0.10522	0.005000	0.04900	-0.328000	0.07945	-0.487000	0.06735	-0.888000	0.02935	GCG	.		0.642	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060508.1	NM_001013736	
FAM47C	442444	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	37028029	37028029	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chrX:37028029G>C	ENST00000358047.3	+	1	1598	c.1546G>C	c.(1546-1548)Gag>Cag	p.E516Q		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	516										breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						AGAGCCTTCTGAGACTGGAGT	0.607																																					p.E516Q		.											.	FAM47C-111	0			c.G1546C						.						84.0	82.0	83.0					X																	37028029		2202	4300	6502	SO:0001583	missense	442444	exon1			CCTTCTGAGACTG	AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.1546G>C	X.37:g.37028029G>C	ENSP00000367913:p.Glu516Gln	Somatic	83	0		WXS	Illumina GAIIx	Phase_I	80	29	NM_001013736	0	0	0	0	0	Q6ZU46	Missense_Mutation	SNP	ENST00000358047.3	37	CCDS35227.1	.	.	.	.	.	.	.	.	.	.	g	11.59	1.684134	0.29872	.	.	ENSG00000198173	ENST00000358047	T	0.15487	2.42	0.993	-1.84	0.07809	.	.	.	.	.	T	0.23330	0.0564	M	0.77313	2.365	0.09310	N	1	P	0.50710	0.938	P	0.52554	0.702	T	0.20472	-1.0274	9	0.15066	T	0.55	.	3.482	0.07606	0.22:0.2607:0.5193:0.0	.	516	Q5HY64	FA47C_HUMAN	Q	516	ENSP00000367913:E516Q	ENSP00000367913:E516Q	E	+	1	0	FAM47C	36937950	0.001000	0.12720	0.000000	0.03702	0.004000	0.04260	-0.171000	0.09883	-0.770000	0.04614	0.413000	0.27773	GAG	.		0.607	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060508.1	NM_001013736	
GPR82	27197	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	41586498	41586498	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chrX:41586498C>G	ENST00000302548.4	+	3	459	c.219C>G	c.(217-219)atC>atG	p.I73M	CASK_ENST00000378154.1_Intron|CASK_ENST00000318588.9_Intron|CASK_ENST00000361962.4_Intron|CASK_ENST00000442742.2_Intron|CASK_ENST00000378163.1_Intron|CASK_ENST00000378166.4_Intron|CASK_ENST00000421587.2_Intron|CASK_ENST00000378158.1_Intron	NM_080817.4	NP_543007.1	Q96P67	GPR82_HUMAN	G protein-coupled receptor 82	73						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.I73I(2)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(4)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	10						TCATGAGTATCTATTTCCTGA	0.393																																					p.I73M		.											.	GPR82-110	2	Substitution - coding silent(2)	lung(2)	c.C219G						.						100.0	79.0	86.0					X																	41586498		2203	4300	6503	SO:0001583	missense	27197	exon3			GAGTATCTATTTC	AF411111	CCDS14259.1	Xp11.4	2012-08-21			ENSG00000171657	ENSG00000171657		"""GPCR / Class A : Orphans"""	4533	protein-coding gene	gene with protein product		300748				11574155	Standard	NM_080817		Approved		uc004dft.3	Q96P67	OTTHUMG00000021373	ENST00000302548.4:c.219C>G	X.37:g.41586498C>G	ENSP00000303549:p.Ile73Met	Somatic	120	0		WXS	Illumina GAIIx	Phase_I	130	41	NM_080817	0	0	0	0	0	Q5VT13	Missense_Mutation	SNP	ENST00000302548.4	37	CCDS14259.1	.	.	.	.	.	.	.	.	.	.	C	9.111	1.006571	0.19199	.	.	ENSG00000171657	ENST00000302548	T	0.38722	1.12	5.42	3.58	0.41010	GPCR, rhodopsin-like superfamily (1);	0.902199	0.09383	N	0.809643	T	0.30230	0.0758	L	0.36672	1.1	0.30097	N	0.807807	B	0.12630	0.006	B	0.17098	0.017	T	0.34601	-0.9822	10	0.22109	T	0.4	-1.4774	4.297	0.10906	0.1677:0.5957:0.1504:0.0861	.	73	Q96P67	GPR82_HUMAN	M	73	ENSP00000303549:I73M	ENSP00000303549:I73M	I	+	3	3	GPR82	41471442	0.991000	0.36638	0.997000	0.53966	0.835000	0.47333	0.966000	0.29331	0.437000	0.26423	0.513000	0.50165	ATC	.		0.393	GPR82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056261.1	NM_080817	
PORCN	64840	broad.mit.edu	37	X	48368343	48368343	+	Splice_Site	SNP	C	C	G			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chrX:48368343C>G	ENST00000326194.6	+	1	178	c.135C>G	c.(133-135)ctC>ctG	p.L45L	PORCN_ENST00000361988.3_Splice_Site_p.L45L|PORCN_ENST00000537758.1_Splice_Site_p.L45L|PORCN_ENST00000355092.3_Splice_Site_p.L45L|AF196972.9_ENST00000445586.1_RNA|PORCN_ENST00000486272.1_3'UTR|PORCN_ENST00000359882.4_Splice_Site_p.L45L|PORCN_ENST00000355961.4_Splice_Site_p.L45L|PORCN_ENST00000367574.4_5'UTR	NM_203475.1	NP_982301.1	Q9H237	PORCN_HUMAN	porcupine homolog (Drosophila)	45	Leu-rich.				glycoprotein metabolic process (GO:0009100)|Wnt signaling pathway (GO:0016055)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|integral component of endoplasmic reticulum membrane (GO:0030176)	transferase activity, transferring acyl groups (GO:0016746)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						TCTGGAGGCTCGGTAAGTGCC	0.602																																					p.L45L		.											.	PORCN-133	0			c.C135G						.						29.0	28.0	28.0					X																	48368343		2201	4300	6501	SO:0001630	splice_region_variant	64840	exon1			GAGGCTCGGTAAG	AF317058	CCDS14296.1, CCDS14297.1, CCDS14298.1, CCDS14299.1	Xp11.23	2014-02-05			ENSG00000102312	ENSG00000102312			17652	protein-coding gene	gene with protein product		300651	"""dermal hypoplasia, focal"""	DHOF		10866835, 12034504, 17546030	Standard	NM_203474		Approved	MG61, PORC, PPN, por	uc004djv.1	Q9H237	OTTHUMG00000024116	ENST00000326194.6:c.136+1C>G	X.37:g.48368343C>G		Somatic	116	7		WXS	Illumina GAIIx	Phase_I	108	12	NM_203475	0	0	0	0	0	B2RBN8|B7ZAR3|Q14829|Q9H234|Q9H235|Q9H236|Q9UJU7	Silent	SNP	ENST00000326194.6	37	CCDS14299.1																																																																																			.		0.602	PORCN-011	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000356990.1	NM_022825	Silent
IQSEC2	23096	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	53284064	53284064	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chrX:53284064G>C	ENST00000375368.5	-	3	1219	c.1019C>G	c.(1018-1020)gCt>gGt	p.A340G	IQSEC2_ENST00000375365.2_Missense_Mutation_p.A145G|IQSEC2_ENST00000396435.3_Missense_Mutation_p.A350G			Q5JU85	IQEC2_HUMAN	IQ motif and Sec7 domain 2	340	IQ. {ECO:0000255|PROSITE- ProRule:PRU00116}.				actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(10)|ovary(4)|skin(1)	29						GGTCCTGGCAGCCCTGCGGCT	0.602																																					p.A350G		.											.	IQSEC2-178	0			c.C1049G						.						31.0	28.0	29.0					X																	53284064		2203	4299	6502	SO:0001583	missense	23096	exon4			CTGGCAGCCCTGC	AB011094	CCDS35298.1, CCDS48130.1	Xp11.23	2014-01-31			ENSG00000124313	ENSG00000124313			29059	protein-coding gene	gene with protein product		300522	"""mental retardation, X-linked 1 (non-dysmorphic)"""	MRX1		9628581, 20473311	Standard	NM_001243197		Approved	KIAA0522	uc004dsd.3	Q5JU85	OTTHUMG00000021608	ENST00000375368.5:c.1019C>G	X.37:g.53284064G>C	ENSP00000364517:p.Ala340Gly	Somatic	144	0		WXS	Illumina GAIIx	Phase_I	182	45	NM_001111125	0	0	0	0	0	B3KT97|C7SDG1|O60275|Q5JUX1	Missense_Mutation	SNP	ENST00000375368.5	37		.	.	.	.	.	.	.	.	.	.	G	21.7	4.191528	0.78902	.	.	ENSG00000124313	ENST00000396435;ENST00000375368;ENST00000375365	T;T;T	0.78481	-1.18;-1.18;-1.18	5.09	5.09	0.68999	.	0.121779	0.53938	D	0.000048	D	0.86377	0.5918	M	0.62723	1.935	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.80764	0.994;0.994	D	0.88030	0.2774	10	0.87932	D	0	.	16.3278	0.82994	0.0:0.0:1.0:0.0	.	350;145	Q5JU85-2;Q5JU85-3	.;.	G	350;340;145	ENSP00000379712:A350G;ENSP00000364517:A340G;ENSP00000364514:A145G	ENSP00000364514:A145G	A	-	2	0	IQSEC2	53300789	1.000000	0.71417	0.997000	0.53966	0.903000	0.53119	9.824000	0.99380	2.108000	0.64289	0.513000	0.50165	GCT	.		0.602	IQSEC2-201	KNOWN	basic	protein_coding	protein_coding		XM_291345	
HUWE1	10075	broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	53616611	53616611	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chrX:53616611C>T	ENST00000342160.3	-	35	4814	c.4357G>A	c.(4357-4359)Gag>Aag	p.E1453K	HUWE1_ENST00000262854.6_Missense_Mutation_p.E1453K|HUWE1_ENST00000218328.8_Missense_Mutation_p.E1453K			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	1453					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						TCTGGCAGCTCATCAAGAAGG	0.453																																					p.E1453K		.											.	HUWE1-280	0			c.G4357A						.						215.0	161.0	179.0					X																	53616611		2203	4300	6503	SO:0001583	missense	10075	exon36			GCAGCTCATCAAG	AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.4357G>A	X.37:g.53616611C>T	ENSP00000340648:p.Glu1453Lys	Somatic	217	1		WXS	Illumina GAIIx	Phase_I	225	56	NM_031407	0	0	0	0	0	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	ENST00000342160.3	37	CCDS35301.1	.	.	.	.	.	.	.	.	.	.	C	17.44	3.390230	0.62066	.	.	ENSG00000086758	ENST00000342160;ENST00000262854;ENST00000218328	T;T;T	0.43688	1.24;1.24;0.94	5.93	5.93	0.95920	Armadillo-like helical (1);	0.000000	0.85682	D	0.000000	T	0.36580	0.0972	N	0.14661	0.345	0.80722	D	1	P;P	0.52692	0.924;0.955	B;P	0.50270	0.432;0.636	T	0.09164	-1.0687	10	0.14252	T	0.57	.	17.9436	0.89032	0.0:1.0:0.0:0.0	.	1453;1453	Q7Z6Z7;Q7Z6Z7-2	HUWE1_HUMAN;.	K	1453	ENSP00000340648:E1453K;ENSP00000262854:E1453K;ENSP00000218328:E1453K	ENSP00000218328:E1453K	E	-	1	0	HUWE1	53633336	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	5.797000	0.69087	2.513000	0.84729	0.600000	0.82982	GAG	.		0.453	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1	XM_497119	
COL4A6	1288	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	107447550	107447550	+	Splice_Site	SNP	C	C	A			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chrX:107447550C>A	ENST00000372216.4	-	12	883	c.783G>T	c.(781-783)aaG>aaT	p.K261N	COL4A6_ENST00000394872.2_Splice_Site_p.K258N|COL4A6_ENST00000334504.7_Splice_Site_p.K260N|COL4A6_ENST00000545689.1_Splice_Site_p.K260N|COL4A6_ENST00000538570.1_Splice_Site_p.K260N	NM_001847.2	NP_001838.2	Q14031	CO4A6_HUMAN	collagen, type IV, alpha 6	261	Triple-helical region.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(41)|ovary(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	92						TGTTCACTACCTTGGATCCTT	0.398									Alport syndrome with Diffuse Leiomyomatosis																												p.K261N	Melanoma(87;1895 1945 2589 7165)	.											.	COL4A6-199	0			c.G783T						.						54.0	50.0	52.0					X																	107447550		2203	4300	6503	SO:0001630	splice_region_variant	1288	exon12	Familial Cancer Database		CACTACCTTGGAT	U04845	CCDS14541.1, CCDS14542.1, CCDS76008.1, CCDS76009.1, CCDS76010.1	Xq22	2014-09-17			ENSG00000197565	ENSG00000197565		"""Collagens"""	2208	protein-coding gene	gene with protein product		303631				8356449	Standard	NM_033641		Approved		uc004env.4	Q14031	OTTHUMG00000022179	ENST00000372216.4:c.783+1G>T	X.37:g.107447550C>A		Somatic	49	0		WXS	Illumina GAIIx	Phase_I	35	16	NM_001847	0	0	0	0	0	Q12823|Q14053|Q5JYH6|Q5JYH8|Q9NQM5|Q9NTX3|Q9UJ76|Q9UMG6|Q9Y4L4	Missense_Mutation	SNP	ENST00000372216.4	37	CCDS14541.1	.	.	.	.	.	.	.	.	.	.	C	10.67	1.416610	0.25552	.	.	ENSG00000197565	ENST00000372216;ENST00000334504;ENST00000394872;ENST00000541389;ENST00000545689;ENST00000538570	D;D;D;D;D	0.93859	-3.3;-3.3;-3.28;-3.3;-3.3	5.21	4.31	0.51392	.	0.000000	0.42420	D	0.000709	D	0.93848	0.8032	L	0.58428	1.81	0.35704	D	0.815817	D;D;D;D	0.64830	0.992;0.992;0.994;0.992	P;P;P;P	0.60541	0.876;0.876;0.755;0.876	D	0.94004	0.7278	9	.	.	.	.	6.741	0.23435	0.0:0.7589:0.0:0.2411	.	260;260;261;260	F5H851;F5H3Q5;Q14031;Q14031-2	.;.;CO4A6_HUMAN;.	N	261;260;258;260;260;260	ENSP00000361290:K261N;ENSP00000334733:K260N;ENSP00000378340:K258N;ENSP00000443707:K260N;ENSP00000445236:K260N	.	K	-	3	2	COL4A6	107334206	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	1.295000	0.33377	1.164000	0.42652	0.600000	0.82982	AAG	.		0.398	COL4A6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057875.2		Missense_Mutation
OCRL	4952	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	128722897	128722897	+	Silent	SNP	C	C	A			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chrX:128722897C>A	ENST00000371113.4	+	22	2541	c.2376C>A	c.(2374-2376)ctC>ctA	p.L792L	OCRL_ENST00000357121.5_Silent_p.L784L	NM_000276.3	NP_000267.2	Q01968	OCRL_HUMAN	oculocerebrorenal syndrome of Lowe	792	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				cilium assembly (GO:0042384)|in utero embryonic development (GO:0001701)|inositol phosphate metabolic process (GO:0043647)|lipid metabolic process (GO:0006629)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|Golgi stack (GO:0005795)|Golgi-associated vesicle (GO:0005798)|nucleus (GO:0005634)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	inositol phosphate phosphatase activity (GO:0052745)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)			breast(1)|endometrium(3)|kidney(4)|large_intestine(11)|lung(24)|ovary(2)|upper_aerodigestive_tract(3)	48						AAGCACTGCTCATTTTCTTGG	0.542																																					p.L792L		.											.	OCRL-206	0			c.C2376A						.						120.0	97.0	105.0					X																	128722897		2203	4300	6503	SO:0001819	synonymous_variant	4952	exon22			ACTGCTCATTTTC	U57627	CCDS35393.1, CCDS35394.1	Xq25	2014-06-18			ENSG00000122126	ENSG00000122126			8108	protein-coding gene	gene with protein product		300535					Standard	NM_001587		Approved	OCRL1	uc004euq.3	Q01968	OTTHUMG00000022706	ENST00000371113.4:c.2376C>A	X.37:g.128722897C>A		Somatic	73	0		WXS	Illumina GAIIx	Phase_I	62	8	NM_000276	0	0	0	0	0	A6NKI1|A8KAP2|B7ZLX2|O60800|Q15684|Q15774|Q4VY09|Q4VY10|Q5JQF1|Q5JQF2|Q9UJG5|Q9UMA5	Silent	SNP	ENST00000371113.4	37	CCDS35393.1																																																																																			.		0.542	OCRL-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058917.1	NM_000276	
APLN	8862	ucsc.edu;bcgsc.ca;mdanderson.org	37	X	128782651	128782651	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chrX:128782651G>T	ENST00000307484.6	-	2	511	c.186C>A	c.(184-186)ttC>ttA	p.F62L	APLN_ENST00000429967.1_Missense_Mutation_p.S25Y|APLN_ENST00000427399.1_Missense_Mutation_p.S25Y	NM_017413.4	NP_059109.3	Q9ULZ1	APEL_HUMAN	apelin	62					immune response (GO:0006955)|lactation (GO:0007595)|signal transduction (GO:0007165)	extracellular region (GO:0005576)	receptor binding (GO:0005102)										GCTGGCGGCGGAATTTCCTCC	0.627																																					p.F62L		.											.	APLN-108	0			c.C186A						.						13.0	15.0	15.0					X																	128782651		1937	4102	6039	SO:0001583	missense	8862	exon2			GCGGCGGAATTTC	AF179680		Xq25	2013-02-25	2008-04-21		ENSG00000171388	ENSG00000171388		"""Endogenous ligands"""	16665	protein-coding gene	gene with protein product		300297	"""apelin, AGTRL1 ligand"""			9792798, 10525157	Standard	NM_017413		Approved	apelin, XNPEP2	uc004eus.3	Q9ULZ1	OTTHUMG00000022371	ENST00000307484.6:c.186C>A	X.37:g.128782651G>T	ENSP00000305464:p.Phe62Leu	Somatic	297	3		WXS	Illumina GAIIx	Phase_I	277	92	NM_017413	0	0	0	0	0	Q4VY08|Q8WU89	Missense_Mutation	SNP	ENST00000307484.6	37	CCDS48165.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.7|21.7	4.185407|4.185407	0.78677|0.78677	.|.	.|.	ENSG00000171388|ENSG00000171388	ENST00000307484|ENST00000429967;ENST00000427399	.|.	.|.	.|.	5.64|5.64	-0.0191|-0.0191	0.13961|0.13961	.|.	.|0.464261	.|0.16134	.|N	.|0.228054	T|T	0.38054|0.38054	0.1026|0.1026	.|.	.|.	.|.	0.27303|0.27303	N|N	0.957518|0.957518	B|.	0.17667|.	0.023|.	B|.	0.16289|.	0.015|.	T|T	0.36335|0.36335	-0.9752|-0.9752	7|6	0.26408|0.87932	T|D	0.33|0	-0.8433|-0.8433	4.7146|4.7146	0.12889|0.12889	0.4322:0.1525:0.4153:0.0|0.4322:0.1525:0.4153:0.0	.|.	62|.	Q9ULZ1|.	APEL_HUMAN|.	L|Y	62|25	.|.	ENSP00000305464:F62L|ENSP00000390834:S25Y	F|S	-|-	3|2	2|0	APLN|APLN	128610332|128610332	1.000000|1.000000	0.71417|0.71417	0.320000|0.320000	0.25306|0.25306	0.953000|0.953000	0.61014|0.61014	0.372000|0.372000	0.20467|0.20467	-0.491000|-0.491000	0.06697|0.06697	0.556000|0.556000	0.70494|0.70494	TTC|TCC	.		0.627	APLN-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_017413	
PHF6	84295	broad.mit.edu;bcgsc.ca	37	X	133547878	133547878	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chrX:133547878G>T	ENST00000332070.3	+	7	813	c.611G>T	c.(610-612)aGc>aTc	p.S204I	PHF6_ENST00000370799.1_Missense_Mutation_p.S205I|PHF6_ENST00000370800.4_Missense_Mutation_p.S205I|PHF6_ENST00000416404.2_Missense_Mutation_p.S170I|PHF6_ENST00000394292.1_Missense_Mutation_p.S205I|PHF6_ENST00000370803.3_Missense_Mutation_p.S204I	NM_032458.2	NP_115834.1	Q8IWS0	PHF6_HUMAN	PHD finger protein 6	204					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone binding (GO:0042393)|histone deacetylase binding (GO:0042826)|phosphoprotein binding (GO:0051219)|poly(A) RNA binding (GO:0044822)|ribonucleoprotein complex binding (GO:0043021)|scaffold protein binding (GO:0097110)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(88)|kidney(2)|large_intestine(1)|liver(1)|lung(6)|ovary(1)|skin(1)|urinary_tract(1)	103	Acute lymphoblastic leukemia(192;0.000127)					CACAGAAGCAGCCCTAGTGAC	0.388			"""F, N, Splice, Mis"""		ETP ALL																																p.S205I	Colon(100;666 1493 6344 21231 35807)	.		Rec	yes		X	Xq26.3	84295	PHD finger protein 6		L	.	PHF6-131	0			c.G614T						.						99.0	88.0	91.0					X																	133547878		2203	4300	6503	SO:0001583	missense	84295	exon7			GAAGCAGCCCTAG	AB058726	CCDS14639.1, CCDS14640.1	Xq26	2014-09-17			ENSG00000156531	ENSG00000156531		"""Zinc fingers, PHD-type"""	18145	protein-coding gene	gene with protein product	"""centromere protein 31"""	300414	"""Borjeson-Forssman-Lehmann syndrome"""	BFLS, BORJ		12415272, 15466013	Standard	NM_032335		Approved	KIAA1823, MGC14797, CENP-31	uc004exk.3	Q8IWS0	OTTHUMG00000022453	ENST00000332070.3:c.611G>T	X.37:g.133547878G>T	ENSP00000329097:p.Ser204Ile	Somatic	336	0		WXS	Illumina GAIIx	Phase_I	312	8	NM_032335	0	0	0	0	0	A8K230|B4E0G4|D3DTG3|E9PC97|Q5JRC7|Q5JRC8|Q96JK3|Q9BRU0	Missense_Mutation	SNP	ENST00000332070.3	37	CCDS14639.1	.	.	.	.	.	.	.	.	.	.	G	15.90	2.968818	0.53614	.	.	ENSG00000156531	ENST00000370803;ENST00000332070;ENST00000394292;ENST00000370799;ENST00000416404;ENST00000370800	D;D;D;D;D;D	0.90732	-2.72;-2.72;-2.14;-2.71;-1.73;-2.35	5.71	5.71	0.89125	.	0.034187	0.85682	D	0.000000	D	0.90700	0.7082	L	0.27053	0.805	0.80722	D	1	D;D;P;P;D	0.62365	0.978;0.991;0.769;0.769;0.987	P;P;B;B;P	0.57776	0.543;0.801;0.332;0.332;0.827	D	0.90197	0.4254	10	0.37606	T	0.19	-5.3761	17.9424	0.89029	0.0:0.0:1.0:0.0	.	170;204;204;205;205	B4E0G4;A8K230;Q8IWS0;E9PC97;Q8IWS0-2	.;.;PHF6_HUMAN;.;.	I	204;204;205;205;170;205	ENSP00000359839:S204I;ENSP00000329097:S204I;ENSP00000377831:S205I;ENSP00000359835:S205I;ENSP00000394480:S170I;ENSP00000359836:S205I	ENSP00000329097:S204I	S	+	2	0	PHF6	133375544	1.000000	0.71417	1.000000	0.80357	0.645000	0.38454	7.565000	0.82337	2.544000	0.85801	0.594000	0.82650	AGC	.		0.388	PHF6-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058367.1	NM_032458	
TCHH	7062	broad.mit.edu	37	1	152084175	152084176	+	In_Frame_Ins	INS	-	-	TGCTGCTCGCGCCTCTCC			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr1:152084175_152084176insTGCTGCTCGCGCCTCTCC	ENST00000368804.1	-	2	1516_1517	c.1517_1518insGGAGAGGCGCGAGCAGCA	c.(1516-1518)caa>caGGAGAGGCGCGAGCAGCAa	p.506_506Q>QERREQQ		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	506	9 X 28 AA approximate tandem repeats.				keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCCGCCTTAGTTGCTGCTCGCG	0.644																																					p.Q506delinsQERREQQ		.											.	TCHH-72	0			c.1518_1519insGGAGAGGCGCGAGCAGCA						.																																			SO:0001652	inframe_insertion	7062	exon3			CCTTAGTTGCTGC	L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.1500_1517dupGGAGAGGCGCGAGCAGCA	1.37:g.152084175_152084176insTGCTGCTCGCGCCTCTCC	ENSP00000357794:p.GluArgArgGluGlnGln506dup	Somatic	44	0		WXS	Illumina GAIIx	Phase_I	70	16	NM_007113	0	0	0	0	0	Q5VUI3	In_Frame_Ins	INS	ENST00000368804.1	37	CCDS41396.1																																																																																			.		0.644	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036671.2	NM_007113	
KRTAP5-5	439915	hgsc.bcm.edu;broad.mit.edu	37	11	1651199	1651200	+	In_Frame_Ins	INS	-	-	GGCCGTGGCTCC	rs71025763|rs144216147	byFrequency	TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr11:1651199_1651200insGGCCGTGGCTCC	ENST00000399676.2	+	1	167_168	c.129_130insGGCCGTGGCTCC	c.(130-132)ggc>GGCCGTGGCTCCggc	p.44_44G>GRGSG		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	44						keratin filament (GO:0045095)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		ccggctgtggaggctgtggggg	0.713																																					p.G43delinsGGRGS		.											.	KRTAP5-5-23	0			c.129_130insGGCCGTGGCTCC						.																																			SO:0001652	inframe_insertion	439915	exon1			CTGTGGAGGCTGT	AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	Exception_encountered	11.37:g.1651199_1651200insGGCCGTGGCTCC	Exception_encountered	Somatic	5	0		WXS	Illumina GAIIx	Phase_I	28	20	NM_001001480	0	0	0	0	0	A8MWN2	In_Frame_Ins	INS	ENST00000399676.2	37	CCDS41592.1																																																																																			.		0.713	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127919.1		
POLG	5428	broad.mit.edu	37	15	89876827	89876828	+	In_Frame_Ins	INS	-	-	TGC	rs527965158|rs369920352|rs41550117|rs587781118|rs59510277	byFrequency	TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr15:89876827_89876828insTGC	ENST00000268124.5	-	2	491_492	c.158_159insGCA	c.(157-159)caa>caGCAa	p.53_53Q>QQ	POLG_ENST00000442287.2_In_Frame_Ins_p.53_53Q>QQ|POLG_ENST00000525806.1_5'Flank|RP11-217B1.2_ENST00000569473.1_RNA|RP11-217B1.2_ENST00000562356.1_RNA	NM_001126131.1|NM_002693.2	NP_001119603.1|NP_002684.1	P54098	DPOG1_HUMAN	polymerase (DNA directed), gamma	53	Poly-Gln.				aging (GO:0007568)|base-excision repair, gap-filling (GO:0006287)|cell death (GO:0008219)|DNA metabolic process (GO:0006259)|DNA-dependent DNA replication (GO:0006261)|mitochondrial DNA replication (GO:0006264)	extracellular vesicular exosome (GO:0070062)|gamma DNA polymerase complex (GO:0005760)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|exonuclease activity (GO:0004527)|protease binding (GO:0002020)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(3)|urinary_tract(2)	33	Lung NSC(78;0.0472)|all_lung(78;0.089)		STAD - Stomach adenocarcinoma(125;0.165)			gaggctgctgttgctgctgctg	0.693								DNA polymerases (catalytic subunits)																													p.Q53delinsQQ	Colon(73;648 1203 11348 18386 27782)	.											.	POLG-228	0			c.159_160insGCA						.																																			SO:0001652	inframe_insertion	5428	exon2			CTGCTGTTGCTGC	X98093	CCDS10350.1	15q24	2014-09-17			ENSG00000140521	ENSG00000140521		"""DNA polymerases"""	9179	protein-coding gene	gene with protein product		174763				9465903	Standard	NM_002693		Approved	POLG1, POLGA	uc002bnr.4	P54098	OTTHUMG00000149646	ENST00000268124.5:c.156_158dupGCA	15.37:g.89876834_89876836dupTGC	ENSP00000268124:p.Gln55dup	Somatic	11	0		WXS	Illumina GAIIx	Phase_I	15	5	NM_001126131	0	0	0	0	0	Q8NFM2|Q92515	In_Frame_Ins	INS	ENST00000268124.5	37	CCDS10350.1																																																																																			.		0.693	POLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000312854.2	NM_002693	
RAX	30062	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	18	56939705	56939706	+	Frame_Shift_Ins	INS	-	-	T			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr18:56939705_56939706insT	ENST00000334889.3	-	2	616_617	c.430_431insA	c.(430-432)accfs	p.T144fs	RAX_ENST00000256852.7_Intron	NM_013435.2	NP_038463.2	Q9Y2V3	RX_HUMAN	retina and anterior neural fold homeobox	144					camera-type eye development (GO:0043010)|hypothalamus development (GO:0021854)|limb development (GO:0060173)|pattern specification process (GO:0007389)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|visual perception (GO:0007601)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)|prostate(1)	6		Lung NSC(161;0.0804)|Colorectal(73;0.0946)		STAD - Stomach adenocarcinoma(84;0.18)		CTGGTACGTGGTGAAAGTCGTG	0.644																																					p.T144fs	GBM(150;770 1898 17679 24325 37807)	.											.	RAX-90	0			c.431_432insA						.																																			SO:0001589	frameshift_variant	30062	exon2			TACGTGGTGAAAG	AF115392	CCDS11972.1	18q21.31	2011-06-20			ENSG00000134438	ENSG00000134438		"""Homeoboxes / PRD class"""	18662	protein-coding gene	gene with protein product		601881				10625658, 10766016, 14662654	Standard	NM_013435		Approved	RX	uc002lhx.3	Q9Y2V3	OTTHUMG00000132757	ENST00000334889.3:c.431dupA	18.37:g.56939706_56939706dupT	ENSP00000334813:p.Thr144fs	Somatic	152	0		WXS	Illumina GAIIx	Phase_I	151	55	NM_013435	0	0	0	0	0	Q86V11	Frame_Shift_Ins	INS	ENST00000334889.3	37	CCDS11972.1																																																																																			.		0.644	RAX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256128.2		
PANX2	56666	broad.mit.edu	37	22	50617594	50617595	+	Frame_Shift_Ins	INS	-	-	C	rs376326556		TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr22:50617594_50617595insC	ENST00000395842.2	+	3	1922_1923	c.1922_1923insC	c.(1921-1926)ggccccfs	p.GP641fs	PANX2_ENST00000159647.5_Intron	NM_052839.3	NP_443071.2	Q96RD6	PANX2_HUMAN	pannexin 2	641					ion transport (GO:0006811)|protein hexamerization (GO:0034214)|response to ischemia (GO:0002931)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|gap junction (GO:0005921)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gap junction hemi-channel activity (GO:0055077)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(1)|skin(1)	7		all_cancers(38;1.14e-10)|all_epithelial(38;2.12e-09)|all_lung(38;7.01e-05)|Breast(42;0.000523)|Lung NSC(38;0.0018)|Ovarian(80;0.0365)|Lung SC(80;0.113)		LUAD - Lung adenocarcinoma(64;0.105)		GAGGACGGGGGCCCCCGCCTGC	0.678																																					p.G641fs		.											.	PANX2-131	0			c.1922_1923insC						.																																			SO:0001589	frameshift_variant	56666	exon3			ACGGGGGCCCCCG		CCDS14085.2, CCDS54544.1	22q13.33	2011-12-05			ENSG00000073150	ENSG00000073150		"""Ion channels / Pannexins"""	8600	protein-coding gene	gene with protein product		608421				14702039, 14597722	Standard	NM_052839		Approved	hPANX2, PX2	uc003bjn.4	Q96RD6	OTTHUMG00000044649	ENST00000395842.2:c.1927dupC	22.37:g.50617599_50617599dupC	ENSP00000379183:p.Gly641fs	Somatic	29	0		WXS	Illumina GAIIx	Phase_I	89	15	NM_052839	0	0	0	0	0	B7Z684|Q96RD5|Q9UGX8	Frame_Shift_Ins	INS	ENST00000395842.2	37	CCDS14085.2																																																																																			.		0.678	PANX2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075010.3	NM_052839	
OR6C1	390321	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	55714972	55714973	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	GG	GG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr12:55714972_55714973GG>TT	ENST00000379668.2	+	1	627_628	c.589_590GG>TT	c.(589-591)GGa>TTa	p.G197L		NM_001005182.1	NP_001005182.1	Q96RD1	OR6C1_HUMAN	olfactory receptor, family 6, subfamily C, member 1	197						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G197E(1)		endometrium(3)|large_intestine(5)|liver(2)|lung(13)|ovary(1)|upper_aerodigestive_tract(1)	25						AGAGGTGATGGGATTTTCTTGT	0.342																																					p.G197L		.											.	OR6C1-69	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)	c.G590T						.																																			SO:0001583	missense	390321	exon1			TGATGGGATTTTC	AF399506	CCDS31818.1	12q13.13	2012-08-09			ENSG00000205330	ENSG00000205330		"""GPCR / Class A : Olfactory receptors"""	8355	protein-coding gene	gene with protein product							Standard	NM_001005182		Approved	OST267	uc010spi.2	Q96RD1	OTTHUMG00000168102	Exception_encountered	12.37:g.55714972_55714973delinsTT	ENSP00000368990:p.Gly197Leu	Somatic	118	0		WXS	Illumina GAIIx	Phase_I	130	10	NM_001005182	0	0	0	0	0	B2RNM0	Missense_Mutation	DNP	ENST00000379668.2	37	CCDS31818.1																																																																																			.		0.342	OR6C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398152.1	NM_001005182	
BACH2	60468	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	90660029	90660030	+	Missense_Mutation	DNP	GC	GC	AT			TCGA-OR-A5J4-01A-11D-A29I-10	TCGA-OR-A5J4-10A-01D-A29L-10	GC	GC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4d76daa9-a336-435c-aeef-47344d97ac5b	75574849-0529-454a-92ea-2580f79cc974	g.chr6:90660029_90660030GC>AT	ENST00000257749.4	-	7	2502_2503	c.1795_1796GC>AT	c.(1795-1797)GCa>ATa	p.A599I	BACH2_ENST00000537989.1_Missense_Mutation_p.A599I|BACH2_ENST00000343122.3_Missense_Mutation_p.A599I|RP3-512E2.2_ENST00000445838.1_RNA|RP3-512E2.2_ENST00000413986.1_RNA	NM_021813.2	NP_068585.1	Q9BYV9	BACH2_HUMAN	BTB and CNC homology 1, basic leucine zipper transcription factor 2	599						cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(18)|ovary(5)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	45		all_cancers(76;7.37e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.0063)		BRCA - Breast invasive adenocarcinoma(108;0.0799)		CTCACTGTCTGCTTCCGAGAAC	0.515																																					p.A599I		.											.	BACH2-231	0			c.G1795A						.																																			SO:0001583	missense	60468	exon7			TGTCTGCTTCCGA	AL121787	CCDS5026.1	6q15	2013-01-10			ENSG00000112182	ENSG00000112182		"""BTB/POZ domain containing"", ""basic leucine zipper proteins"""	14078	protein-coding gene	gene with protein product		605394				10949928, 12829606	Standard	NM_001170794		Approved	BTBD25	uc003pnw.3	Q9BYV9	OTTHUMG00000015216	ENST00000257749.4:c.1795_1796delinsAT	6.37:g.90660029_90660030delinsAT	ENSP00000257749:p.Ala599Ile	Somatic	98	0		WXS	Illumina GAIIx	Phase_I	241	0	NM_021813	0	0	0	0	0	E1P518|Q59H70|Q5T793|Q9NTS5	Missense_Mutation	DNP	ENST00000257749.4	37	CCDS5026.1																																																																																			.		0.515	BACH2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041522.2	NM_021813	
