#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ACAP3	116983	hgsc.bcm.edu	37	1	1229971	1229971	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr1:1229971G>T	ENST00000354700.5	-	21	2152	c.1950C>A	c.(1948-1950)gaC>gaA	p.D650E	ACAP3_ENST00000353662.3_Missense_Mutation_p.D575E|ACAP3_ENST00000379037.2_5'Flank	NM_030649.2	NP_085152.2	Q96P50	ACAP3_HUMAN	ArfGAP with coiled-coil, ankyrin repeat and PH domains 3	650					regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			endometrium(3)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	14						CAGTGTCCCCGTCTGCCTCAC	0.756																																					p.D650E		.											.	ACAP3-90	0			c.C1950A						.						7.0	6.0	6.0					1																	1229971		2060	4060	6120	SO:0001583	missense	116983	exon21			GTCCCCGTCTGCC	AF411981	CCDS19.2	1p36	2013-01-10	2008-09-22	2008-09-22	ENSG00000131584	ENSG00000131584		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16754	protein-coding gene	gene with protein product			"""centaurin, beta 5"""	CENTB5			Standard	NM_030649		Approved	KIAA1716	uc001aeb.2	Q96P50	OTTHUMG00000002235	ENST00000354700.5:c.1950C>A	1.37:g.1229971G>T	ENSP00000346733:p.Asp650Glu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	11	7	NM_030649	0	0	0	2	2	B1AMF5|Q5TA42|Q5TA43|Q86UT3|Q9BSR9|Q9C0E7	Missense_Mutation	SNP	ENST00000354700.5	37	CCDS19.2	.	.	.	.	.	.	.	.	.	.	G	9.619	1.133410	0.21041	.	.	ENSG00000131584	ENST00000354700;ENST00000353662	T;T	0.26067	1.76;1.8	3.68	-4.25	0.03766	.	3.612510	0.00508	N	0.000174	T	0.05547	0.0146	N	0.00677	-1.265	0.32839	D	0.505124	B;B	0.15141	0.007;0.012	B;B	0.12156	0.003;0.007	T	0.42865	-0.9426	10	0.02654	T	1	.	1.9447	0.03354	0.3385:0.349:0.1973:0.1152	.	650;575	Q96P50;Q96P50-1	ACAP3_HUMAN;.	E	650;575	ENSP00000346733:D650E;ENSP00000321139:D575E	ENSP00000321139:D575E	D	-	3	2	ACAP3	1219834	0.001000	0.12720	0.050000	0.19076	0.447000	0.32167	-2.074000	0.01375	-1.007000	0.03408	0.185000	0.17295	GAC	.		0.756	ACAP3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006366.2	NM_030649	
PLEKHG5	57449	hgsc.bcm.edu	37	1	6529191	6529191	+	Silent	SNP	C	C	T	rs386628081|rs544570668	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr1:6529191C>T	ENST00000400915.3	-	20	2394	c.2328G>A	c.(2326-2328)gaG>gaA	p.E776E	PLEKHG5_ENST00000377748.1_Silent_p.E797E|PLEKHG5_ENST00000377737.2_Silent_p.E720E|PLEKHG5_ENST00000544978.1_Silent_p.E720E|PLEKHG5_ENST00000537245.1_Silent_p.E799E|PLEKHG5_ENST00000377725.1_Silent_p.E720E|PLEKHG5_ENST00000377728.3_Silent_p.E720E|TNFRSF25_ENST00000351959.5_5'Flank|TNFRSF25_ENST00000377782.3_5'Flank|PLEKHG5_ENST00000535355.1_Silent_p.E789E|PLEKHG5_ENST00000340850.5_Silent_p.E720E|TNFRSF25_ENST00000356876.3_5'Flank|PLEKHG5_ENST00000400913.1_Silent_p.E720E|PLEKHG5_ENST00000377732.1_Silent_p.E757E|PLEKHG5_ENST00000377740.3_Silent_p.E797E	NM_001042663.1	NP_001036128.1	O94827	PKHG5_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 5	776	Glu-rich.				apoptotic signaling pathway (GO:0097190)|endothelial cell chemotaxis (GO:0035767)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			liver(1)	1	Ovarian(185;0.02)|all_lung(157;0.154)	all_cancers(23;1.7e-35)|all_epithelial(116;2.78e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Colorectal(325;4.47e-05)|all_hematologic(16;0.00014)|Breast(487;0.000688)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0448)		Epithelial(90;5.51e-35)|GBM - Glioblastoma multiforme(13;3.57e-27)|Colorectal(212;6.23e-08)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000894)|BRCA - Breast invasive adenocarcinoma(365;0.00107)|STAD - Stomach adenocarcinoma(132;0.00159)|READ - Rectum adenocarcinoma(331;0.0419)		cttcctcctcctcctcctcct	0.632																																					p.E799E		.											.	PLEKHG5-652	0			c.G2397A						.						80.0	79.0	80.0					1																	6529191		2203	4300	6503	SO:0001819	synonymous_variant	57449	exon20			CTCCTCCTCCTCC	AK024676	CCDS79.1, CCDS41240.1, CCDS41241.1, CCDS57967.1, CCDS57968.1, CCDS57969.1	1p36.31	2014-09-17		2005-08-09	ENSG00000171680	ENSG00000171680		"""Pleckstrin homology (PH) domain containing"""	29105	protein-coding gene	gene with protein product	"""synectin-binding guanine exchange factor"""	611101				17564964	Standard	NM_001042663		Approved	KIAA0720, Syx, GEF720, Tech	uc010nzr.1	O94827	OTTHUMG00000000905	ENST00000400915.3:c.2328G>A	1.37:g.6529191C>T		Somatic	36	0		WXS	Illumina GAIIx	Phase_I	62	5	NM_001265592	0	0	0	0	0	B3KU07|B7Z2M3|B7Z5X2|F5GZ21|F5H1I0|Q5SY17|Q5T8W5|Q5T8W9|Q6ZNM0|Q7Z436|Q86YD8|Q96BS1	Silent	SNP	ENST00000400915.3	37	CCDS41241.1																																																																																			C|0.981;T|0.019		0.632	PLEKHG5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000002631.1	NM_020631	
KLHDC7A	127707	hgsc.bcm.edu	37	1	18809305	18809305	+	Silent	SNP	C	C	T	rs114671250	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr1:18809305C>T	ENST00000400664.1	+	1	1882	c.1830C>T	c.(1828-1830)gaC>gaT	p.D610D		NM_152375.2	NP_689588.2	Q5VTJ3	KLD7A_HUMAN	kelch domain containing 7A	610						integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	22		Colorectal(325;3.46e-05)|all_lung(284;0.000152)|Lung NSC(340;0.000185)|Breast(348;0.00046)|Renal(390;0.000518)|Ovarian(437;0.0014)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|BRCA - Breast invasive adenocarcinoma(304;1.41e-05)|Kidney(64;0.00017)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		CCCGCCTGGACCGCTGGGACT	0.701													C|||	76	0.0151757	0.053	0.0072	5008	,	,		11093	0.0		0.001	False		,,,				2504	0.0				p.D610D		.											.	KLHDC7A-93	0			c.C1830T						.	C		172,4232		5,162,2035	23.0	24.0	24.0		1830	3.8	1.0	1	dbSNP_132	24	3,8587		0,3,4292	no	coding-synonymous	KLHDC7A	NM_152375.2		5,165,6327	TT,TC,CC		0.0349,3.9055,1.3468		610/778	18809305	175,12819	2202	4295	6497	SO:0001819	synonymous_variant	127707	exon1			CCTGGACCGCTGG	AK096072	CCDS185.2	1p36.13	2008-02-05			ENSG00000179023	ENSG00000179023			26791	protein-coding gene	gene with protein product							Standard	NM_152375		Approved	FLJ38753	uc001bax.3	Q5VTJ3	OTTHUMG00000002431	ENST00000400664.1:c.1830C>T	1.37:g.18809305C>T		Somatic	3	0		WXS	Illumina GAIIx	Phase_I	50	23	NM_152375	0	0	0	0	0	Q8N8W6	Silent	SNP	ENST00000400664.1	37	CCDS185.2																																																																																			C|0.985;T|0.015		0.701	KLHDC7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006923.3	NM_152375	
AHDC1	27245	hgsc.bcm.edu	37	1	27875518	27875520	+	In_Frame_Del	DEL	AGG	AGG	-	rs111827498	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	AGG	AGG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr1:27875518_27875520delAGG	ENST00000247087.5	-	5	3703_3705	c.3107_3109delCCT	c.(3106-3111)tccttc>ttc	p.S1036del	AHDC1_ENST00000374011.2_In_Frame_Del_p.S1036del			Q5TGY3	AHDC1_HUMAN	AT hook, DNA binding motif, containing 1	1036							DNA binding (GO:0003677)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	42		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0434)|OV - Ovarian serous cystadenocarcinoma(117;8.48e-25)|Colorectal(126;9.17e-09)|COAD - Colon adenocarcinoma(152;1.84e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00192)|BRCA - Breast invasive adenocarcinoma(304;0.00259)|STAD - Stomach adenocarcinoma(196;0.00311)|READ - Rectum adenocarcinoma(331;0.0291)		CTGCTGAAGAAGGAGGCCTTGCT	0.704														137	0.0273562	0.0877	0.0072	5008	,	,		14060	0.004		0.0	False		,,,				2504	0.0123				p.1036_1037del		.											.	AHDC1-90	0			c.3107_3109del						.			334,3910		27,280,1815						5.8	1.0		dbSNP_132	14	19,8207		8,3,4102	no	coding	AHDC1	NM_001029882.2		35,283,5917	A1A1,A1R,RR		0.231,7.8699,2.8308				353,12117				SO:0001651	inframe_deletion	27245	exon6			TGAAGAAGGAGGC	AK125431	CCDS30652.1	1p36.13	2008-02-05			ENSG00000126705	ENSG00000126705			25230	protein-coding gene	gene with protein product		615790				8619474, 9110174	Standard	XM_005245848		Approved	DJ159A19.3, RP1-159A19.1	uc009vsy.3	Q5TGY3	OTTHUMG00000003398	ENST00000247087.5:c.3107_3109delCCT	1.37:g.27875521_27875523delAGG	ENSP00000247087:p.Ser1036del	Somatic	6	2		WXS	Illumina GAIIx	Phase_I	49	17	NM_001029882	0	0	0	0	0	Q5TGY4|Q6PJK1|Q6ZUQ6|Q99769|Q9NUF5	In_Frame_Del	DEL	ENST00000247087.5	37	CCDS30652.1																																																																																			.		0.704	AHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009523.3		
MACF1	23499	broad.mit.edu	37	1	39852989	39852989	+	Silent	SNP	A	A	G			TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr1:39852989A>G	ENST00000372915.3	+	57	14577	c.14490A>G	c.(14488-14490)aaA>aaG	p.K4830K	MACF1_ENST00000567887.1_Silent_p.K4862K|MACF1_ENST00000564288.1_Silent_p.K4825K|MACF1_ENST00000317713.7_Silent_p.K2763K|MACF1_ENST00000545844.1_Silent_p.K2763K|MACF1_ENST00000289893.4_Silent_p.K3265K|MACF1_ENST00000539005.1_Silent_p.K2742K|MACF1_ENST00000361689.2_Silent_p.K2763K			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	4830					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TTTCTGCAAAATTGGAGCGGC	0.453																																					p.K2763K		.											.	MACF1-165	0			c.A8289G						.						127.0	144.0	138.0					1																	39852989		2203	4300	6503	SO:0001819	synonymous_variant	23499	exon54			TGCAAAATTGGAG	AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.14490A>G	1.37:g.39852989A>G		Somatic	110	0		WXS	Illumina GAIIx	Phase_I	118	4	NM_012090	0	0	0	0	0	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Silent	SNP	ENST00000372915.3	37		.	.	.	.	.	.	.	.	.	.	A	0.293	-0.978466	0.02197	.	.	ENSG00000127603	ENST00000372925	.	.	.	6.06	3.75	0.43078	.	.	.	.	.	T	0.57975	0.2090	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54214	-0.8327	4	.	.	.	.	8.1089	0.30903	0.7442:0.0:0.2558:0.0	.	.	.	.	V	1876	.	.	I	+	1	0	MACF1	39625576	0.999000	0.42202	1.000000	0.80357	0.460000	0.32559	1.594000	0.36697	1.119000	0.41883	0.533000	0.62120	ATT	.		0.453	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	NM_033044	
TIE1	7075	bcgsc.ca	37	1	43784956	43784956	+	Silent	SNP	A	A	G	rs1199039|rs45475401	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr1:43784956A>G	ENST00000372476.3	+	18	3052	c.2973A>G	c.(2971-2973)ctA>ctG	p.L991L	TIE1_ENST00000433781.2_Silent_p.L636L|TIE1_ENST00000473014.1_3'UTR	NM_001253357.1|NM_005424.4	NP_001240286.1|NP_005415.1	P35590	TIE1_HUMAN	tyrosine kinase with immunoglobulin-like and EGF-like domains 1	991	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|in utero embryonic development (GO:0001701)|mesoderm development (GO:0007498)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|peptidyl-tyrosine phosphorylation (GO:0018108)|plasma membrane fusion (GO:0045026)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(8)|lung(28)|ovary(3)|prostate(2)|salivary_gland(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	70	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				GAGAGAACCTAGCCTCCAAGA	0.567													G|||	1131	0.225839	0.1815	0.3631	5008	,	,		20631	0.1478		0.3777	False		,,,				2504	0.1125				p.L991L		.											.	TIE1-1404	0			c.A2973G						.	G		904,3502	740.8+/-411.2	93,718,1392	118.0	110.0	113.0		2973	5.1	1.0	1	dbSNP_87	113	3360,5240	642.3+/-399.8	665,2030,1605	no	coding-synonymous	TIE1	NM_005424.2		758,2748,2997	GG,GA,AA		39.0698,20.5175,32.7849		991/1139	43784956	4264,8742	2203	4300	6503	SO:0001819	synonymous_variant	7075	exon18			GAACCTAGCCTCC	BC038239	CCDS482.1	1p34-p33	2013-02-11	2004-12-13	2004-12-14	ENSG00000066056	ENSG00000066056	2.7.10.1	"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	11809	protein-coding gene	gene with protein product		600222	"""tyrosine kinase with immunoglobulin and epidermal growth factor homology domains 1"""	TIE		1312667	Standard	NM_005424		Approved	JTK14	uc001ciu.3	P35590	OTTHUMG00000007282	ENST00000372476.3:c.2973A>G	1.37:g.43784956A>G		Somatic	214	2		WXS	Illumina GAIIx	Phase_I	219	6	NM_005424	0	0	46	46	0	B5A949|B5A950	Silent	SNP	ENST00000372476.3	37	CCDS482.1																																																																																			A|0.697;G|0.303		0.567	TIE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019011.1	NM_005424	
OMA1	115209	broad.mit.edu;bcgsc.ca	37	1	59004877	59004877	+	Silent	SNP	T	T	C			TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr1:59004877T>C	ENST00000371226.3	-	2	203	c.90A>G	c.(88-90)acA>acG	p.T30T	OMA1_ENST00000467063.1_Intron|OMA1_ENST00000358603.2_Silent_p.T30T|DAB1_ENST00000485760.1_Intron	NM_145243.3	NP_660286.1	Q96E52	OMA1_HUMAN	OMA1 zinc metallopeptidase	30					cristae formation (GO:0042407)|diet induced thermogenesis (GO:0002024)|energy homeostasis (GO:0097009)|glucose metabolic process (GO:0006006)|lipid metabolic process (GO:0006629)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|mitochondrial protein processing (GO:0034982)|negative regulation of mitochondrial fusion (GO:0010637)|response to stress (GO:0006950)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			NS(1)|breast(1)|large_intestine(6)|liver(2)|lung(6)|prostate(1)|skin(1)	18	all_cancers(7;6.54e-05)					TGGATGCTAATGTGTTACATT	0.403																																					p.T30T		.											.	OMA1-131	0			c.A90G						.						94.0	95.0	95.0					1																	59004877		2203	4300	6503	SO:0001819	synonymous_variant	115209	exon2			TGCTAATGTGTTA	AK091101	CCDS608.1	1p32.2-p32.1	2013-05-03	2013-05-03		ENSG00000162600	ENSG00000162600			29661	protein-coding gene	gene with protein product	"""overlapping activity with M-AAA protease"", ""zinc metallopeptidase OMA1"""		"""OMA1 zinc metallopeptidase homolog (S. cerevisiae)"""			12477932	Standard	NM_145243		Approved	MPRP-1, YKR087C, ZMPOMA1, FLJ33782	uc001cyy.3	Q96E52	OTTHUMG00000010068	ENST00000371226.3:c.90A>G	1.37:g.59004877T>C		Somatic	66	0		WXS	Illumina GAIIx	Phase_I	47	6	NM_145243	0	0	6	7	1	D3DQ54|Q5T3G6|Q5T3G7|Q5T3G8|Q5T3G9|Q5T3H0|Q8NBB3	Silent	SNP	ENST00000371226.3	37	CCDS608.1																																																																																			.		0.403	OMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027819.1	NM_145243	
SORT1	6272	bcgsc.ca	37	1	109884775	109884775	+	Silent	SNP	T	T	G	rs2228604	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr1:109884775T>G	ENST00000256637.6	-	9	1027	c.969A>C	c.(967-969)acA>acC	p.T323T	SORT1_ENST00000538502.1_Silent_p.T186T	NM_002959.5	NP_002950.3	Q99523	SORT_HUMAN	sortilin 1	323					endocytosis (GO:0006897)|endosome to lysosome transport (GO:0008333)|endosome transport via multivesicular body sorting pathway (GO:0032509)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose import (GO:0046323)|Golgi to endosome transport (GO:0006895)|multicellular organismal development (GO:0007275)|myotube differentiation (GO:0014902)|negative regulation of lipoprotein lipase activity (GO:0051005)|nerve growth factor signaling pathway (GO:0038180)|neuropeptide signaling pathway (GO:0007218)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|plasma membrane to endosome transport (GO:0048227)|regulation of gene expression (GO:0010468)|response to insulin (GO:0032868)|vesicle organization (GO:0016050)	cell surface (GO:0009986)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasmic membrane-bounded vesicle (GO:0016023)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network transport vesicle (GO:0030140)	enzyme binding (GO:0019899)|nerve growth factor binding (GO:0048406)|nerve growth factor receptor activity (GO:0010465)|neurotensin receptor activity, non-G-protein coupled (GO:0030379)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(5)|ovary(2)|prostate(1)|skin(1)	26		all_epithelial(167;4.69e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Lung(183;0.0529)|Colorectal(144;0.142)|Epithelial(280;0.145)|Kidney(133;0.169)|all cancers(265;0.184)		TCCTTCTTGTTGTATCCTAGA	0.428													T|||	3433	0.685503	0.3593	0.8271	5008	,	,		21426	0.9563		0.7127	False		,,,				2504	0.7188				p.T323T		.											.	SORT1-91	0			c.A969C						.	T	,	1850,2556	535.6+/-374.3	393,1064,746	99.0	80.0	87.0		558,969	-1.1	1.0	1	dbSNP_98	87	6253,2347	702.8+/-405.3	2277,1699,324	no	coding-synonymous,coding-synonymous	SORT1	NM_001205228.1,NM_002959.5	,	2670,2763,1070	GG,GT,TT		27.2907,41.9882,37.698	,	186/695,323/832	109884775	8103,4903	2203	4300	6503	SO:0001819	synonymous_variant	6272	exon9			TCTTGTTGTATCC	BC023542	CCDS798.1, CCDS55618.1	1p13.3	2008-05-14			ENSG00000134243	ENSG00000134243			11186	protein-coding gene	gene with protein product		602458					Standard	NM_002959		Approved	Gp95, NT3	uc001dxm.2	Q99523	OTTHUMG00000011999	ENST00000256637.6:c.969A>C	1.37:g.109884775T>G		Somatic	107	0		WXS	Illumina GAIIx	Phase_I	162	9	NM_002959	0	0	0	0	0	B4DWI3|C0JYZ0|Q8IZ49	Silent	SNP	ENST00000256637.6	37	CCDS798.1																																																																																			T|0.284;G|0.716		0.428	SORT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033179.1	NM_002959	
LCE1E	353135	ucsc.edu;bcgsc.ca	37	1	152760075	152760075	+	Silent	SNP	A	A	G	rs201660535	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr1:152760075A>G	ENST00000368770.3	+	2	353	c.300A>G	c.(298-300)tcA>tcG	p.S100S	LCE1E_ENST00000368771.1_Silent_p.S100S	NM_178353.1	NP_848130.1	Q5T753	LCE1E_HUMAN	late cornified envelope 1E	100	Cys-rich.				keratinization (GO:0031424)					lung(5)|stomach(1)	6	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCCAGCCCTCAGGGGGCTCCA	0.642													G|||	1333	0.266174	0.3654	0.2406	5008	,	,		14498	0.3313		0.1064	False		,,,				2504	0.2474				p.S100S		.											.	LCE1E-90	0			c.A300G						.	G		355,3853		89,177,1838	36.0	52.0	47.0		300	-4.6	0.5	1	dbSNP_132	47	177,8331		25,127,4102	no	coding-synonymous	LCE1E	NM_178353.1		114,304,5940	GG,GA,AA		2.0804,8.4363,4.1837		100/119	152760075	532,12184	2104	4254	6358	SO:0001819	synonymous_variant	353135	exon2			GCCCTCAGGGGGC	BC038391	CCDS1024.1	1q21.3	2008-02-05			ENSG00000186226	ENSG00000186226		"""Late cornified envelopes"""	29466	protein-coding gene	gene with protein product		612607				11698679	Standard	NM_178353		Approved	LEP5	uc001fan.3	Q5T753	OTTHUMG00000012405	ENST00000368770.3:c.300A>G	1.37:g.152760075A>G		Somatic	78	3		WXS	Illumina GAIIx	Phase_I	130	28	NM_178353	0	0	0	0	0	D3DV30	Silent	SNP	ENST00000368770.3	37	CCDS1024.1																																																																																			A|0.995;G|0.005		0.642	LCE1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034525.1	NM_178353	
ARHGAP30	257106	bcgsc.ca	37	1	161017556	161017556	+	Silent	SNP	C	C	T	rs2774279	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr1:161017556C>T	ENST00000368013.3	-	12	3575	c.3255G>A	c.(3253-3255)agG>agA	p.R1085R	USF1_ENST00000368020.1_5'Flank|USF1_ENST00000368021.3_5'Flank|USF1_ENST00000435396.1_5'Flank|ARHGAP30_ENST00000368016.3_Silent_p.R874R|ARHGAP30_ENST00000368015.1_Silent_p.R908R	NM_001025598.1|NM_181720.2	NP_001020769.1|NP_859071.2	Q7Z6I6	RHG30_HUMAN	Rho GTPase activating protein 30	1085					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)	GTPase activator activity (GO:0005096)			breast(2)|cervix(3)|endometrium(4)|kidney(2)|large_intestine(4)|lung(6)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	all_cancers(52;8.05e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00122)			ATGCATATGACCTGCGCTGAG	0.552													C|||	1093	0.218251	0.1422	0.2003	5008	,	,		20077	0.1389		0.333	False		,,,				2504	0.2975				p.R1085R		.											.	ARHGAP30-25	0			c.G3255A						.	C	,	846,3560	333.3+/-302.9	80,686,1437	87.0	87.0	87.0		3255,2622	-1.2	0.0	1	dbSNP_100	87	2856,5744	448.2+/-361.8	460,1936,1904	no	coding-synonymous,coding-synonymous	ARHGAP30	NM_001025598.1,NM_181720.2	,	540,2622,3341	TT,TC,CC		33.2093,19.2011,28.4638	,	1085/1102,874/891	161017556	3702,9304	2203	4300	6503	SO:0001819	synonymous_variant	257106	exon12			ATATGACCTGCGC	AL832852	CCDS1215.1, CCDS30918.1, CCDS72958.1	1q23.3	2011-06-29			ENSG00000186517	ENSG00000186517		"""Rho GTPase activating proteins"""	27414	protein-coding gene	gene with protein product		614264					Standard	NM_001287602		Approved	FLJ00267	uc001fxl.3	Q7Z6I6	OTTHUMG00000031477	ENST00000368013.3:c.3255G>A	1.37:g.161017556C>T		Somatic	95	0		WXS	Illumina GAIIx	Phase_I	93	5	NM_001025598	0	0	5	5	0	Q5SY52|Q5SY53|Q5SY54|Q6ZML6|Q7Z3J8|Q86XI7	Silent	SNP	ENST00000368013.3	37	CCDS30918.1																																																																																			C|0.752;T|0.248		0.552	ARHGAP30-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077090.2	NM_181720	
TOR3A	64222	hgsc.bcm.edu	37	1	179051300	179051300	+	Missense_Mutation	SNP	T	T	C	rs2296377	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr1:179051300T>C	ENST00000367627.3	+	1	789	c.37T>C	c.(37-39)Ttc>Ctc	p.F13L	TOR3A_ENST00000352445.6_Missense_Mutation_p.F13L	NM_022371.3	NP_071766.2	Q9H497	TOR3A_HUMAN	torsin family 3, member A	13			F -> L (in dbSNP:rs2296377). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|Ref.3}.		ATP catabolic process (GO:0006200)|chaperone mediated protein folding requiring cofactor (GO:0051085)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			endometrium(1)|kidney(2)|large_intestine(4)|lung(4)|pancreas(1)|urinary_tract(1)	13						TTGGCTCTTTTTCCTGCTGCT	0.751													C|||	3842	0.767173	0.9879	0.6441	5008	,	,		12722	0.6677		0.7117	False		,,,				2504	0.7157				p.F13L		.											.	TOR3A-90	0			c.T37C						.	C	LEU/PHE	3262,174		1547,168,3	2.0	3.0	3.0		37	-0.8	0.0	1	dbSNP_100	3	5365,1739		2051,1263,238	yes	missense	TOR3A	NM_022371.3	22	3598,1431,241	CC,CT,TT		24.4792,5.064,18.1499	benign	13/398	179051300	8627,1913	1718	3552	5270	SO:0001583	missense	64222	exon1			CTCTTTTTCCTGC	BC001085	CCDS1329.1	1q25.2	2008-02-05	2003-04-02		ENSG00000186283	ENSG00000186283			11997	protein-coding gene	gene with protein product		607555	"""ATP-dependant interferon responsive"""	ADIR		10644435	Standard	NM_022371		Approved	FLJ22345, ADIR2	uc001gmd.3	Q9H497	OTTHUMG00000035077	ENST00000367627.3:c.37T>C	1.37:g.179051300T>C	ENSP00000356599:p.Phe13Leu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_022371	0	0	0	0	0	B4DSY0|B7ZB65|Q5M7Y7|Q8WVA7|Q8WWM2|Q9H495|Q9H6E7	Missense_Mutation	SNP	ENST00000367627.3	37	CCDS1329.1	1679	0.7687728937728938	484	0.983739837398374	250	0.6906077348066298	393	0.6870629370629371	552	0.7282321899736148	C	0.033	-1.323382	0.01309	0.94936	0.755208	ENSG00000186283	ENST00000367627;ENST00000367625;ENST00000352445	T;T;T	0.35421	1.31;1.4;1.63	0.427	-0.794	0.10918	.	1.274350	0.05916	N	0.632520	T	0.00012	0.0000	N	0.00368	-1.59	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.45906	-0.9229	8	0.02654	T	1	-1.1524	.	.	.	rs2296377;rs17844883;rs17856371;rs17857600;rs17857917;rs17858479;rs59034332;rs2296377	13	Q9H497	TOR3A_HUMAN	L	13	ENSP00000356599:F13L;ENSP00000356597:F13L;ENSP00000335351:F13L	ENSP00000335351:F13L	F	+	1	0	TOR3A	177317923	0.000000	0.05858	0.002000	0.10522	0.004000	0.04260	-1.490000	0.02304	-1.608000	0.01587	-1.610000	0.00802	TTC	T|0.229;C|0.771		0.751	TOR3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084927.1	NM_022371	
CHIT1	1118	bcgsc.ca	37	1	203186947	203186947	+	Missense_Mutation	SNP	G	G	C	rs201682373	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr1:203186947G>C	ENST00000367229.1	-	10	1110	c.1076C>G	c.(1075-1077)gCa>gGa	p.A359G	CHIT1_ENST00000484834.1_5'UTR|CHIT1_ENST00000535569.1_Missense_Mutation_p.A350G|CHIT1_ENST00000255427.3_Missense_Mutation_p.A340G	NM_001270509.1|NM_003465.2	NP_001257438.1|NP_003456.1	Q13231	CHIT1_HUMAN	chitinase 1 (chitotriosidase)	359					chitin catabolic process (GO:0006032)|immune response (GO:0006955)|polysaccharide catabolic process (GO:0000272)|response to bacterium (GO:0009617)	extracellular space (GO:0005615)|lysosome (GO:0005764)	chitin binding (GO:0008061)|chitinase activity (GO:0004568)|endochitinase activity (GO:0008843)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(13)|ovary(1)|stomach(2)	27						TAAGTCCAGTGCCCAGACCAT	0.637																																					p.A359G		.											.	CHIT1-90	0			c.C1076G						.						60.0	52.0	55.0					1																	203186947		2203	4300	6503	SO:0001583	missense	1118	exon10			TCCAGTGCCCAGA	U29615	CCDS1436.1, CCDS58057.1	1q32.1	2013-06-06			ENSG00000133063	ENSG00000133063			1936	protein-coding gene	gene with protein product		600031				9748235, 9492324	Standard	NM_003465		Approved	CHIT, CHI3	uc001gzn.2	Q13231	OTTHUMG00000042126	ENST00000367229.1:c.1076C>G	1.37:g.203186947G>C	ENSP00000356198:p.Ala359Gly	Somatic	46	0		WXS	Illumina GAIIx	Phase_I	68	6	NM_003465	0	0	0	0	0	B3KNW6|J3KN09|Q0VGG5|Q0VGG6|Q3ZAR1|Q6ISC2|Q9H3V8|Q9UDJ8	Missense_Mutation	SNP	ENST00000367229.1	37	CCDS1436.1	.	.	.	.	.	.	.	.	.	.	G	7.873	0.728517	0.15507	.	.	ENSG00000133063	ENST00000367229;ENST00000255427;ENST00000535569	T;T;T	0.06068	3.35;3.35;3.35	4.57	0.302	0.15786	Chitinase II (1);Glycoside hydrolase, family 18, catalytic domain (1);Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.729039	0.11613	N	0.546569	T	0.10035	0.0246	M	0.85630	2.765	0.09310	N	1	B;B	0.27853	0.191;0.016	B;B	0.29176	0.099;0.04	T	0.34079	-0.9843	10	0.87932	D	0	-8.5687	2.2813	0.04115	0.1816:0.1509:0.5123:0.1553	.	350;359	G5EA51;Q13231	.;CHIT1_HUMAN	G	359;340;350	ENSP00000356198:A359G;ENSP00000255427:A340G;ENSP00000438078:A350G	ENSP00000255427:A340G	A	-	2	0	CHIT1	201453570	0.150000	0.22732	0.000000	0.03702	0.071000	0.16799	2.681000	0.46926	-0.144000	0.11314	0.563000	0.77884	GCA	G|0.988;C|0.012		0.637	CHIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000100275.2	NM_003465	
CHIT1	1118	bcgsc.ca	37	1	203186950	203186950	+	Nonsense_Mutation	SNP	C	C	T	rs201320385|rs3831317|rs150192398	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr1:203186950C>T	ENST00000367229.1	-	10	1107	c.1073G>A	c.(1072-1074)tGg>tAg	p.W358*	CHIT1_ENST00000484834.1_5'UTR|CHIT1_ENST00000535569.1_Nonsense_Mutation_p.W349*|CHIT1_ENST00000255427.3_Nonsense_Mutation_p.W339*	NM_001270509.1|NM_003465.2	NP_001257438.1|NP_003456.1	Q13231	CHIT1_HUMAN	chitinase 1 (chitotriosidase)	358					chitin catabolic process (GO:0006032)|immune response (GO:0006955)|polysaccharide catabolic process (GO:0000272)|response to bacterium (GO:0009617)	extracellular space (GO:0005615)|lysosome (GO:0005764)	chitin binding (GO:0008061)|chitinase activity (GO:0004568)|endochitinase activity (GO:0008843)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(13)|ovary(1)|stomach(2)	27						GTCCAGTGCCCAGACCATGGC	0.632																																					p.W358X		.											.	CHIT1-90	0			c.G1073A						.						60.0	52.0	54.0					1																	203186950		2203	4300	6503	SO:0001587	stop_gained	1118	exon10			AGTGCCCAGACCA	U29615	CCDS1436.1, CCDS58057.1	1q32.1	2013-06-06			ENSG00000133063	ENSG00000133063			1936	protein-coding gene	gene with protein product		600031				9748235, 9492324	Standard	NM_003465		Approved	CHIT, CHI3	uc001gzn.2	Q13231	OTTHUMG00000042126	ENST00000367229.1:c.1073G>A	1.37:g.203186950C>T	ENSP00000356198:p.Trp358*	Somatic	45	0		WXS	Illumina GAIIx	Phase_I	69	8	NM_003465	0	0	0	0	0	B3KNW6|J3KN09|Q0VGG5|Q0VGG6|Q3ZAR1|Q6ISC2|Q9H3V8|Q9UDJ8	Nonsense_Mutation	SNP	ENST00000367229.1	37	CCDS1436.1	.	.	.	.	.	.	.	.	.	.	C	19.93	3.918897	0.73098	.	.	ENSG00000133063	ENST00000367229;ENST00000255427;ENST00000535569	.	.	.	4.57	4.57	0.56435	.	0.000000	0.42053	D	0.000776	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.7042	15.2284	0.73369	0.0:1.0:0.0:0.0	.	.	.	.	X	358;339;349	.	ENSP00000255427:W339X	W	-	2	0	CHIT1	201453573	1.000000	0.71417	0.432000	0.26747	0.080000	0.17528	6.938000	0.75904	2.238000	0.73509	0.563000	0.77884	TGG	C|0.989;T|0.011		0.632	CHIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000100275.2	NM_003465	
RASSF5	83593	hgsc.bcm.edu	37	1	206681323	206681323	+	Silent	SNP	C	C	T	rs77707044	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr1:206681323C>T	ENST00000355294.4	+	1	445	c.388C>T	c.(388-390)Ctg>Ttg	p.L130L	RASSF5_ENST00000367117.3_Silent_p.L130L	NM_182663.2	NP_872604.1	Q8WWW0	RASF5_HUMAN	Ras association (RalGDS/AF-6) domain family member 5	130					apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|negative regulation of cell proliferation (GO:0008285)|positive regulation of protein ubiquitination (GO:0031398)|regulation of protein localization to nucleus (GO:1900180)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)	8	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.166)			CGAGTTGGTGCTGCCGGGCGG	0.721													c|||	173	0.0345447	0.1248	0.0115	5008	,	,		10930	0.0		0.0	False		,,,				2504	0.0				p.L130L	GBM(162;656 1984 11916 22872 31529)	.											.	RASSF5-660	0			c.C388T						.		,	352,3428		14,324,1552	6.0	6.0	6.0		388,388	3.8	0.3	1	dbSNP_131	6	1,7483		0,1,3741	no	coding-synonymous,coding-synonymous	RASSF5	NM_182663.2,NM_182664.2	,	14,325,5293	TT,TC,CC		0.0134,9.3122,3.1339	,	130/419,130/337	206681323	353,10911	1890	3742	5632	SO:0001819	synonymous_variant	83593	exon1			TTGGTGCTGCCGG	BC004270	CCDS1463.1, CCDS1464.1, CCDS30998.1	1q31	2014-04-10	2008-02-22		ENSG00000136653	ENSG00000266094			17609	protein-coding gene	gene with protein product		607020				11978988, 11965544	Standard	NM_182663		Approved	Maxp1, NORE1, RAPL	uc001hed.3	Q8WWW0	OTTHUMG00000184616	ENST00000355294.4:c.388C>T	1.37:g.206681323C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	33	24	NM_182663	0	0	0	0	0	A8K1E6|Q5SY32|Q8WWV9|Q8WXF4|Q9BT99	Silent	SNP	ENST00000355294.4	37	CCDS30998.1																																																																																			C|0.970;T|0.030		0.721	RASSF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088469.1	NM_031437	
CENPF	1063	broad.mit.edu	37	1	214818291	214818291	+	Missense_Mutation	SNP	G	G	A	rs143725699	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr1:214818291G>A	ENST00000366955.3	+	13	5546	c.5378G>A	c.(5377-5379)cGt>cAt	p.R1793H		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	1889					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)			NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		ATAGAGGACCGTGACAGAAAA	0.358													G|||	4	0.000798722	0.0	0.0029	5008	,	,		20325	0.0		0.002	False		,,,				2504	0.0				p.R1793H	Colon(80;575 1284 11000 14801 43496)	.											.	CENPF-567	0			c.G5378A						.	G	HIS/ARG	4,4402	8.1+/-20.4	0,4,2199	38.0	40.0	39.0		5378	2.5	0.8	1	dbSNP_134	39	26,8574	17.9+/-57.8	0,26,4274	yes	missense	CENPF	NM_016343.3	29	0,30,6473	AA,AG,GG		0.3023,0.0908,0.2307	benign	1793/3115	214818291	30,12976	2203	4300	6503	SO:0001583	missense	1063	exon13			AGGACCGTGACAG	U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.5378G>A	1.37:g.214818291G>A	ENSP00000355922:p.Arg1793His	Somatic	102	0		WXS	Illumina GAIIx	Phase_I	111	4	NM_016343	0	0	0	0	0	Q13171|Q13246|Q5VVM7	Missense_Mutation	SNP	ENST00000366955.3	37	CCDS31023.1	4	0.0018315018315018315	0	0.0	2	0.0055248618784530384	0	0.0	2	0.002638522427440633	G	8.861	0.947055	0.18356	9.08E-4	0.003023	ENSG00000117724	ENST00000366955	T	0.03242	4.0	5.56	2.51	0.30379	.	0.551000	0.14154	N	0.337826	T	0.02727	0.0082	L	0.60455	1.87	0.09310	N	1	B	0.15719	0.014	B	0.08055	0.003	T	0.48091	-0.9065	10	0.13108	T	0.6	.	6.0743	0.19907	0.3165:0.1246:0.5589:0.0	.	1889	P49454	CENPF_HUMAN	H	1793	ENSP00000355922:R1793H	ENSP00000355922:R1793H	R	+	2	0	CENPF	212884914	0.017000	0.18338	0.777000	0.31699	0.604000	0.37047	0.898000	0.28404	0.229000	0.21039	0.609000	0.83330	CGT	G|0.998;A|0.002		0.358	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089749.1	NM_016343	
C1orf229	388759	hgsc.bcm.edu	37	1	247275218	247275218	+	Silent	SNP	C	C	G	rs141557009	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr1:247275218C>G	ENST00000408893.2	-	1	501	c.309G>C	c.(307-309)gcG>gcC	p.A103A		NM_207401.1	NP_997284.1	Q6ZS94	CA229_HUMAN	chromosome 1 open reading frame 229	103																	AGCGCGAGGCCGCAGCGGGGA	0.736													C|||	180	0.0359425	0.0522	0.0245	5008	,	,		9692	0.001		0.0398	False		,,,				2504	0.0542				p.A103A		.											.	C1orf229-90	0			c.G309C						.	C		93,2869		0,93,1388	2.0	2.0	2.0		309	-0.7	0.2	1	dbSNP_134	2	197,6065		0,197,2934	no	coding-synonymous	C1orf229	NM_207401.1		0,290,4322	GG,GC,CC		3.146,3.1398,3.144		103/238	247275218	290,8934	1481	3131	4612	SO:0001819	synonymous_variant	388759	exon1			CGAGGCCGCAGCG	BC156415	CCDS1630.1	1q44	2012-05-30			ENSG00000221953	ENSG00000221953			33759	protein-coding gene	gene with protein product							Standard	NM_207401		Approved	FLJ45717	uc001icg.1	Q6ZS94	OTTHUMG00000165196	ENST00000408893.2:c.309G>C	1.37:g.247275218C>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	5	NM_207401	0	0	0	0	0		Silent	SNP	ENST00000408893.2	37	CCDS1630.1																																																																																			C|0.971;G|0.029		0.736	C1orf229-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382614.1	NM_207401	
TRIM58	25893	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	248039251	248039251	+	Silent	SNP	C	C	T	rs201527424	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr1:248039251C>T	ENST00000366481.3	+	6	969	c.921C>T	c.(919-921)acC>acT	p.T307T	OR2W3_ENST00000537741.1_5'UTR	NM_015431.3	NP_056246.3	Q8NG06	TRI58_HUMAN	tripartite motif containing 58	307	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(39)|ovary(4)|pancreas(1)|skin(7)|stomach(1)	63	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0286)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			TGCTCTTGACCGCCGACCTGC	0.572																																					p.T307T		.											.	TRIM58-96	0			c.C921T						.						76.0	71.0	73.0					1																	248039251		2203	4300	6503	SO:0001819	synonymous_variant	25893	exon6			CTTGACCGCCGAC	AF327057	CCDS1636.1	1q44	2013-01-09	2011-01-25		ENSG00000162722	ENSG00000162722		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	24150	protein-coding gene	gene with protein product			"""tripartite motif-containing 58"""				Standard	NM_015431		Approved	BIA2	uc001ido.3	Q8NG06	OTTHUMG00000040203	ENST00000366481.3:c.921C>T	1.37:g.248039251C>T		Somatic	94	0		WXS	Illumina GAIIx	Phase_I	126	35	NM_015431	0	0	0	0	0	Q6B0H9	Silent	SNP	ENST00000366481.3	37	CCDS1636.1																																																																																			C|1.000;G|0.000		0.572	TRIM58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096860.1	NM_015431	
OR2M5	127059	broad.mit.edu	37	1	248308612	248308612	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr1:248308612C>T	ENST00000366476.1	+	1	163	c.163C>T	c.(163-165)Ctc>Ttc	p.L55F		NM_001004690.1	NP_001004690.1	A3KFT3	OR2M5_HUMAN	olfactory receptor, family 2, subfamily M, member 5	55						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(5)|kidney(2)|large_intestine(7)|liver(1)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	49	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0388)			GGACACCCAGCTCCACACCCC	0.532																																					p.L55F		.											.	OR2M5-71	0			c.C163T						.						311.0	295.0	301.0					1																	248308612		2203	4300	6503	SO:0001583	missense	127059	exon1			ACCCAGCTCCACA		CCDS31105.1	1q44	2012-08-09		2004-03-10	ENSG00000162727	ENSG00000162727		"""GPCR / Class A : Olfactory receptors"""	19576	protein-coding gene	gene with protein product				OR2M5P			Standard	NM_001004690		Approved		uc010pze.2	A3KFT3	OTTHUMG00000040447	ENST00000366476.1:c.163C>T	1.37:g.248308612C>T	ENSP00000355432:p.Leu55Phe	Somatic	280	0		WXS	Illumina GAIIx	Phase_I	333	7	NM_001004690	0	0	0	0	0		Missense_Mutation	SNP	ENST00000366476.1	37	CCDS31105.1	.	.	.	.	.	.	.	.	.	.	c	10.75	1.439197	0.25900	.	.	ENSG00000162727	ENST00000366476	T	0.14391	2.51	3.28	0.15	0.14883	GPCR, rhodopsin-like superfamily (1);	0.000000	0.29328	U	0.012477	T	0.41190	0.1148	M	0.93939	3.475	0.21861	N	0.999506	D	0.89917	1.0	D	0.91635	0.999	T	0.24440	-1.0160	10	0.87932	D	0	.	8.0815	0.30748	0.0:0.7112:0.0:0.2888	.	55	A3KFT3	OR2M5_HUMAN	F	55	ENSP00000355432:L55F	ENSP00000355432:L55F	L	+	1	0	OR2M5	246375235	0.556000	0.26538	0.002000	0.10522	0.007000	0.05969	1.167000	0.31847	-0.232000	0.09811	-0.326000	0.08463	CTC	.		0.532	OR2M5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097343.1	NM_001004690	
PCDH15	65217	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	55582281	55582281	+	Silent	SNP	G	G	A			TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr10:55582281G>A	ENST00000320301.6	-	33	5599	c.5205C>T	c.(5203-5205)gcC>gcT	p.A1735A	PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000395430.1_Silent_p.A1732A|PCDH15_ENST00000373965.2_Intron|PCDH15_ENST00000437009.1_Silent_p.A1666A|PCDH15_ENST00000395445.1_Intron|PCDH15_ENST00000414778.1_Intron|PCDH15_ENST00000395432.2_Silent_p.A1695A|PCDH15_ENST00000361849.3_Silent_p.A1737A|PCDH15_ENST00000395446.1_Intron|PCDH15_ENST00000395433.1_Silent_p.A1712A|PCDH15_ENST00000395438.1_Intron|PCDH15_ENST00000409834.1_Intron|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000463095.1_5'UTR|PCDH15_ENST00000373957.3_Intron	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	1735					equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)	p.A1735A(2)|p.A1742A(1)		NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				TTGGTGGATGGGCAAAATTTT	0.463										HNSCC(58;0.16)																											p.A1742A		.											.	PCDH15-193	3	Substitution - coding silent(3)	large_intestine(2)|lung(1)	c.C5226T						.						35.0	36.0	36.0					10																	55582281		2203	4299	6502	SO:0001819	synonymous_variant	65217	exon35			TGGATGGGCAAAA	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.5205C>T	10.37:g.55582281G>A		Somatic	49	0		WXS	Illumina GAIIx	Phase_I	45	10	NM_001142763	0	0	0	0	0	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Silent	SNP	ENST00000320301.6	37	CCDS7248.1																																																																																			.		0.463	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	NM_033056	
WDR11	55717	broad.mit.edu;ucsc.edu	37	10	122643301	122643301	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr10:122643301G>T	ENST00000263461.6	+	14	1995	c.1749G>T	c.(1747-1749)ttG>ttT	p.L583F	WDR11_ENST00000604509.1_3'UTR	NM_018117.11	NP_060587.8	Q8WWQ0	PHIP_HUMAN	WD repeat domain 11	240					cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(9)|prostate(2)|skin(2)|stomach(5)	38						GGCAGTATTTGGCAGTCGTAT	0.348																																					p.L583F		.											.	WDR11-226	0			c.G1749T						.						98.0	94.0	95.0					10																	122643301		2203	4300	6503	SO:0001583	missense	55717	exon14			GTATTTGGCAGTC	AF320223	CCDS7619.1	10q26	2013-01-21	2010-01-06	2010-01-06	ENSG00000120008	ENSG00000120008		"""WD repeat domain containing"""	13831	protein-coding gene	gene with protein product		606417	"""bromodomain and WD repeat domain containing 2"""	BRWD2		10718198, 11536051	Standard	NM_018117		Approved	KIAA1351, FLJ10506, WDR15, HH14, DR11	uc021pzt.1	Q9BZH6	OTTHUMG00000019171	ENST00000263461.6:c.1749G>T	10.37:g.122643301G>T	ENSP00000263461:p.Leu583Phe	Somatic	52	0		WXS	Illumina GAIIx	Phase_I	47	4	NM_018117	0	0	0	0	0	A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	Missense_Mutation	SNP	ENST00000263461.6	37	CCDS7619.1	.	.	.	.	.	.	.	.	.	.	G	7.150	0.583612	0.13749	.	.	ENSG00000120008	ENST00000263461	T	0.58060	0.36	5.86	4.02	0.46733	WD40/YVTN repeat-like-containing domain (1);	0.070780	0.64402	D	0.000019	T	0.37732	0.1014	N	0.17082	0.46	0.58432	D	0.999999	P;P;B	0.41313	0.745;0.745;0.061	B;B;B	0.42959	0.403;0.403;0.069	T	0.08700	-1.0709	10	0.27082	T	0.32	-7.9307	10.512	0.44868	0.2235:0.0:0.7765:0.0	.	583;583;112	Q9BZH6;B2RCJ6;Q659C9	WDR11_HUMAN;.;.	F	583	ENSP00000263461:L583F	ENSP00000263461:L583F	L	+	3	2	WDR11	122633291	1.000000	0.71417	1.000000	0.80357	0.295000	0.27426	5.165000	0.64959	0.821000	0.34540	-0.157000	0.13467	TTG	.		0.348	WDR11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050707.2		
FGFR2	2263	broad.mit.edu	37	10	123239112	123239112	+	3'UTR	SNP	G	G	A	rs1047057	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr10:123239112G>A	ENST00000358487.5	-	0	2997				FGFR2_ENST00000357555.5_Silent_p.L703L|FGFR2_ENST00000356226.4_3'UTR|FGFR2_ENST00000369060.4_3'UTR|FGFR2_ENST00000369061.4_3'UTR|FGFR2_ENST00000478859.1_3'UTR	NM_000141.4	NP_000132.3	P21802	FGFR2_HUMAN	fibroblast growth factor receptor 2						angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axonogenesis (GO:0007409)|bone development (GO:0060348)|bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|branch elongation involved in salivary gland morphogenesis (GO:0060667)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|branching involved in prostate gland morphogenesis (GO:0060442)|branching involved in salivary gland morphogenesis (GO:0060445)|branching morphogenesis of a nerve (GO:0048755)|bud elongation involved in lung branching (GO:0060449)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|coronal suture morphogenesis (GO:0060365)|digestive tract development (GO:0048565)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic organ development (GO:0048568)|embryonic organ morphogenesis (GO:0048562)|embryonic pattern specification (GO:0009880)|endodermal digestive tract morphogenesis (GO:0061031)|epidermal growth factor receptor signaling pathway (GO:0007173)|epidermis morphogenesis (GO:0048730)|epithelial cell differentiation (GO:0030855)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|epithelial to mesenchymal transition (GO:0001837)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|fibroblast growth factor receptor signaling pathway involved in hemopoiesis (GO:0035603)|fibroblast growth factor receptor signaling pathway involved in mammary gland specification (GO:0060595)|fibroblast growth factor receptor signaling pathway involved in negative regulation of apoptotic process in bone marrow (GO:0035602)|fibroblast growth factor receptor signaling pathway involved in orbitofrontal cortex development (GO:0035607)|fibroblast growth factor receptor signaling pathway involved in positive regulation of cell proliferation in bone marrow (GO:0035604)|gland morphogenesis (GO:0022612)|hair follicle morphogenesis (GO:0031069)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|insulin receptor signaling pathway (GO:0008286)|lacrimal gland development (GO:0032808)|lateral sprouting from an epithelium (GO:0060601)|lens fiber cell development (GO:0070307)|limb bud formation (GO:0060174)|lung alveolus development (GO:0048286)|lung development (GO:0030324)|lung lobe morphogenesis (GO:0060463)|lung-associated mesenchyme development (GO:0060484)|mammary gland bud formation (GO:0060615)|membranous septum morphogenesis (GO:0003149)|mesenchymal cell differentiation (GO:0048762)|mesenchymal cell differentiation involved in lung development (GO:0060915)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesodermal cell differentiation (GO:0048333)|midbrain development (GO:0030901)|morphogenesis of embryonic epithelium (GO:0016331)|multicellular organism growth (GO:0035264)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitosis (GO:0045839)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis (GO:0042476)|orbitofrontal cortex development (GO:0021769)|organ growth (GO:0035265)|organ morphogenesis (GO:0009887)|otic vesicle formation (GO:0030916)|outflow tract septum morphogenesis (GO:0003148)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|post-embryonic development (GO:0009791)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|prostate epithelial cord elongation (GO:0060523)|prostate gland morphogenesis (GO:0060512)|protein autophosphorylation (GO:0046777)|pyramidal neuron development (GO:0021860)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of cell fate commitment (GO:0010453)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of morphogenesis of a branching structure (GO:0060688)|regulation of multicellular organism growth (GO:0040014)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoblast proliferation (GO:0033688)|regulation of smooth muscle cell differentiation (GO:0051150)|regulation of smoothened signaling pathway (GO:0008589)|reproductive structure development (GO:0048608)|skeletal system morphogenesis (GO:0048705)|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development (GO:0060529)|synaptic vesicle transport (GO:0048489)|ureteric bud development (GO:0001657)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|ventricular zone neuroblast division (GO:0021847)	cell cortex (GO:0005938)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|excitatory synapse (GO:0060076)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)	p.L703L(1)		breast(3)|central_nervous_system(3)|cervix(2)|endometrium(98)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(7)|lung(21)|ovary(4)|skin(30)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(2)	181		Lung NSC(174;0.0841)|all_lung(145;0.106)|all_neural(114;0.107)	STAD - Stomach adenocarcinoma(1;7.52e-05)|all cancers(1;0.0722)	all cancers(201;9.73e-05)|GBM - Glioblastoma multiforme(135;0.0845)	Palifermin(DB00039)|Ponatinib(DB08901)|Regorafenib(DB08896)|Thalidomide(DB01041)	TCCACAGCCAGTACGCACGGC	0.483		5	Mis		"""gastric. NSCLC, endometrial"""		"""Crouzon, Pfeiffer, and Apert syndromes"""		Saethre-Chotzen syndrome;Apert syndrome				G|||	2075	0.414337	0.0938	0.6873	5008	,	,		15689	0.3512		0.5099	False		,,,				2504	0.6207				p.L703L		.		Dom	yes		10	10q26	2263	fibroblast growth factor receptor 2	yes	E	.	FGFR2-2607	1	Substitution - coding silent(1)	stomach(1)	c.C2107T						.	G	,,,,,,	237,1147		19,199,474	86.0	84.0	85.0		,,2107,,,,	4.5	0.9	10	dbSNP_86	85	1747,1435		500,747,344	no	utr-3,utr-3,coding-synonymous,utr-3,utr-3,utr-3,utr-3	FGFR2	NM_000141.4,NM_001144914.1,NM_001144915.1,NM_001144916.1,NM_001144917.1,NM_001144918.1,NM_022970.3	,,,,,,	519,946,818	AA,AG,GG		45.0974,17.1243,43.4516	,,,,,,	,,703/708,,,,	123239112	1984,2582	692	1591	2283	SO:0001624	3_prime_UTR_variant	2263	exon17	Familial Cancer Database	Acrocephalosyndactyly type III;Acrocephalosyndactyly type I and II, ACS1. ACS2, incl Apert-Crouzon s.	CAGCCAGTACGCA	AK026508	CCDS7620.2, CCDS31298.1, CCDS44485.1, CCDS44486.1, CCDS44487.1, CCDS44488.1, CCDS44489.1, CCDS53584.1, CCDS73210.1	10q25.3-q26	2013-01-11	2008-08-01		ENSG00000066468	ENSG00000066468		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3689	protein-coding gene	gene with protein product	"""Crouzon syndrome"", ""Pfeiffer syndrome"""	176943	"""bacteria-expressed kinase"", ""keratinocyte growth factor receptor"", ""craniofacial dysostosis 1"", ""Jackson-Weiss syndrome"""	KGFR, BEK, CFD1, JWS			Standard	NM_022970		Approved	CEK3, TK14, TK25, ECT1, K-SAM, CD332	uc021pzy.1	P21802	OTTHUMG00000019175	ENST00000358487.5:c.*259C>T	10.37:g.123239112G>A		Somatic	92	0		WXS	Illumina GAIIx	Phase_I	103	3	NM_001144915	0	0	4	4	0	B4DFC2|E7EVR6|E9PCR0|P18443|Q01742|Q12922|Q14300|Q14301|Q14302|Q14303|Q14304|Q14305|Q14672|Q14718|Q14719|Q1KHY5|Q86YI4|Q8IXC7|Q96KL9|Q96KM0|Q96KM1|Q96KM2|Q9NZU2|Q9NZU3|Q9UD01|Q9UD02|Q9UIH3|Q9UIH4|Q9UIH5|Q9UIH6|Q9UIH7|Q9UIH8|Q9UM87|Q9UMC6|Q9UNS7|Q9UQH7|Q9UQH8|Q9UQH9|Q9UQI0	Silent	SNP	ENST00000358487.5	37	CCDS31298.1																																																																																			G|0.609;A|0.391		0.483	FGFR2-001	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000050715.1	NM_022976, NM_000141	
PTPRE	5791	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	129839226	129839226	+	Silent	SNP	C	C	T			TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr10:129839226C>T	ENST00000254667.3	+	3	360	c.81C>T	c.(79-81)gcC>gcT	p.A27A	PTPRE_ENST00000419012.2_Silent_p.A27A|PTPRE_ENST00000471218.1_Silent_p.A27A|PTPRE_ENST00000430713.2_Silent_p.A27A	NM_006504.4	NP_006495.1	P23469	PTPRE_HUMAN	protein tyrosine phosphatase, receptor type, E	27					negative regulation of insulin receptor signaling pathway (GO:0046627)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of mast cell activation (GO:0033003)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	22		all_epithelial(44;1.66e-05)|all_lung(145;0.00456)|Lung NSC(174;0.0066)|all_neural(114;0.0936)|Colorectal(57;0.141)|Breast(234;0.166)|Melanoma(40;0.203)			Alendronate(DB00630)	AGACCACTGCCGACAGCAACG	0.607																																					p.A27A	Colon(52;977 1184 20575 41685)	.											.	PTPRE-227	0			c.C81T						.						99.0	79.0	86.0					10																	129839226		2203	4300	6503	SO:0001819	synonymous_variant	5791	exon3			CACTGCCGACAGC	AF406557	CCDS7657.1, CCDS7658.1	10q26	2011-06-09			ENSG00000132334	ENSG00000132334		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9669	protein-coding gene	gene with protein product		600926				8595895	Standard	NM_130435		Approved	PTPE	uc001lkb.3	P23469	OTTHUMG00000019254	ENST00000254667.3:c.81C>T	10.37:g.129839226C>T		Somatic	183	0		WXS	Illumina GAIIx	Phase_I	168	9	NM_006504	0	0	0	0	0	Q13345|Q5VWH3|Q5VWH4|Q96KQ6	Silent	SNP	ENST00000254667.3	37	CCDS7657.1	.	.	.	.	.	.	.	.	.	.	C	0.273	-0.991689	0.02162	.	.	ENSG00000132334	ENST00000439034	.	.	.	4.52	-9.04	0.00734	.	.	.	.	.	T	0.20007	0.0481	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.27673	-1.0067	5	0.36615	T	0.2	.	2.9457	0.05845	0.1676:0.4026:0.0756:0.3541	.	.	.	.	L	41	.	ENSP00000415807:P41L	P	+	2	0	PTPRE	129729216	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-6.027000	0.00085	-1.490000	0.01842	-1.999000	0.00445	CCG	.		0.607	PTPRE-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050990.1		
CTSD	1509	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	1778638	1778638	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr11:1778638G>A	ENST00000236671.2	-	5	752	c.620C>T	c.(619-621)tCc>tTc	p.S207F	RP11-295K3.1_ENST00000427721.1_Missense_Mutation_p.P78S|AC068580.6_ENST00000449248.1_RNA	NM_001909.4	NP_001900.1	P07339	CATD_HUMAN	cathepsin D	207					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|autophagic vacuole assembly (GO:0000045)|cell death (GO:0008219)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|mitochondrion (GO:0005739)	aspartic-type endopeptidase activity (GO:0004190)			endometrium(1)|large_intestine(4)|lung(8)	13		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0684)|LUSC - Lung squamous cell carcinoma(625;0.0822)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	GTTGTTGACGGAGATGCGGGG	0.597																																					p.S207F		.											.	CTSD-90	0			c.C620T						.						191.0	124.0	147.0					11																	1778638		2202	4299	6501	SO:0001583	missense	1509	exon5			TTGACGGAGATGC	M11233	CCDS7725.1	11p15.5	2009-06-26	2006-12-05		ENSG00000117984	ENSG00000117984	3.4.23.5	"""Cathepsins"""	2529	protein-coding gene	gene with protein product	"""ceroid-lipofuscinosis, neuronal 10"""	116840	"""cathepsin D (lysosomal aspartyl protease)"""	CPSD		3927292	Standard	NM_001909		Approved	CLN10	uc001luc.2	P07339	OTTHUMG00000044760	ENST00000236671.2:c.620C>T	11.37:g.1778638G>A	ENSP00000236671:p.Ser207Phe	Somatic	146	0		WXS	Illumina GAIIx	Phase_I	251	25	NM_001909	0	2	1770	1982	210	Q6IB57	Missense_Mutation	SNP	ENST00000236671.2	37	CCDS7725.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	22.1|22.1	4.239075|4.239075	0.79800|0.79800	.|.	.|.	ENSG00000250644|ENSG00000117984	ENST00000427721|ENST00000236671;ENST00000438213;ENST00000367196	.|T;T;T	.|0.65178	.|-0.14;0.21;0.01	4.11|4.11	4.11|4.11	0.48088|0.48088	.|Peptidase aspartic (1);Peptidase aspartic, catalytic (1);	.|0.241522	.|0.43110	.|D	.|0.000605	D|D	0.87803|0.87803	0.6269|0.6269	H|H	0.99238|0.99238	4.48|4.48	0.80722|0.80722	D|D	1|1	.|D	.|0.76494	.|0.999	.|D	.|0.77557	.|0.99	D|D	0.93421|0.93421	0.6777|0.6777	5|10	.|0.87932	.|D	.|0	.|.	16.5345|16.5345	0.84369|0.84369	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|207	.|P07339	.|CATD_HUMAN	S|F	78|207;192;172	.|ENSP00000236671:S207F;ENSP00000415036:S192F;ENSP00000356164:S172F	.|ENSP00000236671:S207F	P|S	-|-	1|2	0|0	RP11-295K3.1|CTSD	1735214|1735214	1.000000|1.000000	0.71417|0.71417	0.942000|0.942000	0.38095|0.38095	0.633000|0.633000	0.38033|0.38033	8.532000|8.532000	0.90613|0.90613	2.129000|2.129000	0.65627|0.65627	0.472000|0.472000	0.43445|0.43445	CCG|TCC	.		0.597	CTSD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104272.5	NM_001909	
OR56B1	387748	bcgsc.ca	37	11	5758051	5758051	+	Missense_Mutation	SNP	G	G	A	rs75758940	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr11:5758051G>A	ENST00000317121.3	+	1	371	c.305G>A	c.(304-306)aGc>aAc	p.S102N	TRIM5_ENST00000380027.1_Intron	NM_001005180.2	NP_001005180.1	Q8NGI3	O56B1_HUMAN	olfactory receptor, family 56, subfamily B, member 1	102						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(7)|prostate(1)|skin(1)	13		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.086)		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.184)		AAGGTTATTAGCCTCCCTGAG	0.448													G|||	97	0.019369	0.0	0.0922	5008	,	,		21787	0.0298		0.001	False		,,,				2504	0.002				p.S102N		.											.	OR56B1-69	0			c.G305A						.	G	ASN/SER	3,4399	6.2+/-15.9	0,3,2198	177.0	157.0	164.0		305	5.0	0.8	11	dbSNP_131	164	10,8584	7.1+/-27.0	0,10,4287	yes	missense	OR56B1	NM_001005180.2	46	0,13,6485	AA,AG,GG		0.1164,0.0682,0.1	possibly-damaging	102/325	5758051	13,12983	2201	4297	6498	SO:0001583	missense	387748	exon1			TTATTAGCCTCCC	BK004386	CCDS31395.1	11p15.4	2012-08-09		2004-03-10	ENSG00000181023	ENSG00000181023		"""GPCR / Class A : Olfactory receptors"""	15245	protein-coding gene	gene with protein product				OR56B1P			Standard	NM_001005180		Approved		uc001mbt.2	Q8NGI3	OTTHUMG00000066891	ENST00000317121.3:c.305G>A	11.37:g.5758051G>A	ENSP00000322939:p.Ser102Asn	Somatic	120	1		WXS	Illumina GAIIx	Phase_I	127	7	NM_001005180	0	0	0	0	0	B2RNY6|B3KV42|Q6IF76	Missense_Mutation	SNP	ENST00000317121.3	37	CCDS31395.1	46	0.021062271062271064	0	0.0	29	0.08011049723756906	16	0.027972027972027972	1	0.0013192612137203166	G	13.27	2.187142	0.38609	6.82E-4	0.001164	ENSG00000181023	ENST00000317121	T	0.00737	5.76	5.91	4.99	0.66335	GPCR, rhodopsin-like superfamily (1);	0.000000	0.53938	U	0.000060	T	0.00144	0.0004	M	0.90814	3.15	0.25401	N	0.988445	B	0.24043	0.096	B	0.27170	0.077	T	0.28839	-1.0031	10	0.29301	T	0.29	-13.4881	13.4681	0.61268	0.0:0.2995:0.7005:0.0	.	102	Q8NGI3	O56B1_HUMAN	N	102	ENSP00000322939:S102N	ENSP00000322939:S102N	S	+	2	0	OR56B1	5714627	0.001000	0.12720	0.819000	0.32651	0.741000	0.42261	1.117000	0.31234	1.495000	0.48549	0.655000	0.94253	AGC	G|0.992;A|0.008		0.448	OR56B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143354.1	NM_001005180	
WT1	7490	hgsc.bcm.edu	37	11	32456694	32456694	+	Silent	SNP	C	C	A	rs2234582	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr11:32456694C>A	ENST00000332351.3	-	1	482	c.198G>T	c.(196-198)ccG>ccT	p.P66P	WT1-AS_ENST00000459866.1_RNA|WT1-AS_ENST00000525436.1_RNA|WT1-AS_ENST00000426618.2_RNA|WT1-AS_ENST00000494911.1_RNA|WT1-AS_ENST00000395900.1_RNA|WT1-AS_ENST00000478367.1_RNA|WT1_ENST00000448076.3_Silent_p.P66P	NM_024424.3|NM_024426.4	NP_077742.2|NP_077744	P19544	WT1_HUMAN	Wilms tumor 1	0	Pro-rich.				adrenal cortex formation (GO:0035802)|adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye development (GO:0043010)|cardiac muscle cell fate commitment (GO:0060923)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|diaphragm development (GO:0060539)|epithelial cell differentiation (GO:0030855)|germ cell development (GO:0007281)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|gonad development (GO:0008406)|heart development (GO:0007507)|kidney development (GO:0001822)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|mesenchymal to epithelial transition (GO:0060231)|metanephric epithelium development (GO:0072207)|metanephric mesenchyme development (GO:0072075)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of female gonad development (GO:2000195)|negative regulation of metanephric glomerular mesangial cell proliferation (GO:0072302)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of heart growth (GO:0060421)|positive regulation of male gonad development (GO:2000020)|positive regulation of metanephric ureteric bud development (GO:2001076)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior mesonephric tubule development (GO:0072166)|regulation of organ formation (GO:0003156)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|sex determination (GO:0007530)|thorax and anterior abdomen determination (GO:0007356)|tissue development (GO:0009888)|ureteric bud development (GO:0001657)|vasculogenesis (GO:0001570)|visceral serous pericardium development (GO:0061032)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)		EWSR1/WT1(234)	NS(1)|haematopoietic_and_lymphoid_tissue(348)|kidney(149)|large_intestine(9)|lung(20)|peritoneum(1)|pleura(2)|skin(2)|upper_aerodigestive_tract(1)	533	Breast(20;0.247)		OV - Ovarian serous cystadenocarcinoma(30;0.128)			CCATTTGCTGCGGCTCAGACC	0.761			"""D, Mis, N, F, S"""	EWSR1	"""Wilms, desmoplastic small round cell tumor"""	Wilms			Wilms' tumor-Aniridia-ambiguous Genitals-mental Retardation;Frasier syndrome;Familial Wilms' tumor;Denys-Drash syndrome				C|||	1511	0.301717	0.6604	0.1556	5008	,	,		5831	0.0675		0.1839	False		,,,				2504	0.2832				p.P66P		.	yes	Rec	yes	"""Denys-Drash syndrome, Frasier syndrome, Familial Wilms tumor"""	11	11p13	7490	Wilms tumour 1 gene		O	.	WT1-6891	0			c.G198T						.	C	,,	1567,1733		420,727,503	2.0	3.0	3.0		198,198,198	1.2	0.0	11	dbSNP_98	3	1360,5576		235,890,2343	no	coding-synonymous,coding-synonymous,coding-synonymous	WT1	NM_000378.4,NM_024424.3,NM_024426.4	,,	655,1617,2846	AA,AC,CC		19.6078,47.4848,28.5952	,,	66/498,66/515,66/518	32456694	2927,7309	1650	3468	5118	SO:0001819	synonymous_variant	7490	exon1	Familial Cancer Database	WAGR syndrome; ; ;incl.: Early Onset Nephrotic Syndrome-WT1 associated	TTGCTGCGGCTCA		CCDS7878.2, CCDS44561.1, CCDS44562.1, CCDS55750.1, CCDS55751.1	11p13	2014-09-17			ENSG00000184937	ENSG00000184937		"""Zinc fingers, C2H2-type"""	12796	protein-coding gene	gene with protein product		607102		GUD		14681303	Standard	NM_024424		Approved	WAGR, WIT-2, AWT1	uc001mtn.2	P19544	OTTHUMG00000039556	ENST00000332351.3:c.198G>T	11.37:g.32456694C>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_024424	0	0	0	0	0	A8K6S1|B3KSA5|Q15881|Q16256|Q16575|Q4VXV4|Q4VXV5|Q4VXV6|Q8IYZ5	Silent	SNP	ENST00000332351.3	37	CCDS7878.2																																																																																			C|0.748;A|0.252		0.761	WT1-001	KNOWN	non_ATG_start|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000095436.2	NM_000378	
AMBRA1	55626	hgsc.bcm.edu	37	11	46419411	46419411	+	Silent	SNP	G	G	A	rs12295608	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr11:46419411G>A	ENST00000458649.2	-	18	3904	c.3486C>T	c.(3484-3486)gcC>gcT	p.A1162A	AMBRA1_ENST00000314845.3_Silent_p.A1072A|AMBRA1_ENST00000534300.1_Silent_p.A1102A|AMBRA1_ENST00000533727.1_Silent_p.A1043A|AMBRA1_ENST00000426438.1_Silent_p.A1133A|AMBRA1_ENST00000528950.1_Silent_p.A1133A|AMBRA1_ENST00000298834.3_Silent_p.A1102A			Q9C0C7	AMRA1_HUMAN	autophagy/beclin-1 regulator 1	1162					autophagy (GO:0006914)|cell differentiation (GO:0030154)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neural tube development (GO:0021915)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|phagocytic vesicle (GO:0045335)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	39				GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)		GCTGCACCACGGCTGTCATGC	0.617													G|||	354	0.0706869	0.2557	0.0187	5008	,	,		18253	0.001		0.002	False		,,,				2504	0.0				p.A1165A		.											.	AMBRA1-136	0			c.C3495T						.	G		950,3454	358.4+/-314.3	119,712,1371	64.0	49.0	54.0		3216	-8.3	0.5	11	dbSNP_120	54	6,8592	4.3+/-15.6	0,6,4293	no	coding-synonymous	AMBRA1	NM_017749.2		119,718,5664	AA,AG,GG		0.0698,21.5713,7.3527		1072/1209	46419411	956,12046	2202	4299	6501	SO:0001819	synonymous_variant	55626	exon20			CACCACGGCTGTC	AB051523	CCDS31475.1, CCDS58132.1, CCDS73281.1	11p11.2	2013-01-09			ENSG00000110497	ENSG00000110497		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	25990	protein-coding gene	gene with protein product	"""WD repeat domain 94"", ""DDB1 and CUL4 associated factor 3"""	611359				17622796, 17603510, 17589504	Standard	NM_001267782		Approved	FLJ20294, KIAA1736, WDR94, DCAF3	uc001ncv.3	Q9C0C7	OTTHUMG00000166500	ENST00000458649.2:c.3486C>T	11.37:g.46419411G>A		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	25	5	NM_001267782	0	0	37	47	10	A6XN33|D3DQP8|G3V193|Q86XD6|Q9H8Z0|Q9NXE7	Silent	SNP	ENST00000458649.2	37																																																																																				G|0.923;A|0.077		0.617	AMBRA1-005	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000390103.1	NM_017749	
OR8H2	390151	broad.mit.edu	37	11	55873285	55873285	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr11:55873285T>C	ENST00000313503.1	+	1	767	c.767T>C	c.(766-768)aTt>aCt	p.I256T		NM_001005200.1	NP_001005200.1	Q8N162	OR8H2_HUMAN	olfactory receptor, family 8, subfamily H, member 2	256						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(38)|ovary(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	61	Esophageal squamous(21;0.00693)					AGCACTCTGATTTTTACTTAT	0.368										HNSCC(53;0.14)																											p.I256T		.											.	OR8H2-70	0			c.T767C						.						83.0	85.0	84.0					11																	55873285		2201	4296	6497	SO:0001583	missense	390151	exon1			CTCTGATTTTTAC	AB065657	CCDS31518.1	11q11	2012-08-09			ENSG00000181767	ENSG00000181767		"""GPCR / Class A : Olfactory receptors"""	15308	protein-coding gene	gene with protein product							Standard	NM_001005200		Approved		uc010riy.2	Q8N162	OTTHUMG00000166832	ENST00000313503.1:c.767T>C	11.37:g.55873285T>C	ENSP00000323982:p.Ile256Thr	Somatic	77	0		WXS	Illumina GAIIx	Phase_I	78	3	NM_001005200	0	0	0	0	0	Q6IFC1	Missense_Mutation	SNP	ENST00000313503.1	37	CCDS31518.1	.	.	.	.	.	.	.	.	.	.	N	5.594	0.294346	0.10567	.	.	ENSG00000181767	ENST00000313503	T	0.40756	1.02	3.58	1.04	0.20106	GPCR, rhodopsin-like superfamily (1);	0.239764	0.29876	N	0.010969	T	0.41903	0.1179	L	0.61036	1.89	0.09310	N	1	P	0.38535	0.635	P	0.44811	0.461	T	0.31420	-0.9944	10	0.56958	D	0.05	.	6.2867	0.21037	0.0:0.0845:0.3049:0.6106	.	256	Q8N162	OR8H2_HUMAN	T	256	ENSP00000323982:I256T	ENSP00000323982:I256T	I	+	2	0	OR8H2	55629861	0.000000	0.05858	0.000000	0.03702	0.150000	0.21749	0.816000	0.27267	0.076000	0.16826	-0.611000	0.04053	ATT	.		0.368	OR8H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391540.1	NM_001005200	
TMEM223	79064	hgsc.bcm.edu	37	11	62559437	62559437	+	Silent	SNP	C	C	G	rs375107993	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr11:62559437C>G	ENST00000307366.7	-	1	56	c.30G>C	c.(28-30)acG>acC	p.T10T	TMEM223_ENST00000525631.1_Silent_p.T10T|TMEM223_ENST00000527073.1_5'Flank|NXF1_ENST00000533048.1_5'Flank	NM_001080501.2	NP_001073970.1	A0PJW6	TM223_HUMAN	transmembrane protein 223	10						integral component of membrane (GO:0016021)											CTAGCAGCCCCGTGGGCCATC	0.726													C|||	37	0.00738818	0.0272	0.0014	5008	,	,		12223	0.0		0.0	False		,,,				2504	0.0				p.T10T		.											.	.	0			c.G30C						.	C		76,3742		0,76,1833	8.0	11.0	10.0		30	-2.6	0.0	11		10	0,8118		0,0,4059	no	coding-synonymous	TMEM223	NM_001080501.2		0,76,5892	GG,GC,CC		0.0,1.9906,0.6367		10/203	62559437	76,11860	1909	4059	5968	SO:0001819	synonymous_variant	79064	exon1			CAGCCCCGTGGGC		CCDS44628.1	11q12.3	2008-12-08				ENSG00000168569			28464	protein-coding gene	gene with protein product							Standard	NM_001080501		Approved	MGC3196	uc001nve.2	A0PJW6		ENST00000307366.7:c.30G>C	11.37:g.62559437C>G		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	16	9	NM_001080501	0	0	10	29	19	Q504S0|Q86YD4|Q8WUC5|Q96HG0	Silent	SNP	ENST00000307366.7	37	CCDS44628.1	.	.	.	.	.	.	.	.	.	.	C	6.027	0.373402	0.11409	0.019906	0.0	ENSG00000168569	ENST00000528367	.	.	.	4.06	-2.56	0.06268	.	.	.	.	.	T	0.09202	0.0227	.	.	.	0.09310	N	0.999995	.	.	.	.	.	.	T	0.22103	-1.0226	4	.	.	.	7.1604	1.4337	0.02339	0.1557:0.3399:0.3055:0.1989	.	.	.	.	R	10	.	.	G	-	1	0	TMEM223	62316013	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.442000	0.01014	-0.440000	0.07211	-0.258000	0.10820	GGG	.		0.726	TMEM223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395674.1		
PPP2R1B	5519	broad.mit.edu;bcgsc.ca	37	11	111626120	111626120	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr11:111626120A>G	ENST00000527614.1	-	6	807	c.742T>C	c.(742-744)Tct>Cct	p.S248P	PPP2R1B_ENST00000426998.2_Missense_Mutation_p.S184P|PPP2R1B_ENST00000341980.6_Missense_Mutation_p.S248P|PPP2R1B_ENST00000311129.5_Missense_Mutation_p.S248P|PPP2R1B_ENST00000393055.2_Missense_Mutation_p.S121P|PPP2R1B_ENST00000427203.2_Missense_Mutation_p.S87P	NM_001177562.1|NM_002716.4	NP_001171033.1|NP_002707.3	P30154	2AAB_HUMAN	protein phosphatase 2, regulatory subunit A, beta	248					apoptotic process involved in morphogenesis (GO:0060561)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)	extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|liver(1)|lung(10)|prostate(1)|urinary_tract(2)	22		all_cancers(61;2.34e-15)|all_epithelial(67;1.72e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|Epithelial(105;2.36e-06)|all cancers(92;3.78e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0761)		TCATCCTGAGACAATAACTGG	0.443																																					p.S248P		.											.	PPP2R1B-658	0			c.T742C						.						128.0	99.0	109.0					11																	111626120		2201	4297	6498	SO:0001583	missense	5519	exon6			CCTGAGACAATAA	AF087438	CCDS8348.1, CCDS8349.1, CCDS53706.1, CCDS53707.1, CCDS53708.1	11q23.1	2010-06-18	2010-04-14		ENSG00000137713	ENSG00000137713	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9303	protein-coding gene	gene with protein product	"""PP2A-A-beta"", ""protein phosphatase 2A, regulatory subunit A, beta isoform"""	603113	"""protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), beta isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit A, beta isoform"""			2159327, 9795170	Standard	NM_181699		Approved	PR65B, PP2A-Abeta	uc001plw.1	P30154	OTTHUMG00000166741	ENST00000527614.1:c.742T>C	11.37:g.111626120A>G	ENSP00000437193:p.Ser248Pro	Somatic	71	0		WXS	Illumina GAIIx	Phase_I	124	5	NM_001177562	0	0	8	9	1	A8MY67|B0YJ69|B4DGQ6|B4DK91|B4DWW5|F8W8G1|O75620|Q8NHV8	Missense_Mutation	SNP	ENST00000527614.1	37	CCDS8349.1	.	.	.	.	.	.	.	.	.	.	A	4.352	0.064814	0.08388	.	.	ENSG00000137713	ENST00000311129;ENST00000412902;ENST00000426998;ENST00000527614;ENST00000427203;ENST00000341980;ENST00000393055	T;T;T;T;T;T	0.30182	3.25;3.25;3.25;3.25;3.25;1.54	5.65	0.477	0.16784	Armadillo-like helical (1);Armadillo-type fold (1);	0.289213	0.39407	N	0.001366	T	0.05273	0.0140	N	0.00611	-1.325	0.31999	N	0.603606	B;B;B;B;B;B	0.10296	0.0;0.0;0.001;0.0;0.0;0.003	B;B;B;B;B;B	0.08055	0.001;0.003;0.002;0.002;0.0;0.002	T	0.26326	-1.0106	10	0.02654	T	1	-1.1532	0.6589	0.00839	0.3981:0.1511:0.27:0.1807	.	121;248;87;184;248;248	A8MY67;F8W8G1;B7Z1G3;B4DWW5;P30154;P30154-2	.;.;.;.;2AAB_HUMAN;.	P	248;121;184;248;87;248;121	ENSP00000311344:S248P;ENSP00000410671:S184P;ENSP00000437193:S248P;ENSP00000415759:S87P;ENSP00000343317:S248P;ENSP00000376775:S121P	ENSP00000311344:S248P	S	-	1	0	PPP2R1B	111131330	1.000000	0.71417	0.464000	0.27143	0.965000	0.64279	2.733000	0.47360	0.100000	0.17581	0.533000	0.62120	TCT	.		0.443	PPP2R1B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391298.1	NM_002716	
CRACR2A	84766	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	3805999	3805999	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr12:3805999T>A	ENST00000252322.1	-	4	635	c.167A>T	c.(166-168)cAg>cTg	p.Q56L	EFCAB4B_ENST00000440314.2_Missense_Mutation_p.Q56L|EFCAB4B_ENST00000444507.1_Missense_Mutation_p.Q56L	NM_032680.3	NP_116069.1	Q9BSW2	EFC4B_HUMAN		56	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				activation of store-operated calcium channel activity (GO:0032237)|immune system process (GO:0002376)|positive regulation of calcium ion transport (GO:0051928)|store-operated calcium entry (GO:0002115)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			breast(1)|endometrium(3)|large_intestine(2)|liver(1)|lung(12)|ovary(1)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(1)	24			OV - Ovarian serous cystadenocarcinoma(31;0.00287)|COAD - Colon adenocarcinoma(12;0.0264)			AAAGAACTCCTGTGCCTTCCT	0.587																																					p.Q56L		.											.	EFCAB4B-92	0			c.A167T						.						137.0	96.0	110.0					12																	3805999		2203	4300	6503	SO:0001583	missense	84766	exon4			AACTCCTGTGCCT																												ENST00000252322.1:c.167A>T	12.37:g.3805999T>A	ENSP00000252322:p.Gln56Leu	Somatic	103	0		WXS	Illumina GAIIx	Phase_I	138	33	NM_001144958	0	0	0	0	0	B4E1X0|B9EK63	Missense_Mutation	SNP	ENST00000252322.1	37	CCDS8522.1	.	.	.	.	.	.	.	.	.	.	T	12.58	1.981878	0.34942	.	.	ENSG00000130038	ENST00000440314;ENST00000444507;ENST00000252322	T;T;T	0.70516	2.01;-0.49;2.01	5.57	5.57	0.84162	EF-hand-like domain (1);	0.237591	0.42964	D	0.000621	T	0.65260	0.2674	L	0.35487	1.065	0.37876	D	0.930221	B;B;P	0.52842	0.15;0.063;0.956	B;B;P	0.47528	0.053;0.033;0.549	T	0.70583	-0.4832	10	0.46703	T	0.11	-23.6861	12.1393	0.53989	0.0:0.0:0.0:1.0	.	56;56;56	D7UEQ6;Q9BSW2-2;Q9BSW2	.;.;EFC4B_HUMAN	L	56	ENSP00000409382:Q56L;ENSP00000412496:Q56L;ENSP00000252322:Q56L	ENSP00000252322:Q56L	Q	-	2	0	EFCAB4B	3676260	1.000000	0.71417	0.983000	0.44433	0.141000	0.21300	3.585000	0.53943	2.115000	0.64714	0.523000	0.50628	CAG	.		0.587	EFCAB4B-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000398673.1		
C1RL	51279	broad.mit.edu;bcgsc.ca	37	12	7260847	7260847	+	Splice_Site	SNP	T	T	C			TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr12:7260847T>C	ENST00000266542.4	-	2	392	c.300A>G	c.(298-300)acA>acG	p.T100T	C1RL-AS1_ENST00000382215.3_RNA|C1RL_ENST00000545337.1_Splice_Site_p.T100T|C1RL_ENST00000544702.1_Splice_Site_p.T100T|C1RL-AS1_ENST00000435921.2_RNA|C1RL-AS1_ENST00000536679.1_RNA|C1RL_ENST00000545280.1_Intron|C1RL-AS1_ENST00000541775.1_RNA	NM_016546.2	NP_057630.2	Q9NZP8	C1RL_HUMAN	complement component 1, r subcomponent-like	100	CUB. {ECO:0000255|PROSITE- ProRule:PRU00059}.				complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase activity (GO:0004252)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						CCCAGCTCACTGTGACAGAGT	0.652																																					p.T100T		.											.	C1RL-91	0			c.A300G						.						31.0	32.0	31.0					12																	7260847		2203	4300	6503	SO:0001630	splice_region_variant	51279	exon2			GCTCACTGTGACA	AF178985	CCDS8573.1, CCDS73431.1	12p13.31	2008-02-05				ENSG00000139178			21265	protein-coding gene	gene with protein product		608974				12838346	Standard	XM_005253385		Approved	C1r-LP, C1RL1	uc001qsn.3	Q9NZP8		ENST00000266542.4:c.300+1A>G	12.37:g.7260847T>C		Somatic	48	1		WXS	Illumina GAIIx	Phase_I	70	5	NM_016546	0	0	4	4	0	Q53GX9	Silent	SNP	ENST00000266542.4	37	CCDS8573.1																																																																																			.		0.652	C1RL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398367.1	NM_016546	Silent
CLEC4E	26253	bcgsc.ca	37	12	8691875	8691875	+	Missense_Mutation	SNP	T	T	C	rs79940141	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr12:8691875T>C	ENST00000299663.3	-	3	323	c.158A>G	c.(157-159)gAt>gGt	p.D53G	CLEC4E_ENST00000446457.2_Missense_Mutation_p.D53G|CLEC4E_ENST00000545274.1_Missense_Mutation_p.D53G	NM_014358.2	NP_055173.1	Q9ULY5	CLC4E_HUMAN	C-type lectin domain family 4, member E	53					immune response (GO:0006955)|positive regulation of cytokine secretion (GO:0050715)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	12	Lung SC(5;0.184)					CTTTTTCTCATCACAGGTTTG	0.348													T|||	36	0.0071885	0.0257	0.0029	5008	,	,		-128	0.0		0.0	False		,,,				2504	0.0				p.D53G		.											.	CLEC4E-90	0			c.A158G						.	T	GLY/ASP	126,4280	92.0+/-130.7	4,118,2081	134.0	136.0	136.0		158	0.3	0.0	12	dbSNP_131	136	1,8599	1.2+/-3.3	0,1,4299	yes	missense	CLEC4E	NM_014358.2	94	4,119,6380	CC,CT,TT		0.0116,2.8597,0.9765	benign	53/220	8691875	127,12879	2203	4300	6503	SO:0001583	missense	26253	exon3			TTCTCATCACAGG	AB024718	CCDS8594.1	12p13.31	2005-02-09		2005-02-09	ENSG00000166523	ENSG00000166523		"""C-type lectin domain containing"""	14555	protein-coding gene	gene with protein product		609962	"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 9"""	CLECSF9		10528209	Standard	NM_014358		Approved	mincle	uc001quo.1	Q9ULY5	OTTHUMG00000168675	ENST00000299663.3:c.158A>G	12.37:g.8691875T>C	ENSP00000299663:p.Asp53Gly	Somatic	106	0		WXS	Illumina GAIIx	Phase_I	154	7	NM_014358	0	0	5	5	0	B2R6Q6	Missense_Mutation	SNP	ENST00000299663.3	37	CCDS8594.1	16	0.007326007326007326	16	0.032520325203252036	0	0.0	0	0.0	0	0.0	T	5.318	0.244004	0.10077	0.028597	1.16E-4	ENSG00000166523	ENST00000299663;ENST00000446457;ENST00000545274	T;T	0.37235	4.17;1.21	3.92	0.321	0.15883	C-type lectin-like (1);	0.559563	0.16337	N	0.218864	T	0.04318	0.0119	N	0.04508	-0.205	0.09310	N	1	B	0.09022	0.002	B	0.09377	0.004	T	0.23440	-1.0188	10	0.18710	T	0.47	.	5.8709	0.18802	0.0:0.36:0.0:0.64	.	53	Q9ULY5	CLC4E_HUMAN	G	53	ENSP00000299663:D53G;ENSP00000443034:D53G	ENSP00000299663:D53G	D	-	2	0	CLEC4E	8583142	0.145000	0.22656	0.002000	0.10522	0.073000	0.16967	-0.131000	0.10482	0.051000	0.15978	0.533000	0.62120	GAT	T|0.991;C|0.009		0.348	CLEC4E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400566.1	NM_014358	
BCAT1	586	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	24989464	24989464	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr12:24989464A>G	ENST00000261192.7	-	8	1410	c.884T>C	c.(883-885)cTg>cCg	p.L295P	BCAT1_ENST00000544418.1_5'UTR|BCAT1_ENST00000538118.1_Missense_Mutation_p.L294P|BCAT1_ENST00000342945.5_Missense_Mutation_p.L234P|RP11-625L16.3_ENST00000545410.1_RNA|BCAT1_ENST00000539282.1_Missense_Mutation_p.L307P|BCAT1_ENST00000539780.1_Missense_Mutation_p.L258P	NM_001178091.1|NM_005504.6	NP_001171562.1|NP_005495.2	P54687	BCAT1_HUMAN	branched chain amino-acid transaminase 1, cytosolic	295					branched-chain amino acid biosynthetic process (GO:0009082)|branched-chain amino acid catabolic process (GO:0009083)|cell proliferation (GO:0008283)|cellular nitrogen compound metabolic process (GO:0034641)|G1/S transition of mitotic cell cycle (GO:0000082)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	branched-chain-amino-acid transaminase activity (GO:0004084)|L-isoleucine transaminase activity (GO:0052656)|L-leucine transaminase activity (GO:0052654)|L-valine transaminase activity (GO:0052655)			breast(1)|large_intestine(1)|lung(3)|prostate(2)	7	Acute lymphoblastic leukemia(6;0.00112)|all_hematologic(7;0.00152)|Ovarian(17;0.107)|Colorectal(261;0.196)				Gabapentin(DB00996)|L-Isoleucine(DB00167)|L-Leucine(DB00149)|L-Valine(DB00161)	TGCCAGGTCCAGAATGCACCG	0.413																																					p.L307P		.											.	BCAT1-522	0			c.T920C						.						69.0	66.0	67.0					12																	24989464		1916	4122	6038	SO:0001583	missense	586	exon8			AGGTCCAGAATGC		CCDS44845.1, CCDS53760.1, CCDS53761.1, CCDS53762.1, CCDS53763.1	12p12.1	2012-10-02	2010-05-07		ENSG00000060982	ENSG00000060982	2.6.1.42		976	protein-coding gene	gene with protein product		113520	"""branched chain aminotransferase 1, cytosolic"""	BCT1		9165094	Standard	NM_005504		Approved		uc010six.2	P54687	OTTHUMG00000169053	ENST00000261192.7:c.884T>C	12.37:g.24989464A>G	ENSP00000261192:p.Leu295Pro	Somatic	66	0		WXS	Illumina GAIIx	Phase_I	88	15	NM_001178093	0	0	2	2	0	B3KY27|B7Z2M5|B7Z5L0|F5H5E4|Q68DQ7|Q96MY9	Missense_Mutation	SNP	ENST00000261192.7	37	CCDS44845.1	.	.	.	.	.	.	.	.	.	.	A	20.9	4.059333	0.76074	.	.	ENSG00000060982	ENST00000261192;ENST00000538118;ENST00000342945;ENST00000539282;ENST00000539780	T;T;T;T;T	0.33216	1.42;1.42;1.42;1.42;1.42	5.11	5.11	0.69529	.	0.083454	0.49916	D	0.000134	T	0.71592	0.3358	H	0.98314	4.2	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.87578	0.995;0.996;0.995;0.998;0.998	D	0.83931	0.0306	10	0.87932	D	0	-25.8717	15.2341	0.73416	1.0:0.0:0.0:0.0	.	258;307;234;295;294	B7Z5L0;F5H5E4;B3KY27;P54687;Q68DQ7	.;.;.;BCAT1_HUMAN;.	P	295;294;234;307;258	ENSP00000261192:L295P;ENSP00000440817:L294P;ENSP00000339805:L234P;ENSP00000443459:L307P;ENSP00000440827:L258P	ENSP00000261192:L295P	L	-	2	0	BCAT1	24880731	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	7.840000	0.86819	2.054000	0.61138	0.528000	0.53228	CTG	.		0.413	BCAT1-001	KNOWN	upstream_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402080.1	NM_005504	
KRT6B	3854	bcgsc.ca	37	12	52841765	52841765	+	Silent	SNP	G	G	A	rs388626	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr12:52841765G>A	ENST00000252252.3	-	7	1268	c.1221C>T	c.(1219-1221)gcC>gcT	p.A407A		NM_005555.3	NP_005546.2	P04259	K2C6B_HUMAN	keratin 6B	407	Coil 2.|Rod.				ectoderm development (GO:0007398)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(19)|ovary(4)|prostate(2)	40				BRCA - Breast invasive adenocarcinoma(357;0.083)		CAGCAATGGCGGCCTGTAGGT	0.537													G|||	2592	0.517572	0.4781	0.572	5008	,	,		21821	0.6825		0.505	False		,,,				2504	0.3753				p.A407A		.											.	KRT6B-92	0			c.C1221T						.	G		1978,2428	558.4+/-380.0	438,1102,663	74.0	68.0	70.0		1221	-4.8	0.0	12	dbSNP_80	70	4228,4372	571.5+/-389.6	1031,2166,1103	no	coding-synonymous	KRT6B	NM_005555.3		1469,3268,1766	AA,AG,GG		49.1628,44.8933,47.7164		407/565	52841765	6206,6800	2203	4300	6503	SO:0001819	synonymous_variant	3854	exon7			AATGGCGGCCTGT	BC034535	CCDS8828.1	12q13.13	2013-01-16	2004-08-11		ENSG00000185479	ENSG00000185479		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6444	protein-coding gene	gene with protein product		148042	"""keratin-like 1 (a type II keratin sequence)"""	KRTL1		1713141, 16831889	Standard	NM_005555		Approved		uc001sak.3	P04259	OTTHUMG00000169593	ENST00000252252.3:c.1221C>T	12.37:g.52841765G>A		Somatic	179	2		WXS	Illumina GAIIx	Phase_I	257	8	NM_005555	0	0	0	0	0	P48669	Silent	SNP	ENST00000252252.3	37	CCDS8828.1																																																																																			G|0.488;A|0.512		0.537	KRT6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404969.1	NM_005555	
GTSF1	121355	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	54854183	54854183	+	Silent	SNP	C	C	A			TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr12:54854183C>A	ENST00000552397.1	-	7	1361	c.465G>T	c.(463-465)ccG>ccT	p.P155P	GTSF1_ENST00000552395.1_5'UTR|RP11-753H16.5_ENST00000552785.1_RNA|RP11-753H16.3_ENST00000550474.1_RNA|GTSF1_ENST00000305879.5_Silent_p.P155P			Q8WW33	GTSF1_HUMAN	gametocyte specific factor 1	155						cytoplasm (GO:0005737)	metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	5		Myeloproliferative disorder(1001;0.00452)				GCAGAACATACGGCAGAGATT	0.383																																					p.P155P		.											.	GTSF1-90	0			c.G465T						.						117.0	113.0	115.0					12																	54854183		2203	4300	6503	SO:0001819	synonymous_variant	121355	exon7			AACATACGGCAGA	AK098819	CCDS8881.1	12q13.2	2008-02-04	2007-11-27	2007-11-27		ENSG00000170627			26565	protein-coding gene	gene with protein product			"""family with sequence similarity 112, member B"""	FAM112B		12477932	Standard	NM_144594		Approved	FLJ32942	uc001sgb.3	Q8WW33		ENST00000552397.1:c.465G>T	12.37:g.54854183C>A		Somatic	83	0		WXS	Illumina GAIIx	Phase_I	146	29	NM_144594	0	0	0	0	0	B3KQ60|Q0VGM4|Q8N778	Silent	SNP	ENST00000552397.1	37	CCDS8881.1																																																																																			C|1.000;T|0.000		0.383	GTSF1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406187.1	NM_144594	
NAP1L1	4673	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	76447086	76447086	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr12:76447086G>C	ENST00000261182.8	-	10	1301	c.815C>G	c.(814-816)aCt>aGt	p.T272S	NAP1L1_ENST00000542344.1_Missense_Mutation_p.T230S|NAP1L1_ENST00000431879.3_Missense_Mutation_p.T204S|NAP1L1_ENST00000552342.1_Missense_Mutation_p.T283S|NAP1L1_ENST00000548044.1_Missense_Mutation_p.T231S|NAP1L1_ENST00000393263.3_Missense_Mutation_p.T272S|NAP1L1_ENST00000549596.1_Missense_Mutation_p.T272S|NAP1L1_ENST00000535020.2_Missense_Mutation_p.T272S|NAP1L1_ENST00000547773.1_Missense_Mutation_p.T209S|NAP1L1_ENST00000544816.1_Missense_Mutation_p.T89S|NAP1L1_ENST00000547993.1_Missense_Mutation_p.T89S	NM_004537.4|NM_139207.2	NP_004528.1|NP_631946.1	P55209	NP1L1_HUMAN	nucleosome assembly protein 1-like 1	272					DNA replication (GO:0006260)|nucleosome assembly (GO:0006334)|positive regulation of cell proliferation (GO:0008284)	membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			kidney(1)|large_intestine(1)|lung(3)|ovary(2)|prostate(1)|skin(1)	9		Colorectal(145;0.09)				CTTCTTAATAGTTTTCAAAGT	0.358																																					p.T272S		.											.	NAP1L1-92	0			c.C815G						.						130.0	133.0	132.0					12																	76447086		2203	4300	6503	SO:0001583	missense	4673	exon10			TTAATAGTTTTCA		CCDS9013.1	12q21.1	2010-03-17			ENSG00000187109	ENSG00000187109			7637	protein-coding gene	gene with protein product		164060				8297347	Standard	NM_004537		Approved	NRP, NAP1, NAP1L, MGC8688, MGC23410	uc001sxx.2	P55209		ENST00000261182.8:c.815C>G	12.37:g.76447086G>C	ENSP00000261182:p.Thr272Ser	Somatic	135	0		WXS	Illumina GAIIx	Phase_I	189	11	NM_004537	0	0	428	486	58	B3KNT8	Missense_Mutation	SNP	ENST00000261182.8	37	CCDS9013.1	.	.	.	.	.	.	.	.	.	.	G	33	5.203603	0.95033	.	.	ENSG00000187109	ENST00000261182;ENST00000552056;ENST00000393263;ENST00000431879;ENST00000547773;ENST00000544816;ENST00000542344;ENST00000535020;ENST00000549596;ENST00000547993;ENST00000552342;ENST00000548044	T;T;T;T;T;T;T;T;T;T;T;T	0.44881	0.91;0.91;0.91;0.91;0.91;0.91;0.91;0.91;0.91;0.91;0.91;0.91	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.61211	0.2329	M	0.61703	1.905	0.80722	D	1	D;P;D;P;B;P;P	0.54047	0.964;0.767;0.964;0.949;0.099;0.511;0.9	P;P;P;P;P;B;P	0.59115	0.852;0.752;0.852;0.752;0.507;0.373;0.589	T	0.57717	-0.7763	10	0.51188	T	0.08	.	20.4024	0.99000	0.0:0.0:1.0:0.0	.	272;230;283;272;204;209;272	F5H4R6;B7Z9C2;F8W0J6;B3KNT8;B3KV44;F8W543;P55209	.;.;.;.;.;.;NP1L1_HUMAN	S	272;266;272;204;209;89;230;272;272;89;283;231	ENSP00000261182:T272S;ENSP00000450236:T266S;ENSP00000376947:T272S;ENSP00000409795:T204S;ENSP00000448167:T209S;ENSP00000437507:T89S;ENSP00000444759:T230S;ENSP00000445008:T272S;ENSP00000447793:T272S;ENSP00000448007:T89S;ENSP00000447196:T283S;ENSP00000449649:T231S	ENSP00000261182:T272S	T	-	2	0	NAP1L1	74733353	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.848000	0.99507	2.828000	0.97474	0.650000	0.86243	ACT	.		0.358	NAP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405850.3	NM_139207	
CEP290	80184	ucsc.edu;bcgsc.ca	37	12	88478595	88478595	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr12:88478595G>T	ENST00000552810.1	-	35	4815	c.4472C>A	c.(4471-4473)gCa>gAa	p.A1491E	CEP290_ENST00000547691.2_Missense_Mutation_p.A551E|CEP290_ENST00000397838.3_Missense_Mutation_p.A551E|CEP290_ENST00000309041.7_Missense_Mutation_p.A1493E	NM_025114.3	NP_079390.3	O15078	CE290_HUMAN	centrosomal protein 290kDa	1491					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|G2/M transition of mitotic cell cycle (GO:0000086)|hindbrain development (GO:0030902)|mitotic cell cycle (GO:0000278)|otic vesicle formation (GO:0030916)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephros development (GO:0048793)|protein transport (GO:0015031)|regulation of cAMP metabolic process (GO:0030814)|regulation of establishment of protein localization (GO:0070201)|retina development in camera-type eye (GO:0060041)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|protein complex (GO:0043234)|TCTN-B9D complex (GO:0036038)				breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|liver(1)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	73						ATTTTGTTCTGCTAACCTTAA	0.338																																					p.A1491E		.											.	CEP290-96	0			c.C4472A						.						69.0	61.0	64.0					12																	88478595		1813	4071	5884	SO:0001583	missense	80184	exon35			TGTTCTGCTAACC	AB002371	CCDS55858.1	12q21.33	2014-09-17				ENSG00000198707			29021	protein-coding gene	gene with protein product	"""Joubert syndrome 5"", ""nephrocystin-6"", ""cancer/testis antigen 87"", ""POC3 centriolar protein homolog (Chlamydomonas)"", ""Meckel syndrome, type 4"""	610142				15474516, 16682973, 16632484	Standard	NM_025114		Approved	KIAA0373, FLJ13615, 3H11Ag, rd16, NPHP6, JBTS5, SLSN6, LCA10, MKS4, BBS14, CT87, POC3	uc001tar.3	O15078		ENST00000552810.1:c.4472C>A	12.37:g.88478595G>T	ENSP00000448012:p.Ala1491Glu	Somatic	25	0		WXS	Illumina GAIIx	Phase_I	21	4	NM_025114	0	0	1	1	0	Q1PSK5|Q66GS8|Q9H2G6|Q9H6Q7|Q9H8I0	Missense_Mutation	SNP	ENST00000552810.1	37	CCDS55858.1	.	.	.	.	.	.	.	.	.	.	G	28.1	4.890854	0.91889	.	.	ENSG00000198707	ENST00000547691;ENST00000552810;ENST00000309041;ENST00000397838	T;T;T;T	0.67865	0.34;-0.29;-0.29;0.34	5.48	5.48	0.80851	.	0.050606	0.85682	D	0.000000	T	0.74665	0.3746	L	0.56769	1.78	0.51233	D	0.999915	D	0.69078	0.997	P	0.62491	0.903	T	0.68017	-0.5520	10	0.02654	T	1	.	19.7133	0.96105	0.0:0.0:1.0:0.0	.	1491	O15078	CE290_HUMAN	E	551;1491;1493;551	ENSP00000446905:A551E;ENSP00000448012:A1491E;ENSP00000308021:A1493E;ENSP00000380938:A551E	ENSP00000308021:A1493E	A	-	2	0	CEP290	87002726	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.357000	0.79456	2.725000	0.93324	0.655000	0.94253	GCA	.		0.338	CEP290-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000406344.1	NM_025114	
ANKS1B	56899	bcgsc.ca	37	12	99640557	99640557	+	Silent	SNP	T	T	C	rs1552759	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr12:99640557T>C	ENST00000547776.2	-	13	1841	c.1842A>G	c.(1840-1842)ccA>ccG	p.P614P	ANKS1B_ENST00000329257.7_Silent_p.P614P|ANKS1B_ENST00000547010.1_Silent_p.P194P|ANKS1B_ENST00000550833.1_5'UTR	NM_152788.4	NP_690001.3	Q7Z6G8	ANS1B_HUMAN	ankyrin repeat and sterile alpha motif domain containing 1B	614						cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	ephrin receptor binding (GO:0046875)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(15)|lung(38)|pancreas(1)|prostate(2)|skin(1)	70		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)		ACTCACAGGCTGGAGAGGATC	0.463													t|||	3166	0.632188	0.3003	0.647	5008	,	,		18945	0.9087		0.6083	False		,,,				2504	0.8098				p.P614P		.											.	.	0			c.A1842G						.	C		1357,2387		237,883,752	151.0	141.0	144.0		1842	4.5	1.0	12	dbSNP_88	144	5392,2814		1768,1856,479	no	coding-synonymous	ANKS1B	NM_152788.4		2005,2739,1231	CC,CT,TT		34.292,36.2447,43.523		614/1249	99640557	6749,5201	1872	4103	5975	SO:0001819	synonymous_variant	56899	exon13			ACAGGCTGGAGAG	AF145204	CCDS55864.1, CCDS55865.1, CCDS55866.1, CCDS55867.1, CCDS55868.1, CCDS55869.1, CCDS55870.1, CCDS55871.1, CCDS55872.1	12q23.1	2013-01-10						"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	24600	protein-coding gene	gene with protein product		607815				10490826, 12415113	Standard	NM_020140		Approved	EB-1, AIDA-1, cajalin-2, ANKS2	uc001tge.2	Q7Z6G8		ENST00000547776.2:c.1842A>G	12.37:g.99640557T>C		Somatic	46	0		WXS	Illumina GAIIx	Phase_I	72	4	NM_152788	0	0	0	0	0	A5PKY5|A7E259|A8K153|A8MSN4|B4DFP6|B4DH98|F8VPM3|F8VZR9|F8WC27|Q5XLJ0|Q6IVB5|Q6NUS4|Q7Z6G6|Q7Z6G7|Q8TAP3|Q9NRX7|Q9Y5K9	Silent	SNP	ENST00000547776.2	37	CCDS55872.1																																																																																			T|0.380;C|0.620		0.463	ANKS1B-003	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000408421.3	NM_020140	
RPH3A	22895	ucsc.edu;bcgsc.ca	37	12	113285539	113285539	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr12:113285539C>A	ENST00000389385.4	+	5	619	c.122C>A	c.(121-123)cCt>cAt	p.P41H	RPH3A_ENST00000420983.2_Missense_Mutation_p.P41H|RPH3A_ENST00000447659.2_Intron|RPH3A_ENST00000551052.1_Missense_Mutation_p.P37H|RPH3A_ENST00000415485.3_Missense_Mutation_p.P41H|RPH3A_ENST00000548866.1_Intron|RPH3A_ENST00000543106.2_Missense_Mutation_p.P41H	NM_001143854.1|NM_014954.3	NP_001137326.1|NP_055769.2	Q9Y2J0	RP3A_HUMAN	rabphilin 3A	41					intracellular protein transport (GO:0006886)	cell junction (GO:0030054)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phosphatidylinositol phosphate binding (GO:1901981)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(16)|ovary(3)|prostate(4)|skin(6)|urinary_tract(1)	47				BRCA - Breast invasive adenocarcinoma(302;0.00453)		GGTGGTCAGCCTGACAGGCAG	0.532																																					p.P41H		.											.	RPH3A-519	0			c.C122A						.						77.0	71.0	73.0					12																	113285539		2203	4300	6503	SO:0001583	missense	22895	exon5			GTCAGCCTGACAG	AB023202	CCDS31904.1, CCDS44979.1	12q24.13	2014-07-02	2014-07-02		ENSG00000089169	ENSG00000089169		"""Synaptotagmins"""	17056	protein-coding gene	gene with protein product		612159	"""rabphilin 3A homolog (mouse)"""			10231032, 7822236	Standard	NM_014954		Approved	KIAA0985, rabphilin, exophilin-1	uc001ttz.3	Q9Y2J0	OTTHUMG00000169713	ENST00000389385.4:c.122C>A	12.37:g.113285539C>A	ENSP00000374036:p.Pro41His	Somatic	245	2		WXS	Illumina GAIIx	Phase_I	328	49	NM_001143854	0	0	0	0	0	B7Z3C3|Q96AE0	Missense_Mutation	SNP	ENST00000389385.4	37	CCDS44979.1	.	.	.	.	.	.	.	.	.	.	C	10.92	1.488039	0.26686	.	.	ENSG00000089169	ENST00000548197;ENST00000547686;ENST00000543106;ENST00000551593;ENST00000551748;ENST00000546703;ENST00000547840;ENST00000547728;ENST00000549769;ENST00000552667;ENST00000389385;ENST00000551198;ENST00000551052;ENST00000415485;ENST00000553114;ENST00000420983	T;T;T;T;T	0.63417	-0.03;-0.03;-0.04;-0.03;-0.03	5.07	4.15	0.48705	Rabphilin-3A effector, zinc-binding (1);	0.258783	0.27371	N	0.019672	T	0.52757	0.1754	L	0.47716	1.5	0.29240	N	0.872705	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.002;0.002;0.001	T	0.46978	-0.9152	9	.	.	.	.	11.9026	0.52692	0.1908:0.8092:0.0:0.0	.	41;41;37	B7Z9Z7;Q9Y2J0;Q9Y2J0-2	.;RP3A_HUMAN;.	H	41;41;41;41;41;41;41;41;41;41;41;41;37;41;41;41	ENSP00000440384:P41H;ENSP00000374036:P41H;ENSP00000448297:P37H;ENSP00000405357:P41H;ENSP00000408889:P41H	.	P	+	2	0	RPH3A	111769922	0.270000	0.24152	0.146000	0.22360	0.474000	0.32979	2.136000	0.42121	1.174000	0.42811	0.655000	0.94253	CCT	.		0.532	RPH3A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405561.1	NM_014954	
PITPNM2	57605	hgsc.bcm.edu	37	12	123480124	123480132	+	In_Frame_Del	DEL	GCCACCACC	GCCACCACC	-	rs372515303|rs528475926|rs150324875	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	GCCACCACC	GCCACCACC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr12:123480124_123480132delGCCACCACC	ENST00000542749.1	-	12	1921_1929	c.1858_1866delGGTGGTGGC	c.(1858-1866)ggtggtggcdel	p.GGG620del	PITPNM2_ENST00000320201.4_In_Frame_Del_p.GGG620del|PITPNM2_ENST00000392428.1_In_Frame_Del_p.GGG341del|PITPNM2_ENST00000280562.5_In_Frame_Del_p.GGG620del			Q9BZ72	PITM2_HUMAN	phosphatidylinositol transfer protein, membrane-associated 2	620	Gly-rich.				metabolic process (GO:0008152)|transport (GO:0006810)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	calcium ion binding (GO:0005509)|lipid binding (GO:0008289)			NS(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	39	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.55e-05)|Epithelial(86;8.43e-05)|BRCA - Breast invasive adenocarcinoma(302;0.123)		caccactgctgccaccaccgccaccgccg	0.67														235	0.0469249	0.1694	0.0115	5008	,	,		15035	0.002		0.001	False		,,,				2504	0.0				p.620_622del		.											.	PITPNM2-228	0			c.1858_1866del						.			565,3573		81,403,1585						-2.4	0.0		dbSNP_129	31	51,8067		16,19,4024	no	coding	PITPNM2	NM_020845.2		97,422,5609	A1A1,A1R,RR		0.6282,13.6539,5.0261				616,11640				SO:0001651	inframe_deletion	57605	exon13			ACTGCTGCCACCA	AF334585	CCDS9242.1, CCDS73543.1	12q24.31	2008-02-05				ENSG00000090975			21044	protein-coding gene	gene with protein product		608920				10022914	Standard	XM_005253582		Approved	RDGBA2, RDGB2, NIR3	uc001uej.1	Q9BZ72		ENST00000542749.1:c.1858_1866delGGTGGTGGC	12.37:g.123480124_123480132delGCCACCACC	ENSP00000437611:p.Gly620_Gly622del	Somatic	6	0		WXS	Illumina GAIIx	Phase_I	86	32	NM_020845	0	0	0	0	0	Q9P271	In_Frame_Del	DEL	ENST00000542749.1	37	CCDS9242.1																																																																																			.		0.670	PITPNM2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401342.1	NM_020845	
NCOR2	9612	hgsc.bcm.edu;broad.mit.edu	37	12	124887093	124887093	+	Silent	SNP	C	C	T			TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr12:124887093C>T	ENST00000405201.1	-	14	1497	c.1497G>A	c.(1495-1497)caG>caA	p.Q499Q	NCOR2_ENST00000404121.2_Silent_p.Q69Q|NCOR2_ENST00000356219.3_Silent_p.Q499Q|NCOR2_ENST00000404621.1_Silent_p.Q498Q|NCOR2_ENST00000397355.1_Silent_p.Q499Q|NCOR2_ENST00000429285.2_Silent_p.Q498Q			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	499	Poly-Gln.				cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)	p.Q499Q(9)		breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		gctgctgctgctgttgttgct	0.617																																					p.Q499Q		.											.	NCOR2-229	9	Substitution - coding silent(9)	endometrium(4)|large_intestine(3)|kidney(2)	c.G1497A						.						9.0	10.0	10.0					12																	124887093		2051	4183	6234	SO:0001819	synonymous_variant	9612	exon16			CTGCTGCTGTTGT	U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.1497G>A	12.37:g.124887093C>T		Somatic	28	0		WXS	Illumina GAIIx	Phase_I	52	4	NM_006312	0	0	5	21	16	O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Silent	SNP	ENST00000405201.1	37	CCDS41858.2																																																																																			.		0.617	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318173.2	NM_006312	
EP400	57634	broad.mit.edu	37	12	132547087	132547087	+	Silent	SNP	G	G	A	rs12366766	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr12:132547087G>A	ENST00000333577.4	+	48	8392	c.8283G>A	c.(8281-8283)caG>caA	p.Q2761Q	EP400_ENST00000389561.2_Silent_p.Q2725Q|EP400_ENST00000389562.2_Silent_p.Q2724Q|EP400_ENST00000332482.4_Silent_p.Q2688Q|EP400_ENST00000330386.6_Silent_p.Q2644Q			Q96L91	EP400_HUMAN	E1A binding protein p400	2761	Interaction with ZNF42. {ECO:0000250}.|Poly-Gln.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.Q2724Q(16)|p.Q2725Q(1)		NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		agcagcagcagcaacaacagc	0.562													G|||	37	0.00738818	0.0038	0.0072	5008	,	,		15585	0.002		0.0149	False		,,,				2504	0.0102				p.Q2725Q		.											.	EP400-520	17	Substitution - coding silent(17)	prostate(4)|kidney(4)|central_nervous_system(3)|lung(3)|endometrium(2)|urinary_tract(1)	c.G8175A						.						28.0	31.0	30.0					12																	132547087		2199	4282	6481	SO:0001819	synonymous_variant	57634	exon47			GCAGCAGCAACAA	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.8283G>A	12.37:g.132547087G>A		Somatic	97	1		WXS	Illumina GAIIx	Phase_I	213	7	NM_015409	0	0	0	0	0	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Silent	SNP	ENST00000333577.4	37																																																																																				.		0.562	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409	
OXGR1	27199	bcgsc.ca	37	13	97639827	97639827	+	Silent	SNP	T	T	G	rs9300380	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr13:97639827T>G	ENST00000298440.1	-	4	430	c.187A>C	c.(187-189)Aga>Cga	p.R63R	OXGR1_ENST00000543457.1_Silent_p.R63R	NM_080818.3	NP_543008.3	Q96P68	OXGR1_HUMAN	oxoglutarate (alpha-ketoglutarate) receptor 1	63					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|large_intestine(1)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	15	all_neural(89;0.0982)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.186)			TTCCAAGGTCTCATTTTGAAA	0.473													G|||	317	0.0632987	0.2118	0.0288	5008	,	,		21471	0.0		0.0169	False		,,,				2504	0.0				p.R63R		.											.	OXGR1-70	0			c.A187C						.	G		815,3591	747.9+/-411.9	74,667,1462	121.0	113.0	116.0		187	3.3	1.0	13	dbSNP_119	116	83,8517	815.3+/-407.0	0,83,4217	no	coding-synonymous	OXGR1	NM_080818.3		74,750,5679	GG,GT,TT		0.9651,18.4975,6.9045		63/338	97639827	898,12108	2203	4300	6503	SO:0001819	synonymous_variant	27199	exon4			AAGGTCTCATTTT	AF411109	CCDS9482.1	13q32.2	2014-04-09	2004-07-08	2004-07-09	ENSG00000165621	ENSG00000165621		"""GPCR / Class A : Orphans"""	4531	protein-coding gene	gene with protein product	"""2-oxoglutarate receptor 1"", ""alpha-ketoglutarate receptor 1"""	606922	"""G protein-coupled receptor 80"""	GPR99, GPR80		15141213, 12098360	Standard	NM_080818		Approved	P2RY15, P2Y15, aKGR	uc001vmx.1	Q96P68	OTTHUMG00000017236	ENST00000298440.1:c.187A>C	13.37:g.97639827T>G		Somatic	185	0		WXS	Illumina GAIIx	Phase_I	182	8	NM_080818	0	0	0	0	0	Q5T5A7|Q86TL1	Silent	SNP	ENST00000298440.1	37	CCDS9482.1																																																																																			T|0.939;G|0.061		0.473	OXGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045521.3	NM_080818	
CARS2	79587	ucsc.edu	37	13	111340101	111340101	+	Missense_Mutation	SNP	T	T	C	rs72661692	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr13:111340101T>C	ENST00000257347.4	-	5	601	c.538A>G	c.(538-540)Att>Gtt	p.I180V	CARS2_ENST00000535398.1_5'UTR	NM_024537.2	NP_078813.1	Q9HA77	SYCM_HUMAN	cysteinyl-tRNA synthetase 2, mitochondrial (putative)	180					cysteinyl-tRNA aminoacylation (GO:0006423)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|cysteine-tRNA ligase activity (GO:0004817)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(2)|prostate(4)|skin(1)	13	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.163)		L-Cysteine(DB00151)	CCACGAGCAATGATTCCTTCA	0.408																																					p.I180V		.											.	CARS2-90	0			c.A538G						.						189.0	200.0	196.0					13																	111340101		2203	4300	6503	SO:0001583	missense	79587	exon5			GAGCAATGATTCC	BC007220	CCDS9514.1	13q34	2011-07-01	2007-02-22		ENSG00000134905	ENSG00000134905	6.1.1.16	"""Aminoacyl tRNA synthetases / Class I"""	25695	protein-coding gene	gene with protein product	"""cysteine tRNA ligase 2, mitochondrial (putative)"""	612800				15779907	Standard	NM_024537		Approved	FLJ12118	uc001vrd.2	Q9HA77	OTTHUMG00000017347	ENST00000257347.4:c.538A>G	13.37:g.111340101T>C	ENSP00000257347:p.Ile180Val	Somatic	75	1		WXS	Illumina GAIIx	Phase_I	84	13	NM_024537	0	0	36	48	12	Q8NI84|Q96IV4	Missense_Mutation	SNP	ENST00000257347.4	37	CCDS9514.1	.	.	.	.	.	.	.	.	.	.	T	11.64	1.698995	0.30142	.	.	ENSG00000134905	ENST00000257347;ENST00000542709	T	0.33438	1.41	4.71	0.802	0.18686	Rossmann-like alpha/beta/alpha sandwich fold (1);	0.000000	0.85682	D	0.000000	T	0.21186	0.0510	L	0.43598	1.365	0.48511	D	0.999668	B	0.20368	0.044	B	0.26864	0.074	T	0.06391	-1.0829	10	0.22706	T	0.39	-13.4943	5.3662	0.16115	0.0:0.159:0.1511:0.6899	.	180	Q9HA77	SYCM_HUMAN	V	180;171	ENSP00000257347:I180V	ENSP00000257347:I180V	I	-	1	0	CARS2	110138102	1.000000	0.71417	0.001000	0.08648	0.015000	0.08874	3.482000	0.53186	-0.028000	0.13850	0.455000	0.32223	ATT	T|0.929;A|0.071		0.408	CARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045772.3	NM_024537	
C14orf39	317761	bcgsc.ca	37	14	60903757	60903757	+	Missense_Mutation	SNP	G	G	A	rs1254319	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr14:60903757G>A	ENST00000321731.3	-	18	1729	c.1570C>T	c.(1570-1572)Ctt>Ttt	p.L524F		NM_174978.2	NP_777638	Q8N1H7	S6OS1_HUMAN	chromosome 14 open reading frame 39	524				L -> F (in Ref. 1; BAC05253). {ECO:0000305}.	multicellular organismal development (GO:0007275)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)					breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(108;0.0448)		GGCTTCTCAAGTAAGTTTCCT	0.299													A|||	2338	0.466853	0.5182	0.2406	5008	,	,		16553	0.6944		0.3012	False		,,,				2504	0.4939				p.L524F		.											.	C14orf39-94	0			c.C1570T						.	A	PHE/LEU	2181,2225	580.0+/-385.0	541,1099,563	102.0	114.0	110.0		1570	4.0	1.0	14	dbSNP_87	110	2535,6063	688.6+/-404.3	362,1811,2126	yes	missense	C14orf39	NM_174978.2	22	903,2910,2689	AA,AG,GG		29.4836,49.5007,36.2658	benign	524/588	60903757	4716,8288	2203	4299	6502	SO:0001583	missense	317761	exon18			TCTCAAGTAAGTT	AK098187	CCDS9746.1	14q23.1	2012-11-05	2012-11-05	2012-11-05	ENSG00000179008	ENSG00000179008			19849	protein-coding gene	gene with protein product							Standard	NM_174978		Approved	SIX6OS1	uc001xez.4	Q8N1H7	OTTHUMG00000140332	ENST00000321731.3:c.1570C>T	14.37:g.60903757G>A	ENSP00000324920:p.Leu524Phe	Somatic	108	0		WXS	Illumina GAIIx	Phase_I	78	7	NM_174978	0	0	0	0	0	Q08AQ4	Missense_Mutation	SNP	ENST00000321731.3	37	CCDS9746.1	954	0.4368131868131868	243	0.49390243902439024	107	0.2955801104972376	385	0.6730769230769231	219	0.28891820580474936	A	0.031	-1.331798	0.01298	0.495007	0.294836	ENSG00000179008	ENST00000321731	T	0.15372	2.43	5.17	4.03	0.46877	.	0.103898	0.43260	N	0.000594	T	0.00012	0.0000	N	0.00104	-2.125	0.39087	P	0.03897099999999998	B	0.02656	0.0	B	0.01281	0.0	T	0.43278	-0.9401	9	0.02654	T	1	-4.4151	8.9267	0.35646	0.8474:0.0:0.1526:0.0	rs1254319;rs57641575;rs1254319	524	Q8N1H7	S6OS1_HUMAN	F	524	ENSP00000324920:L524F	ENSP00000324920:L524F	L	-	1	0	C14orf39	59973510	1.000000	0.71417	0.998000	0.56505	0.458000	0.32498	4.268000	0.58883	0.307000	0.22880	-1.266000	0.01441	CTT	G|0.588;A|0.412		0.299	C14orf39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276948.1	NM_174978	
AHNAK2	113146	broad.mit.edu	37	14	105412335	105412335	+	Silent	SNP	C	C	T	rs202104959	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr14:105412335C>T	ENST00000333244.5	-	7	9572	c.9453G>A	c.(9451-9453)ccG>ccA	p.P3151P	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3151						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.P3151P(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CCCCGAACGACGGCATCTTGA	0.602																																					p.P3151P		.											.	AHNAK2-47	1	Substitution - coding silent(1)	endometrium(1)	c.G9453A						.						198.0	138.0	157.0					14																	105412335		1921	4005	5926	SO:0001819	synonymous_variant	113146	exon7			GAACGACGGCATC	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.9453G>A	14.37:g.105412335C>T		Somatic	139	0		WXS	Illumina GAIIx	Phase_I	59	9	NM_138420	0	0	0	0	0	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Silent	SNP	ENST00000333244.5	37	CCDS45177.1																																																																																			C|0.963;T|0.037		0.602	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
AHNAK2	113146	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	105417098	105417098	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr14:105417098C>T	ENST00000333244.5	-	7	4809	c.4690G>A	c.(4690-4692)Ggc>Agc	p.G1564S	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	1564						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GACACAGGGCCCTCTGGGAGT	0.617																																					p.G1564S		.											.	AHNAK2-47	0			c.G4690A						.						97.0	99.0	99.0					14																	105417098		1875	4059	5934	SO:0001583	missense	113146	exon7			CAGGGCCCTCTGG	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.4690G>A	14.37:g.105417098C>T	ENSP00000353114:p.Gly1564Ser	Somatic	157	0		WXS	Illumina GAIIx	Phase_I	159	48	NM_138420	0	0	0	0	0	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	c	12.42	1.932166	0.34096	.	.	ENSG00000185567	ENST00000333244	T	0.00711	5.8	3.89	1.97	0.26223	.	.	.	.	.	T	0.01222	0.0040	L	0.39514	1.22	0.09310	N	1	D	0.54964	0.969	P	0.56042	0.79	T	0.36286	-0.9754	9	0.07482	T	0.82	.	5.9307	0.19138	0.0:0.6943:0.1972:0.1086	.	1564	Q8IVF2	AHNK2_HUMAN	S	1564	ENSP00000353114:G1564S	ENSP00000353114:G1564S	G	-	1	0	AHNAK2	104488143	0.000000	0.05858	0.006000	0.13384	0.007000	0.05969	-0.039000	0.12124	0.587000	0.29643	0.485000	0.47835	GGC	.		0.617	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
GABRG3	2567	hgsc.bcm.edu	37	15	27216691	27216691	+	Silent	SNP	G	G	A	rs28399525	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr15:27216691G>A	ENST00000333743.6	+	1	263	c.9G>A	c.(7-9)ccG>ccA	p.P3P	GABRG3_ENST00000555083.1_Silent_p.P3P	NM_033223.4	NP_150092.2	Q99928	GBRG3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 3	3					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(23)|skin(1)|upper_aerodigestive_tract(4)	42		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	CCATGGCCCCGAAGCTGCTGC	0.771													G|||	114	0.0227636	0.0817	0.0086	5008	,	,		7697	0.0		0.0	False		,,,				2504	0.0				p.P3P	NSCLC(114;800 1656 7410 37729 45293)	.											.	.	0			c.G9A						.	G		113,2875		1,111,1382	4.0	7.0	6.0		9	-1.8	0.5	15	dbSNP_125	6	0,6116		0,0,3058	no	coding-synonymous	GABRG3	NM_033223.4		1,111,4440	AA,AG,GG		0.0,3.7818,1.2412		3/468	27216691	113,8991	1494	3058	4552	SO:0001819	synonymous_variant	2567	exon1			GGCCCCGAAGCTG		CCDS45195.1, CCDS59251.1	15q12	2012-06-22			ENSG00000182256	ENSG00000182256		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4088	protein-coding gene	gene with protein product	"""GABA(G) receptor, gamma 3"""	600233				7601451	Standard	NM_033223		Approved		uc001zbg.2	Q99928	OTTHUMG00000044462	ENST00000333743.6:c.9G>A	15.37:g.27216691G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	5	NM_001270873	0	0	0	0	0	G3V594|Q9HD46|Q9NYT2	Silent	SNP	ENST00000333743.6	37	CCDS45195.1																																																																																			G|0.972;A|0.028		0.771	GABRG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103584.2		
FAM81A	145773	bcgsc.ca	37	15	59806609	59806609	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr15:59806609G>T	ENST00000288228.5	+	7	959	c.772G>T	c.(772-774)Gtt>Ttt	p.V258F		NM_152450.2	NP_689663.2	Q8TBF8	FA81A_HUMAN	family with sequence similarity 81, member A	258										endometrium(2)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	10						TTCCTTGATTGTTAAGGAAAA	0.343																																					p.V258F		.											.	FAM81A-91	0			c.G772T						.						110.0	112.0	112.0					15																	59806609		1789	4062	5851	SO:0001583	missense	145773	exon7			TTGATTGTTAAGG		CCDS45269.1	15q22.2	2012-10-02			ENSG00000157470	ENSG00000157470			28379	protein-coding gene	gene with protein product							Standard	NM_152450		Approved	MGC26690	uc002agc.2	Q8TBF8	OTTHUMG00000171915	ENST00000288228.5:c.772G>T	15.37:g.59806609G>T	ENSP00000288228:p.Val258Phe	Somatic	52	0		WXS	Illumina GAIIx	Phase_I	65	6	NM_152450	0	0	0	0	0		Missense_Mutation	SNP	ENST00000288228.5	37	CCDS45269.1	.	.	.	.	.	.	.	.	.	.	G	9.907	1.208423	0.22205	.	.	ENSG00000157470	ENST00000288228	T	0.75260	-0.92	5.77	1.68	0.24146	.	0.332477	0.26038	N	0.026715	T	0.51329	0.1668	N	0.21448	0.665	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.22034	-1.0228	10	0.23891	T	0.37	-3.013	2.0425	0.03553	0.2274:0.1258:0.5021:0.1448	.	258	Q8TBF8	FA81A_HUMAN	F	258	ENSP00000288228:V258F	ENSP00000288228:V258F	V	+	1	0	FAM81A	57593901	0.765000	0.28485	0.049000	0.19019	0.882000	0.50991	0.859000	0.27858	0.124000	0.18369	0.655000	0.94253	GTT	.		0.343	FAM81A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415876.1	NM_152450	
LACTB	114294	hgsc.bcm.edu	37	15	63414083	63414083	+	Missense_Mutation	SNP	A	A	C	rs34317102	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr15:63414083A>C	ENST00000261893.4	+	1	85	c.13A>C	c.(13-15)Atg>Ctg	p.M5L	LACTB_ENST00000413507.2_Missense_Mutation_p.M5L	NM_032857.3	NP_116246.2	P83111	LACTB_HUMAN	lactamase, beta	5				M -> L (in Ref. 1 and 2). {ECO:0000305}.		cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	hydrolase activity (GO:0016787)			NS(1)|breast(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)|stomach(1)	12						GTACCGGCTCATGTCAGCAGT	0.751													C|||	3981	0.794928	0.6725	0.8256	5008	,	,		8367	0.997		0.7316	False		,,,				2504	0.7955				p.M5L	Melanoma(85;443 1381 6215 27308 35583)	.											.	LACTB-90	0			c.A13C						.	C	LEU/MET,LEU/MET	1936,668		733,470,99	4.0	4.0	4.0		13,13	3.1	1.0	15	dbSNP_126	4	4375,1183		1737,901,141	yes	missense,missense	LACTB	NM_032857.3,NM_171846.2	15,15	2470,1371,240	CC,CA,AA		21.2846,25.6528,22.6783	benign,benign	5/548,5/374	63414083	6311,1851	1302	2779	4081	SO:0001583	missense	114294	exon1			CGGCTCATGTCAG	AK027808	CCDS10182.1, CCDS45275.1	15q22.1	2012-11-14	2001-12-12	2001-12-14	ENSG00000103642	ENSG00000103642		"""Mitochondrial ribosomal proteins / large subunits"""	16468	protein-coding gene	gene with protein product		608440	"""mitochondrial ribosomal protein L56"""	MRPL56		11707067	Standard	NM_032857		Approved	FLJ14902	uc002alw.3	P83111	OTTHUMG00000132807	ENST00000261893.4:c.13A>C	15.37:g.63414083A>C	ENSP00000261893:p.Met5Leu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_171846	0	0	0	0	0	P83096	Missense_Mutation	SNP	ENST00000261893.4	37	CCDS10182.1	1713	0.7843406593406593	304	0.6178861788617886	287	0.7928176795580111	568	0.993006993006993	554	0.7308707124010554	C	0.674	-0.800779	0.02841	0.743472	0.787154	ENSG00000103642	ENST00000261893;ENST00000413507	T	0.33216	1.42	3.1	3.1	0.35709	.	0.592824	0.14749	N	0.300689	T	0.00012	0.0000	N	0.02539	-0.55	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.37842	-0.9688	9	0.02654	T	1	0.0321	7.626	0.28212	0.2541:0.7459:0.0:0.0	rs34317102	5	P83111	LACTB_HUMAN	L	5	ENSP00000261893:M5L	ENSP00000261893:M5L	M	+	1	0	LACTB	61201136	0.994000	0.37717	0.956000	0.39512	0.117000	0.20001	0.346000	0.19997	0.640000	0.30582	-0.677000	0.03784	ATG	A|0.226;C|0.774		0.751	LACTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256224.1	NM_032857	
MCTP2	55784	bcgsc.ca	37	15	94945719	94945719	+	Intron	SNP	G	G	T	rs7178698	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr15:94945719G>T	ENST00000357742.4	+	16	2085				MCTP2_ENST00000331706.4_Missense_Mutation_p.R285L|MCTP2_ENST00000557742.1_Missense_Mutation_p.R285L|MCTP2_ENST00000451018.3_Intron	NM_018349.3	NP_060819.3	Q6DN12	MCTP2_HUMAN	multiple C2 domains, transmembrane 2						calcium-mediated signaling (GO:0019722)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|liver(1)|lung(12)|ovary(1)|pancreas(1)|skin(9)|stomach(2)	49	Lung NSC(78;0.0821)|all_lung(78;0.148)		BRCA - Breast invasive adenocarcinoma(143;0.0323)|OV - Ovarian serous cystadenocarcinoma(32;0.0593)			ATTCAGCACCGCAAAGAGGAA	0.378													T|||	3107	0.620407	0.5499	0.6484	5008	,	,		19751	0.5089		0.8131	False		,,,				2504	0.6125				p.R285L		.											.	MCTP2-93	0			c.G854T						.	T	,LEU/ARG,	761,611		210,341,135	147.0	116.0	126.0		,854,	-2.4	0.0	15	dbSNP_116	126	2566,612		1037,492,60	yes	intron,missense,intron	MCTP2	NM_001159643.1,NM_001159644.1,NM_018349.3	,102,	1247,833,195	TT,TG,GG		19.2574,44.5335,26.8791	,,	,285/307,	94945719	3327,1223	686	1589	2275	SO:0001627	intron_variant	55784	exon10			AGCACCGCAAAGA	AK002037	CCDS32338.1, CCDS53975.1, CCDS53976.1	15q26.2	2006-02-08				ENSG00000140563			25636	protein-coding gene	gene with protein product						15528213	Standard	NM_018349		Approved	FLJ11175, FLJ33303	uc002btj.3	Q6DN12		ENST00000357742.4:c.2085+471G>T	15.37:g.94945719G>T		Somatic	124	0		WXS	Illumina GAIIx	Phase_I	135	5	NM_001159644	0	0	0	0	0	A2RRC2|C6G483|C6G484|Q49AB0|Q8TAX2|Q9NUS2|Q9NUW7	Missense_Mutation	SNP	ENST00000357742.4	37	CCDS32338.1	1421	0.6506410256410257	256	0.5203252032520326	250	0.6906077348066298	291	0.5087412587412588	624	0.8232189973614775	T	5.565	0.289024	0.10513	0.554665	0.807426	ENSG00000140563	ENST00000331706	T	0.64260	-0.09	4.39	-2.44	0.06502	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.35375	-0.9791	7	0.11485	T	0.65	.	3.8968	0.09143	0.3508:0.0:0.3439:0.3053	rs7178698;rs57280670;rs7178698	285	Q6DN12-4	.	L	285	ENSP00000329646:R285L	ENSP00000329646:R285L	R	+	2	0	MCTP2	92746723	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.547000	0.06055	-0.821000	0.04312	-1.962000	0.00476	CGC	G|0.358;T|0.642		0.378	MCTP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415060.3	NM_018349	
HBQ1	3049	hgsc.bcm.edu	37	16	230817	230817	+	Missense_Mutation	SNP	C	C	T	rs80294025	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr16:230817C>T	ENST00000199708.2	+	2	282	c.248C>T	c.(247-249)gCg>gTg	p.A83V	Y_RNA_ENST00000384514.1_RNA	NM_005331.4	NP_005322.1	P09105	HBAT_HUMAN	hemoglobin, theta 1	83					oxygen transport (GO:0015671)	hemoglobin complex (GO:0005833)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|oxygen transporter activity (GO:0005344)			large_intestine(1)	1		all_cancers(16;2.03e-06)|all_epithelial(16;5.16e-06)|Hepatocellular(16;0.000325)|Lung NSC(18;0.0138)|all_lung(18;0.0306)				GCGCTGTCCGCGCTGAGCCAC	0.746													c|||	65	0.0129792	0.0477	0.0029	5008	,	,		8690	0.0		0.0	False		,,,				2504	0.0				p.A83V		.											.	HBQ1-90	0			c.C248T						.		VAL/ALA	129,4135		1,127,2004	10.0	10.0	10.0		248	2.5	0.0	16	dbSNP_131	10	2,8414		0,2,4206	no	missense	HBQ1	NM_005331.4	64	1,129,6210	TT,TC,CC		0.0238,3.0253,1.0331	benign	83/143	230817	131,12549	2132	4208	6340	SO:0001583	missense	3049	exon2			TGTCCGCGCTGAG	BC056686	CCDS10400.1	16p13.3	2014-05-19			ENSG00000086506	ENSG00000086506			4833	protein-coding gene	gene with protein product		142240				2649166	Standard	NM_005331		Approved	HBQ	uc002cfz.3	P09105	OTTHUMG00000060727	ENST00000199708.2:c.248C>T	16.37:g.230817C>T	ENSP00000199708:p.Ala83Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	5	NM_005331	0	0	0	0	0	Q13723|Q1W6G5	Missense_Mutation	SNP	ENST00000199708.2	37	CCDS10400.1	19	0.0086996336996337	18	0.036585365853658534	1	0.0027624309392265192	0	0.0	0	0.0	c	10.73	1.432517	0.25813	0.030253	2.38E-4	ENSG00000086506	ENST00000199708	D	0.93366	-3.21	3.53	2.55	0.30701	Globin-like (1);Globin, structural domain (1);	0.502966	0.21928	N	0.067071	T	0.65811	0.2727	L	0.47716	1.5	0.09310	N	1	P	0.45396	0.857	B	0.33042	0.157	T	0.72547	-0.4260	10	0.62326	D	0.03	-0.535	6.4293	0.21788	0.3863:0.4482:0.1655:0.0	.	83	P09105	HBAT_HUMAN	V	83	ENSP00000199708:A83V	ENSP00000199708:A83V	A	+	2	0	HBQ1	170817	0.000000	0.05858	0.022000	0.16811	0.020000	0.10135	-0.794000	0.04584	0.804000	0.34136	0.556000	0.70494	GCG	C|0.988;T|0.012		0.746	HBQ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000134226.1	NM_005331	
SLX4	84464	hgsc.bcm.edu	37	16	3646276	3646276	+	Missense_Mutation	SNP	G	G	A	rs59706816	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr16:3646276G>A	ENST00000294008.3	-	8	2442	c.1802C>T	c.(1801-1803)tCg>tTg	p.S601L		NM_032444.2	NP_115820.2	Q8IY92	SLX4_HUMAN	SLX4 structure-specific endonuclease subunit	601	Interaction with SLX4IP, ERCC4 and MSH2.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing involved in repair via single-strand annealing (GO:0010792)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|nucleotide-excision repair (GO:0006289)|positive regulation of catalytic activity (GO:0043085)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|Slx1-Slx4 complex (GO:0033557)	5'-flap endonuclease activity (GO:0017108)|enzyme activator activity (GO:0008047)			breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	76						GGCCGAAGGCGACGGGCCCCT	0.726								Direct reversal of damage					G|||	14	0.00279553	0.0098	0.0014	5008	,	,		14693	0.0		0.0	False		,,,				2504	0.0				p.S601L		.											.	SLX4-94	0			c.C1802T						.	G	LEU/SER	38,4274		0,38,2118	8.0	10.0	9.0		1802	1.0	0.0	16	dbSNP_129	9	0,8468		0,0,4234	no	missense	SLX4	NM_032444.2	145	0,38,6352	AA,AG,GG		0.0,0.8813,0.2973	possibly-damaging	601/1835	3646276	38,12742	2156	4234	6390	SO:0001583	missense	84464	exon8			GAAGGCGACGGGC	AB058687	CCDS10506.2	16p13.3	2014-09-17	2013-06-05	2010-09-13	ENSG00000188827	ENSG00000188827		"""Fanconi anemia, complementation groups"", ""BTB/POZ domain containing"""	23845	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group P"""	613278	"""BTB (POZ) domain containing 12"", ""SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)"""	BTBD12		11347906, 19595721	Standard	NM_032444		Approved	KIAA1784, KIAA1987, FANCP	uc002cvp.2	Q8IY92	OTTHUMG00000074089	ENST00000294008.3:c.1802C>T	16.37:g.3646276G>A	ENSP00000294008:p.Ser601Leu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	52	20	NM_032444	0	0	0	0	0	Q69YT8|Q8TF15|Q96JP1	Missense_Mutation	SNP	ENST00000294008.3	37	CCDS10506.2	9	0.004120879120879121	8	0.016260162601626018	1	0.0027624309392265192	0	0.0	0	0.0	G	10.18	1.278993	0.23307	0.008813	0.0	ENSG00000188827	ENST00000294008	T	0.21932	1.98	5.21	0.982	0.19762	.	1.352410	0.05110	N	0.488801	T	0.04861	0.0131	N	0.19112	0.55	0.09310	N	1	B	0.22604	0.072	B	0.12156	0.007	T	0.20174	-1.0283	10	0.02654	T	1	.	3.8932	0.09128	0.3605:0.1758:0.4638:0.0	rs59706816	601	Q8IY92	SLX4_HUMAN	L	601	ENSP00000294008:S601L	ENSP00000294008:S601L	S	-	2	0	SLX4	3586277	0.000000	0.05858	0.000000	0.03702	0.041000	0.13682	0.570000	0.23653	0.201000	0.20466	0.561000	0.74099	TCG	G|0.996;A|0.004		0.726	SLX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157301.3	NM_032444	
TMC7	79905	bcgsc.ca	37	16	19067933	19067933	+	Silent	SNP	G	G	A	rs17854511	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr16:19067933G>A	ENST00000304381.5	+	14	2071	c.1941G>A	c.(1939-1941)acG>acA	p.T647T	TMC7_ENST00000421369.3_Silent_p.T537T|TMC7_ENST00000569532.1_Silent_p.T647T	NM_024847.3	NP_079123.3	Q7Z402	TMC7_HUMAN	transmembrane channel-like 7	647					ion transport (GO:0006811)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	28						TCCCCAAGACGGTGAGCACCT	0.547													G|||	2360	0.471246	0.0946	0.5	5008	,	,		17901	0.754		0.6193	False		,,,				2504	0.5164				p.T647T		.											.	TMC7-93	0			c.G1941A						.	G	,	805,3589	321.5+/-297.2	66,673,1458	186.0	139.0	154.0		1611,1941	-11.6	0.0	16	dbSNP_123	154	5150,3450	637.3+/-399.2	1553,2044,703	no	coding-synonymous,coding-synonymous	TMC7	NM_001160364.1,NM_024847.3	,	1619,2717,2161	AA,AG,GG		40.1163,18.3204,45.8288	,	537/614,647/724	19067933	5955,7039	2197	4300	6497	SO:0001819	synonymous_variant	79905	exon14			CAAGACGGTGAGC	AY263165	CCDS10573.1, CCDS53992.1, CCDS73837.1	16p13.11	2008-02-05			ENSG00000170537	ENSG00000170537			23000	protein-coding gene	gene with protein product						12812529, 12906855	Standard	XM_005255597		Approved	FLJ21240	uc002dfq.3	Q7Z402	OTTHUMG00000131456	ENST00000304381.5:c.1941G>A	16.37:g.19067933G>A		Somatic	272	2		WXS	Illumina GAIIx	Phase_I	288	10	NM_024847	0	0	0	0	0	E7ERB6|Q5H9Q8|Q7Z5M4|Q86WX0|Q9H766	Silent	SNP	ENST00000304381.5	37	CCDS10573.1																																																																																			G|0.511;A|0.489		0.547	TMC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254276.3	NM_024847	
PKD1L2	114780	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	81232405	81232405	+	RNA	SNP	A	A	G			TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr16:81232405A>G	ENST00000525539.1	-	0	1404				PKD1L2_ENST00000337114.4_RNA	NM_052892.3	NP_443124.3	Q7Z442	PK1L2_HUMAN	polycystic kidney disease 1-like 2						ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						ATGGTGATCAATAGGTCCTGT	0.542																																					p.L469L		.											.	PKD1L2-92	0			c.T1405C						.						112.0	115.0	114.0					16																	81232405		2013	4170	6183			114780	exon7			TGATCAATAGGTC	AY164483	CCDS61998.1, CCDS61999.1	16q23.2	2014-09-11			ENSG00000166473	ENSG00000166473			21715	protein-coding gene	gene with protein product		607894				12782129	Standard	NM_052892		Approved	KIAA1879	uc002fgf.1	Q7Z442	OTTHUMG00000166126		16.37:g.81232405A>G		Somatic	147	0		WXS	Illumina GAIIx	Phase_I	174	50	NM_001076780	0	0	0	0	0	Q6UEE1|Q6ZN46|Q6ZSP2|Q8N1H9|Q96CL2|Q96Q08	Silent	SNP	ENST00000525539.1	37																																																																																				.		0.542	PKD1L2-001	KNOWN	non_canonical_polymorphism|basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000387972.2		
C17orf97	400566	hgsc.bcm.edu	37	17	260182	260182	+	Silent	SNP	T	T	C	rs7502594	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr17:260182T>C	ENST00000571106.1	+	1	55	c.49T>C	c.(49-51)Tta>Cta	p.L17L	AC108004.3_ENST00000466740.2_RNA|AC108004.3_ENST00000599026.1_RNA|C17orf97_ENST00000360127.6_Silent_p.L17L			Q6ZQX7	CQ097_HUMAN	chromosome 17 open reading frame 97	17										breast(1)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(1)	14						GAGTCGCCGATTAGTCGGCAT	0.751													c|||	1929	0.385184	0.6286	0.2666	5008	,	,		13427	0.3125		0.2396	False		,,,				2504	0.365				p.L17L		.											.	C17orf97-91	0			c.T49C						.			1512,2124		272,968,578	3.0	4.0	4.0		49	2.9	0.0	17	dbSNP_116	4	1503,5991		176,1151,2420	no	coding-synonymous	C17orf97	NM_001013672.4		448,2119,2998	CC,CT,TT		20.056,41.5842,27.0889		17/424	260182	3015,8115	1818	3747	5565	SO:0001819	synonymous_variant	400566	exon1			CGCCGATTAGTCG	AK128660, BC057385	CCDS32519.2	17p13.3	2008-08-15			ENSG00000187624	ENSG00000187624			33800	protein-coding gene	gene with protein product						12477932	Standard	NM_001013672		Approved	LOC400566	uc021tna.1	Q6ZQX7	OTTHUMG00000132479	ENST00000571106.1:c.49T>C	17.37:g.260182T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_001013672	0	0	0	0	0	A5D8T6|Q6NSI2|Q6PFW9	Silent	SNP	ENST00000571106.1	37																																																																																				T|0.657;C|0.343		0.751	C17orf97-003	PUTATIVE	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000436874.1	NM_001013672	
USP43	124739	hgsc.bcm.edu	37	17	9549360	9549360	+	Silent	SNP	T	T	G	rs114382285	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr17:9549360T>G	ENST00000285199.7	+	1	507	c.411T>G	c.(409-411)gcT>gcG	p.A137A	USP43_ENST00000570475.1_Silent_p.A137A|RP11-55L4.2_ENST00000584676.1_RNA|RP11-55L4.1_ENST00000572923.1_RNA|USP43_ENST00000570827.2_Intron	NM_001267576.1|NM_153210.4	NP_001254505.1|NP_694942.3	Q70EL4	UBP43_HUMAN	ubiquitin specific peptidase 43	137	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	26						ACCGGGCGGCTCCGGGCCGCG	0.672													G|||	423	0.0844649	0.2943	0.0288	5008	,	,		10691	0.0		0.005	False		,,,				2504	0.0092				p.A137A		.											.	USP43-637	0			c.T411G						.	G		463,2703		17,429,1137	2.0	3.0	3.0		411	0.1	0.3	17	dbSNP_132	3	18,6822		0,18,3402	no	coding-synonymous	USP43	NM_153210.3		17,447,4539	GG,GT,TT		0.2632,14.6241,4.8071		137/1124	9549360	481,9525	1583	3420	5003	SO:0001819	synonymous_variant	124739	exon1			GGCGGCTCCGGGC	AK055188	CCDS45610.1, CCDS58516.1	17p12	2005-08-08	2005-08-08			ENSG00000154914		"""Ubiquitin-specific peptidases"""	20072	protein-coding gene	gene with protein product			"""ubiquitin specific protease 43"""			12838346	Standard	NM_153210		Approved	FLJ30626	uc010cod.4	Q70EL4		ENST00000285199.7:c.411T>G	17.37:g.9549360T>G		Somatic	2	0		WXS	Illumina GAIIx	Phase_I	8	5	NM_001267576	0	0	0	0	0	A6NDT9|B7ZLT9|B7ZVX5|Q8N2C5|Q96DQ6	Silent	SNP	ENST00000285199.7	37	CCDS45610.1																																																																																			T|0.919;G|0.081		0.672	USP43-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439855.3	NM_153210	
RNF135	84282	hgsc.bcm.edu	37	17	29298304	29298304	+	Missense_Mutation	SNP	C	C	G	rs7225888	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr17:29298304C>G	ENST00000328381.5	+	1	1086	c.213C>G	c.(211-213)caC>caG	p.H71Q	RNF135_ENST00000443677.2_Missense_Mutation_p.H71Q|RNF135_ENST00000324689.4_Missense_Mutation_p.H71Q|RNF135_ENST00000535306.2_Missense_Mutation_p.H71Q|RP11-848P1.2_ENST00000580979.1_RNA	NM_032322.3	NP_115698.3	Q8IUD6	RN135_HUMAN	ring finger protein 135	71			H -> Q (in dbSNP:rs7225888). {ECO:0000269|PubMed:19291764}.		innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|positive regulation of interferon-beta production (GO:0032728)|protein ubiquitination (GO:0016567)|regulation of innate immune response (GO:0045088)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ligase activity (GO:0016874)|ribonucleoprotein complex binding (GO:0043021)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.?(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(1)|skin(2)|urinary_tract(1)	10		all_cancers(10;8.65e-08)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Myeloproliferative disorder(56;0.0255)				AGCAGCCGCACCTGCGGAAGA	0.751													G|||	1093	0.218251	0.7731	0.0548	5008	,	,		12060	0.001		0.0119	False		,,,				2504	0.0204				p.H71Q		.											.	RNF135-227	1	Unknown(1)	central_nervous_system(1)	c.C213G						.	G	GLN/HIS,GLN/HIS,GLN/HIS	1145,1729		129,887,421	2.0	2.0	2.0		213,213,213	3.5	0.1	17	dbSNP_116	2	39,5995		0,39,2978	yes	missense,missense,missense	RNF135	NM_001184992.1,NM_032322.3,NM_197939.1	24,24,24	129,926,3399	GG,GC,CC		0.6463,39.8399,13.2914	benign,benign,benign	71/287,71/433,71/211	29298304	1184,7724	1437	3017	4454	SO:0001583	missense	84282	exon1			GCCGCACCTGCGG	AJ496729	CCDS11262.1, CCDS11263.1, CCDS54104.1	17q11.2	2013-01-09			ENSG00000181481	ENSG00000181481		"""RING-type (C3HC4) zinc fingers"""	21158	protein-coding gene	gene with protein product	"""riplet"""	611358				11468690, 19017631	Standard	NM_001184992		Approved	MGC13061	uc002hfz.3	Q8IUD6	OTTHUMG00000132867	ENST00000328381.5:c.213C>G	17.37:g.29298304C>G	ENSP00000328340:p.His71Gln	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	4	NM_197939	0	0	0	3	3	A0AVM5|B2R7G9|B6ZLM5|F5GX60|Q9BSE9	Missense_Mutation	SNP	ENST00000328381.5	37	CCDS11262.1	391	0.17902930402930403	360	0.7317073170731707	20	0.055248618784530384	1	0.0017482517482517483	10	0.013192612137203167	G	6.815	0.519408	0.13005	0.398399	0.006463	ENSG00000181481	ENST00000328381;ENST00000324689;ENST00000535306;ENST00000443677	T;T;T	0.53857	0.6;3.11;3.09	3.55	3.55	0.40652	Zinc finger, RING/FYVE/PHD-type (1);	1.724060	0.03994	N	0.295353	T	0.00012	0.0000	N	0.00436	-1.5	0.80722	P	0.0	B;B;B;B	0.06786	0.0;0.001;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.46176	-0.9210	9	0.24483	T	0.36	0.0064	10.1192	0.42609	0.0:0.3977:0.6023:0.0	rs7225888;rs57782344;rs7225888	71;71;71;71	F5GX60;Q8IUD6-2;B2R7G9;Q8IUD6	.;.;.;RN135_HUMAN	Q	71;71;71;5	ENSP00000328340:H71Q;ENSP00000323693:H71Q;ENSP00000440470:H71Q	ENSP00000323693:H71Q	H	+	3	2	RNF135	26322430	0.001000	0.12720	0.139000	0.22197	0.013000	0.08279	-0.536000	0.06135	0.594000	0.29761	-0.365000	0.07479	CAC	C|0.810;G|0.190		0.751	RNF135-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256342.3	NM_032322	
KRTAP1-1	81851	broad.mit.edu	37	17	39197304	39197304	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr17:39197304T>C	ENST00000306271.4	-	1	409	c.346A>G	c.(346-348)Atc>Gtc	p.I116V		NM_030967.2	NP_112229.1	Q07627	KRA11_HUMAN	keratin associated protein 1-1	116						keratin filament (GO:0045095)		p.I116V(1)		NS(2)|endometrium(2)|kidney(5)|lung(4)|prostate(1)	14		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			CACCACCTGATACGGGTGCTC	0.662																																					p.I116V		.											.	.	1	Substitution - Missense(1)	NS(1)	c.A346G						.						22.0	27.0	25.0					17																	39197304		2019	4148	6167	SO:0001583	missense	81851	exon1			ACCTGATACGGGT	AJ406926	CCDS42324.1	17q21.2	2014-06-05			ENSG00000188581	ENSG00000188581		"""Keratin associated proteins"""	16772	protein-coding gene	gene with protein product		608819				11279113	Standard	NM_030967		Approved	KAP1.1B, HB2A, KAP1.1, KAP1.1A	uc002hvw.1	Q07627	OTTHUMG00000133592	ENST00000306271.4:c.346A>G	17.37:g.39197304T>C	ENSP00000305975:p.Ile116Val	Somatic	67	0		WXS	Illumina GAIIx	Phase_I	229	8	NM_030967	0	0	0	0	0	A6NC32|Q96S60|Q96S67	Missense_Mutation	SNP	ENST00000306271.4	37	CCDS42324.1	.	.	.	.	.	.	.	.	.	.	T	8.173	0.792133	0.16258	.	.	ENSG00000188581	ENST00000306271;ENST00000543328	T	0.29655	1.56	4.28	-1.23	0.09465	.	.	.	.	.	T	0.12135	0.0295	N	0.03253	-0.375	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.34079	-0.9843	9	0.20046	T	0.44	.	9.4726	0.38851	0.0:0.573:0.0:0.427	.	116	Q07627	KRA11_HUMAN	V	116;106	ENSP00000305975:I116V	ENSP00000305975:I116V	I	-	1	0	KRTAP1-1	36450830	0.132000	0.22450	0.024000	0.17045	0.516000	0.34256	0.017000	0.13399	-0.199000	0.10317	0.529000	0.55759	ATC	.		0.662	KRTAP1-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257696.1	NM_030967	
KRTAP4-8	728224	ucsc.edu	37	17	39254054	39254054	+	Missense_Mutation	SNP	A	A	T	rs76270529		TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr17:39254054A>T	ENST00000333822.4	-	1	339	c.283T>A	c.(283-285)Tgc>Agc	p.C95S		NM_031960.2	NP_114166.1	Q9BYQ9	KRA48_HUMAN	keratin associated protein 4-8	95	25 X 5 AA repeats of C-C-[IKRQVHEC]- [SPRT]-[STCVQPR].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)		p.C95S(4)		endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|prostate(1)	11						ctggagatgcagcagcTAGGG	0.677																																					p.C95S		.											.	.	4	Substitution - Missense(4)	endometrium(3)|kidney(1)	c.T283A						.						7.0	11.0	10.0					17																	39254054		685	1582	2267	SO:0001583	missense	728224	exon1			AGATGCAGCAGCT	AJ406940	CCDS45674.1	17q21.2	2013-06-25			ENSG00000204880	ENSG00000204880		"""Keratin associated proteins"""	17230	protein-coding gene	gene with protein product						11279113	Standard	NM_031960		Approved	KAP4.8	uc010wfo.2	Q9BYQ9	OTTHUMG00000133580	ENST00000333822.4:c.283T>A	17.37:g.39254054A>T	ENSP00000328444:p.Cys95Ser	Somatic	16	1		WXS	Illumina GAIIx	Phase_I	142	25	NM_031960	0	0	0	0	0	A8MSH3	Missense_Mutation	SNP	ENST00000333822.4	37	CCDS45674.1	.	.	.	.	.	.	.	.	.	.	.	15.18	2.755714	0.49362	.	.	ENSG00000204880	ENST00000333822;ENST00000332991	T	0.02280	4.36	3.11	2.01	0.26516	.	0.000000	0.52532	U	0.000067	T	0.04497	0.0123	M	0.83223	2.63	0.25182	N	0.99019	B	0.21606	0.058	B	0.27887	0.084	T	0.21793	-1.0235	10	0.54805	T	0.06	.	6.3859	0.21559	0.8715:0.0:0.1285:0.0	.	95	Q9BYQ9	KRA48_HUMAN	S	95;80	ENSP00000328444:C95S	ENSP00000414561:C80S	C	-	1	0	KRTAP4-8	36507580	0.999000	0.42202	0.393000	0.26258	0.649000	0.38597	3.122000	0.50446	0.404000	0.25506	0.374000	0.22700	TGC	A|0.500;T|0.500		0.677	KRTAP4-8-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257684.1	NM_031960	
KRTAP4-6	81871	broad.mit.edu;ucsc.edu	37	17	39296254	39296254	+	Silent	SNP	C	C	T	rs72483263		TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr17:39296254C>T	ENST00000345847.4	-	1	485	c.486G>A	c.(484-486)ccG>ccA	p.P162P		NM_030976.1	NP_112238.1	Q9BYQ5	KRA46_HUMAN	keratin associated protein 4-6	162	30 X 5 AA repeats of C-C-[IRQVEL]-[SPTR]- [STVQRCP].					keratin filament (GO:0045095)				endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(1)|prostate(1)|urinary_tract(1)	9						ggcagcagcacgggcggcagc	0.662																																					p.P162P		.											.	.	0			c.G486A						.																																			SO:0001819	synonymous_variant	81871	exon1			GCAGCACGGGCGG	AJ406938	CCDS54125.1	17q21.2	2013-06-25			ENSG00000198090	ENSG00000198090		"""Keratin associated proteins"""	18909	protein-coding gene	gene with protein product			"""keratin associated protein 4-15"""	KRTAP4-15			Standard	NM_030976		Approved	KAP4.6, KAP4.15	uc010cxk.2	Q9BYQ5	OTTHUMG00000133634	ENST00000345847.4:c.486G>A	17.37:g.39296254C>T		Somatic	28	1		WXS	Illumina GAIIx	Phase_I	257	72	NM_030976	0	0	0	0	0	Q9BYR1	Silent	SNP	ENST00000345847.4	37	CCDS54125.1																																																																																			C|0.500;T|0.500		0.662	KRTAP4-6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257779.1		
G6PC3	92579	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	42153148	42153148	+	Missense_Mutation	SNP	G	G	A	rs200478425		TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr17:42153148G>A	ENST00000269097.4	+	6	1009	c.778G>A	c.(778-780)Ggc>Agc	p.G260S		NM_138387.3	NP_612396.1	Q9BUM1	G6PC3_HUMAN	glucose 6 phosphatase, catalytic, 3	260			G -> R (in SCN4; loss of function). {ECO:0000269|PubMed:20220065, ECO:0000269|PubMed:20616219}.		carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose 6-phosphate metabolic process (GO:0051156)|glucose transport (GO:0015758)|glucose-6-phosphate transport (GO:0015760)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucose-6-phosphatase activity (GO:0004346)			endometrium(2)|large_intestine(5)|lung(1)|ovary(2)|skin(1)	11		Breast(137;0.00637)|Prostate(33;0.0313)		BRCA - Breast invasive adenocarcinoma(366;0.113)		GGCTGCCCTGGGCCTGGGCAT	0.632																																					p.G260S		.											.	G6PC3-91	0			c.G778A	GRCh37	CM090105	G6PC3	M		.						55.0	53.0	54.0					17																	42153148		2203	4300	6503	SO:0001583	missense	92579	exon6			GCCCTGGGCCTGG	BC021574	CCDS11476.1	17q21.31	2014-09-17				ENSG00000141349			24861	protein-coding gene	gene with protein product		611045				12370122, 12965222	Standard	NM_138387		Approved	UGRP	uc002iex.3	Q9BUM1		ENST00000269097.4:c.778G>A	17.37:g.42153148G>A	ENSP00000269097:p.Gly260Ser	Somatic	51	0		WXS	Illumina GAIIx	Phase_I	80	18	NM_138387	0	0	100	139	39	Q8WU15	Missense_Mutation	SNP	ENST00000269097.4	37	CCDS11476.1	.	.	.	.	.	.	.	.	.	.	G	34	5.400942	0.96030	.	.	ENSG00000141349	ENST00000269097	T	0.80393	-1.37	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	D	0.88377	0.6420	M	0.67700	2.07	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.87633	0.2517	10	0.48119	T	0.1	-49.3741	16.1963	0.82029	0.0:0.0:1.0:0.0	.	260	Q9BUM1	G6PC3_HUMAN	S	260	ENSP00000269097:G260S	ENSP00000269097:G260S	G	+	1	0	G6PC3	39508674	1.000000	0.71417	0.998000	0.56505	0.949000	0.60115	8.003000	0.88520	2.818000	0.97014	0.655000	0.94253	GGC	.		0.632	G6PC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457675.1	NM_138387	
EPB41L3	23136	bcgsc.ca	37	18	5410574	5410574	+	Silent	SNP	A	A	G	rs3817466	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr18:5410574A>G	ENST00000341928.2	-	14	2452	c.2112T>C	c.(2110-2112)acT>acC	p.T704T	EPB41L3_ENST00000427684.2_5'UTR|EPB41L3_ENST00000400111.3_Silent_p.T535T|EPB41L3_ENST00000342933.3_Silent_p.T704T|EPB41L3_ENST00000540638.2_Silent_p.T535T|EPB41L3_ENST00000544123.1_Silent_p.T535T|EPB41L3_ENST00000542146.1_5'UTR|EPB41L3_ENST00000542652.2_5'UTR	NM_012307.2	NP_036439.2	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	704	Spectrin--actin-binding. {ECO:0000255}.				apoptotic process (GO:0006915)|cortical actin cytoskeleton organization (GO:0030866)|cortical cytoskeleton organization (GO:0030865)|cytoskeletal anchoring at plasma membrane (GO:0007016)|myelin maintenance (GO:0043217)|neuron projection morphogenesis (GO:0048812)|paranodal junction assembly (GO:0030913)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|protein localization to plasma membrane (GO:0072659)|regulation of cell shape (GO:0008360)	axolemma (GO:0030673)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|juxtaparanode region of axon (GO:0044224)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(52)|ovary(5)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	105						CCTCAGTGGCAGTGGTCTCCC	0.537													G|||	3564	0.711661	0.2791	0.8156	5008	,	,		17791	0.9177		0.9135	False		,,,				2504	0.8027				p.T704T		.											.	EPB41L3-95	0			c.T2112C						.						102.0	68.0	79.0					18																	5410574		2203	4300	6503	SO:0001819	synonymous_variant	23136	exon14			AGTGGCAGTGGTC	AB023204	CCDS11838.1, CCDS62381.1, CCDS62382.1	18p11.32	2006-06-28			ENSG00000082397	ENSG00000082397			3380	protein-coding gene	gene with protein product		605331				9828140, 9892180	Standard	NM_012307		Approved	DAL1, KIAA0987, 4.1B	uc002kmt.1	Q9Y2J2	OTTHUMG00000131562	ENST00000341928.2:c.2112T>C	18.37:g.5410574A>G		Somatic	155	0		WXS	Illumina GAIIx	Phase_I	138	6	NM_012307	0	0	0	0	0	B7Z4I5|F5GX05|O95713|Q9BRP5	Silent	SNP	ENST00000341928.2	37	CCDS11838.1																																																																																			G|0.754;N|0.001		0.537	EPB41L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254424.1	NM_012307	
ZNF521	25925	hgsc.bcm.edu;broad.mit.edu	37	18	22807146	22807146	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr18:22807146G>C	ENST00000361524.3	-	4	884	c.736C>G	c.(736-738)Cag>Gag	p.Q246E	ZNF521_ENST00000584787.1_Missense_Mutation_p.Q26E|ZNF521_ENST00000538137.2_Missense_Mutation_p.Q246E|ZNF521_ENST00000579111.1_5'Flank	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	246					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					CTGCACTTCTGAGTGTCCTTC	0.537			T	PAX5	ALL																																p.Q246E		.		Dom	yes		18	18q11.2	25925	zinc finger protein 521		L	.	ZNF521-275	0			c.C736G						.						137.0	112.0	120.0					18																	22807146		2203	4300	6503	SO:0001583	missense	25925	exon4			ACTTCTGAGTGTC	AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.736C>G	18.37:g.22807146G>C	ENSP00000354794:p.Gln246Glu	Somatic	136	0		WXS	Illumina GAIIx	Phase_I	108	6	NM_015461	0	0	1	1	0	A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Missense_Mutation	SNP	ENST00000361524.3	37	CCDS32806.1	.	.	.	.	.	.	.	.	.	.	G	10.12	1.261763	0.23051	.	.	ENSG00000198795	ENST00000361524;ENST00000538137;ENST00000399425	T;T	0.08102	3.13;3.16	5.92	5.92	0.95590	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);	0.057177	0.64402	D	0.000001	T	0.05868	0.0153	N	0.08118	0	0.30927	N	0.727374	P	0.36183	0.542	B	0.36766	0.232	T	0.07888	-1.0749	10	0.87932	D	0	-31.812	13.5147	0.61533	0.071:0.0:0.929:0.0	.	246	Q96K83	ZN521_HUMAN	E	246;280;246	ENSP00000354794:Q246E;ENSP00000382352:Q246E	ENSP00000354794:Q246E	Q	-	1	0	ZNF521	21061144	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.318000	0.79029	2.818000	0.97014	0.655000	0.94253	CAG	.		0.537	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446781.2	NM_015461	
TMPRSS9	360200	hgsc.bcm.edu	37	19	2425145	2425145	+	Silent	SNP	C	C	T	rs77360217	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr19:2425145C>T	ENST00000332578.3	+	15	2761	c.2761C>T	c.(2761-2763)Ctg>Ttg	p.L921L		NM_182973.1	NP_892018.1	Q7Z410	TMPS9_HUMAN	transmembrane protease, serine 9	921	Peptidase S1 3. {ECO:0000255|PROSITE- ProRule:PRU00274}.				plasminogen activation (GO:0031639)	integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCTGCTGGAGCTGGCGGGGCC	0.726													C|||	213	0.0425319	0.1528	0.0101	5008	,	,		5183	0.0		0.004	False		,,,				2504	0.0				p.L921L		.											.	TMPRSS9-91	0			c.C2761T						.	C		557,3817		28,501,1658	14.0	12.0	13.0		2761	1.9	1.0	19	dbSNP_131	13	7,8521		0,7,4257	no	coding-synonymous	TMPRSS9	NM_182973.1		28,508,5915	TT,TC,CC		0.0821,12.7343,4.3714		921/1060	2425145	564,12338	2187	4264	6451	SO:0001819	synonymous_variant	360200	exon15			CTGGAGCTGGCGG	AJ488946	CCDS12088.1	19p13.3	2010-04-13						"""Serine peptidases / Transmembrane"""	30079	protein-coding gene	gene with protein product	"""polyserase 1"""	610477				12886014	Standard	NM_182973		Approved		uc010xgx.2	Q7Z410		ENST00000332578.3:c.2761C>T	19.37:g.2425145C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	15	12	NM_182973	0	0	7	12	5	Q6ZND6|Q7Z411	Silent	SNP	ENST00000332578.3	37	CCDS12088.1																																																																																			C|0.956;T|0.044		0.726	TMPRSS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451330.3	NM_182973	
MFSD12	126321	hgsc.bcm.edu	37	19	3547955	3547955	+	Missense_Mutation	SNP	C	C	T	rs10414812	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr19:3547955C>T	ENST00000355415.2	-	4	897	c.728G>A	c.(727-729)cGc>cAc	p.R243H	MFSD12_ENST00000389395.3_Missense_Mutation_p.R243H|MFSD12_ENST00000398558.4_Missense_Mutation_p.R243H|MFSD12_ENST00000591878.1_5'UTR|AC005786.7_ENST00000589360.1_RNA	NM_174983.3	NP_778148.2	Q6NUT3	MFS12_HUMAN	major facilitator superfamily domain containing 12	243			R -> H (in dbSNP:rs10414812).		transport (GO:0006810)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)				cervix(1)|endometrium(2)|lung(4)|urinary_tract(2)	9						ATGCGGCCGGCGCCTCTCCCG	0.697													C|||	390	0.0778754	0.2496	0.0159	5008	,	,		13194	0.001		0.007	False		,,,				2504	0.0419				p.R243H		.											.	.	0			c.G728A						.	C	HIS/ARG,HIS/ARG,HIS/ARG	696,3158		62,572,1293	11.0	14.0	13.0		728,728,728	-2.5	0.0	19	dbSNP_119	13	94,8038		1,92,3973	yes	missense,missense,missense	C19orf28	NM_001042680.1,NM_021731.2,NM_174983.3	29,29,29	63,664,5266	TT,TC,CC		1.1559,18.0592,6.591	benign,benign,benign	243/474,243/539,243/481	3547955	790,11196	1927	4066	5993	SO:0001583	missense	126321	exon4			GGCCGGCGCCTCT	AF218008	CCDS42465.1, CCDS74256.1	19p13.3	2012-03-09	2011-11-24	2011-11-24	ENSG00000161091	ENSG00000161091			28299	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 28"""	C19orf28		12477932	Standard	NM_174983		Approved	MGC20700, PP3501	uc002lxw.3	Q6NUT3		ENST00000355415.2:c.728G>A	19.37:g.3547955C>T	ENSP00000347583:p.Arg243His	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	5	NM_001042680	0	0	18	30	12	A8MXP7|D6W615|E9PAJ8|Q8N459	Missense_Mutation	SNP	ENST00000355415.2	37	CCDS42465.1	111	0.050824175824175824	101	0.20528455284552846	5	0.013812154696132596	0	0.0	5	0.006596306068601583	C	8.455	0.854057	0.17106	0.180592	0.011559	ENSG00000161091	ENST00000389395;ENST00000398558;ENST00000355415	T;T;T	0.81078	-1.45;-1.45;-1.45	4.62	-2.51	0.06365	Major facilitator superfamily domain, general substrate transporter (1);	0.826990	0.10770	N	0.636139	T	0.00109	0.0003	M	0.68952	2.095	0.80722	P	0.0	B;B;B	0.20887	0.002;0.012;0.049	B;B;B	0.14023	0.009;0.004;0.01	T	0.06734	-1.0810	9	0.14656	T	0.56	-17.7259	2.4452	0.04504	0.1012:0.3645:0.2777:0.2565	rs10414812;rs10414812	243;234;243	Q6NUT3;Q6NUT3-2;A8MXP7	CS028_HUMAN;.;.	H	243	ENSP00000374046:R243H;ENSP00000381566:R243H;ENSP00000347583:R243H	ENSP00000347583:R243H	R	-	2	0	C19orf28	3498955	0.000000	0.05858	0.000000	0.03702	0.145000	0.21501	-1.127000	0.03251	0.047000	0.15862	0.555000	0.69702	CGC	C|0.947;T|0.053		0.697	MFSD12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000452949.2	NM_174983	
PNPLA6	10908	hgsc.bcm.edu	37	19	7615942	7615942	+	Silent	SNP	G	G	A	rs113335442	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr19:7615942G>A	ENST00000221249.6	+	20	2447	c.2016G>A	c.(2014-2016)ctG>ctA	p.L672L	PNPLA6_ENST00000600737.1_Silent_p.L711L|PNPLA6_ENST00000545201.2_Silent_p.L646L|PNPLA6_ENST00000450331.3_Silent_p.L672L|PNPLA6_ENST00000414982.3_Silent_p.L720L	NM_006702.4	NP_006693.3	Q8IY17	PLPL6_HUMAN	patatin-like phospholipase domain containing 6	711					angiogenesis (GO:0001525)|cell death (GO:0008219)|lipid catabolic process (GO:0016042)|organ morphogenesis (GO:0009887)|phosphatidylcholine metabolic process (GO:0046470)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	lysophospholipase activity (GO:0004622)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(14)|ovary(3)|stomach(1)|upper_aerodigestive_tract(1)	35						ACACGGAGCTGGCCAAGCTTC	0.721													G|||	46	0.0091853	0.0333	0.0029	5008	,	,		9733	0.0		0.0	False		,,,				2504	0.0				p.L720L		.											.	PNPLA6-47	0			c.G2160A						.	G	,,,,	102,3956		0,102,1927	5.0	6.0	6.0		2160,1938,2016,2133,2016	2.4	1.0	19	dbSNP_132	6	0,7862		0,0,3931	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PNPLA6	NM_001166111.1,NM_001166112.1,NM_001166113.1,NM_001166114.1,NM_006702.4	,,,,	0,102,5858	AA,AG,GG		0.0,2.5136,0.8557	,,,,	720/1376,646/1301,672/1328,711/1366,672/1328	7615942	102,11818	2029	3931	5960	SO:0001819	synonymous_variant	10908	exon19			GGAGCTGGCCAAG	AJ004832	CCDS32891.1, CCDS54206.1, CCDS54207.1, CCDS59343.1	19p13.2	2013-09-11						"""Patatin-like phospholipase domain containing"""	16268	protein-coding gene	gene with protein product	"""neuropathy target esterase"""	603197				9576844, 16799181, 19029121	Standard	NM_006702		Approved	NTE, sws, iPLA2delta, SPG39	uc010xjq.2	Q8IY17		ENST00000221249.6:c.2016G>A	19.37:g.7615942G>A		Somatic	2	0		WXS	Illumina GAIIx	Phase_I	67	32	NM_001166111	0	0	15	27	12	A6NGQ0|B4DFB9|B7Z7T2|F5H5K9|J3KQS3|O60859|Q86W58|Q9UG58	Silent	SNP	ENST00000221249.6	37	CCDS32891.1																																																																																			G|0.992;A|0.008		0.721	PNPLA6-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459275.1	NM_006702	
CD320	51293	hgsc.bcm.edu	37	19	8373152	8373152	+	Missense_Mutation	SNP	T	T	C	rs2232775	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr19:8373152T>C	ENST00000301458.5	-	1	87	c.23A>G	c.(22-24)cAg>cGg	p.Q8R	CD320_ENST00000537716.2_Missense_Mutation_p.Q8R|CD320_ENST00000596246.1_5'UTR	NM_016579.3	NP_057663.1	Q9NPF0	CD320_HUMAN	CD320 molecule	8			Q -> R (in dbSNP:rs2232775). {ECO:0000269|Ref.6}.		cobalamin metabolic process (GO:0009235)|regulation of cell growth (GO:0001558)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cobalamin binding (GO:0031419)			central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(2)	6						CGCTCCAACCTGCGCCATCCA	0.731													C|||	1026	0.204872	0.472	0.0591	5008	,	,		12375	0.0813		0.0437	False		,,,				2504	0.2403				p.Q8R		.											.	CD320-90	0			c.A23G						.	C	ARG/GLN,ARG/GLN	1254,2810		181,892,959	6.0	7.0	7.0		23,23	1.9	0.0	19	dbSNP_98	7	261,8013		4,253,3880	no	missense,missense	CD320	NM_001165895.1,NM_016579.3	43,43	185,1145,4839	CC,CT,TT		3.1545,30.8563,12.2791	benign,benign	8/241,8/283	8373152	1515,10823	2032	4137	6169	SO:0001583	missense	51293	exon1			CCAACCTGCGCCA	AF161254	CCDS12198.1, CCDS54210.1	19p13.3-p13.2	2008-02-05	2006-03-28			ENSG00000167775		"""CD molecules"""	16692	protein-coding gene	gene with protein product	"""8D6 antigen"""	606475	"""CD320 antigen"""			10727470	Standard	NM_016579		Approved	8D6, 8D6A	uc002mjj.2	Q9NPF0		ENST00000301458.5:c.23A>G	19.37:g.8373152T>C	ENSP00000301458:p.Gln8Arg	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	11	6	NM_001165895	0	1	21	39	17	B2RDS5|D6W668|F5H6D3|Q53HF7	Missense_Mutation	SNP	ENST00000301458.5	37	CCDS12198.1	321	0.14697802197802198	223	0.4532520325203252	18	0.049723756906077346	51	0.08916083916083917	29	0.03825857519788918	C	1.030	-0.682008	0.03353	0.308563	0.031545	ENSG00000167775	ENST00000301458;ENST00000537716	D;D	0.95918	-2.91;-3.85	4.09	1.88	0.25563	.	0.730560	0.11271	N	0.581501	T	0.00012	0.0000	N	0.01352	-0.895	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.27365	-1.0076	9	0.02654	T	1	-1.2784	3.6347	0.08145	0.2174:0.5698:0.0:0.2129	rs2232775;rs3180350	8;8	F5H6D3;Q9NPF0	.;CD320_HUMAN	R	8	ENSP00000301458:Q8R;ENSP00000437697:Q8R	ENSP00000301458:Q8R	Q	-	2	0	CD320	8279152	0.000000	0.05858	0.003000	0.11579	0.014000	0.08584	-0.149000	0.10204	0.110000	0.17919	-1.212000	0.01626	CAG	T|0.852;C|0.148		0.731	CD320-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461366.1	NM_016579	
GADD45GIP1	90480	hgsc.bcm.edu	37	19	13067746	13067746	+	Missense_Mutation	SNP	G	G	C	rs137887501	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr19:13067746G>C	ENST00000316939.1	-	1	304	c.281C>G	c.(280-282)cCg>cGg	p.P94R	AC092069.1_ENST00000410560.3_RNA	NM_052850.3	NP_443082.2	Q8TAE8	G45IP_HUMAN	growth arrest and DNA-damage-inducible, gamma interacting protein 1	94					cell cycle (GO:0007049)|viral process (GO:0016032)	mitochondrion (GO:0005739)|nucleus (GO:0005634)				ovary(2)|prostate(1)|skin(1)	4						CGCCAGGCTCGGGTACCATTC	0.701													G|||	21	0.00419329	0.0144	0.0029	5008	,	,		14815	0.0		0.0	False		,,,				2504	0.0				p.P94R		.											.	GADD45GIP1-92	0			c.C281G						.	G	ARG/PRO	38,4366		0,38,2164	21.0	23.0	22.0		281	3.7	0.5	19	dbSNP_134	22	1,8585		0,1,4292	no	missense	GADD45GIP1	NM_052850.2	103	0,39,6456	CC,CG,GG		0.0116,0.8629,0.3002	probably-damaging	94/223	13067746	39,12951	2202	4293	6495	SO:0001583	missense	90480	exon1			AGGCTCGGGTACC	AF479749	CCDS12290.1	19p13.2	2014-02-12				ENSG00000179271			29996	protein-coding gene	gene with protein product	"""papillomavirus L2 interacting nuclear protein 1"", ""CKII beta binding protein 2"", ""CR6 interacting factor 1"", ""p53-responsive gene 6"""	605162				10441517, 12482659	Standard	NM_052850		Approved	PLINP-1, MGC4667, MGC4758, CKBBP2, PRG6, Plinp1, CRIF1, CKbetaBP2	uc002mwb.4	Q8TAE8		ENST00000316939.1:c.281C>G	19.37:g.13067746G>C	ENSP00000323065:p.Pro94Arg	Somatic	4	0		WXS	Illumina GAIIx	Phase_I	37	19	NM_052850	0	0	77	189	112	Q8IVM3|Q8TE51|Q969P9|Q9BSM6	Missense_Mutation	SNP	ENST00000316939.1	37	CCDS12290.1	11	0.005036630036630037	9	0.018292682926829267	2	0.0055248618784530384	0	0.0	0	0.0	G	15.22	2.770027	0.49680	0.008629	1.16E-4	ENSG00000179271	ENST00000316939	.	.	.	4.7	3.67	0.42095	.	0.000000	0.85682	D	0.000000	T	0.61553	0.2356	M	0.67700	2.07	0.52501	D	0.999952	D	0.89917	1.0	D	0.79784	0.993	T	0.72023	-0.4415	9	0.72032	D	0.01	-29.1657	11.7367	0.51769	0.0889:0.0:0.9111:0.0	.	94	Q8TAE8	G45IP_HUMAN	R	94	.	ENSP00000323065:P94R	P	-	2	0	GADD45GIP1	12928746	1.000000	0.71417	0.466000	0.27168	0.005000	0.04900	8.073000	0.89498	0.981000	0.38548	-0.373000	0.07131	CCG	G|0.995;C|0.005		0.701	GADD45GIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452759.2	NM_052850	
NACC1	112939	hgsc.bcm.edu	37	19	13246606	13246606	+	Silent	SNP	C	C	T	rs113254389	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr19:13246606C>T	ENST00000292431.4	+	2	711	c.585C>T	c.(583-585)ggC>ggT	p.G195G		NM_052876.3	NP_443108.1	Q96RE7	NACC1_HUMAN	nucleus accumbens associated 1, BEN and BTB (POZ) domain containing	195	Poly-Gly.				negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|protein homooligomerization (GO:0051260)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear body (GO:0016604)|nucleus (GO:0005634)				endometrium(3)|large_intestine(2)|lung(3)|skin(1)	9						AGGCTGGGGGCGGCGGCAATG	0.697													C|||	121	0.0241613	0.0893	0.0029	5008	,	,		14327	0.0		0.001	False		,,,				2504	0.0				p.G195G		.											.	NACC1-90	0			c.C585T						.	C		218,3760		7,204,1778	6.0	6.0	6.0		585	-6.6	0.0	19	dbSNP_132	6	3,7933		0,3,3965	no	coding-synonymous	NACC1	NM_052876.2		7,207,5743	TT,TC,CC		0.0378,5.4801,1.855		195/528	13246606	221,11693	1989	3968	5957	SO:0001819	synonymous_variant	112939	exon2			TGGGGGCGGCGGC	AF395817	CCDS12294.1	19p13.13	2013-01-09	2008-10-03	2008-10-03		ENSG00000160877		"""BEN domain containing"", ""BTB/POZ domain containing"""	20967	protein-coding gene	gene with protein product	"""nucleus accumbens associated 1"", ""BEN domain containing 8"""	610672	"""BTB (POZ) domain containing 14B"""	BTBD14B		12477932	Standard	NM_052876		Approved	NAC1, NAC-1, BEND8, BTBD30	uc002mwm.4	Q96RE7		ENST00000292431.4:c.585C>T	19.37:g.13246606C>T		Somatic	4	0		WXS	Illumina GAIIx	Phase_I	56	23	NM_052876	0	0	10	15	5		Silent	SNP	ENST00000292431.4	37	CCDS12294.1																																																																																			C|0.978;T|0.022		0.697	NACC1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452879.1	NM_052876	
IER2	9592	hgsc.bcm.edu	37	19	13264242	13264242	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr19:13264242C>T	ENST00000588173.1	+	1	1454	c.242C>T	c.(241-243)gCc>gTc	p.A81V	IER2_ENST00000587885.1_Missense_Mutation_p.A81V|CTC-250I14.6_ENST00000586483.1_RNA|CTC-250I14.6_ENST00000592882.1_RNA|IER2_ENST00000292433.3_Missense_Mutation_p.A81V			Q9BTL4	IER2_HUMAN	immediate early response 2	81						cytoplasm (GO:0005737)				kidney(1)|lung(1)|ovary(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(19;3.41e-21)			GAGTCCACGGCCGAGACAGCG	0.731											OREG0025291	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A81V		.											.	IER2-537	0			c.C242T						.						6.0	6.0	6.0					19																	13264242		2059	4096	6155	SO:0001583	missense	9592	exon2			CCACGGCCGAGAC	M62831	CCDS12295.1	19p13.13	2008-02-05				ENSG00000160888			28871	protein-coding gene	gene with protein product						2061303	Standard	NM_004907		Approved	ETR101	uc002mwr.3	Q9BTL4		ENST00000588173.1:c.242C>T	19.37:g.13264242C>T	ENSP00000465617:p.Ala81Val	Somatic	2	0	686	WXS	Illumina GAIIx	Phase_I	66	41	NM_004907	0	0	21	44	23	Q03827|Q2TAZ2	Missense_Mutation	SNP	ENST00000588173.1	37	CCDS12295.1	.	.	.	.	.	.	.	.	.	.	C	8.324	0.824935	0.16678	.	.	ENSG00000160888	ENST00000292433	T	0.08896	3.04	4.38	2.23	0.28157	.	1.236640	0.05928	N	0.634710	T	0.06645	0.0170	L	0.27053	0.805	0.09310	N	1	B	0.02656	0.0	B	0.10450	0.005	T	0.45833	-0.9234	10	0.12103	T	0.63	-1.0528	7.9006	0.29731	0.0:0.7888:0.0:0.2112	.	81	Q9BTL4	IER2_HUMAN	V	81	ENSP00000292433:A81V	ENSP00000292433:A81V	A	+	2	0	IER2	13125242	0.003000	0.15002	0.001000	0.08648	0.024000	0.10985	1.418000	0.34782	0.299000	0.22661	-0.448000	0.05591	GCC	.		0.731	IER2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453033.1	NM_004907	
PODNL1	79883	hgsc.bcm.edu	37	19	14043843	14043843	+	Missense_Mutation	SNP	C	C	T	rs80103045	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr19:14043843C>T	ENST00000339560.5	-	8	1487	c.1214G>A	c.(1213-1215)cGc>cAc	p.R405H	PODNL1_ENST00000538371.2_Missense_Mutation_p.R403H|PODNL1_ENST00000538517.2_Missense_Mutation_p.R314H|PODNL1_ENST00000254320.3_Missense_Mutation_p.R323H	NM_024825.3	NP_079101.3	Q6PEZ8	PONL1_HUMAN	podocan-like 1	405	Leu-rich.					proteinaceous extracellular matrix (GO:0005578)				central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)|skin(1)	8			OV - Ovarian serous cystadenocarcinoma(19;5.26e-23)			ACGCAACCGGCGGAAGGCCCG	0.711													C|||	153	0.0305511	0.1074	0.0029	5008	,	,		15309	0.0		0.001	False		,,,				2504	0.0082				p.R405H		.											.	PODNL1-90	0			c.G1214A						.	C	HIS/ARG,HIS/ARG,HIS/ARG	318,3856		6,306,1775	6.0	7.0	7.0		1208,941,1214	3.8	0.9	19	dbSNP_131	7	17,8171		0,17,4077	yes	missense,missense,missense	PODNL1	NM_001146254.1,NM_001146255.1,NM_024825.3	29,29,29	6,323,5852	TT,TC,CC		0.2076,7.6186,2.7099	probably-damaging,probably-damaging,probably-damaging	403/511,314/422,405/513	14043843	335,12027	2087	4094	6181	SO:0001583	missense	79883	exon8			AACCGGCGGAAGG	AK027100	CCDS12300.1, CCDS54225.1, CCDS54226.1	19p13.12	2008-02-05							26275	protein-coding gene	gene with protein product						12477932	Standard	NM_024825		Approved	FLJ23447, SLRR5B	uc010xnj.2	Q6PEZ8		ENST00000339560.5:c.1214G>A	19.37:g.14043843C>T	ENSP00000345175:p.Arg405His	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_024825	0	0	0	0	0	B7Z564|Q9H5G9	Missense_Mutation	SNP	ENST00000339560.5	37	CCDS12300.1	34	0.015567765567765568	32	0.06504065040650407	2	0.0055248618784530384	0	0.0	0	0.0	C	13.68	2.309090	0.40895	0.076186	0.002076	ENSG00000132000	ENST00000538371;ENST00000538517;ENST00000339560;ENST00000545071;ENST00000254320	T;T;T;T	0.57436	0.4;0.4;0.4;0.4	4.79	3.76	0.43208	.	0.451987	0.18547	N	0.138005	T	0.02267	0.0070	N	0.16066	0.365	0.26971	N	0.965586	B;B;B;B	0.29037	0.046;0.231;0.113;0.224	B;B;B;B	0.33690	0.046;0.115;0.052;0.168	T	0.04400	-1.0954	10	0.51188	T	0.08	.	10.0503	0.42212	0.0:0.9024:0.0:0.0976	.	403;323;314;405	F5H7F9;B7Z3M0;G3V1J6;Q6PEZ8	.;.;.;PONL1_HUMAN	H	403;314;405;255;323	ENSP00000442553:R403H;ENSP00000440080:R314H;ENSP00000345175:R405H;ENSP00000254320:R323H	ENSP00000254320:R323H	R	-	2	0	PODNL1	13904843	0.997000	0.39634	0.903000	0.35520	0.313000	0.28021	2.510000	0.45468	1.015000	0.39444	0.453000	0.30009	CGC	C|0.980;T|0.020		0.711	PODNL1-003	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457967.1	NM_024825	
PKN1	5585	hgsc.bcm.edu	37	19	14552020	14552020	+	Silent	SNP	C	C	T	rs369378980	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr19:14552020C>T	ENST00000242783.6	+	2	252	c.87C>T	c.(85-87)ccC>ccT	p.P29P	PKN1_ENST00000587429.1_3'UTR|PKN1_ENST00000342216.4_Silent_p.P35P	NM_002741.3	NP_002732.3	Q16512	PKN1_HUMAN	protein kinase N1	29					activation of JUN kinase activity (GO:0007257)|epithelial cell migration (GO:0010631)|histone H3-T11 phosphorylation (GO:0035407)|hyperosmotic response (GO:0006972)|protein phosphorylation (GO:0006468)|regulation of cell motility (GO:2000145)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|GTP-Rho binding (GO:0017049)|histone binding (GO:0042393)|histone deacetylase binding (GO:0042826)|histone kinase activity (H3-T11 specific) (GO:0035402)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|Rac GTPase binding (GO:0048365)			breast(3)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)	31						TGGCGGCCCCCGGGGTACAGC	0.687													C|||	8	0.00159744	0.0053	0.0014	5008	,	,		15693	0.0		0.0	False		,,,				2504	0.0				p.P35P	NSCLC(185;2539 2965 10733 52867)	.											.	PKN1-1481	0			c.C105T						.	C	,	16,3562		0,16,1773	7.0	9.0	8.0		87,105	-8.3	0.6	19		8	0,7796		0,0,3898	no	coding-synonymous,coding-synonymous	PKN1	NM_002741.3,NM_213560.1	,	0,16,5671	TT,TC,CC		0.0,0.4472,0.1407	,	29/943,35/949	14552020	16,11358	1789	3898	5687	SO:0001819	synonymous_variant	5585	exon2			GGCCCCCGGGGTA	S75546	CCDS42513.1, CCDS42514.1	19p13.12	2008-05-14	2004-07-01	2004-07-01	ENSG00000123143	ENSG00000123143			9405	protein-coding gene	gene with protein product		601032	"""protein kinase C-like 1"""	PRKCL1		9570957	Standard	NM_002741		Approved	DBK, PRK1, PKN, MGC46204, PAK1	uc002myq.3	Q16512	OTTHUMG00000039611	ENST00000242783.6:c.87C>T	19.37:g.14552020C>T		Somatic	2	0		WXS	Illumina GAIIx	Phase_I	29	21	NM_213560	0	0	13	23	10	A8K7W5|B2R9R4|B3KVN3|Q15143|Q504U4|Q8IUV5|Q9UD44	Silent	SNP	ENST00000242783.6	37	CCDS42513.1																																																																																			.		0.687	PKN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095510.1	NM_002741, NM_213560	
ZNF85	7639	broad.mit.edu	37	19	21117821	21117821	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr19:21117821A>C	ENST00000328178.8	+	3	310	c.197A>C	c.(196-198)aAg>aCg	p.K66T	ZNF85_ENST00000601023.1_5'Flank|ZNF85_ENST00000345030.6_Intron|ZNF85_ENST00000597314.1_Missense_Mutation_p.E60D|ZNF85_ENST00000596476.1_Missense_Mutation_p.K34T|ZNF85_ENST00000300540.3_Missense_Mutation_p.K66T	NM_001256173.1|NM_003429.4	NP_001243102.1|NP_003420.2	Q03923	ZNF85_HUMAN	zinc finger protein 85	66	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)	20						TGGAGTATGAAGAGACATGAG	0.413																																					p.K66T		.											.	ZNF85-514	0			c.A197C						.						60.0	58.0	59.0					19																	21117821		2203	4300	6503	SO:0001583	missense	7639	exon3			GTATGAAGAGACA	U35376	CCDS32977.1, CCDS58657.1	19p12	2013-01-08	2006-05-12			ENSG00000105750		"""Zinc fingers, C2H2-type"", ""-"""	13160	protein-coding gene	gene with protein product		603899	"""zinc finger protein 85 (HPF4, HTF1)"""			2505992	Standard	NM_003429		Approved	HPF4, HTF1	uc031rjx.1	Q03923		ENST00000328178.8:c.197A>C	19.37:g.21117821A>C	ENSP00000329793:p.Lys66Thr	Somatic	266	0		WXS	Illumina GAIIx	Phase_I	387	8	NM_003429	0	0	1	1	0	B9ZVP4|Q6NVI0	Missense_Mutation	SNP	ENST00000328178.8	37	CCDS32977.1	.	.	.	.	.	.	.	.	.	.	.	11.16	1.557072	0.27827	.	.	ENSG00000105750	ENST00000328178;ENST00000300540	T;T	0.05319	3.46;5.7	1.05	1.05	0.20165	Krueppel-associated box (1);	.	.	.	.	T	0.06781	0.0173	L	0.58583	1.82	0.09310	N	1	B	0.26744	0.158	B	0.17433	0.018	T	0.32719	-0.9896	9	0.87932	D	0	.	4.1668	0.10310	1.0:0.0:0.0:0.0	.	66	Q03923	ZNF85_HUMAN	T	66	ENSP00000329793:K66T;ENSP00000300540:K66T	ENSP00000300540:K66T	K	+	2	0	ZNF85	20909661	0.288000	0.24324	0.013000	0.15412	0.013000	0.08279	1.157000	0.31724	0.389000	0.25086	0.379000	0.24179	AAG	.		0.413	ZNF85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463430.1	NM_003429	
MEGF8	1954	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	42841342	42841342	+	Silent	SNP	G	G	A	rs374205876		TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr19:42841342G>A	ENST00000251268.6	+	8	1497	c.1497G>A	c.(1495-1497)ccG>ccA	p.P499P	MEGF8_ENST00000334370.4_Silent_p.P499P	NM_001271938.1	NP_001258867.1	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	499					BMP signaling pathway (GO:0030509)|cell migration involved in gastrulation (GO:0042074)|craniofacial suture morphogenesis (GO:0097094)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of heart left/right asymmetry (GO:0061371)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic heart tube morphogenesis (GO:0003143)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|epiboly involved in gastrulation with mouth forming second (GO:0055113)|fasciculation of sensory neuron axon (GO:0097155)|left/right pattern formation (GO:0060972)|limb morphogenesis (GO:0035108)|positive regulation of axon extension involved in axon guidance (GO:0048842)|regulation of gene expression (GO:0010468)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|receptor activity (GO:0004872)			breast(2)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	50		Prostate(69;0.00682)				AGCTTGCCCCGCCAGGAACCC	0.572																																					p.P499P		.											.	MEGF8-23	0			c.G1497A						.	G		0,4406		0,0,2203	69.0	67.0	68.0		1497	-9.1	0.4	19		68	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	MEGF8	NM_001410.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		499/2779	42841342	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	1954	exon8			TGCCCCGCCAGGA	AB011541	CCDS12604.2, CCDS62693.1	19q13.2	2011-11-24	2006-03-31	2006-03-31	ENSG00000105429	ENSG00000105429			3233	protein-coding gene	gene with protein product	"""HBV pre s2 binding protein 1"""	604267	"""EGF-like-domain, multiple 4"", ""chromosome 19 open reading frame 49"""	EGFL4, C19orf49		9693030	Standard	NM_001410		Approved	SBP1, FLJ22365	uc002otm.5	Q7Z7M0	OTTHUMG00000150342	ENST00000251268.6:c.1497G>A	19.37:g.42841342G>A		Somatic	82	0		WXS	Illumina GAIIx	Phase_I	122	27	NM_001271938	0	0	2	2	0	A8KAY0|O75097	Silent	SNP	ENST00000251268.6	37																																																																																				.		0.572	MEGF8-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000463854.1	NM_001410	
TPRX1	284355	ucsc.edu	37	19	48305650	48305650	+	Silent	SNP	C	C	T	rs112397458		TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr19:48305650C>T	ENST00000322175.3	-	2	773	c.618G>A	c.(616-618)ccG>ccA	p.P206P	TPRX1_ENST00000535759.1_Silent_p.P303P|TPRX1_ENST00000543508.1_Silent_p.P196P	NM_198479.2	NP_940881.2	Q8N7U7	TPRX1_HUMAN	tetra-peptide repeat homeobox 1	206	Gly-rich.			P -> L (in Ref. 1; BAC05130). {ECO:0000305}.		nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(5)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)|skin(1)	18		all_cancers(25;3.02e-09)|all_epithelial(76;7e-07)|all_lung(116;2.48e-06)|Lung NSC(112;5.15e-06)|Ovarian(192;0.0139)|all_neural(266;0.0146)|Breast(70;0.133)		OV - Ovarian serous cystadenocarcinoma(262;0.000241)|all cancers(93;0.00036)|Epithelial(262;0.0127)|GBM - Glioblastoma multiforme(486;0.048)		ggcctgggatcgggcctggga	0.677																																					p.P206P	Esophageal Squamous(123;175 2281 3051 32395)	.											.	TPRX1-90	0			c.G618A						.	T		31,3587		0,31,1778	12.0	9.0	10.0		618	-0.8	0.0	19	dbSNP_132	10	264,6594		0,264,3165	no	coding-synonymous	TPRX1	NM_198479.2		0,295,4943	TT,TC,CC		3.8495,0.8568,2.816		206/412	48305650	295,10181	1809	3429	5238	SO:0001819	synonymous_variant	284355	exon2			TGGGATCGGGCCT		CCDS33066.1	19q13.33	2011-07-08			ENSG00000178928	ENSG00000178928		"""Homeoboxes / PRD class"""	32174	protein-coding gene	gene with protein product		611166					Standard	XM_005258788		Approved	FLJ40321	uc002php.2	Q8N7U7		ENST00000322175.3:c.618G>A	19.37:g.48305650C>T		Somatic	21	0		WXS	Illumina GAIIx	Phase_I	60	8	NM_198479	0	0	0	0	0	A5D8Y3|B2RPL5	Silent	SNP	ENST00000322175.3	37	CCDS33066.1																																																																																			C|0.912;T|0.088		0.677	TPRX1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409868.1	NM_198479	
SIGLEC5	8778	bcgsc.ca	37	19	52115645	52115645	+	Missense_Mutation	SNP	G	G	C	rs3829655	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr19:52115645G>C	ENST00000534261.2	-	10	1894	c.1495C>G	c.(1495-1497)Ccc>Gcc	p.P499A	SIGLEC5_ENST00000429354.3_Missense_Mutation_p.P499A|SIGLEC5_ENST00000599649.1_Missense_Mutation_p.P499A|SIGLEC5_ENST00000570106.2_Missense_Mutation_p.P499A|SIGLEC5_ENST00000222107.4_Missense_Mutation_p.P499A			O15389	SIGL5_HUMAN	sialic acid binding Ig-like lectin 5	499			P -> A (in dbSNP:rs3829655). {ECO:0000269|PubMed:15489334}.		cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|large_intestine(4)|lung(9)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	27		all_neural(266;0.0726)		GBM - Glioblastoma multiforme(134;0.00124)|OV - Ovarian serous cystadenocarcinoma(262;0.0218)		TGATCTCCGGGGCTGTCTGGC	0.498													G|||	2180	0.435304	0.3275	0.4683	5008	,	,		19086	0.5794		0.4225	False		,,,				2504	0.4223				p.P499A		.											.	SIGLEC5-92	0			c.C1495G						.	G	ALA/PRO	1423,2983	460.7+/-352.7	244,935,1024	72.0	75.0	74.0		1495	-1.3	0.0	19	dbSNP_107	74	3753,4847	527.6+/-381.2	800,2153,1347	yes	missense	SIGLEC5	NM_003830.2	27	1044,3088,2371	CC,CG,GG		43.6395,32.2969,39.797	benign	499/552	52115645	5176,7830	2203	4300	6503	SO:0001583	missense	8778	exon9			CTCCGGGGCTGTC	U71383	CCDS33088.1	19q13.41	2013-01-29			ENSG00000105501	ENSG00000105501		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10874	protein-coding gene	gene with protein product		604200		CD33L2		10343116	Standard	NM_003830		Approved	OB-BP2, SIGLEC-5, CD170	uc002pxe.4	O15389	OTTHUMG00000165510	ENST00000534261.2:c.1495C>G	19.37:g.52115645G>C	ENSP00000473238:p.Pro499Ala	Somatic	31	0		WXS	Illumina GAIIx	Phase_I	44	4	NM_003830	0	0	0	0	0		Missense_Mutation	SNP	ENST00000534261.2	37	CCDS33088.1	970	0.4441391941391941	151	0.30691056910569103	166	0.4585635359116022	319	0.5576923076923077	334	0.44063324538258575	G	8.436	0.849683	0.17034	0.322969	0.436395	ENSG00000105501	ENST00000222107;ENST00000429354	T;T	0.59364	0.27;0.27	3.52	-1.27	0.09347	.	.	.	.	.	T	0.00012	0.0000	M	0.64567	1.98	0.80722	P	0.0	P	0.52463	0.953	B	0.42462	0.388	T	0.40270	-0.9572	8	0.52906	T	0.07	.	1.8675	0.03201	0.1081:0.1749:0.3589:0.3581	rs3829655;rs17852717;rs3829655	499	O15389	SIGL5_HUMAN	A	499	ENSP00000222107:P499A;ENSP00000415200:P499A	ENSP00000222107:P499A	P	-	1	0	SIGLEC5	56807457	0.005000	0.15991	0.005000	0.12908	0.005000	0.04900	0.278000	0.18753	-0.109000	0.12044	-0.152000	0.13540	CCC	G|0.550;C|0.450		0.498	SIGLEC5-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466897.2	NM_003830	
ZNF813	126017	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	53994970	53994970	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr19:53994970A>G	ENST00000396403.4	+	4	1612	c.1484A>G	c.(1483-1485)tAc>tGc	p.Y495C	ZNF813_ENST00000396421.4_Intron	NM_001004301.3	NP_001004301.2	Q6ZN06	ZN813_HUMAN	zinc finger protein 813	495					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(1)	1				GBM - Glioblastoma multiforme(134;0.00619)		GAGAAACCTTACAAGTGTAAT	0.398																																					p.Y495C		.											.	ZNF813-67	0			c.A1484G						.						51.0	55.0	54.0					19																	53994970		2200	4295	6495	SO:0001583	missense	126017	exon4			AACCTTACAAGTG	AK091460	CCDS46172.1	19q13.41	2013-01-08			ENSG00000198346	ENSG00000198346		"""Zinc fingers, C2H2-type"", ""-"""	33257	protein-coding gene	gene with protein product							Standard	NM_001004301		Approved	FLJ16542	uc002qbu.2	Q6ZN06	OTTHUMG00000158309	ENST00000396403.4:c.1484A>G	19.37:g.53994970A>G	ENSP00000379684:p.Tyr495Cys	Somatic	184	0		WXS	Illumina GAIIx	Phase_I	230	42	NM_001004301	0	0	51	51	0		Missense_Mutation	SNP	ENST00000396403.4	37	CCDS46172.1	.	.	.	.	.	.	.	.	.	.	a	9.898	1.206052	0.22205	.	.	ENSG00000198346	ENST00000396403	T	0.25414	1.8	1.15	1.15	0.20763	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.28928	0.0718	M	0.83692	2.655	0.25533	N	0.987251	P	0.43314	0.803	B	0.39904	0.313	T	0.26360	-1.0105	9	0.87932	D	0	.	4.1926	0.10428	0.6957:0.0:0.0:0.3043	.	495	Q6ZN06	ZN813_HUMAN	C	495	ENSP00000379684:Y495C	ENSP00000379684:Y495C	Y	+	2	0	ZNF813	58686782	0.000000	0.05858	0.129000	0.21949	0.128000	0.20619	-1.834000	0.01693	0.168000	0.19655	0.166000	0.16787	TAC	.		0.398	ZNF813-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350638.1	NM_001004301	
CDC42EP5	148170	hgsc.bcm.edu	37	19	54976342	54976342	+	Silent	SNP	G	G	C	rs117435208	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr19:54976342G>C	ENST00000301200.2	-	3	731	c.390C>G	c.(388-390)ccC>ccG	p.P130P	LENG9_ENST00000333834.4_5'Flank	NM_145057.2	NP_659494.2	Q6NZY7	BORG3_HUMAN	CDC42 effector protein (Rho GTPase binding) 5	130					JNK cascade (GO:0007254)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of pseudopodium assembly (GO:0031274)|regulation of cell shape (GO:0008360)|Rho protein signal transduction (GO:0007266)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTP-Rho binding (GO:0017049)			lung(1)|skin(1)	2	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.138)		AGCGGGCCTGGGGGGGCTGCG	0.756													G|||	252	0.0503195	0.0703	0.0274	5008	,	,		7019	0.0704		0.0149	False		,,,				2504	0.0552				p.P130P		.											.	CDC42EP5-90	0			c.C390G						.	G		132,3050		0,132,1459	3.0	4.0	4.0		390	1.9	0.3	19	dbSNP_132	4	77,6191		0,77,3057	no	coding-synonymous	CDC42EP5	NM_145057.2		0,209,4516	CC,CG,GG		1.2285,4.1483,2.2116		130/149	54976342	209,9241	1591	3134	4725	SO:0001819	synonymous_variant	148170	exon3			GGCCTGGGGGGGC	BC024327	CCDS12896.1	19q13.42	2008-02-05			ENSG00000167617	ENSG00000167617			17408	protein-coding gene	gene with protein product		609171					Standard	NM_145057		Approved	CEP5, Borg3	uc002qfz.1	Q6NZY7	OTTHUMG00000065699	ENST00000301200.2:c.390C>G	19.37:g.54976342G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	11	5	NM_145057	0	0	1	1	0	B0VJZ2|Q8TB51	Silent	SNP	ENST00000301200.2	37	CCDS12896.1																																																																																			G|0.955;C|0.045		0.756	CDC42EP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140804.1	NM_145057	
PTPRH	5794	broad.mit.edu	37	19	55716805	55716805	+	Missense_Mutation	SNP	G	G	A	rs200319382		TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr19:55716805G>A	ENST00000376350.3	-	4	530	c.508C>T	c.(508-510)Cac>Tac	p.H170Y	PTPRH_ENST00000263434.5_Intron|PTPRH_ENST00000588559.1_5'UTR	NM_002842.3	NP_002833.3	Q9HD43	PTPRH_HUMAN	protein tyrosine phosphatase, receptor type, H	170	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				apoptotic process (GO:0006915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(8)|lung(27)|ovary(2)|prostate(5)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	67		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0479)		ATGTTAGTGTGTGCTGTGCTT	0.567													t|||	1	0.000199681	0.0	0.0	5008	,	,		19765	0.001		0.0	False		,,,				2504	0.0				p.H170Y		.											.	PTPRH-138	0			c.C508T						.						162.0	144.0	150.0					19																	55716805		2203	4299	6502	SO:0001583	missense	5794	exon4			TAGTGTGTGCTGT		CCDS33110.1, CCDS54321.1	19q13.4	2013-02-11				ENSG00000080031		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9672	protein-coding gene	gene with protein product		602510				8294459	Standard	XM_006723312		Approved	SAP-1	uc002qjq.3	Q9HD43		ENST00000376350.3:c.508C>T	19.37:g.55716805G>A	ENSP00000365528:p.His170Tyr	Somatic	283	2		WXS	Illumina GAIIx	Phase_I	364	11	NM_002842	0	0	1	1	0	C9JCH2|Q15426|Q2NKN9|Q2NKP0	Missense_Mutation	SNP	ENST00000376350.3	37	CCDS33110.1	.	.	.	.	.	.	.	.	.	.	t	14.77	2.635065	0.47049	.	.	ENSG00000080031	ENST00000376350	T	0.57436	0.4	3.93	-1.55	0.08558	Fibronectin, type III (4);Immunoglobulin-like fold (1);	3.173960	0.01664	N	0.025272	T	0.37046	0.0989	N	0.14661	0.345	0.09310	N	1	B	0.31519	0.327	B	0.35607	0.206	T	0.21759	-1.0236	10	0.51188	T	0.08	.	4.2695	0.10780	0.0:0.3384:0.3199:0.3416	.	170	Q9HD43	PTPRH_HUMAN	Y	170	ENSP00000365528:H170Y	ENSP00000365528:H170Y	H	-	1	0	PTPRH	60408617	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.994000	0.00656	-0.644000	0.05465	-2.191000	0.00312	CAC	.		0.567	PTPRH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452649.1		
NTSR2	23620	hgsc.bcm.edu	37	2	11810118	11810118	+	Silent	SNP	G	G	C	rs113661052	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr2:11810118G>C	ENST00000306928.5	-	1	172	c.138C>G	c.(136-138)ggC>ggG	p.G46G		NM_012344.3	NP_036476	O95665	NTR2_HUMAN	neurotensin receptor 2	46					cell surface receptor signaling pathway (GO:0007166)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|regulation of membrane potential (GO:0042391)|sensory perception (GO:0007600)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled neurotensin receptor activity (GO:0016492)|G-protein coupled receptor activity (GO:0004930)			breast(1)|large_intestine(7)|lung(7)|prostate(1)|urinary_tract(1)	17	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.129)|OV - Ovarian serous cystadenocarcinoma(76;0.24)	Levocabastine(DB01106)	TGCCCGCCGCGCCCAGCGCCC	0.761													G|||	39	0.00778754	0.0295	0.0	5008	,	,		13834	0.0		0.0	False		,,,				2504	0.0				p.G46G		.											.	NTSR2-946	0			c.C138G						.						2.0	2.0	2.0					2																	11810118		1399	2802	4201	SO:0001819	synonymous_variant	23620	exon1			CGCCGCGCCCAGC	Y10148	CCDS1681.1	2p25.1	2012-08-08			ENSG00000169006	ENSG00000169006		"""GPCR / Class A : Neurotensin receptors"""	8040	protein-coding gene	gene with protein product		605538				8647296, 9851594	Standard	NM_012344		Approved	NTR2	uc002rbq.4	O95665	OTTHUMG00000119083	ENST00000306928.5:c.138C>G	2.37:g.11810118G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	23	13	NM_012344	0	0	0	1	1	Q53QQ5|Q57Z87|Q8IY58|Q8TBH6	Silent	SNP	ENST00000306928.5	37	CCDS1681.1																																																																																			G|0.500;C|0.500		0.761	NTSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239297.1		
DNAH6	1768	broad.mit.edu	37	2	84880658	84880658	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr2:84880658T>C	ENST00000237449.6	+	33	5302	c.5294T>C	c.(5293-5295)aTa>aCa	p.I1765T	DNAH6_ENST00000389394.3_Missense_Mutation_p.I1765T|DNAH6_ENST00000398278.2_Missense_Mutation_p.I1765T			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	1765	AAA 2. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						GTTTACCGAATACTAGCAGAA	0.378																																					p.I1765T		.											.	DNAH6-69	0			c.T5294C						.						76.0	70.0	72.0					2																	84880658		692	1591	2283	SO:0001583	missense	1768	exon34			ACCGAATACTAGC	U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.5294T>C	2.37:g.84880658T>C	ENSP00000237449:p.Ile1765Thr	Somatic	106	0		WXS	Illumina GAIIx	Phase_I	140	6	NM_001370	0	0	0	0	0	A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Missense_Mutation	SNP	ENST00000237449.6	37	CCDS46348.1	.	.	.	.	.	.	.	.	.	.	T	7.708	0.694432	0.15039	.	.	ENSG00000115423	ENST00000389394;ENST00000398278;ENST00000237449	T;T;T	0.53423	0.62;0.62;0.62	5.14	5.14	0.70334	ATPase, AAA+ type, core (1);ATPase, dynein-related, AAA domain (1);	.	.	.	.	T	0.25901	0.0631	N	0.03224	-0.385	0.25226	N	0.989868	B	0.09022	0.002	B	0.18263	0.021	T	0.09509	-1.0671	9	0.13853	T	0.58	.	13.9485	0.64101	0.0:0.0:0.0:1.0	.	1765	Q9C0G6	DYH6_HUMAN	T	1765	ENSP00000374045:I1765T;ENSP00000381326:I1765T;ENSP00000237449:I1765T	ENSP00000237449:I1765T	I	+	2	0	DNAH6	84734169	0.979000	0.34478	0.982000	0.44146	0.977000	0.68977	3.469000	0.53093	1.947000	0.56498	0.445000	0.29226	ATA	.		0.378	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328537.2	NM_001370	
C2orf40	84417	hgsc.bcm.edu	37	2	106682226	106682226	+	Silent	SNP	T	T	C	rs4271786|rs543094154	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr2:106682226T>C	ENST00000238044.3	+	1	115	c.6T>C	c.(4-6)gcT>gcC	p.A2A	C2orf40_ENST00000489174.1_Intron|C2orf40_ENST00000409944.1_Intron	NM_032411.2	NP_115787.1	Q9H1Z8	AUGN_HUMAN	chromosome 2 open reading frame 40	2					cellular senescence (GO:0090398)|cyclin catabolic process (GO:0008054)|G1 to G0 transition (GO:0070314)	cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)				lung(7)|urinary_tract(1)	8						CCGCCATGGCTGCCTCCCCCG	0.766													C|||	1272	0.253994	0.2753	0.1369	5008	,	,		11771	0.2411		0.2227	False		,,,				2504	0.3538				p.A2A		.											.	C2orf40-90	0			c.T6C						.	C		520,2666		23,474,1096	2.0	3.0	3.0		6	1.0	0.3	2	dbSNP_111	3	871,5647		54,763,2442	no	coding-synonymous	C2orf40	NM_032411.2		77,1237,3538	CC,CT,TT		13.363,16.3214,14.3343		2/149	106682226	1391,8313	1593	3259	4852	SO:0001819	synonymous_variant	84417	exon1			CATGGCTGCCTCC	BC021742	CCDS2072.1	2q12.2	2014-01-28			ENSG00000119147	ENSG00000119147			24642	protein-coding gene	gene with protein product	"""esophageal cancer related gene 4 protein"""	611752				12800218	Standard	NM_032411		Approved	ECRG4, augurin	uc010fjf.3	Q9H1Z8	OTTHUMG00000130921	ENST00000238044.3:c.6T>C	2.37:g.106682226T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_032411	0	0	0	0	0	D3DVK2	Silent	SNP	ENST00000238044.3	37	CCDS2072.1																																																																																			T|0.765;C|0.235		0.766	C2orf40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253515.2	NM_032411	
C2orf40	84417	hgsc.bcm.edu	37	2	106682235	106682235	+	Silent	SNP	C	C	G	rs4266035	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr2:106682235C>G	ENST00000238044.3	+	1	124	c.15C>G	c.(13-15)ccC>ccG	p.P5P	C2orf40_ENST00000489174.1_Intron|C2orf40_ENST00000409944.1_Intron	NM_032411.2	NP_115787.1	Q9H1Z8	AUGN_HUMAN	chromosome 2 open reading frame 40	5					cellular senescence (GO:0090398)|cyclin catabolic process (GO:0008054)|G1 to G0 transition (GO:0070314)	cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)				lung(7)|urinary_tract(1)	8						CTGCCTCCCCCGCGCGGCCTG	0.751													C|||	1156	0.230831	0.18	0.1239	5008	,	,		11837	0.2391		0.2187	False		,,,				2504	0.3793				p.P5P		.											.	C2orf40-90	0			c.C15G						.						2.0	3.0	3.0					2																	106682235		1650	3370	5020	SO:0001819	synonymous_variant	84417	exon1			CTCCCCCGCGCGG	BC021742	CCDS2072.1	2q12.2	2014-01-28			ENSG00000119147	ENSG00000119147			24642	protein-coding gene	gene with protein product	"""esophageal cancer related gene 4 protein"""	611752				12800218	Standard	NM_032411		Approved	ECRG4, augurin	uc010fjf.3	Q9H1Z8	OTTHUMG00000130921	ENST00000238044.3:c.15C>G	2.37:g.106682235C>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_032411	0	0	0	0	0	D3DVK2	Silent	SNP	ENST00000238044.3	37	CCDS2072.1																																																																																			C|0.795;G|0.205		0.751	C2orf40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253515.2	NM_032411	
SH3RF3	344558	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	110053528	110053528	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr2:110053528C>G	ENST00000309415.6	+	7	1754	c.1754C>G	c.(1753-1755)tCg>tGg	p.S585W		NM_001099289.1	NP_001092759.1	Q8TEJ3	SH3R3_HUMAN	SH3 domain containing ring finger 3	585							zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(6)|liver(2)|lung(5)|ovary(2)	18						CCCACAGCCTCGCCCCCAACA	0.682																																					p.S585W		.											.	SH3RF3-24	0			c.C1754G						.						28.0	43.0	38.0					2																	110053528		2117	4210	6327	SO:0001583	missense	344558	exon7			CAGCCTCGCCCCC	AK074131	CCDS74557.1	2q13	2013-01-11	2008-05-14	2008-05-14	ENSG00000172985	ENSG00000172985		"""RING-type (C3HC4) zinc fingers"""	24699	protein-coding gene	gene with protein product			"""SH3 multiple domains 4"""	SH3MD4		16374509	Standard	XM_006712493		Approved	FLJ00204, POSH2	uc010ywt.1	Q8TEJ3	OTTHUMG00000153439	ENST00000309415.6:c.1754C>G	2.37:g.110053528C>G	ENSP00000309186:p.Ser585Trp	Somatic	26	0		WXS	Illumina GAIIx	Phase_I	259	53	NM_001099289	0	0	2	3	1	A0SDZ7|A8MPR1|Q8NDU1	Missense_Mutation	SNP	ENST00000309415.6	37		.	.	.	.	.	.	.	.	.	.	C	16.83	3.231863	0.58777	.	.	ENSG00000172985	ENST00000418513;ENST00000309415	T;T	0.59906	0.23;2.01	5.69	4.81	0.61882	.	0.320683	0.33959	N	0.004395	T	0.75273	0.3827	.	.	.	0.35015	D	0.757326	D	0.89917	1.0	D	0.87578	0.998	D	0.84128	0.0410	9	0.87932	D	0	-9.5173	12.852	0.57862	0.0:0.9246:0.0:0.0754	.	585	Q8TEJ3	SH3R3_HUMAN	W	585	ENSP00000414997:S585W;ENSP00000309186:S585W	ENSP00000309186:S585W	S	+	2	0	SH3RF3	109419960	0.962000	0.33011	0.008000	0.14137	0.926000	0.56050	4.890000	0.63178	1.399000	0.46721	0.650000	0.86243	TCG	.		0.682	SH3RF3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001099289	
TMEM177	80775	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	120439176	120439176	+	Missense_Mutation	SNP	C	C	G	rs374882180		TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr2:120439176C>G	ENST00000424086.1	+	2	1220	c.747C>G	c.(745-747)ttC>ttG	p.F249L	TMEM177_ENST00000272521.6_Missense_Mutation_p.F249L|TMEM177_ENST00000409951.1_Intron|TMEM177_ENST00000496203.1_Intron|TMEM177_ENST00000401466.1_Missense_Mutation_p.F249L	NM_001105198.1	NP_001098668.1	Q53S58	TM177_HUMAN	transmembrane protein 177	249						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	13	Colorectal(110;0.196)					GAGTGGAGTTCTATGAGAAGC	0.607																																					p.F249L		.											.	TMEM177-91	0			c.C747G						.						58.0	53.0	55.0					2																	120439176		2203	4300	6503	SO:0001583	missense	80775	exon2			GGAGTTCTATGAG	BC004404	CCDS2128.1	2q14.2	2008-02-05			ENSG00000144120	ENSG00000144120			28143	protein-coding gene	gene with protein product						12477932	Standard	NM_001105198		Approved	MGC10993	uc002tmc.1	Q53S58	OTTHUMG00000153312	ENST00000424086.1:c.747C>G	2.37:g.120439176C>G	ENSP00000402661:p.Phe249Leu	Somatic	132	0		WXS	Illumina GAIIx	Phase_I	170	30	NM_001105198	0	0	5	7	2	Q9BT20	Missense_Mutation	SNP	ENST00000424086.1	37	CCDS2128.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.118094	0.77323	.	.	ENSG00000144120	ENST00000401466;ENST00000424086;ENST00000272521;ENST00000415646	T;T;T	0.41065	1.01;1.01;1.01	4.81	3.92	0.45320	.	0.108654	0.64402	D	0.000005	T	0.60907	0.2305	M	0.81341	2.54	0.58432	D	0.999996	D	0.89917	1.0	D	0.85130	0.997	T	0.64198	-0.6464	10	0.87932	D	0	-4.1449	6.727	0.23363	0.0:0.8014:0.0:0.1986	.	249	Q53S58	TM177_HUMAN	L	249;249;249;216	ENSP00000385966:F249L;ENSP00000402661:F249L;ENSP00000272521:F249L	ENSP00000272521:F249L	F	+	3	2	TMEM177	120155646	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	0.890000	0.28295	2.402000	0.81655	0.549000	0.68633	TTC	.		0.607	TMEM177-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330673.1	NM_030577	
SCN2A	6326	ucsc.edu;bcgsc.ca	37	2	166201291	166201291	+	Missense_Mutation	SNP	A	A	T			TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr2:166201291A>T	ENST00000375437.2	+	16	3079	c.2789A>T	c.(2788-2790)cAc>cTc	p.H930L	SCN2A_ENST00000283256.6_Missense_Mutation_p.H930L|SCN2A_ENST00000375427.2_Missense_Mutation_p.H930L|SCN2A_ENST00000357398.3_Missense_Mutation_p.H930L	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	930					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GACTTTTTCCACTCCTTCCTG	0.507																																					p.H930L		.											.	SCN2A-142	0			c.A2789T						.						256.0	224.0	235.0					2																	166201291		2203	4300	6503	SO:0001583	missense	6326	exon15			TTTTCCACTCCTT	AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.2789A>T	2.37:g.166201291A>T	ENSP00000364586:p.His930Leu	Somatic	458	4		WXS	Illumina GAIIx	Phase_I	660	141	NM_001040143	0	0	2	2	0	A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Missense_Mutation	SNP	ENST00000375437.2	37	CCDS33314.1	.	.	.	.	.	.	.	.	.	.	A	28.4	4.919579	0.92249	.	.	ENSG00000136531	ENST00000375437;ENST00000357398;ENST00000283256;ENST00000375427	D;D;D;D	0.98400	-4.91;-4.91;-4.91;-4.91	5.42	5.42	0.78866	Ion transport (1);	0.000000	0.64402	D	0.000003	D	0.98814	0.9600	M	0.78223	2.4	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.992;0.999	D	0.99864	1.1087	10	0.87932	D	0	.	15.4924	0.75619	1.0:0.0:0.0:0.0	.	930;930	Q99250-2;Q99250	.;SCN2A_HUMAN	L	930	ENSP00000364586:H930L;ENSP00000349973:H930L;ENSP00000283256:H930L;ENSP00000364576:H930L	ENSP00000283256:H930L	H	+	2	0	SCN2A	165909537	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.194000	0.94962	2.057000	0.61298	0.528000	0.53228	CAC	.		0.507	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000102659.2	NM_021007	
LRP2	4036	bcgsc.ca	37	2	170032989	170032989	+	Silent	SNP	C	C	T	rs2229265	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr2:170032989C>T	ENST00000263816.3	-	54	10788	c.10503G>A	c.(10501-10503)caG>caA	p.Q3501Q	LRP2_ENST00000461418.1_5'Flank	NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	3501	EGF-like 13. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	TGCCACTCAGCTGAAGGGTGC	0.542													C|||	1901	0.379593	0.2995	0.6268	5008	,	,		19364	0.1062		0.496	False		,,,				2504	0.4744				p.Q3501Q		.											.	LRP2-175	0			c.G10503A						.	C		1420,2986	463.6+/-353.6	224,972,1007	163.0	122.0	136.0		10503	-11.9	0.0	2	dbSNP_98	136	4451,4149	588.3+/-392.3	1170,2111,1019	no	coding-synonymous	LRP2	NM_004525.2		1394,3083,2026	TT,TC,CC		48.2442,32.2288,45.1407		3501/4656	170032989	5871,7135	2203	4300	6503	SO:0001819	synonymous_variant	4036	exon54			ACTCAGCTGAAGG		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.10503G>A	2.37:g.170032989C>T		Somatic	191	0		WXS	Illumina GAIIx	Phase_I	229	7	NM_004525	0	0	0	0	0	O00711|Q16215	Silent	SNP	ENST00000263816.3	37	CCDS2232.1																																																																																			T|0.264;G|0.268		0.542	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525	
FAM182A	284800	broad.mit.edu	37	20	26061831	26061831	+	RNA	DEL	G	G	-	rs78032466		TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr20:26061831delG	ENST00000376398.2	+	0	851					NR_026713.1		Q5T1J6	F182A_HUMAN	family with sequence similarity 182, member A									p.R62fs*49(1)		breast(1)|endometrium(2)|kidney(1)	4						TAGAAATGGTGAGAGAACTTT	0.473																																					.		.											.	.	1	Deletion - Frameshift(1)	breast(1)	.						.						18.0	14.0	15.0					20																	26061831		692	1585	2277			284800	.			AATGGTGAGAGAA	AL391119		20p11	2013-03-18	2008-08-05	2008-08-05	ENSG00000125804	ENSG00000125804			16222	other	unknown			"""chromosome 20 open reading frame 91"""	C20orf91			Standard	NR_026713		Approved	bB329D4.1, C20orf91A	uc010gdq.3	Q5T1J6	OTTHUMG00000032144		20.37:g.26061831delG		Somatic	65	3		WXS	Illumina GAIIx	Phase_I	105	7	.	0	0	0	0	0	A2RRD0|Q8N947	RNA	DEL	ENST00000376398.2	37																																																																																				.		0.473	FAM182A-001	KNOWN	basic	lincRNA	processed_transcript	OTTHUMT00000078473.2		
CLIC6	54102	hgsc.bcm.edu	37	21	36042579	36042579	+	Missense_Mutation	SNP	C	C	G	rs13049028	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr21:36042579C>G	ENST00000360731.3	+	1	892	c.892C>G	c.(892-894)Caa>Gaa	p.Q298E	CLIC6_ENST00000349499.2_Missense_Mutation_p.Q298E			Q96NY7	CLIC6_HUMAN	chloride intracellular channel 6	298						chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	voltage-gated chloride channel activity (GO:0005247)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	19						TGAGCCGCAGCAATCGGGGGA	0.756													G|||	1116	0.222843	0.2648	0.1657	5008	,	,		8796	0.1825		0.2137	False		,,,				2504	0.2577				p.Q298E		.											.	CLIC6-91	0			c.C892G						.	G	GLU/GLN	454,2348		41,372,988	2.0	2.0	2.0		892	-0.8	0.0	21	dbSNP_121	2	925,5025		74,777,2124	no	missense	CLIC6	NM_053277.1	29	115,1149,3112	GG,GC,CC		15.5462,16.2027,15.7564	benign	298/687	36042579	1379,7373	1401	2975	4376	SO:0001583	missense	54102	exon1			CCGCAGCAATCGG	AF426169	CCDS13638.1	21q22.12	2012-09-26			ENSG00000159212	ENSG00000159212		"""Ion channels / Chloride channels : Intracellular"""	2065	protein-coding gene	gene with protein product		615321		CLIC1L		10830953	Standard	NM_053277		Approved	CLIC5	uc002yuf.1	Q96NY7	OTTHUMG00000086237	ENST00000360731.3:c.892C>G	21.37:g.36042579C>G	ENSP00000353959:p.Gln298Glu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	13	9	NM_053277	0	0	0	0	0	A8K0U8|Q8IX31	Missense_Mutation	SNP	ENST00000360731.3	37		434	0.1987179487179487	125	0.2540650406504065	63	0.17403314917127072	81	0.14160839160839161	165	0.21767810026385223	G	0.195	-1.050076	0.01981	0.162027	0.155462	ENSG00000159212	ENST00000360731;ENST00000349499	T;T	0.21361	2.02;2.01	3.75	-0.792	0.10925	.	.	.	.	.	T	0.00012	0.0000	N	0.02539	-0.55	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.43861	-0.9365	8	0.02654	T	1	-10.3162	7.3436	0.26650	0.1642:0.3831:0.4527:0.0	rs13049028	298;298	Q96NY7;Q96NY7-2	CLIC6_HUMAN;.	E	298	ENSP00000353959:Q298E;ENSP00000290332:Q298E	ENSP00000290332:Q298E	Q	+	1	0	CLIC6	34964449	0.256000	0.24012	0.012000	0.15200	0.009000	0.06853	0.804000	0.27098	-0.082000	0.12640	-0.676000	0.03789	CAA	C|0.802;G|0.198		0.756	CLIC6-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000194156.1		
CLIC6	54102	hgsc.bcm.edu	37	21	36042584	36042584	+	Silent	SNP	G	G	A	rs13049239	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr21:36042584G>A	ENST00000360731.3	+	1	897	c.897G>A	c.(895-897)tcG>tcA	p.S299S	CLIC6_ENST00000349499.2_Silent_p.S299S			Q96NY7	CLIC6_HUMAN	chloride intracellular channel 6	299						chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	voltage-gated chloride channel activity (GO:0005247)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	19						CGCAGCAATCGGGGGACGGCA	0.751													A|||	1101	0.219848	0.2549	0.1628	5008	,	,		9144	0.1825		0.2137	False		,,,				2504	0.2577				p.S299S		.											.	CLIC6-91	0			c.G897A						.	A		412,2410		18,376,1017	2.0	2.0	2.0		897	-0.2	0.0	21	dbSNP_121	2	842,5136		42,758,2189	no	coding-synonymous	CLIC6	NM_053277.1		60,1134,3206	AA,AG,GG		14.085,14.5996,14.25		299/687	36042584	1254,7546	1411	2989	4400	SO:0001819	synonymous_variant	54102	exon1			GCAATCGGGGGAC	AF426169	CCDS13638.1	21q22.12	2012-09-26			ENSG00000159212	ENSG00000159212		"""Ion channels / Chloride channels : Intracellular"""	2065	protein-coding gene	gene with protein product		615321		CLIC1L		10830953	Standard	NM_053277		Approved	CLIC5	uc002yuf.1	Q96NY7	OTTHUMG00000086237	ENST00000360731.3:c.897G>A	21.37:g.36042584G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	12	8	NM_053277	0	0	0	0	0	A8K0U8|Q8IX31	Silent	SNP	ENST00000360731.3	37																																																																																				G|0.803;A|0.197		0.751	CLIC6-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000194156.1		
KRTAP10-2	386679	hgsc.bcm.edu	37	21	45971108	45971108	+	Silent	SNP	C	C	T			TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr21:45971108C>T	ENST00000391621.1	-	1	280	c.234G>A	c.(232-234)tcG>tcA	p.S78S	TSPEAR_ENST00000323084.4_Intron|KRTAP10-2_ENST00000498210.1_Intron|TSPEAR_ENST00000397916.1_Intron	NM_198693.2	NP_941966.1	P60368	KR102_HUMAN	keratin associated protein 10-2	78	22 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				large_intestine(1)|lung(4)|skin(1)	6						GCTGGCAGCACGAGGGCGTGC	0.687																																					p.S78S		.											.	KRTAP10-2-135	0			c.G234A						.						52.0	56.0	55.0					21																	45971108		2202	4293	6495	SO:0001819	synonymous_variant	386679	exon1			GCAGCACGAGGGC	AJ566381	CCDS42955.1	21q22.3	2007-10-05			ENSG00000205445	ENSG00000205445		"""Keratin associated proteins"""	22967	protein-coding gene	gene with protein product				KRTAP18-2			Standard	NM_198693		Approved	KAP10.2, KAP18.2	uc002zfi.1	P60368	OTTHUMG00000057625	ENST00000391621.1:c.234G>A	21.37:g.45971108C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	110	18	NM_198693	0	0	0	0	0	Q70LJ5	Silent	SNP	ENST00000391621.1	37	CCDS42955.1																																																																																			.		0.687	KRTAP10-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128027.1		
KRTAP10-7	386675	broad.mit.edu	37	21	46020656	46020670	+	In_Frame_Del	DEL	CTGCTGCGCCCCCAG	CTGCTGCGCCCCCAG	-	rs36208679|rs60739860|rs373191083		TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr21:46020656_46020670delCTGCTGCGCCCCCAG	ENST00000380102.2	+	1	160_174	c.135_149delCTGCTGCGCCCCCAG	c.(133-150)ccctgctgcgcccccagc>ccc	p.CCAPS46del	TSPEAR_ENST00000323084.4_Intron	NM_198689.2	NP_941962.1	P60409	KR107_HUMAN	keratin associated protein 10-7	46	30 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)		p.S50_P54delSCCAP(1)		breast(1)|large_intestine(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	8						GCGAGCCCCCCTGCTGCGCCCCCAGCTGCTGCGCC	0.698																																					.		.											.	.	1	Deletion - In frame(1)	upper_aerodigestive_tract(1)	.						.		,	2258,1042		849,560,241					,	-0.7	1.0		dbSNP_126	22	6001,1123		2605,791,166	no	coding,intron	TSPEAR,KRTAP10-7	NM_198689.2,NM_144991.2	,	3454,1351,407	A1A1,A1R,RR		15.7636,31.5758,20.7694	,	,		8259,2165				SO:0001651	inframe_deletion	386675	.			GCCCCCCTGCTGC	AJ566385	CCDS74803.1	21q22.3	2014-04-10			ENSG00000205441	ENSG00000272804		"""Keratin associated proteins"""	22970	protein-coding gene	gene with protein product				KRTAP18-7			Standard	NM_198689		Approved	KAP10.7, KAP18.7	uc002zfn.4	P60409	OTTHUMG00000188307	ENST00000380102.2:c.135_149delCTGCTGCGCCCCCAG	21.37:g.46020656_46020670delCTGCTGCGCCCCCAG	ENSP00000369445:p.Cys46_Ser50del	Somatic	13	0		WXS	Illumina GAIIx	Phase_I	75	23	.	0	0	0	0	0	Q0VDJ8|Q70LJ2	Splice_Site	DEL	ENST00000380102.2	37																																																																																				.		0.698	KRTAP10-7-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000128038.1	NM_198689	
TPST2	8459	broad.mit.edu	37	22	26937214	26937214	+	Missense_Mutation	SNP	A	A	C	rs200758682		TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr22:26937214A>C	ENST00000338754.4	-	3	653	c.383T>G	c.(382-384)gTg>gGg	p.V128G	TPST2_ENST00000398110.2_Missense_Mutation_p.V128G|TPST2_ENST00000403880.1_Missense_Mutation_p.V128G	NM_003595.3	NP_003586.3	O60704	TPST2_HUMAN	tyrosylprotein sulfotransferase 2	128					fusion of sperm to egg plasma membrane (GO:0007342)|peptidyl-tyrosine sulfation (GO:0006478)|prevention of polyspermy (GO:0060468)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein-tyrosine sulfotransferase activity (GO:0008476)	p.V128G(1)		central_nervous_system(1)|large_intestine(1)|lung(5)	7						CTCATCCGTCACCCCCGCCTC	0.672																																					p.V128G		.											.	TPST2-90	1	Substitution - Missense(1)	lung(1)	c.T383G						.						34.0	28.0	30.0					22																	26937214		2201	4298	6499	SO:0001583	missense	8459	exon3			TCCGTCACCCCCG	AF049891	CCDS13839.1	22q12.1	2012-12-13			ENSG00000128294	ENSG00000128294	2.8.2.20	"""Sulfotransferases, membrane-bound"""	12021	protein-coding gene	gene with protein product	"""transport and golgi organization 13 homolog B (Drosophila)"""	603126				9736702, 9733778	Standard	NM_003595		Approved	TANGO13B	uc003acx.3	O60704	OTTHUMG00000150987	ENST00000338754.4:c.383T>G	22.37:g.26937214A>C	ENSP00000339813:p.Val128Gly	Somatic	16	1		WXS	Illumina GAIIx	Phase_I	73	21	NM_001008566	0	0	19	22	3	B3KQA7|Q6FI98|Q9H0V4	Missense_Mutation	SNP	ENST00000338754.4	37	CCDS13839.1	.	.	.	.	.	.	.	.	.	.	A	14.93	2.681749	0.47991	.	.	ENSG00000128294	ENST00000338754;ENST00000398110;ENST00000403880;ENST00000528868;ENST00000442495	.	.	.	5.33	5.33	0.75918	Sulfotransferase domain (1);	0.000000	0.64402	D	0.000003	T	0.78685	0.4322	M	0.79475	2.455	0.80722	D	1	D	0.64830	0.994	D	0.74674	0.984	T	0.80939	-0.1158	9	0.56958	D	0.05	-31.6206	14.4823	0.67592	1.0:0.0:0.0:0.0	.	128	O60704	TPST2_HUMAN	G	128;128;128;61;128	.	ENSP00000339813:V128G	V	-	2	0	TPST2	25267214	1.000000	0.71417	1.000000	0.80357	0.070000	0.16714	6.838000	0.75359	2.023000	0.59567	0.496000	0.49642	GTG	.		0.672	TPST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320820.3	NM_003595	
MIRLET7BHG	400931	mdanderson.org	37	22	46505652	46505652	+	Missense_Mutation	SNP	C	C	G	rs58819475	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr22:46505652C>G	ENST00000360737.3	+	5	404	c.245C>G	c.(244-246)cCt>cGt	p.P82R	MIRLET7A3_ENST00000362116.1_RNA																							AGGGCCCAGCCTGCCTCGAGC	0.662													C|||	567	0.113219	0.3064	0.0591	5008	,	,		16154	0.001		0.0527	False		,,,				2504	0.0685				.		.											.	.	0			.						.						17.0	19.0	19.0					22																	46505652		692	1589	2281	SO:0001583	missense	400931	.			CCCAGCCTGCCTC																												ENST00000360737.3:c.245C>G	22.37:g.46505652C>G	ENSP00000353966:p.Pro82Arg	Somatic	21	1		WXS	Illumina GAIIx	Phase_I	71	34	.	0	0	1	1	0		RNA	SNP	ENST00000360737.3	37		204	0.09340659340659341	142	0.2886178861788618	19	0.052486187845303865	1	0.0017482517482517483	42	0.055408970976253295	C	4.535	0.099354	0.08681	.	.	ENSG00000197182	ENST00000360737	.	.	.	2.73	-4.41	0.03590	.	.	.	.	.	T	0.00012	0.0000	.	.	.	.	.	.	B	0.31383	0.321	B	0.28709	0.093	T	0.33137	-0.9880	6	0.37606	T	0.19	.	6.0456	0.19758	0.0:0.2766:0.5722:0.1511	rs58819475;rs62225899	82	Q6ZNQ0	.	R	82	.	ENSP00000353966:P82R	P	+	2	0	MIRLET7BHG	44884316	0.001000	0.12720	0.002000	0.10522	0.005000	0.04900	-0.290000	0.08354	-0.403000	0.07622	-0.502000	0.04539	CCT	C|0.910;G|0.090		0.662	FLJ27365-001	PUTATIVE	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000316781.1		
CACNA1D	776	broad.mit.edu	37	3	53529193	53529195	+	Start_Codon_Del	DEL	GAT	GAT	-			TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr3:53529193_53529195delGAT	ENST00000350061.5	+	0	511_513				CACNA1D_ENST00000422281.2_Start_Codon_Del|CACNA1D_ENST00000288139.4_Start_Codon_Del	NM_001128840.1	NP_001122312.1	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type, alpha 1D subunit						adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|energy reserve metabolic process (GO:0006112)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during SA node cell action potential (GO:0086052)|positive regulation of calcium ion transport (GO:0051928)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|ankyrin binding (GO:0030506)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)|voltage-gated calcium channel activity involved in cardiac muscle cell action potential (GO:0086007)|voltage-gated calcium channel activity involved SA node cell action potential (GO:0086059)			breast(3)|central_nervous_system(9)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(13)|liver(1)|lung(29)|ovary(6)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	90				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	aatgttcgtGgatgatgatgatg	0.581																																							.											.	CACNA1D-100	0									.																																			SO:0001582	initiator_codon_variant	776	wholegene			TTCGTGGATGATG	AB209171	CCDS2872.1, CCDS46848.1, CCDS46849.1	3p14.3	2012-03-07			ENSG00000157388	ENSG00000157388		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1391	protein-coding gene	gene with protein product		114206		CCHL1A2, CACNL1A2		1664412	Standard	NM_000720		Approved	Cav1.3, CACH3, CACN4	uc003dgu.5	Q01668	OTTHUMG00000158278		3.37:g.53529202_53529204delGAT		Somatic	272	0		WXS	Illumina GAIIx	Phase_I	461	8	NM_001128840	0	0	0	0	0	B0FYA3|Q13916|Q13931|Q71UT1|Q9UDC3	Frame_Shift_Del	DEL	ENST00000350061.5	37	CCDS46848.1																																																																																			.		0.581	CACNA1D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350557.1	NM_000720	
PPP4R2	151987	broad.mit.edu;bcgsc.ca	37	3	73096477	73096477	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr3:73096477G>C	ENST00000356692.5	+	3	510	c.257G>C	c.(256-258)aGa>aCa	p.R86T	PPP4R2_ENST00000295862.9_Missense_Mutation_p.R30T|PPP4R2_ENST00000394284.3_Intron			Q9NY27	PP4R2_HUMAN	protein phosphatase 4, regulatory subunit 2	86					cellular protein modification process (GO:0006464)|hematopoietic progenitor cell differentiation (GO:0002244)|mRNA processing (GO:0006397)|regulation of catalytic activity (GO:0050790)|regulation of double-strand break repair via homologous recombination (GO:0010569)|RNA splicing (GO:0008380)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein phosphatase 4 complex (GO:0030289)	protein binding, bridging (GO:0030674)|protein phosphatase type 4 regulator activity (GO:0030362)			breast(2)|endometrium(1)|large_intestine(1)|lung(3)|skin(2)|stomach(1)|urinary_tract(2)	12		Prostate(10;0.0187)|Lung SC(41;0.236)		Epithelial(33;1.76e-07)|BRCA - Breast invasive adenocarcinoma(55;9.42e-05)|LUSC - Lung squamous cell carcinoma(21;0.00211)|Lung(16;0.00643)|KIRC - Kidney renal clear cell carcinoma(39;0.0164)|Kidney(39;0.0193)|OV - Ovarian serous cystadenocarcinoma(275;0.031)		ATGAAGGAAAGAATACTGAAA	0.343																																					p.R86T		.											.	PPP4R2-227	0			c.G257C						.						74.0	80.0	78.0					3																	73096477		2203	4300	6503	SO:0001583	missense	151987	exon3			AGGAAAGAATACT	AJ271448	CCDS2917.1	3q29	2010-06-18			ENSG00000163605	ENSG00000163605		"""Serine/threonine phosphatases / Protein phosphatase 4, regulatory subunits"""	18296	protein-coding gene	gene with protein product		613822				10769191	Standard	NM_174907		Approved		uc003dph.1	Q9NY27	OTTHUMG00000158816	ENST00000356692.5:c.257G>C	3.37:g.73096477G>C	ENSP00000349124:p.Arg86Thr	Somatic	316	0		WXS	Illumina GAIIx	Phase_I	281	9	NM_174907	0	0	11	13	2	A8K1I6|Q2TAJ9|Q498B8|Q8WXX6	Missense_Mutation	SNP	ENST00000356692.5	37	CCDS2917.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.483691	0.84854	.	.	ENSG00000163605	ENST00000356692;ENST00000488810;ENST00000295862;ENST00000476505	T;T;T;T	0.44482	0.92;0.92;0.92;0.92	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.67979	0.2951	M	0.77313	2.365	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.71170	-0.4671	10	0.72032	D	0.01	.	19.3579	0.94422	0.0:0.0:1.0:0.0	.	86	Q9NY27	PP4R2_HUMAN	T	86;86;30;48	ENSP00000349124:R86T;ENSP00000418750:R86T;ENSP00000295862:R30T;ENSP00000420098:R48T	ENSP00000295862:R30T	R	+	2	0	PPP4R2	73179167	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.700000	0.98707	2.576000	0.86940	0.557000	0.71058	AGA	.		0.343	PPP4R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352321.1	NM_174907	
MUC13	56667	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	124629329	124629329	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr3:124629329T>C	ENST00000311075.3	-	10	1305	c.1267A>G	c.(1267-1269)Act>Gct	p.T423A		NM_033049.3	NP_149038	Q9H3R2	MUC13_HUMAN	mucin 13, cell surface associated	424					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(6)|lung(5)|prostate(1)|skin(1)|stomach(1)	18						CCCACAATAGTGAGGATCAGC	0.428																																					p.T423A		.											.	MUC13-90	0			c.A1267G						.						77.0	70.0	72.0					3																	124629329		2203	4300	6503	SO:0001583	missense	56667	exon10			CAATAGTGAGGAT	AF286113		3q21.2	2007-01-17	2006-03-14		ENSG00000173702	ENSG00000173702		"""Mucins"""	7511	protein-coding gene	gene with protein product		612181	"""down-regulated in colon cancer 1"", ""mucin 13, epithelial transmembrane"""	DRCC1		11278439	Standard	NM_033049		Approved		uc003ehq.2	Q9H3R2	OTTHUMG00000159484	ENST00000311075.3:c.1267A>G	3.37:g.124629329T>C	ENSP00000312235:p.Thr423Ala	Somatic	226	0		WXS	Illumina GAIIx	Phase_I	143	35	NM_033049	0	0	0	0	0	Q6UWD9|Q9NXT5	Missense_Mutation	SNP	ENST00000311075.3	37		.	.	.	.	.	.	.	.	.	.	T	16.71	3.199582	0.58126	.	.	ENSG00000173702	ENST00000311075	T	0.17528	2.27	5.19	5.19	0.71726	.	0.114787	0.40064	N	0.001191	T	0.36441	0.0967	L	0.61218	1.895	0.30797	N	0.740326	D	0.76494	0.999	D	0.80764	0.994	T	0.29912	-0.9996	10	0.44086	T	0.13	-27.6004	11.6395	0.51224	0.0:0.0:0.0:1.0	.	423	Q9H3R2	MUC13_HUMAN	A	423	ENSP00000312235:T423A	ENSP00000312235:T423A	T	-	1	0	MUC13	126112019	1.000000	0.71417	0.969000	0.41365	0.443000	0.32047	3.340000	0.52143	2.317000	0.78254	0.460000	0.39030	ACT	.		0.428	MUC13-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000355714.1	NM_033049	
PLXNA1	5361	broad.mit.edu	37	3	126707544	126707544	+	Silent	SNP	T	T	G			TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr3:126707544T>G	ENST00000393409.2	+	1	108	c.108T>G	c.(106-108)ggT>ggG	p.G36G	PLXNA1_ENST00000251772.4_Silent_p.G13G	NM_032242.3	NP_115618.3	Q9UIW2	PLXA1_HUMAN	plexin A1	36	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|multicellular organismal development (GO:0007275)|regulation of smooth muscle cell migration (GO:0014910)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)	p.G13G(4)		breast(3)|central_nervous_system(5)|endometrium(10)|kidney(5)|large_intestine(4)|lung(32)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	67				GBM - Glioblastoma multiforme(114;0.155)		CAGGCGGGGGTTCACAGCCCC	0.682																																					p.G36G		.											.	PLXNA1-93	4	Substitution - coding silent(4)	lung(2)|kidney(2)	c.T108G						.						26.0	27.0	27.0					3																	126707544		2203	4300	6503	SO:0001819	synonymous_variant	5361	exon1			CGGGGGTTCACAG	X87832	CCDS33847.1, CCDS33847.2	3q21.2	2006-12-19				ENSG00000114554		"""Plexins"""	9099	protein-coding gene	gene with protein product		601055		PLXN1		8570614	Standard	NM_032242		Approved	NOV	uc003ejg.3	Q9UIW2		ENST00000393409.2:c.108T>G	3.37:g.126707544T>G		Somatic	21	1		WXS	Illumina GAIIx	Phase_I	100	26	NM_032242	0	0	0	0	0		Silent	SNP	ENST00000393409.2	37	CCDS33847.2																																																																																			.		0.682	PLXNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356451.1	NM_032242	
PLXNA1	5361	hgsc.bcm.edu	37	3	126733329	126733329	+	Silent	SNP	C	C	T	rs80308004	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr3:126733329C>T	ENST00000393409.2	+	12	2613	c.2613C>T	c.(2611-2613)ccC>ccT	p.P871P	PLXNA1_ENST00000251772.4_Silent_p.P848P	NM_032242.3	NP_115618.3	Q9UIW2	PLXA1_HUMAN	plexin A1	871	IPT/TIG 1.				axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|multicellular organismal development (GO:0007275)|regulation of smooth muscle cell migration (GO:0014910)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)			breast(3)|central_nervous_system(5)|endometrium(10)|kidney(5)|large_intestine(4)|lung(32)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	67				GBM - Glioblastoma multiforme(114;0.155)		AGCTGTCCCCCGAGACGGGCC	0.711													C|||	202	0.0403355	0.1415	0.0216	5008	,	,		11478	0.0		0.0	False		,,,				2504	0.0				p.P871P		.											.	PLXNA1-93	0			c.C2613T						.	C		536,3866		30,476,1695	24.0	29.0	27.0		2613	-7.0	1.0	3	dbSNP_131	27	5,8589		0,5,4292	no	coding-synonymous	PLXNA1	NM_032242.3		30,481,5987	TT,TC,CC		0.0582,12.1763,4.1628		871/1897	126733329	541,12455	2201	4297	6498	SO:0001819	synonymous_variant	5361	exon12			GTCCCCCGAGACG	X87832	CCDS33847.1, CCDS33847.2	3q21.2	2006-12-19				ENSG00000114554		"""Plexins"""	9099	protein-coding gene	gene with protein product		601055		PLXN1		8570614	Standard	NM_032242		Approved	NOV	uc003ejg.3	Q9UIW2		ENST00000393409.2:c.2613C>T	3.37:g.126733329C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	37	7	NM_032242	0	0	0	0	0		Silent	SNP	ENST00000393409.2	37	CCDS33847.2																																																																																			C|0.959;T|0.041		0.711	PLXNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356451.1	NM_032242	
RAB43	339122	hgsc.bcm.edu	37	3	128840321	128840321	+	Silent	SNP	C	C	T	rs76233276	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr3:128840321C>T	ENST00000315150.5	-	1	312	c.12G>A	c.(10-12)ccG>ccA	p.P4P	RAB43_ENST00000393304.1_Silent_p.P4P|RP11-434H6.6_ENST00000608909.1_RNA|ISY1-RAB43_ENST00000418265.1_Intron|RAB43_ENST00000393307.1_Silent_p.P4P|RAB43_ENST00000393305.1_Silent_p.P4P|RAB43_ENST00000476465.1_Silent_p.P4P|RAB43_ENST00000393308.1_Silent_p.P4P	NM_001204888.1|NM_198490.2	NP_001191817.1|NP_940892.1	Q86YS6	RAB43_HUMAN	RAB43, member RAS oncogene family	4					Golgi organization (GO:0007030)|GTP catabolic process (GO:0006184)|phagosome maturation (GO:0090382)|protein transport (GO:0015031)|retrograde transport, plasma membrane to Golgi (GO:0035526)|small GTPase mediated signal transduction (GO:0007264)|virion assembly (GO:0019068)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|phagocytic vesicle (GO:0045335)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			kidney(2)|liver(1)|lung(2)|skin(1)	6						GGCCTGGGCCCGGCCCTGCCA	0.711													C|||	331	0.0660942	0.0885	0.0115	5008	,	,		8035	0.1022		0.005	False		,,,				2504	0.1002				p.P4P		.											.	RAB43-369	0			c.G12A						.	C	,,,,,,,	348,4044		14,320,1862	10.0	12.0	11.0		12,12,12,12,12,12,,12	1.9	1.0	3	dbSNP_131	11	9,8573		0,9,4282	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,intron,coding-synonymous	RAB43,ISY1-RAB43	NM_001204883.1,NM_001204884.1,NM_001204885.1,NM_001204886.1,NM_001204887.1,NM_001204888.1,NM_001204890.1,NM_198490.2	,,,,,,,	14,329,6144	TT,TC,CC		0.1049,7.9235,2.7517	,,,,,,,	4/213,4/213,4/213,4/213,4/156,4/109,,4/213	128840321	357,12617	2196	4291	6487	SO:0001819	synonymous_variant	339122	exon2			TGGGCCCGGCCCT	AY166852	CCDS33850.1, CCDS56275.1	3q21.3	2010-03-30			ENSG00000172780	ENSG00000172780		"""RAB, member RAS oncogene"""	19983	protein-coding gene	gene with protein product						15018353	Standard	NM_198490		Approved	RAB41, RAB11B, ISY1	uc021xdp.1	Q86YS6	OTTHUMG00000137364	ENST00000315150.5:c.12G>A	3.37:g.128840321C>T		Somatic	7	0		WXS	Illumina GAIIx	Phase_I	41	7	NM_001204886	0	0	0	0	0	A8K4P9|E9PBQ0	Silent	SNP	ENST00000315150.5	37	CCDS33850.1																																																																																			C|0.954;T|0.046		0.711	RAB43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000267849.1	XM_290714	
MYNN	55892	bcgsc.ca	37	3	169492101	169492101	+	Silent	SNP	C	C	T	rs10936599	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr3:169492101C>T	ENST00000349841.5	+	2	681	c.18C>T	c.(16-18)caC>caT	p.H6H	MYNN_ENST00000356716.4_Silent_p.H6H|RP11-362K14.5_ENST00000602342.1_RNA|MYNN_ENST00000392733.1_Silent_p.H6H|RP11-816J6.3_ENST00000602879.1_RNA|MYNN_ENST00000544106.1_Silent_p.H6H	NM_018657.4	NP_061127.1	Q9NPC7	MYNN_HUMAN	myoneurin	6					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16	all_cancers(22;9.55e-22)|all_epithelial(15;2.04e-26)|all_lung(20;5.05e-16)|Lung NSC(18;2.19e-15)|Ovarian(172;0.000223)|Breast(254;0.197)		Epithelial(2;4.03e-64)|all cancers(2;2.19e-58)|Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.00676)			ATTCGCACCACTGTGAGCACC	0.393													C|||	1355	0.270567	0.0371	0.3545	5008	,	,		21836	0.5784		0.2425	False		,,,				2504	0.2382				p.H6H		.											.	MYNN-91	0			c.C18T						.	C	,,	305,4101	164.0+/-195.7	5,295,1903	172.0	165.0	168.0	http://www.ncbi.nlm.nih.gov/pubmed?term	18,18,18	3.9	1.0	3	dbSNP_120	168	2128,6472	366.6+/-334.4	279,1570,2451	yes	coding-synonymous,coding-synonymous,coding-synonymous	MYNN	NM_001185118.1,NM_001185119.1,NM_018657.4	,,	284,1865,4354	TT,TC,CC	http://www.ncbi.nlm.nih.gov/pubmed?term	24.7442,6.9224,18.7068	,,	6/611,6/582,6/611	169492101	2433,10573	2203	4300	6503	SO:0001819	synonymous_variant	55892	exon3			GCACCACTGTGAG	AF148848	CCDS3207.1, CCDS54671.1	3q26.31	2013-01-09			ENSG00000085274	ENSG00000085274		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	14955	protein-coding gene	gene with protein product		606042				10873615	Standard	NM_001185118		Approved	SBBIZ1, ZBTB31, ZNF902	uc010hwo.3	Q9NPC7		ENST00000349841.5:c.18C>T	3.37:g.169492101C>T		Somatic	120	0		WXS	Illumina GAIIx	Phase_I	104	5	NM_001185118	0	0	8	8	0	B2R6C9|Q6QHA6|Q6QHA7|Q6R3G1|Q6R3G2|Q6R4A0|Q7Z716|Q7Z717|Q86Z11|Q86Z12|Q9NS01|Q9UIW8	Silent	SNP	ENST00000349841.5	37	CCDS3207.1																																																																																			C|0.763;T|0.237		0.393	MYNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467801.1	NM_018657	
KCNMB2	10242	bcgsc.ca	37	3	178546026	178546026	+	Silent	SNP	T	T	C	rs9831934	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr3:178546026T>C	ENST00000432997.1	+	4	640	c.288T>C	c.(286-288)aaT>aaC	p.N96N	RP11-385J1.2_ENST00000451742.1_RNA|RP11-385J1.2_ENST00000437488.1_RNA|RP11-385J1.2_ENST00000432385.1_RNA|RP11-385J1.2_ENST00000425330.1_RNA|KCNMB2_ENST00000420517.2_Silent_p.N96N|KCNMB2_ENST00000358316.3_Silent_p.N96N|KCNMB2_ENST00000452583.1_Silent_p.N96N	NM_001278911.1	NP_001265840.1	Q9NPA1	KCMB3_HUMAN	potassium large conductance calcium-activated channel, subfamily M, beta member 2	108					action potential (GO:0001508)|blood coagulation (GO:0007596)|detection of calcium ion (GO:0005513)|neuronal action potential (GO:0019228)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|potassium channel regulator activity (GO:0015459)			NS(2)|endometrium(4)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	12	all_cancers(143;5.38e-18)|Ovarian(172;0.00769)|Breast(254;0.125)		OV - Ovarian serous cystadenocarcinoma(80;1.32e-27)|GBM - Glioblastoma multiforme(14;0.0321)|BRCA - Breast invasive adenocarcinoma(182;0.0841)		Miconazole(DB01110)|Procaine(DB00721)	AAACATTTAATTGCTCCTTCA	0.522													T|||	2919	0.582867	0.9289	0.5245	5008	,	,		20296	0.2252		0.5825	False		,,,				2504	0.5256				p.N96N		.											.	KCNMB2-91	0			c.T288C						.	T	,	3833,573	773.0+/-413.9	1669,495,39	140.0	117.0	125.0		288,288	-4.7	1.0	3	dbSNP_119	125	5039,3561	629.7+/-398.3	1511,2017,772	no	coding-synonymous,coding-synonymous	KCNMB2	NM_005832.3,NM_181361.1	,	3180,2512,811	CC,CT,TT		41.407,13.005,31.7853	,	96/236,96/236	178546026	8872,4134	2203	4300	6503	SO:0001819	synonymous_variant	10242	exon5			ATTTAATTGCTCC	AF099137	CCDS3223.1	3q26.32	2005-10-13			ENSG00000197584	ENSG00000197584		"""Potassium channels"""	6286	protein-coding gene	gene with protein product		605214				10097176	Standard	NM_181361		Approved		uc003fjd.3	Q9Y691	OTTHUMG00000157264	ENST00000432997.1:c.288T>C	3.37:g.178546026T>C		Somatic	131	1		WXS	Illumina GAIIx	Phase_I	128	5	NM_005832	0	0	0	0	0	B7Z9C9|D3DNR2|E9PER5|Q9NPG7|Q9NRM9|Q9UHN3	Silent	SNP	ENST00000432997.1	37	CCDS3223.1																																																																																			T|0.360;C|0.640		0.522	KCNMB2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348251.1	NM_181361	
HRG	3273	bcgsc.ca	37	3	186395436	186395436	+	Missense_Mutation	SNP	C	C	T	rs1042445	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr3:186395436C>T	ENST00000232003.4	+	7	1422	c.1342C>T	c.(1342-1344)Cgt>Tgt	p.R448C		NM_000412.2	NP_000403.1	P04196	HRG_HUMAN	histidine-rich glycoprotein	448	His/Pro-rich (HRR).		R -> C (in dbSNP:rs1042445).		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|chemotaxis (GO:0006935)|defense response to fungus (GO:0050832)|fibrinolysis (GO:0042730)|heme export (GO:0097037)|negative regulation of angiogenesis (GO:0016525)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of apoptotic process (GO:0043065)|positive regulation of blood vessel remodeling (GO:2000504)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of immune response to tumor cell (GO:0002839)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of platelet activation (GO:0010543)|regulation of protein complex assembly (GO:0043254)|regulation of transcription from RNA polymerase II promoter in response to iron (GO:0034395)|response to organic cyclic compound (GO:0014070)	blood microparticle (GO:0072562)|endolysosome (GO:0036019)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|phagolysosome membrane (GO:0061474)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|heme binding (GO:0020037)|heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)|immunoglobulin binding (GO:0019865)|metal ion binding (GO:0046872)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(12)|lung(13)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37	all_cancers(143;6.64e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;5.73e-20)	GBM - Glioblastoma multiforme(93;0.0683)		TAAAGGACCCCGTCCCTTCCA	0.567													C|||	1368	0.273163	0.2428	0.2752	5008	,	,		17691	0.2847		0.2455	False		,,,				2504	0.3292				p.R448C		.											.	HRG-91	0			c.C1342T						.	C	CYS/ARG	1101,3305	396.5+/-330.1	140,821,1242	79.0	76.0	77.0		1342	2.3	0.0	3	dbSNP_86	77	1955,6645	344.0+/-325.1	202,1551,2547	yes	missense	HRG	NM_000412.2	180	342,2372,3789	TT,TC,CC		22.7326,24.9887,23.4968	benign	448/526	186395436	3056,9950	2203	4300	6503	SO:0001583	missense	3273	exon7			GGACCCCGTCCCT		CCDS3280.1	3q27	2008-07-18			ENSG00000113905	ENSG00000113905			5181	protein-coding gene	gene with protein product	"""histidine-proline rich glycoprotein"", ""thrombophilia due to elevated HRG"""	142640				1678514	Standard	NM_000412		Approved	HRGP, HPRG	uc003fqq.3	P04196	OTTHUMG00000156578	ENST00000232003.4:c.1342C>T	3.37:g.186395436C>T	ENSP00000232003:p.Arg448Cys	Somatic	175	0		WXS	Illumina GAIIx	Phase_I	150	7	NM_000412	0	0	0	0	0	B9EK35|D3DNU7	Missense_Mutation	SNP	ENST00000232003.4	37	CCDS3280.1	588	0.2692307692307692	137	0.2784552845528455	96	0.26519337016574585	165	0.28846153846153844	190	0.25065963060686014	C	2.396	-0.338783	0.05243	0.249887	0.227326	ENSG00000113905	ENST00000232003	T	0.11277	2.79	4.94	2.35	0.29111	.	0.755923	0.11783	N	0.529939	T	0.00012	0.0000	N	0.03608	-0.345	0.58432	P	1.0000000000287557E-6	B	0.06786	0.001	B	0.01281	0.0	T	0.46884	-0.9159	9	0.38643	T	0.18	-1.9829	6.7873	0.23679	0.0:0.197:0.0:0.803	rs1042445;rs3181923;rs52832999;rs60599328;rs1042445	448	P04196	HRG_HUMAN	C	448	ENSP00000232003:R448C	ENSP00000232003:R448C	R	+	1	0	HRG	187878130	0.000000	0.05858	0.037000	0.18230	0.001000	0.01503	-0.431000	0.06965	0.430000	0.26230	-0.474000	0.04947	CGT	C|0.751;T|0.249		0.567	HRG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344655.1	NM_000412	
MUC4	4585	bcgsc.ca	37	3	195477786	195477786	+	Missense_Mutation	SNP	C	C	T	rs6808605	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr3:195477786C>T	ENST00000346145.4	-	22	3176	c.3137G>A	c.(3136-3138)gGg>gAg	p.G1046E	MUC4_ENST00000475231.1_Missense_Mutation_p.G5230E|MUC4_ENST00000463781.3_Missense_Mutation_p.G5282E|MUC4_ENST00000349607.4_Missense_Mutation_p.G995E	NM_004532.5	NP_004523.3	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	2039					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CACGTCTTCCCCGGAGATGGG	0.637													.|||	302	0.0603035	0.0348	0.0764	5008	,	,		12146	0.001		0.1451	False		,,,				2504	0.0573				p.G5282E		.											.	MUC4-90	0			c.G15845A						.	C	GLU/GLY,GLU/GLY,GLU/GLY	173,4233	113.8+/-151.8	2,169,2032	60.0	54.0	56.0		2984,15845,3137	1.3	0.0	3	dbSNP_116	56	1144,7456	233.5+/-266.7	48,1048,3204	no	missense,missense,missense	MUC4	NM_138297.4,NM_018406.6,NM_004532.5	98,98,98	50,1217,5236	TT,TC,CC		13.3023,3.9265,10.1261	benign,benign,benign	995/1126,5282/5413,1046/1177	195477786	1317,11689	2203	4300	6503	SO:0001583	missense	4585	exon23			TCTTCCCCGGAGA	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000346145.4:c.3137G>A	3.37:g.195477786C>T	ENSP00000304207:p.Gly1046Glu	Somatic	131	0		WXS	Illumina GAIIx	Phase_I	132	5	NM_018406	0	0	0	0	0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000346145.4	37	CCDS3310.1	159	0.07280219780219781	24	0.04878048780487805	34	0.09392265193370165	0	0.0	101	0.13324538258575197	c	12.45	1.940731	0.34283	0.039265	0.133023	ENSG00000145113	ENST00000349607;ENST00000346145;ENST00000463781;ENST00000475231;ENST00000392409	T;T;T;T	0.35973	1.28;1.64;1.58;1.58	5.15	1.33	0.21861	.	0.251261	0.28665	N	0.014546	T	0.00144	0.0004	N	0.08118	0	0.80722	P	0.0	B;B;B;B;B;B	0.31054	0.011;0.094;0.094;0.0;0.0;0.306	B;B;B;B;B;B	0.26693	0.002;0.031;0.031;0.0;0.0;0.072	T	0.27123	-1.0083	9	0.19590	T	0.45	-6.8799	7.6814	0.28515	0.0:0.6424:0.0:0.3576	rs6808605	5154;995;1046;5282;5230;1987	E7ESK3;Q99102-12;Q99102-13;E9PDY6;E7ENC5;Q99102-10	.;.;.;.;.;.	E	995;1046;5282;5230;1782	ENSP00000338109:G995E;ENSP00000304207:G1046E;ENSP00000417498:G5282E;ENSP00000420243:G5230E	ENSP00000304207:G1046E	G	-	2	0	MUC4	196963457	0.011000	0.17503	0.005000	0.12908	0.069000	0.16628	0.160000	0.16462	0.208000	0.20626	-0.234000	0.12200	GGG	C|0.901;T|0.099		0.637	MUC4-015	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341862.1	NM_018406	
MUC4	4585	bcgsc.ca	37	3	195510011	195510011	+	Missense_Mutation	SNP	C	C	T	rs28375716		TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr3:195510011C>T	ENST00000463781.3	-	2	8899	c.8440G>A	c.(8440-8442)Gcc>Acc	p.A2814T	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.A2814T|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGAGAGGTGGCGTGACCTGTG	0.587																																					p.A2814T		.											.	MUC4-90	0			c.G8440A						.						70.0	44.0	52.0					3																	195510011		685	1518	2203	SO:0001583	missense	4585	exon2			AGGTGGCGTGACC	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8440G>A	3.37:g.195510011C>T	ENSP00000417498:p.Ala2814Thr	Somatic	465	10		WXS	Illumina GAIIx	Phase_I	499	20	NM_018406	0	0	0	0	0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	8.082	0.772585	0.16051	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.34472	1.37;1.36	.	.	.	.	.	.	.	.	T	0.23330	0.0564	N	0.19112	0.55	0.09310	N	0.999993	D	0.53312	0.959	P	0.45971	0.499	T	0.13575	-1.0504	7	.	.	.	.	5.8178	0.18506	0.0:0.999:0.0:0.001	.	2686	E7ESK3	.	T	2814	ENSP00000417498:A2814T;ENSP00000420243:A2814T	.	A	-	1	0	MUC4	196994790	0.001000	0.12720	0.022000	0.16811	0.020000	0.10135	-2.830000	0.00744	-0.000000	0.14550	0.000000	0.15137	GCC	.		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
CRIPAK	285464	hgsc.bcm.edu	37	4	1389192	1389192	+	Missense_Mutation	SNP	A	A	G	rs146804633	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr4:1389192A>G	ENST00000324803.4	+	1	3853	c.893A>G	c.(892-894)gAg>gGg	p.E298G		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	298					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			GCCCATGTGGAGTGCCCGCCT	0.682													A|||	46	0.0091853	0.0212	0.0072	5008	,	,		14642	0.0		0.005	False		,,,				2504	0.0082				p.E298G		.											.	CRIPAK-90	0			c.A893G						.						128.0	132.0	131.0					4																	1389192		2202	4298	6500	SO:0001583	missense	285464	exon1			ATGTGGAGTGCCC	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.893A>G	4.37:g.1389192A>G	ENSP00000323978:p.Glu298Gly	Somatic	5	0		WXS	Illumina GAIIx	Phase_I	42	12	NM_175918	0	0	51	61	10	Q8NB03	Missense_Mutation	SNP	ENST00000324803.4	37	CCDS3349.1	.	.	.	.	.	.	.	.	.	.	A	2.554	-0.303322	0.05495	.	.	ENSG00000179979	ENST00000324803;ENST00000382944	T	0.19532	2.14	0.815	-1.63	0.08345	.	.	.	.	.	T	0.08626	0.0214	N	0.08118	0	0.09310	N	1	B	0.12630	0.006	B	0.04013	0.001	T	0.23797	-1.0178	9	0.51188	T	0.08	.	2.8991	0.05700	0.2283:0.0:0.4427:0.329	.	298	Q8N1N5	CRPAK_HUMAN	G	298;240	ENSP00000323978:E298G	ENSP00000323978:E298G	E	+	2	0	CRIPAK	1379192	0.008000	0.16893	0.000000	0.03702	0.000000	0.00434	0.016000	0.13377	-1.564000	0.01678	-0.530000	0.04314	GAG	A|0.995;G|0.005		0.682	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
HGFAC	3083	hgsc.bcm.edu	37	4	3446682	3446682	+	Silent	SNP	C	C	T	rs144021102	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr4:3446682C>T	ENST00000382774.3	+	8	1093	c.978C>T	c.(976-978)gcC>gcT	p.A326A	HGFAC_ENST00000511533.1_Silent_p.A326A	NM_001528.2	NP_001519.1	Q04756	HGFA_HUMAN	HGF activator	326	Kringle. {ECO:0000255|PROSITE- ProRule:PRU00121}.				proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|rough endoplasmic reticulum (GO:0005791)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.A326A(1)		central_nervous_system(3)|cervix(1)|endometrium(4)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	22				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		CCGTGGGCGCCGCGGCCCTGC	0.716													C|||	50	0.00998403	0.0	0.0	5008	,	,		15116	0.0486		0.0	False		,,,				2504	0.001				p.A326A		.											.	HGFAC-514	1	Substitution - coding silent(1)	central_nervous_system(1)	c.C978T						.	C		3,4373		0,3,2185	15.0	17.0	16.0		978	-2.6	0.9	4	dbSNP_134	16	0,8574		0,0,4287	no	coding-synonymous	HGFAC	NM_001528.2		0,3,6472	TT,TC,CC		0.0,0.0686,0.0232		326/656	3446682	3,12947	2188	4287	6475	SO:0001819	synonymous_variant	3083	exon8			GGGCGCCGCGGCC	D14012	CCDS3369.1, CCDS75098.1	4p16	2008-02-07			ENSG00000109758	ENSG00000109758	3.4.21.-		4894	protein-coding gene	gene with protein product		604552				7683665, 8226803	Standard	XM_005247966		Approved	HGFAP, HGFA	uc003ghc.3	Q04756	OTTHUMG00000090281	ENST00000382774.3:c.978C>T	4.37:g.3446682C>T		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	25	17	NM_001528	0	0	1	1	0	Q14726|Q2M1W7|Q53X47	Silent	SNP	ENST00000382774.3	37	CCDS3369.1																																																																																			C|0.997;T|0.003		0.716	HGFAC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206607.3		
MAN2B2	23324	broad.mit.edu	37	4	6621656	6621656	+	Silent	SNP	T	T	C			TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr4:6621656T>C	ENST00000285599.3	+	18	2853	c.2817T>C	c.(2815-2817)gcT>gcC	p.A939A	MAN2B2_ENST00000504248.1_Silent_p.A888A	NM_015274.1	NP_056089.1	Q9Y2E5	MA2B2_HUMAN	mannosidase, alpha, class 2B, member 2	939					mannose metabolic process (GO:0006013)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)			breast(2)|cervix(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(9)|ovary(4)|prostate(2)|skin(2)|urinary_tract(1)	30						CCCTGCAGGCTGTGCTGCAGG	0.642																																					p.A939A		.											.	MAN2B2-92	0			c.T2817C						.						53.0	60.0	58.0					4																	6621656		2203	4300	6503	SO:0001819	synonymous_variant	23324	exon18			GCAGGCTGTGCTG	BC033307	CCDS33951.1	4p16.2	2005-11-09			ENSG00000013288	ENSG00000013288			29623	protein-coding gene	gene with protein product	"""core-specific lysosomal alpha-1,6-Mannosidase"""					10231032, 16115860	Standard	XR_241647		Approved	KIAA0935	uc003gjf.1	Q9Y2E5	OTTHUMG00000160073	ENST00000285599.3:c.2817T>C	4.37:g.6621656T>C		Somatic	41	0		WXS	Illumina GAIIx	Phase_I	101	4	NM_015274	0	0	3	3	0	Q66MP2|Q86T67	Silent	SNP	ENST00000285599.3	37	CCDS33951.1																																																																																			.		0.642	MAN2B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359106.2	NM_015274	
TBC1D1	23216	bcgsc.ca	37	4	37904089	37904089	+	Missense_Mutation	SNP	C	C	T	rs35859249	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr4:37904089C>T	ENST00000261439.4	+	2	728	c.373C>T	c.(373-375)Cgg>Tgg	p.R125W	TBC1D1_ENST00000402522.1_Missense_Mutation_p.R125W|TBC1D1_ENST00000508802.1_Missense_Mutation_p.R125W	NM_001253914.1|NM_001253915.1|NM_015173.3	NP_001240843.1|NP_001240844.1|NP_055988.2	Q86TI0	TBCD1_HUMAN	TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1	125			R -> W (may be associated with risk of familial obesity; dbSNP:rs35859249). {ECO:0000269|PubMed:16893906, ECO:0000269|PubMed:18325908}.		membrane organization (GO:0061024)|regulation of protein localization (GO:0032880)	cytosol (GO:0005829)|nucleus (GO:0005634)	Rab GTPase activator activity (GO:0005097)			NS(1)|breast(3)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	36						CGCTGTCCACCGGCAGAGTAT	0.438													C|||	422	0.0842652	0.0136	0.0648	5008	,	,		19784	0.124		0.1004	False		,,,				2504	0.136				p.R125W		.											.	TBC1D1-91	0			c.C373T	GRCh37	CM064293	TBC1D1	M	rs35859249	.	C	TRP/ARG	130,4276	91.6+/-130.3	4,122,2077	76.0	77.0	77.0	http://omim.org/entry/608410	373	3.2	0.0	4	dbSNP_126	77	831,7769	189.1+/-236.0	41,749,3510	yes	missense	TBC1D1	NM_015173.2	101	45,871,5587	TT,TC,CC		9.6628,2.9505,7.3889	probably-damaging	125/1169	37904089	961,12045	2203	4300	6503	SO:0001583	missense	23216	exon2			GTCCACCGGCAGA	AB029031	CCDS33972.1, CCDS58897.1	4p14	2013-07-09			ENSG00000065882	ENSG00000065882			11578	protein-coding gene	gene with protein product		609850				10965142, 18258599	Standard	NM_015173		Approved	TBC, TBC1, KIAA1108	uc003gtb.3	Q86TI0	OTTHUMG00000150302	ENST00000261439.4:c.373C>T	4.37:g.37904089C>T	ENSP00000261439:p.Arg125Trp	Somatic	84	0		WXS	Illumina GAIIx	Phase_I	107	6	NM_015173	0	0	1	1	0	B7Z3D9|E9PGH8|Q96K82|Q9UPP4	Missense_Mutation	SNP	ENST00000261439.4	37	CCDS33972.1	176	0.08058608058608059	5	0.01016260162601626	23	0.06353591160220995	68	0.11888111888111888	80	0.10554089709762533	C	15.27	2.783590	0.49891	0.029505	0.096628	ENSG00000065882	ENST00000508802;ENST00000261439;ENST00000402522	T;T;T	0.23950	3.59;3.98;1.88	6.07	3.15	0.36227	Phosphotyrosine interaction domain (1);Pleckstrin homology-type (1);	1.202460	0.06320	N	0.704358	T	0.00300	0.0009	N	0.08118	0	0.44275	P	0.0028650000000000064	D;D	0.63046	0.992;0.958	B;P	0.44860	0.332;0.462	T	0.35822	-0.9773	9	0.66056	D	0.02	-6.0566	15.2101	0.73214	0.4489:0.5511:0.0:0.0	rs35859249;rs61752237	125;125	E9PGH8;Q86TI0	.;TBCD1_HUMAN	W	125	ENSP00000423651:R125W;ENSP00000261439:R125W;ENSP00000383994:R125W	ENSP00000261439:R125W	R	+	1	2	TBC1D1	37580484	0.002000	0.14202	0.005000	0.12908	0.417000	0.31264	0.851000	0.27751	0.271000	0.22005	0.585000	0.79938	CGG	C|0.922;T|0.078		0.438	TBC1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317443.2	NM_015173	
ADAMTS3	9508	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	73280551	73280551	+	Silent	SNP	G	G	C			TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr4:73280551G>C	ENST00000286657.4	-	4	678	c.642C>G	c.(640-642)tcC>tcG	p.S214S		NM_014243.2	NP_055058.2	O15072	ATS3_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 3	214					collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix organization (GO:0030198)|positive regulation of vascular endothelial growth factor signaling pathway (GO:1900748)|protein processing (GO:0016485)|vascular endothelial growth factor production (GO:0010573)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	endopeptidase activity (GO:0004175)|heparin binding (GO:0008201)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(33)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	76			Epithelial(6;4.97e-05)|OV - Ovarian serous cystadenocarcinoma(6;5.66e-05)|all cancers(17;0.000486)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			GGAAGTCTTTGGACATGTCTA	0.383																																					p.S214S	NSCLC(168;1941 2048 2918 13048 43078)	.											.	ADAMTS3-651	0			c.C642G						.						151.0	141.0	145.0					4																	73280551		2203	4300	6503	SO:0001819	synonymous_variant	9508	exon4			GTCTTTGGACATG	AB002364	CCDS3553.1	4q21	2008-07-29	2005-08-19		ENSG00000156140	ENSG00000156140	3.4.24.-	"""ADAM metallopeptidases with thrombospondin type 1 motif"""	219	protein-coding gene	gene with protein product		605011	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 3"""			10094461	Standard	NM_014243		Approved	KIAA0366, ADAMTS-4	uc003hgk.2	O15072	OTTHUMG00000129912	ENST00000286657.4:c.642C>G	4.37:g.73280551G>C		Somatic	98	0		WXS	Illumina GAIIx	Phase_I	97	17	NM_014243	0	0	0	0	0	A1L3U9|Q9BXZ8	Silent	SNP	ENST00000286657.4	37	CCDS3553.1																																																																																			.		0.383	ADAMTS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252164.2		
MTHFD2L	441024	broad.mit.edu;bcgsc.ca	37	4	75066988	75066988	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr4:75066988A>G	ENST00000395759.2	+	5	640	c.613A>G	c.(613-615)Aca>Gca	p.T205A	MTHFD2L_ENST00000331145.6_Missense_Mutation_p.T147A|MTHFD2L_ENST00000433372.1_Missense_Mutation_p.T70A|MTHFD2L_ENST00000325278.6_Missense_Mutation_p.T147A	NM_001144978.1	NP_001138450.1	Q9H903	MTD2L_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like	205					folic acid-containing compound biosynthetic process (GO:0009396)|histidine biosynthetic process (GO:0000105)|methionine biosynthetic process (GO:0009086)|one-carbon metabolic process (GO:0006730)|purine nucleotide biosynthetic process (GO:0006164)|tetrahydrofolate interconversion (GO:0035999)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	methenyltetrahydrofolate cyclohydrolase activity (GO:0004477)|methylenetetrahydrofolate dehydrogenase (NAD+) activity (GO:0004487)|methylenetetrahydrofolate dehydrogenase (NADP+) activity (GO:0004488)			central_nervous_system(1)|endometrium(1)|lung(4)|ovary(2)	8			all cancers(17;0.0101)|Lung(101;0.196)			AGGAATTCAAACATTTGGAAA	0.373																																					p.T205A		.											.	MTHFD2L-91	0			c.A613G						.						83.0	82.0	83.0					4																	75066988		2203	4300	6503	SO:0001583	missense	441024	exon5			ATTCAAACATTTG	BC065771	CCDS47075.1	4q13.3	2011-08-03			ENSG00000163738	ENSG00000163738			31865	protein-coding gene	gene with protein product		614047				21163947	Standard	NM_001144978		Approved	MGC72244	uc011cbk.2	Q9H903	OTTHUMG00000157135	ENST00000395759.2:c.613A>G	4.37:g.75066988A>G	ENSP00000379108:p.Thr205Ala	Somatic	102	0		WXS	Illumina GAIIx	Phase_I	125	6	NM_001144978	0	0	0	0	0	Q6P079|Q8N560	Missense_Mutation	SNP	ENST00000395759.2	37	CCDS47075.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.117464	0.77323	.	.	ENSG00000163738	ENST00000433372;ENST00000395759;ENST00000331145;ENST00000359107;ENST00000325278	T;T;T;T;T	0.57436	0.4;0.4;0.4;0.4;0.4	5.97	5.97	0.96955	Tetrahydrofolate dehydrogenase/cyclohydrolase, NAD(P)-binding domain (1);NAD(P)-binding domain (1);	0.043113	0.85682	D	0.000000	T	0.74550	0.3731	M	0.91663	3.23	0.53688	D	0.999975	P;D	0.52996	0.927;0.957	P;P	0.57846	0.679;0.828	T	0.79855	-0.1627	10	0.54805	T	0.06	-22.5925	14.4055	0.67079	1.0:0.0:0.0:0.0	.	205;147	Q9H903;Q9H903-3	MTD2L_HUMAN;.	A	70;205;147;147;147	ENSP00000405692:T70A;ENSP00000379108:T205A;ENSP00000330982:T147A;ENSP00000352012:T147A;ENSP00000321984:T147A	ENSP00000321984:T147A	T	+	1	0	MTHFD2L	75285852	1.000000	0.71417	0.998000	0.56505	0.606000	0.37113	8.810000	0.91950	2.285000	0.76669	0.477000	0.44152	ACA	.		0.373	MTHFD2L-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001004346	
ANAPC10	10393	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	145916557	145916557	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr4:145916557T>C	ENST00000507656.1	-	5	619	c.526A>G	c.(526-528)Ata>Gta	p.I176V	ANAPC10_ENST00000309439.5_Missense_Mutation_p.I176V|ANAPC10_ENST00000510270.1_5'UTR|ANAPC10_ENST00000451299.2_Missense_Mutation_p.I176V	NM_001256706.1	NP_001243635.1	Q9UM13	APC10_HUMAN	anaphase promoting complex subunit 10	176	DOC. {ECO:0000255|PROSITE- ProRule:PRU00614}.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)				endometrium(1)|large_intestine(3)|lung(1)|skin(1)	6	all_hematologic(180;0.151)					ATGAAATCTATAGTTGTACAT	0.313																																					p.I187V		.											.	ANAPC10-650	0			c.A559G						.						123.0	119.0	121.0					4																	145916557		1813	4076	5889	SO:0001583	missense	10393	exon7			AATCTATAGTTGT	AF132794	CCDS43273.1	4q31	2011-06-15			ENSG00000164162	ENSG00000164162		"""Anaphase promoting complex subunits"""	24077	protein-coding gene	gene with protein product		613745				10318877, 11230166	Standard	NM_001256706		Approved	APC10, DOC1, DKFZP564L0562	uc031shk.1	Q9UM13	OTTHUMG00000161477	ENST00000507656.1:c.526A>G	4.37:g.145916557T>C	ENSP00000423995:p.Ile176Val	Somatic	59	0		WXS	Illumina GAIIx	Phase_I	47	12	NM_001256709	0	0	8	14	6	D3DNZ7|Q2V500|Q9UG51|Q9Y5R0	Missense_Mutation	SNP	ENST00000507656.1	37	CCDS43273.1	.	.	.	.	.	.	.	.	.	.	T	4.012	-0.000441	0.07819	.	.	ENSG00000164162	ENST00000507656;ENST00000309439;ENST00000451299	T;T;T	0.70631	-0.5;-0.5;-0.5	5.82	5.82	0.92795	Anaphase-promoting complex, subunit 10/DOC domain (2);	0.049797	0.85682	D	0.000000	T	0.45637	0.1352	N	0.03000	-0.44	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.44190	-0.9344	10	0.23891	T	0.37	-17.9681	12.01	0.53282	0.0:0.069:0.0:0.9309	.	176	Q9UM13	APC10_HUMAN	V	176	ENSP00000423995:I176V;ENSP00000310071:I176V;ENSP00000403891:I176V	ENSP00000310071:I176V	I	-	1	0	ANAPC10	146136007	1.000000	0.71417	0.999000	0.59377	0.988000	0.76386	4.842000	0.62831	2.229000	0.72834	0.397000	0.26171	ATA	.		0.313	ANAPC10-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365090.1	NM_014885	
FRG1	2483	bcgsc.ca	37	4	190876283	190876283	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr4:190876283C>A	ENST00000226798.4	+	5	631	c.409C>A	c.(409-411)Caa>Aaa	p.Q137K	FRG1_ENST00000514482.1_3'UTR	NM_004477.2	NP_004468.1	Q14331	FRG1_HUMAN	FSHD region gene 1	137					mRNA splicing, via spliceosome (GO:0000398)|muscle organ development (GO:0007517)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|lung(11)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|urinary_tract(1)	32		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		ACCAAGAGAACAATGGGAACC	0.353																																					p.Q137K		.											.	FRG1-90	0			c.C409A						.						88.0	87.0	87.0					4																	190876283		2203	4300	6503	SO:0001583	missense	2483	exon5			AGAGAACAATGGG	L76159	CCDS34121.1	4q35	2008-02-05			ENSG00000109536	ENSG00000109536			3954	protein-coding gene	gene with protein product		601278				8733123	Standard	XM_005262880		Approved	FSG1, FRG1A	uc003izs.3	Q14331	OTTHUMG00000160202	ENST00000226798.4:c.409C>A	4.37:g.190876283C>A	ENSP00000226798:p.Gln137Lys	Somatic	252	2		WXS	Illumina GAIIx	Phase_I	346	11	NM_004477	0	1	102	103	0	A8K775	Missense_Mutation	SNP	ENST00000226798.4	37	CCDS34121.1	.	.	.	.	.	.	.	.	.	.	.	16.72	3.202137	0.58234	.	.	ENSG00000109536	ENST00000226798;ENST00000531991	T;T	0.49139	2.03;0.79	4.04	4.04	0.47022	Actin cross-linking (1);	0.103449	0.64402	D	0.000002	T	0.54902	0.1887	M	0.88377	2.95	0.80722	D	1	B	0.11235	0.004	B	0.15484	0.013	T	0.60078	-0.7333	10	0.42905	T	0.14	-3.5101	14.1451	0.65347	0.0:1.0:0.0:0.0	.	137	Q14331	FRG1_HUMAN	K	137;74	ENSP00000226798:Q137K;ENSP00000435943:Q74K	ENSP00000226798:Q137K	Q	+	1	0	FRG1	191113277	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	7.292000	0.78731	1.964000	0.57103	0.567000	0.79289	CAA	.		0.353	FRG1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000359622.4	NM_004477	
ZDHHC11	79844	broad.mit.edu	37	5	825360	825360	+	Silent	SNP	T	T	C	rs201174878		TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr5:825360T>C	ENST00000283441.8	-	8	1325	c.942A>G	c.(940-942)aaA>aaG	p.K314K	ZDHHC11_ENST00000424784.2_Silent_p.K314K|ZDHHC11_ENST00000503758.2_5'UTR	NM_024786.2	NP_079062.1	Q9H8X9	ZDH11_HUMAN	zinc finger, DHHC-type containing 11	314						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|liver(1)|lung(10)|pancreas(1)|prostate(5)|skin(2)|urinary_tract(1)	21			Epithelial(17;0.000445)|all cancers(22;0.00176)|OV - Ovarian serous cystadenocarcinoma(19;0.00227)|Lung(60;0.0863)			AGCTCTTGGCTTTGACTCTGG	0.552																																					p.K314K		.											.	ZDHHC11-92	0			c.A942G						.						168.0	117.0	134.0					5																	825360		2203	4296	6499	SO:0001819	synonymous_variant	79844	exon8			CTTGGCTTTGACT	AK023215	CCDS3857.1	5p15.2	2011-02-09			ENSG00000188818	ENSG00000188818		"""Zinc fingers, DHHC-type"""	19158	protein-coding gene	gene with protein product							Standard	NM_024786		Approved	ZNF399, FLJ13153	uc011cma.1	Q9H8X9	OTTHUMG00000090319	ENST00000283441.8:c.942A>G	5.37:g.825360T>C		Somatic	136	0		WXS	Illumina GAIIx	Phase_I	212	9	NM_024786	0	0	0	0	0	Q6UWR9	Silent	SNP	ENST00000283441.8	37	CCDS3857.1																																																																																			T|0.999;C|0.001		0.552	ZDHHC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206681.3	NM_024786	
C5orf38	153571	hgsc.bcm.edu	37	5	2752393	2752393	+	Silent	SNP	G	G	C	rs185444055	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr5:2752393G>C	ENST00000334000.3	+	1	132	c.15G>C	c.(13-15)gcG>gcC	p.A5A	IRX2_ENST00000302057.5_5'Flank|C5orf38_ENST00000457752.2_Silent_p.A5A|IRX2_ENST00000502957.1_Intron|C5orf38_ENST00000505778.1_Silent_p.A5A|IRX2_ENST00000382611.6_5'Flank|C5orf38_ENST00000397835.4_Silent_p.A5A|C5orf38_ENST00000515640.1_Silent_p.A5A	NM_178569.2	NP_848664.1	Q86SI9	CEI_HUMAN	chromosome 5 open reading frame 38	5						extracellular region (GO:0005576)				endometrium(2)|large_intestine(1)|lung(1)	4				GBM - Glioblastoma multiforme(108;0.205)		TGGCGCCCGCGGCTCGGGTCT	0.726													G|||	64	0.0127796	0.0454	0.0058	5008	,	,		8588	0.0		0.0	False		,,,				2504	0.0				p.A5A		.											.	C5orf38-226	0			c.G15C						.	G		89,4097		1,87,2005	7.0	11.0	9.0		15	-0.9	0.0	5		9	0,8364		0,0,4182	no	coding-synonymous	C5orf38	NM_178569.2		1,87,6187	CC,CG,GG		0.0,2.1261,0.7092		5/139	2752393	89,12461	2093	4182	6275	SO:0001819	synonymous_variant	153571	exon1			GCCCGCGGCTCGG	AY249324	CCDS34131.1	5p15.33	2014-06-02			ENSG00000186493	ENSG00000186493			24226	protein-coding gene	gene with protein product	"""coordinated expression to IRX2"", ""IRX2 neighbor"""	610522				16515847, 16750006	Standard	XM_005248256		Approved	CEI, IRX2NB	uc003jdc.3	Q86SI9	OTTHUMG00000161741	ENST00000334000.3:c.15G>C	5.37:g.2752393G>C		Somatic	6	0		WXS	Illumina GAIIx	Phase_I	67	37	NM_178569	0	0	0	0	0		Silent	SNP	ENST00000334000.3	37	CCDS34131.1																																																																																			G|0.990;C|0.010		0.726	C5orf38-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000365956.2	NM_178569	
OTP	23440	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	76932656	76932656	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr5:76932656G>C	ENST00000306422.3	-	2	1575	c.437C>G	c.(436-438)tCc>tGc	p.S146C	OTP_ENST00000515716.1_5'UTR	NM_032109.2	NP_115485.1	Q5XKR4	OTP_HUMAN	orthopedia homeobox	146					forebrain neuron differentiation (GO:0021879)|hypothalamus cell differentiation (GO:0021979)|neurohypophysis development (GO:0021985)|positive regulation of neuroblast proliferation (GO:0002052)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|pancreas(1)	13		all_lung(232;0.00051)|Lung NSC(167;0.000601)|Ovarian(174;0.0105)|Prostate(461;0.214)		OV - Ovarian serous cystadenocarcinoma(54;9.04e-51)|Epithelial(54;1.62e-45)|all cancers(79;4.4e-41)		CTGCACTCGGGACTCGGTCAG	0.612																																					p.S146C		.											.	OTP-69	0			c.C437G						.						69.0	66.0	67.0					5																	76932656		2203	4300	6503	SO:0001583	missense	23440	exon2			ACTCGGGACTCGG		CCDS4039.1	5q14.1	2011-06-20	2007-02-15		ENSG00000171540	ENSG00000171540		"""Homeoboxes / PRD class"""	8518	protein-coding gene	gene with protein product		604529	"""orthopedia homolog (Drosophila)"""			10458915	Standard	NM_032109		Approved		uc003kfg.3	Q5XKR4	OTTHUMG00000102171	ENST00000306422.3:c.437C>G	5.37:g.76932656G>C	ENSP00000302814:p.Ser146Cys	Somatic	149	2		WXS	Illumina GAIIx	Phase_I	218	45	NM_032109	0	0	0	0	0		Missense_Mutation	SNP	ENST00000306422.3	37	CCDS4039.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.479156	0.84747	.	.	ENSG00000171540	ENST00000306422	D	0.96427	-4.01	5.21	5.21	0.72293	Homeodomain-related (1);Helix-turn-helix motif, lambda-like repressor (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.97773	0.9269	M	0.68728	2.09	0.80722	D	1	D	0.76494	0.999	D	0.76071	0.987	D	0.98444	1.0588	10	0.72032	D	0.01	.	18.712	0.91661	0.0:0.0:1.0:0.0	.	146	Q5XKR4	OTP_HUMAN	C	146	ENSP00000302814:S146C	ENSP00000302814:S146C	S	-	2	0	OTP	76968412	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	9.717000	0.98755	2.597000	0.87782	0.655000	0.94253	TCC	.		0.612	OTP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220016.2		
ADAMTS19	171019	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	128864313	128864313	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr5:128864313T>A	ENST00000274487.4	+	6	1398	c.1253T>A	c.(1252-1254)aTg>aAg	p.M418K	CTC-575N7.1_ENST00000503616.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	418	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		CATTTAGAGATGTCAACAAAC	0.353																																					p.M418K		.											.	ADAMTS19-295	0			c.T1253A						.						100.0	103.0	102.0					5																	128864313		2203	4300	6503	SO:0001583	missense	171019	exon6			TAGAGATGTCAAC	AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.1253T>A	5.37:g.128864313T>A	ENSP00000274487:p.Met418Lys	Somatic	143	0		WXS	Illumina GAIIx	Phase_I	173	30	NM_133638	0	0	0	0	0		Missense_Mutation	SNP	ENST00000274487.4	37	CCDS4146.1	.	.	.	.	.	.	.	.	.	.	T	12.35	1.910446	0.33721	.	.	ENSG00000145808	ENST00000274487	D	0.85955	-2.05	4.06	4.06	0.47325	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.183165	0.42172	D	0.000750	T	0.70386	0.3218	N	0.08118	0	0.53688	D	0.999972	B	0.28933	0.228	B	0.30251	0.113	T	0.67452	-0.5667	9	.	.	.	.	14.062	0.64806	0.0:0.0:0.0:1.0	.	418	Q8TE59	ATS19_HUMAN	K	418	ENSP00000274487:M418K	.	M	+	2	0	ADAMTS19	128892212	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.533000	0.67160	2.049000	0.60858	0.533000	0.62120	ATG	.		0.353	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250979.2	NM_133638	
NRG2	9542	hgsc.bcm.edu	37	5	139422602	139422602	+	Missense_Mutation	SNP	C	C	T	rs188534354	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr5:139422602C>T	ENST00000361474.1	-	1	277	c.53G>A	c.(52-54)cGg>cAg	p.R18Q	NRG2_ENST00000289422.7_Missense_Mutation_p.R18Q|NRG2_ENST00000545385.1_Missense_Mutation_p.R18Q|NRG2_ENST00000358522.3_Missense_Mutation_p.R18Q|NRG2_ENST00000289409.4_Missense_Mutation_p.R18Q|NRG2_ENST00000541337.1_Missense_Mutation_p.R18Q|NRG2_ENST00000394770.1_Missense_Mutation_p.R18Q	NM_004883.2	NP_004874.1	O14511	NRG2_HUMAN	neuregulin 2	18					embryo development (GO:0009790)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	25			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			gctgctgcACCGACCCTTCTC	0.701													C|||	11	0.00219649	0.0008	0.0072	5008	,	,		10461	0.0		0.005	False		,,,				2504	0.0				p.R18Q		.											.	NRG2-526	0			c.G53A						.	C	GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG	0,3008		0,0,1504	4.0	5.0	5.0		53,53,53,53,53	-2.4	1.0	5		5	9,6245		0,9,3118	no	missense,missense,missense,missense,missense	NRG2	NM_013983.2,NM_013982.2,NM_013981.3,NM_004883.2,NM_001184935.1	43,43,43,43,43	0,9,4622	TT,TC,CC		0.1439,0.0,0.0972	benign,benign,benign,benign,benign	18/853,18/859,18/845,18/851,18/785	139422602	9,9253	1504	3127	4631	SO:0001583	missense	9542	exon1			CTGCACCGACCCT		CCDS4217.1, CCDS54910.1	5q23-q33	2013-01-11			ENSG00000158458	ENSG00000158458		"""Immunoglobulin superfamily / I-set domain containing"""	7998	protein-coding gene	gene with protein product	"""neural- and thymus-derived activator for ErbB kinases"", ""divergent of neuregulin-1"""	603818				9168114, 9168115	Standard	NM_004883		Approved	Don-1, NTAK, HRG2	uc003lev.2	O14511	OTTHUMG00000129241	ENST00000361474.1:c.53G>A	5.37:g.139422602C>T	ENSP00000354910:p.Arg18Gln	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	15	12	NM_013982	0	0	1	1	0		Missense_Mutation	SNP	ENST00000361474.1	37	CCDS4217.1	16	0.007326007326007326	10	0.02032520325203252	1	0.0027624309392265192	0	0.0	5	0.006596306068601583	C	14.46	2.542008	0.45280	0.0	0.001439	ENSG00000158458	ENST00000541337;ENST00000289422;ENST00000361474;ENST00000446269;ENST00000545385;ENST00000394770;ENST00000289409;ENST00000358522;ENST00000378238	T;T;T;T;T;T;T;T	0.75821	-0.72;-0.76;-0.72;-0.76;-0.97;-0.97;-0.76;-0.97	3.88	-2.44	0.06502	.	.	.	.	.	T	0.39145	0.1067	N	0.08118	0	0.27621	N	0.948338	B;B;B;B	0.23891	0.093;0.056;0.093;0.093	B;B;B;B	0.23275	0.045;0.02;0.045;0.045	T	0.27262	-1.0079	9	0.41790	T	0.15	-5.1631	16.7016	0.85350	0.0:0.3488:0.6512:0.0	.	18;18;18;18	O14511-2;O14511;O14511-4;O14511-3	.;NRG2_HUMAN;.;.	Q	18	ENSP00000444235:R18Q;ENSP00000289422:R18Q;ENSP00000354910:R18Q;ENSP00000438753:R18Q;ENSP00000378251:R18Q;ENSP00000289409:R18Q;ENSP00000351323:R18Q;ENSP00000367483:R18Q	ENSP00000289409:R18Q	R	-	2	0	NRG2	139402786	0.998000	0.40836	0.996000	0.52242	0.989000	0.77384	0.158000	0.16422	-0.236000	0.09753	0.491000	0.48974	CGG	C|0.993;T|0.007		0.701	NRG2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251340.1	NM_013982	
PCDHB6	56130	broad.mit.edu	37	5	140531248	140531248	+	Silent	SNP	C	C	T			TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr5:140531248C>T	ENST00000231136.1	+	1	1410	c.1410C>T	c.(1408-1410)agC>agT	p.S470S	PCDHB6_ENST00000543635.1_Silent_p.S334S	NM_018939.2	NP_061762.1	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6	470	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			cervix(1)|endometrium(14)|kidney(6)|large_intestine(16)|liver(1)|lung(33)|ovary(1)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	84			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ACATCGGCAGCGTCAGCGCCA	0.642																																					p.S470S		.											.	PCDHB6-91	0			c.C1410T						.						93.0	102.0	99.0					5																	140531248		2203	4300	6503	SO:0001819	synonymous_variant	56130	exon1			CGGCAGCGTCAGC	AF152499	CCDS4248.1	5q31	2010-01-26			ENSG00000113211	ENSG00000113211		"""Cadherins / Protocadherins : Clustered"""	8691	other	protocadherin		606332				10380929	Standard	NM_018939		Approved	PCDH-BETA6	uc003lir.3	Q9Y5E3	OTTHUMG00000129623	ENST00000231136.1:c.1410C>T	5.37:g.140531248C>T		Somatic	67	0		WXS	Illumina GAIIx	Phase_I	303	17	NM_018939	0	0	7	14	7	B2R8R9	Silent	SNP	ENST00000231136.1	37	CCDS4248.1																																																																																			.		0.642	PCDHB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251818.2	NM_018939	
PCDHB8	56128	hgsc.bcm.edu	37	5	140559514	140559514	+	Silent	SNP	G	G	A	rs142690275	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr5:140559514G>A	ENST00000239444.2	+	1	2144	c.1899G>A	c.(1897-1899)gaG>gaA	p.E633E	PCDHB16_ENST00000361016.2_5'Flank	NM_019120.3	NP_061993.2	Q9UN66	PCDB8_HUMAN	protocadherin beta 8	633	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(14)|liver(1)|lung(38)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGCTGAGCGAGCGCGACGCGG	0.692													G|||	59	0.0117812	0.0303	0.0072	5008	,	,		16359	0.0		0.0109	False		,,,				2504	0.0031				p.E633E		.											.	PCDHB8-131	0			c.G1899A						.	G		163,3887		6,151,1868	21.0	24.0	23.0		1899	3.3	1.0	5	dbSNP_134	23	37,8077		0,37,4020	no	coding-synonymous	PCDHB8	NM_019120.3		6,188,5888	AA,AG,GG		0.456,4.0247,1.6442		633/802	140559514	200,11964	2025	4057	6082	SO:0001819	synonymous_variant	56128	exon1			GAGCGAGCGCGAC	AF152501	CCDS4250.1	5q31	2010-01-26			ENSG00000120322	ENSG00000120322		"""Cadherins / Protocadherins : Clustered"""	8693	other	protocadherin		606334				10380929	Standard	NM_019120		Approved	PCDH-BETA8, PCDH3I	uc011dai.2	Q9UN66	OTTHUMG00000129621	ENST00000239444.2:c.1899G>A	5.37:g.140559514G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	32	20	NM_019120	0	0	5	5	0	B9EGV1	Silent	SNP	ENST00000239444.2	37	CCDS4250.1																																																																																			G|0.986;A|0.014		0.692	PCDHB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251816.2	NM_019120	
GLRA1	2741	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	151231120	151231120	+	Missense_Mutation	SNP	A	A	T			TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr5:151231120A>T	ENST00000455880.2	-	7	1029	c.743T>A	c.(742-744)aTg>aAg	p.M248K	GLRA1_ENST00000274576.4_Missense_Mutation_p.M248K|GLRA1_ENST00000545569.1_Missense_Mutation_p.M165K|GLRA1_ENST00000471351.2_5'UTR			P23415	GLRA1_HUMAN	glycine receptor, alpha 1	248					acrosome reaction (GO:0007340)|action potential (GO:0001508)|adult walking behavior (GO:0007628)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|muscle contraction (GO:0006936)|negative regulation of transmission of nerve impulse (GO:0051970)|neuromuscular process controlling posture (GO:0050884)|neuropeptide signaling pathway (GO:0007218)|positive regulation of acrosome reaction (GO:2000344)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of membrane potential (GO:0042391)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|righting reflex (GO:0060013)|startle response (GO:0001964)|synaptic transmission, glycinergic (GO:0060012)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|external side of plasma membrane (GO:0009897)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glycine-gated chloride channel activity (GO:0016934)|glycine binding (GO:0016594)|taurine binding (GO:0030977)|transmitter-gated ion channel activity (GO:0022824)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	23		all_hematologic(541;0.0341)|Medulloblastoma(196;0.0912)	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Ethanol(DB00898)|Ginkgo biloba(DB01381)|Glycine(DB00145)|Halothane(DB01159)|Isoflurane(DB00753)|Lindane(DB00431)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	GTAGTAACCCATCTGCCGCTC	0.502																																					p.M248K		.											.	GLRA1-91	0			c.T743A						.						117.0	110.0	112.0					5																	151231120		2203	4300	6503	SO:0001583	missense	2741	exon7			TAACCCATCTGCC		CCDS4320.1, CCDS54942.1	5q33.1	2012-02-07	2008-01-24		ENSG00000145888	ENSG00000145888		"""Ligand-gated ion channels / Glycine receptors"""	4326	protein-coding gene	gene with protein product	"""startle disease/hyperekplexia"", ""stiff person syndrome"""	138491	"""glycine receptor, alpha 1 (startle disease/hyperekplexia)"""	STHE		1355335, 8298642	Standard	NM_000171		Approved		uc003lut.3	P23415	OTTHUMG00000130121	ENST00000455880.2:c.743T>A	5.37:g.151231120A>T	ENSP00000411593:p.Met248Lys	Somatic	173	0		WXS	Illumina GAIIx	Phase_I	264	60	NM_000171	0	0	0	0	0	B2R6T3|Q14C77|Q6DJV9	Missense_Mutation	SNP	ENST00000455880.2	37	CCDS54942.1	.	.	.	.	.	.	.	.	.	.	A	19.40	3.820856	0.71028	.	.	ENSG00000145888	ENST00000274576;ENST00000455880;ENST00000545569	D;D;D	0.84516	-1.86;-1.86;-1.86	5.2	5.2	0.72013	Neurotransmitter-gated ion-channel ligand-binding (2);Neurotransmitter-gated ion-channel transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.91277	0.7250	M	0.66560	2.04	0.80722	D	1	P;D;D	0.76494	0.952;0.999;0.991	P;D;D	0.91635	0.871;0.999;0.991	D	0.92307	0.5854	10	0.87932	D	0	.	15.3686	0.74545	1.0:0.0:0.0:0.0	.	248;165;248	P23415;Q14C71;P23415-2	GLRA1_HUMAN;.;.	K	248;248;165	ENSP00000274576:M248K;ENSP00000411593:M248K;ENSP00000445913:M165K	ENSP00000274576:M248K	M	-	2	0	GLRA1	151211313	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.125000	0.94402	2.086000	0.62901	0.533000	0.62120	ATG	.		0.502	GLRA1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000373959.1		
PPP1R3G	648791	hgsc.bcm.edu	37	6	5085983	5085983	+	Silent	SNP	C	C	G	rs148308290	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr6:5085983C>G	ENST00000405617.2	+	1	264	c.264C>G	c.(262-264)ccC>ccG	p.P88P		NM_001145115.1	NP_001138587.1	B7ZBB8	PP13G_HUMAN	protein phosphatase 1, regulatory subunit 3G	88					glucose homeostasis (GO:0042593)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of glycogen biosynthetic process (GO:0045725)	cytoplasm (GO:0005737)	glycogen binding (GO:2001069)			kidney(2)	2						TTTCCTTGCCCGCCGACCCCA	0.726													C|||	57	0.0113818	0.0424	0.0014	5008	,	,		12916	0.0		0.0	False		,,,				2504	0.0				p.P88P		.											.	PPP1R3G-136	0			c.C264G						.						2.0	5.0	4.0					6																	5085983		554	1363	1917	SO:0001819	synonymous_variant	648791	exon1			CTTGCCCGCCGAC		CCDS47366.1	6p25.1	2012-04-17	2011-10-04		ENSG00000219607	ENSG00000219607		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14945	protein-coding gene	gene with protein product			"""protein phosphatase 1, regulatory (inhibitor) subunit 3G"""			11948623	Standard	NM_001145115		Approved		uc011dia.1	B7ZBB8	OTTHUMG00000014172	ENST00000405617.2:c.264C>G	6.37:g.5085983C>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	26	12	NM_001145115	0	0	1	1	0		Silent	SNP	ENST00000405617.2	37	CCDS47366.1																																																																																			C|0.993;G|0.007		0.726	PPP1R3G-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039740.3	NM_001145115	
HIST1H1E	3008	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	26157045	26157045	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr6:26157045G>T	ENST00000304218.3	+	1	487	c.427G>T	c.(427-429)Ggg>Tgg	p.G143W	HIST1H2BD_ENST00000289316.2_5'Flank|HIST1H2BD_ENST00000377777.4_5'Flank	NM_005321.2	NP_005312.1	P10412	H14_HUMAN	histone cluster 1, H1e	143					nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)	extracellular vesicular exosome (GO:0070062)|nuclear heterochromatin (GO:0005720)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)			NS(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|liver(1)|lung(9)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	26						GAAGGCGACGGGGGCGGCCAC	0.622																																					p.G143W		.											.	HIST1H1E-154	0			c.G427T						.						12.0	20.0	18.0					6																	26157045		2193	4278	6471	SO:0001583	missense	3008	exon1			GCGACGGGGGCGG	M60748	CCDS4586.1	6p22.1	2012-05-04	2006-10-11	2003-02-21	ENSG00000168298	ENSG00000168298		"""Histones / Replication-dependent"""	4718	protein-coding gene	gene with protein product		142220	"""H1 histone family, member 4"", ""histone 1, H1e"""	H1F4		1916825, 12408966	Standard	NM_005321		Approved	H1.4, H1e, H1s-4	uc003ngq.3	P10412	OTTHUMG00000014422	ENST00000304218.3:c.427G>T	6.37:g.26157045G>T	ENSP00000307705:p.Gly143Trp	Somatic	51	0		WXS	Illumina GAIIx	Phase_I	138	37	NM_005321	0	0	0	0	0	Q4VB25	Missense_Mutation	SNP	ENST00000304218.3	37	CCDS4586.1	.	.	.	.	.	.	.	.	.	.	.	11.09	1.535648	0.27475	.	.	ENSG00000168298	ENST00000304218	T	0.04083	3.71	5.36	4.49	0.54785	.	0.340680	0.27876	N	0.017496	T	0.01156	0.0038	N	0.14661	0.345	0.28754	N	0.901299	P	0.51653	0.947	B	0.36959	0.237	T	0.44360	-0.9333	10	0.66056	D	0.02	-5.8076	11.4944	0.50400	0.1515:0.0:0.8485:0.0	.	143	P10412	H14_HUMAN	W	143	ENSP00000307705:G143W	ENSP00000307705:G143W	G	+	1	0	HIST1H1E	26265024	0.873000	0.30073	0.186000	0.23195	0.577000	0.36160	1.573000	0.36472	1.375000	0.46248	0.561000	0.74099	GGG	.		0.622	HIST1H1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040084.1	NM_005321	
HLA-A	3105	bcgsc.ca	37	6	29910688	29910688	+	Missense_Mutation	SNP	A	A	G	rs41544012	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr6:29910688A>G	ENST00000396634.1	+	4	569	c.228A>G	c.(226-228)atA>atG	p.I76M	HLA-A_ENST00000376809.5_Missense_Mutation_p.I76M|HLA-A_ENST00000376802.2_Missense_Mutation_p.I76M|HLA-A_ENST00000376806.5_Missense_Mutation_p.I76M			P16189	1A31_HUMAN	major histocompatibility complex, class I, A	76	Alpha-1.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	beta-2-microglobulin binding (GO:0030881)|peptide antigen binding (GO:0042605)|TAP binding (GO:0046977)			central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	30						CGCCGTGGATAGAGCAGGAGG	0.662									Osteosarcoma, Familial Clustering of;Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of;Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of	Multiple Myeloma(9;0.094)																											p.I76M		.											.	HLA-A-92	0			c.A228G						.						50.0	52.0	52.0					6																	29910688		2203	4299	6502	SO:0001583	missense	3105	exon2	Familial Cancer Database	Familial Osteogenic Sarcoma;incl.: Familial Head and Neck Cancer; ;Lichen Sclerosis, Familial	GTGGATAGAGCAG	D32129	CCDS34373.1	6p21.3	2013-01-11			ENSG00000206503	ENSG00000206503		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4931	protein-coding gene	gene with protein product		142800				8838351	Standard	NM_001242758		Approved		uc003nol.3	P01891	OTTHUMG00000130501	ENST00000396634.1:c.228A>G	6.37:g.29910688A>G	ENSP00000379873:p.Ile76Met	Somatic	110	2		WXS	Illumina GAIIx	Phase_I	516	39	NM_001242758	1	1	2208	2212	2	O62924|O98009|O98137|Q8MHM1|Q9TPQ3|Q9TQ24|Q9UQU6|Q9UQU7	Missense_Mutation	SNP	ENST00000396634.1	37	CCDS34373.1	264	0.12087912087912088	78	0.15853658536585366	37	0.10220994475138122	70	0.12237762237762238	79	0.10422163588390501	.	10.57	1.387103	0.25031	.	.	ENSG00000206503	ENST00000396634;ENST00000376806;ENST00000376809;ENST00000355767;ENST00000376802	T;T;T;T	0.00008	9.61;9.61;9.61;9.61	3.71	1.8	0.24995	MHC class I, alpha chain, alpha1/alpha2 (3);MHC classes I/II-like antigen recognition protein (3);MHC class I-like antigen recognition (3);	4.887320	0.02623	U	0.103442	T	0.00012	0.0000	N	0.00859	-1.14	0.09310	N	1	B;B;B;B;B	0.10296	0.002;0.003;0.003;0.003;0.003	B;B;B;B;B	0.26094	0.02;0.041;0.037;0.066;0.037	T	0.42430	-0.9452	10	0.66056	D	0.02	.	6.565	0.22507	0.2379:0.0:0.7621:0.0	rs41544012	76;76;76;76;76	P13746;Q5SRN7;P16188;Q5SRN5;P04439	1A11_HUMAN;.;1A30_HUMAN;.;1A03_HUMAN	M	76	ENSP00000379873:I76M;ENSP00000366002:I76M;ENSP00000366005:I76M;ENSP00000365998:I76M	ENSP00000348012:I76M	I	+	3	3	HLA-A	30018667	0.000000	0.05858	0.003000	0.11579	0.096000	0.18686	-0.131000	0.10482	0.352000	0.24053	-0.538000	0.04264	ATA	A|0.885;G|0.115		0.662	HLA-A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252909.1	NM_002116	
HLA-A	3105	hgsc.bcm.edu	37	6	29910699	29910699	+	Missense_Mutation	SNP	G	G	A	rs1059451		TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr6:29910699G>A	ENST00000396634.1	+	4	580	c.239G>A	c.(238-240)gGg>gAg	p.G80E	HLA-A_ENST00000376809.5_Missense_Mutation_p.G80E|HLA-A_ENST00000376802.2_Missense_Mutation_p.G80E|HLA-A_ENST00000376806.5_Missense_Mutation_p.G80E			P16189	1A31_HUMAN	major histocompatibility complex, class I, A	80	Alpha-1.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	beta-2-microglobulin binding (GO:0030881)|peptide antigen binding (GO:0042605)|TAP binding (GO:0046977)			central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	30						GAGCAGGAGGGGCCGGAGTAT	0.657									Osteosarcoma, Familial Clustering of;Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of;Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of	Multiple Myeloma(9;0.094)																											p.G80E		.											.	HLA-A-92	0			c.G239A						.						60.0	64.0	63.0					6																	29910699		2203	4300	6503	SO:0001583	missense	3105	exon2	Familial Cancer Database	Familial Osteogenic Sarcoma;incl.: Familial Head and Neck Cancer; ;Lichen Sclerosis, Familial	AGGAGGGGCCGGA	D32129	CCDS34373.1	6p21.3	2013-01-11			ENSG00000206503	ENSG00000206503		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4931	protein-coding gene	gene with protein product		142800				8838351	Standard	NM_001242758		Approved		uc003nol.3	P01891	OTTHUMG00000130501	ENST00000396634.1:c.239G>A	6.37:g.29910699G>A	ENSP00000379873:p.Gly80Glu	Somatic	130	0		WXS	Illumina GAIIx	Phase_I	528	28	NM_001242758	0	0	1790	1791	1	O62924|O98009|O98137|Q8MHM1|Q9TPQ3|Q9TQ24|Q9UQU6|Q9UQU7	Missense_Mutation	SNP	ENST00000396634.1	37	CCDS34373.1	.	.	.	.	.	.	.	.	.	.	.	10.31	1.314580	0.23908	.	.	ENSG00000206503	ENST00000396634;ENST00000376806;ENST00000376809;ENST00000355767;ENST00000376802	T;T;T;T	0.00856	5.61;5.61;5.61;5.61	3.72	-6.15	0.02105	MHC class I, alpha chain, alpha1/alpha2 (2);MHC classes I/II-like antigen recognition protein (2);MHC class I-like antigen recognition (2);	.	.	.	.	T	0.00552	0.0018	M	0.80183	2.485	0.09310	N	1	B;B;B;B	0.18610	0.002;0.008;0.029;0.017	B;B;B;B	0.28849	0.019;0.049;0.049;0.095	T	0.36407	-0.9749	9	0.72032	D	0.01	.	5.6199	0.17451	0.4487:0.2137:0.3376:0.0	rs1059451;rs2230986;rs3173428;rs41545313	80;80;80;80	P13746;Q5SRN7;Q5SRN5;P04439	1A11_HUMAN;.;.;1A03_HUMAN	E	80	ENSP00000379873:G80E;ENSP00000366002:G80E;ENSP00000366005:G80E;ENSP00000365998:G80E	ENSP00000348012:G80E	G	+	2	0	HLA-A	30018678	0.000000	0.05858	0.000000	0.03702	0.198000	0.23893	-0.747000	0.04823	-1.556000	0.01695	-0.346000	0.07831	GGG	G|0.999;A|0.001		0.657	HLA-A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252909.1	NM_002116	
CPNE5	57699	hgsc.bcm.edu	37	6	36710069	36710069	+	Silent	SNP	C	C	A	rs150763631	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr6:36710069C>A	ENST00000244751.2	-	21	2382	c.1758G>T	c.(1756-1758)gcG>gcT	p.A586A	CPNE5_ENST00000393189.2_Silent_p.A294A|CPNE5_ENST00000459703.1_5'UTR	NM_020939.1	NP_065990.1	Q9HCH3	CPNE5_HUMAN	copine V	586						extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(4)|liver(1)|lung(9)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25						GCAGGGGGGACGCAGGGGGCG	0.697													C|||	61	0.0121805	0.0424	0.0072	5008	,	,		12498	0.0		0.0	False		,,,				2504	0.0				p.A586A		.											.	CPNE5-91	0			c.G1758T						.	C		162,4238		5,152,2043	25.0	30.0	28.0		1758	-8.7	0.0	6	dbSNP_134	28	0,8596		0,0,4298	no	coding-synonymous	CPNE5	NM_020939.1		5,152,6341	AA,AC,CC		0.0,3.6818,1.2465		586/594	36710069	162,12834	2200	4298	6498	SO:0001819	synonymous_variant	57699	exon21			GGGGGACGCAGGG	H09181	CCDS4825.1	6p21.2	2010-05-28			ENSG00000124772	ENSG00000124772			2318	protein-coding gene	gene with protein product		604209				9430674	Standard	NM_020939		Approved	CPN5, COPN5, KIAA1599	uc003omr.1	Q9HCH3	OTTHUMG00000014602	ENST00000244751.2:c.1758G>T	6.37:g.36710069C>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	13	4	NM_020939	0	0	0	1	1	Q7Z6C8	Silent	SNP	ENST00000244751.2	37	CCDS4825.1																																																																																			C|0.989;A|0.011		0.697	CPNE5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040351.1	NM_020939	
POLR1C	9533	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	43485110	43485110	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr6:43485110G>A	ENST00000372389.3	+	2	224	c.136G>A	c.(136-138)Gag>Aag	p.E46K	RP3-337H4.9_ENST00000607571.1_RNA|POLR1C_ENST00000372344.2_Missense_Mutation_p.E46K|POLR1C_ENST00000304004.3_Missense_Mutation_p.E46K|YIPF3_ENST00000506469.1_5'Flank|YIPF3_ENST00000372422.2_5'Flank	NM_203290.2	NP_976035.1	O15160	RPAC1_HUMAN	polymerase (RNA) I polypeptide C, 30kDa	46					gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase I transcription (GO:0006363)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytosol (GO:0005829)|DNA-directed RNA polymerase I complex (GO:0005736)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			kidney(1)|large_intestine(2)|lung(1)|prostate(1)	5	all_cancers(18;3.79e-05)|Lung NSC(15;0.00217)|all_lung(25;0.00536)		Colorectal(64;0.00245)|all cancers(41;0.00511)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0711)			GGACCGCTTCGAGAAGGTAAG	0.547																																					p.E46K		.											.	POLR1C-90	0			c.G136A						.						155.0	157.0	156.0					6																	43485110		2203	4300	6503	SO:0001583	missense	9533	exon2			CGCTTCGAGAAGG	AF008442	CCDS4901.1	6p21.1	2013-01-21			ENSG00000171453	ENSG00000171453		"""RNA polymerase subunits"""	20194	protein-coding gene	gene with protein product		610060				11042152, 12446911	Standard	NM_203290		Approved	RPA40, RPA39, RPA5, RPAC1	uc003ovn.3	O15160	OTTHUMG00000014739	ENST00000372389.3:c.136G>A	6.37:g.43485110G>A	ENSP00000361465:p.Glu46Lys	Somatic	87	0		WXS	Illumina GAIIx	Phase_I	154	8	NM_203290	0	0	0	0	0	O75395|Q5JTE3	Missense_Mutation	SNP	ENST00000372389.3	37	CCDS4901.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	7.303|7.303	0.613357|0.613357	0.14066|0.14066	.|.	.|.	ENSG00000171453|ENSG00000171453	ENST00000372389;ENST00000372344;ENST00000304004|ENST00000423780	D;D;T|.	0.81659|.	-1.52;-1.52;-0.52|.	5.3|5.3	4.43|4.43	0.53597|0.53597	DNA-directed RNA polymerase, RBP11-like (1);|.	0.109676|.	0.64402|.	D|.	0.000008|.	T|T	0.24928|0.24928	0.0605|0.0605	N|N	0.12637|0.12637	0.245|0.245	0.53005|0.53005	D|D	0.999964|0.999964	B;B|.	0.19445|.	0.036;0.002|.	B;B|.	0.13407|.	0.009;0.003|.	T|T	0.14062|0.14062	-1.0486|-1.0486	10|5	0.02654|.	T|.	1|.	-25.5649|-25.5649	14.3154|14.3154	0.66446|0.66446	0.0:0.1486:0.8514:0.0|0.0:0.1486:0.8514:0.0	.|.	46;46|.	O15160-2;O15160|.	.;RPAC1_HUMAN|.	K|Q	46|45	ENSP00000361465:E46K;ENSP00000361419:E46K;ENSP00000307212:E46K|.	ENSP00000307212:E46K|.	E|R	+|+	1|2	0|0	POLR1C|POLR1C	43593088|43593088	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.780000|0.780000	0.44128|0.44128	3.359000|3.359000	0.52292|0.52292	1.216000|1.216000	0.43427|0.43427	-0.321000|-0.321000	0.08615|0.08615	GAG|CGA	.		0.547	POLR1C-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040652.3	NM_004875	
IGF2R	3482	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	160453715	160453715	+	Missense_Mutation	SNP	A	A	G	rs369933452		TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr6:160453715A>G	ENST00000356956.1	+	8	1163	c.1015A>G	c.(1015-1017)Ata>Gta	p.I339V		NM_000876.2	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor	339					insulin-like growth factor receptor signaling pathway (GO:0048009)|liver development (GO:0001889)|organ regeneration (GO:0031100)|positive regulation of apoptotic process (GO:0043065)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	cell surface (GO:0009986)|clathrin coat (GO:0030118)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network transport vesicle (GO:0030140)	G-protein coupled receptor activity (GO:0004930)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|insulin-like growth factor-activated receptor activity (GO:0005010)|mannose binding (GO:0005537)|phosphoprotein binding (GO:0051219)|receptor activity (GO:0004872)|retinoic acid binding (GO:0001972)|transporter activity (GO:0005215)			breast(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(27)|lung(31)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)	Mecasermin(DB01277)	GGATGTCTCCATAGACCTCAC	0.532																																					p.I339V		.											.	IGF2R-118	0			c.A1015G						.						86.0	83.0	84.0					6																	160453715		2203	4300	6503	SO:0001583	missense	3482	exon8			GTCTCCATAGACC	J03528	CCDS5273.1	6q25.3	2014-09-16			ENSG00000197081	ENSG00000197081		"""CD molecules"""	5467	protein-coding gene	gene with protein product	"""cation-independent mannose-6 phosphate receptor"""	147280					Standard	NM_000876		Approved	CD222, MPRI, MPR1, CIMPR, M6P-R	uc003qta.3	P11717	OTTHUMG00000015945	ENST00000356956.1:c.1015A>G	6.37:g.160453715A>G	ENSP00000349437:p.Ile339Val	Somatic	52	0		WXS	Illumina GAIIx	Phase_I	119	18	NM_000876	0	0	8	17	9	Q7Z7G9|Q96PT5	Missense_Mutation	SNP	ENST00000356956.1	37	CCDS5273.1	.	.	.	.	.	.	.	.	.	.	A	5.224	0.226916	0.09916	.	.	ENSG00000197081	ENST00000356956	T	0.02158	4.42	5.09	-1.76	0.08006	Mannose-6-phosphate receptor, binding (1);	0.298647	0.35378	N	0.003253	T	0.00784	0.0026	L	0.33710	1.025	0.39412	D	0.966762	B	0.14805	0.011	B	0.20184	0.028	T	0.48822	-0.9001	10	0.28530	T	0.3	-11.1593	12.3226	0.54993	0.4689:0.0:0.5311:0.0	.	339	P11717	MPRI_HUMAN	V	339	ENSP00000349437:I339V	ENSP00000349437:I339V	I	+	1	0	IGF2R	160373705	0.147000	0.22687	0.005000	0.12908	0.010000	0.07245	0.537000	0.23144	-0.472000	0.06881	-0.290000	0.09829	ATA	.		0.532	IGF2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042931.1	NM_000876	
SMOC2	64094	hgsc.bcm.edu	37	6	168842113	168842113	+	Silent	SNP	T	T	G	rs73270928	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr6:168842113T>G	ENST00000356284.2	+	1	283	c.63T>G	c.(61-63)gcT>gcG	p.A21A	SMOC2_ENST00000354536.5_Silent_p.A21A	NM_001166412.1	NP_001159884.1	Q9H3U7	SMOC2_HUMAN	SPARC related modular calcium binding 2	21					extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)|signal transduction (GO:0007165)	basement membrane (GO:0005604)|interstitial matrix (GO:0005614)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	32		Breast(66;0.000141)|Esophageal squamous(34;0.222)|Ovarian(120;0.231)		OV - Ovarian serous cystadenocarcinoma(33;1.31e-19)|BRCA - Breast invasive adenocarcinoma(81;3.06e-06)|GBM - Glioblastoma multiforme(31;0.00109)		CGGTGCCCGCTCAGAAGTTCT	0.751													G|||	1980	0.395367	0.5787	0.2839	5008	,	,		9314	0.4593		0.167	False		,,,				2504	0.3957				p.A21A		.											.	SMOC2-91	0			c.T63G						.	G	,	924,2074		89,746,664	2.0	3.0	3.0		63,63	-0.4	1.0	6	dbSNP_131	3	645,5799		34,577,2611	no	coding-synonymous,coding-synonymous	SMOC2	NM_001166412.1,NM_022138.2	,	123,1323,3275	GG,GT,TT		10.0093,30.8205,16.6172	,	21/447,21/458	168842113	1569,7873	1499	3222	4721	SO:0001819	synonymous_variant	64094	exon1			GCCCGCTCAGAAG	AB014730	CCDS5307.1, CCDS55076.1	6q27	2013-01-10			ENSG00000112562	ENSG00000112562		"""EF-hand domain containing"""	20323	protein-coding gene	gene with protein product		607223				12031507	Standard	NM_022138		Approved	SMAP2	uc003qwr.2	Q9H3U7	OTTHUMG00000016050	ENST00000356284.2:c.63T>G	6.37:g.168842113T>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_022138	0	0	0	0	0	B3KPS7|Q4G169|Q5TAT7|Q5TAT8|Q86VV9|Q96SF3|Q9H1L3|Q9H1L4|Q9H3U0|Q9H4F7|Q9HCV2	Silent	SNP	ENST00000356284.2	37	CCDS55076.1																																																																																			T|0.654;G|0.346		0.751	SMOC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043201.1		
RADIL	55698	hgsc.bcm.edu	37	7	4841489	4841489	+	Silent	SNP	G	G	A	rs151229803	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr7:4841489G>A	ENST00000399583.3	-	12	2824	c.2637C>T	c.(2635-2637)gcC>gcT	p.A879A	RADIL_ENST00000536091.1_3'UTR|RADIL_ENST00000538469.1_Silent_p.A639A	NM_018059.4	NP_060529.4	Q96JH8	RADIL_HUMAN	Ras association and DIL domains	879	Pro-rich.				multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)|substrate adhesion-dependent cell spreading (GO:0034446)	microtubule (GO:0005874)				NS(1)|biliary_tract(2)|breast(1)|central_nervous_system(3)|endometrium(2)|large_intestine(2)|lung(22)|pancreas(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;7.41e-15)		TTCCAGGGGGGGCCTGTGCCC	0.736													T|||	73	0.0145767	0.0537	0.0029	5008	,	,		12777	0.0		0.0	False		,,,				2504	0.0				p.A879A		.											.	RADIL-994	0			c.C2637T						.	T		106,3144		1,104,1520	5.0	6.0	6.0		2637	-7.4	0.0	7	dbSNP_134	6	1,7417		0,1,3708	no	coding-synonymous	RADIL	NM_018059.4		1,105,5228	AA,AG,GG		0.0135,3.2615,1.003		879/1076	4841489	107,10561	1625	3709	5334	SO:0001819	synonymous_variant	55698	exon12			AGGGGGGGCCTGT	AB058752	CCDS43544.1	7p22.1	2010-08-27			ENSG00000157927	ENSG00000157927			22226	protein-coding gene	gene with protein product		611491				16051602, 17704304	Standard	NM_018059		Approved	FLJ10324, KIAA1849, RASIP2	uc003snj.1	Q96JH8	OTTHUMG00000151753	ENST00000399583.3:c.2637C>T	7.37:g.4841489G>A		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	17	12	NM_018059	0	0	1	2	1	A4D1Z5|A5YM49|B7ZL20|Q0VFZ9|Q75LH3|Q9BSP5|Q9H0M6|Q9NW43|Q9NWC4	Silent	SNP	ENST00000399583.3	37	CCDS43544.1																																																																																			G|0.991;A|0.009		0.736	RADIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323769.2	NM_018059	
GARS	2617	hgsc.bcm.edu	37	7	30634661	30634661	+	Missense_Mutation	SNP	C	C	G	rs1049402	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr7:30634661C>G	ENST00000389266.3	+	1	365	c.124C>G	c.(124-126)Ccc>Gcc	p.P42A	AC005154.6_ENST00000584199.1_RNA|AC005154.6_ENST00000584372.1_RNA|AC005154.6_ENST00000581665.1_RNA|AC005154.6_ENST00000580440.1_RNA|AC005154.6_ENST00000578994.1_RNA|AC005154.6_ENST00000582549.1_RNA|AC005154.6_ENST00000583664.1_RNA|AC005154.6_ENST00000579174.1_RNA	NM_002047.2	NP_002038.2	P41250	SYG_HUMAN	glycyl-tRNA synthetase	42			P -> A (in dbSNP:rs1049402). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:7753621, ECO:0000269|PubMed:7961834, ECO:0000269|PubMed:7962006}.		cell death (GO:0008219)|diadenosine tetraphosphate biosynthetic process (GO:0015966)|gene expression (GO:0010467)|glycyl-tRNA aminoacylation (GO:0006426)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|secretory granule (GO:0030141)	ATP binding (GO:0005524)|glycine-tRNA ligase activity (GO:0004820)|protein dimerization activity (GO:0046983)	p.P42fs*20(1)		breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|skin(3)|urinary_tract(1)	24					Glycine(DB00145)	GGCCTCCTGCCCCCCGATCTC	0.736													G|||	3252	0.649361	0.5219	0.7147	5008	,	,		13746	0.6677		0.7634	False		,,,				2504	0.6391				p.P42A		.											.	GARS-91	1	Insertion - Frameshift(1)	large_intestine(1)	c.C124G						.	G	ALA/PRO	2445,1427		776,893,267	5.0	8.0	7.0		124	-6.6	0.0	7	dbSNP_86	7	6367,1671		2577,1213,229	no	missense	GARS	NM_002047.2	27	3353,2106,496	GG,GC,CC		20.7888,36.8543,26.0118	benign	42/740	30634661	8812,3098	1936	4019	5955	SO:0001583	missense	2617	exon1			TCCTGCCCCCCGA	AK074524	CCDS43564.1	7p15	2014-09-17	2004-02-13		ENSG00000106105	ENSG00000106105	6.1.1.14	"""Aminoacyl tRNA synthetases / Class II"""	4162	protein-coding gene	gene with protein product	"""glycine tRNA ligase"""	600287	"""Charcot-Marie-Tooth neuropathy 2D"""	CMT2D		8595897, 8872480	Standard	NM_002047		Approved	GlyRS, DSMAV, SMAD1	uc003tbm.3	P41250	OTTHUMG00000152769	ENST00000389266.3:c.124C>G	7.37:g.30634661C>G	ENSP00000373918:p.Pro42Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_002047	0	0	0	7	7	B3KQA2|B4DIA0|Q969Y1	Missense_Mutation	SNP	ENST00000389266.3	37	CCDS43564.1	1456	0.6666666666666666	278	0.5650406504065041	268	0.7403314917127072	337	0.5891608391608392	573	0.7559366754617414	G	0.005	-2.164835	0.00318	0.631457	0.792112	ENSG00000106105	ENST00000389266	T	0.80393	-1.37	3.31	-6.63	0.01807	.	1.037800	0.07609	N	0.925137	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.13575	-1.0504	9	0.08179	T	0.78	.	5.5596	0.17135	0.0726:0.2689:0.1197:0.5389	rs1049402;rs3189564;rs11553500;rs17856223;rs17856227;rs1049402	42	P41250	SYG_HUMAN	A	42	ENSP00000373918:P42A	ENSP00000373918:P42A	P	+	1	0	GARS	30601186	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	-0.671000	0.05250	-2.551000	0.00479	-0.744000	0.03518	CCC	C|0.329;G|0.671		0.736	GARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327735.1	NM_002047	
ELMO1	9844	bcgsc.ca	37	7	37272769	37272769	+	Silent	SNP	C	C	T	rs35387639	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr7:37272769C>T	ENST00000310758.4	-	8	1127	c.480G>A	c.(478-480)acG>acA	p.T160T	ELMO1_ENST00000442504.1_Silent_p.T160T|ELMO1_ENST00000448602.1_Silent_p.T160T	NM_001206480.1|NM_014800.10	NP_001193409.1|NP_055615.8	Q92556	ELMO1_HUMAN	engulfment and cell motility 1	160					actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|phagocytosis, engulfment (GO:0006911)|Rac protein signal transduction (GO:0016601)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	SH3 domain binding (GO:0017124)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(28)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	58						CAACGAAGGCCGTCAGGGTGA	0.493													C|||	160	0.0319489	0.0242	0.0476	5008	,	,		18279	0.0		0.0626	False		,,,				2504	0.0327				p.T160T		.											.	ELMO1-96	0			c.G480A						.	C	,,	146,4260	102.5+/-141.1	1,144,2058	99.0	83.0	89.0		480,480,480	-3.4	1.0	7	dbSNP_126	89	345,8255	117.2+/-176.8	5,335,3960	no	coding-synonymous,coding-synonymous,coding-synonymous	ELMO1	NM_001206480.1,NM_001206482.1,NM_014800.10	,,	6,479,6018	TT,TC,CC		4.0116,3.3137,3.7752	,,	160/728,160/728,160/728	37272769	491,12515	2203	4300	6503	SO:0001819	synonymous_variant	9844	exon8			GAAGGCCGTCAGG	AF398885	CCDS5449.1, CCDS5450.1	7p14.1	2012-07-10	2006-01-20		ENSG00000155849	ENSG00000155849		"""Engulfment and cell motility proteins"""	16286	protein-coding gene	gene with protein product		606420	"""engulfment and cell motility 1 (ced-12 homolog, C. elegans)"""			11595183	Standard	NM_001039459		Approved	KIAA0281, CED12, ELMO-1, CED-12	uc003tfk.2	Q92556	OTTHUMG00000023701	ENST00000310758.4:c.480G>A	7.37:g.37272769C>T		Somatic	95	0		WXS	Illumina GAIIx	Phase_I	128	5	NM_014800	0	0	1	1	0	A4D1X6|Q29R79|Q6ZTJ0|Q96PB0|Q9H0I1	Silent	SNP	ENST00000310758.4	37	CCDS5449.1																																																																																			C|0.964;T|0.036		0.493	ELMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219830.4	NM_130442	
LRRN3	54674	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	110764308	110764308	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr7:110764308T>C	ENST00000422987.3	+	2	2311	c.1480T>C	c.(1480-1482)Tat>Cat	p.Y494H	IMMP2L_ENST00000450877.1_Intron|IMMP2L_ENST00000489381.1_Intron|IMMP2L_ENST00000405709.2_Intron|IMMP2L_ENST00000331762.3_Intron|LRRN3_ENST00000451085.1_Missense_Mutation_p.Y494H|IMMP2L_ENST00000452895.1_Intron|IMMP2L_ENST00000437687.1_Intron|IMMP2L_ENST00000447215.1_Intron|LRRN3_ENST00000308478.5_Missense_Mutation_p.Y494H|IMMP2L_ENST00000415362.1_Intron	NM_018334.4	NP_060804.3	Q9H3W5	LRRN3_HUMAN	leucine rich repeat neuronal 3	494	Ig-like C2-type.				positive regulation of protein phosphorylation (GO:0001934)	clathrin adaptor complex (GO:0030131)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(15)|lung(20)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				UCEC - Uterine corpus endometrioid carcinoma (4;0.245)|LUSC - Lung squamous cell carcinoma(290;0.0715)|Lung(3;0.0864)|STAD - Stomach adenocarcinoma(3;0.125)		AGGGGGTTTATATACTTGTAT	0.393																																					p.Y494H		.											.	LRRN3-154	0			c.T1480C						.						59.0	58.0	58.0					7																	110764308		2203	4300	6503	SO:0001583	missense	54674	exon2			GGTTTATATACTT	AB060967	CCDS5754.1	7q31.1	2013-02-11			ENSG00000173114	ENSG00000173114		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	17200	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 5"""					11549284	Standard	NM_001099660		Approved	NLRR3, FLJ11129, FIGLER5	uc003vfs.4	Q9H3W5	OTTHUMG00000155039	ENST00000422987.3:c.1480T>C	7.37:g.110764308T>C	ENSP00000412417:p.Tyr494His	Somatic	162	0		WXS	Illumina GAIIx	Phase_I	196	35	NM_018334	0	0	1	1	0	O43377|Q6I9V8|Q8IYQ6	Missense_Mutation	SNP	ENST00000422987.3	37	CCDS5754.1	.	.	.	.	.	.	.	.	.	.	T	18.38	3.610304	0.66558	.	.	ENSG00000173114	ENST00000308478;ENST00000451085;ENST00000422987	D;D;D	0.99598	-6.26;-6.26;-6.26	6.17	6.17	0.99709	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.56097	D	0.000037	D	0.99851	0.9931	H	0.99516	4.605	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96418	0.9309	10	0.87932	D	0	.	16.8222	0.85835	0.0:0.0:0.0:1.0	.	494	Q9H3W5	LRRN3_HUMAN	H	494	ENSP00000312001:Y494H;ENSP00000397312:Y494H;ENSP00000412417:Y494H	ENSP00000312001:Y494H	Y	+	1	0	LRRN3	110551544	1.000000	0.71417	0.985000	0.45067	0.994000	0.84299	8.040000	0.89188	2.371000	0.80710	0.533000	0.62120	TAT	.		0.393	LRRN3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338171.2	NM_018334	
CAPZA2	830	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	116557779	116557779	+	Splice_Site	SNP	A	A	G			TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr7:116557779A>G	ENST00000361183.3	+	10	859		c.e10-1		CAPZA2_ENST00000458284.2_Splice_Site	NM_006136.2	NP_006127.1	P47755	CAZA2_HUMAN	capping protein (actin filament) muscle Z-line, alpha 2						actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|blood coagulation (GO:0007596)|cellular component movement (GO:0006928)|innate immune response (GO:0045087)|protein complex assembly (GO:0006461)	actin cytoskeleton (GO:0015629)|cortical cytoskeleton (GO:0030863)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|F-actin capping protein complex (GO:0008290)|membrane (GO:0016020)|WASH complex (GO:0071203)				endometrium(2)|kidney(3)|large_intestine(4)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	13	all_cancers(3;8.53e-08)|all_epithelial(6;7.79e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)		GBM - Glioblastoma multiforme(2;5.01e-06)|STAD - Stomach adenocarcinoma(10;0.000512)|all cancers(2;0.00326)			TGTTTTTCATAGACTGCCATC	0.348																																					.		.											.	CAPZA2-514	0			c.721-2A>G						.						119.0	117.0	118.0					7																	116557779		2203	4300	6503	SO:0001630	splice_region_variant	830	exon10			TTTCATAGACTGC		CCDS5768.1	7q31.2-q31.3	2008-07-18			ENSG00000198898	ENSG00000198898			1490	protein-coding gene	gene with protein product	"""F-actin capping protein alpha-2 subunit"""	601571					Standard	NM_006136		Approved	CAPZ, CAPPA2	uc003vil.3	P47755	OTTHUMG00000023185	ENST00000361183.3:c.721-1A>G	7.37:g.116557779A>G		Somatic	75	0		WXS	Illumina GAIIx	Phase_I	116	26	NM_006136	0	0	0	0	0	B4DG50	Splice_Site	SNP	ENST00000361183.3	37	CCDS5768.1	.	.	.	.	.	.	.	.	.	.	A	17.22	3.334524	0.60853	.	.	ENSG00000198898	ENST00000361183	.	.	.	5.63	5.63	0.86233	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.8386	0.78824	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CAPZA2	116345015	1.000000	0.71417	0.991000	0.47740	0.986000	0.74619	9.245000	0.95431	2.135000	0.66039	0.383000	0.25322	.	.		0.348	CAPZA2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059506.4	NM_006136	Intron
RP1L1	94137	hgsc.bcm.edu	37	8	10470130	10470130	+	Missense_Mutation	SNP	C	C	T	rs79401306	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr8:10470130C>T	ENST00000382483.3	-	4	1701	c.1478G>A	c.(1477-1479)cGg>cAg	p.R493Q		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	493					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		TCCAGCTTTCCGCTCAGCCCC	0.721													C|||	103	0.0205671	0.0764	0.0029	5008	,	,		15146	0.0		0.0	False		,,,				2504	0.0				p.R493Q		.											.	RP1L1-139	0			c.G1478A						.	C	GLN/ARG	205,3593		6,193,1700	26.0	30.0	29.0		1478	-2.6	0.0	8	dbSNP_131	29	3,8241		0,3,4119	yes	missense	RP1L1	NM_178857.5	43	6,196,5819	TT,TC,CC		0.0364,5.3976,1.7273	possibly-damaging	493/2401	10470130	208,11834	1899	4122	6021	SO:0001583	missense	94137	exon4			GCTTTCCGCTCAG	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.1478G>A	8.37:g.10470130C>T	ENSP00000371923:p.Arg493Gln	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	5	NM_178857	0	0	0	0	0	Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	ENST00000382483.3	37	CCDS43708.1	44	0.020146520146520148	44	0.08943089430894309	0	0.0	0	0.0	0	0.0	C	7.544	0.661253	0.14645	0.053976	3.64E-4	ENSG00000183638	ENST00000382483	T	0.04083	3.71	4.06	-2.57	0.06248	.	.	.	.	.	T	0.00109	0.0003	N	0.08118	0	0.09310	N	1	B	0.16396	0.017	B	0.04013	0.001	T	0.45190	-0.9278	9	0.41790	T	0.15	14.544	4.0305	0.09706	0.1672:0.3134:0.0:0.5194	.	493	A6NKC6	.	Q	493	ENSP00000371923:R493Q	ENSP00000371923:R493Q	R	-	2	0	RP1L1	10507540	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.619000	0.05572	-0.838000	0.04218	0.561000	0.74099	CGG	C|0.987;T|0.013		0.721	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1		
RP1L1	94137	hgsc.bcm.edu	37	8	10470764	10470764	+	Missense_Mutation	SNP	T	T	G	rs75814156	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr8:10470764T>G	ENST00000382483.3	-	4	1067	c.844A>C	c.(844-846)Aac>Cac	p.N282H		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	282					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		ACCGGGGGGTTGCTAGGACCA	0.672													T|||	113	0.0225639	0.084	0.0029	5008	,	,		15048	0.0		0.0	False		,,,				2504	0.0				p.N282H		.											.	RP1L1-139	0			c.A844C						.	T	HIS/ASN	236,3690		8,220,1735	55.0	62.0	60.0		844	0.6	0.0	8	dbSNP_131	60	2,8288		0,2,4143	yes	missense	RP1L1	NM_178857.5	68	8,222,5878	GG,GT,TT		0.0241,6.0112,1.9483	probably-damaging	282/2401	10470764	238,11978	1963	4145	6108	SO:0001583	missense	94137	exon4			GGGGGTTGCTAGG	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.844A>C	8.37:g.10470764T>G	ENSP00000371923:p.Asn282His	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	53	29	NM_178857	0	0	0	0	0	Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	ENST00000382483.3	37	CCDS43708.1	49	0.022435897435897436	49	0.09959349593495935	0	0.0	0	0.0	0	0.0	T	13.74	2.326457	0.41197	0.060112	2.41E-4	ENSG00000183638	ENST00000382483	T	0.04360	3.64	4.67	0.552	0.17230	.	0.788418	0.10319	N	0.688987	T	0.00144	0.0004	N	0.14661	0.345	0.09310	N	1	D	0.58970	0.984	P	0.46796	0.527	T	0.49960	-0.8883	10	0.59425	D	0.04	-5.163	5.688	0.17813	0.0:0.5952:0.1546:0.2502	.	282	A6NKC6	.	H	282	ENSP00000371923:N282H	ENSP00000371923:N282H	N	-	1	0	RP1L1	10508174	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	0.263000	0.18478	-0.050000	0.13356	-0.643000	0.03959	AAC	T|0.984;G|0.016		0.672	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1		
SLC25A37	51312	bcgsc.ca	37	8	23423669	23423669	+	Missense_Mutation	SNP	A	A	G	rs2942194	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr8:23423669A>G	ENST00000519973.1	+	2	457	c.259A>G	c.(259-261)Atc>Gtc	p.I87V	SLC25A37_ENST00000517923.1_3'UTR	NM_016612.2	NP_057696.2	Q9NYZ2	MFRN1_HUMAN	solute carrier family 25 (mitochondrial iron transporter), member 37	87			I -> V (in dbSNP:rs2942194).		iron ion homeostasis (GO:0055072)|mitochondrial iron ion transport (GO:0048250)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	iron ion transmembrane transporter activity (GO:0005381)			NS(1)|endometrium(3)|large_intestine(2)|lung(8)|urinary_tract(1)	15		Prostate(55;0.114)		Colorectal(74;0.0198)|COAD - Colon adenocarcinoma(73;0.0751)		GTACACAAGTATCTACGGAGC	0.522													A|||	867	0.173123	0.0197	0.2421	5008	,	,		17834	0.2163		0.2922	False		,,,				2504	0.1646				p.I87V		.											.	SLC25A37-90	0			c.A259G						.	A	VAL/ILE	224,3528		8,208,1660	50.0	46.0	48.0		259	3.5	0.6	8	dbSNP_101	48	2270,5940		334,1602,2169	yes	missense	SLC25A37	NM_016612.2	29	342,1810,3829	GG,GA,AA		27.6492,5.9701,20.8494	benign	87/339	23423669	2494,9468	1876	4105	5981	SO:0001583	missense	51312	exon2			ACAAGTATCTACG	AF495725	CCDS47828.1	8p21.2	2013-05-22	2012-03-29		ENSG00000147454	ENSG00000147454		"""Solute carriers"""	29786	protein-coding gene	gene with protein product	"""mitoferrin"""	610387	"""solute carrier family 25, member 37"""			16511496	Standard	XM_006716352		Approved	MSCP, MFRN, MFRN1	uc003xdo.3	Q9NYZ2	OTTHUMG00000163865	ENST00000519973.1:c.259A>G	8.37:g.23423669A>G	ENSP00000429200:p.Ile87Val	Somatic	68	0		WXS	Illumina GAIIx	Phase_I	99	5	NM_016612	0	0	13	13	0	A2RU93|Q53FT7|Q69YJ8|Q969S1|Q9P0J2	Missense_Mutation	SNP	ENST00000519973.1	37	CCDS47828.1	436	0.19963369963369965	9	0.018292682926829267	101	0.27900552486187846	114	0.1993006993006993	212	0.2796833773087071	A	4.840	0.156136	0.09236	0.059701	0.276492	ENSG00000147454	ENST00000519973;ENST00000523930	T;T	0.79352	-1.26;-1.26	5.63	3.49	0.39957	Mitochondrial carrier domain (2);	0.108721	0.64402	N	0.000008	T	0.00012	0.0000	N	0.02865	-0.47	0.30069	P	0.8102119999999999	B;B	0.02656	0.0;0.0	B;B	0.08055	0.003;0.003	T	0.09818	-1.0657	9	0.02654	T	1	-0.971	5.0266	0.14389	0.4417:0.0:0.5583:0.0	rs2942194;rs3736031;rs17778429;rs61300777;rs2942194	87;87	Q9NYZ2;Q9NYZ2-2	MFRN1_HUMAN;.	V	87;68	ENSP00000429200:I87V;ENSP00000428066:I68V	ENSP00000290075:I87V	I	+	1	0	SLC25A37	23479614	1.000000	0.71417	0.591000	0.28745	0.960000	0.62799	4.460000	0.60108	0.457000	0.26962	0.533000	0.62120	ATC	A|0.818;G|0.182		0.522	SLC25A37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376039.1	NM_016612	
ASPH	444	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	62596612	62596612	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr8:62596612T>C	ENST00000379454.4	-	2	426	c.239A>G	c.(238-240)tAt>tGt	p.Y80C	ASPH_ENST00000379449.6_Missense_Mutation_p.Y80C|ASPH_ENST00000389204.4_Missense_Mutation_p.Y51C|ASPH_ENST00000445642.3_Missense_Mutation_p.Y51C|ASPH_ENST00000517847.2_Missense_Mutation_p.Y51C|ASPH_ENST00000518068.1_Missense_Mutation_p.Y80C|ASPH_ENST00000517661.1_Missense_Mutation_p.Y51C|ASPH_ENST00000522835.1_Missense_Mutation_p.Y51C|ASPH_ENST00000517856.1_Missense_Mutation_p.Y80C|ASPH_ENST00000522603.1_Missense_Mutation_p.Y51C|ASPH_ENST00000517903.1_Missense_Mutation_p.Y51C|ASPH_ENST00000541428.1_Missense_Mutation_p.Y51C|ASPH_ENST00000356457.5_Missense_Mutation_p.Y80C	NM_004318.3	NP_004309.2	Q12797	ASPH_HUMAN	aspartate beta-hydroxylase	80					activation of cysteine-type endopeptidase activity (GO:0097202)|activation of store-operated calcium channel activity (GO:0032237)|calcium ion transmembrane transport (GO:0070588)|cellular response to calcium ion (GO:0071277)|detection of calcium ion (GO:0005513)|face morphogenesis (GO:0060325)|limb morphogenesis (GO:0035108)|muscle contraction (GO:0006936)|negative regulation of cell proliferation (GO:0008285)|palate development (GO:0060021)|pattern specification process (GO:0007389)|peptidyl-aspartic acid hydroxylation (GO:0042264)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of proteolysis (GO:0045862)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031585)|regulation of protein depolymerization (GO:1901879)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|response to ATP (GO:0033198)	calcium channel complex (GO:0034704)|cortical endoplasmic reticulum (GO:0032541)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|electron carrier activity (GO:0009055)|ion channel binding (GO:0044325)|peptide-aspartate beta-dioxygenase activity (GO:0004597)|structural constituent of muscle (GO:0008307)|structural molecule activity (GO:0005198)			breast(1)|cervix(1)|endometrium(5)|large_intestine(5)|lung(16)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35	Lung SC(2;0.153)	Lung NSC(129;0.0358)|all_lung(136;0.0654)|all_epithelial(80;0.101)			L-Aspartic Acid(DB00128)|Succinic acid(DB00139)	AACTTCCTCATAGTCAACAAG	0.398																																					p.Y80C		.											.	ASPH-93	0			c.A239G						.						138.0	134.0	136.0					8																	62596612		2203	4300	6503	SO:0001583	missense	444	exon2			TCCTCATAGTCAA	AF224468	CCDS34898.1, CCDS34899.1, CCDS34900.1, CCDS43742.1, CCDS47866.1, CCDS55234.1, CCDS55235.1, CCDS55236.1, CCDS55237.1, CCDS55238.1, CCDS75746.1	8q12.1	2008-02-05			ENSG00000198363	ENSG00000198363	1.14.11.16		757	protein-coding gene	gene with protein product	"""junctin"", ""humbug"", ""junctate"""	600582				7821814, 10974562	Standard	NM_004318		Approved	CASQ2BP1, BAH, JCTN, HAAH	uc003xuj.3	Q12797	OTTHUMG00000164375	ENST00000379454.4:c.239A>G	8.37:g.62596612T>C	ENSP00000368767:p.Tyr80Cys	Somatic	37	0		WXS	Illumina GAIIx	Phase_I	54	10	NM_001164754	0	0	27	35	8	A6NDF4|A6NHI2|B4DIC9|B4E2K4|B7ZM95|E5RGP5|F5H667|Q6NXR7|Q8TB28|Q9H291|Q9H2C4|Q9NRI0|Q9NRI1|Q9Y4J0	Missense_Mutation	SNP	ENST00000379454.4	37	CCDS34898.1	.	.	.	.	.	.	.	.	.	.	T	23.4	4.416533	0.83449	.	.	ENSG00000198363	ENST00000389213;ENST00000541428;ENST00000379454;ENST00000522349;ENST00000356457;ENST00000519234;ENST00000518068;ENST00000517903;ENST00000445642;ENST00000517847;ENST00000522835;ENST00000518306;ENST00000517856;ENST00000389204;ENST00000522603;ENST00000379449;ENST00000517661	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.73363	-0.74;-0.74;-0.74;-0.74;-0.74;-0.74;-0.74;-0.74;-0.74;-0.74;-0.74;-0.74;-0.74;-0.74;-0.74;-0.74	6.07	6.07	0.98685	Aspartyl beta-hydroxylase/Triadin domain (1);	0.000000	0.85682	D	0.000000	D	0.84920	0.5579	M	0.62723	1.935	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.97110	0.999;0.999;1.0;1.0;1.0;1.0;1.0;1.0;0.999;1.0;1.0;0.999;1.0;1.0	D	0.86152	0.1588	10	0.87932	D	0	-18.426	16.6407	0.85098	0.0:0.0:0.0:1.0	.	51;51;80;51;51;51;51;80;80;80;80;80;51;80	Q12797-4;Q12797-3;B8Y0L3;B4DIC9;B7ZM95;B7ZM96;F5H667;E5RG56;Q6NXR7;F8W7A9;Q8TB28;Q12797-2;Q9H291;Q12797	.;.;.;.;.;.;.;.;.;.;.;.;.;ASPH_HUMAN	C	80;51;80;51;80;80;80;51;51;51;51;51;80;51;51;80;51	ENSP00000437864:Y51C;ENSP00000368767:Y80C;ENSP00000429718:Y51C;ENSP00000348841:Y80C;ENSP00000427823:Y80C;ENSP00000429286:Y80C;ENSP00000430245:Y51C;ENSP00000394013:Y51C;ENSP00000429954:Y51C;ENSP00000429160:Y51C;ENSP00000427877:Y51C;ENSP00000429743:Y80C;ENSP00000373856:Y51C;ENSP00000436188:Y51C;ENSP00000368762:Y80C;ENSP00000428060:Y51C	ENSP00000348841:Y80C	Y	-	2	0	ASPH	62759166	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.576000	0.82467	2.326000	0.78906	0.533000	0.62120	TAT	.		0.398	ASPH-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378510.3	NM_004318	
CNBD1	168975	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	87917323	87917323	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr8:87917323A>G	ENST00000518476.1	+	3	224	c.173A>G	c.(172-174)aAt>aGt	p.N58S		NM_173538.2	NP_775809.1	Q8NA66	CNBD1_HUMAN	cyclic nucleotide binding domain containing 1	58										breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(4)|urinary_tract(1)	32						AGTATGAGCAATATCTTATCA	0.343																																					p.N58S		.											.	CNBD1-3	0			c.A173G						.						77.0	69.0	72.0					8																	87917323		1847	4099	5946	SO:0001583	missense	168975	exon3			TGAGCAATATCTT	AK093121	CCDS55259.1	8q21.3	2005-08-09				ENSG00000176571			26663	protein-coding gene	gene with protein product							Standard	NM_173538		Approved	FLJ35802	uc003ydy.2	Q8NA66		ENST00000518476.1:c.173A>G	8.37:g.87917323A>G	ENSP00000430073:p.Asn58Ser	Somatic	68	0		WXS	Illumina GAIIx	Phase_I	69	17	NM_173538	0	0	0	0	0		Missense_Mutation	SNP	ENST00000518476.1	37	CCDS55259.1	.	.	.	.	.	.	.	.	.	.	A	0.026	-1.374047	0.01214	.	.	ENSG00000176571	ENST00000518476	T	0.11063	2.81	4.33	-8.38	0.00973	.	1.337400	0.04961	N	0.462100	T	0.02455	0.0075	N	0.02916	-0.46	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.36504	-0.9745	10	0.02654	T	1	.	1.8134	0.03095	0.2678:0.3636:0.2407:0.128	.	58	Q8NA66	CNBD1_HUMAN	S	58	ENSP00000430073:N58S	ENSP00000430073:N58S	N	+	2	0	CNBD1	87986439	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.458000	0.01000	-1.152000	0.02832	-0.472000	0.04984	AAT	.		0.343	CNBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375113.2	NM_173538	
MROH5	389690	hgsc.bcm.edu	37	8	142477498	142477498	+	RNA	SNP	C	C	T	rs76084829	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr8:142477498C>T	ENST00000430863.1	-	0	2403					NM_207414.2	NP_997297.2	Q6ZUA9	MROH5_HUMAN	maestro heat-like repeat family member 5																		AGCGCCCTCACGATCTCCAGC	0.711													c|||	68	0.0135783	0.0507	0.0014	5008	,	,		14174	0.0		0.0	False		,,,				2504	0.0				.		.											.	.	0			c.2322+1G>A						.			138,3778		1,136,1821	16.0	17.0	17.0			1.8	0.0	8	dbSNP_132	17	4,8260		0,4,4128	yes	splice-5	FLJ43860	NM_207414.2		1,140,5949	TT,TC,CC		0.0484,3.524,1.1658			142477498	142,12038	1958	4132	6090			389690	exon19			CCCTCACGATCTC			8q24.3	2012-12-20			ENSG00000226807	ENSG00000226807		"""maestro heat-like repeat containing"""	42976	protein-coding gene	gene with protein product							Standard	NM_207414		Approved	FLJ43860	uc003ywi.2	Q6ZUA9	OTTHUMG00000155944		8.37:g.142477498C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	48	18	NM_207414	0	0	0	0	0		Splice_Site	SNP	ENST00000430863.1	37																																																																																				C|0.982;T|0.018		0.711	MROH5-001	KNOWN	non_canonical_polymorphism|basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000342412.4	NM_207414	
ZNF696	79943	hgsc.bcm.edu	37	8	144378731	144378731	+	Missense_Mutation	SNP	C	C	G	rs371549135		TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr8:144378731C>G	ENST00000330143.3	+	3	1295	c.886C>G	c.(886-888)Cag>Gag	p.Q296E		NM_030895.2	NP_112157.2	Q9H7X3	ZN696_HUMAN	zinc finger protein 696	296					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	8	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)			CTTCGCCTGCCAGGACTGCGG	0.731																																					p.Q296E		.											.	ZNF696-90	0			c.C886G						.	C	GLU/GLN	1,3975		0,1,1987	10.0	13.0	12.0		886	-1.8	0.0	8		12	0,7858		0,0,3929	no	missense	ZNF696	NM_030895.2	29	0,1,5916	GG,GC,CC		0.0,0.0252,0.0085	benign	296/375	144378731	1,11833	1988	3929	5917	SO:0001583	missense	79943	exon3			GCCTGCCAGGACT	AK024191	CCDS6399.1	8q24.3	2013-01-08				ENSG00000185730		"""Zinc fingers, C2H2-type"""	25872	protein-coding gene	gene with protein product							Standard	NM_030895		Approved	FLJ14129	uc003yxy.4	Q9H7X3		ENST00000330143.3:c.886C>G	8.37:g.144378731C>G	ENSP00000328515:p.Gln296Glu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	12	6	NM_030895	0	0	4	6	2	A0AVE2	Missense_Mutation	SNP	ENST00000330143.3	37	CCDS6399.1	.	.	.	.	.	.	.	.	.	.	C	2.379	-0.342553	0.05243	2.52E-4	0.0	ENSG00000185730	ENST00000330143	T	0.16597	2.33	3.2	-1.8	0.07907	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04137	0.0115	N	0.01076	-1.035	0.09310	N	1	B	0.18968	0.032	B	0.10450	0.005	T	0.44590	-0.9318	8	.	.	.	.	5.7834	0.18320	0.4513:0.2413:0.3074:0.0	.	296	Q9H7X3	ZN696_HUMAN	E	296	ENSP00000328515:Q296E	.	Q	+	1	0	ZNF696	144450106	0.000000	0.05858	0.000000	0.03702	0.156000	0.22039	-3.083000	0.00612	-0.160000	0.11002	-0.330000	0.08379	CAG	.		0.731	ZNF696-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381164.2	NM_030895	
EPPK1	83481	hgsc.bcm.edu;broad.mit.edu	37	8	144940427	144940427	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr8:144940427C>T	ENST00000525985.1	-	2	7066	c.6995G>A	c.(6994-6996)cGg>cAg	p.R2332Q				P58107	EPIPL_HUMAN	epiplakin 1	2332						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			GCCGTGCTCCCGGACGATGAG	0.706																																					p.R2332Q		.											.	EPPK1-25	0			c.G6995A						.						176.0	176.0	176.0					8																	144940427		2161	4245	6406	SO:0001583	missense	83481	exon1			TGCTCCCGGACGA	AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.6995G>A	8.37:g.144940427C>T	ENSP00000436337:p.Arg2332Gln	Somatic	32	0		WXS	Illumina GAIIx	Phase_I	202	17	NM_031308	0	0	0	0	0	Q76E58|Q9NSU9	Missense_Mutation	SNP	ENST00000525985.1	37		.	.	.	.	.	.	.	.	.	.	C	19.43	3.826941	0.71143	.	.	ENSG00000227184	ENST00000525985	T	0.69435	-0.4	4.33	3.43	0.39272	.	.	.	.	.	T	0.33352	0.0860	N	0.04959	-0.14	0.09310	N	1	P	0.47253	0.892	B	0.31390	0.129	T	0.05733	-1.0867	9	0.16896	T	0.51	.	6.2376	0.20772	0.0:0.7721:0.0:0.2279	.	2332	E9PPU0	.	Q	2332	ENSP00000436337:R2332Q	ENSP00000436337:R2332Q	R	-	2	0	EPPK1	145012415	0.000000	0.05858	0.020000	0.16555	0.975000	0.68041	0.479000	0.22228	1.153000	0.42468	0.586000	0.80456	CGG	.		0.706	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382675.1	NM_031308	
EPPK1	83481	hgsc.bcm.edu	37	8	144946602	144946602	+	Missense_Mutation	SNP	G	G	A	rs147805507	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr8:144946602G>A	ENST00000525985.1	-	2	891	c.820C>T	c.(820-822)Cgt>Tgt	p.R274C				P58107	EPIPL_HUMAN	epiplakin 1	274						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)	p.R274C(1)		NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			ACCTCGGCACGTGCACTCACG	0.682													G|||	15	0.00299521	0.0083	0.0014	5008	,	,		17846	0.003		0.0	False		,,,				2504	0.0				p.R274C		.											.	EPPK1-25	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)	c.C820T						.	G	CYS/ARG	39,4315		0,39,2138	17.0	21.0	20.0		820	3.0	0.0	8	dbSNP_134	20	0,8510		0,0,4255	yes	missense	EPPK1	NM_031308.1	180	0,39,6393	AA,AG,GG		0.0,0.8957,0.3032	probably-damaging	274/2420	144946602	39,12825	2177	4255	6432	SO:0001583	missense	83481	exon1			CGGCACGTGCACT	AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.820C>T	8.37:g.144946602G>A	ENSP00000436337:p.Arg274Cys	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	55	37	NM_031308	0	0	0	0	0	Q76E58|Q9NSU9	Missense_Mutation	SNP	ENST00000525985.1	37		10	0.004578754578754579	6	0.012195121951219513	1	0.0027624309392265192	3	0.005244755244755245	0	0.0	G	11.01	1.513463	0.27123	0.008957	0.0	ENSG00000227184	ENST00000525985	T	0.68479	-0.33	4.81	3.02	0.34903	.	.	.	.	.	T	0.49115	0.1538	L	0.38175	1.15	0.09310	N	1	D	0.63880	0.993	B	0.44315	0.446	T	0.43702	-0.9375	9	0.62326	D	0.03	.	8.9077	0.35535	0.1833:0.0:0.8167:0.0	.	274	E9PPU0	.	C	274	ENSP00000436337:R274C	ENSP00000436337:R274C	R	-	1	0	EPPK1	145018590	0.000000	0.05858	0.007000	0.13788	0.039000	0.13416	0.257000	0.18369	0.630000	0.30394	0.511000	0.50034	CGT	G|0.995;A|0.005		0.682	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382675.1	NM_031308	
PLEC	5339	hgsc.bcm.edu	37	8	144997023	144997023	+	Silent	SNP	C	C	T	rs146381488	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr8:144997023C>T	ENST00000322810.4	-	31	7654	c.7485G>A	c.(7483-7485)gcG>gcA	p.A2495A	PLEC_ENST00000354589.3_Silent_p.A2358A|PLEC_ENST00000357649.2_Silent_p.A2362A|PLEC_ENST00000356346.3_Silent_p.A2344A|PLEC_ENST00000398774.2_Silent_p.A2326A|PLEC_ENST00000436759.2_Silent_p.A2385A|PLEC_ENST00000527096.1_Silent_p.A2381A|PLEC_ENST00000354958.2_Silent_p.A2336A|PLEC_ENST00000345136.3_Silent_p.A2358A	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	2495	Central fibrous rod domain.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						GCGTCTCCTCCGCCAGCTGCT	0.687													C|||	10	0.00199681	0.0	0.0043	5008	,	,		15355	0.0		0.007	False		,,,				2504	0.0				p.A2495A		.											.	PLEC-141	0			c.G7485A						.	C	,,,,,,,	9,4313		0,9,2152	6.0	7.0	7.0		7155,7032,7008,7485,6978,7074,7086,7074	-10.3	0.0	8	dbSNP_134	7	41,8461		0,41,4210	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	,,,,,,,	0,50,6362	TT,TC,CC		0.4822,0.2082,0.3899	,,,,,,,	2385/4575,2344/4534,2336/4526,2495/4685,2326/4516,2358/4548,2362/4552,2358/4548	144997023	50,12774	2161	4251	6412	SO:0001819	synonymous_variant	5339	exon31			CTCCTCCGCCAGC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.7485G>A	8.37:g.144997023C>T		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	32	17	NM_201380	0	0	1	5	4	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																			C|0.998;T|0.002		0.687	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
FAM205A	259308	broad.mit.edu	37	9	34724786	34724786	+	Silent	SNP	G	G	A	rs72617336	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr9:34724786G>A	ENST00000378788.3	-	4	2490	c.2451C>T	c.(2449-2451)ccC>ccT	p.P817P		NM_001141917.1	NP_001135389.1	Q6ZU69	F205A_HUMAN	family with sequence similarity 205, member A	817						integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(1)	4						GGATTTCCACGGGACTAGGCT	0.542													G|||	2001	0.399561	0.0666	0.3991	5008	,	,		19790	0.6171		0.4791	False		,,,				2504	0.544				p.P817P		.											.	.	0			c.C2451T						.	G		168,1216		7,154,531	30.0	26.0	27.0		2451	1.0	0.0	9	dbSNP_130	27	1526,1656		355,816,420	no	coding-synonymous	FAM205A	NM_001141917.1		362,970,951	AA,AG,GG		47.9573,12.1387,37.1003		817/1336	34724786	1694,2872	692	1591	2283	SO:0001819	synonymous_variant	259308	exon4			TTCCACGGGACTA		CCDS55305.1	9p13.3	2014-05-16			ENSG00000205108	ENSG00000205108			41911	protein-coding gene	gene with protein product							Standard	NM_001141917		Approved	C9orf144B	uc011lor.2	Q6ZU69	OTTHUMG00000000448	ENST00000378788.3:c.2451C>T	9.37:g.34724786G>A		Somatic	140	1		WXS	Illumina GAIIx	Phase_I	191	6	NM_001141917	0	0	0	0	0	A8MVW7	Silent	SNP	ENST00000378788.3	37	CCDS55305.1																																																																																			G|0.579;A|0.421		0.542	FAM205A-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001150.2	NM_001141917	
FAM205A	259308	broad.mit.edu	37	9	34724796	34724796	+	Missense_Mutation	SNP	T	T	A	rs150496452	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr9:34724796T>A	ENST00000378788.3	-	4	2480	c.2441A>T	c.(2440-2442)gAg>gTg	p.E814V		NM_001141917.1	NP_001135389.1	Q6ZU69	F205A_HUMAN	family with sequence similarity 205, member A	814				E -> V (in Ref. 1; BAC86357). {ECO:0000305}.		integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(1)	4						GGGACTAGGCTCCATCTCTGT	0.552													A|||	2018	0.402955	0.0696	0.4049	5008	,	,		19637	0.6181		0.4871	False		,,,				2504	0.544				p.E814V		.											.	.	0			c.A2441T						.	A	VAL/GLU	176,1208		8,160,524	22.0	20.0	21.0		2441	2.2	0.0	9	dbSNP_134	21	1527,1655		357,813,421	no	missense	FAM205A	NM_001141917.1	121	365,973,945	AA,AT,TT		47.9887,12.7168,37.2974	benign	814/1336	34724796	1703,2863	692	1591	2283	SO:0001583	missense	259308	exon4			CTAGGCTCCATCT		CCDS55305.1	9p13.3	2014-05-16			ENSG00000205108	ENSG00000205108			41911	protein-coding gene	gene with protein product							Standard	NM_001141917		Approved	C9orf144B	uc011lor.2	Q6ZU69	OTTHUMG00000000448	ENST00000378788.3:c.2441A>T	9.37:g.34724796T>A	ENSP00000417711:p.Glu814Val	Somatic	121	1		WXS	Illumina GAIIx	Phase_I	179	7	NM_001141917	0	0	0	0	0	A8MVW7	Missense_Mutation	SNP	ENST00000378788.3	37	CCDS55305.1	910	0.4166666666666667	45	0.09146341463414634	151	0.4171270718232044	334	0.583916083916084	380	0.5013192612137203	A	0.136	-1.107839	0.01813	0.127168	0.479887	ENSG00000205108	ENST00000378788	T	0.37584	1.19	4.7	2.24	0.28232	.	.	.	.	.	T	0.00012	0.0000	N	0.00538	-1.39	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.47142	-0.9140	8	0.02654	T	1	.	4.3631	0.11211	0.4712:0.1804:0.0:0.3484	.	814	Q6ZU69	F205A_HUMAN	V	814	ENSP00000417711:E814V	ENSP00000417711:E814V	E	-	2	0	RP11-195F19.10	34714796	0.000000	0.05858	0.004000	0.12327	0.027000	0.11550	-0.281000	0.08456	0.758000	0.33059	-0.265000	0.10407	GAG	T|1.000;|0.000		0.552	FAM205A-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001150.2	NM_001141917	
PGM5	5239	hgsc.bcm.edu	37	9	70972109	70972109	+	Silent	SNP	C	C	T	rs79088300	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr9:70972109C>T	ENST00000396396.1	+	1	295	c.66C>T	c.(64-66)gcC>gcT	p.A22A	PGM5-AS1_ENST00000420855.1_RNA|PGM5-AS1_ENST00000417887.1_RNA|PGM5_ENST00000604870.2_Intron|PGM5_ENST00000396392.1_Silent_p.A22A	NM_021965.3	NP_068800.2	Q15124	PGM5_HUMAN	phosphoglucomutase 5	22				A -> S (in Ref. 4; CAA73882). {ECO:0000305}.	carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)	cell-cell adherens junction (GO:0005913)|costamere (GO:0043034)|cytoplasmic side of plasma membrane (GO:0009898)|dystrophin-associated glycoprotein complex (GO:0016010)|focal adhesion (GO:0005925)|intercalated disc (GO:0014704)|sarcolemma (GO:0042383)|spot adherens junction (GO:0005914)|stress fiber (GO:0001725)|Z disc (GO:0030018)	intramolecular transferase activity, phosphotransferases (GO:0016868)|magnesium ion binding (GO:0000287)|structural molecule activity (GO:0005198)			endometrium(5)|kidney(1)|large_intestine(5)|liver(2)|lung(15)|ovary(1)|pancreas(1)|prostate(3)|skin(1)	34						Agcggccggccggcggcgggg	0.726													c|||	333	0.0664936	0.2405	0.0173	5008	,	,		9774	0.0		0.003	False		,,,				2504	0.0				p.A22A		.											.	PGM5-92	0			c.C66T						.	C		224,2228		1,222,1003	2.0	2.0	2.0		66	-1.9	0.7	9	dbSNP_131	2	4,5508		0,4,2752	no	coding-synonymous	PGM5	NM_021965.3		1,226,3755	TT,TC,CC		0.0726,9.1354,2.8629		22/568	70972109	228,7736	1226	2756	3982	SO:0001819	synonymous_variant	5239	exon1			GCCGGCCGGCGGC	L40933	CCDS6622.2	9q13	2008-02-05			ENSG00000154330	ENSG00000154330			8908	protein-coding gene	gene with protein product	"""phosphoglucomutase-related protein"""	600981				8586438, 8631316	Standard	NM_021965		Approved	PGMRP	uc004agr.3	Q15124	OTTHUMG00000019966	ENST00000396396.1:c.66C>T	9.37:g.70972109C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	7	NM_021965	0	0	5	11	6	B1AM46|B4DLQ6|Q5VYV3|Q8N527|Q9UDH4	Silent	SNP	ENST00000396396.1	37	CCDS6622.2																																																																																			C|0.936;T|0.064		0.726	PGM5-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052548.2	NM_021965	
TNC	3371	bcgsc.ca	37	9	117797597	117797597	+	Silent	SNP	T	T	C	rs12347433	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr9:117797597T>C	ENST00000350763.4	-	22	6084	c.5673A>G	c.(5671-5673)agA>agG	p.R1891R	TNC_ENST00000423613.2_Silent_p.R1618R|TNC_ENST00000542877.1_Silent_p.R1528R|TNC_ENST00000345230.3_Silent_p.R1254R|TNC_ENST00000341037.4_Silent_p.R1709R|TNC_ENST00000537320.1_Silent_p.R1254R|TNC_ENST00000346706.3_Silent_p.R1345R|TNC_ENST00000535648.1_Silent_p.R1436R|TNC_ENST00000340094.3_Silent_p.R1527R	NM_002160.3	NP_002151.2	P24821	TENA_HUMAN	tenascin C	1891	Fibronectin type-III 15. {ECO:0000255|PROSITE-ProRule:PRU00316}.				bud outgrowth involved in lung branching (GO:0060447)|cell adhesion (GO:0007155)|cellular response to prostaglandin D stimulus (GO:0071799)|cellular response to retinoic acid (GO:0071300)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|mesenchymal-epithelial cell signaling involved in prostate gland development (GO:0060739)|negative regulation of cell adhesion (GO:0007162)|neuromuscular junction development (GO:0007528)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|prostate gland epithelium morphogenesis (GO:0060740)|response to ethanol (GO:0045471)|response to fibroblast growth factor (GO:0071774)|response to mechanical stimulus (GO:0009612)|response to wounding (GO:0009611)|wound healing (GO:0042060)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	syndecan binding (GO:0045545)	p.R1891R(1)		NS(3)|breast(5)|central_nervous_system(4)|endometrium(8)|kidney(6)|large_intestine(32)|liver(1)|lung(39)|ovary(1)|pancreas(2)|prostate(5)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	120						CAGTCAAGTCTCTTGGAGAAT	0.512													T|||	773	0.154353	0.0666	0.1484	5008	,	,		19335	0.129		0.2793	False		,,,				2504	0.1748				p.R1891R		.											.	TNC-517	1	Substitution - coding silent(1)	stomach(1)	c.A5673G						.	T		404,4002	199.4+/-223.0	21,362,1820	72.0	72.0	72.0		5673	6.0	1.0	9	dbSNP_120	72	2313,6287	389.1+/-342.8	320,1673,2307	no	coding-synonymous	TNC	NM_002160.3		341,2035,4127	CC,CT,TT		26.8953,9.1693,20.8904		1891/2202	117797597	2717,10289	2203	4300	6503	SO:0001819	synonymous_variant	3371	exon22			CAAGTCTCTTGGA		CCDS6811.1	9q33.1	2014-01-28	2008-07-31	2002-06-07	ENSG00000041982	ENSG00000041982		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	5318	protein-coding gene	gene with protein product	"""hexabrachion (tenascin)"""	187380	"""hexabrachion (tenascin C, cytotactin)"", ""deafness, autosomal dominant 56"""	HXB, DFNA56		1704365, 1707164, 23936043	Standard	NM_002160		Approved	TN, MGC167029	uc004bjj.4	P24821	OTTHUMG00000021010	ENST00000350763.4:c.5673A>G	9.37:g.117797597T>C		Somatic	87	0		WXS	Illumina GAIIx	Phase_I	89	7	NM_002160	0	0	0	0	0	C9IYT7|C9J575|C9J6D9|C9J848|Q14583|Q15567|Q5T7S3	Silent	SNP	ENST00000350763.4	37	CCDS6811.1	383	0.17536630036630035	40	0.08130081300813008	46	0.1270718232044199	85	0.1486013986013986	212	0.2796833773087071	T	10.49	1.365894	0.24684	0.091693	0.268953	ENSG00000041982	ENST00000544972	T	0.57436	0.4	5.97	5.97	0.96955	.	0.206129	0.51477	D	0.000084	T	0.00012	0.0000	.	.	.	0.09310	P	1.0	.	.	.	.	.	.	T	0.22034	-1.0228	6	0.48119	T	0.1	.	10.4647	0.44600	0.0:0.1145:0.0:0.8855	rs12347433;rs17240303;rs12347433	.	.	.	G	454	ENSP00000445380:R454G	ENSP00000445380:R454G	R	-	1	2	TNC	116837418	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	3.042000	0.49815	2.274000	0.75844	0.533000	0.62120	AGA	T|0.813;C|0.187		0.512	TNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055418.2	NM_002160	
GOLGA1	2800	broad.mit.edu	37	9	127693630	127693630	+	Missense_Mutation	SNP	T	T	C	rs148050398		TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr9:127693630T>C	ENST00000373555.4	-	4	524	c.191A>G	c.(190-192)aAt>aGt	p.N64S		NM_002077.3	NP_002068	Q92805	GOGA1_HUMAN	golgin A1	64					protein targeting to Golgi (GO:0000042)	Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)				NS(1)|endometrium(5)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|stomach(1)	20						TATCTGTTCATTCCTTCTCAG	0.433													T|||	1	0.000199681	0.0008	0.0	5008	,	,		16388	0.0		0.0	False		,,,				2504	0.0				p.N64S		.											.	GOLGA1-91	0			c.A191G						.	T	SER/ASN	8,4398	14.3+/-33.2	0,8,2195	148.0	141.0	144.0		191	5.1	1.0	9	dbSNP_134	144	0,8600		0,0,4300	yes	missense	GOLGA1	NM_002077.3	46	0,8,6495	CC,CT,TT		0.0,0.1816,0.0615	possibly-damaging	64/768	127693630	8,12998	2203	4300	6503	SO:0001583	missense	2800	exon4			TGTTCATTCCTTC	U51587	CCDS6860.1	9q34.11	2010-02-12	2010-02-12		ENSG00000136935	ENSG00000136935			4424	protein-coding gene	gene with protein product		602502	"""golgi autoantigen, golgin subfamily a, 1"""			9324025	Standard	NM_002077		Approved	golgin-97, MGC33154	uc004bpc.3	Q92805	OTTHUMG00000020665	ENST00000373555.4:c.191A>G	9.37:g.127693630T>C	ENSP00000362656:p.Asn64Ser	Somatic	82	1		WXS	Illumina GAIIx	Phase_I	98	3	NM_002077	0	0	6	6	0	Q5T164|Q8IYZ9	Missense_Mutation	SNP	ENST00000373555.4	37	CCDS6860.1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.944635	0.73672	0.001816	0.0	ENSG00000136935	ENST00000373555;ENST00000421514	T;T	0.16743	2.32;2.32	5.11	5.11	0.69529	.	0.146859	0.31010	U	0.008435	T	0.13756	0.0333	L	0.36672	1.1	0.54753	D	0.999981	B	0.28512	0.214	B	0.24848	0.056	T	0.08680	-1.0710	10	0.15499	T	0.54	-13.7441	14.232	0.65898	0.0:0.0:0.0:1.0	.	64	Q92805	GOGA1_HUMAN	S	64	ENSP00000362656:N64S;ENSP00000396966:N64S	ENSP00000362656:N64S	N	-	2	0	GOLGA1	126733451	1.000000	0.71417	0.999000	0.59377	0.818000	0.46254	7.174000	0.77620	2.142000	0.66516	0.482000	0.46254	AAT	T|0.999;C|0.001		0.433	GOLGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054049.1	NM_002077	
C9orf171	389799	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	135447854	135447854	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr9:135447854T>C	ENST00000343036.2	+	7	968	c.920T>C	c.(919-921)gTg>gCg	p.V307A	C9orf171_ENST00000393216.2_Missense_Mutation_p.V271A	NM_207417.1	NP_997300.1	Q6ZQR2	CI171_HUMAN	chromosome 9 open reading frame 171	307										large_intestine(7)|lung(9)|ovary(4)|prostate(3)	23						GAGTGTGCCGTGCGCCAGGGG	0.602																																					p.V307A		.											.	C9orf171-157	0			c.T920C						.						53.0	51.0	52.0					9																	135447854		2203	4300	6503	SO:0001583	missense	389799	exon7			GTGCCGTGCGCCA	AK128819	CCDS6949.1, CCDS65167.1	9q34.13	2012-04-03			ENSG00000188523	ENSG00000188523			33776	protein-coding gene	gene with protein product							Standard	NM_207417		Approved	FLJ46082	uc004cbn.3	Q6ZQR2	OTTHUMG00000131684	ENST00000343036.2:c.920T>C	9.37:g.135447854T>C	ENSP00000343290:p.Val307Ala	Somatic	33	0		WXS	Illumina GAIIx	Phase_I	43	15	NM_207417	0	0	0	0	0	Q147X1	Missense_Mutation	SNP	ENST00000343036.2	37	CCDS6949.1	.	.	.	.	.	.	.	.	.	.	T	4.414	0.076506	0.08485	.	.	ENSG00000188523	ENST00000343036;ENST00000393216	T;T	0.21543	2.01;2.0	5.53	2.99	0.34606	.	0.411149	0.21865	N	0.067979	T	0.09992	0.0245	N	0.25647	0.755	0.21967	N	0.999448	B;B	0.15930	0.001;0.015	B;B	0.14023	0.002;0.01	T	0.39440	-0.9614	10	0.02654	T	1	.	5.3118	0.15835	0.0:0.0925:0.1788:0.7287	.	271;307	Q6ZQR2-2;Q6ZQR2	.;CI171_HUMAN	A	307;271	ENSP00000343290:V307A;ENSP00000376909:V271A	ENSP00000343290:V307A	V	+	2	0	C9orf171	134437675	0.999000	0.42202	0.990000	0.47175	0.893000	0.52053	1.116000	0.31221	2.115000	0.64714	0.443000	0.29094	GTG	.		0.602	C9orf171-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254589.1	NM_207417	
EXD3	54932	hgsc.bcm.edu	37	9	140243589	140243589	+	Silent	SNP	T	T	C	rs114716688	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr9:140243589T>C	ENST00000340951.4	-	16	1998	c.1803A>G	c.(1801-1803)aaA>aaG	p.K601K	EXD3_ENST00000342129.4_Silent_p.K281K	NM_017820.3	NP_060290.3	Q9NX53	MUT7B_HUMAN	exonuclease 3'-5' domain containing 3	0										NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(2)	12						GTGCTGACGCTTTCTGCAGGC	0.667													t|||	124	0.0247604	0.0885	0.0072	5008	,	,		13791	0.0		0.002	False		,,,				2504	0.0				p.K601K		.											.	EXD3-90	0			c.A1803G						.			279,3675		21,237,1719	16.0	22.0	20.0		1803	1.4	0.0	9	dbSNP_132	20	0,8300		0,0,4150	no	coding-synonymous	EXD3	NM_017820.3		21,237,5869	CC,CT,TT		0.0,7.0561,2.2768		601/877	140243589	279,11975	1977	4150	6127	SO:0001819	synonymous_variant	54932	exon16			TGACGCTTTCTGC		CCDS48066.1, CCDS75942.1	9q34.3	2009-03-04			ENSG00000187609	ENSG00000187609			26023	protein-coding gene	gene with protein product							Standard	XM_005266093		Approved	LOC54932, FLJ20433, mut-7	uc004cmp.2	Q8N9H8	OTTHUMG00000156149	ENST00000340951.4:c.1803A>G	9.37:g.140243589T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	45	26	NM_017820	0	0	1	5	4	Q6P1M1|Q8IXT8	Silent	SNP	ENST00000340951.4	37	CCDS48066.1																																																																																			T|0.979;C|0.021		0.667	EXD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000343182.1	NM_017820	
CDKL5	6792	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	18631388	18631388	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chrX:18631388G>T	ENST00000379989.3	+	16	2554	c.2269G>T	c.(2269-2271)Gat>Tat	p.D757Y	CDKL5_ENST00000379996.3_Missense_Mutation_p.D757Y|CDKL5_ENST00000463994.1_Intron	NM_001037343.1	NP_001032420.1	O76039	CDKL5_HUMAN	cyclin-dependent kinase-like 5	757				Missing (in Ref. 5; CAA61445). {ECO:0000305}.	neuron migration (GO:0001764)|positive regulation of axon extension (GO:0045773)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of Rac GTPase activity (GO:0032855)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of dendrite development (GO:0050773)	cytoplasm (GO:0005737)|dendrite cytoplasm (GO:0032839)|dendritic growth cone (GO:0044294)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|kinase activity (GO:0016301)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rac GTPase binding (GO:0048365)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(4)|skin(5)|stomach(1)	44	Hepatocellular(33;0.183)					ACCAGCATTCGATCCATGGTG	0.348																																					p.D757Y		.											.	CDKL5-838	0			c.G2269T						.						118.0	113.0	115.0					X																	18631388		2203	4300	6503	SO:0001583	missense	6792	exon15			GCATTCGATCCAT	Y15057	CCDS14186.1	Xp22	2011-11-04	2002-11-26	2002-11-29	ENSG00000008086	ENSG00000008086		"""Cyclin-dependent kinases"""	11411	protein-coding gene	gene with protein product		300203	"""serine/threonine kinase 9"""	STK9		9721213, 16935860	Standard	XM_005274584		Approved	EIEE2	uc004cym.3	O76039	OTTHUMG00000021214	ENST00000379989.3:c.2269G>T	X.37:g.18631388G>T	ENSP00000369325:p.Asp757Tyr	Somatic	259	0		WXS	Illumina GAIIx	Phase_I	253	43	NM_003159	0	0	0	0	0	G9B9X4|Q14198|Q5H985|Q8IYC7|Q9UJL6	Missense_Mutation	SNP	ENST00000379989.3	37	CCDS14186.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.233478	0.79688	.	.	ENSG00000008086	ENST00000379996;ENST00000379989	D;D	0.81499	-1.5;-1.5	5.03	5.03	0.67393	.	0.043313	0.85682	D	0.000000	D	0.84606	0.5509	L	0.34521	1.04	0.52501	D	0.999956	D	0.89917	1.0	D	0.67548	0.952	D	0.86889	0.2047	10	0.87932	D	0	-17.5163	17.7203	0.88349	0.0:0.0:1.0:0.0	.	757	O76039	CDKL5_HUMAN	Y	757	ENSP00000369332:D757Y;ENSP00000369325:D757Y	ENSP00000369325:D757Y	D	+	1	0	CDKL5	18541309	1.000000	0.71417	0.977000	0.42913	0.992000	0.81027	8.652000	0.91083	2.202000	0.70862	0.499000	0.49734	GAT	.		0.348	CDKL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055945.2	NM_003159	
SH3KBP1	30011	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	19587243	19587243	+	Silent	SNP	G	G	A			TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chrX:19587243G>A	ENST00000397821.3	-	13	1652	c.1362C>T	c.(1360-1362)ctC>ctT	p.L454L	SH3KBP1_ENST00000379716.1_Silent_p.L216L|SH3KBP1_ENST00000541422.1_Silent_p.L193L|SH3KBP1_ENST00000379698.4_Silent_p.L417L	NM_031892.2	NP_114098.1	Q96B97	SH3K1_HUMAN	SH3-domain kinase binding protein 1	454					apoptotic process (GO:0006915)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|cytoskeleton organization (GO:0007010)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|regulation of cell shape (GO:0008360)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)				breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(8)|skin(4)	29						TGCGGTCCGAGAGATCTTTGT	0.473																																					p.L454L		.											.	SH3KBP1-130	0			c.C1362T						.						162.0	136.0	145.0					X																	19587243		2203	4300	6503	SO:0001819	synonymous_variant	30011	exon13			GTCCGAGAGATCT	AF230904	CCDS14193.1, CCDS35213.1, CCDS55383.1	Xp22.1-p21.3	2008-02-05			ENSG00000147010	ENSG00000147010			13867	protein-coding gene	gene with protein product		300374				8889549, 7566098	Standard	NM_031892		Approved	CIN85	uc004czm.3	Q96B97	OTTHUMG00000021227	ENST00000397821.3:c.1362C>T	X.37:g.19587243G>A		Somatic	109	0		WXS	Illumina GAIIx	Phase_I	142	33	NM_031892	0	0	3	7	4	B7Z1D5|Q5JPT4|Q5JPT5|Q8IWX6|Q8IX98|Q96RN4|Q9NYR0	Silent	SNP	ENST00000397821.3	37	CCDS14193.1																																																																																			.		0.473	SH3KBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055992.1	NM_031892	
PPP1R3F	89801	hgsc.bcm.edu	37	X	49126714	49126714	+	Silent	SNP	C	C	T	rs111938103		TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chrX:49126714C>T	ENST00000055335.6	+	1	398	c.382C>T	c.(382-384)Ctg>Ttg	p.L128L	PPP1R3F_ENST00000495799.1_Intron|PPP1R3F_ENST00000466508.1_Intron|LL0XNC01-7P3.1_ENST00000602455.1_lincRNA|PPP1R3F_ENST00000438316.1_Intron	NM_033215.4	NP_149992.3	Q6ZSY5	PPR3F_HUMAN	protein phosphatase 1, regulatory subunit 3F	128	CBM21. {ECO:0000255|PROSITE- ProRule:PRU00491}.				regulation of glycogen (starch) synthase activity (GO:2000465)|regulation of glycogen biosynthetic process (GO:0005979)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	glycogen binding (GO:2001069)|protein phosphatase binding (GO:0019903)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|skin(4)	27	Ovarian(276;0.236)					GCCGGGCCGTCTGGAGCGCTT	0.761													c|||	321	0.0850331	0.2254	0.0231	3775	,	,		6517	0.0		0.0	False		,,,				2504	0.0072				p.L128L		.											.	PPP1R3F-229	0			c.C382T						.		,	536,2408		20,412,84,850,296	3.0	3.0	3.0		,382	3.3	1.0	X	dbSNP_132	3	4,5429		0,3,1,2043,1340	no	intron,coding-synonymous	PPP1R3F	NM_001184745.1,NM_033215.4	,	20,415,85,2893,1636	TT,TC,T,CC,C		0.0736,18.2065,6.4462	,	,128/800	49126714	540,7837	1662	3387	5049	SO:0001819	synonymous_variant	89801	exon1			GGCCGTCTGGAGC		CCDS35254.1, CCDS55415.1	Xp11.23	2012-04-17	2011-10-04		ENSG00000049769	ENSG00000049769		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14944	protein-coding gene	gene with protein product			"""protein phosphatase 1, regulatory (inhibitor) subunit 3F"""			11948623	Standard	NM_033215		Approved	Hb2E	uc004dnh.2	Q6ZSY5	OTTHUMG00000024139	ENST00000055335.6:c.382C>T	X.37:g.49126714C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	6	NM_033215	0	0	0	0	0	A2VDJ8|B3KPW2|E9PCM3	Silent	SNP	ENST00000055335.6	37	CCDS35254.1																																																																																			C|0.941;T|0.059		0.761	PPP1R3F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060819.2	NM_033215	
TRPC5	7224	broad.mit.edu;bcgsc.ca	37	X	111195291	111195291	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chrX:111195291G>A	ENST00000262839.2	-	2	1276	c.358C>T	c.(358-360)Cgg>Tgg	p.R120W		NM_012471.2	NP_036603.1	Q9UL62	TRPC5_HUMAN	transient receptor potential cation channel, subfamily C, member 5	120					axon guidance (GO:0007411)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|nervous system development (GO:0007399)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			biliary_tract(1)|breast(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(38)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						CCGCTGGGCCGCCTGTAGCTG	0.552																																					p.R120W		.											.	TRPC5-130	0			c.C358T						.						94.0	91.0	92.0					X																	111195291		2203	4300	6503	SO:0001583	missense	7224	exon2			TGGGCCGCCTGTA	AF054568	CCDS14561.1	Xq23	2014-06-13			ENSG00000072315	ENSG00000072315		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12337	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 159"""	300334				10493832, 16382100	Standard	NM_012471		Approved	PPP1R159	uc004epl.1	Q9UL62	OTTHUMG00000022212	ENST00000262839.2:c.358C>T	X.37:g.111195291G>A	ENSP00000262839:p.Arg120Trp	Somatic	197	0		WXS	Illumina GAIIx	Phase_I	189	6	NM_012471	0	0	0	0	0	B2RP53|O75233|Q5JXY8|Q9Y514	Missense_Mutation	SNP	ENST00000262839.2	37	CCDS14561.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.024497	0.75390	.	.	ENSG00000072315	ENST00000262839	T	0.52983	0.64	5.6	2.27	0.28462	Ankyrin repeat-containing domain (2);	0.173201	0.49916	D	0.000123	T	0.51686	0.1689	N	0.25332	0.735	0.33461	D	0.584896	D;D	0.69078	0.994;0.997	P;D	0.64321	0.878;0.924	T	0.65475	-0.6159	10	0.87932	D	0	-0.126	13.6681	0.62407	0.0:0.0:0.2019:0.7981	.	121;120	Q59G51;Q9UL62	.;TRPC5_HUMAN	W	120	ENSP00000262839:R120W	ENSP00000262839:R120W	R	-	1	2	TRPC5	111081947	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.078000	0.41567	0.423000	0.26033	0.513000	0.50165	CGG	.		0.552	TRPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057945.1	NM_012471	
RBMXL3	139804	hgsc.bcm.edu	37	X	114424608	114424608	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chrX:114424608C>A	ENST00000424776.3	+	1	646	c.604C>A	c.(604-606)Cca>Aca	p.P202T	LRCH2_ENST00000538422.1_Intron|LRCH2_ENST00000317135.8_Intron	NM_001145346.1	NP_001138818.1	Q8N7X1	RMXL3_HUMAN	RNA binding motif protein, X-linked-like 3	202							nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(13)|kidney(2)|skin(1)	16						CTGGGCCGGCCCACCCCACAA	0.682																																					p.P202T		.											.	.	0			c.C604A						.																																			SO:0001583	missense	139804	exon1			GCCGGCCCACCCC	AK097568	CCDS55478.1	Xq23	2013-02-12	2009-03-24	2009-03-24	ENSG00000175718	ENSG00000175718		"""RNA binding motif (RRM) containing"""	26859	protein-coding gene	gene with protein product			"""chromosome X open reading frame 55"""	CXorf55			Standard	NM_001145346		Approved	FLJ40249	uc011mte.1	Q8N7X1	OTTHUMG00000022230	ENST00000424776.3:c.604C>A	X.37:g.114424608C>A	ENSP00000417451:p.Pro202Thr	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	38	25	NM_001145346	0	0	0	0	0	B4DXC0	Missense_Mutation	SNP	ENST00000424776.3	37	CCDS55478.1	.	.	.	.	.	.	.	.	.	.	c	12.43	1.934732	0.34189	.	.	ENSG00000175718	ENST00000424776	T	0.03801	3.8	0.776	0.776	0.18532	.	.	.	.	.	T	0.12475	0.0303	L	0.49126	1.545	0.09310	N	1	D	0.76494	0.999	D	0.68621	0.959	T	0.12553	-1.0543	9	0.87932	D	0	.	7.1511	0.25612	0.0:0.9999:0.0:1.0E-4	.	202	Q8N7X1	RMXL3_HUMAN	T	202	ENSP00000417451:P202T	ENSP00000417451:P202T	P	+	1	0	RBMXL3	114330864	0.088000	0.21588	0.003000	0.11579	0.014000	0.08584	-1.067000	0.03451	0.652000	0.30806	0.183000	0.17082	CCA	.		0.682	RBMXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057968.3	NM_001145346	
GATA3	2625	hgsc.bcm.edu	37	10	8100397	8100398	+	In_Frame_Ins	INS	-	-	CGG	rs547425013	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr10:8100397_8100398insCGG	ENST00000346208.3	+	3	826_827	c.371_372insCGG	c.(370-375)cacggc>caCGGcggc	p.125_126insG	GATA3_ENST00000379328.3_In_Frame_Ins_p.125_126insG|GATA3_ENST00000461472.1_3'UTR			P23771	GATA3_HUMAN	GATA binding protein 3	125					anatomical structure formation involved in morphogenesis (GO:0048646)|anatomical structure morphogenesis (GO:0009653)|aortic valve morphogenesis (GO:0003180)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cardiac right ventricle morphogenesis (GO:0003215)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|cellular response to interferon-alpha (GO:0035457)|cellular response to interleukin-4 (GO:0071353)|cellular response to tumor necrosis factor (GO:0071356)|defense response (GO:0006952)|developmental growth (GO:0048589)|ear development (GO:0043583)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|interferon-gamma secretion (GO:0072643)|interleukin-4 secretion (GO:0072602)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lymphocyte migration (GO:0072676)|male gonad development (GO:0008584)|mast cell differentiation (GO:0060374)|mesenchymal to epithelial transition (GO:0060231)|mesonephros development (GO:0001823)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell motility (GO:2000146)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell proliferation involved in mesonephros development (GO:2000607)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation (GO:2000703)|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation (GO:2000734)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct formation (GO:0072179)|nephric duct morphogenesis (GO:0072178)|neuron migration (GO:0001764)|norepinephrine biosynthetic process (GO:0042421)|otic vesicle development (GO:0071599)|parathyroid gland development (GO:0060017)|parathyroid hormone secretion (GO:0035898)|pharyngeal system development (GO:0060037)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of signal transduction (GO:0009967)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureteric bud formation (GO:0072107)|post-embryonic development (GO:0009791)|pro-T cell differentiation (GO:0002572)|regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043370)|regulation of cellular response to X-ray (GO:2000683)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of establishment of cell polarity (GO:2000114)|regulation of histone H3-K27 methylation (GO:0061085)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to virus (GO:0009615)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)|T cell receptor signaling pathway (GO:0050852)|T-helper 2 cell differentiation (GO:0045064)|thymic T cell selection (GO:0045061)|thymus development (GO:0048538)|TOR signaling (GO:0031929)|transcription from RNA polymerase II promoter (GO:0006366)|type IV hypersensitivity (GO:0001806)|ureter maturation (GO:0035799)|ureteric bud formation (GO:0060676)|uterus development (GO:0060065)|ventricular septum development (GO:0003281)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer sequence-specific DNA binding (GO:0001158)|HMG box domain binding (GO:0071837)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)			NS(1)|breast(44)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(24)|ovary(3)|skin(2)	87						TCCATCCACCACGGCTCCCCGG	0.713			"""F, N, S"""		breast		"""HDR syndrome (HYPOPARATHYROIDISM, SENSORINEURAL DEAFNESS, AND RENAL DISEASE)"""							3	0.000599042	0.0023	0.0	5008	,	,		13352	0.0		0.0	False		,,,				2504	0.0				p.H124delinsHG		.		Rec	yes		10	10p15	2625	GATA binding protein 3	yes	E	.	GATA3-1004	0			c.371_372insCGG						.		,	14,4250		0,14,2118					,	5.4	1.0			75	1,8251		0,1,4125	no	coding,coding	GATA3	NM_002051.2,NM_001002295.1	,	0,15,6243	A1A1,A1R,RR		0.0121,0.3283,0.1198	,	,		15,12501				SO:0001652	inframe_insertion	2625	exon3			TCCACCACGGCTC	X55122	CCDS7083.1, CCDS31143.1	10p15	2013-01-25	2001-11-28		ENSG00000107485	ENSG00000107485		"""GATA zinc finger domain containing"""	4172	protein-coding gene	gene with protein product		131320	"""GATA-binding protein 3"""			2050118, 15087456	Standard	NM_002051		Approved	HDR	uc001ijz.3	P23771	OTTHUMG00000017640	ENST00000346208.3:c.372_374dupCGG	10.37:g.8100398_8100400dupCGG	ENSP00000341619:p.Gly125_Gly125dup	Somatic	4	1		WXS	Illumina GAIIx	Phase_I	54	15	NM_002051	0	0	0	0	0	Q5VWG7|Q5VWG8|Q96J16	In_Frame_Ins	INS	ENST00000346208.3	37	CCDS7083.1																																																																																			.		0.713	GATA3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000046719.1	NM_001002295	
SALL1	6299	hgsc.bcm.edu	37	16	51175655	51175656	+	In_Frame_Ins	INS	-	-	GCTGCT	rs113614842|rs199760974|rs372299573	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr16:51175655_51175656insGCTGCT	ENST00000251020.4	-	2	510_511	c.477_478insAGCAGC	c.(475-480)agcggc>agcAGCAGCggc	p.158_159insSS	SALL1_ENST00000562674.1_5'Flank|SALL1_ENST00000440970.1_In_Frame_Ins_p.61_62insSS|SALL1_ENST00000566102.1_Intron|SALL1_ENST00000541611.1_Intron	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	158	Poly-Ser.		S -> G (in dbSNP:rs13336129). {ECO:0000269|PubMed:9973281}.		adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			ccgccgccgccgctgctgctgc	0.629																																					p.G160delinsSSG	GBM(103;1352 1446 1855 4775 8890)	.											.	SALL1-98	0			c.478_479insAGCAGC						.																																			SO:0001652	inframe_insertion	6299	exon2			CGCCGCCGCTGCT	X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.472_477dupAGCAGC	16.37:g.51175656_51175661dupGCTGCT	ENSP00000251020:p.Ser157_Ser158dup	Somatic	35	0		WXS	Illumina GAIIx	Phase_I	94	18	NM_002968	0	0	0	0	0	Q99881|Q9NSC3|Q9P1R0	In_Frame_Ins	INS	ENST00000251020.4	37	CCDS10747.1																																																																																			-|0.500;GCC|0.250;GCT|0.250		0.629	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256883.2	NM_002968	
SOCS7	30837	broad.mit.edu	37	17	36508662	36508663	+	In_Frame_Ins	INS	-	-	AGC	rs55849419|rs60453610|rs549479183|rs547838143	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr17:36508662_36508663insAGC	ENST00000577233.1	+	1	535_536	c.535_536insAGC	c.(535-537)gag>gAGCag	p.187_188insQ	SOCS7_ENST00000331159.5_In_Frame_Ins_p.187_188insQ	NM_014598.2	NP_055413.1	O14512	SOCS7_HUMAN	suppressor of cytokine signaling 7	187	Mediates interaction with SORBS3.|Poly-Gln.|Poly-Pro.				fat cell differentiation (GO:0045444)|insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|negative regulation of signal transduction (GO:0009968)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	SH3 domain binding (GO:0017124)	p.Q187delQ(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|prostate(1)|skin(5)	9	Breast(7;3.47e-17)					GAGTAGAGGGGagcagcagcag	0.703														199	0.0397364	0.115	0.0144	5008	,	,		13083	0.0		0.0149	False		,,,				2504	0.0225				p.E179delinsEQ		.											.	SOCS7-227	1	Deletion - In frame(1)	central_nervous_system(1)	c.535_536insAGC						.																																			SO:0001652	inframe_insertion	30837	exon1			AGAGGGGAGCAGC	AB005216	CCDS32637.1	17q12	2014-08-12			ENSG00000274211	ENSG00000274211		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	29846	protein-coding gene	gene with protein product	"""Nck, Ash and phospholipase C binding protein"", ""NCK-associated protein 4"""	608788				9344857, 12076535	Standard	XM_005257264		Approved	NAP4, NCKAP4	uc002hqa.3	O14512	OTTHUMG00000188546	ENST00000577233.1:c.557_559dupAGC	17.37:g.36508669_36508671dupAGC	ENSP00000464034:p.Gln187_Gln187dup	Somatic	9	0		WXS	Illumina GAIIx	Phase_I	90	19	NM_014598	0	0	0	0	0	A2VCU2|Q0IJ63	In_Frame_Ins	INS	ENST00000577233.1	37	CCDS32637.1																																																																																			.		0.703	SOCS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440486.4	XM_371052	
RALY	22913	hgsc.bcm.edu	37	20	32664865	32664866	+	In_Frame_Ins	INS	-	-	AGC	rs57852506|rs11538302	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr20:32664865_32664866insAGC	ENST00000246194.3	+	8	1192_1193	c.690_691insAGC	c.(691-693)ggc>AGCggc	p.230_231insS	RALY_ENST00000375114.3_In_Frame_Ins_p.214_215insS	NM_016732.2	NP_057951.1	Q9UKM9	RALY_HUMAN	RALY heterogeneous nuclear ribonucleoprotein	230	Epitope (recognized by BKRF1 antibodies).|Poly-Gly.			A -> AS (in Ref. 2; AAC28898). {ECO:0000305}.	mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			kidney(2)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	12						GAggtggcgccggcggcggcgg	0.663																																					p.A230delinsAS		.											.	RALY-91	0			c.690_691insAGC						.																																			SO:0001652	inframe_insertion	22913	exon8			TGGCGCCGGCGGC	AF148457	CCDS13229.1, CCDS13230.1	20q11.21-q11.23	2013-08-06	2013-08-06		ENSG00000125970	ENSG00000125970		"""RNA binding motif (RRM) containing"""	15921	protein-coding gene	gene with protein product		614663	"""RNA-binding protein (autoantigenic, hnRNP-associated with lethal yellow)"", ""RNA binding protein, autoantigenic (hnRNP-associated with lethal yellow homolog (mouse))"""			10500250, 23614458	Standard	NM_016732		Approved	P542, HNRPCL2	uc002xab.3	Q9UKM9	OTTHUMG00000032283	Exception_encountered	20.37:g.32664865_32664866insAGC	ENSP00000246194:p.Ala230_Gly231insSer	Somatic	13	0		WXS	Illumina GAIIx	Phase_I	31	0	NM_016732	0	0	0	0	0	Q14621|Q2M365|Q5QPL8|Q9BQX6|Q9UJE3	In_Frame_Ins	INS	ENST00000246194.3	37	CCDS13230.1																																																																																			-|0.167;AGC|0.833		0.663	RALY-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078753.1		
SGK223	157285	bcgsc.ca	37	8	8234868	8234869	+	In_Frame_Ins	INS	-	-	GCCGCT	rs59372311|rs150979349	byFrequency	TCGA-OR-A5J6-01A-31D-A29I-10	TCGA-OR-A5J6-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	687986f9-fe70-495e-bcb2-569529c56ff2	6c4bf8c2-d374-473b-84f8-7545ce3e3aee	g.chr8:8234868_8234869insGCCGCT	ENST00000520004.1	-	3	1314_1315	c.1050_1051insAGCGGC	c.(1048-1053)ggcgcc>ggcAGCGGCgcc	p.349_350insGS	SGK223_ENST00000330777.4_In_Frame_Ins_p.349_350insGS			Q86YV5	SG223_HUMAN		349							ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)	p.G350_A351insSG(1)|p.G350_S351insSG(1)									GGGCTACTGGCGCCGCTGCCGC	0.653														2980	0.595048	0.7254	0.4942	5008	,	,		15838	0.629		0.3827	False		,,,				2504	0.6738				p.A351delinsSGA	GBM(34;731 755 10259 33573 33867)	.											.	.	2	Insertion - In frame(2)	breast(2)	c.1051_1052insAGCGGC						.																																			SO:0001652	inframe_insertion	0	exon2			TACTGGCGCCGCT																												ENST00000520004.1:c.1045_1050dupAGCGGC	8.37:g.8234869_8234874dupGCCGCT	ENSP00000428054:p.Gly348_Ser349dup	Somatic	34	0		WXS	Illumina GAIIx	Phase_I	94	17	NM_001080826	0	0	0	0	0	Q8N3N5	In_Frame_Ins	INS	ENST00000520004.1	37	CCDS43706.1																																																																																			.		0.653	SGK223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374864.1		
