#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
HES3	390992	hgsc.bcm.edu	37	1	6305303	6305303	+	Silent	SNP	C	C	A	rs61760837	byFrequency	TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr1:6305303C>A	ENST00000377898.3	+	4	362	c.297C>A	c.(295-297)gcC>gcA	p.A99A		NM_001024598.3	NP_001019769.1	Q5TGS1	HES3_HUMAN	hes family bHLH transcription factor 3	99	Orange.				hindbrain morphogenesis (GO:0021575)|in utero embryonic development (GO:0001701)|midbrain development (GO:0030901)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oculomotor nerve development (GO:0021557)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of timing of neuron differentiation (GO:0060164)|transcription, DNA-templated (GO:0006351)|trochlear nerve development (GO:0021558)	nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription factor binding (GO:0008134)			lung(2)|skin(1)	3	Ovarian(185;0.0634)	all_cancers(23;2.48e-32)|all_epithelial(116;1.14e-17)|all_lung(118;2.85e-06)|all_neural(13;3.68e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;3.77e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00475)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;1.2e-37)|GBM - Glioblastoma multiforme(13;3.2e-29)|OV - Ovarian serous cystadenocarcinoma(86;2.52e-19)|Colorectal(212;1.19e-07)|COAD - Colon adenocarcinoma(227;1.3e-05)|Kidney(185;4.88e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000871)|BRCA - Breast invasive adenocarcinoma(365;0.00105)|STAD - Stomach adenocarcinoma(132;0.00308)|READ - Rectum adenocarcinoma(331;0.0642)|Lung(427;0.241)		CCGAGAGCGCCGCCGGCAGCA	0.771													C|||	2792	0.557508	0.3079	0.7536	5008	,	,		7640	0.5615		0.6839	False		,,,				2504	0.6217				p.A99A		.											.	HES3-514	0			c.C297A						.	C		1446,1378		419,608,385	2.0	3.0	2.0		297	0.2	0.0	1	dbSNP_129	2	4876,1552		1960,956,298	no	coding-synonymous	HES3	NM_001024598.3		2379,1564,683	AA,AC,CC		24.1444,48.796,31.6688		99/187	6305303	6322,2930	1412	3214	4626	SO:0001819	synonymous_variant	390992	exon4			GAGCGCCGCCGGC		CCDS41238.1	1p36.31	2013-10-17	2013-10-17		ENSG00000173673	ENSG00000173673		"""Basic helix-loop-helix proteins"""	26226	protein-coding gene	gene with protein product		609971	"""hairy and enhancer of split 3 (Drosophila)"""				Standard	NM_001024598		Approved	bHLHb43	uc009vly.2	Q5TGS1	OTTHUMG00000001271	ENST00000377898.3:c.297C>A	1.37:g.6305303C>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_001024598	0	0	0	0	0	Q5TGS0	Silent	SNP	ENST00000377898.3	37	CCDS41238.1																																																																																			C|0.438;A|0.562		0.771	HES3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000003716.3	NM_001024598	
KIF1B	23095	broad.mit.edu	37	1	10351187	10351187	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr1:10351187G>T	ENST00000377086.1	+	16	1684	c.1482G>T	c.(1480-1482)aaG>aaT	p.K494N	KIF1B_ENST00000377081.1_Missense_Mutation_p.K494N|KIF1B_ENST00000377083.1_Missense_Mutation_p.K448N|KIF1B_ENST00000263934.6_Missense_Mutation_p.K448N|KIF1B_ENST00000377093.4_Missense_Mutation_p.K448N			O60333	KIF1B_HUMAN	kinesin family member 1B	494					anterograde axon cargo transport (GO:0008089)|apoptotic process (GO:0006915)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|mitochondrion transport along microtubule (GO:0047497)|neuromuscular synaptic transmission (GO:0007274)|neuron-neuron synaptic transmission (GO:0007270)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|endometrium(7)|kidney(8)|large_intestine(9)|lung(29)|ovary(3)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(2)	71	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		GGGAAGAGAAGCTTCGTAAAA	0.383																																					p.K448N		.											.	KIF1B-93	0			c.G1344T						.						83.0	86.0	85.0					1																	10351187		2203	4300	6503	SO:0001583	missense	23095	exon14			AGAGAAGCTTCGT	AF257176	CCDS111.1, CCDS112.1	1p36.22	2014-09-17			ENSG00000054523	ENSG00000054523		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	16636	protein-coding gene	gene with protein product		605995		CMT2A, CMT2		11389829, 10762626	Standard	NM_015074		Approved	KIAA0591, KLP, HMSNII	uc001aqw.4	O60333	OTTHUMG00000001817	ENST00000377086.1:c.1482G>T	1.37:g.10351187G>T	ENSP00000366290:p.Lys494Asn	Somatic	41	0		WXS	Illumina GAIIx	Phase_I	54	4	NM_183416	0	0	0	0	0	A6NFS8|A6NKQ4|Q4VXC3|Q4VXC4|Q4VXC5|Q4VXC6|Q96Q94|Q9BV80|Q9P280	Missense_Mutation	SNP	ENST00000377086.1	37		.	.	.	.	.	.	.	.	.	.	G	18.43	3.622291	0.66787	.	.	ENSG00000054523	ENST00000355249;ENST00000263934;ENST00000377093;ENST00000377086;ENST00000377083;ENST00000377081	T;T;D;T;D	0.83075	-1.38;-1.38;-1.67;-1.38;-1.68	5.17	1.48	0.22813	.	0.000000	0.85682	D	0.000000	D	0.90570	0.7044	M	0.88640	2.97	0.58432	D	0.999993	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.999;0.989;1.0	D;D;D;D;D;D;D	0.91635	0.999;0.994;0.997;0.98;0.986;0.985;0.996	D	0.89578	0.3818	10	0.87932	D	0	.	9.3895	0.38363	0.45:0.0:0.55:0.0	.	480;454;494;468;494;448;448	Q4R9M9;Q4R9M7;Q4VXC4;Q4R9M8;O60333;O60333-2;O60333-3	.;.;.;.;KIF1B_HUMAN;.;.	N	494;448;448;494;448;494	ENSP00000263934:K448N;ENSP00000366297:K448N;ENSP00000366290:K494N;ENSP00000366287:K448N;ENSP00000366284:K494N	ENSP00000263934:K448N	K	+	3	2	KIF1B	10273774	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.094000	0.30951	0.369000	0.24510	-0.345000	0.07892	AAG	.		0.383	KIF1B-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000005102.1		
TMCO4	255104	bcgsc.ca	37	1	20009737	20009737	+	Silent	SNP	G	G	A	rs10917514	byFrequency	TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr1:20009737G>A	ENST00000294543.6	-	16	1942	c.1701C>T	c.(1699-1701)tcC>tcT	p.S567S	TMCO4_ENST00000375122.2_Silent_p.S527S|TMCO4_ENST00000489814.1_5'UTR|TMCO4_ENST00000375127.1_Intron	NM_181719.4	NP_859070.3	Q5TGY1	TMCO4_HUMAN	transmembrane and coiled-coil domains 4	567						integral component of membrane (GO:0016021)				biliary_tract(1)|breast(2)|endometrium(2)|kidney(1)|lung(11)|skin(1)|upper_aerodigestive_tract(1)	19		Colorectal(325;0.000147)|Renal(390;0.000469)|all_lung(284;0.00519)|Breast(348;0.00526)|Lung NSC(340;0.00544)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00708)|COAD - Colon adenocarcinoma(152;2.28e-05)|BRCA - Breast invasive adenocarcinoma(304;5.8e-05)|Kidney(64;0.000367)|GBM - Glioblastoma multiforme(114;0.000377)|KIRC - Kidney renal clear cell carcinoma(64;0.00459)|STAD - Stomach adenocarcinoma(196;0.0072)|READ - Rectum adenocarcinoma(331;0.0862)|Lung(427;0.223)		AGGTGTCTCCGGATATGGGAC	0.667													G|||	627	0.1252	0.0537	0.111	5008	,	,		16666	0.2113		0.1133	False		,,,				2504	0.1554				p.S567S		.											.	TMCO4-68	0			c.C1701T						.	G		249,4157	145.4+/-180.2	7,235,1961	65.0	69.0	67.0		1701	-6.1	0.0	1	dbSNP_120	67	1129,7471	233.5+/-266.7	79,971,3250	no	coding-synonymous	TMCO4	NM_181719.4		86,1206,5211	AA,AG,GG		13.1279,5.6514,10.5951		567/635	20009737	1378,11628	2203	4300	6503	SO:0001819	synonymous_variant	255104	exon16			GTCTCCGGATATG		CCDS198.1	1p36.13	2008-02-05			ENSG00000162542	ENSG00000162542			27393	protein-coding gene	gene with protein product							Standard	NM_181719		Approved	DKFZp686C23231	uc001bcn.3	Q5TGY1	OTTHUMG00000002697	ENST00000294543.6:c.1701C>T	1.37:g.20009737G>A		Somatic	313	4		WXS	Illumina GAIIx	Phase_I	289	15	NM_181719	0	0	0	0	0	Q5TGY2|Q6MZN5|Q7Z6K6|Q9UQP4|Q9Y3K1	Silent	SNP	ENST00000294543.6	37	CCDS198.1																																																																																			G|0.888;A|0.112		0.667	TMCO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007658.1	NM_181719	
KCNQ4	9132	bcgsc.ca	37	1	41296828	41296828	+	Missense_Mutation	SNP	T	T	G	rs34287852	byFrequency	TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr1:41296828T>G	ENST00000347132.5	+	10	1447	c.1365T>G	c.(1363-1365)caT>caG	p.H455Q	KCNQ4_ENST00000506017.1_3'UTR|KCNQ4_ENST00000509682.2_Missense_Mutation_p.H401Q	NM_004700.3|NM_172163.2	NP_004691.2|NP_751895.1	P56696	KCNQ4_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 4	455			H -> Q (in dbSNP:rs34287852). {ECO:0000269|PubMed:10025409}.		inner ear morphogenesis (GO:0042472)|potassium ion transport (GO:0006813)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(13)|skin(1)	26	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.38e-17)		Ezogabine(DB04953)	CCAAGCAGCATCTGGCACCTC	0.642													T|||	471	0.0940495	0.0061	0.1124	5008	,	,		14942	0.0516		0.2167	False		,,,				2504	0.1176				p.H455Q		.											.	KCNQ4-90	0			c.T1365G	GRCh37	CM062786	KCNQ4	M	rs34287852	.	T	GLN/HIS,GLN/HIS	215,4187		3,209,1989	43.0	34.0	37.0		1365,1203	2.0	1.0	1	dbSNP_126	37	2062,6538		256,1550,2494	yes	missense,missense	KCNQ4	NM_004700.3,NM_172163.2	24,24	259,1759,4483	GG,GT,TT		23.9767,4.8841,17.5127	benign,benign	455/696,401/642	41296828	2277,10725	2201	4300	6501	SO:0001583	missense	9132	exon10			GCAGCATCTGGCA	AF105202	CCDS456.1	1p34	2012-07-05			ENSG00000117013	ENSG00000117013		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6298	protein-coding gene	gene with protein product		603537		DFNA2		10025409, 16382104	Standard	NM_004700		Approved	Kv7.4	uc001cgh.2	P56696	OTTHUMG00000007730	ENST00000347132.5:c.1365T>G	1.37:g.41296828T>G	ENSP00000262916:p.His455Gln	Somatic	334	5		WXS	Illumina GAIIx	Phase_I	312	10	NM_004700	0	0	0	0	0	O96025	Missense_Mutation	SNP	ENST00000347132.5	37	CCDS456.1	244|244	0.11172161172161173|0.11172161172161173	5|5	0.01016260162601626|0.01016260162601626	48|48	0.13259668508287292|0.13259668508287292	33|33	0.057692307692307696|0.057692307692307696	158|158	0.20844327176781002|0.20844327176781002	T|T	10.83|10.83	1.461499|1.461499	0.26248|0.26248	0.048841|0.048841	0.239767|0.239767	ENSG00000117013|ENSG00000117013	ENST00000347132;ENST00000509682|ENST00000443478	D;D|.	0.98717|.	-5.09;-4.95|.	5.02|5.02	2.05|2.05	0.26809|0.26809	.|.	0.530165|.	0.18743|.	N|.	0.132418|.	T|T	0.00012|0.00012	0.0000|0.0000	N|N	0.14661|0.14661	0.345|0.345	0.35098|0.35098	P|P	0.23502900000000004|0.23502900000000004	B;B|.	0.17465|.	0.001;0.022|.	B;B|.	0.10450|.	0.001;0.005|.	T|T	0.35251|0.35251	-0.9796|-0.9796	9|4	0.17832|.	T|.	0.49|.	-13.1202|-13.1202	7.873|7.873	0.29578|0.29578	0.0:0.7067:0.0:0.2933|0.0:0.7067:0.0:0.2933	rs34287852|rs34287852	401;455|.	P56696-2;P56696|.	.;KCNQ4_HUMAN|.	Q|A	455;401|316	ENSP00000262916:H455Q;ENSP00000423756:H401Q|.	ENSP00000262916:H455Q|.	H|S	+|+	3|1	2|0	KCNQ4|KCNQ4	41069415|41069415	0.995000|0.995000	0.38212|0.38212	1.000000|1.000000	0.80357|0.80357	0.970000|0.970000	0.65996|0.65996	0.412000|0.412000	0.21131|0.21131	0.215000|0.215000	0.20761|0.20761	-0.394000|-0.394000	0.06481|0.06481	CAT|TCT	T|0.858;G|0.142		0.642	KCNQ4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000020812.1	NM_004700	
ERICH3	127254	bcgsc.ca	37	1	75037845	75037845	+	Silent	SNP	A	A	G	rs12723334	byFrequency	TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr1:75037845A>G	ENST00000326665.5	-	14	3767	c.3549T>C	c.(3547-3549)agT>agC	p.S1183S	C1orf173_ENST00000433746.2_5'UTR	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		1183	Glu-rich.									NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						CTCTGGCTTCACTCAGTCTTT	0.517													N|||	1879	0.3752	0.2466	0.3314	5008	,	,		20208	0.5843		0.3549	False		,,,				2504	0.3855				p.S1183S		.											.	C1orf173-94	0			c.T3549C						.	G		1103,3303	719.8+/-409.0	143,817,1243	144.0	141.0	142.0		3549	-8.7	0.0	1	dbSNP_121	142	3177,5423	653.5+/-401.1	598,1981,1721	no	coding-synonymous	C1orf173	NM_001002912.4		741,2798,2964	GG,GA,AA		36.9419,25.034,32.9079		1183/1531	75037845	4280,8726	2203	4300	6503	SO:0001819	synonymous_variant	127254	exon14			GGCTTCACTCAGT																												ENST00000326665.5:c.3549T>C	1.37:g.75037845A>G		Somatic	93	0		WXS	Illumina GAIIx	Phase_I	78	4	NM_001002912	0	0	0	0	0	Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Silent	SNP	ENST00000326665.5	37	CCDS30755.1																																																																																			A|0.649;G|0.351		0.517	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026516.1		
OVGP1	5016	bcgsc.ca	37	1	111957533	111957533	+	Silent	SNP	C	C	T	rs112145355		TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr1:111957533C>T	ENST00000369732.3	-	11	1645	c.1590G>A	c.(1588-1590)caG>caA	p.Q530Q		NM_002557.3	NP_002548.3	Q12889	OVGP1_HUMAN	oviductal glycoprotein 1, 120kDa	530					binding of sperm to zona pellucida (GO:0007339)|carbohydrate metabolic process (GO:0005975)|chitin catabolic process (GO:0006032)|female pregnancy (GO:0007565)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|single fertilization (GO:0007338)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|egg coat (GO:0035805)|perivitelline space (GO:0098595)	chitinase activity (GO:0004568)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(13)|ovary(4)|prostate(1)|skin(4)|stomach(3)|urinary_tract(1)	39		all_cancers(81;8.18e-06)|all_epithelial(167;5.64e-06)|all_lung(203;0.000152)|Lung NSC(277;0.000302)		Lung(183;0.0253)|Colorectal(144;0.033)|all cancers(265;0.0552)|Epithelial(280;0.0802)|COAD - Colon adenocarcinoma(174;0.123)|LUSC - Lung squamous cell carcinoma(189;0.14)		GGGTCACAGACTGATGACCCA	0.542																																					p.Q530Q		.											.	OVGP1-135	0			c.G1590A						.						59.0	57.0	58.0					1																	111957533		2197	4207	6404	SO:0001819	synonymous_variant	5016	exon11			CACAGACTGATGA	U09550	CCDS834.1	1p13.2	2008-07-31	2008-07-31		ENSG00000085465	ENSG00000085465		"""Mucins"""	8524	protein-coding gene	gene with protein product	"""oviductin"""	603578	"""mucin 9"""	MUC9		7819450, 9341614	Standard	NM_002557		Approved	CHIT5	uc001eba.3	Q12889	OTTHUMG00000011746	ENST00000369732.3:c.1590G>A	1.37:g.111957533C>T		Somatic	74	0		WXS	Illumina GAIIx	Phase_I	75	24	NM_002557	0	0	0	0	0	A0AV19|B9EGE1|Q15841	Silent	SNP	ENST00000369732.3	37	CCDS834.1																																																																																			C|0.500;T|0.500		0.542	OVGP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032461.1	NM_002557	
CHRNB2	1141	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	154542804	154542804	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr1:154542804C>A	ENST00000368476.3	+	4	590	c.326C>A	c.(325-327)tCc>tAc	p.S109Y		NM_000748.2	NP_000739.1	P17787	ACHB2_HUMAN	cholinergic receptor, nicotinic, beta 2 (neuronal)	109					action potential (GO:0001508)|associative learning (GO:0008306)|B cell activation (GO:0042113)|behavioral response to nicotine (GO:0035095)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|central nervous system projection neuron axonogenesis (GO:0021952)|cognition (GO:0050890)|conditioned taste aversion (GO:0001661)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|lateral geniculate nucleus development (GO:0021771)|learning (GO:0007612)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|memory (GO:0007613)|negative regulation of action potential (GO:0045759)|neurological system process (GO:0050877)|optic nerve morphogenesis (GO:0021631)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of synaptic transmission, dopaminergic (GO:0032226)|protein heterooligomerization (GO:0051291)|regulation of circadian sleep/wake cycle, non-REM sleep (GO:0045188)|regulation of circadian sleep/wake cycle, REM sleep (GO:0042320)|regulation of dendrite morphogenesis (GO:0048814)|regulation of dopamine metabolic process (GO:0042053)|regulation of dopamine secretion (GO:0014059)|regulation of synapse assembly (GO:0051963)|regulation of synaptic transmission, dopaminergic (GO:0032225)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to nicotine (GO:0035094)|sensory perception of pain (GO:0019233)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)|social behavior (GO:0035176)|synaptic transmission (GO:0007268)|synaptic transmission involved in micturition (GO:0060084)|synaptic transmission, cholinergic (GO:0007271)|vestibulocochlear nerve development (GO:0021562)|visual learning (GO:0008542)|visual perception (GO:0007601)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|drug binding (GO:0008144)|ligand-gated ion channel activity (GO:0015276)	p.S109C(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(12)|skin(1)|urinary_tract(3)	28	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)		Dextromethorphan(DB00514)|Galantamine(DB00674)|Nicotine(DB00184)	CGGCTCCCTTCCAAACACATC	0.532																																					p.S109Y		.											.	CHRNB2-90	1	Substitution - Missense(1)	urinary_tract(1)	c.C326A						.						66.0	55.0	59.0					1																	154542804		2203	4300	6503	SO:0001583	missense	1141	exon4			TCCCTTCCAAACA	U62437	CCDS1070.1	1q21.3	2012-02-11	2006-02-01		ENSG00000160716	ENSG00000160716		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1962	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, beta 2 (neuronal)"""	118507	"""cholinergic receptor, nicotinic, beta polypeptide 2 (neuronal)"""			1505988	Standard	NM_000748		Approved		uc001ffg.3	P17787	OTTHUMG00000037262	ENST00000368476.3:c.326C>A	1.37:g.154542804C>A	ENSP00000357461:p.Ser109Tyr	Somatic	120	0		WXS	Illumina GAIIx	Phase_I	114	12	NM_000748	0	0	0	0	0	Q9UEH9	Missense_Mutation	SNP	ENST00000368476.3	37	CCDS1070.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.478290	0.84747	.	.	ENSG00000160716	ENST00000368476	T	0.80304	-1.36	5.25	4.35	0.52113	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	D	0.84986	0.5594	M	0.67569	2.06	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.87363	0.2345	10	0.87932	D	0	.	13.6082	0.62061	0.0:0.9249:0.0:0.0751	.	109	P17787	ACHB2_HUMAN	Y	109	ENSP00000357461:S109Y	ENSP00000357461:S109Y	S	+	2	0	CHRNB2	152809428	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.651000	0.83577	1.457000	0.47850	0.563000	0.77884	TCC	.		0.532	CHRNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090697.1	NM_000748	
KCNN3	3782	broad.mit.edu;bcgsc.ca	37	1	154842331	154842333	+	In_Frame_Del	DEL	TGC	TGC	-			TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr1:154842331_154842333delTGC	ENST00000271915.4	-	1	423_425	c.108_110delGCA	c.(106-111)cagcaa>caa	p.36_37QQ>Q	KCNN3_ENST00000358505.2_5'Flank	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	36	Gln-rich.				potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	ctgctgctgttgctgctgctgct	0.67																																					p.36_37del		.											.	KCNN3-91	0			c.108_110del						.																																			SO:0001651	inframe_deletion	3782	exon1			TGCTGTTGCTGCT	AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.108_110delGCA	1.37:g.154842340_154842342delTGC	ENSP00000271915:p.Gln41del	Somatic	78	0		WXS	Illumina GAIIx	Phase_I	100	12	NM_001204087	0	0	0	0	0	B1ANX0|O43517|Q86VF9|Q8WXG7	In_Frame_Del	DEL	ENST00000271915.4	37	CCDS30880.1																																																																																			.		0.670	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090688.3	NM_002249	
OR6K3	391114	bcgsc.ca	37	1	158687896	158687896	+	Missense_Mutation	SNP	C	C	T	rs857705	byFrequency	TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr1:158687896C>T	ENST00000368146.1	-	1	57	c.58G>A	c.(58-60)Gga>Aga	p.G20R	OR6K3_ENST00000368145.1_Missense_Mutation_p.G4R			Q8NGY3	OR6K3_HUMAN	olfactory receptor, family 6, subfamily K, member 3	20			G -> R (in dbSNP:rs857705).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(21)|ovary(1)|prostate(1)|skin(2)|stomach(1)	41	all_hematologic(112;0.0378)					GATTGGTTTCCGCTCTCCATA	0.388													c|||	1127	0.22504	0.2943	0.1614	5008	,	,		16757	0.1518		0.2227	False		,,,				2504	0.2546				p.G4R		.											.	OR6K3-70	0			c.G10A						.	T	ARG/GLY	1248,3158	420.2+/-338.9	176,896,1131	48.0	47.0	48.0		10	-2.9	0.0	1	dbSNP_86	48	1756,6844	312.7+/-311.0	164,1428,2708	yes	missense	OR6K3	NM_001005327.2	125	340,2324,3839	TT,TC,CC		20.4186,28.325,23.097	benign	4/316	158687896	3004,10002	2203	4300	6503	SO:0001583	missense	391114	exon1			GGTTTCCGCTCTC	AB065633	CCDS30903.1, CCDS30903.2	1q23.1	2012-08-09			ENSG00000203757	ENSG00000203757		"""GPCR / Class A : Olfactory receptors"""	15030	protein-coding gene	gene with protein product							Standard	NM_001005327		Approved		uc021pbn.1	Q8NGY3	OTTHUMG00000022770	ENST00000368146.1:c.58G>A	1.37:g.158687896C>T	ENSP00000357128:p.Gly20Arg	Somatic	50	0		WXS	Illumina GAIIx	Phase_I	56	5	NM_001005327	0	0	0	0	0	Q5VUV0|Q6IFR5	Missense_Mutation	SNP	ENST00000368146.1	37		463	0.211996336996337	145	0.29471544715447157	60	0.16574585635359115	81	0.14160839160839161	177	0.23350923482849603	c	4.440	0.081406	0.08533	0.28325	0.204186	ENSG00000203757	ENST00000368145;ENST00000368146	T;T	0.00484	7.08;7.08	3.89	-2.94	0.05581	.	.	.	.	.	T	0.00073	0.0002	N	0.25144	0.715	0.80722	P	0.0	B	0.11235	0.004	B	0.06405	0.002	T	0.11060	-1.0603	8	0.17369	T	0.5	.	2.3035	0.04168	0.1216:0.3478:0.1196:0.411	rs857705;rs52837960;rs58065485;rs857705	20	Q8NGY3	OR6K3_HUMAN	R	4;20	ENSP00000357127:G4R;ENSP00000357128:G20R	ENSP00000357127:G4R	G	-	1	0	OR6K3	156954520	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-1.046000	0.03525	-0.465000	0.06953	-1.804000	0.00617	GGA	C|0.776;T|0.224		0.388	OR6K3-201	KNOWN	basic	protein_coding	protein_coding			
SORBS1	10580	ucsc.edu;bcgsc.ca	37	10	97096405	97096405	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr10:97096405G>T	ENST00000361941.3	-	28	3538	c.3512C>A	c.(3511-3513)aCc>aAc	p.T1171N	SORBS1_ENST00000277982.5_Missense_Mutation_p.T1030N|SORBS1_ENST00000371245.3_Intron|SORBS1_ENST00000353505.5_Intron|SORBS1_ENST00000354106.3_Intron|SORBS1_ENST00000306402.6_Intron|SORBS1_ENST00000347291.4_Intron|SORBS1_ENST00000393949.1_Intron|SORBS1_ENST00000371241.1_Intron|SORBS1_ENST00000371239.1_Intron|SORBS1_ENST00000607232.1_Intron|SORBS1_ENST00000371246.2_Missense_Mutation_p.T1030N|SORBS1_ENST00000371247.2_Missense_Mutation_p.T1171N|SORBS1_ENST00000371227.4_Missense_Mutation_p.T1125N|SORBS1_ENST00000371249.2_Intron	NM_001034954.1	NP_001030126			sorbin and SH3 domain containing 1											NS(1)|breast(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(19)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	42		Colorectal(252;0.0429)		Epithelial(162;1.7e-06)|all cancers(201;6.52e-05)		CTCCTCAGGGGTGTTGAGATC	0.602																																					p.T1171N		.											.	SORBS1-155	0			c.C3512A						.						94.0	99.0	97.0					10																	97096405		2203	4300	6503	SO:0001583	missense	10580	exon28			TCAGGGGTGTTGA	AF136381	CCDS7442.1, CCDS31252.1, CCDS31253.1, CCDS31254.1, CCDS31255.1, CCDS31256.1, CCDS73169.1	10q23.33	2011-07-25	2002-05-08		ENSG00000095637	ENSG00000095637			14565	protein-coding gene	gene with protein product	"""c-Cbl-associated protein"""	605264	"""SH3-domain protein 5 (ponsin)"""	SH3D5		10085297, 11001060	Standard	XM_005269405		Approved	FLJ12406, CAP, sh3p12, ponsin, KIAA1296	uc001kkp.3	Q9BX66	OTTHUMG00000018812	ENST00000361941.3:c.3512C>A	10.37:g.97096405G>T	ENSP00000355136:p.Thr1171Asn	Somatic	47	1		WXS	Illumina GAIIx	Phase_I	44	5	NM_001034954	0	0	0	0	0		Missense_Mutation	SNP	ENST00000361941.3	37	CCDS31255.1	.	.	.	.	.	.	.	.	.	.	G	15.72	2.916079	0.52546	.	.	ENSG00000095637	ENST00000371247;ENST00000371227;ENST00000371246;ENST00000361941;ENST00000277982	T;T;T;T;T	0.08458	3.11;3.09;3.36;3.11;3.36	5.58	-1.01	0.10169	.	1.168410	0.06436	N	0.724998	T	0.05547	0.0146	N	0.19112	0.55	0.18873	N	0.999987	B;B;B	0.22983	0.078;0.047;0.078	B;B;B	0.24155	0.051;0.023;0.051	T	0.46034	-0.9220	10	0.25751	T	0.34	0.4862	5.9081	0.19012	0.2757:0.3611:0.3633:0.0	.	1125;1171;1030	Q9BX66-11;Q9BX66;Q9BX66-2	.;SRBS1_HUMAN;.	N	1171;1125;1030;1171;1030	ENSP00000360293:T1171N;ENSP00000360271:T1125N;ENSP00000360292:T1030N;ENSP00000355136:T1171N;ENSP00000277982:T1030N	ENSP00000277982:T1030N	T	-	2	0	SORBS1	97086395	0.281000	0.24258	0.043000	0.18650	0.994000	0.84299	0.042000	0.13949	-0.480000	0.06803	0.561000	0.74099	ACC	.		0.602	SORBS1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049517.1		
CNNM1	26507	bcgsc.ca	37	10	101147692	101147692	+	Missense_Mutation	SNP	G	G	A	rs2298316	byFrequency	TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr10:101147692G>A	ENST00000356713.4	+	8	2745	c.2456G>A	c.(2455-2457)cGg>cAg	p.R819Q	CNNM1_ENST00000370534.4_Missense_Mutation_p.R475Q|CNNM1_ENST00000446890.1_Missense_Mutation_p.R748Q|CNNM1_ENST00000370528.3_Missense_Mutation_p.R748Q	NM_020348.2	NP_065081.2	Q9NRU3	CNNM1_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 1	819			R -> Q (in dbSNP:rs2298316).		ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)			NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(5)|ovary(1)|prostate(1)|skin(1)	25		Colorectal(252;0.234)		Epithelial(162;6.82e-10)|all cancers(201;5.62e-08)		CCCACAACCCGGGGCACACCC	0.627													G|||	193	0.0385383	0.0015	0.0937	5008	,	,		18890	0.003		0.1074	False		,,,				2504	0.0153				p.R819Q		.											.	CNNM1-68	0			c.G2456A						.	G	GLN/ARG	101,4305	80.9+/-119.3	0,101,2102	48.0	49.0	49.0		2456	5.1	1.0	10	dbSNP_100	49	914,7686	201.6+/-245.0	60,794,3446	yes	missense	CNNM1	NM_020348.2	43	60,895,5548	AA,AG,GG		10.6279,2.2923,7.8041	possibly-damaging	819/952	101147692	1015,11991	2203	4300	6503	SO:0001583	missense	26507	exon8			CAACCCGGGGCAC	AF169226	CCDS7478.2	10q24.2	2014-08-08	2014-08-07		ENSG00000119946	ENSG00000119946			102	protein-coding gene	gene with protein product		607802	"""cyclin M1"""	ACDP1		21393841	Standard	NM_020348		Approved		uc001kpp.4	Q9NRU3	OTTHUMG00000018881	ENST00000356713.4:c.2456G>A	10.37:g.101147692G>A	ENSP00000349147:p.Arg819Gln	Somatic	247	1		WXS	Illumina GAIIx	Phase_I	247	8	NM_020348	0	0	0	0	0	Q4QQG7|Q4QQH8|Q4QQP9|Q9NT45	Missense_Mutation	SNP	ENST00000356713.4	37	CCDS7478.2	114	0.0521978021978022	2	0.0040650406504065045	35	0.09668508287292818	1	0.0017482517482517483	76	0.10026385224274406	G	12.71	2.020394	0.35606	0.022923	0.106279	ENSG00000119946	ENST00000356713;ENST00000446890;ENST00000370528;ENST00000370534;ENST00000545665	T;T;T;T	0.32515	1.45;1.45;1.45;1.45	5.05	5.05	0.67936	.	0.101382	0.37761	N	0.001952	T	0.00440	0.0014	L	0.40543	1.245	0.35302	P	0.21687199999999995	P;P;P	0.48640	0.489;0.883;0.913	B;B;B	0.40602	0.096;0.334;0.201	T	0.07328	-1.0778	9	0.07030	T	0.85	-14.0957	16.9713	0.86301	0.0:0.0:1.0:0.0	rs2298316;rs52818796;rs57619431;rs2298316	475;819;819	F5H5J0;Q9NRU3-2;Q9NRU3	.;.;CNNM1_HUMAN	Q	819;748;748;475;272	ENSP00000349147:R819Q;ENSP00000406492:R748Q;ENSP00000359559:R748Q;ENSP00000359565:R475Q	ENSP00000349147:R819Q	R	+	2	0	CNNM1	101137682	0.869000	0.29996	1.000000	0.80357	0.971000	0.66376	2.716000	0.47219	2.493000	0.84123	0.655000	0.94253	CGG	G|0.935;A|0.065		0.627	CNNM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049792.2	NM_020348	
IGSF22	283284	broad.mit.edu;bcgsc.ca	37	11	18736089	18736089	+	Silent	SNP	A	A	G			TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr11:18736089A>G	ENST00000513874.1	-	12	1753	c.1614T>C	c.(1612-1614)aaT>aaC	p.N538N	RP11-1081L13.4_ENST00000527285.1_RNA	NM_173588.3	NP_775859	Q8N9C0	IGS22_HUMAN	immunoglobulin superfamily, member 22	538										NS(2)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(20)|ovary(4)|prostate(4)|skin(3)	56						CCTTCTCGTCATTCAGCACTA	0.612																																					p.N538N		.											.	IGSF22-140	0			c.T1614C						.						132.0	143.0	139.0					11																	18736089		2154	4243	6397	SO:0001819	synonymous_variant	283284	exon12			CTCGTCATTCAGC	AK095113	CCDS41625.1, CCDS41625.2	11p15.1	2014-06-06			ENSG00000179057	ENSG00000179057		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26750	protein-coding gene	gene with protein product							Standard	NM_173588		Approved	FLJ37794	uc009yht.2	Q8N9C0	OTTHUMG00000160502	ENST00000513874.1:c.1614T>C	11.37:g.18736089A>G		Somatic	156	1		WXS	Illumina GAIIx	Phase_I	169	11	NM_173588	0	0	0	0	0	A6NNA0|D6RGV7	Silent	SNP	ENST00000513874.1	37	CCDS41625.2																																																																																			.		0.612	IGSF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360850.2	NM_173588	
OR5D13	390142	broad.mit.edu	37	11	55541042	55541042	+	Silent	SNP	G	G	A			TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr11:55541042G>A	ENST00000361760.1	+	1	129	c.129G>A	c.(127-129)ggG>ggA	p.G43G		NM_001001967.1	NP_001001967.1	Q8NGL4	OR5DD_HUMAN	olfactory receptor, family 5, subfamily D, member 13	43						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(1)|lung(20)|ovary(1)|pancreas(2)|skin(2)|stomach(1)|urinary_tract(1)	40		all_epithelial(135;0.196)				CTGTAGTGGGGAACTTGGGCA	0.403																																					p.G43G		.											.	OR5D13-71	0			c.G129A						.						160.0	150.0	153.0					11																	55541042		2200	4296	6496	SO:0001819	synonymous_variant	390142	exon1			AGTGGGGAACTTG	BK004394	CCDS31507.1	11q11	2012-08-09			ENSG00000198877	ENSG00000198877		"""GPCR / Class A : Olfactory receptors"""	15280	protein-coding gene	gene with protein product							Standard	NM_001001967		Approved		uc010ril.2	Q8NGL4	OTTHUMG00000166807	ENST00000361760.1:c.129G>A	11.37:g.55541042G>A		Somatic	145	0		WXS	Illumina GAIIx	Phase_I	105	4	NM_001001967	0	0	0	0	0	Q6IF68|Q6IFC9	Silent	SNP	ENST00000361760.1	37	CCDS31507.1																																																																																			.		0.403	OR5D13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391511.1	NM_001001967	
RAB3IL1	5866	broad.mit.edu	37	11	61672084	61672084	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr11:61672084A>G	ENST00000394836.2	-	7	990	c.833T>C	c.(832-834)aTt>aCt	p.I278T	RAB3IL1_ENST00000301773.5_Missense_Mutation_p.I252T	NM_013401.2	NP_037533.2	Q8TBN0	R3GEF_HUMAN	RAB3A interacting protein (rabin3)-like 1	278					positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|liver(1)|lung(4)|skin(3)|urinary_tract(1)	14						CACCGGCTCAATGGTGAGCGT	0.647																																					p.I278T		.											.	RAB3IL1-228	0			c.T833C						.						84.0	64.0	71.0					11																	61672084		2202	4299	6501	SO:0001583	missense	5866	exon7			GGCTCAATGGTGA	AF084557	CCDS8014.1, CCDS60809.1	11q12.2	2008-02-01			ENSG00000167994	ENSG00000167994			9780	protein-coding gene	gene with protein product							Standard	NM_013401		Approved		uc001nso.4	Q8TBN0	OTTHUMG00000167524	ENST00000394836.2:c.833T>C	11.37:g.61672084A>G	ENSP00000378313:p.Ile278Thr	Somatic	202	0		WXS	Illumina GAIIx	Phase_I	208	6	NM_013401	0	0	0	0	0	Q86V32|Q9P1Q8	Missense_Mutation	SNP	ENST00000394836.2	37	CCDS8014.1	.	.	.	.	.	.	.	.	.	.	A	24.7	4.564873	0.86439	.	.	ENSG00000167994	ENST00000394836;ENST00000301773	T;T	0.52057	0.68;0.68	4.92	4.92	0.64577	.	0.000000	0.85682	D	0.000000	T	0.69024	0.3065	M	0.85299	2.745	0.46749	D	0.999188	D;D	0.59767	0.986;0.963	P;P	0.61800	0.894;0.704	T	0.75833	-0.3178	10	0.87932	D	0	-18.3907	14.9437	0.71014	1.0:0.0:0.0:0.0	.	252;278	Q8TBN0-2;Q8TBN0	.;R3GEF_HUMAN	T	278;252	ENSP00000378313:I278T;ENSP00000301773:I252T	ENSP00000301773:I252T	I	-	2	0	RAB3IL1	61428660	1.000000	0.71417	0.999000	0.59377	0.881000	0.50899	9.287000	0.95975	2.146000	0.66826	0.379000	0.24179	ATT	.		0.647	RAB3IL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394917.1	NM_013401	
GPR137	56834	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	64054094	64054094	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr11:64054094T>A	ENST00000313074.3	+	1	203	c.98T>A	c.(97-99)cTg>cAg	p.L33Q	BAD_ENST00000394532.3_5'Flank|GPR137_ENST00000411458.1_Missense_Mutation_p.L91Q|GPR137_ENST00000438980.2_Missense_Mutation_p.L33Q|GPR137_ENST00000539851.1_Missense_Mutation_p.L33Q|GPR137_ENST00000377702.4_Missense_Mutation_p.L33Q|BAD_ENST00000309032.3_5'Flank|BAD_ENST00000394531.3_5'Flank|BAD_ENST00000544785.1_5'Flank	NM_020155.3	NP_064540.3	Q96N19	G137A_HUMAN	G protein-coupled receptor 137	33						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(3)|kidney(1)|lung(4)|skin(1)	10						TACACCACCCTGTATGCCCTG	0.617																																					p.L91Q		.											.	GPR137-68	0			c.T272A						.						122.0	111.0	115.0					11																	64054094		2201	4297	6498	SO:0001583	missense	56834	exon3			CCACCCTGTATGC	AJ250392	CCDS8066.1, CCDS53655.1, CCDS53656.1, CCDS53657.1, CCDS53658.1	11q13.1	2014-02-12	2006-01-26		ENSG00000173264	ENSG00000173264		"""GPCR / Unclassified : 7TM orphan receptors"""	24300	protein-coding gene	gene with protein product						10873569, 12732197	Standard	NM_001170726		Approved	C11orf4, GPR137A, TM7SF1L1	uc010rni.2	Q96N19	OTTHUMG00000167817	ENST00000313074.3:c.98T>A	11.37:g.64054094T>A	ENSP00000321698:p.Leu33Gln	Somatic	127	0		WXS	Illumina GAIIx	Phase_I	108	38	NM_001170726	0	0	0	0	0	B4DTG7|B7Z7M1|Q4G0Y9|Q8N4K6	Missense_Mutation	SNP	ENST00000313074.3	37	CCDS8066.1	.	.	.	.	.	.	.	.	.	.	T	21.5	4.159027	0.78226	.	.	ENSG00000173264	ENST00000546139;ENST00000538244;ENST00000411458;ENST00000539851;ENST00000539833;ENST00000377702;ENST00000535675;ENST00000543383;ENST00000538032;ENST00000540370;ENST00000540969;ENST00000438980;ENST00000313074;ENST00000542190;ENST00000541952	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.17054	2.3;2.3;2.3;2.3;2.3;2.3;2.3;2.3;2.3;2.3;2.3;2.3;2.3;2.3	4.19	4.19	0.49359	.	0.000000	0.53938	D	0.000045	T	0.20373	0.0490	L	0.39898	1.24	0.42107	D	0.991362	B;P;B;B;B;P;B	0.48503	0.151;0.911;0.151;0.343;0.151;0.729;0.343	B;P;B;B;B;B;B	0.48400	0.283;0.576;0.283;0.191;0.283;0.373;0.283	T	0.01621	-1.1310	10	0.87932	D	0	-8.1984	11.2254	0.48880	0.0:0.0:0.0:1.0	.	33;91;39;33;33;33;33	B7Z7M1;B4DTG7;F5H234;Q96N19-2;F5GXI8;Q96N19;Q96N19-3	.;.;.;.;.;G137A_HUMAN;.	Q	39;33;91;33;33;33;33;33;33;33;33;33;33;33;33	ENSP00000445570:L39Q;ENSP00000442322:L33Q;ENSP00000411827:L91Q;ENSP00000442792:L33Q;ENSP00000438716:L33Q;ENSP00000366931:L33Q;ENSP00000446342:L33Q;ENSP00000441003:L33Q;ENSP00000445000:L33Q;ENSP00000446387:L33Q;ENSP00000415698:L33Q;ENSP00000321698:L33Q;ENSP00000441034:L33Q;ENSP00000442929:L33Q	ENSP00000321698:L33Q	L	+	2	0	GPR137	63810670	1.000000	0.71417	0.094000	0.20943	0.982000	0.71751	7.813000	0.86123	1.760000	0.52011	0.459000	0.35465	CTG	.		0.617	GPR137-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000396412.1	NM_020155	
EFEMP2	30008	broad.mit.edu;bcgsc.ca	37	11	65638718	65638718	+	Missense_Mutation	SNP	C	C	T	rs2234462	byFrequency	TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr11:65638718C>T	ENST00000307998.6	-	4	507	c.277G>A	c.(277-279)Ggc>Agc	p.G93S	EFEMP2_ENST00000528176.1_Missense_Mutation_p.G93S	NM_016938.4	NP_058634.4	O95967	FBLN4_HUMAN	EGF containing fibulin-like extracellular matrix protein 2	93					blood coagulation (GO:0007596)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)|transmembrane signaling receptor activity (GO:0004888)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21				READ - Rectum adenocarcinoma(159;0.169)		GGTCCCTCGCCGTGTAGGTCG	0.652													C|||	3	0.000599042	0.0	0.0	5008	,	,		17281	0.0		0.003	False		,,,				2504	0.0				p.G93S		.											.	EFEMP2-91	0			c.G277A						.	C	SER/GLY	3,4399	6.2+/-15.9	0,3,2198	93.0	102.0	99.0		277	1.9	0.8	11	dbSNP_98	99	36,8556	24.6+/-71.5	0,36,4260	no	missense	EFEMP2	NM_016938.4	56	0,39,6458	TT,TC,CC		0.419,0.0682,0.3001	benign	93/444	65638718	39,12955	2201	4296	6497	SO:0001583	missense	30008	exon4			CCTCGCCGTGTAG	AF109121	CCDS8116.1	11q13	2011-06-17	2011-01-25		ENSG00000172638	ENSG00000172638		"""Fibulins"""	3219	protein-coding gene	gene with protein product	"""fibulin 4"""	604633	"""EGF-containing fibulin-like extracellular matrix protein 2"""			10601734, 10982184	Standard	NR_037718		Approved	FBLN4, UPH1	uc001ofy.4	O95967	OTTHUMG00000166664	ENST00000307998.6:c.277G>A	11.37:g.65638718C>T	ENSP00000309953:p.Gly93Ser	Somatic	221	2		WXS	Illumina GAIIx	Phase_I	176	8	NM_016938	0	0	0	0	0	A8K7R4|B3KM31|B3KQT1|O75967	Missense_Mutation	SNP	ENST00000307998.6	37	CCDS8116.1	3	0.0013736263736263737	0	0.0	0	0.0	0	0.0	3	0.00395778364116095	C	8.768	0.925137	0.18056	6.82E-4	0.00419	ENSG00000172638	ENST00000528176;ENST00000307998;ENST00000526624;ENST00000527378	D;T;D;T	0.82167	-1.53;-1.45;-1.58;-0.43	4.79	1.86	0.25419	.	0.831981	0.10104	N	0.715577	T	0.65554	0.2702	N	0.16478	0.41	0.09310	N	1	B;B	0.18166	0.026;0.001	B;B	0.08055	0.003;0.0	T	0.47005	-0.9150	10	0.08837	T	0.75	.	6.8928	0.24238	0.0:0.6215:0.0:0.3785	rs2234462	93;93	E9PRU1;O95967	.;FBLN4_HUMAN	S	93	ENSP00000434151:G93S;ENSP00000309953:G93S;ENSP00000435419:G93S;ENSP00000435963:G93S	ENSP00000309953:G93S	G	-	1	0	EFEMP2	65395294	0.069000	0.21087	0.810000	0.32431	0.900000	0.52787	0.049000	0.14099	0.221000	0.20879	0.655000	0.94253	GGC	C|0.998;T|0.002		0.652	EFEMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391047.4	NM_016938	
CST6	1474	hgsc.bcm.edu	37	11	65779590	65779590	+	Silent	SNP	C	C	T	rs1131544	byFrequency	TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr11:65779590C>T	ENST00000312134.2	+	1	279	c.75C>T	c.(73-75)gaC>gaT	p.D25D		NM_001323.3	NP_001314.1	Q15828	CYTM_HUMAN	cystatin E/M	25					anatomical structure morphogenesis (GO:0009653)|epidermis development (GO:0008544)|negative regulation of endopeptidase activity (GO:0010951)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)	cysteine-type endopeptidase inhibitor activity (GO:0004869)			large_intestine(1)|lung(1)|ovary(1)	3						TGCCACGCGACGCCCGGGCCC	0.746													C|||	356	0.0710863	0.0219	0.0922	5008	,	,		12347	0.001		0.162	False		,,,				2504	0.1012				p.D25D		.											.	CST6-523	0			c.C75T						.	C		164,3936		5,154,1891	5.0	6.0	5.0		75	-4.6	0.0	11	dbSNP_86	5	1227,6867		88,1051,2908	no	coding-synonymous	CST6	NM_001323.3		93,1205,4799	TT,TC,CC		15.1594,4.0,11.4072		25/150	65779590	1391,10803	2050	4047	6097	SO:0001819	synonymous_variant	1474	exon1			ACGCGACGCCCGG	U62800	CCDS8126.1	11q13	2005-09-29			ENSG00000175315	ENSG00000175315			2478	protein-coding gene	gene with protein product		601891				9154125, 9099741	Standard	NM_001323		Approved		uc001ogr.3	Q15828	OTTHUMG00000166750	ENST00000312134.2:c.75C>T	11.37:g.65779590C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	4	NM_001323	0	0	0	0	0	Q540N7	Silent	SNP	ENST00000312134.2	37	CCDS8126.1																																																																																			C|0.921;T|0.079		0.746	CST6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391348.1	NM_001323	
SPTBN2	6712	broad.mit.edu	37	11	66472762	66472762	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr11:66472762T>G	ENST00000533211.1	-	15	2316	c.1985A>C	c.(1984-1986)cAc>cCc	p.H662P	SPTBN2_ENST00000309996.2_Missense_Mutation_p.H662P|SPTBN2_ENST00000529997.1_Missense_Mutation_p.H662P			O15020	SPTN2_HUMAN	spectrin, beta, non-erythrocytic 2	662					actin filament capping (GO:0051693)|adult behavior (GO:0030534)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|cell death (GO:0008219)|cerebellar Purkinje cell layer morphogenesis (GO:0021692)|multicellular organism growth (GO:0035264)|synapse assembly (GO:0007416)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|spectrin (GO:0008091)	actin binding (GO:0003779)|phospholipid binding (GO:0005543)|structural constituent of cytoskeleton (GO:0005200)			autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(15)|liver(1)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	74						GGCCAGGAGGTGCTGCTGCTC	0.721																																					p.H662P		.											.	SPTBN2-155	0			c.A1985C						.						7.0	10.0	9.0					11																	66472762		2107	4173	6280	SO:0001583	missense	6712	exon14			AGGAGGTGCTGCT	AB008567, AF026487, AF026488, AF079569	CCDS8150.1	11q13.2	2013-01-10			ENSG00000173898	ENSG00000173898		"""Pleckstrin homology (PH) domain containing"""	11276	protein-coding gene	gene with protein product		604985	"""spinocerebellar ataxia 5"""	SCA5		9826670, 16429157	Standard	NM_006946		Approved		uc001ojd.3	O15020	OTTHUMG00000167262	ENST00000533211.1:c.1985A>C	11.37:g.66472762T>G	ENSP00000432568:p.His662Pro	Somatic	31	4		WXS	Illumina GAIIx	Phase_I	71	15	NM_006946	0	0	0	0	0	O14872|O14873	Missense_Mutation	SNP	ENST00000533211.1	37	CCDS8150.1	.	.	.	.	.	.	.	.	.	.	T	13.41	2.227423	0.39399	.	.	ENSG00000173898	ENST00000533211;ENST00000309996;ENST00000529997	T;T;T	0.47528	0.84;0.84;0.84	4.55	4.55	0.56014	.	0.063428	0.64402	D	0.000004	T	0.18509	0.0444	N	0.01493	-0.835	0.36830	D	0.886832	B	0.06786	0.001	B	0.11329	0.006	T	0.14364	-1.0475	10	0.21014	T	0.42	.	7.8237	0.29303	0.0:0.0956:0.0:0.9044	.	662	O15020	SPTN2_HUMAN	P	662	ENSP00000432568:H662P;ENSP00000311489:H662P;ENSP00000433593:H662P	ENSP00000311489:H662P	H	-	2	0	SPTBN2	66229338	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	2.995000	0.49441	1.904000	0.55121	0.402000	0.26972	CAC	.		0.721	SPTBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393892.2	NM_006946	
UNC93B1	81622	broad.mit.edu	37	11	67763107	67763107	+	Silent	SNP	A	A	G			TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr11:67763107A>G	ENST00000227471.2	-	10	1414	c.1335T>C	c.(1333-1335)agT>agC	p.S445S	UNC93B1_ENST00000530331.1_5'UTR	NM_030930.2	NP_112192.2	Q9H1C4	UN93B_HUMAN	unc-93 homolog B1 (C. elegans)	446					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|intracellular protein transport (GO:0006886)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 7 signaling pathway (GO:0034154)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	early phagosome (GO:0032009)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)											TGTTCAGGGCACTGCCCACAC	0.617																																					.		.											.	.	0			.						.						10.0	10.0	10.0					11																	67763107		1758	3730	5488	SO:0001819	synonymous_variant	81622	.			CAGGGCACTGCCC	AJ271326	CCDS73334.1	11q13.2	2014-09-17	2001-11-28		ENSG00000110057	ENSG00000110057			13481	protein-coding gene	gene with protein product		608204	"""unc93 (C. elegans) homolog B1"""			11867227	Standard	NM_030930		Approved	UNC93	uc001omw.1	Q9H1C4	OTTHUMG00000167472	ENST00000227471.2:c.1335T>C	11.37:g.67763107A>G		Somatic	89	1		WXS	Illumina GAIIx	Phase_I	109	4	.	0	0	0	0	0	O95764|Q569H6|Q710D4	Silent	SNP	ENST00000227471.2	37																																																																																				.		0.617	UNC93B1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_030930	
BUD13	84811	bcgsc.ca	37	11	116633825	116633825	+	Silent	SNP	C	C	T	rs918144	byFrequency	TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr11:116633825C>T	ENST00000260210.4	-	4	503	c.480G>A	c.(478-480)ccG>ccA	p.P160P	BUD13_ENST00000375445.3_Silent_p.P160P	NM_032725.3	NP_116114.1	Q9BRD0	BUD13_HUMAN	BUD13 homolog (S. cerevisiae)	160	Arg-rich.				mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)	nucleus (GO:0005634)|RES complex (GO:0070274)	poly(A) RNA binding (GO:0044822)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(11)|pancreas(2)|skin(1)|urinary_tract(1)	22	all_hematologic(175;0.0487)	all_cancers(61;1.72e-06)|all_epithelial(67;0.000735)|Melanoma(852;0.022)|Acute lymphoblastic leukemia(157;0.0255)|Medulloblastoma(222;0.0523)|Breast(348;0.056)|all_hematologic(158;0.0588)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|Epithelial(105;5.81e-06)|all cancers(92;0.000144)|OV - Ovarian serous cystadenocarcinoma(223;0.154)		GAGAAGGATCCGGGGTGTCAT	0.607													T|||	2730	0.545128	0.6785	0.6023	5008	,	,		16203	0.381		0.4821	False		,,,				2504	0.5583				p.P160P		.											.	BUD13-154	0			c.G480A						.	T	,	2736,1666	507.1+/-366.6	830,1076,295	98.0	106.0	103.0		480,480	-5.0	0.0	11	dbSNP_86	103	4094,4498	588.7+/-392.4	960,2174,1162	no	coding-synonymous,coding-synonymous	BUD13	NM_001159736.1,NM_032725.3	,	1790,3250,1457	TT,TC,CC		47.649,37.8464,47.4373	,	160/486,160/620	116633825	6830,6164	2201	4296	6497	SO:0001819	synonymous_variant	84811	exon4			AGGATCCGGGGTG	BC006350	CCDS8374.1, CCDS53712.1	11q23.3	2012-06-07	2007-01-12		ENSG00000137656	ENSG00000137656			28199	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 71"""		"""BUD13 homolog (yeast)"""			12477932	Standard	NM_032725		Approved	MGC13125, fSAP71, Cwc26	uc001ppn.3	Q9BRD0	OTTHUMG00000045136	ENST00000260210.4:c.480G>A	11.37:g.116633825C>T		Somatic	96	0		WXS	Illumina GAIIx	Phase_I	119	5	NM_001159736	0	0	0	0	0	A8K0S0|Q96LS7	Silent	SNP	ENST00000260210.4	37	CCDS8374.1																																																																																			C|0.470;T|0.530		0.607	BUD13-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000104864.1	NM_032725	
ATN1	1822	ucsc.edu	37	12	7045912	7045912	+	Silent	SNP	G	G	A	rs144280633	byFrequency	TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr12:7045912G>A	ENST00000356654.4	+	5	1719	c.1482G>A	c.(1480-1482)caG>caA	p.Q494Q	ATN1_ENST00000396684.2_Silent_p.Q494Q	NM_001007026.1	NP_001007027.1	P54259	ATN1_HUMAN	atrophin 1	494	Poly-Gln.				cell migration (GO:0016477)|central nervous system development (GO:0007417)|maintenance of cell polarity (GO:0030011)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron apoptotic process (GO:0051402)|toxin metabolic process (GO:0009404)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	40						agcagcagcagcagcagcagc	0.642																																					p.Q494Q		.											.	ATN1-139	0			c.G1482A						.						39.0	49.0	46.0					12																	7045912		2183	4256	6439	SO:0001819	synonymous_variant	1822	exon5			GCAGCAGCAGCAG	U23851	CCDS31734.1	12p	2007-08-01	2005-03-15	2005-03-17		ENSG00000111676			3033	protein-coding gene	gene with protein product		607462	"""dentatorubral-pallidoluysian atrophy (atrophin-1)"""	D12S755E, DRPLA		8136826	Standard	NM_001940		Approved	B37	uc001qrw.1	P54259		ENST00000356654.4:c.1482G>A	12.37:g.7045912G>A		Somatic	156	2		WXS	Illumina GAIIx	Phase_I	157	24	NM_001007026	0	0	0	0	0	Q99495|Q99621|Q9UEK7	Silent	SNP	ENST00000356654.4	37	CCDS31734.1																																																																																			G|0.972;A|0.028		0.642	ATN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401948.2	NM_001940	
KRT81	3887	broad.mit.edu	37	12	52680108	52680108	+	Nonsense_Mutation	SNP	G	G	T	rs370312171		TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr12:52680108G>T	ENST00000327741.5	-	9	1517	c.1449C>A	c.(1447-1449)tgC>tgA	p.C483*	KRT86_ENST00000423955.2_Intron|KRT86_ENST00000544024.1_Intron	NM_002281.3	NP_002272.2	Q14533	KRT81_HUMAN	keratin 81	483	Tail.					extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(2)|endometrium(3)|large_intestine(3)|lung(6)|prostate(1)|stomach(1)	16				BRCA - Breast invasive adenocarcinoma(357;0.189)		AGCCCACGCCGCAGGAACCCC	0.667																																					p.C483X		.											.	KRT81-90	0			c.C1449A						.						30.0	27.0	28.0					12																	52680108		2155	4225	6380	SO:0001587	stop_gained	3887	exon9			CACGCCGCAGGAA	X81420	CCDS31805.1	12q13	2013-01-16	2006-07-17	2006-07-17	ENSG00000205426	ENSG00000205426		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6458	protein-coding gene	gene with protein product	"""hard keratin type II 1"""	602153	"""keratin, hair, basic, 1"""	KRTHB1		7556444, 16831889	Standard	NM_002281		Approved	Hb-1	uc001sab.3	Q14533	OTTHUMG00000167574	ENST00000327741.5:c.1449C>A	12.37:g.52680108G>T	ENSP00000369349:p.Cys483*	Somatic	176	0		WXS	Illumina GAIIx	Phase_I	247	6	NM_002281	0	0	0	0	0	Q14846|Q16274|Q17R48|Q8WU52|Q9BR74	Nonsense_Mutation	SNP	ENST00000327741.5	37	CCDS31805.1	.	.	.	.	.	.	.	.	.	.	G	14.96	2.691862	0.48097	.	.	ENSG00000205426	ENST00000327741	.	.	.	3.32	-4.06	0.03986	.	.	.	.	.	.	.	.	.	.	.	0.29491	N	0.855666	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	.	0.7309	0.00957	0.2063:0.2026:0.338:0.253	.	.	.	.	X	483	.	ENSP00000369349:C483X	C	-	3	2	KRT81	50966375	0.000000	0.05858	0.006000	0.13384	0.035000	0.12851	-0.662000	0.05305	-0.678000	0.05224	-0.448000	0.05591	TGC	.		0.667	KRT81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395128.2	NM_002281	
C14orf39	317761	ucsc.edu	37	14	60932752	60932752	+	Missense_Mutation	SNP	G	G	A	rs12586711	byFrequency	TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr14:60932752G>A	ENST00000321731.3	-	11	1076	c.917C>T	c.(916-918)gCg>gTg	p.A306V		NM_174978.2	NP_777638	Q8N1H7	S6OS1_HUMAN	chromosome 14 open reading frame 39	306				A -> V (in Ref. 1; BAC05253). {ECO:0000305}.	multicellular organismal development (GO:0007275)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)					breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(108;0.0448)		TGACTGCTTCGCAGAACTTTC	0.313													g|||	1079	0.215455	0.0393	0.121	5008	,	,		14149	0.5516		0.2197	False		,,,				2504	0.1697				p.A306V		.											.	C14orf39-94	0			c.C917T						.	G	VAL/ALA	346,4056	178.0+/-206.8	13,320,1868	50.0	51.0	51.0		917	-1.9	0.0	14	dbSNP_120	51	1800,6794	318.0+/-313.5	181,1438,2678	yes	missense	C14orf39	NM_174978.2	64	194,1758,4546	AA,AG,GG		20.9448,7.8601,16.5128	benign	306/588	60932752	2146,10850	2201	4297	6498	SO:0001583	missense	317761	exon11			TGCTTCGCAGAAC	AK098187	CCDS9746.1	14q23.1	2012-11-05	2012-11-05	2012-11-05	ENSG00000179008	ENSG00000179008			19849	protein-coding gene	gene with protein product							Standard	NM_174978		Approved	SIX6OS1	uc001xez.4	Q8N1H7	OTTHUMG00000140332	ENST00000321731.3:c.917C>T	14.37:g.60932752G>A	ENSP00000324920:p.Ala306Val	Somatic	11	0		WXS	Illumina GAIIx	Phase_I	12	7	NM_174978	0	0	0	0	0	Q08AQ4	Missense_Mutation	SNP	ENST00000321731.3	37	CCDS9746.1	542	0.24816849816849818	15	0.03048780487804878	57	0.1574585635359116	302	0.527972027972028	168	0.22163588390501318	g	0.009	-1.801153	0.00611	0.078601	0.209448	ENSG00000179008	ENST00000321731	T	0.22134	1.97	5.68	-1.88	0.07713	.	1.276350	0.05272	N	0.517772	T	0.00012	0.0000	N	0.01267	-0.92	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.45745	-0.9240	9	0.13108	T	0.6	2.3088	10.289	0.43584	0.4884:0.0:0.5116:0.0	rs12586711;rs12586711	306	Q8N1H7	S6OS1_HUMAN	V	306	ENSP00000324920:A306V	ENSP00000324920:A306V	A	-	2	0	C14orf39	60002505	0.000000	0.05858	0.025000	0.17156	0.142000	0.21351	0.038000	0.13862	-0.110000	0.12022	-1.068000	0.02270	GCG	G|0.800;A|0.200		0.313	C14orf39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276948.1	NM_174978	
SPTB	6710	bcgsc.ca	37	14	65242044	65242044	+	Silent	SNP	C	C	T	rs184528	byFrequency	TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr14:65242044C>T	ENST00000389721.5	-	22	4673	c.4641G>A	c.(4639-4641)gcG>gcA	p.A1547A	SPTB_ENST00000389722.3_Silent_p.A1547A|SPTB_ENST00000389720.3_Silent_p.A1547A|SPTB_ENST00000556626.1_Silent_p.A1547A|SPTB_ENST00000542895.1_Silent_p.A1547A	NM_000347.5	NP_000338.3	P11277	SPTB1_HUMAN	spectrin, beta, erythrocytic	1547					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ankyrin binding (GO:0030506)|structural constituent of cytoskeleton (GO:0005200)			breast(5)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(36)|ovary(8)|pancreas(1)|prostate(4)|skin(10)|urinary_tract(3)	106		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		CGATCTCCGCCGCCTCCACCA	0.672													C|||	2064	0.412141	0.7746	0.2493	5008	,	,		19430	0.3671		0.1938	False		,,,				2504	0.3088				p.A1547A		.											.	SPTB-100	0			c.G4641A						.	C	,	2996,1410	675.0+/-403.0	1028,940,235	32.0	26.0	28.0		4641,4641	-5.0	0.0	14	dbSNP_79	28	1518,7082	281.7+/-295.2	114,1290,2896	no	coding-synonymous,coding-synonymous	SPTB	NM_000347.5,NM_001024858.2	,	1142,2230,3131	TT,TC,CC		17.6512,32.0018,34.7071	,	1547/2138,1547/2329	65242044	4514,8492	2203	4300	6503	SO:0001819	synonymous_variant	6710	exon22			CTCCGCCGCCTCC		CCDS32099.1, CCDS32100.1	14q24.1-q24.2	2013-01-10	2008-07-29			ENSG00000070182		"""Pleckstrin homology (PH) domain containing"""	11274	protein-coding gene	gene with protein product	"""spherocytosis, clinical type I"""	182870				2209094	Standard	NM_001024858		Approved		uc001xhr.3	P11277		ENST00000389721.5:c.4641G>A	14.37:g.65242044C>T		Somatic	128	1		WXS	Illumina GAIIx	Phase_I	121	6	NM_000347	0	0	0	0	0	Q15510|Q15519	Silent	SNP	ENST00000389721.5	37	CCDS32100.1																																																																																			C|0.642;T|0.358		0.672	SPTB-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000414080.1		
CKB	1152	hgsc.bcm.edu	37	14	103988180	103988180	+	Silent	SNP	G	G	T	rs1136165	byFrequency	TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr14:103988180G>T	ENST00000348956.2	-	4	813	c.456C>A	c.(454-456)cgC>cgA	p.R152R		NM_001823.4	NP_001814.2	P12277	KCRB_HUMAN	creatine kinase, brain	152	Phosphagen kinase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00843}.				cellular chloride ion homeostasis (GO:0030644)|cellular nitrogen compound metabolic process (GO:0034641)|creatine metabolic process (GO:0006600)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|creatine kinase activity (GO:0004111)			lung(2)|prostate(1)	3		Melanoma(154;0.155)	Epithelial(46;0.14)		Creatine(DB00148)	TCTCGATGGCGCGGCGCTCCC	0.756													G|||	3294	0.657748	0.5416	0.7349	5008	,	,		7060	0.8264		0.6233	False		,,,				2504	0.6217				p.R152R	Esophageal Squamous(186;2492 2823 49929 50127)	.											.	CKB-115	0			c.C456A						.	G		1738,1164		574,590,287	3.0	4.0	3.0		456	-0.0	1.0	14	dbSNP_86	3	4002,2154		1387,1228,463	no	coding-synonymous	CKB	NM_001823.3		1961,1818,750	TT,TG,GG		34.9903,40.1103,36.6306		152/382	103988180	5740,3318	1451	3078	4529	SO:0001819	synonymous_variant	1152	exon4			GATGGCGCGGCGC		CCDS9981.1	14q32.32	2012-10-02			ENSG00000166165	ENSG00000166165	2.7.3.2		1991	protein-coding gene	gene with protein product		123280		CKBB			Standard	NM_001823		Approved		uc001ynf.2	P12277	OTTHUMG00000171786	ENST00000348956.2:c.456C>A	14.37:g.103988180G>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_001823	0	0	0	0	0	A8K236|B2R5R4|Q2LE07|Q6FG40|Q9UC66	Silent	SNP	ENST00000348956.2	37	CCDS9981.1	1462	0.6694139194139194	285	0.5792682926829268	250	0.6906077348066298	460	0.8041958041958042	467	0.6160949868073878	G	13.11	2.138272	0.37728	0.598897	0.650097	ENSG00000166165	ENST00000428256	.	.	.	4.64	-0.0349	0.13894	.	0.000000	0.85682	D	0.000000	T	0.00012	0.0000	.	.	.	0.09310	P	0.9999999999999624	.	.	.	.	.	.	T	0.17592	-1.0364	5	0.41790	T	0.15	-18.9304	4.9837	0.14180	0.3841:0.2745:0.3414:0.0	rs1136165;rs2227867;rs2765044;rs3179077;rs3199393;rs17366340;rs17423634;rs17849441;rs17850309;rs17850603;rs17851735;rs17851741;rs17857802	.	.	.	S	118	.	ENSP00000395515:R118S	R	-	1	0	CKB	103057933	0.001000	0.12720	0.999000	0.59377	0.996000	0.88848	-2.081000	0.01367	0.066000	0.16515	0.449000	0.29647	CGC	G|0.327;T|0.673		0.756	CKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415111.1		
KIF26A	26153	hgsc.bcm.edu	37	14	104644099	104644099	+	Silent	SNP	T	T	C	rs2497297	byFrequency	TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr14:104644099T>C	ENST00000423312.2	+	12	4974	c.4974T>C	c.(4972-4974)agT>agC	p.S1658S	KIF26A_ENST00000315264.7_Silent_p.S1519S	NM_015656.1	NP_056471.1	Q9ULI4	KI26A_HUMAN	kinesin family member 26A	1658					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|enteric nervous system development (GO:0048484)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of signal transduction (GO:0009968)|regulation of cell growth by extracellular stimulus (GO:0001560)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	21		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0767)	Epithelial(46;0.152)	Epithelial(152;0.161)		GTGGCAGCAGTGGCTATGAGA	0.711													C|||	2031	0.405551	0.5764	0.2911	5008	,	,		13449	0.3185		0.3718	False		,,,				2504	0.3804				p.S1658S		.											.	KIF26A-24	0			c.T4974C						.	C		1381,1865		360,661,602	3.0	4.0	4.0		4974	-0.8	1.0	14	dbSNP_100	4	2221,5011		464,1293,1859	no	coding-synonymous	KIF26A	NM_015656.1		824,1954,2461	CC,CT,TT		30.7107,42.5447,34.3768		1658/1883	104644099	3602,6876	1623	3616	5239	SO:0001819	synonymous_variant	26153	exon12			CAGCAGTGGCTAT	AB033062	CCDS45171.1	14q32.33	2009-03-19			ENSG00000066735	ENSG00000066735		"""Kinesins"""	20226	protein-coding gene	gene with protein product		613231				10574462, 11416179	Standard	NM_015656		Approved	KIAA1236, DKFZP434N178	uc001yos.4	Q9ULI4	OTTHUMG00000154986	ENST00000423312.2:c.4974T>C	14.37:g.104644099T>C		Somatic	4	0		WXS	Illumina GAIIx	Phase_I	12	10	NM_015656	0	0	0	0	0	Q8TAZ7|Q96GK3|Q9UFL3	Silent	SNP	ENST00000423312.2	37	CCDS45171.1																																																																																			T|0.603;C|0.397		0.711	KIF26A-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414356.1		
TYRO3	7301	bcgsc.ca	37	15	41862356	41862356	+	Splice_Site	SNP	T	T	C	rs149022093		TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr15:41862356T>C	ENST00000263798.3	+	10	1606		c.e10+2		TYRO3_ENST00000559066.1_Splice_Site	NM_006293.3	NP_006284.2	Q06418	TYRO3_HUMAN	TYRO3 protein tyrosine kinase						apoptotic cell clearance (GO:0043277)|cell adhesion (GO:0007155)|forebrain cell migration (GO:0021885)|natural killer cell differentiation (GO:0001779)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of lymphocyte activation (GO:0051250)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|neuron cellular homeostasis (GO:0070050)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol 3-kinase signaling (GO:0014065)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|protein autophosphorylation (GO:0046777)|protein kinase B signaling (GO:0043491)|secretion by cell (GO:0032940)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(26)|ovary(3)|prostate(1)	43		all_cancers(109;7.33e-15)|all_epithelial(112;2.8e-12)|Lung NSC(122;3.48e-08)|all_lung(180;1.71e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.31e-18)|GBM - Glioblastoma multiforme(113;9.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.117)		GCGGTTTGGGTAAGGGGATGG	0.567																																					.		.											.	TYRO3-1388	0			c.1382+2T>C						.						76.0	75.0	75.0					15																	41862356		2203	4300	6503	SO:0001630	splice_region_variant	7301	exon10			TTTGGGTAAGGGG	D50479	CCDS10080.1	15q15.1-q21.1	2013-02-11			ENSG00000092445	ENSG00000092445	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12446	protein-coding gene	gene with protein product		600341		RSE		7851890	Standard	NM_006293		Approved	Dtk, Brt, Tif, Sky	uc001zof.2	Q06418	OTTHUMG00000130341	ENST00000263798.3:c.1382+2T>C	15.37:g.41862356T>C		Somatic	151	2		WXS	Illumina GAIIx	Phase_I	106	8	NM_006293	0	0	0	0	0	O14953|Q86VR3	Splice_Site	SNP	ENST00000263798.3	37	CCDS10080.1	.	.	.	.	.	.	.	.	.	.	T	21.7	4.181954	0.78677	.	.	ENSG00000092445	ENST00000540218;ENST00000263798	.	.	.	5.26	5.26	0.73747	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.3401	0.74290	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	TYRO3	39649648	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	6.789000	0.75110	2.208000	0.71279	0.533000	0.62120	.	T|0.999;C|0.001		0.567	TYRO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252693.2		Intron
MEFV	4210	hgsc.bcm.edu	37	16	3304573	3304573	+	Silent	SNP	G	G	T	rs224223	byFrequency	TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr16:3304573G>T	ENST00000219596.1	-	2	534	c.495C>A	c.(493-495)gcC>gcA	p.A165A	MEFV_ENST00000536379.1_Intron|MEFV_ENST00000541159.1_Intron|MEFV_ENST00000339854.4_Intron	NM_000243.2	NP_000234.1	O15553	MEFV_HUMAN	Mediterranean fever	165					inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of macrophage inflammatory protein 1 alpha production (GO:0071641)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity (GO:2001056)	cell projection (GO:0042995)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)	p.A165A(2)		NS(2)|biliary_tract(1)|breast(5)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(3)|prostate(1)|skin(6)	50						GGCCCTCCGAGGCCTTCTCTC	0.766													G|||	1935	0.386382	0.528	0.5965	5008	,	,		10896	0.1667		0.4732	False		,,,				2504	0.183				p.A165A		.											.	MEFV-228	2	Substitution - coding silent(2)	prostate(2)	c.C495A						.	G	,	2112,2188		580,952,618	7.0	7.0	7.0		495,	2.9	0.0	16	dbSNP_79	7	3826,4590		964,1898,1346	no	coding-synonymous,intron	MEFV	NM_000243.2,NM_001198536.1	,	1544,2850,1964	TT,TG,GG		45.461,49.1163,46.6971	,	165/782,	3304573	5938,6778	2150	4208	6358	SO:0001819	synonymous_variant	4210	exon2			CTCCGAGGCCTTC	AF018080	CCDS10498.1, CCDS55981.1	16p13.3	2014-09-17			ENSG00000103313	ENSG00000103313		"""Tripartite motif containing / Tripartite motif containing"""	6998	protein-coding gene	gene with protein product	"""pyrin"""	608107		MEF		9288094	Standard	NM_000243		Approved	FMF, TRIM20	uc002cun.1	O15553	OTTHUMG00000129324	ENST00000219596.1:c.495C>A	16.37:g.3304573G>T		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	10	6	NM_000243	0	0	0	0	0	D3DUC0|F5H0Q3|Q3MJ84|Q96PN4|Q96PN5	Silent	SNP	ENST00000219596.1	37	CCDS10498.1																																																																																			G|0.570;T|0.430		0.766	MEFV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251464.1	NM_000243	
NAGPA	51172	broad.mit.edu	37	16	5083340	5083340	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr16:5083340A>C	ENST00000312251.3	-	2	495	c.476T>G	c.(475-477)gTg>gGg	p.V159G	ALG1_ENST00000588623.1_5'Flank|RP11-165E7.1_ENST00000588778.1_RNA|NAGPA_ENST00000381955.3_Missense_Mutation_p.V159G|NAGPA_ENST00000564922.1_Splice_Site	NM_016256.3	NP_057340.2	Q9UK23	NAGPA_HUMAN	N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase	159					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|lysosome organization (GO:0007040)|protein glycosylation (GO:0006486)|protein targeting to lysosome (GO:0006622)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase activity (GO:0003944)			endometrium(4)|large_intestine(4)|lung(3)|urinary_tract(1)	12					N-Acetyl-D-glucosamine(DB00141)	GGAGCTGCTCACCCGCCGCTC	0.731																																					p.V159G		.											.	NAGPA-90	0			c.T476G						.																																			SO:0001583	missense	51172	exon2			CTGCTCACCCGCC	AF187072	CCDS10527.1	16p13.3	2008-02-05			ENSG00000103174	ENSG00000103174	3.1.4.45		17378	protein-coding gene	gene with protein product		607985				10551838, 12058031	Standard	NM_016256		Approved	APAA, UCE	uc002cyg.3	Q9UK23	OTTHUMG00000090515	ENST00000312251.3:c.476T>G	16.37:g.5083340A>C	ENSP00000310998:p.Val159Gly	Somatic	30	6		WXS	Illumina GAIIx	Phase_I	37	11	NM_016256	0	0	0	0	0	B2RAS1|Q96EJ8	Missense_Mutation	SNP	ENST00000312251.3	37	CCDS10527.1	.	.	.	.	.	.	.	.	.	.	A	22.3	4.278032	0.80692	.	.	ENSG00000103174	ENST00000312251;ENST00000381955	T;T	0.37915	1.17;1.38	4.63	4.63	0.57726	.	0.000000	0.85682	D	0.000000	T	0.62816	0.2459	M	0.85197	2.74	0.80722	D	1	B;D	0.89917	0.281;1.0	B;D	0.87578	0.207;0.998	T	0.69537	-0.5119	10	0.87932	D	0	-14.8423	12.615	0.56571	1.0:0.0:0.0:0.0	.	159;159	Q9UK23;Q9UK23-2	NAGPA_HUMAN;.	G	159	ENSP00000310998:V159G;ENSP00000371381:V159G	ENSP00000310998:V159G	V	-	2	0	NAGPA	5023341	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	8.538000	0.90634	1.704000	0.51252	0.455000	0.32223	GTG	.		0.731	NAGPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207003.1	NM_016256	
ZFPM1	161882	hgsc.bcm.edu	37	16	88599697	88599705	+	In_Frame_Del	DEL	AGCCTCTGG	AGCCTCTGG	-	rs67873604|rs149145771|rs368520732|rs67322929|rs201915453|rs67712719	byFrequency	TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10	AGCCTCTGG	AGCCTCTGG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr16:88599697_88599705delAGCCTCTGG	ENST00000319555.3	+	10	1653_1661	c.1331_1339delAGCCTCTGG	c.(1330-1341)gagcctctggcc>gcc	p.EPL444del	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	444				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GCCAGAGCGGAGCCTCTGGCCCAGAATGG	0.746																																					p.444_447del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1331_1339del						.																																			SO:0001651	inframe_deletion	161882	exon10			GAGCGGAGCCTCT	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1331_1339delAGCCTCTGG	16.37:g.88599697_88599705delAGCCTCTGG	ENSP00000326630:p.Glu444_Leu446del	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	21	0	NM_153813	0	0	0	0	0		In_Frame_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.746	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
TBC1D29	26083	bcgsc.ca	37	17	28887667	28887667	+	Silent	SNP	T	T	C	rs78888987	byFrequency	TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr17:28887667T>C	ENST00000580161.1	+	4	2608	c.111T>C	c.(109-111)gaT>gaC	p.D37D	TBC1D29_ENST00000579181.1_Silent_p.D37D|TBC1D29_ENST00000584297.1_Silent_p.D37D|RP11-218M11.6_ENST00000582125.1_RNA			Q9UFV1	TBC29_HUMAN	TBC1 domain family, member 29	37	Rab-GAP TBC; truncated. {ECO:0000255|PROSITE-ProRule:PRU00163}.						Rab GTPase activator activity (GO:0005097)	p.D37D(1)		breast(1)|kidney(1)|lung(3)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	9		Myeloproliferative disorder(56;0.0255)				GCCTGTGGGATATGTATTTGC	0.572																																					p.D37D		.											.	TBC1D29-22	1	Substitution - coding silent(1)	lung(1)	c.T111C						.						149.0	126.0	134.0					17																	28887667		2203	4300	6503	SO:0001819	synonymous_variant	26083	exon3			GTGGGATATGTAT	BC096718	CCDS32606.1	17q11.2	2014-09-04			ENSG00000266733	ENSG00000266733			24509	protein-coding gene	gene with protein product						12618308	Standard	XM_006721805		Approved	DKFZP434O047	uc002hfh.3	Q9UFV1	OTTHUMG00000178857	ENST00000580161.1:c.111T>C	17.37:g.28887667T>C		Somatic	108	2		WXS	Illumina GAIIx	Phase_I	171	17	NM_015594	0	0	0	0	0		Silent	SNP	ENST00000580161.1	37	CCDS32606.1																																																																																			T|0.934;C|0.066		0.572	TBC1D29-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443632.1	NM_015594	
C17orf96	100170841	hgsc.bcm.edu	37	17	36830562	36830562	+	Missense_Mutation	SNP	G	G	C	rs79676758	byFrequency	TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr17:36830562G>C	ENST00000325814.5	-	1	625	c.187C>G	c.(187-189)Ctg>Gtg	p.L63V		NM_001130677.1	NP_001124149.1	A6NHQ4	CQ096_HUMAN	chromosome 17 open reading frame 96	63	Pro-rich.				neuron fate commitment (GO:0048663)												CGCGCCGCCAGCTCCCCAGGC	0.766													G|||	965	0.192692	0.2693	0.1239	5008	,	,		11134	0.2004		0.1779	False		,,,				2504	0.1452				p.L63V		.											.	.	0			c.C187G						.						1.0	2.0	2.0					17																	36830562		328	928	1256	SO:0001583	missense	100170841	exon1			CCGCCAGCTCCCC		CCDS45661.1	17q12	2014-04-17			ENSG00000179294	ENSG00000273604			34493	protein-coding gene	gene with protein product	"""proline rich 28"""					24550272	Standard	NM_001130677		Approved	LOC100170841, PRR28	uc010wdq.2	A6NHQ4	OTTHUMG00000188495	ENST00000325814.5:c.187C>G	17.37:g.36830562G>C	ENSP00000317905:p.Leu63Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	5	NM_001130677	0	0	0	0	0		Missense_Mutation	SNP	ENST00000325814.5	37	CCDS45661.1	383	0.17536630036630035	117	0.23780487804878048	48	0.13259668508287292	93	0.16258741258741258	125	0.16490765171503957	G	13.17	2.158099	0.38119	.	.	ENSG00000179294	ENST00000325814	.	.	.	3.48	3.48	0.39840	.	.	.	.	.	T	0.00012	0.0000	N	0.24115	0.695	0.39035	P	0.03997899999999999	P	0.50443	0.935	P	0.46479	0.518	T	0.10847	-1.0612	7	0.87932	D	0	.	10.799	0.46476	0.0:0.0:1.0:0.0	.	63	A6NHQ4	CQ096_HUMAN	V	63	.	ENSP00000317905:L63V	L	-	1	2	C17orf96	34084088	0.995000	0.38212	0.991000	0.47740	0.004000	0.04260	0.513000	0.22770	1.657000	0.50732	0.462000	0.41574	CTG	G|0.824;C|0.176		0.766	C17orf96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255465.2	NM_001130677	
KRTAP4-11	653240	bcgsc.ca	37	17	39274087	39274087	+	Missense_Mutation	SNP	G	G	C	rs141357429		TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr17:39274087G>C	ENST00000391413.2	-	1	519	c.481C>G	c.(481-483)Ctg>Gtg	p.L161V		NM_033059.3	NP_149048.2	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	161	27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].					keratin filament (GO:0045095)		p.L161V(1)		endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(8)|prostate(5)|skin(1)	33		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			ACTGGACGCAGGcagcagcag	0.657																																					p.L161V		.											.	.	1	Substitution - Missense(1)	prostate(1)	c.C481G						.						17.0	21.0	20.0					17																	39274087		692	1589	2281	SO:0001583	missense	653240	exon1			GACGCAGGCAGCA	AC025904	CCDS45675.1	17q21.2	2013-06-25			ENSG00000212721	ENSG00000212721		"""Keratin associated proteins"""	18911	protein-coding gene	gene with protein product			"""keratin associated protein 4-14"""	KRTAP4-14			Standard	NM_033059		Approved	KAP4.11, KAP4.14	uc002hvz.3	Q9BYQ6	OTTHUMG00000133586	ENST00000391413.2:c.481C>G	17.37:g.39274087G>C	ENSP00000375232:p.Leu161Val	Somatic	144	4		WXS	Illumina GAIIx	Phase_I	198	28	NM_033059	0	0	0	0	0	A0AUY2	Missense_Mutation	SNP	ENST00000391413.2	37	CCDS45675.1	249	0.11401098901098901	67	0.13617886178861788	40	0.11049723756906077	104	0.18181818181818182	38	0.05013192612137203	.	1.347	-0.592411	0.03799	.	.	ENSG00000212721	ENST00000391413	T	0.00614	6.21	4.35	0.986	0.19784	.	.	.	.	.	T	0.00012	0.0000	L	0.31752	0.955	0.80722	P	0.0	B	0.30068	0.267	B	0.18871	0.023	T	0.19063	-1.0317	8	0.11794	T	0.64	.	5.8913	0.18915	0.1751:0.0:0.6569:0.168	.	161	Q9BYQ6	KR411_HUMAN	V	161	ENSP00000375232:L161V	ENSP00000375232:L161V	L	-	1	2	KRTAP4-11	36527613	0.671000	0.27521	0.912000	0.35992	0.970000	0.65996	0.971000	0.29396	0.348000	0.23949	0.609000	0.83330	CTG	G|0.500;C|0.500		0.657	KRTAP4-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257690.1		
BPTF	2186	bcgsc.ca	37	17	65955758	65955758	+	Silent	SNP	T	T	C	rs139709271|rs202116659		TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr17:65955758T>C	ENST00000321892.4	+	26	8467	c.8406T>C	c.(8404-8406)gcT>gcC	p.A2802A	BPTF_ENST00000424123.3_Silent_p.A2520A|BPTF_ENST00000335221.5_Silent_p.A2659A|BPTF_ENST00000306378.6_Silent_p.A2676A			Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	2802	Pro-rich.			AP -> VL (in Ref. 1; BAA89208). {ECO:0000305}.	anterior/posterior pattern specification (GO:0009952)|ATP catabolic process (GO:0006200)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|embryonic placenta development (GO:0001892)|endoderm development (GO:0007492)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NURF complex (GO:0016589)	sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.A2676A(1)|p.A2659A(1)		NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(23)|ovary(3)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	78	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			TGACAccagctcctccagccc	0.582																																					p.A2676A		.											.	BPTF-94	2	Substitution - coding silent(2)	large_intestine(2)	c.T8028C						.						40.0	33.0	36.0					17																	65955758		2203	4300	6503	SO:0001819	synonymous_variant	2186	exon24			ACCAGCTCCTCCA	AY282495	CCDS11673.1	17q24	2013-01-28	2006-12-01	2006-12-01	ENSG00000171634	ENSG00000171634		"""Zinc fingers, PHD-type"""	3581	protein-coding gene	gene with protein product		601819	"""fetal Alzheimer antigen"""	FALZ		8975731, 10662542, 16728976	Standard	NM_182641		Approved	FAC1, NURF301	uc002jgf.3	Q12830	OTTHUMG00000132254	ENST00000321892.4:c.8406T>C	17.37:g.65955758T>C		Somatic	84	1		WXS	Illumina GAIIx	Phase_I	86	9	NM_182641	0	0	0	0	0	Q6NX67|Q7Z7D6|Q9UIG2	Silent	SNP	ENST00000321892.4	37																																																																																				.		0.582	BPTF-201	KNOWN	basic	protein_coding	protein_coding		NM_182641, NM_004459	
SEPT9	10801	broad.mit.edu	37	17	75483522	75483522	+	Silent	SNP	T	T	G			TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr17:75483522T>G	ENST00000427177.1	+	5	1056	c.930T>G	c.(928-930)ggT>ggG	p.G310G	SEPT9_ENST00000329047.8_Silent_p.G292G|SEPT9_ENST00000591198.1_Silent_p.G291G|SEPT9_ENST00000591088.1_Silent_p.G59G|SEPT9_ENST00000541152.2_Silent_p.G59G|SEPT9_ENST00000592481.1_3'UTR|SEPT9_ENST00000590294.1_Silent_p.G292G|SEPT9_ENST00000427180.1_Silent_p.G198G|SEPT9_ENST00000449803.2_Silent_p.G146G|SEPT9_ENST00000427674.2_Silent_p.G146G|SEPT9_ENST00000588690.1_Silent_p.G146G|SEPT9_ENST00000431235.2_Silent_p.G146G|SEPT9_ENST00000585930.1_Silent_p.G86G|SEPT9_ENST00000590917.1_Nonstop_Mutation_p.*58E|SEPT9_ENST00000592951.1_Silent_p.G59G|SEPT9_ENST00000423034.2_Silent_p.G303G	NM_001113491.1	NP_001106963.1	Q9UHD8	SEPT9_HUMAN	septin 9	310	Septin-type G.				cell cycle (GO:0007049)|cell division (GO:0051301)|GTP catabolic process (GO:0006184)|protein heterooligomerization (GO:0051291)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|perinuclear region of cytoplasm (GO:0048471)|stress fiber (GO:0001725)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			autonomic_ganglia(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(2)|ovary(1)|pancreas(1)|prostate(2)	16			BRCA - Breast invasive adenocarcinoma(99;0.153)			GCGGCTTGGGTAAATCCACCT	0.607																																					p.G310G		.											.	SEPT9-659	0			c.T930G						.						41.0	44.0	43.0					17																	75483522		2022	4171	6193	SO:0001819	synonymous_variant	10801	exon5			CTTGGGTAAATCC	AB023208	CCDS45790.1, CCDS45791.1, CCDS45792.1, CCDS45793.1, CCDS45794.1, CCDS45795.1, CCDS74166.1	17q25.3	2014-09-17	2005-01-11	2005-01-12	ENSG00000184640	ENSG00000184640		"""Septins"""	7323	protein-coding gene	gene with protein product	"""Ov/Br septin"""	604061	"""MLL septin-like fusion"""	MSF		10339604, 10485469	Standard	NM_006640		Approved	MSF1, KIAA0991, PNUTL4, AF17q25, SeptD1	uc002jts.4	Q9UHD8		ENST00000427177.1:c.930T>G	17.37:g.75483522T>G		Somatic	184	10		WXS	Illumina GAIIx	Phase_I	216	26	NM_001113491	0	0	0	0	0	A8K2V3|B3KPM0|B4DTL9|B4E0N2|B4E274|B7Z654|Q96QF3|Q96QF4|Q96QF5|Q9HA04|Q9UG40|Q9Y5W4	Silent	SNP	ENST00000427177.1	37	CCDS45790.1																																																																																			.		0.607	SEPT9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000436304.2	NM_006640	
AATK	9625	hgsc.bcm.edu	37	17	79096115	79096115	+	Missense_Mutation	SNP	C	C	T	rs61738821	byFrequency	TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr17:79096115C>T	ENST00000326724.4	-	11	1645	c.1621G>A	c.(1621-1623)Gcc>Acc	p.A541T	AATK_ENST00000417379.1_Missense_Mutation_p.A438T|AATK_ENST00000572339.1_5'Flank|MIR657_ENST00000385003.1_RNA	NM_001080395.2	NP_001073864.2	Q6ZMQ8	LMTK1_HUMAN	apoptosis-associated tyrosine kinase	541				A -> T (in Ref. 1; BAD18544). {ECO:0000305}.	brain development (GO:0007420)|negative regulation of axon extension (GO:0030517)|neuron apoptotic process (GO:0051402)|peptidyl-tyrosine autophosphorylation (GO:0038083)|Rab protein signal transduction (GO:0032482)	axonal growth cone (GO:0044295)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			endometrium(2)|kidney(2)|lung(8)|ovary(3)|prostate(1)|stomach(4)|upper_aerodigestive_tract(1)	21	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			TCGTGGCCGGCGGCGGGTGCG	0.756													C|||	710	0.141773	0.2451	0.0836	5008	,	,		7975	0.0337		0.1342	False		,,,				2504	0.1626				p.A541T		.											.	AATK-933	0			c.G1621A						.						2.0	2.0	2.0					17																	79096115		1391	2783	4174	SO:0001583	missense	9625	exon11			GGCCGGCGGCGGG	AB014541	CCDS45807.1, CCDS58607.1	17q25.3	2014-06-12			ENSG00000181409	ENSG00000181409			21	protein-coding gene	gene with protein product	"""lemur tyrosine kinase 1"", ""protein phosphatase 1, regulatory subunit 77"""	605276				9734811, 10083745	Standard	NM_001080395		Approved	AATYK, KIAA0641, LMTK1, LMR1, AATYK1, PPP1R77	uc010dia.3	Q6ZMQ8	OTTHUMG00000132717	ENST00000326724.4:c.1621G>A	17.37:g.79096115C>T	ENSP00000324196:p.Ala541Thr	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	7	NM_001080395	0	0	0	0	0	O75136|Q6ZN31|Q86X28	Missense_Mutation	SNP	ENST00000326724.4	37	CCDS45807.1	322	0.14743589743589744	149	0.30284552845528456	49	0.13535911602209943	11	0.019230769230769232	113	0.14907651715039577	C	10.34	1.324257	0.24080	.	.	ENSG00000181409	ENST00000326724;ENST00000374792	T;T	0.77489	-1.1;-1.09	4.26	3.26	0.37387	.	0.388682	0.24547	N	0.037589	T	0.00012	0.0000	L	0.48642	1.525	0.80722	P	0.0	P	0.45986	0.87	B	0.27608	0.081	T	0.05716	-1.0868	9	0.29301	T	0.29	.	11.2582	0.49067	0.1833:0.8167:0.0:0.0	rs61738821	541	Q6ZMQ8	LMTK1_HUMAN	T	541;505	ENSP00000324196:A541T;ENSP00000363924:A505T	ENSP00000324196:A541T	A	-	1	0	AATK	76710710	0.009000	0.17119	0.030000	0.17652	0.032000	0.12392	0.876000	0.28092	0.731000	0.32448	0.561000	0.74099	GCC	C|0.850;T|0.150		0.756	AATK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256055.1	NM_004920	
PTPN2	5771	broad.mit.edu	37	18	12794285	12794285	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr18:12794285C>A	ENST00000309660.5	-	9	1333	c.1240G>T	c.(1240-1242)Gcc>Tcc	p.A414S	PTPN2_ENST00000327283.3_Intron|PTPN2_ENST00000591497.1_Missense_Mutation_p.A385S|PTPN2_ENST00000353319.4_Intron|PTPN2_ENST00000591115.1_Intron	NM_002828.3	NP_002819.2	P17706	PTN2_HUMAN	protein tyrosine phosphatase, non-receptor type 2	414	Endoplasmic reticulum location.|Mediates interaction with STX17.				B cell differentiation (GO:0030183)|cytokine-mediated signaling pathway (GO:0019221)|erythrocyte differentiation (GO:0030218)|glucose homeostasis (GO:0042593)|insulin receptor signaling pathway (GO:0008286)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemotaxis (GO:0050922)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of inflammatory response (GO:0050728)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of interleukin-2-mediated signaling pathway (GO:1902206)|negative regulation of interleukin-4-mediated signaling pathway (GO:1902215)|negative regulation of interleukin-6-mediated signaling pathway (GO:0070104)|negative regulation of lipid storage (GO:0010888)|negative regulation of macrophage colony-stimulating factor signaling pathway (GO:1902227)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of positive thymic T cell selection (GO:1902233)|negative regulation of prolactin signaling pathway (GO:1902212)|negative regulation of T cell receptor signaling pathway (GO:0050860)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|negative regulation of tyrosine phosphorylation of Stat1 protein (GO:0042512)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|negative regulation of tyrosine phosphorylation of Stat5 protein (GO:0042524)|negative regulation of tyrosine phosphorylation of Stat6 protein (GO:0042527)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of gluconeogenesis (GO:0045722)|regulation of hepatocyte growth factor receptor signaling pathway (GO:1902202)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|T cell differentiation (GO:0030217)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|receptor tyrosine kinase binding (GO:0030971)|syntaxin binding (GO:0019905)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(2)|prostate(1)|skin(3)	13		Lung NSC(161;8.94e-06)				GTTTATAGGGCATTTTGCTGA	0.418																																					p.A414S		.											.	PTPN2-652	0			c.G1240T						.						94.0	84.0	87.0					18																	12794285		2203	4300	6503	SO:0001583	missense	5771	exon9			ATAGGGCATTTTG	M25393	CCDS11863.1, CCDS11864.1, CCDS11865.1, CCDS59306.1	18p11.3-p11.2	2011-06-09			ENSG00000175354	ENSG00000175354		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9650	protein-coding gene	gene with protein product		176887		PTPT		2164224	Standard	NM_002828		Approved	TCELLPTP, TC-PTP, TCPTP	uc002krp.3	P17706	OTTHUMG00000131702	ENST00000309660.5:c.1240G>T	18.37:g.12794285C>A	ENSP00000311857:p.Ala414Ser	Somatic	69	1		WXS	Illumina GAIIx	Phase_I	83	8	NM_002828	0	0	0	0	0	A8K955|A8MXU3|K7ENG3|Q96AU5|Q96HR2	Missense_Mutation	SNP	ENST00000309660.5	37	CCDS11865.1	.	.	.	.	.	.	.	.	.	.	C	0.006	-2.051055	0.00394	.	.	ENSG00000175354	ENST00000341361;ENST00000309660	T	0.03982	3.74	5.64	0.701	0.18104	.	.	.	.	.	T	0.02267	0.0070	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.45789	-0.9237	9	0.54805	T	0.06	.	0.6337	0.00799	0.2272:0.3402:0.1199:0.3127	.	414	P17706	PTN2_HUMAN	S	391;414	ENSP00000311857:A414S	ENSP00000311857:A414S	A	-	1	0	PTPN2	12784285	0.138000	0.22547	0.024000	0.17045	0.010000	0.07245	0.084000	0.14891	0.283000	0.22279	-0.244000	0.11960	GCC	.		0.418	PTPN2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254613.3	NM_002828, NM_080422, NM_080423	
DOT1L	84444	hgsc.bcm.edu	37	19	2226847	2226847	+	Missense_Mutation	SNP	G	G	T	rs113842228	byFrequency	TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr19:2226847G>T	ENST00000398665.3	+	27	4363	c.4327G>T	c.(4327-4329)Ggc>Tgc	p.G1443C		NM_032482.2	NP_115871.1	Q8TEK3	DOT1L_HUMAN	DOT1-like histone H3K79 methyltransferase	1443					histone lysine methylation (GO:0034968)|regulation of JAK-STAT cascade (GO:0046425)|regulation of transcription regulatory region DNA binding (GO:2000677)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription factor binding (GO:0008134)			NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(2)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(9)	42		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CAGCGGCCCCGGCCTGGCCCC	0.756													G|||	84	0.0167732	0.0038	0.0231	5008	,	,		9311	0.0		0.0537	False		,,,				2504	0.0092				p.G1443C		.											.	DOT1L-132	0			c.G4327T						.	G	CYS/GLY	26,3442		0,26,1708	10.0	15.0	13.0		4327	2.3	0.3	19	dbSNP_132	13	448,7466		10,428,3519	no	missense	DOT1L	NM_032482.2	159	10,454,5227	TT,TG,GG		5.6609,0.7497,4.1645	probably-damaging	1443/1538	2226847	474,10908	1734	3957	5691	SO:0001583	missense	84444	exon27			GGCCCCGGCCTGG	AF509504	CCDS42460.1	19p13.3	2013-05-21	2013-05-21		ENSG00000104885	ENSG00000104885	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"""	24948	protein-coding gene	gene with protein product	"""histone methyltransferase DOT1L"""	607375	"""DOT1-like, histone H3 methyltransferase (S. cerevisiae)"""			11347906, 12123582	Standard	NM_032482		Approved	KIAA1814, DOT1, KMT4	uc002lvb.4	Q8TEK3	OTTHUMG00000150431	ENST00000398665.3:c.4327G>T	19.37:g.2226847G>T	ENSP00000381657:p.Gly1443Cys	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	7	5	NM_032482	0	0	0	0	0	O60379|Q96JL1	Missense_Mutation	SNP	ENST00000398665.3	37	CCDS42460.1	54	0.024725274725274724	2	0.0040650406504065045	10	0.027624309392265192	0	0.0	42	0.055408970976253295	G	13.49	2.251444	0.39797	0.007497	0.056609	ENSG00000104885	ENST00000398665;ENST00000221482;ENST00000457590	T;T	0.36157	1.7;1.27	4.42	2.27	0.28462	.	0.254426	0.28140	N	0.016452	T	0.09202	0.0227	L	0.60455	1.87	0.31449	N	0.670931	D;D	0.89917	1.0;1.0	D;D	0.70716	0.97;0.969	T	0.26883	-1.0090	10	0.87932	D	0	-19.5441	7.0964	0.25311	0.2968:0.0:0.7031:0.0	.	1443;1443	Q8TEK3;Q8TEK3-2	DOT1L_HUMAN;.	C	1443;1443;323	ENSP00000381657:G1443C;ENSP00000407411:G323C	ENSP00000221482:G1443C	G	+	1	0	DOT1L	2177847	0.951000	0.32395	0.333000	0.25482	0.151000	0.21798	1.689000	0.37700	0.846000	0.35142	-0.258000	0.10820	GGC	G|0.970;T|0.030		0.756	DOT1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318066.1	NM_032482	
OR10H5	284433	bcgsc.ca	37	19	15905661	15905661	+	Missense_Mutation	SNP	C	C	A	rs67455341	byFrequency	TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr19:15905661C>A	ENST00000308940.8	+	1	901	c.803C>A	c.(802-804)tCt>tAt	p.S268Y		NM_001004466.1	NP_001004466.1	Q8NGA6	O10H5_HUMAN	olfactory receptor, family 10, subfamily H, member 5	268						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(9)|ovary(1)	20						GGTCCCCAGTCTCCGGAAGGA	0.577													.|||	1121	0.223842	0.3812	0.2565	5008	,	,		16995	0.002		0.2952	False		,,,				2504	0.1431				p.S268Y		.											.	OR10H5-69	0			c.C803A						.	C	TYR/SER	1626,2780		303,1020,880	114.0	93.0	100.0		803	2.7	0.0	19	dbSNP_130	100	2161,6439		294,1573,2433	no	missense	OR10H5	NM_001004466.1	144	597,2593,3313	AA,AC,CC		25.1279,36.9042,29.1173	possibly-damaging	268/316	15905661	3787,9219	2203	4300	6503	SO:0001583	missense	284433	exon1			CCCAGTCTCCGGA	AC011537	CCDS32940.1	19p13.12	2013-09-24			ENSG00000172519	ENSG00000172519		"""GPCR / Class A : Olfactory receptors"""	15389	protein-coding gene	gene with protein product							Standard	NM_001004466		Approved		uc010xos.2	Q8NGA6	OTTHUMG00000182284	ENST00000308940.8:c.803C>A	19.37:g.15905661C>A	ENSP00000310704:p.Ser268Tyr	Somatic	280	1		WXS	Illumina GAIIx	Phase_I	350	12	NM_001004466	0	0	0	0	0	Q6IFJ0|Q96R60	Missense_Mutation	SNP	ENST00000308940.8	37	CCDS32940.1	515	0.2358058608058608	177	0.3597560975609756	114	0.3149171270718232	1	0.0017482517482517483	223	0.2941952506596306	.	8.445	0.851648	0.17034	0.369042	0.251279	ENSG00000172519	ENST00000308940	T	0.00277	8.34	3.88	2.73	0.32206	GPCR, rhodopsin-like superfamily (1);	0.449535	0.18991	N	0.125583	T	0.00012	0.0000	M	0.85859	2.78	0.80722	P	0.0	D	0.53312	0.959	P	0.62649	0.905	T	0.36261	-0.9755	9	0.72032	D	0.01	.	9.6663	0.39986	0.0:0.6307:0.3693:0.0	.	268	Q8NGA6	O10H5_HUMAN	Y	268	ENSP00000310704:S268Y	ENSP00000310704:S268Y	S	+	2	0	OR10H5	15766661	0.000000	0.05858	0.019000	0.16419	0.035000	0.12851	0.184000	0.16939	1.878000	0.54408	0.585000	0.79938	TCT	C|0.733;A|0.267		0.577	OR10H5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460363.1		
ZNF626	199777	hgsc.bcm.edu;bcgsc.ca	37	19	20807300	20807300	+	Silent	SNP	A	A	G	rs4808252	byFrequency	TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr19:20807300A>G	ENST00000601440.1	-	4	1529	c.1383T>C	c.(1381-1383)gcT>gcC	p.A461A	CTC-513N18.7_ENST00000595094.1_lincRNA	NM_001076675.2	NP_001070143.1	Q68DY1	ZN626_HUMAN	zinc finger protein 626	461					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|lung(3)|skin(1)	6						AGCACTTAAAAGCTTTGCCAC	0.398													a|||	2084	0.416134	0.2511	0.4971	5008	,	,		9335	0.4415		0.5169	False		,,,				2504	0.4519				p.A461A		.											.	ZNF626-515	0			c.T1383C						.						39.0	19.0	25.0					19																	20807300		1888	3740	5628	SO:0001819	synonymous_variant	199777	exon4			CTTAAAAGCTTTG	BC007116	CCDS32976.1, CCDS42535.1	19p13.11	2013-01-08				ENSG00000188171		"""Zinc fingers, C2H2-type"", ""-"""	30461	protein-coding gene	gene with protein product						12477932	Standard	NM_145297		Approved		uc002npb.1	Q68DY1		ENST00000601440.1:c.1383T>C	19.37:g.20807300A>G		Somatic	34	0		WXS	Illumina GAIIx	Phase_I	29	4	NM_001076675	0	0	0	0	0	Q8N8T4|Q96QM1	Silent	SNP	ENST00000601440.1	37	CCDS42535.1																																																																																			A|0.500;G|0.500		0.398	ZNF626-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447845.2	NM_145297	
ZNF568	374900	broad.mit.edu	37	19	37441073	37441073	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr19:37441073G>T	ENST00000333987.7	+	7	1524	c.1018G>T	c.(1018-1020)Ggg>Tgg	p.G340W	ZNF568_ENST00000455427.2_Intron|ZNF568_ENST00000415168.1_Missense_Mutation_p.G276W|ZNF568_ENST00000427117.1_Intron	NM_001204835.1|NM_198539.3	NP_001191764.1|NP_940941.2	Q3ZCX4	ZN568_HUMAN	zinc finger protein 568	340					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(9)|ovary(1)	29	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TAAGGAATGTGGGAAATCCTT	0.398																																					p.G340W		.											.	ZNF568-136	0			c.G1018T						.						59.0	66.0	64.0					19																	37441073		2202	4296	6498	SO:0001583	missense	374900	exon7			GAATGTGGGAAAT	BX640681	CCDS42558.1, CCDS56092.1, CCDS56093.1, CCDS74351.1	19q13.12	2013-09-20			ENSG00000198453	ENSG00000198453		"""Zinc fingers, C2H2-type"", ""-"""	25392	protein-coding gene	gene with protein product							Standard	NM_198539		Approved	DKFZp686B0797	uc002ofc.3	Q3ZCX4	OTTHUMG00000048160	ENST00000333987.7:c.1018G>T	19.37:g.37441073G>T	ENSP00000334685:p.Gly340Trp	Somatic	47	0		WXS	Illumina GAIIx	Phase_I	96	4	NM_198539	0	0	0	0	0	B4DS92|E7ER33|Q6N060|Q8NA64	Missense_Mutation	SNP	ENST00000333987.7	37	CCDS42558.1	.	.	.	.	.	.	.	.	.	.	G	16.40	3.113185	0.56398	.	.	ENSG00000198453	ENST00000333987;ENST00000415168	T;T	0.08008	3.14;3.14	4.22	3.18	0.36537	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.208891	0.24222	N	0.040424	T	0.36166	0.0957	H	0.95004	3.61	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.41431	-0.9509	10	0.87932	D	0	.	9.8764	0.41207	0.1023:0.0:0.8977:0.0	.	340	Q3ZCX4	ZN568_HUMAN	W	340;276	ENSP00000334685:G340W;ENSP00000394514:G276W	ENSP00000334685:G340W	G	+	1	0	ZNF568	42132913	0.995000	0.38212	0.959000	0.39883	0.997000	0.91878	3.013000	0.49582	1.118000	0.41863	0.655000	0.94253	GGG	.		0.398	ZNF568-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109572.2	NM_198539	
FAM71E2	284418	hgsc.bcm.edu	37	19	55869899	55869899	+	Silent	SNP	T	T	G	rs386811061|rs67988285|rs67168196	byFrequency	TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr19:55869899T>G	ENST00000424985.3	-	9	2530	c.2337A>C	c.(2335-2337)ccA>ccC	p.P779P	CTD-2105E13.6_ENST00000591954.3_Missense_Mutation_p.H329P	NM_001145402.1	NP_001138874.1	Q8N5Q1	F71E2_HUMAN	family with sequence similarity 71, member E2	779			Missing (in dbSNP:rs35996821). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:17974005}.							NS(1)|breast(3)|endometrium(2)|kidney(1)|skin(1)	8						TCTCGCCCCATGGCTGCTCCT	0.632																																					p.P779P		.											.	.	0			c.A2337C						.						13.0	14.0	14.0					19																	55869899		683	1580	2263	SO:0001819	synonymous_variant	284418	exon9			GCCCCATGGCTGC	AL834316		19q13.42	2014-04-02	2007-11-20	2007-11-20	ENSG00000180043	ENSG00000180043			25278	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 16"""	C19orf16			Standard	NM_001145402		Approved	DKFZp434G1729	uc002qkr.2	Q8N5Q1	OTTHUMG00000170357	ENST00000424985.3:c.2337A>C	19.37:g.55869899T>G		Somatic	73	0		WXS	Illumina GAIIx	Phase_I	78	9	NM_001145402	0	0	0	0	0	Q8ND99	Silent	SNP	ENST00000424985.3	37																																																																																				.		0.632	FAM71E2-010	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000409063.4	NM_001145402	
FAM71E2	284418	hgsc.bcm.edu	37	19	55869902	55869902	+	Silent	SNP	C	C	T	rs386811061|rs67988285|rs67168196	byFrequency	TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr19:55869902C>T	ENST00000424985.3	-	9	2527	c.2334G>A	c.(2332-2334)caG>caA	p.Q778Q	CTD-2105E13.6_ENST00000591954.3_Missense_Mutation_p.S328N	NM_001145402.1	NP_001138874.1	Q8N5Q1	F71E2_HUMAN	family with sequence similarity 71, member E2	778			Missing (in dbSNP:rs35996821). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:17974005}.							NS(1)|breast(3)|endometrium(2)|kidney(1)|skin(1)	8						CGCCCCATGGCTGCTCCTTCA	0.632																																					p.Q778Q		.											.	.	0			c.G2334A						.						14.0	15.0	15.0					19																	55869902		682	1552	2234	SO:0001819	synonymous_variant	284418	exon9			CCATGGCTGCTCC	AL834316		19q13.42	2014-04-02	2007-11-20	2007-11-20	ENSG00000180043	ENSG00000180043			25278	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 16"""	C19orf16			Standard	NM_001145402		Approved	DKFZp434G1729	uc002qkr.2	Q8N5Q1	OTTHUMG00000170357	ENST00000424985.3:c.2334G>A	19.37:g.55869902C>T		Somatic	70	0		WXS	Illumina GAIIx	Phase_I	71	11	NM_001145402	0	0	0	0	0	Q8ND99	Silent	SNP	ENST00000424985.3	37																																																																																				.		0.632	FAM71E2-010	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000409063.4	NM_001145402	
ZNF814	730051	ucsc.edu;bcgsc.ca;mdanderson.org	37	19	58385748	58385748	+	Missense_Mutation	SNP	G	G	A	rs145250945		TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr19:58385748G>A	ENST00000435989.2	-	3	1244	c.1010C>T	c.(1009-1011)gCt>gTt	p.A337V	ZNF814_ENST00000600634.1_Intron|ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000597832.1_Intron|ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000597342.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	337					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A337V(2)		NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						ACTGAAGCTAGCATATTTGCT	0.353																																					p.A337V		.											.	.	2	Substitution - Missense(2)	prostate(2)	c.C1010T						.						58.0	51.0	53.0					19																	58385748		692	1591	2283	SO:0001583	missense	730051	exon3			AAGCTAGCATATT		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.1010C>T	19.37:g.58385748G>A	ENSP00000410545:p.Ala337Val	Somatic	110	1		WXS	Illumina GAIIx	Phase_I	176	64	NM_001144989	0	0	0	0	0	A6NF35	Missense_Mutation	SNP	ENST00000435989.2	37	CCDS46212.1	.	.	.	.	.	.	.	.	.	.	.	3.777	-0.046344	0.07407	.	.	ENSG00000204514	ENST00000435989	T	0.15372	2.43	2.11	-4.21	0.03812	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.07728	0.0194	N	0.21142	0.635	0.09310	N	1	B	0.32781	0.384	B	0.18561	0.022	T	0.05649	-1.0872	9	0.66056	D	0.02	.	3.5015	0.07674	0.0936:0.1206:0.3016:0.4843	.	337	B7Z6K7	ZN814_HUMAN	V	337	ENSP00000410545:A337V	ENSP00000410545:A337V	A	-	2	0	ZNF814	63077560	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-2.230000	0.01207	-3.525000	0.00147	-3.867000	0.00017	GCT	.		0.353	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
ZNF814	730051	ucsc.edu;bcgsc.ca;mdanderson.org	37	19	58385762	58385762	+	Silent	SNP	C	C	G	rs199732634		TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr19:58385762C>G	ENST00000435989.2	-	3	1230	c.996G>C	c.(994-996)tcG>tcC	p.S332S	ZNF814_ENST00000600634.1_Intron|ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000597832.1_Intron|ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000597342.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	332					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S332S(2)		NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						ATTTGCTAAACGATTTCCCAC	0.358																																					p.S332S		.											.	.	2	Substitution - coding silent(2)	kidney(2)	c.G996C						.						25.0	25.0	25.0					19																	58385762		692	1589	2281	SO:0001819	synonymous_variant	730051	exon3			GCTAAACGATTTC		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.996G>C	19.37:g.58385762C>G		Somatic	103	1		WXS	Illumina GAIIx	Phase_I	151	41	NM_001144989	0	0	0	0	0	A6NF35	Silent	SNP	ENST00000435989.2	37	CCDS46212.1																																																																																			.		0.358	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
TPO	7173	hgsc.bcm.edu	37	2	1481231	1481231	+	Missense_Mutation	SNP	G	G	C	rs2175977	byFrequency	TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr2:1481231G>C	ENST00000345913.4	+	8	1284	c.1193G>C	c.(1192-1194)aGc>aCc	p.S398T	TPO_ENST00000346956.3_Missense_Mutation_p.S398T|TPO_ENST00000497517.2_Intron|TPO_ENST00000329066.4_Missense_Mutation_p.S398T|TPO_ENST00000382201.3_Missense_Mutation_p.S398T|TPO_ENST00000382198.1_Intron|TPO_ENST00000337415.3_Missense_Mutation_p.S398T|TPO_ENST00000349624.3_Intron	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	398			S -> T (in dbSNP:rs2175977). {ECO:0000269|PubMed:7550241}.		cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	GGCCGCGCCAGCGAGGTCCCC	0.761													G|||	3557	0.710264	0.8185	0.6571	5008	,	,		9157	0.7758		0.6034	False		,,,				2504	0.6442				p.S398T		.											.	TPO-332	0			c.G1193C						.	G	THR/SER,THR/SER,THR/SER,THR/SER,THR/SER,	2498,394		1072,354,20	2.0	2.0	2.0		1193,1193,1193,1193,1193,	4.1	1.0	2	dbSNP_96	2	4199,1477		1511,1177,150	no	missense,missense,missense,missense,missense,intron	TPO	NM_000547.5,NM_001206744.1,NM_001206745.1,NM_175719.3,NM_175721.3,NM_175722.3	58,58,58,58,58,	2583,1531,170	CC,CG,GG		26.0218,13.6238,21.8371	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,	398/934,398/934,398/877,398/877,398/890,	1481231	6697,1871	1446	2838	4284	SO:0001583	missense	7173	exon8			GCGCCAGCGAGGT		CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.1193G>C	2.37:g.1481231G>C	ENSP00000318820:p.Ser398Thr	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	8	NM_175719	0	0	0	0	0	P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Missense_Mutation	SNP	ENST00000345913.4	37	CCDS1643.1	1512|1512	0.6923076923076923|0.6923076923076923	388|388	0.7886178861788617|0.7886178861788617	227|227	0.6270718232044199|0.6270718232044199	438|438	0.7657342657342657|0.7657342657342657	459|459	0.6055408970976254|0.6055408970976254	G|G	18.72|18.72	3.683431|3.683431	0.68157|0.68157	0.863762|0.863762	0.739782|0.739782	ENSG00000115705|ENSG00000115705	ENST00000536482|ENST00000337415;ENST00000345913;ENST00000346956;ENST00000329066;ENST00000382201;ENST00000422464	.|T;T;T;T;T;T	.|0.73897	.|-0.79;-0.79;-0.79;-0.79;-0.79;-0.79	4.99|4.99	4.08|4.08	0.47627|0.47627	.|.	.|0.142496	.|0.64402	.|N	.|0.000004	T|T	0.00012|0.00012	0.0000|0.0000	M|M	0.62723|0.62723	1.935|1.935	0.09310|0.09310	P|P	1.0|1.0	.|D;D;D	.|0.76494	.|0.998;0.998;0.999	.|D;D;D	.|0.69654	.|0.956;0.94;0.965	T|T	0.30060|0.30060	-0.9991|-0.9991	5|9	0.48119|0.56958	T|D	0.1|0.05	-48.0867|-48.0867	8.6411|8.6411	0.33978|0.33978	0.08:0.1541:0.7659:0.0|0.08:0.1541:0.7659:0.0	rs2175977|rs2175977	.|398;398;398	.|P07202-4;P07202-2;P07202	.|.;.;PERT_HUMAN	H|T	81|398;398;398;398;398;327	.|ENSP00000337263:S398T;ENSP00000318820:S398T;ENSP00000263886:S398T;ENSP00000329869:S398T;ENSP00000371636:S398T;ENSP00000405788:S327T	ENSP00000439133:Q81H|ENSP00000329869:S398T	Q|S	+|+	3|2	2|0	TPO|TPO	1460238|1460238	0.956000|0.956000	0.32656|0.32656	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	1.297000|1.297000	0.33400|0.33400	1.031000|1.031000	0.39867|0.39867	0.460000|0.460000	0.39030|0.39030	CAG|AGC	G|0.301;C|0.699		0.761	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206594.2	NM_000547	
USP34	9736	broad.mit.edu	37	2	61417514	61417514	+	Silent	SNP	G	G	T			TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr2:61417514G>T	ENST00000398571.2	-	78	9841	c.9765C>A	c.(9763-9765)gcC>gcA	p.A3255A	AHSA2_ENST00000394457.3_3'UTR	NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	3255					positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			TGATCAAATTGGCACAGTTTG	0.353																																					p.A3255A		.											.	USP34-579	0			c.C9765A						.						83.0	78.0	80.0					2																	61417514		1833	4094	5927	SO:0001819	synonymous_variant	9736	exon78			CAAATTGGCACAG	AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.9765C>A	2.37:g.61417514G>T		Somatic	56	0		WXS	Illumina GAIIx	Phase_I	68	3	NM_014709	0	0	0	0	0	A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Silent	SNP	ENST00000398571.2	37	CCDS42686.1	.	.	.	.	.	.	.	.	.	.	G	9.008	0.981880	0.18812	.	.	ENSG00000115464	ENST00000411912	.	.	.	5.87	5.87	0.94306	.	.	.	.	.	T	0.69851	0.3157	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.66384	-0.5937	4	.	.	.	.	13.923	0.63945	0.0:0.0:0.7353:0.2647	.	.	.	.	K	932	.	.	Q	-	1	0	USP34	61271018	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.576000	0.46033	2.941000	0.99782	0.655000	0.94253	CAA	.		0.353	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325650.4		
SESTD1	91404	bcgsc.ca	37	2	179986553	179986553	+	Silent	SNP	T	T	C	rs56336305	byFrequency	TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr2:179986553T>C	ENST00000428443.3	-	13	1702	c.1386A>G	c.(1384-1386)aaA>aaG	p.K462K		NM_178123.4	NP_835224.3	Q86VW0	SESD1_HUMAN	SEC14 and spectrin domains 1	462							phosphatidic acid binding (GO:0070300)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)			breast(2)|endometrium(4)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|skin(3)	30			OV - Ovarian serous cystadenocarcinoma(117;0.0344)|Epithelial(96;0.0531)|all cancers(119;0.147)			CCACATTTTCTTTATTTTCAA	0.383													T|||	56	0.0111821	0.0	0.0159	5008	,	,		17677	0.0		0.0278	False		,,,				2504	0.0174				p.K462K		.											.	SESTD1-228	0			c.A1386G						.	T		25,4381	32.6+/-62.9	0,25,2178	110.0	105.0	107.0		1386	2.8	1.0	2	dbSNP_129	107	198,8402	86.9+/-149.2	0,198,4102	no	coding-synonymous	SESTD1	NM_178123.4		0,223,6280	CC,CT,TT		2.3023,0.5674,1.7146		462/697	179986553	223,12783	2203	4300	6503	SO:0001819	synonymous_variant	91404	exon13			ATTTTCTTTATTT	AK096232	CCDS33338.1	2q31.3	2014-01-28			ENSG00000187231	ENSG00000187231			18379	protein-coding gene	gene with protein product						12837271	Standard	NM_178123		Approved	DKFZp434O0515, Solo	uc002uni.4	Q86VW0	OTTHUMG00000154554	ENST00000428443.3:c.1386A>G	2.37:g.179986553T>C		Somatic	78	0		WXS	Illumina GAIIx	Phase_I	52	4	NM_178123	0	0	0	0	0	Q53R38|Q53SP3|Q5GM69|Q8N6M1|Q96LQ2	Silent	SNP	ENST00000428443.3	37	CCDS33338.1																																																																																			T|0.982;C|0.018		0.383	SESTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335916.2	NM_178123	
ISX	91464	broad.mit.edu;bcgsc.ca	37	22	35480438	35480438	+	Silent	SNP	T	T	G			TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr22:35480438T>G	ENST00000308700.6	+	3	1396	c.444T>G	c.(442-444)gcT>gcG	p.A148A	ISX_ENST00000404699.2_Silent_p.A148A	NM_001008494.1	NP_001008494.1	Q2M1V0	ISX_HUMAN	intestine-specific homeobox	148					regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of vitamin A metabolic process (GO:1901738)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(12)|ovary(3)|prostate(1)|skin(4)	26						ACCTGGGGGCTCCACAGCAGC	0.562																																					p.A148A		.											.	ISX-95	0			c.T444G						.						59.0	52.0	55.0					22																	35480438		2203	4300	6503	SO:0001819	synonymous_variant	91464	exon3			GGGGGCTCCACAG	AK025181	CCDS33640.1	22q12.3	2011-06-20			ENSG00000175329	ENSG00000175329		"""Homeoboxes / PRD class"""	28084	protein-coding gene	gene with protein product		612019					Standard	NM_001008494		Approved	RAXLX	uc003anj.3	Q2M1V0	OTTHUMG00000150962	ENST00000308700.6:c.444T>G	22.37:g.35480438T>G		Somatic	78	1		WXS	Illumina GAIIx	Phase_I	107	8	NM_001008494	0	0	0	0	0	Q68DJ5	Silent	SNP	ENST00000308700.6	37	CCDS33640.1																																																																																			.		0.562	ISX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320662.1	NM_001008494	
MIRLET7BHG	400931	broad.mit.edu	37	22	46501355	46501355	+	Missense_Mutation	SNP	G	G	T	rs8139990	byFrequency	TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr22:46501355G>T	ENST00000381051.2	+	5	327	c.274G>T	c.(274-276)Gcc>Tcc	p.A92S	FLJ27365_ENST00000360737.3_Intron																							GCCTGTGTTCGCCACGTGGCC	0.637													T|||	2021	0.403554	0.8729	0.3012	5008	,	,		14449	0.005		0.338	False		,,,				2504	0.32				.		.											.	.	0			.						.																																			SO:0001583	missense	400931	.			GTGTTCGCCACGT																												ENST00000381051.2:c.274G>T	22.37:g.46501355G>T	ENSP00000370439:p.Ala92Ser	Somatic	150	0		WXS	Illumina GAIIx	Phase_I	131	6	.	0	0	0	0	0		RNA	SNP	ENST00000381051.2	37		805	0.3685897435897436	425	0.8638211382113821	110	0.30386740331491713	1	0.0017482517482517483	269	0.3548812664907652	T	6.621	0.483047	0.12581	.	.	ENSG00000197182	ENST00000381051	.	.	.	2.26	-4.27	0.03744	.	.	.	.	.	T	0.00012	0.0000	.	.	.	.	.	.	B	0.02656	0.0	B	0.01281	0.0	T	0.20240	-1.0281	6	0.20046	T	0.44	.	5.3386	0.15971	0.0:0.4631:0.1545:0.3824	rs8139990;rs61112398	92	B1AKH7	.	S	92	.	ENSP00000370439:A92S	A	+	1	0	MIRLET7BHG	44880019	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.647000	0.00860	-1.668000	0.01471	-1.333000	0.01266	GCC	G|0.630;T|0.370		0.637	FLJ27365-003	PUTATIVE	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000316783.1		
SMARCC1	6599	bcgsc.ca	37	3	47712202	47712202	+	Silent	SNP	T	T	C	rs1141601	byFrequency	TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr3:47712202T>C	ENST00000254480.5	-	19	1964	c.1845A>G	c.(1843-1845)aaA>aaG	p.K615K	SMARCC1_ENST00000425518.1_5'UTR	NM_003074.3	NP_003065.3	Q92922	SMRC1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1	615					ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|insulin receptor signaling pathway (GO:0008286)|nervous system development (GO:0007399)|nucleosome disassembly (GO:0006337)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)|XY body (GO:0001741)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|protein N-terminus binding (GO:0047485)|transcription coactivator activity (GO:0003713)			breast(1)|endometrium(5)|kidney(2)|large_intestine(3)|lung(15)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33				BRCA - Breast invasive adenocarcinoma(193;7.47e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)		CACTAGCACCTTTACTCTAAG	0.413													T|||	926	0.184904	0.0113	0.2795	5008	,	,		19467	0.251		0.3221	False		,,,				2504	0.1431				p.K615K		.											.	SMARCC1-228	0			c.A1845G						.	T		257,4149	145.4+/-180.2	9,239,1955	119.0	103.0	108.0		1845	4.3	1.0	3	dbSNP_86	108	2428,6172	392.3+/-344.0	367,1694,2239	no	coding-synonymous	SMARCC1	NM_003074.3		376,1933,4194	CC,CT,TT		28.2326,5.833,20.6443		615/1106	47712202	2685,10321	2203	4300	6503	SO:0001819	synonymous_variant	6599	exon19			AGCACCTTTACTC	U66615	CCDS2758.1	3p21.31	2008-05-15			ENSG00000173473	ENSG00000173473			11104	protein-coding gene	gene with protein product		601732				8804307	Standard	NM_003074		Approved	BAF155, SRG3, Rsc8, CRACC1	uc003crq.2	Q92922	OTTHUMG00000133519	ENST00000254480.5:c.1845A>G	3.37:g.47712202T>C		Somatic	244	0		WXS	Illumina GAIIx	Phase_I	248	7	NM_003074	0	0	0	0	0	Q17RS0|Q6P172|Q8IWH2	Silent	SNP	ENST00000254480.5	37	CCDS2758.1																																																																																			T|0.472;G|0.091		0.413	SMARCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257491.1		
LRIG1	26018	hgsc.bcm.edu	37	3	66550756	66550756	+	Missense_Mutation	SNP	G	G	C	rs1403625	byFrequency	TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr3:66550756G>C	ENST00000273261.3	-	1	600	c.76C>G	c.(76-78)Ctt>Gtt	p.L26V	LRIG1_ENST00000383703.3_Missense_Mutation_p.L26V	NM_015541.2	NP_056356.2	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like domains 1	26				LLL -> VLV (in Ref. 1; AAK62357 and 3; AAH71561). {ECO:0000305}.	innervation (GO:0060384)|otolith morphogenesis (GO:0032474)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)				NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(4)|stomach(4)|urinary_tract(1)	42		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		TCCAGCCGAAGCAAAAGCAGC	0.761													g|||	3605	0.719848	0.1808	0.8833	5008	,	,		8093	0.8284		0.9732	False		,,,				2504	0.9601				p.L26V		.											.	LRIG1-230	0			c.C76G						.		VAL/LEU	1298,1386		255,788,299	3.0	4.0	4.0		76	2.9	0.5	3	dbSNP_88	4	5191,89		2555,81,4	yes	missense	LRIG1	NM_015541.2	32	2810,869,303	CC,CG,GG		1.6856,48.3607,18.5208	benign	26/1094	66550756	6489,1475	1342	2640	3982	SO:0001583	missense	26018	exon1			GCCGAAGCAAAAG	AB050468	CCDS33783.1	3p14	2013-01-14			ENSG00000144749	ENSG00000144749		"""Immunoglobulin superfamily / I-set domain containing"""	17360	protein-coding gene	gene with protein product	"""ortholog of mouse integral membrane glycoprotein LIG-1"", ""leucine-rich repeat protein LRIG1"""	608868				11414704, 12234026	Standard	NM_015541		Approved	LIG-1, DKFZP586O1624, LIG1	uc003dmx.3	Q96JA1	OTTHUMG00000158727	ENST00000273261.3:c.76C>G	3.37:g.66550756G>C	ENSP00000273261:p.Leu26Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_015541	0	0	0	0	0	Q6IQ51|Q96CF9|Q9BYB8|Q9UFI4	Missense_Mutation	SNP	ENST00000273261.3	37	CCDS33783.1	1666	0.7628205128205128	118	0.23983739837398374	325	0.8977900552486188	489	0.8548951048951049	734	0.9683377308707124	g	6.572	0.473779	0.12521	0.483607	0.983144	ENSG00000144749	ENST00000273261;ENST00000383703	T;T	0.67345	-0.26;-0.13	3.84	2.93	0.34026	.	0.847359	0.09512	U	0.792175	T	0.00012	0.0000	N	0.19112	0.55	0.80722	P	0.0	P;P	0.44139	0.827;0.484	B;B	0.37731	0.257;0.096	T	0.48854	-0.8998	9	0.23302	T	0.38	.	8.6883	0.34251	0.1185:0.0:0.8815:0.0	rs1403625;rs13083628	26;26	Q96JA1-2;Q96JA1	.;LRIG1_HUMAN	V	26	ENSP00000273261:L26V;ENSP00000373208:L26V	ENSP00000273261:L26V	L	-	1	0	LRIG1	66633446	.	.	0.520000	0.27837	0.020000	0.10135	.	.	1.845000	0.53610	0.472000	0.43445	CTT	G|0.237;C|0.763		0.761	LRIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351930.1	NM_015541	
LRIG1	26018	hgsc.bcm.edu	37	3	66550762	66550762	+	Missense_Mutation	SNP	G	G	C	rs1403626	byFrequency	TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr3:66550762G>C	ENST00000273261.3	-	1	594	c.70C>G	c.(70-72)Ctt>Gtt	p.L24V	LRIG1_ENST00000383703.3_Missense_Mutation_p.L24V	NM_015541.2	NP_056356.2	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like domains 1	24			L -> V (in dbSNP:rs1403626).	LLL -> VLV (in Ref. 1; AAK62357 and 3; AAH71561). {ECO:0000305}.	innervation (GO:0060384)|otolith morphogenesis (GO:0032474)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)				NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(4)|stomach(4)|urinary_tract(1)	42		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		CGAAGCAAAAGCAGCCAGAGA	0.766													g|||	3605	0.719848	0.1808	0.8833	5008	,	,		8368	0.8284		0.9732	False		,,,				2504	0.9601				p.L24V		.											.	LRIG1-230	0			c.C70G						.		VAL/LEU	1309,1447		265,779,334	3.0	4.0	4.0		70	3.1	0.5	3	dbSNP_88	4	5325,93		2620,85,4	no	missense	LRIG1	NM_015541.2	32	2885,864,338	CC,CG,GG		1.7165,47.4964,18.8402	benign	24/1094	66550762	6634,1540	1378	2709	4087	SO:0001583	missense	26018	exon1			GCAAAAGCAGCCA	AB050468	CCDS33783.1	3p14	2013-01-14			ENSG00000144749	ENSG00000144749		"""Immunoglobulin superfamily / I-set domain containing"""	17360	protein-coding gene	gene with protein product	"""ortholog of mouse integral membrane glycoprotein LIG-1"", ""leucine-rich repeat protein LRIG1"""	608868				11414704, 12234026	Standard	NM_015541		Approved	LIG-1, DKFZP586O1624, LIG1	uc003dmx.3	Q96JA1	OTTHUMG00000158727	ENST00000273261.3:c.70C>G	3.37:g.66550762G>C	ENSP00000273261:p.Leu24Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	12	12	NM_015541	0	0	0	0	0	Q6IQ51|Q96CF9|Q9BYB8|Q9UFI4	Missense_Mutation	SNP	ENST00000273261.3	37	CCDS33783.1	1670	0.7646520146520146	119	0.241869918699187	326	0.9005524861878453	488	0.8531468531468531	737	0.9722955145118733	g	9.592	1.126319	0.20959	0.474964	0.982835	ENSG00000144749	ENST00000273261;ENST00000383703	T;T	0.68765	-0.35;-0.2	3.11	3.11	0.35812	.	0.429988	0.15146	U	0.278020	T	0.00012	0.0000	N	0.19112	0.55	0.39998	P	0.024872000000000005	P;B	0.36282	0.546;0.282	B;B	0.32465	0.146;0.069	T	0.40572	-0.9556	9	0.23891	T	0.37	.	12.0321	0.53403	0.0:0.0:1.0:0.0	rs1403626;rs13083630;rs1403626	24;24	Q96JA1-2;Q96JA1	.;LRIG1_HUMAN	V	24	ENSP00000273261:L24V;ENSP00000373208:L24V	ENSP00000273261:L24V	L	-	1	0	LRIG1	66633452	.	.	0.546000	0.28166	0.017000	0.09413	.	.	1.734000	0.51633	0.472000	0.43445	CTT	G|0.252;C|0.748		0.766	LRIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351930.1	NM_015541	
ZPLD1	131368	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	102171984	102171984	+	Splice_Site	SNP	G	G	T			TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr3:102171984G>T	ENST00000491959.1	+	10	1209		c.e10+1		ZPLD1_ENST00000466937.1_Splice_Site|ZPLD1_ENST00000306176.1_Splice_Site			Q8TCW7	ZPLD1_HUMAN	zona pellucida-like domain containing 1							integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(18)|ovary(2)|skin(3)	35						CAACCTGGTGGTAAGATTAGT	0.418																																					.		.											.	ZPLD1-72	0			c.375+1G>T						.						60.0	53.0	55.0					3																	102171984		2203	4300	6503	SO:0001630	splice_region_variant	131368	exon3			CTGGTGGTAAGAT	AY090780	CCDS2947.1	3q12.3	2009-03-25			ENSG00000170044	ENSG00000170044			27022	protein-coding gene	gene with protein product		615915				18632209	Standard	NM_175056		Approved		uc003dvt.1	Q8TCW7	OTTHUMG00000159229	ENST00000491959.1:c.327+1G>T	3.37:g.102171984G>T		Somatic	72	0		WXS	Illumina GAIIx	Phase_I	76	8	NM_175056	0	0	0	0	0	Q49AS1|Q8WU36	Splice_Site	SNP	ENST00000491959.1	37		.	.	.	.	.	.	.	.	.	.	G	23.3	4.405661	0.83230	.	.	ENSG00000170044	ENST00000491959;ENST00000306176;ENST00000466937	.	.	.	5.69	5.69	0.88448	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.181	0.98201	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ZPLD1	103654674	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	9.301000	0.96167	2.840000	0.97914	0.655000	0.94253	.	.		0.418	ZPLD1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000353984.1	NM_175056	Intron
ALG3	10195	hgsc.bcm.edu	37	3	183959626	183959626	+	IGR	SNP	G	G	T			TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr3:183959626G>T	ENST00000397676.3	-	0	1528				MIR1224_ENST00000408193.1_RNA|EIF2B5_ENST00000444495.1_Intron|ALG3_ENST00000463495.1_5'Flank|VWA5B2_ENST00000426955.2_Nonsense_Mutation_p.E1177*|VWA5B2_ENST00000273794.5_Nonsense_Mutation_p.E959*	NM_005787.5	NP_005778.1	Q92685	ALG3_HUMAN	ALG3, alpha-1,3- mannosyltransferase						cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	alpha-1,3-mannosyltransferase activity (GO:0000033)|dol-P-Man:Man(5)GlcNAc(2)-PP-Dol alpha-1,3-mannosyltransferase activity (GO:0052925)			kidney(1)|large_intestine(1)|lung(6)|upper_aerodigestive_tract(1)	9	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			CGCCTGGCTGGAGCACCGATG	0.721																																					p.E1177X		.											.	.	0			c.G3529T						.						6.0	10.0	9.0					3																	183959626		680	1578	2258	SO:0001628	intergenic_variant	90113	exon19			TGGCTGGAGCACC	BC002839	CCDS46967.1, CCDS46968.1	3q27.3	2013-02-26	2013-02-26		ENSG00000214160	ENSG00000214160	2.4.1.258	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	23056	protein-coding gene	gene with protein product	"""carbohydrate deficient glycoprotein syndrome type IV"", ""dol-P-Man:Man(5)GlcNAc(2)-PP-Dol alpha-1,3-mannosyltransferase"", ""dol-P-Man dependent alpha-1,3- mannosyltransferase"""	608750	"""asparagine-linked glycosylation 3 homolog (yeast, alpha-1,3-mannosyltransferase)"", ""asparagine-linked glycosylation 3, alpha-1,3- mannosyltransferase homolog (S. cerevisiae)"""			1058125	Standard	NM_005787		Approved	NOT56L, Not56, CDGS4, D16Ertd36e	uc003fne.2	Q92685	OTTHUMG00000156823		3.37:g.183959626G>T		Somatic	36	0		WXS	Illumina GAIIx	Phase_I	73	4	NM_138345	0	0	0	0	0	A8JZZ6|Q9BT71	Nonsense_Mutation	SNP	ENST00000397676.3	37	CCDS46968.1	.	.	.	.	.	.	.	.	.	.	G	39	7.487789	0.98316	.	.	ENSG00000145198	ENST00000426955;ENST00000273794	.	.	.	4.73	3.85	0.44370	.	0.000000	0.49305	D	0.000143	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-6.7366	12.1447	0.54016	0.0828:0.0:0.9172:0.0	.	.	.	.	X	1177;959	.	ENSP00000273794:E959X	E	+	1	0	VWA5B2	185442320	1.000000	0.71417	0.998000	0.56505	0.445000	0.32107	7.410000	0.80065	1.348000	0.45733	0.462000	0.41574	GAG	.		0.721	ALG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346033.1	NM_005787	
DOK7	285489	broad.mit.edu	37	4	3494664	3494664	+	Silent	SNP	A	A	C			TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr4:3494664A>C	ENST00000340083.5	+	7	1016	c.951A>C	c.(949-951)ccA>ccC	p.P317P	DOK7_ENST00000507039.1_3'UTR|DOK7_ENST00000512714.1_3'UTR|DOK7_ENST00000389653.2_Silent_p.P317P	NM_173660.4	NP_775931.3	Q18PE1	DOK7_HUMAN	docking protein 7	317	Ser-rich.				neuromuscular junction development (GO:0007528)|positive regulation of protein tyrosine kinase activity (GO:0061098)|receptor clustering (GO:0043113)	cell junction (GO:0030054)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)|protein kinase binding (GO:0019901)			kidney(1)|large_intestine(1)|skin(2)|upper_aerodigestive_tract(1)	5				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		CCTCAAGGCCACCCCCCAAGC	0.692																																					p.P317P		.											.	DOK7-91	0			c.A951C						.						7.0	8.0	7.0					4																	3494664		2122	4167	6289	SO:0001819	synonymous_variant	285489	exon7			AAGGCCACCCCCC	AK091037	CCDS3370.2, CCDS54717.1	4p16.2	2014-09-17	2006-08-24	2006-08-24	ENSG00000175920	ENSG00000175920			26594	protein-coding gene	gene with protein product		610285	"""chromosome 4 open reading frame 25"""	C4orf25		16794080	Standard	NM_173660		Approved	FLJ33718, FLJ39137, Dok-7	uc003ghd.3	Q18PE1	OTTHUMG00000122087	ENST00000340083.5:c.951A>C	4.37:g.3494664A>C		Somatic	20	2		WXS	Illumina GAIIx	Phase_I	113	31	NM_173660	0	0	0	0	0	A2A499|A2RRD4|E9PB56|Q6P6A6|Q86XG5|Q8N2J3|Q8NBC1	Silent	SNP	ENST00000340083.5	37	CCDS3370.2																																																																																			.		0.692	DOK7-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000313538.1	NM_173660	
ZAR1	326340	hgsc.bcm.edu	37	4	48492769	48492769	+	Missense_Mutation	SNP	A	A	T	rs74929644	byFrequency	TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr4:48492769A>T	ENST00000327939.4	+	1	501	c.461A>T	c.(460-462)cAg>cTg	p.Q154L		NM_175619.1	NP_783318.1	Q86SH2	ZAR1_HUMAN	zygote arrest 1	154					multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)				endometrium(1)|large_intestine(4)	5						TTCTCCCAGCAGCCATCCCGT	0.781													A|||	1944	0.388179	0.171	0.572	5008	,	,		7581	0.4454		0.5089	False		,,,				2504	0.3681				p.Q154L		.											.	ZAR1-90	0			c.A461T						.	A	LEU/GLN	483,2381		61,361,1010	4.0	4.0	4.0		461	-6.2	0.0	4	dbSNP_131	4	2428,3758		540,1348,1205	no	missense	ZAR1	NM_175619.1	113	601,1709,2215	TT,TA,AA		39.2499,16.8645,32.1657	benign	154/425	48492769	2911,6139	1432	3093	4525	SO:0001583	missense	326340	exon1			CCCAGCAGCCATC	AY193890	CCDS3483.1	4p11	2014-02-20			ENSG00000182223	ENSG00000182223			20436	protein-coding gene	gene with protein product	"""zinc finger, 3CxxC-type 6"""	607520				12539046	Standard	NM_175619		Approved	Z3CXXC6	uc003gyd.3	Q86SH2	OTTHUMG00000102093	ENST00000327939.4:c.461A>T	4.37:g.48492769A>T	ENSP00000329803:p.Gln154Leu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_175619	0	0	0	0	0		Missense_Mutation	SNP	ENST00000327939.4	37	CCDS3483.1	979	0.4482600732600733	95	0.19308943089430894	212	0.585635359116022	288	0.5034965034965035	384	0.5065963060686016	A	12.09	1.834066	0.32421	0.168645	0.392499	ENSG00000182223	ENST00000327939	.	.	.	3.61	-6.17	0.02091	.	.	.	.	.	T	0.00012	0.0000	N	0.19112	0.55	0.80722	P	0.0	B	0.02656	0.0	B	0.04013	0.001	T	0.49194	-0.8965	7	0.25751	T	0.34	.	0.9878	0.01450	0.443:0.2168:0.1793:0.1609	.	154	Q86SH2	ZAR1_HUMAN	L	154	.	ENSP00000329803:Q154L	Q	+	2	0	ZAR1	48187526	0.000000	0.05858	0.002000	0.10522	0.003000	0.03518	-0.738000	0.04871	-0.489000	0.06716	-0.680000	0.03767	CAG	A|0.552;T|0.448		0.781	ZAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219927.3		
ARL10	285598	hgsc.bcm.edu	37	5	175792605	175792605	+	Silent	SNP	G	G	C	rs2303667	byFrequency	TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr5:175792605G>C	ENST00000310389.5	+	1	135	c.39G>C	c.(37-39)ctG>ctC	p.L13L	MIR1271_ENST00000408537.1_RNA	NM_173664.4	NP_775935.1	Q8N8L6	ARL10_HUMAN	ADP-ribosylation factor-like 10	13					small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	GTP binding (GO:0005525)			endometrium(2)|lung(1)|ovary(1)	4	all_cancers(89;0.0064)|Renal(175;0.000269)|Lung NSC(126;0.0105)|all_lung(126;0.0168)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	Kidney(146;0.0965)		TGCTGGCGCTGGGCGGCGCCG	0.756													G|||	2787	0.55651	0.5938	0.4928	5008	,	,		9772	0.5556		0.6093	False		,,,				2504	0.498				p.L13L		.											.	ARL10-91	0			c.G39C						.	G		1858,1528		603,652,438	3.0	4.0	3.0		39	3.2	0.8	5	dbSNP_100	3	4085,2705		1416,1253,726	no	coding-synonymous	ARL10	NM_173664.4		2019,1905,1164	CC,CG,GG		39.838,45.127,41.5979		13/245	175792605	5943,4233	1693	3395	5088	SO:0001819	synonymous_variant	285598	exon1			GGCGCTGGGCGGC	BK001673	CCDS4400.1	5q35.3	2014-05-09	2005-11-03	2005-11-03	ENSG00000175414	ENSG00000175414		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	22042	protein-coding gene	gene with protein product			"""ADP-ribosylation factor-like 10A"""	ARL10A			Standard	NM_173664		Approved		uc003mec.1	Q8N8L6	OTTHUMG00000130655	ENST00000310389.5:c.39G>C	5.37:g.175792605G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_173664	0	0	0	0	0		Silent	SNP	ENST00000310389.5	37	CCDS4400.1																																																																																			G|0.585;C|0.415		0.756	ARL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253145.2	NM_173664	
MUC21	394263	bcgsc.ca	37	6	30954484	30954484	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr6:30954484A>G	ENST00000376296.3	+	2	773	c.532A>G	c.(532-534)Agc>Ggc	p.S178G	MUC21_ENST00000486149.2_5'UTR	NM_001010909.2	NP_001010909.2	Q5SSG8	MUC21_HUMAN	mucin 21, cell surface associated	178	28 X 15 AA approximate tandem repeats.|Ser-rich.				cellular protein metabolic process (GO:0044267)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(4)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						CAGTGGGGCCAGCACAGCCAC	0.617																																					p.S178G		.											.	MUC21-92	0			c.A532G						.						148.0	142.0	144.0					6																	30954484		2202	4299	6501	SO:0001583	missense	394263	exon2			GGGGCCAGCACAG	AK056612	CCDS34388.1	6p21.33	2008-05-14	2008-05-14	2008-05-14	ENSG00000204544	ENSG00000204544		"""Mucins"""	21661	protein-coding gene	gene with protein product	"""epiglycanin"""		"""chromosome 6 open reading frame 205"""	C6orf205		17977904	Standard	NM_001010909		Approved	bCX31G15.2	uc003nsh.2	Q5SSG8	OTTHUMG00000031216	ENST00000376296.3:c.532A>G	6.37:g.30954484A>G	ENSP00000365473:p.Ser178Gly	Somatic	286	4		WXS	Illumina GAIIx	Phase_I	240	15	NM_001010909	0	0	0	0	0	B0UZT7|B4DQ55|C9JMK2|D9N007|Q0VGF1|Q3B7T2|Q5SS94|Q6UXC5	Missense_Mutation	SNP	ENST00000376296.3	37	CCDS34388.1	.	.	.	.	.	.	.	.	.	.	A	12.70	2.017680	0.35606	.	.	ENSG00000204544	ENST00000450707;ENST00000376296	T	0.02369	4.32	3.72	1.18	0.20946	.	.	.	.	.	T	0.01029	0.0034	L	0.34521	1.04	0.25544	N	0.987158	P	0.36909	0.573	B	0.40901	0.343	T	0.49725	-0.8909	8	.	.	.	-1.0525	6.8168	0.23835	0.7888:0.0:0.2112:0.0	rs9262365	178	Q5SSG8	MUC21_HUMAN	G	178	ENSP00000365473:S178G	.	S	+	1	0	MUC21	31062463	0.000000	0.05858	0.022000	0.16811	0.022000	0.10575	0.546000	0.23284	0.137000	0.18759	0.397000	0.26171	AGC	.		0.617	MUC21-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000128579.3	NM_001010909	
HLA-C	3107	bcgsc.ca	37	6	31239407	31239407	+	Missense_Mutation	SNP	G	G	T	rs17408553	byFrequency	TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr6:31239407G>T	ENST00000376228.5	-	2	326	c.312C>A	c.(310-312)aaC>aaA	p.N104K	HLA-C_ENST00000383329.3_Missense_Mutation_p.N104K	NM_002117.5	NP_002108.4	Q95604	1C17_HUMAN	major histocompatibility complex, class I, C	104	Alpha-1.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	17						AGCCGCGCAGGTTCCGCAGGC	0.716													g|||	1938	0.386981	0.5408	0.3862	5008	,	,		10850	0.1399		0.4115	False		,,,				2504	0.409				p.N104K		.											.	HLA-C-90	0			c.C312A						.	G	LYS/ASN	1618,1404		435,748,328	40.0	41.0	41.0		312	-0.2	0.0	6	dbSNP_123	41	2036,3382		372,1292,1045	no	missense	HLA-C	NM_002117.5	94	807,2040,1373	TT,TG,GG		37.5784,46.4593,43.2938	benign	104/367	31239407	3654,4786	1511	2709	4220	SO:0001583	missense	3107	exon2			GCGCAGGTTCCGC	M11886	CCDS34393.1	6p21.3	2014-01-30			ENSG00000204525	ENSG00000204525		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4933	protein-coding gene	gene with protein product		142840	"""psoriasis susceptibility 1"""	HLA-JY3, D6S204, PSORS1		3863816, 16642438	Standard	NM_001243042		Approved		uc003nsy.3	P04222	OTTHUMG00000031154	ENST00000376228.5:c.312C>A	6.37:g.31239407G>T	ENSP00000365402:p.Asn104Lys	Somatic	201	1		WXS	Illumina GAIIx	Phase_I	202	7	NM_002117	0	0	0	0	0	O02864|O02958|Q29643|Q9MY30	Missense_Mutation	SNP	ENST00000376228.5	37	CCDS34393.1	792|792	0.3626373626373626|0.3626373626373626	263|263	0.5345528455284553|0.5345528455284553	141|141	0.38950276243093923|0.38950276243093923	80|80	0.13986013986013987|0.13986013986013987	308|308	0.40633245382585753|0.40633245382585753	N|N	7.072|7.072	0.568503|0.568503	0.13560|0.13560	0.535407|0.535407	0.375784|0.375784	ENSG00000204525|ENSG00000204525	ENST00000376228;ENST00000383329;ENST00000396254;ENST00000539307|ENST00000415537	T;T|.	0.00686|.	5.85;5.85|.	2.81|2.81	-0.203|-0.203	0.13204|0.13204	MHC class I, alpha chain, alpha1/alpha2 (2);MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);|.	1.795410|.	0.05622|.	U|.	0.580150|.	T|T	0.33381|0.33381	0.0861|0.0861	M|M	0.76838|0.76838	2.35|2.35	0.80722|0.80722	P|P	0.0|0.0	B;B;B;B|.	0.21688|.	0.059;0.017;0.017;0.008|.	B;B;B;B|.	0.33890|.	0.172;0.066;0.097;0.045|.	T|T	0.23833|0.23833	-1.0177|-1.0177	9|4	0.37606|.	T|.	0.19|.	.|.	3.4973|3.4973	0.07659|0.07659	0.2649:0.2124:0.5227:0.0|0.2649:0.2124:0.5227:0.0	rs17408553;rs28393247;rs52821555|rs17408553;rs28393247;rs52821555	104;104;104;104|.	A2AEA4;A6H578;A2AEA2;P10321|.	.;.;.;1C07_HUMAN|.	K|T	104;104;104;141|104	ENSP00000365402:N104K;ENSP00000372819:N104K|.	ENSP00000365402:N104K|.	N|P	-|-	3|1	2|0	HLA-C|HLA-C	31347386|31347386	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.001000|0.001000	0.01503|0.01503	-0.046000|-0.046000	0.11983|0.11983	-0.060000|-0.060000	0.13132|0.13132	0.305000|0.305000	0.20034|0.20034	AAC|CCT	G|0.602;T|0.398		0.716	HLA-C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076281.3	NM_002117	
GPANK1	7918	bcgsc.ca	37	6	31630241	31630241	+	Silent	SNP	C	C	T	rs7992	byFrequency	TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr6:31630241C>T	ENST00000375906.1	-	4	1557	c.873G>A	c.(871-873)agG>agA	p.R291R	GPANK1_ENST00000375895.2_Silent_p.R291R|GPANK1_ENST00000375900.4_Silent_p.R291R|GPANK1_ENST00000375893.2_Silent_p.R291R|Y_RNA_ENST00000364337.1_RNA|C6orf47-AS1_ENST00000422049.1_RNA|GPANK1_ENST00000375896.4_Silent_p.R291R|CSNK2B_ENST00000375885.4_5'Flank|C6orf47_ENST00000375911.1_5'Flank	NM_001199237.1	NP_001186166.1	O95872	GPAN1_HUMAN	G patch domain and ankyrin repeats 1	291	G-patch. {ECO:0000255|PROSITE- ProRule:PRU00092}.						nucleic acid binding (GO:0003676)			central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(7)	12						CTTCCTGGTCCCTCTTGAGGA	0.652													C|||	2058	0.410942	0.6135	0.4078	5008	,	,		17114	0.369		0.2952	False		,,,				2504	0.3016				p.R291R		.											.	GPANK1-91	0			c.G873A						.	C	,,,,	1649,1373		451,747,313	81.0	83.0	82.0		873,873,873,873,873	1.8	1.0	6	dbSNP_52	82	1446,3972		198,1050,1461	yes	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	GPANK1	NM_001199237.1,NM_001199238.1,NM_001199239.1,NM_001199240.1,NM_033177.3	,,,,	649,1797,1774	TT,TC,CC		26.6888,45.4335,36.6706	,,,,	291/357,291/357,291/357,291/357,291/357	31630241	3095,5345	1511	2709	4220	SO:0001819	synonymous_variant	7918	exon4			CTGGTCCCTCTTG		CCDS4711.1	6p21.3	2013-01-28	2010-11-24	2010-11-24	ENSG00000204438	ENSG00000204438		"""Ankyrin repeat domain containing"", ""G patch domain containing"""	13920	protein-coding gene	gene with protein product	"""G patch domain containing 10"", ""ankyrin repeat domain 59"""	142610	"""HLA-B associated transcript 4"""	BAT4		2911734, 2813433	Standard	NM_001199237		Approved	G5, D6S54E, GPATCH10, ANKRD59	uc021yuu.1	O95872	OTTHUMG00000031174	ENST00000375906.1:c.873G>A	6.37:g.31630241C>T		Somatic	175	1		WXS	Illumina GAIIx	Phase_I	134	7	NM_001199238	0	0	0	0	0	A6NG25|B0UXA2|Q5SQ49	Silent	SNP	ENST00000375906.1	37	CCDS4711.1																																																																																			C|0.620;T|0.380		0.652	GPANK1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000144445.2	NM_033177	
CUL9	23113	broad.mit.edu	37	6	43188511	43188511	+	Silent	SNP	T	T	C	rs41274934	byFrequency	TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr6:43188511T>C	ENST00000252050.4	+	33	6534	c.6450T>C	c.(6448-6450)taT>taC	p.Y2150Y	CUL9_ENST00000354495.3_Silent_p.Y2040Y|CUL9_ENST00000372647.2_Silent_p.Y2122Y|RP3-330M21.5_ENST00000500590.1_RNA	NM_015089.2	NP_055904.1	Q8IWT3	CUL9_HUMAN	cullin 9	2150					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|liver(1)|lung(30)|ovary(5)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(4)	92						TGCGTGGCTATGTGGAGAGCT	0.662													T|||	3	0.000599042	0.0008	0.0	5008	,	,		19302	0.0		0.002	False		,,,				2504	0.0				p.Y2150Y		.											.	CUL9-529	0			c.T6450C						.	T		2,4404	4.2+/-10.8	0,2,2201	65.0	60.0	62.0		6450	-4.6	1.0	6	dbSNP_127	62	20,8580	14.6+/-50.1	0,20,4280	no	coding-synonymous	CUL9	NM_015089.2		0,22,6481	CC,CT,TT		0.2326,0.0454,0.1692		2150/2518	43188511	22,12984	2203	4300	6503	SO:0001819	synonymous_variant	23113	exon33			TGGCTATGTGGAG	AB014608	CCDS4890.1	6p21.1	2011-05-24			ENSG00000112659	ENSG00000112659			15982	protein-coding gene	gene with protein product	"""parkin-like cytoplasmic p53 binding protein"", ""p53-associated parkin-like cytoplasmic protein"""	607489				17332328, 10521492, 12526791	Standard	NM_015089		Approved	H7AP1, KIAA0708, PARC	uc003ouk.3	Q8IWT3	OTTHUMG00000014723	ENST00000252050.4:c.6450T>C	6.37:g.43188511T>C		Somatic	98	0		WXS	Illumina GAIIx	Phase_I	92	3	NM_015089	0	0	0	0	0	O75188|Q5TCY3|Q68CP2|Q68D92|Q8N3W9|Q9BU56	Silent	SNP	ENST00000252050.4	37	CCDS4890.1																																																																																			T|0.999;C|0.001		0.662	CUL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040582.2	NM_015089	
HSP90AB1	3326	ucsc.edu	37	6	44221293	44221293	+	Silent	SNP	C	C	T	rs147025760	byFrequency	TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr6:44221293C>T	ENST00000371554.1	+	12	2347	c.2133C>T	c.(2131-2133)ctC>ctT	p.L711L	MIR4647_ENST00000583964.1_RNA|HSP90AB1_ENST00000371646.5_Silent_p.L711L|HSP90AB1_ENST00000353801.3_Silent_p.L711L|SLC35B2_ENST00000495706.1_5'Flank			P08238	HS90B_HUMAN	heat shock protein 90kDa alpha (cytosolic), class B member 1	711					axon guidance (GO:0007411)|cellular response to interleukin-4 (GO:0071353)|cellular response to organic cyclic compound (GO:0071407)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|placenta development (GO:0001890)|positive regulation of cell size (GO:0045793)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein binding (GO:0032092)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|protein folding (GO:0006457)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to salt stress (GO:0009651)|response to unfolded protein (GO:0006986)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|inclusion body (GO:0016234)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|CTP binding (GO:0002135)|dATP binding (GO:0032564)|double-stranded RNA binding (GO:0003725)|GTP binding (GO:0005525)|MHC class II protein complex binding (GO:0023026)|nitric-oxide synthase regulator activity (GO:0030235)|poly(A) RNA binding (GO:0044822)|TPR domain binding (GO:0030911)|UTP binding (GO:0002134)			NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(12)|prostate(2)|skin(2)|urinary_tract(2)	33	all_cancers(18;1.7e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			TCCCCCCTCTCGAGGGCGATG	0.493											OREG0017471	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L711L		.											.	HSP90AB1-658	0			c.C2133T						.						78.0	80.0	79.0					6																	44221293		2203	4300	6503	SO:0001819	synonymous_variant	3326	exon12			CCCTCTCGAGGGC	AF275719	CCDS4909.1	6p12	2011-09-02	2006-02-24	2006-02-24	ENSG00000096384	ENSG00000096384		"""Heat shock proteins / HSPC"""	5258	protein-coding gene	gene with protein product		140572	"""heat shock 90kD protein 1, beta"", ""heat shock 90kDa protein 1, beta"""	HSPC2, HSPCB		2768249, 16269234	Standard	NM_001271969		Approved		uc031sor.1	P08238	OTTHUMG00000014761	ENST00000371554.1:c.2133C>T	6.37:g.44221293C>T		Somatic	146	8	922	WXS	Illumina GAIIx	Phase_I	152	24	NM_007355	0	0	0	0	0	B2R5P0|Q5T9W7|Q9NQW0|Q9NTK6	Silent	SNP	ENST00000371554.1	37	CCDS4909.1																																																																																			C|0.960;T|0.040		0.493	HSP90AB1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040730.1	NM_007355	
TBX18	9096	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	85446964	85446964	+	Silent	SNP	G	G	T			TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr6:85446964G>T	ENST00000369663.5	-	8	1600	c.1263C>A	c.(1261-1263)gcC>gcA	p.A421A	TBX18_ENST00000606784.1_Intron	NM_001080508.1	NP_001073977.1	O95935	TBX18_HUMAN	T-box 18	421					anterior/posterior axis specification (GO:0009948)|cochlea morphogenesis (GO:0090103)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of canonical Wnt signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060829)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of mesenchymal cell proliferation involved in ureter development (GO:2000729)|sensory perception of sound (GO:0007605)|sinoatrial node development (GO:0003163)|smooth muscle cell differentiation (GO:0051145)|somitogenesis (GO:0001756)|ureter development (GO:0072189)	nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(9)|liver(1)|lung(31)|ovary(2)|pancreas(3)|prostate(6)|skin(3)	61		all_cancers(76;0.000283)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0858)		BRCA - Breast invasive adenocarcinoma(108;0.0267)		GGCCTGAGCGGGCACAGGCAG	0.597																																					p.A421A		.											.	TBX18-73	0			c.C1263A						.						96.0	90.0	92.0					6																	85446964		2203	4300	6503	SO:0001819	synonymous_variant	9096	exon8			TGAGCGGGCACAG	AJ010278	CCDS34495.1	6q14.1-q15	2012-12-19			ENSG00000112837	ENSG00000112837		"""T-boxes"""	11595	protein-coding gene	gene with protein product		604613				9888994, 16688725, 23242162	Standard	NM_001080508		Approved		uc003pkl.2	O95935	OTTHUMG00000015129	ENST00000369663.5:c.1263C>A	6.37:g.85446964G>T		Somatic	220	0		WXS	Illumina GAIIx	Phase_I	260	14	NM_001080508	0	0	0	0	0	A2RU13|Q7Z6U4|Q9UJI6	Silent	SNP	ENST00000369663.5	37	CCDS34495.1																																																																																			.		0.597	TBX18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041378.2	NM_001080508	
SOGA3	387104	broad.mit.edu	37	6	127837119	127837119	+	Missense_Mutation	SNP	G	G	C	rs200377274		TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr6:127837119G>C	ENST00000525778.1	-	2	1386	c.641C>G	c.(640-642)gCc>gGc	p.A214G	SOGA3_ENST00000368268.2_Missense_Mutation_p.A214G|SOGA3_ENST00000465909.2_Missense_Mutation_p.A214G|SOGA3_ENST00000556132.1_Missense_Mutation_p.A214G|SOGA3_ENST00000481848.2_Missense_Mutation_p.A214G			Q5TF21	SOGA3_HUMAN	SOGA family member 3	214	Gly-rich.				regulation of autophagy (GO:0010506)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)											AGAAGGGGAGGCCCCCTCCCC	0.741																																					p.A214G		.											.	.	0			c.C641G						.						7.0	9.0	8.0					6																	127837119		1663	3887	5550	SO:0001583	missense	387104	exon2			GGGGAGGCCCCCT	AK096490	CCDS43505.1	6q22.33	2013-03-28	2012-02-27	2012-02-27	ENSG00000214338	ENSG00000214338			21494	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 174"""	C6orf174			Standard	NM_001012279		Approved	dJ403A15.3	uc003qbd.3	Q5TF21	OTTHUMG00000166438	ENST00000525778.1:c.641C>G	6.37:g.127837119G>C	ENSP00000434570:p.Ala214Gly	Somatic	17	3		WXS	Illumina GAIIx	Phase_I	33	9	NM_001012279	0	0	0	0	0		Missense_Mutation	SNP	ENST00000525778.1	37	CCDS43505.1	.	.	.	.	.	.	.	.	.	.	G	14.12	2.440974	0.43326	.	.	ENSG00000214338	ENST00000556132;ENST00000368268;ENST00000525778;ENST00000465909	T;T;T;T	0.41065	1.01;1.01;1.01;1.01	3.69	1.84	0.25277	.	0.622559	0.13342	N	0.395072	T	0.07007	0.0178	N	0.08118	0	0.29173	N	0.876984	B	0.06786	0.001	B	0.04013	0.001	T	0.35226	-0.9797	10	0.27082	T	0.32	-3.1076	5.5157	0.16906	0.3774:0.0:0.6226:0.0	.	214	Q5TF21	CF174_HUMAN	G	214	ENSP00000451768:A214G;ENSP00000357251:A214G;ENSP00000434570:A214G;ENSP00000435559:A214G	ENSP00000435559:A214G	A	-	2	0	C6orf174	127878812	0.944000	0.32072	1.000000	0.80357	0.994000	0.84299	1.068000	0.30629	0.326000	0.23384	0.561000	0.74099	GCC	.		0.741	SOGA3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388246.1	NM_001012279	
RBAK-RBAKDN	100533952	bcgsc.ca	37	7	5112554	5112554	+	Splice_Site	SNP	A	A	C	rs386709674|rs1130329|rs17856932	byFrequency	TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr7:5112554A>C	ENST00000407184.1	+	8	703	c.437A>C	c.(436-438)gAg>gCg	p.E146A	RBAKDN_ENST00000498308.1_lincRNA|RBAK-RBAKDN_ENST00000396904.2_3'UTR					RBAK-RBAKDN readthrough																		CTTCCCCAGGAGTCGGGGCTG	0.652													A|||	1858	0.371006	0.4342	0.2695	5008	,	,		13261	0.2887		0.339	False		,,,				2504	0.4755				.		.											.	.	0			.						.	A		1881,2523		424,1033,745	32.0	41.0	38.0			0.4	0.0	7	dbSNP_86	38	2805,5793		466,1873,1960	yes	utr-3	RBAK-LOC389458	NM_001204513.1		890,2906,2705	CC,CA,AA		32.6239,42.7112,36.0406			5112554	4686,8316	2202	4299	6501	SO:0001630	splice_region_variant	0	.			CCCAGGAGTCGGG		CCDS56463.1	7p22.1	2013-05-20				ENSG00000272968			42971	other	readthrough							Standard	NM_001204513		Approved				OTTHUMG00000186010	ENST00000407184.1:c.436-1A>C	7.37:g.5112554A>C		Somatic	77	0		WXS	Illumina GAIIx	Phase_I	94	6	.	0	0	0	0	0		RNA	SNP	ENST00000407184.1	37		734	0.3360805860805861	198	0.4024390243902439	103	0.2845303867403315	183	0.31993006993006995	250	0.32981530343007914	A	11.32	1.602783	0.28534	0.427112	0.326239	ENSG00000146587	ENST00000407184	T	0.00932	5.53	3.3	0.454	0.16644	.	.	.	.	.	T	0.00012	0.0000	.	.	.	.	.	.	B	0.28801	0.223	B	0.19666	0.026	T	0.32079	-0.9920	7	0.72032	D	0.01	.	6.9865	0.24731	0.697:0.0:0.0:0.303	rs1130329;rs3189039;rs3801056;rs10368424;rs17412728;rs61017816;rs1130329	14	A6NC62	YG007_HUMAN	A	146	ENSP00000385560:E146A	ENSP00000385560:E146A	E	+	2	0	RBAK	5079080	0.000000	0.05858	0.029000	0.17559	0.026000	0.11368	-0.540000	0.06106	0.407000	0.25591	0.379000	0.24179	GAG	A|0.647;C|0.353		0.652	RBAK-RBAKDN-001	KNOWN	basic|appris_principal|readthrough_transcript	protein_coding	protein_coding	OTTHUMT00000472007.1		Missense_Mutation
EIF2AK1	27102	broad.mit.edu	37	7	6078221	6078221	+	Missense_Mutation	SNP	G	G	A	rs142287286		TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr7:6078221G>A	ENST00000199389.6	-	10	1347	c.1201C>T	c.(1201-1203)Cgg>Tgg	p.R401W	EIF2AK1_ENST00000495565.1_5'Flank|EIF2AK1_ENST00000536084.1_Missense_Mutation_p.R277W	NM_001134335.1|NM_014413.3	NP_001127807.1|NP_055228.2	Q9BQI3	E2AK1_HUMAN	eukaryotic translation initiation factor 2-alpha kinase 1	401	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				negative regulation of cell proliferation (GO:0008285)|negative regulation of hemoglobin biosynthetic process (GO:0046986)|negative regulation of translational initiation by iron (GO:0045993)|protein autophosphorylation (GO:0046777)|protoporphyrinogen IX metabolic process (GO:0046501)|regulation of eIF2 alpha phosphorylation by heme (GO:0010999)|response to external stimulus (GO:0009605)|response to stress (GO:0006950)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|heme binding (GO:0020037)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)	27		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.106)|OV - Ovarian serous cystadenocarcinoma(56;5.22e-14)		TCCCGGCCCCGCTTGTTTCTC	0.562																																					p.R401W		.											.	EIF2AK1-408	0			c.C1201T						.	G	TRP/ARG,TRP/ARG	1,4405		0,1,2202	136.0	127.0	130.0		1198,1201	3.7	0.0	7	dbSNP_134	130	4,8596		0,4,4296	yes	missense,missense	EIF2AK1	NM_001134335.1,NM_014413.3	101,101	0,5,6498	AA,AG,GG		0.0465,0.0227,0.0384	probably-damaging,probably-damaging	400/630,401/631	6078221	5,13001	2203	4300	6503	SO:0001583	missense	27102	exon10			GGCCCCGCTTGTT	BC006524	CCDS5345.1	7p22	2005-01-20			ENSG00000086232	ENSG00000086232			24921	protein-coding gene	gene with protein product	"""heme regulated initiation factor 2 alpha kinase"""	613635				7709427, 10718198	Standard	NM_014413		Approved	HRI, KIAA1369	uc003spp.3	Q9BQI3	OTTHUMG00000090689	ENST00000199389.6:c.1201C>T	7.37:g.6078221G>A	ENSP00000199389:p.Arg401Trp	Somatic	64	2		WXS	Illumina GAIIx	Phase_I	93	4	NM_014413	0	0	0	0	0	A8K2R2|Q549K6|Q8NBW3|Q9HC02|Q9NYE0|Q9P0V6|Q9P1J5|Q9P2H8|Q9UHG4	Missense_Mutation	SNP	ENST00000199389.6	37	CCDS5345.1	.	.	.	.	.	.	.	.	.	.	.	16.97	3.269543	0.59540	2.27E-4	4.65E-4	ENSG00000086232	ENST00000199389;ENST00000536084;ENST00000426957	T;T	0.71222	-0.48;-0.55	5.74	3.73	0.42828	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.576734	0.19662	N	0.108953	D	0.84933	0.5582	M	0.88570	2.965	0.09310	N	0.999998	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.71870	0.975;0.951;0.957	T	0.77419	-0.2595	10	0.66056	D	0.02	-14.0177	12.8871	0.58051	0.0:0.0:0.6267:0.3733	.	277;400;401	B4DIP4;Q9BQI3-2;Q9BQI3	.;.;E2AK1_HUMAN	W	401;277;28	ENSP00000199389:R401W;ENSP00000445784:R277W	ENSP00000199389:R401W	R	-	1	2	EIF2AK1	6044747	0.001000	0.12720	0.042000	0.18584	0.046000	0.14306	0.905000	0.28504	1.355000	0.45865	0.650000	0.86243	CGG	G|1.000;A|0.000		0.562	EIF2AK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207373.2	NM_014413	
USP42	84132	hgsc.bcm.edu	37	7	6193521	6193521	+	Missense_Mutation	SNP	G	G	C	rs61729726	byFrequency	TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr7:6193521G>C	ENST00000306177.5	+	15	2494	c.2336G>C	c.(2335-2337)cGc>cCc	p.R779P		NM_032172.2	NP_115548.1	Q9H9J4	UBP42_HUMAN	ubiquitin specific peptidase 42	779	Pro-rich.				cell differentiation (GO:0030154)|protein deubiquitination (GO:0016579)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(2)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	35		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.108)|OV - Ovarian serous cystadenocarcinoma(56;5.77e-14)		CCGCCGCCCCGCGATCCCGGC	0.756													C|||	2895	0.578075	0.8638	0.4121	5008	,	,		10724	0.7331		0.3082	False		,,,				2504	0.4274				p.R779P		.											.	USP42-659	0			c.G2336C						.	C	PRO/ARG	2157,1125		751,655,235	4.0	6.0	5.0		2336	2.6	0.0	7	dbSNP_129	5	1843,5693		290,1263,2215	no	missense	USP42	NM_032172.2	103	1041,1918,2450	CC,CG,GG		24.4559,34.2779,36.9754	benign	779/1317	6193521	4000,6818	1641	3768	5409	SO:0001583	missense	84132	exon15			CGCCCCGCGATCC	AK022759	CCDS47535.1	7p22.2	2005-08-08	2005-08-08		ENSG00000106346	ENSG00000106346		"""Ubiquitin-specific peptidases"""	20068	protein-coding gene	gene with protein product			"""ubiquitin specific protease 42"""			12838346	Standard	NM_032172		Approved	FLJ12697	uc011jwp.2	Q9H9J4	OTTHUMG00000151888	ENST00000306177.5:c.2336G>C	7.37:g.6193521G>C	ENSP00000301962:p.Arg779Pro	Somatic	3	0		WXS	Illumina GAIIx	Phase_I	24	11	NM_032172	0	0	0	0	0	A2RUE3|B5MDA5|Q0VIN8|Q3C166|Q6P9B4	Missense_Mutation	SNP	ENST00000306177.5	37	CCDS47535.1	1188	0.5439560439560439	401	0.8150406504065041	130	0.35911602209944754	440	0.7692307692307693	217	0.2862796833773087	C	10.95	1.494372	0.26774	0.657221	0.244559	ENSG00000106346	ENST00000306177;ENST00000426246	T;T	0.14266	2.52;2.93	5.46	2.59	0.31030	.	0.841331	0.10600	N	0.655737	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.09164	-1.0687	9	0.28530	T	0.3	.	2.8136	0.05448	0.1458:0.5508:0.1414:0.162	rs61729726	779;779	Q9H9J4-2;Q9H9J4	.;UBP42_HUMAN	P	779;625	ENSP00000301962:R779P;ENSP00000408217:R625P	ENSP00000301962:R779P	R	+	2	0	USP42	6160046	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.469000	0.22067	0.265000	0.21872	-0.120000	0.15030	CGC	G|0.456;C|0.544		0.756	USP42-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324262.3	XM_166526	
GARS	2617	hgsc.bcm.edu	37	7	30634630	30634630	+	Silent	SNP	G	G	C	rs2529438	byFrequency	TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr7:30634630G>C	ENST00000389266.3	+	1	334	c.93G>C	c.(91-93)ctG>ctC	p.L31L	AC005154.6_ENST00000583664.1_RNA|AC005154.6_ENST00000584372.1_RNA|AC005154.6_ENST00000581665.1_RNA|AC005154.6_ENST00000584199.1_RNA|AC005154.6_ENST00000578994.1_RNA|AC005154.6_ENST00000579174.1_RNA|AC005154.6_ENST00000582549.1_RNA|AC005154.6_ENST00000580440.1_RNA	NM_002047.2	NP_002038.2	P41250	SYG_HUMAN	glycyl-tRNA synthetase	31					cell death (GO:0008219)|diadenosine tetraphosphate biosynthetic process (GO:0015966)|gene expression (GO:0010467)|glycyl-tRNA aminoacylation (GO:0006426)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|secretory granule (GO:0030141)	ATP binding (GO:0005524)|glycine-tRNA ligase activity (GO:0004820)|protein dimerization activity (GO:0046983)			breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|skin(3)|urinary_tract(1)	24					Glycine(DB00145)	CCTCGCTCCTGCTCCGCCGGT	0.741													G|||	705	0.140775	0.1218	0.0994	5008	,	,		12290	0.1776		0.0726	False		,,,				2504	0.228				p.L31L		.											.	GARS-91	0			c.G93C						.	G		360,3594		14,332,1631	6.0	8.0	7.0		93	2.7	0.0	7	dbSNP_100	7	669,7413		24,621,3396	no	coding-synonymous	GARS	NM_002047.2		38,953,5027	CC,CG,GG		8.2777,9.1047,8.5494		31/740	30634630	1029,11007	1977	4041	6018	SO:0001819	synonymous_variant	2617	exon1			GCTCCTGCTCCGC	AK074524	CCDS43564.1	7p15	2014-09-17	2004-02-13		ENSG00000106105	ENSG00000106105	6.1.1.14	"""Aminoacyl tRNA synthetases / Class II"""	4162	protein-coding gene	gene with protein product	"""glycine tRNA ligase"""	600287	"""Charcot-Marie-Tooth neuropathy 2D"""	CMT2D		8595897, 8872480	Standard	NM_002047		Approved	GlyRS, DSMAV, SMAD1	uc003tbm.3	P41250	OTTHUMG00000152769	ENST00000389266.3:c.93G>C	7.37:g.30634630G>C		Somatic	2	0		WXS	Illumina GAIIx	Phase_I	14	7	NM_002047	0	0	0	0	0	B3KQA2|B4DIA0|Q969Y1	Silent	SNP	ENST00000389266.3	37	CCDS43564.1																																																																																			G|0.889;C|0.111		0.741	GARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327735.1	NM_002047	
GARS	2617	hgsc.bcm.edu	37	7	30634661	30634661	+	Missense_Mutation	SNP	C	C	G	rs1049402	byFrequency	TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr7:30634661C>G	ENST00000389266.3	+	1	365	c.124C>G	c.(124-126)Ccc>Gcc	p.P42A	AC005154.6_ENST00000583664.1_RNA|AC005154.6_ENST00000584372.1_RNA|AC005154.6_ENST00000581665.1_RNA|AC005154.6_ENST00000584199.1_RNA|AC005154.6_ENST00000578994.1_RNA|AC005154.6_ENST00000579174.1_RNA|AC005154.6_ENST00000582549.1_RNA|AC005154.6_ENST00000580440.1_RNA	NM_002047.2	NP_002038.2	P41250	SYG_HUMAN	glycyl-tRNA synthetase	42			P -> A (in dbSNP:rs1049402). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:7753621, ECO:0000269|PubMed:7961834, ECO:0000269|PubMed:7962006}.		cell death (GO:0008219)|diadenosine tetraphosphate biosynthetic process (GO:0015966)|gene expression (GO:0010467)|glycyl-tRNA aminoacylation (GO:0006426)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|secretory granule (GO:0030141)	ATP binding (GO:0005524)|glycine-tRNA ligase activity (GO:0004820)|protein dimerization activity (GO:0046983)	p.P42fs*20(1)		breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|skin(3)|urinary_tract(1)	24					Glycine(DB00145)	GGCCTCCTGCCCCCCGATCTC	0.736													G|||	3252	0.649361	0.5219	0.7147	5008	,	,		13746	0.6677		0.7634	False		,,,				2504	0.6391				p.P42A		.											.	GARS-91	1	Insertion - Frameshift(1)	large_intestine(1)	c.C124G						.	G	ALA/PRO	2445,1427		776,893,267	5.0	8.0	7.0		124	-6.6	0.0	7	dbSNP_86	7	6367,1671		2577,1213,229	no	missense	GARS	NM_002047.2	27	3353,2106,496	GG,GC,CC		20.7888,36.8543,26.0118	benign	42/740	30634661	8812,3098	1936	4019	5955	SO:0001583	missense	2617	exon1			TCCTGCCCCCCGA	AK074524	CCDS43564.1	7p15	2014-09-17	2004-02-13		ENSG00000106105	ENSG00000106105	6.1.1.14	"""Aminoacyl tRNA synthetases / Class II"""	4162	protein-coding gene	gene with protein product	"""glycine tRNA ligase"""	600287	"""Charcot-Marie-Tooth neuropathy 2D"""	CMT2D		8595897, 8872480	Standard	NM_002047		Approved	GlyRS, DSMAV, SMAD1	uc003tbm.3	P41250	OTTHUMG00000152769	ENST00000389266.3:c.124C>G	7.37:g.30634661C>G	ENSP00000373918:p.Pro42Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	11	10	NM_002047	0	0	0	0	0	B3KQA2|B4DIA0|Q969Y1	Missense_Mutation	SNP	ENST00000389266.3	37	CCDS43564.1	1456	0.6666666666666666	278	0.5650406504065041	268	0.7403314917127072	337	0.5891608391608392	573	0.7559366754617414	G	0.005	-2.164835	0.00318	0.631457	0.792112	ENSG00000106105	ENST00000389266	T	0.80393	-1.37	3.31	-6.63	0.01807	.	1.037800	0.07609	N	0.925137	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.13575	-1.0504	9	0.08179	T	0.78	.	5.5596	0.17135	0.0726:0.2689:0.1197:0.5389	rs1049402;rs3189564;rs11553500;rs17856223;rs17856227;rs1049402	42	P41250	SYG_HUMAN	A	42	ENSP00000373918:P42A	ENSP00000373918:P42A	P	+	1	0	GARS	30601186	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	-0.671000	0.05250	-2.551000	0.00479	-0.744000	0.03518	CCC	C|0.329;G|0.671		0.736	GARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327735.1	NM_002047	
PDE1C	5137	broad.mit.edu	37	7	31867930	31867930	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr7:31867930T>G	ENST00000396191.1	-	12	1716	c.1261A>C	c.(1261-1263)Act>Cct	p.T421P	PDE1C_ENST00000396184.3_Missense_Mutation_p.T421P|PDE1C_ENST00000321453.7_Missense_Mutation_p.T421P|PDE1C_ENST00000396193.1_Missense_Mutation_p.T481P|PDE1C_ENST00000396182.2_Missense_Mutation_p.T421P	NM_001191057.1	NP_001177986.1	Q14123	PDE1C_HUMAN	phosphodiesterase 1C, calmodulin-dependent 70kDa	421	Catalytic. {ECO:0000250}.				activation of phospholipase C activity (GO:0007202)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)	cytosol (GO:0005829)	calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)	p.T421P(2)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(38)|prostate(4)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	81			GBM - Glioblastoma multiforme(11;0.216)		Caffeine(DB00201)	GCAACCATAGTGGACTTTCGG	0.468																																					p.T481P		.											.	PDE1C-94	2	Substitution - Missense(2)	haematopoietic_and_lymphoid_tissue(2)	c.A1441C						.						85.0	77.0	80.0					7																	31867930		2203	4300	6503	SO:0001583	missense	5137	exon13			CCATAGTGGACTT	U40371	CCDS5437.1, CCDS55099.1, CCDS55100.1	7p15.1-p14.3	2008-05-15	2002-08-29		ENSG00000154678	ENSG00000154678	3.1.4.17	"""Phosphodiesterases"""	8776	protein-coding gene	gene with protein product		602987	"""phosphodiesterase 1C, calmodulin-dependent (70kD)"""			8557689	Standard	XM_005249769		Approved	Hcam3	uc003tco.2	Q14123	OTTHUMG00000023836	ENST00000396191.1:c.1261A>C	7.37:g.31867930T>G	ENSP00000379494:p.Thr421Pro	Somatic	73	0		WXS	Illumina GAIIx	Phase_I	85	4	NM_001191058	0	0	0	0	0	B3KPC6|E9PE92|Q14124|Q8NB10	Missense_Mutation	SNP	ENST00000396191.1	37	CCDS55099.1	.	.	.	.	.	.	.	.	.	.	T	29.6	5.018863	0.93404	.	.	ENSG00000154678	ENST00000396193;ENST00000396191;ENST00000321453;ENST00000396184;ENST00000396182	D;D;D;D;D	0.82619	-1.63;-1.63;-1.63;-1.63;-1.63	5.61	5.61	0.85477	5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.000000	0.85682	D	0.000000	D	0.89588	0.6758	M	0.62088	1.915	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.998	D;D;D	0.74348	0.983;0.977;0.952	D	0.90601	0.4544	10	0.87932	D	0	.	15.759	0.78063	0.0:0.0:0.0:1.0	.	421;481;421	Q14123-2;E9PE92;Q14123	.;.;PDE1C_HUMAN	P	481;421;421;421;421	ENSP00000379496:T481P;ENSP00000379494:T421P;ENSP00000318105:T421P;ENSP00000379487:T421P;ENSP00000379485:T421P	ENSP00000318105:T421P	T	-	1	0	PDE1C	31834455	1.000000	0.71417	0.931000	0.37212	0.995000	0.86356	7.945000	0.87732	2.269000	0.75478	0.533000	0.62120	ACT	.		0.468	PDE1C-006	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328458.1		
RAMP3	10268	hgsc.bcm.edu	37	7	45197433	45197433	+	Silent	SNP	G	G	A	rs67477213	byFrequency	TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr7:45197433G>A	ENST00000242249.4	+	1	44	c.6G>A	c.(4-6)gaG>gaA	p.E2E	RAMP3_ENST00000481345.1_Silent_p.E2E|RAMP3_ENST00000496212.1_Silent_p.E2E	NM_005856.2	NP_005847.1	O60896	RAMP3_HUMAN	receptor (G protein-coupled) activity modifying protein 3	2					calcium ion transport (GO:0006816)|cellular response to estradiol stimulus (GO:0071392)|G-protein coupled receptor signaling pathway involved in heart process (GO:0086103)|intracellular protein transport (GO:0006886)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of receptor recycling (GO:0001921)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|receptor internalization (GO:0031623)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	coreceptor activity (GO:0015026)|protein transporter activity (GO:0008565)|receptor activity (GO:0004872)			breast(1)|endometrium(1)|large_intestine(4)|lung(4)|stomach(1)	11					Pramlintide(DB01278)	CAGCCATGGAGACTGGAGCGC	0.771													G|||	1244	0.248403	0.4947	0.1657	5008	,	,		7876	0.0159		0.2276	False		,,,				2504	0.2352				p.E2E		.											.	RAMP3-90	0			c.G6A						.	G		1194,2386		196,802,792	3.0	3.0	3.0		6	2.0	0.0	7	dbSNP_130	3	1312,6004		141,1030,2487	no	coding-synonymous	RAMP3	NM_005856.2		337,1832,3279	AA,AG,GG		17.9333,33.352,22.9993		2/149	45197433	2506,8390	1790	3658	5448	SO:0001819	synonymous_variant	10268	exon1			CATGGAGACTGGA	AJ001016	CCDS5503.1	7p13-p12	2006-11-21	2006-11-21		ENSG00000122679	ENSG00000122679		"""Receptor (G protein-coupled) activity modifying proteins"""	9845	protein-coding gene	gene with protein product		605155	"""receptor activity modifying protein 3"", ""receptor (calcitonin) activity modifying protein 3"""				Standard	NM_005856		Approved		uc003tnb.3	O60896	OTTHUMG00000023729	ENST00000242249.4:c.6G>A	7.37:g.45197433G>A		Somatic	2	0		WXS	Illumina GAIIx	Phase_I	10	8	NM_005856	0	0	0	0	0	Q7Z2Y1	Silent	SNP	ENST00000242249.4	37	CCDS5503.1																																																																																			G|0.760;A|0.240		0.771	RAMP3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251343.1	NM_005856	
SCRIB	23513	hgsc.bcm.edu	37	8	144874554	144874554	+	Silent	SNP	T	T	C	rs6991873	byFrequency	TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr8:144874554T>C	ENST00000320476.3	-	32	4356	c.4350A>G	c.(4348-4350)ccA>ccG	p.P1450P	SCRIB_ENST00000356994.2_Silent_p.P1450P|RP11-429J17.8_ENST00000534089.1_RNA|RP11-429J17.8_ENST00000527139.1_RNA|SCRIB_ENST00000377533.3_Silent_p.P1369P|SCRIB_ENST00000546337.1_5'Flank|RP11-429J17.8_ENST00000532625.1_RNA	NM_015356.4	NP_056171	Q14160	SCRIB_HUMAN	scribbled planar cell polarity protein	1450					activation of Rac GTPase activity (GO:0032863)|apoptotic process involved in morphogenesis (GO:0060561)|astrocyte cell migration (GO:0043615)|asymmetric protein localization (GO:0008105)|auditory receptor cell stereocilium organization (GO:0060088)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cochlear nucleus development (GO:0021747)|establishment of apical/basal cell polarity (GO:0035089)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of mitotic cell cycle (GO:0045930)|neural tube closure (GO:0001843)|positive chemotaxis (GO:0050918)|positive regulation of apoptotic process (GO:0043065)|positive regulation of receptor recycling (GO:0001921)|protein localization to adherens junction (GO:0071896)|single organismal cell-cell adhesion (GO:0016337)|synaptic vesicle endocytosis (GO:0048488)|synaptic vesicle targeting (GO:0016080)|viral process (GO:0016032)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cell projection (GO:0042995)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)|Scrib-APC-beta-catenin complex (GO:0034750)				NS(1)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(3)|lung(20)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	42	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;1.12e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			CTCCCAGGGGTGGGGGGGACG	0.751													T|||	4958	0.990016	0.9652	0.9971	5008	,	,		8428	1.0		0.998	False		,,,				2504	1.0				p.P1450P	Pancreas(51;966 1133 10533 14576 29674)	.											.	SCRIB-228	0			c.A4350G						.	T	,	3300,62		1619,62,0	3.0	4.0	4.0		4350,4350	-2.9	0.0	8	dbSNP_116	4	7076,4		3536,4,0	no	coding-synonymous,coding-synonymous	SCRIB	NM_015356.3,NM_182706.3	,	5155,66,0	CC,CT,TT		0.0565,1.8441,0.6321	,	1450/1631,1450/1656	144874554	10376,66	1681	3540	5221	SO:0001819	synonymous_variant	23513	exon32			CAGGGGTGGGGGG	AY062238	CCDS6411.1, CCDS6412.1	8q24.3	2013-03-05	2013-03-05		ENSG00000180900	ENSG00000180900			30377	protein-coding gene	gene with protein product		607733	"""scribbled homolog (Drosophila)"""			11027293, 14681682	Standard	NM_182706		Approved	KIAA0147, SCRB1, Vartul	uc003yzo.1	Q14160	OTTHUMG00000165154	ENST00000320476.3:c.4350A>G	8.37:g.144874554T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_015356	0	0	0	0	0	Q6P496|Q7Z5D1|Q8WWV8|Q96C69|Q96GG1	Silent	SNP	ENST00000320476.3	37	CCDS6411.1	2162	0.98992673992674	472	0.959349593495935	361	0.9972375690607734	572	1.0	757	0.9986807387862797	T	5.986	0.365776	0.11352	0.981559	0.999435	ENSG00000180900	ENST00000526832	.	.	.	4.01	-2.89	0.05665	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.20773	-1.0265	3	.	.	.	.	6.6143	0.22769	0.0:0.6476:0.1513:0.201	rs6991873	.	.	.	A	470	.	.	T	-	1	0	SCRIB	144946542	0.000000	0.05858	0.000000	0.03702	0.031000	0.12232	-0.411000	0.07142	-0.857000	0.04115	-0.386000	0.06593	ACC	T|0.010;C|0.990		0.751	SCRIB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000382215.1	NM_015356	
PLEC	5339	hgsc.bcm.edu	37	8	145001784	145001784	+	Silent	SNP	A	A	G	rs3135109	byFrequency	TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr8:145001784A>G	ENST00000322810.4	-	27	4130	c.3961T>C	c.(3961-3963)Ttg>Ctg	p.L1321L	PLEC_ENST00000354958.2_Silent_p.L1162L|PLEC_ENST00000527096.1_Silent_p.L1207L|PLEC_ENST00000356346.3_Silent_p.L1170L|PLEC_ENST00000357649.2_Silent_p.L1188L|PLEC_ENST00000354589.3_Silent_p.L1184L|PLEC_ENST00000345136.3_Silent_p.L1184L|PLEC_ENST00000398774.2_Silent_p.L1152L|PLEC_ENST00000436759.2_Silent_p.L1211L	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	1321	Globular 1.		L -> V (in dbSNP:rs3135109). {ECO:0000269|PubMed:8698233}.		apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CGCTCAAGCAACTGGGCGACC	0.716													G|||	1156	0.230831	0.028	0.2954	5008	,	,		12494	0.1429		0.4274	False		,,,				2504	0.3476				p.L1321L		.											.	PLEC-141	0			c.T3961C						.	G	,,,,,,,	296,3620		20,256,1682	5.0	6.0	6.0		3631,3508,3484,3961,3454,3550,3562,3550	4.4	0.9	8	dbSNP_103	6	2835,5065		532,1771,1647	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	,,,,,,,	552,2027,3329	GG,GA,AA		35.8861,7.5587,26.498	,,,,,,,	1211/4575,1170/4534,1162/4526,1321/4685,1152/4516,1184/4548,1188/4552,1184/4548	145001784	3131,8685	1958	3950	5908	SO:0001819	synonymous_variant	5339	exon27			CAAGCAACTGGGC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.3961T>C	8.37:g.145001784A>G		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	25	25	NM_201380	0	0	0	0	0	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																			G|0.246;A|0.754		0.716	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
ZNF517	340385	hgsc.bcm.edu	37	8	146033347	146033347	+	Missense_Mutation	SNP	T	T	C	rs2976653	byFrequency	TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr8:146033347T>C	ENST00000531720.1	+	4	1091	c.1046T>C	c.(1045-1047)gTg>gCg	p.V349A	ZNF517_ENST00000525105.1_Intron|ZNF517_ENST00000526178.1_Intron|ZNF517_ENST00000359971.3_Missense_Mutation_p.V349A			Q6ZMY9	ZN517_HUMAN	zinc finger protein 517	349				V -> A (in Ref. 1; BAD18586). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(2)|lung(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_cancers(97;1.03e-11)|all_epithelial(106;6.69e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;5.47e-39)|OV - Ovarian serous cystadenocarcinoma(54;6.38e-39)|all cancers(56;5.47e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)			GACGGCGGCGTGGGGCAGGGC	0.746													C|||	4981	0.994609	1.0	1.0	5008	,	,		12856	1.0		0.994	False		,,,				2504	0.9785				p.V349A		.											.	ZNF517-90	0			c.T1046C						.	C	ALA/VAL	3411,3		1704,3,0	3.0	5.0	4.0		1046	-0.8	0.0	8	dbSNP_101	4	7050,46		3502,46,0	no	missense	ZNF517	NM_213605.2	64	5206,49,0	CC,CT,TT		0.6483,0.0879,0.4662	benign	349/493	146033347	10461,49	1707	3548	5255	SO:0001583	missense	340385	exon5			GCGGCGTGGGGCA	AK096527	CCDS6434.1	8q24.3	2013-01-08				ENSG00000197363		"""Zinc fingers, C2H2-type"", ""-"""	27984	protein-coding gene	gene with protein product							Standard	NM_213605		Approved		uc003zed.1	Q6ZMY9		ENST00000531720.1:c.1046T>C	8.37:g.146033347T>C	ENSP00000436103:p.Val349Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	9	NM_213605	0	0	0	0	0		Missense_Mutation	SNP	ENST00000531720.1	37	CCDS6434.1	2179|2179	0.9977106227106227|0.9977106227106227	492|492	1.0|1.0	362|362	1.0|1.0	572|572	1.0|1.0	753|753	0.9934036939313984|0.9934036939313984	C|C	0.021|0.021	-1.418607|-1.418607	0.01136|0.01136	0.999121|0.999121	0.993517|0.993517	ENSG00000197363|ENSG00000197363	ENST00000359971;ENST00000531720|ENST00000529429	T;T|.	0.05319|.	3.46;3.46|.	2.17|2.17	-0.838|-0.838	0.10762|0.10762	.|.	.|.	.|.	.|.	.|.	T|T	0.00012|0.00012	0.0000|0.0000	L|L	0.35644|0.35644	1.08|1.08	0.80722|0.80722	P|P	0.0|0.0	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|T	0.21449|0.21449	-1.0245|-1.0245	8|4	0.59425|.	D|.	0.04|.	.|.	0.241|0.241	0.00192|0.00192	0.362:0.2246:0.2135:0.1999|0.362:0.2246:0.2135:0.1999	rs2976653;rs59817342|rs2976653;rs59817342	349|.	Q6ZMY9|.	ZN517_HUMAN|.	A|R	349|316	ENSP00000353058:V349A;ENSP00000436103:V349A|.	ENSP00000353058:V349A|.	V|W	+|+	2|1	0|0	ZNF517|ZNF517	146004151|146004151	0.001000|0.001000	0.12720|0.12720	0.002000|0.002000	0.10522|0.10522	0.004000|0.004000	0.04260|0.04260	-0.400000|-0.400000	0.07241|0.07241	-0.612000|-0.612000	0.05701|0.05701	-1.157000|-1.157000	0.01802|0.01802	GTG|TGG	G|0.992;C|0.006		0.746	ZNF517-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382642.1	XM_291261	
ERMP1	79956	hgsc.bcm.edu	37	9	5832719	5832719	+	Missense_Mutation	SNP	G	G	C	rs13302671	byFrequency	TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr9:5832719G>C	ENST00000339450.5	-	1	398	c.309C>G	c.(307-309)caC>caG	p.H103Q	ERMP1_ENST00000214893.5_5'UTR|ERMP1_ENST00000381506.3_5'Flank	NM_024896.2	NP_079172.2	Q7Z2K6	ERMP1_HUMAN	endoplasmic reticulum metallopeptidase 1	103						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			endometrium(2)|kidney(1)|large_intestine(9)|lung(4)|ovary(1)|prostate(2)|skin(1)	20		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00115)|Lung(218;0.111)		ACTCCCCGCGGTGTCCAGCGG	0.751													G|||	78	0.0155751	0.0204	0.0216	5008	,	,		2342	0.001		0.0318	False		,,,				2504	0.0031				p.H103Q		.											.	ERMP1-69	0			c.C309G						.	G	GLN/HIS	34,3206		0,34,1586	4.0	3.0	3.0		309	4.4	0.0	9	dbSNP_121	3	104,6552		0,104,3224	yes	missense	ERMP1	NM_024896.2	24	0,138,4810	CC,CG,GG		1.5625,1.0494,1.3945	benign	103/905	5832719	138,9758	1620	3328	4948	SO:0001583	missense	79956	exon1			CCCGCGGTGTCCA	AB058718	CCDS34983.1	9p24	2008-02-05	2007-07-05	2007-07-05	ENSG00000099219	ENSG00000099219			23703	protein-coding gene	gene with protein product	"""Felix-ina"""	611156	"""KIAA1815"""	KIAA1815		11347906	Standard	XM_005251587		Approved	FLJ23309, FXNA	uc003zjm.1	Q7Z2K6	OTTHUMG00000019508	ENST00000339450.5:c.309C>G	9.37:g.5832719G>C	ENSP00000340427:p.His103Gln	Somatic	6	0		WXS	Illumina GAIIx	Phase_I	15	6	NM_024896	0	0	0	0	0	B2RNA4|B3KSB1|Q8N5T5|Q9H5M1	Missense_Mutation	SNP	ENST00000339450.5	37	CCDS34983.1	38	0.0173992673992674	13	0.026422764227642278	8	0.022099447513812154	0	0.0	17	0.022427440633245383	G	5.805	0.332747	0.11013	0.010494	0.015625	ENSG00000099219	ENST00000339450	T	0.43294	0.95	4.44	4.44	0.53790	.	1.479950	0.04451	N	0.372552	T	0.14700	0.0355	L	0.38175	1.15	0.43377	D	0.995479	B;B	0.14438	0.01;0.009	B;B	0.11329	0.004;0.006	T	0.06770	-1.0808	10	0.11182	T	0.66	0.2942	10.7252	0.46064	0.0883:0.0:0.9117:0.0	rs13302671	103;103	E7ER77;Q7Z2K6	.;ERMP1_HUMAN	Q	103	ENSP00000340427:H103Q	ENSP00000340427:H103Q	H	-	3	2	ERMP1	5822719	0.000000	0.05858	0.003000	0.11579	0.066000	0.16364	0.333000	0.19768	2.009000	0.58944	0.462000	0.41574	CAC	G|0.981;C|0.019		0.751	ERMP1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354877.1	NM_024896	
SPTAN1	6709	broad.mit.edu	37	9	131371246	131371246	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr9:131371246G>T	ENST00000372731.4	+	35	4695	c.4585G>T	c.(4585-4587)Gtc>Ttc	p.V1529F	SPTAN1_ENST00000372739.3_Missense_Mutation_p.V1529F|SPTAN1_ENST00000358161.5_Missense_Mutation_p.V1529F	NM_001195532.1|NM_003127.3	NP_001182461.1|NP_003118.2	Q13813	SPTN1_HUMAN	spectrin, alpha, non-erythrocytic 1	1529					actin filament capping (GO:0051693)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cuticular plate (GO:0032437)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intracellular membrane-bounded organelle (GO:0043231)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|spectrin (GO:0008091)|vesicle (GO:0031982)|Z disc (GO:0030018)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(2)|breast(8)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(21)|liver(1)|lung(25)|ovary(5)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	87						GCGCAATGAGGTCTTGGACAG	0.577																																					p.V1529F	NSCLC(120;833 1744 2558 35612 37579)	.											.	SPTAN1-158	0			c.G4585T						.						112.0	115.0	114.0					9																	131371246		2203	4300	6503	SO:0001583	missense	6709	exon35			AATGAGGTCTTGG	M19725	CCDS6905.1, CCDS48036.1, CCDS75914.1	9q34.11	2013-01-10	2012-06-15		ENSG00000197694	ENSG00000197694		"""EF-hand domain containing"""	11273	protein-coding gene	gene with protein product	"""alpha-fodrin"""	182810				3336352	Standard	NM_003127		Approved		uc004bvm.4	Q13813	OTTHUMG00000020754	ENST00000372731.4:c.4585G>T	9.37:g.131371246G>T	ENSP00000361816:p.Val1529Phe	Somatic	175	0		WXS	Illumina GAIIx	Phase_I	187	6	NM_003127	0	0	0	0	0	Q13186|Q15324|Q16606|Q59EF1|Q5VXV5|Q5VXV6|Q7Z6M5|Q9P0V0	Missense_Mutation	SNP	ENST00000372731.4	37	CCDS6905.1	.	.	.	.	.	.	.	.	.	.	G	25.7	4.667783	0.88348	.	.	ENSG00000197694	ENST00000358161;ENST00000372731;ENST00000372739;ENST00000372719	T;T;T	0.54071	0.59;0.59;0.59	5.77	4.87	0.63330	.	0.000000	0.85682	D	0.000000	T	0.78387	0.4275	M	0.92077	3.27	0.80722	D	1	D;D;D	0.71674	0.998;0.962;0.97	D;P;P	0.72625	0.978;0.575;0.7	D	0.84613	0.0679	10	0.87932	D	0	.	15.2412	0.73471	0.0676:0.0:0.9324:0.0	.	1509;1529;1529	Q13813-3;Q13813-2;Q13813	.;.;SPTA2_HUMAN	F	1529;1529;1529;1509	ENSP00000350882:V1529F;ENSP00000361816:V1529F;ENSP00000361824:V1529F	ENSP00000350882:V1529F	V	+	1	0	SPTAN1	130411067	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.420000	0.97426	1.581000	0.49865	0.655000	0.94253	GTC	.		0.577	SPTAN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054472.1	NM_003127	
SNAPC4	6621	bcgsc.ca	37	9	139273288	139273288	+	Silent	SNP	C	C	T	rs3829112	byFrequency	TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr9:139273288C>T	ENST00000298532.2	-	21	3359	c.2991G>A	c.(2989-2991)gaG>gaA	p.E997E		NM_003086.2	NP_003077.2			small nuclear RNA activating complex, polypeptide 4, 190kDa											biliary_tract(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(3)|skin(2)|urinary_tract(1)	33		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.31e-06)|Epithelial(140;7.13e-06)		GGGCTGTGCCCTCGGCCTCTG	0.667													C|||	945	0.188698	0.0893	0.2594	5008	,	,		10947	0.2738		0.161	False		,,,				2504	0.2137				p.E997E		.											.	SNAPC4-90	0			c.G2991A						.	C		382,4000		17,348,1826	15.0	18.0	17.0		2991	1.9	0.0	9	dbSNP_107	17	1323,7263		102,1119,3072	no	coding-synonymous	SNAPC4	NM_003086.2		119,1467,4898	TT,TC,CC		15.4088,8.7175,13.1477		997/1470	139273288	1705,11263	2191	4293	6484	SO:0001819	synonymous_variant	6621	exon21			TGTGCCCTCGGCC	AF032387	CCDS6998.1	9q34.3	2008-07-21	2002-08-29		ENSG00000165684	ENSG00000165684			11137	protein-coding gene	gene with protein product		602777	"""small nuclear RNA activating complex, polypeptide 4, 190kD"""			9418884	Standard	XM_005266096		Approved	SNAP190, PTFalpha, FLJ13451	uc004chh.3	Q5SXM2	OTTHUMG00000020929	ENST00000298532.2:c.2991G>A	9.37:g.139273288C>T		Somatic	200	3		WXS	Illumina GAIIx	Phase_I	250	8	NM_003086	0	0	0	0	0		Silent	SNP	ENST00000298532.2	37	CCDS6998.1																																																																																			C|0.845;T|0.155		0.667	SNAPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055071.1	NM_003086	
AR	367	hgsc.bcm.edu	37	X	66765159	66765182	+	In_Frame_Del	DEL	GCAGCAGCAGCAGCAGCAGCAGCA	GCAGCAGCAGCAGCAGCAGCAGCA	-	rs137852575|rs200185441|rs62636528|rs62636527	byFrequency	TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10	GCAGCAGCAGCAGCAGCAGCAGCA	GCAGCAGCAGCAGCAGCAGCAGCA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chrX:66765159_66765182delGCAGCAGCAGCAGCAGCAGCAGCA	ENST00000374690.3	+	1	695_718	c.171_194delGCAGCAGCAGCAGCAGCAGCAGCA	c.(169-195)ctgcagcagcagcagcagcagcagcag>ctg	p.QQQQQQQQ66del	AR_ENST00000396044.3_In_Frame_Del_p.QQQQQQQQ66del|AR_ENST00000504326.1_In_Frame_Del_p.QQQQQQQQ66del|AR_ENST00000513847.1_3'UTR	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	66	Gln-rich.|Modulating.|Poly-Gln.				androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.Q58L(2)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	TGCTGCTGCTgcagcagcagcagcagcagcagcagcagcagcag	0.656									Androgen Insensitivity Syndrome																												p.57_65del		.											.	AR-661	2	Substitution - Missense(2)	lung(1)|endometrium(1)	c.171_194del	GRCh37	CD991588|CI065812|CI994028|CM033749|CM054646|CM930034	AR	D|I|M	rs137852575|rs5902610	.																																			SO:0001651	inframe_deletion	367	exon1	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	GCTGCTGCAGCAG	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	ENST00000374690.3:c.171_194delGCAGCAGCAGCAGCAGCAGCAGCA	X.37:g.66765159_66765182delGCAGCAGCAGCAGCAGCAGCAGCA	ENSP00000363822:p.Gln66_Gln73del	Somatic	60	0		WXS	Illumina GAIIx	Phase_I	118	24	NM_000044	0	0	0	0	0	A2RUN2|B1AKD7|Q9UD95	In_Frame_Del	DEL	ENST00000374690.3	37	CCDS14387.1																																																																																			.		0.656	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057007.1	NM_000044	
GPRASP2	114928	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	101971094	101971094	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chrX:101971094G>T	ENST00000535209.1	+	4	2128	c.1297G>T	c.(1297-1299)Gct>Tct	p.A433S	GPRASP2_ENST00000332262.5_Missense_Mutation_p.A433S|GPRASP2_ENST00000543253.1_Missense_Mutation_p.A433S			Q96D09	GASP2_HUMAN	G protein-coupled receptor associated sorting protein 2	433						cytoplasm (GO:0005737)	beta-amyloid binding (GO:0001540)			breast(3)|endometrium(5)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	30						CAGTTTGGGGGCTGTGGCCAG	0.572																																					p.A433S		.											.	GPRASP2-131	0			c.G1297T						.						81.0	80.0	80.0					X																	101971094		2203	4300	6503	SO:0001583	missense	114928	exon4			TTGGGGGCTGTGG	AK094646	CCDS14501.1	Xq22.1	2014-03-21			ENSG00000158301	ENSG00000158301		"""Armadillo repeat containing"""	25169	protein-coding gene	gene with protein product						15086532, 16221301	Standard	NM_138437		Approved	GASP2, FLJ37327		Q96D09	OTTHUMG00000022059	ENST00000535209.1:c.1297G>T	X.37:g.101971094G>T	ENSP00000437394:p.Ala433Ser	Somatic	132	0		WXS	Illumina GAIIx	Phase_I	204	12	NM_138437	0	0	0	0	0	D3DXA0|Q8NAB4	Missense_Mutation	SNP	ENST00000535209.1	37	CCDS14501.1	.	.	.	.	.	.	.	.	.	.	G	9.961	1.222843	0.22457	.	.	ENSG00000158301	ENST00000543253;ENST00000535209;ENST00000332262	T;T;T	0.08807	3.05;3.05;3.05	4.44	4.44	0.53790	.	0.000000	0.42420	D	0.000714	T	0.05502	0.0145	L	0.35414	1.06	0.30743	N	0.745959	B	0.30824	0.296	B	0.23419	0.046	T	0.14254	-1.0479	10	0.10902	T	0.67	.	9.5262	0.39165	0.0:0.2088:0.7912:0.0	.	433	Q96D09	GASP2_HUMAN	S	433	ENSP00000437872:A433S;ENSP00000437394:A433S;ENSP00000339057:A433S	ENSP00000339057:A433S	A	+	1	0	GPRASP2	101857750	0.947000	0.32204	0.995000	0.50966	0.990000	0.78478	1.900000	0.39828	2.458000	0.83093	0.600000	0.82982	GCT	.		0.572	GPRASP2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057626.2	NM_138437	
PLXNB3	5365	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	153032639	153032639	+	Silent	SNP	G	G	A			TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chrX:153032639G>A	ENST00000361971.5	+	3	471	c.357G>A	c.(355-357)ctG>ctA	p.L119L	U52111.14_ENST00000434284.1_RNA|PLXNB3_ENST00000538776.1_Intron|PLXNB3_ENST00000538966.1_Silent_p.L142L|PLXNB3_ENST00000538543.1_Intron|U52111.14_ENST00000416854.1_RNA|PLXNB3_ENST00000538282.1_Intron	NM_005393.2	NP_005384.2	Q9ULL4	PLXB3_HUMAN	plexin B3	119	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|cell chemotaxis (GO:0060326)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|negative regulation of GTPase activity (GO:0034260)|negative regulation of lamellipodium assembly (GO:0010593)|positive chemotaxis (GO:0050918)|positive regulation of endothelial cell proliferation (GO:0001938)|semaphorin-plexin signaling pathway (GO:0071526)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)			central_nervous_system(1)|endometrium(7)|large_intestine(2)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	32	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					CCAACCAGCTGCTGCTGGTGA	0.677																																					p.L142L		.											.	PLXNB3-130	0			c.G426A						.						16.0	15.0	15.0					X																	153032639		2184	4287	6471	SO:0001819	synonymous_variant	5365	exon4			CCAGCTGCTGCTG	AF149019	CCDS14729.1, CCDS55536.1	Xq28	2008-02-05			ENSG00000198753	ENSG00000198753		"""Plexins"""	9105	protein-coding gene	gene with protein product		300214		PLXN6		10520995	Standard	NM_005393		Approved	PLEXR, PLEXB3	uc010nuk.2	Q9ULL4	OTTHUMG00000024217	ENST00000361971.5:c.357G>A	X.37:g.153032639G>A		Somatic	72	1		WXS	Illumina GAIIx	Phase_I	151	38	NM_001163257	0	0	0	0	0	B7Z3E6|F5H773|Q9HDA4	Silent	SNP	ENST00000361971.5	37	CCDS14729.1																																																																																			.		0.677	PLXNB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061063.1		
AVL9	23080	broad.mit.edu	37	7	32535342	32535343	+	Frame_Shift_Ins	INS	-	-	G			TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr7:32535342_32535343insG	ENST00000318709.4	+	1	242_243	c.21_22insG	c.(22-24)gggfs	p.G8fs	LSM5_ENST00000409909.3_5'Flank|LSM5_ENST00000409952.3_5'Flank|AVL9_ENST00000409301.1_Frame_Shift_Ins_p.G8fs|AVL9_ENST00000459629.1_3'UTR|AVL9_ENST00000404479.1_Frame_Shift_Ins_p.G8fs	NM_015060.1	NP_055875.1	Q8NBF6	AVL9_HUMAN	AVL9 homolog (S. cerevisiase)	8					cell migration (GO:0016477)	integral component of membrane (GO:0016021)|recycling endosome (GO:0055037)				endometrium(3)|kidney(1)|large_intestine(3)|lung(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18						CCAGGAGAGGCGGGGATGGCGT	0.718																																					p.G7fs		.											.	AVL9-90	0			c.21_22insG						.			54,3176		7,40,1568						-1.4	0.0			11	106,6304		12,82,3111	no	frameshift	AVL9	NM_015060.1		19,122,4679	A1A1,A1R,RR		1.6537,1.6718,1.6598				160,9480				SO:0001589	frameshift_variant	23080	exon1			GAGAGGCGGGGAT	D87682	CCDS34613.1	7p14.3	2013-05-01	2008-10-03	2008-10-03	ENSG00000105778	ENSG00000105778			28994	protein-coding gene	gene with protein product		612927	"""KIAA0241"""	KIAA0241		17229886, 22595670	Standard	XM_005249668		Approved		uc003tcv.1	Q8NBF6	OTTHUMG00000152929	ENST00000318709.4:c.25dupG	7.37:g.32535346_32535346dupG	ENSP00000315568:p.Gly8fs	Somatic	64	0		WXS	Illumina GAIIx	Phase_I	208	9	NM_015060	0	0	0	0	0	Q92573	Frame_Shift_Ins	INS	ENST00000318709.4	37	CCDS34613.1																																																																																			.		0.718	AVL9-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328643.1	NM_015060	
SPATA31C1	441452	hgsc.bcm.edu	37	9	90534192	90534193	+	RNA	INS	-	-	TCTTGTCTCCCAGCGTCA	rs567658963|rs536300617	byFrequency	TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr9:90534192_90534193insTCTTGTCTCCCAGCGTCA	ENST00000602681.1	+	0	938_939							P0DKV0	S31C1_HUMAN	SPATA31 subfamily C, member 1						cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											TCCCAGCGTCATCTTGTCTCCC	0.594																																					p.H71delinsHLVSQRH		.											.	.	0			c.212_213insTCTTGTCTCCCAGCGTCA						.																																					441452	exon2			AGCGTCATCTTGT	AK093374		9q22.1	2014-03-18	2012-10-12	2012-10-12	ENSG00000230246	ENSG00000230246			27846	other	unknown			"""family with sequence similarity 75, member C1"""	FAM75C1			Standard	NM_001145124		Approved	FLJ36055	uc010mqi.3	P0DKV0	OTTHUMG00000020160		9.37:g.90534192_90534193insTCTTGTCTCCCAGCGTCA		Somatic	360	0		WXS	Illumina GAIIx	Phase_I	463	0	NM_001145124	0	0	0	0	0		In_Frame_Ins	INS	ENST00000602681.1	37																																																																																				.		0.594	SPATA31C1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000467313.1	NM_001145124	
POTEE	445582	ucsc.edu	37	2	131976171	131976172	+	Missense_Mutation	DNP	CA	CA	TG			TCGA-OR-A5JH-01A-11D-A30A-10	TCGA-OR-A5JH-10A-01D-A30A-10	CA	CA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4eaa9703-dace-478d-b1ea-7c326ad34362	da172edc-7af4-48d6-bbab-2cf091662641	g.chr2:131976171_131976172CA>TG	ENST00000356920.5	+	1	290_291	c.196_197CA>TG	c.(196-198)CAc>TGc	p.H66C	PLEKHB2_ENST00000404460.1_Intron|PLEKHB2_ENST00000303908.3_Intron|POTEE_ENST00000358087.5_Missense_Mutation_p.H66C	NM_001083538.1	NP_001077007.1	Q6S8J3	POTEE_HUMAN	POTE ankyrin domain family, member E	66					retina homeostasis (GO:0001895)|substantia nigra development (GO:0021762)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)											CAAGTGGTGCCACCACTGCTTC	0.594																																					p.H66C		.											.	.	0			c.A197G						.																																			SO:0001583	missense	445582	exon1			GGTGCCACCACTG	AY462868	CCDS46414.1	2q21.1	2014-04-10	2008-11-26	2008-11-26	ENSG00000188219	ENSG00000188219		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33895	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 2"""	608914	"""ANKRD26-like family C, member 1A"""	A26C1A			Standard	NM_001083538		Approved	POTE2, POTE-2, A26C1, POTE2gamma, CT104.2	uc002tsn.2	Q6S8J3	OTTHUMG00000186974	Exception_encountered	2.37:g.131976171_131976172delinsTG	ENSP00000439189:p.His66Cys	Somatic	211	0		WXS	Illumina GAIIx	Phase_I	173	0	NM_001083538	0	0	0	0	0	Q6S8J4|Q6S8J5|Q6S8J8	Missense_Mutation	DNP	ENST00000356920.5	37	CCDS46414.1																																																																																			A|0.500;G|0.500		0.594	POTEE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001083538	
