#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PRAMEF1	65121	ucsc.edu	37	1	12854162	12854162	+	Missense_Mutation	SNP	C	C	T	rs199893374		TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr1:12854162C>T	ENST00000332296.7	+	3	489	c.386C>T	c.(385-387)aCg>aTg	p.T129M	PRAMEF1_ENST00000400814.3_5'Flank	NM_023013.2	NP_075389.1	O95521	PRAM1_HUMAN	PRAME family member 1	129					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	35	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CCAGAGACCACGAGTAAGAGG	0.542																																					p.T129M		.											.	PRAMEF1-22	0			c.C386T						.						179.0	199.0	192.0					1																	12854162		2203	4300	6503	SO:0001583	missense	65121	exon3			AGACCACGAGTAA	AL049686	CCDS148.1	1p36.21	2013-01-17			ENSG00000116721	ENSG00000116721		"""-"""	28840	protein-coding gene	gene with protein product							Standard	NM_023013		Approved		uc001auj.2	O95521	OTTHUMG00000001928	ENST00000332296.7:c.386C>T	1.37:g.12854162C>T	ENSP00000332134:p.Thr129Met	Somatic	184	10		WXS	Illumina GAIIx	Phase_I	138	33	NM_023013	0	0	0	0	0	Q9UQP2	Missense_Mutation	SNP	ENST00000332296.7	37	CCDS148.1	.	.	.	.	.	.	.	.	.	.	.	0.003	-2.494679	0.00159	.	.	ENSG00000116721	ENST00000332296	T	0.14022	2.54	1.31	-2.62	0.06152	.	1.683690	0.03848	N	0.271773	T	0.03095	0.0091	N	0.00926	-1.1	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.21586	-1.0241	10	0.02654	T	1	.	1.0679	0.01615	0.1651:0.377:0.1648:0.293	.	129	O95521	PRAM1_HUMAN	M	129	ENSP00000332134:T129M	ENSP00000332134:T129M	T	+	2	0	PRAMEF1	12776749	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.902000	0.00338	-2.916000	0.00306	-2.560000	0.00174	ACG	.		0.542	PRAMEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005458.1	NM_023013	
UBR4	23352	bcgsc.ca	37	1	19433449	19433449	+	Silent	SNP	A	A	G	rs6426677	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr1:19433449A>G	ENST00000375254.3	-	82	12144	c.12117T>C	c.(12115-12117)gtT>gtC	p.V4039V	UBR4_ENST00000375226.2_Silent_p.V4015V|UBR4_ENST00000375267.2_Silent_p.V4039V|UBR4_ENST00000375217.2_Silent_p.V4032V|UBR4_ENST00000375224.1_5'Flank	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	4039					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		TGAGGGCCTCAACGGGGACAT	0.602													G|||	3602	0.719249	0.8366	0.7334	5008	,	,		18352	0.8105		0.6083	False		,,,				2504	0.5706				p.V4039V		.											.	UBR4-612	0			c.T12117C						.	G		3555,851	335.2+/-303.8	1434,687,82	43.0	42.0	42.0		12117	-11.3	0.0	1	dbSNP_116	42	5182,3418	503.2+/-375.9	1576,2030,694	no	coding-synonymous	UBR4	NM_020765.2		3010,2717,776	GG,GA,AA		39.7442,19.3146,32.8233		4039/5184	19433449	8737,4269	2203	4300	6503	SO:0001819	synonymous_variant	23352	exon82			GGCCTCAACGGGG	AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.12117T>C	1.37:g.19433449A>G		Somatic	335	4		WXS	Illumina GAIIx	Phase_I	257	8	NM_020765	0	0	0	0	0	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Silent	SNP	ENST00000375254.3	37	CCDS189.1																																																																																			A|0.311;G|0.689		0.602	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007085.1	NM_020765	
ZMPSTE24	10269	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	40758252	40758252	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr1:40758252G>A	ENST00000372759.3	+	10	1504	c.1339G>A	c.(1339-1341)Gtt>Att	p.V447I		NM_005857.4	NP_005848.2	O75844	FACE1_HUMAN	zinc metallopeptidase STE24	447					CAAX-box protein processing (GO:0071586)|nuclear envelope organization (GO:0006998)|prenylated protein catabolic process (GO:0030327)|proteolysis (GO:0006508)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|metalloexopeptidase activity (GO:0008235)			endometrium(3)|kidney(3)|large_intestine(4)|lung(4)|prostate(1)|skin(1)	16	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;6.3e-18)			GGGATTCCCTGTTTCTGACTG	0.388																																					p.V447I		.											.	ZMPSTE24-226	0			c.G1339A						.						115.0	118.0	117.0					1																	40758252		2203	4300	6503	SO:0001583	missense	10269	exon10			TTCCCTGTTTCTG	Y13834	CCDS449.1	1p34	2014-09-17	2012-12-10		ENSG00000084073	ENSG00000084073	3.4.24.84		12877	protein-coding gene	gene with protein product	"""Hutchinson-Gilford progeria syndrome"", ""CAAX prenyl protease 1 homolog"""	606480	"""zinc metalloproteinase (STE24 homolog, yeast)"", ""zinc metallopeptidase (STE24 homolog, yeast)"", ""zinc metallopeptidase STE24 homolog (S. cerevisiae)"""			10373325, 9700155, 16671095	Standard	NM_005857		Approved	FACE-1, Ste24p, STE24, HGPS, PRO1	uc001cfg.4	O75844	OTTHUMG00000005762	ENST00000372759.3:c.1339G>A	1.37:g.40758252G>A	ENSP00000361845:p.Val447Ile	Somatic	90	0		WXS	Illumina GAIIx	Phase_I	70	52	NM_005857	0	0	0	25	25	B3KQI7|D3DPU7|Q8NDZ8|Q9UBQ2	Missense_Mutation	SNP	ENST00000372759.3	37	CCDS449.1	.	.	.	.	.	.	.	.	.	.	G	16.07	3.019355	0.54576	.	.	ENSG00000084073	ENST00000372759	T	0.74947	-0.89	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	T	0.60521	0.2275	N	0.05124	-0.11	0.80722	D	1	P	0.37083	0.581	B	0.41946	0.371	T	0.60219	-0.7306	10	0.18276	T	0.48	-12.1079	18.79	0.91969	0.0:0.0:1.0:0.0	.	447	O75844	FACE1_HUMAN	I	447	ENSP00000361845:V447I	ENSP00000361845:V447I	V	+	1	0	ZMPSTE24	40530839	1.000000	0.71417	0.997000	0.53966	0.931000	0.56810	9.388000	0.97237	2.442000	0.82660	0.467000	0.42956	GTT	.		0.388	ZMPSTE24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015766.1		
BEST4	266675	hgsc.bcm.edu	37	1	45252159	45252159	+	Missense_Mutation	SNP	T	T	C	rs41306591	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr1:45252159T>C	ENST00000372207.3	-	3	456	c.457A>G	c.(457-459)Acc>Gcc	p.T153A		NM_153274.2	NP_695006.1	Q8NFU0	BEST4_HUMAN	bestrophin 4	153						chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)			large_intestine(1)|lung(4)|ovary(1)|skin(1)	7	Acute lymphoblastic leukemia(166;0.155)					TGCTCCATGGTGGGGAAGCGC	0.736											OREG0013447	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	T|||	6	0.00119808	0.0	0.0014	5008	,	,		14773	0.0		0.005	False		,,,				2504	0.0				p.T153A		.											.	BEST4-91	0			c.A457G						.	T	ALA/THR	3,4269		0,3,2133	8.0	9.0	8.0		457	5.8	1.0	1	dbSNP_127	8	15,8343		0,15,4164	yes	missense	BEST4	NM_153274.2	58	0,18,6297	CC,CT,TT		0.1795,0.0702,0.1425	probably-damaging	153/474	45252159	18,12612	2136	4179	6315	SO:0001583	missense	266675	exon3			CCATGGTGGGGAA	AF440757	CCDS514.1	1p33-p32.3	2012-09-26	2006-10-18	2006-10-18	ENSG00000142959	ENSG00000142959		"""Ion channels / Chloride channels : Calcium activated : Bestrophins"""	17106	protein-coding gene	gene with protein product		607336	"""vitelliform macular dystrophy 2-like 2"""	VMD2L2		12032738, 16702355	Standard	NM_153274		Approved		uc001cmm.3	Q8NFU0	OTTHUMG00000008488	ENST00000372207.3:c.457A>G	1.37:g.45252159T>C	ENSP00000361281:p.Thr153Ala	Somatic	0	0	930	WXS	Illumina GAIIx	Phase_I	15	12	NM_153274	0	0	0	0	0	Q5JR93	Missense_Mutation	SNP	ENST00000372207.3	37	CCDS514.1	6	0.0027472527472527475	3	0.006097560975609756	1	0.0027624309392265192	0	0.0	2	0.002638522427440633	T	36	5.748484	0.96882	7.02E-4	0.001795	ENSG00000142959	ENST00000372207	D	0.98264	-4.83	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	D	0.98588	0.9528	M	0.93808	3.46	0.58432	D	0.999995	P	0.44281	0.831	P	0.55713	0.782	D	0.96014	0.9004	10	0.72032	D	0.01	-32.0345	14.8939	0.70630	0.0:0.0:0.0:1.0	rs41306591	153	Q8NFU0	BEST4_HUMAN	A	153	ENSP00000361281:T153A	ENSP00000361281:T153A	T	-	1	0	BEST4	45024746	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.089000	0.71384	2.200000	0.70718	0.459000	0.35465	ACC	T|0.997;C|0.003		0.736	BEST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023425.1	NM_153274	
CTBS	1486	broad.mit.edu	37	1	85039999	85040007	+	In_Frame_Del	DEL	GCAGCGCCA	GCAGCGCCA	-	rs142534762|rs3217269|rs199701060|rs201060055	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr1:85039999_85040007delGCAGCGCCA	ENST00000370630.5	-	1	140_148	c.92_100delTGGCGCTGC	c.(91-102)ctggcgctgcgg>cgg	p.LAL31del	CTBS_ENST00000477677.1_5'UTR	NM_004388.2	NP_004379.1	Q01459	DIAC_HUMAN	chitobiase, di-N-acetyl-	31					chitin catabolic process (GO:0006032)|oligosaccharide catabolic process (GO:0009313)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	chitinase activity (GO:0004568)			breast(1)|endometrium(1)|large_intestine(4)|lung(2)|ovary(1)	9				all cancers(265;0.00727)|Epithelial(280;0.0192)|OV - Ovarian serous cystadenocarcinoma(397;0.166)		GCCGCGAGCCgcagcgccagcagcgccag	0.718														1537	0.306909	0.5038	0.2954	5008	,	,		11352	0.0556		0.2624	False		,,,				2504	0.3538				p.31_34del		.											.	CTBS-90	0			c.92_100del						.			865,21,1798		349,2,165,3,13,810						-3.6	0.0		dbSNP_134	4	1279,4,4361		415,1,448,1,1,1956	no	codingComplex	CTBS	NM_004388.2		764,3,613,4,14,2766	A1A1,A1A2,A1R,A2A2,A2R,RR		22.7321,33.0104,26.0447				2144,25,6159				SO:0001651	inframe_deletion	1486	exon1			CGAGCCGCAGCGC	M95767	CCDS698.1	1p22	2010-05-04			ENSG00000117151	ENSG00000117151	3.2.1.-		2496	protein-coding gene	gene with protein product		600873		CTB		1549114, 7606925	Standard	NM_004388		Approved		uc001dka.2	Q01459	OTTHUMG00000009922	ENST00000370630.5:c.92_100delTGGCGCTGC	1.37:g.85040008_85040016delGCAGCGCCA	ENSP00000359664:p.Leu31_Leu33del	Somatic	8	0		WXS	Illumina GAIIx	Phase_I	37	14	NM_004388	0	0	0	0	0	Q5VX50	In_Frame_Del	DEL	ENST00000370630.5	37	CCDS698.1																																																																																			.		0.718	CTBS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027457.2	NM_004388	
ATP1A1	476	broad.mit.edu	37	1	116948712	116948712	+	IGR	SNP	G	G	A	rs850610	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr1:116948712G>A	ENST00000295598.5	+	0	3654				ATP1A1OS_ENST00000369491.1_RNA|ATP1A1OS_ENST00000369492.4_RNA	NM_000701.7	NP_000692.2	P05023	AT1A1_HUMAN	ATPase, Na+/K+ transporting, alpha 1 polypeptide						ATP biosynthetic process (GO:0006754)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|membrane hyperpolarization (GO:0060081)|membrane repolarization (GO:0086009)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of glucocorticoid biosynthetic process (GO:0031947)|negative regulation of heart contraction (GO:0045822)|positive regulation of heart contraction (GO:0045823)|positive regulation of striated muscle contraction (GO:0045989)|potassium ion import (GO:0010107)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of sodium ion transport (GO:0002028)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|response to drug (GO:0042493)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|sodium:potassium-exchanging ATPase complex (GO:0005890)|T-tubule (GO:0030315)|vesicle (GO:0031982)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|chaperone binding (GO:0051087)|phosphatase activity (GO:0016791)|potassium ion binding (GO:0030955)|sodium ion binding (GO:0031402)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(2)|breast(2)|cervix(3)|endometrium(2)|kidney(5)|large_intestine(9)|lung(17)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	47	Lung SC(450;0.225)	all_cancers(81;1.28e-06)|all_epithelial(167;3.48e-07)|all_lung(203;2.64e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0164)|LUSC - Lung squamous cell carcinoma(189;0.0548)|Colorectal(144;0.0825)|COAD - Colon adenocarcinoma(174;0.127)|all cancers(265;0.24)	Acetyldigitoxin(DB00511)|Almitrine(DB01430)|Aluminium(DB01370)|Bepridil(DB01244)|Bretylium(DB01158)|Ciclopirox(DB01188)|Deslanoside(DB01078)|Diazoxide(DB01119)|Digitoxin(DB01396)|Digoxin(DB00390)|Ethacrynic acid(DB00903)|Hydroflumethiazide(DB00774)|Ouabain(DB01092)|Trichlormethiazide(DB01021)	GTCTACTTTCGGCATCCCTGG	0.527													G|||	2094	0.418131	0.056	0.5101	5008	,	,		21585	0.2669		0.663	False		,,,				2504	0.7464				.		.											.	.	0			.						.																																			SO:0001628	intergenic_variant	84852	.			ACTTTCGGCATCC	D00099	CCDS887.1, CCDS53351.1, CCDS53352.1	1p13	2012-10-22			ENSG00000163399	ENSG00000163399	3.6.3.9	"""ATPases / P-type"""	799	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-1"", ""sodium pump subunit alpha-1"", ""sodium-potassium ATPase catalytic subunit alpha-1"""	182310					Standard	NM_000701		Approved		uc001ege.3	P05023	OTTHUMG00000012109		1.37:g.116948712G>A		Somatic	100	0		WXS	Illumina GAIIx	Phase_I	65	4	.	0	0	1	1	0	B2RBR6|B7Z2T5|B7Z3U6|F5H3A1|Q16689|Q6LDM4|Q9UCN1|Q9UJ20|Q9UJ21	RNA	SNP	ENST00000295598.5	37	CCDS887.1																																																																																			A|0.382;C|0.006;G|0.610;T|0.002		0.527	ATP1A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000033481.5	NM_001160233	
NOTCH2	4853	hgsc.bcm.edu	37	1	120612006	120612006	+	Silent	SNP	G	G	A	rs4021006	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr1:120612006G>A	ENST00000256646.2	-	1	234	c.15C>T	c.(13-15)cgC>cgT	p.R5R		NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	5					apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)			breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		GCAGAGCGGGGCGCAGGGCGG	0.761			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome				g|||	1973	0.39397	0.2632	0.4049	5008	,	,		21911	0.4315		0.4423	False		,,,				2504	0.4744				p.R5R		.		Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	.	NOTCH2-1441	0			c.C15T						.						6.0	8.0	8.0					1																	120612006		1838	3882	5720	SO:0001819	synonymous_variant	4853	exon1	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	AGCGGGGCGCAGG	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.15C>T	1.37:g.120612006G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	9	NM_024408	0	0	0	4	4	Q5T3X7|Q99734|Q9H240	Silent	SNP	ENST00000256646.2	37	CCDS908.1	.	.	.	.	.	.	.	.	.	.	G	9.758	1.169358	0.21621	.	.	ENSG00000134250	ENST00000538680	.	.	.	2.9	1.95	0.26073	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.0819	0.14661	0.1818:0.0:0.8182:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NOTCH2	120413529	0.988000	0.35896	0.959000	0.39883	0.588000	0.36517	1.074000	0.30703	0.543000	0.28864	0.184000	0.17185	.	G|0.500;A|0.500		0.761	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033679.1	NM_024408	
CGN	57530	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	151503099	151503099	+	Silent	SNP	G	G	A			TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr1:151503099G>A	ENST00000271636.7	+	13	2581	c.2448G>A	c.(2446-2448)caG>caA	p.Q816Q	SNORA44_ENST00000517031.1_RNA	NM_020770.2	NP_065821.1	Q9P2M7	CING_HUMAN	cingulin	810	Glu-rich.				transforming growth factor beta receptor signaling pathway (GO:0007179)	cell junction (GO:0030054)|myosin complex (GO:0016459)|tight junction (GO:0005923)	actin binding (GO:0003779)|motor activity (GO:0003774)			NS(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	Ovarian(49;0.0273)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			GGCAGGAGCAGCAGACACTGA	0.687																																					p.Q816Q		.											.	CGN-93	0			c.G2448A						.						17.0	17.0	17.0					1																	151503099		2200	4294	6494	SO:0001819	synonymous_variant	57530	exon13			GGAGCAGCAGACA	AB037740	CCDS999.1	1q21	2008-02-05			ENSG00000143375	ENSG00000143375			17429	protein-coding gene	gene with protein product		609473				11042084, 12529927	Standard	NM_020770		Approved	KIAA1319	uc009wmw.3	Q9P2M7	OTTHUMG00000012497	ENST00000271636.7:c.2448G>A	1.37:g.151503099G>A		Somatic	38	0		WXS	Illumina GAIIx	Phase_I	74	56	NM_020770	0	0	1	4	3	A6H8L3|A7MD22|Q5T386|Q9NR25	Silent	SNP	ENST00000271636.7	37	CCDS999.1																																																																																			.		0.687	CGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034900.3	NM_020770	
GATAD2B	57459	bcgsc.ca	37	1	153788863	153788863	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr1:153788863G>T	ENST00000368655.4	-	7	1345	c.1102C>A	c.(1102-1104)Cca>Aca	p.P368T		NM_020699.2	NP_065750.1	Q8WXI9	P66B_HUMAN	GATA zinc finger domain containing 2B	368	CR2; histone tail-binding.				ATP-dependent chromatin remodeling (GO:0043044)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(5)|lung(12)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	38	all_lung(78;1.34e-32)|Lung NSC(65;1.04e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			TTAGGGGGTGGGATCTCCAGG	0.527																																					p.P368T		.											.	GATAD2B-90	0			c.C1102A						.						107.0	84.0	92.0					1																	153788863		2203	4300	6503	SO:0001583	missense	57459	exon7			GGGGTGGGATCTC	AF411836	CCDS1054.1	1q21.3	2013-01-25			ENSG00000143614	ENSG00000143614		"""GATA zinc finger domain containing"""	30778	protein-coding gene	gene with protein product	"""transcription repressor p66 beta component of the MeCP1 complex"""	614998				10574461, 11756549	Standard	NM_020699		Approved	P66beta	uc001fdb.4	Q8WXI9	OTTHUMG00000037162	ENST00000368655.4:c.1102C>A	1.37:g.153788863G>T	ENSP00000357644:p.Pro368Thr	Somatic	134	0		WXS	Illumina GAIIx	Phase_I	83	5	NM_020699	0	0	2	2	0	D3DUZ2|Q5VUR2|Q7LG68|Q9ULS0	Missense_Mutation	SNP	ENST00000368655.4	37	CCDS1054.1	.	.	.	.	.	.	.	.	.	.	G	25.7	4.660327	0.88154	.	.	ENSG00000143614	ENST00000368655	T	0.60040	0.22	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	T	0.70272	0.3205	M	0.69523	2.12	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.70590	-0.4830	10	0.49607	T	0.09	1.851	17.374	0.87386	0.0:0.0:1.0:0.0	.	368	Q8WXI9	P66B_HUMAN	T	368	ENSP00000357644:P368T	ENSP00000357644:P368T	P	-	1	0	GATAD2B	152055487	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.624000	0.98398	2.626000	0.88956	0.563000	0.77884	CCA	.		0.527	GATAD2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090305.1	NM_020699	
TOR3A	64222	hgsc.bcm.edu	37	1	179051300	179051300	+	Missense_Mutation	SNP	T	T	C	rs2296377	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr1:179051300T>C	ENST00000367627.3	+	1	789	c.37T>C	c.(37-39)Ttc>Ctc	p.F13L	TOR3A_ENST00000352445.6_Missense_Mutation_p.F13L	NM_022371.3	NP_071766.2	Q9H497	TOR3A_HUMAN	torsin family 3, member A	13			F -> L (in dbSNP:rs2296377). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|Ref.3}.		ATP catabolic process (GO:0006200)|chaperone mediated protein folding requiring cofactor (GO:0051085)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			endometrium(1)|kidney(2)|large_intestine(4)|lung(4)|pancreas(1)|urinary_tract(1)	13						TTGGCTCTTTTTCCTGCTGCT	0.751													C|||	3842	0.767173	0.9879	0.6441	5008	,	,		12722	0.6677		0.7117	False		,,,				2504	0.7157				p.F13L		.											.	TOR3A-90	0			c.T37C						.	C	LEU/PHE	3262,174		1547,168,3	2.0	3.0	3.0		37	-0.8	0.0	1	dbSNP_100	3	5365,1739		2051,1263,238	yes	missense	TOR3A	NM_022371.3	22	3598,1431,241	CC,CT,TT		24.4792,5.064,18.1499	benign	13/398	179051300	8627,1913	1718	3552	5270	SO:0001583	missense	64222	exon1			CTCTTTTTCCTGC	BC001085	CCDS1329.1	1q25.2	2008-02-05	2003-04-02		ENSG00000186283	ENSG00000186283			11997	protein-coding gene	gene with protein product		607555	"""ATP-dependant interferon responsive"""	ADIR		10644435	Standard	NM_022371		Approved	FLJ22345, ADIR2	uc001gmd.3	Q9H497	OTTHUMG00000035077	ENST00000367627.3:c.37T>C	1.37:g.179051300T>C	ENSP00000356599:p.Phe13Leu	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	7	5	NM_022371	0	0	0	1	1	B4DSY0|B7ZB65|Q5M7Y7|Q8WVA7|Q8WWM2|Q9H495|Q9H6E7	Missense_Mutation	SNP	ENST00000367627.3	37	CCDS1329.1	1679	0.7687728937728938	484	0.983739837398374	250	0.6906077348066298	393	0.6870629370629371	552	0.7282321899736148	C	0.033	-1.323382	0.01309	0.94936	0.755208	ENSG00000186283	ENST00000367627;ENST00000367625;ENST00000352445	T;T;T	0.35421	1.31;1.4;1.63	0.427	-0.794	0.10918	.	1.274350	0.05916	N	0.632520	T	0.00012	0.0000	N	0.00368	-1.59	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.45906	-0.9229	8	0.02654	T	1	-1.1524	.	.	.	rs2296377;rs17844883;rs17856371;rs17857600;rs17857917;rs17858479;rs59034332;rs2296377	13	Q9H497	TOR3A_HUMAN	L	13	ENSP00000356599:F13L;ENSP00000356597:F13L;ENSP00000335351:F13L	ENSP00000335351:F13L	F	+	1	0	TOR3A	177317923	0.000000	0.05858	0.002000	0.10522	0.004000	0.04260	-1.490000	0.02304	-1.608000	0.01587	-1.610000	0.00802	TTC	T|0.229;C|0.771		0.751	TOR3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084927.1	NM_022371	
HMCN1	83872	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	186031090	186031090	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr1:186031090G>A	ENST00000271588.4	+	47	7649	c.7420G>A	c.(7420-7422)Gta>Ata	p.V2474I	HMCN1_ENST00000367492.2_Missense_Mutation_p.V2474I	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	2474					response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						TGGGCTTTCAGTATTAGGTAC	0.373																																					p.V2474I		.											.	HMCN1-113	0			c.G7420A						.						112.0	128.0	122.0					1																	186031090		2203	4300	6503	SO:0001583	missense	83872	exon47			CTTTCAGTATTAG	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.7420G>A	1.37:g.186031090G>A	ENSP00000271588:p.Val2474Ile	Somatic	37	0		WXS	Illumina GAIIx	Phase_I	29	26	NM_031935	0	0	0	0	0	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	G	15.84	2.952894	0.53293	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.74209	-0.82;-0.82	5.33	4.42	0.53409	Immunoglobulin I-set (1);Immunoglobulin-like fold (1);	0.174547	0.50627	N	0.000115	D	0.83617	0.5293	M	0.67953	2.075	0.44702	D	0.997697	D	0.60575	0.988	D	0.75484	0.986	D	0.83528	0.0089	10	0.44086	T	0.13	.	13.5786	0.61890	0.0755:0.0:0.9245:0.0	.	2474	Q96RW7	HMCN1_HUMAN	I	2474	ENSP00000271588:V2474I;ENSP00000356462:V2474I	ENSP00000271588:V2474I	V	+	1	0	HMCN1	184297713	0.998000	0.40836	1.000000	0.80357	0.428000	0.31595	2.628000	0.46477	1.254000	0.44035	0.591000	0.81541	GTA	.		0.373	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
KCTD3	51133	hgsc.bcm.edu	37	1	215741053	215741053	+	Missense_Mutation	SNP	T	T	G	rs2275768	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr1:215741053T>G	ENST00000259154.4	+	1	319	c.25T>G	c.(25-27)Ttc>Gtc	p.F9V		NM_016121.3	NP_057205.2	Q9Y597	KCTD3_HUMAN	potassium channel tetramerization domain containing 3	9			F -> V (in dbSNP:rs2275768). {ECO:0000269|PubMed:15489334}.		protein homooligomerization (GO:0051260)					breast(4)|endometrium(2)|kidney(1)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(1)	33				all cancers(67;0.0164)|OV - Ovarian serous cystadenocarcinoma(81;0.019)|GBM - Glioblastoma multiforme(131;0.0862)|Epithelial(68;0.13)		CTGCGGCAGCTTCCCCGCGGC	0.761													T|||	1459	0.291334	0.0605	0.2291	5008	,	,		8959	0.4276		0.2853	False		,,,				2504	0.5133				p.F9V		.											.	KCTD3-93	0			c.T25G						.	T	VAL/PHE	232,2814		17,198,1308	3.0	5.0	5.0		25	1.6	0.8	1	dbSNP_100	5	1189,4951		136,917,2017	no	missense	KCTD3	NM_016121.3	50	153,1115,3325	GG,GT,TT		19.3648,7.6165,15.4692	benign	9/816	215741053	1421,7765	1523	3070	4593	SO:0001583	missense	51133	exon1			GGCAGCTTCCCCG	AK024547	CCDS1515.1	1q41	2013-06-20	2013-06-20		ENSG00000136636	ENSG00000136636			21305	protein-coding gene	gene with protein product		613272	"""potassium channel tetramerisation domain containing 3"""			10508479	Standard	NM_016121		Approved	NY-REN-45	uc001hks.3	Q9Y597	OTTHUMG00000037019	ENST00000259154.4:c.25T>G	1.37:g.215741053T>G	ENSP00000259154:p.Phe9Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	9	NM_016121	0	0	0	6	6	A0AV15|D3DTA6|Q49AG7|Q504Q9|Q6PJN6|Q8ND58|Q8NDJ0|Q8WX16	Missense_Mutation	SNP	ENST00000259154.4	37	CCDS1515.1	595	0.2724358974358974	34	0.06910569105691057	93	0.2569060773480663	249	0.4353146853146853	219	0.28891820580474936	T	10.24	1.294537	0.23564	0.076165	0.193648	ENSG00000136636	ENST00000259154;ENST00000366945	T	0.36520	1.25	2.8	1.63	0.23807	.	0.611401	0.14267	U	0.330439	T	0.00012	0.0000	L	0.27053	0.805	0.50813	P	1.0900000000002574E-4	B;B	0.12013	0.005;0.003	B;B	0.08055	0.003;0.001	T	0.48115	-0.9063	9	0.23891	T	0.37	-7.5445	6.7109	0.23276	0.0:0.2267:0.0:0.7733	rs2275768;rs17845401;rs17858259	9;9	Q9Y597-2;Q9Y597	.;KCTD3_HUMAN	V	9	ENSP00000259154:F9V	ENSP00000259154:F9V	F	+	1	0	KCTD3	213807676	0.045000	0.20229	0.833000	0.33012	0.447000	0.32167	0.628000	0.24522	0.293000	0.22520	0.254000	0.18369	TTC	T|0.721;G|0.279		0.761	KCTD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089871.2	NM_016121	
OBSCN	84033	hgsc.bcm.edu	37	1	228504670	228504670	+	Missense_Mutation	SNP	C	C	T	rs11810627	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr1:228504670C>T	ENST00000422127.1	+	51	13590	c.13546C>T	c.(13546-13548)Cgg>Tgg	p.R4516W	OBSCN_ENST00000366707.4_Missense_Mutation_p.R2150W|OBSCN_ENST00000366709.4_Missense_Mutation_p.R1635W|OBSCN_ENST00000284548.11_Missense_Mutation_p.R4516W|OBSCN_ENST00000570156.2_Missense_Mutation_p.R5473W	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	4516	Ig-like 46.		R -> W (in dbSNP:rs11810627).		apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GGCCTCTGCGCGGCTCACCGT	0.736													c|||	1654	0.330272	0.2791	0.4006	5008	,	,		13971	0.249		0.4861	False		,,,				2504	0.273				p.R5473W		.											.	OBSCN-403	0			c.C16417T						.		TRP/ARG,TRP/ARG	923,2833		165,593,1120	5.0	6.0	6.0		13546,13546	-1.0	0.0	1	dbSNP_120	6	3333,4245		861,1611,1317	yes	missense,missense	OBSCN	NM_001098623.1,NM_052843.2	101,101	1026,2204,2437	TT,TC,CC		43.9826,24.574,37.5507	probably-damaging,probably-damaging	4516/7969,4516/6621	228504670	4256,7078	1878	3789	5667	SO:0001583	missense	84033	exon62			TCTGCGCGGCTCA	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.13546C>T	1.37:g.228504670C>T	ENSP00000409493:p.Arg4516Trp	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	17	16	NM_001271223	0	0	0	0	0	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	CCDS58065.1	774	0.3543956043956044	137	0.2784552845528455	144	0.39779005524861877	134	0.23426573426573427	359	0.4736147757255937	c	11.94	1.787178	0.31593	0.24574	0.439826	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709	T;T;T;T	0.77098	-1.07;-1.07;0.2;0.2	5.41	-0.971	0.10303	Immunoglobulin subtype (1);Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.167607	0.36519	N	0.002550	T	0.00012	0.0000	L	0.41824	1.3	0.50632	P	1.1499999999997623E-4	B;B	0.22541	0.071;0.067	B;B	0.12156	0.007;0.007	T	0.42275	-0.9461	9	0.45353	T	0.12	.	10.3619	0.43998	0.6084:0.317:0.0:0.0747	rs11810627	4516;4516	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	W	4516;4516;2150;1635	ENSP00000284548:R4516W;ENSP00000409493:R4516W;ENSP00000355668:R2150W;ENSP00000355670:R1635W	ENSP00000284548:R4516W	R	+	1	2	OBSCN	226571293	0.968000	0.33430	0.013000	0.15412	0.016000	0.09150	2.032000	0.41127	-0.028000	0.13850	0.550000	0.68814	CGG	C|0.643;T|0.357		0.736	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
OR2T27	403239	bcgsc.ca	37	1	248813723	248813723	+	Missense_Mutation	SNP	C	C	T	rs138825902	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr1:248813723C>T	ENST00000344889.3	-	1	462	c.463G>A	c.(463-465)Gat>Aat	p.D155N		NM_001001824.1	NP_001001824.1	Q8NH04	O2T27_HUMAN	olfactory receptor, family 2, subfamily T, member 27	155						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|endometrium(2)|large_intestine(4)|lung(20)|skin(3)|stomach(1)	32	all_cancers(71;1.15e-05)|all_epithelial(71;5.29e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.089)|Lung NSC(105;0.0969)|Melanoma(84;0.199)	all_cancers(173;0.237)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			AAGAAACCATCGATAGACCCT	0.577													C|||	690	0.13778	0.1906	0.0836	5008	,	,		19973	0.2599		0.0835	False		,,,				2504	0.0348				p.D155N		.											.	OR2T27-47	0			c.G463A						.						21.0	12.0	15.0					1																	248813723		2156	3870	6026	SO:0001583	missense	403239	exon1			AACCATCGATAGA		CCDS31124.1	1q44	2012-08-09			ENSG00000187701	ENSG00000187701		"""GPCR / Class A : Olfactory receptors"""	31252	protein-coding gene	gene with protein product							Standard	NM_001001824		Approved		uc010pzo.2	Q8NH04	OTTHUMG00000040376	ENST00000344889.3:c.463G>A	1.37:g.248813723C>T	ENSP00000342008:p.Asp155Asn	Somatic	308	1		WXS	Illumina GAIIx	Phase_I	147	7	NM_001001824	0	0	0	0	0		Missense_Mutation	SNP	ENST00000344889.3	37	CCDS31124.1	325	0.1488095238095238	73	0.1483739837398374	33	0.09116022099447514	146	0.25524475524475526	73	0.09630606860158311	.	2.953	-0.216289	0.06101	.	.	ENSG00000187701	ENST00000344889	T	0.36520	1.25	3.3	1.12	0.20585	GPCR, rhodopsin-like superfamily (1);	0.000000	0.42821	D	0.000647	T	0.00012	0.0000	N	0.03253	-0.375	0.80722	P	0.0	D	0.54964	0.969	P	0.51297	0.665	T	0.14392	-1.0474	9	0.16420	T	0.52	.	2.5773	0.04809	0.2123:0.4412:0.0:0.3465	.	155	Q8NH04	O2T27_HUMAN	N	155	ENSP00000342008:D155N	ENSP00000342008:D155N	D	-	1	0	OR2T27	246880346	0.000000	0.05858	0.049000	0.19019	0.021000	0.10359	-1.352000	0.02619	0.714000	0.32081	0.194000	0.17425	GAT	C|0.500;T|0.500		0.577	OR2T27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097124.1	NM_001001824	
UPF2	26019	ucsc.edu;bcgsc.ca	37	10	11997479	11997479	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr10:11997479G>T	ENST00000356352.2	-	13	3075	c.2602C>A	c.(2602-2604)Cgc>Agc	p.R868S	UPF2_ENST00000357604.5_Missense_Mutation_p.R868S|UPF2_ENST00000397053.2_Missense_Mutation_p.R868S			Q9HAU5	RENT2_HUMAN	UPF2 regulator of nonsense transcripts homolog (yeast)	868	MIF4G 3.|Sufficient for interaction with EIF4A1 and EIF1.|Sufficient for interaction with UPF3A and UPF3B.				gene expression (GO:0010467)|liver development (GO:0001889)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|organ regeneration (GO:0031100)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleus (GO:0005634)	RNA binding (GO:0003723)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(14)|lung(17)|ovary(2)|skin(3)|urinary_tract(2)	56		Renal(717;0.228)				CTGCTGATGCGCCTCTGATTA	0.358																																					p.R868S		.											.	UPF2-515	0			c.C2602A						.						59.0	58.0	58.0					10																	11997479		2203	4300	6503	SO:0001583	missense	26019	exon14			TGATGCGCCTCTG	AB037829	CCDS7086.1	10p14-p13	2011-06-21			ENSG00000151461	ENSG00000151461			17854	protein-coding gene	gene with protein product	"""smg-3 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	605529				11073994, 11113196	Standard	NM_080599		Approved	RENT2, DKFZP434D222, KIAA1408, smg-3	uc001ilb.3	Q9HAU5	OTTHUMG00000017678	ENST00000356352.2:c.2602C>A	10.37:g.11997479G>T	ENSP00000348708:p.Arg868Ser	Somatic	34	0		WXS	Illumina GAIIx	Phase_I	32	4	NM_080599	0	0	2	2	0	A6NLJ5|D3DRS0|Q14BM1|Q5W0J4|Q8N8U1|Q9H1J2|Q9NWL1|Q9P2D9|Q9Y4M9	Missense_Mutation	SNP	ENST00000356352.2	37	CCDS7086.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.054253	0.75960	.	.	ENSG00000151461	ENST00000356352;ENST00000357604;ENST00000397053	T;T;T	0.22945	1.93;1.93;1.93	5.17	5.17	0.71159	MIF4G-like, type 3 (2);Armadillo-type fold (1);MIF4-like, type 1/2/3 (1);	0.000000	0.85682	D	0.000000	T	0.56046	0.1959	M	0.88570	2.965	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.63834	-0.6547	10	0.87932	D	0	.	12.3971	0.55391	0.0:0.0:0.7054:0.2946	.	868	Q9HAU5	RENT2_HUMAN	S	868	ENSP00000348708:R868S;ENSP00000350221:R868S;ENSP00000380244:R868S	ENSP00000348708:R868S	R	-	1	0	UPF2	12037485	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	6.203000	0.72137	2.413000	0.81919	0.591000	0.81541	CGC	.		0.358	UPF2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046783.1		
DLG5	9231	bcgsc.ca	37	10	79566632	79566632	+	Silent	SNP	G	G	A	rs1058198	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr10:79566632G>A	ENST00000372391.2	-	26	4856	c.4851C>T	c.(4849-4851)gaC>gaT	p.D1617D	DLG5_ENST00000459739.1_5'UTR|DLG5_ENST00000372388.2_Silent_p.D1277D	NM_004747.3	NP_004738.3	Q8TDM6	DLG5_HUMAN	discs, large homolog 5 (Drosophila)	1617	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				apical protein localization (GO:0045176)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|intracellular signal transduction (GO:0035556)|metanephric collecting duct development (GO:0072205)|midbrain development (GO:0030901)|negative regulation of cell proliferation (GO:0008285)|polarized epithelial cell differentiation (GO:0030859)|protein complex assembly (GO:0006461)|protein localization to adherens junction (GO:0071896)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|zonula adherens assembly (GO:0045186)	cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cytoskeletal protein binding (GO:0008092)|receptor signaling complex scaffold activity (GO:0030159)			breast(9)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(17)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	60	all_cancers(46;0.0316)|all_epithelial(25;0.00147)|Breast(12;0.0015)|Prostate(51;0.0146)		Epithelial(14;0.00105)|OV - Ovarian serous cystadenocarcinoma(4;0.00151)|all cancers(16;0.00446)			AGAGGATGTCGTCCTTCTTAA	0.602													G|||	1315	0.26258	0.2466	0.2392	5008	,	,		16932	0.1736		0.339	False		,,,				2504	0.3139				p.D1617D		.											.	DLG5-98	0			c.C4851T						.	G		1180,3226	415.4+/-337.2	169,842,1192	157.0	134.0	142.0		4851	-11.7	0.1	10	dbSNP_86	142	2978,5622	462.9+/-365.8	536,1906,1858	no	coding-synonymous	DLG5	NM_004747.3		705,2748,3050	AA,AG,GG		34.6279,26.7817,31.9699		1617/1920	79566632	4158,8848	2203	4300	6503	SO:0001819	synonymous_variant	9231	exon26			GATGTCGTCCTTC	U61843	CCDS7353.2	10q23	2008-07-09	2001-11-28		ENSG00000151208	ENSG00000151208			2904	protein-coding gene	gene with protein product		604090	"""discs, large (Drosophila) homolog 5"""			9738934	Standard	XM_005270276		Approved	P-dlg, KIAA0583	uc001jzk.3	Q8TDM6	OTTHUMG00000018548	ENST00000372391.2:c.4851C>T	10.37:g.79566632G>A		Somatic	188	2		WXS	Illumina GAIIx	Phase_I	138	5	NM_004747	0	0	4	4	0	A6H8Y3|Q149N1|Q5T1H7|Q5T1H8|Q6DKG3|Q86WC0|Q8TDM7|Q9UE73|Q9Y4E3	Silent	SNP	ENST00000372391.2	37	CCDS7353.2																																																																																			G|0.688;A|0.312		0.602	DLG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048900.2		
CPEB3	22849	bcgsc.ca	37	10	93999850	93999850	+	Silent	SNP	A	A	G	rs3824734	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr10:93999850A>G	ENST00000265997.4	-	2	430	c.258T>C	c.(256-258)ccT>ccC	p.P86P	CPEB3_ENST00000412050.4_Silent_p.P86P	NM_014912.4	NP_055727.3	Q8NE35	CPEB3_HUMAN	cytoplasmic polyadenylation element binding protein 3	86	Pro-rich.				3'-UTR-mediated mRNA destabilization (GO:0061158)|cellular response to amino acid stimulus (GO:0071230)|long-term memory (GO:0007616)|negative regulation of cytoplasmic translational elongation (GO:1900248)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translation (GO:0017148)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of mRNA polyadenylation (GO:1900365)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of translation (GO:0045727)|regulation of dendritic spine development (GO:0060998)|regulation of synaptic plasticity (GO:0048167)|translation (GO:0006412)	apical dendrite (GO:0097440)|CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|neuron projection (GO:0043005)|nucleus (GO:0005634)|synapse (GO:0045202)	mRNA 3'-UTR AU-rich region binding (GO:0035925)|mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA stem-loop binding (GO:0035613)|translation factor activity, nucleic acid binding (GO:0008135)|translation repressor activity, nucleic acid binding (GO:0000900)			breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(5)|skin(2)|upper_aerodigestive_tract(2)	18		Colorectal(252;0.0869)				GCTGCTGAGGAGGCTGATGGA	0.721													G|||	3298	0.658546	0.9501	0.745	5008	,	,		9820	0.499		0.6173	False		,,,				2504	0.41				p.P86P		.											.	CPEB3-90	0			c.T258C						.	G	,	3896,456		1755,386,35	13.0	15.0	14.0		258,258	-0.1	1.0	10	dbSNP_107	14	5207,3285		1622,1963,661	no	coding-synonymous,coding-synonymous	CPEB3	NM_001178137.1,NM_014912.4	,	3377,2349,696	GG,GA,AA		38.6835,10.4779,29.1264	,	86/685,86/699	93999850	9103,3741	2176	4246	6422	SO:0001819	synonymous_variant	22849	exon2			CTGAGGAGGCTGA	AB023157	CCDS31246.1, CCDS53553.1	10q23.33	2013-02-12			ENSG00000107864	ENSG00000107864		"""RNA binding motif (RRM) containing"""	21746	protein-coding gene	gene with protein product		610606				10231032, 12672660	Standard	NM_014912		Approved	KIAA0940	uc001khw.2	Q8NE35	OTTHUMG00000018756	ENST00000265997.4:c.258T>C	10.37:g.93999850A>G		Somatic	11	0		WXS	Illumina GAIIx	Phase_I	32	32	NM_014912	0	0	0	0	0	Q5T389|Q9NQJ7|Q9Y2E9	Silent	SNP	ENST00000265997.4	37	CCDS31246.1																																																																																			A|0.306;G|0.694		0.721	CPEB3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049387.2	NM_014912	
KNDC1	85442	hgsc.bcm.edu	37	10	135000148	135000148	+	Silent	SNP	T	T	C	rs3810965	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr10:135000148T>C	ENST00000304613.3	+	6	1317	c.1296T>C	c.(1294-1296)gcT>gcC	p.A432A	KNDC1_ENST00000368572.2_Silent_p.A432A|KNDC1_ENST00000368571.2_Silent_p.A367A			Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND) containing 1	432					cerebellar granule cell differentiation (GO:0021707)|positive regulation of protein phosphorylation (GO:0001934)|regulation of dendrite morphogenesis (GO:0048814)|small GTPase mediated signal transduction (GO:0007264)	dendrite (GO:0030425)|guanyl-nucleotide exchange factor complex (GO:0032045)|neuronal cell body (GO:0043025)	protein serine/threonine kinase activity (GO:0004674)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			NS(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(27)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	60		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		CAGAAGGAGCTAGGCAGCTGG	0.667													c|||	2087	0.416733	0.118	0.3847	5008	,	,		13870	0.5764		0.4354	False		,,,				2504	0.6595				p.A432A		.											.	KNDC1-229	0			c.T1296C						.			719,3683		63,593,1545	26.0	32.0	30.0		1296	-4.2	0.0	10	dbSNP_107	30	3956,4636		925,2106,1265	no	coding-synonymous	KNDC1	NM_152643.6		988,2699,2810	CC,CT,TT		46.0428,16.3335,35.9781		432/1750	135000148	4675,8319	2201	4296	6497	SO:0001819	synonymous_variant	85442	exon6			AGGAGCTAGGCAG	AK074179	CCDS7674.1	10q26.3	2004-09-14	2004-04-07		ENSG00000171798	ENSG00000171798			29374	protein-coding gene	gene with protein product			"""RasGEF domain family, member 2"""	RASGEF2, C10orf23		11214970	Standard	NM_152643		Approved	KIAA1768, bB439H18.3, FLJ25027	uc001llz.1	Q76NI1	OTTHUMG00000019303	ENST00000304613.3:c.1296T>C	10.37:g.135000148T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_152643	0	0	0	0	0	B0QZC5|Q5T233|Q6ZNH8|Q8TEE5|Q96LV7|Q9C095	Silent	SNP	ENST00000304613.3	37	CCDS7674.1																																																																																			T|0.607;C|0.393		0.667	KNDC1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000277044.3	NM_152643	
KNDC1	85442	hgsc.bcm.edu	37	10	135000159	135000159	+	Missense_Mutation	SNP	A	A	G	rs3810964	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr10:135000159A>G	ENST00000304613.3	+	6	1328	c.1307A>G	c.(1306-1308)gAa>gGa	p.E436G	KNDC1_ENST00000368572.2_Missense_Mutation_p.E436G|KNDC1_ENST00000368571.2_Missense_Mutation_p.E371G			Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND) containing 1	436			E -> G (in dbSNP:rs3810964). {ECO:0000269|Ref.1}.		cerebellar granule cell differentiation (GO:0021707)|positive regulation of protein phosphorylation (GO:0001934)|regulation of dendrite morphogenesis (GO:0048814)|small GTPase mediated signal transduction (GO:0007264)	dendrite (GO:0030425)|guanyl-nucleotide exchange factor complex (GO:0032045)|neuronal cell body (GO:0043025)	protein serine/threonine kinase activity (GO:0004674)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			NS(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(27)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	60		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		AGGCAGCTGGAAAGTGCAGCC	0.652													a|||	2088	0.416933	0.118	0.3847	5008	,	,		14228	0.5774		0.4354	False		,,,				2504	0.6595				p.E436G		.											.	KNDC1-229	0			c.A1307G						.		GLY/GLU	699,3701		65,569,1566	23.0	28.0	26.0		1307	-5.9	0.0	10	dbSNP_107	26	3934,4658		927,2080,1289	yes	missense	KNDC1	NM_152643.6	98	992,2649,2855	GG,GA,AA		45.7868,15.8864,35.6604	benign	436/1750	135000159	4633,8359	2200	4296	6496	SO:0001583	missense	85442	exon6			AGCTGGAAAGTGC	AK074179	CCDS7674.1	10q26.3	2004-09-14	2004-04-07		ENSG00000171798	ENSG00000171798			29374	protein-coding gene	gene with protein product			"""RasGEF domain family, member 2"""	RASGEF2, C10orf23		11214970	Standard	NM_152643		Approved	KIAA1768, bB439H18.3, FLJ25027	uc001llz.1	Q76NI1	OTTHUMG00000019303	ENST00000304613.3:c.1307A>G	10.37:g.135000159A>G	ENSP00000304437:p.Glu436Gly	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_152643	0	0	0	0	0	B0QZC5|Q5T233|Q6ZNH8|Q8TEE5|Q96LV7|Q9C095	Missense_Mutation	SNP	ENST00000304613.3	37	CCDS7674.1	871	0.39880952380952384	52	0.10569105691056911	135	0.3729281767955801	338	0.5909090909090909	346	0.45646437994722955	A	6.455	0.452036	0.12283	0.158864	0.457868	ENSG00000171798	ENST00000304613;ENST00000368572;ENST00000368571	T;T;T	0.28895	1.59;1.59;1.59	3.02	-5.95	0.02241	.	0.946911	0.08625	N	0.917834	T	0.00012	0.0000	N	0.00538	-1.39	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.43893	-0.9363	9	0.09843	T	0.71	-2.0863	2.4481	0.04511	0.2095:0.4457:0.2064:0.1384	rs3810964;rs58651584;rs3810964	371;436	Q76NI1-2;Q76NI1	.;VKIND_HUMAN	G	436;436;371	ENSP00000304437:E436G;ENSP00000357561:E436G;ENSP00000357560:E371G	ENSP00000304437:E436G	E	+	2	0	KNDC1	134850149	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.407000	0.07178	-1.198000	0.02669	-1.676000	0.00740	GAA	A|0.608;G|0.392		0.652	KNDC1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000277044.3	NM_152643	
MUC2	4583	bcgsc.ca	37	11	1092884	1092884	+	Missense_Mutation	SNP	C	C	T	rs201415503		TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr11:1092884C>T	ENST00000441003.2	+	30	4730	c.4703C>T	c.(4702-4704)aCg>aTg	p.T1568M	MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000359061.5_Missense_Mutation_p.T1569M|MUC2_ENST00000361558.6_Intron	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.T1569M(2)|p.T1568M(2)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	ACCACCACCACGGTGacccca	0.637																																					p.T1568M		.											.	MUC2-90	4	Substitution - Missense(4)	large_intestine(2)|skin(2)	c.C4703T						.						129.0	172.0	157.0					11																	1092884		1964	3669	5633	SO:0001583	missense	4583	exon30			CCACCACGGTGAC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4703C>T	11.37:g.1092884C>T	ENSP00000415183:p.Thr1568Met	Somatic	220	5		WXS	Illumina GAIIx	Phase_I	197	11	NM_002457	0	0	0	0	0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	2.409	-0.335727	0.05278	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.14893	2.5;2.47	1.63	0.367	0.16140	.	25.055600	0.00797	U	0.001394	T	0.21841	0.0526	.	.	.	0.09310	N	1	D	0.76494	0.999	P	0.48425	0.577	T	0.35301	-0.9794	9	0.45353	T	0.12	.	8.9064	0.35526	0.0:0.7681:0.2319:0.0	.	1568	E7EUV1	.	M	1568;1569	ENSP00000415183:T1568M;ENSP00000351956:T1569M	ENSP00000351956:T1569M	T	+	2	0	MUC2	1082884	0.000000	0.05858	0.002000	0.10522	0.015000	0.08874	0.878000	0.28126	0.945000	0.37605	0.121000	0.15741	ACG	.		0.637	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
DNHD1	144132	bcgsc.ca	37	11	6588228	6588228	+	Missense_Mutation	SNP	G	G	A	rs10769699	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr11:6588228G>A	ENST00000527990.2	+	34	11489	c.11489G>A	c.(11488-11490)cGt>cAt	p.R3830H	DNHD1_ENST00000254579.6_Missense_Mutation_p.R3830H			Q96M86	DNHD1_HUMAN	dynein heavy chain domain 1	3830			R -> H (in dbSNP:rs10769699).		microtubule-based movement (GO:0007018)	dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)	microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(13)|kidney(6)|large_intestine(11)|lung(14)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	55		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.171)		Epithelial(150;3.93e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		TGCCAGCTGCGTGCTCATTGT	0.537													G|||	1167	0.233027	0.0734	0.3098	5008	,	,		22346	0.2222		0.4095	False		,,,				2504	0.2239				p.R3830H		.											.	DNHD1-24	0			c.G11489A						.	G	HIS/ARG	448,3592		24,400,1596	79.0	82.0	81.0		11489	-0.1	0.7	11	dbSNP_120	81	3213,5139		620,1973,1583	yes	missense	DNHD1	NM_144666.2	29	644,2373,3179	AA,AG,GG		38.4698,11.0891,29.5433	benign	3830/4754	6588228	3661,8731	2020	4176	6196	SO:0001583	missense	144132	exon36			AGCTGCGTGCTCA	AK128064	CCDS44532.1, CCDS7767.1	11p15.4	2011-02-10		2005-11-28	ENSG00000179532	ENSG00000179532			26532	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 47"", ""dynein heavy chain domain 1-like"", ""coiled-coil domain containing 35"""	DHCD1, C11orf47, DNHD1L, CCDC35		12975309	Standard	NM_173589		Approved	FLJ32752, FLJ46184, FLJ35709, DKFZp686J0796	uc001mdw.4	Q96M86	OTTHUMG00000133403	ENST00000527990.2:c.11489G>A	11.37:g.6588228G>A	ENSP00000436180:p.Arg3830His	Somatic	271	0		WXS	Illumina GAIIx	Phase_I	182	6	NM_144666	0	0	0	0	0	Q2NKK8|Q6UWI9|Q8NAA2|Q8TEE6|Q9NSZ9	Missense_Mutation	SNP	ENST00000527990.2	37	CCDS44532.1	603	0.2760989010989011	28	0.056910569105691054	119	0.3287292817679558	151	0.263986013986014	305	0.4023746701846966	G	7.681	0.689026	0.14973	0.110891	0.384698	ENSG00000179532	ENST00000254579;ENST00000527990;ENST00000525883;ENST00000530197	T;T	0.26810	1.71;1.71	4.82	-0.0996	0.13624	.	1.110500	0.06919	N	0.808972	T	0.00012	0.0000	N	0.12182	0.205	0.80722	P	0.0	B;B;B	0.18610	0.013;0.013;0.029	B;B;B	0.10450	0.002;0.002;0.005	T	0.47947	-0.9077	9	0.37606	T	0.19	-0.2341	7.1096	0.25382	0.6282:0.0:0.3718:0.0	rs10769699;rs52822986;rs60470898;rs10769699	2918;98;3830	B0I1S4;D3DQT9;Q96M86	.;.;DNHD1_HUMAN	H	3830;3830;98;98	ENSP00000254579:R3830H;ENSP00000436180:R3830H	ENSP00000254579:R3830H	R	+	2	0	DNHD1	6544804	0.656000	0.27385	0.718000	0.30602	0.611000	0.37282	0.300000	0.19156	0.103000	0.17682	0.655000	0.94253	CGT	G|0.727;A|0.273		0.537	DNHD1-007	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384673.2	NM_144666	
MACROD1	28992	bcgsc.ca	37	11	63767186	63767186	+	Silent	SNP	A	A	G	rs709594	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr11:63767186A>G	ENST00000255681.6	-	6	780	c.714T>C	c.(712-714)agT>agC	p.S238S	OTUB1_ENST00000535715.1_Intron	NM_014067.3	NP_054786.2	Q9BQ69	MACD1_HUMAN	MACRO domain containing 1	238	Macro. {ECO:0000255|PROSITE- ProRule:PRU00490}.				cellular response to DNA damage stimulus (GO:0006974)|protein de-ADP-ribosylation (GO:0051725)|purine nucleoside metabolic process (GO:0042278)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	deacetylase activity (GO:0019213)|hydrolase activity, acting on glycosyl bonds (GO:0016798)			breast(1)|large_intestine(3)|lung(6)|skin(1)	11						CGGCAGCCTGACTGGCGCTGG	0.726													G|||	2143	0.427915	0.736	0.2493	5008	,	,		10778	0.1379		0.4463	False		,,,				2504	0.4182				p.S238S		.											.	MACROD1-68	0			c.T714C						.	G		2959,1321		1069,821,250	10.0	13.0	12.0		714	3.8	1.0	11	dbSNP_86	12	3770,4672		906,1958,1357	no	coding-synonymous	MACROD1	NM_014067.3		1975,2779,1607	GG,GA,AA		44.6577,30.8645,47.1074		238/326	63767186	6729,5993	2140	4221	6361	SO:0001819	synonymous_variant	28992	exon6			AGCCTGACTGGCG	AF202922	CCDS8056.1	11q13.1	2007-07-24	2007-06-11		ENSG00000133315	ENSG00000133315			29598	protein-coding gene	gene with protein product		610400				15691879	Standard	NM_014067		Approved	LRP16	uc001nyh.3	Q9BQ69	OTTHUMG00000167843	ENST00000255681.6:c.714T>C	11.37:g.63767186A>G		Somatic	10	0		WXS	Illumina GAIIx	Phase_I	30	27	NM_014067	0	0	0	20	20	Q9UH96	Silent	SNP	ENST00000255681.6	37	CCDS8056.1																																																																																			A|0.618;G|0.382		0.726	MACROD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396570.1	NM_014067	
SLC22A12	116085	ucsc.edu;bcgsc.ca	37	11	64367862	64367862	+	Silent	SNP	T	T	C	rs7932775	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr11:64367862T>C	ENST00000377574.1	+	8	2056	c.1309T>C	c.(1309-1311)Ttg>Ctg	p.L437L	SLC22A12_ENST00000336464.7_Silent_p.L403L|SLC22A12_ENST00000377567.2_Silent_p.L329L|SLC22A12_ENST00000377572.1_Silent_p.L329L|SLC22A12_ENST00000473690.1_Silent_p.L216L	NM_144585.2	NP_653186.2	Q96S37	S22AC_HUMAN	solute carrier family 22 (organic anion/urate transporter), member 12	437					cellular homeostasis (GO:0019725)|response to drug (GO:0042493)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)|urate transport (GO:0015747)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|urate transmembrane transporter activity (GO:0015143)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(9)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	27					Losartan(DB00678)|Probenecid(DB01032)	GCGCTCAGCCTTGGCCGTGCT	0.647													C|||	1990	0.397364	0.674	0.255	5008	,	,		14174	0.5129		0.2018	False		,,,				2504	0.2065				p.L437L		.											.	SLC22A12-91	0			c.T1309C						.	C	,	2545,1845		746,1053,396	14.0	17.0	16.0		1309,646	2.9	1.0	11	dbSNP_116	16	1592,6994		173,1246,2874	no	coding-synonymous,coding-synonymous	SLC22A12	NM_144585.2,NM_153378.1	,	919,2299,3270	CC,CT,TT		18.5418,42.0273,31.8819	,	437/554,216/333	64367862	4137,8839	2195	4293	6488	SO:0001819	synonymous_variant	116085	exon8			TCAGCCTTGGCCG	AB071863	CCDS8075.1, CCDS60835.1, CCDS60836.1	11q13.1	2013-05-22	2008-01-11		ENSG00000197891	ENSG00000197891		"""Solute carriers"""	17989	protein-coding gene	gene with protein product		607096	"""solute carrier family 22 (organic anion/cation transporter), member 12"""			12024214	Standard	NM_144585		Approved	OAT4L, RST, URAT1	uc009yps.2	Q96S37	OTTHUMG00000045213	ENST00000377574.1:c.1309T>C	11.37:g.64367862T>C		Somatic	16	0		WXS	Illumina GAIIx	Phase_I	16	4	NM_144585	0	0	0	0	0	B7WPG1|G3XAN7|Q19PF7|Q19PF8|Q19PF9|Q19PG0|Q6UXW3|Q96DT2	Silent	SNP	ENST00000377574.1	37	CCDS8075.1																																																																																			T|0.629;C|0.371		0.647	SLC22A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104966.2	NM_144585	
TM7SF2	7108	hgsc.bcm.edu	37	11	64880090	64880090	+	Silent	SNP	G	G	C	rs4930284	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr11:64880090G>C	ENST00000279263.7	+	2	318	c.156G>C	c.(154-156)ccG>ccC	p.P52P	TM7SF2_ENST00000345348.5_Silent_p.P52P|TM7SF2_ENST00000540748.1_5'UTR|AP003068.9_ENST00000528887.1_RNA	NM_003273.2	NP_003264.2	O76062	ERG24_HUMAN	transmembrane 7 superfamily member 2	52					cholesterol biosynthetic process (GO:0006695)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	delta14-sterol reductase activity (GO:0050613)			lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						CGTCCCTGCCGGGGCTGGAGG	0.756													C|||	4990	0.996406	0.9879	0.9986	5008	,	,		10438	1.0		0.999	False		,,,				2504	1.0				p.P52P		.											.	TM7SF2-91	0			c.G156C						.	C		2924,8		1458,8,0	2.0	2.0	2.0		156	-9.8	0.0	11	dbSNP_111	2	6426,0		3213,0,0	no	coding-synonymous	TM7SF2	NM_003273.2		4671,8,0	CC,CG,GG		0.0,0.2729,0.0855		52/419	64880090	9350,8	1466	3213	4679	SO:0001819	synonymous_variant	7108	exon2			CCTGCCGGGGCTG	BC012857	CCDS41669.1, CCDS60846.1	11q13.1	2013-05-23			ENSG00000149809	ENSG00000149809	1.3.1.70		11863	protein-coding gene	gene with protein product	"""delta(14)-sterol reductase"""	603414				9615229, 9286704	Standard	NM_003273		Approved	ANG1, DHCR14A, NET47	uc001oct.4	O76062	OTTHUMG00000165603	ENST00000279263.7:c.156G>C	11.37:g.64880090G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_003273	0	0	0	60	60	A8K4H0|O95982|Q8IY06|Q96E64|Q96GZ1	Silent	SNP	ENST00000279263.7	37	CCDS41669.1																																																																																			G|0.005;C|0.995		0.756	TM7SF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385234.1	NM_003273	
P2RY2	5029	hgsc.bcm.edu	37	11	72945732	72945732	+	Silent	SNP	G	G	A			TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr11:72945732G>A	ENST00000311131.2	+	3	995	c.528G>A	c.(526-528)gcG>gcA	p.A176A	P2RY2_ENST00000393597.2_Silent_p.A176A|P2RY2_ENST00000393596.2_Silent_p.A176A	NM_002564.2|NM_176072.1	NP_002555|NP_788086	P41231	P2RY2_HUMAN	purinergic receptor P2Y, G-protein coupled, 2	176					cellular ion homeostasis (GO:0006873)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of mucus secretion (GO:0070257)|regulation of vasodilation (GO:0042312)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|receptor activity (GO:0004872)			endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(1)|skin(2)|urinary_tract(2)	25					Suramin(DB04786)	CCACCAGCGCGCGCGGGGGCC	0.721																																					p.A176A		.											.	P2RY2-503	0			c.G528A						.						23.0	24.0	24.0					11																	72945732		2199	4292	6491	SO:0001819	synonymous_variant	5029	exon3			CAGCGCGCGCGGG	U07225	CCDS8219.1	11q13.5-q14.1	2012-08-08				ENSG00000175591		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8541	protein-coding gene	gene with protein product		600041				8159738, 9286708	Standard	NM_002564		Approved	P2U	uc001otj.4	P41231		ENST00000311131.2:c.528G>A	11.37:g.72945732G>A		Somatic	3	0		WXS	Illumina GAIIx	Phase_I	17	16	NM_176071	0	0	0	5	5	B2R9W3|Q96EM8	Silent	SNP	ENST00000311131.2	37	CCDS8219.1																																																																																			.		0.721	P2RY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397336.1	NM_176072	
PGR	5241	hgsc.bcm.edu	37	11	100998531	100998531	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr11:100998531G>C	ENST00000325455.5	-	1	2724	c.1271C>G	c.(1270-1272)cCg>cGg	p.P424R	PGR_ENST00000534013.1_Intron|PGR_ENST00000263463.5_Missense_Mutation_p.P424R	NM_000926.4|NM_001202474.1|NM_001271162.1	NP_000917.3|NP_001189403.1|NP_001258091.1	P06401	PRGR_HUMAN	progesterone receptor	424	Modulating, Pro-Rich.				cell-cell signaling (GO:0007267)|epithelial cell maturation (GO:0002070)|gene expression (GO:0010467)|negative regulation of gene expression (GO:0010629)|ovulation from ovarian follicle (GO:0001542)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|progesterone receptor signaling pathway (GO:0050847)|regulation of epithelial cell proliferation (GO:0050678)|signal transduction (GO:0007165)|tertiary branching involved in mammary gland duct morphogenesis (GO:0060748)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mitochondrial outer membrane (GO:0005741)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|liver(1)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	36		Acute lymphoblastic leukemia(157;0.000885)|all_hematologic(158;0.014)		LUSC - Lung squamous cell carcinoma(1;0.0387)|BRCA - Breast invasive adenocarcinoma(274;0.124)|OV - Ovarian serous cystadenocarcinoma(223;0.148)|Lung(307;0.164)	Allylestrenol(DB01431)|Danazol(DB01406)|Desogestrel(DB00304)|Drospirenone(DB01395)|Dydrogesterone(DB00378)|Ethynodiol(DB00823)|Etonogestrel(DB00294)|Fluticasone Propionate(DB00588)|Levonorgestrel(DB00367)|Medroxyprogesterone Acetate(DB00603)|Megestrol acetate(DB00351)|Mifepristone(DB00834)|Norelgestromin(DB06713)|Norethindrone(DB00717)|Norgestimate(DB00957)|Progesterone(DB00396)|Spironolactone(DB00421)	CGGCGGCAGCGGGGGCGGTGG	0.746																																					p.P424R	Pancreas(124;2271 2354 21954 22882)	.											.	PGR-652	0			c.C1271G						.						3.0	5.0	4.0					11																	100998531		1706	3593	5299	SO:0001583	missense	5241	exon1			GGCAGCGGGGGCG	M15716	CCDS8310.1, CCDS59229.1	11q22-q23	2013-01-16			ENSG00000082175	ENSG00000082175		"""Nuclear hormone receptors"""	8910	protein-coding gene	gene with protein product		607311					Standard	NM_000926		Approved	PR, NR3C3	uc001pgh.2	P06401	OTTHUMG00000167531	ENST00000325455.5:c.1271C>G	11.37:g.100998531G>C	ENSP00000325120:p.Pro424Arg	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	6	NM_000926	0	0	0	0	0	A7LQ08|A7X8B0|B4E3T0|Q8TDS3|Q9UPF7	Missense_Mutation	SNP	ENST00000325455.5	37	CCDS8310.1	.	.	.	.	.	.	.	.	.	.	g	10.44	1.350085	0.24512	.	.	ENSG00000082175	ENST00000325455;ENST00000263463;ENST00000537623	T;T	0.19806	2.12;2.12	3.14	2.18	0.27775	.	1.520180	0.04922	U	0.455173	T	0.25975	0.0633	N	0.22421	0.69	0.24503	N	0.994244	P;P	0.47762	0.9;0.732	P;P	0.53912	0.737;0.499	T	0.35674	-0.9779	10	0.26408	T	0.33	.	9.8155	0.40849	0.0:0.0:0.7953:0.2047	.	424;424	Q8TDS3;P06401	.;PRGR_HUMAN	R	424	ENSP00000325120:P424R;ENSP00000263463:P424R	ENSP00000263463:P424R	P	-	2	0	PGR	100503741	0.009000	0.17119	0.047000	0.18901	0.177000	0.22998	1.416000	0.34759	0.251000	0.21505	0.298000	0.19748	CCG	.		0.746	PGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394934.1		
PRB4	5545	ucsc.edu;bcgsc.ca	37	12	11461745	11461745	+	Missense_Mutation	SNP	G	G	C	rs76859544		TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr12:11461745G>C	ENST00000535904.1	-	3	205	c.172C>G	c.(172-174)Caa>Gaa	p.Q58E	PRB4_ENST00000445719.2_Missense_Mutation_p.Q58E|PRB4_ENST00000279575.1_Missense_Mutation_p.Q58E			P10163	PRB4_HUMAN	proline-rich protein BstNI subfamily 4	79	9.5 X 21 AA tandem repeats of K-P-[EQ]- [GR]-[PR]-[PR]-P-Q-G-G-N-Q-[PS]-[QH]- [RG]-[PT]-P-P-[PH]-P-G.					extracellular region (GO:0005576)				breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|skin(4)|upper_aerodigestive_tract(3)	30						GGTGGTCCTTGTGGCTTTCCT	0.622										HNSCC(22;0.051)																											p.Q58E		.											.	PRB4-91	0			c.C172G						.						202.0	219.0	213.0					12																	11461745		2200	4291	6491	SO:0001583	missense	5545	exon3			GTCCTTGTGGCTT		CCDS8641.1, CCDS58208.1	12p13.2	2012-10-02			ENSG00000230657	ENSG00000230657			9340	protein-coding gene	gene with protein product		180990					Standard	NM_002723		Approved		uc001qzt.4	P10163	OTTHUMG00000169116	ENST00000535904.1:c.172C>G	12.37:g.11461745G>C	ENSP00000442834:p.Gln58Glu	Somatic	43	1		WXS	Illumina GAIIx	Phase_I	60	14	NM_001261399	0	0	2	2	0	A1L439|O00600|P02813|P10161|P10162|P81489	Missense_Mutation	SNP	ENST00000535904.1	37	CCDS8641.1	.	.	.	.	.	.	.	.	.	.	.	0.003	-2.536657	0.00143	.	.	ENSG00000230657	ENST00000279575;ENST00000535904;ENST00000445719	T;T;T	0.04706	3.57;3.57;3.57	0.956	-1.49	0.08718	.	.	.	.	.	T	0.02418	0.0074	N	0.13235	0.315	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.47636	-0.9102	9	0.02654	T	1	.	8.6632	0.34106	0.0:0.31:0.69:0.0	.	58	E9PAL0	.	E	58	ENSP00000279575:Q58E;ENSP00000442834:Q58E;ENSP00000412740:Q58E	ENSP00000279575:Q58E	Q	-	1	0	PRB4	11353012	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.476000	0.06591	-2.427000	0.00559	-3.275000	0.00048	CAA	C|1.000;|0.000		0.622	PRB4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402308.1	NM_002723	
REP15	387849	bcgsc.ca	37	12	27849795	27849795	+	Silent	SNP	C	C	T	rs929948|rs386761425	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr12:27849795C>T	ENST00000310791.2	+	1	368	c.300C>T	c.(298-300)tcC>tcT	p.S100S	RP11-1060J15.4_ENST00000536317.1_RNA|RP11-1060J15.4_ENST00000536922.1_RNA|RP11-1060J15.4_ENST00000542660.1_RNA	NM_001029874.1	NP_001025045.1	Q6BDI9	REP15_HUMAN	RAB15 effector protein	100					receptor recycling (GO:0001881)|transferrin transport (GO:0033572)	endosome membrane (GO:0010008)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)				breast(1)|cervix(1)|large_intestine(2)|lung(4)|ovary(1)	9	Lung SC(9;0.0873)					TTTGGGGATCCAACAAGCAAA	0.488													C|||	2985	0.596046	0.6399	0.6888	5008	,	,		20554	0.5268		0.6262	False		,,,				2504	0.5112				p.S100S		.											.	REP15-91	0			c.C300T						.	C		2775,1631	661.2+/-400.9	873,1029,301	83.0	80.0	81.0		300	-9.8	0.0	12	dbSNP_86	81	5305,3295	646.4+/-400.3	1624,2057,619	no	coding-synonymous	REP15	NM_001029874.1		2497,3086,920	TT,TC,CC		38.314,37.0177,37.8748		100/237	27849795	8080,4926	2203	4300	6503	SO:0001819	synonymous_variant	387849	exon1			GGGATCCAACAAG	BC140921	CCDS31762.1	12p11.22	2010-09-02			ENSG00000174236	ENSG00000174236			33748	protein-coding gene	gene with protein product		610848				16195351	Standard	NM_001029874		Approved	RAB15EP	uc001rig.1	Q6BDI9		ENST00000310791.2:c.300C>T	12.37:g.27849795C>T		Somatic	83	0		WXS	Illumina GAIIx	Phase_I	113	5	NM_001029874	0	0	0	0	0	B2RU16	Silent	SNP	ENST00000310791.2	37	CCDS31762.1																																																																																			C|0.409;T|0.591		0.488	REP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402894.1	NM_001029874	
ESPL1	9700	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	53663137	53663137	+	Silent	SNP	C	C	T			TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr12:53663137C>T	ENST00000257934.4	+	3	502	c.411C>T	c.(409-411)ccC>ccT	p.P137P	ESPL1_ENST00000552462.1_Silent_p.P137P	NM_012291.4	NP_036423.4	Q14674	ESPL1_HUMAN	extra spindle pole bodies homolog 1 (S. cerevisiae)	137					apoptotic process (GO:0006915)|cytokinesis (GO:0000910)|establishment of mitotic spindle localization (GO:0040001)|homologous chromosome segregation (GO:0045143)|meiotic spindle organization (GO:0000212)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)	centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|cysteine-type peptidase activity (GO:0008234)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(10)|large_intestine(12)|lung(21)|ovary(2)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(8)	70						AGGCTGCTCCCCAGGACTATG	0.627																																					p.P137P	Colon(53;1069 1201 2587 5382)	.											.	ESPL1-228	0			c.C411T						.						47.0	47.0	47.0					12																	53663137		2203	4300	6503	SO:0001819	synonymous_variant	9700	exon3			TGCTCCCCAGGAC	D79987	CCDS8852.1	12q13.13	2014-08-04	2013-05-03		ENSG00000135476	ENSG00000135476	3.4.22.49		16856	protein-coding gene	gene with protein product	"""separin"", ""separase"", ""separin, cysteine protease"""	604143	"""extra spindle poles like 1 (S. cerevisiae)"""			8724849, 16258266	Standard	NM_012291		Approved	KIAA0165, ESP1, SEPA	uc001sck.2	Q14674	OTTHUMG00000169674	ENST00000257934.4:c.411C>T	12.37:g.53663137C>T		Somatic	51	0		WXS	Illumina GAIIx	Phase_I	63	29	NM_012291	0	0	0	0	0		Silent	SNP	ENST00000257934.4	37	CCDS8852.1																																																																																			.		0.627	ESPL1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406899.2	NM_012291	
PPFIA2	8499	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	82147977	82147977	+	Silent	SNP	C	C	T	rs565852968		TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr12:82147977C>T	ENST00000549396.1	-	3	184	c.24G>A	c.(22-24)acG>acA	p.T8T	PPFIA2_ENST00000550584.2_Silent_p.T8T|PPFIA2_ENST00000552948.1_Silent_p.T8T|PPFIA2_ENST00000548586.1_Silent_p.T8T|PPFIA2_ENST00000549325.1_Silent_p.T8T|PPFIA2_ENST00000333447.7_Silent_p.T8T	NM_001220476.1|NM_001282536.1|NM_003625.3	NP_001207405.1|NP_001269465.1|NP_003616.2	O75334	LIPA2_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2	8					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|presynaptic active zone (GO:0048786)				NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(37)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)	85						CCTCATTAATCGTGGGCATCA	0.428													C|||	1	0.000199681	0.0	0.0014	5008	,	,		18555	0.0		0.0	False		,,,				2504	0.0				p.T8T		.											.	PPFIA2-231	0			c.G24A						.						47.0	44.0	45.0					12																	82147977		1913	4124	6037	SO:0001819	synonymous_variant	8499	exon2			ATTAATCGTGGGC	AF034799	CCDS55850.1, CCDS55851.1, CCDS55852.1, CCDS55853.1, CCDS55854.1, CCDS55855.1, CCDS55856.1, CCDS55857.1, CCDS59236.1, CCDS73503.1	12q21.31	2013-01-10						"""Sterile alpha motif (SAM) domain containing"""	9246	protein-coding gene	gene with protein product	"""Liprin-alpha2"""	603143				9624153	Standard	NM_003625		Approved		uc031qis.1	O75334		ENST00000549396.1:c.24G>A	12.37:g.82147977C>T		Somatic	117	0		WXS	Illumina GAIIx	Phase_I	186	74	NM_001220476	0	0	0	0	0	B3KVT5|B3KXA0|B7Z2A6|B7Z3U9|B7Z663|B7ZKZ5|E7ERB8|E7ETG6|F8VP68|Q2M3G8	Silent	SNP	ENST00000549396.1	37	CCDS55857.1																																																																																			.		0.428	PPFIA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408030.1		
AMDHD1	144193	hgsc.bcm.edu	37	12	96337183	96337183	+	Missense_Mutation	SNP	A	A	G	rs7955450	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr12:96337183A>G	ENST00000266736.2	+	1	113	c.7A>G	c.(7-9)Agc>Ggc	p.S3G	CCDC38_ENST00000546386.1_5'Flank|CCDC38_ENST00000344280.3_5'Flank|CCDC38_ENST00000549752.1_5'Flank	NM_152435.2	NP_689648.2	Q96NU7	HUTI_HUMAN	amidohydrolase domain containing 1	3			S -> G (in dbSNP:rs7955450). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15221005, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:16541075}.		cellular nitrogen compound metabolic process (GO:0034641)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	imidazolonepropionase activity (GO:0050480)|metal ion binding (GO:0046872)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|skin(1)	22						CGACATGGCAAGCGGCCACAG	0.736													G|||	3598	0.71845	0.702	0.6888	5008	,	,		10480	0.9554		0.6004	False		,,,				2504	0.6391				p.S3G		.											.	AMDHD1-90	0			c.A7G						.						2.0	3.0	3.0					12																	96337183		1177	2379	3556	SO:0001583	missense	144193	exon1			ATGGCAAGCGGCC	AB075878	CCDS9057.1	12q23.1	2006-02-02				ENSG00000139344			28577	protein-coding gene	gene with protein product							Standard	NM_152435		Approved	MGC35366	uc001tel.2	Q96NU7	OTTHUMG00000170353	ENST00000266736.2:c.7A>G	12.37:g.96337183A>G	ENSP00000266736:p.Ser3Gly	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_152435	0	0	0	1	1	A8K463|Q68CI8	Missense_Mutation	SNP	ENST00000266736.2	37	CCDS9057.1	1561	0.7147435897435898	348	0.7073170731707317	233	0.643646408839779	540	0.9440559440559441	440	0.5804749340369393	G	5.553	0.286982	0.10513	.	.	ENSG00000139344	ENST00000266736	T	0.30714	1.52	4.39	-8.69	0.00855	.	0.734274	0.13810	N	0.361153	T	0.00012	0.0000	N	0.01576	-0.805	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.28427	-1.0044	9	0.21540	T	0.41	.	1.8829	0.03231	0.44:0.0902:0.1959:0.2739	rs7955450;rs17856824;rs58541549;rs7955450	3	Q96NU7	HUTI_HUMAN	G	3	ENSP00000266736:S3G	ENSP00000266736:S3G	S	+	1	0	AMDHD1	94861314	0.000000	0.05858	0.000000	0.03702	0.134000	0.20937	-0.592000	0.05747	-2.316000	0.00645	-1.140000	0.01884	AGC	A|0.273;G|0.727		0.736	AMDHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408640.1	NM_152435	
TUBA3C	7278	bcgsc.ca	37	13	19751274	19751274	+	Silent	SNP	G	G	A	rs143115179	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr13:19751274G>A	ENST00000400113.3	-	4	953	c.849C>T	c.(847-849)caC>caT	p.H283H		NM_006001.2	NP_005992.1	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	283					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(4)|prostate(7)|skin(7)|urinary_tract(1)	72		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		ACAGCTGCTCGTGGTAGGCCT	0.607																																					p.H283H		.											.	TUBA3C-95	0			c.C849T						.						143.0	128.0	133.0					13																	19751274		2203	4300	6503	SO:0001819	synonymous_variant	7278	exon4			CTGCTCGTGGTAG	AF005392	CCDS9284.1	13q12.11	2007-06-20	2007-02-12	2007-02-12	ENSG00000198033	ENSG00000198033		"""Tubulins"""	12408	protein-coding gene	gene with protein product		602528	"""tubulin, alpha 2"""	TUBA2		9465305	Standard	NM_006001		Approved	bA408E5.3	uc009zzj.3	Q13748	OTTHUMG00000016481	ENST00000400113.3:c.849C>T	13.37:g.19751274G>A		Somatic	360	9		WXS	Illumina GAIIx	Phase_I	242	24	NM_006001	0	0	0	0	0	A6NJQ0|Q5W099|Q6PEY3|Q96F18	Silent	SNP	ENST00000400113.3	37	CCDS9284.1																																																																																			G|0.994;A|0.006		0.607	TUBA3C-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044007.2	NM_006001	
TUBA3C	7278	bcgsc.ca	37	13	19751292	19751292	+	Silent	SNP	T	T	C	rs147482964	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr13:19751292T>C	ENST00000400113.3	-	4	935	c.831A>G	c.(829-831)tcA>tcG	p.S277S		NM_006001.2	NP_005992.1	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	277					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(4)|prostate(7)|skin(7)|urinary_tract(1)	72		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		CCTTCTCGGCTGAGATGACCG	0.612																																					p.S277S		.											.	TUBA3C-95	0			c.A831G						.						131.0	119.0	123.0					13																	19751292		2203	4300	6503	SO:0001819	synonymous_variant	7278	exon4			CTCGGCTGAGATG	AF005392	CCDS9284.1	13q12.11	2007-06-20	2007-02-12	2007-02-12	ENSG00000198033	ENSG00000198033		"""Tubulins"""	12408	protein-coding gene	gene with protein product		602528	"""tubulin, alpha 2"""	TUBA2		9465305	Standard	NM_006001		Approved	bA408E5.3	uc009zzj.3	Q13748	OTTHUMG00000016481	ENST00000400113.3:c.831A>G	13.37:g.19751292T>C		Somatic	364	11		WXS	Illumina GAIIx	Phase_I	236	22	NM_006001	0	0	0	0	0	A6NJQ0|Q5W099|Q6PEY3|Q96F18	Silent	SNP	ENST00000400113.3	37	CCDS9284.1																																																																																			T|0.997;C|0.003		0.612	TUBA3C-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044007.2	NM_006001	
SPERT	220082	hgsc.bcm.edu	37	13	46288017	46288017	+	Nonsense_Mutation	SNP	C	C	A	rs79707842	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr13:46288017C>A	ENST00000310521.1	+	3	937	c.857C>A	c.(856-858)tCa>tAa	p.S286*	SPERT_ENST00000378966.3_Nonsense_Mutation_p.S250*	NM_152719.1	NP_689932.1	Q8NA61	SPERT_HUMAN	spermatid associated	286						cytoplasmic membrane-bounded vesicle (GO:0016023)				NS(1)|central_nervous_system(1)|large_intestine(5)|lung(5)|ovary(1)|pancreas(1)|prostate(1)	15		Breast(56;0.000819)|Lung NSC(96;0.00227)|Prostate(109;0.00703)|Lung SC(185;0.0367)|Hepatocellular(98;0.0556)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;7.26e-05)		CCCGCCCCCTCACCCCACGAG	0.721													c|||	310	0.061901	0.0068	0.0865	5008	,	,		14469	0.0982		0.0875	False		,,,				2504	0.0552				p.S286X		.											.	SPERT-91	0			c.C857A						.		stop/SER	36,3866		0,36,1915	5.0	8.0	7.0		857	3.2	0.0	13	dbSNP_131	7	419,7219		3,413,3403	no	stop-gained	SPERT	NM_152719.1		3,449,5318	AA,AC,CC		5.4857,0.9226,3.9428		286/449	46288017	455,11085	1951	3819	5770	SO:0001587	stop_gained	220082	exon3			CCCCCTCACCCCA	AK093129	CCDS9399.1, CCDS66540.1	13q14.13	2010-03-23			ENSG00000174015	ENSG00000174015			30720	protein-coding gene	gene with protein product	"""spermatid flower-like structure protein"", ""testis specific leucine zipper protein nurit"", ""chibby homolog 2 (Drosophila)"""					12204287, 20096028	Standard	NM_001286341		Approved	NURIT, CBY2	uc001van.1	Q8NA61	OTTHUMG00000016861	ENST00000310521.1:c.857C>A	13.37:g.46288017C>A	ENSP00000309189:p.Ser286*	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	18	18	NM_152719	0	0	0	0	0	A8K8I5|Q8NHV2	Nonsense_Mutation	SNP	ENST00000310521.1	37	CCDS9399.1	161	0.07371794871794872	6	0.012195121951219513	23	0.06353591160220995	68	0.11888111888111888	64	0.08443271767810026	C	21.5	4.165935	0.78339	0.009226	0.054857	ENSG00000174015	ENST00000310521;ENST00000378966	.	.	.	5.05	3.24	0.37175	.	0.731762	0.12237	N	0.486921	.	.	.	.	.	.	0.09310	P	0.9999999999958166	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.5116	0.27577	0.1627:0.751:0.0:0.0863	.	.	.	.	X	286;250	.	ENSP00000309189:S286X	S	+	2	0	SPERT	45186018	0.000000	0.05858	0.005000	0.12908	0.004000	0.04260	0.355000	0.20163	1.350000	0.45770	0.655000	0.94253	TCA	C|0.925;A|0.075		0.721	SPERT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044786.2	NM_152719	
RBM23	55147	ucsc.edu	37	14	23371268	23371268	+	Silent	SNP	A	A	G	rs56708790	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr14:23371268A>G	ENST00000359890.3	-	12	1362	c.1167T>C	c.(1165-1167)gcT>gcC	p.A389A	RBM23_ENST00000555209.1_Silent_p.A139A|RBM23_ENST00000346528.5_Silent_p.A355A|RBM23_ENST00000542016.2_Silent_p.A219A|RBM23_ENST00000399922.2_Silent_p.A373A	NM_001077351.1	NP_001070819.1	Q86U06	RBM23_HUMAN	RNA binding motif protein 23	389	Ala-rich.				mRNA processing (GO:0006397)	membrane (GO:0016020)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(3)|kidney(2)|lung(3)|prostate(1)|skin(1)	10	all_cancers(95;4.69e-05)			GBM - Glioblastoma multiforme(265;0.0128)		cggcggcggcagcagcagcag	0.552													A|||	195	0.0389377	0.0053	0.0778	5008	,	,		16698	0.0179		0.0676	False		,,,				2504	0.0491				p.A389A		.											.	RBM23-91	0			c.T1167C						.	A	,,	54,3898		1,52,1923	34.0	35.0	35.0		1167,1065,1119	-2.4	0.4	14	dbSNP_129	35	529,7793		7,515,3639	yes	coding-synonymous,coding-synonymous,coding-synonymous	RBM23	NM_001077351.1,NM_001077352.1,NM_018107.4	,,	8,567,5562	GG,GA,AA		6.3566,1.3664,4.7499	,,	389/440,355/406,373/424	23371268	583,11691	1976	4161	6137	SO:0001819	synonymous_variant	55147	exon12			GGCGGCAGCAGCA	AF275678	CCDS41919.1, CCDS41920.1, CCDS41921.1	14q11.1	2014-07-03	2004-04-23	2004-04-23		ENSG00000100461		"""RNA binding motif (RRM) containing"""	20155	protein-coding gene	gene with protein product	"""coactivator of activating protein-1 and estrogen recep- tors beta"""		"""RNA-binding region (RNP1, RRM) containing 4"""	RNPC4		15694343	Standard	NM_018107		Approved	FLJ10482, CAPERbeta	uc001whg.3	Q86U06		ENST00000359890.3:c.1167T>C	14.37:g.23371268A>G		Somatic	49	0		WXS	Illumina GAIIx	Phase_I	54	6	NM_001077351	0	0	8	20	12	D3DS32|Q8ND16|Q8TB88|Q8WY40|Q9BUJ1|Q9NVV7	Silent	SNP	ENST00000359890.3	37	CCDS41921.1	252	0.11538461538461539	8	0.016260162601626018	50	0.13812154696132597	73	0.12762237762237763	121	0.15963060686015831	A	0.768	-0.766868	0.02974	0.013664	0.063566	ENSG00000100461	ENST00000553884	.	.	.	3.36	-2.38	0.06622	.	.	.	.	.	T	0.00300	0.0009	.	.	.	0.53005	D	0.999961	.	.	.	.	.	.	T	0.04294	-1.0962	4	.	.	.	.	8.3885	0.32514	0.37:0.0:0.63:0.0	rs56708790;rs61730800	.	.	.	R	164	.	.	C	-	1	0	RBM23	22441108	0.115000	0.22152	0.443000	0.26883	0.195000	0.23768	0.047000	0.14056	-0.453000	0.07076	0.402000	0.26972	TGC	A|0.887;G|0.113		0.552	RBM23-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000413545.3		
AKAP6	9472	bcgsc.ca	37	14	33046388	33046388	+	Silent	SNP	A	A	G	rs1950703	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr14:33046388A>G	ENST00000280979.4	+	5	2579	c.2409A>G	c.(2407-2409)gaA>gaG	p.E803E	AKAP6_ENST00000557354.1_Silent_p.E803E|AKAP6_ENST00000557272.1_Silent_p.E803E	NM_004274.4	NP_004265.3	Q13023	AKAP6_HUMAN	A kinase (PRKA) anchor protein 6	803					action potential (GO:0001508)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cAMP biosynthetic process (GO:0030818)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell growth (GO:0030307)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of delayed rectifier potassium channel activity (GO:1902261)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of potassium ion transmembrane transport (GO:1901381)|positive regulation of protein phosphatase type 2B activity (GO:0032514)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|protein targeting (GO:0006605)|regulation of membrane repolarization (GO:0060306)|regulation of protein kinase A signaling (GO:0010738)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	calcium channel complex (GO:0034704)|caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|junctional sarcoplasmic reticulum membrane (GO:0014701)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	adenylate cyclase binding (GO:0008179)|ion channel binding (GO:0044325)|protein anchor (GO:0043495)|protein complex scaffold (GO:0032947)|protein kinase A binding (GO:0051018)|protein kinase A regulatory subunit binding (GO:0034237)			NS(2)|breast(10)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(25)|lung(42)|ovary(5)|pancreas(2)|prostate(3)|skin(9)|urinary_tract(2)	122	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		AAACTACAGAAAATTGGACTC	0.398													G|||	4339	0.866414	0.8147	0.8617	5008	,	,		16589	0.997		0.7932	False		,,,				2504	0.8804				p.E803E	Melanoma(49;821 1200 7288 13647 42351)	.											.	AKAP6-733	0			c.A2409G						.	G		3569,837	329.9+/-301.2	1449,671,83	129.0	124.0	125.0		2409	1.4	1.0	14	dbSNP_92	125	6974,1626	300.4+/-304.9	2812,1350,138	no	coding-synonymous	AKAP6	NM_004274.4		4261,2021,221	GG,GA,AA		18.907,18.9968,18.9374		803/2320	33046388	10543,2463	2203	4300	6503	SO:0001819	synonymous_variant	9472	exon5			TACAGAAAATTGG	AB002309	CCDS9644.1	14q12	2008-08-11			ENSG00000151320	ENSG00000151320		"""A-kinase anchor proteins"""	376	protein-coding gene	gene with protein product	"""protein kinase A anchoring protein 6"""	604691				7721854, 9205841	Standard	NM_004274		Approved	KIAA0311, mAKAP, AKAP100, PRKA6, ADAP6	uc001wrq.3	Q13023	OTTHUMG00000140207	ENST00000280979.4:c.2409A>G	14.37:g.33046388A>G		Somatic	154	0		WXS	Illumina GAIIx	Phase_I	199	7	NM_004274	0	0	0	0	0	A7E242|A7E2D4|O15028	Silent	SNP	ENST00000280979.4	37	CCDS9644.1																																																																																			A|0.133;G|0.867		0.398	AKAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276617.2	NM_004274	
PLEKHD1	400224	broad.mit.edu	37	14	69995112	69995112	+	Silent	SNP	G	G	A	rs55727771	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr14:69995112G>A	ENST00000322564.7	+	13	1709	c.1497G>A	c.(1495-1497)tcG>tcA	p.S499S		NM_001161498.1	NP_001154970.1	A6NEE1	PLHD1_HUMAN	pleckstrin homology domain containing, family D (with coiled-coil domains) member 1	499										breast(1)|endometrium(1)|kidney(2)	4						GAGCCCCCTCGGCACTCTCCC	0.662													G|||	511	0.102037	0.0484	0.0865	5008	,	,		15213	0.1508		0.1243	False		,,,				2504	0.1125				p.S499S		.											.	PLEKHD1-68	0			c.G1497A						.	G		82,1302		4,74,614	35.0	43.0	41.0		1497	-10.5	0.0	14	dbSNP_129	41	393,2789		20,353,1218	no	coding-synonymous	PLEKHD1	NM_001161498.1		24,427,1832	AA,AG,GG		12.3507,5.9249,10.403		499/507	69995112	475,4091	692	1591	2283	SO:0001819	synonymous_variant	400224	exon13			CCCCTCGGCACTC	AK126770	CCDS53903.1	14q24.1	2013-01-10	2011-05-04		ENSG00000175985	ENSG00000175985		"""Pleckstrin homology (PH) domain containing"""	20148	protein-coding gene	gene with protein product			"""pleckstrin homology domain containing, family D (with M protein repeats) member 1"""				Standard	NM_001161498		Approved	UPF0639	uc010ttf.1	A6NEE1		ENST00000322564.7:c.1497G>A	14.37:g.69995112G>A		Somatic	69	1		WXS	Illumina GAIIx	Phase_I	79	5	NM_001161498	0	0	1	1	0	B9EJC2	Silent	SNP	ENST00000322564.7	37	CCDS53903.1																																																																																			G|0.894;A|0.106		0.662	PLEKHD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412451.2	NM_001161498	
ASPG	374569	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	104573592	104573592	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr14:104573592A>C	ENST00000551177.1	+	12	1435	c.1343A>C	c.(1342-1344)gAg>gCg	p.E448A	ASPG_ENST00000546892.2_Missense_Mutation_p.E448A|ASPG_ENST00000455920.2_Missense_Mutation_p.E448A	NM_001080464.2	NP_001073933.2	Q86U10	LPP60_HUMAN	asparaginase	448					asparagine metabolic process (GO:0006528)|lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)		1-alkyl-2-acetylglycerophosphocholine esterase activity (GO:0003847)|asparaginase activity (GO:0004067)|lysophospholipase activity (GO:0004622)			endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(1)|skin(1)|urinary_tract(1)	11						GGCCACACAGAGGCAGTCACC	0.657																																					p.E448A		.											.	.	0			c.A1343C						.						32.0	42.0	38.0					14																	104573592		2115	4228	6343	SO:0001583	missense	374569	exon12			ACACAGAGGCAGT		CCDS45170.1, CCDS45170.2	14q32.33	2014-03-14	2014-03-14	2008-11-06	ENSG00000166183	ENSG00000166183	3.1.1.5, 3.5.1.1	"""Ankyrin repeat domain containing"""	20123	protein-coding gene	gene with protein product	"""60-kDa-lysophospholipase"""		"""chromosome 14 open reading frame 76"", ""asparaginase homolog (S. cerevisiae)"""	C14orf76			Standard	NM_001080464		Approved		uc001yoq.2	Q86U10		ENST00000551177.1:c.1343A>C	14.37:g.104573592A>C	ENSP00000450040:p.Glu448Ala	Somatic	220	0		WXS	Illumina GAIIx	Phase_I	598	37	NM_001080464	0	0	0	0	0	B9EGQ2|Q8IV80	Missense_Mutation	SNP	ENST00000551177.1	37	CCDS45170.2	.	.	.	.	.	.	.	.	.	.	A	7.896	0.733432	0.15574	.	.	ENSG00000166183	ENST00000551177;ENST00000299234;ENST00000546892;ENST00000455920;ENST00000550583	T;T;T;T	0.69040	0.35;-0.37;0.35;0.35	4.62	-8.17	0.01057	Ankyrin repeat-containing domain (4);	.	.	.	.	T	0.48714	0.1515	L	0.54908	1.71	0.09310	N	1	B;B;B;B	0.15141	0.012;0.002;0.001;0.004	B;B;B;B	0.18263	0.009;0.007;0.004;0.021	T	0.33292	-0.9874	9	0.21540	T	0.41	.	2.4267	0.04461	0.3872:0.3368:0.1681:0.1079	.	448;448;448;476	G3V1Y8;Q86U10;Q86U10-3;E5RFC2	.;LPP60_HUMAN;.;.	A	448;476;448;448;9	ENSP00000450040:E448A;ENSP00000448911:E448A;ENSP00000389003:E448A;ENSP00000446856:E9A	ENSP00000299234:E476A	E	+	2	0	ASPG	103643345	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.273000	0.02823	-1.575000	0.01655	-0.464000	0.05259	GAG	.		0.657	ASPG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407005.1	NM_001080464	
MAP1A	4130	bcgsc.ca	37	15	43815999	43815999	+	Silent	SNP	C	C	T	rs3862138	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr15:43815999C>T	ENST00000300231.5	+	4	2778	c.2328C>T	c.(2326-2328)ccC>ccT	p.P776P	MAP1A_ENST00000382031.1_Silent_p.P1014P|MAP1A_ENST00000399453.1_Silent_p.P776P			P78559	MAP1A_HUMAN	microtubule-associated protein 1A	776					microtubule cytoskeleton organization (GO:0000226)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(5)|pancreas(3)|prostate(2)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	66		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	ATGACCTGCCCGGGCCTGAAG	0.552													C|||	657	0.13119	0.1778	0.1081	5008	,	,		18474	0.001		0.1918	False		,,,				2504	0.1564				p.P776P		.											.	MAP1A-141	0			c.C2328T						.	C		638,3294		57,524,1385	34.0	36.0	36.0		2328	-2.7	1.0	15	dbSNP_108	36	1579,6747		144,1291,2728	no	coding-synonymous	MAP1A	NM_002373.5		201,1815,4113	TT,TC,CC		18.9647,16.2258,18.0861		776/2804	43815999	2217,10041	1966	4163	6129	SO:0001819	synonymous_variant	4130	exon4			CCTGCCCGGGCCT	U38292	CCDS42031.1	15q15.3	2006-06-15			ENSG00000166963	ENSG00000166963			6835	protein-coding gene	gene with protein product		600178		MAP1L		7806212, 7629894	Standard	XM_005254385		Approved		uc001zrt.3	P78559	OTTHUMG00000059756	ENST00000300231.5:c.2328C>T	15.37:g.43815999C>T		Somatic	86	0		WXS	Illumina GAIIx	Phase_I	69	5	NM_002373	0	0	0	0	0	O95643|Q12973|Q15882|Q9UJT4	Silent	SNP	ENST00000300231.5	37	CCDS42031.1																																																																																			C|0.836;T|0.164		0.552	MAP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000132894.5	NM_002373	
DUOX2	50506	hgsc.bcm.edu	37	15	45403779	45403779	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr15:45403779T>C	ENST00000603300.1	-	6	720	c.518A>G	c.(517-519)aAc>aGc	p.N173S	DUOXA2_ENST00000323030.5_5'Flank|DUOX2_ENST00000389039.6_Missense_Mutation_p.N173S	NM_014080.4	NP_054799.4	Q9NRD8	DUOX2_HUMAN	dual oxidase 2	173	Peroxidase-like; mediates peroxidase activity. {ECO:0000250}.				adenohypophysis morphogenesis (GO:0048855)|bone mineralization (GO:0030282)|cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|fertilization (GO:0009566)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|inner ear development (GO:0048839)|multicellular organism growth (GO:0035264)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|response to virus (GO:0009615)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|peroxidase activity (GO:0004601)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(7)|urinary_tract(1)	63		all_cancers(109;3.79e-11)|all_epithelial(112;2.92e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.05e-18)|GBM - Glioblastoma multiforme(94;4.23e-07)|COAD - Colon adenocarcinoma(120;0.0668)|Colorectal(133;0.068)		CGTCACCTGGTTGGCCTGCGG	0.776																																					p.N173S		.											.	DUOX2-95	0			c.A518G						.						3.0	3.0	3.0					15																	45403779		1915	3785	5700	SO:0001583	missense	50506	exon6			ACCTGGTTGGCCT	AF181972	CCDS10117.1	15q15.3-q21	2013-01-10			ENSG00000140279	ENSG00000140279		"""EF-hand domain containing"""	13273	protein-coding gene	gene with protein product	"""dual oxidase-like domains 2"", ""nicotinamide adenine dinucleotide phosphate oxidase"", ""flavoprotein NADPH oxidase"", ""NADPH thyroid oxidase 2"", ""NADH/NADPH thyroid oxidase p138-tox"", ""NADPH oxidase/peroxidase DUOX2"""	606759				10601291, 10806195	Standard	NM_014080		Approved	P138-TOX, P138(TOX), THOX2, LNOX2	uc010bea.3	Q9NRD8	OTTHUMG00000131355	ENST00000603300.1:c.518A>G	15.37:g.45403779T>C	ENSP00000475084:p.Asn173Ser	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	9	9	NM_014080	0	0	0	0	0	A8MQ13|D2XI64|Q9NR02|Q9UHF9	Missense_Mutation	SNP	ENST00000603300.1	37	CCDS10117.1	.	.	.	.	.	.	.	.	.	.	.	30	5.052489	0.93793	.	.	ENSG00000140279	ENST00000389039	.	.	.	5.06	5.06	0.68205	.	0.000000	0.85682	D	0.000000	T	0.79476	0.4452	M	0.81682	2.555	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.82594	-0.0380	9	0.72032	D	0.01	-29.3169	13.9778	0.64284	0.0:0.0:0.0:1.0	.	173	Q9NRD8	DUOX2_HUMAN	S	173	.	ENSP00000373691:N173S	N	-	2	0	DUOX2	43191071	1.000000	0.71417	0.997000	0.53966	0.929000	0.56500	7.859000	0.86982	1.917000	0.55516	0.459000	0.35465	AAC	.		0.776	DUOX2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_014080	
TLN2	83660	ucsc.edu;bcgsc.ca	37	15	63017183	63017183	+	Missense_Mutation	SNP	A	A	C	rs148931336	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr15:63017183A>C	ENST00000561311.1	+	26	3365	c.3135A>C	c.(3133-3135)gaA>gaC	p.E1045D	TLN2_ENST00000306829.6_Missense_Mutation_p.E1045D			Q9Y4G6	TLN2_HUMAN	talin 2	1045	Ala-rich.				cell adhesion (GO:0007155)|cell-cell junction assembly (GO:0007043)|cytoskeletal anchoring at plasma membrane (GO:0007016)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99						AGGCCCATGAAGCTTGTGGTC	0.478													A|||	37	0.00738818	0.0015	0.0115	5008	,	,		20177	0.0		0.0209	False		,,,				2504	0.0061				p.E1045D		.											.	TLN2-573	0			c.A3135C						.	A	ASP/GLU	7,4399	12.9+/-30.5	0,7,2196	64.0	61.0	62.0		3135	5.5	1.0	15	dbSNP_134	62	155,8445	74.5+/-137.1	1,153,4146	yes	missense	TLN2	NM_015059.2	45	1,160,6342	CC,CA,AA		1.8023,0.1589,1.2456	benign	1045/2543	63017183	162,12844	2203	4300	6503	SO:0001583	missense	83660	exon24			CCATGAAGCTTGT	AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914			15447	protein-coding gene	gene with protein product		607349				9205841, 11527381	Standard	NM_015059		Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.3135A>C	15.37:g.63017183A>C	ENSP00000453508:p.Glu1045Asp	Somatic	47	0		WXS	Illumina GAIIx	Phase_I	33	4	NM_015059	0	0	0	0	0	A6NLB8	Missense_Mutation	SNP	ENST00000561311.1	37	CCDS32261.1	18	0.008241758241758242	0	0.0	2	0.0055248618784530384	0	0.0	16	0.021108179419525065	A	13.10	2.135963	0.37728	0.001589	0.018023	ENSG00000171914	ENST00000306829	T	0.68903	-0.36	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.54515	0.1863	N	0.17800	0.525	0.53005	D	0.999968	D	0.71674	0.998	D	0.79108	0.992	T	0.63171	-0.6697	10	0.24483	T	0.36	-23.5089	15.9649	0.79961	1.0:0.0:0.0:0.0	.	1045	Q9Y4G6	TLN2_HUMAN	D	1045	ENSP00000303476:E1045D	ENSP00000303476:E1045D	E	+	3	2	TLN2	60804475	1.000000	0.71417	1.000000	0.80357	0.824000	0.46624	3.495000	0.53280	2.232000	0.73038	0.533000	0.62120	GAA	A|0.988;C|0.012		0.478	TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257878.2		
ACSBG1	23205	bcgsc.ca	37	15	78466127	78466127	+	Missense_Mutation	SNP	T	T	C	rs2304824	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr15:78466127T>C	ENST00000258873.4	-	13	2102	c.1897A>G	c.(1897-1899)Atg>Gtg	p.M633V	ACSBG1_ENST00000541759.1_Missense_Mutation_p.M391V|ACSBG1_ENST00000560817.1_Missense_Mutation_p.M391V	NM_001199377.1|NM_015162.4	NP_001186306.1|NP_055977.3	Q96GR2	ACBG1_HUMAN	acyl-CoA synthetase bubblegum family member 1	633			M -> V (in dbSNP:rs2304824). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:9734811, ECO:0000269|Ref.6}.		long-chain fatty acid metabolic process (GO:0001676)|myelination (GO:0042552)|ovarian follicle atresia (GO:0001552)|response to glucocorticoid (GO:0051384)|very long-chain fatty acid metabolic process (GO:0000038)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			endometrium(2)|kidney(2)|large_intestine(11)|liver(1)|lung(15)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	37						CAGAACTCCATAGCTTGTTCA	0.537													C|||	2638	0.526757	0.73	0.4409	5008	,	,		21424	0.2867		0.498	False		,,,				2504	0.59				p.M633V		.											.	ACSBG1-91	0			c.A1897G						.	C	VAL/MET,VAL/MET	3021,1371	453.4+/-350.3	1031,959,206	77.0	67.0	70.0		1885,1897	-0.0	0.4	15	dbSNP_100	70	4289,4297	576.6+/-390.4	1074,2141,1078	yes	missense,missense	ACSBG1	NM_001199377.1,NM_015162.4	21,21	2105,3100,1284	CC,CT,TT		49.9534,31.2158,43.6739	benign,benign	629/721,633/725	78466127	7310,5668	2196	4293	6489	SO:0001583	missense	23205	exon13			ACTCCATAGCTTG	AB014531	CCDS10298.1	15q23-q24	2006-02-09			ENSG00000103740	ENSG00000103740		"""Acyl-CoA synthetase family"""	29567	protein-coding gene	gene with protein product	"""bubblegum"", ""very long-chain acyl-CoA synthetase"", ""lipidosin"""	614362				9734811, 10954726	Standard	NM_015162		Approved	BGM, FLJ30320, MGC14352, BG1, KIAA0631, hBG1, hsBG	uc002bdh.3	Q96GR2	OTTHUMG00000143734	ENST00000258873.4:c.1897A>G	15.37:g.78466127T>C	ENSP00000258873:p.Met633Val	Somatic	135	1		WXS	Illumina GAIIx	Phase_I	77	6	NM_015162	0	0	0	0	0	B2RB61|O75126|Q76N27|Q9HC26	Missense_Mutation	SNP	ENST00000258873.4	37	CCDS10298.1	1073	0.4913003663003663	358	0.7276422764227642	175	0.48342541436464087	165	0.28846153846153844	375	0.4947229551451187	C	1.769	-0.484813	0.04352	0.687842	0.499534	ENSG00000103740	ENST00000258873;ENST00000541759	T;T	0.34275	1.71;1.37	5.35	-0.0403	0.13872	.	0.487637	0.19405	N	0.115080	T	0.00012	0.0000	N	0.00583	-1.355	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.33727	-0.9857	9	0.12103	T	0.63	-14.1277	0.1445	0.00087	0.2497:0.228:0.2448:0.2775	rs2304824;rs17605786;rs17855404;rs61080752;rs2304824	633	Q96GR2	ACBG1_HUMAN	V	633;391	ENSP00000258873:M633V;ENSP00000439955:M391V	ENSP00000258873:M633V	M	-	1	0	ACSBG1	76253182	0.000000	0.05858	0.394000	0.26270	0.853000	0.48598	-0.598000	0.05706	0.105000	0.17753	-0.186000	0.12905	ATG	T|0.468;C|0.532		0.537	ACSBG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289802.2	NM_015162	
PRR35	146325	hgsc.bcm.edu	37	16	613729	613729	+	Silent	SNP	T	T	G	rs45619831	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr16:613729T>G	ENST00000409413.3	+	2	714	c.435T>G	c.(433-435)gcT>gcG	p.A145A		NM_145270.2	NP_660313.1	P0CG20	PRR35_HUMAN		145	Pro-rich.									central_nervous_system(1)|endometrium(1)|lung(5)|ovary(1)|skin(1)|urinary_tract(1)	10						CCCCTGTGGCTAGGGCCACCC	0.731													T|||	38	0.00758786	0.003	0.0029	5008	,	,		12145	0.0		0.0229	False		,,,				2504	0.0092				p.A145A		.											.	C16orf11-23	0			c.T435G						.	T		21,3395		0,21,1687	3.0	4.0	4.0		435	-5.6	0.0	16	dbSNP_127	4	226,7400		3,220,3590	no	coding-synonymous	C16orf11	NM_145270.2		3,241,5277	GG,GT,TT		2.9635,0.6148,2.2369		145/572	613729	247,10795	1708	3813	5521	SO:0001819	synonymous_variant	146325	exon2			TGTGGCTAGGGCC																												ENST00000409413.3:c.435T>G	16.37:g.613729T>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	24	6	NM_145270	0	0	0	0	0	B8ZZ27|Q8N233|Q96AX3|Q96S23	Silent	SNP	ENST00000409413.3	37	CCDS45365.1																																																																																			T|0.992;G|0.008		0.731	C16orf11-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000333913.1		
GRIN2A	2903	bcgsc.ca	37	16	9943666	9943666	+	Silent	SNP	C	C	T	rs2229193	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr16:9943666C>T	ENST00000396573.2	-	6	1584	c.1275G>A	c.(1273-1275)ctG>ctA	p.L425L	GRIN2A_ENST00000404927.2_Silent_p.L425L|GRIN2A_ENST00000562109.1_Silent_p.L425L|GRIN2A_ENST00000396575.2_Silent_p.L425L|GRIN2A_ENST00000330684.3_Silent_p.L425L|GRIN2A_ENST00000535259.1_Silent_p.L268L	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	425					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	ACGTCTCGGTCAGGGGGTCTA	0.547													C|||	1131	0.225839	0.2988	0.2089	5008	,	,		18934	0.0754		0.2992	False		,,,				2504	0.2188				p.L425L		.											.	GRIN2A-349	0			c.G1275A						.	C	,,	1310,3084	444.1+/-347.2	187,936,1074	179.0	139.0	153.0		1275,1275,1275	3.2	1.0	16	dbSNP_116	153	2543,6057	415.2+/-351.7	346,1851,2103	no	coding-synonymous,coding-synonymous,coding-synonymous	GRIN2A	NM_000833.3,NM_001134407.1,NM_001134408.1	,,	533,2787,3177	TT,TC,CC		29.5698,29.8134,29.6521	,,	425/1465,425/1465,425/1282	9943666	3853,9141	2197	4300	6497	SO:0001819	synonymous_variant	2903	exon6			CTCGGTCAGGGGG		CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.1275G>A	16.37:g.9943666C>T		Somatic	280	3		WXS	Illumina GAIIx	Phase_I	323	10	NM_000833	0	0	0	0	0	O00669|Q17RZ6	Silent	SNP	ENST00000396573.2	37	CCDS10539.1																																																																																			C|0.736;T|0.264		0.547	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251930.3		
ZZEF1	23140	hgsc.bcm.edu	37	17	4046101	4046101	+	Missense_Mutation	SNP	A	A	G	rs1454121	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr17:4046101A>G	ENST00000381638.2	-	1	213	c.89T>C	c.(88-90)gTc>gCc	p.V30A	ZZEF1_ENST00000574474.1_5'UTR|CYB5D2_ENST00000575251.1_5'Flank|CYB5D2_ENST00000573984.1_5'Flank|CYB5D2_ENST00000301391.3_5'Flank	NM_015113.3	NP_055928.3	O43149	ZZEF1_HUMAN	zinc finger, ZZ-type with EF-hand domain 1	30			V -> A (in dbSNP:rs1454121). {ECO:0000269|PubMed:14702039}.				calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	84						CGTGCCCGAGACCGCGGCCCA	0.746													A|||	4028	0.804313	0.4781	0.8617	5008	,	,		11055	1.0		0.8529	False		,,,				2504	0.953				p.V30A		.											.	ZZEF1-93	0			c.T89C						.						2.0	2.0	2.0					17																	4046101		1609	3070	4679	SO:0001583	missense	23140	exon1			CCCGAGACCGCGG	BC035319	CCDS11043.1	17p13.3	2013-01-10	2004-11-03		ENSG00000074755	ENSG00000074755		"""Zinc fingers, ZZ-type"", ""EF-hand domain containing"""	29027	protein-coding gene	gene with protein product			"""zinc finger, ZZ-type with EF hand domain 1"""			9455477	Standard	XM_005256560		Approved	KIAA0399, ZZZ4, FLJ10821	uc002fxe.3	O43149	OTTHUMG00000090741	ENST00000381638.2:c.89T>C	17.37:g.4046101A>G	ENSP00000371051:p.Val30Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_015113	0	0	0	0	0	A7MBM5|Q6NXG0|Q6ZRA1|Q6ZSF4|Q9NVB9	Missense_Mutation	SNP	ENST00000381638.2	37	CCDS11043.1	1773	0.8118131868131868	254	0.516260162601626	308	0.850828729281768	572	1.0	639	0.8430079155672823	A	12.64	1.999923	0.35320	.	.	ENSG00000074755	ENST00000381638	T	0.18810	2.19	4.8	1.17	0.20885	.	0.614467	0.15724	N	0.247743	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.20107	-1.0285	9	0.33940	T	0.23	-2.2642	0.9962	0.01467	0.1675:0.1675:0.1581:0.5069	rs1454121	30;30	O43149-3;O43149	.;ZZEF1_HUMAN	A	30	ENSP00000371051:V30A	ENSP00000371051:V30A	V	-	2	0	ZZEF1	3992850	0.343000	0.24818	0.021000	0.16686	0.882000	0.50991	0.278000	0.18753	0.760000	0.33108	-0.527000	0.04329	GTC	A|0.188;G|0.812		0.746	ZZEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207480.1	NM_015113	
PELP1	27043	ucsc.edu;bcgsc.ca	37	17	4576216	4576216	+	Silent	SNP	G	G	A	rs147763003	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr17:4576216G>A	ENST00000574876.1	-	16	2087	c.2070C>T	c.(2068-2070)ccC>ccT	p.P690P	PELP1_ENST00000572293.1_Silent_p.P740P|PELP1_ENST00000269230.7_Silent_p.P600P|PELP1_ENST00000436683.2_Silent_p.P543P|AC091153.4_ENST00000441700.2_RNA|PELP1_ENST00000301396.4_Silent_p.P834P			Q8IZL8	PELP1_HUMAN	proline, glutamate and leucine rich protein 1	690	Pro-rich.				cellular response to estrogen stimulus (GO:0071391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|MLL1 complex (GO:0071339)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcriptionally active chromatin (GO:0035327)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(2)|endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	15						GGCCTGCTGAGGGCATGGGGC	0.687													G|||	107	0.0213658	0.0045	0.0072	5008	,	,		12426	0.0079		0.0159	False		,,,				2504	0.0736				p.P690P		.											.	PELP1-24	0			c.C2070T						.	G		11,3975		0,11,1982	34.0	40.0	38.0		2070	3.6	0.7	17	dbSNP_134	38	48,8244		0,48,4098	no	coding-synonymous	PELP1	NM_014389.2		0,59,6080	AA,AG,GG		0.5789,0.276,0.4805		690/1131	4576216	59,12219	1993	4146	6139	SO:0001819	synonymous_variant	27043	exon16			TGCTGAGGGCATG		CCDS58503.1, CCDS58503.2, CCDS62038.1	17p13.2	2012-05-02	2008-02-21			ENSG00000141456			30134	protein-coding gene	gene with protein product		609455	"""proline, glutamic acid and leucine rich protein 1"""			11481323, 12682072	Standard	NM_014389		Approved	MNAR	uc002fyi.4	Q8IZL8		ENST00000574876.1:c.2070C>T	17.37:g.4576216G>A		Somatic	27	0		WXS	Illumina GAIIx	Phase_I	47	13	NM_014389	0	0	30	30	0	O15450|Q5EGN3|Q6NTE6|Q96FT1|Q9BU60	Silent	SNP	ENST00000574876.1	37	CCDS58503.1																																																																																			G|0.995;A|0.005		0.687	PELP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000439140.2	NM_014389	
MINK1	50488	bcgsc.ca	37	17	4797305	4797305	+	Missense_Mutation	SNP	G	G	A	rs2302319	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr17:4797305G>A	ENST00000355280.6	+	22	2783	c.2587G>A	c.(2587-2589)Gtc>Atc	p.V863I	MINK1_ENST00000453408.3_Missense_Mutation_p.V843I|MINK1_ENST00000347992.7_Missense_Mutation_p.V834I	NM_001024937.3|NM_015716.4|NM_153827.4	NP_001020108.1|NP_056531.1|NP_722549.2			misshapen-like kinase 1											central_nervous_system(2)|large_intestine(1)|lung(1)|skin(1)|stomach(1)	6						TACAGACAGCGTCAGCACCAT	0.657													G|||	1045	0.208666	0.0076	0.0764	5008	,	,		17031	0.5069		0.1024	False		,,,				2504	0.3763				p.V863I		.											.	MINK1-943	0			c.G2587A						.	G	ILE/VAL,ILE/VAL,ILE/VAL,ILE/VAL	67,4037		1,65,1986	27.0	31.0	30.0		2527,2476,2587,2500	3.2	1.0	17	dbSNP_100	30	632,7756		24,584,3586	yes	missense,missense,missense,missense	MINK1	NM_001024937.3,NM_015716.4,NM_153827.4,NM_170663.4	29,29,29,29	25,649,5572	AA,AG,GG		7.5346,1.6326,5.5956	benign,benign,benign,benign	843/1313,826/1296,863/1333,834/1304	4797305	699,11793	2052	4194	6246	SO:0001583	missense	50488	exon22			GACAGCGTCAGCA	AY775058	CCDS45588.1, CCDS45589.1, CCDS45590.1	17p13.2	2011-04-14	2010-06-24		ENSG00000141503	ENSG00000141503			17565	protein-coding gene	gene with protein product	"""misshapen/NIK-related kinase"""	609426	"""misshapen-like kinase 1 (zebrafish)"""			10708748, 12087176	Standard	NM_015716		Approved	B55, MINK, ZC3, MAP4K6, YSK2	uc010vsl.2	Q8N4C8		ENST00000355280.6:c.2587G>A	17.37:g.4797305G>A	ENSP00000347427:p.Val863Ile	Somatic	138	0		WXS	Illumina GAIIx	Phase_I	108	5	NM_153827	0	0	42	42	0		Missense_Mutation	SNP	ENST00000355280.6	37	CCDS45588.1	391	0.17902930402930403	6	0.012195121951219513	30	0.08287292817679558	276	0.4825174825174825	79	0.10422163588390501	G	14.06	2.423731	0.43020	0.016326	0.075346	ENSG00000141503	ENST00000355280;ENST00000453408;ENST00000347992	T;T;T	0.75154	-0.91;-0.91;-0.91	5.24	3.22	0.36961	.	0.144593	0.44902	D	0.000414	T	0.00012	0.0000	M	0.70275	2.135	0.29795	P	0.832938	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.001;0.001;0.001	T	0.37056	-0.9722	9	0.59425	D	0.04	.	10.3147	0.43729	0.1658:0.0:0.8342:0.0	rs2302319;rs59653681;rs2302319	826;843;863;834	Q8N4C8-2;Q8N4C8-4;Q8N4C8;Q8N4C8-3	.;.;MINK1_HUMAN;.	I	863;843;834	ENSP00000347427:V863I;ENSP00000406487:V843I;ENSP00000269296:V834I	ENSP00000269296:V834I	V	+	1	0	MINK1	4738081	0.991000	0.36638	0.989000	0.46669	0.946000	0.59487	2.046000	0.41260	1.446000	0.47643	-0.137000	0.14449	GTC	G|0.828;A|0.172		0.657	MINK1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439801.1	NM_015716	
TP53	7157	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	7577114	7577114	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr17:7577114C>G	ENST00000269305.4	-	8	1013	c.824G>C	c.(823-825)tGt>tCt	p.C275S	TP53_ENST00000413465.2_Intron|TP53_ENST00000445888.2_Missense_Mutation_p.C275S|TP53_ENST00000359597.4_Missense_Mutation_p.C275S|TP53_ENST00000420246.2_Missense_Mutation_p.C275S|TP53_ENST00000455263.2_Missense_Mutation_p.C275S|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	275	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		C -> F (in sporadic cancers; somatic mutation).|C -> G (in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:7887414}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C275Y(53)|p.C275F(37)|p.0?(8)|p.C275fs*70(3)|p.?(2)|p.C275S(2)|p.C275fs*20(1)|p.L265_K305del41(1)|p.R273_C275delRVC(1)|p.F270_D281del12(1)|p.V274_P278del(1)|p.A276fs*29(1)|p.S269fs*21(1)|p.C275fs*67(1)|p.V272_K292del21(1)|p.C275_R283delCACPGRDRR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGGACAGGCACAAACACGCAC	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.C275S	Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	.	TP53-70225	115	Substitution - Missense(92)|Whole gene deletion(8)|Deletion - Frameshift(7)|Deletion - In frame(6)|Unknown(2)	lung(14)|large_intestine(13)|breast(13)|upper_aerodigestive_tract(12)|central_nervous_system(10)|haematopoietic_and_lymphoid_tissue(10)|ovary(7)|urinary_tract(6)|stomach(5)|oesophagus(5)|bone(5)|liver(5)|skin(3)|pancreas(2)|NS(2)|prostate(2)|biliary_tract(1)	c.G824C	GRCh37	CM076568|CM951234	TP53	M		.						71.0	61.0	64.0					17																	7577114		2203	4300	6503	SO:0001583	missense	7157	exon8	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	CAGGCACAAACAC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.824G>C	17.37:g.7577114C>G	ENSP00000269305:p.Cys275Ser	Somatic	97	0		WXS	Illumina GAIIx	Phase_I	57	44	NM_000546	0	0	3	53	50	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	26.7	4.759306	0.89932	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99869	-7.34;-7.34;-7.34;-7.34;-7.34;-7.34	4.92	4.92	0.64577	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99883	0.9944	M	0.92738	3.34	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.999;0.999	D;D;D;D	0.91635	0.991;0.999;0.987;0.987	D	0.96317	0.9233	10	0.87932	D	0	-17.2181	15.662	0.77193	0.0:1.0:0.0:0.0	.	275;275;275;275	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	S	275;275;275;275;275;264;143	ENSP00000352610:C275S;ENSP00000269305:C275S;ENSP00000398846:C275S;ENSP00000391127:C275S;ENSP00000391478:C275S;ENSP00000425104:C143S	ENSP00000269305:C275S	C	-	2	0	TP53	7517839	1.000000	0.71417	0.999000	0.59377	0.904000	0.53231	7.587000	0.82613	2.556000	0.86216	0.462000	0.41574	TGT	.		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
ELAC2	60528	bcgsc.ca	37	17	12898295	12898295	+	Silent	SNP	T	T	C	rs17552022	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr17:12898295T>C	ENST00000338034.4	-	20	2132	c.1893A>G	c.(1891-1893)acA>acG	p.T631T	ELAC2_ENST00000426905.3_Silent_p.T591T|ELAC2_ENST00000395962.2_Silent_p.T612T	NM_018127.6|NM_173717.1	NP_060597.4|NP_776065.1	Q9BQ52	RNZ2_HUMAN	elaC ribonuclease Z 2	631					mitochondrial tRNA 3'-trailer cleavage, endonucleolytic (GO:0072684)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|skin(1)	23						CCAAATCACATGTTCGCAACA	0.532													T|||	252	0.0503195	0.0053	0.0793	5008	,	,		19149	0.001		0.1203	False		,,,				2504	0.0695				p.T631T		.											.	ELAC2-90	0			c.A1893G						.	T	,,	99,4307	78.8+/-117.2	3,93,2107	178.0	185.0	183.0		1773,1893,1890	-10.6	0.0	17	dbSNP_123	183	1095,7505	228.6+/-263.6	76,943,3281	no	coding-synonymous,coding-synonymous,coding-synonymous	ELAC2	NM_001165962.1,NM_018127.6,NM_173717.1	,,	79,1036,5388	CC,CT,TT		12.7326,2.2469,9.1804	,,	591/787,631/827,630/826	12898295	1194,11812	2203	4300	6503	SO:0001819	synonymous_variant	60528	exon20			ATCACATGTTCGC	AF304370	CCDS11164.1, CCDS54093.1	17p11.2	2013-05-24	2013-05-24		ENSG00000006744	ENSG00000006744	3.1.26.11		14198	protein-coding gene	gene with protein product	"""tRNase Z (long form)"""	605367	"""elaC (E. coli) homolog 2"", ""elaC homolog 2 (E. coli)"""			10986046, 16636667, 21559454	Standard	NM_018127		Approved	FLJ10530, HPC2	uc010vvr.2	Q9BQ52	OTTHUMG00000058764	ENST00000338034.4:c.1893A>G	17.37:g.12898295T>C		Somatic	243	0		WXS	Illumina GAIIx	Phase_I	138	6	NM_018127	0	0	84	84	0	B4DPL9|Q6IA94|Q9HAS8|Q9HAS9|Q9NVT1	Silent	SNP	ENST00000338034.4	37	CCDS11164.1																																																																																			T|0.921;C|0.079		0.532	ELAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129934.5		
TEKT3	64518	bcgsc.ca	37	17	15215660	15215660	+	Silent	SNP	T	T	C	rs2286516	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr17:15215660T>C	ENST00000395930.1	-	7	1203	c.1017A>G	c.(1015-1017)caA>caG	p.Q339Q	TEKT3_ENST00000338696.2_Silent_p.Q339Q|RNU6-799P_ENST00000363567.1_RNA	NM_031898.2	NP_114104.1	Q9BXF9	TEKT3_HUMAN	tektin 3	339					cilium morphogenesis (GO:0060271)|regulation of fertilization (GO:0080154)|sperm motility (GO:0030317)	acrosomal membrane (GO:0002080)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)				endometrium(1)|kidney(3)|large_intestine(5)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	23				UCEC - Uterine corpus endometrioid carcinoma (92;0.0877)		CTTTGTTGAATTGATTCCACA	0.448													T|||	1174	0.234425	0.1445	0.2896	5008	,	,		21481	0.252		0.2793	False		,,,				2504	0.2526				p.Q339Q		.											.	TEKT3-92	0			c.A1017G						.	T		744,3662	306.0+/-289.3	64,616,1523	130.0	113.0	118.0		1017	2.2	1.0	17	dbSNP_100	118	2224,6376	377.6+/-338.6	274,1676,2350	no	coding-synonymous	TEKT3	NM_031898.2		338,2292,3873	CC,CT,TT		25.8605,16.8861,22.8202		339/491	15215660	2968,10038	2203	4300	6503	SO:0001819	synonymous_variant	64518	exon7			GTTGAATTGATTC	AF334676	CCDS11169.1	17p12	2011-05-23			ENSG00000125409	ENSG00000125409			14293	protein-coding gene	gene with protein product		612683				11381029, 14735490	Standard	NM_031898		Approved	FLJ32828	uc002gon.3	Q9BXF9	OTTHUMG00000058965	ENST00000395930.1:c.1017A>G	17.37:g.15215660T>C		Somatic	107	0		WXS	Illumina GAIIx	Phase_I	87	7	NM_031898	0	0	1	1	0	B2RAS7|D3DTT0|Q8N5R5|Q96M48	Silent	SNP	ENST00000395930.1	37	CCDS11169.1																																																																																			T|0.770;C|0.230		0.448	TEKT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130385.2	NM_031898	
TVP23C	201158	ucsc.edu	37	17	15457087	15457087	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr17:15457087C>T	ENST00000225576.3	-	3	247	c.152G>A	c.(151-153)tGt>tAt	p.C51Y	TVP23C_ENST00000428082.2_Missense_Mutation_p.C51Y|TVP23C_ENST00000518321.1_Missense_Mutation_p.C51Y|TVP23C_ENST00000438826.3_Missense_Mutation_p.C51Y|TVP23C_ENST00000584811.1_5'UTR|TVP23C-CDRT4_ENST00000522212.2_Missense_Mutation_p.C51Y|TVP23C_ENST00000519970.1_Intron	NM_145301.2	NP_660344.2	Q96ET8	TV23C_HUMAN	trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)	51						integral component of membrane (GO:0016021)											ACAGAGAAGACAGACGATGAT	0.373																																					p.C51Y		.											.	.	0			c.G152A						.						274.0	265.0	268.0					17																	15457087		2203	4300	6503	SO:0001583	missense	201158	exon3			AGAAGACAGACGA	BC011952	CCDS11170.1, CCDS45617.1	17p12	2012-11-29	2012-11-29	2012-11-29	ENSG00000175106	ENSG00000175106			30453	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B2"""	FAM18B2			Standard	NM_001135036		Approved	MGC8763	uc002goq.2	Q96ET8	OTTHUMG00000171461	ENST00000225576.3:c.152G>A	17.37:g.15457087C>T	ENSP00000225576:p.Cys51Tyr	Somatic	298	17		WXS	Illumina GAIIx	Phase_I	211	9	NM_145301	0	0	3	15	12	Q3LIC7	Missense_Mutation	SNP	ENST00000225576.3	37	CCDS11170.1	.	.	.	.	.	.	.	.	.	.	.	2.368	-0.344949	0.05208	.	.	ENSG00000259024;ENSG00000175106;ENSG00000175106;ENSG00000175106	ENST00000522212;ENST00000225576;ENST00000428082;ENST00000438826	T;T;T;T	0.25749	1.78;1.78;1.78;1.78	4.47	4.47	0.54385	.	0.000000	0.85682	N	0.000000	T	0.02571	0.0078	N	0.00004	-3.335	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.0;0.0;0.002	T	0.38457	-0.9660	10	0.02654	T	1	-3.8701	9.492	0.38965	0.0:0.0877:0.0:0.9123	.	51;51;51	Q96ET8-2;Q96ET8-3;Q96ET8	.;.;F18B2_HUMAN	Y	51	ENSP00000429865:C51Y;ENSP00000225576:C51Y;ENSP00000406387:C51Y;ENSP00000413355:C51Y	ENSP00000225576:C51Y	C	-	2	0	RP11-726O12.1;FAM18B2	15397812	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	6.178000	0.71968	0.670000	0.31165	-0.442000	0.05670	TGT	.		0.373	TVP23C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000130705.2	NM_145301	
MIEF2	125170	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	18168068	18168068	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr17:18168068G>T	ENST00000323019.4	+	4	1566	c.1355G>T	c.(1354-1356)gGg>gTg	p.G452V	MIEF2_ENST00000395706.2_Missense_Mutation_p.G463V|MIEF2_ENST00000395704.4_3'UTR	NM_001144900.1|NM_139162.3	NP_001138372.1|NP_631901.2	Q96C03	MID49_HUMAN	mitochondrial elongation factor 2	452					mitochondrion organization (GO:0007005)|positive regulation of mitochondrial fission (GO:0090141)|positive regulation of protein homooligomerization (GO:0032464)|positive regulation of protein targeting to membrane (GO:0090314)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)											GAGCCCGAGGGGCTGCTCTAG	0.547																																					p.G463V		.											.	SMCR7-90	0			c.G1388T						.						30.0	32.0	31.0					17																	18168068		2199	4290	6489	SO:0001583	missense	125170	exon4			CCGAGGGGCTGCT	BC014973	CCDS11193.1, CCDS45624.1, CCDS45625.1	17p11.2	2013-09-23	2013-09-23	2013-09-23	ENSG00000177427	ENSG00000177427			17920	protein-coding gene	gene with protein product		615498	"""Smith-Magenis syndrome chromosome region, candidate 7"""	SMCR7		11997338, 21508961	Standard	NM_001144900		Approved	MGC23130, MiD49	uc010vxq.2	Q96C03	OTTHUMG00000059392	ENST00000323019.4:c.1355G>T	17.37:g.18168068G>T	ENSP00000323591:p.Gly452Val	Somatic	35	0		WXS	Illumina GAIIx	Phase_I	45	43	NM_148886	0	0	0	13	13	J3KPT3|Q6ZRD4|Q96N07	Missense_Mutation	SNP	ENST00000323019.4	37	CCDS11193.1	.	.	.	.	.	.	.	.	.	.	G	1.060	-0.673187	0.03403	.	.	ENSG00000177427	ENST00000323019;ENST00000395706	T;T	0.10382	2.89;2.88	5.15	-1.54	0.08584	.	2.339200	0.01745	N	0.029585	T	0.05227	0.0139	N	0.19112	0.55	0.09310	N	1	B	0.20887	0.049	B	0.14023	0.01	T	0.20207	-1.0282	10	0.02654	T	1	-0.3163	1.345	0.02162	0.2425:0.2195:0.3823:0.1557	.	452	Q96C03	MID49_HUMAN	V	452;463	ENSP00000323591:G452V;ENSP00000379057:G463V	ENSP00000323591:G452V	G	+	2	0	SMCR7	18108793	0.000000	0.05858	0.237000	0.24090	0.171000	0.22731	0.088000	0.14979	0.016000	0.14998	0.462000	0.41574	GGG	.		0.547	MIEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132060.2	NM_139162	
KRTAP4-11	653240	bcgsc.ca	37	17	39274319	39274319	+	Missense_Mutation	SNP	G	G	C	rs199712484		TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr17:39274319G>C	ENST00000391413.2	-	1	287	c.249C>G	c.(247-249)agC>agG	p.S83R		NM_033059.3	NP_149048.2	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	83	27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].					keratin filament (GO:0045095)		p.S83R(1)		endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(8)|prostate(5)|skin(1)	33		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			GCTTGCAGCAGCTGGACACAC	0.662																																					p.S83R		.											.	.	1	Substitution - Missense(1)	endometrium(1)	c.C249G						.																																			SO:0001583	missense	653240	exon1			GCAGCAGCTGGAC	AC025904	CCDS45675.1	17q21.2	2013-06-25			ENSG00000212721	ENSG00000212721		"""Keratin associated proteins"""	18911	protein-coding gene	gene with protein product			"""keratin associated protein 4-14"""	KRTAP4-14			Standard	NM_033059		Approved	KAP4.11, KAP4.14	uc002hvz.3	Q9BYQ6	OTTHUMG00000133586	ENST00000391413.2:c.249C>G	17.37:g.39274319G>C	ENSP00000375232:p.Ser83Arg	Somatic	45	0		WXS	Illumina GAIIx	Phase_I	143	21	NM_033059	0	0	0	0	0	A0AUY2	Missense_Mutation	SNP	ENST00000391413.2	37	CCDS45675.1	.	.	.	.	.	.	.	.	.	.	.	11.88	1.769671	0.31320	.	.	ENSG00000212721	ENST00000391413	T	0.00686	5.85	4.12	0.987	0.19790	.	8.728350	0.01373	U	0.012645	T	0.01835	0.0058	M	0.85710	2.77	0.20489	N	0.999895	B	0.21381	0.055	B	0.12156	0.007	T	0.50676	-0.8800	10	0.66056	D	0.02	.	3.7776	0.08667	0.3083:0.1839:0.5078:0.0	.	83	Q9BYQ6	KR411_HUMAN	R	83	ENSP00000375232:S83R	ENSP00000375232:S83R	S	-	3	2	KRTAP4-11	36527845	0.052000	0.20516	0.390000	0.26220	0.120000	0.20174	0.102000	0.15272	0.075000	0.16796	0.511000	0.50034	AGC	.		0.662	KRTAP4-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257690.1		
KRTAP4-11	653240	ucsc.edu	37	17	39274364	39274364	+	Missense_Mutation	SNP	T	T	G	rs425784		TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr17:39274364T>G	ENST00000391413.2	-	1	242	c.204A>C	c.(202-204)agA>agC	p.R68S		NM_033059.3	NP_149048.2	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	68	27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].		Missing (in allele KAP4.14). {ECO:0000269|PubMed:15955084}.			keratin filament (GO:0045095)				endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(8)|prostate(5)|skin(1)	33		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			AGATGCAGCATCTGGGGCGGC	0.667																																					p.R68S		.											.	.	0			c.A204C						.						8.0	12.0	11.0					17																	39274364		676	1581	2257	SO:0001583	missense	653240	exon1			GCAGCATCTGGGG	AC025904	CCDS45675.1	17q21.2	2013-06-25			ENSG00000212721	ENSG00000212721		"""Keratin associated proteins"""	18911	protein-coding gene	gene with protein product			"""keratin associated protein 4-14"""	KRTAP4-14			Standard	NM_033059		Approved	KAP4.11, KAP4.14	uc002hvz.3	Q9BYQ6	OTTHUMG00000133586	ENST00000391413.2:c.204A>C	17.37:g.39274364T>G	ENSP00000375232:p.Arg68Ser	Somatic	35	2		WXS	Illumina GAIIx	Phase_I	194	40	NM_033059	0	0	0	0	0	A0AUY2	Missense_Mutation	SNP	ENST00000391413.2	37	CCDS45675.1	.	.	.	.	.	.	.	.	.	.	.	0.572	-0.840659	0.02692	.	.	ENSG00000212721	ENST00000391413	T	0.01139	5.28	3.77	-0.689	0.11313	.	91.536500	0.00963	N	0.003131	T	0.00271	0.0008	N	0.00022	-2.74	0.09310	N	0.999996	B	0.02656	0.0	B	0.01281	0.0	T	0.53429	-0.8440	10	0.02654	T	1	.	0.7939	0.01062	0.2891:0.1622:0.3809:0.1678	rs425784	68	Q9BYQ6	KR411_HUMAN	S	68	ENSP00000375232:R68S	ENSP00000375232:R68S	R	-	3	2	KRTAP4-11	36527890	0.005000	0.15991	0.041000	0.18516	0.133000	0.20885	-0.083000	0.11286	-0.156000	0.11079	-0.875000	0.02981	AGA	.		0.667	KRTAP4-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257690.1		
KRTAP4-11	653240	broad.mit.edu;bcgsc.ca	37	17	39274416	39274416	+	Missense_Mutation	SNP	C	C	T	rs408579	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr17:39274416C>T	ENST00000391413.2	-	1	190	c.152G>A	c.(151-153)aGg>aAg	p.R51K		NM_033059.3	NP_149048.2	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	51	27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].		Missing (in allele KAP4.14). {ECO:0000269|PubMed:15955084}.			keratin filament (GO:0045095)		p.R51K(1)		endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(8)|prostate(5)|skin(1)	33		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			GCACTGGGGCCTGCAGCAGCT	0.672													t|||	242	0.0483227	0.1248	0.0202	5008	,	,		19066	0.005		0.0219	False		,,,				2504	0.0368				p.R51K		.											.	.	1	Substitution - Missense(1)	endometrium(1)	c.G152A						.						9.0	15.0	13.0					17																	39274416		682	1579	2261	SO:0001583	missense	653240	exon1			TGGGGCCTGCAGC	AC025904	CCDS45675.1	17q21.2	2013-06-25			ENSG00000212721	ENSG00000212721		"""Keratin associated proteins"""	18911	protein-coding gene	gene with protein product			"""keratin associated protein 4-14"""	KRTAP4-14			Standard	NM_033059		Approved	KAP4.11, KAP4.14	uc002hvz.3	Q9BYQ6	OTTHUMG00000133586	ENST00000391413.2:c.152G>A	17.37:g.39274416C>T	ENSP00000375232:p.Arg51Lys	Somatic	41	0		WXS	Illumina GAIIx	Phase_I	124	21	NM_033059	0	0	0	0	0	A0AUY2	Missense_Mutation	SNP	ENST00000391413.2	37	CCDS45675.1	.	.	.	.	.	.	.	.	.	.	.	4.205	0.036712	0.08148	.	.	ENSG00000212721	ENST00000391413	T	0.01455	4.87	3.47	-1.13	0.09775	.	2.855670	0.02563	U	0.096976	T	0.02610	0.0079	M	0.72118	2.19	0.09310	N	1	B	0.25441	0.126	B	0.28916	0.096	T	0.52283	-0.8596	10	0.05959	T	0.93	.	3.7627	0.08610	0.1684:0.4051:0.0:0.4265	rs408579	51	Q9BYQ6	KR411_HUMAN	K	51	ENSP00000375232:R51K	ENSP00000375232:R51K	R	-	2	0	KRTAP4-11	36527942	0.000000	0.05858	0.002000	0.10522	0.072000	0.16883	-0.738000	0.04871	-0.091000	0.12440	-0.208000	0.12717	AGG	.		0.672	KRTAP4-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257690.1		
KLHL10	317719	broad.mit.edu	37	17	40004447	40004447	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr17:40004447T>A	ENST00000293303.4	+	5	1868	c.1715T>A	c.(1714-1716)gTa>gAa	p.V572E	RP11-156E6.1_ENST00000560400.1_RNA	NM_152467.3	NP_689680.2	Q6JEL2	KLH10_HUMAN	kelch-like family member 10	572					cell morphogenesis (GO:0000902)|fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia morphogenesis (GO:0048808)|male gonad development (GO:0008584)|protein ubiquitination (GO:0016567)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	26		Breast(137;0.000162)				TGCTGTGTAGTACCAGGGCTG	0.463																																					p.V572E		.											.	KLHL10-227	0			c.T1715A						.						124.0	123.0	123.0					17																	40004447		2004	4185	6189	SO:0001583	missense	317719	exon5			GTGTAGTACCAGG	AK057224	CCDS42340.1	17q21.2	2013-01-30	2013-01-30		ENSG00000161594	ENSG00000161594		"""Kelch-like"", ""BTB/POZ domain containing"""	18829	protein-coding gene	gene with protein product		608778	"""kelch-like 10 (Drosophila)"""				Standard	NM_152467		Approved	FLJ32662	uc010cxr.3	Q6JEL2	OTTHUMG00000152510	ENST00000293303.4:c.1715T>A	17.37:g.40004447T>A	ENSP00000293303:p.Val572Glu	Somatic	97	0		WXS	Illumina GAIIx	Phase_I	75	5	NM_152467	0	0	0	0	0	Q6NW28|Q96MC0	Missense_Mutation	SNP	ENST00000293303.4	37	CCDS42340.1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.100824	0.76983	.	.	ENSG00000161594	ENST00000293303	T	0.70045	-0.45	6.17	6.17	0.99709	Galactose oxidase, beta-propeller (1);	0.118400	0.56097	D	0.000026	T	0.63331	0.2502	L	0.27053	0.805	0.50813	D	0.99989	D	0.60160	0.987	P	0.50708	0.648	T	0.62048	-0.6936	9	.	.	.	.	15.6463	0.77055	0.0:0.0:0.0:1.0	.	572	Q6JEL2	KLH10_HUMAN	E	572	ENSP00000293303:V572E	.	V	+	2	0	KLHL10	37257973	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	5.827000	0.69300	2.371000	0.80710	0.533000	0.62120	GTA	.		0.463	KLHL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326535.1	NM_152467	
FAM20A	54757	hgsc.bcm.edu	37	17	66596769	66596769	+	Silent	SNP	C	C	T	rs2907388	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr17:66596769C>T	ENST00000592554.1	-	1	761	c.39G>A	c.(37-39)ctG>ctA	p.L13L		NM_001243746.1|NM_017565.3	NP_001230675.1|NP_060035.2	Q96MK3	FA20A_HUMAN	family with sequence similarity 20, member A	13					calcium ion homeostasis (GO:0055074)|enamel mineralization (GO:0070166)|tooth eruption (GO:0044691)	cell (GO:0005623)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)				cervix(1)|endometrium(1)|large_intestine(3)|lung(2)|prostate(1)|stomach(1)	9	Breast(10;1.64e-13)					CGCCCAGCAGCAGCAGAGTCA	0.756													c|||	410	0.081869	0.0552	0.0159	5008	,	,		10427	0.1071		0.0278	False		,,,				2504	0.1943				p.L13L		.											.	FAM20A-90	0			c.G39A						.			121,3665		1,119,1773	4.0	4.0	4.0		39	3.1	1.0	17	dbSNP_101	4	143,7217		0,143,3537	no	coding-synonymous	FAM20A	NM_017565.3		1,262,5310	TT,TC,CC		1.9429,3.196,2.3686		13/542	66596769	264,10882	1893	3680	5573	SO:0001819	synonymous_variant	54757	exon1			CAGCAGCAGCAGA	AK056789	CCDS11679.1	17q24.2	2014-02-07			ENSG00000108950	ENSG00000108950			23015	protein-coding gene	gene with protein product		611062					Standard	NM_017565		Approved	DKFZp434F2322	uc002jho.3	Q96MK3	OTTHUMG00000180152	ENST00000592554.1:c.39G>A	17.37:g.66596769C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	15	13	NM_017565	0	0	0	0	0	B2RN47|B2RN49|Q9UF95	Silent	SNP	ENST00000592554.1	37	CCDS11679.1																																																																																			C|0.943;T|0.057		0.756	FAM20A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450029.2	NM_017565	
LAMA3	3909	bcgsc.ca	37	18	21441717	21441717	+	Silent	SNP	C	C	T	rs12965685	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr18:21441717C>T	ENST00000313654.9	+	35	4771	c.4530C>T	c.(4528-4530)ccC>ccT	p.P1510P	LAMA3_ENST00000399516.3_Silent_p.P1510P	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	1510	Laminin IV type A. {ECO:0000255|PROSITE- ProRule:PRU00458}.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					AGGAGCTGCCCGCAACCATCC	0.602													C|||	1706	0.340655	0.1899	0.4121	5008	,	,		19298	0.1746		0.6113	False		,,,				2504	0.3865				p.P1510P		.											.	LAMA3-100	0			c.C4530T						.	C	,	1076,2960		140,796,1082	37.0	41.0	40.0		4530,4530	-7.5	0.0	18	dbSNP_121	40	5162,3200		1583,1996,602	no	coding-synonymous,coding-synonymous	LAMA3	NM_001127717.1,NM_198129.1	,	1723,2792,1684	TT,TC,CC		38.2684,26.6601,49.6854	,	1510/3278,1510/3334	21441717	6238,6160	2018	4181	6199	SO:0001819	synonymous_variant	3909	exon35			GCTGCCCGCAACC	L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.4530C>T	18.37:g.21441717C>T		Somatic	122	2		WXS	Illumina GAIIx	Phase_I	99	5	NM_001127717	0	0	0	0	0	B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Silent	SNP	ENST00000313654.9	37	CCDS42419.1																																																																																			C|0.578;T|0.422		0.602	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254824.3	NM_000227, NM_198129	
ASXL3	80816	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	31323005	31323005	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr18:31323005C>T	ENST00000269197.5	+	12	3193	c.3193C>T	c.(3193-3195)Cgg>Tgg	p.R1065W		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	1065	Ala-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						CCAACAAGCTCGGGCCCAGCG	0.612																																					p.R1065W		.											.	ASXL3-49	0			c.C3193T						.						24.0	26.0	25.0					18																	31323005		1871	4084	5955	SO:0001583	missense	80816	exon12			CAAGCTCGGGCCC	AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.3193C>T	18.37:g.31323005C>T	ENSP00000269197:p.Arg1065Trp	Somatic	27	0		WXS	Illumina GAIIx	Phase_I	25	21	NM_030632	0	0	0	0	0	Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	ENST00000269197.5	37	CCDS45847.1	.	.	.	.	.	.	.	.	.	.	C	16.17	3.047073	0.55110	.	.	ENSG00000141431	ENST00000269197	T	0.54071	0.59	5.9	2.38	0.29361	.	0.560508	0.16050	N	0.232022	T	0.69708	0.3141	M	0.64404	1.975	0.32188	N	0.579422	D	0.89917	1.0	D	0.91635	0.999	T	0.76900	-0.2788	10	0.87932	D	0	.	16.0065	0.80367	0.4585:0.5415:0.0:0.0	.	1065	Q9C0F0	ASXL3_HUMAN	W	1065	ENSP00000269197:R1065W	ENSP00000269197:R1065W	R	+	1	2	ASXL3	29577003	0.912000	0.30974	0.815000	0.32552	0.991000	0.79684	1.923000	0.40055	0.638000	0.30545	0.650000	0.86243	CGG	.		0.612	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441865.2		
SALL3	27164	hgsc.bcm.edu	37	18	76753768	76753768	+	Missense_Mutation	SNP	C	C	G	rs2447437	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr18:76753768C>G	ENST00000537592.2	+	2	1777	c.1777C>G	c.(1777-1779)Ctc>Gtc	p.L593V	SALL3_ENST00000575389.2_Missense_Mutation_p.L593V|SALL3_ENST00000536229.3_Missense_Mutation_p.L460V	NM_171999.3	NP_741996.2	Q9BXA9	SALL3_HUMAN	spalt-like transcription factor 3	593			L -> V (in dbSNP:rs2447437). {ECO:0000269|Ref.1}.		forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|negative regulation of smoothened signaling pathway (GO:0045879)|olfactory bulb interneuron development (GO:0021891)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L593V(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(40)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		CGGGCCGCCCCTCACTAAAGC	0.731													C|||	3973	0.793331	0.5825	0.8444	5008	,	,		9900	0.9226		0.8648	False		,,,				2504	0.8354				p.L593V		.											.	SALL3-155	1	Substitution - Missense(1)	prostate(1)	c.C1777G						.	C	VAL/LEU	2422,1000		875,672,164	3.0	4.0	4.0		1777	5.2	0.2	18	dbSNP_100	4	6372,926		2808,756,85	yes	missense	SALL3	NM_171999.2	32	3683,1428,249	GG,GC,CC		12.6884,29.2227,17.9664	benign	593/1301	76753768	8794,1926	1711	3649	5360	SO:0001583	missense	27164	exon2			CCGCCCCTCACTA	AJ007421	CCDS12013.1	18q23	2013-10-17	2013-10-17		ENSG00000256463	ENSG00000256463		"""Zinc fingers, C2H2-type"""	10527	protein-coding gene	gene with protein product		605079	"""sal (Drosophila)-like 3"", ""sal-like 3 (Drosophila)"""			10610715	Standard	NM_171999		Approved	ZNF796	uc002lmt.3	Q9BXA9	OTTHUMG00000132896	ENST00000537592.2:c.1777C>G	18.37:g.76753768C>G	ENSP00000441823:p.Leu593Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_171999	0	0	0	0	0	Q9UGH1	Missense_Mutation	SNP	ENST00000537592.2	37	CCDS12013.1	1724	0.7893772893772893	287	0.5833333333333334	299	0.8259668508287292	511	0.8933566433566433	627	0.8271767810026385	C	0.073	-1.197989	0.01594	0.707773	0.873116	ENSG00000256463	ENST00000537592;ENST00000536229;ENST00000543056	T	0.08984	3.03	5.2	5.2	0.72013	.	0.464067	0.17974	N	0.155779	T	0.00012	0.0000	L	0.35288	1.05	0.80722	P	0.0	B;B	0.15473	0.013;0.006	B;B	0.18561	0.022;0.002	T	0.36237	-0.9756	9	0.14656	T	0.56	-21.7235	10.231	0.43256	0.2471:0.6277:0.1252:0.0	rs2447437	325;593	F5GXY4;Q9BXA9	.;SALL3_HUMAN	V	593;593;325	ENSP00000441823:L593V	ENSP00000299466:L593V	L	+	1	0	SALL3	74854756	0.002000	0.14202	0.157000	0.22605	0.006000	0.05464	0.292000	0.19011	2.584000	0.87258	0.563000	0.77884	CTC	C|0.780;G|0.220		0.731	SALL3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256397.1	NM_171999	
MADCAM1	8174	hgsc.bcm.edu	37	19	498751	498751	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr19:498751T>C	ENST00000215637.3	+	3	639	c.593T>C	c.(592-594)gTc>gCc	p.V198A	MADCAM1_ENST00000382683.4_Missense_Mutation_p.V103A|AC005775.2_ENST00000592413.1_RNA|MADCAM1_ENST00000346144.4_Missense_Mutation_p.V198A|MADCAM1_ENST00000587541.1_Intron	NM_130760.2	NP_570116.2	Q13477	MADCA_HUMAN	mucosal vascular addressin cell adhesion molecule 1	198	Ig-like 2.				aging (GO:0007568)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|embryo development (GO:0009790)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|immune response (GO:0006955)|integrin-mediated signaling pathway (GO:0007229)|keratinocyte differentiation (GO:0030216)|leukocyte tethering or rolling (GO:0050901)|positive regulation of leukocyte migration (GO:0002687)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	integrin binding involved in cell-matrix adhesion (GO:0098640)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(4)|prostate(1)|skin(2)	10		all_cancers(10;4.25e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGGACCCCTGTCCCGCCCGCC	0.726																																					p.V198A		.											.	MADCAM1-90	0			c.T593C						.						3.0	3.0	3.0					19																	498751		1873	3751	5624	SO:0001583	missense	8174	exon3			CCCCTGTCCCGCC	U43628	CCDS12028.1, CCDS12029.1	19p13.3	2013-01-11			ENSG00000099866	ENSG00000099866		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6765	protein-coding gene	gene with protein product	"""mucosal addressin cell adhesion molecule-1"""	102670				9162097, 8609404	Standard	NM_130762		Approved	MACAM1	uc002los.3	Q13477	OTTHUMG00000180548	ENST00000215637.3:c.593T>C	19.37:g.498751T>C	ENSP00000215637:p.Val198Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	18	7	NM_130760	0	0	0	0	0	A5PKV4|B2RPL9|O60222|O75867|Q5UGI7	Missense_Mutation	SNP	ENST00000215637.3	37	CCDS12028.1	.	.	.	.	.	.	.	.	.	.	T	0.050	-1.253176	0.01457	.	.	ENSG00000099866	ENST00000537731;ENST00000542525;ENST00000543297;ENST00000215637;ENST00000346144;ENST00000382683	T;T	0.14640	3.03;2.49	3.99	-7.07	0.01563	Adhesion molecule, immunoglobulin-like (2);Immunoglobulin-like fold (1);	2.574940	0.01561	N	0.020134	T	0.03783	0.0107	N	0.01576	-0.805	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.0;0.001	T	0.37549	-0.9701	10	0.11794	T	0.64	-2.6989	5.7293	0.18030	0.0:0.2285:0.459:0.3125	.	103;198;198	Q5UGI7;B2RPL9;Q13477	.;.;MADCA_HUMAN	A	198;198;198;198;198;103	ENSP00000215637:V198A;ENSP00000304247:V198A	ENSP00000215637:V198A	V	+	2	0	MADCAM1	449751	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.402000	0.01047	-0.628000	0.05582	-1.145000	0.01858	GTC	.		0.726	MADCAM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451884.1	NM_130760	
ABCA7	10347	hgsc.bcm.edu	37	19	1065044	1065044	+	Silent	SNP	C	C	T	rs4147935	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr19:1065044C>T	ENST00000263094.6	+	46	6390	c.6159C>T	c.(6157-6159)ggC>ggT	p.G2053G	ABCA7_ENST00000433129.1_Silent_p.G2053G|ABCA7_ENST00000435683.2_Silent_p.G1915G|HMHA1_ENST00000313093.2_5'Flank|HMHA1_ENST00000590214.1_5'Flank|HMHA1_ENST00000536472.1_5'Flank|HMHA1_ENST00000539243.2_5'Flank|HMHA1_ENST00000586866.1_5'Flank	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	2053					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)			NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CACATGGAGGCCGCCTGCGCT	0.736																																					p.G2053G		.											.	ABCA7-98	0			c.C6159T						.	C		327,3757		20,287,1735	5.0	6.0	6.0		6159	1.5	0.8	19	dbSNP_110	6	2858,5242		553,1752,1745	no	coding-synonymous	ABCA7	NM_019112.3		573,2039,3480	TT,TC,CC		35.284,8.0069,26.1408		2053/2147	1065044	3185,8999	2042	4050	6092	SO:0001819	synonymous_variant	10347	exon46			TGGAGGCCGCCTG	AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.6159C>T	19.37:g.1065044C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	12	11	NM_019112	0	1	13	31	17	Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Silent	SNP	ENST00000263094.6	37	CCDS12055.1																																																																																			C|0.766;T|0.234		0.736	ABCA7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000394993.1	NM_019112	
PGLS	25796	hgsc.bcm.edu	37	19	17622614	17622614	+	Silent	SNP	C	C	T	rs11086075	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr19:17622614C>T	ENST00000252603.2	+	1	177	c.133C>T	c.(133-135)Ctg>Ttg	p.L45L	CTD-3131K8.2_ENST00000596643.1_lincRNA	NM_012088.2	NP_036220.1	O95336	6PGL_HUMAN	6-phosphogluconolactonase	45					carbohydrate metabolic process (GO:0005975)|pentose-phosphate shunt (GO:0006098)|pentose-phosphate shunt, oxidative branch (GO:0009051)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	6-phosphogluconolactonase activity (GO:0017057)|monosaccharide binding (GO:0048029)			endometrium(1)|lung(1)	2						CGCGCTCGGCCTGTCGGGCGG	0.736													C|||	1862	0.371805	0.2496	0.4207	5008	,	,		10575	0.377		0.4851	False		,,,				2504	0.3804				p.L45L		.											.	PGLS-90	0			c.C133T						.	C		662,2504		107,448,1028	2.0	2.0	2.0		133	2.6	1.0	19	dbSNP_120	2	2200,4094		507,1186,1454	no	coding-synonymous	PGLS	NM_012088.2		614,1634,2482	TT,TC,CC		34.9539,20.9097,30.2537		45/259	17622614	2862,6598	1583	3147	4730	SO:0001819	synonymous_variant	25796	exon1			CTCGGCCTGTCGG	AJ243972	CCDS12361.1	19p13.2	2008-02-05				ENSG00000130313	3.1.1.31		8903	protein-coding gene	gene with protein product		604951				10518023	Standard	NM_012088		Approved	6PGL	uc002ngw.3	O95336		ENST00000252603.2:c.133C>T	19.37:g.17622614C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_012088	0	0	1	74	73		Silent	SNP	ENST00000252603.2	37	CCDS12361.1																																																																																			C|0.617;T|0.383		0.736	PGLS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464154.1		
CILP2	148113	hgsc.bcm.edu	37	19	19651140	19651140	+	Silent	SNP	A	A	G	rs4808970	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr19:19651140A>G	ENST00000291495.5	+	3	376	c.291A>G	c.(289-291)gaA>gaG	p.E97E	CILP2_ENST00000586018.1_Silent_p.E103E	NM_153221.2	NP_694953.2	Q8IUL8	CILP2_HUMAN	cartilage intermediate layer protein 2	97						extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(17)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	32						TGGCGCTGGAAGCGCGCACCA	0.726													A|||	593	0.118411	0.1626	0.1167	5008	,	,		10102	0.0		0.168	False		,,,				2504	0.1309				p.E97E		.											.	CILP2-91	0			c.A291G						.	A		612,3678		42,528,1575	10.0	11.0	11.0		291	3.2	1.0	19	dbSNP_111	11	1223,7149		89,1045,3052	no	coding-synonymous	CILP2	NM_153221.2		131,1573,4627	GG,GA,AA		14.6082,14.2657,14.4922		97/1157	19651140	1835,10827	2145	4186	6331	SO:0001819	synonymous_variant	148113	exon3			GCTGGAAGCGCGC	AF542080	CCDS12405.1	19p13.11	2013-01-14				ENSG00000160161		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	24213	protein-coding gene	gene with protein product		612419				12477932	Standard	NM_153221		Approved	MGC45771	uc002nmv.4	Q8IUL8		ENST00000291495.5:c.291A>G	19.37:g.19651140A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	18	6	NM_153221	0	0	0	0	0	Q6NV88|Q8N4A6|Q8WV21	Silent	SNP	ENST00000291495.5	37	CCDS12405.1																																																																																			A|0.873;G|0.127		0.726	CILP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000459738.3	NM_153221	
UQCRFS1	7386	hgsc.bcm.edu	37	19	29704002	29704002	+	Silent	SNP	T	T	C	rs11666764	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr19:29704002T>C	ENST00000304863.4	-	1	446	c.24A>G	c.(22-24)tcA>tcG	p.S8S	CTB-32O4.2_ENST00000587859.1_lincRNA	NM_006003.2	NP_005994.2	P47985	UCRI_HUMAN	ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1	8					cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|response to antibiotic (GO:0046677)|response to drug (GO:0042493)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	2 iron, 2 sulfur cluster binding (GO:0051537)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			endometrium(4)|kidney(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Breast(6;0.0545)|Esophageal squamous(110;0.239)		Lung(7;0.092)			CGAACGGGCCTGAGCGGGATG	0.751													C|||	4781	0.954673	0.9433	0.9294	5008	,	,		9645	0.999		0.9195	False		,,,				2504	0.9785				p.S8S		.											.	UQCRFS1-226	0			c.A24G						.						1.0	2.0	2.0					19																	29704002		760	1811	2571	SO:0001819	synonymous_variant	7386	exon1			CGGGCCTGAGCGG	BC010035	CCDS12415.1	19q12	2011-07-04			ENSG00000169021	ENSG00000169021	1.10.2.2	"""Mitochondrial respiratory chain complex / Complex III"""	12587	protein-coding gene	gene with protein product	"""cytochrome b-c1 complex subunit 5"""	191327				8088805	Standard	NM_006003		Approved	RIS1, RIP1, UQCR5, RISP	uc002nsd.2	P47985		ENST00000304863.4:c.24A>G	19.37:g.29704002T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_006003	0	0	0	0	0	A8K519|Q6NVX5|Q9UPH2	Silent	SNP	ENST00000304863.4	37	CCDS12415.1																																																																																			T|0.072;C|0.928		0.751	UQCRFS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458563.1	NM_006003	
UQCRFS1	7386	hgsc.bcm.edu	37	19	29704010	29704010	+	Missense_Mutation	SNP	A	A	C	rs8100724	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr19:29704010A>C	ENST00000304863.4	-	1	438	c.16T>G	c.(16-18)Tcc>Gcc	p.S6A	CTB-32O4.2_ENST00000587859.1_lincRNA	NM_006003.2	NP_005994.2	P47985	UCRI_HUMAN	ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1	6			S -> A (in dbSNP:rs8100724). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:2158323, ECO:0000269|PubMed:7721092}.		cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|response to antibiotic (GO:0046677)|response to drug (GO:0042493)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	2 iron, 2 sulfur cluster binding (GO:0051537)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			endometrium(4)|kidney(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Breast(6;0.0545)|Esophageal squamous(110;0.239)		Lung(7;0.092)			CCTGAGCGGGATGCTACCGAC	0.746													C|||	4777	0.953874	0.944	0.9265	5008	,	,		9603	0.999		0.9165	False		,,,				2504	0.9785				p.S6A		.											.	UQCRFS1-226	0			c.T16G						.						1.0	2.0	2.0					19																	29704010		816	1888	2704	SO:0001583	missense	7386	exon1			AGCGGGATGCTAC	BC010035	CCDS12415.1	19q12	2011-07-04			ENSG00000169021	ENSG00000169021	1.10.2.2	"""Mitochondrial respiratory chain complex / Complex III"""	12587	protein-coding gene	gene with protein product	"""cytochrome b-c1 complex subunit 5"""	191327				8088805	Standard	NM_006003		Approved	RIS1, RIP1, UQCR5, RISP	uc002nsd.2	P47985		ENST00000304863.4:c.16T>G	19.37:g.29704010A>C	ENSP00000306397:p.Ser6Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_006003	0	0	0	0	0	A8K519|Q6NVX5|Q9UPH2	Missense_Mutation	SNP	ENST00000304863.4	37	CCDS12415.1	2044	0.9358974358974359	461	0.9369918699186992	326	0.9005524861878453	569	0.9947552447552448	688	0.9076517150395779	C	0.037	-1.301919	0.01353	.	.	ENSG00000169021	ENST00000304863	T	0.36520	1.25	4.42	-0.0799	0.13708	Ubiquinol-cytochrome c reductase 8kDa, N-terminal (1);Globular protein, non-globular alpha/beta subunit (1);	0.198900	0.43579	N	0.000544	T	0.00012	0.0000	N	0.00707	-1.245	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.31696	-0.9934	9	0.02654	T	1	.	4.4059	0.11409	0.1479:0.436:0.0:0.4161	rs8100724;rs17856012;rs17856322;rs60176823;rs8100724	6	P47985	UCRI_HUMAN	A	6	ENSP00000306397:S6A	ENSP00000306397:S6A	S	-	1	0	UQCRFS1	34395850	0.363000	0.24989	0.510000	0.27712	0.005000	0.04900	0.594000	0.24014	-0.304000	0.08843	-1.900000	0.00529	TCC	A|0.065;C|0.935		0.746	UQCRFS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458563.1	NM_006003	
RINL	126432	hgsc.bcm.edu	37	19	39360720	39360720	+	Missense_Mutation	SNP	G	G	A	rs8110393	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr19:39360720G>A	ENST00000591812.1	-	9	1291	c.1205C>T	c.(1204-1206)cCc>cTc	p.P402L	RINL_ENST00000340740.3_Missense_Mutation_p.P288L|RINL_ENST00000602238.1_5'Flank|CTC-360G5.6_ENST00000593830.1_RNA|RINL_ENST00000598904.1_Missense_Mutation_p.P288L			Q6ZS11	RINL_HUMAN	Ras and Rab interactor-like	402	VPS9. {ECO:0000255|PROSITE- ProRule:PRU00550}.		P -> L (in dbSNP:rs8110393).		endocytosis (GO:0006897)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)	actin cytoskeleton (GO:0015629)|cytoplasmic vesicle (GO:0031410)|ruffle (GO:0001726)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(3)|kidney(4)|large_intestine(2)|lung(4)|pancreas(1)|skin(1)|urinary_tract(2)	17						GGCGGGGGCGGGGCTCTGCCC	0.781													G|||	3477	0.694289	0.9289	0.6153	5008	,	,		10275	0.7619		0.4642	False		,,,				2504	0.6002				p.P402L		.											.	RINL-91	0			c.C1205T						.	G	LEU/PRO,LEU/PRO	3328,464		1489,350,57	4.0	4.0	4.0		1205,863	3.5	1.0	19	dbSNP_116	4	4059,3433		1245,1569,932	no	missense,missense	RINL	NM_001195833.1,NM_198445.3	98,98	2734,1919,989	AA,AG,GG		45.8222,12.2363,34.5356	probably-damaging,probably-damaging	402/567,288/453	39360720	7387,3897	1896	3746	5642	SO:0001583	missense	126432	exon9			GGGGCGGGGCTCT	AK127808	CCDS12522.1, CCDS59386.1	19q13.2	2010-07-13			ENSG00000187994	ENSG00000187994			24795	protein-coding gene	gene with protein product							Standard	NM_001195833		Approved	FLJ45909	uc010xuo.2	Q6ZS11		ENST00000591812.1:c.1205C>T	19.37:g.39360720G>A	ENSP00000467107:p.Pro402Leu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	8	NM_001195833	0	0	1	2	1	B4DPG5	Missense_Mutation	SNP	ENST00000591812.1	37	CCDS59386.1	1421	0.6506410256410257	458	0.9308943089430894	225	0.6215469613259669	401	0.701048951048951	337	0.4445910290237467	G	17.17	3.320891	0.60634	0.877637	0.541778	ENSG00000187994	ENST00000340740;ENST00000536520	T	0.28454	1.61	4.57	3.53	0.40419	Vacuolar sorting protein 9 (1);	0.269737	0.35235	N	0.003350	T	0.00012	0.0000	M	0.67700	2.07	0.21553	P	0.999649277	B;B	0.21225	0.053;0.053	B;B	0.22152	0.038;0.038	T	0.17776	-1.0358	9	0.72032	D	0.01	-26.0247	8.5759	0.33598	0.1063:0.0:0.8937:0.0	rs8110393;rs61482706	402;288	B4DPG5;Q6ZS11	.;RINL_HUMAN	L	288	ENSP00000340369:P288L	ENSP00000340369:P288L	P	-	2	0	RINL	44052560	1.000000	0.71417	0.987000	0.45799	0.313000	0.28021	4.771000	0.62318	1.273000	0.44346	0.407000	0.27541	CCC	G|0.349;A|0.651		0.781	RINL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460433.1	NM_198445	
CGB7	94027	bcgsc.ca	37	19	49558216	49558216	+	Missense_Mutation	SNP	C	C	T	rs35728583		TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr19:49558216C>T	ENST00000597853.1	-	4	2936	c.65G>A	c.(64-66)aGg>aAg	p.R22K	CGB7_ENST00000596965.1_Missense_Mutation_p.R22K|CGB7_ENST00000593309.1_5'Flank|CGB7_ENST00000356213.4_Missense_Mutation_p.R20K|CGB7_ENST00000377280.3_Missense_Mutation_p.R22K			P01233	CGHB_HUMAN	chorionic gonadotropin, beta polypeptide 7	22			K -> R (in dbSNP:rs6518). {ECO:0000269|PubMed:11861891}.		apoptotic process (GO:0006915)|cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|female gamete generation (GO:0007292)|peptide hormone processing (GO:0016486)|signal transduction (GO:0007165)	extracellular region (GO:0005576)	hormone activity (GO:0005179)			lung(3)|urinary_tract(2)	5		all_epithelial(76;9.62e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000371)|OV - Ovarian serous cystadenocarcinoma(262;0.000503)|GBM - Glioblastoma multiforme(486;0.00518)|Epithelial(262;0.0427)		AAGCATCTCCCTGGATGCCCA	0.657																																					p.R22K		.											.	CGB7-90	0			c.G65A						.						93.0	71.0	79.0					19																	49558216		1501	2676	4177	SO:0001583	missense	94027	exon2			ATCTCCCTGGATG	K00092	CCDS33071.1	19q13.32	2008-02-05				ENSG00000196337			16451	protein-coding gene	gene with protein product		608826				6194155	Standard	NM_033142		Approved	CG-beta-a		P01233		ENST00000597853.1:c.65G>A	19.37:g.49558216C>T	ENSP00000470813:p.Arg22Lys	Somatic	26	0		WXS	Illumina GAIIx	Phase_I	63	9	NM_033142	0	0	0	0	0	A1A5E0|B9ZVP5|Q13991|Q14000|Q3KPI3|Q3SY41|Q8WTT5|Q8WXL1|Q8WXL2|Q8WXL3|Q8WXL4	Missense_Mutation	SNP	ENST00000597853.1	37	CCDS33071.1	.	.	.	.	.	.	.	.	.	.	C	0.019	-1.450441	0.01080	.	.	ENSG00000196337	ENST00000377280;ENST00000356213	T;T	0.37235	1.21;1.21	2.0	-0.353	0.12594	.	0.756883	0.12433	N	0.469369	T	0.12987	0.0315	.	.	.	0.21652	N	0.999605	.	.	.	.	.	.	T	0.31052	-0.9957	7	0.07175	T	0.84	-4.9346	5.7377	0.18075	0.0:0.7882:0.0:0.2118	rs35728583;rs62127884	.	.	.	K	22;20	ENSP00000366493:R22K;ENSP00000348545:R20K	ENSP00000348545:R20K	R	-	2	0	CGB7	54250028	0.041000	0.20044	0.676000	0.29932	0.004000	0.04260	0.530000	0.23036	0.027000	0.15297	-2.696000	0.00138	AGG	C|0.674;T|0.326		0.657	CGB7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466254.1	NM_033142	
ASPDH	554235	hgsc.bcm.edu	37	19	51015404	51015404	+	Missense_Mutation	SNP	T	T	C	rs12977172	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr19:51015404T>C	ENST00000389208.4	-	6	858	c.797A>G	c.(796-798)cAg>cGg	p.Q266R	ASPDH_ENST00000597030.1_5'Flank|JOSD2_ENST00000391815.3_5'Flank|JOSD2_ENST00000595669.1_5'Flank|JOSD2_ENST00000601423.1_5'Flank|JOSD2_ENST00000598418.1_5'Flank|ASPDH_ENST00000376916.3_Missense_Mutation_p.Q161R	NM_001114598.1	NP_001108070.1	A6ND91	ASPD_HUMAN	aspartate dehydrogenase domain containing	266			Q -> R (in dbSNP:rs12977172). {ECO:0000269|PubMed:15489334, ECO:0000269|Ref.1}.		NAD biosynthetic process (GO:0009435)|NADP catabolic process (GO:0006742)		aspartate dehydrogenase activity (GO:0033735)|NADP binding (GO:0050661)			endometrium(1)|large_intestine(1)|lung(1)	3						CAGGAGGCTCTGCCAGAAGGC	0.706													C|||	3986	0.795927	0.9728	0.7781	5008	,	,		10864	0.7143		0.6849	False		,,,				2504	0.7679				p.Q266R		.											.	ASPDH-90	0			c.A797G						.	C	ARG/GLN,ARG/GLN	3799,331		1771,257,37	6.0	9.0	8.0		482,797	1.9	1.0	19	dbSNP_121	8	5527,2593		1919,1689,452	no	missense,missense	ASPDH	NM_001024656.2,NM_001114598.1	43,43	3690,1946,489	CC,CT,TT		31.9335,8.0145,23.8694	benign,benign	161/179,266/284	51015404	9326,2924	2065	4060	6125	SO:0001583	missense	554235	exon6			AGGCTCTGCCAGA		CCDS33082.1, CCDS46153.1	19q13.33	2012-10-02			ENSG00000204653	ENSG00000204653			33856	protein-coding gene	gene with protein product							Standard	NM_001024656		Approved		uc010enz.3	A6ND91		ENST00000389208.4:c.797A>G	19.37:g.51015404T>C	ENSP00000373860:p.Gln266Arg	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	13	13	NM_001114598	0	0	0	1	1	Q6NZ37	Missense_Mutation	SNP	ENST00000389208.4	37	CCDS46153.1	1681	0.7696886446886447	481	0.9776422764227642	273	0.7541436464088398	412	0.7202797202797203	515	0.679419525065963	C	3.606	-0.080592	0.07141	0.919855	0.680665	ENSG00000204653	ENST00000376916;ENST00000389208	T;T	0.39997	1.05;1.05	2.95	1.88	0.25563	Aspartate dehydrogenase (1);	1.158050	0.06646	N	0.761872	T	0.00012	0.0000	N	0.01705	-0.755	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.30794	-0.9966	9	0.06099	T	0.92	-1.7519	4.8935	0.13738	0.0:0.6813:0.0:0.3187	rs12977172	266;161	A6ND91;A6ND91-2	ASPD_HUMAN;.	R	161;266	ENSP00000366114:Q161R;ENSP00000373860:Q266R	ENSP00000366114:Q161R	Q	-	2	0	ASPDH	55707216	0.916000	0.31088	0.989000	0.46669	0.553000	0.35397	0.171000	0.16685	0.125000	0.18397	-0.355000	0.07637	CAG	T|0.228;C|0.772		0.706	ASPDH-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464861.1	NM_001024656	
LENG9	94059	hgsc.bcm.edu	37	19	54974329	54974329	+	Frame_Shift_Del	DEL	G	G	-			TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr19:54974329delG	ENST00000333834.4	-	1	565	c.447delC	c.(445-447)ttcfs	p.F150fs		NM_198988.1	NP_945339.2	Q96B70	LENG9_HUMAN	leukocyte receptor cluster (LRC) member 9	150							catalytic activity (GO:0003824)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)	11	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.134)		GGAAGCGGAAGAAGCGCACGC	0.731																																					p.F149fs		.											.	LENG9-68	0			c.447delC						.			2,4038		0,2,2018	6.0	7.0	7.0			3.8	1.0	19		7	36,7916		2,32,3942	no	frameshift	LENG9	NM_198988.1		2,34,5960	A1A1,A1R,RR		0.4527,0.0495,0.3169			54974329	38,11954	2097	4160	6257	SO:0001589	frameshift_variant	94059	exon1			GCGGAAGAAGCGC	AF211976		19q13.4	2014-05-06			ENSG00000182909	ENSG00000275183			16306	protein-coding gene	gene with protein product						10941842	Standard	NM_198988		Approved		uc010yez.2	Q96B70	OTTHUMG00000188273	ENST00000333834.4:c.447delC	19.37:g.54974329delG	ENSP00000331647:p.Phe150fs	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	20	10	NM_198988	0	0	0	0	0	B2VAM3	Frame_Shift_Del	DEL	ENST00000333834.4	37	CCDS12895.2																																																																																			.		0.731	LENG9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140806.3	NM_198988	
SBK2	646643	hgsc.bcm.edu	37	19	56041261	56041261	+	Silent	SNP	G	G	A	rs528301476		TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr19:56041261G>A	ENST00000413299.1	-	4	923	c.886C>T	c.(886-888)Ctg>Ttg	p.L296L	SBK2_ENST00000344158.3_Silent_p.L296L	NM_001101401.2	NP_001094871.2	P0C263	SBK2_HUMAN	SH3 domain binding kinase family, member 2	296	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	9						GCGGCGGCCAGGCCGAACCAG	0.746													G|||	1	0.000199681	0.0	0.0014	5008	,	,		10896	0.0		0.0	False		,,,				2504	0.0				p.L296L		.											.	SBK2-68	0			c.C886T						.																																			SO:0001819	synonymous_variant	646643	exon4			CGGCCAGGCCGAA		CCDS42631.1	19q13.42	2013-09-27	2013-09-27		ENSG00000187550	ENSG00000187550			34416	protein-coding gene	gene with protein product			"""SH3-binding domain kinase family, member 2"""				Standard	NM_001101401		Approved	SGK069	uc010ygc.2	P0C263	OTTHUMG00000155830	ENST00000413299.1:c.886C>T	19.37:g.56041261G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	15	7	NM_001101401	0	0	0	0	0		Silent	SNP	ENST00000413299.1	37	CCDS42631.1																																																																																			.		0.746	SBK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341919.1	NM_001101401	
ZIM3	114026	broad.mit.edu;bcgsc.ca	37	19	57648259	57648259	+	Silent	SNP	G	G	A			TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr19:57648259G>A	ENST00000269834.1	-	4	608	c.223C>T	c.(223-225)Ctg>Ttg	p.L75L	U3_ENST00000516874.1_RNA	NM_052882.1	NP_443114.1	Q96PE6	ZIM3_HUMAN	zinc finger, imprinted 3	75	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(27)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	52		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.243)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		CCACTTCCCAGCACTTCCTCT	0.522																																					p.L75L		.											.	ZIM3-92	0			c.C223T						.						277.0	186.0	217.0					19																	57648259		2203	4300	6503	SO:0001819	synonymous_variant	114026	exon4			TTCCCAGCACTTC	AF365931	CCDS33125.1	19q13.4	2013-01-08				ENSG00000141946		"""Zinc fingers, C2H2-type"", ""-"""	16366	protein-coding gene	gene with protein product							Standard	NM_052882		Approved	ZNF657	uc002qnz.1	Q96PE6		ENST00000269834.1:c.223C>T	19.37:g.57648259G>A		Somatic	279	0		WXS	Illumina GAIIx	Phase_I	336	8	NM_052882	0	0	0	0	0	Q14CA6	Silent	SNP	ENST00000269834.1	37	CCDS33125.1																																																																																			.		0.522	ZIM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465078.1		
CMPK2	129607	hgsc.bcm.edu	37	2	7005369	7005369	+	Silent	SNP	A	A	G	rs11678810	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr2:7005369A>G	ENST00000256722.5	-	1	458	c.459T>C	c.(457-459)tgT>tgC	p.C153C	CMPK2_ENST00000404168.1_Silent_p.C153C|CMPK2_ENST00000478738.1_Intron|CMPK2_ENST00000458098.1_Silent_p.C153C	NM_207315.3	NP_997198.2	Q5EBM0	CMPK2_HUMAN	cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial	153					cellular response to lipopolysaccharide (GO:0071222)|dTDP biosynthetic process (GO:0006233)|dUDP biosynthetic process (GO:0006227)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cytidylate kinase activity (GO:0004127)|nucleoside diphosphate kinase activity (GO:0004550)|thymidylate kinase activity (GO:0004798)|UMP kinase activity (GO:0033862)			large_intestine(1)|lung(13)|prostate(1)|upper_aerodigestive_tract(1)	16	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					GTGCCTCCTGACAGGCGCCCA	0.741													G|||	4998	0.998003	0.9924	1.0	5008	,	,		10694	1.0		1.0	False		,,,				2504	1.0				p.C153C		.											.	CMPK2-68	0			c.T459C						.	G		3605,39		1783,39,0	3.0	4.0	4.0		459	1.6	0.0	2	dbSNP_120	4	7874,0		3937,0,0	no	coding-synonymous	CMPK2	NM_207315.2		5720,39,0	GG,GA,AA		0.0,1.0703,0.3386		153/450	7005369	11479,39	1822	3937	5759	SO:0001819	synonymous_variant	129607	exon1			CTCCTGACAGGCG		CCDS42648.1, CCDS58695.1, CCDS58696.1	2p25.2	2008-01-25			ENSG00000134326	ENSG00000134326	2.7.4.14		27015	protein-coding gene	gene with protein product	"""cytidylate kinase 2"""	611787				17999954	Standard	NM_207315		Approved	TYKi, UMP-CMPK2	uc002qyo.4	Q5EBM0	OTTHUMG00000151629	ENST00000256722.5:c.459T>C	2.37:g.7005369A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_001256478	0	0	0	0	0	A2RUB0|A5D8T2|B7ZM18|Q6ZRU2|Q96AL8	Silent	SNP	ENST00000256722.5	37	CCDS42648.1																																																																																			A|0.003;G|0.997		0.741	CMPK2-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323339.2	NM_207315	
AGBL5	60509	broad.mit.edu;bcgsc.ca	37	2	27276815	27276815	+	Missense_Mutation	SNP	C	C	T	rs144135243	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr2:27276815C>T	ENST00000360131.4	+	4	598	c.439C>T	c.(439-441)Cgt>Tgt	p.R147C	RP11-503P10.1_ENST00000607407.1_RNA|AGBL5_ENST00000323064.8_Missense_Mutation_p.R147C	NM_021831.5	NP_068603.4	Q8NDL9	CBPC5_HUMAN	ATP/GTP binding protein-like 5	147					protein branching point deglutamylation (GO:0035611)|protein deglutamylation (GO:0035608)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	28	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CGTGGAGGGCCGTGGGGCCAC	0.552													C|||	4	0.000798722	0.0	0.0	5008	,	,		20878	0.001		0.0	False		,,,				2504	0.0031				p.R147C		.											.	AGBL5-154	0			c.C439T						.	C	CYS/ARG,CYS/ARG	0,4406		0,0,2203	193.0	174.0	181.0		439,439	5.5	1.0	2	dbSNP_134	181	2,8598	2.2+/-6.3	0,2,4298	yes	missense,missense	AGBL5	NM_001035507.2,NM_021831.5	180,180	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	probably-damaging,probably-damaging	147/718,147/887	27276815	2,13004	2203	4300	6503	SO:0001583	missense	60509	exon4			GAGGGCCGTGGGG	BC007415	CCDS1732.3, CCDS42665.1	2p23.3	2014-06-23			ENSG00000084693	ENSG00000084693			26147	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 5"""	615900				24022482	Standard	NM_001035507		Approved	FLJ21839, CCP5	uc002rie.3	Q8NDL9	OTTHUMG00000128406	ENST00000360131.4:c.439C>T	2.37:g.27276815C>T	ENSP00000353249:p.Arg147Cys	Somatic	111	0		WXS	Illumina GAIIx	Phase_I	91	7	NM_021831	0	0	5	5	0	A2VDI7|B7WPG9|B7Z7I7|D6W548|Q53SW0|Q53SZ0|Q96IK8|Q9H6V0|Q9H8P8	Missense_Mutation	SNP	ENST00000360131.4	37	CCDS1732.3	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	26.0	4.695599	0.88830	0.0	2.33E-4	ENSG00000084693	ENST00000453161;ENST00000323064;ENST00000360131	T;T	0.16597	2.36;2.33	5.51	5.51	0.81932	.	0.102421	0.64402	D	0.000001	T	0.46946	0.1419	M	0.81497	2.545	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.991;0.991;0.996	T	0.48364	-0.9042	10	0.72032	D	0.01	-7.1368	18.1957	0.89820	0.0:1.0:0.0:0.0	.	147;147;147	Q8NDL9;Q8NDL9-3;Q8NDL9-2	CBPC5_HUMAN;.;.	C	147	ENSP00000323681:R147C;ENSP00000353249:R147C	ENSP00000323681:R147C	R	+	1	0	AGBL5	27130319	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.424000	0.52764	2.590000	0.87494	0.561000	0.74099	CGT	C|1.000;T|0.000		0.552	AGBL5-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000309033.1	NM_021831	
TTC27	55622	hgsc.bcm.edu;broad.mit.edu	37	2	33036125	33036125	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr2:33036125G>T	ENST00000317907.4	+	17	2264	c.2033G>T	c.(2032-2034)gGg>gTg	p.G678V		NM_001193509.1|NM_017735.4	NP_001180438.1|NP_060205.3	Q6P3X3	TTC27_HUMAN	tetratricopeptide repeat domain 27	678										breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(14)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	38						GTGATTGATGGGATGACTGAT	0.398																																					p.G678V		.											.	TTC27-90	0			c.G2033T						.						116.0	111.0	113.0					2																	33036125		2203	4300	6503	SO:0001583	missense	55622	exon17			TTGATGGGATGAC	BC063791, AK000279	CCDS33176.1	2p22.3	2013-01-10			ENSG00000018699	ENSG00000018699		"""Tetratricopeptide (TTC) repeat domain containing"""	25986	protein-coding gene	gene with protein product							Standard	NM_001193509		Approved	FLJ20272	uc002rom.3	Q6P3X3	OTTHUMG00000152134	ENST00000317907.4:c.2033G>T	2.37:g.33036125G>T	ENSP00000313953:p.Gly678Val	Somatic	122	0		WXS	Illumina GAIIx	Phase_I	73	4	NM_017735	0	0	8	8	0	A6NKJ0|Q96SS5|Q9BVF1|Q9NWR4|Q9NXG4	Missense_Mutation	SNP	ENST00000317907.4	37	CCDS33176.1	.	.	.	.	.	.	.	.	.	.	G	13.29	2.193890	0.38707	.	.	ENSG00000018699	ENST00000317907	T	0.60171	0.21	5.22	4.33	0.51752	.	0.359364	0.32301	N	0.006284	T	0.52435	0.1734	L	0.58101	1.795	0.58432	D	0.999999	P	0.39216	0.664	B	0.36030	0.216	T	0.52859	-0.8519	10	0.31617	T	0.26	-11.836	14.3598	0.66764	0.0717:0.0:0.9283:0.0	.	678	Q6P3X3	TTC27_HUMAN	V	678	ENSP00000313953:G678V	ENSP00000313953:G678V	G	+	2	0	TTC27	32889629	0.998000	0.40836	0.668000	0.29813	0.057000	0.15508	2.917000	0.48821	1.397000	0.46682	0.650000	0.86243	GGG	.		0.398	TTC27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325395.1	NM_017735	
TMEM247	388946	hgsc.bcm.edu;bcgsc.ca	37	2	46707808	46707808	+	Missense_Mutation	SNP	C	C	G	rs70940616|rs74318890		TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr2:46707808C>G	ENST00000434431.1	+	2	382	c.382C>G	c.(382-384)Cag>Gag	p.Q128E		NM_001145051.2	NP_001138523.1	A6NEH6	TM247_HUMAN	transmembrane protein 247	128						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)											GAACCAGCGGCAGCGGCAGCA	0.662																																					p.Q128E		.											.	.	0			c.C382G						.						30.0	40.0	37.0					2																	46707808		692	1591	2283	SO:0001583	missense	388946	exon2			CAGCGGCAGCGGC		CCDS56117.1	2p21	2012-04-11			ENSG00000187600	ENSG00000187600			42967	protein-coding gene	gene with protein product							Standard	NM_001145051		Approved		uc010yod.3	A6NEH6	OTTHUMG00000153137	ENST00000434431.1:c.382C>G	2.37:g.46707808C>G	ENSP00000388684:p.Gln128Glu	Somatic	137	0		WXS	Illumina GAIIx	Phase_I	278	32	NM_001145051	0	0	0	0	0		Missense_Mutation	SNP	ENST00000434431.1	37	CCDS56117.1	.	.	.	.	.	.	.	.	.	.	C	17.67	3.447093	0.63178	.	.	ENSG00000187600	ENST00000434431	.	.	.	4.76	4.76	0.60689	.	0.000000	0.39475	N	0.001353	T	0.65606	0.2707	L	0.34521	1.04	.	.	.	D	0.56035	0.974	D	0.70487	0.969	T	0.71735	-0.4503	8	0.54805	T	0.06	-28.7409	14.7885	0.69821	0.0:1.0:0.0:0.0	.	128	A6NEH6	YB028_HUMAN	E	128	.	ENSP00000388684:Q128E	Q	+	1	0	AC018682.6	46561312	1.000000	0.71417	1.000000	0.80357	0.569000	0.35902	3.910000	0.56371	2.484000	0.83849	0.563000	0.77884	CAG	G|1.000;|0.000		0.662	TMEM247-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329726.1	NM_001145051	
BCL11A	53335	ucsc.edu;mdanderson.org	37	2	60688336	60688336	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr2:60688336T>C	ENST00000335712.6	-	4	1938	c.1711A>G	c.(1711-1713)Aag>Gag	p.K571E	BCL11A_ENST00000537768.1_Missense_Mutation_p.K240E|BCL11A_ENST00000356842.4_Missense_Mutation_p.K571E|BCL11A_ENST00000358510.4_Missense_Mutation_p.K537E|BCL11A_ENST00000359629.5_Intron|BCL11A_ENST00000538214.1_Missense_Mutation_p.K537E|BCL11A_ENST00000477659.1_5'UTR	NM_022893.3	NP_075044.2	Q9H165	BC11A_HUMAN	B-cell CLL/lymphoma 11A (zinc finger protein)	571					B cell differentiation (GO:0030183)|negative regulation of axon extension (GO:0030517)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|negative regulation of protein homooligomerization (GO:0032463)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein sumoylation (GO:0016925)|regulation of dendrite development (GO:0050773)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription corepressor activity (GO:0003714)			NS(1)|breast(6)|central_nervous_system(6)|endometrium(4)|kidney(1)|large_intestine(8)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	59			LUSC - Lung squamous cell carcinoma(5;9.29e-08)|Lung(5;1.34e-06)|Epithelial(17;0.0562)|all cancers(80;0.199)			TGGCCGCGCTTATGCTTCTCG	0.662			T	IGH@	B-CLL																																p.K571E		.		Dom	yes		2	2p13	53335	B-cell CLL/lymphoma 11A		L	.	BCL11A-1149	0			c.A1711G						.						25.0	25.0	25.0					2																	60688336		2196	4282	6478	SO:0001583	missense	53335	exon4			CGCGCTTATGCTT	AJ404611	CCDS1861.1, CCDS1862.1, CCDS46295.1	2p16.1	2013-01-08	2002-05-08		ENSG00000119866	ENSG00000119866		"""Zinc fingers, C2H2-type"""	13221	protein-coding gene	gene with protein product		606557	"""ecotropic viral integration site 9"""	EVI9		11719382, 18245381	Standard	NM_018014		Approved	BCL11A-XL, BCL11A-L, BCL11A-S, CTIP1, HBFQTL5, ZNF856	uc002sae.1	Q9H165	OTTHUMG00000129420	ENST00000335712.6:c.1711A>G	2.37:g.60688336T>C	ENSP00000338774:p.Lys571Glu	Somatic	16	1		WXS	Illumina GAIIx	Phase_I	93	87	NM_018014	0	0	0	2	2	D6W5D7|Q86W14|Q8WU92|Q96JL6|Q9H163|Q9H164|Q9H3G9|Q9NWA7	Missense_Mutation	SNP	ENST00000335712.6	37	CCDS1862.1	.	.	.	.	.	.	.	.	.	.	T	12.33	1.904350	0.33628	.	.	ENSG00000119866	ENST00000356842;ENST00000378117;ENST00000538214;ENST00000537768;ENST00000335712;ENST00000358510	T;T;T;T;T	0.09630	2.96;3.24;3.08;3.26;3.19	5.69	5.69	0.88448	.	0.060475	0.64402	D	0.000004	T	0.12561	0.0305	L	0.59436	1.845	0.58432	D	0.999991	B;B;P;P;P	0.44627	0.148;0.028;0.525;0.839;0.633	B;B;B;B;B	0.34489	0.053;0.016;0.156;0.114;0.184	T	0.02301	-1.1180	10	0.54805	T	0.06	-3.5177	15.9546	0.79876	0.0:0.0:0.0:1.0	.	537;240;537;571;571	F5H2Y4;B4DT16;Q9H165-6;Q9H165;D9YZV9	.;.;.;BC11A_HUMAN;.	E	571;596;537;240;571;537	ENSP00000349300:K571E;ENSP00000438303:K537E;ENSP00000443712:K240E;ENSP00000338774:K571E;ENSP00000351307:K537E	ENSP00000338774:K571E	K	-	1	0	BCL11A	60541840	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.654000	0.54453	2.173000	0.68751	0.454000	0.30748	AAG	.		0.662	BCL11A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251579.2	NM_022893	
DYSF	8291	bcgsc.ca	37	2	71780215	71780215	+	Silent	SNP	T	T	C	rs2303596	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr2:71780215T>C	ENST00000258104.3	+	20	2104	c.1827T>C	c.(1825-1827)gaT>gaC	p.D609D	DYSF_ENST00000413539.2_Silent_p.D640D|DYSF_ENST00000409651.1_Silent_p.D641D|DYSF_ENST00000410041.1_Silent_p.D627D|DYSF_ENST00000410020.3_Silent_p.D627D|DYSF_ENST00000409762.1_Silent_p.D626D|DYSF_ENST00000394120.2_Silent_p.D610D|DYSF_ENST00000409366.1_Silent_p.D610D|DYSF_ENST00000409744.1_Silent_p.D596D|DYSF_ENST00000409582.3_Silent_p.D626D|DYSF_ENST00000429174.2_Silent_p.D609D	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	O75923	DYSF_HUMAN	dysferlin	609					plasma membrane repair (GO:0001778)|vesicle fusion (GO:0006906)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipid binding (GO:0005543)			autonomic_ganglia(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(57)|ovary(3)|pancreas(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	111						ATGTGGATGATGCCATCCAGT	0.562													C|||	2882	0.575479	0.7753	0.6412	5008	,	,		19523	0.2222		0.7336	False		,,,				2504	0.4601				p.D641D		.											.	DYSF-158	0			c.T1923C						.	C	,,,,,,,,,,,,,	3451,955	363.9+/-316.7	1351,749,103	120.0	97.0	105.0		1830,1785,1785,1827,1920,1878,1878,1923,1830,1788,1881,1788,1881,1827	-1.7	0.4	2	dbSNP_100	105	6107,2493	409.6+/-349.9	2178,1751,371	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	DYSF	NM_001130455.1,NM_001130976.1,NM_001130977.1,NM_001130978.1,NM_001130979.1,NM_001130980.1,NM_001130981.1,NM_001130982.1,NM_001130983.1,NM_001130984.1,NM_001130985.1,NM_001130986.1,NM_001130987.1,NM_003494.3	,,,,,,,,,,,,,	3529,2500,474	CC,CT,TT		28.9884,21.675,26.5108	,,,,,,,,,,,,,	610/2082,595/2067,595/2088,609/2102,640/2112,626/2098,626/2119,641/2113,610/2103,596/2089,627/2099,596/2068,627/2120,609/2081	71780215	9558,3448	2203	4300	6503	SO:0001819	synonymous_variant	8291	exon21			GGATGATGCCATC	AF075575	CCDS1918.1, CCDS46323.1, CCDS46324.1, CCDS46325.1, CCDS46326.1, CCDS46327.1, CCDS46328.1, CCDS46329.1, CCDS46330.1, CCDS46331.1, CCDS46332.1	2p13.3	2014-09-17	2013-09-12		ENSG00000135636	ENSG00000135636			3097	protein-coding gene	gene with protein product	"""fer-1-like family member 1"""	603009	"""limb girdle muscular dystrophy 2B (autosomal recessive)"""	LGMD2B		8320700	Standard	NM_003494		Approved	FER1L1	uc010fen.3	O75923	OTTHUMG00000129757	ENST00000258104.3:c.1827T>C	2.37:g.71780215T>C		Somatic	450	1		WXS	Illumina GAIIx	Phase_I	333	10	NM_001130982	0	0	0	0	0	A0FK00|B1PZ70|B1PZ71|B1PZ72|B1PZ73|B1PZ74|B1PZ75|B1PZ76|B1PZ77|B1PZ78|B1PZ79|B1PZ80|B1PZ81|B3KQB9|O75696|Q09EX5|Q0H395|Q53QY3|Q53TD2|Q8TEL8|Q9UEN7	Silent	SNP	ENST00000258104.3	37	CCDS1918.1																																																																																			T|0.328;C|0.672		0.562	DYSF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251970.3	NM_003494	
DYSF	8291	broad.mit.edu	37	2	71892329	71892329	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr2:71892329T>C	ENST00000258104.3	+	46	5372	c.5095T>C	c.(5095-5097)Tcc>Ccc	p.S1699P	DYSF_ENST00000413539.2_Missense_Mutation_p.S1730P|DYSF_ENST00000409651.1_Missense_Mutation_p.S1731P|DYSF_ENST00000410041.1_Missense_Mutation_p.S1717P|DYSF_ENST00000410020.3_Missense_Mutation_p.S1738P|DYSF_ENST00000409762.1_Missense_Mutation_p.S1716P|DYSF_ENST00000394120.2_Missense_Mutation_p.S1700P|DYSF_ENST00000409366.1_Missense_Mutation_p.S1721P|DYSF_ENST00000409744.1_Missense_Mutation_p.S1707P|DYSF_ENST00000409582.3_Missense_Mutation_p.S1737P|DYSF_ENST00000479049.2_3'UTR|DYSF_ENST00000429174.2_Missense_Mutation_p.S1720P	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	O75923	DYSF_HUMAN	dysferlin	1699					plasma membrane repair (GO:0001778)|vesicle fusion (GO:0006906)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipid binding (GO:0005543)			autonomic_ganglia(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(57)|ovary(3)|pancreas(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	111						GCTCCGCCCCTCCCAGCTCCT	0.537																																					p.S1738P		.											.	DYSF-158	0			c.T5212C						.						95.0	95.0	95.0					2																	71892329		2203	4300	6503	SO:0001583	missense	8291	exon47			CGCCCCTCCCAGC	AF075575	CCDS1918.1, CCDS46323.1, CCDS46324.1, CCDS46325.1, CCDS46326.1, CCDS46327.1, CCDS46328.1, CCDS46329.1, CCDS46330.1, CCDS46331.1, CCDS46332.1	2p13.3	2014-09-17	2013-09-12		ENSG00000135636	ENSG00000135636			3097	protein-coding gene	gene with protein product	"""fer-1-like family member 1"""	603009	"""limb girdle muscular dystrophy 2B (autosomal recessive)"""	LGMD2B		8320700	Standard	NM_003494		Approved	FER1L1	uc010fen.3	O75923	OTTHUMG00000129757	ENST00000258104.3:c.5095T>C	2.37:g.71892329T>C	ENSP00000258104:p.Ser1699Pro	Somatic	120	11		WXS	Illumina GAIIx	Phase_I	85	10	NM_001130987	0	0	4	6	2	A0FK00|B1PZ70|B1PZ71|B1PZ72|B1PZ73|B1PZ74|B1PZ75|B1PZ76|B1PZ77|B1PZ78|B1PZ79|B1PZ80|B1PZ81|B3KQB9|O75696|Q09EX5|Q0H395|Q53QY3|Q53TD2|Q8TEL8|Q9UEN7	Missense_Mutation	SNP	ENST00000258104.3	37	CCDS1918.1	.	.	.	.	.	.	.	.	.	.	T	18.54	3.645124	0.67358	.	.	ENSG00000135636	ENST00000413539;ENST00000409762;ENST00000409582;ENST00000429174;ENST00000258104;ENST00000409651;ENST00000394120;ENST00000409744;ENST00000409366;ENST00000410020;ENST00000410041	D;D;D;D;D;D;D;D;D;D;D	0.84298	-1.82;-1.82;-1.82;-1.81;-1.81;-1.83;-1.83;-1.82;-1.82;-1.83;-1.83	5.41	4.13	0.48395	.	0.298471	0.36665	N	0.002469	D	0.90683	0.7077	M	0.86178	2.8	0.22754	N	0.998773	B;D;D;B;D;B;B;B;B;D;B;P;D;D;P	0.55800	0.023;0.973;0.973;0.082;0.973;0.039;0.039;0.039;0.175;0.973;0.036;0.946;0.973;0.973;0.955	B;P;P;B;P;B;B;B;B;P;B;P;P;P;P	0.58928	0.03;0.848;0.848;0.053;0.848;0.099;0.067;0.099;0.132;0.848;0.067;0.786;0.848;0.786;0.709	D	0.84078	0.0383	10	0.72032	D	0.01	-31.2826	10.7847	0.46398	0.1523:0.0:0.0:0.8477	.	463;1731;1738;1721;1686;1717;1707;1716;1706;1730;1737;1720;1685;1700;1699	B7Z8G4;O75923-8;O75923-13;O75923-10;O75923-9;O75923-11;O75923-12;O75923-5;O75923-6;O75923-2;O75923-7;O75923-4;O75923-3;O75923-14;O75923	.;.;.;.;.;.;.;.;.;.;.;.;.;.;DYSF_HUMAN	P	1730;1716;1737;1720;1699;1731;1700;1707;1721;1738;1717	ENSP00000407046:S1730P;ENSP00000387137:S1716P;ENSP00000386547:S1737P;ENSP00000398305:S1720P;ENSP00000258104:S1699P;ENSP00000386683:S1731P;ENSP00000377678:S1700P;ENSP00000386285:S1707P;ENSP00000386512:S1721P;ENSP00000386881:S1738P;ENSP00000386617:S1717P	ENSP00000258104:S1699P	S	+	1	0	DYSF	71745837	0.932000	0.31603	1.000000	0.80357	0.997000	0.91878	1.844000	0.39269	2.048000	0.60808	0.533000	0.62120	TCC	.		0.537	DYSF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251970.3	NM_003494	
MARCH7	64844	bcgsc.ca	37	2	160599717	160599717	+	Missense_Mutation	SNP	C	C	G	rs17813964	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr2:160599717C>G	ENST00000259050.4	+	3	421	c.299C>G	c.(298-300)aCt>aGt	p.T100S	MARCH7_ENST00000409591.1_Missense_Mutation_p.T62S|MARCH7_ENST00000539065.1_Missense_Mutation_p.T100S|MARCH7_ENST00000409175.1_Missense_Mutation_p.T100S|MARCH7_ENST00000473749.1_3'UTR	NM_001282805.1|NM_001282807.1|NM_022826.2	NP_001269734.1|NP_001269736.1|NP_073737.1	Q9H992	MARH7_HUMAN	membrane-associated ring finger (C3HC4) 7, E3 ubiquitin protein ligase	100	Ser-rich.		T -> S (in dbSNP:rs17813964).		protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(3)|prostate(1)|skin(1)|stomach(2)	18						ACAAACTGTACTACCTCAGCT	0.403													C|||	192	0.0383387	0.0038	0.0447	5008	,	,		20371	0.0238		0.0865	False		,,,				2504	0.046				p.T100S		.											.	MARCH7-68	0			c.C299G						.	C	SER/THR	70,4336	64.1+/-101.4	0,70,2133	131.0	126.0	127.0		299	5.5	1.0	2	dbSNP_123	127	730,7870	177.8+/-227.3	30,670,3600	yes	missense	MARCH7	NM_022826.2	58	30,740,5733	GG,GC,CC		8.4884,1.5887,6.151	benign	100/705	160599717	800,12206	2203	4300	6503	SO:0001583	missense	64844	exon3			ACTGTACTACCTC	AK022973	CCDS2210.1, CCDS63038.1, CCDS63039.1	2q24.2	2013-01-09	2012-02-23	2005-01-27	ENSG00000136536	ENSG00000136536		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	17393	protein-coding gene	gene with protein product		613334	"""axotrophin"", ""membrane-associated ring finger (C3HC4) 7"""	AXOT		14722266	Standard	XM_005246773		Approved	MARCH-VII, RNF177	uc002uax.3	Q9H992	OTTHUMG00000132029	ENST00000259050.4:c.299C>G	2.37:g.160599717C>G	ENSP00000259050:p.Thr100Ser	Somatic	239	2		WXS	Illumina GAIIx	Phase_I	189	7	NM_022826	0	0	3	3	0	A8K9X1|B7Z7P5|D3DPB0|Q53GQ1|Q9BTR9	Missense_Mutation	SNP	ENST00000259050.4	37	CCDS2210.1	105	0.04807692307692308	3	0.006097560975609756	17	0.04696132596685083	14	0.024475524475524476	71	0.09366754617414248	C	14.19	2.462449	0.43736	0.015887	0.084884	ENSG00000136536	ENST00000409175;ENST00000539065;ENST00000259050;ENST00000421037;ENST00000409591	T;T;T;T;T	0.50277	2.73;2.68;2.73;0.75;2.72	5.54	5.54	0.83059	.	0.496290	0.22512	N	0.059089	T	0.04272	0.0118	L	0.41236	1.265	0.27891	N	0.939314	D;B;B	0.67145	0.996;0.441;0.307	D;B;B	0.73380	0.98;0.138;0.138	T	0.13710	-1.0499	10	0.10902	T	0.67	-3.1194	17.6728	0.88223	0.0:1.0:0.0:0.0	rs17813964;rs52819098;rs17813964	100;62;100	F5H6W4;B7Z7P5;Q9H992	.;.;MARH7_HUMAN	S	100;100;100;100;62	ENSP00000386830:T100S;ENSP00000442992:T100S;ENSP00000259050:T100S;ENSP00000392862:T100S;ENSP00000387238:T62S	ENSP00000259050:T100S	T	+	2	0	MARCH7	160307963	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.019000	0.64060	2.607000	0.88179	0.650000	0.86243	ACT	C|0.945;G|0.055		0.403	MARCH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255040.3	NM_022826	
XIRP2	129446	bcgsc.ca	37	2	168103304	168103304	+	Missense_Mutation	SNP	G	G	A	rs16853309	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr2:168103304G>A	ENST00000409195.1	+	9	5491	c.5402G>A	c.(5401-5403)cGt>cAt	p.R1801H	XIRP2_ENST00000409273.1_Missense_Mutation_p.R1579H|XIRP2_ENST00000295237.9_Missense_Mutation_p.R1801H|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409756.2_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	1626					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						CTGGTTGAACGTACTGTTAGT	0.403													G|||	989	0.197484	0.3245	0.1311	5008	,	,		21072	0.12		0.1233	False		,,,				2504	0.229				p.R1801H		.											.	XIRP2-104	0			c.G5402A						.	G	HIS/ARG,HIS/ARG,,,	1080,2776		156,768,1004	180.0	168.0	172.0		4736,5402,,,	2.8	1.0	2	dbSNP_123	172	921,7361		55,811,3275	yes	missense,missense,intron,intron,intron	XIRP2	NM_001199144.1,NM_152381.5,NM_001079810.3,NM_001199143.1,NM_001199145.1	29,29,,,	211,1579,4279	AA,AG,GG		11.1205,28.0083,16.4854	possibly-damaging,possibly-damaging,,,	1579/3328,1801/3550,,,	168103304	2001,10137	1928	4141	6069	SO:0001583	missense	129446	exon9			TTGAACGTACTGT	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.5402G>A	2.37:g.168103304G>A	ENSP00000386840:p.Arg1801His	Somatic	223	2		WXS	Illumina GAIIx	Phase_I	146	7	NM_152381	0	0	0	0	0	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	ENST00000409195.1	37	CCDS42769.1	384	0.17582417582417584	170	0.34552845528455284	47	0.1298342541436464	72	0.1258741258741259	95	0.12532981530343007	G	10.60	1.396329	0.25205	0.280083	0.111205	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273	T;T;T	0.04502	3.61;3.61;3.61	5.59	2.84	0.33178	.	0.053822	0.85682	D	0.000000	T	0.00012	0.0000	M	0.74258	2.255	0.18873	P	0.999981003	P;P;P	0.41947	0.655;0.766;0.477	B;B;B	0.33121	0.076;0.158;0.081	T	0.49634	-0.8919	9	0.49607	T	0.09	-5.9326	9.9833	0.41826	0.2251:0.0:0.7749:0.0	rs16853309;rs52829936;rs16853309	1626;1626;1579	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	H	1801;1801;1579	ENSP00000386840:R1801H;ENSP00000295237:R1801H;ENSP00000387255:R1579H	ENSP00000295237:R1801H	R	+	2	0	XIRP2	167811550	1.000000	0.71417	1.000000	0.80357	0.350000	0.29205	2.750000	0.47500	0.740000	0.32651	-0.133000	0.14855	CGT	G|0.820;A|0.180		0.403	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381	
FASTKD1	79675	bcgsc.ca	37	2	170403030	170403030	+	Missense_Mutation	SNP	T	T	C	rs2253680	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr2:170403030T>C	ENST00000453153.2	-	8	1745	c.1399A>G	c.(1399-1401)Atg>Gtg	p.M467V	FASTKD1_ENST00000453929.2_Missense_Mutation_p.M467V	NM_024622.3	NP_078898.3	Q53R41	FAKD1_HUMAN	FAST kinase domains 1	467			M -> V (in dbSNP:rs2253680). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		cellular respiration (GO:0045333)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(5)|large_intestine(10)|lung(9)|ovary(4)|prostate(3)	37						TCCAAATACATGTGATCATGC	0.388													T|||	2719	0.542931	0.4894	0.6744	5008	,	,		19531	0.5089		0.6163	False		,,,				2504	0.4816				p.M467V		.											.	FASTKD1-119	0			c.A1399G						.	T	VAL/MET	2215,2191	590.7+/-387.4	559,1097,547	112.0	100.0	104.0		1399	-9.1	0.0	2	dbSNP_100	104	5028,3572	627.8+/-398.0	1456,2116,728	yes	missense	FASTKD1	NM_024622.3	21	2015,3213,1275	CC,CT,TT		41.5349,49.7276,44.3103	benign	467/848	170403030	7243,5763	2203	4300	6503	SO:0001583	missense	79675	exon8			AATACATGTGATC	AL832058	CCDS33318.1, CCDS63051.1	2q31.1	2008-02-05			ENSG00000138399	ENSG00000138399			26150	protein-coding gene	gene with protein product						11347906	Standard	NM_024622		Approved	FLJ21901	uc002uev.4	Q53R41	OTTHUMG00000154953	ENST00000453153.2:c.1399A>G	2.37:g.170403030T>C	ENSP00000400513:p.Met467Val	Somatic	161	1		WXS	Illumina GAIIx	Phase_I	158	6	NM_024622	0	0	2	2	0	Q8N583|Q8TEA9|Q96JM5|Q96N71|Q9H6T4	Missense_Mutation	SNP	ENST00000453153.2	37	CCDS33318.1	1235	0.5654761904761905	255	0.5182926829268293	231	0.638121546961326	275	0.4807692307692308	474	0.6253298153034301	T	0.003	-2.500765	0.00157	0.502724	0.584651	ENSG00000138399	ENST00000453153;ENST00000453929	T;T	0.17213	2.29;2.3	4.57	-9.13	0.00704	.	1.078920	0.06881	N	0.802567	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.42548	-0.9445	9	0.07030	T	0.85	-19.9073	3.3797	0.07249	0.2303:0.2744:0.3819:0.1134	rs2253680;rs52807251;rs59115908;rs2253680	467;467	Q53R41-2;Q53R41	.;FAKD1_HUMAN	V	467	ENSP00000400513:M467V;ENSP00000403229:M467V	ENSP00000400513:M467V	M	-	1	0	FASTKD1	170111276	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.132000	0.10467	-1.957000	0.01021	-1.444000	0.01066	ATG	T|0.444;C|0.556		0.388	FASTKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337788.2	NM_024622	
EEF1B2	1933	broad.mit.edu	37	2	207025366	207025366	+	Silent	SNP	G	G	A			TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr2:207025366G>A	ENST00000392222.2	+	2	510	c.135G>A	c.(133-135)ccG>ccA	p.P45P	NDUFS1_ENST00000423725.1_5'Flank|SNORA41_ENST00000384675.1_RNA|NDUFS1_ENST00000455934.2_5'Flank|EEF1B2_ENST00000392221.1_Silent_p.P45P|NDUFS1_ENST00000233190.6_5'Flank|NDUFS1_ENST00000432169.1_5'Flank|NDUFS1_ENST00000440274.1_5'Flank|NDUFS1_ENST00000457011.1_5'Flank|SNORD51_ENST00000384320.2_RNA|NDUFS1_ENST00000449699.1_5'Flank|EEF1B2_ENST00000236957.5_Silent_p.P45P	NM_001959.3	NP_001950.1	P24534	EF1B_HUMAN	eukaryotic translation elongation factor 1 beta 2	45	GST C-terminal.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|translation (GO:0006412)|translational elongation (GO:0006414)	cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)	translation elongation factor activity (GO:0003746)	p.P45P(5)		breast(1)|endometrium(5)|kidney(3)|large_intestine(1)|lung(6)	16						CCAGCCCACCGCCTGCCGACT	0.448																																					p.P45P		.											.	EEF1B2-227	5	Substitution - coding silent(5)	kidney(2)|endometrium(2)|lung(1)	c.G135A						.						109.0	99.0	102.0					2																	207025366		2203	4300	6503	SO:0001819	synonymous_variant	1933	exon3			CCCACCGCCTGCC	X60489	CCDS2367.1	2q33.3	2011-04-28			ENSG00000114942	ENSG00000114942			3208	protein-coding gene	gene with protein product		600655				8250921	Standard	NM_001959		Approved		uc002vbf.1	P24534	OTTHUMG00000132891	ENST00000392222.2:c.135G>A	2.37:g.207025366G>A		Somatic	150	1		WXS	Illumina GAIIx	Phase_I	98	3	NM_021121	0	0	569	569	0	A8K795|Q6IBH9	Silent	SNP	ENST00000392222.2	37	CCDS2367.1																																																																																			.		0.448	EEF1B2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336436.1	NM_001037663	
KLHL30	377007	hgsc.bcm.edu	37	2	239050142	239050142	+	Silent	SNP	G	G	A	rs73102336	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr2:239050142G>A	ENST00000409223.1	+	2	854	c.747G>A	c.(745-747)cgG>cgA	p.R249R	KLHL30_ENST00000305959.4_Silent_p.R231R			Q0D2K2	KLH30_HUMAN	kelch-like family member 30	249	BACK.									lung(4)	4		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;4.71e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.02e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.63e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000109)|Lung(119;0.0108)|LUSC - Lung squamous cell carcinoma(224;0.0253)		AGGCATGCCGGGCAGCCCTGT	0.687													g|||	388	0.077476	0.0613	0.0605	5008	,	,		18524	0.0546		0.0934	False		,,,				2504	0.1186				p.R249R		.											.	KLHL30-22	0			c.G747A						.			153,3829		3,147,1841	4.0	5.0	5.0		747	4.8	0.1	2	dbSNP_130	5	592,7512		14,564,3474	no	coding-synonymous	KLHL30	NM_198582.3		17,711,5315	AA,AG,GG		7.305,3.8423,6.1642		249/579	239050142	745,11341	1991	4052	6043	SO:0001819	synonymous_variant	377007	exon2			ATGCCGGGCAGCC		CCDS46555.1, CCDS46555.2	2q37.3	2013-02-22	2013-02-22		ENSG00000168427	ENSG00000168427		"""Kelch-like"", ""BTB/POZ domain containing"""	24770	protein-coding gene	gene with protein product			"""kelch-like 30 (Drosophila)"""				Standard	NM_198582		Approved	FLJ43374	uc002vxr.2	Q0D2K2	OTTHUMG00000152905	ENST00000409223.1:c.747G>A	2.37:g.239050142G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	12	12	NM_198582	0	0	0	0	0	Q6ZUS1	Silent	SNP	ENST00000409223.1	37	CCDS46555.2																																																																																			G|0.930;A|0.070		0.687	KLHL30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328518.1	NM_198582	
LOC151174	151174	broad.mit.edu	37	2	239140728	239140728	+	5'Flank	SNP	A	A	G	rs11689033	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr2:239140728A>G	ENST00000409070.1	-	0	0				AC016757.3_ENST00000334973.4_5'Flank|AC096574.4_ENST00000456601.1_RNA|AC016757.3_ENST00000409942.1_5'Flank|AC016757.3_ENST00000409376.1_5'Flank|AC016757.3_ENST00000470346.1_5'Flank																							CTGGCTGGAGAAATCCGGTGT	0.493													A|||	841	0.167931	0.0212	0.2478	5008	,	,		18366	0.121		0.335	False		,,,				2504	0.1861				.		.											.	.	0			.						.																																			SO:0001631	upstream_gene_variant	0	.			CTGGAGAAATCCG																													2.37:g.239140728A>G	Exception_encountered	Somatic	113	2		WXS	Illumina GAIIx	Phase_I	79	4	.	0	0	0	0	0		RNA	SNP	ENST00000409070.1	37																																																																																				A|0.825;G|0.175		0.493	AC016757.3-006	PUTATIVE	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000328480.1		
FERMT1	55612	bcgsc.ca	37	20	6096632	6096632	+	Silent	SNP	G	G	A	rs1056141	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr20:6096632G>A	ENST00000217289.4	-	3	999	c.211C>T	c.(211-213)Ctg>Ttg	p.L71L	FERMT1_ENST00000536936.1_5'UTR	NM_017671.4	NP_060141.3	Q9BQL6	FERM1_HUMAN	fermitin family member 1	71					cell adhesion (GO:0007155)|establishment of epithelial cell polarity (GO:0090162)|keratinocyte migration (GO:0051546)|keratinocyte proliferation (GO:0043616)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|filamentous actin (GO:0031941)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)				NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(2)|skin(2)	17						TGGGTTTTCAGAAGCCAGCAA	0.468													G|||	442	0.0882588	0.1339	0.0576	5008	,	,		20955	0.0794		0.0905	False		,,,				2504	0.0552				p.L71L		.											.	FERMT1-495	0			c.C211T						.	G		594,3812	260.1+/-263.5	47,500,1656	50.0	51.0	51.0		211	5.5	1.0	20	dbSNP_86	51	816,7784	188.9+/-235.7	33,750,3517	no	coding-synonymous	FERMT1	NM_017671.4		80,1250,5173	AA,AG,GG		9.4884,13.4816,10.8412		71/678	6096632	1410,11596	2203	4300	6503	SO:0001819	synonymous_variant	55612	exon3			TTTTCAGAAGCCA	AK000123	CCDS13098.1	20p12.3	2013-01-10	2010-06-24	2007-12-14	ENSG00000101311	ENSG00000101311		"""Fermitins"", ""Pleckstrin homology (PH) domain containing"""	15889	protein-coding gene	gene with protein product	"""kindlin-1"", ""kinderlin"""	607900	"""chromosome 20 open reading frame 42"", ""fermitin family homolog 1 (Drosophila)"""	C20orf42		12697302, 12789646	Standard	NM_017671		Approved	FLJ20116, URP1, KIND1, UNC112A	uc002wmr.3	Q9BQL6	OTTHUMG00000031826	ENST00000217289.4:c.211C>T	20.37:g.6096632G>A		Somatic	90	0		WXS	Illumina GAIIx	Phase_I	70	4	NM_017671	0	0	0	0	0	D3DW10|Q8IX34|Q8IYH2|Q9NWM2|Q9NXQ3	Silent	SNP	ENST00000217289.4	37	CCDS13098.1																																																																																			G|0.894;A|0.106		0.468	FERMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077908.2	NM_017671	
RRBP1	6238	hgsc.bcm.edu	37	20	17602360	17602360	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr20:17602360G>T	ENST00000377813.1	-	15	3602	c.3299C>A	c.(3298-3300)cCg>cAg	p.P1100Q	RRBP1_ENST00000455029.2_Missense_Mutation_p.P441Q|RRBP1_ENST00000246043.4_Missense_Mutation_p.P1100Q|RRBP1_ENST00000377807.2_Missense_Mutation_p.P667Q|RRBP1_ENST00000360807.4_Missense_Mutation_p.P667Q|RRBP1_ENST00000470422.1_5'UTR			Q9P2E9	RRBP1_HUMAN	ribosome binding protein 1	1100					osteoblast differentiation (GO:0001649)|protein transport (GO:0015031)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|receptor activity (GO:0004872)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|prostate(6)	28						GGGAGCTGGCGGGTGCTTCAG	0.612																																					p.P667Q		.											.	RRBP1-92	0			c.C2000A						.						26.0	31.0	29.0					20																	17602360		2203	4300	6503	SO:0001583	missense	6238	exon15			GCTGGCGGGTGCT	AB037819	CCDS13128.1	20p12	2012-12-07	2012-12-07		ENSG00000125844	ENSG00000125844			10448	protein-coding gene	gene with protein product		601418	"""ribosome binding protein 1 (dog 180kD homolog)"", ""ribosome binding protein 1 homolog 180kDa (dog)"""			8812507	Standard	NM_001042576		Approved	ES/130, hES	uc002wpw.1	Q9P2E9	OTTHUMG00000031945	ENST00000377813.1:c.3299C>A	20.37:g.17602360G>T	ENSP00000367044:p.Pro1100Gln	Somatic	43	0		WXS	Illumina GAIIx	Phase_I	66	4	NM_004587	0	0	287	287	0	A2A2S6|A6NCN6|O75300|O75301|Q5W165|Q96SB2|Q9BWP1|Q9H476	Missense_Mutation	SNP	ENST00000377813.1	37		.	.	.	.	.	.	.	.	.	.	G	4.118	0.020016	0.08006	.	.	ENSG00000125844	ENST00000360807;ENST00000377813;ENST00000377807;ENST00000246043;ENST00000455029	T;T;T;T;T	0.30448	1.53;1.53;1.53;1.53;1.53	5.14	-4.59	0.03400	.	0.716381	0.11540	N	0.553812	T	0.18002	0.0432	L	0.39898	1.24	0.19300	N	0.999978	P;B;B	0.47545	0.897;0.142;0.011	P;B;B	0.45449	0.481;0.014;0.011	T	0.23048	-1.0199	10	0.13108	T	0.6	-2.9984	1.3732	0.02215	0.4432:0.1146:0.2531:0.1891	.	624;667;1100	A1A5C4;Q9P2E9-3;Q9P2E9	.;.;RRBP1_HUMAN	Q	667;1100;667;1100;441	ENSP00000354045:P667Q;ENSP00000367044:P1100Q;ENSP00000367038:P667Q;ENSP00000246043:P1100Q;ENSP00000401206:P441Q	ENSP00000246043:P1100Q	P	-	2	0	RRBP1	17550360	0.001000	0.12720	0.001000	0.08648	0.046000	0.14306	-0.042000	0.12063	-0.453000	0.07076	0.561000	0.74099	CCG	.		0.612	RRBP1-002	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000078125.1	NM_001042576	
ERGIC3	51614	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	34129865	34129865	+	Silent	SNP	C	C	T			TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr20:34129865C>T	ENST00000348547.2	+	1	96	c.19C>T	c.(19-21)Ctg>Ttg	p.L7L	ERGIC3_ENST00000279052.6_Silent_p.L7L|ERGIC3_ENST00000357394.4_Silent_p.L7L|ERGIC3_ENST00000447986.1_Silent_p.L7L	NM_015966.2	NP_057050.1	Q9Y282	ERGI3_HUMAN	ERGIC and golgi 3	7					vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)	16	Lung NSC(9;0.00489)|all_lung(11;0.00729)		BRCA - Breast invasive adenocarcinoma(18;0.0127)			GCTGGGGAAGCTGAAGCAGTT	0.701																																					p.L7L		.											.	ERGIC3-585	0			c.C19T						.						12.0	14.0	14.0					20																	34129865		2191	4268	6459	SO:0001819	synonymous_variant	51614	exon1			GGGAAGCTGAAGC	AF077030	CCDS13257.1, CCDS13258.1	20q11.22	2013-09-19	2006-01-19	2006-01-19	ENSG00000125991	ENSG00000125991			15927	protein-coding gene	gene with protein product			"""serologically defined breast cancer antigen 84"", ""chromosome 20 open reading frame 47"""	SDBCAG84, C20orf47		10810093	Standard	NM_015966		Approved	CGI-54, PRO0989, NY-BR-84, Erv46	uc002xcs.3	Q9Y282	OTTHUMG00000032346	ENST00000348547.2:c.19C>T	20.37:g.34129865C>T		Somatic	38	0		WXS	Illumina GAIIx	Phase_I	137	55	NM_015966	0	0	103	181	78	Q5JWS3|Q6ZWP7|Q9H276|Q9P1L3	Silent	SNP	ENST00000348547.2	37	CCDS13257.1																																																																																			.		0.701	ERGIC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078880.2	NM_015966	
DDX27	55661	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	47855847	47855847	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr20:47855847G>C	ENST00000371764.4	+	16	1971	c.1962G>C	c.(1960-1962)caG>caC	p.Q654H	DDX27_ENST00000484427.1_3'UTR|ZNFX1_ENST00000469991.1_Intron|ZNFX1_ENST00000371754.4_Intron	NM_017895.7	NP_060365.7	Q96GQ7	DDX27_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 27	654						nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(12)|lung(19)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	45			BRCA - Breast invasive adenocarcinoma(12;0.000899)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			GCTGGTTCCAGACCAAAGAAG	0.493																																					p.Q654H		.											.	DDX27-537	0			c.G1962C						.						42.0	42.0	42.0					20																	47855847		2203	4300	6503	SO:0001583	missense	55661	exon16			GTTCCAGACCAAA	AL049766	CCDS13416.1	20q13.13	2010-07-06	2003-06-13		ENSG00000124228	ENSG00000124228		"""DEAD-boxes"""	15837	protein-coding gene	gene with protein product			"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 27"""				Standard	NM_017895		Approved	dJ686N3.1, DRS1	uc002xuh.3	Q96GQ7	OTTHUMG00000033072	ENST00000371764.4:c.1962G>C	20.37:g.47855847G>C	ENSP00000360828:p.Gln654His	Somatic	21	0		WXS	Illumina GAIIx	Phase_I	17	7	NM_017895	0	0	60	60	0	A0AVB6|B7ZLY1|Q5VXM7|Q8WYG4|Q969N7|Q96F57|Q96L97|Q9BWY9|Q9BXF0|Q9H990|Q9NWU3|Q9P0C2|Q9UGD6	Missense_Mutation	SNP	ENST00000371764.4	37	CCDS13416.1	.	.	.	.	.	.	.	.	.	.	G	18.94	3.728865	0.69074	.	.	ENSG00000124228	ENST00000371764	T	0.01665	4.7	5.51	4.56	0.56223	.	0.000000	0.85682	D	0.000000	T	0.10423	0.0255	M	0.87381	2.88	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.00171	-1.1959	10	0.72032	D	0.01	-29.762	8.5319	0.33340	0.1738:0.0:0.8262:0.0	.	654	Q96GQ7	DDX27_HUMAN	H	654	ENSP00000360828:Q654H	ENSP00000360828:Q654H	Q	+	3	2	DDX27	47289254	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	3.885000	0.56182	1.328000	0.45358	0.655000	0.94253	CAG	.		0.493	DDX27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080485.1		
RSPH14	27156	bcgsc.ca	37	22	23482460	23482460	+	Silent	SNP	A	A	G	rs4822360	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr22:23482460A>G	ENST00000216036.4	-	2	344	c.148T>C	c.(148-150)Ttg>Ctg	p.L50L	RTDR1_ENST00000406876.1_Silent_p.L50L	NM_014433.2	NP_055248.1	Q9UHP6	RTDR1_HUMAN		50								p.L50L(1)		breast(1)|endometrium(3)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	18	all_hematologic(9;0.0197)|Acute lymphoblastic leukemia(84;0.181)			READ - Rectum adenocarcinoma(21;0.175)		AGGTCACACAAGGCCATGAGG	0.577													G|||	2628	0.52476	0.6354	0.5706	5008	,	,		18083	0.4038		0.5547	False		,,,				2504	0.4366				p.L50L		.											.	RTDR1-516	1	Substitution - coding silent(1)	stomach(1)	c.T148C						.	G		2827,1579	493.4+/-362.7	899,1029,275	151.0	114.0	126.0		148	3.9	1.0	22	dbSNP_111	126	4819,3781	536.0+/-382.9	1365,2089,846	no	coding-synonymous	RTDR1	NM_014433.2		2264,3118,1121	GG,GA,AA		43.9651,35.8375,41.2117		50/349	23482460	7646,5360	2203	4300	6503	SO:0001819	synonymous_variant	27156	exon2			CACACAAGGCCAT																												ENST00000216036.4:c.148T>C	22.37:g.23482460A>G		Somatic	108	0		WXS	Illumina GAIIx	Phase_I	120	5	NM_014433	0	0	12	12	0		Silent	SNP	ENST00000216036.4	37	CCDS13803.1																																																																																			A|0.436;G|0.564		0.577	RTDR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319049.1		
NEFH	4744	hgsc.bcm.edu	37	22	29885594	29885594	+	Silent	SNP	A	A	T	rs79235463|rs200984527|rs267607533	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr22:29885594A>T	ENST00000310624.6	+	4	1998	c.1965A>T	c.(1963-1965)ccA>ccT	p.P655P		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	661	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						CCAAGTCCCCAGAGAAGGAAG	0.552																																					p.P655P		.											.	NEFH-90	0			c.A1965T						.						83.0	92.0	89.0					22																	29885594		2203	4300	6503	SO:0001819	synonymous_variant	4744	exon4			GTCCCCAGAGAAG		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1965A>T	22.37:g.29885594A>T		Somatic	353	0		WXS	Illumina GAIIx	Phase_I	394	54	NM_021076	0	0	21	21	0	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Silent	SNP	ENST00000310624.6	37	CCDS13858.1																																																																																			A|0.500;T|0.500		0.552	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
NEFH	4744	broad.mit.edu	37	22	29885599	29885604	+	In_Frame_Del	DEL	AGGAAG	AGGAAG	-	rs267607534|rs373980795|rs267607533|rs149571560|rs200984527|rs370803228		TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr22:29885599_29885604delAGGAAG	ENST00000310624.6	+	4	2003_2008	c.1970_1975delAGGAAG	c.(1969-1977)aaggaagag>aag	p.EE658del		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	664	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						TCCCCAGAGAAGGAAGAGGCCAAGTC	0.558																																					p.657_659del		.											.	NEFH-90	0			c.1970_1975del						.																																			SO:0001651	inframe_deletion	4744	exon4			CAGAGAAGGAAGA		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1970_1975delAGGAAG	22.37:g.29885599_29885604delAGGAAG	ENSP00000311997:p.Glu658_Glu659del	Somatic	367	0		WXS	Illumina GAIIx	Phase_I	398	32	NM_021076	0	0	0	0	0	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	In_Frame_Del	DEL	ENST00000310624.6	37	CCDS13858.1																																																																																			.		0.558	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
TRIOBP	11078	hgsc.bcm.edu	37	22	38122462	38122462	+	Missense_Mutation	SNP	A	A	G	rs739138	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr22:38122462A>G	ENST00000406386.3	+	7	4154	c.3899A>G	c.(3898-3900)cAc>cGc	p.H1300R		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	1300			H -> R (in dbSNP:rs739138).		actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					GGCCGCACCCACAGCCCTGGC	0.741													G|||	3010	0.601038	0.1944	0.5836	5008	,	,		13399	0.8859		0.7157	False		,,,				2504	0.7515				p.H1300R		.											.	TRIOBP-136	0			c.A3899G						.	G	ARG/HIS	1221,2235		265,691,772	4.0	6.0	5.0		3899	3.9	1.0	22	dbSNP_86	5	5694,1808		2238,1218,295	yes	missense	TRIOBP	NM_001039141.2	29	2503,1909,1067	GG,GA,AA		24.1002,35.3299,36.8954	benign	1300/2366	38122462	6915,4043	1728	3751	5479	SO:0001583	missense	11078	exon7			GCACCCACAGCCC	AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.3899A>G	22.37:g.38122462A>G	ENSP00000384312:p.His1300Arg	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	25	25	NM_001039141	0	0	0	0	0	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Missense_Mutation	SNP	ENST00000406386.3	37	CCDS43015.1	1409	0.6451465201465202	110	0.22357723577235772	222	0.6132596685082873	531	0.9283216783216783	546	0.7203166226912929	G	12.86	2.065195	0.36470	0.353299	0.758998	ENSG00000100106	ENST00000406386;ENST00000417174	T	0.11063	2.81	4.93	3.9	0.45041	.	.	.	.	.	T	0.00012	0.0000	N	0.01576	-0.805	0.09310	P	0.999999999370294	B	0.02656	0.0	B	0.01281	0.0	T	0.29671	-1.0004	8	0.02654	T	1	.	4.383	0.11304	0.2555:0.0:0.5874:0.1571	rs739138	1300	Q9H2D6	TARA_HUMAN	R	1300	ENSP00000384312:H1300R	ENSP00000384312:H1300R	H	+	2	0	TRIOBP	36452408	1.000000	0.71417	1.000000	0.80357	0.841000	0.47740	1.338000	0.33873	0.503000	0.28060	-0.366000	0.07423	CAC	A|0.354;G|0.646		0.741	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319439.2		
TTLL3	26140	bcgsc.ca	37	3	9867625	9867625	+	Silent	SNP	C	C	T	rs3732527	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr3:9867625C>T	ENST00000547186.1	+	8	1083	c.867C>T	c.(865-867)cgC>cgT	p.R289R	TTLL3_ENST00000430793.1_Silent_p.R77R|TTLL3_ENST00000427853.3_Silent_p.R77R|TTLL3_ENST00000426895.4_Silent_p.R432R|TTLL3_ENST00000466245.1_3'UTR|TTLL3_ENST00000383827.1_Silent_p.R77R|TTLL3_ENST00000397241.1_Silent_p.R77R|ARPC4-TTLL3_ENST00000397256.1_Silent_p.R350R|TTLL3_ENST00000455274.1_Silent_p.R77R	NM_001025930.3	NP_001021100.3	Q9Y4R7	TTLL3_HUMAN	tubulin tyrosine ligase-like family, member 3	289	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				axoneme assembly (GO:0035082)|cilium assembly (GO:0042384)|protein polyglycylation (GO:0018094)	axoneme (GO:0005930)|cilium (GO:0005929)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	protein-glycine ligase activity (GO:0070735)|protein-glycine ligase activity, initiating (GO:0070736)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(2)|skin(1)	26	Medulloblastoma(99;0.227)					CCAAGTCCCGCGGACGAGGTG	0.582													C|||	2371	0.473442	0.5567	0.4438	5008	,	,		21444	0.2093		0.7167	False		,,,				2504	0.4039				p.R432R		.											.	TTLL3-585	0			c.C1296T						.	C	,	2565,1841	635.0+/-396.3	743,1079,381	65.0	59.0	61.0		1296,1050	-6.5	1.0	3	dbSNP_107	61	5862,2738	680.3+/-403.6	2021,1820,459	no	coding-synonymous,coding-synonymous	TTLL3,ARPC4-TTLL3	NM_001025930.3,NM_001198793.1	,	2764,2899,840	TT,TC,CC		31.8372,41.7839,35.2068	,	432/916,350/626	9867625	8427,4579	2203	4300	6503	SO:0001819	synonymous_variant	26140	exon8			GTCCCGCGGACGA		CCDS43048.1, CCDS43048.2	3p25.3	2013-02-14			ENSG00000214021	ENSG00000214021		"""Tubulin tyrosine ligase-like family"""	24483	protein-coding gene	gene with protein product						11054573	Standard	NR_037162		Approved	DKFZP434B103, HOTTL	uc003btg.4	Q9Y4R7	OTTHUMG00000128439	ENST00000547186.1:c.867C>T	3.37:g.9867625C>T		Somatic	503	3		WXS	Illumina GAIIx	Phase_I	354	9	NM_001025930	0	0	0	0	0	Q4KMS8|Q6AWA3|Q6ZU95|Q8NDN8|Q96GG8|Q9H876|Q9UI99	Silent	SNP	ENST00000547186.1	37		1128	0.5164835164835165	270	0.5487804878048781	180	0.4972375690607735	122	0.21328671328671328	556	0.7335092348284961	C	6.449	0.450910	0.12223	0.582161	0.681628	ENSG00000214021	ENST00000310252	T	0.10382	2.88	4.75	-6.5	0.01884	.	0.000000	0.64402	U	0.000001	T	0.00012	0.0000	.	.	.	0.09310	P	1.0	.	.	.	.	.	.	T	0.39800	-0.9596	6	0.87932	D	0	.	0.834	0.01136	0.4278:0.1552:0.1534:0.2637	rs3732527;rs59387898;rs3732527	.	.	.	W	245	ENSP00000312148:R245W	ENSP00000312148:R245W	R	+	1	2	TTLL3	9842625	0.000000	0.05858	0.987000	0.45799	0.444000	0.32077	-2.495000	0.00971	-0.650000	0.05423	-1.165000	0.01757	CGG	C|0.418;T|0.582		0.582	TTLL3-203	KNOWN	basic	protein_coding	protein_coding		NM_001025930.2	
CTNNB1	1499	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	41266137	41266137	+	Missense_Mutation	SNP	C	C	T	rs121913409		TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr3:41266137C>T	ENST00000349496.5	+	3	414	c.134C>T	c.(133-135)tCt>tTt	p.S45F	CTNNB1_ENST00000453024.1_Missense_Mutation_p.S38F|CTNNB1_ENST00000396183.3_Missense_Mutation_p.S45F|CTNNB1_ENST00000405570.1_Missense_Mutation_p.S45F|CTNNB1_ENST00000396185.3_Missense_Mutation_p.S45F	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	45			Missing (in colorectal cancer). {ECO:0000269|PubMed:9065402}.|S -> F (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|S -> P (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.S45F(384)|p.S45del(53)|p.A5_A80del(53)|p.S45C(19)|p.S45Y(17)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.?(4)|p.W25_I140del(3)|p.T3_A126del(2)|p.S45_S47>C(2)|p.D32_S47del(2)|p.P44_S45del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.A5_Q143>E(1)|p.S37_G48>C(1)|p.A13_R151del(1)|p.H36_E53>L(1)|p.M14_S45del(1)|p.S45_G48del(1)|p.Q28_Q61del(1)|p.T41_N51del(1)|p.M1_A87del(1)|p.S45_L46del(1)|p.A20_N141del(1)|p.D11_Y142>H(1)|p.P44_N51del(1)|p.I35_K170del(1)|p.Y30_A97del(1)|p.T42_G48del(1)|p.S45_D58del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.S45fs*2(1)|p.T40_L46del(1)|p.A5_T59del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.H24_M131del(1)|p.S45E(1)|p.M8_A80del(1)|p.A5_E54del(1)|p.A21_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.A20_S111del(1)|p.T42_K49>Q(1)|p.Y30_A80del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		ACAGCTCCTTCTCTGAGTGGT	0.498	S45F(HCC15_LUNG)|S45F(LS180_LARGE_INTESTINE)	15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.S45F	Colon(6;3 56 14213 18255)	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	.	CTNNB1-24361	601	Substitution - Missense(421)|Deletion - In frame(152)|Complex - deletion inframe(20)|Unknown(7)|Deletion - Frameshift(1)	soft_tissue(233)|liver(141)|large_intestine(85)|kidney(74)|endometrium(16)|skin(11)|adrenal_gland(9)|stomach(7)|biliary_tract(5)|ovary(4)|lung(3)|central_nervous_system(2)|cervix(2)|small_intestine(2)|haematopoietic_and_lymphoid_tissue(2)|urinary_tract(1)|pituitary(1)|prostate(1)|bone(1)|pancreas(1)	c.C134T						.						84.0	74.0	77.0					3																	41266137		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	CTCCTTCTCTGAG	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.134C>T	3.37:g.41266137C>T	ENSP00000344456:p.Ser45Phe	Somatic	151	0		WXS	Illumina GAIIx	Phase_I	96	77	NM_001098209	0	0	1	45	44	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	37	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.569754	0.86439	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.52057	0.68;0.68;0.68;0.68;0.68;0.68;0.68;0.68;0.68	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.68165	0.2971	M	0.65677	2.01	0.80722	D	1	D	0.67145	0.996	D	0.64687	0.928	T	0.68895	-0.5288	10	0.87932	D	0	-13.6823	20.2983	0.98569	0.0:1.0:0.0:0.0	.	45	P35222	CTNB1_HUMAN	F	38;45;45;45;45;38;45;45;45	ENSP00000400508:S38F;ENSP00000385604:S45F;ENSP00000412219:S45F;ENSP00000379486:S45F;ENSP00000344456:S45F;ENSP00000411226:S38F;ENSP00000379488:S45F;ENSP00000409302:S45F;ENSP00000401599:S45F	ENSP00000344456:S45F	S	+	2	0	CTNNB1	41241141	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.802000	0.96397	0.655000	0.94253	TCT	.		0.498	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
LRIG1	26018	hgsc.bcm.edu	37	3	66550756	66550756	+	Missense_Mutation	SNP	G	G	C	rs1403625	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr3:66550756G>C	ENST00000273261.3	-	1	600	c.76C>G	c.(76-78)Ctt>Gtt	p.L26V	LRIG1_ENST00000383703.3_Missense_Mutation_p.L26V	NM_015541.2	NP_056356.2	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like domains 1	26				LLL -> VLV (in Ref. 1; AAK62357 and 3; AAH71561). {ECO:0000305}.	innervation (GO:0060384)|otolith morphogenesis (GO:0032474)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)				NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(4)|stomach(4)|urinary_tract(1)	42		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		TCCAGCCGAAGCAAAAGCAGC	0.761													g|||	3605	0.719848	0.1808	0.8833	5008	,	,		8093	0.8284		0.9732	False		,,,				2504	0.9601				p.L26V		.											.	LRIG1-230	0			c.C76G						.		VAL/LEU	1298,1386		255,788,299	3.0	4.0	4.0		76	2.9	0.5	3	dbSNP_88	4	5191,89		2555,81,4	yes	missense	LRIG1	NM_015541.2	32	2810,869,303	CC,CG,GG		1.6856,48.3607,18.5208	benign	26/1094	66550756	6489,1475	1342	2640	3982	SO:0001583	missense	26018	exon1			GCCGAAGCAAAAG	AB050468	CCDS33783.1	3p14	2013-01-14			ENSG00000144749	ENSG00000144749		"""Immunoglobulin superfamily / I-set domain containing"""	17360	protein-coding gene	gene with protein product	"""ortholog of mouse integral membrane glycoprotein LIG-1"", ""leucine-rich repeat protein LRIG1"""	608868				11414704, 12234026	Standard	NM_015541		Approved	LIG-1, DKFZP586O1624, LIG1	uc003dmx.3	Q96JA1	OTTHUMG00000158727	ENST00000273261.3:c.76C>G	3.37:g.66550756G>C	ENSP00000273261:p.Leu26Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_015541	0	0	0	0	0	Q6IQ51|Q96CF9|Q9BYB8|Q9UFI4	Missense_Mutation	SNP	ENST00000273261.3	37	CCDS33783.1	1666	0.7628205128205128	118	0.23983739837398374	325	0.8977900552486188	489	0.8548951048951049	734	0.9683377308707124	g	6.572	0.473779	0.12521	0.483607	0.983144	ENSG00000144749	ENST00000273261;ENST00000383703	T;T	0.67345	-0.26;-0.13	3.84	2.93	0.34026	.	0.847359	0.09512	U	0.792175	T	0.00012	0.0000	N	0.19112	0.55	0.80722	P	0.0	P;P	0.44139	0.827;0.484	B;B	0.37731	0.257;0.096	T	0.48854	-0.8998	9	0.23302	T	0.38	.	8.6883	0.34251	0.1185:0.0:0.8815:0.0	rs1403625;rs13083628	26;26	Q96JA1-2;Q96JA1	.;LRIG1_HUMAN	V	26	ENSP00000273261:L26V;ENSP00000373208:L26V	ENSP00000273261:L26V	L	-	1	0	LRIG1	66633446	.	.	0.520000	0.27837	0.020000	0.10135	.	.	1.845000	0.53610	0.472000	0.43445	CTT	G|0.237;C|0.763		0.761	LRIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351930.1	NM_015541	
LRIG1	26018	hgsc.bcm.edu	37	3	66550762	66550762	+	Missense_Mutation	SNP	G	G	C	rs1403626	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr3:66550762G>C	ENST00000273261.3	-	1	594	c.70C>G	c.(70-72)Ctt>Gtt	p.L24V	LRIG1_ENST00000383703.3_Missense_Mutation_p.L24V	NM_015541.2	NP_056356.2	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like domains 1	24			L -> V (in dbSNP:rs1403626).	LLL -> VLV (in Ref. 1; AAK62357 and 3; AAH71561). {ECO:0000305}.	innervation (GO:0060384)|otolith morphogenesis (GO:0032474)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)				NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(4)|stomach(4)|urinary_tract(1)	42		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		CGAAGCAAAAGCAGCCAGAGA	0.766													g|||	3605	0.719848	0.1808	0.8833	5008	,	,		8368	0.8284		0.9732	False		,,,				2504	0.9601				p.L24V		.											.	LRIG1-230	0			c.C70G						.		VAL/LEU	1309,1447		265,779,334	3.0	4.0	4.0		70	3.1	0.5	3	dbSNP_88	4	5325,93		2620,85,4	no	missense	LRIG1	NM_015541.2	32	2885,864,338	CC,CG,GG		1.7165,47.4964,18.8402	benign	24/1094	66550762	6634,1540	1378	2709	4087	SO:0001583	missense	26018	exon1			GCAAAAGCAGCCA	AB050468	CCDS33783.1	3p14	2013-01-14			ENSG00000144749	ENSG00000144749		"""Immunoglobulin superfamily / I-set domain containing"""	17360	protein-coding gene	gene with protein product	"""ortholog of mouse integral membrane glycoprotein LIG-1"", ""leucine-rich repeat protein LRIG1"""	608868				11414704, 12234026	Standard	NM_015541		Approved	LIG-1, DKFZP586O1624, LIG1	uc003dmx.3	Q96JA1	OTTHUMG00000158727	ENST00000273261.3:c.70C>G	3.37:g.66550762G>C	ENSP00000273261:p.Leu24Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_015541	0	0	0	0	0	Q6IQ51|Q96CF9|Q9BYB8|Q9UFI4	Missense_Mutation	SNP	ENST00000273261.3	37	CCDS33783.1	1670	0.7646520146520146	119	0.241869918699187	326	0.9005524861878453	488	0.8531468531468531	737	0.9722955145118733	g	9.592	1.126319	0.20959	0.474964	0.982835	ENSG00000144749	ENST00000273261;ENST00000383703	T;T	0.68765	-0.35;-0.2	3.11	3.11	0.35812	.	0.429988	0.15146	U	0.278020	T	0.00012	0.0000	N	0.19112	0.55	0.39998	P	0.024872000000000005	P;B	0.36282	0.546;0.282	B;B	0.32465	0.146;0.069	T	0.40572	-0.9556	9	0.23891	T	0.37	.	12.0321	0.53403	0.0:0.0:1.0:0.0	rs1403626;rs13083630;rs1403626	24;24	Q96JA1-2;Q96JA1	.;LRIG1_HUMAN	V	24	ENSP00000273261:L24V;ENSP00000373208:L24V	ENSP00000273261:L24V	L	-	1	0	LRIG1	66633452	.	.	0.546000	0.28166	0.017000	0.09413	.	.	1.734000	0.51633	0.472000	0.43445	CTT	G|0.252;C|0.748		0.766	LRIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351930.1	NM_015541	
CRYBG3	131544	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	97596823	97596823	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr3:97596823C>T	ENST00000182096.4	+	1	1005	c.941C>T	c.(940-942)cCa>cTa	p.P314L		NM_153605.3	NP_705833.3	Q68DQ2	CRBG3_HUMAN	beta-gamma crystallin domain containing 3	2262							carbohydrate binding (GO:0030246)			breast(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(10)|stomach(1)|upper_aerodigestive_tract(2)	32						TTTCAGGAACCAGTGTCAAAA	0.358																																					p.P2262L		.											.	CRYBG3-68	0			c.C6785T						.						75.0	69.0	71.0					3																	97596823		1808	4079	5887	SO:0001583	missense	131544	exon4			AGGAACCAGTGTC			3q11.2	2008-09-30			ENSG00000080200	ENSG00000080200			34427	protein-coding gene	gene with protein product							Standard	NM_153605		Approved	DKFZp667G2110	uc021xbn.2	Q68DQ2	OTTHUMG00000159187	ENST00000182096.4:c.941C>T	3.37:g.97596823C>T	ENSP00000182096:p.Pro314Leu	Somatic	84	0		WXS	Illumina GAIIx	Phase_I	76	52	NM_153605	0	0	0	0	0	B4DLE8|F6VHI2|Q4G0V8|Q7Z4R9|Q86VD0|Q8N262|Q8N7F1|Q8NDQ8	Missense_Mutation	SNP	ENST00000182096.4	37		.	.	.	.	.	.	.	.	.	.	C	14.41	2.528380	0.44969	.	.	ENSG00000080200	ENST00000182096	T	0.73469	-0.75	5.9	5.9	0.94986	.	0.634579	0.15443	N	0.262110	T	0.72045	0.3412	L	0.29908	0.895	0.80722	D	1	D	0.61697	0.99	P	0.52554	0.702	T	0.72934	-0.4141	10	0.87932	D	0	.	10.5021	0.44813	0.0:0.9088:0.0:0.0912	.	314	Q68DQ2	CRBG3_HUMAN	L	314	ENSP00000182096:P314L	ENSP00000182096:P314L	P	+	2	0	CRYBG3	99079513	0.679000	0.27596	0.992000	0.48379	0.928000	0.56348	1.517000	0.35867	2.808000	0.96608	0.650000	0.86243	CCA	.		0.358	CRYBG3-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000353751.1	NM_153605	
SEMA5B	54437	hgsc.bcm.edu	37	3	122631896	122631896	+	Missense_Mutation	SNP	A	A	T	rs2276782	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr3:122631896A>T	ENST00000357599.3	-	18	2905	c.2519T>A	c.(2518-2520)gTc>gAc	p.V840D	SEMA5B_ENST00000195173.4_Missense_Mutation_p.V839D|SEMA5B_ENST00000451055.2_Missense_Mutation_p.V894D	NM_001031702.3|NM_001256348.1	NP_001026872.2|NP_001243277.1	Q9P283	SEM5B_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B	840			V -> D (in dbSNP:rs2276782). {ECO:0000269|PubMed:10819331, ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(13)|lung(26)|ovary(2)|pancreas(3)|skin(2)|upper_aerodigestive_tract(3)	55				GBM - Glioblastoma multiforme(114;0.0367)		GCGCAGGAGGACCTCCACCAG	0.791													T|||	3010	0.601038	0.5348	0.621	5008	,	,		11243	0.3522		0.8082	False		,,,				2504	0.7198				p.V894D		.											.	SEMA5B-157	0			c.T2681A						.	T	ASP/VAL	2573,1477		827,919,279	4.0	5.0	5.0		2519	5.0	1.0	3	dbSNP_100	5	6625,1195		2828,969,113	no	missense	SEMA5B	NM_001031702.2	152	3655,1888,392	TT,TA,AA		15.2813,36.4691,22.5105	benign	840/1152	122631896	9198,2672	2025	3910	5935	SO:0001583	missense	54437	exon18			AGGAGGACCTCCA	AB040878	CCDS35491.1, CCDS58848.1, CCDS74995.1	3q21.1	2008-07-18			ENSG00000082684	ENSG00000082684		"""Semaphorins"""	10737	protein-coding gene	gene with protein product		609298		SEMAG		8817451	Standard	NM_001256346		Approved	SemG, KIAA1445, FLJ10372	uc031sbm.1	Q9P283	OTTHUMG00000140392	ENST00000357599.3:c.2519T>A	3.37:g.122631896A>T	ENSP00000350215:p.Val840Asp	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_001256347	0	0	0	0	0	A8K5U2|B7Z393|F8W9U8|Q6DD89|Q6UY12|Q9NW17	Missense_Mutation	SNP	ENST00000357599.3	37	CCDS35491.1	1286	0.5888278388278388	247	0.5020325203252033	243	0.6712707182320442	193	0.3374125874125874	603	0.7955145118733509	T	5.344	0.248763	0.10130	0.635309	0.847187	ENSG00000082684	ENST00000357599;ENST00000195173;ENST00000418793;ENST00000451055;ENST00000393583	T;T;T;T	0.34072	1.43;1.38;1.48;1.5	5.01	5.01	0.66863	.	0.161766	0.52532	N	0.000069	T	0.00012	0.0000	N	0.00246	-1.78	0.30182	P	0.8002819999999999	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.39354	-0.9618	9	0.02654	T	1	.	10.6514	0.45651	0.1435:0.0:0.0:0.8565	rs2276782	782;840	D3YTI7;Q9P283	.;SEM5B_HUMAN	D	840;839;782;894;840	ENSP00000350215:V840D;ENSP00000195173:V839D;ENSP00000389588:V894D;ENSP00000377208:V840D	ENSP00000195173:V839D	V	-	2	0	SEMA5B	124114586	1.000000	0.71417	0.990000	0.47175	0.785000	0.44390	4.886000	0.63149	0.945000	0.37605	-0.257000	0.10917	GTC	T|0.412;A|0.588		0.791	SEMA5B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000277165.1	NM_001031702	
TSC22D2	9819	hgsc.bcm.edu	37	3	150128392	150128392	+	Missense_Mutation	SNP	G	G	A	rs879634	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr3:150128392G>A	ENST00000361875.3	+	1	2271	c.1255G>A	c.(1255-1257)Gct>Act	p.A419T	TSC22D2_ENST00000361136.2_Missense_Mutation_p.A419T	NM_014779.2	NP_055594.1	O75157	T22D2_HUMAN	TSC22 domain family, member 2	419			A -> T (in dbSNP:rs879634).		response to osmotic stress (GO:0006970)		sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	18			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			CGGCCAGAATGCTTCCTCGGT	0.771													G|||	952	0.190096	0.2224	0.1657	5008	,	,		13018	0.0407		0.2724	False		,,,				2504	0.2331				p.A419T		.											.	TSC22D2-91	0			c.G1255A						.	G	THR/ALA	435,2751		29,377,1187	2.0	3.0	3.0		1255	1.5	0.0	3	dbSNP_86	3	1458,5444		170,1118,2163	yes	missense	TSC22D2	NM_014779.2	58	199,1495,3350	AA,AG,GG		21.1243,13.6535,18.7649	benign	419/781	150128392	1893,8195	1593	3451	5044	SO:0001583	missense	9819	exon1			CAGAATGCTTCCT	AB014569	CCDS3149.1	3q25.1	2005-03-01			ENSG00000196428	ENSG00000196428			29095	protein-coding gene	gene with protein product						9734811	Standard	NM_014779		Approved	KIAA0669, TILZ4a, TILZ4b, TILZ4c	uc003exv.3	O75157	OTTHUMG00000159744	ENST00000361875.3:c.1255G>A	3.37:g.150128392G>A	ENSP00000354543:p.Ala419Thr	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	9	NM_014779	0	0	1	3	2	D3DNI5|Q6PI50|Q9H2Z6|Q9H2Z7|Q9H2Z8	Missense_Mutation	SNP	ENST00000361875.3	37	CCDS3149.1	433	0.19826007326007325	126	0.25609756097560976	72	0.19889502762430938	23	0.04020979020979021	212	0.2796833773087071	G	1.438	-0.568481	0.03910	0.136535	0.211243	ENSG00000196428	ENST00000361875;ENST00000361136	T;T	0.30182	1.54;1.54	3.57	1.47	0.22746	.	0.687211	0.12935	N	0.427041	T	0.00012	0.0000	N	0.19112	0.55	0.80722	P	0.0	B;B	0.10296	0.003;0.001	B;B	0.09377	0.004;0.002	T	0.33599	-0.9862	9	0.51188	T	0.08	.	6.993	0.24765	0.0:0.4503:0.379:0.1707	rs879634;rs3749399;rs58335631	419;419	O75157-2;O75157	.;T22D2_HUMAN	T	419	ENSP00000354543:A419T;ENSP00000354893:A419T	ENSP00000354893:A419T	A	+	1	0	TSC22D2	151611082	0.002000	0.14202	0.001000	0.08648	0.002000	0.02628	0.305000	0.19254	0.805000	0.34159	0.557000	0.71058	GCT	G|0.797;A|0.203		0.771	TSC22D2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000357123.2	NM_014779	
SPON2	10417	bcgsc.ca	37	4	1165748	1165748	+	Missense_Mutation	SNP	T	T	C	rs6836335	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr4:1165748T>C	ENST00000290902.5	-	2	444	c.112A>G	c.(112-114)Aga>Gga	p.R38G	SPON2_ENST00000431380.1_Missense_Mutation_p.R38G	NM_012445.3	NP_036577	Q9BUD6	SPON2_HUMAN	spondin 2, extracellular matrix protein	38	Spondin. {ECO:0000255|PROSITE- ProRule:PRU00364}.		R -> G (in dbSNP:rs6836335).		axon guidance (GO:0007411)|cell adhesion (GO:0007155)|innate immune response (GO:0045087)	extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|pancreas(1)|skin(1)	9			OV - Ovarian serous cystadenocarcinoma(23;0.00805)	UCEC - Uterine corpus endometrioid carcinoma (64;0.139)|Colorectal(103;0.19)		GCCAGGGCTCTGGCGGAACAG	0.692													T|||	690	0.13778	0.2943	0.0994	5008	,	,		12371	0.001		0.1312	False		,,,				2504	0.1012				p.R38G		.											.	SPON2-90	0			c.A112G						.	T	GLY/ARG,GLY/ARG,GLY/ARG	1280,3118		190,900,1109	36.0	49.0	45.0		112,112,112	0.2	0.0	4	dbSNP_116	45	1039,7541		64,911,3315	yes	missense,missense,missense	SPON2	NM_001128325.2,NM_001199021.1,NM_012445.3	125,125,125	254,1811,4424	CC,CT,TT		12.1096,29.1041,17.8687	benign,benign,benign	38/332,38/332,38/332	1165748	2319,10659	2199	4290	6489	SO:0001583	missense	10417	exon2			GGGCTCTGGCGGA	AB027466	CCDS3347.1	4p16.3	2008-07-29			ENSG00000159674	ENSG00000159674			11253	protein-coding gene	gene with protein product	"""Mindin"", ""M-spondin"""	605918				10512675, 15094111	Standard	NM_012445		Approved	DIL1	uc003gco.4	Q9BUD6	OTTHUMG00000089002	ENST00000290902.5:c.112A>G	4.37:g.1165748T>C	ENSP00000290902:p.Arg38Gly	Somatic	72	0		WXS	Illumina GAIIx	Phase_I	324	9	NM_012445	0	0	0	0	0	D3DVN9|Q4W5N4|Q9ULW1	Missense_Mutation	SNP	ENST00000290902.5	37	CCDS3347.1	280	0.1282051282051282	139	0.28252032520325204	42	0.11602209944751381	1	0.0017482517482517483	98	0.12928759894459102	T	12.21	1.868543	0.32977	0.291041	0.121096	ENSG00000159674	ENST00000290902;ENST00000431380;ENST00000503765;ENST00000515004;ENST00000502483	T;T;T;T;T	0.32515	2.95;2.95;1.52;1.46;1.45	4.74	0.199	0.15175	Spondin, N-terminal (1);	0.838802	0.10780	N	0.634936	T	0.00012	0.0000	L	0.53249	1.67	0.54753	P	1.0999999999983245E-5	P;P;B	0.37688	0.605;0.459;0.28	B;B;B	0.36464	0.225;0.017;0.019	T	0.32079	-0.9920	9	0.25751	T	0.34	.	2.1123	0.03706	0.1008:0.322:0.2969:0.2803	rs6836335;rs6836335	38;38;38	D6RB12;D3DVN9;Q9BUD6	.;.;SPON2_HUMAN	G	38	ENSP00000290902:R38G;ENSP00000394832:R38G;ENSP00000424542:R38G;ENSP00000425871:R38G;ENSP00000422516:R38G	ENSP00000290902:R38G	R	-	1	2	SPON2	1155748	0.792000	0.28813	0.001000	0.08648	0.067000	0.16453	1.458000	0.35223	-0.012000	0.14223	0.334000	0.21626	AGA	T|0.847;C|0.153		0.692	SPON2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000202080.2		
CRIPAK	285464	hgsc.bcm.edu	37	4	1388755	1388755	+	Silent	SNP	C	C	G	rs373946226	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr4:1388755C>G	ENST00000324803.4	+	1	3416	c.456C>G	c.(454-456)ccC>ccG	p.P152P		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	152					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			CACACGTGCCCATGCGGAGTG	0.697													N|||	566	0.113019	0.0772	0.1657	5008	,	,		16075	0.0139		0.1441	False		,,,				2504	0.1943				p.P152P		.											.	CRIPAK-90	0			c.C456G						.						75.0	67.0	69.0					4																	1388755		2201	4282	6483	SO:0001819	synonymous_variant	285464	exon1			CGTGCCCATGCGG	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.456C>G	4.37:g.1388755C>G		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	169	52	NM_175918	0	0	35	110	75	Q8NB03	Silent	SNP	ENST00000324803.4	37	CCDS3349.1	.	.	.	.	.	.	.	.	.	.	-	3.606	-0.080629	0.07141	.	.	ENSG00000179979	ENST00000382944	.	.	.	0.948	-1.9	0.07665	.	.	.	.	.	T	0.13713	0.0332	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.26643	-1.0097	5	0.12430	T	0.62	.	2.6602	0.05024	0.0:0.3324:0.2607:0.407	.	.	.	.	D	136	.	ENSP00000372402:H136D	H	+	1	0	CRIPAK	1378755	0.000000	0.05858	0.001000	0.08648	0.018000	0.09664	-4.277000	0.00261	-0.599000	0.05798	-1.737000	0.00689	CAT	C|0.960;G|0.040		0.697	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
CCDC96	257236	hgsc.bcm.edu	37	4	7044357	7044357	+	Silent	SNP	A	A	G	rs871133	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr4:7044357A>G	ENST00000310085.4	-	1	371	c.309T>C	c.(307-309)gtT>gtC	p.V103V	TADA2B_ENST00000512388.1_5'Flank|RP11-367J11.2_ENST00000500031.1_RNA|TADA2B_ENST00000310074.7_5'Flank	NM_153376.2	NP_699207.1	Q2M329	CCD96_HUMAN	coiled-coil domain containing 96	103	Glu-rich.									endometrium(3)|kidney(1)|large_intestine(3)|lung(2)|skin(1)|urinary_tract(1)	11						CCTCAGCCCCAACCTCGGCCG	0.766													G|||	4833	0.965056	0.8979	0.9856	5008	,	,		11811	1.0		0.9702	False		,,,				2504	1.0				p.V103V		.											.	CCDC96-90	0			c.T309C						.	G		2893,205		1348,197,4	3.0	3.0	3.0		309	-4.5	0.0	4	dbSNP_86	3	6689,125		3282,125,0	no	coding-synonymous	CCDC96	NM_153376.2		4630,322,4	GG,GA,AA		1.8345,6.6172,3.3293		103/556	7044357	9582,330	1549	3407	4956	SO:0001819	synonymous_variant	257236	exon1			AGCCCCAACCTCG	AK075056	CCDS3395.1	4p16.1	2008-02-05			ENSG00000173013	ENSG00000173013			26900	protein-coding gene	gene with protein product							Standard	NM_153376		Approved	FLJ90575	uc003gjv.2	Q2M329	OTTHUMG00000125511	ENST00000310085.4:c.309T>C	4.37:g.7044357A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_153376	0	0	0	3	3	Q8N2I7	Silent	SNP	ENST00000310085.4	37	CCDS3395.1																																																																																			A|0.036;G|0.964		0.766	CCDC96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246838.1	NM_153376	
CCDC96	257236	hgsc.bcm.edu	37	4	7044380	7044380	+	Missense_Mutation	SNP	C	C	T	rs871134	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr4:7044380C>T	ENST00000310085.4	-	1	348	c.286G>A	c.(286-288)Gag>Aag	p.E96K	TADA2B_ENST00000512388.1_5'Flank|RP11-367J11.2_ENST00000500031.1_RNA|TADA2B_ENST00000310074.7_5'Flank	NM_153376.2	NP_699207.1	Q2M329	CCD96_HUMAN	coiled-coil domain containing 96	96	Glu-rich.		E -> K (in dbSNP:rs871134). {ECO:0000269|PubMed:15489334}.							endometrium(3)|kidney(1)|large_intestine(3)|lung(2)|skin(1)|urinary_tract(1)	11						TCTTCGGGCTCGGGCTGGGGC	0.776													C|||	2561	0.511382	0.3623	0.4741	5008	,	,		11435	0.6429		0.5845	False		,,,				2504	0.5286				p.E96K		.											.	CCDC96-90	0			c.G286A						.	C	LYS/GLU	1411,1153		409,593,280	2.0	2.0	2.0		286	2.2	0.0	4	dbSNP_86	2	3789,2017		1333,1123,447	no	missense	CCDC96	NM_153376.2	56	1742,1716,727	TT,TC,CC		34.7399,44.9688,37.8734	benign	96/556	7044380	5200,3170	1282	2903	4185	SO:0001583	missense	257236	exon1			CGGGCTCGGGCTG	AK075056	CCDS3395.1	4p16.1	2008-02-05			ENSG00000173013	ENSG00000173013			26900	protein-coding gene	gene with protein product							Standard	NM_153376		Approved	FLJ90575	uc003gjv.2	Q2M329	OTTHUMG00000125511	ENST00000310085.4:c.286G>A	4.37:g.7044380C>T	ENSP00000309285:p.Glu96Lys	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	6	5	NM_153376	0	0	1	2	1	Q8N2I7	Missense_Mutation	SNP	ENST00000310085.4	37	CCDS3395.1	1153	0.5279304029304029	172	0.34959349593495936	193	0.5331491712707183	349	0.6101398601398601	439	0.579155672823219	C	10.33	1.319932	0.23994	0.550312	0.652601	ENSG00000173013	ENST00000310085	T	0.54479	0.57	3.13	2.24	0.28232	.	0.882045	0.09267	N	0.825735	T	0.00012	0.0000	L	0.32530	0.975	0.45284	P	0.0017160000000000508	B	0.21147	0.052	B	0.09377	0.004	T	0.45585	-0.9251	9	0.14252	T	0.57	-0.0803	4.8536	0.13549	0.0:0.6921:0.0:0.3079	rs871134	96	Q2M329	CCD96_HUMAN	K	96	ENSP00000309285:E96K	ENSP00000309285:E96K	E	-	1	0	CCDC96	7095281	0.001000	0.12720	0.000000	0.03702	0.036000	0.12997	0.781000	0.26774	0.602000	0.29896	0.471000	0.43371	GAG	C|0.472;T|0.528		0.776	CCDC96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246838.1	NM_153376	
FAM184B	27146	hgsc.bcm.edu	37	4	17643848	17643848	+	Missense_Mutation	SNP	G	G	A	rs2286771	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr4:17643848G>A	ENST00000265018.3	-	13	2562	c.2350C>T	c.(2350-2352)Cgg>Tgg	p.R784W		NM_015688.1	NP_056503.1	Q9ULE4	F184B_HUMAN	family with sequence similarity 184, member B	784				R -> W (in Ref. 1; BAA86590). {ECO:0000305}.						NS(1)|central_nervous_system(1)|endometrium(1)|prostate(1)	4						GGGCCGCCCCGCTCCTGAGGA	0.701													G|||	2697	0.538538	0.1725	0.6599	5008	,	,		10215	0.8522		0.6233	False		,,,				2504	0.5368				p.R784W		.											.	FAM184B-23	0			c.C2350T						.						1.0	2.0	2.0					4																	17643848		374	1044	1418	SO:0001583	missense	27146	exon13			CGCCCCGCTCCTG		CCDS47033.1	4p16	2009-04-22			ENSG00000047662	ENSG00000047662			29235	protein-coding gene	gene with protein product						10574462	Standard	NM_015688		Approved	KIAA1276	uc003gpm.4	Q9ULE4	OTTHUMG00000160287	ENST00000265018.3:c.2350C>T	4.37:g.17643848G>A	ENSP00000265018:p.Arg784Trp	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	13	13	NM_015688	0	0	0	0	0		Missense_Mutation	SNP	ENST00000265018.3	37	CCDS47033.1	1272	0.5824175824175825	75	0.1524390243902439	232	0.6408839779005525	493	0.8618881118881119	472	0.6226912928759895	G	13.83	2.354233	0.41700	.	.	ENSG00000047662	ENST00000265018	T	0.34072	1.38	3.29	-3.67	0.04476	.	3.541600	0.00901	N	0.002342	T	0.00012	0.0000	N	0.14661	0.345	0.80722	P	0.0	D	0.56968	0.978	B	0.40741	0.339	T	0.48547	-0.9026	9	0.72032	D	0.01	2.0681	6.7491	0.23477	0.107:0.2547:0.5506:0.0877	rs2286771;rs58699512;rs2286771	784	Q9ULE4	F184B_HUMAN	W	784	ENSP00000265018:R784W	ENSP00000265018:R784W	R	-	1	2	FAM184B	17252946	0.000000	0.05858	0.000000	0.03702	0.516000	0.34256	-0.323000	0.07997	-1.014000	0.03379	-0.369000	0.07265	CGG	G|0.440;A|0.560		0.701	FAM184B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360137.1	NM_015688	
NMU	10874	hgsc.bcm.edu	37	4	56502307	56502307	+	Missense_Mutation	SNP	G	G	T	rs3828555	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr4:56502307G>T	ENST00000264218.3	-	1	158	c.53C>A	c.(52-54)gCg>gAg	p.A18E	NMU_ENST00000511469.1_Missense_Mutation_p.A18E|NMU_ENST00000515325.1_Intron|NMU_ENST00000507338.1_Missense_Mutation_p.A18E|NMU_ENST00000505262.1_Missense_Mutation_p.A18E	NM_006681.2	NP_006672.1	P48645	NMU_HUMAN	neuromedin U	18					digestion (GO:0007586)|eating behavior (GO:0042755)|G-protein coupled receptor signaling pathway (GO:0007186)|gastric acid secretion (GO:0001696)|neuropeptide signaling pathway (GO:0007218)|photoperiodism (GO:0009648)|positive regulation of hormone secretion (GO:0046887)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of synaptic transmission (GO:0050806)|regulation of smooth muscle contraction (GO:0006940)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|terminal bouton (GO:0043195)	receptor binding (GO:0005102)			lung(3)|ovary(1)|urinary_tract(1)	5	Lung NSC(11;0.00256)|all_epithelial(27;0.075)|Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.103)	LUSC - Lung squamous cell carcinoma(4;6.72e-08)|Lung(4;6.22e-07)|Epithelial(7;0.00559)	LUSC - Lung squamous cell carcinoma(721;0.0115)		cGGGGACGCCGCGGCCACCTG	0.761													G|||	730	0.145767	0.0764	0.2003	5008	,	,		10197	0.3343		0.0199	False		,,,				2504	0.136				p.A18E		.											.	NMU-650	0			c.C53A						.	G	GLU/ALA	168,3058		3,162,1448	5.0	7.0	6.0		53	0.1	0.0	4	dbSNP_107	6	138,5846		0,138,2854	no	missense	NMU	NM_006681.2	107	3,300,4302	TT,TG,GG		2.3061,5.2077,3.3225	probably-damaging	18/175	56502307	306,8904	1613	2992	4605	SO:0001583	missense	10874	exon1			GACGCCGCGGCCA	X76029	CCDS3501.1, CCDS75125.1	4q12	2013-02-26			ENSG00000109255	ENSG00000109255		"""Endogenous ligands"""	7859	protein-coding gene	gene with protein product	"""prepro-NMU"""	605103				7619205	Standard	XM_005265713		Approved		uc003hbc.3	P48645	OTTHUMG00000102161	ENST00000264218.3:c.53C>A	4.37:g.56502307G>T	ENSP00000264218:p.Ala18Glu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	20	13	NM_006681	0	0	0	1	1		Missense_Mutation	SNP	ENST00000264218.3	37	CCDS3501.1	315	0.14423076923076922	55	0.11178861788617886	55	0.15193370165745856	187	0.3269230769230769	18	0.023746701846965697	G	17.40	3.379938	0.61845	0.052077	0.023061	ENSG00000109255	ENST00000511469;ENST00000264218;ENST00000505262;ENST00000541393;ENST00000507338	T;T;T;T	0.35973	1.28;1.42;1.4;1.39	2.89	0.0796	0.14417	.	1.355690	0.05554	U	0.568010	T	0.00012	0.0000	N	0.22421	0.69	0.80722	P	0.0	P	0.38827	0.649	B	0.37015	0.239	T	0.31110	-0.9955	9	0.62326	D	0.03	-4.4644	5.3309	0.15932	0.4241:0.0:0.5759:0.0	rs3828555	18	P48645	NMU_HUMAN	E	18	ENSP00000422399:A18E;ENSP00000264218:A18E;ENSP00000424246:A18E;ENSP00000422870:A18E	ENSP00000264218:A18E	A	-	2	0	NMU	56197064	0.000000	0.05858	0.003000	0.11579	0.256000	0.26092	0.190000	0.17057	-0.022000	0.13986	0.195000	0.17529	GCG	G|0.853;T|0.147		0.761	NMU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220006.2		
ERAP1	51752	bcgsc.ca	37	5	96118852	96118852	+	Missense_Mutation	SNP	G	G	C	rs27044	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr5:96118852G>C	ENST00000443439.2	-	15	2254	c.2188C>G	c.(2188-2190)Caa>Gaa	p.Q730E	CTD-2260A17.1_ENST00000602972.1_RNA|ERAP1_ENST00000514604.1_5'UTR|CTD-2260A17.1_ENST00000512856.1_RNA|ERAP1_ENST00000296754.3_Missense_Mutation_p.Q730E	NM_001040458.1|NM_001198541.1	NP_001035548.1|NP_001185470.1	Q9NZ08	ERAP1_HUMAN	endoplasmic reticulum aminopeptidase 1	730			Q -> E (in dbSNP:rs27044). {ECO:0000269|PubMed:11481040, ECO:0000269|PubMed:12975309, ECO:0000269|PubMed:9628581, ECO:0000269|Ref.3}.		angiogenesis (GO:0001525)|antigen processing and presentation of endogenous peptide antigen via MHC class I (GO:0019885)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|fat cell differentiation (GO:0045444)|membrane protein ectodomain proteolysis (GO:0006509)|positive regulation of angiogenesis (GO:0045766)|regulation of blood pressure (GO:0008217)|regulation of innate immune response (GO:0045088)|response to bacterium (GO:0009617)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	aminopeptidase activity (GO:0004177)|interleukin-1, Type II receptor binding (GO:0005151)|interleukin-6 receptor binding (GO:0005138)|metalloexopeptidase activity (GO:0008235)|zinc ion binding (GO:0008270)			endometrium(7)|large_intestine(5)|lung(3)|ovary(1)|pancreas(1)|stomach(2)	19		all_cancers(142;1.75e-06)|all_epithelial(76;3.08e-09)|all_lung(232;0.000435)|Lung NSC(167;0.000601)|Ovarian(225;0.024)|Colorectal(57;0.0432)|Breast(839;0.244)		all cancers(79;7.26e-15)|COAD - Colon adenocarcinoma(37;0.071)		AGTAGTAGTTGACTCCGCAGC	0.527													G|||	3402	0.679313	0.711	0.6513	5008	,	,		18703	0.5714		0.7147	False		,,,				2504	0.7311				p.Q730E		.											.	ERAP1-70	0			c.C2188G						.	G	GLU/GLN,GLU/GLN,GLU/GLN	3111,1295	699.6+/-406.5	1086,939,178	185.0	158.0	167.0		2188,2188,2188	4.8	1.0	5	dbSNP_76	167	6094,2506	694.2+/-404.7	2152,1790,358	yes	missense,missense,missense	ERAP1	NM_001040458.1,NM_001198541.1,NM_016442.3	29,29,29	3238,2729,536	CC,CG,GG		29.1395,29.3917,29.225	benign,benign,benign	730/942,730/942,730/949	96118852	9205,3801	2203	4300	6503	SO:0001583	missense	51752	exon15			GTAGTTGACTCCG	AB011097	CCDS4085.1, CCDS47250.1	5q15	2014-04-07			ENSG00000164307	ENSG00000164307			18173	protein-coding gene	gene with protein product	"""aminopeptidase regulator of TNFR1 shedding"", ""adipocyte-derived leucine aminopeptidase"", ""puromycin-insensitive leucyl-specific aminopeptidase"""	606832				10220586, 12189246, 16286653	Standard	NM_001198541		Approved	ARTS-1, A-LAP, PILS-AP, KIAA0525, ERAAP1	uc003kml.3	Q9NZ08	OTTHUMG00000128721	ENST00000443439.2:c.2188C>G	5.37:g.96118852G>C	ENSP00000406304:p.Gln730Glu	Somatic	145	1		WXS	Illumina GAIIx	Phase_I	177	6	NM_001198541	0	0	6	6	0	O60278|Q6UWY6|Q8NEL4|Q8TAD0|Q9UHF8|Q9UKY2	Missense_Mutation	SNP	ENST00000443439.2	37	CCDS47250.1	1418	0.6492673992673993	333	0.676829268292683	235	0.649171270718232	310	0.541958041958042	540	0.712401055408971	G	0.087	-1.172807	0.01646	0.706083	0.708605	ENSG00000164307	ENST00000296754;ENST00000443439;ENST00000414384	T;T	0.05649	3.41;3.41	5.65	4.78	0.61160	.	0.411945	0.24044	N	0.042071	T	0.00012	0.0000	L	0.31207	0.915	0.49687	P	1.8700000000004824E-4	B;B	0.19706	0.022;0.038	B;B	0.21546	0.035;0.021	T	0.36114	-0.9761	9	0.02654	T	1	.	5.4578	0.16600	0.1771:0.1753:0.6476:0.0	rs27044;rs61102894;rs27044	730;730	Q9NZ08;Q9NZ08-2	ERAP1_HUMAN;.	E	730	ENSP00000296754:Q730E;ENSP00000406304:Q730E	ENSP00000296754:Q730E	Q	-	1	0	ERAP1	96144608	0.156000	0.22821	0.987000	0.45799	0.491000	0.33493	0.979000	0.29500	1.379000	0.46325	0.467000	0.42956	CAA	G|0.312;C|0.688		0.527	ERAP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370699.1	NM_016442	
PCDHB10	56126	broad.mit.edu	37	5	140574170	140574175	+	In_Frame_Del	DEL	AGGCCG	AGGCCG	-	rs58244182|rs140613424|rs140393827	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr5:140574170_140574175delAGGCCG	ENST00000239446.4	+	1	2229_2234	c.2045_2050delAGGCCG	c.(2044-2052)caggccgag>cag	p.AE683del		NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10	683					calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCCCAGGCCCAGGCCGAGGCCGACTT	0.704														2124	0.424121	0.4372	0.4971	5008	,	,		11585	0.5347		0.3658	False		,,,				2504	0.3006				p.682_684del		.											.	PCDHB10-92	0			c.2045_2050del						.			851,2755		246,359,1198						2.2	0.0		dbSNP_129	38	1442,5672		362,718,2477	no	coding	PCDHB10	NM_018930.3		608,1077,3675	A1A1,A1R,RR		20.2699,23.5996,21.3899				2293,8427				SO:0001651	inframe_deletion	56126	exon1			AGGCCCAGGCCGA	AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626	ENST00000239446.4:c.2045_2050delAGGCCG	5.37:g.140574176_140574181delAGGCCG	ENSP00000239446:p.Ala683_Glu684del	Somatic	7	0		WXS	Illumina GAIIx	Phase_I	87	15	NM_018930	0	0	0	0	0	Q96T99	In_Frame_Del	DEL	ENST00000239446.4	37	CCDS4252.1																																																																																			-|0.750;GGCCGA|0.250		0.704	PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251821.1	NM_018930	
ARL10	285598	hgsc.bcm.edu	37	5	175792605	175792605	+	Silent	SNP	G	G	C	rs2303667	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr5:175792605G>C	ENST00000310389.5	+	1	135	c.39G>C	c.(37-39)ctG>ctC	p.L13L	MIR1271_ENST00000408537.1_RNA	NM_173664.4	NP_775935.1	Q8N8L6	ARL10_HUMAN	ADP-ribosylation factor-like 10	13					small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	GTP binding (GO:0005525)			endometrium(2)|lung(1)|ovary(1)	4	all_cancers(89;0.0064)|Renal(175;0.000269)|Lung NSC(126;0.0105)|all_lung(126;0.0168)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	Kidney(146;0.0965)		TGCTGGCGCTGGGCGGCGCCG	0.756													G|||	2787	0.55651	0.5938	0.4928	5008	,	,		9772	0.5556		0.6093	False		,,,				2504	0.498				p.L13L		.											.	ARL10-91	0			c.G39C						.	G		1858,1528		603,652,438	3.0	4.0	3.0		39	3.2	0.8	5	dbSNP_100	3	4085,2705		1416,1253,726	no	coding-synonymous	ARL10	NM_173664.4		2019,1905,1164	CC,CG,GG		39.838,45.127,41.5979		13/245	175792605	5943,4233	1693	3395	5088	SO:0001819	synonymous_variant	285598	exon1			GGCGCTGGGCGGC	BK001673	CCDS4400.1	5q35.3	2014-05-09	2005-11-03	2005-11-03	ENSG00000175414	ENSG00000175414		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	22042	protein-coding gene	gene with protein product			"""ADP-ribosylation factor-like 10A"""	ARL10A			Standard	NM_173664		Approved		uc003mec.1	Q8N8L6	OTTHUMG00000130655	ENST00000310389.5:c.39G>C	5.37:g.175792605G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	11	11	NM_173664	0	0	0	0	0		Silent	SNP	ENST00000310389.5	37	CCDS4400.1																																																																																			G|0.585;C|0.415		0.756	ARL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253145.2	NM_173664	
TUBB	203068	broad.mit.edu	37	6	30691786	30691786	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr6:30691786T>A	ENST00000327892.8	+	4	1253	c.947T>A	c.(946-948)gTc>gAc	p.V316D	TUBB_ENST00000396389.1_Missense_Mutation_p.V298D|XXbac-BPG252P9.9_ENST00000607476.1_RNA|TUBB_ENST00000396384.1_Missense_Mutation_p.V244D|TUBB_ENST00000435534.1_Intron|TUBB_ENST00000330914.3_Missense_Mutation_p.V244D	NM_178014.2	NP_821133.1	P07437	TBB5_HUMAN	tubulin, beta class I	316					cell division (GO:0051301)|cellular component movement (GO:0006928)|cellular process (GO:0009987)|cytoskeleton-dependent intracellular transport (GO:0030705)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based process (GO:0007017)|mitotic cell cycle (GO:0000278)|natural killer cell mediated cytotoxicity (GO:0042267)|protein polymerization (GO:0051258)|spindle assembly (GO:0051225)	cell body (GO:0044297)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nuclear envelope lumen (GO:0005641)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|MHC class I protein binding (GO:0042288)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			breast(1)|endometrium(1)|kidney(8)|large_intestine(3)|lung(1)|ovary(1)|urinary_tract(1)	16					Colchicine(DB01394)|Podofilox(DB01179)|Vinblastine(DB00570)|Vincristine(DB00541)|Vinorelbine(DB00361)	GTGGCTGCTGTCTTCCGTGGT	0.562																																					p.V316D		.											.	TUBB-91	0			c.T947A						.						68.0	66.0	67.0					6																	30691786		2203	4300	6503	SO:0001583	missense	203068	exon4			CTGCTGTCTTCCG	AB062393	CCDS4687.1	6p21.33	2011-10-10	2011-10-10		ENSG00000196230	ENSG00000196230		"""Tubulins"""	20778	protein-coding gene	gene with protein product	"""class I beta-tubulin"", ""beta1-tubulin"""	191130	"""tubulin, beta polypeptide"", ""tubulin, beta"""			11504633, 8270253	Standard	NM_001293212		Approved	OK/SW-cl.56, MGC16435, M40, Tubb5	uc003nrl.3	P07437	OTTHUMG00000031059	ENST00000327892.8:c.947T>A	6.37:g.30691786T>A	ENSP00000339001:p.Val316Asp	Somatic	104	1		WXS	Illumina GAIIx	Phase_I	80	5	NM_178014	3	0	474	477	0	P05218|Q8WUC1|Q9CY33	Missense_Mutation	SNP	ENST00000327892.8	37	CCDS4687.1	.	.	.	.	.	.	.	.	.	.	T	14.47	2.544630	0.45280	.	.	ENSG00000196230	ENST00000327892;ENST00000422827;ENST00000330914;ENST00000396389;ENST00000396384;ENST00000538863	D;D;D;D	0.82167	-1.58;-1.58;-1.58;-1.58	4.4	4.4	0.53042	Tubulin/FtsZ, 2-layer sandwich domain (3);Tubulin/FtsZ, C-terminal (1);	0.140485	0.47093	D	0.000254	D	0.86669	0.5988	M	0.72118	2.19	0.80722	D	1	P;P	0.43094	0.799;0.468	P;P	0.61874	0.895;0.817	D	0.88464	0.3057	10	0.87932	D	0	.	11.6193	0.51108	0.0:0.0:0.0:1.0	.	316;316	P07437;F8VW92	TBB5_HUMAN;.	D	316;225;244;298;244;170	ENSP00000339001:V316D;ENSP00000365578:V244D;ENSP00000379672:V298D;ENSP00000379668:V244D	ENSP00000339001:V316D	V	+	2	0	TUBB	30799765	1.000000	0.71417	0.996000	0.52242	0.858000	0.48976	7.585000	0.82584	1.851000	0.53745	0.482000	0.46254	GTC	.		0.562	TUBB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076074.2	NM_178014	
DAXX	1616	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	33288323	33288323	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr6:33288323C>G	ENST00000374542.5	-	4	1289	c.1085G>C	c.(1084-1086)cGg>cCg	p.R362P	ZBTB22_ENST00000418724.1_5'Flank|ZBTB22_ENST00000431845.2_5'Flank|DAXX_ENST00000414083.2_Missense_Mutation_p.R287P|DAXX_ENST00000266000.6_Missense_Mutation_p.R362P|DAXX_ENST00000477162.1_5'UTR	NM_001141969.1|NM_001141970.1|NM_001350.4	NP_001135441.1|NP_001135442.1|NP_001341.1	Q9UER7	DAXX_HUMAN	death-domain associated protein	362	Interaction with histone H3.3.|Necessary for interaction with USP7.				activation of JUN kinase activity (GO:0007257)|androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|chromatin remodeling (GO:0006338)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|mitotic cytokinesis (GO:0000281)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of neuron death (GO:1901216)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein phosphorylation (GO:0001934)|regulation of protein ubiquitination (GO:0031396)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|PML body (GO:0016605)|SWI/SNF superfamily-type complex (GO:0070603)	androgen receptor binding (GO:0050681)|enzyme binding (GO:0019899)|heat shock protein binding (GO:0031072)|histone binding (GO:0042393)|p53 binding (GO:0002039)|protein homodimerization activity (GO:0042803)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|receptor signaling protein activity (GO:0005057)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(2)|lung(7)|ovary(3)|pancreas(18)|prostate(3)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	55						CCGGTTTTCCCGAAGGCGCCG	0.512			"""Mis, F, N"""		Pancreatic neuroendocrine tumors. Paediatric GBM																																p.R374P		.		Rec	yes		6	6p21.3	1616	death-domain associated protein		E	.	DAXX-731	0			c.G1121C						.						62.0	61.0	62.0					6																	33288323		2203	4300	6503	SO:0001583	missense	1616	exon4			TTTTCCCGAAGGC	AF006041	CCDS4776.1, CCDS59008.1	6p21.3	2008-08-29	2008-08-29			ENSG00000204209			2681	protein-coding gene	gene with protein product		603186	"""death-associated protein 6"""			9407001, 9215629	Standard	NM_001141970		Approved	DAP6	uc011dre.2	Q9UER7		ENST00000374542.5:c.1085G>C	6.37:g.33288323C>G	ENSP00000363668:p.Arg362Pro	Somatic	26	0		WXS	Illumina GAIIx	Phase_I	21	15	NM_001141970	0	0	3	43	40	B4E1I3|F5H082|O14747|O15141|O15208|Q5STK9|Q9BWI3	Missense_Mutation	SNP	ENST00000374542.5	37	CCDS4776.1	.	.	.	.	.	.	.	.	.	.	C	17.09	3.301027	0.60195	.	.	ENSG00000204209	ENST00000266000;ENST00000374542;ENST00000414083	.	.	.	4.56	3.69	0.42338	.	0.058667	0.64402	D	0.000002	T	0.68943	0.3056	M	0.75264	2.295	0.52501	D	0.999957	D;D;D	0.76494	0.992;0.999;0.999	D;D;D	0.74023	0.972;0.982;0.982	T	0.73626	-0.3923	9	0.87932	D	0	-8.6865	10.1681	0.42893	0.0:0.9026:0.0:0.0974	.	374;362;362	B4E1C1;B2R7M0;Q9UER7	.;.;DAXX_HUMAN	P	362;362;287	.	ENSP00000266000:R362P	R	-	2	0	DAXX	33396301	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.401000	0.59716	1.154000	0.42482	0.643000	0.83706	CGG	.		0.512	DAXX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076403.1		
KCNK17	89822	hgsc.bcm.edu	37	6	39282036	39282036	+	Missense_Mutation	SNP	T	T	C	rs10947804	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr6:39282036T>C	ENST00000373231.4	-	1	293	c.61A>G	c.(61-63)Agc>Ggc	p.S21G	KCNK17_ENST00000453413.2_Missense_Mutation_p.S21G	NM_031460.3	NP_113648.2	Q96T54	KCNKH_HUMAN	potassium channel, subfamily K, member 17	21			S -> G (in dbSNP:rs10947804). {ECO:0000269|PubMed:11248242, ECO:0000269|PubMed:15489334}.		potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(2)	14						AGCACGGTGCTGGGCACCGCG	0.761													T|||	2917	0.582468	0.8858	0.4553	5008	,	,		12417	0.4673		0.4851	False		,,,				2504	0.4816				p.S21G		.											.	KCNK17-227	0			c.A61G						.	T	GLY/SER,GLY/SER	3100,536		1364,372,82	3.0	4.0	3.0		61,61	2.1	0.0	6	dbSNP_120	3	4061,3263		1251,1559,852	yes	missense,missense	KCNK17	NM_001135111.1,NM_031460.3	56,56	2615,1931,934	CC,CT,TT		44.5522,14.7415,34.6624	benign,benign	21/272,21/333	39282036	7161,3799	1818	3662	5480	SO:0001583	missense	89822	exon1			CGGTGCTGGGCAC	AF358910	CCDS4842.1, CCDS47419.1	6p21	2012-03-07			ENSG00000124780	ENSG00000124780		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	14465	protein-coding gene	gene with protein product		607370				16382106	Standard	NM_031460		Approved	K2p17.1, TALK-2, TALK2, TASK4, TASK-4	uc003ooo.3	Q96T54	OTTHUMG00000014646	ENST00000373231.4:c.61A>G	6.37:g.39282036T>C	ENSP00000362328:p.Ser21Gly	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	10	NM_001135111	0	0	0	0	0	E9PB46|Q5TCF4|Q8TAW4|Q9BXD1|Q9H592	Missense_Mutation	SNP	ENST00000373231.4	37	CCDS4842.1	1214	0.5558608058608059	431	0.8760162601626016	173	0.47790055248618785	244	0.42657342657342656	366	0.48284960422163586	T	8.033	0.762256	0.15914	0.852585	0.554478	ENSG00000124780	ENST00000373231;ENST00000453413	T;T	0.56776	0.44;0.44	4.06	2.09	0.27110	.	1.425750	0.04586	N	0.395947	T	0.14184	0.0343	N	0.17082	0.46	0.80722	P	0.0	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	T	0.09122	-1.0689	9	0.21014	T	0.42	.	5.3388	0.15973	0.0:0.5516:0.0:0.4484	rs10947804;rs17845776;rs17858736;rs60349641	21;21	E9PB46;Q96T54	.;KCNKH_HUMAN	G	21	ENSP00000362328:S21G;ENSP00000401271:S21G	ENSP00000362328:S21G	S	-	1	0	KCNK17	39390014	0.000000	0.05858	0.003000	0.11579	0.032000	0.12392	-0.229000	0.09098	0.383000	0.24910	0.459000	0.35465	AGC	T|0.441;C|0.559		0.761	KCNK17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040453.2	NM_031460	
YIPF3	25844	bcgsc.ca	37	6	43481121	43481121	+	Silent	SNP	C	C	T	rs2231767	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr6:43481121C>T	ENST00000372422.2	-	5	692	c.510G>A	c.(508-510)ggG>ggA	p.G170G	LRRC73_ENST00000372441.1_5'Flank|YIPF3_ENST00000506469.1_Silent_p.G176G	NM_015388.3	NP_056203.2	Q9GZM5	YIPF3_HUMAN	Yip1 domain family, member 3	170					cell differentiation (GO:0030154)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|transport vesicle (GO:0030133)				large_intestine(2)|lung(4)|pancreas(1)|prostate(1)|skin(1)	9	all_cancers(18;3.79e-05)|Lung NSC(15;0.00217)|all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00736)|OV - Ovarian serous cystadenocarcinoma(102;0.0711)			ACGTCTTCATCCCATGGAGTA	0.483													C|||	148	0.0295527	0.0484	0.0115	5008	,	,		21552	0.005		0.0268	False		,,,				2504	0.045				p.G170G		.											.	YIPF3-90	0			c.G510A						.	C		213,4193	129.8+/-166.5	3,207,1993	108.0	109.0	109.0		510	0.6	1.0	6	dbSNP_98	109	278,8322	105.2+/-166.2	5,268,4027	no	coding-synonymous	YIPF3	NM_015388.3		8,475,6020	TT,TC,CC		3.2326,4.8343,3.7752		170/351	43481121	491,12515	2203	4300	6503	SO:0001819	synonymous_variant	25844	exon5			CTTCATCCCATGG	AK000946	CCDS4899.1	6p21.1	2009-10-06	2005-07-04	2005-07-04	ENSG00000137207	ENSG00000137207		"""Yip1 domain family"""	21023	protein-coding gene	gene with protein product		609775	"""chromosome 6 open reading frame 109"""	C6orf109			Standard	NM_015388		Approved	DKFZp566C243, KLIP1, dJ337H4.3, FinGER3	uc003ovl.2	Q9GZM5	OTTHUMG00000014738	ENST00000372422.2:c.510G>A	6.37:g.43481121C>T		Somatic	128	0		WXS	Illumina GAIIx	Phase_I	91	7	NM_015388	0	0	158	158	0	Q5JTD2|Q6FI85|Q8NI57|Q9NWE3|Q9Y3U9	Silent	SNP	ENST00000372422.2	37	CCDS4899.1	51	0.023351648351648352	24	0.04878048780487805	5	0.013812154696132596	0	0.0	22	0.029023746701846966	C	10.37	1.331282	0.24167	0.048343	0.032326	ENSG00000137207	ENST00000500090	T	0.41065	1.01	5.8	0.635	0.17723	.	0.000000	0.85682	D	0.000000	T	0.32852	0.0843	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.22417	-1.0217	7	0.87932	D	0	-20.6883	6.5232	0.22287	0.0:0.4765:0.1188:0.4047	rs2231767;rs2231767	.	.	.	E	108	ENSP00000423544:G108E	ENSP00000259737:G155E	G	-	2	0	YIPF3	43589099	0.989000	0.36119	0.997000	0.53966	0.847000	0.48162	0.131000	0.15870	0.082000	0.17018	0.655000	0.94253	GGA	C|0.967;T|0.033		0.483	YIPF3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040639.2	NM_015388	
TMEM151B	441151	hgsc.bcm.edu	37	6	44243154	44243154	+	Silent	SNP	C	C	T	rs12194552	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr6:44243154C>T	ENST00000451188.2	+	3	868	c.591C>T	c.(589-591)cgC>cgT	p.R197R	RP11-444E17.6_ENST00000505802.1_Intron|TMEM151B_ENST00000438774.2_Intron	NM_001137560.1	NP_001131032.1	Q8IW70	T151B_HUMAN	transmembrane protein 151B	197						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)	6						ACCACGAACGCGTCAACACGC	0.726													C|||	140	0.0279553	0.0023	0.036	5008	,	,		12642	0.001		0.0825	False		,,,				2504	0.0286				p.R197R		.											.	.	0			c.C591T						.	C		17,1325		0,17,654	6.0	9.0	9.0		591	-2.1	1.0	6	dbSNP_120	9	223,2889		9,205,1342	no	coding-synonymous	TMEM151B	NM_001137560.1		9,222,1996	TT,TC,CC		7.1658,1.2668,5.3884		197/567	44243154	240,4214	671	1556	2227	SO:0001819	synonymous_variant	441151	exon3			CGAACGCGTCAAC	AK126839	CCDS47437.1	6p21.1	2009-04-17	2007-10-25	2007-10-25	ENSG00000178233	ENSG00000178233			21315	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 137"", ""transmembrane protein 193"""	C6orf137, TMEM193			Standard	NM_001137560		Approved	bA444E17.5	uc003oxh.2	Q8IW70	OTTHUMG00000014765	ENST00000451188.2:c.591C>T	6.37:g.44243154C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	27	22	NM_001137560	0	0	0	0	0	Q5T9V7	Silent	SNP	ENST00000451188.2	37	CCDS47437.1																																																																																			C|0.967;T|0.033		0.726	TMEM151B-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040740.2	NM_001039704	
FAM46A	55603	broad.mit.edu	37	6	82461728	82461742	+	In_Frame_Del	DEL	CCGCCGAAGTCGCCG	CCGCCGAAGTCGCCG	-	rs375746695	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr6:82461728_82461742delCCGCCGAAGTCGCCG	ENST00000320172.6	-	2	431_445	c.117_131delCGGCGACTTCGGCGG	c.(115-132)ggcggcgacttcggcggt>ggt	p.39_44GGDFGG>G	FAM46A_ENST00000369754.3_In_Frame_Del_p.58_63GGDFGG>G|FAM46A_ENST00000369756.3_In_Frame_Del_p.120_125GGDFGG>G	NM_017633.2	NP_060103.2	Q96IP4	FA46A_HUMAN	family with sequence similarity 46, member A	39			Missing. {ECO:0000269|PubMed:12054608, ECO:0000269|PubMed:16545789}.		regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)		poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(3)|lung(5)|skin(1)|urinary_tract(1)	12		all_cancers(76;6.74e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000282)|all_epithelial(107;0.0104)		BRCA - Breast invasive adenocarcinoma(397;0.0428)		gctgccgccaccgccgaagtcgccgccgccgaagt	0.67																																					p.39_44del		.											.	FAM46A-90	0			c.117_131del						.																																			SO:0001651	inframe_deletion	55603	exon2			CCGCCACCGCCGA	AF350451	CCDS34489.1	6q14	2008-07-03	2004-08-19	2004-08-26	ENSG00000112773	ENSG00000112773			18345	protein-coding gene	gene with protein product		611357	"""chromosome 6 open reading frame 37"""	C6orf37		12054608, 17803723	Standard	NM_017633		Approved	FLJ20037	uc003pjg.3	Q96IP4	OTTHUMG00000015097	ENST00000320172.6:c.117_131delCGGCGACTTCGGCGG	6.37:g.82461728_82461742delCCGCCGAAGTCGCCG	ENSP00000318298:p.Gly39_Gly43del	Somatic	21	0		WXS	Illumina GAIIx	Phase_I	73	12	NM_017633	0	0	0	0	0	A8K7U4|Q5TF86|Q8NFZ9|Q9BW32|Q9NXV5	In_Frame_Del	DEL	ENST00000320172.6	37	CCDS34489.1																																																																																			.		0.670	FAM46A-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000041331.1		
SMOC2	64094	hgsc.bcm.edu	37	6	168842113	168842113	+	Silent	SNP	T	T	G	rs73270928	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr6:168842113T>G	ENST00000356284.2	+	1	283	c.63T>G	c.(61-63)gcT>gcG	p.A21A	SMOC2_ENST00000354536.5_Silent_p.A21A	NM_001166412.1	NP_001159884.1	Q9H3U7	SMOC2_HUMAN	SPARC related modular calcium binding 2	21					extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)|signal transduction (GO:0007165)	basement membrane (GO:0005604)|interstitial matrix (GO:0005614)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	32		Breast(66;0.000141)|Esophageal squamous(34;0.222)|Ovarian(120;0.231)		OV - Ovarian serous cystadenocarcinoma(33;1.31e-19)|BRCA - Breast invasive adenocarcinoma(81;3.06e-06)|GBM - Glioblastoma multiforme(31;0.00109)		CGGTGCCCGCTCAGAAGTTCT	0.751													G|||	1980	0.395367	0.5787	0.2839	5008	,	,		9314	0.4593		0.167	False		,,,				2504	0.3957				p.A21A		.											.	SMOC2-91	0			c.T63G						.	G	,	924,2074		89,746,664	2.0	3.0	3.0		63,63	-0.4	1.0	6	dbSNP_131	3	645,5799		34,577,2611	no	coding-synonymous,coding-synonymous	SMOC2	NM_001166412.1,NM_022138.2	,	123,1323,3275	GG,GT,TT		10.0093,30.8205,16.6172	,	21/447,21/458	168842113	1569,7873	1499	3222	4721	SO:0001819	synonymous_variant	64094	exon1			GCCCGCTCAGAAG	AB014730	CCDS5307.1, CCDS55076.1	6q27	2013-01-10			ENSG00000112562	ENSG00000112562		"""EF-hand domain containing"""	20323	protein-coding gene	gene with protein product		607223				12031507	Standard	NM_022138		Approved	SMAP2	uc003qwr.2	Q9H3U7	OTTHUMG00000016050	ENST00000356284.2:c.63T>G	6.37:g.168842113T>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	33	27	NM_022138	0	0	0	0	0	B3KPS7|Q4G169|Q5TAT7|Q5TAT8|Q86VV9|Q96SF3|Q9H1L3|Q9H1L4|Q9H3U0|Q9H4F7|Q9HCV2	Silent	SNP	ENST00000356284.2	37	CCDS55076.1																																																																																			T|0.654;G|0.346		0.751	SMOC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043201.1		
TNRC18	84629	hgsc.bcm.edu	37	7	5427517	5427517	+	Silent	SNP	G	G	A	rs34693947	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr7:5427517G>A	ENST00000430969.1	-	5	2286	c.1938C>T	c.(1936-1938)ggC>ggT	p.G646G	TNRC18_ENST00000399537.4_Silent_p.G646G	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	646							chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		GCCGGCCGCCGCCCGCTGCAG	0.716													G|||	998	0.199281	0.0552	0.0908	5008	,	,		13710	0.6597		0.0437	False		,,,				2504	0.1564				p.G646G		.											.	TNRC18-46	0			c.C1938T						.	G		141,3189		2,137,1526	4.0	6.0	5.0		1938	-5.6	0.0	7	dbSNP_126	5	219,7185		3,213,3486	no	coding-synonymous	TNRC18	NM_001080495.2		5,350,5012	AA,AG,GG		2.9579,4.2342,3.3538		646/2969	5427517	360,10374	1665	3702	5367	SO:0001819	synonymous_variant	84629	exon5			GCCGCCGCCCGCT	U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.1938C>T	7.37:g.5427517G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	35	18	NM_001080495	0	0	1	1	0	A8MX41|Q96JH1|Q96K91	Silent	SNP	ENST00000430969.1	37	CCDS47534.1																																																																																			G|0.797;A|0.203		0.716	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
GTPBP10	85865	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	89982277	89982278	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	AG	AG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr7:89982277_89982278delAG	ENST00000222511.6	+	2	247_248	c.181_182delAG	c.(181-183)aggfs	p.R61fs	GTPBP10_ENST00000257659.8_Frame_Shift_Del_p.R61fs	NM_033107.3	NP_149098.2	A4D1E9	GTPBA_HUMAN	GTP-binding protein 10 (putative)	61					ribosome biogenesis (GO:0042254)	chromosome (GO:0005694)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|magnesium ion binding (GO:0000287)|poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(2)|large_intestine(3)|lung(4)	10						ACTTAAAGACAGGTATCCTCGG	0.411																																					p.61_61del		.											.	GTPBP10-68	0			c.181_182del						.																																			SO:0001589	frameshift_variant	85865	exon2			AAAGACAGGTATC		CCDS5617.1, CCDS43614.1	7q21.13	2006-08-15			ENSG00000105793	ENSG00000105793			25106	protein-coding gene	gene with protein product		610920				12477932	Standard	NM_001042717		Approved	DKFZP686A10121, FLJ38242	uc003ukm.2	A4D1E9	OTTHUMG00000023655	ENST00000222511.6:c.181_182delAG	7.37:g.89982277_89982278delAG	ENSP00000222511:p.Arg61fs	Somatic	129	0		WXS	Illumina GAIIx	Phase_I	169	65	NM_001042717	0	0	0	0	0	B4DFY6|Q3B7A6|Q5H9V2|Q8IXG8|Q8N982|Q8WU16|Q9BSP1|Q9Y6T6	Frame_Shift_Del	DEL	ENST00000222511.6	37	CCDS5617.1																																																																																			.		0.411	GTPBP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059976.3	NM_033107	
EPHB4	2050	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	100417840	100417840	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr7:100417840G>A	ENST00000358173.3	-	5	1355	c.887C>T	c.(886-888)aCc>aTc	p.T296I	RN7SL750P_ENST00000582814.1_RNA|EPHB4_ENST00000477446.1_5'UTR|EPHB4_ENST00000360620.3_Missense_Mutation_p.T296I	NM_004444.4	NP_004435.3	P54760	EPHB4_HUMAN	EPH receptor B4	296	Cys-rich.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|ephrin receptor signaling pathway (GO:0048013)|heart morphogenesis (GO:0003007)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(3)	47	Lung NSC(181;0.041)|all_lung(186;0.0581)					TGATCCAATGGTGTTAGAGTG	0.622																																					p.T296I	GBM(200;2113 3072 25865 52728)	.											.	EPHB4-1446	0			c.C887T						.						103.0	118.0	113.0					7																	100417840		2203	4300	6503	SO:0001583	missense	2050	exon5			CCAATGGTGTTAG	AY056047	CCDS5706.1	7q22	2013-02-11	2004-10-28		ENSG00000196411	ENSG00000196411		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3395	protein-coding gene	gene with protein product		600011	"""EphB4"""	HTK		8188704	Standard	NM_004444		Approved	Tyro11	uc003uwn.1	P54760	OTTHUMG00000157040	ENST00000358173.3:c.887C>T	7.37:g.100417840G>A	ENSP00000350896:p.Thr296Ile	Somatic	130	1		WXS	Illumina GAIIx	Phase_I	141	64	NM_004444	0	0	23	36	13	B5A970|B5A971|B5A972|Q7Z635|Q9BTA5|Q9BXP0	Missense_Mutation	SNP	ENST00000358173.3	37	CCDS5706.1	.	.	.	.	.	.	.	.	.	.	G	3.076	-0.189974	0.06299	.	.	ENSG00000196411	ENST00000360620;ENST00000358173	D;D	0.97553	-4.43;-4.43	5.35	0.0901	0.14462	Tyrosine-protein kinase ephrin type A/B receptor-like (1);	1.194740	0.06049	N	0.656327	D	0.93749	0.8002	L	0.29908	0.895	0.09310	N	1	B;B;B;B	0.12013	0.005;0.001;0.0;0.001	B;B;B;B	0.08055	0.003;0.003;0.002;0.003	D	0.83501	0.0075	10	0.46703	T	0.11	.	10.7714	0.46325	0.0:0.2061:0.4727:0.3212	.	296;296;296;296	B5A972;B5A970;Q96L35;P54760	.;.;.;EPHB4_HUMAN	I	296	ENSP00000353833:T296I;ENSP00000350896:T296I	ENSP00000350896:T296I	T	-	2	0	EPHB4	100255776	0.006000	0.16342	0.004000	0.12327	0.081000	0.17604	1.028000	0.30128	-0.606000	0.05746	-2.688000	0.00140	ACC	.		0.622	EPHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347222.1	NM_004444	
TMEM229A	730130	hgsc.bcm.edu	37	7	123672457	123672462	+	In_Frame_Del	DEL	GCTGCT	GCTGCT	-	rs71163719|rs374529977|rs566327350|rs72310362	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	GCTGCT	GCTGCT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr7:123672457_123672462delGCTGCT	ENST00000455783.1	-	1	1061_1066	c.596_601delAGCAGC	c.(595-603)cagcagcgg>cgg	p.QQ199del	RP5-921G16.1_ENST00000484322.1_RNA	NM_001136002.1	NP_001129474.1	B2RXF0	T229A_HUMAN	transmembrane protein 229A	199						host cell nucleus (GO:0042025)|integral component of membrane (GO:0016021)	sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(3)	6						GCGCCCCTCCgctgctgctgctgctg	0.757														714	0.142572	0.3026	0.0908	5008	,	,		13703	0.002		0.1282	False		,,,				2504	0.1227				p.199_201del		.											.	.	0			c.596_601del						.			16,422,143,1041		8,0,0,0,177,9,59,56,22,480						-4.0	0.0			3	5,438,299,2868		1,0,0,3,176,3,83,104,88,1347	no	codingComplex	TMEM229A	NM_001136002.1		9,0,0,3,353,12,142,160,110,1827	A1A1,A1A2,A1A3,A1R,A2A2,A2A3,A2R,A3A3,A3R,RR		20.554,35.82,25.2867				21,860,442,3909				SO:0001651	inframe_deletion	730130	exon1			CCCTCCGCTGCTG	BC157828	CCDS47694.1	7q31.32	2009-09-22			ENSG00000234224	ENSG00000234224			37279	protein-coding gene	gene with protein product							Standard	NM_001136002		Approved		uc011kob.2	B2RXF0	OTTHUMG00000154762	ENST00000455783.1:c.596_601delAGCAGC	7.37:g.123672463_123672468delGCTGCT	ENSP00000395244:p.Gln199_Gln200del	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	17	12	NM_001136002	0	0	0	0	0	A4D0X6	In_Frame_Del	DEL	ENST00000455783.1	37	CCDS47694.1																																																																																			.		0.757	TMEM229A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336960.3	NM_001136002	
ATP6V0A4	50617	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	138413506	138413506	+	Splice_Site	SNP	C	C	G			TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr7:138413506C>G	ENST00000310018.2	-	18	2292	c.2010G>C	c.(2008-2010)caG>caC	p.Q670H	ATP6V0A4_ENST00000393054.1_Splice_Site_p.Q670H|ATP6V0A4_ENST00000353492.4_Splice_Site_p.Q670H	NM_020632.2|NM_130840.2	NP_065683.2|NP_570855.2	Q9HBG4	VPP4_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit a4	670					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|excretion (GO:0007588)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|ossification (GO:0001503)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|regulation of pH (GO:0006885)|sensory perception of sound (GO:0007605)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	ATPase binding (GO:0051117)|hydrogen ion transmembrane transporter activity (GO:0015078)			NS(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(15)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36						CAGCCCTTACCTGGGATTTCC	0.443																																					p.Q670H		.											.	ATP6V0A4-91	0			c.G2010C						.						176.0	182.0	180.0					7																	138413506		2203	4300	6503	SO:0001630	splice_region_variant	50617	exon17			CCTTACCTGGGAT	AF245517	CCDS5849.1	7q34	2011-06-09	2006-01-20	2002-05-10	ENSG00000105929	ENSG00000105929		"""ATPases / V-type"""	866	protein-coding gene	gene with protein product		605239	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) non-catalytic accessory protein 1B"", ""ATPase, H+ transporting, lysosomal V0 subunit a isoform 4"", ""ATPase, H+ transporting, lysosomal V0 subunit A4"""	ATP6N1B, ATP6N2, RTA1C		10577919, 10973252	Standard	XM_005250393		Approved	RDRTA2, VPP2, RTADR, a4, Vph1, Stv1	uc003vuf.3	Q9HBG4	OTTHUMG00000157122	ENST00000310018.2:c.2010+1G>C	7.37:g.138413506C>G		Somatic	89	0		WXS	Illumina GAIIx	Phase_I	108	49	NM_130841	0	0	0	0	0	A4D1R4|A8KA80|Q32M47	Missense_Mutation	SNP	ENST00000310018.2	37	CCDS5849.1	.	.	.	.	.	.	.	.	.	.	C	17.30	3.355118	0.61293	.	.	ENSG00000105929	ENST00000310018;ENST00000393054;ENST00000353492	D;D;D	0.85955	-2.05;-2.05;-2.05	5.68	5.68	0.88126	.	29.914300	0.00166	N	0.000002	D	0.87063	0.6084	N	0.17278	0.47	0.47862	D	0.999534	P	0.48016	0.904	P	0.54312	0.748	T	0.72693	-0.4216	9	.	.	.	-18.1006	17.9774	0.89131	0.0:1.0:0.0:0.0	.	670	Q9HBG4	VPP4_HUMAN	H	670	ENSP00000308122:Q670H;ENSP00000376774:Q670H;ENSP00000253856:Q670H	.	Q	-	3	2	ATP6V0A4	138064046	1.000000	0.71417	1.000000	0.80357	0.873000	0.50193	4.062000	0.57492	2.679000	0.91253	0.650000	0.86243	CAG	.		0.443	ATP6V0A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347514.1	NM_020632	Missense_Mutation
BHLHE22	27319	hgsc.bcm.edu	37	8	65493532	65493532	+	Missense_Mutation	SNP	T	T	A	rs62519835	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr8:65493532T>A	ENST00000321870.1	+	1	719	c.185T>A	c.(184-186)cTg>cAg	p.L62Q	RP11-21C4.1_ENST00000517909.1_RNA	NM_152414.4	NP_689627.1	Q8NFJ8	BHE22_HUMAN	basic helix-loop-helix family, member e22	62					anterior commissure morphogenesis (GO:0021960)|cerebral cortex regionalization (GO:0021796)|corpus callosum morphogenesis (GO:0021540)|corticospinal tract morphogenesis (GO:0021957)|negative regulation of transcription, DNA-templated (GO:0045892)|retinal bipolar neuron differentiation (GO:0060040)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.L62Q(1)		NS(1)|central_nervous_system(1)|lung(1)|prostate(1)|skin(1)	5						TCGTCGCCCCTGGGCTGCTTC	0.776													T|||	233	0.0465256	0.0053	0.0706	5008	,	,		6928	0.004		0.1481	False		,,,				2504	0.0245				p.L62Q	Colon(113;104 1586 2865 9855 18065)	.											.	BHLHE22-90	1	Substitution - Missense(1)	NS(1)	c.T185A						.	T	GLN/LEU	38,3528		0,38,1745	4.0	5.0	4.0		185	2.0	1.0	8	dbSNP_129	4	573,6683		11,551,3066	no	missense	BHLHE22	NM_152414.4	113	11,589,4811	AA,AT,TT		7.8969,1.0656,5.6459	probably-damaging	62/382	65493532	611,10211	1783	3628	5411	SO:0001583	missense	27319	exon1			CGCCCCTGGGCTG	U80755	CCDS6179.1	8q12.1	2009-01-12	2009-01-12	2009-01-12		ENSG00000180828		"""Basic helix-loop-helix proteins"""	11963	protein-coding gene	gene with protein product		613483	"""trinucleotide repeat containing 20"", ""basic helix-loop-helix domain containing, class B, 5"""	TNRC20, BHLHB5		9225980, 12213201, 18557763	Standard	NM_152414		Approved	CAGL85, Beta3, bHLHe22	uc003xvi.3	Q8NFJ8		ENST00000321870.1:c.185T>A	8.37:g.65493532T>A	ENSP00000318799:p.Leu62Gln	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	12	5	NM_152414	0	0	0	0	0		Missense_Mutation	SNP	ENST00000321870.1	37	CCDS6179.1	139	0.06364468864468864	5	0.01016260162601626	24	0.06629834254143646	1	0.0017482517482517483	109	0.1437994722955145	T	14.21	2.468289	0.43839	0.010656	0.078969	ENSG00000180828	ENST00000321870	D	0.97888	-4.59	3.18	1.96	0.26148	.	0.107189	0.40144	U	0.001175	T	0.10252	0.0251	N	0.24115	0.695	0.35078	P	0.23685	B	0.34015	0.435	B	0.31337	0.128	T	0.66941	-0.5796	9	0.54805	T	0.06	-9.9523	5.2123	0.15325	0.0:0.1025:0.1827:0.7148	rs62519835	62	Q8NFJ8	BHE22_HUMAN	Q	62	ENSP00000318799:L62Q	ENSP00000318799:L62Q	L	+	2	0	BHLHE22	65656086	0.992000	0.36948	1.000000	0.80357	0.982000	0.71751	2.935000	0.48963	0.410000	0.25675	0.374000	0.22700	CTG	T|0.935;A|0.065		0.776	BHLHE22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378549.1	NM_152414	
ZNF696	79943	hgsc.bcm.edu	37	8	144378868	144378868	+	Silent	SNP	A	A	G	rs7386259	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr8:144378868A>G	ENST00000330143.3	+	3	1432	c.1023A>G	c.(1021-1023)cgA>cgG	p.R341R		NM_030895.2	NP_112157.2	Q9H7X3	ZN696_HUMAN	zinc finger protein 696	341					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	8	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)			GGCACCAGCGACTCCACACGG	0.726													G|||	4505	0.899561	0.9425	0.9179	5008	,	,		11520	0.8403		0.8608	False		,,,				2504	0.9294				p.R341R		.											.	ZNF696-90	0			c.A1023G						.	G		3773,275		1771,231,22	5.0	5.0	5.0		1023	-0.3	0.0	8	dbSNP_116	5	6735,1261		2843,1049,106	no	coding-synonymous	ZNF696	NM_030895.2		4614,1280,128	GG,GA,AA		15.7704,6.7935,12.7532		341/375	144378868	10508,1536	2024	3998	6022	SO:0001819	synonymous_variant	79943	exon3			CCAGCGACTCCAC	AK024191	CCDS6399.1	8q24.3	2013-01-08				ENSG00000185730		"""Zinc fingers, C2H2-type"""	25872	protein-coding gene	gene with protein product							Standard	NM_030895		Approved	FLJ14129	uc003yxy.4	Q9H7X3		ENST00000330143.3:c.1023A>G	8.37:g.144378868A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_030895	0	0	0	1	1	A0AVE2	Silent	SNP	ENST00000330143.3	37	CCDS6399.1																																																																																			A|0.118;G|0.882		0.726	ZNF696-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381164.2	NM_030895	
FAM83H	286077	hgsc.bcm.edu	37	8	144809268	144809268	+	Missense_Mutation	SNP	C	C	T	rs56148058	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr8:144809268C>T	ENST00000388913.3	-	5	2488	c.2363G>A	c.(2362-2364)aGc>aAc	p.S788N		NM_198488.3	NP_940890	Q6ZRV2	FA83H_HUMAN	family with sequence similarity 83, member H	788					biomineral tissue development (GO:0031214)					central_nervous_system(2)|endometrium(1)|large_intestine(1)|lung(12)|pancreas(1)|prostate(3)|urinary_tract(1)	21	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			CAGCAGGCAGCTCTCGAGGCT	0.731													C|||	116	0.0231629	0.0038	0.0115	5008	,	,		10561	0.0268		0.0229	False		,,,				2504	0.0542				p.S788N		.											.	FAM83H-92	0			c.G2363A						.	C	ASN/SER	14,3668		0,14,1827	3.0	3.0	3.0		2363	3.4	1.0	8	dbSNP_129	3	185,7199		1,183,3508	yes	missense	FAM83H	NM_198488.3	46	1,197,5335	TT,TC,CC		2.5054,0.3802,1.7983	probably-damaging	788/1180	144809268	199,10867	1841	3692	5533	SO:0001583	missense	286077	exon5			AGGCAGCTCTCGA	AK127960	CCDS6410.2	8q24.3	2014-03-13			ENSG00000180921	ENSG00000180921			24797	protein-coding gene	gene with protein product		611927				18252228	Standard	NM_198488		Approved	FLJ46072	uc003yzk.3	Q6ZRV2	OTTHUMG00000133559	ENST00000388913.3:c.2363G>A	8.37:g.144809268C>T	ENSP00000373565:p.Ser788Asn	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_198488	0	0	2	6	4	A0JLS2|Q8N4W0	Missense_Mutation	SNP	ENST00000388913.3	37	CCDS6410.2	45	0.020604395604395604	2	0.0040650406504065045	5	0.013812154696132596	20	0.03496503496503497	18	0.023746701846965697	c	17.95	3.513746	0.64522	0.003802	0.025054	ENSG00000180921	ENST00000388913	T	0.22134	1.97	4.26	3.37	0.38596	.	1.065800	0.07442	U	0.897448	T	0.09202	0.0227	L	0.32530	0.975	0.28653	N	0.90656	P	0.50943	0.94	P	0.47915	0.561	T	0.19192	-1.0313	10	0.35671	T	0.21	.	13.5524	0.61740	0.0:0.8431:0.1569:0.0	rs56148058	788	Q6ZRV2	FA83H_HUMAN	N	788	ENSP00000373565:S788N	ENSP00000373565:S788N	S	-	2	0	FAM83H	144881256	1.000000	0.71417	0.996000	0.52242	0.570000	0.35934	2.978000	0.49305	0.900000	0.36469	0.491000	0.48974	AGC	C|0.978;T|0.022		0.731	FAM83H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257632.2	NM_198488	
EPPK1	83481	bcgsc.ca	37	8	144940290	144940290	+	Missense_Mutation	SNP	C	C	G	rs201976887		TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr8:144940290C>G	ENST00000525985.1	-	2	7203	c.7132G>C	c.(7132-7134)Gac>Cac	p.D2378H				P58107	EPIPL_HUMAN	epiplakin 1	2378						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			TCGCTGGGGTCGGCCAGGACG	0.682																																					p.D2378H		.											.	EPPK1-25	0			c.G7132C						.	C	HIS/ASP	51,4341	20.2+/-43.8	0,51,2145	315.0	292.0	300.0		7132	3.6	0.8	8		300	22,8530	7.1+/-27.0	0,22,4254	no	missense	EPPK1	NM_031308.1	81	0,73,6399	GG,GC,CC		0.2572,1.1612,0.564	probably-damaging	2378/2420	144940290	73,12871	2196	4276	6472	SO:0001583	missense	83481	exon1			TGGGGTCGGCCAG	AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.7132G>C	8.37:g.144940290C>G	ENSP00000436337:p.Asp2378His	Somatic	114	2		WXS	Illumina GAIIx	Phase_I	518	27	NM_031308	0	0	0	0	0	Q76E58|Q9NSU9	Missense_Mutation	SNP	ENST00000525985.1	37		.	.	.	.	.	.	.	.	.	.	C	22.4	4.279155	0.80692	0.011612	0.002572	ENSG00000227184	ENST00000525985	T	0.74737	-0.87	4.43	3.56	0.40772	.	.	.	.	.	D	0.83133	0.5188	M	0.89785	3.06	0.42176	D	0.991666	D	0.89917	1.0	D	0.91635	0.999	D	0.86316	0.1689	9	0.62326	D	0.03	.	10.4012	0.44231	0.0:0.9038:0.0:0.0962	.	2378	E9PPU0	.	H	2378	ENSP00000436337:D2378H	ENSP00000436337:D2378H	D	-	1	0	EPPK1	145012278	1.000000	0.71417	0.773000	0.31616	0.942000	0.58702	7.555000	0.82223	1.223000	0.43536	0.591000	0.81541	GAC	.		0.682	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382675.1	NM_031308	
SCRT1	83482	hgsc.bcm.edu	37	8	145557497	145557497	+	Missense_Mutation	SNP	A	A	C	rs7013127	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr8:145557497A>C	ENST00000332135.4	-	2	508	c.397T>G	c.(397-399)Tct>Gct	p.S133A		NM_031309.4	NP_112599.2	Q9BWW7	SCRT1_HUMAN	scratch family zinc finger 1	133			S -> A (in dbSNP:rs7013127). {ECO:0000269|Ref.2}.		negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of neuron migration (GO:2001222)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|upper_aerodigestive_tract(1)	3	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.94e-40)|Epithelial(56;1.35e-39)|all cancers(56;1.37e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0441)|Colorectal(110;0.055)			GCGGCGGCAGAGCCGGCATTG	0.776													c|||	4719	0.942292	0.9418	0.9568	5008	,	,		3920	0.9921		0.8956	False		,,,				2504	0.9294				p.S133A		.											.	.	0			c.T397G						.						1.0	1.0	1.0					8																	145557497		634	1472	2106	SO:0001583	missense	83482	exon2			CGGCAGAGCCGGC	BC014675	CCDS6421.1	8q24.3	2013-10-09	2013-10-09		ENSG00000170616	ENSG00000261678		"""Zinc fingers, C2H2-type"""	15950	protein-coding gene	gene with protein product		605858	"""scratch (drosophila homolog) 1, zinc finger protein"", ""scratch homolog 1, zinc finger protein (Drosophila)"""			11274425	Standard	NM_031309		Approved	DKFZp547F072, ZNF898	uc003zbw.1	Q9BWW7	OTTHUMG00000165229	ENST00000332135.4:c.397T>G	8.37:g.145557497A>C	ENSP00000331692:p.Ser133Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_031309	0	0	0	0	0	A8MX66|Q96C52	Missense_Mutation	SNP	ENST00000332135.4	37	CCDS6421.1	1975	0.9043040293040293	396	0.8048780487804879	339	0.93646408839779	552	0.965034965034965	688	0.9076517150395779	c	0.007	-1.995963	0.00435	.	.	ENSG00000170616	ENST00000332135	T	0.06933	3.24	0.926	-0.0566	0.13805	.	.	.	.	.	T	0.00012	0.0000	N	0.02539	-0.55	0.58432	P	5.999999999950489E-6	B	0.02656	0.0	B	0.01281	0.0	T	0.33879	-0.9851	8	0.05525	T	0.97	5.8842	6.2142	0.20646	0.3034:0.6966:0.0:0.0	rs7013127	133	Q9BWW7	SCRT1_HUMAN	A	133	ENSP00000331692:S133A	ENSP00000331692:S133A	S	-	1	0	SCRT1	145528305	.	.	0.675000	0.29917	0.381000	0.30169	.	.	-1.712000	0.01393	-3.289000	0.00047	TCT	A|0.096;C|0.904		0.776	SCRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382800.2	NM_031309	
ZNF517	340385	hgsc.bcm.edu	37	8	146033347	146033347	+	Missense_Mutation	SNP	T	T	C	rs2976653	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr8:146033347T>C	ENST00000531720.1	+	4	1091	c.1046T>C	c.(1045-1047)gTg>gCg	p.V349A	ZNF517_ENST00000526178.1_Intron|ZNF517_ENST00000525105.1_Intron|ZNF517_ENST00000359971.3_Missense_Mutation_p.V349A			Q6ZMY9	ZN517_HUMAN	zinc finger protein 517	349				V -> A (in Ref. 1; BAD18586). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(2)|lung(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_cancers(97;1.03e-11)|all_epithelial(106;6.69e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;5.47e-39)|OV - Ovarian serous cystadenocarcinoma(54;6.38e-39)|all cancers(56;5.47e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)			GACGGCGGCGTGGGGCAGGGC	0.746													C|||	4981	0.994609	1.0	1.0	5008	,	,		12856	1.0		0.994	False		,,,				2504	0.9785				p.V349A		.											.	ZNF517-90	0			c.T1046C						.	C	ALA/VAL	3411,3		1704,3,0	3.0	5.0	4.0		1046	-0.8	0.0	8	dbSNP_101	4	7050,46		3502,46,0	no	missense	ZNF517	NM_213605.2	64	5206,49,0	CC,CT,TT		0.6483,0.0879,0.4662	benign	349/493	146033347	10461,49	1707	3548	5255	SO:0001583	missense	340385	exon5			GCGGCGTGGGGCA	AK096527	CCDS6434.1	8q24.3	2013-01-08				ENSG00000197363		"""Zinc fingers, C2H2-type"", ""-"""	27984	protein-coding gene	gene with protein product							Standard	NM_213605		Approved		uc003zed.1	Q6ZMY9		ENST00000531720.1:c.1046T>C	8.37:g.146033347T>C	ENSP00000436103:p.Val349Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_213605	0	0	0	2	2		Missense_Mutation	SNP	ENST00000531720.1	37	CCDS6434.1	2179|2179	0.9977106227106227|0.9977106227106227	492|492	1.0|1.0	362|362	1.0|1.0	572|572	1.0|1.0	753|753	0.9934036939313984|0.9934036939313984	C|C	0.021|0.021	-1.418607|-1.418607	0.01136|0.01136	0.999121|0.999121	0.993517|0.993517	ENSG00000197363|ENSG00000197363	ENST00000359971;ENST00000531720|ENST00000529429	T;T|.	0.05319|.	3.46;3.46|.	2.17|2.17	-0.838|-0.838	0.10762|0.10762	.|.	.|.	.|.	.|.	.|.	T|T	0.00012|0.00012	0.0000|0.0000	L|L	0.35644|0.35644	1.08|1.08	0.80722|0.80722	P|P	0.0|0.0	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|T	0.21449|0.21449	-1.0245|-1.0245	8|4	0.59425|.	D|.	0.04|.	.|.	0.241|0.241	0.00192|0.00192	0.362:0.2246:0.2135:0.1999|0.362:0.2246:0.2135:0.1999	rs2976653;rs59817342|rs2976653;rs59817342	349|.	Q6ZMY9|.	ZN517_HUMAN|.	A|R	349|316	ENSP00000353058:V349A;ENSP00000436103:V349A|.	ENSP00000353058:V349A|.	V|W	+|+	2|1	0|0	ZNF517|ZNF517	146004151|146004151	0.001000|0.001000	0.12720|0.12720	0.002000|0.002000	0.10522|0.10522	0.004000|0.004000	0.04260|0.04260	-0.400000|-0.400000	0.07241|0.07241	-0.612000|-0.612000	0.05701|0.05701	-1.157000|-1.157000	0.01802|0.01802	GTG|TGG	G|0.992;C|0.006		0.746	ZNF517-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382642.1	XM_291261	
PTPRD	5789	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	8528683	8528683	+	Missense_Mutation	SNP	C	C	A	rs149175517		TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr9:8528683C>A	ENST00000381196.4	-	12	992	c.449G>T	c.(448-450)aGt>aTt	p.S150I	PTPRD_ENST00000397611.3_Missense_Mutation_p.S150I|PTPRD_ENST00000537002.1_Missense_Mutation_p.S150I|PTPRD_ENST00000463477.1_Missense_Mutation_p.S150I|PTPRD_ENST00000358503.5_Missense_Mutation_p.S150I|PTPRD_ENST00000540109.1_Missense_Mutation_p.S150I|PTPRD_ENST00000356435.5_Missense_Mutation_p.S150I|PTPRD_ENST00000360074.4_Missense_Mutation_p.S150I|PTPRD_ENST00000355233.5_Missense_Mutation_p.S150I|PTPRD_ENST00000397606.3_Missense_Mutation_p.S150I|PTPRD_ENST00000486161.1_Missense_Mutation_p.S150I|PTPRD_ENST00000397617.3_Missense_Mutation_p.S150I	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	150	Ig-like C2-type 2.				heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		CGGATTACCACTGGCTGCACA	0.493										TSP Lung(15;0.13)																											p.S150I		.											.	PTPRD-912	0			c.G449T						.						129.0	117.0	121.0					9																	8528683		2203	4300	6503	SO:0001583	missense	5789	exon4			TTACCACTGGCTG	X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.449G>T	9.37:g.8528683C>A	ENSP00000370593:p.Ser150Ile	Somatic	104	0		WXS	Illumina GAIIx	Phase_I	72	61	NM_001040712	0	0	0	0	0	B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Missense_Mutation	SNP	ENST00000381196.4	37	CCDS43786.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.975983	0.74360	.	.	ENSG00000153707	ENST00000381196;ENST00000356435;ENST00000360074;ENST00000358503;ENST00000355233;ENST00000397617;ENST00000397611;ENST00000537002;ENST00000346816;ENST00000540109;ENST00000486161;ENST00000397606;ENST00000463477	T;T;T;T;T;T;T;T;T;T;T;T	0.68331	-0.32;-0.32;-0.32;-0.32;-0.32;-0.32;-0.32;-0.32;-0.32;-0.32;-0.32;2.56	6.17	6.17	0.99709	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.78246	0.4253	L	0.45228	1.405	0.80722	D	1	D;D;D;D;D;D;D;P;D;P	0.89917	0.999;0.993;0.986;0.977;0.998;0.998;0.992;0.951;1.0;0.922	D;D;P;P;D;P;P;P;D;P	0.87578	0.998;0.927;0.902;0.575;0.927;0.851;0.881;0.449;0.987;0.471	T	0.73260	-0.4039	9	.	.	.	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	150;150;150;150;150;150;150;150;150;150	C9J8S8;Q3KPJ2;Q3KPI9;Q3KPJ0;Q3KPJ1;F5GWT7;F5GWY7;G3XAE2;Q2HXI4;P23468	.;.;.;.;.;.;.;.;.;PTPRD_HUMAN	I	150	ENSP00000370593:S150I;ENSP00000348812:S150I;ENSP00000353187:S150I;ENSP00000351293:S150I;ENSP00000347373:S150I;ENSP00000380741:S150I;ENSP00000380735:S150I;ENSP00000440515:S150I;ENSP00000438164:S150I;ENSP00000417093:S150I;ENSP00000380731:S150I;ENSP00000417661:S150I	.	S	-	2	0	PTPRD	8518683	1.000000	0.71417	1.000000	0.80357	0.847000	0.48162	7.818000	0.86416	2.941000	0.99782	0.655000	0.94253	AGT	C|1.000;T|0.000		0.493	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055395.3		
FREM1	158326	bcgsc.ca	37	9	14801687	14801687	+	Silent	SNP	T	T	C	rs10738380	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr9:14801687T>C	ENST00000380880.3	-	20	4440	c.3657A>G	c.(3655-3657)gcA>gcG	p.A1219A	FREM1_ENST00000380881.4_Silent_p.A1220A|FREM1_ENST00000422223.2_Silent_p.A1219A			Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1	1219					cell communication (GO:0007154)|cell-matrix adhesion (GO:0007160)|craniofacial suture morphogenesis (GO:0097094)	basement membrane (GO:0005604)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(40)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	100				GBM - Glioblastoma multiforme(50;3.53e-06)		TGTGAACAGGTGCATGTTTCT	0.443													T|||	886	0.176917	0.0325	0.1945	5008	,	,		19888	0.2312		0.2336	False		,,,				2504	0.2454				p.A1219A		.											.	FREM1-138	0			c.A3657G						.	T		241,3679		4,233,1723	130.0	129.0	129.0		3657	0.3	0.0	9	dbSNP_120	129	1933,6383		235,1463,2460	no	coding-synonymous	FREM1	NM_144966.5		239,1696,4183	CC,CT,TT		23.2443,6.148,17.7672		1219/2180	14801687	2174,10062	1960	4158	6118	SO:0001819	synonymous_variant	158326	exon21			AACAGGTGCATGT	AK058190	CCDS47952.1, CCDS55293.1	9p22.3	2010-06-04	2004-12-15	2004-12-15	ENSG00000164946	ENSG00000164946			23399	protein-coding gene	gene with protein product		608944	"""chromosome 9 open reading frame 154"""	C9orf154		12838346, 15345741	Standard	NM_144966		Approved	FLJ25461, C9orf145, C9orf143, DKFZp686M16108, TILRR	uc003zlm.3	Q5H8C1	OTTHUMG00000019575	ENST00000380880.3:c.3657A>G	9.37:g.14801687T>C		Somatic	232	1		WXS	Illumina GAIIx	Phase_I	172	6	NM_144966	0	0	1	1	0	B7ZBX4|Q5VV00|Q5VV01|Q6MZI4|Q8NEG9|Q96LI3	Silent	SNP	ENST00000380880.3	37	CCDS47952.1																																																																																			T|0.834;C|0.166		0.443	FREM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339474.2	NM_144966	
FANCG	2189	bcgsc.ca	37	9	35076482	35076482	+	Silent	SNP	G	G	T			TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr9:35076482G>T	ENST00000378643.3	-	8	1514	c.1023C>A	c.(1021-1023)ggC>ggA	p.G341G	FANCG_ENST00000476212.1_Intron	NM_004629.1	NP_004620.1	O15287	FANCG_HUMAN	Fanconi anemia, complementation group G	341					cell cycle checkpoint (GO:0000075)|DNA repair (GO:0006281)|mitochondrion organization (GO:0007005)|ovarian follicle development (GO:0001541)|response to radiation (GO:0009314)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	damaged DNA binding (GO:0003684)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(7)|ovary(2)|prostate(3)|stomach(1)	28			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			GGCTCTGAGTGCCACAATGAA	0.542			"""Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks																													p.G341G		.	yes	Rec		Fanconi anaemia G	9	9p13	2189	"""Fanconi anemia, complementation group G"""		L	.	FANCG-724	0			c.C1023A						.						153.0	115.0	128.0					9																	35076482		2203	4300	6503	SO:0001819	synonymous_variant	2189	exon8			CTGAGTGCCACAA	AJ007669	CCDS6574.1	9p13	2014-09-17			ENSG00000221829	ENSG00000221829		"""Fanconi anemia, complementation groups"""	3588	protein-coding gene	gene with protein product	"""DNA repair protein XRCC9"", ""X-ray repair, complementing defective, in Chinese hamster, 9"", ""X-ray repair complementing defective repair in Chinese hamster cells 9"""	602956		XRCC9		9256465, 9382107	Standard	NM_004629		Approved	FAG	uc003zwb.1	O15287	OTTHUMG00000019850	ENST00000378643.3:c.1023C>A	9.37:g.35076482G>T		Somatic	189	0		WXS	Illumina GAIIx	Phase_I	126	6	NM_004629	0	0	7	7	0		Silent	SNP	ENST00000378643.3	37	CCDS6574.1																																																																																			.		0.542	FANCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052269.1	NM_004629	
CNTNAP3	79937	hgsc.bcm.edu	37	9	39133031	39133031	+	Missense_Mutation	SNP	C	C	A	rs11794921	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr9:39133031C>A	ENST00000297668.6	-	13	2051	c.1978G>T	c.(1978-1980)Gca>Tca	p.A660S	CNTNAP3_ENST00000358144.2_Missense_Mutation_p.A572S|CNTNAP3_ENST00000377656.2_Missense_Mutation_p.A659S|CNTNAP3_ENST00000323947.7_Missense_Mutation_p.A566S|CNTNAP3_ENST00000377659.1_Missense_Mutation_p.A659S	NM_033655.3	NP_387504.2	Q9BZ76	CNTP3_HUMAN	contactin associated protein-like 3	660	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				cell adhesion (GO:0007155)|cell recognition (GO:0008037)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|liver(2)|lung(8)|ovary(1)|upper_aerodigestive_tract(2)	24				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		GCGCCCGCTGCGTACGCGAAG	0.776													C|||	239	0.0477236	0.0673	0.013	5008	,	,		12988	0.1121		0.0159	False		,,,				2504	0.0123				p.A660S		.											.	CNTNAP3-91	0			c.G1978T						.						3.0	4.0	3.0					9																	39133031		1172	2464	3636	SO:0001583	missense	79937	exon13			CCGCTGCGTACGC	AF333769	CCDS6616.1	9q12	2008-02-05			ENSG00000106714	ENSG00000106714			13834	protein-coding gene	gene with protein product	"""cell recognition molecule CASPR3 (FLJ14195, KIAA1714)"""	610517				12093160	Standard	NM_033655		Approved	CASPR3, KIAA1714, FLJ14195, CNTNAP3A	uc004abi.3	Q9BZ76	OTTHUMG00000019954	ENST00000297668.6:c.1978G>T	9.37:g.39133031C>A	ENSP00000297668:p.Ala660Ser	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	12	6	NM_033655	0	0	0	2	2	B1AMA0|Q9C0E9	Missense_Mutation	SNP	ENST00000297668.6	37	CCDS6616.1	110	0.05036630036630037	36	0.07317073170731707	7	0.019337016574585635	54	0.0944055944055944	13	0.017150395778364115	C	0.039	-1.290954	0.01375	.	.	ENSG00000106714	ENST00000297668;ENST00000377656;ENST00000358144;ENST00000323947;ENST00000377659	T;T;T;T;T	0.13420	2.59;2.59;2.59;2.59;2.99	2.48	-3.0	0.05480	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (1);	.	.	.	.	T	0.00144	0.0004	N	0.01493	-0.835	0.09310	N	1	B;B;B;B;B	0.11235	0.0;0.0;0.0;0.004;0.002	B;B;B;B;B	0.11329	0.0;0.001;0.001;0.004;0.006	T	0.40572	-0.9556	9	0.09843	T	0.71	.	2.9067	0.05723	0.3783:0.3798:0.0:0.2418	rs11794921	566;660;660;659;660	E2QRH2;Q96NU0;Q9BZ76-2;A6NC89;Q9BZ76	.;CNT3B_HUMAN;.;.;CNTP3_HUMAN	S	660;659;572;566;659	ENSP00000297668:A660S;ENSP00000366884:A659S;ENSP00000350863:A572S;ENSP00000320728:A566S;ENSP00000366887:A659S	ENSP00000297668:A660S	A	-	1	0	CNTNAP3	39123031	0.000000	0.05858	0.000000	0.03702	0.031000	0.12232	-0.155000	0.10115	-0.649000	0.05430	-0.696000	0.03686	GCA	C|0.949;A|0.051		0.776	CNTNAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052511.1	NM_033655	
CRB2	286204	hgsc.bcm.edu	37	9	126136139	126136139	+	Missense_Mutation	SNP	C	C	T	rs73571431	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr9:126136139C>T	ENST00000373631.3	+	10	3330	c.3329C>T	c.(3328-3330)aCg>aTg	p.T1110M	CRB2_ENST00000359999.3_Missense_Mutation_p.T1110M|CRB2_ENST00000373629.2_Missense_Mutation_p.T778M	NM_173689.5	NP_775960.4	Q5IJ48	CRUM2_HUMAN	crumbs family member 2	1110	EGF-like 13. {ECO:0000255|PROSITE- ProRule:PRU00076}.		T -> M (in dbSNP:rs73571431). {ECO:0000269|PubMed:15851977}.		cardiovascular system development (GO:0072358)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|mesoderm formation (GO:0001707)|negative regulation of endopeptidase activity (GO:0010951)|notochord formation (GO:0014028)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|somitogenesis (GO:0001756)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)			NS(2)|breast(1)|cervix(1)|endometrium(2)|lung(11)|ovary(1)|prostate(2)|skin(3)	23						CGCTGTCACACGCACCCCGAC	0.771													C|||	530	0.105831	0.1059	0.1873	5008	,	,		9885	0.0764		0.1412	False		,,,				2504	0.0419				p.T1110M		.											.	CRB2-91	0			c.C3329T						.	C	MET/THR	273,2733		10,253,1240	3.0	3.0	3.0		3329	2.8	0.1	9	dbSNP_131	3	523,5481		24,475,2503	no	missense	CRB2	NM_173689.5	81	34,728,3743	TT,TC,CC		8.7109,9.0818,8.8346	possibly-damaging	1110/1286	126136139	796,8214	1503	3002	4505	SO:0001583	missense	286204	exon10			GTCACACGCACCC	AK095783	CCDS6852.2	9q33.2	2014-02-06	2014-02-06		ENSG00000148204	ENSG00000148204			18688	protein-coding gene	gene with protein product		609720	"""crumbs homolog 2 (Drosophila)"""			14767562	Standard	XM_005251934		Approved	FLJ38464, FLJ16786	uc004bnx.1	Q5IJ48	OTTHUMG00000020638	ENST00000373631.3:c.3329C>T	9.37:g.126136139C>T	ENSP00000362734:p.Thr1110Met	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	5	NM_173689	0	0	0	0	0	A2A3N4|Q0QD46|Q5JS41|Q5JS43|Q6ZTA9|Q6ZWI6	Missense_Mutation	SNP	ENST00000373631.3	37	CCDS6852.2	272	0.12454212454212454	60	0.12195121951219512	50	0.13812154696132597	56	0.0979020979020979	106	0.13984168865435356	.	6.539	0.467763	0.12402	0.090818	0.087109	ENSG00000148204	ENST00000359999;ENST00000373631;ENST00000373629	D;D;D	0.90732	-2.1;-2.0;-2.72	3.77	2.82	0.32997	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	1.339200	0.05453	N	0.549893	T	0.01976	0.0062	N	0.12746	0.255	0.80722	P	0.0	P;D	0.56521	0.925;0.976	B;B	0.38562	0.101;0.276	T	0.57100	-0.7869	9	0.36615	T	0.2	.	3.1184	0.06382	0.0:0.4522:0.2781:0.2698	.	1110;1110	Q5IJ48;Q5IJ48-2	CRUM2_HUMAN;.	M	1110;1110;778	ENSP00000353092:T1110M;ENSP00000362734:T1110M;ENSP00000362732:T778M	ENSP00000353092:T1110M	T	+	2	0	CRB2	125175960	0.000000	0.05858	0.081000	0.20488	0.039000	0.13416	0.001000	0.13038	1.929000	0.55896	0.455000	0.32223	ACG	C|0.875;T|0.125		0.771	CRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053990.3	NM_173689	
FPGS	2356	hgsc.bcm.edu	37	9	130565267	130565267	+	Missense_Mutation	SNP	A	A	G	rs11554717|rs10760502	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr9:130565267A>G	ENST00000373247.2	+	1	114	c.64A>G	c.(64-66)Ata>Gta	p.I22V	FPGS_ENST00000373245.1_Missense_Mutation_p.I22V|FPGS_ENST00000373225.3_5'Flank|FPGS_ENST00000393706.2_Missense_Mutation_p.I22V|FPGS_ENST00000460181.1_3'UTR	NM_004957.4	NP_004948.4	Q05932	FOLC_HUMAN	folylpolyglutamate synthase	22			I -> V (in dbSNP:rs10760502). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:7721888}.		brain development (GO:0007420)|folic acid metabolic process (GO:0046655)|liver development (GO:0001889)|nucleobase-containing compound metabolic process (GO:0006139)|one-carbon metabolic process (GO:0006730)|organ regeneration (GO:0031100)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|tetrahydrofolylpolyglutamate synthase activity (GO:0004326)			endometrium(2)|kidney(1)|lung(3)|ovary(1)	7					Methotrexate(DB00563)|Pralatrexate(DB06813)|Raltitrexed(DB00293)	TGCGCGCGGCATAACGACCCA	0.761													g|||	3912	0.78115	0.8956	0.6153	5008	,	,		6680	0.9583		0.6352	False		,,,				2504	0.7117				p.I22V		.											.	FPGS-90	0			c.A64G						.		VAL/ILE	2249,281		997,255,13	1.0	3.0	2.0		64	1.8	0.0	9	dbSNP_120	2	3848,1396		1394,1060,168	no	missense	FPGS	NM_004957.4	29	2391,1315,181	GG,GA,AA		26.6209,11.1067,21.5719	benign	22/588	130565267	6097,1677	1265	2622	3887	SO:0001583	missense	2356	exon1			CGCGGCATAACGA		CCDS35148.1, CCDS35149.1, CCDS75905.1	9q34.11	2013-09-19			ENSG00000136877	ENSG00000136877	6.3.2.17		3824	protein-coding gene	gene with protein product		136510					Standard	NM_004957		Approved		uc004bsg.1	Q05932	OTTHUMG00000020716	ENST00000373247.2:c.64A>G	9.37:g.130565267A>G	ENSP00000362344:p.Ile22Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_004957	0	0	0	6	6	B3KPW4|B7Z2Z3|F5H0K6|Q5JU19|Q5JU22|Q6P2P6	Missense_Mutation	SNP	ENST00000373247.2	37	CCDS35148.1	1668	0.7637362637362637	432	0.8780487804878049	215	0.5939226519337016	545	0.9527972027972028	476	0.6279683377308707	g	3.002	-0.205821	0.06180	0.888933	0.733791	ENSG00000136877	ENST00000373247;ENST00000373245;ENST00000393706;ENST00000373228	T;T;T;T	0.29655	3.02;1.56;3.03;1.56	4.93	1.83	0.25207	.	0.868559	0.09918	N	0.738853	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.37361	-0.9709	9	0.02654	T	1	-12.2003	6.0757	0.19913	0.2469:0.2097:0.5434:0.0	rs10760502;rs17855899;rs56845445	22;22	Q05932-4;Q05932	.;FOLC_HUMAN	V	22	ENSP00000362344:I22V;ENSP00000362342:I22V;ENSP00000377309:I22V;ENSP00000362325:I22V	ENSP00000362325:I22V	I	+	1	0	FPGS	129605088	0.000000	0.05858	0.001000	0.08648	0.021000	0.10359	0.242000	0.18087	0.210000	0.20664	-0.258000	0.10820	ATA	A|0.235;G|0.765		0.761	FPGS-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054251.1		
SNAPC4	6621	broad.mit.edu	37	9	139277995	139277997	+	In_Frame_Del	DEL	GCT	GCT	-	rs147271628|rs34427285|rs35266724|rs34222232	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr9:139277995_139277997delGCT	ENST00000298532.2	-	15	1992_1994	c.1624_1626delAGC	c.(1624-1626)agcdel	p.S542del		NM_003086.2	NP_003077.2			small nuclear RNA activating complex, polypeptide 4, 190kDa									p.S542delS(2)		biliary_tract(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(3)|skin(2)|urinary_tract(1)	33		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.31e-06)|Epithelial(140;7.13e-06)		CGTCCTCCTCgctgctgctgctg	0.69														955	0.190695	0.1808	0.3184	5008	,	,		11493	0.0565		0.2356	False		,,,				2504	0.2055				p.542_542del		.											.	SNAPC4-90	2	Deletion - In frame(2)	prostate(1)|central_nervous_system(1)	c.1624_1626del						.																																			SO:0001651	inframe_deletion	6621	exon15			CTCCTCGCTGCTG	AF032387	CCDS6998.1	9q34.3	2008-07-21	2002-08-29		ENSG00000165684	ENSG00000165684			11137	protein-coding gene	gene with protein product		602777	"""small nuclear RNA activating complex, polypeptide 4, 190kD"""			9418884	Standard	XM_005266096		Approved	SNAP190, PTFalpha, FLJ13451	uc004chh.3	Q5SXM2	OTTHUMG00000020929	ENST00000298532.2:c.1624_1626delAGC	9.37:g.139278004_139278006delGCT	ENSP00000298532:p.Ser542del	Somatic	26	0		WXS	Illumina GAIIx	Phase_I	260	10	NM_003086	0	0	0	0	0		In_Frame_Del	DEL	ENST00000298532.2	37	CCDS6998.1																																																																																			.		0.690	SNAPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055071.1	NM_003086	
Unknown	0	bcgsc.ca;mdanderson.org	37	Y	21154569	21154569	+	IGR	SNP	A	A	G	rs17855271		TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chrY:21154569A>G								TTTY14 (114455 upstream) : RNU6-255P (26299 downstream)																							GCCCCAGCCCAAGCCTGGCCA	0.612																																					p.L9L		.											.	.	0			c.T27C						.																																			SO:0001628	intergenic_variant	100133941	exon1			CAGCCCAAGCCTG																													Y.37:g.21154569A>G		Somatic	59	0		WXS	Illumina GAIIx	Phase_I	41	21	NM_013230	0	0	0	0	0		Silent	SNP		37																																																																																				.	0	0.612								
TTTY14	83869	bcgsc.ca;mdanderson.org	37	Y	21154603	21154603	+	IGR	SNP	A	A	C	rs79788321		TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chrY:21154603A>C								TTTY14 (114489 upstream) : RNU6-255P (26265 downstream)																							CATGTCCCCTACGTCGGTGCG	0.662																																					.		.											.	.	0			.						.																																			SO:0001628	intergenic_variant	100133941	.			TCCCCTACGTCGG																													Y.37:g.21154603A>C		Somatic	30	0		WXS	Illumina GAIIx	Phase_I	49	39	.	0	0	0	0	0		RNA	SNP		37																																																																																				.	0	0.662								
SIX6	4990	broad.mit.edu	37	14	60977896	60977897	+	Frame_Shift_Ins	INS	-	-	C	rs372216093		TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr14:60977896_60977897insC	ENST00000327720.5	+	2	1115_1116	c.667_668insC	c.(667-669)gccfs	p.A223fs		NM_007374.2	NP_031400.2	O95475	SIX6_HUMAN	SIX homeobox 6	223					organ morphogenesis (GO:0009887)|visual perception (GO:0007601)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)			NS(1)|autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(2)	11				OV - Ovarian serous cystadenocarcinoma(108;0.088)		CACCAGCCCGGCCGCCAGTCTA	0.663																																					p.A223fs		.											.	SIX6-90	0			c.667_668insC						.																																			SO:0001589	frameshift_variant	4990	exon2			AGCCCGGCCGCCA	AF141651	CCDS9747.1	14q23.1	2011-06-20	2007-07-13		ENSG00000184302	ENSG00000184302		"""Homeoboxes / SINE class"""	10892	protein-coding gene	gene with protein product		606326	"""sine oculis homeobox (Drosophila) homolog 6"", ""sine oculis homeobox homolog 6 (Drosophila)"""	OPTX2		10512683	Standard	NM_007374		Approved	Six9	uc001xfa.4	O95475	OTTHUMG00000152339	ENST00000327720.5:c.669dupC	14.37:g.60977898_60977898dupC	ENSP00000328596:p.Ala223fs	Somatic	41	0		WXS	Illumina GAIIx	Phase_I	143	11	NM_007374	0	0	0	0	0	Q6NT42|Q9P1X8	Frame_Shift_Ins	INS	ENST00000327720.5	37	CCDS9747.1																																																																																			.		0.663	SIX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276952.2		
PELP1	27043	hgsc.bcm.edu	37	17	4576216	4576217	+	In_Frame_Ins	INS	-	-	GGCATGGGGCCTGCTGAA	rs147763003	byFrequency	TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr17:4576216_4576217insGGCATGGGGCCTGCTGAA	ENST00000574876.1	-	16	2086_2087	c.2069_2070insTTCAGCAGGCCCCATGCC	c.(2068-2070)ccc>ccTTCAGCAGGCCCCATGCCc	p.690_690P>PSAGPMP	PELP1_ENST00000572293.1_In_Frame_Ins_p.740_740P>PSAGPMP|PELP1_ENST00000269230.7_In_Frame_Ins_p.600_600P>PSAGPMP|PELP1_ENST00000436683.2_In_Frame_Ins_p.543_543P>PSAGPMP|AC091153.4_ENST00000441700.2_RNA|PELP1_ENST00000301396.4_In_Frame_Ins_p.834_834P>PSAGPMP			Q8IZL8	PELP1_HUMAN	proline, glutamate and leucine rich protein 1	690	Pro-rich.				cellular response to estrogen stimulus (GO:0071391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|MLL1 complex (GO:0071339)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcriptionally active chromatin (GO:0035327)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(2)|endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	15						GGCCTGCTGAGGGCATGGGGCC	0.688																																					p.P690delinsPSAGPMP		.											.	PELP1-24	0			c.2070_2071insTTCAGCAGGCCCCATGCC						.																																			SO:0001652	inframe_insertion	27043	exon16			TGCTGAGGGCATG		CCDS58503.1, CCDS58503.2, CCDS62038.1	17p13.2	2012-05-02	2008-02-21			ENSG00000141456			30134	protein-coding gene	gene with protein product		609455	"""proline, glutamic acid and leucine rich protein 1"""			11481323, 12682072	Standard	NM_014389		Approved	MNAR	uc002fyi.4	Q8IZL8		ENST00000574876.1:c.2052_2069dupTTCAGCAGGCCCCATGCC	17.37:g.4576216_4576217insGGCATGGGGCCTGCTGAA	ENSP00000461625:p.SerAlaGlyProMetPro690dup	Somatic	27	0		WXS	Illumina GAIIx	Phase_I	47	0	NM_014389	0	0	0	0	0	O15450|Q5EGN3|Q6NTE6|Q96FT1|Q9BU60	In_Frame_Ins	INS	ENST00000574876.1	37	CCDS58503.1																																																																																			.		0.688	PELP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000439140.2	NM_014389	
NEFH	4744	broad.mit.edu	37	22	29885622	29885623	+	In_Frame_Ins	INS	-	-	AGGAAG	rs267607534|rs267607535		TCGA-OR-A5JJ-01A-11D-A29I-10	TCGA-OR-A5JJ-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dcf5e656-aebe-41de-8011-62b30c3ec4f2	17fa8960-7a43-4e72-a0fe-b97cf4734610	g.chr22:29885622_29885623insAGGAAG	ENST00000310624.6	+	4	2026_2027	c.1993_1994insAGGAAG	c.(1993-1995)aag>aAGGAAGag	p.665_666insEE		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	671	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						GTCCCCTGAGAAGGCCAAGTCC	0.579																																					p.K665delinsKEE		.											.	NEFH-90	0			c.1993_1994insAGGAAG						.																																			SO:0001652	inframe_insertion	4744	exon4			CCTGAGAAGGCCA		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	Exception_encountered	22.37:g.29885622_29885623insAGGAAG	ENSP00000311997:p.Lys665_Ala666insGluGlu	Somatic	421	0		WXS	Illumina GAIIx	Phase_I	490	9	NM_021076	0	0	0	0	0	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	In_Frame_Ins	INS	ENST00000310624.6	37	CCDS13858.1																																																																																			.		0.579	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
