#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PRKCZ	5590	bcgsc.ca	37	1	2103506	2103506	+	Silent	SNP	C	C	G	rs2280272	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr1:2103506C>G	ENST00000400921.2	+	9	1208	c.525C>G	c.(523-525)gcC>gcG	p.A175A	PRKCZ_ENST00000400920.1_Silent_p.A175A|PRKCZ_ENST00000479263.1_3'UTR	NM_001033581.1	NP_001028753.1	Q05513	KPCZ_HUMAN	protein kinase C, zeta	358					actin cytoskeleton reorganization (GO:0031532)|activation of phospholipase D activity (GO:0031584)|activation of protein kinase B activity (GO:0032148)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|establishment of cell polarity (GO:0030010)|inflammatory response (GO:0006954)|insulin receptor signaling pathway (GO:0008286)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|membrane hyperpolarization (GO:0060081)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of apoptotic process (GO:0043066)|negative regulation of hydrolase activity (GO:0051346)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of protein complex assembly (GO:0031333)|neuron projection extension (GO:1990138)|peptidyl-serine phosphorylation (GO:0018105)|platelet activation (GO:0030168)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of glucose import (GO:0046326)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of interleukin-10 secretion (GO:2001181)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T-helper 2 cell cytokine production (GO:2000553)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|protein heterooligomerization (GO:0051291)|protein kinase C signaling (GO:0070528)|protein localization to plasma membrane (GO:0072659)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vesicle transport along microtubule (GO:0047496)	apical cortex (GO:0045179)|apical plasma membrane (GO:0016324)|axon hillock (GO:0043203)|cell junction (GO:0030054)|cell leading edge (GO:0031252)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane raft (GO:0045121)|microtubule organizing center (GO:0005815)|myelin sheath abaxonal region (GO:0035748)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)	ATP binding (GO:0005524)|insulin receptor substrate binding (GO:0043560)|potassium channel regulator activity (GO:0015459)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(4)|endometrium(1)|large_intestine(5)|lung(5)|stomach(1)	18	all_cancers(77;0.000177)|all_epithelial(69;6.41e-05)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;1.14e-19)|all_lung(118;1.22e-08)|Lung NSC(185;1.24e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;2.96e-37)|OV - Ovarian serous cystadenocarcinoma(86;3.3e-23)|GBM - Glioblastoma multiforme(42;2.85e-08)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.00294)|BRCA - Breast invasive adenocarcinoma(365;0.00493)|STAD - Stomach adenocarcinoma(132;0.00669)|KIRC - Kidney renal clear cell carcinoma(229;0.0411)|Lung(427;0.213)	Tamoxifen(DB00675)	TCTACGCGGCCGAGATCTGCA	0.642													C|||	81	0.0161741	0.0	0.0014	5008	,	,		17537	0.0744		0.0	False		,,,				2504	0.0051				p.A358A		.											.	PRKCZ-1465	0			c.C1074G						.	C	,,,	6,4400	9.9+/-24.2	0,6,2197	75.0	58.0	64.0		525,525,762,1074	-5.3	0.5	1	dbSNP_100	64	3,8597	3.0+/-9.4	0,3,4297	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PRKCZ	NM_001033581.1,NM_001033582.1,NM_001242874.1,NM_002744.4	,,,	0,9,6494	GG,GC,CC		0.0349,0.1362,0.0692	,,,	175/410,175/410,254/489,358/593	2103506	9,12997	2203	4300	6503	SO:0001819	synonymous_variant	5590	exon12			CGCGGCCGAGATC	BC014270	CCDS37.1, CCDS41229.1, CCDS55563.1	1p36.33-p36.2	2009-07-10			ENSG00000067606	ENSG00000067606	2.7.11.1		9412	protein-coding gene	gene with protein product		176982					Standard	NM_001242874		Approved	PKC2	uc001aiq.3	Q05513	OTTHUMG00000001238	ENST00000400921.2:c.525C>G	1.37:g.2103506C>G		Somatic	99	1		WXS	Illumina GAIIx	Phase_I	80	6	NM_002744	0	0	10	10	0	A8K4N0|A8MU64|B7Z2J7|E9PCW2|Q15207|Q5SYT5|Q969S4	Silent	SNP	ENST00000400921.2	37	CCDS41229.1																																																																																			C|0.994;G|0.006		0.642	PRKCZ-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000098533.3	NM_002744	
HES3	390992	hgsc.bcm.edu	37	1	6305292	6305292	+	Missense_Mutation	SNP	C	C	A	rs61760836	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr1:6305292C>A	ENST00000377898.3	+	4	351	c.286C>A	c.(286-288)Ccc>Acc	p.P96T		NM_001024598.3	NP_001019769.1	Q5TGS1	HES3_HUMAN	hes family bHLH transcription factor 3	96	Orange.				hindbrain morphogenesis (GO:0021575)|in utero embryonic development (GO:0001701)|midbrain development (GO:0030901)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oculomotor nerve development (GO:0021557)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of timing of neuron differentiation (GO:0060164)|transcription, DNA-templated (GO:0006351)|trochlear nerve development (GO:0021558)	nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription factor binding (GO:0008134)			lung(2)|skin(1)	3	Ovarian(185;0.0634)	all_cancers(23;2.48e-32)|all_epithelial(116;1.14e-17)|all_lung(118;2.85e-06)|all_neural(13;3.68e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;3.77e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00475)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;1.2e-37)|GBM - Glioblastoma multiforme(13;3.2e-29)|OV - Ovarian serous cystadenocarcinoma(86;2.52e-19)|Colorectal(212;1.19e-07)|COAD - Colon adenocarcinoma(227;1.3e-05)|Kidney(185;4.88e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000871)|BRCA - Breast invasive adenocarcinoma(365;0.00105)|STAD - Stomach adenocarcinoma(132;0.00308)|READ - Rectum adenocarcinoma(331;0.0642)|Lung(427;0.241)		CCCCCTGGTGCCCGAGAGCGC	0.751													C|||	2794	0.557907	0.3079	0.755	5008	,	,		7447	0.5615		0.6849	False		,,,				2504	0.6217				p.P96T		.											.	HES3-514	0			c.C286A						.	C	THR/PRO	1430,1518		391,648,435	2.0	3.0	2.0		286	2.4	0.2	1	dbSNP_129	2	4911,1731		1926,1059,336	no	missense	HES3	NM_001024598.3	38	2317,1707,771	AA,AC,CC		26.0614,48.5075,33.879	benign	96/187	6305292	6341,3249	1474	3321	4795	SO:0001583	missense	390992	exon4			CTGGTGCCCGAGA		CCDS41238.1	1p36.31	2013-10-17	2013-10-17		ENSG00000173673	ENSG00000173673		"""Basic helix-loop-helix proteins"""	26226	protein-coding gene	gene with protein product		609971	"""hairy and enhancer of split 3 (Drosophila)"""				Standard	NM_001024598		Approved	bHLHb43	uc009vly.2	Q5TGS1	OTTHUMG00000001271	ENST00000377898.3:c.286C>A	1.37:g.6305292C>A	ENSP00000367130:p.Pro96Thr	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_001024598	0	0	0	0	0	Q5TGS0	Missense_Mutation	SNP	ENST00000377898.3	37	CCDS41238.1	1241	0.5682234432234432	158	0.32113821138211385	254	0.7016574585635359	313	0.5472027972027972	516	0.6807387862796834	C	2.270	-0.367136	0.05069	0.485075	0.739386	ENSG00000173673	ENST00000377898	T	0.29397	1.57	3.31	2.4	0.29515	.	.	.	.	.	T	0.00012	0.0000	N	0.14661	0.345	0.80722	P	0.0	B	0.22003	0.063	B	0.17098	0.017	T	0.30765	-0.9967	8	0.11794	T	0.64	-26.1056	6.4315	0.21798	0.0:0.8639:0.0:0.1361	rs61760836	96	Q5TGS1	HES3_HUMAN	T	96	ENSP00000367130:P96T	ENSP00000367130:P96T	P	+	1	0	HES3	6227879	0.724000	0.28038	0.207000	0.23584	0.040000	0.13550	1.220000	0.32491	0.982000	0.38575	0.289000	0.19496	CCC	C|0.430;A|0.570		0.751	HES3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000003716.3	NM_001024598	
HES3	390992	hgsc.bcm.edu	37	1	6305303	6305303	+	Silent	SNP	C	C	A	rs61760837	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr1:6305303C>A	ENST00000377898.3	+	4	362	c.297C>A	c.(295-297)gcC>gcA	p.A99A		NM_001024598.3	NP_001019769.1	Q5TGS1	HES3_HUMAN	hes family bHLH transcription factor 3	99	Orange.				hindbrain morphogenesis (GO:0021575)|in utero embryonic development (GO:0001701)|midbrain development (GO:0030901)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oculomotor nerve development (GO:0021557)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of timing of neuron differentiation (GO:0060164)|transcription, DNA-templated (GO:0006351)|trochlear nerve development (GO:0021558)	nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription factor binding (GO:0008134)			lung(2)|skin(1)	3	Ovarian(185;0.0634)	all_cancers(23;2.48e-32)|all_epithelial(116;1.14e-17)|all_lung(118;2.85e-06)|all_neural(13;3.68e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;3.77e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00475)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;1.2e-37)|GBM - Glioblastoma multiforme(13;3.2e-29)|OV - Ovarian serous cystadenocarcinoma(86;2.52e-19)|Colorectal(212;1.19e-07)|COAD - Colon adenocarcinoma(227;1.3e-05)|Kidney(185;4.88e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000871)|BRCA - Breast invasive adenocarcinoma(365;0.00105)|STAD - Stomach adenocarcinoma(132;0.00308)|READ - Rectum adenocarcinoma(331;0.0642)|Lung(427;0.241)		CCGAGAGCGCCGCCGGCAGCA	0.771													C|||	2792	0.557508	0.3079	0.7536	5008	,	,		7640	0.5615		0.6839	False		,,,				2504	0.6217				p.A99A		.											.	HES3-514	0			c.C297A						.	C		1446,1378		419,608,385	2.0	3.0	2.0		297	0.2	0.0	1	dbSNP_129	2	4876,1552		1960,956,298	no	coding-synonymous	HES3	NM_001024598.3		2379,1564,683	AA,AC,CC		24.1444,48.796,31.6688		99/187	6305303	6322,2930	1412	3214	4626	SO:0001819	synonymous_variant	390992	exon4			GAGCGCCGCCGGC		CCDS41238.1	1p36.31	2013-10-17	2013-10-17		ENSG00000173673	ENSG00000173673		"""Basic helix-loop-helix proteins"""	26226	protein-coding gene	gene with protein product		609971	"""hairy and enhancer of split 3 (Drosophila)"""				Standard	NM_001024598		Approved	bHLHb43	uc009vly.2	Q5TGS1	OTTHUMG00000001271	ENST00000377898.3:c.297C>A	1.37:g.6305303C>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_001024598	0	0	0	0	0	Q5TGS0	Silent	SNP	ENST00000377898.3	37	CCDS41238.1																																																																																			C|0.438;A|0.562		0.771	HES3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000003716.3	NM_001024598	
H6PD	9563	bcgsc.ca	37	1	9307033	9307033	+	Silent	SNP	G	G	A	rs7524046	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr1:9307033G>A	ENST00000377403.2	+	3	938	c.636G>A	c.(634-636)gcG>gcA	p.A212A	H6PD_ENST00000602477.1_Silent_p.A223A	NM_001282587.1|NM_004285.3	NP_001269516.1|NP_004276.2	O95479	G6PE_HUMAN	hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)	212	Glucose 1-dehydrogenase.				pentose-phosphate shunt (GO:0006098)|response to alcohol (GO:0097305)	endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)	6-phosphogluconolactonase activity (GO:0017057)|carbohydrate binding (GO:0030246)|glucose 1-dehydrogenase [NAD(P)] activity (GO:0047936)|glucose-6-phosphate dehydrogenase activity (GO:0004345)|NADP binding (GO:0050661)			breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)	23	all_lung(157;0.23)	all_epithelial(116;1.28e-19)|all_lung(118;5.22e-06)|Lung NSC(185;1.98e-05)|Renal(390;0.000147)|Breast(348;0.00109)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;1.88e-07)|COAD - Colon adenocarcinoma(227;7.47e-05)|Kidney(185;0.000244)|KIRC - Kidney renal clear cell carcinoma(229;0.000905)|STAD - Stomach adenocarcinoma(132;0.00176)|BRCA - Breast invasive adenocarcinoma(304;0.00183)|READ - Rectum adenocarcinoma(331;0.0419)		AGGCTGTGGCGCAGATCCTGC	0.602													g|||	1115	0.222644	0.1074	0.2622	5008	,	,		15526	0.4038		0.2445	False		,,,				2504	0.1411				p.A212A		.											.	H6PD-90	0			c.G636A						.	A		698,3708	294.4+/-283.1	51,596,1556	94.0	91.0	92.0		636	-10.1	0.6	1	dbSNP_116	92	2054,6546	357.1+/-330.6	238,1578,2484	no	coding-synonymous	H6PD	NM_004285.3		289,2174,4040	AA,AG,GG		23.8837,15.842,21.1595		212/792	9307033	2752,10254	2203	4300	6503	SO:0001819	synonymous_variant	9563	exon3			TGTGGCGCAGATC	AJ012590	CCDS101.1, CCDS72697.1	1p36	2008-02-05	2003-10-10		ENSG00000049239	ENSG00000049239	1.1.1.47		4795	protein-coding gene	gene with protein product		138090	"""glucose dehyrogenase"""	GDH		10349511	Standard	NM_001282587		Approved		uc001apt.3	O95479	OTTHUMG00000001768	ENST00000377403.2:c.636G>A	1.37:g.9307033G>A		Somatic	121	1		WXS	Illumina GAIIx	Phase_I	72	4	NM_004285	0	0	0	0	0	Q4TT33|Q66I35|Q68DT3	Silent	SNP	ENST00000377403.2	37	CCDS101.1																																																																																			G|0.772;A|0.228		0.602	H6PD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004928.2	NM_004285	
KIF17	57576	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	21013968	21013968	+	Silent	SNP	G	G	A			TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr1:21013968G>A	ENST00000247986.2	-	8	2161	c.1851C>T	c.(1849-1851)gcC>gcT	p.A617A	KIF17_ENST00000490034.1_Intron|KIF17_ENST00000400463.3_Silent_p.A617A|KIF17_ENST00000375044.1_Silent_p.A517A			Q9P2E2	KIF17_HUMAN	kinesin family member 17	617					ATP catabolic process (GO:0006200)|cell projection organization (GO:0030030)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|neurogenesis (GO:0022008)|protein complex localization (GO:0031503)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			NS(2)|endometrium(3)|kidney(3)|large_intestine(9)|liver(1)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)		CTTCCACCTCGGCAAACGGGT	0.652																																					p.A617A		.											.	KIF17-94	0			c.C1851T						.						68.0	64.0	65.0					1																	21013968		2203	4300	6503	SO:0001819	synonymous_variant	57576	exon8			CACCTCGGCAAAC	AB037826	CCDS213.1, CCDS44079.1, CCDS72722.1	1p36.13	2012-08-01			ENSG00000117245	ENSG00000117245		"""Kinesins"""	19167	protein-coding gene	gene with protein product	"""kinesin-like protein KIF17"", ""KIF3-related motor protein"", ""KIF17 variant protein"""	605037				10846156	Standard	XR_241202		Approved	KIAA1405, KIF3X, KIF17B, OSM-3, KLP-2	uc001bdr.4	Q9P2E2	OTTHUMG00000002863	ENST00000247986.2:c.1851C>T	1.37:g.21013968G>A		Somatic	117	0		WXS	Illumina GAIIx	Phase_I	67	37	NM_001122819	0	0	0	0	0	A2A3Q7|A2A3Q8|O95077|Q53YS6|Q5VWA9|Q6GSA8|Q8N411	Silent	SNP	ENST00000247986.2	37	CCDS213.1																																																																																			.		0.652	KIF17-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276995.1	NM_020816	
LUZP1	7798	bcgsc.ca	37	1	23418803	23418803	+	Missense_Mutation	SNP	G	G	C	rs35645814	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr1:23418803G>C	ENST00000302291.4	-	4	2753	c.1952C>G	c.(1951-1953)tCc>tGc	p.S651C	LUZP1_ENST00000314174.5_Missense_Mutation_p.S651C|LUZP1_ENST00000374623.3_Missense_Mutation_p.S651C|LUZP1_ENST00000418342.1_Missense_Mutation_p.S651C			Q86V48	LUZP1_HUMAN	leucine zipper protein 1	651					artery development (GO:0060840)|neural fold bending (GO:0021503)|ventricular septum development (GO:0003281)	membrane (GO:0016020)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(12)|upper_aerodigestive_tract(2)	31		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Ovarian(437;0.00373)|Breast(348;0.00815)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;4.88e-27)|Colorectal(126;8.36e-08)|COAD - Colon adenocarcinoma(152;4.31e-06)|GBM - Glioblastoma multiforme(114;8.64e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00112)|KIRC - Kidney renal clear cell carcinoma(1967;0.00176)|STAD - Stomach adenocarcinoma(196;0.0146)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.0967)|LUSC - Lung squamous cell carcinoma(448;0.199)		TCTGCCACTGGATTTGATGAC	0.478													G|||	17	0.00339457	0.0008	0.0029	5008	,	,		22089	0.0		0.0139	False		,,,				2504	0.0				p.S651C		.											.	LUZP1-90	0			c.C1952G						.	G	CYS/SER,CYS/SER	15,4391	23.3+/-48.9	0,15,2188	176.0	166.0	169.0		1952,1952	1.6	0.1	1	dbSNP_126	169	117,8483	61.7+/-123.6	2,113,4185	yes	missense,missense	LUZP1	NM_001142546.1,NM_033631.3	112,112	2,128,6373	CC,CG,GG		1.3605,0.3404,1.0149	possibly-damaging,possibly-damaging	651/1077,651/1077	23418803	132,12874	2203	4300	6503	SO:0001583	missense	7798	exon4			CCACTGGATTTGA	BC051733	CCDS30628.1	1p36	2008-02-05			ENSG00000169641	ENSG00000169641			14985	protein-coding gene	gene with protein product		601422				8812416	Standard	NM_033631		Approved	LUZP	uc010odv.1	Q86V48	OTTHUMG00000003227	ENST00000302291.4:c.1952C>G	1.37:g.23418803G>C	ENSP00000303758:p.Ser651Cys	Somatic	202	0		WXS	Illumina GAIIx	Phase_I	173	6	NM_033631	0	0	0	0	0	Q5TH93|Q8N4X3|Q8TEH1	Missense_Mutation	SNP	ENST00000302291.4	37	CCDS30628.1	11	0.005036630036630037	1	0.0020325203252032522	1	0.0027624309392265192	0	0.0	9	0.011873350923482849	G	13.12	2.141010	0.37825	0.003404	0.013605	ENSG00000169641	ENST00000418342;ENST00000374623;ENST00000302291;ENST00000314174	T;T;T;T	0.17054	2.52;2.52;2.52;2.3	5.74	1.62	0.23740	.	0.602245	0.14982	N	0.287204	T	0.10035	0.0246	L	0.54323	1.7	0.09310	N	0.999999	B;B	0.10296	0.003;0.003	B;B	0.08055	0.003;0.003	T	0.24941	-1.0146	10	0.46703	T	0.11	.	3.6656	0.08254	0.1449:0.1318:0.5869:0.1364	rs35645814	651;651	Q86V48-2;Q86V48	.;LUZP1_HUMAN	C	651	ENSP00000393460:S651C;ENSP00000363752:S651C;ENSP00000303758:S651C;ENSP00000313705:S651C	ENSP00000303758:S651C	S	-	2	0	LUZP1	23291390	0.048000	0.20356	0.068000	0.19968	0.957000	0.61999	1.218000	0.32467	0.049000	0.15920	0.650000	0.86243	TCC	G|0.991;C|0.009		0.478	LUZP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008900.3	NM_033631	
FOXD3	27022	hgsc.bcm.edu	37	1	63788951	63788951	+	Silent	SNP	C	C	A	rs2274187	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr1:63788951C>A	ENST00000371116.2	+	1	222	c.222C>A	c.(220-222)ccC>ccA	p.P74P	RP4-792G4.2_ENST00000426393.1_RNA|RP4-792G4.2_ENST00000449386.1_RNA|RP4-792G4.2_ENST00000418244.1_RNA|RP4-792G4.2_ENST00000431294.1_RNA|RP4-792G4.2_ENST00000427268.1_RNA	NM_012183.2	NP_036315.1	Q9UJU5	FOXD3_HUMAN	forkhead box D3	74					embryonic placenta development (GO:0001892)|in utero embryonic development (GO:0001701)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|trophectodermal cell differentiation (GO:0001829)	nuclear chromatin (GO:0000790)	double-stranded DNA binding (GO:0003690)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|lung(2)|upper_aerodigestive_tract(1)	5						CTCAGCCGCCCCACCAGCAGC	0.781													c|||	590	0.117812	0.0136	0.1873	5008	,	,		7772	0.1617		0.1829	False		,,,				2504	0.0971				p.P74P	Pancreas(68;276 1750 11966 31252)	.											.	FOXD3-226	0			c.C222A						.						3.0	5.0	4.0					1																	63788951		1601	3141	4742	SO:0001819	synonymous_variant	27022	exon1			GCCGCCCCACCAG	AF197560	CCDS624.1	1p31.3	2008-04-10			ENSG00000187140	ENSG00000187140		"""Forkhead boxes"""	3804	protein-coding gene	gene with protein product		611539				8499623	Standard	NM_012183		Approved	Genesis, HFH2	uc001dax.2	Q9UJU5	OTTHUMG00000009141	ENST00000371116.2:c.222C>A	1.37:g.63788951C>A		Somatic	4	0		WXS	Illumina GAIIx	Phase_I	19	15	NM_012183	0	0	0	0	0	Q9BYM2|Q9UDD1	Silent	SNP	ENST00000371116.2	37	CCDS624.1																																																																																			C|0.842;A|0.158		0.781	FOXD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025331.1		
CTBS	1486	hgsc.bcm.edu	37	1	85040024	85040024	+	Silent	SNP	C	C	T			TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr1:85040024C>T	ENST00000370630.5	-	1	123	c.75G>A	c.(73-75)ctG>ctA	p.L25L	CTBS_ENST00000477677.1_5'UTR	NM_004388.2	NP_004379.1	Q01459	DIAC_HUMAN	chitobiase, di-N-acetyl-	25					chitin catabolic process (GO:0006032)|oligosaccharide catabolic process (GO:0009313)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	chitinase activity (GO:0004568)			breast(1)|endometrium(1)|large_intestine(4)|lung(2)|ovary(1)	9				all cancers(265;0.00727)|Epithelial(280;0.0192)|OV - Ovarian serous cystadenocarcinoma(397;0.166)		ccagcagcgccagcagcgcTA	0.726																																					p.L25L		.											.	CTBS-90	0			c.G75A						.						3.0	4.0	4.0					1																	85040024		1689	3502	5191	SO:0001819	synonymous_variant	1486	exon1			CAGCGCCAGCAGC	M95767	CCDS698.1	1p22	2010-05-04			ENSG00000117151	ENSG00000117151	3.2.1.-		2496	protein-coding gene	gene with protein product		600873		CTB		1549114, 7606925	Standard	NM_004388		Approved		uc001dka.2	Q01459	OTTHUMG00000009922	ENST00000370630.5:c.75G>A	1.37:g.85040024C>T		Somatic	8	0		WXS	Illumina GAIIx	Phase_I	36	3	NM_004388	0	0	1	1	0	Q5VX50	Silent	SNP	ENST00000370630.5	37	CCDS698.1																																																																																			.		0.726	CTBS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027457.2	NM_004388	
SPRR3	6707	ucsc.edu;mdanderson.org	37	1	152975715	152975715	+	Silent	SNP	C	C	T	rs28989168	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr1:152975715C>T	ENST00000295367.4	+	2	261	c.219C>T	c.(217-219)ggC>ggT	p.G73G	SPRR3_ENST00000331860.3_Silent_p.G73G|SPRR3_ENST00000542696.1_Silent_p.G73G	NM_001097589.1	NP_001091058.1	Q9UBC9	SPRR3_HUMAN	small proline-rich protein 3	73	14 X 8 AA approximate tandem repeats.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	structural molecule activity (GO:0005198)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	11	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			CTGAGCCAGGCTGTACCAAGG	0.577													T|||	2	0.000399361	0.0015	0.0	5008	,	,		14904	0.0		0.0	False		,,,				2504	0.0				p.G73G		.											.	SPRR3-45	0			c.C219T						.						42.0	39.0	40.0					1																	152975715		2182	4268	6450	SO:0001819	synonymous_variant	6707	exon2			GCCAGGCTGTACC	AY118269	CCDS1033.1	1q21-q22	2008-02-05			ENSG00000163209	ENSG00000163209			11268	protein-coding gene	gene with protein product		182271				8325635	Standard	NM_005416		Approved		uc001faz.4	Q9UBC9	OTTHUMG00000013872	ENST00000295367.4:c.219C>T	1.37:g.152975715C>T		Somatic	111	0		WXS	Illumina GAIIx	Phase_I	97	47	NM_001097589	0	0	0	0	0	A5YKK8|B2R4G8|D3DV32|O75597|Q4ZGI7|Q5T525|Q8NET7|Q9UDG3	Silent	SNP	ENST00000295367.4	37	CCDS1033.1																																																																																			A|0.000;C|0.697;T|0.303		0.577	SPRR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000038910.1	NM_005416	
SPRR3	6707	hgsc.bcm.edu;ucsc.edu	37	1	152975739	152975739	+	Silent	SNP	T	T	A	rs17851565	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr1:152975739T>A	ENST00000295367.4	+	2	285	c.243T>A	c.(241-243)ggT>ggA	p.G81G	SPRR3_ENST00000331860.3_Silent_p.G81G|SPRR3_ENST00000542696.1_Silent_p.G81G	NM_001097589.1	NP_001091058.1	Q9UBC9	SPRR3_HUMAN	small proline-rich protein 3	81	14 X 8 AA approximate tandem repeats.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	structural molecule activity (GO:0005198)	p.G81G(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	11	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			CTGAGCCAGGTTGTACCAAGG	0.592																																					p.G81G		.											.	SPRR3-45	1	Substitution - coding silent(1)	prostate(1)	c.T243A						.						61.0	52.0	55.0					1																	152975739		2203	4299	6502	SO:0001819	synonymous_variant	6707	exon2			GCCAGGTTGTACC	AY118269	CCDS1033.1	1q21-q22	2008-02-05			ENSG00000163209	ENSG00000163209			11268	protein-coding gene	gene with protein product		182271				8325635	Standard	NM_005416		Approved		uc001faz.4	Q9UBC9	OTTHUMG00000013872	ENST00000295367.4:c.243T>A	1.37:g.152975739T>A		Somatic	123	0		WXS	Illumina GAIIx	Phase_I	97	22	NM_001097589	0	0	0	0	0	A5YKK8|B2R4G8|D3DV32|O75597|Q4ZGI7|Q5T525|Q8NET7|Q9UDG3	Silent	SNP	ENST00000295367.4	37	CCDS1033.1																																																																																			A|0.010;C|0.001;T|0.988		0.592	SPRR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000038910.1	NM_005416	
BPNT1	10380	hgsc.bcm.edu	37	1	220236230	220236230	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr1:220236230G>C	ENST00000469520.2	-	8	990	c.541C>G	c.(541-543)Cag>Gag	p.Q181E	BPNT1_ENST00000544404.1_Missense_Mutation_p.Q126E|BPNT1_ENST00000414869.2_Missense_Mutation_p.Q145E|BPNT1_ENST00000482136.1_5'UTR|BPNT1_ENST00000354807.3_Missense_Mutation_p.Q196E|BPNT1_ENST00000322067.7_Missense_Mutation_p.Q181E			O95861	BPNT1_HUMAN	3'(2'), 5'-bisphosphate nucleotidase 1	181					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|dephosphorylation (GO:0016311)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|phosphatidylinositol phosphorylation (GO:0046854)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	3'(2'),5'-bisphosphate nucleotidase activity (GO:0008441)|inositol-1,4-bisphosphate 1-phosphatase activity (GO:0004441)|magnesium ion binding (GO:0000287)	p.Q181*(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(9)|ovary(1)|skin(1)	14				GBM - Glioblastoma multiforme(131;0.0558)		TCTTTCAGCTGAAACCCAAAG	0.483																																					p.Q181E		.											.	BPNT1-91	1	Substitution - Nonsense(1)	skin(1)	c.C541G						.						110.0	125.0	120.0					1																	220236230		1911	4125	6036	SO:0001583	missense	10380	exon7			TCAGCTGAAACCC	AF125042	CCDS41469.1, CCDS65787.1, CCDS65788.1	1q42	2008-02-05			ENSG00000162813	ENSG00000162813	3.1.3.7		1096	protein-coding gene	gene with protein product		604053				10224133	Standard	XM_005272998		Approved		uc001hma.3	O95861	OTTHUMG00000037435	ENST00000469520.2:c.541C>G	1.37:g.220236230G>C	ENSP00000446828:p.Gln181Glu	Somatic	228	1		WXS	Illumina GAIIx	Phase_I	118	31	NM_006085	0	0	0	0	0	A8K7C8|B4DPS5|B4DUS9|D3DTA9|Q8WVL5|Q9UGJ3	Missense_Mutation	SNP	ENST00000469520.2	37	CCDS41469.1	.	.	.	.	.	.	.	.	.	.	G	3.581	-0.085603	0.07097	.	.	ENSG00000162813	ENST00000322067;ENST00000469520;ENST00000354807;ENST00000302686;ENST00000544404;ENST00000414869;ENST00000463953	D;D;D;D;D;D	0.81908	-1.55;-1.55;-1.55;-1.55;-1.55;-1.55	5.58	5.58	0.84498	.	0.104661	0.64402	D	0.000002	T	0.61825	0.2378	N	0.03177	-0.4	0.49582	D	0.999803	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.0;0.002;0.001	T	0.60919	-0.7167	10	0.02654	T	1	.	14.7623	0.69614	0.0:0.2631:0.7368:0.0	.	145;196;181	B4DUS9;A6NF51;O95861	.;.;BPNT1_HUMAN	E	181;181;196;181;126;145;145	ENSP00000318852:Q181E;ENSP00000446828:Q181E;ENSP00000346862:Q196E;ENSP00000444398:Q126E;ENSP00000410348:Q145E;ENSP00000446953:Q145E	ENSP00000307087:Q181E	Q	-	1	0	BPNT1	218302853	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.752000	0.55172	2.780000	0.95670	0.655000	0.94253	CAG	.		0.483	BPNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091137.2	NM_006085	
BPNT1	10380	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	220236230	220236233	+	Frame_Shift_Del	DEL	GAAA	GAAA	-			TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	GAAA	GAAA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr1:220236230_220236233delGAAA	ENST00000469520.2	-	8	987_990	c.538_541delTTTC	c.(538-543)tttcagfs	p.FQ180fs	BPNT1_ENST00000544404.1_Frame_Shift_Del_p.FQ125fs|BPNT1_ENST00000414869.2_Frame_Shift_Del_p.FQ144fs|BPNT1_ENST00000482136.1_5'UTR|BPNT1_ENST00000354807.3_Frame_Shift_Del_p.FQ195fs|BPNT1_ENST00000322067.7_Frame_Shift_Del_p.FQ180fs			O95861	BPNT1_HUMAN	3'(2'), 5'-bisphosphate nucleotidase 1	180					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|dephosphorylation (GO:0016311)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|phosphatidylinositol phosphorylation (GO:0046854)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	3'(2'),5'-bisphosphate nucleotidase activity (GO:0008441)|inositol-1,4-bisphosphate 1-phosphatase activity (GO:0004441)|magnesium ion binding (GO:0000287)	p.Q181*(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(9)|ovary(1)|skin(1)	14				GBM - Glioblastoma multiforme(131;0.0558)		TCTTTCAGCTGAAACCCAAAGGCG	0.475																																					p.180_181del		.											.	BPNT1-91	1	Substitution - Nonsense(1)	skin(1)	c.538_541del						.																																			SO:0001589	frameshift_variant	10380	exon7			TCAGCTGAAACCC	AF125042	CCDS41469.1, CCDS65787.1, CCDS65788.1	1q42	2008-02-05			ENSG00000162813	ENSG00000162813	3.1.3.7		1096	protein-coding gene	gene with protein product		604053				10224133	Standard	XM_005272998		Approved		uc001hma.3	O95861	OTTHUMG00000037435	ENST00000469520.2:c.538_541delTTTC	1.37:g.220236230_220236233delGAAA	ENSP00000446828:p.Phe180fs	Somatic	228	0		WXS	Illumina GAIIx	Phase_I	120	23	NM_006085	0	0	0	0	0	A8K7C8|B4DPS5|B4DUS9|D3DTA9|Q8WVL5|Q9UGJ3	Frame_Shift_Del	DEL	ENST00000469520.2	37	CCDS41469.1																																																																																			.		0.475	BPNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091137.2	NM_006085	
BPNT1	10380	hgsc.bcm.edu	37	1	220236234	220236255	+	Frame_Shift_Del	DEL	CCCAAAGGCGCCTAAACCTAAA	CCCAAAGGCGCCTAAACCTAAA	-	rs111614124		TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	CCCAAAGGCGCCTAAACCTAAA	CCCAAAGGCGCCTAAACCTAAA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr1:220236234_220236255delCCCAAAGGCGCCTAAACCTAAA	ENST00000469520.2	-	8	965_986	c.516_537delTTTAGGTTTAGGCGCCTTTGGG	c.(514-537)gttttaggtttaggcgcctttgggfs	p.VLGLGAFG172fs	BPNT1_ENST00000544404.1_Frame_Shift_Del_p.VLGLGAFG117fs|BPNT1_ENST00000414869.2_Frame_Shift_Del_p.VLGLGAFG136fs|BPNT1_ENST00000482136.1_5'UTR|BPNT1_ENST00000354807.3_Frame_Shift_Del_p.VLGLGAFG187fs|BPNT1_ENST00000322067.7_Frame_Shift_Del_p.VLGLGAFG172fs			O95861	BPNT1_HUMAN	3'(2'), 5'-bisphosphate nucleotidase 1	172					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|dephosphorylation (GO:0016311)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|phosphatidylinositol phosphorylation (GO:0046854)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	3'(2'),5'-bisphosphate nucleotidase activity (GO:0008441)|inositol-1,4-bisphosphate 1-phosphatase activity (GO:0004441)|magnesium ion binding (GO:0000287)			breast(1)|endometrium(1)|large_intestine(1)|lung(9)|ovary(1)|skin(1)	14				GBM - Glioblastoma multiforme(131;0.0558)		TCAGCTGAAACCCAAAGGCGCCTAAACCTAAAACTCCCCAGA	0.473																																					p.172_179del		.											.	BPNT1-91	0			c.516_537del						.																																			SO:0001589	frameshift_variant	10380	exon7			CTGAAACCCAAAG	AF125042	CCDS41469.1, CCDS65787.1, CCDS65788.1	1q42	2008-02-05			ENSG00000162813	ENSG00000162813	3.1.3.7		1096	protein-coding gene	gene with protein product		604053				10224133	Standard	XM_005272998		Approved		uc001hma.3	O95861	OTTHUMG00000037435	ENST00000469520.2:c.516_537delTTTAGGTTTAGGCGCCTTTGGG	1.37:g.220236234_220236255delCCCAAAGGCGCCTAAACCTAAA	ENSP00000446828:p.Val172fs	Somatic	225	0		WXS	Illumina GAIIx	Phase_I	110	0	NM_006085	0	0	0	0	0	A8K7C8|B4DPS5|B4DUS9|D3DTA9|Q8WVL5|Q9UGJ3	Frame_Shift_Del	DEL	ENST00000469520.2	37	CCDS41469.1																																																																																			.		0.473	BPNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091137.2	NM_006085	
BPNT1	10380	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	220236235	220236252	+	In_Frame_Del	DEL	CCAAAGGCGCCTAAACCT	CCAAAGGCGCCTAAACCT	-	rs111614124		TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	CCAAAGGCGCCTAAACCT	CCAAAGGCGCCTAAACCT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr1:220236235_220236252delCCAAAGGCGCCTAAACCT	ENST00000469520.2	-	8	968_985	c.519_536delAGGTTTAGGCGCCTTTGG	c.(517-537)ttaggtttaggcgcctttggg>ttg	p.GLGAFG174del	BPNT1_ENST00000544404.1_In_Frame_Del_p.GLGAFG119del|BPNT1_ENST00000414869.2_In_Frame_Del_p.GLGAFG138del|BPNT1_ENST00000482136.1_5'UTR|BPNT1_ENST00000354807.3_In_Frame_Del_p.GLGAFG189del|BPNT1_ENST00000322067.7_In_Frame_Del_p.GLGAFG174del			O95861	BPNT1_HUMAN	3'(2'), 5'-bisphosphate nucleotidase 1	174					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|dephosphorylation (GO:0016311)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|phosphatidylinositol phosphorylation (GO:0046854)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	3'(2'),5'-bisphosphate nucleotidase activity (GO:0008441)|inositol-1,4-bisphosphate 1-phosphatase activity (GO:0004441)|magnesium ion binding (GO:0000287)			breast(1)|endometrium(1)|large_intestine(1)|lung(9)|ovary(1)|skin(1)	14				GBM - Glioblastoma multiforme(131;0.0558)		CAGCTGAAACCCAAAGGCGCCTAAACCTAAAACTCCCC	0.472																																					p.173_179del		.											.	BPNT1-91	0			c.519_536del						.																																			SO:0001651	inframe_deletion	10380	exon7			TGAAACCCAAAGG	AF125042	CCDS41469.1, CCDS65787.1, CCDS65788.1	1q42	2008-02-05			ENSG00000162813	ENSG00000162813	3.1.3.7		1096	protein-coding gene	gene with protein product		604053				10224133	Standard	XM_005272998		Approved		uc001hma.3	O95861	OTTHUMG00000037435	ENST00000469520.2:c.519_536delAGGTTTAGGCGCCTTTGG	1.37:g.220236235_220236252delCCAAAGGCGCCTAAACCT	ENSP00000446828:p.Gly174_Gly179del	Somatic	222	0		WXS	Illumina GAIIx	Phase_I	95	23	NM_006085	0	0	0	0	0	A8K7C8|B4DPS5|B4DUS9|D3DTA9|Q8WVL5|Q9UGJ3	In_Frame_Del	DEL	ENST00000469520.2	37	CCDS41469.1																																																																																			.		0.472	BPNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091137.2	NM_006085	
IRF2BP2	359948	hgsc.bcm.edu	37	1	234744413	234744413	+	Silent	SNP	C	C	A	rs4636	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr1:234744413C>A	ENST00000366609.3	-	1	858	c.828G>T	c.(826-828)gcG>gcT	p.A276A	IRF2BP2_ENST00000491430.1_5'Flank|RP4-781K5.2_ENST00000436039.1_RNA|IRF2BP2_ENST00000366610.3_Silent_p.A276A	NM_182972.2	NP_892017.2	Q7Z5L9	I2BP2_HUMAN	interferon regulatory factor 2 binding protein 2	276					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	11	Ovarian(103;0.0303)	all_cancers(173;0.0236)|Prostate(94;0.0115)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)|Epithelial(3;6.2e-05)			CGGCCCCGGCCGCGGTGGACA	0.741													C|||	1306	0.260783	0.1619	0.2896	5008	,	,		9433	0.2083		0.4185	False		,,,				2504	0.2658				p.A276A		.											.	IRF2BP2-90	0			c.G828T						.	C	,	599,3223		57,485,1369	4.0	5.0	4.0		828,828	3.5	0.9	1	dbSNP_52	4	2729,5241		513,1703,1769	no	coding-synonymous,coding-synonymous	IRF2BP2	NM_001077397.1,NM_182972.2	,	570,2188,3138	AA,AC,CC		34.2409,15.6724,28.2225	,	276/572,276/588	234744413	3328,8464	1911	3985	5896	SO:0001819	synonymous_variant	359948	exon1			CCCGGCCGCGGTG	AY278023	CCDS1602.1, CCDS41475.1	1q42.3	2008-02-05			ENSG00000168264	ENSG00000168264			21729	protein-coding gene	gene with protein product		615332				12799427	Standard	NM_182972		Approved	IRF-2BP2	uc001hwg.3	Q7Z5L9	OTTHUMG00000037981	ENST00000366609.3:c.828G>T	1.37:g.234744413C>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	12	11	NM_182972	0	0	0	10	10	B1AM35|B1AM36|Q6P083|Q7Z5L8|Q8N351|Q8WUH8	Silent	SNP	ENST00000366609.3	37	CCDS1602.1																																																																																			C|0.714;A|0.286		0.741	IRF2BP2-002	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000092705.1	NM_182972	
ANKRD16	54522	hgsc.bcm.edu	37	10	5931230	5931230	+	Missense_Mutation	SNP	C	C	T	rs3750659	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr10:5931230C>T	ENST00000380094.5	-	1	631	c.88G>A	c.(88-90)Ggg>Agg	p.G30R	ANKRD16_ENST00000191063.8_Missense_Mutation_p.G30R|ANKRD16_ENST00000380092.4_Missense_Mutation_p.G30R|FBXO18_ENST00000362091.4_5'Flank|FBXO18_ENST00000397269.3_5'Flank	NM_019046.2	NP_061919.1	Q6P6B7	ANR16_HUMAN	ankyrin repeat domain 16	30										breast(1)|endometrium(1)|large_intestine(5)|lung(3)|stomach(2)	12						gggcagcccccggccgccTGC	0.786													C|||	303	0.0605032	0.0008	0.0346	5008	,	,		8341	0.1429		0.0368	False		,,,				2504	0.0992				p.G30R		.											.	ANKRD16-90	0			c.G88A						.	C	ARG/GLY,ARG/GLY,ARG/GLY	18,3412		0,18,1697	3.0	4.0	4.0		88,88,88	0.9	0.0	10	dbSNP_107	4	172,6644		1,170,3237	no	missense,missense,missense	ANKRD16	NM_001009941.2,NM_001009943.2,NM_019046.2	125,125,125	1,188,4934	TT,TC,CC		2.5235,0.5248,1.8544	benign,benign,benign	30/362,30/305,30/362	5931230	190,10056	1715	3408	5123	SO:0001583	missense	54522	exon1			AGCCCCCGGCCGC	AL137614	CCDS31136.1, CCDS31137.1	10p15.1	2013-01-10			ENSG00000134461	ENSG00000134461		"""Ankyrin repeat domain containing"""	23471	protein-coding gene	gene with protein product							Standard	NM_019046		Approved	DKFZP434N1511	uc010qat.2	Q6P6B7	OTTHUMG00000017610	ENST00000380094.5:c.88G>A	10.37:g.5931230C>T	ENSP00000369436:p.Gly30Arg	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	10	8	NM_001009943	0	0	0	0	0	A6NEF0|F8WEI4|Q9NT01	Missense_Mutation	SNP	ENST00000380094.5	37	CCDS31136.1	130	0.05952380952380952	17	0.034552845528455285	13	0.03591160220994475	69	0.12062937062937062	31	0.040897097625329816	C	15.52	2.858404	0.51376	0.005248	0.025235	ENSG00000134461	ENST00000380094;ENST00000380092;ENST00000191063	T;T;T	0.65549	-0.16;-0.16;0.17	4.22	0.951	0.19579	Ankyrin repeat-containing domain (1);	0.519198	0.21401	N	0.075148	T	0.00666	0.0022	N	0.24115	0.695	0.80722	P	0.0	B;B;B	0.17852	0.001;0.024;0.019	B;B;B	0.17433	0.003;0.018;0.009	T	0.04930	-1.0917	9	0.59425	D	0.04	-8.5351	5.2185	0.15356	0.0:0.5957:0.148:0.2563	rs3750659	30;30;30	Q6P6B7;C9JP28;F8WEI4	ANR16_HUMAN;.;.	R	30	ENSP00000369436:G30R;ENSP00000369434:G30R;ENSP00000352361:G30R	ENSP00000352361:G30R	G	-	1	0	ANKRD16	5971236	0.000000	0.05858	0.005000	0.12908	0.790000	0.44656	-0.387000	0.07361	0.353000	0.24079	0.430000	0.28490	GGG	C|0.938;T|0.062		0.786	ANKRD16-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046611.2	XM_166138	
RPP38	10557	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	15145497	15145497	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr10:15145497G>T	ENST00000378197.4	+	3	698	c.184G>T	c.(184-186)Gat>Tat	p.D62Y	NMT2_ENST00000466201.1_5'UTR|RPP38_ENST00000378202.5_Missense_Mutation_p.D62Y|RPP38_ENST00000451677.1_Intron	NM_183005.4	NP_892117.1	P78345	RPP38_HUMAN	ribonuclease P/MRP 38kDa subunit	62					RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|tRNA processing (GO:0008033)	nucleolar ribonuclease P complex (GO:0005655)|nucleus (GO:0005634)	ribonuclease P activity (GO:0004526)			breast(1)|endometrium(3)|large_intestine(1)|lung(2)|ovary(1)	8						GAAGATTGAAGATAAGAAGAA	0.408																																					p.D62Y	GBM(118;1591 1611 9649 34378 50720)	.											.	RPP38-91	0			c.G184T						.						51.0	55.0	54.0					10																	15145497		2203	4300	6503	SO:0001583	missense	10557	exon2			ATTGAAGATAAGA	U77664	CCDS7108.1	10p13	2012-05-21			ENSG00000152464	ENSG00000152464			30329	protein-coding gene	gene with protein product		606116				9037013, 9630247	Standard	NM_183005		Approved		uc001inx.5	P78345	OTTHUMG00000017728	ENST00000378197.4:c.184G>T	10.37:g.15145497G>T	ENSP00000367439:p.Asp62Tyr	Somatic	85	0		WXS	Illumina GAIIx	Phase_I	112	39	NM_001265601	0	0	8	11	3	B3KPY0|D3DRT8|Q53F71|Q8NHS8	Missense_Mutation	SNP	ENST00000378197.4	37	CCDS7108.1	.	.	.	.	.	.	.	.	.	.	G	12.69	2.012294	0.35511	.	.	ENSG00000152464	ENST00000378203;ENST00000378201;ENST00000378202;ENST00000378197;ENST00000441850	T;T;T;T	0.23552	2.9;2.9;2.9;1.9	5.75	2.42	0.29668	.	0.551000	0.19378	N	0.115726	T	0.22126	0.0533	M	0.68317	2.08	0.09310	N	1	P	0.42409	0.779	B	0.36808	0.233	T	0.19614	-1.0300	10	0.59425	D	0.04	-19.7047	5.0591	0.14548	0.2553:0.3088:0.4359:0.0	.	62	P78345	RPP38_HUMAN	Y	62	ENSP00000367445:D62Y;ENSP00000367444:D62Y;ENSP00000367439:D62Y;ENSP00000402635:D62Y	ENSP00000367439:D62Y	D	+	1	0	RPP38	15185503	0.997000	0.39634	0.507000	0.27676	0.405000	0.30901	0.871000	0.28023	0.765000	0.33221	0.650000	0.86243	GAT	.		0.408	RPP38-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046976.1	NM_006414	
DDX50	79009	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	70672928	70672928	+	Nonsense_Mutation	SNP	T	T	A			TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr10:70672928T>A	ENST00000373585.3	+	5	757	c.650T>A	c.(649-651)tTg>tAg	p.L217*	RNU6-571P_ENST00000384128.1_RNA	NM_024045.1	NP_076950.1	Q9BQ39	DDX50_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 50	217	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.					membrane (GO:0016020)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(5)|liver(2)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	29						GTACTTGTTTTGGCTCCAACA	0.343																																					p.L217X		.											.	DDX50-91	0			c.T650A						.						59.0	58.0	59.0					10																	70672928		2203	4300	6503	SO:0001587	stop_gained	79009	exon5			TTGTTTTGGCTCC	AF334103	CCDS7283.1	10q22.2	2010-09-30			ENSG00000107625	ENSG00000107625		"""DEAD-boxes"""	17906	protein-coding gene	gene with protein product		610373				11891046	Standard	NM_024045		Approved	GU2, MGC3199, GUB, RH-II/GuB	uc001jou.3	Q9BQ39	OTTHUMG00000018362	ENST00000373585.3:c.650T>A	10.37:g.70672928T>A	ENSP00000362687:p.Leu217*	Somatic	134	0		WXS	Illumina GAIIx	Phase_I	175	9	NM_024045	0	0	0	0	0	Q5VX37|Q8WV76|Q9BWI8	Nonsense_Mutation	SNP	ENST00000373585.3	37	CCDS7283.1	.	.	.	.	.	.	.	.	.	.	T	34	5.383397	0.95967	.	.	ENSG00000107625	ENST00000373585;ENST00000541832	.	.	.	5.05	5.05	0.67936	.	0.062829	0.64402	D	0.000007	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.9484	15.0866	0.72158	0.0:0.0:0.0:1.0	.	.	.	.	X	217	.	ENSP00000362687:L217X	L	+	2	0	DDX50	70342934	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.698000	0.84413	2.038000	0.60285	0.379000	0.24179	TTG	.		0.343	DDX50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048363.1	NM_024045	
CNNM1	26507	broad.mit.edu	37	10	101124187	101124187	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr10:101124187T>G	ENST00000356713.4	+	5	2331	c.2042T>G	c.(2041-2043)gTg>gGg	p.V681G	CNNM1_ENST00000370534.4_Missense_Mutation_p.V316G|CNNM1_ENST00000370528.3_Missense_Mutation_p.V610G|CNNM1_ENST00000446890.1_Missense_Mutation_p.V610G	NM_020348.2	NP_065081.2	Q9NRU3	CNNM1_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 1	681					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)	p.V316G(1)		NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(5)|ovary(1)|prostate(1)|skin(1)	25		Colorectal(252;0.234)		Epithelial(162;6.82e-10)|all cancers(201;5.62e-08)		AAAGTGGAGGTGGAGGTTGGT	0.433																																					p.V681G		.											.	CNNM1-68	1	Substitution - Missense(1)	skin(1)	c.T2042G						.						88.0	69.0	75.0					10																	101124187		2203	4300	6503	SO:0001583	missense	26507	exon5			TGGAGGTGGAGGT	AF169226	CCDS7478.2	10q24.2	2014-08-08	2014-08-07		ENSG00000119946	ENSG00000119946			102	protein-coding gene	gene with protein product		607802	"""cyclin M1"""	ACDP1		21393841	Standard	NM_020348		Approved		uc001kpp.4	Q9NRU3	OTTHUMG00000018881	ENST00000356713.4:c.2042T>G	10.37:g.101124187T>G	ENSP00000349147:p.Val681Gly	Somatic	35	7		WXS	Illumina GAIIx	Phase_I	41	13	NM_020348	0	0	0	0	0	Q4QQG7|Q4QQH8|Q4QQP9|Q9NT45	Missense_Mutation	SNP	ENST00000356713.4	37	CCDS7478.2	.	.	.	.	.	.	.	.	.	.	T	22.1	4.242197	0.79912	.	.	ENSG00000119946	ENST00000356713;ENST00000446890;ENST00000370528;ENST00000370534;ENST00000545665	D;D;D;D	0.90676	-2.65;-2.71;-2.63;-1.6	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	D	0.96112	0.8733	M	0.90542	3.125	0.80722	D	1	D;D;D;D	0.89917	1.0;0.997;0.999;0.996	D;D;D;D	0.81914	0.995;0.979;0.971;0.969	D	0.96895	0.9656	10	0.87932	D	0	-22.9685	15.9362	0.79712	0.0:0.0:0.0:1.0	.	316;681;316;681	F5H5J0;Q9NRU3-2;B7Z5S3;Q9NRU3	.;.;.;CNNM1_HUMAN	G	681;610;610;316;134	ENSP00000349147:V681G;ENSP00000406492:V610G;ENSP00000359559:V610G;ENSP00000359565:V316G	ENSP00000349147:V681G	V	+	2	0	CNNM1	101114177	1.000000	0.71417	1.000000	0.80357	0.821000	0.46438	7.841000	0.86834	2.170000	0.68504	0.379000	0.24179	GTG	.		0.433	CNNM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049792.2	NM_020348	
PDZD7	79955	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	10	102775566	102775566	+	IGR	SNP	G	G	A			TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr10:102775566G>A	ENST00000370215.3	-	0	2032					NM_024895.4	NP_079171.1	Q9H5P4	PDZD7_HUMAN	PDZ domain containing 7							cilium (GO:0005929)|extracellular space (GO:0005615)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22				Epithelial(162;6.98e-09)|all cancers(201;3.55e-07)		CCCCTCTCCTGGTCTGCAGGG	0.682																																					p.Q526X		.											.	PDZD7-136	0			c.C1576T						.																																			SO:0001628	intergenic_variant	79955	exon11			TCTCCTGGTCTGC	AK026862	CCDS31269.1, CCDS73182.1	10q24.32	2006-01-24		2006-01-24	ENSG00000186862	ENSG00000186862			26257	protein-coding gene	gene with protein product		612971		PDZK7		12477932	Standard	NM_024895		Approved	FLJ23209, bA108L7.8	uc021pxc.1	Q9H5P4	OTTHUMG00000018916		10.37:g.102775566G>A		Somatic	159	0		WXS	Illumina GAIIx	Phase_I	146	58	NM_001195263	0	0	0	0	0	D5FJ77|Q8N321	Nonsense_Mutation	SNP	ENST00000370215.3	37	CCDS31269.1	.	.	.	.	.	.	.	.	.	.	G	18.47	3.630232	0.67015	.	.	ENSG00000186862	ENST00000393462	.	.	.	4.88	1.78	0.24846	.	.	.	.	.	.	.	.	.	.	.	0.21627	N	0.999614	.	.	.	.	.	.	.	.	.	.	0.05525	T	0.97	.	6.9407	0.24490	0.1685:0.0:0.681:0.1505	.	.	.	.	X	526	.	ENSP00000377106:Q526X	Q	-	1	0	PDZD7	102765556	0.432000	0.25554	0.956000	0.39512	0.931000	0.56810	0.529000	0.23019	0.674000	0.31244	0.561000	0.74099	CAG	.		0.682	PDZD7-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049883.1	NM_024895	
EPS8L2	64787	broad.mit.edu	37	11	726471	726471	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr11:726471G>T	ENST00000533256.1	+	20	2296	c.1921G>T	c.(1921-1923)Gcc>Tcc	p.A641S	AP006621.9_ENST00000527021.2_RNA|EPS8L2_ENST00000318562.8_Missense_Mutation_p.A641S|EPS8L2_ENST00000526198.1_Missense_Mutation_p.A657S|EPS8L2_ENST00000530636.1_Missense_Mutation_p.A641S			Q9H6S3	ES8L2_HUMAN	EPS8-like 2	641					positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of ruffle assembly (GO:1900029)|regulation of Rho protein signal transduction (GO:0035023)|Rho protein signal transduction (GO:0007266)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)|vesicle (GO:0031982)	actin binding (GO:0003779)			NS(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|pancreas(1)|prostate(2)|soft_tissue(1)|urinary_tract(1)	13		all_cancers(49;1.24e-08)|all_epithelial(84;1.87e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;4.37e-27)|Epithelial(43;2.81e-26)|OV - Ovarian serous cystadenocarcinoma(40;1.33e-20)|BRCA - Breast invasive adenocarcinoma(625;4.29e-05)|Lung(200;0.0582)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGAAGCCAAGGCCTTCAGCCC	0.756																																					p.A641S		.											.	EPS8L2-91	0			c.G1921T						.																																			SO:0001583	missense	64787	exon19			GCCAAGGCCTTCA	AF318331	CCDS31328.1	11p15.5	2008-02-05				ENSG00000177106			21296	protein-coding gene	gene with protein product		614988				12620401	Standard	NM_022772		Approved	FLJ21935, FLJ22171, MGC3088	uc001lqt.3	Q9H6S3		ENST00000533256.1:c.1921G>T	11.37:g.726471G>T	ENSP00000435585:p.Ala641Ser	Somatic	54	2		WXS	Illumina GAIIx	Phase_I	44	8	NM_022772	0	0	0	0	0	B3KSX1|B7ZKL3|Q53GM8|Q8WYW7|Q96K06|Q9H6K9	Missense_Mutation	SNP	ENST00000533256.1	37	CCDS31328.1	.	.	.	.	.	.	.	.	.	.	G	13.36	2.212487	0.39102	.	.	ENSG00000177106	ENST00000318562;ENST00000533256;ENST00000530636;ENST00000526198	T;T;T;T	0.16196	2.36;2.36;2.36;2.36	3.3	1.09	0.20402	.	0.208508	0.29383	U	0.012303	T	0.11153	0.0272	L	0.27053	0.805	0.26101	N	0.980812	B;B	0.14438	0.01;0.01	B;B	0.10450	0.005;0.003	T	0.23297	-1.0192	10	0.45353	T	0.12	-19.1124	9.8968	0.41322	0.0:0.0:0.5629:0.4371	.	657;641	B7ZKL3;Q9H6S3	.;ES8L2_HUMAN	S	641;641;641;657	ENSP00000320828:A641S;ENSP00000435585:A641S;ENSP00000436035:A641S;ENSP00000436230:A657S	ENSP00000320828:A641S	A	+	1	0	EPS8L2	716471	1.000000	0.71417	0.995000	0.50966	0.558000	0.35554	2.264000	0.43302	0.706000	0.31912	0.298000	0.19748	GCC	.		0.756	EPS8L2-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382344.1	NM_022772	
MUC6	4588	bcgsc.ca	37	11	1017249	1017249	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr11:1017249C>T	ENST00000421673.2	-	31	5602	c.5552G>A	c.(5551-5553)aGt>aAt	p.S1851N		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1851	Approximate repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CGTGTGAGTACTTGGAGTCAC	0.542																																					p.S1851N		.											.	MUC6-23	0			c.G5552A						.																																			SO:0001583	missense	4588	exon31			TGAGTACTTGGAG	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5552G>A	11.37:g.1017249C>T	ENSP00000406861:p.Ser1851Asn	Somatic	1494	36		WXS	Illumina GAIIx	Phase_I	929	52	NM_005961	0	0	0	0	0	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	C	4.088	0.014305	0.07959	.	.	ENSG00000184956	ENST00000421673	T	0.19532	2.14	2.55	-0.458	0.12182	.	.	.	.	.	T	0.20901	0.0503	L	0.53249	1.67	0.09310	N	1	B	0.28128	0.201	B	0.38428	0.273	T	0.43410	-0.9393	9	0.15066	T	0.55	.	7.3143	0.26491	0.0:0.3432:0.4818:0.175	.	1851	Q6W4X9	MUC6_HUMAN	N	1851	ENSP00000406861:S1851N	ENSP00000406861:S1851N	S	-	2	0	MUC6	1007249	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.080000	0.14802	-0.083000	0.12618	-3.978000	0.00014	AGT	.		0.542	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
OR52B6	340980	bcgsc.ca	37	11	5602438	5602438	+	Missense_Mutation	SNP	T	T	A	rs541562623|rs2341432	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr11:5602438T>A	ENST00000345043.2	+	1	332	c.332T>A	c.(331-333)cTc>cAc	p.L111H	AC015691.13_ENST00000394793.2_RNA|HBG2_ENST00000380259.2_Intron	NM_001005162.2	NP_001005162.2	Q8NGF0	O52B6_HUMAN	olfactory receptor, family 52, subfamily B, member 6	111			L -> H (in dbSNP:rs2341432).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|lung(7)|ovary(1)|prostate(1)	12		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;3.56e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGTTATAGCCTCATTTCCTTT	0.502														3581	0.715056	0.7352	0.67	5008	,	,		23317	0.9802		0.4761	False		,,,				2504	0.6922				p.L111H		.											.	OR52B6-69	0			c.T332A						.	A	HIS/LEU	3064,1328	394.9+/-329.4	1077,910,209	109.0	110.0	109.0		332	2.7	0.0	11	dbSNP_100	109	4023,4567	578.8+/-390.8	936,2151,1208	yes	missense	OR52B6	NM_001005162.2	99	2013,3061,1417	AA,AT,TT		46.8335,30.2368,45.409	benign	111/336	5602438	7087,5895	2196	4295	6491	SO:0001583	missense	340980	exon1			ATAGCCTCATTTC	AB065858	CCDS41611.1	11p15.4	2012-08-09			ENSG00000187747	ENSG00000187747		"""GPCR / Class A : Olfactory receptors"""	15211	protein-coding gene	gene with protein product							Standard	NM_001005162		Approved		uc010qzi.2	Q8NGF0	OTTHUMG00000066906	ENST00000345043.2:c.332T>A	11.37:g.5602438T>A	ENSP00000341581:p.Leu111His	Somatic	225	0		WXS	Illumina GAIIx	Phase_I	162	7	NM_001005162	0	0	0	0	0	Q6IFI7	Missense_Mutation	SNP	ENST00000345043.2	37	CCDS41611.1	1483	0.6790293040293041	348	0.7073170731707317	227	0.6270718232044199	553	0.9667832167832168	355	0.4683377308707124	A	3.783	-0.045281	0.07452	0.697632	0.468335	ENSG00000187747	ENST00000345043	T	0.00554	6.64	5.15	2.71	0.32032	GPCR, rhodopsin-like superfamily (1);	0.686748	0.11712	N	0.536805	T	0.00012	0.0000	N	0.10707	0.03	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.38265	-0.9669	9	0.41790	T	0.15	.	5.9086	0.19014	0.5833:0.1517:0.0:0.265	rs2341432;rs16933200;rs52836118;rs60418242;rs2341432	111	Q8NGF0	O52B6_HUMAN	H	111	ENSP00000341581:L111H	ENSP00000341581:L111H	L	+	2	0	OR52B6	5559014	0.000000	0.05858	0.000000	0.03702	0.293000	0.27360	0.473000	0.22132	0.400000	0.25396	-0.265000	0.10407	CTC	T|0.358;A|0.642		0.502	OR52B6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143397.1	NM_001005162	
PCNXL3	399909	bcgsc.ca	37	11	65387378	65387378	+	Silent	SNP	T	T	A	rs61744384	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr11:65387378T>A	ENST00000355703.3	+	8	2522	c.1983T>A	c.(1981-1983)gcT>gcA	p.A661A		NM_032223.2	NP_115599.2	Q9H6A9	PCX3_HUMAN	pecanex-like 3 (Drosophila)	661						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)	13						CTGAGGGTGCTGTGCACTATT	0.612													T|||	2062	0.411741	0.2065	0.3228	5008	,	,		19233	0.4355		0.4672	False		,,,				2504	0.6708				p.A661A		.											.	PCNXL3-46	0			c.T1983A						.	T		1012,3214		128,756,1229	53.0	52.0	52.0		1983	-3.8	0.6	11	dbSNP_129	52	3728,4694		836,2056,1319	no	coding-synonymous	PCNXL3	NM_032223.2		964,2812,2548	AA,AT,TT		44.265,23.947,37.4763		661/2035	65387378	4740,7908	2113	4211	6324	SO:0001819	synonymous_variant	399909	exon8			GGGTGCTGTGCAC	BX640978	CCDS44650.1	11q12.1	2008-07-21			ENSG00000197136	ENSG00000197136			18760	protein-coding gene	gene with protein product						15146197	Standard	NM_032223		Approved	FLJ22427	uc001oey.2	Q9H6A9	OTTHUMG00000166539	ENST00000355703.3:c.1983T>A	11.37:g.65387378T>A		Somatic	116	1		WXS	Illumina GAIIx	Phase_I	76	4	NM_032223	0	0	0	0	0	Q6MZN8	Silent	SNP	ENST00000355703.3	37	CCDS44650.1																																																																																			T|0.604;A|0.396		0.612	PCNXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390321.1	NM_032223	
GAL3ST3	89792	hgsc.bcm.edu	37	11	65810209	65810209	+	Silent	SNP	C	C	T	rs61895584	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr11:65810209C>T	ENST00000312006.4	-	3	1346	c.1065G>A	c.(1063-1065)ccG>ccA	p.P355P	GAL3ST3_ENST00000527878.1_Silent_p.P355P	NM_033036.2	NP_149025.1	Q96A11	G3ST3_HUMAN	galactose-3-O-sulfotransferase 3	355					monosaccharide metabolic process (GO:0005996)|oligosaccharide metabolic process (GO:0009311)|poly-N-acetyllactosamine metabolic process (GO:0030309)|proteoglycan biosynthetic process (GO:0030166)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|carbohydrate binding (GO:0030246)|galactose 3-O-sulfotransferase activity (GO:0050694)|galactosylceramide sulfotransferase activity (GO:0001733)|proteoglycan sulfotransferase activity (GO:0050698)			kidney(1)|lung(9)|ovary(2)|skin(2)	14						TGGGCTGCCACGGCTGCAGCT	0.741													C|||	3763	0.751398	0.5408	0.8746	5008	,	,		7225	0.7649		0.8549	False		,,,				2504	0.8282				p.P355P		.											.	GAL3ST3-91	0			c.G1065A						.	C		1752,666		619,514,76	3.0	2.0	2.0		1065	-9.2	0.7	11	dbSNP_129	2	4565,363		2119,327,18	no	coding-synonymous	GAL3ST3	NM_033036.2		2738,841,94	TT,TC,CC		7.3661,27.5434,14.0076		355/432	65810209	6317,1029	1209	2464	3673	SO:0001819	synonymous_variant	89792	exon3			CTGCCACGGCTGC	AY026481	CCDS8128.1	11q13.1	2014-08-12			ENSG00000175229	ENSG00000175229		"""Sulfotransferases, membrane-bound"""	24144	protein-coding gene	gene with protein product		608234				11323440, 11356829	Standard	NM_033036		Approved	GAL3ST2	uc001ogw.3	Q96A11	OTTHUMG00000166667	ENST00000312006.4:c.1065G>A	11.37:g.65810209C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	4	NM_033036	0	0	0	0	0	Q14D05	Silent	SNP	ENST00000312006.4	37	CCDS8128.1																																																																																			C|0.233;T|0.767		0.741	GAL3ST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391052.1	NM_033036	
KLHL42	57542	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	27950800	27950800	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr12:27950800C>T	ENST00000381271.2	+	3	1530	c.1219C>T	c.(1219-1221)Cgc>Tgc	p.R407C	RP11-860B13.3_ENST00000543527.1_RNA	NM_020782.1	NP_065833.1	Q9P2K6	KLH42_HUMAN	kelch-like family member 42	407					mitotic nuclear division (GO:0007067)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein polyubiquitination (GO:0000209)|regulation of microtubule-based process (GO:0032886)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)											GGGGCCCAACCGCAGGAGCAG	0.582																																					p.R407C		.											.	.	0			c.C1219T						.						101.0	89.0	93.0					12																	27950800		2203	4300	6503	SO:0001583	missense	57542	exon3			CCCAACCGCAGGA	AB037761	CCDS31763.1	12p11.22	2013-04-24	2013-02-22	2013-01-30	ENSG00000087448	ENSG00000087448		"""Kelch-like"""	29252	protein-coding gene	gene with protein product			"""kelch domain containing 5"""	KLHDC5		19261606	Standard	NM_020782		Approved	KIAA1340, Ctb9	uc001rij.3	Q9P2K6	OTTHUMG00000169217	ENST00000381271.2:c.1219C>T	12.37:g.27950800C>T	ENSP00000370671:p.Arg407Cys	Somatic	193	0		WXS	Illumina GAIIx	Phase_I	216	75	NM_020782	0	0	7	11	4	Q2VPK1|Q8N334	Missense_Mutation	SNP	ENST00000381271.2	37	CCDS31763.1	.	.	.	.	.	.	.	.	.	.	C	17.13	3.310002	0.60414	.	.	ENSG00000087448	ENST00000381271	T	0.76060	-0.99	5.42	2.32	0.28847	Kelch-type beta propeller (1);	0.157867	0.47852	D	0.000218	T	0.60130	0.2245	L	0.34521	1.04	0.09310	N	0.999999	B	0.17465	0.022	B	0.08055	0.003	T	0.57027	-0.7881	10	0.72032	D	0.01	.	8.227	0.31575	0.1383:0.7083:0.0:0.1534	.	407	Q9P2K6	KLDC5_HUMAN	C	407	ENSP00000370671:R407C	ENSP00000370671:R407C	R	+	1	0	KLHDC5	27842067	0.062000	0.20869	0.076000	0.20297	0.986000	0.74619	1.383000	0.34385	1.269000	0.44280	0.655000	0.94253	CGC	.		0.582	KLHL42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402904.1	NM_020782	
LARP4	113251	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	50822742	50822742	+	Missense_Mutation	SNP	T	T	C	rs541317273	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr12:50822742T>C	ENST00000398473.2	+	3	303	c.191T>C	c.(190-192)aTa>aCa	p.I64T	LARP4_ENST00000347328.5_Missense_Mutation_p.I64T|LARP4_ENST00000293618.8_Missense_Mutation_p.I64T|LARP4_ENST00000522085.1_Missense_Mutation_p.I64T|LARP4_ENST00000518561.1_5'UTR|LARP4_ENST00000429001.3_Missense_Mutation_p.I70T|LARP4_ENST00000518444.1_Missense_Mutation_p.I63T	NM_052879.4|NM_199188.2	NP_443111.4|NP_954658.2	Q71RC2	LARP4_HUMAN	La ribonucleoprotein domain family, member 4	64					cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(3)|kidney(2)|large_intestine(2)|liver(2)|lung(7)|ovary(1)|skin(2)|urinary_tract(1)	23						TCAGAAGATATATGTAAAGAA	0.343													T|||	5	0.000998403	0.0	0.0	5008	,	,		17131	0.0		0.0	False		,,,				2504	0.0051				p.I64T		.											.	LARP4-91	0			c.T191C						.						77.0	73.0	74.0					12																	50822742		1813	4072	5885	SO:0001583	missense	113251	exon3			AAGATATATGTAA	AY004310	CCDS41782.1, CCDS44879.1, CCDS44880.1, CCDS44879.2, CCDS53789.1, CCDS53790.1	12q13.12	2005-08-09			ENSG00000161813	ENSG00000161813		"""La ribonucleoprotein domain containing"""	24320	protein-coding gene	gene with protein product						12477932	Standard	NM_052879		Approved	PP13296	uc001rwp.2	Q71RC2	OTTHUMG00000163724	ENST00000398473.2:c.191T>C	12.37:g.50822742T>C	ENSP00000381490:p.Ile64Thr	Somatic	38	0		WXS	Illumina GAIIx	Phase_I	35	14	NM_001170808	0	0	0	1	1	A8K6T1|E9PDG5|G3XAA8|G5E976|Q5CZ97|Q6ZV14|Q96NF9	Missense_Mutation	SNP	ENST00000398473.2	37	CCDS41782.1	.	.	.	.	.	.	.	.	.	.	T	0.012	-1.663150	0.00772	.	.	ENSG00000161813	ENST00000293618;ENST00000429001;ENST00000548174;ENST00000398473;ENST00000522085;ENST00000398464;ENST00000518444;ENST00000551886;ENST00000520064;ENST00000347328;ENST00000550260	T;T;T;T;T;T	0.40756	1.6;1.55;1.6;1.02;1.6;1.61	5.31	-3.27	0.05048	.	1.095370	0.06824	N	0.792755	T	0.15696	0.0378	N	0.08118	0	0.09310	N	1	B;B;B;B;B	0.19331	0.001;0.0;0.032;0.001;0.035	B;B;B;B;B	0.22386	0.003;0.0;0.039;0.001;0.03	T	0.26710	-1.0095	10	0.05959	T	0.93	.	2.6833	0.05100	0.0956:0.2979:0.1644:0.4422	.	63;64;64;64;70	Q71RC2-3;G3XAA8;G5E976;Q71RC2;Q71RC2-4	.;.;.;LARP4_HUMAN;.	T	64;70;72;64;64;64;63;64;63;64;63	ENSP00000293618:I64T;ENSP00000415464:I70T;ENSP00000381490:I64T;ENSP00000429781:I64T;ENSP00000429077:I63T;ENSP00000340901:I64T	ENSP00000293618:I64T	I	+	2	0	LARP4	49109009	0.385000	0.25172	0.348000	0.25681	0.594000	0.36715	0.278000	0.18753	-0.136000	0.11475	-2.064000	0.00396	ATA	.		0.343	LARP4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374981.1	NM_052879	
MARS	4141	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	57908595	57908595	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr12:57908595T>G	ENST00000262027.5	+	16	2194	c.2060T>G	c.(2059-2061)cTg>cGg	p.L687R	MARS_ENST00000315473.5_Missense_Mutation_p.L453R|RN7SL312P_ENST00000582079.1_RNA	NM_004990.3	NP_004981.2	P56192	SYMC_HUMAN	methionyl-tRNA synthetase	687					gene expression (GO:0010467)|methionyl-tRNA aminoacylation (GO:0006431)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|methionine-tRNA ligase activity (GO:0004825)|tRNA binding (GO:0000049)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	33			GBM - Glioblastoma multiforme(3;4.27e-41)		L-Methionine(DB00134)	CATGTCACCCTGGAGCTCCAG	0.522																																					p.L687R		.											.	MARS-654	0			c.T2060G						.						205.0	203.0	204.0					12																	57908595		2203	4300	6503	SO:0001583	missense	4141	exon16			TCACCCTGGAGCT	X94754	CCDS8942.1	12q13.3	2014-05-06	2007-02-26		ENSG00000166986	ENSG00000166986	6.1.1.10	"""Aminoacyl tRNA synthetases / Class I"""	6898	protein-coding gene	gene with protein product	"""methionine tRNA ligase 1, cytoplasmic"""	156560				10448063, 24482476	Standard	NM_004990		Approved	MetRS, SPG70	uc001sog.3	P56192	OTTHUMG00000169996	ENST00000262027.5:c.2060T>G	12.37:g.57908595T>G	ENSP00000262027:p.Leu687Arg	Somatic	121	0		WXS	Illumina GAIIx	Phase_I	102	32	NM_004990	0	0	27	43	16	B3KVK7|Q14895|Q53H14|Q96A15|Q96BZ0|Q9NSE0	Missense_Mutation	SNP	ENST00000262027.5	37	CCDS8942.1	.	.	.	.	.	.	.	.	.	.	T	3.368	-0.129077	0.06753	.	.	ENSG00000166986	ENST00000262027;ENST00000315473;ENST00000552914	T;T;T	0.40476	1.03;1.03;1.03	5.55	3.1	0.35709	Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (1);	0.533605	0.20132	N	0.098569	T	0.10035	0.0246	N	0.00841	-1.15	0.29744	N	0.836895	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.30446	-0.9978	10	0.02654	T	1	-2.7408	2.9901	0.05980	0.1401:0.0776:0.1563:0.626	.	453;687	A6NC17;P56192	.;SYMC_HUMAN	R	687;453;43	ENSP00000262027:L687R;ENSP00000314653:L453R;ENSP00000449787:L43R	ENSP00000262027:L687R	L	+	2	0	MARS	56194862	0.978000	0.34361	0.948000	0.38648	0.998000	0.95712	1.628000	0.37060	0.433000	0.26313	0.482000	0.46254	CTG	.		0.522	MARS-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407014.1	NM_004990	
NCOR2	9612	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	124904549	124904549	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr12:124904549T>C	ENST00000405201.1	-	13	1436	c.1436A>G	c.(1435-1437)tAt>tGt	p.Y479C	NCOR2_ENST00000356219.3_Missense_Mutation_p.Y479C|NCOR2_ENST00000404121.2_Missense_Mutation_p.Y49C|NCOR2_ENST00000397355.1_Missense_Mutation_p.Y479C|NCOR2_ENST00000404621.1_Missense_Mutation_p.Y478C|NCOR2_ENST00000429285.2_Missense_Mutation_p.Y478C			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	479					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		CAGGCTCTTATAGTTCTCATT	0.567																																					p.Y479C		.											.	NCOR2-229	0			c.A1436G						.						120.0	127.0	125.0					12																	124904549		1996	4164	6160	SO:0001583	missense	9612	exon15			CTCTTATAGTTCT	U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.1436A>G	12.37:g.124904549T>C	ENSP00000384018:p.Tyr479Cys	Somatic	98	0		WXS	Illumina GAIIx	Phase_I	67	32	NM_006312	0	0	3	5	2	O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Missense_Mutation	SNP	ENST00000405201.1	37	CCDS41858.2	.	.	.	.	.	.	.	.	.	.	T	14.15	2.450010	0.43531	.	.	ENSG00000196498	ENST00000405201;ENST00000404621;ENST00000356219;ENST00000397355;ENST00000447011;ENST00000404121;ENST00000429285;ENST00000458234;ENST00000420698	T;T;T;T;T;T;T;T	0.42900	0.96;0.96;0.96;0.96;0.96;0.96;0.96;0.96	4.52	4.52	0.55395	.	0.318356	0.30235	N	0.010097	T	0.69160	0.3080	M	0.89287	3.02	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.997;0.997;0.999	T	0.76658	-0.2878	10	0.87932	D	0	-14.6792	14.1788	0.65559	0.0:0.0:0.0:1.0	.	478;479;479	C9J0Q5;C9J239;C9JFD3	.;.;.	C	479;478;479;479;479;49;478;479;479	ENSP00000384018:Y479C;ENSP00000384202:Y478C;ENSP00000348551:Y479C;ENSP00000380513:Y479C;ENSP00000385618:Y49C;ENSP00000400281:Y478C;ENSP00000402808:Y479C;ENSP00000405367:Y479C	ENSP00000348551:Y479C	Y	-	2	0	NCOR2	123470502	1.000000	0.71417	0.995000	0.50966	0.920000	0.55202	7.528000	0.81941	1.831000	0.53308	0.459000	0.35465	TAT	.		0.567	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318173.2	NM_006312	
POLE	5426	bcgsc.ca	37	12	133219831	133219831	+	Silent	SNP	T	T	C	rs5744944	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr12:133219831T>C	ENST00000320574.5	-	35	4573	c.4530A>G	c.(4528-4530)gcA>gcG	p.A1510A	POLE_ENST00000535270.1_Silent_p.A1483A|POLE_ENST00000434528.3_5'Flank	NM_006231.2	NP_006222.2	Q07864	DPOE1_HUMAN	polymerase (DNA directed), epsilon, catalytic subunit	1510					base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA synthesis involved in DNA repair (GO:0000731)|G1/S transition of mitotic cell cycle (GO:0000082)|in utero embryonic development (GO:0001701)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	cytoplasm (GO:0005737)|epsilon DNA polymerase complex (GO:0008622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|nucleotide binding (GO:0000166)|zinc ion binding (GO:0008270)			NS(2)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(41)|ovary(3)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	89	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)	Cladribine(DB00242)	CAAAGACGGATGCCCTGCGCT	0.602								DNA polymerases (catalytic subunits)					C|||	3031	0.605232	0.761	0.5317	5008	,	,		20994	0.6736		0.4304	False		,,,				2504	0.5562				p.A1510A		.											.	POLE-233	0			c.A4530G						.	C		3091,1315	441.2+/-346.3	1076,939,188	101.0	91.0	94.0		4530	-11.9	0.1	12	dbSNP_114	94	3703,4897	619.4+/-396.9	797,2109,1394	no	coding-synonymous	POLE	NM_006231.2		1873,3048,1582	CC,CT,TT		43.0581,29.8457,47.7626		1510/2287	133219831	6794,6212	2203	4300	6503	SO:0001819	synonymous_variant	5426	exon35			GACGGATGCCCTG		CCDS9278.1	12q24.3	2014-09-17	2012-05-18		ENSG00000177084	ENSG00000177084		"""DNA polymerases"""	9177	protein-coding gene	gene with protein product	"""DNA polymerase epsilon catalytic subunit A"""	174762	"""polymerase (DNA directed), epsilon"""			8020968	Standard	NM_006231		Approved	POLE1	uc001uks.1	Q07864	OTTHUMG00000168045	ENST00000320574.5:c.4530A>G	12.37:g.133219831T>C		Somatic	118	1		WXS	Illumina GAIIx	Phase_I	112	7	NM_006231	0	0	2	2	0	Q13533|Q86VH9	Silent	SNP	ENST00000320574.5	37	CCDS9278.1																																																																																			T|0.448;C|0.552		0.602	POLE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397689.2	NM_006231	
OLFM4	10562	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	53603040	53603040	+	Silent	SNP	G	G	A			TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr13:53603040G>A	ENST00000219022.2	+	1	147	c.69G>A	c.(67-69)ggG>ggA	p.G23G		NM_006418.4	NP_006409.3	Q6UX06	OLFM4_HUMAN	olfactomedin 4	23					cell adhesion (GO:0007155)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of immune response (GO:0050777)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|protein homooligomerization (GO:0051260)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|specific granule (GO:0042581)	cadherin binding (GO:0045296)|catalytic activity (GO:0003824)|protein homodimerization activity (GO:0042803)			breast(2)|endometrium(4)|kidney(4)|large_intestine(5)|lung(20)|skin(3)|urinary_tract(1)	39		Breast(56;0.000776)|Lung NSC(96;0.000814)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.13e-08)		GGGATTTGGGGGATGTGGGAC	0.607																																					p.G23G		.											.	OLFM4-69	0			c.G69A						.						116.0	121.0	119.0					13																	53603040		2203	4300	6503	SO:0001819	synonymous_variant	10562	exon1			TTTGGGGGATGTG	AY358567	CCDS9440.1	13q14	2004-06-25			ENSG00000102837	ENSG00000102837			17190	protein-coding gene	gene with protein product		614061					Standard	NM_006418		Approved	OlfD, GW112, GC1	uc001vhl.3	Q6UX06	OTTHUMG00000016981	ENST00000219022.2:c.69G>A	13.37:g.53603040G>A		Somatic	57	0		WXS	Illumina GAIIx	Phase_I	42	31	NM_006418	0	0	0	0	0	O95362|Q5VWG0|Q86T22	Silent	SNP	ENST00000219022.2	37	CCDS9440.1																																																																																			.		0.607	OLFM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045112.2	NM_006418	
TMTC4	84899	bcgsc.ca	37	13	101287404	101287404	+	Silent	SNP	G	G	A	rs2297943	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr13:101287404G>A	ENST00000376234.3	-	10	1380	c.1191C>T	c.(1189-1191)ccC>ccT	p.P397P	TMTC4_ENST00000328767.5_Silent_p.P286P|TMTC4_ENST00000462211.1_5'UTR|TMTC4_ENST00000342624.5_Silent_p.P416P	NM_001079669.1	NP_001073137.1	Q5T4D3	TMTC4_HUMAN	transmembrane and tetratricopeptide repeat containing 4	397						integral component of membrane (GO:0016021)				breast(3)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(14)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					GGTTACTCGCGGGGAGAAATG	0.488													.|||	1331	0.265775	0.0378	0.3617	5008	,	,		19380	0.3343		0.3598	False		,,,				2504	0.3384				p.P416P		.											.	TMTC4-155	0			c.C1248T						.	G	,	392,4014	192.6+/-218.0	19,354,1830	41.0	38.0	39.0		1191,1248	1.3	1.0	13	dbSNP_100	39	2920,5680	449.5+/-362.1	497,1926,1877	no	coding-synonymous,coding-synonymous	TMTC4	NM_001079669.1,NM_032813.2	,	516,2280,3707	AA,AG,GG		33.9535,8.897,25.4652	,	397/742,416/761	101287404	3312,9694	2203	4300	6503	SO:0001819	synonymous_variant	84899	exon11			ACTCGCGGGGAGA		CCDS9497.2, CCDS41904.1, CCDS66575.1	13q32.3	2013-01-10	2006-01-06		ENSG00000125247	ENSG00000125247		"""Tetratricopeptide (TTC) repeat domain containing"""	25904	protein-coding gene	gene with protein product							Standard	XM_005254082		Approved	FLJ14624, FLJ22153	uc001vot.3	Q5T4D3	OTTHUMG00000017289	ENST00000376234.3:c.1191C>T	13.37:g.101287404G>A		Somatic	116	0		WXS	Illumina GAIIx	Phase_I	96	6	NM_032813	0	0	3	3	0	A6NLI7|B7Z666|Q5T4D4|Q5T4D5|Q5T4D6|Q8WV63|Q96SU8	Silent	SNP	ENST00000376234.3	37	CCDS41904.1																																																																																			G|0.737;A|0.263		0.488	TMTC4-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045649.2	NM_032813	
OR4N2	390429	bcgsc.ca	37	14	20296519	20296519	+	Silent	SNP	G	G	A	rs201350516		TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr14:20296519G>A	ENST00000315947.1	+	1	912	c.912G>A	c.(910-912)aaG>aaA	p.K304K	OR4N2_ENST00000568211.1_3'UTR	NM_001004723.1	NP_001004723.1	Q8NGD1	OR4N2_HUMAN	olfactory receptor, family 4, subfamily N, member 2	304						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|liver(1)|lung(32)|ovary(2)|prostate(1)|skin(2)|stomach(2)	52	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TGTTTAATAAGCACATAGCCT	0.338																																					p.K304K		.											.	OR4N2-71	0			c.G912A						.						24.0	26.0	25.0					14																	20296519		2188	4237	6425	SO:0001819	synonymous_variant	390429	exon1			TAATAAGCACATA		CCDS32022.1	14q11.2	2013-09-23				ENSG00000176294		"""GPCR / Class A : Olfactory receptors"""	14742	protein-coding gene	gene with protein product							Standard	NM_001004723		Approved		uc010tkv.2	Q8NGD1		ENST00000315947.1:c.912G>A	14.37:g.20296519G>A		Somatic	61	2		WXS	Illumina GAIIx	Phase_I	42	8	NM_001004723	0	0	0	0	0	Q6IEY9|Q6IFA2	Silent	SNP	ENST00000315947.1	37	CCDS32022.1																																																																																			G|0.999;A|0.001		0.338	OR4N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409821.2		
DNAAF2	55172	hgsc.bcm.edu	37	14	50100683	50100683	+	Silent	SNP	C	C	G	rs2985686	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr14:50100683C>G	ENST00000298292.8	-	1	1265	c.1185G>C	c.(1183-1185)gcG>gcC	p.A395A	DNAAF2_ENST00000406043.3_Silent_p.A395A	NM_018139.2	NP_060609.2	Q9NVR5	KTU_HUMAN	dynein, axonemal, assembly factor 2	395					axonemal dynein complex assembly (GO:0070286)|bacterial-type flagellum-dependent cell motility (GO:0071973)|cilium-dependent cell motility (GO:0060285)|response to retinoic acid (GO:0032526)	cytoplasm (GO:0005737)				kidney(1)|lung(4)	5						CTCCGTCCTCCGCGCGACTCC	0.781													G|||	2800	0.559105	0.6702	0.6715	5008	,	,		11594	0.1736		0.7604	False		,,,				2504	0.5194				p.A395A		.											.	.	0			c.G1185C						.						1.0	1.0	1.0					14																	50100683		917	2082	2999	SO:0001819	synonymous_variant	55172	exon1			GTCCTCCGCGCGA	AK001425	CCDS9691.2, CCDS45100.1	14q21.3	2012-05-03	2011-06-09	2011-06-09	ENSG00000165506	ENSG00000165506			20188	protein-coding gene	gene with protein product	"""kintoun"""	612517	"""chromosome 14 open reading frame 104"""	C14orf104			Standard	NM_001083908		Approved	FLJ10563, KTU, PF13, CILD10	uc001wws.4	Q9NVR5	OTTHUMG00000152331	ENST00000298292.8:c.1185G>C	14.37:g.50100683C>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_018139	0	0	0	0	0	B9WS54|C0JAP7|Q86TR1|Q86TY8|Q969Z5	Silent	SNP	ENST00000298292.8	37	CCDS9691.2																																																																																			C|0.569;G|0.431		0.781	DNAAF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276813.1		
PLEKHH1	57475	bcgsc.ca	37	14	68041061	68041061	+	Missense_Mutation	SNP	G	G	A	rs61534804	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr14:68041061G>A	ENST00000329153.5	+	14	2161	c.2029G>A	c.(2029-2031)Ggg>Agg	p.G677R		NM_020715.2	NP_065766.1	Q9ULM0	PKHH1_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 1	677						cytoskeleton (GO:0005856)				endometrium(2)|kidney(4)|lung(12)|urinary_tract(1)	19				all cancers(60;0.000771)|OV - Ovarian serous cystadenocarcinoma(108;0.00502)|BRCA - Breast invasive adenocarcinoma(234;0.011)		GCAGGCCACCGGGCCTCCAGC	0.617													G|||	537	0.107228	0.0938	0.2046	5008	,	,		18719	0.0625		0.0905	False		,,,				2504	0.1196				p.G677R		.											.	PLEKHH1-22	0			c.G2029A						.	G	ARG/GLY	294,3622		14,266,1678	24.0	24.0	24.0		2029	4.5	0.9	14	dbSNP_129	24	688,7544		32,624,3460	yes	missense	PLEKHH1	NM_020715.2	125	46,890,5138	AA,AG,GG		8.3576,7.5077,8.0836	benign	677/1365	68041061	982,11166	1958	4116	6074	SO:0001583	missense	57475	exon14			GCCACCGGGCCTC	AB033026	CCDS45128.1	14q24.1	2013-01-10				ENSG00000054690		"""Pleckstrin homology (PH) domain containing"""	17733	protein-coding gene	gene with protein product						10574462	Standard	NM_020715		Approved	KIAA1200	uc001xjl.1	Q9ULM0		ENST00000329153.5:c.2029G>A	14.37:g.68041061G>A	ENSP00000330278:p.Gly677Arg	Somatic	130	1		WXS	Illumina GAIIx	Phase_I	102	5	NM_020715	0	0	5	5	0	A6H8X6|Q6PJL4|Q6ZWC7	Missense_Mutation	SNP	ENST00000329153.5	37	CCDS45128.1	220	0.10073260073260074	42	0.08536585365853659	82	0.2265193370165746	30	0.05244755244755245	66	0.0870712401055409	G	17.79	3.475788	0.63737	0.075077	0.083576	ENSG00000054690	ENST00000329153	T	0.72394	-0.65	5.41	4.51	0.55191	.	0.174933	0.52532	N	0.000063	T	0.00073	0.0002	L	0.44542	1.39	0.09310	P	0.9999999999999999	D;B	0.64830	0.994;0.259	P;B	0.60286	0.872;0.018	T	0.08106	-1.0738	9	0.35671	T	0.21	.	8.6628	0.34103	0.2123:0.0:0.7877:0.0	rs61534804	192;677	Q9ULM0-2;Q9ULM0	.;PKHH1_HUMAN	R	677	ENSP00000330278:G677R	ENSP00000330278:G677R	G	+	1	0	PLEKHH1	67110814	0.963000	0.33076	0.918000	0.36340	0.734000	0.41952	1.912000	0.39946	1.507000	0.48752	0.591000	0.81541	GGG	G|0.897;A|0.103		0.617	PLEKHH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412730.3	XM_031054	
CATSPERB	79820	hgsc.bcm.edu;bcgsc.ca	37	14	92126304	92126304	+	Missense_Mutation	SNP	C	C	T	rs147058492	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr14:92126304C>T	ENST00000256343.3	-	15	1465	c.1309G>A	c.(1309-1311)Ggc>Agc	p.G437S		NM_024764.2	NP_079040.2	Q9H7T0	CTSRB_HUMAN	catsper channel auxiliary subunit beta	437					cell differentiation (GO:0030154)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|cilium (GO:0005929)|plasma membrane (GO:0005886)		p.G437S(1)		NS(1)|breast(4)|central_nervous_system(1)|kidney(3)|large_intestine(15)|liver(1)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|skin(9)|urinary_tract(2)	54		all_cancers(154;0.0663)|all_epithelial(191;0.236)				AAGGTGTTGCCGCCATCAACT	0.358																																					p.G437S		.											.	CATSPERB-138	1	Substitution - Missense(1)	large_intestine(1)	c.G1309A						.	C	SER/GLY	1,4405	2.1+/-5.4	0,1,2202	80.0	80.0	80.0		1309	4.6	1.0	14	dbSNP_134	80	5,8595	3.7+/-12.6	0,5,4295	yes	missense	CATSPERB	NM_024764.2	56	0,6,6497	TT,TC,CC		0.0581,0.0227,0.0461	probably-damaging	437/1117	92126304	6,13000	2203	4300	6503	SO:0001583	missense	79820	exon15			TGTTGCCGCCATC	AK024360	CCDS32142.1	14q32.12	2012-02-22	2012-02-22	2007-10-18	ENSG00000133962	ENSG00000133962			20500	protein-coding gene	gene with protein product		611169	"""chromosome 14 open reading frame 161"", ""cation channel, sperm-associated, beta"""	C14orf161		17478420	Standard	NM_024764		Approved	FLJ14298	uc001xzs.1	Q9H7T0	OTTHUMG00000171118	ENST00000256343.3:c.1309G>A	14.37:g.92126304C>T	ENSP00000256343:p.Gly437Ser	Somatic	81	0		WXS	Illumina GAIIx	Phase_I	55	4	NM_024764	0	0	0	0	0	A0AV51	Missense_Mutation	SNP	ENST00000256343.3	37	CCDS32142.1	.	.	.	.	.	.	.	.	.	.	C	15.45	2.837079	0.50951	2.27E-4	5.81E-4	ENSG00000133962	ENST00000256343	T	0.61627	0.09	4.62	4.62	0.57501	.	0.000000	0.53938	D	0.000047	T	0.71333	0.3327	L	0.58101	1.795	0.37009	D	0.895654	D	0.89917	1.0	D	0.91635	0.999	T	0.77943	-0.2398	10	0.87932	D	0	-9.6013	13.332	0.60492	0.0:1.0:0.0:0.0	.	437	Q9H7T0	CTSRB_HUMAN	S	437	ENSP00000256343:G437S	ENSP00000256343:G437S	G	-	1	0	CATSPERB	91196057	1.000000	0.71417	0.957000	0.39632	0.192000	0.23643	3.716000	0.54904	2.258000	0.74832	0.555000	0.69702	GGC	C|0.999;T|0.001		0.358	CATSPERB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411769.1	NM_024764	
HHIPL1	84439	hgsc.bcm.edu	37	14	100141689	100141689	+	Missense_Mutation	SNP	T	T	C	rs7158073	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr14:100141689T>C	ENST00000330710.5	+	9	2173	c.2075T>C	c.(2074-2076)gTg>gCg	p.V692A		NM_001127258.1	NP_001120730.1	Q96JK4	HIPL1_HUMAN	HHIP-like 1	692	SRCR. {ECO:0000255|PROSITE- ProRule:PRU00196}.		V -> A (in dbSNP:rs7158073).		carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)|membrane (GO:0016020)	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)|scavenger receptor activity (GO:0005044)			breast(1)|endometrium(2)|large_intestine(2)|lung(8)|skin(2)	15		Melanoma(154;0.128)				GAGGTGTTCGTGGGCGGACGC	0.746													T|||	2585	0.516174	0.3933	0.536	5008	,	,		7828	0.6131		0.5676	False		,,,				2504	0.5153				p.V692A		.											.	HHIPL1-70	0			c.T2075C						.	T	ALA/VAL	503,863		120,263,300	7.0	9.0	8.0		2075	-3.8	0.0	14	dbSNP_116	8	1711,1441		496,719,361	no	missense	HHIPL1	NM_001127258.1	64	616,982,661	CC,CT,TT		45.717,36.8228,49.004	benign	692/783	100141689	2214,2304	683	1576	2259	SO:0001583	missense	84439	exon9			TGTTCGTGGGCGG	AB058725	CCDS9953.1, CCDS45162.1	14q32	2008-01-16	2008-01-16	2008-01-16		ENSG00000182218			19710	protein-coding gene	gene with protein product			"""KIAA1822"""	KIAA1822			Standard	NM_032425		Approved		uc010avs.3	Q96JK4		ENST00000330710.5:c.2075T>C	14.37:g.100141689T>C	ENSP00000330601:p.Val692Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	20	16	NM_001127258	0	0	0	0	0	A2RUF8|B2RN09|Q6UXX2	Missense_Mutation	SNP	ENST00000330710.5	37	CCDS45162.1	1146	0.5247252747252747	201	0.40853658536585363	196	0.5414364640883977	347	0.6066433566433567	402	0.5303430079155673	T	4.106	0.017676	0.07959	0.368228	0.54283	ENSG00000182218	ENST00000330710	T	0.28895	1.59	4.74	-3.78	0.04333	Speract/scavenger receptor (3);Speract/scavenger receptor-related (2);	.	.	.	.	T	0.00012	0.0000	N	0.17872	0.535	0.80722	P	0.0	B	0.02656	0.0	B	0.08055	0.003	T	0.47459	-0.9116	8	0.16420	T	0.52	.	1.8306	0.03130	0.1251:0.2661:0.1277:0.4811	rs7158073;rs57071746;rs7158073	692	Q96JK4	HIPL1_HUMAN	A	692	ENSP00000330601:V692A	ENSP00000330601:V692A	V	+	2	0	HHIPL1	99211442	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.153000	0.16323	-0.525000	0.06391	-0.468000	0.05107	GTG	T|0.478;C|0.522		0.746	HHIPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413811.1	XM_041566	
PDIA2	64714	broad.mit.edu	37	16	334557	334557	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr16:334557C>T	ENST00000219406.6	+	2	388	c.370C>T	c.(370-372)Cgc>Tgc	p.R124C	PDIA2_ENST00000404312.1_Missense_Mutation_p.R124C	NM_006849.2	NP_006840.2	Q13087	PDIA2_HUMAN	protein disulfide isomerase family A, member 2	124	Thioredoxin 1. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell redox homeostasis (GO:0045454)|peptidyl-proline hydroxylation (GO:0019511)|protein folding (GO:0006457)|protein retention in ER lumen (GO:0006621)|regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902175)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)	protein disulfide isomerase activity (GO:0003756)|steroid binding (GO:0005496)			breast(1)|central_nervous_system(4)|kidney(3)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	17		all_cancers(16;6.71e-07)|all_epithelial(16;1.59e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00769)|all_lung(18;0.0186)				CAAGTTCTTCCGCAATGGGAA	0.667																																					p.R124C		.											.	PDIA2-91	0			c.C370T						.						51.0	58.0	56.0					16																	334557		2151	4240	6391	SO:0001583	missense	64714	exon2			TTCTTCCGCAATG	U19948	CCDS42089.1	16p13.3	2009-11-20	2005-06-29	2005-03-03	ENSG00000185615	ENSG00000185615	5.3.4.1	"""Protein disulfide isomerases"""	14180	protein-coding gene	gene with protein product		608012	"""protein disulfide isomerase, pancreatic"", ""protein disulfide isomerase-associated 2"""	PDIP		8561901	Standard	NM_006849		Approved	PDA2, PDI, PDIR	uc002cgo.1	Q13087	OTTHUMG00000064891	ENST00000219406.6:c.370C>T	16.37:g.334557C>T	ENSP00000219406:p.Arg124Cys	Somatic	151	0		WXS	Illumina GAIIx	Phase_I	149	4	NM_006849	0	0	0	0	0	A6ZJ64|B4DI27|Q2WGM4|Q4TT67|Q6B010|Q96KJ6|Q9BW95	Missense_Mutation	SNP	ENST00000219406.6	37	CCDS42089.1	.	.	.	.	.	.	.	.	.	.	c	13.68	2.308617	0.40895	.	.	ENSG00000185615	ENST00000219406;ENST00000455994;ENST00000404312	T;T	0.43294	0.95;0.95	4.14	1.85	0.25348	Thioredoxin domain (1);Thioredoxin-like fold (3);	0.598782	0.14003	N	0.347977	T	0.62048	0.2396	M	0.80746	2.51	0.33045	D	0.532037	D	0.76494	0.999	D	0.68765	0.96	T	0.71794	-0.4485	10	0.87932	D	0	.	10.8189	0.46593	0.3869:0.6131:0.0:0.0	.	124	Q13087	PDIA2_HUMAN	C	124;93;124	ENSP00000219406:R124C;ENSP00000384410:R124C	ENSP00000219406:R124C	R	+	1	0	PDIA2	274558	0.171000	0.23029	0.876000	0.34364	0.094000	0.18550	0.668000	0.25127	1.873000	0.54277	0.550000	0.68814	CGC	.		0.667	PDIA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139315.3	NM_006849	
RABEP2	79874	broad.mit.edu	37	16	28922226	28922226	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr16:28922226G>A	ENST00000358201.4	-	7	1660	c.1072C>T	c.(1072-1074)Cgg>Tgg	p.R358W	RABEP2_ENST00000357573.6_Missense_Mutation_p.R326W|RABEP2_ENST00000544477.1_Missense_Mutation_p.R287W	NM_024816.2	NP_079092.2	Q9H5N1	RABE2_HUMAN	rabaptin, RAB GTPase binding effector protein 2	358					endocytosis (GO:0006897)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|endosome (GO:0005768)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(1)	16						AGCTGCACCCGCTCCTGGGCC	0.667																																					p.R358W	Pancreas(66;639 1284 10093 31061 49099)	.											.	RABEP2-137	0			c.C1072T						.						39.0	43.0	42.0					16																	28922226		2040	4185	6225	SO:0001583	missense	79874	exon7			GCACCCGCTCCTG	AK026935	CCDS42140.1	16p11.2	2014-09-11			ENSG00000177548	ENSG00000177548			24817	protein-coding gene	gene with protein product		611869				12477932	Standard	NM_024816		Approved	FRA, FLJ23282	uc002drq.3	Q9H5N1	OTTHUMG00000176593	ENST00000358201.4:c.1072C>T	16.37:g.28922226G>A	ENSP00000350934:p.Arg358Trp	Somatic	75	0		WXS	Illumina GAIIx	Phase_I	89	4	NM_024816	0	0	56	59	3		Missense_Mutation	SNP	ENST00000358201.4	37	CCDS42140.1	.	.	.	.	.	.	.	.	.	.	G	17.64	3.438583	0.62955	.	.	ENSG00000177548	ENST00000358201;ENST00000357573;ENST00000544477	T;T;T	0.46063	0.88;0.88;0.88	5.12	4.11	0.48088	Rabaptin, GTPase-Rab5 binding (1);	0.140168	0.47455	D	0.000237	T	0.57740	0.2074	L	0.57536	1.79	0.34681	D	0.724696	D;D;D;D	0.89917	1.0;1.0;1.0;0.998	D;D;D;D	0.73708	0.91;0.967;0.981;0.948	T	0.69785	-0.5051	10	0.87932	D	0	-40.2673	12.0048	0.53252	0.0:0.0:0.7306:0.2694	.	287;326;358;358	B4DHR0;Q9H5N1-2;Q49AT6;Q9H5N1	.;.;.;RABE2_HUMAN	W	358;326;287	ENSP00000350934:R358W;ENSP00000350186:R326W;ENSP00000442798:R287W	ENSP00000350186:R326W	R	-	1	2	RABEP2	28829727	0.993000	0.37304	1.000000	0.80357	0.920000	0.55202	2.052000	0.41316	2.395000	0.81488	0.561000	0.74099	CGG	.		0.667	RABEP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000432691.1	NM_024816	
ZFPM1	161882	hgsc.bcm.edu	37	16	88599697	88599705	+	In_Frame_Del	DEL	AGCCTCTGG	AGCCTCTGG	-	rs67873604|rs149145771|rs368520732|rs67322929|rs201915453|rs67712719	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	AGCCTCTGG	AGCCTCTGG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr16:88599697_88599705delAGCCTCTGG	ENST00000319555.3	+	10	1653_1661	c.1331_1339delAGCCTCTGG	c.(1330-1341)gagcctctggcc>gcc	p.EPL444del	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	444				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GCCAGAGCGGAGCCTCTGGCCCAGAATGG	0.746																																					p.444_447del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1331_1339del						.																																			SO:0001651	inframe_deletion	161882	exon10			GAGCGGAGCCTCT	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1331_1339delAGCCTCTGG	16.37:g.88599697_88599705delAGCCTCTGG	ENSP00000326630:p.Glu444_Leu446del	Somatic	3	0		WXS	Illumina GAIIx	Phase_I	24	0	NM_153813	0	0	0	0	0		In_Frame_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.746	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
P2RX5	5026	broad.mit.edu	37	17	3592842	3592842	+	Nonsense_Mutation	SNP	G	G	A			TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr17:3592842G>A	ENST00000225328.5	-	7	1095	c.697C>T	c.(697-699)Cga>Tga	p.R233*	P2RX5_ENST00000547178.1_Nonsense_Mutation_p.R232*|P2RX5_ENST00000552050.1_Nonsense_Mutation_p.R173*|P2RX5-TAX1BP3_ENST00000550383.1_Nonsense_Mutation_p.R233*|P2RX5_ENST00000550772.1_Intron|P2RX5_ENST00000345901.3_Nonsense_Mutation_p.R209*|P2RX5_ENST00000552276.1_Nonsense_Mutation_p.R232*|P2RX5_ENST00000435558.1_Nonsense_Mutation_p.R233*|P2RX5_ENST00000551178.1_Nonsense_Mutation_p.R208*	NM_001204519.1|NM_002561.3	NP_001191448.1|NP_002552.2	Q93086	P2RX5_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 5	233					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|nervous system development (GO:0007399)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of calcium-mediated signaling (GO:0050850)|purinergic nucleotide receptor signaling pathway (GO:0035590)|signal transduction (GO:0007165)|transport (GO:0006810)	integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|extracellular ATP-gated cation channel activity (GO:0004931)|ion channel activity (GO:0005216)|purinergic nucleotide receptor activity (GO:0001614)|transmembrane signaling receptor activity (GO:0004888)			endometrium(1)|large_intestine(2)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	11						GAGCCCAGTCGGAAGATGGGG	0.622																																					p.R233X		.											.	P2RX5-22	0			c.C697T						.						182.0	149.0	160.0					17																	3592842		2203	4300	6503	SO:0001587	stop_gained	5026	exon7			CCAGTCGGAAGAT	AF016709	CCDS11034.1, CCDS11035.1, CCDS56014.1, CCDS56015.1	17p13.3	2012-01-17			ENSG00000083454	ENSG00000083454		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	8536	protein-coding gene	gene with protein product		602836				9414125	Standard	NM_002561		Approved	P2X5	uc002fwi.3	Q93086	OTTHUMG00000090700	ENST00000225328.5:c.697C>T	17.37:g.3592842G>A	ENSP00000225328:p.Arg233*	Somatic	243	0		WXS	Illumina GAIIx	Phase_I	143	6	NM_002561	0	0	0	0	0	G5E981|O43450|O75540|Q308M5|Q59F38|Q8IXW4|Q93087|Q9NZV0	Nonsense_Mutation	SNP	ENST00000225328.5	37	CCDS11034.1	.	.	.	.	.	.	.	.	.	.	G	37	5.981807	0.97168	.	.	ENSG00000083454	ENST00000435558;ENST00000551178;ENST00000547178;ENST00000225328;ENST00000345901;ENST00000552050	.	.	.	5.44	2.38	0.29361	.	0.660669	0.14972	N	0.287768	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.2017	4.7506	0.13059	0.1331:0.1201:0.6228:0.124	.	.	.	.	X	233;208;232;233;209;173	.	ENSP00000225328:R233X	R	-	1	2	P2RX5	3539591	1.000000	0.71417	0.413000	0.26509	0.614000	0.37383	3.921000	0.56454	0.369000	0.24510	0.655000	0.94253	CGA	.		0.622	P2RX5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207388.3	NM_002561, NM_175080, NM_175081	
GLTPD2	388323	hgsc.bcm.edu	37	17	4693342	4693342	+	Missense_Mutation	SNP	C	C	A	rs35910358	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr17:4693342C>A	ENST00000331264.7	+	4	680	c.627C>A	c.(625-627)gaC>gaA	p.D209E		NM_001014985.2	NP_001014985	A6NH11	GLTD2_HUMAN	glycolipid transfer protein domain containing 2	209				D -> E (in Ref. 2; AAI50537). {ECO:0000305}.		cytoplasm (GO:0005737)	glycolipid binding (GO:0051861)|glycolipid transporter activity (GO:0017089)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)	4						GAGGCCCGGACGCGGGCGTGC	0.761													C|||	4904	0.979233	0.9228	1.0	5008	,	,		11019	1.0		0.998	False		,,,				2504	1.0				p.D209E		.											.	GLTPD2-68	0			c.C627A						.	C	GLU/ASP	2706,78		1314,78,0	2.0	2.0	2.0		627	0.2	0.1	17	dbSNP_126	2	6028,0		3014,0,0	no	missense	GLTPD2	NM_001014985.2	45	4328,78,0	AA,AC,CC		0.0,2.8017,0.8852	benign	209/292	4693342	8734,78	1392	3014	4406	SO:0001583	missense	388323	exon4			CCCGGACGCGGGC	BC029290	CCDS32534.1	17p13.2	2007-12-19				ENSG00000182327			33756	protein-coding gene	gene with protein product							Standard	NM_001014985		Approved		uc002fza.2	A6NH11		ENST00000331264.7:c.627C>A	17.37:g.4693342C>A	ENSP00000328070:p.Asp209Glu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_001014985	0	0	0	0	0	A7E2T2	Missense_Mutation	SNP	ENST00000331264.7	37	CCDS32534.1	2151	0.9848901098901099	466	0.9471544715447154	362	1.0	572	1.0	751	0.9907651715039578	C	9.155	1.017148	0.19355	0.971983	1.0	ENSG00000182327	ENST00000331264	.	.	.	4.58	0.162	0.14981	Glycolipid transfer protein domain (3);	.	.	.	.	T	0.00012	0.0000	L	0.41027	1.25	0.80722	P	0.0	B	0.22080	0.064	B	0.31614	0.133	T	0.34650	-0.9820	7	0.12103	T	0.63	-20.1635	5.889	0.18897	0.0:0.5269:0.298:0.1751	rs35910358	209	A6NH11	GLTD2_HUMAN	E	209	.	ENSP00000328070:D209E	D	+	3	2	GLTPD2	4640082	0.004000	0.15560	0.082000	0.20525	0.081000	0.17604	0.011000	0.13264	-0.068000	0.12953	0.555000	0.69702	GAC	C|0.015;A|0.985		0.761	GLTPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439781.1	NM_001014985	
KDM6B	23135	broad.mit.edu	37	17	7751859	7751861	+	In_Frame_Del	DEL	CAC	CAC	-	rs59627144|rs377654044	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr17:7751859_7751861delCAC	ENST00000448097.2	+	11	2584_2586	c.2253_2255delCAC	c.(2251-2256)gtcacc>gtc	p.T762del	KDM6B_ENST00000254846.5_In_Frame_Del_p.T762del			O15054	KDM6B_HUMAN	lysine (K)-specific demethylase 6B	762	Pro-rich.|Thr-rich.				cardiac muscle cell differentiation (GO:0055007)|cellular response to hydrogen peroxide (GO:0070301)|endothelial cell differentiation (GO:0045446)|inflammatory response (GO:0006954)|mesodermal cell differentiation (GO:0048333)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(3)|lung(18)|ovary(1)|pancreas(1)|skin(5)	37						CTGTCGCCGTcaccaccaccacc	0.65																																					p.751_752del		.											.	KDM6B-205	0			c.2253_2255del						.																																			SO:0001651	inframe_deletion	23135	exon11			CGCCGTCACCACC	AB002344	CCDS32552.1	17p13.1	2011-07-01	2009-04-17	2009-04-17		ENSG00000132510		"""Chromatin-modifying enzymes / K-demethylases"""	29012	protein-coding gene	gene with protein product		611577	"""jumonji domain containing 3"", ""jumonji domain containing 3, histone lysine demethylase"""	JMJD3		10662545, 9205841	Standard	NM_001080424		Approved	KIAA0346	uc002giw.1	O15054		ENST00000448097.2:c.2253_2255delCAC	17.37:g.7751868_7751870delCAC	ENSP00000412513:p.Thr762del	Somatic	24	0		WXS	Illumina GAIIx	Phase_I	9	3	NM_001080424	0	0	0	0	0	C9IZ40|Q96G33	In_Frame_Del	DEL	ENST00000448097.2	37																																																																																				.		0.650	KDM6B-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000440248.1	XM_043272	
HES7	84667	bcgsc.ca	37	17	8026364	8026364	+	Silent	SNP	C	C	T	rs61731639	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr17:8026364C>T	ENST00000317814.4	-	2	122	c.123G>A	c.(121-123)gaG>gaA	p.E41E	HES7_ENST00000541682.2_Silent_p.E41E			Q9BYE0	HES7_HUMAN	hes family bHLH transcription factor 7	41	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				mesoderm development (GO:0007498)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|post-anal tail morphogenesis (GO:0036342)|regulation of somitogenesis (GO:0014807)|rhythmic process (GO:0048511)|skeletal system development (GO:0001501)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription factor binding (GO:0008134)										CCCGGGTCCGCTCCAGCAGCA	0.662													C|||	702	0.140176	0.0068	0.2709	5008	,	,		14642	0.375		0.0437	False		,,,				2504	0.0849				p.E41E		.											.	HES7-658	0			c.G123A						.	C	,	53,3827		1,51,1888	10.0	13.0	12.0		123,123	4.3	1.0	17	dbSNP_129	12	332,7902		8,316,3793	no	coding-synonymous,coding-synonymous	HES7	NM_001165967.1,NM_032580.3	,	9,367,5681	TT,TC,CC		4.0321,1.366,3.1781	,	41/231,41/226	8026364	385,11729	1940	4117	6057	SO:0001819	synonymous_variant	84667	exon2			GGTCCGCTCCAGC	AB049064	CCDS42258.1, CCDS54085.1	17p13.1	2013-10-17	2013-10-17			ENSG00000179111		"""Basic helix-loop-helix proteins"""	15977	protein-coding gene	gene with protein product	"""bHLH factor Hes7"""	608059	"""hairy and enhancer of split 7 (Drosophila)"""			11260262	Standard	NM_032580		Approved	bHLHb37	uc002gkb.2	Q9BYE0		ENST00000317814.4:c.123G>A	17.37:g.8026364C>T		Somatic	283	2		WXS	Illumina GAIIx	Phase_I	148	7	NM_001165967	0	0	0	0	0	F8VPC9	Silent	SNP	ENST00000317814.4	37	CCDS42258.1																																																																																			C|0.854;T|0.146		0.662	HES7-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000441479.1	NM_032580	
NF1	4763	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	29533326	29533326	+	Silent	SNP	T	T	C			TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr17:29533326T>C	ENST00000358273.4	+	12	1712	c.1329T>C	c.(1327-1329)ttT>ttC	p.F443F	NF1_ENST00000356175.3_Silent_p.F443F|NF1_ENST00000431387.4_Silent_p.F443F	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	443					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(6)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		GAAATATGTTTGGTGAAACAC	0.413			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																											p.F443F		.	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	.	NF1-3353	14	Whole gene deletion(8)|Unknown(6)	soft_tissue(7)|autonomic_ganglia(3)|central_nervous_system(3)|lung(1)	c.T1329C						.						236.0	213.0	221.0					17																	29533326		2203	4300	6503	SO:0001819	synonymous_variant	4763	exon12	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome	TATGTTTGGTGAA		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.1329T>C	17.37:g.29533326T>C		Somatic	222	0		WXS	Illumina GAIIx	Phase_I	189	106	NM_001128147	0	0	0	4	4	O00662|Q14284|Q14930|Q14931|Q9UMK3	Silent	SNP	ENST00000358273.4	37	CCDS42292.1																																																																																			.		0.413	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267	
RARA	5914	bcgsc.ca	37	17	38508263	38508287	+	Frame_Shift_Del	DEL	GTGCGCAAAGCGCACCAGGAAACCT	GTGCGCAAAGCGCACCAGGAAACCT	-	rs113014668		TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	GTGCGCAAAGCGCACCAGGAAACCT	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr17:38508263_38508287delGTGCGCAAAGCGCACCAGGAAACCT	ENST00000254066.5	+	5	1026_1050	c.571_595delGTGCGCAAAGCGCACCAGGAAACCT	c.(571-597)gtgcgcaaagcgcaccaggaaaccttcfs	p.VRKAHQETF191fs	RARA_ENST00000394081.3_Frame_Shift_Del_p.VRKAHQETF186fs|RARA_ENST00000420042.1_3'UTR|RARA_ENST00000394089.2_Frame_Shift_Del_p.VRKAHQETF191fs|RARA_ENST00000425707.3_Frame_Shift_Del_p.VRKAHQETF94fs|RARA_ENST00000394086.3_Frame_Shift_Del_p.VRKAHQETF207fs	NM_000964.3	NP_000955.1	P10276	RARA_HUMAN	retinoic acid receptor, alpha	191	Hinge.				apoptotic cell clearance (GO:0043277)|cellular response to estrogen stimulus (GO:0071391)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|chondroblast differentiation (GO:0060591)|embryonic camera-type eye development (GO:0031076)|face development (GO:0060324)|female pregnancy (GO:0007565)|gene expression (GO:0010467)|germ cell development (GO:0007281)|glandular epithelial cell development (GO:0002068)|growth plate cartilage development (GO:0003417)|intracellular estrogen receptor signaling pathway (GO:0030520)|limb development (GO:0060173)|liver development (GO:0001889)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell proliferation (GO:0008285)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translational initiation (GO:0045947)|negative regulation of tumor necrosis factor production (GO:0032720)|neural tube closure (GO:0001843)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of binding (GO:0051099)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein phosphorylation (GO:0006468)|regulation of myelination (GO:0031641)|regulation of synaptic plasticity (GO:0048167)|response to cytokine (GO:0034097)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to retinoic acid (GO:0032526)|response to vitamin A (GO:0033189)|retinoic acid receptor signaling pathway (GO:0048384)|Sertoli cell fate commitment (GO:0060010)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|trachea cartilage development (GO:0060534)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ureteric bud development (GO:0001657)|ventricular cardiac muscle cell differentiation (GO:0055012)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	chromatin DNA binding (GO:0031490)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|mRNA 5'-UTR binding (GO:0048027)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)|protein domain specific binding (GO:0019904)|protein heterodimerization activity (GO:0046982)|protein kinase A binding (GO:0051018)|protein kinase B binding (GO:0043422)|receptor binding (GO:0005102)|retinoic acid binding (GO:0001972)|retinoic acid receptor activity (GO:0003708)|retinoic acid-responsive element binding (GO:0044323)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|translation repressor activity, nucleic acid binding (GO:0000900)|zinc ion binding (GO:0008270)			breast(1)|kidney(4)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)|urinary_tract(2)	16		Breast(137;0.00328)	STAD - Stomach adenocarcinoma(5;0.00143)		Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Isotretinoin(DB00982)|Tamibarotene(DB04942)|Tazarotene(DB00799)	CATTGAGAAGGTGCGCAAAGCGCACCAGGAAACCTTCCCTGCCCT	0.613			T	"""PML, ZNF145, TIF1, NUMA1, NPM1"""	APL																																p.191_199del		.		Dom	yes		17	17q12	5914	"""retinoic acid receptor, alpha"""		L	.	RARA-1083	0			c.571_595del						.																																			SO:0001589	frameshift_variant	5914	exon5			GAGAAGGTGCGCA	X06538	CCDS11366.1, CCDS42317.1, CCDS45671.1	17q21.1	2014-01-20			ENSG00000131759	ENSG00000131759		"""Nuclear hormone receptors"""	9864	protein-coding gene	gene with protein product		180240				2825036, 8244378	Standard	NM_001145301		Approved	RAR, NR1B1	uc002huk.2	P10276	OTTHUMG00000133328	ENST00000254066.5:c.571_595delGTGCGCAAAGCGCACCAGGAAACCT	17.37:g.38508263_38508287delGTGCGCAAAGCGCACCAGGAAACCT	ENSP00000254066:p.Val191fs	Somatic	73	0		WXS	Illumina GAIIx	Phase_I	19	5	NM_000964	0	0	0	0	0	B8Y636|P78456|Q13440|Q13441|Q96S41|Q9NQS0	Frame_Shift_Del	DEL	ENST00000254066.5	37	CCDS11366.1																																																																																			.		0.613	RARA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257136.2		
KRT39	390792	bcgsc.ca	37	17	39116728	39116728	+	Missense_Mutation	SNP	G	G	A	rs17843021	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr17:39116728G>A	ENST00000355612.2	-	6	1057	c.1022C>T	c.(1021-1023)aCg>aTg	p.T341M	AC004231.2_ENST00000418393.1_RNA	NM_213656.3	NP_998821.3	Q6A163	K1C39_HUMAN	keratin 39	341	Coil 2.|Rod.		T -> M (in dbSNP:rs17843021).			intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(8)|upper_aerodigestive_tract(1)	17		Breast(137;0.00043)|Ovarian(249;0.15)				CTCTGTCTCCGTTAGGATGCA	0.493													G|||	585	0.116813	0.1452	0.0548	5008	,	,		18259	0.1399		0.1322	False		,,,				2504	0.0828				p.T341M		.											.	.	0			c.C1022T						.	G	MET/THR	630,3776	274.0+/-271.7	53,524,1626	137.0	135.0	135.0		1022	-1.1	0.0	17	dbSNP_123	135	1136,7456	235.1+/-267.8	71,994,3231	yes	missense	KRT39	NM_213656.3	81	124,1518,4857	AA,AG,GG		13.2216,14.2987,13.5867	possibly-damaging	341/492	39116728	1766,11232	2203	4296	6499	SO:0001583	missense	390792	exon6			GTCTCCGTTAGGA	AJ786657	CCDS11382.1	17q21.2	2013-01-16			ENSG00000196859	ENSG00000196859		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	32971	protein-coding gene	gene with protein product						16831889	Standard	NM_213656		Approved	KA35	uc002hvo.1	Q6A163	OTTHUMG00000133424	ENST00000355612.2:c.1022C>T	17.37:g.39116728G>A	ENSP00000347823:p.Thr341Met	Somatic	121	0		WXS	Illumina GAIIx	Phase_I	98	5	NM_213656	0	0	0	0	0	B2RXK6|Q6IFU6	Missense_Mutation	SNP	ENST00000355612.2	37	CCDS11382.1	273	0.125	69	0.1402439024390244	29	0.08011049723756906	75	0.13111888111888112	100	0.13192612137203166	G	6.273	0.418486	0.11870	0.142987	0.132216	ENSG00000196859	ENST00000355612	D	0.89050	-2.46	5.81	-1.12	0.09808	Filament (1);	1.437790	0.04585	N	0.395707	T	0.03651	0.0104	M	0.64170	1.965	0.80722	P	0.0	P	0.41947	0.766	B	0.37239	0.244	T	0.51655	-0.8678	9	0.62326	D	0.03	.	4.6774	0.12719	0.2521:0.0:0.3101:0.4378	rs17843021;rs17843021	341	Q6A163	K1C39_HUMAN	M	341	ENSP00000347823:T341M	ENSP00000347823:T341M	T	-	2	0	KRT39	36370254	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.117000	0.10708	-0.383000	0.07858	-0.218000	0.12543	ACG	G|0.868;A|0.132		0.493	KRT39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257287.1	NM_213656	
ASB16	92591	bcgsc.ca	37	17	42248346	42248346	+	Missense_Mutation	SNP	A	A	T	rs7218599	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr17:42248346A>T	ENST00000293414.1	+	1	273	c.189A>T	c.(187-189)caA>caT	p.Q63H		NM_080863.4	NP_543139.4	Q96NS5	ASB16_HUMAN	ankyrin repeat and SOCS box containing 16	63				Q -> H (in Ref. 1; BAB70800/BAG37167 and 3; AAH75088). {ECO:0000305}.	intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(2)|liver(2)|lung(2)|prostate(1)	14		Breast(137;0.00765)|Prostate(33;0.0313)		BRCA - Breast invasive adenocarcinoma(366;0.114)		CTGTCCACCAAGCCCTCTTCT	0.652													T|||	4640	0.926518	0.9917	0.928	5008	,	,		15715	0.9881		0.8539	False		,,,				2504	0.8487				p.Q63H		.											.	ASB16-227	0			c.A189T						.	T	HIS/GLN	4290,116	82.9+/-121.4	2093,104,6	30.0	29.0	29.0		189	3.1	1.0	17	dbSNP_116	29	7396,1204	234.4+/-267.4	3180,1036,84	yes	missense	ASB16	NM_080863.4	24	5273,1140,90	TT,TA,AA		14.0,2.6328,10.1492	benign	63/454	42248346	11686,1320	2203	4300	6503	SO:0001583	missense	92591	exon1			CCACCAAGCCCTC	AK054727	CCDS11478.1	17q21.31	2013-01-10	2011-01-25		ENSG00000161664	ENSG00000161664		"""Ankyrin repeat domain containing"""	19768	protein-coding gene	gene with protein product		615056	"""ankyrin repeat and SOCS box-containing 16"""			12076535	Standard	NM_080863		Approved	FLJ30165	uc002ifl.1	Q96NS5	OTTHUMG00000181809	ENST00000293414.1:c.189A>T	17.37:g.42248346A>T	ENSP00000293414:p.Gln63His	Somatic	201	1		WXS	Illumina GAIIx	Phase_I	132	5	NM_080863	0	0	0	0	0	B2RBC0|Q8WXK0	Missense_Mutation	SNP	ENST00000293414.1	37	CCDS11478.1	2034	0.9313186813186813	486	0.9878048780487805	329	0.9088397790055248	562	0.9825174825174825	657	0.866754617414248	T	13.83	2.353447	0.41700	0.973672	0.86	ENSG00000161664	ENST00000293414	T	0.53206	0.63	5.26	3.06	0.35304	Ankyrin repeat-containing domain (2);	0.181260	0.56097	N	0.000022	T	0.00012	0.0000	N	0.22421	0.69	0.54753	P	1.0999999999983245E-5	B	0.02656	0.0	B	0.01281	0.0	T	0.32214	-0.9915	9	0.15066	T	0.55	0.0078	4.0728	0.09891	0.1422:0.2311:0.0:0.6267	rs7218599;rs7218599	63	Q96NS5	ASB16_HUMAN	H	63	ENSP00000293414:Q63H	ENSP00000293414:Q63H	Q	+	3	2	ASB16	39603872	0.886000	0.30341	0.987000	0.45799	0.833000	0.47200	-0.067000	0.11579	0.128000	0.18479	-0.364000	0.07487	CAA	A|0.093;T|0.907		0.652	ASB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457703.1		
CDC27	996	hgsc.bcm.edu	37	17	45234367	45234367	+	Missense_Mutation	SNP	A	A	T	rs200148949		TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr17:45234367A>T	ENST00000066544.3	-	7	847	c.754T>A	c.(754-756)Tcc>Acc	p.S252T	CDC27_ENST00000528748.1_5'Flank|CDC27_ENST00000531206.1_Missense_Mutation_p.S252T|CDC27_ENST00000527547.1_Missense_Mutation_p.S252T|CDC27_ENST00000446365.2_Missense_Mutation_p.S191T	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	252					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)	p.S252T(3)		NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						GATAATATGGAAGTTCCTGTT	0.383																																					p.S252T		.											.	CDC27-291	3	Substitution - Missense(3)	prostate(3)	c.T754A						.						54.0	60.0	58.0					17																	45234367		2197	4295	6492	SO:0001583	missense	996	exon7			ATATGGAAGTTCC	U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.754T>A	17.37:g.45234367A>T	ENSP00000066544:p.Ser252Thr	Somatic	37	0		WXS	Illumina GAIIx	Phase_I	50	10	NM_001114091	0	0	1	1	0	G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	ENST00000066544.3	37	CCDS11509.1	.	.	.	.	.	.	.	.	.	.	A	11.88	1.770710	0.31320	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547;ENST00000526866	T;T;T;T;T	0.68181	-0.31;-0.26;0.01;-0.31;0.83	5.44	2.92	0.33932	.	0.295461	0.32687	N	0.005769	T	0.46425	0.1392	N	0.24115	0.695	0.34835	D	0.740078	B;B;B;B	0.09022	0.002;0.001;0.001;0.0	B;B;B;B	0.08055	0.001;0.003;0.002;0.001	T	0.45702	-0.9243	10	0.19590	T	0.45	-13.824	7.977	0.30161	0.7316:0.1283:0.0:0.1401	.	191;252;252;252	B4DL80;G5EA36;G3V1C4;P30260	.;.;.;CDC27_HUMAN	T	252;252;191;252;252	ENSP00000066544:S252T;ENSP00000434614:S252T;ENSP00000392802:S191T;ENSP00000437339:S252T;ENSP00000432105:S252T	ENSP00000066544:S252T	S	-	1	0	CDC27	42589366	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	2.784000	0.47774	0.864000	0.35578	0.377000	0.23210	TCC	.		0.383	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2		
CDK5RAP3	80279	ucsc.edu	37	17	46053334	46053334	+	Silent	SNP	A	A	G	rs202125432	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr17:46053334A>G	ENST00000338399.4	+	8	859	c.753A>G	c.(751-753)gaA>gaG	p.E251E	CDK5RAP3_ENST00000536708.2_Silent_p.E276E|RP11-6N17.9_ENST00000582262.1_RNA	NM_176096.1	NP_788276.1	Q96JB5	CK5P3_HUMAN	CDK5 regulatory subunit associated protein 3	251					brain development (GO:0007420)|protein ufmylation (GO:0071569)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of neuron differentiation (GO:0045664)	membrane (GO:0016020)	protein kinase binding (GO:0019901)	p.E251E(1)		NS(1)|central_nervous_system(2)|cervix(3)|endometrium(3)|large_intestine(2)|lung(5)|prostate(1)|skin(1)	18						CTGTGGTGGAACGACCCCACC	0.602																																					p.E251E		.											.	CDK5RAP3-226	1	Substitution - coding silent(1)	prostate(1)	c.A753G						.																																			SO:0001819	synonymous_variant	80279	exon8			GGTGGAACGACCC	AF110322	CCDS42356.1, CCDS62232.1	17q21.2	2008-07-18				ENSG00000108465			18673	protein-coding gene	gene with protein product	"""ischemic heart CDK5 activator-binding protein C53"", ""LXXLL/leucine-zipper-containing ARFbinding protein"""	608202				10721722	Standard	NM_176096		Approved	MST016, FLJ13660, C53, IC53, HSF-27, OK/SW-cl.114, LZAP	uc010wlc.3	Q96JB5		ENST00000338399.4:c.753A>G	17.37:g.46053334A>G		Somatic	115	4		WXS	Illumina GAIIx	Phase_I	112	13	NM_176096	0	0	55	55	0	B7Z6N4|D3DTU1|D3DTU2|F5H3I5|Q53FA2|Q9H3F8|Q9H8G0|Q9HBR9	Silent	SNP	ENST00000338399.4	37	CCDS42356.1																																																																																			A|0.949;G|0.051		0.602	CDK5RAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442913.1	NM_176096	
FOXJ1	2302	hgsc.bcm.edu	37	17	74133974	74133974	+	Silent	SNP	C	C	T	rs894542	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr17:74133974C>T	ENST00000322957.6	-	3	1080	c.726G>A	c.(724-726)acG>acA	p.T242T	RNF157-AS1_ENST00000585542.1_RNA|RNF157-AS1_ENST00000590137.1_RNA	NM_001454.3	NP_001445.2	Q92949	FOXJ1_HUMAN	forkhead box J1	242					actin cytoskeleton organization (GO:0030036)|activation of Rho GTPase activity (GO:0032862)|brain development (GO:0007420)|central tolerance induction (GO:0002508)|cilium assembly (GO:0042384)|epithelium development (GO:0060429)|establishment of apical/basal cell polarity (GO:0035089)|glomerular parietal epithelial cell development (GO:0072016)|humoral immune response (GO:0006959)|left/right pattern formation (GO:0060972)|leukocyte migration (GO:0050900)|lung epithelium development (GO:0060428)|metanephric part of ureteric bud development (GO:0035502)|negative regulation of B cell activation (GO:0050869)|negative regulation of germinal center formation (GO:0002635)|negative regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002924)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of T cell differentiation in thymus (GO:0033085)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|pattern specification process (GO:0007389)|positive regulation of central B cell tolerance induction (GO:0002897)|positive regulation of lung ciliated cell differentiation (GO:1901248)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			large_intestine(1)|liver(1)|pancreas(1)|skin(1)	4			LUSC - Lung squamous cell carcinoma(166;0.187)			CGGTATTCACCGTCAGCGGCC	0.716													C|||	385	0.076877	0.0431	0.134	5008	,	,		12954	0.0347		0.1103	False		,,,				2504	0.091				p.T242T		.											.	FOXJ1-227	0			c.G726A						.	C		156,3988		3,150,1919	4.0	6.0	5.0		726	1.5	1.0	17	dbSNP_86	5	700,7392		28,644,3374	no	coding-synonymous	FOXJ1	NM_001454.3		31,794,5293	TT,TC,CC		8.6505,3.7645,6.9958		242/422	74133974	856,11380	2072	4046	6118	SO:0001819	synonymous_variant	2302	exon3			ATTCACCGTCAGC	X99349	CCDS32739.1	17q25.1	2008-05-14				ENSG00000129654		"""Forkhead boxes"""	3816	protein-coding gene	gene with protein product		602291		FKHL13		9073514, 16518568	Standard	NM_001454		Approved	HFH-4, HFH4	uc002jqx.3	Q92949		ENST00000322957.6:c.726G>A	17.37:g.74133974C>T		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	9	8	NM_001454	0	0	0	0	0	O00630	Silent	SNP	ENST00000322957.6	37	CCDS32739.1																																																																																			C|0.925;T|0.075		0.716	FOXJ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449856.1	NM_001454	
SYT4	6860	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	40854213	40854213	+	Missense_Mutation	SNP	C	C	T	rs368892366		TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr18:40854213C>T	ENST00000255224.3	-	2	549	c.181G>A	c.(181-183)Gat>Aat	p.D61N	SYT4_ENST00000586678.1_Intron|SYT4_ENST00000590752.1_Missense_Mutation_p.D43N	NM_020783.3	NP_065834.1	Q9H2B2	SYT4_HUMAN	synaptotagmin IV	61					exocytosis (GO:0006887)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of vesicle fusion (GO:0031339)|neurotransmitter secretion (GO:0007269)	cell junction (GO:0030054)|dense core granule (GO:0031045)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	44						GGGTAAATATCAACTCCCTTA	0.383																																					p.D61N	NSCLC(85;81 1419 2855 22820 35912)	.											.	SYT4-132	0			c.G181A						.	C	ASN/ASP	0,4406		0,0,2203	86.0	82.0	83.0		181	5.9	1.0	18		83	1,8597		0,1,4298	no	missense	SYT4	NM_020783.3	23	0,1,6501	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	61/426	40854213	1,13003	2203	4299	6502	SO:0001583	missense	6860	exon2			AAATATCAACTCC	BC036538	CCDS11922.1	18q12.3	2013-01-21			ENSG00000132872	ENSG00000132872		"""Synaptotagmins"""	11512	protein-coding gene	gene with protein product		600103				8058779	Standard	NM_020783		Approved	KIAA1342, HsT1192	uc002law.3	Q9H2B2	OTTHUMG00000132610	ENST00000255224.3:c.181G>A	18.37:g.40854213C>T	ENSP00000255224:p.Asp61Asn	Somatic	46	0		WXS	Illumina GAIIx	Phase_I	64	15	NM_020783	0	0	0	0	0	B4DEU3|Q9P2K4	Missense_Mutation	SNP	ENST00000255224.3	37	CCDS11922.1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.008075	0.75046	0.0	1.16E-4	ENSG00000132872	ENST00000255224	T	0.37915	1.17	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	T	0.60405	0.2266	M	0.62723	1.935	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.77004	0.989;0.989	T	0.54344	-0.8308	10	0.46703	T	0.11	.	20.5632	0.99335	0.0:1.0:0.0:0.0	.	43;61	B4DEU3;Q9H2B2	.;SYT4_HUMAN	N	61	ENSP00000255224:D61N	ENSP00000255224:D61N	D	-	1	0	SYT4	39108211	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.373000	0.79623	2.937000	0.99478	0.650000	0.86243	GAT	.		0.383	SYT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255851.2	NM_020783	
MEX3C	51320	hgsc.bcm.edu	37	18	48723146	48723154	+	Intron	DEL	GCCGCCGCG	GCCGCCGCG	-	rs78074704|rs530394988|rs147438518|rs201868643|rs62092914|rs530602218	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	GCCGCCGCG	GCCGCCGCG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr18:48723146_48723154delGCCGCCGCG	ENST00000591040.1	-	2	43				MEX3C_ENST00000592416.1_5'Flank			Q5U5Q3	MEX3C_HUMAN	mex-3 RNA binding family member C						chondrocyte hypertrophy (GO:0003415)|energy homeostasis (GO:0097009)|regulation of fat cell differentiation (GO:0045598)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(11)|ovary(1)|skin(1)	17		Colorectal(6;0.003)|all_epithelial(6;0.0473)		Colorectal(16;0.0175)|READ - Rectum adenocarcinoma(32;0.15)		CCccgccgccgccgccgcggccgccgccT	0.78																																					p.179_182del		.											.	MEX3C-659	0			c.537_545del						.			429,1467		144,141,663						-0.2	0.9		dbSNP_131	4	2100,2286		804,492,897	no	coding	MEX3C	NM_016626.4		948,633,1560	A1A1,A1R,RR		47.8796,22.6266,40.2579				2529,3753				SO:0001627	intron_variant	51320	exon1			GCCGCCGCCGCCG	BC041122	CCDS11951.2	18q21.1	2013-08-21	2013-08-21	2007-07-18	ENSG00000176624	ENSG00000176624		"""RING-type (C3HC4) zinc fingers"", ""Mex-3 homologs"""	28040	protein-coding gene	gene with protein product		611005	"""ring finger and KH domain containing 2"", ""mex-3 homolog C (C. elegans)"""	RKHD2		17267406	Standard	NM_016626		Approved	FLJ38871, RNF194	uc002lfc.4	Q5U5Q3	OTTHUMG00000132693	ENST00000591040.1:c.757-19200CGCGGCGGC>-	18.37:g.48723146_48723154delGCCGCCGCG		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	20	12	NM_016626	0	0	0	0	0	A1L022|Q9NZE3	In_Frame_Del	DEL	ENST00000591040.1	37																																																																																				.		0.780	MEX3C-003	KNOWN	mRNA_end_NF|basic	processed_transcript	protein_coding	OTTHUMT00000449559.1	NM_016626	
ANKRD24	170961	hgsc.bcm.edu	37	19	4217956	4217956	+	Silent	SNP	A	A	G	rs6510794	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr19:4217956A>G	ENST00000600132.1	+	18	3075	c.2799A>G	c.(2797-2799)gcA>gcG	p.A933A	ANKRD24_ENST00000318934.4_Silent_p.A933A|ANKRD24_ENST00000262970.5_Silent_p.A1023A	NM_133475.1	NP_597732.1	Q8TF21	ANR24_HUMAN	ankyrin repeat domain 24	933										endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)	21				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0233)|STAD - Stomach adenocarcinoma(1328;0.181)		GGGGCCGGGCAGCCAGTCTGG	0.766													G|||	2256	0.450479	0.5166	0.4164	5008	,	,		6898	0.4692		0.4751	False		,,,				2504	0.3405				p.A933A		.											.	ANKRD24-68	0			c.A2799G						.	G		1357,2019		337,683,668	3.0	6.0	5.0		2799	0.3	1.0	19	dbSNP_116	5	2607,4473		599,1409,1532	no	coding-synonymous	ANKRD24	NM_133475.1		936,2092,2200	GG,GA,AA		36.822,40.1955,37.9112		933/1147	4217956	3964,6492	1688	3540	5228	SO:0001819	synonymous_variant	170961	exon18			CCGGGCAGCCAGT	AB075861	CCDS45925.1	19p13.3	2013-01-10				ENSG00000089847		"""Ankyrin repeat domain containing"""	29424	protein-coding gene	gene with protein product						11853319	Standard	NM_133475		Approved	KIAA1981	uc010dtt.1	Q8TF21		ENST00000600132.1:c.2799A>G	19.37:g.4217956A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	11	4	NM_133475	0	0	1	1	0	O75268|O95781	Silent	SNP	ENST00000600132.1	37	CCDS45925.1																																																																																			A|0.541;G|0.459		0.766	ANKRD24-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458188.1	XM_114000	
MUC16	94025	broad.mit.edu;bcgsc.ca	37	19	9049512	9049512	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr19:9049512C>G	ENST00000397910.4	-	5	32322	c.32119G>C	c.(32119-32121)Gat>Cat	p.D10707H		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	10709	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GGTGTGGCATCTGATTCATGA	0.478																																					p.D10707H		.											.	MUC16-566	0			c.G32119C						.						231.0	211.0	217.0					19																	9049512		1988	4163	6151	SO:0001583	missense	94025	exon5			TGGCATCTGATTC	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.32119G>C	19.37:g.9049512C>G	ENSP00000381008:p.Asp10707His	Somatic	195	0		WXS	Illumina GAIIx	Phase_I	251	7	NM_024690	0	0	0	0	0	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	c	3.132	-0.178309	0.06380	.	.	ENSG00000181143	ENST00000397910	T	0.03094	4.05	2.49	-1.42	0.08913	.	.	.	.	.	T	0.05410	0.0143	N	0.19112	0.55	.	.	.	D	0.62365	0.991	D	0.66847	0.947	T	0.38067	-0.9678	8	0.87932	D	0	.	1.298	0.02073	0.2207:0.4222:0.2162:0.1409	.	10707	B5ME49	.	H	10707	ENSP00000381008:D10707H	ENSP00000381008:D10707H	D	-	1	0	MUC16	8910512	0.000000	0.05858	0.001000	0.08648	0.009000	0.06853	-0.146000	0.10250	-0.190000	0.10465	-0.530000	0.04314	GAT	.		0.478	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
MAP1S	55201	hgsc.bcm.edu	37	19	17837425	17837425	+	Missense_Mutation	SNP	C	C	G	rs17710707	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr19:17837425C>G	ENST00000324096.4	+	5	1383	c.1232C>G	c.(1231-1233)tCt>tGt	p.S411C	MAP1S_ENST00000544059.2_Missense_Mutation_p.S385C|CTD-3149D2.4_ENST00000595363.1_RNA|MAP1S_ENST00000597681.1_Intron	NM_018174.4	NP_060644.4	Q66K74	MAP1S_HUMAN	microtubule-associated protein 1S	411	Necessary for the microtubule-organizing center localization.		S -> C (in dbSNP:rs17710707). {ECO:0000269|PubMed:15489334}.		apoptotic DNA fragmentation (GO:0006309)|brain development (GO:0007420)|execution phase of apoptosis (GO:0097194)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|nervous system development (GO:0007399)|neuron projection morphogenesis (GO:0048812)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|synapse (GO:0045202)	actin filament binding (GO:0051015)|beta-tubulin binding (GO:0048487)|DNA binding (GO:0003677)|microtubule binding (GO:0008017)|tubulin binding (GO:0015631)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	25						ACGCTGGCCTCTGTGTGCGCC	0.731													C|||	574	0.114617	0.0832	0.1772	5008	,	,		12607	0.0169		0.2068	False		,,,				2504	0.1186				p.S411C		.											.	MAP1S-90	0			c.C1232G						.	C	CYS/SER	344,3714		17,310,1702	5.0	5.0	5.0		1232	2.6	0.2	19	dbSNP_123	5	1234,6710		91,1052,2829	no	missense	MAP1S	NM_018174.4	112	108,1362,4531	GG,GC,CC		15.5337,8.4771,13.1478	probably-damaging	411/1060	17837425	1578,10424	2029	3972	6001	SO:0001583	missense	55201	exon5			TGGCCTCTGTGTG	BC067115	CCDS32954.1	19p13.12	2008-02-05	2006-07-04	2006-07-04		ENSG00000130479			15715	protein-coding gene	gene with protein product		607573	"""chromosome 19 open reading frame 5"", ""VCY2 interacting protein 1"", ""BPY2 interacting protein 1"""	C19orf5, VCY2IP1, BPY2IP1		11827465, 15528209, 16297881, 14627543	Standard	NM_018174		Approved	FLJ10669, MAP8	uc002nhe.1	Q66K74		ENST00000324096.4:c.1232C>G	19.37:g.17837425C>G	ENSP00000325313:p.Ser411Cys	Somatic	3	0		WXS	Illumina GAIIx	Phase_I	39	15	NM_018174	0	0	2	2	0	B4DH53|Q27QB1|Q6NXF1|Q8N3L8|Q8N3W5|Q8NI88|Q96H94|Q96IT4|Q96SP8|Q9BRC6|Q9H928|Q9NVK7	Missense_Mutation	SNP	ENST00000324096.4	37	CCDS32954.1	257	0.11767399267399267	34	0.06910569105691057	66	0.18232044198895028	7	0.012237762237762238	150	0.19788918205804748	C	15.12	2.738952	0.49045	0.084771	0.155337	ENSG00000130479	ENST00000324096;ENST00000544059	T;T	0.03801	3.8;3.8	3.67	2.61	0.31194	.	0.155772	0.30277	N	0.009981	T	0.00012	0.0000	M	0.79614	2.46	0.09310	P	0.99999454915	D;D	0.89917	1.0;1.0	D;D	0.80764	0.977;0.994	T	0.06006	-1.0851	9	0.87932	D	0	-16.5051	8.9574	0.35827	0.0:0.8847:0.0:0.1153	rs17710707	385;411	B4DH53;Q66K74	.;MAP1S_HUMAN	C	411;385	ENSP00000325313:S411C;ENSP00000439243:S385C	ENSP00000325313:S411C	S	+	2	0	MAP1S	17698425	0.998000	0.40836	0.209000	0.23619	0.382000	0.30200	7.628000	0.83189	0.516000	0.28340	-0.291000	0.09656	TCT	C|0.883;G|0.117		0.731	MAP1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466027.1	NM_018174	
FCHO1	23149	bcgsc.ca	37	19	17885270	17885270	+	Silent	SNP	A	A	G	rs2287859	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr19:17885270A>G	ENST00000596536.1	+	13	1186	c.903A>G	c.(901-903)ccA>ccG	p.P301P	FCHO1_ENST00000595033.1_Silent_p.P251P|FCHO1_ENST00000596951.1_Silent_p.P301P|FCHO1_ENST00000594202.1_Silent_p.P301P|FCHO1_ENST00000597512.1_Silent_p.P308P|FCHO1_ENST00000539407.1_Silent_p.P301P|FCHO1_ENST00000389133.4_Silent_p.P301P|FCHO1_ENST00000600676.1_Silent_p.P301P|FCHO1_ENST00000252771.7_Silent_p.P301P	NM_015122.2	NP_055937.1	O14526	FCHO1_HUMAN	FCH domain only 1	301	Mediates interaction with the adaptor protein complex AP-2.				clathrin coat assembly (GO:0048268)|clathrin-mediated endocytosis (GO:0072583)	coated pit (GO:0005905)|plasma membrane (GO:0005886)	AP-2 adaptor complex binding (GO:0035612)			NS(2)|breast(1)|large_intestine(6)|liver(1)|lung(12)	22						AGCGGGAGCCAGAGCCACCTG	0.647													G|||	2978	0.594649	0.5772	0.5937	5008	,	,		16879	0.8254		0.4056	False		,,,				2504	0.5757				p.P301P		.											.	FCHO1-90	0			c.A903G						.	G	,,,	2455,1951	537.5+/-374.7	687,1081,435	34.0	39.0	37.0		903,903,753,903	-6.4	0.1	19	dbSNP_100	37	3523,5075	621.9+/-397.2	750,2023,1526	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	FCHO1	NM_001161357.1,NM_001161358.1,NM_001161359.1,NM_015122.2	,,,	1437,3104,1961	GG,GA,AA		40.9746,44.2805,45.9705	,,,	301/892,301/890,251/840,301/890	17885270	5978,7026	2203	4299	6502	SO:0001819	synonymous_variant	23149	exon12			GGAGCCAGAGCCA	AB006628	CCDS32955.1, CCDS59365.1, CCDS59366.1	19p13.12	2008-02-05				ENSG00000130475			29002	protein-coding gene	gene with protein product		613437				12477932	Standard	NM_001161357		Approved	KIAA0290	uc002nhg.3	O14526		ENST00000596536.1:c.903A>G	19.37:g.17885270A>G		Somatic	156	0		WXS	Illumina GAIIx	Phase_I	118	6	NM_001161358	0	0	0	0	0	A6NHE6|A8K5U5|B4E120|Q05C93|Q8IW22	Silent	SNP	ENST00000596536.1	37	CCDS32955.1																																																																																			A|0.495;G|0.505		0.647	FCHO1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466946.2	NM_015122	
FBXO17	115290	hgsc.bcm.edu	37	19	39440918	39440918	+	Silent	SNP	T	T	C	rs2304117	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr19:39440918T>C	ENST00000292852.4	-	2	383	c.42A>G	c.(40-42)ccA>ccG	p.P14P	CTC-360G5.8_ENST00000599996.1_5'Flank|FBXO17_ENST00000595329.1_Silent_p.P14P|SARS2_ENST00000448145.2_5'Flank	NM_024907.5	NP_079183.4	Q96EF6	FBX17_HUMAN	F-box protein 17	14						SCF ubiquitin ligase complex (GO:0019005)	glycoprotein binding (GO:0001948)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)	7	all_cancers(60;8.37e-07)|all_lung(34;3.71e-07)|Lung NSC(34;4.17e-07)|all_epithelial(25;1.13e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			GGGCCAGGGATGGGTCCGCCG	0.731													c|||	2378	0.47484	0.3336	0.3746	5008	,	,		11867	0.6796		0.4195	False		,,,				2504	0.5828				p.P23P		.											.	FBXO17-226	0			c.A69G						.		,	1052,2556		213,626,965	3.0	4.0	3.0		42,69	0.5	0.0	19	dbSNP_100	3	2265,4819		496,1273,1773	no	coding-synonymous,coding-synonymous	FBXO17	NM_024907.5,NM_148169.1	,	709,1899,2738	CC,CT,TT		31.9735,29.1574,31.0232	,	14/279,23/288	39440918	3317,7375	1804	3542	5346	SO:0001819	synonymous_variant	115290	exon2			CAGGGATGGGTCC	AF386743	CCDS12526.1	19q13.2	2010-07-02	2004-06-15	2004-06-16		ENSG00000269190		"""F-boxes /  ""other"""""	18754	protein-coding gene	gene with protein product	"""F-box only protein 26"""	609094	"""F-box only protein 17"""	FBXO26			Standard	NM_148169		Approved	FBG4, FLJ25205, MGC9379, FLJ11798, Fbx17		Q96EF6		ENST00000292852.4:c.42A>G	19.37:g.39440918T>C		Somatic	3	0		WXS	Illumina GAIIx	Phase_I	22	6	NM_148169	0	0	0	2	2	Q96LQ4	Silent	SNP	ENST00000292852.4	37	CCDS12526.1																																																																																			T|0.545;C|0.455		0.731	FBXO17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463273.1	NM_024907	
MYBPC2	4606	bcgsc.ca	37	19	50957397	50957397	+	Missense_Mutation	SNP	G	G	A	rs25665	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr19:50957397G>A	ENST00000357701.5	+	17	1921	c.1870G>A	c.(1870-1872)Gtc>Atc	p.V624I		NM_004533.3	NP_004524.3	Q14324	MYPC2_HUMAN	myosin binding protein C, fast type	624	Ig-like C2-type 5.		V -> I (in dbSNP:rs25665).		cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			breast(1)	1		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.0079)|GBM - Glioblastoma multiforme(134;0.0144)		CACCAACCCCGTCGGCGAGGA	0.632													g|||	1184	0.236422	0.034	0.2824	5008	,	,		18456	0.3829		0.2515	False		,,,				2504	0.3108				p.V624I		.											.	MYBPC2-67	0			c.G1870A						.	G	ILE/VAL	263,3941		7,249,1846	34.0	38.0	37.0		1870	-0.5	0.0	19	dbSNP_72	37	1778,6626		196,1386,2620	yes	missense	MYBPC2	NM_004533.3	29	203,1635,4466	AA,AG,GG		21.1566,6.2559,16.1881	benign	624/1142	50957397	2041,10567	2102	4202	6304	SO:0001583	missense	4606	exon17			AACCCCGTCGGCG		CCDS46152.1	19q13.33	2013-02-11	2001-11-28		ENSG00000086967	ENSG00000086967		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7550	protein-coding gene	gene with protein product	"""fast-type muscle myosin-binding-protein C"""	160793	"""myosin-binding protein C, fast-type"""			8375400	Standard	NM_004533		Approved	MYBPCF, MYBPC, MGC163408	uc002psf.2	Q14324		ENST00000357701.5:c.1870G>A	19.37:g.50957397G>A	ENSP00000350332:p.Val624Ile	Somatic	311	1		WXS	Illumina GAIIx	Phase_I	327	8	NM_004533	0	0	0	0	0	A1L4G9	Missense_Mutation	SNP	ENST00000357701.5	37	CCDS46152.1	526	0.24084249084249085	19	0.03861788617886179	91	0.2513812154696133	228	0.3986013986013986	188	0.24802110817941952	g	9.583	1.124179	0.20959	0.062559	0.211566	ENSG00000086967	ENST00000357701	T	0.68181	-0.31	3.26	-0.485	0.12067	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Fibronectin, type III (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	15.483300	0.02223	U	0.064183	T	0.00012	0.0000	L	0.58810	1.83	0.80722	P	0.0	B	0.20052	0.041	B	0.17098	0.017	T	0.15723	-1.0427	9	0.20519	T	0.43	.	3.9465	0.09350	0.0969:0.1597:0.579:0.1645	rs25665;rs2230838;rs2272322;rs12978290;rs17804237;rs52823468;rs25665	624	Q14324	MYPC2_HUMAN	I	624	ENSP00000350332:V624I	ENSP00000350332:V624I	V	+	1	0	MYBPC2	55649209	0.007000	0.16637	0.010000	0.14722	0.324000	0.28378	1.574000	0.36482	-0.057000	0.13199	-0.555000	0.04198	GTC	G|0.772;A|0.228		0.632	MYBPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464751.1	NM_004533	
ZNF160	90338	bcgsc.ca	37	19	53572917	53572917	+	Silent	SNP	G	G	A	rs10407463	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr19:53572917G>A	ENST00000429604.1	-	7	1285	c.870C>T	c.(868-870)tgC>tgT	p.C290C	ZNF160_ENST00000599056.1_Silent_p.C290C|ZNF160_ENST00000601421.1_Silent_p.C254C|ZNF160_ENST00000418871.1_Silent_p.C290C	NM_001102603.1|NM_198893.2	NP_001096073.1|NP_942596.1	Q9HCG1	ZN160_HUMAN	zinc finger protein 160	290					hemopoiesis (GO:0030097)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(8)|lung(10)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	35				GBM - Glioblastoma multiforme(134;0.02)		AGGTTTTGCCGCACTCACTGC	0.408													g|||	694	0.138578	0.2511	0.1167	5008	,	,		21331	0.0526		0.1481	False		,,,				2504	0.0808				p.C290C		.											.	ZNF160-90	0			c.C870T						.	A	,,	997,3409	371.2+/-319.9	114,769,1320	150.0	142.0	144.0		870,870,870	-2.9	0.0	19	dbSNP_119	144	1342,7258	262.4+/-284.4	104,1134,3062	no	coding-synonymous,coding-synonymous,coding-synonymous	ZNF160	NM_001102603.1,NM_033288.3,NM_198893.2	,,	218,1903,4382	AA,AG,GG		15.6047,22.6282,17.984	,,	290/819,290/819,290/819	53572917	2339,10667	2203	4300	6503	SO:0001819	synonymous_variant	90338	exon7			TTTGCCGCACTCA	X78928	CCDS12859.1	19q13.42	2013-01-08				ENSG00000170949		"""Zinc fingers, C2H2-type"", ""-"""	12948	protein-coding gene	gene with protein product		600398				7774943, 7865130	Standard	NM_198893		Approved	HZF5, F11, KR18, HKr18, FLJ00032, KIAA1611	uc002qar.4	Q9HCG1		ENST00000429604.1:c.870C>T	19.37:g.53572917G>A		Somatic	152	0		WXS	Illumina GAIIx	Phase_I	189	8	NM_001102603	0	0	3	3	0	Q14589|Q504Q8|Q96JC5|Q9BVY9|Q9H7N6	Silent	SNP	ENST00000429604.1	37	CCDS12859.1																																																																																			G|0.843;A|0.157		0.408	ZNF160-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463994.2	NM_033288	
LILRB2	10288	bcgsc.ca	37	19	54782919	54782919	+	Missense_Mutation	SNP	C	C	T	rs386056	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr19:54782919C>T	ENST00000391749.4	-	6	974	c.703G>A	c.(703-705)Gtg>Atg	p.V235M	LILRB2_ENST00000391746.1_Missense_Mutation_p.V235M|LILRB2_ENST00000314446.5_Missense_Mutation_p.V235M|LILRB2_ENST00000391748.1_Missense_Mutation_p.V235M|LILRB2_ENST00000471216.1_5'Flank|LILRB2_ENST00000434421.1_Missense_Mutation_p.V119M	NM_001278406.1	NP_001265335.1	Q8N423	LIRB2_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 2	235	Ig-like C2-type 3.		V -> M (in dbSNP:rs386056).		cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular defense response (GO:0006968)|cellular response to lipopolysaccharide (GO:0071222)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|heterotypic cell-cell adhesion (GO:0034113)|immune response (GO:0006955)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|negative regulation of antigen processing and presentation (GO:0002578)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T cell tolerance induction (GO:0002666)|regulation of dendritic cell differentiation (GO:2001198)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|inhibitory MHC class I receptor activity (GO:0032396)|MHC class I protein binding (GO:0042288)|MHC class Ib protein binding (GO:0023029)|protein phosphatase 1 binding (GO:0008157)|receptor activity (GO:0004872)			breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(30)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	44	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		CCAGGGGCCACGACAGGACCC	0.577													.|||	1261	0.251797	0.1256	0.2392	5008	,	,		16650	0.6052		0.173	False		,,,				2504	0.1483				p.V235M		.											.	LILRB2-91	0			c.G703A						.	C	MET/VAL,MET/VAL	676,3730	285.2+/-278.0	42,592,1569	93.0	94.0	94.0		703,703	-3.9	0.0	19	dbSNP_80	94	1563,7037	293.8+/-301.5	155,1253,2892	no	missense,missense	LILRB2	NM_001080978.2,NM_005874.3	21,21	197,1845,4461	TT,TC,CC		18.1744,15.3427,17.2151	benign,benign	235/598,235/599	54782919	2239,10767	2203	4300	6503	SO:0001583	missense	10288	exon6			GGGCCACGACAGG	AF000574	CCDS12886.1, CCDS42612.1, CCDS62791.1, CCDS62792.1	19q13.4	2013-01-11			ENSG00000131042	ENSG00000131042		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6606	protein-coding gene	gene with protein product		604815				9151699, 9079806	Standard	XM_006722966		Approved	LIR-2, ILT4, MIR-10, LIR2, CD85d, MIR10	uc002qfb.3	Q8N423	OTTHUMG00000064896	ENST00000391749.4:c.703G>A	19.37:g.54782919C>T	ENSP00000375629:p.Val235Met	Somatic	476	6		WXS	Illumina GAIIx	Phase_I	411	11	NM_005874	0	0	2	2	0	A8MU67|C9JF29|O75017|Q8NHJ7|Q8NHJ8	Missense_Mutation	SNP	ENST00000391749.4	37	CCDS12886.1	729	0.33379120879120877	71	0.1443089430894309	93	0.2569060773480663	426	0.7447552447552448	139	0.18337730870712401	C	11.86	1.765440	0.31228	0.153427	0.181744	ENSG00000131042	ENST00000391748;ENST00000314446;ENST00000391749;ENST00000391746;ENST00000434421	T;T;T;T;T	0.16597	2.33;2.33;2.33;2.33;2.33	2.44	-3.93	0.04143	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	2.090410	0.02456	N	0.086115	T	0.00012	0.0000	M	0.92169	3.28	0.80722	P	0.0	P;B;B	0.43352	0.804;0.443;0.42	B;B;B	0.43809	0.432;0.432;0.199	T	0.52298	-0.8594	9	0.54805	T	0.06	.	10.3378	0.43860	0.0:0.2758:0.7242:0.0	rs386056	235;252;235	A8MU67;E7EVY1;Q8N423	.;.;LIRB2_HUMAN	M	235;235;235;235;119	ENSP00000375628:V235M;ENSP00000319960:V235M;ENSP00000375629:V235M;ENSP00000375626:V235M;ENSP00000410117:V119M	ENSP00000319960:V235M	V	-	1	0	LILRB2	59474731	0.003000	0.15002	0.001000	0.08648	0.009000	0.06853	-0.385000	0.07379	-0.189000	0.10482	-0.535000	0.04281	GTG	C|0.787;T|0.213		0.577	LILRB2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139510.1		
ZNF787	126208	hgsc.bcm.edu	37	19	56599438	56599440	+	In_Frame_Del	DEL	TCG	TCG	-	rs5828672|rs71696054	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	TCG	TCG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr19:56599438_56599440delTCG	ENST00000270459.3	-	3	1219_1221	c.1101_1103delCGA	c.(1099-1104)gacgag>gag	p.D367del		NM_001002836.2	NP_001002836	Q6DD87	ZN787_HUMAN	zinc finger protein 787	367					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|lung(2)|pancreas(1)	5		Colorectal(82;3.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0559)		GCCCGCGGCCTCGTCGTCGTCGT	0.778														4509	0.900359	0.9939	0.732	5008	,	,		3238	0.7252		0.9821	False		,,,				2504	0.9898				p.367_368del		.											.	ZNF787-69	0			c.1101_1103del						.																																			SO:0001651	inframe_deletion	126208	exon3			GCGGCCTCGTCGT	BC077728, AF000560	CCDS42634.1	19q13.42	2013-01-08				ENSG00000142409		"""Zinc fingers, C2H2-type"""	26998	protein-coding gene	gene with protein product							Standard	NM_001002836		Approved		uc010eth.1	Q6DD87		ENST00000270459.3:c.1101_1103delCGA	19.37:g.56599447_56599449delTCG	ENSP00000270459:p.Asp367del	Somatic	2	2		WXS	Illumina GAIIx	Phase_I	19	18	NM_001002836	0	0	0	0	0	O00455	In_Frame_Del	DEL	ENST00000270459.3	37	CCDS42634.1																																																																																			.		0.778	ZNF787-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457498.1	NM_001002836	
ZNF814	730051	ucsc.edu	37	19	58384445	58384445	+	Silent	SNP	A	A	G			TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr19:58384445A>G	ENST00000435989.2	-	3	2547	c.2313T>C	c.(2311-2313)ccT>ccC	p.P771P	ZNF814_ENST00000600634.1_Intron|ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000597832.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	771					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						TGCACTCATAAGGCTTTTCTC	0.403																																					p.P771P		.											.	.	0			c.T2313C						.						72.0	60.0	64.0					19																	58384445		692	1591	2283	SO:0001819	synonymous_variant	730051	exon3			CTCATAAGGCTTT		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.2313T>C	19.37:g.58384445A>G		Somatic	63	0		WXS	Illumina GAIIx	Phase_I	82	2	NM_001144989	0	0	6	7	1	A6NF35	Silent	SNP	ENST00000435989.2	37	CCDS46212.1																																																																																			.		0.403	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
SIX3	6496	hgsc.bcm.edu	37	2	45171842	45171842	+	Silent	SNP	A	A	G	rs338074	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr2:45171842A>G	ENST00000260653.3	+	2	1284	c.942A>G	c.(940-942)gcA>gcG	p.A314A	SIX3-AS1_ENST00000419364.1_RNA	NM_005413.3	NP_005404.1	O95343	SIX3_HUMAN	SIX homeobox 3	314					brain development (GO:0007420)|circadian behavior (GO:0048512)|diencephalon development (GO:0021536)|eye development (GO:0001654)|forebrain anterior/posterior pattern specification (GO:0021797)|forebrain dorsal/ventral pattern formation (GO:0021798)|lens induction in camera-type eye (GO:0060235)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|protein import into nucleus (GO:0006606)|telencephalon development (GO:0021537)|visual perception (GO:0007601)	nucleus (GO:0005634)	RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|transcription corepressor binding (GO:0001222)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|skin(1)	11		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				CGGAGCGCGCAGACACCGGCA	0.697													G|||	4695	0.9375	0.9773	0.9323	5008	,	,		10095	0.9901		0.9165	False		,,,				2504	0.8548				p.A314A		.											.	SIX3-90	0			c.A942G						.	G		4039,129		1959,121,4	18.0	19.0	19.0		942	1.0	1.0	2	dbSNP_129	19	7494,648		3453,588,30	yes	coding-synonymous	SIX3	NM_005413.3		5412,709,34	GG,GA,AA		7.9587,3.095,6.3119		314/333	45171842	11533,777	2084	4071	6155	SO:0001819	synonymous_variant	6496	exon2			GCGCGCAGACACC	AF092047	CCDS1821.1	2p21	2011-06-20	2007-07-13		ENSG00000138083	ENSG00000138083		"""Homeoboxes / SINE class"""	10889	protein-coding gene	gene with protein product		603714	"""holoprosencephaly 2, alobar or semilobar"", ""sine oculis homeobox homolog 3 (Drosophila)"""	HPE2		9889003, 10369266	Standard	NM_005413		Approved		uc002run.2	O95343	OTTHUMG00000152424	ENST00000260653.3:c.942A>G	2.37:g.45171842A>G		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	8	5	NM_005413	0	0	0	0	0	D6W5A5|Q53T42	Silent	SNP	ENST00000260653.3	37	CCDS1821.1																																																																																			A|0.059;G|0.941		0.697	SIX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326192.1	NM_005413	
STON1	11037	bcgsc.ca	37	2	48809593	48809593	+	Missense_Mutation	SNP	G	G	T	rs3792234	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr2:48809593G>T	ENST00000406226.1	+	3	2016	c.1821G>T	c.(1819-1821)caG>caT	p.Q607H	STON1_ENST00000309835.3_Missense_Mutation_p.Q607H|STON1_ENST00000404752.1_Missense_Mutation_p.Q607H|STON1-GTF2A1L_ENST00000394754.1_Missense_Mutation_p.Q607H|STON1-GTF2A1L_ENST00000309827.2_Missense_Mutation_p.Q607H|STON1-GTF2A1L_ENST00000402114.2_Missense_Mutation_p.Q607H|STON1-GTF2A1L_ENST00000394751.3_Missense_Mutation_p.Q607H|STON1-GTF2A1L_ENST00000405008.1_Missense_Mutation_p.Q607H	NM_001198595.1	NP_001185524.1	Q9Y6Q2	STON1_HUMAN	stonin 1	607	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.		Q -> H (in dbSNP:rs3792234). {ECO:0000269|PubMed:15489334}.		endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)|regulation of endocytosis (GO:0030100)	clathrin adaptor complex (GO:0030131)		p.Q607H(2)		NS(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(19)|prostate(3)|skin(2)	37		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			GGAGTTTACAGGAACTTGAAT	0.498													T|||	1985	0.396366	0.2927	0.4135	5008	,	,		19325	0.37		0.4811	False		,,,				2504	0.4642				p.Q607H		.											.	STON1-91	2	Substitution - Missense(2)	prostate(2)	c.G1821T						.	T	HIS/GLN,HIS/GLN,HIS/GLN,HIS/GLN,HIS/GLN	1493,2913	677.9+/-403.5	249,995,959	67.0	66.0	67.0		1821,1821,1821,1821,1821	-11.3	0.0	2	dbSNP_107	67	4329,4271	574.5+/-390.1	1095,2139,1066	yes	missense,missense,missense,missense,missense	STON1,STON1-GTF2A1L	NM_001198593.1,NM_001198594.1,NM_001198595.1,NM_006873.3,NM_172311.2	24,24,24,24,24	1344,3134,2025	TT,TG,GG		49.6628,33.8856,44.764	benign,benign,benign,benign,benign	607/1159,607/1136,607/736,607/736,607/1183	48809593	5822,7184	2203	4300	6503	SO:0001583	missense	11037	exon3			TTTACAGGAACTT	AF026169	CCDS1841.1	2p16.3	2008-02-05			ENSG00000243244	ENSG00000243244			17003	protein-coding gene	gene with protein product	"""stoned B homolog 1 (Drosophila)"""	605357				14504226, 10364255	Standard	NM_001198595		Approved	SBLF, stoned-b1		Q9Y6Q2	OTTHUMG00000129169	ENST00000406226.1:c.1821G>T	2.37:g.48809593G>T	ENSP00000384615:p.Gln607His	Somatic	159	0		WXS	Illumina GAIIx	Phase_I	143	6	NM_001198595	0	0	0	0	0	A8MXJ1|B5MCF5|B7ZL16|Q96JE3|Q9BYX3	Missense_Mutation	SNP	ENST00000406226.1	37	CCDS1841.1	896	0.41025641025641024	150	0.3048780487804878	141	0.38950276243093923	226	0.3951048951048951	379	0.5	T	0.003	-2.467123	0.00169	0.338856	0.503372	ENSG00000243244;ENSG00000243244;ENSG00000243244;ENSG00000068781;ENSG00000068781;ENSG00000068781;ENSG00000068781;ENSG00000068781	ENST00000404752;ENST00000406226;ENST00000309835;ENST00000405008;ENST00000402114;ENST00000394754;ENST00000309827;ENST00000394751	T;T;T;T;T;T;T;T	0.09911	2.93;2.93;2.93;2.93;2.93;2.93;2.93;3.1	5.65	-11.3	0.00108	Clathrin adaptor, mu subunit, C-terminal (3);	0.495539	0.25447	N	0.030601	T	0.00012	0.0000	N	0.03268	-0.37	0.80722	P	0.0	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.0;0.001	T	0.40440	-0.9563	9	0.27082	T	0.32	.	7.5168	0.27606	0.0744:0.3781:0.3935:0.154	rs3792234;rs52821443;rs57146593;rs3792234	607;607;607	A8MXJ1;Q53S48;Q9Y6Q2	.;.;STON1_HUMAN	H	607	ENSP00000385273:Q607H;ENSP00000384615:Q607H;ENSP00000310969:Q607H;ENSP00000385499:Q607H;ENSP00000385701:Q607H;ENSP00000378236:Q607H;ENSP00000311493:Q607H;ENSP00000378234:Q607H	ENSP00000310969:Q607H	Q	+	3	2	STON1-GTF2A1L;STON1	48663097	0.000000	0.05858	0.016000	0.15963	0.149000	0.21700	-2.081000	0.01367	-3.411000	0.00168	-3.194000	0.00055	CAG	G|0.570;T|0.430		0.498	STON1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323848.2	NM_006873	
ASTL	431705	bcgsc.ca	37	2	96795857	96795857	+	Missense_Mutation	SNP	T	T	C	rs749458	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr2:96795857T>C	ENST00000342380.2	-	7	664	c.665A>G	c.(664-666)cAg>cGg	p.Q222R		NM_001002036.3	NP_001002036.3			astacin-like metallo-endopeptidase (M12 family)											endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(13)|ovary(1)|prostate(1)|skin(2)	30						GTTGCTGCTCTGAGACTTGAT	0.488													C|||	4643	0.927117	0.9924	0.8732	5008	,	,		22115	1.0		0.7684	False		,,,				2504	0.9652				p.Q222R		.											.	ASTL-90	0			c.A665G						.	C	ARG/GLN	4222,184	116.7+/-154.6	2020,182,1	124.0	127.0	126.0		665	-1.9	0.9	2	dbSNP_86	126	6840,1760	320.5+/-314.7	2723,1394,183	yes	missense	ASTL	NM_001002036.3	43	4743,1576,184	CC,CT,TT		20.4651,4.1761,14.9469	benign	222/432	96795857	11062,1944	2203	4300	6503	SO:0001583	missense	431705	exon7			CTGCTCTGAGACT	AJ537600	CCDS33249.1	2q11.1	2014-07-23	2006-10-10		ENSG00000188886	ENSG00000188886	3.4.24.21		31704	protein-coding gene	gene with protein product	"""sperm acrosomal SLLP1 binding"""	608860	"""astacin-like metalloendopeptidase (M12 family)"""			15087446	Standard	NM_001002036		Approved	ovastacin, SAS1B	uc010yui.2	Q6HA08	OTTHUMG00000155212	ENST00000342380.2:c.665A>G	2.37:g.96795857T>C	ENSP00000343674:p.Gln222Arg	Somatic	224	3		WXS	Illumina GAIIx	Phase_I	153	6	NM_001002036	0	0	0	0	0		Missense_Mutation	SNP	ENST00000342380.2	37	CCDS33249.1	1950	0.8928571428571429	486	0.9878048780487805	303	0.8370165745856354	572	1.0	589	0.7770448548812665	C	0.507	-0.868078	0.02590	0.958239	0.795349	ENSG00000188886	ENST00000342380	T	0.62498	0.02	4.14	-1.91	0.07641	Peptidase, metallopeptidase (1);Peptidase M12A, astacin (1);Metallopeptidase, catalytic domain (1);	0.873151	0.09681	N	0.769810	T	0.00012	0.0000	N	0.04805	-0.155	0.80722	P	0.0	B	0.02656	0.0	B	0.04013	0.001	T	0.41233	-0.9520	9	0.05721	T	0.95	-2.6861	1.3369	0.02147	0.1372:0.1828:0.2703:0.4097	rs749458;rs1724123;rs56560104;rs58650142;rs749458	222	Q6HA08	ASTL_HUMAN	R	222	ENSP00000343674:Q222R	ENSP00000343674:Q222R	Q	-	2	0	ASTL	96159584	0.001000	0.12720	0.931000	0.37212	0.971000	0.66376	-0.603000	0.05674	-0.522000	0.06417	-0.222000	0.12452	CAG	T|0.132;C|0.868		0.488	ASTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338801.1		
SOWAHC	65124	hgsc.bcm.edu	37	2	110372192	110372192	+	Silent	SNP	A	A	G	rs6594048		TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr2:110372192A>G	ENST00000356454.3	+	1	282	c.126A>G	c.(124-126)ctA>ctG	p.L42L	SEPT10_ENST00000415095.1_5'Flank|SEPT10_ENST00000397714.2_5'Flank|SEPT10_ENST00000334001.6_5'Flank|SEPT10_ENST00000437928.1_5'Flank|SEPT10_ENST00000356688.4_5'Flank|SEPT10_ENST00000545389.1_5'Flank|SEPT10_ENST00000397712.2_5'Flank	NM_023016.3	NP_075392.2	Q53LP3	SWAHC_HUMAN	sosondowah ankyrin repeat domain family member C	42																	GGGGCGCCCTAGGCGGCGAAC	0.771													G|||	5008	1.0	1.0	1.0	5008	,	,		6158	1.0		1.0	False		,,,				2504	1.0				p.L42L		.											.	.	0			c.A126G						.						1.0	2.0	2.0					2																	110372192		1239	2477	3716	SO:0001819	synonymous_variant	65124	exon1			CGCCCTAGGCGGC	AK023346	CCDS33270.1	2q13	2013-01-10	2012-01-12	2012-01-12	ENSG00000198142	ENSG00000198142		"""Ankyrin repeat domain containing"""	26149	protein-coding gene	gene with protein product			"""ankyrin repeat domain 57"""	C2orf26, ANKRD57		22234889	Standard	NM_023016		Approved	FLJ21870	uc002tfb.3	Q53LP3	OTTHUMG00000153219	ENST00000356454.3:c.126A>G	2.37:g.110372192A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	22	22	NM_023016	0	0	0	0	0	Q8NE15|Q9H6U1	Silent	SNP	ENST00000356454.3	37	CCDS33270.1																																																																																			A|0.029;G|0.971		0.771	SOWAHC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330168.1	NM_023016	
UGGT1	56886	bcgsc.ca	37	2	128934400	128934400	+	Silent	SNP	T	T	C	rs2290111	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr2:128934400T>C	ENST00000259253.6	+	32	3599	c.3552T>C	c.(3550-3552)acT>acC	p.T1184T	UGGT1_ENST00000375990.3_Silent_p.T1160T	NM_020120.3	NP_064505.1	Q9NYU2	UGGG1_HUMAN	UDP-glucose glycoprotein glucosyltransferase 1	1184					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)	UDP-glucose:glycoprotein glucosyltransferase activity (GO:0003980)|unfolded protein binding (GO:0051082)			NS(1)|breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(14)|lung(20)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						ACGATGGCACTGATTCTCCCC	0.418													C|||	3327	0.664337	0.9622	0.5418	5008	,	,		22234	0.4127		0.5855	False		,,,				2504	0.6892				p.T1184T		.											.	UGGT1-91	0			c.T3552C						.	C		3992,414	204.1+/-226.4	1809,374,20	184.0	175.0	178.0		3552	0.2	0.9	2	dbSNP_100	178	5104,3496	511.4+/-377.7	1512,2080,708	no	coding-synonymous	UGGT1	NM_020120.3		3321,2454,728	CC,CT,TT		40.6512,9.3963,30.063		1184/1556	128934400	9096,3910	2203	4300	6503	SO:0001819	synonymous_variant	56886	exon32			TGGCACTGATTCT	AF227905	CCDS2154.1	2q14.3	2009-07-23	2009-07-23	2009-07-23	ENSG00000136731	ENSG00000136731			15663	protein-coding gene	gene with protein product		605897	"""UDP-glucose ceramide glucosyltransferase-like 1"""	UGCGL1		10694380	Standard	NM_020120		Approved	HUGT1	uc002tps.3	Q9NYU2	OTTHUMG00000131570	ENST00000259253.6:c.3552T>C	2.37:g.128934400T>C		Somatic	211	2		WXS	Illumina GAIIx	Phase_I	154	7	NM_020120	0	0	0	0	0	Q53QP2|Q53SL3|Q8IW30|Q9H8I4	Silent	SNP	ENST00000259253.6	37	CCDS2154.1																																																																																			T|0.323;C|0.677		0.418	UGGT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254435.2	NM_020120	
NCKAP5	344148	ucsc.edu;bcgsc.ca	37	2	133541575	133541575	+	Missense_Mutation	SNP	C	C	T	rs12611515	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr2:133541575C>T	ENST00000409261.1	-	14	3182	c.2809G>A	c.(2809-2811)Gtc>Atc	p.V937I	NCKAP5_ENST00000473859.1_5'Flank|NCKAP5_ENST00000405974.3_Intron|NCKAP5_ENST00000409213.1_Intron|NCKAP5_ENST00000317721.6_Missense_Mutation_p.V937I	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	937			V -> I (in dbSNP:rs12611515).							NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						AGCAGGGAGACGGACCTGCCT	0.617													c|||	1867	0.372804	0.4554	0.3141	5008	,	,		15512	0.497		0.2952	False		,,,				2504	0.2546				p.V937I		.											.	.	0			c.G2809A						.	C	ILE/VAL,	1698,2154		418,862,646	16.0	18.0	18.0		2809,	3.4	0.9	2	dbSNP_120	18	2375,5867		371,1633,2117	yes	missense,intron	NCKAP5	NM_207363.2,NM_207481.3	29,	789,2495,2763	TT,TC,CC		28.8158,44.081,33.6779	possibly-damaging,	937/1910,	133541575	4073,8021	1926	4121	6047	SO:0001583	missense	344148	exon14			GGGAGACGGACCT	AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.2809G>A	2.37:g.133541575C>T	ENSP00000387128:p.Val937Ile	Somatic	27	0		WXS	Illumina GAIIx	Phase_I	32	4	NM_207363	0	0	0	0	0	B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	SNP	ENST00000409261.1	37	CCDS46418.1	844	0.38644688644688646	218	0.44308943089430897	118	0.3259668508287293	296	0.5174825174825175	212	0.2796833773087071	c	3.753	-0.051168	0.07407	0.44081	0.288158	ENSG00000176771	ENST00000409261;ENST00000317721	T;T	0.10960	2.82;2.82	5.18	3.36	0.38483	.	0.794876	0.10109	U	0.714992	T	0.00012	0.0000	L	0.27053	0.805	0.09310	P	0.9999999999528724	B	0.10296	0.003	B	0.08055	0.003	T	0.42103	-0.9471	9	0.32370	T	0.25	.	3.5614	0.07884	0.2085:0.5653:0.0:0.2261	rs12611515;rs52798675;rs57514357;rs12611515	937	O14513	NCKP5_HUMAN	I	937	ENSP00000387128:V937I;ENSP00000380603:V937I	ENSP00000380603:V937I	V	-	1	0	NCKAP5	133258045	1.000000	0.71417	0.934000	0.37439	0.077000	0.17291	2.178000	0.42519	0.753000	0.32945	-0.148000	0.13756	GTC	C|0.618;T|0.382		0.617	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331663.1	NM_207481	
NEB	4703	bcgsc.ca	37	2	152499355	152499355	+	Missense_Mutation	SNP	T	T	C	rs76767949	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr2:152499355T>C	ENST00000172853.10	-	59	8336	c.8189A>G	c.(8188-8190)gAt>gGt	p.D2730G	NEB_ENST00000604864.1_Missense_Mutation_p.D2730G|NEB_ENST00000409198.1_Missense_Mutation_p.D2730G|NEB_ENST00000427231.2_Missense_Mutation_p.D2730G|NEB_ENST00000397345.3_Missense_Mutation_p.D2730G|NEB_ENST00000603639.1_Missense_Mutation_p.D2730G			P20929	NEBU_HUMAN	nebulin	2730					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)	p.D2730G(1)		NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		AGTGGTTTTATCTTTATCCCA	0.353													T|||	101	0.0201677	0.0	0.0187	5008	,	,		18527	0.0813		0.001	False		,,,				2504	0.0051				p.D2730G		.											.	NEB-145	1	Substitution - Missense(1)	stomach(1)	c.A8189G						.	T	GLY/ASP,GLY/ASP,GLY/ASP	1,3657		0,1,1828	50.0	48.0	49.0		8189,8189,8189	6.0	1.0	2	dbSNP_132	49	4,8156		0,4,4076	yes	missense,missense,missense	NEB	NM_001164507.1,NM_001164508.1,NM_004543.4	94,94,94	0,5,5904	CC,CT,TT		0.049,0.0273,0.0423	probably-damaging,probably-damaging,probably-damaging	2730/8526,2730/8526,2730/6670	152499355	5,11813	1829	4080	5909	SO:0001583	missense	4703	exon59			GTTTTATCTTTAT	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.8189A>G	2.37:g.152499355T>C	ENSP00000172853:p.Asp2730Gly	Somatic	48	0		WXS	Illumina GAIIx	Phase_I	68	5	NM_004543	0	0	0	0	0	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	ENST00000172853.10	37		52	0.023809523809523808	0	0.0	4	0.011049723756906077	47	0.08216783216783216	1	0.0013192612137203166	T	23.9	4.476210	0.84640	2.73E-4	4.9E-4	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000172853	T;T;T;T	0.47869	0.83;0.83;0.83;0.83	5.97	5.97	0.96955	.	0.114166	0.56097	D	0.000022	T	0.13372	0.0324	M	0.89478	3.035	0.80722	D	1	D	0.55800	0.973	D	0.65140	0.932	T	0.53121	-0.8483	10	0.36615	T	0.2	.	16.4608	0.84044	0.0:0.0:0.0:1.0	.	2730	P20929	NEBU_HUMAN	G	2730	ENSP00000386259:D2730G;ENSP00000380505:D2730G;ENSP00000416578:D2730G;ENSP00000172853:D2730G	ENSP00000172853:D2730G	D	-	2	0	NEB	152207601	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	4.987000	0.63857	2.288000	0.76882	0.533000	0.62120	GAT	T|0.974;C|0.026		0.353	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543	
PGAP1	80055	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	197707448	197707448	+	Nonsense_Mutation	SNP	G	G	C			TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr2:197707448G>C	ENST00000354764.4	-	26	2741	c.2627C>G	c.(2626-2628)tCa>tGa	p.S876*		NM_024989.3	NP_079265.2	Q75T13	PGAP1_HUMAN	post-GPI attachment to proteins 1	876					anterior/posterior axis specification (GO:0009948)|attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|embryonic pattern specification (GO:0009880)|forebrain regionalization (GO:0021871)|head development (GO:0060322)|intracellular protein transport (GO:0006886)|myo-inositol transport (GO:0015798)|post-translational protein modification (GO:0043687)|sensory perception of sound (GO:0007605)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	nuclease activity (GO:0004518)|phosphoric ester hydrolase activity (GO:0042578)			breast(4)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(9)|lung(11)|ovary(6)|stomach(1)|urinary_tract(1)	40						ACTGTACCTTGATTTTATTGA	0.269																																					p.S876X		.											.	PGAP1-93	0			c.C2627G						.						61.0	70.0	67.0					2																	197707448		2203	4290	6493	SO:0001587	stop_gained	80055	exon26			TACCTTGATTTTA		CCDS2318.1	2q33.1	2014-03-03			ENSG00000197121	ENSG00000197121			25712	protein-coding gene	gene with protein product	"""GPI inositol-deacylase"""	611655				14734546, 17711852, 24482476	Standard	XM_005246866		Approved	FLJ12377, Bst1, SPG67	uc002utw.3	Q75T13	OTTHUMG00000132743	ENST00000354764.4:c.2627C>G	2.37:g.197707448G>C	ENSP00000346809:p.Ser876*	Somatic	203	0		WXS	Illumina GAIIx	Phase_I	152	99	NM_024989	0	0	0	0	0	Q4G0R8|Q4ZG47|Q53SM0|Q6AW92|Q6UWV4|Q9HA24	Nonsense_Mutation	SNP	ENST00000354764.4	37	CCDS2318.1	.	.	.	.	.	.	.	.	.	.	G	41	8.862563	0.98982	.	.	ENSG00000197121	ENST00000354764	.	.	.	5.14	5.14	0.70334	.	0.259485	0.33290	N	0.005077	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.44086	T	0.13	.	18.7876	0.91961	0.0:0.0:1.0:0.0	.	.	.	.	X	876	.	ENSP00000346809:S876X	S	-	2	0	PGAP1	197415693	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	4.596000	0.61055	2.673000	0.90976	0.591000	0.81541	TCA	.		0.269	PGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256103.5	NM_024989	
ALPPL2	251	hgsc.bcm.edu	37	2	233274476	233274476	+	Missense_Mutation	SNP	G	G	C	rs114768772		TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr2:233274476G>C	ENST00000295453.3	+	11	1545	c.1493G>C	c.(1492-1494)cGc>cCc	p.R498P		NM_031313.2	NP_112603.2	P10696	PPBN_HUMAN	alkaline phosphatase, placental-like 2	498				R -> P (in Ref. 1; AAA98616 and 4; CAA39425). {ECO:0000305}.|R -> S (in Ref. 3; CAA37374). {ECO:0000305}.	dephosphorylation (GO:0016311)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	alkaline phosphatase activity (GO:0004035)|metal ion binding (GO:0046872)			breast(2)|kidney(1)|large_intestine(1)|liver(2)|lung(6)|skin(1)	13		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)	Amifostine(DB01143)	CTGGCGCCCCGCGCCGGCACC	0.726																																					p.R498P		.											.	ALPPL2-91	0			c.G1493C						.						12.0	16.0	15.0					2																	233274476		2172	4236	6408	SO:0001583	missense	251	exon11			CGCCCCGCGCCGG	J04948	CCDS2491.1	2q37	2008-05-20			ENSG00000163286	ENSG00000163286			441	protein-coding gene	gene with protein product		171810					Standard	NM_031313		Approved		uc002vss.4	P10696	OTTHUMG00000133257	ENST00000295453.3:c.1493G>C	2.37:g.233274476G>C	ENSP00000295453:p.Arg498Pro	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	23	21	NM_031313	0	0	0	0	0	A8KAF2|Q16727|Q53S81|Q96CM1	Missense_Mutation	SNP	ENST00000295453.3	37	CCDS2491.1	194	0.08882783882783883	42	0.08536585365853659	21	0.058011049723756904	71	0.12412587412587413	60	0.079155672823219	a	0.009	-1.842776	0.00568	.	.	ENSG00000163286	ENST00000295453	D	0.95622	-3.76	2.39	1.49	0.22878	Alkaline-phosphatase-like, core domain (1);	0.504996	0.18426	N	0.141584	T	0.05640	0.0148	N	0.01874	-0.695	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.55425	-0.8143	10	0.02654	T	1	.	6.1524	0.20318	0.3771:0.4391:0.1839:0.0	.	498	P10696	PPBN_HUMAN	P	498	ENSP00000295453:R498P	ENSP00000295453:R498P	R	+	2	0	ALPPL2	232982720	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.066000	0.11598	-0.037000	0.13646	-2.747000	0.00125	CGC	G|0.946;C|0.054		0.726	ALPPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257034.2	NM_031313	
ANGPT4	51378	bcgsc.ca	37	20	854940	854940	+	Silent	SNP	T	T	C	rs944110	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr20:854940T>C	ENST00000381922.3	-	8	1440	c.1338A>G	c.(1336-1338)caA>caG	p.Q446Q	ANGPT4_ENST00000546022.1_Intron	NM_015985.2	NP_057069.1	Q9Y264	ANGP4_HUMAN	angiopoietin 4	446	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cellular response to hypoxia (GO:0071456)|leukocyte migration (GO:0050900)|negative regulation of angiogenesis (GO:0016525)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	receptor tyrosine kinase binding (GO:0030971)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)	27						CAGACATCACTTGGGCACACT	0.612													C|||	2569	0.512979	0.5227	0.4337	5008	,	,		21990	0.6905		0.3191	False		,,,				2504	0.5726				p.Q446Q	Pancreas(181;481 2077 3259 31286 49856)	.											.	ANGPT4-92	0			c.A1338G						.	C		2205,2201	588.4+/-386.9	537,1131,535	107.0	81.0	90.0		1338	4.2	1.0	20	dbSNP_86	90	2879,5721	672.1+/-402.9	491,1897,1912	no	coding-synonymous	ANGPT4	NM_015985.2		1028,3028,2447	CC,CT,TT		33.4767,49.9546,39.0897		446/504	854940	5084,7922	2203	4300	6503	SO:0001819	synonymous_variant	51378	exon8			CATCACTTGGGCA	AF074332	CCDS13009.1	20p13	2013-02-06			ENSG00000101280	ENSG00000101280		"""Fibrinogen C domain containing"""	487	protein-coding gene	gene with protein product		603705				10051567, 10218486	Standard	NM_015985		Approved		uc002wei.3	Q9Y264	OTTHUMG00000031652	ENST00000381922.3:c.1338A>G	20.37:g.854940T>C		Somatic	271	0		WXS	Illumina GAIIx	Phase_I	286	8	NM_015985	0	0	0	0	0	B4E3J9|Q5TFF4|Q9H4Z4	Silent	SNP	ENST00000381922.3	37	CCDS13009.1																																																																																			T|0.549;C|0.451		0.612	ANGPT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077493.1	NM_015985	
LRRN4	164312	hgsc.bcm.edu	37	20	6033025	6033025	+	Missense_Mutation	SNP	T	T	C	rs1884643	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr20:6033025T>C	ENST00000378858.4	-	2	645	c.421A>G	c.(421-423)Acc>Gcc	p.T141A		NM_152611.4	NP_689824.2	Q8WUT4	LRRN4_HUMAN	leucine rich repeat neuronal 4	141			T -> A (in dbSNP:rs1884643).		long-term memory (GO:0007616)|visual learning (GO:0008542)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)				breast(1)|endometrium(3)|large_intestine(3)|lung(10)|ovary(2)|prostate(1)|skin(5)|urinary_tract(2)	27						GCGGGCCCGGTGCACGGCGGC	0.776													C|||	1964	0.392173	0.5257	0.4265	5008	,	,		11757	0.4306		0.2495	False		,,,				2504	0.2945				p.T141A		.											.	LRRN4-93	0			c.A421G						.	C	ALA/THR	561,1475		45,471,502	2.0	2.0	2.0		421	-5.9	0.0	20	dbSNP_92	2	909,4281		72,765,1758	no	missense	LRRN4	NM_152611.3	58	117,1236,2260	CC,CT,TT		17.5145,27.554,20.3432	benign	141/741	6033025	1470,5756	1018	2595	3613	SO:0001583	missense	164312	exon2			GCCCGGTGCACGG	AL118505	CCDS13097.1	20p12.3	2013-02-11	2008-05-20	2008-05-20	ENSG00000125872	ENSG00000125872		"""Fibronectin type III domain containing"""	16208	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 75"""	C20orf75		15870286	Standard	NM_152611		Approved	dJ1056H1.1, NLRR4	uc002wmo.3	Q8WUT4	OTTHUMG00000031825	ENST00000378858.4:c.421A>G	20.37:g.6033025T>C	ENSP00000368135:p.Thr141Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_152611	0	0	0	0	0	A8K258|Q5JWV6|Q9H419	Missense_Mutation	SNP	ENST00000378858.4	37	CCDS13097.1	842	0.38553113553113555	259	0.5264227642276422	154	0.425414364640884	241	0.42132867132867136	188	0.24802110817941952	C	0.016	-1.511817	0.00984	0.27554	0.175145	ENSG00000125872	ENST00000378858	T	0.55413	0.52	5.16	-5.88	0.02290	.	0.935551	0.08855	N	0.883870	T	0.00012	0.0000	N	0.04686	-0.185	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.41538	-0.9503	9	0.02654	T	1	-7.2124	1.4288	0.02329	0.2344:0.2431:0.3275:0.195	rs1884643;rs59237991	141;141	Q6ZMD1;Q8WUT4	.;LRRN4_HUMAN	A	141	ENSP00000368135:T141A	ENSP00000368135:T141A	T	-	1	0	LRRN4	5981025	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.236000	0.02925	-0.947000	0.03673	-1.428000	0.01097	ACC	T|0.614;C|0.386		0.776	LRRN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077907.2	NM_152611	
FRG1B	284802	bcgsc.ca	37	20	29623219	29623219	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr20:29623219A>G	ENST00000278882.3	+	3	411	c.31A>G	c.(31-33)Atg>Gtg	p.M11V	FRG1B_ENST00000358464.4_Missense_Mutation_p.M11V|FRG1B_ENST00000439954.2_Missense_Mutation_p.N12S			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	11										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						GCACTCGACAATGGTCTTTTT	0.413																																					.		.											.	FRG1B-22	0			.						.																																			SO:0001583	missense	284802	.			TCGACAATGGTCT			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.31A>G	20.37:g.29623219A>G	ENSP00000278882:p.Met11Val	Somatic	922	18		WXS	Illumina GAIIx	Phase_I	930	26	.	0	1	34	35	0	C4AME5	RNA	SNP	ENST00000278882.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	a|a	0.925|0.925	-0.714671|-0.714671	0.03206|0.03206	.|.	.|.	ENSG00000149531|ENSG00000149531	ENST00000278882;ENST00000358464|ENST00000439954	.|T	.|0.53206	.|0.63	1.93|1.93	1.93|1.93	0.25924|0.25924	.|.	0.114289|.	0.56097|.	U|.	0.000024|.	T|T	0.42040|0.42040	0.1185|0.1185	.|.	.|.	.|.	0.18873|0.18873	N|N	0.999983|0.999983	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.36648|0.36648	-0.9739|-0.9739	6|6	0.66056|0.54805	D|T	0.02|0.06	.|.	4.9441|4.9441	0.13980|0.13980	0.6812:0.3188:0.0:0.0|0.6812:0.3188:0.0:0.0	.|.	.|.	.|.	.|.	V|S	11|12	.|ENSP00000408863:N12S	ENSP00000278882:M11V|ENSP00000408863:N12S	M|N	+|+	1|2	0|0	FRG1B|FRG1B	28236880|28236880	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.107000|0.107000	0.19398|0.19398	3.154000|3.154000	0.50693|0.50693	1.147000|1.147000	0.42369|0.42369	0.347000|0.347000	0.21830|0.21830	ATG|AAT	.		0.413	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
FRG1B	284802	bcgsc.ca	37	20	29628225	29628225	+	Splice_Site	SNP	A	A	G			TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr20:29628225A>G	ENST00000278882.3	+	6	608		c.e6-1		FRG1B_ENST00000358464.4_Splice_Site|FRG1B_ENST00000439954.2_Splice_Site			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B											endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						TGTTTCACTTAGGGGAAAATG	0.358																																					.		.											.	FRG1B-22	0			c.529-2A>G						.																																			SO:0001630	splice_region_variant	284802	exon5			TCACTTAGGGGAA			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.229-1A>G	20.37:g.29628225A>G		Somatic	988	16		WXS	Illumina GAIIx	Phase_I	1066	28	NR_003579	0	0	0	0	0	C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	.	8.410	0.843922	0.16963	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	.	.	.	1.89	1.89	0.25635	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.7774	0.29046	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FRG1B	28241886	1.000000	0.71417	0.998000	0.56505	0.247000	0.25773	7.946000	0.87746	1.131000	0.42111	0.147000	0.16070	.	.		0.358	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	Intron
MYLK2	85366	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	30414412	30414412	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr20:30414412T>C	ENST00000375994.2	+	6	1250	c.977T>C	c.(976-978)aTg>aCg	p.M326T	MYLK2_ENST00000375985.4_Missense_Mutation_p.M326T			Q9H1R3	MYLK2_HUMAN	myosin light chain kinase 2	326	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cardiac muscle contraction (GO:0060048)|cardiac muscle tissue morphogenesis (GO:0055008)|neuromuscular synaptic transmission (GO:0007274)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of gene expression (GO:0010628)|protein autophosphorylation (GO:0046777)|regulation of muscle filament sliding (GO:0032971)|skeletal muscle cell differentiation (GO:0035914)|skeletal muscle satellite cell differentiation (GO:0014816)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|myosin light chain kinase activity (GO:0004687)			NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	33			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			CCCCAGGAAATGGTGTTGCTG	0.572																																					p.M326T		.											.	MYLK2-760	0			c.T977C						.						113.0	85.0	94.0					20																	30414412		2203	4300	6503	SO:0001583	missense	85366	exon7			AGGAAATGGTGTT	AF325549	CCDS13191.1	20q13.31	2014-09-17	2008-01-23		ENSG00000101306	ENSG00000101306	2.7.11.18		16243	protein-coding gene	gene with protein product	"""skeletal muscle myosin light chain kinase"""	606566	"""myosin light chain kinase 2, skeletal muscle"""				Standard	NM_033118		Approved	skMLCK, KMLC, MLCK2	uc002wwq.2	Q9H1R3	OTTHUMG00000032194	ENST00000375994.2:c.977T>C	20.37:g.30414412T>C	ENSP00000365162:p.Met326Thr	Somatic	170	0		WXS	Illumina GAIIx	Phase_I	163	59	NM_033118	0	0	0	0	0	Q569L1|Q96I84	Missense_Mutation	SNP	ENST00000375994.2	37	CCDS13191.1	.	.	.	.	.	.	.	.	.	.	T	9.554	1.116661	0.20795	.	.	ENSG00000101306	ENST00000375994;ENST00000375985	T;T	0.63913	-0.07;-0.07	3.55	3.55	0.40652	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.35364	0.0929	N	0.03608	-0.345	0.41555	D	0.988598	B	0.13594	0.008	B	0.23150	0.044	T	0.15150	-1.0447	9	0.30078	T	0.28	.	7.3426	0.26646	0.1955:0.0:0.0:0.8045	.	326	Q9H1R3	MYLK2_HUMAN	T	326	ENSP00000365162:M326T;ENSP00000365152:M326T	ENSP00000365152:M326T	M	+	2	0	MYLK2	29878073	1.000000	0.71417	1.000000	0.80357	0.441000	0.31987	2.577000	0.46042	1.485000	0.48380	0.358000	0.22013	ATG	.		0.572	MYLK2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078583.2	NM_033118	
DNTTIP1	116092	hgsc.bcm.edu	37	20	44420682	44420682	+	Silent	SNP	T	T	C	rs2664591	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr20:44420682T>C	ENST00000372622.3	+	1	107	c.39T>C	c.(37-39)ccT>ccC	p.P13P	WFDC3_ENST00000481847.1_5'Flank|WFDC3_ENST00000372630.2_5'Flank|WFDC3_ENST00000372632.2_5'Flank|WFDC3_ENST00000243938.4_5'Flank	NM_052951.2	NP_443183.1	Q9H147	TDIF1_HUMAN	deoxynucleotidyltransferase, terminal, interacting protein 1	13						nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)	9		Myeloproliferative disorder(115;0.0122)				CGCGGGGACCTAGCGGGGCCG	0.746													C|||	3358	0.670527	0.6952	0.7968	5008	,	,		12080	0.6458		0.7058	False		,,,				2504	0.5368				p.P13P		.											.	DNTTIP1-91	0			c.T39C						.	C		2483,791		949,585,103	4.0	6.0	5.0		39	1.1	0.9	20	dbSNP_100	5	5222,1736		1983,1256,240	no	coding-synonymous	DNTTIP1	NM_052951.2		2932,1841,343	CC,CT,TT		24.9497,24.16,24.697		13/330	44420682	7705,2527	1637	3479	5116	SO:0001819	synonymous_variant	116092	exon1			GGGACCTAGCGGG	AB035676	CCDS13369.1	20q13.12	2003-09-10	2003-09-10	2003-09-12	ENSG00000101457	ENSG00000101457			16160	protein-coding gene	gene with protein product	"""novel protein similar to synaptotagmin 1 (SYT1, P65) (isoform 1)"", ""TdT binding protein"""	611388	"""chromosome 20 open reading frame 167"""	C20orf167		11473582	Standard	NM_052951		Approved	dJ447F3.4, Tdif1	uc002xpk.3	Q9H147	OTTHUMG00000032610	ENST00000372622.3:c.39T>C	20.37:g.44420682T>C		Somatic	2	0		WXS	Illumina GAIIx	Phase_I	10	7	NM_052951	0	0	0	0	0	B2RA18|Q96DE3|Q9BQP2|Q9H148	Silent	SNP	ENST00000372622.3	37	CCDS13369.1																																																																																			T|0.311;C|0.689		0.746	DNTTIP1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079502.1	NM_052951	
MMP9	4318	broad.mit.edu;bcgsc.ca	37	20	44641917	44641917	+	Missense_Mutation	SNP	C	C	T	rs368282794		TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr20:44641917C>T	ENST00000372330.3	+	9	1373	c.1354C>T	c.(1354-1356)Cgg>Tgg	p.R452W	RP11-465L10.10_ENST00000535913.1_RNA	NM_004994.2	NP_004985.2	P14780	MMP9_HUMAN	matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)	452					collagen catabolic process (GO:0030574)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|macrophage differentiation (GO:0030225)|negative regulation of cation channel activity (GO:2001258)|ossification (GO:0001503)|positive regulation of apoptotic process (GO:0043065)|positive regulation of keratinocyte migration (GO:0051549)|positive regulation of receptor binding (GO:1900122)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	collagen binding (GO:0005518)|identical protein binding (GO:0042802)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|endometrium(4)|large_intestine(14)|liver(2)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(3)	46		Myeloproliferative disorder(115;0.0122)			Captopril(DB01197)|Glucosamine(DB01296)|Marimastat(DB00786)|Minocycline(DB01017)	ACCTGAGCCACGGCCTCCAAC	0.642											OREG0025990	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R452W		.											.	MMP9-652	0			c.C1354T						.	C	TRP/ARG	1,4393		0,1,2196	64.0	83.0	76.0		1354	0.3	0.0	20		76	0,8570		0,0,4285	no	missense	MMP9	NM_004994.2	101	0,1,6481	TT,TC,CC		0.0,0.0228,0.0077	possibly-damaging	452/708	44641917	1,12963	2197	4285	6482	SO:0001583	missense	4318	exon9			GAGCCACGGCCTC		CCDS13390.1	20q12-q13	2008-01-07	2005-08-08		ENSG00000100985	ENSG00000100985	3.4.24.35		7176	protein-coding gene	gene with protein product		120361	"""matrix metalloproteinase 9 (gelatinase B, 92kD gelatinase, 92kD type IV collagenase)"", ""matrix metalloproteinase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)"""	CLG4B		2158484	Standard	NM_004994		Approved		uc002xqz.3	P14780	OTTHUMG00000033044	ENST00000372330.3:c.1354C>T	20.37:g.44641917C>T	ENSP00000361405:p.Arg452Trp	Somatic	90	0	925	WXS	Illumina GAIIx	Phase_I	88	5	NM_004994	0	0	0	0	0	B2R7V9|Q3LR70|Q8N725|Q9H4Z1|Q9UCJ9|Q9UCL1|Q9UDK2	Missense_Mutation	SNP	ENST00000372330.3	37	CCDS13390.1	.	.	.	.	.	.	.	.	.	.	C	7.526	0.657714	0.14645	2.28E-4	0.0	ENSG00000100985	ENST00000372330;ENST00000545925	T	0.21191	2.02	4.76	0.262	0.15597	.	1.820200	0.02694	N	0.110951	T	0.16685	0.0401	L	0.38175	1.15	0.09310	N	1	P	0.51537	0.946	B	0.36666	0.23	T	0.40608	-0.9554	10	0.66056	D	0.02	.	8.228	0.31582	0.4783:0.4048:0.1169:0.0	.	452	P14780	MMP9_HUMAN	W	452;97	ENSP00000361405:R452W	ENSP00000361405:R452W	R	+	1	2	MMP9	44075324	0.000000	0.05858	0.023000	0.16930	0.055000	0.15305	-0.066000	0.11598	0.515000	0.28320	0.655000	0.94253	CGG	.		0.642	MMP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080337.1		
CASS4	57091	bcgsc.ca	37	20	55033420	55033420	+	Missense_Mutation	SNP	C	C	T	rs35031530	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr20:55033420C>T	ENST00000360314.3	+	7	2203	c.1978C>T	c.(1978-1980)Cct>Tct	p.P660S	AL121914.1_ENST00000390795.2_RNA|CASS4_ENST00000371336.3_Missense_Mutation_p.P660S|CASS4_ENST00000434344.1_Missense_Mutation_p.P223S	NM_001164116.1	NP_001157588.1	Q9NQ75	CASS4_HUMAN	Cas scaffolding protein family member 4	660			P -> S (in dbSNP:rs35031530). {ECO:0000269|PubMed:14702039}.		cell adhesion (GO:0007155)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)	phosphorelay sensor kinase activity (GO:0000155)			breast(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(26)|ovary(4)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	54						TATACCTCAGCCTTCGAGTCA	0.507													C|||	735	0.146765	0.3086	0.0403	5008	,	,		13987	0.2381		0.004	False		,,,				2504	0.0562				p.P660S		.											.	CASS4-25	0			c.C1978T						.	C	SER/PRO,SER/PRO,SER/PRO,SER/PRO	1094,3312	372.0+/-320.2	134,826,1243	51.0	57.0	55.0		1816,667,1978,1978	-2.6	0.0	20	dbSNP_126	55	33,8567	22.2+/-67.0	0,33,4267	yes	missense,missense,missense,missense	CASS4	NM_001164114.1,NM_001164115.1,NM_001164116.1,NM_020356.3	74,74,74,74	134,859,5510	TT,TC,CC		0.3837,24.8298,8.6652	benign,benign,benign,benign	606/733,223/350,660/787,660/787	55033420	1127,11879	2203	4300	6503	SO:0001583	missense	57091	exon6			CCTCAGCCTTCGA	AJ276678	CCDS33492.1, CCDS54475.1	20q13.31	2011-04-13	2008-04-14	2008-04-15	ENSG00000087589	ENSG00000087589		"""Cas scaffolding proteins"""	15878	protein-coding gene	gene with protein product	"""HEF-like protein"", ""HEF1-Efs-p130Cas-like"""		"""chromosome 20 open reading frame 32"""	C20orf32			Standard	NM_020356		Approved	HEFL, HEPL	uc002xxr.2	Q9NQ75	OTTHUMG00000032788	ENST00000360314.3:c.1978C>T	20.37:g.55033420C>T	ENSP00000353462:p.Pro660Ser	Somatic	100	0		WXS	Illumina GAIIx	Phase_I	107	5	NM_020356	0	0	1	1	0	E1P5Z8|Q5QPD6|Q96K09|Q9BYL5	Missense_Mutation	SNP	ENST00000360314.3	37	CCDS33492.1	297	0.13598901098901098	135	0.27439024390243905	12	0.03314917127071823	148	0.25874125874125875	2	0.002638522427440633	C	8.848	0.943837	0.18281	0.248298	0.003837	ENSG00000087589	ENST00000360314;ENST00000371336;ENST00000434344	T;T;T	0.20738	2.05;2.05;2.05	5.65	-2.58	0.06228	CAS family, DUF3513 (1);	1.567350	0.02946	N	0.141079	T	0.00012	0.0000	N	0.11560	0.145	0.80722	P	0.0	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.12837	0.003;0.004;0.008	T	0.41052	-0.9530	9	0.18276	T	0.48	-1.3722	0.1155	0.00060	0.2771:0.2108:0.1786:0.3335	rs35031530;rs57004305	606;223;660	B4DII4;Q9NQ75-3;Q9NQ75	.;.;CASS4_HUMAN	S	660;660;223	ENSP00000353462:P660S;ENSP00000360387:P660S;ENSP00000410027:P223S	ENSP00000353462:P660S	P	+	1	0	CASS4	54466827	0.000000	0.05858	0.002000	0.10522	0.010000	0.07245	-0.416000	0.07097	-0.141000	0.11374	-0.878000	0.02970	CCT	C|0.905;T|0.095		0.507	CASS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079789.2	NM_020356	
PRODH	5625	bcgsc.ca	37	22	18912678	18912678	+	Missense_Mutation	SNP	A	A	G	rs386819653|rs4819756	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr22:18912678A>G	ENST00000357068.6	-	4	818	c.553T>C	c.(553-555)Tgg>Cgg	p.W185R	PRODH_ENST00000334029.2_Missense_Mutation_p.W77R|PRODH_ENST00000420436.1_Missense_Mutation_p.W77R	NM_016335.4	NP_057419	O43272	PROD_HUMAN	proline dehydrogenase (oxidase) 1	185			R -> Q (no effect on enzymatic activity).|R -> W (moderate reduction of enzymatic activity; dbSNP:rs4819756).		4-hydroxyproline catabolic process (GO:0019470)|cellular nitrogen compound metabolic process (GO:0034641)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|proline catabolic process (GO:0006562)|proline catabolic process to glutamate (GO:0010133)|proline metabolic process (GO:0006560)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)	FAD binding (GO:0071949)|proline dehydrogenase activity (GO:0004657)			breast(1)|endometrium(3)|lung(4)|upper_aerodigestive_tract(1)	9					L-Proline(DB00172)	CCGAAGGCCCAGTGGGCCTGG	0.592													.|||	3911	0.78095	0.916	0.6715	5008	,	,		18594	0.9712		0.5567	False		,,,				2504	0.7106				p.W185R		.											.	PRODH-289	0			c.T553C	GRCh37	CM057554	PRODH	M	rs4819756	.		ARG/TRP,ARG/TRP	3798,608		1646,506,51	104.0	104.0	104.0		229,553	2.9	0.2	22	dbSNP_111	104	4967,3633		1455,2057,788	yes	missense,missense	PRODH	NM_001195226.1,NM_016335.4	101,101	3101,2563,839	GG,GA,AA		42.2442,13.7994,32.608	probably-damaging,probably-damaging	77/493,185/601	18912678	8765,4241	2203	4300	6503	SO:0001583	missense	5625	exon5			AGGCCCAGTGGGC	AF010310	CCDS13754.1, CCDS56223.1	22q11.2	2014-07-10	2001-12-05		ENSG00000100033	ENSG00000100033	1.5.5.2		9453	protein-coding gene	gene with protein product		606810	"""proline dehydrogenase (proline oxidase )"""			9385373, 10192398	Standard	NM_001195226		Approved	HSPOX2, PRODH1, PIG6, PRODH2, TP53I6	uc002zok.4	O43272	OTTHUMG00000150163	ENST00000357068.6:c.553T>C	22.37:g.18912678A>G	ENSP00000349577:p.Trp185Arg	Somatic	232	1		WXS	Illumina GAIIx	Phase_I	161	6	NM_016335	0	0	0	0	0	A6NF53|O14680|Q0P507|Q147W8|Q504W1|Q59FI8|Q6NV86|Q9UF13	Missense_Mutation	SNP	ENST00000357068.6	37	CCDS13754.1	1621|1621	0.7422161172161172|0.7422161172161172	429|429	0.8719512195121951|0.8719512195121951	235|235	0.649171270718232|0.649171270718232	552|552	0.965034965034965|0.965034965034965	405|405	0.5343007915567283|0.5343007915567283	.|.	0.065|0.065	-1.215883|-1.215883	0.01542|0.01542	0.862006|0.862006	0.577558|0.577558	ENSG00000100033|ENSG00000100033	ENST00000457083|ENST00000357068;ENST00000438924;ENST00000450579	.|T;T	.|0.75260	.|-0.92;-0.92	5.03|5.03	2.88|2.88	0.33553|0.33553	.|.	.|0.520350	.|0.20347	.|N	.|0.094139	T|T	0.00012|0.00012	0.0000|0.0000	.|.	.|.	.|.	0.47476|0.47476	P|P	5.610000000000337E-4|5.610000000000337E-4	.|B	.|0.02656	.|0.0	.|B	.|0.01281	.|0.0	T|T	0.32402|0.32402	-0.9908|-0.9908	3|8	.|0.15952	.|T	.|0.53	0.0658|0.0658	6.4381|6.4381	0.21835|0.21835	0.1618:0.0:0.6925:0.1458|0.1618:0.0:0.6925:0.1458	rs4819756;rs58835750;rs4819756|rs4819756;rs58835750;rs4819756	.|77	.|E7EQL6	.|.	P|R	108|185;67;26	.|ENSP00000349577:W185R;ENSP00000396806:W26R	.|ENSP00000334726:W77R	L|W	-|-	2|1	0|0	PRODH|PRODH	17292678|17292678	0.975000|0.975000	0.34042|0.34042	0.234000|0.234000	0.24042|0.24042	0.007000|0.007000	0.05969|0.05969	3.683000|3.683000	0.54663|0.54663	0.250000|0.250000	0.21479|0.21479	-1.516000|-1.516000	0.00938|0.00938	CTG|TGG	A|0.284;G|0.716		0.592	PRODH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316637.2	NM_016335	
MMP11	4320	bcgsc.ca	37	22	24124623	24124623	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr22:24124623G>T	ENST00000215743.3	+	7	1338	c.1286G>T	c.(1285-1287)tGg>tTg	p.W429L	AP000349.1_ENST00000598975.1_Missense_Mutation_p.P199Q	NM_005940.3	NP_005931.2	P24347	MMP11_HUMAN	matrix metallopeptidase 11 (stromelysin 3)	429					basement membrane organization (GO:0071711)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|negative regulation of fat cell differentiation (GO:0045599)|proteolysis (GO:0006508)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|liver(2)|lung(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)	27		Medulloblastoma(6;9.86e-08)|all_neural(6;0.000318)			Marimastat(DB00786)	GCCACTGACTGGAGAGGGGTG	0.637																																					p.W429L		.											.	MMP11-291	0			c.G1286T						.						39.0	32.0	35.0					22																	24124623		2203	4300	6503	SO:0001583	missense	4320	exon7			CTGACTGGAGAGG		CCDS13816.1	22q11.23	2008-06-11	2005-08-08		ENSG00000099953	ENSG00000099953			7157	protein-coding gene	gene with protein product		185261	"""matrix metalloproteinase 11 (stromelysin 3)"""	STMY3		1639418, 7657606, 12006591	Standard	NM_005940		Approved		uc002zxx.3	P24347	OTTHUMG00000150742	ENST00000215743.3:c.1286G>T	22.37:g.24124623G>T	ENSP00000215743:p.Trp429Leu	Somatic	125	0		WXS	Illumina GAIIx	Phase_I	90	4	NM_005940	0	0	8	8	0	Q5FX24|Q6PEZ6|Q9UC26	Missense_Mutation	SNP	ENST00000215743.3	37	CCDS13816.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.508413	0.85282	.	.	ENSG00000099953	ENST00000215743	T	0.33438	1.41	4.93	4.93	0.64822	Hemopexin/matrixin (2);	0.000000	0.85682	D	0.000000	T	0.65760	0.2722	M	0.92507	3.315	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.74808	-0.3539	10	0.87932	D	0	.	17.7437	0.88414	0.0:0.0:1.0:0.0	.	429	P24347	MMP11_HUMAN	L	429	ENSP00000215743:W429L	ENSP00000215743:W429L	W	+	2	0	MMP11	22454623	1.000000	0.71417	1.000000	0.80357	0.624000	0.37722	8.880000	0.92407	2.761000	0.94854	0.585000	0.79938	TGG	.		0.637	MMP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319891.2	NM_005940	
BPIFC	254240	bcgsc.ca	37	22	32810378	32810378	+	Missense_Mutation	SNP	T	T	G	rs35856742	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr22:32810378T>G	ENST00000397452.1	-	16	1546	c.1436A>C	c.(1435-1437)gAa>gCa	p.E479A	BPIFC_ENST00000432451.2_Missense_Mutation_p.E236A|BPIFC_ENST00000300399.3_Missense_Mutation_p.E479A|BPIFC_ENST00000534972.1_Missense_Mutation_p.E203A|RTCB_ENST00000216038.5_5'Flank|RTCB_ENST00000451746.2_5'Flank			Q8NFQ6	BPIFC_HUMAN	BPI fold containing family C	479			E -> A (in dbSNP:rs35856742).			extracellular region (GO:0005576)	lipopolysaccharide binding (GO:0001530)|phospholipid binding (GO:0005543)										TGAGGATGTTTCATACTTCAG	0.493													T|||	296	0.0591054	0.1233	0.0303	5008	,	,		18467	0.0139		0.0527	False		,,,				2504	0.046				p.E479A		.											.	.	0			c.A1436C						.	T	ALA/GLU	496,3910	230.4+/-244.6	35,426,1742	144.0	123.0	130.0		1436	4.3	0.8	22	dbSNP_126	130	372,8228	122.2+/-181.2	15,342,3943	yes	missense	BPIFC	NM_174932.2	107	50,768,5685	GG,GT,TT		4.3256,11.2574,6.6738	benign	479/508	32810378	868,12138	2203	4300	6503	SO:0001583	missense	254240	exon15			GATGTTTCATACT	AF465766	CCDS13906.1	22q12.3	2011-08-04	2011-08-01	2011-08-01	ENSG00000184459	ENSG00000184459		"""BPI fold containing"""	16503	protein-coding gene	gene with protein product		614109	"""bactericidal/permeability-increasing protein-like 2"""	BPIL2			Standard	NM_174932		Approved	dJ149A16.7	uc003amn.2	Q8NFQ6	OTTHUMG00000058273	ENST00000397452.1:c.1436A>C	22.37:g.32810378T>G	ENSP00000380594:p.Glu479Ala	Somatic	192	1		WXS	Illumina GAIIx	Phase_I	173	6	NM_174932	0	0	0	0	0	A2RRF1	Missense_Mutation	SNP	ENST00000397452.1	37	CCDS13906.1	129	0.059065934065934064	68	0.13821138211382114	12	0.03314917127071823	4	0.006993006993006993	45	0.059366754617414245	T	14.93	2.681075	0.47886	0.112574	0.043256	ENSG00000184459	ENST00000397452;ENST00000300399;ENST00000534972;ENST00000432451	T;T;T;T	0.04917	3.53;3.53;4.28;3.97	5.39	4.29	0.51040	.	0.550764	0.20116	N	0.098913	T	0.00039	0.0001	M	0.68317	2.08	0.80722	P	0.0	B;P	0.35745	0.047;0.518	B;B	0.30401	0.014;0.115	T	0.18967	-1.0320	9	0.10111	T	0.7	-2.8015	9.7286	0.40348	0.0:0.0:0.1729:0.8271	rs35856742	236;479	A2RRF1;Q8NFQ6	.;BPIFC_HUMAN	A	479;479;203;236	ENSP00000380594:E479A;ENSP00000300399:E479A;ENSP00000439123:E203A;ENSP00000408920:E236A	ENSP00000300399:E479A	E	-	2	0	BPIFC	31140378	0.939000	0.31865	0.819000	0.32651	0.995000	0.86356	1.613000	0.36900	2.167000	0.68274	0.460000	0.39030	GAA	T|0.936;G|0.064		0.493	BPIFC-010	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129029.2	NM_174932	
PKDREJ	10343	bcgsc.ca	37	22	46656246	46656246	+	Missense_Mutation	SNP	T	T	G	rs7291444	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr22:46656246T>G	ENST00000253255.5	-	1	2973	c.2974A>C	c.(2974-2976)Aca>Cca	p.T992P		NM_006071.1	NP_006062.1	Q9NTG1	PKDRE_HUMAN	polycystin (PKD) family receptor for egg jelly	992			T -> P (in dbSNP:rs7291444).		acrosome reaction (GO:0007340)|calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|neuropeptide signaling pathway (GO:0007218)|regulation of acrosome reaction (GO:0060046)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)			NS(2)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(4)|kidney(5)|large_intestine(21)|lung(16)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	73		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00459)		CTAAGCACTGTGCTGTCCACT	0.507													T|||	1065	0.21266	0.5575	0.1297	5008	,	,		21694	0.001		0.16	False		,,,				2504	0.0777				p.T992P		.											.	PKDREJ-156	0			c.A2974C						.	T	PRO/THR	2031,2375	562.8+/-381.0	571,889,743	147.0	140.0	142.0		2974	-1.3	0.0	22	dbSNP_116	142	1254,7346	251.0+/-277.6	88,1078,3134	yes	missense	PKDREJ	NM_006071.1	38	659,1967,3877	GG,GT,TT		14.5814,46.0962,25.2576	benign	992/2254	46656246	3285,9721	2203	4300	6503	SO:0001583	missense	10343	exon1			GCACTGTGCTGTC	AF116458	CCDS14073.1	22q13.31	2013-07-31	2013-07-31		ENSG00000130943	ENSG00000130943			9015	protein-coding gene	gene with protein product		604670	"""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly, sea urchin homolog)-like"", ""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly homolog, sea urchin)-like"", ""polycystic kidney disease (polycystin) and REJ homolog (sperm receptor for egg jelly homolog, sea urchin)"""			9949214, 10591208	Standard	NM_006071		Approved		uc003bhh.3	Q9NTG1	OTTHUMG00000150493	ENST00000253255.5:c.2974A>C	22.37:g.46656246T>G	ENSP00000253255:p.Thr992Pro	Somatic	267	3		WXS	Illumina GAIIx	Phase_I	191	7	NM_006071	0	0	0	0	0	B1AJY3|O95850	Missense_Mutation	SNP	ENST00000253255.5	37	CCDS14073.1	449	0.20558608058608058	281	0.5711382113821138	55	0.15193370165745856	0	0.0	113	0.14907651715039577	T	9.836	1.189664	0.21954	0.460962	0.145814	ENSG00000130943	ENST00000253255	T	0.36340	1.26	4.65	-1.26	0.09376	.	1.107710	0.06788	N	0.786461	T	0.00012	0.0000	N	0.19112	0.55	0.80722	P	0.0	B	0.20368	0.044	B	0.16722	0.016	T	0.47355	-0.9124	9	0.30078	T	0.28	0.8913	5.6541	0.17633	0.0:0.2993:0.1343:0.5664	rs7291444;rs52836498;rs57430542;rs7291444	992	Q9NTG1	PKDRE_HUMAN	P	992	ENSP00000253255:T992P	ENSP00000253255:T992P	T	-	1	0	PKDREJ	45034910	0.000000	0.05858	0.000000	0.03702	0.187000	0.23431	-1.782000	0.01772	-0.425000	0.07371	0.533000	0.62120	ACA	A|0.001;G|0.248;T|0.751		0.507	PKDREJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318466.1	NM_006071	
C3orf17	25871	ucsc.edu	37	3	112730187	112730187	+	Silent	SNP	T	T	C			TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr3:112730187T>C	ENST00000314400.5	-	6	809	c.618A>G	c.(616-618)caA>caG	p.Q206Q	C3orf17_ENST00000383675.2_Silent_p.Q136Q|C3orf17_ENST00000472762.1_5'Flank|C3orf17_ENST00000393857.2_Silent_p.Q70Q	NM_015412.3	NP_056227.2	Q6NW34	CC017_HUMAN	chromosome 3 open reading frame 17	206					negative regulation of neuron differentiation (GO:0045665)|positive regulation of Notch signaling pathway (GO:0045747)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(1)|kidney(2)|lung(6)|prostate(2)|skin(1)	13						TAGCGACCTCTTGAAGCAATC	0.353																																					p.Q206Q		.											.	C3orf17-90	0			c.A618G						.						82.0	91.0	88.0					3																	112730187		2197	4296	6493	SO:0001819	synonymous_variant	25871	exon6			GACCTCTTGAAGC	AL117573	CCDS33824.1	3q13.2	2009-11-06			ENSG00000163608	ENSG00000163608			24496	protein-coding gene	gene with protein product						12477932	Standard	NR_027794		Approved	DKFZP434F2021, NET17	uc003dzr.3	Q6NW34	OTTHUMG00000159286	ENST00000314400.5:c.618A>G	3.37:g.112730187T>C		Somatic	30	0		WXS	Illumina GAIIx	Phase_I	28	4	NM_015412	0	0	3	3	0	D3DN69|Q68DM6|Q9H7U0|Q9UFM4	Silent	SNP	ENST00000314400.5	37	CCDS33824.1																																																																																			.		0.353	C3orf17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354405.3	NM_015412	
EVC	2121	bcgsc.ca	37	4	5749904	5749904	+	Silent	SNP	T	T	C	rs4688963	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr4:5749904T>C	ENST00000264956.6	+	8	1153	c.969T>C	c.(967-969)aaT>aaC	p.N323N	EVC_ENST00000509451.1_Silent_p.N323N|EVC_ENST00000382674.2_Silent_p.N323N	NM_153717.2	NP_714928.1	P57679	EVC_HUMAN	Ellis van Creveld syndrome	323					cartilage development (GO:0051216)|endochondral bone growth (GO:0003416)|muscle organ development (GO:0007517)|positive regulation of smoothened signaling pathway (GO:0045880)|skeletal system development (GO:0001501)|smoothened signaling pathway (GO:0007224)	ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|endometrium(2)|large_intestine(10)|lung(11)|ovary(1)|skin(1)|stomach(1)	28		Myeloproliferative disorder(84;0.117)				AGATGGCAAATATCCAGCACT	0.463													C|||	2361	0.471446	0.4879	0.3098	5008	,	,		20183	0.6171		0.3569	False		,,,				2504	0.5317				p.N323N		.											.	EVC-92	0			c.T969C						.	C		2066,2340	608.3+/-391.1	480,1106,617	112.0	109.0	110.0		969	3.0	1.0	4	dbSNP_111	110	3210,5390	653.2+/-401.0	596,2018,1686	no	coding-synonymous	EVC	NM_153717.2		1076,3124,2303	CC,CT,TT		37.3256,46.8906,40.5659		323/993	5749904	5276,7730	2203	4300	6503	SO:0001819	synonymous_variant	2121	exon8			GGCAAATATCCAG	AF216184	CCDS3383.1	4p16	2008-07-03			ENSG00000072840	ENSG00000072840			3497	protein-coding gene	gene with protein product		604831				10700184	Standard	NM_153717		Approved	DWF-1	uc003gil.1	P57679	OTTHUMG00000090427	ENST00000264956.6:c.969T>C	4.37:g.5749904T>C		Somatic	122	0		WXS	Illumina GAIIx	Phase_I	127	6	NM_153717	0	0	0	0	0		Silent	SNP	ENST00000264956.6	37	CCDS3383.1																																																																																			T|0.559;C|0.441		0.463	EVC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206859.1		
EVC	2121	bcgsc.ca	37	4	5795412	5795412	+	Silent	SNP	C	C	T	rs11737221	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr4:5795412C>T	ENST00000264956.6	+	13	2038	c.1854C>T	c.(1852-1854)ggC>ggT	p.G618G	EVC_ENST00000515113.1_3'UTR|EVC_ENST00000382674.2_Silent_p.G618G	NM_153717.2	NP_714928.1	P57679	EVC_HUMAN	Ellis van Creveld syndrome	618					cartilage development (GO:0051216)|endochondral bone growth (GO:0003416)|muscle organ development (GO:0007517)|positive regulation of smoothened signaling pathway (GO:0045880)|skeletal system development (GO:0001501)|smoothened signaling pathway (GO:0007224)	ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|endometrium(2)|large_intestine(10)|lung(11)|ovary(1)|skin(1)|stomach(1)	28		Myeloproliferative disorder(84;0.117)				CCATCCGCGGCGTCTTGGGCC	0.642													C|||	1672	0.333866	0.0681	0.2896	5008	,	,		14377	0.5278		0.3091	False		,,,				2504	0.5501				p.G618G		.											.	EVC-92	0			c.C1854T						.	C		409,3917		26,357,1780	19.0	19.0	19.0		1854	-8.3	0.0	4	dbSNP_120	19	2408,5964		361,1686,2139	no	coding-synonymous	EVC	NM_153717.2		387,2043,3919	TT,TC,CC		28.7625,9.4545,22.1846		618/993	5795412	2817,9881	2163	4186	6349	SO:0001819	synonymous_variant	2121	exon13			CCGCGGCGTCTTG	AF216184	CCDS3383.1	4p16	2008-07-03			ENSG00000072840	ENSG00000072840			3497	protein-coding gene	gene with protein product		604831				10700184	Standard	NM_153717		Approved	DWF-1	uc003gil.1	P57679	OTTHUMG00000090427	ENST00000264956.6:c.1854C>T	4.37:g.5795412C>T		Somatic	134	1		WXS	Illumina GAIIx	Phase_I	167	9	NM_153717	0	0	0	0	0		Silent	SNP	ENST00000264956.6	37	CCDS3383.1																																																																																			C|0.742;T|0.258		0.642	EVC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206859.1		
RBM47	54502	hgsc.bcm.edu	37	4	40440854	40440854	+	Silent	SNP	G	G	C	rs1052153	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr4:40440854G>C	ENST00000381793.2	-	3	453	c.57C>G	c.(55-57)tcC>tcG	p.S19S	RBM47_ENST00000381795.6_Silent_p.S19S|RBM47_ENST00000514014.1_Intron|RBM47_ENST00000319592.4_Silent_p.S19S|RBM47_ENST00000295971.7_Silent_p.S19S|RBM47_ENST00000515809.1_Intron			A0AV96	RBM47_HUMAN	RNA binding motif protein 47	19					hematopoietic progenitor cell differentiation (GO:0002244)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(5)|endometrium(1)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	29						GCACCTTGGCGGAGGACCCGG	0.662													C|||	4016	0.801917	0.6808	0.8588	5008	,	,		14653	0.7679		0.8837	False		,,,				2504	0.8763				p.S19S		.											.	RBM47-25	0			c.C57G						.	C	,	3111,1133		1151,809,162	8.0	9.0	9.0		57,57	-7.6	0.0	4	dbSNP_86	9	7487,919		3358,771,74	no	coding-synonymous,coding-synonymous	RBM47	NM_001098634.1,NM_019027.3	,	4509,1580,236	CC,CG,GG		10.9327,26.6965,16.2213	,	19/594,19/525	40440854	10598,2052	2122	4203	6325	SO:0001819	synonymous_variant	54502	exon4			CTTGGCGGAGGAC	AK000280	CCDS3460.1, CCDS43223.1	4p14	2013-02-12			ENSG00000163694	ENSG00000163694		"""RNA binding motif (RRM) containing"""	30358	protein-coding gene	gene with protein product							Standard	NM_019027		Approved	FLJ20273, NET18	uc003gvc.2	A0AV96	OTTHUMG00000128598	ENST00000381793.2:c.57C>G	4.37:g.40440854G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	5	NM_001098634	0	0	1	1	0	A0PJK2|B5MED4|Q8NI52|Q8NI53|Q9NXG3	Silent	SNP	ENST00000381793.2	37	CCDS43223.1																																																																																			G|0.794;C|0.206		0.662	RBM47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250456.2	NM_019027	
AREG	374	broad.mit.edu;bcgsc.ca	37	4	75482066	75482066	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr4:75482066C>T	ENST00000380846.3	+	2	332	c.122C>T	c.(121-123)tCt>tTt	p.S41F	AC142293.3_ENST00000510419.1_RNA			P15514	AREG_HUMAN		41					cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|dichotomous subdivision of terminal units involved in mammary gland duct morphogenesis (GO:0060598)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation involved in mammary gland duct elongation (GO:0060750)|G-protein coupled receptor signaling pathway (GO:0007186)|glial cell proliferation (GO:0014009)|mammary gland alveolus development (GO:0060749)|mammary gland branching involved in thelarche (GO:0060744)|negative regulation of osteoblast differentiation (GO:0045668)|neuron projection development (GO:0031175)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|positive regulation of phosphorylation (GO:0042327)|response to cAMP (GO:0051591)|response to estradiol (GO:0032355)|response to glucocorticoid (GO:0051384)|response to hydrogen peroxide (GO:0042542)|response to peptide hormone (GO:0043434)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	growth factor activity (GO:0008083)			kidney(1)	1						GAACCATTTTCTGGGGACCAC	0.473																																					p.S41F		.											.	AREG-946	0			c.C122T						.						68.0	49.0	55.0					4																	75482066		1561	3330	4891	SO:0001583	missense	374	exon2			CATTTTCTGGGGA																												ENST00000380846.3:c.122C>T	4.37:g.75482066C>T	ENSP00000370227:p.Ser41Phe	Somatic	823	0		WXS	Illumina GAIIx	Phase_I	976	90	NM_001657	0	0	0	0	0	Q5U026	Missense_Mutation	SNP	ENST00000380846.3	37		.	.	.	.	.	.	.	.	.	.	C	17.75	3.466971	0.63625	.	.	ENSG00000205595	ENST00000380846	T	0.20463	2.07	3.42	3.42	0.39159	.	0.340814	0.31472	N	0.007586	T	0.36138	0.0956	.	.	.	0.35822	D	0.824651	.	.	.	.	.	.	T	0.53136	-0.8481	7	0.87932	D	0	-4.5906	12.403	0.55424	0.0:1.0:0.0:0.0	.	.	.	.	F	41	ENSP00000370227:S41F	ENSP00000370227:S41F	S	+	2	0	AREGB	75701090	0.208000	0.23494	0.757000	0.31301	0.908000	0.53690	3.857000	0.55972	1.738000	0.51689	0.423000	0.28283	TCT	.		0.473	AREGB-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000362747.1		
SHROOM3	57619	hgsc.bcm.edu	37	4	77662248	77662248	+	Silent	SNP	G	G	A	rs344142	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr4:77662248G>A	ENST00000296043.6	+	5	3875	c.2922G>A	c.(2920-2922)tcG>tcA	p.S974S		NM_020859.3	NP_065910.3	Q8TF72	SHRM3_HUMAN	shroom family member 3	974	ASD1. {ECO:0000255|PROSITE- ProRule:PRU00637}.				actin cytoskeleton organization (GO:0030036)|apical protein localization (GO:0045176)|cell morphogenesis (GO:0000902)|cellular pigment accumulation (GO:0043482)|columnar/cuboidal epithelial cell development (GO:0002066)|neural tube closure (GO:0001843)|pattern specification process (GO:0007389)|regulation of cell shape (GO:0008360)	adherens junction (GO:0005912)|apical junction complex (GO:0043296)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule (GO:0005874)				NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(29)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	60			Lung(101;0.0903)			CCGAGGCGTCGGCCTCCGCCT	0.776													G|||	2165	0.432308	0.4054	0.4827	5008	,	,		9965	0.2669		0.6044	False		,,,				2504	0.4264				p.S974S		.											.	SHROOM3-93	0			c.G2922A						.	G		1740,1410		550,640,385	2.0	3.0	3.0		2922	0.4	0.0	4	dbSNP_129	3	4503,2047		1663,1177,435	no	coding-synonymous	SHROOM3	NM_020859.3		2213,1817,820	AA,AG,GG		31.2519,44.7619,35.6392		974/1997	77662248	6243,3457	1575	3275	4850	SO:0001819	synonymous_variant	57619	exon5			GGCGTCGGCCTCC	AB055660	CCDS3579.2	4q21.1	2009-11-25			ENSG00000138771	ENSG00000138771			30422	protein-coding gene	gene with protein product		604570				10589677, 16615870	Standard	NM_020859		Approved	ShrmL, SHRM, KIAA1481, APXL3	uc011cbx.2	Q8TF72	OTTHUMG00000157075	ENST00000296043.6:c.2922G>A	4.37:g.77662248G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_020859	0	0	0	0	0	Q5QTQ3|Q6ZRW3|Q96IR9|Q9P247	Silent	SNP	ENST00000296043.6	37	CCDS3579.2																																																																																			G|0.531;A|0.469		0.776	SHROOM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252408.2	NM_020859	
TKTL2	84076	broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	164394479	164394479	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr4:164394479C>T	ENST00000280605.3	-	1	568	c.408G>A	c.(406-408)atG>atA	p.M136I		NM_032136.4	NP_115512.3	Q9H0I9	TKTL2_HUMAN	transketolase-like 2	136						cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|transketolase activity (GO:0004802)			breast(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(42)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	70	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				CAGTATAAGCCATTCCACATG	0.537																																					p.M136I		.											.	TKTL2-95	0			c.G408A						.						115.0	112.0	113.0					4																	164394479		2203	4300	6503	SO:0001583	missense	84076	exon1			ATAAGCCATTCCA	BC028707	CCDS3805.1	4q32.2	2009-10-06			ENSG00000151005	ENSG00000151005			25313	protein-coding gene	gene with protein product	"""similar to transketolase"""					11230166	Standard	NM_032136		Approved	FLJ32975, DKFZP434L1717	uc003iqp.4	Q9H0I9	OTTHUMG00000161527	ENST00000280605.3:c.408G>A	4.37:g.164394479C>T	ENSP00000280605:p.Met136Ile	Somatic	109	2		WXS	Illumina GAIIx	Phase_I	155	56	NM_032136	0	0	0	0	0	A4FVB4|Q8NCT0|Q96M82	Missense_Mutation	SNP	ENST00000280605.3	37	CCDS3805.1	.	.	.	.	.	.	.	.	.	.	C	17.48	3.399756	0.62177	.	.	ENSG00000151005	ENST00000280605	T	0.25085	1.82	3.71	3.71	0.42584	Transketolase, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.47893	0.1470	M	0.73372	2.23	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.43782	-0.9370	10	0.40728	T	0.16	-25.0496	13.8036	0.63216	0.0:1.0:0.0:0.0	.	136	Q9H0I9	TKTL2_HUMAN	I	136	ENSP00000280605:M136I	ENSP00000280605:M136I	M	-	3	0	TKTL2	164613929	1.000000	0.71417	0.962000	0.40283	0.810000	0.45777	7.256000	0.78350	2.359000	0.80004	0.561000	0.74099	ATG	.		0.537	TKTL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365207.1	NM_032136	
TENM3	55714	broad.mit.edu;bcgsc.ca	37	4	183651430	183651430	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr4:183651430A>G	ENST00000511685.1	+	15	2786	c.2663A>G	c.(2662-2664)cAt>cGt	p.H888R	TENM3_ENST00000406950.2_Missense_Mutation_p.H888R|TENM3_ENST00000502950.1_3'UTR			Q9P273	TEN3_HUMAN	teneurin transmembrane protein 3	888					camera-type eye morphogenesis (GO:0048593)|homophilic cell adhesion (GO:0007156)|positive regulation of neuron projection development (GO:0010976)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										TCGTTTTTCCATTACCCAGAA	0.413																																					p.H888R		.											.	.	0			c.A2663G						.						135.0	126.0	129.0					4																	183651430		1870	4103	5973	SO:0001583	missense	55714	exon14			TTTTCCATTACCC	AF195420	CCDS47165.1	4q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000218336	ENSG00000218336			29944	protein-coding gene	gene with protein product		610083	"""odz, odd Oz/ten-m homolog 3 (Drosophila)"""	ODZ3		10331952, 10625539	Standard	NM_001080477		Approved	Ten-M3, KIAA1455	uc003ivd.1	Q9P273	OTTHUMG00000160682	ENST00000511685.1:c.2663A>G	4.37:g.183651430A>G	ENSP00000424226:p.His888Arg	Somatic	119	0		WXS	Illumina GAIIx	Phase_I	183	8	NM_001080477	0	0	0	0	0	Q5XUL9|Q96SY2|Q9NV77|Q9NVW1|Q9NZJ2	Missense_Mutation	SNP	ENST00000511685.1	37	CCDS47165.1	.	.	.	.	.	.	.	.	.	.	A	10.98	1.503866	0.26949	.	.	ENSG00000218336	ENST00000511685;ENST00000406950	T;T	0.13420	2.59;2.59	4.92	3.73	0.42828	Carboxypeptidase-like, regulatory domain (1);	.	.	.	.	T	0.08846	0.0219	L	0.31804	0.96	0.46849	D	0.999228	B	0.02656	0.0	B	0.04013	0.001	T	0.10474	-1.0628	9	0.07325	T	0.83	.	10.7281	0.46081	0.9251:0.0:0.0749:0.0	.	888	Q9P273	TEN3_HUMAN	R	888	ENSP00000424226:H888R;ENSP00000385276:H888R	ENSP00000385276:H888R	H	+	2	0	ODZ3	183888424	1.000000	0.71417	0.999000	0.59377	0.981000	0.71138	6.139000	0.71728	0.897000	0.36392	-0.254000	0.11334	CAT	.		0.413	TENM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361734.1		
TRIP13	9319	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	912038	912038	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr5:912038A>G	ENST00000166345.3	+	10	1303	c.947A>G	c.(946-948)aAg>aGg	p.K316R		NM_004237.3	NP_004228.1	Q15645	PCH2_HUMAN	thyroid hormone receptor interactor 13	316					double-strand break repair (GO:0006302)|female meiosis I (GO:0007144)|male meiosis I (GO:0007141)|oocyte maturation (GO:0001556)|oogenesis (GO:0048477)|reciprocal meiotic recombination (GO:0007131)|regulation of RNA biosynthetic process (GO:2001141)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)|transcription from RNA polymerase II promoter (GO:0006366)	male germ cell nucleus (GO:0001673)|nucleus (GO:0005634)	ATP binding (GO:0005524)|transcription cofactor activity (GO:0003712)			breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(1)	18			Epithelial(17;0.00147)|OV - Ovarian serous cystadenocarcinoma(19;0.00271)|all cancers(22;0.00622)|Lung(60;0.165)			GCTGACATCAAGCAGTACATT	0.463																																					p.K316R		.											.	TRIP13-90	0			c.A947G						.						190.0	154.0	166.0					5																	912038		2203	4300	6503	SO:0001583	missense	9319	exon10			ACATCAAGCAGTA	L40384	CCDS3858.1	5p15	2010-04-21			ENSG00000071539	ENSG00000071539		"""ATPases / AAA-type"""	12307	protein-coding gene	gene with protein product	"""thyroid receptor interacting protein 13"""	604507				7776974	Standard	NM_004237		Approved	16E1BP	uc003jbr.3	Q15645	OTTHUMG00000090349	ENST00000166345.3:c.947A>G	5.37:g.912038A>G	ENSP00000166345:p.Lys316Arg	Somatic	143	0		WXS	Illumina GAIIx	Phase_I	210	70	NM_004237	0	0	2	2	0	C9K0T3|D3DTC0|O15324	Missense_Mutation	SNP	ENST00000166345.3	37	CCDS3858.1	.	.	.	.	.	.	.	.	.	.	.	15.57	2.871444	0.51695	.	.	ENSG00000071539	ENST00000166345	D	0.94793	-3.52	5.78	4.71	0.59529	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.043242	0.85682	N	0.000000	D	0.89364	0.6694	L	0.38692	1.165	0.58432	D	0.99999	B	0.22604	0.072	B	0.26310	0.068	T	0.82729	-0.0313	10	0.23302	T	0.38	-28.6123	6.9083	0.24321	0.8748:0.0:0.1252:0.0	.	316	Q15645	PCH2_HUMAN	R	316	ENSP00000166345:K316R	ENSP00000166345:K316R	K	+	2	0	TRIP13	965038	1.000000	0.71417	1.000000	0.80357	0.714000	0.41099	5.637000	0.67854	1.150000	0.42419	0.533000	0.62120	AAG	.		0.463	TRIP13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206721.2	NM_004237	
PAPD7	11044	bcgsc.ca	37	5	6746484	6746484	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr5:6746484C>A	ENST00000230859.6	+	7	782	c.653C>A	c.(652-654)gCc>gAc	p.A218D		NM_001171805.1|NM_001171806.1|NM_006999.4	NP_001165276.1|NP_001165277.1|NP_008930.1	Q5XG87	PAPD7_HUMAN	PAP associated domain containing 7	448					double-strand break repair (GO:0006302)|mitotic chromosome condensation (GO:0007076)|response to drug (GO:0042493)|sister chromatid cohesion (GO:0007062)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|polynucleotide adenylyltransferase activity (GO:0004652)|SMC family protein binding (GO:0043221)			cervix(1)|endometrium(2)|large_intestine(8)|lung(10)|ovary(2)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27						ATCATGAAAGCCATGACCAGC	0.498																																					p.A218D	NSCLC(7;212 333 5667 23379 46547)	.											.	PAPD7-69	0			c.C653A						.						96.0	101.0	100.0					5																	6746484		2203	4300	6503	SO:0001583	missense	11044	exon7			TGAAAGCCATGAC	AF089896	CCDS3871.1	5p15	2010-11-18	2010-01-19	2010-01-19	ENSG00000112941	ENSG00000112941			16705	protein-coding gene	gene with protein product	"""topoisomerase-related function protein 4-1"", ""polymerase (DNA-directed) sigma"", ""DNA polymerase kappa"", ""TUTase5"""	605198	"""polymerase (DNA directed) sigma"""	POLS		10066793, 10926539	Standard	NM_006999		Approved	POLK, TRF4, LAK-1, TRF4-1	uc003jdx.1	Q5XG87	OTTHUMG00000090457	ENST00000230859.6:c.653C>A	5.37:g.6746484C>A	ENSP00000230859:p.Ala218Asp	Somatic	51	0		WXS	Illumina GAIIx	Phase_I	53	4	NM_001171805	0	0	0	0	0	A8K1E2|M1JCE6|O43289|Q17RZ1|Q9Y6C1	Missense_Mutation	SNP	ENST00000230859.6	37	CCDS3871.1	.	.	.	.	.	.	.	.	.	.	C	11.54	1.668073	0.29604	.	.	ENSG00000112941	ENST00000230859	T	0.76578	-1.03	5.27	5.27	0.74061	PAP/25A-associated (1);	0.158596	0.56097	D	0.000029	T	0.44746	0.1308	N	0.01168	-0.975	0.43222	D	0.995105	B;B	0.09022	0.002;0.002	B;B	0.15052	0.012;0.012	T	0.49716	-0.8910	10	0.11794	T	0.64	-4.0299	5.6759	0.17747	0.1913:0.6902:0.0:0.1184	.	218;218	B7ZLL4;Q5XG87	.;PAPD7_HUMAN	D	218	ENSP00000230859:A218D	ENSP00000230859:A218D	A	+	2	0	PAPD7	6799484	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.232000	0.32636	2.618000	0.88619	0.561000	0.74099	GCC	.		0.498	PAPD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206904.1	NM_006999	
NLN	57486	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	65105961	65105961	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr5:65105961C>G	ENST00000380985.5	+	11	1990	c.1812C>G	c.(1810-1812)tgC>tgG	p.C604W	NLN_ENST00000502464.1_Missense_Mutation_p.C500W	NM_020726.4	NP_065777.1	Q9BYT8	NEUL_HUMAN	neurolysin (metallopeptidase M3 family)	604						mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)			central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(10)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	26		Lung NSC(167;7.21e-05)|Prostate(74;0.0174)|Ovarian(174;0.186)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0743)|Lung(70;0.00616)		CCAAATACTGCTCAGAAATAT	0.448																																					p.C604W		.											.	NLN-90	0			c.C1812G						.						96.0	92.0	93.0					5																	65105961		2203	4300	6503	SO:0001583	missense	57486	exon11			ATACTGCTCAGAA	AJ300837	CCDS3989.1	5q12.3	2008-02-05	2005-03-31		ENSG00000123213	ENSG00000123213	3.4.24.16		16058	protein-coding gene	gene with protein product		611530	"""angiotensin binding protein"""	AGTBP		10574462	Standard	NM_020726		Approved	KIAA1226	uc003juf.3	Q9BYT8	OTTHUMG00000097803	ENST00000380985.5:c.1812C>G	5.37:g.65105961C>G	ENSP00000370372:p.Cys604Trp	Somatic	85	0		WXS	Illumina GAIIx	Phase_I	109	18	NM_020726	0	0	0	0	0	Q9ULJ4	Missense_Mutation	SNP	ENST00000380985.5	37	CCDS3989.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	16.62|16.62|16.62	3.174478|3.174478|3.174478	0.57692|0.57692|0.57692	.|.|.	.|.|.	ENSG00000123213|ENSG00000123213|ENSG00000123213	ENST00000340159|ENST00000380985;ENST00000502464;ENST00000511299|ENST00000509935	.|T;T;T|.	.|0.07444|.	.|3.19;3.19;3.19|.	5.9|5.9|5.9	4.85|4.85|4.85	0.62838|0.62838|0.62838	.|Neurolysin/Thimet oligopeptidase, domain 2 (1);|.	.|0.204017|.	.|0.56097|.	.|D|.	.|0.000023|.	T|T|T	0.40347|0.40347|0.40347	0.1113|0.1113|0.1113	N|N|N	0.20986|0.20986|0.20986	0.625|0.625|0.625	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|D;D|.	.|0.89917|.	.|1.0;1.0|.	.|D;D|.	.|0.81914|.	.|0.993;0.995|.	T|T|T	0.17471|0.17471|0.17471	-1.0368|-1.0368|-1.0368	6|10|5	0.19147|0.72032|.	T|D|.	0.46|0.01|.	-12.6986|-12.6986|-12.6986	6.0723|6.0723|6.0723	0.19895|0.19895|0.19895	0.0:0.6618:0.2012:0.137|0.0:0.6618:0.2012:0.137|0.0:0.6618:0.2012:0.137	.|.|.	.|281;604|.	.|Q96K48;Q9BYT8|.	.|.;NEUL_HUMAN|.	G|W|V	604|604;500;314|201	.|ENSP00000370372:C604W;ENSP00000423214:C500W;ENSP00000427417:C314W|.	ENSP00000339283:A604G|ENSP00000370372:C604W|.	A|C|L	+|+|+	2|3|1	0|2|0	NLN|NLN|NLN	65141717|65141717|65141717	0.992000|0.992000|0.992000	0.36948|0.36948|0.36948	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.993000|0.993000|0.993000	0.82548|0.82548|0.82548	2.273000|2.273000|2.273000	0.43381|0.43381|0.43381	2.799000|2.799000|2.799000	0.96334|0.96334|0.96334	0.643000|0.643000|0.643000	0.83706|0.83706|0.83706	GCT|TGC|CTC	.		0.448	NLN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215060.1		
RAD17	5884	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	68684968	68684968	+	Silent	SNP	A	A	T	rs140360093		TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr5:68684968A>T	ENST00000509734.1	+	11	1713	c.1035A>T	c.(1033-1035)tcA>tcT	p.S345S	RAD17_ENST00000282891.6_Silent_p.S248S|RAD17_ENST00000521422.1_Silent_p.S169S|RAD17_ENST00000354868.5_Silent_p.S334S|RAD17_ENST00000361732.2_Silent_p.S334S|RAD17_ENST00000345306.6_Silent_p.S334S|RAD17_ENST00000504177.1_Intron|RAD17_ENST00000305138.4_Silent_p.S334S|RAD17_ENST00000358030.2_Silent_p.S169S|RAD17_ENST00000354312.3_Silent_p.S334S|RAD17_ENST00000380774.3_Silent_p.S345S			O75943	RAD17_HUMAN	RAD17 homolog (S. pombe)	345					cellular response to DNA damage stimulus (GO:0006974)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of DNA replication (GO:0008156)|regulation of phosphorylation (GO:0042325)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)						Lung NSC(167;5.19e-05)|Prostate(74;0.0143)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;9.36e-57)|Epithelial(20;1.21e-52)|all cancers(19;3.34e-48)|Lung(70;0.0183)		TTTCTTCTTCAAAAGGTAACT	0.358								Other conserved DNA damage response genes																													p.S345S		.											.	RAD17-205	0			c.A1035T						.	A	,,,,,,,	0,4406		0,0,2203	91.0	95.0	93.0		1002,1002,1035,507,744,1002,1002,1002	-2.9	1.0	5	dbSNP_134	93	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	RAD17	NM_002873.1,NM_133338.1,NM_133339.1,NM_133340.1,NM_133341.1,NM_133342.1,NM_133343.1,NM_133344.1	,,,,,,,	0,1,6502	TT,TA,AA		0.0116,0.0,0.0077	,,,,,,,	334/671,334/671,345/682,169/506,248/585,334/671,334/671,334/671	68684968	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	5884	exon9			TTCTTCAAAAGGT	AF085736	CCDS4003.1, CCDS4004.1, CCDS4005.1, CCDS47226.1	5q13	2010-09-24	2001-11-28		ENSG00000152942	ENSG00000152942			9807	protein-coding gene	gene with protein product		603139	"""RAD1 (S. pombe) homolog"""			9869296, 9660800	Standard	NM_133343		Approved	Rad24, RAD17Sp, CCYC	uc003jwo.3	O75943	OTTHUMG00000099357	ENST00000509734.1:c.1035A>T	5.37:g.68684968A>T		Somatic	48	0		WXS	Illumina GAIIx	Phase_I	49	8	NM_133339	0	0	0	0	0	A8K8X2|D3DWA5|O75714|Q7Z3S4|Q9UNK7|Q9UNR7|Q9UNR8|Q9UPF5	Silent	SNP	ENST00000509734.1	37	CCDS4003.1																																																																																			A|1.000;T|0.000		0.358	RAD17-008	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369171.1	NM_133344	
CMYA5	202333	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	79029380	79029380	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr5:79029380G>A	ENST00000446378.2	+	2	4823	c.4792G>A	c.(4792-4794)Gta>Ata	p.V1598I		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	1598					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		GGCAGTGGAGGTATCTTCTAC	0.458																																					p.V1598I		.											.	CMYA5-77	0			c.G4792A						.						122.0	122.0	122.0					5																	79029380		1881	4119	6000	SO:0001583	missense	202333	exon2			GTGGAGGTATCTT	AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.4792G>A	5.37:g.79029380G>A	ENSP00000394770:p.Val1598Ile	Somatic	78	0		WXS	Illumina GAIIx	Phase_I	140	37	NM_153610	0	0	0	0	0	A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Missense_Mutation	SNP	ENST00000446378.2	37	CCDS47238.1	.	.	.	.	.	.	.	.	.	.	G	7.624	0.677493	0.14841	.	.	ENSG00000164309	ENST00000446378	T	0.03860	3.78	5.07	-6.27	0.02026	.	1.038790	0.07606	N	0.924530	T	0.02156	0.0067	N	0.19112	0.55	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.48305	-0.9047	10	0.18710	T	0.47	.	0.277	0.00239	0.2582:0.266:0.2346:0.2411	.	1598	Q8N3K9	CMYA5_HUMAN	I	1598	ENSP00000394770:V1598I	ENSP00000394770:V1598I	V	+	1	0	CMYA5	79065136	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	0.001000	0.13038	-0.882000	0.03987	-0.878000	0.02970	GTA	.		0.458	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369497.1	NM_153610	
PCDHB7	56129	broad.mit.edu	37	5	140553994	140553994	+	Silent	SNP	G	G	T	rs374392843		TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr5:140553994G>T	ENST00000231137.3	+	1	1752	c.1578G>T	c.(1576-1578)gcG>gcT	p.A526A		NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	526	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A526A(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCCTGCAGGCGTTCGAGTTCC	0.706													g|||	1	0.000199681	0.0	0.0	5008	,	,		16269	0.0		0.001	False		,,,				2504	0.0				p.A526A		.											.	PCDHB7-95	1	Substitution - coding silent(1)	lung(1)	c.G1578T						.						62.0	68.0	66.0					5																	140553994		2203	4300	6503	SO:0001819	synonymous_variant	56129	exon1			GCAGGCGTTCGAG	AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.1578G>T	5.37:g.140553994G>T		Somatic	162	1		WXS	Illumina GAIIx	Phase_I	381	17	NM_018940	0	0	9	9	0	A1L3Y8	Silent	SNP	ENST00000231137.3	37	CCDS4249.1																																																																																			.		0.706	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251803.2	NM_018940	
ARL10	285598	hgsc.bcm.edu	37	5	175792605	175792605	+	Silent	SNP	G	G	C	rs2303667	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr5:175792605G>C	ENST00000310389.5	+	1	135	c.39G>C	c.(37-39)ctG>ctC	p.L13L	MIR1271_ENST00000408537.1_RNA	NM_173664.4	NP_775935.1	Q8N8L6	ARL10_HUMAN	ADP-ribosylation factor-like 10	13					small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	GTP binding (GO:0005525)			endometrium(2)|lung(1)|ovary(1)	4	all_cancers(89;0.0064)|Renal(175;0.000269)|Lung NSC(126;0.0105)|all_lung(126;0.0168)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	Kidney(146;0.0965)		TGCTGGCGCTGGGCGGCGCCG	0.756													G|||	2787	0.55651	0.5938	0.4928	5008	,	,		9772	0.5556		0.6093	False		,,,				2504	0.498				p.L13L		.											.	ARL10-91	0			c.G39C						.	G		1858,1528		603,652,438	3.0	4.0	3.0		39	3.2	0.8	5	dbSNP_100	3	4085,2705		1416,1253,726	no	coding-synonymous	ARL10	NM_173664.4		2019,1905,1164	CC,CG,GG		39.838,45.127,41.5979		13/245	175792605	5943,4233	1693	3395	5088	SO:0001819	synonymous_variant	285598	exon1			GGCGCTGGGCGGC	BK001673	CCDS4400.1	5q35.3	2014-05-09	2005-11-03	2005-11-03	ENSG00000175414	ENSG00000175414		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	22042	protein-coding gene	gene with protein product			"""ADP-ribosylation factor-like 10A"""	ARL10A			Standard	NM_173664		Approved		uc003mec.1	Q8N8L6	OTTHUMG00000130655	ENST00000310389.5:c.39G>C	5.37:g.175792605G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	13	13	NM_173664	0	0	0	0	0		Silent	SNP	ENST00000310389.5	37	CCDS4400.1																																																																																			G|0.585;C|0.415		0.756	ARL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253145.2	NM_173664	
SLC35B3	51000	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	8417697	8417697	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr6:8417697A>G	ENST00000379660.4	-	8	1260	c.811T>C	c.(811-813)Tac>Cac	p.Y271H		NM_001142540.1|NM_001142541.1|NM_015948.3	NP_001136012.1|NP_001136013.1|NP_057032.2	Q9H1N7	S35B3_HUMAN	solute carrier family 35 (adenosine 3'-phospho 5'-phosphosulfate transporter), member B3	271					3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|xenobiotic metabolic process (GO:0006805)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(1)|prostate(1)	15	Ovarian(93;0.0569)					AGTAAAATGTATACAAAACCA	0.308																																					p.Y271H	Melanoma(83;700 1353 9357 11478 30548)	.											.	SLC35B3-90	0			c.T811C						.						75.0	71.0	72.0					6																	8417697		2203	4296	6499	SO:0001583	missense	51000	exon8			AAATGTATACAAA	AF132953	CCDS4508.1	6p24.3	2013-07-17	2013-07-17	2003-09-10	ENSG00000124786	ENSG00000124786		"""Solute carriers"""	21601	protein-coding gene	gene with protein product	"""3' phosphoadenosine 5' phosphosulfate transporter 2"""	610845	"""chromosome 6 open reading frame 196"", ""solute carrier family 35, member B3"""	C6orf196		10810093	Standard	XM_005249156		Approved	CGI-19, dJ453H5.1, PAPST2	uc010joe.3	Q9H1N7	OTTHUMG00000014224	ENST00000379660.4:c.811T>C	6.37:g.8417697A>G	ENSP00000368981:p.Tyr271His	Somatic	151	0		WXS	Illumina GAIIx	Phase_I	162	87	NM_001142540	0	0	0	5	5	A6NKX9|Q1XH11|Q6MZJ0|Q7Z662|Q9Y308	Missense_Mutation	SNP	ENST00000379660.4	37	CCDS4508.1	.	.	.	.	.	.	.	.	.	.	A	17.92	3.505811	0.64410	.	.	ENSG00000124786	ENST00000379660	T	0.32023	1.47	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.53818	0.1820	M	0.87547	2.89	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.992	T	0.62253	-0.6893	9	.	.	.	-11.1728	15.9054	0.79423	1.0:0.0:0.0:0.0	.	271;271	Q9H1N7;B2R8V5	S35B3_HUMAN;.	H	271	ENSP00000368981:Y271H	.	Y	-	1	0	SLC35B3	8362696	1.000000	0.71417	1.000000	0.80357	0.355000	0.29361	7.377000	0.79668	2.157000	0.67596	0.533000	0.62120	TAC	.		0.308	SLC35B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039802.1	NM_015948	
MLN	4295	bcgsc.ca	37	6	33768897	33768897	+	Missense_Mutation	SNP	A	A	G	rs2281820	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr6:33768897A>G	ENST00000430124.2	-	2	109	c.44T>C	c.(43-45)gTa>gCa	p.V15A	MLN_ENST00000507738.1_Missense_Mutation_p.V15A|MLN_ENST00000266003.5_Missense_Mutation_p.V15A	NM_001040109.1|NM_001184698.1|NM_002418.2	NP_001035198.1|NP_001171627.1|NP_002409.1	P12872	MOTI_HUMAN	motilin	15			V -> A (in dbSNP:rs2281820). {ECO:0000269|PubMed:15489334}.		cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway (GO:0007186)	extracellular region (GO:0005576)	receptor binding (GO:0005102)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)|skin(1)	6						CATGGCAGCTACATGCACCAC	0.577													G|||	3163	0.631589	0.4932	0.5216	5008	,	,		20036	0.8562		0.5368	False		,,,				2504	0.7628				p.V15A		.											.	MLN-90	0			c.T44C						.	G	ALA/VAL,ALA/VAL,ALA/VAL	2229,2177	585.3+/-386.2	560,1109,534	98.0	86.0	90.0		44,44,44	-1.1	0.0	6	dbSNP_100	90	4994,3606	520.8+/-379.8	1460,2074,766	yes	missense,missense,missense	MLN	NM_001040109.1,NM_001184698.1,NM_002418.2	64,64,64	2020,3183,1300	GG,GA,AA		41.9302,49.4099,44.4641	benign,benign,benign	15/115,15/109,15/116	33768897	7223,5783	2203	4300	6503	SO:0001583	missense	4295	exon2			GCAGCTACATGCA		CCDS4786.1, CCDS47412.1, CCDS54993.1	6p21.31	2014-01-30			ENSG00000096395	ENSG00000096395		"""Endogenous ligands"""	7141	protein-coding gene	gene with protein product	"""prepromotilin"""	158270					Standard	NM_001184698		Approved		uc003off.1	P12872	OTTHUMG00000014536	ENST00000430124.2:c.44T>C	6.37:g.33768897A>G	ENSP00000388825:p.Val15Ala	Somatic	313	5		WXS	Illumina GAIIx	Phase_I	213	9	NM_002418	0	0	0	0	0	B7ZLR7|E9PDN2|J3KN51|Q2M1L2|Q5T975|Q6NSY7	Missense_Mutation	SNP	ENST00000430124.2	37	CCDS4786.1	1328	0.608058608058608	256	0.5203252032520326	185	0.511049723756906	475	0.8304195804195804	412	0.5435356200527705	G	0.628	-0.818365	0.02776	0.505901	0.580698	ENSG00000096395	ENST00000430124;ENST00000266003;ENST00000507738	T;T;T	0.51325	0.71;0.71;0.71	5.43	-1.12	0.09808	.	1.272520	0.05417	N	0.543508	T	0.11067	0.0270	L	0.28115	0.83	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.12682	-1.0538	9	0.10636	T	0.68	0.251	7.2176	0.25969	0.4771:0.12:0.4029:0.0	rs2281820;rs52813189;rs61381966;rs2281820	15;15	E9PDN2;P12872	.;MOTI_HUMAN	A	15	ENSP00000388825:V15A;ENSP00000266003:V15A;ENSP00000425467:V15A	ENSP00000266003:V15A	V	-	2	0	MLN	33876875	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.753000	0.04792	-0.651000	0.05415	-0.812000	0.03155	GTA	A|0.403;G|0.597		0.577	MLN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040211.4		
KCNQ5	56479	hgsc.bcm.edu	37	6	73332040	73332040	+	Silent	SNP	C	C	G	rs3734212	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr6:73332040C>G	ENST00000370398.1	+	1	232	c.123C>G	c.(121-123)tcC>tcG	p.S41S	KCNQ5_ENST00000414165.2_Silent_p.S41S|KCNQ5_ENST00000370392.1_Silent_p.S41S|KCNQ5_ENST00000355194.4_Silent_p.S41S|KCNQ5_ENST00000355635.3_Silent_p.S41S|KCNQ5_ENST00000342056.2_Silent_p.S41S|KCNQ5_ENST00000402622.2_Silent_p.S41S|KCNQ5_ENST00000403813.2_Silent_p.S41S	NM_019842.3	NP_062816.2	Q9NR82	KCNQ5_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 5	41					protein complex assembly (GO:0006461)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|inward rectifier potassium channel activity (GO:0005242)			breast(1)|cervix(1)|endometrium(6)|kidney(7)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	57		all_epithelial(107;0.116)|Lung NSC(302;0.219)		COAD - Colon adenocarcinoma(1;0.0107)|Colorectal(1;0.0583)	Ezogabine(DB04953)	ATGTGGAGTCCGGCCGGGGCA	0.791													G|||	2294	0.458067	0.2625	0.4337	5008	,	,		8962	0.4524		0.7097	False		,,,				2504	0.4867				p.S41S	GBM(142;1375 1859 14391 23261 44706)	.											.	KCNQ5-158	0			c.C123G						.	G	,,,,	1342,1750		314,714,518	2.0	3.0	3.0		123,123,123,123,123	-2.2	1.0	6	dbSNP_107	3	4892,1744		1918,1056,344	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	KCNQ5	NM_001160130.1,NM_001160132.1,NM_001160133.1,NM_001160134.1,NM_019842.3	,,,,	2232,1770,862	GG,GC,CC		26.2809,43.4023,35.9169	,,,,	41/924,41/943,41/952,41/823,41/933	73332040	6234,3494	1546	3318	4864	SO:0001819	synonymous_variant	56479	exon1			GGAGTCCGGCCGG	AF202977	CCDS4976.1, CCDS55034.1	6q14	2012-07-05			ENSG00000185760	ENSG00000185760		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6299	protein-coding gene	gene with protein product		607357				10787416, 10816588, 16382104	Standard	NM_019842		Approved	Kv7.5	uc011dyh.2	Q9NR82	OTTHUMG00000015020	ENST00000370398.1:c.123C>G	6.37:g.73332040C>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_001160132	0	0	0	0	0	A6NKT6|A6PVT6|A8MSQ5|B4DS33|B5MC83|B7ZL37|F5GZV0|Q17RE1|Q5VVP3|Q86W40|Q9NRN0|Q9NYA6	Silent	SNP	ENST00000370398.1	37	CCDS4976.1																																																																																			C|0.505;G|0.495		0.791	KCNQ5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000041198.3	NM_019842	
PHACTR2	9749	bcgsc.ca	37	6	144081768	144081768	+	Silent	SNP	C	C	A	rs2073215	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr6:144081768C>A	ENST00000427704.2	+	5	782	c.652C>A	c.(652-654)Cga>Aga	p.R218R	PHACTR2_ENST00000367584.4_Intron|PHACTR2_ENST00000367582.3_Intron|PHACTR2_ENST00000305766.6_Intron|PHACTR2_ENST00000440869.2_Silent_p.R229R	NM_001100166.1|NM_014721.2	NP_001093636.1|NP_055536.2	O75167	PHAR2_HUMAN	phosphatase and actin regulator 2	218							protein phosphatase inhibitor activity (GO:0004864)			NS(3)|breast(1)|cervix(1)|endometrium(3)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	30				OV - Ovarian serous cystadenocarcinoma(155;1.58e-05)|GBM - Glioblastoma multiforme(68;0.0386)		AAACACGACCCGAGAGGCTGG	0.557													C|||	1098	0.219249	0.2247	0.183	5008	,	,		18438	0.3988		0.0964	False		,,,				2504	0.1789				p.R229R	Pancreas(12;292 433 7358 48260 52635)|Ovarian(20;501 618 3485 36581 49208)	.											.	PHACTR2-92	0			c.C685A						.	C	,,,	782,2942		89,604,1169	40.0	45.0	44.0		685,,,652	6.1	1.0	6	dbSNP_96	44	666,7516		30,606,3455	no	coding-synonymous,intron,intron,coding-synonymous	PHACTR2	NM_001100164.1,NM_001100165.1,NM_001100166.1,NM_014721.2	,,,	119,1210,4624	AA,AC,CC		8.1398,20.9989,12.1619	,,,	229/646,,,218/635	144081768	1448,10458	1862	4091	5953	SO:0001819	synonymous_variant	9749	exon5			ACGACCCGAGAGG	AB014580	CCDS43512.1, CCDS47492.1, CCDS47493.1, CCDS47494.1	6q24.1	2013-01-24	2004-05-20	2004-05-20	ENSG00000112419	ENSG00000112419		"""Phosphatase and actin regulators"""	20956	protein-coding gene	gene with protein product		608724	"""chromosome 6 open reading frame 56"""	C6orf56		9734811, 15107502	Standard	NM_001100164		Approved	KIAA0680	uc010khi.3	O75167	OTTHUMG00000015732	ENST00000427704.2:c.652C>A	6.37:g.144081768C>A		Somatic	35	0		WXS	Illumina GAIIx	Phase_I	53	4	NM_001100164	0	0	0	0	0	A6NKP5|A7MCZ5|A8MZC0|B2RWP7|B4DN76|B4DPB5|B4DTH7|Q5TFA0|Q68DM2	Silent	SNP	ENST00000427704.2	37	CCDS47492.1																																																																																			C|0.799;A|0.201		0.557	PHACTR2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000042528.2	NM_014721	
RPS6KA2	6196	ucsc.edu	37	6	166826304	166826304	+	Silent	SNP	T	T	C	rs760670	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr6:166826304T>C	ENST00000265678.4	-	21	2371	c.2148A>G	c.(2146-2148)tcA>tcG	p.S716S	RPS6KA2_ENST00000510118.1_Silent_p.S741S|RPS6KA2_ENST00000481261.2_Silent_p.S627S|RPS6KA2_ENST00000503859.1_Silent_p.S724S|RPS6KA2_ENST00000405189.3_Silent_p.S627S|RPS6KA2_ENST00000509742.1_5'UTR	NM_021135.4	NP_066958.2	Q15349	KS6A2_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 2	716					axon guidance (GO:0007411)|brain renin-angiotensin system (GO:0002035)|cardiac muscle cell apoptotic process (GO:0010659)|cellular response to carbohydrate stimulus (GO:0071322)|heart contraction (GO:0060047)|heart development (GO:0007507)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of meiosis (GO:0045835)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oocyte maturation (GO:0001556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of gene expression (GO:0010628)|regulation of protein processing (GO:0070613)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|ribosomal protein S6 kinase activity (GO:0004711)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(15)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	45		Breast(66;2.04e-05)|Ovarian(120;0.0652)|Prostate(117;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.76e-18)|GBM - Glioblastoma multiforme(31;9.94e-06)|BRCA - Breast invasive adenocarcinoma(81;1.36e-05)		CCAGGTTGGATGACAGCACGG	0.647													C|||	3984	0.795527	0.8646	0.7507	5008	,	,		15129	0.7887		0.6789	False		,,,				2504	0.8609				p.S724S		.											.	RPS6KA2-1405	0			c.A2172G						.	C	,	3650,744		1516,618,63	32.0	31.0	31.0		2172,2148	-7.3	0.7	6	dbSNP_86	31	5979,2615		2083,1813,401	no	coding-synonymous,coding-synonymous	RPS6KA2	NM_001006932.1,NM_021135.4	,	3599,2431,464	CC,CT,TT		30.4282,16.9322,25.8623	,	724/742,716/734	166826304	9629,3359	2197	4297	6494	SO:0001819	synonymous_variant	6196	exon22			GTTGGATGACAGC	L07598	CCDS5294.1, CCDS34570.1	6q27	2011-04-05	2002-08-29		ENSG00000071242	ENSG00000071242			10431	protein-coding gene	gene with protein product		601685	"""ribosomal protein S6 kinase, 90kD, polypeptide 2"""			8141249	Standard	NM_001006932		Approved	RSK, RSK3, HU-2	uc003qvc.1	Q15349	OTTHUMG00000016007	ENST00000265678.4:c.2148A>G	6.37:g.166826304T>C		Somatic	67	2		WXS	Illumina GAIIx	Phase_I	44	4	NM_001006932	0	0	1	1	0	B3KTK9|Q15419|Q59GJ3|Q5TI68|Q96J38|Q9UJN5	Silent	SNP	ENST00000265678.4	37	CCDS5294.1																																																																																			T|0.240;C|0.760		0.647	RPS6KA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043075.3	NM_021135	
USP42	84132	hgsc.bcm.edu	37	7	6193521	6193521	+	Missense_Mutation	SNP	G	G	C	rs61729726	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr7:6193521G>C	ENST00000306177.5	+	15	2494	c.2336G>C	c.(2335-2337)cGc>cCc	p.R779P		NM_032172.2	NP_115548.1	Q9H9J4	UBP42_HUMAN	ubiquitin specific peptidase 42	779	Pro-rich.				cell differentiation (GO:0030154)|protein deubiquitination (GO:0016579)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(2)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	35		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.108)|OV - Ovarian serous cystadenocarcinoma(56;5.77e-14)		CCGCCGCCCCGCGATCCCGGC	0.756													C|||	2895	0.578075	0.8638	0.4121	5008	,	,		10724	0.7331		0.3082	False		,,,				2504	0.4274				p.R779P		.											.	USP42-659	0			c.G2336C						.	C	PRO/ARG	2157,1125		751,655,235	4.0	6.0	5.0		2336	2.6	0.0	7	dbSNP_129	5	1843,5693		290,1263,2215	no	missense	USP42	NM_032172.2	103	1041,1918,2450	CC,CG,GG		24.4559,34.2779,36.9754	benign	779/1317	6193521	4000,6818	1641	3768	5409	SO:0001583	missense	84132	exon15			CGCCCCGCGATCC	AK022759	CCDS47535.1	7p22.2	2005-08-08	2005-08-08		ENSG00000106346	ENSG00000106346		"""Ubiquitin-specific peptidases"""	20068	protein-coding gene	gene with protein product			"""ubiquitin specific protease 42"""			12838346	Standard	NM_032172		Approved	FLJ12697	uc011jwp.2	Q9H9J4	OTTHUMG00000151888	ENST00000306177.5:c.2336G>C	7.37:g.6193521G>C	ENSP00000301962:p.Arg779Pro	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	20	7	NM_032172	0	0	0	0	0	A2RUE3|B5MDA5|Q0VIN8|Q3C166|Q6P9B4	Missense_Mutation	SNP	ENST00000306177.5	37	CCDS47535.1	1188	0.5439560439560439	401	0.8150406504065041	130	0.35911602209944754	440	0.7692307692307693	217	0.2862796833773087	C	10.95	1.494372	0.26774	0.657221	0.244559	ENSG00000106346	ENST00000306177;ENST00000426246	T;T	0.14266	2.52;2.93	5.46	2.59	0.31030	.	0.841331	0.10600	N	0.655737	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.09164	-1.0687	9	0.28530	T	0.3	.	2.8136	0.05448	0.1458:0.5508:0.1414:0.162	rs61729726	779;779	Q9H9J4-2;Q9H9J4	.;UBP42_HUMAN	P	779;625	ENSP00000301962:R779P;ENSP00000408217:R625P	ENSP00000301962:R779P	R	+	2	0	USP42	6160046	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.469000	0.22067	0.265000	0.21872	-0.120000	0.15030	CGC	G|0.456;C|0.544		0.756	USP42-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324262.3	XM_166526	
GLI3	2737	hgsc.bcm.edu	37	7	42005678	42005678	+	Missense_Mutation	SNP	G	G	A	rs929387	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr7:42005678G>A	ENST00000395925.3	-	15	3077	c.2993C>T	c.(2992-2994)cCg>cTg	p.P998L	GLI3_ENST00000479210.1_5'UTR	NM_000168.5	NP_000159.3	P10071	GLI3_HUMAN	GLI family zinc finger 3	998			P -> L (in dbSNP:rs929387). {ECO:0000269|PubMed:10441342, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:2118997}.		anterior semicircular canal development (GO:0060873)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye morphogenesis (GO:0048593)|cell differentiation involved in kidney development (GO:0061005)|cerebral cortex radial glia guided migration (GO:0021801)|developmental growth (GO:0048589)|embryonic digestive tract development (GO:0048566)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain radial glial cell differentiation (GO:0021861)|frontal suture morphogenesis (GO:0060364)|heart development (GO:0007507)|hindgut morphogenesis (GO:0007442)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|lambdoid suture morphogenesis (GO:0060366)|lateral ganglionic eminence cell proliferation (GO:0022018)|lateral semicircular canal development (GO:0060875)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|mammary gland specification (GO:0060594)|melanocyte differentiation (GO:0030318)|metanephros development (GO:0001656)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative thymic T cell selection (GO:0045060)|nose morphogenesis (GO:0043585)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte differentiation (GO:0048709)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein processing (GO:0016485)|proximal/distal pattern formation (GO:0009954)|response to estrogen (GO:0043627)|sagittal suture morphogenesis (GO:0060367)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)|T cell differentiation in thymus (GO:0033077)|thymocyte apoptotic process (GO:0070242)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|primary cilium (GO:0072372)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|biliary_tract(1)|breast(4)|central_nervous_system(2)|endometrium(12)|kidney(7)|large_intestine(25)|lung(49)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	112						GCCGTGGCCCGGCGCATCGTG	0.746									Pallister-Hall syndrome;Greig Cephalopolysyndactyly				G|||	2111	0.421526	0.1619	0.4424	5008	,	,		11700	0.7688		0.3161	False		,,,				2504	0.5082				p.P998L		.											.	GLI3-1149	0			c.C2993T						.	G	LEU/PRO	654,2960		69,516,1222	4.0	5.0	5.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	2993	3.8	0.2	7	dbSNP_86	5	2170,5232		331,1508,1862	no	missense	GLI3	NM_000168.5	98	400,2024,3084	AA,AG,GG		29.3164,18.0963,25.6354	benign	998/1581	42005678	2824,8192	1807	3701	5508	SO:0001583	missense	2737	exon15	Familial Cancer Database	;	TGGCCCGGCGCAT		CCDS5465.1	7p13	2013-01-25	2009-03-05		ENSG00000106571	ENSG00000106571		"""Zinc fingers, C2H2-type"""	4319	protein-coding gene	gene with protein product	"""zinc finger protein GLI3"", ""oncogene GLI3"", ""DNA-binding protein"""	165240	"""Greig cephalopolysyndactyly syndrome"", ""GLI-Kruppel family member GLI3"", ""glioma-associated oncogene family zinc finger 3"""	GCPS, PHS		2118997	Standard	NM_000168		Approved	PAP-A, PAPA, PAPA1, PAPB, ACLS, PPDIV	uc011kbh.2	P10071	OTTHUMG00000023630	ENST00000395925.3:c.2993C>T	7.37:g.42005678G>A	ENSP00000379258:p.Pro998Leu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	11	11	NM_000168	0	0	0	0	0	A4D1W1|O75219|Q17RW4|Q75MT0|Q75MU9|Q9UDT5|Q9UJ39	Missense_Mutation	SNP	ENST00000395925.3	37	CCDS5465.1	917	0.4198717948717949	75	0.1524390243902439	153	0.42265193370165743	451	0.7884615384615384	238	0.31398416886543534	G	1.729	-0.494582	0.04322	0.180963	0.293164	ENSG00000106571	ENST00000395925	T	0.15256	2.44	4.98	3.83	0.44106	.	0.327528	0.33217	N	0.005158	T	0.00012	0.0000	N	0.05554	-0.025	0.09310	P	0.9999999999224007	B	0.06786	0.001	B	0.04013	0.001	T	0.16247	-1.0409	9	0.17369	T	0.5	.	5.4162	0.16376	0.7624:0.0:0.0842:0.1533	rs929387;rs929387	998	P10071	GLI3_HUMAN	L	998	ENSP00000379258:P998L	ENSP00000379258:P998L	P	-	2	0	GLI3	41972203	1.000000	0.71417	0.171000	0.22900	0.021000	0.10359	4.758000	0.62220	0.733000	0.32492	-0.471000	0.05019	CCG	G|0.565;A|0.435		0.746	GLI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250806.3	NM_000168	
LAMB4	22798	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	107677982	107677982	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr7:107677982G>C	ENST00000388781.3	-	30	4613	c.4530C>G	c.(4528-4530)caC>caG	p.H1510Q	AC005048.1_ENST00000401266.1_RNA|LAMB4_ENST00000388780.3_Missense_Mutation_p.H1510Q|LAMB4_ENST00000483484.1_5'Flank|LAMB4_ENST00000205386.4_Missense_Mutation_p.H1510Q	NM_007356.2	NP_031382.2	A4D0S4	LAMB4_HUMAN	laminin, beta 4	1510	Domain I.		H -> Y (in dbSNP:rs1627354).		cell adhesion (GO:0007155)	basement membrane (GO:0005604)				NS(1)|breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(22)|lung(40)|ovary(4)|prostate(5)|skin(4)	97						GAATTGGTAGGTGAATGTCAA	0.398																																					p.H1510Q		.											.	LAMB4-140	0			c.C4530G						.						226.0	214.0	218.0					7																	107677982		2203	4300	6503	SO:0001583	missense	22798	exon30			TGGTAGGTGAATG	AF028816	CCDS34732.1	7q31	2013-03-01			ENSG00000091128	ENSG00000091128		"""Laminins"""	6491	protein-coding gene	gene with protein product							Standard	NM_007356		Approved		uc010ljo.1	A4D0S4	OTTHUMG00000154874	ENST00000388781.3:c.4530C>G	7.37:g.107677982G>C	ENSP00000373433:p.His1510Gln	Somatic	211	0		WXS	Illumina GAIIx	Phase_I	226	19	NM_007356	0	0	0	0	0	A5PKU6|B2RTT3|B5MEB9|Q86TP7|Q86XN2|Q8NBX5	Missense_Mutation	SNP	ENST00000388781.3	37	CCDS34732.1	.	.	.	.	.	.	.	.	.	.	G	2.239	-0.374248	0.05034	.	.	ENSG00000091128	ENST00000205386;ENST00000388781;ENST00000422975;ENST00000388780	T;T;T;T	0.28895	1.59;1.59;2.01;1.61	4.63	0.185	0.15096	.	0.264049	0.26654	N	0.023195	T	0.11879	0.0289	N	0.19112	0.55	0.19575	N	0.999969	B;P	0.40144	0.01;0.704	B;B	0.29663	0.01;0.105	T	0.26224	-1.0109	10	0.23302	T	0.38	.	5.5311	0.16985	0.2733:0.1408:0.5859:0.0	.	1510;1510	A4D0S4-3;A4D0S4	.;LAMB4_HUMAN	Q	1510;1510;536;1510	ENSP00000205386:H1510Q;ENSP00000373433:H1510Q;ENSP00000416562:H536Q;ENSP00000373432:H1510Q	ENSP00000205386:H1510Q	H	-	3	2	LAMB4	107465218	0.971000	0.33674	0.008000	0.14137	0.022000	0.10575	0.185000	0.16958	-0.064000	0.13043	-0.176000	0.13171	CAC	.		0.398	LAMB4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337442.1	XM_209857	
CLDN23	137075	hgsc.bcm.edu	37	8	8560536	8560536	+	Missense_Mutation	SNP	G	G	A	rs12548737	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr8:8560536G>A	ENST00000519106.1	+	1	1089	c.628G>A	c.(628-630)Gtg>Atg	p.V210M		NM_194284.2	NP_919260.2	Q96B33	CLD23_HUMAN	claudin 23	210			V -> M (in dbSNP:rs12548737).		calcium-independent cell-cell adhesion (GO:0016338)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			endometrium(2)	2		Hepatocellular(245;0.217)		COAD - Colon adenocarcinoma(149;0.071)|READ - Rectum adenocarcinoma(644;0.238)		CACCATCCAAGTGGAGTGGCC	0.731													G|||	569	0.113618	0.0083	0.1916	5008	,	,		12622	0.1488		0.0954	False		,,,				2504	0.183				p.V210M		.											.	.	0			c.G628A						.	G	MET/VAL	84,3832		0,84,1874	5.0	8.0	7.0		628	2.3	0.8	8	dbSNP_120	7	857,7211		50,757,3227	yes	missense	CLDN23	NM_194284.2	21	50,841,5101	AA,AG,GG		10.6222,2.145,7.8521	possibly-damaging	210/293	8560536	941,11043	1958	4034	5992	SO:0001583	missense	137075	exon1			ATCCAAGTGGAGT	AK123547	CCDS55195.1	8p23.1	2006-04-12				ENSG00000253958		"""Claudins"""	17591	protein-coding gene	gene with protein product		609203				12736707	Standard	NM_194284		Approved	CLDNL	uc003wsi.3	Q96B33		ENST00000519106.1:c.628G>A	8.37:g.8560536G>A	ENSP00000428780:p.Val210Met	Somatic	6	0		WXS	Illumina GAIIx	Phase_I	15	6	NM_194284	0	0	0	0	0	Q08AJ3	Missense_Mutation	SNP	ENST00000519106.1	37	CCDS55195.1	199	0.09111721611721611	8	0.016260162601626018	54	0.14917127071823205	69	0.12062937062937062	68	0.08970976253298153	G	12.41	1.930863	0.34096	0.02145	0.106222	ENSG00000253958	ENST00000519106	T	0.61859	0.07	4.12	2.31	0.28768	.	.	.	.	.	T	0.00300	0.0009	L	0.27053	0.805	0.40159	P	0.022958000000000034	P	0.48162	0.906	P	0.46585	0.521	T	0.03524	-1.1028	8	0.33940	T	0.23	.	8.182	0.31315	0.2087:0.0:0.7913:0.0	rs12548737	210	Q96B33	CLD23_HUMAN	M	210	ENSP00000428780:V210M	ENSP00000428780:V210M	V	+	1	0	CLDN23	8597946	0.949000	0.32298	0.846000	0.33378	0.051000	0.14879	3.623000	0.54224	1.090000	0.41315	0.407000	0.27541	GTG	G|0.907;A|0.093		0.731	CLDN23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374721.1	NM_194284	
CCAR2	57805	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	22475230	22475230	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr8:22475230C>T	ENST00000308511.4	+	16	2261	c.2012C>T	c.(2011-2013)tCg>tTg	p.S671L	CCAR2_ENST00000520861.1_Missense_Mutation_p.S346L|RP11-582J16.5_ENST00000521025.1_RNA|CCAR2_ENST00000389279.3_Missense_Mutation_p.S671L			Q8N163	CCAR2_HUMAN	cell cycle and apoptosis regulator 2	671					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mRNA processing (GO:0006397)|negative regulation of catalytic activity (GO:0043086)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage checkpoint (GO:2000003)|regulation of circadian rhythm (GO:0042752)|regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of protein stability (GO:0031647)|response to UV (GO:0009411)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|DBIRD complex (GO:0044609)|mitochondrial matrix (GO:0005759)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core binding (GO:0000993)										CTGGAGGATTCGGAGGTCCGG	0.537																																					p.S671L		.											.	KIAA1967-92	0			c.C2012T						.						187.0	183.0	184.0					8																	22475230		2203	4300	6503	SO:0001583	missense	57805	exon16			AGGATTCGGAGGT	AL834351	CCDS34863.1	8p22	2013-08-22	2013-08-22	2013-08-22		ENSG00000158941			23360	protein-coding gene	gene with protein product	"""deleted in breast cancer"""	607359	"""KIAA1967"""	KIAA1967		12370419	Standard	NM_021174		Approved	DBC-1, DBC1, NET35	uc003xci.3	Q8N163		ENST00000308511.4:c.2012C>T	8.37:g.22475230C>T	ENSP00000310670:p.Ser671Leu	Somatic	173	0		WXS	Illumina GAIIx	Phase_I	181	66	NM_021174	0	0	32	55	23	A6NL03|B2RB79|D3DSR6|Q6P0Q9|Q8N3G7|Q8N8M1|Q8TF34|Q9H9Q9|Q9HD12|Q9NT55	Missense_Mutation	SNP	ENST00000308511.4	37	CCDS34863.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.09|15.09	2.729438|2.729438	0.48833|0.48833	.|.	.|.	ENSG00000158941|ENSG00000158941	ENST00000520738|ENST00000308511;ENST00000389279;ENST00000520861	.|T;T;T	.|0.32023	.|1.47;1.47;1.48	5.86|5.86	5.86|5.86	0.93980|0.93980	.|.	.|0.345734	.|0.26546	.|N	.|0.023775	T|T	0.18002|0.18002	0.0432|0.0432	N|N	0.14661|0.14661	0.345|0.345	0.09310|0.09310	N|N	1|1	.|P;B	.|0.35700	.|0.516;0.091	.|B;B	.|0.28139	.|0.086;0.01	T|T	0.16100|0.16100	-1.0414|-1.0414	5|10	.|0.28530	.|T	.|0.3	-8.2705|-8.2705	15.6866|15.6866	0.77415|0.77415	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|346;671	.|G3V119;Q8N163	.|.;K1967_HUMAN	W|L	363|671;671;346	.|ENSP00000310670:S671L;ENSP00000373930:S671L;ENSP00000429773:S346L	.|ENSP00000310670:S671L	R|S	+|+	1|2	2|0	KIAA1967|KIAA1967	22531175|22531175	0.805000|0.805000	0.28982|0.28982	0.079000|0.079000	0.20413|0.20413	0.965000|0.965000	0.64279|0.64279	4.110000|4.110000	0.57831|0.57831	2.775000|2.775000	0.95449|0.95449	0.655000|0.655000	0.94253|0.94253	CGG|TCG	.		0.537	CCAR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375865.1	NM_021174	
STMN2	11075	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	80553660	80553660	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr8:80553660G>C	ENST00000220876.7	+	3	545	c.163G>C	c.(163-165)Gag>Cag	p.E55Q	STMN2_ENST00000518491.1_Missense_Mutation_p.E44Q|STMN2_ENST00000518111.1_Missense_Mutation_p.E55Q	NM_001199214.1|NM_007029.3	NP_001186143.1|NP_008960.2	Q93045	STMN2_HUMAN	stathmin 2	55	Regulatory/phosphorylation domain. {ECO:0000255}.|SLD. {ECO:0000255|PROSITE- ProRule:PRU00998}.				cellular response to nerve growth factor stimulus (GO:1990090)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of microtubule polymerization (GO:0031115)|negative regulation of neuron projection development (GO:0010977)|positive regulation of microtubule depolymerization (GO:0031117)|positive regulation of neuron projection development (GO:0010976)	cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|vesicle (GO:0031982)	calcium-dependent protein binding (GO:0048306)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	11	all_lung(9;8.34e-05)		Epithelial(68;0.0229)|all cancers(69;0.0874)			CCAGGCTTTTGAGCTGATCTT	0.448																																					p.E55Q		.											.	STMN2-515	0			c.G163C						.						90.0	87.0	88.0					8																	80553660		1950	4153	6103	SO:0001583	missense	11075	exon3			GCTTTTGAGCTGA		CCDS43748.1, CCDS56542.1	8q21.13	2014-04-01	2014-04-01	2001-07-13	ENSG00000104435	ENSG00000104435			10577	protein-coding gene	gene with protein product		600621	"""stathmin-like 2"""	SCGN10		8622778, 12140291	Standard	NM_007029		Approved	SCG10	uc022awk.1	Q93045	OTTHUMG00000164610	ENST00000220876.7:c.163G>C	8.37:g.80553660G>C	ENSP00000220876:p.Glu55Gln	Somatic	59	0		WXS	Illumina GAIIx	Phase_I	90	10	NM_007029	0	0	0	0	0	A8K9M2|G3V110|O14952|Q6PK68	Missense_Mutation	SNP	ENST00000220876.7	37	CCDS43748.1	.	.	.	.	.	.	.	.	.	.	G	29.6	5.022361	0.93462	.	.	ENSG00000104435	ENST00000220876;ENST00000414622;ENST00000518111;ENST00000518491	.	.	.	5.68	5.68	0.88126	.	0.090508	0.85682	D	0.000000	T	0.77711	0.4171	M	0.81497	2.545	0.80722	D	1	P;P	0.52061	0.901;0.95	P;P	0.55011	0.766;0.649	T	0.79761	-0.1667	9	0.62326	D	0.03	-6.7579	19.7823	0.96420	0.0:0.0:1.0:0.0	.	55;55	B7Z4K3;Q93045	.;STMN2_HUMAN	Q	55;55;55;44	.	ENSP00000220876:E55Q	E	+	1	0	STMN2	80716215	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.869000	0.99810	2.666000	0.90696	0.467000	0.42956	GAG	.		0.448	STMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379261.2	NM_007029	
E2F5	1875	hgsc.bcm.edu	37	8	86089787	86089787	+	Silent	SNP	C	C	G	rs12926	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr8:86089787C>G	ENST00000416274.2	+	1	166	c.132C>G	c.(130-132)gcC>gcG	p.A44A	RP11-219B4.3_ENST00000520129.1_RNA|E2F5_ENST00000256117.5_Silent_p.A44A|E2F5_ENST00000418930.2_Silent_p.A44A|RP11-219B4.7_ENST00000562577.1_RNA|RP11-219B4.7_ENST00000566000.1_RNA	NM_001083588.1|NM_001951.3	NP_001077057.1|NP_001942.2	Q15329	E2F5_HUMAN	E2F transcription factor 5, p130-binding	44					gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			NS(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)	8						TCGGGGGCGCCGGGGGCGGCA	0.751													C|||	2815	0.562101	0.5545	0.549	5008	,	,		6370	0.4157		0.6928	False		,,,				2504	0.5982				p.A44A		.											.	E2F5-415	0			c.C132G						.	C	,	2392,1558		800,792,383	4.0	5.0	5.0		132,132	0.9	0.1	8	dbSNP_52	5	5668,2428		2076,1516,456	no	coding-synonymous,coding-synonymous	E2F5	NM_001083588.1,NM_001951.3	,	2876,2308,839	GG,GC,CC		29.9901,39.443,33.0898	,	44/346,44/347	86089787	8060,3986	1975	4048	6023	SO:0001819	synonymous_variant	1875	exon1			GGGCGCCGGGGGC	X86097	CCDS47885.1, CCDS47886.1, CCDS55254.1	8q21.2	2004-01-29			ENSG00000133740	ENSG00000133740			3119	protein-coding gene	gene with protein product		600967				7892279	Standard	NM_001083588		Approved		uc003ycz.4	Q15329	OTTHUMG00000164785	ENST00000416274.2:c.132C>G	8.37:g.86089787C>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_001083588	0	0	0	0	0	E9PBN9|Q16601|Q92756	Silent	SNP	ENST00000416274.2	37	CCDS47885.1																																																																																			C|0.434;G|0.566		0.751	E2F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000380274.1	NM_001951	
TMEM74	157753	broad.mit.edu;bcgsc.ca	37	8	109796433	109796433	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr8:109796433C>G	ENST00000297459.3	-	2	1073	c.895G>C	c.(895-897)Gat>Cat	p.D299H	TMEM74_ENST00000518838.1_Intron	NM_153015.1	NP_694560.1	Q96NL1	TMM74_HUMAN	transmembrane protein 74	299					autophagy (GO:0006914)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)				breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(3)|skin(2)|urinary_tract(1)	29			OV - Ovarian serous cystadenocarcinoma(57;3.08e-10)			GCAAGCGCATCTTCCTCTACC	0.373																																					p.D299H		.											.	TMEM74-228	0			c.G895C						.						74.0	74.0	74.0					8																	109796433		2203	4300	6503	SO:0001583	missense	157753	exon2			GCGCATCTTCCTC	AK055230	CCDS6310.1	8q23.1	2009-11-06				ENSG00000164841			26409	protein-coding gene	gene with protein product		613935				12477932	Standard	NM_153015		Approved	FLJ30668, NET36	uc003ymy.1	Q96NL1		ENST00000297459.3:c.895G>C	8.37:g.109796433C>G	ENSP00000297459:p.Asp299His	Somatic	176	0		WXS	Illumina GAIIx	Phase_I	178	7	NM_153015	0	0	0	0	0		Missense_Mutation	SNP	ENST00000297459.3	37	CCDS6310.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.063867	0.76187	.	.	ENSG00000164841	ENST00000297459	.	.	.	5.96	5.96	0.96718	.	0.253704	0.39834	N	0.001249	T	0.78259	0.4255	L	0.56769	1.78	0.58432	D	0.999997	D	0.89917	1.0	D	0.81914	0.995	T	0.78198	-0.2297	9	0.87932	D	0	-21.5706	20.4008	0.98991	0.0:1.0:0.0:0.0	.	299	Q96NL1	TMM74_HUMAN	H	299	.	ENSP00000297459:D299H	D	-	1	0	TMEM74	109865609	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	4.378000	0.59568	2.826000	0.97356	0.655000	0.94253	GAT	.		0.373	TMEM74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380755.1	NM_153015	
GLI4	2738	hgsc.bcm.edu	37	8	144358302	144358302	+	Silent	SNP	C	C	T	rs1056146	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr8:144358302C>T	ENST00000523522.1	+	3	498	c.459C>T	c.(457-459)gcC>gcT	p.A153A	GLI4_ENST00000340042.1_Silent_p.A153A|ZFP41_ENST00000522452.1_3'UTR|GLI4_ENST00000523812.1_3'UTR			P10075	GLI4_HUMAN	GLI family zinc finger 4	153					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|large_intestine(1)|lung(5)	9	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)			AAGCAGCGGCCGGGCCCGAGG	0.791													C|||	1441	0.28774	0.5038	0.1888	5008	,	,		8805	0.1161		0.3072	False		,,,				2504	0.2229				p.A153A		.											.	GLI4-91	0			c.C459T						.	C		490,1334		38,414,460	1.0	2.0	1.0		459	-6.5	0.0	8	dbSNP_86	1	773,3947		46,681,1633	no	coding-synonymous	GLI4	NM_138465.3		84,1095,2093	TT,TC,CC		16.3771,26.864,19.3001		153/377	144358302	1263,5281	912	2360	3272	SO:0001819	synonymous_variant	2738	exon4			AGCGGCCGGGCCC		CCDS6398.1	8q24.3	2013-01-08	2009-03-05		ENSG00000250571	ENSG00000250571		"""Zinc fingers, C2H2-type"""	4320	protein-coding gene	gene with protein product		165280	"""GLI-Kruppel family member GLI4"", ""glioma-associated oncogene family zinc finger 4"""			2850480	Standard	NM_138465		Approved	HKR4, ZNF928	uc003yxx.3	P10075	OTTHUMG00000164952	ENST00000523522.1:c.459C>T	8.37:g.144358302C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	15	7	NM_138465	0	0	0	1	1	Q96CK9	Silent	SNP	ENST00000523522.1	37	CCDS6398.1																																																																																			C|0.723;T|0.277		0.791	GLI4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381128.2		
SCRIB	23513	hgsc.bcm.edu	37	8	144874477	144874477	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr8:144874477G>A	ENST00000320476.3	-	32	4433	c.4427C>T	c.(4426-4428)cCg>cTg	p.P1476L	RP11-429J17.8_ENST00000527139.1_RNA|SCRIB_ENST00000377533.3_Missense_Mutation_p.P1395L|SCRIB_ENST00000546337.1_5'Flank|RP11-429J17.8_ENST00000534089.1_RNA|SCRIB_ENST00000356994.2_Missense_Mutation_p.P1476L|RP11-429J17.8_ENST00000532625.1_RNA	NM_015356.4	NP_056171	Q14160	SCRIB_HUMAN	scribbled planar cell polarity protein	1476					activation of Rac GTPase activity (GO:0032863)|apoptotic process involved in morphogenesis (GO:0060561)|astrocyte cell migration (GO:0043615)|asymmetric protein localization (GO:0008105)|auditory receptor cell stereocilium organization (GO:0060088)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cochlear nucleus development (GO:0021747)|establishment of apical/basal cell polarity (GO:0035089)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of mitotic cell cycle (GO:0045930)|neural tube closure (GO:0001843)|positive chemotaxis (GO:0050918)|positive regulation of apoptotic process (GO:0043065)|positive regulation of receptor recycling (GO:0001921)|protein localization to adherens junction (GO:0071896)|single organismal cell-cell adhesion (GO:0016337)|synaptic vesicle endocytosis (GO:0048488)|synaptic vesicle targeting (GO:0016080)|viral process (GO:0016032)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cell projection (GO:0042995)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)|Scrib-APC-beta-catenin complex (GO:0034750)				NS(1)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(3)|lung(20)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	42	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;1.12e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			CGGTGGCTCCGGACTCTGCAC	0.756																																					p.P1476L	Pancreas(51;966 1133 10533 14576 29674)	.											.	SCRIB-228	0			c.C4427T						.						3.0	4.0	4.0					8																	144874477		1845	3733	5578	SO:0001583	missense	23513	exon32			GGCTCCGGACTCT	AY062238	CCDS6411.1, CCDS6412.1	8q24.3	2013-03-05	2013-03-05		ENSG00000180900	ENSG00000180900			30377	protein-coding gene	gene with protein product		607733	"""scribbled homolog (Drosophila)"""			11027293, 14681682	Standard	NM_182706		Approved	KIAA0147, SCRB1, Vartul	uc003yzo.1	Q14160	OTTHUMG00000165154	ENST00000320476.3:c.4427C>T	8.37:g.144874477G>A	ENSP00000322938:p.Pro1476Leu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	16	6	NM_015356	0	0	18	32	14	Q6P496|Q7Z5D1|Q8WWV8|Q96C69|Q96GG1	Missense_Mutation	SNP	ENST00000320476.3	37	CCDS6411.1	.	.	.	.	.	.	.	.	.	.	G	10.90	1.480577	0.26598	.	.	ENSG00000180900	ENST00000356994;ENST00000320476;ENST00000377533	T;T;T	0.36520	1.48;1.42;1.25	4.67	3.78	0.43462	.	.	.	.	.	T	0.53981	0.1830	L	0.56769	1.78	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.999	T	0.52682	-0.8543	9	0.46703	T	0.11	.	12.7913	0.57534	0.0:0.0:0.8347:0.1653	.	1476;1476;1395	Q14160;Q14160-3;Q14160-2	SCRIB_HUMAN;.;.	L	1476;1476;1395	ENSP00000349486:P1476L;ENSP00000322938:P1476L;ENSP00000366756:P1395L	ENSP00000322938:P1476L	P	-	2	0	SCRIB	144946465	1.000000	0.71417	0.879000	0.34478	0.050000	0.14768	8.947000	0.93000	0.943000	0.37553	0.556000	0.70494	CCG	.		0.756	SCRIB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000382215.1	NM_015356	
PLEC	5339	hgsc.bcm.edu	37	8	144998169	144998169	+	Silent	SNP	C	C	T	rs1140522	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr8:144998169C>T	ENST00000322810.4	-	31	6508	c.6339G>A	c.(6337-6339)gcG>gcA	p.A2113A	PLEC_ENST00000354958.2_Silent_p.A1954A|PLEC_ENST00000356346.3_Silent_p.A1962A|PLEC_ENST00000398774.2_Silent_p.A1944A|PLEC_ENST00000345136.3_Silent_p.A1976A|PLEC_ENST00000527096.1_Silent_p.A1999A|PLEC_ENST00000436759.2_Silent_p.A2003A|PLEC_ENST00000357649.2_Silent_p.A1980A|PLEC_ENST00000354589.3_Silent_p.A1976A	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	2113	Central fibrous rod domain.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CCTCCTCCGCCGCCAGCTGCC	0.741													C|||	1156	0.230831	0.028	0.2968	5008	,	,		12421	0.1429		0.4274	False		,,,				2504	0.3466				p.A2113A		.											.	PLEC-141	0			c.G6339A						.	C	,,,,,,,	297,3657		19,259,1699	5.0	7.0	6.0		6009,5886,5862,6339,5832,5928,5940,5928	-8.9	0.0	8	dbSNP_86	6	2901,4993		551,1799,1597	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	,,,,,,,	570,2058,3296	TT,TC,CC		36.7494,7.5114,26.9919	,,,,,,,	2003/4575,1962/4534,1954/4526,2113/4685,1944/4516,1976/4548,1980/4552,1976/4548	144998169	3198,8650	1977	3947	5924	SO:0001819	synonymous_variant	5339	exon31			CTCCGCCGCCAGC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.6339G>A	8.37:g.144998169C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	22	22	NM_201380	0	0	0	6	6	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																			C|0.740;T|0.260		0.741	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
PLEC	5339	hgsc.bcm.edu	37	8	145001588	145001588	+	Missense_Mutation	SNP	C	C	T	rs11136334	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr8:145001588C>T	ENST00000322810.4	-	27	4326	c.4157G>A	c.(4156-4158)cGg>cAg	p.R1386Q	PLEC_ENST00000354958.2_Missense_Mutation_p.R1227Q|PLEC_ENST00000356346.3_Missense_Mutation_p.R1235Q|PLEC_ENST00000398774.2_Missense_Mutation_p.R1217Q|PLEC_ENST00000345136.3_Missense_Mutation_p.R1249Q|PLEC_ENST00000527096.1_Missense_Mutation_p.R1272Q|PLEC_ENST00000436759.2_Missense_Mutation_p.R1276Q|PLEC_ENST00000357649.2_Missense_Mutation_p.R1253Q|PLEC_ENST00000354589.3_Missense_Mutation_p.R1249Q	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	1386	Globular 1.		R -> Q (in dbSNP:rs11136334).		apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CTGCTCCTGCCGCAGCTGCTC	0.736													C|||	1156	0.230831	0.028	0.2954	5008	,	,		13418	0.1429		0.4274	False		,,,				2504	0.3476				p.R1386Q		.											.	PLEC-141	0			c.G4157A						.	C	GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG	388,3674		38,312,1681	12.0	16.0	15.0		3746,3758,3746,3650,4157,3680,3704,3827	-0.7	1.0	8	dbSNP_120	15	3413,4885		747,1919,1483	no	missense,missense,missense,missense,missense,missense,missense,missense	PLEC	NM_201384.1,NM_201383.1,NM_201382.2,NM_201381.1,NM_201380.2,NM_201379.1,NM_201378.2,NM_000445.3	43,43,43,43,43,43,43,43	785,2231,3164	TT,TC,CC		41.1304,9.5519,30.7524	benign,benign,benign,benign,benign,benign,benign,benign	1249/4548,1253/4552,1249/4548,1217/4516,1386/4685,1227/4526,1235/4534,1276/4575	145001588	3801,8559	2031	4149	6180	SO:0001583	missense	5339	exon27			TCCTGCCGCAGCT	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.4157G>A	8.37:g.145001588C>T	ENSP00000323856:p.Arg1386Gln	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	33	33	NM_201380	0	0	0	0	0	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Missense_Mutation	SNP	ENST00000322810.4	37	CCDS43772.1	536	0.2454212454212454	15	0.03048780487804878	108	0.2983425414364641	94	0.16433566433566432	319	0.420844327176781	C	12.61	1.989397	0.35131	0.095519	0.411304	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096	T;T;T;T;T;T;T;T;T	0.34072	1.38;1.38;1.38;1.38;1.38;1.38;1.38;1.38;1.38	5.1	-0.662	0.11413	.	1.260670	0.05768	N	0.606168	T	0.00012	0.0000	N	0.02011	-0.69	0.41093	P	0.014382000000000006	B;B;B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B;B;B	0.01281	0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0	T	0.44605	-0.9317	9	0.19590	T	0.45	.	4.6892	0.12772	0.2556:0.2308:0.0:0.5136	rs11136334	1276;1235;1227;1386;1217;1249;1253;1249	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4	.;.;.;PLEC_HUMAN;.;.;.;.	Q	1249;1253;1249;1217;1386;1227;1235;1276;1272	ENSP00000344848:R1249Q;ENSP00000350277:R1253Q;ENSP00000346602:R1249Q;ENSP00000381756:R1217Q;ENSP00000323856:R1386Q;ENSP00000347044:R1227Q;ENSP00000348702:R1235Q;ENSP00000388180:R1276Q;ENSP00000434583:R1272Q	ENSP00000323856:R1386Q	R	-	2	0	PLEC	145073576	0.001000	0.12720	0.979000	0.43373	0.833000	0.47200	0.002000	0.13061	-0.040000	0.13580	-0.369000	0.07265	CGG	C|0.707;T|0.293		0.736	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
BNC2	54796	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	16418993	16418993	+	Silent	SNP	T	T	A			TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr9:16418993T>A	ENST00000380672.4	-	7	3351	c.3294A>T	c.(3292-3294)gtA>gtT	p.V1098V	BNC2_ENST00000545497.1_Silent_p.V1003V|BNC2_ENST00000380667.2_Silent_p.V1031V	NM_017637.5	NP_060107.3			basonuclin 2											NS(2)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(16)|liver(1)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(50;9.01e-08)		GAGACTAATCTACTGAAGTGA	0.463																																					p.V1098V		.											.	BNC2-92	0			c.A3294T						.						124.0	120.0	121.0					9																	16418993		2203	4300	6503	SO:0001819	synonymous_variant	54796	exon7			CTAATCTACTGAA	AK092247	CCDS6482.2	9p22.2	2013-05-20			ENSG00000173068	ENSG00000173068		"""Zinc fingers, C2H2-type"""	30988	protein-coding gene	gene with protein product		608669				14702039	Standard	XM_006716784		Approved	BSN2, FLJ20043	uc003zml.3	Q6ZN30	OTTHUMG00000019593	ENST00000380672.4:c.3294A>T	9.37:g.16418993T>A		Somatic	174	0		WXS	Illumina GAIIx	Phase_I	115	72	NM_017637	0	0	0	0	0		Silent	SNP	ENST00000380672.4	37	CCDS6482.2																																																																																			.		0.463	BNC2-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216901.5	NM_017637	
KIAA0368	23392	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	114128569	114128569	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr9:114128569G>T	ENST00000338205.5	-	47	5477	c.5258C>A	c.(5257-5259)gCt>gAt	p.A1753D	KIAA0368_ENST00000259335.4_Missense_Mutation_p.A1931D|KIAA0368_ENST00000465499.1_5'UTR|KIAA0368_ENST00000374378.3_Intron			Q5VYK3	ECM29_HUMAN	KIAA0368	1759					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	centrosome (GO:0005813)|cytoplasmic membrane-bounded vesicle (GO:0016023)|early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle (GO:0030134)|late endosome (GO:0005770)|membrane (GO:0016020)|multivesicular body (GO:0005771)|nucleus (GO:0005634)|proteasome complex (GO:0000502)				NS(2)|breast(3)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(23)|prostate(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	65						TTCAGCCAAAGCCTCAGGATC	0.343																																					p.A1931D		.											.	KIAA0368-68	0			c.C5792A						.						69.0	62.0	64.0					9																	114128569		1845	4081	5926	SO:0001583	missense	23392	exon49			GCCAAAGCCTCAG	AK025689	CCDS48006.1	9q32	2012-11-29	2006-11-23	2006-11-23	ENSG00000136813	ENSG00000136813			29020	protein-coding gene	gene with protein product	"""ECM29 homolog (S. cerevisiae)"""					9205841, 15496406, 20682791	Standard	NM_001080398		Approved	FLJ22036, ECM29	uc004bfe.1	Q5VYK3	OTTHUMG00000020489	ENST00000338205.5:c.5258C>A	9.37:g.114128569G>T	ENSP00000339889:p.Ala1753Asp	Somatic	136	0		WXS	Illumina GAIIx	Phase_I	105	60	NM_001080398	0	0	20	70	50	O15074|Q8WU82	Missense_Mutation	SNP	ENST00000338205.5	37		.	.	.	.	.	.	.	.	.	.	G	17.20	3.328874	0.60743	.	.	ENSG00000136813	ENST00000338205;ENST00000259335;ENST00000543827	T	0.66815	-0.23	5.22	4.31	0.51392	.	0.157706	0.56097	D	0.000030	T	0.56307	0.1976	L	0.50333	1.59	0.80722	D	1	B	0.28128	0.201	B	0.18263	0.021	T	0.53070	-0.8490	10	0.19147	T	0.46	-8.343	13.1726	0.59606	0.0766:0.0:0.9234:0.0	.	1228	B3KXF2	.	D	1753;1931;1228	ENSP00000259335:A1931D	ENSP00000259335:A1931D	A	-	2	0	KIAA0368	113168390	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.954000	0.63631	2.426000	0.82243	0.655000	0.94253	GCT	.		0.343	KIAA0368-001	NOVEL	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000053637.2	NM_014686	
WDR34	89891	hgsc.bcm.edu	37	9	131418828	131418828	+	Missense_Mutation	SNP	A	A	C	rs4837292		TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr9:131418828A>C	ENST00000372715.2	-	1	238	c.178T>G	c.(178-180)Tgg>Ggg	p.W60G		NM_052844.3	NP_443076.2	Q96EX3	WDR34_HUMAN	WD repeat domain 34	60				W -> G (in Ref. 2; AAH11874/AAH01614). {ECO:0000305}.		axoneme (GO:0005930)|centriole (GO:0005814)|ciliary basal body (GO:0036064)				central_nervous_system(2)|lung(5)|skin(1)|urinary_tract(1)	9						ACCGTCTCCCAGCGGATGCCC	0.806																																					p.W60G		.											.	WDR34-92	0			c.T178G						.	C	GLY/TRP	1803,9		897,9,0	1.0	1.0	1.0		178	2.1	1.0	9	dbSNP_111	1	3858,0		1929,0,0	no	missense	WDR34	NM_052844.3	184	2826,9,0	CC,CA,AA		0.0,0.4967,0.1587	benign	60/537	131418828	5661,9	906	1929	2835	SO:0001583	missense	89891	exon1			TCTCCCAGCGGAT	BC011874	CCDS6906.2	9q34.11	2013-11-15	2013-02-19	2013-02-19	ENSG00000119333	ENSG00000119333		"""WD repeat domain containing"""	28296	protein-coding gene	gene with protein product		613363				19521662, 21953912, 24183451	Standard	NM_052844		Approved	DIC5, MGC20486, bA216B9.3, FAP133	uc004bvq.1	Q96EX3	OTTHUMG00000020750	ENST00000372715.2:c.178T>G	9.37:g.131418828A>C	ENSP00000361800:p.Trp60Gly	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_052844	0	0	0	0	0	Q5VXV4|Q9BV46	Missense_Mutation	SNP	ENST00000372715.2	37	CCDS6906.2	2170	0.9935897435897436	486	0.9878048780487805	362	1.0	571	0.9982517482517482	751	0.9907651715039578	C	7.343	0.621247	0.14193	0.995033	1.0	ENSG00000119333	ENST00000372715;ENST00000451652;ENST00000419989	T;T;T	0.74106	-0.81;-0.81;-0.81	4.02	2.12	0.27331	.	0.538297	0.18788	N	0.131154	T	0.00012	0.0000	N	0.00538	-1.39	0.58432	P	1.999999999946489E-6	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.34625	-0.9821	9	0.08381	T	0.77	-3.0135	7.4804	0.27402	0.1755:0.4462:0.3784:0.0	rs4837292;rs56752541	45;60	A2A3F8;Q96EX3	.;WDR34_HUMAN	G	60;51;45	ENSP00000361800:W60G;ENSP00000411370:W51G;ENSP00000415421:W45G	ENSP00000361800:W60G	W	-	1	0	WDR34	130458649	1.000000	0.71417	0.994000	0.49952	0.970000	0.65996	0.709000	0.25734	0.259000	0.21709	-0.126000	0.14955	TGG	A|0.006;C|0.994		0.806	WDR34-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054463.1	NM_052844	
SUPT20HL1	100130302	bcgsc.ca;mdanderson.org	37	X	24382453	24382453	+	IGR	SNP	G	G	C	rs112697166		TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chrX:24382453G>C								AC004552.1 (15430 upstream) : PDK3 (100884 downstream)																							agctgctgctgctgctcctgc	0.627																																					p.A526P		.											.	.	0			c.G1576C						.						2.0	2.0	2.0					X																	24382453		966	2386	3352	SO:0001628	intergenic_variant	100130302	exon1			GCTGCTGCTGCTC																													X.37:g.24382453G>C		Somatic	111	1		WXS	Illumina GAIIx	Phase_I	119	49	NM_001136234	0	0	0	0	0		Missense_Mutation	SNP		37																																																																																				G|0.500;C|0.500	0	0.627								
DCAF8L2	347442	hgsc.bcm.edu	37	X	27765408	27765408	+	Silent	SNP	G	G	A			TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chrX:27765408G>A	ENST00000451261.2	+	5	795	c.396G>A	c.(394-396)gaG>gaA	p.E132E		NM_001136533.1	NP_001130005.1	P0C7V8	DC8L2_HUMAN	DDB1 and CUL4 associated factor 8-like 2	132	Glu-rich.									central_nervous_system(1)|endometrium(9)|kidney(3)|lung(7)|pancreas(1)|skin(3)	24						aagaggaggaggaggaggagg	0.567																																					p.E132E		.											.	DCAF8L2-42	0			c.G396A						.						18.0	16.0	16.0					X																	27765408		692	1587	2279	SO:0001819	synonymous_variant	347442	exon1			GGAGGAGGAGGAG		CCDS59162.1	Xp22.11	2013-01-09	2009-07-17	2009-07-17		ENSG00000189186		"""WD repeat domain containing"""	31811	protein-coding gene	gene with protein product			"""WD repeat domain 42C"""	WDR42C			Standard	NM_001136533		Approved		uc011mjy.2	P0C7V8		ENST00000451261.2:c.396G>A	X.37:g.27765408G>A		Somatic	24	0		WXS	Illumina GAIIx	Phase_I	22	4	NM_001136533	0	0	1	1	0	B2RXH9|J3KT06	Silent	SNP	ENST00000451261.2	37	CCDS59162.1																																																																																			.		0.567	DCAF8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056143.4	XM_293354	
FAM155B	27112	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	68725226	68725226	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chrX:68725226G>C	ENST00000252338.4	+	1	143	c.101G>C	c.(100-102)tGc>tCc	p.C34S	AL158069.1_ENST00000579664.1_RNA	NM_015686.2	NP_056501.2	O75949	F155B_HUMAN	family with sequence similarity 155, member B	34						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(2)|endometrium(4)|large_intestine(2)|lung(4)|ovary(2)|pancreas(1)	16						GACAAACCTTGCGCCGACTCC	0.682																																					p.C34S		.											.	FAM155B-131	0			c.G101C						.						10.0	6.0	7.0					X																	68725226		1891	3622	5513	SO:0001583	missense	27112	exon1			AACCTTGCGCCGA	AF087142	CCDS35317.1	Xq13.1	2008-04-15	2008-04-15	2008-04-15	ENSG00000130054	ENSG00000130054			30701	protein-coding gene	gene with protein product			"""transmembrane protein 28"", ""chromosome X open reading frame 63"""	TMEM28, CXorf63			Standard	NM_015686		Approved	TED	uc004dxk.3	O75949	OTTHUMG00000021756	ENST00000252338.4:c.101G>C	X.37:g.68725226G>C	ENSP00000252338:p.Cys34Ser	Somatic	30	0		WXS	Illumina GAIIx	Phase_I	55	44	NM_015686	0	0	0	0	0	B1ALV6|B9EGK1|D3DVU1	Missense_Mutation	SNP	ENST00000252338.4	37	CCDS35317.1	.	.	.	.	.	.	.	.	.	.	G	13.40	2.225739	0.39300	.	.	ENSG00000130054	ENST00000252338	T	0.42900	0.96	4.2	3.3	0.37823	.	0.107354	0.37219	U	0.002186	T	0.27933	0.0688	N	0.19112	0.55	0.37860	D	0.929706	B	0.18013	0.025	B	0.14023	0.01	T	0.11966	-1.0566	10	0.66056	D	0.02	-6.8838	10.8117	0.46551	0.0:0.1899:0.8101:0.0	.	34	O75949-2	.	S	34	ENSP00000252338:C34S	ENSP00000252338:C34S	C	+	2	0	FAM155B	68641951	0.983000	0.35010	1.000000	0.80357	0.946000	0.59487	0.464000	0.21988	0.577000	0.29470	0.274000	0.19336	TGC	.		0.682	FAM155B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057037.1	NM_015686	
SOWAHD	347454	hgsc.bcm.edu	37	X	118892888	118892888	+	Silent	SNP	G	G	C	rs2782222	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chrX:118892888G>C	ENST00000343905.3	+	1	313	c.258G>C	c.(256-258)gcG>gcC	p.A86A		NM_001105576.2	NP_001099046.1	A6NJG2	SWAHD_HUMAN	sosondowah ankyrin repeat domain family member D	86																	CGGCTCCTGCGGGGTGGCTGT	0.751													c|||	2295	0.607947	0.4735	0.4841	3775	,	,		7549	0.372		0.495	False		,,,				2504	0.4703				p.A86A		.											.	.	0			c.G258C						.			1145,466		378,253,136,67,79	1.0	2.0	2.0		258	2.3	0.0	X	dbSNP_100	2	2545,1233		737,547,524,198,290	no	coding-synonymous	ANKRD58	NM_001105576.2		1115,800,660,265,369	CC,CG,C,GG,G		32.6363,28.9261,31.5272		86/316	118892888	3690,1699	913	2296	3209	SO:0001819	synonymous_variant	347454	exon1			TCCTGCGGGGTGG		CCDS43984.1	Xq24	2013-01-10	2012-01-12	2012-01-12	ENSG00000187808	ENSG00000187808		"""Ankyrin repeat domain containing"""	32960	protein-coding gene	gene with protein product			"""ankyrin repeat domain 58"""	ANKRD58		22234889	Standard	NM_001105576		Approved		uc010nql.3	A6NJG2	OTTHUMG00000159606	ENST00000343905.3:c.258G>C	X.37:g.118892888G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_001105576	0	0	0	1	1		Silent	SNP	ENST00000343905.3	37	CCDS43984.1																																																																																			G|0.401;C|0.599		0.751	SOWAHD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356469.1	NM_001105576	
UTP14A	10813	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	129059084	129059084	+	Silent	SNP	G	G	A			TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chrX:129059084G>A	ENST00000394422.3	+	12	1690	c.1662G>A	c.(1660-1662)aaG>aaA	p.K554K	UTP14A_ENST00000425117.2_Silent_p.K502K|UTP14A_ENST00000371042.3_Silent_p.K386K|UTP14A_ENST00000371051.5_Silent_p.K500K|RP4-537K23.4_ENST00000432062.1_RNA	NM_006649.3	NP_006640.2	Q9BVJ6	UT14A_HUMAN	UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast)	554					rRNA processing (GO:0006364)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(2)|lung(16)|ovary(3)|urinary_tract(1)	32						AGAAGAAAAAGAAGGAGCAAA	0.488																																					p.K554K		.											.	UTP14A-132	0			c.G1662A						.						115.0	105.0	108.0					X																	129059084		2203	4300	6503	SO:0001819	synonymous_variant	10813	exon12			GAAAAAGAAGGAG	AF039694	CCDS14615.1, CCDS55489.1	Xq26.1	2009-01-15	2004-06-01	2004-06-01	ENSG00000156697	ENSG00000156697			10665	protein-coding gene	gene with protein product		300508	"""serologically defined colon cancer antigen 16"""	SDCCAG16		9610721, 16354793	Standard	NM_006649		Approved	NY-CO-16	uc004euz.3	Q9BVJ6	OTTHUMG00000022378	ENST00000394422.3:c.1662G>A	X.37:g.129059084G>A		Somatic	63	0		WXS	Illumina GAIIx	Phase_I	70	5	NM_006649	0	0	12	12	0	A8K7A3|A8MVQ1|B4DQ08|E9PEL7|Q5JYF1	Silent	SNP	ENST00000394422.3	37	CCDS14615.1																																																																																			.		0.488	UTP14A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058221.1	NM_006649	
KIAA1211	57482	broad.mit.edu	37	4	57180576	57180577	+	In_Frame_Ins	INS	-	-	GGAGCGGAGGGAGCGGAG	rs71921617|rs138358443|rs11276076	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr4:57180576_57180577insGGAGCGGAGGGAGCGGAG	ENST00000504228.1	+	6	1013_1014	c.908_909insGGAGCGGAGGGAGCGGAG	c.(907-912)gcggag>gcGGAGCGGAGGGAGCGGAGggag	p.304_305insRRERRE	KIAA1211_ENST00000264229.6_In_Frame_Ins_p.304_305insRRERRE|KIAA1211_ENST00000541073.1_In_Frame_Ins_p.297_298insRRERRE			Q6ZU35	K1211_HUMAN	KIAA1211	304	Glu-rich.									endometrium(7)|large_intestine(10)|lung(39)|ovary(2)|prostate(3)|skin(3)|stomach(1)	65	Glioma(25;0.08)|all_neural(26;0.101)					TGGGAGGACGCGGAGCGGAGGG	0.733														1350	0.269569	0.2716	0.2781	5008	,	,		14300	0.0694		0.4076	False		,,,				2504	0.3252				p.A303delinsAERRERR		.											.	KIAA1211-70	0			c.908_909insGGAGCGGAGGGAGCGGAG						.			903,2311		258,387,962						-10.2	0.0		dbSNP_130	6	2065,4451		612,841,1805	no	coding	KIAA1211	NM_020722.1		870,1228,2767	A1A1,A1R,RR		31.6912,28.0958,30.5036				2968,6762				SO:0001652	inframe_insertion	57482	exon8			AGGACGCGGAGCG	AB033037	CCDS43230.1	4q12	2012-08-03			ENSG00000109265	ENSG00000109265			29219	protein-coding gene	gene with protein product						10574462, 11230166	Standard	NM_020722		Approved		uc003hbk.2	Q6ZU35	OTTHUMG00000160749	Exception_encountered	4.37:g.57180576_57180577insGGAGCGGAGGGAGCGGAG	ENSP00000423366:p.Glu304_Arg305insArgArgGluArgArgGlu	Somatic	26	0		WXS	Illumina GAIIx	Phase_I	51	28	NM_020722	0	0	0	0	0	Q9NTE2|Q9NTP8|Q9ULK9	In_Frame_Ins	INS	ENST00000504228.1	37	CCDS43230.1																																																																																			.		0.733	KIAA1211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362097.2	NM_020722	
PODXL	5420	hgsc.bcm.edu	37	7	131241029	131241030	+	In_Frame_Ins	INS	-	-	GGCGAC	rs11277659|rs547816245|rs532078953|rs79759078|rs571821675	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr7:131241029_131241030insGGCGAC	ENST00000378555.3	-	1	336_337	c.89_90insGTCGCC	c.(88-90)ccc>ccGTCGCCc	p.30_30P>PSP	PODXL_ENST00000541194.1_In_Frame_Ins_p.30_30P>PSP|PODXL_ENST00000537928.1_In_Frame_Ins_p.30_30P>PSP|PODXL_ENST00000322985.9_In_Frame_Ins_p.30_30P>PSP|PODXL_ENST00000465001.1_Intron			O00592	PODXL_HUMAN	podocalyxin-like	30					cell adhesion (GO:0007155)|cell migration (GO:0016477)|epithelial tube formation (GO:0072175)|glomerular visceral epithelial cell development (GO:0072015)|leukocyte migration (GO:0050900)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-cell adhesion (GO:0022408)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|regulation of microvillus assembly (GO:0032534)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|slit diaphragm (GO:0036057)		p.P30_S31delPS(2)		NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24	Melanoma(18;0.162)					CATTCTGGGAGggcgacggcga	0.752																																					p.P30delinsPSP		.											.	PODXL-136	2	Deletion - In frame(2)	prostate(2)	c.90_91insGTCGCC						.																																			SO:0001652	inframe_insertion	5420	exon1			CTGGGAGGGCGAC		CCDS34755.1, CCDS47714.1	7q32-q33	2008-07-18			ENSG00000128567	ENSG00000128567			9171	protein-coding gene	gene with protein product		602632					Standard	NM_001018111		Approved	PCLP, Gp200, PC	uc003vqx.4	O00592	OTTHUMG00000154918	ENST00000378555.3:c.84_89dupGTCGCC	7.37:g.131241030_131241035dupGGCGAC	ENSP00000367817:p.SerPro30dup	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	50	6	NM_005397	0	0	0	0	0	A6NHX8|Q52LZ7|Q53ER6	In_Frame_Ins	INS	ENST00000378555.3	37	CCDS34755.1																																																																																			.		0.752	PODXL-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000337627.2	NM_001018111	
ARHGEF26	26084	bcgsc.ca	37	3	153839959	153839960	+	Missense_Mutation	DNP	CT	CT	TC	rs386667246|rs12497267|rs59508481	byFrequency	TCGA-OR-A5JK-01A-11D-A29I-10	TCGA-OR-A5JK-10A-01D-A29L-10	CT	CT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30ef35e3-dbfe-4e8d-a398-fa59ec891031	9f7d2d3c-956c-4894-ba05-6349fc18bec2	g.chr3:153839959_153839960CT>TC	ENST00000356448.4	+	2	462_463	c.178_179CT>TC	c.(178-180)CTc>TCc	p.L60S	ARHGEF26-AS1_ENST00000491862.1_RNA|ARHGEF26-AS1_ENST00000479270.1_RNA|ARHGEF26-AS1_ENST00000467912.1_RNA|ARHGEF26_ENST00000465093.1_Missense_Mutation_p.L60S|ARHGEF26_ENST00000465817.1_Missense_Mutation_p.L60S|ARHGEF26-AS1_ENST00000480639.1_RNA	NM_001251962.1	NP_001238891.1	Q96DR7	ARHGQ_HUMAN	Rho guanine nucleotide exchange factor (GEF) 26	60			L -> P (in dbSNP:rs12497267). {ECO:0000269|PubMed:15221005}.	L -> S (in Ref. 1; AAL27001, 2; AAS59842, 3; BAG53860 and 6; AAH78655). {ECO:0000305}.	endothelial cell morphogenesis (GO:0001886)|ruffle assembly (GO:0097178)	cell projection (GO:0042995)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(4)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|pancreas(1)|urinary_tract(1)	23						AGGGACGCTCCTCGCAGCGCAG	0.668																																					p.L60S	GBM(163;191 2003 24758 29593 48540)|Ovarian(152;631 1885 20165 22910 51013)	.											.	ARHGEF26-47	0			c.T179C						.																																			SO:0001583	missense	26084	exon2			CGCTCCTCGCAGC	BC016628	CCDS46938.1, CCDS58858.1	3q25.2	2013-01-10			ENSG00000114790	ENSG00000114790		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	24490	protein-coding gene	gene with protein product	"""Src homology 3 domain-containing guanine nucleotide exchange factor"""					15133129, 12697679	Standard	NM_015595		Approved	DKFZP434D146, SGEF	uc021xgc.1	Q96DR7	OTTHUMG00000159098	Exception_encountered	3.37:g.153839959_153839960delinsTC	ENSP00000348828:p.Leu60Ser	Somatic	262	0		WXS	Illumina GAIIx	Phase_I	194	0	NM_001251962	0	0	0	0	0	B3KVP8|E9PBD0|Q68CL1|Q6AZ96|Q6Q8Q8|Q96AW8|Q96DR6|Q9H9D7|Q9H9R2|Q9UFW5	Missense_Mutation	DNP	ENST00000356448.4	37	CCDS46938.1																																																																																			T|0.139;C|0.861		0.668	ARHGEF26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353287.3	NM_015595	
