#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
FAM46B	115572	hgsc.bcm.edu	37	1	27339105	27339105	+	Silent	SNP	C	C	T	rs35810604	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr1:27339105C>T	ENST00000289166.5	-	1	222	c.57G>A	c.(55-57)ggG>ggA	p.G19G		NM_052943.3	NP_443175.2	Q96A09	FA46B_HUMAN	family with sequence similarity 46, member B	19										breast(1)|central_nervous_system(1)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(1)	10		all_cancers(24;1.29e-21)|all_epithelial(13;2.35e-19)|Colorectal(325;0.000147)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Breast(348;0.00131)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;7.71e-51)|OV - Ovarian serous cystadenocarcinoma(117;1.11e-29)|Colorectal(126;5.31e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000272)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|STAD - Stomach adenocarcinoma(196;0.00114)|READ - Rectum adenocarcinoma(331;0.0419)		ccgcagccgtccccacctgag	0.771													C|||	144	0.028754	0.0038	0.0331	5008	,	,		10911	0.0069		0.0567	False		,,,				2504	0.0532				p.G19G		.											.	FAM46B-90	0			c.G57A						.	C		31,2619		0,31,1294	2.0	3.0	3.0		57	2.3	0.9	1	dbSNP_126	3	248,5422		7,234,2594	no	coding-synonymous	FAM46B	NM_052943.3		7,265,3888	TT,TC,CC		4.3739,1.1698,3.3534		19/426	27339105	279,8041	1325	2835	4160	SO:0001819	synonymous_variant	115572	exon1			AGCCGTCCCCACC	AK122816	CCDS294.2	1p35.3	2008-02-05			ENSG00000158246	ENSG00000158246			28273	protein-coding gene	gene with protein product						12477932	Standard	NM_052943		Approved	MGC16491	uc010ofj.2	Q96A09	OTTHUMG00000004278	ENST00000289166.5:c.57G>A	1.37:g.27339105C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	4	NM_052943	0	0	0	0	0		Silent	SNP	ENST00000289166.5	37	CCDS294.2																																																																																			C|0.975;T|0.025		0.771	FAM46B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012347.2	NM_052943	
CLCA3P	9629	bcgsc.ca	37	1	87101375	87101375	+	RNA	SNP	C	C	G	rs2292830	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr1:87101375C>G	ENST00000456587.1	-	0	294				CLCA3P_ENST00000466454.1_RNA																							CAATGACCTACAAATCAAAAT	0.358													G|||	2392	0.477636	0.7315	0.4582	5008	,	,		14632	0.4077		0.4225	False		,,,				2504	0.2771				.		.											.	CLCA3P-90	0			.						.	G		2990,1416	459.0+/-352.1	1021,948,234	83.0	86.0	85.0			5.2	1.0	1	dbSNP_100	85	3712,4880	616.7+/-396.6	780,2152,1364	no	intergenic				1801,3100,1598	GG,GC,CC		43.203,32.138,48.4382			87101375	6702,6296	2203	4296	6499			9629	.			GACCTACAAATCA																													1.37:g.87101375C>G		Somatic	250	0		WXS	Illumina GAIIx	Phase_I	189	6	.	0	0	0	0	0		RNA	SNP	ENST00000456587.1	37																																																																																				C|0.486;G|0.514		0.358	RP4-651E10.4-001	KNOWN	non_canonical_TEC|basic	antisense	antisense	OTTHUMT00000028263.1		
DENND2C	163259	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	115168233	115168233	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr1:115168233C>G	ENST00000393274.1	-	4	998	c.373G>C	c.(373-375)Gaa>Caa	p.E125Q	DENND2C_ENST00000481894.1_5'Flank|DENND2C_ENST00000393277.1_Missense_Mutation_p.E125Q|DENND2C_ENST00000393276.3_Missense_Mutation_p.E125Q	NM_001256404.1	NP_001243333.1	Q68D51	DEN2C_HUMAN	DENN/MADD domain containing 2C	125					positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(2)|breast(2)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(10)|pancreas(1)|skin(3)	37	all_epithelial(7;9.54e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		TTACAGCTTTCAATTTCTTTG	0.363																																					p.E125Q		.											.	DENND2C-229	0			c.G373C						.						82.0	82.0	82.0					1																	115168233		2203	4300	6503	SO:0001583	missense	163259	exon4			AGCTTTCAATTTC		CCDS875.1, CCDS58018.1	1p13.2-p13.1	2012-10-03			ENSG00000175984	ENSG00000175984		"""DENN/MADD domain containing"""	24748	protein-coding gene	gene with protein product							Standard	NM_198459		Approved	FLJ37099, DKFZp686G0351, DKFZp779P1149, dJ1156J9.1, RP5-1156J9.1	uc001efd.1	Q68D51	OTTHUMG00000011893	ENST00000393274.1:c.373G>C	1.37:g.115168233C>G	ENSP00000376955:p.Glu125Gln	Somatic	100	0		WXS	Illumina GAIIx	Phase_I	33	14	NM_001256404	0	0	0	0	0	B1AL26|Q5TCX6|Q6P3R3	Missense_Mutation	SNP	ENST00000393274.1	37	CCDS58018.1	.	.	.	.	.	.	.	.	.	.	C	9.171	1.021047	0.19433	.	.	ENSG00000175984	ENST00000393276;ENST00000393274;ENST00000369540;ENST00000393277	T;T;T	0.09723	3.38;3.54;2.95	5.78	2.81	0.32909	.	0.930281	0.09178	N	0.837868	T	0.04815	0.0130	M	0.68317	2.08	0.27294	N	0.957779	P;P	0.41041	0.736;0.547	B;B	0.32624	0.118;0.149	T	0.32322	-0.9911	10	0.72032	D	0.01	.	9.2394	0.37486	0.0:0.748:0.1196:0.1324	.	125;125	Q68D51;Q68D51-3	DEN2C_HUMAN;.	Q	125	ENSP00000376957:E125Q;ENSP00000376955:E125Q;ENSP00000376958:E125Q	ENSP00000358553:E125Q	E	-	1	0	DENND2C	114969756	0.957000	0.32711	0.623000	0.29173	0.013000	0.08279	2.097000	0.41748	0.760000	0.33108	-0.142000	0.14014	GAA	.		0.363	DENND2C-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000314822.1	NM_198459	
ANKRD34A	284615	hgsc.bcm.edu;bcgsc.ca	37	1	145474257	145474258	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	CT	CT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr1:145474257_145474258delCT	ENST00000323397.4	+	4	2222_2223	c.929_930delCT	c.(928-930)cctfs	p.P310fs	LIX1L_ENST00000369308.3_5'Flank|RP11-315I20.1_ENST00000600340.1_RNA	NM_001039888.2	NP_001034977.1	Q69YU3	AN34A_HUMAN	ankyrin repeat domain 34A	310	Pro-rich.					cytoplasm (GO:0005737)				endometrium(2)|kidney(2)|large_intestine(2)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)	20	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					AGCGGGGGTCCTCTCTCTCGCC	0.653																																					p.310_310del		.											.	ANKRD34A-68	0			c.929_930del						.																																			SO:0001589	frameshift_variant	284615	exon4			GGGGTCCTCTCTC	AK128050	CCDS72874.1	1q21.1	2013-01-10	2007-11-20	2007-11-20	ENSG00000181039	ENSG00000272031		"""Ankyrin repeat domain containing"""	27639	protein-coding gene	gene with protein product			"""ankyrin repeat domain 34"""	ANKRD34			Standard	NM_001039888		Approved		uc001enq.1	Q69YU3	OTTHUMG00000013740	ENST00000323397.4:c.929_930delCT	1.37:g.145474263_145474264delCT	ENSP00000314103:p.Pro310fs	Somatic	107	1		WXS	Illumina GAIIx	Phase_I	76	27	NM_001039888	0	0	0	0	0	B3KSU3	Frame_Shift_Del	DEL	ENST00000323397.4	37	CCDS30829.1																																																																																			.		0.653	ANKRD34A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038512.1		
HRNR	388697	broad.mit.edu;bcgsc.ca	37	1	152188235	152188235	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr1:152188235C>T	ENST00000368801.2	-	3	5945	c.5870G>A	c.(5869-5871)gGt>gAt	p.G1957D	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	1957					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTGCCCAGAACCAGACCCATG	0.617																																					p.G1957D		.											.	HRNR-93	0			c.G5870A						.						272.0	462.0	398.0					1																	152188235		2165	4289	6454	SO:0001583	missense	388697	exon3			CCAGAACCAGACC	AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.5870G>A	1.37:g.152188235C>T	ENSP00000357791:p.Gly1957Asp	Somatic	2699	1		WXS	Illumina GAIIx	Phase_I	2930	70	NM_001009931	0	0	0	0	0	Q5DT20|Q5U1F4	Missense_Mutation	SNP	ENST00000368801.2	37	CCDS30859.1	.	.	.	.	.	.	.	.	.	.	C	4.830	0.154248	0.09236	.	.	ENSG00000197915	ENST00000368801	T	0.02121	4.44	2.63	-0.398	0.12418	.	.	.	.	.	T	0.00524	0.0017	L	0.38838	1.175	0.09310	N	1	B	0.33494	0.414	B	0.36567	0.228	T	0.43212	-0.9405	9	0.12103	T	0.63	.	0.409	0.00438	0.2191:0.3309:0.2168:0.2332	.	1957	Q86YZ3	HORN_HUMAN	D	1957	ENSP00000357791:G1957D	ENSP00000357791:G1957D	G	-	2	0	HRNR	150454859	0.002000	0.14202	0.000000	0.03702	0.016000	0.09150	0.925000	0.28791	-0.229000	0.09854	0.456000	0.33151	GGT	.		0.617	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034016.1	XM_373868	
RRNAD1	51093	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	156703977	156703979	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	CTC	CTC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr1:156703977_156703979delCTC	ENST00000368216.4	+	6	1443_1445	c.813_815delCTC	c.(811-816)ttctcc>ttc	p.S272del	RRNAD1_ENST00000476229.1_Intron|RRNAD1_ENST00000368218.4_Intron	NM_015997.3	NP_057081.3	Q96FB5	RRNAD_HUMAN	ribosomal RNA adenine dimethylase domain containing 1	272						integral component of membrane (GO:0016021)	rRNA (adenine-N6,N6-)-dimethyltransferase activity (GO:0000179)			NS(1)|breast(1)|kidney(1)|large_intestine(3)|lung(3)	9						TGAGACACTTCTCCTGCTGTCCT	0.631																																					p.271_272del		.											.	RRNAD1-90	0			c.813_815del						.																																			SO:0001651	inframe_deletion	51093	exon6			ACACTTCTCCTGC	BC011382	CCDS1154.1, CCDS44246.1	1q23.1	2011-01-28	2011-01-28	2011-01-28	ENSG00000143303	ENSG00000143303			24273	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 66"""	C1orf66		10810093, 310876	Standard	NM_015997		Approved	CGI-41	uc001fpu.3	Q96FB5	OTTHUMG00000041302	ENST00000368216.4:c.813_815delCTC	1.37:g.156703977_156703979delCTC	ENSP00000357199:p.Ser272del	Somatic	156	0		WXS	Illumina GAIIx	Phase_I	106	31	NM_015997	0	0	0	0	0	D3DVC7|Q4VX71|Q5SZ03|Q9Y358	In_Frame_Del	DEL	ENST00000368216.4	37	CCDS1154.1																																																																																			.		0.631	RRNAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098973.1	NM_015997	
PEAR1	375033	broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	156878718	156878718	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr1:156878718G>A	ENST00000338302.3	+	12	1526	c.1301G>A	c.(1300-1302)tGt>tAt	p.C434Y	PEAR1_ENST00000292357.7_Missense_Mutation_p.C434Y			Q5VY43	PEAR1_HUMAN	platelet endothelial aggregation receptor 1	434	EGF-like 5. {ECO:0000255|PROSITE- ProRule:PRU00076}.				recognition of apoptotic cell (GO:0043654)	integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)				breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(6)|lung(22)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)	43	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					GGCCCTCACTGTGCTAGTCTT	0.627																																					p.C434Y		.											.	PEAR1-71	0			c.G1301A						.						115.0	87.0	96.0					1																	156878718		2203	4300	6503	SO:0001583	missense	375033	exon11			CTCACTGTGCTAG	AK098809	CCDS30892.1	1q23.1	2008-02-05	2007-10-25	2007-10-25	ENSG00000187800	ENSG00000187800			33631	protein-coding gene	gene with protein product		610278	"""multiple EGF-like-domains 12"""	MEGF12		15851471	Standard	NM_001080471		Approved	JEDI, FLJ00193	uc001fqj.1	Q5VY43	OTTHUMG00000041293	ENST00000338302.3:c.1301G>A	1.37:g.156878718G>A	ENSP00000344465:p.Cys434Tyr	Somatic	89	0		WXS	Illumina GAIIx	Phase_I	84	30	NM_001080471	0	0	0	0	0	Q8TEK2	Missense_Mutation	SNP	ENST00000338302.3	37	CCDS30892.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.180287	0.78677	.	.	ENSG00000187800	ENST00000338302;ENST00000292357	D;D	0.94862	-3.54;-3.54	4.87	4.87	0.63330	Epidermal growth factor-like (1);EGF-like region, conserved site (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.52532	D	0.000069	D	0.97983	0.9336	H	0.95574	3.69	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98939	1.0790	10	0.87932	D	0	.	15.547	0.76112	0.0:0.0:1.0:0.0	.	235;434	Q8N780;Q5VY43	.;PEAR1_HUMAN	Y	434	ENSP00000344465:C434Y;ENSP00000292357:C434Y	ENSP00000292357:C434Y	C	+	2	0	PEAR1	155145342	1.000000	0.71417	1.000000	0.80357	0.773000	0.43773	7.387000	0.79785	2.506000	0.84524	0.563000	0.77884	TGT	.		0.627	PEAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098937.2	NM_001080471	
TOR3A	64222	hgsc.bcm.edu	37	1	179051300	179051300	+	Missense_Mutation	SNP	T	T	C	rs2296377	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr1:179051300T>C	ENST00000367627.3	+	1	789	c.37T>C	c.(37-39)Ttc>Ctc	p.F13L	TOR3A_ENST00000352445.6_Missense_Mutation_p.F13L	NM_022371.3	NP_071766.2	Q9H497	TOR3A_HUMAN	torsin family 3, member A	13			F -> L (in dbSNP:rs2296377). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|Ref.3}.		ATP catabolic process (GO:0006200)|chaperone mediated protein folding requiring cofactor (GO:0051085)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			endometrium(1)|kidney(2)|large_intestine(4)|lung(4)|pancreas(1)|urinary_tract(1)	13						TTGGCTCTTTTTCCTGCTGCT	0.751													C|||	3842	0.767173	0.9879	0.6441	5008	,	,		12722	0.6677		0.7117	False		,,,				2504	0.7157				p.F13L		.											.	TOR3A-90	0			c.T37C						.	C	LEU/PHE	3262,174		1547,168,3	2.0	3.0	3.0		37	-0.8	0.0	1	dbSNP_100	3	5365,1739		2051,1263,238	yes	missense	TOR3A	NM_022371.3	22	3598,1431,241	CC,CT,TT		24.4792,5.064,18.1499	benign	13/398	179051300	8627,1913	1718	3552	5270	SO:0001583	missense	64222	exon1			CTCTTTTTCCTGC	BC001085	CCDS1329.1	1q25.2	2008-02-05	2003-04-02		ENSG00000186283	ENSG00000186283			11997	protein-coding gene	gene with protein product		607555	"""ATP-dependant interferon responsive"""	ADIR		10644435	Standard	NM_022371		Approved	FLJ22345, ADIR2	uc001gmd.3	Q9H497	OTTHUMG00000035077	ENST00000367627.3:c.37T>C	1.37:g.179051300T>C	ENSP00000356599:p.Phe13Leu	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	7	4	NM_022371	0	0	2	6	4	B4DSY0|B7ZB65|Q5M7Y7|Q8WVA7|Q8WWM2|Q9H495|Q9H6E7	Missense_Mutation	SNP	ENST00000367627.3	37	CCDS1329.1	1679	0.7687728937728938	484	0.983739837398374	250	0.6906077348066298	393	0.6870629370629371	552	0.7282321899736148	C	0.033	-1.323382	0.01309	0.94936	0.755208	ENSG00000186283	ENST00000367627;ENST00000367625;ENST00000352445	T;T;T	0.35421	1.31;1.4;1.63	0.427	-0.794	0.10918	.	1.274350	0.05916	N	0.632520	T	0.00012	0.0000	N	0.00368	-1.59	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.45906	-0.9229	8	0.02654	T	1	-1.1524	.	.	.	rs2296377;rs17844883;rs17856371;rs17857600;rs17857917;rs17858479;rs59034332;rs2296377	13	Q9H497	TOR3A_HUMAN	L	13	ENSP00000356599:F13L;ENSP00000356597:F13L;ENSP00000335351:F13L	ENSP00000335351:F13L	F	+	1	0	TOR3A	177317923	0.000000	0.05858	0.002000	0.10522	0.004000	0.04260	-1.490000	0.02304	-1.608000	0.01587	-1.610000	0.00802	TTC	T|0.229;C|0.771		0.751	TOR3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084927.1	NM_022371	
CACNA1E	777	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	181767904	181767904	+	Silent	SNP	G	G	A			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr1:181767904G>A	ENST00000367573.2	+	48	6876	c.6876G>A	c.(6874-6876)ggG>ggA	p.G2292G	CACNA1E_ENST00000357570.5_Silent_p.G2243G|CACNA1E_ENST00000360108.3_Silent_p.G2273G|CACNA1E_ENST00000358338.5_Silent_p.G2181G|CACNA1E_ENST00000526775.1_Silent_p.G2230G|CACNA1E_ENST00000367570.1_Silent_p.G2249G|CACNA1E_ENST00000367567.4_Silent_p.G1856G	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	2292					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						GGGGGCCTGGGCCAGGCATGA	0.637																																					p.G2292G		.											.	CACNA1E-95	0			c.G6876A						.						17.0	20.0	19.0					1																	181767904		1998	4151	6149	SO:0001819	synonymous_variant	777	exon48			GCCTGGGCCAGGC	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.6876G>A	1.37:g.181767904G>A		Somatic	26	0		WXS	Illumina GAIIx	Phase_I	55	24	NM_001205293	0	0	0	0	0	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Silent	SNP	ENST00000367573.2	37	CCDS55664.1																																																																																			.		0.637	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721	
RASSF5	83593	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	206730911	206730911	+	Intron	SNP	G	G	T			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr1:206730911G>T	ENST00000355294.4	+	2	636				RASSF5_ENST00000304534.8_Missense_Mutation_p.D4Y|RASSF5_ENST00000367117.3_Intron	NM_182663.2	NP_872604.1	Q8WWW0	RASF5_HUMAN	Ras association (RalGDS/AF-6) domain family member 5						apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|negative regulation of cell proliferation (GO:0008285)|positive regulation of protein ubiquitination (GO:0031398)|regulation of protein localization to nucleus (GO:1900180)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)	8	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.166)			GATGACCGTGGACAGCAGCAT	0.627																																					p.D4Y	GBM(162;656 1984 11916 22872 31529)	.											.	RASSF5-660	0			c.G10T						.						80.0	76.0	77.0					1																	206730911		2203	4300	6503	SO:0001627	intron_variant	83593	exon1			ACCGTGGACAGCA	BC004270	CCDS1463.1, CCDS1464.1, CCDS30998.1	1q31	2014-04-10	2008-02-22		ENSG00000136653	ENSG00000266094			17609	protein-coding gene	gene with protein product		607020				11978988, 11965544	Standard	NM_182663		Approved	Maxp1, NORE1, RAPL	uc001hed.3	Q8WWW0	OTTHUMG00000184616	ENST00000355294.4:c.579+19289G>T	1.37:g.206730911G>T		Somatic	136	0		WXS	Illumina GAIIx	Phase_I	112	39	NM_182665	0	0	4	4	0	A8K1E6|Q5SY32|Q8WWV9|Q8WXF4|Q9BT99	Missense_Mutation	SNP	ENST00000355294.4	37	CCDS30998.1	.	.	.	.	.	.	.	.	.	.	G	17.78	3.474131	0.63737	.	.	ENSG00000136653	ENST00000304534	T	0.12147	2.71	5.25	5.25	0.73442	.	.	.	.	.	T	0.21307	0.0513	L	0.40543	1.245	0.25125	N	0.990611	D	0.60160	0.987	P	0.55391	0.775	T	0.07385	-1.0775	9	0.54805	T	0.06	.	9.8805	0.41231	0.0931:0.0:0.9069:0.0	.	4	Q8WWW0-2	.	Y	4	ENSP00000306091:D4Y	ENSP00000306091:D4Y	D	+	1	0	RASSF5	204797534	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.481000	0.66826	2.436000	0.82500	0.655000	0.94253	GAC	.		0.627	RASSF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088469.1	NM_031437	
PARP1	142	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	226566961	226566961	+	Missense_Mutation	SNP	C	C	T	rs200485374		TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr1:226566961C>T	ENST00000366794.5	-	12	1770	c.1627G>A	c.(1627-1629)Gcg>Acg	p.A543T		NM_001618.3	NP_001609.2	P09874	PARP1_HUMAN	poly (ADP-ribose) polymerase 1	543					base-excision repair (GO:0006284)|cellular response to insulin stimulus (GO:0032869)|DNA damage response, detection of DNA damage (GO:0042769)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|gene expression (GO:0010467)|macrophage differentiation (GO:0030225)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|protein ADP-ribosylation (GO:0006471)|protein autoprocessing (GO:0016540)|protein poly-ADP-ribosylation (GO:0070212)|regulation of growth rate (GO:0040009)|signal transduction involved in regulation of gene expression (GO:0023019)|telomere maintenance (GO:0000723)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|NAD binding (GO:0051287)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(2)|endometrium(4)|kidney(4)|large_intestine(8)|lung(15)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	44	Breast(184;0.133)			GBM - Glioblastoma multiforme(131;0.0531)		AGGACATGCGCAGAGTGTTCC	0.542								Poly(ADP-ribose) polymerase (PARP) enzymes that bind to DNA					C|||	1	0.000199681	0.0	0.0014	5008	,	,		23319	0.0		0.0	False		,,,				2504	0.0				p.A543T		.											.	PARP1-727	0			c.G1627A						.						152.0	138.0	143.0					1																	226566961		2203	4300	6503	SO:0001583	missense	142	exon12			CATGCGCAGAGTG	BC037545	CCDS1554.1	1q41-q42	2010-02-16	2008-07-28	2004-08-26	ENSG00000143799	ENSG00000143799	2.4.2.30	"""Poly (ADP-ribose) polymerases"""	270	protein-coding gene	gene with protein product		173870	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)"", ""poly (ADP-ribose) polymerase family, member 1"""	PPOL, ADPRT		10964595	Standard	NM_001618		Approved	PARP	uc001hqd.4	P09874	OTTHUMG00000037556	ENST00000366794.5:c.1627G>A	1.37:g.226566961C>T	ENSP00000355759:p.Ala543Thr	Somatic	234	0		WXS	Illumina GAIIx	Phase_I	303	69	NM_001618	0	0	75	96	21	B1ANJ4|Q8IUZ9	Missense_Mutation	SNP	ENST00000366794.5	37	CCDS1554.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	19.37	3.815377	0.70912	.	.	ENSG00000143799	ENST00000366794	T	0.17691	2.26	5.07	5.07	0.68467	WGR domain (1);	0.102602	0.64402	D	0.000002	T	0.22244	0.0536	M	0.62209	1.925	0.80722	D	1	P	0.36495	0.556	B	0.38921	0.285	T	0.01829	-1.1265	10	0.51188	T	0.08	.	13.4237	0.61013	0.157:0.8429:0.0:0.0	.	543	P09874	PARP1_HUMAN	T	543	ENSP00000355759:A543T	ENSP00000355759:A543T	A	-	1	0	PARP1	224633584	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.416000	0.66417	2.350000	0.79820	0.655000	0.94253	GCG	C|0.999;T|0.000		0.542	PARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091519.1	NM_001618	
JMJD4	65094	hgsc.bcm.edu	37	1	227923081	227923081	+	Missense_Mutation	SNP	G	G	A	rs7419238		TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr1:227923081G>A	ENST00000366758.3	-	1	31	c.32C>T	c.(31-33)gCg>gTg	p.A11V	SNAP47_ENST00000366760.1_Intron|SNAP47_ENST00000366759.4_5'UTR|JMJD4_ENST00000438896.2_Missense_Mutation_p.A11V|JMJD4_ENST00000485807.1_5'Flank|SNAP47_ENST00000315781.5_5'UTR	NM_023007.2	NP_075383.2	Q9H9V9	JMJD4_HUMAN	jumonji domain containing 4	11			A -> V (in dbSNP:rs7419238). {ECO:0000269|PubMed:14702039}.							endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|skin(1)	9		Prostate(94;0.0885)				TTTCTGCCCCGCCAGCGCCTG	0.741													A|||	5008	1.0	1.0	1.0	5008	,	,		11222	1.0		1.0	False		,,,				2504	1.0				p.A11V		.											.	JMJD4-226	0			c.C32T						.	A	VAL/ALA,VAL/ALA,	4035,1		2017,1,0	6.0	7.0	7.0		32,32,	2.0	0.0	1	dbSNP_116	7	8000,0		4000,0,0	yes	missense,missense,utr-5	JMJD4,SNAP47	NM_001161465.1,NM_023007.2,NM_053052.3	64,64,	6017,1,0	AA,AG,GG		0.0,0.0248,0.0083	benign,benign,	11/448,11/464,	227923081	12035,1	2018	4000	6018	SO:0001583	missense	65094	exon1			TGCCCCGCCAGCG	AK022579	CCDS1561.1, CCDS59203.1	1q42.13	2008-02-05			ENSG00000081692	ENSG00000081692			25724	protein-coding gene	gene with protein product						12477932	Standard	NM_023007		Approved	FLJ12517	uc001hrb.3	Q9H9V9	OTTHUMG00000037698	ENST00000366758.3:c.32C>T	1.37:g.227923081G>A	ENSP00000355720:p.Ala11Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	9	NM_023007	0	0	0	2	2	Q5TBZ1|Q5TBZ6|Q9H970	Missense_Mutation	SNP	ENST00000366758.3	37	CCDS1561.1	2179|2179	0.9977106227106227|0.9977106227106227	492|492	1.0|1.0	361|361	0.9972375690607734|0.9972375690607734	572|572	1.0|1.0	754|754	0.9947229551451188|0.9947229551451188	A|A	2.779|2.779	-0.253926|-0.253926	0.05829|0.05829	0.999752|0.999752	1.0|1.0	ENSG00000081692|ENSG00000081692	ENST00000366758|ENST00000438896	T|.	0.19806|.	2.12|.	3.58|3.58	1.99|1.99	0.26369|0.26369	.|.	.|.	.|.	.|.	.|.	T|T	0.00012|0.00012	0.0000|0.0000	N|N	0.03608|0.03608	-0.345|-0.345	0.80722|0.80722	P|P	0.0|0.0	B;B|.	0.02656|.	0.0;0.0|.	B;B|.	0.01281|.	0.0;0.0|.	T|T	0.27400|0.27400	-1.0075|-1.0075	8|4	0.02654|.	T|.	1|.	.|.	5.7765|5.7765	0.18281|0.18281	0.6536:0.0:0.3464:0.0|0.6536:0.0:0.3464:0.0	rs7419238;rs58641567;rs7419238|rs7419238;rs58641567;rs7419238	11;11|.	Q9H9V9-2;Q9H9V9|.	.;JMJD4_HUMAN|.	V|W	11|4	ENSP00000355720:A11V|.	ENSP00000355720:A11V|.	A|R	-|-	2|1	0|2	JMJD4|JMJD4	225989704|225989704	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.004000|0.004000	0.04260|0.04260	-0.100000|-0.100000	0.10990|0.10990	-0.047000|-0.047000	0.13423|0.13423	-0.268000|-0.268000	0.10319|0.10319	GCG|CGG	G|0.002;A|0.998		0.741	JMJD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091970.1	NM_023007	
OBSCN	84033	hgsc.bcm.edu	37	1	228504670	228504670	+	Missense_Mutation	SNP	C	C	T	rs11810627	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr1:228504670C>T	ENST00000422127.1	+	51	13590	c.13546C>T	c.(13546-13548)Cgg>Tgg	p.R4516W	OBSCN_ENST00000366709.4_Missense_Mutation_p.R1635W|OBSCN_ENST00000284548.11_Missense_Mutation_p.R4516W|OBSCN_ENST00000570156.2_Missense_Mutation_p.R5473W|OBSCN_ENST00000366707.4_Missense_Mutation_p.R2150W	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	4516	Ig-like 46.		R -> W (in dbSNP:rs11810627).		apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GGCCTCTGCGCGGCTCACCGT	0.736													c|||	1654	0.330272	0.2791	0.4006	5008	,	,		13971	0.249		0.4861	False		,,,				2504	0.273				p.R5473W		.											.	OBSCN-403	0			c.C16417T						.		TRP/ARG,TRP/ARG	923,2833		165,593,1120	5.0	6.0	6.0		13546,13546	-1.0	0.0	1	dbSNP_120	6	3333,4245		861,1611,1317	yes	missense,missense	OBSCN	NM_001098623.1,NM_052843.2	101,101	1026,2204,2437	TT,TC,CC		43.9826,24.574,37.5507	probably-damaging,probably-damaging	4516/7969,4516/6621	228504670	4256,7078	1878	3789	5667	SO:0001583	missense	84033	exon62			TCTGCGCGGCTCA	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.13546C>T	1.37:g.228504670C>T	ENSP00000409493:p.Arg4516Trp	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	31	31	NM_001271223	0	0	0	0	0	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	CCDS58065.1	774	0.3543956043956044	137	0.2784552845528455	144	0.39779005524861877	134	0.23426573426573427	359	0.4736147757255937	c	11.94	1.787178	0.31593	0.24574	0.439826	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709	T;T;T;T	0.77098	-1.07;-1.07;0.2;0.2	5.41	-0.971	0.10303	Immunoglobulin subtype (1);Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.167607	0.36519	N	0.002550	T	0.00012	0.0000	L	0.41824	1.3	0.50632	P	1.1499999999997623E-4	B;B	0.22541	0.071;0.067	B;B	0.12156	0.007;0.007	T	0.42275	-0.9461	9	0.45353	T	0.12	.	10.3619	0.43998	0.6084:0.317:0.0:0.0747	rs11810627	4516;4516	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	W	4516;4516;2150;1635	ENSP00000284548:R4516W;ENSP00000409493:R4516W;ENSP00000355668:R2150W;ENSP00000355670:R1635W	ENSP00000284548:R4516W	R	+	1	2	OBSCN	226571293	0.968000	0.33430	0.013000	0.15412	0.016000	0.09150	2.032000	0.41127	-0.028000	0.13850	0.550000	0.68814	CGG	C|0.643;T|0.357		0.736	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
OR2T2	401992	broad.mit.edu	37	1	248616705	248616711	+	Frame_Shift_Del	DEL	TGCTGCG	TGCTGCG	-	rs199823862|rs372931983		TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr1:248616705_248616711delTGCTGCG	ENST00000342927.3	+	1	629_635	c.607_613delTGCTGCG	c.(607-615)tgctgcgtgfs	p.CCV203fs		NM_001004136.1	NP_001004136.1	Q6IF00	OR2T2_HUMAN	olfactory receptor, family 2, subfamily T, member 2	203						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(21)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	37	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GATGTATGCCTGCTGCGTGCTGATGCT	0.527																																					p.203_205del		.											.	OR2T2-23	0			c.607_613del						.			51,3755		2,47,1854						-2.5	0.6			76	261,7371		12,237,3567	no	frameshift	OR2T2	NM_001004136.1		14,284,5421	A1A1,A1R,RR		3.4198,1.34,2.7277				312,11126				SO:0001589	frameshift_variant	401992	exon1			TATGCCTGCTGCG	BK004462	CCDS31116.1	1q44	2012-08-09	2002-11-13	2002-11-15	ENSG00000196240	ENSG00000196240		"""GPCR / Class A : Olfactory receptors"""	14725	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily T, member 2 pseudogene"""	OR2T2P		14983052	Standard	NM_001004136		Approved		uc001iek.1	Q6IF00	OTTHUMG00000040480	ENST00000342927.3:c.607_613delTGCTGCG	1.37:g.248616705_248616711delTGCTGCG	ENSP00000343062:p.Cys203fs	Somatic	497	0		WXS	Illumina GAIIx	Phase_I	665	7	NM_001004136	0	0	0	0	0	B2RNM1|B9EH01	Frame_Shift_Del	DEL	ENST00000342927.3	37	CCDS31116.1																																																																																			.		0.527	OR2T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097421.1	NM_001004136	
ANKRD16	54522	hgsc.bcm.edu	37	10	5931230	5931230	+	Missense_Mutation	SNP	C	C	T	rs3750659	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr10:5931230C>T	ENST00000380094.5	-	1	631	c.88G>A	c.(88-90)Ggg>Agg	p.G30R	ANKRD16_ENST00000380092.4_Missense_Mutation_p.G30R|FBXO18_ENST00000397269.3_5'Flank|ANKRD16_ENST00000191063.8_Missense_Mutation_p.G30R|FBXO18_ENST00000362091.4_5'Flank	NM_019046.2	NP_061919.1	Q6P6B7	ANR16_HUMAN	ankyrin repeat domain 16	30										breast(1)|endometrium(1)|large_intestine(5)|lung(3)|stomach(2)	12						gggcagcccccggccgccTGC	0.786													C|||	303	0.0605032	0.0008	0.0346	5008	,	,		8341	0.1429		0.0368	False		,,,				2504	0.0992				p.G30R		.											.	ANKRD16-90	0			c.G88A						.	C	ARG/GLY,ARG/GLY,ARG/GLY	18,3412		0,18,1697	3.0	4.0	4.0		88,88,88	0.9	0.0	10	dbSNP_107	4	172,6644		1,170,3237	no	missense,missense,missense	ANKRD16	NM_001009941.2,NM_001009943.2,NM_019046.2	125,125,125	1,188,4934	TT,TC,CC		2.5235,0.5248,1.8544	benign,benign,benign	30/362,30/305,30/362	5931230	190,10056	1715	3408	5123	SO:0001583	missense	54522	exon1			AGCCCCCGGCCGC	AL137614	CCDS31136.1, CCDS31137.1	10p15.1	2013-01-10			ENSG00000134461	ENSG00000134461		"""Ankyrin repeat domain containing"""	23471	protein-coding gene	gene with protein product							Standard	NM_019046		Approved	DKFZP434N1511	uc010qat.2	Q6P6B7	OTTHUMG00000017610	ENST00000380094.5:c.88G>A	10.37:g.5931230C>T	ENSP00000369436:p.Gly30Arg	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	7	NM_001009943	0	0	0	1	1	A6NEF0|F8WEI4|Q9NT01	Missense_Mutation	SNP	ENST00000380094.5	37	CCDS31136.1	130	0.05952380952380952	17	0.034552845528455285	13	0.03591160220994475	69	0.12062937062937062	31	0.040897097625329816	C	15.52	2.858404	0.51376	0.005248	0.025235	ENSG00000134461	ENST00000380094;ENST00000380092;ENST00000191063	T;T;T	0.65549	-0.16;-0.16;0.17	4.22	0.951	0.19579	Ankyrin repeat-containing domain (1);	0.519198	0.21401	N	0.075148	T	0.00666	0.0022	N	0.24115	0.695	0.80722	P	0.0	B;B;B	0.17852	0.001;0.024;0.019	B;B;B	0.17433	0.003;0.018;0.009	T	0.04930	-1.0917	9	0.59425	D	0.04	-8.5351	5.2185	0.15356	0.0:0.5957:0.148:0.2563	rs3750659	30;30;30	Q6P6B7;C9JP28;F8WEI4	ANR16_HUMAN;.;.	R	30	ENSP00000369436:G30R;ENSP00000369434:G30R;ENSP00000352361:G30R	ENSP00000352361:G30R	G	-	1	0	ANKRD16	5971236	0.000000	0.05858	0.005000	0.12908	0.790000	0.44656	-0.387000	0.07361	0.353000	0.24079	0.430000	0.28490	GGG	C|0.938;T|0.062		0.786	ANKRD16-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046611.2	XM_166138	
CDH23	64072	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	73571772	73571772	+	Splice_Site	SNP	G	G	A			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr10:73571772G>A	ENST00000224721.6	+	65	9400	c.9395G>A	c.(9394-9396)gGa>gAa	p.G3132E	CDH23_ENST00000398788.3_Splice_Site_p.G887E|CDH23_ENST00000475158.1_3'UTR	NM_022124.5	NP_071407.4	Q9H251	CAD23_HUMAN	cadherin-related 23	3127					calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cytosolic calcium ion homeostasis (GO:0051480)|equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(6)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(27)|lung(49)|ovary(3)|pancreas(1)|prostate(7)|stomach(7)|upper_aerodigestive_tract(3)	133						TCCTTTGATGGGTGAGTGGGG	0.632											OREG0020259	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G3127E		.											.	CDH23-563	0			c.G9380A						.						89.0	87.0	88.0					10																	73571772		1976	4154	6130	SO:0001630	splice_region_variant	64072	exon64			TTGATGGGTGAGT	AY010111	CCDS53540.1, CCDS73146.1	10q22.1	2014-08-08	2010-01-25		ENSG00000107736	ENSG00000107736		"""Cadherins / Cadherin-related"""	13733	protein-coding gene	gene with protein product	"""cadherin-related family member 23"""	605516	"""cadherin related 23"", ""cadherin-like 23"""	DFNB12, USH1D		11090341	Standard	NM_022124		Approved	CDHR23	uc001jrx.4	Q9H251	OTTHUMG00000019347	ENST00000224721.6:c.9395+1G>A	10.37:g.73571772G>A		Somatic	224	0	1146	WXS	Illumina GAIIx	Phase_I	292	63	NM_022124	0	0	0	0	0	C4IXS9|F6U049|Q5QGS1|Q5QGS2|Q5QGS5|Q5QGS6|Q5XKN2|Q6UWW1|Q96JL3|Q9H4K9	Missense_Mutation	SNP	ENST00000224721.6	37		.	.	.	.	.	.	.	.	.	.	G	36	5.670598	0.96754	.	.	ENSG00000107736	ENST00000398860;ENST00000398855;ENST00000224721;ENST00000398788	T	0.63913	-0.07	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.80116	0.4564	M	0.69823	2.125	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	T	0.80551	-0.1332	10	0.72032	D	0.01	.	20.0989	0.97860	0.0:0.0:1.0:0.0	.	3127;3127	E9PEX1;Q9H251	.;CAD23_HUMAN	E	3132;3127;3130;887	ENSP00000381768:G887E	ENSP00000224721:G3132E	G	+	2	0	CDH23	73241778	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.312000	0.96287	2.764000	0.94973	0.650000	0.86243	GGA	.		0.632	CDH23-001	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051227.4	NM_052836	Missense_Mutation
HECTD2	143279	hgsc.bcm.edu	37	10	93170250	93170250	+	Missense_Mutation	SNP	C	C	G	rs7081569		TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr10:93170250C>G	ENST00000298068.5	+	1	149	c.55C>G	c.(55-57)Ccc>Gcc	p.P19A	HECTD2_ENST00000371681.4_Missense_Mutation_p.P19A|HECTD2_ENST00000446394.1_Missense_Mutation_p.P19A	NM_182765.3	NP_877497	Q5U5R9	HECD2_HUMAN	HECT domain containing E3 ubiquitin protein ligase 2	19			P -> A (in dbSNP:rs7081569). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|endometrium(2)|kidney(4)|large_intestine(10)|lung(7)|skin(1)|urinary_tract(1)	27						GGTGGCGGCGCCCGCGCCTGA	0.761													G|||	5008	1.0	1.0	1.0	5008	,	,		7483	1.0		1.0	False		,,,				2504	1.0				p.P19A	NSCLC(12;376 469 1699 39910 41417)	.											.	HECTD2-658	0			c.C55G						.						2.0	2.0	2.0					10																	93170250		1173	2544	3717	SO:0001583	missense	143279	exon1			GCGGCGCCCGCGC	AK094625	CCDS7414.1, CCDS7415.1, CCDS60591.1	10q23.32	2013-09-20	2012-02-23		ENSG00000165338	ENSG00000165338			26736	protein-coding gene	gene with protein product			"""HECT domain containing 2"""			8619474, 9110174	Standard	NM_001284274		Approved	FLJ37306	uc001khl.2	Q5U5R9	OTTHUMG00000018742	ENST00000298068.5:c.55C>G	10.37:g.93170250C>G	ENSP00000298068:p.Pro19Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_182765	0	0	0	2	2	Q5VZ97|Q5VZ98|Q5VZ99|Q8N1X7|Q8TCP5	Missense_Mutation	SNP	ENST00000298068.5	37	CCDS7414.1	1998	0.9148351648351648	429	0.8719512195121951	335	0.925414364640884	529	0.9248251748251748	705	0.9300791556728232	g	1.760	-0.486925	0.04352	.	.	ENSG00000165338	ENST00000446394;ENST00000371681;ENST00000298068	T;T;T	0.36699	1.5;1.24;1.5	2.37	2.37	0.29283	.	0.964307	0.08409	N	0.950145	T	0.00012	0.0000	N	0.00538	-1.39	0.46241	P	0.001052000000000053	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.32534	-0.9903	9	0.02654	T	1	.	7.1033	0.25351	0.0:0.2826:0.7174:0.0	rs7081569	19;19;19	E7ERR3;Q5U5R9;Q5VZ98	.;HECD2_HUMAN;.	A	19	ENSP00000401023:P19A;ENSP00000360746:P19A;ENSP00000298068:P19A	ENSP00000298068:P19A	P	+	1	0	HECTD2	93160230	0.858000	0.29795	0.231000	0.23993	0.735000	0.41995	-0.544000	0.06077	0.556000	0.29098	-0.370000	0.07254	CCC	C|0.154;G|0.846		0.761	HECTD2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098620.1		
TBC1D12	23232	hgsc.bcm.edu	37	10	96163039	96163039	+	Silent	SNP	C	C	G	rs2477534	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr10:96163039C>G	ENST00000225235.4	+	1	779	c.669C>G	c.(667-669)ccC>ccG	p.P223P		NM_015188.1	NP_056003.1	O60347	TBC12_HUMAN	TBC1 domain family, member 12	223							Rab GTPase activator activity (GO:0005097)			breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|upper_aerodigestive_tract(2)	20		Colorectal(252;0.0429)				GGGACAGCCCCGCCAGCAGCT	0.751													G|||	3411	0.68111	0.6165	0.5648	5008	,	,		8936	0.8373		0.6342	False		,,,				2504	0.7382				p.P223P		.											.	TBC1D12-68	0			c.C669G						.	G		1895,863		709,477,193	2.0	3.0	3.0		669	-2.0	0.0	10	dbSNP_100	3	4435,1895		1664,1107,394	yes	coding-synonymous	TBC1D12	NM_015188.1		2373,1584,587	GG,GC,CC		29.9368,31.2908,30.3477		223/776	96163039	6330,2758	1379	3165	4544	SO:0001819	synonymous_variant	23232	exon1			CAGCCCCGCCAGC	AB011180	CCDS41553.1	10q23.33	2013-09-20			ENSG00000108239	ENSG00000108239			29082	protein-coding gene	gene with protein product						9628581	Standard	NM_015188		Approved	KIAA0608	uc001kjr.2	O60347	OTTHUMG00000018794	ENST00000225235.4:c.669C>G	10.37:g.96163039C>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	35	35	NM_015188	0	0	0	1	1	Q5VYA6|Q8WX26|Q8WX59|Q9UG83	Silent	SNP	ENST00000225235.4	37	CCDS41553.1																																																																																			C|0.339;G|0.661		0.751	TBC1D12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049482.2		
TAF5	6877	hgsc.bcm.edu	37	10	105128134	105128134	+	Missense_Mutation	SNP	T	T	G	rs10883859	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr10:105128134T>G	ENST00000369839.3	+	1	411	c.388T>G	c.(388-390)Tcc>Gcc	p.S130A	TAF5_ENST00000351396.4_Missense_Mutation_p.S130A	NM_006951.3	NP_008882.2	Q15542	TAF5_HUMAN	TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 100kDa	130			S -> A (in dbSNP:rs10883859). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:8758937, ECO:0000269|PubMed:9045704, ECO:0000269|Ref.5}.		chromatin modification (GO:0016568)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	protein dimerization activity (GO:0046983)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)	15		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;1.83e-09)|all cancers(201;1.4e-08)|BRCA - Breast invasive adenocarcinoma(275;0.198)		AGTGGCGGGCTCCGGAGCCCC	0.741													T|||	1553	0.310104	0.1952	0.4078	5008	,	,		9029	0.4206		0.329	False		,,,				2504	0.2628				p.S130A		.											.	TAF5-92	0			c.T388G						.	T	ALA/SER	635,2955		63,509,1223	3.0	5.0	4.0		388	1.9	1.0	10	dbSNP_120	4	2122,5176		327,1468,1854	no	missense	TAF5	NM_006951.3	99	390,1977,3077	GG,GT,TT		29.0765,17.688,25.3215	benign	130/801	105128134	2757,8131	1795	3649	5444	SO:0001583	missense	6877	exon1			GCGGGCTCCGGAG	X95525	CCDS7547.1	10q24-q25.2	2013-01-10	2002-08-29	2001-12-07	ENSG00000148835	ENSG00000148835		"""WD repeat domain containing"""	11539	protein-coding gene	gene with protein product		601787	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, D, 100kD"""	TAF2D		8884287, 8942982	Standard	NM_006951		Approved	TAFII100	uc001kwv.3	Q15542	OTTHUMG00000018985	ENST00000369839.3:c.388T>G	10.37:g.105128134T>G	ENSP00000358854:p.Ser130Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	15	9	NM_006951	0	0	0	1	1	A8K5B4|B2RMR0|B7ZKJ6|Q53EM4|Q5SYD5|Q86UZ7|Q9Y4K5	Missense_Mutation	SNP	ENST00000369839.3	37	CCDS7547.1	821	0.3759157509157509	127	0.258130081300813	150	0.4143646408839779	277	0.48426573426573427	267	0.35224274406332456	T	12.78	2.040311	0.35989	0.17688	0.290765	ENSG00000148835	ENST00000369839;ENST00000351396	T;T	0.55930	0.73;0.49	4.45	1.88	0.25563	.	0.435426	0.24978	N	0.034100	T	0.00012	0.0000	N	0.04508	-0.205	0.41867	P	0.009742999999999946	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.46373	-0.9196	9	0.09338	T	0.73	-0.0936	6.2404	0.20787	0.1492:0.0:0.2595:0.5913	rs10883859	130;130	Q15542-2;Q15542	.;TAF5_HUMAN	A	130	ENSP00000358854:S130A;ENSP00000311024:S130A	ENSP00000311024:S130A	S	+	1	0	TAF5	105118124	0.988000	0.35896	1.000000	0.80357	0.948000	0.59901	0.932000	0.28884	0.814000	0.34374	0.459000	0.35465	TCC	T|0.623;G|0.377		0.741	TAF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050144.1		
ZDHHC6	64429	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	114193036	114193036	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr10:114193036C>T	ENST00000369405.3	-	8	1330	c.907G>A	c.(907-909)Gaa>Aaa	p.E303K	ZDHHC6_ENST00000482410.1_5'UTR|ZDHHC6_ENST00000369404.3_Missense_Mutation_p.E299K	NM_022494.1	NP_071939.1	Q9H6R6	ZDHC6_HUMAN	zinc finger, DHHC-type containing 6	303					protein palmitoylation (GO:0018345)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(1)|large_intestine(2)|lung(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	14		Colorectal(252;0.198)		Epithelial(162;0.0291)|all cancers(201;0.117)		TTCAACTGTTCTATCTGTTTG	0.338																																					p.E303K		.											.	ZDHHC6-90	0			c.G907A						.						186.0	190.0	189.0					10																	114193036		2198	4298	6496	SO:0001583	missense	64429	exon8			ACTGTTCTATCTG	AK025605	CCDS7574.1	10q26.11	2008-05-02			ENSG00000023041	ENSG00000023041		"""Zinc fingers, DHHC-type"""	19160	protein-coding gene	gene with protein product							Standard	NM_022494		Approved	ZNF376, FLJ21952	uc001kzv.3	Q9H6R6	OTTHUMG00000019062	ENST00000369405.3:c.907G>A	10.37:g.114193036C>T	ENSP00000358413:p.Glu303Lys	Somatic	22	0		WXS	Illumina GAIIx	Phase_I	21	7	NM_022494	0	0	5	5	0	D3DRB6|Q53G45|Q96IV7|Q9H605	Missense_Mutation	SNP	ENST00000369405.3	37	CCDS7574.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.299855	0.81136	.	.	ENSG00000023041	ENST00000369405;ENST00000369404	T;T	0.70631	0.24;-0.5	5.72	4.8	0.61643	.	0.000000	0.85682	D	0.000000	T	0.76681	0.4021	M	0.87381	2.88	0.80722	D	1	B;B	0.20988	0.008;0.05	B;B	0.24541	0.054;0.039	T	0.76919	-0.2781	10	0.66056	D	0.02	-35.7709	16.9377	0.86207	0.0:0.8721:0.1279:0.0	.	299;303	Q9H6R6-2;Q9H6R6	.;ZDHC6_HUMAN	K	303;299	ENSP00000358413:E303K;ENSP00000358412:E299K	ENSP00000358412:E299K	E	-	1	0	ZDHHC6	114183026	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.286000	0.78671	1.513000	0.48852	0.655000	0.94253	GAA	.		0.338	ZDHHC6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050393.1	NM_022494	
ENO4	387712	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	118639436	118639436	+	Silent	SNP	A	A	C			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr10:118639436A>C	ENST00000409522.1	+	6	766	c.711A>C	c.(709-711)cgA>cgC	p.R237R	ENO4_ENST00000369207.2_Silent_p.R319R|ENO4_ENST00000341276.5_Silent_p.R557R			A6NNW6	ENO4_HUMAN	enolase family member 4	557					glycolytic process (GO:0006096)	phosphopyruvate hydratase complex (GO:0000015)	magnesium ion binding (GO:0000287)|phosphopyruvate hydratase activity (GO:0004634)			lung(1)	1						GTGGTGAACGAGTGACTAAAT	0.488																																					p.R554R		.											.	ENO4-69	0			c.A1662C						.																																			SO:0001819	synonymous_variant	387712	exon13			TGAACGAGTGACT		CCDS73206.1	10q25.3	2012-04-19	2009-12-15	2009-12-15	ENSG00000188316	ENSG00000188316			31670	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 134"""	C10orf134			Standard	NM_001242699		Approved	AC023283.3	uc021pzj.1	A6NNW6	OTTHUMG00000019113	ENST00000409522.1:c.711A>C	10.37:g.118639436A>C		Somatic	205	1		WXS	Illumina GAIIx	Phase_I	254	72	NM_001242699	0	0	1	1	0	B8ZZN9	Silent	SNP	ENST00000409522.1	37																																																																																				.		0.488	ENO4-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000331643.1	NM_001242699	
FANK1	92565	hgsc.bcm.edu	37	10	127585212	127585212	+	Start_Codon_SNP	SNP	A	A	T	rs145156460		TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr10:127585212A>T	ENST00000368693.1	+	1	105	c.1A>T	c.(1-3)Atg>Ttg	p.M1L	FANK1_ENST00000449042.2_De_novo_Start_InFrame|FANK1_ENST00000368695.1_De_novo_Start_InFrame			Q8TC84	FANK1_HUMAN	fibronectin type III and ankyrin repeat domains 1	1						cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.M1L(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(10)|ovary(1)|urinary_tract(1)	21		all_lung(145;0.00752)|Lung NSC(174;0.0115)|Colorectal(57;0.0847)|all_neural(114;0.0936)				GCAGCCGACCATGGAGCCCCA	0.761																																					p.M1L		.											.	FANK1-91	1	Substitution - Missense(1)	central_nervous_system(1)	c.A1T						.						9.0	12.0	11.0					10																	127585212		2172	4263	6435	SO:0001582	initiator_codon_variant	92565	exon1			CCGACCATGGAGC	BC024189	CCDS31309.1	10q26.2	2013-02-11	2005-03-01		ENSG00000203780	ENSG00000203780		"""Ankyrin repeat domain containing"", ""Fibronectin type III domain containing"""	23527	protein-coding gene	gene with protein product		611640	"""fibronectin type 3 and ankyrin repeat domains 1"""			12477932	Standard	NM_145235		Approved		uc001ljh.4	Q8TC84	OTTHUMG00000019241	ENST00000368693.1:c.1A>T	10.37:g.127585212A>T	ENSP00000357682:p.Met1Leu	Somatic	23	0		WXS	Illumina GAIIx	Phase_I	179	10	NM_145235	0	0	0	0	0	Q6UXY9|Q6X7T6	Missense_Mutation	SNP	ENST00000368693.1	37	CCDS31309.1	.	.	.	.	.	.	.	.	.	.	A	7.904	0.735016	0.15574	.	.	ENSG00000203780	ENST00000368693	T	0.36520	1.25	2.62	2.62	0.31277	.	.	.	.	.	T	0.21801	0.0525	.	.	.	0.80722	D	1	B;B	0.06786	0.0;0.001	B;B	0.06405	0.0;0.002	T	0.05886	-1.0858	8	0.25751	T	0.34	.	7.1163	0.25418	1.0:0.0:0.0:0.0	.	1;1	Q8TC84-3;Q8TC84	.;FANK1_HUMAN	L	1	ENSP00000357682:M1L	ENSP00000357682:M1L	M	+	1	0	FANK1	127575202	0.921000	0.31238	0.955000	0.39395	0.220000	0.24768	1.121000	0.31283	1.433000	0.47394	0.379000	0.24179	ATG	.		0.761	FANK1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_145235	Missense_Mutation
KRTAP5-5	439915	broad.mit.edu;bcgsc.ca	37	11	1651116	1651127	+	In_Frame_Del	DEL	GGCCGTGGCTCC	GGCCGTGGCTCC	-	rs66665994		TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr11:1651116_1651127delGGCCGTGGCTCC	ENST00000399676.2	+	1	84_95	c.46_57delGGCCGTGGCTCC	c.(46-57)ggccgtggctccdel	p.GRGS16del		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	16						keratin filament (GO:0045095)		p.R17C(2)|p.R17L(2)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		cggctgtggaggccgtggctccggctgtgggg	0.693																																					p.16_19del		.											.	KRTAP5-5-23	4	Substitution - Missense(4)	ovary(1)|lung(1)|large_intestine(1)|endometrium(1)	c.46_57del						.			60,4170		3,54,2058						-1.5	0.8			32	107,8101		1,105,3998	no	coding	KRTAP5-5	NM_001001480.2		4,159,6056	A1A1,A1R,RR		1.3036,1.4184,1.3427				167,12271				SO:0001651	inframe_deletion	439915	exon1			TGTGGAGGCCGTG	AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	ENST00000399676.2:c.46_57delGGCCGTGGCTCC	11.37:g.1651116_1651127delGGCCGTGGCTCC	ENSP00000382584:p.Gly16_Ser19del	Somatic	152	0		WXS	Illumina GAIIx	Phase_I	288	7	NM_001001480	0	0	0	0	0	A8MWN2	In_Frame_Del	DEL	ENST00000399676.2	37	CCDS41592.1																																																																																			.		0.693	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127919.1		
SYT8	90019	hgsc.bcm.edu	37	11	1858572	1858572	+	Missense_Mutation	SNP	C	C	T	rs2292474	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr11:1858572C>T	ENST00000381968.3	+	9	1245	c.1117C>T	c.(1117-1119)Cgg>Tgg	p.R373W	SYT8_ENST00000341958.3_Missense_Mutation_p.R359W|TNNI2_ENST00000381905.3_5'Flank|SYT8_ENST00000535046.1_3'UTR|TNNI2_ENST00000381911.1_5'Flank|TNNI2_ENST00000252898.7_5'Flank|TNNI2_ENST00000381906.1_5'Flank	NM_138567.3	NP_612634	Q8NBV8	SYT8_HUMAN	synaptotagmin VIII	373					acrosome reaction (GO:0007340)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	transporter activity (GO:0005215)			breast(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	6		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		CATTGCCCAGCGGCACCCCCT	0.731													T|||	1928	0.384984	0.1679	0.415	5008	,	,		13483	0.378		0.498	False		,,,				2504	0.5481				p.R373W		.											.	SYT8-91	0			c.C1117T						.	T	TRP/ARG	906,3442		119,668,1387	12.0	14.0	14.0		1117	2.7	1.0	11	dbSNP_100	14	4072,4398		1026,2020,1189	no	missense	SYT8	NM_138567.3	101	1145,2688,2576	TT,TC,CC		48.0756,20.8372,38.836	benign	373/402	1858572	4978,7840	2174	4235	6409	SO:0001583	missense	90019	exon9			GCCCAGCGGCACC	AL137708	CCDS7726.2	11p15.5	2013-01-21			ENSG00000149043	ENSG00000149043		"""Synaptotagmins"""	19264	protein-coding gene	gene with protein product		607719				7791877	Standard	XM_005253216		Approved	DKFZp434K0322	uc001lue.1	Q8NBV8	OTTHUMG00000009026	ENST00000381968.3:c.1117C>T	11.37:g.1858572C>T	ENSP00000371394:p.Arg373Trp	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	14	9	NM_138567	0	0	0	0	0	A6NFJ4|Q9NSV9	Missense_Mutation	SNP	ENST00000381968.3	37	CCDS7726.2	855|855	0.3914835164835165|0.3914835164835165	84|84	0.17073170731707318|0.17073170731707318	163|163	0.45027624309392267|0.45027624309392267	226|226	0.3951048951048951|0.3951048951048951	382|382	0.503957783641161|0.503957783641161	t|t	1.107|1.107	-0.659353|-0.659353	0.03454|0.03454	0.208372|0.208372	0.480756|0.480756	ENSG00000149043|ENSG00000149043	ENST00000381978|ENST00000381968;ENST00000341958	.|T;T	.|0.03951	.|3.77;3.75	3.85|3.85	2.68|2.68	0.31781|0.31781	.|.	.|.	.|.	.|.	.|.	T|T	0.00012|0.00012	0.0000|0.0000	N|N	0.00005|0.00005	-3.275|-3.275	0.09310|0.09310	P|P	1.0|1.0	.|B;B	.|0.02656	.|0.0;0.0	.|B;B	.|0.01281	.|0.0;0.0	T|T	0.41928|0.41928	-0.9481|-0.9481	4|8	.|0.02654	.|T	.|1	.|.	8.5203|8.5203	0.33270|0.33270	0.0:0.1655:0.0:0.8345|0.0:0.1655:0.0:0.8345	rs2292474|rs2292474	.|373;359	.|Q8NBV8;A6NCR4	.|SYT8_HUMAN;.	V|W	371|373;359	.|ENSP00000371394:R373W;ENSP00000343691:R359W	.|ENSP00000343691:R359W	A|R	+|+	2|1	0|2	SYT8|SYT8	1815148|1815148	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.293000|0.293000	0.27360|0.27360	3.304000|3.304000	0.51866|0.51866	0.174000|0.174000	0.19809|0.19809	-0.665000|-0.665000	0.03846|0.03846	GCG|CGG	C|0.602;T|0.398		0.731	SYT8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000025013.4		
OR51F1	256892	bcgsc.ca	37	11	4790948	4790948	+	Missense_Mutation	SNP	C	C	A	rs11033800	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr11:4790948C>A	ENST00000380383.1	-	1	220	c.221G>T	c.(220-222)aGg>aTg	p.R74M	MMP26_ENST00000477339.1_Intron|OR51F1_ENST00000343430.3_Missense_Mutation_p.R67M|MMP26_ENST00000380390.1_Intron			A6NGY5	O51F1_HUMAN	olfactory receptor, family 51, subfamily F, member 1	74			R -> M (in dbSNP:rs11033800).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(3)|lung(11)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	22		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.0778)		Epithelial(150;5.87e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0045)|LUSC - Lung squamous cell carcinoma(625;0.192)		GGCTGATAGCCTGAAGAGGAA	0.438													A|||	1080	0.215655	0.4569	0.2017	5008	,	,		21734	0.0		0.2704	False		,,,				2504	0.0654				p.R67M		.											.	OR51F1-70	0			c.G200T						.	A	MET/ARG	1967,2435	618.8+/-393.2	444,1079,678	69.0	65.0	66.0		200	3.7	0.7	11	dbSNP_120	66	2179,6417	711.6+/-405.8	291,1597,2410	yes	missense	OR51F1	NM_001004752.1	91	735,2676,3088	AA,AC,CC		25.349,44.6842,31.8972	benign	67/313	4790948	4146,8852	2201	4298	6499	SO:0001583	missense	256892	exon1			GATAGCCTGAAGA	BK004771	CCDS31359.1	11p15.4	2012-08-09		2004-03-10	ENSG00000188069	ENSG00000188069		"""GPCR / Class A : Olfactory receptors"""	15196	protein-coding gene	gene with protein product				OR51F1P			Standard	NM_001004752		Approved		uc010qyl.2	A6NGY5	OTTHUMG00000066503	ENST00000380383.1:c.221G>T	11.37:g.4790948C>A	ENSP00000369744:p.Arg74Met	Somatic	159	1		WXS	Illumina GAIIx	Phase_I	147	6	NM_001004752	0	0	0	0	0		Missense_Mutation	SNP	ENST00000380383.1	37		494	0.2261904761904762	225	0.4573170731707317	82	0.2265193370165746	0	0.0	187	0.24670184696569922	A	0.008	-1.904301	0.00512	0.446842	0.25349	ENSG00000188069	ENST00000343430;ENST00000380383	T;T	0.03035	4.07;4.07	4.81	3.66	0.41972	GPCR, rhodopsin-like superfamily (1);	0.189083	0.36628	N	0.002497	T	0.00012	0.0000	N	0.00000	-3.89	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.41305	-0.9516	9	0.02654	T	1	.	6.5145	0.22240	0.5426:0.3089:0.0:0.1485	rs11033800;rs52809349;rs60993028;rs11033800	74	A6NGY5	O51F1_HUMAN	M	67;74	ENSP00000345163:R67M;ENSP00000369744:R74M	ENSP00000345163:R67M	R	-	2	0	OR51F1	4747524	0.947000	0.32204	0.679000	0.29978	0.608000	0.37181	2.960000	0.49161	0.324000	0.23333	-0.346000	0.07831	AGG	C|0.707;A|0.293		0.438	OR51F1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001004752	
OR51F1	256892	bcgsc.ca	37	11	4790951	4790951	+	Missense_Mutation	SNP	A	A	G	rs11033801	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr11:4790951A>G	ENST00000380383.1	-	1	217	c.218T>C	c.(217-219)tTc>tCc	p.F73S	MMP26_ENST00000477339.1_Intron|OR51F1_ENST00000343430.3_Missense_Mutation_p.F66S|MMP26_ENST00000380390.1_Intron			A6NGY5	O51F1_HUMAN	olfactory receptor, family 51, subfamily F, member 1	73			F -> S (in dbSNP:rs11033801).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(3)|lung(11)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	22		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.0778)		Epithelial(150;5.87e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0045)|LUSC - Lung squamous cell carcinoma(625;0.192)		TGATAGCCTGAAGAGGAAATA	0.443													G|||	1080	0.215655	0.4569	0.2017	5008	,	,		21639	0.0		0.2704	False		,,,				2504	0.0654				p.F66S		.											.	OR51F1-70	0			c.T197C						.	G	SER/PHE	1966,2436	617.7+/-393.0	443,1080,678	67.0	63.0	65.0		197	4.8	1.0	11	dbSNP_120	65	2164,6432	712.0+/-405.9	286,1592,2420	yes	missense	OR51F1	NM_001004752.1	155	729,2672,3098	GG,GA,AA		25.1745,44.6615,31.7741	benign	66/313	4790951	4130,8868	2201	4298	6499	SO:0001583	missense	256892	exon1			AGCCTGAAGAGGA	BK004771	CCDS31359.1	11p15.4	2012-08-09		2004-03-10	ENSG00000188069	ENSG00000188069		"""GPCR / Class A : Olfactory receptors"""	15196	protein-coding gene	gene with protein product				OR51F1P			Standard	NM_001004752		Approved		uc010qyl.2	A6NGY5	OTTHUMG00000066503	ENST00000380383.1:c.218T>C	11.37:g.4790951A>G	ENSP00000369744:p.Phe73Ser	Somatic	155	2		WXS	Illumina GAIIx	Phase_I	146	6	NM_001004752	0	0	0	0	0		Missense_Mutation	SNP	ENST00000380383.1	37		494	0.2261904761904762	225	0.4573170731707317	82	0.2265193370165746	0	0.0	187	0.24670184696569922	G	0.026	-1.367725	0.01225	0.446615	0.251745	ENSG00000188069	ENST00000343430;ENST00000380383	T;T	0.00449	7.37;7.37	4.81	4.81	0.61882	GPCR, rhodopsin-like superfamily (1);	0.133054	0.34580	N	0.003857	T	0.00012	0.0000	N	0.00186	-1.895	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.06643	-1.0815	9	0.02654	T	1	.	7.3933	0.26921	0.0863:0.0:0.7488:0.1649	rs11033801;rs52802475;rs58778978;rs11033801	73	A6NGY5	O51F1_HUMAN	S	66;73	ENSP00000345163:F66S;ENSP00000369744:F73S	ENSP00000345163:F66S	F	-	2	0	OR51F1	4747527	0.352000	0.24895	0.965000	0.40720	0.712000	0.41017	0.483000	0.22292	1.271000	0.44313	-0.197000	0.12766	TTC	A|0.702;G|0.298		0.443	OR51F1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001004752	
AGBL2	79841	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	47712028	47712028	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr11:47712028C>G	ENST00000525123.1	-	10	1516	c.1231G>C	c.(1231-1233)Gca>Cca	p.A411P	AGBL2_ENST00000357610.3_Missense_Mutation_p.A411P|AGBL2_ENST00000298861.4_Missense_Mutation_p.A411P|AGBL2_ENST00000529712.1_5'UTR|AGBL2_ENST00000528244.1_Missense_Mutation_p.A373P	NM_024783.3	NP_079059.2	Q5U5Z8	CBPC2_HUMAN	ATP/GTP binding protein-like 2	411						cytosol (GO:0005829)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|endometrium(5)|kidney(1)|large_intestine(8)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(1)	34						GGGTTGTTTGCCACTGACAGG	0.468																																					p.A411P		.											.	AGBL2-92	0			c.G1231C						.						142.0	122.0	129.0					11																	47712028		2201	4298	6499	SO:0001583	missense	79841	exon10			TGTTTGCCACTGA		CCDS7944.1	11p11.2	2014-06-23			ENSG00000165923	ENSG00000165923			26296	protein-coding gene	gene with protein product	"""cytoplasmic carboxypeptidase 2"""					12738998, 21303978	Standard	NM_024783		Approved	FLJ23598, CCP2	uc001ngg.3	Q5U5Z8	OTTHUMG00000165368	ENST00000525123.1:c.1231G>C	11.37:g.47712028C>G	ENSP00000435582:p.Ala411Pro	Somatic	207	1		WXS	Illumina GAIIx	Phase_I	157	20	NM_024783	0	0	0	0	0	A8MPX2|Q53FV5|Q8IV57|Q9H5C0	Missense_Mutation	SNP	ENST00000525123.1	37	CCDS7944.1	.	.	.	.	.	.	.	.	.	.	C	16.41	3.114555	0.56505	.	.	ENSG00000165923	ENST00000525123;ENST00000357610;ENST00000298861;ENST00000528244	T;T;T;T	0.37411	1.2;1.2;1.2;1.2	5.57	4.66	0.58398	.	0.328645	0.37053	N	0.002270	T	0.52996	0.1769	M	0.65975	2.015	0.09310	N	0.999994	D;P;B	0.63880	0.993;0.621;0.153	D;P;B	0.64042	0.921;0.474;0.27	T	0.46775	-0.9167	9	.	.	.	-4.109	10.9393	0.47264	0.0:0.8566:0.0:0.1434	.	373;373;411	F6U0I4;B4DZS1;Q5U5Z8	.;.;CBPC2_HUMAN	P	411;411;411;373	ENSP00000435582:A411P;ENSP00000350228:A411P;ENSP00000298861:A411P;ENSP00000436630:A373P	.	A	-	1	0	AGBL2	47668604	0.000000	0.05858	0.896000	0.35187	0.999000	0.98932	-0.834000	0.04391	1.502000	0.48669	0.655000	0.94253	GCA	.		0.468	AGBL2-001	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000383726.2	NM_024783	
OR5M11	219487	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	56310464	56310464	+	Silent	SNP	G	G	T			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr11:56310464G>T	ENST00000528616.2	-	1	293	c.270C>A	c.(268-270)acC>acA	p.T90T		NM_001005245.1	NP_001005245.1	Q96RB7	OR5MB_HUMAN	olfactory receptor, family 5, subfamily M, member 11	90						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(14)	18						CAAAGGAAATGGTCTTCTCAG	0.448																																					p.T90T		.											.	.	0			c.C270A						.						100.0	101.0	101.0					11																	56310464		2167	4281	6448	SO:0001819	synonymous_variant	219487	exon1			GGAAATGGTCTTC	AP002517	CCDS53629.1	11q11	2012-08-09				ENSG00000255223		"""GPCR / Class A : Olfactory receptors"""	15291	protein-coding gene	gene with protein product							Standard	NM_001005245		Approved	OR11-199	uc010rjl.2	Q96RB7		ENST00000528616.2:c.270C>A	11.37:g.56310464G>T		Somatic	203	0		WXS	Illumina GAIIx	Phase_I	153	44	NM_001005245	0	0	0	0	0	B2RNL5|B2RNL7	Silent	SNP	ENST00000528616.2	37	CCDS53629.1																																																																																			.		0.448	OR5M11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391608.1	NM_001005245	
LRRC10B	390205	hgsc.bcm.edu	37	11	61277031	61277031	+	Silent	SNP	C	C	T	rs1139011	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr11:61277031C>T	ENST00000378075.2	+	1	760	c.561C>T	c.(559-561)ctC>ctT	p.L187L	MIR4488_ENST00000577388.1_RNA	NM_001145077.1	NP_001138549.1	A6NIK2	LR10B_HUMAN	leucine rich repeat containing 10B	187																	TGCACATCCTCGACCTCGACC	0.731													c|||	986	0.196885	0.0068	0.2637	5008	,	,		12936	0.4474		0.0636	False		,,,				2504	0.2853				p.L187L		.											.	.	0			c.C561T						.						5.0	7.0	6.0					11																	61277031		659	1526	2185	SO:0001819	synonymous_variant	390205	exon1			CATCCTCGACCTC		CCDS44621.1	11q12.2	2009-09-08			ENSG00000204950	ENSG00000204950			37215	protein-coding gene	gene with protein product							Standard	NM_001145077		Approved		uc010rlk.2	A6NIK2		ENST00000378075.2:c.561C>T	11.37:g.61277031C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	16	14	NM_001145077	0	0	0	0	0		Silent	SNP	ENST00000378075.2	37	CCDS44621.1																																																																																			C|0.816;T|0.184		0.731	LRRC10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398623.1	NM_001145077	
CST6	1474	hgsc.bcm.edu	37	11	65779590	65779590	+	Silent	SNP	C	C	T	rs1131544	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr11:65779590C>T	ENST00000312134.2	+	1	279	c.75C>T	c.(73-75)gaC>gaT	p.D25D		NM_001323.3	NP_001314.1	Q15828	CYTM_HUMAN	cystatin E/M	25					anatomical structure morphogenesis (GO:0009653)|epidermis development (GO:0008544)|negative regulation of endopeptidase activity (GO:0010951)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)	cysteine-type endopeptidase inhibitor activity (GO:0004869)			large_intestine(1)|lung(1)|ovary(1)	3						TGCCACGCGACGCCCGGGCCC	0.746													C|||	356	0.0710863	0.0219	0.0922	5008	,	,		12347	0.001		0.162	False		,,,				2504	0.1012				p.D25D		.											.	CST6-523	0			c.C75T						.	C		164,3936		5,154,1891	5.0	6.0	5.0		75	-4.6	0.0	11	dbSNP_86	5	1227,6867		88,1051,2908	no	coding-synonymous	CST6	NM_001323.3		93,1205,4799	TT,TC,CC		15.1594,4.0,11.4072		25/150	65779590	1391,10803	2050	4047	6097	SO:0001819	synonymous_variant	1474	exon1			ACGCGACGCCCGG	U62800	CCDS8126.1	11q13	2005-09-29			ENSG00000175315	ENSG00000175315			2478	protein-coding gene	gene with protein product		601891				9154125, 9099741	Standard	NM_001323		Approved		uc001ogr.3	Q15828	OTTHUMG00000166750	ENST00000312134.2:c.75C>T	11.37:g.65779590C>T		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	11	11	NM_001323	0	0	0	0	0	Q540N7	Silent	SNP	ENST00000312134.2	37	CCDS8126.1																																																																																			C|0.921;T|0.079		0.746	CST6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391348.1	NM_001323	
GAL3ST3	89792	hgsc.bcm.edu	37	11	65810209	65810209	+	Silent	SNP	C	C	T	rs61895584	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr11:65810209C>T	ENST00000312006.4	-	3	1346	c.1065G>A	c.(1063-1065)ccG>ccA	p.P355P	GAL3ST3_ENST00000527878.1_Silent_p.P355P	NM_033036.2	NP_149025.1	Q96A11	G3ST3_HUMAN	galactose-3-O-sulfotransferase 3	355					monosaccharide metabolic process (GO:0005996)|oligosaccharide metabolic process (GO:0009311)|poly-N-acetyllactosamine metabolic process (GO:0030309)|proteoglycan biosynthetic process (GO:0030166)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|carbohydrate binding (GO:0030246)|galactose 3-O-sulfotransferase activity (GO:0050694)|galactosylceramide sulfotransferase activity (GO:0001733)|proteoglycan sulfotransferase activity (GO:0050698)			kidney(1)|lung(9)|ovary(2)|skin(2)	14						TGGGCTGCCACGGCTGCAGCT	0.741													C|||	3763	0.751398	0.5408	0.8746	5008	,	,		7225	0.7649		0.8549	False		,,,				2504	0.8282				p.P355P		.											.	GAL3ST3-91	0			c.G1065A						.	C		1752,666		619,514,76	3.0	2.0	2.0		1065	-9.2	0.7	11	dbSNP_129	2	4565,363		2119,327,18	no	coding-synonymous	GAL3ST3	NM_033036.2		2738,841,94	TT,TC,CC		7.3661,27.5434,14.0076		355/432	65810209	6317,1029	1209	2464	3673	SO:0001819	synonymous_variant	89792	exon3			CTGCCACGGCTGC	AY026481	CCDS8128.1	11q13.1	2014-08-12			ENSG00000175229	ENSG00000175229		"""Sulfotransferases, membrane-bound"""	24144	protein-coding gene	gene with protein product		608234				11323440, 11356829	Standard	NM_033036		Approved	GAL3ST2	uc001ogw.3	Q96A11	OTTHUMG00000166667	ENST00000312006.4:c.1065G>A	11.37:g.65810209C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	9	NM_033036	0	0	0	0	0	Q14D05	Silent	SNP	ENST00000312006.4	37	CCDS8128.1																																																																																			C|0.233;T|0.767		0.741	GAL3ST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391052.1	NM_033036	
PACS1	55690	broad.mit.edu	37	11	65988664	65988664	+	Silent	SNP	G	G	A	rs149576765		TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr11:65988664G>A	ENST00000320580.4	+	10	1272	c.1239G>A	c.(1237-1239)acG>acA	p.T413T		NM_018026.3	NP_060496.2	Q6VY07	PACS1_HUMAN	phosphofurin acidic cluster sorting protein 1	413					protein targeting to Golgi (GO:0000042)|protein targeting to plasma membrane (GO:0072661)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	COPI-coated vesicle (GO:0030137)|cytosol (GO:0005829)	ion channel binding (GO:0044325)		RBM14/PACS1(2)	breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(8)|ovary(6)|skin(2)|urinary_tract(1)	37						GCTCCCAGACGGAGATTGGCA	0.627																																					p.T413T		.											.	PACS1-74	0			c.G1239A						.	G		1,4401	2.1+/-5.4	0,1,2200	113.0	95.0	101.0		1239	2.4	1.0	11	dbSNP_134	101	0,8590		0,0,4295	no	coding-synonymous	PACS1	NM_018026.2		0,1,6495	AA,AG,GG		0.0,0.0227,0.0077		413/964	65988664	1,12991	2201	4295	6496	SO:0001819	synonymous_variant	55690	exon10			CCAGACGGAGATT	AB033001	CCDS8129.1	11q13.1-q13.2	2008-02-05			ENSG00000175115	ENSG00000175115			30032	protein-coding gene	gene with protein product		607492				12855553, 14608369	Standard	NM_018026		Approved	FLJ10209, KIAA1175	uc001oha.2	Q6VY07	OTTHUMG00000166889	ENST00000320580.4:c.1239G>A	11.37:g.65988664G>A		Somatic	356	1		WXS	Illumina GAIIx	Phase_I	360	7	NM_018026	0	0	15	15	0	Q6PJY6|Q6PKB6|Q7Z590|Q7Z5W4|Q8N8K6|Q96MW0|Q9NW92|Q9ULP5	Silent	SNP	ENST00000320580.4	37	CCDS8129.1																																																																																			G|1.000;A|0.000		0.627	PACS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391690.2	NM_018026	
FAM86C1	55199	hgsc.bcm.edu	37	11	71498671	71498671	+	Missense_Mutation	SNP	G	G	C	rs12283346	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr11:71498671G>C	ENST00000359244.4	+	1	112	c.89G>C	c.(88-90)cGc>cCc	p.R30P	FAM86C1_ENST00000346333.6_Missense_Mutation_p.R30P|FAM86C1_ENST00000426628.2_Missense_Mutation_p.R30P	NM_018172.2	NP_060642.2	Q9NVL1	FA86C_HUMAN	family with sequence similarity 86, member C1	30			R -> P (in dbSNP:rs12283346). {ECO:0000269|PubMed:14702039}.							lung(1)	1						CGCTCCTTCCGCTGGCAGGTG	0.741													.|||	2261	0.451478	0.3351	0.3516	5008	,	,		10448	0.3452		0.5666	False		,,,				2504	0.6708				p.R30P		.											.	FAM86C1-90	0			c.G89C						.						3.0	3.0	3.0					11																	71498671		1774	3427	5201	SO:0001583	missense	55199	exon1			CCTTCCGCTGGCA	AK130709	CCDS8202.1, CCDS41686.1, CCDS44664.1	11q13.4	2011-07-07	2011-07-07	2011-07-07	ENSG00000158483	ENSG00000158483			25561	protein-coding gene	gene with protein product			"""family with sequence similarity 86, member C"""	FAM86C		12477932	Standard	NM_152563		Approved	FLJ10661, FLJ27199	uc001oqv.4	Q9NVL1	OTTHUMG00000160552	ENST00000359244.4:c.89G>C	11.37:g.71498671G>C	ENSP00000352182:p.Arg30Pro	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	21	6	NM_152563	0	0	0	0	0	Q8N5D3	Missense_Mutation	SNP	ENST00000359244.4	37	CCDS41686.1	871	0.39880952380952384	166	0.33739837398373984	136	0.3756906077348066	173	0.30244755244755245	396	0.5224274406332454	.	1.506	-0.550640	0.03996	.	.	ENSG00000158483	ENST00000346333;ENST00000359244;ENST00000426628;ENST00000528685	T;T;T;T	0.08634	3.07;3.07;3.07;3.07	2.47	2.47	0.30058	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.58432	P	4.000000000004E-6	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.44483	-0.9325	7	0.02654	T	1	.	7.3824	0.26864	0.0:0.7256:0.2744:0.0	rs12283346	30;30;30	G3V0F7;Q9NVL1-2;Q9NVL1	.;.;FA86C_HUMAN	P	30	ENSP00000325662:R30P;ENSP00000352182:R30P;ENSP00000391329:R30P;ENSP00000436598:R30P	ENSP00000325662:R30P	R	+	2	0	FAM86C1	71176319	0.633000	0.27181	0.784000	0.31847	0.041000	0.13682	0.888000	0.28268	0.155000	0.19261	-1.123000	0.02005	CGC	G|0.601;C|0.399		0.741	FAM86C1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000361120.1	NM_152563	
B3GNT6	192134	hgsc.bcm.edu	37	11	76751542	76751542	+	Frame_Shift_Del	DEL	T	T	-	rs11292198		TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr11:76751542delT	ENST00000533140.1	+	2	1085	c.947delT	c.(946-948)cttfs	p.L316fs	B3GNT6_ENST00000354301.5_Splice_Site_p.L316fs|B3GNT6_ENST00000421061.1_Intron			O43505	B3GN1_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (core 3 synthase)	0					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|poly-N-acetyllactosamine biosynthetic process (GO:0030311)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	N-acetyllactosaminide beta-1,3-N-acetylglucosaminyltransferase activity (GO:0008532)			central_nervous_system(1)|kidney(2)|lung(4)|prostate(1)	8						GGCATGTGTCTTGGAGCGCGC	0.741													T|TT|T|insertion	5008	1.0	1.0	1.0	5008	,	,		12582	1.0		1.0	False		,,,				2504	1.0				.		.											.	.	0			c.946+1T>-						.						1.0	1.0	1.0					11																	76751542		431	917	1348	SO:0001589	frameshift_variant	192134	exon2			TGTGTCTTGGAGC	AB073740	CCDS53681.1	11q13.4	2013-02-19			ENSG00000198488	ENSG00000198488		"""Beta 3-glycosyltransferases"""	24141	protein-coding gene	gene with protein product		615315				11821425	Standard	NM_138706		Approved	B3Gn-T6	uc021qnp.1	Q6ZMB0		ENST00000533140.1:c.947delT	11.37:g.76751542delT	ENSP00000435352:p.Leu316fs	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	11	10	NM_138706	0	0	0	0	0	Q4TTN0	Splice_Site	DEL	ENST00000533140.1	37	CCDS53681.1																																																																																			.		0.741	B3GNT6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000382740.2	NM_138706	
KIAA1731	85459	broad.mit.edu;ucsc.edu	37	11	93462779	93462779	+	Splice_Site	SNP	G	G	A			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr11:93462779G>A	ENST00000325212.6	+	27	7561		c.e27-1		SNORA25_ENST00000384384.1_RNA|SNORA8_ENST00000384574.1_RNA|SNORD6_ENST00000365444.1_RNA|SNORA32_ENST00000384072.1_RNA|KIAA1731_ENST00000344196.4_Splice_Site|KIAA1731_ENST00000531700.1_Splice_Site|SNORA1_ENST00000384107.1_RNA|TAF1D_ENST00000546088.1_5'Flank|KIAA1731_ENST00000411936.1_Missense_Mutation_p.E2468K			Q9C0D2	K1731_HUMAN	KIAA1731							centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)	11		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				TCCCCCAGCAGAAACCCCTCG	0.443																																					.		.											.	KIAA1731-22	0			c.7400-1G>A						.						33.0	28.0	29.0					11																	93462779		692	1591	2283	SO:0001630	splice_region_variant	85459	exon27			CCAGCAGAAACCC	AB051518	CCDS44708.1	11q21	2014-03-11			ENSG00000166004	ENSG00000166004			29366	protein-coding gene	gene with protein product						20844083	Standard	NM_033395		Approved		uc009ywb.1	Q9C0D2	OTTHUMG00000167449	ENST00000325212.6:c.7400-1G>A	11.37:g.93462779G>A		Somatic	22	0		WXS	Illumina GAIIx	Phase_I	13	3	NM_033395	0	0	0	2	2	C9J5H9|C9JQY8|Q8N7L4|Q8N919|Q8N9B0|Q96LT8	Splice_Site	SNP	ENST00000325212.6	37	CCDS44708.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.861|8.861	0.946900|0.946900	0.18356|0.18356	.|.	.|.	ENSG00000166004|ENSG00000166004	ENST00000325212;ENST00000344196;ENST00000531700|ENST00000411936;ENST00000531404	.|T	.|0.09445	.|2.98	3.14|3.14	3.14|3.14	0.36123|0.36123	.|.	.|.	.|.	.|.	.|.	.|T	.|0.08626	.|0.0214	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|B	.|0.25809	.|0.135	.|B	.|0.30251	.|0.113	.|T	.|0.23013	.|-1.0200	.|8	.|0.26408	.|T	.|0.33	.|.	10.037|10.037	0.42135|0.42135	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|2468	.|Q9C0D2-3	.|.	.|K	-1|2468;480	.|ENSP00000406505:E2468K	.|ENSP00000406505:E2468K	.|E	+|+	.|1	.|0	KIAA1731|KIAA1731	93102427|93102427	0.047000|0.047000	0.20315|0.20315	0.180000|0.180000	0.23079|0.23079	0.005000|0.005000	0.04900|0.04900	1.739000|1.739000	0.38217|0.38217	2.063000|2.063000	0.61619|0.61619	0.591000|0.591000	0.81541|0.81541	.|GAA	.		0.443	KIAA1731-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000394640.1	NM_033395	Intron
ATM	472	broad.mit.edu	37	11	108124536	108124540	+	Splice_Site	DEL	TGAAG	TGAAG	-			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr11:108124536_108124540delTGAAG	ENST00000452508.2	+	14	2087		c.e14-1		ATM_ENST00000278616.4_Splice_Site			Q13315	ATM_HUMAN	ATM serine/threonine kinase						brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	CTTACTTTCTTGAAGTGAACACCAC	0.298			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																											.		.	yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	.	ATM-3419	0			.	GRCh37	CS014124	ATM	S		.																																			SO:0001630	splice_region_variant	472	.	Familial Cancer Database	AT, Louis-Bar syndrome	CTTTCTTGAAGTG	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.1899-1TGAAG>-	11.37:g.108124536_108124540delTGAAG		Somatic	21	0		WXS	Illumina GAIIx	Phase_I	13	5	.	0	0	0	0	0	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Splice_Site	DEL	ENST00000452508.2	37	CCDS31669.1																																																																																			.		0.298	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389938.1	NM_000051	Intron
CADM1	23705	hgsc.bcm.edu	37	11	115375100	115375100	+	Missense_Mutation	SNP	C	C	G	rs112835318	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr11:115375100C>G	ENST00000452722.3	-	1	33	c.13G>C	c.(13-15)Gtg>Ctg	p.V5L	CADM1_ENST00000536727.1_Missense_Mutation_p.V5L|CADM1_ENST00000537140.1_5'UTR|CADM1_ENST00000537058.1_Missense_Mutation_p.V5L|CADM1_ENST00000542447.2_Missense_Mutation_p.V5L|CADM1_ENST00000331581.6_Missense_Mutation_p.V5L	NM_014333.3	NP_055148.3			cell adhesion molecule 1											cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(9)|ovary(2)|skin(1)	32	all_hematologic(175;0.0628)	all_cancers(61;2.98e-14)|all_epithelial(67;2.64e-08)|all_hematologic(158;0.000154)|Melanoma(852;0.000952)|Acute lymphoblastic leukemia(157;0.00101)|Breast(348;0.0102)|Medulloblastoma(222;0.0429)|Prostate(24;0.145)|all_neural(223;0.237)		BRCA - Breast invasive adenocarcinoma(274;5.01e-06)|Epithelial(105;0.000305)|all cancers(92;0.00303)		CTCGGCAGCACTACACTCGCC	0.697													C|||	86	0.0171725	0.0008	0.0317	5008	,	,		11122	0.0		0.0467	False		,,,				2504	0.0164				p.V5L		.											.	CADM1-92	0			c.G13C						.	C	LEU/VAL,LEU/VAL	33,3259		0,33,1613	3.0	5.0	4.0		13,13	5.6	1.0	11	dbSNP_132	4	281,6137		4,273,2932	yes	missense,missense	CADM1	NM_014333.3,NM_001098517.1	32,32	4,306,4545	GG,GC,CC		4.3783,1.0024,3.2338	benign,benign	5/443,5/415	115375100	314,9396	1646	3209	4855	SO:0001583	missense	23705	exon1			GCAGCACTACACT	AB017563	CCDS8373.1, CCDS53711.1, CCDS73397.1, CCDS73398.1, CCDS73399.1	11q23.2	2013-01-29	2007-02-07	2007-02-07	ENSG00000182985	ENSG00000182985		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5951	protein-coding gene	gene with protein product	"""nectin-like 2"""	605686	"""tumor suppressor in lung cancer 1"", ""immunoglobulin superfamily, member 4"""	TSLC1, IGSF4		10610705	Standard	NM_014333		Approved	NECL2, ST17, BL2, SYNCAM, IGSF4A, Necl-2, SYNCAM1, RA175	uc001ppi.4	Q9BY67	OTTHUMG00000168202	ENST00000452722.3:c.13G>C	11.37:g.115375100C>G	ENSP00000395359:p.Val5Leu	Somatic	4	0		WXS	Illumina GAIIx	Phase_I	21	17	NM_014333	0	0	21	63	42		Missense_Mutation	SNP	ENST00000452722.3	37	CCDS8373.1	48|48	0.02197802197802198|0.02197802197802198	3|3	0.006097560975609756|0.006097560975609756	14|14	0.03867403314917127|0.03867403314917127	0|0	0.0|0.0	31|31	0.040897097625329816|0.040897097625329816	C|C	16.95|16.95	3.262612|3.262612	0.59431|0.59431	0.010024|0.010024	0.043783|0.043783	ENSG00000182985|ENSG00000182985	ENST00000545380|ENST00000542447;ENST00000452722;ENST00000537058;ENST00000536727;ENST00000331581	.|T;T;T;T;T	.|0.69806	.|-0.43;0.14;0.37;0.04;0.15	5.57|5.57	5.57|5.57	0.84162|0.84162	.|.	.|0.000000	.|0.41001	.|D	.|0.000979	T|T	0.15089|0.15089	0.0364|0.0364	N|N	0.08118|0.08118	0|0	0.27334|0.27334	N|N	0.95671|0.95671	.|B;P;B;B;B	.|0.36354	.|0.165;0.549;0.414;0.414;0.414	.|B;B;B;B;B	.|0.28232	.|0.019;0.087;0.04;0.04;0.027	T|T	0.26608|0.26608	-1.0098|-1.0098	5|10	.|0.45353	.|T	.|0.12	.|.	15.0429|15.0429	0.71805|0.71805	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|5;5;6;5;5	.|Q9BY67-2;F5H0J4;A4FVB5;Q9BY67;A0A4Z1	.|.;.;.;CADM1_HUMAN;.	T|L	3|5	.|ENSP00000439176:V5L;ENSP00000395359:V5L;ENSP00000439817:V5L;ENSP00000440322:V5L;ENSP00000329797:V5L	.|ENSP00000329797:V5L	S|V	-|-	2|1	0|0	CADM1|CADM1	114880310|114880310	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.989000|0.989000	0.77384|0.77384	3.464000|3.464000	0.53057|0.53057	2.610000|2.610000	0.88304|0.88304	0.561000|0.561000	0.74099|0.74099	AGT|GTG	C|0.978;G|0.022		0.697	CADM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000398753.2	NM_014333	
NECAP1	25977	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	8242868	8242868	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr12:8242868T>G	ENST00000339754.5	+	3	352	c.274T>G	c.(274-276)Ttt>Gtt	p.F92V		NM_015509.3	NP_056324.2	Q8NC96	NECP1_HUMAN	NECAP endocytosis associated 1	92					endocytosis (GO:0006897)|protein transport (GO:0015031)	clathrin vesicle coat (GO:0030125)|coated pit (GO:0005905)|plasma membrane (GO:0005886)				cervix(1)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10				Kidney(36;0.0915)		TAGCCGCTACTTTGTAATCCG	0.458																																					p.F92V		.											.	NECAP1-91	0			c.T274G						.						97.0	94.0	95.0					12																	8242868		2203	4300	6503	SO:0001583	missense	25977	exon3			CGCTACTTTGTAA	AK074923	CCDS8589.1	12p13.31	2012-05-02			ENSG00000089818	ENSG00000089818			24539	protein-coding gene	gene with protein product		611623				14555962, 15494011	Standard	NM_015509		Approved	DKFZP566B183	uc001qtx.2	Q8NC96	OTTHUMG00000168568	ENST00000339754.5:c.274T>G	12.37:g.8242868T>G	ENSP00000341737:p.Phe92Val	Somatic	203	0		WXS	Illumina GAIIx	Phase_I	260	75	NM_015509	0	0	44	52	8	Q2NL73|Q5XG95|Q6NWY6|Q8N153|Q8NCB0|Q9BU52|Q9Y407	Missense_Mutation	SNP	ENST00000339754.5	37	CCDS8589.1	.	.	.	.	.	.	.	.	.	.	T	24.9	4.576859	0.86645	.	.	ENSG00000089818	ENST00000545179;ENST00000339754	T	0.62941	-0.01	4.62	4.62	0.57501	.	0.000000	0.85682	D	0.000000	D	0.84397	0.5463	H	0.96333	3.805	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.88715	0.3225	10	0.87932	D	0	.	12.3088	0.54918	0.0:0.0:0.0:1.0	.	92	Q8NC96	NECP1_HUMAN	V	92	ENSP00000341737:F92V	ENSP00000341737:F92V	F	+	1	0	NECAP1	8134135	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.043000	0.76572	2.059000	0.61396	0.533000	0.62120	TTT	.		0.458	NECAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400244.1	NM_015509	
GPR19	2842	broad.mit.edu;bcgsc.ca	37	12	12815088	12815088	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr12:12815088T>C	ENST00000540510.1	-	2	487	c.295A>G	c.(295-297)Acc>Gcc	p.T99A	GPR19_ENST00000332427.2_Missense_Mutation_p.T99A			P46093	GPR4_HUMAN	G protein-coupled receptor 19	51					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	17		Prostate(47;0.0802)		BRCA - Breast invasive adenocarcinoma(232;0.048)		TAGTTGGTGGTAGACTGAGTC	0.517																																					p.T99A		.											.	GPR19-91	0			c.A295G						.						141.0	128.0	133.0					12																	12815088		2203	4300	6503	SO:0001583	missense	2842	exon4			TGGTGGTAGACTG		CCDS8652.1	12p12.3	2014-01-30				ENSG00000183150		"""GPCR / Class A : Orphans"""	4473	protein-coding gene	gene with protein product		602927					Standard	NM_006143		Approved		uc001raq.2	Q15760		ENST00000540510.1:c.295A>G	12.37:g.12815088T>C	ENSP00000441832:p.Thr99Ala	Somatic	271	0		WXS	Illumina GAIIx	Phase_I	376	17	NM_006143	0	0	1	1	0	A8K3T3|B0M0K1|Q6NWM4	Missense_Mutation	SNP	ENST00000540510.1	37	CCDS8652.1	.	.	.	.	.	.	.	.	.	.	T	17.56	3.421254	0.62622	.	.	ENSG00000183150	ENST00000540510;ENST00000332427	T;T	0.36520	1.25;1.25	5.28	5.28	0.74379	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.49592	0.1566	L	0.33093	0.98	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	T	0.51036	-0.8756	10	0.62326	D	0.03	-32.1776	15.0478	0.71841	0.0:0.0:0.0:1.0	.	99	Q15760	GPR19_HUMAN	A	99	ENSP00000441832:T99A;ENSP00000333744:T99A	ENSP00000333744:T99A	T	-	1	0	GPR19	12706355	1.000000	0.71417	1.000000	0.80357	0.801000	0.45260	7.669000	0.83911	2.216000	0.71823	0.533000	0.62120	ACC	.		0.517	GPR19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400662.1	NM_006143	
PIK3C2G	5288	broad.mit.edu	37	12	18641552	18641552	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr12:18641552C>T	ENST00000266497.5	+	17	2589	c.2551C>T	c.(2551-2553)Cat>Tat	p.H851Y	PIK3C2G_ENST00000538779.1_Missense_Mutation_p.H892Y|PIK3C2G_ENST00000433979.1_Missense_Mutation_p.H851Y			O75747	P3C2G_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 gamma	851					chemotaxis (GO:0006935)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol phosphate kinase activity (GO:0016307)			breast(5)|central_nervous_system(6)|endometrium(2)|kidney(4)|large_intestine(8)|lung(31)|ovary(2)|prostate(1)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	66		Hepatocellular(102;0.194)				TGCCAGTGACCATCAAAGACA	0.338																																					p.H851Y		.											.	PIK3C2G-1312	0			c.C2551T						.						58.0	56.0	57.0					12																	18641552		1820	4085	5905	SO:0001583	missense	5288	exon18			AGTGACCATCAAA	AJ000008	CCDS44839.1, CCDS73452.1	12p12	2012-07-13	2012-07-13		ENSG00000139144	ENSG00000139144	2.7.1.154		8973	protein-coding gene	gene with protein product		609001	"""phosphoinositide-3-kinase, class 2, gamma polypeptide"""			9878262	Standard	XM_005253393		Approved		uc001rdt.3	O75747	OTTHUMG00000168841	ENST00000266497.5:c.2551C>T	12.37:g.18641552C>T	ENSP00000266497:p.His851Tyr	Somatic	38	0		WXS	Illumina GAIIx	Phase_I	38	5	NM_004570	0	0	0	0	0	A1L3U0	Missense_Mutation	SNP	ENST00000266497.5	37	CCDS44839.1	.	.	.	.	.	.	.	.	.	.	C	10.90	1.481800	0.26598	.	.	ENSG00000139144	ENST00000433979;ENST00000266497;ENST00000538779	T;T;T	0.80824	-1.42;-1.42;-1.42	4.34	1.52	0.23074	Protein kinase-like domain (1);	0.555807	0.18581	N	0.137031	T	0.59418	0.2192	N	0.08118	0	0.22213	N	0.999282	B;B;B	0.33171	0.279;0.4;0.279	B;B;B	0.34346	0.087;0.18;0.087	T	0.53669	-0.8406	10	0.56958	D	0.05	-1.6016	5.3893	0.16236	0.0:0.4848:0.2752:0.24	.	891;892;851	B7ZLY6;F5H369;O75747	.;.;P3C2G_HUMAN	Y	851;851;892	ENSP00000404845:H851Y;ENSP00000266497:H851Y;ENSP00000445381:H892Y	ENSP00000266497:H851Y	H	+	1	0	PIK3C2G	18532819	0.000000	0.05858	0.998000	0.56505	0.995000	0.86356	-1.016000	0.03633	0.357000	0.24183	0.650000	0.86243	CAT	.		0.338	PIK3C2G-002	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401316.1	NM_004570	
XPOT	11260	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	12	64813853	64813853	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr12:64813853G>A	ENST00000332707.5	+	7	1022	c.493G>A	c.(493-495)Gct>Act	p.A165T		NM_007235.4	NP_009166.2	O43592	XPOT_HUMAN	exportin, tRNA	165	Necessary for interaction with Ran, nuclear localization and nuclear import.				intracellular protein transport (GO:0006886)|tRNA export from nucleus (GO:0006409)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	tRNA binding (GO:0000049)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(7)|lung(12)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45				GBM - Glioblastoma multiforme(28;0.0404)		ATTTTAGGAGGCTCGTAGGAA	0.333																																					p.A165T		.											.	XPOT-652	0			c.G493A						.						62.0	61.0	61.0					12																	64813853		2203	4300	6503	SO:0001583	missense	11260	exon7			TAGGAGGCTCGTA	AF039022	CCDS31852.1	12q14.1	2012-10-17	2012-10-17		ENSG00000184575	ENSG00000184575		"""Exportins"""	12826	protein-coding gene	gene with protein product		603180	"""exportin, tRNA (nuclear export receptor for tRNAs)"""			9660920, 9512417	Standard	NM_007235		Approved	XPO3	uc001ssb.3	O43592	OTTHUMG00000168794	ENST00000332707.5:c.493G>A	12.37:g.64813853G>A	ENSP00000327821:p.Ala165Thr	Somatic	24	0		WXS	Illumina GAIIx	Phase_I	175	19	NM_007235	0	0	0	0	0	A6NLH1|O43784|Q8WUG2|Q9BVS7	Missense_Mutation	SNP	ENST00000332707.5	37	CCDS31852.1	.	.	.	.	.	.	.	.	.	.	G	16.20	3.057313	0.55325	.	.	ENSG00000184575	ENST00000332707;ENST00000400935	T;T	0.42900	0.96;0.96	4.79	4.79	0.61399	Exportin-1/Importin-beta-like (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.153219	0.64402	D	0.000017	T	0.31606	0.0802	N	0.21282	0.65	0.44162	D	0.996966	B	0.02656	0.0	B	0.10450	0.005	T	0.07385	-1.0775	9	.	.	.	.	18.7197	0.91688	0.0:0.0:1.0:0.0	.	165	O43592	XPOT_HUMAN	T	165	ENSP00000327821:A165T;ENSP00000383722:A165T	.	A	+	1	0	XPOT	63100120	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.120000	0.71596	2.593000	0.87608	0.655000	0.94253	GCT	.		0.333	XPOT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401122.1	NM_007235	
PTPN11	5781	bcgsc.ca	37	12	112940034	112940034	+	Silent	SNP	T	T	C			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr12:112940034T>C	ENST00000351677.2	+	14	1884	c.1686T>C	c.(1684-1686)ccT>ccC	p.P562P		NM_002834.3	NP_002825.3	Q06124	PTN11_HUMAN	protein tyrosine phosphatase, non-receptor type 11	566					abortive mitotic cell cycle (GO:0033277)|activation of MAPK activity (GO:0000187)|atrioventricular canal development (GO:0036302)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage checkpoint (GO:0000077)|ephrin receptor signaling pathway (GO:0048013)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|face morphogenesis (GO:0060325)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|genitalia development (GO:0048806)|glucose homeostasis (GO:0042593)|heart development (GO:0007507)|hormone metabolic process (GO:0042445)|hormone-mediated signaling pathway (GO:0009755)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|insulin receptor signaling pathway (GO:0008286)|integrin-mediated signaling pathway (GO:0007229)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte migration (GO:0050900)|megakaryocyte development (GO:0035855)|multicellular organismal reproductive process (GO:0048609)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cortisol secretion (GO:0051463)|negative regulation of growth hormone secretion (GO:0060125)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ growth (GO:0035265)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet formation (GO:0030220)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of hormone secretion (GO:0046887)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of multicellular organism growth (GO:0040014)|regulation of protein export from nucleus (GO:0046825)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|T cell costimulation (GO:0031295)|triglyceride metabolic process (GO:0006641)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	insulin receptor binding (GO:0005158)|non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|autonomic_ganglia(2)|breast(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(406)|kidney(2)|large_intestine(6)|lung(16)|ovary(1)|skin(1)|soft_tissue(3)|stomach(3)	451						CTCTCCCGCCTTGTACTCCAA	0.413			Mis		"""JMML, AML, MDS"""		Noonan Syndrome		Noonan syndrome																												p.P562P		.		Dom	yes		12	12q24.1	5781	"""protein tyrosine phosphatase, non-receptor type 11"""	yes	L	.	PTPN11-7239	0			c.T1686C						.						99.0	102.0	101.0					12																	112940034		2203	4300	6503	SO:0001819	synonymous_variant	5781	exon14	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	CCCGCCTTGTACT	D13540	CCDS9163.1, CCDS58280.1	12q24.1	2014-09-17	2008-07-31		ENSG00000179295	ENSG00000179295		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"", ""SH2 domain containing"""	9644	protein-coding gene	gene with protein product		176876	"""Noonan syndrome 1"""	NS1		7894486, 1280823	Standard	NM_080601		Approved	BPTP3, SH-PTP2, SHP-2, PTP2C, SHP2	uc001ttx.3	Q06124	OTTHUMG00000134334	ENST00000351677.2:c.1686T>C	12.37:g.112940034T>C		Somatic	171	1		WXS	Illumina GAIIx	Phase_I	204	28	NM_002834	0	0	29	29	0	A8K1D9|Q96HD7	Silent	SNP	ENST00000351677.2	37	CCDS9163.1																																																																																			.		0.413	PTPN11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259496.2		
GCN1L1	10985	broad.mit.edu	37	12	120595802	120595804	+	In_Frame_Del	DEL	AGG	AGG	-			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr12:120595802_120595804delAGG	ENST00000300648.6	-	26	2948_2950	c.2936_2938delCCT	c.(2935-2940)tcctta>tta	p.S979del	MIR4498_ENST00000577599.1_RNA	NM_006836.1	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis 1-like 1 (yeast)	979					regulation of translation (GO:0006417)|translation (GO:0006412)	cytoplasm (GO:0005737)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)			NS(2)|breast(2)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(13)|liver(1)|lung(36)|ovary(4)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	94	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GGGAAGACTAAGGAGAAGGCTGG	0.581																																					p.979_980del		.											.	GCN1L1-94	0			c.2936_2938del						.																																			SO:0001651	inframe_deletion	10985	exon26			AGACTAAGGAGAA	U77700	CCDS41847.1	12q24.2	2008-07-03	2001-11-28						4199	protein-coding gene	gene with protein product		605614	"""GCN1 (general control of amino-acid synthesis 1, yeast)-like 1"""			9234705	Standard	NM_006836		Approved	KIAA0219, GCN1, GCN1L	uc001txo.3	Q92616	OTTHUMG00000169338	ENST00000300648.6:c.2936_2938delCCT	12.37:g.120595802_120595804delAGG	ENSP00000300648:p.Ser979del	Somatic	192	0		WXS	Illumina GAIIx	Phase_I	174	9	NM_006836	0	0	0	0	0	A8KAY1|O95001|O95651|Q6P2S3|Q86X65|Q8N5I5|Q8WU80|Q99736|Q9UE60	In_Frame_Del	DEL	ENST00000300648.6	37	CCDS41847.1																																																																																			.		0.581	GCN1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403592.1		
MEDAG	84935	hgsc.bcm.edu	37	13	31480827	31480827	+	Missense_Mutation	SNP	A	A	G	rs9531945	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr13:31480827A>G	ENST00000380482.4	+	1	500	c.175A>G	c.(175-177)Agg>Ggg	p.R59G	TEX26-AS1_ENST00000590721.1_RNA|TEX26-AS1_ENST00000590344.1_RNA|TEX26-AS1_ENST00000588726.1_RNA|TEX26-AS1_ENST00000585870.1_RNA|TEX26-AS1_ENST00000593246.1_RNA|TEX26-AS1_ENST00000592950.1_RNA	NM_032849.3	NP_116238	Q5VYS4	MEDAG_HUMAN	mesenteric estrogen-dependent adipogenesis	59			R -> G (in dbSNP:rs9531945). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		positive regulation of fat cell differentiation (GO:0045600)	cytoplasm (GO:0005737)											CGTGGTGGCCAggcccgggga	0.726													G|||	4890	0.976438	0.913	0.9957	5008	,	,		11722	1.0		1.0	False		,,,				2504	1.0				p.R59G		.											.	.	0			c.A175G						.	G	GLY/ARG	2883,187		1349,185,1	3.0	4.0	4.0		175	3.2	0.0	13	dbSNP_119	4	6648,4		3322,4,0	no	missense	C13orf33	NM_032849.3	125	4671,189,1	GG,GA,AA		0.0601,6.0912,1.9646	benign	59/304	31480827	9531,191	1535	3326	4861	SO:0001583	missense	84935	exon1			GTGGCCAGGCCCG	AB055407	CCDS9338.1	13q12.3	2013-10-11	2012-09-26	2012-09-26	ENSG00000102802	ENSG00000102802			25926	protein-coding gene	gene with protein product	"""mesenteric estrogen-dependent adipose 4"", ""activated in W/Wv mouse stomach 3 homolog"""		"""chromosome 13 open reading frame 33"""	C13orf33		22510272	Standard	NM_032849		Approved	FLJ14834, AWMS3, MEDA-4	uc001uth.4	Q5VYS4	OTTHUMG00000016679	ENST00000380482.4:c.175A>G	13.37:g.31480827A>G	ENSP00000369849:p.Arg59Gly	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_032849	0	0	0	0	0	Q8IXF1|Q96K26|Q96NC8	Missense_Mutation	SNP	ENST00000380482.4	37	CCDS9338.1	2123	0.9720695970695971	437	0.8882113821138211	361	0.9972375690607734	567	0.9912587412587412	758	1.0	G	0.006	-2.044123	0.00398	0.939088	0.999399	ENSG00000102802	ENST00000380482	T	0.40225	1.04	4.92	3.15	0.36227	.	0.260438	0.31495	N	0.007559	T	0.00012	0.0000	N	0.02539	-0.55	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.42616	-0.9441	9	0.02654	T	1	-3.5214	6.5331	0.22338	0.1691:0.1474:0.6836:0.0	rs9531945;rs17857210;rs57016010;rs9531945	59	Q5VYS4	CM033_HUMAN	G	59	ENSP00000369849:R59G	ENSP00000369849:R59G	R	+	1	2	C13orf33	30378827	0.386000	0.25180	0.001000	0.08648	0.005000	0.04900	2.086000	0.41643	0.132000	0.18615	-1.032000	0.02404	AGG	A|0.219;G|0.781		0.726	MEDAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044375.1	NM_032849	
ING1	3621	hgsc.bcm.edu	37	13	111368316	111368316	+	Silent	SNP	C	C	T	rs9555726	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr13:111368316C>T	ENST00000375774.3	+	1	988	c.526C>T	c.(526-528)Ctg>Ttg	p.L176L	ING1_ENST00000338450.7_Intron|ING1_ENST00000375775.3_Intron|CARS2_ENST00000535398.1_5'Flank|ING1_ENST00000333219.7_Intron|ING1_ENST00000464141.1_Intron	NM_005537.4	NP_005528.3	Q9UK53	ING1_HUMAN	inhibitor of growth family, member 1	176					cell cycle (GO:0007049)|chromatin modification (GO:0016568)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell death (GO:0010941)	nucleus (GO:0005634)	methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(6)|lung(1)|ovary(1)	12	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.188)			GGCCGCATCTCTGCTGACCCG	0.706													C|||	2912	0.58147	0.23	0.6816	5008	,	,		11066	0.7252		0.6909	False		,,,				2504	0.7249				p.L176L		.											.	ING1-515	0			c.C526T						.	C	,,,	1347,2085		295,757,664	14.0	24.0	21.0		526,,,	-5.6	0.0	13	dbSNP_119	21	5238,1736		2020,1198,269	no	coding-synonymous,intron,intron,intron	ING1	NM_005537.3,NM_198217.1,NM_198218.1,NM_198219.1	,,,	2315,1955,933	TT,TC,CC		24.8925,39.2483,36.7192	,,,	176/423,,,	111368316	6585,3821	1716	3487	5203	SO:0001819	synonymous_variant	3621	exon1			GCATCTCTGCTGA		CCDS9515.1, CCDS9516.1, CCDS9517.1, CCDS9518.1	13q34	2013-01-28			ENSG00000153487	ENSG00000153487		"""Zinc fingers, PHD-type"""	6062	protein-coding gene	gene with protein product	"""inhibitor of growth 1"", ""tumor suppressor ING1"", ""growth inhibitor ING1"", ""growth inhibitory protein ING1"""	601566				8944021, 9186514	Standard	NM_198219		Approved	p33ING1, p33ING1b, p24ING1c, p33, p47, p47ING1a	uc001vri.3	Q9UK53	OTTHUMG00000017346	ENST00000375774.3:c.526C>T	13.37:g.111368316C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	4	NM_005537	0	0	5	7	2	O00532|O43658|Q53ZR3|Q5T9G8|Q5T9G9|Q5T9H0|Q5T9H1|Q9H007|Q9HD98|Q9HD99|Q9NS83|Q9P0U6|Q9UBC6|Q9UIJ1|Q9UIJ2|Q9UIJ3|Q9UIJ4|Q9UK52	Silent	SNP	ENST00000375774.3	37	CCDS9517.1																																																																																			C|0.372;T|0.628		0.706	ING1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000045770.2	NM_005537	
APEX1	328	broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	20925557	20925557	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr14:20925557G>C	ENST00000216714.3	+	5	1115	c.847G>C	c.(847-849)Gat>Cat	p.D283H	APEX1_ENST00000398030.4_Missense_Mutation_p.D283H|APEX1_ENST00000555414.1_Missense_Mutation_p.D283H|OSGEP_ENST00000556252.1_5'Flank|APEX1_ENST00000557054.1_3'UTR|OSGEP_ENST00000206542.4_5'Flank	NM_001244249.1|NM_001641.3	NP_001231178.1|NP_001632.2	P27695	APEX1_HUMAN	APEX nuclease (multifunctional DNA repair enzyme) 1	283		Important for catalytic activity.			aging (GO:0007568)|base-excision repair (GO:0006284)|cell redox homeostasis (GO:0045454)|cellular response to cAMP (GO:0071320)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to peptide hormone stimulus (GO:0071375)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA demethylation (GO:0080111)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|negative regulation of smooth muscle cell migration (GO:0014912)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|oxidation-reduction process (GO:0055114)|positive regulation of DNA repair (GO:0045739)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribosome (GO:0005840)|transcription factor complex (GO:0005667)	3'-5' exonuclease activity (GO:0008408)|chromatin DNA binding (GO:0031490)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|double-stranded DNA 3'-5' exodeoxyribonuclease activity (GO:0008311)|endodeoxyribonuclease activity (GO:0004520)|endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)|phosphodiesterase I activity (GO:0004528)|phosphoric diester hydrolase activity (GO:0008081)|poly(A) RNA binding (GO:0044822)|RNA-DNA hybrid ribonuclease activity (GO:0004523)|site-specific endodeoxyribonuclease activity, specific for altered base (GO:0016890)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|uracil DNA N-glycosylase activity (GO:0004844)			breast(2)|endometrium(1)|large_intestine(4)|ovary(2)	9	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;1.09e-07)|all cancers(55;1.19e-06)	GBM - Glioblastoma multiforme(265;0.0224)|READ - Rectum adenocarcinoma(17;0.193)	Lucanthone(DB04967)	TTGGCGCCTTGATTACTTTTT	0.488								Other BER factors																													p.D283H		.											.	APEX1-661	0			c.G847C						.						244.0	213.0	224.0					14																	20925557		2203	4300	6503	SO:0001583	missense	328	exon5			CGCCTTGATTACT	X59764	CCDS9550.1	14q11.2	2008-02-05	2002-09-11	2002-09-13	ENSG00000100823	ENSG00000100823	4.2.99.18		587	protein-coding gene	gene with protein product		107748	"""APEX nuclease (multifunctional DNA repair enzyme)"""	APEX			Standard	NM_001641		Approved	APE, REF1, HAP1, APX, APEN, REF-1, APE-1	uc021rnr.1	P27695	OTTHUMG00000029544	ENST00000216714.3:c.847G>C	14.37:g.20925557G>C	ENSP00000216714:p.Asp283His	Somatic	163	1		WXS	Illumina GAIIx	Phase_I	219	103	NM_080648	0	1	213	400	186	Q969L5|Q99775	Missense_Mutation	SNP	ENST00000216714.3	37	CCDS9550.1	.	.	.	.	.	.	.	.	.	.	G	17.61	3.432073	0.62844	.	.	ENSG00000100823	ENST00000555414;ENST00000216714;ENST00000398030;ENST00000557054	D;D;D	0.99466	-5.95;-5.95;-5.95	6.06	3.21	0.36854	Endonuclease/exonuclease/phosphatase (2);AP endonuclease, family 1, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.99725	0.9893	H	0.99642	4.675	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97684	1.0174	10	0.87932	D	0	.	7.9769	0.30159	0.139:0.0:0.73:0.131	.	283	P27695	APEX1_HUMAN	H	283;283;283;14	ENSP00000451979:D283H;ENSP00000216714:D283H;ENSP00000381111:D283H	ENSP00000216714:D283H	D	+	1	0	APEX1	19995397	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.317000	0.96327	0.421000	0.25980	0.655000	0.94253	GAT	.		0.488	APEX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073641.3	NM_001641	
AJUBA	84962	broad.mit.edu	37	14	23451230	23451230	+	Silent	SNP	C	C	A			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr14:23451230C>A	ENST00000262713.2	-	1	621	c.246G>T	c.(244-246)gcG>gcT	p.A82A	RP11-298I3.4_ENST00000555294.1_RNA|RP11-298I3.4_ENST00000556503.1_RNA|RP11-298I3.4_ENST00000557615.1_RNA|AJUBA_ENST00000361265.4_Silent_p.A82A|RP11-298I3.5_ENST00000555074.1_Intron	NM_032876.4	NP_116265.1	Q96IF1	AJUBA_HUMAN	ajuba LIM protein	82	PreLIM.				calcium-dependent cell-cell adhesion (GO:0016339)|cellular protein localization (GO:0034613)|focal adhesion assembly (GO:0048041)|G2/M transition of mitotic cell cycle (GO:0000086)|gene silencing by miRNA (GO:0035195)|glycerophospholipid biosynthetic process (GO:0046474)|lamellipodium assembly (GO:0030032)|mitotic cell cycle (GO:0000278)|negative regulation of hippo signaling (GO:0035331)|negative regulation of kinase activity (GO:0033673)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cellular biosynthetic process (GO:0031328)|positive regulation of gene silencing by miRNA (GO:2000637)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein complex assembly (GO:0031334)|regulation of cell migration (GO:0030334)|regulation of cellular response to hypoxia (GO:1900037)|regulation of GTPase activity (GO:0043087)|response to hypoxia (GO:0001666)|transcription, DNA-templated (GO:0006351)|wound healing, spreading of epidermal cells (GO:0035313)	cell-cell junction (GO:0005911)|cytoplasmic mRNA processing body (GO:0000932)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|transcription factor complex (GO:0005667)	alpha-catenin binding (GO:0045294)|chromatin binding (GO:0003682)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)										CGTAGCGCGGCGCCTCAAAGG	0.701																																					p.A82A		.											.	.	0			c.G246T						.																																			SO:0001819	synonymous_variant	84962	exon1			GCGCGGCGCCTCA	AK025567	CCDS9581.1, CCDS9582.1	14q11.2	2011-11-10	2011-11-10	2011-11-10	ENSG00000129474	ENSG00000129474			20250	protein-coding gene	gene with protein product		609066	"""jub, ajuba homolog (Xenopus laevis)"""	JUB		10330178	Standard	NM_032876		Approved	MGC15563	uc001whz.3	Q96IF1	OTTHUMG00000028711	ENST00000262713.2:c.246G>T	14.37:g.23451230C>A		Somatic	19	0		WXS	Illumina GAIIx	Phase_I	58	6	NM_032876	0	0	0	0	0	A8MX18|D3DS37	Silent	SNP	ENST00000262713.2	37	CCDS9581.1																																																																																			.		0.701	AJUBA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071685.2		
DNAAF2	55172	hgsc.bcm.edu	37	14	50100683	50100683	+	Silent	SNP	C	C	G	rs2985686	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr14:50100683C>G	ENST00000298292.8	-	1	1265	c.1185G>C	c.(1183-1185)gcG>gcC	p.A395A	DNAAF2_ENST00000406043.3_Silent_p.A395A	NM_018139.2	NP_060609.2	Q9NVR5	KTU_HUMAN	dynein, axonemal, assembly factor 2	395					axonemal dynein complex assembly (GO:0070286)|bacterial-type flagellum-dependent cell motility (GO:0071973)|cilium-dependent cell motility (GO:0060285)|response to retinoic acid (GO:0032526)	cytoplasm (GO:0005737)				kidney(1)|lung(4)	5						CTCCGTCCTCCGCGCGACTCC	0.781													G|||	2800	0.559105	0.6702	0.6715	5008	,	,		11594	0.1736		0.7604	False		,,,				2504	0.5194				p.A395A		.											.	.	0			c.G1185C						.						1.0	1.0	1.0					14																	50100683		917	2082	2999	SO:0001819	synonymous_variant	55172	exon1			GTCCTCCGCGCGA	AK001425	CCDS9691.2, CCDS45100.1	14q21.3	2012-05-03	2011-06-09	2011-06-09	ENSG00000165506	ENSG00000165506			20188	protein-coding gene	gene with protein product	"""kintoun"""	612517	"""chromosome 14 open reading frame 104"""	C14orf104			Standard	NM_001083908		Approved	FLJ10563, KTU, PF13, CILD10	uc001wws.4	Q9NVR5	OTTHUMG00000152331	ENST00000298292.8:c.1185G>C	14.37:g.50100683C>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	4	NM_018139	0	0	0	1	1	B9WS54|C0JAP7|Q86TR1|Q86TY8|Q969Z5	Silent	SNP	ENST00000298292.8	37	CCDS9691.2																																																																																			C|0.569;G|0.431		0.781	DNAAF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276813.1		
KIAA0586	9786	hgsc.bcm.edu	37	14	58949383	58949383	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr14:58949383G>T	ENST00000556134.1	+	22	3326	c.3052G>T	c.(3052-3054)Gct>Tct	p.A1018S	KIAA0586_ENST00000538571.2_3'UTR|KIAA0586_ENST00000261244.5_Missense_Mutation_p.A957S|KIAA0586_ENST00000354386.6_Missense_Mutation_p.A1086S|KIAA0586_ENST00000423743.3_Missense_Mutation_p.A989S	NM_001244190.1|NM_001244193.1	NP_001231119.1|NP_001231122.1	Q9BVV6	TALD3_HUMAN	KIAA0586	1018					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|regulation of establishment of protein localization (GO:0070201)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)				endometrium(4)|kidney(6)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						AGGTCCTGTTGCTACAGGTGT	0.378																																					p.A1086S		.											.	KIAA0586-23	0			c.G3256T						.						124.0	124.0	124.0					14																	58949383		1862	4119	5981	SO:0001583	missense	9786	exon23			CCTGTTGCTACAG	AB011158	CCDS45115.1, CCDS58320.1, CCDS58321.1, CCDS58322.1, CCDS73639.1	14q23.1	2012-12-06			ENSG00000100578	ENSG00000100578			19960	protein-coding gene	gene with protein product		610178				16702409	Standard	NM_014749		Approved	Talpid3	uc010trr.2	Q9BVV6	OTTHUMG00000171141	ENST00000556134.1:c.3052G>T	14.37:g.58949383G>T	ENSP00000452351:p.Ala1018Ser	Somatic	79	0		WXS	Illumina GAIIx	Phase_I	68	4	NM_001244189	0	0	3	3	0	B4DZB6|E7EWM8|J3KQH9|O60328|Q6NYC6|Q6UV20	Missense_Mutation	SNP	ENST00000556134.1	37	CCDS58321.1	.	.	.	.	.	.	.	.	.	.	G	13.24	2.176817	0.38413	.	.	ENSG00000100578	ENST00000354386;ENST00000556134;ENST00000423743;ENST00000261244;ENST00000546216	T;T;T;T	0.50548	0.74;0.74;0.74;0.74	5.17	3.33	0.38152	.	0.503559	0.21026	N	0.081432	T	0.43678	0.1258	M	0.65975	2.015	0.09310	N	1	P;B;P;P;P;P	0.42692	0.562;0.419;0.763;0.787;0.78;0.705	B;B;B;B;B;B	0.41510	0.275;0.168;0.242;0.273;0.275;0.359	T	0.24297	-1.0164	10	0.23891	T	0.37	.	8.3342	0.32204	0.1864:0.0:0.8136:0.0	.	893;893;1086;957;1018;989	F5GWA3;B7Z7W7;E7EWM8;E9PGW8;Q9BVV6;Q6UV20	.;.;.;.;K0586_HUMAN;.	S	1086;1018;989;957;893	ENSP00000346359:A1086S;ENSP00000452351:A1018S;ENSP00000399427:A989S;ENSP00000261244:A957S	ENSP00000261244:A957S	A	+	1	0	KIAA0586	58019136	0.010000	0.17322	0.002000	0.10522	0.129000	0.20672	1.444000	0.35068	0.832000	0.34804	0.650000	0.86243	GCT	.		0.378	KIAA0586-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000411887.1	NM_014749	
COQ6	51004	bcgsc.ca	37	14	74424938	74424938	+	Silent	SNP	T	T	C	rs3180946	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr14:74424938T>C	ENST00000334571.2	+	5	610	c.570T>C	c.(568-570)caT>caC	p.H190H	COQ6_ENST00000554920.1_Intron|COQ6_ENST00000238709.4_Silent_p.H115H|ENTPD5_ENST00000557325.1_3'UTR|COQ6_ENST00000394026.4_Silent_p.H165H	NM_182476.2	NP_872282.1	Q9Y2Z9	COQ6_HUMAN	coenzyme Q6 monooxygenase	190					small molecule metabolic process (GO:0044281)|ubiquinone biosynthetic process (GO:0006744)	cell projection (GO:0042995)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)			breast(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	16				BRCA - Breast invasive adenocarcinoma(234;0.00337)		CTTGGGTTCATATTACCCTAG	0.473													T|||	926	0.184904	0.0325	0.3199	5008	,	,		19445	0.0496		0.4026	False		,,,				2504	0.2106				p.H190H		.											.	COQ6-90	0			c.T570C						.	T	,	386,4020	194.3+/-219.2	17,352,1834	109.0	97.0	101.0		570,345	-4.1	0.9	14	dbSNP_105	101	3555,5045	517.7+/-379.1	726,2103,1471	no	coding-synonymous,coding-synonymous	COQ6	NM_182476.2,NM_182480.2	,	743,2455,3305	CC,CT,TT		41.3372,8.7608,30.3014	,	190/469,115/394	74424938	3941,9065	2203	4300	6503	SO:0001819	synonymous_variant	51004	exon5			GGTTCATATTACC	AF132944	CCDS9823.1, CCDS9824.1, CCDS9824.2	14q24.1	2013-05-01	2013-05-01		ENSG00000119723	ENSG00000119723			20233	protein-coding gene	gene with protein product		614647	"""coenzyme Q6 homolog (yeast)"", ""coenzyme Q6 homolog, monooxygenase (yeast)"", ""coenzyme Q6 homolog, monooxygenase (S. cerevisiae)"""			21540551	Standard	NM_182476		Approved	CGI-10	uc001xph.3	Q9Y2Z9	OTTHUMG00000171260	ENST00000334571.2:c.570T>C	14.37:g.74424938T>C		Somatic	175	0		WXS	Illumina GAIIx	Phase_I	138	5	NM_182476	0	0	12	13	1	B7Z3K8|Q53GG6|Q86U30|Q96CA1|Q96CK2	Silent	SNP	ENST00000334571.2	37	CCDS9823.1																																																																																			T|0.737;C|0.263		0.473	COQ6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412616.1		
STON2	85439	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	81743692	81743692	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr14:81743692C>G	ENST00000267540.2	-	4	2163	c.1963G>C	c.(1963-1965)Gtt>Ctt	p.V655L	STON2_ENST00000556280.1_5'Flank|STON2_ENST00000555447.1_Missense_Mutation_p.V655L	NM_033104.3	NP_149095.2	Q8WXE9	STON2_HUMAN	stonin 2	655	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.				hematopoietic progenitor cell differentiation (GO:0002244)|intracellular protein transport (GO:0006886)|regulation of endocytosis (GO:0030100)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nucleolus (GO:0005730)|synaptic vesicle (GO:0008021)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(13)|pancreas(2)|prostate(1)|skin(5)	34				BRCA - Breast invasive adenocarcinoma(234;0.0348)		TTGTGGAAAACATCCTCATCC	0.498																																					p.V655L		.											.	STON2-95	0			c.G1963C						.						86.0	69.0	75.0					14																	81743692		2203	4300	6503	SO:0001583	missense	85439	exon6			GGAAAACATCCTC	AB208948	CCDS9875.1, CCDS58332.1	14q31.1	2007-08-01				ENSG00000140022			30652	protein-coding gene	gene with protein product	"""stoned B homolog 2 (Drosophila)"""	608467				11381094, 11454741	Standard	NM_033104		Approved	STNB2, STN2	uc001xvk.2	Q8WXE9		ENST00000267540.2:c.1963G>C	14.37:g.81743692C>G	ENSP00000267540:p.Val655Leu	Somatic	349	0		WXS	Illumina GAIIx	Phase_I	227	96	NM_001256430	0	0	1	1	0	G3V2T7|Q17R24|Q59H11|Q6NT47|Q96RI7|Q96RU6	Missense_Mutation	SNP	ENST00000267540.2	37	CCDS9875.1	.	.	.	.	.	.	.	.	.	.	C	7.373	0.627264	0.14257	.	.	ENSG00000140022	ENST00000555447;ENST00000546306;ENST00000267540	T;T	0.18657	2.2;2.2	6.06	5.17	0.71159	Clathrin adaptor, mu subunit, C-terminal (3);	0.284575	0.33670	N	0.004667	T	0.16428	0.0395	L	0.29908	0.895	0.31612	N	0.651363	B;B	0.29835	0.258;0.218	B;B	0.32980	0.156;0.097	T	0.14643	-1.0465	10	0.29301	T	0.29	-12.9845	10.2783	0.43523	0.0:0.7959:0.0:0.2041	.	655;655	Q8WXE9;G3V2T7	STON2_HUMAN;.	L	655;667;655	ENSP00000450857:V655L;ENSP00000267540:V655L	ENSP00000267540:V655L	V	-	1	0	STON2	80813445	0.031000	0.19500	0.718000	0.30602	0.114000	0.19823	1.261000	0.32980	1.567000	0.49668	0.650000	0.86243	GTT	.		0.498	STON2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000413317.1	NM_033104	
CKB	1152	hgsc.bcm.edu	37	14	103988180	103988180	+	Silent	SNP	G	G	T	rs1136165	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr14:103988180G>T	ENST00000348956.2	-	4	813	c.456C>A	c.(454-456)cgC>cgA	p.R152R		NM_001823.4	NP_001814.2	P12277	KCRB_HUMAN	creatine kinase, brain	152	Phosphagen kinase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00843}.				cellular chloride ion homeostasis (GO:0030644)|cellular nitrogen compound metabolic process (GO:0034641)|creatine metabolic process (GO:0006600)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|creatine kinase activity (GO:0004111)			lung(2)|prostate(1)	3		Melanoma(154;0.155)	Epithelial(46;0.14)		Creatine(DB00148)	TCTCGATGGCGCGGCGCTCCC	0.756													G|||	3294	0.657748	0.5416	0.7349	5008	,	,		7060	0.8264		0.6233	False		,,,				2504	0.6217				p.R152R	Esophageal Squamous(186;2492 2823 49929 50127)	.											.	CKB-115	0			c.C456A						.	G		1738,1164		574,590,287	3.0	4.0	3.0		456	-0.0	1.0	14	dbSNP_86	3	4002,2154		1387,1228,463	no	coding-synonymous	CKB	NM_001823.3		1961,1818,750	TT,TG,GG		34.9903,40.1103,36.6306		152/382	103988180	5740,3318	1451	3078	4529	SO:0001819	synonymous_variant	1152	exon4			GATGGCGCGGCGC		CCDS9981.1	14q32.32	2012-10-02			ENSG00000166165	ENSG00000166165	2.7.3.2		1991	protein-coding gene	gene with protein product		123280		CKBB			Standard	NM_001823		Approved		uc001ynf.2	P12277	OTTHUMG00000171786	ENST00000348956.2:c.456C>A	14.37:g.103988180G>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_001823	0	0	0	56	56	A8K236|B2R5R4|Q2LE07|Q6FG40|Q9UC66	Silent	SNP	ENST00000348956.2	37	CCDS9981.1	1462	0.6694139194139194	285	0.5792682926829268	250	0.6906077348066298	460	0.8041958041958042	467	0.6160949868073878	G	13.11	2.138272	0.37728	0.598897	0.650097	ENSG00000166165	ENST00000428256	.	.	.	4.64	-0.0349	0.13894	.	0.000000	0.85682	D	0.000000	T	0.00012	0.0000	.	.	.	0.09310	P	0.9999999999999624	.	.	.	.	.	.	T	0.17592	-1.0364	5	0.41790	T	0.15	-18.9304	4.9837	0.14180	0.3841:0.2745:0.3414:0.0	rs1136165;rs2227867;rs2765044;rs3179077;rs3199393;rs17366340;rs17423634;rs17849441;rs17850309;rs17850603;rs17851735;rs17851741;rs17857802	.	.	.	S	118	.	ENSP00000395515:R118S	R	-	1	0	CKB	103057933	0.001000	0.12720	0.999000	0.59377	0.996000	0.88848	-2.081000	0.01367	0.066000	0.16515	0.449000	0.29647	CGC	G|0.327;T|0.673		0.756	CKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415111.1		
KIF26A	26153	hgsc.bcm.edu	37	14	104644099	104644099	+	Silent	SNP	T	T	C	rs2497297	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr14:104644099T>C	ENST00000423312.2	+	12	4974	c.4974T>C	c.(4972-4974)agT>agC	p.S1658S	KIF26A_ENST00000315264.7_Silent_p.S1519S	NM_015656.1	NP_056471.1	Q9ULI4	KI26A_HUMAN	kinesin family member 26A	1658					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|enteric nervous system development (GO:0048484)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of signal transduction (GO:0009968)|regulation of cell growth by extracellular stimulus (GO:0001560)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	21		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0767)	Epithelial(46;0.152)	Epithelial(152;0.161)		GTGGCAGCAGTGGCTATGAGA	0.711													C|||	2031	0.405551	0.5764	0.2911	5008	,	,		13449	0.3185		0.3718	False		,,,				2504	0.3804				p.S1658S		.											.	KIF26A-24	0			c.T4974C						.	C		1381,1865		360,661,602	3.0	4.0	4.0		4974	-0.8	1.0	14	dbSNP_100	4	2221,5011		464,1293,1859	no	coding-synonymous	KIF26A	NM_015656.1		824,1954,2461	CC,CT,TT		30.7107,42.5447,34.3768		1658/1883	104644099	3602,6876	1623	3616	5239	SO:0001819	synonymous_variant	26153	exon12			CAGCAGTGGCTAT	AB033062	CCDS45171.1	14q32.33	2009-03-19			ENSG00000066735	ENSG00000066735		"""Kinesins"""	20226	protein-coding gene	gene with protein product		613231				10574462, 11416179	Standard	NM_015656		Approved	KIAA1236, DKFZP434N178	uc001yos.4	Q9ULI4	OTTHUMG00000154986	ENST00000423312.2:c.4974T>C	14.37:g.104644099T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_015656	0	0	0	1	1	Q8TAZ7|Q96GK3|Q9UFL3	Silent	SNP	ENST00000423312.2	37	CCDS45171.1																																																																																			T|0.603;C|0.397		0.711	KIF26A-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414356.1		
MRPS34	65993	hgsc.bcm.edu	37	16	1823054	1823054	+	Missense_Mutation	SNP	C	C	G	rs11552432	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr16:1823054C>G	ENST00000397375.2	-	1	102	c.67G>C	c.(67-69)Gag>Cag	p.E23Q	NME3_ENST00000563498.1_5'Flank|MRPS34_ENST00000177742.3_Missense_Mutation_p.E23Q|EME2_ENST00000568449.1_5'Flank|NME3_ENST00000219302.3_5'Flank|EME2_ENST00000307394.7_5'Flank	NM_023936.1	NP_076425.1	P82930	RT34_HUMAN	mitochondrial ribosomal protein S34	23						mitochondrion (GO:0005739)|ribosome (GO:0005840)				breast(1)|skin(2)	3						TTCAGTTGCTCCCGCAGGGCG	0.741													C|||	53	0.0105831	0.0008	0.013	5008	,	,		11975	0.0		0.0348	False		,,,				2504	0.0082				p.E23Q		.											.	MRPS34-92	0			c.G67C						.	C	GLN/GLU	11,3021		0,11,1505	2.0	3.0	3.0		67	3.7	1.0	16	dbSNP_120	3	113,6393		0,113,3140	yes	missense	MRPS34	NM_023936.1	29	0,124,4645	GG,GC,CC		1.7369,0.3628,1.3001	probably-damaging	23/219	1823054	124,9414	1516	3253	4769	SO:0001583	missense	65993	exon1			GTTGCTCCCGCAG	BC001182	CCDS10444.1, CCDS73805.1	16p13.3	2012-09-13			ENSG00000074071	ENSG00000074071		"""Mitochondrial ribosomal proteins / small subunits"""	16618	protein-coding gene	gene with protein product		611994					Standard	NM_023936		Approved	MRP-S12, MGC2616	uc002cmo.3	P82930	OTTHUMG00000128636	ENST00000397375.2:c.67G>C	16.37:g.1823054C>G	ENSP00000380531:p.Glu23Gln	Somatic	3	0		WXS	Illumina GAIIx	Phase_I	24	13	NM_023936	0	0	0	5	5	Q9BVI7	Missense_Mutation	SNP	ENST00000397375.2	37	CCDS10444.1	30	0.013736263736263736	1	0.0020325203252032522	8	0.022099447513812154	0	0.0	21	0.027704485488126648	C	24.7	4.555305	0.86231	0.003628	0.017369	ENSG00000074071	ENST00000397375;ENST00000177742	T;T	0.54071	0.59;0.59	3.72	3.72	0.42706	.	0.056147	0.64402	D	0.000002	T	0.42921	0.1224	L	0.58101	1.795	0.58432	D	0.999991	D;D	0.76494	0.999;0.999	D;D	0.69479	0.964;0.964	T	0.63287	-0.6671	10	0.66056	D	0.02	-0.3848	14.2401	0.65952	0.0:1.0:0.0:0.0	rs11552432	23;23	C9JJ19;P82930	.;RT34_HUMAN	Q	23	ENSP00000380531:E23Q;ENSP00000177742:E23Q	ENSP00000177742:E23Q	E	-	1	0	MRPS34	1763055	0.998000	0.40836	0.996000	0.52242	0.482000	0.33219	3.988000	0.56951	1.891000	0.54761	0.591000	0.81541	GAG	C|0.014;G|0.986		0.741	MRPS34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250506.1	NM_023936	
NTN3	4917	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	2523112	2523112	+	Missense_Mutation	SNP	G	G	A	rs375026789		TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr16:2523112G>A	ENST00000293973.1	+	3	1447	c.1244G>A	c.(1243-1245)cGc>cAc	p.R415H	TBC1D24_ENST00000567020.1_5'Flank|TBC1D24_ENST00000293970.5_5'Flank	NM_006181.2	NP_006172.1	O00634	NET3_HUMAN	netrin 3	415	Laminin EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)	Golgi apparatus (GO:0005794)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|central_nervous_system(2)|lung(3)|prostate(1)	7						CAGCAAAGCCGCTCCCCAGTG	0.657																																					p.R415H		.											.	NTN3-90	0			c.G1244A						.						46.0	47.0	47.0					16																	2523112		2198	4299	6497	SO:0001583	missense	4917	exon3			AAAGCCGCTCCCC	U86759	CCDS10469.1	16p13.3	2013-03-01	2008-10-29	2008-10-29	ENSG00000162068	ENSG00000162068		"""Netrins"""	8030	protein-coding gene	gene with protein product	"""Netrin-3"""	602349	"""netrin 2 (chicken)-like"", ""netrin 2-like (chicken)"""	NTN2L		9143507, 10366627	Standard	NM_006181		Approved		uc002cqj.3	O00634	OTTHUMG00000128867	ENST00000293973.1:c.1244G>A	16.37:g.2523112G>A	ENSP00000293973:p.Arg415His	Somatic	97	0		WXS	Illumina GAIIx	Phase_I	119	27	NM_006181	0	0	0	0	0		Missense_Mutation	SNP	ENST00000293973.1	37	CCDS10469.1	.	.	.	.	.	.	.	.	.	.	G	18.21	3.574001	0.65765	.	.	ENSG00000162068	ENST00000293973	T	0.61742	0.08	3.9	3.9	0.45041	EGF-like, laminin (4);	0.065487	0.64402	D	0.000007	T	0.70456	0.3226	L	0.58354	1.805	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	T	0.71500	-0.4574	10	0.42905	T	0.14	.	14.4636	0.67467	0.0:0.0:1.0:0.0	.	415	O00634	NET3_HUMAN	H	415	ENSP00000293973:R415H	ENSP00000293973:R415H	R	+	2	0	NTN3	2463113	1.000000	0.71417	0.997000	0.53966	0.816000	0.46133	6.579000	0.74036	1.737000	0.51674	0.313000	0.20887	CGC	.		0.657	NTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250812.1	NM_006181	
SCNN1B	6338	ucsc.edu;bcgsc.ca	37	16	23388659	23388659	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr16:23388659G>T	ENST00000343070.2	+	10	1532	c.1356G>T	c.(1354-1356)caG>caT	p.Q452H	SCNN1B_ENST00000568085.1_Missense_Mutation_p.Q416H|SCNN1B_ENST00000568923.1_Missense_Mutation_p.Q425H|SCNN1B_ENST00000307331.5_Missense_Mutation_p.Q497H	NM_000336.2	NP_000327.2	P51168	SCNNB_HUMAN	sodium channel, non-voltage-gated 1, beta subunit	452					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|multicellular organismal water homeostasis (GO:0050891)|response to stimulus (GO:0050896)|sensory perception of taste (GO:0050909)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)	ligand-gated sodium channel activity (GO:0015280)|WW domain binding (GO:0050699)			breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|liver(2)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	32				GBM - Glioblastoma multiforme(48;0.0465)	Amiloride(DB00594)|Triamterene(DB00384)	GTGACACCCAGTACAAGATGA	0.627																																					p.Q452H		.											.	SCNN1B-157	0			c.G1356T						.						112.0	97.0	102.0					16																	23388659		2197	4300	6497	SO:0001583	missense	6338	exon10			CACCCAGTACAAG	X87159	CCDS10609.1	16p12.2-p12.1	2012-02-28	2012-02-28		ENSG00000168447	ENSG00000168447		"""Ion channels / Sodium channel, nonvoltage-gated"", ""Sodium channels"""	10600	protein-coding gene	gene with protein product	"""Liddle syndrome"""	600760	"""sodium channel, nonvoltage-gated 1, beta"", ""sodium channel, non-voltage-gated 1, beta"""				Standard	NM_000336		Approved	ENaCbeta	uc002dln.3	P51168	OTTHUMG00000131608	ENST00000343070.2:c.1356G>T	16.37:g.23388659G>T	ENSP00000345751:p.Gln452His	Somatic	73	1		WXS	Illumina GAIIx	Phase_I	39	4	NM_000336	0	0	0	0	0	C5HTZ2|O60891|Q96KG2|Q9UJ32|Q9UMU5	Missense_Mutation	SNP	ENST00000343070.2	37	CCDS10609.1	.	.	.	.	.	.	.	.	.	.	G	12.53	1.966419	0.34659	.	.	ENSG00000168447	ENST00000343070;ENST00000307331	T;T	0.64085	-0.08;-0.08	4.73	3.77	0.43336	.	0.252278	0.34156	N	0.004220	T	0.50326	0.1609	L	0.42245	1.32	0.42653	D	0.993452	B	0.12013	0.005	B	0.14578	0.011	T	0.52381	-0.8583	10	0.48119	T	0.1	-23.2057	8.0225	0.30417	0.1809:0.0:0.8191:0.0	.	452	P51168	SCNNB_HUMAN	H	452;497	ENSP00000345751:Q452H;ENSP00000302874:Q497H	ENSP00000302874:Q497H	Q	+	3	2	SCNN1B	23296160	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.221000	0.51215	2.164000	0.68074	0.492000	0.49549	CAG	.		0.627	SCNN1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254495.2		
ZNF423	23090	bcgsc.ca	37	16	49672520	49672520	+	Silent	SNP	A	A	G	rs3803665	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr16:49672520A>G	ENST00000561648.1	-	4	596	c.543T>C	c.(541-543)cgT>cgC	p.R181R	ZNF423_ENST00000567169.1_Silent_p.R64R|ZNF423_ENST00000535559.1_Silent_p.R64R|ZNF423_ENST00000563137.2_Silent_p.R121R|ZNF423_ENST00000562871.1_Silent_p.R121R|ZNF423_ENST00000562520.1_Silent_p.R121R|ZNF423_ENST00000262383.2_Silent_p.R181R	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	181					cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)				TGTGCCGGTCACGGCTCCTCT	0.582													G|||	2898	0.578674	0.9115	0.4597	5008	,	,		19203	0.4603		0.4254	False		,,,				2504	0.4928				p.R181R		.											.	ZNF423-228	0			c.T543C						.	G		3731,665	280.2+/-275.2	1592,547,59	49.0	44.0	46.0		543	-2.0	1.0	16	dbSNP_107	46	3677,4923	619.8+/-397.0	799,2079,1422	no	coding-synonymous	ZNF423	NM_015069.2		2391,2626,1481	GG,GA,AA		42.7558,15.1274,42.9978		181/1285	49672520	7408,5588	2198	4300	6498	SO:0001819	synonymous_variant	23090	exon4			CCGGTCACGGCTC	AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935		"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557				9872452, 10660046	Standard	NM_001271620		Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.543T>C	16.37:g.49672520A>G		Somatic	102	0		WXS	Illumina GAIIx	Phase_I	135	5	NM_015069	0	0	0	0	0	O94860|Q76N04|Q9NZ13	Silent	SNP	ENST00000561648.1	37	CCDS32445.1																																																																																			A|0.440;G|0.560		0.582	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000423258.1	NM_015069	
IRX3	79191	hgsc.bcm.edu	37	16	54318528	54318528	+	Missense_Mutation	SNP	A	A	G	rs1450355	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr16:54318528A>G	ENST00000329734.3	-	2	1977	c.1265T>C	c.(1264-1266)cTg>cCg	p.L422P		NM_024336.2	NP_077312.2	P78415	IRX3_HUMAN	iroquois homeobox 3	422	Pro-rich.		L -> P (in dbSNP:rs1450355). {ECO:0000269|PubMed:15489334}.		mesoderm development (GO:0007498)|metanephros development (GO:0001656)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of neuron differentiation (GO:0045666)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)|transcription, DNA-templated (GO:0006351)	axon (GO:0030424)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|soft_tissue(1)|urinary_tract(1)	14						GAGCGGGTGCAGGCGGGGGCC	0.776													g|||	4851	0.96865	0.888	0.987	5008	,	,		8017	1.0		1.0	False		,,,				2504	1.0				p.L422P	GBM(143;1830 1866 4487 4646 37383)	.											.	IRX3-90	0			c.T1265C						.	T	PRO/LEU	1678,102		788,102,0	1.0	2.0	2.0		1265	2.5	1.0	16	dbSNP_88	2	4195,3		2096,3,0	no	missense	IRX3	NM_024336.2	98	2884,105,0	GG,GA,AA		0.0715,5.7303,1.7564	benign	422/502	54318528	5873,105	890	2099	2989	SO:0001583	missense	79191	exon2			GGGTGCAGGCGGG	U90308	CCDS10750.1	16q12.2	2011-06-20	2007-07-13		ENSG00000177508	ENSG00000177508		"""Homeoboxes / TALE class"""	14360	protein-coding gene	gene with protein product		612985					Standard	NM_024336		Approved	IRX-1	uc002eht.1	P78415	OTTHUMG00000133200	ENST00000329734.3:c.1265T>C	16.37:g.54318528A>G	ENSP00000331608:p.Leu422Pro	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_024336	0	0	0	0	0	Q7Z4A4|Q7Z4A5|Q8IVC6	Missense_Mutation	SNP	ENST00000329734.3	37	CCDS10750.1	2108	0.9652014652014652	433	0.8800813008130082	354	0.9779005524861878	567	0.9912587412587412	754	0.9947229551451188	g	5.642	0.303067	0.10678	0.942697	0.999285	ENSG00000177508	ENST00000329734	T	0.54279	0.58	4.4	2.45	0.29901	.	0.652897	0.14990	N	0.286760	T	0.00012	0.0000	N	0.01352	-0.895	0.29914	P	0.82336	B	0.02656	0.0	B	0.01281	0.0	T	0.21861	-1.0233	9	0.33940	T	0.23	-4.0049	5.143	0.14969	0.1733:0.0:0.6627:0.164	rs1450355;rs17852160;rs60836119	422	P78415	IRX3_HUMAN	P	422	ENSP00000331608:L422P	ENSP00000331608:L422P	L	-	2	0	IRX3	52876029	1.000000	0.71417	0.984000	0.44739	0.000000	0.00434	1.455000	0.35190	0.155000	0.19261	-1.528000	0.00924	CTG	T|0.035;G|0.004		0.776	IRX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256910.2		
NDRG4	65009	bcgsc.ca	37	16	58545426	58545426	+	Silent	SNP	A	A	G	rs42945	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr16:58545426A>G	ENST00000570248.1	+	15	1111	c.1005A>G	c.(1003-1005)tcA>tcG	p.S335S	NDRG4_ENST00000356752.4_Silent_p.S352S|NDRG4_ENST00000394282.4_Silent_p.S374S|NDRG4_ENST00000394279.2_Silent_p.S354S|NDRG4_ENST00000563799.1_Silent_p.S340S|NDRG4_ENST00000569923.1_Silent_p.S267S|NDRG4_ENST00000566192.1_Silent_p.S322S|NDRG4_ENST00000568640.1_Silent_p.S340S|NDRG4_ENST00000258187.5_Silent_p.S354S|NDRG4_ENST00000562999.1_Silent_p.S310S	NM_001242835.1	NP_001229764.1	Q9ULP0	NDRG4_HUMAN	NDRG family member 4	335					cell differentiation (GO:0030154)|cell growth (GO:0016049)|response to stress (GO:0006950)	cytoplasm (GO:0005737)				breast(1)|endometrium(3)|large_intestine(1)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	11						GCACCCACTCAGAGAGCAGCG	0.682													G|||	4078	0.814297	0.9561	0.7392	5008	,	,		15744	0.9673		0.5577	False		,,,				2504	0.7822				p.S374S		.											.	NDRG4-91	0			c.A1122G						.	G	,,,,,,	3883,513	222.3+/-239.2	1720,443,35	61.0	58.0	59.0		1122,1056,1020,1005,966,1062,1062	-8.2	0.1	16	dbSNP_76	59	4614,3980	526.3+/-380.9	1237,2140,920	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	NDRG4	NM_001130487.1,NM_001242833.1,NM_001242834.1,NM_001242835.1,NM_001242836.1,NM_020465.3,NM_022910.3	,,,,,,	2957,2583,955	GG,GA,AA		46.3114,11.6697,34.5881	,,,,,,	374/392,352/370,340/358,335/353,322/340,354/372,354/372	58545426	8497,4493	2198	4297	6495	SO:0001819	synonymous_variant	65009	exon16			CCACTCAGAGAGC	AB044947	CCDS10797.1, CCDS45500.1, CCDS55999.1, CCDS58465.1, CCDS58466.1, CCDS58467.1	16q21-q22.3	2008-07-04			ENSG00000103034	ENSG00000103034			14466	protein-coding gene	gene with protein product		614463				11352569, 16408304	Standard	NM_020465		Approved	KIAA1180, SMAP-8	uc002enk.3	Q9ULP0	OTTHUMG00000133485	ENST00000570248.1:c.1005A>G	16.37:g.58545426A>G		Somatic	190	2		WXS	Illumina GAIIx	Phase_I	269	8	NM_001130487	0	0	14	14	0	B3KNU2|B4DK66|B4DSW5|H7C600|Q6ZNE7|Q6ZTI7|Q96PL9|Q9GZM1|Q9GZN3|Q9GZX0	Silent	SNP	ENST00000570248.1	37	CCDS58466.1																																																																																			A|0.274;G|0.726		0.682	NDRG4-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000422671.2		
CENPT	80152	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	67859153	67859153	+	IGR	SNP	C	C	G			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr16:67859153C>G	ENST00000562787.1	-	0	2345				TSNAXIP1_ENST00000388833.3_Missense_Mutation_p.D210E|TSNAXIP1_ENST00000561639.1_Missense_Mutation_p.D264E|TSNAXIP1_ENST00000562321.1_3'UTR|TSNAXIP1_ENST00000415766.3_Missense_Mutation_p.D195E	NM_025082.3	NP_079358.3	Q96BT3	CENPT_HUMAN	centromere protein T						chromosome organization (GO:0051276)|chromosome segregation (GO:0007059)|kinetochore assembly (GO:0051382)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|lung(6)|urinary_tract(1)	10		Acute lymphoblastic leukemia(13;0.000299)|all_hematologic(13;0.0184)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00429)|Epithelial(162;0.019)|all cancers(182;0.124)		AGCGGGAGGACATGTCATTAG	0.547																																					p.D210E		.											.	TSNAXIP1-90	0			c.C630G						.						95.0	100.0	98.0					16																	67859153		2071	4204	6275	SO:0001628	intergenic_variant	55815	exon7			GGAGGACATGTCA	AK056097	CCDS42182.1	16q22.1	2013-11-05	2006-06-15	2006-06-15		ENSG00000102901			25787	protein-coding gene	gene with protein product		611510	"""chromosome 16 open reading frame 56"""	C16orf56		16622420, 16622419	Standard	NM_025082		Approved	FLJ13111, CENP-T	uc002eun.4	Q96BT3			16.37:g.67859153C>G		Somatic	164	0		WXS	Illumina GAIIx	Phase_I	129	44	NM_018430	0	0	0	0	0	Q96I29|Q96IC6|Q96NK9|Q9H901	Missense_Mutation	SNP	ENST00000562787.1	37	CCDS42182.1	.	.	.	.	.	.	.	.	.	.	C	14.97	2.695102	0.48202	.	.	ENSG00000102904	ENST00000415766;ENST00000388833	T;T	0.00949	5.51;5.51	6.07	2.94	0.34122	.	0.160684	0.42172	D	0.000753	T	0.00998	0.0033	L	0.39898	1.24	0.30934	N	0.726607	B;P;P	0.51537	0.394;0.946;0.734	B;B;B	0.43155	0.12;0.41;0.301	T	0.51911	-0.8645	10	0.23891	T	0.37	-31.9849	6.8622	0.24074	0.0:0.7006:0.1443:0.1551	.	195;264;210	E7ENJ7;B4DXD0;Q2TAA8	.;.;TXIP1_HUMAN	E	195;210	ENSP00000411472:D195E;ENSP00000373485:D210E	ENSP00000373485:D210E	D	+	3	2	TSNAXIP1	66416654	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	0.314000	0.19432	0.903000	0.36546	0.655000	0.94253	GAC	.		0.547	CENPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422020.1	NM_025082	
ZNF23	7571	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	71482631	71482631	+	Missense_Mutation	SNP	A	A	T			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr16:71482631A>T	ENST00000393539.2	-	6	2110	c.1297T>A	c.(1297-1299)Tcc>Acc	p.S433T	ZNF23_ENST00000358700.2_3'UTR|ZNF23_ENST00000539742.1_5'UTR|ZNF23_ENST00000497160.1_3'UTR|AC010547.9_ENST00000561908.1_3'UTR|ZNF23_ENST00000564528.1_Missense_Mutation_p.S375T|ZNF23_ENST00000428724.2_Missense_Mutation_p.S375T|ZNF23_ENST00000417828.1_Missense_Mutation_p.S433T|ZNF23_ENST00000357254.4_Missense_Mutation_p.S433T	NM_145911.1	NP_666016.1	P17027	ZNF23_HUMAN	zinc finger protein 23	433					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(14)|stomach(1)|urinary_tract(1)	29		Ovarian(137;0.00768)		BRCA - Breast invasive adenocarcinoma(221;0.0686)		CGAAATTGGGAGTTACATCTG	0.468																																					p.S433T		.											.	ZNF23-90	0			c.T1297A						.						60.0	59.0	59.0					16																	71482631		2198	4300	6498	SO:0001583	missense	7571	exon6			ATTGGGAGTTACA	X52347	CCDS10900.1	16q22.2	2013-03-28	2012-07-12		ENSG00000167377	ENSG00000167377		"""Zinc fingers, C2H2-type"""	13023	protein-coding gene	gene with protein product		194527	"""zinc finger protein 359"""	ZNF359			Standard	NM_145911		Approved	KOX16, Zfp612, ZNF612	uc002faf.3	P17027	OTTHUMG00000176797	ENST00000393539.2:c.1297T>A	16.37:g.71482631A>T	ENSP00000377171:p.Ser433Thr	Somatic	39	0		WXS	Illumina GAIIx	Phase_I	33	7	NM_145911	0	0	4	5	1	Q8NDP5|Q96IT3|Q9UG42	Missense_Mutation	SNP	ENST00000393539.2	37	CCDS10900.1	.	.	.	.	.	.	.	.	.	.	A	11.28	1.591533	0.28357	.	.	ENSG00000167377	ENST00000393539;ENST00000357254;ENST00000417828;ENST00000428724;ENST00000539742;ENST00000358700	T;T;T;T	0.07567	3.18;3.18;3.18;3.18	4.27	4.27	0.50696	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.165369	0.29300	N	0.012547	T	0.13798	0.0334	M	0.76002	2.32	0.09310	N	0.999999	B;P	0.43938	0.171;0.822	B;B	0.41946	0.108;0.371	T	0.11203	-1.0597	10	0.66056	D	0.02	-9.1116	12.0056	0.53257	1.0:0.0:0.0:0.0	.	433;433	B3KR55;P17027	.;ZNF23_HUMAN	T	433;433;433;375;375;205	ENSP00000377171:S433T;ENSP00000349796:S433T;ENSP00000395712:S433T;ENSP00000387673:S375T	ENSP00000349796:S433T	S	-	1	0	ZNF23	70040132	0.000000	0.05858	0.980000	0.43619	0.460000	0.32559	0.462000	0.21956	2.148000	0.66965	0.459000	0.35465	TCC	.		0.468	ZNF23-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268985.23	NM_145911	
ADAD2	161931	hgsc.bcm.edu	37	16	84224967	84224967	+	Missense_Mutation	SNP	G	G	A	rs8044695|rs554488585	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr16:84224967G>A	ENST00000315906.5	+	1	183	c.131G>A	c.(130-132)gGg>gAg	p.G44E	RP11-486L19.2_ENST00000536986.1_RNA|ADAD2_ENST00000567413.1_3'UTR|ADAD2_ENST00000268624.3_Missense_Mutation_p.G44E|RP11-486L19.2_ENST00000561900.1_RNA|RP11-486L19.2_ENST00000565643.1_RNA	NM_001145400.1	NP_001138872.1	Q8NCV1	ADAD2_HUMAN	adenosine deaminase domain containing 2	44			G -> E (in dbSNP:rs8044695). {ECO:0000269|PubMed:14702039, ECO:0000269|Ref.3}.		RNA processing (GO:0006396)		adenosine deaminase activity (GO:0004000)|RNA binding (GO:0003723)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(2)|skin(1)	13						AGTGCCTgggggcccgcgccc	0.751														3435	0.685903	0.8616	0.6686	5008	,	,		11640	0.6677		0.6471	False		,,,				2504	0.5194				p.G44E		.											.	ADAD2-68	0			c.G131A						.	A	GLU/GLY,GLU/GLY	3145,519		1356,433,43	5.0	7.0	7.0		131,131	-1.1	0.0	16	dbSNP_116	7	5102,2224		1808,1486,369	no	missense,missense	ADAD2	NM_001145400.1,NM_139174.3	98,98	3164,1919,412	AA,AG,GG		30.3576,14.1648,24.9591	benign,benign	44/584,44/666	84224967	8247,2743	1832	3663	5495	SO:0001583	missense	161931	exon1			CCTGGGGGCCCGC	AF447586	CCDS10944.1, CCDS45536.1	16q24.1	2007-05-31			ENSG00000140955	ENSG00000140955			30714	protein-coding gene	gene with protein product							Standard	NM_139174		Approved	TENRL, FLJ00337	uc002fhr.2	Q8NCV1	OTTHUMG00000137637	ENST00000315906.5:c.131G>A	16.37:g.84224967G>A	ENSP00000325153:p.Gly44Glu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_001145400	0	0	0	0	0	B2RCL6|Q8NA94	Missense_Mutation	SNP	ENST00000315906.5	37	CCDS45536.1	1545	0.7074175824175825	420	0.8536585365853658	227	0.6270718232044199	403	0.7045454545454546	495	0.6530343007915568	A	0.689	-0.795256	0.02862	0.858352	0.696424	ENSG00000140955	ENST00000315906;ENST00000268624	T;T	0.16196	2.36;2.47	3.61	-1.07	0.09968	.	1.276770	0.06034	N	0.653713	T	0.00012	0.0000	N	0.01874	-0.695	0.80722	P	0.0	B;B	0.06786	0.0;0.001	B;B	0.04013	0.0;0.001	T	0.30297	-0.9983	9	0.02654	T	1	-5.6132	8.9029	0.35505	0.4397:0.0:0.5603:0.0	rs8044695;rs57310648	44;44	Q8NCV1;Q8NCV1-2	ADAD2_HUMAN;.	E	44	ENSP00000325153:G44E;ENSP00000268624:G44E	ENSP00000268624:G44E	G	+	2	0	ADAD2	82782468	0.057000	0.20700	0.000000	0.03702	0.002000	0.02628	-0.069000	0.11542	-0.575000	0.05982	-1.305000	0.01319	GGG	G|0.292;A|0.708		0.751	ADAD2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433385.1	NM_139174	
ATP2C2	9914	broad.mit.edu	37	16	84456017	84456017	+	Nonsense_Mutation	SNP	G	G	T			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr16:84456017G>T	ENST00000262429.4	+	8	735	c.646G>T	c.(646-648)Gaa>Taa	p.E216*	ATP2C2_ENST00000416219.2_Nonsense_Mutation_p.E216*|ATP2C2_ENST00000420010.2_3'UTR	NM_014861.2	NP_055676.2	O75185	AT2C2_HUMAN	ATPase, Ca++ transporting, type 2C, member 2	216					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(3)|skin(5)|urinary_tract(1)	33						CTTGGTGGATGAATCCAGTTT	0.537																																					p.E216X		.											.	ATP2C2-91	0			c.G646T						.						85.0	89.0	88.0					16																	84456017		1953	4155	6108	SO:0001587	stop_gained	9914	exon8			GTGGATGAATCCA	AK091051	CCDS42207.1, CCDS67088.1	16q24.1	2010-04-20			ENSG00000064270	ENSG00000064270	3.6.3.8	"""ATPases / P-type"""	29103	protein-coding gene	gene with protein product	"""secretory pathway calcium ATPase 2"""	613082				9734811	Standard	XM_006721355		Approved	KIAA0703, SPCA2	uc002fhx.3	O75185		ENST00000262429.4:c.646G>T	16.37:g.84456017G>T	ENSP00000262429:p.Glu216*	Somatic	231	0		WXS	Illumina GAIIx	Phase_I	169	5	NM_014861	0	0	0	0	0	B4DU76|E7ES94|Q5HYC3|Q5S053|Q68CQ2	Nonsense_Mutation	SNP	ENST00000262429.4	37	CCDS42207.1	.	.	.	.	.	.	.	.	.	.	G	37	6.255563	0.97417	.	.	ENSG00000064270	ENST00000416219;ENST00000262429;ENST00000420010	.	.	.	5.04	5.04	0.67666	.	0.000000	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	16.9295	0.86186	0.0:0.0:1.0:0.0	.	.	.	.	X	216;216;65	.	ENSP00000262429:E216X	E	+	1	0	ATP2C2	83013518	1.000000	0.71417	0.958000	0.39756	0.696000	0.40369	9.101000	0.94219	2.316000	0.78162	0.563000	0.77884	GAA	.		0.537	ATP2C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433404.1	NM_014861	
ZFPM1	161882	hgsc.bcm.edu	37	16	88599696	88599697	+	Frame_Shift_Del	DEL	GA	GA	-	rs368520732|rs67712719	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	GA	GA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr16:88599696_88599697delGA	ENST00000319555.3	+	10	1652_1653	c.1330_1331delGA	c.(1330-1332)gagfs	p.E444fs	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	444				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GGCCAGAGCGGAGCCTCTGGCC	0.743														4881	0.974641	0.9138	0.9914	5008	,	,		7261	0.996		1.0	False		,,,				2504	0.9969				p.444_444del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1330_1331del						.			2219,383		1063,93,145						-6.5	0.0		dbSNP_130	3	4709,133		2339,31,51	no	frameshift	ZFPM1	NM_153813.2		3402,124,196	A1A1,A1R,RR		2.7468,14.7194,6.9318				6928,516				SO:0001589	frameshift_variant	161882	exon10			AGAGCGGAGCCTC	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1330_1331delGA	16.37:g.88599696_88599697delGA	ENSP00000326630:p.Glu444fs	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	17	13	NM_153813	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.743	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
ZFPM1	161882	hgsc.bcm.edu	37	16	88599697	88599705	+	In_Frame_Del	DEL	AGCCTCTGG	AGCCTCTGG	-	rs67873604|rs149145771|rs368520732|rs67322929|rs201915453|rs67712719	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	AGCCTCTGG	AGCCTCTGG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr16:88599697_88599705delAGCCTCTGG	ENST00000319555.3	+	10	1653_1661	c.1331_1339delAGCCTCTGG	c.(1330-1341)gagcctctggcc>gcc	p.EPL444del	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	444				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GCCAGAGCGGAGCCTCTGGCCCAGAATGG	0.746																																					p.444_447del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1331_1339del						.																																			SO:0001651	inframe_deletion	161882	exon10			GAGCGGAGCCTCT	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1331_1339delAGCCTCTGG	16.37:g.88599697_88599705delAGCCTCTGG	ENSP00000326630:p.Glu444_Leu446del	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	16	0	NM_153813	0	0	0	0	0		In_Frame_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.746	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
ZFPM1	161882	hgsc.bcm.edu	37	16	88599701	88599701	+	Frame_Shift_Del	DEL	T	T	-	rs67322929|rs149145771	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr16:88599701delT	ENST00000319555.3	+	10	1657	c.1335delT	c.(1333-1335)cctfs	p.P445fs	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	445				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GAGCGGAGCCTCTGGCCCAGA	0.746													-|T|-|insertion	4871	0.972644	0.9145	0.9899	5008	,	,		7405	0.995		0.994	False		,,,				2504	0.9939				p.P445fs	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1335delT						.						1.0	1.0	1.0					16																	88599701		392	657	1049	SO:0001589	frameshift_variant	161882	exon10			GGAGCCTCTGGCC	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1335delT	16.37:g.88599701delT	ENSP00000326630:p.Pro445fs	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	14	10	NM_153813	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.746	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
ZFPM1	161882	hgsc.bcm.edu	37	16	88599703	88599705	+	In_Frame_Del	DEL	TGG	TGG	-	rs149145771|rs67873604	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	TGG	TGG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr16:88599703_88599705delTGG	ENST00000319555.3	+	10	1659_1661	c.1337_1339delTGG	c.(1336-1341)ctggcc>ccc	p.446_447LA>P	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	446				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GCGGAGCCTCTGGCCCAGAATGG	0.739														4871	0.972644	0.9145	0.9899	5008	,	,		7191	0.995		0.994	False		,,,				2504	0.9939				p.446_447del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1337_1339del						.																																			SO:0001651	inframe_deletion	161882	exon10			AGCCTCTGGCCCA	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1337_1339delTGG	16.37:g.88599703_88599705delTGG	ENSP00000326630:p.Leu446_Ala447delinsPro	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	13	10	NM_153813	0	0	0	0	0		In_Frame_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.739	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
RPL13	6137	hgsc.bcm.edu	37	16	89627671	89627671	+	Silent	SNP	C	C	T	rs174035	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr16:89627671C>T	ENST00000393099.3	+	2	390	c.141C>T	c.(139-141)gcC>gcT	p.A47A	RPL13_ENST00000311528.5_Silent_p.A47A|RPL13_ENST00000452368.3_Silent_p.A47A|SNORD68_ENST00000363214.1_RNA|RPL13_ENST00000567815.1_Silent_p.A47A	NM_033251.2	NP_150254.1	P26373	RL13_HUMAN	ribosomal protein L13	47					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|cytosolic ribosome (GO:0022626)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			lung(3)|skin(1)|upper_aerodigestive_tract(2)	6		all_hematologic(23;0.0748)		all cancers(4;1.15e-07)|OV - Ovarian serous cystadenocarcinoma(4;7.8e-06)|BRCA - Breast invasive adenocarcinoma(80;0.0139)		GCCGCATCGCCCCGCGCCCCG	0.741													C|||	720	0.14377	0.1256	0.1282	5008	,	,		12083	0.13		0.1839	False		,,,				2504	0.1524				p.A47A		.											.	RPL13-90	0			c.C141T						.	C	,	382,2954		24,334,1310	3.0	4.0	3.0		141,141	0.9	1.0	16	dbSNP_79	3	1125,5851		71,983,2434	no	coding-synonymous,coding-synonymous	RPL13	NM_000977.3,NM_033251.2	,	95,1317,3744	TT,TC,CC		16.1267,11.4508,14.614	,	47/212,47/212	89627671	1507,8805	1668	3488	5156	SO:0001819	synonymous_variant	6137	exon3			CATCGCCCCGCGC	AB007172	CCDS10979.1, CCDS58492.1	16q24.3	2011-04-06			ENSG00000167526	ENSG00000167526		"""L ribosomal proteins"""	10303	protein-coding gene	gene with protein product		113703				9582194	Standard	NM_000977		Approved	D16S444E, BBC1, L13	uc002fnm.2	P26373	OTTHUMG00000133770	ENST00000393099.3:c.141C>T	16.37:g.89627671C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	12	12	NM_001243131	1	5	2	1487	1479	B4DLX3|F5H1S2|Q3KQT8|Q567Q8|Q9BPX0	Silent	SNP	ENST00000393099.3	37	CCDS10979.1																																																																																			C|0.846;T|0.154		0.741	RPL13-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258294.2	NM_000977	
PELP1	27043	bcgsc.ca	37	17	4576620	4576620	+	Silent	SNP	C	C	T	rs55677157	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr17:4576620C>T	ENST00000574876.1	-	15	1787	c.1770G>A	c.(1768-1770)ccG>ccA	p.P590P	PELP1_ENST00000301396.4_Silent_p.P734P|PELP1_ENST00000572293.1_Silent_p.P640P|AC091153.4_ENST00000441700.2_RNA|PELP1_ENST00000436683.2_Silent_p.P443P|PELP1_ENST00000269230.7_Intron			Q8IZL8	PELP1_HUMAN	proline, glutamate and leucine rich protein 1	590					cellular response to estrogen stimulus (GO:0071391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|MLL1 complex (GO:0071339)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcriptionally active chromatin (GO:0035327)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(2)|endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	15						AGCGAGGAGACGGGGCCAGCA	0.652													C|||	425	0.0848642	0.0484	0.1282	5008	,	,		16334	0.003		0.2117	False		,,,				2504	0.0573				p.P590P		.											.	PELP1-24	0			c.G1770A						.	C		292,4018		12,268,1875	19.0	30.0	27.0		1770	-3.2	0.9	17	dbSNP_129	27	1899,6647		204,1491,2578	no	coding-synonymous	PELP1	NM_014389.2		216,1759,4453	TT,TC,CC		22.2209,6.7749,17.0426		590/1131	4576620	2191,10665	2155	4273	6428	SO:0001819	synonymous_variant	27043	exon15			AGGAGACGGGGCC		CCDS58503.1, CCDS58503.2, CCDS62038.1	17p13.2	2012-05-02	2008-02-21			ENSG00000141456			30134	protein-coding gene	gene with protein product		609455	"""proline, glutamic acid and leucine rich protein 1"""			11481323, 12682072	Standard	NM_014389		Approved	MNAR	uc002fyi.4	Q8IZL8		ENST00000574876.1:c.1770G>A	17.37:g.4576620C>T		Somatic	227	3		WXS	Illumina GAIIx	Phase_I	140	6	NM_014389	0	0	16	16	0	O15450|Q5EGN3|Q6NTE6|Q96FT1|Q9BU60	Silent	SNP	ENST00000574876.1	37	CCDS58503.1																																																																																			C|0.892;T|0.108		0.652	PELP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000439140.2	NM_014389	
NUFIP2	57532	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	27614591	27614591	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr17:27614591C>G	ENST00000225388.4	-	2	479	c.421G>C	c.(421-423)Gcc>Ccc	p.A141P	NUFIP2_ENST00000579665.1_Intron	NM_020772.2	NP_065823.1	Q7Z417	NUFP2_HUMAN	nuclear fragile X mental retardation protein interacting protein 2	141						cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|polysomal ribosome (GO:0042788)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|liver(1)|lung(7)|ovary(1)|prostate(2)|skin(4)|urinary_tract(1)	24			BRCA - Breast invasive adenocarcinoma(11;0.000457)|Colorectal(6;0.0178)|COAD - Colon adenocarcinoma(6;0.0551)			AAGGTGTTGGCCTTTACAGTC	0.403																																					p.A141P		.											.	NUFIP2-138	0			c.G421C						.						123.0	121.0	122.0					17																	27614591		2203	4300	6503	SO:0001583	missense	57532	exon2			TGTTGGCCTTTAC	AB037742	CCDS32600.1	17q11.1	2006-03-01				ENSG00000108256			17634	protein-coding gene	gene with protein product		609356				12837692, 16407062	Standard	NM_020772		Approved	KIAA1321, MGC117262, PIG1, 182-FIP, FIP-82, 82-FIP	uc002hdy.4	Q7Z417		ENST00000225388.4:c.421G>C	17.37:g.27614591C>G	ENSP00000225388:p.Ala141Pro	Somatic	78	0		WXS	Illumina GAIIx	Phase_I	142	53	NM_020772	0	0	6	10	4	A1L3A6|Q9P2M5	Missense_Mutation	SNP	ENST00000225388.4	37	CCDS32600.1	.	.	.	.	.	.	.	.	.	.	C	6.137	0.393502	0.11638	.	.	ENSG00000108256	ENST00000225388	.	.	.	6.17	-8.13	0.01073	.	0.734910	0.13547	N	0.379797	T	0.15955	0.0384	N	0.14661	0.345	0.30574	N	0.763219	B	0.02656	0.0	B	0.08055	0.003	T	0.03993	-1.0986	9	0.59425	D	0.04	1.7998	1.5743	0.02621	0.2715:0.268:0.0829:0.3776	.	141	Q7Z417	NUFP2_HUMAN	P	141	.	ENSP00000225388:A141P	A	-	1	0	NUFIP2	24638717	0.187000	0.23238	0.629000	0.29254	0.640000	0.38277	-0.558000	0.05978	-1.305000	0.02327	-0.838000	0.03060	GCC	.		0.403	NUFIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447015.2	NM_020772	
NR1D1	9572	hgsc.bcm.edu;bcgsc.ca	37	17	38252715	38252716	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	AG	AG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr17:38252715_38252716delAG	ENST00000246672.3	-	4	1214_1215	c.584_585delCT	c.(583-585)tctfs	p.S195fs		NM_021724.3	NP_068370.1	P20393	NR1D1_HUMAN	nuclear receptor subfamily 1, group D, member 1	195	Crucial for activation of GJA1. {ECO:0000250}.				cell differentiation (GO:0030154)|cellular response to lipopolysaccharide (GO:0071222)|circadian regulation of gene expression (GO:0032922)|circadian temperature homeostasis (GO:0060086)|gene expression (GO:0010467)|glycogen biosynthetic process (GO:0005978)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of receptor biosynthetic process (GO:0010871)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of bile acid biosynthetic process (GO:0070859)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasomal protein catabolic process (GO:0010498)|regulation of cholesterol homeostasis (GO:2000188)|regulation of circadian rhythm (GO:0042752)|regulation of fat cell differentiation (GO:0045598)|regulation of gluconeogenesis by regulation of transcription from RNA polymerase II promoter (GO:0035947)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of lipid metabolic process (GO:0019216)|regulation of type B pancreatic cell proliferation (GO:0061469)|response to leptin (GO:0044321)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|heme binding (GO:0020037)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|steroid hormone receptor activity (GO:0003707)|transcription corepressor activity (GO:0003714)|transcription corepressor binding (GO:0001222)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(5)|lung(2)|skin(1)|upper_aerodigestive_tract(2)	11	Colorectal(19;0.000442)					ACATGCCCACAGAGAGACACTT	0.49																																					p.195_195del		.											.	NR1D1-226	0			c.584_585del						.																																			SO:0001589	frameshift_variant	9572	exon4			GCCCACAGAGAGA	X72631	CCDS11361.1	17q11.2	2013-01-16			ENSG00000126368	ENSG00000126368		"""Nuclear hormone receptors"""	7962	protein-coding gene	gene with protein product		602408		THRAL		1971514	Standard	NM_021724		Approved	ear-1, hRev, Rev-ErbAalpha, THRA1	uc002htz.3	P20393	OTTHUMG00000133327	ENST00000246672.3:c.584_585delCT	17.37:g.38252719_38252720delAG	ENSP00000246672:p.Ser195fs	Somatic	178	1		WXS	Illumina GAIIx	Phase_I	191	86	NM_021724	0	0	0	0	0	Q0P5Z4|Q15304	Frame_Shift_Del	DEL	ENST00000246672.3	37	CCDS11361.1																																																																																			.		0.490	NR1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257135.1		
KRTAP9-1	728318	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	17	39346567	39346567	+	Nonsense_Mutation	SNP	C	C	A	rs148036927		TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr17:39346567C>A	ENST00000398470.1	+	1	429	c.429C>A	c.(427-429)tgC>tgA	p.C143*	KRTAP9-1_ENST00000318329.5_Nonsense_Mutation_p.C60*|KRTAP9-1_ENST00000377723.3_Intron	NM_001190460.1	NP_001177389.1	A8MXZ3	KRA91_HUMAN	keratin associated protein 9-1	143	30 X 5 AA repeats of C-C-[CGSVRQH]- [SQTNP]-[PTSI].					keratin filament (GO:0045095)				breast(1)|lung(3)	4						AGCCCACCTGCTGCAGGAACA	0.587																																					p.C143X		.											.	.	0			c.C429A						.																																			SO:0001587	stop_gained	728318	exon1			CACCTGCTGCAGG	AC006070	CCDS56029.1	17q21.2	2010-06-03			ENSG00000240542	ENSG00000240542		"""Keratin associated proteins"""	18912	protein-coding gene	gene with protein product			"""keratin associated protein 9-like 3"""	KRTAP9L3			Standard	NM_001190460		Approved	KAP9.1	uc021txf.1	A8MXZ3	OTTHUMG00000133636	ENST00000398470.1:c.429C>A	17.37:g.39346567C>A	ENSP00000381488:p.Cys143*	Somatic	146	0		WXS	Illumina GAIIx	Phase_I	205	46	NM_001190460	0	0	0	0	0		Nonsense_Mutation	SNP	ENST00000398470.1	37	CCDS56029.1	.	.	.	.	.	.	.	.	.	.	C	12.82	2.052086	0.36181	.	.	ENSG00000240542	ENST00000398470;ENST00000318329	.	.	.	3.39	2.35	0.29111	.	.	.	.	.	.	.	.	.	.	.	0.58432	D	0.999998	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.4334	0.32773	0.0:0.864:0.0:0.136	.	.	.	.	X	143;60	.	ENSP00000325023:C60X	C	+	3	2	KRTAP9-1	36600093	0.857000	0.29778	0.088000	0.20740	0.058000	0.15608	1.015000	0.29963	0.647000	0.30713	0.205000	0.17691	TGC	.		0.587	KRTAP9-1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257781.1		
KRT33A	3883	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	39505635	39505635	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr17:39505635C>A	ENST00000007735.3	-	2	438	c.394G>T	c.(394-396)Gac>Tac	p.D132Y		NM_004138.3	NP_004129.2	O76009	KT33A_HUMAN	keratin 33A	132	Coil 1B.|Rod.					extracellular space (GO:0005615)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	21		Breast(137;0.000496)				TTGGCATTGTCGATCTGCACC	0.488																																					p.D132Y		.											.	KRT33A-90	0			c.G394T						.						119.0	107.0	111.0					17																	39505635		2203	4300	6503	SO:0001583	missense	3883	exon2			CATTGTCGATCTG	Y16788	CCDS11388.1	17q21.2	2013-06-20	2006-07-17	2006-07-17	ENSG00000006059	ENSG00000006059		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6450	protein-coding gene	gene with protein product	"""hard keratin type I 3I"""	602761	"""keratin, hair, acidic, 3A"""	KRTHA3A		7565656, 16831889	Standard	NM_004138		Approved	Ha-3I, Krt1-3	uc002hwk.2	O76009	OTTHUMG00000133432	ENST00000007735.3:c.394G>T	17.37:g.39505635C>A	ENSP00000007735:p.Asp132Tyr	Somatic	171	0		WXS	Illumina GAIIx	Phase_I	208	62	NM_004138	0	0	0	0	0	B2RA87|Q6NTB9|Q6ZZB9	Missense_Mutation	SNP	ENST00000007735.3	37	CCDS11388.1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.754895	0.89843	.	.	ENSG00000006059	ENST00000007735	D	0.90261	-2.64	5.03	5.03	0.67393	Filament (1);	0.090873	0.48286	D	0.000192	D	0.97213	0.9089	H	0.97265	3.97	0.58432	D	0.99999	D	0.89917	1.0	D	0.91635	0.999	D	0.98310	1.0523	10	0.87932	D	0	.	17.8727	0.88815	0.0:1.0:0.0:0.0	.	132	O76009	KT33A_HUMAN	Y	132	ENSP00000007735:D132Y	ENSP00000007735:D132Y	D	-	1	0	KRT33A	36759161	1.000000	0.71417	0.987000	0.45799	0.990000	0.78478	7.462000	0.80851	2.760000	0.94817	0.655000	0.94253	GAC	.		0.488	KRT33A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257295.1	NM_004138	
UBTF	7343	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	42288160	42288162	+	Splice_Site	DEL	CTT	CTT	-			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	CTT	CTT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr17:42288160_42288162delCTT	ENST00000302904.4	-	13	1849_1851	c.1357_1359delAAG	c.(1357-1359)aagdel	p.K453del	UBTF_ENST00000393606.3_Splice_Site_p.K416del|UBTF_ENST00000527034.1_Splice_Site_p.K416del|CTB-175E5.7_ENST00000586560.1_RNA|UBTF_ENST00000526094.1_Splice_Site_p.K416del|UBTF_ENST00000436088.1_Splice_Site_p.K453del|UBTF_ENST00000529383.1_Splice_Site_p.K453del|UBTF_ENST00000533177.1_Splice_Site_p.K416del|UBTF_ENST00000343638.5_Splice_Site_p.K416del			P17480	UBF1_HUMAN	upstream binding transcription factor, RNA polymerase I	453					chromatin silencing at rDNA (GO:0000183)|gene expression (GO:0010467)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(9)|lung(10)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Breast(137;0.00765)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.114)		GCAGCCTGACCTTCTTCTTCTCA	0.709																																					p.453_453del		.											.	UBTF-90	0			c.1357_1359del						.																																			SO:0001630	splice_region_variant	7343	exon13			CCTGACCTTCTTC	BC042297	CCDS11480.1, CCDS42346.1	17q21.31	2014-03-25			ENSG00000108312	ENSG00000108312			12511	protein-coding gene	gene with protein product		600673				9126496	Standard	NM_001076683		Approved	UBF, NOR-90, UBF1, UBF2	uc010czs.3	P17480	OTTHUMG00000167585	ENST00000302904.4:c.1359+1AAG>-	17.37:g.42288166_42288168delCTT		Somatic	59	0		WXS	Illumina GAIIx	Phase_I	128	53	NM_014233	0	0	0	0	0	A8K6R8	In_Frame_Del	DEL	ENST00000302904.4	37	CCDS11480.1																																																																																			.		0.709	UBTF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395205.1	NM_014233	In_Frame_Del
CBX4	8535	hgsc.bcm.edu;broad.mit.edu	37	17	77807927	77807927	+	Missense_Mutation	SNP	A	A	G	rs200965379		TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr17:77807927A>G	ENST00000269397.4	-	5	1691	c.1514T>C	c.(1513-1515)gTg>gCg	p.V505A		NM_003655.2	NP_003646.2	O00257	CBX4_HUMAN	chromobox homolog 4	505	Interaction with BMI1.|Poly-Ala.			V -> VAA (in Ref. 3; ACA49234). {ECO:0000305}.	chromatin modification (GO:0016568)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein sumoylation (GO:0016925)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|single-stranded RNA binding (GO:0003727)|SUMO binding (GO:0032183)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(3)|skin(2)|urinary_tract(1)	18			OV - Ovarian serous cystadenocarcinoma(97;0.0102)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			tgccgccgccaccgccaccgc	0.711																																					p.V505A		.											.	CBX4-228	0			c.T1514C						.						15.0	21.0	19.0					17																	77807927		1776	3704	5480	SO:0001583	missense	8535	exon5			GCCGCCACCGCCA	AF013956	CCDS32758.1	17q25.3	2010-07-06	2010-06-24		ENSG00000141582	ENSG00000141582			1554	protein-coding gene	gene with protein product	"""NS5ATP1-binding protein 16"", ""Pc class 2 homolog (Drosophila)"""	603079	"""chromobox homolog 4 (Drosophila Pc class)"""			9315667	Standard	NM_003655		Approved	hPC2, PC2, NBP16	uc002jxe.3	O00257	OTTHUMG00000150415	ENST00000269397.4:c.1514T>C	17.37:g.77807927A>G	ENSP00000269397:p.Val505Ala	Somatic	10	0		WXS	Illumina GAIIx	Phase_I	42	20	NM_003655	0	0	9	9	0	B1PJR7|Q6TPI8|Q96C04	Missense_Mutation	SNP	ENST00000269397.4	37	CCDS32758.1	.	.	.	.	.	.	.	.	.	.	a	0.008	-1.872700	0.00542	.	.	ENSG00000141582	ENST00000269397;ENST00000343048	.	.	.	0.575	0.575	0.17374	.	2.519730	0.02140	N	0.057046	T	0.20333	0.0489	N	0.08118	0	0.19775	N	0.999955	B	0.13594	0.008	B	0.04013	0.001	T	0.16217	-1.0410	8	0.32370	T	0.25	.	.	.	.	.	505	O00257	CBX4_HUMAN	A	505;235	.	ENSP00000269397:V505A	V	-	2	0	CBX4	75422522	0.000000	0.05858	0.005000	0.12908	0.005000	0.04900	0.179000	0.16840	0.475000	0.27415	0.158000	0.16466	GTG	.		0.711	CBX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318007.1	NM_003655	
CARD14	79092	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	78172210	78172210	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr17:78172210G>A	ENST00000573882.1	+	15	2207	c.1671G>A	c.(1669-1671)atG>atA	p.M557I	RP11-334C17.5_ENST00000570309.1_RNA|CARD14_ENST00000344227.2_Missense_Mutation_p.M557I|CARD14_ENST00000570421.1_Missense_Mutation_p.M557I|CARD14_ENST00000573754.1_3'UTR|CARD14_ENST00000392434.2_Missense_Mutation_p.M320I			Q9BXL6	CAR14_HUMAN	caspase recruitment domain family, member 14	557					activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein phosphorylation (GO:0001934)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)			NS(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(5)|prostate(1)|skin(1)	23	all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.017)|BRCA - Breast invasive adenocarcinoma(99;0.0908)			GCGTCCTCATGCGGCGGAGGC	0.677																																					p.M557I		.											.	CARD14-231	0			c.G1671A						.						30.0	29.0	29.0					17																	78172210		2203	4298	6501	SO:0001583	missense	79092	exon13			CCTCATGCGGCGG	AF322642	CCDS11768.1, CCDS58605.1	17q25.3	2014-09-04			ENSG00000141527	ENSG00000141527			16446	protein-coding gene	gene with protein product		607211	"""psoriasis susceptibility 2"""	PSORS2		11278692, 11356195, 22521418	Standard	NM_052819		Approved	CARMA2, BIMP2	uc031res.1	Q9BXL6	OTTHUMG00000177549	ENST00000573882.1:c.1671G>A	17.37:g.78172210G>A	ENSP00000458715:p.Met557Ile	Somatic	46	0		WXS	Illumina GAIIx	Phase_I	93	32	NM_024110	0	0	0	0	0	B8QQJ3|Q9BVB5	Missense_Mutation	SNP	ENST00000573882.1	37	CCDS11768.1	.	.	.	.	.	.	.	.	.	.	G	10.74	1.436114	0.25813	.	.	ENSG00000141527	ENST00000344227;ENST00000392434;ENST00000309710	T;T	0.25250	1.81;2.48	4.7	4.7	0.59300	.	1.629980	0.03498	N	0.217667	T	0.31513	0.0799	L	0.46157	1.445	0.25374	N	0.988676	B;B	0.15473	0.013;0.009	B;B	0.13407	0.009;0.003	T	0.31558	-0.9939	10	0.45353	T	0.12	-23.3447	14.5304	0.67920	0.0:0.0:1.0:0.0	.	320;557	E7ETJ2;Q9BXL6	.;CAR14_HUMAN	I	557;320;320	ENSP00000344549:M557I;ENSP00000376229:M320I	ENSP00000308507:M320I	M	+	3	0	CARD14	75786805	0.998000	0.40836	0.955000	0.39395	0.201000	0.24016	2.714000	0.47202	2.146000	0.66826	0.467000	0.42956	ATG	.		0.677	CARD14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437507.1		
SEH1L	81929	hgsc.bcm.edu	37	18	12955467	12955467	+	Silent	SNP	T	T	C			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr18:12955467T>C	ENST00000262124.11	+	3	295	c.168T>C	c.(166-168)caT>caC	p.H56H	SEH1L_ENST00000399892.2_Silent_p.H56H	NM_031216.3	NP_112493.2	Q96EE3	SEH1_HUMAN	SEH1-like (S. cerevisiae)	56					attachment of spindle microtubules to kinetochore involved in mitotic sister chromatid segregation (GO:0051315)|carbohydrate metabolic process (GO:0005975)|cytokine production involved in inflammatory response (GO:0002534)|cytokine-mediated signaling pathway (GO:0019221)|defense response to Gram-positive bacterium (GO:0050830)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic metaphase plate congression (GO:0007080)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore organization (GO:0006999)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nuclear envelope (GO:0005635)|nuclear pore outer ring (GO:0031080)		p.H56H(2)		central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(5)|pancreas(1)|prostate(1)	11						CCCAGACACATAGTGGATCTG	0.398																																					p.H56H		.											.	SEH1L-90	2	Substitution - coding silent(2)	prostate(1)|central_nervous_system(1)	c.T168C						.						150.0	135.0	140.0					18																	12955467		2203	4300	6503	SO:0001819	synonymous_variant	81929	exon3			GACACATAGTGGA	BC012430	CCDS32791.1, CCDS45832.1	18p11.21	2013-01-10				ENSG00000085415		"""WD repeat domain containing"""	30379	protein-coding gene	gene with protein product	"""sec13 like protein"", ""nucleoporin Seh1"""	609263				12196509, 14517296	Standard	XM_005258152		Approved	SEH1A, SEH1B, Seh1, SEC13L	uc002krq.3	Q96EE3		ENST00000262124.11:c.168T>C	18.37:g.12955467T>C		Somatic	68	0		WXS	Illumina GAIIx	Phase_I	99	5	NM_001013437	0	0	0	0	0	A8K5B1|Q8NFU6|Q96MH3|Q9C069	Silent	SNP	ENST00000262124.11	37	CCDS45832.1																																																																																			.		0.398	SEH1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458254.1	NM_031216	
IMPACT	55364	broad.mit.edu	37	18	22023012	22023012	+	Splice_Site	SNP	G	G	A			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr18:22023012G>A	ENST00000284202.4	+	7	631		c.e7-1			NM_018439.3	NP_060909	Q9P2X3	IMPCT_HUMAN	impact RWD domain protein						negative regulation of protein phosphorylation (GO:0001933)|regulation of translational initiation (GO:0006446)	cytoplasm (GO:0005737)				endometrium(1)|large_intestine(3)|lung(9)|skin(1)|upper_aerodigestive_tract(2)	16	all_cancers(21;0.00018)|all_epithelial(16;1.5e-06)|Lung NSC(20;0.0027)|all_lung(20;0.0085)|Colorectal(14;0.0361)|Ovarian(20;0.0991)					TACATTTCTAGAAGTAGAAGT	0.363																																					.		.											.	IMPACT-90	0			c.491-1G>A						.						93.0	89.0	91.0					18																	22023012		2203	4300	6503	SO:0001630	splice_region_variant	55364	exon7			TTTCTAGAAGTAG	AB026264	CCDS11886.1	18q11.2-q12.1	2012-12-07	2012-12-07		ENSG00000154059	ENSG00000154059			20387	protein-coding gene	gene with protein product	"""RWD domain containing 5"""	615319	"""Impact homolog (mouse)"""			11116084	Standard	NM_018439		Approved	RWDD5	uc002kvh.4	Q9P2X3	OTTHUMG00000131943	ENST00000284202.4:c.491-1G>A	18.37:g.22023012G>A		Somatic	48	0		WXS	Illumina GAIIx	Phase_I	34	6	NM_018439	0	0	0	0	0	A8MXG0|Q49AM0|Q9H2X4	Splice_Site	SNP	ENST00000284202.4	37	CCDS11886.1	.	.	.	.	.	.	.	.	.	.	G	6.487	0.457962	0.12342	.	.	ENSG00000154059	ENST00000284202	.	.	.	0.158	0.158	0.14942	.	.	.	.	.	.	.	.	.	.	.	0.28874	N	0.894784	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	-1	.	.	.	+	.	.	IMPACT	20277010	0.444000	0.25649	0.246000	0.24233	0.287000	0.27160	0.241000	0.18065	0.202000	0.20498	0.205000	0.17691	.	.		0.363	IMPACT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254901.1	NM_018439	Intron
DSC3	1825	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	18	28605791	28605791	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr18:28605791C>G	ENST00000360428.4	-	5	645	c.565G>C	c.(565-567)Gaa>Caa	p.E189Q	DSC3_ENST00000434452.1_Missense_Mutation_p.E189Q	NM_001941.3	NP_001932.2	Q14574	DSC3_HUMAN	desmocollin 3	189	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|protein stabilization (GO:0050821)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|desmosome (GO:0030057)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)			endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(6)|lung(29)|ovary(2)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	56			OV - Ovarian serous cystadenocarcinoma(10;0.125)			GTGTCTCTTTCTATATAAAAC	0.343																																					p.E189Q		.											.	DSC3-94	0			c.G565C						.						67.0	68.0	68.0					18																	28605791		2202	4299	6501	SO:0001583	missense	1825	exon5			CTCTTTCTATATA	X83929	CCDS32810.1	18q12.1	2014-07-30			ENSG00000134762	ENSG00000134762		"""Cadherins / Major cadherins"""	3037	protein-coding gene	gene with protein product		600271		DSC4		7774948, 8486729	Standard	NM_001941		Approved	CDHF3, DSC, DSC1, DSC2	uc002kwj.4	Q14574	OTTHUMG00000179622	ENST00000360428.4:c.565G>C	18.37:g.28605791C>G	ENSP00000353608:p.Glu189Gln	Somatic	178	0		WXS	Illumina GAIIx	Phase_I	138	8	NM_024423	0	0	0	0	0	A6NN35|Q14200|Q9HAZ9	Missense_Mutation	SNP	ENST00000360428.4	37	CCDS32810.1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.628212	0.87560	.	.	ENSG00000134762	ENST00000360428;ENST00000434452	T;T	0.61627	0.09;0.09	4.94	4.94	0.65067	Cadherin (5);Cadherin-like (1);	0.784649	0.10391	N	0.680392	D	0.82421	0.5033	M	0.92317	3.295	0.58432	D	0.999991	D;D	0.65815	0.978;0.995	D;D	0.67103	0.949;0.945	T	0.83188	-0.0085	10	0.72032	D	0.01	.	17.4558	0.87607	0.0:1.0:0.0:0.0	.	189;189	Q14574;Q14574-2	DSC3_HUMAN;.	Q	189	ENSP00000353608:E189Q;ENSP00000392068:E189Q	ENSP00000353608:E189Q	E	-	1	0	DSC3	26859789	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	4.239000	0.58694	2.706000	0.92434	0.655000	0.94253	GAA	.		0.343	DSC3-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000447384.1	NM_001941, NM_024423	
SALL3	27164	hgsc.bcm.edu	37	18	76753768	76753768	+	Missense_Mutation	SNP	C	C	G	rs2447437	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr18:76753768C>G	ENST00000537592.2	+	2	1777	c.1777C>G	c.(1777-1779)Ctc>Gtc	p.L593V	SALL3_ENST00000536229.3_Missense_Mutation_p.L460V|SALL3_ENST00000575389.2_Missense_Mutation_p.L593V	NM_171999.3	NP_741996.2	Q9BXA9	SALL3_HUMAN	spalt-like transcription factor 3	593			L -> V (in dbSNP:rs2447437). {ECO:0000269|Ref.1}.		forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|negative regulation of smoothened signaling pathway (GO:0045879)|olfactory bulb interneuron development (GO:0021891)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L593V(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(40)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		CGGGCCGCCCCTCACTAAAGC	0.731													C|||	3973	0.793331	0.5825	0.8444	5008	,	,		9900	0.9226		0.8648	False		,,,				2504	0.8354				p.L593V		.											.	SALL3-155	1	Substitution - Missense(1)	prostate(1)	c.C1777G						.	C	VAL/LEU	2422,1000		875,672,164	3.0	4.0	4.0		1777	5.2	0.2	18	dbSNP_100	4	6372,926		2808,756,85	yes	missense	SALL3	NM_171999.2	32	3683,1428,249	GG,GC,CC		12.6884,29.2227,17.9664	benign	593/1301	76753768	8794,1926	1711	3649	5360	SO:0001583	missense	27164	exon2			CCGCCCCTCACTA	AJ007421	CCDS12013.1	18q23	2013-10-17	2013-10-17		ENSG00000256463	ENSG00000256463		"""Zinc fingers, C2H2-type"""	10527	protein-coding gene	gene with protein product		605079	"""sal (Drosophila)-like 3"", ""sal-like 3 (Drosophila)"""			10610715	Standard	NM_171999		Approved	ZNF796	uc002lmt.3	Q9BXA9	OTTHUMG00000132896	ENST00000537592.2:c.1777C>G	18.37:g.76753768C>G	ENSP00000441823:p.Leu593Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_171999	0	0	0	0	0	Q9UGH1	Missense_Mutation	SNP	ENST00000537592.2	37	CCDS12013.1	1724	0.7893772893772893	287	0.5833333333333334	299	0.8259668508287292	511	0.8933566433566433	627	0.8271767810026385	C	0.073	-1.197989	0.01594	0.707773	0.873116	ENSG00000256463	ENST00000537592;ENST00000536229;ENST00000543056	T	0.08984	3.03	5.2	5.2	0.72013	.	0.464067	0.17974	N	0.155779	T	0.00012	0.0000	L	0.35288	1.05	0.80722	P	0.0	B;B	0.15473	0.013;0.006	B;B	0.18561	0.022;0.002	T	0.36237	-0.9756	9	0.14656	T	0.56	-21.7235	10.231	0.43256	0.2471:0.6277:0.1252:0.0	rs2447437	325;593	F5GXY4;Q9BXA9	.;SALL3_HUMAN	V	593;593;325	ENSP00000441823:L593V	ENSP00000299466:L593V	L	+	1	0	SALL3	74854756	0.002000	0.14202	0.157000	0.22605	0.006000	0.05464	0.292000	0.19011	2.584000	0.87258	0.563000	0.77884	CTC	C|0.780;G|0.220		0.731	SALL3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256397.1	NM_171999	
KISS1R	84634	hgsc.bcm.edu	37	19	917526	917526	+	Silent	SNP	A	A	G	rs10407968	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr19:917526A>G	ENST00000234371.5	+	1	177	c.24A>G	c.(22-24)ggA>ggG	p.G8G	KISS1R_ENST00000606939.1_Silent_p.G8G	NM_032551.4	NP_115940.2	Q969F8	KISSR_HUMAN	KISS1 receptor	8					activation of MAPKK activity (GO:0000186)|arachidonic acid secretion (GO:0050482)|calcium-mediated signaling (GO:0019722)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of cell proliferation (GO:0008285)|neuropeptide signaling pathway (GO:0007218)|positive regulation of hormone secretion (GO:0046887)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of synaptic transmission (GO:0050806)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide binding (GO:0042923)|neuropeptide receptor activity (GO:0008188)			cervix(1)|kidney(1)|ovary(1)|pancreas(1)|skin(1)	5		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTACGTCCGGACCCAACGCGT	0.781													g|||	933	0.186302	0.233	0.1758	5008	,	,		2673	0.1339		0.159	False		,,,				2504	0.2127				p.G8G		.											.	KISS1R-91	0			c.A24G						.	G		616,3176		47,522,1327	5.0	5.0	5.0		24	-3.6	0.0	19	dbSNP_119	5	742,6668		44,654,3007	no	coding-synonymous	KISS1R	NM_032551.4		91,1176,4334	GG,GA,AA		10.0135,16.2447,12.1228		8/399	917526	1358,9844	1896	3705	5601	SO:0001819	synonymous_variant	84634	exon1			GTCCGGACCCAAC	AB051065	CCDS12049.1	19p13.3	2012-08-10	2006-02-15	2006-02-15	ENSG00000116014	ENSG00000116014		"""GPCR / Class A : RF amide peptide receptors"""	4510	protein-coding gene	gene with protein product		604161	"""G protein-coupled receptor 54"""	GPR54		10100623	Standard	NM_032551		Approved	HOT7T175, AXOR12	uc002lqk.4	Q969F8		ENST00000234371.5:c.24A>G	19.37:g.917526A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	7	NM_032551	0	0	0	0	0	A5D8U2|B2RTV1|Q96QG0	Silent	SNP	ENST00000234371.5	37	CCDS12049.1																																																																																			A|0.821;G|0.179		0.781	KISS1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458217.3	NM_032551	
ARID3A	1820	hgsc.bcm.edu	37	19	929678	929678	+	Silent	SNP	G	G	A	rs3826948	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr19:929678G>A	ENST00000263620.3	+	2	477	c.150G>A	c.(148-150)gaG>gaA	p.E50E	AC005391.2_ENST00000585647.1_RNA	NM_005224.2	NP_005215.1	Q99856	ARI3A_HUMAN	AT rich interactive domain 3A (BRIGHT-like)	50						cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|ovary(1)	10		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GAGAGCCCGAGAGTGCCCGGA	0.766													g|||	2308	0.460863	0.1112	0.487	5008	,	,		7932	0.6756		0.6223	False		,,,				2504	0.5276				p.E50E	Pancreas(29;54 1022 32760 50921)	.											.	ARID3A-90	0			c.G150A						.	G		470,2552		61,348,1102	3.0	4.0	3.0		150	1.1	0.4	19	dbSNP_107	3	3721,3153		1076,1569,792	no	coding-synonymous	ARID3A	NM_005224.2		1137,1917,1894	AA,AG,GG		45.8685,15.5526,42.3504		50/594	929678	4191,5705	1511	3437	4948	SO:0001819	synonymous_variant	1820	exon2			GCCCGAGAGTGCC	U88047	CCDS12050.1	19p13.3	2013-02-07	2006-11-08	2004-01-30		ENSG00000116017		"""-"""	3031	protein-coding gene	gene with protein product		603265	"""dead ringer-like 1 (Drosophila)"", ""AT rich interactive domain 3A (BRIGHT- like)"""	DRIL1		9722953	Standard	NM_005224		Approved	BRIGHT	uc002lql.3	Q99856		ENST00000263620.3:c.150G>A	19.37:g.929678G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_005224	0	0	0	2	2	Q5I858|Q6P9C6|Q8IZA7|Q8N4Z3	Silent	SNP	ENST00000263620.3	37	CCDS12050.1																																																																																			T|0.495;C|0.504		0.766	ARID3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458219.1	NM_005224	
ARID3A	1820	hgsc.bcm.edu	37	19	929753	929753	+	Silent	SNP	A	A	G	rs1799595	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr19:929753A>G	ENST00000263620.3	+	2	552	c.225A>G	c.(223-225)ccA>ccG	p.P75P	AC005391.2_ENST00000585647.1_RNA	NM_005224.2	NP_005215.1	Q99856	ARI3A_HUMAN	AT rich interactive domain 3A (BRIGHT-like)	75						cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|ovary(1)	10		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGGACACCCAGCCAGCCCCG	0.751													t|||	4428	0.884185	0.9062	0.804	5008	,	,		8534	0.998		0.836	False		,,,				2504	0.8436				p.P75P	Pancreas(29;54 1022 32760 50921)	.											.	ARID3A-90	0			c.A225G						.	G		3389,305		1555,279,13	4.0	5.0	5.0		225	-6.8	0.0	19	dbSNP_89	5	6619,1123		2834,951,86	no	coding-synonymous	ARID3A	NM_005224.2		4389,1230,99	GG,GA,AA		14.5053,8.2566,12.4869		75/594	929753	10008,1428	1847	3871	5718	SO:0001819	synonymous_variant	1820	exon2			ACACCCAGCCAGC	U88047	CCDS12050.1	19p13.3	2013-02-07	2006-11-08	2004-01-30		ENSG00000116017		"""-"""	3031	protein-coding gene	gene with protein product		603265	"""dead ringer-like 1 (Drosophila)"", ""AT rich interactive domain 3A (BRIGHT- like)"""	DRIL1		9722953	Standard	NM_005224		Approved	BRIGHT	uc002lql.3	Q99856		ENST00000263620.3:c.225A>G	19.37:g.929753A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	14	14	NM_005224	0	0	0	3	3	Q5I858|Q6P9C6|Q8IZA7|Q8N4Z3	Silent	SNP	ENST00000263620.3	37	CCDS12050.1																																																																																			A|0.114;G|0.886		0.751	ARID3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458219.1	NM_005224	
KLF16	83855	hgsc.bcm.edu	37	19	1854557	1854557	+	Silent	SNP	A	A	G	rs3746045	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr19:1854557A>G	ENST00000250916.4	-	2	730	c.660T>C	c.(658-660)ccT>ccC	p.P220P	CTB-31O20.6_ENST00000592884.1_RNA|KLF16_ENST00000592313.1_5'UTR	NM_031918.3	NP_114124.1	Q9BXK1	KLF16_HUMAN	Kruppel-like factor 16	220	Pro/Ser-rich.				dopamine receptor signaling pathway (GO:0007212)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(1)	1		Ovarian(11;1.78e-06)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGCGGGCACCAGGGCGCCGGA	0.756													A|||	2119	0.423123	0.6785	0.4611	5008	,	,		10654	0.3829		0.2177	False		,,,				2504	0.3037				p.P220P		.											.	KLF16-90	0			c.T660C						.	A		2319,1817		694,931,443	10.0	16.0	14.0		660	-6.7	0.2	19	dbSNP_107	14	1682,6356		211,1260,2548	no	coding-synonymous	KLF16	NM_031918.3		905,2191,2991	GG,GA,AA		20.9256,43.9313,32.8651		220/253	1854557	4001,8173	2068	4019	6087	SO:0001819	synonymous_variant	83855	exon2			GGCACCAGGGCGC	AF327440	CCDS12075.1	19p13.3	2013-10-15			ENSG00000129911	ENSG00000129911		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	16857	protein-coding gene	gene with protein product		606139				11438660	Standard	NM_031918		Approved	NSLP2, BTEB4, DRRF	uc002luc.3	Q9BXK1	OTTHUMG00000179994	ENST00000250916.4:c.660T>C	19.37:g.1854557A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	26	11	NM_031918	0	0	28	39	11		Silent	SNP	ENST00000250916.4	37	CCDS12075.1																																																																																			A|0.591;G|0.409		0.756	KLF16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449214.1		
UHRF1	29128	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	4950704	4950704	+	RNA	SNP	C	C	A			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr19:4950704C>A	ENST00000592666.1	+	0	2175							Q96T88	UHRF1_HUMAN	ubiquitin-like with PHD and ring finger domains 1						cell cycle (GO:0007049)|cell proliferation (GO:0008283)|DNA repair (GO:0006281)|histone monoubiquitination (GO:0010390)|histone ubiquitination (GO:0016574)|maintenance of DNA methylation (GO:0010216)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of DNA topoisomerase (ATP-hydrolyzing) activity (GO:2000373)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein autoubiquitination (GO:0051865)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|heterochromatin (GO:0000792)|nuclear chromatin (GO:0000790)|nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|replication fork (GO:0005657)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|hemi-methylated DNA-binding (GO:0044729)|histone binding (GO:0042393)|identical protein binding (GO:0042802)|ligase activity (GO:0016874)|methyl-CpG binding (GO:0008327)|methylated histone binding (GO:0035064)|nucleosomal histone binding (GO:0031493)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|prostate(1)|upper_aerodigestive_tract(2)	16				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0276)		GGAAGCCGGTCAGGGTGGTGC	0.617																																					.		.											.	UHRF1-522	0			.						.						25.0	29.0	28.0					19																	4950704		1966	4115	6081			29128	.			GCCGGTCAGGGTG	AF129507	CCDS74262.1, CCDS74263.1	19p13.3	2012-04-20	2008-08-14		ENSG00000034063	ENSG00000276043		"""RING-type (C3HC4) zinc fingers"""	12556	protein-coding gene	gene with protein product		607990				10646863	Standard	NM_001048201		Approved	ICBP90, Np95, FLJ21925, RNF106	uc002mbo.3	Q96T88			19.37:g.4950704C>A		Somatic	316	1		WXS	Illumina GAIIx	Phase_I	400	76	.	0	0	11	14	3	A0JBR2|A8K024|B2RBA9|Q2HIX7|Q8J022|Q9H6S6|Q9P115|Q9P1U7	RNA	SNP	ENST00000592666.1	37																																																																																				.		0.617	UHRF1-006	KNOWN	sequence_error|basic	processed_transcript	processed_transcript	OTTHUMT00000450444.1	NM_001048201	
FUT6	2528	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	5832103	5832103	+	Missense_Mutation	SNP	C	C	T	rs140726017		TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr19:5832103C>T	ENST00000318336.4	-	3	1670	c.476G>A	c.(475-477)cGc>cAc	p.R159H	FUT6_ENST00000527106.1_Missense_Mutation_p.R159H|FUT6_ENST00000524754.1_Missense_Mutation_p.R159H|FUT6_ENST00000592563.1_Missense_Mutation_p.R159H|FUT6_ENST00000286955.5_Missense_Mutation_p.R159H	NM_000150.2	NP_000141.1	P51993	FUT6_HUMAN	fucosyltransferase 6 (alpha (1,3) fucosyltransferase)	159					fucosylation (GO:0036065)|L-fucose catabolic process (GO:0042355)|protein glycosylation (GO:0006486)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	3-galactosyl-N-acetylglucosaminide 4-alpha-L-fucosyltransferase activity (GO:0017060)|alpha-(1->3)-fucosyltransferase activity (GO:0046920)|fucosyltransferase activity (GO:0008417)			endometrium(2)|kidney(1)|large_intestine(1)|lung(2)	6						GGAGTCGCTGCGGTAGGACAT	0.637																																					p.R159H		.											.	FUT6-90	0			c.G476A						.	C	HIS/ARG,HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	70.0	54.0	59.0		476,476	3.1	1.0	19	dbSNP_134	59	0,8600		0,0,4300	no	missense,missense	FUT6	NM_000150.2,NM_001040701.1	29,29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging	159/360,159/360	5832103	1,13005	2203	4300	6503	SO:0001583	missense	2528	exon3			TCGCTGCGGTAGG		CCDS12152.1	19p13.3	2013-02-26			ENSG00000156413	ENSG00000156413	2.4.1.65	"""Fucosyltransferases"""	4017	protein-coding gene	gene with protein product	"""alpha-(1,3)-fucosyltransferase"", ""galactoside 3-L-fucosyltransferase"""	136836				1520296, 7782074	Standard	NM_001040701		Approved	FT1A, FCT3A, FucT-VI, FLJ40754	uc002mdh.1	P51993	OTTHUMG00000167335	ENST00000318336.4:c.476G>A	19.37:g.5832103C>T	ENSP00000313398:p.Arg159His	Somatic	282	0		WXS	Illumina GAIIx	Phase_I	373	160	NM_000150	0	0	0	0	0	A6NEX0|D6W637|Q9UND8	Missense_Mutation	SNP	ENST00000318336.4	37	CCDS12152.1	.	.	.	.	.	.	.	.	.	.	C	19.87	3.906962	0.72868	2.27E-4	0.0	ENSG00000156413	ENST00000524754;ENST00000527106;ENST00000318336;ENST00000286955;ENST00000341530	T;T;T;T	0.39997	1.05;1.05;1.05;1.05	3.11	3.11	0.35812	.	0.000000	0.56097	D	0.000027	T	0.68622	0.3021	M	0.91090	3.175	0.33010	D	0.527386	D;D	0.89917	1.0;1.0	D;D	0.75484	0.986;0.986	T	0.80843	-0.1201	10	0.66056	D	0.02	.	12.4349	0.55595	0.0:1.0:0.0:0.0	.	159;159	C9J8A2;P51993	.;FUT6_HUMAN	H	159	ENSP00000431708:R159H;ENSP00000432954:R159H;ENSP00000313398:R159H;ENSP00000286955:R159H	ENSP00000286955:R159H	R	-	2	0	FUT6	5783103	0.931000	0.31567	1.000000	0.80357	0.950000	0.60333	1.975000	0.40569	1.681000	0.50988	0.436000	0.28706	CGC	C|1.000;T|0.000		0.637	FUT6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394218.2	NM_000150	
ZNF653	115950	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	11598309	11598309	+	Silent	SNP	C	C	T			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr19:11598309C>T	ENST00000293771.5	-	4	1105	c.969G>A	c.(967-969)gcG>gcA	p.A323A	CTC-398G3.6_ENST00000585656.1_Intron	NM_138783.3	NP_620138.2	Q96CK0	ZN653_HUMAN	zinc finger protein 653	323					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(3)|large_intestine(2)|lung(8)|prostate(1)|skin(1)	17						AACCAGGGCCCGCAATGATGA	0.672																																					p.A323A	Pancreas(83;980 1446 4542 6441 43352)	.											.	ZNF653-90	0			c.G969A						.						65.0	61.0	62.0					19																	11598309		2203	4300	6503	SO:0001819	synonymous_variant	115950	exon4			AGGGCCCGCAATG	AY072704	CCDS12261.1	19p13.2	2013-01-08						"""Zinc fingers, C2H2-type"""	25196	protein-coding gene	gene with protein product		611371				12477932	Standard	NM_138783		Approved	Zip67	uc002mrz.2	Q96CK0		ENST00000293771.5:c.969G>A	19.37:g.11598309C>T		Somatic	65	0		WXS	Illumina GAIIx	Phase_I	172	36	NM_138783	0	0	16	16	0	Q96AS7	Silent	SNP	ENST00000293771.5	37	CCDS12261.1																																																																																			.		0.672	ZNF653-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458836.2	NM_138783	
MAP1S	55201	hgsc.bcm.edu	37	19	17837417	17837417	+	Silent	SNP	G	G	A	rs138676223	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr19:17837417G>A	ENST00000324096.4	+	5	1375	c.1224G>A	c.(1222-1224)acG>acA	p.T408T	MAP1S_ENST00000544059.2_Silent_p.T382T|MAP1S_ENST00000597681.1_Intron|CTD-3149D2.4_ENST00000595363.1_RNA	NM_018174.4	NP_060644.4	Q66K74	MAP1S_HUMAN	microtubule-associated protein 1S	408	Necessary for the microtubule-organizing center localization.				apoptotic DNA fragmentation (GO:0006309)|brain development (GO:0007420)|execution phase of apoptosis (GO:0097194)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|nervous system development (GO:0007399)|neuron projection morphogenesis (GO:0048812)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|synapse (GO:0045202)	actin filament binding (GO:0051015)|beta-tubulin binding (GO:0048487)|DNA binding (GO:0003677)|microtubule binding (GO:0008017)|tubulin binding (GO:0015631)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	25						CCGAGCGCACGCTGGCCTCTG	0.736													G|||	45	0.00898562	0.0015	0.0144	5008	,	,		12480	0.0		0.0268	False		,,,				2504	0.0061				p.T408T		.											.	MAP1S-90	0			c.G1224A						.	G		21,4095		0,21,2037	5.0	5.0	5.0		1224	-2.1	0.0	19	dbSNP_134	5	121,7915		1,119,3898	no	coding-synonymous	MAP1S	NM_018174.4		1,140,5935	AA,AG,GG		1.5057,0.5102,1.1685		408/1060	17837417	142,12010	2058	4018	6076	SO:0001819	synonymous_variant	55201	exon5			GCGCACGCTGGCC	BC067115	CCDS32954.1	19p13.12	2008-02-05	2006-07-04	2006-07-04		ENSG00000130479			15715	protein-coding gene	gene with protein product		607573	"""chromosome 19 open reading frame 5"", ""VCY2 interacting protein 1"", ""BPY2 interacting protein 1"""	C19orf5, VCY2IP1, BPY2IP1		11827465, 15528209, 16297881, 14627543	Standard	NM_018174		Approved	FLJ10669, MAP8	uc002nhe.1	Q66K74		ENST00000324096.4:c.1224G>A	19.37:g.17837417G>A		Somatic	2	0		WXS	Illumina GAIIx	Phase_I	37	29	NM_018174	0	0	6	14	8	B4DH53|Q27QB1|Q6NXF1|Q8N3L8|Q8N3W5|Q8NI88|Q96H94|Q96IT4|Q96SP8|Q9BRC6|Q9H928|Q9NVK7	Silent	SNP	ENST00000324096.4	37	CCDS32954.1																																																																																			G|0.987;A|0.013		0.736	MAP1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466027.1	NM_018174	
MAP1S	55201	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	17838767	17838767	+	Silent	SNP	C	C	T			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr19:17838767C>T	ENST00000324096.4	+	5	2725	c.2574C>T	c.(2572-2574)aaC>aaT	p.N858N	MAP1S_ENST00000544059.2_Silent_p.N832N|MAP1S_ENST00000597681.1_3'UTR|CTD-3149D2.4_ENST00000595363.1_RNA	NM_018174.4	NP_060644.4	Q66K74	MAP1S_HUMAN	microtubule-associated protein 1S	858	Necessary for association with microtubules.|Necessary for interaction with RASSF1 isoform A and isoform C.				apoptotic DNA fragmentation (GO:0006309)|brain development (GO:0007420)|execution phase of apoptosis (GO:0097194)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|nervous system development (GO:0007399)|neuron projection morphogenesis (GO:0048812)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|synapse (GO:0045202)	actin filament binding (GO:0051015)|beta-tubulin binding (GO:0048487)|DNA binding (GO:0003677)|microtubule binding (GO:0008017)|tubulin binding (GO:0015631)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	25						AAACGGAGAACGTCAGCCGCA	0.672																																					p.N858N		.											.	MAP1S-90	0			c.C2574T						.						17.0	17.0	17.0					19																	17838767		2200	4296	6496	SO:0001819	synonymous_variant	55201	exon5			GGAGAACGTCAGC	BC067115	CCDS32954.1	19p13.12	2008-02-05	2006-07-04	2006-07-04		ENSG00000130479			15715	protein-coding gene	gene with protein product		607573	"""chromosome 19 open reading frame 5"", ""VCY2 interacting protein 1"", ""BPY2 interacting protein 1"""	C19orf5, VCY2IP1, BPY2IP1		11827465, 15528209, 16297881, 14627543	Standard	NM_018174		Approved	FLJ10669, MAP8	uc002nhe.1	Q66K74		ENST00000324096.4:c.2574C>T	19.37:g.17838767C>T		Somatic	31	0		WXS	Illumina GAIIx	Phase_I	134	36	NM_018174	0	0	31	37	6	B4DH53|Q27QB1|Q6NXF1|Q8N3L8|Q8N3W5|Q8NI88|Q96H94|Q96IT4|Q96SP8|Q9BRC6|Q9H928|Q9NVK7	Silent	SNP	ENST00000324096.4	37	CCDS32954.1																																																																																			.		0.672	MAP1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466027.1	NM_018174	
ZNF737	100129842	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	20728340	20728340	+	Silent	SNP	A	A	G	rs187919890	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr19:20728340A>G	ENST00000427401.4	-	4	763	c.669T>C	c.(667-669)caT>caC	p.H223H		NM_001159293.1	NP_001152765.1	O75373	ZN737_HUMAN	zinc finger protein 737	223					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|kidney(1)|lung(7)|ovary(1)|stomach(1)|urinary_tract(1)	13						TCTCTCCAGTATGAATTCTCT	0.408													a|||	2	0.000399361	0.0	0.0029	5008	,	,		19526	0.0		0.0	False		,,,				2504	0.0				p.H223H		.											.	ZNF737-1	0			c.T669C						.						25.0	25.0	25.0					19																	20728340		692	1591	2283	SO:0001819	synonymous_variant	100129842	exon4			TCCAGTATGAATT	BC015765	CCDS54238.1	19p12	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	32468	protein-coding gene	gene with protein product		603984					Standard	NM_001159293		Approved	ZNF102	uc002npa.3	O75373		ENST00000427401.4:c.669T>C	19.37:g.20728340A>G		Somatic	34	0		WXS	Illumina GAIIx	Phase_I	44	17	NM_001159293	0	0	2	2	0	C9JHM3	Silent	SNP	ENST00000427401.4	37	CCDS54238.1																																																																																			A|0.999;G|0.000		0.408	ZNF737-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447844.2	NM_145289	
LGI4	163175	hgsc.bcm.edu	37	19	35617513	35617513	+	Silent	SNP	G	G	C	rs77635806	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr19:35617513G>C	ENST00000310123.3	-	8	1479	c.960C>G	c.(958-960)gcC>gcG	p.A320A	LGI4_ENST00000392225.3_Missense_Mutation_p.P346R|LGI4_ENST00000493050.1_5'UTR	NM_139284.2	NP_644813.1	Q8N135	LGI4_HUMAN	leucine-rich repeat LGI family, member 4	320					adult locomotory behavior (GO:0008344)|glial cell proliferation (GO:0014009)|myelination in peripheral nervous system (GO:0022011)|neuron maturation (GO:0042551)	extracellular space (GO:0005615)				endometrium(1)|large_intestine(1)|lung(4)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10	all_lung(56;7.56e-09)|Lung NSC(56;1.1e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.54e-20)|OV - Ovarian serous cystadenocarcinoma(14;1.33e-18)|all cancers(14;4.27e-17)|LUSC - Lung squamous cell carcinoma(66;0.0849)			ACAGGAGCTCGGCGTCATTGG	0.736													G|||	40	0.00798722	0.0	0.0187	5008	,	,		12972	0.0		0.0209	False		,,,				2504	0.0061				p.A320A		.											.	LGI4-91	0			c.C960G						.	G		12,3404		0,12,1696	5.0	4.0	4.0		960	-3.8	1.0	19	dbSNP_133	4	132,6922		0,132,3395	no	coding-synonymous	LGI4	NM_139284.2		0,144,5091	CC,CG,GG		1.8713,0.3513,1.3754		320/538	35617513	144,10326	1708	3527	5235	SO:0001819	synonymous_variant	163175	exon8			GAGCTCGGCGTCA	AJ487519	CCDS12444.1	19q13.13	2008-07-03			ENSG00000153902	ENSG00000153902			18712	protein-coding gene	gene with protein product		608303				12023020	Standard	NM_139284		Approved		uc002nxx.2	Q8N135	OTTHUMG00000044558	ENST00000310123.3:c.960C>G	19.37:g.35617513G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	17	10	NM_139284	0	0	0	0	0	B2RN53|B9EGS7|Q5M8T1	Silent	SNP	ENST00000310123.3	37	CCDS12444.1	41	0.018772893772893772	1	0.0020325203252032522	12	0.03314917127071823	6	0.01048951048951049	22	0.029023746701846966	G	10.69	1.421749	0.25639	0.003513	0.018713	ENSG00000153902	ENST00000392225	T	0.73469	-0.75	4.34	-3.77	0.04346	.	.	.	.	.	T	0.45915	0.1366	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.62426	-0.6857	6	0.87932	D	0	.	1.5004	0.02475	0.3464:0.1344:0.382:0.1372	.	.	.	.	R	346	ENSP00000376059:P346R	ENSP00000376059:P346R	P	-	2	0	LGI4	40309353	0.000000	0.05858	0.983000	0.44433	0.976000	0.68499	-3.212000	0.00555	-0.684000	0.05183	0.305000	0.20034	CCG	G|0.981;C|0.019		0.736	LGI4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103963.1		
KMT2B	9757	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	36211355	36211357	+	In_Frame_Del	DEL	AAG	AAG	-	rs201152143|rs369065472	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	AAG	AAG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr19:36211355_36211357delAAG	ENST00000222270.7	+	3	1106_1108	c.1106_1108delAAG	c.(1105-1110)aaagaa>aaa	p.E373del	KMT2B_ENST00000420124.1_In_Frame_Del_p.E373del|KMT2B_ENST00000607650.1_RNA|KMT2B_ENST00000341701.1_In_Frame_Del_p.E373del	NM_014727.1	NP_055542.1	Q9UMN6	KMT2B_HUMAN	lysine (K)-specific methyltransferase 2B	373	Asp/Glu-rich (acidic).				chromatin-mediated maintenance of transcription (GO:0048096)|gene silencing (GO:0016458)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|oocyte differentiation (GO:0009994)|ovarian follicle development (GO:0001541)|ovulation (GO:0030728)|regulation of histone H3-K4 methylation (GO:0051569)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										gaagagaagaaagaagaagaaga	0.507														90	0.0179712	0.0651	0.0043	5008	,	,		17039	0.0		0.0	False		,,,				2504	0.001				p.369_370del		.											.	MLL4-697	0			c.1106_1108del						.			220,3390		35,150,1620						1.0	0.0			20	16,7506		5,6,3750	no	coding	MLL4	NM_014727.1		40,156,5370	A1A1,A1R,RR		0.2127,6.0942,2.12				236,10896				SO:0001651	inframe_deletion	8085	exon3			AGAAGAAAGAAGA	AJ007041	CCDS46055.1	19q13.1	2014-02-18			ENSG00000105663	ENSG00000272333		"""Chromatin-modifying enzymes / K-methyltransferases"""	15840	protein-coding gene	gene with protein product	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 4"""	606834				10409430, 10637508	Standard	XM_006723513		Approved	KIAA0304, MLL2, TRX2, HRX2, WBP7, MLL1B, MLL4		Q9UMN6	OTTHUMG00000048119	ENST00000222270.7:c.1106_1108delAAG	19.37:g.36211364_36211366delAAG	ENSP00000222270:p.Glu373del	Somatic	128	0		WXS	Illumina GAIIx	Phase_I	120	29	NM_014727	0	0	0	0	0	O15022|O95836|Q96GP2|Q96IP3|Q9UK25|Q9Y668|Q9Y669	In_Frame_Del	DEL	ENST00000222270.7	37	CCDS46055.1																																																																																			.		0.507	KMT2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_014727	
RINL	126432	hgsc.bcm.edu	37	19	39360720	39360720	+	Missense_Mutation	SNP	G	G	A	rs8110393	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr19:39360720G>A	ENST00000591812.1	-	9	1291	c.1205C>T	c.(1204-1206)cCc>cTc	p.P402L	RINL_ENST00000598904.1_Missense_Mutation_p.P288L|CTC-360G5.6_ENST00000593830.1_RNA|RINL_ENST00000340740.3_Missense_Mutation_p.P288L|RINL_ENST00000602238.1_5'Flank			Q6ZS11	RINL_HUMAN	Ras and Rab interactor-like	402	VPS9. {ECO:0000255|PROSITE- ProRule:PRU00550}.		P -> L (in dbSNP:rs8110393).		endocytosis (GO:0006897)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)	actin cytoskeleton (GO:0015629)|cytoplasmic vesicle (GO:0031410)|ruffle (GO:0001726)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(3)|kidney(4)|large_intestine(2)|lung(4)|pancreas(1)|skin(1)|urinary_tract(2)	17						GGCGGGGGCGGGGCTCTGCCC	0.781													G|||	3477	0.694289	0.9289	0.6153	5008	,	,		10275	0.7619		0.4642	False		,,,				2504	0.6002				p.P402L		.											.	RINL-91	0			c.C1205T						.	G	LEU/PRO,LEU/PRO	3328,464		1489,350,57	4.0	4.0	4.0		1205,863	3.5	1.0	19	dbSNP_116	4	4059,3433		1245,1569,932	no	missense,missense	RINL	NM_001195833.1,NM_198445.3	98,98	2734,1919,989	AA,AG,GG		45.8222,12.2363,34.5356	probably-damaging,probably-damaging	402/567,288/453	39360720	7387,3897	1896	3746	5642	SO:0001583	missense	126432	exon9			GGGGCGGGGCTCT	AK127808	CCDS12522.1, CCDS59386.1	19q13.2	2010-07-13			ENSG00000187994	ENSG00000187994			24795	protein-coding gene	gene with protein product							Standard	NM_001195833		Approved	FLJ45909	uc010xuo.2	Q6ZS11		ENST00000591812.1:c.1205C>T	19.37:g.39360720G>A	ENSP00000467107:p.Pro402Leu	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	15	15	NM_001195833	0	0	0	0	0	B4DPG5	Missense_Mutation	SNP	ENST00000591812.1	37	CCDS59386.1	1421	0.6506410256410257	458	0.9308943089430894	225	0.6215469613259669	401	0.701048951048951	337	0.4445910290237467	G	17.17	3.320891	0.60634	0.877637	0.541778	ENSG00000187994	ENST00000340740;ENST00000536520	T	0.28454	1.61	4.57	3.53	0.40419	Vacuolar sorting protein 9 (1);	0.269737	0.35235	N	0.003350	T	0.00012	0.0000	M	0.67700	2.07	0.21553	P	0.999649277	B;B	0.21225	0.053;0.053	B;B	0.22152	0.038;0.038	T	0.17776	-1.0358	9	0.72032	D	0.01	-26.0247	8.5759	0.33598	0.1063:0.0:0.8937:0.0	rs8110393;rs61482706	402;288	B4DPG5;Q6ZS11	.;RINL_HUMAN	L	288	ENSP00000340369:P288L	ENSP00000340369:P288L	P	-	2	0	RINL	44052560	1.000000	0.71417	0.987000	0.45799	0.313000	0.28021	4.771000	0.62318	1.273000	0.44346	0.407000	0.27541	CCC	G|0.349;A|0.651		0.781	RINL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460433.1	NM_198445	
ERCC2	2068	hgsc.bcm.edu	37	19	45867259	45867259	+	Missense_Mutation	SNP	C	C	T	rs1799793	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr19:45867259C>T	ENST00000391945.4	-	10	1011	c.934G>A	c.(934-936)Gac>Aac	p.D312N	ERCC2_ENST00000391944.3_Missense_Mutation_p.D234N|ERCC2_ENST00000485403.2_Missense_Mutation_p.D288N|ERCC2_ENST00000391940.4_Missense_Mutation_p.D288N|ERCC2_ENST00000221481.6_3'UTR	NM_000400.3	NP_000391.1	P18074	ERCC2_HUMAN	excision repair cross-complementation group 2	312			D -> N (in dbSNP:rs1799793). {ECO:0000269|PubMed:11245433, ECO:0000269|PubMed:11470747, ECO:0000269|PubMed:11709541, ECO:0000269|Ref.3}.		7-methylguanosine mRNA capping (GO:0006370)|aging (GO:0007568)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|central nervous system myelin formation (GO:0032289)|chromosome segregation (GO:0007059)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)|embryonic cleavage (GO:0040016)|erythrocyte maturation (GO:0043249)|extracellular matrix organization (GO:0030198)|gene expression (GO:0010467)|hair cell differentiation (GO:0035315)|hair follicle maturation (GO:0048820)|hematopoietic stem cell differentiation (GO:0060218)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision (GO:0033683)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral transcription (GO:0050434)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to hypoxia (GO:0001666)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|spinal cord development (GO:0021510)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)|viral process (GO:0016032)	cytoplasm (GO:0005737)|holo TFIIH complex (GO:0005675)|MMXD complex (GO:0071817)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	4 iron, 4 sulfur cluster binding (GO:0051539)|5'-3' DNA helicase activity (GO:0043139)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			large_intestine(4)|lung(2)|ovary(1)|pancreas(1)|stomach(1)	9		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		AGCACTTCGTCGGGCAGCACG	0.746			"""Mis, N, F, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum				C|||	974	0.194489	0.0734	0.1988	5008	,	,		10423	0.0496		0.3588	False		,,,				2504	0.3354				p.D312N		.	yes	Rec		Xeroderma pigmentosum (D)	19	19q13.2-q13.3	2068	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 (xeroderma pigmentosum D)"""		E	.	ERCC2-848	0			c.G934A	GRCh37	CM015299	ERCC2	M	rs1799793	.	C	ASN/ASP,ASN/ASP	387,3577		30,327,1625	5.0	8.0	7.0		934,862	5.2	0.5	19	dbSNP_89	7	2507,5397		444,1619,1889	no	missense,missense	ERCC2	NM_000400.3,NM_001130867.1	23,23	474,1946,3514	TT,TC,CC		31.7181,9.7629,24.3849	benign,benign	312/761,288/406	45867259	2894,8974	1982	3952	5934	SO:0001583	missense	2068	exon10	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	CTTCGTCGGGCAG		CCDS33049.1, CCDS46112.1	19q13.3	2014-09-17	2014-03-07		ENSG00000104884	ENSG00000104884	3.6.4.12	"""General transcription factor IIH complex subunits"""	3434	protein-coding gene	gene with protein product	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 protein"", ""TFIIH basal transcription factor complex helicase XPB subunit"""	126340	"""xeroderma pigmentosum complementary group D"", ""excision repair cross-complementing rodent repair deficiency, complementation group 2"""	XPD		8413672, 2184031	Standard	NM_000400		Approved	MAG, EM9, MGC102762, MGC126218, MGC126219, TFIIH	uc002pbj.2	P18074	OTTHUMG00000048190	ENST00000391945.4:c.934G>A	19.37:g.45867259C>T	ENSP00000375809:p.Asp312Asn	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	26	12	NM_000400	0	0	12	25	13	Q2TB78|Q2YDY2|Q7KZU6|Q8N721	Missense_Mutation	SNP	ENST00000391945.4	37	CCDS33049.1	423	0.1936813186813187	34	0.06910569105691057	70	0.19337016574585636	38	0.06643356643356643	281	0.370712401055409	C	20.0	3.930510	0.73327	0.097629	0.317181	ENSG00000104884	ENST00000391941;ENST00000391942;ENST00000391945;ENST00000391944;ENST00000391940	T;T;T	0.64438	-0.1;-0.1;-0.1	5.15	5.15	0.70609	Domain of unknown function DUF1227 (1);	0.000000	0.85682	D	0.000000	T	0.00012	0.0000	L	0.46947	1.48	0.09310	P	1.0	B;P;B	0.34639	0.065;0.461;0.053	B;B;B	0.35353	0.059;0.201;0.051	T	0.28267	-1.0049	9	0.33940	T	0.23	-30.0006	16.1268	0.81402	0.0:1.0:0.0:0.0	rs1799793;rs3916814;rs58989209;rs1799793	234;288;312	E7EVE9;Q7KZU6;P18074	.;.;ERCC2_HUMAN	N	262;288;312;234;288	ENSP00000375809:D312N;ENSP00000375808:D234N;ENSP00000375804:D288N	ENSP00000375804:D288N	D	-	1	0	ERCC2	50559099	1.000000	0.71417	0.523000	0.27875	0.865000	0.49528	7.192000	0.77771	2.388000	0.81334	0.561000	0.74099	GAC	C|0.804;T|0.196		0.746	ERCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109626.2	NM_000400	
GPR4	2828	broad.mit.edu	37	19	46094763	46094763	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr19:46094763T>G	ENST00000323040.4	-	2	1306	c.362A>C	c.(361-363)cAc>cCc	p.H121P	OPA3_ENST00000544371.1_Intron|GPR4_ENST00000591614.1_5'Flank	NM_005282.2	NP_005273.1	P46093	GPR4_HUMAN	G protein-coupled receptor 4	121					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(2)|endometrium(1)|kidney(3)|large_intestine(1)|lung(11)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23				OV - Ovarian serous cystadenocarcinoma(262;0.0071)|GBM - Glioblastoma multiforme(486;0.128)|Epithelial(262;0.223)		GCGGAGTGGGTGGGCCACAGC	0.652																																					p.H121P	Esophageal Squamous(117;181 1612 1673 14956 42937)	.											.	GPR4-92	0			c.A362C						.						47.0	52.0	50.0					19																	46094763		2203	4300	6503	SO:0001583	missense	2828	exon2			AGTGGGTGGGCCA	BC067536	CCDS12669.1	19q13.3	2012-08-21				ENSG00000177464		"""GPCR / Class A : Orphans"""	4497	protein-coding gene	gene with protein product		600551				8595909	Standard	NM_005282		Approved		uc002pcm.3	P46093		ENST00000323040.4:c.362A>C	19.37:g.46094763T>G	ENSP00000319744:p.His121Pro	Somatic	69	12		WXS	Illumina GAIIx	Phase_I	135	52	NM_005282	0	0	4	5	1	A8K3T3|B0M0K1|Q6NWM4	Missense_Mutation	SNP	ENST00000323040.4	37	CCDS12669.1	.	.	.	.	.	.	.	.	.	.	T	21.8	4.204071	0.79127	.	.	ENSG00000177464	ENST00000323040	T	0.40225	1.04	5.33	5.33	0.75918	GPCR, rhodopsin-like superfamily (1);	0.080840	0.49916	D	0.000121	T	0.67202	0.2868	M	0.85542	2.76	0.47905	D	0.999547	D	0.89917	1.0	D	0.80764	0.994	T	0.73316	-0.4021	10	0.87932	D	0	.	13.2483	0.60036	0.0:0.0:0.0:1.0	.	121	P46093	GPR4_HUMAN	P	121	ENSP00000319744:H121P	ENSP00000319744:H121P	H	-	2	0	GPR4	50786603	1.000000	0.71417	0.997000	0.53966	0.934000	0.57294	4.977000	0.63792	2.023000	0.59567	0.374000	0.22700	CAC	.		0.652	GPR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459603.1	NM_005282	
PNMAL2	57469	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	46997582	46997582	+	Intron	SNP	T	T	C			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr19:46997582T>C	ENST00000377655.2	-	1	734				PNMAL2_ENST00000594749.1_Intron|AC011484.1_ENST00000377652.3_5'Flank|PNMAL2_ENST00000599531.1_Missense_Mutation_p.K381E			Q9ULN7	PNML2_HUMAN	paraneoplastic Ma antigen family-like 2											central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(4)	8		Ovarian(192;0.00965)|all_neural(266;0.0459)		OV - Ovarian serous cystadenocarcinoma(262;0.000322)|all cancers(93;0.00233)|GBM - Glioblastoma multiforme(486;0.0421)|Epithelial(262;0.0427)		TTAGTGTCCTTGGACATGACG	0.632																																					p.K381E		.											.	PNMAL2-1	0			c.A1141G						.						21.0	23.0	22.0					19																	46997582		1948	4102	6050	SO:0001627	intron_variant	57469	exon1			TGTCCTTGGACAT	AB033009	CCDS59400.1	19q13.32	2014-02-12	2012-02-09		ENSG00000204851	ENSG00000204851		"""Paraneoplastic Ma antigens"""	29206	protein-coding gene	gene with protein product			"""PNMA-like 2"""			10574461	Standard	NM_020709		Approved	KIAA1183	uc002pes.2	Q9ULN7		ENST00000377655.2:c.734+406A>G	19.37:g.46997582T>C		Somatic	66	0		WXS	Illumina GAIIx	Phase_I	69	16	NM_020709	0	0	5	8	3	C9JGD5|M0R374|Q08E79|Q0D2F9|Q6ZVD1	Missense_Mutation	SNP	ENST00000377655.2	37																																																																																				.		0.632	PNMAL2-201	KNOWN	basic	protein_coding	protein_coding		NM_020709	
GLTSCR2	29997	hgsc.bcm.edu	37	19	48258717	48258717	+	Missense_Mutation	SNP	A	A	G	rs1804994	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr19:48258717A>G	ENST00000246802.5	+	9	1204	c.1166A>G	c.(1165-1167)cAg>cGg	p.Q389R	CTD-2571L23.6_ENST00000602048.1_RNA|GLTSCR2_ENST00000598681.1_3'UTR|SNORD23_ENST00000408876.1_RNA	NM_015710.4	NP_056525.2	Q9NZM5	GSCR2_HUMAN	glioma tumor suppressor candidate region gene 2	389			Q -> R (in dbSNP:rs1804994). {ECO:0000269|PubMed:10708517, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:17974005, ECO:0000269|Ref.4}.			intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)	15		all_cancers(25;1.47e-06)|all_lung(116;6.89e-05)|all_epithelial(76;0.000108)|Lung NSC(112;0.000117)|all_neural(266;0.0332)|Ovarian(192;0.086)		all cancers(93;0.000301)|OV - Ovarian serous cystadenocarcinoma(262;0.00031)|Epithelial(262;0.0149)|GBM - Glioblastoma multiforme(486;0.0278)		gcgcggcggcagaggcggcgg	0.761													G|||	3570	0.712859	0.857	0.6888	5008	,	,		6528	0.5546		0.6799	False		,,,				2504	0.7321				p.Q389R	Colon(58;613 1041 9473 10089 15241)	.											.	GLTSCR2-514	0			c.A1166G						.						1.0	2.0	1.0					19																	48258717		823	2228	3051	SO:0001583	missense	29997	exon9			GGCGGCAGAGGCG	AF182076	CCDS12705.1	19q13.3	2014-01-20				ENSG00000105373			4333	protein-coding gene	gene with protein product		605691				10708517, 16971513, 17657248	Standard	NM_015710		Approved	PICT-1	uc002phm.2	Q9NZM5		ENST00000246802.5:c.1166A>G	19.37:g.48258717A>G	ENSP00000246802:p.Gln389Arg	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	10	NM_015710	0	0	0	34	34	Q9BTC6|Q9HAX6|Q9NPP1|Q9NPR4|Q9UFI2	Missense_Mutation	SNP	ENST00000246802.5	37	CCDS12705.1	1513	0.6927655677655677	424	0.8617886178861789	252	0.6961325966850829	316	0.5524475524475524	521	0.6873350923482849	G	0.092	-1.166361	0.01660	.	.	ENSG00000105373	ENST00000246802;ENST00000325566	T	0.39229	1.09	3.93	2.86	0.33363	.	0.430291	0.24226	N	0.040398	T	0.00012	0.0000	N	0.00289	-1.7	0.54753	P	1.2000000000012001E-5	B	0.02656	0.0	B	0.06405	0.002	T	0.35450	-0.9788	9	0.05620	T	0.96	-11.9316	6.8245	0.23874	0.2235:0.0:0.7765:0.0	rs1804994;rs3211363;rs16949619;rs17343460;rs17856180;rs17856325;rs57240470	389	Q9NZM5	GSCR2_HUMAN	R	389;383	ENSP00000246802:Q389R	ENSP00000246802:Q389R	Q	+	2	0	GLTSCR2	52950529	0.025000	0.19082	0.815000	0.32552	0.328000	0.28507	0.153000	0.16323	0.415000	0.25817	-0.231000	0.12243	CAG	A|0.308;G|0.692		0.761	GLTSCR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464870.1	NM_015710	
IZUMO2	126123	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	50666247	50666247	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr19:50666247C>A	ENST00000293405.3	-	1	205	c.205G>T	c.(205-207)Gcg>Tcg	p.A69S		NM_152358.2	NP_689571.2	Q6UXV1	IZUM2_HUMAN	IZUMO family member 2	69						integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|prostate(1)	7						ACGTTCAGCGCGTAGTCCCGG	0.682																																					p.A69S		.											.	IZUMO2-90	0			c.G205T						.						46.0	51.0	49.0					19																	50666247		1991	4169	6160	SO:0001583	missense	126123	exon1			TCAGCGCGTAGTC	AY358196	CCDS12792.2	19q13.33	2014-02-17	2010-07-29	2010-07-29	ENSG00000161652	ENSG00000161652		"""-"""	28518	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 41"""	C19orf41		19658160, 22957301	Standard	XM_006723007		Approved	MGC33947, SCRL	uc002prp.1	Q6UXV1	OTTHUMG00000074063	ENST00000293405.3:c.205G>T	19.37:g.50666247C>A	ENSP00000293405:p.Ala69Ser	Somatic	149	0		WXS	Illumina GAIIx	Phase_I	274	71	NM_152358	0	0	0	0	0	Q5GRG3|Q5GRG4|Q6ZNM5|Q8NHR8	Missense_Mutation	SNP	ENST00000293405.3	37	CCDS12792.2	.	.	.	.	.	.	.	.	.	.	C	16.09	3.025664	0.54683	.	.	ENSG00000161652	ENST00000293405;ENST00000377000	T	0.23950	1.88	3.81	1.6	0.23607	.	0.669606	0.12308	N	0.480508	T	0.20129	0.0484	L	0.34521	1.04	0.25965	N	0.982575	P	0.41393	0.748	B	0.43478	0.421	T	0.13872	-1.0493	10	0.18276	T	0.48	.	8.7596	0.34667	0.4111:0.5889:0.0:0.0	.	69	Q6UXV1	IZUM2_HUMAN	S	69	ENSP00000293405:A69S	ENSP00000293405:A69S	A	-	1	0	IZUMO2	55358059	1.000000	0.71417	0.889000	0.34880	0.669000	0.39330	1.313000	0.33585	0.548000	0.28955	0.650000	0.86243	GCG	.		0.682	IZUMO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157232.1	NM_152358	
ZNF628	89887	hgsc.bcm.edu	37	19	55993260	55993260	+	Missense_Mutation	SNP	A	A	G	rs34864744	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr19:55993260A>G	ENST00000598519.1	+	3	1253	c.700A>G	c.(700-702)Acc>Gcc	p.T234A	ZNF628_ENST00000391718.2_Missense_Mutation_p.T230A			Q5EBL2	ZN628_HUMAN	zinc finger protein 628	234	Pro-rich.			T -> A (in Ref. 2; AAH89449). {ECO:0000305}.	transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(1)|lung(2)	7	Breast(117;0.155)		BRCA - Breast invasive adenocarcinoma(297;0.18)|LUSC - Lung squamous cell carcinoma(43;0.193)	GBM - Glioblastoma multiforme(193;0.0531)		cgccccgggtaccgcctccgc	0.766													N|||	3815	0.761781	0.9387	0.732	5008	,	,		4719	0.4395		0.837	False		,,,				2504	0.7986				p.T234A		.											.	ZNF628-22	0			c.A700G						.						3.0	4.0	4.0					19																	55993260		1771	3509	5280	SO:0001583	missense	89887	exon3			CCGGGTACCGCCT	AF367249	CCDS33116.3	19q13.43	2013-01-08			ENSG00000197483	ENSG00000197483		"""Zinc fingers, C2H2-type"""	28054	protein-coding gene	gene with protein product	"""Zinc finger expressed in Embryonal cells and Certain adult organs"""	610671					Standard	NM_033113		Approved	ZEC, Zfp628	uc002qld.3	Q5EBL2	OTTHUMG00000150396	ENST00000598519.1:c.700A>G	19.37:g.55993260A>G	ENSP00000469591:p.Thr234Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	9	NM_033113	0	0	0	0	0	Q86X34	Missense_Mutation	SNP	ENST00000598519.1	37	CCDS33116.3	1594	0.7298534798534798	448	0.9105691056910569	272	0.7513812154696132	259	0.4527972027972028	615	0.8113456464379947	.	0.001	-2.964343	0.00049	.	.	ENSG00000197483	ENST00000391718	T	0.08193	3.12	3.0	-0.723	0.11181	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.05852	-1.0860	8	0.25106	T	0.35	0.0335	6.0751	0.19911	0.3452:0.3167:0.3381:0.0	rs34864744	230	Q5EBL2	ZN628_HUMAN	A	230	ENSP00000375598:T230A	ENSP00000375598:T230A	T	+	1	0	ZNF628	60685072	0.324000	0.24652	0.001000	0.08648	0.007000	0.05969	-0.265000	0.08644	-0.261000	0.09405	-2.335000	0.00248	ACC	A|0.270;G|0.730		0.766	ZNF628-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317934.2	XM_058964	
CMPK2	129607	hgsc.bcm.edu	37	2	7005369	7005369	+	Silent	SNP	A	A	G	rs11678810	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr2:7005369A>G	ENST00000256722.5	-	1	458	c.459T>C	c.(457-459)tgT>tgC	p.C153C	CMPK2_ENST00000478738.1_Intron|CMPK2_ENST00000458098.1_Silent_p.C153C|CMPK2_ENST00000404168.1_Silent_p.C153C	NM_207315.3	NP_997198.2	Q5EBM0	CMPK2_HUMAN	cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial	153					cellular response to lipopolysaccharide (GO:0071222)|dTDP biosynthetic process (GO:0006233)|dUDP biosynthetic process (GO:0006227)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cytidylate kinase activity (GO:0004127)|nucleoside diphosphate kinase activity (GO:0004550)|thymidylate kinase activity (GO:0004798)|UMP kinase activity (GO:0033862)			large_intestine(1)|lung(13)|prostate(1)|upper_aerodigestive_tract(1)	16	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					GTGCCTCCTGACAGGCGCCCA	0.741													G|||	4998	0.998003	0.9924	1.0	5008	,	,		10694	1.0		1.0	False		,,,				2504	1.0				p.C153C		.											.	CMPK2-68	0			c.T459C						.	G		3605,39		1783,39,0	3.0	4.0	4.0		459	1.6	0.0	2	dbSNP_120	4	7874,0		3937,0,0	no	coding-synonymous	CMPK2	NM_207315.2		5720,39,0	GG,GA,AA		0.0,1.0703,0.3386		153/450	7005369	11479,39	1822	3937	5759	SO:0001819	synonymous_variant	129607	exon1			CTCCTGACAGGCG		CCDS42648.1, CCDS58695.1, CCDS58696.1	2p25.2	2008-01-25			ENSG00000134326	ENSG00000134326	2.7.4.14		27015	protein-coding gene	gene with protein product	"""cytidylate kinase 2"""	611787				17999954	Standard	NM_207315		Approved	TYKi, UMP-CMPK2	uc002qyo.4	Q5EBM0	OTTHUMG00000151629	ENST00000256722.5:c.459T>C	2.37:g.7005369A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	11	11	NM_001256478	0	0	0	1	1	A2RUB0|A5D8T2|B7ZM18|Q6ZRU2|Q96AL8	Silent	SNP	ENST00000256722.5	37	CCDS42648.1																																																																																			A|0.003;G|0.997		0.741	CMPK2-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323339.2	NM_207315	
FEZ2	9637	hgsc.bcm.edu	37	2	36825137	36825137	+	Missense_Mutation	SNP	G	G	A	rs1544655	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr2:36825137G>A	ENST00000405912.3	-	1	148	c.149C>T	c.(148-150)cCg>cTg	p.P50L	FEZ2_ENST00000379245.4_Missense_Mutation_p.P50L	NM_005102.2	NP_005093.2	Q9UHY8	FEZ2_HUMAN	fasciculation and elongation protein zeta 2 (zygin II)	50			P -> L (in dbSNP:rs1544655). {ECO:0000269|PubMed:10931946}.		axon guidance (GO:0007411)|nervous system development (GO:0007399)|signal transduction (GO:0007165)					breast(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|urinary_tract(1)	7		all_hematologic(82;0.21)				GCTGCAGGCCGGGGCCGGGAA	0.761													A|||	4355	0.869609	0.9039	0.8372	5008	,	,		3879	0.9881		0.7435	False		,,,				2504	0.8538				p.P50L		.											.	FEZ2-23	0			c.C149T						.						2.0	3.0	3.0					2																	36825137		1191	2916	4107	SO:0001583	missense	9637	exon1			CAGGCCGGGGCCG	U60061	CCDS46257.1, CCDS46258.1	2p21	2008-05-15			ENSG00000171055	ENSG00000171055			3660	protein-coding gene	gene with protein product		604826				9096408	Standard	NM_005102		Approved		uc002rpg.2	Q9UHY8	OTTHUMG00000152148	ENST00000405912.3:c.149C>T	2.37:g.36825137G>A	ENSP00000385112:p.Pro50Leu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_001042548	0	0	0	19	19	Q5EBN3|Q76LN0|Q99690	Missense_Mutation	SNP	ENST00000405912.3	37	CCDS46257.1	1789	0.8191391941391941	416	0.8455284552845529	284	0.7845303867403315	557	0.9737762237762237	532	0.7018469656992085	A	9.679	1.148856	0.21288	.	.	ENSG00000171055	ENST00000379245;ENST00000405912	T;T	0.16897	2.31;2.31	3.93	3.93	0.45458	.	0.000000	0.64402	N	0.000005	T	0.00012	0.0000	N	0.00121	-2.07	0.09310	P	0.9999999999999999	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.32025	-0.9922	9	0.02654	T	1	-21.1042	7.5473	0.27775	0.8952:0.0:0.1048:0.0	rs1544655	50;50;50	G3V0F5;Q9UHY8;Q9UHY8-2	.;FEZ2_HUMAN;.	L	50	ENSP00000368547:P50L;ENSP00000385112:P50L	ENSP00000368547:P50L	P	-	2	0	FEZ2	36678641	1.000000	0.71417	0.997000	0.53966	0.540000	0.34992	0.606000	0.24194	0.590000	0.29694	-0.775000	0.03384	CCG	T|0.817;C|0.180		0.761	FEZ2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325432.1		
TTC31	64427	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	74710496	74710496	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr2:74710496A>C	ENST00000233623.5	+	2	95	c.88A>C	c.(88-90)Aaa>Caa	p.K30Q	CCDC142_ENST00000290418.4_5'Flank|TTC31_ENST00000410003.1_Missense_Mutation_p.K30Q|CCDC142_ENST00000471713.1_5'Flank|TTC31_ENST00000463189.1_3'UTR|CCDC142_ENST00000393965.3_5'Flank|TTC31_ENST00000442235.2_5'UTR	NM_022492.4	NP_071937.4	Q49AM3	TTC31_HUMAN	tetratricopeptide repeat domain 31	30										breast(1)|endometrium(1)|large_intestine(4)|lung(2)|skin(1)	9						TGCTGCACCCAAACTTTGCAA	0.577											OREG0014719	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.K30Q		.											.	TTC31-90	0			c.A88C						.						65.0	72.0	70.0					2																	74710496		1949	4158	6107	SO:0001583	missense	64427	exon2			GCACCCAAACTTT	AK026819	CCDS42701.1	2p13.1	2013-01-11			ENSG00000115282	ENSG00000115282		"""Tetratricopeptide (TTC) repeat domain containing"""	25759	protein-coding gene	gene with protein product						12477932	Standard	NM_022492		Approved	FLJ12788	uc002slt.2	Q49AM3	OTTHUMG00000152887	ENST00000233623.5:c.88A>C	2.37:g.74710496A>C	ENSP00000233623:p.Lys30Gln	Somatic	95	0	1154	WXS	Illumina GAIIx	Phase_I	98	5	NM_022492	0	0	14	14	0	Q4KN40|Q53FD4|Q9H9F7	Missense_Mutation	SNP	ENST00000233623.5	37	CCDS42701.1	.	.	.	.	.	.	.	.	.	.	A	15.15	2.747152	0.49257	.	.	ENSG00000115282	ENST00000410003;ENST00000435361;ENST00000441635;ENST00000233623	T;T	0.48201	0.82;0.82	4.07	0.221	0.15283	.	0.595355	0.14895	N	0.292159	T	0.35393	0.0930	L	0.51422	1.61	0.54753	D	0.999983	B	0.20550	0.046	B	0.13407	0.009	T	0.19811	-1.0294	10	0.87932	D	0	.	3.4123	0.07363	0.5763:0.2059:0.2178:0.0	.	30	Q49AM3	TTC31_HUMAN	Q	30	ENSP00000387213:K30Q;ENSP00000233623:K30Q	ENSP00000233623:K30Q	K	+	1	0	TTC31	74564004	0.000000	0.05858	0.613000	0.29037	0.903000	0.53119	0.058000	0.14301	-0.050000	0.13356	0.533000	0.62120	AAA	.		0.577	TTC31-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328422.1	NM_022492	
CD8B	926	hgsc.bcm.edu	37	2	87088964	87088964	+	Silent	SNP	A	A	G	rs62146888	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr2:87088964A>G	ENST00000390655.6	-	1	83	c.25T>C	c.(25-27)Ttg>Ctg	p.L9L	CD8B_ENST00000393761.2_Silent_p.L9L|CD8B_ENST00000349455.3_Silent_p.L9L|CD8B_ENST00000331469.2_Silent_p.L9L|AC111200.1_ENST00000441646.1_5'Flank|CD8B_ENST00000393759.2_Silent_p.L9L|CD8B_ENST00000431506.2_Silent_p.L9L	NM_004931.4	NP_004922.1	P10966	CD8B_HUMAN	CD8b molecule	9					immune response (GO:0006955)|regulation of defense response to virus by virus (GO:0050690)|regulation of immune response (GO:0050776)|T cell activation (GO:0042110)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|viral process (GO:0016032)	early endosome membrane (GO:0031901)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	coreceptor activity (GO:0015026)|MHC class I protein binding (GO:0042288)			NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	13						TGCGCGGCCAAGAGGAGCCAC	0.756													G|||	2559	0.510982	0.6626	0.3862	5008	,	,		7474	0.5427		0.4672	False		,,,				2504	0.407				p.L9L		.											.	CD8B-92	0			c.T25C						.						1.0	1.0	1.0					2																	87088964		543	1520	2063	SO:0001819	synonymous_variant	926	exon1			CGGCCAAGAGGAG		CCDS1994.1, CCDS1995.1, CCDS42708.1, CCDS1997.1, CCDS54376.1	2p12	2013-01-11	2006-03-28	2006-03-09	ENSG00000172116	ENSG00000172116		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1707	protein-coding gene	gene with protein product		186730	"""CD8 antigen, beta polypeptide 1 (p37)"""	CD8B1		1541829	Standard	NM_172213		Approved		uc002srw.3	P10966	OTTHUMG00000130264	ENST00000390655.6:c.25T>C	2.37:g.87088964A>G		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	7	4	NM_004931	0	0	0	0	0	P14860|P14861|Q15980|Q496E0|Q496E1|Q496E2|Q9UDB4|Q9UDB5|Q9UDB6|Q9UDB7|Q9UDB8|Q9UDB9|Q9UDC0|Q9UQ55	Silent	SNP	ENST00000390655.6	37	CCDS1997.1																																																																																			A|0.476;G|0.524		0.756	CD8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330402.1	NM_172099	
SNRNP200	23020	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	96965141	96965141	+	Frame_Shift_Del	DEL	C	C	-			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr2:96965141delC	ENST00000323853.5	-	6	732	c.655delG	c.(655-657)gagfs	p.E219fs	SNRNP200_ENST00000349783.5_Frame_Shift_Del_p.E219fs	NM_014014.4	NP_054733.2	O75643	U520_HUMAN	small nuclear ribonucleoprotein 200kDa (U5)	219					ATP catabolic process (GO:0006200)|cis assembly of pre-catalytic spliceosome (GO:0000354)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U5 snRNP (GO:0005682)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|lung(37)|ovary(7)|prostate(4)|skin(5)|stomach(1)|urinary_tract(1)	90						TCTCGAACCTCCCCGTATACG	0.522																																					p.E219fs		.											.	SNRNP200-162	0			c.655delG						.						237.0	210.0	219.0					2																	96965141		2203	4300	6503	SO:0001589	frameshift_variant	23020	exon6			GAACCTCCCCGTA	AL831994	CCDS2020.1	2q11.2	2013-05-13	2008-10-29	2008-10-29	ENSG00000144028	ENSG00000144028			30859	protein-coding gene	gene with protein product	"""U5 snRNP specific protein, 200 KD"""	601664	"""activating signal cointegrator 1 complex subunit 3-like 1"", ""retinitis pigmentosa 33 (autosomal dominant)"""	ASCC3L1, RP33		9872452, 8670905, 9774689, 9539711, 16612614, 19878916	Standard	NM_014014		Approved	U5-200KD, HELIC2, KIAA0788, BRR2	uc002svu.3	O75643	OTTHUMG00000130455	ENST00000323853.5:c.655delG	2.37:g.96965141delC	ENSP00000317123:p.Glu219fs	Somatic	158	0		WXS	Illumina GAIIx	Phase_I	173	32	NM_014014	0	0	0	0	0	O94884|Q6NZY0|Q6PX59|Q8NBE6|Q96IF2|Q9H7S0	Frame_Shift_Del	DEL	ENST00000323853.5	37	CCDS2020.1																																																																																			.		0.522	SNRNP200-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252846.2	NM_014014	
SCN3A	6328	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	166032830	166032830	+	Silent	SNP	G	G	T	rs112118503		TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr2:166032830G>T	ENST00000360093.3	-	3	566	c.75C>A	c.(73-75)atC>atA	p.I25I	SCN3A_ENST00000283254.7_Silent_p.I25I|SCN3A_ENST00000409101.3_Silent_p.I25I	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	25					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CACGTTTTTCGATAGCAGCAA	0.438																																					p.I25I		.											.	SCN3A-141	0			c.C75A						.						170.0	167.0	168.0					2																	166032830		2203	4300	6503	SO:0001819	synonymous_variant	6328	exon3			TTTTTCGATAGCA	AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.75C>A	2.37:g.166032830G>T		Somatic	78	0		WXS	Illumina GAIIx	Phase_I	66	23	NM_001081676	0	0	0	0	0	Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Silent	SNP	ENST00000360093.3	37																																																																																				G|0.500;A|0.500		0.438	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_006922	
PDE11A	50940	bcgsc.ca	37	2	178762824	178762824	+	Silent	SNP	T	T	C	rs71423514	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr2:178762824T>C	ENST00000286063.6	-	4	1580	c.1263A>G	c.(1261-1263)gaA>gaG	p.E421E	PDE11A_ENST00000449286.2_Silent_p.E63E|PDE11A_ENST00000358450.4_Silent_p.E171E|PDE11A_ENST00000497003.1_5'UTR|PDE11A_ENST00000409504.1_Silent_p.E63E	NM_016953.3	NP_058649.3	Q9HCR9	PDE11_HUMAN	phosphodiesterase 11A	421	GAF 2.				blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|signal transduction (GO:0007165)	cytosol (GO:0005829)|perikaryon (GO:0043204)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|cyclic-nucleotide phosphodiesterase activity (GO:0004112)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(3)	58			OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)		Caffeine(DB00201)|Tadalafil(DB00820)	CAGAACAGCGTTCACATTTCA	0.378									Primary Pigmented Nodular Adrenocortical Disease, Familial				T|||	301	0.0601038	0.0061	0.0735	5008	,	,		15586	0.0149		0.1362	False		,,,				2504	0.092				p.E421E		.											.	PDE11A-93	0			c.A1263G						.	T	,,	137,4269	98.0+/-136.7	4,129,2070	142.0	134.0	137.0		513,189,1263	1.7	1.0	2	dbSNP_130	137	1324,7276	260.3+/-283.2	92,1140,3068	no	coding-synonymous,coding-synonymous,coding-synonymous	PDE11A	NM_001077197.1,NM_001077358.1,NM_016953.3	,,	96,1269,5138	CC,CT,TT		15.3953,3.1094,11.2333	,,	171/684,63/576,421/934	178762824	1461,11545	2203	4300	6503	SO:0001819	synonymous_variant	50940	exon4	Familial Cancer Database	iPPNAD, PPNAD1, incl. familial micronodular adrenocortical hyperplasia, PPNAD2	ACAGCGTTCACAT	AJ251509	CCDS33334.1, CCDS42785.1, CCDS42786.1, CCDS46459.1	2q31.3	2010-06-22			ENSG00000128655	ENSG00000128655	3.1.4.17	"""Phosphodiesterases"""	8773	protein-coding gene	gene with protein product		604961				10725373	Standard	NM_001077196		Approved		uc002ulq.3	Q9HCR9	OTTHUMG00000154188	ENST00000286063.6:c.1263A>G	2.37:g.178762824T>C		Somatic	73	0		WXS	Illumina GAIIx	Phase_I	57	4	NM_016953	0	0	0	0	0	Q14CD1|Q53T16|Q96S76|Q9GZY7|Q9HB46|Q9NY45	Silent	SNP	ENST00000286063.6	37	CCDS33334.1	159	0.07280219780219781	6	0.012195121951219513	29	0.08011049723756906	14	0.024475524475524476	110	0.14511873350923482	T	9.875	1.199996	0.22121	0.031094	0.153953	ENSG00000128655	ENST00000433879	.	.	.	5.89	1.66	0.24008	.	.	.	.	.	T	0.00356	0.0011	.	.	.	0.09310	P	1.0	.	.	.	.	.	.	T	0.11036	-1.0604	3	.	.	.	.	10.0467	0.42190	0.0:0.3364:0.0:0.6636	.	.	.	.	S	60	.	.	N	-	2	0	PDE11A	178471070	0.994000	0.37717	1.000000	0.80357	0.998000	0.95712	0.296000	0.19083	0.431000	0.26258	0.533000	0.62120	AAC	T|0.895;C|0.105		0.378	PDE11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334313.2		
TTN	7273	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	179586707	179586707	+	Silent	SNP	A	A	G	rs532700134		TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr2:179586707A>G	ENST00000591111.1	-	76	21956	c.21732T>C	c.(21730-21732)taT>taC	p.Y7244Y	TTN_ENST00000342992.6_Silent_p.Y6317Y|TTN-AS1_ENST00000585451.1_RNA|RP11-171I2.1_ENST00000590024.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000589042.1_Silent_p.Y7561Y			Q8WZ42	TITIN_HUMAN	titin	12812	Ig-like 54.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATGTGATTGTATAGTTTCCTC	0.428													A|||	1	0.000199681	0.0	0.0	5008	,	,		20586	0.0		0.0	False		,,,				2504	0.001				p.Y7561Y		.											.	TTN-636	0			c.T22683C						.						270.0	253.0	259.0					2																	179586707		1921	4130	6051	SO:0001819	synonymous_variant	7273	exon78			GATTGTATAGTTT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.21732T>C	2.37:g.179586707A>G		Somatic	245	1		WXS	Illumina GAIIx	Phase_I	233	77	NM_001267550	0	0	0	0	0	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37																																																																																				.		0.428	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
FAM171B	165215	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	187626567	187626567	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr2:187626567A>G	ENST00000304698.5	+	8	1701	c.1498A>G	c.(1498-1500)Aat>Gat	p.N500D		NM_177454.3	NP_803237.3	Q6P995	F171B_HUMAN	family with sequence similarity 171, member B	500						integral component of membrane (GO:0016021)	DNA binding (GO:0003677)			NS(1)|breast(6)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(22)|ovary(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	54						TATTAACAACAATCTATCTTC	0.393																																					p.N500D		.											.	FAM171B-141	0			c.A1498G						.						67.0	65.0	66.0					2																	187626567		2203	4300	6503	SO:0001583	missense	165215	exon8			AACAACAATCTAT	AF361495	CCDS33347.1	2q32.2	2008-06-16	2008-06-16	2008-06-16	ENSG00000144369	ENSG00000144369			29412	protein-coding gene	gene with protein product			"""KIAA1946"""	KIAA1946		11853319	Standard	NM_177454		Approved	FLJ34104	uc002ups.3	Q6P995	OTTHUMG00000154278	ENST00000304698.5:c.1498A>G	2.37:g.187626567A>G	ENSP00000304108:p.Asn500Asp	Somatic	87	0		WXS	Illumina GAIIx	Phase_I	74	21	NM_177454	0	0	2	2	0	Q53SK3|Q8N1Y4|Q8N3K1|Q8N970|Q8NB81|Q8TF55|Q8WYR8	Missense_Mutation	SNP	ENST00000304698.5	37	CCDS33347.1	.	.	.	.	.	.	.	.	.	.	A	7.196	0.592573	0.13875	.	.	ENSG00000144369	ENST00000304698	T	0.29917	1.55	5.12	5.12	0.69794	.	0.244697	0.34628	N	0.003813	T	0.17323	0.0416	N	0.22421	0.69	0.09310	N	0.999993	B;B	0.09022	0.002;0.002	B;B	0.08055	0.003;0.003	T	0.21314	-1.0249	10	0.12103	T	0.63	-19.435	7.9601	0.30066	0.8632:0.0:0.1368:0.0	.	500;501	Q6P995;A8K122	F171B_HUMAN;.	D	500	ENSP00000304108:N500D	ENSP00000304108:N500D	N	+	1	0	FAM171B	187334812	0.003000	0.15002	0.966000	0.40874	0.988000	0.76386	1.555000	0.36277	2.123000	0.65237	0.533000	0.62120	AAT	.		0.393	FAM171B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334679.1	NM_177454	
COL5A2	1290	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	189963460	189963460	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr2:189963460C>T	ENST00000374866.3	-	5	669	c.395G>A	c.(394-396)gGa>gAa	p.G132E	AC133106.2_ENST00000419029.1_RNA	NM_000393.3	NP_000384.2	P05997	CO5A2_HUMAN	collagen, type V, alpha 2	132					axon guidance (GO:0007411)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|negative regulation of endodermal cell differentiation (GO:1903225)|skeletal system development (GO:0001501)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)			NS(3)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(53)|ovary(3)|prostate(2)|skin(6)|urinary_tract(3)	95			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			TACTGCCGGTCCTGGACGACC	0.343																																					p.G132E		.											.	COL5A2-92	0			c.G395A						.						86.0	85.0	85.0					2																	189963460		2203	4300	6503	SO:0001583	missense	1290	exon5			GCCGGTCCTGGAC	Y14690	CCDS33350.1	2q14-q32	2014-09-17			ENSG00000204262	ENSG00000204262		"""Collagens"""	2210	protein-coding gene	gene with protein product	"""AB collagen"""	120190				1572660	Standard	NM_000393		Approved		uc002uqk.3	P05997	OTTHUMG00000149842	ENST00000374866.3:c.395G>A	2.37:g.189963460C>T	ENSP00000364000:p.Gly132Glu	Somatic	68	0		WXS	Illumina GAIIx	Phase_I	40	7	NM_000393	0	0	0	0	0	P78440|Q13908|Q53WR4|Q59GR4|Q6LDJ5|Q7KZ55|Q86XF6|Q96QB0|Q96QB3	Missense_Mutation	SNP	ENST00000374866.3	37	CCDS33350.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.285080	0.80803	.	.	ENSG00000204262	ENST00000374866	D	0.99353	-5.77	5.61	5.61	0.85477	.	0.246446	0.28343	N	0.015694	D	0.99677	0.9879	H	0.97829	4.085	0.58432	D	0.999997	D	0.89917	1.0	D	0.91635	0.999	D	0.97546	1.0089	9	.	.	.	.	16.5546	0.84482	0.0:1.0:0.0:0.0	.	132	P05997	CO5A2_HUMAN	E	132	ENSP00000364000:G132E	.	G	-	2	0	COL5A2	189671705	1.000000	0.71417	0.997000	0.53966	0.885000	0.51271	4.775000	0.62346	2.631000	0.89168	0.655000	0.94253	GGA	.		0.343	COL5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313523.1	NM_000393	
CST3	1471	hgsc.bcm.edu	37	20	23618488	23618488	+	Silent	SNP	G	G	A	rs1055084	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr20:23618488G>A	ENST00000398411.1	-	1	94	c.12C>T	c.(10-12)ccC>ccT	p.P4P	CST3_ENST00000376925.3_Silent_p.P4P|CST3_ENST00000398409.1_Silent_p.P4P			P01034	CYTC_HUMAN	cystatin C	4					apoptotic process (GO:0006915)|brain development (GO:0007420)|cell activation (GO:0001775)|cellular response to hydrogen peroxide (GO:0070301)|circadian sleep/wake cycle, REM sleep (GO:0042747)|defense response (GO:0006952)|embryo implantation (GO:0007566)|extracellular fibril organization (GO:0043206)|eye development (GO:0001654)|negative regulation of blood vessel remodeling (GO:0060313)|negative regulation of cell death (GO:0060548)|negative regulation of collagen catabolic process (GO:0010711)|negative regulation of elastin catabolic process (GO:0060311)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extracellular matrix disassembly (GO:0010716)|negative regulation of peptidase activity (GO:0010466)|negative regulation of proteolysis (GO:0045861)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|regulation of programmed cell death (GO:0043067)|regulation of tissue remodeling (GO:0034103)|response to axon injury (GO:0048678)|response to carbohydrate (GO:0009743)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|response to nutrient levels (GO:0031667)|response to toxic substance (GO:0009636)|salivary gland development (GO:0007431)|Sertoli cell development (GO:0060009)	basement membrane (GO:0005604)|cell projection (GO:0042995)|contractile fiber (GO:0043292)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|nuclear membrane (GO:0031965)|perinuclear region of cytoplasm (GO:0048471)	beta-amyloid binding (GO:0001540)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|endopeptidase inhibitor activity (GO:0004866)|protease binding (GO:0002020)			large_intestine(2)|lung(1)|ovary(1)	4	Lung NSC(19;0.0789)|Colorectal(13;0.0993)|all_lung(19;0.169)					GGGCGCGCAGGGGCCCGGCCA	0.756													g|||	114	0.0227636	0.0015	0.0476	5008	,	,		7697	0.0		0.0696	False		,,,				2504	0.0092				p.P4P		.											.	CST3-91	0			c.C12T						.			35,2527		0,35,1246	2.0	2.0	2.0		12	-3.0	0.0	20	dbSNP_86	2	290,4772		2,286,2243	no	coding-synonymous	CST3	NM_000099.2		2,321,3489	AA,AG,GG		5.729,1.3661,4.2629		4/147	23618488	325,7299	1281	2531	3812	SO:0001819	synonymous_variant	1471	exon1			GCGCAGGGGCCCG		CCDS13158.1	20p11.2	2008-04-15	2008-04-15		ENSG00000101439	ENSG00000101439			2475	protein-coding gene	gene with protein product		604312	"""cystatin C (amyloid angiopathy and cerebral hemorrhage)"""			8486384	Standard	NM_000099		Approved		uc002wtn.1	P01034	OTTHUMG00000032080	ENST00000398411.1:c.12C>T	20.37:g.23618488G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	4	NM_000099	0	0	58	254	196	B2R5J9|D3DW42|Q6FGW9	Silent	SNP	ENST00000398411.1	37	CCDS13158.1																																																																																			T|0.037;C|0.962		0.756	CST3-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256831.1	NM_000099	
VSX1	30813	bcgsc.ca	37	20	25059546	25059546	+	Silent	SNP	T	T	C	rs12480307	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr20:25059546T>C	ENST00000376709.4	-	3	809	c.546A>G	c.(544-546)gcA>gcG	p.A182A	VSX1_ENST00000424574.1_Silent_p.A182A|VSX1_ENST00000376707.3_Silent_p.A182A|VSX1_ENST00000429762.3_Silent_p.A182A|VSX1_ENST00000444511.2_Silent_p.A182A|VSX1_ENST00000451258.1_Silent_p.A182A	NM_014588.5	NP_055403.2	Q9NZR4	VSX1_HUMAN	visual system homeobox 1	182					neuron maturation (GO:0042551)|response to stimulus (GO:0050896)|retinal bipolar neuron differentiation (GO:0060040)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(3)|lung(2)	6						CCTCGCTGAATGCCTTCTCCA	0.572													C|||	1454	0.290335	0.4992	0.3501	5008	,	,		17872	0.0268		0.2207	False		,,,				2504	0.3088				p.A182A		.											.	VSX1-90	0			c.A546G						.	C	,	1908,2498	626.1+/-394.7	405,1098,700	104.0	105.0	104.0		546,546	-10.6	0.0	20	dbSNP_120	104	1987,6613	723.2+/-406.4	238,1511,2551	no	coding-synonymous,coding-synonymous	VSX1	NM_014588.4,NM_199425.1	,	643,2609,3251	CC,CT,TT		23.1047,43.3046,29.9477	,	182/366,182/240	25059546	3895,9111	2203	4300	6503	SO:0001819	synonymous_variant	30813	exon3			GCTGAATGCCTTC	AF176797	CCDS13168.1, CCDS13169.1, CCDS58766.1, CCDS58767.1	20p11.21	2014-02-14	2007-07-12		ENSG00000100987	ENSG00000100987		"""Homeoboxes / PRD class"""	12723	protein-coding gene	gene with protein product		605020	"""posterior polymorphous corneal dystrophy"", ""visual system homeobox 1 homolog, CHX10-like (zebrafish)"""	PPCD		10673340	Standard	NM_001256272		Approved	PPD, PPCD1	uc002wuf.4	Q9NZR4	OTTHUMG00000032111	ENST00000376709.4:c.546A>G	20.37:g.25059546T>C		Somatic	128	0		WXS	Illumina GAIIx	Phase_I	183	6	NM_014588	0	0	0	0	0	B9EGJ4|D1MF28|Q0GM60|Q0GM61|Q0GM62|Q0GM63|Q0GM64|Q0GM65|Q5TF40|Q5TF41|Q9HCU3|Q9NU27	Silent	SNP	ENST00000376709.4	37	CCDS13168.1																																																																																			T|0.715;C|0.285		0.572	VSX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078384.3		
OGFR	11054	hgsc.bcm.edu	37	20	61444569	61444569	+	Silent	SNP	A	A	G	rs3204348		TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr20:61444569A>G	ENST00000290291.6	+	7	1627	c.1602A>G	c.(1600-1602)ccA>ccG	p.P534P	OGFR_ENST00000370461.1_Silent_p.P482P	NM_007346.2	NP_031372.2	Q9NZT2	OGFR_HUMAN	opioid growth factor receptor	534	7 X 20 AA approximate tandem repeats of [ST]-P-S-E-T-P-G-P-[SR]-P-A-G-P-[AT]- [GR]-D-E-P-A-[EK].				opioid receptor signaling pathway (GO:0038003)|regulation of cell growth (GO:0001558)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	opioid receptor activity (GO:0004985)			endometrium(2)|kidney(1)|lung(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	17	Breast(26;3.65e-08)					GGGACGAGCCAGCCGAGAGCC	0.721																																					p.P534P		.											.	OGFR-68	0			c.A1602G						.						11.0	17.0	15.0					20																	61444569		2124	4201	6325	SO:0001819	synonymous_variant	11054	exon7			CGAGCCAGCCGAG	AF109134	CCDS13504.1	20q13.3	2008-05-02			ENSG00000060491	ENSG00000060491			15768	protein-coding gene	gene with protein product		606459				10677613	Standard	NM_007346		Approved	7-60	uc002ydj.3	Q9NZT2	OTTHUMG00000032937	ENST00000290291.6:c.1602A>G	20.37:g.61444569A>G		Somatic	27	0		WXS	Illumina GAIIx	Phase_I	57	11	NM_007346	0	0	99	123	24	O96029|Q4VXW5|Q96CM2|Q9BQW1|Q9H4H0|Q9H7J5|Q9NZT3|Q9NZT4	Silent	SNP	ENST00000290291.6	37	CCDS13504.1																																																																																			A|0.979;G|0.021		0.721	OGFR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080067.1		
OGFR	11054	hgsc.bcm.edu	37	20	61444633	61444633	+	Missense_Mutation	SNP	G	G	A	rs75570150		TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr20:61444633G>A	ENST00000290291.6	+	7	1691	c.1666G>A	c.(1666-1668)Gag>Aag	p.E556K	OGFR_ENST00000370461.1_Missense_Mutation_p.E504K	NM_007346.2	NP_031372.2	Q9NZT2	OGFR_HUMAN	opioid growth factor receptor	556	7 X 20 AA approximate tandem repeats of [ST]-P-S-E-T-P-G-P-[SR]-P-A-G-P-[AT]- [GR]-D-E-P-A-[EK].				opioid receptor signaling pathway (GO:0038003)|regulation of cell growth (GO:0001558)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	opioid receptor activity (GO:0004985)	p.E556K(1)		endometrium(2)|kidney(1)|lung(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	17	Breast(26;3.65e-08)					CGAGCCAGCCGAGAGCCCATC	0.756																																					p.E556K		.											.	OGFR-68	1	Substitution - Missense(1)	skin(1)	c.G1666A						.						6.0	11.0	9.0					20																	61444633		1936	3778	5714	SO:0001583	missense	11054	exon7			CCAGCCGAGAGCC	AF109134	CCDS13504.1	20q13.3	2008-05-02			ENSG00000060491	ENSG00000060491			15768	protein-coding gene	gene with protein product		606459				10677613	Standard	NM_007346		Approved	7-60	uc002ydj.3	Q9NZT2	OTTHUMG00000032937	ENST00000290291.6:c.1666G>A	20.37:g.61444633G>A	ENSP00000290291:p.Glu556Lys	Somatic	6	0		WXS	Illumina GAIIx	Phase_I	44	12	NM_007346	0	0	92	92	0	O96029|Q4VXW5|Q96CM2|Q9BQW1|Q9H4H0|Q9H7J5|Q9NZT3|Q9NZT4	Missense_Mutation	SNP	ENST00000290291.6	37	CCDS13504.1	.	.	.	.	.	.	.	.	.	.	A	2.693	-0.272793	0.05716	.	.	ENSG00000060491	ENST00000290291;ENST00000357163;ENST00000370469;ENST00000370461	T;T	0.52983	0.64;0.64	0.773	-1.55	0.08558	.	.	.	.	.	T	0.25195	0.0612	N	0.14661	0.345	0.09310	N	1	B;B;B	0.09022	0.002;0.002;0.002	B;B;B	0.04013	0.0;0.001;0.0	T	0.12785	-1.0534	9	0.34782	T	0.22	.	5.1465	0.14987	0.4456:0.0:0.5544:0.0	.	556;539;556	B3KMQ6;Q05BV5;Q9NZT2	.;.;OGFR_HUMAN	K	556;536;391;504	ENSP00000290291:E556K;ENSP00000359491:E504K	ENSP00000290291:E556K	E	+	1	0	OGFR	60915078	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-3.269000	0.00532	-0.808000	0.04387	-1.125000	0.01998	GAG	.		0.756	OGFR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080067.1		
OGFR	11054	hgsc.bcm.edu	37	20	61444637	61444637	+	Missense_Mutation	SNP	G	G	C	rs78981100		TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr20:61444637G>C	ENST00000290291.6	+	7	1695	c.1670G>C	c.(1669-1671)aGc>aCc	p.S557T	OGFR_ENST00000370461.1_Missense_Mutation_p.S505T	NM_007346.2	NP_031372.2	Q9NZT2	OGFR_HUMAN	opioid growth factor receptor	557	7 X 20 AA approximate tandem repeats of [ST]-P-S-E-T-P-G-P-[SR]-P-A-G-P-[AT]- [GR]-D-E-P-A-[EK].				opioid receptor signaling pathway (GO:0038003)|regulation of cell growth (GO:0001558)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	opioid receptor activity (GO:0004985)	p.S557T(3)		endometrium(2)|kidney(1)|lung(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	17	Breast(26;3.65e-08)					CCAGCCGAGAGCCCATCGGAG	0.746																																					p.S557T		.											.	OGFR-68	3	Substitution - Missense(3)	upper_aerodigestive_tract(1)|prostate(1)|skin(1)	c.G1670C						.						5.0	10.0	8.0					20																	61444637		1884	3696	5580	SO:0001583	missense	11054	exon7			CCGAGAGCCCATC	AF109134	CCDS13504.1	20q13.3	2008-05-02			ENSG00000060491	ENSG00000060491			15768	protein-coding gene	gene with protein product		606459				10677613	Standard	NM_007346		Approved	7-60	uc002ydj.3	Q9NZT2	OTTHUMG00000032937	ENST00000290291.6:c.1670G>C	20.37:g.61444637G>C	ENSP00000290291:p.Ser557Thr	Somatic	4	0		WXS	Illumina GAIIx	Phase_I	42	10	NM_007346	0	0	89	89	0	O96029|Q4VXW5|Q96CM2|Q9BQW1|Q9H4H0|Q9H7J5|Q9NZT3|Q9NZT4	Missense_Mutation	SNP	ENST00000290291.6	37	CCDS13504.1	.	.	.	.	.	.	.	.	.	.	G	7.631	0.678796	0.14841	.	.	ENSG00000060491	ENST00000290291;ENST00000357163;ENST00000370469;ENST00000370461	T;T	0.40225	1.04;1.04	0.773	0.773	0.18516	.	.	.	.	.	T	0.20373	0.0490	N	0.24115	0.695	0.09310	N	1	P;B;P	0.45594	0.862;0.386;0.862	B;B;B	0.38655	0.278;0.099;0.278	T	0.08868	-1.0701	9	0.09338	T	0.73	3.6159	4.5226	0.11966	0.2481:0.0:0.7519:0.0	.	557;540;557	B3KMQ6;Q05BV5;Q9NZT2	.;.;OGFR_HUMAN	T	557;537;392;505	ENSP00000290291:S557T;ENSP00000359491:S505T	ENSP00000290291:S557T	S	+	2	0	OGFR	60915082	0.000000	0.05858	0.008000	0.14137	0.008000	0.06430	-1.934000	0.01552	0.687000	0.31509	0.185000	0.17295	AGC	.		0.746	OGFR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080067.1		
CECR5	27440	hgsc.bcm.edu	37	22	17640022	17640022	+	Silent	SNP	G	G	C	rs11550530	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr22:17640022G>C	ENST00000336737.4	-	1	145	c.120C>G	c.(118-120)ccC>ccG	p.P40P	CECR5_ENST00000155674.5_Intron|CECR5-AS1_ENST00000329743.3_RNA|CECR5_ENST00000480451.1_5'UTR|CECR5_ENST00000399852.3_Silent_p.P40P|CECR5-AS1_ENST00000431923.1_RNA	NM_033070.2	NP_149061.1	Q9BXW7	CECR5_HUMAN	cat eye syndrome chromosome region, candidate 5	40						mitochondrion (GO:0005739)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|liver(1)|lung(10)|pancreas(1)|prostate(1)	21		all_epithelial(15;0.0181)|Lung NSC(13;0.109)|all_lung(157;0.132)				TCACCTGAGCGGGGCCCACAG	0.791													G|||	523	0.104433	0.1248	0.1297	5008	,	,		6009	0.123		0.0865	False		,,,				2504	0.0583				p.P40P		.											.	CECR5-514	0			c.C120G						.	G	,	187,2477		4,179,1149	2.0	3.0	3.0		,120	-4.2	0.0	22	dbSNP_134	3	289,5621		4,281,2670	no	intron,coding-synonymous	CECR5	NM_017829.5,NM_033070.2	,	8,460,3819	CC,CG,GG		4.89,7.0195,5.5517	,	,40/424	17640022	476,8098	1332	2955	4287	SO:0001819	synonymous_variant	27440	exon1			CTGAGCGGGGCCC	AF273270	CCDS13741.1, CCDS33595.1	22q11.2	2008-06-12			ENSG00000069998	ENSG00000069998			1843	protein-coding gene	gene with protein product						11381032	Standard	NM_017829		Approved		uc002zmf.3	Q9BXW7	OTTHUMG00000150071	ENST00000336737.4:c.120C>G	22.37:g.17640022G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	21	7	NM_033070	0	0	0	0	0	B2RCK5|Q9BXW8|Q9NWA8|Q9NX41	Silent	SNP	ENST00000336737.4	37	CCDS33595.1																																																																																			.		0.791	CECR5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316100.1	NM_017829	
SCARF2	91179	hgsc.bcm.edu	37	22	20780097	20780097	+	Silent	SNP	G	G	C	rs759609		TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr22:20780097G>C	ENST00000266214.5	-	11	2285	c.2181C>G	c.(2179-2181)cgC>cgG	p.R727R	SCARF2_ENST00000405555.3_Silent_p.R722R	NM_153334.4	NP_699165.2	Q96GP6	SREC2_HUMAN	scavenger receptor class F, member 2	727	Pro-rich.				cell adhesion (GO:0007155)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|skin(2)	10	Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			GCCCCGGGGGGCGCGGCGTTG	0.781																																					p.R727R		.											.	SCARF2-341	0			c.C2181G						.	C	,	3271,119		1585,101,9	5.0	5.0	5.0		2181,2166	-5.3	0.0	22	dbSNP_86	5	6306,190		3060,186,2	no	coding-synonymous,coding-synonymous	SCARF2	NM_153334.4,NM_182895.2	,	4645,287,11	CC,CG,GG		2.9249,3.5103,3.1256	,	727/871,722/866	20780097	9577,309	1695	3248	4943	SO:0001819	synonymous_variant	91179	exon11			CGGGGGGCGCGGC	AF522196	CCDS13779.1, CCDS46666.1	22q11.21	2011-10-10			ENSG00000244486	ENSG00000244486			19869	protein-coding gene	gene with protein product		613619				12154095	Standard	XM_006724364		Approved	SREC-II, SREC2, HUMZD58C02	uc002zsk.2	Q96GP6	OTTHUMG00000150779	ENST00000266214.5:c.2181C>G	22.37:g.20780097G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_153334	0	0	0	0	0	E5RFB8|Q58A83|Q8IXF3|Q9BW74	Silent	SNP	ENST00000266214.5	37	CCDS13779.1																																																																																			G|0.826;C|0.174		0.781	SCARF2-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320047.1		
CHEK2	11200	broad.mit.edu	37	22	29091840	29091840	+	Missense_Mutation	SNP	T	T	C	rs142470496	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr22:29091840T>C	ENST00000405598.1	-	12	1308	c.1117A>G	c.(1117-1119)Aag>Gag	p.K373E	CHEK2_ENST00000382565.1_Intron|CHEK2_ENST00000382578.1_Missense_Mutation_p.K282E|CHEK2_ENST00000382580.2_Missense_Mutation_p.K416E|CHEK2_ENST00000404276.1_Missense_Mutation_p.K373E|CHEK2_ENST00000348295.3_Missense_Mutation_p.K344E|CHEK2_ENST00000464581.1_5'Flank|CHEK2_ENST00000328354.6_Missense_Mutation_p.K373E|CHEK2_ENST00000402731.1_Missense_Mutation_p.K344E|CHEK2_ENST00000544772.1_Missense_Mutation_p.K152E|CHEK2_ENST00000403642.1_Missense_Mutation_p.K282E|CHEK2_ENST00000382566.1_3'UTR			O96017	CHK2_HUMAN	checkpoint kinase 2	373	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.|T-loop/activation segment.				cellular protein catabolic process (GO:0044257)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage checkpoint (GO:0000077)|DNA damage induced protein phosphorylation (GO:0006975)|double-strand break repair (GO:0006302)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of protein catabolic process (GO:0042176)|regulation of transcription, DNA-templated (GO:0006355)|replicative senescence (GO:0090399)|response to gamma radiation (GO:0010332)|signal transduction in response to DNA damage (GO:0042770)|signal transduction involved in intra-S DNA damage checkpoint (GO:0072428)|spindle assembly involved in mitosis (GO:0090307)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|PML body (GO:0016605)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)	p.K373E(9)		central_nervous_system(17)|endometrium(2)|kidney(11)|large_intestine(2)|lung(11)|ovary(1)|prostate(4)|stomach(2)	50						CCCAAAATCTTGGAGTGCCCA	0.418			F			breast		Direct reversal of damage;Other conserved DNA damage response genes																													p.K416E		.	yes	Rec		familial breast cancer	22	22q12.1	11200	CHK2 checkpoint homolog (S. pombe)		E	.	CHEK2-1515	9	Substitution - Missense(9)	kidney(4)|prostate(2)|endometrium(1)|stomach(1)|central_nervous_system(1)	c.A1246G						.																																			SO:0001583	missense	11200	exon12			AAATCTTGGAGTG	AF086904	CCDS13843.1, CCDS13844.1, CCDS33629.1	22q12.1	2014-09-17	2011-11-11	2001-09-27	ENSG00000183765	ENSG00000183765			16627	protein-coding gene	gene with protein product		604373	"""CHK2 (checkpoint, S.pombe) homolog"", ""CHK2 checkpoint homolog (S. pombe)"""	RAD53		9836640, 10097108	Standard	NM_001257387		Approved	CDS1, CHK2, HuCds1, PP1425, bA444G7	uc003adt.1	O96017	OTTHUMG00000151023	ENST00000405598.1:c.1117A>G	22.37:g.29091840T>C	ENSP00000386087:p.Lys373Glu	Somatic	196	2		WXS	Illumina GAIIx	Phase_I	205	14	NM_001005735	0	0	25	25	0	A8K3Y9|B7ZBF3|B7ZBF4|B7ZBF5|Q6QA03|Q6QA04|Q6QA05|Q6QA06|Q6QA07|Q6QA08|Q6QA10|Q6QA11|Q6QA12|Q6QA13|Q9HBS5|Q9HCQ8|Q9UGF0|Q9UGF1	Missense_Mutation	SNP	ENST00000405598.1	37	CCDS13843.1	.	.	.	.	.	.	.	.	.	.	T	19.06	3.754336	0.69648	.	.	ENSG00000183765	ENST00000348295;ENST00000382578;ENST00000544772;ENST00000328354;ENST00000404276;ENST00000405598;ENST00000382580;ENST00000403642;ENST00000402731	T;T;T;T;T;T;T;T;T	0.54071	0.9;0.59;0.59;0.59;0.59;0.59;0.59;0.59;0.9	5.89	5.89	0.94794	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.043710	0.85682	D	0.000000	T	0.56292	0.1975	N	0.11756	0.17	0.80722	D	1	D;D;D;D;D;D	0.76494	0.996;0.999;0.998;0.998;0.993;0.991	P;D;D;D;D;P	0.74674	0.905;0.984;0.943;0.969;0.923;0.896	T	0.64769	-0.6329	10	0.87932	D	0	-1.7726	15.4726	0.75453	0.0:0.0:0.0:1.0	.	282;152;373;344;373;416	O96017-4;Q9HBS5;A8JZZ5;O96017-12;O96017;O96017-9	.;.;.;.;CHK2_HUMAN;.	E	344;282;152;373;373;373;416;282;344	ENSP00000329012:K344E;ENSP00000372021:K282E;ENSP00000442458:K152E;ENSP00000329178:K373E;ENSP00000385747:K373E;ENSP00000386087:K373E;ENSP00000372023:K416E;ENSP00000384919:K282E;ENSP00000384835:K344E	ENSP00000329178:K373E	K	-	1	0	CHEK2	27421840	1.000000	0.71417	1.000000	0.80357	0.479000	0.33129	4.270000	0.58896	2.248000	0.74166	0.528000	0.53228	AAG	.		0.418	CHEK2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000321150.1	NM_001005735	
SH3BP1	23616	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	22	38051288	38051288	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr22:38051288C>T	ENST00000357436.4	+	18	2016	c.1703C>T	c.(1702-1704)cCg>cTg	p.P568L	Z83844.1_ENST00000456099.1_RNA|SH3BP1_ENST00000599616.1_Intron	NM_018957.3	NP_061830.3	Q9Y3L3	3BP1_HUMAN	SH3-domain binding protein 1	568					signal transduction (GO:0007165)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	Melanoma(58;0.0574)					GCCAAGCGCCCGGCGCCAGCC	0.701																																					p.P568L		.											.	SH3BP1-90	0			c.C1703T						.						9.0	9.0	9.0					22																	38051288		1816	3732	5548	SO:0001583	missense	23616	exon18			AGCGCCCGGCGCC		CCDS13952.2	22q13.1	2011-07-04			ENSG00000100092	ENSG00000100092		"""Rho GTPase activating proteins"""	10824	protein-coding gene	gene with protein product						10591208, 12029088	Standard	NM_018957		Approved	ARHGAP43	uc003ati.3	Q9Y3L3	OTTHUMG00000030996	ENST00000357436.4:c.1703C>T	22.37:g.38051288C>T	ENSP00000350018:p.Pro568Leu	Somatic	40	0		WXS	Illumina GAIIx	Phase_I	79	31	NM_018957	0	0	0	0	0	Q5R3N0|Q6IBZ2|Q6ZVL9|Q96HQ5|Q9NSQ9	Missense_Mutation	SNP	ENST00000357436.4	37	CCDS13952.2	.	.	.	.	.	.	.	.	.	.	C	16.71	3.199454	0.58126	.	.	ENSG00000100092	ENST00000357436	T	0.19532	2.14	4.18	4.18	0.49190	.	0.346810	0.20045	N	0.100438	T	0.23133	0.0559	N	0.24115	0.695	0.80722	D	1	D	0.71674	0.998	P	0.57057	0.812	T	0.01356	-1.1376	10	0.24483	T	0.36	.	11.0038	0.47622	0.0:0.9072:0.0:0.0928	.	568	Q9Y3L3	3BP1_HUMAN	L	568	ENSP00000350018:P568L	ENSP00000350018:P568L	P	+	2	0	SH3BP1	36381234	0.895000	0.30542	0.941000	0.38009	0.694000	0.40290	1.625000	0.37029	2.163000	0.67991	0.448000	0.29417	CCG	.		0.701	SH3BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075884.4	NM_018957	
TRIOBP	11078	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	22	38122417	38122417	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr22:38122417G>C	ENST00000406386.3	+	7	4109	c.3854G>C	c.(3853-3855)aGa>aCa	p.R1285T		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	1285					actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					CTGGCCCAGAGACAGCCAGGG	0.726																																					p.R1285T		.											.	TRIOBP-136	0			c.G3854C						.						7.0	10.0	9.0					22																	38122417		1876	3956	5832	SO:0001583	missense	11078	exon7			CCCAGAGACAGCC	AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.3854G>C	22.37:g.38122417G>C	ENSP00000384312:p.Arg1285Thr	Somatic	15	0		WXS	Illumina GAIIx	Phase_I	67	19	NM_001039141	0	0	2	2	0	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Missense_Mutation	SNP	ENST00000406386.3	37	CCDS43015.1	.	.	.	.	.	.	.	.	.	.	G	14.74	2.625977	0.46840	.	.	ENSG00000100106	ENST00000406386;ENST00000417174	T	0.27720	1.65	4.87	2.33	0.28932	.	.	.	.	.	T	0.25382	0.0617	L	0.27053	0.805	0.58432	D	0.999998	P	0.47409	0.895	P	0.47044	0.535	T	0.03483	-1.1032	9	0.59425	D	0.04	.	8.5982	0.33729	0.093:0.0:0.7531:0.1538	.	1285	Q9H2D6	TARA_HUMAN	T	1285	ENSP00000384312:R1285T	ENSP00000384312:R1285T	R	+	2	0	TRIOBP	36452363	1.000000	0.71417	0.997000	0.53966	0.885000	0.51271	3.098000	0.50259	1.045000	0.40225	0.456000	0.33151	AGA	.		0.726	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319439.2		
LMF2	91289	broad.mit.edu;bcgsc.ca	37	22	50946029	50946029	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr22:50946029G>A	ENST00000474879.2	-	1	91	c.76C>T	c.(76-78)Ctc>Ttc	p.L26F	LMF2_ENST00000216080.5_5'UTR|NCAPH2_ENST00000299821.11_5'Flank|LMF2_ENST00000505981.1_5'Flank|NCAPH2_ENST00000395698.3_5'Flank|LMF2_ENST00000380796.3_Missense_Mutation_p.L26F|NCAPH2_ENST00000420993.2_5'Flank|NCAPH2_ENST00000395701.3_5'Flank	NM_033200.2	NP_149977.2	Q9BU23	LMF2_HUMAN	lipase maturation factor 2	26						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|cervix(1)|kidney(1)|lung(4)|prostate(1)|skin(2)	10		all_cancers(38;1.31e-09)|all_epithelial(38;1.81e-08)|all_lung(38;0.000817)|Breast(42;0.00387)|Lung NSC(38;0.0124)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		TGCGTGTAGAGGGAAGCGAAA	0.667																																					p.L26F		.											.	LMF2-153	0			c.C76T						.						12.0	18.0	16.0					22																	50946029		1517	3516	5033	SO:0001583	missense	91289	exon1			TGTAGAGGGAAGC	BC002942	CCDS14093.1, CCDS14093.2	22q13.33	2008-02-04	2007-11-29	2007-11-29	ENSG00000100258	ENSG00000100258			25096	protein-coding gene	gene with protein product			"""transmembrane protein 153"", ""transmembrane protein 112B"""	TMEM153, TMEM112B		12477932	Standard	NM_033200		Approved		uc003blp.2	Q9BU23	OTTHUMG00000150206	ENST00000474879.2:c.76C>T	22.37:g.50946029G>A	ENSP00000424381:p.Leu26Phe	Somatic	175	0		WXS	Illumina GAIIx	Phase_I	172	6	NM_033200	0	0	34	37	3	A6NEZ0|Q13392|Q6ZNR2|Q8WU74|Q96C62	Missense_Mutation	SNP	ENST00000474879.2	37	CCDS14093.2	.	.	.	.	.	.	.	.	.	.	g	10.19	1.283046	0.23392	.	.	ENSG00000100258	ENST00000380796;ENST00000474879	T;T	0.34472	1.36;1.79	4.65	4.65	0.58169	.	.	.	.	.	T	0.37785	0.1016	L	0.42581	1.335	0.40650	D	0.982028	D	0.52996	0.957	P	0.49528	0.614	T	0.08827	-1.0703	9	0.25106	T	0.35	.	13.4404	0.61109	0.0:0.0:1.0:0.0	.	26	Q9BU23	LMF2_HUMAN	F	26	ENSP00000370173:L26F;ENSP00000424381:L26F	ENSP00000370173:L26F	L	-	1	0	LMF2	49292895	1.000000	0.71417	1.000000	0.80357	0.022000	0.10575	3.301000	0.51842	2.329000	0.79093	0.466000	0.42574	CTC	.		0.667	LMF2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316833.2	NM_033200	
CTNNB1	1499	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	41266134	41266136	+	In_Frame_Del	DEL	CTT	CTT	-	rs121913407		TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	CTT	CTT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr3:41266134_41266136delCTT	ENST00000349496.5	+	3	411_413	c.131_133delCTT	c.(130-135)ccttct>cct	p.S45del	CTNNB1_ENST00000396185.3_In_Frame_Del_p.S45del|CTNNB1_ENST00000405570.1_In_Frame_Del_p.S45del|CTNNB1_ENST00000453024.1_In_Frame_Del_p.S38del|CTNNB1_ENST00000396183.3_In_Frame_Del_p.S45del	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	45			Missing (in colorectal cancer). {ECO:0000269|PubMed:9065402}.|S -> F (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|S -> P (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.S45P(168)|p.A5_A80del(53)|p.S45del(50)|p.S45A(11)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.?(4)|p.W25_I140del(3)|p.T3_A126del(2)|p.D32_S47del(2)|p.P44_S45del(2)|p.M5_N141>D(2)|p.P44L(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.A5_Q143>E(1)|p.S37_G48>C(1)|p.A13_R151del(1)|p.H36_E53>L(1)|p.M14_S45del(1)|p.S45_G48del(1)|p.Q28_Q61del(1)|p.T41_N51del(1)|p.M1_A87del(1)|p.S45_L46del(1)|p.A20_N141del(1)|p.D11_Y142>H(1)|p.P44_S45insAP(1)|p.P44_N51del(1)|p.I35_K170del(1)|p.Y30_A97del(1)|p.T42_G48del(1)|p.S45_D58del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.T40_L46del(1)|p.A5_T59del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.H24_M131del(1)|p.S45E(1)|p.M8_A80del(1)|p.A5_E54del(1)|p.S45T(1)|p.A21_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.P44del(1)|p.A20_S111del(1)|p.T42_K49>Q(1)|p.Y30_A80del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		ACCACAGCTCCTTCTCTGAGTGG	0.502		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.44_45del	Colon(6;3 56 14213 18255)	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	.	CTNNB1-24361	359	Substitution - Missense(183)|Deletion - In frame(150)|Complex - deletion inframe(18)|Unknown(7)|Insertion - In frame(1)	liver(152)|kidney(53)|soft_tissue(47)|large_intestine(38)|adrenal_gland(28)|endometrium(9)|stomach(7)|skin(6)|thyroid(3)|pituitary(3)|prostate(3)|small_intestine(2)|haematopoietic_and_lymphoid_tissue(2)|bone(2)|pancreas(2)|lung(1)|ovary(1)	c.131_133del						.																																			SO:0001651	inframe_deletion	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	CAGCTCCTTCTCT	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.131_133delCTT	3.37:g.41266134_41266136delCTT	ENSP00000344456:p.Ser45del	Somatic	210	0		WXS	Illumina GAIIx	Phase_I	162	51	NM_001098209	0	0	0	0	0	A8K1L7|Q8NEW9|Q8NI94|Q9H391	In_Frame_Del	DEL	ENST00000349496.5	37	CCDS2694.1																																																																																			.		0.502	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
NKTR	4820	hgsc.bcm.edu;broad.mit.edu	37	3	42679924	42679926	+	In_Frame_Del	DEL	GAA	GAA	-			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	GAA	GAA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr3:42679924_42679926delGAA	ENST00000232978.8	+	13	2916_2918	c.2728_2730delGAA	c.(2728-2730)gaadel	p.E911del	RP4-613B23.1_ENST00000434363.1_RNA|RP4-613B23.1_ENST00000438017.1_RNA|RP4-613B23.1_ENST00000445452.1_RNA	NM_005385.3	NP_005376.2	P30414	NKTR_HUMAN	natural killer cell triggering receptor	911					protein folding (GO:0006457)	membrane (GO:0016020)	cyclosporin A binding (GO:0016018)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	41				KIRC - Kidney renal clear cell carcinoma(284;0.24)		CTCTGACAAGGAAGAAGGTGAGG	0.419																																					p.910_910del		.											.	NKTR-93	0			c.2728_2730del						.																																			SO:0001651	inframe_deletion	4820	exon13			GACAAGGAAGAAG		CCDS2702.1	3p22.1	2014-01-20	2014-01-20		ENSG00000114857	ENSG00000114857			7833	protein-coding gene	gene with protein product	"""NK-tumor recognition protein"", ""natural-killer cells cyclophilin-related protein"", ""NK-TR protein"""	161565	"""natural killer-tumor recognition sequence"""			8314596, 8144875	Standard	XM_005265173		Approved	p104	uc003clo.3	P30414	OTTHUMG00000133037	ENST00000232978.8:c.2728_2730delGAA	3.37:g.42679927_42679929delGAA	ENSP00000232978:p.Glu911del	Somatic	186	0		WXS	Illumina GAIIx	Phase_I	190	11	NM_005385	0	0	0	0	0		In_Frame_Del	DEL	ENST00000232978.8	37	CCDS2702.1																																																																																			.		0.419	NKTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256642.2	NM_005385	
QARS	5859	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	49136628	49136628	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr3:49136628C>G	ENST00000306125.6	-	18	2010	c.1673G>C	c.(1672-1674)cGt>cCt	p.R558P	QARS_ENST00000470225.1_5'Flank|QARS_ENST00000414533.1_Missense_Mutation_p.R547P			P47897	SYQ_HUMAN	glutaminyl-tRNA synthetase	558					brain development (GO:0007420)|gene expression (GO:0010467)|glutaminyl-tRNA aminoacylation (GO:0006425)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|glutamine-tRNA ligase activity (GO:0004819)			breast(1)|endometrium(1)|large_intestine(9)|lung(4)|ovary(1)|prostate(2)|urinary_tract(1)	19				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)	L-Glutamine(DB00130)	CAGCACATCACGCACACAGGC	0.537																																					p.R558P		.											.	QARS-91	0			c.G1673C						.						108.0	105.0	106.0					3																	49136628		2203	4300	6503	SO:0001583	missense	5859	exon18			ACATCACGCACAC	X76013	CCDS2788.1, CCDS63633.1	3p21.31	2011-07-01			ENSG00000172053	ENSG00000172053	6.1.1.18	"""Aminoacyl tRNA synthetases / Class I"""	9751	protein-coding gene	gene with protein product	"""glutamine tRNA ligase"""	603727				8078941, 10393422	Standard	NM_005051		Approved		uc003cvx.4	P47897	OTTHUMG00000156774	ENST00000306125.6:c.1673G>C	3.37:g.49136628C>G	ENSP00000307567:p.Arg558Pro	Somatic	193	0		WXS	Illumina GAIIx	Phase_I	155	51	NM_005051	0	0	122	197	75	B4DWJ2	Missense_Mutation	SNP	ENST00000306125.6	37	CCDS2788.1	.	.	.	.	.	.	.	.	.	.	C	28.0	4.882904	0.91740	.	.	ENSG00000172053	ENST00000453392;ENST00000306125;ENST00000414533	T;T;T	0.25085	1.88;1.82;1.82	6.02	6.02	0.97574	Glutamyl/glutaminyl-tRNA synthetase, class Ib, alpha-bundle domain (1);Glutamyl/glutaminyl-tRNA synthetase, class Ib, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.72558	0.3475	H	0.99286	4.5	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.84003	0.0344	10	0.87932	D	0	-15.0266	20.5407	0.99260	0.0:1.0:0.0:0.0	.	547;558	B4DWJ2;P47897	.;SYQ_HUMAN	P	78;558;547	ENSP00000396326:R78P;ENSP00000307567:R558P;ENSP00000390015:R547P	ENSP00000307567:R558P	R	-	2	0	QARS	49111632	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.273000	0.78527	2.865000	0.98341	0.655000	0.94253	CGT	.		0.537	QARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345689.2	NM_005051	
USP19	10869	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	49155468	49155468	+	Silent	SNP	C	C	T	rs374044689		TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr3:49155468C>T	ENST00000398888.2	-	3	528	c.210G>A	c.(208-210)ggG>ggA	p.G70G	USP19_ENST00000398892.3_Intron|USP19_ENST00000488993.1_5'UTR|USP19_ENST00000417901.1_Silent_p.G70G|USP19_ENST00000453664.1_Silent_p.G70G|USP19_ENST00000398896.1_5'Flank|USP19_ENST00000434032.2_Silent_p.G70G|USP19_ENST00000398898.2_Intron	NM_006677.2	NP_006668.1	O94966	UBP19_HUMAN	ubiquitin specific peptidase 19	70					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|negative regulation of skeletal muscle tissue development (GO:0048642)|positive regulation of cell cycle process (GO:0090068)|protein deubiquitination (GO:0016579)|regulation of cellular response to hypoxia (GO:1900037)|regulation of protein stability (GO:0031647)|response to endoplasmic reticulum stress (GO:0034976)|skeletal muscle atrophy (GO:0014732)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|ubiquitin-specific protease activity (GO:0004843)			NS(1)|breast(3)|endometrium(5)|kidney(2)|large_intestine(10)|lung(5)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		agcctgtgatcccagctgcat	0.532																																					p.G70G		.											.	USP19-663	0			c.G210A						.						47.0	48.0	48.0					3																	49155468		1985	4159	6144	SO:0001819	synonymous_variant	10869	exon3			TGTGATCCCAGCT	AB020698	CCDS43090.1, CCDS56254.1, CCDS56255.1, CCDS56256.1	3p21.31	2005-10-13	2005-08-08		ENSG00000172046	ENSG00000172046		"""Zinc fingers, MYND-type"", ""Ubiquitin-specific peptidases"""	12617	protein-coding gene	gene with protein product		614471	"""ubiquitin specific protease 19"""			12838346	Standard	NM_001199160		Approved	KIAA0891, ZMYND9	uc011bch.2	O94966	OTTHUMG00000133611	ENST00000398888.2:c.210G>A	3.37:g.49155468C>T		Somatic	60	0		WXS	Illumina GAIIx	Phase_I	54	22	NM_001199160	0	0	7	8	1	A5PKX8|A6H8U2|B4DGT3|B4DTZ0|E7EN22|E7ETS0|E9PEG8|Q3KQW4|Q641Q9|Q6NZY8|Q86XV9	Silent	SNP	ENST00000398888.2	37	CCDS43090.1																																																																																			.		0.532	USP19-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000257721.1	NM_006677	
LRIG1	26018	hgsc.bcm.edu	37	3	66550762	66550762	+	Missense_Mutation	SNP	G	G	C	rs1403626	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr3:66550762G>C	ENST00000273261.3	-	1	594	c.70C>G	c.(70-72)Ctt>Gtt	p.L24V	LRIG1_ENST00000383703.3_Missense_Mutation_p.L24V	NM_015541.2	NP_056356.2	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like domains 1	24			L -> V (in dbSNP:rs1403626).	LLL -> VLV (in Ref. 1; AAK62357 and 3; AAH71561). {ECO:0000305}.	innervation (GO:0060384)|otolith morphogenesis (GO:0032474)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)				NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(4)|stomach(4)|urinary_tract(1)	42		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		CGAAGCAAAAGCAGCCAGAGA	0.766													g|||	3605	0.719848	0.1808	0.8833	5008	,	,		8368	0.8284		0.9732	False		,,,				2504	0.9601				p.L24V		.											.	LRIG1-230	0			c.C70G						.		VAL/LEU	1309,1447		265,779,334	3.0	4.0	4.0		70	3.1	0.5	3	dbSNP_88	4	5325,93		2620,85,4	no	missense	LRIG1	NM_015541.2	32	2885,864,338	CC,CG,GG		1.7165,47.4964,18.8402	benign	24/1094	66550762	6634,1540	1378	2709	4087	SO:0001583	missense	26018	exon1			GCAAAAGCAGCCA	AB050468	CCDS33783.1	3p14	2013-01-14			ENSG00000144749	ENSG00000144749		"""Immunoglobulin superfamily / I-set domain containing"""	17360	protein-coding gene	gene with protein product	"""ortholog of mouse integral membrane glycoprotein LIG-1"", ""leucine-rich repeat protein LRIG1"""	608868				11414704, 12234026	Standard	NM_015541		Approved	LIG-1, DKFZP586O1624, LIG1	uc003dmx.3	Q96JA1	OTTHUMG00000158727	ENST00000273261.3:c.70C>G	3.37:g.66550762G>C	ENSP00000273261:p.Leu24Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_015541	0	0	0	0	0	Q6IQ51|Q96CF9|Q9BYB8|Q9UFI4	Missense_Mutation	SNP	ENST00000273261.3	37	CCDS33783.1	1670	0.7646520146520146	119	0.241869918699187	326	0.9005524861878453	488	0.8531468531468531	737	0.9722955145118733	g	9.592	1.126319	0.20959	0.474964	0.982835	ENSG00000144749	ENST00000273261;ENST00000383703	T;T	0.68765	-0.35;-0.2	3.11	3.11	0.35812	.	0.429988	0.15146	U	0.278020	T	0.00012	0.0000	N	0.19112	0.55	0.39998	P	0.024872000000000005	P;B	0.36282	0.546;0.282	B;B	0.32465	0.146;0.069	T	0.40572	-0.9556	9	0.23891	T	0.37	.	12.0321	0.53403	0.0:0.0:1.0:0.0	rs1403626;rs13083630;rs1403626	24;24	Q96JA1-2;Q96JA1	.;LRIG1_HUMAN	V	24	ENSP00000273261:L24V;ENSP00000373208:L24V	ENSP00000273261:L24V	L	-	1	0	LRIG1	66633452	.	.	0.546000	0.28166	0.017000	0.09413	.	.	1.734000	0.51633	0.472000	0.43445	CTT	G|0.252;C|0.748		0.766	LRIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351930.1	NM_015541	
OR5K3	403277	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	98110047	98110047	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr3:98110047G>A	ENST00000383695.1	+	1	538	c.538G>A	c.(538-540)Gat>Aat	p.D180N	RP11-325B23.2_ENST00000508616.1_lincRNA	NM_001005516.1	NP_001005516.1	A6NET4	OR5K3_HUMAN	olfactory receptor, family 5, subfamily K, member 3	180						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(15)|prostate(1)|skin(1)|urinary_tract(1)	27						TTTTTTCTGTGATGTTCTTCC	0.353																																					p.D180N		.											.	OR5K3-68	0			c.G538A						.						138.0	137.0	138.0					3																	98110047		2203	4300	6503	SO:0001583	missense	403277	exon1			TTCTGTGATGTTC		CCDS33803.1	3q11.2	2013-09-23			ENSG00000206536	ENSG00000206536		"""GPCR / Class A : Olfactory receptors"""	31290	protein-coding gene	gene with protein product							Standard	NM_001005516		Approved		uc011bgw.2	A6NET4	OTTHUMG00000160077	ENST00000383695.1:c.538G>A	3.37:g.98110047G>A	ENSP00000373194:p.Asp180Asn	Somatic	62	0		WXS	Illumina GAIIx	Phase_I	54	10	NM_001005516	0	0	0	0	0		Missense_Mutation	SNP	ENST00000383695.1	37	CCDS33803.1	.	.	.	.	.	.	.	.	.	.	G	19.05	3.751356	0.69533	.	.	ENSG00000206536	ENST00000383695	T	0.00188	8.59	5.15	5.15	0.70609	GPCR, rhodopsin-like superfamily (1);	0.000000	0.46758	D	0.000279	T	0.00695	0.0023	M	0.87180	2.865	0.29461	N	0.857791	D	0.76494	0.999	D	0.77557	0.99	T	0.35822	-0.9773	10	0.66056	D	0.02	-37.1506	16.4659	0.84079	0.0:0.0:1.0:0.0	.	180	A6NET4	OR5K3_HUMAN	N	180	ENSP00000373194:D180N	ENSP00000373194:D180N	D	+	1	0	OR5K3	99592737	1.000000	0.71417	0.998000	0.56505	0.749000	0.42624	4.544000	0.60691	2.527000	0.85204	0.603000	0.83216	GAT	.		0.353	OR5K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359110.1		
CCDC14	64770	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	123633689	123633689	+	Silent	SNP	C	C	T			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr3:123633689C>T	ENST00000488653.2	-	13	2889	c.2799G>A	c.(2797-2799)gcG>gcA	p.A933A	CCDC14_ENST00000483247.1_5'UTR|CCDC14_ENST00000489746.1_Silent_p.A733A|CCDC14_ENST00000433542.2_Silent_p.A892A|CCDC14_ENST00000485727.1_Silent_p.A733A|CCDC14_ENST00000310351.4_Silent_p.A773A			Q49A88	CCD14_HUMAN	coiled-coil domain containing 14	933					substantia nigra development (GO:0021762)	centrosome (GO:0005813)				NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(10)	21		Lung NSC(201;0.0371)|Prostate(884;0.0405)|Myeloproliferative disorder(1037;0.205)		Lung(219;0.00942)|GBM - Glioblastoma multiforme(114;0.159)		CATCTAATGCCGCAAGGCCAT	0.408																																					p.A892A		.											.	CCDC14-68	0			c.G2676A						.						33.0	32.0	32.0					3																	123633689		2203	4300	6503	SO:0001819	synonymous_variant	64770	exon12			TAATGCCGCAAGG	AL122079	CCDS3025.2	3q21.1	2014-03-20			ENSG00000175455	ENSG00000175455			25766	protein-coding gene	gene with protein product						12477932	Standard	NM_022757		Approved	FLJ12892, DKFZp434L1050	uc010hrt.3	Q49A88	OTTHUMG00000153005	ENST00000488653.2:c.2799G>A	3.37:g.123633689C>T		Somatic	102	0		WXS	Illumina GAIIx	Phase_I	122	35	NM_022757	0	0	17	28	11	B7Z2T2|B8ZZ41|B8ZZ58|D3DN98|Q7Z3N3|Q86T30|Q8IWF8|Q8WUJ8|Q96K47|Q9H9A3|Q9UFH0	Silent	SNP	ENST00000488653.2	37																																																																																				.		0.408	CCDC14-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_022757	
EFCC1	79825	hgsc.bcm.edu	37	3	128720487	128720487	+	Missense_Mutation	SNP	A	A	G	rs1871951	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr3:128720487A>G	ENST00000480450.1	+	1	16	c.16A>G	c.(16-18)Acg>Gcg	p.T6A	EFCC1_ENST00000436022.2_5'UTR|KIAA1257_ENST00000510149.1_Intron			Q9HA90	EFCC1_HUMAN	EF-hand and coiled-coil domain containing 1	6							calcium ion binding (GO:0005509)										GCCGGTCAGCACGGGCGCGGA	0.756													G|||	3483	0.695487	0.9592	0.6052	5008	,	,		11644	0.6677		0.5915	False		,,,				2504	0.5389				p.T6A		.											.	.	0			c.A16G						.						2.0	4.0	3.0					3																	128720487		494	1283	1777	SO:0001583	missense	79825	exon1			GTCAGCACGGGCG	AK022119	CCDS3054.1, CCDS3054.2	3q21.3	2013-01-11	2013-01-11	2013-01-11	ENSG00000114654	ENSG00000114654		"""EF-hand domain containing"""	25692	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 73"", ""coiled-coil domain containing 48"""	C3orf73, CCDC48			Standard	NM_024768		Approved	FLJ12057	uc011bkt.2	Q9HA90	OTTHUMG00000158996	ENST00000480450.1:c.16A>G	3.37:g.128720487A>G	ENSP00000420075:p.Thr6Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_024768	0	0	0	0	0	A8MYE2	Missense_Mutation	SNP	ENST00000480450.1	37	CCDS3054.2	1498	0.6858974358974359	465	0.9451219512195121	229	0.6325966850828729	362	0.6328671328671329	442	0.58311345646438	g	0.361	-0.939497	0.02322	.	.	ENSG00000114654	ENST00000480450	T	0.41400	1.0	2.78	-3.05	0.05396	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.58432	P	6.999999999979245E-6	B	0.02656	0.0	B	0.01281	0.0	T	0.37407	-0.9707	8	0.02654	T	1	.	3.5784	0.07943	0.1405:0.2998:0.4439:0.1159	rs1871951	6	Q9HA90	CCD48_HUMAN	A	6	ENSP00000420075:T6A	ENSP00000420075:T6A	T	+	1	0	CCDC48	130203177	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-1.263000	0.02850	-0.802000	0.04421	-0.701000	0.03672	ACG	A|0.315;G|0.685		0.756	EFCC1-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000352832.1	NM_024768	
PLXND1	23129	hgsc.bcm.edu	37	3	129324982	129324982	+	Silent	SNP	C	C	T	rs532094812		TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr3:129324982C>T	ENST00000324093.4	-	1	679	c.501G>A	c.(499-501)gcG>gcA	p.A167A	PLXND1_ENST00000393239.1_Silent_p.A167A	NM_015103.2	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1	167	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|endothelial cell migration (GO:0043542)|outflow tract morphogenesis (GO:0003151)|patterning of blood vessels (GO:0001569)|positive regulation of protein binding (GO:0032092)|regulation of angiogenesis (GO:0045765)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|synapse assembly (GO:0007416)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)		PLXND1/TMCC1(4)	NS(1)|breast(1)|endometrium(4)|kidney(5)|large_intestine(17)|lung(28)|prostate(10)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	72						cggcgggcggcgcggcgggcg	0.731													c|||	1	0.000199681	0.0	0.0	5008	,	,		9421	0.0		0.001	False		,,,				2504	0.0				p.A167A	Ovarian(97;366 1484 3738 22084 39045)	.											.	PLXND1-90	0			c.G501A						.						2.0	3.0	3.0					3																	129324982		1518	3277	4795	SO:0001819	synonymous_variant	23129	exon1			GGGCGGCGCGGCG	AY116661	CCDS33854.1	3q21.3	2007-05-16			ENSG00000004399	ENSG00000004399		"""Plexins"""	9107	protein-coding gene	gene with protein product		604282				12412018	Standard	NM_015103		Approved	KIAA0620	uc003emx.2	Q9Y4D7	OTTHUMG00000159547	ENST00000324093.4:c.501G>A	3.37:g.129324982C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_015103	0	0	0	0	0	A7E2C6|C9JPZ6|Q6PJS9|Q8IZJ2|Q9BTQ2	Silent	SNP	ENST00000324093.4	37	CCDS33854.1																																																																																			.		0.731	PLXND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356132.4	NM_015103	
IDUA	3425	broad.mit.edu	37	4	996204	996204	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr4:996204A>C	ENST00000247933.4	+	8	1208	c.1120A>C	c.(1120-1122)Acc>Ccc	p.T374P	IDUA_ENST00000514224.1_Missense_Mutation_p.T242P|IDUA_ENST00000453894.1_Missense_Mutation_p.T396P	NM_000203.3	NP_000194.2	P35475	IDUA_HUMAN	iduronidase, alpha-L-	374					carbohydrate metabolic process (GO:0005975)|cell morphogenesis (GO:0000902)|chemical homeostasis (GO:0048878)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate catabolic process (GO:0030209)|disaccharide metabolic process (GO:0005984)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|limb morphogenesis (GO:0035108)|lysosome organization (GO:0007040)|skeletal system morphogenesis (GO:0048705)|small molecule metabolic process (GO:0044281)	coated vesicle (GO:0030135)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	L-iduronidase activity (GO:0003940)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	12			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			GGTCAACAACACCCGCCCGCC	0.711																																					p.T374P		.											.	IDUA-91	0			c.A1120C						.						26.0	28.0	27.0					4																	996204		2185	4282	6467	SO:0001583	missense	3425	exon8			AACAACACCCGCC	M74715	CCDS3343.1	4p16.3	2012-10-02			ENSG00000127415	ENSG00000127415	3.2.1.76		5391	protein-coding gene	gene with protein product		252800				1832239	Standard	NM_000203		Approved	MPS1	uc003gby.3	P35475	OTTHUMG00000088901	ENST00000247933.4:c.1120A>C	4.37:g.996204A>C	ENSP00000247933:p.Thr374Pro	Somatic	91	19		WXS	Illumina GAIIx	Phase_I	244	106	NM_000203	0	0	5	5	0	B3KWK6	Missense_Mutation	SNP	ENST00000247933.4	37	CCDS3343.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.117066	0.77323	.	.	ENSG00000127415	ENST00000247933;ENST00000453894;ENST00000514224	D;D;D	0.94280	-3.39;-3.39;-3.39	5.31	5.31	0.75309	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.156849	0.56097	D	0.000026	D	0.96611	0.8894	M	0.86178	2.8	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.995	D	0.96508	0.9376	10	0.46703	T	0.11	-7.29	13.2474	0.60029	1.0:0.0:0.0:0.0	.	396;374	B3KWK6;P35475	.;IDUA_HUMAN	P	374;396;242	ENSP00000247933:T374P;ENSP00000396458:T396P;ENSP00000425081:T242P	ENSP00000247933:T374P	T	+	1	0	IDUA	986204	1.000000	0.71417	0.995000	0.50966	0.426000	0.31534	5.967000	0.70403	2.024000	0.59613	0.454000	0.30748	ACC	.		0.711	IDUA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000201812.1	NM_000203	
MSX1	4487	hgsc.bcm.edu	37	4	4861745	4861745	+	Missense_Mutation	SNP	C	C	G	rs36059701	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr4:4861745C>G	ENST00000382723.4	+	1	353	c.119C>G	c.(118-120)gCa>gGa	p.A40G		NM_002448.3	NP_002439.2	P28360	MSX1_HUMAN	msh homeobox 1	40	Poly-Ala.				activation of meiosis (GO:0090427)|anterior/posterior pattern specification (GO:0009952)|BMP signaling pathway involved in heart development (GO:0061312)|bone morphogenesis (GO:0060349)|cartilage morphogenesis (GO:0060536)|cell morphogenesis (GO:0000902)|cellular response to nicotine (GO:0071316)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic nail plate morphogenesis (GO:0035880)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|mammary gland epithelium development (GO:0061180)|mesenchymal cell proliferation (GO:0010463)|midbrain development (GO:0030901)|middle ear morphogenesis (GO:0042474)|muscle organ development (GO:0007517)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of striated muscle cell differentiation (GO:0051154)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|pituitary gland development (GO:0021983)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of intrinsic apoptotic signaling pathway by p53 class mediator (GO:1902255)|positive regulation of mesenchymal cell apoptotic process (GO:2001055)|protein localization to nucleus (GO:0034504)|protein stabilization (GO:0050821)|regulation of odontogenesis (GO:0042481)|signal transduction involved in regulation of gene expression (GO:0023019)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	p53 binding (GO:0002039)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			endometrium(3)|lung(5)|ovary(1)|prostate(1)|urinary_tract(1)	11				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		gcggccACGGCAGCCGCCATG	0.716													C|||	519	0.103634	0.0893	0.1037	5008	,	,		6085	0.0565		0.165	False		,,,				2504	0.1084				p.A40G		.											.	MSX1-90	0			c.C119G	GRCh37	CM045070	MSX1	M	rs36059701	.	C	GLY/ALA	241,2261		15,211,1025	3.0	4.0	4.0		119	2.9	0.4	4	dbSNP_126	4	677,4129		58,561,1784	no	missense	MSX1	NM_002448.3	60	73,772,2809	GG,GC,CC		14.0866,9.6323,12.5616	benign	40/304	4861745	918,6390	1251	2403	3654	SO:0001583	missense	4487	exon1			CCACGGCAGCCGC	M97676	CCDS3378.2	4p16.2	2011-06-20	2006-11-21		ENSG00000163132	ENSG00000163132		"""Homeoboxes / ANTP class : NKL subclass"""	7391	protein-coding gene	gene with protein product		142983	"""msh (Drosophila) homeo box homolog 1 (formerly homeo box 7)"", ""msh homeobox homolog 1 (Drosophila)"""	HOX7		1685479, 1973146	Standard	NM_002448		Approved	HYD1, OFC5	uc003gif.3	P28360	OTTHUMG00000090335	ENST00000382723.4:c.119C>G	4.37:g.4861745C>G	ENSP00000372170:p.Ala40Gly	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_002448	0	0	2	3	1	A0SZU5|A8K3M1|Q96NY4	Missense_Mutation	SNP	ENST00000382723.4	37	CCDS3378.2	290	0.13278388278388278	53	0.10772357723577236	45	0.12430939226519337	44	0.07692307692307693	148	0.19525065963060687	C	6.955	0.546124	0.13312	0.096323	0.140866	ENSG00000163132	ENST00000382723	D	0.95885	-3.84	4.66	2.92	0.33932	.	0.650131	0.15386	N	0.265060	T	0.00552	0.0018	N	0.24115	0.695	0.51767	P	6.20000000000065E-5	B	0.16166	0.016	B	0.15870	0.014	T	0.44003	-0.9356	9	0.11182	T	0.66	-4.3518	5.025	0.14379	0.1663:0.6515:0.0:0.1822	rs36059701	34	P28360	MSX1_HUMAN	G	40	ENSP00000372170:A40G	ENSP00000372170:A40G	A	+	2	0	MSX1	4912646	0.996000	0.38824	0.367000	0.25926	0.047000	0.14425	0.572000	0.23684	0.390000	0.25115	0.491000	0.48974	GCA	C|0.867;G|0.133		0.716	MSX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206700.3		
FAM184B	27146	hgsc.bcm.edu	37	4	17643848	17643848	+	Missense_Mutation	SNP	G	G	A	rs2286771	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr4:17643848G>A	ENST00000265018.3	-	13	2562	c.2350C>T	c.(2350-2352)Cgg>Tgg	p.R784W		NM_015688.1	NP_056503.1	Q9ULE4	F184B_HUMAN	family with sequence similarity 184, member B	784				R -> W (in Ref. 1; BAA86590). {ECO:0000305}.						NS(1)|central_nervous_system(1)|endometrium(1)|prostate(1)	4						GGGCCGCCCCGCTCCTGAGGA	0.701													G|||	2697	0.538538	0.1725	0.6599	5008	,	,		10215	0.8522		0.6233	False		,,,				2504	0.5368				p.R784W		.											.	FAM184B-23	0			c.C2350T						.						1.0	2.0	2.0					4																	17643848		374	1044	1418	SO:0001583	missense	27146	exon13			CGCCCCGCTCCTG		CCDS47033.1	4p16	2009-04-22			ENSG00000047662	ENSG00000047662			29235	protein-coding gene	gene with protein product						10574462	Standard	NM_015688		Approved	KIAA1276	uc003gpm.4	Q9ULE4	OTTHUMG00000160287	ENST00000265018.3:c.2350C>T	4.37:g.17643848G>A	ENSP00000265018:p.Arg784Trp	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	15	12	NM_015688	0	0	0	1	1		Missense_Mutation	SNP	ENST00000265018.3	37	CCDS47033.1	1272	0.5824175824175825	75	0.1524390243902439	232	0.6408839779005525	493	0.8618881118881119	472	0.6226912928759895	G	13.83	2.354233	0.41700	.	.	ENSG00000047662	ENST00000265018	T	0.34072	1.38	3.29	-3.67	0.04476	.	3.541600	0.00901	N	0.002342	T	0.00012	0.0000	N	0.14661	0.345	0.80722	P	0.0	D	0.56968	0.978	B	0.40741	0.339	T	0.48547	-0.9026	9	0.72032	D	0.01	2.0681	6.7491	0.23477	0.107:0.2547:0.5506:0.0877	rs2286771;rs58699512;rs2286771	784	Q9ULE4	F184B_HUMAN	W	784	ENSP00000265018:R784W	ENSP00000265018:R784W	R	-	1	2	FAM184B	17252946	0.000000	0.05858	0.000000	0.03702	0.516000	0.34256	-0.323000	0.07997	-1.014000	0.03379	-0.369000	0.07265	CGG	G|0.440;A|0.560		0.701	FAM184B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360137.1	NM_015688	
GPR125	166647	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	22390318	22390319	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	AA	AA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr4:22390318_22390319delAA	ENST00000334304.5	-	19	3244_3245	c.2975_2976delTT	c.(2974-2976)tttfs	p.F992fs	GPR125_ENST00000282943.5_5'UTR	NM_145290.3	NP_660333.2	Q8IWK6	GP125_HUMAN	G protein-coupled receptor 125	992					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(33)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	56		Breast(46;0.198)				GCTGAGAATGAAAAGTGTGCTC	0.426																																					p.992_992del		.											.	GPR125-91	0			c.2975_2976del						.																																			SO:0001589	frameshift_variant	166647	exon19			AGAATGAAAAGTG	AK095866	CCDS33964.1	4p15.31	2014-08-08			ENSG00000152990	ENSG00000152990		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / I-set domain containing"""	13839	protein-coding gene	gene with protein product		612303				12565841	Standard	NM_145290		Approved	FLJ38547, PGR21	uc003gqm.2	Q8IWK6	OTTHUMG00000160926	ENST00000334304.5:c.2975_2976delTT	4.37:g.22390320_22390321delAA	ENSP00000334952:p.Phe992fs	Somatic	80	0		WXS	Illumina GAIIx	Phase_I	71	17	NM_145290	0	0	0	0	0	Q6UXK9|Q86SQ5|Q8TC55	Frame_Shift_Del	DEL	ENST00000334304.5	37	CCDS33964.1																																																																																			.		0.426	GPR125-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362960.3		
KIAA1211	57482	bcgsc.ca	37	4	57190356	57190356	+	Silent	SNP	G	G	A	rs7695701	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr4:57190356G>A	ENST00000504228.1	+	8	3570	c.3465G>A	c.(3463-3465)agG>agA	p.R1155R	KIAA1211_ENST00000264229.6_Silent_p.R1155R|KIAA1211_ENST00000541073.1_Silent_p.R1148R			Q6ZU35	K1211_HUMAN	KIAA1211	1155								p.R1155R(1)		endometrium(7)|large_intestine(10)|lung(39)|ovary(2)|prostate(3)|skin(3)|stomach(1)	65	Glioma(25;0.08)|all_neural(26;0.101)					AAGAGAAGAGGCCCGAGACTG	0.567													G|||	1129	0.225439	0.0968	0.268	5008	,	,		20625	0.0704		0.4135	False		,,,				2504	0.3354				p.R1155R		.											.	KIAA1211-70	1	Substitution - coding silent(1)	prostate(1)	c.G3465A						.	G		555,3675		28,499,1588	59.0	66.0	63.0		3465	4.5	1.0	4	dbSNP_116	63	3519,4971		712,2095,1438	no	coding-synonymous	KIAA1211	NM_020722.1		740,2594,3026	AA,AG,GG		41.4488,13.1206,32.0283		1155/1234	57190356	4074,8646	2115	4245	6360	SO:0001819	synonymous_variant	57482	exon10			GAAGAGGCCCGAG	AB033037	CCDS43230.1	4q12	2012-08-03			ENSG00000109265	ENSG00000109265			29219	protein-coding gene	gene with protein product						10574462, 11230166	Standard	NM_020722		Approved		uc003hbk.2	Q6ZU35	OTTHUMG00000160749	ENST00000504228.1:c.3465G>A	4.37:g.57190356G>A		Somatic	339	4		WXS	Illumina GAIIx	Phase_I	399	11	NM_020722	0	0	1	1	0	Q9NTE2|Q9NTP8|Q9ULK9	Silent	SNP	ENST00000504228.1	37	CCDS43230.1																																																																																			G|0.741;A|0.259		0.567	KIAA1211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362097.2	NM_020722	
PCDH18	54510	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	138442524	138442524	+	Missense_Mutation	SNP	A	A	G	rs386679966		TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr4:138442524A>G	ENST00000344876.4	-	4	3453	c.3067T>C	c.(3067-3069)Tat>Cat	p.Y1023H	PCDH18_ENST00000507846.1_Missense_Mutation_p.Y802H|PCDH18_ENST00000510305.1_Missense_Mutation_p.Y234H|PCDH18_ENST00000412923.2_Missense_Mutation_p.Y1022H|PCDH18_ENST00000511115.1_Missense_Mutation_p.Y203H	NM_019035.3	NP_061908.1	Q9HCL0	PCD18_HUMAN	protocadherin 18	1023	Interaction with DAB1. {ECO:0000250}.				brain development (GO:0007420)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(27)|lung(21)|ovary(2)|pancreas(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86	all_hematologic(180;0.24)					CATTCAGAATAGGTGTCCAGG	0.572																																					p.Y1023H		.											.	PCDH18-185	0			c.T3067C						.						74.0	69.0	71.0					4																	138442524		2203	4300	6503	SO:0001583	missense	54510	exon4			CAGAATAGGTGTC	AL137471	CCDS34064.1, CCDS75193.1	4q28.3	2010-01-26			ENSG00000189184	ENSG00000189184		"""Cadherins / Protocadherins : Non-clustered"""	14268	protein-coding gene	gene with protein product		608287				10835267, 11549318	Standard	XM_005263070		Approved	KIAA1562, PCDH68L	uc003ihe.4	Q9HCL0	OTTHUMG00000161348	ENST00000344876.4:c.3067T>C	4.37:g.138442524A>G	ENSP00000355082:p.Tyr1023His	Somatic	214	0		WXS	Illumina GAIIx	Phase_I	134	66	NM_019035	0	0	3	3	0	A8K7K3|B7ZKT1|Q52LS2	Missense_Mutation	SNP	ENST00000344876.4	37	CCDS34064.1	.	.	.	.	.	.	.	.	.	.	A	11.52	1.664298	0.29604	.	.	ENSG00000189184	ENST00000344876;ENST00000412923;ENST00000507846;ENST00000510305;ENST00000511115	T;T;T;T;T	0.53423	0.72;0.73;0.62;1.5;1.49	4.86	3.59	0.41128	.	0.191216	0.25388	N	0.031032	T	0.47930	0.1472	M	0.67953	2.075	0.36971	D	0.89382	B;P;P;P	0.44260	0.033;0.739;0.83;0.739	B;B;P;B	0.46049	0.033;0.305;0.502;0.305	T	0.52056	-0.8626	10	0.15499	T	0.54	.	11.232	0.48918	0.8468:0.1532:0.0:0.0	.	203;802;1022;1023	B4DLR6;D6RIG4;Q9HCL0-2;Q9HCL0	.;.;.;PCD18_HUMAN	H	1023;1022;802;234;203	ENSP00000355082:Y1023H;ENSP00000390688:Y1022H;ENSP00000425903:Y802H;ENSP00000424269:Y234H;ENSP00000425647:Y203H	ENSP00000355082:Y1023H	Y	-	1	0	PCDH18	138661974	1.000000	0.71417	0.866000	0.34008	0.975000	0.68041	5.516000	0.67055	1.827000	0.53221	0.533000	0.62120	TAT	.		0.572	PCDH18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364614.1	NM_019035	
FAM149A	25854	hgsc.bcm.edu	37	4	187077240	187077240	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr4:187077240G>T	ENST00000356371.5	+	7	1343	c.1343G>T	c.(1342-1344)tGt>tTt	p.C448F	FAM149A_ENST00000227065.4_Missense_Mutation_p.C157F|FAM149A_ENST00000514829.1_3'UTR|FAM149A_ENST00000503432.1_Missense_Mutation_p.C157F|FAM149A_ENST00000514153.1_Missense_Mutation_p.C157F|FAM149A_ENST00000502970.1_Missense_Mutation_p.C157F|FAM149A_ENST00000389354.5_Missense_Mutation_p.C157F			A5PLN7	F149A_HUMAN	family with sequence similarity 149, member A	448										breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(8)|lung(8)|pancreas(1)|prostate(1)|skin(2)	25		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.19e-10)|BRCA - Breast invasive adenocarcinoma(30;1.22e-05)|GBM - Glioblastoma multiforme(59;0.000122)|STAD - Stomach adenocarcinoma(60;0.000288)|LUSC - Lung squamous cell carcinoma(40;0.00241)|READ - Rectum adenocarcinoma(43;0.166)		CCGCGTGACTGTGTCAAAGAT	0.453																																					p.C157F		.											.	FAM149A-90	0			c.G470T						.						129.0	117.0	121.0					4																	187077240		2203	4300	6503	SO:0001583	missense	25854	exon6			GTGACTGTGTCAA	AK057166	CCDS34117.1	4q35.1	2012-04-19			ENSG00000109794	ENSG00000109794			24527	protein-coding gene	gene with protein product							Standard	NM_015398		Approved	DKFZP564J102, MST119, MSTP119	uc010isl.3	A5PLN7	OTTHUMG00000160565	ENST00000356371.5:c.1343G>T	4.37:g.187077240G>T	ENSP00000348732:p.Cys448Phe	Somatic	125	0		WXS	Illumina GAIIx	Phase_I	80	4	NM_001006655	0	0	5	5	0	B5MDB8|Q2TAN6|Q7Z2S5|Q9Y4T9	Missense_Mutation	SNP	ENST00000356371.5	37		.	.	.	.	.	.	.	.	.	.	G	15.27	2.783678	0.49891	.	.	ENSG00000109794	ENST00000503432;ENST00000356371;ENST00000227065;ENST00000502970;ENST00000514153;ENST00000389354	T;T;T;T;T;T	0.29917	1.58;1.55;1.58;1.58;1.58;1.58	5.46	5.46	0.80206	.	0.061204	0.64402	D	0.000002	T	0.61689	0.2367	M	0.82323	2.585	0.54753	D	0.999983	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.999	T	0.65331	-0.6194	10	0.87932	D	0	-20.1862	19.1637	0.93544	0.0:0.0:1.0:0.0	.	448;448;157	A5PLN7-3;A5PLN7;B4DHZ9	.;F149A_HUMAN;.	F	157;448;157;157;157;157	ENSP00000426835:C157F;ENSP00000348732:C448F;ENSP00000227065:C157F;ENSP00000427155:C157F;ENSP00000424380:C157F;ENSP00000374005:C157F	ENSP00000227065:C157F	C	+	2	0	FAM149A	187314234	1.000000	0.71417	0.772000	0.31596	0.001000	0.01503	7.120000	0.77153	2.861000	0.98227	0.650000	0.86243	TGT	.		0.453	FAM149A-201	KNOWN	basic	protein_coding	protein_coding		NM_001006655	
FAT1	2195	bcgsc.ca	37	4	187522528	187522528	+	Silent	SNP	C	C	T	rs2289550	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr4:187522528C>T	ENST00000441802.2	-	21	11744	c.11535G>A	c.(11533-11535)acG>acA	p.T3845T	FAT1_ENST00000512347.1_5'Flank	NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	3845	Laminin G-like. {ECO:0000255|PROSITE- ProRule:PRU00122}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						TTTCATTTTCCGTCAGACGGT	0.413										HNSCC(5;0.00058)			C|||	279	0.0557109	0.0023	0.1052	5008	,	,		17244	0.1558		0.0348	False		,,,				2504	0.0112				p.T3845T	Colon(197;1040 2055 4143 4984 49344)	.											.	FAT1-34	0			c.G11535A						.	C		32,3780		0,32,1874	139.0	137.0	137.0		11535	2.7	0.8	4	dbSNP_100	137	247,7991		3,241,3875	no	coding-synonymous	FAT1	NM_005245.3		3,273,5749	TT,TC,CC		2.9983,0.8395,2.3154		3845/4589	187522528	279,11771	1906	4119	6025	SO:0001819	synonymous_variant	2195	exon21			ATTTTCCGTCAGA	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.11535G>A	4.37:g.187522528C>T		Somatic	138	0		WXS	Illumina GAIIx	Phase_I	79	4	NM_005245	0	0	44	44	0		Silent	SNP	ENST00000441802.2	37	CCDS47177.1																																																																																			C|0.934;T|0.066		0.413	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245	
PLK2	10769	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	57755592	57755592	+	Silent	SNP	C	C	G			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr5:57755592C>G	ENST00000274289.3	-	1	495	c.195G>C	c.(193-195)tcG>tcC	p.S65S	PLK2_ENST00000502671.1_5'Flank	NM_001252226.1|NM_006622.3	NP_001239155.1|NP_006613.2	Q9NYY3	PLK2_HUMAN	polo-like kinase 2	65					G1/S transition of mitotic cell cycle (GO:0000082)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|mitotic cell cycle checkpoint (GO:0007093)|mitotic spindle organization (GO:0007052)|negative regulation of apoptotic process (GO:0043066)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein phosphorylation (GO:0006468)|Rap protein signal transduction (GO:0032486)|Ras protein signal transduction (GO:0007265)|regulation of centriole replication (GO:0046599)|regulation of synaptic plasticity (GO:0048167)	centriole (GO:0005814)|centrosome (GO:0005813)|dendrite (GO:0030425)|intracellular (GO:0005622)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			endometrium(7)|large_intestine(7)|lung(5)|ovary(3)|prostate(2)|skin(2)	26		all_cancers(5;1.76e-12)|all_epithelial(5;2.09e-13)|all_lung(5;6.64e-05)|Lung NSC(5;0.000127)|Prostate(74;0.055)|Breast(144;0.0602)|Ovarian(174;0.182)		OV - Ovarian serous cystadenocarcinoma(10;7.03e-37)		TCTCCGGCCCCGAGTGCGAAT	0.692																																					p.S65S		.											.	PLK2-409	0			c.G195C						.						15.0	20.0	18.0					5																	57755592		2193	4291	6484	SO:0001819	synonymous_variant	10769	exon1			CGGCCCCGAGTGC		CCDS3974.1, CCDS75250.1	5q12.1-q13.2	2013-01-18	2010-06-24		ENSG00000145632	ENSG00000145632			19699	protein-coding gene	gene with protein product	"""serum-inducible kinase"""	607023	"""polo-like kinase 2 (Drosophila)"""				Standard	NM_006622		Approved	SNK	uc003jrn.3	Q9NYY3	OTTHUMG00000097047	ENST00000274289.3:c.195G>C	5.37:g.57755592C>G		Somatic	37	0		WXS	Illumina GAIIx	Phase_I	72	22	NM_006622	0	0	26	37	11	O60679|Q96CV7|Q9UE61	Silent	SNP	ENST00000274289.3	37	CCDS3974.1																																																																																			.		0.692	PLK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214150.1	NM_006622	
SOWAHA	134548	hgsc.bcm.edu	37	5	132149684	132149684	+	Missense_Mutation	SNP	G	G	C	rs40274	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr5:132149684G>C	ENST00000378693.2	+	1	652	c.371G>C	c.(370-372)cGg>cCg	p.R124P		NM_175873.4	NP_787069.3	Q2M3V2	SWAHA_HUMAN	sosondowah ankyrin repeat domain family member A	124	Pro-rich.		R -> P (in dbSNP:rs40274).														CCCTTGGTCCGGGTGCCGCGG	0.776																																					p.R124P		.											.	.	0			c.G371C						.	C	PRO/ARG	2599,13		1293,13,0	2.0	3.0	3.0		371	-0.3	0.0	5	dbSNP_76	3	6177,193		2993,191,1	no	missense	ANKRD43	NM_175873.4	103	4286,204,1	CC,CG,GG		3.0298,0.4977,2.2935	benign	124/550	132149684	8776,206	1306	3185	4491	SO:0001583	missense	134548	exon1			TGGTCCGGGTGCC	AK090823	CCDS43361.1	5q23.3	2013-01-10	2012-01-12	2012-01-12	ENSG00000198944	ENSG00000198944		"""Ankyrin repeat domain containing"""	27033	protein-coding gene	gene with protein product			"""ankyrin repeat domain 43"""	ANKRD43		22234889	Standard	NM_175873		Approved		uc003kxw.3	Q2M3V2	OTTHUMG00000059844	ENST00000378693.2:c.371G>C	5.37:g.132149684G>C	ENSP00000367965:p.Arg124Pro	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_175873	0	0	0	0	0	Q8NAE7	Missense_Mutation	SNP	ENST00000378693.2	37	CCDS43361.1	2142	0.9807692307692307	482	0.9796747967479674	357	0.9861878453038674	562	0.9825174825174825	741	0.9775725593667546	c	9.833	1.188835	0.21954	0.995023	0.969702	ENSG00000198944	ENST00000378693	T	0.38077	1.16	4.27	-0.265	0.12946	.	2.345400	0.02245	N	0.066177	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.36261	-0.9755	9	0.30078	T	0.28	-5.2019	3.6102	0.08057	0.2245:0.4439:0.2467:0.085	rs40274	124	Q2M3V2	ANR43_HUMAN	P	124	ENSP00000367965:R124P	ENSP00000367965:R124P	R	+	2	0	ANKRD43	132177583	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.768000	0.01794	-0.003000	0.14444	-3.153000	0.00058	CGG	G|0.980;C|0.020		0.776	SOWAHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133062.1	NM_175873	
HSPA4	3308	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	132406071	132406072	+	Frame_Shift_Del	DEL	AT	AT	-			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	AT	AT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr5:132406071_132406072delAT	ENST00000304858.2	+	4	601_602	c.312_313delAT	c.(310-315)acatatfs	p.Y105fs		NM_002154.3	NP_002145.3	P34932	HSP74_HUMAN	heat shock 70kDa protein 4	105					chaperone-mediated protein complex assembly (GO:0051131)|protein import into mitochondrial outer membrane (GO:0045040)|response to unfolded protein (GO:0006986)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(10)|stomach(1)	32			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TGCAGGTGACATATATGGAGGA	0.396																																					p.104_105del	Colon(114;1299 1588 6063 12302 48757)	.											.	HSPA4-226	0			c.312_313del						.																																			SO:0001589	frameshift_variant	3308	exon4			GGTGACATATATG	AB023420	CCDS4166.1	5q31.1	2011-09-07	2002-08-29		ENSG00000170606	ENSG00000170606		"""Heat shock proteins / HSP70"""	5237	protein-coding gene	gene with protein product	"""hsp70 RY"""	601113	"""heat shock 70kD protein 4"""			8335910	Standard	NM_002154		Approved	HS24/P52, HSPH2	uc003kyj.3	P34932	OTTHUMG00000129012	ENST00000304858.2:c.312_313delAT	5.37:g.132406075_132406076delAT	ENSP00000302961:p.Tyr105fs	Somatic	68	0		WXS	Illumina GAIIx	Phase_I	93	26	NM_002154	0	0	0	0	0	O95756|Q2TAL4|Q9BUK9	Frame_Shift_Del	DEL	ENST00000304858.2	37	CCDS4166.1																																																																																			.		0.396	HSPA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251011.1	NM_002154, NM_198431	
PCDHA3	56145	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140182806	140182806	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr5:140182806C>A	ENST00000522353.2	+	1	2024	c.2024C>A	c.(2023-2025)gCa>gAa	p.A675E	PCDHA1_ENST00000394633.3_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA3_ENST00000532566.2_Missense_Mutation_p.A675E|PCDHA2_ENST00000520672.2_Intron	NM_018906.2	NP_061729.1	Q9Y5H8	PCDA3_HUMAN	protocadherin alpha 3	675	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(16)|kidney(3)|large_intestine(19)|lung(36)|ovary(7)|prostate(8)|skin(3)|stomach(1)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGTGGCCAGGCACCCAAGGCC	0.672																																					p.A675E		.											.	PCDHA3-98	0			c.C2024A						.						49.0	51.0	50.0					5																	140182806		2203	4300	6503	SO:0001583	missense	56145	exon1			GCCAGGCACCCAA	AF152481	CCDS54915.1	5q31	2010-11-26				ENSG00000255408		"""Cadherins / Protocadherins : Clustered"""	8669	other	complex locus constituent	"""KIAA0345-like 11"""	606309				10380929	Standard	NM_018906		Approved	PCDH-ALPHA3		Q9Y5H8		ENST00000522353.2:c.2024C>A	5.37:g.140182806C>A	ENSP00000429808:p.Ala675Glu	Somatic	101	2		WXS	Illumina GAIIx	Phase_I	254	85	NM_031497	0	0	0	0	0	O75286	Missense_Mutation	SNP	ENST00000522353.2	37	CCDS54915.1	.	.	.	.	.	.	.	.	.	.	c	10.04	1.241072	0.22711	.	.	ENSG00000255408	ENST00000522353;ENST00000532566	T;T	0.51325	0.79;0.71	4.32	2.31	0.28768	Cadherin (2);	0.942550	0.08572	U	0.925869	T	0.29389	0.0732	N	0.21282	0.65	0.09310	N	1	B;B	0.20261	0.043;0.006	B;B	0.26416	0.069;0.021	T	0.33523	-0.9865	10	0.08837	T	0.75	.	4.7341	0.12979	0.2852:0.538:0.0:0.1768	.	675;675	Q9Y5H8-2;Q9Y5H8	.;PCDA3_HUMAN	E	675	ENSP00000429808:A675E;ENSP00000434086:A675E	ENSP00000429808:A675E	A	+	2	0	PCDHA3	140162990	0.998000	0.40836	0.021000	0.16686	0.166000	0.22503	0.000000	0.12993	0.902000	0.36520	0.467000	0.42956	GCA	.		0.672	PCDHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372848.2	NM_018906	
PWWP2A	114825	hgsc.bcm.edu	37	5	159546013	159546013	+	Missense_Mutation	SNP	T	T	C	rs56806495	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr5:159546013T>C	ENST00000307063.7	-	1	417	c.383A>G	c.(382-384)gAg>gGg	p.E128G	PWWP2A_ENST00000456329.3_Missense_Mutation_p.E128G|PWWP2A_ENST00000523662.1_Missense_Mutation_p.E128G	NM_001130864.1	NP_001124336.1	Q96N64	PWP2A_HUMAN	PWWP domain containing 2A	128	Pro-rich.									kidney(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	5	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CTCGCGCTCCTCGGGAGCCGG	0.761													T|||	290	0.0579073	0.0212	0.0403	5008	,	,		9537	0.1101		0.0398	False		,,,				2504	0.0849				p.E128G		.											.	PWWP2A-68	0			c.A383G						.	T	GLY/GLU,GLY/GLU	73,3487		1,71,1708	9.0	12.0	11.0		383,383	3.9	1.0	5	dbSNP_129	11	251,7547		4,243,3652	no	missense,missense	PWWP2A	NM_001130864.1,NM_052927.2	98,98	5,314,5360	CC,CT,TT		3.2188,2.0506,2.8526	benign,benign	128/756,128/561	159546013	324,11034	1780	3899	5679	SO:0001583	missense	114825	exon1			CGCTCCTCGGGAG		CCDS47331.1, CCDS47332.1, CCDS58990.1	5q33.3	2011-03-23			ENSG00000170234	ENSG00000170234			29406	protein-coding gene	gene with protein product							Standard	NM_052927		Approved	KIAA1935	uc011ded.2	Q96N64	OTTHUMG00000163546	ENST00000307063.7:c.383A>G	5.37:g.159546013T>C	ENSP00000305151:p.Glu128Gly	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	5	NM_052927	0	0	0	1	1	G5EA07|Q2HJJ2|Q8IYR3|Q96PV3	Missense_Mutation	SNP	ENST00000307063.7	37	CCDS47332.1	130	0.05952380952380952	13	0.026422764227642278	16	0.04419889502762431	66	0.11538461538461539	35	0.04617414248021108	t	12.29	1.894481	0.33442	0.020506	0.032188	ENSG00000170234	ENST00000456329;ENST00000523662;ENST00000307063	T;T;T	0.58797	1.27;1.28;0.31	3.91	3.91	0.45181	.	0.844365	0.10167	N	0.707655	T	0.00875	0.0029	L	0.40543	1.245	0.31235	N	0.695827	B;B;B	0.15930	0.001;0.006;0.015	B;B;B	0.11329	0.002;0.006;0.006	T	0.04216	-1.0968	10	0.33141	T	0.24	-6.1269	10.374	0.44071	0.0:0.0:0.0:1.0	rs56806495	128;128;128	Q96N64;G5EA07;Q96N64-2	PWP2A_HUMAN;.;.	G	128	ENSP00000390462:E128G;ENSP00000428143:E128G;ENSP00000305151:E128G	ENSP00000305151:E128G	E	-	2	0	PWWP2A	159478591	1.000000	0.71417	0.966000	0.40874	0.384000	0.30261	3.710000	0.54860	1.628000	0.50416	0.454000	0.30748	GAG	T|0.943;C|0.057		0.761	PWWP2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374092.1		
ECI2	10455	broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	4116248	4116248	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr6:4116248T>C	ENST00000380118.3	-	10	1081	c.1045A>G	c.(1045-1047)Aaa>Gaa	p.K349E	C6orf201_ENST00000430835.2_Intron|ECI2_ENST00000465828.1_Missense_Mutation_p.K319E|ECI2_ENST00000361538.2_Missense_Mutation_p.K319E|ECI2_ENST00000380125.2_Missense_Mutation_p.K319E|C6orf201_ENST00000333388.5_Intron|ECI2_ENST00000413766.2_Missense_Mutation_p.K182E|C6orf201_ENST00000380175.4_Intron			O75521	ECI2_HUMAN	enoyl-CoA delta isomerase 2	349					fatty acid catabolic process (GO:0009062)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	dodecenoyl-CoA delta-isomerase activity (GO:0004165)|fatty-acyl-CoA binding (GO:0000062)|receptor binding (GO:0005102)			endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	11						ATTACCTCTTTTGAAATTCTC	0.433																																					p.K349E		.											.	ECI2-90	0			c.A1045G						.						89.0	81.0	84.0					6																	4116248		2203	4300	6503	SO:0001583	missense	10455	exon10			CCTCTTTTGAAAT	AF069301	CCDS4490.1, CCDS43420.1, CCDS43420.2	6p24.3	2011-03-15	2011-03-15	2011-03-15	ENSG00000198721	ENSG00000198721			14601	protein-coding gene	gene with protein product	"""acyl-Coenzyme A binding domain containing 2"", "" Hepatocellular carcinoma-associated antigen 88"""	608024	"""peroxisomal D3,D2-enoyl-CoA isomerase"""	PECI		10419495	Standard	NM_206836		Approved	ACBD2, DRS1, HCA88	uc003mwf.3	O75521	OTTHUMG00000014158	ENST00000380118.3:c.1045A>G	6.37:g.4116248T>C	ENSP00000369461:p.Lys349Glu	Somatic	152	2		WXS	Illumina GAIIx	Phase_I	171	49	NM_206836	0	0	418	552	134	Q5JYK5|Q5JYK7|Q7L124|Q8N0X0|Q9BUE9|Q9H0T9|Q9NQH1|Q9NYH7|Q9UN55	Missense_Mutation	SNP	ENST00000380118.3	37	CCDS43420.2	.	.	.	.	.	.	.	.	.	.	T	33	5.267878	0.95399	.	.	ENSG00000198721	ENST00000380118;ENST00000380125;ENST00000413766;ENST00000361538;ENST00000465828	T;T;T;T;T	0.59638	0.25;0.25;0.25;0.25;0.25	5.44	5.44	0.79542	.	0.087225	0.85682	D	0.000000	T	0.81059	0.4744	H	0.97051	3.93	0.58432	D	0.999995	D	0.89917	1.0	D	0.91635	0.999	D	0.87662	0.2535	10	0.87932	D	0	.	14.3289	0.66541	0.0:0.0:0.0:1.0	.	349	O75521	ECI2_HUMAN	E	349;319;182;319;319	ENSP00000369461:K349E;ENSP00000369468:K319E;ENSP00000406969:K182E;ENSP00000354737:K319E;ENSP00000420309:K319E	ENSP00000354737:K319E	K	-	1	0	ECI2	4061247	1.000000	0.71417	0.012000	0.15200	0.709000	0.40893	6.821000	0.75272	2.052000	0.61016	0.533000	0.62120	AAA	.		0.433	ECI2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039716.4	NM_006117	
PPP1R3G	648791	hgsc.bcm.edu	37	6	5086070	5086070	+	Silent	SNP	A	A	G	rs667752		TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr6:5086070A>G	ENST00000405617.2	+	1	351	c.351A>G	c.(349-351)gcA>gcG	p.A117A		NM_001145115.1	NP_001138587.1	B7ZBB8	PP13G_HUMAN	protein phosphatase 1, regulatory subunit 3G	117					glucose homeostasis (GO:0042593)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of glycogen biosynthetic process (GO:0045725)	cytoplasm (GO:0005737)	glycogen binding (GO:2001069)			kidney(2)	2						CGGAGGACGCACAGCTCGGCC	0.692													G|||	5008	1.0	1.0	1.0	5008	,	,		12505	1.0		1.0	False		,,,				2504	1.0				p.A117A		.											.	PPP1R3G-136	0			c.A351G						.						1.0	2.0	2.0					6																	5086070		400	1062	1462	SO:0001819	synonymous_variant	648791	exon1			GGACGCACAGCTC		CCDS47366.1	6p25.1	2012-04-17	2011-10-04		ENSG00000219607	ENSG00000219607		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14945	protein-coding gene	gene with protein product			"""protein phosphatase 1, regulatory (inhibitor) subunit 3G"""			11948623	Standard	NM_001145115		Approved		uc011dia.1	B7ZBB8	OTTHUMG00000014172	ENST00000405617.2:c.351A>G	6.37:g.5086070A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	21	21	NM_001145115	0	0	0	8	8		Silent	SNP	ENST00000405617.2	37	CCDS47366.1																																																																																			A|0.006;G|0.994		0.692	PPP1R3G-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039740.3	NM_001145115	
PPP1R3G	648791	hgsc.bcm.edu	37	6	5086211	5086211	+	Silent	SNP	G	G	C	rs584962		TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr6:5086211G>C	ENST00000405617.2	+	1	492	c.492G>C	c.(490-492)ctG>ctC	p.L164L		NM_001145115.1	NP_001138587.1	B7ZBB8	PP13G_HUMAN	protein phosphatase 1, regulatory subunit 3G	164					glucose homeostasis (GO:0042593)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of glycogen biosynthetic process (GO:0045725)	cytoplasm (GO:0005737)	glycogen binding (GO:2001069)			kidney(2)	2						TCTCGCGCCTGCGAAGCTTCC	0.736													C|||	5008	1.0	1.0	1.0	5008	,	,		12118	1.0		1.0	False		,,,				2504	1.0				p.L164L		.											.	PPP1R3G-136	0			c.G492C						.						1.0	2.0	1.0					6																	5086211		271	872	1143	SO:0001819	synonymous_variant	648791	exon1			GCGCCTGCGAAGC		CCDS47366.1	6p25.1	2012-04-17	2011-10-04		ENSG00000219607	ENSG00000219607		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14945	protein-coding gene	gene with protein product			"""protein phosphatase 1, regulatory (inhibitor) subunit 3G"""			11948623	Standard	NM_001145115		Approved		uc011dia.1	B7ZBB8	OTTHUMG00000014172	ENST00000405617.2:c.492G>C	6.37:g.5086211G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_001145115	0	0	0	8	8		Silent	SNP	ENST00000405617.2	37	CCDS47366.1																																																																																			G|0.000;C|1.000		0.736	PPP1R3G-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039740.3	NM_001145115	
RNF144B	255488	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	18459916	18459916	+	Silent	SNP	C	C	A	rs139497819		TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr6:18459916C>A	ENST00000259939.3	+	6	932	c.615C>A	c.(613-615)ggC>ggA	p.G205G	RNF144B_ENST00000429054.2_Silent_p.G116G	NM_182757.3	NP_877434.2	Q7Z419	R144B_HUMAN	ring finger protein 144B	205					apoptotic process (GO:0006915)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|mitochondrial membrane (GO:0031966)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(1)|lung(7)	11	Ovarian(93;0.00365)|Breast(50;0.0145)	all_hematologic(90;0.0536)	OV - Ovarian serous cystadenocarcinoma(7;0.00165)|all cancers(50;0.0102)|Epithelial(50;0.0105)			GCAATGAAGGCTGCGCTCAGA	0.463																																					p.G205G		.											.	RNF144B-226	0			c.C615A						.	C		0,4406		0,0,2203	141.0	128.0	132.0		615	5.1	1.0	6	dbSNP_134	132	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	RNF144B	NM_182757.3		0,2,6501	AA,AC,CC		0.0233,0.0,0.0154		205/304	18459916	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	255488	exon6			TGAAGGCTGCGCT	AK096832	CCDS34345.1	6p22.3	2011-05-23	2009-01-05	2007-08-20	ENSG00000137393	ENSG00000137393		"""RING-type (C3HC4) zinc fingers"""	21578	protein-coding gene	gene with protein product			"""IBR domain containing 2"""	IBRDC2			Standard	NM_182757		Approved	bA528A10.3	uc003ncs.3	Q7Z419	OTTHUMG00000014322	ENST00000259939.3:c.615C>A	6.37:g.18459916C>A		Somatic	143	0		WXS	Illumina GAIIx	Phase_I	188	44	NM_182757	0	0	0	0	0	B3KUA8|B4DZI2|Q5TB85|Q6P4Q0|Q8N3R7|Q9BX38	Silent	SNP	ENST00000259939.3	37	CCDS34345.1																																																																																			C|1.000;A|0.000		0.463	RNF144B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039965.2	XM_172581	
LY6G5C	80741	broad.mit.edu	37	6	31646904	31646904	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr6:31646904C>A	ENST00000383237.4	-	2	266	c.263G>T	c.(262-264)aGc>aTc	p.S88I	LY6G5C_ENST00000375858.3_Missense_Mutation_p.S85I|LY6G5C_ENST00000375860.2_Missense_Mutation_p.S86I|LY6G5C_ENST00000474395.1_5'UTR			Q5SRR4	LY65C_HUMAN	lymphocyte antigen 6 complex, locus G5C	88	UPAR/Ly6.					extracellular region (GO:0005576)				endometrium(1)|large_intestine(1)|lung(3)|prostate(1)|skin(1)	7						AGTGATGCAGCTGCTGCCAGC	0.562																																					p.S88I		.											.	LY6G5C-90	0			c.G263T						.						238.0	227.0	231.0					6																	31646904		1511	2709	4220	SO:0001583	missense	80741	exon2			ATGCAGCTGCTGC		CCDS34401.1, CCDS34401.2	6p21	2010-02-17	2002-07-29	2002-08-01	ENSG00000204428	ENSG00000204428			13932	protein-coding gene	gene with protein product		610434	"""chromosome 6 open reading frame 20"""	C6orf20		12079290	Standard	NM_025262		Approved	G5c, NG33	uc003nvu.2	Q5SRR4	OTTHUMG00000031228	ENST00000383237.4:c.263G>T	6.37:g.31646904C>A	ENSP00000372724:p.Ser88Ile	Somatic	182	1		WXS	Illumina GAIIx	Phase_I	256	7	NM_025262	0	0	0	0	0	A6NCW4|B0UXB3|B0UXB4|B0UZ69|B0UZQ0|B1B0L9|O95871|Q5SQ59|Q8NDY0|Q8NDY1	Missense_Mutation	SNP	ENST00000383237.4	37	CCDS34401.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.1|22.1	4.245897|4.245897	0.80024|0.80024	.|.	.|.	ENSG00000204428|ENSG00000204428	ENST00000375863|ENST00000375860;ENST00000375858;ENST00000383237	.|D;D;D	.|0.86230	.|-2.09;-2.09;-2.09	3.46|3.46	1.53|1.53	0.23141|0.23141	.|.	.|0.662297	.|0.12543	.|N	.|0.459711	T|T	0.76955|0.76955	0.4060|0.4060	L|L	0.32530|0.32530	0.975|0.975	0.28615|0.28615	N|N	0.908478|0.908478	.|D	.|0.54047	.|0.964	.|P	.|0.51833	.|0.681	T|T	0.67681|0.67681	-0.5608|-0.5608	5|10	.|0.54805	.|T	.|0.06	-7.2786|-7.2786	9.5578|9.5578	0.39351|0.39351	0.0:0.5831:0.4169:0.0|0.0:0.5831:0.4169:0.0	.|.	.|88	.|Q5SRR4	.|LY65C_HUMAN	S|I	163|86;85;88	.|ENSP00000365020:S86I;ENSP00000365018:S85I;ENSP00000372724:S88I	.|ENSP00000365018:S85I	A|S	-|-	1|2	0|0	LY6G5C|LY6G5C	31754883|31754883	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.887000|0.887000	0.51463|0.51463	0.906000|0.906000	0.28517|0.28517	0.229000|0.229000	0.21039|0.21039	0.462000|0.462000	0.41574|0.41574	GCT|AGC	.		0.562	LY6G5C-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076473.4		
NELFE	7936	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	31922199	31922199	+	Missense_Mutation	SNP	G	G	A	rs542263058		TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr6:31922199G>A	ENST00000375429.3	-	8	989	c.763C>T	c.(763-765)Cgg>Tgg	p.R255W	NELFE_ENST00000375425.5_Missense_Mutation_p.R262W|NELFE_ENST00000444811.2_Missense_Mutation_p.R225W|MIR1236_ENST00000408340.1_RNA	NM_002904.5	NP_002895.3	P18615	NELFE_HUMAN	negative elongation factor complex member E	255					gene expression (GO:0010467)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	NELF complex (GO:0032021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)										GGGGCTCGCCGTTCAGGGAAT	0.468													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20535	0.0		0.0	False		,,,				2504	0.0				p.R255W		.											.	.	0			c.C763T						.						93.0	86.0	88.0					6																	31922199		2203	4300	6503	SO:0001583	missense	7936	exon8			CTCGCCGTTCAGG	M33230	CCDS4730.1	6p21.3	2013-02-12	2013-01-31	2013-01-31	ENSG00000204356	ENSG00000204356		"""RNA binding motif (RRM) containing"""	13974	protein-coding gene	gene with protein product		154040	"""RD RNA-binding protein"", ""RD RNA binding protein"""	RDBP			Standard	XM_006715205		Approved	RD, D6S45, NELF-E, RDP	uc003nyk.3	P18615	OTTHUMG00000031046	ENST00000375429.3:c.763C>T	6.37:g.31922199G>A	ENSP00000364578:p.Arg255Trp	Somatic	107	0		WXS	Illumina GAIIx	Phase_I	131	27	NM_002904	0	0	93	121	28	A2BE08|B4DUN1|B4DYX9|Q5JP74|Q5JP75|Q96F56|Q9NPK2	Missense_Mutation	SNP	ENST00000375429.3	37	CCDS4730.1	.	.	.	.	.	.	.	.	.	.	G	19.35	3.811057	0.70797	.	.	ENSG00000204356	ENST00000375429;ENST00000375425;ENST00000444811;ENST00000441998;ENST00000454913;ENST00000436289	T;T;T;T;T	0.45276	0.9;0.9;0.9;0.9;0.9	5.42	4.36	0.52297	Nucleotide-binding, alpha-beta plait (1);	0.112301	0.64402	D	0.000012	T	0.38161	0.1030	L	0.38175	1.15	0.45194	D	0.998201	D;D;D	0.76494	0.999;0.999;0.999	P;P;P	0.56474	0.799;0.799;0.799	T	0.27806	-1.0063	10	0.66056	D	0.02	-11.4519	13.973	0.64252	0.0885:0.0:0.9115:0.0	.	225;250;255	B4DUN1;E9PCL7;P18615	.;.;NELFE_HUMAN	W	255;262;225;250;255;250	ENSP00000364578:R255W;ENSP00000364574:R262W;ENSP00000388400:R225W;ENSP00000397914:R250W;ENSP00000409389:R255W	ENSP00000364574:R262W	R	-	1	2	RDBP	32030178	1.000000	0.71417	1.000000	0.80357	0.824000	0.46624	4.032000	0.57274	2.549000	0.85964	0.655000	0.94253	CGG	.		0.468	NELFE-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076047.4		
PKHD1	5314	broad.mit.edu	37	6	51720866	51720866	+	Missense_Mutation	SNP	G	G	T	rs78361537	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr6:51720866G>T	ENST00000371117.3	-	49	8011	c.7736C>A	c.(7735-7737)gCg>gAg	p.A2579E	PKHD1_ENST00000340994.4_Missense_Mutation_p.A2579E	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	2579					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					AGGAGTATTCGCTCTAAGGTG	0.353																																					p.A2579E		.											.	PKHD1-603	0			c.C7736A						.						95.0	103.0	100.0					6																	51720866		2203	4300	6503	SO:0001583	missense	5314	exon49			GTATTCGCTCTAA	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.7736C>A	6.37:g.51720866G>T	ENSP00000360158:p.Ala2579Glu	Somatic	54	0		WXS	Illumina GAIIx	Phase_I	90	3	NM_170724	0	0	0	0	0	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	ENST00000371117.3	37	CCDS4935.1	.	.	.	.	.	.	.	.	.	.	G	8.603	0.887351	0.17540	.	.	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	D;D	0.87412	-2.05;-2.25	6.17	-2.69	0.06022	.	1.088580	0.06877	N	0.801770	T	0.68054	0.2959	L	0.56769	1.78	0.09310	N	1	B;B;B	0.31790	0.19;0.34;0.19	B;B;B	0.31869	0.07;0.137;0.048	T	0.59994	-0.7349	10	0.52906	T	0.07	.	1.8017	0.03073	0.4238:0.0922:0.2933:0.1907	.	2579;2579;2579	A8MVM9;P08F94-2;P08F94	.;.;PKHD1_HUMAN	E	2579	ENSP00000360158:A2579E;ENSP00000341097:A2579E	ENSP00000341097:A2579E	A	-	2	0	PKHD1	51828825	0.000000	0.05858	0.002000	0.10522	0.059000	0.15707	-0.031000	0.12287	-0.235000	0.09767	0.655000	0.94253	GCG	G|0.999;A|0.001		0.353	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	
KHDC1L	100129128	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	73935030	73935032	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	CTC	CTC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr6:73935030_73935032delCTC	ENST00000370388.3	-	1	143_145	c.100_102delGAG	c.(100-102)gagdel	p.E34del	KHDC1L_ENST00000471312.1_5'UTR|RP11-257K9.8_ENST00000423730.3_In_Frame_Del_p.R136del	NM_001126063.2	NP_001119535.1	Q5JSQ8	KHDCL_HUMAN	KH homology domain containing 1-like	34										breast(1)|endometrium(1)|kidney(1)|lung(3)|skin(1)	7						CGAAGATGAGCTCCTCCTGGTCC	0.512																																					p.34_34del		.											.	KHDC1L-1	0			c.100_102del						.																																			SO:0001651	inframe_deletion	100129128	exon1			GATGAGCTCCTCC	BC004267	CCDS47450.1	6q13	2014-05-15			ENSG00000256980	ENSG00000256980			37274	protein-coding gene	gene with protein product							Standard	NM_001126063		Approved	RP11-257K9.7	uc003pgm.4	Q5JSQ8	OTTHUMG00000132474	ENST00000370388.3:c.100_102delGAG	6.37:g.73935033_73935035delCTC	ENSP00000359415:p.Glu34del	Somatic	110	0		WXS	Illumina GAIIx	Phase_I	120	35	NM_001126063	0	0	0	0	0	E1P535	In_Frame_Del	DEL	ENST00000370388.3	37	CCDS47450.1																																																																																			.		0.512	KHDC1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255640.1	NM_001126063	
CEP162	22832	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	84896081	84896083	+	In_Frame_Del	DEL	GAA	GAA	-			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	GAA	GAA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr6:84896081_84896083delGAA	ENST00000403245.3	-	12	1482_1484	c.1368_1370delTTC	c.(1366-1371)tcttca>tca	p.456_457SS>S	KIAA1009_ENST00000461137.1_5'UTR|KIAA1009_ENST00000257766.4_In_Frame_Del_p.380_381SS>S	NM_014895.2	NP_055710.2														breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(17)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	43		all_cancers(76;1.5e-06)|Acute lymphoblastic leukemia(125;2.69e-07)|all_hematologic(105;0.000151)|all_epithelial(107;0.00258)		BRCA - Breast invasive adenocarcinoma(397;0.089)		AGATAATGATGAAGAATTAACAG	0.286																																					p.456_457del		.											.	KIAA1009-91	0			c.1368_1370del						.																																			SO:0001651	inframe_deletion	22832	exon12			AATGATGAAGAAT																												ENST00000403245.3:c.1368_1370delTTC	6.37:g.84896084_84896086delGAA	ENSP00000385215:p.Ser458del	Somatic	84	0		WXS	Illumina GAIIx	Phase_I	88	16	NM_014895	0	0	0	0	0		In_Frame_Del	DEL	ENST00000403245.3	37	CCDS34494.2																																																																																			.		0.286	KIAA1009-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317315.1		
TMEM200A	114801	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	130762220	130762220	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr6:130762220G>C	ENST00000296978.3	+	3	1524	c.653G>C	c.(652-654)aGc>aCc	p.S218T	TMEM200A_ENST00000392429.1_Missense_Mutation_p.S218T|TMEM200A_ENST00000545622.1_Missense_Mutation_p.S218T	NM_001258276.1|NM_001258277.1|NM_001258278.1	NP_001245205.1|NP_001245206.1|NP_001245207.1	Q86VY9	T200A_HUMAN	transmembrane protein 200A	218						integral component of membrane (GO:0016021)				NS(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(30)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52				GBM - Glioblastoma multiforme(226;0.0139)|OV - Ovarian serous cystadenocarcinoma(155;0.12)		GGTTTTCGGAGCAGTTTTCGA	0.478																																					p.S218T		.											.	TMEM200A-23	0			c.G653C						.						59.0	57.0	58.0					6																	130762220		2203	4300	6503	SO:0001583	missense	114801	exon3			TTCGGAGCAGTTT	AB067500	CCDS5140.1	6q23.1	2009-09-04	2007-12-18	2007-12-18	ENSG00000164484	ENSG00000164484			21075	protein-coding gene	gene with protein product			"""KIAA1913"""	KIAA1913		15722956	Standard	NM_001258276		Approved	TTMC	uc010kfh.4	Q86VY9	OTTHUMG00000015557	ENST00000296978.3:c.653G>C	6.37:g.130762220G>C	ENSP00000296978:p.Ser218Thr	Somatic	160	0		WXS	Illumina GAIIx	Phase_I	145	55	NM_001258277	0	0	4	8	4	Q96PX5	Missense_Mutation	SNP	ENST00000296978.3	37	CCDS5140.1	.	.	.	.	.	.	.	.	.	.	G	8.777	0.927223	0.18056	.	.	ENSG00000164484	ENST00000296978;ENST00000545622;ENST00000392429	.	.	.	5.61	1.82	0.25136	.	0.399254	0.30277	N	0.010000	T	0.11239	0.0274	L	0.40543	1.245	0.25447	N	0.988042	B	0.17038	0.02	B	0.14023	0.01	T	0.37220	-0.9715	9	0.13470	T	0.59	-9.9357	8.8135	0.34983	0.3616:0.0:0.6384:0.0	.	218	Q86VY9	T200A_HUMAN	T	218	.	ENSP00000296978:S218T	S	+	2	0	TMEM200A	130803913	1.000000	0.71417	0.959000	0.39883	0.409000	0.31022	3.080000	0.50112	0.043000	0.15746	-0.216000	0.12614	AGC	.		0.478	TMEM200A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042201.1	NM_052913	
TAAR9	134860	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	132860125	132860125	+	RNA	SNP	A	A	T			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr6:132860125A>T	ENST00000434551.1	+	0	697					NM_175057.3	NP_778227.3	Q96RI9	TAAR9_HUMAN	trace amine associated receptor 9 (gene/pseudogene)						G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|trace-amine receptor activity (GO:0001594)					Breast(56;0.112)			OV - Ovarian serous cystadenocarcinoma(155;0.0042)|GBM - Glioblastoma multiforme(226;0.00816)		GAAGATAGAAAGTACAGCCAG	0.428																																					.	Colon(10;433 445 15992 45047 47213)	.											.	.	0			.						.						82.0	81.0	81.0					6																	132860125		1904	4115	6019			134860	.			ATAGAAAGTACAG	AF380189	CCDS75520.1	6q23.2	2013-10-02	2010-03-12	2005-02-24	ENSG00000237110	ENSG00000237110		"""GPCR / Class A : Trace amine associated receptors"""	20977	protein-coding gene	gene with protein product		608282	"""trace amine receptor 3"", ""trace amine associated receptor 9"""	TRAR3		15718104	Standard	NM_175057		Approved	TA3, TAR3	uc011eci.2	Q96RI9	OTTHUMG00000015578		6.37:g.132860125A>T		Somatic	60	0		WXS	Illumina GAIIx	Phase_I	52	15	.	0	0	0	0	0		RNA	SNP	ENST00000434551.1	37																																																																																				.		0.428	TAAR9-001	KNOWN	mRNA_end_NF|cds_end_NF|basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000042254.2	NM_175057	
SERAC1	84947	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	158569912	158569912	+	Missense_Mutation	SNP	G	G	A	rs372754952		TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr6:158569912G>A	ENST00000367104.3	-	5	471	c.340C>T	c.(340-342)Cgg>Tgg	p.R114W	SERAC1_ENST00000367101.1_Missense_Mutation_p.R114W|SERAC1_ENST00000367102.2_Missense_Mutation_p.R114W|SERAC1_ENST00000607000.1_Missense_Mutation_p.R114W	NM_032861.3	NP_116250.3	Q96JX3	SRAC1_HUMAN	serine active site containing 1	114					extracellular matrix organization (GO:0030198)|GPI anchor metabolic process (GO:0006505)|intracellular protein transport (GO:0006886)|phospholipid biosynthetic process (GO:0008654)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)			endometrium(1)|kidney(2)|large_intestine(6)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	15		Breast(66;0.00519)|Ovarian(120;0.123)|Prostate(117;0.178)		OV - Ovarian serous cystadenocarcinoma(65;1.37e-18)|BRCA - Breast invasive adenocarcinoma(81;3.19e-05)		AATGGATTCCGCAGTATCTTG	0.338																																					p.R114W		.											.	SERAC1-90	0			c.C340T						.	G	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	160.0	127.0	138.0		340	4.7	0.0	6		138	0,8600		0,0,4300	no	missense	SERAC1	NM_032861.3	101	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	114/655	158569912	1,13005	2203	4300	6503	SO:0001583	missense	84947	exon5			GATTCCGCAGTAT	BC001705	CCDS5255.1	6q25.3	2003-05-12			ENSG00000122335	ENSG00000122335			21061	protein-coding gene	gene with protein product		614725					Standard	NM_032861		Approved	FLJ14917	uc003qrc.2	Q96JX3	OTTHUMG00000015905	ENST00000367104.3:c.340C>T	6.37:g.158569912G>A	ENSP00000356071:p.Arg114Trp	Somatic	62	0		WXS	Illumina GAIIx	Phase_I	116	28	NM_032861	0	0	8	8	0	Q49AT1|Q5VTX3|Q6PKF3	Missense_Mutation	SNP	ENST00000367104.3	37	CCDS5255.1	.	.	.	.	.	.	.	.	.	.	G	14.14	2.446509	0.43429	2.27E-4	0.0	ENSG00000122335	ENST00000367102;ENST00000367104;ENST00000367101	T;T;T	0.68331	-0.32;-0.32;-0.32	5.61	4.74	0.60224	.	0.420066	0.27219	N	0.020379	T	0.47322	0.1439	M	0.68317	2.08	0.26991	N	0.965131	D	0.63046	0.992	P	0.46208	0.507	T	0.58825	-0.7568	10	0.40728	T	0.16	-3.3088	8.6062	0.33775	0.0782:0.0:0.771:0.1508	.	114	Q96JX3	SRAC1_HUMAN	W	114	ENSP00000356069:R114W;ENSP00000356071:R114W;ENSP00000356068:R114W	ENSP00000356068:R114W	R	-	1	2	SERAC1	158489900	0.858000	0.29795	0.004000	0.12327	0.321000	0.28281	3.987000	0.56944	-1.686000	0.01439	-0.385000	0.06624	CGG	.		0.338	SERAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042862.1	NM_032861	
TCP10	6953	broad.mit.edu;bcgsc.ca	37	6	167787940	167787940	+	Splice_Site	SNP	C	C	A			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr6:167787940C>A	ENST00000397829.4	-	7	856		c.e7-1		TCP10_ENST00000366827.2_Splice_Site	NM_004610.3	NP_004601.3	Q12799	TCP10_HUMAN	t-complex 10							cytosol (GO:0005829)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(2)|lung(6)	18		Breast(66;1.53e-05)|Ovarian(120;0.024)		OV - Ovarian serous cystadenocarcinoma(33;4.05e-20)|BRCA - Breast invasive adenocarcinoma(81;1.1e-06)|GBM - Glioblastoma multiforme(31;0.0386)		GAGCTTCTGTCTAAAAAGCAA	0.443																																					.		.											.	TCP10-89	0			c.689-1G>T						.						35.0	39.0	38.0					6																	167787940		1828	4083	5911	SO:0001630	splice_region_variant	6953	exon8			TTCTGTCTAAAAA	U03399	CCDS43527.1	6q27	2012-09-20	2012-09-20		ENSG00000203690	ENSG00000203690			11656	protein-coding gene	gene with protein product		187020	"""t-complex 10 (a murine tcp homolog)"", ""t-complex 10 (mouse)"", ""t-complex 10 homolog (mouse)"""			8111376	Standard	NM_004610		Approved		uc003qvv.1	Q12799	OTTHUMG00000016026	ENST00000397829.4:c.689-1G>T	6.37:g.167787940C>A		Somatic	841	1		WXS	Illumina GAIIx	Phase_I	1345	54	NM_004610	0	0	0	0	0	Q5JR60|Q6P4F4	Splice_Site	SNP	ENST00000397829.4	37	CCDS43527.1	.	.	.	.	.	.	.	.	.	.	c	4.284	0.051870	0.08291	.	.	ENSG00000203690	ENST00000366827;ENST00000397829	.	.	.	1.38	1.38	0.22167	.	.	.	.	.	.	.	.	.	.	.	0.18873	N	0.999989	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.1701	0.20412	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TCP10	167707930	0.045000	0.20229	0.003000	0.11579	0.063000	0.16089	1.791000	0.38744	1.062000	0.40625	0.313000	0.20887	.	.		0.443	TCP10-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000365570.1	NM_004610	Intron
SUN1	23353	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	900013	900014	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	AG	AG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr7:900013_900014delAG	ENST00000405266.1	+	15	1908_1909	c.1884_1885delAG	c.(1882-1887)acagagfs	p.E629fs	SUN1_ENST00000389574.3_Frame_Shift_Del_p.E509fs|SUN1_ENST00000425407.2_Frame_Shift_Del_p.E509fs|SUN1_ENST00000452783.2_Frame_Shift_Del_p.E489fs|SUN1_ENST00000456758.2_Frame_Shift_Del_p.E781fs|SUN1_ENST00000401592.1_Frame_Shift_Del_p.E592fs|SUN1_ENST00000413514.2_Frame_Shift_Del_p.E390fs			O94901	SUN1_HUMAN	Sad1 and UNC84 domain containing 1	619					cytoskeletal anchoring at nuclear membrane (GO:0090286)|nuclear envelope organization (GO:0006998)|nuclear matrix anchoring at nuclear membrane (GO:0090292)	acrosomal membrane (GO:0002080)|integral component of nuclear inner membrane (GO:0005639)|nuclear envelope (GO:0005635)|SUN-KASH complex (GO:0034993)				NS(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(17)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						CTGGAATAACAGAGGCGGTGAG	0.574																																					p.591_592del		.											.	SUN1-90	0			c.1773_1774del						.																																			SO:0001589	frameshift_variant	23353	exon14			AATAACAGAGGCG	AF202724	CCDS43533.1, CCDS47525.1, CCDS55078.1, CCDS55079.1, CCDS55080.1	7p22.3	2010-01-27	2010-01-27	2010-01-27	ENSG00000164828	ENSG00000164828			18587	protein-coding gene	gene with protein product	"""Sad1 unc-84 domain protein 1"""	607723	"""unc-84 homolog A (C. elegans)"""	UNC84A		11593002	Standard	NM_001130965		Approved	KIAA0810, FLJ12407	uc021zym.1	O94901	OTTHUMG00000151426	ENST00000405266.1:c.1884_1885delAG	7.37:g.900015_900016delAG	ENSP00000384116:p.Glu629fs	Somatic	142	0		WXS	Illumina GAIIx	Phase_I	122	38	NM_001130965	0	0	0	0	0	A5PL20|B3KMV7|B4DZF7|B7WNY4|B7WP53|E9PDU4|E9PF23|F8WD13|Q96CZ7|Q9HA14|Q9UH98	Frame_Shift_Del	DEL	ENST00000405266.1	37																																																																																				.		0.574	SUN1-001	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000322566.1	NM_025154	
MICALL2	79778	hgsc.bcm.edu	37	7	1484572	1484572	+	Silent	SNP	A	A	G	rs10435184	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr7:1484572A>G	ENST00000297508.7	-	6	1309	c.1134T>C	c.(1132-1134)ggT>ggC	p.G378G	MICALL2_ENST00000405088.4_Silent_p.G166G	NM_182924.3	NP_891554.1	Q8IY33	MILK2_HUMAN	MICAL-like 2	378	Mediates targeting to the cell plasma membrane. {ECO:0000250}.|Necessary and sufficient for interaction with actinins. {ECO:0000250}.				actin cytoskeleton reorganization (GO:0031532)|actin filament polymerization (GO:0030041)|endocytic recycling (GO:0032456)|neuron projection development (GO:0031175)|substrate adhesion-dependent cell spreading (GO:0034446)|tight junction assembly (GO:0070830)	cell-cell junction (GO:0005911)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)|stress fiber (GO:0001725)|tight junction (GO:0005923)	actin filament binding (GO:0051015)|filamin binding (GO:0031005)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|lung(8)|ovary(2)|skin(2)	19		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;6.01e-15)		GGGCTCCCCCACCCTGGGGTG	0.716													G|||	4980	0.994409	0.9985	0.9914	5008	,	,		11496	1.0		0.9801	False		,,,				2504	1.0				p.G378G		.											.	MICALL2-90	0			c.T1134C						.			3824,4		1910,4,0	4.0	4.0	4.0		1134	1.5	0.0	7	dbSNP_119	4	7610,92		3759,92,0	yes	coding-synonymous	MICALL2	NM_182924.3		5669,96,0	GG,GA,AA		1.1945,0.1045,0.8326		378/905	1484572	11434,96	1914	3851	5765	SO:0001819	synonymous_variant	79778	exon6			TCCCCCACCCTGG	BC037988	CCDS5324.1	7p22.3	2006-11-24			ENSG00000164877	ENSG00000164877			29672	protein-coding gene	gene with protein product	"""junctional Rab13-binding protein"""					12110185, 16525024	Standard	NM_182924		Approved	MGC46023, FLJ23471, MICAL-L2, JRAB	uc003skj.4	Q8IY33	OTTHUMG00000119021	ENST00000297508.7:c.1134T>C	7.37:g.1484572A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_182924	0	0	0	8	8	D3YTD2|Q7RTP4|Q7Z655|Q8TEQ4|Q9H5F9	Silent	SNP	ENST00000297508.7	37	CCDS5324.1																																																																																			A|0.009;G|0.991		0.716	MICALL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239223.2	NM_182924	
RBAK	57786	broad.mit.edu	37	7	5104585	5104585	+	Missense_Mutation	SNP	G	G	A	rs149739845	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr7:5104585G>A	ENST00000353796.3	+	6	1822	c.1498G>A	c.(1498-1500)Gac>Aac	p.D500N	RBAK-RBAKDN_ENST00000396904.2_Intron|RBAK-RBAKDN_ENST00000407184.1_Intron|RBAK_ENST00000396912.1_Missense_Mutation_p.D500N	NM_001204456.1	NP_001191385.1	Q9NYW8	RBAK_HUMAN	RB-associated KRAB zinc finger	500	Interaction with AR.				negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|kidney(1)|large_intestine(2)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)	10		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0916)|OV - Ovarian serous cystadenocarcinoma(56;2.44e-14)		GTATCTCACCGACCATCATAC	0.408													G|||	7	0.00139776	0.0	0.0	5008	,	,		20454	0.0		0.002	False		,,,				2504	0.0051				p.D500N		.											.	RBAK-653	0			c.G1498A						.	G	ASN/ASP,,ASN/ASP	3,4403	4.2+/-10.8	0,3,2200	66.0	66.0	66.0		1498,,1498	-1.4	0.0	7	dbSNP_134	66	9,8589	7.1+/-27.0	0,9,4290	yes	missense,intron,missense	RBAK,RBAK-LOC389458	NM_001204456.1,NM_001204513.1,NM_021163.3	23,,23	0,12,6490	AA,AG,GG		0.1047,0.0681,0.0923	benign,,benign	500/715,,500/715	5104585	12,12992	2203	4299	6502	SO:0001583	missense	57786	exon6			CTCACCGACCATC	AF226869	CCDS5337.1	7p22.1	2013-01-08			ENSG00000146587	ENSG00000146587		"""Zinc fingers, C2H2-type"", ""-"""	17680	protein-coding gene	gene with protein product		608191					Standard	NM_021163		Approved	ZNF769	uc003sns.1	Q9NYW8	OTTHUMG00000121155	ENST00000353796.3:c.1498G>A	7.37:g.5104585G>A	ENSP00000275423:p.Asp500Asn	Somatic	86	0		WXS	Illumina GAIIx	Phase_I	91	4	NM_001204456	0	0	5	5	0	A6NDF2|A8KAK4|B2RN44|B9EGS1|F8W6M7	Missense_Mutation	SNP	ENST00000353796.3	37	CCDS5337.1	.	.	.	.	.	.	.	.	.	.	G	1.536	-0.542985	0.04053	6.81E-4	0.001047	ENSG00000146587	ENST00000353796;ENST00000396912	T;T	0.14640	2.49;2.49	3.77	-1.42	0.08913	Zinc finger, C2H2-like (1);	0.565121	0.16026	N	0.233062	T	0.06280	0.0162	N	0.20357	0.565	0.24271	N	0.995249	B	0.06786	0.001	B	0.04013	0.001	T	0.34477	-0.9827	8	.	.	.	.	4.4221	0.11486	0.3632:0.3103:0.3266:0.0	.	500	Q9NYW8	RBAK_HUMAN	N	500	ENSP00000275423:D500N;ENSP00000380120:D500N	.	D	+	1	0	RBAK	5071111	0.000000	0.05858	0.000000	0.03702	0.505000	0.33919	0.061000	0.14366	-0.279000	0.09167	0.561000	0.74099	GAC	G|0.999;A|0.001		0.408	RBAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241640.2	NM_021163	
TNRC18	84629	bcgsc.ca	37	7	5347914	5347914	+	Silent	SNP	G	G	A	rs11554710	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr7:5347914G>A	ENST00000430969.1	-	30	9078	c.8730C>T	c.(8728-8730)gaC>gaT	p.D2910D	TNRC18_ENST00000399537.4_Silent_p.D2910D	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	2910	BAH. {ECO:0000255|PROSITE- ProRule:PRU00370}.						chromatin binding (GO:0003682)	p.D2910D(1)		central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		CGTCATTTTCGTCCACATGCG	0.637													G|||	516	0.103035	0.0477	0.1758	5008	,	,		19611	0.0982		0.1521	False		,,,				2504	0.0808				p.D2910D		.											.	TNRC18-46	1	Substitution - coding silent(1)	stomach(1)	c.C8730T						.	G		253,3923		5,243,1840	38.0	38.0	38.0		8730	1.2	1.0	7	dbSNP_120	38	1457,6947		132,1193,2877	no	coding-synonymous	TNRC18	NM_001080495.2		137,1436,4717	AA,AG,GG		17.337,6.0584,13.593		2910/2969	5347914	1710,10870	2088	4202	6290	SO:0001819	synonymous_variant	84629	exon30			ATTTTCGTCCACA	U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.8730C>T	7.37:g.5347914G>A		Somatic	307	0		WXS	Illumina GAIIx	Phase_I	305	11	NM_001080495	0	0	40	40	0	A8MX41|Q96JH1|Q96K91	Silent	SNP	ENST00000430969.1	37	CCDS47534.1																																																																																			G|0.862;A|0.138		0.637	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
USP42	84132	bcgsc.ca	37	7	6189780	6189780	+	Silent	SNP	T	T	C	rs3764814	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr7:6189780T>C	ENST00000306177.5	+	13	2111	c.1953T>C	c.(1951-1953)ctT>ctC	p.L651L		NM_032172.2	NP_115548.1	Q9H9J4	UBP42_HUMAN	ubiquitin specific peptidase 42	651					cell differentiation (GO:0030154)|protein deubiquitination (GO:0016579)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(2)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	35		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.108)|OV - Ovarian serous cystadenocarcinoma(56;5.77e-14)		CGCACGAGCTTCAAGAACCCA	0.577													C|||	1416	0.282748	0.4349	0.1844	5008	,	,		19683	0.4276		0.0885	False		,,,				2504	0.1973				p.L651L		.											.	USP42-659	0			c.T1953C						.	C		1484,2590		263,958,816	34.0	40.0	38.0		1953	-6.2	0.0	7	dbSNP_107	38	596,7796		34,528,3634	no	coding-synonymous	USP42	NM_032172.2		297,1486,4450	CC,CT,TT		7.102,36.4261,16.6854		651/1317	6189780	2080,10386	2037	4196	6233	SO:0001819	synonymous_variant	84132	exon13			CGAGCTTCAAGAA	AK022759	CCDS47535.1	7p22.2	2005-08-08	2005-08-08		ENSG00000106346	ENSG00000106346		"""Ubiquitin-specific peptidases"""	20068	protein-coding gene	gene with protein product			"""ubiquitin specific protease 42"""			12838346	Standard	NM_032172		Approved	FLJ12697	uc011jwp.2	Q9H9J4	OTTHUMG00000151888	ENST00000306177.5:c.1953T>C	7.37:g.6189780T>C		Somatic	107	0		WXS	Illumina GAIIx	Phase_I	82	5	NM_032172	0	0	7	7	0	A2RUE3|B5MDA5|Q0VIN8|Q3C166|Q6P9B4	Silent	SNP	ENST00000306177.5	37	CCDS47535.1																																																																																			T|0.728;C|0.272		0.577	USP42-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324262.3	XM_166526	
WIPF3	644150	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	29923752	29923752	+	Silent	SNP	G	G	C			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr7:29923752G>C	ENST00000409290.1	+	4	642	c.642G>C	c.(640-642)gtG>gtC	p.V214V	WIPF3_ENST00000409123.1_Silent_p.V214V|WIPF3_ENST00000242140.5_Silent_p.V214V	NM_001080529.2	NP_001073998.2	A6NGB9	WIPF3_HUMAN	WAS/WASL interacting protein family, member 3	214					cell differentiation (GO:0030154)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)				breast(2)|large_intestine(3)|lung(6)|ovary(1)	12						ACCTCCCGGTGGTTGCACccc	0.692																																					p.V214V		.											.	WIPF3-69	0			c.G642C						.						4.0	4.0	4.0					7																	29923752		1401	3246	4647	SO:0001819	synonymous_variant	644150	exon5			CCCGGTGGTTGCA	AK094250	CCDS56472.1	7p15.1	2006-10-12			ENSG00000122574	ENSG00000122574			22004	protein-coding gene	gene with protein product		612432					Standard	NM_001080529		Approved	CR16, FLJ36931	uc022aaz.1	A6NGB9	OTTHUMG00000152761	ENST00000409290.1:c.642G>C	7.37:g.29923752G>C		Somatic	27	0		WXS	Illumina GAIIx	Phase_I	44	11	NM_001080529	0	0	1	1	0	B8ZZV2	Silent	SNP	ENST00000409290.1	37	CCDS56472.1																																																																																			.		0.692	WIPF3-002	NOVEL	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000327705.1		
GARS	2617	hgsc.bcm.edu	37	7	30634661	30634661	+	Missense_Mutation	SNP	C	C	G	rs1049402	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr7:30634661C>G	ENST00000389266.3	+	1	365	c.124C>G	c.(124-126)Ccc>Gcc	p.P42A	AC005154.6_ENST00000583664.1_RNA|AC005154.6_ENST00000584372.1_RNA|AC005154.6_ENST00000582549.1_RNA|AC005154.6_ENST00000581665.1_RNA|AC005154.6_ENST00000584199.1_RNA|AC005154.6_ENST00000580440.1_RNA|AC005154.6_ENST00000579174.1_RNA|AC005154.6_ENST00000578994.1_RNA	NM_002047.2	NP_002038.2	P41250	SYG_HUMAN	glycyl-tRNA synthetase	42			P -> A (in dbSNP:rs1049402). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:7753621, ECO:0000269|PubMed:7961834, ECO:0000269|PubMed:7962006}.		cell death (GO:0008219)|diadenosine tetraphosphate biosynthetic process (GO:0015966)|gene expression (GO:0010467)|glycyl-tRNA aminoacylation (GO:0006426)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|secretory granule (GO:0030141)	ATP binding (GO:0005524)|glycine-tRNA ligase activity (GO:0004820)|protein dimerization activity (GO:0046983)	p.P42fs*20(1)		breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|skin(3)|urinary_tract(1)	24					Glycine(DB00145)	GGCCTCCTGCCCCCCGATCTC	0.736													G|||	3252	0.649361	0.5219	0.7147	5008	,	,		13746	0.6677		0.7634	False		,,,				2504	0.6391				p.P42A		.											.	GARS-91	1	Insertion - Frameshift(1)	large_intestine(1)	c.C124G						.	G	ALA/PRO	2445,1427		776,893,267	5.0	8.0	7.0		124	-6.6	0.0	7	dbSNP_86	7	6367,1671		2577,1213,229	no	missense	GARS	NM_002047.2	27	3353,2106,496	GG,GC,CC		20.7888,36.8543,26.0118	benign	42/740	30634661	8812,3098	1936	4019	5955	SO:0001583	missense	2617	exon1			TCCTGCCCCCCGA	AK074524	CCDS43564.1	7p15	2014-09-17	2004-02-13		ENSG00000106105	ENSG00000106105	6.1.1.14	"""Aminoacyl tRNA synthetases / Class II"""	4162	protein-coding gene	gene with protein product	"""glycine tRNA ligase"""	600287	"""Charcot-Marie-Tooth neuropathy 2D"""	CMT2D		8595897, 8872480	Standard	NM_002047		Approved	GlyRS, DSMAV, SMAD1	uc003tbm.3	P41250	OTTHUMG00000152769	ENST00000389266.3:c.124C>G	7.37:g.30634661C>G	ENSP00000373918:p.Pro42Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	12	12	NM_002047	0	0	0	14	14	B3KQA2|B4DIA0|Q969Y1	Missense_Mutation	SNP	ENST00000389266.3	37	CCDS43564.1	1456	0.6666666666666666	278	0.5650406504065041	268	0.7403314917127072	337	0.5891608391608392	573	0.7559366754617414	G	0.005	-2.164835	0.00318	0.631457	0.792112	ENSG00000106105	ENST00000389266	T	0.80393	-1.37	3.31	-6.63	0.01807	.	1.037800	0.07609	N	0.925137	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.13575	-1.0504	9	0.08179	T	0.78	.	5.5596	0.17135	0.0726:0.2689:0.1197:0.5389	rs1049402;rs3189564;rs11553500;rs17856223;rs17856227;rs1049402	42	P41250	SYG_HUMAN	A	42	ENSP00000373918:P42A	ENSP00000373918:P42A	P	+	1	0	GARS	30601186	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	-0.671000	0.05250	-2.551000	0.00479	-0.744000	0.03518	CCC	C|0.329;G|0.671		0.736	GARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327735.1	NM_002047	
AVL9	23080	bcgsc.ca	37	7	32598630	32598630	+	Missense_Mutation	SNP	T	T	A	rs2290213	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr7:32598630T>A	ENST00000318709.4	+	10	990	c.769T>A	c.(769-771)Tgt>Agt	p.C257S	AVL9_ENST00000409301.1_Missense_Mutation_p.C257S|AVL9_ENST00000404479.1_Missense_Mutation_p.C257S	NM_015060.1	NP_055875.1	Q8NBF6	AVL9_HUMAN	AVL9 homolog (S. cerevisiase)	257			C -> S (in dbSNP:rs2290213).		cell migration (GO:0016477)	integral component of membrane (GO:0016021)|recycling endosome (GO:0055037)				endometrium(3)|kidney(1)|large_intestine(3)|lung(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18						AAGTAACCCATGTGCAGATGA	0.443													T|||	780	0.155751	0.1793	0.1066	5008	,	,		18083	0.129		0.1243	False		,,,				2504	0.2188				p.C257S		.											.	AVL9-90	0			c.T769A						.	T	SER/CYS	794,3612	314.7+/-293.7	89,616,1498	97.0	94.0	95.0		769	-1.3	0.0	7	dbSNP_100	95	1098,7502	228.0+/-263.2	64,970,3266	yes	missense	AVL9	NM_015060.1	112	153,1586,4764	AA,AT,TT		12.7674,18.0209,14.5471	benign	257/649	32598630	1892,11114	2203	4300	6503	SO:0001583	missense	23080	exon10			AACCCATGTGCAG	D87682	CCDS34613.1	7p14.3	2013-05-01	2008-10-03	2008-10-03	ENSG00000105778	ENSG00000105778			28994	protein-coding gene	gene with protein product		612927	"""KIAA0241"""	KIAA0241		17229886, 22595670	Standard	XM_005249668		Approved		uc003tcv.1	Q8NBF6	OTTHUMG00000152929	ENST00000318709.4:c.769T>A	7.37:g.32598630T>A	ENSP00000315568:p.Cys257Ser	Somatic	149	0		WXS	Illumina GAIIx	Phase_I	106	5	NM_015060	0	0	14	14	0	Q92573	Missense_Mutation	SNP	ENST00000318709.4	37	CCDS34613.1	327	0.14972527472527472	98	0.1991869918699187	39	0.10773480662983426	91	0.1590909090909091	99	0.13060686015831136	T	0.014	-1.585371	0.00872	0.180209	0.127674	ENSG00000105778	ENST00000318709;ENST00000409301;ENST00000329714;ENST00000404479;ENST00000446718	T;T;T;T	0.39787	1.11;1.11;1.07;1.06	5.31	-1.29	0.09288	.	0.871343	0.10468	N	0.671197	T	0.00012	0.0000	N	0.02539	-0.55	0.80722	P	0.0	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.31916	-0.9926	9	0.08381	T	0.77	-28.4598	6.015	0.19598	0.1203:0.42:0.0:0.4597	rs2290213;rs52798277;rs2290213	257;257;257	Q8N6Z3;Q8NBF6-2;Q8NBF6	.;.;AVL9_HUMAN	S	257;257;257;257;188	ENSP00000315568:C257S;ENSP00000387011:C257S;ENSP00000385242:C257S;ENSP00000395134:C188S	ENSP00000315568:C257S	C	+	1	0	AVL9	32565155	0.000000	0.05858	0.000000	0.03702	0.083000	0.17756	-0.114000	0.10757	-0.455000	0.07054	-0.326000	0.08463	TGT	A|0.150;C|0.000;T|0.850		0.443	AVL9-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328643.1	NM_015060	
NT5C3A	51251	bcgsc.ca	37	7	33060946	33060946	+	Silent	SNP	A	A	G	rs3750117	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr7:33060946A>G	ENST00000242210.7	-	5	469	c.393T>C	c.(391-393)taT>taC	p.Y131Y	NT5C3A_ENST00000396152.2_Silent_p.Y92Y|NT5C3A_ENST00000409467.1_Silent_p.Y80Y|NT5C3A_ENST00000610140.1_Silent_p.Y126Y|NT5C3A_ENST00000409787.1_Silent_p.Y92Y|AVL9_ENST00000404479.1_Intron|NT5C3A_ENST00000405342.1_Silent_p.Y92Y|NT5C3A_ENST00000381626.2_Silent_p.Y80Y	NM_001002009.2|NM_001002010.2	NP_001002009.1|NP_001002010.1	Q9H0P0	5NT3A_HUMAN	5'-nucleotidase, cytosolic IIIA	131					dephosphorylation (GO:0016311)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide metabolic process (GO:0009117)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|pyrimidine nucleoside metabolic process (GO:0006213)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)	2'-phosphotransferase activity (GO:0008665)|5'-nucleotidase activity (GO:0008253)|magnesium ion binding (GO:0000287)|nucleotide binding (GO:0000166)										CAATAGCGTAATATTTTTCCT	0.299													A|||	3340	0.666933	0.8139	0.7176	5008	,	,		17582	0.4613		0.7087	False		,,,				2504	0.6012				p.Y131Y		.											.	.	0			c.T393C						.	A	,,	3375,1029	723.7+/-409.4	1291,793,118	94.0	95.0	94.0		393,240,276	-1.0	1.0	7	dbSNP_107	94	5943,2647	680.7+/-403.7	2053,1837,405	no	coding-synonymous,coding-synonymous,coding-synonymous	NT5C3	NM_001002010.1,NM_001166118.1,NM_016489.11	,,	3344,2630,523	GG,GA,AA		30.8149,23.3651,28.29	,,	131/337,80/286,92/298	33060946	9318,3676	2202	4295	6497	SO:0001819	synonymous_variant	0	exon5			AGCGTAATATTTT	AF312735	CCDS34616.1, CCDS34617.1, CCDS55101.1	7p14.3	2013-03-06	2013-03-06	2013-03-06	ENSG00000122643	ENSG00000122643	3.1.3.5		17820	protein-coding gene	gene with protein product	"""lupin"""	606224	"""5'-nucleotidase, cytosolic III"""	NT5C3		11042152, 10942414	Standard	NM_001002010		Approved	UMPH1, PSN1, PN-I, UMPH, P5'N-1, cN-III, p36, POMP, hUMP1	uc003tdk.4	Q9H0P0	OTTHUMG00000152983	ENST00000242210.7:c.393T>C	7.37:g.33060946A>G		Somatic	424	4		WXS	Illumina GAIIx	Phase_I	392	9	NM_001002010	0	0	21	21	0	A8K253|B2RAA5|B8ZZC4|Q6IPZ1|Q6NXS6|Q7L3G6|Q9P0P5|Q9UC42|Q9UC43|Q9UC44|Q9UC45	Silent	SNP	ENST00000242210.7	37	CCDS34616.1																																																																																			A|0.300;G|0.700		0.299	NT5C3A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000328880.1	NM_016489	
URGCP	55665	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	43916339	43916340	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	TC	TC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr7:43916339_43916340delTC	ENST00000453200.1	-	6	3215_3216	c.2722_2723delGA	c.(2722-2724)gaafs	p.E908fs	URGCP_ENST00000336086.6_Frame_Shift_Del_p.E865fs|URGCP-MRPS24_ENST00000603700.1_Intron|URGCP_ENST00000497914.1_5'UTR|URGCP_ENST00000223341.7_Frame_Shift_Del_p.E865fs|URGCP_ENST00000447717.3_Frame_Shift_Del_p.E865fs|URGCP_ENST00000402306.3_Frame_Shift_Del_p.E899fs|URGCP_ENST00000443736.1_Frame_Shift_Del_p.E865fs			Q8TCY9	URGCP_HUMAN	upregulator of cell proliferation	908	VLIG-type G.				cell cycle (GO:0007049)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|liver(1)|lung(13)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						CCTGATGTTTTCGAGTAGGCAT	0.525																																					p.908_908del		.											.	URGCP-94	0			c.2722_2723del						.																																			SO:0001589	frameshift_variant	55665	exon6			ATGTTTTCGAGTA		CCDS43572.1, CCDS47577.1, CCDS47578.1	7p13	2010-02-17			ENSG00000106608	ENSG00000106608			30890	protein-coding gene	gene with protein product	"""up-regulated gene 4"""	610337				10819331, 12082552	Standard	NM_017920		Approved	URG4, KIAA1507, FLJ20654, DKFZp666G166, DKFZp686O0457	uc003tiw.3	Q8TCY9	OTTHUMG00000155245	ENST00000453200.1:c.2722_2723delGA	7.37:g.43916339_43916340delTC	ENSP00000396918:p.Glu908fs	Somatic	176	0		WXS	Illumina GAIIx	Phase_I	173	54	NM_001077663	0	0	0	0	0	E9PFF6|Q658M4|Q68DH6|Q6MZZ5|Q8WV98|Q9NWR7|Q9P221	Frame_Shift_Del	DEL	ENST00000453200.1	37	CCDS47578.1																																																																																			.		0.525	URGCP-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338995.1	NM_001077664	
LRRD1	401387	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	91793979	91793979	+	Nonsense_Mutation	SNP	G	G	A			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr7:91793979G>A	ENST00000458448.1	-	2	738	c.538C>T	c.(538-540)Caa>Taa	p.Q180*	CTB-161K23.1_ENST00000453068.1_RNA|LRRD1_ENST00000454089.2_5'UTR|LRRD1_ENST00000343318.5_Intron|LRRD1_ENST00000430130.2_Nonsense_Mutation_p.Q180*|LRRD1_ENST00000422722.1_Intron			A4D1F6	LRRD1_HUMAN	leucine-rich repeats and death domain containing 1	180					signal transduction (GO:0007165)					breast(4)|endometrium(1)	5						TCTGCCCCTTGAAATGTTTTG	0.323																																					p.Q180X		.											.	.	0			c.C538T						.						37.0	30.0	32.0					7																	91793979		692	1590	2282	SO:0001587	stop_gained	401387	exon1			CCCCTTGAAATGT	BC026112	CCDS55124.1	7q21.2	2011-05-23			ENSG00000240720	ENSG00000240720			34300	protein-coding gene	gene with protein product							Standard	NM_001161528		Approved	IMAGE:4798971	uc011khp.1	A4D1F6	OTTHUMG00000155861	ENST00000458448.1:c.538C>T	7.37:g.91793979G>A	ENSP00000405987:p.Gln180*	Somatic	58	0		WXS	Illumina GAIIx	Phase_I	38	16	NM_001161528	0	0	0	0	0	B7ZMM9|Q49AT9	Nonsense_Mutation	SNP	ENST00000458448.1	37	CCDS55124.1	.	.	.	.	.	.	.	.	.	.	G	13.58	2.280607	0.40294	.	.	ENSG00000240720	ENST00000458448;ENST00000430130	.	.	.	5.71	1.2	0.21068	.	.	.	.	.	.	.	.	.	.	.	0.30132	N	0.804671	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	.	5.4632	0.16627	0.0698:0.2645:0.4402:0.2255	.	.	.	.	X	180	.	ENSP00000411568:Q180X	Q	-	1	0	LRRD1	91631915	0.816000	0.29132	0.955000	0.39395	0.320000	0.28249	0.909000	0.28558	0.252000	0.21531	-0.182000	0.12963	CAA	.		0.323	LRRD1-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342027.2	NM_001045475	
EPHB4	2050	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	100416169	100416169	+	Silent	SNP	C	C	T			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr7:100416169C>T	ENST00000358173.3	-	7	1863	c.1395G>A	c.(1393-1395)ctG>ctA	p.L465L	EPHB4_ENST00000360620.3_Silent_p.L465L|RN7SL750P_ENST00000582814.1_RNA|EPHB4_ENST00000477446.1_5'UTR	NM_004444.4	NP_004435.3	P54760	EPHB4_HUMAN	EPH receptor B4	465	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|ephrin receptor signaling pathway (GO:0048013)|heart morphogenesis (GO:0003007)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(3)	47	Lung NSC(181;0.041)|all_lung(186;0.0581)					CCTCGTAGTCCAGCACAGCCC	0.637																																					p.L465L	GBM(200;2113 3072 25865 52728)	.											.	EPHB4-1446	0			c.G1395A						.						66.0	59.0	62.0					7																	100416169		2203	4300	6503	SO:0001819	synonymous_variant	2050	exon7			GTAGTCCAGCACA	AY056047	CCDS5706.1	7q22	2013-02-11	2004-10-28		ENSG00000196411	ENSG00000196411		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3395	protein-coding gene	gene with protein product		600011	"""EphB4"""	HTK		8188704	Standard	NM_004444		Approved	Tyro11	uc003uwn.1	P54760	OTTHUMG00000157040	ENST00000358173.3:c.1395G>A	7.37:g.100416169C>T		Somatic	60	0		WXS	Illumina GAIIx	Phase_I	60	23	NM_004444	0	0	11	16	5	B5A970|B5A971|B5A972|Q7Z635|Q9BTA5|Q9BXP0	Silent	SNP	ENST00000358173.3	37	CCDS5706.1																																																																																			.		0.637	EPHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347222.1	NM_004444	
UFSP1	402682	broad.mit.edu	37	7	100486576	100486576	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr7:100486576G>T	ENST00000388761.2	-	1	763	c.317C>A	c.(316-318)gCt>gAt	p.A106D		NM_001015072.3	NP_001015072.2	Q6NVU6	UFSP1_HUMAN	UFM1-specific peptidase 1 (non-functional)	106						extracellular vesicular exosome (GO:0070062)	thiolester hydrolase activity (GO:0016790)|UFM1 hydrolase activity (GO:0071567)			lung(1)|stomach(1)	2	Lung NSC(181;0.041)|all_lung(186;0.0581)					CCACCCAGCAGCCTGTAGTTC	0.592																																					p.A106D		.											.	UFSP1-22	0			c.C317A						.						97.0	98.0	98.0					7																	100486576		2203	4300	6503	SO:0001583	missense	402682	exon1			CCAGCAGCCTGTA	AF312032	CCDS34710.1	7q22.1	2008-03-25			ENSG00000176125	ENSG00000176125			33821	protein-coding gene	gene with protein product		611481				17182609, 18321862	Standard	NM_001015072		Approved	UFSP	uc003uxc.4	Q6NVU6	OTTHUMG00000159662	ENST00000388761.2:c.317C>A	7.37:g.100486576G>T	ENSP00000373413:p.Ala106Asp	Somatic	125	2		WXS	Illumina GAIIx	Phase_I	70	5	NM_001015072	0	0	2	2	0	A4D2E4|A8K8V2|B6ZDG6|Q9BXP6	Missense_Mutation	SNP	ENST00000388761.2	37	CCDS34710.1	.	.	.	.	.	.	.	.	.	.	G	6.488	0.458235	0.12342	.	.	ENSG00000176125	ENST00000388761	T	0.28454	1.61	5.19	-2.95	0.05564	.	1.095140	0.07033	N	0.828743	T	0.12347	0.0300	N	0.11313	0.125	0.09310	N	1	B	0.06786	0.001	B	0.09377	0.004	T	0.30504	-0.9976	10	0.11794	T	0.64	-32.6919	4.1681	0.10317	0.3985:0.0:0.3527:0.2488	.	106	Q6NVU6	UFSP1_HUMAN	D	106	ENSP00000373413:A106D	ENSP00000373413:A106D	A	-	2	0	UFSP1	100324512	0.001000	0.12720	0.001000	0.08648	0.198000	0.23893	0.338000	0.19858	-0.530000	0.06349	-0.237000	0.12165	GCT	.		0.592	UFSP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356751.1	NM_001015072	
RBM33	155435	bcgsc.ca	37	7	155530954	155530954	+	Silent	SNP	T	T	C	rs2178428	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr7:155530954T>C	ENST00000401878.3	+	11	1792	c.1594T>C	c.(1594-1596)Ttg>Ctg	p.L532L		NM_053043.2	NP_444271.2	Q96EV2	RBM33_HUMAN	RNA binding motif protein 33	532	Pro-rich.						nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(4)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	27	all_neural(206;0.101)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.2)		ACGACCAGCCTTGCAGCCTCC	0.597													C|||	1590	0.317492	0.5492	0.2695	5008	,	,		17130	0.3125		0.1869	False		,,,				2504	0.1779				p.L532L		.											.	RBM33-23	0			c.T1594C						.	C		2011,2151		485,1041,555	80.0	90.0	87.0		1594	1.8	0.7	7	dbSNP_96	87	1626,6790		177,1272,2759	no	coding-synonymous	RBM33	NM_053043.2		662,2313,3314	CC,CT,TT		19.3203,48.3181,28.9156		532/1171	155530954	3637,8941	2081	4208	6289	SO:0001819	synonymous_variant	155435	exon11			CCAGCCTTGCAGC	AL832196	CCDS5941.2	7q36.3	2013-02-12			ENSG00000184863	ENSG00000184863		"""RNA binding motif (RRM) containing"""	27223	protein-coding gene	gene with protein product			"""proline rich 8"""	PRR8			Standard	NM_053043		Approved	DKFZp686F102, MGC20460, DKFZp434D1319	uc010lqk.1	Q96EV2	OTTHUMG00000150260	ENST00000401878.3:c.1594T>C	7.37:g.155530954T>C		Somatic	224	2		WXS	Illumina GAIIx	Phase_I	137	7	NM_053043	0	0	1	1	0	A4D244|B5MC24|Q52LF5|Q75LN9|Q75ML5|Q9NSV0	Silent	SNP	ENST00000401878.3	37	CCDS5941.2																																																																																			T|0.708;C|0.292		0.597	RBM33-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317225.3	NM_001008408	
DLC1	10395	hgsc.bcm.edu;broad.mit.edu	37	8	12943918	12943919	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	CA	CA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr8:12943918_12943919delCA	ENST00000276297.4	-	17	4755_4756	c.4346_4347delTG	c.(4345-4347)gtgfs	p.V1449fs	DLC1_ENST00000512044.2_Frame_Shift_Del_p.V1046fs|DLC1_ENST00000510318.1_5'UTR|DLC1_ENST00000520226.1_Frame_Shift_Del_p.V938fs|DLC1_ENST00000358919.2_Frame_Shift_Del_p.V1012fs	NM_182643.2	NP_872584.2	Q96QB1	RHG07_HUMAN	DLC1 Rho GTPase activating protein	1449	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.				actin cytoskeleton organization (GO:0030036)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|focal adhesion assembly (GO:0048041)|forebrain development (GO:0030900)|heart morphogenesis (GO:0003007)|hindbrain morphogenesis (GO:0021575)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neural tube closure (GO:0001843)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	lipid binding (GO:0008289)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)			NS(2)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(39)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	110						GATCGTGATCCACAGAGGTTAG	0.475																																					p.1449_1449del		.											.	DLC1-657	0			c.4346_4347del						.																																			SO:0001589	frameshift_variant	10395	exon17			GTGATCCACAGAG	AF035119	CCDS5989.1, CCDS5990.1, CCDS5991.1, CCDS5991.2, CCDS55201.1	8p22	2014-06-20	2014-06-20		ENSG00000164741	ENSG00000164741		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	2897	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 12"""	604258	"""deleted in liver cancer 1"""			9605766, 11214970	Standard	NM_182643		Approved	HP, ARHGAP7, STARD12, DLC-1, p122-RhoGAP	uc003wwm.2	Q96QB1	OTTHUMG00000090825	ENST00000276297.4:c.4346_4347delTG	8.37:g.12943920_12943921delCA	ENSP00000276297:p.Val1449fs	Somatic	108	0		WXS	Illumina GAIIx	Phase_I	175	16	NM_182643	0	0	0	0	0	B4DR10|B8PTI0|E9PDZ8|E9PF76|E9PGY9|O14868|O43199|Q7Z5R8|Q86UC6|Q9C0E0|Q9H7A2	Frame_Shift_Del	DEL	ENST00000276297.4	37	CCDS5989.1																																																																																			.		0.475	DLC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207632.2	NM_182643, NM_006094	
OPRK1	4986	hgsc.bcm.edu	37	8	54163562	54163562	+	Silent	SNP	C	C	A	rs1051660	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr8:54163562C>A	ENST00000265572.3	-	2	333	c.36G>T	c.(34-36)ccG>ccT	p.P12P	OPRK1_ENST00000520287.1_Silent_p.P12P	NM_000912.3	NP_000903.2	P41145	OPRK_HUMAN	opioid receptor, kappa 1	12					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-inhibiting opioid receptor signaling pathway (GO:0031635)|behavior (GO:0007610)|defense response to virus (GO:0051607)|immune response (GO:0006955)|locomotory behavior (GO:0007626)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|regulation of saliva secretion (GO:0046877)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dynorphin receptor activity (GO:0038048)|opioid receptor activity (GO:0004985)			NS(2)|breast(3)|endometrium(3)|kidney(12)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(5)|urinary_tract(1)	43		all_epithelial(80;0.066)|Lung NSC(129;0.0804)|all_lung(136;0.136)			Alvimopan(DB06274)|Amitriptyline(DB00321)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Dezocine(DB01209)|Fentanyl(DB00813)|Heroin(DB01452)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levorphanol(DB00854)|Loperamide(DB00836)|Menthol(DB00825)|Methylnaltrexone(DB06800)|Mianserin(DB06148)|Mirtazapine(DB00370)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Pentazocine(DB00652)|Pethidine(DB00454)|Progesterone(DB00396)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	AGGTAGGGCCCGGCTCCCCGC	0.726													c|||	573	0.114417	0.0968	0.0476	5008	,	,		11885	0.1478		0.0785	False		,,,				2504	0.1881				p.P12P		.											.	OPRK1-70	0			c.G36T	GRCh37	CM074395	OPRK1	M	rs1051660	.			392,3590		20,352,1619	6.0	9.0	8.0		36	-1.5	0.1	8	dbSNP_86	8	701,7415		24,653,3381	no	coding-synonymous	OPRK1	NM_000912.3		44,1005,5000	AA,AC,CC		8.6373,9.8443,9.0346		12/381	54163562	1093,11005	1991	4058	6049	SO:0001819	synonymous_variant	4986	exon2			AGGGCCCGGCTCC		CCDS6152.1, CCDS64895.1	8q11.2	2014-05-21			ENSG00000082556	ENSG00000082556		"""GPCR / Class A : Opioid receptors"""	8154	protein-coding gene	gene with protein product		165196				8188308	Standard	XM_005251252		Approved	KOR, OPRK	uc003xri.1	P41145	OTTHUMG00000164276	ENST00000265572.3:c.36G>T	8.37:g.54163562C>A		Somatic	3	0		WXS	Illumina GAIIx	Phase_I	11	7	NM_000912	0	0	0	0	0	E5RHC9|Q499G4	Silent	SNP	ENST00000265572.3	37	CCDS6152.1																																																																																			C|0.895;A|0.105		0.726	OPRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378048.1		
ANKRD46	157567	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	101540156	101540156	+	Silent	SNP	T	T	C			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr8:101540156T>C	ENST00000520552.1	-	4	548	c.387A>G	c.(385-387)gaA>gaG	p.E129E	ANKRD46_ENST00000519316.1_Intron|ANKRD46_ENST00000519597.1_Silent_p.E129E|ANKRD46_ENST00000520311.1_Silent_p.E129E|ANKRD46_ENST00000335659.3_Silent_p.E129E	NM_001270379.1	NP_001257308.1	Q86W74	ANR46_HUMAN	ankyrin repeat domain 46	129						integral component of membrane (GO:0016021)				kidney(1)|large_intestine(2)|lung(4)	7	all_cancers(14;5.07e-05)|all_epithelial(15;2.84e-07)|Lung NSC(17;0.000353)|all_lung(17;0.000998)		Epithelial(11;2.61e-11)|all cancers(13;5.03e-09)|OV - Ovarian serous cystadenocarcinoma(57;4.49e-06)|STAD - Stomach adenocarcinoma(118;0.0957)			CTTCCAAAGATTCCAGCAATC	0.403																																					p.E129E		.											.	ANKRD46-22	0			c.A387G						.						156.0	150.0	152.0					8																	101540156		2203	4300	6503	SO:0001819	synonymous_variant	157567	exon4			CAAAGATTCCAGC	AB077205	CCDS6287.1, CCDS59109.1	8q22.3	2013-01-10						"""Ankyrin repeat domain containing"""	27229	protein-coding gene	gene with protein product							Standard	NM_001270377		Approved		uc003yjm.4	Q86W74		ENST00000520552.1:c.387A>G	8.37:g.101540156T>C		Somatic	98	0		WXS	Illumina GAIIx	Phase_I	128	29	NM_001270378	0	0	18	18	0	Q6P9B7	Silent	SNP	ENST00000520552.1	37	CCDS59109.1																																																																																			.		0.403	ANKRD46-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000379899.1	NM_198401	
TMEM74	157753	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	109796810	109796810	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr8:109796810G>A	ENST00000297459.3	-	2	696	c.518C>T	c.(517-519)tCt>tTt	p.S173F	TMEM74_ENST00000518838.1_Intron	NM_153015.1	NP_694560.1	Q96NL1	TMM74_HUMAN	transmembrane protein 74	173					autophagy (GO:0006914)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)				breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(3)|skin(2)|urinary_tract(1)	29			OV - Ovarian serous cystadenocarcinoma(57;3.08e-10)			ATAGTCTATAGACTTCCCTGA	0.493																																					p.S173F		.											.	TMEM74-228	0			c.C518T						.						112.0	107.0	109.0					8																	109796810		2203	4300	6503	SO:0001583	missense	157753	exon2			TCTATAGACTTCC	AK055230	CCDS6310.1	8q23.1	2009-11-06				ENSG00000164841			26409	protein-coding gene	gene with protein product		613935				12477932	Standard	NM_153015		Approved	FLJ30668, NET36	uc003ymy.1	Q96NL1		ENST00000297459.3:c.518C>T	8.37:g.109796810G>A	ENSP00000297459:p.Ser173Phe	Somatic	180	0		WXS	Illumina GAIIx	Phase_I	256	42	NM_153015	0	0	0	0	0		Missense_Mutation	SNP	ENST00000297459.3	37	CCDS6310.1	.	.	.	.	.	.	.	.	.	.	G	16.90	3.249897	0.59212	.	.	ENSG00000164841	ENST00000297459	.	.	.	5.95	5.95	0.96441	.	0.123245	0.56097	D	0.000027	T	0.79545	0.4464	M	0.71036	2.16	0.80722	D	1	D	0.76494	0.999	D	0.68483	0.958	T	0.79727	-0.1682	9	0.72032	D	0.01	-4.9048	20.3812	0.98933	0.0:0.0:1.0:0.0	.	173	Q96NL1	TMM74_HUMAN	F	173	.	ENSP00000297459:S173F	S	-	2	0	TMEM74	109865986	1.000000	0.71417	0.955000	0.39395	0.127000	0.20565	9.869000	0.99810	2.821000	0.97095	0.650000	0.86243	TCT	.		0.493	TMEM74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380755.1	NM_153015	
SCRIB	23513	hgsc.bcm.edu	37	8	144874554	144874554	+	Silent	SNP	T	T	C	rs6991873	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr8:144874554T>C	ENST00000320476.3	-	32	4356	c.4350A>G	c.(4348-4350)ccA>ccG	p.P1450P	SCRIB_ENST00000546337.1_5'Flank|SCRIB_ENST00000356994.2_Silent_p.P1450P|SCRIB_ENST00000377533.3_Silent_p.P1369P|RP11-429J17.8_ENST00000534089.1_RNA|RP11-429J17.8_ENST00000532625.1_RNA|RP11-429J17.8_ENST00000527139.1_RNA	NM_015356.4	NP_056171	Q14160	SCRIB_HUMAN	scribbled planar cell polarity protein	1450					activation of Rac GTPase activity (GO:0032863)|apoptotic process involved in morphogenesis (GO:0060561)|astrocyte cell migration (GO:0043615)|asymmetric protein localization (GO:0008105)|auditory receptor cell stereocilium organization (GO:0060088)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cochlear nucleus development (GO:0021747)|establishment of apical/basal cell polarity (GO:0035089)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of mitotic cell cycle (GO:0045930)|neural tube closure (GO:0001843)|positive chemotaxis (GO:0050918)|positive regulation of apoptotic process (GO:0043065)|positive regulation of receptor recycling (GO:0001921)|protein localization to adherens junction (GO:0071896)|single organismal cell-cell adhesion (GO:0016337)|synaptic vesicle endocytosis (GO:0048488)|synaptic vesicle targeting (GO:0016080)|viral process (GO:0016032)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cell projection (GO:0042995)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)|Scrib-APC-beta-catenin complex (GO:0034750)				NS(1)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(3)|lung(20)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	42	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;1.12e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			CTCCCAGGGGTGGGGGGGACG	0.751													T|||	4958	0.990016	0.9652	0.9971	5008	,	,		8428	1.0		0.998	False		,,,				2504	1.0				p.P1450P	Pancreas(51;966 1133 10533 14576 29674)	.											.	SCRIB-228	0			c.A4350G						.	T	,	3300,62		1619,62,0	3.0	4.0	4.0		4350,4350	-2.9	0.0	8	dbSNP_116	4	7076,4		3536,4,0	no	coding-synonymous,coding-synonymous	SCRIB	NM_015356.3,NM_182706.3	,	5155,66,0	CC,CT,TT		0.0565,1.8441,0.6321	,	1450/1631,1450/1656	144874554	10376,66	1681	3540	5221	SO:0001819	synonymous_variant	23513	exon32			CAGGGGTGGGGGG	AY062238	CCDS6411.1, CCDS6412.1	8q24.3	2013-03-05	2013-03-05		ENSG00000180900	ENSG00000180900			30377	protein-coding gene	gene with protein product		607733	"""scribbled homolog (Drosophila)"""			11027293, 14681682	Standard	NM_182706		Approved	KIAA0147, SCRB1, Vartul	uc003yzo.1	Q14160	OTTHUMG00000165154	ENST00000320476.3:c.4350A>G	8.37:g.144874554T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_015356	0	0	0	48	48	Q6P496|Q7Z5D1|Q8WWV8|Q96C69|Q96GG1	Silent	SNP	ENST00000320476.3	37	CCDS6411.1	2162	0.98992673992674	472	0.959349593495935	361	0.9972375690607734	572	1.0	757	0.9986807387862797	T	5.986	0.365776	0.11352	0.981559	0.999435	ENSG00000180900	ENST00000526832	.	.	.	4.01	-2.89	0.05665	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.20773	-1.0265	3	.	.	.	.	6.6143	0.22769	0.0:0.6476:0.1513:0.201	rs6991873	.	.	.	A	470	.	.	T	-	1	0	SCRIB	144946542	0.000000	0.05858	0.000000	0.03702	0.031000	0.12232	-0.411000	0.07142	-0.857000	0.04115	-0.386000	0.06593	ACC	T|0.010;C|0.990		0.751	SCRIB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000382215.1	NM_015356	
ZNF517	340385	hgsc.bcm.edu	37	8	146033347	146033347	+	Missense_Mutation	SNP	T	T	C	rs2976653	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr8:146033347T>C	ENST00000531720.1	+	4	1091	c.1046T>C	c.(1045-1047)gTg>gCg	p.V349A	ZNF517_ENST00000526178.1_Intron|ZNF517_ENST00000525105.1_Intron|ZNF517_ENST00000359971.3_Missense_Mutation_p.V349A			Q6ZMY9	ZN517_HUMAN	zinc finger protein 517	349				V -> A (in Ref. 1; BAD18586). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(2)|lung(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_cancers(97;1.03e-11)|all_epithelial(106;6.69e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;5.47e-39)|OV - Ovarian serous cystadenocarcinoma(54;6.38e-39)|all cancers(56;5.47e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)			GACGGCGGCGTGGGGCAGGGC	0.746													C|||	4981	0.994609	1.0	1.0	5008	,	,		12856	1.0		0.994	False		,,,				2504	0.9785				p.V349A		.											.	ZNF517-90	0			c.T1046C						.	C	ALA/VAL	3411,3		1704,3,0	3.0	5.0	4.0		1046	-0.8	0.0	8	dbSNP_101	4	7050,46		3502,46,0	no	missense	ZNF517	NM_213605.2	64	5206,49,0	CC,CT,TT		0.6483,0.0879,0.4662	benign	349/493	146033347	10461,49	1707	3548	5255	SO:0001583	missense	340385	exon5			GCGGCGTGGGGCA	AK096527	CCDS6434.1	8q24.3	2013-01-08				ENSG00000197363		"""Zinc fingers, C2H2-type"", ""-"""	27984	protein-coding gene	gene with protein product							Standard	NM_213605		Approved		uc003zed.1	Q6ZMY9		ENST00000531720.1:c.1046T>C	8.37:g.146033347T>C	ENSP00000436103:p.Val349Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	13	13	NM_213605	0	0	0	4	4		Missense_Mutation	SNP	ENST00000531720.1	37	CCDS6434.1	2179|2179	0.9977106227106227|0.9977106227106227	492|492	1.0|1.0	362|362	1.0|1.0	572|572	1.0|1.0	753|753	0.9934036939313984|0.9934036939313984	C|C	0.021|0.021	-1.418607|-1.418607	0.01136|0.01136	0.999121|0.999121	0.993517|0.993517	ENSG00000197363|ENSG00000197363	ENST00000359971;ENST00000531720|ENST00000529429	T;T|.	0.05319|.	3.46;3.46|.	2.17|2.17	-0.838|-0.838	0.10762|0.10762	.|.	.|.	.|.	.|.	.|.	T|T	0.00012|0.00012	0.0000|0.0000	L|L	0.35644|0.35644	1.08|1.08	0.80722|0.80722	P|P	0.0|0.0	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|T	0.21449|0.21449	-1.0245|-1.0245	8|4	0.59425|.	D|.	0.04|.	.|.	0.241|0.241	0.00192|0.00192	0.362:0.2246:0.2135:0.1999|0.362:0.2246:0.2135:0.1999	rs2976653;rs59817342|rs2976653;rs59817342	349|.	Q6ZMY9|.	ZN517_HUMAN|.	A|R	349|316	ENSP00000353058:V349A;ENSP00000436103:V349A|.	ENSP00000353058:V349A|.	V|W	+|+	2|1	0|0	ZNF517|ZNF517	146004151|146004151	0.001000|0.001000	0.12720|0.12720	0.002000|0.002000	0.10522|0.10522	0.004000|0.004000	0.04260|0.04260	-0.400000|-0.400000	0.07241|0.07241	-0.612000|-0.612000	0.05701|0.05701	-1.157000|-1.157000	0.01802|0.01802	GTG|TGG	G|0.992;C|0.006		0.746	ZNF517-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382642.1	XM_291261	
CDKN2A	1029	broad.mit.edu;bcgsc.ca	37	9	21974723	21974738	+	Frame_Shift_Del	DEL	CCCGCCTCCAGCAGCG	CCCGCCTCCAGCAGCG	-			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr9:21974723_21974738delCCCGCCTCCAGCAGCG	ENST00000304494.5	-	1	359_374	c.89_104delCGCTGCTGGAGGCGGG	c.(88-105)gcgctgctggaggcggggfs	p.ALLEAG30fs	CDKN2A_ENST00000498124.1_Frame_Shift_Del_p.ALLEAG30fs|CDKN2A_ENST00000361570.3_Intron|CDKN2A_ENST00000579755.1_Intron|CDKN2A_ENST00000494262.1_Intron|CDKN2A_ENST00000446177.1_Frame_Shift_Del_p.ALLEAG30fs|RP11-145E5.5_ENST00000404796.2_Intron|CDKN2A_ENST00000498628.2_Intron|CDKN2A_ENST00000530628.2_Intron|CDKN2A_ENST00000579122.1_Frame_Shift_Del_p.ALLEAG30fs	NM_000077.4	NP_000068.1	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A	30					cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular senescence (GO:2000774)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|Ras protein signal transduction (GO:0007265)|replicative senescence (GO:0090399)|senescence-associated heterochromatin focus assembly (GO:0035986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|senescence-associated heterochromatin focus (GO:0035985)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)	p.0?(1315)|p.?(23)|p.L32_L37del(5)|p.A30V(3)|p.G35E(3)|p.A34V(2)|p.A30A(2)|p.V28_E33del(2)|p.E33*(2)|p.R29_A34del(2)|p.G35R(2)|p.E33D(1)|p.L31P(1)|p.A34A(1)|p.E33fs*8(1)|p.R29fs*9(1)|p.A36fs*8(1)|p.0(1)|p.L32R(1)|p.G35fs*13(1)|p.V28_V51del(1)|p.G35V(1)		NS(28)|adrenal_gland(6)|autonomic_ganglia(11)|biliary_tract(74)|bone(84)|breast(46)|central_nervous_system(522)|cervix(23)|endometrium(14)|eye(4)|genital_tract(15)|haematopoietic_and_lymphoid_tissue(698)|kidney(39)|large_intestine(11)|liver(92)|lung(365)|meninges(18)|oesophagus(239)|ovary(98)|pancreas(263)|pleura(94)|prostate(13)|salivary_gland(10)|skin(541)|small_intestine(1)|soft_tissue(93)|stomach(48)|thymus(4)|thyroid(24)|upper_aerodigestive_tract(436)|urinary_tract(283)|vulva(2)	4199		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		GGGCAGCGCCCCCGCCTCCAGCAGCGCCCGCACCTC	0.731		17								HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)																											p.30_35del		.											.	CDKN2A-23992	1372	Whole gene deletion(1316)|Unknown(23)|Substitution - Missense(14)|Deletion - In frame(10)|Deletion - Frameshift(3)|Substitution - coding silent(3)|Substitution - Nonsense(2)|Insertion - Frameshift(1)	haematopoietic_and_lymphoid_tissue(279)|skin(176)|central_nervous_system(163)|lung(147)|urinary_tract(90)|bone(73)|soft_tissue(58)|oesophagus(56)|pleura(52)|upper_aerodigestive_tract(52)|pancreas(36)|ovary(35)|kidney(31)|breast(30)|thyroid(14)|biliary_tract(14)|NS(12)|stomach(12)|liver(8)|autonomic_ganglia(7)|meninges(7)|large_intestine(6)|salivary_gland(4)|thymus(4)|vulva(2)|endometrium(2)|prostate(2)	c.89_104del	GRCh37	CM065062|CM950225|CM950226	CDKN2A	M		.																																			SO:0001589	frameshift_variant	1029	exon1			AGCGCCCCCGCCT	L27211	CCDS6510.1, CCDS6511.1, CCDS6511.2, CCDS56565.1	9p21	2014-09-17	2012-03-08		ENSG00000147889	ENSG00000147889			1787	protein-coding gene	gene with protein product		600160	"""cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)"""	CDKN2, MLM		8152487, 7606716	Standard	NM_058195		Approved	CDK4I, p16, INK4a, MTS1, CMM2, ARF, p19, p14, INK4, p16INK4a, p19Arf	uc003zpk.3	P42771	OTTHUMG00000019686	ENST00000304494.5:c.89_104delCGCTGCTGGAGGCGGG	9.37:g.21974723_21974738delCCCGCCTCCAGCAGCG	ENSP00000307101:p.Ala30fs	Somatic	43	0		WXS	Illumina GAIIx	Phase_I	26	4	NM_058197	0	0	0	0	0	A5X2G7|D3DRK1|O95440|Q15191|Q5VVJ5|Q96B52|Q9NP05	Frame_Shift_Del	DEL	ENST00000304494.5	37	CCDS6510.1																																																																																			.		0.731	CDKN2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000051915.1	NM_000077	
ZCCHC6	79670	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	88938270	88938270	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr9:88938270C>T	ENST00000375963.3	-	13	2567	c.2395G>A	c.(2395-2397)Gag>Aag	p.E799K	ZCCHC6_ENST00000469004.1_5'Flank|ZCCHC6_ENST00000375960.2_Missense_Mutation_p.E676K|ZCCHC6_ENST00000277141.6_Missense_Mutation_p.E88K|ZCCHC6_ENST00000375961.2_Missense_Mutation_p.E799K	NM_001185059.1|NM_024617.3	NP_001171988.1|NP_078893.2	Q5VYS8	TUT7_HUMAN	zinc finger, CCHC domain containing 6	799					RNA 3'-end processing (GO:0031123)		poly(A) RNA binding (GO:0044822)|RNA uridylyltransferase activity (GO:0050265)|zinc ion binding (GO:0008270)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	46						CCCTCACACTCTTTAGCTGTG	0.438																																					p.E799K		.											.	ZCCHC6-92	0			c.G2395A						.						161.0	154.0	157.0					9																	88938270		2203	4300	6503	SO:0001583	missense	79670	exon13			CACACTCTTTAGC	AL832026	CCDS35057.1, CCDS55323.1	9q21	2014-03-05			ENSG00000083223	ENSG00000083223		"""Zinc fingers, CCHC domain containing"""	25817	protein-coding gene	gene with protein product	"""TUTase7"""					11214970	Standard	NM_001185059		Approved	KIAA1711, FLJ13409, PAPD6, TUT7	uc004aoq.3	Q5VYS8	OTTHUMG00000020137	ENST00000375963.3:c.2395G>A	9.37:g.88938270C>T	ENSP00000365130:p.Glu799Lys	Somatic	83	0		WXS	Illumina GAIIx	Phase_I	84	18	NM_024617	0	0	1	1	0	Q5H9T0|Q5VYS5|Q5VYS7|Q658Z9|Q659A2|Q6MZJ3|Q8N5F0|Q96N57|Q96NE8|Q9C0F2|Q9H8M6	Missense_Mutation	SNP	ENST00000375963.3	37	CCDS35057.1	.	.	.	.	.	.	.	.	.	.	C	12.43	1.934235	0.34096	.	.	ENSG00000083223	ENST00000277141;ENST00000375960;ENST00000375961;ENST00000375963	T;T;T;T	0.57436	0.4;0.61;0.72;0.75	5.39	2.51	0.30379	.	0.391434	0.26119	N	0.026236	T	0.36991	0.0987	L	0.29908	0.895	0.09310	N	1	B;B	0.15141	0.012;0.003	B;B	0.14578	0.011;0.002	T	0.24440	-1.0160	10	0.45353	T	0.12	-15.2906	8.1164	0.30946	0.0:0.624:0.2426:0.1334	.	676;799	Q5VYS8-4;Q5VYS8	.;TUT7_HUMAN	K	88;676;799;799	ENSP00000277141:E88K;ENSP00000365127:E676K;ENSP00000365128:E799K;ENSP00000365130:E799K	ENSP00000277141:E88K	E	-	1	0	ZCCHC6	88128090	0.012000	0.17670	0.000000	0.03702	0.092000	0.18411	1.304000	0.33482	0.386000	0.24997	-0.291000	0.09656	GAG	.		0.438	ZCCHC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052918.1	NM_024617	
CCDC180	100499483	broad.mit.edu	37	9	100079354	100079354	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr9:100079354A>C	ENST00000357054.1	+	23	2287	c.1352A>C	c.(1351-1353)aAc>aCc	p.N451T	RP11-23J9.4_ENST00000534123.1_RNA|CCDC180_ENST00000375202.2_Missense_Mutation_p.N312T|CCDC180_ENST00000395220.1_Missense_Mutation_p.N451T|CCDC180_ENST00000460482.2_3'UTR|CCDC180_ENST00000529487.1_Missense_Mutation_p.N312T|CCDC180_ENST00000411667.2_Missense_Mutation_p.N309T			Q9P1Z9	CC180_HUMAN	coiled-coil domain containing 180	451						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											CAGGTCATGAACTATGCCCTG	0.622																																					p.N312T		.											.	.	0			c.A935C						.						131.0	132.0	132.0					9																	100079354		2203	4300	6503	SO:0001583	missense	0	exon9			TCATGAACTATGC	AK123391	CCDS35077.1, CCDS35077.2	9q22.33	2013-03-08	2013-03-08	2013-03-08		ENSG00000197816			29303	protein-coding gene	gene with protein product	"""Behcet's Disease Associated Gene 1"""		"""KIAA1529"", ""chromosome 9 open reading frame 174"""	KIAA1529, C9orf174		10819331	Standard	NM_020893		Approved	DKFZp434I2420, BDAG1	uc004axg.2	Q9P1Z9	OTTHUMG00000167001	ENST00000357054.1:c.1352A>C	9.37:g.100079354A>C	ENSP00000349562:p.Asn451Thr	Somatic	105	0		WXS	Illumina GAIIx	Phase_I	93	4	NM_020893	0	0	0	0	0	Q2KHR6|Q5VV25|Q68DP5|Q69YV9|Q6AHY0	Missense_Mutation	SNP	ENST00000357054.1	37		.	.	.	.	.	.	.	.	.	.	A	15.90	2.969976	0.53614	.	.	ENSG00000197816	ENST00000357054;ENST00000395220;ENST00000375202;ENST00000411667;ENST00000541524;ENST00000529487	T;T;T;T;T	0.43688	0.94;0.94;0.94;0.94;0.94	5.28	5.28	0.74379	.	0.267764	0.38111	N	0.001811	T	0.62938	0.2469	M	0.78049	2.395	0.33763	D	0.622124	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.998;0.998;0.998	T	0.72969	-0.4130	10	0.36615	T	0.2	-32.4421	11.9078	0.52723	1.0:0.0:0.0:0.0	.	309;451;312;451	F5H149;B7ZMG3;Q9P1Z9-2;Q9P1Z9	.;.;.;CI174_HUMAN	T	451;451;312;309;335;312	ENSP00000349562:N451T;ENSP00000378646:N451T;ENSP00000364348:N312T;ENSP00000414000:N309T;ENSP00000434727:N312T	ENSP00000349562:N451T	N	+	2	0	C9orf174	99119175	1.000000	0.71417	1.000000	0.80357	0.834000	0.47266	4.968000	0.63728	2.144000	0.66660	0.460000	0.39030	AAC	.		0.622	CCDC180-201	KNOWN	basic	protein_coding	protein_coding		NM_020893	
GABBR2	9568	bcgsc.ca	37	9	101068580	101068580	+	Silent	SNP	G	G	A	rs2304389	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr9:101068580G>A	ENST00000259455.2	-	15	2511	c.2052C>T	c.(2050-2052)ccC>ccT	p.P684P		NM_005458.7	NP_005449.5	O75899	GABR2_HUMAN	gamma-aminobutyric acid (GABA) B receptor, 2	684					G-protein coupled receptor signaling pathway (GO:0007186)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|G-protein coupled receptor heterodimeric complex (GO:0038039)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled GABA receptor activity (GO:0004965)		NOTCH1_ENST00000277541/GABBR2(2)	breast(4)|endometrium(4)|large_intestine(12)|lung(21)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	49		Acute lymphoblastic leukemia(62;0.0527)			Baclofen(DB00181)	CGTTGAGTGCGGGGATGCTGA	0.557													G|||	970	0.19369	0.1815	0.2061	5008	,	,		19497	0.1925		0.17	False		,,,				2504	0.227				p.P684P		.											.	GABBR2-518	0			c.C2052T						.	G		737,3669	303.2+/-287.8	63,611,1529	119.0	80.0	93.0		2052	-10.3	0.1	9	dbSNP_100	93	1427,7173	273.0+/-290.4	122,1183,2995	no	coding-synonymous	GABBR2	NM_005458.7		185,1794,4524	AA,AG,GG		16.593,16.7272,16.6385		684/942	101068580	2164,10842	2203	4300	6503	SO:0001819	synonymous_variant	9568	exon15			GAGTGCGGGGATG	AF069755	CCDS6736.1	9q22.1-q22.3	2012-08-29	2006-02-16	2006-02-16	ENSG00000136928	ENSG00000136928		"""GABA receptors"", ""GPCR / Class C : GABA(B) receptors"""	4507	protein-coding gene	gene with protein product		607340	"""G protein-coupled receptor 51"""	GPR51		10087195	Standard	NM_005458		Approved	HG20, GABABR2, GPRC3B	uc004ays.3	O75899	OTTHUMG00000020345	ENST00000259455.2:c.2052C>T	9.37:g.101068580G>A		Somatic	424	1		WXS	Illumina GAIIx	Phase_I	378	10	NM_005458	0	0	0	0	0	O75974|O75975|Q5VXZ2|Q8WX04|Q9P1R2|Q9UNR1|Q9UNS9	Silent	SNP	ENST00000259455.2	37	CCDS6736.1																																																																																			G|0.831;A|0.169		0.557	GABBR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053373.1		
AKAP2	11217	hgsc.bcm.edu	37	9	112811038	112811038	+	Missense_Mutation	SNP	C	C	T	rs78923754	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr9:112811038C>T	ENST00000374525.1	+	1	63	c.59C>T	c.(58-60)cCg>cTg	p.P20L	AKAP2_ENST00000434623.2_Missense_Mutation_p.P20L|AKAP2_ENST00000555236.1_Intron|PALM2-AKAP2_ENST00000302798.7_Intron|PALM2-AKAP2_ENST00000374530.3_Intron|AKAP2_ENST00000510514.5_Intron	NM_001004065.4	NP_001004065.2	Q9Y2D5	AKAP2_HUMAN	A kinase (PRKA) anchor protein 2	374										breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	33						CCTGGACCCCCGGAGTCTCCT	0.776													-|||	379	0.0756789	0.0703	0.0879	5008	,	,		9335	0.0298		0.0954	False		,,,				2504	0.1012				p.P20L		.											.	AKAP2-24	0			c.C59T						.	C	LEU/PRO,LEU/PRO,,	146,2418		2,142,1138	2.0	3.0	2.0		59,59,,	0.3	0.0	9	dbSNP_132	2	557,5611		13,531,2540	no	missense,missense,intron,intron	AKAP2,PALM2-AKAP2	NM_001004065.4,NM_001198656.1,NM_007203.4,NM_147150.2	98,98,,	15,673,3678	TT,TC,CC		9.0305,5.6942,8.0508	,,,	20/949,20/962,,	112811038	703,8029	1282	3084	4366	SO:0001583	missense	11217	exon1			GACCCCCGGAGTC	AB023137	CCDS43861.1, CCDS48003.1, CCDS56581.1	9q31.3	2009-10-16			ENSG00000241978	ENSG00000241978		"""A-kinase anchor proteins"""	372	protein-coding gene	gene with protein product	"""protein kinase A2"""	604582		PRKA2		10231032	Standard	NM_001136562		Approved	AKAP-KL, KIAA0920, DKFZp564L0716		Q9Y2D5	OTTHUMG00000156811	ENST00000374525.1:c.59C>T	9.37:g.112811038C>T	ENSP00000363649:p.Pro20Leu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	12	8	NM_001004065	0	0	0	0	0	B1ALX9|B2RTU4|B3KQ00|B4DTZ2|B7ZW07|B9EJB5|Q9UG26	Missense_Mutation	SNP	ENST00000374525.1	37	CCDS43861.1	184	0.08424908424908426	48	0.0975609756097561	42	0.11602209944751381	16	0.027972027972027972	78	0.10290237467018469	-	6.449	0.450901	0.12223	0.056942	0.090305	ENSG00000241978	ENST00000434623;ENST00000374525	T;T	0.44482	1.5;0.92	3.3	0.302	0.15786	.	.	.	.	.	T	0.00412	0.0013	.	.	.	0.58432	P	5.000000000032756E-6	B;B	0.11235	0.001;0.004	B;B	0.04013	0.001;0.001	T	0.06972	-1.0797	7	0.72032	D	0.01	-9.3294	7.3755	0.26825	0.0:0.6472:0.0:0.3528	.	20;21	Q9Y2D5-7;B1ALY1	.;.	L	20	ENSP00000404782:P20L;ENSP00000363649:P20L	ENSP00000363649:P20L	P	+	2	0	AKAP2	111850859	0.208000	0.23494	0.001000	0.08648	0.000000	0.00434	0.026000	0.13599	-0.068000	0.12953	-1.980000	0.00456	CCG	C|0.917;T|0.083		0.776	AKAP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000053609.3	NM_001004065	
SNAPC4	6621	broad.mit.edu	37	9	139277995	139277997	+	In_Frame_Del	DEL	GCT	GCT	-	rs147271628|rs34427285|rs35266724|rs34222232	byFrequency	TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr9:139277995_139277997delGCT	ENST00000298532.2	-	15	1992_1994	c.1624_1626delAGC	c.(1624-1626)agcdel	p.S542del		NM_003086.2	NP_003077.2			small nuclear RNA activating complex, polypeptide 4, 190kDa									p.S542delS(2)		biliary_tract(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(3)|skin(2)|urinary_tract(1)	33		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.31e-06)|Epithelial(140;7.13e-06)		CGTCCTCCTCgctgctgctgctg	0.69														955	0.190695	0.1808	0.3184	5008	,	,		11493	0.0565		0.2356	False		,,,				2504	0.2055				p.542_542del		.											.	SNAPC4-90	2	Deletion - In frame(2)	prostate(1)|central_nervous_system(1)	c.1624_1626del						.																																			SO:0001651	inframe_deletion	6621	exon15			CTCCTCGCTGCTG	AF032387	CCDS6998.1	9q34.3	2008-07-21	2002-08-29		ENSG00000165684	ENSG00000165684			11137	protein-coding gene	gene with protein product		602777	"""small nuclear RNA activating complex, polypeptide 4, 190kD"""			9418884	Standard	XM_005266096		Approved	SNAP190, PTFalpha, FLJ13451	uc004chh.3	Q5SXM2	OTTHUMG00000020929	ENST00000298532.2:c.1624_1626delAGC	9.37:g.139278004_139278006delGCT	ENSP00000298532:p.Ser542del	Somatic	45	0		WXS	Illumina GAIIx	Phase_I	165	7	NM_003086	0	0	0	0	0		In_Frame_Del	DEL	ENST00000298532.2	37	CCDS6998.1																																																																																			.		0.690	SNAPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055071.1	NM_003086	
MAP3K15	389840	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	19428068	19428068	+	Silent	SNP	A	A	G			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chrX:19428068A>G	ENST00000338883.4	-	12	1721	c.1722T>C	c.(1720-1722)ttT>ttC	p.F574F	MAP3K15_ENST00000359173.3_Silent_p.F9F|MAP3K15_ENST00000469203.2_Silent_p.F406F|MAP3K15_ENST00000518578.1_5'UTR	NM_001001671.3	NP_001001671.3	Q6ZN16	M3K15_HUMAN	mitogen-activated protein kinase kinase kinase 15	574							ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)			NS(2)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(13)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	42	Hepatocellular(33;0.183)					AAGAGGCTGTAAAATTCCATT	0.303																																					p.F574F		.											.	MAP3K15-335	0			c.T1722C						.						125.0	113.0	117.0					X																	19428068		2202	4299	6501	SO:0001819	synonymous_variant	389840	exon12			GGCTGTAAAATTC	AK131412		Xp22.12	2011-06-09			ENSG00000180815	ENSG00000180815		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	31689	protein-coding gene	gene with protein product		300820					Standard	NM_001001671		Approved	bA723P2.3, FLJ16518	uc022btq.1	Q6ZN16	OTTHUMG00000022724	ENST00000338883.4:c.1722T>C	X.37:g.19428068A>G		Somatic	58	0		WXS	Illumina GAIIx	Phase_I	80	19	NM_001001671	0	0	5	5	0	A2AI49|A2AI50|A6NJ61|Q5JPR4|Q6ZMV3	Silent	SNP	ENST00000338883.4	37																																																																																				.		0.303	MAP3K15-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001001671	
SUPT20HL1	100130302	bcgsc.ca	37	X	24382429	24382443	+	IGR	DEL	CCTGCTCCTGCTCTA	CCTGCTCCTGCTCTA	-	rs113091397		TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	CCTGCTCCTGCTCTA	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chrX:24382429_24382443delCCTGCTCCTGCTCTA								AC004552.1 (15406 upstream) : PDK3 (100894 downstream)																							tgctgctgctcctgctcctgctctagctgctgctg	0.628																																					p.518_522del		.											.	.	0			c.1552_1566del						.																																			SO:0001628	intergenic_variant	100130302	exon1			GCTGCTCCTGCTC																													X.37:g.24382429_24382443delCCTGCTCCTGCTCTA		Somatic	310	0		WXS	Illumina GAIIx	Phase_I	257	92	NM_001136234	0	0	0	0	0		In_Frame_Del	DEL		37																																																																																				.	0	0.628								
SUPT20HL1	100130302	bcgsc.ca	37	X	24382453	24382453	+	IGR	SNP	G	G	C	rs112697166		TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chrX:24382453G>C								AC004552.1 (15430 upstream) : PDK3 (100884 downstream)																							agctgctgctgctgctcctgc	0.627																																					p.A526P		.											.	.	0			c.G1576C						.						2.0	2.0	2.0					X																	24382453		966	2386	3352	SO:0001628	intergenic_variant	100130302	exon1			GCTGCTGCTGCTC																													X.37:g.24382453G>C		Somatic	251	0		WXS	Illumina GAIIx	Phase_I	237	66	NM_001136234	0	0	0	0	0		Missense_Mutation	SNP		37																																																																																				G|0.500;C|0.500	0	0.627								
FAM47C	442444	broad.mit.edu	37	X	37028425	37028425	+	Missense_Mutation	SNP	A	A	G	rs145580328		TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chrX:37028425A>G	ENST00000358047.3	+	1	1994	c.1942A>G	c.(1942-1944)Aat>Gat	p.N648D		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	648								p.N648D(7)		breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						GGAGCCTCCCAATACTGGAGT	0.642																																					p.N648D		.											.	FAM47C-111	7	Substitution - Missense(7)	urinary_tract(2)|prostate(2)|lung(2)|skin(1)	c.A1942G						.						51.0	56.0	55.0					X																	37028425		2201	4299	6500	SO:0001583	missense	442444	exon1			CCTCCCAATACTG	AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.1942A>G	X.37:g.37028425A>G	ENSP00000367913:p.Asn648Asp	Somatic	98	0		WXS	Illumina GAIIx	Phase_I	107	3	NM_001013736	0	0	0	0	0	Q6ZU46	Missense_Mutation	SNP	ENST00000358047.3	37	CCDS35227.1	.	.	.	.	.	.	.	.	.	.	-	3.343	-0.134139	0.06711	.	.	ENSG00000198173	ENST00000358047	T	0.13196	2.61	1.61	-3.22	0.05125	.	.	.	.	.	T	0.04543	0.0124	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.38993	-0.9635	9	0.20519	T	0.43	.	0.6811	0.00875	0.2356:0.2078:0.3498:0.2069	.	648	Q5HY64	FA47C_HUMAN	D	648	ENSP00000367913:N648D	ENSP00000367913:N648D	N	+	1	0	FAM47C	36938346	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.937000	0.01547	-1.437000	0.01967	-1.178000	0.01721	AAT	A|1.000;G|0.000		0.642	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060508.1	NM_001013736	
UBQLN2	29978	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	56591776	56591776	+	Silent	SNP	C	C	G			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chrX:56591776C>G	ENST00000338222.5	+	1	1751	c.1470C>G	c.(1468-1470)ggC>ggG	p.G490G		NM_013444.3	NP_038472.2	Q9UHD9	UBQL2_HUMAN	ubiquilin 2	490					cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|endometrium(3)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(1)	21						CCGCTATAGGCCCTGTAGGCC	0.622																																					p.G490G	Esophageal Squamous(104;218 1492 6022 10838 28884)	.											.	UBQLN2-131	0			c.C1470G						.						19.0	18.0	19.0					X																	56591776		2203	4298	6501	SO:0001819	synonymous_variant	29978	exon1			TATAGGCCCTGTA	AF189009	CCDS14374.1	Xp11.21	2014-09-17			ENSG00000188021	ENSG00000188021		"""Ubiquilin family"""	12509	protein-coding gene	gene with protein product	"""NEDD4 binding protein 4"""	300264				10675567	Standard	NM_013444		Approved	Chap1, Dsk2, RIHFB2157, LIC-2, CHAP1/DSK2, PLIC-2, N4BP4, PLIC2	uc004dus.3	Q9UHD9	OTTHUMG00000021669	ENST00000338222.5:c.1470C>G	X.37:g.56591776C>G		Somatic	88	0		WXS	Illumina GAIIx	Phase_I	69	21	NM_013444	0	0	40	40	0	O94798|Q5D027|Q9H3W6|Q9HAZ4	Silent	SNP	ENST00000338222.5	37	CCDS14374.1																																																																																			.		0.622	UBQLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056891.1	NM_013444	
Unknown	0	bcgsc.ca	37	X	71379853	71379853	+	IGR	SNP	C	C	T	rs7880917		TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chrX:71379853C>T								BX119917.1 (7589 upstream) : PIN4 (21672 downstream)																							GAAATGCCTCCGCTGAAGGCC	0.498													C|||	1372	0.363444	0.2156	0.389	3775	,	,		15788	0.0317		0.5517	False		,,,				2504	0.2352				p.S58S		.											.	FLJ44635-108	0			c.C174T						.	C		1215,2620		162,711,180,759,391	96.0	84.0	88.0		174	0.5	0.2	X	dbSNP_116	88	4972,1756		1355,902,1360,171,512	no	coding-synonymous	FLJ44635	NM_207422.2		1517,1613,1540,930,903	TT,TC,T,CC,C		26.0999,31.6819,41.4276		58/141	71379853	6187,4376	2203	4300	6503	SO:0001628	intergenic_variant	0	exon2			TGCCTCCGCTGAA																													X.37:g.71379853C>T		Somatic	381	2		WXS	Illumina GAIIx	Phase_I	355	9	NM_207422	0	0	3	3	0		Silent	SNP		37																																																																																				C|0.581;T|0.419	0	0.498								
RBM41	55285	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	106358708	106358708	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chrX:106358708G>A	ENST00000372479.3	-	4	427	c.397C>T	c.(397-399)Cgc>Tgc	p.R133C	RBM41_ENST00000471079.1_5'UTR|RBM41_ENST00000203616.8_Missense_Mutation_p.R133C|RBM41_ENST00000372487.1_Missense_Mutation_p.R133C	NM_018301.3	NP_060771.3	Q96IZ5	RBM41_HUMAN	RNA binding motif protein 41	133							nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	13						CAAAGAATGCGCTGACGCTCC	0.458																																					p.R133C		.											.	RBM41-131	0			c.C397T						.						134.0	118.0	123.0					X																	106358708		2203	4300	6503	SO:0001583	missense	55285	exon4			GAATGCGCTGACG	BC006986	CCDS14526.1, CCDS55472.1	Xq22.3	2013-02-12			ENSG00000089682	ENSG00000089682		"""RNA binding motif (RRM) containing"""	25617	protein-coding gene	gene with protein product						12477932	Standard	NM_001171080		Approved	FLJ11016	uc004emz.3	Q96IZ5	OTTHUMG00000022156	ENST00000372479.3:c.397C>T	X.37:g.106358708G>A	ENSP00000361557:p.Arg133Cys	Somatic	121	1		WXS	Illumina GAIIx	Phase_I	107	50	NM_001171080	0	0	1	1	0	Q5JSN7|Q5JSN8|Q9H8F7|Q9NV04	Missense_Mutation	SNP	ENST00000372479.3	37	CCDS14526.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.09|19.09	3.759239|3.759239	0.69763|0.69763	.|.	.|.	ENSG00000089682|ENSG00000089682	ENST00000434854|ENST00000372487;ENST00000372479;ENST00000203616;ENST00000372482	.|T;T	.|0.28069	.|1.63;1.69	5.33|5.33	5.33|5.33	0.75918|0.75918	.|.	.|0.188253	.|0.48286	.|D	.|0.000184	T|T	0.28699|0.28699	0.0711|0.0711	N|N	0.19112|0.19112	0.55|0.55	0.53005|0.53005	D|D	0.999963|0.999963	.|D	.|0.63046	.|0.992	.|P	.|0.49421	.|0.61	T|T	0.07635|0.07635	-1.0762|-1.0762	5|10	.|0.87932	.|D	.|0	.|.	13.3554|13.3554	0.60625|0.60625	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|133	.|Q96IZ5	.|RBM41_HUMAN	V|C	130|133	.|ENSP00000361565:R133C;ENSP00000361557:R133C	.|ENSP00000203616:R133C	A|R	-|-	2|1	0|0	RBM41|RBM41	106245364|106245364	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.985000|0.985000	0.73830|0.73830	4.652000|4.652000	0.61454|0.61454	2.216000|2.216000	0.71823|0.71823	0.468000|0.468000	0.43344|0.43344	GCG|CGC	.		0.458	RBM41-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057819.1	NM_018301	
PAK3	5063	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	110395637	110395637	+	Splice_Site	SNP	G	G	A			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chrX:110395637G>A	ENST00000372010.1	+	9	917		c.e9-1		PAK3_ENST00000519681.1_Splice_Site|PAK3_ENST00000360648.4_Splice_Site|PAK3_ENST00000372007.5_Splice_Site|PAK3_ENST00000518291.1_Splice_Site|PAK3_ENST00000262836.4_Splice_Site|PAK3_ENST00000417227.1_Splice_Site|PAK3_ENST00000446737.1_Splice_Site|PAK3_ENST00000425146.1_Splice_Site			O75914	PAK3_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 3						activation of MAPK activity (GO:0000187)|axonogenesis (GO:0007409)|dendrite development (GO:0016358)|dendritic spine morphogenesis (GO:0060997)|MAPK cascade (GO:0000165)|regulation of actin filament polymerization (GO:0030833)|synapse organization (GO:0050808)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(15)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	41						TCACTTTGCAGATAAAAGTGC	0.323										TSP Lung(19;0.15)																											.		.											.	PAK3-1043	0			c.431-1G>A						.						83.0	74.0	77.0					X																	110395637		2203	4299	6502	SO:0001630	splice_region_variant	5063	exon6			TTTGCAGATAAAA	AF068864	CCDS14554.1, CCDS48151.1, CCDS48152.1, CCDS48153.1	Xq22.3	2008-06-17	2008-06-17		ENSG00000077264	ENSG00000077264			8592	protein-coding gene	gene with protein product		300142	"""mental retardation, X-linked 47"", ""p21 (CDKN1A)-activated kinase 3"""	MRX30, MRX47		8826460, 9731525	Standard	NM_002578		Approved	hPAK3, bPAK	uc010npv.1	O75914	OTTHUMG00000022202	ENST00000372010.1:c.476-1G>A	X.37:g.110395637G>A		Somatic	164	0		WXS	Illumina GAIIx	Phase_I	116	37	NM_001128166	0	0	0	0	0	A8K389|B1GX77|B1GX78|B1GX79|Q5JWX1|Q5JWX2|Q7Z2D6|Q7Z2E4|Q7Z3Z8|Q8WWK5|Q8WX23|Q9P0J8	Splice_Site	SNP	ENST00000372010.1	37	CCDS48153.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.953396	0.73902	.	.	ENSG00000077264	ENST00000446737;ENST00000425146;ENST00000372010;ENST00000519681;ENST00000372007;ENST00000518291;ENST00000429193;ENST00000360648;ENST00000417227;ENST00000262836	.	.	.	5.45	5.45	0.79879	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.36	0.90372	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PAK3	110282293	1.000000	0.71417	1.000000	0.80357	0.861000	0.49209	8.849000	0.92178	2.275000	0.75901	0.600000	0.82982	.	.		0.323	PAK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057918.1	NM_002578	Intron
AVPR2	554	broad.mit.edu	37	X	153171451	153171451	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chrX:153171451G>T	ENST00000358927.2	+	3	700	c.491G>T	c.(490-492)tGg>tTg	p.W164L	AVPR2_ENST00000370049.1_Missense_Mutation_p.W164L|AVPR2_ENST00000337474.5_Missense_Mutation_p.W164L			P30518	V2R_HUMAN	arginine vasopressin receptor 2	164			W -> S (in XNDI).		activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|excretion (GO:0007588)|hemostasis (GO:0007599)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|interferon-gamma production (GO:0032609)|negative regulation of renal sodium excretion (GO:0035814)|negative regulation of urine volume (GO:0035811)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of systemic arterial blood pressure (GO:0003084)|response to cytokine (GO:0034097)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	vasopressin receptor activity (GO:0005000)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|skin(1)	26	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)				Conivaptan(DB00872)|Desmopressin(DB00035)|Terlipressin(DB02638)|Tolvaptan(DB06212)|Vasopressin(DB00067)	CTAGTGGCTTGGGCCTTCTCG	0.662																																					p.W164L		.											.	AVPR2-625	0			c.G491T	GRCh37	CM940156	AVPR2	M		.						49.0	37.0	41.0					X																	153171451		2203	4300	6503	SO:0001583	missense	554	exon2			TGGCTTGGGCCTT	Z11687	CCDS14735.1, CCDS55539.1	Xq28	2014-09-17	2008-08-01		ENSG00000126895	ENSG00000126895		"""GPCR / Class A : Vasopressin and oxytocin receptors"""	897	protein-coding gene	gene with protein product	"""nephrogenic diabetes insipidus"""	300538		DIR3, DIR		1324225	Standard	NM_000054		Approved	V2R	uc004fjh.4	P30518	OTTHUMG00000024227	ENST00000358927.2:c.491G>T	X.37:g.153171451G>T	ENSP00000351805:p.Trp164Leu	Somatic	66	10		WXS	Illumina GAIIx	Phase_I	79	12	NM_001146151	0	0	0	0	0	C5HF20|O43192|Q3MJD3|Q9UCV9	Missense_Mutation	SNP	ENST00000358927.2	37	CCDS14735.1	.	.	.	.	.	.	.	.	.	.	g	19.48	3.835267	0.71373	.	.	ENSG00000126895	ENST00000358927;ENST00000430697;ENST00000337474;ENST00000370049	D;D;D;D	0.88741	-2.42;-2.42;-2.42;-2.42	3.74	3.74	0.42951	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.96324	0.8801	H	0.97315	3.98	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97702	1.0185	10	0.87932	D	0	-17.4968	14.3563	0.66740	0.0:0.0:1.0:0.0	.	164;164	P30518-2;P30518	.;V2R_HUMAN	L	164	ENSP00000351805:W164L;ENSP00000393513:W164L;ENSP00000338072:W164L;ENSP00000359066:W164L	ENSP00000338072:W164L	W	+	2	0	AVPR2	152824645	1.000000	0.71417	1.000000	0.80357	0.686000	0.39977	7.872000	0.87187	1.811000	0.52892	0.279000	0.19357	TGG	.		0.662	AVPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061127.2		
SHANK3	85358	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	22	51144507	51144508	+	Frame_Shift_Ins	INS	-	-	C			TCGA-OR-A5JM-01A-11D-A29I-10	TCGA-OR-A5JM-10B-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a8935e4c-a863-4168-82a5-bcaaaf194e6d	4f8cbee5-63de-4167-8bd7-530ad1d3d2a0	g.chr22:51144507_51144508insC	ENST00000414786.2	+	17	2222_2223	c.1995_1996insC	c.(1996-1998)cccfs	p.P666fs	SHANK3_ENST00000262795.3_Frame_Shift_Ins_p.P696fs|SHANK3_ENST00000445220.2_Frame_Shift_Ins_p.P681fs			Q9BYB0	SHAN3_HUMAN	SH3 and multiple ankyrin repeat domains 3	680					adult behavior (GO:0030534)|alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|brain morphogenesis (GO:0048854)|dendritic spine morphogenesis (GO:0060997)|guanylate kinase-associated protein clustering (GO:0097117)|learning (GO:0007612)|MAPK cascade (GO:0000165)|memory (GO:0007613)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of actin filament bundle assembly (GO:0032232)|negative regulation of cell volume (GO:0045794)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of glutamate receptor signaling pathway (GO:1900451)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse structural plasticity (GO:0051835)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density assembly (GO:0097107)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of long term synaptic depression (GO:1900452)|regulation of long-term synaptic potentiation (GO:1900271)|social behavior (GO:0035176)|striatal medium spiny neuron differentiation (GO:0021773)|synapse assembly (GO:0007416)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|neuron spine (GO:0044309)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(5)	8		all_cancers(38;3.75e-11)|all_epithelial(38;1.82e-09)|Breast(42;0.000448)|all_lung(38;0.000665)|Lung NSC(38;0.0104)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		BRCA - Breast invasive adenocarcinoma(115;0.22)		CAGCCCCACCGCCCCCCAAGAG	0.688																																					p.P665fs		.											.	SHANK3-69	0			c.1995_1996insC						.																																			SO:0001589	frameshift_variant	85358	exon17			CCCACCGCCCCCC	AB051437		22q13.3	2013-11-14			ENSG00000251322	ENSG00000251322		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14294	protein-coding gene	gene with protein product	"""proline rich synapse associated protein 2"", ""shank postsynaptic density protein"""	606230				11258795, 11431708, 10806096, 17173049	Standard	NM_033517		Approved	SPANK-2, prosap2, KIAA1650, PSAP2	uc031ryd.1	Q9BYB0	OTTHUMG00000150169	ENST00000414786.2:c.2001dupC	22.37:g.51144513_51144513dupC	ENSP00000464552:p.Pro666fs	Somatic	96	0		WXS	Illumina GAIIx	Phase_I	112	38	NM_033517	0	0	0	0	0	D7UT47|Q8TET3	Frame_Shift_Ins	INS	ENST00000414786.2	37																																																																																				.		0.688	SHANK3-001	KNOWN	non_canonical_polymorphism|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000316674.2	NM_001080420	
