#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
C1orf159	54991	broad.mit.edu	37	1	1019753	1019753	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr1:1019753A>G	ENST00000379339.1	-	11	800	c.590T>C	c.(589-591)aTc>aCc	p.I197T	C1orf159_ENST00000379320.1_Missense_Mutation_p.I161T|C1orf159_ENST00000421241.2_Missense_Mutation_p.I161T|C1orf159_ENST00000482816.1_5'UTR|C1orf159_ENST00000294576.5_Missense_Mutation_p.I161T|C1orf159_ENST00000448924.1_Missense_Mutation_p.I197T|C1orf159_ENST00000379319.1_Missense_Mutation_p.I161T			Q96HA4	CA159_HUMAN	chromosome 1 open reading frame 159	197						integral component of membrane (GO:0016021)						all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;2.96e-36)|OV - Ovarian serous cystadenocarcinoma(86;1.77e-22)|Colorectal(212;6.51e-05)|COAD - Colon adenocarcinoma(227;0.000214)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|Kidney(185;0.00254)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.037)|Lung(427;0.205)		TGGCGGGGGGATCATTGCAGC	0.622																																					p.I161T		.											.	.	0			c.T482C						.						28.0	30.0	30.0					1																	1019753		2201	4298	6499	SO:0001583	missense	54991	exon9			GGGGGGATCATTG	AK128434	CCDS7.2	1p36.33	2008-02-05			ENSG00000131591	ENSG00000131591			26062	protein-coding gene	gene with protein product						12975309	Standard	NM_017891		Approved	FLJ20584	uc001acu.2	Q96HA4	OTTHUMG00000000745	ENST00000379339.1:c.590T>C	1.37:g.1019753A>G	ENSP00000368644:p.Ile197Thr	Somatic	47	7		WXS	Illumina GAIIx	Phase_I	47	8	NM_017891	0	0	0	0	0	B3KQ46|Q5T2W6|Q6UX67|Q6ZR77|Q9NWV0	Missense_Mutation	SNP	ENST00000379339.1	37		.	.	.	.	.	.	.	.	.	.	A	15.32	2.797716	0.50208	.	.	ENSG00000131591	ENST00000379339;ENST00000448924;ENST00000294576;ENST00000421241;ENST00000379320;ENST00000379319;ENST00000434641;ENST00000457999	.	.	.	3.66	3.66	0.41972	.	0.190179	0.42964	D	0.000633	T	0.66665	0.2812	L	0.59436	1.845	0.80722	D	1	P;D;D;D	0.65815	0.936;0.995;0.96;0.995	P;P;P;P	0.61003	0.654;0.882;0.523;0.844	T	0.70004	-0.4991	9	0.87932	D	0	-23.4528	10.5642	0.45163	1.0:0.0:0.0:0.0	.	161;197;161;161	Q5T2W7;Q96HA4;Q96HA4-4;Q5T2W9	.;CA159_HUMAN;.;.	T	197;197;161;161;161;161;161;172	.	ENSP00000294576:I161T	I	-	2	0	C1orf159	1009616	0.631000	0.27164	0.990000	0.47175	0.962000	0.63368	1.572000	0.36461	1.651000	0.50673	0.459000	0.35465	ATC	.		0.622	C1orf159-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000001851.2	NM_017891	
SRM	6723	hgsc.bcm.edu	37	1	11119899	11119899	+	Silent	SNP	T	T	C	rs7545802		TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr1:11119899T>C	ENST00000376957.2	-	1	182	c.102A>G	c.(100-102)tcA>tcG	p.S34S		NM_003132.2	NP_003123.2	P19623	SPEE_HUMAN	spermidine synthase	34	PABS.				cellular nitrogen compound metabolic process (GO:0034641)|polyamine metabolic process (GO:0006595)|small molecule metabolic process (GO:0044281)|spermidine biosynthetic process (GO:0008295)	cytosol (GO:0005829)	protein homodimerization activity (GO:0042803)|spermidine synthase activity (GO:0004766)			large_intestine(1)|lung(1)|urinary_tract(1)	3	Ovarian(185;0.249)	Lung NSC(185;1.74e-05)|all_lung(284;2.05e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.228)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.14e-07)|COAD - Colon adenocarcinoma(227;7.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000294)|Kidney(185;0.000728)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|READ - Rectum adenocarcinoma(331;0.0487)|STAD - Stomach adenocarcinoma(313;0.192)	S-Adenosylmethionine(DB00118)	CCACCTGCAGTGACAGGGCCT	0.761													C|||	5008	1.0	1.0	1.0	5008	,	,		7294	1.0		1.0	False		,,,				2504	1.0				p.S34S		.											.	SRM-90	0			c.A102G						.						8.0	10.0	10.0					1																	11119899		1613	3461	5074	SO:0001819	synonymous_variant	6723	exon1			CTGCAGTGACAGG	BC033106	CCDS125.1	1p36-p22	2010-11-08			ENSG00000116649	ENSG00000116649	2.5.1.16		11296	protein-coding gene	gene with protein product		182891		SRML1		2344393	Standard	NM_003132		Approved	SPS1	uc001arz.1	P19623	OTTHUMG00000002119	ENST00000376957.2:c.102A>G	1.37:g.11119899T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_003132	0	0	0	44	44	B1AKP9|Q15511	Silent	SNP	ENST00000376957.2	37	CCDS125.1																																																																																			T|0.001;C|0.999		0.761	SRM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006056.1	NM_003132	
UBR4	23352	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	19518980	19518980	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr1:19518980C>A	ENST00000375254.3	-	10	1225	c.1198G>T	c.(1198-1200)Ggt>Tgt	p.G400C	UBR4_ENST00000375267.2_Missense_Mutation_p.G400C|UBR4_ENST00000375217.2_Missense_Mutation_p.G400C|UBR4_ENST00000375226.2_Missense_Mutation_p.G400C	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	400					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		CTTACCTCACCACCAGCCCGG	0.403																																					p.G400C		.											.	UBR4-612	0			c.G1198T						.						94.0	85.0	88.0					1																	19518980		2203	4300	6503	SO:0001583	missense	23352	exon10			CCTCACCACCAGC	AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.1198G>T	1.37:g.19518980C>A	ENSP00000364403:p.Gly400Cys	Somatic	179	0		WXS	Illumina GAIIx	Phase_I	210	17	NM_020765	0	0	0	0	0	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Missense_Mutation	SNP	ENST00000375254.3	37	CCDS189.1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.804827	0.90623	.	.	ENSG00000127481	ENST00000375254;ENST00000375267;ENST00000375217;ENST00000375226	T;T;T;T	0.34472	1.4;1.39;1.37;1.36	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.56761	0.2007	L	0.50333	1.59	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.56920	-0.7899	10	0.72032	D	0.01	.	18.1764	0.89762	0.0:1.0:0.0:0.0	.	400	Q5T4S7	UBR4_HUMAN	C	400	ENSP00000364403:G400C;ENSP00000364416:G400C;ENSP00000364365:G400C;ENSP00000364374:G400C	ENSP00000364365:G400C	G	-	1	0	UBR4	19391567	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	7.440000	0.80464	2.630000	0.89119	0.591000	0.81541	GGT	.		0.403	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007085.1	NM_020765	
HSPG2	3339	hgsc.bcm.edu;broad.mit.edu	37	1	22191465	22191467	+	In_Frame_Del	DEL	GGA	GGA	-	rs557975423		TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	GGA	GGA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr1:22191465_22191467delGGA	ENST00000374695.3	-	36	4574_4576	c.4495_4497delTCC	c.(4495-4497)tccdel	p.S1499del		NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	1499	Laminin IV type A 3. {ECO:0000255|PROSITE-ProRule:PRU00458}.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	CCAGCGGCACGGAGGAGAACGTG	0.714																																					p.1499_1499del		.											.	HSPG2-141	0			c.4495_4497del						.																																			SO:0001651	inframe_deletion	3339	exon36			CGGCACGGAGGAG	M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.4495_4497delTCC	1.37:g.22191468_22191470delGGA	ENSP00000363827:p.Ser1499del	Somatic	10	0		WXS	Illumina GAIIx	Phase_I	96	29	NM_005529	0	0	0	0	0	Q16287|Q5SZI3|Q9H3V5	In_Frame_Del	DEL	ENST00000374695.3	37	CCDS30625.1																																																																																			.		0.714	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007598.1	NM_005529	
OPRD1	4985	hgsc.bcm.edu	37	1	29138975	29138975	+	Missense_Mutation	SNP	G	G	T	rs1042114	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr1:29138975G>T	ENST00000234961.2	+	1	322	c.80G>T	c.(79-81)tGc>tTc	p.C27F		NM_000911.3	NP_000902.3	P41143	OPRD_HUMAN	opioid receptor, delta 1	27			C -> F (improved maturation and increased expression at the cell surface; dbSNP:rs1042114). {ECO:0000269|PubMed:10982041, ECO:0000269|PubMed:8201839, ECO:0000269|Ref.4}.		adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adult locomotory behavior (GO:0008344)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|cellular response to toxic substance (GO:0097237)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|immune response (GO:0006955)|negative regulation of gene expression (GO:0010629)|negative regulation of protein oligomerization (GO:0032460)|neuropeptide signaling pathway (GO:0007218)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein import into nucleus, translocation (GO:0000060)|regulation of calcium ion transport (GO:0051924)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of sensory perception of pain (GO:0051930)	axon terminus (GO:0043679)|cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	enkephalin receptor activity (GO:0038046)|opioid receptor activity (GO:0004985)			breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15		Colorectal(325;3.46e-05)|Lung NSC(340;0.000947)|all_lung(284;0.00131)|Renal(390;0.00758)|Breast(348;0.00765)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;1.29e-07)|COAD - Colon adenocarcinoma(152;7.51e-06)|STAD - Stomach adenocarcinoma(196;0.00306)|BRCA - Breast invasive adenocarcinoma(304;0.0241)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)	Alvimopan(DB06274)|Amitriptyline(DB00321)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diphenoxylate(DB01081)|Fentanyl(DB00813)|Heroin(DB01452)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levorphanol(DB00854)|Loperamide(DB00836)|Methadone(DB00333)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	CCTAGCGCCTGCCCCAGCGCT	0.771													T|||	4730	0.944489	0.9796	0.9193	5008	,	,		9147	1.0		0.8678	False		,,,				2504	0.9366				p.C27F		.											.	OPRD1-69	0			c.G80T						.	T	PHE/CYS	3689,115		1788,113,1	4.0	6.0	5.0	http://www.ncbi.nlm.nih.gov/omim/103780,165195|http://omim.org/entry/165195|http://omim.org/entry/103780	80	2.9	1.0	1	dbSNP_86	5	6762,846		2982,798,24	no	missense	OPRD1	NM_000911.3	205	4770,911,25	TT,TG,GG		11.1199,3.0231,8.421	benign	27/373	29138975	10451,961	1902	3804	5706	SO:0001583	missense	4985	exon1			GCGCCTGCCCCAG	U10504	CCDS329.1	1p36.1-p34.3	2012-08-08			ENSG00000116329	ENSG00000116329		"""GPCR / Class A : Opioid receptors"""	8153	protein-coding gene	gene with protein product		165195				8415697	Standard	NM_000911		Approved		uc001brf.1	P41143	OTTHUMG00000003646	ENST00000234961.2:c.80G>T	1.37:g.29138975G>T	ENSP00000234961:p.Cys27Phe	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_000911	0	0	0	0	0	B5B0B8	Missense_Mutation	SNP	ENST00000234961.2	37	CCDS329.1	2035	0.9317765567765568	474	0.9634146341463414	331	0.914364640883978	572	1.0	658	0.8680738786279684	T	0.016	-1.513433	0.00975	0.969769	0.888801	ENSG00000116329	ENST00000234961;ENST00000536280	T	0.67698	-0.28	4.0	2.89	0.33648	.	1.802200	0.02327	N	0.073605	T	0.00012	0.0000	N	0.01874	-0.695	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.41342	-0.9514	9	0.09338	T	0.73	.	3.8109	0.08796	0.0:0.1144:0.2238:0.6618	rs1042114;rs59349662;rs1042114	27	P41143	OPRD_HUMAN	F	27	ENSP00000234961:C27F	ENSP00000234961:C27F	C	+	2	0	OPRD1	29011562	0.002000	0.14202	0.992000	0.48379	0.116000	0.19942	0.521000	0.22893	0.713000	0.32060	-0.694000	0.03704	TGC	G|0.061;T|0.939		0.771	OPRD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010330.1	NM_000911	
TIE1	7075	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	43779576	43779576	+	Silent	SNP	C	C	A			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr1:43779576C>A	ENST00000372476.3	+	14	2425	c.2346C>A	c.(2344-2346)acC>acA	p.T782T	TIE1_ENST00000433781.2_Silent_p.T427T|TIE1_ENST00000473014.1_3'UTR	NM_001253357.1|NM_005424.4	NP_001240286.1|NP_005415.1	P35590	TIE1_HUMAN	tyrosine kinase with immunoglobulin-like and EGF-like domains 1	782					angiogenesis (GO:0001525)|in utero embryonic development (GO:0001701)|mesoderm development (GO:0007498)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|peptidyl-tyrosine phosphorylation (GO:0018108)|plasma membrane fusion (GO:0045026)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(8)|lung(28)|ovary(3)|prostate(2)|salivary_gland(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	70	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				CCCTTTTAACCCTGGTGTGCA	0.647																																					p.T782T		.											.	TIE1-1404	0			c.C2346A						.						78.0	71.0	74.0					1																	43779576		2203	4300	6503	SO:0001819	synonymous_variant	7075	exon14			TTTAACCCTGGTG	BC038239	CCDS482.1	1p34-p33	2013-02-11	2004-12-13	2004-12-14	ENSG00000066056	ENSG00000066056	2.7.10.1	"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	11809	protein-coding gene	gene with protein product		600222	"""tyrosine kinase with immunoglobulin and epidermal growth factor homology domains 1"""	TIE		1312667	Standard	NM_005424		Approved	JTK14	uc001ciu.3	P35590	OTTHUMG00000007282	ENST00000372476.3:c.2346C>A	1.37:g.43779576C>A		Somatic	174	0		WXS	Illumina GAIIx	Phase_I	300	25	NM_005424	0	0	1	1	0	B5A949|B5A950	Silent	SNP	ENST00000372476.3	37	CCDS482.1																																																																																			.		0.647	TIE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019011.1	NM_005424	
C1orf87	127795	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	60499262	60499262	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr1:60499262C>A	ENST00000371201.3	-	7	1022	c.915G>T	c.(913-915)ttG>ttT	p.L305F	C1orf87_ENST00000450089.2_Intron	NM_152377.2	NP_689590.1	Q8N0U7	CA087_HUMAN	chromosome 1 open reading frame 87	305							calcium ion binding (GO:0005509)			breast(2)|endometrium(2)|large_intestine(6)|lung(19)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	33						TCAAAATCTCCAACAGACTCC	0.478																																					p.L305F	NSCLC(75;811 1386 4923 13371 51772)	.											.	C1orf87-154	0			c.G915T						.						180.0	165.0	170.0					1																	60499262		2203	4300	6503	SO:0001583	missense	127795	exon7			AATCTCCAACAGA	AK124828	CCDS614.1	1p32.1	2014-04-03			ENSG00000162598	ENSG00000162598			28547	protein-coding gene	gene with protein product	"""carcinoma-related EF-hand protein"""					12477932	Standard	NM_152377		Approved	MGC34837, CREF	uc001czs.2	Q8N0U7	OTTHUMG00000008992	ENST00000371201.3:c.915G>T	1.37:g.60499262C>A	ENSP00000360244:p.Leu305Phe	Somatic	135	0		WXS	Illumina GAIIx	Phase_I	150	24	NM_152377	0	0	0	0	0	Q6ZU07|Q8IVS0	Missense_Mutation	SNP	ENST00000371201.3	37	CCDS614.1	.	.	.	.	.	.	.	.	.	.	C	13.40	2.225234	0.39300	.	.	ENSG00000162598	ENST00000371201	T	0.24538	1.85	5.11	-0.726	0.11170	EF-hand-like domain (1);	0.891618	0.09356	N	0.813405	T	0.28632	0.0709	M	0.61703	1.905	0.09310	N	1	P	0.52061	0.95	P	0.51355	0.667	T	0.20338	-1.0278	10	0.35671	T	0.21	-0.2744	0.8677	0.01207	0.1593:0.3649:0.1554:0.3204	.	305	Q8N0U7	CA087_HUMAN	F	305	ENSP00000360244:L305F	ENSP00000360244:L305F	L	-	3	2	C1orf87	60271850	0.075000	0.21258	0.093000	0.20910	0.185000	0.23345	0.060000	0.14342	0.221000	0.20879	-0.150000	0.13652	TTG	.		0.478	C1orf87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024943.1	NM_152377	
LRRC7	57554	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	70493957	70493957	+	Missense_Mutation	SNP	G	G	A	rs375559029		TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr1:70493957G>A	ENST00000035383.5	+	16	1814	c.1784G>A	c.(1783-1785)cGt>cAt	p.R595H	LRRC7_ENST00000415775.2_Intron|RP11-181B18.1_ENST00000414132.1_RNA|LRRC7_ENST00000310961.5_Missense_Mutation_p.R600H	NM_020794.2	NP_065845.1	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	595						cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)				breast(11)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(3)|lung(81)|ovary(9)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	162						CATGGAGTGCGTGTTGAGAAT	0.408																																					p.R595H		.											.	LRRC7-163	0			c.G1784A						.	G	HIS/ARG	0,4406		0,0,2203	93.0	94.0	94.0		1784	6.1	1.0	1		94	1,8599	1.2+/-3.3	0,1,4299	no	missense	LRRC7	NM_020794.2	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	595/1538	70493957	1,13005	2203	4300	6503	SO:0001583	missense	57554	exon16			GAGTGCGTGTTGA		CCDS645.1	1p31.1	2008-02-05			ENSG00000033122	ENSG00000033122			18531	protein-coding gene	gene with protein product		614453				12525888	Standard	NM_020794		Approved	KIAA1365, densin-180	uc001dep.3	Q96NW7	OTTHUMG00000059194	ENST00000035383.5:c.1784G>A	1.37:g.70493957G>A	ENSP00000035383:p.Arg595His	Somatic	203	1		WXS	Illumina GAIIx	Phase_I	211	43	NM_020794	0	0	0	0	0	Q5VXC2|Q5VXC3|Q68D07|Q86VE8|Q8WX20|Q9P2I2	Missense_Mutation	SNP	ENST00000035383.5	37	CCDS645.1	.	.	.	.	.	.	.	.	.	.	G	14.98	2.695966	0.48202	0.0	1.16E-4	ENSG00000033122	ENST00000310961;ENST00000035383;ENST00000370957	T;T	0.37915	1.17;1.24	6.06	6.06	0.98353	.	0.293833	0.38548	N	0.001652	T	0.13415	0.0325	N	0.14661	0.345	0.80722	D	1	B	0.12630	0.006	B	0.04013	0.001	T	0.03112	-1.1071	10	0.44086	T	0.13	.	15.145	0.72643	0.0:0.1405:0.8595:0.0	.	595	Q96NW7	LRRC7_HUMAN	H	600;595;418	ENSP00000309245:R600H;ENSP00000035383:R595H	ENSP00000035383:R595H	R	+	2	0	LRRC7	70266545	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.627000	0.61276	2.880000	0.98712	0.650000	0.86243	CGT	.		0.408	LRRC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131261.1	NM_020794	
COL11A1	1301	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	103487285	103487285	+	Missense_Mutation	SNP	C	C	G	rs541227218		TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr1:103487285C>G	ENST00000370096.3	-	9	1598	c.1286G>C	c.(1285-1287)gGa>gCa	p.G429A	COL11A1_ENST00000512756.1_Missense_Mutation_p.G313A|COL11A1_ENST00000358392.2_Missense_Mutation_p.G441A|COL11A1_ENST00000353414.4_Missense_Mutation_p.G390A	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	429	Triple-helical region (interrupted).				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		TGCTGGTTCTCCTTTCTGTCC	0.353																																					p.G441A		.											.	COL11A1-586	0			c.G1322C						.						162.0	149.0	153.0					1																	103487285		2203	4300	6503	SO:0001583	missense	1301	exon9			GGTTCTCCTTTCT	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.1286G>C	1.37:g.103487285C>G	ENSP00000359114:p.Gly429Ala	Somatic	110	0		WXS	Illumina GAIIx	Phase_I	129	48	NM_080629	0	0	11	17	6	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	ENST00000370096.3	37	CCDS778.1	.	.	.	.	.	.	.	.	.	.	C	19.64	3.864751	0.71949	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000512756;ENST00000427239	D;D;D;D;D	0.97850	-4.57;-4.57;-4.57;-3.8;-3.8	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	D	0.99058	0.9677	M	0.92507	3.315	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.87578	0.987;0.998;0.998;0.995	D	0.99410	1.0930	10	0.62326	D	0.03	.	18.9067	0.92466	0.0:1.0:0.0:0.0	.	313;390;441;429	E9PCU0;P12107-3;P12107-2;P12107	.;.;.;COBA1_HUMAN	A	429;441;390;313;441	ENSP00000359114:G429A;ENSP00000351163:G441A;ENSP00000302551:G390A;ENSP00000426533:G313A;ENSP00000408640:G441A	ENSP00000302551:G390A	G	-	2	0	COL11A1	103259873	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	5.089000	0.64492	2.466000	0.83321	0.637000	0.83480	GGA	.		0.353	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630	
SPAG17	200162	broad.mit.edu	37	1	118642324	118642324	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr1:118642324G>T	ENST00000336338.5	-	6	799	c.734C>A	c.(733-735)aCc>aAc	p.T245N		NM_206996.2	NP_996879.1	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	245						cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)				NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(30)|liver(2)|lung(56)|ovary(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	123	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		AATCACGCTGGTTATAGGAAT	0.433																																					p.T245N		.											.	SPAG17-158	0			c.C734A						.						97.0	95.0	96.0					1																	118642324		2203	4300	6503	SO:0001583	missense	200162	exon6			ACGCTGGTTATAG		CCDS899.1	1p12	2014-01-21			ENSG00000155761	ENSG00000155761			26620	protein-coding gene	gene with protein product							Standard	NM_206996		Approved	FLJ34497, PF6, RP4-776P7.2, CT143	uc001ehk.2	Q6Q759	OTTHUMG00000012198	ENST00000336338.5:c.734C>A	1.37:g.118642324G>T	ENSP00000337804:p.Thr245Asn	Somatic	75	0		WXS	Illumina GAIIx	Phase_I	78	3	NM_206996	0	0	0	0	0	Q8NAZ1|Q9NT21	Missense_Mutation	SNP	ENST00000336338.5	37	CCDS899.1	.	.	.	.	.	.	.	.	.	.	G	13.81	2.347089	0.41599	.	.	ENSG00000155761	ENST00000336338	T	0.68765	-0.35	5.67	3.76	0.43208	.	0.260402	0.44688	D	0.000425	T	0.36580	0.0972	L	0.29908	0.895	0.28373	N	0.919929	P	0.38504	0.634	B	0.31101	0.124	T	0.37430	-0.9706	10	0.59425	D	0.04	.	16.2315	0.82344	0.0:0.3627:0.6373:0.0	.	245	Q6Q759	SPG17_HUMAN	N	245	ENSP00000337804:T245N	ENSP00000337804:T245N	T	-	2	0	SPAG17	118443847	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.927000	0.48900	1.414000	0.47017	0.563000	0.77884	ACC	.		0.433	SPAG17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033723.1	NM_206996	
RPRD2	23248	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	150444740	150444740	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr1:150444740G>A	ENST00000369068.4	+	11	3320	c.3316G>A	c.(3316-3318)Gta>Ata	p.V1106I	RPRD2_ENST00000401000.4_Missense_Mutation_p.V1080I|RPRD2_ENST00000492220.1_3'UTR	NM_015203.3	NP_056018.2	Q5VT52	RPRD2_HUMAN	regulation of nuclear pre-mRNA domain containing 2	1106						DNA-directed RNA polymerase II, holoenzyme (GO:0016591)				central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(20)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	37						GATCCAGACCGTAGAGTCCAT	0.517																																					p.V1106I		.											.	RPRD2-23	0			c.G3316A						.						39.0	42.0	41.0					1																	150444740		1947	4143	6090	SO:0001583	missense	23248	exon11			CAGACCGTAGAGT	BX641025	CCDS44216.1, CCDS72907.1	1q21.2	2012-02-09	2008-08-15	2008-07-28	ENSG00000163125	ENSG00000163125			29039	protein-coding gene	gene with protein product		614695	"""KIAA0460"""	KIAA0460		22231121	Standard	XM_005245033		Approved	FLJ32145, HSPC099	uc009wlr.3	Q5VT52	OTTHUMG00000012808	ENST00000369068.4:c.3316G>A	1.37:g.150444740G>A	ENSP00000358064:p.Val1106Ile	Somatic	54	0		WXS	Illumina GAIIx	Phase_I	52	8	NM_015203	0	0	31	31	0	A8K6N8|B3KPT1|B4E2Q6|O75048|Q5VT51|Q5VT53|Q6MZL4|Q86XD2|Q9P0D7	Missense_Mutation	SNP	ENST00000369068.4	37	CCDS44216.1	.	.	.	.	.	.	.	.	.	.	G	17.00	3.277051	0.59758	.	.	ENSG00000163125	ENST00000401000;ENST00000369068	T;T	0.57907	0.37;0.38	5.14	4.2	0.49525	.	0.165679	0.40908	D	0.000990	T	0.33440	0.0863	N	0.24115	0.695	0.80722	D	1	P;D	0.55800	0.954;0.973	B;P	0.47603	0.349;0.551	T	0.37267	-0.9713	10	0.87932	D	0	-8.1009	14.5222	0.67859	0.0:0.0:0.8523:0.1477	.	1106;1080	Q5VT52;Q5VT52-3	RPRD2_HUMAN;.	I	1080;1106	ENSP00000383785:V1080I;ENSP00000358064:V1106I	ENSP00000358064:V1106I	V	+	1	0	RPRD2	148711364	1.000000	0.71417	0.986000	0.45419	0.991000	0.79684	6.309000	0.72825	1.321000	0.45227	0.655000	0.94253	GTA	.		0.517	RPRD2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000035844.1	NM_015203	
SLC27A3	11000	hgsc.bcm.edu	37	1	153748161	153748161	+	Missense_Mutation	SNP	G	G	C	rs34527123|rs587776392	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr1:153748161G>C	ENST00000368661.3	+	1	394	c.329G>C	c.(328-330)gGg>gCg	p.G110A	SLC27A3_ENST00000484014.1_Intron|SLC27A3_ENST00000271857.2_Missense_Mutation_p.G191A	NM_024330.1	NP_077306.1	Q5K4L6	S27A3_HUMAN	solute carrier family 27 (fatty acid transporter), member 3	110			G -> A (in dbSNP:rs34527123).		fatty acid metabolic process (GO:0006631)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)	fatty-acyl-CoA synthase activity (GO:0004321)|ligase activity (GO:0016874)|nucleotide binding (GO:0000166)			NS(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)	14	all_lung(78;6.47e-32)|Lung NSC(65;2.52e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			GGTCCCGAGGGGGGCTGCAGC	0.711													G|||	51	0.0101837	0.0008	0.0173	5008	,	,		13208	0.001		0.0328	False		,,,				2504	0.0041				p.G110A		.											.	SLC27A3-91	0			c.G329C						.	G	ALA/GLY	21,3907		0,21,1943	4.0	6.0	5.0		329	2.8	1.0	1	dbSNP_126	5	220,7654		2,216,3719	no	missense	SLC27A3	NM_024330.1	60	2,237,5662	CC,CG,GG		2.794,0.5346,2.042	possibly-damaging	110/731	153748161	241,11561	1964	3937	5901	SO:0001583	missense	11000	exon1			CCGAGGGGGGCTG	BC009916	CCDS1053.1	1q21.1	2013-05-22			ENSG00000143554	ENSG00000143554		"""Acyl-CoA synthetase family"", ""Solute carriers"""	10997	protein-coding gene	gene with protein product		604193				9671728	Standard	NM_024330		Approved	FATP3, MGC4365, ACSVL3	uc001fcz.3	Q5K4L6	OTTHUMG00000037155	ENST00000368661.3:c.329G>C	1.37:g.153748161G>C	ENSP00000357650:p.Gly110Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	13	7	NM_024330	0	0	2	5	3	Q5VUQ7|Q5VUQ8|Q5VUR3|Q6ZV16|Q8N2X7|Q8TEJ0|Q96SW5|Q9BTJ5|Q9BTY5	Missense_Mutation	SNP	ENST00000368661.3	37	CCDS1053.1	40	0.018315018315018316	3	0.006097560975609756	8	0.022099447513812154	1	0.0017482517482517483	28	0.036939313984168866	G	15.58	2.876242	0.51801	0.005346	0.02794	ENSG00000143554	ENST00000271857;ENST00000368661	T;T	0.58210	0.35;0.4	3.71	2.78	0.32641	.	0.562171	0.15028	N	0.284627	T	0.13970	0.0338	N	0.14661	0.345	0.19300	N	0.999971	B	0.02656	0.0	B	0.04013	0.001	T	0.24512	-1.0158	10	0.25751	T	0.34	-2.2657	8.9582	0.35832	0.0:0.2277:0.7723:0.0	rs34527123	110	Q5K4L6	S27A3_HUMAN	A	191;110	ENSP00000271857:G191A;ENSP00000357650:G110A	ENSP00000271857:G191A	G	+	2	0	SLC27A3	152014785	0.535000	0.26370	0.973000	0.42090	0.938000	0.57974	0.716000	0.25836	0.753000	0.32945	0.462000	0.41574	GGG	G|0.051;C|0.949		0.711	SLC27A3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_024330	
TNR	7143	bcgsc.ca	37	1	175335234	175335234	+	Silent	SNP	C	C	T	rs1385541	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr1:175335234C>T	ENST00000367674.2	-	11	2802	c.2094G>A	c.(2092-2094)tcG>tcA	p.S698S	TNR_ENST00000263525.2_Silent_p.S698S			Q92752	TENR_HUMAN	tenascin R	698	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)				NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					TGGAGGTCTCCGAGGAGGCTG	0.522													C|||	832	0.166134	0.1483	0.1974	5008	,	,		22079	0.1042		0.2445	False		,,,				2504	0.1513				p.S698S		.											.	TNR-324	0			c.G2094A						.	C		604,3802	264.1+/-265.8	53,498,1652	116.0	94.0	102.0		2094	-11.8	0.5	1	dbSNP_88	102	2089,6511	360.6+/-332.0	258,1573,2469	no	coding-synonymous	TNR	NM_003285.2		311,2071,4121	TT,TC,CC		24.2907,13.7086,20.7058		698/1359	175335234	2693,10313	2203	4300	6503	SO:0001819	synonymous_variant	7143	exon11			GGTCTCCGAGGAG	X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.2094G>A	1.37:g.175335234C>T		Somatic	222	2		WXS	Illumina GAIIx	Phase_I	276	7	NM_003285	0	0	0	0	0	C9J563|Q15568|Q5R3G0	Silent	SNP	ENST00000367674.2	37	CCDS1318.1																																																																																			C|0.809;T|0.191		0.522	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084414.4	NM_003285	
TSEN15	116461	bcgsc.ca	37	1	184023529	184023529	+	Missense_Mutation	SNP	A	A	C	rs1046934	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr1:184023529A>C	ENST00000361641.1	+	2	256	c.177A>C	c.(175-177)caA>caC	p.Q59H	TSEN15_ENST00000533373.1_Missense_Mutation_p.Q59H|TSEN15_ENST00000423085.2_Missense_Mutation_p.Q59H	NM_052965.2	NP_443197.1	Q8WW01	SEN15_HUMAN	TSEN15 tRNA splicing endonuclease subunit	59			Q -> H (in dbSNP:rs1046934).		mRNA processing (GO:0006397)|tRNA splicing, via endonucleolytic cleavage and ligation (GO:0006388)	nucleus (GO:0005634)	tRNA-intron endonuclease activity (GO:0000213)			breast(1)|kidney(3)|large_intestine(2)|lung(2)	8						ATGCCACCCAAGTTTATGTAG	0.323													A|||	1517	0.302915	0.1233	0.3026	5008	,	,		16302	0.4504		0.327	False		,,,				2504	0.3691				p.Q59H		.											.	TSEN15-90	0			c.A177C						.	A	HIS/GLN,HIS/GLN	717,3689	297.0+/-284.5	55,607,1541	177.0	173.0	174.0		177,177	1.6	1.0	1	dbSNP_86	174	2989,5611	462.2+/-365.6	491,2007,1802	yes	missense,missense	TSEN15	NM_001127394.2,NM_052965.2	24,24	546,2614,3343	CC,CA,AA	http://www.ncbi.nlm.nih.gov/pubmed?term	34.7558,16.2733,28.4945	probably-damaging,probably-damaging	59/130,59/172	184023529	3706,9300	2203	4300	6503	SO:0001583	missense	116461	exon2			CACCCAAGTTTAT	AF288394	CCDS1361.1, CCDS44286.1, CCDS72993.1	1q25	2013-08-06	2013-08-06	2008-06-12	ENSG00000198860	ENSG00000198860		"""tRNA splicing endonuclease subunits"""	16791	protein-coding gene	gene with protein product		608756	"""chromosome 1 open reading frame 19"", ""tRNA splicing endonuclease 15 homolog (S. cerevisiae)"""	C1orf19		11318611, 17166513	Standard	XM_006711148		Approved		uc001gqt.4	Q8WW01	OTTHUMG00000035461	ENST00000361641.1:c.177A>C	1.37:g.184023529A>C	ENSP00000355299:p.Gln59His	Somatic	101	0		WXS	Illumina GAIIx	Phase_I	73	4	NM_001127394	0	0	18	18	0	B4DKP0|Q9BZQ5	Missense_Mutation	SNP	ENST00000361641.1	37	CCDS1361.1	703	0.3218864468864469	76	0.15447154471544716	112	0.30939226519337015	263	0.4597902097902098	252	0.3324538258575198	A	17.48	3.399957	0.62177	0.162733	0.347558	ENSG00000198860	ENST00000361641;ENST00000533373;ENST00000423085	T;T;T	0.49139	0.79;0.79;0.79	5.27	1.56	0.23342	tRNA-intron endonuclease, Sen15 domain (1);	0.053462	0.85682	N	0.000000	T	0.00012	0.0000	M	0.61703	1.905	0.21719	P	0.999571061	B;B	0.13145	0.007;0.002	B;B	0.18263	0.021;0.009	T	0.36016	-0.9765	9	0.72032	D	0.01	-14.3213	5.5494	0.17081	0.5737:0.3382:0.0881:0.0	rs1046934;rs3186920;rs3736959;rs17415534;rs52791391;rs58806237;rs1046934	59;59	B4DKP0;Q8WW01	.;SEN15_HUMAN	H	59	ENSP00000355299:Q59H;ENSP00000436996:Q59H;ENSP00000402002:Q59H	ENSP00000355299:Q59H	Q	+	3	2	TSEN15	182290152	1.000000	0.71417	0.998000	0.56505	0.983000	0.72400	1.476000	0.35420	0.094000	0.17404	0.528000	0.53228	CAA	A|0.705;C|0.295		0.323	TSEN15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086132.1		
C1orf106	55765	hgsc.bcm.edu	37	1	200880978	200880978	+	Missense_Mutation	SNP	C	C	T	rs296520	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr1:200880978C>T	ENST00000367342.4	+	9	1812	c.1612C>T	c.(1612-1614)Cgc>Tgc	p.R538C	C1orf106_ENST00000413687.2_Missense_Mutation_p.R453C	NM_018265.3	NP_060735.3	Q3KP66	CA106_HUMAN	chromosome 1 open reading frame 106	538			R -> C (in dbSNP:rs296520). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.							endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(2)	21						GTGGGAGCTGCGCCGCGCAGC	0.736													T|||	3966	0.791933	0.6089	0.8213	5008	,	,		12017	0.997		0.7256	False		,,,				2504	0.8753				p.R552C		.											.	C1orf106-93	0			c.C1654T						.	T	CYS/ARG,CYS/ARG	2547,1503		890,767,368	5.0	7.0	6.0		1357,1612	0.8	0.0	1	dbSNP_79	6	5587,2355		2124,1339,508	no	missense,missense	C1orf106	NM_001142569.2,NM_018265.3	180,180	3014,2106,876	TT,TC,CC		29.6525,37.1111,32.1714	benign,benign	453/579,538/664	200880978	8134,3858	2025	3971	5996	SO:0001583	missense	55765	exon9			GAGCTGCGCCGCG	AK001763	CCDS44292.1	1q32.1	2011-02-15			ENSG00000163362	ENSG00000163362			25599	protein-coding gene	gene with protein product						14702039	Standard	NM_018265		Approved	FLJ10901	uc001gvo.4	Q3KP66	OTTHUMG00000035789	ENST00000367342.4:c.1612C>T	1.37:g.200880978C>T	ENSP00000356311:p.Arg538Cys	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_018265	0	0	0	0	0	B4E1K9|E9PFY0|Q9NV65|Q9NVI0	Missense_Mutation	SNP	ENST00000367342.4	37		1677	0.7678571428571429	261	0.5304878048780488	285	0.787292817679558	569	0.9947552447552448	562	0.741424802110818	T	0.366	-0.936884	0.02340	0.628889	0.703475	ENSG00000163362	ENST00000367342;ENST00000413687	T;T	0.28454	1.61;1.61	3.39	0.759	0.18438	.	0.912041	0.09365	N	0.812206	T	0.00012	0.0000	N	0.01576	-0.805	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.16188	-1.0411	9	0.29301	T	0.29	-23.0614	3.796	0.08740	0.0:0.2241:0.1856:0.5903	rs296520;rs7519373;rs56757010	538	Q3KP66	CA106_HUMAN	C	538;453	ENSP00000356311:R538C;ENSP00000392105:R453C	ENSP00000356311:R538C	R	+	1	0	C1orf106	199147601	0.004000	0.15560	0.002000	0.10522	0.007000	0.05969	-0.731000	0.04909	-0.124000	0.11724	-0.381000	0.06696	CGC	C|0.242;T|0.758		0.736	C1orf106-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000087057.2	NM_018265	
PLXNA2	5362	broad.mit.edu	37	1	208225716	208225716	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr1:208225716G>T	ENST00000367033.3	-	15	3706	c.2949C>A	c.(2947-2949)agC>agA	p.S983R		NM_025179.3	NP_079455.3	O75051	PLXA2_HUMAN	plexin A2	983	IPT/TIG 2.				axon guidance (GO:0007411)|centrosome localization (GO:0051642)|cerebellar granule cell precursor tangential migration (GO:0021935)|limb bud formation (GO:0060174)|neural tube development (GO:0021915)|pharyngeal system development (GO:0060037)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|somitogenesis (GO:0001756)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)	80				OV - Ovarian serous cystadenocarcinoma(81;0.199)		CTGCCACGCTGCTCCCAGCCC	0.557																																					p.S983R		.											.	PLXNA2-92	0			c.C2949A						.						105.0	100.0	102.0					1																	208225716		2203	4300	6503	SO:0001583	missense	5362	exon15			CACGCTGCTCCCA	X87831	CCDS31013.1	1q32.2	2008-07-18			ENSG00000076356	ENSG00000076356		"""Plexins"""	9100	protein-coding gene	gene with protein product	"""plexin 2"", ""plexin-A2"", ""semaphorin receptor OCT"", ""transmembrane protein OCT"""	601054		PLXN2		8570614	Standard	NM_025179		Approved	OCT, FLJ11751, FLJ30634, KIAA0463	uc001hgz.3	O75051	OTTHUMG00000036564	ENST00000367033.3:c.2949C>A	1.37:g.208225716G>T	ENSP00000356000:p.Ser983Arg	Somatic	66	1		WXS	Illumina GAIIx	Phase_I	94	4	NM_025179	0	0	4	4	0	A2RTX9|B2RMX7|Q6UX61|Q96GN9|Q9BRL1|Q9UIW1	Missense_Mutation	SNP	ENST00000367033.3	37	CCDS31013.1	.	.	.	.	.	.	.	.	.	.	G	20.5	3.996434	0.74818	.	.	ENSG00000076356	ENST00000367033	T	0.77358	-1.09	5.46	4.45	0.53987	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.85691	0.5755	M	0.66378	2.025	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.86757	0.1964	10	0.87932	D	0	.	12.7608	0.57363	0.1101:0.0:0.8899:0.0	.	983	O75051	PLXA2_HUMAN	R	983	ENSP00000356000:S983R	ENSP00000356000:S983R	S	-	3	2	PLXNA2	206292339	1.000000	0.71417	0.997000	0.53966	0.934000	0.57294	3.504000	0.53347	2.557000	0.86248	0.650000	0.86243	AGC	.		0.557	PLXNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088932.6	NM_025179	
DNAH14	127602	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	225528307	225528307	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr1:225528307G>C	ENST00000445597.2	+	47	7894	c.7894G>C	c.(7894-7896)Gat>Cat	p.D2632H	DNAH14_ENST00000439375.2_Missense_Mutation_p.D3435H|DNAH14_ENST00000430092.1_Missense_Mutation_p.D3435H			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14	2632					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						TCATTTAGAAGATCAACGTTC	0.353																																					p.D3435H		.											.	DNAH14-23	0			c.G10303C						.						166.0	141.0	149.0					1																	225528307		692	1591	2283	SO:0001583	missense	127602	exon67			TTAGAAGATCAAC	U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.7894G>C	1.37:g.225528307G>C	ENSP00000409472:p.Asp2632His	Somatic	212	0		WXS	Illumina GAIIx	Phase_I	213	26	NM_001373	0	0	1	1	0	A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Missense_Mutation	SNP	ENST00000445597.2	37		.	.	.	.	.	.	.	.	.	.	G	9.874	1.199615	0.22121	.	.	ENSG00000185842	ENST00000445597;ENST00000430092;ENST00000439375	T;T;T	0.22336	1.96;1.96;1.96	5.35	-1.27	0.09347	.	.	.	.	.	T	0.11495	0.0280	.	.	.	0.31011	N	0.719244	P	0.40032	0.699	B	0.35550	0.205	T	0.30357	-0.9981	8	0.66056	D	0.02	.	0.4389	0.00483	0.2301:0.2368:0.2815:0.2517	.	3435	Q0VDD8-4	.	H	2632;3435;3435	ENSP00000409472:D2632H;ENSP00000414402:D3435H;ENSP00000392061:D3435H	ENSP00000414402:D3435H	D	+	1	0	DNAH14	223594930	0.184000	0.23200	0.530000	0.27963	0.510000	0.34073	-0.109000	0.10840	0.090000	0.17273	0.603000	0.83216	GAT	.		0.353	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000331217.3	XM_059166	
JMJD4	65094	hgsc.bcm.edu	37	1	227923081	227923081	+	Missense_Mutation	SNP	G	G	A	rs7419238		TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr1:227923081G>A	ENST00000366758.3	-	1	31	c.32C>T	c.(31-33)gCg>gTg	p.A11V	JMJD4_ENST00000485807.1_5'Flank|SNAP47_ENST00000366759.4_5'UTR|SNAP47_ENST00000315781.5_5'UTR|SNAP47_ENST00000366760.1_Intron|JMJD4_ENST00000438896.2_Missense_Mutation_p.A11V	NM_023007.2	NP_075383.2	Q9H9V9	JMJD4_HUMAN	jumonji domain containing 4	11			A -> V (in dbSNP:rs7419238). {ECO:0000269|PubMed:14702039}.							endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|skin(1)	9		Prostate(94;0.0885)				TTTCTGCCCCGCCAGCGCCTG	0.741													A|||	5008	1.0	1.0	1.0	5008	,	,		11222	1.0		1.0	False		,,,				2504	1.0				p.A11V		.											.	JMJD4-226	0			c.C32T						.	A	VAL/ALA,VAL/ALA,	4035,1		2017,1,0	6.0	7.0	7.0		32,32,	2.0	0.0	1	dbSNP_116	7	8000,0		4000,0,0	yes	missense,missense,utr-5	JMJD4,SNAP47	NM_001161465.1,NM_023007.2,NM_053052.3	64,64,	6017,1,0	AA,AG,GG		0.0,0.0248,0.0083	benign,benign,	11/448,11/464,	227923081	12035,1	2018	4000	6018	SO:0001583	missense	65094	exon1			TGCCCCGCCAGCG	AK022579	CCDS1561.1, CCDS59203.1	1q42.13	2008-02-05			ENSG00000081692	ENSG00000081692			25724	protein-coding gene	gene with protein product						12477932	Standard	NM_023007		Approved	FLJ12517	uc001hrb.3	Q9H9V9	OTTHUMG00000037698	ENST00000366758.3:c.32C>T	1.37:g.227923081G>A	ENSP00000355720:p.Ala11Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	8	NM_023007	0	0	0	1	1	Q5TBZ1|Q5TBZ6|Q9H970	Missense_Mutation	SNP	ENST00000366758.3	37	CCDS1561.1	2179|2179	0.9977106227106227|0.9977106227106227	492|492	1.0|1.0	361|361	0.9972375690607734|0.9972375690607734	572|572	1.0|1.0	754|754	0.9947229551451188|0.9947229551451188	A|A	2.779|2.779	-0.253926|-0.253926	0.05829|0.05829	0.999752|0.999752	1.0|1.0	ENSG00000081692|ENSG00000081692	ENST00000366758|ENST00000438896	T|.	0.19806|.	2.12|.	3.58|3.58	1.99|1.99	0.26369|0.26369	.|.	.|.	.|.	.|.	.|.	T|T	0.00012|0.00012	0.0000|0.0000	N|N	0.03608|0.03608	-0.345|-0.345	0.80722|0.80722	P|P	0.0|0.0	B;B|.	0.02656|.	0.0;0.0|.	B;B|.	0.01281|.	0.0;0.0|.	T|T	0.27400|0.27400	-1.0075|-1.0075	8|4	0.02654|.	T|.	1|.	.|.	5.7765|5.7765	0.18281|0.18281	0.6536:0.0:0.3464:0.0|0.6536:0.0:0.3464:0.0	rs7419238;rs58641567;rs7419238|rs7419238;rs58641567;rs7419238	11;11|.	Q9H9V9-2;Q9H9V9|.	.;JMJD4_HUMAN|.	V|W	11|4	ENSP00000355720:A11V|.	ENSP00000355720:A11V|.	A|R	-|-	2|1	0|2	JMJD4|JMJD4	225989704|225989704	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.004000|0.004000	0.04260|0.04260	-0.100000|-0.100000	0.10990|0.10990	-0.047000|-0.047000	0.13423|0.13423	-0.268000|-0.268000	0.10319|0.10319	GCG|CGG	G|0.002;A|0.998		0.741	JMJD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091970.1	NM_023007	
OBSCN	84033	hgsc.bcm.edu	37	1	228504669	228504669	+	Silent	SNP	G	G	A	rs61825302	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr1:228504669G>A	ENST00000422127.1	+	51	13589	c.13545G>A	c.(13543-13545)gcG>gcA	p.A4515A	OBSCN_ENST00000284548.11_Silent_p.A4515A|OBSCN_ENST00000366707.4_Silent_p.A2149A|OBSCN_ENST00000570156.2_Silent_p.A5472A|OBSCN_ENST00000366709.4_Silent_p.A1634A	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	4515	Ig-like 46.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				TGGCCTCTGCGCGGCTCACCG	0.731													g|||	729	0.145567	0.1218	0.2349	5008	,	,		13931	0.1518		0.159	False		,,,				2504	0.0941				p.A5472A		.											.	OBSCN-403	0			c.G16416A						.		,	507,3253		36,435,1409	5.0	6.0	6.0		13545,13545	-6.2	0.0	1	dbSNP_129	6	1105,6501		71,963,2769	no	coding-synonymous,coding-synonymous	OBSCN	NM_001098623.1,NM_052843.2	,	107,1398,4178	AA,AG,GG		14.528,13.484,14.1827	,	4515/7969,4515/6621	228504669	1612,9754	1880	3803	5683	SO:0001819	synonymous_variant	84033	exon62			CTCTGCGCGGCTC	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.13545G>A	1.37:g.228504669G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	13	11	NM_001271223	0	0	0	0	0	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Silent	SNP	ENST00000422127.1	37	CCDS58065.1																																																																																			G|0.841;A|0.159		0.731	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
SH3BP5L	80851	hgsc.bcm.edu	37	1	249106348	249106348	+	Silent	SNP	G	G	C	rs202116012	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr1:249106348G>C	ENST00000366472.5	-	7	2162	c.933C>G	c.(931-933)gcC>gcG	p.A311A	SH3BP5L_ENST00000475978.1_5'UTR|SH3BP5L_ENST00000411742.2_Silent_p.A279A	NM_030645.1	NP_085148.1	Q7L8J4	3BP5L_HUMAN	SH3-binding domain protein 5-like	311										endometrium(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	23	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.19)	OV - Ovarian serous cystadenocarcinoma(106;0.00805)			CCGCACCCTCGGCCCCCTCAA	0.746													G|||	23	0.00459265	0.0008	0.0144	5008	,	,		12601	0.0		0.0119	False		,,,				2504	0.0				p.A311A		.											.	SH3BP5L-90	0			c.C933G						.	G		17,4377		0,17,2180	13.0	16.0	15.0		933	-8.6	0.4	1		15	135,8433		2,131,4151	no	coding-synonymous	SH3BP5L	NM_030645.1		2,148,6331	CC,CG,GG		1.5756,0.3869,1.1727		311/394	249106348	152,12810	2197	4284	6481	SO:0001819	synonymous_variant	80851	exon7			ACCCTCGGCCCCC	AB051507	CCDS31126.1	1q44	2008-02-05			ENSG00000175137	ENSG00000175137			29360	protein-coding gene	gene with protein product							Standard	NM_030645		Approved	KIAA1720	uc001iew.1	Q7L8J4	OTTHUMG00000040389	ENST00000366472.5:c.933C>G	1.37:g.249106348G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	18	8	NM_030645	0	1	17	24	6	B4DQ94|Q96FI5|Q9BQH8|Q9C0E3	Silent	SNP	ENST00000366472.5	37	CCDS31126.1																																																																																			G|0.991;C|0.008		0.746	SH3BP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097140.1	NM_030645	
BICC1	80114	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	60273078	60273078	+	Nonsense_Mutation	SNP	G	G	T			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr10:60273078G>T	ENST00000373886.3	+	1	179	c.175G>T	c.(175-177)Gag>Tag	p.E59*		NM_001080512.1	NP_001073981.1	Q9H694	BICC1_HUMAN	BicC family RNA binding protein 1	59					multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)	cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.E59K(1)		breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	44						GAAGAAACTTGAGGCCATGTT	0.657																																					p.E59X		.											.	BICC1-72	1	Substitution - Missense(1)	urinary_tract(1)	c.G175T						.						47.0	43.0	44.0					10																	60273078		2203	4300	6503	SO:0001587	stop_gained	80114	exon1			AAACTTGAGGCCA	AK026129	CCDS31206.1	10q21.3	2014-09-17	2014-02-03		ENSG00000122870	ENSG00000122870		"""Sterile alpha motif (SAM) domain containing"""	19351	protein-coding gene	gene with protein product		614295	"""bicaudal C homolog 1 (Drosophila)"""				Standard	XM_005270166		Approved		uc001jki.1	Q9H694	OTTHUMG00000018271	ENST00000373886.3:c.175G>T	10.37:g.60273078G>T	ENSP00000362993:p.Glu59*	Somatic	186	0		WXS	Illumina GAIIx	Phase_I	477	24	NM_001080512	0	0	0	0	0		Nonsense_Mutation	SNP	ENST00000373886.3	37	CCDS31206.1	.	.	.	.	.	.	.	.	.	.	g	36	5.968586	0.97156	.	.	ENSG00000122870	ENST00000373886	.	.	.	3.06	3.06	0.35304	.	0.000000	0.56097	U	0.000030	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.36615	T	0.2	-8.7965	12.3312	0.55041	0.0:0.0:1.0:0.0	.	.	.	.	X	59	.	ENSP00000362993:E59X	E	+	1	0	BICC1	59943084	1.000000	0.71417	0.998000	0.56505	0.636000	0.38137	8.080000	0.89510	1.699000	0.51192	0.443000	0.29094	GAG	.		0.657	BICC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048150.2	NM_025044	
SFTPD	6441	bcgsc.ca	37	10	81697756	81697756	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr10:81697756G>A	ENST00000372292.3	-	8	1020	c.980C>T	c.(979-981)cCc>cTc	p.P327L		NM_003019.4	NP_003010.4	P35247	SFTPD_HUMAN	surfactant protein D	327	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				defense response to bacterium (GO:0042742)|innate immune response (GO:0045087)|lung alveolus development (GO:0048286)|macrophage chemotaxis (GO:0048246)|negative regulation of interleukin-2 biosynthetic process (GO:0045085)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of phagocytosis (GO:0050766)|reactive oxygen species metabolic process (GO:0072593)|receptor-mediated endocytosis (GO:0006898)|regulation of cytokine production (GO:0001817)|respiratory gaseous exchange (GO:0007585)|surfactant homeostasis (GO:0043129)	collagen trimer (GO:0005581)|endocytic vesicle (GO:0030139)|extracellular region (GO:0005576)|lysosome (GO:0005764)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)			endometrium(1)|kidney(3)|large_intestine(5)|lung(3)|skin(4)|urinary_tract(1)	17	Breast(12;0.000615)|Prostate(51;0.0095)|all_epithelial(25;0.027)		Epithelial(14;0.0244)|all cancers(16;0.0558)|Colorectal(32;0.109)			CTCTCCTGTGGGGTAGGTGAA	0.572																																					p.P327L		.											.	SFTPD-91	0			c.C980T						.						155.0	153.0	153.0					10																	81697756		2203	4300	6503	SO:0001583	missense	6441	exon8			CCTGTGGGGTAGG	L05485	CCDS7362.1	10q22.2-q23.1	2012-11-02	2008-08-26		ENSG00000133661	ENSG00000133661		"""Collectins"""	10803	protein-coding gene	gene with protein product		178635	"""surfactant, pulmonary-associated protein D"""	SFTP4		1898081, 1339284	Standard	NM_003019		Approved	SP-D, COLEC7	uc001kbh.3	P35247	OTTHUMG00000018590	ENST00000372292.3:c.980C>T	10.37:g.81697756G>A	ENSP00000361366:p.Pro327Leu	Somatic	90	0		WXS	Illumina GAIIx	Phase_I	141	6	NM_003019	0	0	0	0	0	Q5T0M3|Q6FH08|Q86YK9|Q8TCD8|Q9UCJ2|Q9UCJ3	Missense_Mutation	SNP	ENST00000372292.3	37	CCDS7362.1	.	.	.	.	.	.	.	.	.	.	G	12.18	1.860048	0.32884	.	.	ENSG00000133661	ENST00000372292	T	0.19669	2.13	5.63	4.72	0.59763	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.000000	0.64402	D	0.000020	T	0.13457	0.0326	L	0.35644	1.08	0.42176	D	0.991663	B	0.17852	0.024	B	0.20577	0.03	T	0.06716	-1.0811	10	0.05436	T	0.98	-5.51	8.4502	0.32866	0.1753:0.0:0.8247:0.0	.	327	P35247	SFTPD_HUMAN	L	327	ENSP00000361366:P327L	ENSP00000361366:P327L	P	-	2	0	SFTPD	81687736	0.997000	0.39634	0.808000	0.32385	0.912000	0.54170	2.926000	0.48892	1.367000	0.46095	0.591000	0.81541	CCC	.		0.572	SFTPD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049011.1		
KIF11	3832	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	94397209	94397209	+	Silent	SNP	A	A	G			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr10:94397209A>G	ENST00000260731.3	+	16	2157	c.2067A>G	c.(2065-2067)ctA>ctG	p.L689L		NM_004523.3	NP_004514.2	P52732	KIF11_HUMAN	kinesin family member 11	689					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|chromosome segregation (GO:0007059)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic centrosome separation (GO:0007100)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|spindle assembly involved in mitosis (GO:0090307)|spindle organization (GO:0007051)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)			breast(1)|endometrium(5)|kidney(2)|large_intestine(9)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						TACATGAACTACAAGAAAATA	0.353																																					p.L689L	Colon(47;212 1003 2764 4062 8431)	.											.	KIF11-227	0			c.A2067G						.						73.0	72.0	72.0					10																	94397209		2203	4300	6503	SO:0001819	synonymous_variant	3832	exon16			TGAACTACAAGAA	X85137	CCDS7422.1	10q24.1	2008-03-03	2003-01-09	2003-01-10	ENSG00000138160	ENSG00000138160		"""Kinesins"""	6388	protein-coding gene	gene with protein product		148760	"""kinesin-like 1"""	KNSL1		1505978, 8548803	Standard	NM_004523		Approved	Eg5, HKSP, TRIP5	uc001kic.3	P52732	OTTHUMG00000018761	ENST00000260731.3:c.2067A>G	10.37:g.94397209A>G		Somatic	155	0		WXS	Illumina GAIIx	Phase_I	212	17	NM_004523	0	0	4	4	0	A0AV49|B2RMV3|Q15716|Q5VWX0	Silent	SNP	ENST00000260731.3	37	CCDS7422.1																																																																																			.		0.353	KIF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049401.1	NM_004523	
CYP2C8	1558	broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	96802824	96802824	+	Silent	SNP	C	C	T	rs529746836		TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr10:96802824C>T	ENST00000371270.3	-	7	1066	c.972G>A	c.(970-972)caG>caA	p.Q324Q	CYP2C8_ENST00000535898.1_Silent_p.Q222Q|CYP2C8_ENST00000539050.1_Silent_p.Q238Q	NM_000770.3|NM_001198853.1|NM_001198855.1	NP_000761.3|NP_001185782.1|NP_001185784.1	P10632	CP2C8_HUMAN	cytochrome P450, family 2, subfamily C, polypeptide 8	324					arachidonic acid metabolic process (GO:0019369)|drug metabolic process (GO:0017144)|epoxygenase P450 pathway (GO:0019373)|exogenous drug catabolic process (GO:0042738)|omega-hydroxylase P450 pathway (GO:0097267)|organic acid metabolic process (GO:0006082)|oxidation-reduction process (GO:0055114)|oxidative demethylation (GO:0070989)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|caffeine oxidase activity (GO:0034875)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)			breast(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(6)|skin(3)	21		Colorectal(252;0.0397)		all cancers(201;6.21e-05)	Abiraterone(DB05812)|Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Almotriptan(DB00918)|Aminophenazone(DB01424)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amodiaquine(DB00613)|Amprenavir(DB00701)|Antipyrine(DB01435)|Apixaban(DB06605)|Atorvastatin(DB01076)|Azelastine(DB00972)|Benzyl alcohol(DB06770)|Bezafibrate(DB01393)|Bortezomib(DB00188)|Brompheniramine(DB00835)|Buprenorphine(DB00921)|Bupropion(DB01156)|Cabazitaxel(DB06772)|Caffeine(DB00201)|Candesartan(DB00796)|Carbamazepine(DB00564)|Carbinoxamine(DB00748)|Chloramphenicol(DB00446)|Chloroquine(DB00608)|Cholecalciferol(DB00169)|Cimetidine(DB00501)|Cisapride(DB00604)|Clopidogrel(DB00758)|Clotrimazole(DB00257)|Clozapine(DB00363)|Cocaine(DB00907)|Colchicine(DB01394)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dabrafenib(DB08912)|Dapsone(DB00250)|Delavirdine(DB00705)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Diltiazem(DB00343)|Domperidone(DB01184)|Eltrombopag(DB06210)|Enzalutamide(DB08899)|Erlotinib(DB00530)|Estradiol(DB00783)|Eszopiclone(DB00402)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Felodipine(DB01023)|Fenofibrate(DB01039)|Fluorouracil(DB00544)|Fluvastatin(DB01095)|Fosphenytoin(DB01320)|Gemfibrozil(DB01241)|Halofantrine(DB01218)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Ifosfamide(DB01181)|Irbesartan(DB01029)|Isoniazid(DB00951)|Ketamine(DB01221)|Ketobemidone(DB06738)|Ketoconazole(DB01026)|Ketoprofen(DB01009)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Levomilnacipran(DB08918)|Levothyroxine(DB00451)|Lidocaine(DB00281)|Liotrix(DB01583)|Loperamide(DB00836)|Loratadine(DB00455)|Losartan(DB00678)|Lovastatin(DB00227)|Medroxyprogesterone Acetate(DB00603)|Mefenamic acid(DB00784)|Meloxicam(DB00814)|Methadone(DB00333)|Metronidazole(DB00916)|Mirtazapine(DB00370)|Mometasone(DB00764)|Montelukast(DB00471)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Naloxone(DB01183)|Naproxen(DB00788)|Nicardipine(DB00622)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nilutamide(DB00665)|Nilvadipine(DB06712)|Omeprazole(DB00338)|Oxybutynin(DB01062)|Paclitaxel(DB01229)|Paramethadione(DB00617)|Paroxetine(DB00715)|Pazopanib(DB06589)|Pentamidine(DB00738)|Perphenazine(DB00850)|Phenelzine(DB00780)|Phenobarbital(DB01174)|Phenprocoumon(DB00946)|Phenytoin(DB00252)|Pioglitazone(DB01132)|Piroxicam(DB00554)|Pitavastatin(DB08860)|Ponatinib(DB08901)|Pravastatin(DB00175)|Primidone(DB00794)|Probenecid(DB01032)|Progesterone(DB00396)|Propafenone(DB01182)|Propofol(DB00818)|Pyrimethamine(DB00205)|Quinidine(DB00908)|Quinine(DB00468)|Raloxifene(DB00481)|Regorafenib(DB08896)|Repaglinide(DB00912)|Rifampicin(DB01045)|Rifapentine(DB01201)|Ritonavir(DB00503)|Rosiglitazone(DB00412)|Salmeterol(DB00938)|Saquinavir(DB01232)|Secobarbital(DB00418)|Selegiline(DB01037)|Simvastatin(DB00641)|Sitagliptin(DB01261)|Sorafenib(DB00398)|Spironolactone(DB00421)|Sulfadiazine(DB00359)|Sulfamethoxazole(DB01015)|Sulfaphenazole(DB06729)|Sulfinpyrazone(DB01138)|Tamoxifen(DB00675)|Tazarotene(DB00799)|Temazepam(DB00231)|Terbinafine(DB00857)|Testosterone(DB00624)|Theophylline(DB00277)|Thioridazine(DB00679)|Ticlopidine(DB00208)|Tioconazole(DB01007)|Tolbutamide(DB01124)|Torasemide(DB00214)|Trametinib(DB08911)|Tretinoin(DB00755)|Triazolam(DB00897)|Trimethadione(DB00347)|Trimethoprim(DB00440)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Verapamil(DB00661)|Vismodegib(DB08828)|Warfarin(DB00682)|Zafirlukast(DB00549)|Zidovudine(DB00495)|Zopiclone(DB01198)	CAATCTCTTCCTGGACTTTAG	0.423													C|||	1	0.000199681	0.0	0.0	5008	,	,		18923	0.0		0.0	False		,,,				2504	0.001				p.Q324Q		.											.	CYP2C8-90	0			c.G972A						.						149.0	122.0	131.0					10																	96802824		2203	4300	6503	SO:0001819	synonymous_variant	1558	exon7			CTCTTCCTGGACT	M17397	CCDS7438.1, CCDS55721.1, CCDS73166.1	10q24.1	2007-12-14	2003-01-14		ENSG00000138115	ENSG00000138115		"""Cytochrome P450s"""	2622	protein-coding gene	gene with protein product		601129	"""cytochrome P450, subfamily IIC (mephenytoin 4-hydroxylase), polypeptide 8"""			7841444	Standard	NM_001198853		Approved	CPC8	uc001kkb.3	P10632	OTTHUMG00000018804	ENST00000371270.3:c.972G>A	10.37:g.96802824C>T		Somatic	137	1		WXS	Illumina GAIIx	Phase_I	224	44	NM_000770	0	0	0	0	0	A8K9N8|B0AZN2|B7Z1F6|Q5VX93|Q8WWB1|Q9UCZ9	Silent	SNP	ENST00000371270.3	37	CCDS7438.1																																																																																			.		0.423	CYP2C8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049499.2	NM_000770	
PIK3AP1	118788	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	98408466	98408466	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr10:98408466C>A	ENST00000339364.5	-	7	1254	c.1135G>T	c.(1135-1137)Gct>Tct	p.A379S	PIK3AP1_ENST00000371110.2_Missense_Mutation_p.A201S|PIK3AP1_ENST00000468783.1_5'UTR	NM_152309.2	NP_689522.2	Q6ZUJ8	BCAP_HUMAN	phosphoinositide-3-kinase adaptor protein 1	379					negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|regulation of inflammatory response (GO:0050727)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 7 signaling pathway (GO:0034154)|toll-like receptor 9 signaling pathway (GO:0034162)	cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	phosphatidylinositol 3-kinase regulatory subunit binding (GO:0036312)			NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(27)|ovary(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	52		Colorectal(252;0.0442)		Epithelial(162;6.29e-08)|all cancers(201;3.18e-06)		TGTTTCTCAGCGATGGTGTTG	0.577																																					p.A379S		.											.	PIK3AP1-519	0			c.G1135T						.						113.0	87.0	96.0					10																	98408466		2203	4300	6503	SO:0001583	missense	118788	exon7			TCTCAGCGATGGT	AK092883	CCDS31259.1	10q24.2	2008-10-23			ENSG00000155629	ENSG00000155629			30034	protein-coding gene	gene with protein product		607942				1251844, 11163197	Standard	NM_152309		Approved	BCAP, FLJ35564	uc001kmq.3	Q6ZUJ8	OTTHUMG00000018838	ENST00000339364.5:c.1135G>T	10.37:g.98408466C>A	ENSP00000339826:p.Ala379Ser	Somatic	150	0		WXS	Illumina GAIIx	Phase_I	295	60	NM_152309	0	0	0	0	0	Q5TB56|Q5VXJ9|Q8N6J6|Q8NAC8	Missense_Mutation	SNP	ENST00000339364.5	37	CCDS31259.1	.	.	.	.	.	.	.	.	.	.	C	35	5.449827	0.96205	.	.	ENSG00000155629	ENST00000339364;ENST00000371110	T;T	0.52526	0.66;0.66	5.79	5.79	0.91817	Ankyrin repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.71600	0.3359	M	0.76838	2.35	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.73886	-0.3841	10	0.87932	D	0	-17.9102	19.0248	0.92929	0.0:1.0:0.0:0.0	.	379	Q6ZUJ8	BCAP_HUMAN	S	379;201	ENSP00000339826:A379S;ENSP00000360151:A201S	ENSP00000339826:A379S	A	-	1	0	PIK3AP1	98398456	1.000000	0.71417	0.532000	0.27989	0.990000	0.78478	7.752000	0.85141	2.736000	0.93811	0.561000	0.74099	GCT	.		0.577	PIK3AP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049619.2	NM_152309	
PPRC1	23082	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	103901266	103901266	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr10:103901266C>G	ENST00000278070.2	+	5	3040	c.3001C>G	c.(3001-3003)Cct>Gct	p.P1001A	PPRC1_ENST00000370012.1_5'UTR|PPRC1_ENST00000413464.2_Missense_Mutation_p.P1001A	NM_015062.3	NP_055877.3	Q5VV67	PPRC1_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator-related 1	1001	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(10)|lung(19)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	56		Colorectal(252;0.122)		Epithelial(162;4.97e-08)|all cancers(201;8.99e-07)		TCCCCCACCTCCTTTGCCTCC	0.562																																					p.P1001A		.											.	PPRC1-227	0			c.C3001G						.						50.0	50.0	50.0					10																	103901266		2202	4300	6502	SO:0001583	missense	23082	exon5			CCACCTCCTTTGC	AF325193	CCDS7529.1, CCDS73186.1	10q24.32	2013-02-12	2006-10-17		ENSG00000148840	ENSG00000148840		"""RNA binding motif (RRM) containing"""	30025	protein-coding gene	gene with protein product			"""peroxisome proliferative activated receptor, gamma, coactivator-related 1"""			9628581, 11340167	Standard	XM_005269656		Approved	PRC, KIAA0595, MGC74642	uc001kum.3	Q5VV67	OTTHUMG00000018948	ENST00000278070.2:c.3001C>G	10.37:g.103901266C>G	ENSP00000278070:p.Pro1001Ala	Somatic	85	0		WXS	Illumina GAIIx	Phase_I	95	10	NM_015062	0	0	6	10	4	Q5VV66|Q6P3U5|Q6P3W1|Q76N31|Q9BUJ3|Q9BZE5|Q9Y4E0	Missense_Mutation	SNP	ENST00000278070.2	37	CCDS7529.1	.	.	.	.	.	.	.	.	.	.	C	15.28	2.785653	0.49997	.	.	ENSG00000148840	ENST00000278070;ENST00000413464	T;T	0.30182	1.66;1.54	5.79	5.79	0.91817	.	0.077729	0.53938	D	0.000054	T	0.46483	0.1395	L	0.32530	0.975	0.39925	D	0.974211	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.998	T	0.31668	-0.9935	10	0.42905	T	0.14	.	17.8243	0.88660	0.0:1.0:0.0:0.0	.	1001;881;1001	E7EVG6;Q5VV67-2;Q5VV67	.;.;PPRC1_HUMAN	A	1001	ENSP00000278070:P1001A;ENSP00000399743:P1001A	ENSP00000278070:P1001A	P	+	1	0	PPRC1	103891256	0.000000	0.05858	1.000000	0.80357	0.450000	0.32258	0.043000	0.13971	2.745000	0.94114	0.462000	0.41574	CCT	.		0.562	PPRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050021.1	NM_015062	
NFKB2	4791	hgsc.bcm.edu	37	10	104159196	104159196	+	Silent	SNP	A	A	G	rs4919633	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr10:104159196A>G	ENST00000369966.3	+	13	1519	c.1269A>G	c.(1267-1269)ccA>ccG	p.P423P	NFKB2_ENST00000428099.1_Silent_p.P423P|NFKB2_ENST00000336486.5_3'UTR|NFKB2_ENST00000189444.6_Silent_p.P423P	NM_001077494.2	NP_001070962.1	Q00653	NFKB2_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)	423					extracellular matrix organization (GO:0030198)|follicular dendritic cell differentiation (GO:0002268)|germinal center formation (GO:0002467)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|spleen development (GO:0048536)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	Bcl3/NF-kappaB2 complex (GO:0033257)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(10)|skin(2)	23		Colorectal(252;0.00957)		Epithelial(162;3.4e-08)|all cancers(201;6.41e-07)	Acetylsalicylic acid(DB00945)|Glucosamine(DB01296)	CCGCGGAGCCAAGCGCCCCCT	0.786			T	IGH@	B-NHL								G|||	4942	0.986821	0.9539	0.9942	5008	,	,		10589	1.0		0.999	False		,,,				2504	1.0				p.P423P		.		Dom	yes		10	10q24	4791	nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)		L	.	NFKB2-522	0			c.A1269G						.	G	,,	2876,76		1401,74,1	3.0	5.0	4.0		1269,1269,1269	-4.9	0.0	10	dbSNP_111	4	6622,2		3310,2,0	no	coding-synonymous,coding-synonymous,coding-synonymous	NFKB2	NM_001077493.1,NM_001077494.1,NM_002502.3	,,	4711,76,1	GG,GA,AA		0.0302,2.5745,0.8145	,,	423/900,423/901,423/900	104159196	9498,78	1476	3312	4788	SO:0001819	synonymous_variant	4791	exon13			GGAGCCAAGCGCC	X61498	CCDS41564.1, CCDS41565.1	10q24	2013-01-10			ENSG00000077150	ENSG00000077150		"""Ankyrin repeat domain containing"""	7795	protein-coding gene	gene with protein product		164012				1876189	Standard	XM_005269860		Approved	LYT-10, p52, p105, NF-kB2	uc001kvb.4	Q00653	OTTHUMG00000018962	ENST00000369966.3:c.1269A>G	10.37:g.104159196A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_001077494	0	0	0	11	11	A8K9D9|D3DR83|Q04860|Q9BU75|Q9H471|Q9H472	Silent	SNP	ENST00000369966.3	37	CCDS41564.1																																																																																			A|0.009;G|0.991		0.786	NFKB2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050080.2		
MKI67	4288	bcgsc.ca	37	10	129901747	129901747	+	Missense_Mutation	SNP	C	C	T	rs10764749	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr10:129901747C>T	ENST00000368654.3	-	13	8732	c.8357G>A	c.(8356-8358)cGg>cAg	p.R2786Q	MKI67_ENST00000368653.3_Missense_Mutation_p.R2426Q	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	2786	16 X 122 AA approximate repeats.		R -> Q (in dbSNP:rs10764749).		cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				TGCTCTTGGCCGTCTCCTGCT	0.502													C|||	900	0.179712	0.0787	0.3112	5008	,	,		14562	0.1181		0.2704	False		,,,				2504	0.1933				p.R2786Q		.											.	MKI67-519	0			c.G8357A						.	C	GLN/ARG,GLN/ARG	412,3994	200.4+/-223.7	16,380,1807	75.0	75.0	75.0		7277,8357	-5.0	0.0	10	dbSNP_120	75	2131,6469	364.6+/-333.6	272,1587,2441	yes	missense,missense	MKI67	NM_001145966.1,NM_002417.4	43,43	288,1967,4248	TT,TC,CC		24.7791,9.3509,19.5525	probably-damaging,probably-damaging	2426/2897,2786/3257	129901747	2543,10463	2203	4300	6503	SO:0001583	missense	4288	exon13			CTTGGCCGTCTCC	X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.8357G>A	10.37:g.129901747C>T	ENSP00000357643:p.Arg2786Gln	Somatic	54	0		WXS	Illumina GAIIx	Phase_I	66	5	NM_002417	0	0	6	6	0	Q5VWH2	Missense_Mutation	SNP	ENST00000368654.3	37	CCDS7659.1	433	0.19826007326007325	29	0.05894308943089431	119	0.3287292817679558	83	0.1451048951048951	202	0.26649076517150394	C	16.23	3.065692	0.55539	0.093509	0.247791	ENSG00000148773	ENST00000368654;ENST00000368653;ENST00000537609	T;T	0.01902	4.57;4.57	3.93	-5.02	0.02982	.	.	.	.	.	T	0.00012	0.0000	N	0.10874	0.06	0.80722	P	0.0	D;P;P	0.62365	0.991;0.698;0.743	P;B;B	0.50570	0.644;0.139;0.156	T	0.37709	-0.9694	8	0.12103	T	0.63	.	0.5841	0.00717	0.4036:0.2032:0.1195:0.2738	rs10764749;rs52837602;rs10764749	2785;2426;2786	F5H4V4;P46013-2;P46013	.;.;KI67_HUMAN	Q	2786;2426;2785	ENSP00000357643:R2786Q;ENSP00000357642:R2426Q	ENSP00000357642:R2426Q	R	-	2	0	MKI67	129791737	0.000000	0.05858	0.000000	0.03702	0.412000	0.31113	-0.829000	0.04415	-1.121000	0.02949	0.655000	0.94253	CGG	C|0.808;T|0.192		0.502	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050999.1	NM_002417	
DRD4	1815	hgsc.bcm.edu	37	11	639873	639873	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr11:639873G>A	ENST00000176183.5	+	3	636	c.624G>A	c.(622-624)atG>atA	p.M208I		NM_000797.3	NP_000788.2	P21917	DRD4_HUMAN	dopamine receptor D4	208					activation of MAPK activity (GO:0000187)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|adult locomotory behavior (GO:0008344)|arachidonic acid secretion (GO:0050482)|behavioral fear response (GO:0001662)|behavioral response to cocaine (GO:0048148)|behavioral response to ethanol (GO:0048149)|cellular calcium ion homeostasis (GO:0006874)|circadian rhythm (GO:0007623)|dopamine metabolic process (GO:0042417)|dopamine receptor signaling pathway (GO:0007212)|fear response (GO:0042596)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of protein secretion (GO:0050709)|negative regulation of voltage-gated calcium channel activity (GO:1901386)|olfactory learning (GO:0008355)|photoperiodism (GO:0009648)|positive regulation of dopamine uptake involved in synaptic transmission (GO:0051586)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of kinase activity (GO:0033674)|positive regulation of penile erection (GO:0060406)|positive regulation of sodium:proton antiporter activity (GO:0032417)|regulation of calcium-mediated signaling (GO:0050848)|regulation of circadian rhythm (GO:0042752)|regulation of dopamine metabolic process (GO:0042053)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of neurotransmitter secretion (GO:0046928)|response to amphetamine (GO:0001975)|response to histamine (GO:0034776)|response to steroid hormone (GO:0048545)|retina development in camera-type eye (GO:0060041)|short-term memory (GO:0007614)|social behavior (GO:0035176)|synaptic transmission, dopaminergic (GO:0001963)	cell cortex (GO:0005938)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|terminal bouton (GO:0043195)|vesicle membrane (GO:0012506)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity (GO:0004952)|dopamine neurotransmitter receptor activity, coupled via Gi/Go (GO:0001591)|drug binding (GO:0008144)|identical protein binding (GO:0042802)|potassium channel regulator activity (GO:0015459)|SH3 domain binding (GO:0017124)			NS(1)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	4		all_cancers(49;1.69e-08)|all_epithelial(84;1.65e-05)|Breast(177;0.000231)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;4.36e-28)|Epithelial(43;2.59e-27)|OV - Ovarian serous cystadenocarcinoma(40;3.53e-21)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0234)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Clozapine(DB00363)|Dopamine(DB00988)|Iloperidone(DB04946)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Methotrimeprazine(DB01403)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Pramipexole(DB00413)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Ziprasidone(DB00246)	GCCCGCTCATGCTGCTGCTCT	0.731																																					p.M208I		.											.	DRD4-90	0			c.G624A						.						52.0	39.0	44.0					11																	639873		2200	4300	6500	SO:0001583	missense	1815	exon3			GCTCATGCTGCTG	L12398	CCDS7710.1	11p15.5	2012-08-08			ENSG00000069696	ENSG00000069696		"""GPCR / Class A : Dopamine receptors"""	3025	protein-coding gene	gene with protein product		126452					Standard	NM_000797		Approved		uc001lqp.2	P21917	OTTHUMG00000133312	ENST00000176183.5:c.624G>A	11.37:g.639873G>A	ENSP00000176183:p.Met208Ile	Somatic	10	0		WXS	Illumina GAIIx	Phase_I	22	7	NM_000797	0	0	0	0	0	B0M0J7|Q7Z7Q5|Q8NGM5	Missense_Mutation	SNP	ENST00000176183.5	37	CCDS7710.1	.	.	.	.	.	.	.	.	.	.	G	19.53	3.845580	0.71603	.	.	ENSG00000069696	ENST00000176183	T	0.31510	1.49	3.03	3.03	0.35002	GPCR, rhodopsin-like superfamily (1);	0.101474	0.64402	D	0.000003	T	0.52645	0.1747	.	.	.	0.58432	D	0.999999	D	0.69078	0.997	D	0.77004	0.989	T	0.56848	-0.7911	9	0.46703	T	0.11	.	13.265	0.60128	0.0:0.0:1.0:0.0	.	208	P21917	DRD4_HUMAN	I	208	ENSP00000176183:M208I	ENSP00000176183:M208I	M	+	3	0	DRD4	629873	1.000000	0.71417	1.000000	0.80357	0.875000	0.50365	6.794000	0.75135	1.695000	0.51148	0.462000	0.41574	ATG	.		0.731	DRD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257109.1	NM_000797	
MUC2	4583	broad.mit.edu	37	11	1093344	1093344	+	Silent	SNP	G	G	T			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr11:1093344G>T	ENST00000441003.2	+	30	5190	c.5163G>T	c.(5161-5163)ccG>ccT	p.P1721P	MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_Silent_p.P9P|MUC2_ENST00000359061.5_Silent_p.P1688P	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.P1688P(1)|p.P1721P(1)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	ccccaaccccgacacccatct	0.642																																					p.P1721P		.											.	MUC2-90	2	Substitution - coding silent(2)	lung(2)	c.G5163T						.						231.0	269.0	256.0					11																	1093344		1975	3757	5732	SO:0001819	synonymous_variant	4583	exon30			AACCCCGACACCC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5163G>T	11.37:g.1093344G>T		Somatic	104	1		WXS	Illumina GAIIx	Phase_I	157	7	NM_002457	0	0	0	0	0	Q14878	Silent	SNP	ENST00000441003.2	37																																																																																				.		0.642	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MUC2	4583	bcgsc.ca	37	11	1093393	1093393	+	Missense_Mutation	SNP	G	G	A	rs199525790		TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr11:1093393G>A	ENST00000441003.2	+	30	5239	c.5212G>A	c.(5212-5214)Ggc>Agc	p.G1738S	MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_Missense_Mutation_p.G26S|MUC2_ENST00000359061.5_Missense_Mutation_p.G1705S	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	aacacccaccggcacacagac	0.647																																					p.G1738S		.											.	MUC2-90	0			c.G5212A						.						167.0	217.0	200.0					11																	1093393		1999	3870	5869	SO:0001583	missense	4583	exon30			CCCACCGGCACAC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5212G>A	11.37:g.1093393G>A	ENSP00000415183:p.Gly1738Ser	Somatic	141	6		WXS	Illumina GAIIx	Phase_I	170	10	NM_002457	0	0	0	0	0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	G	0.322	-0.961495	0.02249	.	.	ENSG00000198788	ENST00000441003;ENST00000359061;ENST00000333592	T;T;T	0.16743	3.21;3.25;2.32	0.677	-1.35	0.09114	.	381.381000	0.01358	N	0.012136	T	0.08537	0.0212	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.21861	-1.0233	9	0.12430	T	0.62	.	4.7623	0.13113	0.7467:0.0:0.2533:0.0	.	1738	E7EUV1	.	S	1738;1705;26	ENSP00000415183:G1738S;ENSP00000351956:G1705S;ENSP00000331373:G26S	ENSP00000331373:G26S	G	+	1	0	MUC2	1083393	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.042000	0.13949	-0.796000	0.04456	-1.112000	0.02068	GGC	.		0.647	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
NELL1	4745	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	21250963	21250963	+	Nonsense_Mutation	SNP	C	C	A			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr11:21250963C>A	ENST00000357134.5	+	14	1664	c.1512C>A	c.(1510-1512)tgC>tgA	p.C504*	NELL1_ENST00000298925.5_Nonsense_Mutation_p.C532*|NELL1_ENST00000325319.5_Nonsense_Mutation_p.C447*|NELL1_ENST00000532434.1_Nonsense_Mutation_p.C504*	NM_006157.3|NM_201551.1	NP_006148.2|NP_963845.1	Q92832	NELL1_HUMAN	NEL-like 1 (chicken)	504	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell differentiation (GO:0030154)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of osteoblast proliferation (GO:0033689)|nervous system development (GO:0007399)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of gene expression (GO:0010468)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(5)|kidney(3)|large_intestine(15)|lung(36)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	70						GCTGCACCTGCAAACCGGGCT	0.567																																					p.C504X		.											.	NELL1-155	0			c.C1512A						.						107.0	76.0	87.0					11																	21250963		2203	4300	6503	SO:0001587	stop_gained	4745	exon14			CACCTGCAAACCG	AK127805	CCDS7855.1, CCDS44555.1, CCDS73267.1, CCDS73268.1	11p15.1	2008-02-01	2001-11-28		ENSG00000165973	ENSG00000165973			7750	protein-coding gene	gene with protein product		602319	"""nel (chicken)-like 1"""			8975702	Standard	NM_006157		Approved	IDH3GL, FLJ45906	uc001mqe.3	Q92832	OTTHUMG00000166042	ENST00000357134.5:c.1512C>A	11.37:g.21250963C>A	ENSP00000349654:p.Cys504*	Somatic	235	0		WXS	Illumina GAIIx	Phase_I	277	36	NM_006157	0	0	0	0	0	B2CKC1|Q4VB90|Q4VB91|Q6NSY8|Q9Y472	Nonsense_Mutation	SNP	ENST00000357134.5	37	CCDS7855.1	.	.	.	.	.	.	.	.	.	.	C	36	5.902959	0.97087	.	.	ENSG00000165973	ENST00000298925;ENST00000357134;ENST00000325319;ENST00000532434	.	.	.	5.81	4.9	0.64082	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.1684	10.9561	0.47358	0.0:0.8581:0.0:0.1419	.	.	.	.	X	532;504;447;504	.	ENSP00000298925:C532X	C	+	3	2	NELL1	21207539	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.073000	0.57570	1.468000	0.48064	-0.136000	0.14681	TGC	.		0.567	NELL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387588.1	NM_006157	
FERMT3	83706	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	63978534	63978534	+	Missense_Mutation	SNP	C	C	G	rs78810429	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr11:63978534C>G	ENST00000279227.5	+	4	500	c.405C>G	c.(403-405)caC>caG	p.H135Q	FERMT3_ENST00000345728.5_Missense_Mutation_p.H135Q	NM_178443.2	NP_848537.1	Q86UX7	URP2_HUMAN	fermitin family member 3	135					integrin activation (GO:0033622)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|platelet aggregation (GO:0070527)|regulation of cell-cell adhesion mediated by integrin (GO:0033632)|substrate adhesion-dependent cell spreading (GO:0034446)	cell junction (GO:0030054)|cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|podosome (GO:0002102)	integrin binding (GO:0005178)			breast(1)|cervix(1)|endometrium(4)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	18						GCATCCGGCACCCCGAGGAGC	0.617																																					p.H135Q		.											.	FERMT3-23	0			c.C405G						.						13.0	14.0	14.0					11																	63978534		2194	4292	6486	SO:0001583	missense	83706	exon4			CCGGCACCCCGAG	L25343	CCDS8059.1, CCDS8060.1	11q13.1	2014-09-17	2010-06-24		ENSG00000149781	ENSG00000149781		"""Fermitins"", ""Pleckstrin homology (PH) domain containing"""	23151	protein-coding gene	gene with protein product	"""kindlin-3"""	607901	"""fermitin family homolog 3 (Drosophila)"""				Standard	NM_178443		Approved	URP2, KIND3, MIG2B, MGC10966, MIG-2, UNC112C	uc001nym.2	Q86UX7	OTTHUMG00000167790	ENST00000279227.5:c.405C>G	11.37:g.63978534C>G	ENSP00000279227:p.His135Gln	Somatic	66	0		WXS	Illumina GAIIx	Phase_I	88	22	NM_031471	0	0	0	0	0	Q8IUA1|Q8N207|Q9BT48	Missense_Mutation	SNP	ENST00000279227.5	37	CCDS8060.1	.	.	.	.	.	.	.	.	.	.	C	14.05	2.420815	0.42918	.	.	ENSG00000149781	ENST00000544997;ENST00000345728;ENST00000279227	T;T;T	0.75704	-0.96;0.84;0.84	3.84	0.848	0.18966	Band 4.1 domain (1);	0.148042	0.43110	D	0.000602	T	0.73729	0.3624	L	0.46157	1.445	0.41546	D	0.988548	D;P	0.64830	0.994;0.628	P;B	0.56474	0.799;0.421	T	0.71083	-0.4695	10	0.66056	D	0.02	-21.2512	7.4651	0.27316	0.0:0.6915:0.0:0.3085	.	135;135	Q86UX7-2;Q86UX7	.;URP2_HUMAN	Q	135	ENSP00000445778:H135Q;ENSP00000339950:H135Q;ENSP00000279227:H135Q	ENSP00000279227:H135Q	H	+	3	2	FERMT3	63735110	0.997000	0.39634	0.997000	0.53966	0.937000	0.57800	0.503000	0.22610	-0.027000	0.13873	-0.350000	0.07774	CAC	C|0.993;T|0.007		0.617	FERMT3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000396297.1	NM_031471	
PYGM	5837	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	64518843	64518843	+	Silent	SNP	G	G	A			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr11:64518843G>A	ENST00000164139.3	-	16	2321	c.1923C>T	c.(1921-1923)ctC>ctT	p.L641L	PYGM_ENST00000377432.3_Silent_p.L553L|PYGM_ENST00000462303.1_5'UTR	NM_005609.2	NP_005600.1	P11217	PYGM_HUMAN	phosphorylase, glycogen, muscle	641					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	glycogen phosphorylase activity (GO:0008184)|nucleotide binding (GO:0000166)|pyridoxal phosphate binding (GO:0030170)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(21)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						AGATGACACGGAGGCGGTCAC	0.587																																					p.L641L		.											.	PYGM-92	0			c.C1923T						.						85.0	84.0	84.0					11																	64518843		2201	4297	6498	SO:0001819	synonymous_variant	5837	exon16			GACACGGAGGCGG		CCDS8079.1, CCDS53659.1	11q12-q13.2	2013-03-01	2008-07-31		ENSG00000068976	ENSG00000068976	2.4.1.1	"""Glycogen phosphorylases"""	9726	protein-coding gene	gene with protein product	"""McArdle syndrome"", ""glycogen storage disease type V"", ""glycogen phosphorylase, muscle form"""	608455	"""phosphorylase, glycogen; muscle"""				Standard	NM_005609		Approved		uc001oax.4	P11217	OTTHUMG00000066835	ENST00000164139.3:c.1923C>T	11.37:g.64518843G>A		Somatic	142	0		WXS	Illumina GAIIx	Phase_I	205	52	NM_005609	0	0	1	1	0	A0AVK1|A6NDY6	Silent	SNP	ENST00000164139.3	37	CCDS8079.1																																																																																			.		0.587	PYGM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143254.2	NM_005609	
SYVN1	84447	hgsc.bcm.edu	37	11	64898229	64898229	+	Silent	SNP	T	T	C	rs111304413	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr11:64898229T>C	ENST00000377190.3	-	11	1102	c.1008A>G	c.(1006-1008)gcA>gcG	p.A336A	SYVN1_ENST00000307289.6_Silent_p.A285A|SYVN1_ENST00000526121.1_5'UTR|SYVN1_ENST00000526060.1_Silent_p.A336A|SYVN1_ENST00000294256.8_Silent_p.A336A	NM_172230.2	NP_757385.1	Q86TM6	SYVN1_HUMAN	synovial apoptosis inhibitor 1, synoviolin	336					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|in utero embryonic development (GO:0001701)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|protein N-linked glycosylation via asparagine (GO:0018279)|protein ubiquitination (GO:0016567)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	22						CTGGCAGCGATGCACGAAGGA	0.697													t|||	70	0.0139776	0.0507	0.0014	5008	,	,		10336	0.0		0.002	False		,,,				2504	0.0				p.A336A		.											.	SYVN1-91	0			c.A1008G						.	T	,	174,4228		1,172,2028	21.0	26.0	24.0		1008,1008	-0.3	1.0	11	dbSNP_132	24	1,8587		0,1,4293	no	coding-synonymous,coding-synonymous	SYVN1	NM_032431.2,NM_172230.2	,	1,173,6321	CC,CT,TT		0.0116,3.9527,1.3472	,	336/617,336/618	64898229	175,12815	2201	4294	6495	SO:0001819	synonymous_variant	84447	exon11			CAGCGATGCACGA	AB085847	CCDS8097.1, CCDS31605.1	11q13	2013-01-09			ENSG00000162298	ENSG00000162298		"""RING-type (C3HC4) zinc fingers"""	20738	protein-coding gene	gene with protein product	"""HMG-coA reductase degradation 1 homolog (S. cerevisiae)"""	608046				12975321	Standard	NM_032431		Approved	HRD1, DER3	uc001odb.3	Q86TM6		ENST00000377190.3:c.1008A>G	11.37:g.64898229T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	12	10	NM_172230	0	0	12	32	20	Q8N3K3|Q8N6E8|Q96JL5|Q96PK3	Silent	SNP	ENST00000377190.3	37	CCDS31605.1																																																																																			A|0.000;C|0.015;T|0.985		0.697	SYVN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000385274.1	NM_032431	
HTR3A	3359	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	113857492	113857492	+	Intron	SNP	C	C	A			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr11:113857492C>A	ENST00000504030.2	+	7	1361				HTR3A_ENST00000299961.5_Intron|HTR3A_ENST00000355556.2_Missense_Mutation_p.P326T|HTR3A_ENST00000375498.2_Intron|HTR3A_ENST00000535865.1_Intron|HTR3A_ENST00000506841.2_Missense_Mutation_p.P320T			P46098	5HT3A_HUMAN	5-hydroxytryptamine (serotonin) receptor 3A, ionotropic						cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|cellular response to growth factor stimulus (GO:0071363)|digestion (GO:0007586)|ion transmembrane transport (GO:0034220)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor activity (GO:0004872)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)|serotonin-activated cation-selective channel activity (GO:0005232)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(14)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	36		all_cancers(61;2.31e-17)|all_epithelial(67;2.1e-10)|all_hematologic(158;4.64e-05)|Melanoma(852;0.000312)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0294)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.71e-06)|Epithelial(105;2.58e-05)|all cancers(92;0.000238)|OV - Ovarian serous cystadenocarcinoma(223;0.191)	Alosetron(DB00969)|Amoxapine(DB00543)|Aripiprazole(DB01238)|Chloroprocaine(DB01161)|Cisapride(DB00604)|Clozapine(DB00363)|Dolasetron(DB00757)|Ergoloid mesylate(DB01049)|Granisetron(DB00889)|Loxapine(DB00408)|Memantine(DB01043)|Methadone(DB00333)|Metoclopramide(DB01233)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Ondansetron(DB00904)|Palonosetron(DB00377)|Procaine(DB00721)|Quetiapine(DB01224)|Rocuronium(DB00728)|Tapentadol(DB06204)|Trimipramine(DB00726)|Tubocurarine(DB01199)|Ziprasidone(DB00246)	TGGTGAGAAACCCGCCCCCTC	0.592																																					p.P326T		.											.	HTR3A-90	0			c.C976A						.						115.0	102.0	106.0					11																	113857492		2201	4296	6497	SO:0001627	intron_variant	3359	exon7			GAGAAACCCGCCC	D49394	CCDS8365.1, CCDS8366.1, CCDS8365.2, CCDS8366.2, CCDS53710.1	11q23.1-q23.2	2012-05-22	2012-02-03					"""5-HT (serotonin) receptors"", ""Ligand-gated ion channels / 5-HT (serotonin) receptors, ionotropic"""	5297	protein-coding gene	gene with protein product		182139	"""5-hydroxytryptamine (serotonin) receptor 3A"""	HTR3		8530095, 12867984	Standard	NM_000869		Approved	5-HT3R, 5-HT3A	uc010rxb.2	P46098		ENST00000504030.2:c.916+42C>A	11.37:g.113857492C>A		Somatic	132	0		WXS	Illumina GAIIx	Phase_I	136	12	NM_213621	0	0	0	0	0	B4DSY6|G5E986|O60854|Q7KZM7|Q99918|Q9BSZ9	Missense_Mutation	SNP	ENST00000504030.2	37		.	.	.	.	.	.	.	.	.	.	C	0.650	-0.810078	0.02798	.	.	ENSG00000166736	ENST00000355556;ENST00000506841	T;T	0.74947	-0.89;-0.87	4.08	-0.0931	0.13652	.	11.953300	0.00166	N	0.000000	T	0.51210	0.1661	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.31586	-0.9938	9	.	.	.	2.4848	1.7299	0.02929	0.1213:0.298:0.3533:0.2275	.	326	G5E986	.	T	326;320	ENSP00000347754:P326T;ENSP00000424776:P320T	.	P	+	1	0	HTR3A	113362702	0.000000	0.05858	0.000000	0.03702	0.028000	0.11728	-0.403000	0.07214	-0.118000	0.11851	0.561000	0.74099	CCC	.		0.592	HTR3A-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000360822.2	NM_000869	
GALNT8	26290	bcgsc.ca	37	12	4853806	4853806	+	Missense_Mutation	SNP	A	A	G	rs34776842	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr12:4853806A>G	ENST00000252318.2	+	4	1137	c.800A>G	c.(799-801)gAa>gGa	p.E267G		NM_017417.1	NP_059113.1	Q9NY28	GALT8_HUMAN	polypeptide N-acetylgalactosaminyltransferase 8	267	Catalytic subdomain A.		E -> G (in dbSNP:rs34776842). {ECO:0000269|PubMed:10767557}.		cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(13)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(1)	35						ACTGGCTGGGAAGCTGCCACA	0.488													A|||	98	0.0195687	0.0008	0.0375	5008	,	,		21968	0.0		0.0626	False		,,,				2504	0.0082				p.E267G	Colon(108;631 1558 7270 20097 39846)	.											.	GALNT8-230	0			c.A800G						.	A	GLY/GLU	60,4346		0,60,2143	62.0	49.0	53.0		800	2.0	0.9	12	dbSNP_126	53	637,7963		26,585,3689	yes	missense	GALNT8	NM_017417.1	98	26,645,5832	GG,GA,AA		7.407,1.3618,5.3591	benign	267/638	4853806	697,12309	2203	4300	6503	SO:0001583	missense	26290	exon4			GCTGGGAAGCTGC	AJ271385	CCDS8533.1	12p13.32	2014-03-13	2014-03-13		ENSG00000130035	ENSG00000130035	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4130	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 8"""	606250	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 8 (GalNAc-T8)"""			10767557	Standard	NM_017417		Approved	GALNAC-T8	uc001qne.1	Q9NY28	OTTHUMG00000166188	ENST00000252318.2:c.800A>G	12.37:g.4853806A>G	ENSP00000252318:p.Glu267Gly	Somatic	92	0		WXS	Illumina GAIIx	Phase_I	140	5	NM_017417	0	0	0	0	0	B2RU02	Missense_Mutation	SNP	ENST00000252318.2	37	CCDS8533.1	261	0.11950549450549451	26	0.052845528455284556	46	0.1270718232044199	85	0.1486013986013986	104	0.13720316622691292	A	13.01	2.109331	0.37242	0.013618	0.07407	ENSG00000130035	ENST00000252318	T	0.63096	-0.02	4.5	2.0	0.26442	Glycosyl transferase, family 2 (1);	0.531713	0.19101	N	0.122697	T	0.00384	0.0012	L	0.48174	1.505	0.25632	N	0.986292	B	0.19200	0.034	B	0.21917	0.037	T	0.01056	-1.1466	9	.	.	.	.	9.513	0.39089	0.6569:0.3431:0.0:0.0	rs34776842;rs61753192	267	Q9NY28	GALT8_HUMAN	G	267	ENSP00000252318:E267G	.	E	+	2	0	GALNT8	4724067	0.012000	0.17670	0.886000	0.34754	0.996000	0.88848	0.521000	0.22893	0.224000	0.20940	0.397000	0.26171	GAA	A|0.927;G|0.073		0.488	GALNT8-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388277.2	NM_017417	
PRB3	5544	hgsc.bcm.edu;broad.mit.edu	37	12	11421070	11421070	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr12:11421070C>A	ENST00000279573.7	-	3	248	c.113G>T	c.(112-114)gGa>gTa	p.G38V	PRB3_ENST00000538488.1_Missense_Mutation_p.G38V|PRB3_ENST00000440870.3_5'UTR|PRB3_ENST00000381842.3_Missense_Mutation_p.G38V			Q04118	PRB3_HUMAN	proline-rich protein BstNI subfamily 3	38	Pro-rich.				defense response to Gram-negative bacterium (GO:0050829)	extracellular region (GO:0005576)				breast(2)|endometrium(1)|kidney(2)|large_intestine(1)|lung(13)|ovary(1)|skin(5)	25			OV - Ovarian serous cystadenocarcinoma(49;0.201)			TGGGCGTCGTCCTTCTGGCTT	0.537																																					p.G38V		.											.	PRB3-1	0			c.G113T						.						94.0	77.0	82.0					12																	11421070		2139	4241	6380	SO:0001583	missense	5544	exon3			CGTCGTCCTTCTG			12p13.2	2012-10-02				ENSG00000197870			9339	protein-coding gene	gene with protein product		168840				1894623	Standard	NM_006249		Approved	PRG	uc001qzs.3	Q04118		ENST00000279573.7:c.113G>T	12.37:g.11421070C>A	ENSP00000279573:p.Gly38Val	Somatic	18	0		WXS	Illumina GAIIx	Phase_I	25	4	NM_006249	0	0	0	0	0	Q15188|Q4VAY3|Q4VAY4|Q7M4M9|Q9UCT9	Missense_Mutation	SNP	ENST00000279573.7	37		.	.	.	.	.	.	.	.	.	.	.	3.264	-0.150618	0.06585	.	.	ENSG00000197870	ENST00000381842;ENST00000538488	T;T	0.05025	3.51;3.51	0.548	-1.1	0.09872	.	.	.	.	.	T	0.04407	0.0121	.	.	.	0.09310	N	1	B	0.19817	0.039	B	0.15870	0.014	T	0.41466	-0.9507	7	0.62326	D	0.03	.	.	.	.	.	38	Q04118	PRB3_HUMAN	V	38	ENSP00000371264:G38V;ENSP00000442626:G38V	ENSP00000279573:G38V	G	-	2	0	PRB3	11312337	0.000000	0.05858	0.002000	0.10522	0.046000	0.14306	-0.063000	0.11655	-1.280000	0.02402	0.164000	0.16699	GGA	.		0.537	PRB3-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000402119.5	NM_006249	
PRB4	5545	hgsc.bcm.edu	37	12	11461804	11461804	+	Missense_Mutation	SNP	C	C	A	rs150367358	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr12:11461804C>A	ENST00000535904.1	-	3	146	c.113G>T	c.(112-114)gGa>gTa	p.G38V	PRB4_ENST00000279575.1_Missense_Mutation_p.G38V|PRB4_ENST00000445719.2_Missense_Mutation_p.G38V			P10163	PRB4_HUMAN	proline-rich protein BstNI subfamily 4	38	9.5 X 21 AA tandem repeats of K-P-[EQ]- [GR]-[PR]-[PR]-P-Q-G-G-N-Q-[PS]-[QH]- [RG]-[PT]-P-P-[PH]-P-G.			LISGKPEGR -> IIPPKPPG (in Ref. 5; AA sequence). {ECO:0000305}.		extracellular region (GO:0005576)				breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|skin(4)|upper_aerodigestive_tract(3)	30						TGGGCGTCGTCCTTCTGGCTT	0.537										HNSCC(22;0.051)																											p.G38V		.											.	PRB4-91	0			c.G113T						.						188.0	201.0	196.0					12																	11461804		2197	4292	6489	SO:0001583	missense	5545	exon3			CGTCGTCCTTCTG		CCDS8641.1, CCDS58208.1	12p13.2	2012-10-02			ENSG00000230657	ENSG00000230657			9340	protein-coding gene	gene with protein product		180990					Standard	NM_002723		Approved		uc001qzt.4	P10163	OTTHUMG00000169116	ENST00000535904.1:c.113G>T	12.37:g.11461804C>A	ENSP00000442834:p.Gly38Val	Somatic	38	0		WXS	Illumina GAIIx	Phase_I	56	4	NM_001261399	0	0	0	0	0	A1L439|O00600|P02813|P10161|P10162|P81489	Missense_Mutation	SNP	ENST00000535904.1	37	CCDS8641.1	.	.	.	.	.	.	.	.	.	.	.	5.758	0.324295	0.10900	.	.	ENSG00000230657	ENST00000279575;ENST00000535904;ENST00000445719	T;T;T	0.05025	3.51;3.51;3.51	0.419	0.419	0.16438	.	.	.	.	.	T	0.13286	0.0322	L	0.36672	1.1	0.09310	N	1	D	0.76494	0.999	D	0.76575	0.988	T	0.17258	-1.0375	8	0.66056	D	0.02	.	.	.	.	.	38	E9PAL0	.	V	38	ENSP00000279575:G38V;ENSP00000442834:G38V;ENSP00000412740:G38V	ENSP00000279575:G38V	G	-	2	0	PRB4	11353071	0.002000	0.14202	0.016000	0.15963	0.100000	0.18952	0.570000	0.23653	0.444000	0.26612	0.195000	0.17529	GGA	C|0.999;T|0.001		0.537	PRB4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402308.1	NM_002723	
C12orf36	283422	broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	13526239	13526239	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr12:13526239T>A	ENST00000318426.2	-	3	533	c.316A>T	c.(316-318)Agg>Tgg	p.R106W	C12orf36_ENST00000527705.2_Missense_Mutation_p.R106W|C12orf36_ENST00000531049.1_5'Flank					chromosome 12 open reading frame 36											lung(3)|skin(3)	6				BRCA - Breast invasive adenocarcinoma(232;0.198)		CTCTTCAGCCTCTGAATCCTC	0.478																																					.		.											.	C12orf36-90	0			.						.						214.0	206.0	209.0					12																	13526239		2203	4300	6503	SO:0001583	missense	283422	.			TCAGCCTCTGAAT	AK091129		12p13.1	2012-08-14			ENSG00000180861	ENSG00000180861			26598	protein-coding gene	gene with protein product							Standard	NR_036555		Approved	FLJ33810	uc001rbs.2	Q495D7	OTTHUMG00000167562	ENST00000318426.2:c.316A>T	12.37:g.13526239T>A	ENSP00000443007:p.Arg106Trp	Somatic	91	0		WXS	Illumina GAIIx	Phase_I	79	12	.	0	0	0	0	0		RNA	SNP	ENST00000318426.2	37		.	.	.	.	.	.	.	.	.	.	T	8.624	0.892103	0.17613	.	.	ENSG00000180861	ENST00000318426;ENST00000527705	T;T	0.32272	1.46;1.46	4.05	1.94	0.25998	.	.	.	.	.	T	0.19644	0.0472	.	.	.	0.09310	N	1	B	0.24618	0.107	B	0.24541	0.054	T	0.31251	-0.9950	8	0.87932	D	0	.	1.4275	0.02326	0.3441:0.344:0.0:0.312	.	106	Q495D7	CL036_HUMAN	W	106	ENSP00000443007:R106W;ENSP00000443346:R106W	ENSP00000443007:R106W	R	-	1	2	C12orf36	13417506	0.000000	0.05858	0.001000	0.08648	0.008000	0.06430	0.186000	0.16978	0.504000	0.28082	0.533000	0.62120	AGG	.		0.478	C12orf36-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000395025.2	NM_182558	
PLEKHA5	54477	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	19499950	19499950	+	Intron	SNP	G	G	T			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr12:19499950G>T	ENST00000299275.6	+	18	2406				PLEKHA5_ENST00000359180.3_Intron|PLEKHA5_ENST00000539256.1_Intron|PLEKHA5_ENST00000429027.2_Missense_Mutation_p.R911L|PLEKHA5_ENST00000424268.1_Missense_Mutation_p.R734L|PLEKHA5_ENST00000355397.3_Intron|PLEKHA5_ENST00000317589.4_Missense_Mutation_p.R808L|PLEKHA5_ENST00000538714.1_Intron|PLEKHA5_ENST00000543806.1_Missense_Mutation_p.R727L	NM_019012.5	NP_061885.2	Q9HAU0	PKHA5_HUMAN	pleckstrin homology domain containing, family A member 5						reproductive system development (GO:0061458)	cytosol (GO:0005829)|membrane (GO:0016020)	1-phosphatidylinositol binding (GO:0005545)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)					GTCCCACCTCGTCCTCCACTT	0.453																																					p.R911L	Pancreas(196;329 2193 11246 14234 19524)	.											.	PLEKHA5-227	0			c.G2732T						.						70.0	62.0	64.0					12																	19499950		692	1591	2283	SO:0001627	intron_variant	54477	exon24			CACCTCGTCCTCC	AF302150	CCDS8682.1, CCDS44840.1, CCDS44840.2, CCDS55809.1, CCDS58213.1, CCDS58214.1	12p12	2013-01-10			ENSG00000052126	ENSG00000052126		"""Pleckstrin homology (PH) domain containing"""	30036	protein-coding gene	gene with protein product		607770				11214970, 11001876	Standard	NM_001143821		Approved	PEPP2, KIAA1686, FLJ10667	uc031qgo.1	Q9HAU0	OTTHUMG00000167921	ENST00000299275.6:c.2400+1128G>T	12.37:g.19499950G>T		Somatic	75	0		WXS	Illumina GAIIx	Phase_I	113	15	NM_001256470	0	0	0	0	0	A0JP03|B4DGS1|E9PHQ3|F5H0I0|Q6NSF8|Q86ST7|Q8N3K6|Q96DY9|Q9BVR4|Q9C0H7|Q9H924|Q9NVK8	Missense_Mutation	SNP	ENST00000299275.6	37	CCDS8682.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.420981	0.83559	.	.	ENSG00000052126	ENST00000317589;ENST00000542828;ENST00000429027;ENST00000424268;ENST00000543806;ENST00000536974	T;T;T;T;T	0.05382	3.45;3.45;3.45;3.45;3.45	5.2	5.2	0.72013	.	0.061398	0.64402	D	0.000003	T	0.26159	0.0638	.	.	.	0.80722	D	1	D;D;D;D;D	0.67145	0.996;0.996;0.996;0.993;0.993	D;D;P;P;D	0.79108	0.992;0.992;0.891;0.758;0.982	T	0.00455	-1.1729	9	0.66056	D	0.02	-11.9421	17.2909	0.87156	0.0:0.0:1.0:0.0	.	808;727;734;906;911	Q9HAU0-4;F5H0I0;E7EME8;B4DHK5;E9PHQ3	.;.;.;.;.	L	808;907;911;734;727;700	ENSP00000325155:R808L;ENSP00000404296:R911L;ENSP00000400411:R734L;ENSP00000439837:R727L;ENSP00000440371:R700L	ENSP00000325155:R808L	R	+	2	0	PLEKHA5	19391217	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.711000	0.74675	2.568000	0.86640	0.650000	0.86243	CGT	.		0.453	PLEKHA5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000397013.1	NM_019012	
OVCH1	341350	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	29604304	29604304	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr12:29604304T>C	ENST00000318184.5	-	22	2728	c.2729A>G	c.(2728-2730)gAa>gGa	p.E910G	OVCH1-AS1_ENST00000551108.1_Intron|OVCH1-AS1_ENST00000549411.1_Intron	NM_183378.2	NP_899234.2	Q7RTY7	OVCH1_HUMAN	ovochymase 1	910	CUB 3. {ECO:0000255|PROSITE- ProRule:PRU00059}.					extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(43)|ovary(5)|pancreas(3)|prostate(2)|skin(1)|soft_tissue(1)|stomach(3)	92	Lung NSC(12;1.84e-09)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)					ACTGTGTCTTTCTTCATAAAT	0.428																																					p.E910G		.											.	OVCH1-210	0			c.A2729G						.						57.0	54.0	55.0					12																	29604304		1877	4101	5978	SO:0001583	missense	341350	exon22			TGTCTTTCTTCAT	BN000128		12p11.23	2012-11-08			ENSG00000187950	ENSG00000187950			23080	protein-coding gene	gene with protein product						12838346	Standard	NM_183378		Approved	OVCH	uc001rix.1	Q7RTY7	OTTHUMG00000167741	ENST00000318184.5:c.2729A>G	12.37:g.29604304T>C	ENSP00000326708:p.Glu910Gly	Somatic	64	0		WXS	Illumina GAIIx	Phase_I	78	23	NM_183378	0	0	0	0	0		Missense_Mutation	SNP	ENST00000318184.5	37		.	.	.	.	.	.	.	.	.	.	T	14.91	2.675880	0.47886	.	.	ENSG00000187950	ENST00000318184	T	0.12039	2.72	2.89	2.89	0.33648	CUB (5);	.	.	.	.	T	0.17534	0.0421	N	0.19112	0.55	0.21147	N	0.999777	D	0.76494	0.999	D	0.83275	0.996	T	0.17531	-1.0366	9	0.15499	T	0.54	.	7.6045	0.28095	0.0:0.0:0.0:1.0	.	910	Q7RTY7	OVCH1_HUMAN	G	910	ENSP00000326708:E910G	ENSP00000326708:E910G	E	-	2	0	OVCH1	29495571	0.773000	0.28580	0.831000	0.32960	0.214000	0.24535	0.925000	0.28791	1.565000	0.49641	0.374000	0.22700	GAA	.		0.428	OVCH1-001	KNOWN	non_canonical_TEC|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000395997.2	NM_183378	
SCN8A	6334	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	52188154	52188154	+	Splice_Site	SNP	G	G	T			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr12:52188154G>T	ENST00000354534.6	+	26	4702		c.e26-1		SCN8A_ENST00000545061.1_Splice_Site	NM_001177984.2|NM_014191.3	NP_001171455.1|NP_055006.1	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha subunit						adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|membrane depolarization during action potential (GO:0086010)|muscle organ development (GO:0007517)|myelination (GO:0042552)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|neuronal action potential (GO:0019228)|peripheral nervous system development (GO:0007422)|response to toxic substance (GO:0009636)|sensory perception of sound (GO:0007605)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	ATP binding (GO:0005524)|voltage-gated sodium channel activity (GO:0005248)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55				BRCA - Breast invasive adenocarcinoma(357;0.181)	Valproic Acid(DB00313)	TTCCTCCCCAGAACAAAATCC	0.443																																					.		.											.	SCN8A-29	0			c.4402-1G>T						.						109.0	104.0	105.0					12																	52188154		1948	4175	6123	SO:0001630	splice_region_variant	6334	exon25			TCCCCAGAACAAA	AB027567	CCDS44891.1, CCDS53794.1	12q13.1	2012-02-26	2007-01-23			ENSG00000196876		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10596	protein-coding gene	gene with protein product		600702	"""sodium channel, voltage gated, type VIII, alpha polypeptide"""	MED		7670495, 9828131, 16382098	Standard	NM_014191		Approved	Nav1.6, NaCh6, PN4, CerIII	uc001ryw.4	Q9UQD0		ENST00000354534.6:c.4525-1G>T	12.37:g.52188154G>T		Somatic	60	0		WXS	Illumina GAIIx	Phase_I	97	18	NM_001177984	0	0	0	0	0	B9VWG8|O95788|Q9NYX2|Q9UPB2	Splice_Site	SNP	ENST00000354534.6	37	CCDS44891.1	.	.	.	.	.	.	.	.	.	.	g	24.3	4.511633	0.85389	.	.	ENSG00000196876	ENST00000354534;ENST00000545061;ENST00000355133	.	.	.	4.96	4.96	0.65561	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.8187	0.92088	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SCN8A	50474421	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.613000	0.98350	2.760000	0.94817	0.645000	0.84053	.	.		0.443	SCN8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404372.3	NM_014191	Intron
MYBPC1	4604	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	102043128	102043128	+	Silent	SNP	A	A	G			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr12:102043128A>G	ENST00000550270.1	+	13	1212	c.1212A>G	c.(1210-1212)ggA>ggG	p.G404G	MYBPC1_ENST00000545503.2_Silent_p.G404G|MYBPC1_ENST00000536007.1_Silent_p.G385G|MYBPC1_ENST00000551300.1_Silent_p.G305G|MYBPC1_ENST00000547405.1_Silent_p.G378G|MYBPC1_ENST00000553190.1_Silent_p.G404G|MYBPC1_ENST00000550501.1_Intron|RP11-755O11.2_ENST00000552081.1_RNA|MYBPC1_ENST00000441232.1_Silent_p.G404G|MYBPC1_ENST00000360610.2_Silent_p.G404G|MYBPC1_ENST00000361685.2_Silent_p.G429G|MYBPC1_ENST00000361466.2_Silent_p.G429G|MYBPC1_ENST00000392934.3_Silent_p.G391G|RP11-755O11.2_ENST00000547027.1_RNA|MYBPC1_ENST00000452455.2_Silent_p.G404G|MYBPC1_ENST00000549145.1_Silent_p.G417G|MYBPC1_ENST00000541119.1_Silent_p.G392G|MYBPC1_ENST00000547509.1_Silent_p.G390G			Q00872	MYPC1_HUMAN	myosin binding protein C, slow type	404	Ig-like C2-type 3.				cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myofibril (GO:0030016)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	57						TCATAGAGGGAGCAACAAAGG	0.383																																					p.G429G		.											.	MYBPC1-94	0			c.A1287G						.						177.0	161.0	167.0					12																	102043128		2203	4300	6503	SO:0001819	synonymous_variant	4604	exon15			AGAGGGAGCAACA		CCDS9083.1, CCDS9084.1, CCDS9085.1, CCDS55877.1, CCDS58268.1, CCDS58269.1, CCDS58270.1, CCDS58271.1, CCDS58272.1, CCDS58273.1	12q23.2	2013-02-11	2001-11-28		ENSG00000196091	ENSG00000196091		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7549	protein-coding gene	gene with protein product		160794	"""myosin-binding protein C, slow-type"""			8375400, 16918501	Standard	NM_002465		Approved		uc010svs.2	Q00872	OTTHUMG00000170274	ENST00000550270.1:c.1212A>G	12.37:g.102043128A>G		Somatic	101	0		WXS	Illumina GAIIx	Phase_I	126	22	NM_206819	0	0	0	0	0	B4DKR5|B7Z8G8|B7ZL02|B7ZL09|B7ZL10|E7ESM5|E7EWS6|G3XAE8|Q15497|Q17RR7|Q569K7|Q86T48|Q86TC8|Q8N3L2	Silent	SNP	ENST00000550270.1	37	CCDS9085.1																																																																																			.		0.383	MYBPC1-024	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000408806.1		
ATXN2	6311	hgsc.bcm.edu	37	12	112036797	112036797	+	Silent	SNP	C	C	T	rs4098854	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr12:112036797C>T	ENST00000377617.3	-	1	683	c.522G>A	c.(520-522)caG>caA	p.Q174Q	ATXN2_ENST00000549455.1_5'UTR|ATXN2_ENST00000542287.2_Intron|ATXN2_ENST00000389153.4_5'Flank|ATXN2_ENST00000550104.1_Silent_p.Q174Q|RP11-686G8.2_ENST00000547021.1_RNA|ATXN2_ENST00000608853.1_Silent_p.Q14Q|ATXN2_ENST00000535949.1_Intron	NM_002973.3	NP_002964.3	Q99700	ATX2_HUMAN	ataxin 2	174	Poly-Gln.				cell death (GO:0008219)|cerebellar Purkinje cell differentiation (GO:0021702)|cytoplasmic mRNA processing body assembly (GO:0033962)|homeostasis of number of cells (GO:0048872)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of receptor internalization (GO:0002091)|neuromuscular process (GO:0050905)|neuron projection morphogenesis (GO:0048812)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA transport (GO:0050658)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|trans-Golgi network (GO:0005802)	epidermal growth factor receptor binding (GO:0005154)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	37						gctgctgctgctgctgctgct	0.731													C|||	3289	0.656749	0.5734	0.6787	5008	,	,		4944	0.622		0.7167	False		,,,				2504	0.728				p.Q174Q		.											.	ATXN2-136	0			c.G522A						.						1.0	1.0	1.0					12																	112036797		720	1770	2490	SO:0001819	synonymous_variant	6311	exon1			CTGCTGCTGCTGC	U80749	CCDS31902.1	12q23-q24.1	2014-09-17	2004-08-12	2004-08-13	ENSG00000204842	ENSG00000204842		"""Ataxins"""	10555	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 13"""	601517	"""spinocerebellar ataxia 2 (olivopontocerebellar ataxia 2, autosomal dominant, ataxin 2)"""	SCA2, TNRC13		8358438, 9225980	Standard	NM_002973		Approved	ATX2	uc001tsj.3	Q99700	OTTHUMG00000133475	ENST00000377617.3:c.522G>A	12.37:g.112036797C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_002973	0	0	164	174	10	A6NLD4|Q6ZQZ7|Q99493	Silent	SNP	ENST00000377617.3	37	CCDS31902.1																																																																																			C|0.429;T|0.571		0.731	ATXN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257351.3	NM_002973	
HECTD4	283450	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	112690234	112690234	+	Silent	SNP	G	G	T			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr12:112690234G>T	ENST00000430131.2	-	22	3425	c.2280C>A	c.(2278-2280)cgC>cgA	p.R760R	HECTD4_ENST00000377560.5_Silent_p.R1010R|HECTD4_ENST00000550722.1_Silent_p.R1036R			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	760					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										GTACCTGAGCGCGAACTGTGC	0.463																																					p.R1048R		.											.	.	0			c.C3144A						.						153.0	143.0	146.0					12																	112690234		2203	4300	6503	SO:0001819	synonymous_variant	283450	exon23			CTGAGCGCGAACT	AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.2280C>A	12.37:g.112690234G>T		Somatic	50	0		WXS	Illumina GAIIx	Phase_I	62	5	NM_001109662	0	0	0	0	0	L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Silent	SNP	ENST00000430131.2	37																																																																																				.		0.463	HECTD4-202	KNOWN	basic	protein_coding	protein_coding		NM_173813	
SFSWAP	6433	bcgsc.ca	37	12	132250712	132250712	+	Silent	SNP	G	G	C	rs1051233	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr12:132250712G>C	ENST00000261674.4	+	13	2142	c.2001G>C	c.(1999-2001)ctG>ctC	p.L667L	SFSWAP_ENST00000541286.1_Silent_p.L667L	NM_004592.3	NP_004583.2	Q12872	SFSWA_HUMAN	splicing factor, suppressor of white-apricot family	667					mRNA processing (GO:0006397)|mRNA splice site selection (GO:0006376)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	RNA binding (GO:0003723)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(8)|ovary(1)|skin(2)	25						GGGAAAAGCTGGCCCAGGCGT	0.443													G|||	508	0.101438	0.0091	0.2291	5008	,	,		18099	0.0		0.2366	False		,,,				2504	0.1012				p.L667L		.											.	SFSWAP-91	0			c.G2001C						.	G		206,4200	127.0+/-164.0	7,192,2004	104.0	119.0	114.0		2001	-9.3	0.5	12	dbSNP_86	114	2198,6402	375.7+/-337.9	275,1648,2377	no	coding-synonymous	SFSWAP	NM_004592.2		282,1840,4381	CC,CG,GG		25.5581,4.6754,18.4838		667/952	132250712	2404,10602	2203	4300	6503	SO:0001819	synonymous_variant	6433	exon13			AAAGCTGGCCCAG	U08377	CCDS9273.1, CCDS58290.1	12q24.33	2014-04-14	2014-04-14	2010-09-15	ENSG00000061936	ENSG00000061936			10790	protein-coding gene	gene with protein product		601945	"""splicing factor, arginine/serine-rich 8 (suppressor-of-white-apricot, Drosophila homolog)"", ""splicing factor, arginine/serine-rich 8 (suppressor-of-white-apricot homolog, Drosophila)"", ""splicing factor, suppressor of white-apricot homolog (Drosophila)"""	SFRS8		8940107	Standard	NM_004592		Approved	SWAP	uc010tbn.2	Q12872	OTTHUMG00000168319	ENST00000261674.4:c.2001G>C	12.37:g.132250712G>C		Somatic	39	0		WXS	Illumina GAIIx	Phase_I	37	4	NM_001261411	0	0	47	47	0	B2RN45|B7ZM97|F5H6B8|Q6PJF7	Silent	SNP	ENST00000261674.4	37	CCDS9273.1	284	0.13003663003663005	8	0.016260162601626018	98	0.27071823204419887	0	0.0	178	0.23482849604221637	G	9.674	1.147491	0.21288	0.046754	0.255581	ENSG00000061936	ENST00000537164	.	.	.	5.73	-9.28	0.00656	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.09310	P	0.9999999999999998	.	.	.	.	.	.	T	0.30650	-0.9971	3	.	.	.	-17.2187	1.6034	0.02679	0.2261:0.1231:0.2084:0.4424	rs1051233;rs3191598;rs17678095;rs1051233	.	.	.	S	230	.	.	W	+	2	0	SFSWAP	130816665	0.879000	0.30193	0.539000	0.28077	0.987000	0.75469	-0.165000	0.09968	-1.785000	0.01271	0.591000	0.81541	TGG	G|0.840;C|0.160		0.443	SFSWAP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399276.1	NM_004592	
FREM2	341640	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	39452353	39452353	+	Silent	SNP	T	T	C			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr13:39452353T>C	ENST00000280481.7	+	22	8970	c.8754T>C	c.(8752-8754)ttT>ttC	p.F2918F		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	2918					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		AGAAGGTGTTTCTATGCACTG	0.418																																					p.F2918F		.											.	FREM2-100	0			c.T8754C						.						213.0	181.0	192.0					13																	39452353		2203	4300	6503	SO:0001819	synonymous_variant	341640	exon22			GGTGTTTCTATGC	BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.8754T>C	13.37:g.39452353T>C		Somatic	155	0		WXS	Illumina GAIIx	Phase_I	133	20	NM_207361	0	0	1	1	0	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Silent	SNP	ENST00000280481.7	37	CCDS31960.1																																																																																			.		0.418	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361	
PCDH8	5100	hgsc.bcm.edu	37	13	53420344	53420344	+	Missense_Mutation	SNP	A	A	G	rs5030685	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr13:53420344A>G	ENST00000377942.3	-	1	2431	c.2228T>C	c.(2227-2229)gTg>gCg	p.V743A	PCDH8_ENST00000338862.4_Missense_Mutation_p.V743A	NM_002590.3	NP_002581.2	O95206	PCDH8_HUMAN	protocadherin 8	743			V -> A (in dbSNP:rs5030685). {ECO:0000269|PubMed:12884975}.		cell-cell signaling (GO:0007267)|homophilic cell adhesion (GO:0007156)|morphogenesis of embryonic epithelium (GO:0016331)|somitogenesis (GO:0001756)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(5)|lung(23)|ovary(1)|skin(1)|urinary_tract(1)	36		Lung NSC(96;0.0019)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.19e-08)		CCATTGCAGCACCGACCCGGA	0.716													G|||	269	0.0537141	0.0749	0.085	5008	,	,		10527	0.0109		0.0547	False		,,,				2504	0.046				p.V743A	GBM(36;25 841 9273 49207)	.											.	PCDH8-153	0			c.T2228C						.	G	ALA/VAL,ALA/VAL	273,3977		7,259,1859	19.0	26.0	24.0		2228,2228	3.6	0.9	13	dbSNP_113	24	454,7878		12,430,3724	yes	missense,missense	PCDH8	NM_002590.3,NM_032949.2	64,64	19,689,5583	GG,GA,AA		5.4489,6.4235,5.7781	benign,benign	743/1071,743/974	53420344	727,11855	2125	4166	6291	SO:0001583	missense	5100	exon1			TGCAGCACCGACC	AF061573	CCDS9438.1, CCDS9439.1	13q21.1	2010-02-22			ENSG00000136099	ENSG00000136099		"""Cadherins / Protocadherins : Non-clustered"""	8660	protein-coding gene	gene with protein product		603580				9787079, 9315676	Standard	NM_002590		Approved	PAPC, ARCADLIN	uc001vhi.3	O95206	OTTHUMG00000016979	ENST00000377942.3:c.2228T>C	13.37:g.53420344A>G	ENSP00000367177:p.Val743Ala	Somatic	5	0		WXS	Illumina GAIIx	Phase_I	16	13	NM_002590	0	0	0	0	0	B4DMV7|Q5TAN1|Q5TAN2|Q8IYE9|Q96SF1	Missense_Mutation	SNP	ENST00000377942.3	37	CCDS9438.1	105	0.04807692307692308	30	0.06097560975609756	34	0.09392265193370165	1	0.0017482517482517483	40	0.052770448548812667	G	7.029	0.560314	0.13498	0.064235	0.054489	ENSG00000136099	ENST00000377942;ENST00000338862;ENST00000418407;ENST00000448969	T;T	0.49139	0.83;0.79	3.59	3.59	0.41128	.	0.672756	0.12209	N	0.489532	T	0.00754	0.0025	N	0.03608	-0.345	0.09310	N	0.999998	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.08659	-1.0711	10	0.08837	T	0.75	.	9.238	0.37477	0.1065:0.0:0.8935:0.0	rs5030685;rs5030685	743;743	O95206-2;O95206	.;PCDH8_HUMAN	A	743;743;269;586	ENSP00000367177:V743A;ENSP00000341350:V743A	ENSP00000341350:V743A	V	-	2	0	PCDH8	52318345	0.024000	0.19004	0.860000	0.33809	0.341000	0.28922	0.000000	0.12993	1.114000	0.41781	-0.124000	0.14976	GTG	A|0.947;G|0.053		0.716	PCDH8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045108.2	NM_002590	
UPF3A	65110	broad.mit.edu	37	13	115047559	115047559	+	Silent	SNP	C	C	T			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr13:115047559C>T	ENST00000375299.3	+	2	327	c.271C>T	c.(271-273)Ctg>Ttg	p.L91L	UPF3A_ENST00000351487.5_Silent_p.L91L	NM_023011.3	NP_075387.1	Q9H1J1	REN3A_HUMAN	UPF3 regulator of nonsense transcripts homolog A (yeast)	91	Required for interaction with UPF2.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA transport (GO:0051028)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nucleocytoplasmic transport (GO:0006913)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.L91L(8)		autonomic_ganglia(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	16	Lung NSC(43;0.00299)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0191)|all_epithelial(44;0.00716)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.238)	BRCA - Breast invasive adenocarcinoma(86;0.0886)	OV - Ovarian serous cystadenocarcinoma(48;0.195)|Epithelial(10;0.2)		GCTGCGCCCGCTGCCAGCACA	0.731																																					p.L91L		.											.	UPF3A-91	8	Substitution - coding silent(8)	lung(2)|prostate(2)|kidney(2)|central_nervous_system(2)	c.C271T						.						4.0	4.0	4.0					13																	115047559		1902	3804	5706	SO:0001819	synonymous_variant	65110	exon2			CGCCCGCTGCCAG	AF318575	CCDS9543.1, CCDS9544.1	13q34	2010-04-30			ENSG00000169062	ENSG00000169062			20332	protein-coding gene	gene with protein product		605530				11113196, 11163187	Standard	NM_023011		Approved	RENT3A, UPF3, HUPF3A	uc001vup.3	Q9H1J1	OTTHUMG00000017403	ENST00000375299.3:c.271C>T	13.37:g.115047559C>T		Somatic	17	0		WXS	Illumina GAIIx	Phase_I	60	8	NM_080687	0	0	13	13	0	A2A366|Q5T8C3|Q5T8C9|Q7Z6N3|Q86YK1|Q9BZI8	Silent	SNP	ENST00000375299.3	37	CCDS9543.1																																																																																			.		0.731	UPF3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045968.2		
ZNF219	51222	hgsc.bcm.edu	37	14	21560706	21560706	+	Silent	SNP	C	C	G	rs370417468|rs1065496	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr14:21560706C>G	ENST00000360947.3	-	3	1161	c.750G>C	c.(748-750)ccG>ccC	p.P250P	RP11-998D10.7_ENST00000554733.2_lincRNA|ZNF219_ENST00000451119.2_Silent_p.P250P|ZNF219_ENST00000421093.2_Silent_p.P250P|ZNF219_ENST00000556101.1_5'Flank	NM_016423.2	NP_057507.2	Q9P2Y4	ZN219_HUMAN	zinc finger protein 219	250					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of neurotransmitter levels (GO:0001505)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histamine receptor activity (GO:0004969)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(1)|lung(1)|ovary(1)|prostate(2)	8	all_cancers(95;0.00185)		OV - Ovarian serous cystadenocarcinoma(11;9.86e-11)|Epithelial(56;1.27e-08)|all cancers(55;6.06e-08)	GBM - Glioblastoma multiforme(265;0.0191)		gttcgggctccggctccggct	0.726											OREG0022565	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	C|||	448	0.0894569	0.1097	0.049	5008	,	,		11470	0.0942		0.0785	False		,,,				2504	0.0971				p.P250P		.											.	ZNF219-90	0			c.G750C						.	C	,,	331,3629		14,303,1663	6.0	7.0	7.0		750,750,750	-8.1	0.1	14	dbSNP_86	7	434,7432		9,416,3508	no	coding-synonymous,coding-synonymous,coding-synonymous	ZNF219	NM_001101672.1,NM_001102454.1,NM_016423.2	,,	23,719,5171	GG,GC,CC		5.5174,8.3586,6.4688	,,	250/723,250/723,250/723	21560706	765,11061	1980	3933	5913	SO:0001819	synonymous_variant	51222	exon3			GGGCTCCGGCTCC	AB015427	CCDS9568.1	14q11	2013-01-08			ENSG00000165804	ENSG00000165804		"""Zinc fingers, C2H2-type"""	13011	protein-coding gene	gene with protein product		605036				10819330	Standard	NM_016423		Approved		uc001vzs.2	Q9P2Y4	OTTHUMG00000029647	ENST00000360947.3:c.750G>C	14.37:g.21560706C>G		Somatic	3	0	749	WXS	Illumina GAIIx	Phase_I	33	16	NM_001102454	0	0	33	74	41	D3DS16|Q53Y57|Q8IYC1|Q9BW28	Silent	SNP	ENST00000360947.3	37	CCDS9568.1																																																																																			C|0.100;G|0.900		0.726	ZNF219-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073931.2		
DNAAF2	55172	hgsc.bcm.edu	37	14	50100683	50100683	+	Silent	SNP	C	C	G	rs2985686	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr14:50100683C>G	ENST00000298292.8	-	1	1265	c.1185G>C	c.(1183-1185)gcG>gcC	p.A395A	DNAAF2_ENST00000406043.3_Silent_p.A395A	NM_018139.2	NP_060609.2	Q9NVR5	KTU_HUMAN	dynein, axonemal, assembly factor 2	395					axonemal dynein complex assembly (GO:0070286)|bacterial-type flagellum-dependent cell motility (GO:0071973)|cilium-dependent cell motility (GO:0060285)|response to retinoic acid (GO:0032526)	cytoplasm (GO:0005737)				kidney(1)|lung(4)	5						CTCCGTCCTCCGCGCGACTCC	0.781													G|||	2800	0.559105	0.6702	0.6715	5008	,	,		11594	0.1736		0.7604	False		,,,				2504	0.5194				p.A395A		.											.	.	0			c.G1185C						.						1.0	1.0	1.0					14																	50100683		917	2082	2999	SO:0001819	synonymous_variant	55172	exon1			GTCCTCCGCGCGA	AK001425	CCDS9691.2, CCDS45100.1	14q21.3	2012-05-03	2011-06-09	2011-06-09	ENSG00000165506	ENSG00000165506			20188	protein-coding gene	gene with protein product	"""kintoun"""	612517	"""chromosome 14 open reading frame 104"""	C14orf104			Standard	NM_001083908		Approved	FLJ10563, KTU, PF13, CILD10	uc001wws.4	Q9NVR5	OTTHUMG00000152331	ENST00000298292.8:c.1185G>C	14.37:g.50100683C>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_018139	0	0	0	1	1	B9WS54|C0JAP7|Q86TR1|Q86TY8|Q969Z5	Silent	SNP	ENST00000298292.8	37	CCDS9691.2																																																																																			C|0.569;G|0.431		0.781	DNAAF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276813.1		
TBPL2	387332	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	55903342	55903342	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr14:55903342G>T	ENST00000247219.5	-	2	615	c.545C>A	c.(544-546)tCc>tAc	p.S182Y		NM_199047.2	NP_950248.1			TATA box binding protein like 2											endometrium(2)|kidney(1)|large_intestine(1)|lung(4)	8						GGGAGTTATGGATGCCAGAGA	0.438																																					p.S182Y		.											.	TBPL2-90	0			c.C545A						.						129.0	127.0	128.0					14																	55903342		2203	4300	6503	SO:0001583	missense	387332	exon2			GTTATGGATGCCA	AY457923	CCDS9724.1	14q22.2	2004-06-03			ENSG00000182521	ENSG00000182521			19841	protein-coding gene	gene with protein product		608964				14634207	Standard	NM_199047		Approved	TRF3, TBP2	uc001xby.3	Q6SJ96	OTTHUMG00000140313	ENST00000247219.5:c.545C>A	14.37:g.55903342G>T	ENSP00000247219:p.Ser182Tyr	Somatic	218	0		WXS	Illumina GAIIx	Phase_I	342	40	NM_199047	0	0	0	0	0		Missense_Mutation	SNP	ENST00000247219.5	37	CCDS9724.1	.	.	.	.	.	.	.	.	.	.	G	18.42	3.620869	0.66787	.	.	ENSG00000182521	ENST00000247219	T	0.48836	0.8	5.82	5.82	0.92795	.	0.172150	0.52532	D	0.000077	T	0.63988	0.2558	L	0.60455	1.87	0.19300	N	0.99998	D	0.65815	0.995	P	0.59703	0.862	T	0.59386	-0.7464	10	0.87932	D	0	-4.7274	19.0861	0.93203	0.0:0.0:1.0:0.0	.	182	Q6SJ96	TBPL2_HUMAN	Y	182	ENSP00000247219:S182Y	ENSP00000247219:S182Y	S	-	2	0	TBPL2	54973095	1.000000	0.71417	0.044000	0.18714	0.399000	0.30720	8.799000	0.91895	2.761000	0.94854	0.591000	0.81541	TCC	.		0.438	TBPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276916.1	NM_199047	
TGFB3	7043	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	76447102	76447102	+	Silent	SNP	T	T	G			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr14:76447102T>G	ENST00000238682.3	-	1	432	c.135A>C	c.(133-135)ggA>ggC	p.G45G	TGFB3_ENST00000556674.1_5'Flank|TGFB3_ENST00000556285.1_Silent_p.G45G	NM_003239.2	NP_003230.1	P10600	TGFB3_HUMAN	transforming growth factor, beta 3	45					activation of MAPK activity (GO:0000187)|aging (GO:0007568)|blood coagulation (GO:0007596)|cell growth (GO:0016049)|cell-cell junction organization (GO:0045216)|detection of hypoxia (GO:0070483)|digestive tract development (GO:0048565)|embryonic neurocranium morphogenesis (GO:0048702)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|female pregnancy (GO:0007565)|frontal suture morphogenesis (GO:0060364)|in utero embryonic development (GO:0001701)|inner ear development (GO:0048839)|lung alveolus development (GO:0048286)|mammary gland development (GO:0030879)|menstrual cycle phase (GO:0022601)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of macrophage cytokine production (GO:0010936)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|odontogenesis (GO:0042476)|ossification involved in bone remodeling (GO:0043932)|palate development (GO:0060021)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cell division (GO:0051781)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein secretion (GO:0050714)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|response to laminar fluid shear stress (GO:0034616)|response to progesterone (GO:0032570)|salivary gland morphogenesis (GO:0007435)|SMAD protein import into nucleus (GO:0007184)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cell surface (GO:0009986)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|T-tubule (GO:0030315)	identical protein binding (GO:0042802)|transforming growth factor beta binding (GO:0050431)|type I transforming growth factor beta receptor binding (GO:0034713)|type II transforming growth factor beta receptor binding (GO:0005114)			NS(1)|breast(1)|endometrium(4)|kidney(1)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	11				BRCA - Breast invasive adenocarcinoma(234;0.0169)		TCAAGATCTGTCCCCTAATGG	0.592																																					p.G45G		.											.	TGFB3-524	0			c.A135C						.						155.0	149.0	151.0					14																	76447102		2203	4300	6503	SO:0001819	synonymous_variant	7043	exon1			GATCTGTCCCCTA		CCDS9846.1	14q24	2014-09-17				ENSG00000119699		"""Endogenous ligands"""	11769	protein-coding gene	gene with protein product	"""prepro-transforming growth factor beta-3"""	190230	"""arrhythmogenic right ventricular dysplasia 1"""	ARVD1, ARVD		16549496, 15639475	Standard	XM_005268028		Approved		uc001xsc.2	P10600		ENST00000238682.3:c.135A>C	14.37:g.76447102T>G		Somatic	194	0		WXS	Illumina GAIIx	Phase_I	339	62	NM_003239	0	0	6	7	1	Q8WV88	Silent	SNP	ENST00000238682.3	37	CCDS9846.1																																																																																			.		0.592	TGFB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413685.1	NM_003239	
CEP128	145508	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	81046735	81046735	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr14:81046735C>T	ENST00000555265.1	-	20	3214	c.2839G>A	c.(2839-2841)Gaa>Aaa	p.E947K	CEP128_ENST00000281129.3_Missense_Mutation_p.E947K			Q6ZU80	CE128_HUMAN	centrosomal protein 128kDa	947						centriole (GO:0005814)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|spindle pole (GO:0000922)				NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(22)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	51						GATCCCATTTCTTCATCTTTT	0.323																																					p.E947K		.											.	CEP128-91	0			c.G2839A						.						133.0	116.0	122.0					14																	81046735		2202	4300	6502	SO:0001583	missense	145508	exon19			CCATTTCTTCATC	AK056756	CCDS32130.1	14q31.1	2014-02-20	2011-05-06	2011-05-06	ENSG00000100629	ENSG00000100629			20359	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 61"", ""chromosome 14 open reading frame 145"""	C14orf61, C14orf145		21399614	Standard	NM_152446		Approved		uc001xux.2	Q6ZU80		ENST00000555265.1:c.2839G>A	14.37:g.81046735C>T	ENSP00000451162:p.Glu947Lys	Somatic	32	0		WXS	Illumina GAIIx	Phase_I	23	5	NM_152446	0	0	0	0	0	B9EK52|Q86X97|Q96ML4	Missense_Mutation	SNP	ENST00000555265.1	37	CCDS32130.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.0|22.0	4.234486|4.234486	0.79800|0.79800	.|.	.|.	ENSG00000100629|ENSG00000100629	ENST00000281129;ENST00000555265;ENST00000393619|ENST00000556061	T;T|.	0.34859|.	1.34;1.34|.	5.73|5.73	5.73|5.73	0.89815|0.89815	.|.	0.165233|.	0.40144|.	N|.	0.001175|.	T|T	0.68439|0.68439	0.3001|0.3001	L|L	0.50333|0.50333	1.59|1.59	0.80722|0.80722	D|D	1|1	D|.	0.67145|.	0.996|.	D|.	0.77557|.	0.99|.	T|T	0.63875|0.63875	-0.6538|-0.6538	10|5	0.27785|.	T|.	0.31|.	.|.	15.7506|15.7506	0.77983|0.77983	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	947|.	Q6ZU80|.	CE128_HUMAN|.	K|K	947|12	ENSP00000281129:E947K;ENSP00000451162:E947K|.	ENSP00000281129:E947K|.	E|R	-|-	1|2	0|0	CEP128|CEP128	80116488|80116488	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	4.027000|4.027000	0.57239|0.57239	2.861000|2.861000	0.98227|0.98227	0.655000|0.655000	0.94253|0.94253	GAA|AGA	.		0.323	CEP128-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413415.1	NM_152446	
CKB	1152	hgsc.bcm.edu	37	14	103988180	103988180	+	Silent	SNP	G	G	T	rs1136165	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr14:103988180G>T	ENST00000348956.2	-	4	813	c.456C>A	c.(454-456)cgC>cgA	p.R152R		NM_001823.4	NP_001814.2	P12277	KCRB_HUMAN	creatine kinase, brain	152	Phosphagen kinase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00843}.				cellular chloride ion homeostasis (GO:0030644)|cellular nitrogen compound metabolic process (GO:0034641)|creatine metabolic process (GO:0006600)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|creatine kinase activity (GO:0004111)			lung(2)|prostate(1)	3		Melanoma(154;0.155)	Epithelial(46;0.14)		Creatine(DB00148)	TCTCGATGGCGCGGCGCTCCC	0.756													G|||	3294	0.657748	0.5416	0.7349	5008	,	,		7060	0.8264		0.6233	False		,,,				2504	0.6217				p.R152R	Esophageal Squamous(186;2492 2823 49929 50127)	.											.	CKB-115	0			c.C456A						.	G		1738,1164		574,590,287	3.0	4.0	3.0		456	-0.0	1.0	14	dbSNP_86	3	4002,2154		1387,1228,463	no	coding-synonymous	CKB	NM_001823.3		1961,1818,750	TT,TG,GG		34.9903,40.1103,36.6306		152/382	103988180	5740,3318	1451	3078	4529	SO:0001819	synonymous_variant	1152	exon4			GATGGCGCGGCGC		CCDS9981.1	14q32.32	2012-10-02			ENSG00000166165	ENSG00000166165	2.7.3.2		1991	protein-coding gene	gene with protein product		123280		CKBB			Standard	NM_001823		Approved		uc001ynf.2	P12277	OTTHUMG00000171786	ENST00000348956.2:c.456C>A	14.37:g.103988180G>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	6	NM_001823	0	0	73	147	74	A8K236|B2R5R4|Q2LE07|Q6FG40|Q9UC66	Silent	SNP	ENST00000348956.2	37	CCDS9981.1	1462	0.6694139194139194	285	0.5792682926829268	250	0.6906077348066298	460	0.8041958041958042	467	0.6160949868073878	G	13.11	2.138272	0.37728	0.598897	0.650097	ENSG00000166165	ENST00000428256	.	.	.	4.64	-0.0349	0.13894	.	0.000000	0.85682	D	0.000000	T	0.00012	0.0000	.	.	.	0.09310	P	0.9999999999999624	.	.	.	.	.	.	T	0.17592	-1.0364	5	0.41790	T	0.15	-18.9304	4.9837	0.14180	0.3841:0.2745:0.3414:0.0	rs1136165;rs2227867;rs2765044;rs3179077;rs3199393;rs17366340;rs17423634;rs17849441;rs17850309;rs17850603;rs17851735;rs17851741;rs17857802	.	.	.	S	118	.	ENSP00000395515:R118S	R	-	1	0	CKB	103057933	0.001000	0.12720	0.999000	0.59377	0.996000	0.88848	-2.081000	0.01367	0.066000	0.16515	0.449000	0.29647	CGC	G|0.327;T|0.673		0.756	CKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415111.1		
AHNAK2	113146	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	105415287	105415287	+	Silent	SNP	G	G	C			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr14:105415287G>C	ENST00000333244.5	-	7	6620	c.6501C>G	c.(6499-6501)gcC>gcG	p.A2167A	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2167						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			ACTTGCCTGGGGCAGACACCC	0.587																																					p.A2167A		.											.	AHNAK2-47	0			c.C6501G						.						203.0	137.0	159.0					14																	105415287		1941	3817	5758	SO:0001819	synonymous_variant	113146	exon7			GCCTGGGGCAGAC	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.6501C>G	14.37:g.105415287G>C		Somatic	140	0		WXS	Illumina GAIIx	Phase_I	235	96	NM_138420	0	0	0	0	0	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Silent	SNP	ENST00000333244.5	37	CCDS45177.1																																																																																			.		0.587	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
VPS13C	54832	bcgsc.ca	37	15	62243197	62243197	+	Missense_Mutation	SNP	T	T	C	rs11629598	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr15:62243197T>C	ENST00000261517.5	-	40	4556	c.4483A>G	c.(4483-4485)Att>Gtt	p.I1495V	VPS13C_ENST00000395896.4_Missense_Mutation_p.I1495V|VPS13C_ENST00000395898.3_Missense_Mutation_p.I1452V|VPS13C_ENST00000249837.3_Missense_Mutation_p.I1452V	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)									p.I1495V(1)		NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						GAAGAGTTAATAATGTGAAGA	0.323													T|||	233	0.0465256	0.0159	0.0447	5008	,	,		15840	0.0387		0.0746	False		,,,				2504	0.0685				p.I1495V		.											.	VPS13C-92	1	Substitution - Missense(1)	stomach(1)	c.A4483G						.	T	VAL/ILE,VAL/ILE,VAL/ILE,VAL/ILE	115,4283	84.4+/-122.9	0,115,2084	42.0	43.0	43.0		4483,4354,4354,4483	4.4	1.0	15	dbSNP_120	43	691,7897	165.8+/-217.9	31,629,3634	yes	missense,missense,missense,missense	VPS13C	NM_001018088.2,NM_017684.4,NM_018080.3,NM_020821.2	29,29,29,29	31,744,5718	CC,CT,TT		8.0461,2.6148,6.2067	benign,benign,benign,benign	1495/3629,1452/3711,1452/3586,1495/3754	62243197	806,12180	2199	4294	6493	SO:0001583	missense	54832	exon40			AGTTAATAATGTG	AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.4483A>G	15.37:g.62243197T>C	ENSP00000261517:p.Ile1495Val	Somatic	188	1		WXS	Illumina GAIIx	Phase_I	92	6	NM_020821	0	0	0	0	0		Missense_Mutation	SNP	ENST00000261517.5	37	CCDS32257.1	98	0.04487179487179487	6	0.012195121951219513	17	0.04696132596685083	27	0.0472027972027972	48	0.0633245382585752	T	10.81	1.454534	0.26161	0.026148	0.080461	ENSG00000129003	ENST00000249837;ENST00000261517;ENST00000395896;ENST00000395898	T;T;T	0.20200	2.09;2.09;2.09	5.5	4.38	0.52667	.	0.062159	0.64402	N	0.000006	T	0.00695	0.0023	L	0.39898	1.24	0.44702	D	0.997698	B;B;B;B	0.17852	0.01;0.004;0.024;0.008	B;B;B;B	0.23150	0.028;0.028;0.044;0.009	T	0.25813	-1.0121	10	0.20046	T	0.44	.	3.9809	0.09495	0.0:0.1266:0.2103:0.663	rs11629598;rs52793992;rs61379117;rs11629598	1452;1495;1452;1495	Q709C8-4;Q709C8-2;Q709C8-3;Q709C8	.;.;.;VP13C_HUMAN	V	1452;1495;1495;1495	ENSP00000249837:I1452V;ENSP00000261517:I1495V;ENSP00000379233:I1495V	ENSP00000249837:I1452V	I	-	1	0	VPS13C	60030489	0.961000	0.32948	0.974000	0.42286	0.896000	0.52359	1.033000	0.30191	0.942000	0.37525	0.477000	0.44152	ATT	T|0.946;C|0.054		0.323	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000415997.1	NM_017684	
MTFMT	123263	hgsc.bcm.edu	37	15	65321780	65321780	+	Missense_Mutation	SNP	A	A	T	rs188718836	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr15:65321780A>T	ENST00000220058.4	-	1	185	c.172T>A	c.(172-174)Ttc>Atc	p.F58I	MTFMT_ENST00000561025.1_5'Flank	NM_139242.3	NP_640335.2	Q96DP5	FMT_HUMAN	mitochondrial methionyl-tRNA formyltransferase	58						mitochondrion (GO:0005739)	methionyl-tRNA formyltransferase activity (GO:0004479)			endometrium(1)|large_intestine(3)|lung(3)|ovary(3)	10					Tetrahydrofolic acid(DB00116)	TCGCGGGCGAACTGGTCCGTG	0.761													A|||	27	0.00539137	0.0008	0.0058	5008	,	,		9222	0.0		0.0119	False		,,,				2504	0.0102				p.F58I		.											.	MTFMT-24	0			c.T172A						.	A	ILE/PHE	5,2325		0,5,1160	2.0	3.0	2.0		172	3.6	0.5	15		2	49,5611		0,49,2781	yes	missense	MTFMT	NM_139242.3	21	0,54,3941	TT,TA,AA		0.8657,0.2146,0.6758	probably-damaging	58/390	65321780	54,7936	1165	2830	3995	SO:0001583	missense	123263	exon1			GGGCGAACTGGTC	AK055688	CCDS45280.1	15q22.31	2006-11-29		2005-08-09		ENSG00000103707			29666	protein-coding gene	gene with protein product		611766				9614118	Standard	NM_139242		Approved	FMT1	uc002aof.4	Q96DP5		ENST00000220058.4:c.172T>A	15.37:g.65321780A>T	ENSP00000220058:p.Phe58Ile	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	24	11	NM_139242	0	0	5	6	1	B7Z734	Missense_Mutation	SNP	ENST00000220058.4	37	CCDS45280.1	10	0.004578754578754579	0	0.0	2	0.0055248618784530384	0	0.0	8	0.010554089709762533	A	20.5	3.997572	0.74818	0.002146	0.008657	ENSG00000103707	ENST00000220058;ENST00000543678	T;T	0.77877	-1.13;-1.13	4.83	3.62	0.41486	Formyl transferase, N-terminal (2);	0.049940	0.85682	D	0.000000	T	0.78629	0.4313	M	0.66378	2.025	0.42564	D	0.993154	D	0.57899	0.981	D	0.63033	0.91	T	0.82299	-0.0526	10	0.87932	D	0	-19.2998	8.2755	0.31871	0.8231:0.0:0.0:0.1769	.	58	Q96DP5	FMT_HUMAN	I	58	ENSP00000220058:F58I;ENSP00000443754:F58I	ENSP00000220058:F58I	F	-	1	0	MTFMT	63108833	0.988000	0.35896	0.512000	0.27736	0.150000	0.21749	3.146000	0.50631	1.802000	0.52723	0.528000	0.53228	TTC	A|0.995;T|0.005		0.761	MTFMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418155.1	NM_139242	
KBTBD13	390594	hgsc.bcm.edu	37	15	65369395	65369395	+	Missense_Mutation	SNP	C	C	T	rs2919358	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr15:65369395C>T	ENST00000432196.2	+	1	242	c.242C>T	c.(241-243)gCc>gTc	p.A81V	RASL12_ENST00000434605.2_5'Flank	NM_001101362.2	NP_001094832.1	C9JR72	KBTBD_HUMAN	kelch repeat and BTB (POZ) domain containing 13	81					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				lung(1)|prostate(1)|skin(1)	3						CTGCTGCAGGCCGTGGAGTGC	0.736													C|||	2613	0.521765	0.6036	0.5447	5008	,	,		9840	0.7312		0.3887	False		,,,				2504	0.316				p.A81V		.											.	.	0			c.C242T						.	C	VAL/ALA	1463,1441		405,653,394	2.0	3.0	2.0		242	4.6	1.0	15	dbSNP_101	2	2172,4110		500,1172,1469	no	missense	KBTBD13	NM_001101362.2	64	905,1825,1863	TT,TC,CC		34.575,49.6212,39.5711	possibly-damaging	81/459	65369395	3635,5551	1452	3141	4593	SO:0001583	missense	390594	exon1			TGCAGGCCGTGGA		CCDS45281.1	15q22.31	2014-09-17			ENSG00000234438	ENSG00000234438		"""BTB/POZ domain containing"""	37227	protein-coding gene	gene with protein product	"""nemaline myopathy type 6"""	613727				21109227, 22542517	Standard	NM_001101362		Approved	hCG_1645727, NEM6	uc010uis.2	C9JR72		ENST00000432196.2:c.242C>T	15.37:g.65369395C>T	ENSP00000388723:p.Ala81Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	5	NM_001101362	0	0	0	0	0		Missense_Mutation	SNP	ENST00000432196.2	37	CCDS45281.1	1197	0.5480769230769231	302	0.6138211382113821	191	0.5276243093922652	410	0.7167832167832168	294	0.38786279683377306	C	20.9	4.061996	0.76187	0.503788	0.34575	ENSG00000234438	ENST00000432196	T	0.67865	-0.29	4.6	4.6	0.57074	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (2);	.	.	.	.	T	0.00012	0.0000	N	0.21324	0.655	0.22629	P	0.99891774	P	0.47034	0.889	P	0.50896	0.653	T	0.37753	-0.9692	8	0.26408	T	0.33	.	17.2241	0.86964	0.0:1.0:0.0:0.0	rs2919358	81	C9JR72	KBTBD_HUMAN	V	81	ENSP00000388723:A81V	ENSP00000388723:A81V	A	+	2	0	KBTBD13	63156448	1.000000	0.71417	0.996000	0.52242	0.931000	0.56810	7.251000	0.78297	2.390000	0.81377	0.650000	0.86243	GCC	C|0.452;T|0.548		0.736	KBTBD13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418468.2	NM_001101362	
KBTBD13	390594	hgsc.bcm.edu	37	15	65369531	65369531	+	Silent	SNP	G	G	T	rs2946642	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr15:65369531G>T	ENST00000432196.2	+	1	378	c.378G>T	c.(376-378)gcG>gcT	p.A126A	RASL12_ENST00000434605.2_5'Flank	NM_001101362.2	NP_001094832.1	C9JR72	KBTBD_HUMAN	kelch repeat and BTB (POZ) domain containing 13	126					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				lung(1)|prostate(1)|skin(1)	3						ACAGTGCCGCGCTCTTCATCT	0.716													G|||	2512	0.501597	0.531	0.5403	5008	,	,		9855	0.7302		0.3877	False		,,,				2504	0.316				p.A126A		.											.	.	0			c.G378T						.	G		1399,1573		380,639,467	2.0	2.0	2.0		378	-0.2	1.0	15	dbSNP_101	2	2035,4139		455,1125,1507	no	coding-synonymous	KBTBD13	NM_001101362.2		835,1764,1974	TT,TG,GG		32.9608,47.0727,37.5465		126/459	65369531	3434,5712	1486	3087	4573	SO:0001819	synonymous_variant	390594	exon1			TGCCGCGCTCTTC		CCDS45281.1	15q22.31	2014-09-17			ENSG00000234438	ENSG00000234438		"""BTB/POZ domain containing"""	37227	protein-coding gene	gene with protein product	"""nemaline myopathy type 6"""	613727				21109227, 22542517	Standard	NM_001101362		Approved	hCG_1645727, NEM6	uc010uis.2	C9JR72		ENST00000432196.2:c.378G>T	15.37:g.65369531G>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_001101362	0	0	0	0	0		Silent	SNP	ENST00000432196.2	37	CCDS45281.1																																																																																			G|0.479;T|0.521		0.716	KBTBD13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418468.2	NM_001101362	
CHRNA5	1138	broad.mit.edu;bcgsc.ca	37	15	78882715	78882715	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr15:78882715A>G	ENST00000299565.5	+	5	1182	c.982A>G	c.(982-984)Att>Gtt	p.I328V	CHRNA5_ENST00000559554.1_Intron|RP11-650L12.2_ENST00000567141.1_RNA	NM_000745.3	NP_000736.2	P30532	ACHA5_HUMAN	cholinergic receptor, nicotinic, alpha 5 (neuronal)	328					behavioral response to nicotine (GO:0035095)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(1)|ovary(1)|prostate(1)|skin(3)	15					Galantamine(DB00674)|Nicotine(DB00184)	GACACTGTCAATTATGGTAAC	0.403																																					p.I328V		.											.	CHRNA5-516	0			c.A982G						.						139.0	113.0	122.0					15																	78882715		2196	4293	6489	SO:0001583	missense	1138	exon5			CTGTCAATTATGG		CCDS10304.1	15q24	2012-02-11	2012-02-07		ENSG00000169684	ENSG00000169684		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1959	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 5 (neuronal)"""	118505	"""cholinergic receptor, nicotinic, alpha polypeptide 5"""			2004777	Standard	NM_000745		Approved		uc002bdy.3	P30532	OTTHUMG00000143858	ENST00000299565.5:c.982A>G	15.37:g.78882715A>G	ENSP00000299565:p.Ile328Val	Somatic	122	2		WXS	Illumina GAIIx	Phase_I	175	49	NM_000745	0	0	1	2	1	Q15824|Q99554	Missense_Mutation	SNP	ENST00000299565.5	37	CCDS10304.1	.	.	.	.	.	.	.	.	.	.	A	12.78	2.040426	0.35989	.	.	ENSG00000169684	ENST00000299565;ENST00000394802	D	0.86497	-2.13	5.09	5.09	0.68999	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.87962	0.6310	N	0.17723	0.515	0.80722	D	1	P	0.50066	0.931	D	0.70716	0.97	D	0.87324	0.2320	10	0.33141	T	0.24	.	15.1699	0.72862	1.0:0.0:0.0:0.0	.	328	P30532	ACHA5_HUMAN	V	328;279	ENSP00000299565:I328V	ENSP00000299565:I328V	I	+	1	0	CHRNA5	76669770	1.000000	0.71417	0.177000	0.23020	0.684000	0.39900	9.279000	0.95777	2.044000	0.60594	0.460000	0.39030	ATT	.		0.403	CHRNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000290106.1		
CAPN15	6650	hgsc.bcm.edu	37	16	597408	597408	+	Silent	SNP	G	G	C	rs572003179	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr16:597408G>C	ENST00000219611.2	+	4	933	c.570G>C	c.(568-570)ccG>ccC	p.P190P	LA16c-366D1.3_ENST00000565879.1_RNA	NM_005632.2	NP_005623.1	O75808	CAN15_HUMAN	calpain 15	190					proteolysis (GO:0006508)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|cysteine-type peptidase activity (GO:0008234)|peptidase activity (GO:0008233)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										TGGTGGCCCCGGCCGGCTTCC	0.756													g|||	4	0.000798722	0.0	0.0	5008	,	,		11853	0.001		0.003	False		,,,				2504	0.0				p.P190P		.											.	SOLH-523	0			c.G570C						.						3.0	5.0	5.0					16																	597408		1849	3782	5631	SO:0001819	synonymous_variant	6650	exon4			GGCCCCGGCCGGC	U85647	CCDS10410.1	16p13.3	2013-06-27	2013-06-27	2013-06-27	ENSG00000103326	ENSG00000103326			11182	protein-coding gene	gene with protein product		603267	"""small optic lobes (Drosophila) homolog"", ""small optic lobes homolog (Drosophila)"""	SOLH		9722942	Standard	NM_005632		Approved		uc002chi.3	O75808	OTTHUMG00000119059	ENST00000219611.2:c.570G>C	16.37:g.597408G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	16	7	NM_005632	0	0	8	13	5	B1B1M4|Q2KHS2|Q8WTY9|Q9BUW0	Silent	SNP	ENST00000219611.2	37	CCDS10410.1																																																																																			.		0.756	CAPN15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239271.1	NM_005632	
ZNF598	90850	hgsc.bcm.edu	37	16	2059674	2059674	+	Missense_Mutation	SNP	T	T	C	rs71384660		TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr16:2059674T>C	ENST00000431526.1	-	2	88	c.74A>G	c.(73-75)gAa>gGa	p.E25G	ZNF598_ENST00000562103.1_5'UTR|ZNF598_ENST00000563630.1_5'UTR	NM_178167.2	NP_835461.2	Q86UK7	ZN598_HUMAN	zinc finger protein 598	25							poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|lung(7)|skin(1)|urinary_tract(1)	16						GCTCCCGCCTTCCCGCTCAGG	0.766													C|||	5008	1.0	1.0	1.0	5008	,	,		5162	1.0		1.0	False		,,,				2504	1.0				p.E25G		.											.	ZNF598-432	0			c.A74G						.						1.0	2.0	2.0					16																	2059674		1089	2314	3403	SO:0001583	missense	90850	exon2			CCGCCTTCCCGCT	BC029270		16p13.3	2008-05-02				ENSG00000167962		"""Zinc fingers, C2H2-type"""	28079	protein-coding gene	gene with protein product							Standard	NM_178167		Approved	FLJ00086	uc002cof.2	Q86UK7		ENST00000431526.1:c.74A>G	16.37:g.2059674T>C	ENSP00000411409:p.Glu25Gly	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	5	NM_178167	0	0	0	2	2	Q8IW49|Q8N3D9|Q96FG3|Q9H7J3	Missense_Mutation	SNP	ENST00000431526.1	37		2168	0.9926739926739927	487	0.9898373983739838	361	0.9972375690607734	568	0.993006993006993	752	0.9920844327176781	N	1.560	-0.537056	0.04082	.	.	ENSG00000167962	ENST00000431526	T	0.77098	-1.07	3.3	3.3	0.37823	.	0.415485	0.23105	N	0.051871	T	0.00012	0.0000	.	.	.	0.48696	P	3.1000000000003247E-4	.	.	.	.	.	.	T	0.34650	-0.9820	6	0.22706	T	0.39	-7.8624	8.393	0.32540	0.0:0.8796:0.0:0.1204	.	.	.	.	G	25	ENSP00000411409:E25G	ENSP00000411409:E25G	E	-	2	0	ZNF598	1999675	1.000000	0.71417	1.000000	0.80357	0.107000	0.19398	0.911000	0.28584	0.691000	0.31592	-0.642000	0.03964	GAA	T|0.007;C|0.993		0.766	ZNF598-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_178167	
CCDC102A	92922	hgsc.bcm.edu	37	16	57562804	57562804	+	Missense_Mutation	SNP	G	G	A	rs12935069		TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr16:57562804G>A	ENST00000258214.2	-	2	532	c.286C>T	c.(286-288)Cgg>Tgg	p.R96W		NM_033212.3	NP_149989.2	Q96A19	C102A_HUMAN	coiled-coil domain containing 102A	96				R -> W (in Ref. 2; AAH08285/AAH09941). {ECO:0000305}.						endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)	8						TCCGACCACCGGCGCATGGTC	0.731													A|||	5008	1.0	1.0	1.0	5008	,	,		3757	1.0		1.0	False		,,,				2504	1.0				p.R96W		.											.	CCDC102A-91	0			c.C286T						.						8.0	10.0	9.0					16																	57562804		1834	3717	5551	SO:0001583	missense	92922	exon2			ACCACCGGCGCAT	BC008285	CCDS10784.1	16q13	2008-02-05			ENSG00000135736	ENSG00000135736			28097	protein-coding gene	gene with protein product						12477932	Standard	NM_033212		Approved	MGC10992	uc002elw.3	Q96A19	OTTHUMG00000133472	ENST00000258214.2:c.286C>T	16.37:g.57562804G>A	ENSP00000258214:p.Arg96Trp	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_033212	0	0	0	1	1	Q9BT74	Missense_Mutation	SNP	ENST00000258214.2	37	CCDS10784.1	2180	0.9981684981684982	492	1.0	360	0.994475138121547	570	0.9965034965034965	758	1.0	A	10.17	1.277909	0.23307	.	.	ENSG00000135736	ENST00000258214	T	0.37752	1.18	4.82	4.82	0.62117	.	0.000000	0.64402	N	0.000001	T	0.00012	0.0000	N	0.00049	-2.415	0.40217	P	0.022302999999999962	B	0.02656	0.0	B	0.01281	0.0	T	0.44787	-0.9305	9	0.33141	T	0.24	-23.2491	9.5348	0.39216	0.9152:0.0:0.0848:0.0	rs12935069;rs12935069	96	Q96A19	C102A_HUMAN	W	96	ENSP00000258214:R96W	ENSP00000258214:R96W	R	-	1	2	CCDC102A	56120305	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	6.801000	0.75170	0.698000	0.31739	-0.556000	0.04195	CGG	G|0.001;A|0.999		0.731	CCDC102A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257348.1	NM_033212	
KCNG4	93107	broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	84256305	84256305	+	Silent	SNP	G	G	A			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr16:84256305G>A	ENST00000308251.4	-	3	1146	c.1078C>T	c.(1078-1080)Ctg>Ttg	p.L360L		NM_172347.2	NP_758857.1	Q8TDN1	KCNG4_HUMAN	potassium voltage-gated channel, subfamily G, member 4	360					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(11)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	31						GTGAGCCCCAGCGTCTGCAGC	0.662																																					p.L360L		.											.	KCNG4-93	0			c.C1078T						.						17.0	17.0	17.0					16																	84256305		2197	4298	6495	SO:0001819	synonymous_variant	93107	exon3			GCCCCAGCGTCTG	AF348984	CCDS10945.1	16q24.1	2011-07-05			ENSG00000168418	ENSG00000168418		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	19697	protein-coding gene	gene with protein product		607603				12060745, 16382104	Standard	NM_172347		Approved	Kv6.4	uc010voc.2	Q8TDN1	OTTHUMG00000137638	ENST00000308251.4:c.1078C>T	16.37:g.84256305G>A		Somatic	101	1		WXS	Illumina GAIIx	Phase_I	377	97	NM_172347	0	0	0	0	0	Q96H24	Silent	SNP	ENST00000308251.4	37	CCDS10945.1																																																																																			.		0.662	KCNG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269079.2	NM_172347	
USP10	9100	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	84806251	84806251	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr16:84806251C>G	ENST00000219473.7	+	12	2216	c.2103C>G	c.(2101-2103)atC>atG	p.I701M	USP10_ENST00000570191.1_Missense_Mutation_p.I705M	NM_001272075.1|NM_005153.2	NP_001259004.1|NP_005144.2	Q14694	UBP10_HUMAN	ubiquitin specific peptidase 10	701	USP.				autophagy (GO:0006914)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA repair (GO:0006281)|protein deubiquitination (GO:0016579)|regulation of autophagy (GO:0010506)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|poly(A) RNA binding (GO:0044822)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			endometrium(3)|kidney(1)|large_intestine(7)|lung(3)|prostate(1)|stomach(1)|urinary_tract(1)	17						AGAAGCTTATCAAAAATATTG	0.448																																					p.I705M		.											.	USP10-636	0			c.C2115G						.						116.0	111.0	112.0					16																	84806251		1876	4112	5988	SO:0001583	missense	9100	exon13			GCTTATCAAAAAT	D80012	CCDS45537.1, CCDS62004.1	16q	2008-03-25	2005-08-08			ENSG00000103194		"""Ubiquitin-specific peptidases"""	12608	protein-coding gene	gene with protein product		609818	"""ubiquitin specific protease 10"""			12838346	Standard	NM_005153		Approved	UBPO, KIAA0190	uc002fii.3	Q14694		ENST00000219473.7:c.2103C>G	16.37:g.84806251C>G	ENSP00000219473:p.Ile701Met	Somatic	140	0		WXS	Illumina GAIIx	Phase_I	124	13	NM_001272075	0	0	18	27	9	B2RDJ8|B4DS84|Q9BWG7|Q9NSL7	Missense_Mutation	SNP	ENST00000219473.7	37	CCDS45537.1	.	.	.	.	.	.	.	.	.	.	C	7.316	0.615901	0.14129	.	.	ENSG00000103194	ENST00000219473	T	0.31247	1.5	4.38	2.34	0.29019	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.513321	0.21006	N	0.081771	T	0.21267	0.0512	N	0.22421	0.69	0.40896	D	0.984116	B;B	0.24132	0.098;0.04	B;B	0.26517	0.047;0.07	T	0.05273	-1.0895	10	0.36615	T	0.2	-2.0474	12.2868	0.54797	0.3083:0.6917:0.0:0.0	.	705;701	Q14694-3;Q14694	.;UBP10_HUMAN	M	701	ENSP00000219473:I701M	ENSP00000219473:I701M	I	+	3	3	USP10	83363752	0.755000	0.28372	0.056000	0.19401	0.704000	0.40688	0.096000	0.15147	0.376000	0.24707	0.563000	0.77884	ATC	.		0.448	USP10-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433660.1		
TRPV3	162514	bcgsc.ca	37	17	3446885	3446885	+	Missense_Mutation	SNP	T	T	C	rs322937	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr17:3446885T>C	ENST00000576742.1	-	5	670	c.349A>G	c.(349-351)Agg>Ggg	p.R117G	TRPV3_ENST00000301365.4_Missense_Mutation_p.R117G|TRPV3_ENST00000572519.1_Missense_Mutation_p.R117G	NM_001258205.1|NM_145068.3	NP_001245134.1|NP_659505.1	Q8NET8	TRPV3_HUMAN	transient receptor potential cation channel, subfamily V, member 3	117			R -> G (in dbSNP:rs322937). {ECO:0000269|PubMed:12077606}.		calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|negative regulation of hair cycle (GO:0042636)|positive regulation of calcium ion import (GO:0090280)|response to heat (GO:0009408)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium channel activity (GO:0005262)			breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(12)|ovary(5)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	35					Menthol(DB00825)	TTCAGCCGCCTCTTTTTCCTC	0.547													T|||	1256	0.250799	0.115	0.2147	5008	,	,		19720	0.247		0.3996	False		,,,				2504	0.3108				p.R117G		.											.	TRPV3-94	0			c.A349G						.	T	GLY/ARG	731,3675	301.3+/-286.8	72,587,1544	115.0	111.0	112.0		349	2.8	1.0	17	dbSNP_79	112	3431,5169	505.5+/-376.4	670,2091,1539	yes	missense	TRPV3	NM_145068.2	125	742,2678,3083	CC,CT,TT		39.8953,16.591,32.0006	benign	117/791	3446885	4162,8844	2203	4300	6503	SO:0001583	missense	162514	exon5			GCCGCCTCTTTTT	AF514998	CCDS11029.1, CCDS58500.1	17p13.3	2013-01-10			ENSG00000167723	ENSG00000167723		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18084	protein-coding gene	gene with protein product		607066				12016205, 12077606, 16382100	Standard	NM_001258205		Approved	VRL3	uc002fvr.3	Q8NET8	OTTHUMG00000090695	ENST00000576742.1:c.349A>G	17.37:g.3446885T>C	ENSP00000461518:p.Arg117Gly	Somatic	73	0		WXS	Illumina GAIIx	Phase_I	81	7	NM_001258205	0	0	0	0	0	Q8NDW7|Q8NET9|Q8NFH2	Missense_Mutation	SNP	ENST00000576742.1	37	CCDS11029.1	571	0.26144688644688646	43	0.08739837398373984	89	0.24585635359116023	136	0.23776223776223776	303	0.3997361477572559	T	8.019	0.759106	0.15846	0.16591	0.398953	ENSG00000167723	ENST00000381913;ENST00000301365;ENST00000430263	D	0.87491	-2.26	5.12	2.83	0.33086	.	0.384610	0.26300	N	0.025163	T	0.00012	0.0000	L	0.45352	1.415	0.48288	P	3.769999999999607E-4	B;B;B;B	0.14012	0.007;0.007;0.009;0.007	B;B;B;B	0.19391	0.015;0.015;0.025;0.015	T	0.10894	-1.0610	9	0.39692	T	0.17	-6.117	10.6601	0.45698	0.0:0.0:0.3068:0.6932	rs322937;rs59567507;rs322937	101;117;117;117	E7EV24;Q8NET8-3;Q8NET8;Q8NET8-2	.;.;TRPV3_HUMAN;.	G	117;117;101	ENSP00000301365:R117G	ENSP00000301365:R117G	R	-	1	2	TRPV3	3393635	0.993000	0.37304	0.990000	0.47175	0.079000	0.17450	2.032000	0.41127	0.326000	0.23384	-0.429000	0.05907	AGG	T|0.714;C|0.286		0.547	TRPV3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000207379.2	NM_145068	
SPNS2	124976	ucsc.edu	37	17	4436657	4436657	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr17:4436657G>T	ENST00000329078.3	+	8	1418	c.1208G>T	c.(1207-1209)gGc>gTc	p.G403V		NM_001124758.1	NP_001118230.1	Q8IVW8	SPNS2_HUMAN	spinster homolog 2 (Drosophila)	403					B cell homeostasis (GO:0001782)|bone development (GO:0060348)|lymph node development (GO:0048535)|lymphocyte migration (GO:0072676)|regulation of eye pigmentation (GO:0048073)|regulation of humoral immune response (GO:0002920)|sphingolipid metabolic process (GO:0006665)|sphingosine-1-phosphate signaling pathway (GO:0003376)|T cell homeostasis (GO:0043029)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)	sphingolipid transporter activity (GO:0046624)			large_intestine(3)|lung(1)|prostate(1)|skin(1)	6						TGTGCCGTGGGCATGCTGGGC	0.647																																					p.G403V		.											.	SPNS2-68	0			c.G1208T						.						45.0	45.0	45.0					17																	4436657		1568	3582	5150	SO:0001583	missense	124976	exon8			CCGTGGGCATGCT	BC041772	CCDS42237.1	17p13.2	2008-12-15				ENSG00000183018			26992	protein-coding gene	gene with protein product		612584				12815463	Standard	NM_001124758		Approved		uc002fxx.2	Q8IVW8		ENST00000329078.3:c.1208G>T	17.37:g.4436657G>T	ENSP00000333292:p.Gly403Val	Somatic	13	0		WXS	Illumina GAIIx	Phase_I	41	4	NM_001124758	0	0	1	1	0	B9A1T3	Missense_Mutation	SNP	ENST00000329078.3	37	CCDS42237.1	.	.	.	.	.	.	.	.	.	.	g	28.4	4.921178	0.92249	.	.	ENSG00000183018	ENST00000329078	T	0.63744	-0.06	4.72	4.72	0.59763	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.049998	0.85682	D	0.000000	T	0.79173	0.4401	M	0.77712	2.385	0.80722	D	1	D	0.76494	0.999	D	0.74674	0.984	T	0.82760	-0.0298	10	0.87932	D	0	.	16.2505	0.82481	0.0:0.0:1.0:0.0	.	403	Q8IVW8	SPNS2_HUMAN	V	403	ENSP00000333292:G403V	ENSP00000333292:G403V	G	+	2	0	SPNS2	4383406	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.866000	0.99616	2.161000	0.67846	0.486000	0.48141	GGC	.		0.647	SPNS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438802.1		
NF1	4763	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	29664421	29664421	+	Nonsense_Mutation	SNP	G	G	T			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr17:29664421G>T	ENST00000358273.4	+	43	6846	c.6463G>T	c.(6463-6465)Gag>Tag	p.E2155*	NF1_ENST00000417592.2_5'Flank|NF1_ENST00000356175.3_Nonsense_Mutation_p.E2134*|NF1_ENST00000444181.2_5'Flank	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	2155					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(3)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		CAGTCTGACAGAGTTCTCATT	0.388			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																											p.E2155X		.	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	.	NF1-3353	11	Whole gene deletion(8)|Unknown(3)	soft_tissue(7)|autonomic_ganglia(2)|lung(1)|central_nervous_system(1)	c.G6463T						.						96.0	84.0	88.0					17																	29664421		2203	4300	6503	SO:0001587	stop_gained	4763	exon43	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome	CTGACAGAGTTCT		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.6463G>T	17.37:g.29664421G>T	ENSP00000351015:p.Glu2155*	Somatic	55	0		WXS	Illumina GAIIx	Phase_I	47	32	NM_001042492	0	0	0	0	0	O00662|Q14284|Q14930|Q14931|Q9UMK3	Nonsense_Mutation	SNP	ENST00000358273.4	37	CCDS42292.1	.	.	.	.	.	.	.	.	.	.	G	49	15.696311	0.99842	.	.	ENSG00000196712	ENST00000358273;ENST00000356175;ENST00000456735	.	.	.	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	.	19.8683	0.96840	0.0:0.0:1.0:0.0	.	.	.	.	X	2155;2134;1800	.	ENSP00000348498:E2134X	E	+	1	0	NF1	26688547	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.274000	0.95731	2.753000	0.94483	0.655000	0.94253	GAG	.		0.388	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267	
GPATCH8	23131	broad.mit.edu;bcgsc.ca	37	17	42477935	42477940	+	In_Frame_Del	DEL	CTGAAA	CTGAAA	-			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr17:42477935_42477940delCTGAAA	ENST00000591680.1	-	8	1535_1540	c.1505_1510delTTTCAG	c.(1504-1512)gtttcagag>gag	p.VS502del	GPATCH8_ENST00000434000.1_In_Frame_Del_p.VS424del	NM_001002909.2	NP_001002909.1	Q9UKJ3	GPTC8_HUMAN	G patch domain containing 8	502							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(4)|endometrium(7)|kidney(6)|large_intestine(4)|liver(2)|lung(21)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	50		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.206)		ATTTGGGTCTCTGAAACCTTCTGACT	0.49											OREG0024461	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.502_504del		.											.	GPATCH8-94	0			c.1505_1510del						.																																			SO:0001651	inframe_deletion	23131	exon8			GGGTCTCTGAAAC	AB011125	CCDS32666.1	17q21.31	2013-01-28	2006-08-22	2006-12-13	ENSG00000186566	ENSG00000186566		"""G patch domain containing"""	29066	protein-coding gene	gene with protein product		614396	"""KIAA0553"""	KIAA0553, GPATC8		9628581	Standard	NM_001002909		Approved		uc002igw.2	Q9UKJ3	OTTHUMG00000181818	ENST00000591680.1:c.1505_1510delTTTCAG	17.37:g.42477935_42477940delCTGAAA	ENSP00000467556:p.Val502_Ser503del	Somatic	83	0	909	WXS	Illumina GAIIx	Phase_I	55	7	NM_001002909	0	0	0	0	0	B9EGP9|O60300|Q8TB99	In_Frame_Del	DEL	ENST00000591680.1	37	CCDS32666.1																																																																																			.		0.490	GPATCH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457797.1	NM_001002909	
ITGA3	3675	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	48165662	48165662	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr17:48165662A>C	ENST00000320031.8	+	25	3449	c.3119A>C	c.(3118-3120)cAg>cCg	p.Q1040P	ITGA3_ENST00000007722.7_Intron	NM_002204.2|NM_005501.2	NP_002195.1|NP_005492.1	P26006	ITA3_HUMAN	integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor)	1040					blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|lung development (GO:0030324)|maternal process involved in female pregnancy (GO:0060135)|memory (GO:0007613)|mesodermal cell differentiation (GO:0048333)|negative regulation of cell projection organization (GO:0031345)|nephron development (GO:0072006)|neuron migration (GO:0001764)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|regulation of BMP signaling pathway (GO:0030510)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of Wnt signaling pathway (GO:0030111)|renal filtration (GO:0097205)|response to drug (GO:0042493)|response to gonadotropin (GO:0034698)|skin development (GO:0043588)	basolateral plasma membrane (GO:0016323)|cell periphery (GO:0071944)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|integrin alpha3-beta1 complex (GO:0034667)|integrin complex (GO:0008305)|invadopodium membrane (GO:0071438)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	glycoprotein binding (GO:0001948)|metal ion binding (GO:0046872)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)			endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(2)	31						ATGAAGAGCCAGCCGTCAGAG	0.692																																					p.Q1040P		.											.	ITGA3-229	0			c.A3119C						.						13.0	16.0	15.0					17																	48165662		2183	4269	6452	SO:0001583	missense	3675	exon25			AGAGCCAGCCGTC	M59911	CCDS11557.1, CCDS11558.1	17q21.33	2010-03-23	2003-10-13		ENSG00000005884	ENSG00000005884		"""CD molecules"", ""Integrins"""	6139	protein-coding gene	gene with protein product		605025	"""antigen identified by monoclonal antibody J143"""	MSK18		1655803, 9704023	Standard	NM_005501		Approved	CD49c, VLA3a, VCA-2, GAP-B3	uc010dbm.3	P26006	OTTHUMG00000161890	ENST00000320031.8:c.3119A>C	17.37:g.48165662A>C	ENSP00000315190:p.Gln1040Pro	Somatic	142	0		WXS	Illumina GAIIx	Phase_I	166	18	NM_002204	0	0	10	12	2	A7E246|B7ZM80|B9EGQ1|D3DTX4|D3DTX5	Missense_Mutation	SNP	ENST00000320031.8	37	CCDS11558.1	.	.	.	.	.	.	.	.	.	.	A	12.96	2.095594	0.36952	.	.	ENSG00000005884	ENST00000538917;ENST00000320031	T	0.22743	1.94	5.1	5.1	0.69264	.	.	.	.	.	T	0.11281	0.0275	N	0.08118	0	0.80722	D	1	B	0.13594	0.008	B	0.13407	0.009	T	0.16512	-1.0400	9	0.23302	T	0.38	.	12.3934	0.55370	1.0:0.0:0.0:0.0	.	1040	P26006	ITA3_HUMAN	P	1026;1040	ENSP00000315190:Q1040P	ENSP00000315190:Q1040P	Q	+	2	0	ITGA3	45520661	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	8.551000	0.90678	1.932000	0.55993	0.379000	0.24179	CAG	.		0.692	ITGA3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000366298.1	NM_005501	
ANKRD40	91369	broad.mit.edu	37	17	48774315	48774315	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr17:48774315T>C	ENST00000285243.6	-	4	1215	c.946A>G	c.(946-948)Act>Gct	p.T316A	Y_RNA_ENST00000364470.1_RNA|RP11-294J22.6_ENST00000574246.1_RNA	NM_052855.3	NP_443087.1	Q6AI12	ANR40_HUMAN	ankyrin repeat domain 40	316										breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)|skin(1)|urinary_tract(1)	11			BRCA - Breast invasive adenocarcinoma(22;2.03e-09)			CTTAACAGAGTATTGGGTAAC	0.448																																					p.T316A		.											.	ANKRD40-90	0			c.A946G						.						129.0	125.0	127.0					17																	48774315		2203	4300	6503	SO:0001583	missense	91369	exon4			ACAGAGTATTGGG	BC012978	CCDS11572.1	17q21.33	2013-01-10			ENSG00000154945	ENSG00000154945		"""Ankyrin repeat domain containing"""	28233	protein-coding gene	gene with protein product						12477932	Standard	NM_052855		Approved	MGC15396	uc002iso.3	Q6AI12	OTTHUMG00000162255	ENST00000285243.6:c.946A>G	17.37:g.48774315T>C	ENSP00000285243:p.Thr316Ala	Somatic	72	1		WXS	Illumina GAIIx	Phase_I	108	5	NM_052855	0	0	16	16	0	Q96E32	Missense_Mutation	SNP	ENST00000285243.6	37	CCDS11572.1	.	.	.	.	.	.	.	.	.	.	T	25.4	4.632875	0.87660	.	.	ENSG00000154945	ENST00000285243	T	0.36520	1.25	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.59851	0.2224	M	0.72353	2.195	0.80722	D	1	D	0.76494	0.999	D	0.73380	0.98	T	0.63625	-0.6595	10	0.72032	D	0.01	-22.2218	15.9416	0.79758	0.0:0.0:0.0:1.0	.	316	Q6AI12	ANR40_HUMAN	A	316	ENSP00000285243:T316A	ENSP00000285243:T316A	T	-	1	0	ANKRD40	46129314	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	7.651000	0.83577	2.225000	0.72522	0.533000	0.62120	ACT	.		0.448	ANKRD40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368201.2	NM_052855	
TMEM104	54868	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	72786401	72786401	+	Silent	SNP	C	C	T			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr17:72786401C>T	ENST00000335464.5	+	5	474	c.312C>T	c.(310-312)taC>taT	p.Y104Y	TMEM104_ENST00000417024.2_Silent_p.Y117Y|TMEM104_ENST00000582773.1_Silent_p.Y104Y|TMEM104_ENST00000582330.1_Silent_p.Y104Y	NM_017728.3	NP_060198.3	Q8NE00	TM104_HUMAN	transmembrane protein 104	104						integral component of membrane (GO:0016021)				NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(5)|ovary(1)	19	all_lung(278;0.23)					GGGACAACTACGAGCGGGCAG	0.607																																					p.Y104Y		.											.	TMEM104-90	0			c.C312T						.						116.0	104.0	108.0					17																	72786401		2203	4300	6503	SO:0001819	synonymous_variant	54868	exon5			CAACTACGAGCGG	AK074029	CCDS32723.1	17q25.1	2005-12-19				ENSG00000109066			25984	protein-coding gene	gene with protein product							Standard	NM_017728		Approved	FLJ20255, FLJ00021	uc002jls.4	Q8NE00		ENST00000335464.5:c.312C>T	17.37:g.72786401C>T		Somatic	106	1		WXS	Illumina GAIIx	Phase_I	215	44	NM_017728	0	0	34	44	10	Q8TEU1|Q9NT56|Q9NXH1	Silent	SNP	ENST00000335464.5	37	CCDS32723.1																																																																																			.		0.607	TMEM104-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444442.1	NM_017728	
FDXR	2232	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	72862659	72862659	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr17:72862659T>C	ENST00000293195.5	-	4	380	c.302A>G	c.(301-303)cAt>cGt	p.H101R	FDXR_ENST00000413947.2_Missense_Mutation_p.H132R|FDXR_ENST00000581530.1_Missense_Mutation_p.H101R|FDXR_ENST00000582944.1_Missense_Mutation_p.H93R|FDXR_ENST00000420580.2_Intron|FDXR_ENST00000583917.1_Missense_Mutation_p.H102R|FDXR_ENST00000442102.2_Missense_Mutation_p.H144R|FDXR_ENST00000455107.2_Missense_Mutation_p.H57R|FDXR_ENST00000544854.1_Missense_Mutation_p.H49R|FDXR_ENST00000581969.1_5'UTR	NM_001258014.1|NM_004110.3|NM_024417.2	NP_001244943.1|NP_004101.2|NP_077728.2	P22570	ADRO_HUMAN	ferredoxin reductase	101					cholesterol metabolic process (GO:0008203)|generation of precursor metabolites and energy (GO:0006091)|NADPH oxidation (GO:0070995)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ferredoxin-NADP+ reductase activity (GO:0004324)|NADPH binding (GO:0070402)|NADPH-adrenodoxin reductase activity (GO:0015039)			central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(9)|prostate(1)|skin(1)	16	all_lung(278;0.172)|Lung NSC(278;0.207)				Flavin adenine dinucleotide(DB03147)	GCGGCCAGAATGGGCCGTCTG	0.637																																					p.H144R		.											.	FDXR-226	0			c.A431G						.						42.0	34.0	37.0					17																	72862659		2203	4300	6503	SO:0001583	missense	2232	exon4			CCAGAATGGGCCG	J03826	CCDS11707.1, CCDS58591.1, CCDS58592.1, CCDS58593.1, CCDS58594.1, CCDS58595.1, CCDS58596.1	17q25.1	2013-06-18			ENSG00000161513	ENSG00000161513	1.18.1.6		3642	protein-coding gene	gene with protein product	"""adrenodoxin-NADP(+) reductase"", ""adrenodoxin reductase"""	103270		ADXR		2969697	Standard	NM_001258014		Approved		uc010wrl.2	P22570	OTTHUMG00000179026	ENST00000293195.5:c.302A>G	17.37:g.72862659T>C	ENSP00000293195:p.His101Arg	Somatic	160	1		WXS	Illumina GAIIx	Phase_I	419	90	NM_001258012	0	1	606	846	239	B4DDI7|B4DHX5|B4DQQ4|B4DX24|B7Z7G2|E7EQC1|Q13716|Q4PJI0|Q9BU12	Missense_Mutation	SNP	ENST00000293195.5	37	CCDS58593.1	.	.	.	.	.	.	.	.	.	.	T	12.03	1.816171	0.32145	.	.	ENSG00000161513	ENST00000544854;ENST00000293195;ENST00000455107;ENST00000442102;ENST00000413947	T;T;T;T;T	0.64991	-0.13;-0.13;-0.13;-0.13;-0.13	5.05	-5.12	0.02893	.	0.428864	0.27298	N	0.020019	T	0.17746	0.0426	N	0.00459	-1.475	0.18873	N	0.999985	B;B;B;B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B;B;B;B	0.04013	0.0;0.0;0.001;0.0;0.0;0.0;0.001;0.0;0.0	T	0.44772	-0.9306	10	0.07325	T	0.83	-21.5241	9.0992	0.36658	0.0844:0.7402:0.0:0.1755	.	144;132;99;49;132;101;93;101;101	B4DHX5;E7EQC1;B4DDI9;B7Z7G2;B4DDI7;Q6GSK2;B4DX24;P22570;P22570-2	.;.;.;.;.;.;.;ADRO_HUMAN;.	R	49;101;57;144;132	ENSP00000445432:H49R;ENSP00000293195:H101R;ENSP00000390875:H57R;ENSP00000416515:H144R;ENSP00000408595:H132R	ENSP00000293195:H101R	H	-	2	0	FDXR	70374254	0.002000	0.14202	0.127000	0.21898	0.978000	0.69477	-0.381000	0.07417	-0.777000	0.04572	0.459000	0.35465	CAT	.		0.637	FDXR-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000444449.1	NM_004110	
KIAA0195	9772	bcgsc.ca	37	17	73485707	73485707	+	Silent	SNP	G	G	A	rs34364349	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr17:73485707G>A	ENST00000314256.7	+	9	1312	c.918G>A	c.(916-918)ggG>ggA	p.G306G	KIAA0195_ENST00000375248.5_Silent_p.G316G|KIAA0195_ENST00000579208.1_Intron|KIAA0195_ENST00000583795.1_Intron	NM_014738.4	NP_055553.3	Q12767	K0195_HUMAN	KIAA0195	306						integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(2)|endometrium(5)|kidney(2)|large_intestine(7)|lung(17)|ovary(5)|skin(2)|stomach(1)|urinary_tract(1)	42	all_cancers(13;3.15e-09)|all_epithelial(9;5.94e-10)|Breast(9;1.85e-09)|all_lung(278;0.246)		all cancers(21;5.01e-07)|Epithelial(20;5e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			GTGCCCCGGGGGTCACTTCCT	0.632													G|||	174	0.0347444	0.0386	0.0375	5008	,	,		18477	0.001		0.0755	False		,,,				2504	0.0204				p.G306G		.											.	KIAA0195-91	0			c.G918A						.	G		187,4219	118.8+/-156.5	4,179,2020	100.0	72.0	81.0		918	-3.3	0.9	17	dbSNP_126	81	479,8121	140.0+/-196.6	10,459,3831	no	coding-synonymous	KIAA0195	NM_014738.4		14,638,5851	AA,AG,GG		5.5698,4.2442,5.1207		306/1357	73485707	666,12340	2203	4300	6503	SO:0001819	synonymous_variant	9772	exon9			CCCGGGGGTCACT		CCDS32732.1	17q25.1	2012-03-01			ENSG00000177728	ENSG00000177728			28983	protein-coding gene	gene with protein product						8724849	Standard	NM_014738		Approved	TMEM94	uc002jnz.4	Q12767		ENST00000314256.7:c.918G>A	17.37:g.73485707G>A		Somatic	100	0		WXS	Illumina GAIIx	Phase_I	183	6	NM_014738	0	0	21	21	0	O75536|Q86XF1	Silent	SNP	ENST00000314256.7	37	CCDS32732.1																																																																																			G|0.951;A|0.049		0.632	KIAA0195-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447303.1	NM_014738	
TNRC6C	57690	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	76067213	76067213	+	Silent	SNP	G	G	C			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr17:76067213G>C	ENST00000588061.1	+	8	3553	c.2826G>C	c.(2824-2826)cgG>cgC	p.R942R	TNRC6C_ENST00000541771.1_Silent_p.R942R|TNRC6C_ENST00000544502.1_Silent_p.R939R|TNRC6C_ENST00000301624.4_Silent_p.R942R|TNRC6C_ENST00000588847.1_Silent_p.R939R|TNRC6C_ENST00000335749.4_Silent_p.R939R			Q9HCJ0	TNR6C_HUMAN	trinucleotide repeat containing 6C	942	UBA. {ECO:0000255|PROSITE- ProRule:PRU00212}.				embryonic hemopoiesis (GO:0035162)|endoderm formation (GO:0001706)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of gene silencing by miRNA (GO:0060964)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(9)|lung(16)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			TCATGAGCCGGCTGATCAAAC	0.493																																					p.R942R		.											.	TNRC6C-24	0			c.G2826C						.						72.0	73.0	73.0					17																	76067213		1964	4148	6112	SO:0001819	synonymous_variant	57690	exon7			GAGCCGGCTGATC	AL834429	CCDS45798.1, CCDS45799.1	17q25.3	2012-10-04			ENSG00000078687	ENSG00000078687		"""Trinucleotide (CAG) repeat containing"""	29318	protein-coding gene	gene with protein product		610741					Standard	NM_018996		Approved	KIAA1582, FLJ20015	uc002juf.2	Q9HCJ0	OTTHUMG00000132642	ENST00000588061.1:c.2826G>C	17.37:g.76067213G>C		Somatic	187	0		WXS	Illumina GAIIx	Phase_I	331	27	NM_018996	0	0	1	1	0	G3XAB8|Q86UE5|Q8N3D8|Q96MU9	Silent	SNP	ENST00000588061.1	37	CCDS45798.1																																																																																			.		0.493	TNRC6C-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000395947.1	NM_018996	
SEH1L	81929	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	18	12986994	12986994	+	3'UTR	SNP	C	C	A			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr18:12986994C>A	ENST00000262124.11	+	0	2953				RP11-773H22.4_ENST00000588211.1_RNA|SEH1L_ENST00000399892.2_Missense_Mutation_p.H402N	NM_031216.3	NP_112493.2	Q96EE3	SEH1_HUMAN	SEH1-like (S. cerevisiae)						attachment of spindle microtubules to kinetochore involved in mitotic sister chromatid segregation (GO:0051315)|carbohydrate metabolic process (GO:0005975)|cytokine production involved in inflammatory response (GO:0002534)|cytokine-mediated signaling pathway (GO:0019221)|defense response to Gram-positive bacterium (GO:0050830)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic metaphase plate congression (GO:0007080)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore organization (GO:0006999)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nuclear envelope (GO:0005635)|nuclear pore outer ring (GO:0031080)				central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(5)|pancreas(1)|prostate(1)	11						CCAGTATCCTCACCCTCGCAG	0.493																																					p.H402N		.											.	SEH1L-90	0			c.C1204A						.						114.0	103.0	107.0					18																	12986994		2203	4300	6503	SO:0001624	3_prime_UTR_variant	81929	exon9			TATCCTCACCCTC	BC012430	CCDS32791.1, CCDS45832.1	18p11.21	2013-01-10				ENSG00000085415		"""WD repeat domain containing"""	30379	protein-coding gene	gene with protein product	"""sec13 like protein"", ""nucleoporin Seh1"""	609263				12196509, 14517296	Standard	XM_005258152		Approved	SEH1A, SEH1B, Seh1, SEC13L	uc002krq.3	Q96EE3		ENST00000262124.11:c.*1743C>A	18.37:g.12986994C>A		Somatic	74	0		WXS	Illumina GAIIx	Phase_I	66	26	NM_001013437	0	0	19	35	16	A8K5B1|Q8NFU6|Q96MH3|Q9C069	Missense_Mutation	SNP	ENST00000262124.11	37	CCDS45832.1	.	.	.	.	.	.	.	.	.	.	C	12.58	1.982120	0.34942	.	.	ENSG00000085415	ENST00000399892	T	0.69040	-0.37	5.7	5.7	0.88788	.	0.351640	0.26887	N	0.021997	T	0.58047	0.2095	.	.	.	0.27581	N	0.949582	B	0.02656	0.0	B	0.04013	0.001	T	0.53229	-0.8468	9	0.48119	T	0.1	-6.0588	14.6453	0.68756	0.1454:0.8546:0.0:0.0	.	402	Q96EE3-1	.	N	402	ENSP00000382779:H402N	ENSP00000382779:H402N	H	+	1	0	SEH1L	12976994	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.888000	0.56204	2.697000	0.92050	0.557000	0.71058	CAC	.		0.493	SEH1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458254.1	NM_031216	
ANKRD20A5P	440482	bcgsc.ca	37	18	14183680	14183680	+	RNA	SNP	G	G	A	rs75090388	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr18:14183680G>A	ENST00000581935.1	+	0	531							A0PJZ0	A20A5_HUMAN	ankyrin repeat domain 20 family, member A5, pseudogene											lung(3)	3						TGTGCCAGTGGCCATGTGAAA	0.388																																					.		.											.	ANKRD20A5P-90	0			.						.																																					440482	.			CCAGTGGCCATGT	BC022023		18p11.21	2011-06-01	2011-06-01	2011-06-01	ENSG00000186481	ENSG00000186481			33833	pseudogene	pseudogene			"""ankyrin repeat domain 20 family, member A5"""	ANKRD20A5			Standard	NR_040113		Approved	MGC26718	uc010xag.2	A0PJZ0	OTTHUMG00000157172		18.37:g.14183680G>A		Somatic	157	2		WXS	Illumina GAIIx	Phase_I	136	20	.	0	0	0	0	0	Q4G1B6	RNA	SNP	ENST00000581935.1	37																																																																																				G|0.300;A|0.700		0.388	ANKRD20A5P-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000442833.1		
SMAD7	4092	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	46447841	46447841	+	Silent	SNP	G	G	A	rs141213977	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr18:46447841G>A	ENST00000262158.2	-	4	1468	c.1182C>T	c.(1180-1182)acC>acT	p.T394T	SMAD7_ENST00000585986.1_5'Flank|SMAD7_ENST00000589634.1_Silent_p.T393T|SMAD7_ENST00000591805.1_Silent_p.T179T	NM_001190821.1|NM_005904.3	NP_001177750.1|NP_005895.1	O15105	SMAD7_HUMAN	SMAD family member 7	394	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				adherens junction assembly (GO:0034333)|artery morphogenesis (GO:0048844)|BMP signaling pathway (GO:0030509)|cellular protein complex localization (GO:0034629)|cellular response to transforming growth factor beta stimulus (GO:0071560)|gene expression (GO:0010467)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell migration (GO:0030336)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription by competitive promoter binding (GO:0010944)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein stabilization (GO:0050821)|regulation of activin receptor signaling pathway (GO:0032925)|regulation of cardiac muscle contraction (GO:0055117)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|response to laminar fluid shear stress (GO:0034616)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	activin binding (GO:0048185)|beta-catenin binding (GO:0008013)|I-SMAD binding (GO:0070411)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, inhibitory cytoplasmic mediator activity (GO:0030617)|type I transforming growth factor beta receptor binding (GO:0034713)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)	10	Colorectal(1;0.0518)					TGATCTGCACGGTAAAGCCCG	0.592													G|||	2	0.000399361	0.0	0.0	5008	,	,		14806	0.0		0.0	False		,,,				2504	0.002				p.T394T		.											.	SMAD7-414	0			c.C1182T						.	G	,,,	2,4404	4.2+/-10.8	0,2,2201	61.0	55.0	57.0		1179,537,618,1182	-3.5	0.9	18	dbSNP_134	57	1,8599	2.2+/-6.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	SMAD7	NM_001190821.1,NM_001190822.1,NM_001190823.1,NM_005904.3	,,,	0,3,6500	AA,AG,GG		0.0116,0.0454,0.0231	,,,	393/426,179/212,206/239,394/427	46447841	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	4092	exon4			CTGCACGGTAAAG	AF010193	CCDS11936.1, CCDS54186.1, CCDS59317.1	18q21.1	2006-11-06	2006-11-06	2004-05-26	ENSG00000101665	ENSG00000101665		"""SMADs"""	6773	protein-coding gene	gene with protein product		602932	"""MAD, mothers against decapentaplegic homolog 7 (Drosophila)"", ""SMAD, mothers against DPP homolog 7 (Drosophila)"""	MADH8, MADH7		9256479, 9730599	Standard	NM_005904		Approved		uc002ldg.3	O15105	OTTHUMG00000132655	ENST00000262158.2:c.1182C>T	18.37:g.46447841G>A		Somatic	165	0		WXS	Illumina GAIIx	Phase_I	167	54	NM_005904	0	0	9	14	5	B7Z773|K7EQ10|O14740|Q6DK23	Silent	SNP	ENST00000262158.2	37	CCDS11936.1																																																																																			G|0.999;A|0.001		0.592	SMAD7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255906.1	NM_005904	
ABCA7	10347	hgsc.bcm.edu	37	19	1065044	1065044	+	Silent	SNP	C	C	T	rs4147935	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr19:1065044C>T	ENST00000263094.6	+	46	6390	c.6159C>T	c.(6157-6159)ggC>ggT	p.G2053G	ABCA7_ENST00000433129.1_Silent_p.G2053G|HMHA1_ENST00000586866.1_5'Flank|HMHA1_ENST00000536472.1_5'Flank|ABCA7_ENST00000435683.2_Silent_p.G1915G|HMHA1_ENST00000313093.2_5'Flank|HMHA1_ENST00000590214.1_5'Flank|HMHA1_ENST00000539243.2_5'Flank	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	2053					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)			NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CACATGGAGGCCGCCTGCGCT	0.736																																					p.G2053G		.											.	ABCA7-98	0			c.C6159T						.	C		327,3757		20,287,1735	5.0	6.0	6.0		6159	1.5	0.8	19	dbSNP_110	6	2858,5242		553,1752,1745	no	coding-synonymous	ABCA7	NM_019112.3		573,2039,3480	TT,TC,CC		35.284,8.0069,26.1408		2053/2147	1065044	3185,8999	2042	4050	6092	SO:0001819	synonymous_variant	10347	exon46			TGGAGGCCGCCTG	AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.6159C>T	19.37:g.1065044C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	10	NM_019112	0	0	0	0	0	Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Silent	SNP	ENST00000263094.6	37	CCDS12055.1																																																																																			C|0.766;T|0.234		0.736	ABCA7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000394993.1	NM_019112	
CACTIN	58509	hgsc.bcm.edu	37	19	3613346	3613346	+	Missense_Mutation	SNP	G	G	A	rs2074789	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr19:3613346G>A	ENST00000429344.2	-	9	1548	c.1496C>T	c.(1495-1497)gCg>gTg	p.A499V	CACTIN_ENST00000248420.5_Missense_Mutation_p.A499V|CACTIN_ENST00000221899.3_Missense_Mutation_p.A431V|CACTIN-AS1_ENST00000592274.1_RNA	NM_001080543.1	NP_001074012.1	Q8WUQ7	CATIN_HUMAN	cactin, spliceosome C complex subunit	499				A -> V (in Ref. 4; AAH19848). {ECO:0000305}.	cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to tumor necrosis factor (GO:0071356)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|multicellular organismal development (GO:0007275)|negative regulation of interferon-beta production (GO:0032688)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)										GGTGGGCGCCGCGTCCTCAGG	0.781													G|||	2156	0.430511	0.3018	0.6037	5008	,	,		8769	0.3294		0.5795	False		,,,				2504	0.4325				p.A499V		.											.	.	0			c.C1496T						.	G	VAL/ALA,VAL/ALA	1466,1576		408,650,463	4.0	5.0	5.0		1496,1496	-5.6	0.0	19	dbSNP_96	5	4326,2414		1492,1342,536	yes	missense,missense	C19orf29	NM_001080543.1,NM_021231.1	64,64	1900,1992,999	AA,AG,GG		35.816,48.192,40.7892	benign,benign	499/759,499/759	3613346	5792,3990	1521	3370	4891	SO:0001583	missense	58509	exon9			GGCGCCGCGTCCT	BC019848	CCDS45920.1	19p13.3	2012-06-08	2012-06-08	2012-06-08	ENSG00000105298	ENSG00000105298			29938	protein-coding gene	gene with protein product	"""NY REN 24 antigen"", ""functional spliceosome-associated protein c"", ""cactin homolog (Drosophila)"""		"""chromosome 19 open reading frame 29"""	C19orf29		8619474, 9110174, 21429463, 20829348	Standard	NM_001080543		Approved	NY-REN-24, fSAPc, cactin	uc002lyh.3	Q8WUQ7		ENST00000429344.2:c.1496C>T	19.37:g.3613346G>A	ENSP00000415078:p.Ala499Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_021231	0	0	0	1	1	A6NNA9|A9UL12|O75229|Q7LE08|Q9BTA6|Q9Y5A4	Missense_Mutation	SNP	ENST00000429344.2	37	CCDS45920.1	1016|1016	0.4652014652014652|0.4652014652014652	166|166	0.33739837398373984|0.33739837398373984	219|219	0.6049723756906077|0.6049723756906077	189|189	0.3304195804195804|0.3304195804195804	442|442	0.58311345646438|0.58311345646438	G|G	10.30|10.30	1.311266|1.311266	0.23821|0.23821	0.48192|0.48192	0.64184|0.64184	ENSG00000105298|ENSG00000226800	ENST00000429344;ENST00000248420;ENST00000221899|ENST00000447295	.|.	.|.	.|.	3.38|3.38	-5.6|-5.6	0.02497|0.02497	.|.	2.059910|.	0.01925|.	N|.	0.040837|.	T|T	0.00012|0.00012	0.0000|0.0000	N|N	0.08118|0.08118	0|0	0.80722|0.80722	P|P	0.0|0.0	B;B|.	0.26602|.	0.116;0.154|.	B;B|.	0.18561|.	0.022;0.004|.	T|T	0.46952|0.46952	-0.9154|-0.9154	8|4	0.30078|.	T|.	0.28|.	.|.	0.7428|0.7428	0.00977|0.00977	0.2199:0.145:0.1962:0.4388|0.2199:0.145:0.1962:0.4388	rs2074789;rs11557007|rs2074789;rs11557007	499;499|.	Q8WUQ7-2;Q8WUQ7|.	.;CS029_HUMAN|.	V|H	499;499;431|325	.|.	ENSP00000221899:A431V|.	A|R	-|+	2|2	0|0	C19orf29|C19orf29OS	3564346|3564346	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.007000|0.007000	0.05969|0.05969	-1.122000|-1.122000	0.03267|0.03267	-0.535000|-0.535000	0.06307|0.06307	-0.258000|-0.258000	0.10820|0.10820	GCG|CGC	G|0.535;A|0.465		0.781	CACTIN-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000457370.2		
CACNA1A	773	hgsc.bcm.edu	37	19	13319693	13319693	+	Silent	SNP	A	A	G	rs16051	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr19:13319693A>G	ENST00000360228.5	-	46	6656	c.6657T>C	c.(6655-6657)caT>caC	p.H2219H	CACNA1A_ENST00000573710.2_Silent_p.H2220H	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	2220	Poly-His.				adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	GGGGCGGGGGAtggtggtggt	0.731													g|||	3440	0.686901	0.7874	0.6081	5008	,	,		6615	0.7897		0.6252	False		,,,				2504	0.5644				p.H2220H		.											.	CACNA1A-67	0			c.T6660C						.		,,,,	2283,905		898,487,209	3.0	4.0	3.0		6675,6660,6657,6666,6675		1.0	19	dbSNP_54	3	3993,3127		1321,1351,888	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	CACNA1A	NM_000068.3,NM_001127221.1,NM_001127222.1,NM_001174080.1,NM_023035.2	,,,,	2219,1838,1097	GG,GA,AA		43.9185,28.3877,39.1153	,,,,	2225/2267,2220/2262,2219/2507,2222/2264,2225/2513	13319693	6276,4032	1594	3560	5154	SO:0001819	synonymous_variant	773	exon46			CGGGGGATGGTGG	U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.6657T>C	19.37:g.13319693A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	21	11	NM_001127221	0	0	0	0	0	J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Silent	SNP	ENST00000360228.5	37	CCDS45998.1																																																																																			A|0.360;G|0.640		0.731	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104062.2	NM_000068	
C19orf57	79173	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	14000524	14000524	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr19:14000524C>T	ENST00000586783.1	-	5	1144	c.1145G>A	c.(1144-1146)aGg>aAg	p.R382K	C19orf57_ENST00000591586.1_Intron|C19orf57_ENST00000346736.2_Missense_Mutation_p.R382K|C19orf57_ENST00000454313.1_Missense_Mutation_p.R382K			Q0VDD7	CS057_HUMAN	chromosome 19 open reading frame 57	382					multicellular organismal development (GO:0007275)					breast(2)|kidney(1)|lung(3)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(19;2e-21)			TGGCAAGGCCCTCCTGTGGCC	0.667																																					p.R382K		.											.	C19orf57-93	0			c.G1145A						.						27.0	24.0	25.0					19																	14000524		2203	4297	6500	SO:0001583	missense	79173	exon6			AAGGCCCTCCTGT	BC012945	CCDS12299.1	19p13.12	2012-10-26			ENSG00000132016	ENSG00000132016			28153	protein-coding gene	gene with protein product						8228263	Standard	NM_024323		Approved	MGC11271	uc002mxl.1	Q0VDD7	OTTHUMG00000181851	ENST00000586783.1:c.1145G>A	19.37:g.14000524C>T	ENSP00000465822:p.Arg382Lys	Somatic	24	0		WXS	Illumina GAIIx	Phase_I	51	10	NM_024323	0	0	4	4	0	Q13411|Q8N825|Q96D63|Q9BU49	Missense_Mutation	SNP	ENST00000586783.1	37		.	.	.	.	.	.	.	.	.	.	C	5.208	0.223956	0.09863	.	.	ENSG00000132016	ENST00000454313;ENST00000346736	T;T	0.44083	0.93;0.93	4.21	-0.897	0.10553	.	0.854480	0.09958	N	0.733737	T	0.18841	0.0452	N	0.24115	0.695	0.09310	N	1	B;B	0.24823	0.05;0.112	B;B	0.20767	0.031;0.031	T	0.25813	-1.0121	10	0.05620	T	0.96	-0.0481	2.2681	0.04084	0.4017:0.3446:0.1521:0.1016	.	382;382	Q0VDD7-2;Q0VDD7	.;CS057_HUMAN	K	382	ENSP00000404382:R382K;ENSP00000254336:R382K	ENSP00000254336:R382K	R	-	2	0	C19orf57	13861524	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.661000	0.05311	0.070000	0.16634	-0.274000	0.10170	AGG	.		0.667	C19orf57-003	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000457947.1	NM_024323	
PKN1	5585	hgsc.bcm.edu	37	19	14552087	14552087	+	Silent	SNP	C	C	T			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr19:14552087C>T	ENST00000242783.6	+	2	319	c.154C>T	c.(154-156)Ctg>Ttg	p.L52L	PKN1_ENST00000342216.4_Silent_p.L58L|PKN1_ENST00000587429.1_3'UTR	NM_002741.3	NP_002732.3	Q16512	PKN1_HUMAN	protein kinase N1	52					activation of JUN kinase activity (GO:0007257)|epithelial cell migration (GO:0010631)|histone H3-T11 phosphorylation (GO:0035407)|hyperosmotic response (GO:0006972)|protein phosphorylation (GO:0006468)|regulation of cell motility (GO:2000145)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|GTP-Rho binding (GO:0017049)|histone binding (GO:0042393)|histone deacetylase binding (GO:0042826)|histone kinase activity (H3-T11 specific) (GO:0035402)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|Rac GTPase binding (GO:0048365)			breast(3)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)	31						GGAGCTGAAGCTGAAGGAGGG	0.736																																					p.L58L	NSCLC(185;2539 2965 10733 52867)	.											.	PKN1-1481	0			c.C172T						.						5.0	8.0	7.0					19																	14552087		1833	3984	5817	SO:0001819	synonymous_variant	5585	exon2			CTGAAGCTGAAGG	S75546	CCDS42513.1, CCDS42514.1	19p13.12	2008-05-14	2004-07-01	2004-07-01	ENSG00000123143	ENSG00000123143			9405	protein-coding gene	gene with protein product		601032	"""protein kinase C-like 1"""	PRKCL1		9570957	Standard	NM_002741		Approved	DBK, PRK1, PKN, MGC46204, PAK1	uc002myq.3	Q16512	OTTHUMG00000039611	ENST00000242783.6:c.154C>T	19.37:g.14552087C>T		Somatic	9	0		WXS	Illumina GAIIx	Phase_I	91	8	NM_213560	0	0	27	32	5	A8K7W5|B2R9R4|B3KVN3|Q15143|Q504U4|Q8IUV5|Q9UD44	Silent	SNP	ENST00000242783.6	37	CCDS42513.1																																																																																			.		0.736	PKN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095510.1	NM_002741, NM_213560	
GIPC1	10755	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	14591159	14591159	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr19:14591159G>A	ENST00000393033.4	-	6	882	c.613C>T	c.(613-615)Cgt>Tgt	p.R205C	GIPC1_ENST00000591349.1_Missense_Mutation_p.R108C|GIPC1_ENST00000393028.1_Missense_Mutation_p.R108C|GIPC1_ENST00000586027.1_Missense_Mutation_p.R205C|GIPC1_ENST00000345425.2_Missense_Mutation_p.R205C|GIPC1_ENST00000393029.3_Missense_Mutation_p.R108C	NM_005716.3	NP_005707.1	O14908	GIPC1_HUMAN	GIPC PDZ domain containing family, member 1	205	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				endothelial cell migration (GO:0043542)|G-protein coupled receptor signaling pathway (GO:0007186)|glutamate secretion (GO:0014047)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of cytokinesis (GO:0032467)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|protein targeting (GO:0006605)|regulation of protein stability (GO:0031647)|regulation of synaptic plasticity (GO:0048167)|synaptic transmission (GO:0007268)	brush border (GO:0005903)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)|vesicle membrane (GO:0012506)	actin binding (GO:0003779)|myosin binding (GO:0017022)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			endometrium(1)|lung(4)|upper_aerodigestive_tract(1)	6						GTGAAGGTACGGCCTCGGGGC	0.692											OREG0025316	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R205C	Pancreas(33;78 923 2910 41023 52850)	.											.	GIPC1-226	0			c.C613T						.						41.0	43.0	42.0					19																	14591159		2203	4300	6503	SO:0001583	missense	10755	exon5			AGGTACGGCCTCG	AF089816	CCDS12310.1, CCDS12311.1	19p13.1	2009-09-22	2005-06-28	2005-06-28					1226	protein-coding gene	gene with protein product		605072	"""chromosome 19 open reading frame 3"", ""regulator of G-protein signalling 19 interacting protein 1"""	C19orf3, RGS19IP1		9770488, 9482110	Standard	NM_005716		Approved	TIP-2, Hs.6454, GIPC, SEMCAP, GLUT1CBP, SYNECTIN, NIP	uc002myx.4	O14908		ENST00000393033.4:c.613C>T	19.37:g.14591159G>A	ENSP00000376753:p.Arg205Cys	Somatic	49	0	696	WXS	Illumina GAIIx	Phase_I	312	42	NM_202468	0	0	112	143	31	A8K4I3|A8MZG3|Q9BTC9	Missense_Mutation	SNP	ENST00000393033.4	37	CCDS12310.1	.	.	.	.	.	.	.	.	.	.	G	26.6	4.753772	0.89753	.	.	ENSG00000123159	ENST00000393033;ENST00000345425;ENST00000393029;ENST00000393028;ENST00000351277	T;T;T;T	0.39592	1.07;1.07;1.07;1.07	4.96	4.96	0.65561	PDZ/DHR/GLGF (4);	0.058228	0.64402	D	0.000003	T	0.51295	0.1666	L	0.44542	1.39	0.58432	D	0.999998	D	0.67145	0.996	P	0.56916	0.809	T	0.53294	-0.8459	10	0.59425	D	0.04	-25.5094	15.6737	0.77297	0.0:0.0:1.0:0.0	.	205	O14908	GIPC1_HUMAN	C	205;205;108;108;205	ENSP00000376753:R205C;ENSP00000340698:R205C;ENSP00000376749:R108C;ENSP00000376748:R108C	ENSP00000340698:R205C	R	-	1	0	GIPC1	14452159	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	4.416000	0.59815	2.311000	0.77944	0.561000	0.74099	CGT	.		0.692	GIPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460239.2		
CYP4F8	11283	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	15739164	15739164	+	RNA	SNP	C	C	T			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr19:15739164C>T	ENST00000441682.2	+	0	1229							P98187	CP4F8_HUMAN	cytochrome P450, family 4, subfamily F, polypeptide 8						icosanoid metabolic process (GO:0006690)|prostaglandin metabolic process (GO:0006693)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	alkane 1-monooxygenase activity (GO:0018685)|aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|skin(1)	26						GGAGAGCCTGCGGTTGCATCC	0.617																																					.		.											.	CYP4F8-90	0			.						.						81.0	89.0	86.0					19																	15739164		2203	4300	6503			11283	.			AGCCTGCGGTTGC	AF133298	CCDS74303.1	19p13.12	2013-11-11	2003-01-14		ENSG00000186526	ENSG00000186526		"""Cytochrome P450s"""	2648	protein-coding gene	gene with protein product		611545	"""cytochrome P450, subfamily IVF, polypeptide 8"""			10405341	Standard	NM_007253		Approved		uc002nbi.3	P98187	OTTHUMG00000182386		19.37:g.15739164C>T		Somatic	44	0		WXS	Illumina GAIIx	Phase_I	101	20	.	0	0	0	0	0		RNA	SNP	ENST00000441682.2	37		.	.	.	.	.	.	.	.	.	.	.	11.60	1.687508	0.29962	.	.	ENSG00000186526	ENST00000441682;ENST00000325723;ENST00000443973	.	.	.	3.45	1.1	0.20463	.	0.000000	0.85682	U	0.000000	T	0.65260	0.2674	.	.	.	0.46927	D	0.999252	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.70204	-0.4936	7	0.87932	D	0	.	5.6234	0.17469	0.1926:0.6934:0.0:0.114	.	202;390	B4DU85;P98187	.;CP4F8_HUMAN	W	389;202;239	.	ENSP00000314398:R202W	R	+	1	2	CYP4F8	15600164	1.000000	0.71417	0.921000	0.36526	0.021000	0.10359	1.295000	0.33377	0.653000	0.30826	-0.324000	0.08512	CGG	.		0.617	CYP4F8-201	KNOWN	basic	processed_transcript	processed_transcript		NM_007253	
INSL3	3640	hgsc.bcm.edu	37	19	17932200	17932200	+	Missense_Mutation	SNP	A	A	C	rs570837260		TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr19:17932200A>C	ENST00000317306.7	-	1	132	c.116T>G	c.(115-117)gTa>gGa	p.V39G	INSL3_ENST00000379695.5_Missense_Mutation_p.V39G	NM_005543.3	NP_005534.2	P51460	INSL3_HUMAN	insulin-like 3 (Leydig cell)	39					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cell-cell signaling (GO:0007267)|in utero embryonic development (GO:0001701)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|oocyte maturation (GO:0001556)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cell proliferation (GO:0008284)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|perinuclear region of cytoplasm (GO:0048471)	insulin receptor binding (GO:0005158)|protease binding (GO:0002020)|receptor binding (GO:0005102)			breast(1)|lung(1)	2						TAGCGCGCGTACGAAGTGGTG	0.736													A|||	1	0.000199681	0.0	0.0	5008	,	,		12366	0.0		0.001	False		,,,				2504	0.0				p.V39G		.											.	INSL3-90	0			c.T116G						.						5.0	8.0	7.0					19																	17932200		1902	3657	5559	SO:0001583	missense	3640	exon1			GCGCGTACGAAGT		CCDS12365.1, CCDS58655.1	19p13.2-p12	2013-02-26	2003-05-13			ENSG00000248099		"""Endogenous ligands"""	6086	protein-coding gene	gene with protein product	"""prepro-INSL3"""	146738	"""relaxin-like factor"""	RLNL		8020942	Standard	NM_001265587		Approved	RLF, MGC119818, MGC119819	uc010ebf.2	P51460		ENST00000317306.7:c.116T>G	19.37:g.17932200A>C	ENSP00000321724:p.Val39Gly	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	47	10	NM_005543	0	0	0	0	0	B4DZ72|G3XAG0|Q3KPI5|Q3KPI6|Q6YNB5|Q9UEA2|Q9UPH6	Missense_Mutation	SNP	ENST00000317306.7	37	CCDS12365.1	.	.	.	.	.	.	.	.	.	.	A	17.04	3.285966	0.59867	.	.	ENSG00000248099	ENST00000317306;ENST00000379695	T;T	0.65916	-0.18;-0.18	3.63	3.63	0.41609	Insulin-like (4);	.	.	.	.	T	0.73853	0.3640	M	0.71581	2.175	0.46437	D	0.999041	D;D	0.76494	0.998;0.999	D;D	0.69824	0.943;0.966	T	0.75619	-0.3255	9	0.87932	D	0	.	8.5677	0.33550	1.0:0.0:0.0:0.0	.	39;39	G3XAG0;P51460	.;INSL3_HUMAN	G	39	ENSP00000321724:V39G;ENSP00000369017:V39G	ENSP00000321724:V39G	V	-	2	0	INSL3	17793200	0.048000	0.20356	0.973000	0.42090	0.722000	0.41435	1.062000	0.30555	1.515000	0.48885	0.397000	0.26171	GTA	.		0.736	INSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466836.1	NM_005543	
ZNF675	171392	broad.mit.edu	37	19	23837296	23837296	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr19:23837296C>G	ENST00000359788.4	-	4	607	c.439G>C	c.(439-441)Gat>Cat	p.D147H	ZNF675_ENST00000596211.1_Intron|ZNF675_ENST00000600313.1_Intron|ZNF675_ENST00000601935.1_Intron	NM_138330.2	NP_612203.2	Q8TD23	ZN675_HUMAN	zinc finger protein 675	147					bone resorption (GO:0045453)|cytokine-mediated signaling pathway (GO:0019221)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of interleukin-1-mediated signaling pathway (GO:2000660)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	DNA binding (GO:0003677)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|large_intestine(8)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	27		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				ACATATTTATCACATTGAAAC	0.308																																					p.D147H		.											.	ZNF675-228	0			c.G439C						.						70.0	70.0	70.0					19																	23837296		2202	4299	6501	SO:0001583	missense	171392	exon4			ATTTATCACATTG		CCDS32981.1	19p12	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	30768	protein-coding gene	gene with protein product	"""TRAF6 inhibitory zinc finger"""					11751921	Standard	NM_138330		Approved	TIZ, TBZF	uc002nri.3	Q8TD23		ENST00000359788.4:c.439G>C	19.37:g.23837296C>G	ENSP00000352836:p.Asp147His	Somatic	74	0		WXS	Illumina GAIIx	Phase_I	78	3	NM_138330	0	0	2	2	0	Q8N211	Missense_Mutation	SNP	ENST00000359788.4	37	CCDS32981.1	.	.	.	.	.	.	.	.	.	.	.	6.231	0.410809	0.11812	.	.	ENSG00000197372	ENST00000359788	T	0.30182	1.54	0.916	-0.317	0.12736	.	.	.	.	.	T	0.30634	0.0771	M	0.76328	2.33	0.19575	N	0.999966	B	0.29531	0.247	B	0.35470	0.203	T	0.44065	-0.9352	9	0.56958	D	0.05	.	1.4505	0.02374	0.3489:0.35:0.0:0.3011	.	147	Q8TD23	ZN675_HUMAN	H	147	ENSP00000352836:D147H	ENSP00000352836:D147H	D	-	1	0	ZNF675	23629136	0.000000	0.05858	0.315000	0.25238	0.312000	0.27988	-2.142000	0.01298	0.300000	0.22699	0.305000	0.20034	GAT	.		0.308	ZNF675-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466433.1	NM_138330	
NFKBID	84807	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	36380791	36380791	+	Splice_Site	DEL	C	C	-			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr19:36380791delC	ENST00000396901.1	-	11	1462		c.e11+1		NFKBID_ENST00000606253.1_Splice_Site|NFKBID_ENST00000352614.2_Splice_Site|NFKBID_ENST00000340950.2_Splice_Site	NM_139239.1	NP_640332.1	Q8NI38	IKBD_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, delta						inflammatory response (GO:0006954)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of T cell differentiation in thymus (GO:0033085)|positive regulation of thymocyte apoptotic process (GO:0070245)	nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(6)|ovary(1)|urinary_tract(1)	14						TGCTTACTTACCCCCTCAGGG	0.662																																					.		.											.	NFKBID-90	0			c.888+1G>-						.						36.0	42.0	40.0					19																	36380791		1996	4124	6120	SO:0001630	splice_region_variant	84807	exon12			TACTTACCCCCTC	AF385434	CCDS42552.1	19q13.12	2013-01-10				ENSG00000167604		"""Ankyrin repeat domain containing"""	15671	protein-coding gene	gene with protein product						12477932	Standard	NM_139239		Approved	TA-NFKBH, IkappaBNS	uc002oci.1	Q8NI38		ENST00000396901.1:c.888+1G>-	19.37:g.36380791delC		Somatic	46	0		WXS	Illumina GAIIx	Phase_I	127	54	NM_139239	0	0	0	0	0	Q8NI39|Q9BRG9	Splice_Site	DEL	ENST00000396901.1	37	CCDS42552.1																																																																																			.		0.662	NFKBID-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000452927.3	NM_032721	Intron
FBXO17	115290	hgsc.bcm.edu	37	19	39440918	39440918	+	Silent	SNP	T	T	C	rs2304117	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr19:39440918T>C	ENST00000292852.4	-	2	383	c.42A>G	c.(40-42)ccA>ccG	p.P14P	SARS2_ENST00000448145.2_5'Flank|CTC-360G5.8_ENST00000599996.1_5'Flank|FBXO17_ENST00000595329.1_Silent_p.P14P	NM_024907.5	NP_079183.4	Q96EF6	FBX17_HUMAN	F-box protein 17	14						SCF ubiquitin ligase complex (GO:0019005)	glycoprotein binding (GO:0001948)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)	7	all_cancers(60;8.37e-07)|all_lung(34;3.71e-07)|Lung NSC(34;4.17e-07)|all_epithelial(25;1.13e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			GGGCCAGGGATGGGTCCGCCG	0.731													c|||	2378	0.47484	0.3336	0.3746	5008	,	,		11867	0.6796		0.4195	False		,,,				2504	0.5828				p.P23P		.											.	FBXO17-226	0			c.A69G						.		,	1052,2556		213,626,965	3.0	4.0	3.0		42,69	0.5	0.0	19	dbSNP_100	3	2265,4819		496,1273,1773	no	coding-synonymous,coding-synonymous	FBXO17	NM_024907.5,NM_148169.1	,	709,1899,2738	CC,CT,TT		31.9735,29.1574,31.0232	,	14/279,23/288	39440918	3317,7375	1804	3542	5346	SO:0001819	synonymous_variant	115290	exon2			CAGGGATGGGTCC	AF386743	CCDS12526.1	19q13.2	2010-07-02	2004-06-15	2004-06-16		ENSG00000269190		"""F-boxes /  ""other"""""	18754	protein-coding gene	gene with protein product	"""F-box only protein 26"""	609094	"""F-box only protein 17"""	FBXO26			Standard	NM_148169		Approved	FBG4, FLJ25205, MGC9379, FLJ11798, Fbx17		Q96EF6		ENST00000292852.4:c.42A>G	19.37:g.39440918T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	19	10	NM_148169	0	0	2	2	0	Q96LQ4	Silent	SNP	ENST00000292852.4	37	CCDS12526.1																																																																																			T|0.545;C|0.455		0.731	FBXO17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463273.1	NM_024907	
ERCC2	2068	hgsc.bcm.edu	37	19	45867259	45867259	+	Missense_Mutation	SNP	C	C	T	rs1799793	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr19:45867259C>T	ENST00000391945.4	-	10	1011	c.934G>A	c.(934-936)Gac>Aac	p.D312N	ERCC2_ENST00000391940.4_Missense_Mutation_p.D288N|ERCC2_ENST00000391944.3_Missense_Mutation_p.D234N|ERCC2_ENST00000485403.2_Missense_Mutation_p.D288N|ERCC2_ENST00000221481.6_3'UTR	NM_000400.3	NP_000391.1	P18074	ERCC2_HUMAN	excision repair cross-complementation group 2	312			D -> N (in dbSNP:rs1799793). {ECO:0000269|PubMed:11245433, ECO:0000269|PubMed:11470747, ECO:0000269|PubMed:11709541, ECO:0000269|Ref.3}.		7-methylguanosine mRNA capping (GO:0006370)|aging (GO:0007568)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|central nervous system myelin formation (GO:0032289)|chromosome segregation (GO:0007059)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)|embryonic cleavage (GO:0040016)|erythrocyte maturation (GO:0043249)|extracellular matrix organization (GO:0030198)|gene expression (GO:0010467)|hair cell differentiation (GO:0035315)|hair follicle maturation (GO:0048820)|hematopoietic stem cell differentiation (GO:0060218)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision (GO:0033683)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral transcription (GO:0050434)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to hypoxia (GO:0001666)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|spinal cord development (GO:0021510)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)|viral process (GO:0016032)	cytoplasm (GO:0005737)|holo TFIIH complex (GO:0005675)|MMXD complex (GO:0071817)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	4 iron, 4 sulfur cluster binding (GO:0051539)|5'-3' DNA helicase activity (GO:0043139)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			large_intestine(4)|lung(2)|ovary(1)|pancreas(1)|stomach(1)	9		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		AGCACTTCGTCGGGCAGCACG	0.746			"""Mis, N, F, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum				C|||	974	0.194489	0.0734	0.1988	5008	,	,		10423	0.0496		0.3588	False		,,,				2504	0.3354				p.D312N		.	yes	Rec		Xeroderma pigmentosum (D)	19	19q13.2-q13.3	2068	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 (xeroderma pigmentosum D)"""		E	.	ERCC2-848	0			c.G934A	GRCh37	CM015299	ERCC2	M	rs1799793	.	C	ASN/ASP,ASN/ASP	387,3577		30,327,1625	5.0	8.0	7.0		934,862	5.2	0.5	19	dbSNP_89	7	2507,5397		444,1619,1889	no	missense,missense	ERCC2	NM_000400.3,NM_001130867.1	23,23	474,1946,3514	TT,TC,CC		31.7181,9.7629,24.3849	benign,benign	312/761,288/406	45867259	2894,8974	1982	3952	5934	SO:0001583	missense	2068	exon10	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	CTTCGTCGGGCAG		CCDS33049.1, CCDS46112.1	19q13.3	2014-09-17	2014-03-07		ENSG00000104884	ENSG00000104884	3.6.4.12	"""General transcription factor IIH complex subunits"""	3434	protein-coding gene	gene with protein product	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 protein"", ""TFIIH basal transcription factor complex helicase XPB subunit"""	126340	"""xeroderma pigmentosum complementary group D"", ""excision repair cross-complementing rodent repair deficiency, complementation group 2"""	XPD		8413672, 2184031	Standard	NM_000400		Approved	MAG, EM9, MGC102762, MGC126218, MGC126219, TFIIH	uc002pbj.2	P18074	OTTHUMG00000048190	ENST00000391945.4:c.934G>A	19.37:g.45867259C>T	ENSP00000375809:p.Asp312Asn	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_000400	0	0	5	19	14	Q2TB78|Q2YDY2|Q7KZU6|Q8N721	Missense_Mutation	SNP	ENST00000391945.4	37	CCDS33049.1	423	0.1936813186813187	34	0.06910569105691057	70	0.19337016574585636	38	0.06643356643356643	281	0.370712401055409	C	20.0	3.930510	0.73327	0.097629	0.317181	ENSG00000104884	ENST00000391941;ENST00000391942;ENST00000391945;ENST00000391944;ENST00000391940	T;T;T	0.64438	-0.1;-0.1;-0.1	5.15	5.15	0.70609	Domain of unknown function DUF1227 (1);	0.000000	0.85682	D	0.000000	T	0.00012	0.0000	L	0.46947	1.48	0.09310	P	1.0	B;P;B	0.34639	0.065;0.461;0.053	B;B;B	0.35353	0.059;0.201;0.051	T	0.28267	-1.0049	9	0.33940	T	0.23	-30.0006	16.1268	0.81402	0.0:1.0:0.0:0.0	rs1799793;rs3916814;rs58989209;rs1799793	234;288;312	E7EVE9;Q7KZU6;P18074	.;.;ERCC2_HUMAN	N	262;288;312;234;288	ENSP00000375809:D312N;ENSP00000375808:D234N;ENSP00000375804:D288N	ENSP00000375804:D288N	D	-	1	0	ERCC2	50559099	1.000000	0.71417	0.523000	0.27875	0.865000	0.49528	7.192000	0.77771	2.388000	0.81334	0.561000	0.74099	GAC	C|0.804;T|0.196		0.746	ERCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109626.2	NM_000400	
IRF2BP1	26145	hgsc.bcm.edu	37	19	46387941	46387941	+	Silent	SNP	G	G	A	rs200198801	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr19:46387941G>A	ENST00000302165.3	-	1	1435	c.1092C>T	c.(1090-1092)ggC>ggT	p.G364G		NM_015649.1	NP_056464.1	Q8IU81	I2BP1_HUMAN	interferon regulatory factor 2 binding protein 1	364					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)			cervix(1)|kidney(1)|lung(2)	4		all_neural(266;0.113)|Ovarian(192;0.127)		OV - Ovarian serous cystadenocarcinoma(262;0.00442)|GBM - Glioblastoma multiforme(486;0.0402)|Epithelial(262;0.231)		GCGGGGGTGGGCCACAGAGAG	0.756													G|||	16	0.00319489	0.0	0.0043	5008	,	,		10874	0.001		0.0109	False		,,,				2504	0.001				p.G364G		.											.	IRF2BP1-90	0			c.C1092T						.	G		7,3597		0,7,1795	6.0	9.0	8.0		1092	-1.9	0.5	19		8	117,7379		1,115,3632	no	coding-synonymous	IRF2BP1	NM_015649.1		1,122,5427	AA,AG,GG		1.5608,0.1942,1.1171		364/585	46387941	124,10976	1802	3748	5550	SO:0001819	synonymous_variant	26145	exon1			GGGTGGGCCACAG	AY278022	CCDS12678.1	19q13.32	2008-02-05							21728	protein-coding gene	gene with protein product		615331				12799427	Standard	NM_015649		Approved	DKFZP434M154, IRF-2BP1	uc002pds.1	Q8IU81		ENST00000302165.3:c.1092C>T	19.37:g.46387941G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	10	NM_015649	0	0	0	113	113	Q53EL7|Q6DC95|Q9BRZ9|Q9Y4P4	Silent	SNP	ENST00000302165.3	37	CCDS12678.1																																																																																			G|0.994;A|0.006		0.756	IRF2BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461683.1	NM_015649	
GLTSCR2	29997	hgsc.bcm.edu	37	19	48258717	48258717	+	Missense_Mutation	SNP	A	A	G	rs1804994	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr19:48258717A>G	ENST00000246802.5	+	9	1204	c.1166A>G	c.(1165-1167)cAg>cGg	p.Q389R	CTD-2571L23.6_ENST00000602048.1_RNA|GLTSCR2_ENST00000598681.1_3'UTR|SNORD23_ENST00000408876.1_RNA	NM_015710.4	NP_056525.2	Q9NZM5	GSCR2_HUMAN	glioma tumor suppressor candidate region gene 2	389			Q -> R (in dbSNP:rs1804994). {ECO:0000269|PubMed:10708517, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:17974005, ECO:0000269|Ref.4}.			intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)	15		all_cancers(25;1.47e-06)|all_lung(116;6.89e-05)|all_epithelial(76;0.000108)|Lung NSC(112;0.000117)|all_neural(266;0.0332)|Ovarian(192;0.086)		all cancers(93;0.000301)|OV - Ovarian serous cystadenocarcinoma(262;0.00031)|Epithelial(262;0.0149)|GBM - Glioblastoma multiforme(486;0.0278)		gcgcggcggcagaggcggcgg	0.761													G|||	3570	0.712859	0.857	0.6888	5008	,	,		6528	0.5546		0.6799	False		,,,				2504	0.7321				p.Q389R	Colon(58;613 1041 9473 10089 15241)	.											.	GLTSCR2-514	0			c.A1166G						.						1.0	2.0	1.0					19																	48258717		823	2228	3051	SO:0001583	missense	29997	exon9			GGCGGCAGAGGCG	AF182076	CCDS12705.1	19q13.3	2014-01-20				ENSG00000105373			4333	protein-coding gene	gene with protein product		605691				10708517, 16971513, 17657248	Standard	NM_015710		Approved	PICT-1	uc002phm.2	Q9NZM5		ENST00000246802.5:c.1166A>G	19.37:g.48258717A>G	ENSP00000246802:p.Gln389Arg	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_015710	0	0	0	69	69	Q9BTC6|Q9HAX6|Q9NPP1|Q9NPR4|Q9UFI2	Missense_Mutation	SNP	ENST00000246802.5	37	CCDS12705.1	1513	0.6927655677655677	424	0.8617886178861789	252	0.6961325966850829	316	0.5524475524475524	521	0.6873350923482849	G	0.092	-1.166361	0.01660	.	.	ENSG00000105373	ENST00000246802;ENST00000325566	T	0.39229	1.09	3.93	2.86	0.33363	.	0.430291	0.24226	N	0.040398	T	0.00012	0.0000	N	0.00289	-1.7	0.54753	P	1.2000000000012001E-5	B	0.02656	0.0	B	0.06405	0.002	T	0.35450	-0.9788	9	0.05620	T	0.96	-11.9316	6.8245	0.23874	0.2235:0.0:0.7765:0.0	rs1804994;rs3211363;rs16949619;rs17343460;rs17856180;rs17856325;rs57240470	389	Q9NZM5	GSCR2_HUMAN	R	389;383	ENSP00000246802:Q389R	ENSP00000246802:Q389R	Q	+	2	0	GLTSCR2	52950529	0.025000	0.19082	0.815000	0.32552	0.328000	0.28507	0.153000	0.16323	0.415000	0.25817	-0.231000	0.12243	CAG	A|0.308;G|0.692		0.761	GLTSCR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464870.1	NM_015710	
VN1R2	317701	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	53762590	53762590	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr19:53762590T>G	ENST00000341702.3	+	1	1046	c.962T>G	c.(961-963)gTg>gGg	p.V321G	VN1R2_ENST00000598458.1_Splice_Site	NM_173856.2	NP_776255.2	Q8NFZ6	VN1R2_HUMAN	vomeronasal 1 receptor 2	321					response to pheromone (GO:0019236)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	pheromone receptor activity (GO:0016503)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	31				GBM - Glioblastoma multiforme(134;0.00301)		CTTGCATTGGTGAGCACCTTT	0.458																																					p.V321G		.											.	VN1R2-90	0			c.T962G						.						249.0	216.0	227.0					19																	53762590		2203	4300	6503	SO:0001583	missense	317701	exon1			CATTGGTGAGCAC	AF370359	CCDS12862.1	19q13.42	2012-08-22			ENSG00000196131	ENSG00000196131		"""Vomeronasal receptors / Type 1"", ""GPCR / Unclassified : Vomeronasal receptors, type 1"""	19872	protein-coding gene	gene with protein product						12123587	Standard	NM_173856		Approved	V1RL2	uc002qbi.2	Q8NFZ6		ENST00000341702.3:c.962T>G	19.37:g.53762590T>G	ENSP00000351244:p.Val321Gly	Somatic	229	1		WXS	Illumina GAIIx	Phase_I	399	55	NM_173856	0	0	0	0	0	A1L411|Q8TDU4	Missense_Mutation	SNP	ENST00000341702.3	37	CCDS12862.1	.	.	.	.	.	.	.	.	.	.	T	15.05	2.717866	0.48622	.	.	ENSG00000196131	ENST00000341702	T	0.46451	0.87	2.93	1.89	0.25635	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.67869	0.2939	M	0.92077	3.27	0.20307	N	0.999914	D	0.76494	0.999	D	0.81914	0.995	T	0.55528	-0.8127	9	0.72032	D	0.01	.	7.7473	0.28877	0.0:0.0:0.2135:0.7865	.	321	Q8NFZ6	VN1R2_HUMAN	G	321	ENSP00000351244:V321G	ENSP00000351244:V321G	V	+	2	0	VN1R2	58454402	0.975000	0.34042	0.027000	0.17364	0.261000	0.26267	1.384000	0.34396	0.532000	0.28657	0.481000	0.45027	GTG	.		0.458	VN1R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464285.1	NM_173856	
MYT1L	23040	broad.mit.edu	37	2	1946857	1946859	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr2:1946857_1946859delCTC	ENST00000399161.2	-	9	1147_1149	c.400_402delGAG	c.(400-402)gagdel	p.E134del	MYT1L_ENST00000428368.2_In_Frame_Del_p.E134del	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	134	Asp/Glu-rich.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		cctcctcgatctcctcctcctcc	0.576																																					p.134_134del		.											.	MYT1L-95	0			c.400_402del						.			33,3907		4,25,1941						-0.0	0.0			94	58,7582		7,44,3769	no	coding	MYT1L	NM_015025.2		11,69,5710	A1A1,A1R,RR		0.7592,0.8376,0.7858				91,11489				SO:0001651	inframe_deletion	23040	exon9			CTCGATCTCCTCC	AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.400_402delGAG	2.37:g.1946866_1946868delCTC	ENSP00000382114:p.Glu134del	Somatic	129	0		WXS	Illumina GAIIx	Phase_I	223	8	NM_015025	0	0	0	0	0	A7E2C7|B2RP54|Q6IQ17|Q9UPP6	In_Frame_Del	DEL	ENST00000399161.2	37																																																																																				.		0.576	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000322493.1	NM_015025	
ASAP2	8853	hgsc.bcm.edu	37	2	9533755	9533755	+	Missense_Mutation	SNP	C	C	T	rs370099908		TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr2:9533755C>T	ENST00000281419.3	+	24	3003	c.2663C>T	c.(2662-2664)cCg>cTg	p.P888L	ASAP2_ENST00000491413.1_3'UTR|ASAP2_ENST00000315273.4_Missense_Mutation_p.P843L	NM_003887.2	NP_003878.1	O43150	ASAP2_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 2	888	Pro-rich.				positive regulation of catalytic activity (GO:0043085)|regulation of ARF GTPase activity (GO:0032312)	Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|enzyme activator activity (GO:0008047)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	36						AGCCGCCTCCCGCAGAAGAAG	0.677																																					p.P888L		.											.	ASAP2-90	0			c.C2663T						.	C	LEU/PRO,LEU/PRO	0,4332		0,0,2166	7.0	8.0	8.0		2528,2663	4.3	1.0	2		8	2,8440		0,2,4219	no	missense,missense	ASAP2	NM_001135191.1,NM_003887.2	98,98	0,2,6385	TT,TC,CC		0.0237,0.0,0.0157	benign,benign	843/962,888/1007	9533755	2,12772	2166	4221	6387	SO:0001583	missense	8853	exon24			GCCTCCCGCAGAA	AB007860	CCDS1661.1, CCDS46224.1	2p24	2013-01-10	2008-09-22	2008-09-22	ENSG00000151693	ENSG00000151693		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2721	protein-coding gene	gene with protein product	"""centaurin, beta 3"""	603817	"""development and differentiation enhancing factor 2"""	DDEF2		10022920, 9455477	Standard	NM_003887		Approved	KIAA0400, PAP, SHAG1, CENTB3	uc002qzh.2	O43150	OTTHUMG00000117485	ENST00000281419.3:c.2663C>T	2.37:g.9533755C>T	ENSP00000281419:p.Pro888Leu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	33	16	NM_003887	0	0	6	10	4	D6W4Y8	Missense_Mutation	SNP	ENST00000281419.3	37	CCDS1661.1	.	.	.	.	.	.	.	.	.	.	C	11.19	1.565700	0.27915	0.0	2.37E-4	ENSG00000151693	ENST00000281419;ENST00000315273	T;T	0.58358	0.34;2.3	5.39	4.32	0.51571	Src homology-3 domain (1);	1.179820	0.05754	N	0.603755	T	0.39384	0.1076	N	0.16743	0.435	0.26003	N	0.982095	B;B	0.06786	0.0;0.001	B;B	0.01281	0.0;0.0	T	0.07947	-1.0746	10	0.23302	T	0.38	.	11.5217	0.50555	0.0:0.8448:0.0:0.1552	.	843;888	O43150-2;O43150	.;ASAP2_HUMAN	L	888;843	ENSP00000281419:P888L;ENSP00000316404:P843L	ENSP00000281419:P888L	P	+	2	0	ASAP2	9451206	0.769000	0.28531	0.967000	0.41034	0.966000	0.64601	2.275000	0.43399	2.528000	0.85240	0.563000	0.77884	CCG	.		0.677	ASAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000237522.1	NM_003887	
TMEM214	54867	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	27257050	27257050	+	Silent	SNP	G	G	A			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr2:27257050G>A	ENST00000238788.9	+	2	329	c.267G>A	c.(265-267)aaG>aaA	p.K89K	TMEM214_ENST00000404032.3_Silent_p.K89K	NM_017727.4	NP_060197.4	Q6NUQ4	TM214_HUMAN	transmembrane protein 214	89					apoptotic process (GO:0006915)	cytoplasmic microtubule (GO:0005881)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				kidney(1)|large_intestine(5)|lung(9)|prostate(1)|skin(2)	18						CAGGGAACAAGAAGCAGCCAA	0.547																																					p.K89K		.											.	TMEM214-115	0			c.G267A						.						64.0	67.0	66.0					2																	27257050		1987	4176	6163	SO:0001819	synonymous_variant	54867	exon2			GAACAAGAAGCAG		CCDS42664.1, CCDS46242.1	2p23.3	2013-06-19			ENSG00000119777	ENSG00000119777			25983	protein-coding gene	gene with protein product						23661706	Standard	NM_001083590		Approved	FLJ20254	uc002ria.4	Q6NUQ4	OTTHUMG00000151999	ENST00000238788.9:c.267G>A	2.37:g.27257050G>A		Somatic	177	0		WXS	Illumina GAIIx	Phase_I	226	43	NM_017727	0	0	29	37	8	A6NNF2|B3KUI9|B5MCD8|D6W547|Q53SW1|Q69YH4|Q8NC45|Q8WZ37|Q9NXH2	Silent	SNP	ENST00000238788.9	37	CCDS42664.1																																																																																			.		0.547	TMEM214-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324748.1	NM_017727	
PLB1	151056	hgsc.bcm.edu;bcgsc.ca	37	2	28836923	28836923	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr2:28836923G>T	ENST00000327757.5	+	44	3199	c.3155G>T	c.(3154-3156)cGg>cTg	p.R1052L	PLB1_ENST00000422425.2_Missense_Mutation_p.R1041L|PLB1_ENST00000541605.1_Missense_Mutation_p.R17L	NM_153021.4	NP_694566.4	Q6P1J6	PLB1_HUMAN	phospholipase B1	1052	4 X 308-326 AA approximate repeats.				glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phospholipid metabolic process (GO:0006644)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	lysophospholipase activity (GO:0004622)|phospholipase A2 activity (GO:0004623)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(31)|ovary(6)|prostate(1)|skin(7)|stomach(2)	69	Acute lymphoblastic leukemia(172;0.155)					AGAACCCCTCGGAATAGTAAC	0.463																																					p.R1052L		.											.	PLB1-141	0			c.G3155T						.						134.0	129.0	131.0					2																	28836923		2203	4300	6503	SO:0001583	missense	151056	exon44			CCCCTCGGAATAG		CCDS33168.1, CCDS54340.1	2p23.3	2014-03-14			ENSG00000163803	ENSG00000163803	3.1.1.4, 3.1.1.5		30041	protein-coding gene	gene with protein product		610179				12150957	Standard	NM_153021		Approved	PLB, FLJ30866	uc002rmb.2	Q6P1J6	OTTHUMG00000152014	ENST00000327757.5:c.3155G>T	2.37:g.28836923G>T	ENSP00000330442:p.Arg1052Leu	Somatic	50	0		WXS	Illumina GAIIx	Phase_I	65	4	NM_153021	0	0	1	1	0	A8KAX2|Q53S03|Q8IUP7|Q96DP9	Missense_Mutation	SNP	ENST00000327757.5	37	CCDS33168.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.541|9.541	1.113355|1.113355	0.20795|0.20795	.|.	.|.	ENSG00000163803|ENSG00000163803	ENST00000404858|ENST00000327757;ENST00000422425;ENST00000541605	.|T;T;T	.|0.41400	.|1.0;1.0;2.64	5.69|5.69	-1.08|-1.08	0.09936|0.09936	.|.	.|1.007360	.|0.07974	.|N	.|0.984491	.|T	.|0.46014	.|0.1371	L|L	0.56340|0.56340	1.77|1.77	0.09310|0.09310	N|N	1|1	.|P;P	.|0.49783	.|0.928;0.881	.|P;B	.|0.50570	.|0.644;0.341	.|T	.|0.46119	.|-0.9214	.|10	.|0.51188	.|T	.|0.08	-5.2944|-5.2944	9.2695|9.2695	0.37661|0.37661	0.5201:0.0:0.4799:0.0|0.5201:0.0:0.4799:0.0	.|.	.|1041;1052	.|Q6P1J6-3;Q6P1J6	.|.;PLB1_HUMAN	X|L	1040|1052;1041;17	.|ENSP00000330442:R1052L;ENSP00000416440:R1041L;ENSP00000437426:R17L	.|ENSP00000330442:R1052L	G|R	+|+	1|2	0|0	PLB1|PLB1	28690427|28690427	0.028000|0.028000	0.19301|0.19301	0.020000|0.020000	0.16555|0.16555	0.565000|0.565000	0.35776|0.35776	-0.210000|-0.210000	0.09345|0.09345	-0.181000|-0.181000	0.10619|0.10619	0.655000|0.655000	0.94253|0.94253	GGA|CGG	.		0.463	PLB1-012	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353348.2		
TMEM247	388946	bcgsc.ca	37	2	46707808	46707808	+	Missense_Mutation	SNP	C	C	G	rs70940616|rs74318890		TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr2:46707808C>G	ENST00000434431.1	+	2	382	c.382C>G	c.(382-384)Cag>Gag	p.Q128E		NM_001145051.2	NP_001138523.1	A6NEH6	TM247_HUMAN	transmembrane protein 247	128						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)											GAACCAGCGGCAGCGGCAGCA	0.662																																					p.Q128E		.											.	.	0			c.C382G						.						30.0	40.0	37.0					2																	46707808		692	1591	2283	SO:0001583	missense	388946	exon2			CAGCGGCAGCGGC		CCDS56117.1	2p21	2012-04-11			ENSG00000187600	ENSG00000187600			42967	protein-coding gene	gene with protein product							Standard	NM_001145051		Approved		uc010yod.3	A6NEH6	OTTHUMG00000153137	ENST00000434431.1:c.382C>G	2.37:g.46707808C>G	ENSP00000388684:p.Gln128Glu	Somatic	159	2		WXS	Illumina GAIIx	Phase_I	500	39	NM_001145051	0	0	0	0	0		Missense_Mutation	SNP	ENST00000434431.1	37	CCDS56117.1	.	.	.	.	.	.	.	.	.	.	C	17.67	3.447093	0.63178	.	.	ENSG00000187600	ENST00000434431	.	.	.	4.76	4.76	0.60689	.	0.000000	0.39475	N	0.001353	T	0.65606	0.2707	L	0.34521	1.04	.	.	.	D	0.56035	0.974	D	0.70487	0.969	T	0.71735	-0.4503	8	0.54805	T	0.06	-28.7409	14.7885	0.69821	0.0:1.0:0.0:0.0	.	128	A6NEH6	YB028_HUMAN	E	128	.	ENSP00000388684:Q128E	Q	+	1	0	AC018682.6	46561312	1.000000	0.71417	1.000000	0.80357	0.569000	0.35902	3.910000	0.56371	2.484000	0.83849	0.563000	0.77884	CAG	G|1.000;|0.000		0.662	TMEM247-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329726.1	NM_001145051	
ASPRV1	151516	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	70188127	70188127	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr2:70188127C>T	ENST00000320256.4	-	1	1270	c.694G>A	c.(694-696)Gat>Aat	p.D232N	PCBP1-AS1_ENST00000596259.1_RNA|PCBP1-AS1_ENST00000418564.1_RNA|PCBP1-AS1_ENST00000419542.1_RNA|PCBP1-AS1_ENST00000413436.1_RNA|PCBP1-AS1_ENST00000435880.2_RNA|PCBP1-AS1_ENST00000457076.1_RNA	NM_152792.2	NP_690005.2			aspartic peptidase, retroviral-like 1									p.D232N(2)		endometrium(3)|large_intestine(4)|lung(6)|ovary(1)	14						GTGTCCAGATCGCCATCAGTG	0.567																																					p.D232N		.											.	ASPRV1-69	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G694A						.						87.0	83.0	84.0					2																	70188127		2203	4300	6503	SO:0001583	missense	151516	exon1			CCAGATCGCCATC	AK055994	CCDS1897.1	2p13.3	2008-02-20			ENSG00000244617	ENSG00000244617			26321	protein-coding gene	gene with protein product	"""Skin ASpartic Protease"""	611765				16098038, 16565508	Standard	NM_152792		Approved	Taps, SASPase, FLJ25084	uc002sfz.4	Q53RT3	OTTHUMG00000129647	ENST00000320256.4:c.694G>A	2.37:g.70188127C>T	ENSP00000315383:p.Asp232Asn	Somatic	176	1		WXS	Illumina GAIIx	Phase_I	256	32	NM_152792	0	0	0	1	1		Missense_Mutation	SNP	ENST00000320256.4	37	CCDS1897.1	.	.	.	.	.	.	.	.	.	.	C	14.17	2.455312	0.43634	.	.	ENSG00000244617	ENST00000320256	T	0.44881	0.91	5.17	5.17	0.71159	Peptidase aspartic (1);Peptidase A2A, retrovirus, catalytic (1);Peptidase aspartic, eukaryotic predicted (1);	0.256890	0.25472	N	0.030430	T	0.41419	0.1158	N	0.08118	0	0.19300	N	0.999971	D	0.64830	0.994	P	0.61940	0.896	T	0.38929	-0.9638	10	0.62326	D	0.03	-13.3014	14.0399	0.64669	0.0:1.0:0.0:0.0	.	232	Q53RT3	APRV1_HUMAN	N	232	ENSP00000315383:D232N	ENSP00000315383:D232N	D	-	1	0	ASPRV1	70041631	0.573000	0.26676	0.082000	0.20525	0.316000	0.28119	3.856000	0.55964	2.676000	0.91093	0.655000	0.94253	GAT	.		0.567	ASPRV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334161.1	NM_152792	
DNAH6	1768	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	84848429	84848429	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr2:84848429T>A	ENST00000237449.6	+	24	3915	c.3907T>A	c.(3907-3909)Tat>Aat	p.Y1303N	DNAH6_ENST00000398278.2_Missense_Mutation_p.Y1303N|DNAH6_ENST00000389394.3_Missense_Mutation_p.Y1303N			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	1303	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						CATCGCTGACTATCAGGGGAA	0.502																																					p.Y1303N		.											.	DNAH6-69	0			c.T3907A						.						61.0	55.0	57.0					2																	84848429		692	1591	2283	SO:0001583	missense	1768	exon25			GCTGACTATCAGG	U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.3907T>A	2.37:g.84848429T>A	ENSP00000237449:p.Tyr1303Asn	Somatic	191	0		WXS	Illumina GAIIx	Phase_I	261	17	NM_001370	0	0	0	0	0	A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Missense_Mutation	SNP	ENST00000237449.6	37	CCDS46348.1	.	.	.	.	.	.	.	.	.	.	T	23.6	4.431092	0.83776	.	.	ENSG00000115423	ENST00000389394;ENST00000398278;ENST00000237449	T;T;T	0.64085	-0.08;-0.08;-0.08	5.02	5.02	0.67125	Dynein heavy chain, domain-2 (1);	.	.	.	.	D	0.84520	0.5490	H	0.95294	3.65	0.46981	D	0.999273	D	0.89917	1.0	D	0.87578	0.998	D	0.89077	0.3473	9	0.87932	D	0	.	13.7203	0.62723	0.0:0.0:0.0:1.0	.	1303	Q9C0G6	DYH6_HUMAN	N	1303	ENSP00000374045:Y1303N;ENSP00000381326:Y1303N;ENSP00000237449:Y1303N	ENSP00000237449:Y1303N	Y	+	1	0	DNAH6	84701940	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.668000	0.74457	1.884000	0.54569	0.460000	0.39030	TAT	.		0.502	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328537.2	NM_001370	
DPP10	57628	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	116447467	116447467	+	Silent	SNP	C	C	T	rs151071213	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr2:116447467C>T	ENST00000410059.1	+	7	1026	c.546C>T	c.(544-546)taC>taT	p.Y182Y	DPP10_ENST00000409163.1_Silent_p.Y132Y|DPP10_ENST00000488208.1_3'UTR|DPP10_ENST00000310323.8_Silent_p.Y175Y|DPP10_ENST00000393147.2_Silent_p.Y186Y	NM_001178037.1|NM_020868.3	NP_001171508.1|NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl-peptidase 10 (non-functional)	182						integral component of membrane (GO:0016021)|membrane (GO:0016020)	serine-type peptidase activity (GO:0008236)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(24)|liver(2)|lung(48)|ovary(6)|prostate(1)|skin(5)|soft_tissue(1)	101						TCTTGCAGTACGCGGCCTGGG	0.443													C|||	2	0.000399361	0.0015	0.0	5008	,	,		13709	0.0		0.0	False		,,,				2504	0.0				p.Y186Y		.											.	DPP10-142	0			c.C558T						.	C	,,,,	7,4399	11.4+/-27.6	0,7,2196	79.0	87.0	84.0		525,558,396,534,546	-2.9	1.0	2	dbSNP_134	84	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	DPP10	NM_001004360.3,NM_001178034.1,NM_001178036.1,NM_001178037.1,NM_020868.3	,,,,	0,7,6496	TT,TC,CC		0.0,0.1589,0.0538	,,,,	175/790,186/801,132/747,178/793,182/797	116447467	7,12999	2203	4300	6503	SO:0001819	synonymous_variant	57628	exon7			GCAGTACGCGGCC	AY172661	CCDS33278.1, CCDS46400.1, CCDS54388.1, CCDS54389.1	2q14.1	2010-05-04	2010-05-04		ENSG00000175497	ENSG00000175497			20823	protein-coding gene	gene with protein product		608209	"""dipeptidylpeptidase 10"", ""dipeptidyl-peptidase 10"""			10819331, 12662155	Standard	NM_020868		Approved	DPRP3	uc002tle.3	Q8N608	OTTHUMG00000153294	ENST00000410059.1:c.546C>T	2.37:g.116447467C>T		Somatic	53	0		WXS	Illumina GAIIx	Phase_I	71	15	NM_001178034	0	0	12	20	8	A8K1Q2|J3KPP2|J3KQ46|Q0GLB8|Q53QT3|Q53S86|Q53SL8|Q53SS4|Q6TTV4|Q86YR9|Q9P236	Silent	SNP	ENST00000410059.1	37	CCDS46400.1																																																																																			C|0.999;T|0.001		0.443	DPP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330580.4	NM_020868	
LCT	3938	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	136590717	136590717	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr2:136590717C>G	ENST00000264162.2	-	2	694	c.684G>C	c.(682-684)gaG>gaC	p.E228D		NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	228	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)	p.E228D(1)		breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	CTAGCAGGAGCTCCGGGATAT	0.488																																					p.E228D		.											.	LCT-101	1	Substitution - Missense(1)	lung(1)	c.G684C						.						148.0	160.0	156.0					2																	136590717		2203	4300	6503	SO:0001583	missense	3938	exon2			CAGGAGCTCCGGG	X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.684G>C	2.37:g.136590717C>G	ENSP00000264162:p.Glu228Asp	Somatic	41	0		WXS	Illumina GAIIx	Phase_I	46	7	NM_002299	0	0	0	0	0	Q4ZG58	Missense_Mutation	SNP	ENST00000264162.2	37	CCDS2178.1	.	.	.	.	.	.	.	.	.	.	C	10.02	1.236159	0.22626	.	.	ENSG00000115850	ENST00000264162	T	0.29397	1.57	5.57	2.79	0.32731	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.535983	0.20353	N	0.094010	T	0.23451	0.0567	L	0.40543	1.245	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.18116	-1.0347	10	0.52906	T	0.07	-14.2521	8.4163	0.32672	0.0:0.7517:0.0:0.2483	.	228	P09848	LPH_HUMAN	D	228	ENSP00000264162:E228D	ENSP00000264162:E228D	E	-	3	2	LCT	136307187	0.016000	0.18221	0.197000	0.23402	0.056000	0.15407	0.598000	0.24074	0.842000	0.35045	0.455000	0.32223	GAG	.		0.488	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254657.1	NM_002299	
CDCA7	83879	broad.mit.edu	37	2	174229648	174229648	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr2:174229648G>A	ENST00000347703.3	+	5	732	c.588G>A	c.(586-588)atG>atA	p.M196I	CDCA7_ENST00000410019.3_Missense_Mutation_p.M154I|CDCA7_ENST00000392567.2_Missense_Mutation_p.M196I|CDCA7_ENST00000306721.3_Missense_Mutation_p.M275I|CDCA7_ENST00000410101.3_Missense_Mutation_p.M231I	NM_145810.2	NP_665809.1	Q9BWT1	CDCA7_HUMAN	cell division cycle associated 7	196					apoptotic process (GO:0006915)|regulation of cell proliferation (GO:0042127)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)	18			OV - Ovarian serous cystadenocarcinoma(117;0.116)			CTCTACCCATGGAGGAGGAGG	0.537																																					p.M275I		.											.	CDCA7-91	0			c.G825A						.						63.0	55.0	58.0					2																	174229648		2203	4300	6503	SO:0001583	missense	83879	exon6			ACCCATGGAGGAG	BG354580	CCDS2252.1, CCDS2253.1	2q31.1	2008-02-05			ENSG00000144354	ENSG00000144354			14628	protein-coding gene	gene with protein product		609937				11598121, 12188893	Standard	NM_145810		Approved	FLJ14736, JPO1	uc002uic.1	Q9BWT1	OTTHUMG00000132296	ENST00000347703.3:c.588G>A	2.37:g.174229648G>A	ENSP00000272789:p.Met196Ile	Somatic	51	0		WXS	Illumina GAIIx	Phase_I	71	3	NM_031942	0	0	1	1	0	B4DLP8|B4DV66|Q53EW5|Q580W9|Q658K4|Q658N4|Q8NBY9|Q96BV8|Q96SP5	Missense_Mutation	SNP	ENST00000347703.3	37	CCDS2253.1	.	.	.	.	.	.	.	.	.	.	G	5.858	0.342474	0.11069	.	.	ENSG00000144354	ENST00000347703;ENST00000392567;ENST00000306721;ENST00000410101;ENST00000410019	T;T;T;T;T	0.40756	1.05;1.02;1.04;1.04;1.05	5.65	-11.3	0.00108	.	0.386929	0.29692	N	0.011459	T	0.11324	0.0276	N	0.03608	-0.345	0.09310	N	0.999998	B;B;B;B	0.15473	0.013;0.005;0.005;0.009	B;B;B;B	0.13407	0.004;0.004;0.006;0.009	T	0.06552	-1.0820	10	0.30078	T	0.28	1.3947	5.1577	0.15044	0.605:0.0732:0.1393:0.1824	.	154;231;196;275	B4DLP8;B4DV66;Q9BWT1;Q9BWT1-2	.;.;CDCA7_HUMAN;.	I	196;196;275;231;154	ENSP00000272789:M196I;ENSP00000376348:M196I;ENSP00000306968:M275I;ENSP00000386656:M231I;ENSP00000386833:M154I	ENSP00000306968:M275I	M	+	3	0	CDCA7	173937894	0.991000	0.36638	0.002000	0.10522	0.223000	0.24884	-0.053000	0.11846	-3.306000	0.00191	0.563000	0.77884	ATG	.		0.537	CDCA7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255400.1	NM_031942	
DOCK10	55619	hgsc.bcm.edu;broad.mit.edu	37	2	225717140	225717141	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	CA	CA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr2:225717140_225717141delCA	ENST00000258390.7	-	18	2162_2163	c.2095_2096delTG	c.(2095-2097)tgcfs	p.C699fs	DOCK10_ENST00000409592.3_Frame_Shift_Del_p.C693fs	NM_014689.2	NP_055504.2	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	699	DHR-1.				regulation of cell migration (GO:0030334)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(10)|large_intestine(16)|lung(40)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	87		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		GAATTCAATGCACACAGTTATA	0.406																																					p.699_699del		.											.	DOCK10-92	0			c.2095_2096del						.																																			SO:0001589	frameshift_variant	55619	exon18			TCAATGCACACAG	AB014594	CCDS46528.1, CCDS74661.1	2q36.3	2013-01-10			ENSG00000135905	ENSG00000135905		"""Pleckstrin homology (PH) domain containing"""	23479	protein-coding gene	gene with protein product	"""zizimin3"""	611518				12432077	Standard	NM_014689		Approved	ZIZ3, KIAA0694	uc010fwz.1	Q96BY6	OTTHUMG00000153428	ENST00000258390.7:c.2095_2096delTG	2.37:g.225717144_225717145delCA	ENSP00000258390:p.Cys699fs	Somatic	47	0		WXS	Illumina GAIIx	Phase_I	48	10	NM_014689	0	0	0	0	0	B3FL70|O75178|Q9NW06|Q9NXI8	Frame_Shift_Del	DEL	ENST00000258390.7	37	CCDS46528.1																																																																																			.		0.406	DOCK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331246.1		
BPIFB6	128859	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	31626724	31626724	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr20:31626724C>A	ENST00000349552.1	+	9	856	c.856C>A	c.(856-858)Ctg>Atg	p.L286M		NM_174897.2	NP_777557.1	Q8NFQ5	BPIB6_HUMAN	BPI fold containing family B, member 6	286						extracellular region (GO:0005576)	lipid binding (GO:0008289)										GATTGGTGAGCTGCCCCCACA	0.532																																					p.L286M		.											.	.	0			c.C856A						.						215.0	213.0	213.0					20																	31626724		2203	4300	6503	SO:0001583	missense	128859	exon9			GGTGAGCTGCCCC	AF465767	CCDS13211.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000167104	ENSG00000167104		"""BPI fold containing"""	16504	protein-coding gene	gene with protein product		614110	"""bactericidal/permeability-increasing protein-like 3"""	BPIL3		12185532, 21787333	Standard	NM_174897		Approved	LPLUNC6	uc010zuc.2	Q8NFQ5	OTTHUMG00000032238	ENST00000349552.1:c.856C>A	20.37:g.31626724C>A	ENSP00000344929:p.Leu286Met	Somatic	108	0		WXS	Illumina GAIIx	Phase_I	151	12	NM_174897	0	0	0	0	0		Missense_Mutation	SNP	ENST00000349552.1	37	CCDS13211.1	.	.	.	.	.	.	.	.	.	.	C	15.13	2.741171	0.49151	.	.	ENSG00000167104	ENST00000349552	T	0.09350	2.99	4.49	3.55	0.40652	.	0.153753	0.30151	N	0.010300	T	0.28433	0.0703	M	0.79475	2.455	0.22796	N	0.99872	D	0.76494	0.999	D	0.74348	0.983	T	0.03840	-1.0999	10	0.41790	T	0.15	.	8.2175	0.31521	0.0:0.8914:0.0:0.1086	.	286	Q8NFQ5	BPIB6_HUMAN	M	286	ENSP00000344929:L286M	ENSP00000344929:L286M	L	+	1	2	BPIFB6	31090385	0.337000	0.24766	0.251000	0.24312	0.913000	0.54294	0.712000	0.25779	1.110000	0.41699	0.561000	0.74099	CTG	.		0.532	BPIFB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078658.2	NM_174897	
ELMO2	63916	bcgsc.ca	37	20	45014770	45014770	+	Missense_Mutation	SNP	G	G	A	rs112131818	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr20:45014770G>A	ENST00000290246.6	-	9	864	c.670C>T	c.(670-672)Ctc>Ttc	p.L224F	ELMO2_ENST00000445496.2_Missense_Mutation_p.L41F|ELMO2_ENST00000352077.2_Missense_Mutation_p.L222F|ELMO2_ENST00000372176.1_Missense_Mutation_p.L136F|ELMO2_ENST00000396391.1_Missense_Mutation_p.L224F|ELMO2_ENST00000439931.2_Missense_Mutation_p.L224F|ELMO2_ENST00000488853.1_5'UTR	NM_133171.3	NP_573403.1	Q96JJ3	ELMO2_HUMAN	engulfment and cell motility 2	224					apoptotic process (GO:0006915)|cell chemotaxis (GO:0060326)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)	receptor tyrosine kinase binding (GO:0030971)			breast(1)|endometrium(1)|large_intestine(4)|lung(8)|ovary(1)|urinary_tract(1)	16		Myeloproliferative disorder(115;0.0122)				CACACCTGGAGGTGTGAGATG	0.493													G|||	45	0.00898562	0.0318	0.0	5008	,	,		20924	0.001		0.0	False		,,,				2504	0.002				p.L224F		.											.	ELMO2-91	0			c.C670T						.						115.0	109.0	111.0					20																	45014770		2203	4300	6503	SO:0001583	missense	63916	exon8			CCTGGAGGTGTGA	AF398886	CCDS13398.1	20q13	2010-03-18	2006-01-20		ENSG00000062598	ENSG00000062598		"""Engulfment and cell motility proteins"""	17233	protein-coding gene	gene with protein product		606421	"""engulfment and cell motility 2 (ced-12 homolog, C. elegans)"""			11595183	Standard	NM_133171		Approved	CED12, ELMO-2, CED-12, KIAA1834, FLJ11656	uc002xru.1	Q96JJ3	OTTHUMG00000033070	ENST00000290246.6:c.670C>T	20.37:g.45014770G>A	ENSP00000290246:p.Leu224Phe	Somatic	52	0		WXS	Illumina GAIIx	Phase_I	54	4	NM_182764	0	0	0	0	0	E1P5T3|Q5JVZ6|Q7Z5G9|Q96CJ2|Q96ME5|Q96PA9|Q9H938|Q9H9L5|Q9HAH0|Q9NQQ6	Missense_Mutation	SNP	ENST00000290246.6	37	CCDS13398.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.291388	0.80914	.	.	ENSG00000062598	ENST00000290246;ENST00000372176;ENST00000396391;ENST00000439931;ENST00000445496;ENST00000352077;ENST00000425546;ENST00000450812	T;T;T;T;T;T;T;T	0.64438	-0.1;-0.1;-0.1;-0.1;0.92;-0.1;0.52;-0.1	4.85	4.85	0.62838	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.69151	0.3079	L	0.49571	1.57	0.80722	D	1	P;P;P	0.50156	0.843;0.932;0.91	P;P;P	0.53912	0.737;0.708;0.737	T	0.70396	-0.4883	10	0.49607	T	0.09	-21.0836	17.1413	0.86754	0.0:0.0:1.0:0.0	.	224;224;224	B4DRL5;E9PBG2;Q96JJ3	.;.;ELMO2_HUMAN	F	224;136;224;224;41;222;12;224	ENSP00000290246:L224F;ENSP00000361249:L136F;ENSP00000379673:L224F;ENSP00000396519:L224F;ENSP00000409920:L41F;ENSP00000326172:L222F;ENSP00000388962:L12F;ENSP00000416181:L224F	ENSP00000290246:L224F	L	-	1	0	ELMO2	44448177	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.129000	0.71657	2.526000	0.85167	0.591000	0.81541	CTC	G|0.999;A|0.001		0.493	ELMO2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080466.1	NM_022086	
PREX1	57580	ucsc.edu;bcgsc.ca	37	20	47262549	47262549	+	Missense_Mutation	SNP	C	C	T	rs6012504	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr20:47262549C>T	ENST00000371941.3	-	26	3374	c.3352G>A	c.(3352-3354)Gca>Aca	p.A1118T	PREX1_ENST00000396220.1_Missense_Mutation_p.A1118T	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	1118			A -> T (in dbSNP:rs6012504). {ECO:0000269|PubMed:11955434}.		actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			GCCAAGGATGCGTCGCAGGAC	0.592													C|||	854	0.170527	0.3669	0.0893	5008	,	,		21267	0.0873		0.0805	False		,,,				2504	0.1411				p.A1118T		.											.	PREX1-231	0			c.G3352A						.	C	THR/ALA	1434,2972	465.7+/-354.3	236,962,1005	85.0	72.0	77.0		3352	2.8	0.0	20	dbSNP_114	77	518,8082	146.0+/-201.7	18,482,3800	yes	missense	PREX1	NM_020820.3	58	254,1444,4805	TT,TC,CC		6.0233,32.5465,15.0085	benign	1118/1660	47262549	1952,11054	2203	4300	6503	SO:0001583	missense	57580	exon26			AGGATGCGTCGCA	AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.3352G>A	20.37:g.47262549C>T	ENSP00000361009:p.Ala1118Thr	Somatic	83	0		WXS	Illumina GAIIx	Phase_I	134	33	NM_020820	0	0	2	4	2	E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	Missense_Mutation	SNP	ENST00000371941.3	37	CCDS13410.1	322	0.14743589743589744	177	0.3597560975609756	40	0.11049723756906077	53	0.09265734265734266	52	0.06860158311345646	C	8.060	0.767934	0.15983	0.325465	0.060233	ENSG00000124126	ENST00000371941;ENST00000396220	T;T	0.36157	1.27;1.27	4.86	2.84	0.33178	.	0.365713	0.22680	U	0.056948	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B;B	0.14012	0.009;0.008	B;B	0.09377	0.001;0.004	T	0.44636	-0.9315	9	0.32370	T	0.25	.	10.2951	0.43618	0.0:0.282:0.5772:0.1409	rs6012504;rs57345997;rs6012504	1118;415	Q8TCU6;Q8TCU6-2	PREX1_HUMAN;.	T	1118	ENSP00000361009:A1118T;ENSP00000379522:A1118T	ENSP00000361009:A1118T	A	-	1	0	PREX1	46695956	0.967000	0.33354	0.001000	0.08648	0.000000	0.00434	1.799000	0.38824	0.543000	0.28864	-0.147000	0.13772	GCA	C|0.843;T|0.157		0.592	PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079623.1	NM_020820	
PCK1	5105	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	56136550	56136550	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr20:56136550G>C	ENST00000319441.4	+	2	247	c.83G>C	c.(82-84)aGg>aCg	p.R28T	PCK1_ENST00000543666.1_5'UTR|PCK1_ENST00000535860.1_5'Flank	NM_002591.3	NP_002582.3	P35558	PCKGC_HUMAN	phosphoenolpyruvate carboxykinase 1 (soluble)	28					carbohydrate metabolic process (GO:0005975)|drug metabolic process (GO:0017144)|gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycerol biosynthetic process from pyruvate (GO:0046327)|internal protein amino acid acetylation (GO:0006475)|oxaloacetate metabolic process (GO:0006107)|response to activity (GO:0014823)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	carboxylic acid binding (GO:0031406)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|phosphoenolpyruvate carboxykinase (GTP) activity (GO:0004613)			endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(19)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	34	Lung NSC(12;0.000764)|all_lung(29;0.00264)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;9.88e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.13e-07)			CAGGCAGTGAGGGAGTTTCTC	0.572																																					p.R28T		.											.	PCK1-227	0			c.G83C						.						100.0	96.0	97.0					20																	56136550		2203	4300	6503	SO:0001583	missense	5105	exon2			CAGTGAGGGAGTT		CCDS13460.1	20q13.31	2007-11-06			ENSG00000124253	ENSG00000124253	4.1.1.32		8724	protein-coding gene	gene with protein product		614168				1492743	Standard	NM_002591		Approved	PEPCK-C	uc002xyn.4	P35558	OTTHUMG00000032825	ENST00000319441.4:c.83G>C	20.37:g.56136550G>C	ENSP00000319814:p.Arg28Thr	Somatic	71	0		WXS	Illumina GAIIx	Phase_I	71	14	NM_002591	0	0	1	1	0	A8K437|B4DT64|Q8TCA3|Q9UJD2	Missense_Mutation	SNP	ENST00000319441.4	37	CCDS13460.1	.	.	.	.	.	.	.	.	.	.	G	13.08	2.130220	0.37630	.	.	ENSG00000124253	ENST00000319441	T	0.11712	2.75	5.42	5.42	0.78866	Phosphoenolpyruvate carboxykinase, N-terminal (2);	0.084482	0.85682	D	0.000000	T	0.13500	0.0327	L	0.55213	1.73	0.80722	D	1	B	0.32203	0.36	B	0.35182	0.197	T	0.03240	-1.1057	10	0.34782	T	0.22	-39.0454	12.5584	0.56267	0.0757:0.0:0.9243:0.0	.	28	P35558	PCKGC_HUMAN	T	28	ENSP00000319814:R28T	ENSP00000319814:R28T	R	+	2	0	PCK1	55569956	1.000000	0.71417	0.940000	0.37924	0.184000	0.23303	6.291000	0.72719	2.551000	0.86045	0.561000	0.74099	AGG	.		0.572	PCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079851.2		
CDH4	1002	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	59829909	59829909	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr20:59829909G>A	ENST00000360469.5	+	2	173	c.85G>A	c.(85-87)Gag>Aag	p.E29K		NM_001794.3	NP_001785.2	P55283	CADH4_HUMAN	cadherin 4, type 1, R-cadherin (retinal)	29					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(2)|lung(25)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			TACAACTAGAGAGACCTGCAA	0.438																																					p.E29K		.											.	CDH4-282	0			c.G85A						.						122.0	135.0	130.0					20																	59829909		2203	4300	6503	SO:0001583	missense	1002	exon2			ACTAGAGAGACCT	L34059	CCDS13488.1, CCDS58784.1	20q13.3	2010-01-26			ENSG00000179242	ENSG00000179242		"""Cadherins / Major cadherins"""	1763	protein-coding gene	gene with protein product	"""R-Cadherin"""	603006				10191097, 10516427	Standard	NM_001794		Approved		uc002ybn.2	P55283	OTTHUMG00000032890	ENST00000360469.5:c.85G>A	20.37:g.59829909G>A	ENSP00000353656:p.Glu29Lys	Somatic	102	0		WXS	Illumina GAIIx	Phase_I	81	17	NM_001794	0	0	2	2	0	B3KWB8|G3V1P8|Q2M208|Q5VZ44|Q9BZ05	Missense_Mutation	SNP	ENST00000360469.5	37	CCDS13488.1	.	.	.	.	.	.	.	.	.	.	G	13.71	2.318690	0.40996	.	.	ENSG00000179242	ENST00000360469	T	0.55930	0.49	5.37	3.28	0.37604	.	1.367040	0.05131	N	0.492644	T	0.39384	0.1076	N	0.14661	0.345	0.80722	D	1	B	0.16166	0.016	B	0.14578	0.011	T	0.01791	-1.1273	9	.	.	.	.	13.5511	0.61732	0.0:0.5058:0.4942:0.0	.	29	P55283	CADH4_HUMAN	K	29	ENSP00000353656:E29K	.	E	+	1	0	CDH4	59263304	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.629000	0.46485	1.249000	0.43950	0.655000	0.94253	GAG	.		0.438	CDH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079965.2	NM_001794	
TNFRSF6B	8771	ucsc.edu;bcgsc.ca	37	20	62328453	62328453	+	Silent	SNP	T	T	C	rs2258056	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr20:62328453T>C	ENST00000369996.1	+	1	433	c.333T>C	c.(331-333)cgT>cgC	p.R111R	ARFRP1_ENST00000485858.1_5'Flank|RTEL1-TNFRSF6B_ENST00000482936.1_3'UTR	NM_003823.3	NP_003814.1	O95407	TNF6B_HUMAN	tumor necrosis factor receptor superfamily, member 6b, decoy	111					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)	extracellular space (GO:0005615)	receptor activity (GO:0004872)			central_nervous_system(1)|lung(2)|skin(1)	4	all_cancers(38;4.66e-12)|all_epithelial(29;2.56e-13)|Lung NSC(23;1.06e-08)|all_lung(23;3.34e-08)		Epithelial(9;1.78e-08)|all cancers(9;7.89e-08)|OV - Ovarian serous cystadenocarcinoma(5;0.00504)			CCCACAACCGTGCCTGCCGCT	0.662													C|||	1323	0.264177	0.0242	0.2666	5008	,	,		16647	0.6468		0.2048	False		,,,				2504	0.2536				p.R111R		.											.	TNFRSF6B-651	0			c.T333C						.	C		294,4036		15,264,1886	11.0	13.0	12.0		333	-5.2	0.1	20	dbSNP_100	12	1841,6681		205,1431,2625	no	coding-synonymous	TNFRSF6B	NM_003823.3		220,1695,4511	CC,CT,TT		21.6029,6.7898,16.6122		111/301	62328453	2135,10717	2165	4261	6426	SO:0001819	synonymous_variant	8771	exon1			CAACCGTGCCTGC	AF104419	CCDS13532.1	20q13.33	2012-06-27						"""Tumor necrosis factor receptor superfamily"""	11921	protein-coding gene	gene with protein product		603361				9872321, 10318773	Standard	NM_003823		Approved	DcR3, DCR3, TR6, M68	uc002yfz.3	O95407	OTTHUMG00000143724	ENST00000369996.1:c.333T>C	20.37:g.62328453T>C		Somatic	15	0		WXS	Illumina GAIIx	Phase_I	177	118	NM_003823	0	0	10	29	19		Silent	SNP	ENST00000369996.1	37	CCDS13532.1																																																																																			T|0.777;C|0.223		0.662	TNFRSF6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080182.1		
C21orf62	56245	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	34166441	34166441	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr21:34166441G>C	ENST00000536776.1	-	2	432	c.292C>G	c.(292-294)Ctg>Gtg	p.L98V	C21orf49_ENST00000382378.1_Intron|C21orf49_ENST00000477513.1_Intron|C21orf62_ENST00000479548.1_Missense_Mutation_p.L98V|C21orf62_ENST00000487113.1_Missense_Mutation_p.L98V|C21orf49_ENST00000453404.1_Intron|C21orf49_ENST00000382375.4_Intron|C21orf62_ENST00000490358.1_Missense_Mutation_p.L98V|C21orf49_ENST00000382377.3_Intron	NM_001162495.2|NM_001162496.2|NM_019596.5	NP_001155967.2|NP_001155968.2|NP_062542.5	Q9NYP8	CU062_HUMAN	chromosome 21 open reading frame 62	98										endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|ovary(1)	6		Myeloproliferative disorder(46;0.0255)				TCTTGGACCAGCGTGAAGTTC	0.562																																					p.L98V		.											.	C21orf62-91	0			c.C292G						.						94.0	94.0	94.0					21																	34166441		2101	4227	6328	SO:0001583	missense	56245	exon4			GGACCAGCGTGAA	AF231922	CCDS42919.1, CCDS42919.2	21q22.1	2011-02-24			ENSG00000205929	ENSG00000205929			1305	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 120"""	C21orf120			Standard	NM_001162495		Approved	B37, PRED81	uc011adu.2	Q9NYP8	OTTHUMG00000163477	ENST00000536776.1:c.292C>G	21.37:g.34166441G>C	ENSP00000444950:p.Leu98Val	Somatic	154	0		WXS	Illumina GAIIx	Phase_I	134	47	NM_001162495	0	0	0	0	0	A8K4L8	Missense_Mutation	SNP	ENST00000536776.1	37	CCDS42919.2	.	.	.	.	.	.	.	.	.	.	G	11.71	1.718931	0.30503	.	.	ENSG00000205929	ENST00000536776;ENST00000490358;ENST00000487113;ENST00000382373;ENST00000479548	.	.	.	5.37	0.994	0.19832	.	0.362069	0.19715	U	0.107731	T	0.28896	0.0717	M	0.68952	2.095	0.09310	N	1	P	0.38827	0.649	B	0.36666	0.23	T	0.25152	-1.0140	9	0.59425	D	0.04	-22.0921	2.1875	0.03891	0.2475:0.2007:0.4336:0.1182	.	98	Q9NYP8	CU062_HUMAN	V	98;98;98;145;98	.	ENSP00000371810:L145V	L	-	1	2	C21orf62	33088311	0.000000	0.05858	0.351000	0.25721	0.140000	0.21249	0.199000	0.17237	0.644000	0.30656	0.462000	0.41574	CTG	.		0.562	C21orf62-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139598.5	NM_019596	
ZBTB21	49854	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	43412530	43412530	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr21:43412530C>G	ENST00000310826.5	-	3	1858	c.1675G>C	c.(1675-1677)Gca>Cca	p.A559P	ZBTB21_ENST00000465968.1_Intron|ZBTB21_ENST00000398505.3_Intron|ZBTB21_ENST00000398511.3_Missense_Mutation_p.A559P|ZBTB21_ENST00000398499.1_Missense_Mutation_p.A559P	NM_001098402.1	NP_001091872.1	Q9ULJ3	ZBT21_HUMAN	zinc finger and BTB domain containing 21	559					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyl-CpG binding (GO:0008327)										TGAAGACCTGCTGTTGATCTA	0.403																																					p.A559P		.											.	.	0			c.G1675C						.						151.0	136.0	141.0					21																	43412530		2203	4300	6503	SO:0001583	missense	49854	exon3			GACCTGCTGTTGA	AB033053	CCDS13678.1, CCDS42934.1	21q22.3	2013-01-09	2013-01-09	2013-01-09	ENSG00000173276	ENSG00000173276		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	13083	protein-coding gene	gene with protein product			"""zinc finger protein 295"""	ZNF295			Standard	NM_020727		Approved	KIAA1227	uc002yzy.4	Q9ULJ3	OTTHUMG00000086789	ENST00000310826.5:c.1675G>C	21.37:g.43412530C>G	ENSP00000308759:p.Ala559Pro	Somatic	86	0		WXS	Illumina GAIIx	Phase_I	132	39	NM_001098402	0	0	0	0	0	Q5R2W1|Q5R2W2|Q6P4R0	Missense_Mutation	SNP	ENST00000310826.5	37	CCDS13678.1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.497104	0.85069	.	.	ENSG00000173276	ENST00000310826;ENST00000398499;ENST00000398511	T;T;T	0.15718	2.4;2.4;2.4	5.77	5.77	0.91146	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.000000	0.85682	D	0.000000	T	0.42154	0.1190	L	0.59436	1.845	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.10154	-1.0642	10	0.66056	D	0.02	-13.3213	19.9915	0.97366	0.0:1.0:0.0:0.0	.	559	Q9ULJ3	ZN295_HUMAN	P	559	ENSP00000308759:A559P;ENSP00000381512:A559P;ENSP00000381523:A559P	ENSP00000308759:A559P	A	-	1	0	ZNF295	42285599	1.000000	0.71417	0.564000	0.28396	0.994000	0.84299	5.564000	0.67359	2.723000	0.93209	0.655000	0.94253	GCA	.		0.403	ZBTB21-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195308.1	NM_020727	
MN1	4330	hgsc.bcm.edu	37	22	28194933	28194933	+	Silent	SNP	T	T	C	rs572936881|rs373314940|rs71194738	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr22:28194933T>C	ENST00000302326.4	-	1	2553	c.1599A>G	c.(1597-1599)caA>caG	p.Q533Q		NM_002430.2	NP_002421.3	Q10571	MN1_HUMAN	meningioma (disrupted in balanced translocation) 1	533	Poly-Gln.				intramembranous ossification (GO:0001957)					NS(1)|breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	45						gctgctgctgttgctgctgct	0.652			T	ETV6	"""AML, meningioma"""								T|||	98	0.0195687	0.0613	0.0086	5008	,	,		12327	0.002		0.005	False		,,,				2504	0.0041				p.Q533Q		.		Dom	yes		22	22q13	4330	meningioma (disrupted in balanced translocation) 1		"""L, O"""	.	MN1-993	0			c.A1599G						.	C		9,3561		0,9,1776	4.0	5.0	5.0		1599	-0.4	1.0	22		5	5,7341		0,5,3668	no	coding-synonymous	MN1	NM_002430.2		0,14,5444	CC,CT,TT		0.0681,0.2521,0.1283		533/1321	28194933	14,10902	1785	3673	5458	SO:0001819	synonymous_variant	4330	exon1			CTGCTGTTGCTGC	X82209	CCDS42998.1	22q12.1	2010-09-29			ENSG00000169184	ENSG00000169184			7180	protein-coding gene	gene with protein product	"""probable tumor suppressor protein MN1"""	156100	"""meningioma chromosome region"""	MGCR		7731706, 12569362	Standard	NM_002430		Approved	MGCR1-PEN, MGCR1	uc003adj.3	Q10571	OTTHUMG00000150975	ENST00000302326.4:c.1599A>G	22.37:g.28194933T>C		Somatic	5	0		WXS	Illumina GAIIx	Phase_I	67	6	NM_002430	1	0	71	5563	5491	A9Z1V9	Silent	SNP	ENST00000302326.4	37	CCDS42998.1																																																																																			.		0.652	MN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320737.1	NM_002430	
NEFH	4744	ucsc.edu	37	22	29885594	29885594	+	Silent	SNP	A	A	T	rs79235463|rs200984527|rs267607533	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr22:29885594A>T	ENST00000310624.6	+	4	1998	c.1965A>T	c.(1963-1965)ccA>ccT	p.P655P		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	661	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						CCAAGTCCCCAGAGAAGGAAG	0.552																																					p.P655P		.											.	NEFH-90	0			c.A1965T						.						83.0	92.0	89.0					22																	29885594		2203	4300	6503	SO:0001819	synonymous_variant	4744	exon4			GTCCCCAGAGAAG		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1965A>T	22.37:g.29885594A>T		Somatic	226	1		WXS	Illumina GAIIx	Phase_I	146	22	NM_021076	0	0	20	20	0	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Silent	SNP	ENST00000310624.6	37	CCDS13858.1																																																																																			A|0.500;T|0.500		0.552	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
NEFH	4744	bcgsc.ca	37	22	29885670	29885693	+	In_Frame_Del	DEL	AAGTCCCCAGTGAAGGCAGAAGCA	AAGTCCCCAGTGAAGGCAGAAGCA	-	rs200302220|rs113936045		TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	AAGTCCCCAGTGAAGGCAGAAGCA	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr22:29885670_29885693delAAGTCCCCAGTGAAGGCAGAAGCA	ENST00000310624.6	+	4	2074_2097	c.2041_2064delAAGTCCCCAGTGAAGGCAGAAGCA	c.(2041-2064)aagtccccagtgaaggcagaagcadel	p.KSPVKAEA681del		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	687	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.A686E(1)		cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						TGAGAAGGCCAAGTCCCCAGTGAAGGCAGAAGCAAAGTCCCCTG	0.571																																					p.681_688del		.											.	NEFH-90	1	Substitution - Missense(1)	endometrium(1)	c.2041_2064del						.																																			SO:0001651	inframe_deletion	4744	exon4			AAGGCCAAGTCCC		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.2041_2064delAAGTCCCCAGTGAAGGCAGAAGCA	22.37:g.29885670_29885693delAAGTCCCCAGTGAAGGCAGAAGCA	ENSP00000311997:p.Lys681_Ala688del	Somatic	410	0		WXS	Illumina GAIIx	Phase_I	403	45	NM_021076	0	0	0	0	0	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	In_Frame_Del	DEL	ENST00000310624.6	37	CCDS13858.1																																																																																			.		0.571	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
NEFH	4744	bcgsc.ca	37	22	29885722	29885722	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr22:29885722T>A	ENST00000310624.6	+	4	2126	c.2093T>A	c.(2092-2094)gTg>gAg	p.V698E		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	704	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						AAGTCCCCAGTGAAGGAAGAA	0.552																																					p.V698E		.											.	NEFH-90	0			c.T2093A						.						66.0	70.0	68.0					22																	29885722		2193	4274	6467	SO:0001583	missense	4744	exon4			CCCCAGTGAAGGA		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.2093T>A	22.37:g.29885722T>A	ENSP00000311997:p.Val698Glu	Somatic	417	7		WXS	Illumina GAIIx	Phase_I	372	44	NM_021076	0	0	111	111	0	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Missense_Mutation	SNP	ENST00000310624.6	37	CCDS13858.1	.	.	.	.	.	.	.	.	.	.	T	6.362	0.434952	0.12045	.	.	ENSG00000100285	ENST00000328842;ENST00000310624	D	0.82711	-1.64	4.37	-2.71	0.05986	.	0.514922	0.16469	N	0.213074	T	0.76983	0.4064	L	0.46614	1.455	0.09310	N	1	P	0.39282	0.666	P	0.44394	0.448	T	0.69815	-0.5043	10	0.87932	D	0	.	6.5863	0.22622	0.639:0.1533:0.0:0.2077	.	704	P12036	NFH_HUMAN	E	698	ENSP00000311997:V698E	ENSP00000311997:V698E	V	+	2	0	NEFH	28215722	0.000000	0.05858	0.056000	0.19401	0.172000	0.22775	-0.695000	0.05109	-0.993000	0.03467	-0.472000	0.04984	GTG	.		0.552	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
NEFH	4744	bcgsc.ca	37	22	29885732	29885732	+	Silent	SNP	A	A	G			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr22:29885732A>G	ENST00000310624.6	+	4	2136	c.2103A>G	c.(2101-2103)gaA>gaG	p.E701E		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	707	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						TGAAGGAAGAAGCAAAGTCCC	0.562																																					p.E701E		.											.	NEFH-90	0			c.A2103G						.						67.0	72.0	70.0					22																	29885732		2160	4233	6393	SO:0001819	synonymous_variant	4744	exon4			GGAAGAAGCAAAG		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.2103A>G	22.37:g.29885732A>G		Somatic	410	6		WXS	Illumina GAIIx	Phase_I	355	36	NM_021076	0	0	56	56	0	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Silent	SNP	ENST00000310624.6	37	CCDS13858.1																																																																																			.		0.562	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
NEFH	4744	bcgsc.ca	37	22	29885735	29885735	+	Silent	SNP	A	A	C			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr22:29885735A>C	ENST00000310624.6	+	4	2139	c.2106A>C	c.(2104-2106)gcA>gcC	p.A702A		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	708	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						AGGAAGAAGCAAAGTCCCCTG	0.557																																					p.A702A		.											.	NEFH-90	0			c.A2106C						.						66.0	70.0	69.0					22																	29885735		2119	4173	6292	SO:0001819	synonymous_variant	4744	exon4			AGAAGCAAAGTCC		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.2106A>C	22.37:g.29885735A>C		Somatic	410	10		WXS	Illumina GAIIx	Phase_I	352	38	NM_021076	0	0	50	50	0	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Silent	SNP	ENST00000310624.6	37	CCDS13858.1																																																																																			.		0.557	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
NF2	4771	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	30057313	30057313	+	Silent	SNP	G	G	A	rs376609988		TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr22:30057313G>A	ENST00000338641.4	+	8	1236	c.795G>A	c.(793-795)tcG>tcA	p.S265S	NF2_ENST00000353887.4_Silent_p.S182S|NF2_ENST00000361676.4_Silent_p.S223S|NF2_ENST00000413209.2_Intron|NF2_ENST00000334961.7_Silent_p.S182S|NF2_ENST00000403435.1_Silent_p.S265S|NF2_ENST00000361166.4_Silent_p.S265S|NF2_ENST00000397789.3_Silent_p.S265S|NF2_ENST00000347330.5_Silent_p.S106S|NF2_ENST00000403999.3_Silent_p.S265S|NF2_ENST00000361452.4_Silent_p.S224S	NM_000268.3|NM_016418.5|NM_181832.2	NP_000259.1|NP_057502.2|NP_861970.1	P35240	MERL_HUMAN	neurofibromin 2 (merlin)	265	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				actin cytoskeleton organization (GO:0030036)|cell-cell junction organization (GO:0045216)|ectoderm development (GO:0007398)|hippocampus development (GO:0021766)|lens fiber cell differentiation (GO:0070306)|mesoderm formation (GO:0001707)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of DNA replication (GO:0008156)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|negative regulation of tyrosine phosphorylation of Stat5 protein (GO:0042524)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of cell differentiation (GO:0045597)|positive regulation of stress fiber assembly (GO:0051496)|regulation of hippo signaling (GO:0035330)|regulation of neural precursor cell proliferation (GO:2000177)|regulation of protein localization to nucleus (GO:1900180)|regulation of protein stability (GO:0031647)|Schwann cell proliferation (GO:0014010)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|cleavage furrow (GO:0032154)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|early endosome (GO:0005769)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)		p.?(3)|p.S265fs*2(1)|p.N226_E270del(1)|p.K253_S265del(1)		NS(1)|bone(2)|breast(5)|central_nervous_system(21)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(17)|large_intestine(9)|liver(1)|lung(9)|meninges(372)|ovary(2)|pituitary(1)|pleura(9)|prostate(1)|skin(7)|soft_tissue(303)|stomach(2)|thyroid(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	776						GAAACATCTCGTACAGTGACA	0.552			"""D, Mis, N, F, S, O"""		"""meningioma, acoustic neuroma, renal """	"""meningioma, acoustic neuroma"""			Neurofibromatosis, type 2																												p.S265S		.	yes	Rec	yes	Neurofibromatosis type 2	22	22q12.2	4771	neurofibromatosis type 2 gene		O	.	NF2-4696	6	Unknown(3)|Deletion - In frame(2)|Deletion - Frameshift(1)	soft_tissue(3)|large_intestine(1)|stomach(1)|central_nervous_system(1)	c.G795A						.	G	,,,,,,,,	1,4405	2.1+/-5.4	0,1,2202	123.0	114.0	117.0		795,795,795,669,672,546,546,795,	-11.6	0.2	22		117	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,intron	NF2	NM_000268.3,NM_016418.5,NM_181825.2,NM_181828.2,NM_181829.2,NM_181830.2,NM_181831.2,NM_181832.2,NM_181833.2	,,,,,,,,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,,,,,,,,	265/596,265/591,265/591,223/549,224/550,182/508,182/508,265/591,	30057313	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	4771	exon8	Familial Cancer Database	NF2, Central Neurofibromatosis, Bilateral Acoustic Neurofibromatosis	CATCTCGTACAGT	L11353	CCDS13861.1, CCDS13862.1, CCDS13863.1, CCDS13864.1, CCDS13865.1, CCDS54516.1	22q12.2	2014-09-17	2007-12-17		ENSG00000186575	ENSG00000186575		"""A-kinase anchor proteins"""	7773	protein-coding gene	gene with protein product	"""moesin-ezrin-radixin like"", ""schwannomin"""	607379	"""neurofibromin 2 (bilateral acoustic neuroma)"""			10591208	Standard	NM_000268		Approved	merlin	uc003age.4	P35240	OTTHUMG00000030727	ENST00000338641.4:c.795G>A	22.37:g.30057313G>A		Somatic	56	0		WXS	Illumina GAIIx	Phase_I	62	8	NM_016418	0	0	8	18	10	O95683|Q8WUJ2|Q969N0|Q969Q3|Q96T30|Q96T31|Q96T32|Q96T33|Q9BTW3|Q9UNG9|Q9UNH3|Q9UNH4	Silent	SNP	ENST00000338641.4	37	CCDS13861.1																																																																																			.		0.552	NF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075615.3	NM_000268	
SH3BP1	23616	hgsc.bcm.edu	37	22	38051355	38051355	+	Silent	SNP	G	G	A	rs762989	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr22:38051355G>A	ENST00000357436.4	+	18	2083	c.1770G>A	c.(1768-1770)ccG>ccA	p.P590P	Z83844.1_ENST00000456099.1_RNA|SH3BP1_ENST00000599616.1_Intron	NM_018957.3	NP_061830.3	Q9Y3L3	3BP1_HUMAN	SH3-domain binding protein 1	590					signal transduction (GO:0007165)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	Melanoma(58;0.0574)					CTCCAGCCCCGCCCTTGCCCC	0.741													G|||	975	0.194688	0.2867	0.3055	5008	,	,		4753	0.0833		0.1799	False		,,,				2504	0.1217				p.P590P		.											.	SH3BP1-90	0			c.G1770A						.	G		606,2448		46,514,967	3.0	4.0	4.0		1770	-1.0	0.0	22	dbSNP_86	4	739,5643		39,661,2491	no	coding-synonymous	SH3BP1	NM_018957.3		85,1175,3458	AA,AG,GG		11.5794,19.8428,14.2539		590/702	38051355	1345,8091	1527	3191	4718	SO:0001819	synonymous_variant	23616	exon18			AGCCCCGCCCTTG		CCDS13952.2	22q13.1	2011-07-04			ENSG00000100092	ENSG00000100092		"""Rho GTPase activating proteins"""	10824	protein-coding gene	gene with protein product						10591208, 12029088	Standard	NM_018957		Approved	ARHGAP43	uc003ati.3	Q9Y3L3	OTTHUMG00000030996	ENST00000357436.4:c.1770G>A	22.37:g.38051355G>A		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	7	5	NM_018957	0	0	1	1	0	Q5R3N0|Q6IBZ2|Q6ZVL9|Q96HQ5|Q9NSQ9	Silent	SNP	ENST00000357436.4	37	CCDS13952.2																																																																																			G|0.825;A|0.175		0.741	SH3BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075884.4	NM_018957	
SOX10	6663	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	38374133	38374133	+	Silent	SNP	G	G	A			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr22:38374133G>A	ENST00000396884.2	-	3	720	c.438C>T	c.(436-438)aaC>aaT	p.N146N	SOX10_ENST00000470555.1_5'UTR|POLR2F_ENST00000405557.1_Intron|SOX10_ENST00000360880.2_Silent_p.N146N|POLR2F_ENST00000407936.1_Intron	NM_006941.3	NP_008872.1	P56693	SOX10_HUMAN	SRY (sex determining region Y)-box 10	146					anatomical structure morphogenesis (GO:0009653)|cell maturation (GO:0048469)|developmental growth (GO:0048589)|digestive tract morphogenesis (GO:0048546)|enteric nervous system development (GO:0048484)|in utero embryonic development (GO:0001701)|melanocyte differentiation (GO:0030318)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell migration (GO:0001755)|oligodendrocyte differentiation (GO:0048709)|peripheral nervous system development (GO:0007422)|positive regulation of gliogenesis (GO:0014015)|positive regulation of neuroblast proliferation (GO:0002052)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	extrinsic component of mitochondrial outer membrane (GO:0031315)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|transcription coactivator activity (GO:0003713)			NS(6)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(4)|skin(2)	20	Melanoma(58;0.045)					TGTCACTTTCGTTCAGCAGCC	0.617																																					p.N146N	Melanoma(39;342 1098 6220 32775 40068)|GBM(21;140 497 5227 16059 19275)	.											.	SOX10-650	0			c.C438T						.						17.0	16.0	16.0					22																	38374133		2203	4298	6501	SO:0001819	synonymous_variant	6663	exon3			ACTTTCGTTCAGC		CCDS13964.1	22q13.1	2014-09-17			ENSG00000100146	ENSG00000100146		"""SRY (sex determining region Y)-boxes"""	11190	protein-coding gene	gene with protein product	"""dominant megacolon, mouse, human homolog of"""	602229				9462749, 10441344, 12944398	Standard	NM_006941		Approved	DOM, WS4, WS2E	uc003aun.1	P56693	OTTHUMG00000149913	ENST00000396884.2:c.438C>T	22.37:g.38374133G>A		Somatic	45	0		WXS	Illumina GAIIx	Phase_I	46	5	NM_006941	0	0	0	0	0	B4DV62|Q6FHW7	Silent	SNP	ENST00000396884.2	37	CCDS13964.1	.	.	.	.	.	.	.	.	.	.	G	7.633	0.679272	0.14907	.	.	ENSG00000100146	ENST00000446929	.	.	.	4.45	-7.78	0.01223	.	.	.	.	.	T	0.62392	0.2424	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.67964	-0.5534	4	.	.	.	.	15.9762	0.80066	0.7092:0.0:0.2908:0.0	.	.	.	.	M	23	.	.	T	-	2	0	SOX10	36704079	0.147000	0.22687	0.925000	0.36789	0.846000	0.48090	-0.543000	0.06084	-1.450000	0.01936	-0.463000	0.05309	ACG	.		0.617	SOX10-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313875.1	NM_006941	
CCR3	1232	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	46306920	46306920	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr3:46306920A>C	ENST00000357422.2	+	4	814	c.271A>C	c.(271-273)Atc>Ctc	p.I91L	CCR3_ENST00000541018.1_Missense_Mutation_p.I91L|CCR3_ENST00000545097.1_Missense_Mutation_p.I112L|CCR3_ENST00000395940.2_Missense_Mutation_p.I91L|CCR3_ENST00000395942.2_Missense_Mutation_p.I91L			P51677	CCR3_HUMAN	chemokine (C-C motif) receptor 3	91					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cell adhesion (GO:0007155)|cellular defense response (GO:0006968)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|inflammatory response (GO:0006954)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of endothelial cell proliferation (GO:0001938)|viral process (GO:0016032)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|chemokine receptor activity (GO:0004950)			breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|ovary(3)|urinary_tract(1)	18				BRCA - Breast invasive adenocarcinoma(193;0.00119)|KIRC - Kidney renal clear cell carcinoma(197;0.0183)|Kidney(197;0.0216)		TCCATTCTGGATCCACTATGT	0.483																																					p.I112L		.											.	CCR3-660	0			c.A334C						.						180.0	168.0	172.0					3																	46306920		2203	4300	6503	SO:0001583	missense	1232	exon3			TTCTGGATCCACT	AF247361	CCDS2738.1, CCDS54574.1	3p21.3	2012-08-08			ENSG00000183625	ENSG00000183625		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1604	protein-coding gene	gene with protein product		601268		CMKBR3			Standard	NM_178328		Approved	CC-CKR-3, CKR3, CD193	uc003cpk.2	P51677	OTTHUMG00000133484	ENST00000357422.2:c.271A>C	3.37:g.46306920A>C	ENSP00000350003:p.Ile91Leu	Somatic	336	0		WXS	Illumina GAIIx	Phase_I	287	109	NM_178328	0	0	0	0	0	B3KVQ1|F5GWL6|Q15748|Q2YDB9|Q86WD2|Q8TDP6|Q9ULY8	Missense_Mutation	SNP	ENST00000357422.2	37	CCDS2738.1	.	.	.	.	.	.	.	.	.	.	A	15.29	2.788756	0.49997	.	.	ENSG00000183625	ENST00000357422;ENST00000545097;ENST00000541018;ENST00000395940;ENST00000395942	T;T;T;T;T	0.36699	1.24;1.24;1.24;1.24;1.24	6.07	6.07	0.98685	GPCR, rhodopsin-like superfamily (1);	0.241604	0.30043	N	0.010542	T	0.38983	0.1061	L	0.51914	1.62	0.31691	N	0.641878	P;P	0.45569	0.861;0.73	P;P	0.49561	0.615;0.612	T	0.57154	-0.7860	10	0.72032	D	0.01	.	5.2642	0.15589	0.7167:0.1776:0.1056:0.0	.	112;91	F5GWL6;P51677	.;CCR3_HUMAN	L	91;112;91;91;91	ENSP00000350003:I91L;ENSP00000441600:I112L;ENSP00000440097:I91L;ENSP00000379271:I91L;ENSP00000379273:I91L	ENSP00000350003:I91L	I	+	1	0	CCR3	46281924	1.000000	0.71417	0.999000	0.59377	0.251000	0.25915	4.547000	0.60712	2.326000	0.78906	0.533000	0.62120	ATC	.		0.483	CCR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257380.2		
ALS2CL	259173	bcgsc.ca	37	3	46729757	46729757	+	Missense_Mutation	SNP	C	C	G	rs7642448	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr3:46729757C>G	ENST00000318962.4	-	3	216	c.133G>C	c.(133-135)Gag>Cag	p.E45Q	ALS2CL_ENST00000415953.1_Missense_Mutation_p.E45Q	NM_147129.3	NP_667340.2	Q60I27	AL2CL_HUMAN	ALS2 C-terminal like	45			E -> Q (in dbSNP:rs7642448). {ECO:0000269|PubMed:17974005}.		endosome organization (GO:0007032)|protein localization (GO:0008104)	cytoplasmic membrane-bounded vesicle (GO:0016023)	GTPase activator activity (GO:0005096)|identical protein binding (GO:0042802)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(1)|lung(7)|skin(3)|stomach(2)	29				BRCA - Breast invasive adenocarcinoma(193;0.000726)|KIRC - Kidney renal clear cell carcinoma(197;0.0171)|Kidney(197;0.0202)		CGCAGGCACTCTCTGCCCCAG	0.617													C|||	2246	0.448482	0.736	0.3991	5008	,	,		20682	0.3046		0.3161	False		,,,				2504	0.3793				p.E45Q		.											.	ALS2CL-155	0			c.G133C						.	C	GLN/GLU,GLN/GLU	2839,1567	657.0+/-400.2	921,997,285	36.0	37.0	37.0		133,133	4.4	0.6	3	dbSNP_116	37	2641,5959	418.8+/-352.9	400,1841,2059	yes	missense,missense	ALS2CL	NM_001190707.1,NM_147129.3	29,29	1321,2838,2344	GG,GC,CC		30.7093,35.5651,42.1344	possibly-damaging,possibly-damaging	45/954,45/954	46729757	5480,7526	2203	4300	6503	SO:0001583	missense	259173	exon3			GGCACTCTCTGCC	AK074118	CCDS2743.1, CCDS43080.1	3p21.31	2008-01-30			ENSG00000178038	ENSG00000178038			20605	protein-coding gene	gene with protein product		612402				15388334, 8889548, 17239822	Standard	NM_147129		Approved	FLJ36525, RN49018, DKFZp686I0110	uc003cqb.2	Q60I27	OTTHUMG00000128673	ENST00000318962.4:c.133G>C	3.37:g.46729757C>G	ENSP00000313670:p.Glu45Gln	Somatic	108	0		WXS	Illumina GAIIx	Phase_I	85	5	NM_001190707	0	0	0	0	0	Q32MA1|Q6AI56|Q6ZNC5|Q6ZNC7|Q6ZTL4|Q86YD2|Q8N9U1|Q8NAL7	Missense_Mutation	SNP	ENST00000318962.4	37	CCDS2743.1	875	0.40064102564102566	337	0.6849593495934959	146	0.40331491712707185	159	0.27797202797202797	233	0.3073878627968338	C	11.66	1.703594	0.30232	0.644349	0.307093	ENSG00000178038	ENST00000318962;ENST00000415953	T;T	0.56275	0.47;0.47	4.36	4.36	0.52297	.	0.111814	0.39407	N	0.001379	T	0.00012	0.0000	L	0.34521	1.04	0.09310	P	0.9999999999980187	D	0.60575	0.988	P	0.52109	0.69	T	0.40739	-0.9547	9	0.39692	T	0.17	.	12.5671	0.56316	0.0:1.0:0.0:0.0	rs7642448;rs59127538;rs7642448	45	Q60I27	AL2CL_HUMAN	Q	45	ENSP00000313670:E45Q;ENSP00000413223:E45Q	ENSP00000313670:E45Q	E	-	1	0	ALS2CL	46704761	0.845000	0.29573	0.643000	0.29450	0.182000	0.23217	3.504000	0.53347	2.413000	0.81919	0.591000	0.81541	GAG	C|0.587;G|0.413		0.617	ALS2CL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250567.3	NM_147129	
SLC25A26	115286	bcgsc.ca	37	3	66419942	66419942	+	Silent	SNP	A	A	G	rs1129179	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr3:66419942A>G	ENST00000413054.1	+	6	419	c.345A>G	c.(343-345)gcA>gcG	p.A115A	SLC25A26_ENST00000536651.1_3'UTR|SLC25A26_ENST00000484768.1_3'UTR|SLC25A26_ENST00000336733.6_Silent_p.A115A|SLC25A26_ENST00000354883.6_Silent_p.A203A			Q70HW3	SAMC_HUMAN	solute carrier family 25 (S-adenosylmethionine carrier), member 26	203					S-adenosyl-L-methionine transmembrane transport (GO:1901962)|S-adenosyl-L-methionine transport (GO:0015805)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	S-adenosyl-L-methionine transmembrane transporter activity (GO:0000095)			endometrium(1)|large_intestine(1)|lung(2)|pancreas(1)|stomach(2)|urinary_tract(1)	8		Lung NSC(201;0.00774)		BRCA - Breast invasive adenocarcinoma(55;0.00046)|KIRC - Kidney renal clear cell carcinoma(15;0.0515)|Kidney(15;0.0648)		TAGACGTGGCAAAGACAAGAA	0.408													A|||	495	0.0988419	0.0363	0.1138	5008	,	,		22024	0.0873		0.1839	False		,,,				2504	0.0971				p.A203A		.											.	SLC25A26-46	0			c.A609G						.	A	,	291,4115	154.4+/-187.8	5,281,1917	92.0	83.0	86.0		345,609	-0.8	1.0	3	dbSNP_86	86	1641,6959	280.5+/-294.5	167,1307,2826	no	coding-synonymous,coding-synonymous	SLC25A26	NM_001164796.1,NM_173471.3	,	172,1588,4743	GG,GA,AA		19.0814,6.6046,14.8547	,	115/187,203/275	66419942	1932,11074	2203	4300	6503	SO:0001819	synonymous_variant	115286	exon9			CGTGGCAAAGACA	AJ580932	CCDS54604.1, CCDS2905.2	3p14.2	2013-05-22	2012-03-29		ENSG00000144741	ENSG00000144741		"""Solute carriers"""	20661	protein-coding gene	gene with protein product		611037	"""solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 26"""			14674884	Standard	NM_173471		Approved		uc011bfq.2	Q70HW3	OTTHUMG00000149917	ENST00000413054.1:c.345A>G	3.37:g.66419942A>G		Somatic	155	0		WXS	Illumina GAIIx	Phase_I	167	7	NM_173471	0	0	19	19	0	A8K758|B3KRZ7|Q7Z786|Q96E68	Silent	SNP	ENST00000413054.1	37		251	0.11492673992673992	16	0.032520325203252036	46	0.1270718232044199	45	0.07867132867132867	144	0.18997361477572558	A	7.990	0.753079	0.15778	0.066046	0.190814	ENSG00000144741	ENST00000413054	.	.	.	5.38	-0.784	0.10954	.	.	.	.	.	T	0.00039	0.0001	.	.	.	0.09310	P	0.9999999999999998	.	.	.	.	.	.	T	0.23726	-1.0180	3	.	.	.	-14.2864	3.9139	0.09214	0.3837:0.3951:0.1241:0.0971	rs1129179;rs3186774;rs17415499;rs1129179	.	.	.	R	140	.	.	Q	+	2	0	SLC25A26	66502632	0.833000	0.29383	0.999000	0.59377	0.567000	0.35839	-0.003000	0.12901	0.005000	0.14708	-0.313000	0.08912	CAA	A|0.869;G|0.131;T|0.000		0.408	SLC25A26-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000313895.2	NM_173471	
SLC25A26	115286	bcgsc.ca	37	3	66419956	66419956	+	Missense_Mutation	SNP	C	C	T	rs13874	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr3:66419956C>T	ENST00000413054.1	+	6	433	c.359C>T	c.(358-360)aCg>aTg	p.T120M	SLC25A26_ENST00000536651.1_3'UTR|SLC25A26_ENST00000484768.1_3'UTR|SLC25A26_ENST00000336733.6_Missense_Mutation_p.T120M|SLC25A26_ENST00000354883.6_Missense_Mutation_p.T208M			Q70HW3	SAMC_HUMAN	solute carrier family 25 (S-adenosylmethionine carrier), member 26	208					S-adenosyl-L-methionine transmembrane transport (GO:1901962)|S-adenosyl-L-methionine transport (GO:0015805)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	S-adenosyl-L-methionine transmembrane transporter activity (GO:0000095)			endometrium(1)|large_intestine(1)|lung(2)|pancreas(1)|stomach(2)|urinary_tract(1)	8		Lung NSC(201;0.00774)		BRCA - Breast invasive adenocarcinoma(55;0.00046)|KIRC - Kidney renal clear cell carcinoma(15;0.0515)|Kidney(15;0.0648)		ACAAGAATTACGCTGGCAAAG	0.433													T|||	3405	0.679912	0.8396	0.621	5008	,	,		21912	0.7659		0.4761	False		,,,				2504	0.6268				p.T208M		.											.	SLC25A26-46	0			c.C623T						.	T	MET/THR,MET/THR	3442,964	352.1+/-311.5	1348,746,109	93.0	84.0	87.0		359,623	5.5	1.0	3	dbSNP_52	87	3801,4799	584.2+/-391.7	861,2079,1360	yes	missense,missense	SLC25A26	NM_001164796.1,NM_173471.3	81,81	2209,2825,1469	TT,TC,CC		44.1977,21.8793,44.3103	benign,benign	120/187,208/275	66419956	7243,5763	2203	4300	6503	SO:0001583	missense	115286	exon9			GAATTACGCTGGC	AJ580932	CCDS54604.1, CCDS2905.2	3p14.2	2013-05-22	2012-03-29		ENSG00000144741	ENSG00000144741		"""Solute carriers"""	20661	protein-coding gene	gene with protein product		611037	"""solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 26"""			14674884	Standard	NM_173471		Approved		uc011bfq.2	Q70HW3	OTTHUMG00000149917	ENST00000413054.1:c.359C>T	3.37:g.66419956C>T	ENSP00000415304:p.Thr120Met	Somatic	163	0		WXS	Illumina GAIIx	Phase_I	174	9	NM_173471	0	0	0	0	0	A8K758|B3KRZ7|Q7Z786|Q96E68	Missense_Mutation	SNP	ENST00000413054.1	37		1413|1413	0.646978021978022|0.646978021978022	405|405	0.823170731707317|0.823170731707317	226|226	0.6243093922651933|0.6243093922651933	421|421	0.736013986013986|0.736013986013986	361|361	0.4762532981530343|0.4762532981530343	T|T	0.369|0.369	-0.935221|-0.935221	0.02340|0.02340	0.781207|0.781207	0.441977|0.441977	ENSG00000144741|ENSG00000144741	ENST00000413054|ENST00000354883;ENST00000336733	.|T;T	.|0.78595	.|-1.19;-1.19	5.49|5.49	5.49|5.49	0.81192|0.81192	.|Mitochondrial carrier domain (2);	.|0.077986	.|0.85682	.|N	.|0.000000	T|T	0.00012|0.00012	0.0000|0.0000	N|N	0.00007|0.00007	-3.15|-3.15	0.48087|0.48087	P|P	4.150000000000542E-4|4.150000000000542E-4	.|B;B	.|0.02656	.|0.0;0.0	.|B;B	.|0.01281	.|0.0;0.0	T|T	0.46400|0.46400	-0.9194|-0.9194	4|9	.|0.02654	.|T	.|1	-23.2708|-23.2708	11.4812|11.4812	0.50326|0.50326	0.0:0.0704:0.0:0.9296|0.0:0.0704:0.0:0.9296	rs13874;rs332380;rs1129181;rs1678130;rs3186777;rs11549728;rs11566372;rs17825759;rs59760960;rs13874|rs13874;rs332380;rs1129181;rs1678130;rs3186777;rs11549728;rs11566372;rs17825759;rs59760960;rs13874	.|208;208	.|F8WAB8;Q70HW3	.|.;SAMC_HUMAN	C|M	145|208;120	.|ENSP00000346955:T208M;ENSP00000336801:T120M	.|ENSP00000336801:T120M	R|T	+|+	1|2	0|0	SLC25A26|SLC25A26	66502646|66502646	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.043000|0.043000	0.13939|0.13939	5.324000|5.324000	0.65863|0.65863	0.922000|0.922000	0.37019|0.37019	-0.254000|-0.254000	0.11334|0.11334	CGC|ACG	C|0.342;T|0.658		0.433	SLC25A26-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000313895.2	NM_173471	
STX19	415117	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	93733581	93733581	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr3:93733581G>C	ENST00000315099.2	-	2	789	c.533C>G	c.(532-534)tCt>tGt	p.S178C	ARL13B_ENST00000303097.7_Intron|ARL13B_ENST00000535334.1_Intron|ARL13B_ENST00000394222.3_Intron|ARL13B_ENST00000486562.1_Intron|ARL13B_ENST00000539730.1_Intron|ARL13B_ENST00000471138.1_Intron	NM_001001850.2	NP_001001850.1	Q8N4C7	STX19_HUMAN	syntaxin 19	178					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	integral component of membrane (GO:0016021)				kidney(2)|large_intestine(2)|lung(4)|prostate(1)	9						ATCTTCTTCAGACATCTCTTT	0.338																																					p.S178C		.											.	STX19-90	0			c.C533G						.						120.0	117.0	118.0					3																	93733581		2203	4300	6503	SO:0001583	missense	415117	exon2			TCTTCAGACATCT	AF461456	CCDS33793.1	3q11	2005-12-30			ENSG00000178750	ENSG00000178750			19300	protein-coding gene	gene with protein product							Standard	NM_001001850		Approved	MGC21382	uc003drh.1	Q8N4C7	OTTHUMG00000159013	ENST00000315099.2:c.533C>G	3.37:g.93733581G>C	ENSP00000320679:p.Ser178Cys	Somatic	71	0		WXS	Illumina GAIIx	Phase_I	50	25	NM_001001850	0	0	0	0	0		Missense_Mutation	SNP	ENST00000315099.2	37	CCDS33793.1	.	.	.	.	.	.	.	.	.	.	G	10.40	1.340146	0.24339	.	.	ENSG00000178750	ENST00000315099	T	0.26518	1.73	4.76	3.87	0.44632	t-SNARE (1);	0.551366	0.19609	N	0.110193	T	0.31263	0.0791	M	0.74647	2.275	0.40666	D	0.982177	P	0.38167	0.621	B	0.36186	0.219	T	0.35151	-0.9800	10	0.72032	D	0.01	-19.1312	13.601	0.62020	0.077:0.0:0.923:0.0	.	178	Q8N4C7	STX19_HUMAN	C	178	ENSP00000320679:S178C	ENSP00000320679:S178C	S	-	2	0	STX19	95216271	0.986000	0.35501	0.326000	0.25389	0.334000	0.28698	6.299000	0.72770	1.318000	0.45170	0.650000	0.86243	TCT	.		0.338	STX19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352909.1	NM_001001850	
SEC22A	26984	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	122990434	122990434	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr3:122990434C>G	ENST00000309934.4	+	6	1685	c.789C>G	c.(787-789)atC>atG	p.I263M	SEC22A_ENST00000492595.1_Missense_Mutation_p.I263M|SEC22A_ENST00000481965.2_3'UTR	NM_012430.4	NP_036562.2	Q96IW7	SC22A_HUMAN	SEC22 vesicle trafficking protein homolog A (S. cerevisiae)	263					ER to Golgi vesicle-mediated transport (GO:0006888)|protein transport (GO:0015031)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			NS(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)	10				GBM - Glioblastoma multiforme(114;0.0548)		TTGGCTTAATCTGTCTATGCA	0.393																																					p.I263M		.											.	SEC22A-91	0			c.C789G						.						107.0	108.0	107.0					3																	122990434		2203	4300	6503	SO:0001583	missense	26984	exon7			CTTAATCTGTCTA	AF100749	CCDS3021.1	3q21.1	2006-04-25	2006-04-25	2006-04-25	ENSG00000121542	ENSG00000121542			20260	protein-coding gene	gene with protein product		612442	"""SEC22 vesicle trafficking protein-like 2 (S. cerevisiae)"""	SEC22L2		9094723, 9501016	Standard	NM_012430		Approved		uc003ege.3	Q96IW7	OTTHUMG00000159495	ENST00000309934.4:c.789C>G	3.37:g.122990434C>G	ENSP00000310521:p.Ile263Met	Somatic	47	0		WXS	Illumina GAIIx	Phase_I	45	9	NM_012430	0	0	14	14	0	B2RE26|Q9Y682	Missense_Mutation	SNP	ENST00000309934.4	37	CCDS3021.1	.	.	.	.	.	.	.	.	.	.	C	16.44	3.122551	0.56613	.	.	ENSG00000121542	ENST00000492595;ENST00000473494;ENST00000309934	T;T;T	0.24723	1.84;1.85;1.84	5.76	2.97	0.34412	.	0.100245	0.64402	D	0.000003	T	0.38532	0.1044	M	0.78801	2.425	0.46396	D	0.999024	P	0.46512	0.879	P	0.49276	0.605	T	0.31447	-0.9943	10	0.87932	D	0	-9.701	11.128	0.48330	0.1004:0.7308:0.0:0.1688	.	263	Q96IW7	SC22A_HUMAN	M	263	ENSP00000417972:I263M;ENSP00000420343:I263M;ENSP00000310521:I263M	ENSP00000310521:I263M	I	+	3	3	SEC22A	124473124	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	1.139000	0.31504	0.457000	0.26962	-0.824000	0.03097	ATC	.		0.393	SEC22A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355770.2	NM_012430	
GHSR	2693	hgsc.bcm.edu	37	3	172166144	172166144	+	Silent	SNP	G	G	A	rs2232165	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr3:172166144G>A	ENST00000241256.2	-	1	102	c.60C>T	c.(58-60)gaC>gaT	p.D20D	GHSR_ENST00000427970.1_Silent_p.D20D	NM_198407.2	NP_940799.1	Q92847	GHSR_HUMAN	growth hormone secretagogue receptor	20					actin polymerization or depolymerization (GO:0008154)|adult feeding behavior (GO:0008343)|cellular response to insulin stimulus (GO:0032869)|decidualization (GO:0046697)|G-protein coupled receptor signaling pathway (GO:0007186)|growth hormone secretion (GO:0030252)|hormone-mediated signaling pathway (GO:0009755)|negative regulation of inflammatory response (GO:0050728)|negative regulation of insulin secretion (GO:0046676)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of appetite (GO:0032100)|positive regulation of fatty acid metabolic process (GO:0045923)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of multicellular organism growth (GO:0040018)|regulation of hindgut contraction (GO:0043134)|regulation of synapse assembly (GO:0051963)|response to food (GO:0032094)|response to hormone (GO:0009725)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|growth hormone secretagogue receptor activity (GO:0001616)|growth hormone-releasing hormone receptor activity (GO:0016520)|peptide hormone binding (GO:0017046)			biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(16)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	33	Ovarian(172;0.00143)|Breast(254;0.197)		Lung(28;3.93e-15)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)|STAD - Stomach adenocarcinoma(35;0.235)			AAGCATCCCAGTCCAGGTCGG	0.687													G|||	174	0.0347444	0.0764	0.0259	5008	,	,		16047	0.0		0.0278	False		,,,				2504	0.0276				p.D20D	Esophageal Squamous(93;641 1401 20883 29581 34638)	.											.	GHSR-501	0			c.C60T						.	G	,	340,4066	171.9+/-202.1	10,320,1873	28.0	28.0	28.0		60,60	0.1	0.0	3	dbSNP_98	28	251,8349	96.6+/-158.3	5,241,4054	no	coding-synonymous,coding-synonymous	GHSR	NM_004122.2,NM_198407.2	,	15,561,5927	AA,AG,GG		2.9186,7.7167,4.5441	,	20/290,20/367	172166144	591,12415	2203	4300	6503	SO:0001819	synonymous_variant	2693	exon1			ATCCCAGTCCAGG	AY429112	CCDS3218.1, CCDS46959.1	3q26.31	2012-08-08			ENSG00000121853	ENSG00000121853		"""GPCR / Class A : Ghrelin receptors"""	4267	protein-coding gene	gene with protein product		601898				8688086	Standard	NM_198407		Approved		uc003fib.2	Q92847	OTTHUMG00000156946	ENST00000241256.2:c.60C>T	3.37:g.172166144G>A		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	14	12	NM_198407	0	0	0	0	0	Q14D12|Q6ISR8|Q92848|Q96RJ7	Silent	SNP	ENST00000241256.2	37	CCDS3218.1																																																																																			G|0.960;A|0.040		0.687	GHSR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346728.1	NM_004122	
HTR3D	200909	broad.mit.edu	37	3	183753777	183753777	+	Missense_Mutation	SNP	G	G	A	rs36092077	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr3:183753777G>A	ENST00000382489.3	+	3	269	c.269G>A	c.(268-270)cGg>cAg	p.R90Q	HTR3D_ENST00000453435.1_Intron|HTR3D_ENST00000428798.2_Intron|HTR3D_ENST00000334128.2_Intron	NM_001163646.1	NP_001157118.1	Q70Z44	5HT3D_HUMAN	5-hydroxytryptamine (serotonin) receptor 3D, ionotropic	90					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	extracellular ligand-gated ion channel activity (GO:0005230)			large_intestine(3)|lung(3)|prostate(1)|skin(1)|stomach(2)	10	all_cancers(143;2.33e-10)|Ovarian(172;0.0303)		Epithelial(37;6.23e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)		Ergoloid mesylate(DB01049)	caccatgcccggccTTGGCAC	0.537													g|||	1198	0.239217	0.1838	0.2579	5008	,	,		18463	0.4345		0.1819	False		,,,				2504	0.1585				p.R90Q		.											.	HTR3D-90	0			c.G269A						.		,GLN/ARG,	245,1139		19,207,466	29.0	27.0	28.0		,269,	-1.2	0.0	3	dbSNP_126	28	585,2597		64,457,1070	yes	intron,missense,intron	HTR3D	NM_001145143.1,NM_001163646.1,NM_182537.2	,43,	83,664,1536	AA,AG,GG		18.3847,17.7023,18.1778	,benign,	,90/455,	183753777	830,3736	692	1591	2283	SO:0001583	missense	200909	exon3			ATGCCCGGCCTTG	AY159812	CCDS3249.1, CCDS46966.1, CCDS54685.1	3q27	2012-05-22	2012-02-03		ENSG00000186090	ENSG00000186090		"""5-HT (serotonin) receptors"", ""Ligand-gated ion channels / 5-HT (serotonin) receptors, ionotropic"""	24004	protein-coding gene	gene with protein product		610122	"""5-hydroxytryptamine (serotonin) receptor 3 family member D"""			12801637	Standard	NM_001145143		Approved		uc011bqv.2	Q70Z44	OTTHUMG00000156858	ENST00000382489.3:c.269G>A	3.37:g.183753777G>A	ENSP00000371929:p.Arg90Gln	Somatic	94	0		WXS	Illumina GAIIx	Phase_I	93	3	NM_001163646	0	0	0	0	0	C9J2I6|J3QT78|Q495N5|Q495N6|Q7Z6B3	Missense_Mutation	SNP	ENST00000382489.3	37	CCDS54685.1	516	0.23626373626373626	78	0.15853658536585366	66	0.18232044198895028	227	0.3968531468531469	145	0.19129287598944592	g	0.024	-1.388639	0.01185	0.177023	0.183847	ENSG00000186090	ENST00000382489	T	0.74842	-0.88	1.41	-1.24	0.09435	Neurotransmitter-gated ion-channel ligand-binding (3);	738.728000	0.00166	N	0.000002	T	0.00012	0.0000	N	0.04508	-0.205	0.51767	P	6.300000000003525E-5	B	0.13594	0.008	B	0.14023	0.01	T	0.13764	-1.0497	9	0.13108	T	0.6	.	3.949	0.09361	0.6575:0.0:0.3425:0.0	rs36092077	90	Q70Z44	5HT3D_HUMAN	Q	90	ENSP00000371929:R90Q	ENSP00000371929:R90Q	R	+	2	0	HTR3D	185236471	0.157000	0.22836	0.009000	0.14445	0.014000	0.08584	1.118000	0.31246	-0.277000	0.09193	-0.224000	0.12420	CGG	G|0.763;A|0.237		0.537	HTR3D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000346289.1	NM_182537	
IDUA	3425	broad.mit.edu	37	4	996204	996204	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr4:996204A>C	ENST00000247933.4	+	8	1208	c.1120A>C	c.(1120-1122)Acc>Ccc	p.T374P	IDUA_ENST00000514224.1_Missense_Mutation_p.T242P|IDUA_ENST00000453894.1_Missense_Mutation_p.T396P	NM_000203.3	NP_000194.2	P35475	IDUA_HUMAN	iduronidase, alpha-L-	374					carbohydrate metabolic process (GO:0005975)|cell morphogenesis (GO:0000902)|chemical homeostasis (GO:0048878)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate catabolic process (GO:0030209)|disaccharide metabolic process (GO:0005984)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|limb morphogenesis (GO:0035108)|lysosome organization (GO:0007040)|skeletal system morphogenesis (GO:0048705)|small molecule metabolic process (GO:0044281)	coated vesicle (GO:0030135)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	L-iduronidase activity (GO:0003940)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	12			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			GGTCAACAACACCCGCCCGCC	0.711																																					p.T374P		.											.	IDUA-91	0			c.A1120C						.						26.0	28.0	27.0					4																	996204		2185	4282	6467	SO:0001583	missense	3425	exon8			AACAACACCCGCC	M74715	CCDS3343.1	4p16.3	2012-10-02			ENSG00000127415	ENSG00000127415	3.2.1.76		5391	protein-coding gene	gene with protein product		252800				1832239	Standard	NM_000203		Approved	MPS1	uc003gby.3	P35475	OTTHUMG00000088901	ENST00000247933.4:c.1120A>C	4.37:g.996204A>C	ENSP00000247933:p.Thr374Pro	Somatic	55	6		WXS	Illumina GAIIx	Phase_I	272	74	NM_000203	0	0	1	3	2	B3KWK6	Missense_Mutation	SNP	ENST00000247933.4	37	CCDS3343.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.117066	0.77323	.	.	ENSG00000127415	ENST00000247933;ENST00000453894;ENST00000514224	D;D;D	0.94280	-3.39;-3.39;-3.39	5.31	5.31	0.75309	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.156849	0.56097	D	0.000026	D	0.96611	0.8894	M	0.86178	2.8	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.995	D	0.96508	0.9376	10	0.46703	T	0.11	-7.29	13.2474	0.60029	1.0:0.0:0.0:0.0	.	396;374	B3KWK6;P35475	.;IDUA_HUMAN	P	374;396;242	ENSP00000247933:T374P;ENSP00000396458:T396P;ENSP00000425081:T242P	ENSP00000247933:T374P	T	+	1	0	IDUA	986204	1.000000	0.71417	0.995000	0.50966	0.426000	0.31534	5.967000	0.70403	2.024000	0.59613	0.454000	0.30748	ACC	.		0.711	IDUA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000201812.1	NM_000203	
CRIPAK	285464	hgsc.bcm.edu	37	4	1388755	1388755	+	Silent	SNP	C	C	G	rs373946226	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr4:1388755C>G	ENST00000324803.4	+	1	3416	c.456C>G	c.(454-456)ccC>ccG	p.P152P		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	152					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			CACACGTGCCCATGCGGAGTG	0.697													N|||	566	0.113019	0.0772	0.1657	5008	,	,		16075	0.0139		0.1441	False		,,,				2504	0.1943				p.P152P		.											.	CRIPAK-90	0			c.C456G						.						75.0	67.0	69.0					4																	1388755		2201	4282	6483	SO:0001819	synonymous_variant	285464	exon1			CGTGCCCATGCGG	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.456C>G	4.37:g.1388755C>G		Somatic	4	0		WXS	Illumina GAIIx	Phase_I	110	10	NM_175918	0	0	15	41	26	Q8NB03	Silent	SNP	ENST00000324803.4	37	CCDS3349.1	.	.	.	.	.	.	.	.	.	.	-	3.606	-0.080629	0.07141	.	.	ENSG00000179979	ENST00000382944	.	.	.	0.948	-1.9	0.07665	.	.	.	.	.	T	0.13713	0.0332	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.26643	-1.0097	5	0.12430	T	0.62	.	2.6602	0.05024	0.0:0.3324:0.2607:0.407	.	.	.	.	D	136	.	ENSP00000372402:H136D	H	+	1	0	CRIPAK	1378755	0.000000	0.05858	0.001000	0.08648	0.018000	0.09664	-4.277000	0.00261	-0.599000	0.05798	-1.737000	0.00689	CAT	C|0.960;G|0.040		0.697	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
FAM184B	27146	hgsc.bcm.edu	37	4	17643848	17643848	+	Missense_Mutation	SNP	G	G	A	rs2286771	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr4:17643848G>A	ENST00000265018.3	-	13	2562	c.2350C>T	c.(2350-2352)Cgg>Tgg	p.R784W		NM_015688.1	NP_056503.1	Q9ULE4	F184B_HUMAN	family with sequence similarity 184, member B	784				R -> W (in Ref. 1; BAA86590). {ECO:0000305}.						NS(1)|central_nervous_system(1)|endometrium(1)|prostate(1)	4						GGGCCGCCCCGCTCCTGAGGA	0.701													G|||	2697	0.538538	0.1725	0.6599	5008	,	,		10215	0.8522		0.6233	False		,,,				2504	0.5368				p.R784W		.											.	FAM184B-23	0			c.C2350T						.						1.0	2.0	2.0					4																	17643848		374	1044	1418	SO:0001583	missense	27146	exon13			CGCCCCGCTCCTG		CCDS47033.1	4p16	2009-04-22			ENSG00000047662	ENSG00000047662			29235	protein-coding gene	gene with protein product						10574462	Standard	NM_015688		Approved	KIAA1276	uc003gpm.4	Q9ULE4	OTTHUMG00000160287	ENST00000265018.3:c.2350C>T	4.37:g.17643848G>A	ENSP00000265018:p.Arg784Trp	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_015688	0	0	0	0	0		Missense_Mutation	SNP	ENST00000265018.3	37	CCDS47033.1	1272	0.5824175824175825	75	0.1524390243902439	232	0.6408839779005525	493	0.8618881118881119	472	0.6226912928759895	G	13.83	2.354233	0.41700	.	.	ENSG00000047662	ENST00000265018	T	0.34072	1.38	3.29	-3.67	0.04476	.	3.541600	0.00901	N	0.002342	T	0.00012	0.0000	N	0.14661	0.345	0.80722	P	0.0	D	0.56968	0.978	B	0.40741	0.339	T	0.48547	-0.9026	9	0.72032	D	0.01	2.0681	6.7491	0.23477	0.107:0.2547:0.5506:0.0877	rs2286771;rs58699512;rs2286771	784	Q9ULE4	F184B_HUMAN	W	784	ENSP00000265018:R784W	ENSP00000265018:R784W	R	-	1	2	FAM184B	17252946	0.000000	0.05858	0.000000	0.03702	0.516000	0.34256	-0.323000	0.07997	-1.014000	0.03379	-0.369000	0.07265	CGG	G|0.440;A|0.560		0.701	FAM184B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360137.1	NM_015688	
NSUN7	79730	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	40810424	40810426	+	In_Frame_Del	DEL	AGA	AGA	-			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	AGA	AGA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr4:40810424_40810426delAGA	ENST00000381782.2	+	12	2120_2122	c.1625_1627delAGA	c.(1624-1629)gagaag>gag	p.K547del	NSUN7_ENST00000316607.5_3'UTR	NM_024677.4	NP_078953	Q8NE18	NSUN7_HUMAN	NOP2/Sun domain family, member 7	547							methyltransferase activity (GO:0008168)|RNA binding (GO:0003723)			NS(1)|autonomic_ganglia(1)|cervix(1)|large_intestine(1)|lung(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	12						TCAAAACGGGAGAAGAAGAAGAA	0.438																																					p.542_543del		.											.	NSUN7-90	0			c.1625_1627del						.			1,16,4249		0,0,1,7,2,2123						5.1	1.0			85	4,22,8228		0,0,4,11,0,4112	no	codingComplex	NSUN7	NM_024677.4		0,0,5,18,2,6235	A1A1,A1A2,A1R,A2A2,A2R,RR		0.315,0.3985,0.3435				5,38,12477				SO:0001651	inframe_deletion	79730	exon12			AACGGGAGAAGAA	BC036568	CCDS3461.2	4p14	2013-10-11	2009-11-23		ENSG00000179299	ENSG00000179299		"""NOP2/Sun domain containing"""	25857	protein-coding gene	gene with protein product			"""NOL1/NOP2/Sun domain family, member 7"""			17442852	Standard	NM_024677		Approved	FLJ14001	uc003gvj.4	Q8NE18	OTTHUMG00000128597	ENST00000381782.2:c.1625_1627delAGA	4.37:g.40810433_40810435delAGA	ENSP00000371201:p.Lys547del	Somatic	150	0		WXS	Illumina GAIIx	Phase_I	120	25	NM_024677	0	0	0	0	0	C9JI19|Q8N9K8|Q9H815	In_Frame_Del	DEL	ENST00000381782.2	37	CCDS3461.2																																																																																			.		0.438	NSUN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250454.2	NM_024677	
EPHA5	2044	bcgsc.ca	37	4	66197804	66197804	+	Silent	SNP	C	C	T	rs7349683	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr4:66197804C>T	ENST00000273854.3	-	17	3495	c.2895G>A	c.(2893-2895)ggG>ggA	p.G965G	EPHA5_ENST00000511294.1_Silent_p.G966G|EPHA5_ENST00000432638.2_Silent_p.G802G|EPHA5_ENST00000354839.4_Silent_p.G943G	NM_001281765.1|NM_004439.5	NP_001268694.1|NP_004430.4	P54756	EPHA5_HUMAN	EPH receptor A5	965	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				axon guidance (GO:0007411)|cAMP-mediated signaling (GO:0019933)|ephrin receptor signaling pathway (GO:0048013)|hippocampus development (GO:0021766)|negative regulation of synapse assembly (GO:0051964)|neuron development (GO:0048666)|positive regulation of CREB transcription factor activity (GO:0032793)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of Rac GTPase activity (GO:0032314)	dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|GPI-linked ephrin receptor activity (GO:0005004)|transmembrane-ephrin receptor activity (GO:0005005)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(25)|liver(1)|lung(76)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	142						ATCTGTAGGCCCCAGATCCTA	0.368										TSP Lung(17;0.13)			C|||	1636	0.326677	0.0893	0.3098	5008	,	,		15856	0.4613		0.3748	False		,,,				2504	0.4714				p.G965G		.											.	EPHA5-1430	0			c.G2895A						.	C	,	607,3799	264.1+/-265.8	44,519,1640	75.0	69.0	71.0		2895,2829	3.7	1.0	4	dbSNP_116	71	3073,5527	471.0+/-368.0	550,1973,1777	no	coding-synonymous,coding-synonymous	EPHA5	NM_004439.5,NM_182472.2	,	594,2492,3417	TT,TC,CC		35.7326,13.7767,28.2946	,	965/1038,943/1016	66197804	3680,9326	2203	4300	6503	SO:0001819	synonymous_variant	2044	exon17			GTAGGCCCCAGAT	L36644	CCDS3513.1, CCDS3514.1, CCDS75131.1, CCDS75132.1, CCDS75133.1	4q13.1	2013-02-11	2004-10-28		ENSG00000145242	ENSG00000145242		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3389	protein-coding gene	gene with protein product		600004	"""EphA5"""			9267020, 7528718	Standard	NM_004439		Approved	Hek7, TYRO4, CEK7, EHK1	uc003hcy.3	P54756	OTTHUMG00000129273	ENST00000273854.3:c.2895G>A	4.37:g.66197804C>T		Somatic	44	0		WXS	Illumina GAIIx	Phase_I	46	4	NM_004439	0	0	0	0	0	Q7Z3F2	Silent	SNP	ENST00000273854.3	37	CCDS3513.1																																																																																			C|0.704;T|0.296		0.368	EPHA5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251388.2	NM_004439	
ART3	419	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	77033649	77033649	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr4:77033649A>G	ENST00000355810.4	+	12	1266	c.1147A>G	c.(1147-1149)Ata>Gta	p.I383V	ART3_ENST00000341029.5_Missense_Mutation_p.I361V|ART3_ENST00000349321.3_Missense_Mutation_p.I372V	NM_001130016.2	NP_001123488.1	Q13508	NAR3_HUMAN	ADP-ribosyltransferase 3	383					protein ADP-ribosylation (GO:0006471)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	NAD(P)+-protein-arginine ADP-ribosyltransferase activity (GO:0003956)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|stomach(1)	16			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			TGTTTCTGCTATAAATCTCTT	0.398																																					p.I383V		.											.	ART3-92	0			c.A1147G						.						254.0	222.0	233.0					4																	77033649		2203	4300	6503	SO:0001583	missense	419	exon12			TCTGCTATAAATC	X95827	CCDS3575.1, CCDS47079.1, CCDS47080.1	4q21.1	2008-05-15			ENSG00000156219	ENSG00000156219			725	protein-coding gene	gene with protein product		603086				9119374	Standard	NM_001130017		Approved		uc003hjo.3	Q13508	OTTHUMG00000130110	ENST00000355810.4:c.1147A>G	4.37:g.77033649A>G	ENSP00000348064:p.Ile383Val	Somatic	39	0		WXS	Illumina GAIIx	Phase_I	44	4	NM_001130016	0	0	0	0	0	Q53XW3|Q6FHT7|Q8WVJ7|Q93069|Q96HL1	Missense_Mutation	SNP	ENST00000355810.4	37	CCDS47079.1	.	.	.	.	.	.	.	.	.	.	A	0	-2.846117	0.00067	.	.	ENSG00000156219	ENST00000341029;ENST00000355810;ENST00000349321	T;T;T	0.05580	3.43;3.47;3.42	5.43	-10.9	0.00192	.	6.223750	0.00166	N	0.000012	T	0.01940	0.0061	N	0.04203	-0.255	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.0;0.0;0.001;0.001	T	0.35574	-0.9783	10	0.02654	T	1	-16.5947	4.0577	0.09824	0.1134:0.3768:0.3591:0.1507	.	332;383;372;361	D6RBN3;Q13508;Q13508-3;Q13508-2	.;NAR3_HUMAN;.;.	V	361;383;372	ENSP00000343843:I361V;ENSP00000348064:I383V;ENSP00000304313:I372V	ENSP00000343843:I361V	I	+	1	0	ART3	77252673	0.000000	0.05858	0.000000	0.03702	0.126000	0.20510	-3.230000	0.00548	-2.992000	0.00279	-1.542000	0.00909	ATA	.		0.398	ART3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252416.2	NM_001179	
COQ2	27235	bcgsc.ca	37	4	84191031	84191031	+	Silent	SNP	A	A	G	rs6535454	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr4:84191031A>G	ENST00000311469.4	-	5	893	c.894T>C	c.(892-894)gaT>gaC	p.D298D	COQ2_ENST00000439031.2_Silent_p.D261D|COQ2_ENST00000311461.7_Silent_p.D248D	NM_015697.7	NP_056512.5	Q96H96	COQ2_HUMAN	coenzyme Q2 4-hydroxybenzoate polyprenyltransferase	248					cell death (GO:0008219)|glycerol metabolic process (GO:0006071)|isoprenoid biosynthetic process (GO:0008299)|small molecule metabolic process (GO:0044281)|ubiquinone biosynthetic process (GO:0006744)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	4-hydroxybenzoate decaprenyltransferase activity (GO:0002083)|4-hydroxybenzoate nonaprenyltransferase activity (GO:0047293)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|ovary(1)|skin(1)|stomach(1)	8		Hepatocellular(203;0.114)				CATAAATAGTATCATATATTA	0.358													A|||	3897	0.778155	0.8283	0.6801	5008	,	,		17970	0.871		0.7435	False		,,,				2504	0.7198				p.D298D		.											.	COQ2-92	0			c.T894C						.	A		2965,677		1212,541,68	59.0	53.0	55.0		894	-0.3	1.0	4	dbSNP_116	55	5749,2435		2031,1687,374	no	coding-synonymous	COQ2	NM_015697.7		3243,2228,442	GG,GA,AA		29.7532,18.5887,26.3149		298/422	84191031	8714,3112	1821	4092	5913	SO:0001819	synonymous_variant	27235	exon5			AATAGTATCATAT		CCDS47090.1, CCDS47090.2	4q21.23	2013-05-23	2013-05-23				2.5.1.39		25223	protein-coding gene	gene with protein product	"""4-hydroxybenzoate polyprenyltransferase"""	609825	"""coenzyme Q2 homolog, prenyltransferase (yeast)"""			15153069, 17332895	Standard	NM_015697		Approved	CL640, FLJ26072	uc003hog.3	Q96H96		ENST00000311469.4:c.894T>C	4.37:g.84191031A>G		Somatic	145	1		WXS	Illumina GAIIx	Phase_I	115	7	NM_015697	0	0	32	32	0	O95331|Q1JQ78|Q684R2	Silent	SNP	ENST00000311469.4	37	CCDS47090.2																																																																																			A|0.215;G|0.785		0.358	COQ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363027.3	NM_015697	
ENPEP	2028	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	111409785	111409785	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr4:111409785A>G	ENST00000265162.5	+	2	1075	c.733A>G	c.(733-735)Ata>Gta	p.I245V		NM_001977.3	NP_001968.3	Q07075	AMPE_HUMAN	glutamyl aminopeptidase (aminopeptidase A)	245					angiogenesis (GO:0001525)|angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|glomerulus development (GO:0032835)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|brush border (GO:0005903)|cytoplasmic vesicle (GO:0031410)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metalloaminopeptidase activity (GO:0070006)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(22)|ovary(1)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(1)	54		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.0031)		AACTTATACAATATCTATCAC	0.388																																					p.I245V		.											.	ENPEP-157	0			c.A733G						.						105.0	101.0	102.0					4																	111409785		2203	4300	6503	SO:0001583	missense	2028	exon2			TATACAATATCTA	L12468	CCDS3691.1	4q25	2008-02-05			ENSG00000138792	ENSG00000138792	3.4.11.7	"""CD molecules"""	3355	protein-coding gene	gene with protein product		138297				9268642	Standard	NM_001977		Approved	gp160, CD249	uc003iab.4	Q07075	OTTHUMG00000132546	ENST00000265162.5:c.733A>G	4.37:g.111409785A>G	ENSP00000265162:p.Ile245Val	Somatic	52	0		WXS	Illumina GAIIx	Phase_I	74	15	NM_001977	0	0	5	5	0	Q504U2	Missense_Mutation	SNP	ENST00000265162.5	37	CCDS3691.1	.	.	.	.	.	.	.	.	.	.	A	18.45	3.627466	0.66901	.	.	ENSG00000138792	ENST00000265162	T	0.04049	3.72	4.9	3.71	0.42584	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	0.044023	0.85682	D	0.000000	T	0.14141	0.0342	L	0.56769	1.78	0.58432	D	0.999998	D	0.67145	0.996	D	0.67900	0.954	T	0.01169	-1.1430	10	0.35671	T	0.21	.	10.4264	0.44380	0.9223:0.0:0.0777:0.0	.	245	Q07075	AMPE_HUMAN	V	245	ENSP00000265162:I245V	ENSP00000265162:I245V	I	+	1	0	ENPEP	111629234	1.000000	0.71417	0.041000	0.18516	0.970000	0.65996	6.001000	0.70685	0.725000	0.32318	0.460000	0.39030	ATA	.		0.388	ENPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255747.2		
TDO2	6999	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	156830150	156830150	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr4:156830150G>C	ENST00000536354.2	+	5	479	c.415G>C	c.(415-417)Gac>Cac	p.D139H		NM_005651.3	NP_005642.1			tryptophan 2,3-dioxygenase											breast(3)|endometrium(1)|large_intestine(4)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	18	all_hematologic(180;0.24)	Renal(120;0.0854)		KIRC - Kidney renal clear cell carcinoma(143;0.0455)|Kidney(143;0.0568)|COAD - Colon adenocarcinoma(41;0.141)		GACAGCCTTGGACTTCAATGA	0.428																																					p.D139H	Colon(57;928 1036 2595 6946 26094)	.											.	TDO2-514	0			c.G415C						.						87.0	76.0	80.0					4																	156830150		2203	4300	6503	SO:0001583	missense	6999	exon5			GCCTTGGACTTCA		CCDS34086.1	4q31-q32	2008-02-05				ENSG00000151790	1.13.11.11		11708	protein-coding gene	gene with protein product		191070					Standard	NM_005651		Approved	TDO, TPH2	uc003ipf.2	P48775		ENST00000536354.2:c.415G>C	4.37:g.156830150G>C	ENSP00000444788:p.Asp139His	Somatic	39	0		WXS	Illumina GAIIx	Phase_I	58	23	NM_005651	0	0	0	1	1		Missense_Mutation	SNP	ENST00000536354.2	37	CCDS34086.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.461081	0.84317	.	.	ENSG00000151790	ENST00000506072;ENST00000507590;ENST00000536354	.	.	.	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	D	0.84047	0.5386	M	0.89163	3.01	0.80722	D	1	P	0.47604	0.898	P	0.59221	0.854	D	0.86181	0.1606	9	0.87932	D	0	-34.3508	19.9103	0.97024	0.0:0.0:1.0:0.0	.	139	P48775	T23O_HUMAN	H	32;32;139	.	ENSP00000281525:D139H	D	+	1	0	TDO2	157049600	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	9.384000	0.97219	2.765000	0.95021	0.650000	0.86243	GAC	.		0.428	TDO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366209.3	NM_005651	
FRG1	2483	bcgsc.ca	37	4	190878626	190878626	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr4:190878626G>A	ENST00000226798.4	+	6	728	c.506G>A	c.(505-507)aGt>aAt	p.S169N	FRG1_ENST00000514482.1_3'UTR	NM_004477.2	NP_004468.1	Q14331	FRG1_HUMAN	FSHD region gene 1	169					mRNA splicing, via spliceosome (GO:0000398)|muscle organ development (GO:0007517)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.S169N(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|lung(11)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|urinary_tract(1)	32		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		GAAGCAAAAAGTAAAACAGCA	0.363																																					p.S169N		.											.	FRG1-90	1	Substitution - Missense(1)	skin(1)	c.G506A						.						49.0	46.0	47.0					4																	190878626		2184	4282	6466	SO:0001583	missense	2483	exon6			CAAAAAGTAAAAC	L76159	CCDS34121.1	4q35	2008-02-05			ENSG00000109536	ENSG00000109536			3954	protein-coding gene	gene with protein product		601278				8733123	Standard	XM_005262880		Approved	FSG1, FRG1A	uc003izs.3	Q14331	OTTHUMG00000160202	ENST00000226798.4:c.506G>A	4.37:g.190878626G>A	ENSP00000226798:p.Ser169Asn	Somatic	671	12		WXS	Illumina GAIIx	Phase_I	1070	24	NM_004477	0	1	191	193	1	A8K775	Missense_Mutation	SNP	ENST00000226798.4	37	CCDS34121.1	.	.	.	.	.	.	.	.	.	.	.	14.80	2.642895	0.47153	.	.	ENSG00000109536	ENST00000226798;ENST00000524583;ENST00000531991	T;T	0.48522	1.77;0.81	4.19	2.41	0.29592	Actin cross-linking (1);	0.160510	0.64402	N	0.000002	T	0.36552	0.0971	N	0.17723	0.515	0.45777	D	0.998661	P	0.35982	0.531	P	0.45406	0.479	T	0.07578	-1.0765	10	0.30854	T	0.27	0.1847	7.6816	0.28518	0.219:0.0:0.781:0.0	.	169	Q14331	FRG1_HUMAN	N	169;41;106	ENSP00000226798:S169N;ENSP00000435943:S106N	ENSP00000226798:S169N	S	+	2	0	FRG1	191115620	1.000000	0.71417	1.000000	0.80357	0.849000	0.48306	1.784000	0.38674	0.340000	0.23745	0.454000	0.30748	AGT	G|0.500;A|0.500		0.363	FRG1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000359622.4	NM_004477	
IRX4	50805	hgsc.bcm.edu	37	5	1882129	1882129	+	Silent	SNP	T	T	G	rs2232374	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr5:1882129T>G	ENST00000505790.1	-	3	546	c.90A>C	c.(88-90)ggA>ggC	p.G30G	CTD-2194D22.3_ENST00000506335.1_RNA|IRX4_ENST00000505938.1_5'Flank|IRX4_ENST00000231357.2_Silent_p.G30G|IRX4_ENST00000513692.1_Silent_p.G30G	NM_001278634.1	NP_001265563.1	P78413	IRX4_HUMAN	iroquois homeobox 4	30					establishment of organ orientation (GO:0048561)|heart development (GO:0007507)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|lung(7)|ovary(1)|prostate(1)	10				GBM - Glioblastoma multiforme(108;0.242)		GCGTGCGGCCTCCGGACTCGC	0.741													N|||	1389	0.277356	0.2821	0.3141	5008	,	,		10764	0.3313		0.2177	False		,,,				2504	0.2505				p.G30G		.											.	IRX4-226	0			c.A90C						.			440,2456		29,382,1037	2.0	2.0	2.0		90	-2.3	0.0	5	dbSNP_98	2	967,5425		81,805,2310	no	coding-synonymous	IRX4	NM_016358.2		110,1187,3347	GG,GT,TT		15.1283,15.1934,15.1486		30/520	1882129	1407,7881	1448	3196	4644	SO:0001819	synonymous_variant	50805	exon2			GCGGCCTCCGGAC	AF124733	CCDS3867.1, CCDS75225.1	5p15.33	2011-06-20	2007-07-13		ENSG00000113430	ENSG00000113430		"""Homeoboxes / TALE class"""	6129	protein-coding gene	gene with protein product		606199	"""iroquois homeobox protein 4"""			10625552	Standard	NM_016358		Approved		uc003jcz.2	P78413	OTTHUMG00000090411	ENST00000505790.1:c.90A>C	5.37:g.1882129T>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_016358	0	0	0	0	0	B2RMW5|D3DTC5|H1AFL0|H1AFL1|Q2NL64|Q9UHR2	Silent	SNP	ENST00000505790.1	37	CCDS3867.1																																																																																			T|0.735;G|0.265		0.741	IRX4-004	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365500.1	NM_016358	
MROH2B	133558	bcgsc.ca	37	5	41061715	41061715	+	Nonsense_Mutation	SNP	C	C	T	rs1023840|rs386687544	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr5:41061715C>T	ENST00000399564.4	-	6	1022	c.572G>A	c.(571-573)tGg>tAg	p.W191*		NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	191			W -> R (in dbSNP:rs865093). {ECO:0000269|PubMed:15489334}.														CATTATATACCAGAACAGCAT	0.488													C|||	1043	0.208267	0.025	0.3329	5008	,	,		17005	0.2996		0.1819	False		,,,				2504	0.3006				p.W191X		.											.	.	0			c.G572A						.	C	stop/TRP	210,3656		2,206,1725	175.0	168.0	170.0		572	2.9	1.0	5	dbSNP_86	170	1643,6603		176,1291,2656	yes	stop-gained	HEATR7B2	NM_173489.4		178,1497,4381	TT,TC,CC		19.9248,5.432,15.2989		191/1586	41061715	1853,10259	1933	4123	6056	SO:0001587	stop_gained	133558	exon6			ATATACCAGAACA		CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.572G>A	5.37:g.41061715C>T	ENSP00000382476:p.Trp191*	Somatic	89	1		WXS	Illumina GAIIx	Phase_I	102	5	NM_173489	0	0	0	0	0	Q68DM1|Q7Z4U4|Q8N7X3	Nonsense_Mutation	SNP	ENST00000399564.4	37	CCDS47202.1	337	0.1543040293040293	10	0.02032520325203252	97	0.26795580110497236	142	0.24825174825174826	88	0.11609498680738786	C	40	8.282932	0.98742	0.05432	0.199248	ENSG00000171495	ENST00000399564	.	.	.	5.81	2.91	0.33838	.	0.249672	0.28257	N	0.016016	.	.	.	.	.	.	0.09310	P	1.0	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	6.9332	0.24453	0.0:0.6857:0.0:0.3143	rs1023840;rs60925153;rs1023840	.	.	.	X	191	.	ENSP00000382476:W191X	W	-	2	0	HEATR7B2	41097472	0.586000	0.26782	0.992000	0.48379	0.991000	0.79684	-0.147000	0.10234	0.299000	0.22661	0.655000	0.94253	TGG	C|0.822;T|0.178		0.488	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367558.2	NM_173489	
PDE4D	5144	ucsc.edu	37	5	58284356	58284356	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr5:58284356G>T	ENST00000340635.6	-	11	1691	c.1516C>A	c.(1516-1518)Cat>Aat	p.H506N	PDE4D_ENST00000317118.8_Missense_Mutation_p.H215N|PDE4D_ENST00000546160.1_Missense_Mutation_p.H445N|PDE4D_ENST00000360047.5_Missense_Mutation_p.H370N|PDE4D_ENST00000503258.1_Missense_Mutation_p.H376N|PDE4D_ENST00000502484.2_Missense_Mutation_p.H445N|PDE4D_ENST00000507116.1_Missense_Mutation_p.H442N|PDE4D_ENST00000358923.6_Missense_Mutation_p.H204N|PDE4D_ENST00000405755.2_Missense_Mutation_p.H384N	NM_001104631.1	NP_001098101.1	Q08499	PDE4D_HUMAN	phosphodiesterase 4D, cAMP-specific	506					adrenergic receptor signaling pathway (GO:0071875)|adrenergic receptor signaling pathway involved in positive regulation of heart rate (GO:0086024)|aging (GO:0007568)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to lipopolysaccharide (GO:0071222)|establishment of endothelial barrier (GO:0061028)|multicellular organism growth (GO:0035264)|negative regulation of heart contraction (GO:0045822)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of relaxation of cardiac muscle (GO:1901898)|neutrophil chemotaxis (GO:0030593)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-5 production (GO:0032754)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of receptor activity (GO:0010469)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|smooth muscle contraction (GO:0006939)|T cell receptor signaling pathway (GO:0050852)	calcium channel complex (GO:0034704)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|ATPase binding (GO:0051117)|beta-2 adrenergic receptor binding (GO:0031698)|cAMP binding (GO:0030552)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(8)|pancreas(1)	15		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Caffeine(DB00201)|Dyphylline(DB00651)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Roflumilast(DB01656)	ACACCAGGATGATCTACATCA	0.328																																					p.H506N		.											.	PDE4D-226	0			c.C1516A						.						45.0	42.0	43.0					5																	58284356		1812	4035	5847	SO:0001583	missense	5144	exon11			CAGGATGATCTAC		CCDS47213.1, CCDS54858.1, CCDS54859.1, CCDS56369.1, CCDS56370.1, CCDS56371.1, CCDS56372.1, CCDS56373.1	5q12	2010-06-24	2010-06-24				3.1.4.17	"""Phosphodiesterases"""	8783	protein-coding gene	gene with protein product	"""phosphodiesterase E3 dunce homolog (Drosophila)"""	600129	"""phosphodiesterase 4D, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E3)"""	DPDE3			Standard	NM_006203		Approved		uc003jsa.2	Q08499		ENST00000340635.6:c.1516C>A	5.37:g.58284356G>T	ENSP00000345502:p.His506Asn	Somatic	32	0		WXS	Illumina GAIIx	Phase_I	51	4	NM_001104631	0	0	0	0	0	O43433|Q13549|Q13550|Q13551|Q7Z2L8|Q8IV84|Q8IVA9|Q8IVD2|Q8IVD3|Q96HL4|Q9HCX7	Missense_Mutation	SNP	ENST00000340635.6	37	CCDS47213.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.468362	0.84533	.	.	ENSG00000113448	ENST00000340635;ENST00000356665;ENST00000360047;ENST00000507116;ENST00000358923;ENST00000317118;ENST00000503258;ENST00000405755;ENST00000502484;ENST00000546160;ENST00000505453	D;D;D;D;D;D;D;D;D;D	0.89415	-2.51;-2.51;-2.51;-2.51;-2.51;-2.51;-2.51;-2.51;-2.51;-2.51	4.64	4.64	0.57946	Metal-dependent phosphohydrolase, HD domain (1);-cyclic nucleotide phosphodiesterase, conserved site (1);5&apos (3);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (3);	0.000000	0.85682	D	0.000000	D	0.97259	0.9104	H	0.99590	4.645	0.58432	D	0.999999	D;D;D;D;D;D;D;D	0.89917	0.976;0.981;0.976;1.0;1.0;0.976;1.0;1.0	D;D;D;D;D;D;D;D	0.97110	0.973;0.989;0.973;1.0;1.0;0.973;0.998;0.998	D	0.99133	1.0853	10	0.87932	D	0	.	18.0553	0.89362	0.0:0.0:1.0:0.0	.	445;506;442;369;384;376;281;215	Q08499-11;Q08499;Q08499-6;Q08499-2;Q08499-9;Q08499-10;Q08499-4;Q08499-8	.;PDE4D_HUMAN;.;.;.;.;.;.	N	506;375;370;442;204;215;376;384;445;445;204	ENSP00000345502:H506N;ENSP00000353152:H370N;ENSP00000424852:H442N;ENSP00000351800:H204N;ENSP00000321739:H215N;ENSP00000425605:H376N;ENSP00000384806:H384N;ENSP00000423094:H445N;ENSP00000442734:H445N;ENSP00000421013:H204N	ENSP00000321739:H215N	H	-	1	0	PDE4D	58320113	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.601000	0.98297	2.567000	0.86603	0.563000	0.77884	CAT	.		0.328	PDE4D-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367940.3		
PDLIM4	8572	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	131607853	131607853	+	Silent	SNP	G	G	A	rs1140552		TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr5:131607853G>A	ENST00000253754.3	+	7	988	c.924G>A	c.(922-924)gcG>gcA	p.A308A	PDLIM4_ENST00000379018.3_3'UTR|P4HA2_ENST00000471826.1_Intron	NM_001131027.1|NM_003687.3	NP_001124499.1|NP_003678.2	P50479	PDLI4_HUMAN	PDZ and LIM domain 4	308	LIM zinc-binding. {ECO:0000255|PROSITE- ProRule:PRU00125}.						zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(2)|urinary_tract(1)	10			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			ACGCCAAGGCGCGCGTGAAGC	0.617																																					p.A308A		.											.	PDLIM4-91	0			c.G924A						.	G	,	1,4405	2.1+/-5.4	0,1,2202	74.0	66.0	69.0		,924	-5.5	0.6	5	dbSNP_86	69	0,8600		0,0,4300	no	utr-3,coding-synonymous	PDLIM4	NM_001131027.1,NM_003687.3	,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,	,308/331	131607853	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	8572	exon7			CAAGGCGCGCGTG	AF153882	CCDS4152.1, CCDS47261.1	5q31.1	2008-02-05			ENSG00000131435	ENSG00000131435			16501	protein-coding gene	gene with protein product		603422				9573374	Standard	NM_001131027		Approved	RIL	uc003kwn.3	P50479	OTTHUMG00000059645	ENST00000253754.3:c.924G>A	5.37:g.131607853G>A		Somatic	116	0		WXS	Illumina GAIIx	Phase_I	206	55	NM_003687	0	0	0	0	0	B2R8U1|Q53Y39|Q96AT8|Q9BTW8|Q9Y292	Silent	SNP	ENST00000253754.3	37	CCDS4152.1																																																																																			G|1.000;A|0.000		0.617	PDLIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132644.2	NM_003687	
RAD50	10111	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	131940646	131940647	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	TG	TG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr5:131940646_131940647delTG	ENST00000265335.6	+	16	3060_3061	c.2673_2674delTG	c.(2671-2676)actgtgfs	p.V892fs	RAD50_ENST00000378823.3_Frame_Shift_Del_p.V753fs			Q92878	RAD50_HUMAN	RAD50 homolog (S. cerevisiae)	892					cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of kinase activity (GO:0033674)|positive regulation of protein autophosphorylation (GO:0031954)|reciprocal meiotic recombination (GO:0007131)|regulation of mitotic recombination (GO:0000019)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	membrane (GO:0016020)|Mre11 complex (GO:0030870)|nuclear chromosome, telomeric region (GO:0000784)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)|site of double-strand break (GO:0035861)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|nuclease activity (GO:0004518)|protein binding, bridging (GO:0030674)|zinc ion binding (GO:0008270)			breast(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(10)|liver(1)|lung(8)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36		all_cancers(142;0.0368)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			AGGAGCAGACTGTGGAATTATC	0.307								Homologous recombination																													p.891_892del		.											.	RAD50-229	0			c.2673_2674del						.																																			SO:0001589	frameshift_variant	10111	exon16			GCAGACTGTGGAA	Z75311	CCDS34233.1	5q23-q31	2008-05-30	2001-11-28		ENSG00000113522	ENSG00000113522			9816	protein-coding gene	gene with protein product		604040	"""RAD50 (S. cerevisiae) homolog"""			8756642, 9705271	Standard	NM_005732		Approved	hRad50, RAD50-2	uc003kxi.3	Q92878	OTTHUMG00000059613	ENST00000265335.6:c.2673_2674delTG	5.37:g.131940648_131940649delTG	ENSP00000265335:p.Val892fs	Somatic	175	0		WXS	Illumina GAIIx	Phase_I	169	41	NM_005732	0	0	0	0	0	B9EGF5|O43254|Q6GMT7|Q6P5X3|Q9UP86	Frame_Shift_Del	DEL	ENST00000265335.6	37	CCDS34233.1																																																																																			.		0.307	RAD50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132566.5	NM_005732	
PCDHB4	56131	ucsc.edu	37	5	140503237	140503237	+	Missense_Mutation	SNP	A	A	G	rs246669	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr5:140503237A>G	ENST00000194152.1	+	1	1657	c.1657A>G	c.(1657-1659)Acc>Gcc	p.T553A	AC005754.8_ENST00000606030.1_lincRNA	NM_018938.2	NP_061761.1	Q9Y5E5	PCDB4_HUMAN	protocadherin beta 4	553	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.		T -> A (in dbSNP:rs246669).		calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	67			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGTGCTGGACACCAACGACAA	0.701													G|||	1006	0.200879	0.1581	0.2305	5008	,	,		16296	0.1964		0.2276	False		,,,				2504	0.2147				p.T553A		.											.	PCDHB4-93	0			c.A1657G						.						39.0	43.0	42.0					5																	140503237		2197	4288	6485	SO:0001583	missense	56131	exon1			CTGGACACCAACG	AF152497	CCDS4246.1	5q31	2010-01-26			ENSG00000081818	ENSG00000081818		"""Cadherins / Protocadherins : Clustered"""	8689	other	protocadherin		606330				10380929	Standard	NM_018938		Approved	PCDH-BETA4	uc003lip.1	Q9Y5E5	OTTHUMG00000129617	ENST00000194152.1:c.1657A>G	5.37:g.140503237A>G	ENSP00000194152:p.Thr553Ala	Somatic	13	0		WXS	Illumina GAIIx	Phase_I	232	131	NM_018938	0	0	4	118	114	Q4V761	Missense_Mutation	SNP	ENST00000194152.1	37	CCDS4246.1	369	0.16895604395604397	72	0.14634146341463414	72	0.19889502762430938	92	0.16083916083916083	133	0.17546174142480211	G	8.414	0.844735	0.16963	.	.	ENSG00000081818	ENST00000194152	T	0.01113	5.32	3.77	1.95	0.26073	Cadherin (4);Cadherin conserved site (1);Cadherin-like (1);	.	.	.	.	T	0.00012	0.0000	N	0.03084	-0.415	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.32508	-0.9904	8	0.07813	T	0.8	.	5.5672	0.17177	0.2653:0.1467:0.588:0.0	rs246669;rs17844415	553	Q9Y5E5	PCDB4_HUMAN	A	553	ENSP00000194152:T553A	ENSP00000194152:T553A	T	+	1	0	PCDHB4	140483421	0.000000	0.05858	0.965000	0.40720	0.981000	0.71138	-0.068000	0.11561	0.404000	0.25506	-0.330000	0.08379	ACC	G|1.000;|0.000		0.701	PCDHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251812.2	NM_018938	
RBM27	54439	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	145631438	145631438	+	Splice_Site	SNP	G	G	C			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr5:145631438G>C	ENST00000265271.5	+	9	1610	c.1444G>C	c.(1444-1446)Gat>Cat	p.D482H	RBM27_ENST00000506502.1_Intron	NM_018989.1	NP_061862.1	Q9P2N5	RBM27_HUMAN	RNA binding motif protein 27	482					mRNA processing (GO:0006397)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(1)|central_nervous_system(3)|endometrium(4)|kidney(5)|large_intestine(7)|liver(2)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	39			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TCTGGTTCCAGGTAAGCTTTG	0.532																																					p.D482H		.											.	RBM27-70	0			c.G1444C						.						228.0	210.0	216.0					5																	145631438		1568	3582	5150	SO:0001630	splice_region_variant	54439	exon9			GTTCCAGGTAAGC	AL833706	CCDS43378.1	5q32	2013-01-09				ENSG00000091009		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	29243	protein-coding gene	gene with protein product	"""acidic rich RS domain containing 1"""					10718198, 15741184	Standard	NM_018989		Approved	KIAA1311, ARRS1, Psc1, ZC3H18	uc003lnz.4	Q9P2N5		ENST00000265271.5:c.1444+1G>C	5.37:g.145631438G>C		Somatic	66	0		WXS	Illumina GAIIx	Phase_I	98	28	NM_018989	0	0	0	0	0	Q8IYW9	Missense_Mutation	SNP	ENST00000265271.5	37	CCDS43378.1	.	.	.	.	.	.	.	.	.	.	G	15.29	2.788676	0.49997	.	.	ENSG00000091009	ENST00000265271	T	0.51071	0.72	4.99	4.99	0.66335	.	0.351787	0.26300	N	0.025162	T	0.34803	0.0910	N	0.20986	0.625	0.39847	D	0.973182	B	0.02656	0.0	B	0.01281	0.0	T	0.15752	-1.0426	10	0.44086	T	0.13	-8.3295	13.6641	0.62384	0.0:0.0:1.0:0.0	.	482	Q9P2N5	RBM27_HUMAN	H	482	ENSP00000265271:D482H	ENSP00000265271:D482H	D	+	1	0	RBM27	145611631	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.235000	0.58666	2.597000	0.87782	0.655000	0.94253	GAT	.		0.532	RBM27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373420.1	XM_291128	Missense_Mutation
PPP1R3G	648791	hgsc.bcm.edu	37	6	5086070	5086070	+	Silent	SNP	A	A	G	rs667752		TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr6:5086070A>G	ENST00000405617.2	+	1	351	c.351A>G	c.(349-351)gcA>gcG	p.A117A		NM_001145115.1	NP_001138587.1	B7ZBB8	PP13G_HUMAN	protein phosphatase 1, regulatory subunit 3G	117					glucose homeostasis (GO:0042593)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of glycogen biosynthetic process (GO:0045725)	cytoplasm (GO:0005737)	glycogen binding (GO:2001069)			kidney(2)	2						CGGAGGACGCACAGCTCGGCC	0.692													G|||	5008	1.0	1.0	1.0	5008	,	,		12505	1.0		1.0	False		,,,				2504	1.0				p.A117A		.											.	PPP1R3G-136	0			c.A351G						.						1.0	2.0	2.0					6																	5086070		400	1062	1462	SO:0001819	synonymous_variant	648791	exon1			GGACGCACAGCTC		CCDS47366.1	6p25.1	2012-04-17	2011-10-04		ENSG00000219607	ENSG00000219607		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14945	protein-coding gene	gene with protein product			"""protein phosphatase 1, regulatory (inhibitor) subunit 3G"""			11948623	Standard	NM_001145115		Approved		uc011dia.1	B7ZBB8	OTTHUMG00000014172	ENST00000405617.2:c.351A>G	6.37:g.5086070A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_001145115	0	0	0	10	10		Silent	SNP	ENST00000405617.2	37	CCDS47366.1																																																																																			A|0.006;G|0.994		0.692	PPP1R3G-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039740.3	NM_001145115	
F13A1	2162	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	6175004	6175004	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr6:6175004A>G	ENST00000264870.3	-	12	1821	c.1556T>C	c.(1555-1557)gTt>gCt	p.V519A		NM_000129.3	NP_000120.2	P00488	F13A_HUMAN	coagulation factor XIII, A1 polypeptide	519					blood coagulation (GO:0007596)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	62	Ovarian(93;0.0816)	all_hematologic(90;0.152)			L-Glutamine(DB00130)	GTCCATGTCAACGTTGGACCT	0.483																																					p.V519A		.											.	F13A1-519	0			c.T1556C						.						195.0	161.0	172.0					6																	6175004		2203	4300	6503	SO:0001583	missense	2162	exon12			ATGTCAACGTTGG	M14539	CCDS4496.1	6p24.2-p23	2014-01-24			ENSG00000124491	ENSG00000124491		"""Transglutaminases"""	3531	protein-coding gene	gene with protein product		134570		F13A			Standard	NM_000129		Approved		uc003mwv.3	P00488	OTTHUMG00000014186	ENST00000264870.3:c.1556T>C	6.37:g.6175004A>G	ENSP00000264870:p.Val519Ala	Somatic	271	0		WXS	Illumina GAIIx	Phase_I	309	83	NM_000129	0	0	0	0	0	Q59HA7|Q8N6X2|Q96P24|Q9BX29	Missense_Mutation	SNP	ENST00000264870.3	37	CCDS4496.1	.	.	.	.	.	.	.	.	.	.	A	13.26	2.183259	0.38511	.	.	ENSG00000124491	ENST00000264870;ENST00000441301	D	0.81579	-1.51	5.78	4.64	0.57946	Transglutaminase, C-terminal (2);Immunoglobulin-like fold (1);	0.200613	0.44097	D	0.000495	T	0.80722	0.4677	M	0.78049	2.395	0.18873	N	0.999989	P;P	0.50710	0.894;0.938	B;P	0.56823	0.438;0.807	T	0.74904	-0.3505	10	0.72032	D	0.01	.	7.8686	0.29552	0.8478:0.0:0.1522:0.0	.	456;519	F5H080;P00488	.;F13A_HUMAN	A	519;456	ENSP00000264870:V519A	ENSP00000264870:V519A	V	-	2	0	F13A1	6120003	0.209000	0.23505	0.080000	0.20451	0.188000	0.23474	3.911000	0.56378	2.202000	0.70862	0.523000	0.50628	GTT	.		0.483	F13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039756.3	NM_000129	
TMEM14B	81853	ucsc.edu	37	6	10756728	10756728	+	Missense_Mutation	SNP	C	C	T	rs72821581	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr6:10756728C>T	ENST00000379542.5	+	6	489	c.322C>T	c.(322-324)Cgt>Tgt	p.R108C	TMEM14B_ENST00000467317.1_Intron|TMEM14B_ENST00000379530.3_Missense_Mutation_p.R74C|TMEM14B_ENST00000481240.1_Intron|SYCP2L_ENST00000543878.1_Intron|RP11-637O19.3_ENST00000480294.1_Intron|TMEM14B_ENST00000473276.1_Missense_Mutation_p.S48L|TMEM14B_ENST00000491103.1_3'UTR	NM_030969.3	NP_112231.3	Q9NUH8	TM14B_HUMAN	transmembrane protein 14B	108						integral component of membrane (GO:0016021)		p.R108C(4)		NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(2)|skin(2)	11	Ovarian(93;0.107)|Breast(50;0.137)	all_hematologic(90;0.135)				AGTTGGAGTTCGTATGTTGAT	0.358																																					p.R108C		.											.	TMEM14B-90	4	Substitution - Missense(4)	skin(2)|NS(1)|prostate(1)	c.C322T						.						162.0	139.0	147.0					6																	10756728		2203	4300	6503	SO:0001583	missense	81853	exon6			GGAGTTCGTATGT	AL024498	CCDS4515.1, CCDS47372.1, CCDS75395.1, CCDS75396.1, CCDS75397.1	6p25.1-p23	2008-08-12			ENSG00000137210	ENSG00000137210			21384	protein-coding gene	gene with protein product							Standard	NM_030969		Approved	MGC1223	uc003mzk.4	Q9NUH8	OTTHUMG00000014246	ENST00000379542.5:c.322C>T	6.37:g.10756728C>T	ENSP00000368858:p.Arg108Cys	Somatic	126	4		WXS	Illumina GAIIx	Phase_I	163	26	NM_030969	0	0	78	78	0	Q5THN7|Q5THN8|Q96IX7|Q9BVN8	Missense_Mutation	SNP	ENST00000379542.5	37	CCDS4515.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	5.745|5.745	0.321925|0.321925	0.10900|0.10900	.|.	.|.	ENSG00000137210|ENSG00000137210	ENST00000472062;ENST00000379542;ENST00000379530|ENST00000473276	T;T|T	0.26660|0.56941	2.12;1.72|0.43	3.75|3.75	1.3|1.3	0.21679|0.21679	.|.	0.473115|.	0.27366|.	N|.	0.019688|.	T|T	0.39517|0.39517	0.1081|0.1081	L|L	0.57536|0.57536	1.79|1.79	0.09310|0.09310	N|N	1|1	P;P|.	0.49635|.	0.926;0.917|.	B;B|.	0.42653|.	0.226;0.394|.	T|T	0.36359|0.36359	-0.9751|-0.9751	10|7	0.56958|0.87932	D|D	0.05|0	.|.	9.9351|9.9351	0.41545|0.41545	0.4256:0.5744:0.0:0.0|0.4256:0.5744:0.0:0.0	.|.	74;108|.	Q5THN7;Q9NUH8|.	.;TM14B_HUMAN|.	C|L	108;108;74|48	ENSP00000368858:R108C;ENSP00000368845:R74C|ENSP00000420580:S48L	ENSP00000368845:R74C|ENSP00000420580:S48L	R|S	+|+	1|2	0|0	TMEM14B|TMEM14B	10864714|10864714	0.007000|0.007000	0.16637|0.16637	0.210000|0.210000	0.23637|0.23637	0.087000|0.087000	0.18053|0.18053	1.323000|1.323000	0.33701|0.33701	0.291000|0.291000	0.22468|0.22468	-1.051000|-1.051000	0.02340|0.02340	CGT|TCG	C|0.960;T|0.040		0.358	TMEM14B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039836.1	NM_030969	
HLA-A	3105	hgsc.bcm.edu	37	6	29910566	29910566	+	Missense_Mutation	SNP	G	G	A	rs41545116	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr6:29910566G>A	ENST00000396634.1	+	4	447	c.106G>A	c.(106-108)Gtg>Atg	p.V36M	HLA-A_ENST00000376802.2_Missense_Mutation_p.V36M|HLA-A_ENST00000376809.5_Missense_Mutation_p.V36M|HLA-A_ENST00000376806.5_Missense_Mutation_p.V36M			P16189	1A31_HUMAN	major histocompatibility complex, class I, A	36	Alpha-1.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	beta-2-microglobulin binding (GO:0030881)|peptide antigen binding (GO:0042605)|TAP binding (GO:0046977)			central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	30						CTTCACATCCGTGTCCCGGCC	0.711									Osteosarcoma, Familial Clustering of;Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of;Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of	Multiple Myeloma(9;0.094)			g|||	111	0.0221645	0.0688	0.0216	5008	,	,		13876	0.0		0.005	False		,,,				2504	0.0				p.V36M		.											.	HLA-A-92	0			c.G106A						.						17.0	17.0	17.0					6																	29910566		2191	4278	6469	SO:0001583	missense	3105	exon2	Familial Cancer Database	Familial Osteogenic Sarcoma;incl.: Familial Head and Neck Cancer; ;Lichen Sclerosis, Familial	ACATCCGTGTCCC	D32129	CCDS34373.1	6p21.3	2013-01-11			ENSG00000206503	ENSG00000206503		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4931	protein-coding gene	gene with protein product		142800				8838351	Standard	NM_001242758		Approved		uc003nol.3	P01891	OTTHUMG00000130501	ENST00000396634.1:c.106G>A	6.37:g.29910566G>A	ENSP00000379873:p.Val36Met	Somatic	22	0		WXS	Illumina GAIIx	Phase_I	208	17	NM_001242758	1	0	1	2	0	O62924|O98009|O98137|Q8MHM1|Q9TPQ3|Q9TQ24|Q9UQU6|Q9UQU7	Missense_Mutation	SNP	ENST00000396634.1	37	CCDS34373.1	.	.	.	.	.	.	.	.	.	.	.	4.406	0.075018	0.08485	.	.	ENSG00000206503	ENST00000396634;ENST00000376806;ENST00000376809;ENST00000355767;ENST00000376802	T;T;T;T	0.01092	5.35;5.35;5.35;5.35	3.48	-0.824	0.10812	MHC class I, alpha chain, alpha1/alpha2 (3);MHC classes I/II-like antigen recognition protein (3);MHC class I-like antigen recognition (3);	0.226724	0.20772	U	0.085967	T	0.01320	0.0043	M	0.63843	1.955	0.09310	N	1	B;D;P;D;B	0.89917	0.177;1.0;0.572;1.0;0.269	B;D;B;D;B	0.91635	0.136;0.999;0.218;0.999;0.218	T	0.49818	-0.8899	10	0.52906	T	0.07	.	2.8157	0.05455	0.2394:0.0:0.36:0.4006	rs41545116;rs61739761	36;36;36;36;36	P13746;Q5SRN7;P16188;Q5SRN5;P04439	1A11_HUMAN;.;1A30_HUMAN;.;1A03_HUMAN	M	36	ENSP00000379873:V36M;ENSP00000366002:V36M;ENSP00000366005:V36M;ENSP00000365998:V36M	ENSP00000348012:V36M	V	+	1	0	HLA-A	30018545	0.000000	0.05858	0.249000	0.24280	0.102000	0.19082	-0.740000	0.04861	-0.043000	0.13513	-0.556000	0.04195	GTG	A|0.077;G|0.923		0.711	HLA-A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252909.1	NM_002116	
RNF39	80352	hgsc.bcm.edu	37	6	30039364	30039364	+	Missense_Mutation	SNP	C	C	A	rs11753382	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr6:30039364C>A	ENST00000244360.6	-	4	884	c.787G>T	c.(787-789)Ggc>Tgc	p.G263C	RNF39_ENST00000376751.3_Missense_Mutation_p.G263C	NM_025236.3	NP_079512.2	Q9H2S5	RNF39_HUMAN	ring finger protein 39	263	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)										CGCTTGGGGCCGTCAGGGGGC	0.741													c|||	749	0.149561	0.2489	0.134	5008	,	,		10967	0.1528		0.0447	False		,,,				2504	0.1309				p.G263C	NSCLC(8;188 360 1520 20207 31481)	.											.	RNF39-226	0			c.G787T						.		CYS/GLY,CYS/GLY	414,2026		21,372,827	3.0	2.0	2.0		787,787	0.5	0.1	6	dbSNP_120	2	229,4029		6,217,1906	yes	missense,missense	RNF39	NM_025236.3,NM_170769.2	159,159	27,589,2733	AA,AC,CC		5.3781,16.9672,9.5999	benign,benign	263/421,263/355	30039364	643,6055	1220	2129	3349	SO:0001583	missense	80352	exon4			TGGGGCCGTCAGG	AF238315	CCDS4673.1, CCDS4674.1	6p21.3	2013-01-09			ENSG00000204618	ENSG00000204618		"""RING-type (C3HC4) zinc fingers"""	18064	protein-coding gene	gene with protein product		607524				11130983, 11716498	Standard	NM_170769		Approved	HZFw1, LIRF	uc003npe.3	Q9H2S5	OTTHUMG00000031288	ENST00000244360.6:c.787G>T	6.37:g.30039364C>A	ENSP00000244360:p.Gly263Cys	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	8	6	NM_025236	0	0	3	3	0	A2BEK3|A6NCD6|B0S858|Q5SPM8|Q5SPM9|Q5SPN0|Q5SRJ9|Q5SRK1|Q5SS29|Q9H2S3|Q9H2S4	Missense_Mutation	SNP	ENST00000244360.6	37	CCDS4673.1	299	0.13690476190476192	120	0.24390243902439024	56	0.15469613259668508	90	0.15734265734265734	33	0.04353562005277045	c	11.55	1.672102	0.29693	0.169672	0.053781	ENSG00000204618	ENST00000376751;ENST00000244360	T;T	0.10382	2.88;2.88	4.7	0.543	0.17179	Concanavalin A-like lectin/glucanase (1);SPRY-associated (1);B30.2/SPRY domain (1);	0.296117	0.23738	N	0.045041	T	0.03348	0.0097	N	0.19112	0.55	0.48696	P	3.009999999999957E-4	B;P	0.48407	0.06;0.91	B;P	0.47626	0.092;0.552	T	0.41305	-0.9516	9	0.56958	D	0.05	-19.3451	7.7639	0.28968	0.0:0.4441:0.0:0.5559	rs11753382	263;263	Q9H2S5;Q9H2S5-2	RNF39_HUMAN;.	C	263	ENSP00000365942:G263C;ENSP00000244360:G263C	ENSP00000244360:G263C	G	-	1	0	RNF39	30147343	0.003000	0.15002	0.059000	0.19551	0.050000	0.14768	0.158000	0.16422	-0.104000	0.12154	0.466000	0.42574	GGC	C|0.862;A|0.138		0.741	RNF39-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076625.3	NM_170769	
TNXB	7148	broad.mit.edu	37	6	32063513	32063514	+	Frame_Shift_Del	DEL	AC	AC	-	rs144556766		TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr6:32063513_32063514delAC	ENST00000479795.1	-	3	2256_2257	c.2116_2117delGT	c.(2116-2118)gtafs	p.V706fs	TNXB_ENST00000375247.2_Frame_Shift_Del_p.V706fs|TNXB_ENST00000375244.3_Frame_Shift_Del_p.V706fs			P22105	TENX_HUMAN	tenascin XB	706	EGF-like 18. {ECO:0000255|PROSITE- ProRule:PRU00076}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						GAAGCCCTCTACACACACACAC	0.668																																					p.706_706del		.											.	TNXB-90	0			c.2116_2117del						.																																			SO:0001589	frameshift_variant	7148	exon3			CCCTCTACACACA	X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000479795.1:c.2116_2117delGT	6.37:g.32063523_32063524delAC	ENSP00000418248:p.Val706fs	Somatic	220	0		WXS	Illumina GAIIx	Phase_I	447	10	NM_019105	0	0	0	0	0	P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Frame_Shift_Del	DEL	ENST00000479795.1	37																																																																																				.		0.668	TNXB-007	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000357059.1	NM_019105	
NOTCH4	4855	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	32166275	32166275	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr6:32166275G>A	ENST00000375023.3	-	26	4817	c.4679C>T	c.(4678-4680)gCg>gTg	p.A1560V	GPSM3_ENST00000375043.3_5'Flank|NOTCH4_ENST00000443903.2_5'Flank	NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4	1560					cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						CTGAGGGAGCGCCCCACAGCC	0.582																																					p.A1560V		.											.	NOTCH4-1321	0			c.C4679T						.						65.0	54.0	58.0					6																	32166275		1511	2709	4220	SO:0001583	missense	4855	exon26			GGGAGCGCCCCAC		CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.4679C>T	6.37:g.32166275G>A	ENSP00000364163:p.Ala1560Val	Somatic	65	0		WXS	Illumina GAIIx	Phase_I	79	27	NM_004557	0	0	2	2	0	B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	Missense_Mutation	SNP	ENST00000375023.3	37	CCDS34420.1	.	.	.	.	.	.	.	.	.	.	G	12.23	1.874616	0.33069	.	.	ENSG00000204301	ENST00000375023	D	0.81579	-1.51	5.16	-3.72	0.04411	.	0.882779	0.09507	N	0.792818	T	0.27524	0.0676	N	0.03608	-0.345	0.25148	N	0.990442	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.0	T	0.13953	-1.0490	10	0.31617	T	0.26	.	1.1076	0.01698	0.1343:0.2449:0.2819:0.339	.	1560;1559	Q99466;B0S882	NOTC4_HUMAN;.	V	1560	ENSP00000364163:A1560V	ENSP00000364163:A1560V	A	-	2	0	NOTCH4	32274253	0.286000	0.24305	0.675000	0.29917	0.905000	0.53344	-0.472000	0.06623	-0.821000	0.04312	-0.364000	0.07487	GCG	.		0.582	NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076045.2		
HLA-DRB1	3123	bcgsc.ca	37	6	32557461	32557461	+	Missense_Mutation	SNP	A	A	G	rs35053532	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr6:32557461A>G	ENST00000360004.5	-	1	164	c.59T>C	c.(58-60)aTg>aCg	p.M20T		NM_002124.3	NP_002115.2	Q30167	2B1A_HUMAN	major histocompatibility complex, class II, DR beta 1	20					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)				large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(2)|stomach(1)	10						GCTCAGCACCATCAGTGTCAC	0.572										Multiple Myeloma(14;0.17)																											p.M20T		.											.	HLA-DRB1-1	0			c.T59C						.						83.0	99.0	93.0					6																	32557461		1511	2709	4220	SO:0001583	missense	3123	exon1			AGCACCATCAGTG	AJ297583	CCDS47409.1	6p21.3	2013-01-11			ENSG00000196126	ENSG00000196126		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4948	protein-coding gene	gene with protein product		142857		HLA-DR1B			Standard	NM_001243965		Approved		uc011eri.2	P01911	OTTHUMG00000031196	ENST00000360004.5:c.59T>C	6.37:g.32557461A>G	ENSP00000353099:p.Met20Thr	Somatic	340	10		WXS	Illumina GAIIx	Phase_I	468	25	NM_002124	0	0	43	43	0	P01914|Q9MYF5	Missense_Mutation	SNP	ENST00000360004.5	37	CCDS47409.1	.	.	.	.	.	.	.	.	.	.	.	4.424	0.078455	0.08533	.	.	ENSG00000196126	ENST00000360004	T	0.00253	8.43	4.4	2.05	0.26809	MHC classes I/II-like antigen recognition protein (1);	1.753860	0.02864	N	0.130685	T	0.00073	0.0002	L	0.51422	1.61	0.09310	N	0.999999	B	0.20887	0.049	B	0.21360	0.034	T	0.43097	-0.9412	10	0.59425	D	0.04	.	5.3115	0.15833	0.7604:0.0:0.2396:0.0	rs35053532	20	P01911	2B1F_HUMAN	T	20	ENSP00000353099:M20T	ENSP00000353099:M20T	M	-	2	0	HLA-DRB1	32665439	0.226000	0.23696	0.380000	0.26093	0.101000	0.19017	1.241000	0.32743	0.270000	0.21984	0.379000	0.24179	ATG	A|0.986;G|0.013		0.572	HLA-DRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076393.3	NM_002124	
PEX6	5190	hgsc.bcm.edu	37	6	42946490	42946490	+	Silent	SNP	C	C	A	rs9462858	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr6:42946490C>A	ENST00000304611.8	-	1	468	c.399G>T	c.(397-399)gtG>gtT	p.V133V	PEX6_ENST00000244546.4_Silent_p.V133V	NM_000287.3	NP_000278.3	Q13608	PEX6_HUMAN	peroxisomal biogenesis factor 6	133					ATP catabolic process (GO:0006200)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix, translocation (GO:0016561)|protein stabilization (GO:0050821)|protein targeting to peroxisome (GO:0006625)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)			NS(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(3)	15			all cancers(41;0.00235)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.0562)			GCGGTCCGGGCACTGGGAGGG	0.746													C|||	1662	0.331869	0.3691	0.3516	5008	,	,		10923	0.1002		0.4612	False		,,,				2504	0.3732				p.V133V		.											.	PEX6-91	0			c.G399T						.	C		1002,2080		214,574,753	2.0	3.0	3.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	399	2.1	0.9	6	dbSNP_119	3	2653,4001		636,1381,1310	no	coding-synonymous	PEX6	NM_000287.3		850,1955,2063	AA,AC,CC		39.8708,32.5114,37.5411		133/981	42946490	3655,6081	1541	3327	4868	SO:0001819	synonymous_variant	5190	exon1			TCCGGGCACTGGG	U56602	CCDS4877.1	6p22-p11	2010-04-21			ENSG00000124587	ENSG00000124587		"""ATPases / AAA-type"""	8859	protein-coding gene	gene with protein product		601498				8670792	Standard	NM_000287		Approved	PXAAA1, PAF-2	uc003otf.3	Q13608	OTTHUMG00000014713	ENST00000304611.8:c.399G>T	6.37:g.42946490C>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	6	NM_000287	0	0	1	5	4	Q5T8W1|Q8WYQ0|Q8WYQ1|Q8WYQ2|Q99476	Silent	SNP	ENST00000304611.8	37	CCDS4877.1																																																																																			C|0.673;A|0.327		0.746	PEX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040569.1	NM_000287	
FBXO9	26268	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	52960318	52960318	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr6:52960318T>G	ENST00000244426.6	+	11	1263	c.1091T>G	c.(1090-1092)cTt>cGt	p.L364R	FBXO9_ENST00000370939.3_Missense_Mutation_p.L320R|FBXO9_ENST00000323557.7_Missense_Mutation_p.L354R	NM_012347.4	NP_036479.1	Q9UK97	FBX9_HUMAN	F-box protein 9	364					fat cell differentiation (GO:0045444)|innate immune response (GO:0045087)|protein ubiquitination (GO:0016567)|regulation of TOR signaling (GO:0032006)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			kidney(1)|large_intestine(4)|lung(1)|pancreas(2)|skin(1)	9	Lung NSC(77;0.103)					CAGAAACCACTTGACTATAAA	0.378																																					p.L364R		.											.	FBXO9-227	0			c.T1091G						.						63.0	59.0	60.0					6																	52960318		1835	4089	5924	SO:0001583	missense	26268	exon11			AACCACTTGACTA	AF155114	CCDS55022.1, CCDS55023.1, CCDS55024.1	6p12.3-p11.2	2004-06-15	2004-06-15		ENSG00000112146	ENSG00000112146		"""F-boxes /  ""other"""""	13588	protein-coding gene	gene with protein product		609091	"""F-box only protein 9"""			10531035, 10531037	Standard	NM_012347		Approved	FBX9, NY-REN-57	uc021zao.1	Q9UK97	OTTHUMG00000014869	ENST00000244426.6:c.1091T>G	6.37:g.52960318T>G	ENSP00000244426:p.Leu364Arg	Somatic	50	0		WXS	Illumina GAIIx	Phase_I	56	7	NM_012347	0	0	0	0	0	A6NFW3|B3KMM6|O75986|Q59EH8|Q6PKH7|Q9NT57|Q9Y593	Missense_Mutation	SNP	ENST00000244426.6	37	CCDS55023.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	6.375|6.375	0.437380|0.437380	0.12104|0.12104	.|.	.|.	ENSG00000112146|ENSG00000112146	ENST00000370939;ENST00000323557;ENST00000244426|ENST00000473318	T;T;T|.	0.76316|.	-1.0;-1.01;-1.01|.	5.13|5.13	3.94|3.94	0.45596|0.45596	F-box domain, Skp2-like (1);|.	0.492700|0.492700	0.23330|0.23330	N|N	0.049347|0.049347	T|T	0.03305|0.03305	0.0096|0.0096	N|N	0.02539|0.02539	-0.55|-0.55	0.29464|0.29464	N|N	0.857528|0.857528	B;B;B|.	0.26258|.	0.145;0.002;0.001|.	B;B;B|.	0.28232|.	0.087;0.003;0.002|.	T|T	0.41945|0.41945	-0.9480|-0.9480	10|7	0.15499|0.07644	T|T	0.54|0.81	-1.7951|-1.7951	7.6183|7.6183	0.28171|0.28171	0.1403:0.0:0.1469:0.7128|0.1403:0.0:0.1469:0.7128	.|.	354;471;364|.	Q9UK97-2;Q59EH8;Q9UK97|.	.;.;FBX9_HUMAN|.	R|V	320;354;364|113	ENSP00000359977:L320R;ENSP00000326968:L354R;ENSP00000244426:L364R|.	ENSP00000244426:L364R|ENSP00000417349:L113V	L|L	+|+	2|1	0|2	FBXO9|FBXO9	53068277|53068277	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.968000|0.968000	0.65278|0.65278	3.434000|3.434000	0.52841|0.52841	0.870000|0.870000	0.35726|0.35726	-0.341000|-0.341000	0.08007|0.08007	CTT|TTG	.		0.378	FBXO9-002	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000040950.3		
MLIP	90523	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	54095603	54095603	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr6:54095603C>T	ENST00000274897.5	+	11	1318	c.1205C>T	c.(1204-1206)aCc>aTc	p.T402I	MLIP_ENST00000370877.2_Intron|MLIP_ENST00000502396.1_Missense_Mutation_p.T937I|MLIP_ENST00000370876.2_Intron|MLIP_ENST00000509997.1_Intron|MLIP_ENST00000358276.5_Intron	NM_138569.2	NP_612636.2	Q5VWP3	MLIP_HUMAN	muscular LMNA-interacting protein	402						nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|PML body (GO:0016605)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(16)|ovary(8)|skin(4)|stomach(1)|urinary_tract(1)	34						CATCCACAGACCCTCTCACAT	0.517																																					p.T402I		.											.	MLIP-99	0			c.C1205T						.						304.0	269.0	281.0					6																	54095603		2203	4300	6503	SO:0001583	missense	90523	exon11			CACAGACCCTCTC	AK055530	CCDS4954.1, CCDS64448.1, CCDS64449.1	6p12.2-p12.1	2011-04-29	2011-04-29	2011-04-29	ENSG00000146147	ENSG00000146147			21355	protein-coding gene	gene with protein product	"""muscle-enriched A-type lamin interacting protein"""	614106	"""chromosome 6 open reading frame 142"""	C6orf142		21498514	Standard	NM_138569		Approved	MGC18257	uc011dxa.2	Q5VWP3	OTTHUMG00000014891	ENST00000274897.5:c.1205C>T	6.37:g.54095603C>T	ENSP00000274897:p.Thr402Ile	Somatic	104	0		WXS	Illumina GAIIx	Phase_I	133	31	NM_138569	0	0	4	7	3	B7Z2N0|D6RE05|Q96H08|Q96NF7	Missense_Mutation	SNP	ENST00000274897.5	37	CCDS4954.1	.	.	.	.	.	.	.	.	.	.	C	17.62	3.434851	0.62955	.	.	ENSG00000146147	ENST00000274897;ENST00000502396	T;T	0.24350	2.21;1.86	5.59	2.38	0.29361	.	0.567127	0.15982	N	0.235278	T	0.18130	0.0435	N	0.19112	0.55	0.80722	D	1	D;P	0.55385	0.971;0.95	P;P	0.58454	0.839;0.735	T	0.04017	-1.0984	10	0.72032	D	0.01	.	12.1913	0.54273	0.4485:0.5515:0.0:0.0	.	937;402	Q5VWP3-3;Q5VWP3	.;MLIP_HUMAN	I	402;937	ENSP00000274897:T402I;ENSP00000426290:T937I	ENSP00000274897:T402I	T	+	2	0	MLIP	54203562	0.350000	0.24878	0.998000	0.56505	0.976000	0.68499	0.596000	0.24044	0.658000	0.30925	0.650000	0.86243	ACC	.		0.517	MLIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040979.3	NM_138569	
FAM46A	55603	broad.mit.edu	37	6	82461728	82461742	+	In_Frame_Del	DEL	CCGCCGAAGTCGCCG	CCGCCGAAGTCGCCG	-	rs375746695	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr6:82461728_82461742delCCGCCGAAGTCGCCG	ENST00000320172.6	-	2	431_445	c.117_131delCGGCGACTTCGGCGG	c.(115-132)ggcggcgacttcggcggt>ggt	p.39_44GGDFGG>G	FAM46A_ENST00000369756.3_In_Frame_Del_p.120_125GGDFGG>G|FAM46A_ENST00000369754.3_In_Frame_Del_p.58_63GGDFGG>G	NM_017633.2	NP_060103.2	Q96IP4	FA46A_HUMAN	family with sequence similarity 46, member A	39			Missing. {ECO:0000269|PubMed:12054608, ECO:0000269|PubMed:16545789}.		regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)		poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(3)|lung(5)|skin(1)|urinary_tract(1)	12		all_cancers(76;6.74e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000282)|all_epithelial(107;0.0104)		BRCA - Breast invasive adenocarcinoma(397;0.0428)		gctgccgccaccgccgaagtcgccgccgccgaagt	0.67																																					p.39_44del		.											.	FAM46A-90	0			c.117_131del						.																																			SO:0001651	inframe_deletion	55603	exon2			CCGCCACCGCCGA	AF350451	CCDS34489.1	6q14	2008-07-03	2004-08-19	2004-08-26	ENSG00000112773	ENSG00000112773			18345	protein-coding gene	gene with protein product		611357	"""chromosome 6 open reading frame 37"""	C6orf37		12054608, 17803723	Standard	NM_017633		Approved	FLJ20037	uc003pjg.3	Q96IP4	OTTHUMG00000015097	ENST00000320172.6:c.117_131delCGGCGACTTCGGCGG	6.37:g.82461728_82461742delCCGCCGAAGTCGCCG	ENSP00000318298:p.Gly39_Gly43del	Somatic	19	0		WXS	Illumina GAIIx	Phase_I	109	9	NM_017633	0	0	0	0	0	A8K7U4|Q5TF86|Q8NFZ9|Q9BW32|Q9NXV5	In_Frame_Del	DEL	ENST00000320172.6	37	CCDS34489.1																																																																																			.		0.670	FAM46A-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000041331.1		
IBTK	25998	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	82921272	82921272	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr6:82921272A>C	ENST00000306270.7	-	14	2858	c.2309T>G	c.(2308-2310)gTg>gGg	p.V770G	RNU6-130P_ENST00000411112.1_RNA|IBTK_ENST00000510291.1_Missense_Mutation_p.V770G|IBTK_ENST00000503631.1_Missense_Mutation_p.V569G	NM_015525.2	NP_056340.2	Q9P2D0	IBTK_HUMAN	inhibitor of Bruton agammaglobulinemia tyrosine kinase	770	BTB 2. {ECO:0000255|PROSITE- ProRule:PRU00037}.				negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein tyrosine kinase activity (GO:0061099)|release of sequestered calcium ion into cytosol (GO:0051209)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|protein tyrosine kinase inhibitor activity (GO:0030292)			central_nervous_system(2)|endometrium(9)|kidney(3)|large_intestine(10)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	54		all_cancers(76;3.38e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.0037)		BRCA - Breast invasive adenocarcinoma(397;0.0901)		TTTCATGGTCACGTCACACAG	0.338																																					p.V770G		.											.	IBTK-92	0			c.T2309G						.						74.0	70.0	71.0					6																	82921272		2203	4300	6503	SO:0001583	missense	25998	exon14			ATGGTCACGTCAC	AF235049	CCDS34490.1, CCDS75486.1	6q14.3	2013-01-10	2003-10-06	2003-10-08	ENSG00000005700	ENSG00000005700		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	17853	protein-coding gene	gene with protein product		606457	"""Bruton agammaglobulinemia tyrosine kinase inhibitor"""	BTKI		11577348	Standard	XM_006715453		Approved	DKFZP564B116, BTBD26	uc003pjl.1	Q9P2D0	OTTHUMG00000015102	ENST00000306270.7:c.2309T>G	6.37:g.82921272A>C	ENSP00000305721:p.Val770Gly	Somatic	340	0		WXS	Illumina GAIIx	Phase_I	299	67	NM_015525	0	0	8	14	6	Q2QKU2|Q2QKU3|Q2QKU4|Q5TFD7|Q5TFD9|Q8IUQ9|Q8IUY7|Q8TAI4|Q9HBI8|Q9Y3T8	Missense_Mutation	SNP	ENST00000306270.7	37	CCDS34490.1	.	.	.	.	.	.	.	.	.	.	A	22.9	4.354486	0.82243	.	.	ENSG00000005700	ENST00000306270;ENST00000503631;ENST00000510291	T;T;T	0.78595	-1.19;-1.19;-1.19	5.74	5.74	0.90152	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	D	0.91043	0.7182	H	0.96805	3.885	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.997;1.0;0.992;1.0	D	0.93359	0.6725	10	0.54805	T	0.06	-11.3004	16.0294	0.80567	1.0:0.0:0.0:0.0	.	569;770;770;770	E9PDR5;E7EPI0;Q9P2D0-2;Q9P2D0	.;.;.;IBTK_HUMAN	G	770;569;770	ENSP00000305721:V770G;ENSP00000422762:V569G;ENSP00000426405:V770G	ENSP00000305721:V770G	V	-	2	0	IBTK	82977991	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.932000	0.92897	2.190000	0.69967	0.477000	0.44152	GTG	.		0.338	IBTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041337.2	NM_015525	
FAM184A	79632	hgsc.bcm.edu;bcgsc.ca	37	6	119337933	119337933	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr6:119337933C>A	ENST00000338891.7	-	5	1952	c.1509G>T	c.(1507-1509)agG>agT	p.R503S	FAM184A_ENST00000352896.5_Missense_Mutation_p.R383S|FAM184A_ENST00000521531.1_Missense_Mutation_p.R503S|FAM184A_ENST00000368475.4_Missense_Mutation_p.R383S|RP11-351A11.1_ENST00000518570.1_RNA|FAM184A_ENST00000522284.1_Missense_Mutation_p.R383S	NM_024581.4	NP_078857.5	Q8NB25	F184A_HUMAN	family with sequence similarity 184, member A	503						extracellular space (GO:0005615)				breast(2)|central_nervous_system(2)|endometrium(2)|kidney(5)|large_intestine(19)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(5)	52						TTTTCTTATCCCTAATTGCAT	0.368																																					p.R503S		.											.	FAM184A-519	0			c.G1509T						.						110.0	101.0	104.0					6																	119337933		1827	4090	5917	SO:0001583	missense	79632	exon5			CTTATCCCTAATT	BC009055	CCDS43499.1, CCDS43500.1, CCDS75508.1	6q22.31	2008-08-14	2008-08-14	2008-08-14	ENSG00000111879	ENSG00000111879			20991	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 60"""	C6orf60		11230166	Standard	NM_024581		Approved	FLJ13942	uc003pyj.3	Q8NB25	OTTHUMG00000015471	ENST00000338891.7:c.1509G>T	6.37:g.119337933C>A	ENSP00000342604:p.Arg503Ser	Somatic	66	0		WXS	Illumina GAIIx	Phase_I	76	4	NM_024581	0	0	2	2	0	B9DI75|F8W8D6|Q5TBS9|Q7Z323|Q96GY8|Q9H0J8|Q9H851	Missense_Mutation	SNP	ENST00000338891.7	37	CCDS43499.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.50|14.50	2.554976|2.554976	0.45487|0.45487	.|.	.|.	ENSG00000111879|ENSG00000111879	ENST00000448815|ENST00000338891;ENST00000352896;ENST00000368475;ENST00000521531;ENST00000522284	.|T;T;T;T;T	.|0.00348	.|8.0;8.0;8.0;8.0;8.0	5.18|5.18	-0.445|-0.445	0.12242|0.12242	.|.	.|0.259165	.|0.42821	.|D	.|0.000660	T|T	0.00073|0.00073	0.0002|0.0002	L|L	0.40543|0.40543	1.245|1.245	0.29506|0.29506	N|N	0.854536|0.854536	.|B;B;B	.|0.15141	.|0.01;0.01;0.012	.|B;B;B	.|0.23852	.|0.033;0.017;0.049	T|T	0.20338|0.20338	-1.0278|-1.0278	5|10	.|0.34782	.|T	.|0.22	-1.214|-1.214	9.2185|9.2185	0.37362|0.37362	0.0:0.5591:0.0:0.4409|0.0:0.5591:0.0:0.4409	.|.	.|503;383;503	.|Q8NB25-2;F8W8D6;Q8NB25	.|.;.;F184A_HUMAN	V|S	89|503;383;383;503;383	.|ENSP00000342604:R503S;ENSP00000326608:R383S;ENSP00000357460:R383S;ENSP00000430442:R503S;ENSP00000429826:R383S	.|ENSP00000342604:R503S	G|R	-|-	2|3	0|2	FAM184A|FAM184A	119379632|119379632	0.676000|0.676000	0.27567|0.27567	0.245000|0.245000	0.24217|0.24217	0.985000|0.985000	0.73830|0.73830	0.731000|0.731000	0.26058|0.26058	0.099000|0.099000	0.17552|0.17552	0.491000|0.491000	0.48974|0.48974	GGG|AGG	.		0.368	FAM184A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042009.3	NM_024581	
SLC2A12	154091	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	134373567	134373567	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr6:134373567T>A	ENST00000275230.5	-	1	207	c.52A>T	c.(52-54)Aca>Tca	p.T18S		NM_145176.2	NP_660159.1	Q8TD20	GTR12_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 12	18					glucose transport (GO:0015758)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	substrate-specific transmembrane transporter activity (GO:0022891)			NS(1)|breast(1)|large_intestine(6)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	17	Breast(56;0.214)|Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.0101)|GBM - Glioblastoma multiforme(68;0.0123)		TCCACGGCTGTCCCCTTCTGG	0.632																																					p.T18S	Melanoma(122;1663 1672 14489 35294 41228)	.											.	SLC2A12-91	0			c.A52T						.						61.0	61.0	61.0					6																	134373567		2203	4300	6503	SO:0001583	missense	154091	exon1			CGGCTGTCCCCTT	AL035699	CCDS5169.1	6q23.2	2013-05-22			ENSG00000146411	ENSG00000146411		"""Solute carriers"""	18067	protein-coding gene	gene with protein product		610372				11780753, 11832379	Standard	XM_006715349		Approved	GLUT12, GLUT8	uc003qem.1	Q8TD20	OTTHUMG00000015611	ENST00000275230.5:c.52A>T	6.37:g.134373567T>A	ENSP00000275230:p.Thr18Ser	Somatic	42	0		WXS	Illumina GAIIx	Phase_I	52	16	NM_145176	0	0	0	0	0	B3KV17|Q7Z6U3|Q96MR8	Missense_Mutation	SNP	ENST00000275230.5	37	CCDS5169.1	.	.	.	.	.	.	.	.	.	.	T	8.372	0.835471	0.16820	.	.	ENSG00000146411	ENST00000275230	T	0.78246	-1.16	5.35	2.95	0.34219	.	5.969580	0.00166	N	0.000007	T	0.33000	0.0848	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.39272	-0.9622	10	0.09084	T	0.74	-0.0124	6.6159	0.22776	0.0:0.0811:0.1668:0.7522	.	18	Q8TD20	GTR12_HUMAN	S	18	ENSP00000275230:T18S	ENSP00000275230:T18S	T	-	1	0	SLC2A12	134415260	0.000000	0.05858	0.001000	0.08648	0.851000	0.48451	0.343000	0.19944	0.476000	0.27440	0.448000	0.29417	ACA	.		0.632	SLC2A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042302.1		
RP3-470B24.5	0	bcgsc.ca	37	6	168376977	168376977	+	lincRNA	SNP	G	G	A	rs113501624		TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr6:168376977G>A	ENST00000538528.1	-	0	642																											TTGGGAGGAGGAGGCAGTGGG	0.632																																					p.S119F		.											.	.	0			c.C356T						.						18.0	16.0	17.0					6																	168376977		692	1590	2282			0	exon1			GAGGAGGAGGCAG																													6.37:g.168376977G>A		Somatic	149	2		WXS	Illumina GAIIx	Phase_I	216	14	NM_001129895	0	0	0	0	0		Missense_Mutation	SNP	ENST00000538528.1	37																																																																																				G|0.500;A|0.500		0.632	RP3-470B24.5-201	KNOWN	basic	lincRNA	lincRNA			
ZFAND2A	90637	bcgsc.ca	37	7	1195215	1195215	+	Silent	SNP	A	A	C	rs1133116	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr7:1195215A>C	ENST00000316495.3	-	4	415	c.156T>G	c.(154-156)gtT>gtG	p.V52V	ZFAND2A_ENST00000401903.1_Silent_p.V52V	NM_182491.2	NP_872297.2	Q8N6M9	ZFN2A_HUMAN	zinc finger, AN1-type domain 2A	52					cellular response to arsenic-containing substance (GO:0071243)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	zinc ion binding (GO:0008270)			lung(2)|ovary(1)	3		Ovarian(82;0.11)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;1.82e-15)		CTGGGACGTGAACATCCTAAA	0.448													A|||	557	0.111222	0.0749	0.1816	5008	,	,		19995	0.0268		0.1481	False		,,,				2504	0.1595				p.V52V		.											.	ZFAND2A-69	0			c.T156G						.			375,4031	190.9+/-216.7	18,339,1846	146.0	138.0	141.0		156	-8.2	0.1	7	dbSNP_86	141	1527,7073	287.0+/-298.0	131,1265,2904	no	coding-synonymous	ZFAND2A	NM_182491.2		149,1604,4750	CC,CA,AA		17.7558,8.5111,14.624		52/146	1195215	1902,11104	2203	4300	6503	SO:0001819	synonymous_variant	90637	exon4			GACGTGAACATCC	BC029558	CCDS5323.1	7p22.3	2010-04-23			ENSG00000178381	ENSG00000178381		"""Zinc fingers, AN1-type domain containing"""	28073	protein-coding gene	gene with protein product	"""arsenite inducible RNA associated protein"""	610699				20185824	Standard	NM_182491		Approved	AIRAP	uc003skc.3	Q8N6M9	OTTHUMG00000119019	ENST00000316495.3:c.156T>G	7.37:g.1195215A>C		Somatic	78	0		WXS	Illumina GAIIx	Phase_I	101	6	NM_182491	0	0	1	1	0	A4D220	Silent	SNP	ENST00000316495.3	37	CCDS5323.1																																																																																			A|0.857;C|0.143		0.448	ZFAND2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239220.2	NM_182491	
ETV1	2115	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	13971355	13971355	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr7:13971355C>T	ENST00000430479.1	-	9	1241	c.574G>A	c.(574-576)Gaa>Aaa	p.E192K	ETV1_ENST00000405192.2_Missense_Mutation_p.E192K|ETV1_ENST00000420159.2_Missense_Mutation_p.E134K|ETV1_ENST00000343495.5_Missense_Mutation_p.E174K|ETV1_ENST00000242066.5_Missense_Mutation_p.E174K|ETV1_ENST00000399357.3_Missense_Mutation_p.E89K|ETV1_ENST00000476720.2_5'UTR|ETV1_ENST00000403527.1_Missense_Mutation_p.E152K|ETV1_ENST00000405218.2_Missense_Mutation_p.E192K|ETV1_ENST00000405358.4_Missense_Mutation_p.E206K|ETV1_ENST00000403685.1_Missense_Mutation_p.E174K	NM_004956.4	NP_004947.2	P50549	ETV1_HUMAN	ets variant 1	192					axon guidance (GO:0007411)|cell differentiation (GO:0030154)|mechanosensory behavior (GO:0007638)|muscle organ development (GO:0007517)|peripheral nervous system neuron development (GO:0048935)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)		TMPRSS2/ETV1(34)|ACSL3_ENST00000357430/ETV1(2)|EWSR1/ETV1(7)|KLK2/ETV1(3)|SLC45A3/ETV1(3)|HNRNPA2B1/ETV1(8)	breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	31						TTACAGGGTTCAGAAAGCTGG	0.468			T	"""EWSR1, TMPRSS2, SLC45A3, C15orf21, HNRNPA2B1. ACSL3"""	"""Ewing sarcoma, prostate"""																																p.E192K		.		Dom	yes		7	7p22	2115	ets variant gene 1		"""M, E"""	.	ETV1-659	0			c.G574A						.						85.0	84.0	84.0					7																	13971355		1963	4138	6101	SO:0001583	missense	2115	exon9			AGGGTTCAGAAAG		CCDS55083.1, CCDS55084.1, CCDS55085.1, CCDS55086.1, CCDS55087.1, CCDS55088.1	7p22	2008-09-12	2008-09-12		ENSG00000006468	ENSG00000006468			3490	protein-coding gene	gene with protein product		600541	"""ets variant gene 1"""			1340465	Standard	NM_004956		Approved	ER81	uc003ssw.4	P50549	OTTHUMG00000152403	ENST00000430479.1:c.574G>A	7.37:g.13971355C>T	ENSP00000405327:p.Glu192Lys	Somatic	250	0		WXS	Illumina GAIIx	Phase_I	267	18	NM_004956	0	0	5	5	0	A4D118|B2R768|B7Z2I4|B7Z618|B7Z9P2|C9JT37|E9PHB1|F5GXR2|O75849|Q4KMQ6|Q59GA7|Q6AI30|Q9UQ71|Q9Y636	Missense_Mutation	SNP	ENST00000430479.1	37	CCDS55088.1	.	.	.	.	.	.	.	.	.	.	C	36	5.802127	0.96960	.	.	ENSG00000006468	ENST00000430479;ENST00000242066;ENST00000343495;ENST00000420159;ENST00000399357;ENST00000405192;ENST00000405358;ENST00000403527;ENST00000405218;ENST00000403685;ENST00000438956;ENST00000443608	T;T;T;T;T;T;T;T;T;T;T;T	0.32515	1.45;1.45;1.45;1.45;1.45;1.45;1.45;1.45;1.45;1.45;1.45;1.45	6.13	6.13	0.99165	PEA3-type ETS-domain transcription factor, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.59183	0.2175	M	0.73217	2.22	0.38075	D	0.936482	D;D;D;D;D;D;D;D	0.89917	0.999;0.997;0.999;0.99;0.99;0.992;0.999;1.0	D;D;D;D;D;D;D;D	0.83275	0.996;0.971;0.995;0.979;0.996;0.987;0.978;0.996	T	0.59799	-0.7386	10	0.66056	D	0.02	.	20.8401	0.99726	0.0:1.0:0.0:0.0	.	203;174;206;134;89;152;134;192	Q59GA7;P50549-2;B5MCT2;F5GXR2;B7Z9P2;E9PHB1;B7Z618;P50549	.;.;.;.;.;.;.;ETV1_HUMAN	K	192;174;174;134;89;192;206;152;192;174;134;89	ENSP00000405327:E192K;ENSP00000242066:E174K;ENSP00000340853:E174K;ENSP00000411626:E134K;ENSP00000382293:E89K;ENSP00000385381:E192K;ENSP00000384085:E206K;ENSP00000384138:E152K;ENSP00000385551:E192K;ENSP00000385686:E174K;ENSP00000393078:E134K;ENSP00000394710:E89K	ENSP00000242066:E174K	E	-	1	0	ETV1	13937880	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.291000	0.78721	2.932000	0.99384	0.644000	0.83932	GAA	.		0.468	ETV1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326111.1	NM_004956	
AMPH	273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	38466556	38466556	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr7:38466556G>C	ENST00000356264.2	-	15	1428	c.1213C>G	c.(1213-1215)Cag>Gag	p.Q405E	AMPH_ENST00000325590.5_Missense_Mutation_p.Q405E|AMPH_ENST00000428293.2_Missense_Mutation_p.Q405E|AMPH_ENST00000471913.1_5'UTR	NM_001635.3	NP_001626.1	P49418	AMPH_HUMAN	amphiphysin	405					endocytosis (GO:0006897)|learning (GO:0007612)|synaptic transmission (GO:0007268)|synaptic vesicle endocytosis (GO:0048488)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|leading edge membrane (GO:0031256)|synaptic vesicle (GO:0008021)	phospholipid binding (GO:0005543)			breast(1)|endometrium(3)|kidney(3)|large_intestine(12)|liver(3)|lung(27)|ovary(3)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)	62						TTCCTTACCTGTGTGAATCCA	0.348																																					p.Q405E		.											.	AMPH-95	0			c.C1213G						.						142.0	136.0	138.0					7																	38466556		2203	4300	6503	SO:0001583	missense	273	exon15			TTACCTGTGTGAA		CCDS5456.1, CCDS47574.1	7p14-p13	2007-06-19	2007-06-19		ENSG00000078053	ENSG00000078053			471	protein-coding gene	gene with protein product		600418	"""amphiphysin (Stiff-Mann syndrome with breast cancer 128kD autoantigen)"", ""amphiphysin (Stiff-Man syndrome with breast cancer 128kDa autoantigen)"""			8245793	Standard	NM_139316		Approved		uc003tgu.3	P49418	OTTHUMG00000023725	ENST00000356264.2:c.1213C>G	7.37:g.38466556G>C	ENSP00000348602:p.Gln405Glu	Somatic	144	0		WXS	Illumina GAIIx	Phase_I	118	20	NM_139316	0	0	0	0	0	A4D1X8|A4D1X9|O43538|Q75MJ8|Q75MK5|Q75MM3|Q8N4G0	Missense_Mutation	SNP	ENST00000356264.2	37	CCDS5456.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.87|19.87	3.906544|3.906544	0.72868|0.72868	.|.	.|.	ENSG00000078053|ENSG00000078053	ENST00000325590;ENST00000356264;ENST00000428293;ENST00000353242;ENST00000421537|ENST00000441628	T;T;T|T	0.59772|0.47528	0.29;0.24;0.28|0.84	5.53|5.53	5.53|5.53	0.82687|0.82687	.|.	0.374634|.	0.27327|.	N|.	0.019872|.	T|T	0.55924|0.55924	0.1951|0.1951	L|L	0.40543|0.40543	1.245|1.245	0.39513|0.39513	D|D	0.968398|0.968398	D;D;D;D|.	0.89917|.	1.0;0.99;0.987;0.969|.	D;P;P;D|.	0.85130|.	0.997;0.789;0.695;0.93|.	T|T	0.54186|0.54186	-0.8331|-0.8331	10|7	0.23302|0.44086	T|T	0.38|0.13	17.1005|17.1005	19.465|19.465	0.94934|0.94934	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	493;405;405;335|.	Q8NFL6;P49418-2;P49418;Q8NFL4|.	.;.;AMPH_HUMAN;.|.	E|R	405;405;405;349;172|329	ENSP00000317441:Q405E;ENSP00000348602:Q405E;ENSP00000390734:Q405E|ENSP00000415085:T329R	ENSP00000317441:Q405E|ENSP00000415085:T329R	Q|T	-|-	1|2	0|0	AMPH|AMPH	38433081|38433081	1.000000|1.000000	0.71417|0.71417	0.988000|0.988000	0.46212|0.46212	0.857000|0.857000	0.48899|0.48899	6.871000|6.871000	0.75531|0.75531	2.600000|2.600000	0.87896|0.87896	0.563000|0.563000	0.77884|0.77884	CAG|ACA	.		0.348	AMPH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000226953.2	NM_001635	
GLI3	2737	bcgsc.ca	37	7	42079765	42079765	+	Silent	SNP	G	G	C	rs35961850	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr7:42079765G>C	ENST00000395925.3	-	7	984	c.900C>G	c.(898-900)tcC>tcG	p.S300S	GLI3_ENST00000479210.1_5'UTR	NM_000168.5	NP_000159.3	P10071	GLI3_HUMAN	GLI family zinc finger 3	300					anterior semicircular canal development (GO:0060873)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye morphogenesis (GO:0048593)|cell differentiation involved in kidney development (GO:0061005)|cerebral cortex radial glia guided migration (GO:0021801)|developmental growth (GO:0048589)|embryonic digestive tract development (GO:0048566)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain radial glial cell differentiation (GO:0021861)|frontal suture morphogenesis (GO:0060364)|heart development (GO:0007507)|hindgut morphogenesis (GO:0007442)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|lambdoid suture morphogenesis (GO:0060366)|lateral ganglionic eminence cell proliferation (GO:0022018)|lateral semicircular canal development (GO:0060875)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|mammary gland specification (GO:0060594)|melanocyte differentiation (GO:0030318)|metanephros development (GO:0001656)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative thymic T cell selection (GO:0045060)|nose morphogenesis (GO:0043585)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte differentiation (GO:0048709)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein processing (GO:0016485)|proximal/distal pattern formation (GO:0009954)|response to estrogen (GO:0043627)|sagittal suture morphogenesis (GO:0060367)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)|T cell differentiation in thymus (GO:0033077)|thymocyte apoptotic process (GO:0070242)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|primary cilium (GO:0072372)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|biliary_tract(1)|breast(4)|central_nervous_system(2)|endometrium(12)|kidney(7)|large_intestine(25)|lung(49)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	112						AGCTATGATCGGAGAGTGGTG	0.488									Pallister-Hall syndrome;Greig Cephalopolysyndactyly																												p.S300S		.											.	GLI3-1149	0			c.C900G						.						211.0	186.0	195.0					7																	42079765		2203	4300	6503	SO:0001819	synonymous_variant	2737	exon7	Familial Cancer Database	;	ATGATCGGAGAGT		CCDS5465.1	7p13	2013-01-25	2009-03-05		ENSG00000106571	ENSG00000106571		"""Zinc fingers, C2H2-type"""	4319	protein-coding gene	gene with protein product	"""zinc finger protein GLI3"", ""oncogene GLI3"", ""DNA-binding protein"""	165240	"""Greig cephalopolysyndactyly syndrome"", ""GLI-Kruppel family member GLI3"", ""glioma-associated oncogene family zinc finger 3"""	GCPS, PHS		2118997	Standard	NM_000168		Approved	PAP-A, PAPA, PAPA1, PAPB, ACLS, PPDIV	uc011kbh.2	P10071	OTTHUMG00000023630	ENST00000395925.3:c.900C>G	7.37:g.42079765G>C		Somatic	247	0		WXS	Illumina GAIIx	Phase_I	280	10	NM_000168	0	0	1	1	0	A4D1W1|O75219|Q17RW4|Q75MT0|Q75MU9|Q9UDT5|Q9UJ39	Silent	SNP	ENST00000395925.3	37	CCDS5465.1																																																																																			G|0.931;A|0.069		0.488	GLI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250806.3	NM_000168	
ZMIZ2	83637	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	44800087	44800087	+	Missense_Mutation	SNP	A	A	T			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr7:44800087A>T	ENST00000309315.4	+	9	1258	c.1135A>T	c.(1135-1137)Acc>Tcc	p.T379S	ZMIZ2_ENST00000441627.1_Missense_Mutation_p.T379S|ZMIZ2_ENST00000413916.1_Missense_Mutation_p.T321S|ZMIZ2_ENST00000433667.1_Missense_Mutation_p.T347S|ZMIZ2_ENST00000265346.7_Missense_Mutation_p.T353S	NM_031449.3	NP_113637.3	Q8NF64	ZMIZ2_HUMAN	zinc finger, MIZ-type containing 2	379	Pro-rich.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|zinc ion binding (GO:0008270)			breast(3)|endometrium(2)|kidney(3)|large_intestine(6)|lung(10)|ovary(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35						GCCACCCATGACCCCAAGCAG	0.577																																					p.T379S	NSCLC(20;604 852 1948 16908 50522)	.											.	ZMIZ2-137	0			c.A1135T						.						139.0	153.0	148.0					7																	44800087		2139	4264	6403	SO:0001583	missense	83637	exon9			CCCATGACCCCAA	AK090415	CCDS43576.1, CCDS43577.1, CCDS75591.1	7p13	2009-11-06			ENSG00000122515	ENSG00000122515		"""Zinc fingers, MIZ-type"""	22229	protein-coding gene	gene with protein product		611196					Standard	XM_005249866		Approved	KIAA1886, hZIMP7, ZIMP7, DKFZp761I2123, NET27	uc003tlr.3	Q8NF64	OTTHUMG00000155817	ENST00000309315.4:c.1135A>T	7.37:g.44800087A>T	ENSP00000311778:p.Thr379Ser	Somatic	247	0		WXS	Illumina GAIIx	Phase_I	320	45	NM_031449	0	0	9	9	0	A4D2K7|D3DVL1|O94790|Q0VGB4|Q659A8|Q6JKL5|Q8WTX8|Q96Q01|Q9BQH7	Missense_Mutation	SNP	ENST00000309315.4	37	CCDS43576.1	.	.	.	.	.	.	.	.	.	.	A	24.8	4.568833	0.86439	.	.	ENSG00000122515	ENST00000413916;ENST00000309315;ENST00000441627;ENST00000433667;ENST00000265346;ENST00000414051	T;T;T;T;T	0.62941	-0.01;-0.01;-0.01;-0.01;-0.01	5.53	4.37	0.52481	.	0.000000	0.56097	D	0.000026	T	0.76564	0.4005	M	0.74881	2.28	0.48975	D	0.999736	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.85130	0.996;0.997;0.996	T	0.77016	-0.2744	10	0.56958	D	0.05	-16.1663	10.8399	0.46708	0.9252:0.0:0.0748:0.0	.	353;379;321	Q8NF64-2;Q8NF64;Q8NF64-3	.;ZMIZ2_HUMAN;.	S	321;379;379;347;353;379	ENSP00000409648:T321S;ENSP00000311778:T379S;ENSP00000414723:T379S;ENSP00000396601:T347S;ENSP00000265346:T353S	ENSP00000265346:T353S	T	+	1	0	ZMIZ2	44766612	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.144000	0.77357	0.937000	0.37394	0.459000	0.35465	ACC	.		0.577	ZMIZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341790.1	NM_031449	
ZNF804B	219578	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	88964602	88964602	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr7:88964602T>C	ENST00000333190.4	+	4	2915	c.2306T>C	c.(2305-2307)aTa>aCa	p.I769T		NM_181646.2	NP_857597.1	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	769							metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(20)|lung(78)|ovary(5)|pancreas(5)|prostate(2)|skin(11)|soft_tissue(1)|upper_aerodigestive_tract(9)	144	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			TCTGATGATATAACAAAGAGC	0.373										HNSCC(36;0.09)																											p.I769T		.											.	ZNF804B-101	0			c.T2306C						.						57.0	51.0	53.0					7																	88964602		2203	4300	6503	SO:0001583	missense	219578	exon4			ATGATATAACAAA	AK056672	CCDS5613.1	7q21.13	2012-10-05	2006-12-18		ENSG00000182348	ENSG00000182348			21958	protein-coding gene	gene with protein product			"""zinc finger 804B"""				Standard	NM_181646		Approved	FLJ32110	uc011khi.2	A4D1E1	OTTHUMG00000131037	ENST00000333190.4:c.2306T>C	7.37:g.88964602T>C	ENSP00000329638:p.Ile769Thr	Somatic	202	0		WXS	Illumina GAIIx	Phase_I	220	68	NM_181646	0	0	0	0	0	B2RTV2|Q7Z714|Q96MN7	Missense_Mutation	SNP	ENST00000333190.4	37	CCDS5613.1	.	.	.	.	.	.	.	.	.	.	T	5.799	0.331677	0.10956	.	.	ENSG00000182348	ENST00000333190	T	0.04406	3.63	5.39	-7.44	0.01379	.	2.088330	0.01326	N	0.011103	T	0.01835	0.0058	N	0.03608	-0.345	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.43972	-0.9358	10	0.14656	T	0.56	4.6728	4.0423	0.09756	0.1188:0.3976:0.3286:0.1549	.	769	A4D1E1	Z804B_HUMAN	T	769	ENSP00000329638:I769T	ENSP00000329638:I769T	I	+	2	0	ZNF804B	88802538	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	-0.407000	0.07178	-0.955000	0.03636	0.528000	0.53228	ATA	.		0.373	ZNF804B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253683.2	NM_181646	
WNT16	51384	bcgsc.ca	37	7	120979089	120979089	+	Missense_Mutation	SNP	C	C	T	rs2707466	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr7:120979089C>T	ENST00000222462.2	+	4	1078	c.788C>T	c.(787-789)aCa>aTa	p.T263I	WNT16_ENST00000361301.2_Missense_Mutation_p.T253I	NM_057168.1	NP_476509.1	Q9UBV4	WNT16_HUMAN	wingless-type MMTV integration site family, member 16	263			T -> I (in dbSNP:rs2707466). {ECO:0000269|PubMed:11095990}.		bone remodeling (GO:0046849)|cardiac epithelial to mesenchymal transition (GO:0060317)|cell fate commitment (GO:0045165)|keratinocyte differentiation (GO:0030216)|keratinocyte proliferation (GO:0043616)|negative regulation of cell death (GO:0060548)|neuron differentiation (GO:0030182)|optic cup formation involved in camera-type eye development (GO:0003408)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of gene expression (GO:0010628)|positive regulation of JNK cascade (GO:0046330)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|replicative senescence (GO:0090399)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)			breast(1)|large_intestine(4)|lung(9)|ovary(3)|prostate(1)	18	all_neural(327;0.117)					TCAGACAAAACAAAGAGGAAA	0.363													T|||	2519	0.502995	0.9017	0.4063	5008	,	,		22765	0.1716		0.4404	False		,,,				2504	0.4387				p.T263I		.											.	WNT16-1011	0			c.C788T						.	T	ILE/THR,ILE/THR	3624,782	316.9+/-294.8	1493,638,72	75.0	77.0	76.0		758,788	2.7	1.0	7	dbSNP_100	76	3922,4678	606.5+/-395.1	912,2098,1290	yes	missense,missense	WNT16	NM_016087.2,NM_057168.1	89,89	2405,2736,1362	TT,TC,CC	http://www.ncbi.nlm.nih.gov/pubmed?term	45.6047,17.7485,41.9806	benign,benign	253/356,263/366	120979089	7546,5460	2203	4300	6503	SO:0001583	missense	51384	exon4			ACAAAACAAAGAG	AF152584	CCDS5780.1, CCDS5781.1	7q31	2008-07-18			ENSG00000002745	ENSG00000002745		"""Wingless-type MMTV integration sites"""	16267	protein-coding gene	gene with protein product		606267				10500199	Standard	NM_016087		Approved		uc003vjw.3	Q9UBV4	OTTHUMG00000156963	ENST00000222462.2:c.788C>T	7.37:g.120979089C>T	ENSP00000222462:p.Thr263Ile	Somatic	95	1		WXS	Illumina GAIIx	Phase_I	72	6	NM_057168	0	0	1	1	0	Q2M3G1|Q9Y5C0	Missense_Mutation	SNP	ENST00000222462.2	37	CCDS5781.1	1030	0.4716117216117216	442	0.8983739837398373	158	0.43646408839779005	100	0.17482517482517482	330	0.43535620052770446	T	11.32	1.602926	0.28534	0.822515	0.456047	ENSG00000002745	ENST00000361301;ENST00000222462	T;T	0.76186	-1.0;-1.0	5.51	2.66	0.31614	.	.	.	.	.	T	0.00012	0.0000	N	0.25060	0.705	0.51233	P	8.699999999994823E-5	B;B	0.10296	0.003;0.003	B;B	0.09377	0.004;0.004	T	0.31833	-0.9929	8	0.29301	T	0.29	.	9.1866	0.37174	0.0:0.2482:0.0:0.7518	rs2707466;rs52828976;rs56918180;rs2707466	263;253	Q9UBV4;E9PH60	WNT16_HUMAN;.	I	253;263	ENSP00000355065:T253I;ENSP00000222462:T263I	ENSP00000222462:T263I	T	+	2	0	WNT16	120766325	1.000000	0.71417	0.977000	0.42913	0.979000	0.70002	2.782000	0.47758	0.021000	0.15133	-0.254000	0.11334	ACA	C|0.462;T|0.538		0.363	WNT16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346843.1	NM_057168	
WDR91	29062	bcgsc.ca	37	7	134871775	134871775	+	Silent	SNP	C	C	T	rs292557	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr7:134871775C>T	ENST00000354475.4	-	14	2059	c.2028G>A	c.(2026-2028)tcG>tcA	p.S676S	WDR91_ENST00000423565.1_Silent_p.S641S|WDR91_ENST00000344400.5_3'UTR	NM_014149.3	NP_054868.3	A4D1P6	WDR91_HUMAN	WD repeat domain 91	676										breast(3)|endometrium(2)|kidney(2)|large_intestine(12)|lung(14)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	40						AATTTCCCTCCGAGTCAAAAG	0.577													C|||	3566	0.712061	0.4962	0.8372	5008	,	,		19133	0.8214		0.7068	False		,,,				2504	0.8078				p.S676S		.											.	WDR91-137	0			c.G2028A						.	C		2436,1970	619.7+/-393.4	683,1070,450	122.0	125.0	124.0		2028	-10.8	0.1	7	dbSNP_79	124	6247,2353	702.9+/-405.3	2279,1689,332	no	coding-synonymous	WDR91	NM_014149.3		2962,2759,782	TT,TC,CC		27.3605,44.7118,33.2385		676/748	134871775	8683,4323	2203	4300	6503	SO:0001819	synonymous_variant	29062	exon14			TCCCTCCGAGTCA	AF161534	CCDS34758.1	7q33	2013-01-09			ENSG00000105875	ENSG00000105875		"""WD repeat domain containing"""	24997	protein-coding gene	gene with protein product						11042152, 11230166	Standard	NM_014149		Approved	HSPC049	uc003vsp.2	A4D1P6	OTTHUMG00000155414	ENST00000354475.4:c.2028G>A	7.37:g.134871775C>T		Somatic	135	0		WXS	Illumina GAIIx	Phase_I	131	5	NM_014149	0	0	4	4	0	A6NK54|C9JMI4|Q6FI65|Q6MZQ1|Q6P4I1|Q96AE5|Q96G63|Q9H062|Q9H9B6|Q9NVG7|Q9NZY6	Silent	SNP	ENST00000354475.4	37	CCDS34758.1																																																																																			C|0.315;N|0.000		0.577	WDR91-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340019.1	NM_014149	
DERL1	79139	bcgsc.ca	37	8	124031541	124031541	+	Missense_Mutation	SNP	T	T	C	rs2272722	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr8:124031541T>C	ENST00000259512.4	-	7	811	c.511A>G	c.(511-513)Atc>Gtc	p.I171V	RP11-557C18.3_ENST00000521258.1_RNA|DERL1_ENST00000523036.1_Missense_Mutation_p.I71V|DERL1_ENST00000519018.1_Missense_Mutation_p.I71V|DERL1_ENST00000405944.3_Intron|DERL1_ENST00000419562.2_Missense_Mutation_p.I71V	NM_001134671.2|NM_024295.5	NP_001128143.1|NP_077271.1	Q9BUN8	DERL1_HUMAN	derlin 1	171			I -> V (in dbSNP:rs2272722).		endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|establishment of protein localization (GO:0045184)|intracellular transport of viral protein in host cell (GO:0019060)|response to unfolded protein (GO:0006986)|retrograde protein transport, ER to cytosol (GO:0030970)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|Hrd1p ubiquitin ligase complex (GO:0000836)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)	MHC class I protein binding (GO:0042288)|receptor activity (GO:0004872)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)	8	Lung NSC(37;1.06e-09)|Ovarian(258;0.0205)		STAD - Stomach adenocarcinoma(47;0.00527)			AGCTCATTGATTACCCTGCAA	0.388													T|||	265	0.0529153	0.0953	0.0677	5008	,	,		21308	0.005		0.0626	False		,,,				2504	0.0245				p.I171V		.											.	DERL1-226	0			c.A511G						.	T	,VAL/ILE	321,4085	169.1+/-199.8	13,295,1895	64.0	62.0	62.0		,511	4.4	0.8	8	dbSNP_100	62	695,7905	171.3+/-222.3	28,639,3633	yes	intron,missense	DERL1	NM_001134671.1,NM_024295.4	,29	41,934,5528	CC,CT,TT		8.0814,7.2855,7.8118	,benign	,171/252	124031541	1016,11990	2203	4300	6503	SO:0001583	missense	79139	exon7			CATTGATTACCCT	BC002457	CCDS6337.1, CCDS47915.1	8q24.13	2012-02-01	2012-02-01		ENSG00000136986	ENSG00000136986			28454	protein-coding gene	gene with protein product		608813	"""Der1-like domain family, member 1"""			12975309, 15215855	Standard	NM_024295		Approved	MGC3067, PRO2577, FLJ13784, DER1, DER-1, derlin-1	uc003ypl.3	Q9BUN8	OTTHUMG00000165080	ENST00000259512.4:c.511A>G	8.37:g.124031541T>C	ENSP00000259512:p.Ile171Val	Somatic	62	0		WXS	Illumina GAIIx	Phase_I	52	4	NM_024295	0	0	0	0	0	B3KW41|E9PH19	Missense_Mutation	SNP	ENST00000259512.4	37	CCDS6337.1	136	0.06227106227106227	54	0.10975609756097561	35	0.09668508287292818	3	0.005244755244755245	44	0.05804749340369393	T	4.278	0.050812	0.08243	0.072855	0.080814	ENSG00000136986	ENST00000259512;ENST00000419562;ENST00000519018;ENST00000523036	T;T;T;T	0.27104	1.69;1.69;1.69;1.69	5.61	4.45	0.53987	.	0.234322	0.45867	D	0.000330	T	0.00241	0.0007	N	0.04959	-0.14	0.35251	D	0.778677	B;B	0.18310	0.027;0.0	B;B	0.22880	0.042;0.002	T	0.29882	-0.9997	10	0.12430	T	0.62	.	8.8661	0.35286	0.0:0.1439:0.0:0.8561	rs2272722;rs52815824;rs60455215;rs2272722	71;171	B4E1G1;Q9BUN8	.;DERL1_HUMAN	V	171;71;71;71	ENSP00000259512:I171V;ENSP00000389965:I71V;ENSP00000430086:I71V;ENSP00000429199:I71V	ENSP00000259512:I171V	I	-	1	0	DERL1	124100722	0.997000	0.39634	0.766000	0.31476	0.958000	0.62258	2.937000	0.48979	0.953000	0.37825	-0.274000	0.10170	ATC	T|0.926;C|0.074		0.388	DERL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381714.2	NM_024295	
ZNF696	79943	hgsc.bcm.edu	37	8	144378868	144378868	+	Silent	SNP	A	A	G	rs7386259	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr8:144378868A>G	ENST00000330143.3	+	3	1432	c.1023A>G	c.(1021-1023)cgA>cgG	p.R341R		NM_030895.2	NP_112157.2	Q9H7X3	ZN696_HUMAN	zinc finger protein 696	341					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	8	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)			GGCACCAGCGACTCCACACGG	0.726													G|||	4505	0.899561	0.9425	0.9179	5008	,	,		11520	0.8403		0.8608	False		,,,				2504	0.9294				p.R341R		.											.	ZNF696-90	0			c.A1023G						.	G		3773,275		1771,231,22	5.0	5.0	5.0		1023	-0.3	0.0	8	dbSNP_116	5	6735,1261		2843,1049,106	no	coding-synonymous	ZNF696	NM_030895.2		4614,1280,128	GG,GA,AA		15.7704,6.7935,12.7532		341/375	144378868	10508,1536	2024	3998	6022	SO:0001819	synonymous_variant	79943	exon3			CCAGCGACTCCAC	AK024191	CCDS6399.1	8q24.3	2013-01-08				ENSG00000185730		"""Zinc fingers, C2H2-type"""	25872	protein-coding gene	gene with protein product							Standard	NM_030895		Approved	FLJ14129	uc003yxy.4	Q9H7X3		ENST00000330143.3:c.1023A>G	8.37:g.144378868A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	11	9	NM_030895	0	0	0	4	4	A0AVE2	Silent	SNP	ENST00000330143.3	37	CCDS6399.1																																																																																			A|0.118;G|0.882		0.726	ZNF696-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381164.2	NM_030895	
MROH6	642475	hgsc.bcm.edu	37	8	144649625	144649625	+	Silent	SNP	T	T	C	rs10097556	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr8:144649625T>C	ENST00000398882.3	-	14	2200	c.1944A>G	c.(1942-1944)cgA>cgG	p.R648R	MROH6_ENST00000534459.1_5'UTR|MROH6_ENST00000532704.1_Intron|MROH6_ENST00000533679.1_5'UTR|MROH6_ENST00000524906.1_5'UTR	NM_001100878.1	NP_001094348.1	A6NGR9	MROH6_HUMAN	maestro heat-like repeat family member 6	648																	CGCTCTGCAGTCGCCCTAGGT	0.771													C|||	4736	0.945687	0.8041	0.9841	5008	,	,		9094	1.0		0.998	False		,,,				2504	1.0				p.R648R		.											.	.	0			c.A1944G						.						2.0	3.0	2.0					8																	144649625		1227	2564	3791	SO:0001819	synonymous_variant	642475	exon14			CTGCAGTCGCCCT	AF289596	CCDS47928.1	8q24.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000204839	ENSG00000204839		"""maestro heat-like repeat containing"""	27814	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 73"""	C8orf73		12477932	Standard	NM_001100878		Approved		uc010mff.3	A6NGR9	OTTHUMG00000165164	ENST00000398882.3:c.1944A>G	8.37:g.144649625T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	11	11	NM_001100878	0	0	0	2	2	A8MWB1	Silent	SNP	ENST00000398882.3	37	CCDS47928.1																																																																																			T|0.058;C|0.942		0.771	MROH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382330.3	NM_001100878	
TSTA3	7264	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	144695922	144695922	+	Splice_Site	SNP	G	G	A			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr8:144695922G>A	ENST00000425753.2	-	8	832	c.729C>T	c.(727-729)tcC>tcT	p.S243S	TSTA3_ENST00000529064.1_Splice_Site_p.S243S	NM_003313.3	NP_003304.1	Q13630	FCL_HUMAN	tissue specific transplantation antigen P35B	243					'de novo' GDP-L-fucose biosynthetic process (GO:0042351)|cytolysis (GO:0019835)|GDP-mannose metabolic process (GO:0019673)|leukocyte cell-cell adhesion (GO:0007159)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	coenzyme binding (GO:0050662)|electron carrier activity (GO:0009055)|GDP-4-dehydro-D-rhamnose reductase activity (GO:0042356)|GDP-L-fucose synthase activity (GO:0050577)|isomerase activity (GO:0016853)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)|pancreas(1)|prostate(1)|skin(1)	9	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.17e-38)|Epithelial(56;7.17e-37)|all cancers(56;2.46e-32)|Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.239)			GGTACCCACCGGAGAGGATGA	0.597																																					p.S243S		.											.	TSTA3-91	0			c.C729T						.						32.0	28.0	29.0					8																	144695922		2116	4099	6215	SO:0001630	splice_region_variant	7264	exon8			CCCACCGGAGAGG	U58766	CCDS6408.1	8q24.3	2012-02-22			ENSG00000104522	ENSG00000104522	1.1.1.271	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	12390	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 4E, member 1"", ""GDP-L-fucose synthase"""	137020				7803801, 1348494, 19027726	Standard	NM_003313		Approved	FX, P35B, SDR4E1	uc003yzb.2	Q13630	OTTHUMG00000165159	ENST00000425753.2:c.730+1C>T	8.37:g.144695922G>A		Somatic	128	0		WXS	Illumina GAIIx	Phase_I	223	49	NM_003313	0	0	0	1	1	B2R8Y7|D3DWK5|Q567Q9|Q9UDG7	Silent	SNP	ENST00000425753.2	37	CCDS6408.1																																																																																			.		0.597	TSTA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382263.1	NM_003313	Silent
TONSL	4796	hgsc.bcm.edu	37	8	145661675	145661675	+	Missense_Mutation	SNP	G	G	A	rs7830832	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr8:145661675G>A	ENST00000409379.3	-	17	2170	c.2141C>T	c.(2140-2142)gCc>gTc	p.A714V	AC084125.4_ENST00000442850.1_RNA|AC084125.4_ENST00000544423.1_RNA	NM_013432.4	NP_038460.4	Q96HA7	TONSL_HUMAN	tonsoku-like, DNA repair protein	714			A -> V (in dbSNP:rs7830832). {ECO:0000269|PubMed:15489334}.		cytoplasmic sequestering of transcription factor (GO:0042994)|double-strand break repair via homologous recombination (GO:0000724)|regulation of RNA biosynthetic process (GO:2001141)|replication fork processing (GO:0031297)	cytoplasm (GO:0005737)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)	histone binding (GO:0042393)|transcription corepressor activity (GO:0003714)			biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|lung(14)|ovary(3)|prostate(1)|skin(1)	26						CCTGACATGGGCCTGAGAGGC	0.652													G|||	2215	0.442292	0.3192	0.4265	5008	,	,		13977	0.4246		0.4662	False		,,,				2504	0.6135				p.A714V		.											.	TONSL-92	0			c.C2141T						.	G	VAL/ALA	1506,2844		286,934,955	19.0	26.0	24.0		2141	2.8	0.1	8	dbSNP_116	24	3865,4627		955,1955,1336	yes	missense	TONSL	NM_013432.4	64	1241,2889,2291	AA,AG,GG		45.5134,34.6207,41.8237	probably-damaging	714/1379	145661675	5371,7471	2175	4246	6421	SO:0001583	missense	4796	exon17			ACATGGGCCTGAG		CCDS34968.2	8q24.3	2013-01-10	2010-12-02	2010-11-30	ENSG00000160949	ENSG00000160949		"""Ankyrin repeat domain containing"""	7801	protein-coding gene	gene with protein product		604546	"""nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 2"""	NFKBIL2		7738005, 11246458	Standard	NM_013432		Approved	IKBR	uc011llg.2	Q96HA7	OTTHUMG00000153122	ENST00000409379.3:c.2141C>T	8.37:g.145661675G>A	ENSP00000386239:p.Ala714Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	6	NM_013432	0	0	4	6	2	B5MDP0|C9JKB1|C9JNV8|Q13006|Q9UGJ2	Missense_Mutation	SNP	ENST00000409379.3	37	CCDS34968.2	856	0.39194139194139194	153	0.31097560975609756	148	0.4088397790055249	216	0.3776223776223776	339	0.4472295514511873	G	20.8	4.054738	0.75960	0.346207	0.455134	ENSG00000160949	ENST00000409379;ENST00000422691	T	0.48836	0.8	3.73	2.85	0.33270	.	0.748949	0.12251	N	0.485589	T	0.00012	0.0000	L	0.36672	1.1	0.80722	P	0.0	B	0.14805	0.011	B	0.14578	0.011	T	0.45249	-0.9274	9	0.26408	T	0.33	-5.5318	7.1129	0.25401	0.1264:0.0:0.8736:0.0	rs7830832;rs17850384;rs59752457;rs7830832	714	Q96HA7	TONSL_HUMAN	V	714;713	ENSP00000386239:A714V	ENSP00000386239:A714V	A	-	2	0	TONSL	145632483	0.001000	0.12720	0.074000	0.20217	0.742000	0.42306	0.522000	0.22909	0.902000	0.36520	0.462000	0.41574	GCC	G|0.593;A|0.407		0.652	TONSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329668.2	NM_013432	
TUSC1	286319	hgsc.bcm.edu	37	9	25678122	25678122	+	Silent	SNP	G	G	C	rs72631814	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr9:25678122G>C	ENST00000358022.3	-	1	734	c.198C>G	c.(196-198)gcC>gcG	p.A66A		NM_001004125.2	NP_001004125.1	Q2TAM9	TUSC1_HUMAN	tumor suppressor candidate 1	66										kidney(1)	1	all_hematologic(1;0.197)	all_neural(3;5.42e-18)|Glioma(3;5.54e-17)		GBM - Glioblastoma multiforme(1;1.51e-108)|Lung(42;2.88e-14)|LUSC - Lung squamous cell carcinoma(38;3.16e-11)		CCGCCAGGTCGGCAAACCGCT	0.776													G|||	885	0.176717	0.1324	0.1772	5008	,	,		7019	0.1151		0.3002	False		,,,				2504	0.1728				p.A66A	Pancreas(19;648 672 25630 30820 31331)	.											.	TUSC1-90	0			c.C198G						.	G		389,3633		24,341,1646	6.0	6.0	6.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	198	0.6	1.0	9	dbSNP_130	6	1826,6086		225,1376,2355	no	coding-synonymous	TUSC1	NM_001004125.2		249,1717,4001	CC,CG,GG		23.0789,9.6718,18.5604		66/213	25678122	2215,9719	2011	3956	5967	SO:0001819	synonymous_variant	286319	exon1			CAGGTCGGCAAAC	AY168647	CCDS34999.1	9p21.2	2014-05-22			ENSG00000198680	ENSG00000198680			31010	protein-coding gene	gene with protein product		610529				15208665	Standard	NM_001004125		Approved	TSG-9	uc003zpx.3	Q2TAM9	OTTHUMG00000159591	ENST00000358022.3:c.198C>G	9.37:g.25678122G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	13	12	NM_001004125	0	0	0	1	1	A0PJ78|Q67GI3|Q86SS1|Q8TAH8	Silent	SNP	ENST00000358022.3	37	CCDS34999.1																																																																																			G|0.807;C|0.193		0.776	TUSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356351.1	NM_001004125	
DDX58	23586	bcgsc.ca	37	9	32487537	32487537	+	Missense_Mutation	SNP	G	G	T	rs139635230		TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr9:32487537G>T	ENST00000379883.2	-	9	1464	c.1307C>A	c.(1306-1308)gCg>gAg	p.A436E	DDX58_ENST00000379868.1_Missense_Mutation_p.A233E|DDX58_ENST00000379882.1_Missense_Mutation_p.A391E|DDX58_ENST00000545044.1_Missense_Mutation_p.A233E|DDX58_ENST00000542096.1_Missense_Mutation_p.A365E	NM_014314.3	NP_055129.2	O95786	DDX58_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 58	436	Interaction with ZC3HAV1.				cytoplasmic pattern recognition receptor signaling pathway in response to virus (GO:0039528)|detection of virus (GO:0009597)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell migration (GO:0030334)|regulation of type III interferon production (GO:0034344)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|RIG-I signaling pathway (GO:0039529)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	ATP binding (GO:0005524)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|identical protein binding (GO:0042802)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(9)|ovary(2)|pancreas(1)|prostate(1)	27			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;0.00056)		TATCACTGACGCATCAAGAGA	0.453																																					p.A436E		.											.	DDX58-230	0			c.C1307A						.						138.0	122.0	128.0					9																	32487537		2203	4300	6503	SO:0001583	missense	23586	exon9			ACTGACGCATCAA	AF038963	CCDS6526.1	9p12	2011-08-05			ENSG00000107201	ENSG00000107201		"""DEAD-boxes"""	19102	protein-coding gene	gene with protein product	"""RNA helicase RIG-I"", ""retinoic acid inducible gene I"""	609631				21690088	Standard	NM_014314		Approved	RIG-I, FLJ13599, DKFZp434J1111	uc003zra.3	O95786	OTTHUMG00000019746	ENST00000379883.2:c.1307C>A	9.37:g.32487537G>T	ENSP00000369213:p.Ala436Glu	Somatic	178	0		WXS	Illumina GAIIx	Phase_I	128	5	NM_014314	0	0	1	1	0	A2RU81|Q5HYE1|Q5VYT1|Q9NT04	Missense_Mutation	SNP	ENST00000379883.2	37	CCDS6526.1	.	.	.	.	.	.	.	.	.	.	G	13.78	2.337783	0.41398	.	.	ENSG00000107201	ENST00000379882;ENST00000379883;ENST00000379868;ENST00000542096;ENST00000545044	T;T;T;T;T	0.12147	3.26;3.26;3.16;3.13;2.71	4.84	0.93	0.19454	DEAD-like helicase (1);ATPase, AAA+ type, core (1);	0.684951	0.13114	N	0.412788	T	0.30823	0.0777	M	0.77486	2.375	0.09310	N	1	D;D;D;D	0.63046	0.961;0.992;0.971;0.984	P;P;P;P	0.62740	0.665;0.906;0.668;0.668	T	0.08146	-1.0736	10	0.44086	T	0.13	-0.009	8.2406	0.31658	0.4072:0.0:0.5928:0.0	.	233;391;365;436	F5H5W6;O95786-2;B3KWW1;O95786	.;.;.;DDX58_HUMAN	E	391;436;233;365;233	ENSP00000369212:A391E;ENSP00000369213:A436E;ENSP00000369197:A233E;ENSP00000442160:A365E;ENSP00000443055:A233E	ENSP00000369197:A233E	A	-	2	0	DDX58	32477537	0.000000	0.05858	0.172000	0.22920	0.595000	0.36748	0.369000	0.20416	-0.024000	0.13941	-0.145000	0.13849	GCG	G|1.000;A|0.000		0.453	DDX58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052011.1	NM_014314	
CHMP5	51510	hgsc.bcm.edu	37	9	33264540	33264540	+	5'Flank	SNP	C	C	G	rs1071545	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr9:33264540C>G	ENST00000223500.8	+	0	0				BAG1_ENST00000379704.2_5'UTR|CHMP5_ENST00000419016.2_5'Flank|BAG1_ENST00000472232.3_Missense_Mutation_p.G45R	NM_016410.5	NP_057494.3	Q9NZZ3	CHMP5_HUMAN	charged multivesicular body protein 5						endosomal transport (GO:0016197)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|membrane organization (GO:0061024)|protein transport (GO:0015031)|regulation of receptor recycling (GO:0001919)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)	10			LUSC - Lung squamous cell carcinoma(29;0.00506)			GGTGGACGCCCAGAGGGAGGC	0.771													G|||	4905	0.979433	0.9251	0.9942	5008	,	,		8749	1.0		1.0	False		,,,				2504	1.0				p.G45R		.											.	BAG1-228	0			c.G133C						.		,ARG/GLY	3714,198		1759,196,1	4.0	5.0	4.0		,133	3.6	0.0	9	dbSNP_86	4	7514,4		3755,4,0	no	utr-5,missense	BAG1	NM_001172415.1,NM_004323.5	,125	5514,200,1	GG,GC,CC		0.0532,5.0613,1.7673	,benign	,45/346	33264540	11228,202	1956	3759	5715	SO:0001631	upstream_gene_variant	573	exon1			GACGCCCAGAGGG	AF132968	CCDS6537.1, CCDS56569.1	9p13.3	2011-09-21	2011-09-21	2005-08-09	ENSG00000086065	ENSG00000086065		"""Charged multivesicular body proteins"""	26942	protein-coding gene	gene with protein product		610900	"""chromosome 9 open reading frame 83"", ""chromatin modifying protein 5"""	C9orf83, SNF7DC2		15644320, 11559748	Standard	NM_016410		Approved	HSPC177, CGI-34, Vps60	uc003zsm.4	Q9NZZ3	OTTHUMG00000019765		9.37:g.33264540C>G	Exception_encountered	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_004323	0	0	0	20	20	B2RD95|B4DIR6|Q5VXW2|Q96AV2|Q9HB68|Q9NYS4|Q9Y323	Missense_Mutation	SNP	ENST00000223500.8	37	CCDS6537.1	2143	0.9812271062271062	452	0.9186991869918699	361	0.9972375690607734	572	1.0	758	1.0	G	5.424	0.263435	0.10294	0.949387	0.999468	ENSG00000107262	ENST00000472232	.	.	.	3.62	3.62	0.41486	.	0.965269	0.08484	N	0.939035	T	0.00012	0.0000	N	0.08118	0	0.47407	P	5.870000000000042E-4	B	0.02656	0.0	B	0.01281	0.0	T	0.39761	-0.9598	8	0.06236	T	0.91	-3.4106	9.2895	0.37778	0.0:0.2201:0.7798:0.0	rs1071545;rs1702659;rs59772010	45	Q99933	BAG1_HUMAN	R	45	.	ENSP00000420514:G45R	G	-	1	0	BAG1	33254540	0.798000	0.28890	0.040000	0.18447	0.006000	0.05464	0.985000	0.29578	1.113000	0.41760	-0.674000	0.03794	GGG	C|0.976;G|0.024		0.771	CHMP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052040.3	NM_016410	
OR2S2	56656	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	35958062	35958062	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr9:35958062C>G	ENST00000341959.2	-	1	89	c.34G>C	c.(34-36)Ggg>Cgg	p.G12R		NM_019897.2	NP_063950.2	Q9NQN1	OR2S1_HUMAN	olfactory receptor, family 2, subfamily S, member 2	12					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(2)|endometrium(2)|large_intestine(2)|lung(8)|ovary(1)|skin(1)|stomach(1)	17			LUSC - Lung squamous cell carcinoma(32;0.00613)|STAD - Stomach adenocarcinoma(86;0.194)			AGAACGAACCCCATCACAGGG	0.537																																					p.G12R	Pancreas(172;293 2036 17878 24427 30946)	.											.	OR2S2-68	0			c.G34C						.						40.0	40.0	40.0					9																	35958062		2203	4300	6503	SO:0001583	missense	56656	exon1			CGAACCCCATCAC	AL135841	CCDS6596.2	9p13.3	2012-08-09			ENSG00000122718	ENSG00000122718		"""GPCR / Class A : Olfactory receptors"""	8276	protein-coding gene	gene with protein product							Standard	NM_019897		Approved		uc011lpi.2	Q9NQN1	OTTHUMG00000019891	ENST00000341959.2:c.34G>C	9.37:g.35958062C>G	ENSP00000344040:p.Gly12Arg	Somatic	102	0		WXS	Illumina GAIIx	Phase_I	104	13	NM_019897	0	0	0	0	0	Q2M3L0|Q6IF19|Q96R42	Missense_Mutation	SNP	ENST00000341959.2	37	CCDS6596.2	.	.	.	.	.	.	.	.	.	.	C	8.410	0.843976	0.16963	.	.	ENSG00000122718	ENST00000341959	T	0.02974	4.09	4.07	1.17	0.20885	.	0.579808	0.15563	N	0.255848	T	0.02494	0.0076	L	0.38953	1.18	0.09310	N	1	B	0.09022	0.002	B	0.09377	0.004	T	0.42582	-0.9443	10	0.39692	T	0.17	.	5.0597	0.14551	0.1684:0.641:0.0:0.1906	.	12	Q9NQN1	OR2S1_HUMAN	R	12	ENSP00000344040:G12R	ENSP00000344040:G12R	G	-	1	0	OR2S2	35948062	0.000000	0.05858	0.137000	0.22149	0.485000	0.33311	0.816000	0.27267	0.254000	0.21573	0.655000	0.94253	GGG	.		0.537	OR2S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052400.2	NM_019897	
ZCCHC6	79670	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	88954993	88954994	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	AA	AA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr9:88954993_88954994delAA	ENST00000375963.3	-	8	1337_1338	c.1165_1166delTT	c.(1165-1167)ttcfs	p.F389fs	ZCCHC6_ENST00000375960.2_Intron|ZCCHC6_ENST00000375948.1_Frame_Shift_Del_p.F27fs|ZCCHC6_ENST00000277141.6_5'UTR|ZCCHC6_ENST00000375961.2_Frame_Shift_Del_p.F389fs	NM_001185059.1|NM_024617.3	NP_001171988.1|NP_078893.2	Q5VYS8	TUT7_HUMAN	zinc finger, CCHC domain containing 6	389					RNA 3'-end processing (GO:0031123)		poly(A) RNA binding (GO:0044822)|RNA uridylyltransferase activity (GO:0050265)|zinc ion binding (GO:0008270)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	46						CCTAGCATGGAAGTCTGCATCA	0.361																																					p.389_389del		.											.	ZCCHC6-92	0			c.1165_1166del						.																																			SO:0001589	frameshift_variant	79670	exon8			GCATGGAAGTCTG	AL832026	CCDS35057.1, CCDS55323.1	9q21	2014-03-05			ENSG00000083223	ENSG00000083223		"""Zinc fingers, CCHC domain containing"""	25817	protein-coding gene	gene with protein product	"""TUTase7"""					11214970	Standard	NM_001185059		Approved	KIAA1711, FLJ13409, PAPD6, TUT7	uc004aoq.3	Q5VYS8	OTTHUMG00000020137	ENST00000375963.3:c.1165_1166delTT	9.37:g.88954993_88954994delAA	ENSP00000365130:p.Phe389fs	Somatic	64	0		WXS	Illumina GAIIx	Phase_I	53	17	NM_024617	0	0	0	0	0	Q5H9T0|Q5VYS5|Q5VYS7|Q658Z9|Q659A2|Q6MZJ3|Q8N5F0|Q96N57|Q96NE8|Q9C0F2|Q9H8M6	Frame_Shift_Del	DEL	ENST00000375963.3	37	CCDS35057.1																																																																																			.		0.361	ZCCHC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052918.1	NM_024617	
WDR34	89891	hgsc.bcm.edu	37	9	131418828	131418828	+	Missense_Mutation	SNP	A	A	C	rs4837292		TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr9:131418828A>C	ENST00000372715.2	-	1	238	c.178T>G	c.(178-180)Tgg>Ggg	p.W60G		NM_052844.3	NP_443076.2	Q96EX3	WDR34_HUMAN	WD repeat domain 34	60				W -> G (in Ref. 2; AAH11874/AAH01614). {ECO:0000305}.		axoneme (GO:0005930)|centriole (GO:0005814)|ciliary basal body (GO:0036064)				central_nervous_system(2)|lung(5)|skin(1)|urinary_tract(1)	9						ACCGTCTCCCAGCGGATGCCC	0.806																																					p.W60G		.											.	WDR34-92	0			c.T178G						.	C	GLY/TRP	1803,9		897,9,0	1.0	1.0	1.0		178	2.1	1.0	9	dbSNP_111	1	3858,0		1929,0,0	no	missense	WDR34	NM_052844.3	184	2826,9,0	CC,CA,AA		0.0,0.4967,0.1587	benign	60/537	131418828	5661,9	906	1929	2835	SO:0001583	missense	89891	exon1			TCTCCCAGCGGAT	BC011874	CCDS6906.2	9q34.11	2013-11-15	2013-02-19	2013-02-19	ENSG00000119333	ENSG00000119333		"""WD repeat domain containing"""	28296	protein-coding gene	gene with protein product		613363				19521662, 21953912, 24183451	Standard	NM_052844		Approved	DIC5, MGC20486, bA216B9.3, FAP133	uc004bvq.1	Q96EX3	OTTHUMG00000020750	ENST00000372715.2:c.178T>G	9.37:g.131418828A>C	ENSP00000361800:p.Trp60Gly	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_052844	0	0	0	0	0	Q5VXV4|Q9BV46	Missense_Mutation	SNP	ENST00000372715.2	37	CCDS6906.2	2170	0.9935897435897436	486	0.9878048780487805	362	1.0	571	0.9982517482517482	751	0.9907651715039578	C	7.343	0.621247	0.14193	0.995033	1.0	ENSG00000119333	ENST00000372715;ENST00000451652;ENST00000419989	T;T;T	0.74106	-0.81;-0.81;-0.81	4.02	2.12	0.27331	.	0.538297	0.18788	N	0.131154	T	0.00012	0.0000	N	0.00538	-1.39	0.58432	P	1.999999999946489E-6	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.34625	-0.9821	9	0.08381	T	0.77	-3.0135	7.4804	0.27402	0.1755:0.4462:0.3784:0.0	rs4837292;rs56752541	45;60	A2A3F8;Q96EX3	.;WDR34_HUMAN	G	60;51;45	ENSP00000361800:W60G;ENSP00000411370:W51G;ENSP00000415421:W45G	ENSP00000361800:W60G	W	-	1	0	WDR34	130458649	1.000000	0.71417	0.994000	0.49952	0.970000	0.65996	0.709000	0.25734	0.259000	0.21709	-0.126000	0.14955	TGG	A|0.006;C|0.994		0.806	WDR34-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054463.1	NM_052844	
SURF2	6835	hgsc.bcm.edu	37	9	136223541	136223541	+	Missense_Mutation	SNP	C	C	T	rs143037947	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr9:136223541C>T	ENST00000371964.4	+	1	114	c.73C>T	c.(73-75)Cgc>Tgc	p.R25C	SURF1_ENST00000495952.1_5'Flank|SURF2_ENST00000495524.1_3'UTR|SURF1_ENST00000371974.3_5'Flank	NM_017503.3	NP_059973.4	Q15527	SURF2_HUMAN	surfeit 2	25						nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|large_intestine(1)|lung(4)	6				OV - Ovarian serous cystadenocarcinoma(145;4.87e-07)|Epithelial(140;4.02e-06)|all cancers(34;3.71e-05)		GACGGACGCCCGCAAGGTTCG	0.736													C|||	121	0.0241613	0.0015	0.0922	5008	,	,		6577	0.001		0.0129	False		,,,				2504	0.0419				p.R25C		.											.	SURF2-226	0			c.C73T						.	C	CYS/ARG	8,2794		0,8,1393	2.0	3.0	3.0		73	-5.3	0.0	9	dbSNP_134	3	79,6487		0,79,3204	yes	missense	SURF2	NM_017503.3	180	0,87,4597	TT,TC,CC		1.2032,0.2855,0.9287	benign	25/257	136223541	87,9281	1401	3283	4684	SO:0001583	missense	6835	exon1			GACGCCCGCAAGG		CCDS6967.1	9q33-q34	2008-07-21			ENSG00000148291	ENSG00000148291			11475	protein-coding gene	gene with protein product	"""surfeit locus protein 2"""	185630					Standard	NM_017503		Approved		uc004cdi.2	Q15527	OTTHUMG00000020867	ENST00000371964.4:c.73C>T	9.37:g.136223541C>T	ENSP00000361032:p.Arg25Cys	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	15	7	NM_017503	0	0	0	0	0	Q6IBP9|Q96CD1	Missense_Mutation	SNP	ENST00000371964.4	37	CCDS6967.1	64	0.029304029304029304	10	0.02032520325203252	31	0.0856353591160221	11	0.019230769230769232	12	0.0158311345646438	C	10.47	1.358826	0.24598	0.002855	0.012032	ENSG00000148291	ENST00000371964	T	0.32753	1.44	2.63	-5.26	0.02772	.	1.643460	0.03313	N	0.190733	T	0.00608	0.0020	N	0.16478	0.41	0.09310	N	1	B	0.16603	0.018	B	0.10450	0.005	T	0.12218	-1.0556	10	0.51188	T	0.08	-4.7044	4.956	0.14041	0.1023:0.1208:0.5084:0.2685	.	25	Q15527	SURF2_HUMAN	C	25	ENSP00000361032:R25C	ENSP00000361032:R25C	R	+	1	0	SURF2	135213362	0.000000	0.05858	0.000000	0.03702	0.061000	0.15899	-4.104000	0.00294	-2.470000	0.00530	0.297000	0.19635	CGC	C|0.971;T|0.029		0.736	SURF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054883.1	NM_017503	
DBH	1621	hgsc.bcm.edu;bcgsc.ca	37	9	136501584	136501584	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr9:136501584G>T	ENST00000393056.2	+	1	103	c.91G>T	c.(91-93)Gtc>Ttc	p.V31F		NM_000787.3	NP_000778.3	P09172	DOPO_HUMAN	dopamine beta-hydroxylase (dopamine beta-monooxygenase)	31					behavioral response to ethanol (GO:0048149)|blood vessel remodeling (GO:0001974)|catecholamine biosynthetic process (GO:0042423)|cellular nitrogen compound metabolic process (GO:0034641)|cytokine production (GO:0001816)|dopamine catabolic process (GO:0042420)|fear response (GO:0042596)|glucose homeostasis (GO:0042593)|homoiothermy (GO:0042309)|leukocyte mediated immunity (GO:0002443)|leukocyte migration (GO:0050900)|locomotory behavior (GO:0007626)|maternal behavior (GO:0042711)|memory (GO:0007613)|norepinephrine biosynthetic process (GO:0042421)|positive regulation of vasoconstriction (GO:0045907)|regulation of cell proliferation (GO:0042127)|regulation of extrinsic apoptotic signaling pathway (GO:2001236)|response to amphetamine (GO:0001975)|response to pain (GO:0048265)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|secretory granule lumen (GO:0034774)	catalytic activity (GO:0003824)|copper ion binding (GO:0005507)|dopamine beta-monooxygenase activity (GO:0004500)|L-ascorbic acid binding (GO:0031418)			central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(9)|liver(1)|lung(6)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	36				OV - Ovarian serous cystadenocarcinoma(145;2.33e-07)|Epithelial(140;1.5e-06)|all cancers(34;1.66e-05)	Disulfiram(DB00822)|Dopamine(DB00988)|Propylthiouracil(DB00550)|Vitamin C(DB00126)	CATCTTCCTGGTCATCCTGGT	0.687																																					p.V31F		.											.	DBH-516	0			c.G91T						.						45.0	44.0	44.0					9																	136501584		2203	4300	6503	SO:0001583	missense	1621	exon1			TTCCTGGTCATCC	X13256	CCDS6977.2	9q34	2013-06-03			ENSG00000123454	ENSG00000123454	1.14.17.1		2689	protein-coding gene	gene with protein product		609312					Standard	NM_000787		Approved	DBM	uc004cel.3	P09172	OTTHUMG00000020878	ENST00000393056.2:c.91G>T	9.37:g.136501584G>T	ENSP00000376776:p.Val31Phe	Somatic	36	0		WXS	Illumina GAIIx	Phase_I	100	5	NM_000787	0	0	0	0	0	Q5T381|Q96AG2	Missense_Mutation	SNP	ENST00000393056.2	37	CCDS6977.2	.	.	.	.	.	.	.	.	.	.	G	19.85	3.903799	0.72754	.	.	ENSG00000123454	ENST00000393056;ENST00000371880;ENST00000263611	T;T	0.52983	0.66;0.64	5.5	4.5	0.54988	.	0.171142	0.51477	D	0.000084	T	0.52725	0.1752	M	0.73598	2.24	0.51233	D	0.99991	D	0.53619	0.961	P	0.50405	0.64	T	0.58346	-0.7652	10	0.72032	D	0.01	-32.764	5.9731	0.19363	0.1788:0.1785:0.6427:0.0	.	31	P09172	DOPO_HUMAN	F	31;17;17	ENSP00000376776:V31F;ENSP00000263611:V17F	ENSP00000263611:V17F	V	+	1	0	DBH	135491405	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	3.419000	0.52728	2.597000	0.87782	0.491000	0.48974	GTC	.		0.687	DBH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054929.2	NM_000787	
ENTPD2	954	hgsc.bcm.edu	37	9	139943400	139943400	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr9:139943400T>A	ENST00000355097.2	-	8	1324	c.1277A>T	c.(1276-1278)cAg>cTg	p.Q426L	ENTPD2_ENST00000312665.5_Missense_Mutation_p.Q403L|NPDC1_ENST00000371601.4_5'Flank|ENTPD2_ENST00000460614.1_5'UTR|NPDC1_ENST00000488145.1_5'Flank	NM_001246.3|NM_203468.2	NP_001237.1|NP_982293.1	Q9Y5L3	ENTP2_HUMAN	ectonucleoside triphosphate diphosphohydrolase 2	426					G-protein coupled receptor signaling pathway (GO:0007186)|platelet activation (GO:0030168)|purine ribonucleoside diphosphate catabolic process (GO:0009181)	basal lamina (GO:0005605)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|nucleoside-diphosphatase activity (GO:0017110)|nucleoside-triphosphatase activity (GO:0017111)			endometrium(1)|lung(5)|prostate(1)|skin(2)|urinary_tract(3)	12	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		CACCTTCTTCTGGAAGATCAC	0.746																																					p.Q426L		.											.	ENTPD2-90	0			c.A1277T						.						1.0	2.0	2.0					9																	139943400		1150	2640	3790	SO:0001583	missense	954	exon8			TTCTTCTGGAAGA	U91510	CCDS7025.1, CCDS7026.1	9q34	2008-07-21			ENSG00000054179	ENSG00000054179			3364	protein-coding gene	gene with protein product	"""CD39-like-1"", ""ecto-ATPase"""	602012		CD39L1		9271669	Standard	NM_203468		Approved	NTPDase-2	uc004ckw.2	Q9Y5L3	OTTHUMG00000020953	ENST00000355097.2:c.1277A>T	9.37:g.139943400T>A	ENSP00000347213:p.Gln426Leu	Somatic	6	0		WXS	Illumina GAIIx	Phase_I	21	21	NM_203468	0	0	0	0	0	O15464|Q5SPY6|Q5SPY7	Missense_Mutation	SNP	ENST00000355097.2	37	CCDS7026.1	.	.	.	.	.	.	.	.	.	.	T	16.12	3.034123	0.54896	.	.	ENSG00000054179	ENST00000355097;ENST00000312665	T;T	0.12361	2.91;2.69	3.65	2.5	0.30297	.	0.058782	0.64402	D	0.000001	T	0.27594	0.0678	M	0.72894	2.215	0.44603	D	0.997574	D;D;D	0.65815	0.995;0.993;0.993	P;P;P	0.62014	0.897;0.794;0.794	T	0.01334	-1.1382	10	0.34782	T	0.22	-10.5801	8.1048	0.30879	0.0:0.1002:0.0:0.8998	.	403;426;426	Q9Y5L3-2;Q9Y5L3;Q5SPY7	.;ENTP2_HUMAN;.	L	426;403	ENSP00000347213:Q426L;ENSP00000312494:Q403L	ENSP00000312494:Q403L	Q	-	2	0	ENTPD2	139063221	1.000000	0.71417	0.983000	0.44433	0.461000	0.32589	2.260000	0.43267	0.579000	0.29504	0.368000	0.22195	CAG	.		0.746	ENTPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055169.1	NM_203468	
RBM3	5935	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	48433575	48433575	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chrX:48433575T>A	ENST00000376759.3	+	2	70	c.7T>A	c.(7-9)Tct>Act	p.S3T	RBM3_ENST00000354480.2_5'Flank|RBM3_ENST00000376755.1_Missense_Mutation_p.S3T|RBM3_ENST00000430348.2_De_novo_Start_OutOfFrame|RBM3_ENST00000466764.1_3'UTR|AC115618.1_ENST00000376775.2_5'Flank	NM_006743.4	NP_006734.1	P98179	RBM3_HUMAN	RNA binding motif (RNP1, RRM) protein 3	3					positive regulation of translation (GO:0045727)|production of miRNAs involved in gene silencing by miRNA (GO:0035196)|regulation of translation (GO:0006417)|response to cold (GO:0009409)|RNA processing (GO:0006396)|translation (GO:0006412)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|ribosomal large subunit binding (GO:0043023)|RNA binding (GO:0003723)			endometrium(1)|large_intestine(1)|lung(1)|ovary(1)	4						TGCCATGTCCTCTGAAGAAGG	0.498											OREG0019765	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S3T		.											.	RBM3-131	0			c.T7A						.						66.0	48.0	54.0					X																	48433575		2203	4300	6503	SO:0001583	missense	5935	exon2			ATGTCCTCTGAAG	BC006825	CCDS14301.1	Xp11.2	2014-05-19	2004-04-23		ENSG00000102317	ENSG00000102317		"""RNA binding motif (RRM) containing"""	9900	protein-coding gene	gene with protein product		300027	"""RNA binding motif protein 3"""			8634703	Standard	NM_006743		Approved	IS1-RNPL	uc004dkf.2	P98179	OTTHUMG00000024121	ENST00000376759.3:c.7T>A	X.37:g.48433575T>A	ENSP00000365950:p.Ser3Thr	Somatic	42	0	954	WXS	Illumina GAIIx	Phase_I	43	19	NM_006743	0	0	30	103	73		Missense_Mutation	SNP	ENST00000376759.3	37	CCDS14301.1	.	.	.	.	.	.	.	.	.	.	T	22.4	4.289749	0.80914	.	.	ENSG00000102317	ENST00000376759;ENST00000376755	T;T	0.18338	2.22;2.22	4.55	4.55	0.56014	.	0.385400	0.20491	U	0.091282	T	0.30759	0.0775	L	0.49455	1.56	0.80722	D	1	D	0.62365	0.991	P	0.60541	0.876	T	0.02404	-1.1164	10	0.72032	D	0.01	-11.0599	11.0012	0.47607	0.0:0.0:0.0:1.0	.	3	P98179	RBM3_HUMAN	T	3	ENSP00000365950:S3T;ENSP00000365946:S3T	ENSP00000365946:S3T	S	+	1	0	RBM3	48318519	1.000000	0.71417	0.986000	0.45419	0.860000	0.49131	4.084000	0.57650	1.797000	0.52628	0.417000	0.27973	TCT	.		0.498	RBM3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060755.1	NM_006743	
RRAGB	10325	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	55758011	55758011	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chrX:55758011C>G	ENST00000262850.7	+	6	1035	c.592C>G	c.(592-594)Cgg>Ggg	p.R198G	RRAGB_ENST00000374941.4_Missense_Mutation_p.R170G|RRAGB_ENST00000474757.1_3'UTR	NM_016656.3	NP_057740.2			Ras-related GTP binding B											breast(1)|endometrium(3)|large_intestine(5)|lung(3)|pancreas(1)|prostate(1)	14						GGAGGATCAACGGGACCTGGT	0.413																																					p.R198G		.											.	RRAGB-130	0			c.C592G						.						39.0	31.0	34.0					X																	55758011		2203	4299	6502	SO:0001583	missense	10325	exon6			GATCAACGGGACC	X90530	CCDS14371.1, CCDS14372.1	Xp11.21	2008-02-05			ENSG00000083750	ENSG00000083750			19901	protein-coding gene	gene with protein product		300725				7499430, 9394008	Standard	NM_006064		Approved		uc004dup.3	Q5VZM2	OTTHUMG00000021662	ENST00000262850.7:c.592C>G	X.37:g.55758011C>G	ENSP00000262850:p.Arg198Gly	Somatic	52	0		WXS	Illumina GAIIx	Phase_I	29	9	NM_016656	0	0	4	5	1		Missense_Mutation	SNP	ENST00000262850.7	37	CCDS14372.1	.	.	.	.	.	.	.	.	.	.	C	15.74	2.923625	0.52653	.	.	ENSG00000083750	ENST00000374941;ENST00000414239;ENST00000262850	T;T	0.71579	-0.58;-0.51	4.74	3.84	0.44239	.	0.000000	0.85682	D	0.000000	D	0.85822	0.5786	M	0.90870	3.155	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	D	0.87347	0.2335	10	0.87932	D	0	-8.8928	11.2382	0.48953	0.1843:0.8157:0.0:0.0	.	170;198	Q5VZM2-2;Q5VZM2	.;RRAGB_HUMAN	G	170;132;198	ENSP00000364077:R170G;ENSP00000410630:R132G	ENSP00000262850:R198G	R	+	1	2	RRAGB	55774736	1.000000	0.71417	1.000000	0.80357	0.824000	0.46624	3.645000	0.54389	0.875000	0.35847	0.529000	0.55759	CGG	.		0.413	RRAGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056878.1	NM_016656	
P2RY4	5030	bcgsc.ca	37	X	69478421	69478421	+	Missense_Mutation	SNP	G	G	T	rs72628860	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chrX:69478421G>T	ENST00000374519.2	-	1	1233	c.1054C>A	c.(1054-1056)Ccc>Acc	p.P352T		NM_002565.3	NP_002556.1	P51582	P2RY4_HUMAN	pyrimidinergic receptor P2Y, G-protein coupled, 4	352				P -> T (in Ref. 5; AAH96069). {ECO:0000305}.	phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|transepithelial chloride transport (GO:0030321)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|uridine nucleotide receptor activity (GO:0015065)|UTP-activated nucleotide receptor activity (GO:0045030)			cervix(2)|endometrium(2)|large_intestine(8)|lung(6)	18						CTGTCCTGGGGGGTGGCCGCC	0.622													G|||	156	0.0413245	0.0507	0.0072	3775	,	,		13258	0.0466		0.0179	False		,,,				2504	0.0194				p.P352T		.											.	P2RY4-540	0			c.C1054A						.	G	THR/PRO	210,3620		4,172,30,1454,540	41.0	43.0	42.0		1054	1.9	0.0	X	dbSNP_130	42	231,6497		5,161,60,2262,1812	yes	missense	P2RY4	NM_002565.3	38	9,333,90,3716,2352	TT,TG,T,GG,G		3.4334,5.483,4.1769	benign	352/366	69478421	441,10117	2200	4300	6500	SO:0001583	missense	5030	exon1			CCTGGGGGGTGGC	X91852	CCDS14398.1	Xq13	2012-08-08			ENSG00000186912	ENSG00000186912		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8542	protein-coding gene	gene with protein product		300038				8537336	Standard	NM_002565		Approved	NRU, P2Y4, UNR, P2P	uc004dxz.1	P51582	OTTHUMG00000021769	ENST00000374519.2:c.1054C>A	X.37:g.69478421G>T	ENSP00000363643:p.Pro352Thr	Somatic	179	2		WXS	Illumina GAIIx	Phase_I	155	10	NM_002565	0	0	0	0	0	Q4VBB7|Q4VBB8|Q502W2|Q5JT22	Missense_Mutation	SNP	ENST00000374519.2	37	CCDS14398.1	61	0.03676913803496082	22	0.04564315352697095	1	0.002777777777777778	12	0.021505376344086023	8	0.0106951871657754	G	4.718	0.133566	0.09032	0.05483	0.034334	ENSG00000186912	ENST00000374519	T	0.71103	-0.54	4.7	1.88	0.25563	.	1.020860	0.07884	U	0.969964	T	0.10294	0.0252	N	0.08118	0	0.80722	P	0.0	B	0.20671	0.047	B	0.12156	0.007	T	0.21348	-1.0248	9	0.07644	T	0.81	.	4.343	0.11119	0.1999:0.0:0.6208:0.1792	.	352	P51582	P2RY4_HUMAN	T	352	ENSP00000363643:P352T	ENSP00000363643:P352T	P	-	1	0	P2RY4	69395146	0.000000	0.05858	0.000000	0.03702	0.027000	0.11550	-0.263000	0.08670	0.070000	0.16634	-0.205000	0.12727	CCC	G|0.960;T|0.040		0.622	P2RY4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057058.2	NM_002565	
CDX4	1046	broad.mit.edu;bcgsc.ca	37	X	72674262	72674262	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chrX:72674262C>G	ENST00000373514.2	+	3	696	c.696C>G	c.(694-696)atC>atG	p.I232M		NM_005193.1	NP_005184.1	O14627	CDX4_HUMAN	caudal type homeobox 4	232					anterior/posterior pattern specification (GO:0009952)|blood vessel development (GO:0001568)|labyrinthine layer development (GO:0060711)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			endometrium(4)|kidney(1)|large_intestine(1)|lung(11)|skin(1)	18	Renal(35;0.156)					GAAAGATGATCAAAAAGAAAA	0.433																																					p.I232M		.											.	CDX4-130	0			c.C696G						.						106.0	90.0	96.0					X																	72674262		2203	4300	6503	SO:0001583	missense	1046	exon3			GATGATCAAAAAG	AF029879	CCDS14424.1	Xq13.2	2012-03-09	2007-07-09		ENSG00000131264	ENSG00000131264		"""Homeoboxes / ANTP class : HOXL subclass"""	1808	protein-coding gene	gene with protein product		300025	"""caudal type homeo box transcription factor 4"""			7655457	Standard	NM_005193		Approved		uc011mqk.2	O14627	OTTHUMG00000021831	ENST00000373514.2:c.696C>G	X.37:g.72674262C>G	ENSP00000362613:p.Ile232Met	Somatic	98	1		WXS	Illumina GAIIx	Phase_I	72	4	NM_005193	0	0	0	0	0	A1A513|Q5JS20	Missense_Mutation	SNP	ENST00000373514.2	37	CCDS14424.1	.	.	.	.	.	.	.	.	.	.	C	13.72	2.320097	0.41096	.	.	ENSG00000131264	ENST00000373514	D	0.92397	-3.03	4.05	0.856	0.19019	Homeobox (1);Homeodomain-like (1);	0.202144	0.41294	D	0.000914	D	0.90573	0.7045	L	0.38838	1.175	0.42504	D	0.992944	D	0.65815	0.995	P	0.59221	0.854	D	0.87429	0.2387	10	0.52906	T	0.07	-12.0554	7.7023	0.28630	0.31:0.5401:0.1499:0.0	.	232	O14627	CDX4_HUMAN	M	232	ENSP00000362613:I232M	ENSP00000362613:I232M	I	+	3	3	CDX4	72590987	1.000000	0.71417	0.995000	0.50966	0.980000	0.70556	1.818000	0.39012	0.157000	0.19338	0.429000	0.28392	ATC	.		0.433	CDX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057229.2	NM_005193	
ECE1	1889	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	21599251	21599252	+	Frame_Shift_Ins	INS	-	-	GT			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr1:21599251_21599252insGT	ENST00000374893.6	-	4	507_508	c.433_434insAC	c.(433-435)cgcfs	p.R145fs	ECE1_ENST00000436918.2_Frame_Shift_Ins_p.R145fs|ECE1_ENST00000357071.4_Frame_Shift_Ins_p.R133fs|ECE1_ENST00000264205.6_Frame_Shift_Ins_p.R142fs|ECE1_ENST00000415912.2_Frame_Shift_Ins_p.R129fs	NM_001397.2	NP_001388.1	P42892	ECE1_HUMAN	endothelin converting enzyme 1	145					bradykinin catabolic process (GO:0010815)|calcitonin catabolic process (GO:0010816)|ear development (GO:0043583)|embryonic digit morphogenesis (GO:0042733)|endothelin maturation (GO:0034959)|heart development (GO:0007507)|hormone catabolic process (GO:0042447)|peptide hormone processing (GO:0016486)|pharyngeal system development (GO:0060037)|positive regulation of receptor recycling (GO:0001921)|protein processing (GO:0016485)|regulation of systemic arterial blood pressure by endothelin (GO:0003100)|regulation of vasoconstriction (GO:0019229)|substance P catabolic process (GO:0010814)	early endosome (GO:0005769)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intrinsic component of endosome membrane (GO:0031302)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)|Weibel-Palade body (GO:0033093)	endopeptidase activity (GO:0004175)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|peptide hormone binding (GO:0017046)|protein homodimerization activity (GO:0042803)			endometrium(5)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(1)	25		Lung NSC(340;1.14e-05)|all_lung(284;1.23e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00147)|Ovarian(437;0.00432)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0183)|OV - Ovarian serous cystadenocarcinoma(117;4.83e-27)|COAD - Colon adenocarcinoma(152;1.36e-06)|GBM - Glioblastoma multiforme(114;1.47e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000162)|STAD - Stomach adenocarcinoma(196;0.00326)|KIRC - Kidney renal clear cell carcinoma(1967;0.00755)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.206)		GGTCCCCCAGCGTGAGTGGCCA	0.584																																					p.R145fs		.											.	ECE1-93	0			c.434_435insAC						.																																			SO:0001589	frameshift_variant	1889	exon4			CCCCAGCGTGAGT	D49471	CCDS215.1, CCDS44081.1, CCDS44082.1, CCDS44083.1	1p36.1	2008-02-05			ENSG00000117298	ENSG00000117298			3146	protein-coding gene	gene with protein product		600423		ECE		7805846, 7864876, 17592116	Standard	NM_001397		Approved		uc001bei.2	P42892	OTTHUMG00000002625	ENST00000374893.6:c.432_433dupAC	1.37:g.21599252_21599253dupGT	ENSP00000364028:p.Arg145fs	Somatic	217	0		WXS	Illumina GAIIx	Phase_I	319	87	NM_001397	0	0	0	0	0	A8K3P1|B4E291|Q14217|Q17RN5|Q2Z2K8|Q58GE7|Q5THM5|Q5THM7|Q5THM8|Q9UJQ6|Q9UPF4|Q9UPM4|Q9Y501	Frame_Shift_Ins	INS	ENST00000374893.6	37	CCDS215.1																																																																																			.		0.584	ECE1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000007470.2	NM_001397	
PCBP2	5094	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	53856277	53856278	+	Frame_Shift_Ins	INS	-	-	C			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr12:53856277_53856278insC	ENST00000439930.3	+	7	539_540	c.517_518insC	c.(517-519)tccfs	p.S173fs	PCBP2_ENST00000552819.1_Frame_Shift_Ins_p.S173fs|PCBP2_ENST00000359282.5_Splice_Site_p.S169fs|RP11-793H13.8_ENST00000547717.1_RNA|PCBP2_ENST00000541275.1_Splice_Site_p.S169fs|PCBP2_ENST00000455667.3_Splice_Site_p.S169fs|PCBP2_ENST00000552296.2_Splice_Site_p.S169fs|PCBP2_ENST00000359462.5_Frame_Shift_Ins_p.S173fs|PCBP2_ENST00000437231.1_Splice_Site_p.S169fs|PCBP2_ENST00000549863.1_Frame_Shift_Ins_p.S173fs|PCBP2_ENST00000603815.1_Frame_Shift_Ins_p.S173fs|PCBP2_ENST00000447282.1_Frame_Shift_Ins_p.S173fs|PCBP2_ENST00000546463.1_Splice_Site_p.S169fs|PCBP2_ENST00000548933.1_Frame_Shift_Ins_p.S173fs			Q15366	PCBP2_HUMAN	poly(rC) binding protein 2	173					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of defense response to virus (GO:0050687)|negative regulation of type I interferon production (GO:0032480)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(4)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	15						TCTCTCCCAGTCCCCCCCGAAG	0.5																																					p.S173fs		.											.	PCBP2-226	0			c.517_518insC						.																																			SO:0001589	frameshift_variant	5094	exon8			TCCCAGTCCCCCC	BC035420	CCDS8859.1, CCDS44900.1, CCDS44901.1, CCDS44902.1, CCDS44903.1, CCDS44904.1, CCDS55830.1	12q13.13	2013-10-30	2001-11-28		ENSG00000197111	ENSG00000197111			8648	protein-coding gene	gene with protein product	"""heterogenous nuclear ribonucleoprotein E2"""	601210	"""poly(rC)-binding protein 2"""			8833161	Standard	NM_001098620		Approved	HNRPE2, hnRNP-E2, HNRNPE2	uc001sdc.4	Q15366	OTTHUMG00000169439	ENST00000439930.3:c.524dupC	12.37:g.53856284_53856284dupC	ENSP00000408949:p.Ser173fs	Somatic	81	0		WXS	Illumina GAIIx	Phase_I	84	18	NM_005016	0	0	0	0	0	A8K7X6|F8VYL7|G3V0E8|I6L8F9|Q32Q82|Q59HD4|Q68Y55|Q6IPF4|Q6PKG5	Frame_Shift_Ins	INS	ENST00000439930.3	37	CCDS44901.1																																																																																			.		0.500	PCBP2-027	NOVEL	NAGNAG_splice_site|non_canonical_conserved|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000407545.2	NM_005016	
TP53	7157	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	7574011	7574012	+	Frame_Shift_Ins	INS	-	-	CGAAG	rs17882252	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr17:7574011_7574012insCGAAG	ENST00000269305.4	-	10	1204_1205	c.1015_1016insCTTCG	c.(1015-1017)gagfs	p.E339fs	TP53_ENST00000445888.2_Frame_Shift_Ins_p.E339fs|TP53_ENST00000359597.4_Intron|TP53_ENST00000455263.2_3'UTR|TP53_ENST00000413465.2_Intron|TP53_ENST00000420246.2_3'UTR	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	339	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.|Interaction with HIPK2.|Oligomerization.		E -> K (in a sporadic cancer; somatic mutation; dbSNP:rs17882252). {ECO:0000269|Ref.12}.|E -> Q (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.E339*(14)|p.0?(8)|p.E339fs*8(2)|p.E339Q(1)|p.?(1)|p.F338fs*6(1)|p.F338_E339>L(1)|p.E339fs*13(1)|p.I332fs*5(1)|p.E339K(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCGGAACATCTCGAAGCGCTCA	0.54		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.E339fs	Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	.	TP53-70225	31	Substitution - Nonsense(14)|Whole gene deletion(8)|Insertion - Frameshift(3)|Unknown(2)|Deletion - Frameshift(2)|Substitution - Missense(2)	upper_aerodigestive_tract(5)|breast(5)|liver(4)|bone(4)|large_intestine(3)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(2)|pancreas(2)|stomach(1)|oesophagus(1)|ovary(1)	c.1016_1017insCTTCG	GRCh37	CM984588	TP53	M	rs17882252	.																																			SO:0001589	frameshift_variant	7157	exon10	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AACATCTCGAAGC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.1011_1015dupCTTCG	17.37:g.7574012_7574016dupCGAAG	ENSP00000269305:p.Glu339fs	Somatic	176	0		WXS	Illumina GAIIx	Phase_I	118	25	NM_001126112	0	0	0	0	0	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Ins	INS	ENST00000269305.4	37	CCDS11118.1																																																																																			.		0.540	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
KRTAP4-5	85289	broad.mit.edu	37	17	39305775	39305776	+	In_Frame_Ins	INS	-	-	GGCAGCAGCTGGGGC	rs535144703|rs141265645|rs58117746|rs146438235	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr17:39305775_39305776insGGCAGCAGCTGGGGC	ENST00000343246.4	-	1	278_279	c.244_245insGCCCCAGCTGCTGCC	c.(244-246)cag>cGCCCCAGCTGCTGCCag	p.81_82insRPSCC		NM_033188.3	NP_149445.3	Q9BYR2	KRA45_HUMAN	keratin associated protein 4-5	81	26 X 5 AA repeats of C-C-[GRQVCHIEK]- [SPTR]-[VSTQYC].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(4)	6		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			gcaggtggtctggcagcagcag	0.653														2119	0.423123	0.5401	0.4236	5008	,	,		17097	0.3065		0.3897	False		,,,				2504	0.4192				p.Q82delinsRPSCCQ		.											.	KRTAP4-5-90	0			c.245_246insGCCCCAGCTGCTGCC						.																																			SO:0001652	inframe_insertion	85289	exon1			GTGGTCTGGCAGC	AJ406937	CCDS32650.1	17q21.2	2013-06-25			ENSG00000198271	ENSG00000198271		"""Keratin associated proteins"""	18899	protein-coding gene	gene with protein product						11279113	Standard	NM_033188		Approved	KAP4.5	uc002hwb.3	Q9BYR2	OTTHUMG00000133638	ENST00000343246.4:c.244_245insGCCCCAGCTGCTGCC	17.37:g.39305775_39305776insGGCAGCAGCTGGGGC	ENSP00000340546:p.Cys81_Gln82insArgProSerCysCys	Somatic	11	0		WXS	Illumina GAIIx	Phase_I	94	66	NM_033188	0	0	0	0	0		In_Frame_Ins	INS	ENST00000343246.4	37	CCDS32650.1																																																																																			.		0.653	KRTAP4-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257783.1		
LPHN1	22859	broad.mit.edu	37	19	14272186	14272187	+	Frame_Shift_Ins	INS	-	-	C			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr19:14272186_14272187insC	ENST00000340736.6	-	7	1759_1760	c.1462_1463insG	c.(1462-1464)gtcfs	p.V488fs	CTB-55O6.12_ENST00000592086.1_RNA|LPHN1_ENST00000361434.3_Frame_Shift_Ins_p.V483fs|CTB-55O6.12_ENST00000588387.1_RNA|LPHN1_ENST00000591528.1_5'Flank	NM_001008701.2	NP_001008701.1	O94910	LPHN1_HUMAN	latrophilin 1	488					calcium-mediated signaling using intracellular calcium source (GO:0035584)|G-protein coupled receptor signaling pathway (GO:0007186)|heterophilic cell-cell adhesion (GO:0007157)|neuropeptide signaling pathway (GO:0007218)|positive regulation of synapse maturation (GO:0090129)	axon (GO:0030424)|cell junction (GO:0030054)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|synapse (GO:0045202)	carbohydrate binding (GO:0030246)|cell adhesion molecule binding (GO:0050839)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)			central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(3)|liver(1)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						CGGCCACTGGACCCGCCGTACC	0.713																																					p.V488fs		.											.	LPHN1-523	0			c.1463_1464insG						.																																			SO:0001589	frameshift_variant	22859	exon7			CACTGGACCCGCC	AB020628	CCDS12307.1, CCDS32928.1	19p13.2	2014-08-08				ENSG00000072071		"""-"", ""GPCR / Class B : Orphans"""	20973	protein-coding gene	gene with protein product						10994649	Standard	NM_014921		Approved	KIAA0821, CIRL1, LEC2	uc010xnn.2	O94910		ENST00000340736.6:c.1463dupG	19.37:g.14272189_14272189dupC	ENSP00000340688:p.Val488fs	Somatic	20	0		WXS	Illumina GAIIx	Phase_I	139	7	NM_001008701	0	0	0	0	0	Q96IE7|Q9BU07|Q9HAR3	Frame_Shift_Ins	INS	ENST00000340736.6	37	CCDS32928.1																																																																																			.		0.713	LPHN1-001	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000459696.1	NM_014921	
C21orf58	54058	broad.mit.edu	37	21	47721985	47721986	+	In_Frame_Ins	INS	-	-	TGG	rs144178764|rs112899928|rs35902237|rs71318063	byFrequency	TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr21:47721985_47721986insTGG	ENST00000291691.7	-	8	2032_2033	c.896_897insCCA	c.(895-897)cat>caCCAt	p.299_299H>HH	C21orf58_ENST00000397682.3_In_Frame_Ins_p.193_193H>HH|C21orf58_ENST00000472607.1_5'UTR|C21orf58_ENST00000397680.1_In_Frame_Ins_p.193_193H>HH|C21orf58_ENST00000397679.1_In_Frame_Ins_p.193_193H>HH|C21orf58_ENST00000397683.1_In_Frame_Ins_p.193_193H>HH	NM_058180.3	NP_478060.2	P58505	CU058_HUMAN	chromosome 21 open reading frame 58	299	Poly-His.							p.H299_A300insH(3)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|lung(1)|pancreas(1)	9	Breast(49;0.112)			Colorectal(79;0.239)		GCCACACAGCAtggtggtggtg	0.708														1382	0.275958	0.1384	0.4063	5008	,	,		16708	0.3046		0.3091	False		,,,				2504	0.3057				p.H299delinsHH		.											.	C21orf58-91	3	Insertion - In frame(3)	breast(2)|central_nervous_system(1)	c.897_898insCCA						.																																			SO:0001652	inframe_insertion	54058	exon8			CACAGCATGGTGG		CCDS13735.1, CCDS68229.1	21q22.3	2008-07-07			ENSG00000160298	ENSG00000160298			1300	protein-coding gene	gene with protein product							Standard	XM_005261149		Approved		uc002zjf.3	P58505	OTTHUMG00000090634	ENST00000291691.7:c.894_896dupCCA	21.37:g.47721992_47721994dupTGG	ENSP00000291691:p.His299dup	Somatic	8	0		WXS	Illumina GAIIx	Phase_I	93	15	NM_058180	0	0	0	0	0	B3KPI1	In_Frame_Ins	INS	ENST00000291691.7	37	CCDS13735.1																																																																																			-|0.500;TGG|0.500		0.708	C21orf58-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207283.1	NM_058180	
FUBP3	8939	bcgsc.ca	37	9	133501801	133501802	+	Frame_Shift_Ins	INS	-	-	CGTGGCGACTGGAG			TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr9:133501801_133501802insCGTGGCGACTGGAG	ENST00000319725.9	+	12	1101_1102	c.1026_1027insCGTGGCGACTGGAG	c.(1027-1029)cgtfs	p.-347fs		NM_003934.1	NP_003925.1	Q96I24	FUBP3_HUMAN	far upstream element (FUSE) binding protein 3						positive regulation of gene expression (GO:0010628)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(10)|ovary(2)|urinary_tract(2)	21				OV - Ovarian serous cystadenocarcinoma(145;0.000279)		GAGGTCGTGGCCGTGGCGACTG	0.609											OREG0019546	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G342fs		.											.	FUBP3-69	0			c.1026_1027insCGTGGCGACTGGAG						.																																			SO:0001589	frameshift_variant	8939	exon12			TCGTGGCCGTGGC	U69127	CCDS43893.1	9q34.11	2008-02-05			ENSG00000107164	ENSG00000107164			4005	protein-coding gene	gene with protein product		603536		FBP3		8940189	Standard	NM_003934		Approved		uc004bzr.1	Q96I24	OTTHUMG00000020809	ENST00000319725.9:c.1027_1040dupCGTGGCGACTGGAG	9.37:g.133501801_133501802insCGTGGCGACTGGAG	ENSP00000318177:p.Ser347fs	Somatic	88	0	1603	WXS	Illumina GAIIx	Phase_I	111	4	NM_003934	0	0	0	0	0	A3KFK8|A3KFL0|Q92946|Q9BVB6	Frame_Shift_Ins	INS	ENST00000319725.9	37	CCDS43893.1																																																																																			.		0.609	FUBP3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054666.1		
NEFH	4744	bcgsc.ca	37	22	29885644	29885645	+	Missense_Mutation	DNP	CA	CA	AG	rs267607535		TCGA-OR-A5JP-01A-11D-A29I-10	TCGA-OR-A5JP-10A-01D-A29L-10	CA	CA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	427accf5-7c11-44b2-9f7f-3731decb1c0f	8376e154-d763-4a55-8294-07af51b920ca	g.chr22:29885644_29885645CA>AG	ENST00000310624.6	+	4	2048_2049	c.2015_2016CA>AG	c.(2014-2016)gCA>gAG	p.A672E		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	678	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						CCAGTGAAGGCAGAAGCAAAGT	0.564																																					p.A672E		.											.	NEFH-90	0			c.A2016G						.																																			SO:0001583	missense	4744	exon4			GAAGGCAGAAGCA		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	Exception_encountered	22.37:g.29885644_29885645delinsAG	ENSP00000311997:p.Ala672Glu	Somatic	358	0		WXS	Illumina GAIIx	Phase_I	340	0	NM_021076	0	0	0	0	0	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Missense_Mutation	DNP	ENST00000310624.6	37	CCDS13858.1																																																																																			.		0.564	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
