#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
LCE1E	353135	bcgsc.ca	37	1	152760096	152760096	+	Silent	SNP	A	A	T	rs115864544	byFrequency	TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr1:152760096A>T	ENST00000368770.3	+	2	374	c.321A>T	c.(319-321)ggA>ggT	p.G107G	LCE1E_ENST00000368771.1_Silent_p.G107G	NM_178353.1	NP_848130.1	Q5T753	LCE1E_HUMAN	late cornified envelope 1E	107	Cys-rich.				keratinization (GO:0031424)					lung(5)|stomach(1)	6	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCTGCTGTGGAGGGGGCAGCG	0.622													A|||	882	0.176118	0.239	0.1383	5008	,	,		14571	0.2639		0.0616	False		,,,				2504	0.1452				p.G107G		.											.	LCE1E-90	0			c.A321T						.	A		397,3855		43,311,1772	39.0	58.0	52.0		321	1.2	1.0	1	dbSNP_132	52	221,8299		15,191,4054	no	coding-synonymous	LCE1E	NM_178353.1		58,502,5826	TT,TA,AA		2.5939,9.3368,4.8387		107/119	152760096	618,12154	2126	4260	6386	SO:0001819	synonymous_variant	353135	exon2			CTGTGGAGGGGGC	BC038391	CCDS1024.1	1q21.3	2008-02-05			ENSG00000186226	ENSG00000186226		"""Late cornified envelopes"""	29466	protein-coding gene	gene with protein product		612607				11698679	Standard	NM_178353		Approved	LEP5	uc001fan.3	Q5T753	OTTHUMG00000012405	ENST00000368770.3:c.321A>T	1.37:g.152760096A>T		Somatic	170	29		WXS	Illumina GAIIx	Phase_I	80	49	NM_178353	0	0	0	0	0	D3DV30	Silent	SNP	ENST00000368770.3	37	CCDS1024.1																																																																																			A|0.901;T|0.099		0.622	LCE1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034525.1	NM_178353	
LOR	4014	hgsc.bcm.edu	37	1	153233578	153233578	+	Silent	SNP	C	C	T	rs1143389	byFrequency	TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr1:153233578C>T	ENST00000368742.3	+	2	210	c.153C>T	c.(151-153)tgC>tgT	p.C51C		NM_000427.2	NP_000418.2	P23490	LORI_HUMAN	loricrin	51					keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein binding, bridging (GO:0030674)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			lung(2)	2	all_lung(78;3.35e-32)|Lung NSC(65;1.22e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			gttctggctgcggctactccg	0.796													C|||	1003	0.20028	0.034	0.147	5008	,	,		4886	0.3194		0.1412	False		,,,				2504	0.4008				p.C51C		.											.	LOR-90	0			c.C153T						.	C		83,2085		3,77,1004	2.0	2.0	2.0		153	-7.2	0.0	1	dbSNP_86	2	743,3969		44,655,1657	no	coding-synonymous	LOR	NM_000427.2		47,732,2661	TT,TC,CC		15.7683,3.8284,12.0058		51/313	153233578	826,6054	1084	2356	3440	SO:0001819	synonymous_variant	4014	exon2			TGGCTGCGGCTAC	M61120	CCDS30870.1	1q21	2008-02-05			ENSG00000203782	ENSG00000203782			6663	protein-coding gene	gene with protein product		152445				2007607, 1355480	Standard	NM_000427		Approved		uc001fbm.3	P23490	OTTHUMG00000013938	ENST00000368742.3:c.153C>T	1.37:g.153233578C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_000427	0	0	0	0	0	Q5T869|Q5XKF8	Silent	SNP	ENST00000368742.3	37	CCDS30870.1																																																																																			C|0.818;T|0.182		0.796	LOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039107.1	NM_000427	
TOR3A	64222	hgsc.bcm.edu	37	1	179051300	179051300	+	Missense_Mutation	SNP	T	T	C	rs2296377	byFrequency	TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr1:179051300T>C	ENST00000367627.3	+	1	789	c.37T>C	c.(37-39)Ttc>Ctc	p.F13L	TOR3A_ENST00000352445.6_Missense_Mutation_p.F13L	NM_022371.3	NP_071766.2	Q9H497	TOR3A_HUMAN	torsin family 3, member A	13			F -> L (in dbSNP:rs2296377). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|Ref.3}.		ATP catabolic process (GO:0006200)|chaperone mediated protein folding requiring cofactor (GO:0051085)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			endometrium(1)|kidney(2)|large_intestine(4)|lung(4)|pancreas(1)|urinary_tract(1)	13						TTGGCTCTTTTTCCTGCTGCT	0.751													C|||	3842	0.767173	0.9879	0.6441	5008	,	,		12722	0.6677		0.7117	False		,,,				2504	0.7157				p.F13L		.											.	TOR3A-90	0			c.T37C						.	C	LEU/PHE	3262,174		1547,168,3	2.0	3.0	3.0		37	-0.8	0.0	1	dbSNP_100	3	5365,1739		2051,1263,238	yes	missense	TOR3A	NM_022371.3	22	3598,1431,241	CC,CT,TT		24.4792,5.064,18.1499	benign	13/398	179051300	8627,1913	1718	3552	5270	SO:0001583	missense	64222	exon1			CTCTTTTTCCTGC	BC001085	CCDS1329.1	1q25.2	2008-02-05	2003-04-02		ENSG00000186283	ENSG00000186283			11997	protein-coding gene	gene with protein product		607555	"""ATP-dependant interferon responsive"""	ADIR		10644435	Standard	NM_022371		Approved	FLJ22345, ADIR2	uc001gmd.3	Q9H497	OTTHUMG00000035077	ENST00000367627.3:c.37T>C	1.37:g.179051300T>C	ENSP00000356599:p.Phe13Leu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	9	NM_022371	0	0	0	2	2	B4DSY0|B7ZB65|Q5M7Y7|Q8WVA7|Q8WWM2|Q9H495|Q9H6E7	Missense_Mutation	SNP	ENST00000367627.3	37	CCDS1329.1	1679	0.7687728937728938	484	0.983739837398374	250	0.6906077348066298	393	0.6870629370629371	552	0.7282321899736148	C	0.033	-1.323382	0.01309	0.94936	0.755208	ENSG00000186283	ENST00000367627;ENST00000367625;ENST00000352445	T;T;T	0.35421	1.31;1.4;1.63	0.427	-0.794	0.10918	.	1.274350	0.05916	N	0.632520	T	0.00012	0.0000	N	0.00368	-1.59	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.45906	-0.9229	8	0.02654	T	1	-1.1524	.	.	.	rs2296377;rs17844883;rs17856371;rs17857600;rs17857917;rs17858479;rs59034332;rs2296377	13	Q9H497	TOR3A_HUMAN	L	13	ENSP00000356599:F13L;ENSP00000356597:F13L;ENSP00000335351:F13L	ENSP00000335351:F13L	F	+	1	0	TOR3A	177317923	0.000000	0.05858	0.002000	0.10522	0.004000	0.04260	-1.490000	0.02304	-1.608000	0.01587	-1.610000	0.00802	TTC	T|0.229;C|0.771		0.751	TOR3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084927.1	NM_022371	
EIF2D	1939	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	206784680	206784680	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr1:206784680G>C	ENST00000271764.2	-	2	312	c.104C>G	c.(103-105)aCt>aGt	p.T35S	EIF2D_ENST00000367114.3_Missense_Mutation_p.T35S	NM_006893.2	NP_008824.2	P41214	EIF2D_HUMAN	eukaryotic translation initiation factor 2D	35					formation of translation preinitiation complex (GO:0001731)|intracellular protein transport (GO:0006886)|IRES-dependent translational initiation (GO:0002192)|ribosome disassembly (GO:0032790)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	receptor activity (GO:0004872)|translation initiation factor activity (GO:0003743)			autonomic_ganglia(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	23						GACTTGATCAGTTCCAAGGGT	0.478																																					p.T35S		.											.	EIF2D-92	0			c.C104G						.						112.0	96.0	102.0					1																	206784680		2203	4300	6503	SO:0001583	missense	1939	exon2			TGATCAGTTCCAA	BC001585	CCDS1465.1, CCDS55680.1	1q32.1	2014-05-06	2011-01-19	2011-01-19	ENSG00000143486	ENSG00000143486			6583	protein-coding gene	gene with protein product		613709				20566627	Standard	NM_001201478		Approved	LGTN	uc001heh.2	P41214	OTTHUMG00000184619	ENST00000271764.2:c.104C>G	1.37:g.206784680G>C	ENSP00000271764:p.Thr35Ser	Somatic	136	1		WXS	Illumina GAIIx	Phase_I	132	96	NM_006893	0	0	3	17	14	Q5SY40|Q8IXV3|Q96DG3|Q96TG7|Q9NR27|Q9NSN0|Q9NV18|Q9NZ21	Missense_Mutation	SNP	ENST00000271764.2	37	CCDS1465.1	.	.	.	.	.	.	.	.	.	.	G	4.769	0.142917	0.09083	.	.	ENSG00000143486	ENST00000367114;ENST00000271764;ENST00000367111;ENST00000437518	T;T;T	0.44482	0.92;0.92;0.92	5.47	2.55	0.30701	.	0.487596	0.24007	N	0.042407	T	0.32255	0.0823	L	0.51422	1.61	0.09310	N	1	B;B;B	0.15473	0.013;0.012;0.009	B;B;B	0.21917	0.009;0.037;0.009	T	0.25222	-1.0138	10	0.15499	T	0.54	-9.3649	7.6659	0.28430	0.1498:0.1364:0.7138:0.0	.	35;35;35	B4DGD2;P41214-2;P41214	.;.;EIF2D_HUMAN	S	35	ENSP00000356081:T35S;ENSP00000271764:T35S;ENSP00000394685:T35S	ENSP00000271764:T35S	T	-	2	0	EIF2D	204851303	0.177000	0.23109	0.002000	0.10522	0.975000	0.68041	2.910000	0.48766	0.419000	0.25927	0.552000	0.68991	ACT	.		0.478	EIF2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088475.1	NM_006893	
OR2T33	391195	broad.mit.edu	37	1	248436537	248436537	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr1:248436537C>G	ENST00000318021.2	-	1	601	c.580G>C	c.(580-582)Gaa>Caa	p.E194Q		NM_001004695.1	NP_001004695.1	Q8NG76	O2T33_HUMAN	olfactory receptor, family 2, subfamily T, member 33	194						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(41)|ovary(1)|prostate(1)|skin(4)	67	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			ATGGCGTTTTCGAAGACTGAA	0.532																																					p.E194Q		.											.	OR2T33-114	0			c.G580C						.						23.0	26.0	25.0					1																	248436537		2190	4271	6461	SO:0001583	missense	391195	exon1			CGTTTTCGAAGAC		CCDS31109.1	1q44	2012-08-09			ENSG00000177212	ENSG00000177212		"""GPCR / Class A : Olfactory receptors"""	31255	protein-coding gene	gene with protein product							Standard	NM_001004695		Approved		uc010pzi.2	Q8NG76	OTTHUMG00000040458	ENST00000318021.2:c.580G>C	1.37:g.248436537C>G	ENSP00000324687:p.Glu194Gln	Somatic	609	0		WXS	Illumina GAIIx	Phase_I	666	19	NM_001004695	0	0	1	1	0	B2RNN0	Missense_Mutation	SNP	ENST00000318021.2	37	CCDS31109.1	.	.	.	.	.	.	.	.	.	.	-	8.005	0.756214	0.15846	.	.	ENSG00000177212	ENST00000318021	T	0.00237	8.47	2.52	2.52	0.30459	GPCR, rhodopsin-like superfamily (1);	0.000000	0.35407	U	0.003231	T	0.00496	0.0016	M	0.71036	2.16	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.44574	-0.9319	10	0.72032	D	0.01	.	13.4017	0.60887	0.0:1.0:0.0:0.0	.	194	Q8NG76	O2T33_HUMAN	Q	194	ENSP00000324687:E194Q	ENSP00000324687:E194Q	E	-	1	0	OR2T33	246503160	0.000000	0.05858	0.011000	0.14972	0.024000	0.10985	0.037000	0.13840	1.338000	0.45544	0.494000	0.49563	GAA	.		0.532	OR2T33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097354.1	NM_001004695	
MUC2	4583	broad.mit.edu	37	11	1092953	1092953	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr11:1092953C>T	ENST00000441003.2	+	30	4799	c.4772C>T	c.(4771-4773)aCg>aTg	p.T1591M	MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000359061.5_Splice_Site_p.T1592M	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.T1592M(1)|p.T1591M(1)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	accaccactacggtgacccca	0.627																																					p.T1591M		.											.	MUC2-90	2	Substitution - Missense(2)	endometrium(2)	c.C4772T						.						54.0	86.0	74.0					11																	1092953		1812	3313	5125	SO:0001583	missense	4583	exon30			CCACTACGGTGAC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4772C>T	11.37:g.1092953C>T	ENSP00000415183:p.Thr1591Met	Somatic	112	1		WXS	Illumina GAIIx	Phase_I	136	9	NM_002457	0	0	0	0	0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	3.179	-0.168424	0.06461	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.16743	2.32;2.56	1.75	-0.619	0.11572	.	6.725620	0.00827	U	0.001636	T	0.08846	0.0219	.	.	.	0.09310	N	1	D	0.60575	0.988	B	0.34489	0.184	T	0.24548	-1.0157	9	0.32370	T	0.25	.	3.3423	0.07123	0.2481:0.5888:0.0:0.163	.	1591	E7EUV1	.	M	1591;1592	ENSP00000415183:T1591M;ENSP00000351956:T1592M	ENSP00000351956:T1592M	T	+	2	0	MUC2	1082953	0.064000	0.20934	0.000000	0.03702	0.189000	0.23516	1.615000	0.36922	-0.313000	0.08728	0.121000	0.15741	ACG	.		0.627	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
OR51F1	256892	bcgsc.ca	37	11	4790671	4790671	+	Silent	SNP	C	C	T	rs11033795	byFrequency	TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr11:4790671C>T	ENST00000380383.1	-	1	497	c.498G>A	c.(496-498)ttG>ttA	p.L166L	OR51F1_ENST00000343430.3_Silent_p.L159L|MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron			A6NGY5	O51F1_HUMAN	olfactory receptor, family 51, subfamily F, member 1	166						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(3)|lung(11)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	22		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.0778)		Epithelial(150;5.87e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0045)|LUSC - Lung squamous cell carcinoma(625;0.192)		AAAGTAGTGGCAATATTAGTA	0.403													T|||	1080	0.215655	0.4569	0.2017	5008	,	,		22619	0.0		0.2704	False		,,,				2504	0.0654				p.L159L		.											.	OR51F1-70	0			c.G477A						.	T		1968,2434	618.7+/-393.2	445,1078,678	115.0	115.0	115.0		477	-8.8	0.0	11	dbSNP_120	115	2179,6417	712.2+/-405.9	291,1597,2410	no	coding-synonymous	OR51F1	NM_001004752.1		736,2675,3088	TT,TC,CC		25.349,44.707,31.9049		159/313	4790671	4147,8851	2201	4298	6499	SO:0001819	synonymous_variant	256892	exon1			TAGTGGCAATATT	BK004771	CCDS31359.1	11p15.4	2012-08-09		2004-03-10	ENSG00000188069	ENSG00000188069		"""GPCR / Class A : Olfactory receptors"""	15196	protein-coding gene	gene with protein product				OR51F1P			Standard	NM_001004752		Approved		uc010qyl.2	A6NGY5	OTTHUMG00000066503	ENST00000380383.1:c.498G>A	11.37:g.4790671C>T		Somatic	155	1		WXS	Illumina GAIIx	Phase_I	144	6	NM_001004752	0	0	0	0	0		Silent	SNP	ENST00000380383.1	37																																																																																				C|0.706;T|0.294		0.403	OR51F1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001004752	
ZDHHC13	54503	broad.mit.edu	37	11	19185906	19185906	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr11:19185906G>T	ENST00000446113.2	+	12	1413	c.1292G>T	c.(1291-1293)tGt>tTt	p.C431F	ZDHHC13_ENST00000399351.3_Missense_Mutation_p.C301F	NM_019028.2	NP_061901.2	Q8IUH4	ZDH13_HUMAN	zinc finger, DHHC-type containing 13	431					metabolic process (GO:0008152)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle membrane (GO:0030660)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	magnesium ion transmembrane transporter activity (GO:0015095)|palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)			NS(1)|kidney(1)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	6						TGTACATCATGTCTTGTGAGT	0.343																																					p.C431F		.											.	ZDHHC13-90	0			c.G1292T						.						147.0	133.0	137.0					11																	19185906		1836	4081	5917	SO:0001583	missense	54503	exon12			CATCATGTCTTGT	AB024495	CCDS44550.1, CCDS44551.1	11p15.1	2013-01-10			ENSG00000177054	ENSG00000177054		"""Zinc fingers, DHHC-type"", ""Ankyrin repeat domain containing"""	18413	protein-coding gene	gene with protein product		612815				18794299	Standard	NM_001001483		Approved	FLJ10852, FLJ10941, HIP14L	uc001mpi.3	Q8IUH4	OTTHUMG00000166099	ENST00000446113.2:c.1292G>T	11.37:g.19185906G>T	ENSP00000400113:p.Cys431Phe	Somatic	78	0		WXS	Illumina GAIIx	Phase_I	65	3	NM_019028	0	0	0	0	0	Q7Z2D3|Q86VK2|Q9NV30|Q9NV99	Missense_Mutation	SNP	ENST00000446113.2	37	CCDS44550.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.977058	0.74360	.	.	ENSG00000177054	ENST00000446113;ENST00000399351	T;T	0.56103	0.48;0.48	5.59	5.59	0.84812	Zinc finger, DHHC-type, palmitoyltransferase (2);	0.040866	0.85682	D	0.000000	D	0.82568	0.5065	H	0.97707	4.06	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.88495	0.3078	10	0.87932	D	0	20.286	16.4967	0.84247	0.0:0.0:1.0:0.0	.	431	Q8IUH4	ZDH13_HUMAN	F	431;301	ENSP00000400113:C431F;ENSP00000382288:C301F	ENSP00000382288:C301F	C	+	2	0	ZDHHC13	19142482	1.000000	0.71417	0.999000	0.59377	0.978000	0.69477	5.915000	0.69973	2.640000	0.89533	0.557000	0.71058	TGT	.		0.343	ZDHHC13-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387821.1	NM_019028	
CCDC34	91057	bcgsc.ca	37	11	27362359	27362359	+	Missense_Mutation	SNP	T	T	G	rs17244028	byFrequency	TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr11:27362359T>G	ENST00000328697.6	-	5	1464	c.791A>C	c.(790-792)gAa>gCa	p.E264A	CCDC34_ENST00000529615.1_5'UTR	NM_030771.1	NP_110398.1	Q96HJ3	CCD34_HUMAN	coiled-coil domain containing 34	264			E -> A (in dbSNP:rs17244028). {ECO:0000269|Ref.6}.							endometrium(2)|large_intestine(4)|lung(1)|prostate(1)|urinary_tract(1)	9						CTCCTGTATTTCAGCTTGCTG	0.338													T|||	808	0.161342	0.056	0.2637	5008	,	,		16669	0.0734		0.34	False		,,,				2504	0.138				p.E264A		.											.	CCDC34-90	0			c.A791C						.	T	ALA/GLU	479,3925	223.3+/-239.8	26,427,1749	155.0	144.0	148.0		791	5.9	1.0	11	dbSNP_123	148	3029,5569	467.1+/-367.0	545,1939,1815	yes	missense	CCDC34	NM_030771.1	107	571,2366,3564	GG,GT,TT		35.2291,10.8765,26.9805	probably-damaging	264/374	27362359	3508,9494	2202	4299	6501	SO:0001583	missense	91057	exon5			TGTATTTCAGCTT	AF382034	CCDS7863.1, CCDS31448.1	11p14.1	2010-03-30			ENSG00000109881	ENSG00000109881			25079	protein-coding gene	gene with protein product		612324				11173847	Standard	NM_080654		Approved	NY-REN-41, L15, RAMA3	uc001mrh.1	Q96HJ3	OTTHUMG00000166211	ENST00000328697.6:c.791A>C	11.37:g.27362359T>G	ENSP00000330240:p.Glu264Ala	Somatic	60	0		WXS	Illumina GAIIx	Phase_I	64	5	NM_030771	0	0	15	15	0	B2R8G2|Q8IX69|Q9H2A6|Q9Y599	Missense_Mutation	SNP	ENST00000328697.6	37	CCDS31448.1	433	0.19826007326007325	33	0.06707317073170732	100	0.27624309392265195	40	0.06993006993006994	260	0.34300791556728233	T	13.88	2.367807	0.42003	0.108765	0.352291	ENSG00000109881	ENST00000328697	T	0.25250	1.81	5.92	5.92	0.95590	.	0.067529	0.56097	D	0.000022	T	0.00012	0.0000	L	0.49455	1.56	0.09310	P	1.0	D	0.52996	0.957	P	0.59595	0.86	T	0.44697	-0.9311	9	0.48119	T	0.1	-10.9812	11.2236	0.48871	0.0:0.0:0.1532:0.8468	rs17244028;rs52822831;rs17244028	264	Q96HJ3	CCD34_HUMAN	A	264	ENSP00000330240:E264A	ENSP00000330240:E264A	E	-	2	0	CCDC34	27318935	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.873000	0.56093	2.266000	0.75297	0.533000	0.62120	GAA	T|0.772;G|0.228		0.338	CCDC34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388396.2	NM_030771	
WT1	7490	hgsc.bcm.edu	37	11	32456694	32456694	+	Silent	SNP	C	C	A	rs2234582	byFrequency	TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr11:32456694C>A	ENST00000332351.3	-	1	482	c.198G>T	c.(196-198)ccG>ccT	p.P66P	WT1-AS_ENST00000395900.1_RNA|WT1-AS_ENST00000459866.1_RNA|WT1-AS_ENST00000478367.1_RNA|WT1_ENST00000448076.3_Silent_p.P66P|WT1-AS_ENST00000494911.1_RNA|WT1-AS_ENST00000426618.2_RNA|WT1-AS_ENST00000525436.1_RNA	NM_024424.3|NM_024426.4	NP_077742.2|NP_077744	P19544	WT1_HUMAN	Wilms tumor 1	0	Pro-rich.				adrenal cortex formation (GO:0035802)|adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye development (GO:0043010)|cardiac muscle cell fate commitment (GO:0060923)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|diaphragm development (GO:0060539)|epithelial cell differentiation (GO:0030855)|germ cell development (GO:0007281)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|gonad development (GO:0008406)|heart development (GO:0007507)|kidney development (GO:0001822)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|mesenchymal to epithelial transition (GO:0060231)|metanephric epithelium development (GO:0072207)|metanephric mesenchyme development (GO:0072075)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of female gonad development (GO:2000195)|negative regulation of metanephric glomerular mesangial cell proliferation (GO:0072302)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of heart growth (GO:0060421)|positive regulation of male gonad development (GO:2000020)|positive regulation of metanephric ureteric bud development (GO:2001076)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior mesonephric tubule development (GO:0072166)|regulation of organ formation (GO:0003156)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|sex determination (GO:0007530)|thorax and anterior abdomen determination (GO:0007356)|tissue development (GO:0009888)|ureteric bud development (GO:0001657)|vasculogenesis (GO:0001570)|visceral serous pericardium development (GO:0061032)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)		EWSR1/WT1(234)	NS(1)|haematopoietic_and_lymphoid_tissue(348)|kidney(149)|large_intestine(9)|lung(20)|peritoneum(1)|pleura(2)|skin(2)|upper_aerodigestive_tract(1)	533	Breast(20;0.247)		OV - Ovarian serous cystadenocarcinoma(30;0.128)			CCATTTGCTGCGGCTCAGACC	0.761			"""D, Mis, N, F, S"""	EWSR1	"""Wilms, desmoplastic small round cell tumor"""	Wilms			Wilms' tumor-Aniridia-ambiguous Genitals-mental Retardation;Frasier syndrome;Familial Wilms' tumor;Denys-Drash syndrome				C|||	1511	0.301717	0.6604	0.1556	5008	,	,		5831	0.0675		0.1839	False		,,,				2504	0.2832				p.P66P		.	yes	Rec	yes	"""Denys-Drash syndrome, Frasier syndrome, Familial Wilms tumor"""	11	11p13	7490	Wilms tumour 1 gene		O	.	WT1-6891	0			c.G198T						.	C	,,	1567,1733		420,727,503	2.0	3.0	3.0		198,198,198	1.2	0.0	11	dbSNP_98	3	1360,5576		235,890,2343	no	coding-synonymous,coding-synonymous,coding-synonymous	WT1	NM_000378.4,NM_024424.3,NM_024426.4	,,	655,1617,2846	AA,AC,CC		19.6078,47.4848,28.5952	,,	66/498,66/515,66/518	32456694	2927,7309	1650	3468	5118	SO:0001819	synonymous_variant	7490	exon1	Familial Cancer Database	WAGR syndrome; ; ;incl.: Early Onset Nephrotic Syndrome-WT1 associated	TTGCTGCGGCTCA		CCDS7878.2, CCDS44561.1, CCDS44562.1, CCDS55750.1, CCDS55751.1	11p13	2014-09-17			ENSG00000184937	ENSG00000184937		"""Zinc fingers, C2H2-type"""	12796	protein-coding gene	gene with protein product		607102		GUD		14681303	Standard	NM_024424		Approved	WAGR, WIT-2, AWT1	uc001mtn.2	P19544	OTTHUMG00000039556	ENST00000332351.3:c.198G>T	11.37:g.32456694C>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	4	NM_024424	0	0	0	0	0	A8K6S1|B3KSA5|Q15881|Q16256|Q16575|Q4VXV4|Q4VXV5|Q4VXV6|Q8IYZ5	Silent	SNP	ENST00000332351.3	37	CCDS7878.2																																																																																			C|0.748;A|0.252		0.761	WT1-001	KNOWN	non_ATG_start|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000095436.2	NM_000378	
OR4A16	81327	ucsc.edu;bcgsc.ca	37	11	55111584	55111584	+	Missense_Mutation	SNP	A	A	T	rs10896659	byFrequency	TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr11:55111584A>T	ENST00000314721.2	+	1	958	c.908A>T	c.(907-909)aAg>aTg	p.K303M		NM_001005274.1	NP_001005274.1	Q8NH70	O4A16_HUMAN	olfactory receptor, family 4, subfamily A, member 16	303			K -> M (in dbSNP:rs10896659).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(28)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	51						TGGTGTGAAAAGTTAAGTATA	0.323													.|||	2066	0.41254	0.1853	0.5504	5008	,	,		18442	0.5387		0.494	False		,,,				2504	0.408				p.K303M		.											.	OR4A16-69	0			c.A908T						.	A	MET/LYS	1017,3385	362.1+/-316.0	130,757,1314	36.0	36.0	36.0		908	1.8	0.0	11	dbSNP_120	36	4172,4418	547.8+/-385.2	1032,2108,1155	yes	missense	OR4A16	NM_001005274.1	95	1162,2865,2469	TT,TA,AA		48.5681,23.1031,39.94	benign	303/329	55111584	5189,7803	2201	4295	6496	SO:0001583	missense	81327	exon1			GTGAAAAGTTAAG	AB065519	CCDS31499.1	11q11	2012-08-09			ENSG00000181961	ENSG00000181961		"""GPCR / Class A : Olfactory receptors"""	15153	protein-coding gene	gene with protein product							Standard	NM_001005274		Approved	OR4A16Q	uc010rie.2	Q8NH70	OTTHUMG00000166710	ENST00000314721.2:c.908A>T	11.37:g.55111584A>T	ENSP00000325128:p.Lys303Met	Somatic	13	0		WXS	Illumina GAIIx	Phase_I	19	18	NM_001005274	0	0	0	0	0	Q6IFL3	Missense_Mutation	SNP	ENST00000314721.2	37	CCDS31499.1	965	0.44184981684981683	68	0.13821138211382114	207	0.5718232044198895	307	0.5367132867132867	383	0.5052770448548812	a	10.04	1.242232	0.22796	0.231031	0.485681	ENSG00000181961	ENST00000314721	T	0.39592	1.07	3.02	1.79	0.24919	.	.	.	.	.	T	0.00012	0.0000	L	0.52905	1.665	0.80722	P	0.0	B	0.23249	0.082	B	0.22601	0.04	T	0.41288	-0.9517	8	0.49607	T	0.09	.	6.2828	0.21017	0.7663:0.0:0.0:0.2337	rs10896659;rs52838177;rs58877730;rs10896659	303	Q8NH70	O4A16_HUMAN	M	303	ENSP00000325128:K303M	ENSP00000325128:K303M	K	+	2	0	OR4A16	54868160	0.017000	0.18338	0.018000	0.16275	0.016000	0.09150	1.722000	0.38042	0.320000	0.23234	0.346000	0.21813	AAG	A|0.589;T|0.411		0.323	OR4A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391160.1	NM_001005274	
NUMA1	4926	bcgsc.ca	37	11	71717106	71717106	+	Silent	SNP	G	G	A	rs61745941	byFrequency	TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr11:71717106G>A	ENST00000393695.3	-	22	5998	c.5667C>T	c.(5665-5667)gcC>gcT	p.A1889A	NUMA1_ENST00000351960.6_Silent_p.A753A|NUMA1_ENST00000358965.6_Silent_p.A1875A	NM_006185.2	NP_006176.2			nuclear mitotic apparatus protein 1											central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(12)|lung(20)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	65						TGGACACCCCGGCCTGGGAAC	0.597			T	RARA	APL								G|||	219	0.04373	0.0189	0.0447	5008	,	,		18923	0.0823		0.0348	False		,,,				2504	0.046				p.A1889A		.		Dom	yes		11	11q13	4926	nuclear mitotic apparatus protein 1		L	.	NUMA1-633	0			c.C5667T						.	G		80,4320	67.0+/-104.6	1,78,2121	58.0	69.0	65.0		5667	-10.2	0.1	11	dbSNP_129	65	235,8351	93.1+/-155.1	4,227,4062	no	coding-synonymous	NUMA1	NM_006185.2		5,305,6183	AA,AG,GG		2.737,1.8182,2.4257		1889/2116	71717106	315,12671	2200	4293	6493	SO:0001819	synonymous_variant	4926	exon22			CACCCCGGCCTGG	Z11584	CCDS31633.1, CCDS66156.1	11q13	2008-02-05				ENSG00000137497			8059	protein-coding gene	gene with protein product		164009				8406455	Standard	NM_006185		Approved		uc001orl.1	Q14980		ENST00000393695.3:c.5667C>T	11.37:g.71717106G>A		Somatic	82	1		WXS	Illumina GAIIx	Phase_I	94	6	NM_006185	0	0	80	80	0		Silent	SNP	ENST00000393695.3	37	CCDS31633.1	104	0.047619047619047616	17	0.034552845528455285	15	0.04143646408839779	49	0.08566433566433566	23	0.030343007915567283	G	6.573	0.474061	0.12521	0.018182	0.02737	ENSG00000137497	ENST00000541584	.	.	.	5.11	-10.2	0.00374	.	.	.	.	.	T	0.02767	0.0083	.	.	.	0.43271	D	0.995225	.	.	.	.	.	.	T	0.56505	-0.7968	4	.	.	.	.	10.9463	0.47301	0.1966:0.0869:0.6301:0.0864	rs61745941	.	.	.	L	738	.	.	P	-	2	0	NUMA1	71394754	0.055000	0.20627	0.086000	0.20670	0.764000	0.43329	-1.306000	0.02735	-2.382000	0.00593	-1.202000	0.01658	CCG	G|0.969;A|0.031		0.597	NUMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395769.1		
PGM2L1	283209	bcgsc.ca	37	11	74109166	74109166	+	Missense_Mutation	SNP	A	A	G	rs12049823	byFrequency	TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr11:74109166A>G	ENST00000298198.4	-	1	352	c.41T>C	c.(40-42)cTc>cCc	p.L14P	RP11-702H23.4_ENST00000533008.1_RNA|MIR548AL_ENST00000578416.1_RNA|RP11-702H23.4_ENST00000531906.1_RNA	NM_173582.3	NP_775853.2	Q6PCE3	PGM2L_HUMAN	phosphoglucomutase 2-like 1	14			L -> P (in dbSNP:rs12049823). {ECO:0000269|PubMed:15489334}.		glucose metabolic process (GO:0006006)|phosphorylation (GO:0016310)	cytosol (GO:0005829)	glucose-1,6-bisphosphate synthase activity (GO:0047933)|intramolecular transferase activity, phosphotransferases (GO:0016868)			NS(2)|breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(11)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	Breast(11;3.32e-06)					GGGGGCGTGGAGCAGGTTGGA	0.672													A|||	941	0.187899	0.112	0.1311	5008	,	,		13499	0.2669		0.161	False		,,,				2504	0.2771				p.L14P		.											.	PGM2L1-91	0			c.T41C						.	A	PRO/LEU	514,3886	234.6+/-247.4	28,458,1714	124.0	113.0	117.0		41	3.7	1.0	11	dbSNP_120	117	1284,7302	253.9+/-279.4	102,1080,3111	yes	missense	PGM2L1	NM_173582.3	98	130,1538,4825	GG,GA,AA		14.9546,11.6818,13.8457	benign	14/623	74109166	1798,11188	2200	4293	6493	SO:0001583	missense	283209	exon1			GCGTGGAGCAGGT	AB019210	CCDS8231.1	11q13.3	2008-12-01			ENSG00000165434	ENSG00000165434			20898	protein-coding gene	gene with protein product	"""glucose-1,6-bisphosphate synthase"""	611610				17804405	Standard	NM_173582		Approved	FLJ32029, BM32A	uc001ovb.1	Q6PCE3	OTTHUMG00000168132	ENST00000298198.4:c.41T>C	11.37:g.74109166A>G	ENSP00000298198:p.Leu14Pro	Somatic	66	1		WXS	Illumina GAIIx	Phase_I	84	5	NM_173582	0	0	1	1	0	Q96MQ7|Q9UIK3	Missense_Mutation	SNP	ENST00000298198.4	37	CCDS8231.1	395	0.18086080586080586	57	0.11585365853658537	46	0.1270718232044199	163	0.28496503496503495	129	0.17018469656992086	A	13.57	2.275855	0.40294	0.116818	0.149546	ENSG00000165434	ENST00000298198	T	0.18174	2.23	4.87	3.72	0.42706	.	0.431607	0.21265	N	0.077402	T	0.00012	0.0000	L	0.52573	1.65	0.19575	P	0.9999695974	B	0.02656	0.0	B	0.01281	0.0	T	0.28138	-1.0053	9	0.62326	D	0.03	-5.4947	5.7867	0.18336	0.8788:0.0:0.1212:0.0	rs12049823;rs17854987;rs61002785;rs12049823	14	Q6PCE3	PGM2L_HUMAN	P	14	ENSP00000298198:L14P	ENSP00000298198:L14P	L	-	2	0	PGM2L1	73786814	1.000000	0.71417	1.000000	0.80357	0.729000	0.41735	1.992000	0.40737	2.037000	0.60232	0.379000	0.24179	CTC	A|0.843;G|0.157		0.672	PGM2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398324.1	NM_173582	
B3GNT6	192134	hgsc.bcm.edu	37	11	76751542	76751542	+	Frame_Shift_Del	DEL	T	T	-	rs11292198		TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr11:76751542delT	ENST00000533140.1	+	2	1085	c.947delT	c.(946-948)cttfs	p.L316fs	B3GNT6_ENST00000354301.5_Splice_Site_p.L316fs|B3GNT6_ENST00000421061.1_Intron			O43505	B3GN1_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (core 3 synthase)	0					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|poly-N-acetyllactosamine biosynthetic process (GO:0030311)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	N-acetyllactosaminide beta-1,3-N-acetylglucosaminyltransferase activity (GO:0008532)			central_nervous_system(1)|kidney(2)|lung(4)|prostate(1)	8						GGCATGTGTCTTGGAGCGCGC	0.741													T|TT|T|insertion	5008	1.0	1.0	1.0	5008	,	,		12582	1.0		1.0	False		,,,				2504	1.0				.		.											.	.	0			c.946+1T>-						.						1.0	1.0	1.0					11																	76751542		431	917	1348	SO:0001589	frameshift_variant	192134	exon2			TGTGTCTTGGAGC	AB073740	CCDS53681.1	11q13.4	2013-02-19			ENSG00000198488	ENSG00000198488		"""Beta 3-glycosyltransferases"""	24141	protein-coding gene	gene with protein product		615315				11821425	Standard	NM_138706		Approved	B3Gn-T6	uc021qnp.1	Q6ZMB0		ENST00000533140.1:c.947delT	11.37:g.76751542delT	ENSP00000435352:p.Leu316fs	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	13	13	NM_138706	0	0	0	0	0	Q4TTN0	Splice_Site	DEL	ENST00000533140.1	37	CCDS53681.1																																																																																			.		0.741	B3GNT6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000382740.2	NM_138706	
AKAP3	10566	bcgsc.ca	37	12	4737042	4737042	+	Silent	SNP	G	G	A	rs7972737	byFrequency	TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr12:4737042G>A	ENST00000545990.2	-	5	1550	c.1026C>T	c.(1024-1026)caC>caT	p.H342H	AKAP3_ENST00000228850.1_Silent_p.H342H|RP11-500M8.7_ENST00000536588.1_Intron	NM_001278309.1	NP_001265238.1	O75969	AKAP3_HUMAN	A kinase (PRKA) anchor protein 3	342					acrosome reaction (GO:0007340)|cellular component movement (GO:0006928)|protein localization (GO:0008104)|single fertilization (GO:0007338)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	acrosomal vesicle (GO:0001669)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	protein kinase A binding (GO:0051018)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|liver(1)|lung(17)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	51						CTGTGACGCTGTGGAGATTCC	0.488													G|||	1425	0.284545	0.0371	0.4625	5008	,	,		23282	0.2073		0.5258	False		,,,				2504	0.3241				p.H342H		.											.	AKAP3-292	0			c.C1026T						.	G		482,3924	224.3+/-240.5	40,402,1761	157.0	149.0	152.0		1026	3.8	1.0	12	dbSNP_116	152	4404,4196	585.5+/-391.9	1154,2096,1050	no	coding-synonymous	AKAP3	NM_006422.2		1194,2498,2811	AA,AG,GG		48.7907,10.9396,37.5673		342/854	4737042	4886,8120	2203	4300	6503	SO:0001819	synonymous_variant	10566	exon4			GACGCTGTGGAGA	U85715	CCDS8531.1	12p13.3	2009-03-12				ENSG00000111254		"""A-kinase anchor proteins"""	373	protein-coding gene	gene with protein product	"""Fibrous Sheath Protein of 95 kDa"", ""cancer/testis antigen 82"""	604689				10334916, 10319321	Standard	NM_001278309		Approved	FSP95, SOB1, AKAP110, CT82	uc001qnb.4	O75969		ENST00000545990.2:c.1026C>T	12.37:g.4737042G>A		Somatic	142	1		WXS	Illumina GAIIx	Phase_I	228	8	NM_006422	0	0	2	2	0	O75945|Q86X01|Q9UM61	Silent	SNP	ENST00000545990.2	37	CCDS8531.1																																																																																			G|0.653;A|0.347		0.488	AKAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398911.2	NM_006422	
KANSL2	54934	broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	49075305	49075305	+	Silent	SNP	G	G	A			TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr12:49075305G>A	ENST00000420613.2	-	2	158	c.111C>T	c.(109-111)caC>caT	p.H37H	KANSL2_ENST00000553086.1_Silent_p.H37H|KANSL2_ENST00000357861.3_5'UTR|KANSL2_ENST00000550347.1_Silent_p.H220H	NM_017822.3	NP_060292.3	Q9H9L4	KANL2_HUMAN	KAT8 regulatory NSL complex subunit 2	37					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)	histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)											CCAGACGAGGGTGAGAGCATG	0.488																																					p.H37H		.											.	.	0			c.C111T						.						160.0	157.0	158.0					12																	49075305		2004	4176	6180	SO:0001819	synonymous_variant	54934	exon2			ACGAGGGTGAGAG	AK094528	CCDS44869.1	12q13.11	2011-10-31	2011-10-31	2011-10-31	ENSG00000139620	ENSG00000139620			26024	protein-coding gene	gene with protein product		615488	"""chromosome 12 open reading frame 41"""	C12orf41		12477932	Standard	NM_017822		Approved	FLJ20436, NSL2	uc001rrz.2	Q9H9L4	OTTHUMG00000170392	ENST00000420613.2:c.111C>T	12.37:g.49075305G>A		Somatic	148	1		WXS	Illumina GAIIx	Phase_I	270	128	NM_017822	0	0	3	8	5	Q8N3B5|Q96CV0|Q9NX51	Silent	SNP	ENST00000420613.2	37	CCDS44869.1																																																																																			.		0.488	KANSL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408841.1	NM_017822	
TUBA1C	84790	ucsc.edu	37	12	49666152	49666152	+	Silent	SNP	G	G	A	rs199599214	byFrequency	TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr12:49666152G>A	ENST00000301072.6	+	4	767	c.492G>A	c.(490-492)aaG>aaA	p.K164K	TUBA1C_ENST00000541364.1_Silent_p.K234K|RP11-161H23.5_ENST00000550468.2_RNA	NM_032704.3	NP_116093.1	Q9BQE3	TBA1C_HUMAN	tubulin, alpha 1c	164					'de novo' posttranslational protein folding (GO:0051084)|cell division (GO:0051301)|cellular protein metabolic process (GO:0044267)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasmic microtubule (GO:0005881)|microtubule (GO:0005874)|nucleus (GO:0005634)|vesicle (GO:0031982)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.K164K(1)		endometrium(1)|large_intestine(3)|liver(1)|lung(7)|skin(1)	13						ATGGCAAGAAGTCCAAGCTGG	0.547																																					p.K164K		.											.	TUBA1C-90	1	Substitution - coding silent(1)	large_intestine(1)	c.G492A						.						56.0	58.0	57.0					12																	49666152		2203	4300	6503	SO:0001819	synonymous_variant	84790	exon4			CAAGAAGTCCAAG	BC004949	CCDS8782.1	12q13.12	2007-03-16	2007-02-12	2007-02-12		ENSG00000167553		"""Tubulins"""	20768	protein-coding gene	gene with protein product			"""tubulin, alpha 6"""	TUBA6		7821789	Standard	NM_032704		Approved	MGC14580, MGC10851, bcm948	uc001rtt.1	Q9BQE3		ENST00000301072.6:c.492G>A	12.37:g.49666152G>A		Somatic	221	15		WXS	Illumina GAIIx	Phase_I	379	21	NM_032704	0	0	1138	1688	550		Silent	SNP	ENST00000301072.6	37	CCDS8782.1																																																																																			G|0.998;A|0.002		0.547	TUBA1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404424.1	NM_032704	
KRT1	3848	broad.mit.edu	37	12	53069236	53069256	+	In_Frame_Del	DEL	TAGCTGCTACCTCCGGAGCCA	TAGCTGCTACCTCCGGAGCCA	-	rs371843007|rs77846840|rs540699806|rs267607656	byFrequency	TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr12:53069236_53069256delTAGCTGCTACCTCCGGAGCCA	ENST00000252244.3	-	9	1714_1734	c.1656_1676delTGGCTCCGGAGGTAGCAGCTA	c.(1654-1677)tatggctccggaggtagcagctac>tac	p.552_559YGSGGSSY>Y		NM_006121.3	NP_006112.3	P04264	K2C1_HUMAN	keratin 1	552	Gly/Ser-rich.|Tail.				complement activation, lectin pathway (GO:0001867)|establishment of skin barrier (GO:0061436)|fibrinolysis (GO:0042730)|negative regulation of inflammatory response (GO:0050728)|regulation of angiogenesis (GO:0045765)|response to oxidative stress (GO:0006979)|retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)|structural molecule activity (GO:0005198)	p.S557_G563delSSYGSGG(3)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(7)|skin(3)	39						tccggagccgtagctgctacctccggagccatagctgccac	0.688																																					p.552_559del		.											.	KRT1-92	3	Deletion - In frame(3)	prostate(2)|central_nervous_system(1)	c.1656_1676del						.			1239,2109		396,447,831				http://www.ncbi.nlm.nih.gov/sites/varvu?gene		-4.4	0.0		dbSNP_129	4	2732,4060		826,1080,1490	no	coding	KRT1	NM_006121.3		1222,1527,2321	A1A1,A1R,RR		40.2238,37.0072,39.1617				3971,6169				SO:0001651	inframe_deletion	3848	exon9			GAGCCGTAGCTGC	X69725	CCDS8836.1	12q13.13	2014-06-05	2008-08-01		ENSG00000167768	ENSG00000167768		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6412	protein-coding gene	gene with protein product		139350	"""epidermolytic hyperkeratosis 1"""	EHK1		2461420, 2470667, 16831889	Standard	NM_006121		Approved	KRT1A	uc001sau.1	P04264	OTTHUMG00000169749	ENST00000252244.3:c.1656_1676delTGGCTCCGGAGGTAGCAGCTA	12.37:g.53069236_53069256delTAGCTGCTACCTCCGGAGCCA	ENSP00000252244:p.Tyr552_Ser558del	Somatic	10	0		WXS	Illumina GAIIx	Phase_I	49	14	NM_006121	0	0	0	0	0	B2RA01|P85925|P86104|Q14720|Q6GSJ0|Q9H298	In_Frame_Del	DEL	ENST00000252244.3	37	CCDS8836.1																																																																																			.		0.688	KRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405706.1	NM_006121	
NAP1L1	4673	broad.mit.edu	37	12	76444319	76444319	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr12:76444319C>T	ENST00000261182.8	-	12	1537	c.1051G>A	c.(1051-1053)Gat>Aat	p.D351N	NAP1L1_ENST00000548044.1_Missense_Mutation_p.D310N|NAP1L1_ENST00000542344.1_Missense_Mutation_p.D309N|NAP1L1_ENST00000431879.3_Missense_Mutation_p.D283N|NAP1L1_ENST00000393263.3_Missense_Mutation_p.D351N|NAP1L1_ENST00000549596.1_Missense_Mutation_p.D351N|NAP1L1_ENST00000535020.2_Missense_Mutation_p.D351N|NAP1L1_ENST00000547773.1_Missense_Mutation_p.D288N|NAP1L1_ENST00000544816.1_Missense_Mutation_p.D168N|NAP1L1_ENST00000552342.1_Missense_Mutation_p.D362N|NAP1L1_ENST00000547993.1_Missense_Mutation_p.D168N	NM_004537.4|NM_139207.2	NP_004528.1|NP_631946.1	P55209	NP1L1_HUMAN	nucleosome assembly protein 1-like 1	351	Asp/Glu-rich (acidic).				DNA replication (GO:0006260)|nucleosome assembly (GO:0006334)|positive regulation of cell proliferation (GO:0008284)	membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			kidney(1)|large_intestine(1)|lung(3)|ovary(2)|prostate(1)|skin(1)	9		Colorectal(145;0.09)				ACATCATCATCATCATCTTCA	0.358																																					p.D351N		.											.	NAP1L1-92	0			c.G1051A						.						69.0	70.0	70.0					12																	76444319		2203	4300	6503	SO:0001583	missense	4673	exon12			CATCATCATCATC		CCDS9013.1	12q21.1	2010-03-17			ENSG00000187109	ENSG00000187109			7637	protein-coding gene	gene with protein product		164060				8297347	Standard	NM_004537		Approved	NRP, NAP1, NAP1L, MGC8688, MGC23410	uc001sxx.2	P55209		ENST00000261182.8:c.1051G>A	12.37:g.76444319C>T	ENSP00000261182:p.Asp351Asn	Somatic	120	0		WXS	Illumina GAIIx	Phase_I	144	4	NM_004537	0	0	0	0	0	B3KNT8	Missense_Mutation	SNP	ENST00000261182.8	37	CCDS9013.1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.620113	0.87460	.	.	ENSG00000187109	ENST00000261182;ENST00000552056;ENST00000393263;ENST00000431879;ENST00000547773;ENST00000544816;ENST00000542344;ENST00000535020;ENST00000549596;ENST00000547993;ENST00000552342;ENST00000548044	T;T;T;T;T;T;T;T;T;T;T;T	0.63096	-0.02;-0.02;-0.02;-0.02;-0.02;-0.02;-0.02;-0.02;-0.02;-0.02;-0.02;-0.02	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.75206	0.3818	L	0.46157	1.445	0.80722	D	1	D;D;D;D;D;P;D	0.67145	0.996;0.993;0.996;0.993;0.993;0.557;0.993	D;D;D;D;D;B;D	0.76071	0.981;0.956;0.987;0.956;0.956;0.368;0.956	T	0.73496	-0.3964	10	0.45353	T	0.12	.	19.7278	0.96172	0.0:1.0:0.0:0.0	.	351;309;362;351;283;288;351	F5H4R6;B7Z9C2;F8W0J6;B3KNT8;B3KV44;F8W543;P55209	.;.;.;.;.;.;NP1L1_HUMAN	N	351;345;351;283;288;168;309;351;351;168;362;310	ENSP00000261182:D351N;ENSP00000450236:D345N;ENSP00000376947:D351N;ENSP00000409795:D283N;ENSP00000448167:D288N;ENSP00000437507:D168N;ENSP00000444759:D309N;ENSP00000445008:D351N;ENSP00000447793:D351N;ENSP00000448007:D168N;ENSP00000447196:D362N;ENSP00000449649:D310N	ENSP00000261182:D351N	D	-	1	0	NAP1L1	74730586	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.818000	0.86416	2.656000	0.90262	0.591000	0.81541	GAT	.		0.358	NAP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405850.3	NM_139207	
TMEM119	338773	hgsc.bcm.edu	37	12	108986112	108986112	+	Silent	SNP	G	G	C	rs10861953	byFrequency	TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr12:108986112G>C	ENST00000392806.3	-	2	216	c.48C>G	c.(46-48)ctC>ctG	p.L16L		NM_181724.2	NP_859075.2	Q4V9L6	TM119_HUMAN	transmembrane protein 119	16					osteoblast differentiation (GO:0001649)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				large_intestine(2)|lung(3)|ovary(1)|skin(1)	7						CAGACCCCAGGAGCAGCAACA	0.662													G|||	986	0.196885	0.1384	0.1297	5008	,	,		16113	0.256		0.1759	False		,,,				2504	0.2843				p.L16L		.											.	TMEM119-69	0			c.C48G						.	G		571,3727		46,479,1624	10.0	11.0	11.0		48	0.4	0.1	12	dbSNP_120	11	1365,6937		115,1135,2901	no	coding-synonymous	TMEM119	NM_181724.2		161,1614,4525	CC,CG,GG		16.4418,13.2852,15.3651		16/284	108986112	1936,10664	2149	4151	6300	SO:0001819	synonymous_variant	338773	exon2			CCCCAGGAGCAGC	AK075501	CCDS9119.1	12q23.3	2014-02-12				ENSG00000183160			27884	protein-coding gene	gene with protein product						12975309	Standard	NM_181724		Approved		uc001tng.3	Q4V9L6		ENST00000392806.3:c.48C>G	12.37:g.108986112G>C		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	9	6	NM_181724	0	0	0	2	2	Q6UXE5|Q8N2F5	Silent	SNP	ENST00000392806.3	37	CCDS9119.1																																																																																			G|0.822;C|0.178		0.662	TMEM119-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403900.1	NM_181724	
PARP4	143	ucsc.edu;bcgsc.ca	37	13	25016762	25016762	+	Missense_Mutation	SNP	G	G	A	rs113301501	byFrequency	TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr13:25016762G>A	ENST00000381989.3	-	29	3614	c.3509C>T	c.(3508-3510)aCa>aTa	p.T1170I		NM_006437.3	NP_006428.2	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4	1170					cell death (GO:0008219)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|inflammatory response (GO:0006954)|protein ADP-ribosylation (GO:0006471)|response to drug (GO:0042493)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spindle microtubule (GO:0005876)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(14)|lung(18)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)		TGTAAATTGTGTTATGAGAGA	0.289																																					p.T1170I		.											.	PARP4-94	0			c.C3509T						.						81.0	83.0	82.0					13																	25016762		2201	4298	6499	SO:0001583	missense	143	exon29			AATTGTGTTATGA	AF057160	CCDS9307.1	13q11	2010-09-29	2004-08-20	2004-08-26	ENSG00000102699	ENSG00000102699		"""Poly (ADP-ribose) polymerases"""	271	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 5C"""	607519	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like 1"""	ADPRTL1		10644454	Standard	NM_006437		Approved	VAULT3, p193, VPARP, VWA5C	uc001upl.3	Q9UKK3	OTTHUMG00000016582	ENST00000381989.3:c.3509C>T	13.37:g.25016762G>A	ENSP00000371419:p.Thr1170Ile	Somatic	162	3		WXS	Illumina GAIIx	Phase_I	148	17	NM_006437	0	0	61	61	0	O75903|Q14682|Q5QNZ9|Q9H1M6	Missense_Mutation	SNP	ENST00000381989.3	37	CCDS9307.1	.	.	.	.	.	.	.	.	.	.	g	16.99	3.273741	0.59649	.	.	ENSG00000102699	ENST00000381989	T	0.64803	-0.12	4.65	3.81	0.43845	.	0.193075	0.42053	D	0.000769	T	0.59197	0.2176	M	0.76328	2.33	0.33718	D	0.616609	B	0.32203	0.36	B	0.27796	0.083	T	0.71896	-0.4454	10	0.87932	D	0	-18.9801	10.8642	0.46844	0.0924:0.0:0.9076:0.0	.	1170	Q9UKK3	PARP4_HUMAN	I	1170	ENSP00000371419:T1170I	ENSP00000371419:T1170I	T	-	2	0	PARP4	23914762	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	5.530000	0.67141	1.207000	0.43291	-0.131000	0.14894	ACA	G|0.935;A|0.065		0.289	PARP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044189.1	NM_006437	
ERICH6B	220081	hgsc.bcm.edu	37	13	46170735	46170735	+	Missense_Mutation	SNP	C	C	T	rs142875900|rs28460344|rs375947127	byFrequency	TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr13:46170735C>T	ENST00000298738.2	-	3	570	c.406G>A	c.(406-408)Gag>Aag	p.E136K		NM_182542.2	NP_872348.2	Q5W0A0	ERI6B_HUMAN		136	Glu-rich.									breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)	5						TActcttcctcctccagatgc	0.483													C|||	1385	0.276558	0.1362	0.4308	5008	,	,		19628	0.1627		0.494	False		,,,				2504	0.2505				p.E136K		.											.	FAM194B-68	0			c.G406A						.						134.0	78.0	95.0					13																	46170735		692	1565	2257	SO:0001583	missense	220081	exon3			CTTCCTCCTCCAG																												ENST00000298738.2:c.406G>A	13.37:g.46170735C>T	ENSP00000298738:p.Glu136Lys	Somatic	77	0		WXS	Illumina GAIIx	Phase_I	87	9	NM_182542	0	0	0	0	0	Q96MB5	Missense_Mutation	SNP	ENST00000298738.2	37	CCDS45045.1	.	.	.	.	.	.	.	.	.	.	C	8.526	0.869929	0.17322	.	.	ENSG00000165837	ENST00000298738	T	0.06142	3.34	2.1	0.141	0.14811	.	.	.	.	.	T	0.02571	0.0078	N	0.02539	-0.55	0.09310	N	1	B;B	0.09022	0.0;0.002	B;B	0.06405	0.002;0.001	T	0.43015	-0.9417	9	0.87932	D	0	-1.9096	5.6342	0.17528	0.0:0.5396:0.0:0.4604	rs28460344	136;136	A2VDI6;Q5W0A0	.;F194B_HUMAN	K	136	ENSP00000298738:E136K	ENSP00000298738:E136K	E	-	1	0	FAM194B	45068736	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.079000	0.14782	-0.180000	0.10637	-1.380000	0.01176	GAG	.		0.483	FAM194B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044781.3		
FAM179B	23116	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	45542716	45542716	+	Silent	SNP	A	A	G			TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr14:45542716A>G	ENST00000361577.3	+	19	5329	c.5115A>G	c.(5113-5115)aaA>aaG	p.K1705K	FAM179B_ENST00000361462.2_Silent_p.K1758K|FAM179B_ENST00000382233.2_3'UTR	NM_015091.2	NP_055906.2	Q9Y4F4	F179B_HUMAN	family with sequence similarity 179, member B	1705										endometrium(4)|kidney(5)|large_intestine(12)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	45						CACATATCAAAAAGAGTTTGG	0.333																																					p.K1705K		.											.	FAM179B-93	0			c.A5115G						.						76.0	74.0	75.0					14																	45542716		2203	4300	6503	SO:0001819	synonymous_variant	23116	exon19			TATCAAAAAGAGT	AB007883	CCDS9681.1	14q21.3	2008-07-21	2008-07-21	2008-07-21	ENSG00000198718	ENSG00000198718			19959	protein-coding gene	gene with protein product			"""KIAA0423"""	KIAA0423			Standard	XM_005267451		Approved		uc001wvv.3	Q9Y4F4	OTTHUMG00000140264	ENST00000361577.3:c.5115A>G	14.37:g.45542716A>G		Somatic	80	0		WXS	Illumina GAIIx	Phase_I	76	28	NM_015091	0	0	1	8	7	Q68D66|Q6PG27	Silent	SNP	ENST00000361577.3	37	CCDS9681.1																																																																																			.		0.333	FAM179B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276791.1	XM_113781	
FERMT2	10979	bcgsc.ca	37	14	53341962	53341962	+	Silent	SNP	C	C	G	rs1130597	byFrequency	TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr14:53341962C>G	ENST00000395631.2	-	8	1293	c.1077G>C	c.(1075-1077)ggG>ggC	p.G359G	FERMT2_ENST00000553373.1_Silent_p.G359G|FERMT2_ENST00000399304.3_Silent_p.G359G|FERMT2_ENST00000343279.4_Silent_p.G359G|FERMT2_ENST00000341590.3_Silent_p.G359G			Q96AC1	FERM2_HUMAN	fermitin family member 2	359	FERM.				cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|focal adhesion assembly (GO:0048041)|integrin activation (GO:0033622)|integrin-mediated signaling pathway (GO:0007229)|protein localization to membrane (GO:0072657)|regulation of cell shape (GO:0008360)|substrate adhesion-dependent cell spreading (GO:0034446)|transforming growth factor beta receptor signaling pathway (GO:0007179)|Wnt signaling pathway (GO:0016055)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|filamentous actin (GO:0031941)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|stress fiber (GO:0001725)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)		ERO1L/FERMT2(2)	NS(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	20	Breast(41;0.0342)					ACGTTTTACCCCCTTCCAGAG	0.368													C|||	10	0.00199681	0.0	0.0043	5008	,	,		16517	0.0		0.007	False		,,,				2504	0.0				p.G359G		.											.	FERMT2-68	0			c.G1077C						.	C	,,	8,4398	14.3+/-33.2	0,8,2195	125.0	114.0	118.0		1077,1077,1077	3.7	1.0	14	dbSNP_86	118	76,8524	44.9+/-103.4	0,76,4224	no	coding-synonymous,coding-synonymous,coding-synonymous	FERMT2	NM_001134999.1,NM_001135000.1,NM_006832.2	,,	0,84,6419	GG,GC,CC		0.8837,0.1816,0.6459	,,	359/688,359/634,359/681	53341962	84,12922	2203	4300	6503	SO:0001819	synonymous_variant	10979	exon8			TTTACCCCCTTCC	Z24725	CCDS9713.1, CCDS45107.1, CCDS45108.1	14q22.1	2013-01-10	2010-06-24	2007-12-14	ENSG00000073712	ENSG00000073712		"""Fermitins"", ""Pleckstrin homology (PH) domain containing"""	15767	protein-coding gene	gene with protein product	"""kindlin-2"""	607746	"""pleckstrin homology domain containing, family C (with FERM domain) member 1"", ""fermitin family homolog 2 (Drosophila)"""	PLEKHC1		8175911, 12697302	Standard	NM_006832		Approved	mig-2, KIND2, UNC112B	uc001xac.3	Q96AC1	OTTHUMG00000140309	ENST00000395631.2:c.1077G>C	14.37:g.53341962C>G		Somatic	109	0		WXS	Illumina GAIIx	Phase_I	64	4	NM_001135000	0	0	11	11	0	B5TJY2|Q14840|Q86TY7	Silent	SNP	ENST00000395631.2	37	CCDS9713.1																																																																																			G|0.274;C|0.726		0.368	FERMT2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276907.2	NM_006832	
L3HYPDH	112849	hgsc.bcm.edu	37	14	59950676	59950676	+	Missense_Mutation	SNP	A	A	C	rs34741399	byFrequency	TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr14:59950676A>C	ENST00000247194.4	-	1	472	c.359T>G	c.(358-360)cTt>cGt	p.L120R	JKAMP_ENST00000425728.2_5'Flank|JKAMP_ENST00000356057.5_5'Flank|RP11-701B16.2_ENST00000554253.1_RNA|JKAMP_ENST00000554271.1_5'Flank|JKAMP_ENST00000261247.9_5'Flank|JKAMP_ENST00000556985.1_5'Flank|L3HYPDH_ENST00000487285.1_5'Flank	NM_144581.1	NP_653182.1	Q96EM0	T3HPD_HUMAN	L-3-hydroxyproline dehydratase (trans-)	120					metabolic process (GO:0008152)		hydro-lyase activity (GO:0016836)|trans-L-3-hydroxyproline dehydratase activity (GO:0050346)									L-Proline(DB00172)	CGCCGGCACAAGCCCGAAGTC	0.706											OREG0022712	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	A|||	118	0.0235623	0.0015	0.0519	5008	,	,		15591	0.0		0.0736	False		,,,				2504	0.0061				p.L120R		.											.	.	0			c.T359G						.	A	ARG/LEU	60,4172		0,60,2056	9.0	9.0	9.0		359	5.1	1.0	14	dbSNP_126	9	503,7747		10,483,3632	no	missense	C14orf149	NM_144581.1	102	10,543,5688	CC,CA,AA		6.097,1.4178,4.5105	probably-damaging	120/355	59950676	563,11919	2116	4125	6241	SO:0001583	missense	112849	exon1			GGCACAAGCCCGA	AI762327	CCDS9739.1	14q23.1	2012-08-15	2012-08-15	2012-08-15	ENSG00000126790	ENSG00000126790	4.2.1.77		20488	protein-coding gene	gene with protein product	"""trans-L-3-hydroxyproline dehydratase"""	614811	"""chromosome 14 open reading frame 149"""	C14orf149		22528483	Standard	NM_144581		Approved	FLJ25436	uc001xee.1	Q96EM0	OTTHUMG00000028941	ENST00000247194.4:c.359T>G	14.37:g.59950676A>C	ENSP00000247194:p.Leu120Arg	Somatic	5	0	1042	WXS	Illumina GAIIx	Phase_I	28	4	NM_144581	0	0	1	1	0	Q96LJ5	Missense_Mutation	SNP	ENST00000247194.4	37	CCDS9739.1	77	0.035256410256410256	1	0.0020325203252032522	26	0.0718232044198895	0	0.0	50	0.06596306068601583	A	15.50	2.851546	0.51270	0.014178	0.06097	ENSG00000126790	ENST00000247194	T	0.20463	2.07	5.1	5.1	0.69264	.	0.000000	0.64402	D	0.000001	T	0.01905	0.0060	L	0.39633	1.23	0.80722	D	1	P;P	0.46706	0.883;0.863	P;P	0.49140	0.601;0.449	T	0.00150	-1.1986	10	0.87932	D	0	.	11.7847	0.52034	0.8531:0.1469:0.0:0.0	rs34741399;rs61985498	120;120	B4DGY8;Q96EM0	.;PRCM_HUMAN	R	120	ENSP00000247194:L120R	ENSP00000247194:L120R	L	-	2	0	C14orf149	59020429	1.000000	0.71417	0.995000	0.50966	0.014000	0.08584	8.399000	0.90197	2.039000	0.60335	0.459000	0.35465	CTT	A|0.965;C|0.035		0.706	L3HYPDH-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000072254.5	NM_144581	
PCNXL4	64430	bcgsc.ca	37	14	60591887	60591887	+	Missense_Mutation	SNP	G	G	A	rs167437	byFrequency	TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr14:60591887G>A	ENST00000406854.1	+	9	3552	c.2998G>A	c.(2998-3000)Ggt>Agt	p.G1000S	PCNXL4_ENST00000535349.1_Missense_Mutation_p.G207S|PCNXL4_ENST00000404681.2_Missense_Mutation_p.G1000S|PCNXL4_ENST00000317623.4_Missense_Mutation_p.G766S|PCNXL4_ENST00000406949.1_Missense_Mutation_p.G766S			Q63HM2	PCX4_HUMAN	pecanex-like 4 (Drosophila)	1000			G -> S (in dbSNP:rs167437). {ECO:0000269|PubMed:17974005}.			integral component of membrane (GO:0016021)											GAGAGTTTACGGTGGTGTTTT	0.363													A|||	1747	0.348842	0.6082	0.1412	5008	,	,		19049	0.3472		0.1183	False		,,,				2504	0.3845				p.G766S		.											.	.	0			c.G2296A						.	A	SER/GLY	2375,2031	558.0+/-379.9	630,1115,458	52.0	52.0	52.0		2296	5.2	1.0	14	dbSNP_79	52	1103,7497	763.8+/-407.6	75,953,3272	yes	missense	C14orf135	NM_022495.5	56	705,2068,3730	AA,AG,GG		12.8256,46.0962,26.7415	benign	766/939	60591887	3478,9528	2203	4300	6503	SO:0001583	missense	64430	exon8			GTTTACGGTGGTG	AK022861		14q23.1	2012-07-18	2012-07-18	2012-07-18	ENSG00000126773	ENSG00000126773			20349	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 135"""	C14orf135			Standard	NM_022495		Approved		uc001xer.4	Q63HM2	OTTHUMG00000150361	ENST00000406854.1:c.2998G>A	14.37:g.60591887G>A	ENSP00000384801:p.Gly1000Ser	Somatic	204	0		WXS	Illumina GAIIx	Phase_I	168	6	NM_022495	0	0	19	19	0	A8MXM2|Q9BQG8|Q9H9F2	Missense_Mutation	SNP	ENST00000406854.1	37		610	0.2793040293040293	277	0.5630081300813008	57	0.1574585635359116	196	0.34265734265734266	80	0.10554089709762533	A	3.746	-0.052626	0.07362	0.539038	0.128256	ENSG00000126773	ENST00000317623;ENST00000406854;ENST00000406949;ENST00000404681;ENST00000535349	T;T;T;T;T	0.38722	1.12;1.12;1.12;1.12;1.12	5.18	5.18	0.71444	.	0.472372	0.27100	N	0.020923	T	0.00012	0.0000	N	0.01352	-0.895	0.58432	P	1.0000000000287557E-6	B;B	0.11235	0.004;0.0	B;B	0.06405	0.002;0.001	T	0.44892	-0.9298	9	0.07482	T	0.82	.	6.5552	0.22456	0.7897:0.0:0.0736:0.1367	rs167437;rs3737079;rs52795398;rs61537067;rs167437	1000;766	Q63HM2;B5MC47	CN135_HUMAN;.	S	766;1000;766;1000;207	ENSP00000317396:G766S;ENSP00000384801:G1000S;ENSP00000385201:G766S;ENSP00000385713:G1000S;ENSP00000445644:G207S	ENSP00000317396:G766S	G	+	1	0	C14orf135	59661640	0.999000	0.42202	0.998000	0.56505	0.729000	0.41735	4.470000	0.60175	0.914000	0.36822	-0.893000	0.02921	GGT	G|0.537;T|0.066		0.363	PCNXL4-005	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000317847.1	NM_022495	
FAM161B	145483	bcgsc.ca	37	14	74413129	74413129	+	Silent	SNP	C	C	G	rs7146634	byFrequency	TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr14:74413129C>G	ENST00000534936.1	-	2	339	c.234G>C	c.(232-234)ggG>ggC	p.G78G	FAM161B_ENST00000286544.3_Silent_p.G141G			Q96MY7	F161B_HUMAN	family with sequence similarity 161, member B	78										breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(2)|skin(2)	21						GACACCATCTCCCTTTCTGCT	0.478													G|||	1301	0.259784	0.3003	0.3429	5008	,	,		20403	0.0506		0.4056	False		,,,				2504	0.2117				p.G141G		.											.	FAM161B-91	0			c.G423C						.	G		1345,3061	694.1+/-405.8	198,949,1056	197.0	188.0	191.0		423	-0.5	0.0	14	dbSNP_116	191	3561,5039	628.9+/-398.2	730,2101,1469	no	coding-synonymous	FAM161B	NM_152445.2		928,3050,2525	GG,GC,CC		41.407,30.5266,37.7211		141/711	74413129	4906,8100	2203	4300	6503	SO:0001819	synonymous_variant	145483	exon2			CCATCTCCCTTTC	AA356453	CCDS9822.1, CCDS9822.2	14q24.2	2008-06-05	2008-06-05	2008-06-05		ENSG00000156050			19854	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 44"""	C14orf44			Standard	NM_152445		Approved	FLJ31697	uc001xpd.3	Q96MY7		ENST00000534936.1:c.234G>C	14.37:g.74413129C>G		Somatic	112	1		WXS	Illumina GAIIx	Phase_I	111	5	NM_152445	0	0	2	2	0	B7Z882|J3KNA2	Silent	SNP	ENST00000534936.1	37																																																																																				C|0.648;G|0.352		0.478	FAM161B-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_152445	
ISM2	145501	hgsc.bcm.edu	37	14	77965094	77965094	+	Silent	SNP	G	G	A	rs12431905	byFrequency	TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr14:77965094G>A	ENST00000342219.4	-	1	99	c.43C>T	c.(43-45)Ctg>Ttg	p.L15L	ISM2_ENST00000493585.1_Silent_p.L15L|ISM2_ENST00000393684.3_5'UTR|ISM2_ENST00000412904.1_Silent_p.L15L|ISM2_ENST00000429906.1_Silent_p.L15L	NM_199296.2	NP_954993.1	Q6H9L7	ISM2_HUMAN	isthmin 2	15						extracellular region (GO:0005576)				endometrium(3)|large_intestine(4)|lung(11)|prostate(1)|skin(1)|urinary_tract(1)	21						GCCAGCAGCAGCACGCAGAGG	0.731													G|||	270	0.0539137	0.0061	0.1571	5008	,	,		10603	0.0129		0.0755	False		,,,				2504	0.0654				p.L15L		.											.	ISM2-91	0			c.C43T						.	G	,	51,3145		0,51,1547	3.0	3.0	3.0		43,43	-4.3	0.0	14	dbSNP_120	3	420,5934		10,400,2767	no	coding-synonymous,coding-synonymous	ISM2	NM_182509.3,NM_199296.2	,	10,451,4314	AA,AG,GG		6.61,1.5957,4.9319	,	15/293,15/572	77965094	471,9079	1598	3177	4775	SO:0001819	synonymous_variant	145501	exon1			GCAGCAGCACGCA	AK056709	CCDS9864.1, CCDS45143.1	14q24.3	2013-05-15	2013-05-15	2008-12-23	ENSG00000100593	ENSG00000100593			23176	protein-coding gene	gene with protein product	"""thrombospondin and AMOP containing isthmin-like 1"""	612684	"""thrombospondin, type I domain-containing 3"", ""thrombospondin, type I, domain containing 3"", ""isthmin 2 homolog (zebrafish)"""	THSD3		15194193	Standard	NM_199296		Approved	FLJ32147, TAIL1	uc001xtz.3	Q6H9L7	OTTHUMG00000158563	ENST00000342219.4:c.43C>T	14.37:g.77965094G>A		Somatic	2	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_199296	0	0	0	0	0	A8K6D5|O95432|Q495U5|Q68CN3|Q86TQ7|Q86TW3|Q86TW4|Q8N501|Q8NBL0	Silent	SNP	ENST00000342219.4	37	CCDS9864.1																																																																																			G|0.934;A|0.066		0.731	ISM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000351309.1	NM_182509	
SERPINA1	5265	bcgsc.ca	37	14	94847415	94847415	+	Missense_Mutation	SNP	A	A	G	rs6647	byFrequency	TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr14:94847415A>G	ENST00000448921.1	-	5	1282	c.710T>C	c.(709-711)gTg>gCg	p.V237A	SERPINA1_ENST00000393088.4_Missense_Mutation_p.V237A|SERPINA1_ENST00000437397.1_Missense_Mutation_p.V237A|SERPINA1_ENST00000355814.4_Missense_Mutation_p.V237A|SERPINA1_ENST00000402629.1_Missense_Mutation_p.V237A|SERPINA1_ENST00000440909.1_Missense_Mutation_p.V237A|SERPINA1_ENST00000404814.4_Missense_Mutation_p.V237A|SERPINA1_ENST00000449399.3_Missense_Mutation_p.V237A|SERPINA1_ENST00000555289.1_5'Flank|SERPINA1_ENST00000393087.4_Missense_Mutation_p.V237A	NM_001002236.2|NM_001127701.1|NM_001127703.1|NM_001127704.1|NM_001127705.1	NP_001002236.1|NP_001121173.1|NP_001121175.1|NP_001121176.1|NP_001121177.1	P01009	A1AT_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1	237			V -> A (in M1A and Z; associated with K- 366 in Z; dbSNP:rs6647). {ECO:0000269|PubMed:17650587, ECO:0000269|PubMed:23826168, ECO:0000269|Ref.12, ECO:0000269|Ref.8}.		acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|negative regulation of endopeptidase activity (GO:0010951)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of proteolysis (GO:0030162)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)	glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|protease binding (GO:0002020)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|skin(6)|stomach(1)	24		all_cancers(154;0.0649)|all_epithelial(191;0.223)		Epithelial(152;0.135)|COAD - Colon adenocarcinoma(157;0.207)|all cancers(159;0.221)		CACGGTGGTCACCTGGTCCAC	0.547													G|||	1249	0.249401	0.6074	0.1153	5008	,	,		20209	0.0218		0.1958	False		,,,				2504	0.1503				p.V237A		.											.	SERPINA1-226	0			c.T710C						.	G	ALA/VAL,ALA/VAL,ALA/VAL,ALA/VAL,ALA/VAL,ALA/VAL,ALA/VAL,ALA/VAL,ALA/VAL,ALA/VAL,ALA/VAL	2382,2024	564.4+/-381.4	625,1132,446	105.0	76.0	86.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	710,710,710,710,710,710,710,710,710,710,710	-9.9	0.0	14	dbSNP_52	86	1821,6779	731.7+/-406.8	185,1451,2664	yes	missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense	SERPINA1	NM_000295.4,NM_001002235.2,NM_001002236.2,NM_001127700.1,NM_001127701.1,NM_001127702.1,NM_001127703.1,NM_001127704.1,NM_001127705.1,NM_001127706.1,NM_001127707.1	64,64,64,64,64,64,64,64,64,64,64	810,2583,3110	GG,GA,AA		21.1744,45.9374,32.3159	benign,benign,benign,benign,benign,benign,benign,benign,benign,benign,benign	237/419,237/419,237/419,237/419,237/419,237/419,237/419,237/419,237/419,237/419,237/419	94847415	4203,8803	2203	4300	6503	SO:0001583	missense	5265	exon5			GTGGTCACCTGGT	X01683	CCDS9925.1	14q32.1	2014-02-18	2005-08-18		ENSG00000197249	ENSG00000197249		"""Serine (or cysteine) peptidase inhibitors"""	8941	protein-coding gene	gene with protein product	"""protease inhibitor 1 (anti-elastase), alpha-1-antitrypsin"""	107400	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1"""	PI		24172014	Standard	NM_000295		Approved	AAT, A1A, PI1, alpha-1-antitrypsin, A1AT, alpha1AT	uc010aux.3	P01009	OTTHUMG00000150355	ENST00000448921.1:c.710T>C	14.37:g.94847415A>G	ENSP00000416066:p.Val237Ala	Somatic	167	2		WXS	Illumina GAIIx	Phase_I	143	5	NM_001127701	0	0	22	22	0	A6PX14|B2RDQ8|Q0PVP5|Q13672|Q53XB8|Q5U0M1|Q7M4R2|Q86U18|Q86U19|Q96BF9|Q96ES1|Q9P1P0|Q9UCE6|Q9UCM3	Missense_Mutation	SNP	ENST00000448921.1	37	CCDS9925.1	534	0.2445054945054945	310	0.6300813008130082	47	0.1298342541436464	14	0.024475524475524476	163	0.21503957783641162	G	7.506	0.653591	0.14580	0.540626	0.211744	ENSG00000197249	ENST00000440909;ENST00000448921;ENST00000437397;ENST00000355814;ENST00000393087;ENST00000393088;ENST00000404814;ENST00000449399;ENST00000402629	D;D;D;D;D;D;D;D;D	0.83673	-1.75;-1.75;-1.75;-1.75;-1.75;-1.75;-1.75;-1.75;-1.75	5.22	-9.95	0.00446	Serpin domain (3);	3.695110	0.00797	N	0.001383	T	0.00012	0.0000	N	0.03281	-0.365	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.08994	-1.0695	9	0.16420	T	0.52	.	8.3574	0.32338	0.2211:0.0:0.3322:0.4467	rs6647;rs17581;rs1049594;rs3189781;rs17856489;rs52795319;rs57059392;rs6647	237;237	P01009-2;P01009	.;A1AT_HUMAN	A	237	ENSP00000390299:V237A;ENSP00000416066:V237A;ENSP00000408474:V237A;ENSP00000348068:V237A;ENSP00000376802:V237A;ENSP00000376803:V237A;ENSP00000385960:V237A;ENSP00000416354:V237A;ENSP00000386094:V237A	ENSP00000348068:V237A	V	-	2	0	SERPINA1	93917168	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.447000	0.06828	-2.158000	0.00788	-2.846000	0.00104	GTG	A|0.718;G|0.282		0.547	SERPINA1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317768.2	NM_001002235	
TDRD9	122402	broad.mit.edu;bcgsc.ca	37	14	104394850	104394850	+	Silent	SNP	C	C	T	rs9324066	byFrequency	TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr14:104394850C>T	ENST00000409874.4	+	1	52	c.4C>T	c.(4-6)Ctg>Ttg	p.L2L	C14orf2_ENST00000554880.1_5'Flank|TDRD9_ENST00000339063.5_Silent_p.L2L	NM_153046.2	NP_694591.2	Q8NDG6	TDRD9_HUMAN	tudor domain containing 9	2					cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|male meiosis (GO:0007140)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|piP-body (GO:0071547)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	33		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0768)				CTTGAGGATGCTGCGGAAGCT	0.701													C|||	2308	0.460863	0.5946	0.5216	5008	,	,		5602	0.3869		0.4016	False		,,,				2504	0.3742				p.L2L		.											.	TDRD9-70	0			c.C4T						.	C		777,607		217,343,132	21.0	25.0	24.0		4	3.6	1.0	14	dbSNP_119	24	1212,1970		225,762,604	yes	coding-synonymous	TDRD9	NM_153046.2		442,1105,736	TT,TC,CC		38.0893,43.8584,43.5611		2/1383	104394850	1989,2577	692	1591	2283	SO:0001819	synonymous_variant	122402	exon1			AGGATGCTGCGGA	AK093483	CCDS9987.2	14q32.33	2013-01-23	2004-04-01	2004-04-02	ENSG00000156414	ENSG00000156414		"""Tudor domain containing"""	20122	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 75"""	C14orf75			Standard	NM_153046		Approved	DKFZp434N0820, FLJ36164, NET54	uc001yom.4	Q8NDG6	OTTHUMG00000152876	ENST00000409874.4:c.4C>T	14.37:g.104394850C>T		Somatic	55	0		WXS	Illumina GAIIx	Phase_I	113	8	NM_153046	0	0	0	0	0	A1A4S7|Q6ZU54|Q8N7T3|Q8N827|Q8N9V5|Q96AS9	Silent	SNP	ENST00000409874.4	37	CCDS9987.2																																																																																			A|0.000;C|0.519;G|0.000;T|0.480		0.701	TDRD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328325.3	NM_153046	
ZNF592	9640	bcgsc.ca	37	15	85333953	85333953	+	Silent	SNP	A	A	G	rs2241645	byFrequency	TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr15:85333953A>G	ENST00000560079.2	+	5	2526	c.2238A>G	c.(2236-2238)caA>caG	p.Q746Q	ZNF592_ENST00000299927.3_Silent_p.Q746Q	NM_014630.2	NP_055445.2	Q92610	ZN592_HUMAN	zinc finger protein 592	746					cell death (GO:0008219)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|kidney(1)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(2)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(143;0.0587)			AGGTATGCCAAATGCTGCTGC	0.572													G|||	3926	0.783946	0.798	0.7176	5008	,	,		19845	0.9435		0.7167	False		,,,				2504	0.7168				p.Q746Q		.											.	ZNF592-96	0			c.A2238G						.	G		3487,919	352.1+/-311.5	1391,705,107	131.0	113.0	119.0		2238	3.8	1.0	15	dbSNP_98	119	6302,2296	386.3+/-341.8	2297,1708,294	no	coding-synonymous	ZNF592	NM_014630.2		3688,2413,401	GG,GA,AA		26.7039,20.8579,24.7232		746/1268	85333953	9789,3215	2203	4299	6502	SO:0001819	synonymous_variant	9640	exon5			ATGCCAAATGCTG	D86966	CCDS32317.1	15q25.2	2011-03-15				ENSG00000166716		"""Zinc fingers, C2H2-type"""	28986	protein-coding gene	gene with protein product		613624	"""spinocerebellar ataxia, autosomal recessive 5"""	SCAR5		9039502, 12030328, 20531441	Standard	NM_014630		Approved	KIAA0211, CAMOS	uc002bld.3	Q92610		ENST00000560079.2:c.2238A>G	15.37:g.85333953A>G		Somatic	101	1		WXS	Illumina GAIIx	Phase_I	79	4	NM_014630	0	0	8	8	0	Q2M1T2|Q504Y9	Silent	SNP	ENST00000560079.2	37	CCDS32317.1																																																																																			A|0.223;G|0.777		0.572	ZNF592-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418779.2	NM_014630	
HDDC3	374659	hgsc.bcm.edu	37	15	91475756	91475756	+	Silent	SNP	C	C	G			TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr15:91475756C>G	ENST00000394272.3	-	1	43	c.15G>C	c.(13-15)gcG>gcC	p.A5A	AC068831.3_ENST00000448987.1_RNA|AC068831.3_ENST00000438890.1_RNA|HDDC3_ENST00000330334.3_Silent_p.A5A|UNC45A_ENST00000418476.2_5'Flank|UNC45A_ENST00000394275.2_Intron|HDDC3_ENST00000559898.1_Silent_p.A5A			Q8N4P3	MESH1_HUMAN	HD domain containing 3	5							guanosine-3',5'-bis(diphosphate) 3'-diphosphatase activity (GO:0008893)|metal ion binding (GO:0046872)			NS(1)|ovary(1)	2	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.189)			GCAGCTGCGCCGCCTCAGAGC	0.736																																					p.A5A		.											.	HDDC3-91	0			c.G15C						.						3.0	3.0	3.0					15																	91475756		1431	2881	4312	SO:0001819	synonymous_variant	374659	exon1			CTGCGCCGCCTCA	AK057584	CCDS10366.1, CCDS66866.1	15q26.1	2005-08-22			ENSG00000184508	ENSG00000184508			30522	protein-coding gene	gene with protein product						12477932	Standard	NM_001286451		Approved	MGC45386	uc002bqe.4	Q8N4P3	OTTHUMG00000141260	ENST00000394272.3:c.15G>C	15.37:g.91475756C>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	7	NM_198527	0	0	0	16	16		Silent	SNP	ENST00000394272.3	37																																																																																				.		0.736	HDDC3-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000280403.2	NM_198527	
RCCD1	91433	hgsc.bcm.edu	37	15	91499986	91499986	+	Missense_Mutation	SNP	G	G	T	rs4932380	byFrequency	TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr15:91499986G>T	ENST00000394258.2	+	2	224	c.22G>T	c.(22-24)Gcc>Tcc	p.A8S	RCCD1_ENST00000556618.1_Missense_Mutation_p.A8S|AC068831.6_ENST00000553321.1_RNA|RCCD1_ENST00000555155.1_Missense_Mutation_p.A8S|RCCD1_ENST00000556774.1_Intron	NM_001017919.1|NM_033544.2	NP_001017919.1|NP_291022.2	A6NED2	RCCD1_HUMAN	RCC1 domain containing 1	8			A -> S (in dbSNP:rs4932380).			cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				breast(1)|kidney(1)|large_intestine(2)	4	Lung NSC(78;0.0987)|all_lung(78;0.175)		Lung(145;0.189)			GCGGCCGGGGGCCTGGTTCGG	0.761											OREG0023477	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	951	0.189896	0.0469	0.2954	5008	,	,		8275	0.3819		0.0835	False		,,,				2504	0.2198				p.A8S		.											.	RCCD1-90	0			c.G22T						.	G	SER/ALA,SER/ALA	202,3844		4,194,1825	5.0	9.0	7.0		22,22	-4.2	0.0	15	dbSNP_111	7	594,7378		19,556,3411	yes	missense,missense	RCCD1	NM_001017919.1,NM_033544.2	99,99	23,750,5236	TT,TG,GG		7.4511,4.9926,6.6234	benign,benign	8/377,8/377	91499986	796,11222	2023	3986	6009	SO:0001583	missense	91433	exon2			CCGGGGGCCTGGT		CCDS32333.1	15q26.1	2005-10-21	2005-10-21			ENSG00000166965			30457	protein-coding gene	gene with protein product						12477932	Standard	XM_006720763		Approved	MGC14386	uc002bqk.3	A6NED2		ENST00000394258.2:c.22G>T	15.37:g.91499986G>T	ENSP00000377801:p.Ala8Ser	Somatic	3	0	1283	WXS	Illumina GAIIx	Phase_I	12	12	NM_001017919	0	0	0	1	1	B2RTP9|Q29RX6	Missense_Mutation	SNP	ENST00000394258.2	37	CCDS32333.1	390	0.17857142857142858	22	0.044715447154471545	89	0.24585635359116023	223	0.38986013986013984	56	0.07387862796833773	G	3.046	-0.196425	0.06259	0.049926	0.074511	ENSG00000166965	ENST00000394258;ENST00000555155;ENST00000556618	T;T;T	0.79653	-1.29;-1.29;-1.29	3.71	-4.18	0.03846	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.620743	0.15175	N	0.276447	T	0.00012	0.0000	L	0.27053	0.805	0.58432	P	5.000000000032756E-6	B;B	0.16802	0.019;0.011	B;B	0.14578	0.011;0.005	T	0.30208	-0.9986	9	0.16420	T	0.52	.	0.4602	0.00515	0.2924:0.2652:0.2603:0.1821	rs4932380	8;8	G3V2I3;A6NED2	.;RCCD1_HUMAN	S	8	ENSP00000377801:A8S;ENSP00000450678:A8S;ENSP00000451963:A8S	ENSP00000377801:A8S	A	+	1	0	RCCD1	89300990	0.000000	0.05858	0.021000	0.16686	0.107000	0.19398	-1.567000	0.02146	-0.916000	0.03818	-0.225000	0.12378	GCC	G|0.822;T|0.178		0.761	RCCD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000414748.1	NM_033544	
FAM173A	65990	hgsc.bcm.edu	37	16	771286	771286	+	Silent	SNP	C	C	T	rs11540049	byFrequency	TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr16:771286C>T	ENST00000569529.1	+	1	312	c.12C>T	c.(10-12)gaC>gaT	p.D4D	FAM173A_ENST00000564000.1_Silent_p.D4D|FAM173A_ENST00000219535.3_Silent_p.D4D	NM_023933.2	NP_076422.1	Q9BQD7	F173A_HUMAN	family with sequence similarity 173, member A	4						integral component of membrane (GO:0016021)				pancreas(1)	1						TGGAGCAGGACGACCCGGTCG	0.776													C|||	2702	0.539537	0.4576	0.5144	5008	,	,		9107	0.5337		0.4553	False		,,,				2504	0.7607				p.D4D		.											.	FAM173A-91	0			c.C12T						.						1.0	1.0	1.0					16																	771286		542	1076	1618	SO:0001819	synonymous_variant	65990	exon1			GCAGGACGACCCG	BC002624	CCDS10423.1, CCDS59254.1	16p13.3	2008-06-19	2008-06-19	2008-06-19	ENSG00000103254	ENSG00000103254			14152	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 24"""	C16orf24			Standard	NM_023933		Approved	MGC2494	uc002cje.4	Q9BQD7	OTTHUMG00000121177	ENST00000569529.1:c.12C>T	16.37:g.771286C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_001271285	0	0	1	3	2	A2IDD4	Silent	SNP	ENST00000569529.1	37	CCDS10423.1																																																																																			C|0.504;T|0.496		0.776	FAM173A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000241667.2	NM_023933	
EME2	197342	hgsc.bcm.edu	37	16	1823444	1823444	+	Silent	SNP	C	C	G	rs761065	byFrequency	TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr16:1823444C>G	ENST00000568449.1	+	1	237	c.216C>G	c.(214-216)gtC>gtG	p.V72V	MRPS34_ENST00000177742.3_5'Flank|MRPS34_ENST00000397375.2_5'Flank|NME3_ENST00000219302.3_5'Flank|NME3_ENST00000563498.1_5'Flank|EME2_ENST00000307394.7_Silent_p.V72V	NM_001257370.1	NP_001244299.1	A4GXA9	EME2_HUMAN	essential meiotic structure-specific endonuclease subunit 2	72					DNA recombination (GO:0006310)|DNA repair (GO:0006281)	nucleus (GO:0005634)	DNA binding (GO:0003677)|endonuclease activity (GO:0004519)			central_nervous_system(1)|kidney(2)|lung(5)|pancreas(1)	9						CGGAGCAGGTCCTGAAGCGCC	0.746								Direct reversal of damage;Homologous recombination					C|||	1683	0.336062	0.0915	0.4885	5008	,	,		9781	0.2808		0.5666	False		,,,				2504	0.3783				p.V72V		.											.	EME2-229	0			c.C216G						.	C		457,2833		68,321,1256	4.0	5.0	5.0		216	-5.9	0.0	16	dbSNP_86	5	3986,3362		1200,1586,888	no	coding-synonymous	EME2	NM_001010865.1		1268,1907,2144	GG,GC,CC		45.7539,13.8906,41.7654		72/445	1823444	4443,6195	1645	3674	5319	SO:0001819	synonymous_variant	197342	exon1			GCAGGTCCTGAAG	AK074080	CCDS58404.1	16p13.3	2013-07-03	2013-07-03			ENSG00000197774			27289	protein-coding gene	gene with protein product	"""SLX2 structure-specific endonuclease subunit homolog B (S. cerevisiae)"""	610886	"""essential meiotic endonuclease 1 homolog 2 (S. pombe)"""			12721304	Standard	NM_001257370		Approved	FLJ00151, SLX2B	uc010brw.1	A4GXA9		ENST00000568449.1:c.216C>G	16.37:g.1823444C>G		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	9	9	NM_001257370	0	0	0	1	1	Q8TEP2|Q96RY3	Silent	SNP	ENST00000568449.1	37	CCDS58404.1																																																																																			C|0.615;G|0.385		0.746	EME2-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000433185.2	NM_001010865	
ITGAM	3684	broad.mit.edu	37	16	31342579	31342579	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr16:31342579A>C	ENST00000287497.8	+	29	3445	c.3370A>C	c.(3370-3372)Acc>Ccc	p.T1124P	ITGAM_ENST00000544665.3_Missense_Mutation_p.T1125P			P11215	ITAM_HUMAN	integrin, alpha M (complement component 3 receptor 3 subunit)	1124					activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular extravasation (GO:0045123)|ectodermal cell differentiation (GO:0010668)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|microglia development (GO:0014005)|neutrophil chemotaxis (GO:0030593)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integrin complex (GO:0008305)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)			endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(1)|prostate(4)|skin(1)	56						GGCCCTCATCACCGCCGCGCT	0.706																																					p.T1125P		.											.	ITGAM-226	0			c.A3373C						.						23.0	28.0	27.0					16																	31342579		1986	4181	6167	SO:0001583	missense	3684	exon29			CTCATCACCGCCG	J03925	CCDS45470.1, CCDS54004.1	16p11.2	2010-03-23	2006-02-10			ENSG00000169896		"""CD molecules"", ""Complement system"", ""Integrins"""	6149	protein-coding gene	gene with protein product		120980	"""integrin, alpha M (complement component receptor 3, alpha; also known as CD11b (p170), macrophage antigen alpha polypeptide)"""	CR3A, CD11B			Standard	NM_001145808		Approved	MAC-1, CD11b	uc002ebr.3	P11215		ENST00000287497.8:c.3370A>C	16.37:g.31342579A>C	ENSP00000287497:p.Thr1124Pro	Somatic	66	15		WXS	Illumina GAIIx	Phase_I	110	19	NM_001145808	0	0	9	9	0	Q4VAK0|Q4VAK1|Q4VAK2	Missense_Mutation	SNP	ENST00000287497.8	37	CCDS45470.1	.	.	.	.	.	.	.	.	.	.	A	13.63	2.293070	0.40594	.	.	ENSG00000169896	ENST00000544665;ENST00000287497	T;T	0.54479	0.57;0.57	5.17	5.17	0.71159	.	.	.	.	.	T	0.57784	0.2077	M	0.81942	2.565	0.38892	D	0.957146	P;P	0.50943	0.94;0.94	B;B	0.42959	0.403;0.403	T	0.68911	-0.5284	9	0.59425	D	0.04	.	13.9744	0.64262	1.0:0.0:0.0:0.0	.	1124;1124	Q4VAK1;P11215	.;ITAM_HUMAN	P	1125;1124	ENSP00000441691:T1125P;ENSP00000287497:T1124P	ENSP00000287497:T1124P	T	+	1	0	ITGAM	31250080	0.997000	0.39634	0.993000	0.49108	0.145000	0.21501	3.698000	0.54771	1.937000	0.56155	0.528000	0.53228	ACC	.		0.706	ITGAM-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000432816.1	NM_000632	
CBLN1	869	broad.mit.edu	37	16	49315298	49315298	+	Missense_Mutation	SNP	G	G	T	rs200550358		TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr16:49315298G>T	ENST00000219197.6	-	1	444	c.79C>A	c.(79-81)Ccc>Acc	p.P27T	CBLN1_ENST00000536749.1_Missense_Mutation_p.P27T	NM_004352.3	NP_004343.1	P23435	CBLN1_HUMAN	cerebellin 1 precursor	27					cerebellar granule cell differentiation (GO:0021707)|heterophilic cell-cell adhesion (GO:0007157)|nervous system development (GO:0007399)|positive regulation of synapse assembly (GO:0051965)|protein secretion (GO:0009306)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|extracellular region (GO:0005576)|postsynaptic membrane (GO:0045211)				breast(1)|kidney(3)|large_intestine(2)|lung(3)	9		all_cancers(37;0.0766)|all_lung(18;0.24)				AGCACGATGGGCTCCGTCTCA	0.741																																					p.P27T		.											.	CBLN1-90	0			c.C79A						.						23.0	24.0	24.0					16																	49315298		2199	4299	6498	SO:0001583	missense	869	exon1			CGATGGGCTCCGT	M58583	CCDS10736.1	16q12.1	2008-02-05			ENSG00000102924	ENSG00000102924			1543	protein-coding gene	gene with protein product		600432				7877445, 1704129	Standard	NM_004352		Approved		uc002efq.3	P23435	OTTHUMG00000133148	ENST00000219197.6:c.79C>A	16.37:g.49315298G>T	ENSP00000219197:p.Pro27Thr	Somatic	27	2		WXS	Illumina GAIIx	Phase_I	86	8	NM_004352	0	0	6	6	0	B2RAN9|P02682|Q52M09	Missense_Mutation	SNP	ENST00000219197.6	37	CCDS10736.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.712808	0.89112	.	.	ENSG00000102924	ENST00000219197;ENST00000536749	D;D	0.84146	-1.81;-1.81	3.88	3.88	0.44766	.	0.000000	0.85682	D	0.000000	D	0.89441	0.6716	M	0.72353	2.195	0.80722	D	1	D	0.58268	0.982	P	0.56127	0.792	D	0.91202	0.4992	10	0.72032	D	0.01	-12.6452	15.6102	0.76710	0.0:0.0:1.0:0.0	.	27	P23435	CBLN1_HUMAN	T	27	ENSP00000219197:P27T;ENSP00000444651:P27T	ENSP00000219197:P27T	P	-	1	0	CBLN1	47872799	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	8.863000	0.92288	1.994000	0.58287	0.462000	0.41574	CCC	.		0.741	CBLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256845.4	NM_004352	
RBL2	5934	hgsc.bcm.edu	37	16	53468699	53468699	+	Silent	SNP	C	C	T			TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr16:53468699C>T	ENST00000262133.6	+	1	368	c.231C>T	c.(229-231)taC>taT	p.Y77Y		NM_005611.3	NP_005602.3	Q08999	RBL2_HUMAN	retinoblastoma-like 2	77					chromatin modification (GO:0016568)|mitotic cell cycle (GO:0000278)|regulation of cell cycle (GO:0051726)|regulation of lipid kinase activity (GO:0043550)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)			breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(17)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						GCGAAAGCTACACGCTGGAGG	0.701																																					p.Y77Y		.											.	RBL2-841	0			c.C231T						.						4.0	6.0	5.0					16																	53468699		2022	3995	6017	SO:0001819	synonymous_variant	5934	exon1			AAGCTACACGCTG	X74594	CCDS10748.1	16q12.2	2014-03-11	2014-03-11		ENSG00000103479	ENSG00000103479			9894	protein-coding gene	gene with protein product		180203				8361765, 8643454	Standard	NM_005611		Approved	Rb2, p130	uc002ehi.4	Q08999	OTTHUMG00000133198	ENST00000262133.6:c.231C>T	16.37:g.53468699C>T		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	18	9	NM_005611	0	0	0	0	0	B7Z913|Q15073|Q16084|Q8NE70|Q92812	Silent	SNP	ENST00000262133.6	37	CCDS10748.1																																																																																			.		0.701	RBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256908.3	NM_005611	
CCDC102A	92922	hgsc.bcm.edu	37	16	57562804	57562804	+	Missense_Mutation	SNP	G	G	A	rs12935069		TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr16:57562804G>A	ENST00000258214.2	-	2	532	c.286C>T	c.(286-288)Cgg>Tgg	p.R96W		NM_033212.3	NP_149989.2	Q96A19	C102A_HUMAN	coiled-coil domain containing 102A	96				R -> W (in Ref. 2; AAH08285/AAH09941). {ECO:0000305}.						endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)	8						TCCGACCACCGGCGCATGGTC	0.731													A|||	5008	1.0	1.0	1.0	5008	,	,		3757	1.0		1.0	False		,,,				2504	1.0				p.R96W		.											.	CCDC102A-91	0			c.C286T						.						8.0	10.0	9.0					16																	57562804		1834	3717	5551	SO:0001583	missense	92922	exon2			ACCACCGGCGCAT	BC008285	CCDS10784.1	16q13	2008-02-05			ENSG00000135736	ENSG00000135736			28097	protein-coding gene	gene with protein product						12477932	Standard	NM_033212		Approved	MGC10992	uc002elw.3	Q96A19	OTTHUMG00000133472	ENST00000258214.2:c.286C>T	16.37:g.57562804G>A	ENSP00000258214:p.Arg96Trp	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_033212	0	0	0	0	0	Q9BT74	Missense_Mutation	SNP	ENST00000258214.2	37	CCDS10784.1	2180	0.9981684981684982	492	1.0	360	0.994475138121547	570	0.9965034965034965	758	1.0	A	10.17	1.277909	0.23307	.	.	ENSG00000135736	ENST00000258214	T	0.37752	1.18	4.82	4.82	0.62117	.	0.000000	0.64402	N	0.000001	T	0.00012	0.0000	N	0.00049	-2.415	0.40217	P	0.022302999999999962	B	0.02656	0.0	B	0.01281	0.0	T	0.44787	-0.9305	9	0.33141	T	0.24	-23.2491	9.5348	0.39216	0.9152:0.0:0.0848:0.0	rs12935069;rs12935069	96	Q96A19	C102A_HUMAN	W	96	ENSP00000258214:R96W	ENSP00000258214:R96W	R	-	1	2	CCDC102A	56120305	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	6.801000	0.75170	0.698000	0.31739	-0.556000	0.04195	CGG	G|0.001;A|0.999		0.731	CCDC102A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257348.1	NM_033212	
ZFPM1	161882	hgsc.bcm.edu	37	16	88599697	88599705	+	In_Frame_Del	DEL	AGCCTCTGG	AGCCTCTGG	-	rs67873604|rs149145771|rs368520732|rs67322929|rs201915453|rs67712719	byFrequency	TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	AGCCTCTGG	AGCCTCTGG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr16:88599697_88599705delAGCCTCTGG	ENST00000319555.3	+	10	1653_1661	c.1331_1339delAGCCTCTGG	c.(1330-1341)gagcctctggcc>gcc	p.EPL444del	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	444				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GCCAGAGCGGAGCCTCTGGCCCAGAATGG	0.746																																					p.444_447del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1331_1339del						.																																			SO:0001651	inframe_deletion	161882	exon10			GAGCGGAGCCTCT	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1331_1339delAGCCTCTGG	16.37:g.88599697_88599705delAGCCTCTGG	ENSP00000326630:p.Glu444_Leu446del	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	24	0	NM_153813	0	0	0	0	0		In_Frame_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.746	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
KRTAP4-5	85289	ucsc.edu	37	17	39305785	39305785	+	Missense_Mutation	SNP	A	A	T	rs411367		TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr17:39305785A>T	ENST00000343246.4	-	1	269	c.235T>A	c.(235-237)Tgc>Agc	p.C79S		NM_033188.3	NP_149445.3	Q9BYR2	KRA45_HUMAN	keratin associated protein 4-5	79	26 X 5 AA repeats of C-C-[GRQVCHIEK]- [SPTR]-[VSTQYC].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(4)	6		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			tggcagcagcaggggcggcag	0.657																																					p.C79S		.											.	KRTAP4-5-90	0			c.T235A						.						12.0	18.0	16.0					17																	39305785		2089	4172	6261	SO:0001583	missense	85289	exon1			AGCAGCAGGGGCG	AJ406937	CCDS32650.1	17q21.2	2013-06-25			ENSG00000198271	ENSG00000198271		"""Keratin associated proteins"""	18899	protein-coding gene	gene with protein product						11279113	Standard	NM_033188		Approved	KAP4.5	uc002hwb.3	Q9BYR2	OTTHUMG00000133638	ENST00000343246.4:c.235T>A	17.37:g.39305785A>T	ENSP00000340546:p.Cys79Ser	Somatic	35	1		WXS	Illumina GAIIx	Phase_I	59	11	NM_033188	0	0	0	0	0		Missense_Mutation	SNP	ENST00000343246.4	37	CCDS32650.1	773	0.35393772893772896	210	0.4268292682926829	126	0.34806629834254144	175	0.30594405594405594	262	0.34564643799472294	.	0.010	-1.763522	0.00651	.	.	ENSG00000198271	ENST00000343246	T	0.00534	6.74	2.78	-5.56	0.02529	.	0.768893	0.10092	N	0.717076	T	0.00012	0.0000	N	0.01431	-0.87	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.23297	-1.0192	9	0.02654	T	1	.	5.4481	0.16548	0.6146:0.0:0.1542:0.2312	rs411367;rs6503604	79	Q9BYR2	KRA45_HUMAN	S	79	ENSP00000340546:C79S	ENSP00000340546:C79S	C	-	1	0	KRTAP4-5	36559311	0.977000	0.34250	0.000000	0.03702	0.000000	0.00434	-0.260000	0.08708	-1.272000	0.02427	-2.057000	0.00402	TGC	A|0.354;T|0.646		0.657	KRTAP4-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257783.1		
CDK5RAP3	80279	bcgsc.ca	37	17	46053334	46053334	+	Silent	SNP	A	A	G	rs202125432	byFrequency	TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr17:46053334A>G	ENST00000338399.4	+	8	859	c.753A>G	c.(751-753)gaA>gaG	p.E251E	CDK5RAP3_ENST00000536708.2_Silent_p.E276E|RP11-6N17.9_ENST00000582262.1_RNA	NM_176096.1	NP_788276.1	Q96JB5	CK5P3_HUMAN	CDK5 regulatory subunit associated protein 3	251					brain development (GO:0007420)|protein ufmylation (GO:0071569)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of neuron differentiation (GO:0045664)	membrane (GO:0016020)	protein kinase binding (GO:0019901)	p.E251E(1)		NS(1)|central_nervous_system(2)|cervix(3)|endometrium(3)|large_intestine(2)|lung(5)|prostate(1)|skin(1)	18						CTGTGGTGGAACGACCCCACC	0.602																																					p.E251E		.											.	CDK5RAP3-226	1	Substitution - coding silent(1)	prostate(1)	c.A753G						.																																			SO:0001819	synonymous_variant	80279	exon8			GGTGGAACGACCC	AF110322	CCDS42356.1, CCDS62232.1	17q21.2	2008-07-18				ENSG00000108465			18673	protein-coding gene	gene with protein product	"""ischemic heart CDK5 activator-binding protein C53"", ""LXXLL/leucine-zipper-containing ARFbinding protein"""	608202				10721722	Standard	NM_176096		Approved	MST016, FLJ13660, C53, IC53, HSF-27, OK/SW-cl.114, LZAP	uc010wlc.3	Q96JB5		ENST00000338399.4:c.753A>G	17.37:g.46053334A>G		Somatic	90	0		WXS	Illumina GAIIx	Phase_I	87	7	NM_176096	0	0	52	52	0	B7Z6N4|D3DTU1|D3DTU2|F5H3I5|Q53FA2|Q9H3F8|Q9H8G0|Q9HBR9	Silent	SNP	ENST00000338399.4	37	CCDS42356.1																																																																																			A|0.949;G|0.051		0.602	CDK5RAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442913.1	NM_176096	
STXBP4	252983	broad.mit.edu;bcgsc.ca	37	17	53063612	53063612	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr17:53063612C>T	ENST00000376352.2	+	3	239	c.32C>T	c.(31-33)cCc>cTc	p.P11L	STXBP4_ENST00000398391.2_5'UTR|STXBP4_ENST00000434978.2_Missense_Mutation_p.P11L|STXBP4_ENST00000299341.4_5'UTR|STXBP4_ENST00000405898.1_Missense_Mutation_p.P11L	NM_178509.5	NP_848604.3	Q6ZWJ1	STXB4_HUMAN	syntaxin binding protein 4	11					cellular response to DNA damage stimulus (GO:0006974)|glucose transport (GO:0015758)|insulin receptor signaling pathway (GO:0008286)|positive regulation of cell cycle G1/S phase transition (GO:1902808)|positive regulation of keratinocyte proliferation (GO:0010838)|protein stabilization (GO:0050821)|protein targeting (GO:0006605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(4)|ovary(1)|upper_aerodigestive_tract(2)	19						GTAGTATCACCCAGTCTACTT	0.254																																					p.P11L		.											.	STXBP4-91	0			c.C32T						.						56.0	61.0	59.0					17																	53063612		2203	4290	6493	SO:0001583	missense	252983	exon3			TATCACCCAGTCT	BC041485	CCDS11584.2	17q22	2008-02-05			ENSG00000166263	ENSG00000166263			19694	protein-coding gene	gene with protein product		610415				12855681	Standard	XM_005257187		Approved	Synip, MGC50337	uc002iuf.1	Q6ZWJ1	OTTHUMG00000074043	ENST00000376352.2:c.32C>T	17.37:g.53063612C>T	ENSP00000365530:p.Pro11Leu	Somatic	214	0		WXS	Illumina GAIIx	Phase_I	157	6	NM_178509	0	0	1	1	0	Q8IVZ5	Missense_Mutation	SNP	ENST00000376352.2	37	CCDS11584.2	.	.	.	.	.	.	.	.	.	.	C	10.55	1.381902	0.24944	.	.	ENSG00000166263	ENST00000376352;ENST00000405898;ENST00000434978	T;T;T	0.04360	3.76;3.64;3.75	5.53	4.5	0.54988	.	0.409870	0.24985	N	0.034040	T	0.03095	0.0091	N	0.14661	0.345	0.80722	D	1	B;B	0.12630	0.0;0.006	B;B	0.15870	0.0;0.014	T	0.51220	-0.8733	10	0.26408	T	0.33	-2.4036	8.4122	0.32651	0.0:0.8947:0.0:0.1053	.	11;11	E7EPP7;Q6ZWJ1	.;STXB4_HUMAN	L	11	ENSP00000365530:P11L;ENSP00000385944:P11L;ENSP00000391087:P11L	ENSP00000365530:P11L	P	+	2	0	STXBP4	50418611	0.732000	0.28121	0.794000	0.32065	0.584000	0.36387	2.039000	0.41193	2.882000	0.98803	0.655000	0.94253	CCC	.		0.254	STXBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157184.1	NM_178509	
TCF3	6929	hgsc.bcm.edu	37	19	1619348	1619348	+	Silent	SNP	G	G	A	rs386805766|rs1052696	byFrequency	TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr19:1619348G>A	ENST00000262965.5	-	15	1637	c.1293C>T	c.(1291-1293)ggC>ggT	p.G431G	RNU6-1223P_ENST00000517124.1_RNA|TCF3_ENST00000395423.3_Silent_p.G380G|TCF3_ENST00000588136.1_Silent_p.G431G|TCF3_ENST00000453954.2_Silent_p.G347G|TCF3_ENST00000344749.5_Silent_p.G431G	NM_003200.3	NP_003191.1	Q9HCS4	TF7L1_HUMAN	transcription factor 3	0					anterior/posterior axis specification, embryo (GO:0008595)|axial mesoderm morphogenesis (GO:0048319)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|chromatin organization (GO:0006325)|generation of neurons (GO:0048699)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	16		Acute lymphoblastic leukemia(61;5.94e-12)|all_hematologic(61;1.27e-07)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GTGACATGGGGCCGGTGAAAC	0.736			T	"""PBX1, HLF, TFPT"""	pre B-ALL								G|||	536	0.107029	0.0371	0.0432	5008	,	,		13774	0.254		0.0706	False		,,,				2504	0.1329				p.G431G		.		Dom	yes		19	19p13.3	6929	transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47)		L	.	TCF3-721	0			c.C1293T						.	G	,	155,4211		3,149,2031	13.0	15.0	14.0		1293,1293	-0.6	0.1	19	dbSNP_86	14	512,7976		18,476,3750	no	coding-synonymous,coding-synonymous	TCF3	NM_001136139.2,NM_003200.3	,	21,625,5781	AA,AG,GG		6.032,3.5502,5.189	,	431/652,431/655	1619348	667,12187	2183	4244	6427	SO:0001819	synonymous_variant	6929	exon15			CATGGGGCCGGTG	M65214	CCDS12074.1, CCDS45899.1	19p13.3	2014-02-13	2013-02-26		ENSG00000071564	ENSG00000071564		"""Basic helix-loop-helix proteins"""	11633	protein-coding gene	gene with protein product	"""transcription factor E2-alpha"", ""immunoglobulin transcription factor 1"", ""kappa-E2-binding factor"", ""E2A immunoglobulin enhancer-binding factor E12/E47"", ""VDR interacting repressor"""	147141				2308859, 1967983	Standard	NM_003200		Approved	E2A, ITF1, MGC129647, MGC129648, bHLHb21, VDIR, E47	uc002ltt.4	P15923	OTTHUMG00000180031	ENST00000262965.5:c.1293C>T	19.37:g.1619348G>A		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	8	7	NM_003200	0	0	0	0	0	Q53R97|Q6PD70|Q9NP00	Silent	SNP	ENST00000262965.5	37	CCDS12074.1																																																																																			G|0.903;A|0.097		0.736	TCF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449367.1	NM_003200	
TCF3	6929	hgsc.bcm.edu	37	19	1619350	1619350	+	Missense_Mutation	SNP	C	C	T	rs386805766|rs1052692	byFrequency	TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr19:1619350C>T	ENST00000262965.5	-	15	1635	c.1291G>A	c.(1291-1293)Ggc>Agc	p.G431S	RNU6-1223P_ENST00000517124.1_RNA|TCF3_ENST00000395423.3_Missense_Mutation_p.G380S|TCF3_ENST00000588136.1_Missense_Mutation_p.G431S|TCF3_ENST00000453954.2_Missense_Mutation_p.G347S|TCF3_ENST00000344749.5_Missense_Mutation_p.G431S	NM_003200.3	NP_003191.1	Q9HCS4	TF7L1_HUMAN	transcription factor 3	0					anterior/posterior axis specification, embryo (GO:0008595)|axial mesoderm morphogenesis (GO:0048319)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|chromatin organization (GO:0006325)|generation of neurons (GO:0048699)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	16		Acute lymphoblastic leukemia(61;5.94e-12)|all_hematologic(61;1.27e-07)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GACATGGGGCCGGTGAAACCT	0.741			T	"""PBX1, HLF, TFPT"""	pre B-ALL								C|||	564	0.11262	0.056	0.0476	5008	,	,		13830	0.254		0.0716	False		,,,				2504	0.1319				p.G431S		.		Dom	yes		19	19p13.3	6929	transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47)		L	.	TCF3-721	0			c.G1291A						.	C	SER/GLY,SER/GLY	215,4155		5,205,1975	13.0	15.0	14.0		1291,1291	-0.7	0.0	19	dbSNP_86	14	530,7974		19,492,3741	yes	missense,missense	TCF3	NM_001136139.2,NM_003200.3	56,56	24,697,5716	TT,TC,CC		6.2324,4.9199,5.7869	benign,benign	431/652,431/655	1619350	745,12129	2185	4252	6437	SO:0001583	missense	6929	exon15			TGGGGCCGGTGAA	M65214	CCDS12074.1, CCDS45899.1	19p13.3	2014-02-13	2013-02-26		ENSG00000071564	ENSG00000071564		"""Basic helix-loop-helix proteins"""	11633	protein-coding gene	gene with protein product	"""transcription factor E2-alpha"", ""immunoglobulin transcription factor 1"", ""kappa-E2-binding factor"", ""E2A immunoglobulin enhancer-binding factor E12/E47"", ""VDR interacting repressor"""	147141				2308859, 1967983	Standard	NM_003200		Approved	E2A, ITF1, MGC129647, MGC129648, bHLHb21, VDIR, E47	uc002ltt.4	P15923	OTTHUMG00000180031	ENST00000262965.5:c.1291G>A	19.37:g.1619350C>T	ENSP00000262965:p.Gly431Ser	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	8	7	NM_003200	0	0	0	0	0	Q53R97|Q6PD70|Q9NP00	Missense_Mutation	SNP	ENST00000262965.5	37	CCDS12074.1	219	0.10027472527472528	18	0.036585365853658534	14	0.03867403314917127	142	0.24825174825174826	45	0.059366754617414245	C	11.78	1.740783	0.30865	0.049199	0.062324	ENSG00000071564	ENST00000262965;ENST00000344749;ENST00000453954;ENST00000395423	T;T;T	0.57907	0.37;0.37;0.37	4.29	-0.72	0.11195	.	0.354219	0.29342	N	0.012425	T	0.00012	0.0000	L	0.48260	1.515	0.80722	P	0.0	B;P;B;B	0.38827	0.304;0.649;0.048;0.085	B;B;B;B	0.26416	0.056;0.069;0.014;0.011	T	0.18999	-1.0319	9	0.23891	T	0.37	-16.7082	4.654	0.12608	0.1526:0.572:0.0:0.2754	rs1052692;rs3170423	431;431;380;368	P15923-2;P15923;Q2TB39;Q6PJU3	.;TFE2_HUMAN;.;.	S	431;431;431;380	ENSP00000262965:G431S;ENSP00000344375:G431S;ENSP00000378813:G380S	ENSP00000262965:G431S	G	-	1	0	TCF3	1570350	0.000000	0.05858	0.031000	0.17742	0.007000	0.05969	-1.118000	0.03280	0.264000	0.21851	-0.258000	0.10820	GGC	C|0.901;T|0.099		0.741	TCF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449367.1	NM_003200	
PRKCSH	5589	hgsc.bcm.edu	37	19	11558367	11558367	+	Silent	SNP	G	G	A			TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr19:11558367G>A	ENST00000589838.1	+	10	963	c.963G>A	c.(961-963)gaG>gaA	p.E321E	PRKCSH_ENST00000412601.1_Silent_p.E321E|PRKCSH_ENST00000587327.1_Silent_p.E321E|PRKCSH_ENST00000592741.1_Silent_p.E321E|PRKCSH_ENST00000252455.2_Silent_p.E321E|PRKCSH_ENST00000591462.1_Silent_p.E321E			P14314	GLU2B_HUMAN	protein kinase C substrate 80K-H	321	Glu-rich (acidic).				cellular protein metabolic process (GO:0044267)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|liver development (GO:0001889)|N-glycan processing (GO:0006491)|negative regulation of neuron projection development (GO:0010977)|nitrogen compound metabolic process (GO:0006807)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein heterooligomerization (GO:0051291)|protein N-linked glycosylation via asparagine (GO:0018279)|renal system development (GO:0072001)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|intracellular (GO:0005622)	calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|phosphoprotein binding (GO:0051219)|protein kinase C binding (GO:0005080)|RNA binding (GO:0003723)	p.E321_E322delEE(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|prostate(3)	19						aggaggaggaggaggaagaag	0.632																																					p.E321E		.											.	PRKCSH-90	1	Deletion - In frame(1)	central_nervous_system(1)	c.G963A						.						28.0	28.0	28.0					19																	11558367		2200	4298	6498	SO:0001819	synonymous_variant	5589	exon11			GGAGGAGGAGGAA		CCDS32911.1, CCDS45977.1, CCDS74286.1	19p13.2	2014-01-30			ENSG00000130175	ENSG00000130175	2.7.11.1	"""EF-hand domain containing"""	9411	protein-coding gene	gene with protein product		177060	"""polycystic liver disease"""	G19P1, PCLD, PLD1		12529853	Standard	NM_002743		Approved		uc002mrt.3	P14314	OTTHUMG00000182029	ENST00000589838.1:c.963G>A	19.37:g.11558367G>A		Somatic	95	0		WXS	Illumina GAIIx	Phase_I	125	7	NM_001001329	0	0	71	71	0	A8K318|Q96BU9|Q96D06|Q9P0W9	Silent	SNP	ENST00000589838.1	37	CCDS32911.1																																																																																			.		0.632	PRKCSH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458817.1		
CILP2	148113	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	19656298	19656298	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr19:19656298G>A	ENST00000291495.5	+	8	3029	c.2944G>A	c.(2944-2946)Gag>Aag	p.E982K	CILP2_ENST00000586018.1_Missense_Mutation_p.E988K	NM_153221.2	NP_694953.2	Q8IUL8	CILP2_HUMAN	cartilage intermediate layer protein 2	982						extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(17)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	32						GCGAGACCCCGAGCGTCCGGG	0.672																																					p.E982K		.											.	CILP2-91	0			c.G2944A						.						16.0	19.0	18.0					19																	19656298		2196	4294	6490	SO:0001583	missense	148113	exon8			GACCCCGAGCGTC	AF542080	CCDS12405.1	19p13.11	2013-01-14				ENSG00000160161		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	24213	protein-coding gene	gene with protein product		612419				12477932	Standard	NM_153221		Approved	MGC45771	uc002nmv.4	Q8IUL8		ENST00000291495.5:c.2944G>A	19.37:g.19656298G>A	ENSP00000291495:p.Glu982Lys	Somatic	33	0		WXS	Illumina GAIIx	Phase_I	95	31	NM_153221	0	0	1	1	0	Q6NV88|Q8N4A6|Q8WV21	Missense_Mutation	SNP	ENST00000291495.5	37	CCDS12405.1	.	.	.	.	.	.	.	.	.	.	G	7.215	0.596150	0.13875	.	.	ENSG00000160161	ENST00000291495	T	0.08984	3.03	5.79	-5.23	0.02798	.	0.485974	0.22648	N	0.057377	T	0.09598	0.0236	L	0.50333	1.59	0.09310	N	1	B;B	0.28082	0.2;0.2	B;B	0.23574	0.036;0.047	T	0.35151	-0.9800	10	0.15066	T	0.55	-2.2347	26.967	0.99997	0.0:0.8487:0.1513:0.0	.	982;982	B2RAJ0;Q8IUL8	.;CILP2_HUMAN	K	982	ENSP00000291495:E982K	ENSP00000291495:E982K	E	+	1	0	CILP2	19517298	0.001000	0.12720	0.000000	0.03702	0.007000	0.05969	-0.271000	0.08572	-0.941000	0.03700	-0.314000	0.08810	GAG	.		0.672	CILP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000459738.3	NM_153221	
PLEKHF1	79156	hgsc.bcm.edu	37	19	30165225	30165225	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr19:30165225G>A	ENST00000436066.3	+	2	945	c.479G>A	c.(478-480)cGc>cAc	p.R160H	PLEKHF1_ENST00000592810.1_Missense_Mutation_p.R160H	NM_024310.4	NP_077286.3	Q96S99	PKHF1_HUMAN	pleckstrin homology domain containing, family F (with FYVE domain) member 1	160					apoptotic process (GO:0006915)|endosome organization (GO:0007032)|positive regulation of autophagy (GO:0010508)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|protein localization to plasma membrane (GO:0072659)|vesicle organization (GO:0016050)	endosome membrane (GO:0010008)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)			breast(1)|lung(3)|ovary(1)|prostate(1)	6	Ovarian(5;0.000567)|Breast(6;0.0602)|Esophageal squamous(110;0.239)		UCEC - Uterine corpus endometrioid carcinoma (4;2.65e-06)|STAD - Stomach adenocarcinoma(5;1.7e-06)|Lung(7;0.0623)|LUAD - Lung adenocarcinoma(5;0.0989)|BRCA - Breast invasive adenocarcinoma(6;0.225)			ATCTGCATGCGCTGCACGCAG	0.711																																					p.R160H		.											.	PLEKHF1-226	0			c.G479A						.						14.0	19.0	18.0					19																	30165225		2194	4271	6465	SO:0001583	missense	79156	exon2			GCATGCGCTGCAC	AF434818	CCDS12417.1	19q11	2013-01-10				ENSG00000166289		"""Zinc fingers, FYVE domain containing"", ""Pleckstrin homology (PH) domain containing"""	20764	protein-coding gene	gene with protein product		615200					Standard	NM_024310		Approved	APPD, MGC4090, PHAFIN1, ZFYVE15	uc002nsh.4	Q96S99		ENST00000436066.3:c.479G>A	19.37:g.30165225G>A	ENSP00000389787:p.Arg160His	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	17	8	NM_024310	0	0	1	1	0	Q96K11|Q9BUB9	Missense_Mutation	SNP	ENST00000436066.3	37	CCDS12417.1	.	.	.	.	.	.	.	.	.	.	G	16.06	3.016353	0.54468	.	.	ENSG00000166289	ENST00000436066	T	0.72167	-0.63	5.3	5.3	0.74995	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, FYVE-type (2);Zinc finger, FYVE-related (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	T	0.59211	0.2177	L	0.37800	1.135	0.80722	D	1	P;P	0.37663	0.604;0.555	B;B	0.29862	0.058;0.108	T	0.58929	-0.7549	10	0.24483	T	0.36	-0.6485	17.9384	0.89019	0.0:0.0:1.0:0.0	.	245;160	B4DWN9;Q96S99	.;PKHF1_HUMAN	H	160	ENSP00000389787:R160H	ENSP00000389787:R160H	R	+	2	0	PLEKHF1	34857065	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.742000	0.98846	2.473000	0.83533	0.462000	0.41574	CGC	.		0.711	PLEKHF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459323.1	NM_024310	
RGS9BP	388531	hgsc.bcm.edu	37	19	33167455	33167455	+	Missense_Mutation	SNP	G	G	T	rs259290	byFrequency	TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr19:33167455G>T	ENST00000334176.3	+	1	1143	c.286G>T	c.(286-288)Gcg>Tcg	p.A96S	ANKRD27_ENST00000587352.1_5'Flank|ANKRD27_ENST00000306065.4_5'Flank	NM_207391.2	NP_997274.2	Q6ZS82	R9BP_HUMAN	regulator of G protein signaling 9 binding protein	96			A -> S (in dbSNP:rs259290). {ECO:0000269|PubMed:14702039}.		detection of light stimulus involved in visual perception (GO:0050908)|negative regulation of signal transduction (GO:0009968)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)	integral component of membrane (GO:0016021)				central_nervous_system(1)|lung(2)	3	Esophageal squamous(110;0.137)					CATGCGACGCGCGCTGGAGCT	0.786													G|||	2178	0.434904	0.3805	0.4856	5008	,	,		10415	0.2579		0.6233	False		,,,				2504	0.4611				p.A96S		.											.	RGS9BP-90	0			c.G286T						.	G	SER/ALA	1584,1384		459,666,359	2.0	2.0	2.0		286	3.5	1.0	19	dbSNP_79	2	4397,1763		1670,1057,353	yes	missense	RGS9BP	NM_207391.2	99	2129,1723,712	TT,TG,GG		28.6201,46.6307,34.4763	possibly-damaging	96/236	33167455	5981,3147	1484	3080	4564	SO:0001583	missense	388531	exon1			CGACGCGCGCTGG	AW302149	CCDS12424.1	19q13.11	2008-02-05	2007-08-14			ENSG00000186326			30304	protein-coding gene	gene with protein product		607814	"""regulator of G protein signalling 9 binding protein"""			12119397, 8889548	Standard	NM_207391		Approved	FLJ45744, PERRS, R9AP, RGS9	uc002ntp.1	Q6ZS82		ENST00000334176.3:c.286G>T	19.37:g.33167455G>T	ENSP00000334134:p.Ala96Ser	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_207391	0	0	0	0	0	Q6ZVJ6	Missense_Mutation	SNP	ENST00000334176.3	37	CCDS12424.1	1007	0.4610805860805861	184	0.37398373983739835	188	0.5193370165745856	161	0.28146853146853146	474	0.6253298153034301	G	15.38	2.815844	0.50527	0.533693	0.713799	ENSG00000186326	ENST00000334176	T	0.33654	1.4	4.57	3.5	0.40072	.	0.065802	0.64402	U	0.000009	T	0.00012	0.0000	L	0.28115	0.83	0.20873	P	0.999831543	P	0.52170	0.951	P	0.50352	0.638	T	0.12528	-1.0544	9	0.35671	T	0.21	-21.6697	13.7833	0.63094	0.0:0.0:0.8453:0.1547	rs259290	96	Q6ZS82	R9BP_HUMAN	S	96	ENSP00000334134:A96S	ENSP00000334134:A96S	A	+	1	0	RGS9BP	37859295	1.000000	0.71417	1.000000	0.80357	0.125000	0.20455	4.816000	0.62642	1.092000	0.41356	0.313000	0.20887	GCG	G|0.540;T|0.460		0.786	RGS9BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450337.1	NM_207391	
ERCC2	2068	hgsc.bcm.edu	37	19	45867259	45867259	+	Missense_Mutation	SNP	C	C	T	rs1799793	byFrequency	TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr19:45867259C>T	ENST00000391945.4	-	10	1011	c.934G>A	c.(934-936)Gac>Aac	p.D312N	ERCC2_ENST00000485403.2_Missense_Mutation_p.D288N|ERCC2_ENST00000221481.6_3'UTR|ERCC2_ENST00000391940.4_Missense_Mutation_p.D288N|ERCC2_ENST00000391944.3_Missense_Mutation_p.D234N	NM_000400.3	NP_000391.1	P18074	ERCC2_HUMAN	excision repair cross-complementation group 2	312			D -> N (in dbSNP:rs1799793). {ECO:0000269|PubMed:11245433, ECO:0000269|PubMed:11470747, ECO:0000269|PubMed:11709541, ECO:0000269|Ref.3}.		7-methylguanosine mRNA capping (GO:0006370)|aging (GO:0007568)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|central nervous system myelin formation (GO:0032289)|chromosome segregation (GO:0007059)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)|embryonic cleavage (GO:0040016)|erythrocyte maturation (GO:0043249)|extracellular matrix organization (GO:0030198)|gene expression (GO:0010467)|hair cell differentiation (GO:0035315)|hair follicle maturation (GO:0048820)|hematopoietic stem cell differentiation (GO:0060218)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision (GO:0033683)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral transcription (GO:0050434)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to hypoxia (GO:0001666)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|spinal cord development (GO:0021510)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)|viral process (GO:0016032)	cytoplasm (GO:0005737)|holo TFIIH complex (GO:0005675)|MMXD complex (GO:0071817)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	4 iron, 4 sulfur cluster binding (GO:0051539)|5'-3' DNA helicase activity (GO:0043139)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			large_intestine(4)|lung(2)|ovary(1)|pancreas(1)|stomach(1)	9		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		AGCACTTCGTCGGGCAGCACG	0.746			"""Mis, N, F, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum				C|||	974	0.194489	0.0734	0.1988	5008	,	,		10423	0.0496		0.3588	False		,,,				2504	0.3354				p.D312N		.	yes	Rec		Xeroderma pigmentosum (D)	19	19q13.2-q13.3	2068	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 (xeroderma pigmentosum D)"""		E	.	ERCC2-848	0			c.G934A	GRCh37	CM015299	ERCC2	M	rs1799793	.	C	ASN/ASP,ASN/ASP	387,3577		30,327,1625	5.0	8.0	7.0		934,862	5.2	0.5	19	dbSNP_89	7	2507,5397		444,1619,1889	no	missense,missense	ERCC2	NM_000400.3,NM_001130867.1	23,23	474,1946,3514	TT,TC,CC		31.7181,9.7629,24.3849	benign,benign	312/761,288/406	45867259	2894,8974	1982	3952	5934	SO:0001583	missense	2068	exon10	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	CTTCGTCGGGCAG		CCDS33049.1, CCDS46112.1	19q13.3	2014-09-17	2014-03-07		ENSG00000104884	ENSG00000104884	3.6.4.12	"""General transcription factor IIH complex subunits"""	3434	protein-coding gene	gene with protein product	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 protein"", ""TFIIH basal transcription factor complex helicase XPB subunit"""	126340	"""xeroderma pigmentosum complementary group D"", ""excision repair cross-complementing rodent repair deficiency, complementation group 2"""	XPD		8413672, 2184031	Standard	NM_000400		Approved	MAG, EM9, MGC102762, MGC126218, MGC126219, TFIIH	uc002pbj.2	P18074	OTTHUMG00000048190	ENST00000391945.4:c.934G>A	19.37:g.45867259C>T	ENSP00000375809:p.Asp312Asn	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	19	12	NM_000400	0	0	1	14	13	Q2TB78|Q2YDY2|Q7KZU6|Q8N721	Missense_Mutation	SNP	ENST00000391945.4	37	CCDS33049.1	423	0.1936813186813187	34	0.06910569105691057	70	0.19337016574585636	38	0.06643356643356643	281	0.370712401055409	C	20.0	3.930510	0.73327	0.097629	0.317181	ENSG00000104884	ENST00000391941;ENST00000391942;ENST00000391945;ENST00000391944;ENST00000391940	T;T;T	0.64438	-0.1;-0.1;-0.1	5.15	5.15	0.70609	Domain of unknown function DUF1227 (1);	0.000000	0.85682	D	0.000000	T	0.00012	0.0000	L	0.46947	1.48	0.09310	P	1.0	B;P;B	0.34639	0.065;0.461;0.053	B;B;B	0.35353	0.059;0.201;0.051	T	0.28267	-1.0049	9	0.33940	T	0.23	-30.0006	16.1268	0.81402	0.0:1.0:0.0:0.0	rs1799793;rs3916814;rs58989209;rs1799793	234;288;312	E7EVE9;Q7KZU6;P18074	.;.;ERCC2_HUMAN	N	262;288;312;234;288	ENSP00000375809:D312N;ENSP00000375808:D234N;ENSP00000375804:D288N	ENSP00000375804:D288N	D	-	1	0	ERCC2	50559099	1.000000	0.71417	0.523000	0.27875	0.865000	0.49528	7.192000	0.77771	2.388000	0.81334	0.561000	0.74099	GAC	C|0.804;T|0.196		0.746	ERCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109626.2	NM_000400	
PTGIR	5739	hgsc.bcm.edu	37	19	47127324	47127324	+	Silent	SNP	C	C	G	rs2229128	byFrequency	TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr19:47127324C>G	ENST00000291294.2	-	2	292	c.159G>C	c.(157-159)gtG>gtC	p.V53V	PTGIR_ENST00000597185.1_Intron|PTGIR_ENST00000594275.1_Intron|PTGIR_ENST00000596260.1_Silent_p.V53V|PTGIR_ENST00000598865.1_Intron	NM_000960.3	NP_000951.1	P43119	PI2R_HUMAN	prostaglandin I2 (prostacyclin) receptor (IP)	53					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of GTPase activity (GO:0043547)|response to lipopolysaccharide (GO:0032496)	cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	13		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000327)|all cancers(93;0.000641)|Epithelial(262;0.0174)|GBM - Glioblastoma multiforme(486;0.0331)	Dinoprost Tromethamine(DB01160)|Epoprostenol(DB01240)|Iloprost(DB01088)|Treprostinil(DB00374)	CCAGTCCGGTCACCAGCACCG	0.731													G|||	1139	0.227436	0.1362	0.2133	5008	,	,		13968	0.3313		0.2465	False		,,,				2504	0.2342				p.V53V		.											.	PTGIR-522	0			c.G159C						.	G		523,3103		62,399,1352	3.0	5.0	5.0		159	2.2	1.0	19	dbSNP_98	5	1678,5498		231,1216,2141	no	coding-synonymous	PTGIR	NM_000960.3		293,1615,3493	GG,GC,CC		23.3835,14.4236,20.3759		53/387	47127324	2201,8601	1813	3588	5401	SO:0001819	synonymous_variant	5739	exon2			TCCGGTCACCAGC		CCDS12686.1	19q13.3	2012-08-08				ENSG00000160013		"""GPCR / Class A : Prostanoid receptors"""	9602	protein-coding gene	gene with protein product		600022				7759114	Standard	NM_000960		Approved	IP	uc002pex.3	P43119		ENST00000291294.2:c.159G>C	19.37:g.47127324C>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	4	NM_000960	0	0	0	0	0		Silent	SNP	ENST00000291294.2	37	CCDS12686.1																																																																																			C|0.254;G|0.746		0.731	PTGIR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466581.1		
TPRX1	284355	ucsc.edu	37	19	48305650	48305650	+	Silent	SNP	C	C	T	rs112397458		TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr19:48305650C>T	ENST00000322175.3	-	2	773	c.618G>A	c.(616-618)ccG>ccA	p.P206P	TPRX1_ENST00000543508.1_Silent_p.P196P|TPRX1_ENST00000535759.1_Silent_p.P303P	NM_198479.2	NP_940881.2	Q8N7U7	TPRX1_HUMAN	tetra-peptide repeat homeobox 1	206	Gly-rich.			P -> L (in Ref. 1; BAC05130). {ECO:0000305}.		nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(5)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)|skin(1)	18		all_cancers(25;3.02e-09)|all_epithelial(76;7e-07)|all_lung(116;2.48e-06)|Lung NSC(112;5.15e-06)|Ovarian(192;0.0139)|all_neural(266;0.0146)|Breast(70;0.133)		OV - Ovarian serous cystadenocarcinoma(262;0.000241)|all cancers(93;0.00036)|Epithelial(262;0.0127)|GBM - Glioblastoma multiforme(486;0.048)		ggcctgggatcgggcctggga	0.677																																					p.P206P	Esophageal Squamous(123;175 2281 3051 32395)	.											.	TPRX1-90	0			c.G618A						.	T		31,3587		0,31,1778	12.0	9.0	10.0		618	-0.8	0.0	19	dbSNP_132	10	264,6594		0,264,3165	no	coding-synonymous	TPRX1	NM_198479.2		0,295,4943	TT,TC,CC		3.8495,0.8568,2.816		206/412	48305650	295,10181	1809	3429	5238	SO:0001819	synonymous_variant	284355	exon2			TGGGATCGGGCCT		CCDS33066.1	19q13.33	2011-07-08			ENSG00000178928	ENSG00000178928		"""Homeoboxes / PRD class"""	32174	protein-coding gene	gene with protein product		611166					Standard	XM_005258788		Approved	FLJ40321	uc002php.2	Q8N7U7		ENST00000322175.3:c.618G>A	19.37:g.48305650C>T		Somatic	31	0		WXS	Illumina GAIIx	Phase_I	46	10	NM_198479	0	0	0	0	0	A5D8Y3|B2RPL5	Silent	SNP	ENST00000322175.3	37	CCDS33066.1																																																																																			C|0.912;T|0.088		0.677	TPRX1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409868.1	NM_198479	
GYS1	2997	bcgsc.ca	37	19	49485548	49485548	+	Silent	SNP	G	G	A	rs5464	byFrequency	TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr19:49485548G>A	ENST00000323798.3	-	7	1222	c.1026C>T	c.(1024-1026)ttC>ttT	p.F342F	GYS1_ENST00000263276.6_Silent_p.F278F|GYS1_ENST00000541188.1_Silent_p.F262F|GYS1_ENST00000540532.1_Missense_Mutation_p.S223F|GYS1_ENST00000544287.1_5'UTR	NM_002103.4	NP_002094.2	P13807	GYS1_HUMAN	glycogen synthase 1 (muscle)	342					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|heart development (GO:0007507)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|inclusion body (GO:0016234)|membrane (GO:0016020)	glucose binding (GO:0005536)|glycogen (starch) synthase activity (GO:0004373)|glycogen synthase activity, transferring glucose-1-phosphate (GO:0061547)|protein kinase binding (GO:0019901)			breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000164)|all cancers(93;0.000226)|GBM - Glioblastoma multiforme(486;0.00561)|Epithelial(262;0.0286)		ATGCCTCCAGGAAGACGTCAG	0.517													G|||	1275	0.254593	0.2943	0.2608	5008	,	,		17958	0.2183		0.2922	False		,,,				2504	0.1953				p.F342F		.											.	GYS1-524	0			c.C1026T						.	G	,	1243,3163	431.0+/-342.8	197,849,1157	110.0	101.0	104.0		834,1026	4.2	1.0	19	dbSNP_52	104	2535,6065	415.4+/-351.8	365,1805,2130	no	coding-synonymous,coding-synonymous	GYS1	NM_001161587.1,NM_002103.4	,	562,2654,3287	AA,AG,GG		29.4767,28.2115,29.0481	,	278/674,342/738	49485548	3778,9228	2203	4300	6503	SO:0001819	synonymous_variant	2997	exon7			CTCCAGGAAGACG		CCDS12747.1, CCDS54292.1	19q13.3	2013-02-22			ENSG00000104812	ENSG00000104812	2.4.1.11	"""Glycosyltransferase group 1 domain containing"""	4706	protein-coding gene	gene with protein product		138570		GYS			Standard	NM_002103		Approved	GSY	uc002plp.3	P13807	OTTHUMG00000150723	ENST00000323798.3:c.1026C>T	19.37:g.49485548G>A		Somatic	151	1		WXS	Illumina GAIIx	Phase_I	253	10	NM_002103	0	0	94	94	0	Q9BTT9	Silent	SNP	ENST00000323798.3	37	CCDS12747.1	589	0.2696886446886447	156	0.3170731707317073	100	0.27624309392265195	134	0.23426573426573427	199	0.262532981530343	G	12.39	1.922336	0.33908	0.282115	0.294767	ENSG00000104812	ENST00000540532	T	0.26373	1.74	5.21	4.16	0.48862	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.39974	P	0.025175999999999976	.	.	.	.	.	.	T	0.43669	-0.9377	4	.	.	.	-31.0172	8.5832	0.33642	0.1731:0.0:0.8269:0.0	rs5464;rs2228476;rs8192706;rs13306416;rs16981011;rs16981013;rs17206756;rs5464	.	.	.	F	223	ENSP00000445197:S223F	.	S	-	2	0	GYS1	54177360	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	1.703000	0.37846	2.613000	0.88420	0.650000	0.86243	TCC	G|0.713;A|0.287		0.517	GYS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319791.1	NM_002103	
ZNF814	730051	hgsc.bcm.edu	37	19	58385790	58385790	+	Missense_Mutation	SNP	G	G	T	rs111727691		TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr19:58385790G>T	ENST00000435989.2	-	3	1202	c.968C>A	c.(967-969)cCt>cAt	p.P323H	ZNF814_ENST00000600634.1_Intron|ZNF814_ENST00000597832.1_Intron|ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000595295.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	323					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						ACATTCATAAGGTCTTTTCCC	0.358																																					p.P323H		.											.	.	0			c.C968A						.						15.0	12.0	13.0					19																	58385790		688	1563	2251	SO:0001583	missense	730051	exon3			TCATAAGGTCTTT		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.968C>A	19.37:g.58385790G>T	ENSP00000410545:p.Pro323His	Somatic	103	0		WXS	Illumina GAIIx	Phase_I	114	15	NM_001144989	0	0	9	9	0	A6NF35	Missense_Mutation	SNP	ENST00000435989.2	37	CCDS46212.1	.	.	.	.	.	.	.	.	.	.	.	8.139	0.784825	0.16189	.	.	ENSG00000204514	ENST00000435989	T	0.29397	1.57	2.27	1.18	0.20946	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.57080	0.2029	M	0.90019	3.08	0.20764	N	0.999853	D	0.89917	1.0	D	0.67231	0.95	T	0.46247	-0.9205	9	0.66056	D	0.02	.	9.258	0.37595	0.0:0.0:0.7811:0.2189	.	323	B7Z6K7	ZN814_HUMAN	H	323	ENSP00000410545:P323H	ENSP00000410545:P323H	P	-	2	0	ZNF814	63077602	0.000000	0.05858	0.028000	0.17463	0.016000	0.09150	-0.439000	0.06897	0.330000	0.23485	-1.407000	0.01130	CCT	G|0.500;T|0.500		0.358	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
ZNF814	730051	hgsc.bcm.edu	37	19	58385793	58385793	+	Missense_Mutation	SNP	C	C	T	rs113623532		TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr19:58385793C>T	ENST00000435989.2	-	3	1199	c.965G>A	c.(964-966)aGa>aAa	p.R322K	ZNF814_ENST00000600634.1_Intron|ZNF814_ENST00000597832.1_Intron|ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000595295.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	322					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						TTCATAAGGTCTTTTCCCAGT	0.358																																					p.R322K		.											.	.	0			c.G965A						.						15.0	12.0	13.0					19																	58385793		687	1562	2249	SO:0001583	missense	730051	exon3			TAAGGTCTTTTCC		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.965G>A	19.37:g.58385793C>T	ENSP00000410545:p.Arg322Lys	Somatic	101	0		WXS	Illumina GAIIx	Phase_I	109	13	NM_001144989	0	0	9	9	0	A6NF35	Missense_Mutation	SNP	ENST00000435989.2	37	CCDS46212.1	.	.	.	.	.	.	.	.	.	.	.	0.023	-1.395361	0.01175	.	.	ENSG00000204514	ENST00000435989	T	0.12361	2.69	2.27	9.47E-4	0.14044	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03608	0.0103	N	0.02225	-0.63	0.09310	N	0.999999	B	0.29301	0.241	B	0.28916	0.096	T	0.40534	-0.9558	9	0.02654	T	1	.	4.6969	0.12808	0.0:0.4166:0.0:0.5834	.	322	B7Z6K7	ZN814_HUMAN	K	322	ENSP00000410545:R322K	ENSP00000410545:R322K	R	-	2	0	ZNF814	63077605	0.000000	0.05858	0.024000	0.17045	0.009000	0.06853	-1.883000	0.01623	0.331000	0.23511	-1.381000	0.01174	AGA	C|0.500;T|0.500		0.358	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
ZBTB45	84878	hgsc.bcm.edu	37	19	59028585	59028585	+	Silent	SNP	G	G	A	rs11545185	byFrequency	TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr19:59028585G>A	ENST00000594051.1	-	2	936	c.456C>T	c.(454-456)cgC>cgT	p.R152R	ZBTB45_ENST00000354590.3_Silent_p.R152R|ZBTB45_ENST00000600990.1_Silent_p.R152R			Q96K62	ZBT45_HUMAN	zinc finger and BTB domain containing 45	152	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|lung(5)|urinary_tract(1)	11		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0165)|Lung(386;0.18)		GGTGGCGCAGGCGGTGACGCA	0.751											OREG0025700	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	783	0.15635	0.171	0.1571	5008	,	,		12592	0.0556		0.2097	False		,,,				2504	0.1851				p.R152R	NSCLC(164;1383 2017 5233 27540 46677)	.											.	ZBTB45-90	0			c.C456T						.	G		607,3451		44,519,1466	9.0	12.0	11.0		456	0.6	1.0	19	dbSNP_120	11	1218,6788		98,1022,2883	no	coding-synonymous	ZBTB45	NM_032792.2		142,1541,4349	AA,AG,GG		15.2136,14.9581,15.1277		152/512	59028585	1825,10239	2029	4003	6032	SO:0001819	synonymous_variant	84878	exon2			GCGCAGGCGGTGA	AK027392	CCDS12984.1	19q13.43	2013-10-10	2006-09-19	2006-09-19	ENSG00000119574	ENSG00000119574		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	23715	protein-coding gene	gene with protein product			"""zinc finger protein 499"""	ZNF499			Standard	NM_032792		Approved	FLJ14486	uc002qtd.3	Q96K62	OTTHUMG00000183545	ENST00000594051.1:c.456C>T	19.37:g.59028585G>A		Somatic	0	0	1035	WXS	Illumina GAIIx	Phase_I	9	4	NM_032792	0	0	3	7	4		Silent	SNP	ENST00000594051.1	37	CCDS12984.1																																																																																			G|0.844;A|0.156		0.751	ZBTB45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467067.1	NM_032792	
CMPK2	129607	hgsc.bcm.edu	37	2	7005369	7005369	+	Silent	SNP	A	A	G	rs11678810	byFrequency	TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr2:7005369A>G	ENST00000256722.5	-	1	458	c.459T>C	c.(457-459)tgT>tgC	p.C153C	CMPK2_ENST00000404168.1_Silent_p.C153C|CMPK2_ENST00000458098.1_Silent_p.C153C|CMPK2_ENST00000478738.1_Intron	NM_207315.3	NP_997198.2	Q5EBM0	CMPK2_HUMAN	cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial	153					cellular response to lipopolysaccharide (GO:0071222)|dTDP biosynthetic process (GO:0006233)|dUDP biosynthetic process (GO:0006227)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cytidylate kinase activity (GO:0004127)|nucleoside diphosphate kinase activity (GO:0004550)|thymidylate kinase activity (GO:0004798)|UMP kinase activity (GO:0033862)			large_intestine(1)|lung(13)|prostate(1)|upper_aerodigestive_tract(1)	16	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					GTGCCTCCTGACAGGCGCCCA	0.741													G|||	4998	0.998003	0.9924	1.0	5008	,	,		10694	1.0		1.0	False		,,,				2504	1.0				p.C153C		.											.	CMPK2-68	0			c.T459C						.	G		3605,39		1783,39,0	3.0	4.0	4.0		459	1.6	0.0	2	dbSNP_120	4	7874,0		3937,0,0	no	coding-synonymous	CMPK2	NM_207315.2		5720,39,0	GG,GA,AA		0.0,1.0703,0.3386		153/450	7005369	11479,39	1822	3937	5759	SO:0001819	synonymous_variant	129607	exon1			CTCCTGACAGGCG		CCDS42648.1, CCDS58695.1, CCDS58696.1	2p25.2	2008-01-25			ENSG00000134326	ENSG00000134326	2.7.4.14		27015	protein-coding gene	gene with protein product	"""cytidylate kinase 2"""	611787				17999954	Standard	NM_207315		Approved	TYKi, UMP-CMPK2	uc002qyo.4	Q5EBM0	OTTHUMG00000151629	ENST00000256722.5:c.459T>C	2.37:g.7005369A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_001256478	0	0	0	0	0	A2RUB0|A5D8T2|B7ZM18|Q6ZRU2|Q96AL8	Silent	SNP	ENST00000256722.5	37	CCDS42648.1																																																																																			A|0.003;G|0.997		0.741	CMPK2-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323339.2	NM_207315	
DYNC1I2	1781	bcgsc.ca	37	2	172585298	172585298	+	Silent	SNP	T	T	C	rs62184168		TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr2:172585298T>C	ENST00000397119.3	+	14	1496	c.1329T>C	c.(1327-1329)gaT>gaC	p.D443D	DYNC1I2_ENST00000534253.2_Silent_p.D443D|DYNC1I2_ENST00000263811.4_Silent_p.D437D|DYNC1I2_ENST00000409197.1_Silent_p.D417D|DYNC1I2_ENST00000340296.4_Silent_p.D417D|DYNC1I2_ENST00000409773.1_Silent_p.D443D|DYNC1I2_ENST00000409317.1_Silent_p.D437D|DYNC1I2_ENST00000409453.1_Silent_p.D443D|DYNC1I2_ENST00000508530.1_Silent_p.D417D|DYNC1I2_ENST00000410079.3_Silent_p.D435D|DYNC1I2_ENST00000358002.6_Silent_p.D435D	NM_001378.1	NP_001369.1	Q13409	DC1I2_HUMAN	dynein, cytoplasmic 1, intermediate chain 2	443					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|G2/M transition of mitotic cell cycle (GO:0000086)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|transport (GO:0006810)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|microtubule (GO:0005874)|vesicle (GO:0031982)	microtubule motor activity (GO:0003777)			breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(2)|ovary(1)	15			OV - Ovarian serous cystadenocarcinoma(117;0.198)			CTGTTGGAGATGTCAACAACT	0.398																																					p.D443D		.											.	DYNC1I2-91	0			c.T1329C						.						67.0	65.0	65.0					2																	172585298		1866	4092	5958	SO:0001819	synonymous_variant	1781	exon14			TGGAGATGTCAAC	AK055491	CCDS46450.1, CCDS63054.1, CCDS63056.1, CCDS63057.1	2q31.1	2013-01-10	2005-11-24	2005-11-24	ENSG00000077380	ENSG00000077380		"""Cytoplasmic dyneins"", ""WD repeat domain containing"""	2964	protein-coding gene	gene with protein product		603331	"""dynein, cytoplasmic, intermediate polypeptide 2"""	DNCI2		10049579, 16260502	Standard	NM_001378		Approved		uc002uha.2	Q13409	OTTHUMG00000154061	ENST00000397119.3:c.1329T>C	2.37:g.172585298T>C		Somatic	332	2		WXS	Illumina GAIIx	Phase_I	369	12	NM_001378	0	0	164	164	0	B7ZA04|D3DPD4|D3DPD5|D3DPD6|Q32LY9|Q53S84|Q5BJF8|Q7Z4X1|Q96NG7|Q96S87|Q9BXZ5|Q9NT58	Silent	SNP	ENST00000397119.3	37	CCDS46450.1																																																																																			T|0.333;C|0.667		0.398	DYNC1I2-001	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333683.2	NM_001378	
TTN	7273	bcgsc.ca	37	2	179421694	179421694	+	Missense_Mutation	SNP	A	A	G	rs9808377	byFrequency	TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr2:179421694A>G	ENST00000591111.1	-	280	83488	c.83264T>C	c.(83263-83265)aTc>aCc	p.I27755T	TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.I20523T|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.I29396T|TTN_ENST00000342992.6_Missense_Mutation_p.I26828T|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.I20456T|TTN_ENST00000460472.2_Missense_Mutation_p.I20331T			Q8WZ42	TITIN_HUMAN	titin	27755	Fibronectin type-III 102. {ECO:0000255|PROSITE-ProRule:PRU00316}.		I -> T. {ECO:0000269|PubMed:17344846, ECO:0000269|PubMed:7569978}.		adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GCCAGAGATGATGAATTGAGT	0.463													G|||	2540	0.507188	0.5666	0.4049	5008	,	,		20211	0.7153		0.2495	False		,,,				2504	0.5501				p.I29396T		.											.	TTN-636	0			c.T88187C						.	G	THR/ILE,THR/ILE,THR/ILE,THR/ILE	2066,1878		556,954,462	92.0	95.0	94.0		61568,61367,80483,60992	-2.9	0.1	2	dbSNP_119	94	1831,6469		187,1457,2506	yes	missense,missense,missense,missense	TTN	NM_133437.3,NM_133432.3,NM_133378.4,NM_003319.4	89,89,89,89	743,2411,2968	GG,GA,AA		22.0602,47.6166,31.8278	benign,benign,benign,benign	20523/27119,20456/27052,26828/33424,20331/26927	179421694	3897,8347	1972	4150	6122	SO:0001583	missense	7273	exon330			GAGATGATGAATT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.83264T>C	2.37:g.179421694A>G	ENSP00000465570:p.Ile27755Thr	Somatic	108	1		WXS	Illumina GAIIx	Phase_I	119	5	NM_001267550	0	0	0	0	0	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		979	0.4482600732600733	282	0.573170731707317	129	0.356353591160221	385	0.6730769230769231	183	0.24142480211081793	G	3.223	-0.159019	0.06544	0.523834	0.220602	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.50813	0.73;0.73;0.73;0.73	5.87	-2.9	0.05648	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.00012	0.0000	N	0.00044	-2.455	0.51482	P	7.299999999998974E-5	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.50617	-0.8807	8	0.87932	D	0	.	12.5594	0.56273	0.6079:0.0:0.3921:0.0	rs9808377;rs56743405;rs9808377	20331;20456;20523;27755	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	T	26828;20331;20523;20456;20328	ENSP00000343764:I26828T;ENSP00000434586:I20331T;ENSP00000340554:I20523T;ENSP00000352154:I20456T	ENSP00000340554:I20523T	I	-	2	0	TTN	179129940	0.202000	0.23423	0.094000	0.20943	0.170000	0.22686	0.686000	0.25392	-1.202000	0.02655	-0.726000	0.03593	ATC	A|0.549;G|0.451		0.463	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
PRR21	643905	bcgsc.ca	37	2	240982243	240982243	+	Missense_Mutation	SNP	G	G	A	rs80033040	byFrequency	TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr2:240982243G>A	ENST00000408934.1	-	1	156	c.157C>T	c.(157-159)Cgg>Tgg	p.R53W		NM_001080835.1	NP_001074304.1	Q8WXC7	PRR21_HUMAN	proline rich 21	53	Pro-rich.							p.R53W(2)		NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(5)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)	29						GTGAAGAGCCGTGGATGAAGG	0.582																																					p.R53W		.											.	PRR21-70	2	Substitution - Missense(2)	haematopoietic_and_lymphoid_tissue(2)	c.C157T						.						121.0	107.0	112.0					2																	240982243		2203	4300	6503	SO:0001583	missense	643905	exon1			AGAGCCGTGGATG	AF453950	CCDS33417.1	2q37.3	2009-04-20			ENSG00000221961	ENSG00000221961			33866	protein-coding gene	gene with protein product							Standard	NM_001080835		Approved		uc010zod.2	Q8WXC7	OTTHUMG00000159174	ENST00000408934.1:c.157C>T	2.37:g.240982243G>A	ENSP00000386166:p.Arg53Trp	Somatic	182	3		WXS	Illumina GAIIx	Phase_I	115	9	NM_001080835	0	0	0	0	0		Missense_Mutation	SNP	ENST00000408934.1	37	CCDS33417.1	.	.	.	.	.	.	.	.	.	.	N	7.137	0.581093	0.13686	.	.	ENSG00000221961	ENST00000408934;ENST00000486799	T;T	0.13657	2.57;2.57	1.19	-1.7	0.08159	.	.	.	.	.	T	0.05640	0.0148	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.35101	-0.9802	9	0.56958	D	0.05	.	2.7336	0.05234	0.2267:0.299:0.4742:0.0	.	53	Q8WXC7	PRR21_HUMAN	W	53	ENSP00000386166:R53W;ENSP00000418240:R53W	ENSP00000386166:R53W	R	-	1	2	PRR21	240630916	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.394000	0.07296	-0.428000	0.07339	-0.481000	0.04817	CGG	G|0.966;A|0.034		0.582	PRR21-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001080835	
TCF15	6939	hgsc.bcm.edu	37	20	590456	590456	+	Silent	SNP	A	A	G	rs282164	byFrequency	TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr20:590456A>G	ENST00000246080.3	-	1	586	c.426T>C	c.(424-426)cgT>cgC	p.R142R		NM_004609.3	NP_004600.2	Q12870	TCF15_HUMAN	transcription factor 15 (basic helix-loop-helix)	142					death (GO:0016265)|ear development (GO:0043583)|eating behavior (GO:0042755)|establishment of epithelial cell apical/basal polarity (GO:0045198)|mesenchymal to epithelial transition (GO:0060231)|mesoderm development (GO:0007498)|muscle organ morphogenesis (GO:0048644)|neuromuscular process controlling posture (GO:0050884)|paraxial mesoderm development (GO:0048339)|post-anal tail morphogenesis (GO:0036342)|regulation of gene expression involved in extracellular matrix organization (GO:1901311)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|respiratory system process (GO:0003016)|skeletal system morphogenesis (GO:0048705)|skin development (GO:0043588)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|lung(2)|prostate(1)	4		Breast(17;0.231)				TGCCCGCGGCACGGAAGCACG	0.736													g|||	4317	0.862021	0.7413	0.9035	5008	,	,		6474	0.998		0.8072	False		,,,				2504	0.9121				p.R142R		.											.	TCF15-90	0			c.T426C						.			3211,1033		1232,747,143	7.0	8.0	8.0		426	-9.0	0.0	20	dbSNP_79	8	6663,1669		2708,1247,211	no	coding-synonymous	TCF15	NM_004609.3		3940,1994,354	GG,GA,AA		20.0312,24.3402,21.4854		142/200	590456	9874,2702	2122	4166	6288	SO:0001819	synonymous_variant	6939	exon1			CGCGGCACGGAAG		CCDS33432.1	20p13	2013-05-21			ENSG00000125878	ENSG00000125878		"""Basic helix-loop-helix proteins"""	11627	protein-coding gene	gene with protein product		601010				8825648, 8041747	Standard	NM_004609		Approved	EC2, PARAXIS, bHLHa40	uc002wdz.3	Q12870	OTTHUMG00000031640	ENST00000246080.3:c.426T>C	20.37:g.590456A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	11	11	NM_004609	0	0	0	0	0	Q9NQQ1	Silent	SNP	ENST00000246080.3	37	CCDS33432.1																																																																																			A|0.165;G|0.835		0.736	TCF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077475.2	NM_004609	
CST1	1469	broad.mit.edu	37	20	23728528	23728528	+	Silent	SNP	C	C	T			TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr20:23728528C>T	ENST00000304749.2	-	3	421	c.351G>A	c.(349-351)ttG>ttA	p.L117L	CST1_ENST00000398402.1_Silent_p.L117L	NM_001898.2	NP_001889.2	P01037	CYTN_HUMAN	cystatin SN	117					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|negative regulation of endopeptidase activity (GO:0010951)	extracellular space (GO:0005615)	cysteine-type endopeptidase inhibitor activity (GO:0004869)	p.L117L(1)		kidney(1)|large_intestine(1)|lung(8)|ovary(1)|stomach(1)|urinary_tract(1)	13	Lung NSC(19;0.0676)|all_lung(19;0.148)					CGAAAGAGCACAACTGTTTCT	0.527																																					p.L117L		.											.	CST1-91	1	Substitution - coding silent(1)	lung(1)	c.G351A						.						93.0	81.0	85.0					20																	23728528		2203	4300	6503	SO:0001819	synonymous_variant	1469	exon3			AGAGCACAACTGT	M19169	CCDS13160.1	20p11.2	2008-04-15			ENSG00000170373	ENSG00000170373			2473	protein-coding gene	gene with protein product		123855					Standard	NM_001898		Approved		uc002wtp.3	P01037	OTTHUMG00000032085	ENST00000304749.2:c.351G>A	20.37:g.23728528C>T		Somatic	118	0		WXS	Illumina GAIIx	Phase_I	176	11	NM_001898	0	0	0	0	0	Q96LE6|Q9UCQ6	Silent	SNP	ENST00000304749.2	37	CCDS13160.1																																																																																			.		0.527	CST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078351.2	NM_001898	
SCARF2	91179	hgsc.bcm.edu	37	22	20780097	20780097	+	Silent	SNP	G	G	C	rs759609		TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr22:20780097G>C	ENST00000266214.5	-	11	2285	c.2181C>G	c.(2179-2181)cgC>cgG	p.R727R	SCARF2_ENST00000405555.3_Silent_p.R722R	NM_153334.4	NP_699165.2	Q96GP6	SREC2_HUMAN	scavenger receptor class F, member 2	727	Pro-rich.				cell adhesion (GO:0007155)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|skin(2)	10	Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			GCCCCGGGGGGCGCGGCGTTG	0.781																																					p.R727R		.											.	SCARF2-341	0			c.C2181G						.	C	,	3271,119		1585,101,9	5.0	5.0	5.0		2181,2166	-5.3	0.0	22	dbSNP_86	5	6306,190		3060,186,2	no	coding-synonymous,coding-synonymous	SCARF2	NM_153334.4,NM_182895.2	,	4645,287,11	CC,CG,GG		2.9249,3.5103,3.1256	,	727/871,722/866	20780097	9577,309	1695	3248	4943	SO:0001819	synonymous_variant	91179	exon11			CGGGGGGCGCGGC	AF522196	CCDS13779.1, CCDS46666.1	22q11.21	2011-10-10			ENSG00000244486	ENSG00000244486			19869	protein-coding gene	gene with protein product		613619				12154095	Standard	XM_006724364		Approved	SREC-II, SREC2, HUMZD58C02	uc002zsk.2	Q96GP6	OTTHUMG00000150779	ENST00000266214.5:c.2181C>G	22.37:g.20780097G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_153334	0	0	0	0	0	E5RFB8|Q58A83|Q8IXF3|Q9BW74	Silent	SNP	ENST00000266214.5	37	CCDS13779.1																																																																																			G|0.826;C|0.174		0.781	SCARF2-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320047.1		
PI4KAP2	375133	bcgsc.ca	37	22	21832428	21832428	+	RNA	SNP	A	A	G	rs371352178	byFrequency	TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr22:21832428A>G	ENST00000450651.1	-	0	1359							A4QPH2	PI4P2_HUMAN	phosphatidylinositol 4-kinase, catalytic, alpha pseudogene 2						phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)		kinase activity (GO:0016301)|phosphotransferase activity, alcohol group as acceptor (GO:0016773)			endometrium(3)|urinary_tract(1)	4						GTCAGTTGGCATCCTTGCACC	0.602													.|||	2662	0.53155	0.7648	0.4697	5008	,	,		8904	0.245		0.8101	False		,,,				2504	0.2689				.		.											.	PI4KAP2-68	0			.						.						29.0	26.0	27.0					22																	21832428		245	689	934			375133	.			GTTGGCATCCTTG			22q11.21	2014-03-20	2007-08-14		ENSG00000183506	ENSG00000183506			33577	pseudogene	pseudogene							Standard	NR_003700		Approved		uc011aie.1	A4QPH2	OTTHUMG00000150827		22.37:g.21832428A>G		Somatic	165	27		WXS	Illumina GAIIx	Phase_I	63	29	.	0	0	0	0	0	Q6ICJ0|Q6ZT68|Q8WUK7	RNA	SNP	ENST00000450651.1	37																																																																																				G|1.000;|0.000		0.602	PI4KAP2-005	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000334908.1		
SEMA5B	54437	hgsc.bcm.edu	37	3	122631896	122631896	+	Missense_Mutation	SNP	A	A	T	rs2276782	byFrequency	TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr3:122631896A>T	ENST00000357599.3	-	18	2905	c.2519T>A	c.(2518-2520)gTc>gAc	p.V840D	SEMA5B_ENST00000195173.4_Missense_Mutation_p.V839D|SEMA5B_ENST00000451055.2_Missense_Mutation_p.V894D	NM_001031702.3|NM_001256348.1	NP_001026872.2|NP_001243277.1	Q9P283	SEM5B_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B	840			V -> D (in dbSNP:rs2276782). {ECO:0000269|PubMed:10819331, ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(13)|lung(26)|ovary(2)|pancreas(3)|skin(2)|upper_aerodigestive_tract(3)	55				GBM - Glioblastoma multiforme(114;0.0367)		GCGCAGGAGGACCTCCACCAG	0.791													T|||	3010	0.601038	0.5348	0.621	5008	,	,		11243	0.3522		0.8082	False		,,,				2504	0.7198				p.V894D		.											.	SEMA5B-157	0			c.T2681A						.	T	ASP/VAL	2573,1477		827,919,279	4.0	5.0	5.0		2519	5.0	1.0	3	dbSNP_100	5	6625,1195		2828,969,113	no	missense	SEMA5B	NM_001031702.2	152	3655,1888,392	TT,TA,AA		15.2813,36.4691,22.5105	benign	840/1152	122631896	9198,2672	2025	3910	5935	SO:0001583	missense	54437	exon18			AGGAGGACCTCCA	AB040878	CCDS35491.1, CCDS58848.1, CCDS74995.1	3q21.1	2008-07-18			ENSG00000082684	ENSG00000082684		"""Semaphorins"""	10737	protein-coding gene	gene with protein product		609298		SEMAG		8817451	Standard	NM_001256346		Approved	SemG, KIAA1445, FLJ10372	uc031sbm.1	Q9P283	OTTHUMG00000140392	ENST00000357599.3:c.2519T>A	3.37:g.122631896A>T	ENSP00000350215:p.Val840Asp	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	5	NM_001256347	0	0	0	0	0	A8K5U2|B7Z393|F8W9U8|Q6DD89|Q6UY12|Q9NW17	Missense_Mutation	SNP	ENST00000357599.3	37	CCDS35491.1	1286	0.5888278388278388	247	0.5020325203252033	243	0.6712707182320442	193	0.3374125874125874	603	0.7955145118733509	T	5.344	0.248763	0.10130	0.635309	0.847187	ENSG00000082684	ENST00000357599;ENST00000195173;ENST00000418793;ENST00000451055;ENST00000393583	T;T;T;T	0.34072	1.43;1.38;1.48;1.5	5.01	5.01	0.66863	.	0.161766	0.52532	N	0.000069	T	0.00012	0.0000	N	0.00246	-1.78	0.30182	P	0.8002819999999999	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.39354	-0.9618	9	0.02654	T	1	.	10.6514	0.45651	0.1435:0.0:0.0:0.8565	rs2276782	782;840	D3YTI7;Q9P283	.;SEM5B_HUMAN	D	840;839;782;894;840	ENSP00000350215:V840D;ENSP00000195173:V839D;ENSP00000389588:V894D;ENSP00000377208:V840D	ENSP00000195173:V839D	V	-	2	0	SEMA5B	124114586	1.000000	0.71417	0.990000	0.47175	0.785000	0.44390	4.886000	0.63149	0.945000	0.37605	-0.257000	0.10917	GTC	T|0.412;A|0.588		0.791	SEMA5B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000277165.1	NM_001031702	
ADCY5	111	hgsc.bcm.edu	37	3	123167249	123167249	+	Silent	SNP	G	G	A	rs4678027	byFrequency	TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr3:123167249G>A	ENST00000462833.1	-	1	1356	c.144C>T	c.(142-144)ggC>ggT	p.G48G		NM_183357.2	NP_899200.1	O95622	ADCY5_HUMAN	adenylate cyclase 5	48					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenosine receptor signaling pathway (GO:0001973)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			breast(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(22)|ovary(5)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(114;0.0342)		CGCGGGCAGAGCCCCCGGGGG	0.756													A|||	4941	0.986621	0.9501	0.9986	5008	,	,		7224	1.0		1.0	False		,,,				2504	1.0				p.G48G		.											.	ADCY5-94	0			c.C144T						.	A		2646,76		1285,76,0	2.0	2.0	2.0		144	-2.7	0.8	3	dbSNP_111	2	5980,0		2990,0,0	no	coding-synonymous	ADCY5	NM_183357.2		4275,76,0	AA,AG,GG		0.0,2.7921,0.8734		48/1262	123167249	8626,76	1361	2990	4351	SO:0001819	synonymous_variant	111	exon1			GGCAGAGCCCCCG	U65473	CCDS3022.1, CCDS56274.1	3q21.1	2013-02-04			ENSG00000173175	ENSG00000173175	4.6.1.1	"""Adenylate cyclases"""	236	protein-coding gene	gene with protein product		600293				10481931	Standard	NM_183357		Approved	AC5	uc003egh.2	O95622	OTTHUMG00000159517	ENST00000462833.1:c.144C>T	3.37:g.123167249G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_183357	0	0	0	0	0	B7Z8A6|Q7RTV7|Q8NFM3	Silent	SNP	ENST00000462833.1	37	CCDS3022.1																																																																																			G|0.028;A|0.972		0.756	ADCY5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355889.4	XM_171048	
MUC4	4585	hgsc.bcm.edu	37	3	195508147	195508194	+	In_Frame_Del	DEL	GTGGATGCTGAGGAAGTGCTGGTGACAGGAAGAGGGGTGGCGTGACCT	GTGGATGCTGAGGAAGTGCTGGTGACAGGAAGAGGGGTGGCGTGACCT	-	rs570953070|rs200854768|rs201771865|rs372617756|rs569036865|rs200073211|rs199718961|rs531870026|rs527644110|rs542475778|rs201253018|rs550776832	byFrequency	TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	GTGGATGCTGAGGAAGTGCTGGTGACAGGAAGAGGGGTGGCGTGACCT	GTGGATGCTGAGGAAGTGCTGGTGACAGGAAGAGGGGTGGCGTGACCT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr3:195508147_195508194delGTGGATGCTGAGGAAGTGCTGGTGACAGGAAGAGGGGTGGCGTGACCT	ENST00000463781.3	-	2	10716_10763	c.10257_10304delAGGTCACGCCACCCCTCTTCCTGTCACCAGCACTTCCTCAGCATCCAC	c.(10255-10305)acaggtcacgccacccctcttcctgtcaccagcacttcctcagcatccacc>acc	p.3419_3435TGHATPLPVTSTSSAST>T	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_In_Frame_Del_p.3419_3435TGHATPLPVTSTSSAST>T	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.P3426S(1)|p.S3431S(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGCGTGACCGGTGGATGCTGAGGAAGTGCTGGTGACAGGAAGAGGGGTGGCGTGACCTGTGGATGCTG	0.585																																					p.3419_3435del		.											.	MUC4-90	2	Substitution - Missense(1)|Substitution - coding silent(1)	endometrium(2)	c.10257_10304del						.																																			SO:0001651	inframe_deletion	4585	exon2			TGACCGGTGGATG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.10257_10304delAGGTCACGCCACCCCTCTTCCTGTCACCAGCACTTCCTCAGCATCCAC	3.37:g.195508147_195508194delGTGGATGCTGAGGAAGTGCTGGTGACAGGAAGAGGGGTGGCGTGACCT	ENSP00000417498:p.Thr3419_Ser3434del	Somatic	459	0		WXS	Illumina GAIIx	Phase_I	725	0	NM_018406	0	0	0	0	0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	In_Frame_Del	DEL	ENST00000463781.3	37	CCDS54700.1																																																																																			.		0.585	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
TACC3	10460	ucsc.edu	37	4	1729795	1729795	+	Silent	SNP	A	A	G	rs200539908	byFrequency	TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr4:1729795A>G	ENST00000313288.4	+	4	772	c.666A>G	c.(664-666)gaA>gaG	p.E222E		NM_006342.2	NP_006333.1	Q9Y6A5	TACC3_HUMAN	transforming, acidic coiled-coil containing protein 3	222					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|cytoplasmic sequestering of transcription factor (GO:0042994)|hemopoiesis (GO:0030097)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of cell cycle (GO:0051726)|regulation of microtubule-based process (GO:0032886)|response to hypoxia (GO:0001666)	centrosome (GO:0005813)|cytoplasm (GO:0005737)				central_nervous_system(1)|endometrium(4)|large_intestine(1)|lung(10)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	25		Breast(71;0.212)|all_epithelial(65;0.241)	OV - Ovarian serous cystadenocarcinoma(23;0.00765)|Epithelial(3;0.0126)			GAGCCGAGGAAGAATGCAAAG	0.617													-|||	192	0.0383387	0.056	0.0173	5008	,	,		16940	0.0129		0.0199	False		,,,				2504	0.0746				p.E222E	Ovarian(120;482 2294 11894 35824)	.											.	TACC3-91	0			c.A666G						.	A		135,4267		4,127,2070	20.0	22.0	21.0		666	0.8	0.0	4		21	86,8506		2,82,4212	no	coding-synonymous	TACC3	NM_006342.1		6,209,6282	GG,GA,AA		1.0009,3.0668,1.7008		222/839	1729795	221,12773	2201	4296	6497	SO:0001819	synonymous_variant	10460	exon4			CGAGGAAGAATGC	AF093543	CCDS3352.1	4p16.3	2008-07-29			ENSG00000013810	ENSG00000013810			11524	protein-coding gene	gene with protein product		605303				17675670	Standard	NM_006342		Approved	ERIC1	uc003gdo.3	Q9Y6A5	OTTHUMG00000089535	ENST00000313288.4:c.666A>G	4.37:g.1729795A>G		Somatic	44	0		WXS	Illumina GAIIx	Phase_I	90	25	NM_006342	0	0	4	4	0	Q2NKK4|Q3KQS5|Q9UMQ1	Silent	SNP	ENST00000313288.4	37	CCDS3352.1																																																																																			A|0.992;G|0.008		0.617	TACC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000203730.2		
CCDC96	257236	hgsc.bcm.edu	37	4	7044357	7044357	+	Silent	SNP	A	A	G	rs871133	byFrequency	TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr4:7044357A>G	ENST00000310085.4	-	1	371	c.309T>C	c.(307-309)gtT>gtC	p.V103V	TADA2B_ENST00000512388.1_5'Flank|RP11-367J11.2_ENST00000500031.1_RNA|TADA2B_ENST00000310074.7_5'Flank	NM_153376.2	NP_699207.1	Q2M329	CCD96_HUMAN	coiled-coil domain containing 96	103	Glu-rich.									endometrium(3)|kidney(1)|large_intestine(3)|lung(2)|skin(1)|urinary_tract(1)	11						CCTCAGCCCCAACCTCGGCCG	0.766													G|||	4833	0.965056	0.8979	0.9856	5008	,	,		11811	1.0		0.9702	False		,,,				2504	1.0				p.V103V		.											.	CCDC96-90	0			c.T309C						.	G		2893,205		1348,197,4	3.0	3.0	3.0		309	-4.5	0.0	4	dbSNP_86	3	6689,125		3282,125,0	no	coding-synonymous	CCDC96	NM_153376.2		4630,322,4	GG,GA,AA		1.8345,6.6172,3.3293		103/556	7044357	9582,330	1549	3407	4956	SO:0001819	synonymous_variant	257236	exon1			AGCCCCAACCTCG	AK075056	CCDS3395.1	4p16.1	2008-02-05			ENSG00000173013	ENSG00000173013			26900	protein-coding gene	gene with protein product							Standard	NM_153376		Approved	FLJ90575	uc003gjv.2	Q2M329	OTTHUMG00000125511	ENST00000310085.4:c.309T>C	4.37:g.7044357A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	14	14	NM_153376	0	0	0	4	4	Q8N2I7	Silent	SNP	ENST00000310085.4	37	CCDS3395.1																																																																																			A|0.036;G|0.964		0.766	CCDC96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246838.1	NM_153376	
CCDC96	257236	hgsc.bcm.edu	37	4	7044380	7044380	+	Missense_Mutation	SNP	C	C	T	rs871134	byFrequency	TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr4:7044380C>T	ENST00000310085.4	-	1	348	c.286G>A	c.(286-288)Gag>Aag	p.E96K	TADA2B_ENST00000512388.1_5'Flank|RP11-367J11.2_ENST00000500031.1_RNA|TADA2B_ENST00000310074.7_5'Flank	NM_153376.2	NP_699207.1	Q2M329	CCD96_HUMAN	coiled-coil domain containing 96	96	Glu-rich.		E -> K (in dbSNP:rs871134). {ECO:0000269|PubMed:15489334}.							endometrium(3)|kidney(1)|large_intestine(3)|lung(2)|skin(1)|urinary_tract(1)	11						TCTTCGGGCTCGGGCTGGGGC	0.776													C|||	2561	0.511382	0.3623	0.4741	5008	,	,		11435	0.6429		0.5845	False		,,,				2504	0.5286				p.E96K		.											.	CCDC96-90	0			c.G286A						.	C	LYS/GLU	1411,1153		409,593,280	2.0	2.0	2.0		286	2.2	0.0	4	dbSNP_86	2	3789,2017		1333,1123,447	no	missense	CCDC96	NM_153376.2	56	1742,1716,727	TT,TC,CC		34.7399,44.9688,37.8734	benign	96/556	7044380	5200,3170	1282	2903	4185	SO:0001583	missense	257236	exon1			CGGGCTCGGGCTG	AK075056	CCDS3395.1	4p16.1	2008-02-05			ENSG00000173013	ENSG00000173013			26900	protein-coding gene	gene with protein product							Standard	NM_153376		Approved	FLJ90575	uc003gjv.2	Q2M329	OTTHUMG00000125511	ENST00000310085.4:c.286G>A	4.37:g.7044380C>T	ENSP00000309285:p.Glu96Lys	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_153376	0	0	0	2	2	Q8N2I7	Missense_Mutation	SNP	ENST00000310085.4	37	CCDS3395.1	1153	0.5279304029304029	172	0.34959349593495936	193	0.5331491712707183	349	0.6101398601398601	439	0.579155672823219	C	10.33	1.319932	0.23994	0.550312	0.652601	ENSG00000173013	ENST00000310085	T	0.54479	0.57	3.13	2.24	0.28232	.	0.882045	0.09267	N	0.825735	T	0.00012	0.0000	L	0.32530	0.975	0.45284	P	0.0017160000000000508	B	0.21147	0.052	B	0.09377	0.004	T	0.45585	-0.9251	9	0.14252	T	0.57	-0.0803	4.8536	0.13549	0.0:0.6921:0.0:0.3079	rs871134	96	Q2M329	CCD96_HUMAN	K	96	ENSP00000309285:E96K	ENSP00000309285:E96K	E	-	1	0	CCDC96	7095281	0.001000	0.12720	0.000000	0.03702	0.036000	0.12997	0.781000	0.26774	0.602000	0.29896	0.471000	0.43371	GAG	C|0.472;T|0.528		0.776	CCDC96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246838.1	NM_153376	
PDCD6	10016	hgsc.bcm.edu	37	5	271858	271869	+	In_Frame_Del	DEL	CCGGCCCTGGGG	CCGGCCCTGGGG	-	rs529816592|rs147793210|rs201564379	byFrequency	TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	CCGGCCCTGGGG	CCGGCCCTGGGG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr5:271858_271869delCCGGCCCTGGGG	ENST00000264933.4	+	1	123_134	c.23_34delCCGGCCCTGGGG	c.(22-36)cccggccctggggcc>ccc	p.GPGA9del	PDCD6_ENST00000505221.1_In_Frame_Del_p.GPGA9del|PDCD6_ENST00000509581.1_In_Frame_Del_p.GPGA9del|CTD-2083E4.6_ENST00000512642.1_RNA|PDCD6_ENST00000507528.1_In_Frame_Del_p.GPGA9del	NM_001267556.1|NM_001267558.1|NM_013232.3	NP_001254485.1|NP_001254487.1|NP_037364.1	O75340	PDCD6_HUMAN	programmed cell death 6	9					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|cellular response to heat (GO:0034605)|intracellular protein transport (GO:0006886)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|proteolysis (GO:0006508)|response to calcium ion (GO:0051592)|vascular endothelial growth factor receptor-2 signaling pathway (GO:0036324)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	binding, bridging (GO:0060090)|calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|calcium-dependent protein binding (GO:0048306)|protein dimerization activity (GO:0046983)	p.A12_G15delAGPG(2)		breast(2)|endometrium(1)|large_intestine(4)|lung(1)	8			Epithelial(17;0.00193)|OV - Ovarian serous cystadenocarcinoma(19;0.00489)|all cancers(22;0.00511)|Lung(60;0.113)			TCTTACCGCCCCGGCCCTGGGGCCGGCCCTGG	0.741														513	0.102436	0.1316	0.1657	5008	,	,		10520	0.0546		0.0905	False		,,,				2504	0.0798				p.8_12del		.											.	PDCD6-290	2	Deletion - In frame(2)	breast(2)	c.23_34del						.			265,2557		60,145,1206						2.2	1.0		dbSNP_126	6	779,5791		158,463,2664	no	coding	PDCD6	NM_013232.3		218,608,3870	A1A1,A1R,RR		11.8569,9.3905,11.1158				1044,8348				SO:0001651	inframe_deletion	10016	exon1			ACCGCCCCGGCCC	AF035606	CCDS3854.1, CCDS58940.1, CCDS58941.1, CCDS75222.1, CCDS75223.1	5p15.33	2013-01-10			ENSG00000249915	ENSG00000249915		"""EF-hand domain containing"""	8765	protein-coding gene	gene with protein product	"""apoptosis-linked gene-2"""	601057				8560270	Standard	NM_013232		Approved	ALG-2, PEF1B	uc003jat.1	O75340	OTTHUMG00000090283	ENST00000264933.4:c.23_34delCCGGCCCTGGGG	5.37:g.271858_271869delCCGGCCCTGGGG	ENSP00000264933:p.Gly9_Ala12del	Somatic	3	0		WXS	Illumina GAIIx	Phase_I	25	10	NM_013232	0	0	0	0	0	B2RD16|E7ESR3|Q2YDC2|Q5TZS0	In_Frame_Del	DEL	ENST00000264933.4	37	CCDS3854.1																																																																																			.		0.741	PDCD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206609.2	NM_013232	
NSUN2	54888	hgsc.bcm.edu	37	5	6633042	6633042	+	Silent	SNP	C	C	T	rs10062086	byFrequency	TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr5:6633042C>T	ENST00000264670.6	-	1	362	c.51G>A	c.(49-51)gaG>gaA	p.E17E	SRD5A1_ENST00000274192.5_5'Flank|SRD5A1_ENST00000538824.1_5'Flank|NSUN2_ENST00000539938.1_5'UTR|NSUN2_ENST00000506139.1_Silent_p.E17E|SRD5A1_ENST00000537411.1_5'Flank	NM_017755.5	NP_060225.4	Q08J23	NSUN2_HUMAN	NOP2/Sun RNA methyltransferase family, member 2	17					mitotic nuclear division (GO:0007067)|tRNA methylation (GO:0030488)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|tRNA (cytosine-5-)-methyltransferase activity (GO:0016428)|tRNA binding (GO:0000049)			breast(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(23)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	41						CCTCCGCGTCCTCCGGCCGCT	0.781													C|||	1385	0.276558	0.2829	0.3905	5008	,	,		9693	0.1587		0.3917	False		,,,				2504	0.1902				p.E17E		.											.	NSUN2-91	0			c.G51A						.						2.0	3.0	2.0					5																	6633042		1293	2804	4097	SO:0001819	synonymous_variant	54888	exon1			CGCGTCCTCCGGC	AK000310	CCDS3869.1, CCDS54832.1	5p15.32	2014-01-31	2012-06-12		ENSG00000037474	ENSG00000037474		"""NOP2/Sun domain containing"""	25994	protein-coding gene	gene with protein product	"""tRNA methyltransferase 4 homolog (S. cerevisiae)"", ""Myc-induced SUN-domain-containing protein"""	610916	"""NOL1/NOP2/Sun domain family, member 2"", ""NOP2/Sun domain family, member 2"", ""mental retardation, non-syndromic, autosomal recessive, 5"""	MRT5		17071714, 22541559	Standard	NM_017755		Approved	FLJ20303, TRM4, Misu	uc003jdu.3	Q08J23	OTTHUMG00000090455	ENST00000264670.6:c.51G>A	5.37:g.6633042C>T		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_017755	0	0	4	9	5	A8K529|B2RNR4|B3KP09|B4DQW2|G3V1R4|Q9BVN4|Q9H858|Q9NXD9	Silent	SNP	ENST00000264670.6	37	CCDS3869.1																																																																																			C|0.687;T|0.313		0.781	NSUN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206902.1	NM_017755	
C9	735	broad.mit.edu;bcgsc.ca	37	5	39341264	39341264	+	Nonsense_Mutation	SNP	G	G	A	rs144138616		TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr5:39341264G>A	ENST00000263408.4	-	4	555	c.460C>T	c.(460-462)Cga>Tga	p.R154*	C9_ENST00000509186.1_5'UTR	NM_001737.3	NP_001728.1	P02748	CO9_HUMAN	complement component 9	154	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|hemolysis by symbiont of host erythrocytes (GO:0019836)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane attack complex (GO:0005579)|plasma membrane (GO:0005886)		p.R154*(1)		central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(17)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	32	all_lung(31;0.000197)	all_neural(839;7.57e-10)|Lung NSC(810;2.62e-08)|Ovarian(839;0.00384)|Breast(839;0.0184)|Myeloproliferative disorder(839;0.0511)	Epithelial(62;0.158)			CCTGCTGTTCGTGCCAGCTCA	0.458																																					p.R154X		.											.	C9-90	1	Substitution - Nonsense(1)	endometrium(1)	c.C460T	GRCh37	CM970207	C9	M	rs144138616	.	G	stop/ARG	0,4406		0,0,2203	110.0	110.0	110.0		460	3.6	0.5	5	dbSNP_134	110	2,8598	2.2+/-6.3	0,2,4298	yes	stop-gained	C9	NM_001737.3		0,2,6501	AA,AG,GG		0.0233,0.0,0.0154		154/560	39341264	2,13004	2203	4300	6503	SO:0001587	stop_gained	735	exon4			CTGTTCGTGCCAG		CCDS3929.1	5p14-p12	2014-09-17			ENSG00000113600	ENSG00000113600		"""Complement system"""	1358	protein-coding gene	gene with protein product		120940					Standard	NM_001737		Approved		uc003jlv.4	P02748	OTTHUMG00000094767	ENST00000263408.4:c.460C>T	5.37:g.39341264G>A	ENSP00000263408:p.Arg154*	Somatic	143	0		WXS	Illumina GAIIx	Phase_I	218	7	NM_001737	0	0	0	0	0		Nonsense_Mutation	SNP	ENST00000263408.4	37	CCDS3929.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	28.8	4.954200	0.92726	0.0	2.33E-4	ENSG00000113600	ENST00000263408	.	.	.	5.52	3.58	0.41010	.	0.119263	0.52532	D	0.000066	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.5335	11.6329	0.51187	0.0:0.0:0.4847:0.5153	.	.	.	.	X	154	.	ENSP00000263408:R154X	R	-	1	2	C9	39377021	0.978000	0.34361	0.483000	0.27378	0.987000	0.75469	2.118000	0.41949	1.285000	0.44548	0.563000	0.77884	CGA	G|1.000;A|0.000		0.458	C9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211576.3		
SOWAHA	134548	hgsc.bcm.edu	37	5	132149684	132149684	+	Missense_Mutation	SNP	G	G	C	rs40274	byFrequency	TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr5:132149684G>C	ENST00000378693.2	+	1	652	c.371G>C	c.(370-372)cGg>cCg	p.R124P		NM_175873.4	NP_787069.3	Q2M3V2	SWAHA_HUMAN	sosondowah ankyrin repeat domain family member A	124	Pro-rich.		R -> P (in dbSNP:rs40274).														CCCTTGGTCCGGGTGCCGCGG	0.776																																					p.R124P		.											.	.	0			c.G371C						.	C	PRO/ARG	2599,13		1293,13,0	2.0	3.0	3.0		371	-0.3	0.0	5	dbSNP_76	3	6177,193		2993,191,1	no	missense	ANKRD43	NM_175873.4	103	4286,204,1	CC,CG,GG		3.0298,0.4977,2.2935	benign	124/550	132149684	8776,206	1306	3185	4491	SO:0001583	missense	134548	exon1			TGGTCCGGGTGCC	AK090823	CCDS43361.1	5q23.3	2013-01-10	2012-01-12	2012-01-12	ENSG00000198944	ENSG00000198944		"""Ankyrin repeat domain containing"""	27033	protein-coding gene	gene with protein product			"""ankyrin repeat domain 43"""	ANKRD43		22234889	Standard	NM_175873		Approved		uc003kxw.3	Q2M3V2	OTTHUMG00000059844	ENST00000378693.2:c.371G>C	5.37:g.132149684G>C	ENSP00000367965:p.Arg124Pro	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_175873	0	0	0	0	0	Q8NAE7	Missense_Mutation	SNP	ENST00000378693.2	37	CCDS43361.1	2142	0.9807692307692307	482	0.9796747967479674	357	0.9861878453038674	562	0.9825174825174825	741	0.9775725593667546	c	9.833	1.188835	0.21954	0.995023	0.969702	ENSG00000198944	ENST00000378693	T	0.38077	1.16	4.27	-0.265	0.12946	.	2.345400	0.02245	N	0.066177	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.36261	-0.9755	9	0.30078	T	0.28	-5.2019	3.6102	0.08057	0.2245:0.4439:0.2467:0.085	rs40274	124	Q2M3V2	ANR43_HUMAN	P	124	ENSP00000367965:R124P	ENSP00000367965:R124P	R	+	2	0	ANKRD43	132177583	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.768000	0.01794	-0.003000	0.14444	-3.153000	0.00058	CGG	G|0.980;C|0.020		0.776	SOWAHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133062.1	NM_175873	
PROB1	389333	hgsc.bcm.edu	37	5	138730037	138730037	+	Missense_Mutation	SNP	T	T	C	rs11748963	byFrequency	TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr5:138730037T>C	ENST00000434752.2	-	1	848	c.734A>G	c.(733-735)cAg>cGg	p.Q245R		NM_001161546.1	NP_001155018.1	E7EW31	PROB1_HUMAN	proline-rich basic protein 1	245																	CGCGGCGGCCTGCAGGGGGCC	0.781													T|||	1773	0.354034	0.146	0.2839	5008	,	,		10752	0.6151		0.3042	False		,,,				2504	0.4673				p.Q245R		.											.	.	0			c.A734G						.						5.0	7.0	6.0					5																	138730037		671	1537	2208	SO:0001583	missense	389333	exon1			GCGGCCTGCAGGG	AK316483	CCDS54909.1	5q31.2	2012-10-01	2012-10-01	2012-10-01	ENSG00000228672	ENSG00000228672			41906	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 65"""	C5orf65			Standard	NM_001161546		Approved		uc011czc.1	E7EW31		ENST00000434752.2:c.734A>G	5.37:g.138730037T>C	ENSP00000416033:p.Gln245Arg	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	17	7	NM_001161546	0	0	1	1	0	B4E007	Missense_Mutation	SNP	ENST00000434752.2	37	CCDS54909.1	803	0.3676739926739927	105	0.21341463414634146	108	0.2983425414364641	366	0.6398601398601399	224	0.2955145118733509	T	21.8	4.205823	0.79127	.	.	ENSG00000228672	ENST00000434752	.	.	.	4.26	4.26	0.50523	.	.	.	.	.	T	0.00012	0.0000	L	0.36672	1.1	0.33628	P	0.39427599999999996	D	0.76494	0.999	D	0.83275	0.996	T	0.45483	-0.9258	7	0.52906	T	0.07	.	11.6588	0.51334	0.0:0.0:0.0:1.0	rs11748963	245	E7EW31	CE065_HUMAN	R	245	.	ENSP00000416033:Q245R	Q	-	2	0	AC135457.1	138757936	0.990000	0.36364	0.998000	0.56505	0.770000	0.43624	2.116000	0.41930	1.919000	0.55581	0.459000	0.35465	CAG	T|0.632;C|0.368		0.781	PROB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000470735.1	NM_001161546	
RUNX2	860	hgsc.bcm.edu	37	6	45390514	45390514	+	Silent	SNP	G	G	A			TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr6:45390514G>A	ENST00000371438.1	+	2	601	c.243G>A	c.(241-243)gcG>gcA	p.A81A	RUNX2_ENST00000465038.2_Silent_p.A81A|RUNX2_ENST00000541979.1_Silent_p.A149A|RUNX2_ENST00000371436.6_Silent_p.A81A|RUNX2_ENST00000371432.3_Silent_p.A67A|RUNX2_ENST00000576263.1_Silent_p.A81A|RP1-244F24.1_ENST00000606796.1_RNA|RUNX2_ENST00000352853.5_Silent_p.A149A|RUNX2_ENST00000359524.5_Silent_p.A67A	NM_001024630.3	NP_001019801.3	Q13950	RUNX2_HUMAN	runt-related transcription factor 2	81	Poly-Ala.		Missing. {ECO:0000269|PubMed:9182765}.		BMP signaling pathway (GO:0030509)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|chondrocyte development (GO:0002063)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic forelimb morphogenesis (GO:0035115)|endochondral ossification (GO:0001958)|gene expression (GO:0010467)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|osteoblast development (GO:0002076)|osteoblast differentiation (GO:0001649)|osteoblast fate commitment (GO:0002051)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|stem cell differentiation (GO:0048863)|T cell differentiation (GO:0030217)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(18)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34						cggcggcggcggcggctgcgg	0.726																																					p.A81A		.											.	RUNX2-417	0			c.G243A						.						3.0	5.0	5.0					6																	45390514		922	2241	3163	SO:0001819	synonymous_variant	860	exon3			GGCGGCGGCGGCT	AF001450	CCDS43467.1, CCDS43468.1, CCDS43467.2, CCDS43468.2	6p21	2010-08-20			ENSG00000124813	ENSG00000124813			10472	protein-coding gene	gene with protein product		600211		CCD, CBFA1, CCD1		7835892	Standard	NM_001024630		Approved	AML3, PEBP2A1, PEBP2aA1	uc011dvx.2	Q13950	OTTHUMG00000014774	ENST00000371438.1:c.243G>A	6.37:g.45390514G>A		Somatic	2	0		WXS	Illumina GAIIx	Phase_I	6	4	NM_001024630	0	0	0	0	0	O14614|O14615|O95181	Silent	SNP	ENST00000371438.1	37	CCDS43467.2																																																																																			.		0.726	RUNX2-003	KNOWN	not_organism_supported|upstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040755.2	NM_004348	
POU3F2	5454	hgsc.bcm.edu	37	6	99283376	99283376	+	Silent	SNP	T	T	G	rs195860	byFrequency	TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr6:99283376T>G	ENST00000328345.5	+	1	797	c.627T>G	c.(625-627)ggT>ggG	p.G209G		NM_005604.3	NP_005595.2	P20265	PO3F2_HUMAN	POU class 3 homeobox 2	209					astrocyte development (GO:0014002)|cellular response to organic substance (GO:0071310)|cerebral cortex radially oriented cell migration (GO:0021799)|epidermis development (GO:0008544)|forebrain ventricular zone progenitor cell division (GO:0021869)|hypothalamus cell differentiation (GO:0021979)|myelination in peripheral nervous system (GO:0022011)|neurohypophysis development (GO:0021985)|neuron differentiation (GO:0030182)|positive regulation of cell proliferation (GO:0008284)|positive regulation of multicellular organism growth (GO:0040018)|regulation of axonogenesis (GO:0050770)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	identical protein binding (GO:0042802)|RNA polymerase II transcription coactivator activity (GO:0001105)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|large_intestine(3)|lung(5)	10		all_cancers(76;1.56e-06)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00893)|Colorectal(196;0.069)|Lung NSC(302;0.197)		BRCA - Breast invasive adenocarcinoma(108;0.0355)		AGCCGGCCGGTCTGCACCACC	0.736													G|||	4460	0.890575	0.8994	0.9121	5008	,	,		6412	0.9544		0.8598	False		,,,				2504	0.8292				p.G209G		.											.	POU3F2-90	0			c.T627G						.	G		3186,306		1453,280,13	4.0	4.0	4.0		627	3.1	1.0	6	dbSNP_79	4	6282,930		2738,806,62	no	coding-synonymous	POU3F2	NM_005604.2		4191,1086,75	GG,GT,TT		12.8952,8.7629,11.5471		209/444	99283376	9468,1236	1746	3606	5352	SO:0001819	synonymous_variant	5454	exon1			GGCCGGTCTGCAC	Z11933	CCDS5040.1	6q16.2	2011-06-20	2007-07-13		ENSG00000184486	ENSG00000184486		"""Homeoboxes / POU class"""	9215	protein-coding gene	gene with protein product		600494	"""POU domain class 3, transcription factor 2"""	OTF7		8441633	Standard	NM_005604		Approved	POUF3, BRN2, OCT7	uc003ppe.3	P20265	OTTHUMG00000015258	ENST00000328345.5:c.627T>G	6.37:g.99283376T>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	12	12	NM_005604	0	0	0	0	0	Q14960|Q86V54|Q9UJL0	Silent	SNP	ENST00000328345.5	37	CCDS5040.1																																																																																			T|0.089;G|0.911		0.736	POU3F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041586.2		
TTLL2	83887	bcgsc.ca	37	6	167753691	167753691	+	Silent	SNP	C	C	T	rs877653	byFrequency	TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr6:167753691C>T	ENST00000239587.5	+	3	391	c.303C>T	c.(301-303)agC>agT	p.S101S		NM_031949.4	NP_114155.4	Q9BWV7	TTLL2_HUMAN	tubulin tyrosine ligase-like family, member 2	101	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				cellular protein modification process (GO:0006464)		ligase activity (GO:0016874)			central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(17)|ovary(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(66;7.8e-06)|Ovarian(120;0.024)		OV - Ovarian serous cystadenocarcinoma(33;2.22e-20)|BRCA - Breast invasive adenocarcinoma(81;6.17e-07)|GBM - Glioblastoma multiforme(31;0.00492)		TGGTGCAAAGCGTCCTCCTGG	0.542													C|||	1552	0.309904	0.1679	0.2824	5008	,	,		20342	0.5079		0.2664	False		,,,				2504	0.362				p.S101S		.											.	TTLL2-92	0			c.C303T						.	C		840,3566	329.6+/-301.1	80,680,1443	62.0	57.0	59.0		303	-6.0	0.2	6	dbSNP_86	59	2537,6063	415.1+/-351.7	364,1809,2127	no	coding-synonymous	TTLL2	NM_031949.4		444,2489,3570	TT,TC,CC		29.5,19.0649,25.9649		101/593	167753691	3377,9629	2203	4300	6503	SO:0001819	synonymous_variant	83887	exon3			GCAAAGCGTCCTC	AK093039	CCDS5301.1	6q27	2013-02-14		2004-01-14	ENSG00000120440	ENSG00000120440		"""Tubulin tyrosine ligase-like family"""	21211	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 104"""	C6orf104		11054573	Standard	XM_006715572		Approved	NYD-TSPG, dJ366N23.3	uc003qvs.1	Q9BWV7	OTTHUMG00000016023	ENST00000239587.5:c.303C>T	6.37:g.167753691C>T		Somatic	162	1		WXS	Illumina GAIIx	Phase_I	125	6	NM_031949	0	0	0	0	0	B2RB11|B3KS77|Q7Z6R8|Q86X22	Silent	SNP	ENST00000239587.5	37	CCDS5301.1																																																																																			C|0.724;T|0.276		0.542	TTLL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043127.3	NM_031949	
SMOC2	64094	hgsc.bcm.edu	37	6	168842113	168842113	+	Silent	SNP	T	T	G	rs73270928	byFrequency	TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr6:168842113T>G	ENST00000356284.2	+	1	283	c.63T>G	c.(61-63)gcT>gcG	p.A21A	SMOC2_ENST00000354536.5_Silent_p.A21A	NM_001166412.1	NP_001159884.1	Q9H3U7	SMOC2_HUMAN	SPARC related modular calcium binding 2	21					extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)|signal transduction (GO:0007165)	basement membrane (GO:0005604)|interstitial matrix (GO:0005614)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	32		Breast(66;0.000141)|Esophageal squamous(34;0.222)|Ovarian(120;0.231)		OV - Ovarian serous cystadenocarcinoma(33;1.31e-19)|BRCA - Breast invasive adenocarcinoma(81;3.06e-06)|GBM - Glioblastoma multiforme(31;0.00109)		CGGTGCCCGCTCAGAAGTTCT	0.751													G|||	1980	0.395367	0.5787	0.2839	5008	,	,		9314	0.4593		0.167	False		,,,				2504	0.3957				p.A21A		.											.	SMOC2-91	0			c.T63G						.	G	,	924,2074		89,746,664	2.0	3.0	3.0		63,63	-0.4	1.0	6	dbSNP_131	3	645,5799		34,577,2611	no	coding-synonymous,coding-synonymous	SMOC2	NM_001166412.1,NM_022138.2	,	123,1323,3275	GG,GT,TT		10.0093,30.8205,16.6172	,	21/447,21/458	168842113	1569,7873	1499	3222	4721	SO:0001819	synonymous_variant	64094	exon1			GCCCGCTCAGAAG	AB014730	CCDS5307.1, CCDS55076.1	6q27	2013-01-10			ENSG00000112562	ENSG00000112562		"""EF-hand domain containing"""	20323	protein-coding gene	gene with protein product		607223				12031507	Standard	NM_022138		Approved	SMAP2	uc003qwr.2	Q9H3U7	OTTHUMG00000016050	ENST00000356284.2:c.63T>G	6.37:g.168842113T>G		Somatic	9	0		WXS	Illumina GAIIx	Phase_I	31	25	NM_022138	0	0	0	0	0	B3KPS7|Q4G169|Q5TAT7|Q5TAT8|Q86VV9|Q96SF3|Q9H1L3|Q9H1L4|Q9H3U0|Q9H4F7|Q9HCV2	Silent	SNP	ENST00000356284.2	37	CCDS55076.1																																																																																			T|0.654;G|0.346		0.751	SMOC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043201.1		
TNRC18	84629	hgsc.bcm.edu	37	7	5352635	5352635	+	Silent	SNP	T	T	G			TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr7:5352635T>G	ENST00000430969.1	-	27	8235	c.7887A>C	c.(7885-7887)tcA>tcC	p.S2629S	TNRC18_ENST00000399537.4_Silent_p.S2629S	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	2629	Ser-rich.						chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		aagaggaggatgaggaggagg	0.642																																					p.S2629S		.											.	TNRC18-46	0			c.A7887C						.						5.0	8.0	7.0					7																	5352635		1423	3213	4636	SO:0001819	synonymous_variant	84629	exon27			GGAGGATGAGGAG	U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.7887A>C	7.37:g.5352635T>G		Somatic	5	0		WXS	Illumina GAIIx	Phase_I	24	9	NM_001080495	0	0	1	2	1	A8MX41|Q96JH1|Q96K91	Silent	SNP	ENST00000430969.1	37	CCDS47534.1	.	.	.	.	.	.	.	.	.	.	N	0.020	-1.445364	0.01089	.	.	ENSG00000182095	ENST00000399544	.	.	.	3.4	-6.8	0.01709	.	1.000120	0.08080	N	1.000000	T	0.52853	0.1760	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.60979	-0.7155	6	0.87932	D	0	.	3.168	0.06542	0.3128:0.3903:0.1985:0.0984	.	.	.	.	P	1142	.	ENSP00000382459:H1142P	H	-	2	0	TNRC18	5319161	0.989000	0.36119	0.000000	0.03702	0.001000	0.01503	-1.429000	0.02437	-4.431000	0.00049	-3.452000	0.00036	CAT	.		0.642	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
USP42	84132	hgsc.bcm.edu	37	7	6193521	6193521	+	Missense_Mutation	SNP	G	G	C	rs61729726	byFrequency	TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr7:6193521G>C	ENST00000306177.5	+	15	2494	c.2336G>C	c.(2335-2337)cGc>cCc	p.R779P		NM_032172.2	NP_115548.1	Q9H9J4	UBP42_HUMAN	ubiquitin specific peptidase 42	779	Pro-rich.				cell differentiation (GO:0030154)|protein deubiquitination (GO:0016579)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(2)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	35		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.108)|OV - Ovarian serous cystadenocarcinoma(56;5.77e-14)		CCGCCGCCCCGCGATCCCGGC	0.756													C|||	2895	0.578075	0.8638	0.4121	5008	,	,		10724	0.7331		0.3082	False		,,,				2504	0.4274				p.R779P		.											.	USP42-659	0			c.G2336C						.	C	PRO/ARG	2157,1125		751,655,235	4.0	6.0	5.0		2336	2.6	0.0	7	dbSNP_129	5	1843,5693		290,1263,2215	no	missense	USP42	NM_032172.2	103	1041,1918,2450	CC,CG,GG		24.4559,34.2779,36.9754	benign	779/1317	6193521	4000,6818	1641	3768	5409	SO:0001583	missense	84132	exon15			CGCCCCGCGATCC	AK022759	CCDS47535.1	7p22.2	2005-08-08	2005-08-08		ENSG00000106346	ENSG00000106346		"""Ubiquitin-specific peptidases"""	20068	protein-coding gene	gene with protein product			"""ubiquitin specific protease 42"""			12838346	Standard	NM_032172		Approved	FLJ12697	uc011jwp.2	Q9H9J4	OTTHUMG00000151888	ENST00000306177.5:c.2336G>C	7.37:g.6193521G>C	ENSP00000301962:p.Arg779Pro	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	11	5	NM_032172	0	0	4	4	0	A2RUE3|B5MDA5|Q0VIN8|Q3C166|Q6P9B4	Missense_Mutation	SNP	ENST00000306177.5	37	CCDS47535.1	1188	0.5439560439560439	401	0.8150406504065041	130	0.35911602209944754	440	0.7692307692307693	217	0.2862796833773087	C	10.95	1.494372	0.26774	0.657221	0.244559	ENSG00000106346	ENST00000306177;ENST00000426246	T;T	0.14266	2.52;2.93	5.46	2.59	0.31030	.	0.841331	0.10600	N	0.655737	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.09164	-1.0687	9	0.28530	T	0.3	.	2.8136	0.05448	0.1458:0.5508:0.1414:0.162	rs61729726	779;779	Q9H9J4-2;Q9H9J4	.;UBP42_HUMAN	P	779;625	ENSP00000301962:R779P;ENSP00000408217:R625P	ENSP00000301962:R779P	R	+	2	0	USP42	6160046	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.469000	0.22067	0.265000	0.21872	-0.120000	0.15030	CGC	G|0.456;C|0.544		0.756	USP42-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324262.3	XM_166526	
PODXL	5420	hgsc.bcm.edu;broad.mit.edu	37	7	131241030	131241035	+	In_Frame_Del	DEL	GGCGAC	GGCGAC	-	rs11277659|rs547816245|rs532078953	byFrequency	TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	GGCGAC	GGCGAC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr7:131241030_131241035delGGCGAC	ENST00000378555.3	-	1	331_336	c.84_89delGTCGCC	c.(82-90)ccgtcgccc>ccc	p.28_30PSP>P	PODXL_ENST00000541194.1_In_Frame_Del_p.28_30PSP>P|PODXL_ENST00000465001.1_Intron|PODXL_ENST00000322985.9_In_Frame_Del_p.28_30PSP>P|PODXL_ENST00000537928.1_In_Frame_Del_p.28_30PSP>P			O00592	PODXL_HUMAN	podocalyxin-like	28					cell adhesion (GO:0007155)|cell migration (GO:0016477)|epithelial tube formation (GO:0072175)|glomerular visceral epithelial cell development (GO:0072015)|leukocyte migration (GO:0050900)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-cell adhesion (GO:0022408)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|regulation of microvillus assembly (GO:0032534)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|slit diaphragm (GO:0036057)		p.P30_S31delPS(2)		NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24	Melanoma(18;0.162)					ATTCTGGGAGggcgacggcgacggcg	0.748																																					p.28_30del		.											.	PODXL-136	2	Deletion - In frame(2)	prostate(2)	c.84_89del						.																																			SO:0001651	inframe_deletion	5420	exon1			TGGGAGGGCGACG		CCDS34755.1, CCDS47714.1	7q32-q33	2008-07-18			ENSG00000128567	ENSG00000128567			9171	protein-coding gene	gene with protein product		602632					Standard	NM_001018111		Approved	PCLP, Gp200, PC	uc003vqx.4	O00592	OTTHUMG00000154918	ENST00000378555.3:c.84_89delGTCGCC	7.37:g.131241036_131241041delGGCGAC	ENSP00000367817:p.Pro30_Ser31del	Somatic	9	0		WXS	Illumina GAIIx	Phase_I	54	14	NM_001018111	0	0	0	0	0	A6NHX8|Q52LZ7|Q53ER6	In_Frame_Del	DEL	ENST00000378555.3	37	CCDS34755.1																																																																																			.		0.748	PODXL-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000337627.2	NM_001018111	
EPPK1	83481	bcgsc.ca	37	8	144940267	144940267	+	Silent	SNP	G	G	A	rs28441354		TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr8:144940267G>A	ENST00000525985.1	-	2	7226	c.7155C>T	c.(7153-7155)ggC>ggT	p.G2385G				P58107	EPIPL_HUMAN	epiplakin 1	2385						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			GGTCGAAGAAGCCCTTGGTGT	0.642																																					p.G2385G		.											.	EPPK1-25	0			c.C7155T						.						274.0	257.0	263.0					8																	144940267		2190	4273	6463	SO:0001819	synonymous_variant	83481	exon1			GAAGAAGCCCTTG	AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.7155C>T	8.37:g.144940267G>A		Somatic	123	1		WXS	Illumina GAIIx	Phase_I	322	14	NM_031308	0	0	1	1	0	Q76E58|Q9NSU9	Silent	SNP	ENST00000525985.1	37																																																																																				G|0.995;A|0.005		0.642	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382675.1	NM_031308	
PLEC	5339	hgsc.bcm.edu	37	8	144990528	144990528	+	Silent	SNP	A	A	G	rs7014582	byFrequency	TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr8:144990528A>G	ENST00000322810.4	-	32	14041	c.13872T>C	c.(13870-13872)gcT>gcC	p.A4624A	PLEC_ENST00000345136.3_Silent_p.A4487A|PLEC_ENST00000527096.1_Silent_p.A4510A|PLEC_ENST00000356346.3_Silent_p.A4473A|PLEC_ENST00000354589.3_Silent_p.A4487A|PLEC_ENST00000354958.2_Silent_p.A4465A|PLEC_ENST00000357649.2_Silent_p.A4491A|PLEC_ENST00000398774.2_Silent_p.A4455A|PLEC_ENST00000436759.2_Silent_p.A4514A	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	4624	Globular 2.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						TGCGGGAGCCAGCGGTAGAGC	0.716													G|||	2389	0.477037	0.8979	0.3746	5008	,	,		8857	0.1508		0.4404	False		,,,				2504	0.3548				p.A4624A		.											.	PLEC-141	0			c.T13872C						.	G	,,,,,,,	2833,621		1197,439,91	12.0	16.0	15.0		13542,13419,13395,13872,13365,13461,13473,13461	-8.1	0.0	8	dbSNP_116	15	3324,4610		785,1754,1428	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	,,,,,,,	1982,2193,1519	GG,GA,AA		41.8956,17.9792,45.9343	,,,,,,,	4514/4575,4473/4534,4465/4526,4624/4685,4455/4516,4487/4548,4491/4552,4487/4548	144990528	6157,5231	1727	3967	5694	SO:0001819	synonymous_variant	5339	exon32			GGAGCCAGCGGTA	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.13872T>C	8.37:g.144990528A>G		Somatic	5	0		WXS	Illumina GAIIx	Phase_I	22	10	NM_201380	0	0	34	65	31	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																			A|0.536;G|0.464		0.716	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
C9orf66	157983	hgsc.bcm.edu	37	9	214706	214706	+	Missense_Mutation	SNP	G	G	C	rs540473	byFrequency	TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr9:214706G>C	ENST00000382387.2	-	1	1187	c.691C>G	c.(691-693)Cga>Gga	p.R231G	DOCK8_ENST00000432829.2_5'Flank|DOCK8_ENST00000453981.1_5'Flank	NM_152569.2	NP_689782.2	Q5T8R8	CI066_HUMAN	chromosome 9 open reading frame 66	231	Arg-rich.		R -> G (in dbSNP:rs540473).							central_nervous_system(1)|cervix(1)|kidney(1)|skin(1)	4	all_lung(41;0.218)	all_cancers(5;2.09e-12)|all_epithelial(5;6.16e-09)|all_lung(10;1.15e-08)|Lung NSC(10;1.91e-08)|Acute lymphoblastic leukemia(5;0.00457)|all_hematologic(5;0.0332)|Breast(48;0.0646)|Prostate(43;0.137)	Kidney(42;0.112)|KIRC - Kidney renal clear cell carcinoma(5;0.157)	all cancers(5;0.000704)|Lung(218;0.00755)|GBM - Glioblastoma multiforme(5;0.0149)|Epithelial(6;0.0154)		CCCCAGTATCGGGAGGCCAGT	0.791													C|||	2724	0.54393	0.4856	0.5504	5008	,	,		9921	0.7401		0.4324	False		,,,				2504	0.5307				p.R231G		.											.	C9orf66-514	0			c.C691G						.	C	GLY/ARG	1470,1990		362,746,622	3.0	4.0	4.0		691	1.7	0.9	9	dbSNP_83	4	2548,4318		590,1368,1475	no	missense	C9orf66	NM_152569.2	125	952,2114,2097	CC,CG,GG		37.1104,42.4855,38.9115	benign	231/296	214706	4018,6308	1730	3433	5163	SO:0001583	missense	157983	exon1			AGTATCGGGAGGC	AK055720	CCDS6439.1	9p24.3	2008-02-05			ENSG00000183784	ENSG00000183784			26436	protein-coding gene	gene with protein product							Standard	NM_152569		Approved	FLJ31158	uc003zge.4	Q5T8R8	OTTHUMG00000021017	ENST00000382387.2:c.691C>G	9.37:g.214706G>C	ENSP00000371824:p.Arg231Gly	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_152569	0	0	0	0	0	Q96NB0	Missense_Mutation	SNP	ENST00000382387.2	37	CCDS6439.1	1127	0.5160256410256411	240	0.4878048780487805	182	0.5027624309392266	387	0.6765734265734266	318	0.41952506596306066	.	6.200	0.405074	0.11754	0.424855	0.371104	ENSG00000183784	ENST00000382387	T	0.22743	1.94	3.91	1.74	0.24563	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.54753	P	1.7000000000044757E-5	B	0.02656	0.0	B	0.01281	0.0	T	0.25813	-1.0121	8	0.87932	D	0	.	11.1247	0.48310	0.0:0.4274:0.5726:0.0	rs540473;rs13292950	231	Q5T8R8	CI066_HUMAN	G	231	ENSP00000371824:R231G	ENSP00000371824:R231G	R	-	1	2	C9orf66	204706	0.960000	0.32886	0.885000	0.34714	0.005000	0.04900	0.456000	0.21859	0.370000	0.24538	-0.335000	0.08231	CGA	G|0.516;C|0.484		0.791	C9orf66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055436.1	NM_152569	
ZNF618	114991	bcgsc.ca	37	9	116810204	116810204	+	Silent	SNP	G	G	A	rs12378906	byFrequency	TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr9:116810204G>A	ENST00000374126.5	+	14	1377	c.1278G>A	c.(1276-1278)caG>caA	p.Q426Q	ZNF618_ENST00000470105.1_3'UTR|ZNF618_ENST00000288466.7_Silent_p.Q333Q			Q5T7W0	ZN618_HUMAN	zinc finger protein 618	426					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|lung(10)|urinary_tract(1)	16						CCTCCAACCAGTCCCGATCGC	0.532													G|||	329	0.0656949	0.1203	0.0605	5008	,	,		21014	0.0		0.0885	False		,,,				2504	0.0399				p.Q333Q		.											.	ZNF618-22	0			c.G999A						.	G		467,3649		17,433,1608	75.0	78.0	77.0		999	3.6	1.0	9	dbSNP_120	77	715,7715		33,649,3533	yes	coding-synonymous	ZNF618	NM_133374.2		50,1082,5141	AA,AG,GG		8.4816,11.346,9.4213		333/862	116810204	1182,11364	2058	4215	6273	SO:0001819	synonymous_variant	114991	exon13			CAACCAGTCCCGA	BC012922	CCDS48008.1	9q33.1	2010-04-21			ENSG00000157657	ENSG00000157657		"""Zinc fingers, C2H2-type"""	29416	protein-coding gene	gene with protein product	"""neural precursor cell expressed, developmentally down-regulated 10"""					11853319	Standard	NM_133374		Approved	KIAA1952, NEDD10	uc004bic.3	Q5T7W0	OTTHUMG00000020532	ENST00000374126.5:c.1278G>A	9.37:g.116810204G>A		Somatic	305	2		WXS	Illumina GAIIx	Phase_I	314	9	NM_133374	0	0	8	8	0	B9EG82|Q4G0X6|Q5T7W1|Q6ZT53|Q7Z6B9|Q8TF49|Q96E49	Silent	SNP	ENST00000374126.5	37																																																																																				G|0.927;A|0.073		0.532	ZNF618-004	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000053749.1	XM_054983	
FPGS	2356	hgsc.bcm.edu	37	9	130565267	130565267	+	Missense_Mutation	SNP	A	A	G	rs11554717|rs10760502	byFrequency	TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr9:130565267A>G	ENST00000373247.2	+	1	114	c.64A>G	c.(64-66)Ata>Gta	p.I22V	FPGS_ENST00000393706.2_Missense_Mutation_p.I22V|FPGS_ENST00000373225.3_5'Flank|FPGS_ENST00000373245.1_Missense_Mutation_p.I22V|FPGS_ENST00000460181.1_3'UTR	NM_004957.4	NP_004948.4	Q05932	FOLC_HUMAN	folylpolyglutamate synthase	22			I -> V (in dbSNP:rs10760502). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:7721888}.		brain development (GO:0007420)|folic acid metabolic process (GO:0046655)|liver development (GO:0001889)|nucleobase-containing compound metabolic process (GO:0006139)|one-carbon metabolic process (GO:0006730)|organ regeneration (GO:0031100)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|tetrahydrofolylpolyglutamate synthase activity (GO:0004326)			endometrium(2)|kidney(1)|lung(3)|ovary(1)	7					Methotrexate(DB00563)|Pralatrexate(DB06813)|Raltitrexed(DB00293)	TGCGCGCGGCATAACGACCCA	0.761													g|||	3912	0.78115	0.8956	0.6153	5008	,	,		6680	0.9583		0.6352	False		,,,				2504	0.7117				p.I22V		.											.	FPGS-90	0			c.A64G						.		VAL/ILE	2249,281		997,255,13	1.0	3.0	2.0		64	1.8	0.0	9	dbSNP_120	2	3848,1396		1394,1060,168	no	missense	FPGS	NM_004957.4	29	2391,1315,181	GG,GA,AA		26.6209,11.1067,21.5719	benign	22/588	130565267	6097,1677	1265	2622	3887	SO:0001583	missense	2356	exon1			CGCGGCATAACGA		CCDS35148.1, CCDS35149.1, CCDS75905.1	9q34.11	2013-09-19			ENSG00000136877	ENSG00000136877	6.3.2.17		3824	protein-coding gene	gene with protein product		136510					Standard	NM_004957		Approved		uc004bsg.1	Q05932	OTTHUMG00000020716	ENST00000373247.2:c.64A>G	9.37:g.130565267A>G	ENSP00000362344:p.Ile22Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_004957	0	0	0	1	1	B3KPW4|B7Z2Z3|F5H0K6|Q5JU19|Q5JU22|Q6P2P6	Missense_Mutation	SNP	ENST00000373247.2	37	CCDS35148.1	1668	0.7637362637362637	432	0.8780487804878049	215	0.5939226519337016	545	0.9527972027972028	476	0.6279683377308707	g	3.002	-0.205821	0.06180	0.888933	0.733791	ENSG00000136877	ENST00000373247;ENST00000373245;ENST00000393706;ENST00000373228	T;T;T;T	0.29655	3.02;1.56;3.03;1.56	4.93	1.83	0.25207	.	0.868559	0.09918	N	0.738853	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.37361	-0.9709	9	0.02654	T	1	-12.2003	6.0757	0.19913	0.2469:0.2097:0.5434:0.0	rs10760502;rs17855899;rs56845445	22;22	Q05932-4;Q05932	.;FOLC_HUMAN	V	22	ENSP00000362344:I22V;ENSP00000362342:I22V;ENSP00000377309:I22V;ENSP00000362325:I22V	ENSP00000362325:I22V	I	+	1	0	FPGS	129605088	0.000000	0.05858	0.001000	0.08648	0.021000	0.10359	0.242000	0.18087	0.210000	0.20664	-0.258000	0.10820	ATA	A|0.235;G|0.765		0.761	FPGS-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054251.1		
SALL3	27164	hgsc.bcm.edu	37	18	76752544	76752545	+	Missense_Mutation	DNP	GC	GC	TT	rs186555722|rs191414199	byFrequency	TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	GC	GC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr18:76752544_76752545GC>TT	ENST00000537592.2	+	2	553_554	c.553_554GC>TT	c.(553-555)GCg>TTg	p.A185L	SALL3_ENST00000575389.2_Missense_Mutation_p.A185L|SALL3_ENST00000536229.3_Missense_Mutation_p.A52L	NM_171999.3	NP_741996.2	Q9BXA9	SALL3_HUMAN	spalt-like transcription factor 3	185					forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|negative regulation of smoothened signaling pathway (GO:0045879)|olfactory bulb interneuron development (GO:0021891)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(40)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		CTCGCAGGGCGCGCGCGCGGCA	0.723																																					p.A185L		.											.	SALL3-155	0			c.C554T						.																																			SO:0001583	missense	27164	exon2			AGGGCGCGCGCGC	AJ007421	CCDS12013.1	18q23	2013-10-17	2013-10-17		ENSG00000256463	ENSG00000256463		"""Zinc fingers, C2H2-type"""	10527	protein-coding gene	gene with protein product		605079	"""sal (Drosophila)-like 3"", ""sal-like 3 (Drosophila)"""			10610715	Standard	NM_171999		Approved	ZNF796	uc002lmt.3	Q9BXA9	OTTHUMG00000132896	Exception_encountered	18.37:g.76752544_76752545delinsTT	ENSP00000441823:p.Ala185Leu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	4	NM_171999	0	0	0	0	0	Q9UGH1	Missense_Mutation	DNP	ENST00000537592.2	37	CCDS12013.1																																																																																			C|0.967;T|0.033		0.723	SALL3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256397.1	NM_171999	
ZNF814	730051	hgsc.bcm.edu	37	19	58385798	58385799	+	Missense_Mutation	DNP	CC	CC	TT			TCGA-OR-A5JR-01A-11D-A29I-10	TCGA-OR-A5JR-10A-01D-A29L-10	CC	CC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6625a9c0-ac73-4f14-a02d-7a8e64f7b2bb	8ea6498c-da66-42fc-bb2a-b4f5e02c0438	g.chr19:58385798_58385799CC>TT	ENST00000435989.2	-	3	1193_1194	c.959_960GG>AA	c.(958-960)gGG>gAA	p.G320E	ZNF814_ENST00000600634.1_Intron|ZNF814_ENST00000597832.1_Intron|ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000595295.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	320					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G320E(1)|p.G320G(1)		NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						AAGGTCTTTTCCCAGTGTGAAC	0.356																																					p.G320E		.											.	.	2	Substitution - Missense(1)|Substitution - coding silent(1)	central_nervous_system(2)	c.G959A						.																																			SO:0001583	missense	730051	exon3			CTTTTCCCAGTGT		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.959_960delinsTT	19.37:g.58385798_58385799delinsTT	ENSP00000410545:p.Gly320Glu	Somatic	91	0		WXS	Illumina GAIIx	Phase_I	97	6	NM_001144989	0	0	0	0	0	A6NF35	Missense_Mutation	DNP	ENST00000435989.2	37	CCDS46212.1																																																																																			.		0.356	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
