#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
HES3	390992	hgsc.bcm.edu	37	1	6305292	6305292	+	Missense_Mutation	SNP	C	C	A	rs61760836	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr1:6305292C>A	ENST00000377898.3	+	4	351	c.286C>A	c.(286-288)Ccc>Acc	p.P96T		NM_001024598.3	NP_001019769.1	Q5TGS1	HES3_HUMAN	hes family bHLH transcription factor 3	96	Orange.				hindbrain morphogenesis (GO:0021575)|in utero embryonic development (GO:0001701)|midbrain development (GO:0030901)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oculomotor nerve development (GO:0021557)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of timing of neuron differentiation (GO:0060164)|transcription, DNA-templated (GO:0006351)|trochlear nerve development (GO:0021558)	nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription factor binding (GO:0008134)			lung(2)|skin(1)	3	Ovarian(185;0.0634)	all_cancers(23;2.48e-32)|all_epithelial(116;1.14e-17)|all_lung(118;2.85e-06)|all_neural(13;3.68e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;3.77e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00475)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;1.2e-37)|GBM - Glioblastoma multiforme(13;3.2e-29)|OV - Ovarian serous cystadenocarcinoma(86;2.52e-19)|Colorectal(212;1.19e-07)|COAD - Colon adenocarcinoma(227;1.3e-05)|Kidney(185;4.88e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000871)|BRCA - Breast invasive adenocarcinoma(365;0.00105)|STAD - Stomach adenocarcinoma(132;0.00308)|READ - Rectum adenocarcinoma(331;0.0642)|Lung(427;0.241)		CCCCCTGGTGCCCGAGAGCGC	0.751													C|||	2794	0.557907	0.3079	0.755	5008	,	,		7447	0.5615		0.6849	False		,,,				2504	0.6217				p.P96T		.											.	HES3-514	0			c.C286A						.	C	THR/PRO	1430,1518		391,648,435	2.0	3.0	2.0		286	2.4	0.2	1	dbSNP_129	2	4911,1731		1926,1059,336	no	missense	HES3	NM_001024598.3	38	2317,1707,771	AA,AC,CC		26.0614,48.5075,33.879	benign	96/187	6305292	6341,3249	1474	3321	4795	SO:0001583	missense	390992	exon4			CTGGTGCCCGAGA		CCDS41238.1	1p36.31	2013-10-17	2013-10-17		ENSG00000173673	ENSG00000173673		"""Basic helix-loop-helix proteins"""	26226	protein-coding gene	gene with protein product		609971	"""hairy and enhancer of split 3 (Drosophila)"""				Standard	NM_001024598		Approved	bHLHb43	uc009vly.2	Q5TGS1	OTTHUMG00000001271	ENST00000377898.3:c.286C>A	1.37:g.6305292C>A	ENSP00000367130:p.Pro96Thr	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_001024598	0	0	0	0	0	Q5TGS0	Missense_Mutation	SNP	ENST00000377898.3	37	CCDS41238.1	1241	0.5682234432234432	158	0.32113821138211385	254	0.7016574585635359	313	0.5472027972027972	516	0.6807387862796834	C	2.270	-0.367136	0.05069	0.485075	0.739386	ENSG00000173673	ENST00000377898	T	0.29397	1.57	3.31	2.4	0.29515	.	.	.	.	.	T	0.00012	0.0000	N	0.14661	0.345	0.80722	P	0.0	B	0.22003	0.063	B	0.17098	0.017	T	0.30765	-0.9967	8	0.11794	T	0.64	-26.1056	6.4315	0.21798	0.0:0.8639:0.0:0.1361	rs61760836	96	Q5TGS1	HES3_HUMAN	T	96	ENSP00000367130:P96T	ENSP00000367130:P96T	P	+	1	0	HES3	6227879	0.724000	0.28038	0.207000	0.23584	0.040000	0.13550	1.220000	0.32491	0.982000	0.38575	0.289000	0.19496	CCC	C|0.430;A|0.570		0.751	HES3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000003716.3	NM_001024598	
HES3	390992	hgsc.bcm.edu	37	1	6305303	6305303	+	Silent	SNP	C	C	A	rs61760837	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr1:6305303C>A	ENST00000377898.3	+	4	362	c.297C>A	c.(295-297)gcC>gcA	p.A99A		NM_001024598.3	NP_001019769.1	Q5TGS1	HES3_HUMAN	hes family bHLH transcription factor 3	99	Orange.				hindbrain morphogenesis (GO:0021575)|in utero embryonic development (GO:0001701)|midbrain development (GO:0030901)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oculomotor nerve development (GO:0021557)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of timing of neuron differentiation (GO:0060164)|transcription, DNA-templated (GO:0006351)|trochlear nerve development (GO:0021558)	nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription factor binding (GO:0008134)			lung(2)|skin(1)	3	Ovarian(185;0.0634)	all_cancers(23;2.48e-32)|all_epithelial(116;1.14e-17)|all_lung(118;2.85e-06)|all_neural(13;3.68e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;3.77e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00475)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;1.2e-37)|GBM - Glioblastoma multiforme(13;3.2e-29)|OV - Ovarian serous cystadenocarcinoma(86;2.52e-19)|Colorectal(212;1.19e-07)|COAD - Colon adenocarcinoma(227;1.3e-05)|Kidney(185;4.88e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000871)|BRCA - Breast invasive adenocarcinoma(365;0.00105)|STAD - Stomach adenocarcinoma(132;0.00308)|READ - Rectum adenocarcinoma(331;0.0642)|Lung(427;0.241)		CCGAGAGCGCCGCCGGCAGCA	0.771													C|||	2792	0.557508	0.3079	0.7536	5008	,	,		7640	0.5615		0.6839	False		,,,				2504	0.6217				p.A99A		.											.	HES3-514	0			c.C297A						.	C		1446,1378		419,608,385	2.0	3.0	2.0		297	0.2	0.0	1	dbSNP_129	2	4876,1552		1960,956,298	no	coding-synonymous	HES3	NM_001024598.3		2379,1564,683	AA,AC,CC		24.1444,48.796,31.6688		99/187	6305303	6322,2930	1412	3214	4626	SO:0001819	synonymous_variant	390992	exon4			GAGCGCCGCCGGC		CCDS41238.1	1p36.31	2013-10-17	2013-10-17		ENSG00000173673	ENSG00000173673		"""Basic helix-loop-helix proteins"""	26226	protein-coding gene	gene with protein product		609971	"""hairy and enhancer of split 3 (Drosophila)"""				Standard	NM_001024598		Approved	bHLHb43	uc009vly.2	Q5TGS1	OTTHUMG00000001271	ENST00000377898.3:c.297C>A	1.37:g.6305303C>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_001024598	0	0	0	0	0	Q5TGS0	Silent	SNP	ENST00000377898.3	37	CCDS41238.1																																																																																			C|0.438;A|0.562		0.771	HES3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000003716.3	NM_001024598	
HES3	390992	hgsc.bcm.edu	37	1	6305321	6305321	+	Silent	SNP	C	C	T	rs180888799	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr1:6305321C>T	ENST00000377898.3	+	4	380	c.315C>T	c.(313-315)gaC>gaT	p.D105D		NM_001024598.3	NP_001019769.1	Q5TGS1	HES3_HUMAN	hes family bHLH transcription factor 3	105					hindbrain morphogenesis (GO:0021575)|in utero embryonic development (GO:0001701)|midbrain development (GO:0030901)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oculomotor nerve development (GO:0021557)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of timing of neuron differentiation (GO:0060164)|transcription, DNA-templated (GO:0006351)|trochlear nerve development (GO:0021558)	nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription factor binding (GO:0008134)			lung(2)|skin(1)	3	Ovarian(185;0.0634)	all_cancers(23;2.48e-32)|all_epithelial(116;1.14e-17)|all_lung(118;2.85e-06)|all_neural(13;3.68e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;3.77e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00475)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;1.2e-37)|GBM - Glioblastoma multiforme(13;3.2e-29)|OV - Ovarian serous cystadenocarcinoma(86;2.52e-19)|Colorectal(212;1.19e-07)|COAD - Colon adenocarcinoma(227;1.3e-05)|Kidney(185;4.88e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000871)|BRCA - Breast invasive adenocarcinoma(365;0.00105)|STAD - Stomach adenocarcinoma(132;0.00308)|READ - Rectum adenocarcinoma(331;0.0642)|Lung(427;0.241)		GCACCATGGACAGCGCCGGGT	0.781											OREG0004446	type=TRANSCRIPTION FACTOR BINDING SITE|Gene=HES3|TFbs=REST|Dataset=NRSF/REST ChIPSeq sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)	C|||	17	0.00339457	0.0015	0.0043	5008	,	,		7794	0.0		0.008	False		,,,				2504	0.0041				p.D105D		.											.	HES3-514	0			c.C315T						.	C		1,2827		0,1,1413	2.0	3.0	2.0		315	3.3	1.0	1		2	27,6243		0,27,3108	no	coding-synonymous	HES3	NM_001024598.3		0,28,4521	TT,TC,CC		0.4306,0.0354,0.3078		105/187	6305321	28,9070	1414	3135	4549	SO:0001819	synonymous_variant	390992	exon4			CATGGACAGCGCC		CCDS41238.1	1p36.31	2013-10-17	2013-10-17		ENSG00000173673	ENSG00000173673		"""Basic helix-loop-helix proteins"""	26226	protein-coding gene	gene with protein product		609971	"""hairy and enhancer of split 3 (Drosophila)"""				Standard	NM_001024598		Approved	bHLHb43	uc009vly.2	Q5TGS1	OTTHUMG00000001271	ENST00000377898.3:c.315C>T	1.37:g.6305321C>T		Somatic	0	0	633	WXS	Illumina GAIIx	Phase_I	5	5	NM_001024598	0	0	0	0	0	Q5TGS0	Silent	SNP	ENST00000377898.3	37	CCDS41238.1																																																																																			C|0.995;T|0.005		0.781	HES3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000003716.3	NM_001024598	
TAS1R2	80834	broad.mit.edu	37	1	19181387	19181387	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr1:19181387C>A	ENST00000375371.3	-	3	598	c.577G>T	c.(577-579)Gcc>Tcc	p.A193S	RP13-279N23.2_ENST00000494072.3_3'UTR	NM_152232.2	NP_689418.2	Q8TE23	TS1R2_HUMAN	taste receptor, type 1, member 2	193					detection of chemical stimulus involved in sensory perception of sweet taste (GO:0001582)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|sensory perception of sweet taste (GO:0050916)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(10)|lung(14)|ovary(1)|pancreas(3)|prostate(1)|skin(3)|stomach(1)	45		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Aspartame(DB00168)	TGCACCATGGCCTCGATGTGG	0.617																																					p.A193S		.											.	TAS1R2-93	0			c.G577T						.						41.0	40.0	40.0					1																	19181387		2203	4300	6503	SO:0001583	missense	80834	exon3			CCATGGCCTCGAT		CCDS187.1	1p36.13	2012-08-22	2003-03-07		ENSG00000179002	ENSG00000179002		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14905	protein-coding gene	gene with protein product		606226	"""G protein-coupled receptor 71"""	GPR71			Standard	NM_152232		Approved	T1R2, TR2	uc001bba.1	Q8TE23	OTTHUMG00000002442	ENST00000375371.3:c.577G>T	1.37:g.19181387C>A	ENSP00000364520:p.Ala193Ser	Somatic	54	0		WXS	Illumina GAIIx	Phase_I	73	6	NM_152232	0	0	0	0	0	Q5TZ19	Missense_Mutation	SNP	ENST00000375371.3	37	CCDS187.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.203781	0.79127	.	.	ENSG00000179002	ENST00000375371	D	0.89123	-2.47	4.9	4.9	0.64082	Extracellular ligand-binding receptor (1);	0.291140	0.24391	N	0.038921	D	0.94991	0.8379	M	0.89163	3.01	0.51482	D	0.999928	D	0.76494	0.999	D	0.74348	0.983	D	0.95343	0.8440	10	0.59425	D	0.04	.	15.6102	0.76710	0.0:1.0:0.0:0.0	.	193	Q8TE23	TS1R2_HUMAN	S	193	ENSP00000364520:A193S	ENSP00000364520:A193S	A	-	1	0	TAS1R2	19053974	1.000000	0.71417	1.000000	0.80357	0.393000	0.30537	7.505000	0.81655	2.560000	0.86352	0.491000	0.48974	GCC	.		0.617	TAS1R2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000006953.1		
FAM46B	115572	hgsc.bcm.edu	37	1	27339103	27339103	+	Missense_Mutation	SNP	G	G	T	rs4970471	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr1:27339103G>T	ENST00000289166.5	-	1	224	c.59C>A	c.(58-60)aCg>aAg	p.T20K		NM_052943.3	NP_443175.2	Q96A09	FA46B_HUMAN	family with sequence similarity 46, member B	20										breast(1)|central_nervous_system(1)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(1)	10		all_cancers(24;1.29e-21)|all_epithelial(13;2.35e-19)|Colorectal(325;0.000147)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Breast(348;0.00131)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;7.71e-51)|OV - Ovarian serous cystadenocarcinoma(117;1.11e-29)|Colorectal(126;5.31e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000272)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|STAD - Stomach adenocarcinoma(196;0.00114)|READ - Rectum adenocarcinoma(331;0.0419)		ggccgcagccgtccccacctg	0.776													G|||	1682	0.335863	0.0416	0.3833	5008	,	,		10818	0.7232		0.17	False		,,,				2504	0.4714				p.T20K		.											.	FAM46B-90	0			c.C59A						.						2.0	3.0	3.0					1																	27339103		1323	2827	4150	SO:0001583	missense	115572	exon1			GCAGCCGTCCCCA	AK122816	CCDS294.2	1p35.3	2008-02-05			ENSG00000158246	ENSG00000158246			28273	protein-coding gene	gene with protein product						12477932	Standard	NM_052943		Approved	MGC16491	uc010ofj.2	Q96A09	OTTHUMG00000004278	ENST00000289166.5:c.59C>A	1.37:g.27339103G>T	ENSP00000289166:p.Thr20Lys	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_052943	0	0	0	0	0		Missense_Mutation	SNP	ENST00000289166.5	37	CCDS294.2	721	0.3301282051282051	37	0.07520325203252033	121	0.3342541436464088	437	0.763986013986014	126	0.1662269129287599	G	11.37	1.619792	0.28801	.	.	ENSG00000158246	ENST00000289166	T	0.21191	2.02	5.38	3.52	0.40303	.	1.667900	0.02757	N	0.118208	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.06786	0.001	B	0.04013	0.001	T	0.47100	-0.9143	9	0.59425	D	0.04	2.3053	4.1771	0.10356	0.2481:0.0:0.5902:0.1618	rs4970471	20	Q96A09	FA46B_HUMAN	K	20	ENSP00000289166:T20K	ENSP00000289166:T20K	T	-	2	0	FAM46B	27211690	0.009000	0.17119	0.813000	0.32504	0.001000	0.01503	0.817000	0.27281	0.843000	0.35070	-0.137000	0.14449	ACG	G|0.670;T|0.330		0.776	FAM46B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012347.2	NM_052943	
OPRD1	4985	hgsc.bcm.edu	37	1	29138975	29138975	+	Missense_Mutation	SNP	G	G	T	rs1042114	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr1:29138975G>T	ENST00000234961.2	+	1	322	c.80G>T	c.(79-81)tGc>tTc	p.C27F		NM_000911.3	NP_000902.3	P41143	OPRD_HUMAN	opioid receptor, delta 1	27			C -> F (improved maturation and increased expression at the cell surface; dbSNP:rs1042114). {ECO:0000269|PubMed:10982041, ECO:0000269|PubMed:8201839, ECO:0000269|Ref.4}.		adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adult locomotory behavior (GO:0008344)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|cellular response to toxic substance (GO:0097237)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|immune response (GO:0006955)|negative regulation of gene expression (GO:0010629)|negative regulation of protein oligomerization (GO:0032460)|neuropeptide signaling pathway (GO:0007218)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein import into nucleus, translocation (GO:0000060)|regulation of calcium ion transport (GO:0051924)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of sensory perception of pain (GO:0051930)	axon terminus (GO:0043679)|cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	enkephalin receptor activity (GO:0038046)|opioid receptor activity (GO:0004985)			breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15		Colorectal(325;3.46e-05)|Lung NSC(340;0.000947)|all_lung(284;0.00131)|Renal(390;0.00758)|Breast(348;0.00765)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;1.29e-07)|COAD - Colon adenocarcinoma(152;7.51e-06)|STAD - Stomach adenocarcinoma(196;0.00306)|BRCA - Breast invasive adenocarcinoma(304;0.0241)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)	Alvimopan(DB06274)|Amitriptyline(DB00321)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diphenoxylate(DB01081)|Fentanyl(DB00813)|Heroin(DB01452)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levorphanol(DB00854)|Loperamide(DB00836)|Methadone(DB00333)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	CCTAGCGCCTGCCCCAGCGCT	0.771													T|||	4730	0.944489	0.9796	0.9193	5008	,	,		9147	1.0		0.8678	False		,,,				2504	0.9366				p.C27F		.											.	OPRD1-69	0			c.G80T						.	T	PHE/CYS	3689,115		1788,113,1	4.0	6.0	5.0	http://www.ncbi.nlm.nih.gov/omim/103780,165195|http://omim.org/entry/165195|http://omim.org/entry/103780	80	2.9	1.0	1	dbSNP_86	5	6762,846		2982,798,24	no	missense	OPRD1	NM_000911.3	205	4770,911,25	TT,TG,GG		11.1199,3.0231,8.421	benign	27/373	29138975	10451,961	1902	3804	5706	SO:0001583	missense	4985	exon1			GCGCCTGCCCCAG	U10504	CCDS329.1	1p36.1-p34.3	2012-08-08			ENSG00000116329	ENSG00000116329		"""GPCR / Class A : Opioid receptors"""	8153	protein-coding gene	gene with protein product		165195				8415697	Standard	NM_000911		Approved		uc001brf.1	P41143	OTTHUMG00000003646	ENST00000234961.2:c.80G>T	1.37:g.29138975G>T	ENSP00000234961:p.Cys27Phe	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	15	14	NM_000911	0	0	0	0	0	B5B0B8	Missense_Mutation	SNP	ENST00000234961.2	37	CCDS329.1	2035	0.9317765567765568	474	0.9634146341463414	331	0.914364640883978	572	1.0	658	0.8680738786279684	T	0.016	-1.513433	0.00975	0.969769	0.888801	ENSG00000116329	ENST00000234961;ENST00000536280	T	0.67698	-0.28	4.0	2.89	0.33648	.	1.802200	0.02327	N	0.073605	T	0.00012	0.0000	N	0.01874	-0.695	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.41342	-0.9514	9	0.09338	T	0.73	.	3.8109	0.08796	0.0:0.1144:0.2238:0.6618	rs1042114;rs59349662;rs1042114	27	P41143	OPRD_HUMAN	F	27	ENSP00000234961:C27F	ENSP00000234961:C27F	C	+	2	0	OPRD1	29011562	0.002000	0.14202	0.992000	0.48379	0.116000	0.19942	0.521000	0.22893	0.713000	0.32060	-0.694000	0.03704	TGC	G|0.061;T|0.939		0.771	OPRD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010330.1	NM_000911	
RSBN1	54665	hgsc.bcm.edu	37	1	114354654	114354654	+	Silent	SNP	T	T	C	rs3195954	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr1:114354654T>C	ENST00000261441.5	-	1	444	c.381A>G	c.(379-381)ccA>ccG	p.P127P	RP5-1073O3.2_ENST00000429398.1_RNA|RP5-1073O3.2_ENST00000418238.1_RNA	NM_018364.3	NP_060834.2	Q5VWQ0	RSBN1_HUMAN	round spermatid basic protein 1	127	Pro-rich.					nucleus (GO:0005634)				breast(1)|endometrium(2)|large_intestine(4)|lung(16)|ovary(1)|prostate(3)|urinary_tract(2)	29	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CTGCATTCGTTGGCGGCAGCG	0.746													T|||	610	0.121805	0.0045	0.1311	5008	,	,		11529	0.2282		0.1869	False		,,,				2504	0.0971				p.P127P		.											.	RSBN1-91	0			c.A381G						.	T		149,4053		2,145,1954	13.0	24.0	21.0		381	-4.9	0.5	1	dbSNP_105	21	1412,6854		115,1182,2836	no	coding-synonymous	RSBN1	NM_018364.3		117,1327,4790	CC,CT,TT		17.082,3.5459,12.5201		127/803	114354654	1561,10907	2101	4133	6234	SO:0001819	synonymous_variant	54665	exon1			ATTCGTTGGCGGC	AK002082	CCDS862.1	1p13.1	2008-02-05			ENSG00000081019	ENSG00000081019			25642	protein-coding gene	gene with protein product		615858				12477932	Standard	NM_018364		Approved	FLJ11220, ROSBIN	uc001edq.3	Q5VWQ0	OTTHUMG00000011938	ENST00000261441.5:c.381A>G	1.37:g.114354654T>C		Somatic	4	0		WXS	Illumina GAIIx	Phase_I	26	25	NM_018364	0	0	1	2	1	A8K937|Q6AI21|Q8TC33|Q9HA80|Q9NUP6	Silent	SNP	ENST00000261441.5	37	CCDS862.1																																																																																			T|0.861;C|0.139		0.746	RSBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033022.2	NM_018364	
THEM4	117145	hgsc.bcm.edu	37	1	151881885	151881885	+	Missense_Mutation	SNP	A	A	C	rs3748805	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr1:151881885A>C	ENST00000368814.3	-	1	399	c.50T>G	c.(49-51)cTg>cGg	p.L17R	THEM4_ENST00000489410.1_Missense_Mutation_p.L17R	NM_053055.4	NP_444283.2	Q5T1C6	THEM4_HUMAN	thioesterase superfamily member 4	17			L -> R (in dbSNP:rs3748805). {ECO:0000269|PubMed:11598301, ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:17013611, ECO:0000269|Ref.4}.		epidermal growth factor receptor signaling pathway (GO:0007173)|fatty acid metabolic process (GO:0006631)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|protein kinase B signaling (GO:0043491)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)	cell projection (GO:0042995)|cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	palmitoyl-CoA hydrolase activity (GO:0016290)			endometrium(1)|large_intestine(4)|lung(3)|urinary_tract(1)	9	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			TACTGGCGGCAGGCACAGAGC	0.741													C|||	4622	0.922923	0.8986	0.9092	5008	,	,		8223	0.9494		0.9155	False		,,,				2504	0.9458				p.L17R		.											.	THEM4-522	0			c.T50G						.						1.0	1.0	1.0					1																	151881885		1068	2473	3541	SO:0001583	missense	117145	exon1			GGCGGCAGGCACA	AJ313515	CCDS1006.1	1q21.3	2008-02-05			ENSG00000159445	ENSG00000159445			17947	protein-coding gene	gene with protein product	"""C-terminal modulator protein"""	606388				11598301	Standard	NM_053055		Approved	CTMP	uc001ezj.2	Q5T1C6	OTTHUMG00000013049	ENST00000368814.3:c.50T>G	1.37:g.151881885A>C	ENSP00000357804:p.Leu17Arg	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_053055	0	0	0	13	13	B2RBX2|Q96KR2	Missense_Mutation	SNP	ENST00000368814.3	37	CCDS1006.1	2023	0.9262820512820513	453	0.9207317073170732	320	0.8839779005524862	545	0.9527972027972028	705	0.9300791556728232	C	0.562	-0.845033	0.02671	.	.	ENSG00000159445	ENST00000368814;ENST00000489410	T;T	0.25579	2.45;1.79	1.92	-0.278	0.12894	.	16.336300	0.02935	N	0.139768	T	0.02455	0.0075	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.21143	-1.0254	9	0.10111	T	0.7	0.3431	0.4569	0.00510	0.2457:0.3181:0.2427:0.1934	rs3748805;rs17855960	17	Q5T1C6	THEM4_HUMAN	R	17	ENSP00000357804:L17R;ENSP00000433304:L17R	ENSP00000357804:L17R	L	-	2	0	THEM4	150148509	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.350000	0.07721	-0.432000	0.07297	-0.358000	0.07595	CTG	T|0.073;G|0.921		0.741	THEM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036615.1	NM_053055	
ITLN2	142683	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	160922445	160922445	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr1:160922445C>A	ENST00000368029.3	-	3	215	c.158G>T	c.(157-159)tGc>tTc	p.C53F	ITLN2_ENST00000494442.1_5'Flank|RP11-544M22.1_ENST00000356006.3_RNA	NM_080878.2	NP_543154.1	Q8WWU7	ITLN2_HUMAN	intelectin 2	53	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.					extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)			endometrium(4)|large_intestine(4)|lung(5)|ovary(1)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(1)	19	all_cancers(52;2.99e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			GATTTCTTTGCAGCTTCTAGG	0.473																																					p.C53F		.											.	ITLN2-91	0			c.G158T						.						111.0	106.0	108.0					1																	160922445		2203	4300	6503	SO:0001583	missense	142683	exon3			TCTTTGCAGCTTC	AY065973	CCDS1212.1	1q22-q23.5	2013-02-06			ENSG00000158764	ENSG00000158764		"""Fibrinogen C domain containing"""	20599	protein-coding gene	gene with protein product		609874				11181563	Standard	NM_080878		Approved	HL-2	uc001fxd.3	Q8WWU7	OTTHUMG00000028605	ENST00000368029.3:c.158G>T	1.37:g.160922445C>A	ENSP00000357008:p.Cys53Phe	Somatic	78	0		WXS	Illumina GAIIx	Phase_I	111	41	NM_080878	0	0	0	0	0	Q17RR2|Q5VYI0	Missense_Mutation	SNP	ENST00000368029.3	37	CCDS1212.1	.	.	.	.	.	.	.	.	.	.	C	11.08	1.534235	0.27475	.	.	ENSG00000158764	ENST00000368029	D	0.87491	-2.26	3.95	1.9	0.25705	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1 (1);	0.000000	0.64402	U	0.000020	D	0.94833	0.8331	H	0.98721	4.31	0.37910	D	0.931331	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.94798	0.7968	10	0.87932	D	0	-14.7516	10.4569	0.44557	0.3456:0.6544:0.0:0.0	.	52;53	A6NI51;Q8WWU7	.;ITLN2_HUMAN	F	53	ENSP00000357008:C53F	ENSP00000357008:C53F	C	-	2	0	ITLN2	159189069	1.000000	0.71417	1.000000	0.80357	0.060000	0.15804	0.664000	0.25068	0.830000	0.34757	0.561000	0.74099	TGC	.		0.473	ITLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071465.1	NM_080878	
C1orf106	55765	hgsc.bcm.edu	37	1	200880978	200880978	+	Missense_Mutation	SNP	C	C	T	rs296520	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr1:200880978C>T	ENST00000367342.4	+	9	1812	c.1612C>T	c.(1612-1614)Cgc>Tgc	p.R538C	C1orf106_ENST00000413687.2_Missense_Mutation_p.R453C	NM_018265.3	NP_060735.3	Q3KP66	CA106_HUMAN	chromosome 1 open reading frame 106	538			R -> C (in dbSNP:rs296520). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.							endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(2)	21						GTGGGAGCTGCGCCGCGCAGC	0.736													T|||	3966	0.791933	0.6089	0.8213	5008	,	,		12017	0.997		0.7256	False		,,,				2504	0.8753				p.R552C		.											.	C1orf106-93	0			c.C1654T						.	T	CYS/ARG,CYS/ARG	2547,1503		890,767,368	5.0	7.0	6.0		1357,1612	0.8	0.0	1	dbSNP_79	6	5587,2355		2124,1339,508	no	missense,missense	C1orf106	NM_001142569.2,NM_018265.3	180,180	3014,2106,876	TT,TC,CC		29.6525,37.1111,32.1714	benign,benign	453/579,538/664	200880978	8134,3858	2025	3971	5996	SO:0001583	missense	55765	exon9			GAGCTGCGCCGCG	AK001763	CCDS44292.1	1q32.1	2011-02-15			ENSG00000163362	ENSG00000163362			25599	protein-coding gene	gene with protein product						14702039	Standard	NM_018265		Approved	FLJ10901	uc001gvo.4	Q3KP66	OTTHUMG00000035789	ENST00000367342.4:c.1612C>T	1.37:g.200880978C>T	ENSP00000356311:p.Arg538Cys	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	39	23	NM_018265	0	0	0	0	0	B4E1K9|E9PFY0|Q9NV65|Q9NVI0	Missense_Mutation	SNP	ENST00000367342.4	37		1677	0.7678571428571429	261	0.5304878048780488	285	0.787292817679558	569	0.9947552447552448	562	0.741424802110818	T	0.366	-0.936884	0.02340	0.628889	0.703475	ENSG00000163362	ENST00000367342;ENST00000413687	T;T	0.28454	1.61;1.61	3.39	0.759	0.18438	.	0.912041	0.09365	N	0.812206	T	0.00012	0.0000	N	0.01576	-0.805	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.16188	-1.0411	9	0.29301	T	0.29	-23.0614	3.796	0.08740	0.0:0.2241:0.1856:0.5903	rs296520;rs7519373;rs56757010	538	Q3KP66	CA106_HUMAN	C	538;453	ENSP00000356311:R538C;ENSP00000392105:R453C	ENSP00000356311:R538C	R	+	1	0	C1orf106	199147601	0.004000	0.15560	0.002000	0.10522	0.007000	0.05969	-0.731000	0.04909	-0.124000	0.11724	-0.381000	0.06696	CGC	C|0.242;T|0.758		0.736	C1orf106-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000087057.2	NM_018265	
TATDN3	128387	broad.mit.edu	37	1	212988479	212988479	+	Missense_Mutation	SNP	G	G	A	rs147372063	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr1:212988479G>A	ENST00000366974.4	+	10	900	c.806G>A	c.(805-807)cGa>cAa	p.R269Q	TATDN3_ENST00000525569.1_3'UTR|TATDN3_ENST00000366973.4_Missense_Mutation_p.R268Q|TATDN3_ENST00000532324.1_Missense_Mutation_p.R276Q|TATDN3_ENST00000526641.1_Missense_Mutation_p.R248Q|TATDN3_ENST00000526997.1_3'UTR|TATDN3_ENST00000531963.1_3'UTR	NM_001042552.2|NM_001042553.2|NM_001146169.1|NM_001146171.1	NP_001036017.1|NP_001036018.1|NP_001139641.1|NP_001139643.1	Q17R31	TATD3_HUMAN	TatD DNase domain containing 3	269					DNA catabolic process (GO:0006308)	intracellular organelle (GO:0043229)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(2)|lung(6)	9				OV - Ovarian serous cystadenocarcinoma(81;0.00699)|all cancers(67;0.0118)|GBM - Glioblastoma multiforme(131;0.0801)|Epithelial(68;0.104)		CCTAAGCTCCGACACTTGCTC	0.393													G|||	3	0.000599042	0.0	0.0014	5008	,	,		18700	0.0		0.001	False		,,,				2504	0.001				p.R276Q		.											.	TATDN3-22	0			c.G827A						.	G	GLN/ARG,GLN/ARG,,GLN/ARG,GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	91.0	92.0	91.0		806,803,,743,827	-9.4	0.0	1	dbSNP_134	91	8,8592	6.4+/-24.3	0,8,4292	yes	missense,missense,utr-3,missense,missense	TATDN3	NM_001042552.2,NM_001042553.2,NM_001146169.1,NM_001146170.1,NM_001146171.1	43,43,,43,43	0,9,6494	AA,AG,GG		0.093,0.0227,0.0692	benign,benign,,benign,benign	269/275,268/274,,248/254,276/282	212988479	9,12997	2203	4300	6503	SO:0001583	missense	128387	exon10			AGCTCCGACACTT	AL832248	CCDS31019.1, CCDS41465.1, CCDS53475.1, CCDS53476.1, CCDS53477.1	1q32.3	2008-02-05			ENSG00000203705	ENSG00000203705			27010	protein-coding gene	gene with protein product							Standard	NM_001042552		Approved		uc001hjo.2	Q17R31	OTTHUMG00000036805	ENST00000366974.4:c.806G>A	1.37:g.212988479G>A	ENSP00000355941:p.Arg269Gln	Somatic	64	2		WXS	Illumina GAIIx	Phase_I	78	4	NM_001146171	0	0	46	46	0	A6NGS3|B7Z1C1|B7Z978|B7ZLQ6|E9PJE5|E9PNH3|G3V151|Q4G0L1	Missense_Mutation	SNP	ENST00000366974.4	37	CCDS31019.1	2	9.157509157509158E-4	0	0.0	1	0.0027624309392265192	0	0.0	1	0.0013192612137203166	G	11.21	1.570678	0.28003	2.27E-4	9.3E-4	ENSG00000203705	ENST00000532324;ENST00000366974;ENST00000526641;ENST00000366973	.	.	.	5.3	-9.4	0.00616	.	0.608178	0.17249	N	0.181233	T	0.16128	0.0388	N	0.03608	-0.345	0.09310	N	0.999998	B;B;B;B;B	0.09022	0.0;0.001;0.002;0.002;0.001	B;B;B;B;B	0.04013	0.0;0.0;0.001;0.0;0.0	T	0.12734	-1.0536	9	0.16420	T	0.52	-11.3573	18.6287	0.91350	0.7584:0.0:0.2416:0.0	.	216;248;276;268;269	B7Z2Z9;E9PNH3;G3V151;Q17R31-2;Q17R31	.;.;.;.;TATD3_HUMAN	Q	276;269;248;268	.	ENSP00000355940:R268Q	R	+	2	0	TATDN3	211055102	0.000000	0.05858	0.000000	0.03702	0.653000	0.38743	-0.347000	0.07750	-1.988000	0.00980	-0.251000	0.11542	CGA	G|0.999;A|0.001		0.393	TATDN3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000089396.2	XM_375838	
KCTD3	51133	hgsc.bcm.edu	37	1	215741053	215741053	+	Missense_Mutation	SNP	T	T	G	rs2275768	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr1:215741053T>G	ENST00000259154.4	+	1	319	c.25T>G	c.(25-27)Ttc>Gtc	p.F9V		NM_016121.3	NP_057205.2	Q9Y597	KCTD3_HUMAN	potassium channel tetramerization domain containing 3	9			F -> V (in dbSNP:rs2275768). {ECO:0000269|PubMed:15489334}.		protein homooligomerization (GO:0051260)					breast(4)|endometrium(2)|kidney(1)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(1)	33				all cancers(67;0.0164)|OV - Ovarian serous cystadenocarcinoma(81;0.019)|GBM - Glioblastoma multiforme(131;0.0862)|Epithelial(68;0.13)		CTGCGGCAGCTTCCCCGCGGC	0.761													T|||	1459	0.291334	0.0605	0.2291	5008	,	,		8959	0.4276		0.2853	False		,,,				2504	0.5133				p.F9V		.											.	KCTD3-93	0			c.T25G						.	T	VAL/PHE	232,2814		17,198,1308	3.0	5.0	5.0		25	1.6	0.8	1	dbSNP_100	5	1189,4951		136,917,2017	no	missense	KCTD3	NM_016121.3	50	153,1115,3325	GG,GT,TT		19.3648,7.6165,15.4692	benign	9/816	215741053	1421,7765	1523	3070	4593	SO:0001583	missense	51133	exon1			GGCAGCTTCCCCG	AK024547	CCDS1515.1	1q41	2013-06-20	2013-06-20		ENSG00000136636	ENSG00000136636			21305	protein-coding gene	gene with protein product		613272	"""potassium channel tetramerisation domain containing 3"""			10508479	Standard	NM_016121		Approved	NY-REN-45	uc001hks.3	Q9Y597	OTTHUMG00000037019	ENST00000259154.4:c.25T>G	1.37:g.215741053T>G	ENSP00000259154:p.Phe9Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	18	18	NM_016121	0	0	0	6	6	A0AV15|D3DTA6|Q49AG7|Q504Q9|Q6PJN6|Q8ND58|Q8NDJ0|Q8WX16	Missense_Mutation	SNP	ENST00000259154.4	37	CCDS1515.1	595	0.2724358974358974	34	0.06910569105691057	93	0.2569060773480663	249	0.4353146853146853	219	0.28891820580474936	T	10.24	1.294537	0.23564	0.076165	0.193648	ENSG00000136636	ENST00000259154;ENST00000366945	T	0.36520	1.25	2.8	1.63	0.23807	.	0.611401	0.14267	U	0.330439	T	0.00012	0.0000	L	0.27053	0.805	0.50813	P	1.0900000000002574E-4	B;B	0.12013	0.005;0.003	B;B	0.08055	0.003;0.001	T	0.48115	-0.9063	9	0.23891	T	0.37	-7.5445	6.7109	0.23276	0.0:0.2267:0.0:0.7733	rs2275768;rs17845401;rs17858259	9;9	Q9Y597-2;Q9Y597	.;KCTD3_HUMAN	V	9	ENSP00000259154:F9V	ENSP00000259154:F9V	F	+	1	0	KCTD3	213807676	0.045000	0.20229	0.833000	0.33012	0.447000	0.32167	0.628000	0.24522	0.293000	0.22520	0.254000	0.18369	TTC	T|0.721;G|0.279		0.761	KCTD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089871.2	NM_016121	
KCTD3	51133	ucsc.edu;bcgsc.ca	37	1	215781465	215781465	+	Silent	SNP	C	C	A			TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr1:215781465C>A	ENST00000259154.4	+	14	1710	c.1416C>A	c.(1414-1416)tcC>tcA	p.S472S		NM_016121.3	NP_057205.2	Q9Y597	KCTD3_HUMAN	potassium channel tetramerization domain containing 3	472					protein homooligomerization (GO:0051260)					breast(4)|endometrium(2)|kidney(1)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(1)	33				all cancers(67;0.0164)|OV - Ovarian serous cystadenocarcinoma(81;0.019)|GBM - Glioblastoma multiforme(131;0.0862)|Epithelial(68;0.13)		AGATACTATCCCTGGAGGAGA	0.413																																					p.S472S		.											.	KCTD3-93	0			c.C1416A						.						142.0	132.0	136.0					1																	215781465		2203	4299	6502	SO:0001819	synonymous_variant	51133	exon14			ACTATCCCTGGAG	AK024547	CCDS1515.1	1q41	2013-06-20	2013-06-20		ENSG00000136636	ENSG00000136636			21305	protein-coding gene	gene with protein product		613272	"""potassium channel tetramerisation domain containing 3"""			10508479	Standard	NM_016121		Approved	NY-REN-45	uc001hks.3	Q9Y597	OTTHUMG00000037019	ENST00000259154.4:c.1416C>A	1.37:g.215781465C>A		Somatic	162	2		WXS	Illumina GAIIx	Phase_I	181	77	NM_016121	0	0	64	97	33	A0AV15|D3DTA6|Q49AG7|Q504Q9|Q6PJN6|Q8ND58|Q8NDJ0|Q8WX16	Silent	SNP	ENST00000259154.4	37	CCDS1515.1	.	.	.	.	.	.	.	.	.	.	C	8.682	0.905418	0.17760	.	.	ENSG00000136636	ENST00000452413	.	.	.	5.55	-2.55	0.06288	.	.	.	.	.	T	0.42471	0.1204	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.28933	-1.0028	4	.	.	.	-15.6079	3.9881	0.09525	0.115:0.4396:0.1178:0.3276	.	.	.	.	T	104	.	.	P	+	1	0	KCTD3	213848088	0.301000	0.24444	0.719000	0.30619	0.882000	0.50991	-0.121000	0.10643	-0.783000	0.04534	-0.885000	0.02943	CCT	.		0.413	KCTD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089871.2	NM_016121	
OBSCN	84033	hgsc.bcm.edu	37	1	228504670	228504670	+	Missense_Mutation	SNP	C	C	T	rs11810627	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr1:228504670C>T	ENST00000422127.1	+	51	13590	c.13546C>T	c.(13546-13548)Cgg>Tgg	p.R4516W	OBSCN_ENST00000284548.11_Missense_Mutation_p.R4516W|OBSCN_ENST00000366707.4_Missense_Mutation_p.R2150W|OBSCN_ENST00000366709.4_Missense_Mutation_p.R1635W|OBSCN_ENST00000570156.2_Missense_Mutation_p.R5473W	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	4516	Ig-like 46.		R -> W (in dbSNP:rs11810627).		apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GGCCTCTGCGCGGCTCACCGT	0.736													c|||	1654	0.330272	0.2791	0.4006	5008	,	,		13971	0.249		0.4861	False		,,,				2504	0.273				p.R5473W		.											.	OBSCN-403	0			c.C16417T						.		TRP/ARG,TRP/ARG	923,2833		165,593,1120	5.0	6.0	6.0		13546,13546	-1.0	0.0	1	dbSNP_120	6	3333,4245		861,1611,1317	yes	missense,missense	OBSCN	NM_001098623.1,NM_052843.2	101,101	1026,2204,2437	TT,TC,CC		43.9826,24.574,37.5507	probably-damaging,probably-damaging	4516/7969,4516/6621	228504670	4256,7078	1878	3789	5667	SO:0001583	missense	84033	exon62			TCTGCGCGGCTCA	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.13546C>T	1.37:g.228504670C>T	ENSP00000409493:p.Arg4516Trp	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	61	61	NM_001271223	0	0	0	0	0	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	CCDS58065.1	774	0.3543956043956044	137	0.2784552845528455	144	0.39779005524861877	134	0.23426573426573427	359	0.4736147757255937	c	11.94	1.787178	0.31593	0.24574	0.439826	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709	T;T;T;T	0.77098	-1.07;-1.07;0.2;0.2	5.41	-0.971	0.10303	Immunoglobulin subtype (1);Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.167607	0.36519	N	0.002550	T	0.00012	0.0000	L	0.41824	1.3	0.50632	P	1.1499999999997623E-4	B;B	0.22541	0.071;0.067	B;B	0.12156	0.007;0.007	T	0.42275	-0.9461	9	0.45353	T	0.12	.	10.3619	0.43998	0.6084:0.317:0.0:0.0747	rs11810627	4516;4516	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	W	4516;4516;2150;1635	ENSP00000284548:R4516W;ENSP00000409493:R4516W;ENSP00000355668:R2150W;ENSP00000355670:R1635W	ENSP00000284548:R4516W	R	+	1	2	OBSCN	226571293	0.968000	0.33430	0.013000	0.15412	0.016000	0.09150	2.032000	0.41127	-0.028000	0.13850	0.550000	0.68814	CGG	C|0.643;T|0.357		0.736	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
FAM25C	644054	broad.mit.edu	37	10	49207753	49207753	+	Missense_Mutation	SNP	C	C	A	rs566948491		TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr10:49207753C>A	ENST00000342763.4	-	1	65	c.47G>T	c.(46-48)cGc>cTc	p.R16L	FAM25C_ENST00000479781.1_5'Flank	NM_001137548.1	NP_001131020.1	B3EWG5	FM25C_HUMAN	family with sequence similarity 25, member C	16																	CTTCTCGGTGCGGTGGGCCAG	0.667																																					p.R16L		.											.	.	0			c.G47T						.																																			SO:0001583	missense	100132929	exon1			TCGGTGCGGTGGG			10q11.22	2008-08-13			ENSG00000188279				23586	protein-coding gene	gene with protein product							Standard	NM_001137548		Approved	bA164N7.4	uc010qfw.2	B3EWG5	OTTHUMG00000018165	ENST00000342763.4:c.47G>T	10.37:g.49207753C>A	ENSP00000341481:p.Arg16Leu	Somatic	246	1		WXS	Illumina GAIIx	Phase_I	327	33	NM_001137556	0	0	0	0	0	B2RV02|Q5VTM1	Missense_Mutation	SNP	ENST00000342763.4	37	CCDS44383.1	.	.	.	.	.	.	.	.	.	.	.	6.667	0.491542	0.12702	.	.	ENSG00000188279	ENST00000445114	.	.	.	0.569	-1.14	0.09741	.	0.124786	0.37715	N	0.001977	T	0.36303	0.0962	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.30387	-0.9980	5	0.62326	D	0.03	-1.0462	.	.	.	.	.	.	.	L	16	.	ENSP00000400040:R16L	R	-	2	0	FAM25C	48877759	0.806000	0.28996	0.032000	0.17829	0.003000	0.03518	1.232000	0.32636	-0.164000	0.10927	-1.709000	0.00716	CGC	.		0.667	FAM25C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047913.2		
KCNMA1	3778	hgsc.bcm.edu	37	10	78729786	78729786	+	Frame_Shift_Del	DEL	T	T	-			TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr10:78729786delT	ENST00000286628.8	-	20	2305	c.2306delA	c.(2305-2307)aagfs	p.K769fs	KCNMA1_ENST00000372440.1_Frame_Shift_Del_p.K711fs|KCNMA1_ENST00000406533.3_Frame_Shift_Del_p.K773fs|KCNMA1_ENST00000372443.1_Frame_Shift_Del_p.K711fs|KCNMA1_ENST00000286627.5_Frame_Shift_Del_p.K711fs|KCNMA1_ENST00000404771.3_Frame_Shift_Del_p.K769fs|KCNMA1_ENST00000354353.5_Frame_Shift_Del_p.K772fs|RP11-443A13.5_ENST00000458661.2_RNA|RP11-443A13.5_ENST00000600782.1_RNA|KCNMA1_ENST00000404857.1_Frame_Shift_Del_p.K711fs|RP11-443A13.5_ENST00000598613.1_RNA	NM_001161352.1	NP_001154824.1	Q12791	KCMA1_HUMAN	potassium large conductance calcium-activated channel, subfamily M, alpha member 1	769					blood coagulation (GO:0007596)|cellular potassium ion homeostasis (GO:0030007)|micturition (GO:0060073)|negative regulation of cell volume (GO:0045794)|positive regulation of apoptotic process (GO:0043065)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|response to calcium ion (GO:0051592)|response to carbon monoxide (GO:0034465)|response to hypoxia (GO:0001666)|response to osmotic stress (GO:0006970)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	actin binding (GO:0003779)|calcium-activated potassium channel activity (GO:0015269)|large conductance calcium-activated potassium channel activity (GO:0060072)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)	p.K711fs*17(1)		breast(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(17)|lung(23)|ovary(2)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	68	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Chlorzoxazone(DB00356)|Cromoglicic acid(DB01003)|Diazoxide(DB01119)|Halothane(DB01159)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Miconazole(DB01110)|Procaine(DB00721)	ATTCCGTTGCTTTTTTTTTGG	0.502																																					p.K769fs		.											.	KCNMA1-93	1	Deletion - Frameshift(1)	ovary(1)	c.2306delA						.						249.0	212.0	225.0					10																	78729786		2203	4300	6503	SO:0001589	frameshift_variant	3778	exon20			CGTTGCTTTTTTT	U11717	CCDS7352.1, CCDS60569.1, CCDS60571.1, CCDS60572.1, CCDS73156.1	10q22	2012-07-05			ENSG00000156113	ENSG00000156113		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6284	protein-coding gene	gene with protein product	"""BK channel alpha subunit"""	600150		SLO		7987297, 16382103	Standard	NM_002247		Approved	KCa1.1, mSLO1	uc001jxn.3	Q12791	OTTHUMG00000018543	ENST00000286628.8:c.2306delA	10.37:g.78729786delT	ENSP00000286628:p.Lys769fs	Somatic	181	5		WXS	Illumina GAIIx	Phase_I	194	12	NM_001161352	0	0	0	0	0	F8WA96|Q12886|Q12917|Q12921|Q12960|Q13150|Q5JQ23|Q5SQR9|Q96LG8|Q9UBB0|Q9UCX0|Q9UQK6	Frame_Shift_Del	DEL	ENST00000286628.8	37																																																																																				.		0.502	KCNMA1-009	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000048885.3	NM_002247	
FAM178A	55719	hgsc.bcm.edu;bcgsc.ca	37	10	102676854	102676854	+	Frame_Shift_Del	DEL	T	T	-			TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr10:102676854delT	ENST00000238961.4	+	3	1254	c.712delT	c.(712-714)ttgfs	p.L238fs	FAM178A_ENST00000370269.3_Frame_Shift_Del_p.L238fs|FAM178A_ENST00000370271.3_Frame_Shift_Del_p.L238fs	NM_018121.3	NP_060591.3	Q8IX21	F178A_HUMAN	family with sequence similarity 178, member A	238						chromatin (GO:0000785)|extracellular space (GO:0005615)|nucleus (GO:0005634)											TAAATTCCAGTTGTCACTAGC	0.483																																					p.L238fs		.											.	.	0			c.712delT						.						60.0	61.0	61.0					10																	102676854		2203	4300	6503	SO:0001589	frameshift_variant	55719	exon3			TTCCAGTTGTCAC	AF460991	CCDS7500.1, CCDS44470.1, CCDS65918.1	10q24.31	2008-07-18	2008-07-18	2008-07-18	ENSG00000119906	ENSG00000119906			17814	protein-coding gene	gene with protein product		610348	"""chromosome 10 open reading frame 6"""	C10orf6		12459258	Standard	NM_018121		Approved	FLJ10512, FLJ25012	uc001krs.3	Q8IX21	OTTHUMG00000018919	ENST00000238961.4:c.712delT	10.37:g.102676854delT	ENSP00000238961:p.Leu238fs	Somatic	235	1		WXS	Illumina GAIIx	Phase_I	171	54	NM_001136123	0	0	0	0	0	A8K950|B1AL17|Q5W0L8|Q6GMU6|Q9NPE8	Frame_Shift_Del	DEL	ENST00000238961.4	37	CCDS7500.1																																																																																			.		0.483	FAM178A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049897.3		
NFKB2	4791	hgsc.bcm.edu	37	10	104159196	104159196	+	Silent	SNP	A	A	G	rs4919633	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr10:104159196A>G	ENST00000369966.3	+	13	1519	c.1269A>G	c.(1267-1269)ccA>ccG	p.P423P	NFKB2_ENST00000189444.6_Silent_p.P423P|NFKB2_ENST00000428099.1_Silent_p.P423P|NFKB2_ENST00000336486.5_3'UTR	NM_001077494.2	NP_001070962.1	Q00653	NFKB2_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)	423					extracellular matrix organization (GO:0030198)|follicular dendritic cell differentiation (GO:0002268)|germinal center formation (GO:0002467)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|spleen development (GO:0048536)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	Bcl3/NF-kappaB2 complex (GO:0033257)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(10)|skin(2)	23		Colorectal(252;0.00957)		Epithelial(162;3.4e-08)|all cancers(201;6.41e-07)	Acetylsalicylic acid(DB00945)|Glucosamine(DB01296)	CCGCGGAGCCAAGCGCCCCCT	0.786			T	IGH@	B-NHL								G|||	4942	0.986821	0.9539	0.9942	5008	,	,		10589	1.0		0.999	False		,,,				2504	1.0				p.P423P		.		Dom	yes		10	10q24	4791	nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)		L	.	NFKB2-522	0			c.A1269G						.	G	,,	2876,76		1401,74,1	3.0	5.0	4.0		1269,1269,1269	-4.9	0.0	10	dbSNP_111	4	6622,2		3310,2,0	no	coding-synonymous,coding-synonymous,coding-synonymous	NFKB2	NM_001077493.1,NM_001077494.1,NM_002502.3	,,	4711,76,1	GG,GA,AA		0.0302,2.5745,0.8145	,,	423/900,423/901,423/900	104159196	9498,78	1476	3312	4788	SO:0001819	synonymous_variant	4791	exon13			GGAGCCAAGCGCC	X61498	CCDS41564.1, CCDS41565.1	10q24	2013-01-10			ENSG00000077150	ENSG00000077150		"""Ankyrin repeat domain containing"""	7795	protein-coding gene	gene with protein product		164012				1876189	Standard	XM_005269860		Approved	LYT-10, p52, p105, NF-kB2	uc001kvb.4	Q00653	OTTHUMG00000018962	ENST00000369966.3:c.1269A>G	10.37:g.104159196A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	18	18	NM_001077494	0	0	0	9	9	A8K9D9|D3DR83|Q04860|Q9BU75|Q9H471|Q9H472	Silent	SNP	ENST00000369966.3	37	CCDS41564.1																																																																																			A|0.009;G|0.991		0.786	NFKB2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050080.2		
PWWP2B	170394	hgsc.bcm.edu	37	10	134219066	134219066	+	Silent	SNP	G	G	C	rs76595411	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr10:134219066G>C	ENST00000305233.5	+	2	1121	c.1062G>C	c.(1060-1062)gtG>gtC	p.V354V	PWWP2B_ENST00000368609.4_Silent_p.V354V	NM_138499.3	NP_612508.3	Q6NUJ5	PWP2B_HUMAN	PWWP domain containing 2B	354										central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(5)|urinary_tract(1)	9		all_cancers(35;6.69e-12)|all_epithelial(44;1.55e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Breast(234;0.106)|Colorectal(31;0.109)|Melanoma(40;0.123)|Glioma(114;0.203)|all_hematologic(284;0.224)		OV - Ovarian serous cystadenocarcinoma(35;7.49e-05)|Epithelial(32;0.00016)|all cancers(32;0.000186)		CCGAGCTGGTGGGGGAGCTGA	0.726													G|||	150	0.0299521	0.0083	0.0504	5008	,	,		14238	0.002		0.0636	False		,,,				2504	0.0389				p.V354V		.											.	PWWP2B-90	0			c.G1062C						.	G	,	58,4234		0,58,2088	21.0	26.0	24.0		1062,1062	-1.9	0.8	10	dbSNP_132	24	487,7941		17,453,3744	no	coding-synonymous,coding-synonymous	PWWP2B	NM_001098637.1,NM_138499.3	,	17,511,5832	CC,CG,GG		5.7784,1.3514,4.2846	,	354/500,354/591	134219066	545,12175	2146	4214	6360	SO:0001819	synonymous_variant	170394	exon2			GCTGGTGGGGGAG	AK128663	CCDS7667.2	10q26.3	2009-06-03	2007-10-22	2007-10-22	ENSG00000171813	ENSG00000171813			25150	protein-coding gene	gene with protein product			"""PWWP domain containing 2"""	PWWP2			Standard	NM_001098637		Approved	bA432J24.1, FLJ46823	uc001lll.4	Q6NUJ5	OTTHUMG00000019286	ENST00000305233.5:c.1062G>C	10.37:g.134219066G>C		Somatic	3	0		WXS	Illumina GAIIx	Phase_I	22	5	NM_001098637	0	0	25	32	7	A6NM90|B5MDQ1|H9KV61|Q5SZI0|Q6ZQX5|Q96F43	Silent	SNP	ENST00000305233.5	37	CCDS7667.2																																																																																			G|0.955;C|0.045		0.726	PWWP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051075.3	NM_138499	
MUC2	4583	broad.mit.edu	37	11	1093069	1093069	+	Missense_Mutation	SNP	A	A	G	rs201496058	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr11:1093069A>G	ENST00000441003.2	+	30	4915	c.4888A>G	c.(4888-4890)Aca>Gca	p.T1630A	MUC2_ENST00000359061.5_Missense_Mutation_p.T1597A|MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000361558.6_Intron	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	cccaaccccaacagccatcac	0.627													a|||	2	0.000399361	0.0008	0.0	5008	,	,		11607	0.0		0.001	False		,,,				2504	0.0				p.T1630A		.											.	MUC2-90	0			c.A4888G						.						118.0	160.0	146.0					11																	1093069		1875	3586	5461	SO:0001583	missense	4583	exon30			ACCCCAACAGCCA	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4888A>G	11.37:g.1093069A>G	ENSP00000415183:p.Thr1630Ala	Somatic	78	2		WXS	Illumina GAIIx	Phase_I	112	15	NM_002457	0	0	0	0	0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	A	3.426	-0.117053	0.06838	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.15372	2.43;3.2	1.75	0.602	0.17535	.	.	.	.	.	T	0.04724	0.0128	.	.	.	0.09310	N	1	P	0.36222	0.544	B	0.23716	0.048	T	0.26467	-1.0102	8	0.08599	T	0.76	.	3.1008	0.06325	0.744:0.0:0.256:0.0	.	1630	E7EUV1	.	A	1630;1597	ENSP00000415183:T1630A;ENSP00000351956:T1597A	ENSP00000351956:T1597A	T	+	1	0	MUC2	1083069	0.000000	0.05858	0.002000	0.10522	0.004000	0.04260	0.327000	0.19663	0.841000	0.35020	0.102000	0.15555	ACA	.		0.627	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
WEE1	7465	hgsc.bcm.edu	37	11	9595768	9595768	+	Silent	SNP	C	C	T	rs117347074	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr11:9595768C>T	ENST00000450114.2	+	1	541	c.288C>T	c.(286-288)ccC>ccT	p.P96P	WEE1_ENST00000299613.6_5'Flank	NM_003390.3	NP_003381.1	P30291	WEE1_HUMAN	WEE1 G2 checkpoint kinase	96					blood coagulation (GO:0007596)|establishment of cell polarity (GO:0030010)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|neuron projection morphogenesis (GO:0048812)|regulation of cell cycle (GO:0051726)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	23				all cancers(16;4.59e-09)|Epithelial(150;3.15e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0484)		TGTTGCTGCCCGGCGCCTGCC	0.826													C|||	288	0.057508	0.0658	0.0605	5008	,	,		4788	0.005		0.0527	False		,,,				2504	0.1033				p.P96P		.											.	WEE1-1404	0			c.C288T						.						2.0	2.0	2.0					11																	9595768		1140	2650	3790	SO:0001819	synonymous_variant	7465	exon1			GCTGCCCGGCGCC	X62048	CCDS7800.1, CCDS44536.1	11p15.4	2013-10-21	2013-10-21		ENSG00000166483	ENSG00000166483			12761	protein-coding gene	gene with protein product		193525	"""wee1+ (S. pombe) homolog"", ""WEE1 homolog (S. pombe)"""			1840647	Standard	NM_003390		Approved		uc001mhs.3	P30291	OTTHUMG00000165863	ENST00000450114.2:c.288C>T	11.37:g.9595768C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	6	NM_003390	0	0	0	0	0	B3KVE1|D3DQV0	Silent	SNP	ENST00000450114.2	37	CCDS7800.1																																																																																			C|0.953;T|0.047		0.826	WEE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386757.1	NM_003390	
RAG1	5896	broad.mit.edu;bcgsc.ca	37	11	36596586	36596586	+	Silent	SNP	T	T	C			TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr11:36596586T>C	ENST00000299440.5	+	2	1844	c.1732T>C	c.(1732-1734)Ttg>Ctg	p.L578L		NM_000448.2	NP_000439	P15918	RAG1_HUMAN	recombination activating gene 1	578					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|DNA recombination (GO:0006310)|histone monoubiquitination (GO:0010390)|immune response (GO:0006955)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of thymocyte apoptotic process (GO:0070244)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|pre-B cell allelic exclusion (GO:0002331)|protein autoubiquitination (GO:0051865)|regulation of T cell differentiation (GO:0045580)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)|V(D)J recombination (GO:0033151)	nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	65	all_lung(20;0.226)	all_hematologic(20;0.107)				AGAAGACATCTTGGAAGGCAT	0.478									Familial Hemophagocytic Lymphohistiocytosis																												p.L578L	Pancreas(43;321 1249 3212 48200)|Esophageal Squamous(38;49 1003 17530 24363)	.											.	RAG1-230	0			c.T1732C						.						113.0	95.0	101.0					11																	36596586		2202	4298	6500	SO:0001819	synonymous_variant	5896	exon2	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	GACATCTTGGAAG	M29474	CCDS7902.1	11p13	2014-09-17				ENSG00000166349		"""RING-type (C3HC4) zinc fingers"""	9831	protein-coding gene	gene with protein product	"""recombination activating protein 1"", ""RING finger protein 74"", ""V(D)J recombination-activating protein 1"""	179615				1612612, 1283330	Standard	NM_000448		Approved	RNF74, MGC43321	uc001mwu.4	P15918		ENST00000299440.5:c.1732T>C	11.37:g.36596586T>C		Somatic	194	0		WXS	Illumina GAIIx	Phase_I	238	8	NM_000448	0	0	0	0	0	E9PPC4|Q8IY72|Q8NER2	Silent	SNP	ENST00000299440.5	37	CCDS7902.1																																																																																			.		0.478	RAG1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389535.1	NM_000448	
FNBP4	23360	hgsc.bcm.edu	37	11	47788664	47788669	+	In_Frame_Del	DEL	GGTGGT	GGTGGT	-	rs59413596|rs67450550|rs397711020	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	GGTGGT	GGTGGT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr11:47788664_47788669delGGTGGT	ENST00000263773.5	-	1	184_189	c.172_177delACCACC	c.(172-177)accaccdel	p.TT58del	FNBP4_ENST00000534003.1_5'UTR	NM_015308.2	NP_056123.2	Q8N3X1	FNBP4_HUMAN	formin binding protein 4	58						nucleus (GO:0005634)		p.T58_T59delTT(3)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(12)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	44						CAGTCACCGCGGTGGTGGTGGTCGTC	0.748														1722	0.34385	0.084	0.317	5008	,	,		12964	0.4345		0.4304	False		,,,				2504	0.5317				p.58_59del		.											.	FNBP4-91	3	Deletion - In frame(3)	prostate(1)|breast(1)|central_nervous_system(1)	c.172_177del						.			233,2043		62,109,967						-2.3	0.0		dbSNP_130	3	1924,3380		655,614,1383	no	coding	FNBP4	NM_015308.2		717,723,2350	A1A1,A1R,RR		36.2745,10.2373,28.4565				2157,5423				SO:0001651	inframe_deletion	23360	exon1			CACCGCGGTGGTG	BC037404	CCDS41644.1	11q12.1	2008-02-05			ENSG00000109920	ENSG00000109920			19752	protein-coding gene	gene with protein product		615265				10231032	Standard	NM_015308		Approved	KIAA1014	uc009ylv.3	Q8N3X1	OTTHUMG00000166533	ENST00000263773.5:c.172_177delACCACC	11.37:g.47788670_47788675delGGTGGT	ENSP00000263773:p.Thr58_Thr59del	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	25	11	NM_015308	0	0	0	0	0	Q9H985|Q9NT81|Q9Y2L7	In_Frame_Del	DEL	ENST00000263773.5	37	CCDS41644.1																																																																																			.		0.748	FNBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390237.3		
LRRC10B	390205	hgsc.bcm.edu	37	11	61277031	61277031	+	Silent	SNP	C	C	T	rs1139011	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr11:61277031C>T	ENST00000378075.2	+	1	760	c.561C>T	c.(559-561)ctC>ctT	p.L187L	MIR4488_ENST00000577388.1_RNA	NM_001145077.1	NP_001138549.1	A6NIK2	LR10B_HUMAN	leucine rich repeat containing 10B	187																	TGCACATCCTCGACCTCGACC	0.731													c|||	986	0.196885	0.0068	0.2637	5008	,	,		12936	0.4474		0.0636	False		,,,				2504	0.2853				p.L187L		.											.	.	0			c.C561T						.						5.0	7.0	6.0					11																	61277031		659	1526	2185	SO:0001819	synonymous_variant	390205	exon1			CATCCTCGACCTC		CCDS44621.1	11q12.2	2009-09-08			ENSG00000204950	ENSG00000204950			37215	protein-coding gene	gene with protein product							Standard	NM_001145077		Approved		uc010rlk.2	A6NIK2		ENST00000378075.2:c.561C>T	11.37:g.61277031C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	36	16	NM_001145077	0	0	0	0	0		Silent	SNP	ENST00000378075.2	37	CCDS44621.1																																																																																			C|0.816;T|0.184		0.731	LRRC10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398623.1	NM_001145077	
SNX15	29907	hgsc.bcm.edu	37	11	64809090	64809090	+	IGR	SNP	T	T	G	rs12271134	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr11:64809090T>G	ENST00000377244.3	+	0	1939				SAC3D1_ENST00000530213.1_3'UTR|SAC3D1_ENST00000398846.1_Missense_Mutation_p.L109R|SAC3D1_ENST00000531072.1_Missense_Mutation_p.L109R	NM_013306.4|NM_147777.3	NP_037438.2|NP_680086.2	Q9NRS6	SNX15_HUMAN	sorting nexin 15						intracellular protein transport (GO:0006886)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)	phosphatidylinositol binding (GO:0035091)			endometrium(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	14						CGAGCTGTGCTCCTGGACCTG	0.746													G|||	4995	0.997404	0.9909	0.9986	5008	,	,		9130	1.0		1.0	False		,,,				2504	1.0				p.L109R	Esophageal Squamous(56;269 1304 3324 8253)	.											.	SAC3D1-90	0			c.T326G						.	G	ARG/LEU	2642,10		1316,10,0	2.0	2.0	2.0		326	3.9	0.9	11	dbSNP_120	2	5685,1		2842,1,0	no	missense	SAC3D1	NM_013299.3	102	4158,11,0	GG,GT,TT		0.0176,0.3771,0.1319	benign	109/359	64809090	8327,11	1326	2843	4169	SO:0001628	intergenic_variant	29901	exon1			CTGTGCTCCTGGA	AF175267	CCDS8089.1, CCDS8090.1	11q12	2008-05-22			ENSG00000110025	ENSG00000110025		"""Sorting nexins"""	14978	protein-coding gene	gene with protein product		605964				11208079	Standard	NM_013306		Approved			Q9NRS6	OTTHUMG00000037387		11.37:g.64809090T>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_013299	0	0	0	4	4	E5KQS6|Q9NRS5	Missense_Mutation	SNP	ENST00000377244.3	37	CCDS8089.1	2174	0.9954212454212454	489	0.9939024390243902	361	0.9972375690607734	566	0.9895104895104895	758	1.0	G	5.044	0.193816	0.09599	0.996229	0.999824	ENSG00000168061	ENST00000531072;ENST00000398846;ENST00000301885;ENST00000529996	T;T;T	0.20598	2.06;2.06;2.06	3.9	3.9	0.45041	.	0.000000	0.38272	N	0.001754	T	0.00012	0.0000	N	0.00104	-2.125	0.53688	P	2.8999999999945736E-5	B	0.02656	0.0	B	0.01281	0.0	T	0.37798	-0.9690	9	0.02654	T	1	-10.6158	10.9504	0.47325	0.0:0.0:0.811:0.189	rs12271134	155	A6NKF1	SAC31_HUMAN	R	109;109;154;125	ENSP00000436649:L109R;ENSP00000381824:L109R;ENSP00000436704:L125R	ENSP00000301885:L154R	L	+	2	0	SAC3D1	64565666	1.000000	0.71417	0.924000	0.36721	0.504000	0.33889	3.759000	0.55227	1.003000	0.39130	-0.217000	0.12591	CTC	T|0.005;G|0.995		0.746	SNX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091004.3		
TM7SF2	7108	hgsc.bcm.edu	37	11	64880090	64880090	+	Silent	SNP	G	G	C	rs4930284	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr11:64880090G>C	ENST00000279263.7	+	2	318	c.156G>C	c.(154-156)ccG>ccC	p.P52P	AP003068.9_ENST00000528887.1_RNA|TM7SF2_ENST00000345348.5_Silent_p.P52P|TM7SF2_ENST00000540748.1_5'UTR	NM_003273.2	NP_003264.2	O76062	ERG24_HUMAN	transmembrane 7 superfamily member 2	52					cholesterol biosynthetic process (GO:0006695)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	delta14-sterol reductase activity (GO:0050613)			lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						CGTCCCTGCCGGGGCTGGAGG	0.756													C|||	4990	0.996406	0.9879	0.9986	5008	,	,		10438	1.0		0.999	False		,,,				2504	1.0				p.P52P		.											.	TM7SF2-91	0			c.G156C						.	C		2924,8		1458,8,0	2.0	2.0	2.0		156	-9.8	0.0	11	dbSNP_111	2	6426,0		3213,0,0	no	coding-synonymous	TM7SF2	NM_003273.2		4671,8,0	CC,CG,GG		0.0,0.2729,0.0855		52/419	64880090	9350,8	1466	3213	4679	SO:0001819	synonymous_variant	7108	exon2			CCTGCCGGGGCTG	BC012857	CCDS41669.1, CCDS60846.1	11q13.1	2013-05-23			ENSG00000149809	ENSG00000149809	1.3.1.70		11863	protein-coding gene	gene with protein product	"""delta(14)-sterol reductase"""	603414				9615229, 9286704	Standard	NM_003273		Approved	ANG1, DHCR14A, NET47	uc001oct.4	O76062	OTTHUMG00000165603	ENST00000279263.7:c.156G>C	11.37:g.64880090G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	14	14	NM_003273	0	0	1	299	298	A8K4H0|O95982|Q8IY06|Q96E64|Q96GZ1	Silent	SNP	ENST00000279263.7	37	CCDS41669.1																																																																																			G|0.005;C|0.995		0.756	TM7SF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385234.1	NM_003273	
MAML2	84441	ucsc.edu	37	11	95825383	95825383	+	Silent	SNP	C	C	T	rs113349418|rs141671766|rs60727839	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr11:95825383C>T	ENST00000524717.1	-	2	3096	c.1812G>A	c.(1810-1812)caG>caA	p.Q604Q		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	604					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)		CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				gttgctgctgctgctgctgct	0.527			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid																																p.Q604Q		.		Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	.	MAML2-850	0			c.G1812A						.						19.0	23.0	22.0					11																	95825383		1910	3681	5591	SO:0001819	synonymous_variant	84441	exon2			CTGCTGCTGCTGC	AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.1812G>A	11.37:g.95825383C>T		Somatic	159	0		WXS	Illumina GAIIx	Phase_I	186	37	NM_032427	0	0	43	62	19	A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Silent	SNP	ENST00000524717.1	37	CCDS44714.1																																																																																			C|0.500;T|0.500		0.527	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395540.1		
MAML2	84441	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	11	95825407	95825407	+	Silent	SNP	C	C	T	rs61901862		TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr11:95825407C>T	ENST00000524717.1	-	2	3072	c.1788G>A	c.(1786-1788)caG>caA	p.Q596Q		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	596					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)	p.Q596Q(1)	CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				gctgctgctgctgctgctgtt	0.532			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid																																p.Q596Q		.		Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	.	MAML2-850	1	Substitution - coding silent(1)	kidney(1)	c.G1788A						.						28.0	35.0	33.0					11																	95825407		2119	4148	6267	SO:0001819	synonymous_variant	84441	exon2			CTGCTGCTGCTGC	AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.1788G>A	11.37:g.95825407C>T		Somatic	180	0		WXS	Illumina GAIIx	Phase_I	220	24	NM_032427	0	0	109	121	12	A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Silent	SNP	ENST00000524717.1	37	CCDS44714.1																																																																																			C|0.250;T|0.750		0.532	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395540.1		
PRDM10	56980	broad.mit.edu;bcgsc.ca	37	11	129788483	129788483	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr11:129788483G>A	ENST00000360871.3	-	14	2396	c.2165C>T	c.(2164-2166)aCg>aTg	p.T722M	PRDM10_ENST00000526082.1_Missense_Mutation_p.T640M|PRDM10_ENST00000528746.1_Missense_Mutation_p.T696M|PRDM10_ENST00000358825.5_Missense_Mutation_p.T726M|PRDM10_ENST00000423662.2_Missense_Mutation_p.T640M|PRDM10_ENST00000304538.6_Missense_Mutation_p.T636M	NM_199437.1	NP_955469.1	Q9NQV6	PRD10_HUMAN	PR domain containing 10	726					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			breast(2)|endometrium(6)|kidney(3)|large_intestine(14)|lung(15)|pancreas(2)|skin(1)|stomach(3)|urinary_tract(2)	48	all_hematologic(175;0.0537)	Breast(109;0.000496)|Lung NSC(97;0.000693)|all_lung(97;0.00151)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0174)|Lung(977;0.176)|LUSC - Lung squamous cell carcinoma(976;0.185)		GCACTTGAACGTGAAGCTGTC	0.602																																					p.T726M		.											.	PRDM10-91	0			c.C2177T						.						218.0	200.0	206.0					11																	129788483		2201	4297	6498	SO:0001583	missense	56980	exon15			TTGAACGTGAAGC	AF275817	CCDS8484.1, CCDS8485.1, CCDS44771.1, CCDS44772.1	11q24.3	2013-01-08			ENSG00000170325	ENSG00000170325		"""Zinc fingers, C2H2-type"""	13995	protein-coding gene	gene with protein product	"""PRDM zinc finger transcription factor"", ""PR-domain family member 7"", ""tristanin"""					12175877	Standard	NM_020228		Approved	KIAA1231, PFM7, MGC131802	uc001qfm.3	Q9NQV6	OTTHUMG00000165762	ENST00000360871.3:c.2165C>T	11.37:g.129788483G>A	ENSP00000354118:p.Thr722Met	Somatic	120	0		WXS	Illumina GAIIx	Phase_I	169	8	NM_020228	0	0	0	0	0	B7ZL71|G3XAE5|J3KP23|Q17R90|Q2KHR4|Q863Z2|Q9NXI4|Q9ULI9	Missense_Mutation	SNP	ENST00000360871.3	37	CCDS8484.1	.	.	.	.	.	.	.	.	.	.	G	14.92	2.680446	0.47886	.	.	ENSG00000170325	ENST00000358825;ENST00000304538;ENST00000360871;ENST00000423662;ENST00000528746;ENST00000526082;ENST00000533431	T;T;T;T;T;T;T	0.09817	2.97;2.94;2.98;2.94;3.01;2.95;3.06	5.79	4.88	0.63580	.	0.093893	0.64402	D	0.000001	T	0.03608	0.0103	N	0.02539	-0.55	0.39261	D	0.9642	B;B;B;B;B;B	0.26195	0.041;0.068;0.041;0.068;0.144;0.068	B;B;B;B;B;B	0.15870	0.006;0.014;0.006;0.014;0.005;0.014	T	0.41858	-0.9485	10	0.35671	T	0.21	-18.9841	5.5346	0.17003	0.2619:0.0:0.7381:0.0	.	636;722;726;640;636;640	B7ZL72;G3XAE5;Q9NQV6;Q9NQV6-5;Q9NQV6-2;Q9NQV6-1	.;.;PRD10_HUMAN;.;.;.	M	726;636;722;640;696;640;439	ENSP00000351686:T726M;ENSP00000302669:T636M;ENSP00000354118:T722M;ENSP00000398431:T640M;ENSP00000431262:T696M;ENSP00000432237:T640M;ENSP00000435940:T439M	ENSP00000302669:T636M	T	-	2	0	PRDM10	129293693	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.035000	0.76517	2.733000	0.93635	0.655000	0.94253	ACG	.		0.602	PRDM10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386076.1	NM_199437	
GLB1L2	89944	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	134240909	134240909	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr11:134240909A>G	ENST00000535456.2	+	13	1411	c.1223A>G	c.(1222-1224)aAg>aGg	p.K408R	GLB1L2_ENST00000389881.3_Missense_Mutation_p.K408R|GLB1L2_ENST00000339772.7_Missense_Mutation_p.K408R|GLB1L2_ENST00000529077.1_3'UTR	NM_138342.3	NP_612351.2	Q8IW92	GLBL2_HUMAN	galactosidase, beta 1-like 2	408					carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)	beta-galactosidase activity (GO:0004565)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(20)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	41	all_hematologic(175;0.127)	all_cancers(12;2.85e-18)|all_epithelial(12;1.21e-12)|all_lung(97;0.000276)|Lung NSC(97;0.000518)|Breast(109;0.00122)|Medulloblastoma(222;0.0399)|all_neural(223;0.0412)|Esophageal squamous(93;0.0844)		Epithelial(10;1.37e-11)|all cancers(11;2.2e-10)|BRCA - Breast invasive adenocarcinoma(10;3.09e-10)|OV - Ovarian serous cystadenocarcinoma(99;0.000885)|Lung(977;0.223)		CAGCCAATCAAGTCTGAAAAG	0.572																																					p.K408R		.											.	GLB1L2-25	0			c.A1223G						.						126.0	129.0	128.0					11																	134240909		2201	4297	6498	SO:0001583	missense	89944	exon13			CAATCAAGTCTGA		CCDS31724.1	11q25	2008-01-29			ENSG00000149328	ENSG00000149328			25129	protein-coding gene	gene with protein product						12975309	Standard	NM_138342		Approved		uc001qhp.3	Q8IW92	OTTHUMG00000167179	ENST00000535456.2:c.1223A>G	11.37:g.134240909A>G	ENSP00000444628:p.Lys408Arg	Somatic	63	0		WXS	Illumina GAIIx	Phase_I	98	45	NM_138342	0	0	0	0	0	A6NCE6|Q6UX60|Q8NC62|Q8NCB3|Q8NCJ1|Q96HP3	Missense_Mutation	SNP	ENST00000535456.2	37	CCDS31724.1	.	.	.	.	.	.	.	.	.	.	A	10.87	1.472910	0.26423	.	.	ENSG00000149328	ENST00000339772;ENST00000535456;ENST00000389881	D;D;D	0.93426	-3.22;-3.22;-3.22	5.77	-7.8	0.01214	.	0.765819	0.12913	N	0.428836	T	0.80385	0.4613	N	0.21282	0.65	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.69989	-0.4995	10	0.15066	T	0.55	-2.112	2.8538	0.05565	0.2739:0.4206:0.1189:0.1866	.	408	Q8IW92	GLBL2_HUMAN	R	408	ENSP00000344659:K408R;ENSP00000444628:K408R;ENSP00000374531:K408R	ENSP00000344659:K408R	K	+	2	0	GLB1L2	133746119	0.000000	0.05858	0.000000	0.03702	0.050000	0.14768	-0.175000	0.09825	-1.640000	0.01525	0.533000	0.62120	AAG	.		0.572	GLB1L2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393629.2	NM_138342	
ATN1	1822	broad.mit.edu	37	12	7047103	7047103	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr12:7047103C>A	ENST00000356654.4	+	6	2627	c.2390C>A	c.(2389-2391)gCc>gAc	p.A797D	ATN1_ENST00000396684.2_Missense_Mutation_p.A797D	NM_001007026.1	NP_001007027.1	P54259	ATN1_HUMAN	atrophin 1	797					cell migration (GO:0016477)|central nervous system development (GO:0007417)|maintenance of cell polarity (GO:0030011)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron apoptotic process (GO:0051402)|toxin metabolic process (GO:0009404)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	40						AAGAAGCGGGCCGACCTGGTG	0.677																																					p.A797D		.											.	ATN1-139	0			c.C2390A						.						14.0	14.0	14.0					12																	7047103		2190	4289	6479	SO:0001583	missense	1822	exon6			AGCGGGCCGACCT	U23851	CCDS31734.1	12p	2007-08-01	2005-03-15	2005-03-17		ENSG00000111676			3033	protein-coding gene	gene with protein product		607462	"""dentatorubral-pallidoluysian atrophy (atrophin-1)"""	D12S755E, DRPLA		8136826	Standard	NM_001940		Approved	B37	uc001qrw.1	P54259		ENST00000356654.4:c.2390C>A	12.37:g.7047103C>A	ENSP00000349076:p.Ala797Asp	Somatic	29	1		WXS	Illumina GAIIx	Phase_I	232	12	NM_001007026	2	0	135	138	1	Q99495|Q99621|Q9UEK7	Missense_Mutation	SNP	ENST00000356654.4	37	CCDS31734.1	.	.	.	.	.	.	.	.	.	.	C	13.88	2.369773	0.42003	.	.	ENSG00000111676	ENST00000356654;ENST00000396684;ENST00000544325;ENST00000229279	T;T;T	0.44482	0.92;0.92;0.92	3.8	3.8	0.43715	.	0.000000	0.33772	U	0.004570	T	0.35913	0.0948	L	0.36672	1.1	0.41835	D	0.990094	P	0.41313	0.745	B	0.39562	0.303	T	0.38779	-0.9645	10	0.48119	T	0.1	.	16.216	0.82217	0.0:1.0:0.0:0.0	.	797	P54259	ATN1_HUMAN	D	797;797;797;382	ENSP00000349076:A797D;ENSP00000379915:A797D;ENSP00000441744:A797D	ENSP00000229279:A382D	A	+	2	0	ATN1	6917364	1.000000	0.71417	0.988000	0.46212	0.089000	0.18198	4.946000	0.63576	2.121000	0.65114	0.563000	0.77884	GCC	.		0.677	ATN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401948.2	NM_001940	
FAM186A	121006	broad.mit.edu	37	12	50747102	50747102	+	Silent	SNP	A	A	G			TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr12:50747102A>G	ENST00000327337.5	-	4	3512	c.3513T>C	c.(3511-3513)ctT>ctC	p.L1171L	FAM186A_ENST00000543096.1_5'Flank|FAM186A_ENST00000543111.1_Silent_p.L1171L	NM_001145475.1	NP_001138947.1	A6NE01	F186A_HUMAN	family with sequence similarity 186, member A	1171								p.L1171L(2)									GCTGAGGGGTAAGAGGGATCC	0.642																																					p.L1171L	NSCLC(138;1796 1887 12511 19463 37884)	.											.	FAM186A-68	2	Substitution - coding silent(2)	endometrium(2)	c.T3513C						.						28.0	25.0	26.0					12																	50747102		692	1591	2283	SO:0001819	synonymous_variant	121006	exon4			AGGGGTAAGAGGG		CCDS44878.1	12q13.13	2009-04-22			ENSG00000185958	ENSG00000185958			26980	protein-coding gene	gene with protein product							Standard	NM_001145475		Approved	LOC121006	uc001rwl.2	A6NE01	OTTHUMG00000167889	ENST00000327337.5:c.3513T>C	12.37:g.50747102A>G		Somatic	110	1		WXS	Illumina GAIIx	Phase_I	124	7	NM_001145475	0	0	0	0	0		Silent	SNP	ENST00000327337.5	37	CCDS44878.1																																																																																			.		0.642	FAM186A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396838.1	XM_001718353	
KRT4	3851	bcgsc.ca	37	12	53207603	53207603	+	Silent	SNP	A	A	G	rs7135148		TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr12:53207603A>G	ENST00000551956.1	-	1	732	c.240T>C	c.(238-240)ttT>ttC	p.F80F	KRT4_ENST00000293774.4_Silent_p.F154F|KRT4_ENST00000458244.2_Silent_p.F60F			P19013	K2C4_HUMAN	keratin 4	80	Gly-rich.|Head.				cytoskeleton organization (GO:0007010)|epithelial cell differentiation (GO:0030855)|negative regulation of epithelial cell proliferation (GO:0050680)	cell surface (GO:0009986)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(4)|prostate(2)|skin(2)	29						CACCAGTGCCAAAGCCTCCAG	0.602																																					p.F80F	Pancreas(190;284 2995 41444 45903)	.											.	KRT4-96	0			c.T240C						.						82.0	99.0	94.0					12																	53207603		2119	4253	6372	SO:0001819	synonymous_variant	3851	exon1			AGTGCCAAAGCCT		CCDS41787.1, CCDS41787.2	12q13.13	2013-01-16			ENSG00000170477	ENSG00000170477		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6441	protein-coding gene	gene with protein product	"""cytokeratin 4"", ""keratin, type II cytoskeletal 4"""	123940		CYK4		16831889	Standard	NM_002272		Approved	CK4, K4	uc031qhk.1	P19013		ENST00000551956.1:c.240T>C	12.37:g.53207603A>G		Somatic	47	0		WXS	Illumina GAIIx	Phase_I	101	9	NM_002272	0	0	0	0	0	F8VS64|Q6GTR8|Q96LA7|Q9BTL1	Silent	SNP	ENST00000551956.1	37	CCDS41787.2																																																																																			A|1.000;|0.000		0.602	KRT4-001	KNOWN	upstream_ATG|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405931.1	NM_002272	
KRT4	3851	bcgsc.ca	37	12	53207606	53207606	+	Silent	SNP	G	G	A	rs79164931		TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr12:53207606G>A	ENST00000551956.1	-	1	729	c.237C>T	c.(235-237)ggC>ggT	p.G79G	KRT4_ENST00000293774.4_Silent_p.G153G|KRT4_ENST00000458244.2_Silent_p.G59G			P19013	K2C4_HUMAN	keratin 4	79	Gly-rich.|Head.				cytoskeleton organization (GO:0007010)|epithelial cell differentiation (GO:0030855)|negative regulation of epithelial cell proliferation (GO:0050680)	cell surface (GO:0009986)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(4)|prostate(2)|skin(2)	29						CAGTGCCAAAGCCTCCAGCAC	0.597																																					p.G79G	Pancreas(190;284 2995 41444 45903)	.											.	KRT4-96	0			c.C237T						.						85.0	102.0	96.0					12																	53207606		2113	4248	6361	SO:0001819	synonymous_variant	3851	exon1			GCCAAAGCCTCCA		CCDS41787.1, CCDS41787.2	12q13.13	2013-01-16			ENSG00000170477	ENSG00000170477		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6441	protein-coding gene	gene with protein product	"""cytokeratin 4"", ""keratin, type II cytoskeletal 4"""	123940		CYK4		16831889	Standard	NM_002272		Approved	CK4, K4	uc031qhk.1	P19013		ENST00000551956.1:c.237C>T	12.37:g.53207606G>A		Somatic	49	0		WXS	Illumina GAIIx	Phase_I	102	8	NM_002272	0	0	0	0	0	F8VS64|Q6GTR8|Q96LA7|Q9BTL1	Silent	SNP	ENST00000551956.1	37	CCDS41787.2																																																																																			.		0.597	KRT4-001	KNOWN	upstream_ATG|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405931.1	NM_002272	
ITGA7	3679	broad.mit.edu	37	12	56094084	56094084	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr12:56094084T>G	ENST00000555728.1	-	5	792	c.764A>C	c.(763-765)gAc>gCc	p.D255A	ITGA7_ENST00000394229.2_Intron|ITGA7_ENST00000257880.7_Missense_Mutation_p.D255A|ITGA7_ENST00000452168.2_Missense_Mutation_p.D158A|ITGA7_ENST00000553804.1_Missense_Mutation_p.D255A|ITGA7_ENST00000394230.2_Missense_Mutation_p.D255A|ITGA7_ENST00000257879.6_Intron|ITGA7_ENST00000347027.6_Intron			Q13683	ITA7_HUMAN	integrin, alpha 7	255					blood vessel morphogenesis (GO:0048514)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|muscle organ development (GO:0007517)|regulation of cell shape (GO:0008360)|skeletal muscle tissue development (GO:0007519)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|integrin alpha7-beta1 complex (GO:0034677)|muscle tendon junction (GO:0005927)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(16)|ovary(2)|prostate(2)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						GAGGCGGGGGTCCTGCTCCTT	0.652																																					p.D255A		.											.	ITGA7-229	0			c.A764C						.						31.0	34.0	33.0					12																	56094084		1568	3582	5150	SO:0001583	missense	3679	exon5			CGGGGGTCCTGCT		CCDS8888.1, CCDS44914.1, CCDS55832.1	12q13	2014-09-17				ENSG00000135424		"""Integrins"""	6143	protein-coding gene	gene with protein product		600536				7607681	Standard	NM_002206		Approved		uc001shh.3	Q13683		ENST00000555728.1:c.764A>C	12.37:g.56094084T>G	ENSP00000452387:p.Asp255Ala	Somatic	38	7		WXS	Illumina GAIIx	Phase_I	71	14	NM_001144996	0	0	6	6	0	B4E3U0|C9JMD3|C9JMZ6|O43197|Q86W93|Q9NY89|Q9UET0|Q9UEV2	Missense_Mutation	SNP	ENST00000555728.1	37		.	.	.	.	.	.	.	.	.	.	T	23.9	4.476045	0.84640	.	.	ENSG00000135424	ENST00000553804;ENST00000452168;ENST00000257880;ENST00000394230;ENST00000353687;ENST00000555728	T;T;T;T;T	0.70749	-0.51;-0.51;-0.44;-0.51;-0.45	4.67	4.67	0.58626	.	0.184142	0.46145	D	0.000313	T	0.77011	0.4068	L	0.43152	1.355	0.38595	D	0.950516	P;D	0.65815	0.934;0.995	P;D	0.66847	0.851;0.947	T	0.80815	-0.1214	10	0.72032	D	0.01	.	12.4318	0.55578	0.0:0.0:0.0:1.0	.	158;255	Q13683-13;Q13683-3	.;.	A	255;158;255;255;255;255	ENSP00000452120:D255A;ENSP00000393844:D158A;ENSP00000257880:D255A;ENSP00000377777:D255A;ENSP00000452387:D255A	ENSP00000257880:D255A	D	-	2	0	ITGA7	54380351	1.000000	0.71417	0.996000	0.52242	0.993000	0.82548	7.423000	0.80229	1.893000	0.54813	0.449000	0.29647	GAC	.		0.652	ITGA7-014	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000410138.1	NM_002206	
MARCH9	92979	hgsc.bcm.edu	37	12	58149446	58149446	+	Silent	SNP	C	C	T	rs1689582	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr12:58149446C>T	ENST00000266643.5	+	1	566	c.135C>T	c.(133-135)ggC>ggT	p.G45G	MARCH9_ENST00000548358.1_5'Flank	NM_138396.5	NP_612405.2	Q86YJ5	MARH9_HUMAN	membrane-associated ring finger (C3HC4) 9	45					protein ubiquitination (GO:0016567)	Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|trans-Golgi network (GO:0005802)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|large_intestine(2)|lung(1)	4	all_cancers(7;4.96e-69)|Lung NSC(6;5.5e-25)|all_lung(6;3.87e-23)|all_epithelial(6;1.66e-15)|Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)		GBM - Glioblastoma multiforme(5;4.21e-120)|all cancers(5;3.75e-83)|BRCA - Breast invasive adenocarcinoma(9;0.0294)			ccTTCGCTGGCTGCTCCACCC	0.801													C|||	4639	0.926318	0.789	0.9755	5008	,	,		3828	0.998		0.999	False		,,,				2504	0.9284				p.G45G		.											.	MARCH9-492	0			c.C135T						.						1.0	1.0	1.0					12																	58149446		343	936	1279	SO:0001819	synonymous_variant	92979	exon1			CGCTGGCTGCTCC	BC009489	CCDS31847.1	12q14.1	2013-01-09				ENSG00000139266		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	25139	protein-coding gene	gene with protein product		613336				14722266	Standard	NM_138396		Approved	RNF179, FLJ36578	uc001spx.2	Q86YJ5		ENST00000266643.5:c.135C>T	12.37:g.58149446C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_138396	0	0	0	0	0	B2R9U9|Q86VN5|Q96GG2	Silent	SNP	ENST00000266643.5	37	CCDS31847.1																																																																																			T|0.004;G|0.064		0.801	MARCH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409244.1	NM_138396	
DUSP6	1848	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	89744754	89744754	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr12:89744754T>C	ENST00000279488.7	-	2	1680	c.449A>G	c.(448-450)aAt>aGt	p.N150S	DUSP6_ENST00000308385.6_Intron|DUSP6_ENST00000547140.1_5'UTR|DUSP6_ENST00000547291.1_Missense_Mutation_p.N25S	NM_001946.2	NP_001937.2	Q16828	DUS6_HUMAN	dual specificity phosphatase 6	150					cell differentiation (GO:0030154)|dorsal/ventral pattern formation (GO:0009953)|inactivation of MAPK activity (GO:0000188)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of apoptotic process (GO:0043065)|regulation of endodermal cell fate specification (GO:0042663)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of heart growth (GO:0060420)|response to drug (GO:0042493)|response to nitrosative stress (GO:0051409)|response to organic cyclic compound (GO:0014070)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)			large_intestine(5)|lung(8)|skin(2)|urinary_tract(1)	16						GCCGTCTAGATTGGTCTCGCA	0.567																																					p.N150S	Colon(132;3456 5224)	.											.	DUSP6-846	0			c.A449G						.						19.0	19.0	19.0					12																	89744754		2203	4300	6503	SO:0001583	missense	1848	exon2			TCTAGATTGGTCT	BC037236	CCDS9033.1, CCDS9034.1	12q22-q23	2011-06-09				ENSG00000139318		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3072	protein-coding gene	gene with protein product		602748				8626780, 9205128	Standard	NM_001946		Approved	MKP-3, PYST1	uc001tay.3	Q16828		ENST00000279488.7:c.449A>G	12.37:g.89744754T>C	ENSP00000279488:p.Asn150Ser	Somatic	33	0		WXS	Illumina GAIIx	Phase_I	45	24	NM_001946	0	0	13	17	4	O75109|Q53Y75|Q9BSH6	Missense_Mutation	SNP	ENST00000279488.7	37	CCDS9033.1	.	.	.	.	.	.	.	.	.	.	T	13.16	2.154226	0.38021	.	.	ENSG00000139318	ENST00000279488;ENST00000547291	T;T	0.02606	4.44;4.23	5.85	4.65	0.58169	Rhodanese-like (2);	0.040714	0.85682	D	0.000000	T	0.02267	0.0070	N	0.25789	0.76	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.31024	-0.9958	10	0.02654	T	1	.	12.7567	0.57339	0.0:0.0:0.1368:0.8632	.	150	Q16828	DUS6_HUMAN	S	150;25	ENSP00000279488:N150S;ENSP00000449838:N25S	ENSP00000279488:N150S	N	-	2	0	DUSP6	88268885	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.123000	0.57917	2.234000	0.73211	0.533000	0.62120	AAT	.		0.567	DUSP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406534.2	NM_001946, NM_022652	
LHX5	64211	hgsc.bcm.edu	37	12	113901232	113901232	+	Silent	SNP	T	T	C	rs202131487	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr12:113901232T>C	ENST00000261731.3	-	5	1545	c.972A>G	c.(970-972)ggA>ggG	p.G324G		NM_022363.2	NP_071758.1	Q9H2C1	LHX5_HUMAN	LIM homeobox 5	324					cell proliferation in forebrain (GO:0021846)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellar Purkinje cell-granule cell precursor cell signaling involved in regulation of granule cell precursor cell proliferation (GO:0021937)|forebrain neuron differentiation (GO:0021879)|hippocampus development (GO:0021766)|positive regulation of transcription, DNA-templated (GO:0045893)|spinal cord association neuron differentiation (GO:0021527)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(1)|endometrium(2)|large_intestine(1)|lung(4)|prostate(1)|skin(1)	10						GTTCCAGCGCTCCCAGCGGCG	0.736													G|||	18	0.00359425	0.0008	0.0029	5008	,	,		9203	0.001		0.0099	False		,,,				2504	0.0041				p.G324G		.											.	LHX5-90	0			c.A972G						.	G		3,4059		0,3,2028	7.0	10.0	9.0		972	-1.0	1.0	12		9	56,7872		0,56,3908	no	coding-synonymous	LHX5	NM_022363.2		0,59,5936	CC,CT,TT		0.7064,0.0739,0.4921		324/403	113901232	59,11931	2031	3964	5995	SO:0001819	synonymous_variant	64211	exon5			CAGCGCTCCCAGC	AF291181	CCDS9171.1	12q24.13	2014-01-15			ENSG00000089116	ENSG00000089116		"""Homeoboxes / LIM class"""	14216	protein-coding gene	gene with protein product		605992					Standard	NM_022363		Approved		uc001tvj.1	Q9H2C1	OTTHUMG00000169552	ENST00000261731.3:c.972A>G	12.37:g.113901232T>C		Somatic	2	0		WXS	Illumina GAIIx	Phase_I	37	18	NM_022363	0	0	0	0	0	Q32MA4	Silent	SNP	ENST00000261731.3	37	CCDS9171.1																																																																																			.		0.736	LHX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404788.3	NM_022363	
C12orf49	79794	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	117160973	117160973	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr12:117160973G>A	ENST00000261318.3	-	2	327	c.167C>T	c.(166-168)cCc>cTc	p.P56L	C12orf49_ENST00000536380.1_Intron	NM_024738.1	NP_079014.1	Q9H741	CL049_HUMAN	chromosome 12 open reading frame 49	56						extracellular region (GO:0005576)				endometrium(1)|lung(1)|ovary(1)|skin(1)	4	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0281)		CCACGGGATGGGCTGATTATG	0.488																																					p.P56L		.											.	C12orf49-91	0			c.C167T						.						162.0	118.0	132.0					12																	117160973		2203	4300	6503	SO:0001583	missense	79794	exon2			GGGATGGGCTGAT	AK025068	CCDS9179.1	12q24.22	2012-05-30			ENSG00000111412	ENSG00000111412			26128	protein-coding gene	gene with protein product						12477932	Standard	NM_024738		Approved	FLJ21415	uc001tvz.1	Q9H741	OTTHUMG00000169392	ENST00000261318.3:c.167C>T	12.37:g.117160973G>A	ENSP00000261318:p.Pro56Leu	Somatic	204	0		WXS	Illumina GAIIx	Phase_I	250	47	NM_024738	0	0	7	9	2	Q53GE8	Missense_Mutation	SNP	ENST00000261318.3	37	CCDS9179.1	.	.	.	.	.	.	.	.	.	.	G	14.00	2.405768	0.42715	.	.	ENSG00000111412	ENST00000261318	T	0.43294	0.95	3.89	3.89	0.44902	.	0.307066	0.36409	N	0.002609	T	0.22704	0.0548	N	0.14661	0.345	0.80722	D	1	B	0.31125	0.309	B	0.19666	0.026	T	0.07328	-1.0778	10	0.27082	T	0.32	-34.5305	12.3135	0.54942	0.0:0.0:0.8305:0.1695	.	56	Q9H741	CL049_HUMAN	L	56	ENSP00000261318:P56L	ENSP00000261318:P56L	P	-	2	0	C12orf49	115645356	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	4.090000	0.57693	2.469000	0.83416	0.655000	0.94253	CCC	.		0.488	C12orf49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403847.1	NM_024738	
GCN1L1	10985	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	120616700	120616700	+	Silent	SNP	G	G	A			TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr12:120616700G>A	ENST00000300648.6	-	6	492	c.480C>T	c.(478-480)caC>caT	p.H160H		NM_006836.1	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis 1-like 1 (yeast)	160					regulation of translation (GO:0006417)|translation (GO:0006412)	cytoplasm (GO:0005737)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)			NS(2)|breast(2)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(13)|liver(1)|lung(36)|ovary(4)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	94	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CATCCACGGCGTGCTTGTGGG	0.592																																					p.H160H		.											.	GCN1L1-94	0			c.C480T						.						45.0	50.0	49.0					12																	120616700		2129	4232	6361	SO:0001819	synonymous_variant	10985	exon6			CACGGCGTGCTTG	U77700	CCDS41847.1	12q24.2	2008-07-03	2001-11-28						4199	protein-coding gene	gene with protein product		605614	"""GCN1 (general control of amino-acid synthesis 1, yeast)-like 1"""			9234705	Standard	NM_006836		Approved	KIAA0219, GCN1, GCN1L	uc001txo.3	Q92616	OTTHUMG00000169338	ENST00000300648.6:c.480C>T	12.37:g.120616700G>A		Somatic	67	0		WXS	Illumina GAIIx	Phase_I	75	28	NM_006836	0	0	2	5	3	A8KAY1|O95001|O95651|Q6P2S3|Q86X65|Q8N5I5|Q8WU80|Q99736|Q9UE60	Silent	SNP	ENST00000300648.6	37	CCDS41847.1																																																																																			.		0.592	GCN1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403592.1		
FBRSL1	57666	hgsc.bcm.edu	37	12	133159733	133159733	+	Missense_Mutation	SNP	C	C	T	rs11550079	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr12:133159733C>T	ENST00000434748.2	+	17	3527	c.2507C>T	c.(2506-2508)gCc>gTc	p.A836V	FBRSL1_ENST00000261673.6_Missense_Mutation_p.A763V	NM_001142641.1	NP_001136113.1	Q9HCM7	FBSL_HUMAN	fibrosin-like 1	836				A -> V (in Ref. 3; BAB13371). {ECO:0000305}.			poly(A) RNA binding (GO:0044822)			central_nervous_system(2)|endometrium(1)|stomach(1)	4						AAGGAGGAGGCCGCCAAGATG	0.761													C|||	2725	0.544129	0.4939	0.6225	5008	,	,		5355	0.7113		0.4026	False		,,,				2504	0.5297				p.A836V		.											.	FBRSL1-70	0			c.C2507T						.						2.0	6.0	5.0					12																	133159733		475	1282	1757	SO:0001583	missense	57666	exon17			AGGAGGCCGCCAA		CCDS45010.1	12q24.33	2008-12-09			ENSG00000112787	ENSG00000112787			29308	protein-coding gene	gene with protein product						10997877	Standard	NM_001142641		Approved	KIAA1545	uc001ukf.3	Q9HCM7	OTTHUMG00000167991	ENST00000434748.2:c.2507C>T	12.37:g.133159733C>T	ENSP00000396160:p.Ala836Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	11	10	NM_001142641	0	1	5	8	2	Q86XQ1	Missense_Mutation	SNP	ENST00000434748.2	37	CCDS45010.1	1159	0.5306776556776557	248	0.5040650406504065	211	0.5828729281767956	393	0.6870629370629371	307	0.4050131926121372	c	9.709	1.156573	0.21454	.	.	ENSG00000112787	ENST00000434748;ENST00000261673	T;T	0.31769	1.48;1.49	3.17	-0.242	0.13039	.	0.664906	0.15256	U	0.272063	T	0.00012	0.0000	N	0.14661	0.345	0.80722	P	0.0	P	0.44627	0.839	B	0.40134	0.32	T	0.26677	-1.0096	9	0.45353	T	0.12	-3.3224	5.7681	0.18237	0.1838:0.5714:0.2447:0.0	rs11550079	836	Q9HCM7	FBSL_HUMAN	V	836;763	ENSP00000396160:A836V;ENSP00000261673:A763V	ENSP00000261673:A763V	A	+	2	0	FBRSL1	131669806	0.317000	0.24589	0.004000	0.12327	0.011000	0.07611	0.750000	0.26334	0.431000	0.26258	-0.720000	0.03607	GCC	C|0.470;T|0.530		0.761	FBRSL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397404.2		
MICU2	221154	hgsc.bcm.edu	37	13	22178258	22178258	+	Silent	SNP	C	C	T	rs9509812	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr13:22178258C>T	ENST00000382374.4	-	1	95	c.30G>A	c.(28-30)cgG>cgA	p.R10R		NM_152726.2	NP_689939.1	Q8IYU8	MICU2_HUMAN	mitochondrial calcium uptake 2	10	Ala-rich.				mitochondrial calcium ion transport (GO:0006851)|negative regulation of mitochondrial calcium ion concentration (GO:0051562)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)	calcium channel complex (GO:0034704)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|uniplex complex (GO:1990246)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)										AGGCCGCCACCCGCGCGCAGC	0.751													C|||	455	0.0908546	0.0113	0.1441	5008	,	,		12694	0.002		0.2545	False		,,,				2504	0.0838				p.R10R		.											.	EFHA1-90	0			c.G30A						.	C		108,3144		5,98,1523	3.0	3.0	3.0		30	-1.6	0.0	13	dbSNP_119	3	1216,5514		95,1026,2244	no	coding-synonymous	EFHA1	NM_152726.2		100,1124,3767	TT,TC,CC		18.0684,3.321,13.2639		10/435	22178258	1324,8658	1626	3365	4991	SO:0001819	synonymous_variant	221154	exon1			CGCCACCCGCGCG	AK091907	CCDS9297.1	13q12.11	2013-03-13	2013-03-13	2013-03-13	ENSG00000165487	ENSG00000165487		"""EF-hand domain containing"""	31830	protein-coding gene	gene with protein product		610632	"""EF hand domain family A1"", ""EF-hand domain family, member A1"""	EFHA1		23409044	Standard	NM_152726		Approved		uc001uof.3	Q8IYU8	OTTHUMG00000067414	ENST00000382374.4:c.30G>A	13.37:g.22178258C>T		Somatic	2	0		WXS	Illumina GAIIx	Phase_I	15	11	NM_152726	0	0	0	7	7	Q8N0T6|Q8NAX8	Silent	SNP	ENST00000382374.4	37	CCDS9297.1																																																																																			C|0.873;T|0.127		0.751	MICU2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000144355.1	NM_152726	
RASL11A	387496	broad.mit.edu;bcgsc.ca	37	13	27847550	27847550	+	Silent	SNP	C	C	G	rs148298639	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr13:27847550C>G	ENST00000241463.4	+	4	1266	c.648C>G	c.(646-648)cgC>cgG	p.R216R		NM_206827.1	NP_996563.1			RAS-like, family 11, member A											breast(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)|prostate(1)	10		Lung SC(185;0.0161)	Colorectal(13;0.00042)|READ - Rectum adenocarcinoma(15;0.105)	all cancers(112;0.0173)|GBM - Glioblastoma multiforme(144;0.0557)|OV - Ovarian serous cystadenocarcinoma(117;0.152)|Epithelial(112;0.164)		CTCGGCCCCGCTCTCCCAACA	0.542													C|||	50	0.00998403	0.0008	0.013	5008	,	,		15453	0.0		0.0119	False		,,,				2504	0.0286				p.R216R		.											.	RASL11A-522	0			c.C648G						.	C		5,4401	9.9+/-24.2	0,5,2198	56.0	54.0	55.0		648	-0.7	1.0	13	dbSNP_134	55	87,8513	49.4+/-109.1	0,87,4213	no	coding-synonymous	RASL11A	NM_206827.1		0,92,6411	GG,GC,CC		1.0116,0.1135,0.7074		216/243	27847550	92,12914	2203	4300	6503	SO:0001819	synonymous_variant	387496	exon4			GCCCCGCTCTCCC	AY439004	CCDS9321.1	13q12.2	2014-05-09			ENSG00000122035	ENSG00000122035			23802	protein-coding gene	gene with protein product		612403				15033445	Standard	NM_206827		Approved		uc001urd.1	Q6T310	OTTHUMG00000016627	ENST00000241463.4:c.648C>G	13.37:g.27847550C>G		Somatic	217	1		WXS	Illumina GAIIx	Phase_I	149	5	NM_206827	0	0	4	4	0		Silent	SNP	ENST00000241463.4	37	CCDS9321.1																																																																																			C|0.992;G|0.008		0.542	RASL11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044265.2	NM_206827	
RB1	5925	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	48934194	48934194	+	Nonsense_Mutation	SNP	C	C	T			TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr13:48934194C>T	ENST00000267163.4	+	7	787	c.649C>T	c.(649-651)Cag>Tag	p.Q217*		NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	217					androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(6)|p.Q217*(4)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	GATTTCATTTCAGTTAATGCT	0.308		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																											p.Q217X		.	yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	.	RB1-3784	25	Whole gene deletion(15)|Unknown(6)|Substitution - Nonsense(4)	bone(11)|breast(5)|haematopoietic_and_lymphoid_tissue(2)|lung(2)|eye(1)|soft_tissue(1)|central_nervous_system(1)|endometrium(1)|urinary_tract(1)	c.C649T						.						106.0	106.0	106.0					13																	48934194		2203	4299	6502	SO:0001587	stop_gained	5925	exon7	Familial Cancer Database		TCATTTCAGTTAA	M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.649C>T	13.37:g.48934194C>T	ENSP00000267163:p.Gln217*	Somatic	85	0		WXS	Illumina GAIIx	Phase_I	32	24	NM_000321	0	0	0	0	0	A8K5E3|P78499|Q5VW46|Q8IZL4	Nonsense_Mutation	SNP	ENST00000267163.4	37	CCDS31973.1	.	.	.	.	.	.	.	.	.	.	C	34	5.298380	0.95574	.	.	ENSG00000139687	ENST00000542917;ENST00000267163	.	.	.	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	18.357	0.90361	0.0:1.0:0.0:0.0	.	.	.	.	X	196;217	.	ENSP00000267163:Q217X	Q	+	1	0	RB1	47832195	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.271000	0.65553	2.631000	0.89168	0.650000	0.86243	CAG	.		0.308	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000044884.1		
UPF3A	65110	broad.mit.edu	37	13	115047559	115047559	+	Silent	SNP	C	C	T			TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr13:115047559C>T	ENST00000375299.3	+	2	327	c.271C>T	c.(271-273)Ctg>Ttg	p.L91L	UPF3A_ENST00000351487.5_Silent_p.L91L	NM_023011.3	NP_075387.1	Q9H1J1	REN3A_HUMAN	UPF3 regulator of nonsense transcripts homolog A (yeast)	91	Required for interaction with UPF2.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA transport (GO:0051028)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nucleocytoplasmic transport (GO:0006913)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.L91L(8)		autonomic_ganglia(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	16	Lung NSC(43;0.00299)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0191)|all_epithelial(44;0.00716)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.238)	BRCA - Breast invasive adenocarcinoma(86;0.0886)	OV - Ovarian serous cystadenocarcinoma(48;0.195)|Epithelial(10;0.2)		GCTGCGCCCGCTGCCAGCACA	0.731																																					p.L91L		.											.	UPF3A-91	8	Substitution - coding silent(8)	lung(2)|prostate(2)|kidney(2)|central_nervous_system(2)	c.C271T						.						4.0	4.0	4.0					13																	115047559		1902	3804	5706	SO:0001819	synonymous_variant	65110	exon2			CGCCCGCTGCCAG	AF318575	CCDS9543.1, CCDS9544.1	13q34	2010-04-30			ENSG00000169062	ENSG00000169062			20332	protein-coding gene	gene with protein product		605530				11113196, 11163187	Standard	NM_023011		Approved	RENT3A, UPF3, HUPF3A	uc001vup.3	Q9H1J1	OTTHUMG00000017403	ENST00000375299.3:c.271C>T	13.37:g.115047559C>T		Somatic	16	0		WXS	Illumina GAIIx	Phase_I	49	9	NM_080687	0	0	11	11	0	A2A366|Q5T8C3|Q5T8C9|Q7Z6N3|Q86YK1|Q9BZI8	Silent	SNP	ENST00000375299.3	37	CCDS9543.1																																																																																			.		0.731	UPF3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045968.2		
ACIN1	22985	ucsc.edu	37	14	23548787	23548787	+	Missense_Mutation	SNP	C	C	T	rs55838227|rs34870944|rs61741619	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr14:23548787C>T	ENST00000262710.1	-	6	2258	c.1931G>A	c.(1930-1932)cGt>cAt	p.R644H	ACIN1_ENST00000555352.1_5'Flank|ACIN1_ENST00000555053.1_Missense_Mutation_p.R644H|ACIN1_ENST00000605057.1_Missense_Mutation_p.R586H|ACIN1_ENST00000457657.1_Missense_Mutation_p.R604H	NM_001164814.1|NM_014977.3	NP_001158286.1|NP_055792	Q9UKV3	ACINU_HUMAN	apoptotic chromatin condensation inducer 1	644	Ser-rich.				apoptotic chromosome condensation (GO:0030263)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|erythrocyte differentiation (GO:0030218)|mRNA processing (GO:0006397)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|positive regulation of apoptotic process (GO:0043065)|positive regulation of monocyte differentiation (GO:0045657)|RNA splicing (GO:0008380)	ASAP complex (GO:0061574)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATPase activity (GO:0016887)|enzyme binding (GO:0019899)|nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.S643_R644insHS(1)		breast(1)|endometrium(6)|kidney(4)|large_intestine(9)|lung(10)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	37	all_cancers(95;1.36e-05)			GBM - Glioblastoma multiforme(265;0.00816)		TGAACGAGAACGTGAACGTGA	0.488																																					p.R644H		.											.	ACIN1-156	1	Insertion - In frame(1)	upper_aerodigestive_tract(1)	c.G1931A						.						255.0	224.0	235.0					14																	23548787		2203	4300	6503	SO:0001583	missense	22985	exon6			CGAGAACGTGAAC	AB014570	CCDS9587.1, CCDS53887.1, CCDS53888.1, CCDS53889.1, CCDS55905.1	14q11.2	2008-11-25	2004-03-31	2004-04-01	ENSG00000100813	ENSG00000100813			17066	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 152"""	604562	"""apoptotic chromatin condensation inducer in the nucleus"""	ACINUS		9734811, 10490026	Standard	NM_014977		Approved	KIAA0670, fSAP152	uc001wit.4	Q9UKV3	OTTHUMG00000028716	ENST00000262710.1:c.1931G>A	14.37:g.23548787C>T	ENSP00000262710:p.Arg644His	Somatic	197	0		WXS	Illumina GAIIx	Phase_I	236	45	NM_001164814	0	0	0	0	0	B2RTT4|D3DS45|O75158|Q9UG91|Q9UKV1|Q9UKV2	Missense_Mutation	SNP	ENST00000262710.1	37	CCDS9587.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.061864	0.76187	.	.	ENSG00000100813	ENST00000262710;ENST00000457657;ENST00000555053	T;T;T	0.30448	2.29;1.53;2.29	5.46	5.46	0.80206	.	0.000000	0.41001	D	0.000979	T	0.42720	0.1215	L	0.27053	0.805	0.36352	D	0.86012	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.79784	0.993;0.984;0.984	T	0.50808	-0.8784	10	0.59425	D	0.04	-1.7144	14.8141	0.70017	0.0:1.0:0.0:0.0	.	644;644;604	G3V3M7;Q9UKV3;E7EQT4	.;ACINU_HUMAN;.	H	644;604;644	ENSP00000262710:R644H;ENSP00000405677:R604H;ENSP00000451328:R644H	ENSP00000262710:R644H	R	-	2	0	ACIN1	22618627	0.999000	0.42202	1.000000	0.80357	0.906000	0.53458	1.398000	0.34554	2.556000	0.86216	0.655000	0.94253	CGT	C|0.985;T|0.015		0.488	ACIN1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000071707.3	NM_014977	
ARHGAP5	394	bcgsc.ca	37	14	32561296	32561296	+	Missense_Mutation	SNP	T	T	C	rs200111638		TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr14:32561296T>C	ENST00000345122.3	+	2	1736	c.1421T>C	c.(1420-1422)gTa>gCa	p.V474A	ARHGAP5_ENST00000556611.1_Missense_Mutation_p.V474A|ARHGAP5_ENST00000432921.1_Missense_Mutation_p.V474A|ARHGAP5_ENST00000539826.2_Missense_Mutation_p.V474A|ARHGAP5_ENST00000433497.1_Intron|ARHGAP5_ENST00000396582.2_Intron	NM_001030055.1	NP_001025226.1	Q13017	RHG05_HUMAN	Rho GTPase activating protein 5	474	FF 3.				cell adhesion (GO:0007155)|GTP catabolic process (GO:0006184)|mammary gland development (GO:0030879)|positive regulation of cell migration (GO:0030335)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell size (GO:0008361)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)			NS(2)|breast(10)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(12)|ovary(4)|skin(1)|stomach(1)|urinary_tract(4)	55	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)		AGCAAAGAGGTATATGGTAGG	0.368																																					p.V474A	NSCLC(9;77 350 3443 29227 41353)	.											.	ARHGAP5-94	0			c.T1421C						.						74.0	77.0	76.0					14																	32561296		2203	4297	6500	SO:0001583	missense	394	exon2			AAGAGGTATATGG	U17032	CCDS32062.1, CCDS45095.1	14q12	2010-02-05						"""Rho GTPase activating proteins"""	675	protein-coding gene	gene with protein product		602680	"""growth factor independent 2"""	GFI2		8537347	Standard	XM_005267635		Approved	RhoGAP5, p190-B, p190BRhoGAP	uc001wrn.3	Q13017		ENST00000345122.3:c.1421T>C	14.37:g.32561296T>C	ENSP00000371897:p.Val474Ala	Somatic	170	2		WXS	Illumina GAIIx	Phase_I	190	7	NM_001173	0	0	2	2	0	A1L375|A1L376|A8KAA1|D3DS89|D3DS90|Q05BE8|Q05BU8|Q59ER0|Q6DHZ3	Missense_Mutation	SNP	ENST00000345122.3	37	CCDS32062.1	.	.	.	.	.	.	.	.	.	.	T	17.13	3.311365	0.60414	.	.	ENSG00000100852	ENST00000556611;ENST00000539826;ENST00000345122;ENST00000432921	T;T;T;T	0.12039	2.72;2.72;2.72;2.72	6.02	6.02	0.97574	FF domain (1);	0.000000	0.85682	D	0.000000	T	0.25457	0.0619	L	0.40543	1.245	0.80722	D	1	P;P	0.49961	0.93;0.885	P;P	0.56042	0.79;0.622	T	0.00254	-1.1874	10	0.56958	D	0.05	.	16.5494	0.84464	0.0:0.0:0.0:1.0	.	474;474	Q13017-2;Q13017	.;RHG05_HUMAN	A	474	ENSP00000452222:V474A;ENSP00000441692:V474A;ENSP00000371897:V474A;ENSP00000393307:V474A	ENSP00000371897:V474A	V	+	2	0	ARHGAP5	31631047	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	8.040000	0.89188	2.299000	0.77371	0.528000	0.53228	GTA	T|0.999;C|0.001		0.368	ARHGAP5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409735.1	NM_001030055	
OTX2	5015	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	57268974	57268974	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr14:57268974G>C	ENST00000555006.1	-	4	757	c.349C>G	c.(349-351)Cca>Gca	p.P117A	OTX2_ENST00000408990.3_Missense_Mutation_p.P117A|OTX2_ENST00000554788.1_3'UTR|RP11-1085N6.6_ENST00000602485.1_lincRNA|OTX2_ENST00000339475.5_Missense_Mutation_p.P125A|OTX2_ENST00000554559.1_3'UTR			P32243	OTX2_HUMAN	orthodenticle homeobox 2	117					axon guidance (GO:0007411)|cell fate specification (GO:0001708)|diencephalon morphogenesis (GO:0048852)|dorsal/ventral pattern formation (GO:0009953)|endoderm development (GO:0007492)|eye photoreceptor cell fate commitment (GO:0042706)|forebrain development (GO:0030900)|inner ear morphogenesis (GO:0042472)|metencephalon development (GO:0022037)|midbrain development (GO:0030901)|neuron fate determination (GO:0048664)|positive regulation of embryonic development (GO:0040019)|positive regulation of gastrulation (GO:2000543)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|primitive streak formation (GO:0090009)|protein complex assembly (GO:0006461)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of smoothened signaling pathway (GO:0008589)|somite rostral/caudal axis specification (GO:0032525)	cytoplasm (GO:0005737)|growth cone (GO:0030426)|nucleus (GO:0005634)|protein complex (GO:0043234)	eukaryotic initiation factor 4E binding (GO:0008190)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(7)|ovary(1)|prostate(1)|urinary_tract(1)	19	Medulloblastoma(1;0.00184)|all_neural(1;0.00414)					TCCCGAGCTGGAGATGTCTTC	0.512																																					p.P125A		.											.	OTX2-205	0			c.C373G						.						88.0	85.0	86.0					14																	57268974		2203	4300	6503	SO:0001583	missense	5015	exon3			GAGCTGGAGATGT	AF298117	CCDS9728.1, CCDS41960.1	14q22.3	2014-09-17	2007-02-15		ENSG00000165588	ENSG00000165588		"""Homeoboxes / PRD class"""	8522	protein-coding gene	gene with protein product		600037	"""orthodenticle homolog 2 (Drosophila)"""			7959790	Standard	NM_021728		Approved		uc031qor.1	P32243	OTTHUMG00000152338	ENST00000555006.1:c.349C>G	14.37:g.57268974G>C	ENSP00000452336:p.Pro117Ala	Somatic	42	0		WXS	Illumina GAIIx	Phase_I	56	22	NM_001270525	0	0	0	0	0	B2RAN5|Q6GTV3|Q9HAW3|Q9P2R1	Missense_Mutation	SNP	ENST00000555006.1	37	CCDS41960.1	.	.	.	.	.	.	.	.	.	.	G	15.17	2.755275	0.49362	.	.	ENSG00000165588	ENST00000339475;ENST00000408990;ENST00000555006;ENST00000554845;ENST00000555804	D;D;D;D;D	0.92545	-2.95;-2.92;-2.92;-3.06;-3.05	5.78	4.89	0.63831	.	0.155674	0.30311	N	0.009907	D	0.95554	0.8555	M	0.80183	2.485	0.80722	D	1	D;D	0.89917	0.98;1.0	P;D	0.78314	0.887;0.991	D	0.94743	0.7920	10	0.34782	T	0.22	.	13.6809	0.62484	0.0736:0.0:0.9264:0.0	.	125;117	F1T0D1;P32243	.;OTX2_HUMAN	A	125;117;117;125;117	ENSP00000343819:P125A;ENSP00000386185:P117A;ENSP00000452336:P117A;ENSP00000451357:P125A;ENSP00000451272:P117A	ENSP00000343819:P125A	P	-	1	0	OTX2	56338727	1.000000	0.71417	0.959000	0.39883	0.978000	0.69477	9.787000	0.99055	1.458000	0.47871	0.455000	0.32223	CCA	.		0.512	OTX2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411522.1	NM_021728.	
PLEKHG3	26030	hgsc.bcm.edu	37	14	65210339	65210339	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr14:65210339C>T	ENST00000394691.1	+	17	3725	c.3578C>T	c.(3577-3579)tCc>tTc	p.S1193F	PLEKHG3_ENST00000471182.2_Missense_Mutation_p.S726F|PLEKHG3_ENST00000484731.2_Missense_Mutation_p.S698F|PLEKHG3_ENST00000492928.1_Intron|PLEKHG3_ENST00000247226.7_Missense_Mutation_p.S1137F			A1L390	PKHG3_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 3	1193							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(5)|kidney(2)|large_intestine(1)|lung(14)|prostate(2)|skin(3)|urinary_tract(2)	29				all cancers(60;0.00802)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)|BRCA - Breast invasive adenocarcinoma(234;0.0485)		GAAGAGGGTTCCAGGGACCCG	0.622																																					p.S1137F		.											.	PLEKHG3-91	0			c.C3410T						.						29.0	31.0	30.0					14																	65210339		2200	4297	6497	SO:0001583	missense	26030	exon15			AGGGTTCCAGGGA	AB011171	CCDS32098.1	14q23.3	2013-01-10	2004-12-01	2004-12-01	ENSG00000126822	ENSG00000126822		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	20364	protein-coding gene	gene with protein product			"""KIAA0599"""	KIAA0599			Standard	XM_005267511		Approved	ARHGEF43	uc001xhp.2	A1L390	OTTHUMG00000029671	ENST00000394691.1:c.3578C>T	14.37:g.65210339C>T	ENSP00000378183:p.Ser1193Phe	Somatic	57	0		WXS	Illumina GAIIx	Phase_I	65	4	NM_015549	0	0	7	7	0	A1L389|B5MEC9|O60339|Q6GMS3|Q6P4B1|Q7L3S3|Q86SW7|Q8TEF5|Q96EW6|Q9BT82	Missense_Mutation	SNP	ENST00000394691.1	37		.	.	.	.	.	.	.	.	.	.	C	8.413	0.844564	0.16963	.	.	ENSG00000126822	ENST00000247226;ENST00000394691;ENST00000471182;ENST00000484731	T;T;T;T	0.60672	0.62;0.17;1.5;1.5	5.54	2.62	0.31277	.	0.991035	0.08188	N	0.984416	T	0.38214	0.1032	N	0.08118	0	0.09310	N	1	B;B;B;B	0.33904	0.232;0.015;0.305;0.431	B;B;B;B	0.35770	0.015;0.012;0.104;0.21	T	0.34900	-0.9810	10	0.72032	D	0.01	.	6.7622	0.23546	0.1321:0.6687:0.1275:0.0717	.	726;698;1193;1137	A1L390-2;G3V311;A1L390;A1L390-3	.;.;PKHG3_HUMAN;.	F	1137;1193;726;698	ENSP00000247226:S1137F;ENSP00000378183:S1193F;ENSP00000450945:S726F;ENSP00000450973:S698F	ENSP00000247226:S1137F	S	+	2	0	PLEKHG3	64280092	0.222000	0.23652	0.087000	0.20705	0.051000	0.14879	1.804000	0.38873	0.685000	0.31468	0.655000	0.94253	TCC	.		0.622	PLEKHG3-010	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000412028.1	NM_015549	
ACOT4	122970	hgsc.bcm.edu	37	14	74058832	74058832	+	Missense_Mutation	SNP	C	C	T	rs3742819	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr14:74058832C>T	ENST00000326303.4	+	1	423	c.169C>T	c.(169-171)Cgc>Tgc	p.R57C		NM_152331.3	NP_689544.3	Q8N9L9	ACOT4_HUMAN	acyl-CoA thioesterase 4	57			R -> C (in dbSNP:rs3742819). {ECO:0000269|PubMed:15489334}.		acyl-CoA metabolic process (GO:0006637)|dicarboxylic acid catabolic process (GO:0043649)|dicarboxylic acid metabolic process (GO:0043648)|long-chain fatty acid metabolic process (GO:0001676)|saturated monocarboxylic acid metabolic process (GO:0032788)|short-chain fatty acid metabolic process (GO:0046459)|succinyl-CoA metabolic process (GO:0006104)|unsaturated monocarboxylic acid metabolic process (GO:0032789)|very long-chain fatty acid metabolic process (GO:0000038)	peroxisome (GO:0005777)	acyl-CoA hydrolase activity (GO:0047617)|carboxylic ester hydrolase activity (GO:0052689)|palmitoyl-CoA hydrolase activity (GO:0016290)|receptor binding (GO:0005102)|succinyl-CoA hydrolase activity (GO:0004778)			endometrium(1)|large_intestine(3)|lung(4)	8				BRCA - Breast invasive adenocarcinoma(234;0.00331)		CGCCGACGCCCGCGGCGAGCT	0.761													C|||	1988	0.396965	0.1059	0.513	5008	,	,		12914	0.629		0.3926	False		,,,				2504	0.4734				p.R57C		.											.	ACOT4-90	0			c.C169T						.	C	CYS/ARG	496,3446		38,420,1513	6.0	7.0	6.0		169	-9.9	0.0	14	dbSNP_107	6	2402,5202		412,1578,1812	no	missense	ACOT4	NM_152331.3	180	450,1998,3325	TT,TC,CC		31.5886,12.5824,25.0996	possibly-damaging	57/422	74058832	2898,8648	1971	3802	5773	SO:0001583	missense	122970	exon1			GACGCCCGCGGCG	BC031799	CCDS9817.1	14q24.1	2011-02-16			ENSG00000177465	ENSG00000177465		"""Acyl CoA thioesterases"""	19748	protein-coding gene	gene with protein product		614314				16103133, 16940157	Standard	NM_152331		Approved	FLJ31235, PTE-Ib, PTE2B	uc001xoo.3	Q8N9L9	OTTHUMG00000169485	ENST00000326303.4:c.169C>T	14.37:g.74058832C>T	ENSP00000323071:p.Arg57Cys	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	20	18	NM_152331	0	0	0	1	1	Q17RF4|Q5BKT6|Q86TX0|Q86TX1|Q96N88	Missense_Mutation	SNP	ENST00000326303.4	37	CCDS9817.1	873	0.39972527472527475	60	0.12195121951219512	175	0.48342541436464087	366	0.6398601398601399	272	0.35883905013192613	C	13.86	2.362653	0.41902	0.125824	0.315886	ENSG00000177465	ENST00000326303	T	0.70516	-0.49	4.93	-9.85	0.00476	Acyl-CoA thioester hydrolase/bile acid-CoA amino acid N-acetyltransferase (1);	2.024500	0.02238	N	0.065442	T	0.00012	0.0000	L	0.53249	1.67	0.80722	P	0.0	P	0.51351	0.944	P	0.53954	0.738	T	0.48536	-0.9027	9	0.56958	D	0.05	-7.9166	15.5626	0.76262	0.2094:0.6193:0.1713:0.0	rs3742819	57	Q8N9L9	ACOT4_HUMAN	C	57	ENSP00000323071:R57C	ENSP00000323071:R57C	R	+	1	0	ACOT4	73128585	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.196000	0.03041	-2.884000	0.00318	-0.502000	0.04539	CGC	T|0.002;G|0.599		0.761	ACOT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404298.2	NM_152331	
ASB2	51676	broad.mit.edu	37	14	94405527	94405527	+	Missense_Mutation	SNP	T	T	G	rs199833352		TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr14:94405527T>G	ENST00000315988.4	-	6	1888	c.1400A>C	c.(1399-1401)cAc>cCc	p.H467P	ASB2_ENST00000556337.1_5'Flank|RP11-131H24.4_ENST00000557646.1_5'Flank|ASB2_ENST00000555019.1_Missense_Mutation_p.H515P	NM_016150.4	NP_057234.2	Q96Q27	ASB2_HUMAN	ankyrin repeat and SOCS box containing 2	467					intracellular signal transduction (GO:0035556)|myoblast differentiation (GO:0045445)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|signal transduction (GO:0007165)|skeletal muscle cell differentiation (GO:0035914)	Cul5-RING ubiquitin ligase complex (GO:0031466)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(8)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|soft_tissue(1)|urinary_tract(1)	27		all_cancers(154;0.13)		COAD - Colon adenocarcinoma(157;0.217)|Epithelial(152;0.232)		GGCCGGCGGGTGCGGGCCGTT	0.692																																					p.H515P		.											.	ASB2-228	0			c.A1544C						.						11.0	13.0	12.0					14																	94405527		2100	4140	6240	SO:0001583	missense	51676	exon8			GGCGGGTGCGGGC	AF159164	CCDS9915.1, CCDS55940.1	14q31-q32	2013-01-10	2011-01-25					"""Ankyrin repeat domain containing"""	16012	protein-coding gene	gene with protein product		605759	"""ankyrin repeat and SOCS box-containing 2"""				Standard	NM_016150		Approved	ASB-2	uc001ycd.3	Q96Q27		ENST00000315988.4:c.1400A>C	14.37:g.94405527T>G	ENSP00000320675:p.His467Pro	Somatic	22	0		WXS	Illumina GAIIx	Phase_I	178	42	NM_001202429	0	0	1	1	0	B2RDP9|B4E166|Q9NSU5|Q9Y567	Missense_Mutation	SNP	ENST00000315988.4	37	CCDS9915.1	.	.	.	.	.	.	.	.	.	.	T	17.65	3.443232	0.63067	.	.	ENSG00000100628	ENST00000555019;ENST00000434324;ENST00000315988;ENST00000543546;ENST00000555507	T;T;T	0.69685	-0.42;-0.34;-0.32	5.07	3.92	0.45320	.	0.000000	0.85682	D	0.000000	T	0.80082	0.4558	M	0.80847	2.515	0.58432	D	0.999992	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.80764	0.987;0.994;0.987	T	0.78076	-0.2345	10	0.30854	T	0.27	.	12.1543	0.54068	0.0:0.0:0.1436:0.8564	.	483;515;467	B3KPZ6;B4E166;Q96Q27	.;.;ASB2_HUMAN	P	515;483;467;413;413	ENSP00000451575:H515P;ENSP00000320675:H467P;ENSP00000450940:H413P	ENSP00000320675:H467P	H	-	2	0	ASB2	93475280	1.000000	0.71417	1.000000	0.80357	0.565000	0.35776	7.714000	0.84703	0.781000	0.33589	-0.527000	0.04329	CAC	.		0.692	ASB2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000412845.1		
DICER1	23405	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	95571420	95571420	+	Frame_Shift_Del	DEL	G	G	-			TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr14:95571420delG	ENST00000526495.1	-	22	3548	c.3257delC	c.(3256-3258)cctfs	p.P1086fs	DICER1_ENST00000527414.1_Frame_Shift_Del_p.P1086fs|DICER1_ENST00000393063.1_Frame_Shift_Del_p.P1086fs|DICER1_ENST00000541352.1_Frame_Shift_Del_p.P1086fs|DICER1_ENST00000343455.3_Frame_Shift_Del_p.P1086fs|DICER1_ENST00000556045.1_Frame_Shift_Del_p.L10fs			Q9UPY3	DICER_HUMAN	dicer 1, ribonuclease type III	1086					angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac muscle cell development (GO:0055013)|cerebral cortex development (GO:0021987)|defense response to virus (GO:0051607)|embryonic hindlimb morphogenesis (GO:0035116)|gene expression (GO:0010467)|hair follicle cell proliferation (GO:0071335)|hair follicle morphogenesis (GO:0031069)|inner ear receptor cell development (GO:0060119)|intestinal epithelial cell development (GO:0060576)|lung development (GO:0030324)|mRNA stabilization (GO:0048255)|multicellular organism growth (GO:0035264)|negative regulation of Schwann cell proliferation (GO:0010626)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nerve development (GO:0021675)|neuron projection morphogenesis (GO:0048812)|olfactory bulb interneuron differentiation (GO:0021889)|peripheral nervous system myelin formation (GO:0032290)|positive regulation of gene expression (GO:0010628)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of myelination (GO:0031643)|positive regulation of Schwann cell differentiation (GO:0014040)|post-embryonic development (GO:0009791)|pre-miRNA processing (GO:0031054)|production of miRNAs involved in gene silencing by miRNA (GO:0035196)|production of siRNA involved in RNA interference (GO:0030422)|regulation of cell cycle (GO:0051726)|regulation of enamel mineralization (GO:0070173)|regulation of neuron differentiation (GO:0045664)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of viral genome replication (GO:0045069)|reproductive structure development (GO:0048608)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|spinal cord motor neuron differentiation (GO:0021522)|spindle assembly (GO:0051225)|spleen development (GO:0048536)|stem cell maintenance (GO:0019827)|targeting of mRNA for destruction involved in RNA interference (GO:0030423)|zygote asymmetric cell division (GO:0010070)	axon (GO:0030424)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|growth cone (GO:0030426)|RISC complex (GO:0016442)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|miRNA binding (GO:0035198)|ribonuclease III activity (GO:0004525)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(13)|kidney(3)|large_intestine(10)|lung(33)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)	75		all_cancers(154;0.0621)|all_epithelial(191;0.223)		Epithelial(152;0.211)|COAD - Colon adenocarcinoma(157;0.215)		AAAATCCGCAGGAAGTGATCT	0.453			"""Mis F, N"""		"""sex cord-stromal tumour, TGCT, embryonal rhadomyosarcoma"""	pleuropulmonary blastoma			Familial Multinodular Goiter ;DICER 1 syndrome																												p.P1086fs		.	yes	Rec	yes	Familial Pleuropulmonary Blastoma	14	14q32.13	23405	"""dicer 1, ribonuclease type III """		"""E, M, O"""	.	DICER1-961	0			c.3257delC						.						86.0	89.0	88.0					14																	95571420		2203	4300	6503	SO:0001589	frameshift_variant	23405	exon21	Familial Cancer Database	Adolescent Multinodular Goiter, incl. Multinodular Euthyroid Goiter & Non-Medullary Thyroid Cancer;incl. Pleuropulmonary Blastoma, Familial ; Cystic Nephroma, Familial	TCCGCAGGAAGTG	AB028449	CCDS9931.1, CCDS55941.1	14q32.13	2014-09-17	2008-02-20		ENSG00000100697	ENSG00000100697			17098	protein-coding gene	gene with protein product	"""dicer 1, double-stranded RNA-specific endoribonuclease"""	606241	"""Dicer1, Dcr-1 homolog (Drosophila)"", ""multinodular goitre 1"""	MNG1		10051563, 10786632, 21205968	Standard	NM_177438		Approved	Dicer, KIAA0928, K12H4.8-LIKE, HERNA	uc001ydw.2	Q9UPY3	OTTHUMG00000166134	ENST00000526495.1:c.3257delC	14.37:g.95571420delG	ENSP00000437256:p.Pro1086fs	Somatic	115	0		WXS	Illumina GAIIx	Phase_I	140	64	NM_030621	0	0	0	0	0	A7E2D3|B3KRG4|E0AD28|O95943|Q9UQ02	Frame_Shift_Del	DEL	ENST00000526495.1	37	CCDS9931.1																																																																																			.		0.453	DICER1-004	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387997.1		
CEP170B	283638	broad.mit.edu	37	14	105352885	105352890	+	In_Frame_Del	DEL	GCAGGA	GCAGGA	-	rs60001925|rs150426191	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr14:105352885_105352890delGCAGGA	ENST00000414716.3	+	12	2537_2542	c.2309_2314delGCAGGA	c.(2308-2316)cgcaggagc>cgc	p.RS771del	CEP170B_ENST00000453495.1_In_Frame_Del_p.RS772del|CEP170B_ENST00000556508.1_In_Frame_Del_p.RS701del|CEP170B_ENST00000418279.1_In_Frame_Del_p.RS701del	NM_001112726.2	NP_001106197.1	Q9Y4F5	C170B_HUMAN	centrosomal protein 170B	771						cytoplasm (GO:0005737)|microtubule (GO:0005874)											GACAGCAGACGCAGGAGCCCCCAGGA	0.694														358	0.0714856	0.0061	0.1196	5008	,	,		13278	0.1091		0.0775	False		,,,				2504	0.0808				p.770_772del		.											.	.	0			c.2309_2314del						.		,	62,3458		5,52,1703					,	3.2	0.0		dbSNP_129	9	575,7107		59,457,3325	no	coding,coding	KIAA0284	NM_015005.2,NM_001112726.2	,	64,509,5028	A1A1,A1R,RR		7.485,1.7614,5.6865	,	,		637,10565				SO:0001651	inframe_deletion	283638	exon12			GCAGACGCAGGAG	AB006622	CCDS45175.1, CCDS45176.1, CCDS45176.2	14q32.33	2014-02-20	2012-11-30	2012-11-30	ENSG00000099814	ENSG00000099814			20362	protein-coding gene	gene with protein product	"""Cep170-related"""		"""KIAA0284"""	KIAA0284		23087211	Standard	NM_015005		Approved	FAM68C, Cep170R	uc010axb.4	Q9Y4F5	OTTHUMG00000170763	ENST00000414716.3:c.2309_2314delGCAGGA	14.37:g.105352885_105352890delGCAGGA	ENSP00000404151:p.Arg771_Ser772del	Somatic	5	0		WXS	Illumina GAIIx	Phase_I	35	13	NM_001112726	0	0	0	0	0	Q2KHR7|Q86TI7	In_Frame_Del	DEL	ENST00000414716.3	37	CCDS45175.1																																																																																			.		0.694	CEP170B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000410289.2	NM_001112726	
AHNAK2	113146	bcgsc.ca	37	14	105414629	105414629	+	Missense_Mutation	SNP	G	G	A	rs72702027	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr14:105414629G>A	ENST00000333244.5	-	7	7278	c.7159C>T	c.(7159-7161)Cca>Tca	p.P2387S	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2387						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.K2385fs*18(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GGGCCCTCTGGGAGTTTCACA	0.637													.|||	2664	0.531949	0.5673	0.5101	5008	,	,		16631	0.4048		0.5328	False		,,,				2504	0.6299				p.P2387S		.											.	AHNAK2-47	1	Deletion - Frameshift(1)	ovary(1)	c.C7159T						.	G	SER/PRO	2290,1486		726,838,324	104.0	117.0	113.0		7159	0.8	0.0	14	dbSNP_131	113	4464,3752		1227,2010,871	no	missense	AHNAK2	NM_138420.2	74	1953,2848,1195	AA,AG,GG		45.667,39.3538,43.6791	possibly-damaging	2387/5796	105414629	6754,5238	1888	4108	5996	SO:0001583	missense	113146	exon7			CCTCTGGGAGTTT	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.7159C>T	14.37:g.105414629G>A	ENSP00000353114:p.Pro2387Ser	Somatic	132	0		WXS	Illumina GAIIx	Phase_I	191	6	NM_138420	0	0	0	0	0	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	1113	0.5096153846153846	297	0.6036585365853658	201	0.5552486187845304	217	0.3793706293706294	398	0.525065963060686	-	15.77	2.932190	0.52866	0.606462	0.54333	ENSG00000185567	ENST00000333244	T	0.03242	4.0	4.0	0.756	0.18421	.	.	.	.	.	T	0.00012	0.0000	M	0.90870	3.155	0.80722	P	0.0	P	0.44344	0.833	P	0.52758	0.708	T	0.27938	-1.0059	8	0.45353	T	0.12	.	16.3569	0.83237	0.0:0.575:0.425:0.0	.	2387	Q8IVF2	AHNK2_HUMAN	S	2387	ENSP00000353114:P2387S	ENSP00000353114:P2387S	P	-	1	0	AHNAK2	104485674	0.002000	0.14202	0.001000	0.08648	0.010000	0.07245	0.145000	0.16157	0.151000	0.19162	0.485000	0.47835	CCA	G|0.478;A|0.522		0.637	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
LACTB	114294	hgsc.bcm.edu	37	15	63414083	63414083	+	Missense_Mutation	SNP	A	A	C	rs34317102	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr15:63414083A>C	ENST00000261893.4	+	1	85	c.13A>C	c.(13-15)Atg>Ctg	p.M5L	LACTB_ENST00000413507.2_Missense_Mutation_p.M5L	NM_032857.3	NP_116246.2	P83111	LACTB_HUMAN	lactamase, beta	5				M -> L (in Ref. 1 and 2). {ECO:0000305}.		cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	hydrolase activity (GO:0016787)			NS(1)|breast(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)|stomach(1)	12						GTACCGGCTCATGTCAGCAGT	0.751													C|||	3981	0.794928	0.6725	0.8256	5008	,	,		8367	0.997		0.7316	False		,,,				2504	0.7955				p.M5L	Melanoma(85;443 1381 6215 27308 35583)	.											.	LACTB-90	0			c.A13C						.	C	LEU/MET,LEU/MET	1936,668		733,470,99	4.0	4.0	4.0		13,13	3.1	1.0	15	dbSNP_126	4	4375,1183		1737,901,141	yes	missense,missense	LACTB	NM_032857.3,NM_171846.2	15,15	2470,1371,240	CC,CA,AA		21.2846,25.6528,22.6783	benign,benign	5/548,5/374	63414083	6311,1851	1302	2779	4081	SO:0001583	missense	114294	exon1			CGGCTCATGTCAG	AK027808	CCDS10182.1, CCDS45275.1	15q22.1	2012-11-14	2001-12-12	2001-12-14	ENSG00000103642	ENSG00000103642		"""Mitochondrial ribosomal proteins / large subunits"""	16468	protein-coding gene	gene with protein product		608440	"""mitochondrial ribosomal protein L56"""	MRPL56		11707067	Standard	NM_032857		Approved	FLJ14902	uc002alw.3	P83111	OTTHUMG00000132807	ENST00000261893.4:c.13A>C	15.37:g.63414083A>C	ENSP00000261893:p.Met5Leu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	13	6	NM_171846	0	0	5	5	0	P83096	Missense_Mutation	SNP	ENST00000261893.4	37	CCDS10182.1	1713	0.7843406593406593	304	0.6178861788617886	287	0.7928176795580111	568	0.993006993006993	554	0.7308707124010554	C	0.674	-0.800779	0.02841	0.743472	0.787154	ENSG00000103642	ENST00000261893;ENST00000413507	T	0.33216	1.42	3.1	3.1	0.35709	.	0.592824	0.14749	N	0.300689	T	0.00012	0.0000	N	0.02539	-0.55	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.37842	-0.9688	9	0.02654	T	1	0.0321	7.626	0.28212	0.2541:0.7459:0.0:0.0	rs34317102	5	P83111	LACTB_HUMAN	L	5	ENSP00000261893:M5L	ENSP00000261893:M5L	M	+	1	0	LACTB	61201136	0.994000	0.37717	0.956000	0.39512	0.117000	0.20001	0.346000	0.19997	0.640000	0.30582	-0.677000	0.03784	ATG	A|0.226;C|0.774		0.751	LACTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256224.1	NM_032857	
MTFMT	123263	hgsc.bcm.edu	37	15	65321938	65321938	+	Missense_Mutation	SNP	A	A	G	rs2946655	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr15:65321938A>G	ENST00000220058.4	-	1	27	c.14T>C	c.(13-15)gTg>gCg	p.V5A	MTFMT_ENST00000561025.1_5'Flank	NM_139242.3	NP_640335.2	Q96DP5	FMT_HUMAN	mitochondrial methionyl-tRNA formyltransferase	5			V -> A (in dbSNP:rs2946655).			mitochondrion (GO:0005739)	methionyl-tRNA formyltransferase activity (GO:0004479)			endometrium(1)|large_intestine(3)|lung(3)|ovary(3)	10					Tetrahydrofolic acid(DB00116)	ACAGCGCCGCACCAACACCCT	0.756													A|||	338	0.067492	0.1641	0.0389	5008	,	,		7250	0.0169		0.0398	False		,,,				2504	0.0378				p.V5A		.											.	MTFMT-24	0			c.T14C						.	A	ALA/VAL	143,1983		1,141,921	2.0	2.0	2.0		14	-4.2	0.0	15	dbSNP_101	2	108,5112		0,108,2502	no	missense	MTFMT	NM_139242.3	64	1,249,3423	GG,GA,AA		2.069,6.7262,3.4168	benign	5/390	65321938	251,7095	1063	2610	3673	SO:0001583	missense	123263	exon1			CGCCGCACCAACA	AK055688	CCDS45280.1	15q22.31	2006-11-29		2005-08-09		ENSG00000103707			29666	protein-coding gene	gene with protein product		611766				9614118	Standard	NM_139242		Approved	FMT1	uc002aof.4	Q96DP5		ENST00000220058.4:c.14T>C	15.37:g.65321938A>G	ENSP00000220058:p.Val5Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	22	8	NM_139242	0	0	5	19	14	B7Z734	Missense_Mutation	SNP	ENST00000220058.4	37	CCDS45280.1	124	0.056776556776556776	72	0.14634146341463414	16	0.04419889502762431	11	0.019230769230769232	25	0.032981530343007916	A	12.07	1.827975	0.32329	0.067262	0.02069	ENSG00000103707	ENST00000220058;ENST00000543678	T;T	0.66280	-0.14;-0.2	4.72	-4.22	0.03800	.	1.925310	0.03217	N	0.176917	T	0.00271	0.0008	N	0.24115	0.695	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.03344	-1.1046	9	0.27785	T	0.31	-0.3296	6.2961	0.21087	0.233:0.3076:0.4595:0.0	rs2946655;rs2946655	5	Q96DP5	FMT_HUMAN	A	5	ENSP00000220058:V5A;ENSP00000443754:V5A	ENSP00000220058:V5A	V	-	2	0	MTFMT	63108991	0.000000	0.05858	0.000000	0.03702	0.074000	0.17049	0.089000	0.15002	-0.347000	0.08299	0.524000	0.50904	GTG	A|0.942;G|0.058		0.756	MTFMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418155.1	NM_139242	
KBTBD13	390594	hgsc.bcm.edu	37	15	65369947	65369947	+	Missense_Mutation	SNP	G	G	A	rs146917406	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr15:65369947G>A	ENST00000432196.2	+	1	794	c.794G>A	c.(793-795)gGc>gAc	p.G265D	RASL12_ENST00000434605.2_5'Flank	NM_001101362.2	NP_001094832.1	C9JR72	KBTBD_HUMAN	kelch repeat and BTB (POZ) domain containing 13	265					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				lung(1)|prostate(1)|skin(1)	3						GCCATCGGCGGCGAATTCCAG	0.731													g|||	20	0.00399361	0.0008	0.0058	5008	,	,		12084	0.0		0.0089	False		,,,				2504	0.0061				p.G265D		.											.	.	0			c.G794A						.		ASP/GLY	7,3503		0,7,1748	4.0	6.0	6.0		794	5.3	1.0	15	dbSNP_134	6	101,7689		0,101,3794	yes	missense	KBTBD13	NM_001101362.2	94	0,108,5542	AA,AG,GG		1.2965,0.1994,0.9558	probably-damaging	265/459	65369947	108,11192	1755	3895	5650	SO:0001583	missense	390594	exon1			TCGGCGGCGAATT		CCDS45281.1	15q22.31	2014-09-17			ENSG00000234438	ENSG00000234438		"""BTB/POZ domain containing"""	37227	protein-coding gene	gene with protein product	"""nemaline myopathy type 6"""	613727				21109227, 22542517	Standard	NM_001101362		Approved	hCG_1645727, NEM6	uc010uis.2	C9JR72		ENST00000432196.2:c.794G>A	15.37:g.65369947G>A	ENSP00000388723:p.Gly265Asp	Somatic	4	0		WXS	Illumina GAIIx	Phase_I	28	16	NM_001101362	0	0	0	0	0		Missense_Mutation	SNP	ENST00000432196.2	37	CCDS45281.1	18	0.008241758241758242	7	0.014227642276422764	3	0.008287292817679558	0	0.0	8	0.010554089709762533	g	20.9	4.061646	0.76187	0.001994	0.012965	ENSG00000234438	ENST00000432196	D	0.99494	-6.01	5.28	5.28	0.74379	Kelch-type beta propeller (1);	.	.	.	.	D	0.99554	0.9840	H	0.95328	3.655	0.52501	D	0.999954	D	0.89917	1.0	D	0.97110	1.0	D	0.95058	0.8193	9	0.87932	D	0	.	18.5255	0.90971	0.0:0.0:1.0:0.0	.	265	C9JR72	KBTBD_HUMAN	D	265	ENSP00000388723:G265D	ENSP00000388723:G265D	G	+	2	0	KBTBD13	63157000	1.000000	0.71417	0.997000	0.53966	0.304000	0.27724	9.522000	0.98032	2.456000	0.83038	0.651000	0.88453	GGC	G|0.992;A|0.008		0.731	KBTBD13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418468.2	NM_001101362	
RPS2	6187	hgsc.bcm.edu	37	16	2014528	2014528	+	Silent	SNP	G	G	A	rs17135712	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr16:2014528G>A	ENST00000343262.4	-	2	155	c.99C>T	c.(97-99)atC>atT	p.I33I	RPS2_ENST00000529806.1_Silent_p.I33I|RNF151_ENST00000321392.3_5'Flank|SNHG9_ENST00000459373.1_lincRNA|RPS2_ENST00000530225.1_Silent_p.I33I|RNF151_ENST00000569714.1_5'Flank|RPS2_ENST00000526522.1_Silent_p.I33I|RNF151_ENST00000569210.2_5'Flank|SNORA10_ENST00000384084.1_RNA|SNORA64_ENST00000384674.1_RNA	NM_002952.3	NP_002943.2	P15880	RS2_HUMAN	ribosomal protein S2	33	Arg/Gly-rich.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of transferase activity (GO:0051347)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|urinary_tract(2)	7						CCCGGCCCCGGATGCCACTGC	0.751													G|||	533	0.10643	0.0045	0.1873	5008	,	,		12219	0.0149		0.1143	False		,,,				2504	0.273				p.I33I		.											.	RPS2-90	0			c.C99T						.	G		74,3152		0,74,1539	5.0	8.0	7.0		99	-2.2	0.3	16	dbSNP_123	7	745,6175		36,673,2751	no	coding-synonymous	RPS2	NM_002952.3		36,747,4290	AA,AG,GG		10.7659,2.2939,8.0721		33/294	2014528	819,9327	1613	3460	5073	SO:0001819	synonymous_variant	6187	exon2			GCCCCGGATGCCA	AB007147	CCDS10452.1	16p13.3	2011-04-05			ENSG00000140988	ENSG00000140988		"""S ribosomal proteins"""	10404	protein-coding gene	gene with protein product		603624				9582194	Standard	NM_002952		Approved	LLREP3, S2	uc002cno.2	P15880	OTTHUMG00000128708	ENST00000343262.4:c.99C>T	16.37:g.2014528G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	22	8	NM_002952	0	0	75	230	155	B2R5G0|D3DU82|Q3MIB1	Silent	SNP	ENST00000343262.4	37	CCDS10452.1																																																																																			G|0.933;A|0.067		0.751	RPS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250613.2	NM_002952	
ZNF598	90850	hgsc.bcm.edu	37	16	2059674	2059674	+	Missense_Mutation	SNP	T	T	C	rs71384660		TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr16:2059674T>C	ENST00000431526.1	-	2	88	c.74A>G	c.(73-75)gAa>gGa	p.E25G	ZNF598_ENST00000563630.1_5'UTR|ZNF598_ENST00000562103.1_5'UTR	NM_178167.2	NP_835461.2	Q86UK7	ZN598_HUMAN	zinc finger protein 598	25							poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|lung(7)|skin(1)|urinary_tract(1)	16						GCTCCCGCCTTCCCGCTCAGG	0.766													C|||	5008	1.0	1.0	1.0	5008	,	,		5162	1.0		1.0	False		,,,				2504	1.0				p.E25G		.											.	ZNF598-432	0			c.A74G						.						1.0	2.0	2.0					16																	2059674		1089	2314	3403	SO:0001583	missense	90850	exon2			CCGCCTTCCCGCT	BC029270		16p13.3	2008-05-02				ENSG00000167962		"""Zinc fingers, C2H2-type"""	28079	protein-coding gene	gene with protein product							Standard	NM_178167		Approved	FLJ00086	uc002cof.2	Q86UK7		ENST00000431526.1:c.74A>G	16.37:g.2059674T>C	ENSP00000411409:p.Glu25Gly	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_178167	0	0	0	8	8	Q8IW49|Q8N3D9|Q96FG3|Q9H7J3	Missense_Mutation	SNP	ENST00000431526.1	37		2168	0.9926739926739927	487	0.9898373983739838	361	0.9972375690607734	568	0.993006993006993	752	0.9920844327176781	N	1.560	-0.537056	0.04082	.	.	ENSG00000167962	ENST00000431526	T	0.77098	-1.07	3.3	3.3	0.37823	.	0.415485	0.23105	N	0.051871	T	0.00012	0.0000	.	.	.	0.48696	P	3.1000000000003247E-4	.	.	.	.	.	.	T	0.34650	-0.9820	6	0.22706	T	0.39	-7.8624	8.393	0.32540	0.0:0.8796:0.0:0.1204	.	.	.	.	G	25	ENSP00000411409:E25G	ENSP00000411409:E25G	E	-	2	0	ZNF598	1999675	1.000000	0.71417	1.000000	0.80357	0.107000	0.19398	0.911000	0.28584	0.691000	0.31592	-0.642000	0.03964	GAA	T|0.007;C|0.993		0.766	ZNF598-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_178167	
TSC2	7249	bcgsc.ca	37	16	2138269	2138269	+	Silent	SNP	T	T	C	rs137854091|rs1748	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr16:2138269T>C	ENST00000219476.3	+	41	5832	c.5202T>C	c.(5200-5202)gaT>gaC	p.D1734D	TSC2_ENST00000353929.4_Silent_p.D1691D|TSC2_ENST00000439673.2_Silent_p.D1631D|MIR1225_ENST00000408729.1_RNA|TSC2_ENST00000401874.2_Silent_p.D1667D|TSC2_ENST00000350773.4_Silent_p.D1711D|TSC2_ENST00000382538.6_Silent_p.D1619D|TSC2_ENST00000568454.1_Silent_p.D1678D	NM_000548.3	NP_000539.2	P49815	TSC2_HUMAN	tuberous sclerosis 2	1734	Rap-GAP. {ECO:0000255|PROSITE- ProRule:PRU00165}.				acute-phase response (GO:0006953)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive chemotaxis (GO:0050918)|positive regulation of Ras GTPase activity (GO:0032320)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein import into nucleus (GO:0006606)|protein kinase B signaling (GO:0043491)|protein localization (GO:0008104)|regulation of cell cycle (GO:0051726)|regulation of endocytosis (GO:0030100)|regulation of insulin receptor signaling pathway (GO:0046626)|response to hypoxia (GO:0001666)|vesicle-mediated transport (GO:0016192)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|TSC1-TSC2 complex (GO:0033596)	GTPase activator activity (GO:0005096)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(3)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|soft_tissue(1)	56		Hepatocellular(780;0.0202)				ACCCCACCGATATCTACCCCT	0.652			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis				C|||	1384	0.276358	0.7481	0.1988	5008	,	,		14957	0.0		0.1839	False		,,,				2504	0.0736				p.D1734D		.	yes	Rec		Tuberous sclerosis 2	16	16p13.3	7249	tuberous sclerosis 2 gene		"""E, O"""	.	TSC2-1908	0			c.T5202C						.	C	,,	2789,1607	496.0+/-363.4	885,1019,294	96.0	103.0	101.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	5202,5001,5133	3.2	1.0	16	dbSNP_36	101	1531,7067	745.9+/-407.3	140,1251,2908	no	coding-synonymous,coding-synonymous,coding-synonymous	TSC2	NM_000548.3,NM_001077183.1,NM_001114382.1	,,	1025,2270,3202	CC,CT,TT		17.8065,36.556,33.2461	,,	1734/1808,1667/1741,1711/1785	2138269	4320,8674	2198	4299	6497	SO:0001819	synonymous_variant	7249	exon41	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	CACCGATATCTAC	AB014460	CCDS10458.1, CCDS45384.1, CCDS58408.1	16p13.3	2014-09-17			ENSG00000103197	ENSG00000103197			12363	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 160"""	191092		TSC4		1303246, 7558029	Standard	NM_001077183		Approved	tuberin, LAM, PPP1R160	uc002con.3	P49815	OTTHUMG00000128745	ENST00000219476.3:c.5202T>C	16.37:g.2138269T>C		Somatic	56	0		WXS	Illumina GAIIx	Phase_I	121	5	NM_000548	0	0	65	65	0	A7E2E2|B4DIL8|B4DIQ7|B4DRN2|B7Z2B8|C9J378|O75275|Q4LE71|Q8TAZ1	Silent	SNP	ENST00000219476.3	37	CCDS10458.1																																																																																			T|0.505;G|0.066;C|0.239;A|0.190		0.652	TSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250657.2	NM_000548	
RSL1D1	26156	bcgsc.ca	37	16	11940390	11940390	+	Silent	SNP	T	T	C	rs8052900	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr16:11940390T>C	ENST00000571133.1	-	5	675	c.603A>G	c.(601-603)acA>acG	p.T201T	RSL1D1_ENST00000542106.1_5'UTR	NM_015659.2	NP_056474.2	O76021	RL1D1_HUMAN	ribosomal L1 domain containing 1	201					osteoblast differentiation (GO:0001649)|regulation of apoptotic process (GO:0042981)|regulation of cellular senescence (GO:2000772)|regulation of protein localization (GO:0032880)	membrane (GO:0016020)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)	p.T201T(1)		NS(1)|breast(1)|kidney(1)|large_intestine(2)|lung(5)|prostate(1)|stomach(2)|urinary_tract(2)	15						TGTTTAAGACTGTTCCACCTA	0.333													C|||	3523	0.703474	0.9788	0.7983	5008	,	,		18858	0.4355		0.6551	False		,,,				2504	0.59				p.T201T		.											.	RSL1D1-90	1	Substitution - coding silent(1)	stomach(1)	c.A603G						.	C		4084,310	165.1+/-196.6	1898,288,11	102.0	101.0	101.0		603	-3.7	0.0	16	dbSNP_116	101	5715,2885	450.9+/-362.5	1882,1951,467	no	coding-synonymous	RSL1D1	NM_015659.2		3780,2239,478	CC,CT,TT		33.5465,7.0551,24.5883		201/491	11940390	9799,3195	2197	4300	6497	SO:0001819	synonymous_variant	26156	exon5			TAAGACTGTTCCA	AY154473	CCDS10551.1	16p13.13	2011-08-12			ENSG00000171490	ENSG00000171490			24534	protein-coding gene	gene with protein product		615874				15334068, 9859858	Standard	NM_015659		Approved	PBK1, L12, DKFZP564M182, CSIG, UTP30	uc002dbp.1	O76021	OTTHUMG00000129824	ENST00000571133.1:c.603A>G	16.37:g.11940390T>C		Somatic	119	0		WXS	Illumina GAIIx	Phase_I	112	6	NM_015659	0	0	130	131	1	B4DJ58|D3DUG7|Q2M1T7|Q6PL22|Q8IWS7|Q8WUZ1|Q9HDA9|Q9Y3Z9	Silent	SNP	ENST00000571133.1	37	CCDS10551.1																																																																																			T|0.271;C|0.729		0.333	RSL1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252059.2	NM_015659	
GP2	2813	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	20335574	20335574	+	Silent	SNP	A	A	G			TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr16:20335574A>G	ENST00000381362.4	-	3	175	c.99T>C	c.(97-99)taT>taC	p.Y33Y	GP2_ENST00000381360.5_Intron|GP2_ENST00000302555.5_Silent_p.Y33Y|GP2_ENST00000341642.5_Intron|GP2_ENST00000573897.1_5'Flank	NM_001007240.1|NM_001502.2	NP_001007241.2|NP_001493.2	P55259	GP2_HUMAN	glycoprotein 2 (zymogen granule membrane)	33					antigen transcytosis by M cells in mucosal-associated lymphoid tissue (GO:0002412)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)	antigen binding (GO:0003823)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	48						TGGGGTTTCCATAACCTGGGA	0.512																																					p.Y33Y		.											.	GP2-94	0			c.T99C						.						37.0	35.0	36.0					16																	20335574		2203	4300	6503	SO:0001819	synonymous_variant	2813	exon3			GTTTCCATAACCT	U36221	CCDS10582.2, CCDS42128.1, CCDS45432.1, CCDS45433.1	16p12.3	2008-02-05			ENSG00000169347	ENSG00000169347			4441	protein-coding gene	gene with protein product		602977				9605860	Standard	XM_005255259		Approved		uc002dgw.3	P55259	OTTHUMG00000131489	ENST00000381362.4:c.99T>C	16.37:g.20335574A>G		Somatic	149	0		WXS	Illumina GAIIx	Phase_I	208	82	NM_001502	0	0	0	0	0	A6NFM9|A6NJA8|Q13338|Q9UIF1	Silent	SNP	ENST00000381362.4	37	CCDS42128.1																																																																																			.		0.512	GP2-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000436920.1	NM_016295	
RBBP6	5930	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	24580870	24580870	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr16:24580870A>C	ENST00000319715.4	+	17	3291	c.2859A>C	c.(2857-2859)ttA>ttC	p.L953F	RBBP6_ENST00000348022.2_Missense_Mutation_p.L919F|RBBP6_ENST00000381039.3_Intron	NM_006910.4	NP_008841.2	Q7Z6E9	RBBP6_HUMAN	retinoblastoma binding protein 6	953					embryonic organ development (GO:0048568)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|somite development (GO:0061053)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(4)|pancreas(1)|prostate(2)|urinary_tract(1)	46				GBM - Glioblastoma multiforme(48;0.0518)		ACCCAGAGTTATTAGAGACTT	0.393																																					p.L953F		.											.	RBBP6-230	0			c.A2859C						.						52.0	56.0	55.0					16																	24580870		2170	4283	6453	SO:0001583	missense	5930	exon17			AGAGTTATTAGAG		CCDS10621.1, CCDS10622.1, CCDS45444.1	16p12.2	2008-08-04	2001-11-28		ENSG00000122257	ENSG00000122257			9889	protein-coding gene	gene with protein product	"""proliferation potential-related protein"""	600938	"""retinoblastoma-binding protein 6"""			8595913, 16396680	Standard	NM_006910		Approved	P2P-R, PACT, SNAMA	uc002dmh.3	Q7Z6E9	OTTHUMG00000096991	ENST00000319715.4:c.2859A>C	16.37:g.24580870A>C	ENSP00000317872:p.Leu953Phe	Somatic	60	0		WXS	Illumina GAIIx	Phase_I	78	35	NM_006910	0	0	6	17	11	Q147T5|Q15290|Q6DKH4|Q6P4C2|Q6YNC9|Q7Z6E8|Q8N0V2|Q96PH3|Q9H3I8|Q9H5M5|Q9NPX4	Missense_Mutation	SNP	ENST00000319715.4	37	CCDS10621.1	.	.	.	.	.	.	.	.	.	.	A	15.19	2.760421	0.49468	.	.	ENSG00000122257	ENST00000319715;ENST00000348022	T;T	0.16324	2.35;2.35	5.54	0.34	0.15985	.	0.000000	0.44902	D	0.000413	T	0.14743	0.0356	N	0.19112	0.55	0.24477	N	0.994369	D;D	0.65815	0.995;0.991	P;P	0.55161	0.77;0.454	T	0.25433	-1.0132	10	0.12766	T	0.61	-10.1252	10.3128	0.43718	0.6687:0.0:0.3313:0.0	.	919;953	Q7Z6E9-2;Q7Z6E9	.;RBBP6_HUMAN	F	953;919	ENSP00000317872:L953F;ENSP00000316291:L919F	ENSP00000317872:L953F	L	+	3	2	RBBP6	24488371	0.100000	0.21855	0.830000	0.32933	0.993000	0.82548	-0.040000	0.12104	0.288000	0.22398	0.533000	0.62120	TTA	.		0.393	RBBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214067.2	NM_006910	
INO80E	283899	broad.mit.edu	37	16	30007665	30007665	+	Frame_Shift_Del	DEL	A	A	-			TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr16:30007665delA	ENST00000563197.1	+	1	1051	c.34delA	c.(34-36)aaafs	p.K14fs	INO80E_ENST00000563040.1_3'UTR|INO80E_ENST00000304516.7_Frame_Shift_Del_p.K14fs|INO80E_ENST00000567254.1_Frame_Shift_Del_p.K14fs|INO80E_ENST00000567705.1_Frame_Shift_Del_p.K14fs|HIRIP3_ENST00000566471.1_5'Flank|HIRIP3_ENST00000564026.1_5'Flank|HIRIP3_ENST00000279392.3_5'UTR	NM_173618.1	NP_775889.1	Q8NBZ0	IN80E_HUMAN	INO80 complex subunit E	14					DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Ino80 complex (GO:0031011)|nucleolus (GO:0005730)|nucleus (GO:0005634)				endometrium(1)|large_intestine(2)|lung(1)|skin(1)|urinary_tract(1)	6						AGTGGACTACAAAAAAAAATA	0.632																																					p.K12fs		.											.	INO80E-91	0			c.34delA						.			60,46,4144		0,1,59,0,45,2020	28.0	31.0	30.0			5.2	1.0	16	dbSNP_126	30	90,92,8032		0,0,90,2,88,3927	no	codingComplex	INO80E	NM_173618.1		0,1,149,2,133,5947	A1A1,A1A2,A1R,A2A2,A2R,RR		2.2157,2.4941,2.3107			30007665	150,138,12176	2193	4283	6476	SO:0001589	frameshift_variant	283899	exon1			GACTACAAAAAAA	AK075133	CCDS10665.1	16p11.2	2011-07-06	2008-08-07	2008-08-07	ENSG00000169592	ENSG00000169592		"""INO80 complex subunits"""	26905	protein-coding gene	gene with protein product			"""coiled-coil domain containing 95"""	CCDC95		16230350	Standard	NM_173618		Approved	FLJ90652	uc002dvg.1	Q8NBZ0	OTTHUMG00000132114	ENST00000563197.1:c.34delA	16.37:g.30007665delA	ENSP00000457016:p.Lys14fs	Somatic	174	0		WXS	Illumina GAIIx	Phase_I	310	8	NM_173618	0	0	0	0	0	Q6Y2K3	Frame_Shift_Del	DEL	ENST00000563197.1	37	CCDS10665.1																																																																																			.		0.632	INO80E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255156.2	NM_173618	
IRX3	79191	hgsc.bcm.edu	37	16	54318528	54318528	+	Missense_Mutation	SNP	A	A	G	rs1450355	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr16:54318528A>G	ENST00000329734.3	-	2	1977	c.1265T>C	c.(1264-1266)cTg>cCg	p.L422P		NM_024336.2	NP_077312.2	P78415	IRX3_HUMAN	iroquois homeobox 3	422	Pro-rich.		L -> P (in dbSNP:rs1450355). {ECO:0000269|PubMed:15489334}.		mesoderm development (GO:0007498)|metanephros development (GO:0001656)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of neuron differentiation (GO:0045666)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)|transcription, DNA-templated (GO:0006351)	axon (GO:0030424)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|soft_tissue(1)|urinary_tract(1)	14						GAGCGGGTGCAGGCGGGGGCC	0.776													g|||	4851	0.96865	0.888	0.987	5008	,	,		8017	1.0		1.0	False		,,,				2504	1.0				p.L422P	GBM(143;1830 1866 4487 4646 37383)	.											.	IRX3-90	0			c.T1265C						.	T	PRO/LEU	1678,102		788,102,0	1.0	2.0	2.0		1265	2.5	1.0	16	dbSNP_88	2	4195,3		2096,3,0	no	missense	IRX3	NM_024336.2	98	2884,105,0	GG,GA,AA		0.0715,5.7303,1.7564	benign	422/502	54318528	5873,105	890	2099	2989	SO:0001583	missense	79191	exon2			GGGTGCAGGCGGG	U90308	CCDS10750.1	16q12.2	2011-06-20	2007-07-13		ENSG00000177508	ENSG00000177508		"""Homeoboxes / TALE class"""	14360	protein-coding gene	gene with protein product		612985					Standard	NM_024336		Approved	IRX-1	uc002eht.1	P78415	OTTHUMG00000133200	ENST00000329734.3:c.1265T>C	16.37:g.54318528A>G	ENSP00000331608:p.Leu422Pro	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_024336	0	0	0	1	1	Q7Z4A4|Q7Z4A5|Q8IVC6	Missense_Mutation	SNP	ENST00000329734.3	37	CCDS10750.1	2108	0.9652014652014652	433	0.8800813008130082	354	0.9779005524861878	567	0.9912587412587412	754	0.9947229551451188	g	5.642	0.303067	0.10678	0.942697	0.999285	ENSG00000177508	ENST00000329734	T	0.54279	0.58	4.4	2.45	0.29901	.	0.652897	0.14990	N	0.286760	T	0.00012	0.0000	N	0.01352	-0.895	0.29914	P	0.82336	B	0.02656	0.0	B	0.01281	0.0	T	0.21861	-1.0233	9	0.33940	T	0.23	-4.0049	5.143	0.14969	0.1733:0.0:0.6627:0.164	rs1450355;rs17852160;rs60836119	422	P78415	IRX3_HUMAN	P	422	ENSP00000331608:L422P	ENSP00000331608:L422P	L	-	2	0	IRX3	52876029	1.000000	0.71417	0.984000	0.44739	0.000000	0.00434	1.455000	0.35190	0.155000	0.19261	-1.528000	0.00924	CTG	T|0.035;G|0.004		0.776	IRX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256910.2		
CLEC18A	348174	ucsc.edu	37	16	69988260	69988260	+	Silent	SNP	G	G	A	rs684036	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr16:69988260G>A	ENST00000288040.6	+	3	427	c.240G>A	c.(238-240)caG>caA	p.Q80Q	CLEC18A_ENST00000568461.1_Silent_p.Q80Q|CLEC18A_ENST00000449317.2_Silent_p.Q80Q|CLEC18A_ENST00000393701.2_Silent_p.Q80Q	NM_001136214.2	NP_001129686.1	A5D8T8	CL18A_HUMAN	C-type lectin domain family 18, member A	80	SCP.					extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)			NS(1)|endometrium(2)|lung(1)|skin(1)	5						GCCTGGCCCAGCTGGCTCAAG	0.647													.|||	759	0.151558	0.0174	0.2709	5008	,	,		17235	0.0704		0.328	False		,,,				2504	0.1503				p.Q80Q		.											.	CLEC18A-68	0			c.G240A						.	A	,	3,4371		0,3,2184	48.0	36.0	40.0		240,240	-3.4	0.0	16	dbSNP_83	40	221,7801		0,221,3790	no	coding-synonymous,coding-synonymous	CLEC18A	NM_001136214.1,NM_182619.2	,	0,224,5974	AA,AG,GG		2.7549,0.0686,1.807	,	80/447,80/447	69988260	224,12172	2187	4011	6198	SO:0001819	synonymous_variant	348174	exon4			GGCCCAGCTGGCT	AF428259	CCDS10886.1	16q22.1	2010-04-27	2009-03-10	2009-03-10		ENSG00000157322		"""C-type lectin domain containing"""	30388	protein-coding gene	gene with protein product	"""mannose receptor-like"""					12975309	Standard	NM_001136214		Approved	MRCL	uc010vlo.3	A5D8T8		ENST00000288040.6:c.240G>A	16.37:g.69988260G>A		Somatic	112	21		WXS	Illumina GAIIx	Phase_I	220	61	NM_001271197	0	0	0	0	0	A8K1G9|Q6DCB3|Q7Z5K9|Q96HH2	Silent	SNP	ENST00000288040.6	37	CCDS10886.1																																																																																			G|0.500;A|0.500		0.647	CLEC18A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000268955.2	NM_182619	
MARVELD3	91862	ucsc.edu;bcgsc.ca	37	16	71674801	71674801	+	Silent	SNP	G	G	A			TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr16:71674801G>A	ENST00000299952.4	+	3	1147	c.1104G>A	c.(1102-1104)gtG>gtA	p.V368V	MARVELD3_ENST00000561682.1_Intron|MARVELD3_ENST00000565261.1_3'UTR|PHLPP2_ENST00000540628.1_3'UTR	NM_001017967.3|NM_001271329.1	NP_001017967.2|NP_001258258.1	Q96A59	MALD3_HUMAN	MARVEL domain containing 3	371	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|tight junction (GO:0005923)				NS(1)|endometrium(3)|large_intestine(5)|lung(6)|skin(2)	17		Ovarian(137;0.125)				GTCTTCTCGTGATCATGTACG	0.592																																					p.V368V		.											.	MARVELD3-91	0			c.G1104A						.						60.0	49.0	53.0					16																	71674801		2198	4300	6498	SO:0001819	synonymous_variant	91862	exon3			TCTCGTGATCATG	BC013376	CCDS10904.1, CCDS32478.1, CCDS59270.1	16q22.2	2008-02-05	2004-07-12	2004-07-14	ENSG00000140832	ENSG00000140832			30525	protein-coding gene	gene with protein product		614094	"""MARVEL (membrane-associating) domain containing 3"""	MRVLDC3			Standard	NM_001017967		Approved		uc002fat.4	Q96A59	OTTHUMG00000137591	ENST00000299952.4:c.1104G>A	16.37:g.71674801G>A		Somatic	259	2		WXS	Illumina GAIIx	Phase_I	361	157	NM_001017967	0	0	0	1	1	A8K820|H3BQM5|Q96MJ4	Silent	SNP	ENST00000299952.4	37	CCDS32478.1																																																																																			.		0.592	MARVELD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268990.1	NM_052858	
ADAD2	161931	hgsc.bcm.edu	37	16	84224967	84224967	+	Missense_Mutation	SNP	G	G	A	rs8044695|rs554488585	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr16:84224967G>A	ENST00000315906.5	+	1	183	c.131G>A	c.(130-132)gGg>gAg	p.G44E	ADAD2_ENST00000268624.3_Missense_Mutation_p.G44E|RP11-486L19.2_ENST00000561900.1_RNA|RP11-486L19.2_ENST00000565643.1_RNA|ADAD2_ENST00000567413.1_3'UTR|RP11-486L19.2_ENST00000536986.1_RNA	NM_001145400.1	NP_001138872.1	Q8NCV1	ADAD2_HUMAN	adenosine deaminase domain containing 2	44			G -> E (in dbSNP:rs8044695). {ECO:0000269|PubMed:14702039, ECO:0000269|Ref.3}.		RNA processing (GO:0006396)		adenosine deaminase activity (GO:0004000)|RNA binding (GO:0003723)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(2)|skin(1)	13						AGTGCCTgggggcccgcgccc	0.751														3435	0.685903	0.8616	0.6686	5008	,	,		11640	0.6677		0.6471	False		,,,				2504	0.5194				p.G44E		.											.	ADAD2-68	0			c.G131A						.	A	GLU/GLY,GLU/GLY	3145,519		1356,433,43	5.0	7.0	7.0		131,131	-1.1	0.0	16	dbSNP_116	7	5102,2224		1808,1486,369	no	missense,missense	ADAD2	NM_001145400.1,NM_139174.3	98,98	3164,1919,412	AA,AG,GG		30.3576,14.1648,24.9591	benign,benign	44/584,44/666	84224967	8247,2743	1832	3663	5495	SO:0001583	missense	161931	exon1			CCTGGGGGCCCGC	AF447586	CCDS10944.1, CCDS45536.1	16q24.1	2007-05-31			ENSG00000140955	ENSG00000140955			30714	protein-coding gene	gene with protein product							Standard	NM_139174		Approved	TENRL, FLJ00337	uc002fhr.2	Q8NCV1	OTTHUMG00000137637	ENST00000315906.5:c.131G>A	16.37:g.84224967G>A	ENSP00000325153:p.Gly44Glu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	20	20	NM_001145400	0	0	0	1	1	B2RCL6|Q8NA94	Missense_Mutation	SNP	ENST00000315906.5	37	CCDS45536.1	1545	0.7074175824175825	420	0.8536585365853658	227	0.6270718232044199	403	0.7045454545454546	495	0.6530343007915568	A	0.689	-0.795256	0.02862	0.858352	0.696424	ENSG00000140955	ENST00000315906;ENST00000268624	T;T	0.16196	2.36;2.47	3.61	-1.07	0.09968	.	1.276770	0.06034	N	0.653713	T	0.00012	0.0000	N	0.01874	-0.695	0.80722	P	0.0	B;B	0.06786	0.0;0.001	B;B	0.04013	0.0;0.001	T	0.30297	-0.9983	9	0.02654	T	1	-5.6132	8.9029	0.35505	0.4397:0.0:0.5603:0.0	rs8044695;rs57310648	44;44	Q8NCV1;Q8NCV1-2	ADAD2_HUMAN;.	E	44	ENSP00000325153:G44E;ENSP00000268624:G44E	ENSP00000268624:G44E	G	+	2	0	ADAD2	82782468	0.057000	0.20700	0.000000	0.03702	0.002000	0.02628	-0.069000	0.11542	-0.575000	0.05982	-1.305000	0.01319	GGG	G|0.292;A|0.708		0.751	ADAD2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433385.1	NM_139174	
IRF8	3394	hgsc.bcm.edu	37	16	85952145	85952145	+	Missense_Mutation	SNP	T	T	C	rs142267779	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr16:85952145T>C	ENST00000268638.5	+	7	1146	c.724T>C	c.(724-726)Tat>Cat	p.Y242H	IRF8_ENST00000562492.1_Missense_Mutation_p.Y38H	NM_002163.2	NP_002154.1	Q02556	IRF8_HUMAN	interferon regulatory factor 8	242					cellular response to lipopolysaccharide (GO:0071222)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|myeloid cell differentiation (GO:0030099)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phagocytosis (GO:0006909)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|transcription from RNA polymerase II promoter (GO:0006366)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|nucleus (GO:0005634)	regulatory region DNA binding (GO:0000975)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	24		Prostate(104;0.0771)				CACCAAGCTGTATGGGCCCGA	0.711													T|||	2	0.000399361	0.0	0.0	5008	,	,		15000	0.0		0.002	False		,,,				2504	0.0				p.Y242H		.											.	IRF8-154	0			c.T724C						.	T	HIS/TYR	2,4354		0,2,2176	22.0	28.0	26.0		724	4.9	0.2	16	dbSNP_134	26	34,8506		0,34,4236	no	missense	IRF8	NM_002163.2	83	0,36,6412	CC,CT,TT		0.3981,0.0459,0.2792	possibly-damaging	242/427	85952145	36,12860	2178	4270	6448	SO:0001583	missense	3394	exon7			AAGCTGTATGGGC	M91196	CCDS10956.1	16q24.1	2014-09-17	2004-11-12	2004-11-12	ENSG00000140968	ENSG00000140968			5358	protein-coding gene	gene with protein product		601565	"""interferon consensus sequence binding protein 1"""	ICSBP1		1460054, 11997525	Standard	NM_002163		Approved	IRF-8, ICSBP	uc002fjh.3	Q02556	OTTHUMG00000137648	ENST00000268638.5:c.724T>C	16.37:g.85952145T>C	ENSP00000268638:p.Tyr242His	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	65	21	NM_002163	0	0	0	0	0	A0AV82	Missense_Mutation	SNP	ENST00000268638.5	37	CCDS10956.1	2	9.157509157509158E-4	0	0.0	0	0.0	0	0.0	2	0.002638522427440633	T	19.01	3.744496	0.69418	4.59E-4	0.003981	ENSG00000140968	ENST00000268638	D	0.94280	-3.39	4.95	4.95	0.65309	SMAD domain-like (1);SMAD/FHA domain (1);Interferon regulatory factor-3 (1);	0.500315	0.24141	N	0.041171	D	0.95143	0.8426	M	0.77103	2.36	0.54753	D	0.999989	D	0.58970	0.984	P	0.60609	0.877	D	0.93426	0.6781	10	0.22109	T	0.4	-15.9933	10.9953	0.47571	0.0:0.0:0.1561:0.8439	.	242	Q02556	IRF8_HUMAN	H	242	ENSP00000268638:Y242H	ENSP00000268638:Y242H	Y	+	1	0	IRF8	84509646	1.000000	0.71417	0.221000	0.23827	0.817000	0.46193	2.989000	0.49393	1.986000	0.57962	0.528000	0.53228	TAT	T|0.998;C|0.002		0.711	IRF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269100.2	NM_002163	
ZFPM1	161882	hgsc.bcm.edu	37	16	88599696	88599697	+	Frame_Shift_Del	DEL	GA	GA	-	rs368520732|rs67712719	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	GA	GA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr16:88599696_88599697delGA	ENST00000319555.3	+	10	1652_1653	c.1330_1331delGA	c.(1330-1332)gagfs	p.E444fs	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	444				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GGCCAGAGCGGAGCCTCTGGCC	0.743														4881	0.974641	0.9138	0.9914	5008	,	,		7261	0.996		1.0	False		,,,				2504	0.9969				p.444_444del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1330_1331del						.			2219,383		1063,93,145						-6.5	0.0		dbSNP_130	3	4709,133		2339,31,51	no	frameshift	ZFPM1	NM_153813.2		3402,124,196	A1A1,A1R,RR		2.7468,14.7194,6.9318				6928,516				SO:0001589	frameshift_variant	161882	exon10			AGAGCGGAGCCTC	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1330_1331delGA	16.37:g.88599696_88599697delGA	ENSP00000326630:p.Glu444fs	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	20	17	NM_153813	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.743	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
ZFPM1	161882	hgsc.bcm.edu	37	16	88599697	88599705	+	In_Frame_Del	DEL	AGCCTCTGG	AGCCTCTGG	-	rs67873604|rs149145771|rs368520732|rs67322929|rs201915453|rs67712719	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	AGCCTCTGG	AGCCTCTGG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr16:88599697_88599705delAGCCTCTGG	ENST00000319555.3	+	10	1653_1661	c.1331_1339delAGCCTCTGG	c.(1330-1341)gagcctctggcc>gcc	p.EPL444del	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	444				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GCCAGAGCGGAGCCTCTGGCCCAGAATGG	0.746																																					p.444_447del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1331_1339del						.																																			SO:0001651	inframe_deletion	161882	exon10			GAGCGGAGCCTCT	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1331_1339delAGCCTCTGG	16.37:g.88599697_88599705delAGCCTCTGG	ENSP00000326630:p.Glu444_Leu446del	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	19	0	NM_153813	0	0	0	0	0		In_Frame_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.746	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
ZFPM1	161882	hgsc.bcm.edu	37	16	88599701	88599701	+	Frame_Shift_Del	DEL	T	T	-	rs67322929|rs149145771	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr16:88599701delT	ENST00000319555.3	+	10	1657	c.1335delT	c.(1333-1335)cctfs	p.P445fs	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	445				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GAGCGGAGCCTCTGGCCCAGA	0.746													-|T|-|insertion	4871	0.972644	0.9145	0.9899	5008	,	,		7405	0.995		0.994	False		,,,				2504	0.9939				p.P445fs	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1335delT						.						1.0	1.0	1.0					16																	88599701		392	657	1049	SO:0001589	frameshift_variant	161882	exon10			GGAGCCTCTGGCC	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1335delT	16.37:g.88599701delT	ENSP00000326630:p.Pro445fs	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	17	17	NM_153813	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.746	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
ZFPM1	161882	hgsc.bcm.edu	37	16	88599703	88599705	+	In_Frame_Del	DEL	TGG	TGG	-	rs149145771|rs67873604	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	TGG	TGG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr16:88599703_88599705delTGG	ENST00000319555.3	+	10	1659_1661	c.1337_1339delTGG	c.(1336-1341)ctggcc>ccc	p.446_447LA>P	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	446				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GCGGAGCCTCTGGCCCAGAATGG	0.739														4871	0.972644	0.9145	0.9899	5008	,	,		7191	0.995		0.994	False		,,,				2504	0.9939				p.446_447del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1337_1339del						.																																			SO:0001651	inframe_deletion	161882	exon10			AGCCTCTGGCCCA	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1337_1339delTGG	16.37:g.88599703_88599705delTGG	ENSP00000326630:p.Leu446_Ala447delinsPro	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	17	17	NM_153813	0	0	0	0	0		In_Frame_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.739	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
C17orf97	400566	hgsc.bcm.edu	37	17	260182	260182	+	Silent	SNP	T	T	C	rs7502594	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr17:260182T>C	ENST00000571106.1	+	1	55	c.49T>C	c.(49-51)Tta>Cta	p.L17L	AC108004.3_ENST00000466740.2_RNA|C17orf97_ENST00000360127.6_Silent_p.L17L|AC108004.3_ENST00000599026.1_RNA			Q6ZQX7	CQ097_HUMAN	chromosome 17 open reading frame 97	17										breast(1)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(1)	14						GAGTCGCCGATTAGTCGGCAT	0.751													c|||	1929	0.385184	0.6286	0.2666	5008	,	,		13427	0.3125		0.2396	False		,,,				2504	0.365				p.L17L		.											.	C17orf97-91	0			c.T49C						.			1512,2124		272,968,578	3.0	4.0	4.0		49	2.9	0.0	17	dbSNP_116	4	1503,5991		176,1151,2420	no	coding-synonymous	C17orf97	NM_001013672.4		448,2119,2998	CC,CT,TT		20.056,41.5842,27.0889		17/424	260182	3015,8115	1818	3747	5565	SO:0001819	synonymous_variant	400566	exon1			CGCCGATTAGTCG	AK128660, BC057385	CCDS32519.2	17p13.3	2008-08-15			ENSG00000187624	ENSG00000187624			33800	protein-coding gene	gene with protein product						12477932	Standard	NM_001013672		Approved	LOC400566	uc021tna.1	Q6ZQX7	OTTHUMG00000132479	ENST00000571106.1:c.49T>C	17.37:g.260182T>C		Somatic	2	0		WXS	Illumina GAIIx	Phase_I	21	18	NM_001013672	0	0	0	0	0	A5D8T6|Q6NSI2|Q6PFW9	Silent	SNP	ENST00000571106.1	37																																																																																				T|0.657;C|0.343		0.751	C17orf97-003	PUTATIVE	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000436874.1	NM_001013672	
GLTPD2	388323	hgsc.bcm.edu	37	17	4693342	4693342	+	Missense_Mutation	SNP	C	C	A	rs35910358	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr17:4693342C>A	ENST00000331264.7	+	4	680	c.627C>A	c.(625-627)gaC>gaA	p.D209E		NM_001014985.2	NP_001014985	A6NH11	GLTD2_HUMAN	glycolipid transfer protein domain containing 2	209				D -> E (in Ref. 2; AAI50537). {ECO:0000305}.		cytoplasm (GO:0005737)	glycolipid binding (GO:0051861)|glycolipid transporter activity (GO:0017089)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)	4						GAGGCCCGGACGCGGGCGTGC	0.761													C|||	4904	0.979233	0.9228	1.0	5008	,	,		11019	1.0		0.998	False		,,,				2504	1.0				p.D209E		.											.	GLTPD2-68	0			c.C627A						.	C	GLU/ASP	2706,78		1314,78,0	2.0	2.0	2.0		627	0.2	0.1	17	dbSNP_126	2	6028,0		3014,0,0	no	missense	GLTPD2	NM_001014985.2	45	4328,78,0	AA,AC,CC		0.0,2.8017,0.8852	benign	209/292	4693342	8734,78	1392	3014	4406	SO:0001583	missense	388323	exon4			CCCGGACGCGGGC	BC029290	CCDS32534.1	17p13.2	2007-12-19				ENSG00000182327			33756	protein-coding gene	gene with protein product							Standard	NM_001014985		Approved		uc002fza.2	A6NH11		ENST00000331264.7:c.627C>A	17.37:g.4693342C>A	ENSP00000328070:p.Asp209Glu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	10	NM_001014985	0	0	0	1	1	A7E2T2	Missense_Mutation	SNP	ENST00000331264.7	37	CCDS32534.1	2151	0.9848901098901099	466	0.9471544715447154	362	1.0	572	1.0	751	0.9907651715039578	C	9.155	1.017148	0.19355	0.971983	1.0	ENSG00000182327	ENST00000331264	.	.	.	4.58	0.162	0.14981	Glycolipid transfer protein domain (3);	.	.	.	.	T	0.00012	0.0000	L	0.41027	1.25	0.80722	P	0.0	B	0.22080	0.064	B	0.31614	0.133	T	0.34650	-0.9820	7	0.12103	T	0.63	-20.1635	5.889	0.18897	0.0:0.5269:0.298:0.1751	rs35910358	209	A6NH11	GLTD2_HUMAN	E	209	.	ENSP00000328070:D209E	D	+	3	2	GLTPD2	4640082	0.004000	0.15560	0.082000	0.20525	0.081000	0.17604	0.011000	0.13264	-0.068000	0.12953	0.555000	0.69702	GAC	C|0.015;A|0.985		0.761	GLTPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439781.1	NM_001014985	
TNFSF12	8742	hgsc.bcm.edu	37	17	7452542	7452542	+	Silent	SNP	C	C	T	rs77711855	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr17:7452542C>T	ENST00000293825.6	+	1	335	c.72C>T	c.(70-72)ctC>ctT	p.L24L	TNFSF12-TNFSF13_ENST00000293826.4_Silent_p.L24L|TNFSF12_ENST00000557233.1_Silent_p.L24L	NM_003809.2	NP_003800.1	O43508	TNF12_HUMAN	tumor necrosis factor (ligand) superfamily, member 12	24					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell differentiation (GO:0030154)|endothelial cell migration (GO:0043542)|immune response (GO:0006955)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)	cytokine activity (GO:0005125)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(3)|large_intestine(5)|prostate(2)	11		Prostate(122;0.157)				TGGTCCCGCTCGCGCTGGGCC	0.791													C|||	560	0.111821	0.1944	0.0706	5008	,	,		9326	0.1151		0.0825	False		,,,				2504	0.0562				p.L24L		.											.	TNFSF12-44	0			c.C72T						.	C	,	215,1795		0,215,790	1.0	1.0	1.0		72,72	-4.8	0.7	17	dbSNP_132	1	261,3683		4,253,1715	no	coding-synonymous,coding-synonymous	TNFSF12,TNFSF12-TNFSF13	NM_003809.2,NM_172089.3	,	4,468,2505	TT,TC,CC		6.6176,10.6965,7.9946	,	24/250,24/331	7452542	476,5478	1005	1972	2977	SO:0001819	synonymous_variant	8742	exon1			CCCGCTCGCGCTG	AF030099	CCDS11109.1	17p13.1	2008-02-01			ENSG00000239697	ENSG00000239697		"""Tumor necrosis factor (ligand) superfamily"""	11927	protein-coding gene	gene with protein product		602695				9405449, 9560343	Standard	NM_003809		Approved	TWEAK, DR3LG, APO3L		O43508	OTTHUMG00000108148	ENST00000293825.6:c.72C>T	17.37:g.7452542C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_003809	0	0	0	10	10	Q8IZK7|Q8WUZ7	Silent	SNP	ENST00000293825.6	37	CCDS11109.1																																																																																			C|0.883;T|0.117		0.791	TNFSF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226951.2	NM_003809	
RNF222	643904	hgsc.bcm.edu	37	17	8296383	8296383	+	Missense_Mutation	SNP	C	C	T	rs12601362	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr17:8296383C>T	ENST00000399398.2	-	3	705	c.397G>A	c.(397-399)Gcc>Acc	p.A133T	RNF222_ENST00000344001.3_Missense_Mutation_p.A133T	NM_001146684.2	NP_001140156.1	A6NCQ9	RN222_HUMAN	ring finger protein 222	133						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			breast(1)	1						GGGAGCTGGGCGCTctggccc	0.721													C|||	918	0.183307	0.118	0.1657	5008	,	,		14126	0.1954		0.2346	False		,,,				2504	0.2188				p.A133T		.											.	RNF222-68	0			c.G397A						.	C	THR/ALA	123,941		12,99,421	2.0	4.0	3.0		397	-3.4	0.0	17	dbSNP_120	3	556,2088		72,412,838	no	missense	RNF222	NM_001146684.2	58	84,511,1259	TT,TC,CC		21.0287,11.5602,18.3118	benign	133/221	8296383	679,3029	532	1322	1854	SO:0001583	missense	643904	exon3			GCTGGGCGCTCTG		CCDS45608.1	17p13.1	2013-01-09			ENSG00000189051	ENSG00000189051		"""RING-type (C3HC4) zinc fingers"""	34517	protein-coding gene	gene with protein product							Standard	NM_001146684		Approved		uc010vuy.1	A6NCQ9	OTTHUMG00000132049	ENST00000399398.2:c.397G>A	17.37:g.8296383C>T	ENSP00000382330:p.Ala133Thr	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	12	10	NM_001146684	0	0	0	0	0		Missense_Mutation	SNP	ENST00000399398.2	37	CCDS45608.1	416	0.19047619047619047	69	0.1402439024390244	68	0.1878453038674033	102	0.17832167832167833	177	0.23350923482849603	C	2.546	-0.305162	0.05495	0.115602	0.210287	ENSG00000189051	ENST00000344001;ENST00000399398	.	.	.	4.22	-3.43	0.04810	.	1.112540	0.06977	N	0.819153	T	0.00012	0.0000	N	0.14661	0.345	0.80722	P	0.0	B	0.06786	0.001	B	0.01281	0.0	T	0.34254	-0.9836	8	0.52906	T	0.07	-18.9555	2.2125	0.03951	0.1223:0.447:0.1198:0.3109	rs12601362	133	A6NCQ9	RN222_HUMAN	T	133	.	ENSP00000343799:A133T	A	-	1	0	RNF222	8237108	0.001000	0.12720	0.000000	0.03702	0.224000	0.24922	-0.068000	0.11561	-0.331000	0.08501	0.549000	0.68633	GCC	C|0.808;T|0.192		0.721	RNF222-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255072.2	NM_001146684.2	
VTN	7448	hgsc.bcm.edu	37	17	26699121	26699121	+	5'Flank	SNP	G	G	C	rs7212814		TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr17:26699121G>C	ENST00000226218.4	-	0	0				CTB-96E2.3_ENST00000591482.1_RNA|SARM1_ENST00000457710.3_5'UTR|TMEM199_ENST00000509083.1_Intron|SARM1_ENST00000379061.4_Intron|VTN_ENST00000536498.1_5'Flank	NM_000638.3	NP_000629.3	P04004	VTNC_HUMAN	vitronectin						cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|immune response (GO:0006955)|innate immune response (GO:0045087)|negative regulation of blood coagulation (GO:0030195)|negative regulation of endopeptidase activity (GO:0010951)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein binding (GO:0032092)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation of wound healing (GO:0090303)|regulation of complement activation (GO:0030449)|smooth muscle cell-matrix adhesion (GO:0061302)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|blood microparticle (GO:0072562)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			kidney(2)|large_intestine(7)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	13	all_lung(13;0.000533)|Lung NSC(42;0.00171)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)	Abciximab(DB00054)	GGCCCACGGCGGGGCGCCGAG	0.761													C|||	5008	1.0	1.0	1.0	5008	,	,		9002	1.0		1.0	False		,,,				2504	1.0				p.R23P		.											.	.	0			c.G68C						.						2.0	2.0	2.0					17																	26699121		1378	3066	4444	SO:0001631	upstream_gene_variant	23098	exon1			CACGGCGGGGCGC	BC005046	CCDS11229.1	17q11.2	2014-08-08	2006-02-10		ENSG00000109072	ENSG00000109072		"""Endogenous ligands"""	12724	protein-coding gene	gene with protein product	"""serum spreading factor"", ""somatomedin B"", ""complement S-protein"""	193190	"""vitronectin (serum spreading factor, somatomedin B, complement S-protein)"""			2447940	Standard	NM_000638		Approved	VN	uc002hbc.3	P04004	OTTHUMG00000132500		17.37:g.26699121G>C	Exception_encountered	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_015077	0	0	0	1	1	B2R7G0|P01141|Q9BSH7	Missense_Mutation	SNP	ENST00000226218.4	37	CCDS11229.1	2181	0.9986263736263736	490	0.9959349593495935	362	1.0	571	0.9982517482517482	758	1.0	C	4.627	0.116613	0.08881	.	.	ENSG00000004139	ENST00000457710	.	.	.	4.93	3.94	0.45596	.	1.216040	0.06217	N	0.686070	T	0.00012	0.0000	.	.	.	0.45837	P	0.0012929999999999886	.	.	.	.	.	.	T	0.38757	-0.9646	5	0.02654	T	1	0.2642	5.2918	0.15731	0.1514:0.6261:0.1455:0.077	rs7212814	.	.	.	P	23	.	ENSP00000406738:R23P	R	+	2	0	SARM1	23723248	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	1.263000	0.33004	0.497000	0.27926	-1.514000	0.00941	CGG	G|0.001;C|0.999		0.761	VTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255680.2	NM_000638	
MYO18A	399687	broad.mit.edu	37	17	27437604	27437604	+	Silent	SNP	G	G	T			TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr17:27437604G>T	ENST00000527372.1	-	18	3117	c.2937C>A	c.(2935-2937)ggC>ggA	p.G979G	MYO18A_ENST00000533112.1_Silent_p.G979G|MYO18A_ENST00000531253.1_Silent_p.G979G|MYO18A_ENST00000354329.4_Silent_p.G979G	NM_078471.3	NP_510880.2	Q92614	MY18A_HUMAN	myosin XVIIIA	979	Myosin motor.				actomyosin structure organization (GO:0031032)|cell migration (GO:0016477)|DNA metabolic process (GO:0006259)|Golgi organization (GO:0007030)|Golgi vesicle budding (GO:0048194)|negative regulation of apoptotic process (GO:0043066)|positive regulation of protein secretion (GO:0050714)	actomyosin (GO:0042641)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|myosin complex (GO:0016459)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)	p.G979G(2)		NS(1)|cervix(1)|endometrium(6)|kidney(6)|lung(20)|urinary_tract(2)	36			Epithelial(11;4.97e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000221)|all cancers(11;0.000234)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			CCGTGGCACTGCCTGCGCGGC	0.627																																					p.G979G	Esophageal Squamous(182;472 2015 7001 15270 22562)	.											.	MYO18A-22	2	Substitution - coding silent(2)	endometrium(2)	c.C2937A						.						39.0	43.0	42.0					17																	27437604		1981	4171	6152	SO:0001819	synonymous_variant	399687	exon18			GGCACTGCCTGCG	D86970	CCDS45641.1, CCDS45642.1	17q11.2	2011-09-27			ENSG00000196535	ENSG00000196535		"""Myosins / Myosin superfamily : Class XVIII"""	31104	protein-coding gene	gene with protein product		610067				12761286	Standard	NM_078471		Approved	KIAA0216, MysPDZ	uc002hdt.1	Q92614	OTTHUMG00000166360	ENST00000527372.1:c.2937C>A	17.37:g.27437604G>T		Somatic	11	0		WXS	Illumina GAIIx	Phase_I	43	8	NM_078471	0	0	3	3	0	Q5H9U3|Q5W9F9|Q5W9G1|Q8IXP8	Silent	SNP	ENST00000527372.1	37	CCDS45642.1																																																																																			.		0.627	MYO18A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389396.1	NM_078471	
TOP2A	7153	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	38561085	38561085	+	Silent	SNP	G	G	A			TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr17:38561085G>A	ENST00000423485.1	-	17	2162	c.2004C>T	c.(2002-2004)ttC>ttT	p.F668F		NM_001067.3	NP_001058.2	P11388	TOP2A_HUMAN	topoisomerase (DNA) II alpha 170kDa	668					apoptotic chromosome condensation (GO:0030263)|ATP catabolic process (GO:0006200)|cellular response to DNA damage stimulus (GO:0006974)|chromosome segregation (GO:0007059)|DNA ligation (GO:0006266)|DNA topological change (GO:0006265)|DNA unwinding involved in DNA replication (GO:0006268)|embryonic cleavage (GO:0040016)|hematopoietic progenitor cell differentiation (GO:0002244)|mitotic cell cycle (GO:0000278)|mitotic DNA integrity checkpoint (GO:0044774)|mitotic recombination (GO:0006312)|positive regulation of apoptotic process (GO:0043065)|positive regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral genome replication (GO:0045070)|resolution of meiotic recombination intermediates (GO:0000712)|sister chromatid segregation (GO:0000819)	condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|DNA topoisomerase complex (ATP-hydrolyzing) (GO:0009330)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|DNA-dependent ATPase activity (GO:0008094)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|magnesium ion binding (GO:0000287)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)|ubiquitin binding (GO:0043130)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(9)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	39		Breast(137;0.00328)	STAD - Stomach adenocarcinoma(5;0.00183)		Amsacrine(DB00276)|Ciprofloxacin(DB00537)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Dexrazoxane(DB00380)|Doxorubicin(DB00997)|Enoxacin(DB00467)|Epirubicin(DB00445)|Etoposide(DB00773)|Fleroxacin(DB04576)|Idarubicin(DB01177)|Levofloxacin(DB01137)|Lomefloxacin(DB00978)|Lucanthone(DB04967)|Mitoxantrone(DB01204)|Moxifloxacin(DB00218)|Norfloxacin(DB01059)|Ofloxacin(DB01165)|Pefloxacin(DB00487)|Podofilox(DB01179)|Sparfloxacin(DB01208)|Teniposide(DB00444)|Trovafloxacin(DB00685)|Valrubicin(DB00385)	TATCCTCCATGAAATTAGTTA	0.343																																					p.F668F		.											.	TOP2A-655	0			c.C2004T						.						98.0	86.0	90.0					17																	38561085		1809	4076	5885	SO:0001819	synonymous_variant	7153	exon17			CTCCATGAAATTA		CCDS45672.1	17q21-q22	2008-08-06	2002-08-29		ENSG00000131747	ENSG00000131747	5.99.1.2		11989	protein-coding gene	gene with protein product		126430	"""topoisomerase (DNA) II alpha (170kD)"""	TOP2			Standard	NM_001067		Approved		uc002huq.3	P11388	OTTHUMG00000155008	ENST00000423485.1:c.2004C>T	17.37:g.38561085G>A		Somatic	81	0		WXS	Illumina GAIIx	Phase_I	98	38	NM_001067	0	0	6	6	0	B2RTS1|Q71UN1|Q71UQ5|Q9HB24|Q9HB25|Q9HB26|Q9UP44|Q9UQP9	Silent	SNP	ENST00000423485.1	37	CCDS45672.1																																																																																			.		0.343	TOP2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338035.1		
IGFBP4	3487	hgsc.bcm.edu	37	17	38600092	38600092	+	Silent	SNP	G	G	A	rs598892	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr17:38600092G>A	ENST00000269593.4	+	1	380	c.105G>A	c.(103-105)ctG>ctA	p.L35L	IGFBP4_ENST00000542955.1_Intron	NM_001552.2	NP_001543.2	P22692	IBP4_HUMAN	insulin-like growth factor binding protein 4	35	IGFBP N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00653}.				cell proliferation (GO:0008283)|cellular protein metabolic process (GO:0044267)|DNA metabolic process (GO:0006259)|inflammatory response (GO:0006954)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of MAPK cascade (GO:0043410)|regulation of cell growth (GO:0001558)|regulation of glucose metabolic process (GO:0010906)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|type B pancreatic cell proliferation (GO:0044342)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|endometrium(1)|kidney(1)|large_intestine(2)	5		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(5;5.91e-05)			AGGAGAAGCTGGCGCGCTGCC	0.771													G|||	1792	0.357827	0.0386	0.5	5008	,	,		9796	0.4752		0.3946	False		,,,				2504	0.5297				p.L35L	GBM(160;940 3581 26177)	.											.	IGFBP4-522	0			c.G105A						.	G		266,3270		24,218,1526	3.0	3.0	3.0		105	4.0	1.0	17	dbSNP_83	3	2267,4893		352,1563,1665	no	coding-synonymous	IGFBP4	NM_001552.2		376,1781,3191	AA,AG,GG		31.662,7.5226,23.6818		35/259	38600092	2533,8163	1768	3580	5348	SO:0001819	synonymous_variant	3487	exon1			GAAGCTGGCGCGC	M38177	CCDS11367.1	17q21.2	2014-09-16	2001-11-28		ENSG00000141753	ENSG00000141753			5473	protein-coding gene	gene with protein product	"""IGF-binding protein 4"""	146733	"""insulin-like growth factor-binding protein 4"""			1707125, 1704481	Standard	NM_001552		Approved	IBP4, BP-4, HT29-IGFBP, IGFBP-4	uc002hus.3	P22692	OTTHUMG00000133326	ENST00000269593.4:c.105G>A	17.37:g.38600092G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	14	14	NM_001552	0	0	0	1	1	A0N9W2|B4E351|Q5U012|Q9UCL6	Silent	SNP	ENST00000269593.4	37	CCDS11367.1																																																																																			G|0.645;A|0.355		0.771	IGFBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257134.1	NM_001552	
GOSR2	9570	broad.mit.edu;bcgsc.ca	37	17	45012394	45012394	+	Splice_Site	SNP	G	G	A			TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr17:45012394G>A	ENST00000393456.2	+	5	393		c.e5-1		GOSR2_ENST00000415811.2_Splice_Site|GOSR2_ENST00000225567.4_Splice_Site|GOSR2_ENST00000576910.2_Intron|RP11-156P1.2_ENST00000571841.1_Splice_Site|GOSR2_ENST00000439730.2_Splice_Site	NM_004287.3	NP_004278.2	O14653	GOSR2_HUMAN	golgi SNAP receptor complex member 2						activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER to Golgi vesicle-mediated transport (GO:0006888)|membrane fusion (GO:0061025)|protein transport (GO:0015031)	Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transporter activity (GO:0005215)			kidney(1)|large_intestine(2)|liver(1)|lung(1)|ovary(1)|skin(1)	7			BRCA - Breast invasive adenocarcinoma(9;0.102)			TTCTTTCACAGGACTCTGACA	0.488																																					.		.											.	GOSR2-92	0			c.337-1G>A						.						119.0	102.0	108.0					17																	45012394		2203	4300	6503	SO:0001630	splice_region_variant	9570	exon5			TTCACAGGACTCT	AF007548	CCDS11507.1, CCDS42355.1, CCDS45719.1	17q21	2006-02-10				ENSG00000108433			4431	protein-coding gene	gene with protein product		604027				9349823, 10198168	Standard	XM_005257843		Approved	GS27, Bos1	uc002ikz.3	O14653		ENST00000393456.2:c.337-1G>A	17.37:g.45012394G>A		Somatic	138	1		WXS	Illumina GAIIx	Phase_I	163	78	NM_004287	0	0	0	0	0	D3DXJ5|D3DXJ6|Q8N4B8|Q96DA5|Q9BZZ4	Splice_Site	SNP	ENST00000393456.2	37	CCDS42355.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.187463	0.78789	.	.	ENSG00000108433	ENST00000225567;ENST00000393456;ENST00000415811;ENST00000439730	.	.	.	5.69	4.71	0.59529	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.9858	0.80151	0.0:0.0:0.8641:0.1359	.	.	.	.	.	-1	.	.	.	+	.	.	GOSR2	42367393	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	9.869000	0.99810	1.387000	0.46486	0.655000	0.94253	.	.		0.488	GOSR2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440438.1		Intron
HID1	283987	bcgsc.ca	37	17	72949146	72949146	+	Silent	SNP	C	C	T	rs2307010	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr17:72949146C>T	ENST00000425042.2	-	16	2084	c.2007G>A	c.(2005-2007)ccG>ccA	p.P669P		NM_030630.2	NP_085133.1	Q8IV36	HID1_HUMAN	HID1 domain containing	669					intracellular protein transport (GO:0006886)|response to brefeldin A (GO:0031001)	cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|extracellular vesicular exosome (GO:0070062)|extrinsic component of Golgi membrane (GO:0090498)|Golgi apparatus (GO:0005794)|Golgi medial cisterna (GO:0005797)|Golgi trans cisterna (GO:0000138)											ATGAGGTGGACGGTCGCCGCT	0.692													C|||	984	0.196486	0.0734	0.1859	5008	,	,		13990	0.2698		0.2396	False		,,,				2504	0.2505				p.P669P		.											.	.	0			c.G2007A						.	C		440,3966		25,390,1788	23.0	20.0	21.0		2007	-1.3	0.8	17	dbSNP_100	21	2060,6536		256,1548,2494	no	coding-synonymous	C17orf28	NM_030630.2		281,1938,4282	TT,TC,CC		23.9646,9.9864,19.2278		669/789	72949146	2500,10502	2203	4298	6501	SO:0001819	synonymous_variant	283987	exon16			GGTGGACGGTCGC		CCDS32726.1	17q25.1	2012-10-10	2012-10-10	2012-10-10	ENSG00000167861	ENSG00000167861			15736	protein-coding gene	gene with protein product	"""downregulated in multiple cancer 1"""	605752	"""chromosome 17 open reading frame 28"""	C17orf28		11281419, 21337012	Standard	NM_030630		Approved	DMC1, HID-1	uc002jmj.4	Q8IV36	OTTHUMG00000166490	ENST00000425042.2:c.2007G>A	17.37:g.72949146C>T		Somatic	142	0		WXS	Illumina GAIIx	Phase_I	108	5	NM_030630	0	0	1	1	0	Q8N5L6|Q8TE83|Q9NT34	Silent	SNP	ENST00000425042.2	37	CCDS32726.1																																																																																			C|0.809;T|0.191		0.692	HID1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390011.2	NM_030630	
C1QTNF1	114897	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	77043879	77043879	+	Silent	SNP	C	C	T			TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr17:77043879C>T	ENST00000339142.2	+	5	1110	c.555C>T	c.(553-555)ttC>ttT	p.F185F	C1QTNF1_ENST00000580474.1_Silent_p.F185F|C1QTNF1_ENST00000354124.3_Silent_p.F195F|C1QTNF1_ENST00000579760.1_Silent_p.F185F|C1QTNF1_ENST00000581774.1_Silent_p.F185F|C1QTNF1_ENST00000580454.1_Silent_p.F185F|C1QTNF1_ENST00000578229.1_Silent_p.F103F|C1QTNF1_ENST00000583904.1_Silent_p.F185F|C1QTNF1_ENST00000311661.4_Silent_p.F103F|C1QTNF1_ENST00000392445.2_Silent_p.F185F|C1QTNF1_ENST00000582625.1_3'UTR	NM_198593.3	NP_940995.1	Q9BXJ1	C1QT1_HUMAN	C1q and tumor necrosis factor related protein 1	185	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.				negative regulation of platelet activation (GO:0010544)|negative regulation of platelet aggregation (GO:0090331)|positive regulation of aldosterone secretion (GO:2000860)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase B signaling (GO:0051897)|protein heterotrimerization (GO:0070208)|protein homooligomerization (GO:0051260)|regulation of glucose metabolic process (GO:0010906)	collagen trimer (GO:0005581)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	collagen binding (GO:0005518)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|ovary(2)	14			BRCA - Breast invasive adenocarcinoma(99;0.0294)|OV - Ovarian serous cystadenocarcinoma(97;0.201)			CCGGCAAGTTCTACTGCTACG	0.542																																					p.F185F		.											.	C1QTNF1-91	0			c.C555T						.						176.0	159.0	165.0					17																	77043879		2203	4300	6503	SO:0001819	synonymous_variant	114897	exon4			CAAGTTCTACTGC	AF329840	CCDS11761.1, CCDS11762.1	17q25	2012-07-02			ENSG00000173918	ENSG00000173918			14324	protein-coding gene	gene with protein product	"""G protein coupled receptor interacting protein"""	610365				12409230	Standard	NM_198593		Approved	CTRP1, ZSIG37, GIP, FLJ90694	uc002jwp.4	Q9BXJ1	OTTHUMG00000177533	ENST00000339142.2:c.555C>T	17.37:g.77043879C>T		Somatic	180	1		WXS	Illumina GAIIx	Phase_I	120	94	NM_030968	0	0	1	36	35	Q6ZMH6|Q96NF2|Q9GZR4	Silent	SNP	ENST00000339142.2	37	CCDS11761.1																																																																																			.		0.542	C1QTNF1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437388.2	NM_030968	
ROCK1	6093	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	18629131	18629131	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr18:18629131C>T	ENST00000399799.2	-	4	1276	c.336G>A	c.(334-336)atG>atA	p.M112I		NM_005406.2	NP_005397.1	Q13464	ROCK1_HUMAN	Rho-associated, coiled-coil containing protein kinase 1	112	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton organization (GO:0030036)|apical constriction (GO:0003383)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|bleb assembly (GO:0032060)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|membrane to membrane docking (GO:0022614)|myoblast migration (GO:0051451)|negative regulation of angiogenesis (GO:0016525)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of focal adhesion assembly (GO:0051894)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of establishment of cell polarity (GO:2000114)|regulation of focal adhesion assembly (GO:0051893)|regulation of keratinocyte differentiation (GO:0045616)|regulation of stress fiber assembly (GO:0051492)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(4)|central_nervous_system(1)|large_intestine(8)|lung(2)	16	Melanoma(1;0.165)					ATCTCTTTATCATTTCAAATT	0.368																																					p.M112I		.											.	ROCK1-1026	0			c.G336A						.						97.0	99.0	98.0					18																	18629131		2203	4300	6503	SO:0001583	missense	6093	exon4			CTTTATCATTTCA		CCDS11870.2	18q11.2	2013-01-10			ENSG00000067900	ENSG00000067900	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	10251	protein-coding gene	gene with protein product		601702				8617235	Standard	NM_005406		Approved	p160ROCK	uc002kte.3	Q13464	OTTHUMG00000131723	ENST00000399799.2:c.336G>A	18.37:g.18629131C>T	ENSP00000382697:p.Met112Ile	Somatic	63	0		WXS	Illumina GAIIx	Phase_I	58	20	NM_005406	0	0	2	2	0	B0YJ91|Q2KHM4|Q59GZ4	Missense_Mutation	SNP	ENST00000399799.2	37	CCDS11870.2	.	.	.	.	.	.	.	.	.	.	C	35	5.466509	0.96257	.	.	ENSG00000067900	ENST00000399799	T	0.64260	-0.09	5.94	5.94	0.96194	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.61035	0.2315	N	0.02665	-0.54	0.80722	D	1	D	0.69078	0.997	D	0.75020	0.985	T	0.74751	-0.3559	10	0.87932	D	0	.	20.3616	0.98856	0.0:1.0:0.0:0.0	.	112	Q13464	ROCK1_HUMAN	I	112	ENSP00000382697:M112I	ENSP00000382697:M112I	M	-	3	0	ROCK1	16883129	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.811000	0.86092	2.818000	0.97014	0.637000	0.83480	ATG	.		0.368	ROCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254641.2	NM_005406	
CBLN2	147381	hgsc.bcm.edu	37	18	70209321	70209321	+	Silent	SNP	C	C	A	rs7237888	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr18:70209321C>A	ENST00000269503.4	-	3	848	c.75G>T	c.(73-75)ccG>ccT	p.P25P	CBLN2_ENST00000584764.1_Intron|CBLN2_ENST00000581073.1_Intron|CBLN2_ENST00000583651.1_Intron|CBLN2_ENST00000585159.1_Silent_p.P25P	NM_182511.3	NP_872317.1	Q8IUK8	CBLN2_HUMAN	cerebellin 2 precursor	25					positive regulation of synapse assembly (GO:0051965)	extracellular space (GO:0005615)				endometrium(2)|lung(15)	17		Esophageal squamous(42;0.131)				CGCAgccgcccggctcgcgca	0.786													C|||	2820	0.563099	0.1868	0.8573	5008	,	,		7947	0.381		0.9304	False		,,,				2504	0.6728				p.P25P		.											.	CBLN2-90	0			c.G75T						.	C		1660,2420		328,1004,708	5.0	7.0	6.0		75	-0.8	1.0	18	dbSNP_116	6	7475,487		3530,415,36	no	coding-synonymous	CBLN2	NM_182511.3		3858,1419,744	AA,AC,CC		6.1166,40.6863,24.1405		25/225	70209321	9135,2907	2040	3981	6021	SO:0001819	synonymous_variant	147381	exon3			GCCGCCCGGCTCG	BC035789	CCDS11999.1	18q22.3	2007-11-19			ENSG00000141668	ENSG00000141668			1544	protein-coding gene	gene with protein product		600433				7877445	Standard	NM_182511		Approved		uc002lkv.2	Q8IUK8	OTTHUMG00000132825	ENST00000269503.4:c.75G>T	18.37:g.70209321C>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	9	NM_182511	0	0	0	0	0	Q53Z56	Silent	SNP	ENST00000269503.4	37	CCDS11999.1																																																																																			C|0.390;A|0.610		0.786	CBLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256288.1	NM_182511	
EFNA2	1943	hgsc.bcm.edu	37	19	1295717	1295717	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr19:1295717G>A	ENST00000215368.2	+	2	329	c.314G>A	c.(313-315)cGc>cAc	p.R105H	MUM1_ENST00000344663.3_Intron	NM_001405.3	NP_001396.2	O43921	EFNA2_HUMAN	ephrin-A2	105	Ephrin RBD. {ECO:0000255|PROSITE- ProRule:PRU00884}.				axon guidance (GO:0007411)|bone remodeling (GO:0046849)|cell-cell signaling (GO:0007267)|ephrin receptor signaling pathway (GO:0048013)|olfactory bulb development (GO:0021772)|osteoclast differentiation (GO:0030316)	anchored component of membrane (GO:0031225)|neuromuscular junction (GO:0031594)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)	ephrin receptor binding (GO:0046875)			lung(2)	2		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGCGACCACCGCCAGCGCGGC	0.701																																					p.R105H		.											.	EFNA2-90	0			c.G314A						.						12.0	13.0	12.0					19																	1295717		2185	4270	6455	SO:0001583	missense	1943	exon2			ACCACCGCCAGCG		CCDS12061.1	19p13	2011-03-09			ENSG00000099617	ENSG00000099617		"""Ephrins"""	3222	protein-coding gene	gene with protein product		602756		EPLG6			Standard	NM_001405		Approved	ELF-1, LERK6	uc002lry.2	O43921		ENST00000215368.2:c.314G>A	19.37:g.1295717G>A	ENSP00000215368:p.Arg105His	Somatic	10	0		WXS	Illumina GAIIx	Phase_I	95	6	NM_001405	0	0	0	0	0	O76020	Missense_Mutation	SNP	ENST00000215368.2	37	CCDS12061.1	.	.	.	.	.	.	.	.	.	.	G	15.40	2.822700	0.50739	.	.	ENSG00000099617	ENST00000215368	D	0.93247	-3.19	3.3	3.3	0.37823	Cupredoxin (2);	0.072948	0.56097	U	0.000035	D	0.87966	0.6311	L	0.38531	1.155	0.48511	D	0.999661	B	0.23316	0.083	B	0.22152	0.038	D	0.84720	0.0739	10	0.41790	T	0.15	.	9.284	0.37746	0.0:0.0:0.7843:0.2157	.	105	O43921	EFNA2_HUMAN	H	105	ENSP00000215368:R105H	ENSP00000215368:R105H	R	+	2	0	EFNA2	1246717	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.496000	0.45346	1.836000	0.53414	0.478000	0.44815	CGC	.		0.701	EFNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450016.1	NM_001405	
TCF3	6929	hgsc.bcm.edu	37	19	1619339	1619339	+	Silent	SNP	T	T	C	rs8140	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr19:1619339T>C	ENST00000262965.5	-	15	1646	c.1302A>G	c.(1300-1302)tcA>tcG	p.S434S	TCF3_ENST00000395423.3_Silent_p.S383S|TCF3_ENST00000588136.1_Silent_p.S434S|TCF3_ENST00000344749.5_Silent_p.S434S|TCF3_ENST00000453954.2_Silent_p.S350S|RNU6-1223P_ENST00000517124.1_RNA	NM_003200.3	NP_003191.1	Q9HCS4	TF7L1_HUMAN	transcription factor 3	0					anterior/posterior axis specification, embryo (GO:0008595)|axial mesoderm morphogenesis (GO:0048319)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|chromatin organization (GO:0006325)|generation of neurons (GO:0048699)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	16		Acute lymphoblastic leukemia(61;5.94e-12)|all_hematologic(61;1.27e-07)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCCCGCCCAGTGACATGGGGC	0.746			T	"""PBX1, HLF, TFPT"""	pre B-ALL								C|||	3124	0.623802	0.7723	0.5187	5008	,	,		13680	0.8839		0.3658	False		,,,				2504	0.4949				p.S434S		.		Dom	yes		19	19p13.3	6929	transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47)		L	.	TCF3-721	0			c.A1302G						.	C	,	3016,1346		1071,874,236	11.0	14.0	13.0		1302,1302	-7.1	0.0	19	dbSNP_52	13	3268,5190		653,1962,1614	no	coding-synonymous,coding-synonymous	TCF3	NM_001136139.2,NM_003200.3	,	1724,2836,1850	CC,CT,TT		38.638,30.8574,49.0172	,	434/652,434/655	1619339	6284,6536	2181	4229	6410	SO:0001819	synonymous_variant	6929	exon15			GCCCAGTGACATG	M65214	CCDS12074.1, CCDS45899.1	19p13.3	2014-02-13	2013-02-26		ENSG00000071564	ENSG00000071564		"""Basic helix-loop-helix proteins"""	11633	protein-coding gene	gene with protein product	"""transcription factor E2-alpha"", ""immunoglobulin transcription factor 1"", ""kappa-E2-binding factor"", ""E2A immunoglobulin enhancer-binding factor E12/E47"", ""VDR interacting repressor"""	147141				2308859, 1967983	Standard	NM_003200		Approved	E2A, ITF1, MGC129647, MGC129648, bHLHb21, VDIR, E47	uc002ltt.4	P15923	OTTHUMG00000180031	ENST00000262965.5:c.1302A>G	19.37:g.1619339T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	22	8	NM_003200	0	0	11	11	0	Q53R97|Q6PD70|Q9NP00	Silent	SNP	ENST00000262965.5	37	CCDS12074.1																																																																																			T|0.403;C|0.597		0.746	TCF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449367.1	NM_003200	
KANK3	256949	hgsc.bcm.edu	37	19	8399628	8399628	+	Silent	SNP	A	A	G	rs710949	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr19:8399628A>G	ENST00000593649.1	-	3	1148	c.1083T>C	c.(1081-1083)agT>agC	p.S361S	KANK3_ENST00000330915.3_Silent_p.S361S			Q6NY19	KANK3_HUMAN	KN motif and ankyrin repeat domains 3	361										breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|skin(1)|urinary_tract(1)	9						GGTGCTCCAGACTGGCGCGCA	0.766													G|||	3017	0.602436	0.7443	0.6153	5008	,	,		10732	0.4147		0.5984	False		,,,				2504	0.5992				p.S361S		.											.	KANK3-90	0			c.T1083C						.	G		1917,541		783,351,95	1.0	1.0	1.0		1083	3.4	1.0	19	dbSNP_86	1	3649,1585		1364,921,332	no	coding-synonymous	KANK3	NM_198471.2		2147,1272,427	GG,GA,AA		30.2828,22.0098,27.6391		361/822	8399628	5566,2126	1229	2617	3846	SO:0001819	synonymous_variant	256949	exon3			CTCCAGACTGGCG	AK128815	CCDS12199.1	19p13.2	2013-01-10	2008-01-29	2008-01-29		ENSG00000186994		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	24796	protein-coding gene	gene with protein product		614611	"""ankyrin repeat domain 47"""	ANKRD47		17996375, 19554261	Standard	NM_198471		Approved	FLJ46061	uc010dwa.3	Q6NY19		ENST00000593649.1:c.1083T>C	19.37:g.8399628A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	16	16	NM_198471	0	0	0	1	1	Q6NZI1|Q6ZQR3|Q8IUV2	Silent	SNP	ENST00000593649.1	37																																																																																				A|0.411;G|0.589		0.766	KANK3-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000461379.1	NM_198471	
ZNF558	148156	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	8922403	8922403	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr19:8922403T>C	ENST00000601372.1	-	10	1474	c.763A>G	c.(763-765)Aag>Gag	p.K255E	ZNF558_ENST00000301475.1_Missense_Mutation_p.K255E|ZNF558_ENST00000444186.2_Missense_Mutation_p.K184E			Q96NG5	ZN558_HUMAN	zinc finger protein 558	255					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(7)|prostate(1)|skin(1)	15						TGAATCCTCTTGTGGCTTTTG	0.443																																					p.K255E		.											.	ZNF558-90	0			c.A763G						.						120.0	111.0	114.0					19																	8922403		2203	4300	6503	SO:0001583	missense	148156	exon6			TCCTCTTGTGGCT	AK055494	CCDS12208.1	19p13.2	2013-09-20			ENSG00000167785	ENSG00000167785		"""Zinc fingers, C2H2-type"", ""-"""	26422	protein-coding gene	gene with protein product							Standard	NM_144693		Approved	FLJ30932	uc002mkn.1	Q96NG5	OTTHUMG00000182196	ENST00000601372.1:c.763A>G	19.37:g.8922403T>C	ENSP00000471277:p.Lys255Glu	Somatic	135	0		WXS	Illumina GAIIx	Phase_I	151	65	NM_144693	0	0	6	7	1	A8K5F0|B7Z798	Missense_Mutation	SNP	ENST00000601372.1	37	CCDS12208.1	.	.	.	.	.	.	.	.	.	.	T	17.10	3.303023	0.60195	.	.	ENSG00000167785	ENST00000301475;ENST00000444186	T;T	0.18016	2.24;2.24	4.98	2.68	0.31781	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.45867	D	0.000332	T	0.06416	0.0165	N	0.03891	-0.335	0.25231	N	0.989827	B	0.22146	0.065	B	0.15870	0.014	T	0.23797	-1.0178	10	0.52906	T	0.07	-19.6819	5.299	0.15768	0.0:0.0926:0.3536:0.5537	.	255	Q96NG5	ZN558_HUMAN	E	255;184	ENSP00000301475:K255E;ENSP00000410703:K184E	ENSP00000301475:K255E	K	-	1	0	ZNF558	8783403	0.177000	0.23109	0.994000	0.49952	0.847000	0.48162	1.142000	0.31540	0.866000	0.35629	0.482000	0.46254	AAG	.		0.443	ZNF558-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459955.2	NM_144693	
CCDC105	126402	hgsc.bcm.edu	37	19	15133926	15133926	+	Missense_Mutation	SNP	C	C	A	rs8112667	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr19:15133926C>A	ENST00000292574.3	+	7	1577	c.1495C>A	c.(1495-1497)Ccc>Acc	p.P499T		NM_173482.2	NP_775753.2	Q8IYK2	CC105_HUMAN	coiled-coil domain containing 105	499			P -> T (in dbSNP:rs8112667).			extracellular vesicular exosome (GO:0070062)				NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(4)|skin(2)	23						CAGCGCGGACCCCTAGTGACC	0.716													c|||	1705	0.340455	0.1929	0.438	5008	,	,		11943	0.5208		0.2326	False		,,,				2504	0.3957				p.P499T		.											.	CCDC105-91	0			c.C1495A						.		THR/PRO	868,3356		95,678,1339	7.0	9.0	8.0		1495	-6.6	0.0	19	dbSNP_116	8	1799,6519		206,1387,2566	yes	missense	CCDC105	NM_173482.2	38	301,2065,3905	AA,AC,CC		21.6278,20.5492,21.2646	benign	499/500	15133926	2667,9875	2112	4159	6271	SO:0001583	missense	126402	exon7			GCGGACCCCTAGT	AK097684	CCDS12322.1	19p13.12	2008-02-05				ENSG00000160994			26866	protein-coding gene	gene with protein product						12477932	Standard	NM_173482		Approved	FLJ40365	uc002nae.2	Q8IYK2		ENST00000292574.3:c.1495C>A	19.37:g.15133926C>A	ENSP00000292574:p.Pro499Thr	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	40	19	NM_173482	0	0	0	0	0	Q8N7T5|Q8NDL5	Missense_Mutation	SNP	ENST00000292574.3	37	CCDS12322.1	718	0.32875457875457875	102	0.2073170731707317	139	0.3839779005524862	297	0.5192307692307693	180	0.23746701846965698	c	12.70	2.017064	0.35606	0.205492	0.216278	ENSG00000160994	ENST00000292574	T	0.15139	2.45	3.29	-6.58	0.01836	.	1.321340	0.05609	N	0.577760	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.44528	-0.9322	9	0.87932	D	0	.	0.9387	0.01351	0.3527:0.1586:0.3022:0.1865	rs8112667;rs59368867;rs8112667	499	Q8IYK2	CC105_HUMAN	T	499	ENSP00000292574:P499T	ENSP00000292574:P499T	P	+	1	0	CCDC105	14994926	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.281000	0.00528	-1.857000	0.01159	-1.528000	0.00924	CCC	C|0.671;A|0.329		0.716	CCDC105-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466293.1	NM_173482	
CPAMD8	27151	bcgsc.ca	37	19	17111272	17111272	+	Silent	SNP	T	T	C	rs61740405	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr19:17111272T>C	ENST00000443236.1	-	10	991	c.960A>G	c.(958-960)gtA>gtG	p.V320V	CPAMD8_ENST00000388925.4_Silent_p.V273V	NM_015692.2	NP_056507.2	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain containing 8	273						extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(11)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(14)|ovary(7)|pancreas(2)|prostate(4)|skin(5)	82						TGTAGTACCCTACACCATTAA	0.512													-|||	28	0.00559105	0.0015	0.0187	5008	,	,		16305	0.0		0.0129	False		,,,				2504	0.0				p.V320V		.											.	CPAMD8-141	0			c.A960G						.	T		12,3836		0,12,1912	61.0	62.0	62.0		960	1.5	1.0	19	dbSNP_129	62	174,8068		2,170,3949	no	coding-synonymous	CPAMD8	NM_015692.2		2,182,5861	CC,CT,TT		2.1111,0.3119,1.5385		320/1933	17111272	186,11904	1924	4121	6045	SO:0001819	synonymous_variant	27151	exon10			GTACCCTACACCA	AY101765	CCDS42519.1	19p13.12	2008-02-05			ENSG00000160111	ENSG00000160111			23228	protein-coding gene	gene with protein product		608841				10574462	Standard	NM_015692		Approved	KIAA1283, VIP, K-CAP	uc002nfb.3	Q8IZJ3	OTTHUMG00000133549	ENST00000443236.1:c.960A>G	19.37:g.17111272T>C		Somatic	56	0		WXS	Illumina GAIIx	Phase_I	86	5	NM_015692	0	0	0	0	0	Q8NC09|Q9ULD7	Silent	SNP	ENST00000443236.1	37	CCDS42519.1	20	0.009157509157509158	2	0.0040650406504065045	8	0.022099447513812154	0	0.0	10	0.013192612137203167	-	0.406	-0.916006	0.02415	0.003119	0.021111	ENSG00000160111	ENST00000443236	.	.	.	2.55	1.48	0.22813	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	3.5611	0.07882	0.3256:0.4611:0.0:0.2133	.	.	.	.	W	331	.	.	X	-	2	0	CPAMD8	16972272	0.589000	0.26807	0.997000	0.53966	0.026000	0.11368	-0.557000	0.05985	0.219000	0.20840	-0.439000	0.05793	TAG	T|0.986;C|0.014		0.512	CPAMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257531.2	NM_015692	
UQCRFS1	7386	hgsc.bcm.edu	37	19	29704002	29704002	+	Silent	SNP	T	T	C	rs11666764	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr19:29704002T>C	ENST00000304863.4	-	1	446	c.24A>G	c.(22-24)tcA>tcG	p.S8S	CTB-32O4.2_ENST00000587859.1_lincRNA	NM_006003.2	NP_005994.2	P47985	UCRI_HUMAN	ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1	8					cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|response to antibiotic (GO:0046677)|response to drug (GO:0042493)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	2 iron, 2 sulfur cluster binding (GO:0051537)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			endometrium(4)|kidney(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Breast(6;0.0545)|Esophageal squamous(110;0.239)		Lung(7;0.092)			CGAACGGGCCTGAGCGGGATG	0.751													C|||	4781	0.954673	0.9433	0.9294	5008	,	,		9645	0.999		0.9195	False		,,,				2504	0.9785				p.S8S		.											.	UQCRFS1-226	0			c.A24G						.						1.0	2.0	2.0					19																	29704002		760	1811	2571	SO:0001819	synonymous_variant	7386	exon1			CGGGCCTGAGCGG	BC010035	CCDS12415.1	19q12	2011-07-04			ENSG00000169021	ENSG00000169021	1.10.2.2	"""Mitochondrial respiratory chain complex / Complex III"""	12587	protein-coding gene	gene with protein product	"""cytochrome b-c1 complex subunit 5"""	191327				8088805	Standard	NM_006003		Approved	RIS1, RIP1, UQCR5, RISP	uc002nsd.2	P47985		ENST00000304863.4:c.24A>G	19.37:g.29704002T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_006003	0	0	0	0	0	A8K519|Q6NVX5|Q9UPH2	Silent	SNP	ENST00000304863.4	37	CCDS12415.1																																																																																			T|0.072;C|0.928		0.751	UQCRFS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458563.1	NM_006003	
UQCRFS1	7386	hgsc.bcm.edu	37	19	29704010	29704010	+	Missense_Mutation	SNP	A	A	C	rs8100724	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr19:29704010A>C	ENST00000304863.4	-	1	438	c.16T>G	c.(16-18)Tcc>Gcc	p.S6A	CTB-32O4.2_ENST00000587859.1_lincRNA	NM_006003.2	NP_005994.2	P47985	UCRI_HUMAN	ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1	6			S -> A (in dbSNP:rs8100724). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:2158323, ECO:0000269|PubMed:7721092}.		cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|response to antibiotic (GO:0046677)|response to drug (GO:0042493)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	2 iron, 2 sulfur cluster binding (GO:0051537)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			endometrium(4)|kidney(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Breast(6;0.0545)|Esophageal squamous(110;0.239)		Lung(7;0.092)			CCTGAGCGGGATGCTACCGAC	0.746													C|||	4777	0.953874	0.944	0.9265	5008	,	,		9603	0.999		0.9165	False		,,,				2504	0.9785				p.S6A		.											.	UQCRFS1-226	0			c.T16G						.						1.0	2.0	2.0					19																	29704010		816	1888	2704	SO:0001583	missense	7386	exon1			AGCGGGATGCTAC	BC010035	CCDS12415.1	19q12	2011-07-04			ENSG00000169021	ENSG00000169021	1.10.2.2	"""Mitochondrial respiratory chain complex / Complex III"""	12587	protein-coding gene	gene with protein product	"""cytochrome b-c1 complex subunit 5"""	191327				8088805	Standard	NM_006003		Approved	RIS1, RIP1, UQCR5, RISP	uc002nsd.2	P47985		ENST00000304863.4:c.16T>G	19.37:g.29704010A>C	ENSP00000306397:p.Ser6Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_006003	0	0	0	0	0	A8K519|Q6NVX5|Q9UPH2	Missense_Mutation	SNP	ENST00000304863.4	37	CCDS12415.1	2044	0.9358974358974359	461	0.9369918699186992	326	0.9005524861878453	569	0.9947552447552448	688	0.9076517150395779	C	0.037	-1.301919	0.01353	.	.	ENSG00000169021	ENST00000304863	T	0.36520	1.25	4.42	-0.0799	0.13708	Ubiquinol-cytochrome c reductase 8kDa, N-terminal (1);Globular protein, non-globular alpha/beta subunit (1);	0.198900	0.43579	N	0.000544	T	0.00012	0.0000	N	0.00707	-1.245	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.31696	-0.9934	9	0.02654	T	1	.	4.4059	0.11409	0.1479:0.436:0.0:0.4161	rs8100724;rs17856012;rs17856322;rs60176823;rs8100724	6	P47985	UCRI_HUMAN	A	6	ENSP00000306397:S6A	ENSP00000306397:S6A	S	-	1	0	UQCRFS1	34395850	0.363000	0.24989	0.510000	0.27712	0.005000	0.04900	0.594000	0.24014	-0.304000	0.08843	-1.900000	0.00529	TCC	A|0.065;C|0.935		0.746	UQCRFS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458563.1	NM_006003	
LSM14A	26065	broad.mit.edu	37	19	34710315	34710315	+	Silent	SNP	T	T	G	rs201741862		TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr19:34710315T>G	ENST00000433627.5	+	7	876	c.801T>G	c.(799-801)gcT>gcG	p.A267A	LSM14A_ENST00000544216.3_Silent_p.A267A|LSM14A_ENST00000540746.2_Silent_p.A226A	NM_001114093.1	NP_001107565.1	Q8ND56	LS14A_HUMAN	LSM14A, SCD6 homolog A (S. cerevisiae)	267					cytoplasmic mRNA processing body assembly (GO:0033962)|multicellular organismal development (GO:0007275)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of translation (GO:0006417)|RIG-I signaling pathway (GO:0039529)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|intracellular membrane-bounded organelle (GO:0043231)	double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|single-stranded RNA binding (GO:0003727)	p.A267A(2)		breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(7)|skin(1)	22	Esophageal squamous(110;0.162)					CTCCTTCAGCTCCAAGGAGAG	0.438																																					p.A267A		.											.	LSM14A-91	2	Substitution - coding silent(2)	endometrium(1)|kidney(1)	c.T801G						.						64.0	74.0	71.0					19																	34710315		2203	4300	6503	SO:0001819	synonymous_variant	26065	exon7			TTCAGCTCCAAGG	AL834398	CCDS12435.1, CCDS46040.1	19q13.12	2010-01-27	2006-12-21	2006-01-24		ENSG00000257103			24489	protein-coding gene	gene with protein product		610677	"""chromosome 19 open reading frame 13"", ""family with sequence similarity 61, member A"", ""LSM14 homolog A (SCD6, S. cerevisiae)"""	C19orf13, FAM61A		12477932	Standard	NM_015578		Approved	DKFZP434D1335, RAP55A, RAP55	uc002nva.4	Q8ND56		ENST00000433627.5:c.801T>G	19.37:g.34710315T>G		Somatic	62	0		WXS	Illumina GAIIx	Phase_I	72	3	NM_001114093	0	0	17	18	1	B4DTG6|Q76LX7|Q96AR3|Q96K73|Q96SN5|Q9UFR3	Silent	SNP	ENST00000433627.5	37	CCDS46040.1																																																																																			T|0.999;G|0.001		0.438	LSM14A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451576.3	NM_015578	
FAM98C	147965	hgsc.bcm.edu	37	19	38894307	38894307	+	Missense_Mutation	SNP	G	G	A	rs150024474	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr19:38894307G>A	ENST00000252530.5	+	3	341	c.322G>A	c.(322-324)Gaa>Aaa	p.E108K	FAM98C_ENST00000585954.1_3'UTR|FAM98C_ENST00000588262.1_Missense_Mutation_p.E108K|FAM98C_ENST00000343358.7_Missense_Mutation_p.E108K	NM_174905.3	NP_777565.3	Q17RN3	FA98C_HUMAN	family with sequence similarity 98, member C	108										endometrium(2)|large_intestine(3)|lung(6)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	15	all_cancers(60;3.95e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			TGCGCTTCGGGAACCCGGTGC	0.701													G|||	163	0.0325479	0.0567	0.0187	5008	,	,		8213	0.0		0.0378	False		,,,				2504	0.0378				p.E108K		.											.	FAM98C-91	0			c.G322A						.	G	LYS/GLU	88,3112		0,88,1512	3.0	4.0	4.0		322	0.3	0.6	19	dbSNP_134	4	135,6981		0,135,3423	yes	missense	FAM98C	NM_174905.3	56	0,223,4935	AA,AG,GG		1.8971,2.75,2.1617	benign	108/350	38894307	223,10093	1600	3558	5158	SO:0001583	missense	147965	exon3			CTTCGGGAACCCG		CCDS42562.1	19q13.2	2008-02-05				ENSG00000130244			27119	protein-coding gene	gene with protein product						12477932	Standard	NM_174905		Approved	FLJ44669	uc002oin.1	Q17RN3		ENST00000252530.5:c.322G>A	19.37:g.38894307G>A	ENSP00000252530:p.Glu108Lys	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	18	13	NM_174905	0	0	10	19	9	A6NMW3|Q66K45	Missense_Mutation	SNP	ENST00000252530.5	37	CCDS42562.1	70	0.03205128205128205	34	0.06910569105691057	6	0.016574585635359115	0	0.0	30	0.0395778364116095	g	0.538	-0.854682	0.02630	0.0275	0.018971	ENSG00000130244	ENST00000252530;ENST00000343358	T;T	0.40476	1.03;1.03	3.77	0.289	0.15723	.	0.714837	0.11500	U	0.557841	T	0.01523	0.0049	N	0.17872	0.535	0.09310	N	1	B;B	0.17268	0.021;0.006	B;B	0.15484	0.013;0.007	T	0.15150	-1.0447	10	0.16896	T	0.51	-13.154	3.9581	0.09399	0.3104:0.1826:0.507:0.0	.	108;108	Q17RN3-2;Q17RN3	.;FA98C_HUMAN	K	108	ENSP00000252530:E108K;ENSP00000340348:E108K	ENSP00000252530:E108K	E	+	1	0	FAM98C	43586147	0.000000	0.05858	0.571000	0.28486	0.022000	0.10575	-0.097000	0.11042	0.297000	0.22615	-0.393000	0.06486	GAA	G|0.968;A|0.032		0.701	FAM98C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000459222.1	NM_174905	
RINL	126432	hgsc.bcm.edu	37	19	39360720	39360720	+	Missense_Mutation	SNP	G	G	A	rs8110393	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr19:39360720G>A	ENST00000591812.1	-	9	1291	c.1205C>T	c.(1204-1206)cCc>cTc	p.P402L	RINL_ENST00000340740.3_Missense_Mutation_p.P288L|RINL_ENST00000598904.1_Missense_Mutation_p.P288L|RINL_ENST00000602238.1_5'Flank|CTC-360G5.6_ENST00000593830.1_RNA			Q6ZS11	RINL_HUMAN	Ras and Rab interactor-like	402	VPS9. {ECO:0000255|PROSITE- ProRule:PRU00550}.		P -> L (in dbSNP:rs8110393).		endocytosis (GO:0006897)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)	actin cytoskeleton (GO:0015629)|cytoplasmic vesicle (GO:0031410)|ruffle (GO:0001726)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(3)|kidney(4)|large_intestine(2)|lung(4)|pancreas(1)|skin(1)|urinary_tract(2)	17						GGCGGGGGCGGGGCTCTGCCC	0.781													G|||	3477	0.694289	0.9289	0.6153	5008	,	,		10275	0.7619		0.4642	False		,,,				2504	0.6002				p.P402L		.											.	RINL-91	0			c.C1205T						.	G	LEU/PRO,LEU/PRO	3328,464		1489,350,57	4.0	4.0	4.0		1205,863	3.5	1.0	19	dbSNP_116	4	4059,3433		1245,1569,932	no	missense,missense	RINL	NM_001195833.1,NM_198445.3	98,98	2734,1919,989	AA,AG,GG		45.8222,12.2363,34.5356	probably-damaging,probably-damaging	402/567,288/453	39360720	7387,3897	1896	3746	5642	SO:0001583	missense	126432	exon9			GGGGCGGGGCTCT	AK127808	CCDS12522.1, CCDS59386.1	19q13.2	2010-07-13			ENSG00000187994	ENSG00000187994			24795	protein-coding gene	gene with protein product							Standard	NM_001195833		Approved	FLJ45909	uc010xuo.2	Q6ZS11		ENST00000591812.1:c.1205C>T	19.37:g.39360720G>A	ENSP00000467107:p.Pro402Leu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	34	20	NM_001195833	0	0	0	0	0	B4DPG5	Missense_Mutation	SNP	ENST00000591812.1	37	CCDS59386.1	1421	0.6506410256410257	458	0.9308943089430894	225	0.6215469613259669	401	0.701048951048951	337	0.4445910290237467	G	17.17	3.320891	0.60634	0.877637	0.541778	ENSG00000187994	ENST00000340740;ENST00000536520	T	0.28454	1.61	4.57	3.53	0.40419	Vacuolar sorting protein 9 (1);	0.269737	0.35235	N	0.003350	T	0.00012	0.0000	M	0.67700	2.07	0.21553	P	0.999649277	B;B	0.21225	0.053;0.053	B;B	0.22152	0.038;0.038	T	0.17776	-1.0358	9	0.72032	D	0.01	-26.0247	8.5759	0.33598	0.1063:0.0:0.8937:0.0	rs8110393;rs61482706	402;288	B4DPG5;Q6ZS11	.;RINL_HUMAN	L	288	ENSP00000340369:P288L	ENSP00000340369:P288L	P	-	2	0	RINL	44052560	1.000000	0.71417	0.987000	0.45799	0.313000	0.28021	4.771000	0.62318	1.273000	0.44346	0.407000	0.27541	CCC	G|0.349;A|0.651		0.781	RINL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460433.1	NM_198445	
FBXO17	115290	hgsc.bcm.edu	37	19	39440918	39440918	+	Silent	SNP	T	T	C	rs2304117	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr19:39440918T>C	ENST00000292852.4	-	2	383	c.42A>G	c.(40-42)ccA>ccG	p.P14P	SARS2_ENST00000448145.2_5'Flank|CTC-360G5.8_ENST00000599996.1_5'Flank|FBXO17_ENST00000595329.1_Silent_p.P14P	NM_024907.5	NP_079183.4	Q96EF6	FBX17_HUMAN	F-box protein 17	14						SCF ubiquitin ligase complex (GO:0019005)	glycoprotein binding (GO:0001948)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)	7	all_cancers(60;8.37e-07)|all_lung(34;3.71e-07)|Lung NSC(34;4.17e-07)|all_epithelial(25;1.13e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			GGGCCAGGGATGGGTCCGCCG	0.731													c|||	2378	0.47484	0.3336	0.3746	5008	,	,		11867	0.6796		0.4195	False		,,,				2504	0.5828				p.P23P		.											.	FBXO17-226	0			c.A69G						.		,	1052,2556		213,626,965	3.0	4.0	3.0		42,69	0.5	0.0	19	dbSNP_100	3	2265,4819		496,1273,1773	no	coding-synonymous,coding-synonymous	FBXO17	NM_024907.5,NM_148169.1	,	709,1899,2738	CC,CT,TT		31.9735,29.1574,31.0232	,	14/279,23/288	39440918	3317,7375	1804	3542	5346	SO:0001819	synonymous_variant	115290	exon2			CAGGGATGGGTCC	AF386743	CCDS12526.1	19q13.2	2010-07-02	2004-06-15	2004-06-16		ENSG00000269190		"""F-boxes /  ""other"""""	18754	protein-coding gene	gene with protein product	"""F-box only protein 26"""	609094	"""F-box only protein 17"""	FBXO26			Standard	NM_148169		Approved	FBG4, FLJ25205, MGC9379, FLJ11798, Fbx17		Q96EF6		ENST00000292852.4:c.42A>G	19.37:g.39440918T>C		Somatic	3	0		WXS	Illumina GAIIx	Phase_I	25	8	NM_148169	0	0	6	7	1	Q96LQ4	Silent	SNP	ENST00000292852.4	37	CCDS12526.1																																																																																			T|0.545;C|0.455		0.731	FBXO17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463273.1	NM_024907	
SPTBN4	57731	broad.mit.edu	37	19	40993664	40993664	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr19:40993664G>A	ENST00000352632.3	+	3	316	c.230G>A	c.(229-231)cGc>cAc	p.R77H	SPTBN4_ENST00000344104.3_Missense_Mutation_p.R77H|SPTBN4_ENST00000595535.1_Missense_Mutation_p.R77H|SPTBN4_ENST00000598249.1_Missense_Mutation_p.R77H|SPTBN4_ENST00000338932.3_Missense_Mutation_p.R77H			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4	77	Actin-binding.|CH 1. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin filament capping (GO:0051693)|adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cardiac conduction (GO:0061337)|central nervous system projection neuron axonogenesis (GO:0021952)|clustering of voltage-gated sodium channels (GO:0045162)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization to plasma membrane (GO:0090002)|fertilization (GO:0009566)|negative regulation of heart rate (GO:0010459)|positive regulation of multicellular organism growth (GO:0040018)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of sodium ion transport (GO:0002028)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|nuclear matrix (GO:0016363)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|PML body (GO:0016605)|spectrin (GO:0008091)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phosphatase binding (GO:0019902)|phospholipid binding (GO:0005543)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			CACCTCGCCCGCGTGGGCTGC	0.657																																					p.R77H		.											.	SPTBN4-94	0			c.G230A						.						38.0	39.0	39.0					19																	40993664		2203	4300	6503	SO:0001583	missense	57731	exon3			TCGCCCGCGTGGG	AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460		"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214				11086001	Standard	NM_020971		Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.230G>A	19.37:g.40993664G>A	ENSP00000263373:p.Arg77His	Somatic	57	0		WXS	Illumina GAIIx	Phase_I	75	5	NM_020971	0	0	0	0	0	E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	Missense_Mutation	SNP	ENST00000352632.3	37	CCDS12559.1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.515737	0.85495	.	.	ENSG00000160460	ENST00000428507;ENST00000352632;ENST00000338932;ENST00000344104	T;T;T	0.60299	0.2;0.2;0.2	4.28	4.28	0.50868	Calponin homology domain (5);	0.000000	0.52532	U	0.000064	T	0.68220	0.2977	L	0.61036	1.89	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.77557	0.954;0.99	T	0.70454	-0.4867	10	0.87932	D	0	.	6.4051	0.21660	0.2043:0.0:0.7957:0.0	.	77;77	Q9H254;Q71S06	SPTN4_HUMAN;.	H	77	ENSP00000263373:R77H;ENSP00000340345:R77H;ENSP00000340741:R77H	ENSP00000340345:R77H	R	+	2	0	SPTBN4	45685504	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.601000	0.74136	2.215000	0.71742	0.591000	0.81541	CGC	.		0.657	SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462559.2		
CYP2A6	1548	bcgsc.ca	37	19	41355820	41355820	+	Silent	SNP	A	A	G	rs199702575		TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr19:41355820A>G	ENST00000301141.5	-	2	266	c.246T>C	c.(244-246)tgT>tgC	p.C82C	CTC-490E21.12_ENST00000601627.1_Intron	NM_000762.5	NP_000753	P11509	CP2A6_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 6	82					coumarin catabolic process (GO:0046226)|coumarin metabolic process (GO:0009804)|drug metabolic process (GO:0017144)|exogenous drug catabolic process (GO:0042738)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	cytoplasmic microtubule (GO:0005881)|endoplasmic reticulum membrane (GO:0005789)	coumarin 7-hydroxylase activity (GO:0008389)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(2)	37			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)		Acetaminophen(DB00316)|Amiodarone(DB01118)|Amlodipine(DB00381)|Amobarbital(DB01351)|Amphetamine(DB00182)|Antipyrine(DB01435)|Arformoterol(DB01274)|Azelastine(DB00972)|Azithromycin(DB00207)|Buprenorphine(DB00921)|Bupropion(DB01156)|Chlorzoxazone(DB00356)|Cinnarizine(DB00568)|Cisapride(DB00604)|Clofibrate(DB00636)|Clomifene(DB00882)|Clotrimazole(DB00257)|Clozapine(DB00363)|Cyclophosphamide(DB00531)|Dapagliflozin(DB06292)|Desipramine(DB01151)|Dexamethasone(DB01234)|Dexfenfluramine(DB01191)|Diethylstilbestrol(DB00255)|Dronabinol(DB00470)|Eletriptan(DB00216)|Ezogabine(DB04953)|Flunarizine(DB04841)|Flunitrazepam(DB01544)|Fluorouracil(DB00544)|Flurazepam(DB00690)|Fomepizole(DB01213)|Formoterol(DB00983)|Halothane(DB01159)|Ifosfamide(DB01181)|Isoniazid(DB00951)|Ketoconazole(DB01026)|Letrozole(DB01006)|Lidocaine(DB00281)|Lorcaserin(DB04871)|Memantine(DB01043)|Menadione(DB00170)|Methimazole(DB00763)|Methoxsalen(DB00553)|Methoxyflurane(DB01028)|Metyrapone(DB01011)|Miconazole(DB01110)|Montelukast(DB00471)|Nevirapine(DB00238)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Norfloxacin(DB01059)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Pilocarpine(DB01085)|Prednisolone(DB00860)|Progesterone(DB00396)|Propofol(DB00818)|Rifampicin(DB01045)|Rosiglitazone(DB00412)|Selegiline(DB01037)|Sevoflurane(DB01236)|Sulfaphenazole(DB06729)|Tamoxifen(DB00675)|Tranylcypromine(DB00752)|Tretinoin(DB00755)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Zidovudine(DB00495)	CATCATGTCCACACAGCACCA	0.617																																					p.C82C		.											.	CYP2A6-92	0			c.T246C						.						63.0	62.0	62.0					19																	41355820		2203	4296	6499	SO:0001819	synonymous_variant	1548	exon2			ATGTCCACACAGC	AF182275	CCDS12568.1	19q13.2	2013-11-11	2003-01-14		ENSG00000255974	ENSG00000255974		"""Cytochrome P450s"""	2610	protein-coding gene	gene with protein product		122720	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 6"""	CYP2A3		7668294, 2748347	Standard	NM_000762		Approved	CPA6, CYP2A	uc002opl.4	P11509	OTTHUMG00000182713	ENST00000301141.5:c.246T>C	19.37:g.41355820A>G		Somatic	282	10		WXS	Illumina GAIIx	Phase_I	397	18	NM_000762	0	0	0	0	0	A7YAE5|B2R7F6|P00190|P10890|Q16803|Q4VAT9|Q4VAU0|Q4VAU1|Q9H1Z7|Q9UCU0|Q9UK48	Silent	SNP	ENST00000301141.5	37	CCDS12568.1																																																																																			A|0.999;G|0.001		0.617	CYP2A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463259.1	NM_000762	
CYP2A6	1548	bcgsc.ca	37	19	41355828	41355828	+	Missense_Mutation	SNP	C	C	T	rs200582200		TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr19:41355828C>T	ENST00000301141.5	-	2	258	c.238G>A	c.(238-240)Gtg>Atg	p.V80M	CTC-490E21.12_ENST00000601627.1_Intron	NM_000762.5	NP_000753	P11509	CP2A6_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 6	80					coumarin catabolic process (GO:0046226)|coumarin metabolic process (GO:0009804)|drug metabolic process (GO:0017144)|exogenous drug catabolic process (GO:0042738)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	cytoplasmic microtubule (GO:0005881)|endoplasmic reticulum membrane (GO:0005789)	coumarin 7-hydroxylase activity (GO:0008389)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(2)	37			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)		Acetaminophen(DB00316)|Amiodarone(DB01118)|Amlodipine(DB00381)|Amobarbital(DB01351)|Amphetamine(DB00182)|Antipyrine(DB01435)|Arformoterol(DB01274)|Azelastine(DB00972)|Azithromycin(DB00207)|Buprenorphine(DB00921)|Bupropion(DB01156)|Chlorzoxazone(DB00356)|Cinnarizine(DB00568)|Cisapride(DB00604)|Clofibrate(DB00636)|Clomifene(DB00882)|Clotrimazole(DB00257)|Clozapine(DB00363)|Cyclophosphamide(DB00531)|Dapagliflozin(DB06292)|Desipramine(DB01151)|Dexamethasone(DB01234)|Dexfenfluramine(DB01191)|Diethylstilbestrol(DB00255)|Dronabinol(DB00470)|Eletriptan(DB00216)|Ezogabine(DB04953)|Flunarizine(DB04841)|Flunitrazepam(DB01544)|Fluorouracil(DB00544)|Flurazepam(DB00690)|Fomepizole(DB01213)|Formoterol(DB00983)|Halothane(DB01159)|Ifosfamide(DB01181)|Isoniazid(DB00951)|Ketoconazole(DB01026)|Letrozole(DB01006)|Lidocaine(DB00281)|Lorcaserin(DB04871)|Memantine(DB01043)|Menadione(DB00170)|Methimazole(DB00763)|Methoxsalen(DB00553)|Methoxyflurane(DB01028)|Metyrapone(DB01011)|Miconazole(DB01110)|Montelukast(DB00471)|Nevirapine(DB00238)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Norfloxacin(DB01059)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Pilocarpine(DB01085)|Prednisolone(DB00860)|Progesterone(DB00396)|Propofol(DB00818)|Rifampicin(DB01045)|Rosiglitazone(DB00412)|Selegiline(DB01037)|Sevoflurane(DB01236)|Sulfaphenazole(DB06729)|Tamoxifen(DB00675)|Tranylcypromine(DB00752)|Tretinoin(DB00755)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Zidovudine(DB00495)	CCACACAGCACCACGACCCGC	0.627																																					p.V80M		.											.	CYP2A6-92	0			c.G238A						.																																			SO:0001583	missense	1548	exon2			ACAGCACCACGAC	AF182275	CCDS12568.1	19q13.2	2013-11-11	2003-01-14		ENSG00000255974	ENSG00000255974		"""Cytochrome P450s"""	2610	protein-coding gene	gene with protein product		122720	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 6"""	CYP2A3		7668294, 2748347	Standard	NM_000762		Approved	CPA6, CYP2A	uc002opl.4	P11509	OTTHUMG00000182713	ENST00000301141.5:c.238G>A	19.37:g.41355828C>T	ENSP00000301141:p.Val80Met	Somatic	278	11		WXS	Illumina GAIIx	Phase_I	383	20	NM_000762	0	0	0	0	0	A7YAE5|B2R7F6|P00190|P10890|Q16803|Q4VAT9|Q4VAU0|Q4VAU1|Q9H1Z7|Q9UCU0|Q9UK48	Missense_Mutation	SNP	ENST00000301141.5	37	CCDS12568.1	.	.	.	.	.	.	.	.	.	.	-	14.78	2.638204	0.47153	.	.	ENSG00000255974	ENST00000301141	T	0.72167	-0.63	2.72	2.72	0.32119	.	0.233778	0.33792	U	0.004555	T	0.71567	0.3355	M	0.69463	2.115	0.30711	N	0.749265	D	0.61697	0.99	P	0.48524	0.58	T	0.74197	-0.3743	10	0.48119	T	0.1	.	12.2118	0.54383	0.0:1.0:0.0:0.0	.	80	P11509	CP2A6_HUMAN	M	80	ENSP00000301141:V80M	ENSP00000301141:V80M	V	-	1	0	CYP2A6	46047668	1.000000	0.71417	0.330000	0.25442	0.037000	0.13140	2.581000	0.46077	1.336000	0.45506	0.185000	0.17295	GTG	.		0.627	CYP2A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463259.1	NM_000762	
ERCC2	2068	hgsc.bcm.edu	37	19	45867259	45867259	+	Missense_Mutation	SNP	C	C	T	rs1799793	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr19:45867259C>T	ENST00000391945.4	-	10	1011	c.934G>A	c.(934-936)Gac>Aac	p.D312N	ERCC2_ENST00000221481.6_3'UTR|ERCC2_ENST00000391940.4_Missense_Mutation_p.D288N|ERCC2_ENST00000391944.3_Missense_Mutation_p.D234N|ERCC2_ENST00000485403.2_Missense_Mutation_p.D288N	NM_000400.3	NP_000391.1	P18074	ERCC2_HUMAN	excision repair cross-complementation group 2	312			D -> N (in dbSNP:rs1799793). {ECO:0000269|PubMed:11245433, ECO:0000269|PubMed:11470747, ECO:0000269|PubMed:11709541, ECO:0000269|Ref.3}.		7-methylguanosine mRNA capping (GO:0006370)|aging (GO:0007568)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|central nervous system myelin formation (GO:0032289)|chromosome segregation (GO:0007059)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)|embryonic cleavage (GO:0040016)|erythrocyte maturation (GO:0043249)|extracellular matrix organization (GO:0030198)|gene expression (GO:0010467)|hair cell differentiation (GO:0035315)|hair follicle maturation (GO:0048820)|hematopoietic stem cell differentiation (GO:0060218)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision (GO:0033683)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral transcription (GO:0050434)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to hypoxia (GO:0001666)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|spinal cord development (GO:0021510)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)|viral process (GO:0016032)	cytoplasm (GO:0005737)|holo TFIIH complex (GO:0005675)|MMXD complex (GO:0071817)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	4 iron, 4 sulfur cluster binding (GO:0051539)|5'-3' DNA helicase activity (GO:0043139)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			large_intestine(4)|lung(2)|ovary(1)|pancreas(1)|stomach(1)	9		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		AGCACTTCGTCGGGCAGCACG	0.746			"""Mis, N, F, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum				C|||	974	0.194489	0.0734	0.1988	5008	,	,		10423	0.0496		0.3588	False		,,,				2504	0.3354				p.D312N		.	yes	Rec		Xeroderma pigmentosum (D)	19	19q13.2-q13.3	2068	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 (xeroderma pigmentosum D)"""		E	.	ERCC2-848	0			c.G934A	GRCh37	CM015299	ERCC2	M	rs1799793	.	C	ASN/ASP,ASN/ASP	387,3577		30,327,1625	5.0	8.0	7.0		934,862	5.2	0.5	19	dbSNP_89	7	2507,5397		444,1619,1889	no	missense,missense	ERCC2	NM_000400.3,NM_001130867.1	23,23	474,1946,3514	TT,TC,CC		31.7181,9.7629,24.3849	benign,benign	312/761,288/406	45867259	2894,8974	1982	3952	5934	SO:0001583	missense	2068	exon10	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	CTTCGTCGGGCAG		CCDS33049.1, CCDS46112.1	19q13.3	2014-09-17	2014-03-07		ENSG00000104884	ENSG00000104884	3.6.4.12	"""General transcription factor IIH complex subunits"""	3434	protein-coding gene	gene with protein product	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 protein"", ""TFIIH basal transcription factor complex helicase XPB subunit"""	126340	"""xeroderma pigmentosum complementary group D"", ""excision repair cross-complementing rodent repair deficiency, complementation group 2"""	XPD		8413672, 2184031	Standard	NM_000400		Approved	MAG, EM9, MGC102762, MGC126218, MGC126219, TFIIH	uc002pbj.2	P18074	OTTHUMG00000048190	ENST00000391945.4:c.934G>A	19.37:g.45867259C>T	ENSP00000375809:p.Asp312Asn	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	27	12	NM_000400	0	0	2	6	4	Q2TB78|Q2YDY2|Q7KZU6|Q8N721	Missense_Mutation	SNP	ENST00000391945.4	37	CCDS33049.1	423	0.1936813186813187	34	0.06910569105691057	70	0.19337016574585636	38	0.06643356643356643	281	0.370712401055409	C	20.0	3.930510	0.73327	0.097629	0.317181	ENSG00000104884	ENST00000391941;ENST00000391942;ENST00000391945;ENST00000391944;ENST00000391940	T;T;T	0.64438	-0.1;-0.1;-0.1	5.15	5.15	0.70609	Domain of unknown function DUF1227 (1);	0.000000	0.85682	D	0.000000	T	0.00012	0.0000	L	0.46947	1.48	0.09310	P	1.0	B;P;B	0.34639	0.065;0.461;0.053	B;B;B	0.35353	0.059;0.201;0.051	T	0.28267	-1.0049	9	0.33940	T	0.23	-30.0006	16.1268	0.81402	0.0:1.0:0.0:0.0	rs1799793;rs3916814;rs58989209;rs1799793	234;288;312	E7EVE9;Q7KZU6;P18074	.;.;ERCC2_HUMAN	N	262;288;312;234;288	ENSP00000375809:D312N;ENSP00000375808:D234N;ENSP00000375804:D288N	ENSP00000375804:D288N	D	-	1	0	ERCC2	50559099	1.000000	0.71417	0.523000	0.27875	0.865000	0.49528	7.192000	0.77771	2.388000	0.81334	0.561000	0.74099	GAC	C|0.804;T|0.196		0.746	ERCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109626.2	NM_000400	
NTF4	4909	ucsc.edu	37	19	49565034	49565034	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr19:49565034G>A	ENST00000593537.1	-	1	220	c.221C>T	c.(220-222)cCg>cTg	p.P74L	CGB7_ENST00000597853.1_5'Flank|NTF4_ENST00000301411.3_Missense_Mutation_p.P74L|NTF4_ENST00000594938.1_5'Flank|NTF4_ENST00000451356.2_5'UTR|CTB-60B18.18_ENST00000599209.1_lincRNA|CGB7_ENST00000356213.4_5'Flank|CTB-60B18.12_ENST00000597865.1_RNA			P34130	NTF4_HUMAN	neurotrophin 4	74					adult locomotory behavior (GO:0008344)|epidermis development (GO:0008544)|ganglion mother cell fate determination (GO:0007402)|innervation (GO:0060384)|long-term memory (GO:0007616)|mechanoreceptor differentiation (GO:0042490)|negative regulation of cell death (GO:0060548)|sensory organ boundary specification (GO:0008052)|taste bud development (GO:0061193)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	growth factor activity (GO:0008083)			kidney(1)|lung(4)|upper_aerodigestive_tract(1)	6		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_epithelial(76;3.83e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000371)|OV - Ovarian serous cystadenocarcinoma(262;0.000503)|GBM - Glioblastoma multiforme(486;0.00518)|Epithelial(262;0.0427)		GCGGTTGGCCGGGGCACCTGC	0.682																																					p.P74L		.											.	NTF4-68	0			c.C221T						.						6.0	6.0	6.0					19																	49565034		2115	4144	6259	SO:0001583	missense	4909	exon2			TTGGCCGGGGCAC		CCDS12754.1	19q13.3	2014-01-30	2008-01-31	2008-01-31		ENSG00000225950		"""Endogenous ligands"""	8024	protein-coding gene	gene with protein product	"""neurotrophic factor 4"""	162662	"""neurotrophin 5 (neurotrophin 4/5)"""	NTF5		1496419	Standard	NM_006179		Approved	NT-4/5, GLC1O	uc010yah.1	P34130		ENST00000593537.1:c.221C>T	19.37:g.49565034G>A	ENSP00000469455:p.Pro74Leu	Somatic	17	0		WXS	Illumina GAIIx	Phase_I	43	5	NM_006179	0	0	0	0	0	Q6FH56	Missense_Mutation	SNP	ENST00000593537.1	37	CCDS12754.1	.	.	.	.	.	.	.	.	.	.	G	9.161	1.018795	0.19355	.	.	ENSG00000167744	ENST00000301411	T	0.61742	0.08	3.54	3.54	0.40534	.	0.794895	0.10336	N	0.686840	T	0.39279	0.1072	N	0.14661	0.345	0.32092	N	0.591681	B	0.15719	0.014	B	0.08055	0.003	T	0.40887	-0.9539	10	0.34782	T	0.22	-8.2342	9.4814	0.38902	0.1122:0.0:0.8878:0.0	.	74	P34130	NTF4_HUMAN	L	74	ENSP00000301411:P74L	ENSP00000301411:P74L	P	-	2	0	NTF4	54256846	0.985000	0.35326	0.764000	0.31436	0.547000	0.35210	2.866000	0.48420	1.945000	0.56424	0.313000	0.20887	CCG	.		0.682	NTF4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466258.1	NM_006179	
ASPDH	554235	hgsc.bcm.edu	37	19	51015404	51015404	+	Missense_Mutation	SNP	T	T	C	rs12977172	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr19:51015404T>C	ENST00000389208.4	-	6	858	c.797A>G	c.(796-798)cAg>cGg	p.Q266R	JOSD2_ENST00000391815.3_5'Flank|ASPDH_ENST00000597030.1_5'Flank|ASPDH_ENST00000376916.3_Missense_Mutation_p.Q161R|JOSD2_ENST00000598418.1_5'Flank|JOSD2_ENST00000601423.1_5'Flank|JOSD2_ENST00000595669.1_5'Flank	NM_001114598.1	NP_001108070.1	A6ND91	ASPD_HUMAN	aspartate dehydrogenase domain containing	266			Q -> R (in dbSNP:rs12977172). {ECO:0000269|PubMed:15489334, ECO:0000269|Ref.1}.		NAD biosynthetic process (GO:0009435)|NADP catabolic process (GO:0006742)		aspartate dehydrogenase activity (GO:0033735)|NADP binding (GO:0050661)			endometrium(1)|large_intestine(1)|lung(1)	3						CAGGAGGCTCTGCCAGAAGGC	0.706													C|||	3986	0.795927	0.9728	0.7781	5008	,	,		10864	0.7143		0.6849	False		,,,				2504	0.7679				p.Q266R		.											.	ASPDH-90	0			c.A797G						.	C	ARG/GLN,ARG/GLN	3799,331		1771,257,37	6.0	9.0	8.0		482,797	1.9	1.0	19	dbSNP_121	8	5527,2593		1919,1689,452	no	missense,missense	ASPDH	NM_001024656.2,NM_001114598.1	43,43	3690,1946,489	CC,CT,TT		31.9335,8.0145,23.8694	benign,benign	161/179,266/284	51015404	9326,2924	2065	4060	6125	SO:0001583	missense	554235	exon6			AGGCTCTGCCAGA		CCDS33082.1, CCDS46153.1	19q13.33	2012-10-02			ENSG00000204653	ENSG00000204653			33856	protein-coding gene	gene with protein product							Standard	NM_001024656		Approved		uc010enz.3	A6ND91		ENST00000389208.4:c.797A>G	19.37:g.51015404T>C	ENSP00000373860:p.Gln266Arg	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	11	11	NM_001114598	0	0	0	0	0	Q6NZ37	Missense_Mutation	SNP	ENST00000389208.4	37	CCDS46153.1	1681	0.7696886446886447	481	0.9776422764227642	273	0.7541436464088398	412	0.7202797202797203	515	0.679419525065963	C	3.606	-0.080592	0.07141	0.919855	0.680665	ENSG00000204653	ENST00000376916;ENST00000389208	T;T	0.39997	1.05;1.05	2.95	1.88	0.25563	Aspartate dehydrogenase (1);	1.158050	0.06646	N	0.761872	T	0.00012	0.0000	N	0.01705	-0.755	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.30794	-0.9966	9	0.06099	T	0.92	-1.7519	4.8935	0.13738	0.0:0.6813:0.0:0.3187	rs12977172	266;161	A6ND91;A6ND91-2	ASPD_HUMAN;.	R	161;266	ENSP00000366114:Q161R;ENSP00000373860:Q266R	ENSP00000366114:Q161R	Q	-	2	0	ASPDH	55707216	0.916000	0.31088	0.989000	0.46669	0.553000	0.35397	0.171000	0.16685	0.125000	0.18397	-0.355000	0.07637	CAG	T|0.228;C|0.772		0.706	ASPDH-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464861.1	NM_001024656	
ZNF880	400713	broad.mit.edu	37	19	52888210	52888210	+	Silent	SNP	T	T	C	rs56151179	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr19:52888210T>C	ENST00000422689.2	+	4	1392	c.1377T>C	c.(1375-1377)acT>acC	p.T459T		NM_001145434.1	NP_001138906.1	Q6PDB4	ZN880_HUMAN	zinc finger protein 880	459					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(2)|skin(1)	10						GATTTCATACTGGAGAGAAAC	0.388																																					p.T459T		.											.	.	0			c.T1377C						.	T		529,855		102,325,265	74.0	70.0	71.0		1377	2.0	0.9	19	dbSNP_129	71	1217,1965		222,773,596	no	coding-synonymous	ZNF880	NM_001145434.1		324,1098,861	CC,CT,TT		38.2464,38.2225,38.2392		459/578	52888210	1746,2820	692	1591	2283	SO:0001819	synonymous_variant	400713	exon4			TCATACTGGAGAG	BC058819	CCDS46164.1	19q13.41	2013-01-08			ENSG00000221923	ENSG00000221923		"""Zinc fingers, C2H2-type"", ""-"""	37249	protein-coding gene	gene with protein product							Standard	NM_001145434		Approved		uc002pzc.3	Q6PDB4	OTTHUMG00000167972	ENST00000422689.2:c.1377T>C	19.37:g.52888210T>C		Somatic	86	0		WXS	Illumina GAIIx	Phase_I	97	4	NM_001145434	0	0	0	1	1	B4DNA6	Silent	SNP	ENST00000422689.2	37	CCDS46164.1																																																																																			T|0.632;C|0.368		0.388	ZNF880-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397374.1	NM_001145434	
ZNF880	400713	broad.mit.edu	37	19	52888245	52888245	+	Missense_Mutation	SNP	A	A	G	rs55748277	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr19:52888245A>G	ENST00000422689.2	+	4	1427	c.1412A>G	c.(1411-1413)aAg>aGg	p.K471R		NM_001145434.1	NP_001138906.1	Q6PDB4	ZN880_HUMAN	zinc finger protein 880	471					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(2)|skin(1)	10						GAATGTGGCAAGGACTTCACT	0.388													A|||	2061	0.411542	0.3555	0.3919	5008	,	,		22737	0.3492		0.4205	False		,,,				2504	0.5562				p.K471R		.											.	.	0			c.A1412G						.	A	ARG/LYS	529,855		102,325,265	83.0	75.0	77.0		1412	-0.5	0.0	19	dbSNP_129	77	1216,1966		222,772,597	no	missense	ZNF880	NM_001145434.1	26	324,1097,862	GG,GA,AA		38.215,38.2225,38.2173	possibly-damaging	471/578	52888245	1745,2821	692	1591	2283	SO:0001583	missense	400713	exon4			GTGGCAAGGACTT	BC058819	CCDS46164.1	19q13.41	2013-01-08			ENSG00000221923	ENSG00000221923		"""Zinc fingers, C2H2-type"", ""-"""	37249	protein-coding gene	gene with protein product							Standard	NM_001145434		Approved		uc002pzc.3	Q6PDB4	OTTHUMG00000167972	ENST00000422689.2:c.1412A>G	19.37:g.52888245A>G	ENSP00000406318:p.Lys471Arg	Somatic	111	1		WXS	Illumina GAIIx	Phase_I	136	4	NM_001145434	0	0	0	0	0	B4DNA6	Missense_Mutation	SNP	ENST00000422689.2	37	CCDS46164.1	802	0.36721611721611724	164	0.3333333333333333	148	0.4088397790055249	179	0.3129370629370629	311	0.4102902374670185	A	13.64	2.296527	0.40594	0.382225	0.38215	ENSG00000221923	ENST00000422689	T	0.26223	1.75	2.03	-0.46	0.12175	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.00012	0.0000	L	0.35854	1.095	0.58432	P	9.99999999995449E-6	D	0.62365	0.991	D	0.63703	0.917	T	0.43750	-0.9372	7	.	.	.	.	6.4253	0.21766	0.7772:0.0:0.2228:0.0	rs55748277;rs62108357	471	Q6PDB4	ZN880_HUMAN	R	471	ENSP00000406318:K471R	.	K	+	2	0	ZNF880	57580057	0.060000	0.20803	0.007000	0.13788	0.010000	0.07245	1.664000	0.37439	-0.387000	0.07809	0.450000	0.29827	AAG	A|0.631;G|0.369		0.388	ZNF880-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397374.1	NM_001145434	
UBE2S	27338	hgsc.bcm.edu	37	19	55912946	55912946	+	Missense_Mutation	SNP	T	T	G	rs61748180	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr19:55912946T>G	ENST00000264552.9	-	4	714	c.527A>C	c.(526-528)gAa>gCa	p.E176A	CTD-2105E13.13_ENST00000589101.1_lincRNA|UBE2S_ENST00000592570.1_5'Flank|RPL28_ENST00000560055.1_Intron	NM_014501.2	NP_055316.2	Q16763	UBE2S_HUMAN	ubiquitin-conjugating enzyme E2S	176					activation of anaphase-promoting complex activity (GO:0051488)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cellular protein modification process (GO:0006464)|exit from mitosis (GO:0010458)|free ubiquitin chain polymerization (GO:0010994)|protein K11-linked ubiquitination (GO:0070979)|protein K27-linked ubiquitination (GO:0044314)|protein K29-linked ubiquitination (GO:0035519)|protein K6-linked ubiquitination (GO:0085020)|protein K63-linked ubiquitination (GO:0070534)	anaphase-promoting complex (GO:0005680)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin-protein transferase activity (GO:0004842)			lung(1)	1	Breast(117;0.155)		LUSC - Lung squamous cell carcinoma(43;0.13)|BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.11)		GGAGGAAGCTTCAGTGCCACT	0.731													G|||	195	0.0389377	0.0265	0.0893	5008	,	,		10123	0.0		0.0865	False		,,,				2504	0.0112				p.E176A		.											.	UBE2S-226	0			c.A527C						.						10.0	12.0	11.0					19																	55912946		1884	3905	5789	SO:0001583	missense	27338	exon4			GAAGCTTCAGTGC	BC004236	CCDS33114.1	19q13.43	2008-02-05				ENSG00000108106		"""Ubiquitin-conjugating enzymes E2"""	17895	protein-coding gene	gene with protein product	"""ubiquitin carrier protein"", ""ubiquitin-conjugating enzyme E2-24 kD"", ""ubiquitin-protein ligase"""	610309				1379239	Standard	NM_014501		Approved	E2-EPF	uc002qkx.1	Q16763		ENST00000264552.9:c.527A>C	19.37:g.55912946T>G	ENSP00000264552:p.Glu176Ala	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	30	16	NM_014501	0	0	59	135	76	Q9BTC1	Missense_Mutation	SNP	ENST00000264552.9	37	CCDS33114.1	98	0.04487179487179487	10	0.02032520325203252	34	0.09392265193370165	0	0.0	54	0.0712401055408971	G	0.014	-1.590515	0.00864	.	.	ENSG00000108106	ENST00000264552	T	0.58060	0.36	4.56	0.755	0.18415	.	0.541519	0.18159	N	0.149853	T	0.00724	0.0024	N	0.03608	-0.345	0.36078	D	0.842578	B	0.02656	0.0	B	0.01281	0.0	T	0.10823	-1.0613	10	0.10902	T	0.67	-0.0888	4.4617	0.11669	0.0819:0.1297:0.5229:0.2655	rs61748180	176	Q16763	UBE2S_HUMAN	A	176	ENSP00000264552:E176A	ENSP00000264552:E176A	E	-	2	0	UBE2S	60604758	0.003000	0.15002	0.001000	0.08648	0.032000	0.12392	1.161000	0.31773	0.117000	0.18138	-0.217000	0.12591	GAA	T|0.951;G|0.049		0.731	UBE2S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453088.1	NM_014501	
ZNF814	730051	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	58385748	58385748	+	Missense_Mutation	SNP	G	G	A	rs145250945		TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr19:58385748G>A	ENST00000435989.2	-	3	1244	c.1010C>T	c.(1009-1011)gCt>gTt	p.A337V	ZNF814_ENST00000600634.1_Intron|ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000597832.1_Intron|ZNF814_ENST00000597342.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	337					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A337V(2)		NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						ACTGAAGCTAGCATATTTGCT	0.353																																					p.A337V		.											.	.	2	Substitution - Missense(2)	prostate(2)	c.C1010T						.						58.0	51.0	53.0					19																	58385748		692	1591	2283	SO:0001583	missense	730051	exon3			AAGCTAGCATATT		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.1010C>T	19.37:g.58385748G>A	ENSP00000410545:p.Ala337Val	Somatic	114	1		WXS	Illumina GAIIx	Phase_I	267	105	NM_001144989	0	0	1	1	0	A6NF35	Missense_Mutation	SNP	ENST00000435989.2	37	CCDS46212.1	.	.	.	.	.	.	.	.	.	.	.	3.777	-0.046344	0.07407	.	.	ENSG00000204514	ENST00000435989	T	0.15372	2.43	2.11	-4.21	0.03812	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.07728	0.0194	N	0.21142	0.635	0.09310	N	1	B	0.32781	0.384	B	0.18561	0.022	T	0.05649	-1.0872	9	0.66056	D	0.02	.	3.5015	0.07674	0.0936:0.1206:0.3016:0.4843	.	337	B7Z6K7	ZN814_HUMAN	V	337	ENSP00000410545:A337V	ENSP00000410545:A337V	A	-	2	0	ZNF814	63077560	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-2.230000	0.01207	-3.525000	0.00147	-3.867000	0.00017	GCT	.		0.353	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
ZNF814	730051	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	58385762	58385762	+	Silent	SNP	C	C	G	rs199732634		TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr19:58385762C>G	ENST00000435989.2	-	3	1230	c.996G>C	c.(994-996)tcG>tcC	p.S332S	ZNF814_ENST00000600634.1_Intron|ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000597832.1_Intron|ZNF814_ENST00000597342.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	332					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S332S(2)		NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						ATTTGCTAAACGATTTCCCAC	0.358																																					p.S332S		.											.	.	2	Substitution - coding silent(2)	kidney(2)	c.G996C						.						25.0	25.0	25.0					19																	58385762		692	1589	2281	SO:0001819	synonymous_variant	730051	exon3			GCTAAACGATTTC		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.996G>C	19.37:g.58385762C>G		Somatic	101	1		WXS	Illumina GAIIx	Phase_I	238	73	NM_001144989	0	0	1	1	0	A6NF35	Silent	SNP	ENST00000435989.2	37	CCDS46212.1																																																																																			.		0.358	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
ZNF814	730051	bcgsc.ca	37	19	58385873	58385873	+	Silent	SNP	T	T	C	rs397978905	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr19:58385873T>C	ENST00000435989.2	-	3	1119	c.885A>G	c.(883-885)aaA>aaG	p.K295K	ZNF814_ENST00000600634.1_Intron|ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000597832.1_Intron|ZNF814_ENST00000597342.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	295					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						CACATTCATGTTTTTTTTCAG	0.358																																					p.K295K		.											.	.	0			c.A885G						.						17.0	13.0	14.0					19																	58385873		687	1561	2248	SO:0001819	synonymous_variant	730051	exon3			TTCATGTTTTTTT		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.885A>G	19.37:g.58385873T>C		Somatic	126	6		WXS	Illumina GAIIx	Phase_I	41	9	NM_001144989	0	0	0	0	0	A6NF35	Silent	SNP	ENST00000435989.2	37	CCDS46212.1																																																																																			.		0.358	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
TPO	7173	hgsc.bcm.edu	37	2	1481231	1481231	+	Missense_Mutation	SNP	G	G	C	rs2175977	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr2:1481231G>C	ENST00000345913.4	+	8	1284	c.1193G>C	c.(1192-1194)aGc>aCc	p.S398T	TPO_ENST00000337415.3_Missense_Mutation_p.S398T|TPO_ENST00000329066.4_Missense_Mutation_p.S398T|TPO_ENST00000382198.1_Intron|TPO_ENST00000497517.2_Intron|TPO_ENST00000349624.3_Intron|TPO_ENST00000346956.3_Missense_Mutation_p.S398T|TPO_ENST00000382201.3_Missense_Mutation_p.S398T	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	398			S -> T (in dbSNP:rs2175977). {ECO:0000269|PubMed:7550241}.		cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	GGCCGCGCCAGCGAGGTCCCC	0.761													G|||	3557	0.710264	0.8185	0.6571	5008	,	,		9157	0.7758		0.6034	False		,,,				2504	0.6442				p.S398T		.											.	TPO-332	0			c.G1193C						.	G	THR/SER,THR/SER,THR/SER,THR/SER,THR/SER,	2498,394		1072,354,20	2.0	2.0	2.0		1193,1193,1193,1193,1193,	4.1	1.0	2	dbSNP_96	2	4199,1477		1511,1177,150	no	missense,missense,missense,missense,missense,intron	TPO	NM_000547.5,NM_001206744.1,NM_001206745.1,NM_175719.3,NM_175721.3,NM_175722.3	58,58,58,58,58,	2583,1531,170	CC,CG,GG		26.0218,13.6238,21.8371	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,	398/934,398/934,398/877,398/877,398/890,	1481231	6697,1871	1446	2838	4284	SO:0001583	missense	7173	exon8			GCGCCAGCGAGGT		CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.1193G>C	2.37:g.1481231G>C	ENSP00000318820:p.Ser398Thr	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	15	15	NM_175719	0	0	0	0	0	P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Missense_Mutation	SNP	ENST00000345913.4	37	CCDS1643.1	1512|1512	0.6923076923076923|0.6923076923076923	388|388	0.7886178861788617|0.7886178861788617	227|227	0.6270718232044199|0.6270718232044199	438|438	0.7657342657342657|0.7657342657342657	459|459	0.6055408970976254|0.6055408970976254	G|G	18.72|18.72	3.683431|3.683431	0.68157|0.68157	0.863762|0.863762	0.739782|0.739782	ENSG00000115705|ENSG00000115705	ENST00000536482|ENST00000337415;ENST00000345913;ENST00000346956;ENST00000329066;ENST00000382201;ENST00000422464	.|T;T;T;T;T;T	.|0.73897	.|-0.79;-0.79;-0.79;-0.79;-0.79;-0.79	4.99|4.99	4.08|4.08	0.47627|0.47627	.|.	.|0.142496	.|0.64402	.|N	.|0.000004	T|T	0.00012|0.00012	0.0000|0.0000	M|M	0.62723|0.62723	1.935|1.935	0.09310|0.09310	P|P	1.0|1.0	.|D;D;D	.|0.76494	.|0.998;0.998;0.999	.|D;D;D	.|0.69654	.|0.956;0.94;0.965	T|T	0.30060|0.30060	-0.9991|-0.9991	5|9	0.48119|0.56958	T|D	0.1|0.05	-48.0867|-48.0867	8.6411|8.6411	0.33978|0.33978	0.08:0.1541:0.7659:0.0|0.08:0.1541:0.7659:0.0	rs2175977|rs2175977	.|398;398;398	.|P07202-4;P07202-2;P07202	.|.;.;PERT_HUMAN	H|T	81|398;398;398;398;398;327	.|ENSP00000337263:S398T;ENSP00000318820:S398T;ENSP00000263886:S398T;ENSP00000329869:S398T;ENSP00000371636:S398T;ENSP00000405788:S327T	ENSP00000439133:Q81H|ENSP00000329869:S398T	Q|S	+|+	3|2	2|0	TPO|TPO	1460238|1460238	0.956000|0.956000	0.32656|0.32656	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	1.297000|1.297000	0.33400|0.33400	1.031000|1.031000	0.39867|0.39867	0.460000|0.460000	0.39030|0.39030	CAG|AGC	G|0.301;C|0.699		0.761	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206594.2	NM_000547	
CMPK2	129607	hgsc.bcm.edu	37	2	7005369	7005369	+	Silent	SNP	A	A	G	rs11678810	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr2:7005369A>G	ENST00000256722.5	-	1	458	c.459T>C	c.(457-459)tgT>tgC	p.C153C	CMPK2_ENST00000458098.1_Silent_p.C153C|CMPK2_ENST00000478738.1_Intron|CMPK2_ENST00000404168.1_Silent_p.C153C	NM_207315.3	NP_997198.2	Q5EBM0	CMPK2_HUMAN	cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial	153					cellular response to lipopolysaccharide (GO:0071222)|dTDP biosynthetic process (GO:0006233)|dUDP biosynthetic process (GO:0006227)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cytidylate kinase activity (GO:0004127)|nucleoside diphosphate kinase activity (GO:0004550)|thymidylate kinase activity (GO:0004798)|UMP kinase activity (GO:0033862)			large_intestine(1)|lung(13)|prostate(1)|upper_aerodigestive_tract(1)	16	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					GTGCCTCCTGACAGGCGCCCA	0.741													G|||	4998	0.998003	0.9924	1.0	5008	,	,		10694	1.0		1.0	False		,,,				2504	1.0				p.C153C		.											.	CMPK2-68	0			c.T459C						.	G		3605,39		1783,39,0	3.0	4.0	4.0		459	1.6	0.0	2	dbSNP_120	4	7874,0		3937,0,0	no	coding-synonymous	CMPK2	NM_207315.2		5720,39,0	GG,GA,AA		0.0,1.0703,0.3386		153/450	7005369	11479,39	1822	3937	5759	SO:0001819	synonymous_variant	129607	exon1			CTCCTGACAGGCG		CCDS42648.1, CCDS58695.1, CCDS58696.1	2p25.2	2008-01-25			ENSG00000134326	ENSG00000134326	2.7.4.14		27015	protein-coding gene	gene with protein product	"""cytidylate kinase 2"""	611787				17999954	Standard	NM_207315		Approved	TYKi, UMP-CMPK2	uc002qyo.4	Q5EBM0	OTTHUMG00000151629	ENST00000256722.5:c.459T>C	2.37:g.7005369A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	10	NM_001256478	0	0	0	0	0	A2RUB0|A5D8T2|B7ZM18|Q6ZRU2|Q96AL8	Silent	SNP	ENST00000256722.5	37	CCDS42648.1																																																																																			A|0.003;G|0.997		0.741	CMPK2-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323339.2	NM_207315	
CRIM1	51232	hgsc.bcm.edu	37	2	36583461	36583461	+	Missense_Mutation	SNP	G	G	T	rs3821169	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr2:36583461G>T	ENST00000280527.2	+	1	393	c.26G>T	c.(25-27)gGg>gTg	p.G9V	RP11-490M8.1_ENST00000565283.1_lincRNA	NM_016441.2	NP_057525.1	Q9NZV1	CRIM1_HUMAN	cysteine rich transmembrane BMP regulator 1 (chordin-like)	9					insulin-like growth factor receptor signaling pathway (GO:0048009)|nervous system development (GO:0007399)|regulation of cell growth (GO:0001558)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	insulin-like growth factor-activated receptor activity (GO:0005010)|PDZ domain binding (GO:0030165)|serine-type endopeptidase inhibitor activity (GO:0004867)			autonomic_ganglia(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(15)|liver(2)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	45		all_hematologic(82;0.131)|Acute lymphoblastic leukemia(82;0.154)				GGGGACAGGGGGTTGGCCGGC	0.781													g|||	330	0.0658946	0.0008	0.0245	5008	,	,		7264	0.255		0.0089	False		,,,				2504	0.047				p.G9V		.											.	CRIM1-118	0			c.G26T						.		VAL/GLY	5,3997		0,5,1996	5.0	9.0	8.0		26	0.4	1.0	2	dbSNP_107	8	51,8007		0,51,3978	no	missense	CRIM1	NM_016441.2	109	0,56,5974	TT,TG,GG		0.6329,0.1249,0.4643	probably-damaging	9/1037	36583461	56,12004	2001	4029	6030	SO:0001583	missense	51232	exon1			ACAGGGGGTTGGC	AF168681	CCDS1783.1	2p21	2010-06-29	2005-07-25		ENSG00000150938	ENSG00000150938			2359	protein-coding gene	gene with protein product		606189	"""cysteine-rich motor neuron 1"""	S52		10642437	Standard	NM_016441		Approved		uc002rpd.3	Q9NZV1	OTTHUMG00000099419	ENST00000280527.2:c.26G>T	2.37:g.36583461G>T	ENSP00000280527:p.Gly9Val	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	24	12	NM_016441	0	0	0	0	0	Q2M2G4|Q59GH0|Q7LCQ5|Q9H318	Missense_Mutation	SNP	ENST00000280527.2	37	CCDS1783.1	159	0.07280219780219781	8	0.016260162601626018	3	0.008287292817679558	138	0.24125874125874125	10	0.013192612137203167	g	16.67	3.186798	0.57909	0.001249	0.006329	ENSG00000150938	ENST00000280527	T	0.05199	3.48	2.72	0.447	0.16608	.	0.259942	0.26983	U	0.021515	T	0.00012	0.0000	L	0.36672	1.1	0.22412	P	0.999128459	B	0.12630	0.006	B	0.17098	0.017	T	0.45556	-0.9253	9	0.87932	D	0	-4.1818	2.0298	0.03527	0.1274:0.1922:0.4851:0.1953	rs3821169	9	Q9NZV1	CRIM1_HUMAN	V	9	ENSP00000280527:G9V	ENSP00000280527:G9V	G	+	2	0	CRIM1	36436965	1.000000	0.71417	0.997000	0.53966	0.973000	0.67179	4.254000	0.58798	0.278000	0.22164	0.444000	0.29173	GGG	G|0.927;T|0.073		0.781	CRIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216878.2	NM_016441	
ADD2	119	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	70933534	70933534	+	Missense_Mutation	SNP	C	C	T	rs200519011	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr2:70933534C>T	ENST00000264436.4	-	3	451	c.7G>A	c.(7-9)Gaa>Aaa	p.E3K	ADD2_ENST00000407644.2_Missense_Mutation_p.E3K|ADD2_ENST00000413157.2_Missense_Mutation_p.E3K|ADD2_ENST00000473232.1_5'Flank|ADD2_ENST00000430656.1_Missense_Mutation_p.E19K|ADD2_ENST00000355733.3_Missense_Mutation_p.E3K	NM_001617.3	NP_001608.1	P35612	ADDB_HUMAN	adducin 2 (beta)	3					actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|barbed-end actin filament capping (GO:0051016)|hemopoiesis (GO:0030097)|positive regulation of protein binding (GO:0032092)|protein complex assembly (GO:0006461)	cytoplasmic membrane-bounded vesicle (GO:0016023)|F-actin capping protein complex (GO:0008290)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|spectrin binding (GO:0030507)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(11)|lung(13)|ovary(3)|pancreas(1)|skin(2)	36						ACCGTCTCTTCGCTCATTTTC	0.617													C|||	3	0.000599042	0.0015	0.0	5008	,	,		17246	0.0		0.001	False		,,,				2504	0.0				p.E19K		.											.	ADD2-93	0			c.G55A						.						47.0	48.0	48.0					2																	70933534		2202	4300	6502	SO:0001583	missense	119	exon2			TCTCTTCGCTCAT	X58199	CCDS1906.1, CCDS1909.1, CCDS46318.1, CCDS54365.1	2p13.3	2008-02-05			ENSG00000075340	ENSG00000075340			244	protein-coding gene	gene with protein product		102681				1840603	Standard	NM_001617		Approved	ADDB	uc021vjc.1	P35612	OTTHUMG00000129710	ENST00000264436.4:c.7G>A	2.37:g.70933534C>T	ENSP00000264436:p.Glu3Lys	Somatic	17	0		WXS	Illumina GAIIx	Phase_I	41	18	NM_001185055	0	0	0	0	0	A8K4P2|B4DM17|D6W5G7|D6W5G8|Q13482|Q16412|Q59G82|Q5U5P4|Q6P0P2|Q6PGQ4|Q7Z688|Q7Z689|Q7Z690|Q7Z691	Missense_Mutation	SNP	ENST00000264436.4	37	CCDS1906.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	15.17	2.754242	0.49362	.	.	ENSG00000075340	ENST00000264436;ENST00000407644;ENST00000456320;ENST00000355733;ENST00000522886;ENST00000264439;ENST00000356565;ENST00000517596;ENST00000413157;ENST00000430656;ENST00000415348;ENST00000425976;ENST00000447731	T;T;T;T;T;T;T;T	0.31510	3.38;3.38;3.18;1.91;3.08;1.56;1.5;1.49	5.64	5.64	0.86602	.	0.483704	0.21622	N	0.071626	T	0.16854	0.0405	N	0.14661	0.345	0.28474	N	0.915269	B;P;P;P;P;B	0.41475	0.242;0.588;0.628;0.751;0.622;0.257	B;B;B;B;B;B	0.33890	0.054;0.172;0.113;0.121;0.083;0.024	T	0.12528	-1.0544	10	0.59425	D	0.04	-5.5483	10.9232	0.47178	0.0:0.9146:0.0:0.0854	.	19;3;3;3;3;3	B4DM17;P35612-4;E9PAN1;Q05DK5;P35612;P35612-3	.;.;.;.;ADDB_HUMAN;.	K	3;3;3;3;3;3;3;3;3;19;3;3;3	ENSP00000264436:E3K;ENSP00000384677:E3K;ENSP00000347972:E3K;ENSP00000430243:E3K;ENSP00000388072:E3K;ENSP00000398112:E19K;ENSP00000412357:E3K;ENSP00000412681:E3K	ENSP00000264436:E3K	E	-	1	0	ADD2	70787042	0.000000	0.05858	0.998000	0.56505	0.855000	0.48748	0.186000	0.16978	2.807000	0.96579	0.591000	0.81541	GAA	C|0.999;T|0.000		0.617	ADD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251918.4	NM_001617	
C2orf81	388963	broad.mit.edu	37	2	74642280	74642280	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr2:74642280T>G	ENST00000517883.1	-	1	1430	c.739A>C	c.(739-741)Acc>Ccc	p.T247P	C2orf81_ENST00000290390.5_Missense_Mutation_p.T315P			A6NN90	CB081_HUMAN	chromosome 2 open reading frame 81	308										endometrium(3)|kidney(1)	4						GAGGGGCGGGTGGCGCCGCCC	0.716																																					p.T315P		.											.	.	0			c.A943C						.						7.0	10.0	9.0					2																	74642280		682	1575	2257	SO:0001583	missense	388963	exon4			GGCGGGTGGCGCC	AC005041, CH471053		2p13.1	2012-08-07			ENSG00000159239	ENSG00000159239			34350	protein-coding gene	gene with protein product						15815621	Standard	NM_001145054		Approved	LOC388963, hCG40743	uc010yrq.1	A6NN90	OTTHUMG00000164184	ENST00000517883.1:c.739A>C	2.37:g.74642280T>G	ENSP00000431103:p.Thr247Pro	Somatic	34	8		WXS	Illumina GAIIx	Phase_I	133	44	NM_001145054	0	0	2	3	1		Missense_Mutation	SNP	ENST00000517883.1	37		.	.	.	.	.	.	.	.	.	.	t	12.14	1.849844	0.32699	.	.	ENSG00000159239	ENST00000517883;ENST00000290390	.	.	.	3.91	-3.99	0.04069	.	1.321610	0.05237	N	0.511487	T	0.30135	0.0755	L	0.44542	1.39	0.09310	N	1	B	0.19073	0.033	B	0.22601	0.04	T	0.39396	-0.9616	9	0.72032	D	0.01	-3.9874	1.2321	0.01946	0.1409:0.2887:0.2874:0.283	.	315	G3XAA6	.	P	247;315	.	ENSP00000290390:T315P	T	-	1	0	C2orf81	74495788	0.007000	0.16637	0.000000	0.03702	0.008000	0.06430	0.309000	0.19332	-0.435000	0.07264	0.454000	0.30748	ACC	.		0.716	C2orf81-002	PUTATIVE	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000377683.1	NM_001145054	
ATOH8	84913	hgsc.bcm.edu	37	2	85981761	85981761	+	Missense_Mutation	SNP	T	T	C	rs17851881	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr2:85981761T>C	ENST00000306279.3	+	1	745	c.449T>C	c.(448-450)cTg>cCg	p.L150P		NM_032827.6	NP_116216.2	Q96SQ7	ATOH8_HUMAN	atonal homolog 8 (Drosophila)	150	Pro-rich.		L -> P (in dbSNP:rs17851881). {ECO:0000269|PubMed:12419857, ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		cell differentiation (GO:0030154)|nervous system development (GO:0007399)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(1)|large_intestine(1)|lung(2)	5						GAGCCGGGTCTGCGTCCTCGC	0.786													T|||	2860	0.571086	0.4758	0.6383	5008	,	,		10130	0.7421		0.6093	False		,,,				2504	0.4366				p.L150P		.											.	ATOH8-90	0			c.T449C						.	T	PRO/LEU	1790,1646		523,744,451	5.0	7.0	6.0		449	2.5	0.8	2	dbSNP_123	6	3836,2834		1197,1442,696	no	missense	ATOH8	NM_032827.6	98	1720,2186,1147	CC,CT,TT		42.4888,47.9045,44.3301	possibly-damaging	150/322	85981761	5626,4480	1718	3335	5053	SO:0001583	missense	84913	exon1			CGGGTCTGCGTCC	AK074681	CCDS1985.1	2p11.2	2013-05-21			ENSG00000168874	ENSG00000168874		"""Basic helix-loop-helix proteins"""	24126	protein-coding gene	gene with protein product	"""basic helix loop helix transcription factor 6"""					12419857	Standard	NM_032827		Approved	HATH6, FLJ14708, bHLHa21	uc002sqn.3	Q96SQ7	OTTHUMG00000130178	ENST00000306279.3:c.449T>C	2.37:g.85981761T>C	ENSP00000304676:p.Leu150Pro	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	11	4	NM_032827	0	0	0	0	0	Q504S2|Q659B0	Missense_Mutation	SNP	ENST00000306279.3	37	CCDS1985.1	1347	0.6167582417582418	233	0.4735772357723577	232	0.6408839779005525	433	0.756993006993007	449	0.5923482849604221	T	13.11	2.140335	0.37825	0.520955	0.575112	ENSG00000168874	ENST00000306279	D	0.94650	-3.48	3.6	2.45	0.29901	.	0.166402	0.23793	N	0.044509	T	0.00012	0.0000	N	0.24115	0.695	0.26047	P	0.9815344	B;B	0.10296	0.003;0.001	B;B	0.08055	0.002;0.003	T	0.45352	-0.9267	9	0.72032	D	0.01	-10.2738	5.5522	0.17097	0.0:0.126:0.0:0.874	rs17851881	150;150	Q96SQ7;Q96SQ7-2	ATOH8_HUMAN;.	P	150	ENSP00000304676:L150P	ENSP00000304676:L150P	L	+	2	0	ATOH8	85835272	0.913000	0.31002	0.756000	0.31282	0.353000	0.29299	1.683000	0.37638	0.758000	0.33059	0.374000	0.22700	CTG	T|0.382;C|0.618		0.786	ATOH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252496.1	NM_032827	
LYG2	254773	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	99860495	99860495	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr2:99860495A>G	ENST00000409238.1	-	4	507	c.487T>C	c.(487-489)Ttc>Ctc	p.F163L	LYG2_ENST00000423800.1_Missense_Mutation_p.F163L|LYG2_ENST00000333017.2_Missense_Mutation_p.F163L|LYG2_ENST00000409679.1_Missense_Mutation_p.F163L			Q86SG7	LYG2_HUMAN	lysozyme G-like 2	163					cell wall macromolecule catabolic process (GO:0016998)|peptidoglycan catabolic process (GO:0009253)	extracellular region (GO:0005576)	lysozyme activity (GO:0003796)			large_intestine(3)|lung(4)|ovary(1)|prostate(2)|skin(1)|stomach(1)	12						CACGTGGGGAATTTTTTCTGG	0.463																																					p.F163L		.											.	LYG2-91	0			c.T487C						.						118.0	112.0	114.0					2																	99860495		2203	4300	6503	SO:0001583	missense	254773	exon5			TGGGGAATTTTTT	AF323919	CCDS2042.1	2q11.2	2008-02-05			ENSG00000185674	ENSG00000185674			29615	protein-coding gene	gene with protein product						8889548, 12574869	Standard	NM_175735		Approved	LYGH	uc002szw.1	Q86SG7	OTTHUMG00000130643	ENST00000409238.1:c.487T>C	2.37:g.99860495A>G	ENSP00000386939:p.Phe163Leu	Somatic	92	0		WXS	Illumina GAIIx	Phase_I	90	48	NM_175735	0	0	0	0	0	Q496G2|Q53RW0	Missense_Mutation	SNP	ENST00000409238.1	37	CCDS2042.1	.	.	.	.	.	.	.	.	.	.	A	23.8	4.464381	0.84425	.	.	ENSG00000185674	ENST00000409238;ENST00000333017;ENST00000409679;ENST00000423306	.	.	.	5.58	5.58	0.84498	Lytic transglycosylase-like, catalytic (1);Lysozyme-like domain (1);	0.000000	0.64402	D	0.000013	T	0.79399	0.4439	M	0.83012	2.62	0.49798	D	0.999821	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.87578	0.998;0.998;0.998	T	0.81531	-0.0890	8	.	.	.	-18.9955	12.1331	0.53955	1.0:0.0:0.0:0.0	.	163;163;163	Q496G2;C9J4J0;Q86SG7	.;.;LYG2_HUMAN	L	163	.	.	F	-	1	0	LYG2	99226927	1.000000	0.71417	0.998000	0.56505	0.801000	0.45260	4.413000	0.59795	2.121000	0.65114	0.454000	0.30748	TTC	.		0.463	LYG2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330307.1	NM_175735	
XIRP2	129446	broad.mit.edu;bcgsc.ca	37	2	168100197	168100197	+	Silent	SNP	A	A	T			TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr2:168100197A>T	ENST00000409195.1	+	9	2384	c.2295A>T	c.(2293-2295)ggA>ggT	p.G765G	XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000295237.9_Silent_p.G765G|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409273.1_Silent_p.G543G|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000420519.1_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	590					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						TTGAAAAGGGAGATGTAAGAA	0.378																																					p.G765G		.											.	XIRP2-104	0			c.A2295T						.						72.0	67.0	68.0					2																	168100197		1858	4088	5946	SO:0001819	synonymous_variant	129446	exon9			AAAGGGAGATGTA	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.2295A>T	2.37:g.168100197A>T		Somatic	236	0		WXS	Illumina GAIIx	Phase_I	193	7	NM_152381	0	0	0	0	0	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Silent	SNP	ENST00000409195.1	37	CCDS42769.1																																																																																			.		0.378	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381	
CTLA4	1493	bcgsc.ca	37	2	204732714	204732714	+	Missense_Mutation	SNP	A	A	G	rs231775	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr2:204732714A>G	ENST00000302823.3	+	1	206	c.49A>G	c.(49-51)Acc>Gcc	p.T17A	CTLA4_ENST00000427473.2_5'Flank|CTLA4_ENST00000295854.6_Missense_Mutation_p.T17A|CTLA4_ENST00000472206.1_Missense_Mutation_p.T17A|CTLA4_ENST00000487393.1_3'UTR	NM_005214.4	NP_005205.2	P16410	CTLA4_HUMAN	cytotoxic T-lymphocyte-associated protein 4	17			T -> A (increased risk for Graves disease, insulin-dependent diabetes mellitus, thyroid-associated orbitopathy, systemic lupus erythematosus and susceptibility to HBV infection; dbSNP:rs231775). {ECO:0000269|PubMed:10475192, ECO:0000269|PubMed:10903931, ECO:0000269|PubMed:10924276, ECO:0000269|PubMed:15452244, ECO:0000269|PubMed:1713603, ECO:0000269|PubMed:18595775, ECO:0000269|PubMed:9259273}.		B cell receptor signaling pathway (GO:0050853)|cellular response to DNA damage stimulus (GO:0006974)|immune response (GO:0006955)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of immune response (GO:0050777)|negative regulation of regulatory T cell differentiation (GO:0045590)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of apoptotic process (GO:0043065)|T cell costimulation (GO:0031295)	clathrin-coated endocytic vesicle (GO:0045334)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)				large_intestine(4)|lung(4)|skin(1)	9					Ipilimumab(DB06186)	GAACCTGGCTACCAGGACCTG	0.507													A|||	2140	0.427316	0.388	0.4625	5008	,	,		18012	0.6369		0.3588	False		,,,				2504	0.3098				p.T17A		.											.	CTLA4-90	0			c.A49G	GRCh37	CM970403	CTLA4	M	rs231775	.	A	ALA/THR,ALA/THR	1629,2777	501.5+/-365.0	288,1053,862	154.0	133.0	140.0	http://omim.org/entry/123890#0001	49,49	-2.8	0.0	2	dbSNP_79	140	3176,5424	481.5+/-370.7	593,1990,1717	yes	missense,missense	CTLA4	NM_001037631.2,NM_005214.4	58,58	881,3043,2579	GG,GA,AA		36.9302,36.9723,36.9445	benign,benign	17/175,17/224	204732714	4805,8201	2203	4300	6503	SO:0001583	missense	1493	exon1			CTGGCTACCAGGA		CCDS2362.1, CCDS42803.1	2q33	2014-02-03			ENSG00000163599	ENSG00000163599		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	2505	protein-coding gene	gene with protein product		123890	"""celiac disease 3"", ""insulin-dependent diabetes mellitus 12"""	CELIAC3, IDDM12		3220103, 8817351	Standard	NM_005214		Approved	CD152, CD, GSE, CD28, ICOS	uc002vak.2	P16410	OTTHUMG00000132877	ENST00000302823.3:c.49A>G	2.37:g.204732714A>G	ENSP00000303939:p.Thr17Ala	Somatic	124	0		WXS	Illumina GAIIx	Phase_I	120	5	NM_005214	0	0	0	0	0	A0N1S0|E9PDH0|O95653|Q0PP65|Q52MC1|Q53TD5|Q5S005|Q8WXJ1|Q96P43|Q9UKN9	Missense_Mutation	SNP	ENST00000302823.3	37	CCDS2362.1	987	0.4519230769230769	197	0.40040650406504064	147	0.40607734806629836	367	0.6416083916083916	276	0.3641160949868074	A	0.643	-0.812512	0.02798	0.369723	0.369302	ENSG00000163599	ENST00000302823;ENST00000541886;ENST00000295854;ENST00000472206	T;T;T	0.26518	1.73;1.73;1.73	3.94	-2.84	0.05751	.	1.862500	0.02307	N	0.071771	T	0.00012	0.0000	L	0.36672	1.1	0.80722	P	0.0	B;B;B	0.15930	0.015;0.007;0.007	B;B;B	0.11329	0.006;0.003;0.002	T	0.47886	-0.9082	9	0.49607	T	0.09	-6.4144	4.3597	0.11196	0.2102:0.4297:0.0:0.3601	rs231775;rs57563726;rs231775	17;17;17	P16410-4;Q8TDA6;P16410	.;.;CTLA4_HUMAN	A	17	ENSP00000303939:T17A;ENSP00000295854:T17A;ENSP00000417779:T17A	ENSP00000295854:T17A	T	+	1	0	CTLA4	204440959	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-0.318000	0.08050	-0.514000	0.06488	-0.438000	0.05819	ACC	A|0.591;G|0.409		0.507	CTLA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256365.1	NM_005214	
TCF15	6939	hgsc.bcm.edu	37	20	590456	590456	+	Silent	SNP	A	A	G	rs282164	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr20:590456A>G	ENST00000246080.3	-	1	586	c.426T>C	c.(424-426)cgT>cgC	p.R142R		NM_004609.3	NP_004600.2	Q12870	TCF15_HUMAN	transcription factor 15 (basic helix-loop-helix)	142					death (GO:0016265)|ear development (GO:0043583)|eating behavior (GO:0042755)|establishment of epithelial cell apical/basal polarity (GO:0045198)|mesenchymal to epithelial transition (GO:0060231)|mesoderm development (GO:0007498)|muscle organ morphogenesis (GO:0048644)|neuromuscular process controlling posture (GO:0050884)|paraxial mesoderm development (GO:0048339)|post-anal tail morphogenesis (GO:0036342)|regulation of gene expression involved in extracellular matrix organization (GO:1901311)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|respiratory system process (GO:0003016)|skeletal system morphogenesis (GO:0048705)|skin development (GO:0043588)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|lung(2)|prostate(1)	4		Breast(17;0.231)				TGCCCGCGGCACGGAAGCACG	0.736													g|||	4317	0.862021	0.7413	0.9035	5008	,	,		6474	0.998		0.8072	False		,,,				2504	0.9121				p.R142R		.											.	TCF15-90	0			c.T426C						.			3211,1033		1232,747,143	7.0	8.0	8.0		426	-9.0	0.0	20	dbSNP_79	8	6663,1669		2708,1247,211	no	coding-synonymous	TCF15	NM_004609.3		3940,1994,354	GG,GA,AA		20.0312,24.3402,21.4854		142/200	590456	9874,2702	2122	4166	6288	SO:0001819	synonymous_variant	6939	exon1			CGCGGCACGGAAG		CCDS33432.1	20p13	2013-05-21			ENSG00000125878	ENSG00000125878		"""Basic helix-loop-helix proteins"""	11627	protein-coding gene	gene with protein product		601010				8825648, 8041747	Standard	NM_004609		Approved	EC2, PARAXIS, bHLHa40	uc002wdz.3	Q12870	OTTHUMG00000031640	ENST00000246080.3:c.426T>C	20.37:g.590456A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_004609	0	0	0	0	0	Q9NQQ1	Silent	SNP	ENST00000246080.3	37	CCDS33432.1																																																																																			A|0.165;G|0.835		0.736	TCF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077475.2	NM_004609	
PANK2	80025	hgsc.bcm.edu	37	20	3870124	3870124	+	Missense_Mutation	SNP	G	G	C	rs3737084	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr20:3870124G>C	ENST00000316562.4	+	1	383	c.377G>C	c.(376-378)gGg>gCg	p.G126A	RP11-119B16.2_ENST00000451507.1_RNA|PANK2_ENST00000610179.1_Missense_Mutation_p.G3A|PANK2_ENST00000497424.1_Intron	NM_153638.2	NP_705902.2	Q9BZ23	PANK2_HUMAN	pantothenate kinase 2	126			G -> A (in dbSNP:rs3737084). {ECO:0000269|PubMed:11479594, ECO:0000269|PubMed:12554685, ECO:0000269|Ref.3}.		aerobic respiration (GO:0009060)|cell death (GO:0008219)|coenzyme A biosynthetic process (GO:0015937)|coenzyme biosynthetic process (GO:0009108)|mitochondrion morphogenesis (GO:0070584)|pantothenate metabolic process (GO:0015939)|regulation of mitochondrial membrane potential (GO:0051881)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial intermembrane space (GO:0005758)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						CGGATGGGAGGGGGCCGGCTC	0.766													C|||	4403	0.879193	0.9939	0.9323	5008	,	,		9294	0.7946		0.8757	False		,,,				2504	0.7771				p.G126A		.											.	PANK2-115	0			c.G377C						.		,ALA/GLY	3009,53		1478,53,0	2.0	3.0	3.0		,377	4.7	1.0	20	dbSNP_107	3	6120,564		2797,526,19	no	intron,missense	PANK2	NM_024960.4,NM_153638.2	,60	4275,579,19	CC,CG,GG		8.4381,1.7309,6.3308	,benign	,126/571	3870124	9129,617	1531	3342	4873	SO:0001583	missense	80025	exon1			TGGGAGGGGGCCG	AK021791	CCDS13071.2, CCDS13072.1	20p13	2008-07-31	2008-07-31	2002-09-06	ENSG00000125779	ENSG00000125779	2.7.1.33		15894	protein-coding gene	gene with protein product	"""Hallervorden-Spatz syndrome"""	606157	"""neurodegeneration with brain iron accumulation 1 (Hallervorden-Spatz syndrome)"""	C20orf48, NBIA1		8944032, 11479594	Standard	XM_005260835		Approved	HSS, FLJ11729, PKAN, HARP	uc002wkc.3	Q9BZ23	OTTHUMG00000031768	ENST00000316562.4:c.377G>C	20.37:g.3870124G>C	ENSP00000313377:p.Gly126Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_153638	0	0	0	1	1	B1AK33|B2Z3X0|D3DVZ0|Q5T7I2|Q5T7I4|Q7RTX5|Q8N7Q4|Q8TCR5|Q9BYW5|Q9HAF2	Missense_Mutation	SNP	ENST00000316562.4	37	CCDS13071.2	1920	0.8791208791208791	489	0.9939024390243902	334	0.9226519337016574	438	0.7657342657342657	659	0.8693931398416886	C	8.681	0.905209	0.17760	0.982691	0.915619	ENSG00000125779	ENST00000316562	D	0.96265	-3.96	4.73	4.73	0.59995	.	0.504726	0.16798	N	0.199120	T	0.00012	0.0000	N	0.08118	0	0.58432	P	1.0000000000287557E-6	B	0.02656	0.0	B	0.01281	0.0	T	0.41574	-0.9501	9	0.02654	T	1	.	11.198	0.48724	0.0:0.8144:0.1856:0.0	rs3737084	126	Q9BZ23	PANK2_HUMAN	A	126	ENSP00000313377:G126A	ENSP00000313377:G126A	G	+	2	0	PANK2	3818124	0.994000	0.37717	0.990000	0.47175	0.991000	0.79684	1.019000	0.30014	1.369000	0.46134	-0.164000	0.13417	GGG	G|0.122;C|0.878		0.766	PANK2-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077793.2	NM_024960	
LRRN4	164312	hgsc.bcm.edu	37	20	6033033	6033033	+	Missense_Mutation	SNP	G	G	A	rs6107751	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr20:6033033G>A	ENST00000378858.4	-	2	637	c.413C>T	c.(412-414)cCg>cTg	p.P138L		NM_152611.4	NP_689824.2	Q8WUT4	LRRN4_HUMAN	leucine rich repeat neuronal 4	138			P -> L (in dbSNP:rs6107751). {ECO:0000269|PubMed:15489334}.		long-term memory (GO:0007616)|visual learning (GO:0008542)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)				breast(1)|endometrium(3)|large_intestine(3)|lung(10)|ovary(2)|prostate(1)|skin(5)|urinary_tract(2)	27						GGTGCACGGCGGCAGAGCGGC	0.781													G|||	565	0.112819	0.053	0.1844	5008	,	,		11700	0.0972		0.173	False		,,,				2504	0.0971				p.P138L		.											.	LRRN4-93	0			c.C413T						.	G	LEU/PRO	120,2142		3,114,1014	2.0	2.0	2.0		413	4.2	0.8	20	dbSNP_114	2	724,4820		32,660,2080	no	missense	LRRN4	NM_152611.3	98	35,774,3094	AA,AG,GG		13.0592,5.305,10.8122	possibly-damaging	138/741	6033033	844,6962	1131	2772	3903	SO:0001583	missense	164312	exon2			CACGGCGGCAGAG	AL118505	CCDS13097.1	20p12.3	2013-02-11	2008-05-20	2008-05-20	ENSG00000125872	ENSG00000125872		"""Fibronectin type III domain containing"""	16208	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 75"""	C20orf75		15870286	Standard	NM_152611		Approved	dJ1056H1.1, NLRR4	uc002wmo.3	Q8WUT4	OTTHUMG00000031825	ENST00000378858.4:c.413C>T	20.37:g.6033033G>A	ENSP00000368135:p.Pro138Leu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_152611	0	0	0	0	0	A8K258|Q5JWV6|Q9H419	Missense_Mutation	SNP	ENST00000378858.4	37	CCDS13097.1	295	0.13507326007326007	29	0.05894308943089431	65	0.17955801104972377	62	0.10839160839160839	139	0.18337730870712401	G	16.04	3.009170	0.54361	0.05305	0.130592	ENSG00000125872	ENST00000378858	T	0.09073	3.02	5.09	4.15	0.48705	.	0.091120	0.46758	D	0.000263	T	0.00039	0.0001	M	0.76328	2.33	0.22762	P	0.99876042	D;P	0.59767	0.986;0.809	P;P	0.57960	0.83;0.787	T	0.04915	-1.0918	9	0.87932	D	0	-27.3795	13.7965	0.63175	0.0747:0.0:0.9253:0.0	rs6107751;rs17852455	138;138	Q6ZMD1;Q8WUT4	.;LRRN4_HUMAN	L	138	ENSP00000368135:P138L	ENSP00000368135:P138L	P	-	2	0	LRRN4	5981033	0.997000	0.39634	0.763000	0.31416	0.008000	0.06430	2.667000	0.46808	1.278000	0.44430	0.491000	0.48974	CCG	G|0.864;A|0.136		0.781	LRRN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077907.2	NM_152611	
ACTR5	79913	hgsc.bcm.edu	37	20	37377139	37377139	+	Silent	SNP	C	C	T	rs2254105	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr20:37377139C>T	ENST00000243903.4	+	1	55	c.18C>T	c.(16-18)ttC>ttT	p.F6F		NM_024855.3	NP_079131.3	Q9H9F9	ARP5_HUMAN	ARP5 actin-related protein 5 homolog (yeast)	6					DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|UV-damage excision repair (GO:0070914)	cytoplasm (GO:0005737)|Ino80 complex (GO:0031011)|nucleus (GO:0005634)				kidney(2)|large_intestine(2)|liver(1)|lung(5)|skin(2)	12		Myeloproliferative disorder(115;0.00878)				CGAACGTGTTCCCGTTCCGCG	0.756													C|||	1227	0.245008	0.205	0.2334	5008	,	,		10427	0.2679		0.2565	False		,,,				2504	0.272				p.F6F		.											.	ACTR5-90	0			c.C18T						.						3.0	4.0	4.0					20																	37377139		1470	2633	4103	SO:0001819	synonymous_variant	79913	exon1			CGTGTTCCCGTTC	AK022847	CCDS13308.1	20q12	2011-07-06	2001-11-28		ENSG00000101442	ENSG00000101442		"""INO80 complex subunits"""	14671	protein-coding gene	gene with protein product	"""INO80 complex subunit M"""		"""ARP5 (actin-related protein 5, yeast) homolog"""			16230350	Standard	NM_024855		Approved	FLJ12785, Arp5, INO80M	uc002xjd.2	Q9H9F9	OTTHUMG00000032456	ENST00000243903.4:c.18C>T	20.37:g.37377139C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	39	37	NM_024855	0	0	0	0	0	Q86WF7|Q8IUY5|Q8N724|Q9BRN0|Q9BVB7	Silent	SNP	ENST00000243903.4	37	CCDS13308.1																																																																																			C|0.769;T|0.231		0.756	ACTR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079205.2	NM_024855	
SLC35C2	51006	hgsc.bcm.edu;bcgsc.ca	37	20	44979124	44979131	+	Frame_Shift_Del	DEL	CTGGAGCC	CTGGAGCC	-	rs201597886		TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	CTGGAGCC	CTGGAGCC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr20:44979124_44979131delCTGGAGCC	ENST00000372227.1	-	10	1540_1547	c.1000_1007delGGCTCCAG	c.(1000-1008)ggctccagcfs	p.GSS334fs	SLC35C2_ENST00000317734.8_Frame_Shift_Del_p.GSS313fs|SLC35C2_ENST00000372230.5_Frame_Shift_Del_p.GSS334fs|SLC35C2_ENST00000243896.2_Frame_Shift_Del_p.GSS334fs|SLC35C2_ENST00000543605.1_Frame_Shift_Del_p.GSS363fs|SLC35C2_ENST00000493599.1_5'UTR|SLC35C2_ENST00000372229.1_Frame_Shift_Del_p.GSS201fs	NM_001281458.1|NM_001281460.1	NP_001268387.1|NP_001268389.1	Q9NQQ7	S35C2_HUMAN	solute carrier family 35 (GDP-fucose transporter), member C2	334					negative regulation of gene expression (GO:0010629)|positive regulation of Notch signaling pathway (GO:0045747)|protein O-linked fucosylation (GO:0036066)|transport (GO:0006810)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)		p.G334D(1)		cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)	16		Myeloproliferative disorder(115;0.0122)				CAGGTCGGGGCTGGAGCCCAGCCCCTTC	0.606																																					p.334_336del		.											.	SLC35C2-91	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	c.1000_1007del						.																																			SO:0001589	frameshift_variant	51006	exon10			TCGGGGCTGGAGC		CCDS13396.1, CCDS13397.1, CCDS63292.1	20q13.12	2013-07-17	2013-07-17	2003-10-10	ENSG00000080189	ENSG00000080189		"""Solute carriers"""	17117	protein-coding gene	gene with protein product			"""ovarian cancer overexpressed 1"", ""solute carrier family 35, member C2"""	C20orf5, OVCOV1		10810093, 11549316	Standard	NM_173179		Approved	CGI-15, bA394O2.1	uc002xrq.3	Q9NQQ7	OTTHUMG00000033050	ENST00000372227.1:c.1000_1007delGGCTCCAG	20.37:g.44979124_44979131delCTGGAGCC	ENSP00000361301:p.Gly334fs	Somatic	110	1		WXS	Illumina GAIIx	Phase_I	105	81	NM_173179	0	0	0	0	0	B7Z6V6|E1P5T0|Q53GK3|Q5JW05|Q96CJ8|Q9Y304	Frame_Shift_Del	DEL	ENST00000372227.1	37	CCDS13396.1																																																																																			.		0.606	SLC35C2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080363.1	NM_015945	
TMEM189-UBE2V1	387522	hgsc.bcm.edu	37	20	48770159	48770159	+	Missense_Mutation	SNP	T	T	C	rs232733		TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr20:48770159T>C	ENST00000341698.2	-	1	15	c.16A>G	c.(16-18)Aac>Gac	p.N6D	TMEM189_ENST00000371650.5_Missense_Mutation_p.N6D|TMEM189_ENST00000371652.4_Missense_Mutation_p.N6D|TMEM189_ENST00000557021.1_Missense_Mutation_p.N6D	NM_001257399.1	NP_001244328.1			TMEM189-UBE2V1 readthrough											breast(1)|endometrium(4)|large_intestine(6)|lung(6)	17			BRCA - Breast invasive adenocarcinoma(9;8.29e-07)			CCCGGCCAGTTCTCGGCGCCC	0.766													C|||	5008	1.0	1.0	1.0	5008	,	,		6103	1.0		1.0	False		,,,				2504	1.0				p.N6D		.											.	TMEM189-22	0			c.A16G						.						2.0	2.0	2.0					20																	48770159		1101	2248	3349	SO:0001583	missense	387521	exon1			GCCAGTTCTCGGC	U39361	CCDS13424.1	20q13.13	2011-05-31			ENSG00000124208	ENSG00000124208			33521	other	readthrough						11076860	Standard	NM_199203		Approved	Kua-UEV, CROC-1B	uc002xvf.3		OTTHUMG00000033085	ENST00000341698.2:c.16A>G	20.37:g.48770159T>C	ENSP00000344166:p.Asn6Asp	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	19	19	NM_199129	0	0	0	22	22		Missense_Mutation	SNP	ENST00000341698.2	37	CCDS13424.1	2182	0.9990842490842491	492	1.0	360	0.994475138121547	572	1.0	758	1.0	C	0.054	-1.242740	0.01481	.	.	ENSG00000124208;ENSG00000240849;ENSG00000240849;ENSG00000240849	ENST00000341698;ENST00000557021;ENST00000371650;ENST00000371652	T;T;T;T	0.46819	0.86;0.86;1.11;1.11	3.81	0.707	0.18139	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.40757	-0.9546	8	0.02654	T	1	.	3.4688	0.07559	0.1731:0.5239:0.0:0.303	rs232733;rs674252;rs56654084	6;6;6	Q5TGE1;A5PLL7;G3V2F7	.;TM189_HUMAN;.	D	6	ENSP00000344166:N6D;ENSP00000450635:N6D;ENSP00000360713:N6D;ENSP00000360715:N6D	ENSP00000360713:N6D	N	-	1	0	TMEM189-UBE2V1;TMEM189	48203566	1.000000	0.71417	0.503000	0.27626	0.073000	0.16967	0.497000	0.22514	-0.274000	0.09232	-2.268000	0.00277	AAC	C|0.999;T|0.001		0.766	TMEM189-UBE2V1-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000080532.5		
CLIC6	54102	hgsc.bcm.edu	37	21	36041978	36041978	+	Silent	SNP	A	A	G	rs7280973		TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr21:36041978A>G	ENST00000360731.3	+	1	291	c.291A>G	c.(289-291)caA>caG	p.Q97Q	CLIC6_ENST00000349499.2_Silent_p.Q97Q			Q96NY7	CLIC6_HUMAN	chloride intracellular channel 6	97						chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	voltage-gated chloride channel activity (GO:0005247)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	19						AGGTGCCCCAAGGAGGGGAGG	0.796													G|||	5008	1.0	1.0	1.0	5008	,	,		8940	1.0		1.0	False		,,,				2504	1.0				p.Q97Q		.											.	CLIC6-91	0			c.A291G						.						2.0	2.0	2.0					21																	36041978		1056	2327	3383	SO:0001819	synonymous_variant	54102	exon1			GCCCCAAGGAGGG	AF426169	CCDS13638.1	21q22.12	2012-09-26			ENSG00000159212	ENSG00000159212		"""Ion channels / Chloride channels : Intracellular"""	2065	protein-coding gene	gene with protein product		615321		CLIC1L		10830953	Standard	NM_053277		Approved	CLIC5	uc002yuf.1	Q96NY7	OTTHUMG00000086237	ENST00000360731.3:c.291A>G	21.37:g.36041978A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_053277	0	0	0	0	0	A8K0U8|Q8IX31	Silent	SNP	ENST00000360731.3	37																																																																																				A|0.001;G|0.999		0.796	CLIC6-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000194156.1		
COL18A1	80781	hgsc.bcm.edu	37	21	46924425	46924425	+	Silent	SNP	C	C	A	rs149296338|rs201180574|rs78227997|rs543392161	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr21:46924425C>A	ENST00000359759.4	+	33	4089	c.4068C>A	c.(4066-4068)ccC>ccA	p.P1356P	COL18A1_ENST00000400337.2_Silent_p.P941P|SLC19A1_ENST00000567670.1_Intron|COL18A1_ENST00000355480.5_Silent_p.P1121P			P39060	COIA1_HUMAN	collagen, type XVIII, alpha 1	1356	Triple-helical region 9 (COL9).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endothelial cell morphogenesis (GO:0001886)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|response to drug (GO:0042493)|response to hydrostatic pressure (GO:0051599)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		ccggcccccccggccccccag	0.706													C|||	7	0.00139776	0.0015	0.0029	5008	,	,		10940	0.001		0.002	False		,,,				2504	0.0				p.P1121P		.											.	COL18A1-90	0			c.C3363A						.						4.0	6.0	5.0					21																	46924425		1287	3146	4433	SO:0001819	synonymous_variant	80781	exon33			CCCCCCCGGCCCC		CCDS42971.1, CCDS42972.1	21q22.3	2013-01-16			ENSG00000182871	ENSG00000182871		"""Collagens"""	2195	protein-coding gene	gene with protein product	"""endostatin"""	120328	"""Knobloch syndrome, type 1"""	KNO		8188291, 8776601, 10942434, 17546652	Standard	NM_130445		Approved	KS, KNO1	uc002zhi.3	P39060	OTTHUMG00000090407	ENST00000359759.4:c.4068C>A	21.37:g.46924425C>A		Somatic	12	0		WXS	Illumina GAIIx	Phase_I	27	7	NM_030582	0	0	1	1	0	A8MVI4|Q58EX6|Q6RZ39|Q6RZ40|Q6RZ41|Q8N4S4|Q8WXI5|Q96T70|Q9UK38|Q9Y6Q7|Q9Y6Q8	Silent	SNP	ENST00000359759.4	37																																																																																				.		0.706	COL18A1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000206827.1		
TRIOBP	11078	hgsc.bcm.edu	37	22	38122462	38122462	+	Missense_Mutation	SNP	A	A	G	rs739138	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr22:38122462A>G	ENST00000406386.3	+	7	4154	c.3899A>G	c.(3898-3900)cAc>cGc	p.H1300R		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	1300			H -> R (in dbSNP:rs739138).		actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					GGCCGCACCCACAGCCCTGGC	0.741													G|||	3010	0.601038	0.1944	0.5836	5008	,	,		13399	0.8859		0.7157	False		,,,				2504	0.7515				p.H1300R		.											.	TRIOBP-136	0			c.A3899G						.	G	ARG/HIS	1221,2235		265,691,772	4.0	6.0	5.0		3899	3.9	1.0	22	dbSNP_86	5	5694,1808		2238,1218,295	yes	missense	TRIOBP	NM_001039141.2	29	2503,1909,1067	GG,GA,AA		24.1002,35.3299,36.8954	benign	1300/2366	38122462	6915,4043	1728	3751	5479	SO:0001583	missense	11078	exon7			GCACCCACAGCCC	AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.3899A>G	22.37:g.38122462A>G	ENSP00000384312:p.His1300Arg	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	20	10	NM_001039141	0	0	1	1	0	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Missense_Mutation	SNP	ENST00000406386.3	37	CCDS43015.1	1409	0.6451465201465202	110	0.22357723577235772	222	0.6132596685082873	531	0.9283216783216783	546	0.7203166226912929	G	12.86	2.065195	0.36470	0.353299	0.758998	ENSG00000100106	ENST00000406386;ENST00000417174	T	0.11063	2.81	4.93	3.9	0.45041	.	.	.	.	.	T	0.00012	0.0000	N	0.01576	-0.805	0.09310	P	0.999999999370294	B	0.02656	0.0	B	0.01281	0.0	T	0.29671	-1.0004	8	0.02654	T	1	.	4.383	0.11304	0.2555:0.0:0.5874:0.1571	rs739138	1300	Q9H2D6	TARA_HUMAN	R	1300	ENSP00000384312:H1300R	ENSP00000384312:H1300R	H	+	2	0	TRIOBP	36452408	1.000000	0.71417	1.000000	0.80357	0.841000	0.47740	1.338000	0.33873	0.503000	0.28060	-0.366000	0.07423	CAC	A|0.354;G|0.646		0.741	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319439.2		
PRR34	55267	hgsc.bcm.edu	37	22	46449891	46449891	+	Missense_Mutation	SNP	G	G	A	rs12159707	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr22:46449891G>A	ENST00000396008.2	-	1	133	c.83C>T	c.(82-84)cCc>cTc	p.P28L	RP6-109B7.3_ENST00000445441.1_RNA|C22orf26_ENST00000333761.1_Missense_Mutation_p.P28L|RP6-109B7.5_ENST00000608644.1_RNA|RP6-109B7.2_ENST00000439423.1_lincRNA|RP6-109B7.3_ENST00000416202.1_RNA|FLJ27365_ENST00000381051.2_Intron|RP6-109B7.3_ENST00000451166.1_RNA			Q9NV39	PRR34_HUMAN		28	Pro-rich.		P -> L (in dbSNP:rs12159707).										Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|BRCA - Breast invasive adenocarcinoma(115;0.0784)|LUAD - Lung adenocarcinoma(64;0.247)		TGCGGGGTTGGGGGGGGAGGT	0.746													G|||	1079	0.215455	0.2723	0.2723	5008	,	,		6433	0.0278		0.33	False		,,,				2504	0.1738				p.P28L		.											.	C22orf26-90	0			c.C83T						.	G	LEU/PRO	1414,2432		349,716,858	5.0	5.0	5.0		83	0.7	0.0	22	dbSNP_120	5	2591,5181		546,1499,1841	no	missense	C22orf26	NM_018280.2	98	895,2215,2699	AA,AG,GG		33.3376,36.7655,34.4724	probably-damaging	28/139	46449891	4005,7613	1923	3886	5809	SO:0001583	missense	55267	exon1			GGGTTGGGGGGGG																												ENST00000396008.2:c.83C>T	22.37:g.46449891G>A	ENSP00000379329:p.Pro28Leu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	5	NM_018280	0	0	3	5	2	B0QZ24	Missense_Mutation	SNP	ENST00000396008.2	37	CCDS14071.1	542	0.24816849816849818	155	0.3150406504065041	117	0.32320441988950277	22	0.038461538461538464	248	0.32717678100263853	G	5.153	0.213778	0.09810	0.367655	0.333376	ENSG00000182257	ENST00000396008;ENST00000333761	T;T	0.41400	1.0;1.0	0.666	0.666	0.17901	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	D	0.69078	0.997	D	0.68483	0.958	T	0.42189	-0.9466	7	0.87932	D	0	.	.	.	.	rs12159707;rs59880898	28	Q9NV39	CV026_HUMAN	L	28	ENSP00000379329:P28L;ENSP00000327764:P28L	ENSP00000327764:P28L	P	-	2	0	C22orf26	44828555	0.742000	0.28228	0.008000	0.14137	0.010000	0.07245	0.672000	0.25187	0.636000	0.30508	0.645000	0.84053	CCC	A|0.248;C|0.000;G|0.752		0.746	C22orf26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317994.1		
RBMS3	27303	broad.mit.edu;ucsc.edu	37	3	30029712	30029712	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr3:30029712G>A	ENST00000383767.2	+	13	1513	c.1177G>A	c.(1177-1179)Gaa>Aaa	p.E393K	RBMS3_ENST00000452462.1_Missense_Mutation_p.E377K|RBMS3_ENST00000473799.1_3'UTR|RBMS3_ENST00000383766.2_Missense_Mutation_p.E375K|RBMS3_ENST00000456853.1_Missense_Mutation_p.E390K|RBMS3_ENST00000434693.2_Missense_Mutation_p.E392K|RBMS3_ENST00000273139.9_Missense_Mutation_p.E377K|RBMS3_ENST00000396583.3_Missense_Mutation_p.E390K			Q6XE24	RBMS3_HUMAN	RNA binding motif, single stranded interacting protein 3	393					positive regulation of translation (GO:0045727)	cytoplasm (GO:0005737)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)			breast(1)|central_nervous_system(1)|large_intestine(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	11		Ovarian(412;0.0956)				TGTTTCTATTGAAGTAAGTCT	0.413																																					p.E393K		.											.	RBMS3-90	0			c.G1177A						.						75.0	72.0	73.0					3																	30029712		2203	4300	6503	SO:0001583	missense	27303	exon13			TCTATTGAAGTAA	AF023259	CCDS33724.1, CCDS33725.1, CCDS33726.1, CCDS54557.1, CCDS54558.1	3p24-p23	2013-02-12	2010-04-20		ENSG00000144642	ENSG00000144642		"""RNA binding motif (RRM) containing"""	13427	protein-coding gene	gene with protein product	"""RNA-binding protein"""	605786	"""RNA binding motif, single stranded interacting protein"""			10675610	Standard	NM_001003793		Approved		uc003cel.3	Q6XE24	OTTHUMG00000155699	ENST00000383767.2:c.1177G>A	3.37:g.30029712G>A	ENSP00000373277:p.Glu393Lys	Somatic	53	1		WXS	Illumina GAIIx	Phase_I	59	10	NM_001003793	0	0	0	0	0	A8K9S4|B7ZL17|G5E9J9|O75876|Q17RI0|Q6XE23	Missense_Mutation	SNP	ENST00000383767.2	37	CCDS33724.1	.	.	.	.	.	.	.	.	.	.	G	33	5.245337	0.95272	.	.	ENSG00000144642	ENST00000434693;ENST00000396583;ENST00000383767;ENST00000273139;ENST00000383766;ENST00000452462;ENST00000456853	T;T;T;T;T;T;T	0.27720	1.65;1.7;1.67;1.72;1.77;1.71;1.7	5.79	5.79	0.91817	.	0.103315	0.64402	D	0.000004	T	0.34424	0.0897	N	0.08118	0	0.80722	D	1	P;P;D;P	0.55172	0.855;0.84;0.97;0.95	P;P;P;P	0.61201	0.678;0.678;0.885;0.77	T	0.23904	-1.0175	9	.	.	.	.	20.0313	0.97540	0.0:0.0:1.0:0.0	.	377;390;375;393	G5E9J9;Q6XE24-2;Q6XE24-3;Q6XE24	.;.;.;RBMS3_HUMAN	K	392;390;393;377;375;377;390	ENSP00000395592:E392K;ENSP00000379828:E390K;ENSP00000373277:E393K;ENSP00000273139:E377K;ENSP00000373276:E375K;ENSP00000397926:E377K;ENSP00000400519:E390K	.	E	+	1	0	RBMS3	30004716	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.845000	0.99498	2.746000	0.94184	0.655000	0.94253	GAA	.		0.413	RBMS3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000341306.1	NM_001003792	
CTNNB1	1499	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	41266103	41266103	+	Missense_Mutation	SNP	G	G	C	rs121913399|rs121913416		TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr3:41266103G>C	ENST00000349496.5	+	3	380	c.100G>C	c.(100-102)Gga>Cga	p.G34R	CTNNB1_ENST00000396183.3_Missense_Mutation_p.G34R|CTNNB1_ENST00000396185.3_Missense_Mutation_p.G34R|CTNNB1_ENST00000405570.1_Missense_Mutation_p.G34R|CTNNB1_ENST00000453024.1_Missense_Mutation_p.G27R	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	34			G -> E (in PTR). {ECO:0000269|PubMed:10192393}.|G -> R (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|G -> V (in hepatoblastoma; dbSNP:rs28931589). {ECO:0000269|PubMed:9927029}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.G34R(87)|p.A5_A80del(53)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.?(4)|p.V22_G38del(3)|p.W25_I140del(3)|p.T3_A126del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.A5_Q143>E(1)|p.A13_R151del(1)|p.D32_H36>D(1)|p.M14_S45del(1)|p.A20_N141del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.H24_G38del(1)|p.S23_I35del(1)|p.Y30_A97del(1)|p.V22_T102del(1)|p.S33_G34insGTS(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.A20_I35del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.GIHS34?(1)|p.S23_A39del(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.D32fs*9(1)|p.A5_T40del(1)|p.S29_H36del(1)|p.A5_E54del(1)|p.W25_I35del(1)|p.S33_S37del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.Y30_T40del(1)|p.S33_G34insGI(1)|p.A5_I35del(1)|p.D32_H36del(1)|p.Y30_A80del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		CCTGGACTCTGGAATCCATTC	0.488		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.G34R	Colon(6;3 56 14213 18255)	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	.	CTNNB1-24361	220	Deletion - In frame(105)|Substitution - Missense(87)|Complex - deletion inframe(16)|Unknown(7)|Deletion - Frameshift(3)|Insertion - In frame(2)	liver(126)|large_intestine(21)|central_nervous_system(19)|pancreas(15)|endometrium(11)|stomach(10)|skin(4)|pituitary(4)|soft_tissue(2)|small_intestine(2)|adrenal_gland(1)|haematopoietic_and_lymphoid_tissue(1)|bone(1)|lung(1)|ovary(1)|kidney(1)	c.G100C						.						92.0	77.0	82.0					3																	41266103		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	GACTCTGGAATCC	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.100G>C	3.37:g.41266103G>C	ENSP00000344456:p.Gly34Arg	Somatic	185	0		WXS	Illumina GAIIx	Phase_I	265	59	NM_001098209	0	0	114	150	36	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	37	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	G	25.3	4.625128	0.87560	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.52526	0.66;0.66;0.66;0.66;0.66;0.66;0.66;0.66;0.66	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.72053	0.3413	M	0.79258	2.445	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.74188	-0.3746	10	0.87932	D	0	-31.2232	19.9596	0.97236	0.0:0.0:1.0:0.0	.	34	P35222	CTNB1_HUMAN	R	27;34;34;34;34;27;34;34;34	ENSP00000400508:G27R;ENSP00000385604:G34R;ENSP00000412219:G34R;ENSP00000379486:G34R;ENSP00000344456:G34R;ENSP00000411226:G27R;ENSP00000379488:G34R;ENSP00000409302:G34R;ENSP00000401599:G34R	ENSP00000344456:G34R	G	+	1	0	CTNNB1	41241107	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.726000	0.93360	0.655000	0.94253	GGA	.		0.488	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
LYZL4	131375	broad.mit.edu	37	3	42448455	42448455	+	Missense_Mutation	SNP	G	G	A	rs76947105	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr3:42448455G>A	ENST00000287748.3	-	3	450	c.175C>T	c.(175-177)Ccc>Tcc	p.P59S	LYZL4_ENST00000441172.1_Missense_Mutation_p.P59S|LYZL4_ENST00000470991.1_5'UTR	NM_144634.2	NP_653235.1	Q96KX0	LYZL4_HUMAN	lysozyme-like 4	59					cell wall macromolecule catabolic process (GO:0016998)	extracellular region (GO:0005576)|nucleus (GO:0005634)	lysozyme activity (GO:0003796)			central_nervous_system(1)|endometrium(1)|lung(1)	3				KIRC - Kidney renal clear cell carcinoma(284;0.222)		ATGGCCATGGGGTTGAACTTG	0.567													G|||	8	0.00159744	0.0	0.0029	5008	,	,		21197	0.0		0.005	False		,,,				2504	0.001				p.P59S		.											.	LYZL4-90	0			c.C175T						.	G	SER/PRO	2,4404	4.2+/-10.8	0,2,2201	102.0	83.0	89.0		175	3.3	1.0	3	dbSNP_131	89	36,8564	24.6+/-71.5	1,34,4265	yes	missense	LYZL4	NM_144634.2	74	1,36,6466	AA,AG,GG		0.4186,0.0454,0.2922	benign	59/147	42448455	38,12968	2203	4300	6503	SO:0001583	missense	131375	exon3			CCATGGGGTTGAA	BC016747, AF326749	CCDS2697.1	3p21.33	2006-04-12			ENSG00000157093	ENSG00000157093			28387	protein-coding gene	gene with protein product		612750				12477932	Standard	NM_144634		Approved	MGC26768, LYC4	uc003cle.3	Q96KX0	OTTHUMG00000131793	ENST00000287748.3:c.175C>T	3.37:g.42448455G>A	ENSP00000287748:p.Pro59Ser	Somatic	169	0		WXS	Illumina GAIIx	Phase_I	240	4	NM_144634	0	0	0	0	0		Missense_Mutation	SNP	ENST00000287748.3	37	CCDS2697.1	4	0.0018315018315018315	0	0.0	1	0.0027624309392265192	0	0.0	3	0.00395778364116095	G	8.590	0.884395	0.17467	4.54E-4	0.004186	ENSG00000157093	ENST00000287748;ENST00000441172	T;T	0.68025	-0.3;-0.3	4.31	3.27	0.37495	Lysozyme-like domain (1);	0.073855	0.49916	D	0.000134	T	0.60573	0.2279	L	0.41356	1.27	0.33835	D	0.630709	P	0.44877	0.845	P	0.47251	0.542	T	0.72290	-0.4337	10	0.72032	D	0.01	-22.4725	8.2245	0.31560	0.0:0.0:0.699:0.301	.	59	Q96KX0	LYZL4_HUMAN	S	59	ENSP00000287748:P59S;ENSP00000387897:P59S	ENSP00000287748:P59S	P	-	1	0	LYZL4	42423459	1.000000	0.71417	0.996000	0.52242	0.635000	0.38103	1.954000	0.40362	2.105000	0.64084	0.563000	0.77884	CCC	G|0.997;A|0.003		0.567	LYZL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254729.2	NM_144634	
ARHGEF3	50650	bcgsc.ca	37	3	56835761	56835761	+	Silent	SNP	G	G	A	rs3732508	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr3:56835761G>A	ENST00000296315.3	-	1	234	c.66C>T	c.(64-66)ccC>ccT	p.P22P	ARHGEF3_ENST00000338458.4_Intron|ARHGEF3_ENST00000496106.1_Intron|ARHGEF3_ENST00000498517.1_Intron|ARHGEF3_ENST00000495373.1_Silent_p.P22P	NM_019555.2	NP_062455.1	Q9NR81	ARHG3_HUMAN	Rho guanine nucleotide exchange factor (GEF) 3	22					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|intracellular (GO:0005622)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(1)	25				KIRC - Kidney renal clear cell carcinoma(284;0.0161)|Kidney(284;0.019)|OV - Ovarian serous cystadenocarcinoma(275;0.193)		CGCTGGCCGGGGGTAGCTCCA	0.652													G|||	1609	0.321286	0.0227	0.487	5008	,	,		16762	0.1944		0.5716	False		,,,				2504	0.4806				p.P22P		.											.	ARHGEF3-228	0			c.C66T						.	G	,	492,3902		44,404,1749	35.0	31.0	33.0		,66	4.0	1.0	3	dbSNP_107	33	4617,3949		1292,2033,958	no	intron,coding-synonymous	ARHGEF3	NM_001128615.1,NM_019555.2	,	1336,2437,2707	AA,AG,GG		46.1009,11.1971,39.4213	,	,22/527	56835761	5109,7851	2197	4283	6480	SO:0001819	synonymous_variant	50650	exon1			GGCCGGGGGTAGC	AB209661	CCDS2878.1, CCDS46854.1, CCDS46855.1, CCDS74948.1	3p14.3	2012-09-20			ENSG00000163947	ENSG00000163947		"""Rho guanine nucleotide exchange factors"""	683	protein-coding gene	gene with protein product	"""exchange factor found in platelets and leukemic and neuronal tissues, XPLN"", ""RhoGEF protein"""	612115				10873612	Standard	NM_019555		Approved	STA3, XPLN, GEF3, DKFZP434F2429	uc003dih.2	Q9NR81	OTTHUMG00000158857	ENST00000296315.3:c.66C>T	3.37:g.56835761G>A		Somatic	127	1		WXS	Illumina GAIIx	Phase_I	215	7	NM_019555	0	0	9	9	0	A8K5U7|Q4FZB6|Q4QQI5|Q4QQQ0|Q59F00|Q6NUN3|Q7Z4U2|Q7Z5T2|Q9H7T4	Silent	SNP	ENST00000296315.3	37	CCDS2878.1																																																																																			G|0.677;A|0.323		0.652	ARHGEF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352431.2	NM_019555	
LRIG1	26018	hgsc.bcm.edu	37	3	66550756	66550756	+	Missense_Mutation	SNP	G	G	C	rs1403625	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr3:66550756G>C	ENST00000273261.3	-	1	600	c.76C>G	c.(76-78)Ctt>Gtt	p.L26V	LRIG1_ENST00000383703.3_Missense_Mutation_p.L26V	NM_015541.2	NP_056356.2	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like domains 1	26				LLL -> VLV (in Ref. 1; AAK62357 and 3; AAH71561). {ECO:0000305}.	innervation (GO:0060384)|otolith morphogenesis (GO:0032474)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)				NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(4)|stomach(4)|urinary_tract(1)	42		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		TCCAGCCGAAGCAAAAGCAGC	0.761													g|||	3605	0.719848	0.1808	0.8833	5008	,	,		8093	0.8284		0.9732	False		,,,				2504	0.9601				p.L26V		.											.	LRIG1-230	0			c.C76G						.		VAL/LEU	1298,1386		255,788,299	3.0	4.0	4.0		76	2.9	0.5	3	dbSNP_88	4	5191,89		2555,81,4	yes	missense	LRIG1	NM_015541.2	32	2810,869,303	CC,CG,GG		1.6856,48.3607,18.5208	benign	26/1094	66550756	6489,1475	1342	2640	3982	SO:0001583	missense	26018	exon1			GCCGAAGCAAAAG	AB050468	CCDS33783.1	3p14	2013-01-14			ENSG00000144749	ENSG00000144749		"""Immunoglobulin superfamily / I-set domain containing"""	17360	protein-coding gene	gene with protein product	"""ortholog of mouse integral membrane glycoprotein LIG-1"", ""leucine-rich repeat protein LRIG1"""	608868				11414704, 12234026	Standard	NM_015541		Approved	LIG-1, DKFZP586O1624, LIG1	uc003dmx.3	Q96JA1	OTTHUMG00000158727	ENST00000273261.3:c.76C>G	3.37:g.66550756G>C	ENSP00000273261:p.Leu26Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_015541	0	0	0	0	0	Q6IQ51|Q96CF9|Q9BYB8|Q9UFI4	Missense_Mutation	SNP	ENST00000273261.3	37	CCDS33783.1	1666	0.7628205128205128	118	0.23983739837398374	325	0.8977900552486188	489	0.8548951048951049	734	0.9683377308707124	g	6.572	0.473779	0.12521	0.483607	0.983144	ENSG00000144749	ENST00000273261;ENST00000383703	T;T	0.67345	-0.26;-0.13	3.84	2.93	0.34026	.	0.847359	0.09512	U	0.792175	T	0.00012	0.0000	N	0.19112	0.55	0.80722	P	0.0	P;P	0.44139	0.827;0.484	B;B	0.37731	0.257;0.096	T	0.48854	-0.8998	9	0.23302	T	0.38	.	8.6883	0.34251	0.1185:0.0:0.8815:0.0	rs1403625;rs13083628	26;26	Q96JA1-2;Q96JA1	.;LRIG1_HUMAN	V	26	ENSP00000273261:L26V;ENSP00000373208:L26V	ENSP00000273261:L26V	L	-	1	0	LRIG1	66633446	.	.	0.520000	0.27837	0.020000	0.10135	.	.	1.845000	0.53610	0.472000	0.43445	CTT	G|0.237;C|0.763		0.761	LRIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351930.1	NM_015541	
LRIG1	26018	hgsc.bcm.edu	37	3	66550762	66550762	+	Missense_Mutation	SNP	G	G	C	rs1403626	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr3:66550762G>C	ENST00000273261.3	-	1	594	c.70C>G	c.(70-72)Ctt>Gtt	p.L24V	LRIG1_ENST00000383703.3_Missense_Mutation_p.L24V	NM_015541.2	NP_056356.2	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like domains 1	24			L -> V (in dbSNP:rs1403626).	LLL -> VLV (in Ref. 1; AAK62357 and 3; AAH71561). {ECO:0000305}.	innervation (GO:0060384)|otolith morphogenesis (GO:0032474)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)				NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(4)|stomach(4)|urinary_tract(1)	42		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		CGAAGCAAAAGCAGCCAGAGA	0.766													g|||	3605	0.719848	0.1808	0.8833	5008	,	,		8368	0.8284		0.9732	False		,,,				2504	0.9601				p.L24V		.											.	LRIG1-230	0			c.C70G						.		VAL/LEU	1309,1447		265,779,334	3.0	4.0	4.0		70	3.1	0.5	3	dbSNP_88	4	5325,93		2620,85,4	no	missense	LRIG1	NM_015541.2	32	2885,864,338	CC,CG,GG		1.7165,47.4964,18.8402	benign	24/1094	66550762	6634,1540	1378	2709	4087	SO:0001583	missense	26018	exon1			GCAAAAGCAGCCA	AB050468	CCDS33783.1	3p14	2013-01-14			ENSG00000144749	ENSG00000144749		"""Immunoglobulin superfamily / I-set domain containing"""	17360	protein-coding gene	gene with protein product	"""ortholog of mouse integral membrane glycoprotein LIG-1"", ""leucine-rich repeat protein LRIG1"""	608868				11414704, 12234026	Standard	NM_015541		Approved	LIG-1, DKFZP586O1624, LIG1	uc003dmx.3	Q96JA1	OTTHUMG00000158727	ENST00000273261.3:c.70C>G	3.37:g.66550762G>C	ENSP00000273261:p.Leu24Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	10	NM_015541	0	0	0	0	0	Q6IQ51|Q96CF9|Q9BYB8|Q9UFI4	Missense_Mutation	SNP	ENST00000273261.3	37	CCDS33783.1	1670	0.7646520146520146	119	0.241869918699187	326	0.9005524861878453	488	0.8531468531468531	737	0.9722955145118733	g	9.592	1.126319	0.20959	0.474964	0.982835	ENSG00000144749	ENST00000273261;ENST00000383703	T;T	0.68765	-0.35;-0.2	3.11	3.11	0.35812	.	0.429988	0.15146	U	0.278020	T	0.00012	0.0000	N	0.19112	0.55	0.39998	P	0.024872000000000005	P;B	0.36282	0.546;0.282	B;B	0.32465	0.146;0.069	T	0.40572	-0.9556	9	0.23891	T	0.37	.	12.0321	0.53403	0.0:0.0:1.0:0.0	rs1403626;rs13083630;rs1403626	24;24	Q96JA1-2;Q96JA1	.;LRIG1_HUMAN	V	24	ENSP00000273261:L24V;ENSP00000373208:L24V	ENSP00000273261:L24V	L	-	1	0	LRIG1	66633452	.	.	0.546000	0.28166	0.017000	0.09413	.	.	1.734000	0.51633	0.472000	0.43445	CTT	G|0.252;C|0.748		0.766	LRIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351930.1	NM_015541	
SEMA5B	54437	hgsc.bcm.edu	37	3	122631896	122631896	+	Missense_Mutation	SNP	A	A	T	rs2276782	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr3:122631896A>T	ENST00000357599.3	-	18	2905	c.2519T>A	c.(2518-2520)gTc>gAc	p.V840D	SEMA5B_ENST00000451055.2_Missense_Mutation_p.V894D|SEMA5B_ENST00000195173.4_Missense_Mutation_p.V839D	NM_001031702.3|NM_001256348.1	NP_001026872.2|NP_001243277.1	Q9P283	SEM5B_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B	840			V -> D (in dbSNP:rs2276782). {ECO:0000269|PubMed:10819331, ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(13)|lung(26)|ovary(2)|pancreas(3)|skin(2)|upper_aerodigestive_tract(3)	55				GBM - Glioblastoma multiforme(114;0.0367)		GCGCAGGAGGACCTCCACCAG	0.791													T|||	3010	0.601038	0.5348	0.621	5008	,	,		11243	0.3522		0.8082	False		,,,				2504	0.7198				p.V894D		.											.	SEMA5B-157	0			c.T2681A						.	T	ASP/VAL	2573,1477		827,919,279	4.0	5.0	5.0		2519	5.0	1.0	3	dbSNP_100	5	6625,1195		2828,969,113	no	missense	SEMA5B	NM_001031702.2	152	3655,1888,392	TT,TA,AA		15.2813,36.4691,22.5105	benign	840/1152	122631896	9198,2672	2025	3910	5935	SO:0001583	missense	54437	exon18			AGGAGGACCTCCA	AB040878	CCDS35491.1, CCDS58848.1, CCDS74995.1	3q21.1	2008-07-18			ENSG00000082684	ENSG00000082684		"""Semaphorins"""	10737	protein-coding gene	gene with protein product		609298		SEMAG		8817451	Standard	NM_001256346		Approved	SemG, KIAA1445, FLJ10372	uc031sbm.1	Q9P283	OTTHUMG00000140392	ENST00000357599.3:c.2519T>A	3.37:g.122631896A>T	ENSP00000350215:p.Val840Asp	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	18	18	NM_001256347	0	0	0	0	0	A8K5U2|B7Z393|F8W9U8|Q6DD89|Q6UY12|Q9NW17	Missense_Mutation	SNP	ENST00000357599.3	37	CCDS35491.1	1286	0.5888278388278388	247	0.5020325203252033	243	0.6712707182320442	193	0.3374125874125874	603	0.7955145118733509	T	5.344	0.248763	0.10130	0.635309	0.847187	ENSG00000082684	ENST00000357599;ENST00000195173;ENST00000418793;ENST00000451055;ENST00000393583	T;T;T;T	0.34072	1.43;1.38;1.48;1.5	5.01	5.01	0.66863	.	0.161766	0.52532	N	0.000069	T	0.00012	0.0000	N	0.00246	-1.78	0.30182	P	0.8002819999999999	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.39354	-0.9618	9	0.02654	T	1	.	10.6514	0.45651	0.1435:0.0:0.0:0.8565	rs2276782	782;840	D3YTI7;Q9P283	.;SEM5B_HUMAN	D	840;839;782;894;840	ENSP00000350215:V840D;ENSP00000195173:V839D;ENSP00000389588:V894D;ENSP00000377208:V840D	ENSP00000195173:V839D	V	-	2	0	SEMA5B	124114586	1.000000	0.71417	0.990000	0.47175	0.785000	0.44390	4.886000	0.63149	0.945000	0.37605	-0.257000	0.10917	GTC	T|0.412;A|0.588		0.791	SEMA5B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000277165.1	NM_001031702	
ADCY5	111	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	123010075	123010075	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr3:123010075G>A	ENST00000462833.1	-	18	4424	c.3212C>T	c.(3211-3213)gCg>gTg	p.A1071V	ADCY5_ENST00000491190.1_Missense_Mutation_p.A729V|ADCY5_ENST00000309879.5_Missense_Mutation_p.A721V	NM_183357.2	NP_899200.1	O95622	ADCY5_HUMAN	adenylate cyclase 5	1071	Guanylate cyclase 2. {ECO:0000255|PROSITE-ProRule:PRU00099}.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenosine receptor signaling pathway (GO:0001973)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			breast(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(22)|ovary(5)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(114;0.0342)		GAACATGACCGCCACACACTC	0.592																																					p.A1071V		.											.	ADCY5-94	0			c.C3212T						.						104.0	83.0	90.0					3																	123010075		2203	4300	6503	SO:0001583	missense	111	exon18			ATGACCGCCACAC	U65473	CCDS3022.1, CCDS56274.1	3q21.1	2013-02-04			ENSG00000173175	ENSG00000173175	4.6.1.1	"""Adenylate cyclases"""	236	protein-coding gene	gene with protein product		600293				10481931	Standard	NM_183357		Approved	AC5	uc003egh.2	O95622	OTTHUMG00000159517	ENST00000462833.1:c.3212C>T	3.37:g.123010075G>A	ENSP00000419361:p.Ala1071Val	Somatic	379	0		WXS	Illumina GAIIx	Phase_I	566	334	NM_183357	0	0	0	0	0	B7Z8A6|Q7RTV7|Q8NFM3	Missense_Mutation	SNP	ENST00000462833.1	37	CCDS3022.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.507113	0.85282	.	.	ENSG00000173175	ENST00000462833;ENST00000491190;ENST00000309879	D;D;D	0.82433	-1.61;-1.61;-1.61	4.53	4.53	0.55603	Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.000000	0.64402	D	0.000001	D	0.90504	0.7025	M	0.76328	2.33	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.74674	0.984;0.954	D	0.91456	0.5185	10	0.59425	D	0.04	.	17.4829	0.87679	0.0:0.0:1.0:0.0	.	1071;729	O95622;B3KWA8	ADCY5_HUMAN;.	V	1071;729;721	ENSP00000419361:A1071V;ENSP00000418537:A729V;ENSP00000308685:A721V	ENSP00000308685:A721V	A	-	2	0	ADCY5	124492765	1.000000	0.71417	0.999000	0.59377	0.664000	0.39144	6.340000	0.72973	2.362000	0.80069	0.563000	0.77884	GCG	.		0.592	ADCY5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355889.4	XM_171048	
MUC4	4585	broad.mit.edu	37	3	195508940	195508940	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr3:195508940C>G	ENST00000463781.3	-	2	9970	c.9511G>C	c.(9511-9513)Gtc>Ctc	p.V3171L	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.V3171L	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGGCTGGTGACAGGAAGAGGG	0.577																																					p.V3171L		.											.	MUC4-90	0			c.G9511C						.																																			SO:0001583	missense	4585	exon2			TGGTGACAGGAAG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.9511G>C	3.37:g.195508940C>G	ENSP00000417498:p.Val3171Leu	Somatic	254	0		WXS	Illumina GAIIx	Phase_I	371	12	NM_018406	0	0	0	0	0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	c	0.743	-0.775724	0.02951	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.36340	1.26;1.26	.	.	.	.	.	.	.	.	T	0.18215	0.0437	N	0.19112	0.55	0.09310	N	1	B	0.13594	0.008	B	0.08055	0.003	T	0.24225	-1.0166	7	.	.	.	.	3.6045	0.08037	2.0E-4:0.5019:0.4977:2.0E-4	.	3043	E7ESK3	.	L	3171	ENSP00000417498:V3171L;ENSP00000420243:V3171L	.	V	-	1	0	MUC4	196993719	0.001000	0.12720	0.017000	0.16124	0.017000	0.09413	0.318000	0.19504	0.073000	0.16731	0.074000	0.15403	GTC	.		0.577	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
TNK2	10188	hgsc.bcm.edu	37	3	195595405	195595405	+	Silent	SNP	G	G	A	rs1056726	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr3:195595405G>A	ENST00000333602.6	-	12	2336	c.1719C>T	c.(1717-1719)ttC>ttT	p.F573F	TNK2_ENST00000392400.1_Silent_p.F573F|TNK2_ENST00000381916.2_Silent_p.F651F|TNK2_ENST00000428187.1_Silent_p.F605F	NM_005781.4	NP_005772.3	Q07912	ACK1_HUMAN	tyrosine kinase, non-receptor, 2	573				Missing (in Ref. 4; AAH08884). {ECO:0000305}.	cell surface receptor signaling pathway (GO:0007166)|endocytosis (GO:0006897)|negative regulation of catalytic activity (GO:0043086)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of clathrin-mediated endocytosis (GO:2000369)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|cell junction (GO:0030054)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|endosome (GO:0005768)|Grb2-EGFR complex (GO:0070436)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|WW domain binding (GO:0050699)			central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(11)|ovary(3)|prostate(4)|skin(2)|stomach(1)|urinary_tract(1)	29	all_cancers(143;6.48e-09)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;1.46e-22)|OV - Ovarian serous cystadenocarcinoma(49;8.3e-19)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;0.000757)	Adenosine triphosphate(DB00171)	GCTCCTCACCGAAGTCGATGA	0.746													a|||	310	0.061901	0.0847	0.0259	5008	,	,		10834	0.0704		0.0467	False		,,,				2504	0.0634				p.F651F		.											.	TNK2-957	0			c.C1953T						.		,	269,3657		9,251,1703	5.0	6.0	6.0		1953,1719	-5.7	0.0	3	dbSNP_86	6	322,7600		4,314,3643	no	coding-synonymous,coding-synonymous	TNK2	NM_001010938.1,NM_005781.4	,	13,565,5346	AA,AG,GG		4.0646,6.8518,4.9882	,	651/1087,573/1039	195595405	591,11257	1963	3961	5924	SO:0001819	synonymous_variant	10188	exon13			CTCACCGAAGTCG	L13738	CCDS33927.1, CCDS33928.1	3q29	2013-09-02			ENSG00000061938	ENSG00000061938			19297	protein-coding gene	gene with protein product	"""activated Cdc42-associated kinase 1"""	606994				8497321, 14506255	Standard	XM_006713460		Approved	p21cdc42Hs, ACK, ACK1	uc003fvt.1	Q07912	OTTHUMG00000155737	ENST00000333602.6:c.1719C>T	3.37:g.195595405G>A		Somatic	2	0		WXS	Illumina GAIIx	Phase_I	10	10	NM_001010938	0	0	0	5	5	Q6ZMQ0|Q8N6U7|Q96H59	Silent	SNP	ENST00000333602.6	37	CCDS33928.1	134	0.06135531135531135	38	0.07723577235772358	10	0.027624309392265192	53	0.09265734265734266	33	0.04353562005277045	A	0.025	-1.382365	0.01204	0.068518	0.040646	ENSG00000061938	ENST00000424563	.	.	.	5.41	-5.74	0.02391	.	.	.	.	.	T	0.06096	0.0158	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.56288	-0.8004	4	.	.	.	.	15.998	0.80265	0.6944:0.0:0.3056:0.0	rs1056726;rs3197336;rs57297005	.	.	.	L	183	.	.	S	-	2	0	TNK2	197079802	0.028000	0.19301	0.045000	0.18777	0.071000	0.16799	-0.555000	0.05999	-1.423000	0.02002	-2.075000	0.00382	TCG	G|0.936;A|0.064		0.746	TNK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341437.3	NM_005781	
RNF212	285498	broad.mit.edu;bcgsc.ca;mdanderson.org	37	4	1107223	1107223	+	Silent	SNP	G	G	A			TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr4:1107223G>A	ENST00000433731.2	-	1	91	c.30C>T	c.(28-30)tgC>tgT	p.C10C	RNF212_ENST00000333673.5_Silent_p.C10C|RNF212_ENST00000505730.1_5'UTR|RP11-20I20.2_ENST00000504969.1_RNA|RNF212_ENST00000382968.5_Silent_p.C10C|TMED11P_ENST00000502630.1_RNA			Q495C1	RN212_HUMAN	ring finger protein 212	10					chiasma assembly (GO:0051026)|meiotic gene conversion (GO:0006311)|protein sumoylation (GO:0016925)|reciprocal meiotic recombination (GO:0007131)	synaptonemal complex (GO:0000795)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	10			OV - Ovarian serous cystadenocarcinoma(23;0.0179)	UCEC - Uterine corpus endometrioid carcinoma (64;0.151)		GCGGCTGGAAGCAGCGATTAC	0.687																																					p.C10C		.											.	RNF212-68	0			c.C30T						.						48.0	39.0	42.0					4																	1107223		2193	4297	6490	SO:0001819	synonymous_variant	285498	exon1			CTGGAAGCAGCGA	AK096160	CCDS3345.1, CCDS46996.1, CCDS54704.1	4p16.3	2013-02-27	2007-01-19	2007-01-19	ENSG00000178222	ENSG00000178222		"""RING-type (C3HC4) zinc fingers"""	27729	protein-coding gene	gene with protein product		612041	"""hypothetical protein LOC285498"""	LOC285498		23396135	Standard	NM_001131034		Approved	FLJ38841	uc003gcj.3	Q495C1	OTTHUMG00000118997	ENST00000433731.2:c.30C>T	4.37:g.1107223G>A		Somatic	90	1		WXS	Illumina GAIIx	Phase_I	212	67	NM_194439	0	0	0	0	0	C9J8N0|Q495C0|Q86W82|Q8IY99|Q8N8U7	Silent	SNP	ENST00000433731.2	37	CCDS46996.1																																																																																			.		0.687	RNF212-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359124.2	NM_194439	
CRIPAK	285464	hgsc.bcm.edu	37	4	1388726	1388726	+	Missense_Mutation	SNP	T	T	C	rs199689156	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr4:1388726T>C	ENST00000324803.4	+	1	3387	c.427T>C	c.(427-429)Tgc>Cgc	p.C143R		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	143					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			CACGTGCCCATGCGGAGTGCC	0.697																																					p.C143R		.											.	CRIPAK-90	0			c.T427C						.						38.0	37.0	37.0					4																	1388726		1908	3685	5593	SO:0001583	missense	285464	exon1			TGCCCATGCGGAG	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.427T>C	4.37:g.1388726T>C	ENSP00000323978:p.Cys143Arg	Somatic	11	0		WXS	Illumina GAIIx	Phase_I	137	13	NM_175918	0	0	9	9	0	Q8NB03	Missense_Mutation	SNP	ENST00000324803.4	37	CCDS3349.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	-|-	8.608|8.608	0.888529|0.888529	0.17540|0.17540	.|.	.|.	ENSG00000179979|ENSG00000179979	ENST00000324803|ENST00000382944	T|.	0.29142|.	1.58|.	0.948|0.948	-0.668|-0.668	0.11392|0.11392	Post-SET domain (1);|.	.|.	.|.	.|.	.|.	T|T	0.12860|0.12860	0.0312|0.0312	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B|.	0.27594|.	0.182|.	B|.	0.13407|.	0.009|.	T|T	0.30621|0.30621	-0.9972|-0.9972	9|6	0.51188|0.06365	T|T	0.08|0.9	.|.	4.4755|4.4755	0.11733|0.11733	0.0:0.2357:0.0:0.7643|0.0:0.2357:0.0:0.7643	.|.	143|.	Q8N1N5|.	CRPAK_HUMAN|.	R|T	143|126	ENSP00000323978:C143R|.	ENSP00000323978:C143R|ENSP00000372402:M126T	C|M	+|+	1|2	0|0	CRIPAK|CRIPAK	1378726|1378726	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.008000|0.008000	0.06430|0.06430	-0.703000|-0.703000	0.05063|0.05063	-0.155000|-0.155000	0.11098|0.11098	0.102000|0.102000	0.15555|0.15555	TGC|ATG	T|0.980;C|0.020		0.697	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
CRIPAK	285464	bcgsc.ca	37	4	1389005	1389005	+	Missense_Mutation	SNP	T	T	C	rs71614970	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr4:1389005T>C	ENST00000324803.4	+	1	3666	c.706T>C	c.(706-708)Tgc>Cgc	p.C236R		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	236					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			CACGTGCCGATGCGGAGTGCC	0.672													t|||	859	0.171526	0.1059	0.245	5008	,	,		14444	0.0437		0.2913	False		,,,				2504	0.2168				p.C236R		.											.	CRIPAK-90	0			c.T706C						.						163.0	133.0	143.0					4																	1389005		2188	4292	6480	SO:0001583	missense	285464	exon1			TGCCGATGCGGAG	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.706T>C	4.37:g.1389005T>C	ENSP00000323978:p.Cys236Arg	Somatic	17	0		WXS	Illumina GAIIx	Phase_I	102	34	NM_175918	0	0	15	27	12	Q8NB03	Missense_Mutation	SNP	ENST00000324803.4	37	CCDS3349.1	.	.	.	.	.	.	.	.	.	.	t	1.791	-0.479438	0.04383	.	.	ENSG00000179979	ENST00000324803;ENST00000382944	T	0.18338	2.22	1.11	-2.23	0.06930	Post-SET domain (1);	.	.	.	.	T	0.06781	0.0173	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.32214	-0.9915	9	0.46703	T	0.11	.	2.6743	0.05077	0.0:0.3283:0.2597:0.412	.	236	Q8N1N5	CRPAK_HUMAN	R	236;178	ENSP00000323978:C236R	ENSP00000323978:C236R	C	+	1	0	CRIPAK	1379005	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.211000	0.09332	-0.571000	0.06014	-0.530000	0.04314	TGC	C|1.000;|0.000		0.672	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
MSANTD1	345222	hgsc.bcm.edu	37	4	3251006	3251006	+	Silent	SNP	C	C	T			TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr4:3251006C>T	ENST00000438480.2	+	1	1804	c.57C>T	c.(55-57)ggC>ggT	p.G19G	MSANTD1_ENST00000507492.1_Splice_Site_p.G6G|MSANTD1_ENST00000510580.1_Silent_p.G19G	NM_001042690.1	NP_001036155.1	Q6ZTZ1	MSD1_HUMAN	Myb/SANT-like DNA-binding domain containing 1	19										endometrium(1)|lung(2)	3						ACCCCACAGGCGCCTCCGGCA	0.771																																					p.G19G		.											.	.	0			c.C57T						.						2.0	4.0	3.0					4																	3251006		1611	3327	4938	SO:0001819	synonymous_variant	345222	exon1			CACAGGCGCCTCC		CCDS47003.1	4p16.2	2012-03-02	2012-03-02	2012-03-02	ENSG00000188981	ENSG00000188981			33741	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 44"""	C4orf44			Standard	NM_001042690		Approved	LOC345222	uc003ggs.3	Q6ZTZ1	OTTHUMG00000159977	ENST00000438480.2:c.57C>T	4.37:g.3251006C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	14	9	NM_001042690	0	0	0	0	0	C9J6V0	Silent	SNP	ENST00000438480.2	37	CCDS47003.1																																																																																			.		0.771	MSANTD1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370924.1	NM_001012982	
DOK7	285489	hgsc.bcm.edu	37	4	3495095	3495095	+	Missense_Mutation	SNP	G	G	A	rs9684786	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr4:3495095G>A	ENST00000340083.5	+	7	1447	c.1382G>A	c.(1381-1383)gGc>gAc	p.G461D	DOK7_ENST00000389653.2_Missense_Mutation_p.G461D|DOK7_ENST00000507039.1_3'UTR|DOK7_ENST00000512714.1_3'UTR	NM_173660.4	NP_775931.3	Q18PE1	DOK7_HUMAN	docking protein 7	461			G -> D (in dbSNP:rs9684786). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:22661499}.		neuromuscular junction development (GO:0007528)|positive regulation of protein tyrosine kinase activity (GO:0061098)|receptor clustering (GO:0043113)	cell junction (GO:0030054)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)|protein kinase binding (GO:0019901)			kidney(1)|large_intestine(1)|skin(2)|upper_aerodigestive_tract(1)	5				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		GCCCCCCAGGGCAGCGAGGCC	0.736													.|||	979	0.195487	0.1301	0.2536	5008	,	,		12640	0.126		0.1859	False		,,,				2504	0.3241				p.G461D		.											.	DOK7-91	0			c.G1382A						.	G	,ASP/GLY	491,3733		21,449,1642	5.0	7.0	6.0		,1382	2.6	0.0	4	dbSNP_119	6	1533,6777		146,1241,2768	no	utr-3,missense	DOK7	NM_001164673.1,NM_173660.4	,94	167,1690,4410	AA,AG,GG		18.4477,11.6241,16.1481	,possibly-damaging	,461/505	3495095	2024,10510	2112	4155	6267	SO:0001583	missense	285489	exon7			CCCAGGGCAGCGA	AK091037	CCDS3370.2, CCDS54717.1	4p16.2	2014-09-17	2006-08-24	2006-08-24	ENSG00000175920	ENSG00000175920			26594	protein-coding gene	gene with protein product		610285	"""chromosome 4 open reading frame 25"""	C4orf25		16794080	Standard	NM_173660		Approved	FLJ33718, FLJ39137, Dok-7	uc003ghd.3	Q18PE1	OTTHUMG00000122087	ENST00000340083.5:c.1382G>A	4.37:g.3495095G>A	ENSP00000344432:p.Gly461Asp	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	40	26	NM_173660	0	0	0	0	0	A2A499|A2RRD4|E9PB56|Q6P6A6|Q86XG5|Q8N2J3|Q8NBC1	Missense_Mutation	SNP	ENST00000340083.5	37	CCDS3370.2	361	0.1652930402930403	71	0.1443089430894309	89	0.24585635359116023	60	0.1048951048951049	141	0.18601583113456466	G	11.67	1.708532	0.30322	0.116241	0.184477	ENSG00000175920	ENST00000389653;ENST00000340083	T;T	0.65364	-0.15;-0.05	3.45	2.59	0.31030	.	0.256266	0.35096	N	0.003451	T	0.00039	0.0001	L	0.60455	1.87	0.80722	P	0.0	B;P;B	0.40731	0.192;0.728;0.005	B;P;B	0.44359	0.066;0.447;0.001	T	0.03706	-1.1011	9	0.51188	T	0.08	-7.7911	11.2519	0.49031	0.0:0.0:0.8164:0.1835	rs9684786;rs17846359;rs17859395	461;323;461	Q18PE1-3;Q18PE1-2;Q18PE1	.;.;DOK7_HUMAN	D	461	ENSP00000374304:G461D;ENSP00000344432:G461D	ENSP00000344432:G461D	G	+	2	0	DOK7	3464893	1.000000	0.71417	0.010000	0.14722	0.077000	0.17291	2.742000	0.47434	0.667000	0.31107	0.555000	0.69702	GGC	G|0.834;A|0.166		0.736	DOK7-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000313538.1	NM_173660	
OTOP1	133060	broad.mit.edu	37	4	4228274	4228282	+	In_Frame_Del	DEL	CCACAGCAG	CCACAGCAG	-	rs75328065|rs199840382|rs111245977|rs377667898|rs200554408|rs201436152	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr4:4228274_4228282delCCACAGCAG	ENST00000296358.4	-	1	334_342	c.310_318delCTGCTGTGG	c.(310-318)ctgctgtggdel	p.LLW104del		NM_177998.1	NP_819056.1	Q7RTM1	OTOP1_HUMAN	otopetrin 1	104					biomineral tissue development (GO:0031214)|detection of gravity (GO:0009590)|inner ear morphogenesis (GO:0042472)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)		p.L104_W106delLLW(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|liver(4)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		ACCACAGCATCCACAGCAGCTGCAGCAGC	0.727																																					p.104_106del		.											.	OTOP1-92	1	Deletion - In frame(1)	upper_aerodigestive_tract(1)	c.310_318del						.																																			SO:0001651	inframe_deletion	133060	exon1			CAGCATCCACAGC	BK000653	CCDS3372.1	4p16.2	2008-02-05			ENSG00000163982	ENSG00000163982			19656	protein-coding gene	gene with protein product		607806				12651873	Standard	NM_177998		Approved		uc003ghp.1	Q7RTM1	OTTHUMG00000090301	ENST00000296358.4:c.310_318delCTGCTGTGG	4.37:g.4228274_4228282delCCACAGCAG	ENSP00000296358:p.Leu104_Trp106del	Somatic	5	0		WXS	Illumina GAIIx	Phase_I	78	16	NM_177998	0	0	0	0	0	A1L476	In_Frame_Del	DEL	ENST00000296358.4	37	CCDS3372.1																																																																																			.		0.727	OTOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206661.2	NM_177998	
CRMP1	1400	hgsc.bcm.edu	37	4	5894586	5894586	+	Silent	SNP	G	G	A	rs143304363	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr4:5894586G>A	ENST00000324989.7	-	1	199	c.111C>T	c.(109-111)gcC>gcT	p.A37A	CRMP1_ENST00000512574.1_5'Flank	NM_001014809.1	NP_001014809.1	Q14194	DPYL1_HUMAN	collapsin response mediator protein 1	0					axon guidance (GO:0007411)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|pyrimidine nucleobase catabolic process (GO:0006208)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			NS(1)|cervix(2)|endometrium(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	36				Colorectal(103;0.0721)		CCTCCACCGCGGCGAACATGC	0.756													G|||	277	0.0553115	0.0076	0.0461	5008	,	,		4031	0.0437		0.0805	False		,,,				2504	0.1125				p.A37A		.											.	CRMP1-92	0			c.C111T						.	G		56,3324		2,52,1636	4.0	4.0	4.0		111	0.2	1.0	4	dbSNP_134	4	409,6095		9,391,2852	no	coding-synonymous	CRMP1	NM_001014809.1		11,443,4488	AA,AG,GG		6.2884,1.6568,4.7046		37/687	5894586	465,9419	1690	3252	4942	SO:0001819	synonymous_variant	1400	exon1			CACCGCGGCGAAC	D78012	CCDS33950.1, CCDS43207.1, CCDS75102.1	4p16.1	2008-05-15			ENSG00000072832	ENSG00000072832			2365	protein-coding gene	gene with protein product		602462				8973361	Standard	XM_005247940		Approved	DRP-1, DPYSL1	uc003gis.3	Q14194	OTTHUMG00000125489	ENST00000324989.7:c.111C>T	4.37:g.5894586G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	18	16	NM_001014809	0	0	0	0	0	A0EJG6|Q13024|Q4W5F1|Q96TC8	Silent	SNP	ENST00000324989.7	37	CCDS33950.1																																																																																			G|0.946;A|0.054		0.756	CRMP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000246814.2	NM_001313	
CCDC96	257236	hgsc.bcm.edu	37	4	7044357	7044357	+	Silent	SNP	A	A	G	rs871133	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr4:7044357A>G	ENST00000310085.4	-	1	371	c.309T>C	c.(307-309)gtT>gtC	p.V103V	TADA2B_ENST00000512388.1_5'Flank|RP11-367J11.2_ENST00000500031.1_RNA|TADA2B_ENST00000310074.7_5'Flank	NM_153376.2	NP_699207.1	Q2M329	CCD96_HUMAN	coiled-coil domain containing 96	103	Glu-rich.									endometrium(3)|kidney(1)|large_intestine(3)|lung(2)|skin(1)|urinary_tract(1)	11						CCTCAGCCCCAACCTCGGCCG	0.766													G|||	4833	0.965056	0.8979	0.9856	5008	,	,		11811	1.0		0.9702	False		,,,				2504	1.0				p.V103V		.											.	CCDC96-90	0			c.T309C						.	G		2893,205		1348,197,4	3.0	3.0	3.0		309	-4.5	0.0	4	dbSNP_86	3	6689,125		3282,125,0	no	coding-synonymous	CCDC96	NM_153376.2		4630,322,4	GG,GA,AA		1.8345,6.6172,3.3293		103/556	7044357	9582,330	1549	3407	4956	SO:0001819	synonymous_variant	257236	exon1			AGCCCCAACCTCG	AK075056	CCDS3395.1	4p16.1	2008-02-05			ENSG00000173013	ENSG00000173013			26900	protein-coding gene	gene with protein product							Standard	NM_153376		Approved	FLJ90575	uc003gjv.2	Q2M329	OTTHUMG00000125511	ENST00000310085.4:c.309T>C	4.37:g.7044357A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_153376	0	0	0	0	0	Q8N2I7	Silent	SNP	ENST00000310085.4	37	CCDS3395.1																																																																																			A|0.036;G|0.964		0.766	CCDC96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246838.1	NM_153376	
CCDC96	257236	hgsc.bcm.edu	37	4	7044380	7044380	+	Missense_Mutation	SNP	C	C	T	rs871134	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr4:7044380C>T	ENST00000310085.4	-	1	348	c.286G>A	c.(286-288)Gag>Aag	p.E96K	TADA2B_ENST00000512388.1_5'Flank|RP11-367J11.2_ENST00000500031.1_RNA|TADA2B_ENST00000310074.7_5'Flank	NM_153376.2	NP_699207.1	Q2M329	CCD96_HUMAN	coiled-coil domain containing 96	96	Glu-rich.		E -> K (in dbSNP:rs871134). {ECO:0000269|PubMed:15489334}.							endometrium(3)|kidney(1)|large_intestine(3)|lung(2)|skin(1)|urinary_tract(1)	11						TCTTCGGGCTCGGGCTGGGGC	0.776													C|||	2561	0.511382	0.3623	0.4741	5008	,	,		11435	0.6429		0.5845	False		,,,				2504	0.5286				p.E96K		.											.	CCDC96-90	0			c.G286A						.	C	LYS/GLU	1411,1153		409,593,280	2.0	2.0	2.0		286	2.2	0.0	4	dbSNP_86	2	3789,2017		1333,1123,447	no	missense	CCDC96	NM_153376.2	56	1742,1716,727	TT,TC,CC		34.7399,44.9688,37.8734	benign	96/556	7044380	5200,3170	1282	2903	4185	SO:0001583	missense	257236	exon1			CGGGCTCGGGCTG	AK075056	CCDS3395.1	4p16.1	2008-02-05			ENSG00000173013	ENSG00000173013			26900	protein-coding gene	gene with protein product							Standard	NM_153376		Approved	FLJ90575	uc003gjv.2	Q2M329	OTTHUMG00000125511	ENST00000310085.4:c.286G>A	4.37:g.7044380C>T	ENSP00000309285:p.Glu96Lys	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_153376	0	0	0	3	3	Q8N2I7	Missense_Mutation	SNP	ENST00000310085.4	37	CCDS3395.1	1153	0.5279304029304029	172	0.34959349593495936	193	0.5331491712707183	349	0.6101398601398601	439	0.579155672823219	C	10.33	1.319932	0.23994	0.550312	0.652601	ENSG00000173013	ENST00000310085	T	0.54479	0.57	3.13	2.24	0.28232	.	0.882045	0.09267	N	0.825735	T	0.00012	0.0000	L	0.32530	0.975	0.45284	P	0.0017160000000000508	B	0.21147	0.052	B	0.09377	0.004	T	0.45585	-0.9251	9	0.14252	T	0.57	-0.0803	4.8536	0.13549	0.0:0.6921:0.0:0.3079	rs871134	96	Q2M329	CCD96_HUMAN	K	96	ENSP00000309285:E96K	ENSP00000309285:E96K	E	-	1	0	CCDC96	7095281	0.001000	0.12720	0.000000	0.03702	0.036000	0.12997	0.781000	0.26774	0.602000	0.29896	0.471000	0.43371	GAG	C|0.472;T|0.528		0.776	CCDC96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246838.1	NM_153376	
CPZ	8532	broad.mit.edu	37	4	8605757	8605757	+	Missense_Mutation	SNP	G	G	A	rs376798665		TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr4:8605757G>A	ENST00000360986.4	+	4	725	c.551G>A	c.(550-552)cGc>cAc	p.R184H	CPZ_ENST00000429646.2_5'UTR|CPZ_ENST00000315782.6_Missense_Mutation_p.R173H|CPZ_ENST00000382480.2_Missense_Mutation_p.R47H	NM_001014447.2	NP_001014447	Q66K79	CBPZ_HUMAN	carboxypeptidase Z	184					proteolysis (GO:0006508)|Wnt signaling pathway (GO:0016055)	extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(23)|ovary(3)|pancreas(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						ACCTTCATCCGCTTCAGCCAC	0.701																																					p.R184H		.											.	CPZ-93	0			c.G551A						.	G	HIS/ARG,HIS/ARG,HIS/ARG	0,4348		0,0,2174	30.0	25.0	26.0		551,140,518	-2.9	0.2	4		26	2,8516		0,2,4257	no	missense,missense,missense	CPZ	NM_001014447.2,NM_001014448.2,NM_003652.3	29,29,29	0,2,6431	AA,AG,GG		0.0235,0.0,0.0155	benign,benign,benign	184/653,47/516,173/642	8605757	2,12864	2174	4259	6433	SO:0001583	missense	8532	exon4			TCATCCGCTTCAG	U83411	CCDS3404.1, CCDS33953.1, CCDS43212.1	4p16.1	2012-02-10			ENSG00000109625	ENSG00000109625			2333	protein-coding gene	gene with protein product	"""metallocarboxypeptidase Z"""	603105				9099699	Standard	NM_001014447		Approved		uc003glm.3	Q66K79	OTTHUMG00000090513	ENST00000360986.4:c.551G>A	4.37:g.8605757G>A	ENSP00000354255:p.Arg184His	Somatic	24	0		WXS	Illumina GAIIx	Phase_I	92	3	NM_001014447	0	0	0	0	0	O00520|Q96MX2	Missense_Mutation	SNP	ENST00000360986.4	37	CCDS33953.1	.	.	.	.	.	.	.	.	.	.	G	7.156	0.584727	0.13749	0.0	2.35E-4	ENSG00000109625	ENST00000360986;ENST00000382480;ENST00000315782	T;T;T	0.03301	3.98;3.98;3.98	3.86	-2.92	0.05615	.	0.595436	0.18160	N	0.149807	T	0.01870	0.0059	N	0.12182	0.205	0.80722	D	1	B;B	0.20671	0.047;0.028	B;B	0.14578	0.011;0.005	T	0.49021	-0.8982	10	0.54805	T	0.06	-15.3796	5.3119	0.15835	0.6471:0.0:0.2035:0.1494	.	173;184	Q66K79-2;Q66K79	.;CBPZ_HUMAN	H	184;47;173	ENSP00000354255:R184H;ENSP00000371920:R47H;ENSP00000315074:R173H	ENSP00000315074:R173H	R	+	2	0	CPZ	8656657	0.061000	0.20836	0.155000	0.22561	0.108000	0.19459	-0.006000	0.12833	-0.543000	0.06240	-0.228000	0.12330	CGC	.		0.701	CPZ-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207001.4	NM_003652	
C1QTNF7	114905	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	15444216	15444216	+	Silent	SNP	C	C	T	rs140722077	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr4:15444216C>T	ENST00000444304.2	+	3	989	c.663C>T	c.(661-663)ttC>ttT	p.F221F	C1QTNF7_ENST00000429690.1_Silent_p.F221F|C1QTNF7_ENST00000295297.4_Silent_p.F228F			Q9BXJ2	C1QT7_HUMAN	C1q and tumor necrosis factor related protein 7	221	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.				protein homooligomerization (GO:0051260)	collagen trimer (GO:0005581)|extracellular space (GO:0005615)		p.F221F(1)		endometrium(5)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|stomach(1)	16						TAAAGACCTTCGACGCCAACA	0.463													C|||	2	0.000399361	0.0015	0.0	5008	,	,		19768	0.0		0.0	False		,,,				2504	0.0				p.F228F		.											.	C1QTNF7-90	1	Substitution - coding silent(1)	large_intestine(1)	c.C684T						.	C	,,	8,4398	14.3+/-33.2	0,8,2195	106.0	110.0	108.0		684,663,663	-4.1	0.8	4	dbSNP_134	108	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous	C1QTNF7	NM_001135170.1,NM_001135171.1,NM_031911.4	,,	0,8,6495	TT,TC,CC		0.0,0.1816,0.0615	,,	228/297,221/290,221/290	15444216	8,12998	2203	4300	6503	SO:0001819	synonymous_variant	114905	exon3			GACCTTCGACGCC	AF329839	CCDS3414.1, CCDS47025.1	4p15.3	2008-08-29			ENSG00000163145	ENSG00000163145			14342	protein-coding gene	gene with protein product							Standard	NM_001135170		Approved	CTRP7	uc003gnp.3	Q9BXJ2	OTTHUMG00000097095	ENST00000444304.2:c.663C>T	4.37:g.15444216C>T		Somatic	69	0		WXS	Illumina GAIIx	Phase_I	90	48	NM_001135170	0	0	0	0	0	B2RBT3|J3KPW3	Silent	SNP	ENST00000444304.2	37	CCDS3414.1																																																																																			C|0.999;T|0.001		0.463	C1QTNF7-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000250891.2		
RBM47	54502	hgsc.bcm.edu	37	4	40440854	40440854	+	Silent	SNP	G	G	C	rs1052153	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr4:40440854G>C	ENST00000381793.2	-	3	453	c.57C>G	c.(55-57)tcC>tcG	p.S19S	RBM47_ENST00000319592.4_Silent_p.S19S|RBM47_ENST00000381795.6_Silent_p.S19S|RBM47_ENST00000515809.1_Intron|RBM47_ENST00000514014.1_Intron|RBM47_ENST00000295971.7_Silent_p.S19S			A0AV96	RBM47_HUMAN	RNA binding motif protein 47	19					hematopoietic progenitor cell differentiation (GO:0002244)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(5)|endometrium(1)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	29						GCACCTTGGCGGAGGACCCGG	0.662													C|||	4016	0.801917	0.6808	0.8588	5008	,	,		14653	0.7679		0.8837	False		,,,				2504	0.8763				p.S19S		.											.	RBM47-25	0			c.C57G						.	C	,	3111,1133		1151,809,162	8.0	9.0	9.0		57,57	-7.6	0.0	4	dbSNP_86	9	7487,919		3358,771,74	no	coding-synonymous,coding-synonymous	RBM47	NM_001098634.1,NM_019027.3	,	4509,1580,236	CC,CG,GG		10.9327,26.6965,16.2213	,	19/594,19/525	40440854	10598,2052	2122	4203	6325	SO:0001819	synonymous_variant	54502	exon4			CTTGGCGGAGGAC	AK000280	CCDS3460.1, CCDS43223.1	4p14	2013-02-12			ENSG00000163694	ENSG00000163694		"""RNA binding motif (RRM) containing"""	30358	protein-coding gene	gene with protein product							Standard	NM_019027		Approved	FLJ20273, NET18	uc003gvc.2	A0AV96	OTTHUMG00000128598	ENST00000381793.2:c.57C>G	4.37:g.40440854G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_001098634	0	0	0	5	5	A0PJK2|B5MED4|Q8NI52|Q8NI53|Q9NXG3	Silent	SNP	ENST00000381793.2	37	CCDS43223.1																																																																																			G|0.794;C|0.206		0.662	RBM47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250456.2	NM_019027	
ZAR1	326340	hgsc.bcm.edu	37	4	48492434	48492434	+	Missense_Mutation	SNP	G	G	C	rs10008444	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr4:48492434G>C	ENST00000327939.4	+	1	166	c.126G>C	c.(124-126)caG>caC	p.Q42H		NM_175619.1	NP_783318.1	Q86SH2	ZAR1_HUMAN	zygote arrest 1	42					multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)				endometrium(1)|large_intestine(4)	5						GCTGGCAGCAGCGCGGCAGGG	0.756													C|||	4938	0.986022	0.9493	0.9957	5008	,	,		9261	1.0		1.0	False		,,,				2504	1.0				p.Q42H		.											.	ZAR1-90	0			c.G126C						.	C	HIS/GLN	2851,89		1381,89,0	2.0	3.0	3.0		126	-0.2	0.0	4	dbSNP_119	3	6474,0		3237,0,0	no	missense	ZAR1	NM_175619.1	24	4618,89,0	CC,CG,GG		0.0,3.0272,0.9454	benign	42/425	48492434	9325,89	1470	3237	4707	SO:0001583	missense	326340	exon1			GCAGCAGCGCGGC	AY193890	CCDS3483.1	4p11	2014-02-20			ENSG00000182223	ENSG00000182223			20436	protein-coding gene	gene with protein product	"""zinc finger, 3CxxC-type 6"""	607520				12539046	Standard	NM_175619		Approved	Z3CXXC6	uc003gyd.3	Q86SH2	OTTHUMG00000102093	ENST00000327939.4:c.126G>C	4.37:g.48492434G>C	ENSP00000329803:p.Gln42His	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	20	20	NM_175619	0	0	0	0	0		Missense_Mutation	SNP	ENST00000327939.4	37	CCDS3483.1	2130	0.9752747252747253	449	0.9126016260162602	359	0.9917127071823204	565	0.9877622377622378	757	0.9986807387862797	C	0.021	-1.426522	0.01117	0.969728	1.0	ENSG00000182223	ENST00000327939	.	.	.	4.09	-0.185	0.13276	.	0.811302	0.10779	N	0.635071	T	0.00012	0.0000	N	0.03608	-0.345	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.22103	-1.0226	8	0.14252	T	0.57	-31.571	6.2995	0.21105	0.0:0.2927:0.4307:0.2766	rs10008444;rs58304706	42	Q86SH2	ZAR1_HUMAN	H	42	.	ENSP00000329803:Q42H	Q	+	3	2	ZAR1	48187191	0.000000	0.05858	0.000000	0.03702	0.070000	0.16714	0.053000	0.14184	-0.405000	0.07599	-0.676000	0.03789	CAG	G|0.025;C|0.975		0.756	ZAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219927.3		
TMPRSS11F	389208	bcgsc.ca	37	4	68928722	68928722	+	Intron	SNP	A	A	G			TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr4:68928722A>G	ENST00000356291.2	-	8	1075				RP11-35D5.1_ENST00000600441.1_RNA|UBA6-AS1_ENST00000500538.2_RNA|UBA6-AS1_ENST00000511571.1_RNA|UBA6-AS1_ENST00000499180.2_RNA	NM_207407.2	NP_997290.2	Q6ZWK6	TM11F_HUMAN	transmembrane protease, serine 11F							extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(4)	39						TACTTTCACTACAAGACATTT	0.433																																					.		.											.	.	0			.						.						131.0	129.0	130.0					4																	68928722		2203	4300	6503	SO:0001627	intron_variant	0	.			TTCACTACAAGAC	AK122625	CCDS3520.1	4q13.2	2010-04-13			ENSG00000198092	ENSG00000198092		"""Serine peptidases / Transmembrane"""	29994	protein-coding gene	gene with protein product							Standard	NM_207407		Approved	FLJ16046	uc003hdt.1	Q6ZWK6	OTTHUMG00000129307	ENST00000356291.2:c.1015+1680T>C	4.37:g.68928722A>G		Somatic	103	0		WXS	Illumina GAIIx	Phase_I	87	4	.	0	0	0	0	0	A8MXX2	RNA	SNP	ENST00000356291.2	37	CCDS3520.1																																																																																			.		0.433	TMPRSS11F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251439.1	NM_207407	
SHROOM3	57619	hgsc.bcm.edu	37	4	77662248	77662248	+	Silent	SNP	G	G	A	rs344142	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr4:77662248G>A	ENST00000296043.6	+	5	3875	c.2922G>A	c.(2920-2922)tcG>tcA	p.S974S		NM_020859.3	NP_065910.3	Q8TF72	SHRM3_HUMAN	shroom family member 3	974	ASD1. {ECO:0000255|PROSITE- ProRule:PRU00637}.				actin cytoskeleton organization (GO:0030036)|apical protein localization (GO:0045176)|cell morphogenesis (GO:0000902)|cellular pigment accumulation (GO:0043482)|columnar/cuboidal epithelial cell development (GO:0002066)|neural tube closure (GO:0001843)|pattern specification process (GO:0007389)|regulation of cell shape (GO:0008360)	adherens junction (GO:0005912)|apical junction complex (GO:0043296)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule (GO:0005874)				NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(29)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	60			Lung(101;0.0903)			CCGAGGCGTCGGCCTCCGCCT	0.776													G|||	2165	0.432308	0.4054	0.4827	5008	,	,		9965	0.2669		0.6044	False		,,,				2504	0.4264				p.S974S		.											.	SHROOM3-93	0			c.G2922A						.	G		1740,1410		550,640,385	2.0	3.0	3.0		2922	0.4	0.0	4	dbSNP_129	3	4503,2047		1663,1177,435	no	coding-synonymous	SHROOM3	NM_020859.3		2213,1817,820	AA,AG,GG		31.2519,44.7619,35.6392		974/1997	77662248	6243,3457	1575	3275	4850	SO:0001819	synonymous_variant	57619	exon5			GGCGTCGGCCTCC	AB055660	CCDS3579.2	4q21.1	2009-11-25			ENSG00000138771	ENSG00000138771			30422	protein-coding gene	gene with protein product		604570				10589677, 16615870	Standard	NM_020859		Approved	ShrmL, SHRM, KIAA1481, APXL3	uc011cbx.2	Q8TF72	OTTHUMG00000157075	ENST00000296043.6:c.2922G>A	4.37:g.77662248G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_020859	0	0	0	2	2	Q5QTQ3|Q6ZRW3|Q96IR9|Q9P247	Silent	SNP	ENST00000296043.6	37	CCDS3579.2																																																																																			G|0.531;A|0.469		0.776	SHROOM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252408.2	NM_020859	
SHROOM3	57619	hgsc.bcm.edu	37	4	77662309	77662309	+	Silent	SNP	C	C	T	rs344143	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr4:77662309C>T	ENST00000296043.6	+	5	3936	c.2983C>T	c.(2983-2985)Ctg>Ttg	p.L995L		NM_020859.3	NP_065910.3	Q8TF72	SHRM3_HUMAN	shroom family member 3	995	ASD1. {ECO:0000255|PROSITE- ProRule:PRU00637}.				actin cytoskeleton organization (GO:0030036)|apical protein localization (GO:0045176)|cell morphogenesis (GO:0000902)|cellular pigment accumulation (GO:0043482)|columnar/cuboidal epithelial cell development (GO:0002066)|neural tube closure (GO:0001843)|pattern specification process (GO:0007389)|regulation of cell shape (GO:0008360)	adherens junction (GO:0005912)|apical junction complex (GO:0043296)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule (GO:0005874)				NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(29)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	60			Lung(101;0.0903)			TGAGGGCGACCTGGCCAGGCC	0.741													C|||	1906	0.380591	0.4115	0.4078	5008	,	,		9710	0.2669		0.4245	False		,,,				2504	0.3916				p.L995L		.											.	SHROOM3-93	0			c.C2983T						.	C		1365,2227		322,721,753	3.0	4.0	4.0		2983	-0.1	0.0	4	dbSNP_79	4	3066,4302		771,1524,1389	no	coding-synonymous	SHROOM3	NM_020859.3		1093,2245,2142	TT,TC,CC		41.6124,38.0011,40.4288		995/1997	77662309	4431,6529	1796	3684	5480	SO:0001819	synonymous_variant	57619	exon5			GGCGACCTGGCCA	AB055660	CCDS3579.2	4q21.1	2009-11-25			ENSG00000138771	ENSG00000138771			30422	protein-coding gene	gene with protein product		604570				10589677, 16615870	Standard	NM_020859		Approved	ShrmL, SHRM, KIAA1481, APXL3	uc011cbx.2	Q8TF72	OTTHUMG00000157075	ENST00000296043.6:c.2983C>T	4.37:g.77662309C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	18	18	NM_020859	0	0	0	2	2	Q5QTQ3|Q6ZRW3|Q96IR9|Q9P247	Silent	SNP	ENST00000296043.6	37	CCDS3579.2																																																																																			C|0.604;T|0.396		0.741	SHROOM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252408.2	NM_020859	
SOWAHB	345079	hgsc.bcm.edu	37	4	77818202	77818202	+	Silent	SNP	T	T	C	rs2645674	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr4:77818202T>C	ENST00000334306.2	-	1	800	c.801A>G	c.(799-801)acA>acG	p.T267T		NM_001029870.1	NP_001025041.1	A6NEL2	SWAHB_HUMAN	sosondowah ankyrin repeat domain family member B	267	Ala-rich.																AAGCCCTGCTTGTCGCAGCCT	0.726													C|||	1670	0.333466	0.4887	0.2392	5008	,	,		13358	0.2292		0.332	False		,,,				2504	0.2996				p.T267T		.											.	.	0			c.A801G						.	C		1258,2610		207,844,883	3.0	5.0	4.0		801	-3.8	0.0	4	dbSNP_100	4	1803,5973		226,1351,2311	no	coding-synonymous	ANKRD56	NM_001029870.1		433,2195,3194	CC,CT,TT		23.1867,32.5233,26.2882		267/794	77818202	3061,8583	1934	3888	5822	SO:0001819	synonymous_variant	345079	exon1			CCTGCTTGTCGCA		CCDS34017.1	4q21.1	2013-01-10	2012-01-12	2012-01-12	ENSG00000186212	ENSG00000186212		"""Ankyrin repeat domain containing"""	32958	protein-coding gene	gene with protein product			"""ankyrin repeat domain 56"""	ANKRD56		22234889	Standard	NM_001029870		Approved		uc003hki.3	A6NEL2	OTTHUMG00000160876	ENST00000334306.2:c.801A>G	4.37:g.77818202T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	15	6	NM_001029870	0	0	0	0	0	B2RP29	Silent	SNP	ENST00000334306.2	37	CCDS34017.1																																																																																			T|0.691;C|0.309		0.726	SOWAHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362762.1	NM_001029870	
GK2	2712	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	80328985	80328985	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr4:80328985C>T	ENST00000358842.3	-	1	387	c.370G>A	c.(370-372)Gag>Aag	p.E124K		NM_033214.2	NP_149991.2	Q01415	GALK2_HUMAN	glycerol kinase 2	0					carbohydrate metabolic process (GO:0005975)|galactose metabolic process (GO:0006012)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|galactokinase activity (GO:0004335)|N-acetylgalactosamine kinase activity (GO:0033858)			autonomic_ganglia(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	39						CTAAGATCCTCAACAGTAGTC	0.433																																					p.E124K		.											.	GK2-94	0			c.G370A						.						137.0	135.0	136.0					4																	80328985		2203	4300	6503	SO:0001583	missense	2712	exon1			GATCCTCAACAGT	BC029820	CCDS3585.1	4q13	2008-02-05	2002-10-03	2002-10-04	ENSG00000196475	ENSG00000196475		"""Glycerol kinases"""	4291	protein-coding gene	gene with protein product		600148	"""glycerol kinase pseudogene 2"""	GKP2		7987308	Standard	NM_033214		Approved	GKTA	uc003hlu.3	Q14410	OTTHUMG00000130199	ENST00000358842.3:c.370G>A	4.37:g.80328985C>T	ENSP00000351706:p.Glu124Lys	Somatic	170	0		WXS	Illumina GAIIx	Phase_I	156	43	NM_033214	0	0	0	0	0	Q7Z4Q4	Missense_Mutation	SNP	ENST00000358842.3	37	CCDS3585.1	.	.	.	.	.	.	.	.	.	.	C	12.13	1.844202	0.32606	.	.	ENSG00000196475	ENST00000358842	T	0.59772	0.24	3.76	3.76	0.43208	Carbohydrate kinase, FGGY, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.52435	0.1734	L	0.31926	0.97	0.80722	D	1	P	0.39480	0.675	P	0.45167	0.472	T	0.54997	-0.8209	10	0.44086	T	0.13	-0.2416	13.8928	0.63750	0.0:1.0:0.0:0.0	.	124	Q14410	GLPK2_HUMAN	K	124	ENSP00000351706:E124K	ENSP00000351706:E124K	E	-	1	0	GK2	80548009	0.986000	0.35501	0.179000	0.23059	0.006000	0.05464	2.957000	0.49137	2.418000	0.82041	0.585000	0.79938	GAG	.		0.433	GK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252517.2	NM_033214	
COQ2	27235	hgsc.bcm.edu	37	4	84205872	84205872	+	Missense_Mutation	SNP	C	C	A	rs6818847	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr4:84205872C>A	ENST00000311469.4	-	1	195	c.196G>T	c.(196-198)Gtg>Ttg	p.V66L	COQ2_ENST00000311461.7_Missense_Mutation_p.V16L|COQ2_ENST00000439031.2_Missense_Mutation_p.V29L	NM_015697.7	NP_056512.5	Q96H96	COQ2_HUMAN	coenzyme Q2 4-hydroxybenzoate polyprenyltransferase	16					cell death (GO:0008219)|glycerol metabolic process (GO:0006071)|isoprenoid biosynthetic process (GO:0008299)|small molecule metabolic process (GO:0044281)|ubiquinone biosynthetic process (GO:0006744)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	4-hydroxybenzoate decaprenyltransferase activity (GO:0002083)|4-hydroxybenzoate nonaprenyltransferase activity (GO:0047293)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|ovary(1)|skin(1)|stomach(1)	8		Hepatocellular(203;0.114)				GCCAGTGCCACAGCCCGCAGG	0.766													C|||	3254	0.64976	0.3775	0.647	5008	,	,		9689	0.8879		0.7227	False		,,,				2504	0.6994				p.V66L		.											.	COQ2-92	0			c.G196T						.	C	LEU/VAL	1570,1290		474,622,334	2.0	3.0	3.0		196	-2.7	0.0	4	dbSNP_116	3	4779,1627		1892,995,316	no	missense	COQ2	NM_015697.7	32	2366,1617,650	AA,AC,CC		25.3981,45.1049,31.4807	benign	66/422	84205872	6349,2917	1430	3203	4633	SO:0001583	missense	27235	exon1			GTGCCACAGCCCG		CCDS47090.1, CCDS47090.2	4q21.23	2013-05-23	2013-05-23				2.5.1.39		25223	protein-coding gene	gene with protein product	"""4-hydroxybenzoate polyprenyltransferase"""	609825	"""coenzyme Q2 homolog, prenyltransferase (yeast)"""			15153069, 17332895	Standard	NM_015697		Approved	CL640, FLJ26072	uc003hog.3	Q96H96		ENST00000311469.4:c.196G>T	4.37:g.84205872C>A	ENSP00000310873:p.Val66Leu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	13	13	NM_015697	0	0	0	0	0	O95331|Q1JQ78|Q684R2	Missense_Mutation	SNP	ENST00000311469.4	37	CCDS47090.2	1475	0.6753663003663004	219	0.4451219512195122	244	0.6740331491712708	490	0.8566433566433567	522	0.6886543535620053	C	5.506	0.278257	0.10403	0.548951	0.746019	ENSG00000173085	ENST00000311469;ENST00000439031;ENST00000311461	T;T;T	0.77098	-1.07;-1.03;-1.0	3.59	-2.74	0.05932	.	2.205390	0.02429	N	0.083323	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.33445	-0.9868	8	0.07813	T	0.8	-2.056	4.7989	0.13287	0.0:0.2608:0.3311:0.4081	rs6818847;rs17850399;rs17858544	16	E2QRG7	.	L	66;29;16	ENSP00000310873:V66L;ENSP00000409275:V29L;ENSP00000311835:V16L	ENSP00000311835:V16L	V	-	1	0	COQ2	84424896	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	-1.921000	0.01569	-0.746000	0.04766	0.467000	0.42956	GTG	C|0.324;A|0.676		0.766	COQ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363027.3	NM_015697	
UNC5C	8633	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	96163681	96163681	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr4:96163681C>T	ENST00000453304.1	-	7	1355	c.1007G>A	c.(1006-1008)cGc>cAc	p.R336H	UNC5C_ENST00000506749.1_Missense_Mutation_p.R336H	NM_003728.3	NP_003719.3	O95185	UNC5C_HUMAN	unc-5 homolog C (C. elegans)	336	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|brain development (GO:0007420)|positive regulation of apoptotic process (GO:0043065)|regulation of cell migration (GO:0030334)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(14)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	55		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)		CTCCCTCCTGCGCCAGTGGGT	0.592																																					p.R336H		.											.	UNC5C-94	0			c.G1007A						.						42.0	35.0	37.0					4																	96163681		2203	4300	6503	SO:0001583	missense	8633	exon7			CTCCTGCGCCAGT	AF055634	CCDS3643.1	4q21-q23	2013-01-11	2001-11-28		ENSG00000182168	ENSG00000182168		"""Immunoglobulin superfamily / I-set domain containing"""	12569	protein-coding gene	gene with protein product		603610	"""unc5 (C.elegans homolog) c"""			9126742, 9782087	Standard	NM_003728		Approved		uc003hto.3	O95185	OTTHUMG00000130989	ENST00000453304.1:c.1007G>A	4.37:g.96163681C>T	ENSP00000406022:p.Arg336His	Somatic	130	0		WXS	Illumina GAIIx	Phase_I	141	89	NM_003728	0	0	0	1	1	Q8IUT0	Missense_Mutation	SNP	ENST00000453304.1	37	CCDS3643.1	.	.	.	.	.	.	.	.	.	.	C	35	5.539665	0.96474	.	.	ENSG00000182168	ENST00000453304;ENST00000331502;ENST00000513796;ENST00000506749	T;T;T	0.78707	-1.2;-1.2;-1.2	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	D	0.92492	0.7616	H	0.96833	3.89	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.994;0.998;0.998	D	0.94527	0.7732	10	0.87932	D	0	.	19.0716	0.93140	0.0:1.0:0.0:0.0	.	336;336;336	A8K385;E0CX15;O95185	.;.;UNC5C_HUMAN	H	336;295;336;336	ENSP00000406022:R336H;ENSP00000426924:R336H;ENSP00000426153:R336H	ENSP00000328673:R295H	R	-	2	0	UNC5C	96382704	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.536000	0.82023	2.805000	0.96524	0.655000	0.94253	CGC	.		0.592	UNC5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253607.1	NM_003728	
FAT4	79633	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	126367514	126367514	+	Silent	SNP	C	C	T	rs147010455	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr4:126367514C>T	ENST00000394329.3	+	8	7273	c.7260C>T	c.(7258-7260)agC>agT	p.S2420S	FAT4_ENST00000335110.5_Silent_p.S718S	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	2420	Cadherin 23. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.S2420S(2)		NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						TCATCACCAGCGCATTGTTAG	0.443													C|||	2	0.000399361	0.0	0.0	5008	,	,		16734	0.002		0.0	False		,,,				2504	0.0				p.S2420S		.											.	FAT4-108	2	Substitution - coding silent(2)	large_intestine(2)	c.C7260T						.						121.0	119.0	120.0					4																	126367514		2203	4300	6503	SO:0001819	synonymous_variant	79633	exon8			CACCAGCGCATTG	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.7260C>T	4.37:g.126367514C>T		Somatic	148	0		WXS	Illumina GAIIx	Phase_I	132	30	NM_024582	0	0	0	0	0	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Silent	SNP	ENST00000394329.3	37	CCDS3732.3																																																																																			C|0.999;T|0.001		0.443	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
LRBA	987	broad.mit.edu	37	4	151769988	151769988	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr4:151769988G>A	ENST00000357115.3	-	26	4564	c.4321C>T	c.(4321-4323)Cgg>Tgg	p.R1441W	LRBA_ENST00000510413.1_Missense_Mutation_p.R1441W|LRBA_ENST00000535741.1_Missense_Mutation_p.R1441W|LRBA_ENST00000507224.1_Missense_Mutation_p.R1441W	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing	1441						cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					AGACACTGCCGCAAAATTCCT	0.378																																					p.R1441W		.											.	LRBA-157	0			c.C4321T						.						91.0	96.0	94.0					4																	151769988		2203	4300	6503	SO:0001583	missense	987	exon26			ACTGCCGCAAAAT	AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.4321C>T	4.37:g.151769988G>A	ENSP00000349629:p.Arg1441Trp	Somatic	118	0		WXS	Illumina GAIIx	Phase_I	143	3	NM_006726	0	0	2	2	0	Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	Missense_Mutation	SNP	ENST00000357115.3	37	CCDS3773.1	.	.	.	.	.	.	.	.	.	.	G	19.73	3.882436	0.72294	.	.	ENSG00000198589	ENST00000535741;ENST00000510413;ENST00000357115;ENST00000507224;ENST00000502839	T;T;T;T	0.74421	-0.4;-0.25;-0.4;-0.84	5.9	4.0	0.46444	.	0.000000	0.64402	D	0.000001	D	0.86527	0.5954	M	0.85373	2.75	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.88123	0.2833	10	0.87932	D	0	.	14.131	0.65253	0.0:0.0:0.6678:0.3322	.	1441;1441	P50851;P50851-2	LRBA_HUMAN;.	W	1441;1441;1441;1441;18	ENSP00000446299:R1441W;ENSP00000421552:R1441W;ENSP00000349629:R1441W;ENSP00000422180:R1441W	ENSP00000349629:R1441W	R	-	1	2	LRBA	151989438	0.998000	0.40836	1.000000	0.80357	0.990000	0.78478	2.307000	0.43682	2.808000	0.96608	0.650000	0.86243	CGG	.		0.378	LRBA-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364939.1		
TLR2	7097	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	154624343	154624343	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr4:154624343C>G	ENST00000260010.6	+	1	1692	c.284C>G	c.(283-285)tCt>tGt	p.S95C		NM_003264.3	NP_003255.2	O60603	TLR2_HUMAN	toll-like receptor 2	95					apoptotic process (GO:0006915)|cell surface pattern recognition receptor signaling pathway (GO:0002752)|cellular response to bacterial lipopeptide (GO:0071221)|cellular response to diacyl bacterial lipopeptide (GO:0071726)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to peptidoglycan (GO:0071224)|cellular response to triacyl bacterial lipopeptide (GO:0071727)|central nervous system myelin formation (GO:0032289)|chloramphenicol transport (GO:0042892)|defense response to Gram-positive bacterium (GO:0050830)|detection of diacyl bacterial lipopeptide (GO:0042496)|detection of triacyl bacterial lipopeptide (GO:0042495)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|induction by symbiont of defense-related host nitric oxide production (GO:0052063)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|leukotriene metabolic process (GO:0006691)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of cell proliferation (GO:0008285)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of interleukin-17 production (GO:0032700)|nitric oxide metabolic process (GO:0046209)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of chemokine production (GO:0032722)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-18 production (GO:0032741)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of Wnt signaling pathway (GO:0030177)|response to fatty acid (GO:0070542)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|response to molecule of fungal origin (GO:0002238)|response to progesterone (GO:0032570)|response to toxic substance (GO:0009636)|signal transduction (GO:0007165)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cell body (GO:0044297)|cell projection (GO:0042995)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|Toll-like receptor 1-Toll-like receptor 2 protein complex (GO:0035354)|Toll-like receptor 2-Toll-like receptor 6 protein complex (GO:0035355)	diacyl lipopeptide binding (GO:0042498)|lipopolysaccharide receptor activity (GO:0001875)|lipoteichoic acid binding (GO:0070891)|peptidoglycan binding (GO:0042834)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)|signaling pattern recognition receptor activity (GO:0008329)|transmembrane signaling receptor activity (GO:0004888)|triacyl lipopeptide binding (GO:0042497)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	29	all_hematologic(180;0.093)	Renal(120;0.117)			OspA lipoprotein(DB00045)	GAGGAAGATTCTTTTTCTTCC	0.403																																					p.S95C		.											.	TLR2-523	0			c.C284G						.						71.0	75.0	74.0					4																	154624343		2203	4300	6503	SO:0001583	missense	7097	exon3			AAGATTCTTTTTC	U88878	CCDS3784.1	4q32	2008-02-05				ENSG00000137462		"""CD molecules"""	11848	protein-coding gene	gene with protein product		603028				9435236	Standard	XM_005263193		Approved	TIL4, CD282	uc003inq.3	O60603		ENST00000260010.6:c.284C>G	4.37:g.154624343C>G	ENSP00000260010:p.Ser95Cys	Somatic	168	0		WXS	Illumina GAIIx	Phase_I	154	54	NM_003264	0	0	0	0	0	B3Y612|D1CS45|D1CS48|D1CS49|O15454|Q8NI00	Missense_Mutation	SNP	ENST00000260010.6	37	CCDS3784.1	.	.	.	.	.	.	.	.	.	.	C	16.60	3.167653	0.57476	.	.	ENSG00000137462	ENST00000260010	T	0.58506	0.33	6.03	6.03	0.97812	.	0.198412	0.44483	D	0.000442	T	0.75057	0.3798	L	0.58669	1.825	0.36855	D	0.8881	D	0.89917	1.0	D	0.75484	0.986	T	0.77075	-0.2722	10	0.62326	D	0.03	.	20.5568	0.99304	0.0:1.0:0.0:0.0	.	95	O60603	TLR2_HUMAN	C	95	ENSP00000260010:S95C	ENSP00000260010:S95C	S	+	2	0	TLR2	154843793	0.795000	0.28851	0.097000	0.21041	0.092000	0.18411	6.956000	0.76013	2.861000	0.98227	0.655000	0.94253	TCT	.		0.403	TLR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365205.1		
MAP9	79884	ucsc.edu;bcgsc.ca	37	4	156273768	156273768	+	Missense_Mutation	SNP	T	T	C	rs2305050	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr4:156273768T>C	ENST00000311277.4	-	13	2064	c.1801A>G	c.(1801-1803)Aat>Gat	p.N601D	AC097467.2_ENST00000593387.2_RNA|AC097467.2_ENST00000597939.1_RNA|AC097467.2_ENST00000599555.2_RNA|AC097467.2_ENST00000609716.1_RNA|AC097467.2_ENST00000609486.1_RNA|AC097467.2_ENST00000598252.1_RNA|AC097467.2_ENST00000608463.1_RNA|AC097467.2_ENST00000608092.1_RNA|AC097467.2_ENST00000608406.1_RNA|AC097467.2_ENST00000610249.1_RNA|AC097467.2_ENST00000595229.1_RNA|AC097467.2_ENST00000608762.1_RNA|AC097467.2_ENST00000608544.1_RNA|MAP9_ENST00000515654.1_Missense_Mutation_p.N577D|AC097467.2_ENST00000609254.1_RNA|AC097467.2_ENST00000417474.1_RNA|AC097467.2_ENST00000601977.1_RNA	NM_001039580.1	NP_001034669.1	Q49MG5	MAP9_HUMAN	microtubule-associated protein 9	601			N -> D (in dbSNP:rs2305050). {ECO:0000269|PubMed:17974005}.		cytokinesis (GO:0000910)|regulation of mitosis (GO:0007088)|spindle assembly involved in mitosis (GO:0090307)	astral microtubule (GO:0000235)|mitotic spindle midzone (GO:1990023)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	26	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.143)		TCATATTCATTAATAGCTTGT	0.294													C|||	3276	0.654153	0.7844	0.5346	5008	,	,		16630	0.7946		0.5557	False		,,,				2504	0.5194				p.N601D		.											.	MAP9-91	0			c.A1801G						.	C	ASP/ASN	3191,1213	419.6+/-338.7	1166,859,177	181.0	183.0	182.0		1801	0.3	0.8	4	dbSNP_100	182	4536,4064	556.5+/-386.9	1205,2126,969	yes	missense	MAP9	NM_001039580.1	23	2371,2985,1146	CC,CT,TT		47.2558,27.5431,40.5798	benign	601/648	156273768	7727,5277	2202	4300	6502	SO:0001583	missense	79884	exon13			ATTCATTAATAGC	AK024812	CCDS35493.1	4q32.1	2008-02-05			ENSG00000164114	ENSG00000164114			26118	protein-coding gene	gene with protein product	"""aster-associated protein"""	610070				16049101	Standard	XM_006714306		Approved	ASAP, FLJ21159	uc003ios.3	Q49MG5	OTTHUMG00000133628	ENST00000311277.4:c.1801A>G	4.37:g.156273768T>C	ENSP00000310593:p.Asn601Asp	Somatic	32	0		WXS	Illumina GAIIx	Phase_I	42	5	NM_001039580	0	0	2	2	0	Q4W5I7|Q68DU1|Q9H781|Q9H7B6	Missense_Mutation	SNP	ENST00000311277.4	37	CCDS35493.1	1466	0.6712454212454212	384	0.7804878048780488	193	0.5331491712707183	456	0.7972027972027972	433	0.5712401055408971	C	2.934	-0.220339	0.06061	0.724569	0.527442	ENSG00000164114	ENST00000311277;ENST00000515654	T;T	0.16457	2.36;2.34	5.15	0.287	0.15714	.	0.823090	0.11196	N	0.589371	T	0.00012	0.0000	N	0.02539	-0.55	0.09310	P	0.999999725776	B	0.02656	0.0	B	0.04013	0.001	T	0.25433	-1.0132	9	0.07325	T	0.83	-0.0073	9.4433	0.38681	0.0:0.5786:0.0:0.4214	rs2305050;rs13127917;rs17377512;rs59632960;rs2305050	601	Q49MG5	MAP9_HUMAN	D	601;577	ENSP00000310593:N601D;ENSP00000427402:N577D	ENSP00000310593:N601D	N	-	1	0	MAP9	156493218	0.002000	0.14202	0.818000	0.32626	0.961000	0.63080	0.139000	0.16036	-0.088000	0.12506	-1.427000	0.01099	AAT	T|0.372;C|0.628		0.294	MAP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257771.3	NM_001039580	
ADAMTS16	170690	hgsc.bcm.edu	37	5	5140632	5140632	+	Silent	SNP	T	T	C	rs270208	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr5:5140632T>C	ENST00000274181.7	+	1	190	c.52T>C	c.(52-54)Ttg>Ctg	p.L18L	CTD-2297D10.1_ENST00000514848.1_RNA|ADAMTS16_ENST00000511368.1_Silent_p.L18L|CTD-2297D10.2_ENST00000512155.1_RNA	NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	18					branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						GTGGATGCTGTTGGCGCAGGT	0.766													C|||	3127	0.624401	0.6747	0.6571	5008	,	,		8861	0.8065		0.501	False		,,,				2504	0.4724				p.L18L		.											.	ADAMTS16-275	0			c.T52C						.	C		2046,874		775,496,189	2.0	5.0	4.0		52	1.2	1.0	5	dbSNP_79	4	3653,3047		1121,1411,818	no	coding-synonymous	ADAMTS16	NM_139056.2		1896,1907,1007	CC,CT,TT		45.4776,29.9315,40.7588		18/1225	5140632	5699,3921	1460	3350	4810	SO:0001819	synonymous_variant	170690	exon1			ATGCTGTTGGCGC	AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.52T>C	5.37:g.5140632T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	6	NM_139056	0	0	0	0	0	C6G490|Q8IVE2	Silent	SNP	ENST00000274181.7	37	CCDS43299.1																																																																																			T|0.352;C|0.648		0.766	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365657.1	NM_139056	
MYO10	4651	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	16701501	16701501	+	Silent	SNP	G	G	A	rs370829048		TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr5:16701501G>A	ENST00000513610.1	-	25	3457	c.3003C>T	c.(3001-3003)gaC>gaT	p.D1001D	MYO10_ENST00000515803.1_Silent_p.D340D|MYO10_ENST00000274203.9_Silent_p.D358D|MYO10_ENST00000505695.1_Silent_p.D340D|MYO10_ENST00000427430.2_Silent_p.D358D|MYO10_ENST00000512061.1_5'Flank	NM_012334.2	NP_036466.2	Q9HD67	MYO10_HUMAN	myosin X	1001					ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cytoskeleton-dependent intracellular transport (GO:0030705)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|regulation of cell shape (GO:0008360)|regulation of filopodium assembly (GO:0051489)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|plus-end directed microfilament motor activity (GO:0060002)|spectrin binding (GO:0030507)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|lung(28)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	86						TGAAGGCGTCGTCGTCGGCTT	0.622																																					p.D1001D		.											.	MYO10-3	0			c.C3003T						.	G		1,4303		0,1,2151	39.0	43.0	42.0		3003	-0.2	0.7	5		42	0,8490		0,0,4245	no	coding-synonymous	MYO10	NM_012334.2		0,1,6396	AA,AG,GG		0.0,0.0232,0.0078		1001/2059	16701501	1,12793	2152	4245	6397	SO:0001819	synonymous_variant	4651	exon25			GGCGTCGTCGTCG	AF247457	CCDS54834.1	5p15.1-p14.3	2013-01-10				ENSG00000145555		"""Myosins / Myosin superfamily : Class X"", ""Pleckstrin homology (PH) domain containing"""	7593	protein-coding gene	gene with protein product		601481				8884266	Standard	NM_012334		Approved	KIAA0799	uc003jft.4	Q9HD67		ENST00000513610.1:c.3003C>T	5.37:g.16701501G>A		Somatic	91	0		WXS	Illumina GAIIx	Phase_I	135	53	NM_012334	0	0	0	0	0	A7E2D1|O94893|Q8IVX5|Q9NYM7|Q9P110|Q9P111|Q9UHF6	Silent	SNP	ENST00000513610.1	37	CCDS54834.1																																																																																			.		0.622	MYO10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366167.1	NM_012334	
SLC1A3	6507	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	36671233	36671233	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr5:36671233T>C	ENST00000265113.4	+	4	898	c.422T>C	c.(421-423)aTt>aCt	p.I141T	SLC1A3_ENST00000381918.3_Missense_Mutation_p.I141T|CTD-2353F22.1_ENST00000510740.1_RNA	NM_004172.4	NP_004163.3	P43003	EAA1_HUMAN	solute carrier family 1 (glial high affinity glutamate transporter), member 3	141					auditory behavior (GO:0031223)|cell morphogenesis involved in neuron differentiation (GO:0048667)|cranial nerve development (GO:0021545)|D-aspartate import (GO:0070779)|gamma-aminobutyric acid biosynthetic process (GO:0009449)|glutamate biosynthetic process (GO:0006537)|ion transport (GO:0006811)|L-glutamate import (GO:0051938)|neuromuscular process controlling balance (GO:0050885)|neurotransmitter uptake (GO:0001504)|positive regulation of synaptic transmission (GO:0050806)|response to antibiotic (GO:0046677)|response to drug (GO:0042493)|response to light stimulus (GO:0009416)|response to wounding (GO:0009611)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell projection (GO:0042995)|cell surface (GO:0009986)|fibril (GO:0043205)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	glutamate binding (GO:0016595)|high-affinity glutamate transmembrane transporter activity (GO:0005314)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(23)|skin(1)	41	all_lung(31;0.000245)		Epithelial(62;0.0444)|Lung(74;0.111)|all cancers(62;0.128)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			GGCATAATCATTGTCATCATC	0.468																																					p.I141T		.											.	SLC1A3-90	0			c.T422C						.						149.0	126.0	134.0					5																	36671233		2203	4300	6503	SO:0001583	missense	6507	exon4			TAATCATTGTCAT		CCDS3919.1, CCDS54844.1	5p13	2013-05-22			ENSG00000079215	ENSG00000079215		"""Solute carriers"""	10941	protein-coding gene	gene with protein product	"""glutamate transporter variant EAAT1ex9skip"""	600111				7521911, 7698014	Standard	NM_004172		Approved	EAAT1, GLAST, EA6	uc003jkj.4	P43003	OTTHUMG00000090793	ENST00000265113.4:c.422T>C	5.37:g.36671233T>C	ENSP00000265113:p.Ile141Thr	Somatic	224	0		WXS	Illumina GAIIx	Phase_I	347	135	NM_004172	0	0	3	10	7	B2R5T3|Q4JCQ8	Missense_Mutation	SNP	ENST00000265113.4	37	CCDS3919.1	.	.	.	.	.	.	.	.	.	.	T	17.71	3.457035	0.63401	.	.	ENSG00000079215	ENST00000265113;ENST00000427100;ENST00000381918	T;T	0.59502	0.26;0.26	4.7	4.7	0.59300	.	0.256810	0.44285	D	0.000473	T	0.47229	0.1434	L	0.31578	0.945	0.54753	D	0.999985	B;B	0.32302	0.019;0.363	B;B	0.32022	0.044;0.139	T	0.53947	-0.8366	10	0.87932	D	0	-11.0049	14.3594	0.66761	0.0:0.0:0.0:1.0	.	141;141	Q4JCQ8;P43003	.;EAA1_HUMAN	T	141;89;141	ENSP00000265113:I141T;ENSP00000371343:I141T	ENSP00000265113:I141T	I	+	2	0	SLC1A3	36706990	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.858000	0.86971	1.962000	0.57031	0.533000	0.62120	ATT	.		0.468	SLC1A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207579.2	NM_004172	
SNX18	112574	broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	53815125	53815125	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr5:53815125C>T	ENST00000326277.3	+	1	1533	c.1343C>T	c.(1342-1344)aCg>aTg	p.T448M	SNX18_ENST00000343017.6_Missense_Mutation_p.T448M|SNX18_ENST00000381410.4_Missense_Mutation_p.T448M	NM_052870.2	NP_443102.2	Q96RF0	SNX18_HUMAN	sorting nexin 18	448	BAR.				cleavage furrow formation (GO:0036089)|endocytosis (GO:0006897)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|positive regulation of GTPase activity (GO:0043547)	cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			endometrium(3)|kidney(1)|large_intestine(3)|lung(6)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)	18		Lung NSC(810;3.46e-05)|Breast(144;0.102)				CTCAACCACACGGCCAACGAG	0.617																																					p.T448M		.											.	SNX18-226	0			c.C1343T						.						55.0	56.0	56.0					5																	53815125		2203	4300	6503	SO:0001583	missense	112574	exon1			ACCACACGGCCAA	AF395536	CCDS3962.1, CCDS43317.1, CCDS54851.1	5q11.2	2010-05-12	2008-03-11	2008-03-11	ENSG00000178996	ENSG00000178996		"""Sorting nexins"""	19245	protein-coding gene	gene with protein product			"""sorting nexin associated golgi protein 1"""	SNAG1		16782399, 17761170	Standard	NM_052870		Approved	SH3PX2, SH3PXD3B	uc003jpi.4	Q96RF0	OTTHUMG00000096994	ENST00000326277.3:c.1343C>T	5.37:g.53815125C>T	ENSP00000317332:p.Thr448Met	Somatic	265	2		WXS	Illumina GAIIx	Phase_I	482	69	NM_052870	0	0	21	23	2	B4E2B3|H7BXX3|Q05BB3|Q0VG02	Missense_Mutation	SNP	ENST00000326277.3	37	CCDS3962.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.037328	0.75617	.	.	ENSG00000178996	ENST00000343017;ENST00000381410;ENST00000326277	T;T;T	0.15017	2.65;2.46;2.83	5.13	5.13	0.70059	Sorting nexin protein, WASP-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.41994	0.1183	L	0.61036	1.89	0.80722	D	1	D;P	0.89917	1.0;0.946	D;P	0.91635	0.999;0.519	T	0.22312	-1.0220	10	0.72032	D	0.01	-17.8898	18.7746	0.91907	0.0:1.0:0.0:0.0	.	448;448	Q96RF0;Q96RF0-2	SNX18_HUMAN;.	M	448	ENSP00000342276:T448M;ENSP00000370817:T448M;ENSP00000317332:T448M	ENSP00000317332:T448M	T	+	2	0	SNX18	53850882	1.000000	0.71417	0.961000	0.40146	0.841000	0.47740	4.814000	0.62627	2.665000	0.90641	0.561000	0.74099	ACG	.		0.617	SNX18-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000214072.2		
SV2C	22987	broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	75594617	75594617	+	Splice_Site	SNP	A	A	G			TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr5:75594617A>G	ENST00000502798.2	+	10	1944		c.e10-1		RP11-466P24.6_ENST00000502589.1_RNA|SV2C_ENST00000322285.7_Splice_Site	NM_014979.1	NP_055794.1	Q496J9	SV2C_HUMAN	synaptic vesicle glycoprotein 2C						neurotransmitter transport (GO:0006836)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	transmembrane transporter activity (GO:0022857)			NS(1)|breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		all_lung(232;0.007)|Lung NSC(167;0.0148)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;1.16e-50)|all cancers(79;7.25e-40)		TGTGTTGGGCAGATTCATAGG	0.378																																					.		.											.	SV2C-91	0			c.1503-2A>G						.						197.0	179.0	184.0					5																	75594617		1850	4086	5936	SO:0001630	splice_region_variant	22987	exon10			TTGGGCAGATTCA	AB028977	CCDS43331.1, CCDS75261.1	5q13	2008-02-05			ENSG00000122012	ENSG00000122012			30670	protein-coding gene	gene with protein product		610291				10470851, 9801366	Standard	XM_005248470		Approved		uc003kei.1	Q496J9	OTTHUMG00000162384	ENST00000502798.2:c.1503-1A>G	5.37:g.75594617A>G		Somatic	109	1		WXS	Illumina GAIIx	Phase_I	131	50	NM_014979	0	0	0	0	0	Q496K1|Q9UPU8	Splice_Site	SNP	ENST00000502798.2	37	CCDS43331.1	.	.	.	.	.	.	.	.	.	.	A	14.69	2.609958	0.46527	.	.	ENSG00000122012	ENST00000502798;ENST00000322285	.	.	.	4.87	4.87	0.63330	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.7595	0.69596	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SV2C	75630373	1.000000	0.71417	0.891000	0.34965	0.409000	0.31022	9.185000	0.94900	1.944000	0.56390	0.528000	0.53228	.	.		0.378	SV2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368700.4		Intron
HSPA9	3313	broad.mit.edu	37	5	137909456	137909456	+	Missense_Mutation	SNP	G	G	T	rs201580482		TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr5:137909456G>T	ENST00000297185.3	-	3	349	c.224C>A	c.(223-225)gCa>gAa	p.A75E		NM_004134.6	NP_004125.3	P38646	GRP75_HUMAN	heat shock 70kDa protein 9 (mortalin)	75					cellular protein metabolic process (GO:0044267)|negative regulation of apoptotic process (GO:0043066)|protein export from nucleus (GO:0006611)|protein folding (GO:0006457)|protein targeting to mitochondrion (GO:0006626)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			breast(2)|endometrium(1)|kidney(4)|large_intestine(8)|lung(12)|upper_aerodigestive_tract(1)	28			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			GCTCACCTTTGCTTGTTTACC	0.403																																					p.A75E		.											.	HSPA9-226	0			c.C224A						.						87.0	75.0	79.0					5																	137909456		2203	4300	6503	SO:0001583	missense	3313	exon3			ACCTTTGCTTGTT	L11066	CCDS4208.1	5q31.1	2011-09-02	2006-10-31	2006-10-31	ENSG00000113013	ENSG00000113013		"""Heat shock proteins / HSP70"""	5244	protein-coding gene	gene with protein product		600548	"""heat shock 70kDa protein 9B (mortalin-2)"""	HSPA9B		7684501	Standard	NM_004134		Approved	GRP75, PBP74, mot-2, mthsp75	uc003ldf.3	P38646	OTTHUMG00000129206	ENST00000297185.3:c.224C>A	5.37:g.137909456G>T	ENSP00000297185:p.Ala75Glu	Somatic	92	1		WXS	Illumina GAIIx	Phase_I	57	5	NM_004134	0	0	0	0	0	B2RCM1|P30036|P31932|Q1HB43|Q53H23|Q6GU03|Q9BWB7|Q9UC56	Missense_Mutation	SNP	ENST00000297185.3	37	CCDS4208.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	34|34	5.296376|5.296376	0.95574|0.95574	.|.	.|.	ENSG00000113013|ENSG00000113013	ENST00000297185;ENST00000540484;ENST00000504810;ENST00000507886|ENST00000541333	T;T;T|.	0.18174|.	2.23;2.23;3.71|.	5.32|5.32	5.32|5.32	0.75619|0.75619	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.88544|0.88544	0.6465|0.6465	H|H	0.96604|0.96604	3.85|3.85	0.80722|0.80722	D|D	1|1	D|.	0.60575|.	0.988|.	D|.	0.66979|.	0.948|.	D|D	0.92122|0.92122	0.5705|0.5705	10|6	0.87932|0.87932	D|D	0|0	-13.7707|-13.7707	18.9603|18.9603	0.92676|0.92676	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	75|.	P38646|.	GRP75_HUMAN|.	E|K	75;61;6;6|45	ENSP00000297185:A75E;ENSP00000425598:A6E;ENSP00000423098:A6E|.	ENSP00000297185:A75E|ENSP00000438817:Q45K	A|Q	-|-	2|1	0|0	HSPA9|HSPA9	137937355|137937355	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.984000|0.984000	0.73092|0.73092	9.837000|9.837000	0.99465|0.99465	2.649000|2.649000	0.89929|0.89929	0.650000|0.650000	0.86243|0.86243	GCA|CAA	G|0.999;C|0.001		0.403	HSPA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251285.1	NM_004134	
PCDHB7	56129	broad.mit.edu	37	5	140553994	140553994	+	Silent	SNP	G	G	T	rs374392843		TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr5:140553994G>T	ENST00000231137.3	+	1	1752	c.1578G>T	c.(1576-1578)gcG>gcT	p.A526A		NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	526	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A526A(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCCTGCAGGCGTTCGAGTTCC	0.706													g|||	1	0.000199681	0.0	0.0	5008	,	,		16269	0.0		0.001	False		,,,				2504	0.0				p.A526A		.											.	PCDHB7-95	1	Substitution - coding silent(1)	lung(1)	c.G1578T						.						62.0	68.0	66.0					5																	140553994		2203	4300	6503	SO:0001819	synonymous_variant	56129	exon1			GCAGGCGTTCGAG	AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.1578G>T	5.37:g.140553994G>T		Somatic	79	0		WXS	Illumina GAIIx	Phase_I	268	8	NM_018940	0	0	0	2	2	A1L3Y8	Silent	SNP	ENST00000231137.3	37	CCDS4249.1																																																																																			.		0.706	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251803.2	NM_018940	
B4GALT7	11285	hgsc.bcm.edu	37	5	177036622	177036622	+	Missense_Mutation	SNP	G	G	A	rs145082497	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr5:177036622G>A	ENST00000029410.5	+	6	1021	c.910G>A	c.(910-912)Ggg>Agg	p.G304R	RP11-1277A3.1_ENST00000499900.2_RNA	NM_007255.2	NP_009186.1	Q9UBV7	B4GT7_HUMAN	xylosylprotein beta 1,4-galactosyltransferase, polypeptide 7	304					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|chondroitin sulfate metabolic process (GO:0030204)|extracellular fibril organization (GO:0043206)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|negative regulation of fibroblast proliferation (GO:0048147)|protein N-linked glycosylation (GO:0006487)|proteoglycan metabolic process (GO:0006029)|small molecule metabolic process (GO:0044281)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|galactosyltransferase activity (GO:0008378)|manganese ion binding (GO:0030145)|xylosylprotein 4-beta-galactosyltransferase activity (GO:0046525)			endometrium(2)|large_intestine(1)|lung(1)|pancreas(1)|skin(1)|urinary_tract(1)	7	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GTCTGTGGGCGGGGCCCCCTG	0.592																																					p.G304R		.											.	B4GALT7-91	0			c.G910A						.	G	ARG/GLY	5,4401		0,5,2198	77.0	74.0	75.0		910	5.2	1.0	5	dbSNP_134	75	0,8600		0,0,4300	yes	missense	B4GALT7	NM_007255.2	125	0,5,6498	AA,AG,GG		0.0,0.1135,0.0384	possibly-damaging	304/328	177036622	5,13001	2203	4300	6503	SO:0001583	missense	11285	exon6			GTGGGCGGGGCCC	AB028600	CCDS4429.1	5q35.1-q35.3	2013-02-19	2012-07-18		ENSG00000027847	ENSG00000027847		"""Beta 4-glycosyltransferases"""	930	protein-coding gene	gene with protein product	"""galactosyltransferase I"""	604327				10438455, 10473568	Standard	NM_007255		Approved	XGALT-1, beta4Gal-T7	uc003mhy.3	Q9UBV7	OTTHUMG00000130851	ENST00000029410.5:c.910G>A	5.37:g.177036622G>A	ENSP00000029410:p.Gly304Arg	Somatic	168	0		WXS	Illumina GAIIx	Phase_I	558	37	NM_007255	0	0	110	110	0	B3KN39|Q9UHN2	Missense_Mutation	SNP	ENST00000029410.5	37	CCDS4429.1	.	.	.	.	.	.	.	.	.	.	.	25.7	4.661961	0.88251	0.001135	0.0	ENSG00000027847	ENST00000029410;ENST00000541139	T	0.72282	-0.64	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	T	0.76716	0.4026	M	0.88031	2.925	0.80722	D	1	D	0.57571	0.98	P	0.44422	0.449	T	0.78398	-0.2219	10	0.24483	T	0.36	-36.738	16.596	0.84796	0.0:0.0:1.0:0.0	.	304	Q9UBV7	B4GT7_HUMAN	R	304;190	ENSP00000029410:G304R	ENSP00000029410:G304R	G	+	1	0	B4GALT7	176969228	1.000000	0.71417	0.999000	0.59377	0.925000	0.55904	5.905000	0.69893	2.586000	0.87340	0.561000	0.74099	GGG	G|0.999;A|0.001		0.592	B4GALT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253421.1	NM_007255	
BTNL9	153579	hgsc.bcm.edu	37	5	180486404	180486404	+	Missense_Mutation	SNP	C	C	T	rs186444058	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr5:180486404C>T	ENST00000327705.9	+	11	1381	c.1150C>T	c.(1150-1152)Cac>Tac	p.H384Y	BTNL9_ENST00000376842.3_Missense_Mutation_p.H385Y	NM_152547.4	NP_689760.2	Q6UXG8	BTNL9_HUMAN	butyrophilin-like 9	384	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|kidney(4)|large_intestine(1)|lung(10)|ovary(1)	19	all_cancers(89;2.45e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.00211)|all_lung(126;0.00371)|Breast(19;0.114)	all_cancers(40;0.0801)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.191)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CGCCGGCCGCCACTACTGGGA	0.796													C|||	19	0.00379393	0.0	0.0101	5008	,	,		8064	0.0		0.0089	False		,,,				2504	0.0031				p.H384Y		.											.	BTNL9-91	0			c.C1150T						.						1.0	2.0	1.0					5																	180486404		836	1977	2813	SO:0001583	missense	153579	exon11			GGCCGCCACTACT	AK057097	CCDS4460.2	5q35.3	2014-01-14			ENSG00000165810	ENSG00000165810		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	24176	protein-coding gene	gene with protein product							Standard	NM_152547		Approved	FLJ32535, BTN8	uc003mmt.3	Q6UXG8	OTTHUMG00000133152	ENST00000327705.9:c.1150C>T	5.37:g.180486404C>T	ENSP00000330200:p.His384Tyr	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	22	14	NM_152547	0	0	1	1	0	A6NL42|Q6P660|Q96DM5	Missense_Mutation	SNP	ENST00000327705.9	37	CCDS4460.2	38	0.0173992673992674	7	0.014227642276422764	5	0.013812154696132596	5	0.008741258741258742	21	0.027704485488126648	c	21.1	4.096472	0.76870	.	.	ENSG00000165810	ENST00000327705;ENST00000376842	T;T	0.68479	-0.33;-0.33	4.71	4.71	0.59529	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.217602	0.23321	U	0.049449	T	0.65575	0.2704	M	0.76938	2.355	0.30133	N	0.804617	B	0.28233	0.204	P	0.55615	0.78	T	0.75714	-0.3221	10	0.48119	T	0.1	.	15.5784	0.76410	0.0:1.0:0.0:0.0	.	384	Q6UXG8	BTNL9_HUMAN	Y	384;385	ENSP00000330200:H384Y;ENSP00000366038:H385Y	ENSP00000330200:H384Y	H	+	1	0	BTNL9	180419010	0.959000	0.32827	1.000000	0.80357	0.530000	0.34684	2.310000	0.43708	2.365000	0.80145	0.298000	0.19748	CAC	C|0.983;T|0.017		0.796	BTNL9-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000157342.3	NM_152547	
FOXQ1	94234	hgsc.bcm.edu	37	6	1313117	1313117	+	Missense_Mutation	SNP	A	A	C	rs9502889	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr6:1313117A>C	ENST00000296839.2	+	1	443	c.178A>C	c.(178-180)Acg>Ccg	p.T60P		NM_033260.3	NP_150285.3	Q9C009	FOXQ1_HUMAN	forkhead box Q1	60	Ala/Gly-rich.		T -> P (in dbSNP:rs9502889). {ECO:0000269|PubMed:11747606, ECO:0000269|PubMed:15489334}.		hair follicle morphogenesis (GO:0031069)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(1)|urinary_tract(1)	2	Ovarian(93;0.0733)	Breast(5;0.052)|all_lung(73;0.0713)|all_hematologic(90;0.0895)		OV - Ovarian serous cystadenocarcinoma(45;0.0954)|BRCA - Breast invasive adenocarcinoma(62;0.18)		cgccagagatacgcagggcga	0.781													C|||	4155	0.829673	0.8268	0.817	5008	,	,		7725	0.6478		0.9811	False		,,,				2504	0.8742				p.T60P		.											.	FOXQ1-226	0			c.A178C						.	C	PRO/THR	1459,205		630,199,3	1.0	2.0	2.0		178	2.0	0.0	6	dbSNP_119	2	3448,86		1681,86,0	no	missense	FOXQ1	NM_033260.3	38	2311,285,3	CC,CA,AA		2.4335,12.3197,5.5983	benign	60/404	1313117	4907,291	832	1767	2599	SO:0001583	missense	94234	exon1			AGAGATACGCAGG	AF153341	CCDS4471.1	6p25	2008-02-05			ENSG00000164379	ENSG00000164379		"""Forkhead boxes"""	20951	protein-coding gene	gene with protein product		612788				11747606, 12011061	Standard	NM_033260		Approved	HFH1	uc003mtl.4	Q9C009	OTTHUMG00000016160	ENST00000296839.2:c.178A>C	6.37:g.1313117A>C	ENSP00000296839:p.Thr60Pro	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_033260	0	0	0	0	0	Q9NS06	Missense_Mutation	SNP	ENST00000296839.2	37	CCDS4471.1	1832	0.8388278388278388	418	0.8495934959349594	299	0.8259668508287292	378	0.6608391608391608	737	0.9722955145118733	C	2.302	-0.359998	0.05103	0.876803	0.975665	ENSG00000164379	ENST00000296839	T	0.42513	0.97	2.88	1.96	0.26148	.	1.166200	0.06867	N	0.800158	T	0.07143	0.0181	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.28427	-1.0044	9	0.30078	T	0.28	.	2.761	0.05306	0.229:0.5157:0.0:0.2553	rs9502889;rs17857429	60	Q9C009	FOXQ1_HUMAN	P	60	ENSP00000296839:T60P	ENSP00000296839:T60P	T	+	1	0	FOXQ1	1258117	0.000000	0.05858	0.011000	0.14972	0.029000	0.11900	-0.022000	0.12480	0.431000	0.26258	-0.506000	0.04501	ACG	A|0.161;C|0.839		0.781	FOXQ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043410.1	NM_033260	
FOXQ1	94234	hgsc.bcm.edu	37	6	1313121	1313121	+	Missense_Mutation	SNP	A	A	C	rs9502890	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr6:1313121A>C	ENST00000296839.2	+	1	447	c.182A>C	c.(181-183)cAg>cCg	p.Q61P		NM_033260.3	NP_150285.3	Q9C009	FOXQ1_HUMAN	forkhead box Q1	61	Ala/Gly-rich.		Q -> P (in dbSNP:rs9502890). {ECO:0000269|PubMed:11747606, ECO:0000269|PubMed:15489334}.		hair follicle morphogenesis (GO:0031069)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(1)|urinary_tract(1)	2	Ovarian(93;0.0733)	Breast(5;0.052)|all_lung(73;0.0713)|all_hematologic(90;0.0895)		OV - Ovarian serous cystadenocarcinoma(45;0.0954)|BRCA - Breast invasive adenocarcinoma(62;0.18)		agagatacgcagggcgacggc	0.786													C|||	4155	0.829673	0.8268	0.817	5008	,	,		7820	0.6478		0.9811	False		,,,				2504	0.8742				p.Q61P		.											.	FOXQ1-226	0			c.A182C						.	C	PRO/GLN	1291,195		553,185,5	1.0	2.0	1.0		182	-6.0	0.0	6	dbSNP_119	1	3133,85		1524,85,0	no	missense	FOXQ1	NM_033260.3	76	2077,270,5	CC,CA,AA		2.6414,13.1225,5.9524	benign	61/404	1313121	4424,280	743	1609	2352	SO:0001583	missense	94234	exon1			ATACGCAGGGCGA	AF153341	CCDS4471.1	6p25	2008-02-05			ENSG00000164379	ENSG00000164379		"""Forkhead boxes"""	20951	protein-coding gene	gene with protein product		612788				11747606, 12011061	Standard	NM_033260		Approved	HFH1	uc003mtl.4	Q9C009	OTTHUMG00000016160	ENST00000296839.2:c.182A>C	6.37:g.1313121A>C	ENSP00000296839:p.Gln61Pro	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_033260	0	0	0	0	0	Q9NS06	Missense_Mutation	SNP	ENST00000296839.2	37	CCDS4471.1	1806	0.8269230769230769	387	0.7865853658536586	298	0.8232044198895028	383	0.6695804195804196	738	0.9736147757255936	C	1.298	-0.605630	0.03717	0.868775	0.973586	ENSG00000164379	ENST00000296839	T	0.41758	0.99	3.01	-6.03	0.02185	.	5.999610	0.01694	N	0.026822	T	0.05502	0.0145	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.06552	-1.0820	9	0.30078	T	0.28	.	2.125	0.03736	0.2444:0.1884:0.4343:0.1329	rs9502890;rs17857430	61	Q9C009	FOXQ1_HUMAN	P	61	ENSP00000296839:Q61P	ENSP00000296839:Q61P	Q	+	2	0	FOXQ1	1258121	0.018000	0.18449	0.000000	0.03702	0.006000	0.05464	-0.174000	0.09839	-1.850000	0.01169	-1.043000	0.02367	CAG	A|0.173;C|0.827		0.786	FOXQ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043410.1	NM_033260	
PPP1R3G	648791	hgsc.bcm.edu	37	6	5086211	5086211	+	Silent	SNP	G	G	C	rs584962		TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr6:5086211G>C	ENST00000405617.2	+	1	492	c.492G>C	c.(490-492)ctG>ctC	p.L164L		NM_001145115.1	NP_001138587.1	B7ZBB8	PP13G_HUMAN	protein phosphatase 1, regulatory subunit 3G	164					glucose homeostasis (GO:0042593)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of glycogen biosynthetic process (GO:0045725)	cytoplasm (GO:0005737)	glycogen binding (GO:2001069)			kidney(2)	2						TCTCGCGCCTGCGAAGCTTCC	0.736													C|||	5008	1.0	1.0	1.0	5008	,	,		12118	1.0		1.0	False		,,,				2504	1.0				p.L164L		.											.	PPP1R3G-136	0			c.G492C						.						1.0	2.0	1.0					6																	5086211		271	872	1143	SO:0001819	synonymous_variant	648791	exon1			GCGCCTGCGAAGC		CCDS47366.1	6p25.1	2012-04-17	2011-10-04		ENSG00000219607	ENSG00000219607		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14945	protein-coding gene	gene with protein product			"""protein phosphatase 1, regulatory (inhibitor) subunit 3G"""			11948623	Standard	NM_001145115		Approved		uc011dia.1	B7ZBB8	OTTHUMG00000014172	ENST00000405617.2:c.492G>C	6.37:g.5086211G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_001145115	0	0	0	7	7		Silent	SNP	ENST00000405617.2	37	CCDS47366.1																																																																																			G|0.000;C|1.000		0.736	PPP1R3G-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039740.3	NM_001145115	
ZNF391	346157	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	27368446	27368446	+	Silent	SNP	C	C	T			TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr6:27368446C>T	ENST00000244576.4	+	3	842	c.297C>T	c.(295-297)caC>caT	p.H99H		NM_001076781.1	NP_001070249.1	Q9UJN7	ZN391_HUMAN	zinc finger protein 391	99					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|large_intestine(6)|lung(7)|pancreas(2)|skin(3)|upper_aerodigestive_tract(1)	21						TAATTAAACACCAAAGACTTT	0.368																																					p.H99H		.											.	ZNF391-69	0			c.C297T						.						72.0	69.0	70.0					6																	27368446		1839	4105	5944	SO:0001819	synonymous_variant	346157	exon3			TAAACACCAAAGA	BC132797	CCDS43429.1	6p21	2013-01-08			ENSG00000124613	ENSG00000124613		"""Zinc fingers, C2H2-type"""	18779	protein-coding gene	gene with protein product							Standard	NM_001076781		Approved	dJ153G14.3	uc003njf.1	Q9UJN7	OTTHUMG00000014477	ENST00000244576.4:c.297C>T	6.37:g.27368446C>T		Somatic	69	0		WXS	Illumina GAIIx	Phase_I	77	43	NM_001076781	0	0	0	0	0	B4DH77	Silent	SNP	ENST00000244576.4	37	CCDS43429.1																																																																																			.		0.368	ZNF391-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040145.2	NM_001076781	
FGD2	221472	broad.mit.edu	37	6	36993620	36993620	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr6:36993620A>G	ENST00000274963.8	+	14	1682	c.1511A>G	c.(1510-1512)aAc>aGc	p.N504S		NM_173558.3	NP_775829.2	Q7Z6J4	FGD2_HUMAN	FYVE, RhoGEF and PH domain containing 2	504					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			central_nervous_system(1)|endometrium(6)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	25						TACGACGACAACAGGCCCAAC	0.617																																					p.N504S		.											.	FGD2-229	0			c.A1511G						.						144.0	110.0	122.0					6																	36993620		2203	4300	6503	SO:0001583	missense	221472	exon14			ACGACAACAGGCC	AK097230	CCDS4829.1	6p21.2	2013-01-10	2004-08-24		ENSG00000146192	ENSG00000146192		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	3664	protein-coding gene	gene with protein product		605091	"""FGD1 family, member 2"""			10458911	Standard	NM_173558		Approved	ZFYVE4	uc010jwp.1	Q7Z6J4	OTTHUMG00000014616	ENST00000274963.8:c.1511A>G	6.37:g.36993620A>G	ENSP00000274963:p.Asn504Ser	Somatic	149	0		WXS	Illumina GAIIx	Phase_I	298	6	NM_173558	0	0	1	1	0	Q5T8I1|Q6P6A8|Q6ZNL5|Q8IZ32|Q8N868|Q9H7M2	Missense_Mutation	SNP	ENST00000274963.8	37	CCDS4829.1	.	.	.	.	.	.	.	.	.	.	A	9.924	1.213015	0.22289	.	.	ENSG00000146192	ENST00000274963;ENST00000394459	T	0.77229	-1.08	4.98	4.98	0.66077	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, FYVE-type (2);Zinc finger, FYVE-related (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.45867	D	0.000340	T	0.63082	0.2481	N	0.04508	-0.205	0.36327	D	0.858612	D;P	0.71674	0.998;0.944	D;P	0.67725	0.953;0.842	T	0.68337	-0.5435	10	0.21014	T	0.42	-6.7023	14.6398	0.68714	1.0:0.0:0.0:0.0	.	504;81	Q7Z6J4;Q7Z6J4-2	FGD2_HUMAN;.	S	504;132	ENSP00000274963:N504S	ENSP00000274963:N504S	N	+	2	0	FGD2	37101598	1.000000	0.71417	0.956000	0.39512	0.003000	0.03518	5.063000	0.64332	2.008000	0.58898	0.460000	0.39030	AAC	.		0.617	FGD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040398.2	NM_173558	
FAM46A	55603	hgsc.bcm.edu	37	6	82461742	82461742	+	Silent	SNP	G	G	A			TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr6:82461742G>A	ENST00000320172.6	-	2	431	c.117C>T	c.(115-117)ggC>ggT	p.G39G	FAM46A_ENST00000369754.3_Silent_p.G58G|FAM46A_ENST00000369756.3_Silent_p.G120G	NM_017633.2	NP_060103.2	Q96IP4	FA46A_HUMAN	family with sequence similarity 46, member A	39			Missing. {ECO:0000269|PubMed:12054608, ECO:0000269|PubMed:16545789}.		regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)		poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(3)|lung(5)|skin(1)|urinary_tract(1)	12		all_cancers(76;6.74e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000282)|all_epithelial(107;0.0104)		BRCA - Breast invasive adenocarcinoma(397;0.0428)		cgaagtcgccgccgccgaagt	0.667																																					p.G39G		.											.	FAM46A-90	0			c.C117T						.						7.0	8.0	8.0					6																	82461742		1601	3424	5025	SO:0001819	synonymous_variant	55603	exon2			GTCGCCGCCGCCG	AF350451	CCDS34489.1	6q14	2008-07-03	2004-08-19	2004-08-26	ENSG00000112773	ENSG00000112773			18345	protein-coding gene	gene with protein product		611357	"""chromosome 6 open reading frame 37"""	C6orf37		12054608, 17803723	Standard	NM_017633		Approved	FLJ20037	uc003pjg.3	Q96IP4	OTTHUMG00000015097	ENST00000320172.6:c.117C>T	6.37:g.82461742G>A		Somatic	19	0		WXS	Illumina GAIIx	Phase_I	100	14	NM_017633	0	0	16	16	0	A8K7U4|Q5TF86|Q8NFZ9|Q9BW32|Q9NXV5	Silent	SNP	ENST00000320172.6	37	CCDS34489.1																																																																																			.		0.667	FAM46A-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000041331.1		
POU3F2	5454	hgsc.bcm.edu	37	6	99283376	99283376	+	Silent	SNP	T	T	G	rs195860	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr6:99283376T>G	ENST00000328345.5	+	1	797	c.627T>G	c.(625-627)ggT>ggG	p.G209G		NM_005604.3	NP_005595.2	P20265	PO3F2_HUMAN	POU class 3 homeobox 2	209					astrocyte development (GO:0014002)|cellular response to organic substance (GO:0071310)|cerebral cortex radially oriented cell migration (GO:0021799)|epidermis development (GO:0008544)|forebrain ventricular zone progenitor cell division (GO:0021869)|hypothalamus cell differentiation (GO:0021979)|myelination in peripheral nervous system (GO:0022011)|neurohypophysis development (GO:0021985)|neuron differentiation (GO:0030182)|positive regulation of cell proliferation (GO:0008284)|positive regulation of multicellular organism growth (GO:0040018)|regulation of axonogenesis (GO:0050770)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	identical protein binding (GO:0042802)|RNA polymerase II transcription coactivator activity (GO:0001105)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|large_intestine(3)|lung(5)	10		all_cancers(76;1.56e-06)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00893)|Colorectal(196;0.069)|Lung NSC(302;0.197)		BRCA - Breast invasive adenocarcinoma(108;0.0355)		AGCCGGCCGGTCTGCACCACC	0.736													G|||	4460	0.890575	0.8994	0.9121	5008	,	,		6412	0.9544		0.8598	False		,,,				2504	0.8292				p.G209G		.											.	POU3F2-90	0			c.T627G						.	G		3186,306		1453,280,13	4.0	4.0	4.0		627	3.1	1.0	6	dbSNP_79	4	6282,930		2738,806,62	no	coding-synonymous	POU3F2	NM_005604.2		4191,1086,75	GG,GT,TT		12.8952,8.7629,11.5471		209/444	99283376	9468,1236	1746	3606	5352	SO:0001819	synonymous_variant	5454	exon1			GGCCGGTCTGCAC	Z11933	CCDS5040.1	6q16.2	2011-06-20	2007-07-13		ENSG00000184486	ENSG00000184486		"""Homeoboxes / POU class"""	9215	protein-coding gene	gene with protein product		600494	"""POU domain class 3, transcription factor 2"""	OTF7		8441633	Standard	NM_005604		Approved	POUF3, BRN2, OCT7	uc003ppe.3	P20265	OTTHUMG00000015258	ENST00000328345.5:c.627T>G	6.37:g.99283376T>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	34	34	NM_005604	0	0	0	0	0	Q14960|Q86V54|Q9UJL0	Silent	SNP	ENST00000328345.5	37	CCDS5040.1																																																																																			T|0.089;G|0.911		0.736	POU3F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041586.2		
SEC63	11231	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	108194052	108194052	+	Nonsense_Mutation	SNP	G	G	T			TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr6:108194052G>T	ENST00000369002.4	-	20	2278	c.2099C>A	c.(2098-2100)tCa>tAa	p.S700*		NM_007214.4	NP_009145.1	Q9UGP8	SEC63_HUMAN	SEC63 homolog (S. cerevisiae)	700	SEC63 2.				liver development (GO:0001889)|multicellular organismal aging (GO:0010259)|nitrogen compound metabolic process (GO:0006807)|posttranslational protein targeting to membrane (GO:0006620)|posttranslational protein targeting to membrane, translocation (GO:0031204)|protein targeting to membrane (GO:0006612)|renal system development (GO:0072001)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|receptor activity (GO:0004872)			endometrium(3)|kidney(4)|large_intestine(7)|lung(14)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		all_cancers(87;5.35e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00225)|Colorectal(196;0.0294)		BRCA - Breast invasive adenocarcinoma(108;0.0079)|Epithelial(106;0.0356)|all cancers(137;0.0525)|OV - Ovarian serous cystadenocarcinoma(136;0.054)		ataggagtctgatctcagaaa	0.338																																					p.S700X		.											.	SEC63-227	0			c.C2099A						.						35.0	33.0	34.0					6																	108194052		2142	4192	6334	SO:0001587	stop_gained	11231	exon20			GAGTCTGATCTCA	BC048287	CCDS5061.1	6q21	2011-09-05	2006-09-12		ENSG00000025796	ENSG00000025796		"""Heat shock proteins / DNAJ (HSP40)"""	21082	protein-coding gene	gene with protein product		608648	"""SEC63-like (S. cerevisiae)"""			10219736, 10543453	Standard	NM_007214		Approved	SEC63L, PRO2507, ERdj2, DNAJC23	uc003psc.4	Q9UGP8	OTTHUMG00000015316	ENST00000369002.4:c.2099C>A	6.37:g.108194052G>T	ENSP00000357998:p.Ser700*	Somatic	174	0		WXS	Illumina GAIIx	Phase_I	153	78	NM_007214	0	0	31	72	41	O95380|Q5THN4|Q86VS9|Q8IWL0|Q9NTE0	Nonsense_Mutation	SNP	ENST00000369002.4	37	CCDS5061.1	.	.	.	.	.	.	.	.	.	.	G	39	7.562629	0.98361	.	.	ENSG00000025796	ENST00000369002;ENST00000437345	.	.	.	4.93	4.93	0.64822	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.1566	17.4262	0.87527	0.0:0.0:1.0:0.0	.	.	.	.	X	700;318	.	ENSP00000357998:S700X	S	-	2	0	SEC63	108300745	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.184000	0.50926	2.725000	0.93324	0.591000	0.81541	TCA	.		0.338	SEC63-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041705.4	NM_007214	
PEX7	5191	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	137193359	137193359	+	Silent	SNP	G	G	A			TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr6:137193359G>A	ENST00000318471.4	+	8	852	c.771G>A	c.(769-771)gtG>gtA	p.V257V	PEX7_ENST00000541292.1_3'UTR	NM_000288.3	NP_000279.1	O00628	PEX7_HUMAN	peroxisomal biogenesis factor 7	257					endochondral ossification (GO:0001958)|ether lipid biosynthetic process (GO:0008611)|fatty acid beta-oxidation (GO:0006635)|neuron migration (GO:0001764)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix (GO:0016558)	cytosol (GO:0005829)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	enzyme binding (GO:0019899)|peroxisome matrix targeting signal-2 binding (GO:0005053)|protein homodimerization activity (GO:0042803)			lung(7)|prostate(1)	8	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000257)|OV - Ovarian serous cystadenocarcinoma(155;0.00492)		ATGCTTCTGTGCTGGCCTCTT	0.323																																					p.V257V		.											.	PEX7-90	0			c.G771A						.						147.0	151.0	150.0					6																	137193359		2202	4297	6499	SO:0001819	synonymous_variant	5191	exon8			TTCTGTGCTGGCC	AF180814	CCDS5180.1	6q21-q22.2	2013-01-10			ENSG00000112357	ENSG00000112357		"""WD repeat domain containing"""	8860	protein-coding gene	gene with protein product	"""Refsum disease"""	601757				9090381, 10673331	Standard	NM_000288		Approved	PTS2R, RD	uc003qhd.3	O00628	OTTHUMG00000015650	ENST00000318471.4:c.771G>A	6.37:g.137193359G>A		Somatic	33	0		WXS	Illumina GAIIx	Phase_I	33	9	NM_000288	0	0	7	19	12	C0H5X6	Silent	SNP	ENST00000318471.4	37	CCDS5180.1																																																																																			.		0.323	PEX7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042387.2	NM_000288	
ADGB	79747	broad.mit.edu	37	6	147106841	147106841	+	Silent	SNP	A	A	G	rs259391	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr6:147106841A>G	ENST00000397944.3	+	32	4384	c.4308A>G	c.(4306-4308)aaA>aaG	p.K1436K	ADGB_ENST00000367488.1_Silent_p.K159K|ADGB_ENST00000367493.3_Missense_Mutation_p.K711R	NM_024694.3	NP_078970.3	Q8N7X0	ADGB_HUMAN	androglobin	1436					oxygen transport (GO:0015671)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)			breast(1)|endometrium(2)|kidney(2)	5						CTAAACCAAAAGAAGAAGGTG	0.438													G|||	2742	0.547524	0.5522	0.6931	5008	,	,		16553	0.4067		0.5736	False		,,,				2504	0.5562				p.K1436K		.											.	.	0			c.A4308G						.	G		773,611		218,337,137	98.0	82.0	87.0		4308	-6.1	0.0	6	dbSNP_79	87	1703,1477		471,761,358	no	coding-synonymous	C6orf103	NM_024694.3		689,1098,495	GG,GA,AA		46.4465,44.1474,45.7493		1436/1668	147106841	2476,2088	692	1590	2282	SO:0001819	synonymous_variant	79747	exon32			ACCAAAAGAAGAA	AK026774		6q24.2	2012-02-03	2012-02-03	2012-02-03	ENSG00000118492	ENSG00000118492			21212	protein-coding gene	gene with protein product		614630	"""chromosome 6 open reading frame 103"""	C6orf103		22115833	Standard	NM_024694		Approved	FLJ23121, dJ408K24.1	uc010khx.3	Q8N7X0	OTTHUMG00000015758	ENST00000397944.3:c.4308A>G	6.37:g.147106841A>G		Somatic	103	0		WXS	Illumina GAIIx	Phase_I	115	3	NM_024694	0	0	0	0	0	Q5T402|Q5T904|Q5T905	Silent	SNP	ENST00000397944.3	37		1200	0.5494505494505495	283	0.5752032520325203	245	0.6767955801104972	228	0.3986013986013986	444	0.5857519788918206	G	3.481	-0.105794	0.06924	0.558526	0.535535	ENSG00000118492	ENST00000367493	.	.	.	3.6	-6.13	0.02118	.	.	.	.	.	T	0.15869	0.0382	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.29336	-1.0015	4	0.87932	D	0	.	4.398	0.11372	0.5907:0.1141:0.1796:0.1155	rs259391;rs518825;rs3827634;rs17619302;rs52795579;rs60202758;rs259391	.	.	.	R	711	.	ENSP00000356463:K711R	K	+	2	0	C6orf103	147148534	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.146000	0.03191	-2.182000	0.00764	-2.123000	0.00347	AAG	A|0.449;G|0.551		0.438	ADGB-009	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376350.2	NM_024694	
LRP11	84918	hgsc.bcm.edu	37	6	150184882	150184882	+	Missense_Mutation	SNP	G	G	C	rs9322225	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr6:150184882G>C	ENST00000239367.2	-	1	280	c.275C>G	c.(274-276)cCg>cGg	p.P92R	RP11-244K5.8_ENST00000596229.1_RNA|LRP11_ENST00000367368.2_Missense_Mutation_p.P92R|RP11-244K5.8_ENST00000606915.1_RNA|LRP11_ENST00000546019.1_Intron	NM_032832.5	NP_116221.3	Q86VZ4	LRP11_HUMAN	low density lipoprotein receptor-related protein 11	92			P -> R (in dbSNP:rs9322225). {ECO:0000269|PubMed:15489334}.			integral component of membrane (GO:0016021)				cervix(1)|kidney(5)|large_intestine(1)|lung(1)	8		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;4.56e-12)|GBM - Glioblastoma multiforme(68;0.225)		GCCGCTGCCCGGGCCCGGGCA	0.756													g|||	2394	0.478035	0.3071	0.5101	5008	,	,		7691	0.8224		0.4165	False		,,,				2504	0.3947				p.P92R		.											.	LRP11-90	0			c.C275G						.	G	ARG/PRO	799,1991		151,497,747	2.0	2.0	2.0		275	3.0	0.3	6	dbSNP_119	2	2072,3740		444,1184,1278	yes	missense	LRP11	NM_032832.5	103	595,1681,2025	CC,CG,GG		35.6504,28.638,33.376	possibly-damaging	92/501	150184882	2871,5731	1395	2906	4301	SO:0001583	missense	84918	exon1			CTGCCCGGGCCCG	AK027641	CCDS5220.1	6q24.3	2013-02-27			ENSG00000120256	ENSG00000120256		"""Low density lipoprotein receptors"""	16936	protein-coding gene	gene with protein product							Standard	NM_032832		Approved	bA350J20.3, MANSC3	uc003qng.2	Q86VZ4	OTTHUMG00000015801	ENST00000239367.2:c.275C>G	6.37:g.150184882G>C	ENSP00000239367:p.Pro92Arg	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	6	NM_032832	0	0	4	6	2	Q5VYC0|Q96SN6	Missense_Mutation	SNP	ENST00000239367.2	37	CCDS5220.1	1110	0.5082417582417582	147	0.29878048780487804	188	0.5193370165745856	465	0.8129370629370629	310	0.40897097625329815	G	12.02	1.812850	0.32053	0.28638	0.356504	ENSG00000120256	ENST00000239367;ENST00000367368	T;T	0.20463	2.07;2.07	3.91	2.96	0.34315	Seven cysteines, N-terminal (2);	1.059560	0.07539	N	0.913589	T	0.07279	0.0184	L	0.36672	1.1	0.51767	P	7.00000000000145E-5	B;B	0.25743	0.133;0.012	B;B	0.23150	0.044;0.025	T	0.19484	-1.0304	9	0.19590	T	0.45	-4.154	11.8365	0.52327	0.0:0.1787:0.8213:0.0	rs9322225;rs17846346;rs17859381	92;92	Q5VYB9;Q86VZ4	.;LRP11_HUMAN	R	92	ENSP00000239367:P92R;ENSP00000356338:P92R	ENSP00000239367:P92R	P	-	2	0	LRP11	150226575	0.132000	0.22450	0.342000	0.25602	0.428000	0.31595	0.489000	0.22387	1.900000	0.55004	0.484000	0.47621	CCG	G|0.492;C|0.508		0.756	LRP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042664.1	NM_032832	
ARID1B	57492	hgsc.bcm.edu	37	6	157099799	157099799	+	Missense_Mutation	SNP	G	G	A	rs375160616	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr6:157099799G>A	ENST00000350026.5	+	1	737	c.736G>A	c.(736-738)Ggc>Agc	p.G246S	RP11-230C9.2_ENST00000603191.1_lincRNA|ARID1B_ENST00000275248.4_Missense_Mutation_p.G188S|MIR4466_ENST00000606121.1_RNA|RP11-230C9.3_ENST00000604792.1_RNA|ARID1B_ENST00000367148.1_Missense_Mutation_p.G246S|ARID1B_ENST00000346085.5_Missense_Mutation_p.G246S	NM_017519.2	NP_059989.2	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	246	Gly-rich.		G -> S. {ECO:0000269|PubMed:22405089}.		chromatin-mediated maintenance of transcription (GO:0048096)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			NS(2)|breast(5)|central_nervous_system(4)|endometrium(12)|kidney(4)|large_intestine(11)|lung(30)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(3)	81		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		cggccccggcggccgcgcTGG	0.751													g|||	5	0.000998403	0.0	0.0043	5008	,	,		4552	0.0		0.002	False		,,,				2504	0.0				p.G246S		.											.	ARID1B-154	0			c.G736A						.																																			SO:0001583	missense	57492	exon1			CCCGGCGGCCGCG	AF521671	CCDS5251.1, CCDS5251.2, CCDS55072.1	6q25.3	2014-09-17			ENSG00000049618	ENSG00000049618		"""-"""	18040	protein-coding gene	gene with protein product		614556					Standard	NM_017519		Approved	KIAA1235, ELD/OSA1, p250R, BAF250b, DAN15, 6A3-5	uc003qqo.3	Q8NFD5	OTTHUMG00000015890	ENST00000350026.5:c.736G>A	6.37:g.157099799G>A	ENSP00000055163:p.Gly246Ser	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	20	9	NM_017519	0	0	1	1	0	Q5JRD1|Q5VYC4|Q8IZY8|Q8TEV0|Q8TF02|Q99491|Q9ULI5	Missense_Mutation	SNP	ENST00000350026.5	37	CCDS5251.2	.	.	.	.	.	.	.	.	.	.	g	10.85	1.465966	0.26335	.	.	ENSG00000049618	ENST00000346085;ENST00000350026;ENST00000367148;ENST00000275248	T;T;T;T	0.04083	3.71;3.73;3.78;3.78	2.65	1.31	0.21738	.	.	.	.	.	T	0.00845	0.0028	N	0.08118	0	0.23243	N	0.99806	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.06405	0.001;0.002;0.002	T	0.48822	-0.9001	9	0.62326	D	0.03	.	4.7912	0.13250	0.4178:0.0:0.5822:0.0	.	246;246;188	Q8NFD5;Q8NFD5-2;G3XAA0	ARI1B_HUMAN;.;.	S	246;246;246;188	ENSP00000344546:G246S;ENSP00000055163:G246S;ENSP00000356116:G246S;ENSP00000275248:G188S	ENSP00000275248:G188S	G	+	1	0	ARID1B	157141491	1.000000	0.71417	0.792000	0.32020	0.895000	0.52256	0.741000	0.26202	1.006000	0.39211	0.165000	0.16767	GGC	.		0.751	ARID1B-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000372723.1	NM_020732	
TBP	6908	bcgsc.ca	37	6	170871052	170871052	+	Silent	SNP	G	G	A	rs112083427|rs369312237	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr6:170871052G>A	ENST00000392092.2	+	3	507	c.228G>A	c.(226-228)caG>caA	p.Q76Q	TBP_ENST00000230354.6_Silent_p.Q76Q|TBP_ENST00000540980.1_Silent_p.Q56Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	76	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.Q76Q(4)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		agcaacagcagcagcagcagc	0.572																																					p.Q76Q		.											.	TBP-91	4	Substitution - coding silent(4)	lung(3)|prostate(1)	c.G228A						.						14.0	19.0	17.0					6																	170871052		1952	3842	5794	SO:0001819	synonymous_variant	6908	exon3			ACAGCAGCAGCAG	M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.228G>A	6.37:g.170871052G>A		Somatic	63	7		WXS	Illumina GAIIx	Phase_I	82	7	NM_003194	0	1	324	333	8	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	ENST00000392092.2	37	CCDS5315.1																																																																																			G|0.500;A|0.500		0.572	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043271.2	NM_003194	
TNRC18	84629	hgsc.bcm.edu	37	7	5372406	5372406	+	Silent	SNP	G	G	T	rs13238738	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr7:5372406G>T	ENST00000430969.1	-	19	6342	c.5994C>A	c.(5992-5994)cgC>cgA	p.R1998R	TNRC18_ENST00000399537.4_Silent_p.R1998R	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	1998							chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		TGCGCTCGCTGCGGCGCCGCG	0.756													G|||	2646	0.528355	0.3601	0.4352	5008	,	,		9503	0.7063		0.673	False		,,,				2504	0.4898				p.R1998R		.											.	TNRC18-46	0			c.C5994A						.	G		1260,1040		370,520,260	2.0	3.0	3.0		5994	2.1	1.0	7	dbSNP_121	3	3787,1581		1438,911,335	no	coding-synonymous	TNRC18	NM_001080495.2		1808,1431,595	TT,TG,GG		29.4523,45.2174,34.181		1998/2969	5372406	5047,2621	1150	2684	3834	SO:0001819	synonymous_variant	84629	exon19			CTCGCTGCGGCGC	U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.5994C>A	7.37:g.5372406G>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	9	NM_001080495	0	0	0	0	0	A8MX41|Q96JH1|Q96K91	Silent	SNP	ENST00000430969.1	37	CCDS47534.1	1284	0.5879120879120879	197	0.40040650406504064	170	0.4696132596685083	415	0.7255244755244755	502	0.662269129287599	.	11.77	1.738038	0.30774	0.547826	0.705477	ENSG00000182095	ENST00000455076	.	.	.	4.14	2.1	0.27182	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.09310	P	0.9999999999999956	.	.	.	.	.	.	T	0.35425	-0.9789	3	.	.	.	.	12.3787	0.55295	0.0:0.4664:0.5335:0.0	rs13238738	.	.	.	E	35	.	.	A	-	2	0	TNRC18	5338932	0.998000	0.40836	0.997000	0.53966	0.996000	0.88848	0.427000	0.21379	0.648000	0.30732	0.555000	0.69702	GCA	G|0.411;T|0.589		0.756	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
DNAH11	8701	bcgsc.ca	37	7	21675643	21675643	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr7:21675643G>T	ENST00000409508.3	+	26	4686	c.4655G>T	c.(4654-4656)tGt>tTt	p.C1552F	DNAH11_ENST00000465593.1_3'UTR|DNAH11_ENST00000328843.6_Missense_Mutation_p.C1557F	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	1557	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						ATTTTTGTCTGTTCAGAAGAT	0.403									Kartagener syndrome																												.		.											.	DNAH11-146	0			.						.						85.0	80.0	82.0					7																	21675643		1867	4102	5969	SO:0001583	missense	8701	.	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	TTGTCTGTTCAGA	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.4655G>T	7.37:g.21675643G>T	ENSP00000475939:p.Cys1552Phe	Somatic	155	3		WXS	Illumina GAIIx	Phase_I	184	78	.	0	0	0	0	0	Q9UJ82	Missense_Mutation	SNP	ENST00000409508.3	37		.	.	.	.	.	.	.	.	.	.	G	17.42	3.383929	0.61845	.	.	ENSG00000105877	ENST00000328843	T	0.60548	0.18	5.56	3.72	0.42706	Dynein heavy chain, domain-2 (1);	0.381500	0.30320	N	0.009890	T	0.58163	0.2103	.	.	.	0.32674	N	0.516462	D	0.53151	0.958	P	0.48334	0.574	T	0.69506	-0.5127	9	0.87932	D	0	.	9.8425	0.41006	0.0742:0.0:0.7869:0.1389	.	1557	Q96DT5	DYH11_HUMAN	F	1557	ENSP00000330671:C1557F	ENSP00000330671:C1557F	C	+	2	0	DNAH11	21642168	0.975000	0.34042	0.940000	0.37924	0.948000	0.59901	2.333000	0.43912	0.668000	0.31126	0.650000	0.86243	TGT	.		0.403	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000326582.6	NM_003777	
DOCK4	9732	hgsc.bcm.edu	37	7	111368454	111368454	+	Missense_Mutation	SNP	G	G	A	rs34597439	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr7:111368454G>A	ENST00000437633.1	-	52	6033	c.5777C>T	c.(5776-5778)tCg>tTg	p.S1926L	DOCK4_ENST00000494651.2_Missense_Mutation_p.S809L|DOCK4_ENST00000428084.1_Missense_Mutation_p.S1935L	NM_014705.3	NP_055520.3	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4	1926	Pro-rich.		S -> L (in dbSNP:rs34597439). {ECO:0000269|PubMed:12628187}.		cell chemotaxis (GO:0060326)|positive regulation of Rac GTPase activity (GO:0032855)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|stereocilium (GO:0032420)|stereocilium bundle (GO:0032421)	guanyl-nucleotide exchange factor activity (GO:0005085)|PDZ domain binding (GO:0030165)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)|receptor tyrosine kinase binding (GO:0030971)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(13)|lung(31)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(4)	72		Acute lymphoblastic leukemia(1;0.0441)				GGGCGGCTCCGACGTGACGGG	0.731													G|||	78	0.0155751	0.003	0.0331	5008	,	,		10713	0.0		0.0447	False		,,,				2504	0.0061				p.S1926L		.											.	DOCK4-26	0			c.C5777T						.	G	LEU/SER	19,3609		0,19,1795	16.0	20.0	19.0		5777	4.7	0.0	7	dbSNP_126	19	292,7584		3,286,3649	yes	missense	DOCK4	NM_014705.3	145	3,305,5444	AA,AG,GG		3.7075,0.5237,2.7034	benign	1926/1967	111368454	311,11193	1814	3938	5752	SO:0001583	missense	9732	exon52			GGCTCCGACGTGA		CCDS47688.1	7q31.1	2007-08-07			ENSG00000128512	ENSG00000128512			19192	protein-coding gene	gene with protein product		607679				12432077, 12628187	Standard	XM_006716188		Approved	FLJ34238, KIAA0716	uc003vfx.3	Q8N1I0	OTTHUMG00000155077	ENST00000437633.1:c.5777C>T	7.37:g.111368454G>A	ENSP00000404179:p.Ser1926Leu	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	23	12	NM_014705	0	0	0	2	2	O14584|O94824|Q8NB45	Missense_Mutation	SNP	ENST00000437633.1	37	CCDS47688.1	43|43	0.019688644688644688|0.019688644688644688	2|2	0.0040650406504065045|0.0040650406504065045	14|14	0.03867403314917127|0.03867403314917127	0|0	0.0|0.0	27|27	0.03562005277044855|0.03562005277044855	G|G	6.169|6.169	0.399328|0.399328	0.11696|0.11696	0.005237|0.005237	0.037075|0.037075	ENSG00000128512|ENSG00000128512	ENST00000423057;ENST00000445943|ENST00000352877;ENST00000428084;ENST00000494651;ENST00000437633;ENST00000342288	.|T;T;T	.|0.05649	.|4.13;3.41;4.13	5.59|5.59	4.72|4.72	0.59763|0.59763	.|.	.|1.352470	.|0.04302	.|N	.|0.347525	T|T	0.01254|0.01254	0.0041|0.0041	N|N	0.22421|0.22421	0.69|0.69	0.09310|0.09310	N|N	1|1	.|B;B;B;B;B;B	.|0.23058	.|0.001;0.064;0.011;0.003;0.002;0.079	.|B;B;B;B;B;B	.|0.15870	.|0.001;0.014;0.001;0.001;0.002;0.005	T|T	0.42327|0.42327	-0.9458|-0.9458	5|10	.|0.15952	.|T	.|0.53	.|.	10.5082|10.5082	0.44847|0.44847	0.1502:0.0:0.8498:0.0|0.1502:0.0:0.8498:0.0	rs34597439|rs34597439	.|795;809;1971;1926;1897;239	.|B7Z2K9;F5GXW1;Q149N5;Q8N1I0;Q8N1I0-2;Q8N1I0-4	.|.;.;.;DOCK4_HUMAN;.;.	W|L	1349;1959|1914;1935;809;1926;1885	.|ENSP00000410746:S1935L;ENSP00000440944:S809L;ENSP00000404179:S1926L	.|ENSP00000345432:S1885L	R|S	-|-	1|2	2|0	DOCK4|DOCK4	111155690|111155690	0.714000|0.714000	0.27936|0.27936	0.003000|0.003000	0.11579|0.11579	0.001000|0.001000	0.01503|0.01503	4.219000|4.219000	0.58561|0.58561	1.369000|1.369000	0.46134|0.46134	0.655000|0.655000	0.94253|0.94253	CGG|TCG	G|0.979;A|0.021		0.731	DOCK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338369.4	NM_014705	
CADPS2	93664	broad.mit.edu	37	7	122526225	122526225	+	Frame_Shift_Del	DEL	G	G	-			TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr7:122526225delG	ENST00000449022.2	-	1	186	c.167delC	c.(166-168)tctfs	p.S56fs	CADPS2_ENST00000412584.2_Frame_Shift_Del_p.S56fs|CADPS2_ENST00000334010.7_Frame_Shift_Del_p.S56fs|CADPS2_ENST00000313070.7_Frame_Shift_Del_p.S56fs	NM_017954.10	NP_060424.9	Q86UW7	CAPS2_HUMAN	Ca++-dependent secretion activator 2	56					cellular response to starvation (GO:0009267)|positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)	cell junction (GO:0030054)|cytoplasmic membrane-bounded vesicle (GO:0016023)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(26)|ovary(2)	43						CGGGCTCACAGATCTggccgc	0.756																																					p.S56fs		.											.	CADPS2-94	0			c.167delC						.						6.0	7.0	7.0					7																	122526225		1709	3668	5377	SO:0001589	frameshift_variant	93664	exon1			CTCACAGATCTGG		CCDS47691.1, CCDS55158.1	7q31.32	2013-01-10	2008-08-28		ENSG00000081803	ENSG00000081803		"""Pleckstrin homology (PH) domain containing"""	16018	protein-coding gene	gene with protein product		609978	"""Ca++-dependent activator protein for secretion 2"""				Standard	NM_017954		Approved		uc010lkq.3	Q86UW7	OTTHUMG00000157093	ENST00000449022.2:c.167delC	7.37:g.122526225delG	ENSP00000398481:p.Ser56fs	Somatic	10	0		WXS	Illumina GAIIx	Phase_I	39	14	NM_001167940	0	0	0	0	0	A4D0X3|B7ZM56|Q658Q2|Q7Z5T7|Q8IZW9|Q8N7M4|Q9H6P4|Q9HCI1|Q9NWK8	Frame_Shift_Del	DEL	ENST00000449022.2	37	CCDS55158.1																																																																																			.		0.756	CADPS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347414.2	NM_017954	
ARHGEF5	7984	bcgsc.ca	37	7	144070294	144070294	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr7:144070294C>T	ENST00000056217.5	+	10	4231	c.4057C>T	c.(4057-4059)Cgg>Tgg	p.R1353W	ARHGEF5_ENST00000471847.2_Missense_Mutation_p.R275W	NM_005435.3	NP_005426.2	Q12774	ARHG5_HUMAN	Rho guanine nucleotide exchange factor (GEF) 5	1353	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin cytoskeleton organization (GO:0030036)|intracellular signal transduction (GO:0035556)|myeloid dendritic cell chemotaxis (GO:0002408)|positive regulation of podosome assembly (GO:0071803)|regulation of Rho GTPase activity (GO:0032319)		GTP binding (GO:0005525)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|endometrium(6)|kidney(8)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	Melanoma(164;0.14)					CTAGCTGATCCGGGACTGCAA	0.498																																					p.R1353W		.											.	ARHGEF5-229	0			c.C4057T						.						53.0	52.0	52.0					7																	144070294		2115	4161	6276	SO:0001583	missense	7984	exon10			CTGATCCGGGACT	U02082	CCDS34771.1	7q35	2012-09-20			ENSG00000050327	ENSG00000050327		"""Rho guanine nucleotide exchange factors"""	13209	protein-coding gene	gene with protein product	"""transforming immortalized mammary oncogene"", ""guanine nucleotide regulatory protein TIM"""	600888				8134109, 7656213	Standard	NM_005435		Approved	TIM, TIM1, GEF5, P60	uc003wel.3	Q12774	OTTHUMG00000158004	ENST00000056217.5:c.4057C>T	7.37:g.144070294C>T	ENSP00000056217:p.Arg1353Trp	Somatic	1088	4		WXS	Illumina GAIIx	Phase_I	1518	429	NM_005435	0	0	0	0	0	A6NNJ2|Q6ZML7	Missense_Mutation	SNP	ENST00000056217.5	37	CCDS34771.1	.	.	.	.	.	.	.	.	.	.	C	18.62	3.663497	0.67700	.	.	ENSG00000050327	ENST00000056217;ENST00000344879;ENST00000471847	T;T	0.64260	-0.09;-0.09	4.81	3.92	0.45320	Dbl homology (DH) domain (5);	0.325870	0.28946	N	0.013630	T	0.71459	0.3342	L	0.49126	1.545	0.41458	D	0.988025	D;D	0.89917	0.999;1.0	D;D	0.81914	0.948;0.995	T	0.73455	-0.3977	10	0.87932	D	0	-12.3498	10.2046	0.43105	0.3604:0.6396:0.0:0.0	.	208;1353	B3KQX6;Q12774	.;ARHG5_HUMAN	W	1353;208;275	ENSP00000056217:R1353W;ENSP00000418227:R275W	ENSP00000056217:R1353W	R	+	1	2	ARHGEF5	143701227	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	1.906000	0.39887	1.218000	0.43458	0.655000	0.94253	CGG	.		0.498	ARHGEF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349981.1	NM_005435	
ASIC3	9311	broad.mit.edu	37	7	150746080	150746080	+	Silent	SNP	C	C	A			TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr7:150746080C>A	ENST00000349064.5	+	1	306	c.108C>A	c.(106-108)ggC>ggA	p.G36G	ASIC3_ENST00000357922.4_Silent_p.G36G|ASIC3_ENST00000297512.8_Silent_p.G36G	NM_004769.3|NM_020321.3	NP_004760.1|NP_064717.1	Q9UHC3	ASIC3_HUMAN	acid-sensing (proton-gated) ion channel 3	36					cation transmembrane transport (GO:0098655)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|ion transmembrane transport (GO:0034220)|response to acid chemical (GO:0001101)|response to acidic pH (GO:0010447)|response to heat (GO:0009408)|sensory perception (GO:0007600)|sensory perception of sour taste (GO:0050915)|signal transduction (GO:0007165)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|enterobactin transporter activity (GO:0042931)|ligand-gated sodium channel activity (GO:0015280)|sodium channel activity (GO:0005272)										TCGGGCCAGGCAGCCTGAGCC	0.697																																					p.G36G		.											.	.	0			c.C108A						.						39.0	41.0	40.0					7																	150746080		2202	4298	6500	SO:0001819	synonymous_variant	9311	exon1			GCCAGGCAGCCTG	AB010575	CCDS5914.1, CCDS5915.1, CCDS5916.1	7q35	2012-02-23	2012-02-22	2012-02-22	ENSG00000213199	ENSG00000213199		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	101	protein-coding gene	gene with protein product	"""testis sodium channel 1"""	611741	"""amiloride-sensitive cation channel 3, testis"", ""amiloride-sensitive cation channel 3"""	ACCN3		9571199, 9744806	Standard	NM_004769		Approved	TNaC1, DRASIC	uc003wio.3	Q9UHC3	OTTHUMG00000158685	ENST00000349064.5:c.108C>A	7.37:g.150746080C>A		Somatic	21	2		WXS	Illumina GAIIx	Phase_I	139	11	NM_020322	0	0	1	1	0	B2R9V0|O60263|O75906|Q59FN9|Q9UER8|Q9UHC4	Silent	SNP	ENST00000349064.5	37	CCDS5916.1																																																																																			.		0.697	ASIC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351725.1	NM_004769	
AGAP3	116988	broad.mit.edu	37	7	150835296	150835296	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr7:150835296C>A	ENST00000397238.2	+	12	1562	c.1562C>A	c.(1561-1563)gCt>gAt	p.A521D	AGAP3_ENST00000463381.1_Intron	NM_031946.4	NP_114152.3	Q96P47	AGAP3_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 3	485	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				cellular response to reactive oxygen species (GO:0034614)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein import into nucleus, translocation (GO:0000060)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(3)|liver(2)|lung(9)|ovary(2)|prostate(3)|urinary_tract(1)	28						TCGGCCTGGGCTGGCCCGCGC	0.721																																					p.A521D		.											.	AGAP3-92	0			c.C1562A						.						11.0	13.0	13.0					7																	150835296		2035	4182	6217	SO:0001583	missense	116988	exon12			CCTGGGCTGGCCC	AF413079	CCDS43681.1, CCDS55185.1, CCDS64802.1	7q36.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000133612	ENSG00000133612		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16923	protein-coding gene	gene with protein product			"""centaurin, gamma 3"""	CENTG3			Standard	NM_001042535		Approved		uc003wjg.1	Q96P47	OTTHUMG00000158724	ENST00000397238.2:c.1562C>A	7.37:g.150835296C>A	ENSP00000380413:p.Ala521Asp	Somatic	17	1		WXS	Illumina GAIIx	Phase_I	113	6	NM_031946	0	0	18	18	0	B3KNZ8|E9PAL8|Q59EN0|Q96RK3	Missense_Mutation	SNP	ENST00000397238.2	37	CCDS43681.1	.	.	.	.	.	.	.	.	.	.	C	10.94	1.493226	0.26774	.	.	ENSG00000133612	ENST00000397238;ENST00000335355	T	0.69435	-0.4	3.94	2.07	0.26955	.	0.547114	0.16828	N	0.197877	T	0.44052	0.1275	N	0.08118	0	0.58432	D	0.999998	P	0.37276	0.589	B	0.41088	0.347	T	0.14587	-1.0467	10	0.11794	T	0.64	.	9.2128	0.37328	0.0:0.816:0.0:0.184	.	521	Q96P47-4	.	D	521;485	ENSP00000380413:A521D	ENSP00000334157:A485D	A	+	2	0	AGAP3	150466229	0.933000	0.31639	0.629000	0.29254	0.724000	0.41520	1.295000	0.33377	0.848000	0.35191	0.462000	0.41574	GCT	.		0.721	AGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351908.3	NM_031946	
REEP4	80346	broad.mit.edu	37	8	21996554	21996554	+	Silent	SNP	G	G	T			TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr8:21996554G>T	ENST00000306306.3	-	6	906	c.438C>A	c.(436-438)ggC>ggA	p.G146G	REEP4_ENST00000523293.1_Silent_p.G146G|REEP4_ENST00000334530.5_Intron	NM_025232.2	NP_079508.2	Q9H6H4	REEP4_HUMAN	receptor accessory protein 4	146					mitotic nuclear division (GO:0007067)|mitotic nuclear envelope reassembly (GO:0007084)|nuclear envelope organization (GO:0006998)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|microtubule (GO:0005874)	microtubule binding (GO:0008017)			kidney(1)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	7				Colorectal(74;0.00187)|COAD - Colon adenocarcinoma(73;0.061)|READ - Rectum adenocarcinoma(644;0.0993)		TCCGCAGCCTGCCGGCCAGCG	0.662																																					p.G146G		.											.	REEP4-91	0			c.C438A						.																																			SO:0001819	synonymous_variant	80346	exon6			CAGCCTGCCGGCC	BC013048	CCDS6024.1	8p21.3	2008-05-02	2006-02-07	2006-02-07	ENSG00000168476	ENSG00000168476		"""Receptor accessory proteins"""	26176	protein-coding gene	gene with protein product		609349	"""chromosome 8 open reading frame 20"""	C8orf20		16271481, 15550249	Standard	NM_025232		Approved	FLJ22246, FLJ22277, PP432	uc003xau.1	Q9H6H4	OTTHUMG00000131491	ENST00000306306.3:c.438C>A	8.37:g.21996554G>T		Somatic	33	0		WXS	Illumina GAIIx	Phase_I	37	7	NM_025232	0	0	41	41	0	D3DSQ9|Q86VL1|Q9H6I5|Q9HBP4	Silent	SNP	ENST00000306306.3	37	CCDS6024.1																																																																																			.		0.662	REEP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254337.2	NM_025232	
TACC1	6867	bcgsc.ca	37	8	38677932	38677932	+	Silent	SNP	A	A	G	rs2013586	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr8:38677932A>G	ENST00000317827.4	+	3	1549	c.1170A>G	c.(1168-1170)gaA>gaG	p.E390E	TACC1_ENST00000519416.1_Silent_p.E195E|TACC1_ENST00000443286.2_Silent_p.E406E|TACC1_ENST00000520340.1_Silent_p.E354E|TACC1_ENST00000520973.1_Silent_p.E195E|TACC1_ENST00000520615.1_Silent_p.E195E|TACC1_ENST00000276520.8_Intron|TACC1_ENST00000348567.4_Intron|TACC1_ENST00000330691.6_Intron|TACC1_ENST00000520611.1_5'Flank|TACC1_ENST00000379931.3_Silent_p.E390E|TACC1_ENST00000518415.1_Silent_p.E345E|TACC1_ENST00000522752.1_Intron	NM_006283.2	NP_006274.2	O75410	TACC1_HUMAN	transforming, acidic coiled-coil containing protein 1	390	Interaction with YEATS4.|SPAZ 2.				cell cycle (GO:0007049)|cell division (GO:0051301)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|microtubule cytoskeleton organization (GO:0000226)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)		p.E390E(1)		breast(4)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|skin(3)	17		all_lung(54;0.00292)|Lung NSC(58;0.0115)|Hepatocellular(245;0.065)	LUSC - Lung squamous cell carcinoma(45;1.7e-09)|COAD - Colon adenocarcinoma(9;0.235)			GTCAGTGGGAAAGCCCCAGCT	0.547													A|||	1257	0.250998	0.112	0.2594	5008	,	,		17274	0.2688		0.3887	False		,,,				2504	0.273				p.E390E		.											.	TACC1-187	1	Substitution - coding silent(1)	stomach(1)	c.A1170G						.	A	,,	690,3716	288.9+/-280.1	39,612,1552	112.0	114.0	113.0		,585,1170	-7.8	0.0	8	dbSNP_92	113	3562,5038	517.0+/-379.0	754,2054,1492	no	intron,coding-synonymous,coding-synonymous	TACC1	NM_001122824.1,NM_001146216.2,NM_006283.2	,,	793,2666,3044	GG,GA,AA		41.4186,15.6605,32.6926	,,	,195/611,390/806	38677932	4252,8754	2203	4300	6503	SO:0001819	synonymous_variant	6867	exon3			GTGGGAAAGCCCC	AF049910	CCDS6109.1, CCDS47845.1, CCDS55224.1	8p11	2012-12-20			ENSG00000147526	ENSG00000147526			11522	protein-coding gene	gene with protein product		605301					Standard	NM_006283		Approved		uc010lwp.3	O75410	OTTHUMG00000164018	ENST00000317827.4:c.1170A>G	8.37:g.38677932A>G		Somatic	93	0		WXS	Illumina GAIIx	Phase_I	104	5	NM_006283	0	0	10	10	0	B2RBD9|D3DSX6|Q6Y687|Q86YG7|Q8IUJ2|Q8IUJ3|Q8IUJ4|Q8IZG2|Q8NEY7|Q9UPP9	Silent	SNP	ENST00000317827.4	37	CCDS6109.1	608	0.2783882783882784	59	0.11991869918699187	94	0.2596685082872928	154	0.2692307692307692	301	0.3970976253298153	A	5.770	0.326458	0.10900	0.156605	0.414186	ENSG00000147526	ENST00000521866;ENST00000518809	.	.	.	5.4	-7.82	0.01205	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.47341	P	6.059999999999954E-4	.	.	.	.	.	.	T	0.34030	-0.9845	3	.	.	.	0.0051	5.4787	0.16710	0.1022:0.4703:0.1079:0.3196	rs2013586;rs3739249;rs17514141;rs17854120;rs58803062;rs2013586	.	.	.	R	165;28	.	.	K	+	2	0	TACC1	38797089	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	-1.316000	0.02710	-1.870000	0.01139	-0.890000	0.02929	AAA	A|0.696;G|0.304		0.547	TACC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000376768.1	NM_006283	
TRPA1	8989	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	72981348	72981348	+	Silent	SNP	G	G	T	rs146503939		TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr8:72981348G>T	ENST00000262209.4	-	3	561	c.354C>A	c.(352-354)ctC>ctA	p.L118L		NM_007332.2	NP_015628.2	O75762	TRPA1_HUMAN	transient receptor potential cation channel, subfamily A, member 1	118					calcium ion transmembrane transport (GO:0070588)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to pain (GO:0048265)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium bundle (GO:0032421)	calcium channel activity (GO:0005262)|channel activity (GO:0015267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(26)|lung(44)|ovary(4)|prostate(6)|stomach(1)	98			Epithelial(68;0.223)		Menthol(DB00825)	CTCCTCTGCTGAGAAGAAACT	0.423																																					p.L118L		.											.	TRPA1-230	0			c.C354A						.						198.0	208.0	204.0					8																	72981348		2203	4300	6503	SO:0001819	synonymous_variant	8989	exon3			TCTGCTGAGAAGA	Y10601	CCDS34908.1	8q13	2013-01-10	2003-11-20	2003-11-20	ENSG00000104321	ENSG00000104321		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	497	protein-coding gene	gene with protein product		604775	"""ankyrin-like with transmembrane domains 1"""	ANKTM1		16382100	Standard	NM_007332		Approved		uc003xza.3	O75762	OTTHUMG00000164516	ENST00000262209.4:c.354C>A	8.37:g.72981348G>T		Somatic	79	0		WXS	Illumina GAIIx	Phase_I	90	40	NM_007332	0	0	0	0	0	A6NIN6	Silent	SNP	ENST00000262209.4	37	CCDS34908.1																																																																																			G|1.000;C|0.000		0.423	TRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379079.2	NM_007332	
E2F5	1875	hgsc.bcm.edu	37	8	86089787	86089787	+	Silent	SNP	C	C	G	rs12926	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr8:86089787C>G	ENST00000416274.2	+	1	166	c.132C>G	c.(130-132)gcC>gcG	p.A44A	E2F5_ENST00000256117.5_Silent_p.A44A|RP11-219B4.3_ENST00000520129.1_RNA|RP11-219B4.7_ENST00000566000.1_RNA|RP11-219B4.7_ENST00000562577.1_RNA|E2F5_ENST00000418930.2_Silent_p.A44A	NM_001083588.1|NM_001951.3	NP_001077057.1|NP_001942.2	Q15329	E2F5_HUMAN	E2F transcription factor 5, p130-binding	44					gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			NS(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)	8						TCGGGGGCGCCGGGGGCGGCA	0.751													C|||	2815	0.562101	0.5545	0.549	5008	,	,		6370	0.4157		0.6928	False		,,,				2504	0.5982				p.A44A		.											.	E2F5-415	0			c.C132G						.	C	,	2392,1558		800,792,383	4.0	5.0	5.0		132,132	0.9	0.1	8	dbSNP_52	5	5668,2428		2076,1516,456	no	coding-synonymous,coding-synonymous	E2F5	NM_001083588.1,NM_001951.3	,	2876,2308,839	GG,GC,CC		29.9901,39.443,33.0898	,	44/346,44/347	86089787	8060,3986	1975	4048	6023	SO:0001819	synonymous_variant	1875	exon1			GGGCGCCGGGGGC	X86097	CCDS47885.1, CCDS47886.1, CCDS55254.1	8q21.2	2004-01-29			ENSG00000133740	ENSG00000133740			3119	protein-coding gene	gene with protein product		600967				7892279	Standard	NM_001083588		Approved		uc003ycz.4	Q15329	OTTHUMG00000164785	ENST00000416274.2:c.132C>G	8.37:g.86089787C>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	5	NM_001083588	0	0	2	2	0	E9PBN9|Q16601|Q92756	Silent	SNP	ENST00000416274.2	37	CCDS47885.1																																																																																			C|0.434;G|0.566		0.751	E2F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000380274.1	NM_001951	
MROH6	642475	hgsc.bcm.edu	37	8	144649601	144649601	+	Silent	SNP	A	A	G	rs13268196	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr8:144649601A>G	ENST00000398882.3	-	14	2224	c.1968T>C	c.(1966-1968)gcT>gcC	p.A656A	MROH6_ENST00000533679.1_5'UTR|MROH6_ENST00000524906.1_5'UTR|MROH6_ENST00000532704.1_Intron|MROH6_ENST00000534459.1_5'UTR	NM_001100878.1	NP_001094348.1	A6NGR9	MROH6_HUMAN	maestro heat-like repeat family member 6	656																	CCGCGGCCACAGCCGGCTTGG	0.776													G|||	4732	0.944888	0.8018	0.9827	5008	,	,		8608	1.0		0.998	False		,,,				2504	1.0				p.A656A		.											.	.	0			c.T1968C						.						1.0	2.0	2.0					8																	144649601		1007	2126	3133	SO:0001819	synonymous_variant	642475	exon14			GGCCACAGCCGGC	AF289596	CCDS47928.1	8q24.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000204839	ENSG00000204839		"""maestro heat-like repeat containing"""	27814	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 73"""	C8orf73		12477932	Standard	NM_001100878		Approved		uc010mff.3	A6NGR9	OTTHUMG00000165164	ENST00000398882.3:c.1968T>C	8.37:g.144649601A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	9	NM_001100878	0	0	0	11	11	A8MWB1	Silent	SNP	ENST00000398882.3	37	CCDS47928.1																																																																																			A|0.057;G|0.943		0.776	MROH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382330.3	NM_001100878	
MROH6	642475	hgsc.bcm.edu	37	8	144649625	144649625	+	Silent	SNP	T	T	C	rs10097556	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr8:144649625T>C	ENST00000398882.3	-	14	2200	c.1944A>G	c.(1942-1944)cgA>cgG	p.R648R	MROH6_ENST00000533679.1_5'UTR|MROH6_ENST00000524906.1_5'UTR|MROH6_ENST00000532704.1_Intron|MROH6_ENST00000534459.1_5'UTR	NM_001100878.1	NP_001094348.1	A6NGR9	MROH6_HUMAN	maestro heat-like repeat family member 6	648																	CGCTCTGCAGTCGCCCTAGGT	0.771													C|||	4736	0.945687	0.8041	0.9841	5008	,	,		9094	1.0		0.998	False		,,,				2504	1.0				p.R648R		.											.	.	0			c.A1944G						.						2.0	3.0	2.0					8																	144649625		1227	2564	3791	SO:0001819	synonymous_variant	642475	exon14			CTGCAGTCGCCCT	AF289596	CCDS47928.1	8q24.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000204839	ENSG00000204839		"""maestro heat-like repeat containing"""	27814	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 73"""	C8orf73		12477932	Standard	NM_001100878		Approved		uc010mff.3	A6NGR9	OTTHUMG00000165164	ENST00000398882.3:c.1944A>G	8.37:g.144649625T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	17	17	NM_001100878	0	0	0	0	0	A8MWB1	Silent	SNP	ENST00000398882.3	37	CCDS47928.1																																																																																			T|0.058;C|0.942		0.771	MROH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382330.3	NM_001100878	
ERMP1	79956	hgsc.bcm.edu	37	9	5832728	5832728	+	Silent	SNP	G	G	C	rs1131727	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr9:5832728G>C	ENST00000339450.5	-	1	389	c.300C>G	c.(298-300)gcC>gcG	p.A100A	ERMP1_ENST00000381506.3_5'Flank|ERMP1_ENST00000214893.5_5'UTR	NM_024896.2	NP_079172.2	Q7Z2K6	ERMP1_HUMAN	endoplasmic reticulum metallopeptidase 1	100						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			endometrium(2)|kidney(1)|large_intestine(9)|lung(4)|ovary(1)|prostate(2)|skin(1)	20		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00115)|Lung(218;0.111)		GGTGTCCAGCGGCCCCGCGTA	0.741													G|||	2021	0.403554	0.1309	0.428	5008	,	,		3601	0.7093		0.34	False		,,,				2504	0.5051				p.A100A		.											.	ERMP1-69	0			c.C300G						.						4.0	3.0	3.0					9																	5832728		1620	3326	4946	SO:0001819	synonymous_variant	79956	exon1			TCCAGCGGCCCCG	AB058718	CCDS34983.1	9p24	2008-02-05	2007-07-05	2007-07-05	ENSG00000099219	ENSG00000099219			23703	protein-coding gene	gene with protein product	"""Felix-ina"""	611156	"""KIAA1815"""	KIAA1815		11347906	Standard	XM_005251587		Approved	FLJ23309, FXNA	uc003zjm.1	Q7Z2K6	OTTHUMG00000019508	ENST00000339450.5:c.300C>G	9.37:g.5832728G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	21	20	NM_024896	0	0	0	0	0	B2RNA4|B3KSB1|Q8N5T5|Q9H5M1	Silent	SNP	ENST00000339450.5	37	CCDS34983.1																																																																																			G|0.572;C|0.428		0.741	ERMP1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354877.1	NM_024896	
IL33	90865	bcgsc.ca	37	9	6241723	6241723	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr9:6241723A>G	ENST00000381434.3	+	1	42	c.29A>G	c.(28-30)aAc>aGc	p.N10S	IL33_ENST00000417746.2_Missense_Mutation_p.N10S|IL33_ENST00000456383.2_Missense_Mutation_p.N10S|IL33_ENST00000463336.1_3'UTR	NM_033439.3	NP_254274.1	O95760	IL33_HUMAN	interleukin 33	10	Homeodomain-like HTH domain.				extrinsic apoptotic signaling pathway (GO:0097191)|negative regulation of immunoglobulin secretion (GO:0051025)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of leukocyte migration (GO:0002686)|negative regulation of T-helper 1 type immune response (GO:0002826)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of immunoglobulin secretion (GO:0051024)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of macrophage activation (GO:0043032)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type 2 immune response (GO:0002830)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|nucleus (GO:0005634)	cytokine activity (GO:0005125)			breast(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(4)|stomach(1)|urinary_tract(1)	16		Acute lymphoblastic leukemia(23;0.158)|Prostate(43;0.167)		GBM - Glioblastoma multiforme(50;0.0161)|Lung(218;0.105)		TATTCAACCAACAAAATTTCC	0.333																																					p.N10S		.											.	IL33-90	0			c.A29G						.						91.0	86.0	88.0					9																	6241723		2203	4300	6503	SO:0001583	missense	90865	exon2			CAACCAACAAAAT	AB024518	CCDS6468.1, CCDS56563.1, CCDS56564.1	9p24.1	2014-01-28	2006-11-20	2006-11-20	ENSG00000137033	ENSG00000137033		"""Interleukins and interleukin receptors"""	16028	protein-coding gene	gene with protein product	"""DVS27-related protein"", ""nuclear factor for high endothelial venules"", ""interleukin-1 family, member 11"""	608678	"""chromosome 9 open reading frame 26 (NF-HEV)"""	C9orf26		10566975, 12819012	Standard	NM_033439		Approved	DVS27, DKFZp586H0523, NF-HEV, IL1F11	uc003zjt.3	O95760	OTTHUMG00000019516	ENST00000381434.3:c.29A>G	9.37:g.6241723A>G	ENSP00000370842:p.Asn10Ser	Somatic	157	0		WXS	Illumina GAIIx	Phase_I	90	4	NM_001199640	0	0	0	0	0	B2R8L1|B4DJ35|B4E1Q9|D3DRI5|E7EAX4|Q2YEJ5	Missense_Mutation	SNP	ENST00000381434.3	37	CCDS6468.1	.	.	.	.	.	.	.	.	.	.	A	9.558	1.117764	0.20877	.	.	ENSG00000137033	ENST00000417746;ENST00000456383;ENST00000381434	T;T;T	0.40225	1.04;1.04;1.04	4.26	-4.35	0.03656	.	1.439780	0.04298	N	0.346873	T	0.15132	0.0365	N	0.05078	-0.115	0.09310	N	1	B;B;B	0.12013	0.001;0.005;0.005	B;B;B	0.09377	0.002;0.004;0.004	T	0.13361	-1.0512	10	0.07175	T	0.84	-0.0332	1.4369	0.02345	0.2874:0.1999:0.3445:0.1682	.	10;10;10	B4DJ35;B4E1Q9;O95760	.;.;IL33_HUMAN	S	10	ENSP00000394039:N10S;ENSP00000414238:N10S;ENSP00000370842:N10S	ENSP00000370842:N10S	N	+	2	0	IL33	6231723	0.000000	0.05858	0.000000	0.03702	0.821000	0.46438	-0.456000	0.06754	-0.914000	0.03827	0.397000	0.26171	AAC	.		0.333	IL33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051655.1	NM_033439	
PTPRD	5789	broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	8376721	8376721	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr9:8376721C>A	ENST00000381196.4	-	35	4935	c.4392G>T	c.(4390-4392)aaG>aaT	p.K1464N	PTPRD_ENST00000486161.1_Missense_Mutation_p.K1057N|PTPRD_ENST00000397617.3_Missense_Mutation_p.K1057N|PTPRD_ENST00000397611.3_Missense_Mutation_p.K1054N|PTPRD_ENST00000540109.1_Missense_Mutation_p.K1464N|PTPRD_ENST00000356435.5_Missense_Mutation_p.K1464N|PTPRD_ENST00000397606.3_Missense_Mutation_p.K1057N|PTPRD_ENST00000537002.1_Missense_Mutation_p.K1054N|PTPRD_ENST00000360074.4_Missense_Mutation_p.K1451N|PTPRD_ENST00000355233.5_Missense_Mutation_p.K1058N|PTPRD_ENST00000358503.5_Missense_Mutation_p.K1442N	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	1464	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		ACTGGTCACACTTCACCTACA	0.443										TSP Lung(15;0.13)																											p.K1464N		.											.	PTPRD-912	0			c.G4392T						.						153.0	127.0	136.0					9																	8376721		2203	4300	6503	SO:0001583	missense	5789	exon38			GTCACACTTCACC	X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.4392G>T	9.37:g.8376721C>A	ENSP00000370593:p.Lys1464Asn	Somatic	119	1		WXS	Illumina GAIIx	Phase_I	87	31	NM_002839	0	0	0	0	0	B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Missense_Mutation	SNP	ENST00000381196.4	37	CCDS43786.1	.	.	.	.	.	.	.	.	.	.	C	16.35	3.098988	0.56183	.	.	ENSG00000153707	ENST00000381196;ENST00000356435;ENST00000360074;ENST00000358503;ENST00000355233;ENST00000397617;ENST00000397611;ENST00000537002;ENST00000346816;ENST00000540109;ENST00000486161;ENST00000397606	T;T;T;T;T;T;T;T;T;T;T	0.40756	1.02;1.02;1.02;1.02;1.02;1.02;1.02;1.02;1.02;1.02;1.02	5.57	3.38	0.38709	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.000000	0.85682	D	0.000000	T	0.69450	0.3112	M	0.93898	3.47	0.80722	D	1	D;D;D;D;D;D;D;D;D	0.89917	1.0;0.999;0.999;0.999;1.0;0.999;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D	0.97110	0.999;0.997;0.997;0.997;0.999;0.995;1.0;1.0;1.0	T	0.75309	-0.3363	9	.	.	.	.	9.5644	0.39389	0.0:0.7044:0.0:0.2956	.	1057;1048;1057;1058;1054;1054;1451;1464;1464	Q3KPJ2;Q3KPI9;Q3KPJ0;Q3KPJ1;F5GWT7;F5GWY7;G3XAE2;Q2HXI4;P23468	.;.;.;.;.;.;.;.;PTPRD_HUMAN	N	1464;1464;1451;1442;1058;1057;1054;1054;935;1464;1057;1057	ENSP00000370593:K1464N;ENSP00000348812:K1464N;ENSP00000353187:K1451N;ENSP00000351293:K1442N;ENSP00000347373:K1058N;ENSP00000380741:K1057N;ENSP00000380735:K1054N;ENSP00000440515:K1054N;ENSP00000438164:K1464N;ENSP00000417093:K1057N;ENSP00000380731:K1057N	.	K	-	3	2	PTPRD	8366721	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.084000	0.30828	1.352000	0.45808	0.591000	0.81541	AAG	.		0.443	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055395.3		
PSIP1	11168	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	15478495	15478495	+	Silent	SNP	G	G	A			TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr9:15478495G>A	ENST00000380733.4	-	8	952	c.609C>T	c.(607-609)ccC>ccT	p.P203P	PSIP1_ENST00000380716.4_Silent_p.P203P|PSIP1_ENST00000380738.4_Silent_p.P203P|PSIP1_ENST00000380715.1_Silent_p.P203P|PSIP1_ENST00000397519.2_Silent_p.P203P			O75475	PSIP1_HUMAN	PC4 and SFRS1 interacting protein 1	203					establishment of integrated proviral latency (GO:0075713)|mRNA 5'-splice site recognition (GO:0000395)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to heat (GO:0009408)|response to oxidative stress (GO:0006979)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear heterochromatin (GO:0005720)|nuclear periphery (GO:0034399)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptionally active chromatin (GO:0035327)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription coactivator activity (GO:0001105)|supercoiled DNA binding (GO:0097100)			breast(2)|endometrium(2)|kidney(1)|lung(3)|prostate(1)	9				GBM - Glioblastoma multiforme(50;2.38e-06)		CTGAAGGACAGGGCTGTTTTA	0.328																																					p.P203P		.											.	PSIP1-658	0			c.C609T						.						153.0	152.0	152.0					9																	15478495		2203	4299	6502	SO:0001819	synonymous_variant	11168	exon7			AGGACAGGGCTGT	AF098482	CCDS6479.1, CCDS6480.1	9p22.2	2008-02-05	2004-02-24		ENSG00000164985	ENSG00000164985			9527	protein-coding gene	gene with protein product		603620	"""PC4 and SFRS1 interacting protein 2"""	PSIP2		9822615, 9885563	Standard	NM_033222		Approved	p52, LEDGF, p75	uc003zlw.4	O75475	OTTHUMG00000021021	ENST00000380733.4:c.609C>T	9.37:g.15478495G>A		Somatic	301	0		WXS	Illumina GAIIx	Phase_I	186	12	NM_021144	0	0	40	44	4	D3DRI9|O00256|O95368|Q6P391|Q86YB9|Q9NZI3|Q9UER6	Silent	SNP	ENST00000380733.4	37	CCDS6479.1																																																																																			.		0.328	PSIP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055445.1	NM_033222	
AKAP2	11217	hgsc.bcm.edu	37	9	112811038	112811038	+	Missense_Mutation	SNP	C	C	T	rs78923754	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr9:112811038C>T	ENST00000374525.1	+	1	63	c.59C>T	c.(58-60)cCg>cTg	p.P20L	AKAP2_ENST00000434623.2_Missense_Mutation_p.P20L|AKAP2_ENST00000555236.1_Intron|PALM2-AKAP2_ENST00000302798.7_Intron|PALM2-AKAP2_ENST00000374530.3_Intron|AKAP2_ENST00000510514.5_Intron	NM_001004065.4	NP_001004065.2	Q9Y2D5	AKAP2_HUMAN	A kinase (PRKA) anchor protein 2	374										breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	33						CCTGGACCCCCGGAGTCTCCT	0.776													-|||	379	0.0756789	0.0703	0.0879	5008	,	,		9335	0.0298		0.0954	False		,,,				2504	0.1012				p.P20L		.											.	AKAP2-24	0			c.C59T						.	C	LEU/PRO,LEU/PRO,,	146,2418		2,142,1138	2.0	3.0	2.0		59,59,,	0.3	0.0	9	dbSNP_132	2	557,5611		13,531,2540	no	missense,missense,intron,intron	AKAP2,PALM2-AKAP2	NM_001004065.4,NM_001198656.1,NM_007203.4,NM_147150.2	98,98,,	15,673,3678	TT,TC,CC		9.0305,5.6942,8.0508	,,,	20/949,20/962,,	112811038	703,8029	1282	3084	4366	SO:0001583	missense	11217	exon1			GACCCCCGGAGTC	AB023137	CCDS43861.1, CCDS48003.1, CCDS56581.1	9q31.3	2009-10-16			ENSG00000241978	ENSG00000241978		"""A-kinase anchor proteins"""	372	protein-coding gene	gene with protein product	"""protein kinase A2"""	604582		PRKA2		10231032	Standard	NM_001136562		Approved	AKAP-KL, KIAA0920, DKFZp564L0716		Q9Y2D5	OTTHUMG00000156811	ENST00000374525.1:c.59C>T	9.37:g.112811038C>T	ENSP00000363649:p.Pro20Leu	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	17	9	NM_001004065	0	0	1	1	0	B1ALX9|B2RTU4|B3KQ00|B4DTZ2|B7ZW07|B9EJB5|Q9UG26	Missense_Mutation	SNP	ENST00000374525.1	37	CCDS43861.1	184	0.08424908424908426	48	0.0975609756097561	42	0.11602209944751381	16	0.027972027972027972	78	0.10290237467018469	-	6.449	0.450901	0.12223	0.056942	0.090305	ENSG00000241978	ENST00000434623;ENST00000374525	T;T	0.44482	1.5;0.92	3.3	0.302	0.15786	.	.	.	.	.	T	0.00412	0.0013	.	.	.	0.58432	P	5.000000000032756E-6	B;B	0.11235	0.001;0.004	B;B	0.04013	0.001;0.001	T	0.06972	-1.0797	7	0.72032	D	0.01	-9.3294	7.3755	0.26825	0.0:0.6472:0.0:0.3528	.	20;21	Q9Y2D5-7;B1ALY1	.;.	L	20	ENSP00000404782:P20L;ENSP00000363649:P20L	ENSP00000363649:P20L	P	+	2	0	AKAP2	111850859	0.208000	0.23494	0.001000	0.08648	0.000000	0.00434	0.026000	0.13599	-0.068000	0.12953	-1.980000	0.00456	CCG	C|0.917;T|0.083		0.776	AKAP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000053609.3	NM_001004065	
CRB2	286204	hgsc.bcm.edu	37	9	126135831	126135831	+	Silent	SNP	T	T	C	rs7848449	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr9:126135831T>C	ENST00000373631.3	+	10	3022	c.3021T>C	c.(3019-3021)gcT>gcC	p.A1007A	CRB2_ENST00000373629.2_Silent_p.A675A|CRB2_ENST00000359999.3_Silent_p.A1007A	NM_173689.5	NP_775960.4	Q5IJ48	CRUM2_HUMAN	crumbs family member 2	1007	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cardiovascular system development (GO:0072358)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|mesoderm formation (GO:0001707)|negative regulation of endopeptidase activity (GO:0010951)|notochord formation (GO:0014028)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|somitogenesis (GO:0001756)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)			NS(2)|breast(1)|cervix(1)|endometrium(2)|lung(11)|ovary(1)|prostate(2)|skin(3)	23						TCCTGCTGGCTGAGAACTTCA	0.766													C|||	691	0.137979	0.2436	0.1383	5008	,	,		8285	0.0556		0.0944	False		,,,				2504	0.1247				p.A1007A		.											.	CRB2-91	0			c.T3021C						.	C		511,2581		46,419,1081	6.0	6.0	6.0		3021	-6.8	0.9	9	dbSNP_116	6	457,5659		17,423,2618	no	coding-synonymous	CRB2	NM_173689.5		63,842,3699	CC,CT,TT		7.4722,16.5265,10.5126		1007/1286	126135831	968,8240	1546	3058	4604	SO:0001819	synonymous_variant	286204	exon10			GCTGGCTGAGAAC	AK095783	CCDS6852.2	9q33.2	2014-02-06	2014-02-06		ENSG00000148204	ENSG00000148204			18688	protein-coding gene	gene with protein product		609720	"""crumbs homolog 2 (Drosophila)"""			14767562	Standard	XM_005251934		Approved	FLJ38464, FLJ16786	uc004bnx.1	Q5IJ48	OTTHUMG00000020638	ENST00000373631.3:c.3021T>C	9.37:g.126135831T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	13	13	NM_173689	0	0	0	0	0	A2A3N4|Q0QD46|Q5JS41|Q5JS43|Q6ZTA9|Q6ZWI6	Silent	SNP	ENST00000373631.3	37	CCDS6852.2																																																																																			T|0.886;C|0.114		0.766	CRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053990.3	NM_173689	
GPR144	347088	hgsc.bcm.edu	37	9	127215430	127215430	+	Missense_Mutation	SNP	G	G	C	rs184300525	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr9:127215430G>C	ENST00000334810.1	+	4	454	c.454G>C	c.(454-456)Gac>Cac	p.D152H				Q7Z7M1	GP144_HUMAN	G protein-coupled receptor 144	152	Pentaxin.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(3)	4						CGTGCAGTGGGACTGTGCCTC	0.741													G|||	35	0.00698882	0.0242	0.0029	5008	,	,		10350	0.0		0.001	False		,,,				2504	0.0				p.D152H		.											.	.	0			c.G454C						.						6.0	8.0	7.0					9																	127215430		677	1550	2227	SO:0001583	missense	347088	exon4			CAGTGGGACTGTG	AY278562		9q34.11	2014-08-08			ENSG00000180264	ENSG00000180264		"""-"", ""GPCR / Class B : Orphans"""	18651	protein-coding gene	gene with protein product							Standard	XM_006710216		Approved	PGR24	uc010mwn.3	Q7Z7M1	OTTHUMG00000020652	ENST00000334810.1:c.454G>C	9.37:g.127215430G>C	ENSP00000335156:p.Asp152His	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	36	13	NM_001161808	0	0	0	0	0	Q86SL4|Q8NH12	Missense_Mutation	SNP	ENST00000334810.1	37	CCDS48016.1	20	0.009157509157509158	19	0.03861788617886179	1	0.0027624309392265192	0	0.0	0	0.0	G	20.4	3.977027	0.74360	.	.	ENSG00000180264	ENST00000334810	T	0.66815	-0.23	3.88	0.728	0.18260	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	.	.	.	.	T	0.39358	0.1075	L	0.51422	1.61	0.31733	N	0.636745	D	0.67145	0.996	D	0.64237	0.923	T	0.61574	-0.7035	9	0.72032	D	0.01	.	5.762	0.18205	0.1787:0.0:0.67:0.1513	.	152	Q7Z7M1	GP144_HUMAN	H	152	ENSP00000335156:D152H	ENSP00000335156:D152H	D	+	1	0	GPR144	126255251	1.000000	0.71417	0.184000	0.23157	0.421000	0.31385	2.329000	0.43876	0.114000	0.18032	0.313000	0.20887	GAC	G|0.991;C|0.009		0.741	GPR144-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054026.2	NM_182611	
FPGS	2356	hgsc.bcm.edu	37	9	130565267	130565267	+	Missense_Mutation	SNP	A	A	G	rs11554717|rs10760502	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr9:130565267A>G	ENST00000373247.2	+	1	114	c.64A>G	c.(64-66)Ata>Gta	p.I22V	FPGS_ENST00000373225.3_5'Flank|FPGS_ENST00000393706.2_Missense_Mutation_p.I22V|FPGS_ENST00000460181.1_3'UTR|FPGS_ENST00000373245.1_Missense_Mutation_p.I22V	NM_004957.4	NP_004948.4	Q05932	FOLC_HUMAN	folylpolyglutamate synthase	22			I -> V (in dbSNP:rs10760502). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:7721888}.		brain development (GO:0007420)|folic acid metabolic process (GO:0046655)|liver development (GO:0001889)|nucleobase-containing compound metabolic process (GO:0006139)|one-carbon metabolic process (GO:0006730)|organ regeneration (GO:0031100)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|tetrahydrofolylpolyglutamate synthase activity (GO:0004326)			endometrium(2)|kidney(1)|lung(3)|ovary(1)	7					Methotrexate(DB00563)|Pralatrexate(DB06813)|Raltitrexed(DB00293)	TGCGCGCGGCATAACGACCCA	0.761													g|||	3912	0.78115	0.8956	0.6153	5008	,	,		6680	0.9583		0.6352	False		,,,				2504	0.7117				p.I22V		.											.	FPGS-90	0			c.A64G						.		VAL/ILE	2249,281		997,255,13	1.0	3.0	2.0		64	1.8	0.0	9	dbSNP_120	2	3848,1396		1394,1060,168	no	missense	FPGS	NM_004957.4	29	2391,1315,181	GG,GA,AA		26.6209,11.1067,21.5719	benign	22/588	130565267	6097,1677	1265	2622	3887	SO:0001583	missense	2356	exon1			CGCGGCATAACGA		CCDS35148.1, CCDS35149.1, CCDS75905.1	9q34.11	2013-09-19			ENSG00000136877	ENSG00000136877	6.3.2.17		3824	protein-coding gene	gene with protein product		136510					Standard	NM_004957		Approved		uc004bsg.1	Q05932	OTTHUMG00000020716	ENST00000373247.2:c.64A>G	9.37:g.130565267A>G	ENSP00000362344:p.Ile22Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	12	12	NM_004957	0	0	0	0	0	B3KPW4|B7Z2Z3|F5H0K6|Q5JU19|Q5JU22|Q6P2P6	Missense_Mutation	SNP	ENST00000373247.2	37	CCDS35148.1	1668	0.7637362637362637	432	0.8780487804878049	215	0.5939226519337016	545	0.9527972027972028	476	0.6279683377308707	g	3.002	-0.205821	0.06180	0.888933	0.733791	ENSG00000136877	ENST00000373247;ENST00000373245;ENST00000393706;ENST00000373228	T;T;T;T	0.29655	3.02;1.56;3.03;1.56	4.93	1.83	0.25207	.	0.868559	0.09918	N	0.738853	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.37361	-0.9709	9	0.02654	T	1	-12.2003	6.0757	0.19913	0.2469:0.2097:0.5434:0.0	rs10760502;rs17855899;rs56845445	22;22	Q05932-4;Q05932	.;FOLC_HUMAN	V	22	ENSP00000362344:I22V;ENSP00000362342:I22V;ENSP00000377309:I22V;ENSP00000362325:I22V	ENSP00000362325:I22V	I	+	1	0	FPGS	129605088	0.000000	0.05858	0.001000	0.08648	0.021000	0.10359	0.242000	0.18087	0.210000	0.20664	-0.258000	0.10820	ATA	A|0.235;G|0.765		0.761	FPGS-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054251.1		
WDR34	89891	hgsc.bcm.edu	37	9	131418828	131418828	+	Missense_Mutation	SNP	A	A	C	rs4837292		TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr9:131418828A>C	ENST00000372715.2	-	1	238	c.178T>G	c.(178-180)Tgg>Ggg	p.W60G		NM_052844.3	NP_443076.2	Q96EX3	WDR34_HUMAN	WD repeat domain 34	60				W -> G (in Ref. 2; AAH11874/AAH01614). {ECO:0000305}.		axoneme (GO:0005930)|centriole (GO:0005814)|ciliary basal body (GO:0036064)				central_nervous_system(2)|lung(5)|skin(1)|urinary_tract(1)	9						ACCGTCTCCCAGCGGATGCCC	0.806																																					p.W60G		.											.	WDR34-92	0			c.T178G						.	C	GLY/TRP	1803,9		897,9,0	1.0	1.0	1.0		178	2.1	1.0	9	dbSNP_111	1	3858,0		1929,0,0	no	missense	WDR34	NM_052844.3	184	2826,9,0	CC,CA,AA		0.0,0.4967,0.1587	benign	60/537	131418828	5661,9	906	1929	2835	SO:0001583	missense	89891	exon1			TCTCCCAGCGGAT	BC011874	CCDS6906.2	9q34.11	2013-11-15	2013-02-19	2013-02-19	ENSG00000119333	ENSG00000119333		"""WD repeat domain containing"""	28296	protein-coding gene	gene with protein product		613363				19521662, 21953912, 24183451	Standard	NM_052844		Approved	DIC5, MGC20486, bA216B9.3, FAP133	uc004bvq.1	Q96EX3	OTTHUMG00000020750	ENST00000372715.2:c.178T>G	9.37:g.131418828A>C	ENSP00000361800:p.Trp60Gly	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_052844	0	0	0	0	0	Q5VXV4|Q9BV46	Missense_Mutation	SNP	ENST00000372715.2	37	CCDS6906.2	2170	0.9935897435897436	486	0.9878048780487805	362	1.0	571	0.9982517482517482	751	0.9907651715039578	C	7.343	0.621247	0.14193	0.995033	1.0	ENSG00000119333	ENST00000372715;ENST00000451652;ENST00000419989	T;T;T	0.74106	-0.81;-0.81;-0.81	4.02	2.12	0.27331	.	0.538297	0.18788	N	0.131154	T	0.00012	0.0000	N	0.00538	-1.39	0.58432	P	1.999999999946489E-6	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.34625	-0.9821	9	0.08381	T	0.77	-3.0135	7.4804	0.27402	0.1755:0.4462:0.3784:0.0	rs4837292;rs56752541	45;60	A2A3F8;Q96EX3	.;WDR34_HUMAN	G	60;51;45	ENSP00000361800:W60G;ENSP00000411370:W51G;ENSP00000415421:W45G	ENSP00000361800:W60G	W	-	1	0	WDR34	130458649	1.000000	0.71417	0.994000	0.49952	0.970000	0.65996	0.709000	0.25734	0.259000	0.21709	-0.126000	0.14955	TGG	A|0.006;C|0.994		0.806	WDR34-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054463.1	NM_052844	
CXorf58	254158	bcgsc.ca	37	X	23933912	23933912	+	Splice_Site	SNP	G	G	A	rs62584865	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chrX:23933912G>A	ENST00000379211.3	+	4	860		c.e4+1			NM_001169574.1|NM_152761.2	NP_001163045.1|NP_689974.2	Q96LI9	CX058_HUMAN	chromosome X open reading frame 58											breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(2)|prostate(1)	14						TTAGATTCAGGTAATGTATCT	0.308													G|||	15	0.00397351	0.0	0.0029	3775	,	,		14821	0.0		0.006	False		,,,				2504	0.0072				.		.											.	CXorf58-130	0			c.311+1G>A						.	G	,	9,3825		0,5,4,1627,566	51.0	43.0	46.0		,	5.8	1.0	X	dbSNP_129	46	128,6599		0,98,30,2330,1841	yes	splice-5,splice-5	CXorf58	NM_001169574.1,NM_152761.2	,	0,103,34,3957,2407	AA,AG,A,GG,G		1.9028,0.2347,1.2972	,	,	23933912	137,10424	2202	4299	6501	SO:0001630	splice_region_variant	254158	exon4			ATTCAGGTAATGT	AK058173	CCDS14209.1	Xp22.11	2012-11-28			ENSG00000165182	ENSG00000165182			26356	protein-coding gene	gene with protein product							Standard	NM_152761		Approved	FLJ25444	uc004daz.1	Q96LI9	OTTHUMG00000021258	ENST00000379211.3:c.311+1G>A	X.37:g.23933912G>A		Somatic	186	0		WXS	Illumina GAIIx	Phase_I	193	9	NM_001169574	0	0	0	0	0		Splice_Site	SNP	ENST00000379211.3	37	CCDS14209.1	6	0.003616636528028933	0	0.0	1	0.0027624309392265192	0	0.0	4	0.005291005291005291	g	13.92	2.380686	0.42207	0.002347	0.019028	ENSG00000165182	ENST00000379211;ENST00000435707	.	.	.	5.85	5.85	0.93711	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.8642	0.79052	0.0:0.0:1.0:0.0	rs62584865	.	.	.	.	-1	.	.	.	+	.	.	CXorf58	23843833	1.000000	0.71417	1.000000	0.80357	0.383000	0.30230	5.194000	0.65125	2.460000	0.83146	0.540000	0.68198	.	G|0.991;A|0.009		0.308	CXorf58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056071.1	NM_152761	Intron
SOWAHD	347454	hgsc.bcm.edu	37	X	118892888	118892888	+	Silent	SNP	G	G	C	rs2782222	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chrX:118892888G>C	ENST00000343905.3	+	1	313	c.258G>C	c.(256-258)gcG>gcC	p.A86A		NM_001105576.2	NP_001099046.1	A6NJG2	SWAHD_HUMAN	sosondowah ankyrin repeat domain family member D	86																	CGGCTCCTGCGGGGTGGCTGT	0.751													c|||	2295	0.607947	0.4735	0.4841	3775	,	,		7549	0.372		0.495	False		,,,				2504	0.4703				p.A86A		.											.	.	0			c.G258C						.			1145,466		378,253,136,67,79	1.0	2.0	2.0		258	2.3	0.0	X	dbSNP_100	2	2545,1233		737,547,524,198,290	no	coding-synonymous	ANKRD58	NM_001105576.2		1115,800,660,265,369	CC,CG,C,GG,G		32.6363,28.9261,31.5272		86/316	118892888	3690,1699	913	2296	3209	SO:0001819	synonymous_variant	347454	exon1			TCCTGCGGGGTGG		CCDS43984.1	Xq24	2013-01-10	2012-01-12	2012-01-12	ENSG00000187808	ENSG00000187808		"""Ankyrin repeat domain containing"""	32960	protein-coding gene	gene with protein product			"""ankyrin repeat domain 58"""	ANKRD58		22234889	Standard	NM_001105576		Approved		uc010nql.3	A6NJG2	OTTHUMG00000159606	ENST00000343905.3:c.258G>C	X.37:g.118892888G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	4	NM_001105576	0	0	0	3	3		Silent	SNP	ENST00000343905.3	37	CCDS43984.1																																																																																			G|0.401;C|0.599		0.751	SOWAHD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356469.1	NM_001105576	
KRTAP5-5	439915	hgsc.bcm.edu	37	11	1651199	1651200	+	In_Frame_Ins	INS	-	-	GGCTGTGGCTCC	rs71025763|rs144216147	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr11:1651199_1651200insGGCTGTGGCTCC	ENST00000399676.2	+	1	167_168	c.129_130insGGCTGTGGCTCC	c.(130-132)ggc>GGCTGTGGCTCCggc	p.44_44G>GCGSG		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	44						keratin filament (GO:0045095)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		ccggctgtggaggctgtggggg	0.713																																					p.G43delinsGGCGS		.											.	KRTAP5-5-23	0			c.129_130insGGCTGTGGCTCC						.																																			SO:0001652	inframe_insertion	439915	exon1			CTGTGGAGGCTGT	AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	Exception_encountered	11.37:g.1651199_1651200insGGCTGTGGCTCC	Exception_encountered	Somatic	29	0		WXS	Illumina GAIIx	Phase_I	83	22	NM_001001480	0	0	0	0	0	A8MWN2	In_Frame_Ins	INS	ENST00000399676.2	37	CCDS41592.1																																																																																			.		0.713	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127919.1		
POLG	5428	broad.mit.edu	37	15	89876827	89876828	+	In_Frame_Ins	INS	-	-	TGC	rs527965158|rs369920352|rs41550117|rs587781118|rs59510277	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr15:89876827_89876828insTGC	ENST00000268124.5	-	2	491_492	c.158_159insGCA	c.(157-159)caa>caGCAa	p.53_53Q>QQ	RP11-217B1.2_ENST00000569473.1_RNA|RP11-217B1.2_ENST00000562356.1_RNA|POLG_ENST00000525806.1_5'Flank|POLG_ENST00000442287.2_In_Frame_Ins_p.53_53Q>QQ	NM_001126131.1|NM_002693.2	NP_001119603.1|NP_002684.1	P54098	DPOG1_HUMAN	polymerase (DNA directed), gamma	53	Poly-Gln.				aging (GO:0007568)|base-excision repair, gap-filling (GO:0006287)|cell death (GO:0008219)|DNA metabolic process (GO:0006259)|DNA-dependent DNA replication (GO:0006261)|mitochondrial DNA replication (GO:0006264)	extracellular vesicular exosome (GO:0070062)|gamma DNA polymerase complex (GO:0005760)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|exonuclease activity (GO:0004527)|protease binding (GO:0002020)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(3)|urinary_tract(2)	33	Lung NSC(78;0.0472)|all_lung(78;0.089)		STAD - Stomach adenocarcinoma(125;0.165)			gaggctgctgttgctgctgctg	0.693								DNA polymerases (catalytic subunits)																													p.Q53delinsQQ	Colon(73;648 1203 11348 18386 27782)	.											.	POLG-228	0			c.159_160insGCA						.																																			SO:0001652	inframe_insertion	5428	exon2			CTGCTGTTGCTGC	X98093	CCDS10350.1	15q24	2014-09-17			ENSG00000140521	ENSG00000140521		"""DNA polymerases"""	9179	protein-coding gene	gene with protein product		174763				9465903	Standard	NM_002693		Approved	POLG1, POLGA	uc002bnr.4	P54098	OTTHUMG00000149646	ENST00000268124.5:c.156_158dupGCA	15.37:g.89876834_89876836dupTGC	ENSP00000268124:p.Gln55dup	Somatic	11	0		WXS	Illumina GAIIx	Phase_I	35	10	NM_001126131	0	0	0	0	0	Q8NFM2|Q92515	In_Frame_Ins	INS	ENST00000268124.5	37	CCDS10350.1																																																																																			.		0.693	POLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000312854.2	NM_002693	
BCR	613	broad.mit.edu	37	22	23653975	23653976	+	Frame_Shift_Ins	INS	-	-	CCGG	rs372013175		TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr22:23653975_23653976insCCGG	ENST00000305877.8	+	19	4025_4026	c.3274_3275insCCGG	c.(3274-3276)tccfs	p.-1093fs	BCR_ENST00000436990.2_3'UTR|BCR_ENST00000359540.3_Frame_Shift_Ins_p.-1049fs	NM_004327.3	NP_004318.3	P11274	BCR_HUMAN	breakpoint cluster region						actin cytoskeleton organization (GO:0030036)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of phagocytosis (GO:0050766)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)		BCR/JAK2(6)	central_nervous_system(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	35					Bosutinib(DB06616)|Ponatinib(DB08901)	CTACCGCGTGTCCGGTGTGGCC	0.653			T	"""ABL1,  FGFR1, JAK2 """	"""CML, ALL, AML"""																																p.S1092fs		.		Dom	yes		22	22q11.21	613	breakpoint cluster region		L	.	BCR-1349	0			c.3274_3275insCCGG						.																																			SO:0001589	frameshift_variant	613	exon19			CGCGTGTCCGGTG		CCDS13806.1, CCDS13807.1	22q11	2013-01-10			ENSG00000186716	ENSG00000186716		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	1014	protein-coding gene	gene with protein product		151410		D22S11, BCR1		1657398, 18070886	Standard	NM_004327		Approved	D22S662, CML, PHL, ALL	uc002zww.3	P11274	OTTHUMG00000150655	ENST00000305877.8:c.3275_3278dupCCGG	22.37:g.23653976_23653979dupCCGG	ENSP00000303507:p.Gly1093fs	Somatic	459	6		WXS	Illumina GAIIx	Phase_I	757	16	NM_004327	0	0	0	0	0	P78501|Q12842|Q4LE80|Q6NZI3	Frame_Shift_Ins	INS	ENST00000305877.8	37	CCDS13806.1																																																																																			.		0.653	BCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075819.1	NM_004327	
MN1	4330	hgsc.bcm.edu	37	22	28194933	28194934	+	In_Frame_Ins	INS	-	-	TGCTGC	rs572936881|rs34890218|rs373314940|rs71194738	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr22:28194933_28194934insTGCTGC	ENST00000302326.4	-	1	2552_2553	c.1598_1599insGCAGCA	c.(1597-1599)caa>caGCAGCAa	p.533_533Q>QQQ		NM_002430.2	NP_002421.3	Q10571	MN1_HUMAN	meningioma (disrupted in balanced translocation) 1	533	Poly-Gln.				intramembranous ossification (GO:0001957)					NS(1)|breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	45						gctgctgctgttgctgctgctg	0.653			T	ETV6	"""AML, meningioma"""																																p.Q533delinsQQQ		.		Dom	yes		22	22q13	4330	meningioma (disrupted in balanced translocation) 1		"""L, O"""	.	MN1-993	0			c.1599_1600insGCAGCA						.																																			SO:0001652	inframe_insertion	4330	exon1			CTGCTGTTGCTGC	X82209	CCDS42998.1	22q12.1	2010-09-29			ENSG00000169184	ENSG00000169184			7180	protein-coding gene	gene with protein product	"""probable tumor suppressor protein MN1"""	156100	"""meningioma chromosome region"""	MGCR		7731706, 12569362	Standard	NM_002430		Approved	MGCR1-PEN, MGCR1	uc003adj.3	Q10571	OTTHUMG00000150975	ENST00000302326.4:c.1593_1598dupGCAGCA	22.37:g.28194934_28194939dupTGCTGC	ENSP00000304956:p.GlnGln549dup	Somatic	13	0		WXS	Illumina GAIIx	Phase_I	99	38	NM_002430	0	0	0	0	0	A9Z1V9	In_Frame_Ins	INS	ENST00000302326.4	37	CCDS42998.1																																																																																			.		0.653	MN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320737.1	NM_002430	
TTLL11	158135	broad.mit.edu	37	9	124855330	124855331	+	In_Frame_Ins	INS	-	-	TGGCCT	rs3833704|rs201653732	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr9:124855330_124855331insTGGCCT	ENST00000373776.3	-	1	554_555	c.367_368insAGGCCA	c.(367-369)aca>aAGGCCAca	p.122_123insKA	TTLL11_ENST00000321582.5_In_Frame_Ins_p.122_123insKA|TTLL11_ENST00000474723.1_5'UTR	NM_194252.2	NP_919228.2	Q8NHH1	TTL11_HUMAN	tubulin tyrosine ligase-like family, member 11	122					cellular protein modification process (GO:0006464)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ligase activity (GO:0016874)			breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|prostate(3)|skin(1)	18						cgtctccgctgtggcctcggcc	0.762														678	0.135383	0.1044	0.1254	5008	,	,		10384	0.0367		0.2773	False		,,,				2504	0.1401				p.T123delinsKAT		.											.	TTLL11-112	0			c.368_369insAGGCCA						.		,	363,1875		124,115,880					,	-4.8	0.0		dbSNP_107	2	1330,3776		463,404,1686	no	coding,coding	TTLL11	NM_194252.2,NM_001139442.1	,	587,519,2566	A1A1,A1R,RR		26.0478,16.2198,23.0528	,	,		1693,5651				SO:0001652	inframe_insertion	158135	exon1			TCCGCTGTGGCCT	AF521886	CCDS6834.2, CCDS48012.1	9q34.11	2013-02-14	2005-07-28	2005-07-28	ENSG00000175764	ENSG00000175764		"""Tubulin tyrosine ligase-like family"""	18113	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 20"""	C9orf20		15890843	Standard	NM_001139442		Approved	bA244O19.1	uc011lyl.2	Q8NHH1	OTTHUMG00000020597	ENST00000373776.3:c.362_367dupAGGCCA	9.37:g.124855331_124855336dupTGGCCT	ENSP00000362881:p.Ala122_Thr123insLysAla	Somatic	4	0		WXS	Illumina GAIIx	Phase_I	17	7	NM_001139442	0	0	0	0	0		In_Frame_Ins	INS	ENST00000373776.3	37	CCDS6834.2																																																																																			-|0.843;TGGCCT|0.157		0.762	TTLL11-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000053907.1	XM_088486	
KNDC1	85442	hgsc.bcm.edu	37	10	135012429	135012430	+	Missense_Mutation	DNP	TT	TT	AC	rs386749477|rs3008390|rs3008389	byFrequency	TCGA-OR-A5JS-01A-11D-A29I-10	TCGA-OR-A5JS-10A-01D-A29L-10	TT	TT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	95b96221-95bf-40b5-8c9b-c79910e62b7e	959e8880-50f1-4d05-b574-fd92ffa11704	g.chr10:135012429_135012430TT>AC	ENST00000304613.3	+	14	2438_2439	c.2417_2418TT>AC	c.(2416-2418)gTT>gAC	p.V806D	KNDC1_ENST00000368572.2_Missense_Mutation_p.V806D|KNDC1_ENST00000368571.2_Missense_Mutation_p.V741D			Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND) containing 1	806	Pro-rich.			V -> D (in Ref. 1; BAD12625). {ECO:0000305}.	cerebellar granule cell differentiation (GO:0021707)|positive regulation of protein phosphorylation (GO:0001934)|regulation of dendrite morphogenesis (GO:0048814)|small GTPase mediated signal transduction (GO:0007264)	dendrite (GO:0030425)|guanyl-nucleotide exchange factor complex (GO:0032045)|neuronal cell body (GO:0043025)	protein serine/threonine kinase activity (GO:0004674)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			NS(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(27)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	60		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		CCACCTGGAGTTGCTTCCGGGG	0.748																																					p.V806D		.											.	KNDC1-229	0			c.T2418C						.																																			SO:0001583	missense	85442	exon14			TGGAGTTGCTTCC	AK074179	CCDS7674.1	10q26.3	2004-09-14	2004-04-07		ENSG00000171798	ENSG00000171798			29374	protein-coding gene	gene with protein product			"""RasGEF domain family, member 2"""	RASGEF2, C10orf23		11214970	Standard	NM_152643		Approved	KIAA1768, bB439H18.3, FLJ25027	uc001llz.1	Q76NI1	OTTHUMG00000019303	Exception_encountered	10.37:g.135012429_135012430delinsAC	ENSP00000304437:p.Val806Asp	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	14	0	NM_152643	0	0	0	0	0	B0QZC5|Q5T233|Q6ZNH8|Q8TEE5|Q96LV7|Q9C095	Missense_Mutation	DNP	ENST00000304613.3	37	CCDS7674.1																																																																																			T|0.470;C|0.530		0.748	KNDC1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000277044.3	NM_152643	
