#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SPRR2F	6705	broad.mit.edu	37	1	153085135	153085135	+	Silent	SNP	C	C	T			TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr1:153085135C>T	ENST00000468739.1	-	2	135	c.75G>A	c.(73-75)gaG>gaA	p.E25E	SPRR2B_ENST00000368752.4_Intron	NM_001014450.1	NP_001014450.1	Q96RM1	SPR2F_HUMAN	small proline-rich protein 2F	25	3 X 9 AA tandem repeats of [PS]-K-C-P- [EQ]-[PS]-C-P-P.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)				large_intestine(1)|lung(1)|prostate(1)|urinary_tract(1)	4	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			GTGGACATGGCTCTGGGCACT	0.597																																					p.E25E		.											.	SPRR2F-68	0			c.G75A						.						127.0	112.0	117.0					1																	153085135		2203	4296	6499	SO:0001819	synonymous_variant	6705	exon2			ACATGGCTCTGGG	AF333956	CCDS30867.1	1q21-q22	2008-02-05			ENSG00000244094	ENSG00000244094			11266	protein-coding gene	gene with protein product						8325635, 11279051	Standard	NM_001014450		Approved		uc001fbi.3	Q96RM1	OTTHUMG00000014398	ENST00000468739.1:c.75G>A	1.37:g.153085135C>T		Somatic	49	1		WXS	Illumina GAIIx	Phase_I	71	11	NM_001014450	0	0	0	0	0	Q5T9T3	Silent	SNP	ENST00000468739.1	37	CCDS30867.1																																																																																			.		0.597	SPRR2F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040056.1		
C1orf105	92346	bcgsc.ca	37	1	172431333	172431333	+	Missense_Mutation	SNP	A	A	G	rs16844498	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr1:172431333A>G	ENST00000367727.4	+	5	487	c.289A>G	c.(289-291)Atg>Gtg	p.M97V	C1orf105_ENST00000367726.1_3'UTR|C1orf105_ENST00000367725.4_Missense_Mutation_p.M87V	NM_139240.3	NP_640333.3	O95561	CA105_HUMAN	chromosome 1 open reading frame 105	97			M -> V (in dbSNP:rs16844498).							large_intestine(1)|lung(12)|prostate(1)|skin(1)	15						ACCAAGAACAATGAAAATCCC	0.318													A|||	220	0.0439297	0.0272	0.049	5008	,	,		20279	0.0		0.0875	False		,,,				2504	0.0634				p.M97V		.											.	C1orf105-69	0			c.A289G						.	A	VAL/MET	137,4269	98.5+/-137.1	2,133,2068	97.0	91.0	93.0		289	-8.5	0.0	1	dbSNP_123	93	515,8085	145.4+/-201.1	19,477,3804	yes	missense	C1orf105	NM_139240.3	21	21,610,5872	GG,GA,AA		5.9884,3.1094,5.0131	benign	97/184	172431333	652,12354	2203	4300	6503	SO:0001583	missense	92346	exon5			AGAACAATGAAAA	AL035295	CCDS1301.1, CCDS72983.1	1q24.3	2012-06-26			ENSG00000180999	ENSG00000180999			29591	protein-coding gene	gene with protein product						12477932	Standard	NM_139240		Approved		uc001gik.3	O95561	OTTHUMG00000034750	ENST00000367727.4:c.289A>G	1.37:g.172431333A>G	ENSP00000356700:p.Met97Val	Somatic	298	0		WXS	Illumina GAIIx	Phase_I	189	7	NM_139240	0	0	1	1	0	Q8IY02	Missense_Mutation	SNP	ENST00000367727.4	37	CCDS1301.1	102	0.046703296703296704	14	0.028455284552845527	17	0.04696132596685083	0	0.0	71	0.09366754617414248	A	0.006	-2.077666	0.00375	0.031094	0.059884	ENSG00000180999	ENST00000367727;ENST00000488100;ENST00000367725	T;T;T	0.33438	1.41;1.41;1.41	4.26	-8.53	0.00916	.	1.919010	0.02269	N	0.068313	T	0.03390	0.0098	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.06162	-1.0842	10	0.33141	T	0.24	0.3528	0.2515	0.00206	0.3358:0.2407:0.1748:0.2487	rs16844498;rs52830958;rs16844498	97	O95561	CA105_HUMAN	V	97;68;87	ENSP00000356700:M97V;ENSP00000431442:M68V;ENSP00000356698:M87V	ENSP00000356698:M87V	M	+	1	0	C1orf105	170697956	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-3.598000	0.00419	-4.449000	0.00048	-1.937000	0.00501	ATG	A|0.949;G|0.051		0.318	C1orf105-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084062.2	NM_139240	
PLEKHA6	22874	bcgsc.ca	37	1	204242838	204242838	+	Silent	SNP	A	A	C	rs33911350	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr1:204242838A>C	ENST00000272203.3	-	3	334	c.18T>G	c.(16-18)ggT>ggG	p.G6G	PLEKHA6_ENST00000414478.1_Silent_p.G6G	NM_014935.4	NP_055750.2	Q9Y2H5	PKHA6_HUMAN	pleckstrin homology domain containing, family A member 6	6								p.G6G(1)		breast(2)|endometrium(6)|kidney(1)|large_intestine(9)|lung(21)|ovary(3)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_cancers(21;0.0222)|Breast(84;0.179)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.229)			GGCGTTTCCCACCTGTTTTAT	0.522													A|||	1004	0.200479	0.1286	0.2406	5008	,	,		18200	0.2946		0.1769	False		,,,				2504	0.1963				p.G6G		.											.	PLEKHA6-654	1	Substitution - coding silent(1)	stomach(1)	c.T18G						.	A		641,3765	270.7+/-269.8	50,541,1612	153.0	139.0	144.0		18	2.1	1.0	1	dbSNP_126	144	1474,7126	276.4+/-292.3	144,1186,2970	no	coding-synonymous	PLEKHA6	NM_014935.2		194,1727,4582	CC,CA,AA		17.1395,14.5483,16.2617		6/1049	204242838	2115,10891	2203	4300	6503	SO:0001819	synonymous_variant	22874	exon3			TTTCCCACCTGTT	AB023186	CCDS1444.1	1q32	2013-01-10			ENSG00000143850	ENSG00000143850		"""Pleckstrin homology (PH) domain containing"""	17053	protein-coding gene	gene with protein product		607771				11001876	Standard	NM_014935		Approved	PEPP3, KIAA0969	uc001hau.4	Q9Y2H5	OTTHUMG00000036057	ENST00000272203.3:c.18T>G	1.37:g.204242838A>C		Somatic	123	4		WXS	Illumina GAIIx	Phase_I	124	8	NM_014935	0	0	0	0	0	A7MD51|Q5VTI6	Silent	SNP	ENST00000272203.3	37	CCDS1444.1																																																																																			A|0.831;C|0.169		0.522	PLEKHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087889.3	NM_014935	
PTPLA	9200	hgsc.bcm.edu	37	10	17659149	17659149	+	Missense_Mutation	SNP	C	C	G	rs7895850	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr10:17659149C>G	ENST00000361271.3	-	1	227	c.190G>C	c.(190-192)Gag>Cag	p.E64Q	PTPLA_ENST00000326961.6_Missense_Mutation_p.E64Q	NM_014241.3	NP_055056.3	B0YJ81	HACD1_HUMAN	protein tyrosine phosphatase-like (proline instead of catalytic arginine), member A	64			E -> K (in dbSNP:rs7895850). {ECO:0000269|PubMed:10644438, ECO:0000269|PubMed:11054553, ECO:0000269|PubMed:15489334}.|E -> Q (in dbSNP:rs7895850). {ECO:0000269|PubMed:11054553}.		fatty acid biosynthetic process (GO:0006633)|multicellular organismal development (GO:0007275)|myotube differentiation (GO:0014902)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	lyase activity (GO:0016829)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(6)|skin(1)	13						CGCCTCCGCTCGCCGGGAGCC	0.766													T|||	543	0.108427	0.0401	0.121	5008	,	,		6575	0.2321		0.1103	False		,,,				2504	0.0624				p.E64Q		.											.	PTPLA-226	0			c.G190C						.	T	LYS/GLN/GLU	2648,64,0		1292,64,0,0,0,0	2.0	4.0	4.0		190	2.0	0.1	10	dbSNP_116	4	4685,237,0		2230,225,0,6,0,0	no	missense	PTPLA	NM_014241.3	29,56	3522,289,0,6,0,0	TT,TG,TC,GG,GC,CC		4.8151,2.3599,3.9429	benign	64/289	17659149	7333,301,0	1356	2461	3817	SO:0001583	missense	9200	exon1			TCCGCTCGCCGGG	AF114494	CCDS7121.1	10p14-p13	2008-08-01	2005-11-11		ENSG00000165996	ENSG00000165996			9639	protein-coding gene	gene with protein product	"""cementum attachment protein"""	610467	"""protein tyrosine phosphatase-like (proline instead of catalytic arginine), member a"""			10644438	Standard	XM_005252641		Approved	CAP	uc001ipg.3	B0YJ81	OTTHUMG00000017750	ENST00000361271.3:c.190G>C	10.37:g.17659149C>G	ENSP00000355308:p.Glu64Gln	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	26	15	NM_014241	0	3	0	4	1	B0YJ80|Q6JIC5|Q96FW7|Q9HB93|Q9UHX2	Missense_Mutation	SNP	ENST00000361271.3	37	CCDS7121.1	.	.	.	.	.	.	.	.	.	.	T	6.487	0.458102	0.12342	0.023599	0.0481510000000001	ENSG00000165996	ENST00000361271;ENST00000326961	T;T	0.19105	2.75;2.17	3.35	2.04	0.26737	.	0.660756	0.13666	N	0.371221	T	0.01156	0.0038	N	0.08118	0	0.09310	N	0.999999	B;B;B	0.23854	0.092;0.009;0.007	B;B;B	0.12837	0.008;0.001;0.002	T	0.33137	-0.9880	10	0.24483	T	0.36	-20.0823	3.214	0.06692	0.0:0.1393:0.2442:0.6165	.	64;64;64	A6NP58;B0YJ81-2;B0YJ81	.;.;HACD1_HUMAN	Q	64	ENSP00000355308:E64Q;ENSP00000322923:E64Q	ENSP00000322923:E64Q	E	-	1	0	PTPLA	17699155	1.000000	0.71417	0.050000	0.19076	0.003000	0.03518	1.138000	0.31491	0.439000	0.26476	-0.381000	0.06696	GAG	C|0.007;G|0.002;T|0.991		0.766	PTPLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047046.1	NM_014241	
ALOX5	240	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	45938628	45938628	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr10:45938628G>T	ENST00000374391.2	+	10	1468	c.1415G>T	c.(1414-1416)cGg>cTg	p.R472L	ALOX5_ENST00000542434.1_Missense_Mutation_p.R472L|RP11-67C2.2_ENST00000435635.1_RNA|ALOX5_ENST00000493336.1_3'UTR	NM_000698.3|NM_001256153.1	NP_000689.1|NP_001243082.1	P09917	LOX5_HUMAN	arachidonate 5-lipoxygenase	472	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				arachidonic acid metabolic process (GO:0019369)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|leukotriene production involved in inflammatory response (GO:0002540)|lipoxin metabolic process (GO:2001300)|lipoxygenase pathway (GO:0019372)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular space (GO:0005615)|nuclear envelope (GO:0005635)|nuclear envelope lumen (GO:0005641)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)	arachidonate 5-lipoxygenase activity (GO:0004051)|iron ion binding (GO:0005506)			breast(1)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(14)|ovary(2)|pancreas(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		Lung SC(717;0.0257)			Aminosalicylic Acid(DB00233)|Balsalazide(DB01014)|Diclofenac(DB00586)|Diethylcarbamazine(DB00711)|Masoprocol(DB00179)|Meclofenamic acid(DB00939)|Mesalazine(DB00244)|Minocycline(DB01017)|Montelukast(DB00471)|Sulfasalazine(DB00795)|Vitamin E(DB00163)|Zileuton(DB00744)	TACTTCTACCGGGACGACGGG	0.662																																					p.R472L		.											.	ALOX5-228	0			c.G1415T						.						128.0	138.0	134.0					10																	45938628		2203	4300	6503	SO:0001583	missense	240	exon10			TCTACCGGGACGA	J03571	CCDS7212.1, CCDS58078.1	10q11.2	2008-03-18			ENSG00000012779	ENSG00000012779	1.13.11.34	"""Arachidonate lipoxygenases"""	435	protein-coding gene	gene with protein product		152390				2565035	Standard	NM_001256153		Approved	5-LOX	uc001jce.4	P09917	OTTHUMG00000018081	ENST00000374391.2:c.1415G>T	10.37:g.45938628G>T	ENSP00000363512:p.Arg472Leu	Somatic	140	0		WXS	Illumina GAIIx	Phase_I	299	126	NM_000698	0	0	3	3	0	B7ZLS0|E5FPY5|E5FPY7|E5FPY8|Q5JQ14	Missense_Mutation	SNP	ENST00000374391.2	37	CCDS7212.1	.	.	.	.	.	.	.	.	.	.	G	36	5.648565	0.96714	.	.	ENSG00000012779	ENST00000542434;ENST00000374391	T;T	0.76839	-1.05;-1.05	5.63	5.63	0.86233	Lipoxygenase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.91092	0.7196	M	0.93939	3.475	0.80722	D	1	D;D;D	0.89917	1.0;0.984;0.999	D;P;D	0.79108	0.992;0.764;0.978	D	0.92717	0.6188	10	0.62326	D	0.03	-36.4184	17.16	0.86801	0.0:0.0:1.0:0.0	.	472;440;472	B7ZLS0;E5FPY8;P09917	.;.;LOX5_HUMAN	L	472	ENSP00000437634:R472L;ENSP00000363512:R472L	ENSP00000363512:R472L	R	+	2	0	ALOX5	45258634	1.000000	0.71417	0.996000	0.52242	0.978000	0.69477	9.852000	0.99516	2.647000	0.89833	0.511000	0.50034	CGG	.		0.662	ALOX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047780.1		
GPRIN2	9721	ucsc.edu	37	10	46999601	46999601	+	Missense_Mutation	SNP	G	G	A	rs9422022	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr10:46999601G>A	ENST00000374317.1	+	3	994	c.721G>A	c.(721-723)Gtg>Atg	p.V241M	GPRIN2_ENST00000374314.4_Missense_Mutation_p.V241M	NM_014696.3	NP_055511.2	O60269	GRIN2_HUMAN	G protein regulated inducer of neurite outgrowth 2	241			V -> M (in dbSNP:rs9422022).	VR -> MREVG (in Ref. 1; BAA25440 and 3; AAH11672). {ECO:0000305}.						breast(2)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)	18						CATGAGGGAGGTGAGGGCTGG	0.632													G|||	32	0.00638978	0.0023	0.0014	5008	,	,		31210	0.0139		0.0109	False		,,,				2504	0.0031				p.V241M		.											.	GPRIN2-90	0			c.G721A						.						51.0	53.0	53.0					10																	46999601		2203	4299	6502	SO:0001583	missense	9721	exon3			AGGGAGGTGAGGG	BC011672	CCDS73101.1	10q11.22	2006-08-24	2006-08-24	2006-08-24	ENSG00000204175	ENSG00000204175			23730	protein-coding gene	gene with protein product		611240	"""KIAA0514"""	KIAA0514		9628581	Standard	NM_014696		Approved	MGC15171	uc001jec.3	O60269	OTTHUMG00000018107	ENST00000374317.1:c.721G>A	10.37:g.46999601G>A	ENSP00000363436:p.Val241Met	Somatic	104	0		WXS	Illumina GAIIx	Phase_I	209	29	NM_014696	0	0	0	0	0	Q5SVF0	Missense_Mutation	SNP	ENST00000374317.1	37	CCDS31192.1	786	0.3598901098901099	179	0.3638211382113821	126	0.34806629834254144	219	0.38286713286713286	262	0.34564643799472294	G	3.183	-0.167470	0.06461	.	.	ENSG00000204175	ENST00000374317;ENST00000374314	T;T	0.03496	3.91;3.91	5.12	-1.64	0.08318	.	1.524420	0.04254	N	0.339078	T	0.00012	0.0000	L	0.34521	1.04	0.09310	N	1	B	0.15473	0.013	B	0.09377	0.004	T	0.46978	-0.9152	10	0.27082	T	0.32	0.3266	1.758	0.02986	0.326:0.1295:0.4122:0.1323	rs9422022	241	O60269	GRIN2_HUMAN	M	241	ENSP00000363436:V241M;ENSP00000363433:V241M	ENSP00000363433:V241M	V	+	1	0	GPRIN2	46419607	0.099000	0.21834	0.004000	0.12327	0.003000	0.03518	0.140000	0.16056	-0.217000	0.10033	-0.498000	0.04607	GTG	G|0.639;A|0.361		0.632	GPRIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047836.1	NM_014696	
GPRIN2	9721	hgsc.bcm.edu	37	10	47000217	47000217	+	Missense_Mutation	SNP	G	G	A	rs72780221	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr10:47000217G>A	ENST00000374317.1	+	3	1610	c.1337G>A	c.(1336-1338)cGc>cAc	p.R446H	GPRIN2_ENST00000374314.4_Missense_Mutation_p.R446H	NM_014696.3	NP_055511.2	O60269	GRIN2_HUMAN	G protein regulated inducer of neurite outgrowth 2	446								p.R446H(1)		breast(2)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)	18						TCCCTGCGGCGCCCCAGCTGC	0.716																																					p.R446H		.											.	GPRIN2-90	1	Substitution - Missense(1)	prostate(1)	c.G1337A						.						8.0	9.0	9.0					10																	47000217		2121	4098	6219	SO:0001583	missense	9721	exon3			TGCGGCGCCCCAG	BC011672	CCDS73101.1	10q11.22	2006-08-24	2006-08-24	2006-08-24	ENSG00000204175	ENSG00000204175			23730	protein-coding gene	gene with protein product		611240	"""KIAA0514"""	KIAA0514		9628581	Standard	NM_014696		Approved	MGC15171	uc001jec.3	O60269	OTTHUMG00000018107	ENST00000374317.1:c.1337G>A	10.37:g.47000217G>A	ENSP00000363436:p.Arg446His	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	37	8	NM_014696	0	0	0	0	0	Q5SVF0	Missense_Mutation	SNP	ENST00000374317.1	37	CCDS31192.1	220	0.10073260073260074	86	0.17479674796747968	30	0.08287292817679558	25	0.043706293706293704	79	0.10422163588390501	G	13.52	2.261176	0.39995	.	.	ENSG00000204175	ENST00000374317;ENST00000374314	T;T	0.26223	1.75;1.75	5.11	3.2	0.36748	.	0.744361	0.10758	N	0.637492	T	0.00073	0.0002	L	0.49350	1.555	0.09310	N	1	B	0.24533	0.105	B	0.17433	0.018	T	0.22243	-1.0222	10	0.34782	T	0.22	-0.7153	5.5226	0.16941	0.1777:0.1655:0.6568:0.0	.	446	O60269	GRIN2_HUMAN	H	446	ENSP00000363436:R446H;ENSP00000363433:R446H	ENSP00000363433:R446H	R	+	2	0	GPRIN2	46420223	0.000000	0.05858	0.420000	0.26596	0.986000	0.74619	0.143000	0.16115	0.639000	0.30564	0.561000	0.74099	CGC	G|0.901;A|0.099		0.716	GPRIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047836.1	NM_014696	
PANK1	53354	hgsc.bcm.edu	37	10	91404832	91404832	+	Silent	SNP	T	T	C	rs12769113	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr10:91404832T>C	ENST00000307534.4	-	1	383	c.228A>G	c.(226-228)gcA>gcG	p.A76A	RP11-80H5.2_ENST00000454174.1_RNA|PANK1_ENST00000342512.3_5'Flank|PANK1_ENST00000371774.2_5'Flank|PANK1_ENST00000322191.6_5'Flank|RP11-80H5.6_ENST00000428166.1_lincRNA|RP11-80H5.2_ENST00000451733.1_RNA|PANK1_ENST00000488482.1_5'Flank	NM_148977.2	NP_683878.1	Q8TE04	PANK1_HUMAN	pantothenate kinase 1	76					coenzyme A biosynthetic process (GO:0015937)|coenzyme biosynthetic process (GO:0009108)|pantothenate metabolic process (GO:0015939)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cell periphery (GO:0071944)|clathrin coat (GO:0030118)|cytosol (GO:0005829)|nucleus (GO:0005634)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)			cervix(1)|kidney(1)|large_intestine(3)|lung(4)|prostate(2)	11						CCACCTCCTCTGCGCCCTgcc	0.786													C|||	1827	0.364816	0.4924	0.2233	5008	,	,		7044	0.2996		0.2594	False		,,,				2504	0.4683				p.A76A		.											.	PANK1-90	0			c.A228G						.	C		1379,2293		261,857,718	6.0	8.0	7.0		228	1.1	0.0	10	dbSNP_121	7	1541,6345		172,1197,2574	no	coding-synonymous	PANK1	NM_148977.2		433,2054,3292	CC,CT,TT		19.541,37.5545,25.2639		76/599	91404832	2920,8638	1836	3943	5779	SO:0001819	synonymous_variant	53354	exon1			CTCCTCTGCGCCC	AF355198	CCDS7405.1, CCDS7406.1, CCDS31244.1	10q23.31	2008-05-14	2002-11-13	2002-11-15	ENSG00000152782	ENSG00000152782			8598	protein-coding gene	gene with protein product		606160	"""pantothenate kinase"""	PANK		11809413	Standard	NM_148977		Approved	MGC24596, PANK1a, PANK1b	uc001kgp.2	Q8TE04	OTTHUMG00000018718	ENST00000307534.4:c.228A>G	10.37:g.91404832T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_148977	0	0	0	0	0	A6NIP0|Q7RTX6|Q7Z495|Q8TBQ8	Silent	SNP	ENST00000307534.4	37	CCDS31244.1																																																																																			T|0.708;C|0.292		0.786	PANK1-201	KNOWN	basic|CCDS	protein_coding	protein_coding			
PCGF5	84333	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	93024204	93024204	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr10:93024204A>G	ENST00000336126.5	+	8	822	c.590A>G	c.(589-591)aAt>aGt	p.N197S	PCGF5_ENST00000543648.1_Missense_Mutation_p.N197S	NM_001257101.1|NM_032373.4	NP_001244030.1|NP_115749.2	Q86SE9	PCGF5_HUMAN	polycomb group ring finger 5	197					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|nucleolus (GO:0005730)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)	zinc ion binding (GO:0008270)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)	12						GTGCTGTGCAATGGTGAAATT	0.289																																					p.N197S	Colon(178;732 2696 46441 50370)	.											.	PCGF5-226	0			c.A590G						.						170.0	171.0	170.0					10																	93024204		2203	4300	6503	SO:0001583	missense	84333	exon8			TGTGCAATGGTGA	AL832003	CCDS7413.1	10q23.33	2013-01-09	2005-01-17	2005-01-19	ENSG00000180628	ENSG00000180628		"""RING-type (C3HC4) zinc fingers"", ""Polycomb group ring fingers"""	28264	protein-coding gene	gene with protein product			"""ring finger protein (C3HC4 type) 159"""	RNF159		8076819	Standard	NM_001256549		Approved	MGC16202	uc001khh.4	Q86SE9	OTTHUMG00000018740	ENST00000336126.5:c.590A>G	10.37:g.93024204A>G	ENSP00000337500:p.Asn197Ser	Somatic	60	0		WXS	Illumina GAIIx	Phase_I	99	40	NM_001256549	0	0	25	45	20	B7Z892|D3DR33|Q6PK47|Q86TD0	Missense_Mutation	SNP	ENST00000336126.5	37	CCDS7413.1	.	.	.	.	.	.	.	.	.	.	A	24.8	4.574736	0.86542	.	.	ENSG00000180628	ENST00000543648;ENST00000336126	T;T	0.49139	0.79;0.79	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	T	0.68081	0.2962	M	0.72894	2.215	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	T	0.67979	-0.5530	10	0.44086	T	0.13	-26.2276	16.4608	0.84044	1.0:0.0:0.0:0.0	.	197	Q86SE9	PCGF5_HUMAN	S	197	ENSP00000445704:N197S;ENSP00000337500:N197S	ENSP00000337500:N197S	N	+	2	0	PCGF5	93014184	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.962000	0.93254	2.288000	0.76882	0.533000	0.62120	AAT	.		0.289	PCGF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049363.1	NM_032373	
MUC2	4583	bcgsc.ca	37	11	1093311	1093311	+	Silent	SNP	C	C	A			TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr11:1093311C>A	ENST00000441003.2	+	30	5157	c.5130C>A	c.(5128-5130)acC>acA	p.T1710T	MUC2_ENST00000359061.5_Silent_p.T1677T|MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_5'Flank	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	tgaccccaaccccaacaccca	0.637																																					p.T1710T		.											.	MUC2-90	0			c.C5130A						.						143.0	189.0	173.0					11																	1093311		1906	3557	5463	SO:0001819	synonymous_variant	4583	exon30			CCCAACCCCAACA	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5130C>A	11.37:g.1093311C>A		Somatic	85	8		WXS	Illumina GAIIx	Phase_I	73	16	NM_002457	0	0	0	0	0	Q14878	Silent	SNP	ENST00000441003.2	37																																																																																				.		0.637	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MUC2	4583	bcgsc.ca	37	11	1093375	1093375	+	Missense_Mutation	SNP	C	C	T	rs552937801	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr11:1093375C>T	ENST00000441003.2	+	30	5221	c.5194C>T	c.(5194-5196)Cca>Tca	p.P1732S	MUC2_ENST00000359061.5_Missense_Mutation_p.P1699S|MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_Missense_Mutation_p.P20S	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	tacggtgaccccaaccccaac	0.657																																					p.P1732S		.											.	MUC2-90	0			c.C5194T						.																																			SO:0001583	missense	4583	exon30			GTGACCCCAACCC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5194C>T	11.37:g.1093375C>T	ENSP00000415183:p.Pro1732Ser	Somatic	101	3		WXS	Illumina GAIIx	Phase_I	110	11	NM_002457	0	0	0	0	0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	0.065	-1.214378	0.01555	.	.	ENSG00000198788	ENST00000441003;ENST00000359061;ENST00000333592	T;T;T	0.10288	3.1;3.17;2.89	1.49	-1.27	0.09347	.	498.391000	0.02047	N	0.049780	T	0.06050	0.0157	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.28902	-1.0029	9	0.20519	T	0.43	.	2.7543	0.05288	0.4674:0.3566:0.0:0.176	.	1732	E7EUV1	.	S	1732;1699;20	ENSP00000415183:P1732S;ENSP00000351956:P1699S;ENSP00000331373:P20S	ENSP00000331373:P20S	P	+	1	0	MUC2	1083375	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-2.627000	0.00874	-0.601000	0.05783	-1.152000	0.01820	CCA	.		0.657	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MUC5B	727897	hgsc.bcm.edu	37	11	1253976	1253976	+	Missense_Mutation	SNP	A	A	G	rs76956995		TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr11:1253976A>G	ENST00000529681.1	+	17	2099	c.2041A>G	c.(2041-2043)Agc>Ggc	p.S681G	MUC5B_ENST00000447027.1_Missense_Mutation_p.S684G	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	681					cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CGTACAGCTCAGCGACTGGAG	0.687																																					p.S681G		.											.	.	0			c.A2041G						.						22.0	25.0	24.0					11																	1253976		2121	4235	6356	SO:0001583	missense	727897	exon17			CAGCTCAGCGACT	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.2041A>G	11.37:g.1253976A>G	ENSP00000436812:p.Ser681Gly	Somatic	26	0		WXS	Illumina GAIIx	Phase_I	126	12	NM_002458	0	0	0	0	0	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	A	5.230	0.228008	0.09916	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.76578	-1.03;-1.03	4.6	-7.0	0.01599	Uncharacterised domain, cysteine-rich (2);	.	.	.	.	T	0.70605	0.3243	N	0.25144	0.715	0.09310	N	1	B;D;D	0.59357	0.425;0.985;0.985	B;P;P	0.54499	0.131;0.675;0.754	T	0.69614	-0.5098	9	0.87932	D	0	.	10.9271	0.47197	0.2958:0.5687:0.1355:0.0	.	681;1340;684	Q9HC84;A7Y9J9;E9PBJ0	MUC5B_HUMAN;.;.	G	681;684;682;717	ENSP00000436812:S681G;ENSP00000415793:S684G	ENSP00000343037:S682G	S	+	1	0	MUC5B	1210552	0.000000	0.05858	0.011000	0.14972	0.067000	0.16453	-4.642000	0.00204	-1.098000	0.03038	0.260000	0.18958	AGC	.		0.687	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
MUC5B	727897	hgsc.bcm.edu	37	11	1253980	1253980	+	Missense_Mutation	SNP	A	A	G	rs202127660		TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr11:1253980A>G	ENST00000529681.1	+	17	2103	c.2045A>G	c.(2044-2046)gAc>gGc	p.D682G	MUC5B_ENST00000447027.1_Missense_Mutation_p.D685G	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	682					cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CAGCTCAGCGACTGGAGGGAC	0.682																																					p.D682G		.											.	.	0			c.A2045G						.						21.0	24.0	23.0					11																	1253980		2116	4228	6344	SO:0001583	missense	727897	exon17			TCAGCGACTGGAG	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.2045A>G	11.37:g.1253980A>G	ENSP00000436812:p.Asp682Gly	Somatic	23	0		WXS	Illumina GAIIx	Phase_I	121	8	NM_002458	0	0	0	0	0	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	A	7.541	0.660740	0.14645	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.76060	-0.99;-0.99	4.6	2.72	0.32119	Uncharacterised domain, cysteine-rich (2);	.	.	.	.	T	0.50103	0.1596	N	0.02960	-0.455	0.24874	N	0.992269	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.45920	-0.9228	9	0.87932	D	0	.	8.6635	0.34108	0.2416:0.0:0.7584:0.0	.	682;1341;685	Q9HC84;A7Y9J9;E9PBJ0	MUC5B_HUMAN;.;.	G	682;685;683;718	ENSP00000436812:D682G;ENSP00000415793:D685G	ENSP00000343037:D683G	D	+	2	0	MUC5B	1210556	0.999000	0.42202	0.632000	0.29296	0.070000	0.16714	2.607000	0.46300	0.373000	0.24621	-1.983000	0.00453	GAC	.		0.682	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
KRTAP5-5	439915	bcgsc.ca	37	11	1651646	1651646	+	Silent	SNP	C	C	T			TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr11:1651646C>T	ENST00000399676.2	+	1	614	c.576C>T	c.(574-576)taC>taT	p.Y192Y		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	192	8 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		GTAAGCCCTACTGCTGCCAGT	0.602																																					p.Y192Y		.											.	KRTAP5-5-23	0			c.C576T						.						79.0	87.0	84.0					11																	1651646		2200	4299	6499	SO:0001819	synonymous_variant	439915	exon1			GCCCTACTGCTGC	AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	ENST00000399676.2:c.576C>T	11.37:g.1651646C>T		Somatic	124	0		WXS	Illumina GAIIx	Phase_I	138	13	NM_001001480	0	0	0	0	0	A8MWN2	Silent	SNP	ENST00000399676.2	37	CCDS41592.1																																																																																			.		0.602	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127919.1		
OR51T1	401665	broad.mit.edu	37	11	4903672	4903672	+	Nonsense_Mutation	SNP	C	C	A			TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr11:4903672C>A	ENST00000322049.1	+	1	543	c.543C>A	c.(541-543)tgC>tgA	p.C181*	MMP26_ENST00000380390.1_Intron|OR51T1_ENST00000380378.1_Nonsense_Mutation_p.C208*|MMP26_ENST00000477339.1_Intron			Q8NGJ9	O51T1_HUMAN	olfactory receptor, family 51, subfamily T, member 1	181						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(16)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	34		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		ATCCATTTTGCTACCACCCAG	0.443																																					p.C208X		.											.	OR51T1-115	0			c.C624A						.						178.0	164.0	169.0					11																	4903672		2201	4298	6499	SO:0001587	stop_gained	401665	exon1			ATTTTGCTACCAC	BK004283	CCDS31363.1	11p15.4	2012-08-09			ENSG00000176900	ENSG00000176900		"""GPCR / Class A : Olfactory receptors"""	15205	protein-coding gene	gene with protein product							Standard	NM_001004759		Approved		uc010qyp.2	Q8NGJ9	OTTHUMG00000066507	ENST00000322049.1:c.543C>A	11.37:g.4903672C>A	ENSP00000322679:p.Cys181*	Somatic	169	0		WXS	Illumina GAIIx	Phase_I	141	7	NM_001004759	0	0	0	0	0	Q6IFH9	Nonsense_Mutation	SNP	ENST00000322049.1	37		.	.	.	.	.	.	.	.	.	.	C	18.07	3.542655	0.65198	.	.	ENSG00000176900	ENST00000380378;ENST00000322049	.	.	.	4.8	1.77	0.24775	.	0.301525	0.24128	N	0.041284	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.668	0.28443	0.0:0.6974:0.0:0.3026	.	.	.	.	X	208;181	.	ENSP00000322679:C181X	C	+	3	2	OR51T1	4860248	0.000000	0.05858	0.998000	0.56505	0.745000	0.42441	-0.721000	0.04963	0.192000	0.20272	-0.350000	0.07774	TGC	.		0.443	OR51T1-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000142180.1	NM_001004759	
OR51G2	81282	bcgsc.ca	37	11	4936721	4936721	+	Missense_Mutation	SNP	C	C	T	rs60718970	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr11:4936721C>T	ENST00000322013.3	-	1	201	c.173G>A	c.(172-174)cGc>cAc	p.R58H	MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron	NM_001005238.1	NP_001005238.1	Q8NGK0	O51G2_HUMAN	olfactory receptor, family 51, subfamily G, member 2	58						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|endometrium(1)|large_intestine(9)|lung(12)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)		ATGAAGTGAGCGCTCTGTTTT	0.493													C|||	52	0.0103834	0.0371	0.0043	5008	,	,		20589	0.0		0.0	False		,,,				2504	0.0				p.R58H		.											.	OR51G2-70	0			c.G173A						.	C	HIS/ARG	168,4234	112.5+/-150.6	5,158,2038	94.0	83.0	87.0		173	4.6	1.0	11	dbSNP_129	87	4,8592	4.3+/-15.6	0,4,4294	yes	missense	OR51G2	NM_001005238.1	29	5,162,6332	TT,TC,CC		0.0465,3.8164,1.3233	benign	58/315	4936721	172,12826	2201	4298	6499	SO:0001583	missense	81282	exon1			AGTGAGCGCTCTG	AB065794	CCDS31365.1	11p15.4	2012-08-09			ENSG00000176893	ENSG00000176893		"""GPCR / Class A : Olfactory receptors"""	15198	protein-coding gene	gene with protein product							Standard	NM_001005238		Approved		uc001lzr.1	Q8NGK0	OTTHUMG00000066501	ENST00000322013.3:c.173G>A	11.37:g.4936721C>T	ENSP00000322593:p.Arg58His	Somatic	149	0		WXS	Illumina GAIIx	Phase_I	124	6	NM_001005238	0	0	0	0	0	Q6IFH7	Missense_Mutation	SNP	ENST00000322013.3	37	CCDS31365.1	21	0.009615384615384616	19	0.03861788617886179	2	0.0055248618784530384	0	0.0	0	0.0	C	12.43	1.935827	0.34189	0.038164	4.65E-4	ENSG00000176893	ENST00000322013	T	0.00438	7.42	5.49	4.57	0.56435	GPCR, rhodopsin-like superfamily (1);	0.479278	0.17700	N	0.164956	T	0.00109	0.0003	L	0.33293	1	0.09310	N	1	B	0.25772	0.134	B	0.09377	0.004	T	0.51387	-0.8712	10	0.33141	T	0.24	.	14.9985	0.71451	0.0:0.1498:0.8502:0.0	rs60718970	58	Q8NGK0	O51G2_HUMAN	H	58	ENSP00000322593:R58H	ENSP00000322593:R58H	R	-	2	0	OR51G2	4893297	0.000000	0.05858	1.000000	0.80357	0.919000	0.55068	0.007000	0.13174	1.553000	0.49476	-0.165000	0.13383	CGC	C|0.986;T|0.014		0.493	OR51G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142174.1	NM_001005238	
TPCN2	219931	bcgsc.ca	37	11	68855363	68855363	+	Missense_Mutation	SNP	G	G	A	rs3829241	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr11:68855363G>A	ENST00000294309.3	+	25	2302	c.2201G>A	c.(2200-2202)gGg>gAg	p.G734E	TPCN2_ENST00000542467.1_Missense_Mutation_p.G552E|TPCN2_ENST00000442692.2_3'UTR	NM_139075.3	NP_620714.2	Q8NHX9	TPC2_HUMAN	two pore segment channel 2	734			G -> E (associated with SHEP10; dbSNP:rs3829241). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:17974005, ECO:0000269|PubMed:18488028, ECO:0000269|PubMed:19387438}.		calcium ion transport (GO:0006816)|cellular calcium ion homeostasis (GO:0006874)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|release of sequestered calcium ion into cytosol (GO:0051209)|smooth muscle contraction (GO:0006939)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|NAADP-sensitive calcium-release channel activity (GO:0072345)|protein kinase binding (GO:0019901)|voltage-gated calcium channel activity (GO:0005245)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(17)|prostate(2)|skin(1)|urinary_tract(1)	32			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			GAGGAGCCCGGGGAGGATGAG	0.632													G|||	883	0.176318	0.0386	0.2205	5008	,	,		16887	0.2063		0.3817	False		,,,				2504	0.089				p.G734E		.											.	TPCN2-90	0			c.G2201A	GRCh37	CM083200	TPCN2	M	rs3829241	.	G	GLU/GLY	466,3934	209.5+/-230.2	28,410,1762	27.0	32.0	30.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	2201	-3.6	0.0	11	dbSNP_107	30	3292,5296	470.8+/-367.9	620,2052,1622	yes	missense	TPCN2	NM_139075.3	98	648,2462,3384	AA,AG,GG		38.3326,10.5909,28.9344	benign	734/753	68855363	3758,9230	2200	4294	6494	SO:0001583	missense	219931	exon25			AGCCCGGGGAGGA	AK023366	CCDS8189.1	11q13.1	2011-07-05			ENSG00000162341	ENSG00000162341		"""Voltage-gated ion channels / Two-pore channels"""	20820	protein-coding gene	gene with protein product		612163				16382101	Standard	NM_139075		Approved	TPC2	uc001oos.2	Q8NHX9	OTTHUMG00000167898	ENST00000294309.3:c.2201G>A	11.37:g.68855363G>A	ENSP00000294309:p.Gly734Glu	Somatic	94	0		WXS	Illumina GAIIx	Phase_I	61	5	NM_139075	0	0	4	4	0	Q9NT82	Missense_Mutation	SNP	ENST00000294309.3	37	CCDS8189.1	515	0.2358058608058608	23	0.046747967479674794	98	0.27071823204419887	119	0.20804195804195805	275	0.3627968337730871	G	0.005	-2.162036	0.00318	0.105909	0.383326	ENSG00000162341	ENST00000294309;ENST00000542467	D;D	0.96830	-4.07;-4.14	4.12	-3.6	0.04570	.	0.542623	0.16118	N	0.228770	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B;B	0.06786	0.0;0.001	B;B	0.04013	0.0;0.001	T	0.38520	-0.9657	9	0.02654	T	1	-0.834	3.6019	0.08028	0.2148:0.4832:0.211:0.091	rs3829241;rs17399449;rs17855775;rs57492255;rs3829241	552;734	E7ETX0;Q8NHX9	.;TPC2_HUMAN	E	734;552	ENSP00000294309:G734E;ENSP00000445551:G552E	ENSP00000294309:G734E	G	+	2	0	TPCN2	68611939	0.575000	0.26692	0.027000	0.17364	0.018000	0.09664	1.094000	0.30951	-0.426000	0.07360	-0.672000	0.03802	GGG	G|0.756;A|0.244		0.632	TPCN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396878.2	NM_139075	
TRIM49	57093	bcgsc.ca	37	11	89531764	89531764	+	Missense_Mutation	SNP	T	T	C	rs672762	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr11:89531764T>C	ENST00000329758.1	-	8	1221	c.893A>G	c.(892-894)aAt>aGt	p.N298S	TRIM49_ENST00000532501.2_Missense_Mutation_p.N221S	NM_020358.2	NP_065091.1	P0CI25	TRI49_HUMAN	tripartite motif containing 49	298	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.			N -> S (in Ref. 3; AAH75019/AAH75020). {ECO:0000305}.		intracellular (GO:0005622)	zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(1)|lung(14)|prostate(1)|skin(2)|stomach(1)	27		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				AAAGATATCATTGTTGGCTTC	0.318													c|||	1548	0.309105	0.4826	0.33	5008	,	,		13117	0.2609		0.1899	False		,,,				2504	0.2321				p.N298S		.											.	TRIM49-84	0			c.A893G						.						34.0	46.0	42.0					11																	89531764		2105	4275	6380	SO:0001583	missense	57093	exon8			ATATCATTGTTGG	AB037682	CCDS8287.1	11p11.12-q12	2012-05-21	2011-01-25	2004-11-17	ENSG00000168930	ENSG00000168930		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	13431	protein-coding gene	gene with protein product		606124	"""ring finger protein 18"", ""tripartite motif-containing 49"""	RNF18		11018261	Standard	NM_020358		Approved	TRIM49A	uc001pdb.3	P0CI25		ENST00000329758.1:c.893A>G	11.37:g.89531764T>C	ENSP00000327604:p.Asn298Ser	Somatic	59	3		WXS	Illumina GAIIx	Phase_I	21	9	NM_020358	0	0	0	0	0	A0AVR7|A0AVR9|Q6DJV1|Q9NS80	Missense_Mutation	SNP	ENST00000329758.1	37	CCDS8287.1	.	.	.	.	.	.	.	.	.	.	C	0	-2.838011	0.00069	.	.	ENSG00000168930	ENST00000329758;ENST00000532501	T	0.04454	3.62	0.821	-0.818	0.10833	Concanavalin A-like lectin/glucanase (1);Butyrophylin-like (1);B30.2/SPRY domain (1);	.	.	.	.	T	0.01189	0.0039	N	0.00510	-1.415	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.46331	-0.9199	7	.	.	.	.	4.687	0.12762	0.0:0.2626:0.0:0.7374	.	298	P0CI25	TRI49_HUMAN	S	298;221	ENSP00000327604:N298S	.	N	-	2	0	TRIM49	89171412	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	-2.967000	0.00669	-0.949000	0.03663	-1.033000	0.02402	AAT	T|0.500;C|0.500		0.318	TRIM49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395435.1	NM_020358	
MMP8	4317	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	102595542	102595542	+	Silent	SNP	C	C	A			TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr11:102595542C>A	ENST00000236826.3	-	1	143	c.45G>T	c.(43-45)gtG>gtT	p.V15V		NM_002424.2	NP_002415.1	P22894	MMP8_HUMAN	matrix metallopeptidase 8 (neutrophil collagenase)	15					collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|serine-type endopeptidase activity (GO:0004252)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(3)|kidney(1)|large_intestine(4)|lung(11)|ovary(4)|skin(6)|stomach(1)|urinary_tract(1)	32	all_cancers(8;0.00092)|all_epithelial(12;0.00389)|Lung NSC(15;0.227)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0555)|Lung(13;0.0828)|LUSC - Lung squamous cell carcinoma(19;0.151)|all cancers(10;0.189)	BRCA - Breast invasive adenocarcinoma(274;0.0141)	Marimastat(DB00786)	TGGAAATCTGCACATGGAGTA	0.413																																					p.V15V		.											.	MMP8-229	0			c.G45T						.						163.0	180.0	174.0					11																	102595542		2203	4299	6502	SO:0001819	synonymous_variant	4317	exon1			AATCTGCACATGG	J05556	CCDS8320.1	11q21-q22	2008-02-05	2005-08-08		ENSG00000118113	ENSG00000118113	3.4.24.34		7175	protein-coding gene	gene with protein product		120355	"""matrix metalloproteinase 8 (neutrophil collagenase)"""	CLG1			Standard	NM_002424		Approved		uc001phe.2	P22894	OTTHUMG00000167587	ENST00000236826.3:c.45G>T	11.37:g.102595542C>A		Somatic	166	0		WXS	Illumina GAIIx	Phase_I	99	16	NM_002424	0	0	0	0	0	Q45F99	Silent	SNP	ENST00000236826.3	37	CCDS8320.1																																																																																			.		0.413	MMP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395223.1	NM_002424	
NXPE4	54827	ucsc.edu;bcgsc.ca	37	11	114442103	114442103	+	Missense_Mutation	SNP	A	A	G	rs550897	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr11:114442103A>G	ENST00000375478.3	-	6	1372	c.1192T>C	c.(1192-1194)Tat>Cat	p.Y398H	NXPE4_ENST00000424261.2_Missense_Mutation_p.Y114H	NM_001077639.1	NP_001071107.1	Q6UWF7	NXPE4_HUMAN	neurexophilin and PC-esterase domain family, member 4	398			Y -> H (in dbSNP:rs550897). {ECO:0000269|PubMed:15375555}.			extracellular vesicular exosome (GO:0070062)											GGATAACAATATTTTTGCCAC	0.423													G|||	3275	0.653954	0.9054	0.5605	5008	,	,		19012	0.6746		0.4682	False		,,,				2504	0.5501				p.Y398H		.											.	.	0			c.T1192C						.	G	HIS/TYR,HIS/TYR	3195,621		1345,505,58	212.0	190.0	197.0		1192,340	4.5	0.2	11	dbSNP_83	197	4029,4229		963,2103,1063	yes	missense,missense	FAM55D	NM_001077639.1,NM_017678.2	83,83	2308,2608,1121	GG,GA,AA		48.7891,16.2736,40.169	benign,benign	398/545,114/261	114442103	7224,4850	1908	4129	6037	SO:0001583	missense	54827	exon6			AACAATATTTTTG	AK000134	CCDS41718.1, CCDS44737.1	11q23.3	2012-06-14	2012-06-11	2012-06-11	ENSG00000137634	ENSG00000137634			23117	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 33"", ""family with sequence similarity 55, member D"""	C11orf33, FAM55D		20056006	Standard	NM_017678		Approved	FLJ20127	uc001ppc.3	Q6UWF7	OTTHUMG00000168291	ENST00000375478.3:c.1192T>C	11.37:g.114442103A>G	ENSP00000364627:p.Tyr398His	Somatic	87	0		WXS	Illumina GAIIx	Phase_I	58	6	NM_001077639	0	0	0	0	0	Q6QDB4|Q9NXP5	Missense_Mutation	SNP	ENST00000375478.3	37	CCDS41718.1	1352	0.6190476190476191	436	0.8861788617886179	191	0.5276243093922652	381	0.666083916083916	344	0.45382585751978893	G	1.074	-0.668989	0.03403	0.837264	0.487891	ENSG00000137634	ENST00000424261;ENST00000375478	T;T	0.10960	2.82;2.82	5.44	4.54	0.55810	.	0.000000	0.64402	N	0.000005	T	0.00012	0.0000	N	0.00003	-3.415	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.35798	-0.9774	9	0.02654	T	1	.	11.2986	0.49292	0.1497:0.0:0.8503:0.0	rs550897;rs52827494;rs58118885;rs550897	398	Q6UWF7	FA55D_HUMAN	H	114;398	ENSP00000401503:Y114H;ENSP00000364627:Y398H	ENSP00000364627:Y398H	Y	-	1	0	FAM55D	113947313	0.999000	0.42202	0.201000	0.23476	0.807000	0.45602	4.178000	0.58284	0.804000	0.34136	-0.166000	0.13349	TAT	T|0.145;G|0.383		0.423	NXPE4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000399179.1	NM_017678	
PCSK7	9159	ucsc.edu;bcgsc.ca	37	11	117077034	117077034	+	Silent	SNP	A	A	G	rs28590104	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr11:117077034A>G	ENST00000320934.3	-	17	2667	c.2037T>C	c.(2035-2037)acT>acC	p.T679T	PCSK7_ENST00000540028.1_3'UTR|PCSK7_ENST00000529458.1_5'UTR	NM_004716.2	NP_004707.2	Q16549	PCSK7_HUMAN	proprotein convertase subtilisin/kexin type 7	679					peptide hormone processing (GO:0016486)|protein processing (GO:0016485)	integral component of Golgi membrane (GO:0030173)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			NS(1)|endometrium(3)|large_intestine(2)|lung(8)|ovary(1)|skin(1)	16	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.72e-06)|Epithelial(105;6.71e-05)|all cancers(92;0.000537)		TGTAGTAAACAGTCCAGAAGA	0.552			T	IGH@	MLCLS								G|||	2816	0.5623	0.6989	0.4308	5008	,	,		20516	0.6538		0.3091	False		,,,				2504	0.637				p.T679T		.		Dom	yes		11	11q23.3	9159	proprotein convertase subtilisin/kexin type 7		L	.	PCSK7-658	0			c.T2037C						.						47.0	54.0	51.0					11																	117077034		2201	4296	6497	SO:0001819	synonymous_variant	9159	exon17			GTAAACAGTCCAG	U40623	CCDS8382.1	11q23-q24	2008-02-01			ENSG00000160613	ENSG00000160613			8748	protein-coding gene	gene with protein product		604872				8615762, 9820811	Standard	XM_006718938		Approved	PC7, PC8, LPC, SPC7	uc001pqr.3	Q16549	OTTHUMG00000165640	ENST00000320934.3:c.2037T>C	11.37:g.117077034A>G		Somatic	63	2		WXS	Illumina GAIIx	Phase_I	50	7	NM_004716	0	0	12	12	0	B0YJ60|Q3C1X1|Q53GM4|Q96FK8|Q9UL57	Silent	SNP	ENST00000320934.3	37	CCDS8382.1																																																																																			A|0.563;G|0.437		0.552	PCSK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385529.2	NM_004716	
CEP164	22897	bcgsc.ca	37	11	117266312	117266312	+	Missense_Mutation	SNP	C	C	G	rs2305830	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr11:117266312C>G	ENST00000278935.3	+	24	3110	c.2963C>G	c.(2962-2964)aCc>aGc	p.T988S	CEP164_ENST00000533706.1_3'UTR	NM_001271933.1|NM_014956.4	NP_001258862.1|NP_055771.4	Q9UPV0	CE164_HUMAN	centrosomal protein 164kDa	988			T -> S (in dbSNP:rs2305830). {ECO:0000269|PubMed:17974005}.		cilium assembly (GO:0042384)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary transition fiber (GO:0097539)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|kidney(7)|large_intestine(12)|lung(18)|ovary(3)|prostate(3)	47	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;4e-05)|Epithelial(105;0.0008)		AAGGAGCACACCCACCTGTTG	0.567													C|||	1392	0.277955	0.267	0.2089	5008	,	,		18904	0.3046		0.3211	False		,,,				2504	0.2699				p.T991S		.											.	CEP164-69	0			c.C2972G						.	C	SER/THR	1176,3226	411.3+/-335.7	155,866,1180	56.0	57.0	57.0		2963	0.9	0.0	11	dbSNP_100	57	2658,5934	425.8+/-355.1	405,1848,2043	yes	missense	CEP164	NM_014956.4	58	560,2714,3223	GG,GC,CC		30.9358,26.7151,29.5059	benign	988/1461	117266312	3834,9160	2201	4296	6497	SO:0001583	missense	22897	exon23			AGCACACCCACCT	AB028975	CCDS31683.1	11q23.3	2014-02-20			ENSG00000110274	ENSG00000110274			29182	protein-coding gene	gene with protein product		614848				10470851, 14654843	Standard	NM_014956		Approved	KIAA1052, NPHP15	uc001prc.3	Q9UPV0	OTTHUMG00000167070	ENST00000278935.3:c.2963C>G	11.37:g.117266312C>G	ENSP00000278935:p.Thr988Ser	Somatic	115	1		WXS	Illumina GAIIx	Phase_I	116	8	NM_001271933	0	0	6	6	0	Q6PKH9|Q7Z2X9|Q9NVS0|Q9UFJ6	Missense_Mutation	SNP	ENST00000278935.3	37	CCDS31683.1	635	0.2907509157509158	139	0.28252032520325204	87	0.24033149171270718	168	0.2937062937062937	241	0.3179419525065963	C	10.78	1.445822	0.25987	0.267151	0.309358	ENSG00000110274	ENST00000278935;ENST00000529538	T	0.27104	1.69	5.02	0.953	0.19590	.	0.702415	0.12990	N	0.422568	T	0.00012	0.0000	L	0.50919	1.6	0.80722	P	0.0	B;B;B;B	0.10296	0.002;0.003;0.003;0.003	B;B;B;B	0.10450	0.002;0.005;0.005;0.005	T	0.40664	-0.9551	9	0.29301	T	0.29	-0.0052	3.8141	0.08808	0.1203:0.3898:0.353:0.1368	rs2305830;rs17500832;rs52823446;rs2305830	962;762;988;991	E9PI34;Q9NTH6;Q9UPV0;Q9UPV0-2	.;.;CE164_HUMAN;.	S	988;962	ENSP00000278935:T988S	ENSP00000278935:T988S	T	+	2	0	CEP164	116771522	0.000000	0.05858	0.003000	0.11579	0.953000	0.61014	-0.116000	0.10724	-0.075000	0.12798	0.491000	0.48974	ACC	C|0.710;G|0.290		0.567	CEP164-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392893.1	NM_014956	
GRIN2B	2904	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	13716624	13716624	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr12:13716624G>A	ENST00000609686.1	-	13	3757	c.3548C>T	c.(3547-3549)aCg>aTg	p.T1183M		NM_000834.3	NP_000825.2	Q13224	NMDE2_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2B	1183					behavioral fear response (GO:0001662)|behavioral response to pain (GO:0048266)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|glutamate receptor signaling pathway (GO:0007215)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning (GO:0007612)|learning or memory (GO:0007611)|memory (GO:0007613)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic plasticity (GO:0048167)|response to ethanol (GO:0045471)|sensory organ development (GO:0007423)|startle response (GO:0001964)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(12)|liver(1)|lung(70)|ovary(4)|prostate(6)|skin(10)|upper_aerodigestive_tract(5)|urinary_tract(1)	143					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Haloperidol(DB00502)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	TTTGTCGCCCGTCCCGTGCTT	0.622																																					p.T1183M		.											.	GRIN2B-231	0			c.C3548T						.						100.0	93.0	95.0					12																	13716624		2203	4300	6503	SO:0001583	missense	2904	exon13			TCGCCCGTCCCGT		CCDS8662.1	12p13.1	2014-07-16			ENSG00000273079			"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4586	protein-coding gene	gene with protein product		138252		NMDAR2B		1350383	Standard	NM_000834		Approved	GluN2B	uc001rbt.2	Q13224	OTTHUMG00000137373	ENST00000609686.1:c.3548C>T	12.37:g.13716624G>A	ENSP00000477455:p.Thr1183Met	Somatic	76	0		WXS	Illumina GAIIx	Phase_I	107	47	NM_000834	0	0	0	0	0	Q12919|Q13220|Q13225|Q14CU4|Q9UM56	Missense_Mutation	SNP	ENST00000609686.1	37	CCDS8662.1	.	.	.	.	.	.	.	.	.	.	G	0.835	-0.743773	0.03088	.	.	ENSG00000150086	ENST00000279593	T	0.11712	2.75	4.38	4.38	0.52667	Glutamate [NMDA] receptor, epsilon subunit, C-terminal (1);	0.914251	0.09542	N	0.788189	T	0.11239	0.0274	N	0.14661	0.345	0.09310	N	0.999995	D	0.56521	0.976	P	0.46975	0.533	T	0.38329	-0.9666	10	0.46703	T	0.11	.	15.4982	0.75673	0.0:0.0:1.0:0.0	.	1183	Q13224	NMDE2_HUMAN	M	1183	ENSP00000279593:T1183M	ENSP00000279593:T1183M	T	-	2	0	GRIN2B	13607891	0.053000	0.20554	0.023000	0.16930	0.006000	0.05464	2.667000	0.46808	2.167000	0.68274	0.591000	0.81541	ACG	.		0.622	GRIN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268014.2		
DDX11	1663	ucsc.edu	37	12	31244689	31244689	+	Missense_Mutation	SNP	G	G	A	rs397842879		TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr12:31244689G>A	ENST00000407793.2	+	10	1377	c.1126G>A	c.(1126-1128)Gcc>Acc	p.A376T	DDX11_ENST00000542838.1_Missense_Mutation_p.A376T|DDX11_ENST00000545668.1_Missense_Mutation_p.A376T|DDX11_ENST00000350437.4_Missense_Mutation_p.A376T|DDX11_ENST00000228264.6_Missense_Mutation_p.A350T|DDX11_ENST00000251758.5_3'UTR	NM_030653.3|NM_152438.1	NP_085911.2|NP_689651.1	Q96FC9	DDX11_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11	376	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(11)|large_intestine(5)|lung(23)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	57	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					GCTGCATGCGGCCACTCGGCA	0.672										Multiple Myeloma(12;0.14)																											p.A376T		.											.	DDX11-229	0			c.G1126A						.						26.0	25.0	26.0					12																	31244689		2194	4289	6483	SO:0001583	missense	1663	exon10			CATGCGGCCACTC	U75969	CCDS8721.1, CCDS41767.1, CCDS44856.1, CCDS58224.1	12p11.21	2012-02-23	2012-02-23		ENSG00000013573	ENSG00000013573		"""DEAD-boxes"""	2736	protein-coding gene	gene with protein product	"""CHL1-like helicase homolog (S. cerevisiae)"""	601150	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11 (S.cerevisiae CHL1-like helicase)"", ""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11"""				Standard	NM_030653		Approved	CHLR1, KRG2, CHL1, ChlR1, WABS	uc001rjv.2	Q96FC9	OTTHUMG00000168435	ENST00000407793.2:c.1126G>A	12.37:g.31244689G>A	ENSP00000384703:p.Ala376Thr	Somatic	272	67		WXS	Illumina GAIIx	Phase_I	947	134	NM_030653	0	0	3	6	3	Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	SNP	ENST00000407793.2	37	CCDS44856.1	.	.	.	.	.	.	.	.	.	.	G	7.984	0.751761	0.15778	.	.	ENSG00000013573	ENST00000542838;ENST00000407793;ENST00000404673;ENST00000228264;ENST00000545668;ENST00000350437	T;T;T;T;T	0.71461	-0.57;1.0;-0.57;1.0;1.0	3.05	3.05	0.35203	DEAD2 (1);Helicase-like, DEXD box c2 type (1);Helicase, superfamily 1/2, ATP-binding domain, DinG/Rad3-type (1);	0.324166	0.32703	N	0.005754	T	0.68109	0.2965	L	0.55834	1.745	0.80722	D	1	P;P;D;P;P	0.59767	0.633;0.814;0.986;0.814;0.905	P;B;P;B;B	0.49799	0.507;0.313;0.622;0.294;0.392	T	0.69300	-0.5181	10	0.56958	D	0.05	.	7.318	0.26511	0.0:0.0:0.738:0.262	.	101;350;376;376;376	Q93000;Q96FC9-3;Q96FC9;Q96FC9-4;Q96FC9-2	.;.;DDX11_HUMAN;.;.	T	376;376;101;350;376;376	ENSP00000443426:A376T;ENSP00000384703:A376T;ENSP00000228264:A350T;ENSP00000440402:A376T;ENSP00000309965:A376T	ENSP00000228264:A350T	A	+	1	0	DDX11	31135956	0.935000	0.31712	0.573000	0.28510	0.048000	0.14542	1.665000	0.37449	1.535000	0.49220	0.505000	0.49811	GCC	.		0.672	DDX11-202	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000399728.1	NM_030653	
KRT83	3889	broad.mit.edu	37	12	52709845	52709845	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr12:52709845G>T	ENST00000293670.3	-	7	1156	c.1094C>A	c.(1093-1095)gCc>gAc	p.A365D		NM_002282.3	NP_002273.3	P78385	KRT83_HUMAN	keratin 83	365	Coil 2.|Rod.				aging (GO:0007568)|epidermis development (GO:0008544)|hair cycle (GO:0042633)	extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.A365D(2)		NS(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(9)|prostate(1)|skin(4)|stomach(7)|upper_aerodigestive_tract(1)	32	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)			BRCA - Breast invasive adenocarcinoma(357;0.189)		ATCACTGAGGGCCGCCTCACC	0.597																																					p.A365D	GBM(41;747 834 12702 24089 39393)|Esophageal Squamous(97;805 1414 12559 28198 31861)	.											.	KRT83-91	2	Substitution - Missense(2)	prostate(1)|endometrium(1)	c.C1094A						.						36.0	36.0	36.0					12																	52709845		2203	4299	6502	SO:0001583	missense	3889	exon7			CTGAGGGCCGCCT	X99141	CCDS8823.1	12q13.13	2013-06-20	2006-07-17	2006-07-17	ENSG00000170523	ENSG00000170523		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6460	protein-coding gene	gene with protein product	"""hard keratin type II"""	602765	"""keratin, hair, basic, 3"""	KRTHB3		9084137, 16831889	Standard	NM_002282		Approved	Hb-3	uc001saf.2	P78385	OTTHUMG00000169632	ENST00000293670.3:c.1094C>A	12.37:g.52709845G>T	ENSP00000293670:p.Ala365Asp	Somatic	51	3		WXS	Illumina GAIIx	Phase_I	130	13	NM_002282	0	0	0	0	0	A1A4S9|B2RC21|Q6NT21|Q9NSB3	Missense_Mutation	SNP	ENST00000293670.3	37	CCDS8823.1	.	.	.	.	.	.	.	.	.	.	G	17.16	3.319489	0.60524	.	.	ENSG00000170523	ENST00000293670	T	0.74737	-0.87	3.84	3.84	0.44239	Filament (1);	0.168584	0.27749	U	0.018016	D	0.83830	0.5339	M	0.72894	2.215	0.40384	D	0.97947	D	0.55605	0.972	D	0.64877	0.93	D	0.85501	0.1191	9	.	.	.	.	16.1279	0.81406	0.0:0.0:1.0:0.0	.	365	P78385	KRT83_HUMAN	D	365	ENSP00000293670:A365D	.	A	-	2	0	KRT83	50996112	1.000000	0.71417	0.702000	0.30337	0.425000	0.31504	7.806000	0.86020	1.867000	0.54127	0.563000	0.77884	GCC	.		0.597	KRT83-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405182.1	NM_002282	
OR6C2	341416	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	55846284	55846284	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr12:55846284C>G	ENST00000322678.1	+	1	287	c.287C>G	c.(286-288)gCc>gGc	p.A96G	RP11-110A12.2_ENST00000554049.1_RNA|RP11-110A12.2_ENST00000555138.1_RNA|RP11-110A12.2_ENST00000555146.1_RNA|RP11-110A12.2_ENST00000556750.1_RNA	NM_054105.1	NP_473446.1	Q9NZP2	OR6C2_HUMAN	olfactory receptor, family 6, subfamily C, member 2	96					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(2)|large_intestine(5)|lung(8)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	23						AATGCTTGTGCCAGTCAAATA	0.388																																					p.A96G		.											.	OR6C2-70	0			c.C287G						.						147.0	146.0	146.0					12																	55846284		2203	4299	6502	SO:0001583	missense	341416	exon1			CTTGTGCCAGTCA	AF179766	CCDS31824.1	12q13.2	2012-08-09				ENSG00000179695		"""GPCR / Class A : Olfactory receptors"""	15436	protein-coding gene	gene with protein product							Standard	NM_054105		Approved	OR6C67	uc001sgz.1	Q9NZP2	OTTHUMG00000169957	ENST00000322678.1:c.287C>G	12.37:g.55846284C>G	ENSP00000323606:p.Ala96Gly	Somatic	66	1		WXS	Illumina GAIIx	Phase_I	78	27	NM_054105	0	0	0	0	0		Missense_Mutation	SNP	ENST00000322678.1	37	CCDS31824.1	.	.	.	.	.	.	.	.	.	.	C	12.00	1.806244	0.31961	.	.	ENSG00000179695	ENST00000322678	T	0.19938	2.11	5.42	0.432	0.16529	GPCR, rhodopsin-like superfamily (1);	0.449907	0.21108	N	0.080040	T	0.15262	0.0368	L	0.42245	1.32	0.09310	N	1	B	0.16603	0.018	B	0.22753	0.041	T	0.17868	-1.0355	10	0.42905	T	0.14	.	5.5554	0.17113	0.0:0.4971:0.1314:0.3715	.	96	Q9NZP2	OR6C2_HUMAN	G	96	ENSP00000323606:A96G	ENSP00000323606:A96G	A	+	2	0	OR6C2	54132551	0.000000	0.05858	0.023000	0.16930	0.076000	0.17211	-0.103000	0.10940	0.130000	0.18549	0.609000	0.83330	GCC	.		0.388	OR6C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406676.1	NM_054105	
EEA1	8411	broad.mit.edu;bcgsc.ca	37	12	93226501	93226501	+	Silent	SNP	T	T	C			TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr12:93226501T>C	ENST00000322349.8	-	11	1305	c.1041A>G	c.(1039-1041)caA>caG	p.Q347Q		NM_003566.3	NP_003557	Q15075	EEA1_HUMAN	early endosome antigen 1	347					early endosome to late endosome transport (GO:0045022)|endocytosis (GO:0006897)|synaptic vesicle to endosome fusion (GO:0016189)|vesicle fusion (GO:0006906)	axonal spine (GO:0044308)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|membrane (GO:0016020)|recycling endosome (GO:0055037)|serine-pyruvate aminotransferase complex (GO:0005969)	1-phosphatidylinositol binding (GO:0005545)|calmodulin binding (GO:0005516)|GTP-dependent protein binding (GO:0030742)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(5)|large_intestine(11)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	36						ACTGAAGCTGTTGACAATCTA	0.353																																					p.Q347Q		.											.	EEA1-229	0			c.A1041G						.						141.0	131.0	135.0					12																	93226501		2203	4299	6502	SO:0001819	synonymous_variant	8411	exon11			AAGCTGTTGACAA	L40157	CCDS31874.1	12q22	2007-02-23	2007-02-23			ENSG00000102189		"""Zinc fingers, FYVE domain containing"""	3185	protein-coding gene	gene with protein product		605070	"""early endosome antigen 1, 162kD"""			7768953, 9697774	Standard	NM_003566		Approved	ZFYVE2	uc001tck.3	Q15075	OTTHUMG00000170110	ENST00000322349.8:c.1041A>G	12.37:g.93226501T>C		Somatic	86	0		WXS	Illumina GAIIx	Phase_I	75	6	NM_003566	0	0	13	13	0	Q14221	Silent	SNP	ENST00000322349.8	37	CCDS31874.1																																																																																			.		0.353	EEA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407304.1	NM_003566	
AMDHD1	144193	hgsc.bcm.edu	37	12	96337183	96337183	+	Missense_Mutation	SNP	A	A	G	rs7955450	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr12:96337183A>G	ENST00000266736.2	+	1	113	c.7A>G	c.(7-9)Agc>Ggc	p.S3G	CCDC38_ENST00000549752.1_5'Flank|CCDC38_ENST00000546386.1_5'Flank|CCDC38_ENST00000344280.3_5'Flank	NM_152435.2	NP_689648.2	Q96NU7	HUTI_HUMAN	amidohydrolase domain containing 1	3			S -> G (in dbSNP:rs7955450). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15221005, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:16541075}.		cellular nitrogen compound metabolic process (GO:0034641)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	imidazolonepropionase activity (GO:0050480)|metal ion binding (GO:0046872)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|skin(1)	22						CGACATGGCAAGCGGCCACAG	0.736													G|||	3598	0.71845	0.702	0.6888	5008	,	,		10480	0.9554		0.6004	False		,,,				2504	0.6391				p.S3G		.											.	AMDHD1-90	0			c.A7G						.						2.0	3.0	3.0					12																	96337183		1177	2379	3556	SO:0001583	missense	144193	exon1			ATGGCAAGCGGCC	AB075878	CCDS9057.1	12q23.1	2006-02-02				ENSG00000139344			28577	protein-coding gene	gene with protein product							Standard	NM_152435		Approved	MGC35366	uc001tel.2	Q96NU7	OTTHUMG00000170353	ENST00000266736.2:c.7A>G	12.37:g.96337183A>G	ENSP00000266736:p.Ser3Gly	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	5	NM_152435	0	0	0	0	0	A8K463|Q68CI8	Missense_Mutation	SNP	ENST00000266736.2	37	CCDS9057.1	1561	0.7147435897435898	348	0.7073170731707317	233	0.643646408839779	540	0.9440559440559441	440	0.5804749340369393	G	5.553	0.286982	0.10513	.	.	ENSG00000139344	ENST00000266736	T	0.30714	1.52	4.39	-8.69	0.00855	.	0.734274	0.13810	N	0.361153	T	0.00012	0.0000	N	0.01576	-0.805	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.28427	-1.0044	9	0.21540	T	0.41	.	1.8829	0.03231	0.44:0.0902:0.1959:0.2739	rs7955450;rs17856824;rs58541549;rs7955450	3	Q96NU7	HUTI_HUMAN	G	3	ENSP00000266736:S3G	ENSP00000266736:S3G	S	+	1	0	AMDHD1	94861314	0.000000	0.05858	0.000000	0.03702	0.134000	0.20937	-0.592000	0.05747	-2.316000	0.00645	-1.140000	0.01884	AGC	A|0.273;G|0.727		0.736	AMDHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408640.1	NM_152435	
AMDHD1	144193	hgsc.bcm.edu	37	12	96337225	96337225	+	Silent	SNP	C	C	T	rs1436121	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr12:96337225C>T	ENST00000266736.2	+	1	155	c.49C>T	c.(49-51)Ctg>Ttg	p.L17L	CCDC38_ENST00000549752.1_5'Flank|CCDC38_ENST00000546386.1_5'Flank|CCDC38_ENST00000344280.3_5'Flank	NM_152435.2	NP_689648.2	Q96NU7	HUTI_HUMAN	amidohydrolase domain containing 1	17					cellular nitrogen compound metabolic process (GO:0034641)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	imidazolonepropionase activity (GO:0050480)|metal ion binding (GO:0046872)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|skin(1)	22						GCAAGTGGTGCTGGTGTGCGC	0.741													C|||	1276	0.254792	0.09	0.1297	5008	,	,		11076	0.4732		0.2445	False		,,,				2504	0.3517				p.L17L		.											.	AMDHD1-90	0			c.C49T						.	C		259,2703		9,241,1231	3.0	4.0	4.0		49	1.4	1.0	12	dbSNP_88	4	983,4553		75,833,1860	no	coding-synonymous	AMDHD1	NM_152435.2		84,1074,3091	TT,TC,CC		17.7565,8.7441,14.6152		17/427	96337225	1242,7256	1481	2768	4249	SO:0001819	synonymous_variant	144193	exon1			GTGGTGCTGGTGT	AB075878	CCDS9057.1	12q23.1	2006-02-02				ENSG00000139344			28577	protein-coding gene	gene with protein product							Standard	NM_152435		Approved	MGC35366	uc001tel.2	Q96NU7	OTTHUMG00000170353	ENST00000266736.2:c.49C>T	12.37:g.96337225C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	16	11	NM_152435	0	0	0	0	0	A8K463|Q68CI8	Silent	SNP	ENST00000266736.2	37	CCDS9057.1																																																																																			C|0.752;T|0.248		0.741	AMDHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408640.1	NM_152435	
VSIG10	54621	bcgsc.ca	37	12	118506186	118506186	+	Silent	SNP	A	A	T	rs67405503	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr12:118506186A>T	ENST00000359236.5	-	8	1839	c.1563T>A	c.(1561-1563)ctT>ctA	p.L521L		NM_019086.5	NP_061959.2	Q8N0Z9	VSI10_HUMAN	V-set and immunoglobulin domain containing 10	521						integral component of membrane (GO:0016021)				endometrium(5)|large_intestine(3)|lung(6)|skin(1)|stomach(1)|urinary_tract(1)	17						GCTTACCTTGAAGATCCTGGA	0.448													T|||	2110	0.421326	0.4516	0.4582	5008	,	,		18101	0.372		0.4036	False		,,,				2504	0.4233				p.L521L		.											.	.	0			c.T1563A						.	T		1649,2181		344,961,610	187.0	183.0	184.0		1563	-8.2	0.3	12	dbSNP_130	184	3170,5072		618,1934,1569	no	coding-synonymous	VSIG10	NM_019086.5		962,2895,2179	TT,TA,AA		38.4615,43.0548,39.9188		521/541	118506186	4819,7253	1915	4121	6036	SO:0001819	synonymous_variant	54621	exon8			ACCTTGAAGATCC		CCDS44992.1	12q24.23	2013-01-29			ENSG00000176834	ENSG00000176834		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26078	protein-coding gene	gene with protein product						12477932	Standard	NM_019086		Approved		uc001tws.3	Q8N0Z9		ENST00000359236.5:c.1563T>A	12.37:g.118506186A>T		Somatic	168	0		WXS	Illumina GAIIx	Phase_I	263	10	NM_019086	0	0	0	0	0	Q9NWQ7	Silent	SNP	ENST00000359236.5	37	CCDS44992.1																																																																																			A|0.602;T|0.398		0.448	VSIG10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401273.2	NM_019086	
TAOK3	51347	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	118619354	118619354	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr12:118619354C>T	ENST00000392533.3	-	15	1878	c.1388G>A	c.(1387-1389)gGt>gAt	p.G463D	TAOK3_ENST00000419821.2_Missense_Mutation_p.G463D|TAOK3_ENST00000537952.1_Missense_Mutation_p.G3D	NM_016281.3	NP_057365.3	Q9H2K8	TAOK3_HUMAN	TAO kinase 3	463					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|MAPK cascade (GO:0000165)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of JNK cascade (GO:0046329)|negative regulation of protein kinase activity (GO:0006469)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)|transferase activity (GO:0016740)			central_nervous_system(1)|lung(5)|skin(1)	7	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CCGCTTATAACCTGACATCTG	0.532											OREG0022177	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G463D		.											.	TAOK3-933	0			c.G1388A						.						114.0	97.0	103.0					12																	118619354		2203	4300	6503	SO:0001583	missense	51347	exon15			TTATAACCTGACA	AF135158	CCDS9188.1	12q	2007-08-03				ENSG00000135090			18133	protein-coding gene	gene with protein product						10559204, 10924369	Standard	NM_016281		Approved	JIK, DPK, MAP3K18	uc001twy.4	Q9H2K8		ENST00000392533.3:c.1388G>A	12.37:g.118619354C>T	ENSP00000376317:p.Gly463Asp	Somatic	106	1	1489	WXS	Illumina GAIIx	Phase_I	237	42	NM_016281	0	0	42	49	7	Q658N1|Q8IUM4|Q9HC79|Q9NZM9|Q9UHG7	Missense_Mutation	SNP	ENST00000392533.3	37	CCDS9188.1	.	.	.	.	.	.	.	.	.	.	C	35	5.420039	0.96111	.	.	ENSG00000135090	ENST00000419821;ENST00000392533;ENST00000537952;ENST00000359811;ENST00000540561;ENST00000537822	T;T;T;T	0.34472	1.36;1.36;1.36;1.36	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	T	0.65657	0.2712	M	0.82193	2.58	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.69335	-0.5172	10	0.87932	D	0	.	19.4372	0.94801	0.0:1.0:0.0:0.0	.	463	Q9H2K8	TAOK3_HUMAN	D	463;463;3;83;3;3	ENSP00000416374:G463D;ENSP00000376317:G463D;ENSP00000443834:G3D;ENSP00000443487:G3D	ENSP00000352863:G83D	G	-	2	0	TAOK3	117103737	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.651000	0.83577	2.827000	0.97445	0.650000	0.86243	GGT	.		0.532	TAOK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401456.2	NM_016281	
LRRC43	254050	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	122684857	122684857	+	Missense_Mutation	SNP	G	G	A	rs372715448		TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr12:122684857G>A	ENST00000339777.4	+	8	1499	c.1471G>A	c.(1471-1473)Gtg>Atg	p.V491M	LRRC43_ENST00000425921.1_Missense_Mutation_p.V306M	NM_152759.4	NP_689972.3	Q8N309	LRC43_HUMAN	leucine rich repeat containing 43	491										NS(1)|endometrium(1)|large_intestine(4)|lung(10)|skin(1)|upper_aerodigestive_tract(2)	19	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000312)|Epithelial(86;0.000539)|BRCA - Breast invasive adenocarcinoma(302;0.225)		GGGGACCACCGTGACCATCGT	0.642																																					p.V491M		.											.	LRRC43-135	0			c.G1471A						.	G	MET/VAL,MET/VAL	1,4261		0,1,2130	69.0	77.0	74.0		1471,916	3.0	0.8	12		74	0,8454		0,0,4227	no	missense,missense	LRRC43	NM_001098519.1,NM_152759.4	21,21	0,1,6357	AA,AG,GG		0.0,0.0235,0.0079	probably-damaging,probably-damaging	491/657,306/472	122684857	1,12715	2131	4227	6358	SO:0001583	missense	254050	exon8			ACCACCGTGACCA	AK124107	CCDS45001.1	12q24.31	2014-09-11			ENSG00000158113	ENSG00000158113			28562	protein-coding gene	gene with protein product						12477932	Standard	NM_152759		Approved	MGC35140	uc009zxm.3	Q8N309	OTTHUMG00000168915	ENST00000339777.4:c.1471G>A	12.37:g.122684857G>A	ENSP00000344233:p.Val491Met	Somatic	86	0		WXS	Illumina GAIIx	Phase_I	193	62	NM_001098519	0	0	0	0	0	Q6ZVT9	Missense_Mutation	SNP	ENST00000339777.4	37	CCDS45001.1	.	.	.	.	.	.	.	.	.	.	G	14.92	2.679622	0.47886	2.35E-4	0.0	ENSG00000158113	ENST00000339777;ENST00000289014;ENST00000425921	T;T	0.61742	0.08;0.52	4.85	2.96	0.34315	.	0.308811	0.26112	N	0.026269	T	0.71247	0.3317	M	0.76002	2.32	0.21020	N	0.999807	D	0.89917	1.0	D	0.76575	0.988	T	0.60214	-0.7307	10	0.44086	T	0.13	-41.7047	9.872	0.41180	0.1742:0.0:0.8258:0.0	.	491	Q8N309	LRC43_HUMAN	M	491;362;306	ENSP00000344233:V491M;ENSP00000416628:V306M	ENSP00000289014:V362M	V	+	1	0	LRRC43	121250810	0.985000	0.35326	0.754000	0.31244	0.332000	0.28634	1.980000	0.40618	1.158000	0.42547	0.563000	0.77884	GTG	.		0.642	LRRC43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401589.1	NM_152759	
SACS	26278	bcgsc.ca	37	13	23912220	23912220	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr13:23912220G>T	ENST00000382292.3	-	9	6068	c.5795C>A	c.(5794-5796)gCc>gAc	p.A1932D	SACS_ENST00000382298.3_Missense_Mutation_p.A1932D|SACS_ENST00000402364.1_Missense_Mutation_p.A1182D			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	1932					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		CCCACTAGTGGCCAGGTCCCG	0.398																																					p.A1932D		.											.	SACS-298	0			c.C5795A						.						121.0	105.0	111.0					13																	23912220		2203	4300	6503	SO:0001583	missense	26278	exon10			CTAGTGGCCAGGT	AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.5795C>A	13.37:g.23912220G>T	ENSP00000371729:p.Ala1932Asp	Somatic	87	0		WXS	Illumina GAIIx	Phase_I	60	4	NM_014363	0	0	0	0	0	O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Missense_Mutation	SNP	ENST00000382292.3	37	CCDS9300.2	.	.	.	.	.	.	.	.	.	.	G	17.22	3.333119	0.60853	.	.	ENSG00000151835	ENST00000382292;ENST00000402364;ENST00000382298	D;D;D	0.88124	-2.18;-2.34;-2.18	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	D	0.86239	0.5885	L	0.59436	1.845	0.54753	D	0.999985	B	0.27380	0.177	B	0.26310	0.068	T	0.82196	-0.0577	10	0.35671	T	0.21	.	19.9478	0.97189	0.0:0.0:1.0:0.0	.	1932	Q9NZJ4	SACS_HUMAN	D	1932;1182;1932	ENSP00000371729:A1932D;ENSP00000385844:A1182D;ENSP00000371735:A1932D	ENSP00000371729:A1932D	A	-	2	0	SACS	22810220	1.000000	0.71417	0.954000	0.39281	0.240000	0.25518	6.421000	0.73353	2.712000	0.92718	0.591000	0.81541	GCC	.		0.398	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044148.3	NM_014363	
DGKH	160851	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	13	42761266	42761289	+	Splice_Site	DEL	TGATGCCGTGGCCAGTAAAGTAAG	TGATGCCGTGGCCAGTAAAGTAAG	-	rs370078018|rs141644135	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	TGATGCCGTGGCCAGTAAAGTAAG	TGATGCCGTGGCCAGTAAAGTAAG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr13:42761266_42761289delTGATGCCGTGGCCAGTAAAGTAAG	ENST00000337343.4	+	14	1641_1659	c.1620_1638delTGATGCCGTGGCCAGTAAAGTAAG	c.(1618-1638)gctgatgccgtggccagtaaa>gc	p.ADAVASK540del	DGKH_ENST00000540693.1_Splice_Site_p.ADAVASK540del|DGKH_ENST00000538674.1_Splice_Site_p.ADAVASK295del|DGKH_ENST00000261491.5_Splice_Site_p.ADAVASK540del|DGKH_ENST00000379274.2_Splice_Site_p.ADAVASK404del|DGKH_ENST00000536612.1_Splice_Site_p.ADAVASK404del|DGKH_ENST00000498255.2_3'UTR	NM_178009.3	NP_821077.1	Q86XP1	DGKH_HUMAN	diacylglycerol kinase, eta	540					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein oligomerization (GO:0051259)	cytoplasm (GO:0005737)|endosome (GO:0005768)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)	p.A542V(1)		breast(2)|endometrium(3)|kidney(5)|large_intestine(11)|lung(9)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43		Lung NSC(96;1.02e-05)|Prostate(109;0.0168)|Lung SC(185;0.0262)|Breast(139;0.0709)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;5.88e-05)|GBM - Glioblastoma multiforme(144;0.000935)|BRCA - Breast invasive adenocarcinoma(63;0.109)		CCGTTGTAGCTGATGCCGTGGCCAGTAAAGTAAGAGGGGACTCT	0.42																																					p.540_546del		.											.	DGKH-652	1	Substitution - Missense(1)	prostate(1)	c.1620_1638del						.																																			SO:0001630	splice_region_variant	160851	exon15			TGTAGCTGATGCC	AB078967	CCDS9381.1, CCDS9382.1, CCDS55898.1	13q13.3	2013-01-10			ENSG00000102780	ENSG00000102780		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2854	protein-coding gene	gene with protein product		604071				8702685	Standard	XM_005266271		Approved	DGKeta	uc001uyl.2	Q86XP1	OTTHUMG00000016804	ENST00000337343.4:c.1638+1TGATGCCGTGGCCAGTAAAGTAAG>-	13.37:g.42761266_42761289delTGATGCCGTGGCCAGTAAAGTAAG		Somatic	142	0		WXS	Illumina GAIIx	Phase_I	35	5	NM_001204504	0	0	0	0	0	A2A2W7|A6NFX7|B4DZ34|Q5VZW0|Q6PI56|Q86XP2|Q8N3N0|Q8N7J9	Frame_Shift_Del	DEL	ENST00000337343.4	37	CCDS9381.1																																																																																			.		0.420	DGKH-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044699.2	NM_178009	In_Frame_Del
COG3	83548	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	46050394	46050394	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr13:46050394C>T	ENST00000349995.5	+	2	345	c.233C>T	c.(232-234)tCa>tTa	p.S78L		NM_031431.3	NP_113619	Q96JB2	COG3_HUMAN	component of oligomeric golgi complex 3	78					ER to Golgi vesicle-mediated transport (GO:0006888)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|protein glycosylation (GO:0006486)|protein localization to organelle (GO:0033365)|protein stabilization (GO:0050821)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein transporter activity (GO:0008565)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(2)|skin(2)|stomach(1)	24		Lung NSC(96;0.000145)|Breast(56;0.000596)|Prostate(109;0.00438)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000124)		GAACTGACTTCAGTAGTGCCT	0.403																																					p.S78L	Ovarian(150;1048 1859 18083 21577 42700)	.											.	COG3-154	0			c.C233T						.						106.0	100.0	102.0					13																	46050394		2203	4300	6503	SO:0001583	missense	83548	exon2			TGACTTCAGTAGT	AF131829	CCDS9398.1	13q14.11	2008-02-05			ENSG00000136152	ENSG00000136152		"""Components of oligomeric golgi complex"""	18619	protein-coding gene	gene with protein product		606975				11980916	Standard	NM_031431		Approved	SEC34	uc001vak.3	Q96JB2	OTTHUMG00000016855	ENST00000349995.5:c.233C>T	13.37:g.46050394C>T	ENSP00000258654:p.Ser78Leu	Somatic	77	0		WXS	Illumina GAIIx	Phase_I	43	28	NM_031431	0	0	0	8	8	B2RAW5|Q5VT70|Q8IXX4|Q9BZ92	Missense_Mutation	SNP	ENST00000349995.5	37	CCDS9398.1	.	.	.	.	.	.	.	.	.	.	C	14.40	2.522810	0.44866	.	.	ENSG00000136152	ENST00000349995	T	0.46063	0.88	5.44	5.44	0.79542	.	0.200012	0.42548	D	0.000699	T	0.28366	0.0701	N	0.14661	0.345	0.39456	D	0.967485	B;P;B	0.38395	0.049;0.629;0.178	B;B;B	0.33254	0.016;0.16;0.058	T	0.13415	-1.0510	10	0.40728	T	0.16	-3.2869	18.6011	0.91248	0.0:1.0:0.0:0.0	.	78;78;78	Q96JB2;B4DH72;Q96JB2-2	COG3_HUMAN;.;.	L	78	ENSP00000258654:S78L	ENSP00000258654:S78L	S	+	2	0	COG3	44948395	1.000000	0.71417	0.014000	0.15608	0.492000	0.33523	5.557000	0.67313	2.702000	0.92279	0.655000	0.94253	TCA	.		0.403	COG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044777.2		
CCDC168	643677	broad.mit.edu;bcgsc.ca	37	13	103387768	103387768	+	Silent	SNP	G	G	A			TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr13:103387768G>A	ENST00000322527.2	-	1	1391	c.1392C>T	c.(1390-1392)aaC>aaT	p.N464N		NM_001146197.1	NP_001139669.1	Q8NDH2	CC168_HUMAN	coiled-coil domain containing 168	464																	TTCTTATCACGTTCTCCTGTC	0.398																																					p.N5093N		.											.	.	0			c.C15279T						.						183.0	148.0	159.0					13																	103387768		692	1591	2283	SO:0001819	synonymous_variant	643677	exon4			TATCACGTTCTCC		CCDS73596.1	13q33.1	2014-06-17	2011-08-09	2011-08-09	ENSG00000175820	ENSG00000175820			26851	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 40"""	C13orf40			Standard	NM_001146197		Approved	FLJ40176	uc001vpm.3	Q8NDH2	OTTHUMG00000187287	ENST00000322527.2:c.1392C>T	13.37:g.103387768G>A		Somatic	260	0		WXS	Illumina GAIIx	Phase_I	250	10	NM_001146197	0	0	0	0	0	Q8N800	Silent	SNP	ENST00000322527.2	37																																																																																				.		0.398	CCDC168-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001146197	
FBXO33	254170	hgsc.bcm.edu	37	14	39901157	39901157	+	Silent	SNP	C	C	A	rs61999077	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr14:39901157C>A	ENST00000298097.7	-	1	547	c.210G>T	c.(208-210)tcG>tcT	p.S70S	FBXO33_ENST00000554190.1_5'Flank	NM_203301.3	NP_976046.1	Q7Z6M2	FBX33_HUMAN	F-box protein 33	70	F-box. {ECO:0000255|PROSITE- ProRule:PRU00080}.				protein ubiquitination (GO:0016567)					endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(4)|urinary_tract(1)	9	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00121)|Epithelial(34;0.169)	GBM - Glioblastoma multiforme(112;0.0425)		CGCTGGGCAGCGACGCAGCGC	0.756													C|||	393	0.0784744	0.0166	0.0591	5008	,	,		7195	0.0714		0.0944	False		,,,				2504	0.1667				p.S70S		.											.	FBXO33-658	0			c.G210T						.	C		59,2571		1,57,1257	1.0	1.0	1.0		210	3.0	1.0	14	dbSNP_129	1	290,5020		2,286,2367	no	coding-synonymous	FBXO33	NM_203301.3		3,343,3624	AA,AC,CC		5.4614,2.2433,4.3955		70/556	39901157	349,7591	1315	2655	3970	SO:0001819	synonymous_variant	254170	exon1			GGGCAGCGACGCA	BI460761	CCDS9677.1	14q13.3	2004-08-24	2004-06-15		ENSG00000165355	ENSG00000165355		"""F-boxes /  ""other"""""	19833	protein-coding gene	gene with protein product		609103	"""F-box only protein 33"""				Standard	NM_203301		Approved	Fbx33	uc001wvk.3	Q7Z6M2	OTTHUMG00000140257	ENST00000298097.7:c.210G>T	14.37:g.39901157C>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_203301	0	0	0	1	1	Q6PIR2|Q86TR2|Q86YE0	Silent	SNP	ENST00000298097.7	37	CCDS9677.1																																																																																			C|0.935;A|0.065		0.756	FBXO33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276769.2		
DDHD1	80821	hgsc.bcm.edu	37	14	53619681	53619681	+	Missense_Mutation	SNP	C	C	T	rs61985140	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr14:53619681C>T	ENST00000323669.5	-	1	135	c.136G>A	c.(136-138)Ggc>Agc	p.G46S	DDHD1_ENST00000395606.1_Missense_Mutation_p.G46S|RP11-547D23.1_ENST00000554235.1_RNA|AL356020.1_ENST00000584587.1_RNA|DDHD1_ENST00000357758.3_Missense_Mutation_p.G46S	NM_001160148.1	NP_001153620.1	Q8NEL9	DDHD1_HUMAN	DDHD domain containing 1	46					cell death (GO:0008219)|lipid catabolic process (GO:0016042)	cytoplasm (GO:0005737)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(11)|ovary(3)|prostate(1)	25	Breast(41;0.037)					GGGTCCCCGCCGGGCAGGTGC	0.761													C|||	25	0.00499201	0.0015	0.0058	5008	,	,		9768	0.0		0.0149	False		,,,				2504	0.0041				p.G46S		.											.	DDHD1-92	0			c.G136A						.	C	SER/GLY,SER/GLY,SER/GLY	18,4236		0,18,2109	7.0	10.0	9.0		136,136,136	1.6	1.0	14	dbSNP_129	9	138,7980		1,136,3922	no	missense,missense,missense	DDHD1	NM_001160147.1,NM_001160148.1,NM_030637.2	56,56,56	1,154,6031	TT,TC,CC		1.6999,0.4231,1.2609	benign,benign,benign	46/880,46/901,46/873	53619681	156,12216	2127	4059	6186	SO:0001583	missense	80821	exon1			CCCCGCCGGGCAG	AB051492	CCDS9714.1, CCDS53895.1, CCDS53896.1	14q21	2012-11-23			ENSG00000100523	ENSG00000100523			19714	protein-coding gene	gene with protein product	"""phosphatidic acid-preferring phospholipase A1"""	614603	"""spastic paraplegia 28 (autosomal recessive)"""	SPG28		11214970, 20359546	Standard	NM_030637		Approved	KIAA1705, PA-PLA1	uc001xai.3	Q8NEL9	OTTHUMG00000140305	ENST00000323669.5:c.136G>A	14.37:g.53619681C>T	ENSP00000327104:p.Gly46Ser	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	23	22	NM_001160147	0	0	0	1	1	G5E9D1|Q8WVH3|Q96LL2|Q9C0F8	Missense_Mutation	SNP	ENST00000323669.5	37	CCDS53895.1	15	0.006868131868131868	1	0.0020325203252032522	1	0.0027624309392265192	2	0.0034965034965034965	11	0.014511873350923483	C	8.250	0.808901	0.16467	0.004231	0.016999	ENSG00000100523	ENST00000323669;ENST00000395606;ENST00000357758;ENST00000395610	.	.	.	3.55	1.64	0.23874	.	0.341002	0.26297	N	0.025187	T	0.18635	0.0447	L	0.40543	1.245	0.31479	N	0.667402	B;B;B	0.13145	0.007;0.004;0.003	B;B;B	0.06405	0.002;0.002;0.001	T	0.14559	-1.0468	9	0.33141	T	0.24	-0.5603	6.7849	0.23668	0.0:0.5559:0.3402:0.1039	rs61985140	46;46;46	G5E9D1;Q8NEL9;Q8NEL9-2	.;DDHD1_HUMAN;.	S	46	.	ENSP00000327104:G46S	G	-	1	0	DDHD1	52689431	0.000000	0.05858	0.969000	0.41365	0.297000	0.27493	0.385000	0.20685	0.176000	0.19873	-0.479000	0.04858	GGC	C|0.993;T|0.007		0.761	DDHD1-003	KNOWN	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276901.1		
IRF2BPL	64207	broad.mit.edu	37	14	77493762	77493767	+	In_Frame_Del	DEL	TGCTGC	TGCTGC	-	rs553703325|rs556445214|rs200317113	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr14:77493762_77493767delTGCTGC	ENST00000238647.3	-	1	1267_1272	c.369_374delGCAGCA	c.(367-375)cagcagcaa>caa	p.123_125QQQ>Q		NM_024496.3	NP_078772.1	Q9H1B7	I2BPL_HUMAN	interferon regulatory factor 2 binding protein-like	123	Poly-Gln.				development of secondary female sexual characteristics (GO:0046543)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	extracellular space (GO:0005615)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	11						GAgctgttgttgctgctgctgctgct	0.714														4658	0.930112	0.9297	0.9769	5008	,	,		7189	0.872		0.9712	False		,,,				2504	0.9151				p.123_125del		.											.	IRF2BPL-90	0			c.369_374del						.																																			SO:0001651	inframe_deletion	64207	exon1			TGTTGTTGCTGCT	AJ277365	CCDS9854.1	14q24.3	2011-02-23	2011-02-23	2011-02-23	ENSG00000119669	ENSG00000119669			14282	protein-coding gene	gene with protein product	"""enhanced at puberty 1"""	611720	"""chromosome 14 open reading frame 4"""	C14orf4		11095982, 17627301	Standard	NM_024496		Approved	EAP1, KIAA1865	uc001xsy.4	Q9H1B7		ENST00000238647.3:c.369_374delGCAGCA	14.37:g.77493768_77493773delTGCTGC	ENSP00000238647:p.Gln125_Gln126del	Somatic	10	0		WXS	Illumina GAIIx	Phase_I	28	9	NM_024496	0	0	0	0	0	Q8NDQ2|Q96JG2|Q9H3I7	In_Frame_Del	DEL	ENST00000238647.3	37	CCDS9854.1																																																																																			CTG|1.000;|0.000		0.714	IRF2BPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414298.1	NM_024496	
CKB	1152	hgsc.bcm.edu	37	14	103988180	103988180	+	Silent	SNP	G	G	T	rs1136165	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr14:103988180G>T	ENST00000348956.2	-	4	813	c.456C>A	c.(454-456)cgC>cgA	p.R152R		NM_001823.4	NP_001814.2	P12277	KCRB_HUMAN	creatine kinase, brain	152	Phosphagen kinase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00843}.				cellular chloride ion homeostasis (GO:0030644)|cellular nitrogen compound metabolic process (GO:0034641)|creatine metabolic process (GO:0006600)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|creatine kinase activity (GO:0004111)			lung(2)|prostate(1)	3		Melanoma(154;0.155)	Epithelial(46;0.14)		Creatine(DB00148)	TCTCGATGGCGCGGCGCTCCC	0.756													G|||	3294	0.657748	0.5416	0.7349	5008	,	,		7060	0.8264		0.6233	False		,,,				2504	0.6217				p.R152R	Esophageal Squamous(186;2492 2823 49929 50127)	.											.	CKB-115	0			c.C456A						.	G		1738,1164		574,590,287	3.0	4.0	3.0		456	-0.0	1.0	14	dbSNP_86	3	4002,2154		1387,1228,463	no	coding-synonymous	CKB	NM_001823.3		1961,1818,750	TT,TG,GG		34.9903,40.1103,36.6306		152/382	103988180	5740,3318	1451	3078	4529	SO:0001819	synonymous_variant	1152	exon4			GATGGCGCGGCGC		CCDS9981.1	14q32.32	2012-10-02			ENSG00000166165	ENSG00000166165	2.7.3.2		1991	protein-coding gene	gene with protein product		123280		CKBB			Standard	NM_001823		Approved		uc001ynf.2	P12277	OTTHUMG00000171786	ENST00000348956.2:c.456C>A	14.37:g.103988180G>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_001823	0	0	0	7	7	A8K236|B2R5R4|Q2LE07|Q6FG40|Q9UC66	Silent	SNP	ENST00000348956.2	37	CCDS9981.1	1462	0.6694139194139194	285	0.5792682926829268	250	0.6906077348066298	460	0.8041958041958042	467	0.6160949868073878	G	13.11	2.138272	0.37728	0.598897	0.650097	ENSG00000166165	ENST00000428256	.	.	.	4.64	-0.0349	0.13894	.	0.000000	0.85682	D	0.000000	T	0.00012	0.0000	.	.	.	0.09310	P	0.9999999999999624	.	.	.	.	.	.	T	0.17592	-1.0364	5	0.41790	T	0.15	-18.9304	4.9837	0.14180	0.3841:0.2745:0.3414:0.0	rs1136165;rs2227867;rs2765044;rs3179077;rs3199393;rs17366340;rs17423634;rs17849441;rs17850309;rs17850603;rs17851735;rs17851741;rs17857802	.	.	.	S	118	.	ENSP00000395515:R118S	R	-	1	0	CKB	103057933	0.001000	0.12720	0.999000	0.59377	0.996000	0.88848	-2.081000	0.01367	0.066000	0.16515	0.449000	0.29647	CGC	G|0.327;T|0.673		0.756	CKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415111.1		
NUTM1	256646	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	34648579	34648579	+	Silent	SNP	G	G	T			TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr15:34648579G>T	ENST00000333756.4	+	7	2441	c.2286G>T	c.(2284-2286)ctG>ctT	p.L762L	NUTM1_ENST00000438749.3_Silent_p.L780L|NUTM1_ENST00000537011.1_Silent_p.L790L	NM_175741.1	NP_786883	Q86Y26	NUTM1_HUMAN	NUT midline carcinoma, family member 1	762						cytoplasm (GO:0005737)|nucleus (GO:0005634)											GCCAGGGACTGGGCTCCAGGG	0.547																																					p.L762L		.											.	C15orf55-206	0			c.G2286T						.						69.0	69.0	69.0					15																	34648579		2201	4298	6499	SO:0001819	synonymous_variant	256646	exon7			GGGACTGGGCTCC	AF482429	CCDS32190.1, CCDS61584.1, CCDS61585.1	15q14	2014-01-28	2013-03-14	2013-03-14	ENSG00000184507	ENSG00000184507			29919	protein-coding gene	gene with protein product	"""nuclear protein in testis"""	608963	"""chromosome 15 open reading frame 55"""	C15orf55		12543779	Standard	NM_175741		Approved	NUT, DKFZp434O192, FAM22H	uc001zif.3	Q86Y26	OTTHUMG00000172348	ENST00000333756.4:c.2286G>T	15.37:g.34648579G>T		Somatic	104	0		WXS	Illumina GAIIx	Phase_I	151	65	NM_175741	0	0	0	0	0	B4DZ00|B7Z7Y4|E7EVE8|F5H4I6|Q86YS8|Q8N7F2|Q9NTB3	Silent	SNP	ENST00000333756.4	37	CCDS32190.1																																																																																			.		0.547	NUTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418026.1	NM_175741	
CASC5	57082	bcgsc.ca	37	15	40915045	40915045	+	Silent	SNP	T	T	G	rs8041534	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr15:40915045T>G	ENST00000346991.5	+	11	3051	c.2661T>G	c.(2659-2661)acT>acG	p.T887T	CASC5_ENST00000399668.2_Silent_p.T861T|CASC5_ENST00000527044.1_3'UTR			Q8NG31	CASC5_HUMAN	cancer susceptibility candidate 5	887	2 X 104 AA approximate repeats.				acrosome assembly (GO:0001675)|attachment of spindle microtubules to kinetochore (GO:0008608)|CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|nucleosome assembly (GO:0006334)|protein localization to kinetochore (GO:0034501)|spindle assembly checkpoint (GO:0071173)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				NS(1)|breast(7)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(13)|lung(16)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	57		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)		TTGATAAGACTATTGTATTTT	0.318													T|||	1759	0.351238	0.348	0.3285	5008	,	,		21082	0.254		0.3976	False		,,,				2504	0.4243				p.T887T		.											.	CASC5-660	0			c.T2661G						.	T	,	1342,2304		265,812,746	72.0	69.0	70.0		2583,2661	4.0	0.9	15	dbSNP_116	70	3293,4849		676,1941,1454	no	coding-synonymous,coding-synonymous	CASC5	NM_144508.3,NM_170589.3	,	941,2753,2200	GG,GT,TT		40.4446,36.8075,39.3196	,	861/2317,887/2343	40915045	4635,7153	1823	4071	5894	SO:0001819	synonymous_variant	57082	exon11			TAAGACTATTGTA	AF173994	CCDS42023.1, CCDS42024.1	15q14	2013-07-03			ENSG00000137812	ENSG00000137812		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	24054	protein-coding gene	gene with protein product	"""cancer/testis antigen 29"", ""kinetochore null 1 homolog (C. elegans)"", ""blinkin, bub-linking kinetochore protein"", ""protein phosphatase 1, regulatory subunit 55"""	609173				10980622, 10780384, 18045986	Standard	NM_170589		Approved	D40, AF15Q14, CT29, hKNL-1, KNL1, hSpc105, PPP1R55, Spc7	uc010bbt.1	Q8NG31	OTTHUMG00000166532	ENST00000346991.5:c.2661T>G	15.37:g.40915045T>G		Somatic	173	1		WXS	Illumina GAIIx	Phase_I	171	7	NM_170589	0	0	0	0	0	Q8NHE1|Q8WXA6|Q9HCK2|Q9NR92	Silent	SNP	ENST00000346991.5	37	CCDS42023.1																																																																																			T|0.633;G|0.367		0.318	CASC5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390224.2	NM_144508	
RAD51	5888	broad.mit.edu	37	15	41020953	41020953	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr15:41020953C>A	ENST00000267868.3	+	7	843	c.575C>A	c.(574-576)gCt>gAt	p.A192D	RAD51_ENST00000532743.1_Missense_Mutation_p.A193D|RAD51_ENST00000423169.2_Missense_Mutation_p.A192D|RAD51_ENST00000382643.3_Missense_Mutation_p.A193D|RAD51_ENST00000557850.1_Missense_Mutation_p.A95D	NM_002875.4	NP_002866.2	Q06609	RAD51_HUMAN	RAD51 recombinase	192	Interaction with PALB2.				ATP catabolic process (GO:0006200)|cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to ionizing radiation (GO:0071479)|DNA recombinase assembly (GO:0000730)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA unwinding involved in DNA replication (GO:0006268)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|meiotic nuclear division (GO:0007126)|mitotic recombination (GO:0006312)|positive regulation of DNA ligation (GO:0051106)|protein homooligomerization (GO:0051260)|reciprocal meiotic recombination (GO:0007131)|regulation of double-strand break repair via homologous recombination (GO:0010569)	condensed chromosome (GO:0000793)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|lateral element (GO:0000800)|mitochondrion (GO:0005739)|nuclear chromosome (GO:0000228)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|PML body (GO:0016605)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA polymerase binding (GO:0070182)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|single-stranded DNA binding (GO:0003697)|single-stranded DNA-dependent ATPase activity (GO:0043142)			breast(2)|endometrium(1)|kidney(3)|large_intestine(1)|lung(1)|ovary(1)	9		all_cancers(109;1.19e-18)|all_epithelial(112;2.33e-15)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;1.45e-05)|BRCA - Breast invasive adenocarcinoma(123;0.000421)|COAD - Colon adenocarcinoma(120;0.163)		GTAGCATATGCTCGAGCGTTC	0.453								Homologous recombination																													p.A193D		.											.	RAD51-563	0			c.C578A						.						270.0	246.0	254.0					15																	41020953		2203	4300	6503	SO:0001583	missense	5888	exon7			CATATGCTCGAGC	D13804	CCDS10062.1, CCDS53931.1, CCDS53932.1	15q15.1	2014-06-12	2013-07-02		ENSG00000051180	ENSG00000051180			9817	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 5"""	179617	"""RAD51 (S. cerevisiae) homolog (E coli RecA homolog)"", ""RAD51 homolog (RecA homolog, E. coli) (S. cerevisiae)"", ""RAD51 homolog (S. cerevisiae)"""	RAD51A, RECA		8358431, 8479919	Standard	NM_002875		Approved	HsRad51, HsT16930, BRCC5	uc010bbx.3	Q06609	OTTHUMG00000130067	ENST00000267868.3:c.575C>A	15.37:g.41020953C>A	ENSP00000267868:p.Ala192Asp	Somatic	50	0		WXS	Illumina GAIIx	Phase_I	88	5	NM_133487	0	0	3	3	0	B0FXP0|B2R8T6|Q6FHX9|Q6ZNA8|Q9BV60	Missense_Mutation	SNP	ENST00000267868.3	37	CCDS10062.1	.	.	.	.	.	.	.	.	.	.	C	34	5.411158	0.96072	.	.	ENSG00000051180	ENST00000423169;ENST00000382642;ENST00000267868;ENST00000532743;ENST00000382643	T;T;T;T	0.58358	0.34;0.34;0.34;0.34	5.41	5.41	0.78517	DNA recombination/repair protein RecA/RadB, ATP-binding domain (1);ATPase, AAA+ type, core (1);DNA recombination and repair protein Rad51, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.83321	0.5229	H	0.97491	4.015	0.80722	D	1	D;D;D	0.76494	0.999;0.996;0.999	D;D;D	0.85130	0.997;0.985;0.985	D	0.89389	0.3687	10	0.87932	D	0	-11.1888	19.163	0.93543	0.0:1.0:0.0:0.0	.	192;193;192	Q06609-3;Q6ZNA8;Q06609	.;.;RAD51_HUMAN	D	192;95;192;193;193	ENSP00000406602:A192D;ENSP00000267868:A192D;ENSP00000433924:A193D;ENSP00000372088:A193D	ENSP00000267868:A192D	A	+	2	0	RAD51	38808245	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	7.709000	0.84645	2.525000	0.85131	0.591000	0.81541	GCT	.		0.453	RAD51-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000252358.1	NM_002875, NM_133487	
LACTB	114294	hgsc.bcm.edu	37	15	63414083	63414083	+	Missense_Mutation	SNP	A	A	C	rs34317102	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr15:63414083A>C	ENST00000261893.4	+	1	85	c.13A>C	c.(13-15)Atg>Ctg	p.M5L	LACTB_ENST00000413507.2_Missense_Mutation_p.M5L	NM_032857.3	NP_116246.2	P83111	LACTB_HUMAN	lactamase, beta	5				M -> L (in Ref. 1 and 2). {ECO:0000305}.		cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	hydrolase activity (GO:0016787)			NS(1)|breast(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)|stomach(1)	12						GTACCGGCTCATGTCAGCAGT	0.751													C|||	3981	0.794928	0.6725	0.8256	5008	,	,		8367	0.997		0.7316	False		,,,				2504	0.7955				p.M5L	Melanoma(85;443 1381 6215 27308 35583)	.											.	LACTB-90	0			c.A13C						.	C	LEU/MET,LEU/MET	1936,668		733,470,99	4.0	4.0	4.0		13,13	3.1	1.0	15	dbSNP_126	4	4375,1183		1737,901,141	yes	missense,missense	LACTB	NM_032857.3,NM_171846.2	15,15	2470,1371,240	CC,CA,AA		21.2846,25.6528,22.6783	benign,benign	5/548,5/374	63414083	6311,1851	1302	2779	4081	SO:0001583	missense	114294	exon1			CGGCTCATGTCAG	AK027808	CCDS10182.1, CCDS45275.1	15q22.1	2012-11-14	2001-12-12	2001-12-14	ENSG00000103642	ENSG00000103642		"""Mitochondrial ribosomal proteins / large subunits"""	16468	protein-coding gene	gene with protein product		608440	"""mitochondrial ribosomal protein L56"""	MRPL56		11707067	Standard	NM_032857		Approved	FLJ14902	uc002alw.3	P83111	OTTHUMG00000132807	ENST00000261893.4:c.13A>C	15.37:g.63414083A>C	ENSP00000261893:p.Met5Leu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	11	11	NM_171846	0	0	0	1	1	P83096	Missense_Mutation	SNP	ENST00000261893.4	37	CCDS10182.1	1713	0.7843406593406593	304	0.6178861788617886	287	0.7928176795580111	568	0.993006993006993	554	0.7308707124010554	C	0.674	-0.800779	0.02841	0.743472	0.787154	ENSG00000103642	ENST00000261893;ENST00000413507	T	0.33216	1.42	3.1	3.1	0.35709	.	0.592824	0.14749	N	0.300689	T	0.00012	0.0000	N	0.02539	-0.55	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.37842	-0.9688	9	0.02654	T	1	0.0321	7.626	0.28212	0.2541:0.7459:0.0:0.0	rs34317102	5	P83111	LACTB_HUMAN	L	5	ENSP00000261893:M5L	ENSP00000261893:M5L	M	+	1	0	LACTB	61201136	0.994000	0.37717	0.956000	0.39512	0.117000	0.20001	0.346000	0.19997	0.640000	0.30582	-0.677000	0.03784	ATG	A|0.226;C|0.774		0.751	LACTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256224.1	NM_032857	
KBTBD13	390594	hgsc.bcm.edu	37	15	65369531	65369531	+	Silent	SNP	G	G	T	rs2946642	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr15:65369531G>T	ENST00000432196.2	+	1	378	c.378G>T	c.(376-378)gcG>gcT	p.A126A	RASL12_ENST00000434605.2_5'Flank	NM_001101362.2	NP_001094832.1	C9JR72	KBTBD_HUMAN	kelch repeat and BTB (POZ) domain containing 13	126					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				lung(1)|prostate(1)|skin(1)	3						ACAGTGCCGCGCTCTTCATCT	0.716													G|||	2512	0.501597	0.531	0.5403	5008	,	,		9855	0.7302		0.3877	False		,,,				2504	0.316				p.A126A		.											.	.	0			c.G378T						.	G		1399,1573		380,639,467	2.0	2.0	2.0		378	-0.2	1.0	15	dbSNP_101	2	2035,4139		455,1125,1507	no	coding-synonymous	KBTBD13	NM_001101362.2		835,1764,1974	TT,TG,GG		32.9608,47.0727,37.5465		126/459	65369531	3434,5712	1486	3087	4573	SO:0001819	synonymous_variant	390594	exon1			TGCCGCGCTCTTC		CCDS45281.1	15q22.31	2014-09-17			ENSG00000234438	ENSG00000234438		"""BTB/POZ domain containing"""	37227	protein-coding gene	gene with protein product	"""nemaline myopathy type 6"""	613727				21109227, 22542517	Standard	NM_001101362		Approved	hCG_1645727, NEM6	uc010uis.2	C9JR72		ENST00000432196.2:c.378G>T	15.37:g.65369531G>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	7	NM_001101362	0	0	0	0	0		Silent	SNP	ENST00000432196.2	37	CCDS45281.1																																																																																			G|0.479;T|0.521		0.716	KBTBD13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418468.2	NM_001101362	
CHRNA3	1136	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	78894294	78894294	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr15:78894294G>T	ENST00000326828.5	-	5	1074	c.690C>A	c.(688-690)gaC>gaA	p.D230E	CHRNA3_ENST00000348639.3_Missense_Mutation_p.D230E	NM_000743.4	NP_000734.2	P32297	ACHA3_HUMAN	cholinergic receptor, nicotinic, alpha 3 (neuronal)	230					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|behavioral response to nicotine (GO:0035095)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of dendrite morphogenesis (GO:0048814)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of membrane potential (GO:0042391)|regulation of smooth muscle contraction (GO:0006940)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission involved in micturition (GO:0060084)|synaptic transmission, cholinergic (GO:0007271)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)			central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18					Bupropion(DB01156)|Dextromethorphan(DB00514)|Galantamine(DB00674)|Levomethadyl Acetate(DB01227)|Nicotine(DB00184)|Pentolinium(DB01090)|Varenicline(DB01273)	AGTATGTGATGTCGGGGTAGA	0.547																																					p.D230E		.											.	CHRNA3-515	0			c.C690A						.						215.0	177.0	190.0					15																	78894294		2196	4293	6489	SO:0001583	missense	1136	exon5			TGTGATGTCGGGG		CCDS10305.1, CCDS53964.1	15q24	2012-02-11	2012-02-07		ENSG00000080644	ENSG00000080644		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1957	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 3 (neuronal)"""	118503	"""cholinergic receptor, nicotinic, alpha polypeptide 3"""			2004777	Standard	NM_000743		Approved		uc002bec.3	P32297	OTTHUMG00000143863	ENST00000326828.5:c.690C>A	15.37:g.78894294G>T	ENSP00000315602:p.Asp230Glu	Somatic	194	0		WXS	Illumina GAIIx	Phase_I	267	93	NM_000743	0	0	3	3	0	Q15823|Q4KMN8|Q86U77|Q96RH3|Q99553|Q9BQ93|Q9BRR4	Missense_Mutation	SNP	ENST00000326828.5	37	CCDS10305.1	.	.	.	.	.	.	.	.	.	.	G	19.91	3.914791	0.72983	.	.	ENSG00000080644	ENST00000348639;ENST00000326828;ENST00000326858	T;T	0.79247	-1.25;-1.25	5.91	4.03	0.46877	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	D	0.85754	0.5770	M	0.76002	2.32	0.51012	D	0.999904	D;D	0.71674	0.998;0.998	D;D	0.97110	1.0;0.999	D	0.86535	0.1824	10	0.87932	D	0	.	9.6474	0.39877	0.2086:0.0:0.7914:0.0	.	230;230	P32297;P32297-3	ACHA3_HUMAN;.	E	230;230;94	ENSP00000267951:D230E;ENSP00000315602:D230E	ENSP00000315602:D230E	D	-	3	2	CHRNA3	76681349	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.874000	0.39568	1.500000	0.48636	0.655000	0.94253	GAC	.		0.547	CHRNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000290111.3		
NARFL	64428	hgsc.bcm.edu	37	16	790926	790926	+	Silent	SNP	C	C	T	rs377081357		TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr16:790926C>T	ENST00000251588.2	-	1	76	c.60G>A	c.(58-60)ccG>ccA	p.P20P	NARFL_ENST00000301694.5_Silent_p.P20P|NARFL_ENST00000540986.1_5'UTR	NM_022493.1	NP_071938.1	Q9H6Q4	NARFL_HUMAN	nuclear prelamin A recognition factor-like	20					hematopoietic progenitor cell differentiation (GO:0002244)|iron-sulfur cluster assembly (GO:0016226)|oxygen homeostasis (GO:0032364)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|small molecule metabolic process (GO:0044281)	CIA complex (GO:0097361)	4 iron, 4 sulfur cluster binding (GO:0051539)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|large_intestine(1)|lung(7)	9		Hepatocellular(780;0.0218)				CCACCTGAGACGGCCCGATGA	0.716																																					p.P20P		.											.	NARFL-90	0			c.G60A						.	C		1,3583		0,1,1791	4.0	6.0	5.0		60	1.3	1.0	16		5	28,6848		0,28,3410	no	coding-synonymous	NARFL	NM_022493.1		0,29,5201	TT,TC,CC		0.4072,0.0279,0.2772		20/477	790926	29,10431	1792	3438	5230	SO:0001819	synonymous_variant	64428	exon1			CTGAGACGGCCCG	AY129231	CCDS10425.1	16p13.3	2009-12-17			ENSG00000103245	ENSG00000103245			14179	protein-coding gene	gene with protein product	"""iron-only hydrogenase-like protein 1"""	611118				16956324	Standard	NM_022493		Approved	FLJ21988, PRN, HPRN, IOP1	uc002cjr.3	Q9H6Q4	OTTHUMG00000122093	ENST00000251588.2:c.60G>A	16.37:g.790926C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	38	23	NM_022493	0	0	0	0	0	A1L385|B3KTJ3|Q53GC6|Q96S10|Q9H6J8	Silent	SNP	ENST00000251588.2	37	CCDS10425.1																																																																																			.		0.716	NARFL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242855.1	NM_022493	
C16orf89	146556	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	5115841	5115841	+	Silent	SNP	C	C	T			TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr16:5115841C>T	ENST00000315997.5	-	1	270	c.69G>A	c.(67-69)ctG>ctA	p.L23L	C16orf89_ENST00000472572.3_Silent_p.L23L|C16orf89_ENST00000474471.3_Silent_p.L23L|C16orf89_ENST00000350219.4_Silent_p.L61L|ALG1_ENST00000588623.1_Intron|C16orf89_ENST00000422873.1_Silent_p.L61L	NM_152459.4	NP_689672.4	Q6UX73	CP089_HUMAN	chromosome 16 open reading frame 89	23						cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	12						CCAGCCCAGGCAGTGAGGAGG	0.607																																					p.L23L		.											.	C16orf89-92	0			c.G69A						.						47.0	53.0	51.0					16																	5115841		2118	4248	6366	SO:0001819	synonymous_variant	146556	exon1			CCCAGGCAGTGAG		CCDS42116.1, CCDS45404.1, CCDS42116.2, CCDS45404.2	16p13.3	2011-12-12			ENSG00000153446	ENSG00000153446			28687	protein-coding gene	gene with protein product						12975309, 20578903	Standard	NM_001098514		Approved	MGC45438	uc010bud.3	Q6UX73	OTTHUMG00000159314	ENST00000315997.5:c.69G>A	16.37:g.5115841C>T		Somatic	135	0		WXS	Illumina GAIIx	Phase_I	250	100	NM_001098514	0	0	0	0	0	B4DUM5|Q8N2I3|Q8N4T1	Silent	SNP	ENST00000315997.5	37	CCDS42116.2																																																																																			.		0.607	C16orf89-001	KNOWN	upstream_ATG|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354524.1	NM_152459	
ABCC6	368	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	16256886	16256886	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr16:16256886C>A	ENST00000205557.7	-	24	3499	c.3470G>T	c.(3469-3471)aGc>aTc	p.S1157I		NM_001171.5	NP_001162	O95255	MRP6_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 6	1157	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(10)|lung(10)|ovary(1)|skin(6)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (3;0.123)	Cisplatin(DB00515)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Doxorubicin(DB00997)|Etoposide(DB00773)|Indomethacin(DB00328)|Probenecid(DB01032)|Sulfinpyrazone(DB01138)|Teniposide(DB00444)|Vinblastine(DB00570)	GATCCTCTGGCTTTCATCTAC	0.567																																					p.S1157I		.											.	ABCC6-93	0			c.G3470T						.						125.0	131.0	129.0					16																	16256886		2197	4300	6497	SO:0001583	missense	368	exon24			CTCTGGCTTTCAT	AF076622	CCDS10568.1, CCDS58430.1	16p13.11	2013-01-08			ENSG00000091262	ENSG00000091262		"""ATP binding cassette transporters / subfamily C"""	57	protein-coding gene	gene with protein product		603234	"""pseudoxanthoma elasticum"""	ARA, PXE		9721217, 11439001	Standard	NM_001079528		Approved	MRP6, EST349056, MLP1, URG7	uc002den.4	O95255	OTTHUMG00000129967	ENST00000205557.7:c.3470G>T	16.37:g.16256886C>A	ENSP00000205557:p.Ser1157Ile	Somatic	105	1		WXS	Illumina GAIIx	Phase_I	177	76	NM_001171	0	0	1	1	0	A2RRN8|A8KIG6|A8Y988|E7ESW8|P78420|Q8TCY8|Q9UMZ7	Missense_Mutation	SNP	ENST00000205557.7	37	CCDS10568.1	.	.	.	.	.	.	.	.	.	.	C	17.15	3.315928	0.60524	.	.	ENSG00000091262	ENST00000205557	D	0.94376	-3.41	5.42	-1.37	0.09056	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.679185	0.12916	U	0.428588	D	0.89598	0.6761	L	0.52011	1.625	0.80722	D	1	P	0.37594	0.601	B	0.40410	0.328	D	0.83760	0.0214	10	0.87932	D	0	.	6.4809	0.22063	0.0:0.1652:0.1568:0.678	.	1157	O95255	MRP6_HUMAN	I	1157	ENSP00000205557:S1157I	ENSP00000205557:S1157I	S	-	2	0	ABCC6	16164387	1.000000	0.71417	0.981000	0.43875	0.935000	0.57460	2.112000	0.41892	-0.077000	0.12752	-0.126000	0.14955	AGC	.		0.567	ABCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252232.2		
DNAH3	55567	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	21061229	21061229	+	Splice_Site	SNP	A	A	T			TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr16:21061229A>T	ENST00000261383.3	-	30	4347		c.e30+1		DNAH3_ENST00000415178.1_Splice_Site	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3						cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		GCATTTGCTTACCTGCTTAGC	0.532																																					.		.											.	DNAH3-167	0			c.4347+2T>A						.						237.0	203.0	214.0					16																	21061229		2201	4300	6501	SO:0001630	splice_region_variant	55567	exon31			TTGCTTACCTGCT	U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.4347+1T>A	16.37:g.21061229A>T		Somatic	36	0		WXS	Illumina GAIIx	Phase_I	95	39	NM_017539	0	0	0	0	0	O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Splice_Site	SNP	ENST00000261383.3	37	CCDS10594.1	.	.	.	.	.	.	.	.	.	.	A	19.45	3.830295	0.71258	.	.	ENSG00000158486	ENST00000261383;ENST00000415178	.	.	.	5.88	5.88	0.94601	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.2879	0.82732	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DNAH3	20968730	1.000000	0.71417	0.977000	0.42913	0.664000	0.39144	6.473000	0.73572	2.242000	0.73789	0.533000	0.62120	.	.		0.532	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	NM_017539	Intron
FBRS	64319	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	30677859	30677859	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr16:30677859G>C	ENST00000287468.5	+	6	503	c.240G>C	c.(238-240)ttG>ttC	p.L80F	FBRS_ENST00000568722.1_Intron|FBRS_ENST00000395073.2_5'UTR|FBRS_ENST00000356166.6_Missense_Mutation_p.L600F	NM_001105079.1	NP_001098549.1	Q9HAH7	FBRS_HUMAN	fibrosin	80										ovary(1)	1			Colorectal(24;0.103)			GGCCACCTTTGAGGGTGAGTT	0.587																																					p.L80F		.											.	FBRS-23	0			c.G240C						.						83.0	89.0	87.0					16																	30677859		2088	4222	6310	SO:0001583	missense	64319	exon6			ACCTTTGAGGGTG	AK021680		16p11.2	2008-02-05	2007-04-18	2007-04-18	ENSG00000156860	ENSG00000156860			20442	protein-coding gene	gene with protein product		608601	"""fibrosin 1"""	FBS1		7892239, 9809749	Standard	NM_001105079		Approved	FBS, FLJ11618	uc002dzd.4	Q9HAH7	OTTHUMG00000132390	ENST00000287468.5:c.240G>C	16.37:g.30677859G>C	ENSP00000287468:p.Leu80Phe	Somatic	89	0		WXS	Illumina GAIIx	Phase_I	173	57	NM_001105079	0	0	2	4	2	B4DP86|Q96CI9|Q9H9X4	Missense_Mutation	SNP	ENST00000287468.5	37		.	.	.	.	.	.	.	.	.	.	G	17.99	3.523725	0.64747	.	.	ENSG00000156860	ENST00000356166;ENST00000287468	T	0.36520	1.25	4.93	3.97	0.46021	.	0.000000	0.24940	U	0.034383	T	0.46889	0.1416	L	0.39245	1.2	0.80722	D	1	D	0.65815	0.995	D	0.66351	0.943	T	0.42849	-0.9427	10	0.66056	D	0.02	-1.467	10.6428	0.45602	0.0921:0.0:0.9079:0.0	.	80	Q9HAH7	FBRS_HUMAN	F	600;80	ENSP00000348489:L600F	ENSP00000287468:L80F	L	+	3	2	FBRS	30585360	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	5.129000	0.64739	1.085000	0.41206	0.491000	0.48974	TTG	.		0.587	FBRS-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_022452	
CCDC102A	92922	hgsc.bcm.edu	37	16	57562804	57562804	+	Missense_Mutation	SNP	G	G	A	rs12935069		TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr16:57562804G>A	ENST00000258214.2	-	2	532	c.286C>T	c.(286-288)Cgg>Tgg	p.R96W		NM_033212.3	NP_149989.2	Q96A19	C102A_HUMAN	coiled-coil domain containing 102A	96				R -> W (in Ref. 2; AAH08285/AAH09941). {ECO:0000305}.						endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)	8						TCCGACCACCGGCGCATGGTC	0.731													A|||	5008	1.0	1.0	1.0	5008	,	,		3757	1.0		1.0	False		,,,				2504	1.0				p.R96W		.											.	CCDC102A-91	0			c.C286T						.						8.0	10.0	9.0					16																	57562804		1834	3717	5551	SO:0001583	missense	92922	exon2			ACCACCGGCGCAT	BC008285	CCDS10784.1	16q13	2008-02-05			ENSG00000135736	ENSG00000135736			28097	protein-coding gene	gene with protein product						12477932	Standard	NM_033212		Approved	MGC10992	uc002elw.3	Q96A19	OTTHUMG00000133472	ENST00000258214.2:c.286C>T	16.37:g.57562804G>A	ENSP00000258214:p.Arg96Trp	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_033212	0	0	0	0	0	Q9BT74	Missense_Mutation	SNP	ENST00000258214.2	37	CCDS10784.1	2180	0.9981684981684982	492	1.0	360	0.994475138121547	570	0.9965034965034965	758	1.0	A	10.17	1.277909	0.23307	.	.	ENSG00000135736	ENST00000258214	T	0.37752	1.18	4.82	4.82	0.62117	.	0.000000	0.64402	N	0.000001	T	0.00012	0.0000	N	0.00049	-2.415	0.40217	P	0.022302999999999962	B	0.02656	0.0	B	0.01281	0.0	T	0.44787	-0.9305	9	0.33141	T	0.24	-23.2491	9.5348	0.39216	0.9152:0.0:0.0848:0.0	rs12935069;rs12935069	96	Q96A19	C102A_HUMAN	W	96	ENSP00000258214:R96W	ENSP00000258214:R96W	R	-	1	2	CCDC102A	56120305	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	6.801000	0.75170	0.698000	0.31739	-0.556000	0.04195	CGG	G|0.001;A|0.999		0.731	CCDC102A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257348.1	NM_033212	
SLC38A8	146167	bcgsc.ca	37	16	84070500	84070500	+	Silent	SNP	C	C	G	rs1317524	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr16:84070500C>G	ENST00000299709.3	-	2	194	c.195G>C	c.(193-195)tcG>tcC	p.S65S		NM_001080442.1	NP_001073911.1	A6NNN8	S38A8_HUMAN	solute carrier family 38, member 8	65					amino acid transport (GO:0006865)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	26						GGAAGACCAACGAGACCTGCG	0.657													G|||	2209	0.441094	0.5416	0.3646	5008	,	,		11922	0.5863		0.33	False		,,,				2504	0.3241				p.S65S		.											.	SLC38A8-68	0			c.G195C						.	G		2096,2304	585.5+/-386.3	484,1128,588	47.0	40.0	42.0		195	2.0	1.0	16	dbSNP_88	42	2718,5882	667.3+/-402.5	448,1822,2030	no	coding-synonymous	SLC38A8	NM_001080442.1		932,2950,2618	GG,GC,CC		31.6047,47.6364,37.0308		65/436	84070500	4814,8186	2200	4300	6500	SO:0001819	synonymous_variant	146167	exon2			GACCAACGAGACC		CCDS32495.1	16q23.3	2013-05-22				ENSG00000166558		"""Solute carriers"""	32434	protein-coding gene	gene with protein product		615585					Standard	XM_006721135		Approved		uc002fhg.1	A6NNN8		ENST00000299709.3:c.195G>C	16.37:g.84070500C>G		Somatic	68	0		WXS	Illumina GAIIx	Phase_I	165	7	NM_001080442	0	0	0	0	0		Silent	SNP	ENST00000299709.3	37	CCDS32495.1																																																																																			C|0.617;G|0.383		0.657	SLC38A8-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432623.1	NM_001080442	
SGSM2	9905	bcgsc.ca	37	17	2275734	2275734	+	Silent	SNP	C	C	G	rs3213712	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr17:2275734C>G	ENST00000426855.2	+	14	1780	c.1605C>G	c.(1603-1605)tcC>tcG	p.S535S	SGSM2_ENST00000268989.3_Silent_p.S580S|SGSM2_ENST00000574563.1_Silent_p.S535S|RP1-59D14.5_ENST00000574290.1_RNA	NM_001098509.1	NP_001091979.1	O43147	SGSM2_HUMAN	small G protein signaling modulator 2	535					late endosome to Golgi transport (GO:0034499)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)		Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	20				Colorectal(2;5.15e-05)|READ - Rectum adenocarcinoma(2;0.000115)		CGGGGGCCTCCGCGGGCCTCA	0.687													C|||	1288	0.257188	0.5507	0.1124	5008	,	,		12916	0.1478		0.0954	False		,,,				2504	0.2423				p.S580S		.											.	SGSM2-68	0			c.C1740G						.	C	,	1915,2437		438,1039,699	9.0	13.0	12.0		1605,1740	-11.4	0.0	17	dbSNP_106	12	721,7807		34,653,3577	no	coding-synonymous,coding-synonymous	SGSM2	NM_001098509.1,NM_014853.2	,	472,1692,4276	GG,GC,CC		8.4545,44.0028,20.4658	,	535/1007,580/1052	2275734	2636,10244	2176	4264	6440	SO:0001819	synonymous_variant	9905	exon15			GGCCTCCGCGGGC	BC039204	CCDS32526.1, CCDS45570.1	17p13.3	2013-07-10	2007-08-14	2007-08-14		ENSG00000141258		"""Small G protein signaling modulators"""	29026	protein-coding gene	gene with protein product		611418	"""RUN and TBC1 domain containing 1"""	RUTBC1		9455477, 17509819, 21808068	Standard	NM_014853		Approved	KIAA0397	uc002fum.4	O43147		ENST00000426855.2:c.1605C>G	17.37:g.2275734C>G		Somatic	144	0		WXS	Illumina GAIIx	Phase_I	139	8	NM_014853	0	0	3	3	0	A5LGW2|B4DH69|Q49AC2|Q6ZUY2|Q8IXU4	Silent	SNP	ENST00000426855.2	37	CCDS45570.1																																																																																			C|0.810;G|0.190		0.687	SGSM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438186.1	NM_014853	
TVP23C	201158	ucsc.edu	37	17	15457087	15457087	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr17:15457087C>T	ENST00000225576.3	-	3	247	c.152G>A	c.(151-153)tGt>tAt	p.C51Y	TVP23C_ENST00000584811.1_5'UTR|TVP23C_ENST00000428082.2_Missense_Mutation_p.C51Y|TVP23C_ENST00000438826.3_Missense_Mutation_p.C51Y|TVP23C_ENST00000519970.1_Intron|TVP23C-CDRT4_ENST00000522212.2_Missense_Mutation_p.C51Y|TVP23C_ENST00000518321.1_Missense_Mutation_p.C51Y	NM_145301.2	NP_660344.2	Q96ET8	TV23C_HUMAN	trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)	51						integral component of membrane (GO:0016021)											ACAGAGAAGACAGACGATGAT	0.373																																					p.C51Y		.											.	.	0			c.G152A						.						274.0	265.0	268.0					17																	15457087		2203	4300	6503	SO:0001583	missense	201158	exon3			AGAAGACAGACGA	BC011952	CCDS11170.1, CCDS45617.1	17p12	2012-11-29	2012-11-29	2012-11-29	ENSG00000175106	ENSG00000175106			30453	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B2"""	FAM18B2			Standard	NM_001135036		Approved	MGC8763	uc002goq.2	Q96ET8	OTTHUMG00000171461	ENST00000225576.3:c.152G>A	17.37:g.15457087C>T	ENSP00000225576:p.Cys51Tyr	Somatic	347	32		WXS	Illumina GAIIx	Phase_I	257	22	NM_145301	0	0	3	25	22	Q3LIC7	Missense_Mutation	SNP	ENST00000225576.3	37	CCDS11170.1	.	.	.	.	.	.	.	.	.	.	.	2.368	-0.344949	0.05208	.	.	ENSG00000259024;ENSG00000175106;ENSG00000175106;ENSG00000175106	ENST00000522212;ENST00000225576;ENST00000428082;ENST00000438826	T;T;T;T	0.25749	1.78;1.78;1.78;1.78	4.47	4.47	0.54385	.	0.000000	0.85682	N	0.000000	T	0.02571	0.0078	N	0.00004	-3.335	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.0;0.0;0.002	T	0.38457	-0.9660	10	0.02654	T	1	-3.8701	9.492	0.38965	0.0:0.0877:0.0:0.9123	.	51;51;51	Q96ET8-2;Q96ET8-3;Q96ET8	.;.;F18B2_HUMAN	Y	51	ENSP00000429865:C51Y;ENSP00000225576:C51Y;ENSP00000406387:C51Y;ENSP00000413355:C51Y	ENSP00000225576:C51Y	C	-	2	0	RP11-726O12.1;FAM18B2	15397812	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	6.178000	0.71968	0.670000	0.31165	-0.442000	0.05670	TGT	.		0.373	TVP23C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000130705.2	NM_145301	
VTN	7448	hgsc.bcm.edu	37	17	26699121	26699121	+	5'Flank	SNP	G	G	C	rs7212814		TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr17:26699121G>C	ENST00000226218.4	-	0	0				SARM1_ENST00000379061.4_Intron|VTN_ENST00000536498.1_5'Flank|CTB-96E2.3_ENST00000591482.1_RNA|SARM1_ENST00000457710.3_5'UTR|TMEM199_ENST00000509083.1_Intron	NM_000638.3	NP_000629.3	P04004	VTNC_HUMAN	vitronectin						cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|immune response (GO:0006955)|innate immune response (GO:0045087)|negative regulation of blood coagulation (GO:0030195)|negative regulation of endopeptidase activity (GO:0010951)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein binding (GO:0032092)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation of wound healing (GO:0090303)|regulation of complement activation (GO:0030449)|smooth muscle cell-matrix adhesion (GO:0061302)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|blood microparticle (GO:0072562)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			kidney(2)|large_intestine(7)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	13	all_lung(13;0.000533)|Lung NSC(42;0.00171)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)	Abciximab(DB00054)	GGCCCACGGCGGGGCGCCGAG	0.761													C|||	5008	1.0	1.0	1.0	5008	,	,		9002	1.0		1.0	False		,,,				2504	1.0				p.R23P		.											.	.	0			c.G68C						.						2.0	2.0	2.0					17																	26699121		1378	3066	4444	SO:0001631	upstream_gene_variant	23098	exon1			CACGGCGGGGCGC	BC005046	CCDS11229.1	17q11.2	2014-08-08	2006-02-10		ENSG00000109072	ENSG00000109072		"""Endogenous ligands"""	12724	protein-coding gene	gene with protein product	"""serum spreading factor"", ""somatomedin B"", ""complement S-protein"""	193190	"""vitronectin (serum spreading factor, somatomedin B, complement S-protein)"""			2447940	Standard	NM_000638		Approved	VN	uc002hbc.3	P04004	OTTHUMG00000132500		17.37:g.26699121G>C	Exception_encountered	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_015077	0	0	0	2	2	B2R7G0|P01141|Q9BSH7	Missense_Mutation	SNP	ENST00000226218.4	37	CCDS11229.1	2181	0.9986263736263736	490	0.9959349593495935	362	1.0	571	0.9982517482517482	758	1.0	C	4.627	0.116613	0.08881	.	.	ENSG00000004139	ENST00000457710	.	.	.	4.93	3.94	0.45596	.	1.216040	0.06217	N	0.686070	T	0.00012	0.0000	.	.	.	0.45837	P	0.0012929999999999886	.	.	.	.	.	.	T	0.38757	-0.9646	5	0.02654	T	1	0.2642	5.2918	0.15731	0.1514:0.6261:0.1455:0.077	rs7212814	.	.	.	P	23	.	ENSP00000406738:R23P	R	+	2	0	SARM1	23723248	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	1.263000	0.33004	0.497000	0.27926	-1.514000	0.00941	CGG	G|0.001;C|0.999		0.761	VTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255680.2	NM_000638	
PCGF2	7703	broad.mit.edu	37	17	36891628	36891628	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr17:36891628T>G	ENST00000580830.1	-	12	1584	c.883A>C	c.(883-885)Acc>Ccc	p.T295P	PCGF2_ENST00000360797.2_Missense_Mutation_p.T295P|PCGF2_ENST00000579882.1_3'UTR|PCGF2_ENST00000585100.1_3'UTR|PCGF2_ENST00000578109.1_3'UTR|PCGF2_ENST00000581345.1_Missense_Mutation_p.T295P			P35227	PCGF2_HUMAN	polycomb group ring finger 2	295	Pro/Ser-rich.				anterior/posterior pattern specification (GO:0009952)|cellular response to hydrogen peroxide (GO:0070301)|embryonic skeletal system morphogenesis (GO:0048704)|histone acetylation (GO:0016573)|in utero embryonic development (GO:0001701)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|skin(1)	10	Breast(7;9.07e-22)					GTAGGGTGGGTGGCTGGAGGC	0.682											OREG0024367	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T295P		.											.	PCGF2-658	0			c.A883C						.						16.0	12.0	13.0					17																	36891628		2187	4280	6467	SO:0001583	missense	7703	exon11			GGTGGGTGGCTGG	D13969	CCDS32638.1	17q12	2013-01-09	2005-01-17	2005-01-19		ENSG00000277258		"""RING-type (C3HC4) zinc fingers"", ""Polycomb group ring fingers"""	12929	protein-coding gene	gene with protein product		600346	"""ring finger protein 110"""	ZNF144, RNF110		8325509	Standard	NM_007144		Approved	MEL-18	uc002hqp.1	P35227		ENST00000580830.1:c.883A>C	17.37:g.36891628T>G	ENSP00000461961:p.Thr295Pro	Somatic	86	9	866	WXS	Illumina GAIIx	Phase_I	82	10	NM_007144	0	0	39	40	1	A6NGD8	Missense_Mutation	SNP	ENST00000580830.1	37	CCDS32638.1	.	.	.	.	.	.	.	.	.	.	T	10.42	1.344960	0.24426	.	.	ENSG00000056661	ENST00000360797	T	0.31247	1.5	4.92	-0.193	0.13244	.	0.651897	0.15163	N	0.277024	T	0.13628	0.0330	N	0.04508	-0.205	0.26765	N	0.969921	B	0.02656	0.0	B	0.01281	0.0	T	0.23583	-1.0184	10	0.23891	T	0.37	-6.6811	12.5227	0.56069	0.0:0.0:0.6437:0.3563	.	295	P35227	PCGF2_HUMAN	P	295	ENSP00000354033:T295P	ENSP00000354033:T295P	T	-	1	0	PCGF2	34145154	0.004000	0.15560	0.536000	0.28039	0.978000	0.69477	-0.673000	0.05239	-0.232000	0.09811	0.459000	0.35465	ACC	.		0.682	PCGF2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442246.2	NM_007144	
KRTAP4-11	653240	bcgsc.ca	37	17	39274319	39274319	+	Missense_Mutation	SNP	G	G	C	rs199712484		TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr17:39274319G>C	ENST00000391413.2	-	1	287	c.249C>G	c.(247-249)agC>agG	p.S83R		NM_033059.3	NP_149048.2	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	83	27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].					keratin filament (GO:0045095)		p.S83R(1)		endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(8)|prostate(5)|skin(1)	33		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			GCTTGCAGCAGCTGGACACAC	0.662																																					p.S83R		.											.	.	1	Substitution - Missense(1)	endometrium(1)	c.C249G						.																																			SO:0001583	missense	653240	exon1			GCAGCAGCTGGAC	AC025904	CCDS45675.1	17q21.2	2013-06-25			ENSG00000212721	ENSG00000212721		"""Keratin associated proteins"""	18911	protein-coding gene	gene with protein product			"""keratin associated protein 4-14"""	KRTAP4-14			Standard	NM_033059		Approved	KAP4.11, KAP4.14	uc002hvz.3	Q9BYQ6	OTTHUMG00000133586	ENST00000391413.2:c.249C>G	17.37:g.39274319G>C	ENSP00000375232:p.Ser83Arg	Somatic	44	2		WXS	Illumina GAIIx	Phase_I	132	32	NM_033059	0	0	0	0	0	A0AUY2	Missense_Mutation	SNP	ENST00000391413.2	37	CCDS45675.1	.	.	.	.	.	.	.	.	.	.	.	11.88	1.769671	0.31320	.	.	ENSG00000212721	ENST00000391413	T	0.00686	5.85	4.12	0.987	0.19790	.	8.728350	0.01373	U	0.012645	T	0.01835	0.0058	M	0.85710	2.77	0.20489	N	0.999895	B	0.21381	0.055	B	0.12156	0.007	T	0.50676	-0.8800	10	0.66056	D	0.02	.	3.7776	0.08667	0.3083:0.1839:0.5078:0.0	.	83	Q9BYQ6	KR411_HUMAN	R	83	ENSP00000375232:S83R	ENSP00000375232:S83R	S	-	3	2	KRTAP4-11	36527845	0.052000	0.20516	0.390000	0.26220	0.120000	0.20174	0.102000	0.15272	0.075000	0.16796	0.511000	0.50034	AGC	.		0.662	KRTAP4-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257690.1		
KRTAP4-11	653240	broad.mit.edu	37	17	39274416	39274416	+	Missense_Mutation	SNP	C	C	T	rs408579	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr17:39274416C>T	ENST00000391413.2	-	1	190	c.152G>A	c.(151-153)aGg>aAg	p.R51K		NM_033059.3	NP_149048.2	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	51	27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].		Missing (in allele KAP4.14). {ECO:0000269|PubMed:15955084}.			keratin filament (GO:0045095)		p.R51K(1)		endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(8)|prostate(5)|skin(1)	33		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			GCACTGGGGCCTGCAGCAGCT	0.672													t|||	242	0.0483227	0.1248	0.0202	5008	,	,		19066	0.005		0.0219	False		,,,				2504	0.0368				p.R51K		.											.	.	1	Substitution - Missense(1)	endometrium(1)	c.G152A						.						9.0	15.0	13.0					17																	39274416		682	1579	2261	SO:0001583	missense	653240	exon1			TGGGGCCTGCAGC	AC025904	CCDS45675.1	17q21.2	2013-06-25			ENSG00000212721	ENSG00000212721		"""Keratin associated proteins"""	18911	protein-coding gene	gene with protein product			"""keratin associated protein 4-14"""	KRTAP4-14			Standard	NM_033059		Approved	KAP4.11, KAP4.14	uc002hvz.3	Q9BYQ6	OTTHUMG00000133586	ENST00000391413.2:c.152G>A	17.37:g.39274416C>T	ENSP00000375232:p.Arg51Lys	Somatic	65	3		WXS	Illumina GAIIx	Phase_I	144	32	NM_033059	0	0	0	0	0	A0AUY2	Missense_Mutation	SNP	ENST00000391413.2	37	CCDS45675.1	.	.	.	.	.	.	.	.	.	.	.	4.205	0.036712	0.08148	.	.	ENSG00000212721	ENST00000391413	T	0.01455	4.87	3.47	-1.13	0.09775	.	2.855670	0.02563	U	0.096976	T	0.02610	0.0079	M	0.72118	2.19	0.09310	N	1	B	0.25441	0.126	B	0.28916	0.096	T	0.52283	-0.8596	10	0.05959	T	0.93	.	3.7627	0.08610	0.1684:0.4051:0.0:0.4265	rs408579	51	Q9BYQ6	KR411_HUMAN	K	51	ENSP00000375232:R51K	ENSP00000375232:R51K	R	-	2	0	KRTAP4-11	36527942	0.000000	0.05858	0.002000	0.10522	0.072000	0.16883	-0.738000	0.04871	-0.091000	0.12440	-0.208000	0.12717	AGG	.		0.672	KRTAP4-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257690.1		
RNF157	114804	hgsc.bcm.edu	37	17	74154491	74154491	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr17:74154491C>T	ENST00000269391.6	-	13	1528	c.1396G>A	c.(1396-1398)Gtt>Att	p.V466I	RNF157_ENST00000319945.6_Missense_Mutation_p.V466I	NM_052916.2	NP_443148.1	Q96PX1	RN157_HUMAN	ring finger protein 157	466	Ser-rich.						zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(3)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(2)|urinary_tract(1)	25			LUSC - Lung squamous cell carcinoma(166;0.187)			AGATGCTGAACCGACGGTCTC	0.537																																					p.V466I	GBM(186;507 2120 27388 27773 52994)	.											.	RNF157-228	0			c.G1396A						.						144.0	126.0	132.0					17																	74154491		2203	4300	6503	SO:0001583	missense	114804	exon13			GCTGAACCGACGG	AK091467	CCDS32740.1	17q25.3	2004-02-27			ENSG00000141576	ENSG00000141576		"""RING-type (C3HC4) zinc fingers"""	29402	protein-coding gene	gene with protein product						11572484	Standard	NM_052916		Approved	KIAA1917	uc002jqz.3	Q96PX1	OTTHUMG00000132627	ENST00000269391.6:c.1396G>A	17.37:g.74154491C>T	ENSP00000269391:p.Val466Ile	Somatic	65	0		WXS	Illumina GAIIx	Phase_I	62	5	NM_052916	0	0	11	11	0	Q8NB72|Q96N56	Missense_Mutation	SNP	ENST00000269391.6	37	CCDS32740.1	.	.	.	.	.	.	.	.	.	.	C	12.34	1.908055	0.33721	.	.	ENSG00000141576	ENST00000269391;ENST00000319945	T;T	0.22945	1.93;1.94	5.7	4.71	0.59529	.	0.540943	0.22112	N	0.064476	T	0.13372	0.0324	N	0.14661	0.345	0.22693	N	0.998846	B;B	0.14805	0.011;0.004	B;B	0.15870	0.014;0.009	T	0.15492	-1.0435	10	0.21014	T	0.42	-3.9802	8.2626	0.31795	0.1371:0.6151:0.2478:0.0	.	466;466	Q96PX1-2;Q96PX1	.;RN157_HUMAN	I	466	ENSP00000269391:V466I;ENSP00000321837:V466I	ENSP00000269391:V466I	V	-	1	0	RNF157	71666086	0.003000	0.15002	0.006000	0.13384	0.099000	0.18886	1.528000	0.35985	2.670000	0.90874	0.655000	0.94253	GTT	.		0.537	RNF157-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255874.2	XM_290732	
ANKRD20A5P	440482	ucsc.edu	37	18	14183747	14183747	+	RNA	SNP	T	T	C	rs62085006		TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr18:14183747T>C	ENST00000581935.1	+	0	598							A0PJZ0	A20A5_HUMAN	ankyrin repeat domain 20 family, member A5, pseudogene											lung(3)	3						ACAAAGAAAATAGAACGCCTT	0.353																																					.		.											.	ANKRD20A5P-90	0			.						.						91.0	89.0	90.0					18																	14183747		2203	4300	6503			440482	.			AGAAAATAGAACG	BC022023		18p11.21	2011-06-01	2011-06-01	2011-06-01	ENSG00000186481	ENSG00000186481			33833	pseudogene	pseudogene			"""ankyrin repeat domain 20 family, member A5"""	ANKRD20A5			Standard	NR_040113		Approved	MGC26718	uc010xag.2	A0PJZ0	OTTHUMG00000157172		18.37:g.14183747T>C		Somatic	50	4		WXS	Illumina GAIIx	Phase_I	44	7	.	0	0	0	0	0	Q4G1B6	RNA	SNP	ENST00000581935.1	37																																																																																				.		0.353	ANKRD20A5P-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000442833.1		
LOXHD1	125336	broad.mit.edu;bcgsc.ca	37	18	44057816	44057816	+	Silent	SNP	C	C	T			TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr18:44057816C>T	ENST00000398722.4	-	34	5606	c.5607G>A	c.(5605-5607)aaG>aaA	p.K1869K	LOXHD1_ENST00000398686.4_Silent_p.K386K|LOXHD1_ENST00000441551.2_Silent_p.K1941K|LOXHD1_ENST00000300591.6_Silent_p.K1036K|LOXHD1_ENST00000441893.2_Silent_p.K1018K|LOXHD1_ENST00000579038.1_Silent_p.K940K|LOXHD1_ENST00000398705.2_Silent_p.K386K|LOXHD1_ENST00000582408.1_Silent_p.K974K|LOXHD1_ENST00000536736.1_Silent_p.K2085K			Q8IVV2	LOXH1_HUMAN	lipoxygenase homology domains 1	1869					calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|sensory perception of sound (GO:0007605)	membrane (GO:0016020)|stereocilium (GO:0032420)	calcium channel activity (GO:0005262)			NS(3)|autonomic_ganglia(1)|breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|pancreas(1)|prostate(4)|skin(4)|stomach(1)	36						GGCTCTGGACCTTGCTGGCAA	0.532																																					p.K2085K		.											.	.	0			c.G6255A						.						109.0	102.0	104.0					18																	44057816		692	1591	2283	SO:0001819	synonymous_variant	125336	exon40			CTGGACCTTGCTG	AK057232	CCDS45861.1, CCDS45862.1, CCDS54184.1	18q21.1	2009-09-11			ENSG00000167210	ENSG00000167210			26521	protein-coding gene	gene with protein product		613072	"""deafness, autosomal recessive 77"""	DFNB77		19732867	Standard	NM_144612		Approved	FLJ32670, LH2D1	uc010xcw.1	Q8IVV2	OTTHUMG00000132644	ENST00000398722.4:c.5607G>A	18.37:g.44057816C>T		Somatic	161	0		WXS	Illumina GAIIx	Phase_I	180	7	NM_144612	0	0	0	0	0	B7WNN3|B7WNT1|B7WPI9|Q6ZRY7|Q86WW9|Q96DL7	Silent	SNP	ENST00000398722.4	37																																																																																				.		0.532	LOXHD1-201	KNOWN	basic	protein_coding	protein_coding		NM_144612	
SALL3	27164	hgsc.bcm.edu	37	18	76753768	76753768	+	Missense_Mutation	SNP	C	C	G	rs2447437	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr18:76753768C>G	ENST00000537592.2	+	2	1777	c.1777C>G	c.(1777-1779)Ctc>Gtc	p.L593V	SALL3_ENST00000575389.2_Missense_Mutation_p.L593V|SALL3_ENST00000536229.3_Missense_Mutation_p.L460V	NM_171999.3	NP_741996.2	Q9BXA9	SALL3_HUMAN	spalt-like transcription factor 3	593			L -> V (in dbSNP:rs2447437). {ECO:0000269|Ref.1}.		forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|negative regulation of smoothened signaling pathway (GO:0045879)|olfactory bulb interneuron development (GO:0021891)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L593V(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(40)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		CGGGCCGCCCCTCACTAAAGC	0.731													C|||	3973	0.793331	0.5825	0.8444	5008	,	,		9900	0.9226		0.8648	False		,,,				2504	0.8354				p.L593V		.											.	SALL3-155	1	Substitution - Missense(1)	prostate(1)	c.C1777G						.	C	VAL/LEU	2422,1000		875,672,164	3.0	4.0	4.0		1777	5.2	0.2	18	dbSNP_100	4	6372,926		2808,756,85	yes	missense	SALL3	NM_171999.2	32	3683,1428,249	GG,GC,CC		12.6884,29.2227,17.9664	benign	593/1301	76753768	8794,1926	1711	3649	5360	SO:0001583	missense	27164	exon2			CCGCCCCTCACTA	AJ007421	CCDS12013.1	18q23	2013-10-17	2013-10-17		ENSG00000256463	ENSG00000256463		"""Zinc fingers, C2H2-type"""	10527	protein-coding gene	gene with protein product		605079	"""sal (Drosophila)-like 3"", ""sal-like 3 (Drosophila)"""			10610715	Standard	NM_171999		Approved	ZNF796	uc002lmt.3	Q9BXA9	OTTHUMG00000132896	ENST00000537592.2:c.1777C>G	18.37:g.76753768C>G	ENSP00000441823:p.Leu593Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_171999	0	0	0	0	0	Q9UGH1	Missense_Mutation	SNP	ENST00000537592.2	37	CCDS12013.1	1724	0.7893772893772893	287	0.5833333333333334	299	0.8259668508287292	511	0.8933566433566433	627	0.8271767810026385	C	0.073	-1.197989	0.01594	0.707773	0.873116	ENSG00000256463	ENST00000537592;ENST00000536229;ENST00000543056	T	0.08984	3.03	5.2	5.2	0.72013	.	0.464067	0.17974	N	0.155779	T	0.00012	0.0000	L	0.35288	1.05	0.80722	P	0.0	B;B	0.15473	0.013;0.006	B;B	0.18561	0.022;0.002	T	0.36237	-0.9756	9	0.14656	T	0.56	-21.7235	10.231	0.43256	0.2471:0.6277:0.1252:0.0	rs2447437	325;593	F5GXY4;Q9BXA9	.;SALL3_HUMAN	V	593;593;325	ENSP00000441823:L593V	ENSP00000299466:L593V	L	+	1	0	SALL3	74854756	0.002000	0.14202	0.157000	0.22605	0.006000	0.05464	0.292000	0.19011	2.584000	0.87258	0.563000	0.77884	CTC	C|0.780;G|0.220		0.731	SALL3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256397.1	NM_171999	
LPPR3	79948	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	814975	814975	+	Silent	SNP	G	G	A			TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr19:814975G>A	ENST00000520876.3	-	5	588	c.510C>T	c.(508-510)taC>taT	p.Y170Y	LPPR3_ENST00000359894.2_Silent_p.Y170Y|MIR3187_ENST00000583431.1_RNA	NM_001270366.1	NP_001257295.1	Q6T4P5	LPPR3_HUMAN		170						integral component of membrane (GO:0016021)	phosphatidate phosphatase activity (GO:0008195)										CCAGGAGAGTGTAGTTGGGCT	0.627																																					p.Y170Y		.											.	.	0			c.C510T						.						162.0	144.0	150.0					19																	814975		2203	4300	6503	SO:0001819	synonymous_variant	0	exon5			GAGAGTGTAGTTG																												ENST00000520876.3:c.510C>T	19.37:g.814975G>A		Somatic	123	1		WXS	Illumina GAIIx	Phase_I	248	100	NM_001270366	0	0	0	0	0	Q86XQ4|Q96EH1|Q9BQF9|Q9HAJ4	Silent	SNP	ENST00000520876.3	37	CCDS58636.1																																																																																			.		0.627	LPPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379096.3		
PLIN5	440503	hgsc.bcm.edu	37	19	4524016	4524016	+	Missense_Mutation	SNP	G	G	A	rs1062223	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr19:4524016G>A	ENST00000381848.3	-	8	996	c.916C>T	c.(916-918)Cgg>Tgg	p.R306W		NM_001013706.2	NP_001013728.2	Q00G26	PLIN5_HUMAN	perilipin 5	306	Interaction with PNPLA2 and ABHD5. {ECO:0000250}.		R -> W (in dbSNP:rs1062223). {ECO:0000269|PubMed:17234449}.		lipid particle organization (GO:0034389)|lipid storage (GO:0019915)|mitochondrion localization (GO:0051646)|negative regulation of fatty acid beta-oxidation (GO:0031999)|negative regulation of lipase activity (GO:0060192)|negative regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035359)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of triglyceride catabolic process (GO:0010897)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of lipase activity (GO:0060193)|positive regulation of lipid storage (GO:0010884)|positive regulation of sequestering of triglyceride (GO:0010890)|positive regulation of triglyceride biosynthetic process (GO:0010867)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|lipid particle (GO:0005811)|mitochondrion (GO:0005739)				endometrium(4)|lung(3)|skin(2)|upper_aerodigestive_tract(1)	10						GGCAGGCCCCGCACGCTGGAC	0.711													G|||	464	0.0926518	0.0091	0.2104	5008	,	,		13130	0.0288		0.1958	False		,,,				2504	0.0818				p.R306W		.											.	PLIN5-22	0			c.C916T						.	G	TRP/ARG	154,3340		10,134,1603	3.0	4.0	4.0		916	4.6	1.0	19	dbSNP_86	4	1294,5560		114,1066,2247	yes	missense	PLIN5	NM_001013706.2	101	124,1200,3850	AA,AG,GG		18.8795,4.4076,13.993	probably-damaging	306/464	4524016	1448,8900	1747	3427	5174	SO:0001583	missense	440503	exon8			GGCCCCGCACGCT	DQ839131	CCDS42473.1	19p13.3	2009-08-12			ENSG00000214456	ENSG00000214456		"""Perilipins"""	33196	protein-coding gene	gene with protein product	"""lipid storage droplet protein 5"""	613248				17234449, 19638644	Standard	NM_001013706		Approved	LSDP5, LSDA5, OXPAT, MLDP	uc002mas.3	Q00G26		ENST00000381848.3:c.916C>T	19.37:g.4524016G>A	ENSP00000371272:p.Arg306Trp	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	7	NM_001013706	0	0	1	2	1	A2RRC1|Q6ZS68	Missense_Mutation	SNP	ENST00000381848.3	37	CCDS42473.1	234	0.10714285714285714	10	0.02032520325203252	65	0.17955801104972377	18	0.03146853146853147	141	0.18601583113456466	.	17.14	3.314611	0.60524	0.044076	0.188795	ENSG00000214456	ENST00000381848	T	0.19938	2.11	4.59	4.59	0.56863	.	0.906390	0.09191	U	0.835949	T	0.00073	0.0002	L	0.47716	1.5	0.09310	P	1.0	D	0.89917	1.0	D	0.71184	0.972	T	0.05666	-1.0871	9	0.87932	D	0	-24.5419	14.8561	0.70338	0.0:0.0:1.0:0.0	rs1062223;rs3170378	306	Q00G26	PLIN5_HUMAN	W	306	ENSP00000371272:R306W	ENSP00000371272:R306W	R	-	1	2	PLIN5	4475016	0.995000	0.38212	0.996000	0.52242	0.090000	0.18270	5.443000	0.66581	2.080000	0.62538	0.511000	0.50034	CGG	G|0.892;A|0.108		0.711	PLIN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458647.1	NM_001013706	
C19orf10	56005	hgsc.bcm.edu	37	19	4670313	4670313	+	Missense_Mutation	SNP	C	C	G	rs2270090	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr19:4670313C>G	ENST00000262947.3	-	1	69	c.34G>C	c.(34-36)Ggc>Cgc	p.G12R	C19orf10_ENST00000599630.1_Missense_Mutation_p.G12R	NM_019107.3	NP_061980.1	Q969H8	CS010_HUMAN	chromosome 19 open reading frame 10	12			G -> R (in dbSNP:rs2270090).		activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)	2		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.015)		AAGCTCGCGCCGACGCCGTTC	0.756													c|||	1444	0.288339	0.6589	0.098	5008	,	,		7783	0.2411		0.1103	False		,,,				2504	0.1544				p.G12R		.											.	C19orf10-90	0			c.G34C						.	C	ARG/GLY	1761,2025		414,933,546	4.0	5.0	4.0		34	-4.8	0.0	19	dbSNP_100	4	578,6710		38,502,3104	yes	missense	C19orf10	NM_019107.3	125	452,1435,3650	GG,GC,CC		7.9308,46.5135,21.1215	benign	12/174	4670313	2339,8735	1893	3644	5537	SO:0001583	missense	56005	exon1			TCGCGCCGACGCC	AF282264	CCDS12133.1	19p13.3	2013-11-27	2003-06-25	2003-06-27	ENSG00000074842	ENSG00000074842			16948	protein-coding gene	gene with protein product		606746	"""interleukin 27 working designation"""	IL27, IL27w		17362502, 21128247	Standard	NM_019107		Approved	R33729_1, IL25, SF20, IL-25, IL-27	uc002may.3	Q969H8		ENST00000262947.3:c.34G>C	19.37:g.4670313C>G	ENSP00000262947:p.Gly12Arg	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	8	NM_019107	0	0	0	9	9	D6W628|O75256|O75272|Q9BTK7|Q9NP69	Missense_Mutation	SNP	ENST00000262947.3	37	CCDS12133.1	541	0.24771062271062272	295	0.5995934959349594	32	0.08839779005524862	134	0.23426573426573427	80	0.10554089709762533	C	13.04	2.119829	0.37436	0.465135	0.079308	ENSG00000074842	ENST00000262947	T	0.47177	0.85	3.82	-4.84	0.03151	.	1.090020	0.07201	U	0.857494	T	0.00012	0.0000	N	0.02011	-0.69	0.80722	P	0.0	B	0.09022	0.002	B	0.15052	0.012	T	0.44329	-0.9335	9	0.59425	D	0.04	-5.96	1.5568	0.02586	0.118:0.2656:0.2321:0.3842	rs2270090;rs60071392	12	Q969H8	CS010_HUMAN	R	12	ENSP00000262947:G12R	ENSP00000262947:G12R	G	-	1	0	C19orf10	4621313	0.000000	0.05858	0.000000	0.03702	0.035000	0.12851	-2.427000	0.01026	-1.087000	0.03081	-0.513000	0.04457	GGC	C|0.752;G|0.248		0.756	C19orf10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458937.1	NM_019107	
OR7E24	26648	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	9362064	9362064	+	Nonsense_Mutation	SNP	C	C	A			TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr19:9362064C>A	ENST00000456448.1	+	1	459	c.345C>A	c.(343-345)tgC>tgA	p.C115*		NM_001079935.1	NP_001073404.1	Q6IFN5	O7E24_HUMAN	olfactory receptor, family 7, subfamily E, member 24	115						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(2)	16						ATGAAGGCTGCCTGACTCAGA	0.512																																					p.C115X		.											.	OR7E24-47	0			c.C345A						.						82.0	82.0	82.0					19																	9362064		2191	4295	6486	SO:0001587	stop_gained	26648	exon1			AGGCTGCCTGACT	Y10529	CCDS45955.1	19p13.2	2012-08-09	2004-03-04	2004-03-05		ENSG00000237521		"""GPCR / Class A : Olfactory receptors"""	8396	protein-coding gene	gene with protein product			"""olfactory receptor, family 7, subfamily E, member 24 pseudogene"""	OR7E24P		9268701	Standard	NM_001079935		Approved	OR19-8, HSHT2, OR7E24Q	uc002mlb.1	Q6IFN5		ENST00000456448.1:c.345C>A	19.37:g.9362064C>A	ENSP00000387523:p.Cys115*	Somatic	32	0		WXS	Illumina GAIIx	Phase_I	76	34	NM_001079935	0	0	0	0	0	B9EJD9|Q9UPJ1	Nonsense_Mutation	SNP	ENST00000456448.1	37	CCDS45955.1	.	.	.	.	.	.	.	.	.	.	c	16.18	3.051388	0.55218	.	.	ENSG00000237521	ENST00000456448	.	.	.	2.39	1.32	0.21799	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	4.7455	0.13035	0.0:0.5593:0.0:0.4407	.	.	.	.	X	115	.	ENSP00000387523:C115X	C	+	3	2	OR7E24	9223064	0.000000	0.05858	0.030000	0.17652	0.028000	0.11728	-1.109000	0.03309	0.350000	0.24002	0.436000	0.28706	TGC	.		0.512	OR7E24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449006.1		
DNM2	1785	broad.mit.edu	37	19	10939897	10939897	+	Silent	SNP	A	A	C			TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr19:10939897A>C	ENST00000355667.6	+	19	2324	c.2244A>C	c.(2242-2244)gtA>gtC	p.V748V	DNM2_ENST00000359692.6_Silent_p.V744V|DNM2_ENST00000585892.1_Silent_p.V748V|DNM2_ENST00000389253.4_Silent_p.V748V|DNM2_ENST00000408974.4_Silent_p.V744V|DNM2_ENST00000314646.5_Silent_p.V748V	NM_001005360.2|NM_001190716.1	NP_001005360.1|NP_001177645.1	P50570	DYN2_HUMAN	dynamin 2	748	Pro-rich.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|endocytosis (GO:0006897)|G2/M transition of mitotic cell cycle (GO:0000086)|GTP catabolic process (GO:0006184)|membrane organization (GO:0061024)|nitric oxide metabolic process (GO:0046209)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription, DNA-templated (GO:0045893)|post-Golgi vesicle-mediated transport (GO:0006892)|receptor internalization (GO:0031623)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic vesicle transport (GO:0048489)|transferrin transport (GO:0033572)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	enzyme binding (GO:0019899)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|microtubule binding (GO:0008017)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(2)|large_intestine(10)|lung(11)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	42			Epithelial(33;4.17e-05)|all cancers(31;8.48e-05)			CCACGCCTGTACCCCCGCCTG	0.637			"""F, N, Splice, Mis, O"""		ETP ALL																																p.V748V		.		Rec	yes		19	19p13.2	1785	dynamin 2		L	.	DNM2-471	0			c.A2244C						.						74.0	56.0	62.0					19																	10939897		2203	4300	6503	SO:0001819	synonymous_variant	1785	exon19			GCCTGTACCCCCG		CCDS32907.1, CCDS32908.1, CCDS45968.1, CCDS45969.1, CCDS59351.1	19p	2014-09-17						"""Pleckstrin homology (PH) domain containing"""	2974	protein-coding gene	gene with protein product	"""dynamin II"", ""cytoskeletal protein"""	602378				7590285, 9143510	Standard	NM_001190716		Approved	DYNII, DYN2, CMTDIB, CMTDI1, DI-CMTB	uc002mps.2	P50570		ENST00000355667.6:c.2244A>C	19.37:g.10939897A>C		Somatic	81	13		WXS	Illumina GAIIx	Phase_I	177	36	NM_001005361	2	0	185	192	5	A8K1B6|E7EV30|E9PEQ4|K7ESI9|Q5I0Y0|Q7Z5S3|Q9UPH4	Silent	SNP	ENST00000355667.6	37	CCDS45968.1																																																																																			.		0.637	DNM2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452592.1	NM_004945	
SLC5A5	6528	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	19	17983255	17983255	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr19:17983255A>G	ENST00000222248.3	+	1	474	c.127A>G	c.(127-129)Agc>Ggc	p.S43G		NM_000453.2	NP_000444.1	Q92911	SC5A5_HUMAN	solute carrier family 5 (sodium/iodide cotransporter), member 5	43					cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|iodide transport (GO:0015705)|ion transport (GO:0006811)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	iodide transmembrane transporter activity (GO:0015111)|sodium:iodide symporter activity (GO:0008507)			NS(2)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(6)|lung(13)|ovary(1)|prostate(1)|skin(3)	31						CGGGCAGCGCAGCGCTGAGGA	0.716																																					p.S43G	Melanoma(65;1008 1708 7910 46650)	.											.	SLC5A5-93	0			c.A127G						.						17.0	19.0	19.0					19																	17983255		2197	4286	6483	SO:0001583	missense	6528	exon1			CAGCGCAGCGCTG		CCDS12368.1	19p13.11	2013-07-19	2013-07-19		ENSG00000105641	ENSG00000105641		"""Solute carriers"""	11040	protein-coding gene	gene with protein product		601843	"""solute carrier family 5 (sodium iodide symporter), member 5"""			9231811	Standard	NM_000453		Approved	NIS	uc002nhr.4	Q92911		ENST00000222248.3:c.127A>G	19.37:g.17983255A>G	ENSP00000222248:p.Ser43Gly	Somatic	11	0		WXS	Illumina GAIIx	Phase_I	31	12	NM_000453	0	0	0	0	0	O43702|Q2M335|Q9NYB6	Missense_Mutation	SNP	ENST00000222248.3	37	CCDS12368.1	.	.	.	.	.	.	.	.	.	.	A	18.83	3.707942	0.68615	.	.	ENSG00000105641	ENST00000222248	D	0.86865	-2.18	4.18	4.18	0.49190	.	0.256697	0.43110	D	0.000604	D	0.83783	0.5329	L	0.57536	1.79	0.38446	D	0.946839	B	0.32507	0.373	B	0.31290	0.127	D	0.85372	0.1114	10	0.62326	D	0.03	.	11.522	0.50558	1.0:0.0:0.0:0.0	.	43	Q92911	SC5A5_HUMAN	G	43	ENSP00000222248:S43G	ENSP00000222248:S43G	S	+	1	0	SLC5A5	17844255	0.962000	0.33011	1.000000	0.80357	0.994000	0.84299	4.159000	0.58157	1.688000	0.51068	0.397000	0.26171	AGC	.		0.716	SLC5A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466690.1		
GDF1	2657	hgsc.bcm.edu	37	19	18980172	18980172	+	Missense_Mutation	SNP	G	G	A	rs4808863	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr19:18980172G>A	ENST00000247005.6	-	8	1698	c.353C>T	c.(352-354)gCc>gTc	p.A118V	CERS1_ENST00000427170.2_3'UTR			P27539	GDF1_HUMAN	growth differentiation factor 1	118			A -> V (in dbSNP:rs4808863). {ECO:0000269|PubMed:2034669}.		growth (GO:0040007)	extracellular space (GO:0005615)											CGCGGCCGAGGCAGGCTCCGA	0.716													g|||	1171	0.233826	0.0401	0.4986	5008	,	,		5099	0.1687		0.3946	False		,,,				2504	0.2096				p.A118V		.											.	GDF1-226	0			c.C353T						.						2.0	2.0	2.0					19																	18980172		1157	2328	3485	SO:0001583	missense	2657	exon8			GCCGAGGCAGGCT	M62302	CCDS42526.1	19p13.11	2014-01-30			ENSG00000130283	ENSG00000130283		"""Endogenous ligands"""	4214	protein-coding gene	gene with protein product		602880				2034669	Standard	NM_001492		Approved			P27539		ENST00000247005.6:c.353C>T	19.37:g.18980172G>A	ENSP00000247005:p.Ala118Val	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	11	7	NM_001492	0	0	0	0	0	O43344	Missense_Mutation	SNP	ENST00000247005.6	37	CCDS42526.1	621	0.28434065934065933	39	0.07926829268292683	184	0.5082872928176796	110	0.19230769230769232	288	0.37994722955145116	g	11.82	1.752739	0.31046	.	.	ENSG00000130283	ENST00000247005	T	0.78481	-1.18	3.33	0.926	0.19430	.	0.692776	0.14240	U	0.332130	T	0.00012	0.0000	L	0.44542	1.39	0.58432	P	1.0000000000287557E-6	.	.	.	.	.	.	T	0.41805	-0.9488	7	0.16896	T	0.51	.	9.0728	0.36502	0.0:0.4429:0.5571:0.0	rs4808863	.	.	.	V	118	ENSP00000247005:A118V	ENSP00000247005:A118V	A	-	2	0	GDF1	18841172	0.000000	0.05858	0.001000	0.08648	0.008000	0.06430	0.201000	0.17276	-0.047000	0.13423	-0.546000	0.04227	GCC	G|0.715;A|0.285		0.716	GDF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465926.1	NM_001492	
NUDT19	390916	hgsc.bcm.edu	37	19	33183282	33183282	+	Missense_Mutation	SNP	T	T	G	rs561713304	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr19:33183282T>G	ENST00000397061.3	+	1	416	c.416T>G	c.(415-417)cTg>cGg	p.L139R	CTD-2538C1.2_ENST00000592431.1_lincRNA	NM_001105570.1	NP_001099040.1	A8MXV4	NUD19_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 19	139	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.					mitochondrion (GO:0005739)|peroxisome (GO:0005777)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)|receptor binding (GO:0005102)			endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	8	Esophageal squamous(110;0.137)					GCGGGCGTGCTGCTGCTGCGG	0.726													T|||	3	0.000599042	0.0	0.0	5008	,	,		10697	0.0		0.0	False		,,,				2504	0.0031				p.L139R		.											.	NUDT19-22	0			c.T416G						.						10.0	13.0	12.0					19																	33183282		2070	4184	6254	SO:0001583	missense	390916	exon1			GCGTGCTGCTGCT		CCDS42543.1	19q13.11	2011-11-16			ENSG00000213965	ENSG00000213965		"""Nudix motif containing"""	32036	protein-coding gene	gene with protein product							Standard	NM_001105570		Approved	RP2	uc010edf.3	A8MXV4		ENST00000397061.3:c.416T>G	19.37:g.33183282T>G	ENSP00000380251:p.Leu139Arg	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	16	5	NM_001105570	0	0	2	2	0		Missense_Mutation	SNP	ENST00000397061.3	37	CCDS42543.1	.	.	.	.	.	.	.	.	.	.	T	16.34	3.097023	0.56075	.	.	ENSG00000213965	ENST00000397061	T	0.06933	3.24	4.89	3.86	0.44501	NUDIX hydrolase domain (2);NUDIX hydrolase domain-like (1);	0.000000	0.50627	U	0.000108	T	0.26846	0.0657	M	0.78801	2.425	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.00942	-1.1506	10	0.87932	D	0	-21.6827	10.0847	0.42410	0.1507:0.0:0.0:0.8493	.	139	A8MXV4	NUD19_HUMAN	R	139	ENSP00000380251:L139R	ENSP00000380251:L139R	L	+	2	0	NUDT19	37875122	1.000000	0.71417	0.803000	0.32268	0.002000	0.02628	3.605000	0.54088	0.853000	0.35312	0.459000	0.35465	CTG	.		0.726	NUDT19-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000450338.3	XM_372723	
CEP89	84902	bcgsc.ca	37	19	33444556	33444556	+	Missense_Mutation	SNP	T	T	C	rs73579706	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr19:33444556T>C	ENST00000305768.5	-	4	545	c.457A>G	c.(457-459)Agt>Ggt	p.S153G	CEP89_ENST00000590597.2_Missense_Mutation_p.S153G	NM_032816.3	NP_116205.3	Q96ST8	CEP89_HUMAN	centrosomal protein 89kDa	153					cilium assembly (GO:0042384)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary transition fiber (GO:0097539)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)				breast(2)|cervix(1)|endometrium(4)|large_intestine(4)|lung(15)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	35						AGGTCATCACTGTGGCCTCCT	0.483																																					p.S153G		.											.	CEP89-94	0			c.A457G						.						401.0	426.0	418.0					19																	33444556		2203	4300	6503	SO:0001583	missense	84902	exon4			CATCACTGTGGCC	AL832158	CCDS32987.1	19q13.11	2014-02-20	2011-05-06	2011-05-06		ENSG00000121289			25907	protein-coding gene	gene with protein product		615470	"""coiled-coil domain containing 123"""	CCDC123		16395595	Standard	NM_032816		Approved	FLJ14640	uc002nty.3	Q96ST8		ENST00000305768.5:c.457A>G	19.37:g.33444556T>C	ENSP00000306105:p.Ser153Gly	Somatic	73	0		WXS	Illumina GAIIx	Phase_I	100	8	NM_032816	0	0	3	3	0	B9EGA6|Q8N5J8	Missense_Mutation	SNP	ENST00000305768.5	37	CCDS32987.1	.	.	.	.	.	.	.	.	.	.	T	3.578	-0.086165	0.07097	.	.	ENSG00000121289	ENST00000305768	T	0.31510	1.49	5.12	-10.2	0.00374	.	3.796690	0.00695	N	0.000748	T	0.07234	0.0183	N	0.01048	-1.04	0.09310	N	1	B;B;B	0.12013	0.005;0.0;0.0	B;B;B	0.08055	0.003;0.0;0.0	T	0.34725	-0.9817	10	0.22706	T	0.39	7.6155	0.6143	0.00767	0.2371:0.2982:0.1712:0.2935	.	124;153;153	Q8WUL5;Q96ST8-3;Q96ST8	.;.;CEP89_HUMAN	G	153	ENSP00000306105:S153G	ENSP00000306105:S153G	S	-	1	0	CEP89	38136396	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.650000	0.01991	-4.026000	0.00080	-0.951000	0.02657	AGT	T|0.500;C|0.500		0.483	CEP89-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451300.2	NM_032816	
KIAA0355	9710	ucsc.edu	37	19	34843761	34843761	+	Silent	SNP	C	C	A	rs527829371|rs397414	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr19:34843761C>A	ENST00000299505.6	+	14	3987	c.3114C>A	c.(3112-3114)ccC>ccA	p.P1038P	AC010504.2_ENST00000591311.1_RNA	NM_014686.3	NP_055501.2	O15063	K0355_HUMAN	KIAA0355	1038	Poly-Pro.									breast(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	41	Esophageal squamous(110;0.162)					AGACCCCACCCCAGCCCCCAC	0.647													A|||	3154	0.629792	0.8313	0.4179	5008	,	,		13217	0.8165		0.3907	False		,,,				2504	0.5613				p.P1038P		.											.	KIAA0355-91	0			c.C3114A						.	A		3359,1041		1301,757,142	30.0	19.0	23.0		3114	-11.2	0.2	19	dbSNP_80	23	3308,5264		739,1830,1717	no	coding-synonymous	KIAA0355	NM_014686.3		2040,2587,1859	AA,AC,CC		38.5908,23.6591,48.6047		1038/1071	34843761	6667,6305	2200	4286	6486	SO:0001819	synonymous_variant	9710	exon14			CCCACCCCAGCCC		CCDS12436.1	19q13.12	2012-11-29			ENSG00000166398	ENSG00000166398			29016	protein-coding gene	gene with protein product						9205841	Standard	NM_014686		Approved		uc002nvd.4	O15063	OTTHUMG00000180505	ENST00000299505.6:c.3114C>A	19.37:g.34843761C>A		Somatic	12	0		WXS	Illumina GAIIx	Phase_I	37	5	NM_014686	0	0	0	0	0	Q2M3W4	Silent	SNP	ENST00000299505.6	37	CCDS12436.1																																																																																			C|0.379;A|0.621		0.647	KIAA0355-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451678.4	NM_014686	
FAM98C	147965	hgsc.bcm.edu	37	19	38894294	38894294	+	Silent	SNP	G	G	T	rs369190079	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr19:38894294G>T	ENST00000252530.5	+	3	328	c.309G>T	c.(307-309)gcG>gcT	p.A103A	FAM98C_ENST00000588262.1_Silent_p.A103A|FAM98C_ENST00000343358.7_Silent_p.A103A	NM_174905.3	NP_777565.3	Q17RN3	FA98C_HUMAN	family with sequence similarity 98, member C	103										endometrium(2)|large_intestine(3)|lung(6)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	15	all_cancers(60;3.95e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			GGGATGGCGCGGCTGCGCTTC	0.726													G|||	2	0.000399361	0.0	0.0	5008	,	,		8003	0.0		0.002	False		,,,				2504	0.0				p.A103A		.											.	FAM98C-91	0			c.G309T						.	G		1,3143		0,1,1571	2.0	4.0	3.0		309	2.7	0.1	19		3	8,6924		0,8,3458	no	coding-synonymous	FAM98C	NM_174905.3		0,9,5029	TT,TG,GG		0.1154,0.0318,0.0893		103/350	38894294	9,10067	1572	3466	5038	SO:0001819	synonymous_variant	147965	exon3			TGGCGCGGCTGCG		CCDS42562.1	19q13.2	2008-02-05				ENSG00000130244			27119	protein-coding gene	gene with protein product						12477932	Standard	NM_174905		Approved	FLJ44669	uc002oin.1	Q17RN3		ENST00000252530.5:c.309G>T	19.37:g.38894294G>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	5	NM_174905	0	0	3	9	6	A6NMW3|Q66K45	Silent	SNP	ENST00000252530.5	37	CCDS42562.1																																																																																			.		0.726	FAM98C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000459222.1	NM_174905	
RINL	126432	hgsc.bcm.edu	37	19	39360720	39360720	+	Missense_Mutation	SNP	G	G	A	rs8110393	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr19:39360720G>A	ENST00000591812.1	-	9	1291	c.1205C>T	c.(1204-1206)cCc>cTc	p.P402L	RINL_ENST00000598904.1_Missense_Mutation_p.P288L|RINL_ENST00000602238.1_5'Flank|RINL_ENST00000340740.3_Missense_Mutation_p.P288L|CTC-360G5.6_ENST00000593830.1_RNA			Q6ZS11	RINL_HUMAN	Ras and Rab interactor-like	402	VPS9. {ECO:0000255|PROSITE- ProRule:PRU00550}.		P -> L (in dbSNP:rs8110393).		endocytosis (GO:0006897)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)	actin cytoskeleton (GO:0015629)|cytoplasmic vesicle (GO:0031410)|ruffle (GO:0001726)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(3)|kidney(4)|large_intestine(2)|lung(4)|pancreas(1)|skin(1)|urinary_tract(2)	17						GGCGGGGGCGGGGCTCTGCCC	0.781													G|||	3477	0.694289	0.9289	0.6153	5008	,	,		10275	0.7619		0.4642	False		,,,				2504	0.6002				p.P402L		.											.	RINL-91	0			c.C1205T						.	G	LEU/PRO,LEU/PRO	3328,464		1489,350,57	4.0	4.0	4.0		1205,863	3.5	1.0	19	dbSNP_116	4	4059,3433		1245,1569,932	no	missense,missense	RINL	NM_001195833.1,NM_198445.3	98,98	2734,1919,989	AA,AG,GG		45.8222,12.2363,34.5356	probably-damaging,probably-damaging	402/567,288/453	39360720	7387,3897	1896	3746	5642	SO:0001583	missense	126432	exon9			GGGGCGGGGCTCT	AK127808	CCDS12522.1, CCDS59386.1	19q13.2	2010-07-13			ENSG00000187994	ENSG00000187994			24795	protein-coding gene	gene with protein product							Standard	NM_001195833		Approved	FLJ45909	uc010xuo.2	Q6ZS11		ENST00000591812.1:c.1205C>T	19.37:g.39360720G>A	ENSP00000467107:p.Pro402Leu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_001195833	0	0	0	0	0	B4DPG5	Missense_Mutation	SNP	ENST00000591812.1	37	CCDS59386.1	1421	0.6506410256410257	458	0.9308943089430894	225	0.6215469613259669	401	0.701048951048951	337	0.4445910290237467	G	17.17	3.320891	0.60634	0.877637	0.541778	ENSG00000187994	ENST00000340740;ENST00000536520	T	0.28454	1.61	4.57	3.53	0.40419	Vacuolar sorting protein 9 (1);	0.269737	0.35235	N	0.003350	T	0.00012	0.0000	M	0.67700	2.07	0.21553	P	0.999649277	B;B	0.21225	0.053;0.053	B;B	0.22152	0.038;0.038	T	0.17776	-1.0358	9	0.72032	D	0.01	-26.0247	8.5759	0.33598	0.1063:0.0:0.8937:0.0	rs8110393;rs61482706	402;288	B4DPG5;Q6ZS11	.;RINL_HUMAN	L	288	ENSP00000340369:P288L	ENSP00000340369:P288L	P	-	2	0	RINL	44052560	1.000000	0.71417	0.987000	0.45799	0.313000	0.28021	4.771000	0.62318	1.273000	0.44346	0.407000	0.27541	CCC	G|0.349;A|0.651		0.781	RINL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460433.1	NM_198445	
CYP2B6	1555	bcgsc.ca	37	19	41512841	41512841	+	Missense_Mutation	SNP	G	G	T	rs3745274	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr19:41512841G>T	ENST00000324071.4	+	4	523	c.516G>T	c.(514-516)caG>caT	p.Q172H	CYP2B6_ENST00000330446.5_Intron|CYP2B6_ENST00000598834.1_3'UTR|CYP2B6_ENST00000593831.1_Intron	NM_000767.4	NP_000758.1	P20813	CP2B6_HUMAN	cytochrome P450, family 2, subfamily B, polypeptide 6	172			Q -> H (in allele CYP2B6*6, allele CYP2B6*7, allele CYP2B6*9 and allele CYP2B6*13; dbSNP:rs3745274). {ECO:0000269|PubMed:11243870, ECO:0000269|PubMed:11470993, ECO:0000269|PubMed:12721789, ECO:0000269|PubMed:14551287, ECO:0000269|PubMed:15469410, ECO:0000269|Ref.2, ECO:0000269|Ref.4}.		cellular ketone metabolic process (GO:0042180)|drug metabolic process (GO:0017144)|exogenous drug catabolic process (GO:0042738)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)			NS(1)|breast(1)|endometrium(5)|kidney(1)|lung(14)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	28			LUSC - Lung squamous cell carcinoma(20;0.00322)		Amitriptyline(DB00321)|Amlodipine(DB00381)|Amprenavir(DB00701)|Antipyrine(DB01435)|Artemether(DB06697)|Atorvastatin(DB01076)|Azelastine(DB00972)|Benzphetamine(DB00865)|Benzyl alcohol(DB06770)|Bifonazole(DB04794)|Brompheniramine(DB00835)|Bupropion(DB01156)|Carbamazepine(DB00564)|Carbinoxamine(DB00748)|Cholecalciferol(DB00169)|Cinnarizine(DB00568)|Cisapride(DB00604)|Cisplatin(DB00515)|Citalopram(DB00215)|Clobazam(DB00349)|Clofibrate(DB00636)|Clopidogrel(DB00758)|Clotiazepam(DB01559)|Clotrimazole(DB00257)|Colchicine(DB01394)|Cyclophosphamide(DB00531)|Desipramine(DB01151)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diclofenac(DB00586)|Diphenhydramine(DB01075)|Domperidone(DB01184)|Doxorubicin(DB00997)|Efavirenz(DB00625)|Enzalutamide(DB08899)|Epinastine(DB00751)|Erythromycin(DB00199)|Estrone(DB00655)|Ethanol(DB00898)|Ethylmorphine(DB01466)|Flunarizine(DB04841)|Flunitrazepam(DB01544)|Fluoxetine(DB00472)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Fosphenytoin(DB01320)|Halothane(DB01159)|Ifosfamide(DB01181)|Imipramine(DB00458)|Irinotecan(DB00762)|Isoflurane(DB00753)|Itraconazole(DB01167)|Ketamine(DB01221)|Ketobemidone(DB06738)|Ketoconazole(DB01026)|Lidocaine(DB00281)|Loperamide(DB00836)|Lopinavir(DB01601)|Lorcaserin(DB04871)|Malathion(DB00772)|Memantine(DB01043)|Methadone(DB00333)|Methimazole(DB00763)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyltestosterone(DB06710)|Mexiletine(DB00379)|Mianserin(DB06148)|Miconazole(DB01110)|Midazolam(DB00683)|Modafinil(DB00745)|Nelfinavir(DB00220)|Nevirapine(DB00238)|Nicardipine(DB00622)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nitric Oxide(DB00435)|Orphenadrine(DB01173)|Ospemifene(DB04938)|Paroxetine(DB00715)|Perhexiline(DB01074)|Permethrin(DB04930)|Perphenazine(DB00850)|Pethidine(DB00454)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Prasugrel(DB06209)|Primidone(DB00794)|Promethazine(DB01069)|Propofol(DB00818)|Quinidine(DB00908)|Raloxifene(DB00481)|Regorafenib(DB08896)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Ritonavir(DB00503)|Ropivacaine(DB00296)|Roxithromycin(DB00778)|Selegiline(DB01037)|Sertraline(DB01104)|Sevoflurane(DB01236)|Simvastatin(DB00641)|Sorafenib(DB00398)|Sulfaphenazole(DB06729)|Sulfinpyrazone(DB01138)|Tamoxifen(DB00675)|Temazepam(DB00231)|Testosterone(DB00624)|Thiotepa(DB04572)|Ticlopidine(DB00208)|Tramadol(DB00193)|Tretinoin(DB00755)|Valproic Acid(DB00313)|Venlafaxine(DB00285)|Verapamil(DB00661)	TCCTCTTCCAGTCCATTACCG	0.507													g|||	1581	0.315695	0.3744	0.3732	5008	,	,		19726	0.2153		0.2356	False		,,,				2504	0.3814				p.Q172H		.											.	CYP2B6-92	0			c.G516T	GRCh37	CS080663	CYP2B6	S	rs3745274	.	G	HIS/GLN	1629,2777		311,1007,885	87.0	77.0	81.0		516	-9.0	0.0	19	dbSNP_107	81	2148,6452		267,1614,2419	yes	missense	CYP2B6	NM_000767.4	24	578,2621,3304	TT,TG,GG		24.9767,36.9723,29.0404	benign	172/492	41512841	3777,9229	2203	4300	6503	SO:0001583	missense	1555	exon4			CTTCCAGTCCATT	AF182277	CCDS12570.1	19q13.2	2013-07-25	2003-01-14		ENSG00000197408	ENSG00000197408		"""Cytochrome P450s"""	2615	protein-coding gene	gene with protein product		123930	"""cytochrome P450, subfamily IIB (phenobarbital-inducible), polypeptide 6"", ""cytochrome P450, family 2, subfamily B"", ""cytochrome P450, subfamily IIB (phenobarbital-inducible)"""	CYP2B		7668294, 15128046	Standard	NM_000767		Approved	CPB6, CYPIIB6	uc002opr.1	P20813	OTTHUMG00000182714	ENST00000324071.4:c.516G>T	19.37:g.41512841G>T	ENSP00000324648:p.Gln172His	Somatic	89	0		WXS	Illumina GAIIx	Phase_I	174	7	NM_000767	0	0	0	0	0	B4DWP3|Q2V565|Q9UK46	Missense_Mutation	SNP	ENST00000324071.4	37	CCDS12570.1	583	0.26694139194139194	174	0.35365853658536583	131	0.36187845303867405	102	0.17832167832167833	176	0.23218997361477572	.	7.755	0.704176	0.15172	0.369723	0.249767	ENSG00000197408	ENST00000324071	T	0.69561	-0.41	4.48	-8.96	0.00761	.	0.221834	0.44285	N	0.000465	T	0.00012	0.0000	N	0.17838	0.53	0.80722	P	0.0	B	0.06786	0.001	B	0.10450	0.005	T	0.18493	-1.0335	9	0.45353	T	0.12	.	1.071	0.01621	0.199:0.1663:0.3402:0.2946	rs3745274;rs57685583;rs3745274	172	P20813	CP2B6_HUMAN	H	172	ENSP00000324648:Q172H	ENSP00000324648:Q172H	Q	+	3	2	CYP2B6	46204681	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-1.320000	0.02700	-1.641000	0.01523	-1.412000	0.01120	CAG	.		0.507	CYP2B6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463260.1	NM_000767	
MEGF8	1954	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	42855429	42855429	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr19:42855429G>A	ENST00000251268.6	+	16	2798	c.2798G>A	c.(2797-2799)cGg>cAg	p.R933Q	MEGF8_ENST00000334370.4_Missense_Mutation_p.R866Q	NM_001271938.1	NP_001258867.1	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	933	PSI 3.				BMP signaling pathway (GO:0030509)|cell migration involved in gastrulation (GO:0042074)|craniofacial suture morphogenesis (GO:0097094)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of heart left/right asymmetry (GO:0061371)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic heart tube morphogenesis (GO:0003143)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|epiboly involved in gastrulation with mouth forming second (GO:0055113)|fasciculation of sensory neuron axon (GO:0097155)|left/right pattern formation (GO:0060972)|limb morphogenesis (GO:0035108)|positive regulation of axon extension involved in axon guidance (GO:0048842)|regulation of gene expression (GO:0010468)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|receptor activity (GO:0004872)			breast(2)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	50		Prostate(69;0.00682)				TGCAGCCGGCGGGGCCGGGGT	0.672																																					p.R933Q		.											.	MEGF8-23	0			c.G2798A						.						9.0	12.0	11.0					19																	42855429		2187	4276	6463	SO:0001583	missense	1954	exon16			GCCGGCGGGGCCG	AB011541	CCDS12604.2, CCDS62693.1	19q13.2	2011-11-24	2006-03-31	2006-03-31	ENSG00000105429	ENSG00000105429			3233	protein-coding gene	gene with protein product	"""HBV pre s2 binding protein 1"""	604267	"""EGF-like-domain, multiple 4"", ""chromosome 19 open reading frame 49"""	EGFL4, C19orf49		9693030	Standard	NM_001410		Approved	SBP1, FLJ22365	uc002otm.5	Q7Z7M0	OTTHUMG00000150342	ENST00000251268.6:c.2798G>A	19.37:g.42855429G>A	ENSP00000251268:p.Arg933Gln	Somatic	30	0		WXS	Illumina GAIIx	Phase_I	112	52	NM_001271938	0	0	3	6	3	A8KAY0|O75097	Missense_Mutation	SNP	ENST00000251268.6	37		.	.	.	.	.	.	.	.	.	.	G	36	5.642620	0.96704	.	.	ENSG00000105429	ENST00000334370;ENST00000251268	T;T	0.21734	1.99;2.0	5.07	5.07	0.68467	.	0.000000	0.64402	D	0.000003	T	0.39860	0.1094	L	0.55481	1.735	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.987;0.995	T	0.05767	-1.0865	10	0.20046	T	0.44	-25.9994	15.9683	0.79991	0.0:0.0:1.0:0.0	.	933;866	Q7Z7M0;Q7Z7M0-2	MEGF8_HUMAN;.	Q	866;933	ENSP00000334219:R866Q;ENSP00000251268:R933Q	ENSP00000251268:R933Q	R	+	2	0	MEGF8	47547269	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	8.180000	0.89694	2.358000	0.79984	0.651000	0.88453	CGG	.		0.672	MEGF8-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000463854.1	NM_001410	
APOE	348	hgsc.bcm.edu	37	19	45411941	45411941	+	Missense_Mutation	SNP	T	T	C	rs429358	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr19:45411941T>C	ENST00000252486.4	+	4	499	c.388T>C	c.(388-390)Tgc>Cgc	p.C130R		NM_000041.2	NP_000032.1	P02649	APOE_HUMAN	apolipoprotein E	130	8 X 22 AA approximate tandem repeats.		C -> R (in HLPP3; form E3**, form E4, form E4/3 and some forms E5-type; only form E3** is disease-linked; dbSNP:rs429358). {ECO:0000269|PubMed:11042151, ECO:0000269|PubMed:12966036, ECO:0000269|PubMed:8287539, ECO:0000269|PubMed:9360638}.		aging (GO:0007568)|alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|artery morphogenesis (GO:0048844)|cell death (GO:0008219)|cellular calcium ion homeostasis (GO:0006874)|cellular response to cholesterol (GO:0071397)|cellular response to growth factor stimulus (GO:0071363)|cellular response to interleukin-1 (GO:0071347)|cGMP-mediated signaling (GO:0019934)|cholesterol catabolic process (GO:0006707)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|chylomicron remnant clearance (GO:0034382)|cytoskeleton organization (GO:0007010)|fatty acid homeostasis (GO:0055089)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle assembly (GO:0034380)|high-density lipoprotein particle clearance (GO:0034384)|high-density lipoprotein particle remodeling (GO:0034375)|intracellular transport (GO:0046907)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|long-chain fatty acid transport (GO:0015909)|low-density lipoprotein particle remodeling (GO:0034374)|maintenance of location in cell (GO:0051651)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of blood coagulation (GO:0030195)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cholesterol biosynthetic process (GO:0045541)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of dendritic spine development (GO:0061000)|negative regulation of dendritic spine maintenance (GO:1902951)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of inflammatory response (GO:0050728)|negative regulation of lipid biosynthetic process (GO:0051055)|negative regulation of lipid transport across blood brain barrier (GO:1903001)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron death (GO:1901215)|negative regulation of phospholipid efflux (GO:1902999)|negative regulation of platelet activation (GO:0010544)|negative regulation of postsynaptic membrane organization (GO:1901627)|negative regulation of presynaptic membrane organization (GO:1901630)|nitric oxide mediated signal transduction (GO:0007263)|oligodendrocyte differentiation (GO:0048709)|peripheral nervous system axon regeneration (GO:0014012)|phospholipid efflux (GO:0033700)|phototransduction, visible light (GO:0007603)|positive regulation of axon extension (GO:0045773)|positive regulation of beta-amyloid formation (GO:1902004)|positive regulation of cGMP biosynthetic process (GO:0030828)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of cholesterol esterification (GO:0010873)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of dendritic spine maintenance (GO:1902952)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of lipid transport across blood brain barrier (GO:1903002)|positive regulation of low-density lipoprotein particle receptor catabolic process (GO:0032805)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of neurofibrillary tangle assembly (GO:1902998)|positive regulation of neuron death (GO:1901216)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of phospholipid efflux (GO:1902995)|positive regulation of postsynaptic membrane organization (GO:1901628)|positive regulation of presynaptic membrane organization (GO:1901631)|protein import (GO:0017038)|receptor-mediated endocytosis (GO:0006898)|regulation of axon extension (GO:0030516)|regulation of beta-amyloid clearance (GO:1900221)|regulation of Cdc42 protein signal transduction (GO:0032489)|regulation of neuron death (GO:1901214)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of tau-protein kinase activity (GO:1902947)|response to dietary excess (GO:0002021)|response to ethanol (GO:0045471)|response to insulin (GO:0032868)|response to reactive oxygen species (GO:0000302)|response to retinoic acid (GO:0032526)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|synaptic transmission, cholinergic (GO:0007271)|triglyceride metabolic process (GO:0006641)|vasodilation (GO:0042311)|very-low-density lipoprotein particle clearance (GO:0034447)|very-low-density lipoprotein particle remodeling (GO:0034372)	blood microparticle (GO:0072562)|chylomicron (GO:0042627)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|high-density lipoprotein particle (GO:0034364)|intermediate-density lipoprotein particle (GO:0034363)|late endosome (GO:0005770)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)|vesicle (GO:0031982)	antioxidant activity (GO:0016209)|beta-amyloid binding (GO:0001540)|cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|hydroxyapatite binding (GO:0046848)|identical protein binding (GO:0042802)|lipid binding (GO:0008289)|lipid transporter activity (GO:0005319)|lipoprotein particle binding (GO:0071813)|low-density lipoprotein particle receptor binding (GO:0050750)|metal chelating activity (GO:0046911)|phosphatidylcholine-sterol O-acyltransferase activator activity (GO:0060228)|phospholipid binding (GO:0005543)|protein homodimerization activity (GO:0042803)|tau protein binding (GO:0048156)|very-low-density lipoprotein particle receptor binding (GO:0070326)			large_intestine(1)|lung(2)|prostate(1)	4	Lung NSC(12;0.0018)|all_lung(12;0.00481)	Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00327)|Epithelial(262;0.174)	Human Serum Albumin(DB00062)|Serum albumin iodonated(DB00064)	GGAGGACGTGTGCGGCCGCCT	0.736													c|||	754	0.150559	0.2678	0.1037	5008	,	,		8484	0.0863		0.1551	False		,,,				2504	0.0869				p.C130R		.											.	APOE-90	0			c.T388C	GRCh37	CM900020	APOE	M	rs429358	.	C	ARG/CYS	808,3460		86,636,1412	12.0	12.0	12.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	388	3.0	0.4	19	dbSNP_80	12	961,7261		66,829,3216	no	missense	APOE	NM_000041.2	180	152,1465,4628	CC,CT,TT	http://www.ncbi.nlm.nih.gov/pubmed?term	11.6882,18.9316,14.1633	benign	130/318	45411941	1769,10721	2134	4111	6245	SO:0001583	missense	348	exon4			GACGTGTGCGGCC	K00396	CCDS12647.1	19q13.31	2013-01-24			ENSG00000130203	ENSG00000130203		"""Apolipoproteins"""	613	protein-coding gene	gene with protein product		107741	"""Alzheimer disease 2 (APOE*E4-associated, late onset)"""	AD2		10662539	Standard	NM_000041		Approved		uc002pab.3	P02649	OTTHUMG00000128901	ENST00000252486.4:c.388T>C	19.37:g.45411941T>C	ENSP00000252486:p.Cys130Arg	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	29	13	NM_000041	2	2	577	1092	511	B2RC15|C0JYY5|Q9P2S4	Missense_Mutation	SNP	ENST00000252486.4	37	CCDS12647.1	326	0.14926739926739926	128	0.2601626016260163	40	0.11049723756906077	50	0.08741258741258741	108	0.1424802110817942	C	0.007	-1.965077	0.00461	0.189316	0.116882	ENSG00000130203	ENST00000252486;ENST00000446996;ENST00000434152;ENST00000425718	T;T;T	0.81078	-0.24;-1.45;-1.45	5.25	3.02	0.34903	Apolipoprotein/apolipophorin (1);	0.486559	0.18187	N	0.148941	T	0.00012	0.0000	N	0.00289	-1.7	0.80722	P	0.0	B	0.02656	0.0	B	0.04013	0.001	T	0.25641	-1.0126	9	0.02654	T	1	-8.1152	3.0382	0.06129	0.1694:0.5443:0.1863:0.1001	rs429358;rs630496;rs61228756	130	P02649	APOE_HUMAN	R	130;130;175;130	ENSP00000252486:C130R;ENSP00000413135:C130R;ENSP00000410423:C130R	ENSP00000252486:C130R	C	+	1	0	APOE	50103781	0.019000	0.18553	0.404000	0.26397	0.109000	0.19521	0.121000	0.15667	1.239000	0.43787	-0.215000	0.12644	TGC	T|0.861;C|0.139		0.736	APOE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250865.2	NM_000041	
ERCC2	2068	hgsc.bcm.edu	37	19	45867259	45867259	+	Missense_Mutation	SNP	C	C	T	rs1799793	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr19:45867259C>T	ENST00000391945.4	-	10	1011	c.934G>A	c.(934-936)Gac>Aac	p.D312N	ERCC2_ENST00000485403.2_Missense_Mutation_p.D288N|ERCC2_ENST00000391940.4_Missense_Mutation_p.D288N|ERCC2_ENST00000391944.3_Missense_Mutation_p.D234N|ERCC2_ENST00000221481.6_3'UTR	NM_000400.3	NP_000391.1	P18074	ERCC2_HUMAN	excision repair cross-complementation group 2	312			D -> N (in dbSNP:rs1799793). {ECO:0000269|PubMed:11245433, ECO:0000269|PubMed:11470747, ECO:0000269|PubMed:11709541, ECO:0000269|Ref.3}.		7-methylguanosine mRNA capping (GO:0006370)|aging (GO:0007568)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|central nervous system myelin formation (GO:0032289)|chromosome segregation (GO:0007059)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)|embryonic cleavage (GO:0040016)|erythrocyte maturation (GO:0043249)|extracellular matrix organization (GO:0030198)|gene expression (GO:0010467)|hair cell differentiation (GO:0035315)|hair follicle maturation (GO:0048820)|hematopoietic stem cell differentiation (GO:0060218)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision (GO:0033683)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral transcription (GO:0050434)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to hypoxia (GO:0001666)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|spinal cord development (GO:0021510)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)|viral process (GO:0016032)	cytoplasm (GO:0005737)|holo TFIIH complex (GO:0005675)|MMXD complex (GO:0071817)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	4 iron, 4 sulfur cluster binding (GO:0051539)|5'-3' DNA helicase activity (GO:0043139)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			large_intestine(4)|lung(2)|ovary(1)|pancreas(1)|stomach(1)	9		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		AGCACTTCGTCGGGCAGCACG	0.746			"""Mis, N, F, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum				C|||	974	0.194489	0.0734	0.1988	5008	,	,		10423	0.0496		0.3588	False		,,,				2504	0.3354				p.D312N		.	yes	Rec		Xeroderma pigmentosum (D)	19	19q13.2-q13.3	2068	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 (xeroderma pigmentosum D)"""		E	.	ERCC2-848	0			c.G934A	GRCh37	CM015299	ERCC2	M	rs1799793	.	C	ASN/ASP,ASN/ASP	387,3577		30,327,1625	5.0	8.0	7.0		934,862	5.2	0.5	19	dbSNP_89	7	2507,5397		444,1619,1889	no	missense,missense	ERCC2	NM_000400.3,NM_001130867.1	23,23	474,1946,3514	TT,TC,CC		31.7181,9.7629,24.3849	benign,benign	312/761,288/406	45867259	2894,8974	1982	3952	5934	SO:0001583	missense	2068	exon10	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	CTTCGTCGGGCAG		CCDS33049.1, CCDS46112.1	19q13.3	2014-09-17	2014-03-07		ENSG00000104884	ENSG00000104884	3.6.4.12	"""General transcription factor IIH complex subunits"""	3434	protein-coding gene	gene with protein product	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 protein"", ""TFIIH basal transcription factor complex helicase XPB subunit"""	126340	"""xeroderma pigmentosum complementary group D"", ""excision repair cross-complementing rodent repair deficiency, complementation group 2"""	XPD		8413672, 2184031	Standard	NM_000400		Approved	MAG, EM9, MGC102762, MGC126218, MGC126219, TFIIH	uc002pbj.2	P18074	OTTHUMG00000048190	ENST00000391945.4:c.934G>A	19.37:g.45867259C>T	ENSP00000375809:p.Asp312Asn	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	6	NM_000400	0	0	12	17	5	Q2TB78|Q2YDY2|Q7KZU6|Q8N721	Missense_Mutation	SNP	ENST00000391945.4	37	CCDS33049.1	423	0.1936813186813187	34	0.06910569105691057	70	0.19337016574585636	38	0.06643356643356643	281	0.370712401055409	C	20.0	3.930510	0.73327	0.097629	0.317181	ENSG00000104884	ENST00000391941;ENST00000391942;ENST00000391945;ENST00000391944;ENST00000391940	T;T;T	0.64438	-0.1;-0.1;-0.1	5.15	5.15	0.70609	Domain of unknown function DUF1227 (1);	0.000000	0.85682	D	0.000000	T	0.00012	0.0000	L	0.46947	1.48	0.09310	P	1.0	B;P;B	0.34639	0.065;0.461;0.053	B;B;B	0.35353	0.059;0.201;0.051	T	0.28267	-1.0049	9	0.33940	T	0.23	-30.0006	16.1268	0.81402	0.0:1.0:0.0:0.0	rs1799793;rs3916814;rs58989209;rs1799793	234;288;312	E7EVE9;Q7KZU6;P18074	.;.;ERCC2_HUMAN	N	262;288;312;234;288	ENSP00000375809:D312N;ENSP00000375808:D234N;ENSP00000375804:D288N	ENSP00000375804:D288N	D	-	1	0	ERCC2	50559099	1.000000	0.71417	0.523000	0.27875	0.865000	0.49528	7.192000	0.77771	2.388000	0.81334	0.561000	0.74099	GAC	C|0.804;T|0.196		0.746	ERCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109626.2	NM_000400	
GLTSCR2	29997	hgsc.bcm.edu	37	19	48258699	48258699	+	Missense_Mutation	SNP	C	C	T	rs11538665	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr19:48258699C>T	ENST00000246802.5	+	9	1186	c.1148C>T	c.(1147-1149)gCg>gTg	p.A383V	SNORD23_ENST00000408876.1_RNA|GLTSCR2_ENST00000598681.1_3'UTR|CTD-2571L23.6_ENST00000602048.1_RNA	NM_015710.4	NP_056525.2	Q9NZM5	GSCR2_HUMAN	glioma tumor suppressor candidate region gene 2	383						intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)	15		all_cancers(25;1.47e-06)|all_lung(116;6.89e-05)|all_epithelial(76;0.000108)|Lung NSC(112;0.000117)|all_neural(266;0.0332)|Ovarian(192;0.086)		all cancers(93;0.000301)|OV - Ovarian serous cystadenocarcinoma(262;0.00031)|Epithelial(262;0.0149)|GBM - Glioblastoma multiforme(486;0.0278)		CTGAGGCTGGCGGAGCTggcg	0.761													C|||	17	0.00339457	0.0	0.0043	5008	,	,		7822	0.0		0.008	False		,,,				2504	0.0061				p.A383V	Colon(58;613 1041 9473 10089 15241)	.											.	GLTSCR2-514	0			c.C1148T						.	C	VAL/ALA	8,2480		0,8,1236	1.0	2.0	2.0		1148	3.8	1.0	19	dbSNP_120	2	64,5588		0,64,2762	no	missense	GLTSCR2	NM_015710.4	64	0,72,3998	TT,TC,CC		1.1323,0.3215,0.8845	possibly-damaging	383/479	48258699	72,8068	1244	2826	4070	SO:0001583	missense	29997	exon9			GGCTGGCGGAGCT	AF182076	CCDS12705.1	19q13.3	2014-01-20				ENSG00000105373			4333	protein-coding gene	gene with protein product		605691				10708517, 16971513, 17657248	Standard	NM_015710		Approved	PICT-1	uc002phm.2	Q9NZM5		ENST00000246802.5:c.1148C>T	19.37:g.48258699C>T	ENSP00000246802:p.Ala383Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_015710	0	0	28	92	64	Q9BTC6|Q9HAX6|Q9NPP1|Q9NPR4|Q9UFI2	Missense_Mutation	SNP	ENST00000246802.5	37	CCDS12705.1	12	0.005494505494505495	0	0.0	2	0.0055248618784530384	4	0.006993006993006993	6	0.0079155672823219	C	18.73	3.685886	0.68157	0.003215	0.011323	ENSG00000105373	ENST00000246802	T	0.46451	0.87	3.8	3.8	0.43715	.	0.807243	0.11526	N	0.555190	T	0.33177	0.0854	M	0.62016	1.91	0.31171	N	0.703183	P;P;P	0.49090	0.919;0.919;0.919	B;B;B	0.41917	0.37;0.37;0.37	T	0.42749	-0.9433	10	0.34782	T	0.22	-10.9561	11.3494	0.49579	0.0:1.0:0.0:0.0	rs11538665	383;383;381	Q53YP0;Q9NZM5;Q96CS0	.;GSCR2_HUMAN;.	V	383	ENSP00000246802:A383V	ENSP00000246802:A383V	A	+	2	0	GLTSCR2	52950511	0.652000	0.27349	0.960000	0.40013	0.888000	0.51559	0.923000	0.28757	2.107000	0.64212	0.448000	0.29417	GCG	G|0.994;A|0.006		0.761	GLTSCR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464870.1	NM_015710	
LILRB3	11025	ucsc.edu	37	19	54725992	54725992	+	Silent	SNP	G	G	A	rs148339740	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr19:54725992G>A	ENST00000391750.1	-	5	502	c.366C>T	c.(364-366)agC>agT	p.S122S	LILRA6_ENST00000440558.2_Intron|LILRA6_ENST00000270464.5_Intron|LILRB3_ENST00000245620.9_Silent_p.S122S|LILRB3_ENST00000346401.6_Silent_p.S122S|CTB-83J4.1_ENST00000601161.1_lincRNA|LILRB3_ENST00000424807.1_Silent_p.S122S|LILRA6_ENST00000419410.2_Intron|LILRA6_ENST00000391735.3_Intron|LILRB3_ENST00000407860.2_Silent_p.S122S|LILRB3_ENST00000469273.1_5'Flank			O75022	LIRB3_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 3	122	Ig-like C2-type 2.		S -> N (in dbSNP:rs3826750). {ECO:0000269|PubMed:9278324}.		cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)|negative regulation of osteoclast differentiation (GO:0045671)	integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			endometrium(3)|kidney(13)|large_intestine(1)|lung(6)|ovary(2)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	34	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GGGTGGGTTTGCTGTAGGCTC	0.592													.|||	959	0.191494	0.1029	0.1744	5008	,	,		13407	0.1071		0.2495	False		,,,				2504	0.3507				p.S122S		.											.	LILRB3-93	0			c.C366T						.						62.0	40.0	48.0					19																	54725992		2132	3919	6051	SO:0001819	synonymous_variant	11025	exon4			GGGTTTGCTGTAG	U91928	CCDS33105.1, CCDS46175.1	19q13.4	2013-01-11			ENSG00000204577	ENSG00000204577		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6607	protein-coding gene	gene with protein product		604820				9278324, 9382880	Standard	NM_006864		Approved	LIR-3, HL9, ILT5, LIR3, CD85a	uc002qee.1	O75022	OTTHUMG00000066626	ENST00000391750.1:c.366C>T	19.37:g.54725992G>A		Somatic	100	9		WXS	Illumina GAIIx	Phase_I	121	19	NM_006864	0	0	0	0	0	C9J1P3|C9JIP1|O15471|Q86U49	Silent	SNP	ENST00000391750.1	37	CCDS33105.1																																																																																			G|0.881;A|0.119		0.592	LILRB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000142844.5	NM_006864	
ZNF628	89887	hgsc.bcm.edu	37	19	55993260	55993260	+	Missense_Mutation	SNP	A	A	G	rs34864744	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr19:55993260A>G	ENST00000598519.1	+	3	1253	c.700A>G	c.(700-702)Acc>Gcc	p.T234A	ZNF628_ENST00000391718.2_Missense_Mutation_p.T230A			Q5EBL2	ZN628_HUMAN	zinc finger protein 628	234	Pro-rich.			T -> A (in Ref. 2; AAH89449). {ECO:0000305}.	transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(1)|lung(2)	7	Breast(117;0.155)		BRCA - Breast invasive adenocarcinoma(297;0.18)|LUSC - Lung squamous cell carcinoma(43;0.193)	GBM - Glioblastoma multiforme(193;0.0531)		cgccccgggtaccgcctccgc	0.766													N|||	3815	0.761781	0.9387	0.732	5008	,	,		4719	0.4395		0.837	False		,,,				2504	0.7986				p.T234A		.											.	ZNF628-22	0			c.A700G						.						3.0	4.0	4.0					19																	55993260		1771	3509	5280	SO:0001583	missense	89887	exon3			CCGGGTACCGCCT	AF367249	CCDS33116.3	19q13.43	2013-01-08			ENSG00000197483	ENSG00000197483		"""Zinc fingers, C2H2-type"""	28054	protein-coding gene	gene with protein product	"""Zinc finger expressed in Embryonal cells and Certain adult organs"""	610671					Standard	NM_033113		Approved	ZEC, Zfp628	uc002qld.3	Q5EBL2	OTTHUMG00000150396	ENST00000598519.1:c.700A>G	19.37:g.55993260A>G	ENSP00000469591:p.Thr234Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_033113	0	0	0	0	0	Q86X34	Missense_Mutation	SNP	ENST00000598519.1	37	CCDS33116.3	1594	0.7298534798534798	448	0.9105691056910569	272	0.7513812154696132	259	0.4527972027972028	615	0.8113456464379947	.	0.001	-2.964343	0.00049	.	.	ENSG00000197483	ENST00000391718	T	0.08193	3.12	3.0	-0.723	0.11181	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.05852	-1.0860	8	0.25106	T	0.35	0.0335	6.0751	0.19911	0.3452:0.3167:0.3381:0.0	rs34864744	230	Q5EBL2	ZN628_HUMAN	A	230	ENSP00000375598:T230A	ENSP00000375598:T230A	T	+	1	0	ZNF628	60685072	0.324000	0.24652	0.001000	0.08648	0.007000	0.05969	-0.265000	0.08644	-0.261000	0.09405	-2.335000	0.00248	ACC	A|0.270;G|0.730		0.766	ZNF628-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317934.2	XM_058964	
TMEM247	388946	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	2	46707808	46707808	+	Missense_Mutation	SNP	C	C	G	rs70940616|rs74318890		TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr2:46707808C>G	ENST00000434431.1	+	2	382	c.382C>G	c.(382-384)Cag>Gag	p.Q128E		NM_001145051.2	NP_001138523.1	A6NEH6	TM247_HUMAN	transmembrane protein 247	128						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)											GAACCAGCGGCAGCGGCAGCA	0.662																																					p.Q128E		.											.	.	0			c.C382G						.						30.0	40.0	37.0					2																	46707808		692	1591	2283	SO:0001583	missense	388946	exon2			CAGCGGCAGCGGC		CCDS56117.1	2p21	2012-04-11			ENSG00000187600	ENSG00000187600			42967	protein-coding gene	gene with protein product							Standard	NM_001145051		Approved		uc010yod.3	A6NEH6	OTTHUMG00000153137	ENST00000434431.1:c.382C>G	2.37:g.46707808C>G	ENSP00000388684:p.Gln128Glu	Somatic	176	0		WXS	Illumina GAIIx	Phase_I	283	35	NM_001145051	0	0	0	0	0		Missense_Mutation	SNP	ENST00000434431.1	37	CCDS56117.1	.	.	.	.	.	.	.	.	.	.	C	17.67	3.447093	0.63178	.	.	ENSG00000187600	ENST00000434431	.	.	.	4.76	4.76	0.60689	.	0.000000	0.39475	N	0.001353	T	0.65606	0.2707	L	0.34521	1.04	.	.	.	D	0.56035	0.974	D	0.70487	0.969	T	0.71735	-0.4503	8	0.54805	T	0.06	-28.7409	14.7885	0.69821	0.0:1.0:0.0:0.0	.	128	A6NEH6	YB028_HUMAN	E	128	.	ENSP00000388684:Q128E	Q	+	1	0	AC018682.6	46561312	1.000000	0.71417	1.000000	0.80357	0.569000	0.35902	3.910000	0.56371	2.484000	0.83849	0.563000	0.77884	CAG	G|1.000;|0.000		0.662	TMEM247-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329726.1	NM_001145051	
C2orf81	388963	broad.mit.edu	37	2	74642280	74642280	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr2:74642280T>G	ENST00000517883.1	-	1	1430	c.739A>C	c.(739-741)Acc>Ccc	p.T247P	C2orf81_ENST00000290390.5_Missense_Mutation_p.T315P			A6NN90	CB081_HUMAN	chromosome 2 open reading frame 81	308										endometrium(3)|kidney(1)	4						GAGGGGCGGGTGGCGCCGCCC	0.716																																					p.T315P		.											.	.	0			c.A943C						.						7.0	10.0	9.0					2																	74642280		682	1575	2257	SO:0001583	missense	388963	exon4			GGCGGGTGGCGCC	AC005041, CH471053		2p13.1	2012-08-07			ENSG00000159239	ENSG00000159239			34350	protein-coding gene	gene with protein product						15815621	Standard	NM_001145054		Approved	LOC388963, hCG40743	uc010yrq.1	A6NN90	OTTHUMG00000164184	ENST00000517883.1:c.739A>C	2.37:g.74642280T>G	ENSP00000431103:p.Thr247Pro	Somatic	22	3		WXS	Illumina GAIIx	Phase_I	90	36	NM_001145054	0	0	0	0	0		Missense_Mutation	SNP	ENST00000517883.1	37		.	.	.	.	.	.	.	.	.	.	t	12.14	1.849844	0.32699	.	.	ENSG00000159239	ENST00000517883;ENST00000290390	.	.	.	3.91	-3.99	0.04069	.	1.321610	0.05237	N	0.511487	T	0.30135	0.0755	L	0.44542	1.39	0.09310	N	1	B	0.19073	0.033	B	0.22601	0.04	T	0.39396	-0.9616	9	0.72032	D	0.01	-3.9874	1.2321	0.01946	0.1409:0.2887:0.2874:0.283	.	315	G3XAA6	.	P	247;315	.	ENSP00000290390:T315P	T	-	1	0	C2orf81	74495788	0.007000	0.16637	0.000000	0.03702	0.008000	0.06430	0.309000	0.19332	-0.435000	0.07264	0.454000	0.30748	ACC	.		0.716	C2orf81-002	PUTATIVE	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000377683.1	NM_001145054	
DNAH6	1768	broad.mit.edu;bcgsc.ca	37	2	84945469	84945469	+	Silent	SNP	G	G	A	rs1192344	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr2:84945469G>A	ENST00000237449.6	+	58	9761	c.9753G>A	c.(9751-9753)ctG>ctA	p.L3251L	DNAH6_ENST00000389394.3_Silent_p.L3251L			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	3251	AAA 5. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						GAAATATTCTGGACAATGAAG	0.338													G|||	345	0.0688898	0.1505	0.0331	5008	,	,		19884	0.002		0.0636	False		,,,				2504	0.0583				p.L3251L		.											.	DNAH6-69	0			c.G9753A						.	G		153,1231		12,129,551	107.0	96.0	99.0		9753	-0.2	1.0	2	dbSNP_87	99	171,3011		4,163,1424	no	coding-synonymous	DNAH6	NM_001370.1		16,292,1975	AA,AG,GG		5.374,11.0549,7.0959		3251/4159	84945469	324,4242	692	1591	2283	SO:0001819	synonymous_variant	1768	exon59			TATTCTGGACAAT	U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.9753G>A	2.37:g.84945469G>A		Somatic	85	0		WXS	Illumina GAIIx	Phase_I	58	5	NM_001370	0	0	1	1	0	A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Silent	SNP	ENST00000237449.6	37	CCDS46348.1																																																																																			G|0.933;A|0.067		0.338	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328537.2	NM_001370	
ANKRD30BL	554226	bcgsc.ca	37	2	133014602	133014602	+	Intron	SNP	G	G	C	rs75245503	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr2:133014602G>C	ENST00000470729.1	-	1	441				MIR663B_ENST00000408361.1_RNA	NR_027020.2		A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like											endometrium(1)|kidney(3)	4						GCCACAGACAGGAGGGAGGTA	0.721																																					.		.											.	.	0			.						.						27.0	45.0	39.0					2																	133014602		1553	3578	5131	SO:0001627	intron_variant	100313824	.			CAGACAGGAGGGA			2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000470729.1:c.984+499C>G	2.37:g.133014602G>C		Somatic	31	2		WXS	Illumina GAIIx	Phase_I	110	35	.	0	0	0	0	0	B8ZZL7	RNA	SNP	ENST00000470729.1	37																																																																																				G|0.500;C|0.500		0.721	ANKRD30BL-002	KNOWN	basic	processed_transcript	protein_coding	OTTHUMT00000331354.1	NR_027019	
ANKRD30BL	554226	bcgsc.ca	37	2	133014612	133014612	+	Intron	SNP	A	A	C	rs199913868|rs74853538	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr2:133014612A>C	ENST00000470729.1	-	1	441				MIR663B_ENST00000408361.1_RNA	NR_027020.2		A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like											endometrium(1)|kidney(3)	4						GGAGGGAGGTACCGCAGCGAC	0.716																																					.		.											.	.	0			.						.						27.0	46.0	40.0					2																	133014612		1553	3577	5130	SO:0001627	intron_variant	100313824	.			GGAGGTACCGCAG			2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000470729.1:c.984+489T>G	2.37:g.133014612A>C		Somatic	35	3		WXS	Illumina GAIIx	Phase_I	123	43	.	0	0	0	0	0	B8ZZL7	RNA	SNP	ENST00000470729.1	37																																																																																				A|0.333;C|0.667		0.716	ANKRD30BL-002	KNOWN	basic	processed_transcript	protein_coding	OTTHUMT00000331354.1	NR_027019	
ANKRD44	91526	bcgsc.ca	37	2	198001319	198001319	+	Silent	SNP	A	A	G	rs3731569	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr2:198001319A>G	ENST00000328737.2	-	4	259	c.183T>C	c.(181-183)agT>agC	p.S61S	ANKRD44_ENST00000409153.1_Silent_p.S86S|ANKRD44_ENST00000409919.1_Silent_p.S86S|ANKRD44_ENST00000539527.1_Silent_p.S14S|ANKRD44_ENST00000337207.5_Silent_p.S61S|ANKRD44_ENST00000282272.8_Silent_p.S78S|ANKRD44_ENST00000450567.1_Silent_p.S61S			Q8N8A2	ANR44_HUMAN	ankyrin repeat domain 44	86								p.S61S(1)		NS(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(20)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	45			OV - Ovarian serous cystadenocarcinoma(117;0.246)			CACTCACTTCACTTCTGGAAG	0.428													a|||	1633	0.326078	0.5862	0.2997	5008	,	,		19780	0.2153		0.2247	False		,,,				2504	0.2117				p.S86S		.											.	ANKRD44-230	1	Substitution - coding silent(1)	stomach(1)	c.T258C						.	G	,	2245,2161	593.1+/-387.9	584,1077,542	83.0	84.0	83.0		258,258	0.2	1.0	2	dbSNP_107	83	2018,6582	353.0+/-328.9	227,1564,2509	no	coding-synonymous,coding-synonymous	ANKRD44	NM_001195144.1,NM_153697.2	,	811,2641,3051	GG,GA,AA		23.4651,49.0468,32.7772	,	86/994,86/368	198001319	4263,8743	2203	4300	6503	SO:0001819	synonymous_variant	91526	exon4			CACTTCACTTCTG	AK097086	CCDS33355.1, CCDS33355.2, CCDS74619.1	2q33.1	2013-01-10			ENSG00000065413	ENSG00000065413		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"", ""Ankyrin repeat domain containing"""	25259	protein-coding gene	gene with protein product	"""protein phosphatase 6 ankyrin repeat subunit B"""						Standard	NM_153697		Approved	PP6-ARS-B	uc021vuj.1	Q8N8A2	OTTHUMG00000154411	ENST00000328737.2:c.183T>C	2.37:g.198001319A>G		Somatic	68	0		WXS	Illumina GAIIx	Phase_I	51	5	NM_153697	0	0	0	0	0	Q53SL9|Q6P480|Q86VL5|Q8IZ72|Q9UFA4	Silent	SNP	ENST00000328737.2	37																																																																																				A|0.672;G|0.328		0.428	ANKRD44-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000335113.1	NM_153697	
TCF15	6939	hgsc.bcm.edu	37	20	590456	590456	+	Silent	SNP	A	A	G	rs282164	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr20:590456A>G	ENST00000246080.3	-	1	586	c.426T>C	c.(424-426)cgT>cgC	p.R142R		NM_004609.3	NP_004600.2	Q12870	TCF15_HUMAN	transcription factor 15 (basic helix-loop-helix)	142					death (GO:0016265)|ear development (GO:0043583)|eating behavior (GO:0042755)|establishment of epithelial cell apical/basal polarity (GO:0045198)|mesenchymal to epithelial transition (GO:0060231)|mesoderm development (GO:0007498)|muscle organ morphogenesis (GO:0048644)|neuromuscular process controlling posture (GO:0050884)|paraxial mesoderm development (GO:0048339)|post-anal tail morphogenesis (GO:0036342)|regulation of gene expression involved in extracellular matrix organization (GO:1901311)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|respiratory system process (GO:0003016)|skeletal system morphogenesis (GO:0048705)|skin development (GO:0043588)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|lung(2)|prostate(1)	4		Breast(17;0.231)				TGCCCGCGGCACGGAAGCACG	0.736													g|||	4317	0.862021	0.7413	0.9035	5008	,	,		6474	0.998		0.8072	False		,,,				2504	0.9121				p.R142R		.											.	TCF15-90	0			c.T426C						.			3211,1033		1232,747,143	7.0	8.0	8.0		426	-9.0	0.0	20	dbSNP_79	8	6663,1669		2708,1247,211	no	coding-synonymous	TCF15	NM_004609.3		3940,1994,354	GG,GA,AA		20.0312,24.3402,21.4854		142/200	590456	9874,2702	2122	4166	6288	SO:0001819	synonymous_variant	6939	exon1			CGCGGCACGGAAG		CCDS33432.1	20p13	2013-05-21			ENSG00000125878	ENSG00000125878		"""Basic helix-loop-helix proteins"""	11627	protein-coding gene	gene with protein product		601010				8825648, 8041747	Standard	NM_004609		Approved	EC2, PARAXIS, bHLHa40	uc002wdz.3	Q12870	OTTHUMG00000031640	ENST00000246080.3:c.426T>C	20.37:g.590456A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_004609	0	0	0	0	0	Q9NQQ1	Silent	SNP	ENST00000246080.3	37	CCDS33432.1																																																																																			A|0.165;G|0.835		0.736	TCF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077475.2	NM_004609	
CHGB	1114	bcgsc.ca	37	20	5903388	5903388	+	Missense_Mutation	SNP	A	A	C	rs881118	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr20:5903388A>C	ENST00000378961.4	+	4	802	c.598A>C	c.(598-600)Aat>Cat	p.N200H		NM_001819.2	NP_001810.2	P05060	SCG1_HUMAN	chromogranin B (secretogranin 1)	200			N -> H (in dbSNP:rs881118).			extracellular region (GO:0005576)|secretory granule (GO:0030141)	hormone activity (GO:0005179)			breast(7)|kidney(2)|large_intestine(8)|lung(19)|ovary(1)|pancreas(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	47						CGCTTTTCTCAATGAAAGAAA	0.483													A|||	823	0.164337	0.2231	0.2161	5008	,	,		20925	0.1498		0.0348	False		,,,				2504	0.1963				p.N200H		.											.	CHGB-96	0			c.A598C						.	A	HIS/ASN	899,3507	345.7+/-308.6	93,713,1397	80.0	85.0	83.0		598	-1.7	0.0	20	dbSNP_86	83	322,8278	113.5+/-173.5	8,306,3986	yes	missense	CHGB	NM_001819.2	68	101,1019,5383	CC,CA,AA		3.7442,20.404,9.388	probably-damaging	200/678	5903388	1221,11785	2203	4300	6503	SO:0001583	missense	1114	exon4			TTTCTCAATGAAA		CCDS13092.1	20p12.3	2013-09-19			ENSG00000089199	ENSG00000089199			1930	protein-coding gene	gene with protein product	"""secretogranin B"""	118920		SCG1		3608978	Standard	NM_001819		Approved		uc002wmg.3	P05060	OTTHUMG00000031821	ENST00000378961.4:c.598A>C	20.37:g.5903388A>C	ENSP00000368244:p.Asn200His	Somatic	122	0		WXS	Illumina GAIIx	Phase_I	140	6	NM_001819	0	0	102	102	0	A8K021|Q59EU9|Q6IBS6|Q9BQV6|Q9UC25|Q9UJA6	Missense_Mutation	SNP	ENST00000378961.4	37	CCDS13092.1	297	0.13598901098901098	121	0.2459349593495935	62	0.1712707182320442	88	0.15384615384615385	26	0.03430079155672823	A	15.45	2.838446	0.51057	0.20404	0.037442	ENSG00000089199	ENST00000378961;ENST00000455042	T;T	0.02197	4.4;4.4	5.27	-1.66	0.08265	.	0.863047	0.10421	N	0.676713	T	0.00012	0.0000	M	0.67953	2.075	0.80722	P	0.0	B	0.18013	0.025	B	0.23852	0.049	T	0.45249	-0.9274	9	0.66056	D	0.02	-6.6714	1.9737	0.03412	0.3373:0.1392:0.386:0.1375	rs881118;rs52834263;rs61397083;rs881118	200	P05060	SCG1_HUMAN	H	200;180	ENSP00000368244:N200H;ENSP00000416643:N180H	ENSP00000368244:N200H	N	+	1	0	CHGB	5851388	0.016000	0.18221	0.000000	0.03702	0.012000	0.07955	0.745000	0.26259	-0.284000	0.09102	0.460000	0.39030	AAT	A|0.887;C|0.113		0.483	CHGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077897.2	NM_001819	
FAM182A	284800	broad.mit.edu	37	20	26061818	26061818	+	RNA	SNP	G	G	C	rs112101451		TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr20:26061818G>C	ENST00000376398.2	+	0	838					NR_026713.1		Q5T1J6	F182A_HUMAN	family with sequence similarity 182, member A											breast(1)|endometrium(2)|kidney(1)	4						GATTTCTCCTGCTTAGAAATG	0.463																																					.		.											.	.	0			.						.						12.0	11.0	11.0					20																	26061818		692	1579	2271			284800	.			TCTCCTGCTTAGA	AL391119		20p11	2013-03-18	2008-08-05	2008-08-05	ENSG00000125804	ENSG00000125804			16222	other	unknown			"""chromosome 20 open reading frame 91"""	C20orf91			Standard	NR_026713		Approved	bB329D4.1, C20orf91A	uc010gdq.3	Q5T1J6	OTTHUMG00000032144		20.37:g.26061818G>C		Somatic	47	1		WXS	Illumina GAIIx	Phase_I	38	3	.	0	0	0	0	0	A2RRD0|Q8N947	RNA	SNP	ENST00000376398.2	37		.	.	.	.	.	.	.	.	.	.	N	7.694	0.691703	0.15039	.	.	ENSG00000125804	ENST00000376398;ENST00000246000	.	.	.	0.368	0.368	0.16146	.	.	.	.	.	T	0.47322	0.1439	.	.	.	0.30118	N	0.805912	.	.	.	.	.	.	T	0.53092	-0.8487	4	0.87932	D	0	.	.	.	.	.	.	.	.	S	57	.	ENSP00000246000:C57S	C	+	2	0	FAM182A	26009818	1.000000	0.71417	0.427000	0.26684	0.468000	0.32798	0.774000	0.26675	0.451000	0.26802	0.123000	0.15791	TGC	G|0.994;C|0.006		0.463	FAM182A-001	KNOWN	basic	lincRNA	processed_transcript	OTTHUMT00000078473.2		
SLC32A1	140679	bcgsc.ca	37	20	37356245	37356245	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr20:37356245C>T	ENST00000217420.1	+	2	804	c.541C>T	c.(541-543)Cgc>Tgc	p.R181C		NM_080552.2	NP_542119.1	Q9H598	VIAAT_HUMAN	solute carrier family 32 (GABA vesicular transporter), member 1	181					aging (GO:0007568)|ion transport (GO:0006811)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell tip (GO:0051286)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cone cell pedicle (GO:0044316)|dendrite (GO:0030425)|dendrite terminus (GO:0044292)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuron projection terminus (GO:0044306)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	gamma-aminobutyric acid:proton symporter activity (GO:0015495)|glycine transmembrane transporter activity (GO:0015187)			breast(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(16)|urinary_tract(1)	38		Myeloproliferative disorder(115;0.00878)			Glycine(DB00145)	CGAGGTGGTGCGCGTGCGGGA	0.632																																					p.R181C		.											.	SLC32A1-90	0			c.C541T						.						80.0	64.0	70.0					20																	37356245		2203	4300	6503	SO:0001583	missense	140679	exon2			GTGGTGCGCGTGC	AL133519	CCDS13307.1	20q11	2013-05-22			ENSG00000101438	ENSG00000101438		"""Solute carriers"""	11018	protein-coding gene	gene with protein product			"""vesicular inhibitory amino acid transporter"""	VIAAT		19843525	Standard	NM_080552		Approved	VGAT, bA122O1.1	uc002xjc.3	Q9H598	OTTHUMG00000032457	ENST00000217420.1:c.541C>T	20.37:g.37356245C>T	ENSP00000217420:p.Arg181Cys	Somatic	37	1		WXS	Illumina GAIIx	Phase_I	138	65	NM_080552	0	0	0	0	0	Q8N489	Missense_Mutation	SNP	ENST00000217420.1	37	CCDS13307.1	.	.	.	.	.	.	.	.	.	.	C	18.50	3.637578	0.67130	.	.	ENSG00000101438	ENST00000217420	T	0.02498	4.27	4.13	4.13	0.48395	.	0.000000	0.85682	D	0.000000	T	0.13457	0.0326	M	0.81802	2.56	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.00059	-1.2167	10	0.62326	D	0.03	-26.2117	9.4842	0.38919	0.2111:0.7889:0.0:0.0	.	181	Q9H598	VIAAT_HUMAN	C	181	ENSP00000217420:R181C	ENSP00000217420:R181C	R	+	1	0	SLC32A1	36789659	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.723000	0.61965	2.317000	0.78254	0.563000	0.77884	CGC	.		0.632	SLC32A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079206.1	NM_080552	
COL9A3	1299	bcgsc.ca	37	20	61463522	61463522	+	Missense_Mutation	SNP	C	C	A	rs751557	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr20:61463522C>A	ENST00000343916.3	+	25	1307	c.1304C>A	c.(1303-1305)gCa>gAa	p.A435E		NM_001853.3	NP_001844.3	Q14050	CO9A3_HUMAN	collagen, type IX, alpha 3	435	Triple-helical region 3 (COL3).		A -> E (in dbSNP:rs751557). {ECO:0000269|PubMed:11565064, ECO:0000269|PubMed:8586434}.		axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female gonad development (GO:0008585)|male gonad development (GO:0008584)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(1)|endometrium(3)|large_intestine(1)|lung(18)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	28	Breast(26;5.68e-08)					GGAGGTGCCGCAGGCCCTAAG	0.602													C|||	1066	0.212859	0.447	0.1729	5008	,	,		20947	0.0496		0.2177	False		,,,				2504	0.0879				p.A435E		.											.	COL9A3-514	0			c.C1304A						.	C	GLU/ALA	1747,2659	513.9+/-368.5	338,1071,794	58.0	61.0	60.0		1304	4.2	0.4	20	dbSNP_86	60	1774,6826	317.9+/-313.4	185,1404,2711	yes	missense	COL9A3	NM_001853.3	107	523,2475,3505	AA,AC,CC		20.6279,39.6505,27.0721	probably-damaging	435/685	61463522	3521,9485	2203	4300	6503	SO:0001583	missense	1299	exon25			GTGCCGCAGGCCC	AK075240	CCDS13505.1	20q13.3	2013-01-16			ENSG00000092758	ENSG00000092758		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2219	protein-coding gene	gene with protein product	"""collagen type IX proteoglycan"""	120270				8586434, 1429648	Standard	NM_001853		Approved	IDD, MED, EDM3, FLJ90759, DJ885L7.4.1	uc002ydm.3	Q14050	OTTHUMG00000032938	ENST00000343916.3:c.1304C>A	20.37:g.61463522C>A	ENSP00000341640:p.Ala435Glu	Somatic	184	1		WXS	Illumina GAIIx	Phase_I	360	11	NM_001853	0	0	0	0	0	Q13681|Q9H4G9|Q9UPE2	Missense_Mutation	SNP	ENST00000343916.3	37	CCDS13505.1	464	0.21245421245421245	204	0.4146341463414634	66	0.18232044198895028	32	0.055944055944055944	162	0.21372031662269128	C	10.51	1.371130	0.24771	0.396505	0.206279	ENSG00000092758	ENST00000343916	D	0.93712	-3.27	5.2	4.23	0.50019	.	0.843935	0.10592	N	0.656672	T	0.00012	0.0000	N	0.05078	-0.115	0.80722	P	0.0	B	0.23185	0.081	B	0.25506	0.061	T	0.04664	-1.0935	9	0.07325	T	0.83	.	12.5103	0.56002	0.0:0.868:0.0:0.132	rs751557;rs59729765;rs751557	435	Q14050	CO9A3_HUMAN	E	435	ENSP00000341640:A435E	ENSP00000341640:A435E	A	+	2	0	COL9A3	60933967	0.003000	0.15002	0.425000	0.26659	0.227000	0.25037	0.934000	0.28910	2.584000	0.87258	0.462000	0.41574	GCA	T|0.059;G|0.214		0.602	COL9A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080071.2	NM_001853	
MIR124-3	406909	broad.mit.edu	37	20	61809858	61809858	+	lincRNA	SNP	C	C	A			TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr20:61809858C>A	ENST00000423020.1	-	0	188				MIR124-3_ENST00000384866.1_RNA																							GCCCTGAGGGCCCCTCTGCGT	0.667																																					.		.											.	.	0			.						.						19.0	24.0	22.0					20																	61809858		1567	3581	5148			406909	.			TGAGGGCCCCTCT																													20.37:g.61809858C>A		Somatic	22	1		WXS	Illumina GAIIx	Phase_I	91	5	.	0	0	0	0	0		RNA	SNP	ENST00000423020.1	37																																																																																				.		0.667	RP5-963E22.4-001	KNOWN	basic|exp_conf	lincRNA	lincRNA	OTTHUMT00000276288.1		
LIME1	54923	hgsc.bcm.edu	37	20	62369658	62369658	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr20:62369658G>T	ENST00000309546.3	+	5	478	c.391G>T	c.(391-393)Gca>Tca	p.A131S	RP4-583P15.15_ENST00000490623.2_3'UTR|LIME1_ENST00000490824.1_3'UTR|RP4-583P15.14_ENST00000467211.1_Silent_p.R12R|SLC2A4RG_ENST00000266077.2_5'Flank	NM_017806.2	NP_060276.2	Q9H400	LIME1_HUMAN	Lck interacting transmembrane adaptor 1	131					B cell receptor signaling pathway (GO:0050853)|T cell receptor signaling pathway (GO:0050852)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				kidney(1)|large_intestine(1)|liver(1)	3	all_cancers(38;1.13e-12)|all_epithelial(29;2.64e-14)|Lung NSC(23;4.79e-10)|all_lung(23;1.7e-09)					GGCTCTGCCGGCAGCTGCAGC	0.721																																					p.A131S		.											.	LIME1-44	0			c.G391T						.						3.0	5.0	4.0					20																	62369658		1771	3745	5516	SO:0001583	missense	54923	exon5			CTGCCGGCAGCTG	AK000413	CCDS13536.1	20q13.33	2010-05-11			ENSG00000203896	ENSG00000203896			26016	protein-coding gene	gene with protein product		609809				12477932	Standard	NM_017806		Approved	FLJ20406, dJ583P15.4, LIME	uc002ygp.4	Q9H400	OTTHUMG00000032999	ENST00000309546.3:c.391G>T	20.37:g.62369658G>T	ENSP00000309521:p.Ala131Ser	Somatic	3	0		WXS	Illumina GAIIx	Phase_I	43	23	NM_017806	0	0	8	11	3	E1P5K5|E1P5K6|Q5JWJ2|Q6XYB3|Q9NX69	Missense_Mutation	SNP	ENST00000309546.3	37	CCDS13536.1	.	.	.	.	.	.	.	.	.	.	g	9.530	1.110698	0.20714	.	.	ENSG00000203896	ENST00000309546	T	0.44083	0.93	2.89	0.762	0.18454	.	.	.	.	.	T	0.26919	0.0659	N	0.19112	0.55	0.19300	N	0.999977	P	0.46912	0.886	P	0.44394	0.448	T	0.12091	-1.0561	9	0.25751	T	0.34	-0.5486	6.521	0.22275	0.1151:0.3665:0.5184:0.0	.	131	Q9H400	LIME1_HUMAN	S	131	ENSP00000309521:A131S	ENSP00000309521:A131S	A	+	1	0	LIME1	61840102	0.000000	0.05858	0.002000	0.10522	0.009000	0.06853	-0.200000	0.09478	0.096000	0.17463	0.457000	0.33378	GCA	.		0.721	LIME1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080225.1	NM_017806	
NEFH	4744	ucsc.edu	37	22	29885567	29885567	+	Silent	SNP	A	A	C	rs147489453|rs75808076|rs59279731		TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr22:29885567A>C	ENST00000310624.6	+	4	1971	c.1938A>C	c.(1936-1938)gcA>gcC	p.A646A		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	652	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						AGGAGGAAGCAAAGTCCCCTG	0.567																																					p.A646A		.											.	NEFH-90	0			c.A1938C						.						78.0	77.0	77.0					22																	29885567		2133	4127	6260	SO:0001819	synonymous_variant	4744	exon4			GGAAGCAAAGTCC		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1938A>C	22.37:g.29885567A>C		Somatic	127	0		WXS	Illumina GAIIx	Phase_I	150	32	NM_021076	0	0	0	0	0	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Silent	SNP	ENST00000310624.6	37	CCDS13858.1																																																																																			.		0.567	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
NEFH	4744	hgsc.bcm.edu	37	22	29885581	29885604	+	In_Frame_Del	DEL	AGGCCAAGTCCCCAGAGAAGGAAG	AGGCCAAGTCCCCAGAGAAGGAAG	-	rs267607534|rs373980795|rs267607533|rs149571560|rs79235463|rs200984527|rs370803228	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	AGGCCAAGTCCCCAGAGAAGGAAG	AGGCCAAGTCCCCAGAGAAGGAAG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr22:29885581_29885604delAGGCCAAGTCCCCAGAGAAGGAAG	ENST00000310624.6	+	4	1985_2008	c.1952_1975delAGGCCAAGTCCCCAGAGAAGGAAG	c.(1951-1977)aaggccaagtccccagagaaggaagag>aag	p.AKSPEKEE652del		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	658	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.			Missing (in Ref. 1; CAA33366 and 5; AC000035). {ECO:0000305}.	axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						TCCCCTGAGAAGGCCAAGTCCCCAGAGAAGGAAGAGGCCAAGTC	0.562																																					p.651_659del		.											.	NEFH-90	0			c.1952_1975del						.																																			SO:0001651	inframe_deletion	4744	exon4			CTGAGAAGGCCAA		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1952_1975delAGGCCAAGTCCCCAGAGAAGGAAG	22.37:g.29885581_29885604delAGGCCAAGTCCCCAGAGAAGGAAG	ENSP00000311997:p.Ala652_Glu659del	Somatic	197	0		WXS	Illumina GAIIx	Phase_I	175	80	NM_021076	0	0	0	0	0	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	In_Frame_Del	DEL	ENST00000310624.6	37	CCDS13858.1																																																																																			.		0.562	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
EP300	2033	bcgsc.ca	37	22	41551039	41551039	+	Silent	SNP	T	T	A	rs20552	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr22:41551039T>A	ENST00000263253.7	+	17	4402	c.3183T>A	c.(3181-3183)acT>acA	p.T1061T		NM_001429.3	NP_001420.2	Q09472	EP300_HUMAN	E1A binding protein p300	1061					apoptotic process (GO:0006915)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|circadian rhythm (GO:0007623)|G2/M transition of mitotic cell cycle (GO:0000086)|heart development (GO:0007507)|histone H2B acetylation (GO:0043969)|histone H4 acetylation (GO:0043967)|innate immune response (GO:0045087)|internal peptidyl-lysine acetylation (GO:0018393)|internal protein amino acid acetylation (GO:0006475)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|lung development (GO:0030324)|mitotic cell cycle (GO:0000278)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of protein binding (GO:0032092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tubulin deacetylation (GO:0090043)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|activating transcription factor binding (GO:0033613)|androgen receptor binding (GO:0050681)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|nuclear hormone receptor binding (GO:0035257)|pre-mRNA intronic binding (GO:0097157)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transferase activity, transferring acyl groups (GO:0016746)|zinc ion binding (GO:0008270)			NS(2)|breast(11)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(31)|kidney(5)|large_intestine(31)|liver(2)|lung(33)|ovary(2)|pancreas(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(16)	171						TGATGCCAACTTTGGAGGCAC	0.388			"""T,  N, F, Mis, O"""	"""MLL, RUNXBP2"""	"""colorectal, breast, pancreatic, AML, ALL, DLBCL"""				Rubinstein-Taybi syndrome				A|||	3375	0.673922	0.5091	0.7695	5008	,	,		17967	0.8175		0.6352	False		,,,				2504	0.7209				p.T1061T		.		Rec	yes		22	22q13	2033	300 kd E1A-Binding protein gene		"""L, E"""	.	EP300-2011	0			c.T3183A						.	A		2246,2160	582.1+/-385.5	583,1080,540	214.0	200.0	205.0		3183	-2.4	0.2	22	dbSNP_67	205	5338,3262	490.3+/-372.8	1690,1958,652	no	coding-synonymous	EP300	NM_001429.3		2273,3038,1192	AA,AT,TT		37.9302,49.0241,41.6885		1061/2415	41551039	7584,5422	2203	4300	6503	SO:0001819	synonymous_variant	2033	exon17	Familial Cancer Database	Broad Thumb-Hallux syndrome	GCCAACTTTGGAG	U01877	CCDS14010.1	22q13.2	2011-07-01			ENSG00000100393	ENSG00000100393		"""Chromatin-modifying enzymes / K-acetyltransferases"""	3373	protein-coding gene	gene with protein product	"""histone acetyltransferase p300"""	602700				7523245	Standard	NM_001429		Approved	p300, KAT3B	uc003azl.4	Q09472	OTTHUMG00000150937	ENST00000263253.7:c.3183T>A	22.37:g.41551039T>A		Somatic	79	0		WXS	Illumina GAIIx	Phase_I	50	4	NM_001429	0	0	11	11	0	B1AKC2	Silent	SNP	ENST00000263253.7	37	CCDS14010.1																																																																																			T|0.375;A|0.625		0.388	EP300-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320600.1	NM_001429	
IL17RE	132014	bcgsc.ca	37	3	9956279	9956279	+	Silent	SNP	G	G	A	rs455863	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr3:9956279G>A	ENST00000383814.3	+	14	1449	c.1344G>A	c.(1342-1344)ccG>ccA	p.P448P	IL17RC_ENST00000403601.3_5'Flank|IL17RC_ENST00000413608.1_5'Flank|IL17RE_ENST00000421412.1_Silent_p.P481P|IL17RC_ENST00000416074.2_5'Flank|IL17RE_ENST00000454190.2_Missense_Mutation_p.G473R|IL17RC_ENST00000383812.4_5'Flank|IL17RC_ENST00000455057.1_5'Flank|IL17RC_ENST00000295981.3_5'Flank|IL17RE_ENST00000295980.3_Silent_p.P448P	NM_153480.1	NP_705613.1	Q8NFR9	I17RE_HUMAN	interleukin 17 receptor E	448					inflammatory response (GO:0006954)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(11)|skin(1)	21				OV - Ovarian serous cystadenocarcinoma(96;5.34e-64)		TCTTGTGTCCGGATGGTGAGT	0.607													G|||	1813	0.362021	0.4054	0.4625	5008	,	,		19167	0.0933		0.5447	False		,,,				2504	0.3211				p.G473R		.											.	IL17RE-90	0			c.G1417A						.	G	ARG/GLY,,	1829,2577	533.4+/-373.7	391,1047,765	121.0	123.0	122.0		1417,1344,1464	-9.9	0.0	3	dbSNP_80	122	4579,4021	597.6+/-393.8	1205,2169,926	yes	missense,coding-synonymous,coding-synonymous	IL17RE	NM_001193380.1,NM_153480.1,NM_153483.2	125,,	1596,3216,1691	AA,AG,GG		46.7558,41.5116,49.2696	,,	473/534,448/668,488/708	9956279	6408,6598	2203	4300	6503	SO:0001819	synonymous_variant	132014	exon14			GTGTCCGGATGGT	AF458069	CCDS2589.1, CCDS54552.1	3p25.3	2008-02-05			ENSG00000163701	ENSG00000163701		"""Interleukins and interleukin receptors"""	18439	protein-coding gene	gene with protein product		614995					Standard	NM_153480		Approved	FLJ23658	uc003btu.3	Q8NFR9	OTTHUMG00000128649	ENST00000383814.3:c.1344G>A	3.37:g.9956279G>A		Somatic	108	0		WXS	Illumina GAIIx	Phase_I	101	5	NM_001193380	0	0	0	0	0	B2RB34|B2RNR1|B9EH65|Q6P532|Q8N8H7|Q8N8H8|Q8TEC2	Missense_Mutation	SNP	ENST00000383814.3	37	CCDS2589.1	809	0.37042124542124544	192	0.3902439024390244	168	0.46408839779005523	38	0.06643356643356643	411	0.5422163588390502	G	3.940	-0.014333	0.07681	0.415116	0.532442	ENSG00000163701	ENST00000454190	T	0.30714	1.52	4.94	-9.87	0.00470	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.21861	P	0.999502608	B	0.02656	0.0	B	0.01281	0.0	T	0.31724	-0.9933	7	0.87932	D	0	-12.6119	6.2348	0.20756	0.0884:0.1602:0.4815:0.27	rs455863;rs1300549;rs52806952;rs61674331;rs455863	473	Q8NFR9-3	.	R	473	ENSP00000388086:G473R	ENSP00000388086:G473R	G	+	1	0	IL17RE	9931279	0.000000	0.05858	0.011000	0.14972	0.478000	0.33099	-5.110000	0.00150	-4.926000	0.00027	-2.560000	0.00174	GGA	A|0.424;C|0.006		0.607	IL17RE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250529.1	NM_153480	
ACVR2B	93	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	38519421	38519421	+	Silent	SNP	C	C	T	rs528729033		TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr3:38519421C>T	ENST00000352511.4	+	3	802	c.330C>T	c.(328-330)aaC>aaT	p.N110N		NM_001106.3	NP_001097.2	Q13705	AVR2B_HUMAN	activin A receptor, type IIB	110					activation of protein kinase activity (GO:0032147)|activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|blood vessel remodeling (GO:0001974)|BMP signaling pathway (GO:0030509)|determination of left/right symmetry (GO:0007368)|embryonic foregut morphogenesis (GO:0048617)|gastrulation with mouth forming second (GO:0001702)|heart development (GO:0007507)|insulin secretion (GO:0030073)|kidney development (GO:0001822)|lung development (GO:0030324)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|mesoderm development (GO:0007498)|odontogenesis of dentin-containing tooth (GO:0042475)|organ growth (GO:0035265)|palate development (GO:0060021)|pancreas development (GO:0031016)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|post-embryonic development (GO:0009791)|regulation of transcription, DNA-templated (GO:0006355)|response to glucose (GO:0009749)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|skeletal system morphogenesis (GO:0048705)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)|venous blood vessel development (GO:0060841)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)			lung(1)	1	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0565)|Kidney(284;0.071)		ACTTCTGCAACGAACGCTTCA	0.582																																					p.N110N		.											.	ACVR2B-942	0			c.C330T						.						128.0	126.0	126.0					3																	38519421		2203	4300	6503	SO:0001819	synonymous_variant	93	exon3			CTGCAACGAACGC	X77533	CCDS2679.1	3p22	2006-11-06			ENSG00000114739	ENSG00000114739			174	protein-coding gene	gene with protein product		602730				8161782, 9621519	Standard	NM_001106		Approved	ActR-IIB	uc003cif.3	Q13705	OTTHUMG00000131291	ENST00000352511.4:c.330C>T	3.37:g.38519421C>T		Somatic	225	0		WXS	Illumina GAIIx	Phase_I	215	175	NM_001106	0	0	0	1	1	Q4VAV0	Silent	SNP	ENST00000352511.4	37	CCDS2679.1																																																																																			.		0.582	ACVR2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254059.3	NM_001106	
KIF15	56992	broad.mit.edu;bcgsc.ca	37	3	44856506	44856506	+	Missense_Mutation	SNP	G	G	C	rs34058914	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr3:44856506G>C	ENST00000326047.4	+	20	2636	c.2487G>C	c.(2485-2487)gaG>gaC	p.E829D	KIF15_ENST00000425755.1_Missense_Mutation_p.E464D	NM_020242.2	NP_064627.1	Q9NS87	KIF15_HUMAN	kinesin family member 15	829					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|plus-end kinesin complex (GO:0005873)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|liver(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(5)	36				BRCA - Breast invasive adenocarcinoma(193;0.0099)|KIRC - Kidney renal clear cell carcinoma(197;0.0564)|Kidney(197;0.0707)		CGAATCAGGAGAAAGAATTCA	0.378													G|||	4	0.000798722	0.0	0.0029	5008	,	,		19444	0.0		0.002	False		,,,				2504	0.0				p.E829D		.											.	KIF15-91	0			c.G2487C						.	G	ASP/GLU	0,4406		0,0,2203	110.0	106.0	107.0		2487	3.7	1.0	3	dbSNP_126	107	37,8563	25.1+/-72.6	0,37,4263	yes	missense	KIF15	NM_020242.2	45	0,37,6466	CC,CG,GG		0.4302,0.0,0.2845	possibly-damaging	829/1389	44856506	37,12969	2203	4300	6503	SO:0001583	missense	56992	exon20			TCAGGAGAAAGAA	AB035898	CCDS33744.1	3p21.31	2008-03-03	2005-03-15	2005-03-17	ENSG00000163808	ENSG00000163808		"""Kinesins"""	17273	protein-coding gene	gene with protein product			"""kinesin-like 7"""	KNSL7		10878014	Standard	NM_020242		Approved	HKLP2, NY-BR-62	uc003cnx.4	Q9NS87	OTTHUMG00000156307	ENST00000326047.4:c.2487G>C	3.37:g.44856506G>C	ENSP00000324020:p.Glu829Asp	Somatic	80	0		WXS	Illumina GAIIx	Phase_I	60	5	NM_020242	0	0	1	1	0	Q17RV9|Q69YL6|Q96JX7|Q9H280	Missense_Mutation	SNP	ENST00000326047.4	37	CCDS33744.1	3	0.0013736263736263737	0	0.0	0	0.0	0	0.0	3	0.00395778364116095	G	11.89	1.774333	0.31411	0.0	0.004302	ENSG00000163808	ENST00000326047;ENST00000481166;ENST00000396031;ENST00000425755	T;T;T	0.55052	0.54;0.54;0.54	5.76	3.74	0.42951	.	0.000000	0.52532	D	0.000077	T	0.49575	0.1565	M	0.70595	2.14	0.42822	D	0.993999	B	0.15473	0.013	B	0.15052	0.012	T	0.48502	-0.9030	10	0.28530	T	0.3	.	11.4045	0.49889	0.1954:0.0:0.8046:0.0	rs34058914	829	Q9NS87	KIF15_HUMAN	D	829;601;828;464	ENSP00000324020:E829D;ENSP00000425499:E601D;ENSP00000389982:E464D	ENSP00000324020:E829D	E	+	3	2	KIF15	44831510	1.000000	0.71417	0.994000	0.49952	0.583000	0.36354	2.052000	0.41316	1.449000	0.47699	0.591000	0.81541	GAG	G|0.998;C|0.002		0.378	KIF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343831.2		
OR5H2	79310	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	98001912	98001912	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr3:98001912C>A	ENST00000355273.2	+	1	181	c.181C>A	c.(181-183)Cac>Aac	p.H61N	RP11-325B23.2_ENST00000508616.1_lincRNA	NM_001005482.1	NP_001005482.1	Q8NGV7	OR5H2_HUMAN	olfactory receptor, family 5, subfamily H, member 2	61						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(5)|lung(13)|ovary(3)|upper_aerodigestive_tract(1)	24						CCCACAACTTCACATCCCCAT	0.413																																					p.H61N		.											.	OR5H2-71	0			c.C181A						.						337.0	314.0	321.0					3																	98001912		2203	4300	6503	SO:0001583	missense	79310	exon1			CAACTTCACATCC		CCDS33801.1	3q11.2	2013-09-23			ENSG00000197938	ENSG00000197938		"""GPCR / Class A : Olfactory receptors"""	14752	protein-coding gene	gene with protein product							Standard	NM_001005482		Approved		uc003dsj.1	Q8NGV7	OTTHUMG00000160080	ENST00000355273.2:c.181C>A	3.37:g.98001912C>A	ENSP00000347418:p.His61Asn	Somatic	181	0		WXS	Illumina GAIIx	Phase_I	162	120	NM_001005482	0	0	0	0	0	Q6IF87	Missense_Mutation	SNP	ENST00000355273.2	37	CCDS33801.1	.	.	.	.	.	.	.	.	.	.	C	14.03	2.413728	0.42817	.	.	ENSG00000197938	ENST00000355273	T	0.15952	2.38	3.2	3.2	0.36748	GPCR, rhodopsin-like superfamily (1);	0.000000	0.41294	U	0.000901	T	0.38719	0.1051	M	0.84585	2.705	0.40864	D	0.983852	D	0.62365	0.991	P	0.58721	0.844	T	0.48937	-0.8990	10	0.59425	D	0.04	.	12.205	0.54346	0.0:1.0:0.0:0.0	.	61	Q8NGV7	OR5H2_HUMAN	N	61	ENSP00000347418:H61N	ENSP00000347418:H61N	H	+	1	0	OR5H2	99484602	1.000000	0.71417	0.915000	0.36163	0.030000	0.12068	5.309000	0.65774	1.787000	0.52448	0.543000	0.68304	CAC	.		0.413	OR5H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359113.2		
MYH15	22989	bcgsc.ca	37	3	108188993	108188993	+	Missense_Mutation	SNP	G	G	A	rs9868484	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr3:108188993G>A	ENST00000273353.3	-	15	1566	c.1510C>T	c.(1510-1512)Cac>Tac	p.H504Y		NM_014981.1	NP_055796.1	Q9Y2K3	MYH15_HUMAN	myosin, heavy chain 15	504	Myosin motor.		H -> Y (in dbSNP:rs9868484). {ECO:0000269|PubMed:10231032}.			cytoplasm (GO:0005737)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(3)|central_nervous_system(2)|cervix(4)|endometrium(10)|kidney(4)|large_intestine(14)|lung(47)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	105						ACAAACATGTGCCAATTGAAG	0.343													G|||	2586	0.516374	0.6876	0.572	5008	,	,		18039	0.0218		0.7406	False		,,,				2504	0.5245				p.H504Y		.											.	MYH15-73	0			c.C1510T						.	G	TYR/HIS	2494,1138		844,806,166	113.0	103.0	106.0		1510	4.4	0.0	3	dbSNP_119	106	5903,2267		2118,1667,300	yes	missense	MYH15	NM_014981.1	83	2962,2473,466	AA,AG,GG		27.7479,31.3326,28.851	possibly-damaging	504/1947	108188993	8397,3405	1816	4085	5901	SO:0001583	missense	22989	exon15			ACATGTGCCAATT	AB023217	CCDS43127.1	3q13	2011-09-27	2006-09-29		ENSG00000144821	ENSG00000144821		"""Myosins / Myosin superfamily : Class II"""	31073	protein-coding gene	gene with protein product		609929	"""myosin, heavy polypeptide 15"""			15014174, 15042088	Standard	NM_014981		Approved	KIAA1000	uc003dxa.1	Q9Y2K3	OTTHUMG00000159226	ENST00000273353.3:c.1510C>T	3.37:g.108188993G>A	ENSP00000273353:p.His504Tyr	Somatic	193	2		WXS	Illumina GAIIx	Phase_I	171	8	NM_014981	0	0	0	0	0		Missense_Mutation	SNP	ENST00000273353.3	37	CCDS43127.1	1153	0.5279304029304029	347	0.7052845528455285	228	0.6298342541436464	3	0.005244755244755245	575	0.758575197889182	G	15.59	2.878614	0.51801	0.686674	0.722521	ENSG00000144821	ENST00000273353	T	0.73363	-0.74	6.16	4.37	0.52481	Myosin head, motor domain (2);	.	.	.	.	T	0.00012	0.0000	M	0.92122	3.275	0.26714	P	0.9709055	D	0.65815	0.995	D	0.70227	0.968	T	0.46442	-0.9191	8	0.87932	D	0	.	11.7935	0.52084	0.0636:0.0:0.8124:0.1239	rs9868484;rs52823671;rs57284386;rs9868484	504	Q9Y2K3	MYH15_HUMAN	Y	504	ENSP00000273353:H504Y	ENSP00000273353:H504Y	H	-	1	0	MYH15	109671683	1.000000	0.71417	0.003000	0.11579	0.342000	0.28953	4.767000	0.62286	0.912000	0.36772	0.650000	0.86243	CAC	G|0.424;A|0.576		0.343	MYH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353935.1	XM_036988	
TMEM108	66000	ucsc.edu;bcgsc.ca;mdanderson.org	37	3	133098806	133098806	+	Missense_Mutation	SNP	C	C	T	rs34111099	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr3:133098806C>T	ENST00000321871.6	+	4	461	c.251C>T	c.(250-252)cCg>cTg	p.P84L	TMEM108_ENST00000508711.1_Intron|TMEM108_ENST00000393130.3_Missense_Mutation_p.P84L|TMEM108_ENST00000515826.1_Missense_Mutation_p.P84L	NM_001136469.1|NM_023943.2	NP_001129941.1|NP_076432.1	Q6UXF1	TM108_HUMAN	transmembrane protein 108	84	Pro-rich.		P -> L (in dbSNP:rs34111099). {ECO:0000269|PubMed:11214970, ECO:0000269|PubMed:12975309}.			integral component of membrane (GO:0016021)				endometrium(3)|kidney(1)|large_intestine(5)|lung(22)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38						ATGGCAACACCGACACCCCGT	0.627													c|||	145	0.0289537	0.0136	0.0173	5008	,	,		15503	0.0		0.0616	False		,,,				2504	0.0542				p.P84L		.											.	TMEM108-94	0			c.C251T						.		LEU/PRO,LEU/PRO	82,4324	68.7+/-106.4	2,78,2123	97.0	89.0	92.0		251,251	0.9	0.0	3	dbSNP_126	92	597,8003	157.7+/-211.4	23,551,3726	yes	missense,missense	TMEM108	NM_001136469.1,NM_023943.2	98,98	25,629,5849	TT,TC,CC		6.9419,1.8611,5.2207	benign,benign	84/576,84/576	133098806	679,12327	2203	4300	6503	SO:0001583	missense	66000	exon4			CAACACCGACACC	AL136578	CCDS33858.1, CCDS75012.1	3q22.1	2014-04-07			ENSG00000144868	ENSG00000144868			28451	protein-coding gene	gene with protein product	"""cancer/testis antigen 124"""					11214970	Standard	XM_005247726		Approved	MGC3040, CT124	uc003epi.3	Q6UXF1	OTTHUMG00000159685	ENST00000321871.6:c.251C>T	3.37:g.133098806C>T	ENSP00000324651:p.Pro84Leu	Somatic	166	0		WXS	Illumina GAIIx	Phase_I	175	128	NM_023943	0	0	0	3	3	D3DNC9|Q9BQH1|Q9BW81|Q9C0H3	Missense_Mutation	SNP	ENST00000321871.6	37	CCDS33858.1	61	0.027930402930402932	12	0.024390243902439025	4	0.011049723756906077	0	0.0	45	0.059366754617414245	c	2.305	-0.359279	0.05138	0.018611	0.069419	ENSG00000144868	ENST00000321871;ENST00000393130;ENST00000514894;ENST00000512662;ENST00000512137;ENST00000515826;ENST00000510183	T;T;T;T;T;T;T	0.46063	0.88;0.88;0.88;0.88;0.88;0.88;0.88	2.76	0.893	0.19236	.	0.467395	0.15982	N	0.235273	T	0.01189	0.0039	N	0.08118	0	0.09310	N	1	B;B	0.29862	0.259;0.007	B;B	0.20384	0.029;0.004	T	0.08269	-1.0730	10	0.52906	T	0.07	0.0198	3.2014	0.06651	0.2607:0.5932:0.0:0.1461	rs34111099	84;84	E9PB58;Q6UXF1	.;TM108_HUMAN	L	84;84;35;35;84;84;84	ENSP00000324651:P84L;ENSP00000376838:P84L;ENSP00000422072:P35L;ENSP00000427447:P35L;ENSP00000426301:P84L;ENSP00000423338:P84L;ENSP00000421486:P84L	ENSP00000324651:P84L	P	+	2	0	TMEM108	134581496	0.000000	0.05858	0.000000	0.03702	0.051000	0.14879	0.106000	0.15354	0.219000	0.20840	0.457000	0.33378	CCG	C|0.953;T|0.047		0.627	TMEM108-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356907.2	NM_023943	
DBR1	51163	broad.mit.edu	37	3	137880741	137880743	+	In_Frame_Del	DEL	TCG	TCG	-	rs376362448|rs2622736	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr3:137880741_137880743delTCG	ENST00000260803.4	-	8	1776_1778	c.1623_1625delCGA	c.(1621-1626)gacgat>gat	p.541_542DD>D	DBR1_ENST00000505015.2_In_Frame_Del_p.307_308DD>D	NM_016216.3	NP_057300.2	Q9UK59	DBR1_HUMAN	debranching RNA lariats 1	541					mRNA splicing, via spliceosome (GO:0000398)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|RNA splicing, via transesterification reactions (GO:0000375)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA lariat debranching enzyme activity (GO:0008419)			NS(1)|kidney(1)|large_intestine(4)|lung(8)|skin(1)	15						TTAAGCTGCATCGTCATCATCAT	0.394																																					p.541_542del		.											.	DBR1-90	0			c.1623_1625del						.																																			SO:0001651	inframe_deletion	51163	exon8			GCTGCATCGTCAT	AF180919	CCDS33863.1	3q22.3	2013-05-01	2013-05-01		ENSG00000138231	ENSG00000138231			15594	protein-coding gene	gene with protein product		607024	"""debranching enzyme (S. Cerevisiae) homolog 1"", ""debranching enzyme homolog 1 (S. cerevisiae)"""			10982890	Standard	NM_016216		Approved		uc003erv.3	Q9UK59	OTTHUMG00000159824	ENST00000260803.4:c.1623_1625delCGA	3.37:g.137880741_137880743delTCG	ENSP00000260803:p.Asp542del	Somatic	291	0		WXS	Illumina GAIIx	Phase_I	251	16	NM_016216	0	0	0	0	0	Q96GH0|Q9NXQ6	In_Frame_Del	DEL	ENST00000260803.4	37	CCDS33863.1																																																																																			.		0.394	DBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357585.1		
SKIL	6498	bcgsc.ca	37	3	170078232	170078232	+	Missense_Mutation	SNP	C	C	T	rs3772173	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr3:170078232C>T	ENST00000458537.3	+	1	822	c.113C>T	c.(112-114)gCa>gTa	p.A38V	SKIL_ENST00000413427.2_Missense_Mutation_p.A38V|SKIL_ENST00000259119.4_Missense_Mutation_p.A38V|SKIL_ENST00000426052.2_Missense_Mutation_p.A18V	NM_001145097.2|NM_001248008.1|NM_005414.4	NP_001138569.1|NP_001234937.1|NP_005405.2	P12757	SKIL_HUMAN	SKI-like proto-oncogene	38			A -> V (in dbSNP:rs3772173). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:2762147, ECO:0000269|PubMed:9207045}.		blastocyst formation (GO:0001825)|cell cycle arrest (GO:0007050)|gene expression (GO:0010467)|lens fiber cell differentiation (GO:0070306)|lymphocyte homeostasis (GO:0002260)|negative regulation of cell differentiation (GO:0045596)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of axonogenesis (GO:0050772)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|protein heterotrimerization (GO:0070208)|protein homotrimerization (GO:0070207)|regulation of apoptotic process (GO:0042981)|response to antibiotic (GO:0046677)|response to cytokine (GO:0034097)|response to growth factor (GO:0070848)|skeletal muscle tissue development (GO:0007519)|spermatogenesis (GO:0007283)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|protein complex binding (GO:0032403)|protein domain specific binding (GO:0019904)|SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(12)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	25	all_cancers(22;7.13e-23)|all_epithelial(15;9.95e-28)|all_lung(20;1.23e-16)|Lung NSC(18;5.15e-16)|Ovarian(172;0.000337)|Breast(254;0.137)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)			GACATTCATGCAAATGGAAAA	0.438													C|||	3457	0.690296	0.4281	0.8228	5008	,	,		19411	0.8383		0.8161	False		,,,				2504	0.6687				p.A38V		.											.	SKIL-228	0			c.C113T						.	C	VAL/ALA,VAL/ALA,VAL/ALA	2310,2096	602.2+/-389.9	608,1094,501	102.0	93.0	96.0		113,53,113	4.4	1.0	3	dbSNP_107	96	7054,1546	745.9+/-407.3	2891,1272,137	yes	missense,missense,missense	SKIL	NM_001145097.1,NM_001145098.1,NM_005414.3	64,64,64	3499,2366,638	TT,TC,CC		17.9767,47.5715,28.0025	benign,benign,benign	38/639,18/665,38/685	170078232	9364,3642	2203	4300	6503	SO:0001583	missense	6498	exon1			TTCATGCAAATGG	X15217	CCDS33890.1, CCDS46953.1, CCDS46954.1	3q26	2014-06-25	2014-06-25		ENSG00000136603	ENSG00000136603		"""SKI transcriptional corepressors"""	10897	protein-coding gene	gene with protein product		165340	"""SKI-like oncogene"""			2762147	Standard	NM_005414		Approved	SNO, SnoN, SnoA	uc003fgw.3	P12757	OTTHUMG00000158831	ENST00000458537.3:c.113C>T	3.37:g.170078232C>T	ENSP00000415243:p.Ala38Val	Somatic	262	2		WXS	Illumina GAIIx	Phase_I	210	8	NM_001248008	0	0	12	12	0	A6NGT1|B4DT50|O00464|P12756|Q07501	Missense_Mutation	SNP	ENST00000458537.3	37	CCDS33890.1	1613	0.7385531135531136	209	0.4247967479674797	297	0.8204419889502762	487	0.8513986013986014	620	0.8179419525065963	C	2.560	-0.302084	0.05495	0.524285	0.820233	ENSG00000136603	ENST00000476188;ENST00000259119;ENST00000426052;ENST00000413427;ENST00000458537	T;T;T;T;T	0.59502	0.26;0.26;0.26;0.26;0.26	5.52	4.42	0.53409	.	0.259619	0.38663	N	0.001620	T	0.00012	0.0000	N	0.04043	-0.29	0.33540	P	0.405273	B;B	0.06786	0.0;0.001	B;B	0.06405	0.002;0.002	T	0.48559	-0.9025	9	0.02654	T	1	-7.2877	4.1038	0.10026	0.0:0.683:0.0:0.317	rs3772173;rs17846573;rs17859654;rs52824578;rs58946182;rs3772173	38;38	P12757-3;P12757	.;SKIL_HUMAN	V	38;38;18;38;38	ENSP00000417670:A38V;ENSP00000259119:A38V;ENSP00000406520:A18V;ENSP00000400193:A38V;ENSP00000415243:A38V	ENSP00000259119:A38V	A	+	2	0	SKIL	171560926	1.000000	0.71417	1.000000	0.80357	0.375000	0.29983	2.137000	0.42130	2.773000	0.95371	0.585000	0.79938	GCA	C|0.286;T|0.714		0.438	SKIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352351.4	NM_005414	
TNK2	10188	hgsc.bcm.edu	37	3	195594805	195594805	+	Silent	SNP	A	A	G	rs1056749	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr3:195594805A>G	ENST00000333602.6	-	12	2936	c.2319T>C	c.(2317-2319)gcT>gcC	p.A773A	TNK2_ENST00000381916.2_Silent_p.A851A|TNK2_ENST00000428187.1_Silent_p.A805A|TNK2_ENST00000392400.1_Silent_p.A773A	NM_005781.4	NP_005772.3	Q07912	ACK1_HUMAN	tyrosine kinase, non-receptor, 2	773	EBD domain. {ECO:0000250}.|Pro-rich.			Missing (in Ref. 4; AAH08884). {ECO:0000305}.	cell surface receptor signaling pathway (GO:0007166)|endocytosis (GO:0006897)|negative regulation of catalytic activity (GO:0043086)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of clathrin-mediated endocytosis (GO:2000369)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|cell junction (GO:0030054)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|endosome (GO:0005768)|Grb2-EGFR complex (GO:0070436)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|WW domain binding (GO:0050699)			central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(11)|ovary(3)|prostate(4)|skin(2)|stomach(1)|urinary_tract(1)	29	all_cancers(143;6.48e-09)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;1.46e-22)|OV - Ovarian serous cystadenocarcinoma(49;8.3e-19)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;0.000757)	Adenosine triphosphate(DB00171)	GGGGAGGGGAAGCAGGTCCAG	0.746													a|||	593	0.118411	0.1505	0.0865	5008	,	,		11184	0.0327		0.175	False		,,,				2504	0.1278				p.A851A		.											.	TNK2-957	0			c.T2553C						.		,	451,3449		26,399,1525	5.0	7.0	6.0		2553,2319	-1.4	0.8	3	dbSNP_86	6	1067,6843		74,919,2962	no	coding-synonymous,coding-synonymous	TNK2	NM_001010938.1,NM_005781.4	,	100,1318,4487	GG,GA,AA		13.4893,11.5641,12.8535	,	851/1087,773/1039	195594805	1518,10292	1950	3955	5905	SO:0001819	synonymous_variant	10188	exon13			AGGGGAAGCAGGT	L13738	CCDS33927.1, CCDS33928.1	3q29	2013-09-02			ENSG00000061938	ENSG00000061938			19297	protein-coding gene	gene with protein product	"""activated Cdc42-associated kinase 1"""	606994				8497321, 14506255	Standard	XM_006713460		Approved	p21cdc42Hs, ACK, ACK1	uc003fvt.1	Q07912	OTTHUMG00000155737	ENST00000333602.6:c.2319T>C	3.37:g.195594805A>G		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_001010938	0	0	0	5	5	Q6ZMQ0|Q8N6U7|Q96H59	Silent	SNP	ENST00000333602.6	37	CCDS33928.1																																																																																			A|0.886;G|0.114		0.746	TNK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341437.3	NM_005781	
CRIPAK	285464	hgsc.bcm.edu	37	4	1389070	1389070	+	Silent	SNP	A	A	G	rs151096093	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr4:1389070A>G	ENST00000324803.4	+	1	3731	c.771A>G	c.(769-771)ggA>ggG	p.G257G		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	257					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			GCCGATGTGGAGTGCCCGCCT	0.697																																					p.G257G		.											.	CRIPAK-90	0			c.A771G						.						159.0	142.0	148.0					4																	1389070		2202	4299	6501	SO:0001819	synonymous_variant	285464	exon1			ATGTGGAGTGCCC	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.771A>G	4.37:g.1389070A>G		Somatic	2	0		WXS	Illumina GAIIx	Phase_I	76	27	NM_175918	0	0	2	5	3	Q8NB03	Silent	SNP	ENST00000324803.4	37	CCDS3349.1																																																																																			A|0.981;G|0.019		0.697	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
KIAA1211	57482	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	4	57181586	57181586	+	Nonsense_Mutation	SNP	C	C	T			TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr4:57181586C>T	ENST00000504228.1	+	6	2023	c.1918C>T	c.(1918-1920)Cga>Tga	p.R640*	KIAA1211_ENST00000541073.1_Nonsense_Mutation_p.R633*|KIAA1211_ENST00000264229.6_Nonsense_Mutation_p.R640*			Q6ZU35	K1211_HUMAN	KIAA1211	640										endometrium(7)|large_intestine(10)|lung(39)|ovary(2)|prostate(3)|skin(3)|stomach(1)	65	Glioma(25;0.08)|all_neural(26;0.101)					GAACCCTCCCCGAGGCCCCGG	0.682																																					p.R640X		.											.	KIAA1211-70	0			c.C1918T						.						12.0	15.0	14.0					4																	57181586		1853	4043	5896	SO:0001587	stop_gained	57482	exon8			CCTCCCCGAGGCC	AB033037	CCDS43230.1	4q12	2012-08-03			ENSG00000109265	ENSG00000109265			29219	protein-coding gene	gene with protein product						10574462, 11230166	Standard	NM_020722		Approved		uc003hbk.2	Q6ZU35	OTTHUMG00000160749	ENST00000504228.1:c.1918C>T	4.37:g.57181586C>T	ENSP00000423366:p.Arg640*	Somatic	12	0		WXS	Illumina GAIIx	Phase_I	80	42	NM_020722	0	0	0	0	0	Q9NTE2|Q9NTP8|Q9ULK9	Nonsense_Mutation	SNP	ENST00000504228.1	37	CCDS43230.1	.	.	.	.	.	.	.	.	.	.	C	35	5.545699	0.96488	.	.	ENSG00000109265	ENST00000264229;ENST00000504228;ENST00000541073;ENST00000546221	.	.	.	4.38	3.51	0.40186	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.517	7.5704	0.27904	0.401:0.4616:0.1374:0.0	.	.	.	.	X	640;640;633;550	.	ENSP00000264229:R640X	R	+	1	2	KIAA1211	56876343	0.025000	0.19082	0.024000	0.17045	0.040000	0.13550	0.708000	0.25719	0.779000	0.33543	0.561000	0.74099	CGA	.		0.682	KIAA1211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362097.2	NM_020722	
TKTL2	84076	broad.mit.edu;bcgsc.ca	37	4	164393463	164393463	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr4:164393463C>T	ENST00000280605.3	-	1	1584	c.1424G>A	c.(1423-1425)cGa>cAa	p.R475Q		NM_032136.4	NP_115512.3	Q9H0I9	TKTL2_HUMAN	transketolase-like 2	475						cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|transketolase activity (GO:0004802)	p.R475Q(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(42)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	70	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				TTGGCTGGTTCGAATGAAGCA	0.453																																					p.R475Q		.											.	TKTL2-95	1	Substitution - Missense(1)	skin(1)	c.G1424A						.						104.0	110.0	108.0					4																	164393463		2203	4300	6503	SO:0001583	missense	84076	exon1			CTGGTTCGAATGA	BC028707	CCDS3805.1	4q32.2	2009-10-06			ENSG00000151005	ENSG00000151005			25313	protein-coding gene	gene with protein product	"""similar to transketolase"""					11230166	Standard	NM_032136		Approved	FLJ32975, DKFZP434L1717	uc003iqp.4	Q9H0I9	OTTHUMG00000161527	ENST00000280605.3:c.1424G>A	4.37:g.164393463C>T	ENSP00000280605:p.Arg475Gln	Somatic	69	2		WXS	Illumina GAIIx	Phase_I	111	44	NM_032136	0	0	0	0	0	A4FVB4|Q8NCT0|Q96M82	Missense_Mutation	SNP	ENST00000280605.3	37	CCDS3805.1	.	.	.	.	.	.	.	.	.	.	C	19.25	3.792389	0.70452	.	.	ENSG00000151005	ENST00000280605	D	0.92299	-3.01	4.15	4.15	0.48705	Transketolase-like, pyrimidine-binding domain (2);	0.000000	0.64402	D	0.000001	D	0.97148	0.9068	H	0.98559	4.265	0.58432	D	0.999994	D	0.89917	1.0	D	0.75484	0.986	D	0.96569	0.9421	10	0.87932	D	0	-12.685	8.054	0.30593	0.0:0.8931:0.0:0.1069	.	475	Q9H0I9	TKTL2_HUMAN	Q	475	ENSP00000280605:R475Q	ENSP00000280605:R475Q	R	-	2	0	TKTL2	164612913	0.913000	0.31002	0.224000	0.23877	0.811000	0.45836	5.223000	0.65283	2.611000	0.88343	0.650000	0.86243	CGA	.		0.453	TKTL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365207.1	NM_032136	
KIF3A	11127	broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	132069983	132069983	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr5:132069983G>T	ENST00000378746.4	-	2	412	c.194C>A	c.(193-195)aCt>aAt	p.T65N	KIF3A_ENST00000378735.1_Missense_Mutation_p.T65N|KIF3A_ENST00000403231.1_Missense_Mutation_p.T65N	NM_007054.5	NP_008985.3	Q9Y496	KIF3A_HUMAN	kinesin family member 3A	65	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				anterior/posterior pattern specification (GO:0009952)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|determination of left/right symmetry (GO:0007368)|dorsal/ventral neural tube patterning (GO:0021904)|epidermal stem cell homeostasis (GO:0036334)|epidermis development (GO:0008544)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|inner ear receptor stereocilium organization (GO:0060122)|kidney development (GO:0001822)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|neurogenesis (GO:0022008)|organelle organization (GO:0006996)|plus-end-directed vesicle transport along microtubule (GO:0072383)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of receptor-mediated endocytosis (GO:0048260)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intraciliary transport particle (GO:0030990)|kinesin II complex (GO:0016939)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|neuron projection (GO:0043005)|photoreceptor connecting cilium (GO:0032391)|primary cilium (GO:0072372)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)|spectrin binding (GO:0030507)			endometrium(1)|kidney(4)|large_intestine(8)|lung(3)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	25		all_cancers(142;0.0751)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TCCAAAAACAGTATCAAAAGT	0.368																																					p.T65N		.											.	KIF3A-91	0			c.C194A						.						178.0	177.0	178.0					5																	132069983		2203	4300	6503	SO:0001583	missense	11127	exon2			AAAACAGTATCAA	AF041853	CCDS34235.1, CCDS75295.1, CCDS75296.1	5q31	2012-08-01			ENSG00000131437	ENSG00000131437		"""Kinesins"""	6319	protein-coding gene	gene with protein product	"""kinesin family protein 3A"""	604683				1054846	Standard	XM_005271868		Approved	FLA10, KLP-20	uc003kxo.3	Q9Y496	OTTHUMG00000059725	ENST00000378746.4:c.194C>A	5.37:g.132069983G>T	ENSP00000368020:p.Thr65Asn	Somatic	159	2		WXS	Illumina GAIIx	Phase_I	279	74	NM_007054	0	0	16	20	4	A8MSW9|Q59EN1|Q86XE9|Q9Y6V4	Missense_Mutation	SNP	ENST00000378746.4	37	CCDS34235.1	.	.	.	.	.	.	.	.	.	.	G	16.24	3.067293	0.55539	.	.	ENSG00000131437	ENST00000378746;ENST00000378735;ENST00000541316;ENST00000403231;ENST00000450914;ENST00000428744	T;T;T;T	0.74632	-0.86;-0.86;-0.86;-0.86	5.72	5.72	0.89469	Kinesin, motor domain (4);	0.000000	0.85682	D	0.000000	T	0.58278	0.2111	N	0.02286	-0.61	0.80722	D	1	B;B;B;B	0.30542	0.063;0.284;0.238;0.063	B;B;B;B	0.36885	0.235;0.018;0.079;0.009	T	0.60177	-0.7314	10	0.34782	T	0.22	.	19.8691	0.96843	0.0:0.0:1.0:0.0	.	65;65;65;65	E9PES4;B4DHG8;Q9Y496;Q2UVF2	.;.;KIF3A_HUMAN;.	N	65;65;65;65;35;64	ENSP00000368020:T65N;ENSP00000368009:T65N;ENSP00000385808:T65N;ENSP00000391863:T64N	ENSP00000368009:T65N	T	-	2	0	KIF3A	132097882	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	9.869000	0.99810	2.706000	0.92434	0.313000	0.20887	ACT	.		0.368	KIF3A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000132788.3	NM_007054	
ARL10	285598	hgsc.bcm.edu	37	5	175792605	175792605	+	Silent	SNP	G	G	C	rs2303667	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr5:175792605G>C	ENST00000310389.5	+	1	135	c.39G>C	c.(37-39)ctG>ctC	p.L13L	MIR1271_ENST00000408537.1_RNA	NM_173664.4	NP_775935.1	Q8N8L6	ARL10_HUMAN	ADP-ribosylation factor-like 10	13					small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	GTP binding (GO:0005525)			endometrium(2)|lung(1)|ovary(1)	4	all_cancers(89;0.0064)|Renal(175;0.000269)|Lung NSC(126;0.0105)|all_lung(126;0.0168)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	Kidney(146;0.0965)		TGCTGGCGCTGGGCGGCGCCG	0.756													G|||	2787	0.55651	0.5938	0.4928	5008	,	,		9772	0.5556		0.6093	False		,,,				2504	0.498				p.L13L		.											.	ARL10-91	0			c.G39C						.	G		1858,1528		603,652,438	3.0	4.0	3.0		39	3.2	0.8	5	dbSNP_100	3	4085,2705		1416,1253,726	no	coding-synonymous	ARL10	NM_173664.4		2019,1905,1164	CC,CG,GG		39.838,45.127,41.5979		13/245	175792605	5943,4233	1693	3395	5088	SO:0001819	synonymous_variant	285598	exon1			GGCGCTGGGCGGC	BK001673	CCDS4400.1	5q35.3	2014-05-09	2005-11-03	2005-11-03	ENSG00000175414	ENSG00000175414		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	22042	protein-coding gene	gene with protein product			"""ADP-ribosylation factor-like 10A"""	ARL10A			Standard	NM_173664		Approved		uc003mec.1	Q8N8L6	OTTHUMG00000130655	ENST00000310389.5:c.39G>C	5.37:g.175792605G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	4	NM_173664	0	0	0	0	0		Silent	SNP	ENST00000310389.5	37	CCDS4400.1																																																																																			G|0.585;C|0.415		0.756	ARL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253145.2	NM_173664	
ZNF879	345462	broad.mit.edu;bcgsc.ca	37	5	178459426	178459426	+	Missense_Mutation	SNP	A	A	C	rs17078991	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr5:178459426A>C	ENST00000444149.2	+	5	665	c.477A>C	c.(475-477)gaA>gaC	p.E159D		NM_001136116.1	NP_001129588.1	B4DU55	ZN879_HUMAN	zinc finger protein 879	159					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E159D(1)		endometrium(3)|kidney(2)|pancreas(1)|stomach(1)	7						AAGGTGTTGAATTTGGGAAAA	0.373													A|||	1824	0.364217	0.5182	0.255	5008	,	,		19198	0.4276		0.2237	False		,,,				2504	0.3129				p.E159D		.											.	ZNF879-47	1	Substitution - Missense(1)	stomach(1)	c.A477C						.	A	ASP/GLU	618,766		138,342,212	91.0	77.0	81.0		477	-1.2	0.3	5	dbSNP_123	81	706,2476		75,556,960	yes	missense	ZNF879	NM_001136116.1	45	213,898,1172	CC,CA,AA		22.1873,44.6532,28.9969	benign	159/564	178459426	1324,3242	692	1591	2283	SO:0001583	missense	345462	exon5			TGTTGAATTTGGG	AK300504	CCDS47352.1	5q35.3	2013-01-08			ENSG00000234284	ENSG00000234284		"""Zinc fingers, C2H2-type"", ""-"""	37273	protein-coding gene	gene with protein product							Standard	NM_001136116		Approved	DKFZp686E2433	uc003mjt.4	B4DU55	OTTHUMG00000163596	ENST00000444149.2:c.477A>C	5.37:g.178459426A>C	ENSP00000414887:p.Glu159Asp	Somatic	116	0		WXS	Illumina GAIIx	Phase_I	161	7	NM_001136116	0	0	1	1	0		Missense_Mutation	SNP	ENST00000444149.2	37	CCDS47352.1	770	0.3525641025641026	243	0.49390243902439024	100	0.27624309392265195	244	0.42657342657342656	183	0.24142480211081793	A	9.372	1.070780	0.20147	0.446532	0.221873	ENSG00000234284	ENST00000444149	T	0.06933	3.24	4.45	-1.18	0.09617	.	.	.	.	.	T	0.00012	0.0000	L	0.37850	1.14	0.34582	P	0.28547900000000004	B	0.02656	0.0	B	0.04013	0.001	T	0.42120	-0.9470	8	0.42905	T	0.14	-4.0842	4.6168	0.12430	0.4554:0.3309:0.2137:0.0	rs17078991;rs52798739;rs17078991	159	B4DU55	ZN879_HUMAN	D	159	ENSP00000414887:E159D	ENSP00000414887:E159D	E	+	3	2	ZNF879	178392032	0.000000	0.05858	0.286000	0.24833	0.782000	0.44232	-0.068000	0.11561	-0.283000	0.09115	0.482000	0.46254	GAA	A|0.634;C|0.365		0.373	ZNF879-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374447.1	NM_001136116	
PPP1R3G	648791	hgsc.bcm.edu	37	6	5086070	5086070	+	Silent	SNP	A	A	G	rs667752		TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr6:5086070A>G	ENST00000405617.2	+	1	351	c.351A>G	c.(349-351)gcA>gcG	p.A117A		NM_001145115.1	NP_001138587.1	B7ZBB8	PP13G_HUMAN	protein phosphatase 1, regulatory subunit 3G	117					glucose homeostasis (GO:0042593)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of glycogen biosynthetic process (GO:0045725)	cytoplasm (GO:0005737)	glycogen binding (GO:2001069)			kidney(2)	2						CGGAGGACGCACAGCTCGGCC	0.692													G|||	5008	1.0	1.0	1.0	5008	,	,		12505	1.0		1.0	False		,,,				2504	1.0				p.A117A		.											.	PPP1R3G-136	0			c.A351G						.						1.0	2.0	2.0					6																	5086070		400	1062	1462	SO:0001819	synonymous_variant	648791	exon1			GGACGCACAGCTC		CCDS47366.1	6p25.1	2012-04-17	2011-10-04		ENSG00000219607	ENSG00000219607		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14945	protein-coding gene	gene with protein product			"""protein phosphatase 1, regulatory (inhibitor) subunit 3G"""			11948623	Standard	NM_001145115		Approved		uc011dia.1	B7ZBB8	OTTHUMG00000014172	ENST00000405617.2:c.351A>G	6.37:g.5086070A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_001145115	0	0	0	4	4		Silent	SNP	ENST00000405617.2	37	CCDS47366.1																																																																																			A|0.006;G|0.994		0.692	PPP1R3G-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039740.3	NM_001145115	
VARS	7407	hgsc.bcm.edu	37	6	31762843	31762843	+	Missense_Mutation	SNP	G	G	C	rs2607015|rs67600122	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr6:31762843G>C	ENST00000375663.3	-	2	592	c.152C>G	c.(151-153)cCc>cGc	p.P51R	LSM2_ENST00000491421.1_5'Flank|VARS_ENST00000444930.2_Intron	NM_006295.2	NP_006286.1	P26640	SYVC_HUMAN	valyl-tRNA synthetase	51			P -> R (in dbSNP:rs2607015).|P -> T (in dbSNP:rs2753960).	P -> S (in Ref. 1; CAA41990 and 7; AAH12808). {ECO:0000305}.	gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)|valyl-tRNA aminoacylation (GO:0006438)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|valine-tRNA ligase activity (GO:0004832)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(18)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	30					L-Valine(DB00161)	TGGGGGAAAGGGAGTCCTGCT	0.736													G|||	1751	0.349641	0.1793	0.4179	5008	,	,		11928	0.3859		0.4414	False		,,,				2504	0.3998				p.P51R		.											.	VARS-93	0			c.C152G						.						5.0	7.0	6.0					6																	31762843		1176	2213	3389	SO:0001583	missense	7407	exon2			GGAAAGGGAGTCC	BC012808	CCDS34412.1	6p21.3	2011-07-01		2005-07-05	ENSG00000204394	ENSG00000204394	6.1.1.9	"""Aminoacyl tRNA synthetases / Class I"""	12651	protein-coding gene	gene with protein product	"""valine tRNA ligase 1, cytoplasmic"""	192150	"""valyl-tRNA synthetase 2"""	VARS2		15779907	Standard	XM_005249362		Approved		uc003nxe.3	P26640	OTTHUMG00000031286	ENST00000375663.3:c.152C>G	6.37:g.31762843G>C	ENSP00000364815:p.Pro51Arg	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	8	4	NM_006295	0	0	4	4	0	B0V1N1|B4DZ61|Q5JQ90|Q96E77|Q9UQM2	Missense_Mutation	SNP	ENST00000375663.3	37	CCDS34412.1	804	0.36813186813186816	87	0.17682926829268292	155	0.4281767955801105	245	0.42832167832167833	317	0.4182058047493404	G	14.13	2.444414	0.43429	.	.	ENSG00000204394	ENST00000375663;ENST00000440048	T;T	0.28666	3.72;1.6	5.09	3.1	0.35709	Glutathione S-transferase, N-terminal (1);	0.568214	0.16703	N	0.203053	T	0.07234	0.0183	N	0.08118	0	0.39930	P	0.025724999999999998	B	0.06786	0.001	B	0.10450	0.005	T	0.14420	-1.0473	9	0.37606	T	0.19	-18.6403	11.4885	0.50367	0.0:0.2797:0.7203:0.0	rs2607015;rs57764692;rs2607015	51	P26640	SYVC_HUMAN	R	51	ENSP00000364815:P51R;ENSP00000413925:P51R	ENSP00000364815:P51R	P	-	2	0	VARS	31870822	0.993000	0.37304	0.186000	0.23195	0.994000	0.84299	3.479000	0.53165	2.391000	0.81399	0.462000	0.41574	CCC	CT|0.500;GG|0.500		0.736	VARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076619.2	NM_006295	
C6orf222	389384	broad.mit.edu;bcgsc.ca	37	6	36298316	36298316	+	Missense_Mutation	SNP	G	G	A	rs74561471	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr6:36298316G>A	ENST00000437635.2	-	2	329	c.152C>T	c.(151-153)aCg>aTg	p.T51M		NM_001010903.4	NP_001010903.3	P0C671	CF222_HUMAN	chromosome 6 open reading frame 222	51										breast(4)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|skin(4)|urinary_tract(4)	26						ATCACTGGTCGTCCAGTGAAG	0.647													G|||	5	0.000998403	0.0	0.0	5008	,	,		14758	0.0		0.004	False		,,,				2504	0.001				p.T51M		.											.	C6orf222-93	0			c.C152T						.	G	MET/THR	2,4404	4.2+/-10.8	0,2,2201	49.0	53.0	52.0		152	2.5	0.0	6	dbSNP_132	52	25,8575	16.0+/-53.3	1,23,4276	yes	missense	C6orf222	NM_001010903.4	81	1,25,6477	AA,AG,GG		0.2907,0.0454,0.2076	probably-damaging	51/653	36298316	27,12979	2203	4300	6503	SO:0001583	missense	389384	exon2			CTGGTCGTCCAGT		CCDS34439.1	6p21.31	2012-02-22			ENSG00000189325	ENSG00000189325			33769	protein-coding gene	gene with protein product							Standard	NM_001010903		Approved	DKFZp779B1540	uc003oly.3	P0C671	OTTHUMG00000014591	ENST00000437635.2:c.152C>T	6.37:g.36298316G>A	ENSP00000418983:p.Thr51Met	Somatic	35	0		WXS	Illumina GAIIx	Phase_I	88	6	NM_001010903	0	0	0	0	0	B2RTY8	Missense_Mutation	SNP	ENST00000437635.2	37	CCDS34439.1	3	0.0013736263736263737	0	0.0	0	0.0	0	0.0	3	0.00395778364116095	G	9.448	1.089741	0.20390	4.54E-4	0.002907	ENSG00000189325	ENST00000437635	T	0.51325	0.71	4.33	2.5	0.30297	.	0.499782	0.17010	N	0.190555	T	0.21509	0.0518	L	0.36672	1.1	0.09310	N	1	D	0.57571	0.98	P	0.46585	0.521	T	0.04427	-1.0952	10	0.54805	T	0.06	-16.5245	5.9727	0.19361	0.1097:0.2233:0.667:0.0	.	51	P0C671	CF222_HUMAN	M	51	ENSP00000418983:T51M	ENSP00000418983:T51M	T	-	2	0	C6orf222	36406294	0.005000	0.15991	0.000000	0.03702	0.034000	0.12701	1.656000	0.37355	0.365000	0.24400	0.471000	0.43371	ACG	G|0.998;A|0.002		0.647	C6orf222-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040338.2	NM_001010903	
KCNK17	89822	hgsc.bcm.edu	37	6	39282036	39282036	+	Missense_Mutation	SNP	T	T	C	rs10947804	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr6:39282036T>C	ENST00000373231.4	-	1	293	c.61A>G	c.(61-63)Agc>Ggc	p.S21G	KCNK17_ENST00000453413.2_Missense_Mutation_p.S21G	NM_031460.3	NP_113648.2	Q96T54	KCNKH_HUMAN	potassium channel, subfamily K, member 17	21			S -> G (in dbSNP:rs10947804). {ECO:0000269|PubMed:11248242, ECO:0000269|PubMed:15489334}.		potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(2)	14						AGCACGGTGCTGGGCACCGCG	0.761													T|||	2917	0.582468	0.8858	0.4553	5008	,	,		12417	0.4673		0.4851	False		,,,				2504	0.4816				p.S21G		.											.	KCNK17-227	0			c.A61G						.	T	GLY/SER,GLY/SER	3100,536		1364,372,82	3.0	4.0	3.0		61,61	2.1	0.0	6	dbSNP_120	3	4061,3263		1251,1559,852	yes	missense,missense	KCNK17	NM_001135111.1,NM_031460.3	56,56	2615,1931,934	CC,CT,TT		44.5522,14.7415,34.6624	benign,benign	21/272,21/333	39282036	7161,3799	1818	3662	5480	SO:0001583	missense	89822	exon1			CGGTGCTGGGCAC	AF358910	CCDS4842.1, CCDS47419.1	6p21	2012-03-07			ENSG00000124780	ENSG00000124780		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	14465	protein-coding gene	gene with protein product		607370				16382106	Standard	NM_031460		Approved	K2p17.1, TALK-2, TALK2, TASK4, TASK-4	uc003ooo.3	Q96T54	OTTHUMG00000014646	ENST00000373231.4:c.61A>G	6.37:g.39282036T>C	ENSP00000362328:p.Ser21Gly	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	21	21	NM_001135111	0	0	0	0	0	E9PB46|Q5TCF4|Q8TAW4|Q9BXD1|Q9H592	Missense_Mutation	SNP	ENST00000373231.4	37	CCDS4842.1	1214	0.5558608058608059	431	0.8760162601626016	173	0.47790055248618785	244	0.42657342657342656	366	0.48284960422163586	T	8.033	0.762256	0.15914	0.852585	0.554478	ENSG00000124780	ENST00000373231;ENST00000453413	T;T	0.56776	0.44;0.44	4.06	2.09	0.27110	.	1.425750	0.04586	N	0.395947	T	0.14184	0.0343	N	0.17082	0.46	0.80722	P	0.0	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	T	0.09122	-1.0689	9	0.21014	T	0.42	.	5.3388	0.15973	0.0:0.5516:0.0:0.4484	rs10947804;rs17845776;rs17858736;rs60349641	21;21	E9PB46;Q96T54	.;KCNKH_HUMAN	G	21	ENSP00000362328:S21G;ENSP00000401271:S21G	ENSP00000362328:S21G	S	-	1	0	KCNK17	39390014	0.000000	0.05858	0.003000	0.11579	0.032000	0.12392	-0.229000	0.09098	0.383000	0.24910	0.459000	0.35465	AGC	T|0.441;C|0.559		0.761	KCNK17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040453.2	NM_031460	
PEX6	5190	hgsc.bcm.edu	37	6	42946490	42946490	+	Silent	SNP	C	C	A	rs9462858	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr6:42946490C>A	ENST00000304611.8	-	1	468	c.399G>T	c.(397-399)gtG>gtT	p.V133V	PEX6_ENST00000244546.4_Silent_p.V133V	NM_000287.3	NP_000278.3	Q13608	PEX6_HUMAN	peroxisomal biogenesis factor 6	133					ATP catabolic process (GO:0006200)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix, translocation (GO:0016561)|protein stabilization (GO:0050821)|protein targeting to peroxisome (GO:0006625)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)			NS(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(3)	15			all cancers(41;0.00235)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.0562)			GCGGTCCGGGCACTGGGAGGG	0.746													C|||	1662	0.331869	0.3691	0.3516	5008	,	,		10923	0.1002		0.4612	False		,,,				2504	0.3732				p.V133V		.											.	PEX6-91	0			c.G399T						.	C		1002,2080		214,574,753	2.0	3.0	3.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	399	2.1	0.9	6	dbSNP_119	3	2653,4001		636,1381,1310	no	coding-synonymous	PEX6	NM_000287.3		850,1955,2063	AA,AC,CC		39.8708,32.5114,37.5411		133/981	42946490	3655,6081	1541	3327	4868	SO:0001819	synonymous_variant	5190	exon1			TCCGGGCACTGGG	U56602	CCDS4877.1	6p22-p11	2010-04-21			ENSG00000124587	ENSG00000124587		"""ATPases / AAA-type"""	8859	protein-coding gene	gene with protein product		601498				8670792	Standard	NM_000287		Approved	PXAAA1, PAF-2	uc003otf.3	Q13608	OTTHUMG00000014713	ENST00000304611.8:c.399G>T	6.37:g.42946490C>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_000287	0	0	0	19	19	Q5T8W1|Q8WYQ0|Q8WYQ1|Q8WYQ2|Q99476	Silent	SNP	ENST00000304611.8	37	CCDS4877.1																																																																																			C|0.673;A|0.327		0.746	PEX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040569.1	NM_000287	
NDUFAF4	29078	bcgsc.ca	37	6	97339126	97339126	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr6:97339126G>T	ENST00000316149.7	-	3	461	c.382C>A	c.(382-384)Ctt>Att	p.L128I	NDUFAF4_ENST00000489477.1_5'UTR	NM_014165.3	NP_054884.1	Q9P032	NDUF4_HUMAN	NADH dehydrogenase (ubiquinone) complex I, assembly factor 4	128					mitochondrial respiratory chain complex I assembly (GO:0032981)	mitochondrial membrane (GO:0031966)|mitochondrion (GO:0005739)				large_intestine(5)|lung(3)|ovary(1)|skin(1)	10						TCTGGGAAAAGCTTATGATTA	0.328																																					p.L128I		.											.	NDUFAF4-91	0			c.C382A						.						68.0	70.0	69.0					6																	97339126		2202	4300	6502	SO:0001583	missense	29078	exon3			GGAAAAGCTTATG	AF161474	CCDS5037.1	6q16.3	2012-10-12	2012-05-08	2009-03-18	ENSG00000123545	ENSG00000123545		"""Mitochondrial respiratory chain complex assembly factors"""	21034	protein-coding gene	gene with protein product		611776	"""chromosome 6 open reading frame 66"", ""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 4"""	C6orf66		11042152, 18179882	Standard	NM_014165		Approved	HSPC125, bA22L21.1, My013, HRPAP20	uc003pow.3	Q9P032	OTTHUMG00000015246	ENST00000316149.7:c.382C>A	6.37:g.97339126G>T	ENSP00000358272:p.Leu128Ile	Somatic	43	0		WXS	Illumina GAIIx	Phase_I	57	5	NM_014165	0	0	146	146	0	B2R4J5	Missense_Mutation	SNP	ENST00000316149.7	37	CCDS5037.1	.	.	.	.	.	.	.	.	.	.	G	14.91	2.676851	0.47886	.	.	ENSG00000123545	ENST00000316149	D	0.82711	-1.64	5.27	5.27	0.74061	.	0.324362	0.33938	N	0.004405	T	0.76593	0.4009	M	0.76170	2.325	0.33081	D	0.536685	P	0.40000	0.698	B	0.38616	0.277	T	0.81172	-0.1054	10	0.54805	T	0.06	-13.2794	13.8314	0.63382	0.0:0.0:0.8472:0.1528	.	128	Q9P032	NDUF4_HUMAN	I	128	ENSP00000358272:L128I	ENSP00000358272:L128I	L	-	1	0	NDUFAF4	97445847	1.000000	0.71417	1.000000	0.80357	0.696000	0.40369	4.092000	0.57707	2.465000	0.83290	0.655000	0.94253	CTT	.		0.328	NDUFAF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041567.1	NM_014165	
TFB1M	51106	bcgsc.ca	37	6	155606325	155606325	+	Silent	SNP	C	C	T	rs324356	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr6:155606325C>T	ENST00000367166.4	-	5	688	c.633G>A	c.(631-633)acG>acA	p.T211T		NM_016020.3	NP_057104.2	Q8WVM0	TFB1M_HUMAN	transcription factor B1, mitochondrial	211			T -> A. {ECO:0000269|PubMed:19096125}.		regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	mitochondrial nucleoid (GO:0042645)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|rRNA (adenine-N6,N6-)-dimethyltransferase activity (GO:0000179)			lung(11)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;1.48e-12)|BRCA - Breast invasive adenocarcinoma(81;0.0131)		GTCCTGGAATCGTAAAGATGT	0.448													T|||	3365	0.671925	0.6846	0.7104	5008	,	,		22209	0.8333		0.5328	False		,,,				2504	0.6043				p.T211T		.											.	TFB1M-91	0			c.G633A						.	T		2894,1512	481.9+/-359.3	941,1012,250	145.0	127.0	133.0		633	-11.8	0.0	6	dbSNP_79	133	4269,4331	579.6+/-390.9	1072,2125,1103	no	coding-synonymous	TFB1M	NM_016020.3		2013,3137,1353	TT,TC,CC		49.6395,34.3168,44.9254		211/347	155606325	7163,5843	2203	4300	6503	SO:0001819	synonymous_variant	51106	exon5			TGGAATCGTAAAG	AF151833	CCDS5248.1	6q25.1-q25.3	2011-01-28			ENSG00000029639	ENSG00000029639			17037	protein-coding gene	gene with protein product	"""dimethyladenosine transferase 1, mitochondrial"""	607033				10810093, 11809803	Standard	NM_016020		Approved	mtTFB, CGI-75	uc003qqj.4	Q8WVM0	OTTHUMG00000015881	ENST00000367166.4:c.633G>A	6.37:g.155606325C>T		Somatic	148	1		WXS	Illumina GAIIx	Phase_I	296	8	NM_016020	0	0	30	30	0	Q05DR0|Q9Y384	Silent	SNP	ENST00000367166.4	37	CCDS5248.1																																																																																			C|0.338;T|0.662		0.448	TFB1M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042809.1		
PRPS1L1	221823	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	18066907	18066907	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr7:18066907T>A	ENST00000506618.2	-	1	579	c.499A>T	c.(499-501)Att>Ttt	p.I167F		NM_175886.2	NP_787082	P21108	PRPS3_HUMAN	phosphoribosyl pyrophosphate synthetase 1-like 1	167					5-phosphoribose 1-diphosphate biosynthetic process (GO:0006015)|nucleotide biosynthetic process (GO:0009165)|ribonucleoside monophosphate biosynthetic process (GO:0009156)		ATP binding (GO:0005524)|kinase activity (GO:0016301)|magnesium ion binding (GO:0000287)|protein homodimerization activity (GO:0042803)|ribose phosphate diphosphokinase activity (GO:0004749)			endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(3)	18	Lung NSC(10;0.0385)|all_lung(11;0.0736)					GGCGAGACAATAATGCAGTTC	0.443																																					p.I167F		.											.	PRPS1L1-1	0			c.A499T						.						99.0	96.0	97.0					7																	18066907		2199	4300	6499	SO:0001583	missense	221823	exon1			AGACAATAATGCA	M57423	CCDS47552.1	7p21.1	2010-12-10			ENSG00000229937	ENSG00000229937			9463	protein-coding gene	gene with protein product		611566		PRPSL		2168892	Standard	NM_175886		Approved	PRPS3	uc003stz.3	P21108	OTTHUMG00000152742	ENST00000506618.2:c.499A>T	7.37:g.18066907T>A	ENSP00000424595:p.Ile167Phe	Somatic	166	1		WXS	Illumina GAIIx	Phase_I	260	86	NM_175886	0	0	0	0	0	Q6P5P6	Missense_Mutation	SNP	ENST00000506618.2	37	CCDS47552.1	.	.	.	.	.	.	.	.	.	.	T	15.32	2.799748	0.50208	.	.	ENSG00000229937	ENST00000506618	D	0.92805	-3.11	4.62	-4.66	0.03329	Phosphoribosyltransferase (1);	.	.	.	.	D	0.94820	0.8327	M	0.89214	3.015	.	.	.	B	0.33755	0.424	P	0.49683	0.619	D	0.94343	0.7572	8	0.87932	D	0	.	13.1332	0.59395	0.0:0.5724:0.0:0.4276	.	167	P21108	PRPS3_HUMAN	F	167	ENSP00000424595:I167F	ENSP00000424595:I167F	I	-	1	0	PRPS1L1	18033432	0.502000	0.26107	0.000000	0.03702	0.755000	0.42902	0.789000	0.26886	-0.784000	0.04528	0.528000	0.53228	ATT	.		0.443	PRPS1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327667.1	NM_175886	
SP8	221833	hgsc.bcm.edu	37	7	20824941	20824943	+	In_Frame_Del	DEL	GCC	GCC	-	rs372591893	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	GCC	GCC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr7:20824941_20824943delGCC	ENST00000361443.4	-	3	676_678	c.439_441delGGC	c.(439-441)ggcdel	p.G147del	SP8_ENST00000418710.2_In_Frame_Del_p.G165del	NM_198956.2	NP_945194.1	Q8IXZ3	SP8_HUMAN	Sp8 transcription factor	147					dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|proximal/distal pattern formation (GO:0009954)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G165delG(1)|p.G147delG(1)		NS(1)|central_nervous_system(1)|large_intestine(2)|lung(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	8						GCGCGGAGGAgccgccgccgccg	0.729														461	0.0920527	0.0098	0.1124	5008	,	,		5525	0.002		0.2664	False		,,,				2504	0.1022				p.165_165del		.											.	SP8-91	2	Deletion - In frame(2)	central_nervous_system(2)	c.493_495del						.		,	50,654		19,12,321					,	0.5	0.3			2	602,1424		217,168,628	no	coding,coding	SP8	NM_198956.2,NM_182700.4	,	236,180,949	A1A1,A1R,RR		29.7137,7.1023,23.8828	,	,		652,2078				SO:0001651	inframe_deletion	221833	exon2			GGAGGAGCCGCCG		CCDS5372.1, CCDS43555.1	7p21.2	2013-01-08			ENSG00000164651	ENSG00000164651		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	19196	protein-coding gene	gene with protein product		608306					Standard	NM_182700		Approved		uc003suz.3	Q8IXZ3	OTTHUMG00000094788	ENST00000361443.4:c.439_441delGGC	7.37:g.20824950_20824952delGCC	ENSP00000354482:p.Gly147del	Somatic	7	0		WXS	Illumina GAIIx	Phase_I	43	12	NM_182700	0	0	0	0	0	Q7Z615|Q7Z616|Q96MJ1	In_Frame_Del	DEL	ENST00000361443.4	37	CCDS5372.1																																																																																			.		0.729	SP8-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326904.2		
NPC1L1	29881	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	44560705	44560705	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr7:44560705C>G	ENST00000289547.4	-	13	3021	c.2966G>C	c.(2965-2967)tGc>tCc	p.C989S	NPC1L1_ENST00000546276.1_Missense_Mutation_p.C943S|NPC1L1_ENST00000381160.3_Missense_Mutation_p.C989S	NM_013389.2	NP_037521.2	Q9UHC9	NPCL1_HUMAN	NPC1-like 1	989					cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intestinal cholesterol absorption (GO:0030299)|lipoprotein metabolic process (GO:0042157)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)	brush border membrane (GO:0031526)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|hedgehog receptor activity (GO:0008158)|myosin V binding (GO:0031489)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|large_intestine(7)|lung(27)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	57					Ezetimibe(DB00973)	GTTCTTTAGGCAGTTCAGAGA	0.567																																					p.C989S		.											.	NPC1L1-94	0			c.G2966C						.						113.0	110.0	111.0					7																	44560705		2203	4300	6503	SO:0001583	missense	29881	exon13			TTTAGGCAGTTCA		CCDS5491.1, CCDS43575.1, CCDS75587.1	7p13	2012-11-15	2012-11-15		ENSG00000015520	ENSG00000015520			7898	protein-coding gene	gene with protein product		608010	"""NPC1 (Niemann-Pick disease, type C1, gene)-like 1"""			10783261	Standard	NM_013389		Approved		uc003tlb.3	Q9UHC9	OTTHUMG00000023691	ENST00000289547.4:c.2966G>C	7.37:g.44560705C>G	ENSP00000289547:p.Cys989Ser	Somatic	71	0		WXS	Illumina GAIIx	Phase_I	121	51	NM_001101648	0	0	1	1	0	A4D2J7|B7ZLE6|D3DVK9|Q17RV5|Q6R3Q4|Q9UHC8	Missense_Mutation	SNP	ENST00000289547.4	37	CCDS5491.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.981390	0.74474	.	.	ENSG00000015520	ENST00000289547;ENST00000381160;ENST00000546276	D;D;D	0.94417	-3.29;-3.32;-3.42	5.26	5.26	0.73747	.	4.384240	0.01495	N	0.017265	D	0.98466	0.9489	M	0.94101	3.495	0.58432	D	0.999997	B;D;D	0.89917	0.324;1.0;0.995	B;D;P	0.85130	0.123;0.997;0.858	D	0.91568	0.5269	10	0.46703	T	0.11	-31.617	16.3366	0.83064	0.0:1.0:0.0:0.0	.	943;989;989	B7ZLE6;Q17RV5;D3DVK9	.;.;.	S	989;989;943	ENSP00000289547:C989S;ENSP00000370552:C989S;ENSP00000438033:C943S	ENSP00000289547:C989S	C	-	2	0	NPC1L1	44527230	0.998000	0.40836	0.565000	0.28409	0.691000	0.40173	4.545000	0.60698	2.476000	0.83614	0.585000	0.79938	TGC	.		0.567	NPC1L1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251256.1	NM_013389	
C7orf72	100130988	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	50136067	50136067	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr7:50136067C>T	ENST00000297001.6	+	1	436	c.386C>T	c.(385-387)aCc>aTc	p.T129I		NM_001161834.2	NP_001155306	A4D263	CG072_HUMAN	chromosome 7 open reading frame 72	129										NS(1)|breast(1)|endometrium(2)|kidney(1)|lung(1)|ovary(1)|prostate(2)	9						ACCATACCAACCCTAGTGGAT	0.423																																					p.T129I		.											.	C7orf72-23	0			c.C386T						.						99.0	77.0	84.0					7																	50136067		692	1591	2283	SO:0001583	missense	100130988	exon1			TACCAACCCTAGT		CCDS47585.1	7p12.2	2009-10-15			ENSG00000164500	ENSG00000164500			22564	protein-coding gene	gene with protein product							Standard	NM_001161834		Approved		uc011kcj.2	A4D263	OTTHUMG00000155883	ENST00000297001.6:c.386C>T	7.37:g.50136067C>T	ENSP00000297001:p.Thr129Ile	Somatic	117	0		WXS	Illumina GAIIx	Phase_I	194	98	NM_001161834	0	0	0	0	0	A6NDX9	Missense_Mutation	SNP	ENST00000297001.6	37	CCDS47585.1	.	.	.	.	.	.	.	.	.	.	C	10.98	1.503778	0.26949	.	.	ENSG00000164500	ENST00000297001	.	.	.	5.39	-3.86	0.04230	.	.	.	.	.	T	0.18173	0.0436	N	0.14661	0.345	0.20074	N	0.999935	B	0.29716	0.255	B	0.32465	0.146	T	0.32903	-0.9889	7	.	.	.	-38.8493	7.5173	0.27608	0.3723:0.4486:0.1791:0.0	.	129	A4D263	CG072_HUMAN	I	129	.	.	T	+	2	0	C7orf72	50106613	0.123000	0.22298	0.145000	0.22337	0.584000	0.36387	0.121000	0.15667	-0.439000	0.07222	-0.479000	0.04858	ACC	.		0.423	C7orf72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342124.1	NM_001161834	
AKAP9	10142	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	91646396	91646396	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr7:91646396C>A	ENST00000359028.2	+	13	4078	c.3853C>A	c.(3853-3855)Ctt>Att	p.L1285I	AKAP9_ENST00000356239.3_Missense_Mutation_p.L1273I|AKAP9_ENST00000358100.2_Missense_Mutation_p.L1285I			Q99996	AKAP9_HUMAN	A kinase (PRKA) anchor protein 9	1285					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)|transport (GO:0006810)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|pericentriolar material (GO:0000242)|voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)			NS(1)|autonomic_ganglia(2)|breast(14)|central_nervous_system(3)|cervix(1)|endometrium(13)|kidney(12)|large_intestine(35)|lung(49)|ovary(8)|prostate(6)|skin(8)|stomach(1)|urinary_tract(2)	155	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			ACTCTTGGTACTTCAAACACG	0.313			T	BRAF	papillary thyroid																																p.L1273I		.		Dom	yes		7	7q21-q22	10142	A kinase (PRKA) anchor protein (yotiao) 9		E	.	AKAP9-755	0			c.C3817A						.						80.0	72.0	75.0					7																	91646396		2200	4295	6495	SO:0001583	missense	10142	exon12			TTGGTACTTCAAA	AF091711	CCDS5622.1	7q21-q22	2014-09-17	2013-09-25		ENSG00000127914	ENSG00000127914		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	379	protein-coding gene	gene with protein product	"""A-kinase anchoring protein 450"", ""AKAP9-BRAF fusion protein"", ""AKAP120-like protein"", ""centrosome- and golgi-localized protein kinase N-associated protein"", ""protein kinase A anchoring protein 9"", ""A-kinase anchor protein, 350kDa"", ""protein phosphatase 1, regulatory subunit 45"", ""yotiao"""	604001				9482789, 10390370, 24475373	Standard	NM_147185		Approved	KIAA0803, AKAP350, AKAP450, CG-NAP, YOTIAO, HYPERION, PRKA9, MU-RMS-40.16A, PPP1R45, LQT11	uc003ulg.3	Q99996	OTTHUMG00000131127	ENST00000359028.2:c.3853C>A	7.37:g.91646396C>A	ENSP00000351922:p.Leu1285Ile	Somatic	155	0		WXS	Illumina GAIIx	Phase_I	237	78	NM_005751	0	0	4	8	4	A4D1F0|A4D1F2|A4D1F4|O14869|O43355|O94895|Q75N20|Q9UQH3|Q9UQQ4|Q9Y6B8|Q9Y6Y2	Missense_Mutation	SNP	ENST00000359028.2	37		.	.	.	.	.	.	.	.	.	.	C	13.04	2.117011	0.37339	.	.	ENSG00000127914	ENST00000356239;ENST00000359028;ENST00000358100;ENST00000413120;ENST00000394565	T;T;T	0.06371	3.34;3.34;3.31	4.25	4.25	0.50352	.	0.000000	0.33401	N	0.004946	T	0.22244	0.0536	M	0.69823	2.125	0.40165	D	0.977119	D;D;D;P	0.67145	0.99;0.99;0.996;0.705	P;P;D;B	0.75484	0.761;0.795;0.986;0.249	T	0.00697	-1.1605	10	0.45353	T	0.12	.	13.8381	0.63421	0.0:1.0:0.0:0.0	.	1285;1273;1273;1285	Q99996;Q99996-2;Q99996-3;A4D1E4	AKAP9_HUMAN;.;.;.	I	1273;1285;1285;1285;1285	ENSP00000348573:L1273I;ENSP00000351922:L1285I;ENSP00000350813:L1285I	ENSP00000348573:L1273I	L	+	1	0	AKAP9	91484332	0.999000	0.42202	0.654000	0.29608	0.424000	0.31475	3.994000	0.56994	2.352000	0.79861	0.655000	0.94253	CTT	.		0.313	AKAP9-202	KNOWN	basic	protein_coding	protein_coding		NM_005751	
GPR37	2861	bcgsc.ca	37	7	124386757	124386757	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr7:124386757G>A	ENST00000303921.2	-	2	2314	c.1664C>T	c.(1663-1665)cCc>cTc	p.P555L		NM_005302.3	NP_005293.1	O15354	GPR37_HUMAN	G protein-coupled receptor 37 (endothelin receptor type B-like)	555					dopamine biosynthetic process (GO:0042416)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotion involved in locomotory behavior (GO:0031987)|positive regulation of dopamine metabolic process (GO:0045964)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|ubiquitin ligase complex (GO:0000151)	G-protein coupled receptor activity (GO:0004930)|heat shock protein binding (GO:0031072)|Hsp70 protein binding (GO:0030544)|ubiquitin protein ligase binding (GO:0031625)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(11)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						CCGACTGAAGGGTTTGCAGAG	0.483																																					p.P555L		.											.	GPR37-523	0			c.C1664T						.						104.0	97.0	100.0					7																	124386757		2203	4300	6503	SO:0001583	missense	2861	exon2			CTGAAGGGTTTGC		CCDS5792.1	7q31	2012-08-21			ENSG00000170775	ENSG00000170775		"""GPCR / Class A : Orphans"""	4494	protein-coding gene	gene with protein product		602583				9339362	Standard	NM_005302		Approved	EDNRBL, hET(B)R-LP, PAELR	uc003vli.4	O15354	OTTHUMG00000157197	ENST00000303921.2:c.1664C>T	7.37:g.124386757G>A	ENSP00000306449:p.Pro555Leu	Somatic	157	4		WXS	Illumina GAIIx	Phase_I	182	53	NM_005302	0	0	0	0	0	A4D0Y6|O00348|O14768|Q8TD39	Missense_Mutation	SNP	ENST00000303921.2	37	CCDS5792.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.218300	0.79464	.	.	ENSG00000170775	ENST00000303921	T	0.37752	1.18	5.35	5.35	0.76521	.	0.000000	0.56097	D	0.000023	T	0.56277	0.1974	L	0.54323	1.7	0.80722	D	1	D	0.71674	0.998	D	0.68483	0.958	T	0.57568	-0.7789	10	0.66056	D	0.02	-26.852	18.0541	0.89358	0.0:0.0:1.0:0.0	.	555	O15354	GPR37_HUMAN	L	555	ENSP00000306449:P555L	ENSP00000306449:P555L	P	-	2	0	GPR37	124173993	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.863000	0.87023	2.489000	0.83994	0.655000	0.94253	CCC	.		0.483	GPR37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347873.1	NM_005302	
R3HCC1	203069	broad.mit.edu;ucsc.edu	37	8	23150878	23150878	+	Missense_Mutation	SNP	T	T	G	rs13530	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr8:23150878T>G	ENST00000411463.1	+	7	1208	c.1208T>G	c.(1207-1209)cTg>cGg	p.L403R	R3HCC1_ENST00000518454.1_Missense_Mutation_p.L176R|R3HCC1_ENST00000265806.6_Missense_Mutation_p.L176R|R3HCC1_ENST00000522012.1_3'UTR			Q9Y3T6	R3HC1_HUMAN	R3H domain and coiled-coil containing 1	403			L -> R (in dbSNP:rs13530).				nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)			central_nervous_system(1)|skin(2)	3						TTTCCCTGCCTGGCCTCAGGT	0.607													T|||	2768	0.552716	0.4289	0.4553	5008	,	,		18639	0.7996		0.5398	False		,,,				2504	0.5481				p.L176R		.											.	R3HCC1-69	0			c.T527G						.						41.0	36.0	38.0					8																	23150878		692	1591	2283	SO:0001583	missense	203069	exon6			CCTGCCTGGCCTC		CCDS47826.1	8p21.3	2012-05-23		2005-11-20	ENSG00000104679	ENSG00000104679			27329	protein-coding gene	gene with protein product						12477932	Standard	XM_005273427		Approved	DKFZp564N123	uc003xdf.3	Q9Y3T6	OTTHUMG00000163786	ENST00000411463.1:c.1208T>G	8.37:g.23150878T>G	ENSP00000397555:p.Leu403Arg	Somatic	58	1		WXS	Illumina GAIIx	Phase_I	60	6	NM_001136108	0	0	2	2	0	B7ZLI1	Missense_Mutation	SNP	ENST00000411463.1	37		1277	0.5847069597069597	219	0.4451219512195122	178	0.49171270718232046	459	0.8024475524475524	421	0.5554089709762533	T	12.75	2.032237	0.35893	.	.	ENSG00000104679	ENST00000518454;ENST00000265806;ENST00000411463;ENST00000520480	T;T;T;T	0.41065	1.01;1.01;2.21;1.01	5.83	3.48	0.39840	Nucleotide-binding, alpha-beta plait (1);	0.400244	0.26525	N	0.023881	T	0.00012	0.0000	L	0.54323	1.7	0.09310	P	1.0	D	0.54397	0.966	P	0.52159	0.691	T	0.27191	-1.0081	9	0.15952	T	0.53	-1.5068	7.6633	0.28415	0.0:0.1695:0.0:0.8305	rs13530;rs1128916;rs3186283;rs11135721;rs17296698;rs17357785;rs56792131;rs11135721	403	Q9Y3T6	R3HC1_HUMAN	R	176;176;403;98	ENSP00000430607:L176R;ENSP00000265806:L176R;ENSP00000397555:L403R;ENSP00000430339:L98R	ENSP00000265806:L176R	L	+	2	0	R3HCC1	23206823	0.255000	0.24002	0.992000	0.48379	0.986000	0.74619	0.384000	0.20668	0.489000	0.27749	0.533000	0.62120	CTG	T|0.004;G|0.007		0.607	R3HCC1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001136108	
NSMAF	8439	hgsc.bcm.edu	37	8	59571856	59571856	+	Intron	SNP	A	A	C	rs59606339	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr8:59571856A>C	ENST00000038176.3	-	1	272				NSMAF_ENST00000427130.2_Missense_Mutation_p.I17S|snoU13_ENST00000459488.1_RNA	NM_003580.3	NP_003571.2	Q92636	FAN_HUMAN	neutral sphingomyelinase (N-SMase) activation associated factor						ceramide metabolic process (GO:0006672)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	receptor signaling protein activity (GO:0005057)|sphingomyelin phosphodiesterase activator activity (GO:0016230)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	38		all_lung(136;0.174)|Lung NSC(129;0.2)				GCACTGCCGGATAGCTCGGCA	0.761													C|||	1348	0.269169	0.4697	0.1037	5008	,	,		10863	0.497		0.0467	False		,,,				2504	0.1094				p.I17S		.											.	NSMAF-91	0			c.T50G						.						4.0	7.0	6.0					8																	59571856		613	1513	2126	SO:0001627	intron_variant	8439	exon1			TGCCGGATAGCTC	X96586	CCDS6173.1, CCDS47864.1	8q12-q13	2013-01-10			ENSG00000035681	ENSG00000035681		"""WD repeat domain containing"""	8017	protein-coding gene	gene with protein product		603043				8808629, 10640829	Standard	NM_003580		Approved	FAN	uc011lee.2	Q92636	OTTHUMG00000164352	ENST00000038176.3:c.59+275T>G	8.37:g.59571856A>C		Somatic	4	0		WXS	Illumina GAIIx	Phase_I	13	13	NM_001144772	0	0	0	0	0	B4DFB0|E9PCH0|Q8IW26	Missense_Mutation	SNP	ENST00000038176.3	37	CCDS6173.1	496	0.2271062271062271	186	0.3780487804878049	31	0.0856353591160221	244	0.42657342657342656	35	0.04617414248021108	C	0.151	-1.090991	0.01858	.	.	ENSG00000035681	ENST00000427130	T	0.55413	0.52	1.89	-0.128	0.13506	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.45308	-0.9270	6	.	.	.	.	0.796	0.01066	0.2394:0.3623:0.2355:0.1628	rs59606339	17	Q92636-2	.	S	17	ENSP00000411012:I17S	.	I	-	2	0	NSMAF	59734410	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.459000	0.21908	-0.396000	0.07703	-0.358000	0.07595	ATC	A|0.754;C|0.246		0.761	NSMAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378384.1	NM_003580	
ERMP1	79956	hgsc.bcm.edu	37	9	5832728	5832728	+	Silent	SNP	G	G	C	rs1131727	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr9:5832728G>C	ENST00000339450.5	-	1	389	c.300C>G	c.(298-300)gcC>gcG	p.A100A	ERMP1_ENST00000214893.5_5'UTR|ERMP1_ENST00000381506.3_5'Flank	NM_024896.2	NP_079172.2	Q7Z2K6	ERMP1_HUMAN	endoplasmic reticulum metallopeptidase 1	100						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			endometrium(2)|kidney(1)|large_intestine(9)|lung(4)|ovary(1)|prostate(2)|skin(1)	20		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00115)|Lung(218;0.111)		GGTGTCCAGCGGCCCCGCGTA	0.741													G|||	2021	0.403554	0.1309	0.428	5008	,	,		3601	0.7093		0.34	False		,,,				2504	0.5051				p.A100A		.											.	ERMP1-69	0			c.C300G						.						4.0	3.0	3.0					9																	5832728		1620	3326	4946	SO:0001819	synonymous_variant	79956	exon1			TCCAGCGGCCCCG	AB058718	CCDS34983.1	9p24	2008-02-05	2007-07-05	2007-07-05	ENSG00000099219	ENSG00000099219			23703	protein-coding gene	gene with protein product	"""Felix-ina"""	611156	"""KIAA1815"""	KIAA1815		11347906	Standard	XM_005251587		Approved	FLJ23309, FXNA	uc003zjm.1	Q7Z2K6	OTTHUMG00000019508	ENST00000339450.5:c.300C>G	9.37:g.5832728G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	27	27	NM_024896	0	0	0	5	5	B2RNA4|B3KSB1|Q8N5T5|Q9H5M1	Silent	SNP	ENST00000339450.5	37	CCDS34983.1																																																																																			G|0.572;C|0.428		0.741	ERMP1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354877.1	NM_024896	
KDM4C	23081	bcgsc.ca	37	9	7046901	7046901	+	Missense_Mutation	SNP	C	C	G	rs1407856	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr9:7046901C>G	ENST00000381309.3	+	16	2864	c.2299C>G	c.(2299-2301)Caa>Gaa	p.Q767E	KDM4C_ENST00000535193.1_Missense_Mutation_p.Q789E|KDM4C_ENST00000536108.1_Missense_Mutation_p.Q586E|KDM4C_ENST00000543771.1_Missense_Mutation_p.Q767E|KDM4C_ENST00000428870.2_Missense_Mutation_p.Q454E|KDM4C_ENST00000381306.3_Missense_Mutation_p.Q767E|KDM4C_ENST00000442236.2_Missense_Mutation_p.Q512E	NM_015061.3	NP_055876.2	Q9H3R0	KDM4C_HUMAN	lysine (K)-specific demethylase 4C	767			Q -> E (in dbSNP:rs1407856).		histone H3-K9 demethylation (GO:0033169)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	androgen receptor binding (GO:0050681)|dioxygenase activity (GO:0051213)|enzyme binding (GO:0019899)|histone demethylase activity (H3-K9 specific) (GO:0032454)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(14)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43						TGCTCTTAAGCAAACGAAGAA	0.368													C|||	1127	0.22504	0.025	0.2723	5008	,	,		20955	0.2937		0.171	False		,,,				2504	0.4468				p.Q789E		.											.	KDM4C-228	0			c.C2365G						.	C	GLU/GLN,GLU/GLN,GLU/GLN,GLU/GLN	233,4173	136.5+/-172.5	10,213,1980	171.0	155.0	160.0		2299,2299,2365,2299	2.5	1.0	9	dbSNP_88	160	1519,7081	286.5+/-297.7	135,1249,2916	yes	missense,missense,missense,missense	KDM4C	NM_001146694.1,NM_001146695.1,NM_001146696.1,NM_015061.3	29,29,29,29	145,1462,4896	GG,GC,CC		17.6628,5.2882,13.4707	benign,benign,benign,benign	767/1048,767/814,789/836,767/1057	7046901	1752,11254	2203	4300	6503	SO:0001583	missense	23081	exon16			CTTAAGCAAACGA	AB018323	CCDS6471.1, CCDS55285.1, CCDS55286.1, CCDS55287.1	9p24-p23	2013-01-23	2009-04-06	2009-04-06	ENSG00000107077	ENSG00000107077		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	17071	protein-coding gene	gene with protein product	"""tudor domain containing 14C"""	605469	"""jumonji domain containing 2C"""	JMJD2C		9872452, 15138608	Standard	NM_015061		Approved	GASC1, KIAA0780, TDRD14C	uc003zkh.3	Q9H3R0	OTTHUMG00000019536	ENST00000381309.3:c.2299C>G	9.37:g.7046901C>G	ENSP00000370710:p.Gln767Glu	Somatic	102	0		WXS	Illumina GAIIx	Phase_I	138	5	NM_001146696	0	0	17	17	0	B4E1Y4|B7ZL46|F5H347|F5H7P0|O94877|Q2M3M0|Q5JUC9|Q5VYJ2|Q5VYJ3	Missense_Mutation	SNP	ENST00000381309.3	37	CCDS6471.1	406	0.1858974358974359	24	0.04878048780487805	90	0.24861878453038674	155	0.270979020979021	137	0.18073878627968337	C	8.625	0.892374	0.17613	0.052882	0.176628	ENSG00000107077	ENST00000535193;ENST00000543771;ENST00000381309;ENST00000381306;ENST00000442236;ENST00000536108;ENST00000428870;ENST00000420847	T;T;T;T;T;T;T;T	0.17691	2.55;2.55;2.55;2.55;2.55;2.26;2.55;2.55	5.44	2.53	0.30540	.	0.275088	0.41823	N	0.000819	T	0.00012	0.0000	L	0.52011	1.625	0.27847	P	0.9408761	B;B;B;B;B	0.21381	0.055;0.001;0.002;0.0;0.001	B;B;B;B;B	0.24974	0.057;0.005;0.004;0.004;0.003	T	0.37979	-0.9682	9	0.21540	T	0.41	-35.9624	16.679	0.85287	0.0:0.6856:0.3144:0.0	rs1407856;rs52835630;rs1407856	512;767;789;767;767	E7EV17;F5H347;F5H7P0;Q9H3R0;Q9H3R0-2	.;.;.;KDM4C_HUMAN;.	E	789;767;767;767;512;586;454;111	ENSP00000442382:Q789E;ENSP00000445427:Q767E;ENSP00000370710:Q767E;ENSP00000370707:Q767E;ENSP00000409353:Q512E;ENSP00000440656:Q586E;ENSP00000405739:Q454E;ENSP00000400127:Q111E	ENSP00000370707:Q767E	Q	+	1	0	KDM4C	7036901	1.000000	0.71417	1.000000	0.80357	0.468000	0.32798	2.162000	0.42367	0.377000	0.24735	-0.175000	0.13238	CAA	C|0.685;G|0.315		0.368	KDM4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051692.1	NM_015061	
AKAP2	11217	hgsc.bcm.edu	37	9	112811038	112811038	+	Missense_Mutation	SNP	C	C	T	rs78923754	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr9:112811038C>T	ENST00000374525.1	+	1	63	c.59C>T	c.(58-60)cCg>cTg	p.P20L	AKAP2_ENST00000555236.1_Intron|PALM2-AKAP2_ENST00000374530.3_Intron|PALM2-AKAP2_ENST00000302798.7_Intron|AKAP2_ENST00000434623.2_Missense_Mutation_p.P20L|AKAP2_ENST00000510514.5_Intron	NM_001004065.4	NP_001004065.2	Q9Y2D5	AKAP2_HUMAN	A kinase (PRKA) anchor protein 2	374										breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	33						CCTGGACCCCCGGAGTCTCCT	0.776													-|||	379	0.0756789	0.0703	0.0879	5008	,	,		9335	0.0298		0.0954	False		,,,				2504	0.1012				p.P20L		.											.	AKAP2-24	0			c.C59T						.	C	LEU/PRO,LEU/PRO,,	146,2418		2,142,1138	2.0	3.0	2.0		59,59,,	0.3	0.0	9	dbSNP_132	2	557,5611		13,531,2540	no	missense,missense,intron,intron	AKAP2,PALM2-AKAP2	NM_001004065.4,NM_001198656.1,NM_007203.4,NM_147150.2	98,98,,	15,673,3678	TT,TC,CC		9.0305,5.6942,8.0508	,,,	20/949,20/962,,	112811038	703,8029	1282	3084	4366	SO:0001583	missense	11217	exon1			GACCCCCGGAGTC	AB023137	CCDS43861.1, CCDS48003.1, CCDS56581.1	9q31.3	2009-10-16			ENSG00000241978	ENSG00000241978		"""A-kinase anchor proteins"""	372	protein-coding gene	gene with protein product	"""protein kinase A2"""	604582		PRKA2		10231032	Standard	NM_001136562		Approved	AKAP-KL, KIAA0920, DKFZp564L0716		Q9Y2D5	OTTHUMG00000156811	ENST00000374525.1:c.59C>T	9.37:g.112811038C>T	ENSP00000363649:p.Pro20Leu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	20	19	NM_001004065	0	0	0	1	1	B1ALX9|B2RTU4|B3KQ00|B4DTZ2|B7ZW07|B9EJB5|Q9UG26	Missense_Mutation	SNP	ENST00000374525.1	37	CCDS43861.1	184	0.08424908424908426	48	0.0975609756097561	42	0.11602209944751381	16	0.027972027972027972	78	0.10290237467018469	-	6.449	0.450901	0.12223	0.056942	0.090305	ENSG00000241978	ENST00000434623;ENST00000374525	T;T	0.44482	1.5;0.92	3.3	0.302	0.15786	.	.	.	.	.	T	0.00412	0.0013	.	.	.	0.58432	P	5.000000000032756E-6	B;B	0.11235	0.001;0.004	B;B	0.04013	0.001;0.001	T	0.06972	-1.0797	7	0.72032	D	0.01	-9.3294	7.3755	0.26825	0.0:0.6472:0.0:0.3528	.	20;21	Q9Y2D5-7;B1ALY1	.;.	L	20	ENSP00000404782:P20L;ENSP00000363649:P20L	ENSP00000363649:P20L	P	+	2	0	AKAP2	111850859	0.208000	0.23494	0.001000	0.08648	0.000000	0.00434	0.026000	0.13599	-0.068000	0.12953	-1.980000	0.00456	CCG	C|0.917;T|0.083		0.776	AKAP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000053609.3	NM_001004065	
BRINP1	1620	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	121929775	121929775	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr9:121929775G>T	ENST00000265922.3	-	8	2334	c.1873C>A	c.(1873-1875)Cta>Ata	p.L625I	BRINP1_ENST00000482797.1_Intron	NM_014618.2	NP_055433.2	O60477	BRNP1_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 1	625					cell cycle arrest (GO:0007050)|cell death (GO:0008219)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell cycle (GO:0045786)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	cytoplasm (GO:0005737)											AGGGTAGGTAGCCGAGTCCGA	0.532																																					p.L625I		.											.	DBC1-582	0			c.C1873A						.						135.0	130.0	132.0					9																	121929775		2203	4300	6503	SO:0001583	missense	1620	exon8			TAGGTAGCCGAGT	AF027734	CCDS6822.1	9q32-q33	2013-08-06	2013-08-06	2013-07-31	ENSG00000078725	ENSG00000078725			2687	protein-coding gene	gene with protein product		602865	"""deleted in bladder cancer chromosome region candidate 1"", ""deleted in bladder cancer 1"""	DBCCR1, DBC1		9175739, 10444335, 15193422	Standard	NM_014618		Approved	FAM5A	uc004bkc.2	O60477	OTTHUMG00000021020	ENST00000265922.3:c.1873C>A	9.37:g.121929775G>T	ENSP00000265922:p.Leu625Ile	Somatic	257	1		WXS	Illumina GAIIx	Phase_I	346	294	NM_014618	0	0	0	1	1	Q6IPV6|Q6P1A0|Q8WU22	Missense_Mutation	SNP	ENST00000265922.3	37	CCDS6822.1	.	.	.	.	.	.	.	.	.	.	G	10.48	1.361886	0.24684	.	.	ENSG00000078725	ENST00000373969;ENST00000265922	T	0.14022	2.54	5.09	5.09	0.68999	.	0.067515	0.64402	D	0.000010	T	0.12347	0.0300	N	0.22421	0.69	0.48185	D	0.999608	B	0.06786	0.001	B	0.06405	0.002	T	0.07731	-1.0757	10	0.46703	T	0.11	-5.6304	18.8724	0.92320	0.0:0.0:1.0:0.0	.	625	O60477	DBC1_HUMAN	I	625	ENSP00000265922:L625I	ENSP00000265922:L625I	L	-	1	2	DBC1	120969596	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.120000	0.41968	2.540000	0.85666	0.655000	0.94253	CTA	.		0.532	BRINP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055440.2	NM_014618	
PCDH11X	27328	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	X	91132451	91132451	+	Silent	SNP	C	C	A			TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chrX:91132451C>A	ENST00000373094.1	+	2	2057	c.1212C>A	c.(1210-1212)atC>atA	p.I404I	PCDH11X_ENST00000504220.2_Silent_p.I404I|PCDH11X_ENST00000361724.1_Silent_p.I404I|PCDH11X_ENST00000406881.1_Silent_p.I404I|PCDH11X_ENST00000361655.2_Silent_p.I404I|PCDH11X_ENST00000373097.1_Silent_p.I404I|PCDH11X_ENST00000298274.8_Silent_p.I404I|PCDH11X_ENST00000395337.2_Silent_p.I404I|PCDH11X_ENST00000373088.1_Silent_p.I404I	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked	404	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						ATCATGAAATCCCTTTCAGAT	0.413																																					p.I404I	NSCLC(38;925 1092 2571 38200 45895)	.											.	PCDH11X-193	0			c.C1212A						.						199.0	164.0	176.0					X																	91132451		2203	4300	6503	SO:0001819	synonymous_variant	27328	exon2			TGAAATCCCTTTC	AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.1212C>A	X.37:g.91132451C>A		Somatic	243	2		WXS	Illumina GAIIx	Phase_I	272	242	NM_001168363	0	0	0	0	0	A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	Silent	SNP	ENST00000373094.1	37	CCDS14461.1																																																																																			T|1.000;|0.000		0.413	PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057436.1	NM_032969	
NF1	4763	hgsc.bcm.edu;bcgsc.ca	37	17	29654828	29654829	+	Frame_Shift_Ins	INS	-	-	A			TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr17:29654828_29654829insA	ENST00000358273.4	+	38	5963_5964	c.5580_5581insA	c.(5581-5583)aatfs	p.N1861fs	NF1_ENST00000356175.3_Frame_Shift_Ins_p.N1840fs|NF1_ENST00000581113.2_3'UTR	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	1861					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(3)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		TCGCATTACTTAATTTAGGCAG	0.436			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																											p.L1860fs		.	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	.	NF1-3353	11	Whole gene deletion(8)|Unknown(3)	soft_tissue(7)|autonomic_ganglia(2)|lung(1)|central_nervous_system(1)	c.5580_5581insA	GRCh37	CD072448	NF1	D		.																																			SO:0001589	frameshift_variant	4763	exon38	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome	ATTACTTAATTTA		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.5582dupA	17.37:g.29654830_29654830dupA	ENSP00000351015:p.Asn1861fs	Somatic	97	1		WXS	Illumina GAIIx	Phase_I	55	40	NM_001042492	0	0	0	0	0	O00662|Q14284|Q14930|Q14931|Q9UMK3	Frame_Shift_Ins	INS	ENST00000358273.4	37	CCDS42292.1																																																																																			.		0.436	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267	
TBP	6908	broad.mit.edu	37	6	170871013	170871014	+	In_Frame_Ins	INS	-	-	CAG	rs201732168|rs113202486|rs574714675|rs71010672	byFrequency	TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr6:170871013_170871014insCAG	ENST00000392092.2	+	3	468_469	c.189_190insCAG	c.(190-192)cag>CAGcag	p.64_64Q>QQ	TBP_ENST00000230354.6_In_Frame_Ins_p.64_64Q>QQ|TBP_ENST00000540980.1_In_Frame_Ins_p.44_44Q>QQ	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	64	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.Q63_Q64insQ(1)|p.Q63Q(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		agcaacaacaacagcagcagca	0.55																																					p.Q63delinsQQ		.											.	TBP-91	2	Insertion - In frame(1)|Substitution - coding silent(1)	prostate(1)|breast(1)	c.189_190insCAG						.																																			SO:0001652	inframe_insertion	6908	exon3			ACAACAACAGCAG	M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.211_213dupCAG	6.37:g.170871020_170871022dupCAG	ENSP00000375942:p.Gln95dup	Somatic	61	0		WXS	Illumina GAIIx	Phase_I	115	68	NM_003194	0	0	0	0	0	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	In_Frame_Ins	INS	ENST00000392092.2	37	CCDS5315.1																																																																																			-|0.138;CAG|0.862		0.550	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043271.2	NM_003194	
MLLT3	4300	broad.mit.edu	37	9	20414344	20414345	+	In_Frame_Ins	INS	-	-	TGC			TCGA-OR-A5JW-01A-11D-A29I-10	TCGA-OR-A5JW-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0004802d-73d9-45fd-a460-ea223da20491	b2629be2-b6b9-414c-a7d1-e0103b395590	g.chr9:20414344_20414345insTGC	ENST00000380338.4	-	5	785_786	c.499_500insGCA	c.(499-501)agt>aGCAgt	p.167_167S>SS	MLLT3_ENST00000475957.1_5'UTR|MLLT3_ENST00000429426.2_In_Frame_Ins_p.164_164S>SS|MLLT3_ENST00000355930.6_5'UTR	NM_004529.2	NP_004520.2	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3	167	Poly-Ser.				anterior/posterior pattern specification (GO:0009952)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of transcription, DNA-templated (GO:0006355)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)				central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(6)|lung(24)|ovary(1)|prostate(4)|skin(1)|urinary_tract(7)	66				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		gctgctgctactgctgctgctg	0.53			T	MLL	ALL																																p.S167delinsSS		.		Dom	yes		9	9p22	4300	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 (AF9)"""		L	.	MLLT3-660	0			c.500_501insGCA						.																																			SO:0001652	inframe_insertion	4300	exon5			CTGCTACTGCTGC	L13744	CCDS6494.1	9p22	2008-02-05	2001-11-28		ENSG00000171843	ENSG00000171843			7136	protein-coding gene	gene with protein product		159558	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 3"""			8506309, 8414510	Standard	NM_001286691		Approved	AF-9, AF9, YEATS3	uc003zoe.2	P42568	OTTHUMG00000019650	ENST00000380338.4:c.497_499dupGCA	9.37:g.20414351_20414353dupTGC	ENSP00000369695:p.Ser190dup	Somatic	20	0		WXS	Illumina GAIIx	Phase_I	39	9	NM_004529	0	0	0	0	0	B1AMQ2|B2R7B3|B7Z755|D3DRJ8|Q8IVB0	In_Frame_Ins	INS	ENST00000380338.4	37	CCDS6494.1																																																																																			.		0.530	MLLT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051872.1	NM_004529	
