#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
FBXO42	54455	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	16577408	16577408	+	Silent	SNP	C	C	T			TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr1:16577408C>T	ENST00000375592.3	-	10	2127	c.1911G>A	c.(1909-1911)caG>caA	p.Q637Q		NM_018994.1	NP_061867.1	Q6P3S6	FBX42_HUMAN	F-box protein 42	637										autonomic_ganglia(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	26		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00475)|all_lung(284;0.00671)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0193)|Colorectal(212;3.16e-07)|COAD - Colon adenocarcinoma(227;1.46e-05)|BRCA - Breast invasive adenocarcinoma(304;4.37e-05)|Kidney(64;0.000246)|KIRC - Kidney renal clear cell carcinoma(64;0.00336)|STAD - Stomach adenocarcinoma(313;0.0139)|READ - Rectum adenocarcinoma(331;0.0693)		AGTTCATACTCTGGTATAGGG	0.527																																					p.Q637Q		.											.	FBXO42-228	0			c.G1911A						.						148.0	153.0	151.0					1																	16577408		2203	4300	6503	SO:0001819	synonymous_variant	54455	exon10			CATACTCTGGTAT	BC063864	CCDS30613.1	1p36.23-p36.11	2008-02-05			ENSG00000037637	ENSG00000037637		"""F-boxes /  ""other"""""	29249	protein-coding gene	gene with protein product		609109				10718198	Standard	XM_006710698		Approved	KIAA1332, Fbx42	uc001ayg.3	Q6P3S6	OTTHUMG00000002218	ENST00000375592.3:c.1911G>A	1.37:g.16577408C>T		Somatic	148	0		WXS	Illumina GAIIx	Phase_I	163	92	NM_018994	0	0	6	14	8	B3KP30|Q5TEU8|Q86XI0|Q8N3N4|Q8N5F8|Q9BRM0|Q9P2L4	Silent	SNP	ENST00000375592.3	37	CCDS30613.1																																																																																			.		0.527	FBXO42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006285.1		
OPRD1	4985	hgsc.bcm.edu	37	1	29138975	29138975	+	Missense_Mutation	SNP	G	G	T	rs1042114	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr1:29138975G>T	ENST00000234961.2	+	1	322	c.80G>T	c.(79-81)tGc>tTc	p.C27F		NM_000911.3	NP_000902.3	P41143	OPRD_HUMAN	opioid receptor, delta 1	27			C -> F (improved maturation and increased expression at the cell surface; dbSNP:rs1042114). {ECO:0000269|PubMed:10982041, ECO:0000269|PubMed:8201839, ECO:0000269|Ref.4}.		adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adult locomotory behavior (GO:0008344)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|cellular response to toxic substance (GO:0097237)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|immune response (GO:0006955)|negative regulation of gene expression (GO:0010629)|negative regulation of protein oligomerization (GO:0032460)|neuropeptide signaling pathway (GO:0007218)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein import into nucleus, translocation (GO:0000060)|regulation of calcium ion transport (GO:0051924)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of sensory perception of pain (GO:0051930)	axon terminus (GO:0043679)|cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	enkephalin receptor activity (GO:0038046)|opioid receptor activity (GO:0004985)			breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15		Colorectal(325;3.46e-05)|Lung NSC(340;0.000947)|all_lung(284;0.00131)|Renal(390;0.00758)|Breast(348;0.00765)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;1.29e-07)|COAD - Colon adenocarcinoma(152;7.51e-06)|STAD - Stomach adenocarcinoma(196;0.00306)|BRCA - Breast invasive adenocarcinoma(304;0.0241)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)	Alvimopan(DB06274)|Amitriptyline(DB00321)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diphenoxylate(DB01081)|Fentanyl(DB00813)|Heroin(DB01452)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levorphanol(DB00854)|Loperamide(DB00836)|Methadone(DB00333)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	CCTAGCGCCTGCCCCAGCGCT	0.771													T|||	4730	0.944489	0.9796	0.9193	5008	,	,		9147	1.0		0.8678	False		,,,				2504	0.9366				p.C27F		.											.	OPRD1-69	0			c.G80T						.	T	PHE/CYS	3689,115		1788,113,1	4.0	6.0	5.0	http://www.ncbi.nlm.nih.gov/omim/103780,165195|http://omim.org/entry/165195|http://omim.org/entry/103780	80	2.9	1.0	1	dbSNP_86	5	6762,846		2982,798,24	no	missense	OPRD1	NM_000911.3	205	4770,911,25	TT,TG,GG		11.1199,3.0231,8.421	benign	27/373	29138975	10451,961	1902	3804	5706	SO:0001583	missense	4985	exon1			GCGCCTGCCCCAG	U10504	CCDS329.1	1p36.1-p34.3	2012-08-08			ENSG00000116329	ENSG00000116329		"""GPCR / Class A : Opioid receptors"""	8153	protein-coding gene	gene with protein product		165195				8415697	Standard	NM_000911		Approved		uc001brf.1	P41143	OTTHUMG00000003646	ENST00000234961.2:c.80G>T	1.37:g.29138975G>T	ENSP00000234961:p.Cys27Phe	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	12	12	NM_000911	0	0	0	0	0	B5B0B8	Missense_Mutation	SNP	ENST00000234961.2	37	CCDS329.1	2035	0.9317765567765568	474	0.9634146341463414	331	0.914364640883978	572	1.0	658	0.8680738786279684	T	0.016	-1.513433	0.00975	0.969769	0.888801	ENSG00000116329	ENST00000234961;ENST00000536280	T	0.67698	-0.28	4.0	2.89	0.33648	.	1.802200	0.02327	N	0.073605	T	0.00012	0.0000	N	0.01874	-0.695	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.41342	-0.9514	9	0.09338	T	0.73	.	3.8109	0.08796	0.0:0.1144:0.2238:0.6618	rs1042114;rs59349662;rs1042114	27	P41143	OPRD_HUMAN	F	27	ENSP00000234961:C27F	ENSP00000234961:C27F	C	+	2	0	OPRD1	29011562	0.002000	0.14202	0.992000	0.48379	0.116000	0.19942	0.521000	0.22893	0.713000	0.32060	-0.694000	0.03704	TGC	G|0.061;T|0.939		0.771	OPRD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010330.1	NM_000911	
FOXD2	2306	hgsc.bcm.edu	37	1	47904000	47904000	+	Missense_Mutation	SNP	G	G	A	rs78469326	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr1:47904000G>A	ENST00000334793.5	+	1	2312	c.193G>A	c.(193-195)Gca>Aca	p.A65T		NM_004474.3	NP_004465.3	O60548	FOXD2_HUMAN	forkhead box D2	65					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(4)	4				READ - Rectum adenocarcinoma(2;0.0908)		GGAAGCCGAGGCAGACTTAGC	0.806													G|||	621	0.124002	0.0696	0.0562	5008	,	,		5401	0.1796		0.0755	False		,,,				2504	0.2382				p.A65T		.											.	FOXD2-226	0			c.G193A						.						2.0	2.0	2.0					1																	47904000		1116	2251	3367	SO:0001583	missense	2306	exon1			GCCGAGGCAGACT	AF042832	CCDS30708.1	1p34-p32	2008-02-05			ENSG00000186564	ENSG00000186564		"""Forkhead boxes"""	3803	protein-coding gene	gene with protein product		602211		FKHL17		9403061, 12621056	Standard	NM_004474		Approved	FREAC9	uc001crm.3	O60548	OTTHUMG00000007950	ENST00000334793.5:c.193G>A	1.37:g.47904000G>A	ENSP00000335493:p.Ala65Thr	Somatic	4	0		WXS	Illumina GAIIx	Phase_I	9	9	NM_004474	0	0	0	0	0	Q5SVZ3	Missense_Mutation	SNP	ENST00000334793.5	37	CCDS30708.1	235	0.10760073260073261	42	0.08536585365853659	28	0.07734806629834254	109	0.19055944055944055	56	0.07387862796833773	G	7.446	0.641599	0.14451	.	.	ENSG00000186564	ENST00000334793	D	0.93019	-3.15	4.13	4.13	0.48395	.	0.763324	0.10318	U	0.689132	T	0.00524	0.0017	N	0.08118	0	0.49130	P	2.4199999999996447E-4	B	0.19583	0.037	B	0.12156	0.007	T	0.43426	-0.9392	9	0.15066	T	0.55	.	9.1332	0.36857	0.1056:0.0:0.8944:0.0	.	65	O60548	FOXD2_HUMAN	T	65	ENSP00000335493:A65T	ENSP00000335493:A65T	A	+	1	0	FOXD2	47676587	0.081000	0.21417	0.149000	0.22428	0.050000	0.14768	1.760000	0.38430	1.817000	0.53016	0.505000	0.49811	GCA	G|0.887;A|0.113		0.806	FOXD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021831.1	NM_004474	
FOXD2	2306	hgsc.bcm.edu	37	1	47904909	47904909	+	Missense_Mutation	SNP	G	G	C	rs2405913	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr1:47904909G>C	ENST00000334793.5	+	1	3221	c.1102G>C	c.(1102-1104)Gcg>Ccg	p.A368P		NM_004474.3	NP_004465.3	O60548	FOXD2_HUMAN	forkhead box D2	368	Ala-rich.|Gly-rich.		A -> P (in dbSNP:rs2405913). {ECO:0000269|PubMed:9403061}.		transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(4)	4				READ - Rectum adenocarcinoma(2;0.0908)		AGCCTTCTACGCGGCGTCCCT	0.776													C|||	5006	0.999601	0.9985	1.0	5008	,	,		8227	1.0		1.0	False		,,,				2504	1.0				p.A368P		.											.	FOXD2-226	0			c.G1102C						.						2.0	3.0	2.0					1																	47904909		1345	2971	4316	SO:0001583	missense	2306	exon1			TTCTACGCGGCGT	AF042832	CCDS30708.1	1p34-p32	2008-02-05			ENSG00000186564	ENSG00000186564		"""Forkhead boxes"""	3803	protein-coding gene	gene with protein product		602211		FKHL17		9403061, 12621056	Standard	NM_004474		Approved	FREAC9	uc001crm.3	O60548	OTTHUMG00000007950	ENST00000334793.5:c.1102G>C	1.37:g.47904909G>C	ENSP00000335493:p.Ala368Pro	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_004474	0	0	0	0	0	Q5SVZ3	Missense_Mutation	SNP	ENST00000334793.5	37	CCDS30708.1	2181	0.9986263736263736	489	0.9939024390243902	362	1.0	572	1.0	758	1.0	C	0.800	-0.755720	0.03019	.	.	ENSG00000186564	ENST00000334793	D	0.93547	-3.24	4.4	3.48	0.39840	.	.	.	.	.	T	0.00012	0.0000	N	0.00210	-1.845	0.54753	P	1.7000000000044757E-5	B	0.02656	0.0	B	0.01281	0.0	T	0.42515	-0.9447	8	0.02654	T	1	.	4.1889	0.10411	0.1624:0.5916:0.1573:0.0887	rs2405913;rs2405913	368	O60548	FOXD2_HUMAN	P	368	ENSP00000335493:A368P	ENSP00000335493:A368P	A	+	1	0	FOXD2	47677496	0.000000	0.05858	0.905000	0.35620	0.496000	0.33645	0.098000	0.15189	0.309000	0.22966	-0.978000	0.02582	GCG	G|0.835;C|0.165		0.776	FOXD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021831.1	NM_004474	
LEFTY1	10637	hgsc.bcm.edu	37	1	226075608	226075608	+	Silent	SNP	G	G	A	rs12753531	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr1:226075608G>A	ENST00000272134.5	-	2	454	c.375C>T	c.(373-375)gtC>gtT	p.V125V	RP4-559A3.7_ENST00000432920.2_Missense_Mutation_p.P234S|LEFTY1_ENST00000492457.1_5'UTR	NM_020997.3	NP_066277.1	O75610	LFTY1_HUMAN	left-right determination factor 1	125					cell growth (GO:0016049)|determination of left/right symmetry (GO:0007368)|heart morphogenesis (GO:0003007)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular space (GO:0005615)				cervix(1)|endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	10	Breast(184;0.197)					CGGCCTTGGGGACCGGCTCCT	0.741													G|||	803	0.160343	0.062	0.2017	5008	,	,		10390	0.1131		0.2674	False		,,,				2504	0.2025				p.V125V		.											.	LEFTY1-90	0			c.C375T						.						2.0	3.0	3.0					1																	226075608		1207	3063	4270	SO:0001819	synonymous_variant	10637	exon2			CTTGGGGACCGGC	AF081507	CCDS1548.1	1q42.1	2008-02-05	2004-11-17	2004-11-17	ENSG00000243709	ENSG00000243709			6552	protein-coding gene	gene with protein product		603037	"""left-right determination, factor B"""	LEFTB		10053005, 10886363	Standard	NM_020997		Approved	LEFTYB	uc001hpo.3	O75610	OTTHUMG00000037443	ENST00000272134.5:c.375C>T	1.37:g.226075608G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_020997	0	0	0	0	0	B2R7U0|Q53H67|Q5TE94	Silent	SNP	ENST00000272134.5	37	CCDS1548.1	377	0.17261904761904762	30	0.06097560975609756	75	0.20718232044198895	75	0.13111888111888112	197	0.2598944591029024	G	8.535	0.871818	0.17322	.	.	ENSG00000255835	ENST00000432920	D	0.82433	-1.61	3.63	1.62	0.23740	.	.	.	.	.	T	0.00039	0.0001	.	.	.	0.54753	P	1.3000000000040757E-5	B	0.26935	0.164	B	0.22753	0.041	T	0.03608	-1.1020	7	0.87932	D	0	-3.7816	9.8091	0.40812	0.0:0.4316:0.5684:0.0	rs12753531	234	E7EUD8	.	S	234	ENSP00000414068:P234S	ENSP00000414068:P234S	P	-	1	0	RP4-559A3.7	224142231	0.576000	0.26700	0.314000	0.25224	0.044000	0.14063	0.105000	0.15333	0.142000	0.18901	-0.676000	0.03789	CCC	G|0.827;A|0.173		0.741	LEFTY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091155.1	NM_020997	
OBSCN	84033	hgsc.bcm.edu	37	1	228504670	228504670	+	Missense_Mutation	SNP	C	C	T	rs11810627	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr1:228504670C>T	ENST00000422127.1	+	51	13590	c.13546C>T	c.(13546-13548)Cgg>Tgg	p.R4516W	OBSCN_ENST00000570156.2_Missense_Mutation_p.R5473W|OBSCN_ENST00000366709.4_Missense_Mutation_p.R1635W|OBSCN_ENST00000284548.11_Missense_Mutation_p.R4516W|OBSCN_ENST00000366707.4_Missense_Mutation_p.R2150W	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	4516	Ig-like 46.		R -> W (in dbSNP:rs11810627).		apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GGCCTCTGCGCGGCTCACCGT	0.736													c|||	1654	0.330272	0.2791	0.4006	5008	,	,		13971	0.249		0.4861	False		,,,				2504	0.273				p.R5473W		.											.	OBSCN-403	0			c.C16417T						.		TRP/ARG,TRP/ARG	923,2833		165,593,1120	5.0	6.0	6.0		13546,13546	-1.0	0.0	1	dbSNP_120	6	3333,4245		861,1611,1317	yes	missense,missense	OBSCN	NM_001098623.1,NM_052843.2	101,101	1026,2204,2437	TT,TC,CC		43.9826,24.574,37.5507	probably-damaging,probably-damaging	4516/7969,4516/6621	228504670	4256,7078	1878	3789	5667	SO:0001583	missense	84033	exon62			TCTGCGCGGCTCA	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.13546C>T	1.37:g.228504670C>T	ENSP00000409493:p.Arg4516Trp	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	24	20	NM_001271223	0	0	0	0	0	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	CCDS58065.1	774	0.3543956043956044	137	0.2784552845528455	144	0.39779005524861877	134	0.23426573426573427	359	0.4736147757255937	c	11.94	1.787178	0.31593	0.24574	0.439826	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709	T;T;T;T	0.77098	-1.07;-1.07;0.2;0.2	5.41	-0.971	0.10303	Immunoglobulin subtype (1);Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.167607	0.36519	N	0.002550	T	0.00012	0.0000	L	0.41824	1.3	0.50632	P	1.1499999999997623E-4	B;B	0.22541	0.071;0.067	B;B	0.12156	0.007;0.007	T	0.42275	-0.9461	9	0.45353	T	0.12	.	10.3619	0.43998	0.6084:0.317:0.0:0.0747	rs11810627	4516;4516	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	W	4516;4516;2150;1635	ENSP00000284548:R4516W;ENSP00000409493:R4516W;ENSP00000355668:R2150W;ENSP00000355670:R1635W	ENSP00000284548:R4516W	R	+	1	2	OBSCN	226571293	0.968000	0.33430	0.013000	0.15412	0.016000	0.09150	2.032000	0.41127	-0.028000	0.13850	0.550000	0.68814	CGG	C|0.643;T|0.357		0.736	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
OR2T10	127069	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	248756893	248756893	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr1:248756893C>T	ENST00000330500.2	-	1	207	c.177G>A	c.(175-177)atG>atA	p.M59I	Y_RNA_ENST00000364732.1_RNA	NM_001004693.1	NP_001004693.1	Q8NGZ9	O2T10_HUMAN	olfactory receptor, family 2, subfamily T, member 10	59						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(17)|skin(3)|upper_aerodigestive_tract(1)	26	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TAAAGAAGTACATGGGAGTAT	0.413																																					p.M59I		.											.	OR2T10-69	0			c.G177A						.						81.0	91.0	88.0					1																	248756893		2050	4235	6285	SO:0001583	missense	127069	exon1			GAAGTACATGGGA		CCDS31121.1	1q44	2012-08-09			ENSG00000184022	ENSG00000184022		"""GPCR / Class A : Olfactory receptors"""	19573	protein-coding gene	gene with protein product							Standard	NM_001004693		Approved		uc010pzn.2	Q8NGZ9	OTTHUMG00000040388	ENST00000330500.2:c.177G>A	1.37:g.248756893C>T	ENSP00000329210:p.Met59Ile	Somatic	240	0		WXS	Illumina GAIIx	Phase_I	208	14	NM_001004693	0	0	0	0	0	B2RNK7	Missense_Mutation	SNP	ENST00000330500.2	37	CCDS31121.1	.	.	.	.	.	.	.	.	.	.	.	15.95	2.983863	0.53827	.	.	ENSG00000184022	ENST00000330500	T	0.09350	2.99	2.34	1.36	0.22044	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.41488	0.1161	H	0.97158	3.95	0.26193	N	0.979569	D	0.76494	0.999	D	0.64595	0.927	T	0.31888	-0.9927	9	0.87932	D	0	.	9.3561	0.38168	0.0:0.7766:0.2234:0.0	.	59	Q8NGZ9	O2T10_HUMAN	I	59	ENSP00000329210:M59I	ENSP00000329210:M59I	M	-	3	0	OR2T10	246823516	1.000000	0.71417	0.963000	0.40424	0.965000	0.64279	4.211000	0.58507	0.145000	0.18977	0.441000	0.28932	ATG	.		0.413	OR2T10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097139.1	NM_001004693	
OPTN	10133	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	13154589	13154589	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr10:13154589A>G	ENST00000378748.3	+	6	868	c.506A>G	c.(505-507)aAc>aGc	p.N169S	OPTN_ENST00000482140.1_3'UTR|OPTN_ENST00000378747.3_Missense_Mutation_p.N169S|OPTN_ENST00000378752.3_Missense_Mutation_p.N169S|OPTN_ENST00000263036.5_Missense_Mutation_p.N169S|OPTN_ENST00000378764.2_Missense_Mutation_p.N169S|OPTN_ENST00000378757.2_Missense_Mutation_p.N169S	NM_001008211.1|NM_001008213.1	NP_001008212|NP_001008214	Q96CV9	OPTN_HUMAN	optineurin	169	Interaction with Rab8.				cell death (GO:0008219)|defense response to Gram-negative bacterium (GO:0050829)|G2/M transition of mitotic cell cycle (GO:0000086)|Golgi organization (GO:0007030)|Golgi ribbon formation (GO:0090161)|Golgi to plasma membrane protein transport (GO:0043001)|macroautophagy (GO:0016236)|mitotic cell cycle (GO:0000278)|negative regulation of receptor recycling (GO:0001920)|protein targeting to Golgi (GO:0000042)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	polyubiquitin binding (GO:0031593)|protein C-terminus binding (GO:0008022)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(2)|large_intestine(5)|lung(9)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	22						CTCAAGCTGAACTCCAGCGGC	0.493																																					p.N169S		.											.	OPTN-70	0			c.A506G						.						127.0	129.0	128.0					10																	13154589		2203	4300	6503	SO:0001583	missense	10133	exon5			AGCTGAACTCCAG	AF420371	CCDS7094.1	10p14	2014-01-28	2003-09-08		ENSG00000123240	ENSG00000123240			17142	protein-coding gene	gene with protein product		602432	"""glaucoma 1, open angle, E (adult-onset)"""	GLC1E		11834836, 9488477	Standard	NM_001008211		Approved	FIP2, HYPL, FIP-2, TFIIIA-INTP, NRP, HIP7	uc001ilx.1	Q96CV9	OTTHUMG00000017690	ENST00000378748.3:c.506A>G	10.37:g.13154589A>G	ENSP00000368022:p.Asn169Ser	Somatic	109	0		WXS	Illumina GAIIx	Phase_I	104	91	NM_001008212	0	0	0	111	111	B3KP00|D3DRS4|D3DRS8|Q5T672|Q5T673|Q5T674|Q5T675|Q7LDL9|Q8N562|Q9UET9|Q9UEV4|Q9Y218	Missense_Mutation	SNP	ENST00000378748.3	37	CCDS7094.1	.	.	.	.	.	.	.	.	.	.	A	7.122	0.578243	0.13686	.	.	ENSG00000123240	ENST00000263036;ENST00000378764;ENST00000378757;ENST00000378752;ENST00000378748;ENST00000430081;ENST00000378747	D;D;D;D;D;T;D	0.87491	-2.26;-2.26;-2.26;-2.26;-2.26;1.32;-2.26	5.21	-1.35	0.09114	.	0.544435	0.23528	N	0.047212	T	0.80706	0.4674	M	0.70595	2.14	0.09310	N	1	B;B	0.17268	0.02;0.021	B;B	0.16289	0.015;0.007	T	0.63028	-0.6728	10	0.16420	T	0.52	-6.1115	6.2731	0.20965	0.4864:0.1367:0.3769:0.0	.	169;169	Q96CV9-2;Q96CV9	.;OPTN_HUMAN	S	169;169;169;169;169;112;169	ENSP00000263036:N169S;ENSP00000368040:N169S;ENSP00000368032:N169S;ENSP00000368027:N169S;ENSP00000368022:N169S;ENSP00000414747:N112S;ENSP00000368021:N169S	ENSP00000263036:N169S	N	+	2	0	OPTN	13194595	0.037000	0.19845	0.019000	0.16419	0.576000	0.36127	0.217000	0.17603	-0.429000	0.07329	0.523000	0.50628	AAC	.		0.493	OPTN-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046834.1	NM_021980	
PWWP2B	170394	hgsc.bcm.edu	37	10	134219036	134219036	+	Silent	SNP	G	G	A	rs11817589	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr10:134219036G>A	ENST00000305233.5	+	2	1091	c.1032G>A	c.(1030-1032)gaG>gaA	p.E344E	PWWP2B_ENST00000368609.4_Silent_p.E344E	NM_138499.3	NP_612508.3	Q6NUJ5	PWP2B_HUMAN	PWWP domain containing 2B	344										central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(5)|urinary_tract(1)	9		all_cancers(35;6.69e-12)|all_epithelial(44;1.55e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Breast(234;0.106)|Colorectal(31;0.109)|Melanoma(40;0.123)|Glioma(114;0.203)|all_hematologic(284;0.224)		OV - Ovarian serous cystadenocarcinoma(35;7.49e-05)|Epithelial(32;0.00016)|all cancers(32;0.000186)		GGGACAGCGAGCACGAGCCCG	0.726													G|||	516	0.103035	0.1241	0.0908	5008	,	,		12864	0.0813		0.0875	False		,,,				2504	0.1217				p.E344E		.											.	PWWP2B-90	0			c.G1032A						.	G	,	353,3895		15,323,1786	15.0	19.0	18.0		1032,1032	4.5	0.0	10	dbSNP_120	18	549,7817		13,523,3647	no	coding-synonymous,coding-synonymous	PWWP2B	NM_001098637.1,NM_138499.3	,	28,846,5433	AA,AG,GG		6.5623,8.3098,7.1508	,	344/500,344/591	134219036	902,11712	2124	4183	6307	SO:0001819	synonymous_variant	170394	exon2			CAGCGAGCACGAG	AK128663	CCDS7667.2	10q26.3	2009-06-03	2007-10-22	2007-10-22	ENSG00000171813	ENSG00000171813			25150	protein-coding gene	gene with protein product			"""PWWP domain containing 2"""	PWWP2			Standard	NM_001098637		Approved	bA432J24.1, FLJ46823	uc001lll.4	Q6NUJ5	OTTHUMG00000019286	ENST00000305233.5:c.1032G>A	10.37:g.134219036G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	11	11	NM_001098637	0	0	0	0	0	A6NM90|B5MDQ1|H9KV61|Q5SZI0|Q6ZQX5|Q96F43	Silent	SNP	ENST00000305233.5	37	CCDS7667.2																																																																																			G|0.909;A|0.091		0.726	PWWP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051075.3	NM_138499	
PWWP2B	170394	hgsc.bcm.edu	37	10	134219045	134219045	+	Silent	SNP	C	C	T	rs11146364	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr10:134219045C>T	ENST00000305233.5	+	2	1100	c.1041C>T	c.(1039-1041)ccC>ccT	p.P347P	PWWP2B_ENST00000368609.4_Silent_p.P347P	NM_138499.3	NP_612508.3	Q6NUJ5	PWP2B_HUMAN	PWWP domain containing 2B	347										central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(5)|urinary_tract(1)	9		all_cancers(35;6.69e-12)|all_epithelial(44;1.55e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Breast(234;0.106)|Colorectal(31;0.109)|Melanoma(40;0.123)|Glioma(114;0.203)|all_hematologic(284;0.224)		OV - Ovarian serous cystadenocarcinoma(35;7.49e-05)|Epithelial(32;0.00016)|all cancers(32;0.000186)		AGCACGAGCCCGTGTACCGGG	0.721													C|||	820	0.163738	0.2027	0.2104	5008	,	,		13504	0.1429		0.1074	False		,,,				2504	0.1575				p.P347P		.											.	PWWP2B-90	0			c.C1041T						.	C	,	636,3612		51,534,1539	16.0	21.0	20.0		1041,1041	-2.7	0.1	10	dbSNP_120	20	704,7662		24,656,3503	yes	coding-synonymous,coding-synonymous	PWWP2B	NM_001098637.1,NM_138499.3	,	75,1190,5042	TT,TC,CC		8.415,14.9718,10.6231	,	347/500,347/591	134219045	1340,11274	2124	4183	6307	SO:0001819	synonymous_variant	170394	exon2			CGAGCCCGTGTAC	AK128663	CCDS7667.2	10q26.3	2009-06-03	2007-10-22	2007-10-22	ENSG00000171813	ENSG00000171813			25150	protein-coding gene	gene with protein product			"""PWWP domain containing 2"""	PWWP2			Standard	NM_001098637		Approved	bA432J24.1, FLJ46823	uc001lll.4	Q6NUJ5	OTTHUMG00000019286	ENST00000305233.5:c.1041C>T	10.37:g.134219045C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	13	13	NM_001098637	0	0	0	0	0	A6NM90|B5MDQ1|H9KV61|Q5SZI0|Q6ZQX5|Q96F43	Silent	SNP	ENST00000305233.5	37	CCDS7667.2																																																																																			C|0.860;T|0.140		0.721	PWWP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051075.3	NM_138499	
KNDC1	85442	hgsc.bcm.edu	37	10	135012430	135012430	+	Silent	SNP	T	T	C	rs386749477|rs3008389	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr10:135012430T>C	ENST00000304613.3	+	14	2439	c.2418T>C	c.(2416-2418)gtT>gtC	p.V806V	KNDC1_ENST00000368572.2_Silent_p.V806V|KNDC1_ENST00000368571.2_Silent_p.V741V			Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND) containing 1	806	Pro-rich.			V -> D (in Ref. 1; BAD12625). {ECO:0000305}.	cerebellar granule cell differentiation (GO:0021707)|positive regulation of protein phosphorylation (GO:0001934)|regulation of dendrite morphogenesis (GO:0048814)|small GTPase mediated signal transduction (GO:0007264)	dendrite (GO:0030425)|guanyl-nucleotide exchange factor complex (GO:0032045)|neuronal cell body (GO:0043025)	protein serine/threonine kinase activity (GO:0004674)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			NS(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(27)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	60		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		CACCTGGAGTTGCTTCCGGGG	0.746													C|||	2730	0.545128	0.5166	0.4942	5008	,	,		10776	0.5486		0.5318	False		,,,				2504	0.6299				p.V806V		.											.	KNDC1-229	0			c.T2418C						.			1858,1296		588,682,307	4.0	5.0	4.0		2418	2.5	0.0	10	dbSNP_101	4	4179,3011		1338,1503,754	no	coding-synonymous	KNDC1	NM_152643.6		1926,2185,1061	CC,CT,TT		41.8776,41.0907,41.6377		806/1750	135012430	6037,4307	1577	3595	5172	SO:0001819	synonymous_variant	85442	exon14			TGGAGTTGCTTCC	AK074179	CCDS7674.1	10q26.3	2004-09-14	2004-04-07		ENSG00000171798	ENSG00000171798			29374	protein-coding gene	gene with protein product			"""RasGEF domain family, member 2"""	RASGEF2, C10orf23		11214970	Standard	NM_152643		Approved	KIAA1768, bB439H18.3, FLJ25027	uc001llz.1	Q76NI1	OTTHUMG00000019303	ENST00000304613.3:c.2418T>C	10.37:g.135012430T>C		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_152643	0	0	0	5	5	B0QZC5|Q5T233|Q6ZNH8|Q8TEE5|Q96LV7|Q9C095	Silent	SNP	ENST00000304613.3	37	CCDS7674.1																																																																																			T|0.470;C|0.530		0.746	KNDC1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000277044.3	NM_152643	
CRACR2B	283229	hgsc.bcm.edu	37	11	830120	830120	+	Missense_Mutation	SNP	A	A	G	rs145926870	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr11:830120A>G	ENST00000525077.1	+	4	694	c.593A>G	c.(592-594)cAg>cGg	p.Q198R	CD151_ENST00000322008.4_5'Flank|CD151_ENST00000397420.3_5'Flank|CD151_ENST00000397421.1_5'Flank|AP006621.8_ENST00000532946.1_RNA|EFCAB4A_ENST00000450448.1_Missense_Mutation_p.Q198R|EFCAB4A_ENST00000528542.2_Missense_Mutation_p.Q198R			Q8N4Y2	EFC4A_HUMAN		198					cellular protein localization (GO:0034613)|regulation of store-operated calcium entry (GO:2001256)|store-operated calcium entry (GO:0002115)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)			endometrium(1)|large_intestine(1)|lung(1)	3		all_cancers(49;2.31e-08)|all_epithelial(84;3.72e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.179)|all_lung(207;0.227)		all cancers(45;1.45e-25)|Epithelial(43;1.17e-24)|OV - Ovarian serous cystadenocarcinoma(40;6.76e-19)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGCCTGGAGCAGGCGCTGCGG	0.721													A|||	82	0.0163738	0.0061	0.0159	5008	,	,		14088	0.0		0.0527	False		,,,				2504	0.0102				p.Q198R		.											.	EFCAB4A-90	0			c.A593G						.	A	ARG/GLN	29,3393		0,29,1682	4.0	5.0	5.0		593	3.3	1.0	11	dbSNP_134	5	275,7241		1,273,3484	no	missense	EFCAB4A	NM_173584.3	43	1,302,5166	GG,GA,AA		3.6589,0.8475,2.7793	benign	198/295	830120	304,10634	1711	3758	5469	SO:0001583	missense	283229	exon5			TGGAGCAGGCGCT																												ENST00000525077.1:c.593A>G	11.37:g.830120A>G	ENSP00000435299:p.Gln198Arg	Somatic	4	0		WXS	Illumina GAIIx	Phase_I	18	16	NM_173584	0	0	0	0	0	D5LPR2|Q8NBW8	Missense_Mutation	SNP	ENST00000525077.1	37		53	0.024267399267399268	8	0.016260162601626018	4	0.011049723756906077	0	0.0	41	0.05408970976253298	A	14.26	2.483547	0.44147	0.008475	0.036589	ENSG00000177685	ENST00000528542;ENST00000450448;ENST00000321883;ENST00000525077	T;T;T	0.07444	3.19;3.19;3.36	4.39	3.27	0.37495	.	0.316345	0.30658	N	0.009145	T	0.01730	0.0055	L	0.40543	1.245	0.39309	D	0.965048	B;D;P	0.57571	0.225;0.98;0.728	B;P;B	0.57152	0.053;0.814;0.372	T	0.25222	-1.0138	10	0.25106	T	0.35	-11.306	7.3455	0.26660	0.8924:0.0:0.1076:0.0	.	198;105;198	Q8N4Y2-3;E7EU41;Q8N4Y2	.;.;EFC4A_HUMAN	R	198	ENSP00000432334:Q198R;ENSP00000409256:Q198R;ENSP00000435299:Q198R	ENSP00000324024:Q198R	Q	+	2	0	EFCAB4A	820120	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.773000	0.47686	1.617000	0.50277	0.358000	0.22013	CAG	A|0.976;G|0.024		0.721	EFCAB4A-007	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000383097.1		
KRTAP5-1	387264	hgsc.bcm.edu	37	11	1606121	1606150	+	In_Frame_Del	DEL	CCACAGCCACCCTTGGATCCCCCACAAGAG	CCACAGCCACCCTTGGATCCCCCACAAGAG	-	rs138363822|rs199501537|rs80025267|rs76191756	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	CCACAGCCACCCTTGGATCCCCCACAAGAG	CCACAGCCACCCTTGGATCCCCCACAAGAG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr11:1606121_1606150delCCACAGCCACCCTTGGATCCCCCACAAGAG	ENST00000382171.2	-	1	363_392	c.330_359delCTCTTGTGGGGGATCCAAGGGTGGCTGTGG	c.(328-360)ggctcttgtgggggatccaagggtggctgtggt>ggt	p.110_120GSCGGSKGGCG>G	KRTAP5-AS1_ENST00000532922.1_RNA|KRTAP5-AS1_ENST00000424148.1_RNA|KRTAP5-AS1_ENST00000534077.1_RNA|KRTAP5-AS1_ENST00000524947.1_RNA	NM_001005922.1	NP_001005922.1	Q6L8H4	KRA51_HUMAN	keratin associated protein 5-1	110	8 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				endometrium(3)|kidney(1)|lung(9)|skin(2)|upper_aerodigestive_tract(1)	16		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		ACAGCCGGAACCACAGCCACCCTTGGATCCCCCACAAGAGCCACAGCCCC	0.661																																					p.110_120del		.											.	KRTAP5-1-44	0			c.330_359del						.			2171,2035		609,953,541						-5.2	0.0			71	4129,4059		1127,1875,1092	no	coding	KRTAP5-1	NM_001005922.1		1736,2828,1633	A1A1,A1R,RR		49.5725,48.3833,49.169				6300,6094				SO:0001651	inframe_deletion	387264	exon1			CCGGAACCACAGC	AB126070	CCDS31330.1	11p15.5	2008-02-05			ENSG00000205869	ENSG00000205869		"""Keratin associated proteins"""	23596	protein-coding gene	gene with protein product		148022	"""keratin, cuticle, ultrahigh sulphur 1-like"""	KRN1L		15144888	Standard	NM_001005922		Approved	KRTAP5.1	uc001ltu.1	Q6L8H4	OTTHUMG00000057557	ENST00000382171.2:c.330_359delCTCTTGTGGGGGATCCAAGGGTGGCTGTGG	11.37:g.1606121_1606150delCCACAGCCACCCTTGGATCCCCCACAAGAG	ENSP00000371606:p.Gly110_Cys119del	Somatic	85	0		WXS	Illumina GAIIx	Phase_I	89	0	NM_001005922	0	0	0	0	0		In_Frame_Del	DEL	ENST00000382171.2	37	CCDS31330.1																																																																																			.		0.661	KRTAP5-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127922.1	NM_001005922	
KRTAP5-2	440021	bcgsc.ca	37	11	1619181	1619181	+	Silent	SNP	G	G	A	rs61869704|rs59506446		TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr11:1619181G>A	ENST00000412090.1	-	1	343	c.300C>T	c.(298-300)tcC>tcT	p.S100S	KRTAP5-AS1_ENST00000532922.1_RNA|KRTAP5-AS1_ENST00000424148.1_RNA|KRTAP5-AS1_ENST00000534077.1_RNA|KRTAP5-AS1_ENST00000524947.1_RNA	NM_001004325.1	NP_001004325.1	Q701N4	KRA52_HUMAN	keratin associated protein 5-2	100	6 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				large_intestine(1)|lung(2)|skin(1)	4		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		AACCCCCACAGGAGCCACAGC	0.662																																					p.S100S		.											.	KRTAP5-2-44	0			c.C300T						.																																			SO:0001819	synonymous_variant	440021	exon1			CCCACAGGAGCCA	AB126071	CCDS31331.1	11p15.5	2008-02-05				ENSG00000205867		"""Keratin associated proteins"""	23597	protein-coding gene	gene with protein product						15144888	Standard	NM_001004325		Approved	KRTAP5.2, KRTAP5-8	uc001ltv.3	Q701N4		ENST00000412090.1:c.300C>T	11.37:g.1619181G>A		Somatic	41	1		WXS	Illumina GAIIx	Phase_I	52	9	NM_001004325	0	0	0	0	0	A9JTZ1	Silent	SNP	ENST00000412090.1	37	CCDS31331.1																																																																																			G|0.500;A|0.500		0.662	KRTAP5-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384775.1	NM_001004325	
KRTAP5-2	440021	bcgsc.ca	37	11	1619184	1619184	+	Silent	SNP	G	G	A	rs36134435|rs59506446		TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr11:1619184G>A	ENST00000412090.1	-	1	340	c.297C>T	c.(295-297)ggC>ggT	p.G99G	KRTAP5-AS1_ENST00000532922.1_RNA|KRTAP5-AS1_ENST00000424148.1_RNA|KRTAP5-AS1_ENST00000534077.1_RNA|KRTAP5-AS1_ENST00000524947.1_RNA	NM_001004325.1	NP_001004325.1	Q701N4	KRA52_HUMAN	keratin associated protein 5-2	99	6 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				large_intestine(1)|lung(2)|skin(1)	4		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		CCCCACAGGAGCCACAGCCCC	0.652																																					p.G99G		.											.	KRTAP5-2-44	0			c.C297T						.						55.0	76.0	69.0					11																	1619184		2202	4298	6500	SO:0001819	synonymous_variant	440021	exon1			ACAGGAGCCACAG	AB126071	CCDS31331.1	11p15.5	2008-02-05				ENSG00000205867		"""Keratin associated proteins"""	23597	protein-coding gene	gene with protein product						15144888	Standard	NM_001004325		Approved	KRTAP5.2, KRTAP5-8	uc001ltv.3	Q701N4		ENST00000412090.1:c.297C>T	11.37:g.1619184G>A		Somatic	41	1		WXS	Illumina GAIIx	Phase_I	50	9	NM_001004325	0	0	0	0	0	A9JTZ1	Silent	SNP	ENST00000412090.1	37	CCDS31331.1																																																																																			G|0.500;A|0.500		0.652	KRTAP5-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384775.1	NM_001004325	
FAM86C1	55199	hgsc.bcm.edu	37	11	71498648	71498648	+	Silent	SNP	A	A	G	rs12277291	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr11:71498648A>G	ENST00000359244.4	+	1	89	c.66A>G	c.(64-66)gcA>gcG	p.A22A	FAM86C1_ENST00000346333.6_Silent_p.A22A|FAM86C1_ENST00000426628.2_Silent_p.A22A	NM_018172.2	NP_060642.2	Q9NVL1	FA86C_HUMAN	family with sequence similarity 86, member C1	22										lung(1)	1						GCTTCCTGGCAGCGCGCGCCC	0.736													.|||	2256	0.450479	0.3336	0.3487	5008	,	,		9324	0.3452		0.5666	False		,,,				2504	0.6697				p.A22A		.											.	FAM86C1-90	0			c.A66G						.						4.0	4.0	4.0					11																	71498648		1821	3489	5310	SO:0001819	synonymous_variant	55199	exon1			CCTGGCAGCGCGC	AK130709	CCDS8202.1, CCDS41686.1, CCDS44664.1	11q13.4	2011-07-07	2011-07-07	2011-07-07	ENSG00000158483	ENSG00000158483			25561	protein-coding gene	gene with protein product			"""family with sequence similarity 86, member C"""	FAM86C		12477932	Standard	NM_152563		Approved	FLJ10661, FLJ27199	uc001oqv.4	Q9NVL1	OTTHUMG00000160552	ENST00000359244.4:c.66A>G	11.37:g.71498648A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	9	NM_152563	0	0	0	1	1	Q8N5D3	Silent	SNP	ENST00000359244.4	37	CCDS41686.1																																																																																			A|0.630;G|0.370		0.736	FAM86C1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000361120.1	NM_152563	
B3GNT6	192134	hgsc.bcm.edu	37	11	76751542	76751542	+	Frame_Shift_Del	DEL	T	T	-	rs11292198		TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr11:76751542delT	ENST00000533140.1	+	2	1085	c.947delT	c.(946-948)cttfs	p.L316fs	B3GNT6_ENST00000354301.5_Splice_Site_p.L316fs|B3GNT6_ENST00000421061.1_Intron			O43505	B3GN1_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (core 3 synthase)	0					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|poly-N-acetyllactosamine biosynthetic process (GO:0030311)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	N-acetyllactosaminide beta-1,3-N-acetylglucosaminyltransferase activity (GO:0008532)			central_nervous_system(1)|kidney(2)|lung(4)|prostate(1)	8						GGCATGTGTCTTGGAGCGCGC	0.741													T|TT|T|insertion	5008	1.0	1.0	1.0	5008	,	,		12582	1.0		1.0	False		,,,				2504	1.0				.		.											.	.	0			c.946+1T>-						.						1.0	1.0	1.0					11																	76751542		431	917	1348	SO:0001589	frameshift_variant	192134	exon2			TGTGTCTTGGAGC	AB073740	CCDS53681.1	11q13.4	2013-02-19			ENSG00000198488	ENSG00000198488		"""Beta 3-glycosyltransferases"""	24141	protein-coding gene	gene with protein product		615315				11821425	Standard	NM_138706		Approved	B3Gn-T6	uc021qnp.1	Q6ZMB0		ENST00000533140.1:c.947delT	11.37:g.76751542delT	ENSP00000435352:p.Leu316fs	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	12	12	NM_138706	0	0	0	0	0	Q4TTN0	Splice_Site	DEL	ENST00000533140.1	37	CCDS53681.1																																																																																			.		0.741	B3GNT6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000382740.2	NM_138706	
STT3A	3703	bcgsc.ca	37	11	125479363	125479363	+	Silent	SNP	G	G	A	rs2241502	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr11:125479363G>A	ENST00000529196.1	+	11	1202	c.996G>A	c.(994-996)tcG>tcA	p.S332S	STT3A_ENST00000531491.1_Silent_p.S240S|STT3A_ENST00000392708.4_Silent_p.S332S			P46977	STT3A_HUMAN	STT3A, subunit of the oligosaccharyltransferase complex (catalytic)	332					cellular protein metabolic process (GO:0044267)|co-translational protein modification (GO:0043686)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|oligosaccharyltransferase complex (GO:0008250)	dolichyl-diphosphooligosaccharide-protein glycotransferase activity (GO:0004579)			NS(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(15)|skin(1)	33	all_hematologic(175;0.228)	Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0919)|all_lung(97;0.0994)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0996)		GTTTCTACTCGCTGCTGGATC	0.453													A|||	2100	0.419329	0.5227	0.2752	5008	,	,		19315	0.4335		0.3787	False		,,,				2504	0.409				p.S332S		.											.	STT3A-90	0			c.G996A						.	A		2208,2194	588.4+/-386.9	570,1068,563	200.0	189.0	193.0		996	-4.4	0.9	11	dbSNP_98	193	3157,5441	655.5+/-401.3	583,1991,1725	no	coding-synonymous	STT3A	NM_152713.3		1153,3059,2288	AA,AG,GG		36.7178,49.841,41.2692		332/706	125479363	5365,7635	2201	4299	6500	SO:0001819	synonymous_variant	3703	exon10			CTACTCGCTGCTG	BC020965	CCDS8458.1, CCDS60998.1	11q23.3	2013-03-06	2013-03-06	2006-02-07	ENSG00000134910	ENSG00000134910	2.4.99.18		6172	protein-coding gene	gene with protein product	"""dolichyl-diphosphooligosaccharide protein glycotransferase"""	601134	"""integral membrane protein 1"", ""STT3, subunit of the oligosaccharyltransferase complex, homolog A (S. cerevisiae)"", ""STT3A, cataylic subunit of the oligosaccharyltransferase complex"""	ITM1		8941377, 8634329, 10234787	Standard	NM_152713		Approved	TMC, MGC9042, STT3-A	uc001qcd.2	P46977	OTTHUMG00000165852	ENST00000529196.1:c.996G>A	11.37:g.125479363G>A		Somatic	107	0		WXS	Illumina GAIIx	Phase_I	123	6	NM_152713	0	0	43	43	0	B4DJ24|E9PNQ1|Q86XU9|Q8TE35|Q8WUB4	Silent	SNP	ENST00000529196.1	37	CCDS8458.1	893	0.4088827838827839	280	0.5691056910569106	114	0.3149171270718232	220	0.38461538461538464	279	0.36807387862796836	A	20.3	3.961505	0.74016	0.50159	0.367178	ENSG00000134910	ENST00000526726	.	.	.	5.4	-4.43	0.03568	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.09310	P	1.0	.	.	.	.	.	.	T	0.47484	-0.9114	3	.	.	.	-7.8117	0.9414	0.01356	0.2588:0.3186:0.2101:0.2125	rs2241502;rs17720009;rs59721461;rs2241502	.	.	.	T	75	.	.	A	+	1	0	STT3A	124984573	0.016000	0.18221	0.950000	0.38849	0.919000	0.55068	-0.694000	0.05115	-0.923000	0.03785	-1.905000	0.00526	GCT	G|0.581;A|0.419		0.453	STT3A-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000386691.1	NM_152713	
TUBA1C	84790	ucsc.edu	37	12	49666152	49666152	+	Silent	SNP	G	G	A	rs199599214	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr12:49666152G>A	ENST00000301072.6	+	4	767	c.492G>A	c.(490-492)aaG>aaA	p.K164K	RP11-161H23.5_ENST00000550468.2_RNA|TUBA1C_ENST00000541364.1_Silent_p.K234K	NM_032704.3	NP_116093.1	Q9BQE3	TBA1C_HUMAN	tubulin, alpha 1c	164					'de novo' posttranslational protein folding (GO:0051084)|cell division (GO:0051301)|cellular protein metabolic process (GO:0044267)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasmic microtubule (GO:0005881)|microtubule (GO:0005874)|nucleus (GO:0005634)|vesicle (GO:0031982)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.K164K(1)		endometrium(1)|large_intestine(3)|liver(1)|lung(7)|skin(1)	13						ATGGCAAGAAGTCCAAGCTGG	0.547																																					p.K164K		.											.	TUBA1C-90	1	Substitution - coding silent(1)	large_intestine(1)	c.G492A						.						56.0	58.0	57.0					12																	49666152		2203	4300	6503	SO:0001819	synonymous_variant	84790	exon4			CAAGAAGTCCAAG	BC004949	CCDS8782.1	12q13.12	2007-03-16	2007-02-12	2007-02-12		ENSG00000167553		"""Tubulins"""	20768	protein-coding gene	gene with protein product			"""tubulin, alpha 6"""	TUBA6		7821789	Standard	NM_032704		Approved	MGC14580, MGC10851, bcm948	uc001rtt.1	Q9BQE3		ENST00000301072.6:c.492G>A	12.37:g.49666152G>A		Somatic	251	14		WXS	Illumina GAIIx	Phase_I	495	29	NM_032704	1	0	840	1377	536		Silent	SNP	ENST00000301072.6	37	CCDS8782.1																																																																																			G|0.998;A|0.002		0.547	TUBA1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404424.1	NM_032704	
KRT8	3856	broad.mit.edu	37	12	53298675	53298675	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr12:53298675A>C	ENST00000552551.1	-	2	523	c.91T>G	c.(91-93)Tcc>Gcc	p.S31A	KRT8_ENST00000546897.1_Missense_Mutation_p.S31A|KRT8_ENST00000552150.1_Missense_Mutation_p.S59A|KRT8_ENST00000293308.6_Missense_Mutation_p.S31A			P05787	K2C8_HUMAN	keratin 8	31	Head.|Ser-rich.				cell differentiation involved in embryonic placenta development (GO:0060706)|extrinsic apoptotic signaling pathway (GO:0097191)|hepatocyte apoptotic process (GO:0097284)|response to hydrostatic pressure (GO:0051599)|response to other organism (GO:0051707)|sarcomere organization (GO:0045214)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|viral process (GO:0016032)	cell-cell junction (GO:0005911)|costamere (GO:0043034)|cytoplasm (GO:0005737)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)|sarcolemma (GO:0042383)|Z disc (GO:0030018)	scaffold protein binding (GO:0097110)|structural molecule activity (GO:0005198)	p.S31A(4)		endometrium(5)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|prostate(1)|skin(1)	13				BRCA - Breast invasive adenocarcinoma(357;0.108)	Tenecteplase(DB00031)	CTGATGCGGGAACCGGGCCCA	0.662																																					p.S59A		.											.	KRT8-92	4	Substitution - Missense(4)	endometrium(2)|prostate(1)|liver(1)	c.T175G						.						12.0	14.0	13.0					12																	53298675		2120	4158	6278	SO:0001583	missense	3856	exon2			TGCGGGAACCGGG	BC000654	CCDS8841.1, CCDS58234.1	12q13.13	2013-01-16			ENSG00000170421	ENSG00000170421		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6446	protein-coding gene	gene with protein product		148060				2434381, 1705144, 16831889	Standard	NM_002273		Approved	CARD2, K8, CK8, CYK8, K2C8, KO	uc009zmk.1	P05787	OTTHUMG00000169881	ENST00000552551.1:c.91T>G	12.37:g.53298675A>C	ENSP00000447566:p.Ser31Ala	Somatic	93	1		WXS	Illumina GAIIx	Phase_I	157	8	NM_001256282	0	0	130	130	0	A8K4H3|B0AZN5|F8VXB4|Q14099|Q14716|Q14717|Q53GJ0|Q6DHW5|Q6GMY0|Q6P4C7|Q96J60	Missense_Mutation	SNP	ENST00000552551.1	37	CCDS8841.1	.	.	.	.	.	.	.	.	.	.	-	0.012	-1.651707	0.00785	.	.	ENSG00000170421	ENST00000552551;ENST00000293308;ENST00000547916;ENST00000546897;ENST00000552150;ENST00000546826;ENST00000548998;ENST00000547413;ENST00000546542	T;T;T;T;T;T;T;T	0.80393	-1.37;-1.37;-1.37;-1.37;-1.37;-1.37;-1.37;-1.37	4.05	-8.11	0.01082	.	0.706613	0.13676	N	0.370518	T	0.40619	0.1124	N	0.01197	-0.965	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.0	T	0.43589	-0.9382	10	0.05351	T	0.99	.	6.5956	0.22672	0.4212:0.312:0.0:0.2668	.	59;31;31	F8VXB4;F8VU64;P05787	.;.;K2C8_HUMAN	A	31;31;31;31;59;31;71;31;109	ENSP00000447566:S31A;ENSP00000293308:S31A;ENSP00000447402:S31A;ENSP00000449404:S59A;ENSP00000447881:S31A;ENSP00000447040:S71A;ENSP00000448681:S31A;ENSP00000450228:S109A	ENSP00000293308:S31A	S	-	1	0	KRT8	51584942	0.005000	0.15991	0.000000	0.03702	0.065000	0.16274	-0.018000	0.12568	-3.264000	0.00201	-0.290000	0.09829	TCC	.		0.662	KRT8-001	KNOWN	alternative_5_UTR|overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406385.1	NM_002273	
TSPAN31	6302	hgsc.bcm.edu;bcgsc.ca	37	12	58140369	58140372	+	Splice_Site	DEL	CAGA	CAGA	-			TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	CAGA	CAGA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr12:58140369_58140372delCAGA	ENST00000257910.3	+	4	586_587	c.312_313delCAGA	c.(310-315)cacaga>caga	p.HR104fs	TSPAN31_ENST00000547992.1_Intron|CDK4_ENST00000551888.1_5'Flank|TSPAN31_ENST00000553221.1_3'UTR|TSPAN31_ENST00000547472.1_Splice_Site_p.IR21fs	NM_005981.3	NP_005972.1	Q12999	TSN31_HUMAN	tetraspanin 31	104					positive regulation of cell proliferation (GO:0008284)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)				endometrium(1)|kidney(1)|lung(5)	7	all_cancers(7;4.96e-69)|Lung NSC(6;5.5e-25)|all_lung(6;3.87e-23)|all_epithelial(6;1.66e-15)|Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)		GBM - Glioblastoma multiforme(5;4.21e-120)|all cancers(5;3.75e-83)|BRCA - Breast invasive adenocarcinoma(9;0.0294)			CCATATCTTTCAGACAGATGTCAT	0.431																																					p.105_105del		.											.	TSPAN31-446	0			c.313_313del						.																																			SO:0001630	splice_region_variant	6302	exon4			ATCTTTCAGACAG		CCDS8952.1	12q13-q14	2013-02-14	2005-08-16	2005-08-16		ENSG00000135452		"""Tetraspanins"""	10539	protein-coding gene	gene with protein product		181035	"""sarcoma amplified sequence"""	SAS			Standard	NM_005981		Approved		uc001spt.3	Q12999		ENST00000257910.3:c.313-1CAGA>-	12.37:g.58140373_58140376delCAGA		Somatic	124	2		WXS	Illumina GAIIx	Phase_I	257	99	NM_005981	0	0	0	0	0	O00577|Q53X76	Frame_Shift_Del	DEL	ENST00000257910.3	37	CCDS8952.1																																																																																			.		0.431	TSPAN31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408778.1		Frame_Shift_Del
BTBD11	121551	hgsc.bcm.edu	37	12	107713511	107713511	+	Missense_Mutation	SNP	G	G	C	rs961498	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr12:107713511G>C	ENST00000280758.5	+	1	1322	c.794G>C	c.(793-795)gGg>gCg	p.G265A	BTBD11_ENST00000420571.2_Missense_Mutation_p.G265A|BTBD11_ENST00000490090.2_Missense_Mutation_p.G265A	NM_001018072.1	NP_001018082.1	A6QL63	BTBDB_HUMAN	BTB (POZ) domain containing 11	265						integral component of membrane (GO:0016021)				NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(18)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	53						AGTGGCCCTGGGTCAGGCTCG	0.751													G|||	1975	0.394369	0.2194	0.4539	5008	,	,		9398	0.4127		0.492	False		,,,				2504	0.4693				p.G265A		.											.	BTBD11-93	0			c.G794C						.	G	ALA/GLY	786,2720		135,516,1102	5.0	3.0	3.0		794	4.2	0.1	12	dbSNP_86	3	2882,3822		730,1422,1200	no	missense	BTBD11	NM_001018072.1	60	865,1938,2302	CC,CG,GG		42.9893,22.4187,35.9256	benign	265/1105	107713511	3668,6542	1753	3352	5105	SO:0001583	missense	121551	exon1			GCCCTGGGTCAGG	AK091276	CCDS31893.1, CCDS41827.1	12q24.11	2013-10-02			ENSG00000151136	ENSG00000151136		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	23844	protein-coding gene	gene with protein product							Standard	XM_005268645		Approved	FLJ33957, ABTB2B	uc001tmk.1	A6QL63	OTTHUMG00000150413	ENST00000280758.5:c.794G>C	12.37:g.107713511G>C	ENSP00000280758:p.Gly265Ala	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	6	5	NM_001018072	0	0	0	0	0	A4FU41|B3KXG3|C9J019|C9JK80|E9PHS4|Q3ZTQ4|Q52M89|Q6ZV99|Q8N245	Missense_Mutation	SNP	ENST00000280758.5	37	CCDS31893.1	899	0.4116300366300366	119	0.241869918699187	158	0.43646408839779005	241	0.42132867132867136	381	0.5026385224274407	G	11.75	1.731449	0.30684	0.224187	0.429893	ENSG00000151136	ENST00000280758;ENST00000420571;ENST00000490090	T;T;T	0.33865	1.39;1.48;1.43	4.15	4.15	0.48705	Histone-fold (1);	0.272599	0.26478	N	0.024144	T	0.00012	0.0000	L	0.52905	1.665	0.09310	P	1.0	B;B;B	0.28971	0.229;0.088;0.143	B;B;B	0.29176	0.099;0.017;0.061	T	0.47898	-0.9081	9	0.54805	T	0.06	.	13.8733	0.63634	0.0:0.0:1.0:0.0	rs961498	265;265;265	A6QL63-2;A6QL63;A6QL63-3	.;BTBDB_HUMAN;.	A	265	ENSP00000280758:G265A;ENSP00000413889:G265A;ENSP00000447319:G265A	ENSP00000280758:G265A	G	+	2	0	BTBD11	106237641	0.973000	0.33851	0.080000	0.20451	0.808000	0.45660	2.685000	0.46959	2.308000	0.77769	0.549000	0.68633	GGG	G|0.588;C|0.412		0.751	BTBD11-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318003.1	NM_152322	
FAM109A	144717	hgsc.bcm.edu	37	12	111800827	111800835	+	In_Frame_Del	DEL	GCCACCCCC	GCCACCCCC	-	rs3840795|rs139032867|rs199734407|rs200911236	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	GCCACCCCC	GCCACCCCC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr12:111800827_111800835delGCCACCCCC	ENST00000547838.2	-	2	494_502	c.397_405delGGGGGTGGC	c.(397-405)gggggtggcdel	p.GGG133del	FAM109A_ENST00000361483.3_In_Frame_Del_p.GGG146del|FAM109A_ENST00000450786.2_In_Frame_Del_p.113_116AGVA>A|FAM109A_ENST00000548163.1_In_Frame_Del_p.GGG133del|FAM109A_ENST00000392658.5_In_Frame_Del_p.GGG133del			Q8N4B1	SESQ1_HUMAN	family with sequence similarity 109, member A	133					endosome organization (GO:0007032)|receptor recycling (GO:0001881)|retrograde transport, endosome to Golgi (GO:0042147)	clathrin-coated vesicle (GO:0030136)|early endosome (GO:0005769)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	protein homodimerization activity (GO:0042803)	p.G133M(1)|p.G146_G148delGGG(1)|p.G133_G135delGGG(1)		breast(1)|endometrium(1)|lung(1)|ovary(1)	4						gcagggCCATGCCACCCCCGCCACGTACA	0.732														1710	0.341454	0.233	0.3732	5008	,	,		9526	0.6518		0.2078	False		,,,				2504	0.2832				p.146_148del		.											.	FAM109A-90	3	Deletion - In frame(2)|Substitution - Missense(1)	breast(2)|ovary(1)	c.436_444del						.		,,	674,3090		134,406,1342				http://www.ncbi.nlm.nih.gov/sites/varvu?gene	,,	-4.5	0.0		dbSNP_107	6	1126,6432		186,754,2839	no	coding,coding,coding	FAM109A	NM_144671.4,NM_001177997.1,NM_001177996.1	,,	320,1160,4181	A1A1,A1R,RR		14.8981,17.9065,15.8983	,,	,,		1800,9522				SO:0001651	inframe_deletion	144717	exon4			GGCCATGCCACCC	BC034809	CCDS9152.1, CCDS53833.1	12q24.12	2013-01-10			ENSG00000198324	ENSG00000198324		"""Pleckstrin homology (PH) domain containing"""	26509	protein-coding gene	gene with protein product		614239				12477932	Standard	NM_144671		Approved	FLJ32356	uc009zvu.3	Q8N4B1	OTTHUMG00000169547	ENST00000547838.2:c.397_405delGGGGGTGGC	12.37:g.111800827_111800835delGCCACCCCC	ENSP00000447353:p.Gly133_Gly135del	Somatic	1	1		WXS	Illumina GAIIx	Phase_I	24	21	NM_001177996	0	0	0	0	0	J3KP50|Q6PJL9|Q96MH8	In_Frame_Del	DEL	ENST00000547838.2	37	CCDS9152.1																																																																																			.		0.732	FAM109A-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404768.2	NM_144671	
RNFT2	84900	hgsc.bcm.edu	37	12	117187907	117187907	+	Silent	SNP	T	T	C	rs111256849	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr12:117187907T>C	ENST00000257575.4	+	4	578	c.345T>C	c.(343-345)caT>caC	p.H115H	RNFT2_ENST00000319176.7_Silent_p.H115H|RNFT2_ENST00000407967.3_Silent_p.H115H|RNFT2_ENST00000392549.2_Silent_p.H115H			Q96EX2	RNFT2_HUMAN	ring finger protein, transmembrane 2	115	His-rich.					integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(1)|urinary_tract(1)	6	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.034)		CCCACCACCATTTCCACCATG	0.746													C|||	1284	0.25639	0.4826	0.1326	5008	,	,		12011	0.1786		0.166	False		,,,				2504	0.2117				p.H115H		.											.	.	0			c.T345C						.	C	,	1295,2539		234,827,856	3.0	4.0	4.0		345,345	3.2	1.0	12	dbSNP_132	4	888,6786		67,754,3016	no	coding-synonymous,coding-synonymous	RNFT2	NM_001109903.1,NM_032814.3	,	301,1581,3872	CC,CT,TT		11.5715,33.7767,18.9694	,	115/445,115/421	117187907	2183,9325	1917	3837	5754	SO:0001819	synonymous_variant	84900	exon4			CCACCATTTCCAC	AK027533	CCDS9180.2, CCDS44987.1	12q24.22	2013-01-09	2008-02-26	2008-02-26	ENSG00000135119	ENSG00000135119		"""RING-type (C3HC4) zinc fingers"""	25905	protein-coding gene	gene with protein product			"""transmembrane protein 118"""	TMEM118		12477932	Standard	NM_032814		Approved	FLJ14627	uc009zwn.3	Q96EX2	OTTHUMG00000150882	ENST00000257575.4:c.345T>C	12.37:g.117187907T>C		Somatic	5	0		WXS	Illumina GAIIx	Phase_I	32	16	NM_001109903	0	0	0	0	0	E9PAM7|Q96SU5	Silent	SNP	ENST00000257575.4	37	CCDS44987.1																																																																																			T|0.767;C|0.233		0.746	RNFT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320417.1	NM_032814	
EP400	57634	broad.mit.edu	37	12	132547094	132547096	+	In_Frame_Del	DEL	CAG	CAG	-	rs74479394|rs113304321	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr12:132547094_132547096delCAG	ENST00000333577.4	+	48	8399_8401	c.8290_8292delCAG	c.(8290-8292)cagdel	p.Q2784del	EP400_ENST00000330386.6_In_Frame_Del_p.Q2667del|EP400_ENST00000332482.4_In_Frame_Del_p.Q2711del|EP400_ENST00000389562.2_In_Frame_Del_p.Q2747del|EP400_ENST00000389561.2_In_Frame_Del_p.Q2748del			Q96L91	EP400_HUMAN	E1A binding protein p400	2784	Interaction with ZNF42. {ECO:0000250}.|Poly-Gln.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		gcagcaacaacagcagcagcagc	0.567																																					p.2728_2728del		.											.	EP400-520	0			c.8182_8184del						.																																			SO:0001651	inframe_deletion	57634	exon47			CAACAACAGCAGC	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.8290_8292delCAG	12.37:g.132547103_132547105delCAG	ENSP00000333602:p.Gln2784del	Somatic	112	0		WXS	Illumina GAIIx	Phase_I	284	12	NM_015409	0	0	0	0	0	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	In_Frame_Del	DEL	ENST00000333577.4	37																																																																																				-|0.500;AG|0.500		0.567	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409	
FBRSL1	57666	hgsc.bcm.edu	37	12	133159733	133159733	+	Missense_Mutation	SNP	C	C	T	rs11550079	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr12:133159733C>T	ENST00000434748.2	+	17	3527	c.2507C>T	c.(2506-2508)gCc>gTc	p.A836V	FBRSL1_ENST00000261673.6_Missense_Mutation_p.A763V	NM_001142641.1	NP_001136113.1	Q9HCM7	FBSL_HUMAN	fibrosin-like 1	836				A -> V (in Ref. 3; BAB13371). {ECO:0000305}.			poly(A) RNA binding (GO:0044822)			central_nervous_system(2)|endometrium(1)|stomach(1)	4						AAGGAGGAGGCCGCCAAGATG	0.761													C|||	2725	0.544129	0.4939	0.6225	5008	,	,		5355	0.7113		0.4026	False		,,,				2504	0.5297				p.A836V		.											.	FBRSL1-70	0			c.C2507T						.						2.0	6.0	5.0					12																	133159733		475	1282	1757	SO:0001583	missense	57666	exon17			AGGAGGCCGCCAA		CCDS45010.1	12q24.33	2008-12-09			ENSG00000112787	ENSG00000112787			29308	protein-coding gene	gene with protein product						10997877	Standard	NM_001142641		Approved	KIAA1545	uc001ukf.3	Q9HCM7	OTTHUMG00000167991	ENST00000434748.2:c.2507C>T	12.37:g.133159733C>T	ENSP00000396160:p.Ala836Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	4	NM_001142641	0	0	0	3	3	Q86XQ1	Missense_Mutation	SNP	ENST00000434748.2	37	CCDS45010.1	1159	0.5306776556776557	248	0.5040650406504065	211	0.5828729281767956	393	0.6870629370629371	307	0.4050131926121372	c	9.709	1.156573	0.21454	.	.	ENSG00000112787	ENST00000434748;ENST00000261673	T;T	0.31769	1.48;1.49	3.17	-0.242	0.13039	.	0.664906	0.15256	U	0.272063	T	0.00012	0.0000	N	0.14661	0.345	0.80722	P	0.0	P	0.44627	0.839	B	0.40134	0.32	T	0.26677	-1.0096	9	0.45353	T	0.12	-3.3224	5.7681	0.18237	0.1838:0.5714:0.2447:0.0	rs11550079	836	Q9HCM7	FBSL_HUMAN	V	836;763	ENSP00000396160:A836V;ENSP00000261673:A763V	ENSP00000261673:A763V	A	+	2	0	FBRSL1	131669806	0.317000	0.24589	0.004000	0.12327	0.011000	0.07611	0.750000	0.26334	0.431000	0.26258	-0.720000	0.03607	GCC	C|0.470;T|0.530		0.761	FBRSL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397404.2		
SAP18	10284	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	21715115	21715115	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr13:21715115G>A	ENST00000607003.1	+	2	195	c.163G>A	c.(163-165)Gag>Aag	p.E55K	SNORD27_ENST00000516319.1_RNA|RN7SL80P_ENST00000580631.1_RNA|SAP18_ENST00000485646.1_3'UTR|SAP18_ENST00000382533.4_Missense_Mutation_p.E74K			O00422	SAP18_HUMAN	Sin3A-associated protein, 18kDa	55					mRNA processing (GO:0006397)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|positive regulation of apoptotic process (GO:0043065)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	ASAP complex (GO:0061574)|cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transcription corepressor activity (GO:0003714)			kidney(1)|large_intestine(1)|lung(4)	6		all_cancers(29;2.16e-20)|all_epithelial(30;2.97e-18)|all_lung(29;4.58e-16)|Lung SC(185;0.0262)|Breast(139;0.147)		all cancers(112;9.79e-05)|Epithelial(112;0.000292)|OV - Ovarian serous cystadenocarcinoma(117;0.00276)|Lung(94;0.0941)		ACCGTCCAGCGAGTTGCAGAT	0.577																																					p.E74K		.											.	SAP18-226	0			c.G220A						.						89.0	87.0	88.0					13																	21715115		2203	4300	6503	SO:0001583	missense	10284	exon2			TCCAGCGAGTTGC	U96915	CCDS9295.2	13q12.11	2008-02-05	2006-02-02		ENSG00000150459	ENSG00000150459			10530	protein-coding gene	gene with protein product		602949	"""sin3A-associated protein, 18kDa"""			9150135	Standard	NM_005870		Approved	SAP18p, 2HOR0202, MGC27131	uc001uns.3	O00422	OTTHUMG00000016535	ENST00000607003.1:c.163G>A	13.37:g.21715115G>A	ENSP00000475925:p.Glu55Lys	Somatic	77	0		WXS	Illumina GAIIx	Phase_I	102	92	NM_005870	0	0	5	221	216	B2R494|Q2TTR4|Q6IAW9|Q8N606|Q9UF14	Missense_Mutation	SNP	ENST00000607003.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	33|33	5.281348|5.281348	0.95489|0.95489	.|.	.|.	ENSG00000150459|ENSG00000150459	ENST00000382533|ENST00000450573	.|.	.|.	.|.	4.67|4.67	3.82|3.82	0.43975|0.43975	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.77877|0.77877	0.4196|0.4196	M|M	0.87456|0.87456	2.885|2.885	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.97110|.	1.0|.	T|T	0.80714|0.80714	-0.1259|-0.1259	9|5	0.87932|.	D|.	0|.	-15.2484|-15.2484	13.2295|13.2295	0.59933|0.59933	0.0783:0.0:0.9217:0.0|0.0783:0.0:0.9217:0.0	.|.	55|.	O00422|.	SAP18_HUMAN|.	K|Q	74|68	.|.	ENSP00000371973:E74K|.	E|R	+|+	1|2	0|0	SAP18|SAP18	20613115|20613115	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.951000|0.951000	0.60555|0.60555	9.233000|9.233000	0.95337|0.95337	1.099000|1.099000	0.41499|0.41499	0.491000|0.491000	0.48974|0.48974	GAG|CGA	.		0.577	SAP18-009	PUTATIVE	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000470725.1	NM_005870	
DNAAF2	55172	hgsc.bcm.edu	37	14	50100683	50100683	+	Silent	SNP	C	C	G	rs2985686	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr14:50100683C>G	ENST00000298292.8	-	1	1265	c.1185G>C	c.(1183-1185)gcG>gcC	p.A395A	DNAAF2_ENST00000406043.3_Silent_p.A395A	NM_018139.2	NP_060609.2	Q9NVR5	KTU_HUMAN	dynein, axonemal, assembly factor 2	395					axonemal dynein complex assembly (GO:0070286)|bacterial-type flagellum-dependent cell motility (GO:0071973)|cilium-dependent cell motility (GO:0060285)|response to retinoic acid (GO:0032526)	cytoplasm (GO:0005737)				kidney(1)|lung(4)	5						CTCCGTCCTCCGCGCGACTCC	0.781													G|||	2800	0.559105	0.6702	0.6715	5008	,	,		11594	0.1736		0.7604	False		,,,				2504	0.5194				p.A395A		.											.	.	0			c.G1185C						.						1.0	1.0	1.0					14																	50100683		917	2082	2999	SO:0001819	synonymous_variant	55172	exon1			GTCCTCCGCGCGA	AK001425	CCDS9691.2, CCDS45100.1	14q21.3	2012-05-03	2011-06-09	2011-06-09	ENSG00000165506	ENSG00000165506			20188	protein-coding gene	gene with protein product	"""kintoun"""	612517	"""chromosome 14 open reading frame 104"""	C14orf104			Standard	NM_001083908		Approved	FLJ10563, KTU, PF13, CILD10	uc001wws.4	Q9NVR5	OTTHUMG00000152331	ENST00000298292.8:c.1185G>C	14.37:g.50100683C>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_018139	0	0	0	2	2	B9WS54|C0JAP7|Q86TR1|Q86TY8|Q969Z5	Silent	SNP	ENST00000298292.8	37	CCDS9691.2																																																																																			C|0.569;G|0.431		0.781	DNAAF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276813.1		
RPS6KL1	83694	bcgsc.ca	37	14	75386576	75386576	+	Missense_Mutation	SNP	G	G	A	rs2286913	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr14:75386576G>A	ENST00000555647.1	-	4	649	c.362C>T	c.(361-363)cCg>cTg	p.P121L	RPS6KL1_ENST00000557413.1_Missense_Mutation_p.P121L|RPS6KL1_ENST00000358328.4_Missense_Mutation_p.P121L|RPS6KL1_ENST00000354625.2_Missense_Mutation_p.P121L|RPS6KL1_ENST00000554900.1_5'UTR			Q9Y6S9	RPKL1_HUMAN	ribosomal protein S6 kinase-like 1	121			P -> L (in dbSNP:rs2286913). {ECO:0000269|PubMed:17344846}.			ribosome (GO:0005840)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	17				BRCA - Breast invasive adenocarcinoma(234;0.00658)		ACTGCTCAGCGGCCGCTGCAG	0.647													G|||	1492	0.297923	0.0174	0.3876	5008	,	,		14334	0.5853		0.3738	False		,,,				2504	0.2393				p.P121L		.											.	RPS6KL1-359	0			c.C362T						.	G	LEU/PRO	368,4038	178.7+/-207.4	22,324,1857	26.0	27.0	27.0		362	4.1	0.3	14	dbSNP_100	27	3149,5449	456.4+/-364.1	574,2001,1724	yes	missense	RPS6KL1	NM_031464.4	98	596,2325,3581	AA,AG,GG		36.6248,8.3522,27.0455	benign	121/550	75386576	3517,9487	2203	4299	6502	SO:0001583	missense	83694	exon3			CTCAGCGGCCGCT	BC004540	CCDS9834.1, CCDS9834.2	14q24.2	2011-04-05				ENSG00000198208			20222	protein-coding gene	gene with protein product							Standard	NM_031464		Approved	MGC11287	uc010tux.2	Q9Y6S9		ENST00000555647.1:c.362C>T	14.37:g.75386576G>A	ENSP00000452027:p.Pro121Leu	Somatic	70	0		WXS	Illumina GAIIx	Phase_I	89	5	NM_031464	0	0	3	3	0	A6NGM9|Q69YT9|Q6ZMQ6|Q96NR9|Q9BSU9	Missense_Mutation	SNP	ENST00000555647.1	37	CCDS9834.2	754	0.34523809523809523	12	0.024390243902439025	136	0.3756906077348066	318	0.5559440559440559	288	0.37994722955145116	G	7.553	0.663135	0.14710	0.083522	0.366248	ENSG00000198208	ENST00000555647;ENST00000354625;ENST00000557413;ENST00000358328	T;T;T;T	0.22539	1.95;3.3;1.95;1.95	4.99	4.07	0.47477	MIT (1);	0.411157	0.26812	N	0.022368	T	0.00012	0.0000	L	0.29908	0.895	0.32626	P	0.522599	B;P;B	0.36027	0.106;0.533;0.186	B;B;B	0.28553	0.03;0.091;0.024	T	0.36529	-0.9744	9	0.35671	T	0.21	-4.1088	13.2998	0.60317	0.0:0.1589:0.8411:0.0	rs2286913;rs2286913	121;121;121	Q9Y6S9;Q9Y6S9-4;Q9Y6S9-2	RPKL1_HUMAN;.;.	L	121	ENSP00000452027:P121L;ENSP00000346644:P121L;ENSP00000450567:P121L;ENSP00000351086:P121L	ENSP00000346644:P121L	P	-	2	0	RPS6KL1	74456329	0.998000	0.40836	0.306000	0.25113	0.017000	0.09413	3.053000	0.49901	1.297000	0.44761	0.655000	0.94253	CCG	G|0.708;A|0.292		0.647	RPS6KL1-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413732.1		
IRF2BPL	64207	broad.mit.edu	37	14	77493762	77493767	+	In_Frame_Del	DEL	TGCTGC	TGCTGC	-	rs553703325|rs556445214|rs200317113	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr14:77493762_77493767delTGCTGC	ENST00000238647.3	-	1	1267_1272	c.369_374delGCAGCA	c.(367-375)cagcagcaa>caa	p.123_125QQQ>Q		NM_024496.3	NP_078772.1	Q9H1B7	I2BPL_HUMAN	interferon regulatory factor 2 binding protein-like	123	Poly-Gln.				development of secondary female sexual characteristics (GO:0046543)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	extracellular space (GO:0005615)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	11						GAgctgttgttgctgctgctgctgct	0.714														4658	0.930112	0.9297	0.9769	5008	,	,		7189	0.872		0.9712	False		,,,				2504	0.9151				p.123_125del		.											.	IRF2BPL-90	0			c.369_374del						.																																			SO:0001651	inframe_deletion	64207	exon1			TGTTGTTGCTGCT	AJ277365	CCDS9854.1	14q24.3	2011-02-23	2011-02-23	2011-02-23	ENSG00000119669	ENSG00000119669			14282	protein-coding gene	gene with protein product	"""enhanced at puberty 1"""	611720	"""chromosome 14 open reading frame 4"""	C14orf4		11095982, 17627301	Standard	NM_024496		Approved	EAP1, KIAA1865	uc001xsy.4	Q9H1B7		ENST00000238647.3:c.369_374delGCAGCA	14.37:g.77493768_77493773delTGCTGC	ENSP00000238647:p.Gln125_Gln126del	Somatic	14	0		WXS	Illumina GAIIx	Phase_I	26	10	NM_024496	0	0	0	0	0	Q8NDQ2|Q96JG2|Q9H3I7	In_Frame_Del	DEL	ENST00000238647.3	37	CCDS9854.1																																																																																			CTG|1.000;|0.000		0.714	IRF2BPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414298.1	NM_024496	
ISM2	145501	hgsc.bcm.edu	37	14	77942316	77942316	+	Silent	SNP	G	G	A	rs3742732	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr14:77942316G>A	ENST00000342219.4	-	7	1394	c.1338C>T	c.(1336-1338)gaC>gaT	p.D446D	ISM2_ENST00000493585.1_3'UTR|ISM2_ENST00000393684.3_Silent_p.D358D|ISM2_ENST00000412904.1_Silent_p.D365D|ISM2_ENST00000429906.1_Silent_p.D365D	NM_199296.2	NP_954993.1	Q6H9L7	ISM2_HUMAN	isthmin 2	446	AMOP. {ECO:0000255|PROSITE- ProRule:PRU00347}.					extracellular region (GO:0005576)				endometrium(3)|large_intestine(4)|lung(11)|prostate(1)|skin(1)|urinary_tract(1)	21						CCTGGTGCTCGTCCTGTAGGC	0.652													G|||	322	0.0642971	0.0363	0.1571	5008	,	,		17437	0.0149		0.0765	False		,,,				2504	0.0746				p.D446D		.											.	ISM2-91	0			c.C1338T						.	G	,	210,4196	127.8+/-164.7	6,198,1999	36.0	38.0	37.0		,1338	-3.0	0.3	14	dbSNP_107	37	775,7825	179.2+/-228.4	32,711,3557	no	utr-3,coding-synonymous	ISM2	NM_182509.3,NM_199296.2	,	38,909,5556	AA,AG,GG		9.0116,4.7662,7.5734	,	,446/572	77942316	985,12021	2203	4300	6503	SO:0001819	synonymous_variant	145501	exon7			GTGCTCGTCCTGT	AK056709	CCDS9864.1, CCDS45143.1	14q24.3	2013-05-15	2013-05-15	2008-12-23	ENSG00000100593	ENSG00000100593			23176	protein-coding gene	gene with protein product	"""thrombospondin and AMOP containing isthmin-like 1"""	612684	"""thrombospondin, type I domain-containing 3"", ""thrombospondin, type I, domain containing 3"", ""isthmin 2 homolog (zebrafish)"""	THSD3		15194193	Standard	NM_199296		Approved	FLJ32147, TAIL1	uc001xtz.3	Q6H9L7	OTTHUMG00000158563	ENST00000342219.4:c.1338C>T	14.37:g.77942316G>A		Somatic	5	0		WXS	Illumina GAIIx	Phase_I	17	15	NM_199296	0	0	0	0	0	A8K6D5|O95432|Q495U5|Q68CN3|Q86TQ7|Q86TW3|Q86TW4|Q8N501|Q8NBL0	Silent	SNP	ENST00000342219.4	37	CCDS9864.1																																																																																			G|0.930;A|0.070		0.652	ISM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000351309.1	NM_182509	
ISM2	145501	hgsc.bcm.edu	37	14	77965094	77965094	+	Silent	SNP	G	G	A	rs12431905	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr14:77965094G>A	ENST00000342219.4	-	1	99	c.43C>T	c.(43-45)Ctg>Ttg	p.L15L	ISM2_ENST00000493585.1_Silent_p.L15L|ISM2_ENST00000393684.3_5'UTR|ISM2_ENST00000412904.1_Silent_p.L15L|ISM2_ENST00000429906.1_Silent_p.L15L	NM_199296.2	NP_954993.1	Q6H9L7	ISM2_HUMAN	isthmin 2	15						extracellular region (GO:0005576)				endometrium(3)|large_intestine(4)|lung(11)|prostate(1)|skin(1)|urinary_tract(1)	21						GCCAGCAGCAGCACGCAGAGG	0.731													G|||	270	0.0539137	0.0061	0.1571	5008	,	,		10603	0.0129		0.0755	False		,,,				2504	0.0654				p.L15L		.											.	ISM2-91	0			c.C43T						.	G	,	51,3145		0,51,1547	3.0	3.0	3.0		43,43	-4.3	0.0	14	dbSNP_120	3	420,5934		10,400,2767	no	coding-synonymous,coding-synonymous	ISM2	NM_182509.3,NM_199296.2	,	10,451,4314	AA,AG,GG		6.61,1.5957,4.9319	,	15/293,15/572	77965094	471,9079	1598	3177	4775	SO:0001819	synonymous_variant	145501	exon1			GCAGCAGCACGCA	AK056709	CCDS9864.1, CCDS45143.1	14q24.3	2013-05-15	2013-05-15	2008-12-23	ENSG00000100593	ENSG00000100593			23176	protein-coding gene	gene with protein product	"""thrombospondin and AMOP containing isthmin-like 1"""	612684	"""thrombospondin, type I domain-containing 3"", ""thrombospondin, type I, domain containing 3"", ""isthmin 2 homolog (zebrafish)"""	THSD3		15194193	Standard	NM_199296		Approved	FLJ32147, TAIL1	uc001xtz.3	Q6H9L7	OTTHUMG00000158563	ENST00000342219.4:c.43C>T	14.37:g.77965094G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	9	NM_199296	0	0	0	0	0	A8K6D5|O95432|Q495U5|Q68CN3|Q86TQ7|Q86TW3|Q86TW4|Q8N501|Q8NBL0	Silent	SNP	ENST00000342219.4	37	CCDS9864.1																																																																																			G|0.934;A|0.066		0.731	ISM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000351309.1	NM_182509	
KIF26A	26153	hgsc.bcm.edu	37	14	104644099	104644099	+	Silent	SNP	T	T	C	rs2497297	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr14:104644099T>C	ENST00000423312.2	+	12	4974	c.4974T>C	c.(4972-4974)agT>agC	p.S1658S	KIF26A_ENST00000315264.7_Silent_p.S1519S	NM_015656.1	NP_056471.1	Q9ULI4	KI26A_HUMAN	kinesin family member 26A	1658					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|enteric nervous system development (GO:0048484)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of signal transduction (GO:0009968)|regulation of cell growth by extracellular stimulus (GO:0001560)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	21		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0767)	Epithelial(46;0.152)	Epithelial(152;0.161)		GTGGCAGCAGTGGCTATGAGA	0.711													C|||	2031	0.405551	0.5764	0.2911	5008	,	,		13449	0.3185		0.3718	False		,,,				2504	0.3804				p.S1658S		.											.	KIF26A-24	0			c.T4974C						.	C		1381,1865		360,661,602	3.0	4.0	4.0		4974	-0.8	1.0	14	dbSNP_100	4	2221,5011		464,1293,1859	no	coding-synonymous	KIF26A	NM_015656.1		824,1954,2461	CC,CT,TT		30.7107,42.5447,34.3768		1658/1883	104644099	3602,6876	1623	3616	5239	SO:0001819	synonymous_variant	26153	exon12			CAGCAGTGGCTAT	AB033062	CCDS45171.1	14q32.33	2009-03-19			ENSG00000066735	ENSG00000066735		"""Kinesins"""	20226	protein-coding gene	gene with protein product		613231				10574462, 11416179	Standard	NM_015656		Approved	KIAA1236, DKFZP434N178	uc001yos.4	Q9ULI4	OTTHUMG00000154986	ENST00000423312.2:c.4974T>C	14.37:g.104644099T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_015656	0	0	0	0	0	Q8TAZ7|Q96GK3|Q9UFL3	Silent	SNP	ENST00000423312.2	37	CCDS45171.1																																																																																			T|0.603;C|0.397		0.711	KIF26A-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414356.1		
JAG2	3714	hgsc.bcm.edu	37	14	105634121	105634121	+	Silent	SNP	G	G	A	rs113186535	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr14:105634121G>A	ENST00000331782.3	-	2	793	c.390C>T	c.(388-390)gtC>gtT	p.V130V	RP11-44N21.4_ENST00000548203.1_RNA|JAG2_ENST00000347004.2_Silent_p.V130V	NM_002226.4	NP_002217.3	Q9Y219	JAG2_HUMAN	jagged 2	130					auditory receptor cell fate commitment (GO:0009912)|cell cycle (GO:0007049)|cell differentiation (GO:0030154)|epithelial cell apoptotic process involved in palatal shelf morphogenesis (GO:1990134)|gamma-delta T cell differentiation (GO:0042492)|in utero embryonic development (GO:0001701)|morphogenesis of embryonic epithelium (GO:0016331)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|respiratory system process (GO:0003016)|skeletal system development (GO:0001501)|spermatogenesis (GO:0007283)|T cell differentiation (GO:0030217)|thymic T cell selection (GO:0045061)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|growth factor activity (GO:0008083)|Notch binding (GO:0005112)			breast(2)|endometrium(2)|kidney(3)|large_intestine(1)|lung(7)|prostate(2)|skin(5)	22		all_cancers(154;0.0336)|all_epithelial(191;0.0729)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00989)|all cancers(16;0.0114)|Epithelial(46;0.0272)	Epithelial(152;0.047)|OV - Ovarian serous cystadenocarcinoma(161;0.148)|all cancers(159;0.208)		AGGGGATGACGACGAGGCCCG	0.771													G|||	3	0.000599042	0.0008	0.0	5008	,	,		6109	0.0		0.0	False		,,,				2504	0.002				p.V130V		.											.	JAG2-846	0			c.C390T						.						2.0	2.0	2.0					14																	105634121		716	1186	1902	SO:0001819	synonymous_variant	3714	exon2			GATGACGACGAGG	AF020201	CCDS9998.1, CCDS9999.1	14q32	2008-08-01			ENSG00000184916	ENSG00000184916			6189	protein-coding gene	gene with protein product		602570				9315665, 10662552	Standard	NM_002226		Approved		uc001yqg.4	Q9Y219	OTTHUMG00000140172	ENST00000331782.3:c.390C>T	14.37:g.105634121G>A		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_145159	0	0	0	0	0	Q9UE17|Q9UE99|Q9UNK8|Q9Y6P9|Q9Y6Q0	Silent	SNP	ENST00000331782.3	37	CCDS9998.1																																																																																			.		0.771	JAG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276506.2		
KBTBD13	390594	hgsc.bcm.edu	37	15	65369882	65369882	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr15:65369882C>G	ENST00000432196.2	+	1	729	c.729C>G	c.(727-729)agC>agG	p.S243R	RASL12_ENST00000434605.2_5'Flank	NM_001101362.2	NP_001094832.1	C9JR72	KBTBD_HUMAN	kelch repeat and BTB (POZ) domain containing 13	243					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				lung(1)|prostate(1)|skin(1)	3						AGTTCCCCAGCCCGCACCAGC	0.692																																					p.S243R		.											.	.	0			c.C729G						.						5.0	8.0	7.0					15																	65369882		1922	4047	5969	SO:0001583	missense	390594	exon1			CCCCAGCCCGCAC		CCDS45281.1	15q22.31	2014-09-17			ENSG00000234438	ENSG00000234438		"""BTB/POZ domain containing"""	37227	protein-coding gene	gene with protein product	"""nemaline myopathy type 6"""	613727				21109227, 22542517	Standard	NM_001101362		Approved	hCG_1645727, NEM6	uc010uis.2	C9JR72		ENST00000432196.2:c.729C>G	15.37:g.65369882C>G	ENSP00000388723:p.Ser243Arg	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_001101362	0	0	0	0	0		Missense_Mutation	SNP	ENST00000432196.2	37	CCDS45281.1	.	.	.	.	.	.	.	.	.	.	C	6.469	0.454621	0.12283	.	.	ENSG00000234438	ENST00000432196	T	0.81163	-1.46	4.75	2.89	0.33648	Kelch-type beta propeller (1);	.	.	.	.	T	0.71762	0.3378	L	0.45051	1.395	0.34391	D	0.694206	B	0.30686	0.29	B	0.31101	0.124	T	0.72924	-0.4144	9	0.46703	T	0.11	.	8.3033	0.32027	0.0:0.7569:0.0:0.2431	.	243	C9JR72	KBTBD_HUMAN	R	243	ENSP00000388723:S243R	ENSP00000388723:S243R	S	+	3	2	KBTBD13	63156935	0.988000	0.35896	1.000000	0.80357	0.073000	0.16967	0.257000	0.18369	0.625000	0.30304	-0.127000	0.14921	AGC	.		0.692	KBTBD13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418468.2	NM_001101362	
ADAMTS7	11173	hgsc.bcm.edu	37	15	79051846	79051846	+	Missense_Mutation	SNP	T	T	C	rs199524707		TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr15:79051846T>C	ENST00000388820.4	-	24	5188	c.4978A>G	c.(4978-4980)Atc>Gtc	p.I1660V		NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	1660	PLAC. {ECO:0000255|PROSITE- ProRule:PRU00233}.				cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						TGGGTGCGGATGGTGGGCAGC	0.721																																					p.I1660V		.											.	ADAMTS7-226	0			c.A4978G						.						9.0	11.0	10.0					15																	79051846		2122	4204	6326	SO:0001583	missense	11173	exon24			TGCGGATGGTGGG	AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.4978A>G	15.37:g.79051846T>C	ENSP00000373472:p.Ile1660Val	Somatic	32	0		WXS	Illumina GAIIx	Phase_I	70	11	NM_014272	0	0	11	11	0	Q14F51|Q6P7J9	Missense_Mutation	SNP	ENST00000388820.4	37	CCDS32303.1	.	.	.	.	.	.	.	.	.	.	t	0.003	-2.471801	0.00167	.	.	ENSG00000136378	ENST00000388820	T	0.56941	0.43	2.92	-0.818	0.10833	PLAC (1);	0.176997	0.36002	N	0.002857	T	0.17066	0.0410	N	0.01874	-0.695	0.24807	N	0.992664	B	0.02656	0.0	B	0.01281	0.0	T	0.33292	-0.9874	10	0.02654	T	1	.	7.4446	0.27203	0.0:0.6997:0.0:0.3003	.	1660	Q9UKP4	ATS7_HUMAN	V	1660	ENSP00000373472:I1660V	ENSP00000373472:I1660V	I	-	1	0	ADAMTS7	76838901	0.463000	0.25799	0.157000	0.22605	0.002000	0.02628	0.822000	0.27352	-0.289000	0.09038	-0.830000	0.03078	ATC	.		0.721	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421331.1	NM_014272	
TPSAB1	7177	hgsc.bcm.edu;broad.mit.edu	37	16	1292154	1292169	+	Frame_Shift_Del	DEL	CTGTGCCCAGCCCAAC	CTGTGCCCAGCCCAAC	-	rs535832377|rs373933297	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	CTGTGCCCAGCCCAAC	CTGTGCCCAGCCCAAC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr16:1292154_1292169delCTGTGCCCAGCCCAAC	ENST00000338844.3	+	6	774_789	c.741_756delCTGTGCCCAGCCCAAC	c.(739-756)ggctgtgcccagcccaacfs	p.GCAQPN247fs	TPSAB1_ENST00000461509.2_Frame_Shift_Del_p.GCAQPN254fs	NM_003294.3	NP_003285.2	Q15661	TRYB1_HUMAN	tryptase alpha/beta 1	247	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				defense response (GO:0006952)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			NS(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(4)|skin(1)	10		Hepatocellular(780;0.00369)				GGGGCGAGGGCTGTGCCCAGCCCAACCGGCCTGGCA	0.653																																					p.247_252del		.											.	TPSAB1-22	0			c.741_756del						.																																			SO:0001589	frameshift_variant	7177	exon6			CGAGGGCTGTGCC	M33494	CCDS10431.1	16p13.3	2009-11-13	2004-10-14	2004-10-15	ENSG00000172236	ENSG00000172236			12019	protein-coding gene	gene with protein product	"""tryptase alpha II"", ""tryptase beta I"", ""tryptase-I"", ""tryptase-II"", ""tryptase-III"""	191080	"""tryptase beta 1"""	TPSB1, TPS1, TPS2		2203827, 9920877	Standard	NM_003294		Approved		uc002ckz.3	Q15661	OTTHUMG00000090467	ENST00000338844.3:c.741_756delCTGTGCCCAGCCCAAC	16.37:g.1292154_1292169delCTGTGCCCAGCCCAAC	ENSP00000343577:p.Gly247fs	Somatic	309	0		WXS	Illumina GAIIx	Phase_I	678	11	NM_003294	0	0	0	0	0	D2E6R9|D2E6S1|P15157|Q15663|Q6B052|Q9H2Y4|Q9H2Y5|Q9UQI1	Frame_Shift_Del	DEL	ENST00000338844.3	37	CCDS10431.1																																																																																			.		0.653	TPSAB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000206914.1	NM_003294	
MEFV	4210	hgsc.bcm.edu	37	16	3304573	3304573	+	Silent	SNP	G	G	T	rs224223	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr16:3304573G>T	ENST00000219596.1	-	2	534	c.495C>A	c.(493-495)gcC>gcA	p.A165A	MEFV_ENST00000541159.1_Intron|MEFV_ENST00000339854.4_Intron|MEFV_ENST00000536379.1_Intron	NM_000243.2	NP_000234.1	O15553	MEFV_HUMAN	Mediterranean fever	165					inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of macrophage inflammatory protein 1 alpha production (GO:0071641)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity (GO:2001056)	cell projection (GO:0042995)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)	p.A165A(2)		NS(2)|biliary_tract(1)|breast(5)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(3)|prostate(1)|skin(6)	50						GGCCCTCCGAGGCCTTCTCTC	0.766													G|||	1935	0.386382	0.528	0.5965	5008	,	,		10896	0.1667		0.4732	False		,,,				2504	0.183				p.A165A		.											.	MEFV-228	2	Substitution - coding silent(2)	prostate(2)	c.C495A						.	G	,	2112,2188		580,952,618	7.0	7.0	7.0		495,	2.9	0.0	16	dbSNP_79	7	3826,4590		964,1898,1346	no	coding-synonymous,intron	MEFV	NM_000243.2,NM_001198536.1	,	1544,2850,1964	TT,TG,GG		45.461,49.1163,46.6971	,	165/782,	3304573	5938,6778	2150	4208	6358	SO:0001819	synonymous_variant	4210	exon2			CTCCGAGGCCTTC	AF018080	CCDS10498.1, CCDS55981.1	16p13.3	2014-09-17			ENSG00000103313	ENSG00000103313		"""Tripartite motif containing / Tripartite motif containing"""	6998	protein-coding gene	gene with protein product	"""pyrin"""	608107		MEF		9288094	Standard	NM_000243		Approved	FMF, TRIM20	uc002cun.1	O15553	OTTHUMG00000129324	ENST00000219596.1:c.495C>A	16.37:g.3304573G>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	20	7	NM_000243	0	0	0	0	0	D3DUC0|F5H0Q3|Q3MJ84|Q96PN4|Q96PN5	Silent	SNP	ENST00000219596.1	37	CCDS10498.1																																																																																			G|0.570;T|0.430		0.766	MEFV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251464.1	NM_000243	
NPIPB5	100132247	broad.mit.edu	37	16	22545360	22545360	+	Silent	SNP	C	C	T	rs531193755		TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr16:22545360C>T	ENST00000517539.1	+	8	1131	c.1056C>T	c.(1054-1056)ccC>ccT	p.P352P	NPIPB5_ENST00000424340.1_Silent_p.P352P|NPIPB5_ENST00000415654.1_3'UTR			A8MRT5	NPIB5_HUMAN	nuclear pore complex interacting protein family, member B5	352	Pro-rich.					integral component of membrane (GO:0016021)											CCCTtccaccctcagctctac	0.557													.|||	1	0.000199681	0.0	0.0	5008	,	,		42248	0.0		0.0	False		,,,				2504	0.001				p.P352P		.											.	.	0			c.C1056T						.						8.0	5.0	6.0					16																	22545360		82	554	636	SO:0001819	synonymous_variant	0	exon7			TCCACCCTCAGCT		CCDS45443.1	16p12.2	2013-06-11			ENSG00000243716	ENSG00000243716			37233	protein-coding gene	gene with protein product							Standard	NM_001135865		Approved			A8MRT5	OTTHUMG00000163573	ENST00000517539.1:c.1056C>T	16.37:g.22545360C>T		Somatic	12	0		WXS	Illumina GAIIx	Phase_I	28	7	NM_001135865	0	0	92	92	0	B4DK13	Silent	SNP	ENST00000517539.1	37	CCDS45443.1																																																																																			.		0.557	NPIPB5-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374343.2	NM_001135865	
GGA2	23062	hgsc.bcm.edu	37	16	23521643	23521643	+	Splice_Site	SNP	G	G	C	rs17844840|rs1071685	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr16:23521643G>C	ENST00000309859.4	-	1	172	c.90C>G	c.(88-90)ctC>ctG	p.L30L	GGA2_ENST00000567468.1_Splice_Site_p.L30L	NM_015044.4	NP_055859.1	Q9UJY4	GGA2_HUMAN	golgi-associated, gamma adaptin ear containing, ARF binding protein 2	30					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(4)|ovary(1)	21				GBM - Glioblastoma multiforme(48;0.0386)		GCTACTCACTGAGCCACAGCT	0.781													G|||	3460	0.690895	0.5756	0.7291	5008	,	,		7234	0.6964		0.8131	False		,,,				2504	0.6881				p.L30L		.											.	GGA2-91	0			c.C90G						.						1.0	1.0	1.0					16																	23521643		725	1470	2195	SO:0001630	splice_region_variant	23062	exon1			CTCACTGAGCCAC	AF190863	CCDS10611.1	16p12	2010-02-12	2010-02-12		ENSG00000103365	ENSG00000103365			16064	protein-coding gene	gene with protein product		606005				10747088, 10749927	Standard	NM_015044		Approved	VEAR, KIAA1080	uc002dlq.3	Q9UJY4	OTTHUMG00000096957	ENST00000309859.4:c.91+1C>G	16.37:g.23521643G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	12	12	NM_015044	0	0	0	0	0	D3DWF0|O14564|Q9NYN2|Q9UPS2	Silent	SNP	ENST00000309859.4	37	CCDS10611.1																																																																																			G|0.500;C|0.500		0.781	GGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214019.1		Silent
HAS3	3038	broad.mit.edu;bcgsc.ca	37	16	69148594	69148594	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr16:69148594C>T	ENST00000306560.1	+	4	1243	c.1087C>T	c.(1087-1089)Cgg>Tgg	p.R363W	HAS3_ENST00000219322.3_Intron|HAS3_ENST00000569188.1_Missense_Mutation_p.R363W	NM_005329.2	NP_005320.2	O00219	HYAS3_HUMAN	hyaluronan synthase 3	363					carbohydrate metabolic process (GO:0005975)|extracellular matrix assembly (GO:0085029)|extracellular polysaccharide biosynthetic process (GO:0045226)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|positive regulation of hyaluranon cable assembly (GO:1900106)|positive regulation of transcription, DNA-templated (GO:0045893)|small molecule metabolic process (GO:0044281)	hyaluranon cable (GO:0036117)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronan synthase activity (GO:0050501)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|urinary_tract(2)	16		Ovarian(137;0.101)		OV - Ovarian serous cystadenocarcinoma(108;0.0694)		GTCTTACTTCCGGGAGTGGCT	0.557																																					p.R363W		.											.	HAS3-90	0			c.C1087T						.						100.0	92.0	95.0					16																	69148594		2198	4300	6498	SO:0001583	missense	3038	exon4			TACTTCCGGGAGT	BC021853	CCDS10870.1, CCDS10871.1	16q22.1	2013-02-22			ENSG00000103044	ENSG00000103044	2.4.1.212	"""Glycosyltransferase family 2 domain containing"""	4820	protein-coding gene	gene with protein product		602428				9169154, 9083017	Standard	NM_005329		Approved		uc010cfh.3	O00219	OTTHUMG00000137562	ENST00000306560.1:c.1087C>T	16.37:g.69148594C>T	ENSP00000304440:p.Arg363Trp	Somatic	97	1		WXS	Illumina GAIIx	Phase_I	220	8	NM_005329	0	0	0	0	0	A8K5T5|Q8WTZ0|Q9NYP0	Missense_Mutation	SNP	ENST00000306560.1	37	CCDS10871.1	.	.	.	.	.	.	.	.	.	.	C	20.5	3.997551	0.74818	.	.	ENSG00000103044	ENST00000306560	T	0.61742	0.08	6.07	4.08	0.47627	.	0.000000	0.85682	D	0.000000	T	0.78246	0.4253	M	0.85542	2.76	0.54753	D	0.999982	D	0.89917	1.0	D	0.91635	0.999	T	0.82151	-0.0599	10	0.87932	D	0	-22.6251	15.3021	0.73962	0.2556:0.7444:0.0:0.0	.	363	O00219	HAS3_HUMAN	W	363	ENSP00000304440:R363W	ENSP00000304440:R363W	R	+	1	2	HAS3	67706095	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.274000	0.51631	0.849000	0.35215	0.655000	0.94253	CGG	.		0.557	HAS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268898.2	NM_138612	
ADAD2	161931	hgsc.bcm.edu	37	16	84224967	84224967	+	Missense_Mutation	SNP	G	G	A	rs8044695|rs554488585	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr16:84224967G>A	ENST00000315906.5	+	1	183	c.131G>A	c.(130-132)gGg>gAg	p.G44E	ADAD2_ENST00000268624.3_Missense_Mutation_p.G44E|RP11-486L19.2_ENST00000561900.1_RNA|ADAD2_ENST00000567413.1_3'UTR|RP11-486L19.2_ENST00000536986.1_RNA|RP11-486L19.2_ENST00000565643.1_RNA	NM_001145400.1	NP_001138872.1	Q8NCV1	ADAD2_HUMAN	adenosine deaminase domain containing 2	44			G -> E (in dbSNP:rs8044695). {ECO:0000269|PubMed:14702039, ECO:0000269|Ref.3}.		RNA processing (GO:0006396)		adenosine deaminase activity (GO:0004000)|RNA binding (GO:0003723)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(2)|skin(1)	13						AGTGCCTgggggcccgcgccc	0.751														3435	0.685903	0.8616	0.6686	5008	,	,		11640	0.6677		0.6471	False		,,,				2504	0.5194				p.G44E		.											.	ADAD2-68	0			c.G131A						.	A	GLU/GLY,GLU/GLY	3145,519		1356,433,43	5.0	7.0	7.0		131,131	-1.1	0.0	16	dbSNP_116	7	5102,2224		1808,1486,369	no	missense,missense	ADAD2	NM_001145400.1,NM_139174.3	98,98	3164,1919,412	AA,AG,GG		30.3576,14.1648,24.9591	benign,benign	44/584,44/666	84224967	8247,2743	1832	3663	5495	SO:0001583	missense	161931	exon1			CCTGGGGGCCCGC	AF447586	CCDS10944.1, CCDS45536.1	16q24.1	2007-05-31			ENSG00000140955	ENSG00000140955			30714	protein-coding gene	gene with protein product							Standard	NM_139174		Approved	TENRL, FLJ00337	uc002fhr.2	Q8NCV1	OTTHUMG00000137637	ENST00000315906.5:c.131G>A	16.37:g.84224967G>A	ENSP00000325153:p.Gly44Glu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	17	9	NM_001145400	0	0	0	0	0	B2RCL6|Q8NA94	Missense_Mutation	SNP	ENST00000315906.5	37	CCDS45536.1	1545	0.7074175824175825	420	0.8536585365853658	227	0.6270718232044199	403	0.7045454545454546	495	0.6530343007915568	A	0.689	-0.795256	0.02862	0.858352	0.696424	ENSG00000140955	ENST00000315906;ENST00000268624	T;T	0.16196	2.36;2.47	3.61	-1.07	0.09968	.	1.276770	0.06034	N	0.653713	T	0.00012	0.0000	N	0.01874	-0.695	0.80722	P	0.0	B;B	0.06786	0.0;0.001	B;B	0.04013	0.0;0.001	T	0.30297	-0.9983	9	0.02654	T	1	-5.6132	8.9029	0.35505	0.4397:0.0:0.5603:0.0	rs8044695;rs57310648	44;44	Q8NCV1;Q8NCV1-2	ADAD2_HUMAN;.	E	44	ENSP00000325153:G44E;ENSP00000268624:G44E	ENSP00000268624:G44E	G	+	2	0	ADAD2	82782468	0.057000	0.20700	0.000000	0.03702	0.002000	0.02628	-0.069000	0.11542	-0.575000	0.05982	-1.305000	0.01319	GGG	G|0.292;A|0.708		0.751	ADAD2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433385.1	NM_139174	
ZFPM1	161882	hgsc.bcm.edu	37	16	88599696	88599697	+	Frame_Shift_Del	DEL	GA	GA	-	rs368520732|rs67712719	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	GA	GA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr16:88599696_88599697delGA	ENST00000319555.3	+	10	1652_1653	c.1330_1331delGA	c.(1330-1332)gagfs	p.E444fs	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	444				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GGCCAGAGCGGAGCCTCTGGCC	0.743														4881	0.974641	0.9138	0.9914	5008	,	,		7261	0.996		1.0	False		,,,				2504	0.9969				p.444_444del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1330_1331del						.			2219,383		1063,93,145						-6.5	0.0		dbSNP_130	3	4709,133		2339,31,51	no	frameshift	ZFPM1	NM_153813.2		3402,124,196	A1A1,A1R,RR		2.7468,14.7194,6.9318				6928,516				SO:0001589	frameshift_variant	161882	exon10			AGAGCGGAGCCTC	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1330_1331delGA	16.37:g.88599696_88599697delGA	ENSP00000326630:p.Glu444fs	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	25	10	NM_153813	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.743	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
ZFPM1	161882	hgsc.bcm.edu	37	16	88599697	88599705	+	In_Frame_Del	DEL	AGCCTCTGG	AGCCTCTGG	-	rs67873604|rs149145771|rs368520732|rs67322929|rs201915453|rs67712719	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	AGCCTCTGG	AGCCTCTGG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr16:88599697_88599705delAGCCTCTGG	ENST00000319555.3	+	10	1653_1661	c.1331_1339delAGCCTCTGG	c.(1330-1341)gagcctctggcc>gcc	p.EPL444del	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	444				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GCCAGAGCGGAGCCTCTGGCCCAGAATGG	0.746																																					p.444_447del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1331_1339del						.																																			SO:0001651	inframe_deletion	161882	exon10			GAGCGGAGCCTCT	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1331_1339delAGCCTCTGG	16.37:g.88599697_88599705delAGCCTCTGG	ENSP00000326630:p.Glu444_Leu446del	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	26	0	NM_153813	0	0	0	0	0		In_Frame_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.746	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
ZFPM1	161882	hgsc.bcm.edu	37	16	88599701	88599701	+	Frame_Shift_Del	DEL	T	T	-	rs67322929|rs149145771	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr16:88599701delT	ENST00000319555.3	+	10	1657	c.1335delT	c.(1333-1335)cctfs	p.P445fs	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	445				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GAGCGGAGCCTCTGGCCCAGA	0.746													-|T|-|insertion	4871	0.972644	0.9145	0.9899	5008	,	,		7405	0.995		0.994	False		,,,				2504	0.9939				p.P445fs	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1335delT						.						1.0	1.0	1.0					16																	88599701		392	657	1049	SO:0001589	frameshift_variant	161882	exon10			GGAGCCTCTGGCC	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1335delT	16.37:g.88599701delT	ENSP00000326630:p.Pro445fs	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	20	11	NM_153813	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.746	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
ZFPM1	161882	hgsc.bcm.edu	37	16	88599703	88599705	+	In_Frame_Del	DEL	TGG	TGG	-	rs149145771|rs67873604	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	TGG	TGG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr16:88599703_88599705delTGG	ENST00000319555.3	+	10	1659_1661	c.1337_1339delTGG	c.(1336-1341)ctggcc>ccc	p.446_447LA>P	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	446				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GCGGAGCCTCTGGCCCAGAATGG	0.739														4871	0.972644	0.9145	0.9899	5008	,	,		7191	0.995		0.994	False		,,,				2504	0.9939				p.446_447del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1337_1339del						.																																			SO:0001651	inframe_deletion	161882	exon10			AGCCTCTGGCCCA	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1337_1339delTGG	16.37:g.88599703_88599705delTGG	ENSP00000326630:p.Leu446_Ala447delinsPro	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	17	11	NM_153813	0	0	0	0	0		In_Frame_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.739	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
TVP23C	201158	ucsc.edu	37	17	15457087	15457087	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr17:15457087C>T	ENST00000225576.3	-	3	247	c.152G>A	c.(151-153)tGt>tAt	p.C51Y	TVP23C_ENST00000518321.1_Missense_Mutation_p.C51Y|TVP23C_ENST00000584811.1_5'UTR|TVP23C_ENST00000519970.1_Intron|TVP23C_ENST00000438826.3_Missense_Mutation_p.C51Y|TVP23C_ENST00000428082.2_Missense_Mutation_p.C51Y|TVP23C-CDRT4_ENST00000522212.2_Missense_Mutation_p.C51Y	NM_145301.2	NP_660344.2	Q96ET8	TV23C_HUMAN	trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)	51						integral component of membrane (GO:0016021)											ACAGAGAAGACAGACGATGAT	0.373																																					p.C51Y		.											.	.	0			c.G152A						.						274.0	265.0	268.0					17																	15457087		2203	4300	6503	SO:0001583	missense	201158	exon3			AGAAGACAGACGA	BC011952	CCDS11170.1, CCDS45617.1	17p12	2012-11-29	2012-11-29	2012-11-29	ENSG00000175106	ENSG00000175106			30453	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B2"""	FAM18B2			Standard	NM_001135036		Approved	MGC8763	uc002goq.2	Q96ET8	OTTHUMG00000171461	ENST00000225576.3:c.152G>A	17.37:g.15457087C>T	ENSP00000225576:p.Cys51Tyr	Somatic	352	17		WXS	Illumina GAIIx	Phase_I	288	13	NM_145301	0	0	6	42	36	Q3LIC7	Missense_Mutation	SNP	ENST00000225576.3	37	CCDS11170.1	.	.	.	.	.	.	.	.	.	.	.	2.368	-0.344949	0.05208	.	.	ENSG00000259024;ENSG00000175106;ENSG00000175106;ENSG00000175106	ENST00000522212;ENST00000225576;ENST00000428082;ENST00000438826	T;T;T;T	0.25749	1.78;1.78;1.78;1.78	4.47	4.47	0.54385	.	0.000000	0.85682	N	0.000000	T	0.02571	0.0078	N	0.00004	-3.335	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.0;0.0;0.002	T	0.38457	-0.9660	10	0.02654	T	1	-3.8701	9.492	0.38965	0.0:0.0877:0.0:0.9123	.	51;51;51	Q96ET8-2;Q96ET8-3;Q96ET8	.;.;F18B2_HUMAN	Y	51	ENSP00000429865:C51Y;ENSP00000225576:C51Y;ENSP00000406387:C51Y;ENSP00000413355:C51Y	ENSP00000225576:C51Y	C	-	2	0	RP11-726O12.1;FAM18B2	15397812	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	6.178000	0.71968	0.670000	0.31165	-0.442000	0.05670	TGT	.		0.373	TVP23C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000130705.2	NM_145301	
KRTAP2-3	730755	hgsc.bcm.edu	37	17	39216019	39216019	+	Missense_Mutation	SNP	G	G	A	rs12937861	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr17:39216019G>A	ENST00000391418.2	-	1	325	c.284C>T	c.(283-285)gCc>gTc	p.A95V		NM_001165252.1	NP_001158724.1	P0C7H8	KRA23_HUMAN	keratin associated protein 2-3	95	10 X 5 AA repeats of C-C-[CDPQRWG]- [APRS]-[CIPSTVD].					keratin filament (GO:0045095)											GCAGGTGGTGGCCCAGCAGCA	0.711													g|||	1134	0.226438	0.4728	0.1729	5008	,	,		13335	0.1825		0.1074	False		,,,				2504	0.0992				p.A95V		.											.	.	0			c.C284T						.						7.0	9.0	9.0					17																	39216019		688	1582	2270	SO:0001583	missense	730755	exon1			GTGGTGGCCCAGC	BC012486	CCDS54123.1	17q21.2	2012-08-03			ENSG00000212724	ENSG00000212724		"""Keratin associated proteins"""	18906	protein-coding gene	gene with protein product							Standard	NM_001165252		Approved	KAP2.3	uc002hvx.3	P0C7H8	OTTHUMG00000133655	ENST00000391418.2:c.284C>T	17.37:g.39216019G>A	ENSP00000375237:p.Ala95Val	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	17	17	NM_001165252	0	0	0	0	0		Missense_Mutation	SNP	ENST00000391418.2	37	CCDS54123.1	488	0.22344322344322345	241	0.4898373983739837	56	0.15469613259668508	108	0.1888111888111888	83	0.10949868073878628	.	11.94	1.789012	0.31685	.	.	ENSG00000212724	ENST00000391418	.	.	.	5.63	3.62	0.41486	.	0.381500	0.18532	N	0.138475	T	0.00012	0.0000	.	.	.	0.36495	P	0.13134	B	0.02656	0.0	B	0.09377	0.004	T	0.43972	-0.9358	7	0.10902	T	0.67	.	9.4266	0.38583	0.1708:0.0:0.8292:0.0	rs12937861	95	Q9BYR9	KRA24_HUMAN	V	95	.	ENSP00000375237:A95V	A	-	2	0	KRTAP2-3	36469545	1.000000	0.71417	0.997000	0.53966	0.950000	0.60333	1.884000	0.39668	1.395000	0.46643	0.556000	0.70494	GCC	A|1.000;|0.000		0.711	KRTAP2-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257692.1	NM_001165252	
TXNDC2	84203	ucsc.edu	37	18	9887448	9887448	+	Silent	SNP	C	C	T	rs34819368		TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr18:9887448C>T	ENST00000306084.6	+	2	1171	c.972C>T	c.(970-972)ccC>ccT	p.P324P	TXNDC2_ENST00000536353.2_3'UTR|TXNDC2_ENST00000357775.5_Silent_p.P257P	NM_001098529.1	NP_001091999.1	Q86VQ3	TXND2_HUMAN	thioredoxin domain containing 2 (spermatozoa)	324	22 X 15 AA approximate tandem repeat of Q-P-K-X-G-D-I-P-K-S-[PS]-E-[KE]-X-I.				cell differentiation (GO:0030154)|cell redox homeostasis (GO:0045454)|glycerol ether metabolic process (GO:0006662)|multicellular organismal development (GO:0007275)|oxidation-reduction process (GO:0055114)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|motile cilium (GO:0031514)|nucleolus (GO:0005730)|nucleus (GO:0005634)|outer dense fiber (GO:0001520)	nutrient reservoir activity (GO:0045735)|protein disulfide isomerase activity (GO:0003756)|protein disulfide oxidoreductase activity (GO:0015035)|thioredoxin-disulfide reductase activity (GO:0004791)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|skin(7)|urinary_tract(1)	31						CCATCCAGCCCAAGGAGGGTG	0.597																																					p.P324P		.											.	TXNDC2-92	0			c.C972T						.						121.0	117.0	118.0					18																	9887448		2203	4300	6503	SO:0001819	synonymous_variant	84203	exon2			CCAGCCCAAGGAG	AF080095	CCDS11846.1, CCDS42414.1	18p11.31-p11.2	2009-03-11	2009-03-11	2007-08-16	ENSG00000168454	ENSG00000168454			16470	protein-coding gene	gene with protein product	"""sperm-specific thioredoxin 1"""					11230166, 11399755	Standard	NM_001098529		Approved	SPTRX1	uc002koi.4	Q86VQ3	OTTHUMG00000131602	ENST00000306084.6:c.972C>T	18.37:g.9887448C>T		Somatic	135	8		WXS	Illumina GAIIx	Phase_I	105	22	NM_001098529	0	0	0	0	0	A5YM73|Q8N7U4|Q96RX3|Q9H0L8	Silent	SNP	ENST00000306084.6	37	CCDS42414.1																																																																																			.		0.597	TXNDC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254487.1		
SALL3	27164	hgsc.bcm.edu	37	18	76753768	76753768	+	Missense_Mutation	SNP	C	C	G	rs2447437	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr18:76753768C>G	ENST00000537592.2	+	2	1777	c.1777C>G	c.(1777-1779)Ctc>Gtc	p.L593V	SALL3_ENST00000575389.2_Missense_Mutation_p.L593V|SALL3_ENST00000536229.3_Missense_Mutation_p.L460V	NM_171999.3	NP_741996.2	Q9BXA9	SALL3_HUMAN	spalt-like transcription factor 3	593			L -> V (in dbSNP:rs2447437). {ECO:0000269|Ref.1}.		forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|negative regulation of smoothened signaling pathway (GO:0045879)|olfactory bulb interneuron development (GO:0021891)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L593V(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(40)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		CGGGCCGCCCCTCACTAAAGC	0.731													C|||	3973	0.793331	0.5825	0.8444	5008	,	,		9900	0.9226		0.8648	False		,,,				2504	0.8354				p.L593V		.											.	SALL3-155	1	Substitution - Missense(1)	prostate(1)	c.C1777G						.	C	VAL/LEU	2422,1000		875,672,164	3.0	4.0	4.0		1777	5.2	0.2	18	dbSNP_100	4	6372,926		2808,756,85	yes	missense	SALL3	NM_171999.2	32	3683,1428,249	GG,GC,CC		12.6884,29.2227,17.9664	benign	593/1301	76753768	8794,1926	1711	3649	5360	SO:0001583	missense	27164	exon2			CCGCCCCTCACTA	AJ007421	CCDS12013.1	18q23	2013-10-17	2013-10-17		ENSG00000256463	ENSG00000256463		"""Zinc fingers, C2H2-type"""	10527	protein-coding gene	gene with protein product		605079	"""sal (Drosophila)-like 3"", ""sal-like 3 (Drosophila)"""			10610715	Standard	NM_171999		Approved	ZNF796	uc002lmt.3	Q9BXA9	OTTHUMG00000132896	ENST00000537592.2:c.1777C>G	18.37:g.76753768C>G	ENSP00000441823:p.Leu593Val	Somatic	3	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_171999	0	0	0	0	0	Q9UGH1	Missense_Mutation	SNP	ENST00000537592.2	37	CCDS12013.1	1724	0.7893772893772893	287	0.5833333333333334	299	0.8259668508287292	511	0.8933566433566433	627	0.8271767810026385	C	0.073	-1.197989	0.01594	0.707773	0.873116	ENSG00000256463	ENST00000537592;ENST00000536229;ENST00000543056	T	0.08984	3.03	5.2	5.2	0.72013	.	0.464067	0.17974	N	0.155779	T	0.00012	0.0000	L	0.35288	1.05	0.80722	P	0.0	B;B	0.15473	0.013;0.006	B;B	0.18561	0.022;0.002	T	0.36237	-0.9756	9	0.14656	T	0.56	-21.7235	10.231	0.43256	0.2471:0.6277:0.1252:0.0	rs2447437	325;593	F5GXY4;Q9BXA9	.;SALL3_HUMAN	V	593;593;325	ENSP00000441823:L593V	ENSP00000299466:L593V	L	+	1	0	SALL3	74854756	0.002000	0.14202	0.157000	0.22605	0.006000	0.05464	0.292000	0.19011	2.584000	0.87258	0.563000	0.77884	CTC	C|0.780;G|0.220		0.731	SALL3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256397.1	NM_171999	
APC2	10297	hgsc.bcm.edu	37	19	1467684	1467684	+	Silent	SNP	A	A	C	rs265273	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr19:1467684A>C	ENST00000535453.1	+	14	6097	c.4384A>C	c.(4384-4386)Aga>Cga	p.R1462R	C19orf25_ENST00000588427.1_Intron|APC2_ENST00000233607.2_Silent_p.R1462R|APC2_ENST00000238483.4_Silent_p.R1188R			P02655	APOC2_HUMAN	adenomatosis polyposis coli 2	0					cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|chylomicron remnant clearance (GO:0034382)|chylomicron remodeling (GO:0034371)|high-density lipoprotein particle clearance (GO:0034384)|lipid catabolic process (GO:0016042)|lipoprotein metabolic process (GO:0042157)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cholesterol transport (GO:0032375)|negative regulation of lipid metabolic process (GO:0045833)|negative regulation of receptor-mediated endocytosis (GO:0048261)|negative regulation of very-low-density lipoprotein particle clearance (GO:0010916)|phospholipid efflux (GO:0033700)|phototransduction, visible light (GO:0007603)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of phospholipid catabolic process (GO:0060697)|positive regulation of triglyceride catabolic process (GO:0010898)|positive regulation of very-low-density lipoprotein particle remodeling (GO:0010902)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|triglyceride homeostasis (GO:0070328)|triglyceride-rich lipoprotein particle remodeling (GO:0034370)|very-low-density lipoprotein particle remodeling (GO:0034372)	chylomicron (GO:0042627)|early endosome (GO:0005769)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate-density lipoprotein particle (GO:0034363)|low-density lipoprotein particle (GO:0034362)|spherical high-density lipoprotein particle (GO:0034366)|very-low-density lipoprotein particle (GO:0034361)	lipase inhibitor activity (GO:0055102)|lipid binding (GO:0008289)|lipoprotein lipase activator activity (GO:0060230)|phospholipase activator activity (GO:0016004)|phospholipase binding (GO:0043274)|protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|kidney(4)|large_intestine(2)|lung(5)|pancreas(1)|skin(2)	18		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGGCAAGAACAGAGCAGGGCT	0.776													C|||	4887	0.975839	0.9977	0.9424	5008	,	,		10431	1.0		0.9374	False		,,,				2504	0.9847				p.R1462R		.											.	APC2-290	0			c.A4384C						.						1.0	1.0	1.0					19																	1467684		925	2103	3028	SO:0001819	synonymous_variant	10297	exon15			AAGAACAGAGCAG		CCDS12068.1	19p13.3	2013-02-14			ENSG00000115266	ENSG00000115266		"""Armadillo repeat containing"""	24036	protein-coding gene	gene with protein product	"""adenomatous polyposis coli like"""	612034				9823329, 10021369	Standard	XM_005259475		Approved	APCL	uc002lsr.1	O95996		ENST00000535453.1:c.4384A>C	19.37:g.1467684A>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_005883	0	0	0	0	0	C0JYY4|Q9BS39|Q9UDE3|Q9UNK3	Silent	SNP	ENST00000535453.1	37	CCDS12068.1																																																																																			A|0.030;C|0.970		0.776	APC2-004	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449539.2	NM_005883	
PLIN3	10226	bcgsc.ca	37	19	4852137	4852137	+	Silent	SNP	C	C	T	rs1055919	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr19:4852137C>T	ENST00000221957.4	-	5	701	c.525G>A	c.(523-525)tcG>tcA	p.S175S	PLIN3_ENST00000585479.1_Silent_p.S175S|PLIN3_ENST00000592528.1_Silent_p.S163S	NM_001164189.1|NM_001164194.1|NM_005817.4	NP_001157661.1|NP_001157666.1|NP_005808.3	O60664	PLIN3_HUMAN	perilipin 3	175					vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)|membrane (GO:0016020)				cervix(1)|endometrium(2)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)	9					Galsulfase(DB01279)|Idursulfase(DB01271)	AGCCCATGACCGATTGGACGC	0.662											OREG0025175	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	C|||	2411	0.48143	0.4297	0.5231	5008	,	,		15629	0.4821		0.4682	False		,,,				2504	0.5348				p.S175S		.											.	PLIN3-90	0			c.G525A						.	C	,,	1855,2551	535.3+/-374.2	402,1051,750	75.0	55.0	62.0		525,489,525	-10.3	0.0	19	dbSNP_86	62	3698,4902	527.2+/-381.1	768,2162,1370	no	coding-synonymous,coding-synonymous,coding-synonymous	PLIN3	NM_001164189.1,NM_001164194.1,NM_005817.4	,,	1170,3213,2120	TT,TC,CC		43.0,42.1017,42.6957	,,	175/434,163/423,175/435	4852137	5553,7453	2203	4300	6503	SO:0001819	synonymous_variant	10226	exon5			CATGACCGATTGG	AF051314	CCDS12137.1, CCDS59337.1, CCDS59338.1	19p13.3	2009-08-12	2009-08-12	2009-08-12		ENSG00000105355		"""Perilipins"""	16893	protein-coding gene	gene with protein product	"""cargo selection protein (mannose 6 phosphate receptor binding protein)"", ""placental protein 17"", ""MPR-BINDING PROTEIN, 47-KD"""	602702	"""mannose-6-phosphate receptor binding protein 1"""	M6PRBP1		9590177, 6856484, 19638644	Standard	NM_005817		Approved	TIP47, PP17	uc002mbj.2	O60664		ENST00000221957.4:c.525G>A	19.37:g.4852137C>T		Somatic	59	0	622	WXS	Illumina GAIIx	Phase_I	72	4	NM_001164189	0	0	170	170	0	A8K4Y9|K7EQF4|Q53G77|Q9BS03|Q9UBD7|Q9UP92	Silent	SNP	ENST00000221957.4	37	CCDS12137.1																																																																																			C|0.557;T|0.443		0.662	PLIN3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000450436.1	NM_005817	
KANK3	256949	hgsc.bcm.edu	37	19	8399709	8399709	+	Silent	SNP	C	C	A	rs890852	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr19:8399709C>A	ENST00000593649.1	-	3	1067	c.1002G>T	c.(1000-1002)gtG>gtT	p.V334V	KANK3_ENST00000330915.3_Silent_p.V334V			Q6NY19	KANK3_HUMAN	KN motif and ankyrin repeat domains 3	334										breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|skin(1)|urinary_tract(1)	9						CGTCCGCCTCCACGGTCTCGG	0.781													A|||	606	0.121006	0.0946	0.0634	5008	,	,		9441	0.0893		0.1859	False		,,,				2504	0.1636				p.V334V		.											.	KANK3-90	0			c.G1002T						.						1.0	1.0	1.0					19																	8399709		1139	2506	3645	SO:0001819	synonymous_variant	256949	exon3			CGCCTCCACGGTC	AK128815	CCDS12199.1	19p13.2	2013-01-10	2008-01-29	2008-01-29		ENSG00000186994		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	24796	protein-coding gene	gene with protein product		614611	"""ankyrin repeat domain 47"""	ANKRD47		17996375, 19554261	Standard	NM_198471		Approved	FLJ46061	uc010dwa.3	Q6NY19		ENST00000593649.1:c.1002G>T	19.37:g.8399709C>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_198471	0	0	0	0	0	Q6NZI1|Q6ZQR3|Q8IUV2	Silent	SNP	ENST00000593649.1	37																																																																																				T|0.129;G|0.871		0.781	KANK3-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000461379.1	NM_198471	
OCEL1	79629	hgsc.bcm.edu	37	19	17337555	17337555	+	Silent	SNP	C	C	A	rs3745163	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr19:17337555C>A	ENST00000215061.4	+	2	167	c.123C>A	c.(121-123)acC>acA	p.T41T	OCEL1_ENST00000597836.1_5'UTR|OCEL1_ENST00000601576.1_3'UTR|OCEL1_ENST00000601529.1_Silent_p.T41T	NM_024578.1	NP_078854.1	Q9H607	OCEL1_HUMAN	occludin/ELL domain containing 1	41	Pro-rich.									central_nervous_system(2)|endometrium(2)|kidney(1)|lung(2)	7						CCCGCAGGACCCGCCCATCAG	0.746													C|||	1146	0.228834	0.1702	0.2522	5008	,	,		10081	0.4018		0.2018	False		,,,				2504	0.1411				p.T41T		.											.	OCEL1-68	0			c.C123A						.	C		573,3093		51,471,1311	4.0	6.0	5.0		123	-3.2	0.0	19	dbSNP_107	5	1379,6017		128,1123,2447	no	coding-synonymous	OCEL1	NM_024578.1		179,1594,3758	AA,AC,CC		18.6452,15.6301,17.646		41/265	17337555	1952,9110	1833	3698	5531	SO:0001819	synonymous_variant	79629	exon2			CAGGACCCGCCCA	BC029361	CCDS12351.1	19p13.11	2008-02-05				ENSG00000099330			26221	protein-coding gene	gene with protein product						12477932	Standard	NM_024578		Approved	FLJ22709	uc002nfp.3	Q9H607		ENST00000215061.4:c.123C>A	19.37:g.17337555C>A		Somatic	3	0		WXS	Illumina GAIIx	Phase_I	15	15	NM_024578	0	0	0	14	14		Silent	SNP	ENST00000215061.4	37	CCDS12351.1																																																																																			C|0.734;A|0.266		0.746	OCEL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463307.1	NM_024578	
SLC5A5	6528	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	17985536	17985536	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr19:17985536C>T	ENST00000222248.3	+	4	886	c.539C>T	c.(538-540)gCt>gTt	p.A180V		NM_000453.2	NP_000444.1	Q92911	SC5A5_HUMAN	solute carrier family 5 (sodium/iodide cotransporter), member 5	180					cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|iodide transport (GO:0015705)|ion transport (GO:0006811)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	iodide transmembrane transporter activity (GO:0015111)|sodium:iodide symporter activity (GO:0008507)			NS(2)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(6)|lung(13)|ovary(1)|prostate(1)|skin(3)	31						TTCTACACGGCTGTGGTGAGT	0.612																																					p.A180V	Melanoma(65;1008 1708 7910 46650)	.											.	SLC5A5-93	0			c.C539T						.						77.0	68.0	71.0					19																	17985536		2203	4300	6503	SO:0001583	missense	6528	exon4			ACACGGCTGTGGT		CCDS12368.1	19p13.11	2013-07-19	2013-07-19		ENSG00000105641	ENSG00000105641		"""Solute carriers"""	11040	protein-coding gene	gene with protein product		601843	"""solute carrier family 5 (sodium iodide symporter), member 5"""			9231811	Standard	NM_000453		Approved	NIS	uc002nhr.4	Q92911		ENST00000222248.3:c.539C>T	19.37:g.17985536C>T	ENSP00000222248:p.Ala180Val	Somatic	91	0		WXS	Illumina GAIIx	Phase_I	85	72	NM_000453	0	0	0	0	0	O43702|Q2M335|Q9NYB6	Missense_Mutation	SNP	ENST00000222248.3	37	CCDS12368.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.349923	0.82132	.	.	ENSG00000105641	ENST00000222248	D	0.85955	-2.05	4.38	4.38	0.52667	Sodium/solute symporter, conserved site (1);	0.119562	0.56097	D	0.000040	T	0.74253	0.3692	N	0.12611	0.24	0.35990	D	0.836644	B	0.15719	0.014	B	0.19666	0.026	T	0.75448	-0.3314	10	0.46703	T	0.11	.	14.7999	0.69906	0.0:1.0:0.0:0.0	.	180	Q92911	SC5A5_HUMAN	V	180	ENSP00000222248:A180V	ENSP00000222248:A180V	A	+	2	0	SLC5A5	17846536	0.998000	0.40836	0.427000	0.26684	0.897000	0.52465	7.617000	0.83032	2.161000	0.67846	0.491000	0.48974	GCT	.		0.612	SLC5A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466690.1		
NUDT19	390916	hgsc.bcm.edu	37	19	33183316	33183316	+	Silent	SNP	A	A	G	rs8109823	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr19:33183316A>G	ENST00000397061.3	+	1	450	c.450A>G	c.(448-450)ccA>ccG	p.P150P	CTD-2538C1.2_ENST00000592431.1_lincRNA	NM_001105570.1	NP_001099040.1	A8MXV4	NUD19_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 19	150	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.					mitochondrion (GO:0005739)|peroxisome (GO:0005777)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)|receptor binding (GO:0005102)			endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	8	Esophageal squamous(110;0.137)					CACCAGGCCCAGCACCCGGGC	0.761													A|||	881	0.175919	0.2216	0.0965	5008	,	,		10642	0.2153		0.1779	False		,,,				2504	0.1278				p.P150P		.											.	NUDT19-22	0			c.A450G						.	A		599,3181		35,529,1326	6.0	8.0	7.0		450	-7.1	0.0	19	dbSNP_116	7	1035,7031		77,881,3075	no	coding-synonymous	NUDT19	NM_001105570.1		112,1410,4401	GG,GA,AA		12.8316,15.8466,13.7937		150/376	33183316	1634,10212	1890	4033	5923	SO:0001819	synonymous_variant	390916	exon1			AGGCCCAGCACCC		CCDS42543.1	19q13.11	2011-11-16			ENSG00000213965	ENSG00000213965		"""Nudix motif containing"""	32036	protein-coding gene	gene with protein product							Standard	NM_001105570		Approved	RP2	uc010edf.3	A8MXV4		ENST00000397061.3:c.450A>G	19.37:g.33183316A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_001105570	0	0	0	0	0		Silent	SNP	ENST00000397061.3	37	CCDS42543.1																																																																																			A|0.805;G|0.195		0.761	NUDT19-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000450338.3	XM_372723	
ZNF285	26974	ucsc.edu	37	19	44891010	44891010	+	Missense_Mutation	SNP	G	G	C	rs150792548	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr19:44891010G>C	ENST00000330997.4	-	4	1461	c.1397C>G	c.(1396-1398)gCg>gGg	p.A466G	CTC-512J12.6_ENST00000588212.1_Intron|ZNF285_ENST00000544719.2_Missense_Mutation_p.A466G|ZNF285_ENST00000591679.1_Missense_Mutation_p.A473G	NM_152354.3	NP_689567.3	Q96NJ3	ZN285_HUMAN	zinc finger protein 285	466					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A466G(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|prostate(5)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	44						AGAGCTATACGCAAAATCCTT	0.418																																					p.A466G		.											.	ZNF285-94	1	Substitution - Missense(1)	skin(1)	c.C1397G						.						83.0	84.0	83.0					19																	44891010		2203	4300	6503	SO:0001583	missense	26974	exon4			CTATACGCAAAAT	AK055309	CCDS12638.1, CCDS74389.1	19q13.32	2013-01-08	2010-04-14	2010-04-14		ENSG00000267508		"""Zinc fingers, C2H2-type"", ""-"""	13079	protein-coding gene	gene with protein product			"""zinc finger protein 285A"""	ZNF285A			Standard	XM_005258734		Approved			Q96NJ3	OTTHUMG00000178848	ENST00000330997.4:c.1397C>G	19.37:g.44891010G>C	ENSP00000333595:p.Ala466Gly	Somatic	153	1		WXS	Illumina GAIIx	Phase_I	184	26	NM_152354	0	0	1	1	0	Q17RJ3|Q6B0A8|Q6ISR5	Missense_Mutation	SNP	ENST00000330997.4	37	CCDS12638.1	.	.	.	.	.	.	.	.	.	.	G	9.126	1.010205	0.19277	.	.	ENSG00000062370	ENST00000544719;ENST00000330997	T	0.08008	3.14	3.46	0.829	0.18847	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.08714	0.0216	L	0.45744	1.44	0.09310	N	1	B;B	0.34399	0.452;0.0	B;B	0.36666	0.23;0.001	T	0.29488	-1.0010	9	0.56958	D	0.05	.	6.4144	0.21708	0.1094:0.3586:0.532:0.0	.	490;466	B7ZLR9;Q96NJ3	.;ZN285_HUMAN	G	489;466	ENSP00000333595:A466G	ENSP00000333595:A466G	A	-	2	0	ZNF285	49582850	0.000000	0.05858	0.002000	0.10522	0.860000	0.49131	-6.159000	0.00078	0.511000	0.28236	0.298000	0.19748	GCG	A|0.000;C|0.002;G|0.998		0.418	ZNF285-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443600.1	NM_152354	
ZNF285	26974	ucsc.edu	37	19	44891043	44891043	+	Missense_Mutation	SNP	G	G	T	rs77661661		TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr19:44891043G>T	ENST00000330997.4	-	4	1428	c.1364C>A	c.(1363-1365)cCa>cAa	p.P455Q	CTC-512J12.6_ENST00000588212.1_Intron|ZNF285_ENST00000544719.2_Missense_Mutation_p.P455Q|ZNF285_ENST00000591679.1_Missense_Mutation_p.P462Q	NM_152354.3	NP_689567.3	Q96NJ3	ZN285_HUMAN	zinc finger protein 285	455					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P455Q(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|prostate(5)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	44						GCATTTGTATGGTTTCTCCCC	0.448																																					p.P455Q		.											.	ZNF285-94	1	Substitution - Missense(1)	skin(1)	c.C1364A						.																																			SO:0001583	missense	26974	exon4			TTGTATGGTTTCT	AK055309	CCDS12638.1, CCDS74389.1	19q13.32	2013-01-08	2010-04-14	2010-04-14		ENSG00000267508		"""Zinc fingers, C2H2-type"", ""-"""	13079	protein-coding gene	gene with protein product			"""zinc finger protein 285A"""	ZNF285A			Standard	XM_005258734		Approved			Q96NJ3	OTTHUMG00000178848	ENST00000330997.4:c.1364C>A	19.37:g.44891043G>T	ENSP00000333595:p.Pro455Gln	Somatic	147	4		WXS	Illumina GAIIx	Phase_I	182	37	NM_152354	0	0	1	1	0	Q17RJ3|Q6B0A8|Q6ISR5	Missense_Mutation	SNP	ENST00000330997.4	37	CCDS12638.1	.	.	.	.	.	.	.	.	.	.	G	16.80	3.224441	0.58668	.	.	ENSG00000062370	ENST00000544719;ENST00000330997	T	0.17213	2.29	3.36	3.36	0.38483	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.41834	0.1176	M	0.75447	2.3	0.30665	N	0.754012	D;B	0.89917	1.0;0.012	D;B	0.83275	0.996;0.04	T	0.45323	-0.9269	9	0.62326	D	0.03	.	13.918	0.63914	0.0:0.0:1.0:0.0	.	479;455	B7ZLR9;Q96NJ3	.;ZN285_HUMAN	Q	478;455	ENSP00000333595:P455Q	ENSP00000333595:P455Q	P	-	2	0	ZNF285	49582883	1.000000	0.71417	0.862000	0.33874	0.982000	0.71751	5.120000	0.64685	1.598000	0.50083	0.298000	0.19748	CCA	.		0.448	ZNF285-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443600.1	NM_152354	
GPR4	2828	broad.mit.edu	37	19	46094763	46094763	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr19:46094763T>G	ENST00000323040.4	-	2	1306	c.362A>C	c.(361-363)cAc>cCc	p.H121P	OPA3_ENST00000544371.1_Intron|GPR4_ENST00000591614.1_5'Flank	NM_005282.2	NP_005273.1	P46093	GPR4_HUMAN	G protein-coupled receptor 4	121					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(2)|endometrium(1)|kidney(3)|large_intestine(1)|lung(11)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23				OV - Ovarian serous cystadenocarcinoma(262;0.0071)|GBM - Glioblastoma multiforme(486;0.128)|Epithelial(262;0.223)		GCGGAGTGGGTGGGCCACAGC	0.652																																					p.H121P	Esophageal Squamous(117;181 1612 1673 14956 42937)	.											.	GPR4-92	0			c.A362C						.						47.0	52.0	50.0					19																	46094763		2203	4300	6503	SO:0001583	missense	2828	exon2			AGTGGGTGGGCCA	BC067536	CCDS12669.1	19q13.3	2012-08-21				ENSG00000177464		"""GPCR / Class A : Orphans"""	4497	protein-coding gene	gene with protein product		600551				8595909	Standard	NM_005282		Approved		uc002pcm.3	P46093		ENST00000323040.4:c.362A>C	19.37:g.46094763T>G	ENSP00000319744:p.His121Pro	Somatic	52	14		WXS	Illumina GAIIx	Phase_I	97	34	NM_005282	0	0	1	1	0	A8K3T3|B0M0K1|Q6NWM4	Missense_Mutation	SNP	ENST00000323040.4	37	CCDS12669.1	.	.	.	.	.	.	.	.	.	.	T	21.8	4.204071	0.79127	.	.	ENSG00000177464	ENST00000323040	T	0.40225	1.04	5.33	5.33	0.75918	GPCR, rhodopsin-like superfamily (1);	0.080840	0.49916	D	0.000121	T	0.67202	0.2868	M	0.85542	2.76	0.47905	D	0.999547	D	0.89917	1.0	D	0.80764	0.994	T	0.73316	-0.4021	10	0.87932	D	0	.	13.2483	0.60036	0.0:0.0:0.0:1.0	.	121	P46093	GPR4_HUMAN	P	121	ENSP00000319744:H121P	ENSP00000319744:H121P	H	-	2	0	GPR4	50786603	1.000000	0.71417	0.997000	0.53966	0.934000	0.57294	4.977000	0.63792	2.023000	0.59567	0.374000	0.22700	CAC	.		0.652	GPR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459603.1	NM_005282	
HRC	3270	hgsc.bcm.edu	37	19	49657916	49657916	+	Silent	SNP	T	T	C	rs7409255		TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr19:49657916T>C	ENST00000252825.4	-	1	765	c.579A>G	c.(577-579)gaA>gaG	p.E193E	HRC_ENST00000595625.1_Silent_p.E193E	NM_002152.2	NP_002143.1	P23327	SRCH_HUMAN	histidine rich calcium binding protein	193	4 X tandem repeats, acidic.|6 X approximate tandem repeats.|Glu-rich (acidic).				cytosolic calcium ion homeostasis (GO:0051480)|muscle contraction (GO:0006936)|positive regulation of heart contraction (GO:0045823)|positive regulation of heart rate (GO:0010460)|positive regulation of relaxation of cardiac muscle (GO:1901899)|regulation of calcium ion transmembrane transport (GO:1903169)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(10)|lung(10)|ovary(1)|prostate(3)|urinary_tract(2)	34		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.01e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.00019)|GBM - Glioblastoma multiforme(486;0.00279)|Epithelial(262;0.00622)		cctcctcctcttcTCCTTCAT	0.557																																					p.E193E	Melanoma(37;75 1097 24567 25669 30645)	.											.	HRC-91	0			c.A579G						.						119.0	95.0	103.0					19																	49657916		2203	4300	6503	SO:0001819	synonymous_variant	3270	exon1			CTCCTCTTCTCCT		CCDS12759.1	19q13.3	2008-07-16	2001-11-28			ENSG00000130528			5178	protein-coding gene	gene with protein product		142705	"""histidine-rich calcium-binding protein"""			2037293	Standard	XR_243928		Approved	MGC133236	uc002pmv.3	P23327		ENST00000252825.4:c.579A>G	19.37:g.49657916T>C		Somatic	57	0		WXS	Illumina GAIIx	Phase_I	59	10	NM_002152	0	0	1	1	0	Q504Y6	Silent	SNP	ENST00000252825.4	37	CCDS12759.1																																																																																			.		0.557	HRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465649.1	NM_002152	
DKKL1	27120	bcgsc.ca	37	19	49869051	49869051	+	Splice_Site	SNP	T	T	G	rs2303759	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr19:49869051T>G	ENST00000221498.2	+	4	731	c.326T>G	c.(325-327)aTg>aGg	p.M109R	AC010524.2_ENST00000599433.1_RNA|DKKL1_ENST00000594268.1_Intron	NM_014419.3	NP_055234.1	Q9UK85	DKKL1_HUMAN	dickkopf-like 1	109			M -> R (in dbSNP:rs2303759).		anatomical structure morphogenesis (GO:0009653)|positive regulation of fat cell differentiation (GO:0045600)|signal transduction (GO:0007165)	extracellular space (GO:0005615)	signal transducer activity (GO:0004871)			large_intestine(2)|upper_aerodigestive_tract(1)	3		all_lung(116;1.66e-06)|Lung NSC(112;5.89e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00156)|GBM - Glioblastoma multiforme(486;0.0456)		TCCTCACAGATGACCGACAAC	0.562													T|||	1594	0.318291	0.292	0.2464	5008	,	,		17401	0.3373		0.2396	False		,,,				2504	0.4663				p.M109R		.											.	DKKL1-658	0			c.T326G						.	T	,ARG/MET,ARG/MET	1266,3140	430.6+/-342.6	182,902,1119	102.0	89.0	93.0	http://www.ncbi.nlm.nih.gov/pubmed?term	,101,326	4.3	1.0	19	dbSNP_100	93	2278,6322	384.0+/-341.0	302,1674,2324	no	intron,missense-near-splice,missense-near-splice	DKKL1	NM_001197301.1,NM_001197302.1,NM_014419.3	,91,91	484,2576,3443	GG,GT,TT	http://www.ncbi.nlm.nih.gov/pubmed?term	26.4884,28.7335,27.249	,benign,benign	,34/168,109/243	49869051	3544,9462	2203	4300	6503	SO:0001630	splice_region_variant	27120	exon4			CACAGATGACCGA	AB047816	CCDS12762.1	19q13.3	2010-10-12	2010-10-12		ENSG00000104901	ENSG00000104901			16528	protein-coding gene	gene with protein product	"""cancer/testis antigen 34"", ""soggy"""	605418	"""dickkopf-like 1 (soggy)"""			10570958	Standard	NM_001197301		Approved	SGY-1, CT34	uc002pnk.3	Q9UK85		ENST00000221498.2:c.325-1T>G	19.37:g.49869051T>G		Somatic	125	0		WXS	Illumina GAIIx	Phase_I	156	7	NM_014419	0	0	0	0	0		Missense_Mutation	SNP	ENST00000221498.2	37	CCDS12762.1	590	0.27014652014652013	134	0.27235772357723576	90	0.24861878453038674	186	0.32517482517482516	180	0.23746701846965698	T	10.98	1.504113	0.26949	0.287335	0.264884	ENSG00000104901	ENST00000221498	T	0.11930	2.73	4.35	4.35	0.52113	.	0.503678	0.16898	N	0.195029	T	0.00012	0.0000	N	0.08118	0	0.20764	P	0.99985795	B	0.32620	0.378	B	0.29353	0.101	T	0.43245	-0.9403	9	0.72032	D	0.01	-11.7793	10.1284	0.42663	0.0:0.0:0.0:1.0	rs2303759;rs52827084;rs59086630;rs2303759	109	Q9UK85	DKKL1_HUMAN	R	109	ENSP00000221498:M109R	ENSP00000221498:M109R	M	+	2	0	DKKL1	54560863	1.000000	0.71417	1.000000	0.80357	0.376000	0.30014	3.671000	0.54576	1.980000	0.57719	0.459000	0.35465	ATG	T|0.710;G|0.290		0.562	DKKL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465454.2	NM_014419	Missense_Mutation
CTU1	90353	hgsc.bcm.edu	37	19	51607507	51607507	+	Missense_Mutation	SNP	G	G	A	rs17855403|rs200498841	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr19:51607507G>A	ENST00000421832.2	-	2	364	c.320C>T	c.(319-321)gCg>gTg	p.A107V		NM_145232.3	NP_660275.2			cytosolic thiouridylase subunit 1											large_intestine(2)|lung(1)|urinary_tract(1)	4						CTCCCAGCGCGCCGCCTGGCG	0.746													G|||	692	0.138179	0.0908	0.0879	5008	,	,		6423	0.2312		0.1402	False		,,,				2504	0.1401				p.A107V		.											.	CTU1-68	0			c.C320T						.						1.0	2.0	2.0					19																	51607507		896	2080	2976	SO:0001583	missense	90353	exon2			CAGCGCGCCGCCT		CCDS12824.1	19q13.41	2013-05-31	2013-05-31	2009-08-19		ENSG00000142544			29590	protein-coding gene	gene with protein product		612694	"""ATP binding domain 3"", ""cytosolic thiouridylase subunit 1 homolog (S. pombe)"""	ATPBD3		19017811	Standard	NM_145232		Approved	MGC17332, NCS6	uc010eop.3	Q7Z7A3		ENST00000421832.2:c.320C>T	19.37:g.51607507G>A	ENSP00000390011:p.Ala107Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_145232	0	0	0	5	5		Missense_Mutation	SNP	ENST00000421832.2	37	CCDS12824.1	354	0.1620879120879121	45	0.09146341463414634	43	0.11878453038674033	144	0.2517482517482518	122	0.16094986807387862	.	17.02	3.282346	0.59867	.	.	ENSG00000142544	ENST00000421832	T	0.45276	0.9	4.38	3.32	0.38043	Rossmann-like alpha/beta/alpha sandwich fold (1);tRNA(Ile)-lysidine/2-thiocytidine synthase (1);	0.135763	0.48767	D	0.000169	T	0.00012	0.0000	L	0.59967	1.855	0.34690	P	0.274319	D	0.56035	0.974	P	0.48921	0.595	T	0.15435	-1.0437	9	0.24483	T	0.36	-8.3278	9.5404	0.39248	0.0:0.0:0.618:0.382	rs17855403	107	Q7Z7A3	CTU1_HUMAN	V	107	ENSP00000390011:A107V	ENSP00000390011:A107V	A	-	2	0	CTU1	56299319	0.931000	0.31567	0.997000	0.53966	0.901000	0.52897	1.314000	0.33597	0.803000	0.34113	0.561000	0.74099	GCG	G|0.838;A|0.162		0.746	CTU1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464292.1	NM_145232	
FPR1	2357	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	52249666	52249666	+	Silent	SNP	G	G	A			TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr19:52249666G>A	ENST00000595042.1	-	3	723	c.582C>T	c.(580-582)gcC>gcT	p.A194A	FPR1_ENST00000304748.4_Silent_p.A194A	NM_001193306.1	NP_001180235.1	P21462	FPR1_HUMAN	formyl peptide receptor 1	194					activation of MAPK activity (GO:0000187)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|nitric oxide mediated signal transduction (GO:0007263)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|signal transduction (GO:0007165)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	N-formyl peptide receptor activity (GO:0004982)|receptor activity (GO:0004872)			endometrium(2)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(3)	20		all_neural(266;0.0189)|Medulloblastoma(540;0.146)		GBM - Glioblastoma multiforme(134;0.00106)|OV - Ovarian serous cystadenocarcinoma(262;0.018)	Nedocromil(DB00716)	ACATGGCAACGGCCACATTTA	0.502																																					p.A194A		.											.	FPR1-524	0			c.C582T						.						124.0	114.0	117.0					19																	52249666		2203	4300	6503	SO:0001819	synonymous_variant	2357	exon3			GGCAACGGCCACA	M60627	CCDS12839.1	19q13.41	2014-09-17				ENSG00000171051		"""GPCR / Class A : Formyl peptide receptors"""	3826	protein-coding gene	gene with protein product		136537				2161213, 12595898	Standard	NM_001193306		Approved	FPR, FMLP	uc002pxq.3	P21462		ENST00000595042.1:c.582C>T	19.37:g.52249666G>A		Somatic	116	1		WXS	Illumina GAIIx	Phase_I	127	115	NM_001193306	0	0	0	0	0	Q14939|Q7Z6A4|Q86U52|Q9NS48	Silent	SNP	ENST00000595042.1	37	CCDS12839.1																																																																																			.		0.502	FPR1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466905.1	NM_002029	
ZNF787	126208	hgsc.bcm.edu	37	19	56599438	56599440	+	In_Frame_Del	DEL	TCG	TCG	-	rs5828672|rs71696054	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	TCG	TCG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr19:56599438_56599440delTCG	ENST00000270459.3	-	3	1219_1221	c.1101_1103delCGA	c.(1099-1104)gacgag>gag	p.D367del		NM_001002836.2	NP_001002836	Q6DD87	ZN787_HUMAN	zinc finger protein 787	367					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|lung(2)|pancreas(1)	5		Colorectal(82;3.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0559)		GCCCGCGGCCTCGTCGTCGTCGT	0.778														4509	0.900359	0.9939	0.732	5008	,	,		3238	0.7252		0.9821	False		,,,				2504	0.9898				p.367_368del		.											.	ZNF787-69	0			c.1101_1103del						.																																			SO:0001651	inframe_deletion	126208	exon3			GCGGCCTCGTCGT	BC077728, AF000560	CCDS42634.1	19q13.42	2013-01-08				ENSG00000142409		"""Zinc fingers, C2H2-type"""	26998	protein-coding gene	gene with protein product							Standard	NM_001002836		Approved		uc010eth.1	Q6DD87		ENST00000270459.3:c.1101_1103delCGA	19.37:g.56599447_56599449delTCG	ENSP00000270459:p.Asp367del	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	11	11	NM_001002836	0	0	0	0	0	O00455	In_Frame_Del	DEL	ENST00000270459.3	37	CCDS42634.1																																																																																			.		0.778	ZNF787-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457498.1	NM_001002836	
ZNF814	730051	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	58385748	58385748	+	Missense_Mutation	SNP	G	G	A	rs145250945		TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr19:58385748G>A	ENST00000435989.2	-	3	1244	c.1010C>T	c.(1009-1011)gCt>gTt	p.A337V	ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000600634.1_Intron|ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000597832.1_Intron|ZNF814_ENST00000595295.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	337					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A337V(2)		NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						ACTGAAGCTAGCATATTTGCT	0.353																																					p.A337V		.											.	.	2	Substitution - Missense(2)	prostate(2)	c.C1010T						.						58.0	51.0	53.0					19																	58385748		692	1591	2283	SO:0001583	missense	730051	exon3			AAGCTAGCATATT		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.1010C>T	19.37:g.58385748G>A	ENSP00000410545:p.Ala337Val	Somatic	132	1		WXS	Illumina GAIIx	Phase_I	191	72	NM_001144989	0	0	0	0	0	A6NF35	Missense_Mutation	SNP	ENST00000435989.2	37	CCDS46212.1	.	.	.	.	.	.	.	.	.	.	.	3.777	-0.046344	0.07407	.	.	ENSG00000204514	ENST00000435989	T	0.15372	2.43	2.11	-4.21	0.03812	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.07728	0.0194	N	0.21142	0.635	0.09310	N	1	B	0.32781	0.384	B	0.18561	0.022	T	0.05649	-1.0872	9	0.66056	D	0.02	.	3.5015	0.07674	0.0936:0.1206:0.3016:0.4843	.	337	B7Z6K7	ZN814_HUMAN	V	337	ENSP00000410545:A337V	ENSP00000410545:A337V	A	-	2	0	ZNF814	63077560	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-2.230000	0.01207	-3.525000	0.00147	-3.867000	0.00017	GCT	.		0.353	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
ZNF814	730051	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	58385762	58385762	+	Silent	SNP	C	C	G	rs199732634		TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr19:58385762C>G	ENST00000435989.2	-	3	1230	c.996G>C	c.(994-996)tcG>tcC	p.S332S	ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000600634.1_Intron|ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000597832.1_Intron|ZNF814_ENST00000595295.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	332					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S332S(2)		NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						ATTTGCTAAACGATTTCCCAC	0.358																																					p.S332S		.											.	.	2	Substitution - coding silent(2)	kidney(2)	c.G996C						.						25.0	25.0	25.0					19																	58385762		692	1589	2281	SO:0001819	synonymous_variant	730051	exon3			GCTAAACGATTTC		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.996G>C	19.37:g.58385762C>G		Somatic	122	0		WXS	Illumina GAIIx	Phase_I	155	51	NM_001144989	0	0	0	0	0	A6NF35	Silent	SNP	ENST00000435989.2	37	CCDS46212.1																																																																																			.		0.358	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
TRAPPC12	51112	hgsc.bcm.edu	37	2	3391826	3391826	+	Silent	SNP	C	C	T	rs11127423	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr2:3391826C>T	ENST00000324266.5	+	2	627	c.432C>T	c.(430-432)gcC>gcT	p.A144A	TRAPPC12_ENST00000382110.2_Silent_p.A144A	NM_016030.5	NP_057114.5	Q8WVT3	TPC12_HUMAN	trafficking protein particle complex 12	144					vesicle-mediated transport (GO:0016192)												GCAGCGAAGCCGCGCGCCCGG	0.781													C|||	1528	0.305112	0.2352	0.1628	5008	,	,		6707	0.4048		0.2435	False		,,,				2504	0.4611				p.A144A		.											.	.	0			c.C432T						.						2.0	2.0	2.0					2																	3391826		1308	2977	4285	SO:0001819	synonymous_variant	51112	exon2			CGAAGCCGCGCGC	BC017475	CCDS1652.1	2p25.3	2013-01-10	2011-12-12	2011-12-12	ENSG00000171853	ENSG00000171853		"""Trafficking protein particle complex"", ""Tetratricopeptide (TTC) repeat domain containing"""	24284	protein-coding gene	gene with protein product		614139	"""tetratricopeptide repeat domain 15"""	TTC15		10810093, 21525244, 20562859	Standard	NM_016030		Approved	CGI-87, TTC-15	uc002qxm.1	Q8WVT3	OTTHUMG00000090328	ENST00000324266.5:c.432C>T	2.37:g.3391826C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_016030	0	0	0	2	2	B3KV01|D6W4Y2|Q8WVW1|Q9Y395	Silent	SNP	ENST00000324266.5	37	CCDS1652.1																																																																																			C|0.719;T|0.281		0.781	TRAPPC12-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206693.2	NM_016030	
AAK1	22848	broad.mit.edu	37	2	69746326	69746326	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr2:69746326T>G	ENST00000409085.4	-	12	1633	c.1257A>C	c.(1255-1257)aaA>aaC	p.K419N	RN7SL604P_ENST00000492589.2_RNA|SNORA36C_ENST00000384289.1_RNA|AAK1_ENST00000406297.3_Missense_Mutation_p.K419N|AAK1_ENST00000409068.1_Missense_Mutation_p.K419N	NM_014911.3	NP_055726	Q2M2I8	AAK1_HUMAN	AP2 associated kinase 1	419	Gln-rich.				endocytosis (GO:0006897)|positive regulation of Notch signaling pathway (GO:0045747)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of clathrin-mediated endocytosis (GO:2000369)|regulation of protein localization (GO:0032880)	cell leading edge (GO:0031252)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extrinsic component of plasma membrane (GO:0019897)|terminal bouton (GO:0043195)	AP-2 adaptor complex binding (GO:0035612)|ATP binding (GO:0005524)|Notch binding (GO:0005112)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)	17						GGGCTTGGGGTTTTGGTTGGG	0.557																																					p.K419N		.											.	AAK1-333	0			c.A1257C						.						36.0	43.0	41.0					2																	69746326		2006	4181	6187	SO:0001583	missense	22848	exon12			TTGGGGTTTTGGT	AB028971	CCDS1893.2	2p13.3	2012-07-10			ENSG00000115977	ENSG00000115977			19679	protein-coding gene	gene with protein product						11877461, 12471243	Standard	NM_014911		Approved	KIAA1048, DKFZp686K16132	uc002sfp.2	Q2M2I8	OTTHUMG00000129648	ENST00000409085.4:c.1257A>C	2.37:g.69746326T>G	ENSP00000386456:p.Lys419Asn	Somatic	39	3		WXS	Illumina GAIIx	Phase_I	48	9	NM_014911	0	0	6	7	1	Q4ZFZ3|Q53RX6|Q9UPV4	Missense_Mutation	SNP	ENST00000409085.4	37	CCDS1893.2	.	.	.	.	.	.	.	.	.	.	T	8.494	0.862737	0.17178	.	.	ENSG00000115977	ENST00000409068;ENST00000409085;ENST00000406297	T;T;T	0.76968	1.51;-1.06;-1.04	5.32	4.17	0.49024	.	0.940869	0.09053	N	0.855519	T	0.65004	0.2650	N	0.08118	0	0.22253	N	0.999258	P;P;B	0.47762	0.839;0.9;0.319	B;P;B	0.47645	0.351;0.553;0.149	T	0.52034	-0.8629	10	0.25751	T	0.34	-5.3573	8.7717	0.34735	0.0:0.0854:0.0:0.9146	.	419;419;419	B7ZLC4;Q2M2I8-2;Q2M2I8	.;.;AAK1_HUMAN	N	419	ENSP00000386342:K419N;ENSP00000386456:K419N;ENSP00000385181:K419N	ENSP00000385181:K419N	K	-	3	2	AAK1	69599830	0.953000	0.32496	0.054000	0.19295	0.110000	0.19582	1.130000	0.31393	1.044000	0.40200	-0.250000	0.11733	AAA	.		0.557	AAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251847.4	NM_014911	
C2orf40	84417	hgsc.bcm.edu	37	2	106682226	106682226	+	Silent	SNP	T	T	C	rs4271786|rs543094154	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr2:106682226T>C	ENST00000238044.3	+	1	115	c.6T>C	c.(4-6)gcT>gcC	p.A2A	C2orf40_ENST00000489174.1_Intron|C2orf40_ENST00000409944.1_Intron	NM_032411.2	NP_115787.1	Q9H1Z8	AUGN_HUMAN	chromosome 2 open reading frame 40	2					cellular senescence (GO:0090398)|cyclin catabolic process (GO:0008054)|G1 to G0 transition (GO:0070314)	cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)				lung(7)|urinary_tract(1)	8						CCGCCATGGCTGCCTCCCCCG	0.766													C|||	1272	0.253994	0.2753	0.1369	5008	,	,		11771	0.2411		0.2227	False		,,,				2504	0.3538				p.A2A		.											.	C2orf40-90	0			c.T6C						.	C		520,2666		23,474,1096	2.0	3.0	3.0		6	1.0	0.3	2	dbSNP_111	3	871,5647		54,763,2442	no	coding-synonymous	C2orf40	NM_032411.2		77,1237,3538	CC,CT,TT		13.363,16.3214,14.3343		2/149	106682226	1391,8313	1593	3259	4852	SO:0001819	synonymous_variant	84417	exon1			CATGGCTGCCTCC	BC021742	CCDS2072.1	2q12.2	2014-01-28			ENSG00000119147	ENSG00000119147			24642	protein-coding gene	gene with protein product	"""esophageal cancer related gene 4 protein"""	611752				12800218	Standard	NM_032411		Approved	ECRG4, augurin	uc010fjf.3	Q9H1Z8	OTTHUMG00000130921	ENST00000238044.3:c.6T>C	2.37:g.106682226T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_032411	0	0	0	0	0	D3DVK2	Silent	SNP	ENST00000238044.3	37	CCDS2072.1																																																																																			T|0.765;C|0.235		0.766	C2orf40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253515.2	NM_032411	
SOWAHC	65124	hgsc.bcm.edu	37	2	110372192	110372192	+	Silent	SNP	A	A	G	rs6594048		TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr2:110372192A>G	ENST00000356454.3	+	1	282	c.126A>G	c.(124-126)ctA>ctG	p.L42L	SEPT10_ENST00000334001.6_5'Flank|SEPT10_ENST00000397714.2_5'Flank|SEPT10_ENST00000545389.1_5'Flank|SEPT10_ENST00000397712.2_5'Flank|SEPT10_ENST00000415095.1_5'Flank|SEPT10_ENST00000437928.1_5'Flank|SEPT10_ENST00000356688.4_5'Flank	NM_023016.3	NP_075392.2	Q53LP3	SWAHC_HUMAN	sosondowah ankyrin repeat domain family member C	42																	GGGGCGCCCTAGGCGGCGAAC	0.771													G|||	5008	1.0	1.0	1.0	5008	,	,		6158	1.0		1.0	False		,,,				2504	1.0				p.L42L		.											.	.	0			c.A126G						.						1.0	2.0	2.0					2																	110372192		1239	2477	3716	SO:0001819	synonymous_variant	65124	exon1			CGCCCTAGGCGGC	AK023346	CCDS33270.1	2q13	2013-01-10	2012-01-12	2012-01-12	ENSG00000198142	ENSG00000198142		"""Ankyrin repeat domain containing"""	26149	protein-coding gene	gene with protein product			"""ankyrin repeat domain 57"""	C2orf26, ANKRD57		22234889	Standard	NM_023016		Approved	FLJ21870	uc002tfb.3	Q53LP3	OTTHUMG00000153219	ENST00000356454.3:c.126A>G	2.37:g.110372192A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_023016	0	0	0	0	0	Q8NE15|Q9H6U1	Silent	SNP	ENST00000356454.3	37	CCDS33270.1																																																																																			A|0.029;G|0.971		0.771	SOWAHC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330168.1	NM_023016	
CNTNAP5	129684	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	125262113	125262113	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr2:125262113G>A	ENST00000431078.1	+	8	1668	c.1304G>A	c.(1303-1305)cGc>cAc	p.R435H		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	435	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		ATGACAGAACGCGTAGCTGAA	0.507																																					p.R435H		.											.	CNTNAP5-524	0			c.G1304A						.						57.0	60.0	59.0					2																	125262113		1959	4156	6115	SO:0001583	missense	129684	exon8			CAGAACGCGTAGC	AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.1304G>A	2.37:g.125262113G>A	ENSP00000399013:p.Arg435His	Somatic	115	1		WXS	Illumina GAIIx	Phase_I	132	22	NM_130773	0	0	0	0	0	Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Missense_Mutation	SNP	ENST00000431078.1	37	CCDS46401.1	.	.	.	.	.	.	.	.	.	.	G	4.652	0.121232	0.08881	.	.	ENSG00000155052	ENST00000431078	T	0.79141	-1.24	5.54	-1.91	0.07641	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	1.248430	0.05738	N	0.600904	T	0.49626	0.1568	N	0.02539	-0.55	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.31447	-0.9943	10	0.40728	T	0.16	.	3.3025	0.06988	0.5976:0.1299:0.1429:0.1296	.	435	Q8WYK1	CNTP5_HUMAN	H	435	ENSP00000399013:R435H	ENSP00000399013:R435H	R	+	2	0	CNTNAP5	124978583	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-0.760000	0.04756	-0.381000	0.07882	0.650000	0.86243	CGC	.		0.507	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330864.3		
SGOL2	151246	hgsc.bcm.edu;bcgsc.ca	37	2	201437310	201437310	+	Silent	SNP	G	G	T	rs202134341	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr2:201437310G>T	ENST00000357799.4	+	7	2339	c.2241G>T	c.(2239-2241)acG>acT	p.T747T		NM_001160033.1|NM_001160046.1|NM_152524.5	NP_001153505.1|NP_001153518.1|NP_689737.4	Q562F6	SGOL2_HUMAN	shugoshin-like 2 (S. pombe)	747					meiotic sister chromatid cohesion, centromeric (GO:0051754)|mitotic cell cycle (GO:0000278)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|kinetochore (GO:0000776)|mitotic cohesin complex (GO:0030892)|nucleus (GO:0005634)				NS(2)|breast(2)|cervix(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	46						TCTTTTTAACGCAAAAAGATA	0.343													T|||	3	0.000599042	0.0023	0.0	5008	,	,		17868	0.0		0.0	False		,,,				2504	0.0				p.T747T		.											.	SGOL2-94	0			c.G2241T						.	T	,,	6,3608		0,6,1801	52.0	48.0	49.0		2241,2241,2241	-6.5	0.0	2		49	0,8134		0,0,4067	no	coding-synonymous,coding-synonymous,coding-synonymous	SGOL2	NM_001160033.1,NM_001160046.1,NM_152524.5	,,	0,6,5868	TT,TG,GG		0.0,0.166,0.0511	,,	747/1261,747/1262,747/1266	201437310	6,11742	1807	4067	5874	SO:0001819	synonymous_variant	151246	exon7			TTTAACGCAAAAA	AY094614	CCDS42796.1	2q33.2	2008-02-05			ENSG00000163535	ENSG00000163535			30812	protein-coding gene	gene with protein product		612425					Standard	NM_001160046		Approved	TRIPIN, FLJ25211	uc002uvw.2	Q562F6	OTTHUMG00000154535	ENST00000357799.4:c.2241G>T	2.37:g.201437310G>T		Somatic	122	0		WXS	Illumina GAIIx	Phase_I	63	5	NM_001160046	0	0	2	2	0	Q53RR9|Q53T20|Q86XY4|Q8IWK2|Q8IZK1|Q8N1Q5|Q96LQ3	Silent	SNP	ENST00000357799.4	37	CCDS42796.1																																																																																			G|0.999;A|0.000		0.343	SGOL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335834.1	NM_152524	
EEF1B2	1933	broad.mit.edu	37	2	207025358	207025358	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr2:207025358A>G	ENST00000392222.2	+	2	502	c.127A>G	c.(127-129)Agc>Ggc	p.S43G	NDUFS1_ENST00000423725.1_5'Flank|EEF1B2_ENST00000392221.1_Missense_Mutation_p.S43G|NDUFS1_ENST00000440274.1_5'Flank|NDUFS1_ENST00000449699.1_5'Flank|NDUFS1_ENST00000455934.2_5'Flank|EEF1B2_ENST00000236957.5_Missense_Mutation_p.S43G|SNORA41_ENST00000384675.1_RNA|NDUFS1_ENST00000432169.1_5'Flank|NDUFS1_ENST00000457011.1_5'Flank|SNORD51_ENST00000384320.2_RNA|NDUFS1_ENST00000233190.6_5'Flank	NM_001959.3	NP_001950.1	P24534	EF1B_HUMAN	eukaryotic translation elongation factor 1 beta 2	43	GST C-terminal.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|translation (GO:0006412)|translational elongation (GO:0006414)	cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)	translation elongation factor activity (GO:0003746)	p.S43G(4)		breast(1)|endometrium(5)|kidney(3)|large_intestine(1)|lung(6)	16						AGCCGTGTCCAGCCCACCGCC	0.468																																					p.S43G		.											.	EEF1B2-227	4	Substitution - Missense(4)	endometrium(2)|lung(1)|kidney(1)	c.A127G						.						109.0	99.0	102.0					2																	207025358		2203	4300	6503	SO:0001583	missense	1933	exon3			GTGTCCAGCCCAC	X60489	CCDS2367.1	2q33.3	2011-04-28			ENSG00000114942	ENSG00000114942			3208	protein-coding gene	gene with protein product		600655				8250921	Standard	NM_001959		Approved		uc002vbf.1	P24534	OTTHUMG00000132891	ENST00000392222.2:c.127A>G	2.37:g.207025358A>G	ENSP00000376056:p.Ser43Gly	Somatic	168	0		WXS	Illumina GAIIx	Phase_I	227	4	NM_021121	0	0	514	514	0	A8K795|Q6IBH9	Missense_Mutation	SNP	ENST00000392222.2	37	CCDS2367.1	.	.	.	.	.	.	.	.	.	.	A	0.014	-1.585588	0.00872	.	.	ENSG00000114942	ENST00000236957;ENST00000392221;ENST00000392222;ENST00000445505	T;T;T;T	0.44482	0.92;0.92;0.92;0.92	5.47	0.911	0.19343	Glutathione S-transferase, C-terminal-like (2);	0.442134	0.26800	N	0.022437	T	0.19846	0.0477	N	0.16098	0.37	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.18745	-1.0327	10	0.17832	T	0.49	-2.1703	6.3337	0.21285	0.2348:0.0:0.6384:0.1268	.	43	P24534	EF1B_HUMAN	G	43	ENSP00000236957:S43G;ENSP00000376055:S43G;ENSP00000376056:S43G;ENSP00000407730:S43G	ENSP00000236957:S43G	S	+	1	0	EEF1B2	206733603	0.049000	0.20398	0.145000	0.22337	0.051000	0.14879	0.879000	0.28146	-0.027000	0.13873	-0.252000	0.11476	AGC	.		0.468	EEF1B2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336436.1	NM_001037663	
EEF1B2	1933	broad.mit.edu	37	2	207025366	207025366	+	Silent	SNP	G	G	A			TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr2:207025366G>A	ENST00000392222.2	+	2	510	c.135G>A	c.(133-135)ccG>ccA	p.P45P	NDUFS1_ENST00000423725.1_5'Flank|EEF1B2_ENST00000392221.1_Silent_p.P45P|NDUFS1_ENST00000440274.1_5'Flank|NDUFS1_ENST00000449699.1_5'Flank|NDUFS1_ENST00000455934.2_5'Flank|EEF1B2_ENST00000236957.5_Silent_p.P45P|SNORA41_ENST00000384675.1_RNA|NDUFS1_ENST00000432169.1_5'Flank|NDUFS1_ENST00000457011.1_5'Flank|SNORD51_ENST00000384320.2_RNA|NDUFS1_ENST00000233190.6_5'Flank	NM_001959.3	NP_001950.1	P24534	EF1B_HUMAN	eukaryotic translation elongation factor 1 beta 2	45	GST C-terminal.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|translation (GO:0006412)|translational elongation (GO:0006414)	cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)	translation elongation factor activity (GO:0003746)	p.P45P(5)		breast(1)|endometrium(5)|kidney(3)|large_intestine(1)|lung(6)	16						CCAGCCCACCGCCTGCCGACT	0.448																																					p.P45P		.											.	EEF1B2-227	5	Substitution - coding silent(5)	kidney(2)|endometrium(2)|lung(1)	c.G135A						.						109.0	99.0	102.0					2																	207025366		2203	4300	6503	SO:0001819	synonymous_variant	1933	exon3			CCCACCGCCTGCC	X60489	CCDS2367.1	2q33.3	2011-04-28			ENSG00000114942	ENSG00000114942			3208	protein-coding gene	gene with protein product		600655				8250921	Standard	NM_001959		Approved		uc002vbf.1	P24534	OTTHUMG00000132891	ENST00000392222.2:c.135G>A	2.37:g.207025366G>A		Somatic	176	0		WXS	Illumina GAIIx	Phase_I	220	4	NM_021121	0	0	448	448	0	A8K795|Q6IBH9	Silent	SNP	ENST00000392222.2	37	CCDS2367.1																																																																																			.		0.448	EEF1B2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336436.1	NM_001037663	
LOC151174	151174	broad.mit.edu	37	2	239141221	239141221	+	5'Flank	SNP	G	G	C	rs11694487	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr2:239141221G>C	ENST00000409070.1	-	0	0				AC096574.4_ENST00000456601.1_RNA|AC016757.3_ENST00000409376.1_5'Flank|AC016757.3_ENST00000334973.4_5'Flank|AC016757.3_ENST00000409942.1_5'Flank|AC016757.3_ENST00000470346.1_5'Flank																							TGGGAATCAGGGTGGATTTGG	0.468													G|||	1011	0.201877	0.1195	0.2695	5008	,	,		21384	0.121		0.3549	False		,,,				2504	0.1912				.		.											.	.	0			.						.																																			SO:0001631	upstream_gene_variant	0	.			AATCAGGGTGGAT																													2.37:g.239141221G>C	Exception_encountered	Somatic	76	1		WXS	Illumina GAIIx	Phase_I	85	3	.	0	0	0	0	0		RNA	SNP	ENST00000409070.1	37																																																																																				G|0.782;C|0.218		0.468	AC016757.3-006	PUTATIVE	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000328480.1		
TCF15	6939	hgsc.bcm.edu	37	20	590456	590456	+	Silent	SNP	A	A	G	rs282164	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr20:590456A>G	ENST00000246080.3	-	1	586	c.426T>C	c.(424-426)cgT>cgC	p.R142R		NM_004609.3	NP_004600.2	Q12870	TCF15_HUMAN	transcription factor 15 (basic helix-loop-helix)	142					death (GO:0016265)|ear development (GO:0043583)|eating behavior (GO:0042755)|establishment of epithelial cell apical/basal polarity (GO:0045198)|mesenchymal to epithelial transition (GO:0060231)|mesoderm development (GO:0007498)|muscle organ morphogenesis (GO:0048644)|neuromuscular process controlling posture (GO:0050884)|paraxial mesoderm development (GO:0048339)|post-anal tail morphogenesis (GO:0036342)|regulation of gene expression involved in extracellular matrix organization (GO:1901311)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|respiratory system process (GO:0003016)|skeletal system morphogenesis (GO:0048705)|skin development (GO:0043588)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|lung(2)|prostate(1)	4		Breast(17;0.231)				TGCCCGCGGCACGGAAGCACG	0.736													g|||	4317	0.862021	0.7413	0.9035	5008	,	,		6474	0.998		0.8072	False		,,,				2504	0.9121				p.R142R		.											.	TCF15-90	0			c.T426C						.			3211,1033		1232,747,143	7.0	8.0	8.0		426	-9.0	0.0	20	dbSNP_79	8	6663,1669		2708,1247,211	no	coding-synonymous	TCF15	NM_004609.3		3940,1994,354	GG,GA,AA		20.0312,24.3402,21.4854		142/200	590456	9874,2702	2122	4166	6288	SO:0001819	synonymous_variant	6939	exon1			CGCGGCACGGAAG		CCDS33432.1	20p13	2013-05-21			ENSG00000125878	ENSG00000125878		"""Basic helix-loop-helix proteins"""	11627	protein-coding gene	gene with protein product		601010				8825648, 8041747	Standard	NM_004609		Approved	EC2, PARAXIS, bHLHa40	uc002wdz.3	Q12870	OTTHUMG00000031640	ENST00000246080.3:c.426T>C	20.37:g.590456A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	10	NM_004609	0	0	0	0	0	Q9NQQ1	Silent	SNP	ENST00000246080.3	37	CCDS33432.1																																																																																			A|0.165;G|0.835		0.736	TCF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077475.2	NM_004609	
PANK2	80025	hgsc.bcm.edu	37	20	3870124	3870124	+	Missense_Mutation	SNP	G	G	C	rs3737084	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr20:3870124G>C	ENST00000316562.4	+	1	383	c.377G>C	c.(376-378)gGg>gCg	p.G126A	RP11-119B16.2_ENST00000451507.1_RNA|PANK2_ENST00000610179.1_Missense_Mutation_p.G3A|PANK2_ENST00000497424.1_Intron	NM_153638.2	NP_705902.2	Q9BZ23	PANK2_HUMAN	pantothenate kinase 2	126			G -> A (in dbSNP:rs3737084). {ECO:0000269|PubMed:11479594, ECO:0000269|PubMed:12554685, ECO:0000269|Ref.3}.		aerobic respiration (GO:0009060)|cell death (GO:0008219)|coenzyme A biosynthetic process (GO:0015937)|coenzyme biosynthetic process (GO:0009108)|mitochondrion morphogenesis (GO:0070584)|pantothenate metabolic process (GO:0015939)|regulation of mitochondrial membrane potential (GO:0051881)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial intermembrane space (GO:0005758)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						CGGATGGGAGGGGGCCGGCTC	0.766													C|||	4403	0.879193	0.9939	0.9323	5008	,	,		9294	0.7946		0.8757	False		,,,				2504	0.7771				p.G126A		.											.	PANK2-115	0			c.G377C						.		,ALA/GLY	3009,53		1478,53,0	2.0	3.0	3.0		,377	4.7	1.0	20	dbSNP_107	3	6120,564		2797,526,19	no	intron,missense	PANK2	NM_024960.4,NM_153638.2	,60	4275,579,19	CC,CG,GG		8.4381,1.7309,6.3308	,benign	,126/571	3870124	9129,617	1531	3342	4873	SO:0001583	missense	80025	exon1			TGGGAGGGGGCCG	AK021791	CCDS13071.2, CCDS13072.1	20p13	2008-07-31	2008-07-31	2002-09-06	ENSG00000125779	ENSG00000125779	2.7.1.33		15894	protein-coding gene	gene with protein product	"""Hallervorden-Spatz syndrome"""	606157	"""neurodegeneration with brain iron accumulation 1 (Hallervorden-Spatz syndrome)"""	C20orf48, NBIA1		8944032, 11479594	Standard	XM_005260835		Approved	HSS, FLJ11729, PKAN, HARP	uc002wkc.3	Q9BZ23	OTTHUMG00000031768	ENST00000316562.4:c.377G>C	20.37:g.3870124G>C	ENSP00000313377:p.Gly126Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_153638	0	0	0	0	0	B1AK33|B2Z3X0|D3DVZ0|Q5T7I2|Q5T7I4|Q7RTX5|Q8N7Q4|Q8TCR5|Q9BYW5|Q9HAF2	Missense_Mutation	SNP	ENST00000316562.4	37	CCDS13071.2	1920	0.8791208791208791	489	0.9939024390243902	334	0.9226519337016574	438	0.7657342657342657	659	0.8693931398416886	C	8.681	0.905209	0.17760	0.982691	0.915619	ENSG00000125779	ENST00000316562	D	0.96265	-3.96	4.73	4.73	0.59995	.	0.504726	0.16798	N	0.199120	T	0.00012	0.0000	N	0.08118	0	0.58432	P	1.0000000000287557E-6	B	0.02656	0.0	B	0.01281	0.0	T	0.41574	-0.9501	9	0.02654	T	1	.	11.198	0.48724	0.0:0.8144:0.1856:0.0	rs3737084	126	Q9BZ23	PANK2_HUMAN	A	126	ENSP00000313377:G126A	ENSP00000313377:G126A	G	+	2	0	PANK2	3818124	0.994000	0.37717	0.990000	0.47175	0.991000	0.79684	1.019000	0.30014	1.369000	0.46134	-0.164000	0.13417	GGG	G|0.122;C|0.878		0.766	PANK2-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077793.2	NM_024960	
SNRPB2	6629	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	16712857	16712857	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr20:16712857T>C	ENST00000246071.6	+	3	329	c.113T>C	c.(112-114)gTg>gCg	p.V38A	SNRPB2_ENST00000478522.1_3'UTR|SNRPB2_ENST00000377943.5_Missense_Mutation_p.V38A|RP4-705D16.3_ENST00000425939.1_RNA	NM_003092.4	NP_003083.1	P08579	RU2B_HUMAN	small nuclear ribonucleoprotein polypeptide B	38	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U2 snRNP (GO:0005686)	nucleotide binding (GO:0000166)|snRNA binding (GO:0017069)			large_intestine(2)|lung(2)|urinary_tract(1)	5						GGTCATGTGGTGGACATTGTG	0.403																																					p.V38A		.											.	SNRPB2-153	0			c.T113C						.						148.0	142.0	144.0					20																	16712857		2203	4300	6503	SO:0001583	missense	6629	exon3			ATGTGGTGGACAT		CCDS13123.1	20p12.1	2013-02-12	2010-07-07		ENSG00000125870	ENSG00000125870		"""RNA binding motif (RRM) containing"""	11155	protein-coding gene	gene with protein product		603520	"""small nuclear ribonucleoprotein polypeptide B2"", ""small nuclear ribonucleoprotein polypeptide B''"""			2951739	Standard	NM_198220		Approved	Msl1	uc002wpi.2	P08579	OTTHUMG00000031933	ENST00000246071.6:c.113T>C	20.37:g.16712857T>C	ENSP00000246071:p.Val38Ala	Somatic	159	0		WXS	Illumina GAIIx	Phase_I	245	105	NM_003092	0	0	29	56	27	B2R7J3|D3DW21|Q9UJD4	Missense_Mutation	SNP	ENST00000246071.6	37	CCDS13123.1	.	.	.	.	.	.	.	.	.	.	T	17.72	3.460184	0.63401	.	.	ENSG00000125870	ENST00000377943;ENST00000246071	T;T	0.06528	3.29;3.29	5.75	5.75	0.90469	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.176957	0.52532	D	0.000075	T	0.10766	0.0263	L	0.46670	1.46	0.80722	D	1	P	0.40681	0.727	B	0.42959	0.403	T	0.01280	-1.1397	10	0.72032	D	0.01	-20.9129	16.0475	0.80731	0.0:0.0:0.0:1.0	.	38	P08579	RU2B_HUMAN	A	38	ENSP00000367178:V38A;ENSP00000246071:V38A	ENSP00000246071:V38A	V	+	2	0	SNRPB2	16660857	1.000000	0.71417	1.000000	0.80357	0.667000	0.39255	7.980000	0.88113	2.193000	0.70182	0.528000	0.53228	GTG	.		0.403	SNRPB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078110.1	NM_003092	
FAM182A	284800	broad.mit.edu	37	20	26061818	26061818	+	RNA	SNP	G	G	C	rs112101451		TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr20:26061818G>C	ENST00000376398.2	+	0	838					NR_026713.1		Q5T1J6	F182A_HUMAN	family with sequence similarity 182, member A											breast(1)|endometrium(2)|kidney(1)	4						GATTTCTCCTGCTTAGAAATG	0.463																																					.		.											.	.	0			.						.						12.0	11.0	11.0					20																	26061818		692	1579	2271			284800	.			TCTCCTGCTTAGA	AL391119		20p11	2013-03-18	2008-08-05	2008-08-05	ENSG00000125804	ENSG00000125804			16222	other	unknown			"""chromosome 20 open reading frame 91"""	C20orf91			Standard	NR_026713		Approved	bB329D4.1, C20orf91A	uc010gdq.3	Q5T1J6	OTTHUMG00000032144		20.37:g.26061818G>C		Somatic	64	1		WXS	Illumina GAIIx	Phase_I	85	5	.	0	0	0	0	0	A2RRD0|Q8N947	RNA	SNP	ENST00000376398.2	37		.	.	.	.	.	.	.	.	.	.	N	7.694	0.691703	0.15039	.	.	ENSG00000125804	ENST00000376398;ENST00000246000	.	.	.	0.368	0.368	0.16146	.	.	.	.	.	T	0.47322	0.1439	.	.	.	0.30118	N	0.805912	.	.	.	.	.	.	T	0.53092	-0.8487	4	0.87932	D	0	.	.	.	.	.	.	.	.	S	57	.	ENSP00000246000:C57S	C	+	2	0	FAM182A	26009818	1.000000	0.71417	0.427000	0.26684	0.468000	0.32798	0.774000	0.26675	0.451000	0.26802	0.123000	0.15791	TGC	G|0.994;C|0.006		0.463	FAM182A-001	KNOWN	basic	lincRNA	processed_transcript	OTTHUMT00000078473.2		
ADNP	23394	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	49510967	49510967	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr20:49510967T>C	ENST00000396029.3	-	5	851	c.284A>G	c.(283-285)aAt>aGt	p.N95S	ADNP_ENST00000371602.4_Missense_Mutation_p.N95S|ADNP_ENST00000349014.3_Missense_Mutation_p.N95S|ADNP_ENST00000396032.3_Missense_Mutation_p.N95S	NM_001282531.1|NM_015339.2	NP_001269460.1|NP_056154.1	Q9H2P0	ADNP_HUMAN	activity-dependent neuroprotector homeobox	95					negative regulation of neuron apoptotic process (GO:0043524)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.N95S(1)		NS(1)|breast(4)|endometrium(7)|kidney(1)|large_intestine(13)|lung(7)|ovary(2)|prostate(2)|skin(2)	39						ACTATGGACATTGCGGAAATG	0.368																																					p.N95S		.											.	ADNP-92	1	Substitution - Missense(1)	endometrium(1)	c.A284G						.						82.0	84.0	83.0					20																	49510967		2203	4300	6503	SO:0001583	missense	23394	exon5			TGGACATTGCGGA	AF250860	CCDS13433.1	20q13.13	2011-06-20	2007-07-17		ENSG00000101126	ENSG00000101126		"""Homeoboxes / ZF class"""	15766	protein-coding gene	gene with protein product	"""ADNP homeobox 1"""	611386	"""activity-dependent neuroprotector"""			9872452, 11013255	Standard	NM_015339		Approved	KIAA0784, ADNP1	uc002xvu.1	Q9H2P0	OTTHUMG00000032737	ENST00000396029.3:c.284A>G	20.37:g.49510967T>C	ENSP00000379346:p.Asn95Ser	Somatic	102	0		WXS	Illumina GAIIx	Phase_I	176	80	NM_015339	0	0	3	10	7	E1P5Y2|O94881|Q5BKU2|Q9UG34	Missense_Mutation	SNP	ENST00000396029.3	37	CCDS13433.1	.	.	.	.	.	.	.	.	.	.	T	14.83	2.653149	0.47362	.	.	ENSG00000101126	ENST00000371602;ENST00000349014;ENST00000396029;ENST00000396032;ENST00000534467	T;T;T;T;T	0.71817	-0.6;-0.6;-0.6;-0.6;-0.6	5.42	5.42	0.78866	Zinc finger, C2H2-like (1);	0.000000	0.85682	D	0.000000	T	0.80919	0.4716	L	0.57536	1.79	0.53005	D	0.999969	D	0.63880	0.993	D	0.70227	0.968	T	0.80279	-0.1449	10	0.40728	T	0.16	-20.4365	15.7596	0.78067	0.0:0.0:0.0:1.0	.	95	Q9H2P0	ADNP_HUMAN	S	95	ENSP00000360662:N95S;ENSP00000342905:N95S;ENSP00000379346:N95S;ENSP00000379349:N95S;ENSP00000436181:N95S	ENSP00000342905:N95S	N	-	2	0	ADNP	48944374	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.925000	0.70062	2.184000	0.69523	0.533000	0.62120	AAT	.		0.368	ADNP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079705.2	NM_181442	
SCARF2	91179	hgsc.bcm.edu	37	22	20779768	20779768	+	Missense_Mutation	SNP	G	G	C	rs874101	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr22:20779768G>C	ENST00000266214.5	-	11	2614	c.2510C>G	c.(2509-2511)gCg>gGg	p.A837G	SCARF2_ENST00000405555.3_Missense_Mutation_p.A832G	NM_153334.4	NP_699165.2	Q96GP6	SREC2_HUMAN	scavenger receptor class F, member 2	837	Pro-rich.		A -> G (in dbSNP:rs874101).		cell adhesion (GO:0007155)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|skin(2)	10	Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			GGTCTCAGGCGCGGGCAAGTC	0.756													G|||	2677	0.534545	0.6188	0.5043	5008	,	,		8768	0.3304		0.6471	False		,,,				2504	0.5368				p.A837G		.											.	SCARF2-341	0			c.C2510G						.	G	GLY/ALA,GLY/ALA	1896,962		640,616,173	4.0	6.0	5.0		2510,2495	-3.1	0.0	22	dbSNP_86	5	4269,2301		1472,1325,488	yes	missense,missense	SCARF2	NM_153334.4,NM_182895.2	60,60	2112,1941,661	CC,CG,GG		35.0228,33.6599,34.6097	benign,benign	837/871,832/866	20779768	6165,3263	1429	3285	4714	SO:0001583	missense	91179	exon11			TCAGGCGCGGGCA	AF522196	CCDS13779.1, CCDS46666.1	22q11.21	2011-10-10			ENSG00000244486	ENSG00000244486			19869	protein-coding gene	gene with protein product		613619				12154095	Standard	XM_006724364		Approved	SREC-II, SREC2, HUMZD58C02	uc002zsk.2	Q96GP6	OTTHUMG00000150779	ENST00000266214.5:c.2510C>G	22.37:g.20779768G>C	ENSP00000266214:p.Ala837Gly	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_153334	0	0	0	0	0	E5RFB8|Q58A83|Q8IXF3|Q9BW74	Missense_Mutation	SNP	ENST00000266214.5	37	CCDS13779.1	1159	0.5306776556776557	311	0.6321138211382114	198	0.5469613259668509	174	0.3041958041958042	476	0.6279683377308707	G	5.500	0.277180	0.10403	0.663401	0.649772	ENSG00000244486	ENST00000405555;ENST00000341328;ENST00000266214	T;T	0.20069	2.16;2.1	3.63	-3.09	0.05331	.	3.824140	0.02067	N	0.051201	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.42849	-0.9427	9	0.24483	T	0.36	.	1.7179	0.02905	0.1488:0.3654:0.3149:0.1709	rs874101	832;833	E5RFB8;Q96GP6	.;SREC2_HUMAN	G	832;831;837	ENSP00000385589:A832G;ENSP00000266214:A837G	ENSP00000266214:A837G	A	-	2	0	SCARF2	19109768	0.000000	0.05858	0.004000	0.12327	0.115000	0.19883	0.260000	0.18424	-0.480000	0.06803	0.579000	0.79373	GCG	G|0.531;C|0.469		0.756	SCARF2-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320047.1		
SCARF2	91179	hgsc.bcm.edu	37	22	20780091	20780091	+	Silent	SNP	C	C	G	rs759610		TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr22:20780091C>G	ENST00000266214.5	-	11	2291	c.2187G>C	c.(2185-2187)ccG>ccC	p.P729P	SCARF2_ENST00000405555.3_Silent_p.P724P	NM_153334.4	NP_699165.2	Q96GP6	SREC2_HUMAN	scavenger receptor class F, member 2	729	Pro-rich.				cell adhesion (GO:0007155)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|skin(2)	10	Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			CGGGCAGCCCCGGGGGGCGCG	0.781																																					p.P729P		.											.	SCARF2-341	0			c.G2187C						.	G	,	3110,60		1525,60,0	4.0	5.0	4.0		2187,2172	-6.8	0.1	22	dbSNP_86	4	5974,118		2928,118,0	no	coding-synonymous,coding-synonymous	SCARF2	NM_153334.4,NM_182895.2	,	4453,178,0	GG,GC,CC		1.937,1.8927,1.9218	,	729/871,724/866	20780091	9084,178	1585	3046	4631	SO:0001819	synonymous_variant	91179	exon11			CAGCCCCGGGGGG	AF522196	CCDS13779.1, CCDS46666.1	22q11.21	2011-10-10			ENSG00000244486	ENSG00000244486			19869	protein-coding gene	gene with protein product		613619				12154095	Standard	XM_006724364		Approved	SREC-II, SREC2, HUMZD58C02	uc002zsk.2	Q96GP6	OTTHUMG00000150779	ENST00000266214.5:c.2187G>C	22.37:g.20780091C>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	13	12	NM_153334	0	0	0	0	0	E5RFB8|Q58A83|Q8IXF3|Q9BW74	Silent	SNP	ENST00000266214.5	37	CCDS13779.1																																																																																			C|0.138;G|0.862		0.781	SCARF2-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320047.1		
SCARF2	91179	hgsc.bcm.edu	37	22	20780097	20780097	+	Silent	SNP	G	G	C	rs759609		TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr22:20780097G>C	ENST00000266214.5	-	11	2285	c.2181C>G	c.(2179-2181)cgC>cgG	p.R727R	SCARF2_ENST00000405555.3_Silent_p.R722R	NM_153334.4	NP_699165.2	Q96GP6	SREC2_HUMAN	scavenger receptor class F, member 2	727	Pro-rich.				cell adhesion (GO:0007155)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|skin(2)	10	Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			GCCCCGGGGGGCGCGGCGTTG	0.781																																					p.R727R		.											.	SCARF2-341	0			c.C2181G						.	C	,	3271,119		1585,101,9	5.0	5.0	5.0		2181,2166	-5.3	0.0	22	dbSNP_86	5	6306,190		3060,186,2	no	coding-synonymous,coding-synonymous	SCARF2	NM_153334.4,NM_182895.2	,	4645,287,11	CC,CG,GG		2.9249,3.5103,3.1256	,	727/871,722/866	20780097	9577,309	1695	3248	4943	SO:0001819	synonymous_variant	91179	exon11			CGGGGGGCGCGGC	AF522196	CCDS13779.1, CCDS46666.1	22q11.21	2011-10-10			ENSG00000244486	ENSG00000244486			19869	protein-coding gene	gene with protein product		613619				12154095	Standard	XM_006724364		Approved	SREC-II, SREC2, HUMZD58C02	uc002zsk.2	Q96GP6	OTTHUMG00000150779	ENST00000266214.5:c.2181C>G	22.37:g.20780097G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	15	14	NM_153334	0	0	0	0	0	E5RFB8|Q58A83|Q8IXF3|Q9BW74	Silent	SNP	ENST00000266214.5	37	CCDS13779.1																																																																																			G|0.826;C|0.174		0.781	SCARF2-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320047.1		
POM121L4P	266697	bcgsc.ca	37	22	21044663	21044663	+	RNA	SNP	G	G	C	rs10427829	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr22:21044663G>C	ENST00000412250.3	+	0	345									POM121 transmembrane nucleoporin-like 4 pseudogene											breast(2)	2						GGACGAGCTCGTGCACCAACC	0.627													N|||	3206	0.640176	0.7511	0.5706	5008	,	,		13887	0.5367		0.5954	False		,,,				2504	0.6922				.		.											.	.	0			.						.																																					266697	.			GAGCTCGTGCACC			22q11.2	2012-03-13	2012-03-13		ENSG00000217261	ENSG00000217261			19326	pseudogene	pseudogene			"""POM121 membrane glycoprotein-like 4 pseudogene (rat)"", ""POM121 membrane glycoprotein-like 4 pseudogene"""				Standard	NR_024592		Approved		uc002zsw.2		OTTHUMG00000150756		22.37:g.21044663G>C		Somatic	36	2		WXS	Illumina GAIIx	Phase_I	10	9	.	0	0	0	0	0		RNA	SNP	ENST00000412250.3	37																																																																																				G|0.498;C|0.502		0.627	POM121L4P-002	KNOWN	basic|exp_conf	processed_transcript	pseudogene	OTTHUMT00000468456.1		
TMPRSS6	164656	bcgsc.ca	37	22	37480797	37480797	+	Silent	SNP	C	C	T	rs2111833	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr22:37480797C>T	ENST00000346753.3	-	9	1199	c.1083G>A	c.(1081-1083)tcG>tcA	p.S361S	TMPRSS6_ENST00000442782.2_Silent_p.S361S|TMPRSS6_ENST00000406856.1_Silent_p.S352S|TMPRSS6_ENST00000381792.2_Silent_p.S352S|TMPRSS6_ENST00000406725.1_Silent_p.S352S|RP5-1170K4.7_ENST00000414203.2_RNA	NM_153609.2	NP_705837.1	Q8IU80	TMPS6_HUMAN	transmembrane protease, serine 6	361	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				angiogenesis (GO:0001525)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|intracellular signal transduction (GO:0035556)|iron ion homeostasis (GO:0055072)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)			breast(5)|central_nervous_system(4)|endometrium(4)|kidney(4)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(2)|stomach(3)	40						GGGTTTGGGGCGAGTAGTAGC	0.652													C|||	1567	0.312899	0.3797	0.1988	5008	,	,		18698	0.3046		0.3877	False		,,,				2504	0.2352				p.S361S		.											.	TMPRSS6-292	0			c.G1083A						.	C		1646,2752		331,984,884	87.0	73.0	78.0		1083	-9.1	0.9	22	dbSNP_96	78	2875,5703		527,1821,1941	no	coding-synonymous	TMPRSS6	NM_153609.2		858,2805,2825	TT,TC,CC		33.516,37.4261,34.8412		361/812	37480797	4521,8455	2199	4289	6488	SO:0001819	synonymous_variant	164656	exon9			TTGGGGCGAGTAG	AY055383	CCDS13941.1, CCDS74856.1, CCDS74857.1	22q13.1	2010-04-13			ENSG00000187045	ENSG00000187045		"""Serine peptidases / Transmembrane"""	16517	protein-coding gene	gene with protein product		609862					Standard	NM_001289000		Approved	FLJ30744	uc003aqs.1	Q8IU80	OTTHUMG00000150541	ENST00000346753.3:c.1083G>A	22.37:g.37480797C>T		Somatic	44	0		WXS	Illumina GAIIx	Phase_I	51	4	NM_153609	0	0	0	0	0	B0QYB4|B0QYB7|B0QYB8|Q5TI06|Q6ICC2|Q6UXD8|Q8IUE2|Q8IXV8	Silent	SNP	ENST00000346753.3	37	CCDS13941.1																																																																																			C|0.669;T|0.331		0.652	TMPRSS6-003	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000318822.1	NM_153609	
ATR	545	bcgsc.ca	37	3	142222284	142222284	+	Silent	SNP	A	A	G	rs2227931	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr3:142222284A>G	ENST00000350721.4	-	30	5329	c.5208T>C	c.(5206-5208)taT>taC	p.Y1736Y	ATR_ENST00000383101.3_Silent_p.Y1672Y	NM_001184.3	NP_001175.2	Q13535	ATR_HUMAN	ATR serine/threonine kinase	1736	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.				cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of DNA replication (GO:0008156)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|protein autophosphorylation (GO:0046777)|regulation of protein binding (GO:0043393)|replicative senescence (GO:0090399)|response to drug (GO:0042493)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|XY body (GO:0001741)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MutLalpha complex binding (GO:0032405)|MutSalpha complex binding (GO:0032407)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(10)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|liver(2)|lung(45)|ovary(3)|skin(10)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(4)	122						CTACACCATGATAATGAATGA	0.299								Other conserved DNA damage response genes					A|||	1565	0.3125	0.2073	0.353	5008	,	,		14160	0.3542		0.3917	False		,,,				2504	0.3016				p.Y1736Y		.											.	ATR-1139	0			c.T5208C						.	A		945,3461	352.3+/-311.7	97,751,1355	43.0	41.0	42.0		5208	-0.1	1.0	3	dbSNP_98	42	3598,4992	511.5+/-377.7	763,2072,1460	no	coding-synonymous	ATR	NM_001184.3		860,2823,2815	GG,GA,AA		41.8859,21.448,34.9569		1736/2645	142222284	4543,8453	2203	4295	6498	SO:0001819	synonymous_variant	545	exon30			ACCATGATAATGA	U76308	CCDS3124.1	3q23	2014-06-17	2014-06-17		ENSG00000175054	ENSG00000175054			882	protein-coding gene	gene with protein product	"""MEC1, mitosis entry checkpoint 1, homolog (S. cerevisiae)"""	601215	"""ataxia telangiectasia and Rad3 related"""			8978690, 8610130	Standard	NM_001184		Approved	FRP1, SCKL, SCKL1, MEC1	uc003eux.4	Q13535	OTTHUMG00000159234	ENST00000350721.4:c.5208T>C	3.37:g.142222284A>G		Somatic	252	0		WXS	Illumina GAIIx	Phase_I	146	5	NM_001184	0	0	0	0	0	Q59HB2|Q7KYL3|Q93051|Q9BXK4	Silent	SNP	ENST00000350721.4	37	CCDS3124.1																																																																																			T|0.254;G|0.218		0.299	ATR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353995.2	NM_001184	
IGSF10	285313	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	151161115	151161115	+	Missense_Mutation	SNP	C	C	T	rs145507750	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr3:151161115C>T	ENST00000282466.3	-	5	5619	c.5620G>A	c.(5620-5622)Gtt>Att	p.V1874I	IGSF10_ENST00000495443.1_5'Flank	NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	1874	Ig-like C2-type 5.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			ACCCAGTAAACGCTGGGCTGA	0.423													C|||	5	0.000998403	0.0	0.0	5008	,	,		21352	0.0		0.005	False		,,,				2504	0.0				p.V1874I		.											.	IGSF10-102	0			c.G5620A						.	C	ILE/VAL	0,4406		0,0,2203	72.0	73.0	73.0		5620	3.5	0.5	3	dbSNP_134	73	2,8598	2.2+/-6.3	0,2,4298	yes	missense	IGSF10	NM_178822.4	29	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	benign	1874/2624	151161115	2,13004	2203	4300	6503	SO:0001583	missense	285313	exon5			AGTAAACGCTGGG	AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.5620G>A	3.37:g.151161115C>T	ENSP00000282466:p.Val1874Ile	Somatic	63	0		WXS	Illumina GAIIx	Phase_I	69	57	NM_178822	0	0	0	0	0	Q86YJ9|Q8N772|Q8NA84	Missense_Mutation	SNP	ENST00000282466.3	37	CCDS3160.1	5	0.0022893772893772895	0	0.0	0	0.0	0	0.0	5	0.006596306068601583	C	7.620	0.676695	0.14841	0.0	2.33E-4	ENSG00000152580	ENST00000282466;ENST00000544042	T	0.72282	-0.64	5.26	3.46	0.39613	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.159917	0.28877	N	0.013844	T	0.42017	0.1184	N	0.04994	-0.135	0.27079	N	0.963133	B	0.13594	0.008	B	0.20577	0.03	T	0.15150	-1.0447	9	.	.	.	.	16.3907	0.83537	0.0:0.9282:0.0:0.0718	.	1874	Q6WRI0	IGS10_HUMAN	I	1874;501	ENSP00000282466:V1874I	.	V	-	1	0	IGSF10	152643805	0.004000	0.15560	0.458000	0.27068	0.899000	0.52679	0.134000	0.15932	0.607000	0.29982	-1.287000	0.01368	GTT	C|0.999;T|0.001		0.423	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357782.1	NM_178822	
TNK2	10188	hgsc.bcm.edu	37	3	195595405	195595405	+	Silent	SNP	G	G	A	rs1056726	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr3:195595405G>A	ENST00000333602.6	-	12	2336	c.1719C>T	c.(1717-1719)ttC>ttT	p.F573F	TNK2_ENST00000392400.1_Silent_p.F573F|TNK2_ENST00000381916.2_Silent_p.F651F|TNK2_ENST00000428187.1_Silent_p.F605F	NM_005781.4	NP_005772.3	Q07912	ACK1_HUMAN	tyrosine kinase, non-receptor, 2	573				Missing (in Ref. 4; AAH08884). {ECO:0000305}.	cell surface receptor signaling pathway (GO:0007166)|endocytosis (GO:0006897)|negative regulation of catalytic activity (GO:0043086)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of clathrin-mediated endocytosis (GO:2000369)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|cell junction (GO:0030054)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|endosome (GO:0005768)|Grb2-EGFR complex (GO:0070436)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|WW domain binding (GO:0050699)			central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(11)|ovary(3)|prostate(4)|skin(2)|stomach(1)|urinary_tract(1)	29	all_cancers(143;6.48e-09)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;1.46e-22)|OV - Ovarian serous cystadenocarcinoma(49;8.3e-19)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;0.000757)	Adenosine triphosphate(DB00171)	GCTCCTCACCGAAGTCGATGA	0.746													a|||	310	0.061901	0.0847	0.0259	5008	,	,		10834	0.0704		0.0467	False		,,,				2504	0.0634				p.F651F		.											.	TNK2-957	0			c.C1953T						.		,	269,3657		9,251,1703	5.0	6.0	6.0		1953,1719	-5.7	0.0	3	dbSNP_86	6	322,7600		4,314,3643	no	coding-synonymous,coding-synonymous	TNK2	NM_001010938.1,NM_005781.4	,	13,565,5346	AA,AG,GG		4.0646,6.8518,4.9882	,	651/1087,573/1039	195595405	591,11257	1963	3961	5924	SO:0001819	synonymous_variant	10188	exon13			CTCACCGAAGTCG	L13738	CCDS33927.1, CCDS33928.1	3q29	2013-09-02			ENSG00000061938	ENSG00000061938			19297	protein-coding gene	gene with protein product	"""activated Cdc42-associated kinase 1"""	606994				8497321, 14506255	Standard	XM_006713460		Approved	p21cdc42Hs, ACK, ACK1	uc003fvt.1	Q07912	OTTHUMG00000155737	ENST00000333602.6:c.1719C>T	3.37:g.195595405G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	12	11	NM_001010938	0	0	0	0	0	Q6ZMQ0|Q8N6U7|Q96H59	Silent	SNP	ENST00000333602.6	37	CCDS33928.1	134	0.06135531135531135	38	0.07723577235772358	10	0.027624309392265192	53	0.09265734265734266	33	0.04353562005277045	A	0.025	-1.382365	0.01204	0.068518	0.040646	ENSG00000061938	ENST00000424563	.	.	.	5.41	-5.74	0.02391	.	.	.	.	.	T	0.06096	0.0158	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.56288	-0.8004	4	.	.	.	.	15.998	0.80265	0.6944:0.0:0.3056:0.0	rs1056726;rs3197336;rs57297005	.	.	.	L	183	.	.	S	-	2	0	TNK2	197079802	0.028000	0.19301	0.045000	0.18777	0.071000	0.16799	-0.555000	0.05999	-1.423000	0.02002	-2.075000	0.00382	TCG	G|0.936;A|0.064		0.746	TNK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341437.3	NM_005781	
DOK7	285489	broad.mit.edu	37	4	3494664	3494664	+	Silent	SNP	A	A	C			TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr4:3494664A>C	ENST00000340083.5	+	7	1016	c.951A>C	c.(949-951)ccA>ccC	p.P317P	DOK7_ENST00000507039.1_3'UTR|DOK7_ENST00000389653.2_Silent_p.P317P|DOK7_ENST00000512714.1_3'UTR	NM_173660.4	NP_775931.3	Q18PE1	DOK7_HUMAN	docking protein 7	317	Ser-rich.				neuromuscular junction development (GO:0007528)|positive regulation of protein tyrosine kinase activity (GO:0061098)|receptor clustering (GO:0043113)	cell junction (GO:0030054)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)|protein kinase binding (GO:0019901)			kidney(1)|large_intestine(1)|skin(2)|upper_aerodigestive_tract(1)	5				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		CCTCAAGGCCACCCCCCAAGC	0.692																																					p.P317P		.											.	DOK7-91	0			c.A951C						.						7.0	8.0	7.0					4																	3494664		2122	4167	6289	SO:0001819	synonymous_variant	285489	exon7			AAGGCCACCCCCC	AK091037	CCDS3370.2, CCDS54717.1	4p16.2	2014-09-17	2006-08-24	2006-08-24	ENSG00000175920	ENSG00000175920			26594	protein-coding gene	gene with protein product		610285	"""chromosome 4 open reading frame 25"""	C4orf25		16794080	Standard	NM_173660		Approved	FLJ33718, FLJ39137, Dok-7	uc003ghd.3	Q18PE1	OTTHUMG00000122087	ENST00000340083.5:c.951A>C	4.37:g.3494664A>C		Somatic	32	6		WXS	Illumina GAIIx	Phase_I	104	27	NM_173660	0	0	0	0	0	A2A499|A2RRD4|E9PB56|Q6P6A6|Q86XG5|Q8N2J3|Q8NBC1	Silent	SNP	ENST00000340083.5	37	CCDS3370.2																																																																																			.		0.692	DOK7-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000313538.1	NM_173660	
GABRA2	2555	broad.mit.edu;bcgsc.ca	37	4	46252483	46252483	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr4:46252483G>T	ENST00000510861.1	-	10	1371	c.1198C>A	c.(1198-1200)Cca>Aca	p.P400T	GABRA2_ENST00000356504.1_Missense_Mutation_p.P400T|GABRA2_ENST00000381620.4_Missense_Mutation_p.P400T|GABRA2_ENST00000514090.1_Missense_Mutation_p.P400T|GABRA2_ENST00000507069.1_Missense_Mutation_p.P460T|GABRA2_ENST00000540012.1_Missense_Mutation_p.P405T			P47869	GBRA2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 2	400					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|neurotransmitter transport (GO:0006836)|regulation of neurotransmitter levels (GO:0001505)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	axon (GO:0030424)|cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of synaptic vesicle membrane (GO:0030285)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(9)|lung(33)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	56					Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zolpidem(DB00425)|Zopiclone(DB01198)	TTGTTTTCTGGCTTCTTGTTG	0.418																																					p.P400T		.											.	GABRA2-94	0			c.C1198A						.						199.0	203.0	202.0					4																	46252483		2203	4299	6502	SO:0001583	missense	2555	exon10			TTTCTGGCTTCTT		CCDS3471.1	4p12	2012-06-22			ENSG00000151834	ENSG00000151834		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4076	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 2"""	137140					Standard	NM_000807		Approved		uc010igc.2	P47869	OTTHUMG00000044266	ENST00000510861.1:c.1198C>A	4.37:g.46252483G>T	ENSP00000421828:p.Pro400Thr	Somatic	204	1		WXS	Illumina GAIIx	Phase_I	152	10	NM_000807	0	0	0	0	0	A8K0U7|B7Z1H8|Q59G14	Missense_Mutation	SNP	ENST00000510861.1	37	CCDS3471.1	.	.	.	.	.	.	.	.	.	.	G	10.79	1.450929	0.26074	.	.	ENSG00000151834	ENST00000510861;ENST00000514090;ENST00000381620;ENST00000356504;ENST00000540012;ENST00000507069	D;D;D;D;D;T	0.85556	-2.0;-2.0;-2.0;-2.0;-2.0;-0.46	5.96	5.96	0.96718	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.333863	0.36519	N	0.002551	T	0.81706	0.4879	L	0.46819	1.47	0.38723	D	0.953495	P;B	0.36282	0.546;0.137	B;B	0.36608	0.229;0.08	T	0.79526	-0.1767	10	0.20046	T	0.44	.	17.5676	0.87924	0.0:0.0:1.0:0.0	.	405;400	B7Z1H8;P47869	.;GBRA2_HUMAN	T	400;400;400;400;405;460	ENSP00000421828:P400T;ENSP00000421300:P400T;ENSP00000371033:P400T;ENSP00000348897:P400T;ENSP00000444409:P405T;ENSP00000427603:P460T	ENSP00000348897:P400T	P	-	1	0	GABRA2	45947240	1.000000	0.71417	0.999000	0.59377	0.863000	0.49368	5.830000	0.69324	2.827000	0.97445	0.655000	0.94253	CCA	.		0.418	GABRA2-005	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360848.2		
ZAR1	326340	hgsc.bcm.edu	37	4	48492434	48492434	+	Missense_Mutation	SNP	G	G	C	rs10008444	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr4:48492434G>C	ENST00000327939.4	+	1	166	c.126G>C	c.(124-126)caG>caC	p.Q42H		NM_175619.1	NP_783318.1	Q86SH2	ZAR1_HUMAN	zygote arrest 1	42					multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)				endometrium(1)|large_intestine(4)	5						GCTGGCAGCAGCGCGGCAGGG	0.756													C|||	4938	0.986022	0.9493	0.9957	5008	,	,		9261	1.0		1.0	False		,,,				2504	1.0				p.Q42H		.											.	ZAR1-90	0			c.G126C						.	C	HIS/GLN	2851,89		1381,89,0	2.0	3.0	3.0		126	-0.2	0.0	4	dbSNP_119	3	6474,0		3237,0,0	no	missense	ZAR1	NM_175619.1	24	4618,89,0	CC,CG,GG		0.0,3.0272,0.9454	benign	42/425	48492434	9325,89	1470	3237	4707	SO:0001583	missense	326340	exon1			GCAGCAGCGCGGC	AY193890	CCDS3483.1	4p11	2014-02-20			ENSG00000182223	ENSG00000182223			20436	protein-coding gene	gene with protein product	"""zinc finger, 3CxxC-type 6"""	607520				12539046	Standard	NM_175619		Approved	Z3CXXC6	uc003gyd.3	Q86SH2	OTTHUMG00000102093	ENST00000327939.4:c.126G>C	4.37:g.48492434G>C	ENSP00000329803:p.Gln42His	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	9	NM_175619	0	0	0	0	0		Missense_Mutation	SNP	ENST00000327939.4	37	CCDS3483.1	2130	0.9752747252747253	449	0.9126016260162602	359	0.9917127071823204	565	0.9877622377622378	757	0.9986807387862797	C	0.021	-1.426522	0.01117	0.969728	1.0	ENSG00000182223	ENST00000327939	.	.	.	4.09	-0.185	0.13276	.	0.811302	0.10779	N	0.635071	T	0.00012	0.0000	N	0.03608	-0.345	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.22103	-1.0226	8	0.14252	T	0.57	-31.571	6.2995	0.21105	0.0:0.2927:0.4307:0.2766	rs10008444;rs58304706	42	Q86SH2	ZAR1_HUMAN	H	42	.	ENSP00000329803:Q42H	Q	+	3	2	ZAR1	48187191	0.000000	0.05858	0.000000	0.03702	0.070000	0.16714	0.053000	0.14184	-0.405000	0.07599	-0.676000	0.03789	CAG	G|0.025;C|0.975		0.756	ZAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219927.3		
UGT2B17	7367	ucsc.edu;bcgsc.ca	37	4	69433714	69433714	+	Silent	SNP	C	C	T	rs34664906	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr4:69433714C>T	ENST00000317746.2	-	1	531	c.489G>A	c.(487-489)gaG>gaA	p.E163E		NM_001077.3	NP_001068.1	O75795	UDB17_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B17	163					cellular glucuronidation (GO:0052695)|steroid metabolic process (GO:0008202)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucuronosyltransferase activity (GO:0015020)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(14)|ovary(2)|prostate(1)	30					Losartan(DB00678)	TGTTAAGTAGCTCAGCCAGCA	0.443													C|||	1417	0.282947	0.3306	0.4798	5008	,	,		8754	0.0476		0.3549	False		,,,				2504	0.2474				p.E163E	Melanoma(18;649 833 28984 37818 38500)	.											.	UGT2B17-91	0			c.G489A						.	C		1402,2780		435,532,1124	177.0	173.0	174.0		489	1.8	0.3	4	dbSNP_126	174	3313,4597		1164,985,1806	no	coding-synonymous	UGT2B17	NM_001077.3		1599,1517,2930	TT,TC,CC		41.8837,33.5246,38.9927		163/531	69433714	4715,7377	2091	3955	6046	SO:0001819	synonymous_variant	7367	exon1			AAGTAGCTCAGCC	U59209	CCDS3523.1	4q13	2008-02-05	2005-07-20		ENSG00000197888	ENSG00000197888		"""UDP glucuronosyltransferases"""	12547	protein-coding gene	gene with protein product		601903	"""UDP glycosyltransferase 2 family, polypeptide B17"""			8798464	Standard	NM_001077		Approved		uc021xov.1	O75795	OTTHUMG00000129305	ENST00000317746.2:c.489G>A	4.37:g.69433714C>T		Somatic	183	1		WXS	Illumina GAIIx	Phase_I	22	6	NM_001077	0	0	0	0	0		Silent	SNP	ENST00000317746.2	37	CCDS3523.1																																																																																			C|0.693;T|0.307		0.443	UGT2B17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251436.1	NM_001077	
EREG	2069	bcgsc.ca	37	4	75248434	75248434	+	Silent	SNP	A	A	G	rs2367707	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr4:75248434A>G	ENST00000244869.2	+	4	517	c.351A>G	c.(349-351)gaA>gaG	p.E117E	EREG_ENST00000503689.1_3'UTR	NM_001432.2	NP_001423.1	O14944	EREG_HUMAN	epiregulin	117					anatomical structure morphogenesis (GO:0009653)|angiogenesis (GO:0001525)|cell-cell signaling (GO:0007267)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|female meiotic division (GO:0007143)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|keratinocyte differentiation (GO:0030216)|keratinocyte proliferation (GO:0043616)|luteinizing hormone signaling pathway (GO:0042700)|mRNA transcription (GO:0009299)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of smooth muscle cell differentiation (GO:0051151)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oocyte maturation (GO:0001556)|organ morphogenesis (GO:0009887)|ovarian cumulus expansion (GO:0001550)|ovulation (GO:0030728)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokine biosynthetic process (GO:0042108)|positive regulation of cytokine production (GO:0001819)|positive regulation of DNA replication (GO:0045740)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of innate immune response (GO:0045089)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of mitosis (GO:0045840)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of smooth muscle cell proliferation (GO:0048661)|primary follicle stage (GO:0048160)|response to peptide hormone (GO:0043434)|wound healing (GO:0042060)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	epidermal growth factor receptor binding (GO:0005154)			breast(1)|endometrium(2)|large_intestine(2)|lung(7)|skin(1)	13			Lung(101;0.196)			TAAGCAAAGAATATGTGGCTT	0.383													A|||	3845	0.767772	0.7905	0.8285	5008	,	,		19547	0.6984		0.8101	False		,,,				2504	0.7219				p.E117E		.											.	EREG-586	0			c.A351G						.	A		3321,1085	721.1+/-409.1	1250,821,132	169.0	160.0	163.0		351	2.0	1.0	4	dbSNP_100	163	6799,1801	733.0+/-406.9	2683,1433,184	no	coding-synonymous	EREG	NM_001432.2		3933,2254,316	GG,GA,AA		20.9419,24.6255,22.1898		117/170	75248434	10120,2886	2203	4300	6503	SO:0001819	synonymous_variant	2069	exon4			CAAAGAATATGTG	D30783	CCDS3564.1	4q21.21	2008-07-29			ENSG00000124882	ENSG00000124882			3443	protein-coding gene	gene with protein product		602061				9337852	Standard	NM_001432		Approved	ER	uc003hie.1	O14944	OTTHUMG00000130005	ENST00000244869.2:c.351A>G	4.37:g.75248434A>G		Somatic	162	0		WXS	Illumina GAIIx	Phase_I	140	5	NM_001432	0	0	0	0	0	B2RC66|Q6FH69	Silent	SNP	ENST00000244869.2	37	CCDS3564.1																																																																																			A|0.223;G|0.777		0.383	EREG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252276.1		
FRAS1	80144	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	79351450	79351450	+	Silent	SNP	T	T	C			TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr4:79351450T>C	ENST00000325942.6	+	37	5288	c.4848T>C	c.(4846-4848)ctT>ctC	p.L1616L	FRAS1_ENST00000264895.6_Silent_p.L1616L	NM_001166133.1	NP_001159605.1	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	1616					cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						CTGCAGGACTTCAGGTGGTAG	0.483																																					p.L1616L		.											.	FRAS1-68	0			c.T4848C						.						64.0	67.0	66.0					4																	79351450		1989	4181	6170	SO:0001819	synonymous_variant	80144	exon37			AGGACTTCAGGTG	AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000325942.6:c.4848T>C	4.37:g.79351450T>C		Somatic	87	0		WXS	Illumina GAIIx	Phase_I	71	58	NM_001166133	0	0	0	0	0	A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Silent	SNP	ENST00000325942.6	37	CCDS54772.1	.	.	.	.	.	.	.	.	.	.	T	4.704	0.130875	0.08981	.	.	ENSG00000138759	ENST00000510944	.	.	.	5.16	-3.08	0.05347	.	.	.	.	.	T	0.20047	0.0482	.	.	.	0.29106	N	0.881197	.	.	.	.	.	.	T	0.31024	-0.9958	4	.	.	.	.	2.6133	0.04897	0.103:0.3285:0.2711:0.2974	.	.	.	.	P	66	.	.	S	+	1	0	FRAS1	79570474	0.845000	0.29573	0.073000	0.20177	0.010000	0.07245	-0.419000	0.07071	-0.543000	0.06240	-0.353000	0.07706	TCA	.		0.483	FRAS1-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000362706.2		
DSPP	1834	bcgsc.ca	37	4	88537114	88537114	+	Silent	SNP	C	C	T	rs369973717	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr4:88537114C>T	ENST00000282478.7	+	4	3333	c.3300C>T	c.(3298-3300)agC>agT	p.S1100S	DSPP_ENST00000399271.1_Silent_p.S1100S|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1100	Asp/Ser-rich.			Missing (in Ref. 1; AAF42472 and 3; AAD16120). {ECO:0000305}.	biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gcgatagcagcgacagcagcg	0.547													T|||	2077	0.414736	0.5416	0.487	5008	,	,		13280	0.3323		0.3996	False		,,,				2504	0.2924				p.S1100S		.											.	DSPP-90	0			c.C3300T						.						13.0	21.0	18.0					4																	88537114		1002	1944	2946	SO:0001819	synonymous_variant	1834	exon5			TAGCAGCGACAGC	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3300C>T	4.37:g.88537114C>T		Somatic	67	5		WXS	Illumina GAIIx	Phase_I	108	38	NM_014208	0	0	0	0	0	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	37	CCDS43248.1																																																																																			.		0.547	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
PRDM5	11107	bcgsc.ca	37	4	121738049	121738049	+	Silent	SNP	T	T	C	rs343192	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr4:121738049T>C	ENST00000264808.3	-	6	921	c.681A>G	c.(679-681)ctA>ctG	p.L227L	PRDM5_ENST00000515109.1_Intron|PRDM5_ENST00000428209.2_Intron	NM_018699.2	NP_061169.2	Q9NQX1	PRDM5_HUMAN	PR domain containing 5	227					histone deacetylation (GO:0016575)|histone H3-K9 methylation (GO:0051567)|mitotic cell cycle (GO:0000278)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|repressing transcription factor binding (GO:0070491)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(17)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						AAGACTCCTTTAGACTGCTTT	0.363													C|||	1377	0.27496	0.2057	0.3948	5008	,	,		17855	0.3562		0.3191	False		,,,				2504	0.1544				p.L227L		.											.	PRDM5-91	0			c.A681G						.	C		947,3459	735.3+/-410.7	106,735,1362	154.0	159.0	157.0		681	2.4	1.0	4	dbSNP_79	157	2711,5889	682.3+/-403.8	446,1819,2035	no	coding-synonymous	PRDM5	NM_018699.2		552,2554,3397	CC,CT,TT		31.5233,21.4934,28.1255		227/631	121738049	3658,9348	2203	4300	6503	SO:0001819	synonymous_variant	11107	exon6			CTCCTTTAGACTG	AF272897	CCDS3716.1, CCDS75187.1, CCDS75188.1	4q25-q26	2013-01-08			ENSG00000138738	ENSG00000138738		"""Zinc fingers, C2H2-type"""	9349	protein-coding gene	gene with protein product		614161					Standard	XM_005262706		Approved	PFM2	uc003idn.3	Q9NQX1	OTTHUMG00000132970	ENST00000264808.3:c.681A>G	4.37:g.121738049T>C		Somatic	246	0		WXS	Illumina GAIIx	Phase_I	206	6	NM_018699	0	0	1	1	0	Q0VAI9|Q0VAJ0|Q6NXQ7	Silent	SNP	ENST00000264808.3	37	CCDS3716.1																																																																																			T|0.707;C|0.293		0.363	PRDM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256528.2		
IRX4	50805	hgsc.bcm.edu	37	5	1882129	1882129	+	Silent	SNP	T	T	G	rs2232374	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr5:1882129T>G	ENST00000505790.1	-	3	546	c.90A>C	c.(88-90)ggA>ggC	p.G30G	IRX4_ENST00000231357.2_Silent_p.G30G|IRX4_ENST00000513692.1_Silent_p.G30G|CTD-2194D22.3_ENST00000506335.1_RNA|IRX4_ENST00000505938.1_5'Flank	NM_001278634.1	NP_001265563.1	P78413	IRX4_HUMAN	iroquois homeobox 4	30					establishment of organ orientation (GO:0048561)|heart development (GO:0007507)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|lung(7)|ovary(1)|prostate(1)	10				GBM - Glioblastoma multiforme(108;0.242)		GCGTGCGGCCTCCGGACTCGC	0.741													N|||	1389	0.277356	0.2821	0.3141	5008	,	,		10764	0.3313		0.2177	False		,,,				2504	0.2505				p.G30G		.											.	IRX4-226	0			c.A90C						.			440,2456		29,382,1037	2.0	2.0	2.0		90	-2.3	0.0	5	dbSNP_98	2	967,5425		81,805,2310	no	coding-synonymous	IRX4	NM_016358.2		110,1187,3347	GG,GT,TT		15.1283,15.1934,15.1486		30/520	1882129	1407,7881	1448	3196	4644	SO:0001819	synonymous_variant	50805	exon2			GCGGCCTCCGGAC	AF124733	CCDS3867.1, CCDS75225.1	5p15.33	2011-06-20	2007-07-13		ENSG00000113430	ENSG00000113430		"""Homeoboxes / TALE class"""	6129	protein-coding gene	gene with protein product		606199	"""iroquois homeobox protein 4"""			10625552	Standard	NM_016358		Approved		uc003jcz.2	P78413	OTTHUMG00000090411	ENST00000505790.1:c.90A>C	5.37:g.1882129T>G		Somatic	3	0		WXS	Illumina GAIIx	Phase_I	26	17	NM_016358	0	0	0	0	0	B2RMW5|D3DTC5|H1AFL0|H1AFL1|Q2NL64|Q9UHR2	Silent	SNP	ENST00000505790.1	37	CCDS3867.1																																																																																			T|0.735;G|0.265		0.741	IRX4-004	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365500.1	NM_016358	
PIK3R1	5295	bcgsc.ca	37	5	67588148	67588148	+	Missense_Mutation	SNP	G	G	A	rs3730089	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr5:67588148G>A	ENST00000521381.1	+	8	1594	c.978G>A	c.(976-978)atG>atA	p.M326I	PIK3R1_ENST00000336483.5_Missense_Mutation_p.M56I|PIK3R1_ENST00000521657.1_Missense_Mutation_p.M326I|PIK3R1_ENST00000523872.1_5'Flank|PIK3R1_ENST00000320694.8_Missense_Mutation_p.M26I|PIK3R1_ENST00000274335.5_Missense_Mutation_p.M326I|PIK3R1_ENST00000396611.1_Missense_Mutation_p.M326I	NM_181523.2	NP_852664.1	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1 (alpha)	326			M -> I (does not affect insulin- stimulated lipid kinase activity; dbSNP:rs3730089). {ECO:0000269|PubMed:10768093, ECO:0000269|PubMed:9032108, ECO:0000269|Ref.5}.		B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|cellular response to UV (GO:0034644)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|growth hormone receptor signaling pathway (GO:0060396)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|leukocyte migration (GO:0050900)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of osteoclast differentiation (GO:0045671)|neurotrophin TRK receptor signaling pathway (GO:0048011)|NFAT protein import into nucleus (GO:0051531)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of glucose import (GO:0046326)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|protein phosphorylation (GO:0006468)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|membrane (GO:0016020)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	ErbB-3 class receptor binding (GO:0043125)|insulin binding (GO:0043559)|insulin receptor binding (GO:0005158)|insulin receptor substrate binding (GO:0043560)|insulin-like growth factor receptor binding (GO:0005159)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatidylinositol 3-kinase binding (GO:0043548)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)	p.0?(1)|p.?(1)		breast(12)|central_nervous_system(31)|cervix(1)|endometrium(68)|haematopoietic_and_lymphoid_tissue(5)|kidney(1)|large_intestine(32)|lung(10)|ovary(9)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	178		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoprenaline(DB01064)	ATAACAATATGTCCTTACAAG	0.393			"""Mis, F, O"""		"""gliobastoma, ovarian, colorectal"""					TCGA GBM(4;<1E-08)			G|||	1104	0.220447	0.416	0.2133	5008	,	,		17820	0.1657		0.167	False		,,,				2504	0.0726				p.M326I		.		Rec	yes		5	5q13.1	5295	"""phosphoinositide-3-kinase, regulatory subunit 1 (alpha)"""		"""E, O"""	.	PIK3R1-4332	2	Whole gene deletion(1)|Unknown(1)	large_intestine(1)|lung(1)	c.G978A	GRCh37	CM080497	PIK3R1	M	rs3730089	.	G	ILE/MET,ILE/MET,ILE/MET	1684,2722	509.9+/-367.4	325,1034,844	168.0	158.0	161.0		168,978,78	4.2	1.0	5	dbSNP_107	161	1415,7185	273.4+/-290.6	126,1163,3011	yes	missense,missense,missense	PIK3R1	NM_181504.3,NM_181523.2,NM_181524.1	10,10,10	451,2197,3855	AA,AG,GG		16.4535,38.2206,23.8275	benign,benign,benign	56/455,326/725,26/425	67588148	3099,9907	2203	4300	6503	SO:0001583	missense	5295	exon8			CAATATGTCCTTA	M61906	CCDS3993.1, CCDS3994.1, CCDS3995.1, CCDS56374.1	5q13.1	2014-09-17	2008-02-04		ENSG00000145675	ENSG00000145675		"""SH2 domain containing"""	8979	protein-coding gene	gene with protein product		171833				1314371, 18387942	Standard	NM_181524		Approved	GRB1, p85-ALPHA, p85	uc003jva.3	P27986	OTTHUMG00000131251	ENST00000521381.1:c.978G>A	5.37:g.67588148G>A	ENSP00000428056:p.Met326Ile	Somatic	89	0		WXS	Illumina GAIIx	Phase_I	76	5	NM_181523	0	0	14	14	0	B3KT19|D3DWA0|E7EX19|Q15747|Q4VBZ7|Q53EM6|Q8IXA2|Q8N1C5	Missense_Mutation	SNP	ENST00000521381.1	37	CCDS3993.1	475	0.2174908424908425	186	0.3780487804878049	77	0.212707182320442	92	0.16083916083916083	120	0.158311345646438	G	11.03	1.519262	0.27211	0.382206	0.164535	ENSG00000145675	ENST00000521381;ENST00000521657;ENST00000396611;ENST00000274335;ENST00000523807;ENST00000522084;ENST00000320694;ENST00000336483	T;T;T;T;T;T;T;T	0.62105	0.06;0.06;0.06;0.06;1.99;0.05;0.06;0.06	5.13	4.25	0.50352	SH2 motif (1);	0.115588	0.85682	N	0.000000	T	0.00012	0.0000	L	0.42245	1.32	0.09310	P	0.999999792074	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.26258	-1.0108	9	0.30078	T	0.28	-15.3304	15.3625	0.74492	0.0:0.0:0.8593:0.1407	rs3730089;rs17847316;rs52830014;rs3730089	56;26;326	P27986-2;P27986-3;P27986	.;.;P85A_HUMAN	I	326;326;326;326;56;56;26;56	ENSP00000428056:M326I;ENSP00000429277:M326I;ENSP00000379855:M326I;ENSP00000274335:M326I;ENSP00000430126:M56I;ENSP00000429766:M56I;ENSP00000323512:M26I;ENSP00000338554:M56I	ENSP00000274335:M326I	M	+	3	0	PIK3R1	67623904	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.509000	0.60448	1.498000	0.48600	0.563000	0.77884	ATG	G|0.780;A|0.220		0.393	PIK3R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254013.2	NM_181504	
PROB1	389333	hgsc.bcm.edu	37	5	138730037	138730037	+	Missense_Mutation	SNP	T	T	C	rs11748963	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr5:138730037T>C	ENST00000434752.2	-	1	848	c.734A>G	c.(733-735)cAg>cGg	p.Q245R		NM_001161546.1	NP_001155018.1	E7EW31	PROB1_HUMAN	proline-rich basic protein 1	245																	CGCGGCGGCCTGCAGGGGGCC	0.781													T|||	1773	0.354034	0.146	0.2839	5008	,	,		10752	0.6151		0.3042	False		,,,				2504	0.4673				p.Q245R		.											.	.	0			c.A734G						.						5.0	7.0	6.0					5																	138730037		671	1537	2208	SO:0001583	missense	389333	exon1			GCGGCCTGCAGGG	AK316483	CCDS54909.1	5q31.2	2012-10-01	2012-10-01	2012-10-01	ENSG00000228672	ENSG00000228672			41906	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 65"""	C5orf65			Standard	NM_001161546		Approved		uc011czc.1	E7EW31		ENST00000434752.2:c.734A>G	5.37:g.138730037T>C	ENSP00000416033:p.Gln245Arg	Somatic	4	0		WXS	Illumina GAIIx	Phase_I	22	12	NM_001161546	0	0	0	0	0	B4E007	Missense_Mutation	SNP	ENST00000434752.2	37	CCDS54909.1	803	0.3676739926739927	105	0.21341463414634146	108	0.2983425414364641	366	0.6398601398601399	224	0.2955145118733509	T	21.8	4.205823	0.79127	.	.	ENSG00000228672	ENST00000434752	.	.	.	4.26	4.26	0.50523	.	.	.	.	.	T	0.00012	0.0000	L	0.36672	1.1	0.33628	P	0.39427599999999996	D	0.76494	0.999	D	0.83275	0.996	T	0.45483	-0.9258	7	0.52906	T	0.07	.	11.6588	0.51334	0.0:0.0:0.0:1.0	rs11748963	245	E7EW31	CE065_HUMAN	R	245	.	ENSP00000416033:Q245R	Q	-	2	0	AC135457.1	138757936	0.990000	0.36364	0.998000	0.56505	0.770000	0.43624	2.116000	0.41930	1.919000	0.55581	0.459000	0.35465	CAG	T|0.632;C|0.368		0.781	PROB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000470735.1	NM_001161546	
PPP1R3G	648791	hgsc.bcm.edu	37	6	5086070	5086070	+	Silent	SNP	A	A	G	rs667752		TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr6:5086070A>G	ENST00000405617.2	+	1	351	c.351A>G	c.(349-351)gcA>gcG	p.A117A		NM_001145115.1	NP_001138587.1	B7ZBB8	PP13G_HUMAN	protein phosphatase 1, regulatory subunit 3G	117					glucose homeostasis (GO:0042593)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of glycogen biosynthetic process (GO:0045725)	cytoplasm (GO:0005737)	glycogen binding (GO:2001069)			kidney(2)	2						CGGAGGACGCACAGCTCGGCC	0.692													G|||	5008	1.0	1.0	1.0	5008	,	,		12505	1.0		1.0	False		,,,				2504	1.0				p.A117A		.											.	PPP1R3G-136	0			c.A351G						.						1.0	2.0	2.0					6																	5086070		400	1062	1462	SO:0001819	synonymous_variant	648791	exon1			GGACGCACAGCTC		CCDS47366.1	6p25.1	2012-04-17	2011-10-04		ENSG00000219607	ENSG00000219607		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14945	protein-coding gene	gene with protein product			"""protein phosphatase 1, regulatory (inhibitor) subunit 3G"""			11948623	Standard	NM_001145115		Approved		uc011dia.1	B7ZBB8	OTTHUMG00000014172	ENST00000405617.2:c.351A>G	6.37:g.5086070A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_001145115	0	0	0	5	5		Silent	SNP	ENST00000405617.2	37	CCDS47366.1																																																																																			A|0.006;G|0.994		0.692	PPP1R3G-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039740.3	NM_001145115	
OR2H2	7932	bcgsc.ca	37	6	29555778	29555778	+	Silent	SNP	A	A	G	rs2235698	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr6:29555778A>G	ENST00000383640.2	+	1	96	c.57A>G	c.(55-57)ccA>ccG	p.P19P	GABBR1_ENST00000355973.3_Intron	NM_007160.3	NP_009091.3	O95918	OR2H2_HUMAN	olfactory receptor, family 2, subfamily H, member 2	19					defense response (GO:0006952)|detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|mating (GO:0007618)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(7)|prostate(1)|urinary_tract(1)	14						CTGAACACCCAGGGCTGGAAA	0.557													A|||	1347	0.26897	0.1573	0.2997	5008	,	,		19973	0.3393		0.2555	False		,,,				2504	0.3395				p.P19P		.											.	OR2H2-22	0			c.A57G						.	A		622,2400		74,474,963	173.0	178.0	176.0		57	-1.5	0.1	6	dbSNP_98	176	1286,4132		168,950,1591	no	coding-synonymous	OR2H2	NM_007160.3		242,1424,2554	GG,GA,AA		23.7357,20.5824,22.6066		19/313	29555778	1908,6532	1511	2709	4220	SO:0001819	synonymous_variant	7932	exon1			ACACCCAGGGCTG		CCDS34365.1	6p22.2-p21.31	2012-08-09				ENSG00000204657		"""GPCR / Class A : Olfactory receptors"""	8253	protein-coding gene	gene with protein product		600578					Standard	XM_005249407		Approved	hs6M1-12	uc003nmr.1	O95918		ENST00000383640.2:c.57A>G	6.37:g.29555778A>G		Somatic	147	0		WXS	Illumina GAIIx	Phase_I	136	7	NM_007160	0	0	0	0	0	Q15062|Q2M1Y3|Q5STL8|Q5SUK1|Q6IFN7|Q6NTB7|Q96R14	Silent	SNP	ENST00000383640.2	37	CCDS34365.1																																																																																			A|0.764;G|0.236		0.557	OR2H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076057.2		
HLA-A	3105	bcgsc.ca	37	6	29911925	29911925	+	Missense_Mutation	SNP	C	C	T	rs149288080	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr6:29911925C>T	ENST00000396634.1	+	6	987	c.646C>T	c.(646-648)Cac>Tac	p.H216Y	HLA-A_ENST00000376809.5_Missense_Mutation_p.H216Y|HLA-A_ENST00000376806.5_Missense_Mutation_p.H216Y|HLA-A_ENST00000376802.2_Missense_Mutation_p.H216Y			P16189	1A31_HUMAN	major histocompatibility complex, class I, A	216	Alpha-3.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	beta-2-microglobulin binding (GO:0030881)|peptide antigen binding (GO:0042605)|TAP binding (GO:0046977)			central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	30						TATGACCCACCACCCCATCTC	0.592									Osteosarcoma, Familial Clustering of;Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of;Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of	Multiple Myeloma(9;0.094)			c|||	254	0.0507188	0.0386	0.0749	5008	,	,		20313	0.0218		0.0785	False		,,,				2504	0.0511				p.H216Y		.											.	HLA-A-92	0			c.C646T						.	C	TYR/HIS	143,2871		15,113,1379	102.0	131.0	121.0		646	3.7	0.0	6	dbSNP_134	121	421,4993		32,357,2318	no	missense	HLA-A	NM_002116.7	83	47,470,3697	TT,TC,CC		7.7761,4.7445,6.692	possibly-damaging	216/366	29911925	564,7864	1507	2707	4214	SO:0001583	missense	3105	exon4	Familial Cancer Database	Familial Osteogenic Sarcoma;incl.: Familial Head and Neck Cancer; ;Lichen Sclerosis, Familial	ACCCACCACCCCA	D32129	CCDS34373.1	6p21.3	2013-01-11			ENSG00000206503	ENSG00000206503		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4931	protein-coding gene	gene with protein product		142800				8838351	Standard	NM_001242758		Approved		uc003nol.3	P01891	OTTHUMG00000130501	ENST00000396634.1:c.646C>T	6.37:g.29911925C>T	ENSP00000379873:p.His216Tyr	Somatic	70	0		WXS	Illumina GAIIx	Phase_I	33	4	NM_001242758	0	0	9	9	0	O62924|O98009|O98137|Q8MHM1|Q9TPQ3|Q9TQ24|Q9UQU6|Q9UQU7	Missense_Mutation	SNP	ENST00000396634.1	37	CCDS34373.1	86	0.039377289377289376	24	0.04878048780487805	22	0.06077348066298342	1	0.0017482517482517483	39	0.051451187335092345	.	7.901	0.734329	0.15574	0.047445	0.077761	ENSG00000206503	ENST00000396634;ENST00000376806;ENST00000536480;ENST00000376809;ENST00000376802	T;T;T;T	0.14144	2.53;2.53;2.53;2.53	3.69	3.69	0.42338	Immunoglobulin-like (4);Immunoglobulin-like fold (4);	0.335329	0.21108	U	0.080037	T	0.31009	0.0783	M	0.91920	3.255	0.09310	N	1	P;B;D;P;D;P;B	0.56521	0.786;0.405;0.976;0.533;0.976;0.78;0.24	P;B;D;B;D;P;B	0.71184	0.684;0.315;0.972;0.272;0.972;0.627;0.272	T	0.08310	-1.0728	10	0.87932	D	0	.	11.1517	0.48462	0.0:1.0:0.0:0.0	.	95;216;216;216;216;216;216	B4DVB9;P13746;Q5SRN7;P16188;Q5SRN5;P30455;P04439	.;1A11_HUMAN;.;1A30_HUMAN;.;1A36_HUMAN;1A03_HUMAN	Y	216;216;4;216;216	ENSP00000379873:H216Y;ENSP00000366002:H216Y;ENSP00000366005:H216Y;ENSP00000365998:H216Y	ENSP00000365998:H216Y	H	+	1	0	HLA-A	30019904	0.001000	0.12720	0.043000	0.18650	0.020000	0.10135	0.760000	0.26475	2.070000	0.61991	0.485000	0.47835	CAC	.		0.592	HLA-A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252909.1	NM_002116	
TNXB	7148	broad.mit.edu	37	6	32063513	32063514	+	Frame_Shift_Del	DEL	AC	AC	-	rs144556766		TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr6:32063513_32063514delAC	ENST00000479795.1	-	3	2256_2257	c.2116_2117delGT	c.(2116-2118)gtafs	p.V706fs	TNXB_ENST00000375244.3_Frame_Shift_Del_p.V706fs|TNXB_ENST00000375247.2_Frame_Shift_Del_p.V706fs			P22105	TENX_HUMAN	tenascin XB	706	EGF-like 18. {ECO:0000255|PROSITE- ProRule:PRU00076}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						GAAGCCCTCTACACACACACAC	0.668																																					p.706_706del		.											.	TNXB-90	0			c.2116_2117del						.																																			SO:0001589	frameshift_variant	7148	exon3			CCCTCTACACACA	X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000479795.1:c.2116_2117delGT	6.37:g.32063523_32063524delAC	ENSP00000418248:p.Val706fs	Somatic	240	0		WXS	Illumina GAIIx	Phase_I	409	8	NM_019105	0	0	0	0	0	P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Frame_Shift_Del	DEL	ENST00000479795.1	37																																																																																				.		0.668	TNXB-007	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000357059.1	NM_019105	
HLA-DQA1	3117	bcgsc.ca	37	6	32609126	32609126	+	Missense_Mutation	SNP	T	T	C	rs1071630	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr6:32609126T>C	ENST00000343139.5	+	2	224	c.122T>C	c.(121-123)tTt>tCt	p.F41S	HLA-DQA1_ENST00000374949.2_Missense_Mutation_p.F41S|HLA-DQA1_ENST00000395363.1_Missense_Mutation_p.F41S	NM_002122.3	NP_002113.2	P01909	DQA1_HUMAN	major histocompatibility complex, class II, DQ alpha 1	41	Alpha-1.		S -> F (in allele DQA1*01:01, allele DQA1*01:02, allele DQA1*01:03, allele DQA1*01:04, allele DQA1*01:05, allele DQA1*01:06 and allele DQA1*01:07; dbSNP:rs1071630).		antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	MHC class II receptor activity (GO:0032395)|peptide antigen binding (GO:0042605)			NS(1)|lung(3)|skin(1)|upper_aerodigestive_tract(1)	6						TTGTACCAGTTTTACGGTCCC	0.512													.|||	2770	0.553115	0.5076	0.6974	5008	,	,		15988	0.5446		0.5964	False		,,,				2504	0.4765				p.F41S		.											.	HLA-DQA1-90	0			c.T122C						.	C	SER/PHE	1711,2695		607,497,1099	140.0	117.0	125.0		122	3.0	0.5	6	dbSNP_86	125	3781,4795		1499,783,2006	yes	missense	HLA-DQA1	NM_002122.3	155	2106,1280,3105	CC,CT,TT		44.0882,38.8334,42.3047	benign	41/256	32609126	5492,7490	2203	4288	6491	SO:0001583	missense	3117	exon2			ACCAGTTTTACGG		CCDS4752.1	6p21.3	2013-01-11			ENSG00000196735	ENSG00000196735		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4942	protein-coding gene	gene with protein product		146880		HLA-DQA			Standard	NM_002122		Approved	CELIAC1	uc003obr.3	P01909	OTTHUMG00000031106	ENST00000343139.5:c.122T>C	6.37:g.32609126T>C	ENSP00000339398:p.Phe41Ser	Somatic	164	3		WXS	Illumina GAIIx	Phase_I	35	16	NM_002122	0	0	3	3	0	O19630|O19706|P01907|P01908|P04225|P04226|P05536|P79553|Q06751|Q29876|Q29994|Q2Q6Y6|Q2Q6Y7|Q2Q6Y8|Q2WCM3|Q30064|Q30067|Q30068|Q30070|Q30071|Q30072|Q30073|Q30086|Q30101|Q5Y7D5|Q5Y7F5|Q6ICU6|Q6PR46|Q6QDB1|Q860W2|Q860W4|Q9BD37|Q9TPM3|Q9UM31	Missense_Mutation	SNP	ENST00000343139.5	37	CCDS4752.1	1236|1236	0.5659340659340659|0.5659340659340659	233|233	0.4735772357723577|0.4735772357723577	247|247	0.6823204419889503|0.6823204419889503	318|318	0.5559440559440559|0.5559440559440559	438|438	0.5778364116094987|0.5778364116094987	.|.	0.529|0.529	-0.858787|-0.858787	0.02610|0.02610	0.388334|0.388334	0.440882|0.440882	ENSG00000196735|ENSG00000196735	ENST00000486548|ENST00000343139;ENST00000395364;ENST00000395363;ENST00000496318;ENST00000374949	.|T;T;T;T	.|0.01113	.|5.32;5.32;5.32;5.32	3.84|3.84	2.95|2.95	0.34219|0.34219	.|.	0.176324|0.176324	0.27302|0.27302	U|N	0.019987|0.019987	T|T	0.00073|0.00073	0.0002|0.0002	N|N	0.00008|0.00008	-3.11|-3.11	0.42258|0.42258	P|P	0.008000000000000007|0.008000000000000007	.|B;B	.|0.06786	.|0.001;0.0	.|B;B	.|0.10450	.|0.005;0.0	T|T	0.11397|0.11397	-1.0589|-1.0589	6|9	0.87932|0.02654	D|T	0|1	.|.	6.6795|6.6795	0.23113|0.23113	0.1754:0.7258:0.0:0.0988|0.1754:0.7258:0.0:0.0988	rs1071630;rs3187990;rs3205983;rs3208178;rs9272690;rs12722047;rs17415861|rs1071630;rs3187990;rs3205983;rs3208178;rs9272690;rs12722047;rs17415861	.|47;41	.|Q59F33;G4XQK2	.|.;.	L|S	14|41	.|ENSP00000339398:F41S;ENSP00000378767:F41S;ENSP00000437302:F41S;ENSP00000364087:F41S	ENSP00000437183:F14L|ENSP00000339398:F41S	F|F	+|+	1|2	0|0	HLA-DQA1|HLA-DQA1	32717104|32717104	0.113000|0.113000	0.22115|0.22115	0.496000|0.496000	0.27539|0.27539	0.021000|0.021000	0.10359|0.10359	0.696000|0.696000	0.25541|0.25541	0.401000|0.401000	0.25424|0.25424	-0.355000|-0.355000	0.07637|0.07637	TTT|TTT	T|0.423;C|0.577		0.512	HLA-DQA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076176.3	NM_002122	
NFKBIE	4794	hgsc.bcm.edu	37	6	44233216	44233216	+	Missense_Mutation	SNP	G	G	C	rs28362857	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr6:44233216G>C	ENST00000275015.5	-	1	284	c.285C>G	c.(283-285)caC>caG	p.H95Q		NM_004556.2	NP_004547.2	O00221	IKBE_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon	95			H -> Q (in dbSNP:rs28362857).		cytoplasmic sequestering of transcription factor (GO:0042994)|D-serine transport (GO:0042942)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)				breast(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)|urinary_tract(1)	10	all_cancers(18;2e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			TTCCCGGGCTGTGGGGCTCCG	0.761													G|||	85	0.0169728	0.0038	0.0173	5008	,	,		8929	0.001		0.0547	False		,,,				2504	0.0123				p.H95Q		.											.	NFKBIE-135	0			c.C285G						.	G	GLN/HIS	13,2975		0,13,1481	2.0	2.0	2.0		285	1.5	0.0	6	dbSNP_125	2	164,6046		0,164,2941	no	missense	NFKBIE	NM_004556.2	24	0,177,4422	CC,CG,GG		2.6409,0.4351,1.9243	benign	95/501	44233216	177,9021	1494	3105	4599	SO:0001583	missense	4794	exon1			CGGGCTGTGGGGC	U91616	CCDS34463.1	6p21.1	2013-01-10			ENSG00000146232	ENSG00000146232		"""Ankyrin repeat domain containing"""	7799	protein-coding gene	gene with protein product		604548				9135156	Standard	NM_004556		Approved	IKBE	uc003oxe.1	O00221	OTTHUMG00000014762	ENST00000275015.5:c.285C>G	6.37:g.44233216G>C	ENSP00000275015:p.His95Gln	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	10	NM_004556	0	0	0	0	0	Q5T9V9	Missense_Mutation	SNP	ENST00000275015.5	37	CCDS34463.1	53	0.024267399267399268	3	0.006097560975609756	3	0.008287292817679558	2	0.0034965034965034965	45	0.059366754617414245	G	17.80	3.479338	0.63849	0.004351	0.026409	ENSG00000146232	ENST00000275015	T	0.44083	0.93	4.67	1.51	0.23008	.	5.096390	0.00610	N	0.000415	T	0.08223	0.0205	N	0.03608	-0.345	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.21724	-1.0237	10	0.66056	D	0.02	-39.1688	4.361	0.11203	0.0946:0.1813:0.5784:0.1457	rs28362857	95	O00221	IKBE_HUMAN	Q	95	ENSP00000275015:H95Q	ENSP00000275015:H95Q	H	-	3	2	NFKBIE	44341194	0.002000	0.14202	0.001000	0.08648	0.900000	0.52787	1.124000	0.31320	0.901000	0.36495	0.455000	0.32223	CAC	G|0.059;C|0.941		0.761	NFKBIE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040733.2		
ENPP5	59084	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	46129455	46129455	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr6:46129455T>A	ENST00000371383.2	-	5	1302	c.1042A>T	c.(1042-1044)Atg>Ttg	p.M348L	ENPP5_ENST00000230565.3_Missense_Mutation_p.M348L					ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative)											endometrium(3)|kidney(1)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(1)	12						ATTGGATGCATATCTGCTAAC	0.383																																					p.M348L		.											.	ENPP5-90	0			c.A1042T						.						225.0	239.0	234.0					6																	46129455		2203	4300	6503	SO:0001583	missense	59084	exon4			GATGCATATCTGC	AL035701	CCDS4915.1	6p21.1-p11.2	2010-06-24	2010-06-24		ENSG00000112796	ENSG00000112796			13717	protein-coding gene	gene with protein product						11027689	Standard	XM_005249259		Approved		uc003oxz.1	Q9UJA9	OTTHUMG00000014781	ENST00000371383.2:c.1042A>T	6.37:g.46129455T>A	ENSP00000360436:p.Met348Leu	Somatic	38	0		WXS	Illumina GAIIx	Phase_I	24	22	NM_021572	0	0	0	14	14		Missense_Mutation	SNP	ENST00000371383.2	37	CCDS4915.1	.	.	.	.	.	.	.	.	.	.	T	25.9	4.685566	0.88639	.	.	ENSG00000112796	ENST00000371383;ENST00000230565	T;T	0.77229	-1.08;-1.08	5.53	5.53	0.82687	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.080484	0.85682	D	0.000000	D	0.86368	0.5916	M	0.82823	2.61	0.46131	D	0.998882	D	0.89917	1.0	D	0.91635	0.999	D	0.88826	0.3302	10	0.87932	D	0	-21.3116	14.2265	0.65863	0.0:0.0:0.0:1.0	.	348	Q9UJA9	ENPP5_HUMAN	L	348	ENSP00000360436:M348L;ENSP00000230565:M348L	ENSP00000230565:M348L	M	-	1	0	ENPP5	46237414	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.186000	0.77722	2.100000	0.63781	0.533000	0.62120	ATG	.		0.383	ENPP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040779.2		
STXBP5	134957	broad.mit.edu;bcgsc.ca	37	6	147525733	147525733	+	Missense_Mutation	SNP	A	A	T			TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr6:147525733A>T	ENST00000321680.6	+	1	65	c.65A>T	c.(64-66)cAg>cTg	p.Q22L	STXBP5_ENST00000367480.3_Missense_Mutation_p.Q22L|STXBP5-AS1_ENST00000417502.1_RNA|STXBP5_ENST00000546097.1_Missense_Mutation_p.Q22L|STXBP5_ENST00000367481.3_Missense_Mutation_p.Q22L|STXBP5_ENST00000179882.6_5'Flank|STXBP5-AS1_ENST00000427394.1_RNA|STXBP5-AS1_ENST00000367477.3_RNA	NM_001127715.2	NP_001121187.1	Q5T5C0	STXB5_HUMAN	syntaxin binding protein 5 (tomosyn)	22	Poly-Gln.				exocytosis (GO:0006887)|negative regulation of exocytosis (GO:0045920)|positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|synapse (GO:0045202)	syntaxin-1 binding (GO:0017075)			breast(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(21)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	42		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.77e-09)|GBM - Glioblastoma multiforme(68;0.0694)		TCGGCGTCGCAGCAGCAACAG	0.662																																					p.Q22L		.											.	STXBP5-90	0			c.A65T						.						24.0	29.0	28.0					6																	147525733		2202	4296	6498	SO:0001583	missense	134957	exon1			CGTCGCAGCAGCA	AK055484	CCDS5211.1, CCDS47499.1	6q24.3	2013-01-10			ENSG00000164506	ENSG00000164506		"""WD repeat domain containing"""	19665	protein-coding gene	gene with protein product		604586				9620695, 14767561	Standard	NM_139244		Approved	tomosyn, LLGL3	uc010khz.2	Q5T5C0	OTTHUMG00000015766	ENST00000321680.6:c.65A>T	6.37:g.147525733A>T	ENSP00000321826:p.Gln22Leu	Somatic	207	2		WXS	Illumina GAIIx	Phase_I	222	136	NM_139244	0	0	0	1	1	Q14DF3|Q5T5C1|Q5T5C2|Q8NBG8|Q96NG9	Missense_Mutation	SNP	ENST00000321680.6	37	CCDS47499.1	.	.	.	.	.	.	.	.	.	.	A	17.48	3.399812	0.62177	.	.	ENSG00000164506	ENST00000367481;ENST00000546097;ENST00000321680;ENST00000367480	T;D;T;T	0.84800	2.67;-1.9;2.67;2.77	3.83	3.83	0.44106	.	0.653399	0.13972	N	0.350069	T	0.61060	0.2317	N	0.22421	0.69	0.80722	D	1	B;B	0.16166	0.001;0.016	B;B	0.08055	0.003;0.003	T	0.59915	-0.7364	10	0.38643	T	0.18	.	8.2096	0.31476	0.7135:0.2865:0.0:0.0	.	22;22	Q5T5C0-2;Q5T5C0	.;STXB5_HUMAN	L	22	ENSP00000356451:Q22L;ENSP00000441479:Q22L;ENSP00000321826:Q22L;ENSP00000356450:Q22L	ENSP00000321826:Q22L	Q	+	2	0	STXBP5	147567426	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	1.096000	0.30976	1.381000	0.46364	0.477000	0.44152	CAG	.		0.662	STXBP5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042606.1		
PRR18	285800	hgsc.bcm.edu	37	6	166720806	166720806	+	Silent	SNP	G	G	C	rs911203	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr6:166720806G>C	ENST00000322583.3	-	1	1065	c.825C>G	c.(823-825)tcC>tcG	p.S275S		NM_175922.3	NP_787118.2	Q8N4B5	PRR18_HUMAN	proline rich 18	275										haematopoietic_and_lymphoid_tissue(2)|lung(1)	3		Breast(66;2.35e-05)|Ovarian(120;0.0606)|Prostate(117;0.0959)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-19)|BRCA - Breast invasive adenocarcinoma(81;4.45e-06)|GBM - Glioblastoma multiforme(31;7.96e-05)		cggcagccgcggACTCCACGC	0.741													C|||	3992	0.797125	0.8525	0.6196	5008	,	,		7867	0.9206		0.7465	False		,,,				2504	0.773				p.S275S		.											.	PRR18-514	0			c.C825G						.	C		3541,683		1503,535,74	7.0	7.0	7.0		825	2.4	1.0	6	dbSNP_86	7	6180,2074		2355,1470,302	no	coding-synonymous	PRR18	NM_175922.3		3858,2005,376	CC,CG,GG		25.1272,16.1695,22.0949		275/296	166720806	9721,2757	2112	4127	6239	SO:0001819	synonymous_variant	285800	exon1			AGCCGCGGACTCC	BC034775	CCDS5291.1	6q27	2009-01-27	2009-01-27						28574	protein-coding gene	gene with protein product			"""proline rich region 18"""			12477932	Standard	NM_175922		Approved	MGC35308	uc003quw.1	Q8N4B5		ENST00000322583.3:c.825C>G	6.37:g.166720806G>C		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	6	5	NM_175922	0	0	0	0	0		Silent	SNP	ENST00000322583.3	37	CCDS5291.1																																																																																			G|0.796;C|0.204		0.741	PRR18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392563.3	NM_175922	
EIF3B	8662	hgsc.bcm.edu	37	7	2394991	2394991	+	Silent	SNP	C	C	T	rs11551167	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr7:2394991C>T	ENST00000360876.4	+	1	491	c.435C>T	c.(433-435)aaC>aaT	p.N145N	EIF3B_ENST00000397011.2_Silent_p.N145N	NM_001037283.1	NP_001032360.1			eukaryotic translation initiation factor 3, subunit B											breast(2)|endometrium(4)|kidney(2)|large_intestine(3)|lung(11)|ovary(1)|skin(1)	24		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0833)|OV - Ovarian serous cystadenocarcinoma(56;7.76e-14)		CGCTGGAGAACGGCGACGCGG	0.756													C|||	1173	0.234225	0.0847	0.1513	5008	,	,		9860	0.2808		0.2704	False		,,,				2504	0.41				p.N145N		.											.	EIF3B-68	0			c.C435T						.	C	,	311,3057		24,263,1397	4.0	4.0	4.0		435,435	0.5	1.0	7	dbSNP_120	4	1454,5336		174,1106,2115	no	coding-synonymous,coding-synonymous	EIF3B	NM_001037283.1,NM_003751.3	,	198,1369,3512	TT,TC,CC		21.4138,9.234,17.3755	,	145/815,145/815	2394991	1765,8393	1684	3395	5079	SO:0001819	synonymous_variant	8662	exon1			GGAGAACGGCGAC	U62583	CCDS5332.1	7p22	2013-02-12	2007-07-27	2007-07-27	ENSG00000106263	ENSG00000106263		"""RNA binding motif (RRM) containing"""	3280	protein-coding gene	gene with protein product		603917	"""eukaryotic translation initiation factor 3, subunit 9 eta, 116kDa"""	EIF3S9		8995410	Standard	NM_001037283		Approved	PRT1, eIF3b	uc003sly.3	P55884	OTTHUMG00000022839	ENST00000360876.4:c.435C>T	7.37:g.2394991C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_001037283	0	0	0	36	36		Silent	SNP	ENST00000360876.4	37	CCDS5332.1																																																																																			C|0.787;T|0.213		0.756	EIF3B-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207006.1		
VWDE	221806	bcgsc.ca	37	7	12433347	12433347	+	Missense_Mutation	SNP	C	C	T	rs17165995	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr7:12433347C>T	ENST00000275358.3	-	2	304	c.116G>A	c.(115-117)cGt>cAt	p.R39H		NM_001135924.1	NP_001129396.1	Q8N2E2	VWDE_HUMAN	von Willebrand factor D and EGF domains	39						extracellular region (GO:0005576)				breast(4)|endometrium(2)|kidney(1)|skin(1)	8						TGAGTCAAAACGGACACTTCT	0.458													T|||	992	0.198083	0.3956	0.1167	5008	,	,		16938	0.126		0.1123	False		,,,				2504	0.1513				p.R39H		.											.	VWDE-68	0			c.G116A						.	T	HIS/ARG	489,895		86,317,289	69.0	63.0	65.0		116	2.5	0.1	7	dbSNP_123	65	399,2783		24,351,1216	yes	missense	VWDE	NM_001135924.1	29	110,668,1505	TT,TC,CC		12.5393,35.3324,19.4481	benign	39/1591	12433347	888,3678	692	1591	2283	SO:0001583	missense	221806	exon2			TCAAAACGGACAC		CCDS47544.1	7p21.3	2008-09-23			ENSG00000146530	ENSG00000146530			21897	protein-coding gene	gene with protein product						14702039, 16303743	Standard	NM_001135924		Approved	FLJ14712	uc003ssj.2	Q8N2E2	OTTHUMG00000152315	ENST00000275358.3:c.116G>A	7.37:g.12433347C>T	ENSP00000275358:p.Arg39His	Somatic	134	2		WXS	Illumina GAIIx	Phase_I	110	6	NM_001135924	0	0	1	1	0	B7ZM77|Q96SQ3	Missense_Mutation	SNP	ENST00000275358.3	37	CCDS47544.1	432	0.1978021978021978	208	0.42276422764227645	44	0.12154696132596685	87	0.1520979020979021	93	0.12269129287598944	T	0.432	-0.902961	0.02453	0.353324	0.125393	ENSG00000146530	ENST00000275358;ENST00000541006	T	0.63744	-0.06	4.87	2.49	0.30216	.	0.808953	0.11671	N	0.540894	T	0.00012	0.0000	N	0.04508	-0.205	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.43589	-0.9382	9	0.27785	T	0.31	.	6.0796	0.19935	0.0:0.1447:0.1375:0.7179	rs17165995;rs52826585;rs57756323;rs17165995	39	Q8N2E2	VWDE_HUMAN	H	39	ENSP00000275358:R39H	ENSP00000275358:R39H	R	-	2	0	VWDE	12399872	0.699000	0.27786	0.095000	0.20976	0.700000	0.40528	1.139000	0.31504	0.061000	0.16311	-0.254000	0.11334	CGT	C|0.794;T|0.206		0.458	VWDE-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325870.3	XM_371878	
HECW1	23072	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	43483926	43483943	+	In_Frame_Del	DEL	AGAGTCCTCTGAGAGCTG	AGAGTCCTCTGAGAGCTG	-	rs549203056	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	AGAGTCCTCTGAGAGCTG	AGAGTCCTCTGAGAGCTG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr7:43483926_43483943delAGAGTCCTCTGAGAGCTG	ENST00000395891.2	+	11	1760_1777	c.1155_1172delAGAGTCCTCTGAGAGCTG	c.(1153-1173)ccagagtcctctgagagctgg>ccg	p.ESSESW386del	HECW1_ENST00000453890.1_In_Frame_Del_p.ESSESW386del	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1	386					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						CTGAGGCACCAGAGTCCTCTGAGAGCTGGAAGCCAGAG	0.578																																					p.385_391del		.											.	HECW1-669	0			c.1155_1172del						.																																			SO:0001651	inframe_deletion	23072	exon11			GGCACCAGAGTCC	AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.1155_1172delAGAGTCCTCTGAGAGCTG	7.37:g.43483926_43483943delAGAGTCCTCTGAGAGCTG	ENSP00000379228:p.Glu386_Trp391del	Somatic	147	0		WXS	Illumina GAIIx	Phase_I	89	55	NM_015052	0	0	0	0	0	A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	In_Frame_Del	DEL	ENST00000395891.2	37	CCDS5469.2																																																																																			.		0.578	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250893.2	NM_015052	
DLC1	10395	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	12957772	12957772	+	Silent	SNP	A	A	G			TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr8:12957772A>G	ENST00000276297.4	-	9	2483	c.2074T>C	c.(2074-2076)Ttg>Ctg	p.L692L	DLC1_ENST00000358919.2_Silent_p.L255L|DLC1_ENST00000512044.2_Silent_p.L289L|DLC1_ENST00000520226.1_Silent_p.L181L	NM_182643.2	NP_872584.2	Q96QB1	RHG07_HUMAN	DLC1 Rho GTPase activating protein	692					actin cytoskeleton organization (GO:0030036)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|focal adhesion assembly (GO:0048041)|forebrain development (GO:0030900)|heart morphogenesis (GO:0003007)|hindbrain morphogenesis (GO:0021575)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neural tube closure (GO:0001843)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	lipid binding (GO:0008289)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)			NS(2)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(39)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	110						CTGATGATCAACCCCAGCTTT	0.562																																					p.L692L		.											.	DLC1-657	0			c.T2074C						.						88.0	83.0	85.0					8																	12957772		2203	4300	6503	SO:0001819	synonymous_variant	10395	exon9			TGATCAACCCCAG	AF035119	CCDS5989.1, CCDS5990.1, CCDS5991.1, CCDS5991.2, CCDS55201.1	8p22	2014-06-20	2014-06-20		ENSG00000164741	ENSG00000164741		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	2897	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 12"""	604258	"""deleted in liver cancer 1"""			9605766, 11214970	Standard	NM_182643		Approved	HP, ARHGAP7, STARD12, DLC-1, p122-RhoGAP	uc003wwm.2	Q96QB1	OTTHUMG00000090825	ENST00000276297.4:c.2074T>C	8.37:g.12957772A>G		Somatic	70	0		WXS	Illumina GAIIx	Phase_I	179	81	NM_182643	0	0	6	9	3	B4DR10|B8PTI0|E9PDZ8|E9PF76|E9PGY9|O14868|O43199|Q7Z5R8|Q86UC6|Q9C0E0|Q9H7A2	Silent	SNP	ENST00000276297.4	37	CCDS5989.1																																																																																			.		0.562	DLC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207632.2	NM_182643, NM_006094	
MTDH	92140	hgsc.bcm.edu	37	8	98656966	98656966	+	Missense_Mutation	SNP	G	G	T	rs17854373	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr8:98656966G>T	ENST00000336273.3	+	1	560	c.232G>T	c.(232-234)Gcc>Tcc	p.A78S	MTDH_ENST00000519934.1_Missense_Mutation_p.A55S	NM_178812.3	NP_848927.2	Q86UE4	LYRIC_HUMAN	metadherin	78	Interaction with BCCIP.			A -> S (in Ref. 5; AAH09324/AAH45642). {ECO:0000305}.	lipopolysaccharide-mediated signaling pathway (GO:0031663)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of angiogenesis (GO:0045766)|positive regulation of autophagy (GO:0010508)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein kinase B signaling (GO:0051897)|tight junction assembly (GO:0070830)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intercellular canaliculus (GO:0046581)|nuclear body (GO:0016604)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|tight junction (GO:0005923)	double-stranded RNA binding (GO:0003725)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(5)|liver(1)|lung(8)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	32	Breast(36;2.56e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.178)			TTGCGCCGGCGCCCGCAAAAA	0.736													G|||	124	0.0247604	0.0008	0.0274	5008	,	,		8475	0.0		0.0547	False		,,,				2504	0.0501				p.A78S		.											.	MTDH-91	0			c.G232T						.	G	SER/ALA	42,4076		0,42,2017	6.0	9.0	8.0		232	5.5	1.0	8	dbSNP_123	8	401,7773		7,387,3693	no	missense	MTDH	NM_178812.3	99	7,429,5710	TT,TG,GG		4.9058,1.0199,3.604	probably-damaging	78/583	98656966	443,11849	2059	4087	6146	SO:0001583	missense	92140	exon1			GCCGGCGCCCGCA	AF411226	CCDS6274.1	8q22.1	2014-07-14			ENSG00000147649	ENSG00000147649			29608	protein-coding gene	gene with protein product	"""astrocyte elevated gene 1"""	610323				15093543	Standard	NM_178812		Approved	LYRIC, 3D3, AEG-1	uc003yhz.3	Q86UE4	OTTHUMG00000164692	ENST00000336273.3:c.232G>T	8.37:g.98656966G>T	ENSP00000338235:p.Ala78Ser	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	30	18	NM_178812	0	0	4	7	3	Q05DH2|Q52QU9|Q6PK07|Q8TCX3	Missense_Mutation	SNP	ENST00000336273.3	37	CCDS6274.1	55	0.025183150183150184	0	0.0	13	0.03591160220994475	0	0.0	42	0.055408970976253295	G	25.7	4.660641	0.88154	0.010199	0.049058	ENSG00000147649	ENST00000336273;ENST00000519934	T;T	0.10382	2.88;2.88	5.48	5.48	0.80851	.	0.401308	0.24100	N	0.041542	T	0.02193	0.0068	L	0.34521	1.04	0.41950	D	0.990659	D	0.65815	0.995	P	0.61397	0.888	T	0.00621	-1.1640	10	0.39692	T	0.17	-4.8235	17.1332	0.86732	0.0:0.0:1.0:0.0	rs17854373	78	Q86UE4	LYRIC_HUMAN	S	78;55	ENSP00000338235:A78S;ENSP00000428168:A55S	ENSP00000338235:A78S	A	+	1	0	MTDH	98726142	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.476000	0.53143	2.567000	0.86603	0.591000	0.81541	GCC	G|0.973;T|0.027		0.736	MTDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379772.2		
MAL2	114569	hgsc.bcm.edu	37	8	120220776	120220776	+	Splice_Site	DEL	G	G	-	rs398009582|rs71302978		TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr8:120220776delG	ENST00000276681.6	+	1	167	c.65delG	c.(64-66)cgg>cg	p.R22fs	MAL2_ENST00000521748.1_3'UTR	NM_052886.2	NP_443118.1	Q969L2	MAL2_HUMAN	mal, T-cell differentiation protein 2 (gene/pseudogene)	22						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)						all_cancers(13;1.91e-26)|Lung NSC(37;8.61e-08)|Ovarian(258;0.018)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.000967)			CCGCCGCCCCGGGGTCACCCT	0.771													GGG|GGGG|GGG|insertion	5008	1.0	1.0	1.0	5008	,	,		6681	1.0		1.0	False		,,,				2504	1.0				.		.											.	.	0			c.64+1G>-						.			1571,11		785,1,5	1.0	1.0	1.0			0.7	0.8	8	dbSNP_130	1	4116,22		2057,2,10	no	frameshift	MAL2	NM_052886.2		2842,3,15	A1A1,A1R,RR		0.5317,0.6953,0.5769			120220776	5687,33	184	483	667	SO:0001630	splice_region_variant	114569	exon1			CGCCCCGGGGTCA	AL117612	CCDS75780.1	8q23	2011-01-26	2011-01-26			ENSG00000147676			13634	protein-coding gene	gene with protein product	"""MAL proteolipid protein 2"""	609684				11549320	Standard	NM_052886		Approved		uc003yop.3	Q969L2		ENST00000276681.6:c.66+1G>-	8.37:g.120220776delG		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	32	31	NM_052886	0	0	0	0	0	B2R520|Q6ZMD9	Splice_Site	DEL	ENST00000276681.6	37																																																																																				.		0.771	MAL2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052886	Frame_Shift_Del
COL22A1	169044	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	139729081	139729081	+	Missense_Mutation	SNP	C	C	T	rs144653941		TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr8:139729081C>T	ENST00000303045.6	-	28	2833	c.2387G>A	c.(2386-2388)cGa>cAa	p.R796Q	COL22A1_ENST00000435777.1_Missense_Mutation_p.R796Q|COL22A1_ENST00000341807.4_5'UTR	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	796	Collagen-like 6.|Gly-rich.|Pro-rich.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			CTCTCCAGGTCGGCCTGCCAG	0.383										HNSCC(7;0.00092)																											p.R796Q		.											.	COL22A1-103	0			c.G2387A						.	C	GLN/ARG	0,4406		0,0,2203	69.0	69.0	69.0		2387	-3.1	0.4	8	dbSNP_134	69	1,8599	1.2+/-3.3	0,1,4299	no	missense	COL22A1	NM_152888.1	43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	796/1627	139729081	1,13005	2203	4300	6503	SO:0001583	missense	169044	exon28			CCAGGTCGGCCTG	AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.2387G>A	8.37:g.139729081C>T	ENSP00000303153:p.Arg796Gln	Somatic	55	0		WXS	Illumina GAIIx	Phase_I	76	31	NM_152888	0	0	0	0	0	B7ZMH0|C9K0G4|Q8IVT9	Missense_Mutation	SNP	ENST00000303045.6	37	CCDS6376.1	.	.	.	.	.	.	.	.	.	.	C	7.705	0.693928	0.15039	0.0	1.16E-4	ENSG00000169436	ENST00000303045;ENST00000435777;ENST00000545577	D;D	0.92647	-3.08;-3.08	4.74	-3.1	0.05315	.	0.513022	0.14656	N	0.306266	T	0.75095	0.3803	N	0.02379	-0.575	0.09310	N	1	B;P	0.52061	0.005;0.95	B;P	0.45428	0.002;0.48	T	0.76132	-0.3071	10	0.12766	T	0.61	.	5.4176	0.16382	0.1456:0.3118:0.0:0.5426	.	796;796	Q8NFW1-2;Q8NFW1	.;COMA1_HUMAN	Q	796;796;509	ENSP00000303153:R796Q;ENSP00000387655:R796Q	ENSP00000303153:R796Q	R	-	2	0	COL22A1	139798263	0.007000	0.16637	0.381000	0.26106	0.916000	0.54674	-0.409000	0.07160	-0.434000	0.07275	-0.727000	0.03589	CGA	C|1.000;T|0.000		0.383	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2	XM_291257	
ZNF696	79943	hgsc.bcm.edu	37	8	144378868	144378868	+	Silent	SNP	A	A	G	rs7386259	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr8:144378868A>G	ENST00000330143.3	+	3	1432	c.1023A>G	c.(1021-1023)cgA>cgG	p.R341R		NM_030895.2	NP_112157.2	Q9H7X3	ZN696_HUMAN	zinc finger protein 696	341					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	8	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)			GGCACCAGCGACTCCACACGG	0.726													G|||	4505	0.899561	0.9425	0.9179	5008	,	,		11520	0.8403		0.8608	False		,,,				2504	0.9294				p.R341R		.											.	ZNF696-90	0			c.A1023G						.	G		3773,275		1771,231,22	5.0	5.0	5.0		1023	-0.3	0.0	8	dbSNP_116	5	6735,1261		2843,1049,106	no	coding-synonymous	ZNF696	NM_030895.2		4614,1280,128	GG,GA,AA		15.7704,6.7935,12.7532		341/375	144378868	10508,1536	2024	3998	6022	SO:0001819	synonymous_variant	79943	exon3			CCAGCGACTCCAC	AK024191	CCDS6399.1	8q24.3	2013-01-08				ENSG00000185730		"""Zinc fingers, C2H2-type"""	25872	protein-coding gene	gene with protein product							Standard	NM_030895		Approved	FLJ14129	uc003yxy.4	Q9H7X3		ENST00000330143.3:c.1023A>G	8.37:g.144378868A>G		Somatic	2	0		WXS	Illumina GAIIx	Phase_I	27	9	NM_030895	0	0	0	2	2	A0AVE2	Silent	SNP	ENST00000330143.3	37	CCDS6399.1																																																																																			A|0.118;G|0.882		0.726	ZNF696-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381164.2	NM_030895	
SCRT1	83482	hgsc.bcm.edu	37	8	145557497	145557497	+	Missense_Mutation	SNP	A	A	C	rs7013127	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr8:145557497A>C	ENST00000332135.4	-	2	508	c.397T>G	c.(397-399)Tct>Gct	p.S133A		NM_031309.4	NP_112599.2	Q9BWW7	SCRT1_HUMAN	scratch family zinc finger 1	133			S -> A (in dbSNP:rs7013127). {ECO:0000269|Ref.2}.		negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of neuron migration (GO:2001222)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|upper_aerodigestive_tract(1)	3	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.94e-40)|Epithelial(56;1.35e-39)|all cancers(56;1.37e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0441)|Colorectal(110;0.055)			GCGGCGGCAGAGCCGGCATTG	0.776													c|||	4719	0.942292	0.9418	0.9568	5008	,	,		3920	0.9921		0.8956	False		,,,				2504	0.9294				p.S133A		.											.	.	0			c.T397G						.						1.0	1.0	1.0					8																	145557497		634	1472	2106	SO:0001583	missense	83482	exon2			CGGCAGAGCCGGC	BC014675	CCDS6421.1	8q24.3	2013-10-09	2013-10-09		ENSG00000170616	ENSG00000261678		"""Zinc fingers, C2H2-type"""	15950	protein-coding gene	gene with protein product		605858	"""scratch (drosophila homolog) 1, zinc finger protein"", ""scratch homolog 1, zinc finger protein (Drosophila)"""			11274425	Standard	NM_031309		Approved	DKFZp547F072, ZNF898	uc003zbw.1	Q9BWW7	OTTHUMG00000165229	ENST00000332135.4:c.397T>G	8.37:g.145557497A>C	ENSP00000331692:p.Ser133Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_031309	0	0	0	0	0	A8MX66|Q96C52	Missense_Mutation	SNP	ENST00000332135.4	37	CCDS6421.1	1975	0.9043040293040293	396	0.8048780487804879	339	0.93646408839779	552	0.965034965034965	688	0.9076517150395779	c	0.007	-1.995963	0.00435	.	.	ENSG00000170616	ENST00000332135	T	0.06933	3.24	0.926	-0.0566	0.13805	.	.	.	.	.	T	0.00012	0.0000	N	0.02539	-0.55	0.58432	P	5.999999999950489E-6	B	0.02656	0.0	B	0.01281	0.0	T	0.33879	-0.9851	8	0.05525	T	0.97	5.8842	6.2142	0.20646	0.3034:0.6966:0.0:0.0	rs7013127	133	Q9BWW7	SCRT1_HUMAN	A	133	ENSP00000331692:S133A	ENSP00000331692:S133A	S	-	1	0	SCRT1	145528305	.	.	0.675000	0.29917	0.381000	0.30169	.	.	-1.712000	0.01393	-3.289000	0.00047	TCT	A|0.096;C|0.904		0.776	SCRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382800.2	NM_031309	
ZNF517	340385	hgsc.bcm.edu	37	8	146033347	146033347	+	Missense_Mutation	SNP	T	T	C	rs2976653	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr8:146033347T>C	ENST00000531720.1	+	4	1091	c.1046T>C	c.(1045-1047)gTg>gCg	p.V349A	ZNF517_ENST00000526178.1_Intron|ZNF517_ENST00000525105.1_Intron|ZNF517_ENST00000359971.3_Missense_Mutation_p.V349A			Q6ZMY9	ZN517_HUMAN	zinc finger protein 517	349				V -> A (in Ref. 1; BAD18586). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(2)|lung(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_cancers(97;1.03e-11)|all_epithelial(106;6.69e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;5.47e-39)|OV - Ovarian serous cystadenocarcinoma(54;6.38e-39)|all cancers(56;5.47e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)			GACGGCGGCGTGGGGCAGGGC	0.746													C|||	4981	0.994609	1.0	1.0	5008	,	,		12856	1.0		0.994	False		,,,				2504	0.9785				p.V349A		.											.	ZNF517-90	0			c.T1046C						.	C	ALA/VAL	3411,3		1704,3,0	3.0	5.0	4.0		1046	-0.8	0.0	8	dbSNP_101	4	7050,46		3502,46,0	no	missense	ZNF517	NM_213605.2	64	5206,49,0	CC,CT,TT		0.6483,0.0879,0.4662	benign	349/493	146033347	10461,49	1707	3548	5255	SO:0001583	missense	340385	exon5			GCGGCGTGGGGCA	AK096527	CCDS6434.1	8q24.3	2013-01-08				ENSG00000197363		"""Zinc fingers, C2H2-type"", ""-"""	27984	protein-coding gene	gene with protein product							Standard	NM_213605		Approved		uc003zed.1	Q6ZMY9		ENST00000531720.1:c.1046T>C	8.37:g.146033347T>C	ENSP00000436103:p.Val349Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	14	14	NM_213605	0	0	0	0	0		Missense_Mutation	SNP	ENST00000531720.1	37	CCDS6434.1	2179|2179	0.9977106227106227|0.9977106227106227	492|492	1.0|1.0	362|362	1.0|1.0	572|572	1.0|1.0	753|753	0.9934036939313984|0.9934036939313984	C|C	0.021|0.021	-1.418607|-1.418607	0.01136|0.01136	0.999121|0.999121	0.993517|0.993517	ENSG00000197363|ENSG00000197363	ENST00000359971;ENST00000531720|ENST00000529429	T;T|.	0.05319|.	3.46;3.46|.	2.17|2.17	-0.838|-0.838	0.10762|0.10762	.|.	.|.	.|.	.|.	.|.	T|T	0.00012|0.00012	0.0000|0.0000	L|L	0.35644|0.35644	1.08|1.08	0.80722|0.80722	P|P	0.0|0.0	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|T	0.21449|0.21449	-1.0245|-1.0245	8|4	0.59425|.	D|.	0.04|.	.|.	0.241|0.241	0.00192|0.00192	0.362:0.2246:0.2135:0.1999|0.362:0.2246:0.2135:0.1999	rs2976653;rs59817342|rs2976653;rs59817342	349|.	Q6ZMY9|.	ZN517_HUMAN|.	A|R	349|316	ENSP00000353058:V349A;ENSP00000436103:V349A|.	ENSP00000353058:V349A|.	V|W	+|+	2|1	0|0	ZNF517|ZNF517	146004151|146004151	0.001000|0.001000	0.12720|0.12720	0.002000|0.002000	0.10522|0.10522	0.004000|0.004000	0.04260|0.04260	-0.400000|-0.400000	0.07241|0.07241	-0.612000|-0.612000	0.05701|0.05701	-1.157000|-1.157000	0.01802|0.01802	GTG|TGG	G|0.992;C|0.006		0.746	ZNF517-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382642.1	XM_291261	
ERMP1	79956	hgsc.bcm.edu	37	9	5832728	5832728	+	Silent	SNP	G	G	C	rs1131727	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr9:5832728G>C	ENST00000339450.5	-	1	389	c.300C>G	c.(298-300)gcC>gcG	p.A100A	ERMP1_ENST00000381506.3_5'Flank|ERMP1_ENST00000214893.5_5'UTR	NM_024896.2	NP_079172.2	Q7Z2K6	ERMP1_HUMAN	endoplasmic reticulum metallopeptidase 1	100						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			endometrium(2)|kidney(1)|large_intestine(9)|lung(4)|ovary(1)|prostate(2)|skin(1)	20		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00115)|Lung(218;0.111)		GGTGTCCAGCGGCCCCGCGTA	0.741													G|||	2021	0.403554	0.1309	0.428	5008	,	,		3601	0.7093		0.34	False		,,,				2504	0.5051				p.A100A		.											.	ERMP1-69	0			c.C300G						.						4.0	3.0	3.0					9																	5832728		1620	3326	4946	SO:0001819	synonymous_variant	79956	exon1			TCCAGCGGCCCCG	AB058718	CCDS34983.1	9p24	2008-02-05	2007-07-05	2007-07-05	ENSG00000099219	ENSG00000099219			23703	protein-coding gene	gene with protein product	"""Felix-ina"""	611156	"""KIAA1815"""	KIAA1815		11347906	Standard	XM_005251587		Approved	FLJ23309, FXNA	uc003zjm.1	Q7Z2K6	OTTHUMG00000019508	ENST00000339450.5:c.300C>G	9.37:g.5832728G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	18	17	NM_024896	0	0	0	3	3	B2RNA4|B3KSB1|Q8N5T5|Q9H5M1	Silent	SNP	ENST00000339450.5	37	CCDS34983.1																																																																																			G|0.572;C|0.428		0.741	ERMP1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354877.1	NM_024896	
FPGS	2356	hgsc.bcm.edu	37	9	130565267	130565267	+	Missense_Mutation	SNP	A	A	G	rs11554717|rs10760502	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr9:130565267A>G	ENST00000373247.2	+	1	114	c.64A>G	c.(64-66)Ata>Gta	p.I22V	FPGS_ENST00000393706.2_Missense_Mutation_p.I22V|FPGS_ENST00000373245.1_Missense_Mutation_p.I22V|FPGS_ENST00000373225.3_5'Flank|FPGS_ENST00000460181.1_3'UTR	NM_004957.4	NP_004948.4	Q05932	FOLC_HUMAN	folylpolyglutamate synthase	22			I -> V (in dbSNP:rs10760502). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:7721888}.		brain development (GO:0007420)|folic acid metabolic process (GO:0046655)|liver development (GO:0001889)|nucleobase-containing compound metabolic process (GO:0006139)|one-carbon metabolic process (GO:0006730)|organ regeneration (GO:0031100)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|tetrahydrofolylpolyglutamate synthase activity (GO:0004326)			endometrium(2)|kidney(1)|lung(3)|ovary(1)	7					Methotrexate(DB00563)|Pralatrexate(DB06813)|Raltitrexed(DB00293)	TGCGCGCGGCATAACGACCCA	0.761													g|||	3912	0.78115	0.8956	0.6153	5008	,	,		6680	0.9583		0.6352	False		,,,				2504	0.7117				p.I22V		.											.	FPGS-90	0			c.A64G						.		VAL/ILE	2249,281		997,255,13	1.0	3.0	2.0		64	1.8	0.0	9	dbSNP_120	2	3848,1396		1394,1060,168	no	missense	FPGS	NM_004957.4	29	2391,1315,181	GG,GA,AA		26.6209,11.1067,21.5719	benign	22/588	130565267	6097,1677	1265	2622	3887	SO:0001583	missense	2356	exon1			CGCGGCATAACGA		CCDS35148.1, CCDS35149.1, CCDS75905.1	9q34.11	2013-09-19			ENSG00000136877	ENSG00000136877	6.3.2.17		3824	protein-coding gene	gene with protein product		136510					Standard	NM_004957		Approved		uc004bsg.1	Q05932	OTTHUMG00000020716	ENST00000373247.2:c.64A>G	9.37:g.130565267A>G	ENSP00000362344:p.Ile22Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	7	NM_004957	0	0	1	2	1	B3KPW4|B7Z2Z3|F5H0K6|Q5JU19|Q5JU22|Q6P2P6	Missense_Mutation	SNP	ENST00000373247.2	37	CCDS35148.1	1668	0.7637362637362637	432	0.8780487804878049	215	0.5939226519337016	545	0.9527972027972028	476	0.6279683377308707	g	3.002	-0.205821	0.06180	0.888933	0.733791	ENSG00000136877	ENST00000373247;ENST00000373245;ENST00000393706;ENST00000373228	T;T;T;T	0.29655	3.02;1.56;3.03;1.56	4.93	1.83	0.25207	.	0.868559	0.09918	N	0.738853	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.37361	-0.9709	9	0.02654	T	1	-12.2003	6.0757	0.19913	0.2469:0.2097:0.5434:0.0	rs10760502;rs17855899;rs56845445	22;22	Q05932-4;Q05932	.;FOLC_HUMAN	V	22	ENSP00000362344:I22V;ENSP00000362342:I22V;ENSP00000377309:I22V;ENSP00000362325:I22V	ENSP00000362325:I22V	I	+	1	0	FPGS	129605088	0.000000	0.05858	0.001000	0.08648	0.021000	0.10359	0.242000	0.18087	0.210000	0.20664	-0.258000	0.10820	ATA	A|0.235;G|0.765		0.761	FPGS-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054251.1		
NUDT10	170685	broad.mit.edu	37	X	51076024	51076024	+	Silent	SNP	G	G	A	rs143435240		TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chrX:51076024G>A	ENST00000376006.3	+	2	427	c.207G>A	c.(205-207)gaG>gaA	p.E69E	NUDT10_ENST00000356450.2_Silent_p.E69E	NM_153183.2	NP_694853.1	Q9BW91	NUDT9_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 10	234					ADP catabolic process (GO:0046032)|IDP catabolic process (GO:0046709)|nucleobase-containing small molecule catabolic process (GO:0034656)|nucleobase-containing small molecule metabolic process (GO:0055086)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|mitochondrial matrix (GO:0005759)	adenosine-diphosphatase activity (GO:0043262)|ADP-ribose diphosphatase activity (GO:0047631)|ADP-sugar diphosphatase activity (GO:0019144)	p.E69E(8)		cervix(1)|endometrium(8)|kidney(1)|large_intestine(1)|lung(1)|prostate(3)|upper_aerodigestive_tract(1)	16	Ovarian(276;0.236)					TGTACGAAGAGGCGGGAGTCA	0.657																																					p.E69E	NSCLC(90;1817 2035 37909 38249)	.											.	NUDT10-90	8	Substitution - coding silent(8)	endometrium(5)|cervix(1)|prostate(1)|lung(1)	c.G207A						.						52.0	62.0	59.0					X																	51076024		2203	4300	6503	SO:0001819	synonymous_variant	170685	exon2			CGAAGAGGCGGGA	AF469196	CCDS35278.1	Xp11.22-p11.1	2014-05-20			ENSG00000122824	ENSG00000122824		"""Nudix motif containing"""	17621	protein-coding gene	gene with protein product		300527				12105228	Standard	NM_153183		Approved	DIPP3a, hDIPP3alpha	uc004dph.3	Q8NFP7	OTTHUMG00000021530	ENST00000376006.3:c.207G>A	X.37:g.51076024G>A		Somatic	108	0		WXS	Illumina GAIIx	Phase_I	282	9	NM_153183	0	0	0	0	0	Q8NBN1|Q8NCB9|Q8NG25	Silent	SNP	ENST00000376006.3	37	CCDS35278.1																																																																																			.		0.657	NUDT10-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056578.1	NM_153183	
SAGE1	55511	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	134993856	134993856	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chrX:134993856G>A	ENST00000370709.3	+	17	2265	c.2265G>A	c.(2263-2265)atG>atA	p.M755I	SAGE1_ENST00000535938.1_Missense_Mutation_p.M755I|SAGE1_ENST00000537770.1_Missense_Mutation_p.M379I|SAGE1_ENST00000324447.3_Missense_Mutation_p.M755I			Q9NXZ1	SAGE1_HUMAN	sarcoma antigen 1	755						nucleus (GO:0005634)				breast(5)|endometrium(5)|large_intestine(10)|lung(23)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	55	Acute lymphoblastic leukemia(192;0.000127)					GACATTGTATGCCACCCAATG	0.433																																					p.M755I		.											.	SAGE1-133	0			c.G2265A						.						168.0	159.0	162.0					X																	134993856		2203	4300	6503	SO:0001583	missense	55511	exon18			TTGTATGCCACCC	AJ278111	CCDS14652.1	Xq26	2009-03-25			ENSG00000181433	ENSG00000181433			30369	protein-coding gene	gene with protein product	"""cancer/testis antigen 14"""	300359				10919659	Standard	NM_018666		Approved	SAGE, CT14	uc004ezh.3	Q9NXZ1	OTTHUMG00000022496	ENST00000370709.3:c.2265G>A	X.37:g.134993856G>A	ENSP00000359743:p.Met755Ile	Somatic	141	0		WXS	Illumina GAIIx	Phase_I	197	177	NM_018666	0	0	0	0	0	Q5JNW0	Missense_Mutation	SNP	ENST00000370709.3	37	CCDS14652.1	.	.	.	.	.	.	.	.	.	.	G	5.776	0.327555	0.10956	.	.	ENSG00000181433	ENST00000324447;ENST00000535938;ENST00000537770;ENST00000370709	T;T;T;T	0.29397	1.57;1.57;1.64;1.57	2.67	-0.118	0.13547	.	0.686016	0.14344	N	0.325542	T	0.11750	0.0286	N	0.10760	0.04	0.09310	N	1	B;B	0.18741	0.013;0.03	B;B	0.18561	0.013;0.022	T	0.33394	-0.9870	10	0.13470	T	0.59	.	4.9679	0.14100	0.0:0.1231:0.3953:0.4816	.	379;755	F5H2Z8;Q9NXZ1	.;SAGE1_HUMAN	I	755;755;379;755	ENSP00000323191:M755I;ENSP00000445959:M755I;ENSP00000438276:M379I;ENSP00000359743:M755I	ENSP00000323191:M755I	M	+	3	0	SAGE1	134821522	0.000000	0.05858	0.000000	0.03702	0.027000	0.11550	0.276000	0.18716	-0.442000	0.07190	0.179000	0.17066	ATG	.		0.433	SAGE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058448.1	NM_018666	
ATP11C	286410	ucsc.edu;bcgsc.ca	37	X	138864822	138864822	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chrX:138864822G>T	ENST00000327569.3	-	18	1943	c.1845C>A	c.(1843-1845)aaC>aaA	p.N615K	ATP11C_ENST00000370557.1_Missense_Mutation_p.N612K|ATP11C_ENST00000361648.2_Missense_Mutation_p.N615K|ATP11C_ENST00000460773.1_5'UTR|ATP11C_ENST00000359686.2_Missense_Mutation_p.N615K|ATP11C_ENST00000370543.1_Missense_Mutation_p.N615K	NM_173694.4	NP_775965	Q8NB49	AT11C_HUMAN	ATPase, class VI, type 11C	615					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|positive regulation of B cell differentiation (GO:0045579)|pre-B cell differentiation (GO:0002329)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(2)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(31)|ovary(5)|prostate(1)|skin(3)	75	Acute lymphoblastic leukemia(192;0.000127)					TGAGCTGTCTGTTAATTCTTT	0.363																																					p.N615K		.											.	ATP11C-198	0			c.C1845A						.						96.0	84.0	88.0					X																	138864822		2203	4300	6503	SO:0001583	missense	286410	exon18			CTGTCTGTTAATT	AJ580094	CCDS14668.1, CCDS35410.1	Xq27.1	2011-06-09	2007-09-19		ENSG00000101974	ENSG00000101974		"""ATPases / P-type"""	13554	protein-coding gene	gene with protein product		300516	"""ATPase, Class VI, type 11C"""			11015572	Standard	NM_173694		Approved	ATPIG, ATPIQ	uc004faz.3	Q8NB49	OTTHUMG00000022538	ENST00000327569.3:c.1845C>A	X.37:g.138864822G>T	ENSP00000332756:p.Asn615Lys	Somatic	34	0		WXS	Illumina GAIIx	Phase_I	40	4	NM_001010986	0	0	4	4	0	Q5JT69|Q5JT70|Q5JT71|Q5JT72|Q5JT73|Q6ZND5|Q6ZU50|Q6ZUP7|Q70IJ9|Q70IK0|Q8WX24	Missense_Mutation	SNP	ENST00000327569.3	37	CCDS14668.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.07|11.07	1.532011|1.532011	0.27387|0.27387	.|.	.|.	ENSG00000101974|ENSG00000101974	ENST00000370557;ENST00000361648;ENST00000327569;ENST00000370543;ENST00000359686|ENST00000422228	T;T;T;T;T|.	0.61392|.	0.11;0.11;0.11;0.11;0.11|.	5.68|5.68	4.81|4.81	0.61882|0.61882	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);|.	0.219304|.	0.48286|.	D|.	0.000190|.	T|T	0.52058|0.52058	0.1711|0.1711	L|L	0.31371|0.31371	0.925|0.925	0.38924|0.38924	D|D	0.957793|0.957793	B;B|.	0.18968|.	0.032;0.011|.	B;B|.	0.25759|.	0.038;0.063|.	T|T	0.50882|0.50882	-0.8775|-0.8775	10|5	0.17832|.	T|.	0.49|.	.|.	12.1768|12.1768	0.54190|0.54190	0.0847:0.0:0.9153:0.0|0.0847:0.0:0.9153:0.0	.|.	615;615|.	Q8NB49-3;Q8NB49|.	.;AT11C_HUMAN|.	K|K	612;615;615;615;615|167	ENSP00000359588:N612K;ENSP00000355165:N615K;ENSP00000332756:N615K;ENSP00000359574:N615K;ENSP00000352715:N615K|.	ENSP00000332756:N615K|.	N|T	-|-	3|2	2|0	ATP11C|ATP11C	138692488|138692488	0.987000|0.987000	0.35691|0.35691	0.912000|0.912000	0.35992|0.35992	0.949000|0.949000	0.60115|0.60115	2.115000|2.115000	0.41921|0.41921	1.137000|1.137000	0.42214|0.42214	0.594000|0.594000	0.82650|0.82650	AAC|ACA	.		0.363	ATP11C-008	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354945.1	NM_173694	
GABRE	2564	bcgsc.ca	37	X	151138179	151138179	+	Missense_Mutation	SNP	A	A	C	rs1139916	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chrX:151138179A>C	ENST00000370328.3	-	3	357	c.304T>G	c.(304-306)Tcc>Gcc	p.S102A	GABRE_ENST00000393914.3_5'UTR|GABRE_ENST00000370325.1_Missense_Mutation_p.S102A	NM_004961.3	NP_004952.2	P78334	GBRE_HUMAN	gamma-aminobutyric acid (GABA) A receptor, epsilon	102			S -> A (in dbSNP:rs1139916). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:9039914, ECO:0000269|PubMed:9084408}.		gamma-aminobutyric acid signaling pathway (GO:0007214)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|skin(1)	27	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	CTGTTGACGGAGATCTCAACA	0.517													a|||	2667	0.70649	0.3654	0.5591	3775	,	,		13577	0.6518		0.5318	False		,,,				2504	0.6176				p.S102A		.											.	GABRE-132	0			c.T304G						.		ALA/SER	1933,1902		416,816,285,400,286	99.0	82.0	88.0		304	2.7	0.0	X	dbSNP_86	88	4511,2217		1089,1083,1250,256,622	yes	missense	GABRE	NM_004961.3	99	1505,1899,1535,656,908	CC,CA,C,AA,A		32.9518,49.5958,38.9946	possibly-damaging	102/507	151138179	6444,4119	2203	4300	6503	SO:0001583	missense	2564	exon3			TGACGGAGATCTC	Y09765	CCDS14703.1	Xq28	2012-06-22			ENSG00000102287	ENSG00000102287		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4085	protein-coding gene	gene with protein product	"""GABA(A) receptor, epsilon"""	300093				9039914, 9084408	Standard	NM_004961		Approved		uc004ffi.3	P78334	OTTHUMG00000024176	ENST00000370328.3:c.304T>G	X.37:g.151138179A>C	ENSP00000359353:p.Ser102Ala	Somatic	147	2		WXS	Illumina GAIIx	Phase_I	311	13	NM_004961	0	0	0	0	0	E7ET93|O15345|O15346|Q6PCD2|Q99520	Missense_Mutation	SNP	ENST00000370328.3	37	CCDS14703.1	1143	0.6889692585895117	123	0.30295566502463056	139	0.5791666666666667	245	0.7291666666666666	293	0.5790513833992095	a	9.301	1.052992	0.19907	0.504042	0.670482	ENSG00000102287	ENST00000370328;ENST00000370325	T;T	0.77358	-1.09;-1.09	5.28	2.71	0.32032	Neurotransmitter-gated ion-channel ligand-binding (3);	0.340381	0.21783	N	0.069169	T	0.00012	0.0000	L	0.55990	1.75	0.46185	P	0.0010900000000000354	P	0.42456	0.78	B	0.43301	0.415	T	0.48468	-0.9033	9	0.17832	T	0.49	.	7.3801	0.26851	0.6457:0.0:0.0:0.3543	rs1139916;rs2071306;rs3203977;rs17846569;rs17859650;rs52790880;rs61218654;rs1139916	102	P78334	GBRE_HUMAN	A	102	ENSP00000359353:S102A;ENSP00000359350:S102A	ENSP00000359350:S102A	S	-	1	0	GABRE	150888835	0.998000	0.40836	0.001000	0.08648	0.024000	0.10985	3.505000	0.53356	0.204000	0.20548	0.483000	0.47432	TCC	A|0.369;C|0.631		0.517	GABRE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060903.1	NM_004961, NM_021990, NM_021984	
Unknown	0	bcgsc.ca	37	Y	21154569	21154569	+	IGR	SNP	A	A	G	rs17855271		TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chrY:21154569A>G								TTTY14 (114455 upstream) : RNU6-255P (26299 downstream)																							GCCCCAGCCCAAGCCTGGCCA	0.612																																					p.L9L		.											.	.	0			c.T27C						.																																			SO:0001628	intergenic_variant	100133941	exon1			CAGCCCAAGCCTG																													Y.37:g.21154569A>G		Somatic	64	2		WXS	Illumina GAIIx	Phase_I	151	32	NM_013230	0	0	0	0	0		Silent	SNP		37																																																																																				.	0	0.612								
POLG	5428	hgsc.bcm.edu;broad.mit.edu	37	15	89876827	89876828	+	In_Frame_Ins	INS	-	-	TGCTGC	rs527965158|rs369920352|rs41550117|rs587781118|rs59510277	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr15:89876827_89876828insTGCTGC	ENST00000268124.5	-	2	491_492	c.158_159insGCAGCA	c.(157-159)caa>caGCAGCAa	p.53_53Q>QQQ	RP11-217B1.2_ENST00000562356.1_RNA|POLG_ENST00000525806.1_5'Flank|RP11-217B1.2_ENST00000569473.1_RNA|POLG_ENST00000442287.2_In_Frame_Ins_p.53_53Q>QQQ	NM_001126131.1|NM_002693.2	NP_001119603.1|NP_002684.1	P54098	DPOG1_HUMAN	polymerase (DNA directed), gamma	53	Poly-Gln.				aging (GO:0007568)|base-excision repair, gap-filling (GO:0006287)|cell death (GO:0008219)|DNA metabolic process (GO:0006259)|DNA-dependent DNA replication (GO:0006261)|mitochondrial DNA replication (GO:0006264)	extracellular vesicular exosome (GO:0070062)|gamma DNA polymerase complex (GO:0005760)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|exonuclease activity (GO:0004527)|protease binding (GO:0002020)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(3)|urinary_tract(2)	33	Lung NSC(78;0.0472)|all_lung(78;0.089)		STAD - Stomach adenocarcinoma(125;0.165)			gaggctgctgttgctgctgctg	0.693								DNA polymerases (catalytic subunits)																													p.Q53delinsQQQ	Colon(73;648 1203 11348 18386 27782)	.											.	POLG-228	0			c.159_160insGCAGCA						.																																			SO:0001652	inframe_insertion	5428	exon2			CTGCTGTTGCTGC	X98093	CCDS10350.1	15q24	2014-09-17			ENSG00000140521	ENSG00000140521		"""DNA polymerases"""	9179	protein-coding gene	gene with protein product		174763				9465903	Standard	NM_002693		Approved	POLG1, POLGA	uc002bnr.4	P54098	OTTHUMG00000149646	ENST00000268124.5:c.153_158dupGCAGCA	15.37:g.89876828_89876833dupTGCTGC	ENSP00000268124:p.GlnGln55dup	Somatic	10	0		WXS	Illumina GAIIx	Phase_I	41	12	NM_001126131	0	0	0	0	0	Q8NFM2|Q92515	In_Frame_Ins	INS	ENST00000268124.5	37	CCDS10350.1																																																																																			.		0.693	POLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000312854.2	NM_002693	
ADAMTS18	170692	broad.mit.edu	37	16	77356310	77356311	+	Frame_Shift_Ins	INS	-	-	A			TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr16:77356310_77356311insA	ENST00000282849.5	-	14	2503_2504	c.2085_2086insT	c.(2083-2088)tttgcafs	p.A696fs		NM_199355.2	NP_955387.1	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 18	696	Cys-rich.				eye development (GO:0001654)|negative regulation of platelet aggregation (GO:0090331)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.A696fs*18(2)		NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(26)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(19)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	118						CCGGACATTGCAAAAAAAAATT	0.406																																					p.A696fs		.											.	ADAMTS18-1036	2	Insertion - Frameshift(2)	large_intestine(2)	c.2086_2087insT						.																																			SO:0001589	frameshift_variant	170692	exon14			ACATTGCAAAAAA	AJ311903	CCDS10926.1	16q23	2008-07-29	2005-08-19		ENSG00000140873	ENSG00000140873		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17110	protein-coding gene	gene with protein product		607512	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 18"""	ADAMTS21		11867212, 17546048	Standard	NM_199355		Approved		uc002ffc.4	Q8TE60	OTTHUMG00000137619	ENST00000282849.5:c.2086dupT	16.37:g.77356319_77356319dupA	ENSP00000282849:p.Ala696fs	Somatic	131	0		WXS	Illumina GAIIx	Phase_I	234	7	NM_199355	0	0	0	0	0	Q6P4R5|Q6ZWJ9	Frame_Shift_Ins	INS	ENST00000282849.5	37	CCDS10926.1																																																																																			.		0.406	ADAMTS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269037.1		
ATXN1	6310	broad.mit.edu	37	6	16327915	16327916	+	In_Frame_Ins	INS	-	-	TGC	rs11969612|rs369629396	byFrequency	TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr6:16327915_16327916insTGC	ENST00000244769.4	-	8	1562_1563	c.626_627insGCA	c.(625-627)cat>caGCAt	p.208_209insQ	ATXN1_ENST00000436367.1_In_Frame_Ins_p.208_209insQ	NM_000332.3	NP_000323.2	P54253	ATX1_HUMAN	ataxin 1	208	Poly-Gln.		H -> Q (in dbSNP:rs11969612).		adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|nuclear export (GO:0051168)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear inclusion body (GO:0042405)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|protein self-association (GO:0043621)	p.H209delH(2)|p.H209_H211delHQH(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(11)|lung(12)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)	44	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)				gctgatgctgatgctgctgctg	0.668																																					p.H209delinsQH		.											.	ATXN1-93	3	Deletion - In frame(3)	upper_aerodigestive_tract(1)|large_intestine(1)|prostate(1)	c.627_628insGCA						.																																			SO:0001652	inframe_insertion	6310	exon7			ATGCTGATGCTGC	X79204	CCDS34342.1	6p23	2014-09-17	2004-08-12	2004-08-13	ENSG00000124788	ENSG00000124788		"""Ataxins"""	10548	protein-coding gene	gene with protein product		601556	"""spinocerebellar ataxia 1 (olivopontocerebellar ataxia 1, autosomal dominant, ataxin 1)"""	SCA1		1582256	Standard	NM_000332		Approved	D6S504E, ATX1	uc010jpi.3	P54253	OTTHUMG00000014303	ENST00000244769.4:c.624_626dupGCA	6.37:g.16327922_16327924dupTGC	ENSP00000244769:p.Gln209_Gln210dup	Somatic	26	0		WXS	Illumina GAIIx	Phase_I	36	22	NM_001128164	0	0	0	0	0	Q17S02|Q9UJG2|Q9Y4J1	In_Frame_Ins	INS	ENST00000244769.4	37	CCDS34342.1																																																																																			.		0.668	ATXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039943.3	NM_000332	
MEPCE	56257	broad.mit.edu	37	7	100028067	100028068	+	Frame_Shift_Ins	INS	-	-	G			TCGA-OR-A5JZ-01A-11D-A29I-10	TCGA-OR-A5JZ-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c8fb3b22-0789-4494-b5e0-09d61b0457b8	6225521c-473e-4ee7-946a-d2daec7c45de	g.chr7:100028067_100028068insG	ENST00000310512.2	+	1	814_815	c.426_427insG	c.(427-429)gggfs	p.G143fs	ZCWPW1_ENST00000398027.2_5'Flank|ZCWPW1_ENST00000360951.4_5'Flank|MEPCE_ENST00000414441.1_Intron|ZCWPW1_ENST00000324725.6_5'Flank	NM_019606.5	NP_062552.2	Q7L2J0	MEPCE_HUMAN	methylphosphate capping enzyme	143	Gly-rich.				negative regulation of chromatin binding (GO:0035562)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|RNA methylation (GO:0001510)|snRNA metabolic process (GO:0016073)|snRNA modification (GO:0040031)		poly(A) RNA binding (GO:0044822)|RNA methyltransferase activity (GO:0008173)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(2)|lung(9)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	24	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					ACCGGCCACCTGGGGGGGGCGG	0.693																																					p.P142fs		.											.	MEPCE-91	0			c.426_427insG						.																																			SO:0001589	frameshift_variant	56257	exon1			GCCACCTGGGGGG	AF264752	CCDS5693.1, CCDS55136.1	7q22.1	2008-02-04	2007-07-26	2007-07-26	ENSG00000146834	ENSG00000146834			20247	protein-coding gene	gene with protein product		611478	"""bin3, bicoid-interacting 3, homolog (Drosophila)"""	BCDIN3		12358911, 17643375	Standard	NM_019606		Approved	FLJ20257, MePCE	uc003uuw.3	Q7L2J0	OTTHUMG00000155255	ENST00000310512.2:c.434dupG	7.37:g.100028075_100028075dupG	ENSP00000308546:p.Gly143fs	Somatic	6	0		WXS	Illumina GAIIx	Phase_I	6	2	NM_019606	0	0	0	0	0	B3KP86|D6W5V7|Q9NPD4	Frame_Shift_Ins	INS	ENST00000310512.2	37	CCDS5693.1																																																																																			.		0.693	MEPCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339135.1		
