#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
NOL9	79707	hgsc.bcm.edu	37	1	6614391	6614391	+	Missense_Mutation	SNP	A	A	C	rs6693391	byFrequency	TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr1:6614391A>C	ENST00000377705.5	-	1	204	c.172T>G	c.(172-174)Tcc>Gcc	p.S58A	TAS1R1_ENST00000328191.4_5'Flank|TAS1R1_ENST00000351136.3_5'Flank|TAS1R1_ENST00000333172.6_5'Flank	NM_024654.4	NP_078930	Q5SY16	NOL9_HUMAN	nucleolar protein 9	58			S -> A (in dbSNP:rs6693391). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		maturation of 5.8S rRNA (GO:0000460)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|polynucleotide 5'-hydroxyl-kinase activity (GO:0051731)|RNA binding (GO:0003723)			central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|skin(2)|urinary_tract(1)	19	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;2.46e-35)|all_epithelial(116;1.41e-22)|all_lung(118;7.59e-07)|Lung NSC(185;4.28e-06)|Colorectal(325;4.52e-05)|Breast(487;0.000353)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.47e-07)|COAD - Colon adenocarcinoma(227;1.47e-05)|Kidney(185;5.27e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000971)|BRCA - Breast invasive adenocarcinoma(365;0.00113)|STAD - Stomach adenocarcinoma(132;0.0017)|READ - Rectum adenocarcinoma(331;0.0649)		TCCACGCCGGACGCCTGGGCT	0.781													C|||	4789	0.95627	0.8722	0.9841	5008	,	,		9026	0.9692		0.995	False		,,,				2504	0.9969				p.S58A		.											.	NOL9-515	0			c.T172G						.	C	ALA/SER	2196,260		975,246,7	2.0	3.0	3.0		172	3.0	0.2	1	dbSNP_116	3	4875,25		2425,25,0	no	missense	NOL9	NM_024654.4	99	3400,271,7	CC,CA,AA		0.5102,10.5863,3.8744	benign	58/703	6614391	7071,285	1228	2450	3678	SO:0001583	missense	79707	exon1			CGCCGGACGCCTG	AK091284	CCDS80.1	1p36.31	2012-05-02			ENSG00000162408	ENSG00000162408			26265	protein-coding gene	gene with protein product	"""polynucleotide 5'-kinase"""					21063389	Standard	NM_024654		Approved	FLJ23323, NET6, Grc3	uc001ans.3	Q5SY16	OTTHUMG00000000904	ENST00000377705.5:c.172T>G	1.37:g.6614391A>C	ENSP00000366934:p.Ser58Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_024654	0	0	0	0	0	Q2NL84|Q4VBY3|Q6P472|Q7L4D6|Q96EE0|Q9H5L4	Missense_Mutation	SNP	ENST00000377705.5	37	CCDS80.1	2092	0.9578754578754579	421	0.8556910569105691	355	0.9806629834254144	562	0.9825174825174825	754	0.9947229551451188	C	0.416	-0.910621	0.02434	0.894137	0.994898	ENSG00000162408	ENST00000377705	T	0.15718	2.4	4.0	3.05	0.35203	.	0.361559	0.20066	N	0.099972	T	0.00012	0.0000	N	0.01576	-0.805	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.37798	-0.9690	9	0.02654	T	1	-12.1681	8.8998	0.35487	0.424:0.576:0.0:0.0	rs6693391;rs56691058	58	Q5SY16	NOL9_HUMAN	A	58	ENSP00000366934:S58A	ENSP00000366934:S58A	S	-	1	0	NOL9	6536978	0.795000	0.28851	0.220000	0.23810	0.044000	0.14063	0.592000	0.23984	0.422000	0.26005	-0.285000	0.09966	TCC	A|0.047;C|0.953		0.781	NOL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002625.1	NM_024654	
AHDC1	27245	hgsc.bcm.edu	37	1	27877423	27877423	+	Nonsense_Mutation	SNP	C	C	A			TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr1:27877423C>A	ENST00000247087.5	-	5	1800	c.1204G>T	c.(1204-1206)Gga>Tga	p.G402*	AHDC1_ENST00000374011.2_Nonsense_Mutation_p.G402*			Q5TGY3	AHDC1_HUMAN	AT hook, DNA binding motif, containing 1	402	Pro-rich.						DNA binding (GO:0003677)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	42		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0434)|OV - Ovarian serous cystadenocarcinoma(117;8.48e-25)|Colorectal(126;9.17e-09)|COAD - Colon adenocarcinoma(152;1.84e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00192)|BRCA - Breast invasive adenocarcinoma(304;0.00259)|STAD - Stomach adenocarcinoma(196;0.00311)|READ - Rectum adenocarcinoma(331;0.0291)		GCCTTGCGTCCCCGTCCGGCT	0.726																																					p.G402X		.											.	AHDC1-90	0			c.G1204T						.						7.0	8.0	8.0					1																	27877423		2111	4131	6242	SO:0001587	stop_gained	27245	exon6			TGCGTCCCCGTCC	AK125431	CCDS30652.1	1p36.13	2008-02-05			ENSG00000126705	ENSG00000126705			25230	protein-coding gene	gene with protein product		615790				8619474, 9110174	Standard	XM_005245848		Approved	DJ159A19.3, RP1-159A19.1	uc009vsy.3	Q5TGY3	OTTHUMG00000003398	ENST00000247087.5:c.1204G>T	1.37:g.27877423C>A	ENSP00000247087:p.Gly402*	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	25	22	NM_001029882	0	0	1	16	15	Q5TGY4|Q6PJK1|Q6ZUQ6|Q99769|Q9NUF5	Nonsense_Mutation	SNP	ENST00000247087.5	37	CCDS30652.1	.	.	.	.	.	.	.	.	.	.	C	40	8.531700	0.98852	.	.	ENSG00000126705	ENST00000247087;ENST00000374011	.	.	.	5.76	4.84	0.62591	.	0.000000	0.37809	U	0.001931	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-5.261	11.3525	0.49596	0.0:0.9154:0.0:0.0846	.	.	.	.	X	402	.	ENSP00000247087:G402X	G	-	1	0	AHDC1	27750010	0.954000	0.32549	1.000000	0.80357	0.943000	0.58893	1.850000	0.39328	2.722000	0.93159	0.579000	0.79373	GGA	.		0.726	AHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009523.3		
EPHA10	284656	hgsc.bcm.edu	37	1	38227246	38227246	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr1:38227246C>G	ENST00000373048.4	-	3	680	c.681G>C	c.(679-681)gaG>gaC	p.E227D	EPHA10_ENST00000319637.6_Missense_Mutation_p.E227D|EPHA10_ENST00000427468.2_Missense_Mutation_p.E227D	NM_001099439.1	NP_001092909.1	Q5JZY3	EPHAA_HUMAN	EPH receptor A10	227					ephrin receptor signaling pathway (GO:0048013)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane-ephrin receptor activity (GO:0005005)			NS(2)|breast(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(4)|lung(13)|prostate(3)|skin(8)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				AGAAGGCGCTCTCGGCTGCGG	0.716																																					p.E227D		.											.	EPHA10-1246	0			c.G681C						.						12.0	14.0	13.0					1																	38227246		2190	4268	6458	SO:0001583	missense	284656	exon3			GGCGCTCTCGGCT	AK090974	CCDS425.1, CCDS41305.1	1p34.3	2013-02-11			ENSG00000183317	ENSG00000183317		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19987	protein-coding gene	gene with protein product		611123				12477932	Standard	NM_001099439		Approved	FLJ16103, FLJ33655	uc009vvi.3	Q5JZY3	OTTHUMG00000004325	ENST00000373048.4:c.681G>C	1.37:g.38227246C>G	ENSP00000362139:p.Glu227Asp	Somatic	7	0		WXS	Illumina GAIIx	Phase_I	52	37	NM_001099439	0	0	0	0	0	A4FU89|J3KPB5|Q6NW42	Missense_Mutation	SNP	ENST00000373048.4	37	CCDS41305.1	.	.	.	.	.	.	.	.	.	.	C	18.08	3.544263	0.65198	.	.	ENSG00000183317	ENST00000427468;ENST00000373048;ENST00000319637	T;T;T	0.76186	-1.0;-1.0;4.43	4.4	4.4	0.53042	.	0.171607	0.28026	N	0.016892	T	0.77143	0.4087	M	0.71581	2.175	0.80722	D	1	P;P	0.47762	0.9;0.859	B;P	0.48189	0.444;0.57	T	0.80405	-0.1396	10	0.72032	D	0.01	.	11.6986	0.51558	0.1769:0.8231:0.0:0.0	.	227;227	Q5JZY3;Q5JZY3-2	EPHAA_HUMAN;.	D	227	ENSP00000397746:E227D;ENSP00000362139:E227D;ENSP00000316395:E227D	ENSP00000316395:E227D	E	-	3	2	EPHA10	37999833	0.992000	0.36948	1.000000	0.80357	0.930000	0.56654	0.952000	0.29149	2.411000	0.81874	0.551000	0.68910	GAG	.		0.716	EPHA10-003	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000012497.2	NM_173641	
DHCR24	1718	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	55349290	55349290	+	Splice_Site	SNP	C	C	A			TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr1:55349290C>A	ENST00000371269.3	-	2	486		c.e2+1		DHCR24_ENST00000535035.1_Splice_Site	NM_014762.3	NP_055577.1	Q15392	DHC24_HUMAN	24-dehydrocholesterol reductase						amyloid precursor protein catabolic process (GO:0042987)|apoptotic process (GO:0006915)|cell cycle arrest (GO:0007050)|cholesterol biosynthetic process (GO:0006695)|male genitalia development (GO:0030539)|membrane organization (GO:0061024)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|oxidation-reduction process (GO:0055114)|plasminogen activation (GO:0031639)|protein localization (GO:0008104)|Ras protein signal transduction (GO:0007265)|regulation of neuron death (GO:1901214)|response to hormone (GO:0009725)|response to oxidative stress (GO:0006979)|skin development (GO:0043588)|small molecule metabolic process (GO:0044281)|tissue development (GO:0009888)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	delta24(24-1) sterol reductase activity (GO:0000246)|delta24-sterol reductase activity (GO:0050614)|enzyme binding (GO:0019899)|flavin adenine dinucleotide binding (GO:0050660)|oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor (GO:0016628)|peptide antigen binding (GO:0042605)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)			large_intestine(2)|liver(1)|lung(1)|pancreas(1)|prostate(1)|skin(1)	7						GCTACTCTCACCTGTTTCTTG	0.512																																					.	Pancreas(39;516 1021 24601 30715 32780)	.											.	DHCR24-91	0			c.387+1G>T						.						255.0	234.0	241.0					1																	55349290		2203	4300	6503	SO:0001630	splice_region_variant	1718	exon3			CTCTCACCTGTTT	AF261758	CCDS600.1	1p32.3	2008-02-05			ENSG00000116133	ENSG00000116133			2859	protein-coding gene	gene with protein product		606418				11519011	Standard	NM_014762		Approved	KIAA0018, seladin-1	uc001cyc.1	Q15392	OTTHUMG00000009989	ENST00000371269.3:c.387+1G>T	1.37:g.55349290C>A		Somatic	121	0		WXS	Illumina GAIIx	Phase_I	123	10	NM_014762	0	0	0	0	0	B7Z817|D3DQ51|Q9HBA8	Splice_Site	SNP	ENST00000371269.3	37	CCDS600.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.584322	0.86748	.	.	ENSG00000116133	ENST00000371269;ENST00000535035	.	.	.	5.25	5.25	0.73442	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.8672	0.92298	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DHCR24	55121878	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	7.818000	0.86416	2.467000	0.83353	0.655000	0.94253	.	.		0.512	DHCR24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027680.1	NM_014762	Intron
SRSF11	9295	broad.mit.edu	37	1	70694110	70694110	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr1:70694110C>T	ENST00000370950.3	+	3	291	c.209C>T	c.(208-210)tCg>tTg	p.S70L	SRSF11_ENST00000454435.2_Missense_Mutation_p.S70L|SRSF11_ENST00000436161.2_Missense_Mutation_p.S70L|SRSF11_ENST00000405432.1_Missense_Mutation_p.S70L|SRSF11_ENST00000370951.1_Missense_Mutation_p.S70L			Q05519	SRS11_HUMAN	serine/arginine-rich splicing factor 11	70	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			large_intestine(3)|ovary(2)|skin(1)	6						TTTAGTGATTCGCCTTTGCCA	0.358																																					p.S70L		.											.	SRSF11-227	0			c.C209T						.						119.0	106.0	110.0					1																	70694110		2203	4300	6503	SO:0001583	missense	9295	exon3			GTGATTCGCCTTT	M74002	CCDS647.1, CCDS53332.1	1p31.1	2013-02-12	2010-06-22	2010-06-22	ENSG00000116754	ENSG00000116754		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10782	protein-coding gene	gene with protein product	"""SR splicing factor 11"""	602010	"""splicing factor, arginine/serine-rich 11"""	SFRS11		1896467, 20516191	Standard	NM_004768		Approved	p54, NET2	uc001des.3	Q05519	OTTHUMG00000009342	ENST00000370950.3:c.209C>T	1.37:g.70694110C>T	ENSP00000359988:p.Ser70Leu	Somatic	82	2		WXS	Illumina GAIIx	Phase_I	85	5	NM_004768	0	0	0	0	0	Q5T758|Q8IWE6	Missense_Mutation	SNP	ENST00000370950.3	37	CCDS647.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.020629	0.75275	.	.	ENSG00000116754	ENST00000370951;ENST00000370950;ENST00000405432;ENST00000454435;ENST00000395136;ENST00000436161	.	.	.	5.34	5.34	0.76211	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.70211	0.3198	L	0.45581	1.43	0.80722	D	1	D;D;D;D;D;D	0.76494	0.999;0.96;0.998;0.999;0.999;0.998	D;B;D;D;D;D	0.80764	0.986;0.253;0.992;0.994;0.994;0.992	T	0.72261	-0.4345	9	0.62326	D	0.03	.	19.0454	0.93018	0.0:1.0:0.0:0.0	.	70;70;70;70;70;70	B4DTC1;B4DWT1;Q05BU6;Q6PJB9;Q8IWE6;Q05519	.;.;.;.;.;SRS11_HUMAN	L	70	.	ENSP00000359988:S70L	S	+	2	0	SRSF11	70466698	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.818000	0.86416	2.522000	0.85027	0.563000	0.77884	TCG	.		0.358	SRSF11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000025889.1	NM_004768	
INSRR	3645	broad.mit.edu;bcgsc.ca	37	1	156810733	156810733	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr1:156810733C>T	ENST00000368195.3	-	22	4222	c.3826G>A	c.(3826-3828)Gat>Aat	p.D1276N	NTRK1_ENST00000392302.2_Intron	NM_014215.2	NP_055030.1	P14616	INSRR_HUMAN	insulin receptor-related receptor	1276					actin cytoskeleton reorganization (GO:0031532)|cellular response to alkaline pH (GO:0071469)|male sex determination (GO:0030238)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(7)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	42	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					GGCTCTGCATCGGTGGTAGGC	0.652																																					p.D1276N		.											.	INSRR-1403	0			c.G3826A						.						32.0	34.0	33.0					1																	156810733		2203	4300	6503	SO:0001583	missense	3645	exon22			CTGCATCGGTGGT	J05046	CCDS1160.1	1q21-q23	2013-02-11			ENSG00000027644	ENSG00000027644		"""Fibronectin type III domain containing"""	6093	protein-coding gene	gene with protein product		147671				2768234, 2249481	Standard	NM_014215		Approved	IRR	uc010pht.2	P14616	OTTHUMG00000041291	ENST00000368195.3:c.3826G>A	1.37:g.156810733C>T	ENSP00000357178:p.Asp1276Asn	Somatic	128	0		WXS	Illumina GAIIx	Phase_I	115	6	NM_014215	0	0	0	0	0	O60724|Q5VZS3	Missense_Mutation	SNP	ENST00000368195.3	37	CCDS1160.1	.	.	.	.	.	.	.	.	.	.	C	14.60	2.583288	0.46006	.	.	ENSG00000027644	ENST00000368195	T	0.74002	-0.8	5.4	3.55	0.40652	.	0.282935	0.25045	N	0.033575	T	0.38719	0.1051	.	.	.	0.24126	N	0.995784	B	0.06786	0.001	B	0.04013	0.001	T	0.20940	-1.0260	9	0.22109	T	0.4	.	10.7399	0.46147	0.0:0.8459:0.0:0.1541	.	1276	P14616	INSRR_HUMAN	N	1276	ENSP00000357178:D1276N	ENSP00000357178:D1276N	D	-	1	0	INSRR	155077357	0.712000	0.27916	0.040000	0.18447	0.114000	0.19823	2.223000	0.42936	0.856000	0.35383	0.655000	0.94253	GAT	.		0.652	INSRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098929.1	NM_014215	
FCRL5	83416	bcgsc.ca	37	1	157514091	157514091	+	Missense_Mutation	SNP	C	C	T	rs12036228	byFrequency	TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr1:157514091C>T	ENST00000361835.3	-	5	962	c.805G>A	c.(805-807)Gtc>Atc	p.V269I	FCRL5_ENST00000368189.3_Missense_Mutation_p.V269I|FCRL5_ENST00000368190.3_Missense_Mutation_p.V269I|FCRL5_ENST00000356953.4_Missense_Mutation_p.V269I|FCRL5_ENST00000368191.3_Missense_Mutation_p.V184I	NM_001195388.1|NM_031281.2	NP_001182317.1|NP_112571.2	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5	269	Ig-like C2-type 2.		V -> I (in dbSNP:rs12036228). {ECO:0000269|PubMed:11493702, ECO:0000269|PubMed:15489334}.		negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of release of sequestered calcium ion into cytosol (GO:0051280)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)				breast(5)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(45)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	85	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				TCAGATATGACGCTGTAAGGC	0.512													T|||	990	0.197684	0.295	0.1729	5008	,	,		20744	0.0784		0.2376	False		,,,				2504	0.1656				p.V269I		.											.	FCRL5-156	0			c.G805A						.	T	ILE/VAL,ILE/VAL	1295,3111	699.1+/-406.4	182,931,1090	154.0	152.0	153.0		805,805	-1.6	0.0	1	dbSNP_120	153	1842,6758	731.3+/-406.8	195,1452,2653	yes	missense,missense	FCRL5	NM_001195388.1,NM_031281.2	29,29	377,2383,3743	TT,TC,CC		21.4186,29.3917,24.1196	benign,benign	269/999,269/978	157514091	3137,9869	2203	4300	6503	SO:0001583	missense	83416	exon5			ATATGACGCTGTA	AF369794	CCDS1165.1	1q21	2013-01-11			ENSG00000143297	ENSG00000143297		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18508	protein-coding gene	gene with protein product		605877				11027651, 11290337	Standard	NM_031281		Approved	FCRH5, IRTA2, BXMAS1, CD307e	uc009wsm.3	Q96RD9	OTTHUMG00000017481	ENST00000361835.3:c.805G>A	1.37:g.157514091C>T	ENSP00000354691:p.Val269Ile	Somatic	131	0		WXS	Illumina GAIIx	Phase_I	119	5	NM_031281	0	0	0	0	0	A0N0M2|B7WNT9|B7WP94|Q495Q2|Q495Q4|Q5VYK9|Q6UY46	Missense_Mutation	SNP	ENST00000361835.3	37	CCDS1165.1	457	0.20924908424908426	151	0.30691056910569103	74	0.20441988950276244	46	0.08041958041958042	186	0.24538258575197888	T	7.167	0.586880	0.13749	0.293917	0.214186	ENSG00000143297	ENST00000361835;ENST00000356953;ENST00000368190;ENST00000368191;ENST00000368189	T;T;T;T;T	0.12255	2.7;2.7;2.7;2.7;2.7	4.0	-1.58	0.08479	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.02230	0.0069	N	0.20685	0.6	0.80722	P	0.0	B;B;B;B;B;B	0.28605	0.032;0.1;0.026;0.217;0.114;0.045	B;B;B;B;B;B	0.29524	0.053;0.057;0.049;0.084;0.037;0.103	T	0.47341	-0.9125	8	0.13853	T	0.58	.	10.5466	0.45064	0.0:0.5765:0.0:0.4235	rs12036228;rs12036228	300;184;269;269;269;269	B4DW39;F5GXJ2;Q96RD9-3;A6NJE8;Q96RD9-4;Q96RD9	.;.;.;.;.;FCRL5_HUMAN	I	269;269;269;184;269	ENSP00000354691:V269I;ENSP00000349434:V269I;ENSP00000357173:V269I;ENSP00000357174:V184I;ENSP00000357172:V269I	ENSP00000349434:V269I	V	-	1	0	FCRL5	155780715	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.680000	0.00837	-0.792000	0.04480	-1.361000	0.01213	GTC	C|0.772;T|0.228		0.512	FCRL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046263.1	NM_031281	
TOR3A	64222	hgsc.bcm.edu	37	1	179051300	179051300	+	Missense_Mutation	SNP	T	T	C	rs2296377	byFrequency	TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr1:179051300T>C	ENST00000367627.3	+	1	789	c.37T>C	c.(37-39)Ttc>Ctc	p.F13L	TOR3A_ENST00000352445.6_Missense_Mutation_p.F13L	NM_022371.3	NP_071766.2	Q9H497	TOR3A_HUMAN	torsin family 3, member A	13			F -> L (in dbSNP:rs2296377). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|Ref.3}.		ATP catabolic process (GO:0006200)|chaperone mediated protein folding requiring cofactor (GO:0051085)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			endometrium(1)|kidney(2)|large_intestine(4)|lung(4)|pancreas(1)|urinary_tract(1)	13						TTGGCTCTTTTTCCTGCTGCT	0.751													C|||	3842	0.767173	0.9879	0.6441	5008	,	,		12722	0.6677		0.7117	False		,,,				2504	0.7157				p.F13L		.											.	TOR3A-90	0			c.T37C						.	C	LEU/PHE	3262,174		1547,168,3	2.0	3.0	3.0		37	-0.8	0.0	1	dbSNP_100	3	5365,1739		2051,1263,238	yes	missense	TOR3A	NM_022371.3	22	3598,1431,241	CC,CT,TT		24.4792,5.064,18.1499	benign	13/398	179051300	8627,1913	1718	3552	5270	SO:0001583	missense	64222	exon1			CTCTTTTTCCTGC	BC001085	CCDS1329.1	1q25.2	2008-02-05	2003-04-02		ENSG00000186283	ENSG00000186283			11997	protein-coding gene	gene with protein product		607555	"""ATP-dependant interferon responsive"""	ADIR		10644435	Standard	NM_022371		Approved	FLJ22345, ADIR2	uc001gmd.3	Q9H497	OTTHUMG00000035077	ENST00000367627.3:c.37T>C	1.37:g.179051300T>C	ENSP00000356599:p.Phe13Leu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_022371	0	0	0	3	3	B4DSY0|B7ZB65|Q5M7Y7|Q8WVA7|Q8WWM2|Q9H495|Q9H6E7	Missense_Mutation	SNP	ENST00000367627.3	37	CCDS1329.1	1679	0.7687728937728938	484	0.983739837398374	250	0.6906077348066298	393	0.6870629370629371	552	0.7282321899736148	C	0.033	-1.323382	0.01309	0.94936	0.755208	ENSG00000186283	ENST00000367627;ENST00000367625;ENST00000352445	T;T;T	0.35421	1.31;1.4;1.63	0.427	-0.794	0.10918	.	1.274350	0.05916	N	0.632520	T	0.00012	0.0000	N	0.00368	-1.59	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.45906	-0.9229	8	0.02654	T	1	-1.1524	.	.	.	rs2296377;rs17844883;rs17856371;rs17857600;rs17857917;rs17858479;rs59034332;rs2296377	13	Q9H497	TOR3A_HUMAN	L	13	ENSP00000356599:F13L;ENSP00000356597:F13L;ENSP00000335351:F13L	ENSP00000335351:F13L	F	+	1	0	TOR3A	177317923	0.000000	0.05858	0.002000	0.10522	0.004000	0.04260	-1.490000	0.02304	-1.608000	0.01587	-1.610000	0.00802	TTC	T|0.229;C|0.771		0.751	TOR3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084927.1	NM_022371	
RGS21	431704	hgsc.bcm.edu	37	1	192335239	192335239	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr1:192335239G>T	ENST00000417209.2	+	5	618	c.444G>T	c.(442-444)tgG>tgT	p.W148C		NM_001039152.3	NP_001034241.1	Q2M5E4	RGS21_HUMAN	regulator of G-protein signaling 21	148					positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			NS(1)|endometrium(3)|large_intestine(4)|lung(5)|ovary(1)|skin(1)	15						ATAAAAAATGGCTCCCTTTTT	0.333																																					p.W148C		.											.	RGS21-92	0			c.G444T						.						41.0	40.0	40.0					1																	192335239		1798	4063	5861	SO:0001583	missense	431704	exon5			AAAATGGCTCCCT	AY643711	CCDS41448.1	1q31.2	2013-09-24	2007-08-14		ENSG00000253148	ENSG00000253148		"""Regulators of G-protein signaling"""	26839	protein-coding gene	gene with protein product		612407	"""regulator of G-protein signalling 21"""			15066150	Standard	NM_001039152		Approved		uc001gsh.3	Q2M5E4	OTTHUMG00000035594	ENST00000417209.2:c.444G>T	1.37:g.192335239G>T	ENSP00000428343:p.Trp148Cys	Somatic	22	0		WXS	Illumina GAIIx	Phase_I	16	4	NM_001039152	0	0	0	0	0		Missense_Mutation	SNP	ENST00000417209.2	37	CCDS41448.1	.	.	.	.	.	.	.	.	.	.	G	16.42	3.117872	0.56505	.	.	ENSG00000253148	ENST00000417209	T	0.37584	1.19	5.53	5.53	0.82687	.	0.000000	0.31577	U	0.007418	T	0.49236	0.1545	L	0.60455	1.87	0.53005	D	0.99996	D	0.76494	0.999	P	0.58820	0.846	T	0.42172	-0.9467	10	0.42905	T	0.14	.	11.4982	0.50422	0.0828:0.0:0.9172:0.0	.	148	Q2M5E4	RGS21_HUMAN	C	148	ENSP00000428343:W148C	ENSP00000428343:W148C	W	+	3	0	RGS21	190601862	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.877000	0.63086	2.598000	0.87819	0.591000	0.81541	TGG	.		0.333	RGS21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086387.2		
WDR37	22884	hgsc.bcm.edu	37	10	1094906	1094906	+	5'Flank	SNP	C	C	T	rs7091756	byFrequency	TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr10:1094906C>T	ENST00000358220.1	+	0	0				IDI1_ENST00000381344.3_Missense_Mutation_p.C13Y|IDI1_ENST00000491735.1_5'UTR			Q9Y2I8	WDR37_HUMAN	WD repeat domain 37											breast(2)|endometrium(2)|kidney(1)|lung(9)|prostate(2)|skin(1)	17		all_epithelial(10;0.0449)|Colorectal(49;0.142)		Epithelial(11;0.134)		ccgggccgcgcAGCCAATCGC	0.721													C|||	154	0.0307508	0.0038	0.0317	5008	,	,		13577	0.0		0.0368	False		,,,				2504	0.092				p.C13Y		.											.	IDI1-90	0			c.G38A						.	C	TYR/CYS	42,3924		1,40,1942	4.0	6.0	5.0		38	-3.5	0.0	10	dbSNP_116	5	362,7338		7,348,3495	no	missense	IDI1	NM_004508.2	194	8,388,5437	TT,TC,CC		4.7013,1.059,3.4631	benign	13/285	1094906	404,11262	1983	3850	5833	SO:0001631	upstream_gene_variant	3422	exon1			GCCGCGCAGCCAA	AB023199	CCDS7057.1	10p15.3	2013-01-09			ENSG00000047056	ENSG00000047056		"""WD repeat domain containing"""	31406	protein-coding gene	gene with protein product						10231032, 11230166	Standard	NM_014023		Approved	KIAA0982	uc001igf.1	Q9Y2I8	OTTHUMG00000017540		10.37:g.1094906C>T	Exception_encountered	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	10	NM_004508	0	0	0	2	2	A8K976|D3DRQ7|Q5SW03|Q8WVG2|Q9NTJ6	Missense_Mutation	SNP	ENST00000358220.1	37	CCDS7057.1	45	0.020604395604395604	5	0.01016260162601626	9	0.024861878453038673	0	0.0	31	0.040897097625329816	C	0.031	-1.335823	0.01287	0.01059	0.047013	ENSG00000067064	ENST00000381344	.	.	.	1.77	-3.54	0.04653	.	3.373570	0.01792	U	0.032349	T	0.01940	0.0061	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.17715	-1.0360	8	0.02654	T	1	.	4.1354	0.10169	0.0:0.2425:0.3482:0.4093	rs7091756;rs7091756	13	Q13907-2	.	Y	13	.	ENSP00000370748:C13Y	C	-	2	0	IDI1	1084906	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.721000	0.01870	-1.854000	0.01163	-0.350000	0.07774	TGC	C|0.981;T|0.019		0.721	WDR37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046418.1	NM_014023	
TAF5	6877	hgsc.bcm.edu	37	10	105128134	105128134	+	Missense_Mutation	SNP	T	T	G	rs10883859	byFrequency	TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr10:105128134T>G	ENST00000369839.3	+	1	411	c.388T>G	c.(388-390)Tcc>Gcc	p.S130A	TAF5_ENST00000351396.4_Missense_Mutation_p.S130A	NM_006951.3	NP_008882.2	Q15542	TAF5_HUMAN	TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 100kDa	130			S -> A (in dbSNP:rs10883859). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:8758937, ECO:0000269|PubMed:9045704, ECO:0000269|Ref.5}.		chromatin modification (GO:0016568)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	protein dimerization activity (GO:0046983)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)	15		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;1.83e-09)|all cancers(201;1.4e-08)|BRCA - Breast invasive adenocarcinoma(275;0.198)		AGTGGCGGGCTCCGGAGCCCC	0.741													T|||	1553	0.310104	0.1952	0.4078	5008	,	,		9029	0.4206		0.329	False		,,,				2504	0.2628				p.S130A		.											.	TAF5-92	0			c.T388G						.	T	ALA/SER	635,2955		63,509,1223	3.0	5.0	4.0		388	1.9	1.0	10	dbSNP_120	4	2122,5176		327,1468,1854	no	missense	TAF5	NM_006951.3	99	390,1977,3077	GG,GT,TT		29.0765,17.688,25.3215	benign	130/801	105128134	2757,8131	1795	3649	5444	SO:0001583	missense	6877	exon1			GCGGGCTCCGGAG	X95525	CCDS7547.1	10q24-q25.2	2013-01-10	2002-08-29	2001-12-07	ENSG00000148835	ENSG00000148835		"""WD repeat domain containing"""	11539	protein-coding gene	gene with protein product		601787	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, D, 100kD"""	TAF2D		8884287, 8942982	Standard	NM_006951		Approved	TAFII100	uc001kwv.3	Q15542	OTTHUMG00000018985	ENST00000369839.3:c.388T>G	10.37:g.105128134T>G	ENSP00000358854:p.Ser130Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	7	NM_006951	0	0	0	0	0	A8K5B4|B2RMR0|B7ZKJ6|Q53EM4|Q5SYD5|Q86UZ7|Q9Y4K5	Missense_Mutation	SNP	ENST00000369839.3	37	CCDS7547.1	821	0.3759157509157509	127	0.258130081300813	150	0.4143646408839779	277	0.48426573426573427	267	0.35224274406332456	T	12.78	2.040311	0.35989	0.17688	0.290765	ENSG00000148835	ENST00000369839;ENST00000351396	T;T	0.55930	0.73;0.49	4.45	1.88	0.25563	.	0.435426	0.24978	N	0.034100	T	0.00012	0.0000	N	0.04508	-0.205	0.41867	P	0.009742999999999946	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.46373	-0.9196	9	0.09338	T	0.73	-0.0936	6.2404	0.20787	0.1492:0.0:0.2595:0.5913	rs10883859	130;130	Q15542-2;Q15542	.;TAF5_HUMAN	A	130	ENSP00000358854:S130A;ENSP00000311024:S130A	ENSP00000311024:S130A	S	+	1	0	TAF5	105118124	0.988000	0.35896	1.000000	0.80357	0.948000	0.59901	0.932000	0.28884	0.814000	0.34374	0.459000	0.35465	TCC	T|0.623;G|0.377		0.741	TAF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050144.1		
RBM20	282996	hgsc.bcm.edu	37	10	112404302	112404302	+	Silent	SNP	G	G	A	rs35141404	byFrequency	TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr10:112404302G>A	ENST00000369519.3	+	1	148	c.90G>A	c.(88-90)cgG>cgA	p.R30R	Y_RNA_ENST00000411370.1_RNA	NM_001134363.1	NP_001127835.1	Q5T481	RBM20_HUMAN	RNA binding motif protein 20	30	Pro-rich.				heart development (GO:0007507)|mRNA processing (GO:0006397)|positive regulation of RNA splicing (GO:0033120)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(4)|kidney(3)|large_intestine(1)|ovary(1)|skin(2)	12						CTGGTGCCCGGGCGTCCCCGG	0.746													G|||	1113	0.222244	0.4206	0.1354	5008	,	,		7996	0.1617		0.1392	False		,,,				2504	0.1636				p.R30R		.											.	.	0			c.G90A						.						4.0	9.0	7.0					10																	112404302		625	1495	2120	SO:0001819	synonymous_variant	282996	exon1			TGCCCGGGCGTCC	BX648563	CCDS44477.1	10q25.3	2014-09-17			ENSG00000203867	ENSG00000203867		"""RNA binding motif (RRM) containing"""	27424	protein-coding gene	gene with protein product		613171					Standard	NM_001134363		Approved		uc001kzf.2	Q5T481	OTTHUMG00000019043	ENST00000369519.3:c.90G>A	10.37:g.112404302G>A		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	15	14	NM_001134363	0	0	0	0	0	A6NIP5|B5A868|Q5JVI1	Silent	SNP	ENST00000369519.3	37	CCDS44477.1																																																																																			G|0.808;A|0.192		0.746	RBM20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050339.2	NM_001134363	
FGFR2	2263	broad.mit.edu	37	10	123246935	123246935	+	Missense_Mutation	SNP	G	G	A	rs113014479		TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr10:123246935G>A	ENST00000358487.5	-	15	2262	c.1990C>T	c.(1990-1992)Cgg>Tgg	p.R664W	FGFR2_ENST00000360144.3_Missense_Mutation_p.R576W|FGFR2_ENST00000356226.4_Missense_Mutation_p.R547W|FGFR2_ENST00000369056.1_Missense_Mutation_p.R665W|FGFR2_ENST00000369059.1_Missense_Mutation_p.R550W|FGFR2_ENST00000369061.4_Missense_Mutation_p.R552W|FGFR2_ENST00000357555.5_Missense_Mutation_p.R575W|FGFR2_ENST00000346997.2_Missense_Mutation_p.R662W|FGFR2_ENST00000369060.4_Missense_Mutation_p.R548W|FGFR2_ENST00000457416.2_Missense_Mutation_p.R665W|FGFR2_ENST00000478859.1_Missense_Mutation_p.R436W|FGFR2_ENST00000351936.6_Missense_Mutation_p.R662W	NM_000141.4	NP_000132.3	P21802	FGFR2_HUMAN	fibroblast growth factor receptor 2	664	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axonogenesis (GO:0007409)|bone development (GO:0060348)|bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|branch elongation involved in salivary gland morphogenesis (GO:0060667)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|branching involved in prostate gland morphogenesis (GO:0060442)|branching involved in salivary gland morphogenesis (GO:0060445)|branching morphogenesis of a nerve (GO:0048755)|bud elongation involved in lung branching (GO:0060449)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|coronal suture morphogenesis (GO:0060365)|digestive tract development (GO:0048565)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic organ development (GO:0048568)|embryonic organ morphogenesis (GO:0048562)|embryonic pattern specification (GO:0009880)|endodermal digestive tract morphogenesis (GO:0061031)|epidermal growth factor receptor signaling pathway (GO:0007173)|epidermis morphogenesis (GO:0048730)|epithelial cell differentiation (GO:0030855)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|epithelial to mesenchymal transition (GO:0001837)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|fibroblast growth factor receptor signaling pathway involved in hemopoiesis (GO:0035603)|fibroblast growth factor receptor signaling pathway involved in mammary gland specification (GO:0060595)|fibroblast growth factor receptor signaling pathway involved in negative regulation of apoptotic process in bone marrow (GO:0035602)|fibroblast growth factor receptor signaling pathway involved in orbitofrontal cortex development (GO:0035607)|fibroblast growth factor receptor signaling pathway involved in positive regulation of cell proliferation in bone marrow (GO:0035604)|gland morphogenesis (GO:0022612)|hair follicle morphogenesis (GO:0031069)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|insulin receptor signaling pathway (GO:0008286)|lacrimal gland development (GO:0032808)|lateral sprouting from an epithelium (GO:0060601)|lens fiber cell development (GO:0070307)|limb bud formation (GO:0060174)|lung alveolus development (GO:0048286)|lung development (GO:0030324)|lung lobe morphogenesis (GO:0060463)|lung-associated mesenchyme development (GO:0060484)|mammary gland bud formation (GO:0060615)|membranous septum morphogenesis (GO:0003149)|mesenchymal cell differentiation (GO:0048762)|mesenchymal cell differentiation involved in lung development (GO:0060915)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesodermal cell differentiation (GO:0048333)|midbrain development (GO:0030901)|morphogenesis of embryonic epithelium (GO:0016331)|multicellular organism growth (GO:0035264)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitosis (GO:0045839)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis (GO:0042476)|orbitofrontal cortex development (GO:0021769)|organ growth (GO:0035265)|organ morphogenesis (GO:0009887)|otic vesicle formation (GO:0030916)|outflow tract septum morphogenesis (GO:0003148)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|post-embryonic development (GO:0009791)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|prostate epithelial cord elongation (GO:0060523)|prostate gland morphogenesis (GO:0060512)|protein autophosphorylation (GO:0046777)|pyramidal neuron development (GO:0021860)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of cell fate commitment (GO:0010453)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of morphogenesis of a branching structure (GO:0060688)|regulation of multicellular organism growth (GO:0040014)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoblast proliferation (GO:0033688)|regulation of smooth muscle cell differentiation (GO:0051150)|regulation of smoothened signaling pathway (GO:0008589)|reproductive structure development (GO:0048608)|skeletal system morphogenesis (GO:0048705)|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development (GO:0060529)|synaptic vesicle transport (GO:0048489)|ureteric bud development (GO:0001657)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|ventricular zone neuroblast division (GO:0021847)	cell cortex (GO:0005938)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|excitatory synapse (GO:0060076)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)	p.R664W(1)|p.R575W(1)		breast(3)|central_nervous_system(3)|cervix(2)|endometrium(98)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(7)|lung(21)|ovary(4)|skin(30)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(2)	181		Lung NSC(174;0.0841)|all_lung(145;0.106)|all_neural(114;0.107)	STAD - Stomach adenocarcinoma(1;7.52e-05)|all cancers(1;0.0722)	all cancers(201;9.73e-05)|GBM - Glioblastoma multiforme(135;0.0845)	Palifermin(DB00039)|Ponatinib(DB08901)|Regorafenib(DB08896)|Thalidomide(DB01041)	ACTGGAAGCCGCCCCTGCAAA	0.408		5	Mis		"""gastric. NSCLC, endometrial"""		"""Crouzon, Pfeiffer, and Apert syndromes"""		Saethre-Chotzen syndrome;Apert syndrome																												p.R665W		.		Dom	yes		10	10q26	2263	fibroblast growth factor receptor 2	yes	E	.	FGFR2-2607	2	Substitution - Missense(2)	large_intestine(2)	c.C1993T						.						42.0	46.0	44.0					10																	123246935		2203	4300	6503	SO:0001583	missense	2263	exon15	Familial Cancer Database	Acrocephalosyndactyly type III;Acrocephalosyndactyly type I and II, ACS1. ACS2, incl Apert-Crouzon s.	GAAGCCGCCCCTG	AK026508	CCDS7620.2, CCDS31298.1, CCDS44485.1, CCDS44486.1, CCDS44487.1, CCDS44488.1, CCDS44489.1, CCDS53584.1, CCDS73210.1	10q25.3-q26	2013-01-11	2008-08-01		ENSG00000066468	ENSG00000066468		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3689	protein-coding gene	gene with protein product	"""Crouzon syndrome"", ""Pfeiffer syndrome"""	176943	"""bacteria-expressed kinase"", ""keratinocyte growth factor receptor"", ""craniofacial dysostosis 1"", ""Jackson-Weiss syndrome"""	KGFR, BEK, CFD1, JWS			Standard	NM_022970		Approved	CEK3, TK14, TK25, ECT1, K-SAM, CD332	uc021pzy.1	P21802	OTTHUMG00000019175	ENST00000358487.5:c.1990C>T	10.37:g.123246935G>A	ENSP00000351276:p.Arg664Trp	Somatic	82	0		WXS	Illumina GAIIx	Phase_I	75	5	NM_022970	0	0	0	0	0	B4DFC2|E7EVR6|E9PCR0|P18443|Q01742|Q12922|Q14300|Q14301|Q14302|Q14303|Q14304|Q14305|Q14672|Q14718|Q14719|Q1KHY5|Q86YI4|Q8IXC7|Q96KL9|Q96KM0|Q96KM1|Q96KM2|Q9NZU2|Q9NZU3|Q9UD01|Q9UD02|Q9UIH3|Q9UIH4|Q9UIH5|Q9UIH6|Q9UIH7|Q9UIH8|Q9UM87|Q9UMC6|Q9UNS7|Q9UQH7|Q9UQH8|Q9UQH9|Q9UQI0	Missense_Mutation	SNP	ENST00000358487.5	37	CCDS31298.1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.007776	0.75046	.	.	ENSG00000066468	ENST00000357555;ENST00000369062;ENST00000369061;ENST00000358487;ENST00000356226;ENST00000369060;ENST00000369059;ENST00000429361;ENST00000346997;ENST00000457416;ENST00000351936;ENST00000360144;ENST00000369056;ENST00000369058;ENST00000336553	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.91631	-2.88;-2.88;-2.88;-2.88;-2.88;-2.88;-2.88;-2.88;-2.88;-2.88;-2.88;-2.88;-2.88;-2.88	5.2	5.2	0.72013	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.96386	0.8821	M	0.82193	2.58	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.87578	0.982;0.968;0.998;0.986;0.992;0.991;0.986;0.995	D	0.96810	0.9596	10	0.87932	D	0	.	18.6972	0.91605	0.0:0.0:1.0:0.0	.	681;663;575;547;664;576;665;567	D3DRD5;P21802-18;P21802-21;P21802-20;P21802;P21802-22;P21802-17;D3DRD3	.;.;.;.;FGFR2_HUMAN;.;.;.	W	575;665;552;664;547;548;550;256;662;665;662;576;665;665;573	ENSP00000350166:R575W;ENSP00000358057:R552W;ENSP00000351276:R664W;ENSP00000348559:R547W;ENSP00000358056:R548W;ENSP00000358055:R550W;ENSP00000404219:R256W;ENSP00000263451:R662W;ENSP00000410294:R665W;ENSP00000309878:R662W;ENSP00000353262:R576W;ENSP00000358052:R665W;ENSP00000358054:R665W;ENSP00000337665:R573W	ENSP00000337665:R573W	R	-	1	2	FGFR2	123236925	1.000000	0.71417	0.946000	0.38457	0.398000	0.30690	9.540000	0.98080	2.572000	0.86782	0.655000	0.94253	CGG	.		0.408	FGFR2-001	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000050715.1	NM_022976, NM_000141	
MUC5B	727897	bcgsc.ca	37	11	1266696	1266696	+	Silent	SNP	A	A	C	rs532138150	byFrequency	TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr11:1266696A>C	ENST00000529681.1	+	31	8644	c.8586A>C	c.(8584-8586)ccA>ccC	p.P2862P	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Silent_p.P2865P	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	2862	7 X Cys-rich subdomain repeats.|Thr-rich.			Missing (in Ref. 6; AAB61398). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CATCGGCCCCAATAACCACGG	0.692													-|||	1610	0.321486	0.236	0.3386	5008	,	,		9611	0.497		0.2575	False		,,,				2504	0.3098				p.P2862P		.											.	.	0			c.A8586C						.						54.0	65.0	61.0					11																	1266696		1727	3813	5540	SO:0001819	synonymous_variant	727897	exon31			GGCCCCAATAACC	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.8586A>C	11.37:g.1266696A>C		Somatic	149	2		WXS	Illumina GAIIx	Phase_I	105	59	NM_002458	0	0	0	0	0	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	ENST00000529681.1	37	CCDS44515.2																																																																																			A|0.500;C|0.500		0.692	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
MUC5B	727897	bcgsc.ca	37	11	1266716	1266716	+	Missense_Mutation	SNP	T	T	C	rs200243273	byFrequency	TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr11:1266716T>C	ENST00000529681.1	+	31	8664	c.8606T>C	c.(8605-8607)aTg>aCg	p.M2869T	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Missense_Mutation_p.M2872T	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	2869	7 X Cys-rich subdomain repeats.|Thr-rich.			Missing (in Ref. 6; AAB61398). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GTGGTGACCATGGGCTGTGAG	0.657													-|||	1477	0.294928	0.2284	0.2752	5008	,	,		10473	0.4812		0.2266	False		,,,				2504	0.2771				p.M2869T		.											.	.	0			c.T8606C						.						43.0	51.0	49.0					11																	1266716		1683	3765	5448	SO:0001583	missense	727897	exon31			TGACCATGGGCTG	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.8606T>C	11.37:g.1266716T>C	ENSP00000436812:p.Met2869Thr	Somatic	164	0		WXS	Illumina GAIIx	Phase_I	100	32	NM_002458	0	0	0	0	0	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	-	1.479	-0.557829	0.03967	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.15718	2.4;2.59	1.67	-1.74	0.08056	.	.	.	.	.	T	0.05686	0.0149	N	0.02539	-0.55	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.29882	-0.9997	8	0.87932	D	0	.	3.4419	0.07466	0.1749:0.468:0.0:0.3571	rs2860626;rs2943499;rs2943524;rs3965637	3452;2872	A7Y9J9;E9PBJ0	.;.	T	2869;2872;2841;2829	ENSP00000436812:M2869T;ENSP00000415793:M2872T	ENSP00000343037:M2841T	M	+	2	0	MUC5B	1223292	0.003000	0.15002	0.000000	0.03702	0.007000	0.05969	0.117000	0.15583	-1.035000	0.03291	-0.471000	0.05019	ATG	C|1.000;|0.000		0.657	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
FNBP4	23360	bcgsc.ca	37	11	47745589	47745589	+	Missense_Mutation	SNP	T	T	C	rs34242224	byFrequency	TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr11:47745589T>C	ENST00000263773.5	-	14	2467	c.2455A>G	c.(2455-2457)Ata>Gta	p.I819V	Y_RNA_ENST00000363220.1_RNA	NM_015308.2	NP_056123.2	Q8N3X1	FNBP4_HUMAN	formin binding protein 4	819						nucleus (GO:0005634)				NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(12)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	44						CCTGTAGCTATAGCTGACTGG	0.388													T|||	153	0.0305511	0.0053	0.0504	5008	,	,		18832	0.0		0.0875	False		,,,				2504	0.0235				p.I819V		.											.	FNBP4-91	0			c.A2455G						.	T	VAL/ILE	58,3696		1,56,1820	107.0	106.0	106.0		2455	-6.8	0.7	11	dbSNP_126	106	721,7531		28,665,3433	yes	missense	FNBP4	NM_015308.2	29	29,721,5253	CC,CT,TT		8.7373,1.545,6.4884	benign	819/1018	47745589	779,11227	1877	4126	6003	SO:0001583	missense	23360	exon14			TAGCTATAGCTGA	BC037404	CCDS41644.1	11q12.1	2008-02-05			ENSG00000109920	ENSG00000109920			19752	protein-coding gene	gene with protein product		615265				10231032	Standard	NM_015308		Approved	KIAA1014	uc009ylv.3	Q8N3X1	OTTHUMG00000166533	ENST00000263773.5:c.2455A>G	11.37:g.47745589T>C	ENSP00000263773:p.Ile819Val	Somatic	65	0		WXS	Illumina GAIIx	Phase_I	50	4	NM_015308	0	0	0	0	0	Q9H985|Q9NT81|Q9Y2L7	Missense_Mutation	SNP	ENST00000263773.5	37	CCDS41644.1	97	0.044413919413919416	6	0.012195121951219513	24	0.06629834254143646	0	0.0	67	0.08839050131926121	T	6.862	0.528323	0.13127	0.01545	0.087373	ENSG00000109920	ENST00000263773	T	0.41758	0.99	5.07	-6.82	0.01698	.	1.374210	0.03891	N	0.278631	T	0.00580	0.0019	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.05971	-1.0853	9	0.27785	T	0.31	-0.4376	0.5329	0.00631	0.2012:0.2622:0.2042:0.3325	rs34242224	819	Q8N3X1	FNBP4_HUMAN	V	819	ENSP00000263773:I819V	ENSP00000263773:I819V	I	-	1	0	FNBP4	47702165	0.000000	0.05858	0.694000	0.30210	0.903000	0.53119	-2.117000	0.01326	-0.837000	0.04223	0.459000	0.35465	ATA	T|0.943;C|0.057		0.388	FNBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390237.3		
TM7SF2	7108	hgsc.bcm.edu	37	11	64880090	64880090	+	Silent	SNP	G	G	C	rs4930284	byFrequency	TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr11:64880090G>C	ENST00000279263.7	+	2	318	c.156G>C	c.(154-156)ccG>ccC	p.P52P	AP003068.9_ENST00000528887.1_RNA|TM7SF2_ENST00000345348.5_Silent_p.P52P|TM7SF2_ENST00000540748.1_5'UTR	NM_003273.2	NP_003264.2	O76062	ERG24_HUMAN	transmembrane 7 superfamily member 2	52					cholesterol biosynthetic process (GO:0006695)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	delta14-sterol reductase activity (GO:0050613)			lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						CGTCCCTGCCGGGGCTGGAGG	0.756													C|||	4990	0.996406	0.9879	0.9986	5008	,	,		10438	1.0		0.999	False		,,,				2504	1.0				p.P52P		.											.	TM7SF2-91	0			c.G156C						.	C		2924,8		1458,8,0	2.0	2.0	2.0		156	-9.8	0.0	11	dbSNP_111	2	6426,0		3213,0,0	no	coding-synonymous	TM7SF2	NM_003273.2		4671,8,0	CC,CG,GG		0.0,0.2729,0.0855		52/419	64880090	9350,8	1466	3213	4679	SO:0001819	synonymous_variant	7108	exon2			CCTGCCGGGGCTG	BC012857	CCDS41669.1, CCDS60846.1	11q13.1	2013-05-23			ENSG00000149809	ENSG00000149809	1.3.1.70		11863	protein-coding gene	gene with protein product	"""delta(14)-sterol reductase"""	603414				9615229, 9286704	Standard	NM_003273		Approved	ANG1, DHCR14A, NET47	uc001oct.4	O76062	OTTHUMG00000165603	ENST00000279263.7:c.156G>C	11.37:g.64880090G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_003273	0	0	0	14	14	A8K4H0|O95982|Q8IY06|Q96E64|Q96GZ1	Silent	SNP	ENST00000279263.7	37	CCDS41669.1																																																																																			G|0.005;C|0.995		0.756	TM7SF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385234.1	NM_003273	
FGF4	2249	hgsc.bcm.edu	37	11	69589556	69589556	+	Silent	SNP	G	G	A	rs11600280	byFrequency	TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr11:69589556G>A	ENST00000168712.1	-	1	615	c.297C>T	c.(295-297)ctC>ctT	p.L99L	FGF4_ENST00000538040.1_5'UTR|AP001888.1_ENST00000602104.1_5'Flank	NM_002007.2	NP_001998.1	P08620	FGF4_HUMAN	fibroblast growth factor 4	99					apoptotic process involved in morphogenesis (GO:0060561)|cartilage condensation (GO:0001502)|cell-cell signaling (GO:0007267)|chondroblast differentiation (GO:0060591)|cranial suture morphogenesis (GO:0060363)|embryonic hindlimb morphogenesis (GO:0035116)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|mesenchymal cell proliferation (GO:0010463)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis of dentin-containing tooth (GO:0042475)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)|stem cell maintenance (GO:0019827)	cytosol (GO:0005829)|extracellular region (GO:0005576)|nucleus (GO:0005634)	growth factor activity (GO:0008083)|heparin binding (GO:0008201)			lung(3)	3	Melanoma(5;1.89e-05)		LUSC - Lung squamous cell carcinoma(11;3.74e-15)|STAD - Stomach adenocarcinoma(18;0.0278)		Pentosan Polysulfate(DB00686)	GGCCGTCGGGGAGCGCCTGGA	0.776													G|||	145	0.0289537	0.0008	0.0548	5008	,	,		8358	0.0		0.0865	False		,,,				2504	0.0194				p.L99L		.											.	FGF4-1270	0			c.C297T						.	G		45,3935		0,45,1945	4.0	4.0	4.0		297	-0.8	1.0	11	dbSNP_120	4	419,7473		7,405,3534	no	coding-synonymous	FGF4	NM_002007.2		7,450,5479	AA,AG,GG		5.3092,1.1307,3.9084		99/207	69589556	464,11408	1990	3946	5936	SO:0001819	synonymous_variant	2249	exon1			GTCGGGGAGCGCC	M17446	CCDS8194.1	11q13.3	2014-01-30	2008-08-01		ENSG00000075388	ENSG00000075388		"""Endogenous ligands"""	3682	protein-coding gene	gene with protein product	"""human stomach cancer, transforming factor from FGF-related oncogene"", ""kaposi sarcoma oncogene"", ""transforming protein KS3"""	164980	"""heparin secretory transforming protein 1"""	HSTF1		1611909	Standard	NM_002007		Approved	K-FGF, HBGF-4, HST, HST-1, KFGF	uc001opg.1	P08620	OTTHUMG00000167887	ENST00000168712.1:c.297C>T	11.37:g.69589556G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_002007	0	0	0	0	0	B7U994	Silent	SNP	ENST00000168712.1	37	CCDS8194.1																																																																																			G|0.967;A|0.033		0.776	FGF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396834.2	NM_002007	
KCTD14	65987	ucsc.edu	37	11	77734209	77734209	+	Silent	SNP	T	T	C	rs11237362	byFrequency	TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr11:77734209T>C	ENST00000353172.5	-	1	131	c.87A>G	c.(85-87)ccA>ccG	p.P29P	RP11-7I15.4_ENST00000526730.1_RNA|NDUFC2-KCTD14_ENST00000528251.1_Intron|KCTD14_ENST00000533144.1_Intron|NDUFC2-KCTD14_ENST00000530054.1_Intron	NM_001203260.1|NM_001203262.1|NM_001282406.1|NM_023930.3	NP_001190189.1|NP_001190191.1|NP_001269335.1|NP_076419.2	Q9BQ13	KCD14_HUMAN	potassium channel tetramerization domain containing 14	29					protein homooligomerization (GO:0051260)					endometrium(2)|kidney(1)|large_intestine(1)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	15	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1e-24)			CACTTACCGTTGGCCGCCTGG	0.692													C|||	3454	0.689696	0.5393	0.8127	5008	,	,		13319	0.5694		0.8002	False		,,,				2504	0.816				p.P29P	NSCLC(86;414 1416 18100 32729 49271)|Esophageal Squamous(156;1132 1858 11406 36132 46748)	.											.	KCTD14-92	0			c.A87G						.	C	,,,	2363,1597		726,911,343	24.0	30.0	28.0		,,,87	1.4	0.0	11	dbSNP_120	28	6715,1469		2770,1175,147	no	intron,intron,intron,coding-synonymous	KCTD14,NDUFC2-KCTD14	NM_001203260.1,NM_001203261.1,NM_001203262.1,NM_023930.3	,,,	3496,2086,490	CC,CT,TT		17.9497,40.3283,25.247	,,,	,,,29/256	77734209	9078,3066	1980	4092	6072	SO:0001819	synonymous_variant	65987	exon1			TACCGTTGGCCGC	BC001062	CCDS8255.2, CCDS60908.1	11q13.4	2013-06-20	2013-06-20		ENSG00000151364	ENSG00000151364			23295	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 14"""			12477932	Standard	NM_023930		Approved	MGC2376	uc001oyw.4	Q9BQ13	OTTHUMG00000150224	ENST00000353172.5:c.87A>G	11.37:g.77734209T>C		Somatic	19	1		WXS	Illumina GAIIx	Phase_I	75	8	NM_023930	0	0	0	0	0	B2R9R8	Silent	SNP	ENST00000353172.5	37	CCDS8255.2																																																																																			T|0.290;C|0.710		0.692	KCTD14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316888.1	NM_023930	
CASP5	838	hgsc.bcm.edu;broad.mit.edu	37	11	104872901	104872901	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr11:104872901G>T	ENST00000260315.3	-	5	570	c.571C>A	c.(571-573)Cgc>Agc	p.R191S	CASP5_ENST00000531367.1_Missense_Mutation_p.R49S|CASP5_ENST00000418434.1_Missense_Mutation_p.R49S|CASP5_ENST00000393141.2_Missense_Mutation_p.R204S|CASP5_ENST00000526056.1_Missense_Mutation_p.R204S|CASP5_ENST00000393139.2_Missense_Mutation_p.P121Q|CASP5_ENST00000444749.2_Missense_Mutation_p.R133S			P51878	CASP5_HUMAN	caspase 5, apoptosis-related cysteine peptidase	191					apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|execution phase of apoptosis (GO:0097194)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of inflammatory response (GO:0050727)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|NLRP1 inflammasome complex (GO:0072558)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(15)|ovary(3)|skin(1)|urinary_tract(1)	35		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000943)|Epithelial(105;0.0104)|all cancers(92;0.042)		AGGCGTCTGCGGTCCTCTCTC	0.463																																					p.R204S		.											.	CASP5-661	0			c.C610A						.						113.0	105.0	108.0					11																	104872901		2202	4299	6501	SO:0001583	missense	838	exon5			GTCTGCGGTCCTC		CCDS8328.2, CCDS44718.1, CCDS44719.1, CCDS44720.1	11q22.2-q22.3	2006-02-17	2005-08-17		ENSG00000137757	ENSG00000137757		"""Caspases"""	1506	protein-coding gene	gene with protein product		602665	"""caspase 5, apoptosis-related cysteine protease"""			7797592, 9250871	Standard	NM_004347		Approved	ICE(rel)III	uc010ruz.1	P51878	OTTHUMG00000048073	ENST00000260315.3:c.571C>A	11.37:g.104872901G>T	ENSP00000260315:p.Arg191Ser	Somatic	100	0		WXS	Illumina GAIIx	Phase_I	80	4	NM_001136112	0	0	0	0	0	B4DKP5|Q0QVY7|Q0QVY8|Q0QVZ0|Q0QVZ1|Q0QVZ2|Q14DD6|Q1HBJ3|Q6DJV7	Missense_Mutation	SNP	ENST00000260315.3	37	CCDS8328.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	10.61|10.61	1.399801|1.399801	0.25291|0.25291	.|.	.|.	ENSG00000137757|ENSG00000137757	ENST00000393139|ENST00000393141;ENST00000418434;ENST00000260315;ENST00000444749;ENST00000526056;ENST00000531367	T|T;T;T;T;T;T	0.38560|0.03301	1.13|3.98;3.98;3.98;3.98;3.98;3.98	4.2|4.2	1.24|1.24	0.21308|0.21308	.|Peptidase C14, caspase precursor p45, core (2);Peptidase C14, ICE, catalytic subunit p20 (1);	.|0.243493	.|0.42172	.|D	.|0.000759	T|T	0.16041|0.16041	0.0386|0.0386	M|M	0.86028|0.86028	2.79|2.79	0.09310|0.09310	N|N	1|1	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0	.|D;D;D;D	.|0.87578	.|0.993;0.997;0.984;0.998	T|T	0.02345|0.02345	-1.1173|-1.1173	7|10	0.72032|0.87932	D|D	0.01|0	.|.	7.8169|7.8169	0.29265|0.29265	0.2904:0.0:0.7096:0.0|0.2904:0.0:0.7096:0.0	.|.	.|49;133;191;204	.|P51878-3;P51878-2;P51878;P51878-5	.|.;.;CASP5_HUMAN;.	Q|S	121|204;49;191;133;204;49	ENSP00000376847:P121Q|ENSP00000376849:R204S;ENSP00000398130:R49S;ENSP00000260315:R191S;ENSP00000388365:R133S;ENSP00000436877:R204S;ENSP00000434471:R49S	ENSP00000376847:P121Q|ENSP00000260315:R191S	P|R	-|-	2|1	0|0	CASP5|CASP5	104378111|104378111	0.182000|0.182000	0.23173|0.23173	0.018000|0.018000	0.16275|0.16275	0.016000|0.016000	0.09150|0.09150	2.234000|2.234000	0.43035|0.43035	0.045000|0.045000	0.15804|0.15804	0.411000|0.411000	0.27672|0.27672	CCG|CGC	.		0.463	CASP5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000109397.2	NM_004347	
ENO2	2026	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	7025042	7025042	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr12:7025042G>A	ENST00000535366.1	+	1	672	c.46G>A	c.(46-48)Ggg>Agg	p.G16R	ENO2_ENST00000229277.1_Missense_Mutation_p.G16R|ENO2_ENST00000545045.2_Missense_Mutation_p.G16R|ENO2_ENST00000538763.1_Missense_Mutation_p.G16R|ENO2_ENST00000541477.1_Missense_Mutation_p.G16R|ENO2_ENST00000544774.1_Missense_Mutation_p.G16R			P09104	ENOG_HUMAN	enolase 2 (gamma, neuronal)	16					carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|perikaryon (GO:0043204)|phosphopyruvate hydratase complex (GO:0000015)|photoreceptor inner segment (GO:0001917)|plasma membrane (GO:0005886)	magnesium ion binding (GO:0000287)|phosphopyruvate hydratase activity (GO:0004634)			endometrium(3)|large_intestine(2)|lung(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10						GGACTCCCGCGGGAACCCCAC	0.572																																					p.G16R		.											.	ENO2-226	0			c.G46A						.						100.0	111.0	107.0					12																	7025042		2203	4300	6503	SO:0001583	missense	2026	exon2			TCCCGCGGGAACC	M22349	CCDS8570.1	12p13	2012-10-02				ENSG00000111674	4.2.1.11		3353	protein-coding gene	gene with protein product		131360					Standard	NM_001975		Approved		uc001qru.1	P09104		ENST00000535366.1:c.46G>A	12.37:g.7025042G>A	ENSP00000437402:p.Gly16Arg	Somatic	69	0		WXS	Illumina GAIIx	Phase_I	126	66	NM_001975	0	0	9	15	6	B7Z2X9|Q96J33	Missense_Mutation	SNP	ENST00000535366.1	37	CCDS8570.1	.	.	.	.	.	.	.	.	.	.	G	36	5.654947	0.96724	.	.	ENSG00000111674	ENST00000537688;ENST00000540580;ENST00000541477;ENST00000229277;ENST00000538763;ENST00000544774;ENST00000539713;ENST00000535366;ENST00000545045;ENST00000544430	T;T;T;T;T;T;T;T;T	0.68765	0.3;0.3;-0.35;-0.35;-0.35;-0.35;0.3;-0.35;0.3	4.84	4.84	0.62591	Enolase, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.87140	0.6103	H	0.94183	3.505	0.80722	D	1	P;D	0.89917	0.951;1.0	P;D	0.91635	0.672;0.999	D	0.91065	0.4888	10	0.87932	D	0	-18.6199	18.3018	0.90165	0.0:0.0:1.0:0.0	.	16;16	B7Z2X9;P09104	.;ENOG_HUMAN	R	16	ENSP00000445788:G16R;ENSP00000443117:G16R;ENSP00000438873:G16R;ENSP00000229277:G16R;ENSP00000441490:G16R;ENSP00000446195:G16R;ENSP00000441740:G16R;ENSP00000437402:G16R;ENSP00000438062:G16R	ENSP00000229277:G16R	G	+	1	0	ENO2	6895303	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.813000	0.99286	2.391000	0.81399	0.561000	0.74099	GGG	.		0.572	ENO2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401786.1		
TAS2R42	353164	bcgsc.ca	37	12	11338970	11338970	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr12:11338970G>T	ENST00000334266.1	-	1	573	c.574C>A	c.(574-576)Ccc>Acc	p.P192T		NM_181429.1	NP_852094.1	Q7RTR8	T2R42_HUMAN	taste receptor, type 2, member 42	192					sensory perception of taste (GO:0050909)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|kidney(2)|lung(4)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11			OV - Ovarian serous cystadenocarcinoma(49;0.0455)			AGAGAAAAGGGGATAAAACTG	0.343																																					p.P192T	Melanoma(15;352 722 10077 19546 48810)	.											.	TAS2R42-69	0			c.C574A						.						45.0	48.0	47.0					12																	11338970		2193	4297	6490	SO:0001583	missense	353164	exon1			AAAAGGGGATAAA	AX097739, AB199241	CCDS31747.1	12p13	2012-08-22			ENSG00000186136	ENSG00000186136		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18888	protein-coding gene	gene with protein product		613966				12679530	Standard	NM_181429		Approved	T2R24, T2R55, hT2R55, TAS2R55	uc001qzr.1	Q7RTR8	OTTHUMG00000168567	ENST00000334266.1:c.574C>A	12.37:g.11338970G>T	ENSP00000334050:p.Pro192Thr	Somatic	42	0		WXS	Illumina GAIIx	Phase_I	55	4	NM_181429	0	0	0	0	0	A2RRP4|Q645X0	Missense_Mutation	SNP	ENST00000334266.1	37	CCDS31747.1	.	.	.	.	.	.	.	.	.	.	G	13.12	2.142080	0.37825	.	.	ENSG00000186136	ENST00000334266	T	0.56103	0.48	3.34	3.34	0.38264	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000002	T	0.76421	0.3985	M	0.93678	3.445	0.09310	N	1	D	0.89917	1.0	D	0.83275	0.996	T	0.68135	-0.5489	10	0.87932	D	0	.	10.3567	0.43969	0.0:0.0:1.0:0.0	.	192	Q7RTR8	T2R42_HUMAN	T	192	ENSP00000334050:P192T	ENSP00000334050:P192T	P	-	1	0	TAS2R42	11230237	0.191000	0.23288	0.008000	0.14137	0.001000	0.01503	2.742000	0.47434	1.911000	0.55334	0.462000	0.41574	CCC	.		0.343	TAS2R42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400243.1	NM_181429	
MGST1	4257	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	16516930	16516933	+	Frame_Shift_Del	DEL	TCTT	TCTT	-			TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	TCTT	TCTT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr12:16516930_16516933delTCTT	ENST00000396209.1	+	4	566_569	c.423_426delTCTT	c.(421-426)actcttfs	p.TL141fs	MGST1_ENST00000396207.1_Frame_Shift_Del_p.TL141fs|MGST1_ENST00000396210.3_Frame_Shift_Del_p.TL141fs|MGST1_ENST00000010404.2_Frame_Shift_Del_p.TL141fs|MGST1_ENST00000535309.1_Intron|MGST1_ENST00000540056.1_3'UTR	NM_145791.2	NP_665734.1	P10620	MGST1_HUMAN	microsomal glutathione S-transferase 1	141					cellular response to lipid hydroperoxide (GO:0071449)|glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|Leydig cell differentiation (GO:0033327)|oxidation-reduction process (GO:0055114)|protein homotrimerization (GO:0070207)|response to drug (GO:0042493)|response to lipopolysaccharide (GO:0032496)|response to organonitrogen compound (GO:0010243)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	apical part of cell (GO:0045177)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)	glutathione binding (GO:0043295)|glutathione peroxidase activity (GO:0004602)|glutathione transferase activity (GO:0004364)			endometrium(2)|large_intestine(2)|lung(4)|ovary(1)	9		Hepatocellular(102;0.121)			Glutathione(DB00143)	ATGGAGTTACTCTTTCCATGGCTT	0.392																																					p.141_142del		.											.	MGST1-90	0			c.423_426del						.																																			SO:0001589	frameshift_variant	4257	exon4			AGTTACTCTTTCC	U46494	CCDS8677.1, CCDS58209.1	12p12.3-p12.1	2012-06-21			ENSG00000008394	ENSG00000008394	2.5.1.18	"""Glutathione S-transferases / Microsomal"""	7061	protein-coding gene	gene with protein product		138330		GST12			Standard	NM_145792		Approved	MGST-I	uc031qgl.1	P10620	OTTHUMG00000168816	ENST00000396209.1:c.423_426delTCTT	12.37:g.16516930_16516933delTCTT	ENSP00000379512:p.Thr141fs	Somatic	108	0		WXS	Illumina GAIIx	Phase_I	166	58	NM_020300	0	0	0	0	0	A8K533|G5EA53	Frame_Shift_Del	DEL	ENST00000396209.1	37	CCDS8677.1																																																																																			.		0.392	MGST1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401189.1	NM_145791	
LHX5	64211	hgsc.bcm.edu	37	12	113901232	113901232	+	Silent	SNP	T	T	C	rs202131487	byFrequency	TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr12:113901232T>C	ENST00000261731.3	-	5	1545	c.972A>G	c.(970-972)ggA>ggG	p.G324G		NM_022363.2	NP_071758.1	Q9H2C1	LHX5_HUMAN	LIM homeobox 5	324					cell proliferation in forebrain (GO:0021846)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellar Purkinje cell-granule cell precursor cell signaling involved in regulation of granule cell precursor cell proliferation (GO:0021937)|forebrain neuron differentiation (GO:0021879)|hippocampus development (GO:0021766)|positive regulation of transcription, DNA-templated (GO:0045893)|spinal cord association neuron differentiation (GO:0021527)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(1)|endometrium(2)|large_intestine(1)|lung(4)|prostate(1)|skin(1)	10						GTTCCAGCGCTCCCAGCGGCG	0.736													G|||	18	0.00359425	0.0008	0.0029	5008	,	,		9203	0.001		0.0099	False		,,,				2504	0.0041				p.G324G		.											.	LHX5-90	0			c.A972G						.	G		3,4059		0,3,2028	7.0	10.0	9.0		972	-1.0	1.0	12		9	56,7872		0,56,3908	no	coding-synonymous	LHX5	NM_022363.2		0,59,5936	CC,CT,TT		0.7064,0.0739,0.4921		324/403	113901232	59,11931	2031	3964	5995	SO:0001819	synonymous_variant	64211	exon5			CAGCGCTCCCAGC	AF291181	CCDS9171.1	12q24.13	2014-01-15			ENSG00000089116	ENSG00000089116		"""Homeoboxes / LIM class"""	14216	protein-coding gene	gene with protein product		605992					Standard	NM_022363		Approved		uc001tvj.1	Q9H2C1	OTTHUMG00000169552	ENST00000261731.3:c.972A>G	12.37:g.113901232T>C		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	14	7	NM_022363	0	0	0	0	0	Q32MA4	Silent	SNP	ENST00000261731.3	37	CCDS9171.1																																																																																			.		0.736	LHX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404788.3	NM_022363	
FBRSL1	57666	hgsc.bcm.edu	37	12	133159733	133159733	+	Missense_Mutation	SNP	C	C	T	rs11550079	byFrequency	TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr12:133159733C>T	ENST00000434748.2	+	17	3527	c.2507C>T	c.(2506-2508)gCc>gTc	p.A836V	FBRSL1_ENST00000261673.6_Missense_Mutation_p.A763V	NM_001142641.1	NP_001136113.1	Q9HCM7	FBSL_HUMAN	fibrosin-like 1	836				A -> V (in Ref. 3; BAB13371). {ECO:0000305}.			poly(A) RNA binding (GO:0044822)			central_nervous_system(2)|endometrium(1)|stomach(1)	4						AAGGAGGAGGCCGCCAAGATG	0.761													C|||	2725	0.544129	0.4939	0.6225	5008	,	,		5355	0.7113		0.4026	False		,,,				2504	0.5297				p.A836V		.											.	FBRSL1-70	0			c.C2507T						.						2.0	6.0	5.0					12																	133159733		475	1282	1757	SO:0001583	missense	57666	exon17			AGGAGGCCGCCAA		CCDS45010.1	12q24.33	2008-12-09			ENSG00000112787	ENSG00000112787			29308	protein-coding gene	gene with protein product						10997877	Standard	NM_001142641		Approved	KIAA1545	uc001ukf.3	Q9HCM7	OTTHUMG00000167991	ENST00000434748.2:c.2507C>T	12.37:g.133159733C>T	ENSP00000396160:p.Ala836Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	9	NM_001142641	0	0	0	1	1	Q86XQ1	Missense_Mutation	SNP	ENST00000434748.2	37	CCDS45010.1	1159	0.5306776556776557	248	0.5040650406504065	211	0.5828729281767956	393	0.6870629370629371	307	0.4050131926121372	c	9.709	1.156573	0.21454	.	.	ENSG00000112787	ENST00000434748;ENST00000261673	T;T	0.31769	1.48;1.49	3.17	-0.242	0.13039	.	0.664906	0.15256	U	0.272063	T	0.00012	0.0000	N	0.14661	0.345	0.80722	P	0.0	P	0.44627	0.839	B	0.40134	0.32	T	0.26677	-1.0096	9	0.45353	T	0.12	-3.3224	5.7681	0.18237	0.1838:0.5714:0.2447:0.0	rs11550079	836	Q9HCM7	FBSL_HUMAN	V	836;763	ENSP00000396160:A836V;ENSP00000261673:A763V	ENSP00000261673:A763V	A	+	2	0	FBRSL1	131669806	0.317000	0.24589	0.004000	0.12327	0.011000	0.07611	0.750000	0.26334	0.431000	0.26258	-0.720000	0.03607	GCC	C|0.470;T|0.530		0.761	FBRSL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397404.2		
FRY	10129	broad.mit.edu	37	13	32783790	32783790	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr13:32783790G>T	ENST00000380250.3	+	33	4840	c.4344G>T	c.(4342-4344)tgG>tgT	p.W1448C		NM_023037.2	NP_075463.2	Q5TBA9	FRY_HUMAN	furry homolog (Drosophila)	1448						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(3)|breast(4)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(31)|lung(50)|ovary(5)|pancreas(1)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	132		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		ATGAGAAATGGAGCAACAACC	0.463																																					p.W1448C		.											.	FRY-142	0			c.G4344T						.						163.0	163.0	163.0					13																	32783790		1970	4157	6127	SO:0001583	missense	10129	exon33			GAAATGGAGCAAC	AL049784	CCDS41875.1	13q13.1	2008-02-05	2005-11-24	2005-11-24	ENSG00000073910	ENSG00000073910			20367	protein-coding gene	gene with protein product		614818	"""chromosome 13 open reading frame 14"""	C13orf14		14702039, 8812419	Standard	NM_023037		Approved	bA37E23.1, 13CDNA73, CG003	uc001utx.3	Q5TBA9	OTTHUMG00000016696	ENST00000380250.3:c.4344G>T	13.37:g.32783790G>T	ENSP00000369600:p.Trp1448Cys	Somatic	133	0		WXS	Illumina GAIIx	Phase_I	123	4	NM_023037	0	0	0	0	0	Q9Y3N6	Missense_Mutation	SNP	ENST00000380250.3	37	CCDS41875.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.524574	0.85600	.	.	ENSG00000073910	ENST00000380250;ENST00000380257	T	0.35973	1.28	5.48	5.48	0.80851	.	0.060507	0.64402	D	0.000001	T	0.64170	0.2574	M	0.78456	2.415	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.67325	-0.5699	10	0.72032	D	0.01	.	19.3545	0.94407	0.0:0.0:1.0:0.0	.	1448	Q5TBA9	FRY_HUMAN	C	1448;285	ENSP00000369600:W1448C	ENSP00000369600:W1448C	W	+	3	0	FRY	31681790	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	9.796000	0.99103	2.592000	0.87571	0.561000	0.74099	TGG	.		0.463	FRY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044405.1	NM_023037	
UPF3A	65110	broad.mit.edu	37	13	115047559	115047559	+	Silent	SNP	C	C	T			TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr13:115047559C>T	ENST00000375299.3	+	2	327	c.271C>T	c.(271-273)Ctg>Ttg	p.L91L	UPF3A_ENST00000351487.5_Silent_p.L91L	NM_023011.3	NP_075387.1	Q9H1J1	REN3A_HUMAN	UPF3 regulator of nonsense transcripts homolog A (yeast)	91	Required for interaction with UPF2.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA transport (GO:0051028)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nucleocytoplasmic transport (GO:0006913)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.L91L(8)		autonomic_ganglia(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	16	Lung NSC(43;0.00299)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0191)|all_epithelial(44;0.00716)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.238)	BRCA - Breast invasive adenocarcinoma(86;0.0886)	OV - Ovarian serous cystadenocarcinoma(48;0.195)|Epithelial(10;0.2)		GCTGCGCCCGCTGCCAGCACA	0.731																																					p.L91L		.											.	UPF3A-91	8	Substitution - coding silent(8)	lung(2)|prostate(2)|kidney(2)|central_nervous_system(2)	c.C271T						.						4.0	4.0	4.0					13																	115047559		1902	3804	5706	SO:0001819	synonymous_variant	65110	exon2			CGCCCGCTGCCAG	AF318575	CCDS9543.1, CCDS9544.1	13q34	2010-04-30			ENSG00000169062	ENSG00000169062			20332	protein-coding gene	gene with protein product		605530				11113196, 11163187	Standard	NM_023011		Approved	RENT3A, UPF3, HUPF3A	uc001vup.3	Q9H1J1	OTTHUMG00000017403	ENST00000375299.3:c.271C>T	13.37:g.115047559C>T		Somatic	20	0		WXS	Illumina GAIIx	Phase_I	68	4	NM_080687	0	0	10	10	0	A2A366|Q5T8C3|Q5T8C9|Q7Z6N3|Q86YK1|Q9BZI8	Silent	SNP	ENST00000375299.3	37	CCDS9543.1																																																																																			.		0.731	UPF3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045968.2		
DHRS4L1	728635	broad.mit.edu	37	14	24513024	24513024	+	RNA	DEL	G	G	-	rs139161824		TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr14:24513024delG	ENST00000558293.1	+	0	437					NR_102693.1																						gaaaagaaaagagggttgttt	0.488																																					p.R122fs		.											.	.	0			c.365delG						.			139,2095		20,99,998	81.0	87.0	85.0			0.2	0.0	14	dbSNP_134	85	292,4386		19,254,2066	no	frameshift	DHRS4L1	NM_001082488.1		39,353,3064	A1A1,A1R,RR		6.242,6.222,6.2355			24513024	431,6481	936	2076	3012			728635	exon4			AGAAAAGAGGGTT																													14.37:g.24513024delG		Somatic	8	0		WXS	Illumina GAIIx	Phase_I	9	3	NM_001082488	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000558293.1	37																																																																																				.		0.488	RP11-468E2.9-005	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000417272.1		
GPHN	10243	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	67578631	67578631	+	Silent	SNP	T	T	C			TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr14:67578631T>C	ENST00000315266.5	+	14	2489	c.1368T>C	c.(1366-1368)gaT>gaC	p.D456D	GPHN_ENST00000543237.1_Silent_p.D502D|GPHN_ENST00000478722.1_Silent_p.D489D|GPHN_ENST00000544752.2_3'UTR|GPHN_ENST00000305960.9_Silent_p.D425D	NM_001024218.1	NP_001019389.1	Q9NQX3	GEPH_HUMAN	gephyrin	456	MPT adenylyltransferase.				establishment of synaptic specificity at neuromuscular junction (GO:0007529)|glycine receptor clustering (GO:0072579)|Mo-molybdopterin cofactor biosynthetic process (GO:0006777)|molybdopterin cofactor biosynthetic process (GO:0032324)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|inhibitory synapse (GO:0060077)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|molybdopterin adenylyltransferase activity (GO:0061598)|molybdopterin molybdotransferase activity (GO:0061599)|transferase activity (GO:0016740)			large_intestine(8)|liver(1)|ovary(2)|stomach(1)	12		all_cancers(7;0.0476)|all_hematologic(31;0.0116)		Epithelial(1;1.73e-08)|all cancers(60;3.15e-07)|OV - Ovarian serous cystadenocarcinoma(108;0.000275)|BRCA - Breast invasive adenocarcinoma(234;0.00323)|Colorectal(3;0.0938)|KIRC - Kidney renal clear cell carcinoma(182;0.184)		CAGGCCAAGATATCAGGTAAC	0.408			T	MLL	AL																																p.D489D		.		Dom	yes		14	14q24	10243	gephyrin (GPH)		L	.	GPHN-228	0			c.T1467C						.						78.0	84.0	82.0					14																	67578631		2203	4300	6503	SO:0001819	synonymous_variant	10243	exon15			CCAAGATATCAGG	AB037806	CCDS9777.1, CCDS32103.1	14q23.3	2008-04-22			ENSG00000171723	ENSG00000171723			15465	protein-coding gene	gene with protein product		603930				1319186, 10325225, 18403029	Standard	XM_005267250		Approved	KIAA1385	uc001xix.3	Q9NQX3	OTTHUMG00000029785	ENST00000315266.5:c.1368T>C	14.37:g.67578631T>C		Somatic	154	0		WXS	Illumina GAIIx	Phase_I	150	118	NM_020806	0	0	0	0	0	Q9H4E9|Q9P2G2	Silent	SNP	ENST00000315266.5	37	CCDS32103.1																																																																																			.		0.408	GPHN-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000074299.2	NM_020806	
IRF2BPL	64207	broad.mit.edu	37	14	77493762	77493767	+	In_Frame_Del	DEL	TGCTGC	TGCTGC	-	rs553703325|rs556445214|rs200317113	byFrequency	TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr14:77493762_77493767delTGCTGC	ENST00000238647.3	-	1	1267_1272	c.369_374delGCAGCA	c.(367-375)cagcagcaa>caa	p.123_125QQQ>Q		NM_024496.3	NP_078772.1	Q9H1B7	I2BPL_HUMAN	interferon regulatory factor 2 binding protein-like	123	Poly-Gln.				development of secondary female sexual characteristics (GO:0046543)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	extracellular space (GO:0005615)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	11						GAgctgttgttgctgctgctgctgct	0.714														4658	0.930112	0.9297	0.9769	5008	,	,		7189	0.872		0.9712	False		,,,				2504	0.9151				p.123_125del		.											.	IRF2BPL-90	0			c.369_374del						.																																			SO:0001651	inframe_deletion	64207	exon1			TGTTGTTGCTGCT	AJ277365	CCDS9854.1	14q24.3	2011-02-23	2011-02-23	2011-02-23	ENSG00000119669	ENSG00000119669			14282	protein-coding gene	gene with protein product	"""enhanced at puberty 1"""	611720	"""chromosome 14 open reading frame 4"""	C14orf4		11095982, 17627301	Standard	NM_024496		Approved	EAP1, KIAA1865	uc001xsy.4	Q9H1B7		ENST00000238647.3:c.369_374delGCAGCA	14.37:g.77493768_77493773delTGCTGC	ENSP00000238647:p.Gln125_Gln126del	Somatic	9	0		WXS	Illumina GAIIx	Phase_I	11	6	NM_024496	0	0	0	0	0	Q8NDQ2|Q96JG2|Q9H3I7	In_Frame_Del	DEL	ENST00000238647.3	37	CCDS9854.1																																																																																			CTG|1.000;|0.000		0.714	IRF2BPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414298.1	NM_024496	
EXOC3L4	91828	hgsc.bcm.edu	37	14	103568729	103568729	+	Silent	SNP	A	A	G	rs10142200	byFrequency	TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr14:103568729A>G	ENST00000380069.3	+	2	745	c.669A>G	c.(667-669)gaA>gaG	p.E223E		NM_001077594.1	NP_001071062.1	Q17RC7	EX3L4_HUMAN	exocyst complex component 3-like 4	223					exocytosis (GO:0006887)	exocyst (GO:0000145)				cervix(2)|endometrium(2)|lung(4)|ovary(1)|skin(1)	10						CGGAGGAGGAAGCCCACCCTT	0.756													G|||	2646	0.528355	0.5666	0.5303	5008	,	,		12079	0.6042		0.3917	False		,,,				2504	0.5378				p.E223E		.											.	EXOC3L4-23	0			c.A669G						.	G		2098,2000		603,892,554	5.0	5.0	5.0		669	2.5	0.8	14	dbSNP_119	5	2949,5055		663,1623,1716	no	coding-synonymous	EXOC3L4	NM_001077594.1		1266,2515,2270	GG,GA,AA		36.8441,48.8043,41.7039		223/723	103568729	5047,7055	2049	4002	6051	SO:0001819	synonymous_variant	91828	exon2			GGAGGAAGCCCAC	AK000671	CCDS32163.1	14q32.32	2011-01-31	2011-01-31	2011-01-31	ENSG00000205436	ENSG00000205436			20120	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 73"""	C14orf73			Standard	NM_001077594		Approved		uc001ymk.3	Q17RC7		ENST00000380069.3:c.669A>G	14.37:g.103568729A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	4	NM_001077594	0	0	0	0	0	Q14CR2	Silent	SNP	ENST00000380069.3	37	CCDS32163.1																																																																																			A|0.486;G|0.514		0.756	EXOC3L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415663.1	XM_941093	
EMC7	56851	broad.mit.edu	37	15	34388183	34388183	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr15:34388183G>T	ENST00000256545.4	-	2	377	c.269C>A	c.(268-270)cCt>cAt	p.P90H		NM_020154.2	NP_064539.1	Q9NPA0	EMC7_HUMAN	ER membrane protein complex subunit 7	90						ER membrane protein complex (GO:0072546)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)										AGATCCAGAAGGTATATCATG	0.398																																					p.P90H		.											.	.	0			c.C269A						.						127.0	117.0	121.0					15																	34388183		2201	4298	6499	SO:0001583	missense	56851	exon2			CCAGAAGGTATAT	AJ245874	CCDS10032.1	15q14	2012-05-30	2012-05-30	2012-05-30	ENSG00000134153	ENSG00000134153			24301	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 24"""	C15orf24		10873569, 22119785	Standard	NM_020154		Approved	C11orf3	uc001zhm.3	Q9NPA0	OTTHUMG00000129367	ENST00000256545.4:c.269C>A	15.37:g.34388183G>T	ENSP00000256545:p.Pro90His	Somatic	100	1		WXS	Illumina GAIIx	Phase_I	80	4	NM_020154	0	0	25	25	0	B2RC00|Q96ED5	Missense_Mutation	SNP	ENST00000256545.4	37	CCDS10032.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.9|24.9	4.584794|4.584794	0.86748|0.86748	.|.	.|.	ENSG00000134153|ENSG00000134153	ENST00000528949|ENST00000256545	.|.	.|.	.|.	5.29|5.29	5.29|5.29	0.74685|0.74685	.|Carbohydrate-binding-like fold (1);Domain of unknown function DUF2012 (1);Carboxypeptidase, regulatory domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.84170|0.84170	0.5413|0.5413	M|M	0.87971|0.87971	2.92|2.92	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.77004	.|0.989	D|D	0.86601|0.86601	0.1866|0.1866	5|9	.|0.87932	.|D	.|0	-12.4778|-12.4778	17.3004|17.3004	0.87181|0.87181	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|90	.|Q9NPA0	.|CO024_HUMAN	I|H	26|90	.|.	.|ENSP00000256545:P90H	L|P	-|-	1|2	0|0	C15orf24|C15orf24	32175475|32175475	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.893000|0.893000	0.52053|0.52053	9.483000|9.483000	0.97937|0.97937	2.753000|2.753000	0.94483|0.94483	0.557000|0.557000	0.71058|0.71058	CTT|CCT	.		0.398	EMC7-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000251519.1	NM_020154	
LACTB	114294	hgsc.bcm.edu	37	15	63414119	63414119	+	Missense_Mutation	SNP	G	G	A	rs139879323	byFrequency	TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr15:63414119G>A	ENST00000261893.4	+	1	121	c.49G>A	c.(49-51)Ggc>Agc	p.G17S	LACTB_ENST00000413507.2_Missense_Mutation_p.G17S	NM_032857.3	NP_116246.2	P83111	LACTB_HUMAN	lactamase, beta	17						cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	hydrolase activity (GO:0016787)			NS(1)|breast(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)|stomach(1)	12						CGCCCCCGGGGGCTTGGCCTC	0.746													G|||	96	0.0191693	0.0038	0.0187	5008	,	,		8061	0.0		0.0447	False		,,,				2504	0.0337				p.G17S	Melanoma(85;443 1381 6215 27308 35583)	.											.	LACTB-90	0			c.G49A						.	G	SER/GLY,SER/GLY	19,2777		0,19,1379	4.0	5.0	4.0		49,49	1.1	0.6	15	dbSNP_134	4	167,5917		2,163,2877	no	missense,missense	LACTB	NM_032857.3,NM_171846.2	56,56	2,182,4256	AA,AG,GG		2.7449,0.6795,2.0946	possibly-damaging,possibly-damaging	17/548,17/374	63414119	186,8694	1398	3042	4440	SO:0001583	missense	114294	exon1			CCCGGGGGCTTGG	AK027808	CCDS10182.1, CCDS45275.1	15q22.1	2012-11-14	2001-12-12	2001-12-14	ENSG00000103642	ENSG00000103642		"""Mitochondrial ribosomal proteins / large subunits"""	16468	protein-coding gene	gene with protein product		608440	"""mitochondrial ribosomal protein L56"""	MRPL56		11707067	Standard	NM_032857		Approved	FLJ14902	uc002alw.3	P83111	OTTHUMG00000132807	ENST00000261893.4:c.49G>A	15.37:g.63414119G>A	ENSP00000261893:p.Gly17Ser	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_171846	0	0	0	3	3	P83096	Missense_Mutation	SNP	ENST00000261893.4	37	CCDS10182.1	47	0.02152014652014652	1	0.0020325203252032522	10	0.027624309392265192	0	0.0	36	0.047493403693931395	G	16.85	3.237203	0.58886	0.006795	0.027449	ENSG00000103642	ENST00000261893;ENST00000413507	T	0.43688	0.94	3.11	1.14	0.20703	.	0.937832	0.08808	N	0.890780	T	0.04724	0.0128	N	0.24115	0.695	0.21220	N	0.99976	B	0.06786	0.001	B	0.04013	0.001	T	0.14227	-1.0480	10	0.52906	T	0.07	-2.3138	5.8616	0.18752	0.2671:0.0:0.7329:0.0	.	17	P83111	LACTB_HUMAN	S	17	ENSP00000261893:G17S	ENSP00000261893:G17S	G	+	1	0	LACTB	61201172	0.001000	0.12720	0.601000	0.28877	0.352000	0.29268	-0.127000	0.10547	0.161000	0.19458	-0.671000	0.03813	GGC	G|0.979;A|0.021		0.746	LACTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256224.1	NM_032857	
KBTBD13	390594	hgsc.bcm.edu	37	15	65369395	65369395	+	Missense_Mutation	SNP	C	C	T	rs2919358	byFrequency	TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr15:65369395C>T	ENST00000432196.2	+	1	242	c.242C>T	c.(241-243)gCc>gTc	p.A81V	RASL12_ENST00000434605.2_5'Flank	NM_001101362.2	NP_001094832.1	C9JR72	KBTBD_HUMAN	kelch repeat and BTB (POZ) domain containing 13	81					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				lung(1)|prostate(1)|skin(1)	3						CTGCTGCAGGCCGTGGAGTGC	0.736													C|||	2613	0.521765	0.6036	0.5447	5008	,	,		9840	0.7312		0.3887	False		,,,				2504	0.316				p.A81V		.											.	.	0			c.C242T						.	C	VAL/ALA	1463,1441		405,653,394	2.0	3.0	2.0		242	4.6	1.0	15	dbSNP_101	2	2172,4110		500,1172,1469	no	missense	KBTBD13	NM_001101362.2	64	905,1825,1863	TT,TC,CC		34.575,49.6212,39.5711	possibly-damaging	81/459	65369395	3635,5551	1452	3141	4593	SO:0001583	missense	390594	exon1			TGCAGGCCGTGGA		CCDS45281.1	15q22.31	2014-09-17			ENSG00000234438	ENSG00000234438		"""BTB/POZ domain containing"""	37227	protein-coding gene	gene with protein product	"""nemaline myopathy type 6"""	613727				21109227, 22542517	Standard	NM_001101362		Approved	hCG_1645727, NEM6	uc010uis.2	C9JR72		ENST00000432196.2:c.242C>T	15.37:g.65369395C>T	ENSP00000388723:p.Ala81Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	6	NM_001101362	0	0	0	0	0		Missense_Mutation	SNP	ENST00000432196.2	37	CCDS45281.1	1197	0.5480769230769231	302	0.6138211382113821	191	0.5276243093922652	410	0.7167832167832168	294	0.38786279683377306	C	20.9	4.061996	0.76187	0.503788	0.34575	ENSG00000234438	ENST00000432196	T	0.67865	-0.29	4.6	4.6	0.57074	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (2);	.	.	.	.	T	0.00012	0.0000	N	0.21324	0.655	0.22629	P	0.99891774	P	0.47034	0.889	P	0.50896	0.653	T	0.37753	-0.9692	8	0.26408	T	0.33	.	17.2241	0.86964	0.0:1.0:0.0:0.0	rs2919358	81	C9JR72	KBTBD_HUMAN	V	81	ENSP00000388723:A81V	ENSP00000388723:A81V	A	+	2	0	KBTBD13	63156448	1.000000	0.71417	0.996000	0.52242	0.931000	0.56810	7.251000	0.78297	2.390000	0.81377	0.650000	0.86243	GCC	C|0.452;T|0.548		0.736	KBTBD13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418468.2	NM_001101362	
ZNF598	90850	hgsc.bcm.edu	37	16	2059674	2059674	+	Missense_Mutation	SNP	T	T	C	rs71384660		TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr16:2059674T>C	ENST00000431526.1	-	2	88	c.74A>G	c.(73-75)gAa>gGa	p.E25G	ZNF598_ENST00000562103.1_5'UTR|ZNF598_ENST00000563630.1_5'UTR	NM_178167.2	NP_835461.2	Q86UK7	ZN598_HUMAN	zinc finger protein 598	25							poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|lung(7)|skin(1)|urinary_tract(1)	16						GCTCCCGCCTTCCCGCTCAGG	0.766													C|||	5008	1.0	1.0	1.0	5008	,	,		5162	1.0		1.0	False		,,,				2504	1.0				p.E25G		.											.	ZNF598-432	0			c.A74G						.						1.0	2.0	2.0					16																	2059674		1089	2314	3403	SO:0001583	missense	90850	exon2			CCGCCTTCCCGCT	BC029270		16p13.3	2008-05-02				ENSG00000167962		"""Zinc fingers, C2H2-type"""	28079	protein-coding gene	gene with protein product							Standard	NM_178167		Approved	FLJ00086	uc002cof.2	Q86UK7		ENST00000431526.1:c.74A>G	16.37:g.2059674T>C	ENSP00000411409:p.Glu25Gly	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	9	NM_178167	0	0	0	1	1	Q8IW49|Q8N3D9|Q96FG3|Q9H7J3	Missense_Mutation	SNP	ENST00000431526.1	37		2168	0.9926739926739927	487	0.9898373983739838	361	0.9972375690607734	568	0.993006993006993	752	0.9920844327176781	N	1.560	-0.537056	0.04082	.	.	ENSG00000167962	ENST00000431526	T	0.77098	-1.07	3.3	3.3	0.37823	.	0.415485	0.23105	N	0.051871	T	0.00012	0.0000	.	.	.	0.48696	P	3.1000000000003247E-4	.	.	.	.	.	.	T	0.34650	-0.9820	6	0.22706	T	0.39	-7.8624	8.393	0.32540	0.0:0.8796:0.0:0.1204	.	.	.	.	G	25	ENSP00000411409:E25G	ENSP00000411409:E25G	E	-	2	0	ZNF598	1999675	1.000000	0.71417	1.000000	0.80357	0.107000	0.19398	0.911000	0.28584	0.691000	0.31592	-0.642000	0.03964	GAA	T|0.007;C|0.993		0.766	ZNF598-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_178167	
PKD1	5310	broad.mit.edu	37	16	2154573	2154573	+	Missense_Mutation	SNP	A	A	C	rs201238819		TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr16:2154573A>C	ENST00000262304.4	-	22	8295	c.8087T>G	c.(8086-8088)cTc>cGc	p.L2696R	PKD1_ENST00000561991.1_5'UTR|PKD1_ENST00000423118.1_Missense_Mutation_p.L2696R	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	2696	REJ. {ECO:0000255|PROSITE- ProRule:PRU00511}.		L -> R (in PKD1). {ECO:0000269|PubMed:11316854}.		anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)	p.L2696R(3)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						CTGCAGGATGAGCATCATGGC	0.677																																					p.L2696R		.											.	PKD1-91	3	Substitution - Missense(3)	skin(2)|endometrium(1)	c.T8087G	GRCh37	CM014074	PKD1	M		.						16.0	12.0	13.0					16																	2154573		2107	4184	6291	SO:0001583	missense	5310	exon22			AGGATGAGCATCA	L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.8087T>G	16.37:g.2154573A>C	ENSP00000262304:p.Leu2696Arg	Somatic	87	1		WXS	Illumina GAIIx	Phase_I	244	6	NM_000296	0	0	4	15	11	Q15140|Q15141	Missense_Mutation	SNP	ENST00000262304.4	37	CCDS32369.1	.	.	.	.	.	.	.	.	.	.	-	0.355	-0.942715	0.02322	.	.	ENSG00000008710	ENST00000262304;ENST00000423118;ENST00000306101;ENST00000382481	T;T	0.32988	1.43;1.43	4.37	-1.71	0.08133	Egg jelly receptor, REJ-like (1);Polycystin cation channel (1);	0.646468	0.16090	N	0.230081	T	0.05181	0.0138	N	0.00347	-1.61	0.20873	N	0.99984	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.35500	-0.9786	10	0.12430	T	0.62	.	2.3268	0.04224	0.102:0.2587:0.2052:0.4341	.	2696;2696	P98161-3;P98161	.;PKD1_HUMAN	R	2696;2696;2031;975	ENSP00000262304:L2696R;ENSP00000399501:L2696R	ENSP00000262304:L2696R	L	-	2	0	PKD1	2094574	0.916000	0.31088	0.097000	0.21041	0.126000	0.20510	0.857000	0.27831	-0.349000	0.08274	-0.335000	0.08231	CTC	.		0.677	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341688.1		
PKD1	5310	hgsc.bcm.edu	37	16	2156447	2156447	+	Silent	SNP	G	G	A	rs2003782	byFrequency	TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr16:2156447G>A	ENST00000262304.4	-	18	7649	c.7441C>T	c.(7441-7443)Ctg>Ttg	p.L2481L	PKD1_ENST00000561991.1_5'Flank|PKD1_ENST00000423118.1_Silent_p.L2481L	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	2481	REJ. {ECO:0000255|PROSITE- ProRule:PRU00511}.				anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						ACAGCGCCCAGTGGGAAGAGG	0.716													a|||	1082	0.216054	0.5439	0.1715	5008	,	,		15215	0.0		0.159	False		,,,				2504	0.0859				p.L2481L		.											.	PKD1-91	0			c.C7441T						.		,	1033,1813		192,649,582	3.0	4.0	4.0		7441,7441	0.4	0.0	16	dbSNP_92	4	861,5451		64,733,2359	no	coding-synonymous,coding-synonymous	PKD1	NM_000296.3,NM_001009944.2	,	256,1382,2941	AA,AG,GG		13.6407,36.2966,20.6814	,	2481/4303,2481/4304	2156447	1894,7264	1423	3156	4579	SO:0001819	synonymous_variant	5310	exon18			CGCCCAGTGGGAA	L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.7441C>T	16.37:g.2156447G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	31	19	NM_000296	0	0	8	8	0	Q15140|Q15141	Silent	SNP	ENST00000262304.4	37	CCDS32369.1																																																																																			G|0.793;A|0.207		0.716	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341688.1		
CCP110	9738	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	19547801	19547801	+	Frame_Shift_Del	DEL	G	G	-			TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr16:19547801delG	ENST00000381396.5	+	4	1057	c.810delG	c.(808-810)gtgfs	p.V270fs	CCP110_ENST00000396208.2_Frame_Shift_Del_p.V270fs|CCP110_ENST00000396212.2_Frame_Shift_Del_p.V270fs	NM_001199022.1	NP_001185951	O43303	CP110_HUMAN	centriolar coiled coil protein 110kDa	270					cell projection organization (GO:0030030)|centriole replication (GO:0007099)|centrosome duplication (GO:0051298)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of cytokinesis (GO:0032465)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|protein complex (GO:0043234)				breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(8)|stomach(3)|urinary_tract(1)	21						CTGTTGAAGTGGCTGACTGTG	0.378																																					p.V270fs		.											.	CCP110-90	0			c.810delG						.						70.0	68.0	69.0					16																	19547801		2197	4300	6497	SO:0001589	frameshift_variant	9738	exon4			TGAAGTGGCTGAC	AB007879	CCDS10579.1, CCDS55992.1	16p12.3	2014-02-20	2011-05-27		ENSG00000103540	ENSG00000103540			24342	protein-coding gene	gene with protein product		609544				9455477, 12361598, 16760425	Standard	NM_014711		Approved	KIAA0419, CP110	uc002dgl.4	O43303	OTTHUMG00000131459	ENST00000381396.5:c.810delG	16.37:g.19547801delG	ENSP00000370803:p.Val270fs	Somatic	108	0		WXS	Illumina GAIIx	Phase_I	178	75	NM_001199022	0	0	0	0	0	B7WP23|O43335|Q68DV9|Q8NE13	Frame_Shift_Del	DEL	ENST00000381396.5	37	CCDS55992.1																																																																																			.		0.378	CCP110-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254284.2	NM_014711	
HIRIP3	8479	broad.mit.edu	37	16	30005028	30005028	+	Silent	SNP	G	G	T			TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr16:30005028G>T	ENST00000279392.3	-	5	2171	c.1341C>A	c.(1339-1341)ggC>ggA	p.G447G	INO80E_ENST00000304516.7_5'Flank|INO80E_ENST00000567705.1_5'Flank|INO80E_ENST00000563197.1_5'Flank|HIRIP3_ENST00000566471.1_5'Flank|HIRIP3_ENST00000564026.1_Missense_Mutation_p.L135I|INO80E_ENST00000567254.1_5'Flank	NM_003609.4	NP_003600.2	Q9BW71	HIRP3_HUMAN	HIRA interacting protein 3	447					chromatin assembly or disassembly (GO:0006333)	nucleus (GO:0005634)				central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|liver(1)|lung(9)	17						AGCAACAGGAGCCCAACAGCT	0.632																																					p.L135I		.											.	HIRIP3-90	0			c.C403A						.						55.0	58.0	57.0					16																	30005028		2197	4300	6497	SO:0001819	synonymous_variant	8479	exon4			ACAGGAGCCCAAC	AJ223351	CCDS10664.1, CCDS58449.1	16p12.1	2008-02-05	2001-11-29		ENSG00000149929	ENSG00000149929			4917	protein-coding gene	gene with protein product		603365	"""HIRA-interacting protein 3"""			9710638	Standard	NM_003609		Approved		uc002dve.3	Q9BW71	OTTHUMG00000132118	ENST00000279392.3:c.1341C>A	16.37:g.30005028G>T		Somatic	24	0		WXS	Illumina GAIIx	Phase_I	44	6	NM_001197323	0	0	36	40	4	H3BSR3|O75707|O75708	Missense_Mutation	SNP	ENST00000279392.3	37	CCDS10664.1																																																																																			.		0.632	HIRIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255160.2	NM_003609	
IRX3	79191	hgsc.bcm.edu	37	16	54318528	54318528	+	Missense_Mutation	SNP	A	A	G	rs1450355	byFrequency	TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr16:54318528A>G	ENST00000329734.3	-	2	1977	c.1265T>C	c.(1264-1266)cTg>cCg	p.L422P		NM_024336.2	NP_077312.2	P78415	IRX3_HUMAN	iroquois homeobox 3	422	Pro-rich.		L -> P (in dbSNP:rs1450355). {ECO:0000269|PubMed:15489334}.		mesoderm development (GO:0007498)|metanephros development (GO:0001656)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of neuron differentiation (GO:0045666)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)|transcription, DNA-templated (GO:0006351)	axon (GO:0030424)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|soft_tissue(1)|urinary_tract(1)	14						GAGCGGGTGCAGGCGGGGGCC	0.776													g|||	4851	0.96865	0.888	0.987	5008	,	,		8017	1.0		1.0	False		,,,				2504	1.0				p.L422P	GBM(143;1830 1866 4487 4646 37383)	.											.	IRX3-90	0			c.T1265C						.	T	PRO/LEU	1678,102		788,102,0	1.0	2.0	2.0		1265	2.5	1.0	16	dbSNP_88	2	4195,3		2096,3,0	no	missense	IRX3	NM_024336.2	98	2884,105,0	GG,GA,AA		0.0715,5.7303,1.7564	benign	422/502	54318528	5873,105	890	2099	2989	SO:0001583	missense	79191	exon2			GGGTGCAGGCGGG	U90308	CCDS10750.1	16q12.2	2011-06-20	2007-07-13		ENSG00000177508	ENSG00000177508		"""Homeoboxes / TALE class"""	14360	protein-coding gene	gene with protein product		612985					Standard	NM_024336		Approved	IRX-1	uc002eht.1	P78415	OTTHUMG00000133200	ENST00000329734.3:c.1265T>C	16.37:g.54318528A>G	ENSP00000331608:p.Leu422Pro	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_024336	0	0	0	0	0	Q7Z4A4|Q7Z4A5|Q8IVC6	Missense_Mutation	SNP	ENST00000329734.3	37	CCDS10750.1	2108	0.9652014652014652	433	0.8800813008130082	354	0.9779005524861878	567	0.9912587412587412	754	0.9947229551451188	g	5.642	0.303067	0.10678	0.942697	0.999285	ENSG00000177508	ENST00000329734	T	0.54279	0.58	4.4	2.45	0.29901	.	0.652897	0.14990	N	0.286760	T	0.00012	0.0000	N	0.01352	-0.895	0.29914	P	0.82336	B	0.02656	0.0	B	0.01281	0.0	T	0.21861	-1.0233	9	0.33940	T	0.23	-4.0049	5.143	0.14969	0.1733:0.0:0.6627:0.164	rs1450355;rs17852160;rs60836119	422	P78415	IRX3_HUMAN	P	422	ENSP00000331608:L422P	ENSP00000331608:L422P	L	-	2	0	IRX3	52876029	1.000000	0.71417	0.984000	0.44739	0.000000	0.00434	1.455000	0.35190	0.155000	0.19261	-1.528000	0.00924	CTG	T|0.035;G|0.004		0.776	IRX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256910.2		
THAP11	57215	hgsc.bcm.edu	37	16	67876806	67876829	+	In_Frame_Del	DEL	CAGCAGCAGCAGCAGCAACAGCAG	CAGCAGCAGCAGCAGCAACAGCAG	-	rs111586870|rs28647874|rs377516180|rs376100464|rs199582467|rs34138555|rs34213159|rs143101373|rs3982383	byFrequency	TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	CAGCAGCAGCAGCAGCAACAGCAG	CAGCAGCAGCAGCAGCAACAGCAG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr16:67876806_67876829delCAGCAGCAGCAGCAGCAACAGCAG	ENST00000303596.1	+	1	594_617	c.349_372delCAGCAGCAGCAGCAGCAACAGCAG	c.(349-372)cagcagcagcagcagcaacagcagdel	p.QQQQQQQQ125del	CENPT_ENST00000562787.1_Intron	NM_020457.2	NP_065190.2	Q96EK4	THA11_HUMAN	THAP domain containing 11	125	Gln-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|urinary_tract(1)	8		Acute lymphoblastic leukemia(13;0.000299)|all_hematologic(13;0.0184)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00412)|Epithelial(162;0.018)|all cancers(182;0.118)		acagcagcaacagcagcagcagcagcaacagcagcagcagcagc	0.674																																					p.117_124del		.											.	THAP11-90	0			c.349_372del						.																																			SO:0001651	inframe_deletion	57215	exon1			CAGCAACAGCAGC	AB015338	CCDS10847.1	16q22.1	2013-01-25			ENSG00000168286	ENSG00000168286		"""THAP (C2CH-type zinc finger) domain containing"""	23194	protein-coding gene	gene with protein product		609119				12575992, 8325628	Standard	NM_020457		Approved	HRIHFB2206, CTG-B45d, CTG-B43a	uc002euo.3	Q96EK4	OTTHUMG00000137546	ENST00000303596.1:c.349_372delCAGCAGCAGCAGCAGCAACAGCAG	16.37:g.67876806_67876829delCAGCAGCAGCAGCAGCAACAGCAG	ENSP00000304689:p.Gln125_Gln132del	Somatic	9	0		WXS	Illumina GAIIx	Phase_I	54	24	NM_020457	0	0	0	0	0	A4UCT5|A8K002|O94795	In_Frame_Del	DEL	ENST00000303596.1	37	CCDS10847.1																																																																																			-|0.667;CAG|0.333		0.674	THAP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268879.1	NM_020457	
ZFPM1	161882	hgsc.bcm.edu	37	16	88599697	88599705	+	In_Frame_Del	DEL	AGCCTCTGG	AGCCTCTGG	-	rs67873604|rs149145771|rs368520732|rs67322929|rs201915453|rs67712719	byFrequency	TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	AGCCTCTGG	AGCCTCTGG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr16:88599697_88599705delAGCCTCTGG	ENST00000319555.3	+	10	1653_1661	c.1331_1339delAGCCTCTGG	c.(1330-1341)gagcctctggcc>gcc	p.EPL444del	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	444				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GCCAGAGCGGAGCCTCTGGCCCAGAATGG	0.746																																					p.444_447del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1331_1339del						.																																			SO:0001651	inframe_deletion	161882	exon10			GAGCGGAGCCTCT	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1331_1339delAGCCTCTGG	16.37:g.88599697_88599705delAGCCTCTGG	ENSP00000326630:p.Glu444_Leu446del	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	17	0	NM_153813	0	0	0	0	0		In_Frame_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.746	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
GAS8	2622	bcgsc.ca	37	16	90095558	90095558	+	Intron	SNP	C	C	T	rs76646627		TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr16:90095558C>T	ENST00000268699.4	+	2	212				GAS8_ENST00000540721.1_Intron|GAS8_ENST00000536122.1_Intron|C16orf3_ENST00000408886.2_Missense_Mutation_p.G65S	NM_001481.2	NP_001472.1	O95995	GAS8_HUMAN	growth arrest-specific 8						cellular protein localization (GO:0034613)|negative regulation of cell proliferation (GO:0008285)|sperm motility (GO:0030317)	Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile cilium (GO:0031514)		p.G65S(1)		endometrium(3)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	14		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.029)		acggggcagcctacggggcag	0.672																																					p.G65S		.											.	C16orf3-90	1	Substitution - Missense(1)	lung(1)	c.G193A						.						25.0	20.0	21.0					16																	90095558		2191	4298	6489	SO:0001627	intron_variant	750	exon1			GGCAGCCTACGGG	AF050079	CCDS10992.1, CCDS67101.1, CCDS73932.1	16q24.3	2014-07-18	2003-01-16	2003-01-17	ENSG00000141013	ENSG00000141013			4166	protein-coding gene	gene with protein product		605178	"""growth arrest-specific 11"""	GAS11		9790751	Standard	NM_001481		Approved		uc002fqi.1	O95995	OTTHUMG00000138988	ENST00000268699.4:c.90+1428C>T	16.37:g.90095558C>T		Somatic	29	0		WXS	Illumina GAIIx	Phase_I	118	9	NM_001214	0	0	0	0	0	B2RCT1|B7Z4U1|G3V1L5|Q2M234	Missense_Mutation	SNP	ENST00000268699.4	37	CCDS10992.1	.	.	.	.	.	.	.	.	.	.	C	9.046	0.990885	0.18966	.	.	ENSG00000221819	ENST00000408886	T	0.57595	0.39	1.2	-1.14	0.09741	.	.	.	.	.	T	0.23492	0.0568	N	0.08118	0	0.09310	N	1	B	0.22604	0.072	B	0.14578	0.011	T	0.14755	-1.0461	8	.	.	.	.	2.4936	0.04616	0.0:0.4385:0.3231:0.2384	.	73	O95177	CP003_HUMAN	S	65	ENSP00000386218:G65S	.	G	-	1	0	C16orf3	88623059	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.145000	0.10265	-0.326000	0.08564	0.407000	0.27541	GGC	C|0.500;T|0.500		0.672	GAS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000272877.2		
GLTPD2	388323	hgsc.bcm.edu	37	17	4693342	4693342	+	Missense_Mutation	SNP	C	C	A	rs35910358	byFrequency	TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr17:4693342C>A	ENST00000331264.7	+	4	680	c.627C>A	c.(625-627)gaC>gaA	p.D209E		NM_001014985.2	NP_001014985	A6NH11	GLTD2_HUMAN	glycolipid transfer protein domain containing 2	209				D -> E (in Ref. 2; AAI50537). {ECO:0000305}.		cytoplasm (GO:0005737)	glycolipid binding (GO:0051861)|glycolipid transporter activity (GO:0017089)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)	4						GAGGCCCGGACGCGGGCGTGC	0.761													C|||	4904	0.979233	0.9228	1.0	5008	,	,		11019	1.0		0.998	False		,,,				2504	1.0				p.D209E		.											.	GLTPD2-68	0			c.C627A						.	C	GLU/ASP	2706,78		1314,78,0	2.0	2.0	2.0		627	0.2	0.1	17	dbSNP_126	2	6028,0		3014,0,0	no	missense	GLTPD2	NM_001014985.2	45	4328,78,0	AA,AC,CC		0.0,2.8017,0.8852	benign	209/292	4693342	8734,78	1392	3014	4406	SO:0001583	missense	388323	exon4			CCCGGACGCGGGC	BC029290	CCDS32534.1	17p13.2	2007-12-19				ENSG00000182327			33756	protein-coding gene	gene with protein product							Standard	NM_001014985		Approved		uc002fza.2	A6NH11		ENST00000331264.7:c.627C>A	17.37:g.4693342C>A	ENSP00000328070:p.Asp209Glu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	12	12	NM_001014985	0	0	0	0	0	A7E2T2	Missense_Mutation	SNP	ENST00000331264.7	37	CCDS32534.1	2151	0.9848901098901099	466	0.9471544715447154	362	1.0	572	1.0	751	0.9907651715039578	C	9.155	1.017148	0.19355	0.971983	1.0	ENSG00000182327	ENST00000331264	.	.	.	4.58	0.162	0.14981	Glycolipid transfer protein domain (3);	.	.	.	.	T	0.00012	0.0000	L	0.41027	1.25	0.80722	P	0.0	B	0.22080	0.064	B	0.31614	0.133	T	0.34650	-0.9820	7	0.12103	T	0.63	-20.1635	5.889	0.18897	0.0:0.5269:0.298:0.1751	rs35910358	209	A6NH11	GLTD2_HUMAN	E	209	.	ENSP00000328070:D209E	D	+	3	2	GLTPD2	4640082	0.004000	0.15560	0.082000	0.20525	0.081000	0.17604	0.011000	0.13264	-0.068000	0.12953	0.555000	0.69702	GAC	C|0.015;A|0.985		0.761	GLTPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439781.1	NM_001014985	
LLGL2	3993	bcgsc.ca	37	17	73565171	73565171	+	Missense_Mutation	SNP	T	T	C	rs1671021	byFrequency	TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr17:73565171T>C	ENST00000392550.3	+	13	1552	c.1435T>C	c.(1435-1437)Ttc>Ctc	p.F479L	LLGL2_ENST00000577200.1_Missense_Mutation_p.F479L|LLGL2_ENST00000167462.5_Missense_Mutation_p.F479L	NM_001031803.1	NP_001026973.1	Q6P1M3	L2GL2_HUMAN	lethal giant larvae homolog 2 (Drosophila)	479			F -> L (in dbSNP:rs1671021). {ECO:0000269|PubMed:15489334}.		cell cycle (GO:0007049)|cell division (GO:0051301)|exocytosis (GO:0006887)|regulation of establishment or maintenance of cell polarity (GO:0032878)	cytoplasm (GO:0005737)	PDZ domain binding (GO:0030165)			NS(1)|breast(3)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;1.8e-07)|Epithelial(20;1.38e-06)|Lung(188;0.0696)|LUSC - Lung squamous cell carcinoma(166;0.112)			CAACGAGAACTTCAGTGCCCA	0.667													C|||	2328	0.464856	0.907	0.3372	5008	,	,		17795	0.2639		0.3738	False		,,,				2504	0.2587				p.F479L		.											.	LLGL2-251	0			c.T1435C						.	C	LEU/PHE,LEU/PHE	3630,776	303.5+/-288.0	1501,628,74	45.0	44.0	45.0		1435,1435	4.3	0.9	17	dbSNP_89	45	3320,5280	632.4+/-398.6	673,1974,1653	yes	missense,missense	LLGL2	NM_001031803.1,NM_004524.2	22,22	2174,2602,1727	CC,CT,TT		38.6047,17.6123,46.5631	benign,benign	479/1021,479/1016	73565171	6950,6056	2203	4300	6503	SO:0001583	missense	3993	exon13			GAGAACTTCAGTG	X87342	CCDS11725.1, CCDS32733.1, CCDS45776.1	17q25.1	2013-01-10	2001-11-28			ENSG00000073350		"""WD repeat domain containing"""	6629	protein-coding gene	gene with protein product			"""lethal giant larvae (Drosophila) homolog 2"""				Standard	XR_243659		Approved	HGL	uc002joh.3	Q6P1M3		ENST00000392550.3:c.1435T>C	17.37:g.73565171T>C	ENSP00000376333:p.Phe479Leu	Somatic	111	0		WXS	Illumina GAIIx	Phase_I	116	5	NM_004524	0	0	7	7	0	Q14521|Q9BR62	Missense_Mutation	SNP	ENST00000392550.3	37	CCDS32733.1	982	0.44963369963369965	442	0.8983739837398373	128	0.35359116022099446	125	0.21853146853146854	287	0.3786279683377309	C	10.65	1.409361	0.25378	0.823877	0.386047	ENSG00000073350	ENST00000167462;ENST00000392550;ENST00000545227	T;T	0.09538	2.97;2.97	5.29	4.33	0.51752	WD40 repeat-like-containing domain (1);	0.192645	0.49916	N	0.000140	T	0.00012	0.0000	N	0.01267	-0.92	0.46542	P	9.050000000000447E-4	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.23476	-1.0187	9	0.18710	T	0.47	-3.4459	2.7305	0.05226	0.1772:0.5462:0.1184:0.1582	rs1671021;rs17492156;rs17855940;rs61228063;rs1671021	468;468;479;479	B3KX47;G3V1I9;Q6P1M3-2;Q6P1M3	.;.;.;L2GL2_HUMAN	L	479;479;468	ENSP00000167462:F479L;ENSP00000376333:F479L	ENSP00000167462:F479L	F	+	1	0	LLGL2	71076766	1.000000	0.71417	0.896000	0.35187	0.404000	0.30871	2.038000	0.41184	0.637000	0.30526	-0.222000	0.12452	TTC	T|0.485;C|0.514		0.667	LLGL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000447633.1	NM_004524	
POTEC	388468	broad.mit.edu	37	18	14542740	14542740	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr18:14542740G>A	ENST00000358970.5	-	1	405	c.406C>T	c.(406-408)Cgt>Tgt	p.R136C	POTEC_ENST00000389891.4_5'UTR	NM_001137671.1	NP_001131143.1	B2RU33	POTEC_HUMAN	POTE ankyrin domain family, member C	136										NS(2)|breast(1)|endometrium(9)|kidney(13)|lung(14)|prostate(3)|skin(6)|soft_tissue(1)|urinary_tract(3)	52						TCTTCTCGACGGACGTGGTAC	0.602																																					p.R136C		.											.	POTEC-3	0			c.C406T						.						30.0	45.0	40.0					18																	14542740		692	1590	2282	SO:0001583	missense	388468	exon1			CTCGACGGACGTG	BX649118	CCDS45835.1	18p11.21	2013-01-10	2008-11-26	2008-11-26	ENSG00000183206	ENSG00000183206		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33894	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 6"""		"""ANKRD26-like family B, member 2"""	A26B2			Standard	NM_001137671		Approved	POTE18, POTE-18, DKFZp686J0529, CT104.6	uc010dln.3	B2RU33	OTTHUMG00000162963	ENST00000358970.5:c.406C>T	18.37:g.14542740G>A	ENSP00000351856:p.Arg136Cys	Somatic	536	1		WXS	Illumina GAIIx	Phase_I	645	12	NM_001137671	0	0	0	0	0		Missense_Mutation	SNP	ENST00000358970.5	37	CCDS45835.1	.	.	.	.	.	.	.	.	.	.	G	5.962	0.361500	0.11296	.	.	ENSG00000183206	ENST00000358970;ENST00000389891	T	0.53423	0.62	1.03	0.109	0.14578	.	.	.	.	.	T	0.33177	0.0854	L	0.43152	1.355	0.09310	N	1	B	0.24768	0.111	B	0.13407	0.009	T	0.23833	-1.0177	9	0.48119	T	0.1	.	3.591	0.07989	0.279:0.0:0.721:0.0	.	136	B2RU33	POTEC_HUMAN	C	136	ENSP00000351856:R136C	ENSP00000351856:R136C	R	-	1	0	POTEC	14532740	0.007000	0.16637	0.002000	0.10522	0.001000	0.01503	0.206000	0.17375	0.005000	0.14708	-1.101000	0.02118	CGT	.		0.602	POTEC-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371179.1	XM_496269	
LOXHD1	125336	broad.mit.edu;bcgsc.ca	37	18	44149474	44149474	+	Silent	SNP	G	G	A	rs2086005	byFrequency	TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr18:44149474G>A	ENST00000398722.4	-	9	1340	c.1341C>T	c.(1339-1341)aaC>aaT	p.N447N	LOXHD1_ENST00000536736.1_Silent_p.N725N|LOXHD1_ENST00000441551.2_Silent_p.N725N			Q8IVV2	LOXH1_HUMAN	lipoxygenase homology domains 1	447	PLAT 4. {ECO:0000255|PROSITE- ProRule:PRU00152}.				calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|sensory perception of sound (GO:0007605)	membrane (GO:0016020)|stereocilium (GO:0032420)	calcium channel activity (GO:0005262)			NS(3)|autonomic_ganglia(1)|breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|pancreas(1)|prostate(4)|skin(4)|stomach(1)	36						CTTTGAGGTTGTTGTCAGAGA	0.488													G|||	309	0.0617013	0.0045	0.1052	5008	,	,		21822	0.0496		0.1372	False		,,,				2504	0.0429				p.N725N		.											.	.	0			c.C2175T						.	G		33,1351		1,31,660	133.0	116.0	121.0		2175	0.2	1.0	18	dbSNP_96	121	506,2676		41,424,1126	no	coding-synonymous	LOXHD1	NM_144612.6		42,455,1786	AA,AG,GG		15.9019,2.3844,11.8046		725/2212	44149474	539,4027	692	1591	2283	SO:0001819	synonymous_variant	125336	exon16			GAGGTTGTTGTCA	AK057232	CCDS45861.1, CCDS45862.1, CCDS54184.1	18q21.1	2009-09-11			ENSG00000167210	ENSG00000167210			26521	protein-coding gene	gene with protein product		613072	"""deafness, autosomal recessive 77"""	DFNB77		19732867	Standard	NM_144612		Approved	FLJ32670, LH2D1	uc010xcw.1	Q8IVV2	OTTHUMG00000132644	ENST00000398722.4:c.1341C>T	18.37:g.44149474G>A		Somatic	193	1		WXS	Illumina GAIIx	Phase_I	215	7	NM_144612	0	0	0	0	0	B7WNN3|B7WNT1|B7WPI9|Q6ZRY7|Q86WW9|Q96DL7	Silent	SNP	ENST00000398722.4	37		173	0.07921245421245421	3	0.006097560975609756	44	0.12154696132596685	29	0.050699300699300696	97	0.1279683377308707	G	9.503	1.103818	0.20632	0.023844	0.159019	ENSG00000167210	ENST00000441551	.	.	.	5.66	0.187	0.15109	.	.	.	.	.	.	.	.	.	.	.	0.09310	P	1.0	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.6151	0.51086	0.4543:0.0:0.5456:0.0	rs2086005;rs2086005	.	.	.	X	706	.	.	Q	-	1	0	LOXHD1	42403472	0.995000	0.38212	0.997000	0.53966	0.988000	0.76386	0.430000	0.21428	0.082000	0.17018	0.655000	0.94253	CAA	G|0.917;A|0.083		0.488	LOXHD1-201	KNOWN	basic	protein_coding	protein_coding		NM_144612	
ABCA7	10347	hgsc.bcm.edu	37	19	1065044	1065044	+	Silent	SNP	C	C	T	rs4147935	byFrequency	TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr19:1065044C>T	ENST00000263094.6	+	46	6390	c.6159C>T	c.(6157-6159)ggC>ggT	p.G2053G	ABCA7_ENST00000435683.2_Silent_p.G1915G|HMHA1_ENST00000539243.2_5'Flank|HMHA1_ENST00000590214.1_5'Flank|ABCA7_ENST00000433129.1_Silent_p.G2053G|HMHA1_ENST00000586866.1_5'Flank|HMHA1_ENST00000313093.2_5'Flank|HMHA1_ENST00000536472.1_5'Flank	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	2053					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)			NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CACATGGAGGCCGCCTGCGCT	0.736																																					p.G2053G		.											.	ABCA7-98	0			c.C6159T						.	C		327,3757		20,287,1735	5.0	6.0	6.0		6159	1.5	0.8	19	dbSNP_110	6	2858,5242		553,1752,1745	no	coding-synonymous	ABCA7	NM_019112.3		573,2039,3480	TT,TC,CC		35.284,8.0069,26.1408		2053/2147	1065044	3185,8999	2042	4050	6092	SO:0001819	synonymous_variant	10347	exon46			TGGAGGCCGCCTG	AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.6159C>T	19.37:g.1065044C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	22	20	NM_019112	0	0	0	1	1	Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Silent	SNP	ENST00000263094.6	37	CCDS12055.1																																																																																			C|0.766;T|0.234		0.736	ABCA7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000394993.1	NM_019112	
TCF3	6929	hgsc.bcm.edu	37	19	1619333	1619333	+	Silent	SNP	G	G	A	rs1140828	byFrequency	TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr19:1619333G>A	ENST00000262965.5	-	15	1652	c.1308C>T	c.(1306-1308)ggC>ggT	p.G436G	RNU6-1223P_ENST00000517124.1_RNA|TCF3_ENST00000395423.3_Silent_p.G385G|TCF3_ENST00000588136.1_Silent_p.G436G|TCF3_ENST00000344749.5_Silent_p.G436G|TCF3_ENST00000453954.2_Silent_p.G352G	NM_003200.3	NP_003191.1	Q9HCS4	TF7L1_HUMAN	transcription factor 3	0					anterior/posterior axis specification, embryo (GO:0008595)|axial mesoderm morphogenesis (GO:0048319)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|chromatin organization (GO:0006325)|generation of neurons (GO:0048699)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	16		Acute lymphoblastic leukemia(61;5.94e-12)|all_hematologic(61;1.27e-07)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGTGCCGCCCGCCCAGTGACA	0.746			T	"""PBX1, HLF, TFPT"""	pre B-ALL								G|||	1179	0.235423	0.1702	0.2435	5008	,	,		13595	0.2897		0.3032	False		,,,				2504	0.1922				p.G436G		.		Dom	yes		19	19p13.3	6929	transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47)		L	.	TCF3-721	0			c.C1308T						.	G	,	770,3572		79,612,1480	11.0	14.0	13.0		1308,1308	-3.3	0.4	19	dbSNP_86	13	2644,5770		436,1772,1999	no	coding-synonymous,coding-synonymous	TCF3	NM_001136139.2,NM_003200.3	,	515,2384,3479	AA,AG,GG		31.4238,17.7338,26.7639	,	436/652,436/655	1619333	3414,9342	2171	4207	6378	SO:0001819	synonymous_variant	6929	exon15			CCGCCCGCCCAGT	M65214	CCDS12074.1, CCDS45899.1	19p13.3	2014-02-13	2013-02-26		ENSG00000071564	ENSG00000071564		"""Basic helix-loop-helix proteins"""	11633	protein-coding gene	gene with protein product	"""transcription factor E2-alpha"", ""immunoglobulin transcription factor 1"", ""kappa-E2-binding factor"", ""E2A immunoglobulin enhancer-binding factor E12/E47"", ""VDR interacting repressor"""	147141				2308859, 1967983	Standard	NM_003200		Approved	E2A, ITF1, MGC129647, MGC129648, bHLHb21, VDIR, E47	uc002ltt.4	P15923	OTTHUMG00000180031	ENST00000262965.5:c.1308C>T	19.37:g.1619333G>A		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_003200	0	0	0	0	0	Q53R97|Q6PD70|Q9NP00	Silent	SNP	ENST00000262965.5	37	CCDS12074.1																																																																																			G|0.749;A|0.251		0.746	TCF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449367.1	NM_003200	
ATP8B3	148229	hgsc.bcm.edu;bcgsc.ca	37	19	1806115	1806115	+	Missense_Mutation	SNP	C	C	T	rs548928565		TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr19:1806115C>T	ENST00000310127.6	-	8	969	c.731G>A	c.(730-732)cGc>cAc	p.R244H	ATP8B3_ENST00000526092.2_Missense_Mutation_p.R191H|ATP8B3_ENST00000539485.1_Missense_Mutation_p.R244H|ATP8B3_ENST00000525591.1_Missense_Mutation_p.R191H	NM_138813.3	NP_620168.1	O60423	AT8B3_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 3	244					binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(9)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	23		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GTTGTCCTTGCGGAGACAGAC	0.652													t|||	1	0.000199681	0.0008	0.0	5008	,	,		15521	0.0		0.0	False		,,,				2504	0.0				p.R244H		.											.	.	0			c.G731A						.						40.0	50.0	47.0					19																	1806115		2038	4163	6201	SO:0001583	missense	148229	exon8			TCCTTGCGGAGAC	AA827939	CCDS45901.1, CCDS54196.1	19p13.3	2010-04-28	2010-04-28		ENSG00000130270	ENSG00000130270		"""ATPases / P-type"""	13535	protein-coding gene	gene with protein product	"""aminophospholipid translocase ATP8B3"", ""potential phospholipid-transporting ATPase IK"""	605866	"""ATPase, Class I, type 8B, member 3"", ""ATPase, class I, type 8B, member 3"""			11015572	Standard	NM_138813		Approved	ATPIK	uc002ltw.4	O60423	OTTHUMG00000166189	ENST00000310127.6:c.731G>A	19.37:g.1806115C>T	ENSP00000311336:p.Arg244His	Somatic	80	0		WXS	Illumina GAIIx	Phase_I	63	4	NM_138813	0	0	2	2	0	Q7Z485|Q8IVB8|Q8N4Y8|Q96M22	Missense_Mutation	SNP	ENST00000310127.6	37	CCDS45901.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	t|t	0.904|0.904	-0.721218|-0.721218	0.03182|0.03182	.|.	.|.	ENSG00000130270|ENSG00000130270	ENST00000533993|ENST00000310127;ENST00000539485;ENST00000525591;ENST00000526092;ENST00000382339	.|D;D;D;D	.|0.90900	.|-2.75;-2.75;-2.75;-2.75	3.59|3.59	-7.18|-7.18	0.01505|0.01505	.|ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	.|0.779774	.|0.12303	.|N	.|0.480966	T|T	0.76227|0.76227	0.3958|0.3958	N|N	0.10874|0.10874	0.06|0.06	0.09310|0.09310	N|N	1|1	.|B;B;B	.|0.12630	.|0.006;0.001;0.001	.|B;B;B	.|0.04013	.|0.001;0.001;0.001	T|T	0.58662|0.58662	-0.7597|-0.7597	5|10	.|0.42905	.|T	.|0.14	.|.	9.8514|9.8514	0.41059|0.41059	0.0:0.532:0.1074:0.3606|0.0:0.532:0.1074:0.3606	.|.	.|191;244;191	.|F5H3R9;O60423;Q7Z485	.|.;AT8B3_HUMAN;.	T|H	207|244;244;191;191;191	.|ENSP00000311336:R244H;ENSP00000443574:R244H;ENSP00000437115:R191H;ENSP00000445204:R191H	.|ENSP00000311336:R244H	A|R	-|-	1|2	0|0	ATP8B3|ATP8B3	1757115|1757115	0.001000|0.001000	0.12720|0.12720	0.000000|0.000000	0.03702|0.03702	0.018000|0.018000	0.09664|0.09664	-0.125000|-0.125000	0.10579|0.10579	-2.040000|-2.040000	0.00916|0.00916	-1.300000|-1.300000	0.01332|0.01332	GCA|CGC	.		0.652	ATP8B3-002	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388279.1	NM_138813	
PLIN5	440503	broad.mit.edu	37	19	4525688	4525688	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr19:4525688C>T	ENST00000381848.3	-	6	757	c.677G>A	c.(676-678)cGt>cAt	p.R226H		NM_001013706.2	NP_001013728.2	Q00G26	PLIN5_HUMAN	perilipin 5	226	Interaction with PNPLA2 and ABHD5. {ECO:0000250}.				lipid particle organization (GO:0034389)|lipid storage (GO:0019915)|mitochondrion localization (GO:0051646)|negative regulation of fatty acid beta-oxidation (GO:0031999)|negative regulation of lipase activity (GO:0060192)|negative regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035359)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of triglyceride catabolic process (GO:0010897)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of lipase activity (GO:0060193)|positive regulation of lipid storage (GO:0010884)|positive regulation of sequestering of triglyceride (GO:0010890)|positive regulation of triglyceride biosynthetic process (GO:0010867)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|lipid particle (GO:0005811)|mitochondrion (GO:0005739)				endometrium(4)|lung(3)|skin(2)|upper_aerodigestive_tract(1)	10						GTCCTGGGCACGGTGTTTGCT	0.647																																					p.R226H		.											.	PLIN5-22	0			c.G677A						.						53.0	64.0	60.0					19																	4525688		2124	4229	6353	SO:0001583	missense	440503	exon6			TGGGCACGGTGTT	DQ839131	CCDS42473.1	19p13.3	2009-08-12			ENSG00000214456	ENSG00000214456		"""Perilipins"""	33196	protein-coding gene	gene with protein product	"""lipid storage droplet protein 5"""	613248				17234449, 19638644	Standard	NM_001013706		Approved	LSDP5, LSDA5, OXPAT, MLDP	uc002mas.3	Q00G26		ENST00000381848.3:c.677G>A	19.37:g.4525688C>T	ENSP00000371272:p.Arg226His	Somatic	131	0		WXS	Illumina GAIIx	Phase_I	124	4	NM_001013706	0	0	0	0	0	A2RRC1|Q6ZS68	Missense_Mutation	SNP	ENST00000381848.3	37	CCDS42473.1	.	.	.	.	.	.	.	.	.	.	.	12.68	2.009408	0.35415	.	.	ENSG00000214456	ENST00000381848	T	0.07021	3.23	4.92	2.68	0.31781	.	1.024610	0.07826	N	0.960610	T	0.05410	0.0143	N	0.16201	0.385	0.43321	D	0.99534	B	0.10296	0.003	B	0.08055	0.003	T	0.27806	-1.0063	10	0.34782	T	0.22	-4.9245	5.8615	0.18749	0.0:0.5675:0.0:0.4325	.	226	Q00G26	PLIN5_HUMAN	H	226	ENSP00000371272:R226H	ENSP00000371272:R226H	R	-	2	0	PLIN5	4476688	0.300000	0.24435	0.962000	0.40283	0.995000	0.86356	2.227000	0.42972	1.041000	0.40125	0.561000	0.74099	CGT	.		0.647	PLIN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458647.1	NM_001013706	
RDH8	50700	broad.mit.edu	37	19	10132072	10132072	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr19:10132072G>T	ENST00000171214.1	+	5	927	c.678G>T	c.(676-678)aaG>aaT	p.K226N	RDH8_ENST00000591589.1_Missense_Mutation_p.K246N	NM_015725.2	NP_056540.2	Q9NYR8	RDH8_HUMAN	retinol dehydrogenase 8 (all-trans)	226					estrogen biosynthetic process (GO:0006703)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|steroid biosynthetic process (GO:0006694)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	estradiol 17-beta-dehydrogenase activity (GO:0004303)|NADP-retinol dehydrogenase activity (GO:0052650)|retinol dehydrogenase activity (GO:0004745)			endometrium(3)|large_intestine(3)|lung(10)|ovary(3)|pancreas(1)|prostate(1)	21			Epithelial(33;4.24e-05)		Vitamin A(DB00162)	CCTCCAGGAAGCTGTTTTGCT	0.607																																					p.K246N		.											.	RDH8-94	0			c.G738T						.						80.0	78.0	79.0					19																	10132072		2203	4300	6503	SO:0001583	missense	50700	exon5			CAGGAAGCTGTTT	AF229845	CCDS12223.1, CCDS12223.2	19p13.2	2011-09-14				ENSG00000080511	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	14423	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 28C, member 2"""	608575				10753906, 19027726	Standard	NM_015725		Approved	PRRDH, SDR28C2	uc002mmr.4	Q9NYR8		ENST00000171214.1:c.678G>T	19.37:g.10132072G>T	ENSP00000171214:p.Lys226Asn	Somatic	96	0		WXS	Illumina GAIIx	Phase_I	113	3	NM_015725	0	0	0	0	0	Q9H838	Missense_Mutation	SNP	ENST00000171214.1	37		.	.	.	.	.	.	.	.	.	.	G	9.055	0.993100	0.19043	.	.	ENSG00000080511	ENST00000171214	D	0.93076	-3.16	5.02	5.02	0.67125	NAD(P)-binding domain (1);	0.158890	0.53938	D	0.000043	D	0.84488	0.5483	N	0.04959	-0.14	0.23063	N	0.998359	B	0.02656	0.0	B	0.04013	0.001	T	0.67821	-0.5571	10	0.18276	T	0.48	.	15.8321	0.78760	0.0:0.0:1.0:0.0	.	226	Q9NYR8	RDH8_HUMAN	N	226	ENSP00000171214:K226N	ENSP00000171214:K226N	K	+	3	2	RDH8	9993072	1.000000	0.71417	0.999000	0.59377	0.283000	0.27025	0.984000	0.29565	2.335000	0.79485	0.462000	0.41574	AAG	.		0.607	RDH8-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			
ANKLE1	126549	hgsc.bcm.edu	37	19	17392779	17392779	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr19:17392779A>C	ENST00000394458.3	+	1	326	c.50A>C	c.(49-51)gAg>gCg	p.E17A	ANKLE1_ENST00000598347.1_Missense_Mutation_p.E17A|ANKLE1_ENST00000433424.2_Missense_Mutation_p.E71A|CTD-2278I10.6_ENST00000596542.1_Intron|ANKLE1_ENST00000404085.1_Silent_p.R41R|ANKLE1_ENST00000594072.1_Intron	NM_152363.4	NP_689576	Q8NAG6	ANKL1_HUMAN	ankyrin repeat and LEM domain containing 1	17										large_intestine(1)|lung(3)|prostate(1)|skin(1)|urinary_tract(1)	7						GCGCTgcgggaggaggagccg	0.711																																					p.E17A		.											.	.	0			c.A50C						.						4.0	6.0	5.0					19																	17392779		1645	3199	4844	SO:0001583	missense	126549	exon1			TGCGGGAGGAGGA	AK096688	CCDS12354.2, CCDS12354.3	19p13.11	2013-01-10	2008-03-25	2008-03-25	ENSG00000160117	ENSG00000160117		"""Ankyrin repeat domain containing"""	26812	protein-coding gene	gene with protein product	"""LEM domain containing 6"""		"""ankyrin repeat domain 41"""	ANKRD41			Standard	NM_152363		Approved	FLJ39369, LEMD6	uc002nga.2	Q8NAG6	OTTHUMG00000150839	ENST00000394458.3:c.50A>C	19.37:g.17392779A>C	ENSP00000377971:p.Glu17Ala	Somatic	3	0		WXS	Illumina GAIIx	Phase_I	11	9	NM_152363	0	0	0	0	0	A8VU82|Q8N8J8	Missense_Mutation	SNP	ENST00000394458.3	37	CCDS12354.2	.	.	.	.	.	.	.	.	.	.	A	19.77	3.888661	0.72524	.	.	ENSG00000160117	ENST00000404261;ENST00000433424;ENST00000438921	T;T	0.63913	-0.07;-0.07	3.76	1.6	0.23607	Ankyrin repeat-containing domain (4);	.	.	.	.	T	0.31606	0.0802	N	0.03881	-0.34	0.19775	N	0.99995	B;B	0.21520	0.057;0.005	B;B	0.15870	0.014;0.005	T	0.15235	-1.0444	9	0.27785	T	0.31	.	3.484	0.07613	0.6053:0.2646:0.1301:0.0	.	17;17	E7ETZ9;Q8NAG6	.;ANKL1_HUMAN	A	17;71;17	ENSP00000384753:E17A;ENSP00000394460:E71A	ENSP00000384753:E17A	E	+	2	0	ANKLE1	17253779	0.026000	0.19158	0.705000	0.30386	0.644000	0.38419	0.045000	0.14013	0.625000	0.30304	0.397000	0.26171	GAG	.		0.711	ANKLE1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325392.2	NM_152363	
NUDT19	390916	hgsc.bcm.edu	37	19	33183352	33183352	+	Silent	SNP	G	G	C	rs61732600	byFrequency	TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr19:33183352G>C	ENST00000397061.3	+	1	486	c.486G>C	c.(484-486)ccG>ccC	p.P162P	CTD-2538C1.2_ENST00000592431.1_lincRNA	NM_001105570.1	NP_001099040.1	A8MXV4	NUD19_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 19	162	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.					mitochondrion (GO:0005739)|peroxisome (GO:0005777)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)|receptor binding (GO:0005102)			endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	8	Esophageal squamous(110;0.137)					AGCCACCGCCGGGCCTGGCCT	0.751													G|||	1109	0.221446	0.1498	0.245	5008	,	,		11161	0.249		0.3062	False		,,,				2504	0.1861				p.P162P		.											.	NUDT19-22	0			c.G486C						.	G		469,2861		40,389,1236	4.0	5.0	5.0		486	-9.6	0.0	19	dbSNP_129	5	1887,5465		292,1303,2081	no	coding-synonymous	NUDT19	NM_001105570.1		332,1692,3317	CC,CG,GG		25.6665,14.0841,22.0558		162/376	33183352	2356,8326	1665	3676	5341	SO:0001819	synonymous_variant	390916	exon1			ACCGCCGGGCCTG		CCDS42543.1	19q13.11	2011-11-16			ENSG00000213965	ENSG00000213965		"""Nudix motif containing"""	32036	protein-coding gene	gene with protein product							Standard	NM_001105570		Approved	RP2	uc010edf.3	A8MXV4		ENST00000397061.3:c.486G>C	19.37:g.33183352G>C		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	9	8	NM_001105570	0	0	0	0	0		Silent	SNP	ENST00000397061.3	37	CCDS42543.1																																																																																			G|0.743;C|0.257		0.751	NUDT19-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000450338.3	XM_372723	
IGFLR1	79713	hgsc.bcm.edu	37	19	36231288	36231288	+	Missense_Mutation	SNP	C	C	T	rs140952221	byFrequency	TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr19:36231288C>T	ENST00000592537.1	-	3	435	c.335G>A	c.(334-336)tGc>tAc	p.C112Y	IGFLR1_ENST00000246532.1_Missense_Mutation_p.C112Y|AD000671.6_ENST00000589807.1_3'UTR|IGFLR1_ENST00000592889.1_Intron|IGFLR1_ENST00000588992.1_Intron|IGFLR1_ENST00000344990.3_Intron|KMT2B_ENST00000607650.1_RNA|IGFLR1_ENST00000587101.1_5'UTR			Q9H665	IGFR1_HUMAN	IGF-like family receptor 1	112						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|kidney(3)|large_intestine(1)|lung(8)|prostate(1)	15						CACCTCTCTGCAGCGCCACGG	0.736													C|||	33	0.00658946	0.0023	0.0058	5008	,	,		12274	0.0		0.0249	False		,,,				2504	0.001				p.C112Y		.											.	IGFLR1-90	0			c.G335A						.	C	TYR/CYS	26,4172		0,26,2073	10.0	12.0	11.0		335	2.6	0.0	19	dbSNP_134	11	132,8154		0,132,4011	yes	missense	IGFLR1	NM_024660.2	194	0,158,6084	TT,TC,CC		1.593,0.6193,1.2656	probably-damaging	112/356	36231288	158,12326	2099	4143	6242	SO:0001583	missense	79713	exon3			TCTCTGCAGCGCC	AK026226	CCDS12472.1	19q13.12	2012-10-02	2011-04-04	2011-04-04	ENSG00000126246	ENSG00000126246			23620	protein-coding gene	gene with protein product		614143	"""U2(RNU2) small nuclear RNA auxiliary factor 1-like 4"", ""transmembrane protein 149"""	U2AF1L4, TMEM149		21454693	Standard	NM_024660		Approved	FLJ22573	uc002obd.4	Q9H665		ENST00000592537.1:c.335G>A	19.37:g.36231288C>T	ENSP00000466181:p.Cys112Tyr	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	17	4	NM_024660	0	0	0	0	0	Q8N5X0	Missense_Mutation	SNP	ENST00000592537.1	37	CCDS12472.1	24	0.01098901098901099	1	0.0020325203252032522	2	0.0055248618784530384	0	0.0	21	0.027704485488126648	C	21.0	4.077444	0.76528	0.006193	0.01593	ENSG00000126246	ENST00000246532	D	0.92099	-2.97	4.69	2.59	0.31030	.	0.129434	0.51477	D	0.000082	D	0.84547	0.5496	L	0.59436	1.845	0.19775	N	0.999954	D	0.64830	0.994	D	0.64321	0.924	T	0.79381	-0.1827	10	0.87932	D	0	-14.1129	6.4313	0.21798	0.0:0.7844:0.0:0.2156	.	112	Q9H665	IGFR1_HUMAN	Y	112	ENSP00000246532:C112Y	ENSP00000246532:C112Y	C	-	2	0	IGFLR1	40923128	0.000000	0.05858	0.007000	0.13788	0.536000	0.34869	0.824000	0.27379	1.346000	0.45694	0.561000	0.74099	TGC	C|0.989;T|0.011		0.736	IGFLR1-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459077.1	NM_024660	
FBXO17	115290	hgsc.bcm.edu	37	19	39440918	39440918	+	Silent	SNP	T	T	C	rs2304117	byFrequency	TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr19:39440918T>C	ENST00000292852.4	-	2	383	c.42A>G	c.(40-42)ccA>ccG	p.P14P	FBXO17_ENST00000595329.1_Silent_p.P14P|SARS2_ENST00000448145.2_5'Flank|CTC-360G5.8_ENST00000599996.1_5'Flank	NM_024907.5	NP_079183.4	Q96EF6	FBX17_HUMAN	F-box protein 17	14						SCF ubiquitin ligase complex (GO:0019005)	glycoprotein binding (GO:0001948)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)	7	all_cancers(60;8.37e-07)|all_lung(34;3.71e-07)|Lung NSC(34;4.17e-07)|all_epithelial(25;1.13e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			GGGCCAGGGATGGGTCCGCCG	0.731													c|||	2378	0.47484	0.3336	0.3746	5008	,	,		11867	0.6796		0.4195	False		,,,				2504	0.5828				p.P23P		.											.	FBXO17-226	0			c.A69G						.		,	1052,2556		213,626,965	3.0	4.0	3.0		42,69	0.5	0.0	19	dbSNP_100	3	2265,4819		496,1273,1773	no	coding-synonymous,coding-synonymous	FBXO17	NM_024907.5,NM_148169.1	,	709,1899,2738	CC,CT,TT		31.9735,29.1574,31.0232	,	14/279,23/288	39440918	3317,7375	1804	3542	5346	SO:0001819	synonymous_variant	115290	exon2			CAGGGATGGGTCC	AF386743	CCDS12526.1	19q13.2	2010-07-02	2004-06-15	2004-06-16		ENSG00000269190		"""F-boxes /  ""other"""""	18754	protein-coding gene	gene with protein product	"""F-box only protein 26"""	609094	"""F-box only protein 17"""	FBXO26			Standard	NM_148169		Approved	FBG4, FLJ25205, MGC9379, FLJ11798, Fbx17		Q96EF6		ENST00000292852.4:c.42A>G	19.37:g.39440918T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_148169	0	0	0	0	0	Q96LQ4	Silent	SNP	ENST00000292852.4	37	CCDS12526.1																																																																																			T|0.545;C|0.455		0.731	FBXO17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463273.1	NM_024907	
APOE	348	hgsc.bcm.edu	37	19	45411941	45411941	+	Missense_Mutation	SNP	T	T	C	rs429358	byFrequency	TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr19:45411941T>C	ENST00000252486.4	+	4	499	c.388T>C	c.(388-390)Tgc>Cgc	p.C130R		NM_000041.2	NP_000032.1	P02649	APOE_HUMAN	apolipoprotein E	130	8 X 22 AA approximate tandem repeats.		C -> R (in HLPP3; form E3**, form E4, form E4/3 and some forms E5-type; only form E3** is disease-linked; dbSNP:rs429358). {ECO:0000269|PubMed:11042151, ECO:0000269|PubMed:12966036, ECO:0000269|PubMed:8287539, ECO:0000269|PubMed:9360638}.		aging (GO:0007568)|alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|artery morphogenesis (GO:0048844)|cell death (GO:0008219)|cellular calcium ion homeostasis (GO:0006874)|cellular response to cholesterol (GO:0071397)|cellular response to growth factor stimulus (GO:0071363)|cellular response to interleukin-1 (GO:0071347)|cGMP-mediated signaling (GO:0019934)|cholesterol catabolic process (GO:0006707)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|chylomicron remnant clearance (GO:0034382)|cytoskeleton organization (GO:0007010)|fatty acid homeostasis (GO:0055089)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle assembly (GO:0034380)|high-density lipoprotein particle clearance (GO:0034384)|high-density lipoprotein particle remodeling (GO:0034375)|intracellular transport (GO:0046907)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|long-chain fatty acid transport (GO:0015909)|low-density lipoprotein particle remodeling (GO:0034374)|maintenance of location in cell (GO:0051651)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of blood coagulation (GO:0030195)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cholesterol biosynthetic process (GO:0045541)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of dendritic spine development (GO:0061000)|negative regulation of dendritic spine maintenance (GO:1902951)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of inflammatory response (GO:0050728)|negative regulation of lipid biosynthetic process (GO:0051055)|negative regulation of lipid transport across blood brain barrier (GO:1903001)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron death (GO:1901215)|negative regulation of phospholipid efflux (GO:1902999)|negative regulation of platelet activation (GO:0010544)|negative regulation of postsynaptic membrane organization (GO:1901627)|negative regulation of presynaptic membrane organization (GO:1901630)|nitric oxide mediated signal transduction (GO:0007263)|oligodendrocyte differentiation (GO:0048709)|peripheral nervous system axon regeneration (GO:0014012)|phospholipid efflux (GO:0033700)|phototransduction, visible light (GO:0007603)|positive regulation of axon extension (GO:0045773)|positive regulation of beta-amyloid formation (GO:1902004)|positive regulation of cGMP biosynthetic process (GO:0030828)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of cholesterol esterification (GO:0010873)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of dendritic spine maintenance (GO:1902952)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of lipid transport across blood brain barrier (GO:1903002)|positive regulation of low-density lipoprotein particle receptor catabolic process (GO:0032805)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of neurofibrillary tangle assembly (GO:1902998)|positive regulation of neuron death (GO:1901216)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of phospholipid efflux (GO:1902995)|positive regulation of postsynaptic membrane organization (GO:1901628)|positive regulation of presynaptic membrane organization (GO:1901631)|protein import (GO:0017038)|receptor-mediated endocytosis (GO:0006898)|regulation of axon extension (GO:0030516)|regulation of beta-amyloid clearance (GO:1900221)|regulation of Cdc42 protein signal transduction (GO:0032489)|regulation of neuron death (GO:1901214)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of tau-protein kinase activity (GO:1902947)|response to dietary excess (GO:0002021)|response to ethanol (GO:0045471)|response to insulin (GO:0032868)|response to reactive oxygen species (GO:0000302)|response to retinoic acid (GO:0032526)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|synaptic transmission, cholinergic (GO:0007271)|triglyceride metabolic process (GO:0006641)|vasodilation (GO:0042311)|very-low-density lipoprotein particle clearance (GO:0034447)|very-low-density lipoprotein particle remodeling (GO:0034372)	blood microparticle (GO:0072562)|chylomicron (GO:0042627)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|high-density lipoprotein particle (GO:0034364)|intermediate-density lipoprotein particle (GO:0034363)|late endosome (GO:0005770)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)|vesicle (GO:0031982)	antioxidant activity (GO:0016209)|beta-amyloid binding (GO:0001540)|cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|hydroxyapatite binding (GO:0046848)|identical protein binding (GO:0042802)|lipid binding (GO:0008289)|lipid transporter activity (GO:0005319)|lipoprotein particle binding (GO:0071813)|low-density lipoprotein particle receptor binding (GO:0050750)|metal chelating activity (GO:0046911)|phosphatidylcholine-sterol O-acyltransferase activator activity (GO:0060228)|phospholipid binding (GO:0005543)|protein homodimerization activity (GO:0042803)|tau protein binding (GO:0048156)|very-low-density lipoprotein particle receptor binding (GO:0070326)			large_intestine(1)|lung(2)|prostate(1)	4	Lung NSC(12;0.0018)|all_lung(12;0.00481)	Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00327)|Epithelial(262;0.174)	Human Serum Albumin(DB00062)|Serum albumin iodonated(DB00064)	GGAGGACGTGTGCGGCCGCCT	0.736													c|||	754	0.150559	0.2678	0.1037	5008	,	,		8484	0.0863		0.1551	False		,,,				2504	0.0869				p.C130R		.											.	APOE-90	0			c.T388C	GRCh37	CM900020	APOE	M	rs429358	.	C	ARG/CYS	808,3460		86,636,1412	12.0	12.0	12.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	388	3.0	0.4	19	dbSNP_80	12	961,7261		66,829,3216	no	missense	APOE	NM_000041.2	180	152,1465,4628	CC,CT,TT	http://www.ncbi.nlm.nih.gov/pubmed?term	11.6882,18.9316,14.1633	benign	130/318	45411941	1769,10721	2134	4111	6245	SO:0001583	missense	348	exon4			GACGTGTGCGGCC	K00396	CCDS12647.1	19q13.31	2013-01-24			ENSG00000130203	ENSG00000130203		"""Apolipoproteins"""	613	protein-coding gene	gene with protein product		107741	"""Alzheimer disease 2 (APOE*E4-associated, late onset)"""	AD2		10662539	Standard	NM_000041		Approved		uc002pab.3	P02649	OTTHUMG00000128901	ENST00000252486.4:c.388T>C	19.37:g.45411941T>C	ENSP00000252486:p.Cys130Arg	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	37	26	NM_000041	0	0	2	1356	1354	B2RC15|C0JYY5|Q9P2S4	Missense_Mutation	SNP	ENST00000252486.4	37	CCDS12647.1	326	0.14926739926739926	128	0.2601626016260163	40	0.11049723756906077	50	0.08741258741258741	108	0.1424802110817942	C	0.007	-1.965077	0.00461	0.189316	0.116882	ENSG00000130203	ENST00000252486;ENST00000446996;ENST00000434152;ENST00000425718	T;T;T	0.81078	-0.24;-1.45;-1.45	5.25	3.02	0.34903	Apolipoprotein/apolipophorin (1);	0.486559	0.18187	N	0.148941	T	0.00012	0.0000	N	0.00289	-1.7	0.80722	P	0.0	B	0.02656	0.0	B	0.04013	0.001	T	0.25641	-1.0126	9	0.02654	T	1	-8.1152	3.0382	0.06129	0.1694:0.5443:0.1863:0.1001	rs429358;rs630496;rs61228756	130	P02649	APOE_HUMAN	R	130;130;175;130	ENSP00000252486:C130R;ENSP00000413135:C130R;ENSP00000410423:C130R	ENSP00000252486:C130R	C	+	1	0	APOE	50103781	0.019000	0.18553	0.404000	0.26397	0.109000	0.19521	0.121000	0.15667	1.239000	0.43787	-0.215000	0.12644	TGC	T|0.861;C|0.139		0.736	APOE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250865.2	NM_000041	
ZNF814	730051	ucsc.edu;bcgsc.ca;mdanderson.org	37	19	58385748	58385748	+	Missense_Mutation	SNP	G	G	A	rs145250945		TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr19:58385748G>A	ENST00000435989.2	-	3	1244	c.1010C>T	c.(1009-1011)gCt>gTt	p.A337V	ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000600634.1_Intron|ZNF814_ENST00000597832.1_Intron|ZNF814_ENST00000596604.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	337					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A337V(2)		NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						ACTGAAGCTAGCATATTTGCT	0.353																																					p.A337V		.											.	.	2	Substitution - Missense(2)	prostate(2)	c.C1010T						.						58.0	51.0	53.0					19																	58385748		692	1591	2283	SO:0001583	missense	730051	exon3			AAGCTAGCATATT		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.1010C>T	19.37:g.58385748G>A	ENSP00000410545:p.Ala337Val	Somatic	87	0		WXS	Illumina GAIIx	Phase_I	124	43	NM_001144989	0	0	0	0	0	A6NF35	Missense_Mutation	SNP	ENST00000435989.2	37	CCDS46212.1	.	.	.	.	.	.	.	.	.	.	.	3.777	-0.046344	0.07407	.	.	ENSG00000204514	ENST00000435989	T	0.15372	2.43	2.11	-4.21	0.03812	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.07728	0.0194	N	0.21142	0.635	0.09310	N	1	B	0.32781	0.384	B	0.18561	0.022	T	0.05649	-1.0872	9	0.66056	D	0.02	.	3.5015	0.07674	0.0936:0.1206:0.3016:0.4843	.	337	B7Z6K7	ZN814_HUMAN	V	337	ENSP00000410545:A337V	ENSP00000410545:A337V	A	-	2	0	ZNF814	63077560	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-2.230000	0.01207	-3.525000	0.00147	-3.867000	0.00017	GCT	.		0.353	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
ZNF814	730051	ucsc.edu;bcgsc.ca	37	19	58385762	58385762	+	Silent	SNP	C	C	G	rs199732634		TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr19:58385762C>G	ENST00000435989.2	-	3	1230	c.996G>C	c.(994-996)tcG>tcC	p.S332S	ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000600634.1_Intron|ZNF814_ENST00000597832.1_Intron|ZNF814_ENST00000596604.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	332					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S332S(2)		NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						ATTTGCTAAACGATTTCCCAC	0.358																																					p.S332S		.											.	.	2	Substitution - coding silent(2)	kidney(2)	c.G996C						.						25.0	25.0	25.0					19																	58385762		692	1589	2281	SO:0001819	synonymous_variant	730051	exon3			GCTAAACGATTTC		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.996G>C	19.37:g.58385762C>G		Somatic	85	0		WXS	Illumina GAIIx	Phase_I	97	29	NM_001144989	0	0	0	0	0	A6NF35	Silent	SNP	ENST00000435989.2	37	CCDS46212.1																																																																																			.		0.358	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
ZNF814	730051	bcgsc.ca	37	19	58385788	58385788	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr19:58385788A>G	ENST00000435989.2	-	3	1204	c.970T>C	c.(970-972)Tat>Cat	p.Y324H	ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000600634.1_Intron|ZNF814_ENST00000597832.1_Intron|ZNF814_ENST00000596604.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	324					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						CCACATTCATAAGGTCTTTTC	0.358																																					p.Y324H		.											.	.	0			c.T970C						.						15.0	12.0	13.0					19																	58385788		688	1564	2252	SO:0001583	missense	730051	exon3			ATTCATAAGGTCT		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.970T>C	19.37:g.58385788A>G	ENSP00000410545:p.Tyr324His	Somatic	71	0		WXS	Illumina GAIIx	Phase_I	55	6	NM_001144989	0	0	2	2	0	A6NF35	Missense_Mutation	SNP	ENST00000435989.2	37	CCDS46212.1	.	.	.	.	.	.	.	.	.	.	.	8.644	0.896732	0.17686	.	.	ENSG00000204514	ENST00000435989	T	0.21734	1.99	2.27	-1.27	0.09347	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.13970	0.0338	L	0.33485	1.01	0.09310	N	1	B	0.27498	0.18	B	0.22386	0.039	T	0.24368	-1.0162	9	0.72032	D	0.01	.	7.1587	0.25652	0.6135:0.0:0.3865:0.0	.	324	B7Z6K7	ZN814_HUMAN	H	324	ENSP00000410545:Y324H	ENSP00000410545:Y324H	Y	-	1	0	ZNF814	63077600	0.000000	0.05858	0.008000	0.14137	0.034000	0.12701	0.130000	0.15850	-0.181000	0.10619	0.113000	0.15668	TAT	.		0.358	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
ZSCAN1	284312	hgsc.bcm.edu	37	19	58549354	58549354	+	Silent	SNP	C	C	T	rs113374422	byFrequency	TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr19:58549354C>T	ENST00000282326.1	+	3	397	c.150C>T	c.(148-150)agC>agT	p.S50S	ZSCAN1_ENST00000391700.1_Silent_p.S50S|ZSCAN1_ENST00000601162.1_Silent_p.S50S	NM_182572.3	NP_872378.3	Q8NBB4	ZSCA1_HUMAN	zinc finger and SCAN domain containing 1	50	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	48		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)		ACGTGGCGAGCGGGCCGCACC	0.706													C|||	83	0.0165735	0.0038	0.0187	5008	,	,		10978	0.0		0.0586	False		,,,				2504	0.0061				p.S50S		.											.	ZSCAN1-92	0			c.C150T						.	C		34,4340		0,34,2153	14.0	16.0	15.0		150	-3.9	0.0	19	dbSNP_132	15	319,8239		2,315,3962	no	coding-synonymous	ZSCAN1	NM_182572.3		2,349,6115	TT,TC,CC		3.7275,0.7773,2.7297		50/409	58549354	353,12579	2187	4279	6466	SO:0001819	synonymous_variant	284312	exon3			GGCGAGCGGGCCG	AK091098	CCDS12969.1	19q13.43	2013-06-13	2004-04-21		ENSG00000152467	ENSG00000152467		"""-"", ""Zinc fingers, C2H2-type"""	23712	protein-coding gene	gene with protein product			"""zinc finger with SCAN domain 1"""			12477932	Standard	NM_182572		Approved	FLJ33779, ZNF915	uc002qrc.1	Q8NBB4	OTTHUMG00000183381	ENST00000282326.1:c.150C>T	19.37:g.58549354C>T		Somatic	2	0		WXS	Illumina GAIIx	Phase_I	34	7	NM_182572	0	0	0	0	0	Q3B798|Q6WLH8|Q86WS8	Silent	SNP	ENST00000282326.1	37	CCDS12969.1																																																																																			C|0.975;T|0.025		0.706	ZSCAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466427.1	NM_182572	
TPO	7173	hgsc.bcm.edu	37	2	1481231	1481231	+	Missense_Mutation	SNP	G	G	C	rs2175977	byFrequency	TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr2:1481231G>C	ENST00000345913.4	+	8	1284	c.1193G>C	c.(1192-1194)aGc>aCc	p.S398T	TPO_ENST00000346956.3_Missense_Mutation_p.S398T|TPO_ENST00000329066.4_Missense_Mutation_p.S398T|TPO_ENST00000382201.3_Missense_Mutation_p.S398T|TPO_ENST00000497517.2_Intron|TPO_ENST00000382198.1_Intron|TPO_ENST00000337415.3_Missense_Mutation_p.S398T|TPO_ENST00000349624.3_Intron	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	398			S -> T (in dbSNP:rs2175977). {ECO:0000269|PubMed:7550241}.		cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	GGCCGCGCCAGCGAGGTCCCC	0.761													G|||	3557	0.710264	0.8185	0.6571	5008	,	,		9157	0.7758		0.6034	False		,,,				2504	0.6442				p.S398T		.											.	TPO-332	0			c.G1193C						.	G	THR/SER,THR/SER,THR/SER,THR/SER,THR/SER,	2498,394		1072,354,20	2.0	2.0	2.0		1193,1193,1193,1193,1193,	4.1	1.0	2	dbSNP_96	2	4199,1477		1511,1177,150	no	missense,missense,missense,missense,missense,intron	TPO	NM_000547.5,NM_001206744.1,NM_001206745.1,NM_175719.3,NM_175721.3,NM_175722.3	58,58,58,58,58,	2583,1531,170	CC,CG,GG		26.0218,13.6238,21.8371	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,	398/934,398/934,398/877,398/877,398/890,	1481231	6697,1871	1446	2838	4284	SO:0001583	missense	7173	exon8			GCGCCAGCGAGGT		CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.1193G>C	2.37:g.1481231G>C	ENSP00000318820:p.Ser398Thr	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_175719	0	0	0	0	0	P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Missense_Mutation	SNP	ENST00000345913.4	37	CCDS1643.1	1512|1512	0.6923076923076923|0.6923076923076923	388|388	0.7886178861788617|0.7886178861788617	227|227	0.6270718232044199|0.6270718232044199	438|438	0.7657342657342657|0.7657342657342657	459|459	0.6055408970976254|0.6055408970976254	G|G	18.72|18.72	3.683431|3.683431	0.68157|0.68157	0.863762|0.863762	0.739782|0.739782	ENSG00000115705|ENSG00000115705	ENST00000536482|ENST00000337415;ENST00000345913;ENST00000346956;ENST00000329066;ENST00000382201;ENST00000422464	.|T;T;T;T;T;T	.|0.73897	.|-0.79;-0.79;-0.79;-0.79;-0.79;-0.79	4.99|4.99	4.08|4.08	0.47627|0.47627	.|.	.|0.142496	.|0.64402	.|N	.|0.000004	T|T	0.00012|0.00012	0.0000|0.0000	M|M	0.62723|0.62723	1.935|1.935	0.09310|0.09310	P|P	1.0|1.0	.|D;D;D	.|0.76494	.|0.998;0.998;0.999	.|D;D;D	.|0.69654	.|0.956;0.94;0.965	T|T	0.30060|0.30060	-0.9991|-0.9991	5|9	0.48119|0.56958	T|D	0.1|0.05	-48.0867|-48.0867	8.6411|8.6411	0.33978|0.33978	0.08:0.1541:0.7659:0.0|0.08:0.1541:0.7659:0.0	rs2175977|rs2175977	.|398;398;398	.|P07202-4;P07202-2;P07202	.|.;.;PERT_HUMAN	H|T	81|398;398;398;398;398;327	.|ENSP00000337263:S398T;ENSP00000318820:S398T;ENSP00000263886:S398T;ENSP00000329869:S398T;ENSP00000371636:S398T;ENSP00000405788:S327T	ENSP00000439133:Q81H|ENSP00000329869:S398T	Q|S	+|+	3|2	2|0	TPO|TPO	1460238|1460238	0.956000|0.956000	0.32656|0.32656	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	1.297000|1.297000	0.33400|0.33400	1.031000|1.031000	0.39867|0.39867	0.460000|0.460000	0.39030|0.39030	CAG|AGC	G|0.301;C|0.699		0.761	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206594.2	NM_000547	
C2orf81	388963	broad.mit.edu	37	2	74642280	74642280	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr2:74642280T>G	ENST00000517883.1	-	1	1430	c.739A>C	c.(739-741)Acc>Ccc	p.T247P	C2orf81_ENST00000290390.5_Missense_Mutation_p.T315P			A6NN90	CB081_HUMAN	chromosome 2 open reading frame 81	308										endometrium(3)|kidney(1)	4						GAGGGGCGGGTGGCGCCGCCC	0.716																																					p.T315P		.											.	.	0			c.A943C						.						7.0	10.0	9.0					2																	74642280		682	1575	2257	SO:0001583	missense	388963	exon4			GGCGGGTGGCGCC	AC005041, CH471053		2p13.1	2012-08-07			ENSG00000159239	ENSG00000159239			34350	protein-coding gene	gene with protein product						15815621	Standard	NM_001145054		Approved	LOC388963, hCG40743	uc010yrq.1	A6NN90	OTTHUMG00000164184	ENST00000517883.1:c.739A>C	2.37:g.74642280T>G	ENSP00000431103:p.Thr247Pro	Somatic	32	4		WXS	Illumina GAIIx	Phase_I	92	25	NM_001145054	0	0	1	1	0		Missense_Mutation	SNP	ENST00000517883.1	37		.	.	.	.	.	.	.	.	.	.	t	12.14	1.849844	0.32699	.	.	ENSG00000159239	ENST00000517883;ENST00000290390	.	.	.	3.91	-3.99	0.04069	.	1.321610	0.05237	N	0.511487	T	0.30135	0.0755	L	0.44542	1.39	0.09310	N	1	B	0.19073	0.033	B	0.22601	0.04	T	0.39396	-0.9616	9	0.72032	D	0.01	-3.9874	1.2321	0.01946	0.1409:0.2887:0.2874:0.283	.	315	G3XAA6	.	P	247;315	.	ENSP00000290390:T315P	T	-	1	0	C2orf81	74495788	0.007000	0.16637	0.000000	0.03702	0.008000	0.06430	0.309000	0.19332	-0.435000	0.07264	0.454000	0.30748	ACC	.		0.716	C2orf81-002	PUTATIVE	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000377683.1	NM_001145054	
RMND5A	64795	broad.mit.edu	37	2	86997248	86997248	+	Splice_Site	SNP	T	T	A			TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr2:86997248T>A	ENST00000283632.4	+	7	1452	c.957T>A	c.(955-957)ccT>ccA	p.P319P	RMND5A_ENST00000472843.1_3'UTR	NM_022780.3	NP_073617.1	Q9H871	RMD5A_HUMAN	required for meiotic nuclear division 5 homolog A (S. cerevisiae)	319										kidney(1)|liver(2)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	17						ATGAATTACCTGTGAGTTCCA	0.393																																					p.P319P		.											.	RMND5A-92	0			c.T957A						.						132.0	133.0	133.0					2																	86997248		2203	4300	6503	SO:0001630	splice_region_variant	64795	exon7			ATTACCTGTGAGT	BC012165	CCDS1991.1	2p11.2	2012-07-20			ENSG00000153561	ENSG00000153561			25850	protein-coding gene	gene with protein product	"""GID complex subunit 2 homolog A"""					12477932	Standard	NM_022780		Approved	FLJ13910, RMD5, GID2, GID2A	uc002srs.4	Q9H871	OTTHUMG00000130262	ENST00000283632.4:c.957+1T>A	2.37:g.86997248T>A		Somatic	116	0		WXS	Illumina GAIIx	Phase_I	104	3	NM_022780	0	0	0	0	0	D6W5M6|Q6NTF0|Q9H6W5|Q9H9H2	Silent	SNP	ENST00000283632.4	37	CCDS1991.1																																																																																			.		0.393	RMND5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252591.2	NM_022780	Silent
SMPD4	55627	ucsc.edu	37	2	130910188	130910188	+	Silent	SNP	A	A	G			TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr2:130910188A>G	ENST00000409031.1	-	20	3689	c.2541T>C	c.(2539-2541)taT>taC	p.Y847Y	SMPD4_ENST00000443958.2_Silent_p.Y511Y|SMPD4_ENST00000431183.2_Silent_p.Y745Y|SMPD4_ENST00000339679.7_Silent_p.Y705Y|SMPD4_ENST00000351288.6_Silent_p.Y818Y|SMPD4_ENST00000426662.2_Silent_p.Y483Y|SMPD4_ENST00000452225.2_Silent_p.Y588Y|SMPD4_ENST00000453750.1_Silent_p.Y596Y	NM_017951.4	NP_060421.2	Q9NXE4	NSMA3_HUMAN	sphingomyelin phosphodiesterase 4, neutral membrane (neutral sphingomyelinase-3)	808					cellular response to tumor necrosis factor (GO:0071356)|ceramide biosynthetic process (GO:0046513)|glycerophospholipid catabolic process (GO:0046475)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin catabolic process (GO:0006685)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|trans-Golgi network (GO:0005802)	metal ion binding (GO:0046872)|sphingomyelin phosphodiesterase activity (GO:0004767)|sphingomyelin phosphodiesterase D activity (GO:0050290)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(17)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	29	Colorectal(110;0.1)				Phosphatidylserine(DB00144)	CGTAGAGGACATAGCCCAGGG	0.642																																					p.Y847Y		.											.	SMPD4-90	0			c.T2541C						.						29.0	28.0	29.0					2																	130910188		2153	4238	6391	SO:0001819	synonymous_variant	55627	exon20			GAGGACATAGCCC	AF052134	CCDS2156.2, CCDS42751.1, CCDS54398.1	2q21.1	2009-11-06			ENSG00000136699	ENSG00000136699			32949	protein-coding gene	gene with protein product		610457				16517606	Standard	NM_001171083		Approved	FLJ20297, FLJ20756, nSMase-3, KIAA1418, NSMASE3, NET13	uc002tqr.2	Q9NXE4	OTTHUMG00000131624	ENST00000409031.1:c.2541T>C	2.37:g.130910188A>G		Somatic	179	0		WXS	Illumina GAIIx	Phase_I	231	1	NM_017951	0	0	27	39	12	B4DM23|B4DQ31|B4DRB8|B4DWK7|B4E0L6|E7ESA2|E9PCE6|Q6FI76|Q6P1P7|Q6ZT43|Q9H0M2|Q9NW20|Q9NWL2|Q9P2C9	Silent	SNP	ENST00000409031.1	37	CCDS42751.1	.	.	.	.	.	.	.	.	.	.	.	0.099	-1.154481	0.01700	.	.	ENSG00000136699	ENST00000439886	.	.	.	4.08	1.12	0.20585	.	.	.	.	.	T	0.59155	0.2173	.	.	.	0.53688	D	0.999979	.	.	.	.	.	.	T	0.51973	-0.8637	4	.	.	.	.	11.1425	0.48411	0.1874:0.0:0.8126:0.0	.	.	.	.	T	722	.	.	M	-	2	0	SMPD4	130626658	0.114000	0.22134	0.304000	0.25085	0.051000	0.14879	-0.293000	0.08320	-0.101000	0.12219	-1.816000	0.00601	ATG	.		0.642	SMPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254516.3	NM_017751	
TCF15	6939	hgsc.bcm.edu	37	20	590456	590456	+	Silent	SNP	A	A	G	rs282164	byFrequency	TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr20:590456A>G	ENST00000246080.3	-	1	586	c.426T>C	c.(424-426)cgT>cgC	p.R142R		NM_004609.3	NP_004600.2	Q12870	TCF15_HUMAN	transcription factor 15 (basic helix-loop-helix)	142					death (GO:0016265)|ear development (GO:0043583)|eating behavior (GO:0042755)|establishment of epithelial cell apical/basal polarity (GO:0045198)|mesenchymal to epithelial transition (GO:0060231)|mesoderm development (GO:0007498)|muscle organ morphogenesis (GO:0048644)|neuromuscular process controlling posture (GO:0050884)|paraxial mesoderm development (GO:0048339)|post-anal tail morphogenesis (GO:0036342)|regulation of gene expression involved in extracellular matrix organization (GO:1901311)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|respiratory system process (GO:0003016)|skeletal system morphogenesis (GO:0048705)|skin development (GO:0043588)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|lung(2)|prostate(1)	4		Breast(17;0.231)				TGCCCGCGGCACGGAAGCACG	0.736													g|||	4317	0.862021	0.7413	0.9035	5008	,	,		6474	0.998		0.8072	False		,,,				2504	0.9121				p.R142R		.											.	TCF15-90	0			c.T426C						.			3211,1033		1232,747,143	7.0	8.0	8.0		426	-9.0	0.0	20	dbSNP_79	8	6663,1669		2708,1247,211	no	coding-synonymous	TCF15	NM_004609.3		3940,1994,354	GG,GA,AA		20.0312,24.3402,21.4854		142/200	590456	9874,2702	2122	4166	6288	SO:0001819	synonymous_variant	6939	exon1			CGCGGCACGGAAG		CCDS33432.1	20p13	2013-05-21			ENSG00000125878	ENSG00000125878		"""Basic helix-loop-helix proteins"""	11627	protein-coding gene	gene with protein product		601010				8825648, 8041747	Standard	NM_004609		Approved	EC2, PARAXIS, bHLHa40	uc002wdz.3	Q12870	OTTHUMG00000031640	ENST00000246080.3:c.426T>C	20.37:g.590456A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	9	NM_004609	0	0	0	1	1	Q9NQQ1	Silent	SNP	ENST00000246080.3	37	CCDS33432.1																																																																																			A|0.165;G|0.835		0.736	TCF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077475.2	NM_004609	
FRG1B	284802	bcgsc.ca	37	20	29623219	29623219	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr20:29623219A>G	ENST00000278882.3	+	3	411	c.31A>G	c.(31-33)Atg>Gtg	p.M11V	FRG1B_ENST00000439954.2_Missense_Mutation_p.N12S|FRG1B_ENST00000358464.4_Missense_Mutation_p.M11V			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	11										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						GCACTCGACAATGGTCTTTTT	0.413																																					.		.											.	FRG1B-22	0			.						.																																			SO:0001583	missense	284802	.			TCGACAATGGTCT			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.31A>G	20.37:g.29623219A>G	ENSP00000278882:p.Met11Val	Somatic	686	16		WXS	Illumina GAIIx	Phase_I	769	40	.	0	0	39	43	4	C4AME5	RNA	SNP	ENST00000278882.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	a|a	0.925|0.925	-0.714671|-0.714671	0.03206|0.03206	.|.	.|.	ENSG00000149531|ENSG00000149531	ENST00000278882;ENST00000358464|ENST00000439954	.|T	.|0.53206	.|0.63	1.93|1.93	1.93|1.93	0.25924|0.25924	.|.	0.114289|.	0.56097|.	U|.	0.000024|.	T|T	0.42040|0.42040	0.1185|0.1185	.|.	.|.	.|.	0.18873|0.18873	N|N	0.999983|0.999983	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.36648|0.36648	-0.9739|-0.9739	6|6	0.66056|0.54805	D|T	0.02|0.06	.|.	4.9441|4.9441	0.13980|0.13980	0.6812:0.3188:0.0:0.0|0.6812:0.3188:0.0:0.0	.|.	.|.	.|.	.|.	V|S	11|12	.|ENSP00000408863:N12S	ENSP00000278882:M11V|ENSP00000408863:N12S	M|N	+|+	1|2	0|0	FRG1B|FRG1B	28236880|28236880	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.107000|0.107000	0.19398|0.19398	3.154000|3.154000	0.50693|0.50693	1.147000|1.147000	0.42369|0.42369	0.347000|0.347000	0.21830|0.21830	ATG|AAT	.		0.413	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
TMEM189-UBE2V1	387522	hgsc.bcm.edu	37	20	48770159	48770159	+	Missense_Mutation	SNP	T	T	C	rs232733		TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr20:48770159T>C	ENST00000341698.2	-	1	15	c.16A>G	c.(16-18)Aac>Gac	p.N6D	TMEM189_ENST00000371652.4_Missense_Mutation_p.N6D|TMEM189_ENST00000371650.5_Missense_Mutation_p.N6D|TMEM189_ENST00000557021.1_Missense_Mutation_p.N6D	NM_001257399.1	NP_001244328.1			TMEM189-UBE2V1 readthrough											breast(1)|endometrium(4)|large_intestine(6)|lung(6)	17			BRCA - Breast invasive adenocarcinoma(9;8.29e-07)			CCCGGCCAGTTCTCGGCGCCC	0.766													C|||	5008	1.0	1.0	1.0	5008	,	,		6103	1.0		1.0	False		,,,				2504	1.0				p.N6D		.											.	TMEM189-22	0			c.A16G						.						2.0	2.0	2.0					20																	48770159		1101	2248	3349	SO:0001583	missense	387521	exon1			GCCAGTTCTCGGC	U39361	CCDS13424.1	20q13.13	2011-05-31			ENSG00000124208	ENSG00000124208			33521	other	readthrough						11076860	Standard	NM_199203		Approved	Kua-UEV, CROC-1B	uc002xvf.3		OTTHUMG00000033085	ENST00000341698.2:c.16A>G	20.37:g.48770159T>C	ENSP00000344166:p.Asn6Asp	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_199129	0	0	0	0	0		Missense_Mutation	SNP	ENST00000341698.2	37	CCDS13424.1	2182	0.9990842490842491	492	1.0	360	0.994475138121547	572	1.0	758	1.0	C	0.054	-1.242740	0.01481	.	.	ENSG00000124208;ENSG00000240849;ENSG00000240849;ENSG00000240849	ENST00000341698;ENST00000557021;ENST00000371650;ENST00000371652	T;T;T;T	0.46819	0.86;0.86;1.11;1.11	3.81	0.707	0.18139	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.40757	-0.9546	8	0.02654	T	1	.	3.4688	0.07559	0.1731:0.5239:0.0:0.303	rs232733;rs674252;rs56654084	6;6;6	Q5TGE1;A5PLL7;G3V2F7	.;TM189_HUMAN;.	D	6	ENSP00000344166:N6D;ENSP00000450635:N6D;ENSP00000360713:N6D;ENSP00000360715:N6D	ENSP00000360713:N6D	N	-	1	0	TMEM189-UBE2V1;TMEM189	48203566	1.000000	0.71417	0.503000	0.27626	0.073000	0.16967	0.497000	0.22514	-0.274000	0.09232	-2.268000	0.00277	AAC	C|0.999;T|0.001		0.766	TMEM189-UBE2V1-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000080532.5		
OGFR	11054	hgsc.bcm.edu	37	20	61444569	61444569	+	Silent	SNP	A	A	G	rs3204348		TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr20:61444569A>G	ENST00000290291.6	+	7	1627	c.1602A>G	c.(1600-1602)ccA>ccG	p.P534P	OGFR_ENST00000370461.1_Silent_p.P482P	NM_007346.2	NP_031372.2	Q9NZT2	OGFR_HUMAN	opioid growth factor receptor	534	7 X 20 AA approximate tandem repeats of [ST]-P-S-E-T-P-G-P-[SR]-P-A-G-P-[AT]- [GR]-D-E-P-A-[EK].				opioid receptor signaling pathway (GO:0038003)|regulation of cell growth (GO:0001558)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	opioid receptor activity (GO:0004985)			endometrium(2)|kidney(1)|lung(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	17	Breast(26;3.65e-08)					GGGACGAGCCAGCCGAGAGCC	0.721																																					p.P534P		.											.	OGFR-68	0			c.A1602G						.						11.0	17.0	15.0					20																	61444569		2124	4201	6325	SO:0001819	synonymous_variant	11054	exon7			CGAGCCAGCCGAG	AF109134	CCDS13504.1	20q13.3	2008-05-02			ENSG00000060491	ENSG00000060491			15768	protein-coding gene	gene with protein product		606459				10677613	Standard	NM_007346		Approved	7-60	uc002ydj.3	Q9NZT2	OTTHUMG00000032937	ENST00000290291.6:c.1602A>G	20.37:g.61444569A>G		Somatic	11	0		WXS	Illumina GAIIx	Phase_I	94	6	NM_007346	0	0	156	169	13	O96029|Q4VXW5|Q96CM2|Q9BQW1|Q9H4H0|Q9H7J5|Q9NZT3|Q9NZT4	Silent	SNP	ENST00000290291.6	37	CCDS13504.1																																																																																			A|0.979;G|0.021		0.721	OGFR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080067.1		
OGFR	11054	hgsc.bcm.edu	37	20	61444637	61444637	+	Missense_Mutation	SNP	G	G	C	rs78981100		TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr20:61444637G>C	ENST00000290291.6	+	7	1695	c.1670G>C	c.(1669-1671)aGc>aCc	p.S557T	OGFR_ENST00000370461.1_Missense_Mutation_p.S505T	NM_007346.2	NP_031372.2	Q9NZT2	OGFR_HUMAN	opioid growth factor receptor	557	7 X 20 AA approximate tandem repeats of [ST]-P-S-E-T-P-G-P-[SR]-P-A-G-P-[AT]- [GR]-D-E-P-A-[EK].				opioid receptor signaling pathway (GO:0038003)|regulation of cell growth (GO:0001558)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	opioid receptor activity (GO:0004985)	p.S557T(3)		endometrium(2)|kidney(1)|lung(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	17	Breast(26;3.65e-08)					CCAGCCGAGAGCCCATCGGAG	0.746																																					p.S557T		.											.	OGFR-68	3	Substitution - Missense(3)	upper_aerodigestive_tract(1)|prostate(1)|skin(1)	c.G1670C						.						5.0	10.0	8.0					20																	61444637		1884	3696	5580	SO:0001583	missense	11054	exon7			CCGAGAGCCCATC	AF109134	CCDS13504.1	20q13.3	2008-05-02			ENSG00000060491	ENSG00000060491			15768	protein-coding gene	gene with protein product		606459				10677613	Standard	NM_007346		Approved	7-60	uc002ydj.3	Q9NZT2	OTTHUMG00000032937	ENST00000290291.6:c.1670G>C	20.37:g.61444637G>C	ENSP00000290291:p.Ser557Thr	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	50	14	NM_007346	0	0	116	129	13	O96029|Q4VXW5|Q96CM2|Q9BQW1|Q9H4H0|Q9H7J5|Q9NZT3|Q9NZT4	Missense_Mutation	SNP	ENST00000290291.6	37	CCDS13504.1	.	.	.	.	.	.	.	.	.	.	G	7.631	0.678796	0.14841	.	.	ENSG00000060491	ENST00000290291;ENST00000357163;ENST00000370469;ENST00000370461	T;T	0.40225	1.04;1.04	0.773	0.773	0.18516	.	.	.	.	.	T	0.20373	0.0490	N	0.24115	0.695	0.09310	N	1	P;B;P	0.45594	0.862;0.386;0.862	B;B;B	0.38655	0.278;0.099;0.278	T	0.08868	-1.0701	9	0.09338	T	0.73	3.6159	4.5226	0.11966	0.2481:0.0:0.7519:0.0	.	557;540;557	B3KMQ6;Q05BV5;Q9NZT2	.;.;OGFR_HUMAN	T	557;537;392;505	ENSP00000290291:S557T;ENSP00000359491:S505T	ENSP00000290291:S557T	S	+	2	0	OGFR	60915082	0.000000	0.05858	0.008000	0.14137	0.008000	0.06430	-1.934000	0.01552	0.687000	0.31509	0.185000	0.17295	AGC	.		0.746	OGFR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080067.1		
DIDO1	11083	broad.mit.edu;bcgsc.ca	37	20	61541101	61541101	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr20:61541101C>T	ENST00000266070.4	-	4	1436	c.1111G>A	c.(1111-1113)Gag>Aag	p.E371K	DIDO1_ENST00000395340.1_Missense_Mutation_p.E371K|DIDO1_ENST00000395335.2_Missense_Mutation_p.E371K|DIDO1_ENST00000266071.5_Missense_Mutation_p.E371K|DIDO1_ENST00000354665.4_Missense_Mutation_p.E371K|DIDO1_ENST00000395343.1_Missense_Mutation_p.E371K|DIDO1_ENST00000370371.4_Missense_Mutation_p.E371K|DIDO1_ENST00000370368.1_Missense_Mutation_p.E371K|DIDO1_ENST00000370366.1_Missense_Mutation_p.E371K	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1	371					apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					GCAGCTTTCTCAATTCTACCC	0.468																																					p.E371K	Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)	.											.	DIDO1-96	0			c.G1111A						.						262.0	247.0	252.0					20																	61541101		2203	4300	6503	SO:0001583	missense	11083	exon4			CTTTCTCAATTCT	AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.1111G>A	20.37:g.61541101C>T	ENSP00000266070:p.Glu371Lys	Somatic	162	0		WXS	Illumina GAIIx	Phase_I	320	11	NM_080797	0	0	17	18	1	A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	Missense_Mutation	SNP	ENST00000266070.4	37	CCDS33506.1	.	.	.	.	.	.	.	.	.	.	C	20.5	3.998599	0.74818	.	.	ENSG00000101191	ENST00000266070;ENST00000395343;ENST00000395340;ENST00000395335;ENST00000370371;ENST00000370368;ENST00000354665;ENST00000370366;ENST00000266071	T;T;T;T;T;T;T;T;T	0.20598	2.9;2.9;2.56;2.56;2.06;2.06;2.06;2.08;2.08	5.36	5.36	0.76844	.	0.000000	0.43416	D	0.000574	T	0.50069	0.1594	M	0.78049	2.395	0.80722	D	1	D;D;D;D	0.89917	0.998;0.998;1.0;0.997	D;D;D;D	0.87578	0.981;0.981;0.998;0.985	T	0.43766	-0.9371	10	0.41790	T	0.15	-50.471	19.4402	0.94817	0.0:1.0:0.0:0.0	.	371;371;371;371	Q9BTC0-2;Q9BTC0-3;Q9BTC0-1;Q9BTC0	.;.;.;DIDO1_HUMAN	K	371	ENSP00000266070:E371K;ENSP00000378752:E371K;ENSP00000378749:E371K;ENSP00000378744:E371K;ENSP00000359397:E371K;ENSP00000359394:E371K;ENSP00000346692:E371K;ENSP00000359391:E371K;ENSP00000266071:E371K	ENSP00000266070:E371K	E	-	1	0	DIDO1	61011546	1.000000	0.71417	0.994000	0.49952	0.109000	0.19521	5.516000	0.67055	2.665000	0.90641	0.561000	0.74099	GAG	.		0.468	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080091.2	NM_080796	
CHRNA4	1137	hgsc.bcm.edu	37	20	61992467	61992467	+	Silent	SNP	C	C	T	rs79739740	byFrequency	TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr20:61992467C>T	ENST00000370263.4	-	1	272	c.51G>A	c.(49-51)ctG>ctA	p.L17L	CHRNA4_ENST00000463705.1_Intron|RP11-261N11.8_ENST00000370257.1_RNA	NM_000744.6|NM_001256573.1	NP_000735.1|NP_001243502.1	P43681	ACHA4_HUMAN	cholinergic receptor, nicotinic, alpha 4 (neuronal)	17					action potential (GO:0001508)|B cell activation (GO:0042113)|behavioral response to nicotine (GO:0035095)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|cognition (GO:0050890)|DNA repair (GO:0006281)|exploration behavior (GO:0035640)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|neurological system process (GO:0050877)|regulation of dopamine secretion (GO:0014059)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of membrane potential (GO:0042391)|respiratory gaseous exchange (GO:0007585)|response to hypoxia (GO:0001666)|response to nicotine (GO:0035094)|response to oxidative stress (GO:0006979)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(19)|prostate(3)|skin(3)|soft_tissue(1)	33	all_cancers(38;1.71e-10)				Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Dextromethorphan(DB00514)|Galantamine(DB00674)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Nicotine(DB00184)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)|Varenicline(DB01273)	TCCCcagaagcagcagcagcg	0.756													c|||	137	0.0273562	0.003	0.0447	5008	,	,		7000	0.002		0.0636	False		,,,				2504	0.0368				p.L17L		.											.	CHRNA4-91	0			c.G51A						.						1.0	3.0	2.0					20																	61992467		1121	2450	3571	SO:0001819	synonymous_variant	1137	exon1			CAGAAGCAGCAGC		CCDS13517.1	20q13.33	2013-09-20	2012-02-07		ENSG00000101204	ENSG00000101204		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1958	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 4 (neuronal)"""	118504	"""cholinergic receptor, nicotinic, alpha polypeptide 4"""	EBN, EBN1		1505988	Standard	NM_000744		Approved	BFNC	uc002yes.3	P43681	OTTHUMG00000033080	ENST00000370263.4:c.51G>A	20.37:g.61992467C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_000744	0	0	0	0	0	Q4JGR7|Q4VAQ5|Q4VAQ6	Silent	SNP	ENST00000370263.4	37	CCDS13517.1																																																																																			G|0.977;A|0.023		0.756	CHRNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080508.3		
CLIC6	54102	hgsc.bcm.edu	37	21	36042579	36042579	+	Missense_Mutation	SNP	C	C	G	rs13049028	byFrequency	TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr21:36042579C>G	ENST00000360731.3	+	1	892	c.892C>G	c.(892-894)Caa>Gaa	p.Q298E	CLIC6_ENST00000349499.2_Missense_Mutation_p.Q298E			Q96NY7	CLIC6_HUMAN	chloride intracellular channel 6	298						chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	voltage-gated chloride channel activity (GO:0005247)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	19						TGAGCCGCAGCAATCGGGGGA	0.756													G|||	1116	0.222843	0.2648	0.1657	5008	,	,		8796	0.1825		0.2137	False		,,,				2504	0.2577				p.Q298E		.											.	CLIC6-91	0			c.C892G						.	G	GLU/GLN	454,2348		41,372,988	2.0	2.0	2.0		892	-0.8	0.0	21	dbSNP_121	2	925,5025		74,777,2124	no	missense	CLIC6	NM_053277.1	29	115,1149,3112	GG,GC,CC		15.5462,16.2027,15.7564	benign	298/687	36042579	1379,7373	1401	2975	4376	SO:0001583	missense	54102	exon1			CCGCAGCAATCGG	AF426169	CCDS13638.1	21q22.12	2012-09-26			ENSG00000159212	ENSG00000159212		"""Ion channels / Chloride channels : Intracellular"""	2065	protein-coding gene	gene with protein product		615321		CLIC1L		10830953	Standard	NM_053277		Approved	CLIC5	uc002yuf.1	Q96NY7	OTTHUMG00000086237	ENST00000360731.3:c.892C>G	21.37:g.36042579C>G	ENSP00000353959:p.Gln298Glu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	15	14	NM_053277	0	0	1	1	0	A8K0U8|Q8IX31	Missense_Mutation	SNP	ENST00000360731.3	37		434	0.1987179487179487	125	0.2540650406504065	63	0.17403314917127072	81	0.14160839160839161	165	0.21767810026385223	G	0.195	-1.050076	0.01981	0.162027	0.155462	ENSG00000159212	ENST00000360731;ENST00000349499	T;T	0.21361	2.02;2.01	3.75	-0.792	0.10925	.	.	.	.	.	T	0.00012	0.0000	N	0.02539	-0.55	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.43861	-0.9365	8	0.02654	T	1	-10.3162	7.3436	0.26650	0.1642:0.3831:0.4527:0.0	rs13049028	298;298	Q96NY7;Q96NY7-2	CLIC6_HUMAN;.	E	298	ENSP00000353959:Q298E;ENSP00000290332:Q298E	ENSP00000290332:Q298E	Q	+	1	0	CLIC6	34964449	0.256000	0.24012	0.012000	0.15200	0.009000	0.06853	0.804000	0.27098	-0.082000	0.12640	-0.676000	0.03789	CAA	C|0.802;G|0.198		0.756	CLIC6-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000194156.1		
CLIC6	54102	hgsc.bcm.edu	37	21	36042584	36042584	+	Silent	SNP	G	G	A	rs13049239	byFrequency	TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr21:36042584G>A	ENST00000360731.3	+	1	897	c.897G>A	c.(895-897)tcG>tcA	p.S299S	CLIC6_ENST00000349499.2_Silent_p.S299S			Q96NY7	CLIC6_HUMAN	chloride intracellular channel 6	299						chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	voltage-gated chloride channel activity (GO:0005247)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	19						CGCAGCAATCGGGGGACGGCA	0.751													A|||	1101	0.219848	0.2549	0.1628	5008	,	,		9144	0.1825		0.2137	False		,,,				2504	0.2577				p.S299S		.											.	CLIC6-91	0			c.G897A						.	A		412,2410		18,376,1017	2.0	2.0	2.0		897	-0.2	0.0	21	dbSNP_121	2	842,5136		42,758,2189	no	coding-synonymous	CLIC6	NM_053277.1		60,1134,3206	AA,AG,GG		14.085,14.5996,14.25		299/687	36042584	1254,7546	1411	2989	4400	SO:0001819	synonymous_variant	54102	exon1			GCAATCGGGGGAC	AF426169	CCDS13638.1	21q22.12	2012-09-26			ENSG00000159212	ENSG00000159212		"""Ion channels / Chloride channels : Intracellular"""	2065	protein-coding gene	gene with protein product		615321		CLIC1L		10830953	Standard	NM_053277		Approved	CLIC5	uc002yuf.1	Q96NY7	OTTHUMG00000086237	ENST00000360731.3:c.897G>A	21.37:g.36042584G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	16	15	NM_053277	0	0	1	1	0	A8K0U8|Q8IX31	Silent	SNP	ENST00000360731.3	37																																																																																				G|0.803;A|0.197		0.751	CLIC6-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000194156.1		
KRTAP10-5	386680	ucsc.edu;bcgsc.ca	37	21	46000064	46000064	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr21:46000064C>T	ENST00000400372.1	-	1	417	c.392G>A	c.(391-393)tGt>tAt	p.C131Y	TSPEAR_ENST00000323084.4_Intron	NM_198694.2	NP_941967.2	P60370	KR105_HUMAN	keratin associated protein 10-5	131	22 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				endometrium(2)|kidney(1)|lung(9)|prostate(1)|upper_aerodigestive_tract(1)	14						GACAGGCACACAGCAGGACTG	0.592																																					p.C131Y		.											.	KRTAP10-5-90	0			c.G392A						.						144.0	145.0	145.0					21																	46000064		2203	4300	6503	SO:0001583	missense	386680	exon1			GGCACACAGCAGG	AJ566384	CCDS42958.1	21q22.3	2007-10-05			ENSG00000241123	ENSG00000241123		"""Keratin associated proteins"""	22969	protein-coding gene	gene with protein product				KRTAP18-5			Standard	NM_198694		Approved	KAP10.5, KAP18.5	uc002zfl.1	P60370	OTTHUMG00000057638	ENST00000400372.1:c.392G>A	21.37:g.46000064C>T	ENSP00000383223:p.Cys131Tyr	Somatic	340	3		WXS	Illumina GAIIx	Phase_I	407	305	NM_198694	0	0	0	0	0	Q0VAR7|Q0VAR8|Q70LJ3	Missense_Mutation	SNP	ENST00000400372.1	37	CCDS42958.1	.	.	.	.	.	.	.	.	.	.	c	6.897	0.534965	0.13188	.	.	ENSG00000241123	ENST00000400372	T	0.03242	4.0	3.57	3.57	0.40892	.	.	.	.	.	T	0.20129	0.0484	M	0.90425	3.115	0.26138	N	0.980321	D	0.71674	0.998	D	0.67382	0.951	T	0.02991	-1.1085	9	0.59425	D	0.04	.	11.0118	0.47667	0.0:1.0:0.0:0.0	.	131	P60370	KR105_HUMAN	Y	131	ENSP00000383223:C131Y	ENSP00000383223:C131Y	C	-	2	0	KRTAP10-5	44824492	0.007000	0.16637	0.037000	0.18230	0.301000	0.27625	0.196000	0.17176	1.710000	0.51325	0.455000	0.32223	TGT	.		0.592	KRTAP10-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128042.1		
SCARF2	91179	hgsc.bcm.edu	37	22	20780091	20780091	+	Silent	SNP	C	C	G	rs759610		TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr22:20780091C>G	ENST00000266214.5	-	11	2291	c.2187G>C	c.(2185-2187)ccG>ccC	p.P729P	SCARF2_ENST00000405555.3_Silent_p.P724P	NM_153334.4	NP_699165.2	Q96GP6	SREC2_HUMAN	scavenger receptor class F, member 2	729	Pro-rich.				cell adhesion (GO:0007155)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|skin(2)	10	Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			CGGGCAGCCCCGGGGGGCGCG	0.781																																					p.P729P		.											.	SCARF2-341	0			c.G2187C						.	G	,	3110,60		1525,60,0	4.0	5.0	4.0		2187,2172	-6.8	0.1	22	dbSNP_86	4	5974,118		2928,118,0	no	coding-synonymous,coding-synonymous	SCARF2	NM_153334.4,NM_182895.2	,	4453,178,0	GG,GC,CC		1.937,1.8927,1.9218	,	729/871,724/866	20780091	9084,178	1585	3046	4631	SO:0001819	synonymous_variant	91179	exon11			CAGCCCCGGGGGG	AF522196	CCDS13779.1, CCDS46666.1	22q11.21	2011-10-10			ENSG00000244486	ENSG00000244486			19869	protein-coding gene	gene with protein product		613619				12154095	Standard	XM_006724364		Approved	SREC-II, SREC2, HUMZD58C02	uc002zsk.2	Q96GP6	OTTHUMG00000150779	ENST00000266214.5:c.2187G>C	22.37:g.20780091C>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	6	NM_153334	0	0	0	0	0	E5RFB8|Q58A83|Q8IXF3|Q9BW74	Silent	SNP	ENST00000266214.5	37	CCDS13779.1																																																																																			C|0.138;G|0.862		0.781	SCARF2-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320047.1		
SCARF2	91179	hgsc.bcm.edu	37	22	20780097	20780097	+	Silent	SNP	G	G	C	rs759609		TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr22:20780097G>C	ENST00000266214.5	-	11	2285	c.2181C>G	c.(2179-2181)cgC>cgG	p.R727R	SCARF2_ENST00000405555.3_Silent_p.R722R	NM_153334.4	NP_699165.2	Q96GP6	SREC2_HUMAN	scavenger receptor class F, member 2	727	Pro-rich.				cell adhesion (GO:0007155)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|skin(2)	10	Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			GCCCCGGGGGGCGCGGCGTTG	0.781																																					p.R727R		.											.	SCARF2-341	0			c.C2181G						.	C	,	3271,119		1585,101,9	5.0	5.0	5.0		2181,2166	-5.3	0.0	22	dbSNP_86	5	6306,190		3060,186,2	no	coding-synonymous,coding-synonymous	SCARF2	NM_153334.4,NM_182895.2	,	4645,287,11	CC,CG,GG		2.9249,3.5103,3.1256	,	727/871,722/866	20780097	9577,309	1695	3248	4943	SO:0001819	synonymous_variant	91179	exon11			CGGGGGGCGCGGC	AF522196	CCDS13779.1, CCDS46666.1	22q11.21	2011-10-10			ENSG00000244486	ENSG00000244486			19869	protein-coding gene	gene with protein product		613619				12154095	Standard	XM_006724364		Approved	SREC-II, SREC2, HUMZD58C02	uc002zsk.2	Q96GP6	OTTHUMG00000150779	ENST00000266214.5:c.2181C>G	22.37:g.20780097G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	4	NM_153334	0	0	0	0	0	E5RFB8|Q58A83|Q8IXF3|Q9BW74	Silent	SNP	ENST00000266214.5	37	CCDS13779.1																																																																																			G|0.826;C|0.174		0.781	SCARF2-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320047.1		
NEFH	4744	hgsc.bcm.edu;ucsc.edu	37	22	29885594	29885594	+	Silent	SNP	A	A	T	rs79235463|rs200984527|rs267607533	byFrequency	TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr22:29885594A>T	ENST00000310624.6	+	4	1998	c.1965A>T	c.(1963-1965)ccA>ccT	p.P655P		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	661	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						CCAAGTCCCCAGAGAAGGAAG	0.552																																					p.P655P		.											.	NEFH-90	0			c.A1965T						.						83.0	92.0	89.0					22																	29885594		2203	4300	6503	SO:0001819	synonymous_variant	4744	exon4			GTCCCCAGAGAAG		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1965A>T	22.37:g.29885594A>T		Somatic	250	0		WXS	Illumina GAIIx	Phase_I	219	61	NM_021076	0	0	18	18	0	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Silent	SNP	ENST00000310624.6	37	CCDS13858.1																																																																																			A|0.500;T|0.500		0.552	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
NEFH	4744	broad.mit.edu	37	22	29885599	29885604	+	In_Frame_Del	DEL	AGGAAG	AGGAAG	-	rs267607534|rs373980795|rs267607533|rs149571560|rs200984527|rs370803228		TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr22:29885599_29885604delAGGAAG	ENST00000310624.6	+	4	2003_2008	c.1970_1975delAGGAAG	c.(1969-1977)aaggaagag>aag	p.EE658del		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	664	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						TCCCCAGAGAAGGAAGAGGCCAAGTC	0.558																																					p.657_659del		.											.	NEFH-90	0			c.1970_1975del						.																																			SO:0001651	inframe_deletion	4744	exon4			CAGAGAAGGAAGA		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1970_1975delAGGAAG	22.37:g.29885599_29885604delAGGAAG	ENSP00000311997:p.Glu658_Glu659del	Somatic	266	0		WXS	Illumina GAIIx	Phase_I	216	28	NM_021076	0	0	0	0	0	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	In_Frame_Del	DEL	ENST00000310624.6	37	CCDS13858.1																																																																																			.		0.558	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
TMPRSS6	164656	broad.mit.edu;bcgsc.ca	37	22	37462232	37462232	+	Nonsense_Mutation	SNP	C	C	T			TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr22:37462232C>T	ENST00000346753.3	-	18	2440	c.2324G>A	c.(2323-2325)tGg>tAg	p.W775*	TMPRSS6_ENST00000406856.1_Nonsense_Mutation_p.W788*|TMPRSS6_ENST00000406725.1_Nonsense_Mutation_p.W766*|TMPRSS6_ENST00000381792.2_Nonsense_Mutation_p.W788*	NM_153609.2	NP_705837.1	Q8IU80	TMPS6_HUMAN	transmembrane protease, serine 6	775	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				angiogenesis (GO:0001525)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|intracellular signal transduction (GO:0035556)|iron ion homeostasis (GO:0055072)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)			breast(5)|central_nervous_system(4)|endometrium(4)|kidney(4)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(2)|stomach(3)	40						CGCCAGGAACCAGCGGCCACT	0.622																																					p.W775X		.											.	TMPRSS6-292	0			c.G2324A						.						29.0	29.0	29.0					22																	37462232		2202	4299	6501	SO:0001587	stop_gained	164656	exon18			AGGAACCAGCGGC	AY055383	CCDS13941.1, CCDS74856.1, CCDS74857.1	22q13.1	2010-04-13			ENSG00000187045	ENSG00000187045		"""Serine peptidases / Transmembrane"""	16517	protein-coding gene	gene with protein product		609862					Standard	NM_001289000		Approved	FLJ30744	uc003aqs.1	Q8IU80	OTTHUMG00000150541	ENST00000346753.3:c.2324G>A	22.37:g.37462232C>T	ENSP00000334962:p.Trp775*	Somatic	139	0		WXS	Illumina GAIIx	Phase_I	133	5	NM_153609	0	0	3	3	0	B0QYB4|B0QYB7|B0QYB8|Q5TI06|Q6ICC2|Q6UXD8|Q8IUE2|Q8IXV8	Nonsense_Mutation	SNP	ENST00000346753.3	37	CCDS13941.1	.	.	.	.	.	.	.	.	.	.	C	39	7.517722	0.98332	.	.	ENSG00000187045	ENST00000381792;ENST00000346753;ENST00000406725;ENST00000406856	.	.	.	4.46	4.46	0.54185	.	0.162187	0.44483	D	0.000452	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	17.4693	0.87641	0.0:1.0:0.0:0.0	.	.	.	.	X	788;775;766;788	.	ENSP00000334962:W775X	W	-	2	0	TMPRSS6	35792178	1.000000	0.71417	1.000000	0.80357	0.886000	0.51366	7.675000	0.84002	2.178000	0.69098	0.467000	0.42956	TGG	.		0.622	TMPRSS6-003	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000318822.1	NM_153609	
ARHGAP8	23779	broad.mit.edu	37	22	45255679	45255679	+	Missense_Mutation	SNP	G	G	A	rs147192731	byFrequency	TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr22:45255679G>A	ENST00000389774.2	+	12	1180	c.1039G>A	c.(1039-1041)Gtc>Atc	p.V347I	PRR5-ARHGAP8_ENST00000352766.7_Missense_Mutation_p.V526I|ARHGAP8_ENST00000517296.3_Missense_Mutation_p.V526I|ARHGAP8_ENST00000336963.4_Intron|ARHGAP8_ENST00000389773.5_Missense_Mutation_p.V438I|ARHGAP8_ENST00000356099.6_Missense_Mutation_p.V316I|PRR5-ARHGAP8_ENST00000361473.5_Missense_Mutation_p.V447I	NM_001017526.1	NP_001017526.1	P85298	RHG08_HUMAN	Rho GTPase activating protein 8	347	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho GTPase activator activity (GO:0005100)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(9)|prostate(1)|skin(7)	29		all_neural(38;0.00409)|Ovarian(80;0.00976)|Glioma(61;0.0649)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0204)		GCACAACTACGTCGTCCTCCG	0.657																																					p.V438I		.											.	PRR5-ARHGAP8-161	0			c.G1312A						.	G	ILE/VAL,,ILE/VAL,ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	84.0	70.0	75.0		1039,,1312,946	0.8	0.0	22	dbSNP_134	75	11,8589	8.4+/-32.0	0,11,4289	yes	missense,intron,missense,missense	ARHGAP8,PRR5-ARHGAP8	NM_001017526.1,NM_001198726.1,NM_181334.4,NM_181335.2	29,,29,29	0,12,6491	AA,AG,GG		0.1279,0.0227,0.0923	benign,,benign,benign	347/465,,438/556,316/434	45255679	12,12994	2203	4300	6503	SO:0001583	missense	553158	exon14			AACTACGTCGTCC	AF177331	CCDS14060.2, CCDS33664.1, CCDS56233.1	22q13.3	2010-05-11			ENSG00000241484	ENSG00000241484		"""Rho GTPase activating proteins"""	677	protein-coding gene	gene with protein product		609405				10591208	Standard	NM_001198726		Approved	FLJ20185, BPGAP1		P85298	OTTHUMG00000030234	ENST00000389774.2:c.1039G>A	22.37:g.45255679G>A	ENSP00000374424:p.Val347Ile	Somatic	43	0		WXS	Illumina GAIIx	Phase_I	37	3	NM_181334	0	0	1	1	0	A6ZJ79|A6ZJ80|O75983|O95695|Q96RW1|Q96RW2|Q9HA49|Q9HC46|Q9NSG0|Q9NVX8|Q9NXL1|Q9UH20	Missense_Mutation	SNP	ENST00000389774.2	37	CCDS33664.1	.	.	.	.	.	.	.	.	.	.	G	2.276	-0.365806	0.05069	2.27E-4	0.001279	ENSG00000248405;ENSG00000248405;ENSG00000241484;ENSG00000241484;ENSG00000241484;ENSG00000241484	ENST00000361473;ENST00000352766;ENST00000517296;ENST00000389773;ENST00000389774;ENST00000356099	T;T;T;T;T;T	0.18502	2.21;2.21;2.21;2.21;2.21;2.21	4.14	0.815	0.18763	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.470779	0.15551	U	0.256392	T	0.06962	0.0177	N	0.10707	0.03	0.09310	N	1	B;B;B;B;B	0.25719	0.017;0.019;0.004;0.019;0.132	B;B;B;B;B	0.17722	0.01;0.004;0.01;0.004;0.019	T	0.32693	-0.9897	10	0.33940	T	0.23	.	5.5488	0.17079	0.2398:0.0:0.6217:0.1385	.	369;352;347;526;447	B7ZMA4;A2RU51;P85298;B1AHC4;B1AHC3	.;.;RHG08_HUMAN;.;.	I	447;526;526;438;347;316	ENSP00000354732:V447I;ENSP00000262731:V526I;ENSP00000429240:V526I;ENSP00000374423:V438I;ENSP00000374424:V347I;ENSP00000348407:V316I	ENSP00000348407:V316I	V	+	1	0	PRR5-ARHGAP8;ARHGAP8	43634343	0.040000	0.19996	0.041000	0.18516	0.000000	0.00434	1.908000	0.39907	0.061000	0.16311	-0.373000	0.07131	GTC	G|0.999;A|0.001		0.657	ARHGAP8-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000075088.4	NM_017701	
PRR34	55267	hgsc.bcm.edu	37	22	46449891	46449891	+	Missense_Mutation	SNP	G	G	A	rs12159707	byFrequency	TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr22:46449891G>A	ENST00000396008.2	-	1	133	c.83C>T	c.(82-84)cCc>cTc	p.P28L	RP6-109B7.3_ENST00000451166.1_RNA|RP6-109B7.5_ENST00000608644.1_RNA|C22orf26_ENST00000333761.1_Missense_Mutation_p.P28L|RP6-109B7.3_ENST00000416202.1_RNA|RP6-109B7.2_ENST00000439423.1_lincRNA|RP6-109B7.3_ENST00000445441.1_RNA|FLJ27365_ENST00000381051.2_Intron			Q9NV39	PRR34_HUMAN		28	Pro-rich.		P -> L (in dbSNP:rs12159707).										Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|BRCA - Breast invasive adenocarcinoma(115;0.0784)|LUAD - Lung adenocarcinoma(64;0.247)		TGCGGGGTTGGGGGGGGAGGT	0.746													G|||	1079	0.215455	0.2723	0.2723	5008	,	,		6433	0.0278		0.33	False		,,,				2504	0.1738				p.P28L		.											.	C22orf26-90	0			c.C83T						.	G	LEU/PRO	1414,2432		349,716,858	5.0	5.0	5.0		83	0.7	0.0	22	dbSNP_120	5	2591,5181		546,1499,1841	no	missense	C22orf26	NM_018280.2	98	895,2215,2699	AA,AG,GG		33.3376,36.7655,34.4724	probably-damaging	28/139	46449891	4005,7613	1923	3886	5809	SO:0001583	missense	55267	exon1			GGGTTGGGGGGGG																												ENST00000396008.2:c.83C>T	22.37:g.46449891G>A	ENSP00000379329:p.Pro28Leu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_018280	0	0	0	0	0	B0QZ24	Missense_Mutation	SNP	ENST00000396008.2	37	CCDS14071.1	542	0.24816849816849818	155	0.3150406504065041	117	0.32320441988950277	22	0.038461538461538464	248	0.32717678100263853	G	5.153	0.213778	0.09810	0.367655	0.333376	ENSG00000182257	ENST00000396008;ENST00000333761	T;T	0.41400	1.0;1.0	0.666	0.666	0.17901	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	D	0.69078	0.997	D	0.68483	0.958	T	0.42189	-0.9466	7	0.87932	D	0	.	.	.	.	rs12159707;rs59880898	28	Q9NV39	CV026_HUMAN	L	28	ENSP00000379329:P28L;ENSP00000327764:P28L	ENSP00000327764:P28L	P	-	2	0	C22orf26	44828555	0.742000	0.28228	0.008000	0.14137	0.010000	0.07245	0.672000	0.25187	0.636000	0.30508	0.645000	0.84053	CCC	A|0.248;C|0.000;G|0.752		0.746	C22orf26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317994.1		
TMEM42	131616	hgsc.bcm.edu	37	3	44903434	44903434	+	Silent	SNP	G	G	C	rs2292181	byFrequency	TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr3:44903434G>C	ENST00000302392.4	+	1	74	c.18G>C	c.(16-18)ggG>ggC	p.G6G	MIR564_ENST00000385049.1_RNA	NM_144638.1	NP_653239.1	Q69YG0	TMM42_HUMAN	transmembrane protein 42	6						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(2)|skin(1)|urinary_tract(1)	8				BRCA - Breast invasive adenocarcinoma(193;0.00839)|KIRC - Kidney renal clear cell carcinoma(197;0.0461)|Kidney(197;0.0576)		AGAGGCCGGGGCCTCCGGGCG	0.746													G|||	273	0.0545128	0.056	0.0951	5008	,	,		7698	0.0437		0.0567	False		,,,				2504	0.0327				p.G6G		.											.	TMEM42-90	0			c.G18C						.	G		93,3451		1,91,1680	3.0	4.0	4.0		18	3.2	0.0	3	dbSNP_100	4	184,7076		1,182,3447	no	coding-synonymous	TMEM42	NM_144638.1		2,273,5127	CC,CG,GG		2.5344,2.6242,2.5639		6/160	44903434	277,10527	1772	3630	5402	SO:0001819	synonymous_variant	131616	exon1			GCCGGGGCCTCCG	AL834253	CCDS2722.1	3p21.31	2005-01-19			ENSG00000169964	ENSG00000169964			28444	protein-coding gene	gene with protein product						12477932	Standard	NM_144638		Approved	MGC29956	uc003cnz.3	Q69YG0	OTTHUMG00000133092	ENST00000302392.4:c.18G>C	3.37:g.44903434G>C		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	8	6	NM_144638	0	0	0	6	6	Q8WUQ6	Silent	SNP	ENST00000302392.4	37	CCDS2722.1																																																																																			G|0.938;C|0.062		0.746	TMEM42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256750.2	NM_144638	
RNF123	63891	bcgsc.ca	37	3	49725034	49725034	+	5'Flank	SNP	T	T	A	rs142964215		TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr3:49725034T>A	ENST00000327697.6	+	0	0				MST1_ENST00000383728.3_Missense_Mutation_p.T29S|MST1_ENST00000449682.2_Missense_Mutation_p.T104S|MST1_ENST00000545762.1_Missense_Mutation_p.T90S|MST1_ENST00000494828.2_5'UTR|AC099668.5_ENST00000563780.1_RNA|RNF123_ENST00000432042.1_5'Flank	NM_022064.3	NP_071347.2	Q5XPI4	RN123_HUMAN	ring finger protein 123						protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|Kidney(197;0.00227)|KIRC - Kidney renal clear cell carcinoma(197;0.00255)		CGCAGCCTCGTGTGGGGCGAG	0.617																																					p.T104S		.											.	MST1-278	0			c.A310T						.						64.0	56.0	59.0					3																	49725034		2203	4300	6503	SO:0001631	upstream_gene_variant	4485	exon3			GCCTCGTGTGGGG	AK022627	CCDS33758.1	3p24.3	2008-02-05			ENSG00000164068	ENSG00000164068		"""RING-type (C3HC4) zinc fingers"""	21148	protein-coding gene	gene with protein product		614472					Standard	NM_022064		Approved	FLJ12565	uc003cxh.4	Q5XPI4	OTTHUMG00000156891		3.37:g.49725034T>A	Exception_encountered	Somatic	349	9		WXS	Illumina GAIIx	Phase_I	298	36	NM_020998	0	0	2	2	0	A1L4Q3|A6NLS5|Q5I022|Q6PFW4|Q71RH0|Q8IW18|Q9H0M8|Q9H5L8|Q9H9T2	Missense_Mutation	SNP	ENST00000327697.6	37	CCDS33758.1	.	.	.	.	.	.	.	.	.	.	T	8.993	0.978116	0.18812	.	.	ENSG00000173531	ENST00000449682;ENST00000383728;ENST00000545762	D;D;D	0.88664	-2.41;-2.41;-2.41	5.13	3.94	0.45596	.	0.366754	0.19842	N	0.104821	T	0.81389	0.4812	L	0.51422	1.61	0.09310	N	1	P;B	0.35192	0.489;0.019	B;B	0.30179	0.112;0.023	T	0.66284	-0.5962	10	0.12766	T	0.61	.	7.7821	0.29070	0.0:0.2455:0.0:0.7545	.	90;104	B7Z538;G3XAK1	.;.	S	104;29;90	ENSP00000414287:T104S;ENSP00000373234:T29S;ENSP00000437535:T90S	ENSP00000373234:T29S	T	-	1	0	MST1	49700038	0.183000	0.23186	0.007000	0.13788	0.244000	0.25665	0.974000	0.29436	0.858000	0.35431	0.482000	0.46254	ACG	T|0.938;A|0.062		0.617	RNF123-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346475.2	NM_022064	
RNF123	63891	bcgsc.ca	37	3	49725038	49725038	+	5'Flank	SNP	G	G	C			TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr3:49725038G>C	ENST00000327697.6	+	0	0				MST1_ENST00000383728.3_Silent_p.P27P|MST1_ENST00000449682.2_Silent_p.P102P|MST1_ENST00000545762.1_Silent_p.P88P|MST1_ENST00000494828.2_5'UTR|AC099668.5_ENST00000563780.1_RNA|RNF123_ENST00000432042.1_5'Flank	NM_022064.3	NP_071347.2	Q5XPI4	RN123_HUMAN	ring finger protein 123						protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.P88L(1)		NS(1)|breast(4)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|Kidney(197;0.00227)|KIRC - Kidney renal clear cell carcinoma(197;0.00255)		GCCTCGTGTGGGGCGAGTGTT	0.622																																					p.P102P		.											.	MST1-278	1	Substitution - Missense(1)	skin(1)	c.C306G						.						64.0	56.0	58.0					3																	49725038		2203	4300	6503	SO:0001631	upstream_gene_variant	4485	exon3			CGTGTGGGGCGAG	AK022627	CCDS33758.1	3p24.3	2008-02-05			ENSG00000164068	ENSG00000164068		"""RING-type (C3HC4) zinc fingers"""	21148	protein-coding gene	gene with protein product		614472					Standard	NM_022064		Approved	FLJ12565	uc003cxh.4	Q5XPI4	OTTHUMG00000156891		3.37:g.49725038G>C	Exception_encountered	Somatic	353	9		WXS	Illumina GAIIx	Phase_I	294	35	NM_020998	0	0	1	1	0	A1L4Q3|A6NLS5|Q5I022|Q6PFW4|Q71RH0|Q8IW18|Q9H0M8|Q9H5L8|Q9H9T2	Silent	SNP	ENST00000327697.6	37	CCDS33758.1																																																																																			G|0.928;C|0.072		0.622	RNF123-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346475.2	NM_022064	
RNF123	63891	bcgsc.ca	37	3	49725086	49725086	+	5'Flank	SNP	G	G	A	rs201833731	byFrequency	TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr3:49725086G>A	ENST00000327697.6	+	0	0				MST1_ENST00000383728.3_Silent_p.N11N|MST1_ENST00000449682.2_Silent_p.N86N|MST1_ENST00000545762.1_Silent_p.N72N|MST1_ENST00000494828.2_5'UTR|AC099668.5_ENST00000563780.1_RNA|RNF123_ENST00000432042.1_5'Flank	NM_022064.3	NP_071347.2	Q5XPI4	RN123_HUMAN	ring finger protein 123						protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|Kidney(197;0.00227)|KIRC - Kidney renal clear cell carcinoma(197;0.00255)		GGCTGCTCACGTTGTAGTGGA	0.617																																					p.N86N		.											.	MST1-278	0			c.C258T						.						50.0	44.0	46.0					3																	49725086		2202	4300	6502	SO:0001631	upstream_gene_variant	4485	exon3			GCTCACGTTGTAG	AK022627	CCDS33758.1	3p24.3	2008-02-05			ENSG00000164068	ENSG00000164068		"""RING-type (C3HC4) zinc fingers"""	21148	protein-coding gene	gene with protein product		614472					Standard	NM_022064		Approved	FLJ12565	uc003cxh.4	Q5XPI4	OTTHUMG00000156891		3.37:g.49725086G>A	Exception_encountered	Somatic	288	10		WXS	Illumina GAIIx	Phase_I	214	21	NM_020998	0	0	3	3	0	A1L4Q3|A6NLS5|Q5I022|Q6PFW4|Q71RH0|Q8IW18|Q9H0M8|Q9H5L8|Q9H9T2	Silent	SNP	ENST00000327697.6	37	CCDS33758.1																																																																																			G|0.712;A|0.287		0.617	RNF123-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346475.2	NM_022064	
ZMYND10	51364	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	50379278	50379278	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr3:50379278T>A	ENST00000231749.3	-	10	2356	c.1084A>T	c.(1084-1086)Agc>Tgc	p.S362C	ZMYND10_ENST00000360165.3_Missense_Mutation_p.S357C|RASSF1_ENST00000488024.1_5'Flank|RASSF1_ENST00000357043.2_5'Flank|ZMYND10-AS1_ENST00000440013.1_RNA|RASSF1_ENST00000359365.4_5'Flank|ZMYND10_ENST00000490675.1_5'UTR	NM_015896.2	NP_056980.2	O75800	ZMY10_HUMAN	zinc finger, MYND-type containing 10	362					inner dynein arm assembly (GO:0036159)|motile cilium assembly (GO:0044458)|outer dynein arm assembly (GO:0036158)	centriolar satellite (GO:0034451)|cytoplasm (GO:0005737)	metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|large_intestine(1)|lung(5)|ovary(1)|urinary_tract(2)	14				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		TCTGAGGGGCTGAACACATGC	0.607										TSP Lung(30;0.18)																											p.S362C		.											.	ZMYND10-279	0			c.A1084T						.						49.0	49.0	49.0					3																	50379278		2203	4300	6503	SO:0001583	missense	51364	exon10			AGGGGCTGAACAC	U70824	CCDS2825.1	3p21.3	2014-02-03			ENSG00000004838	ENSG00000004838		"""Zinc fingers, MYND-type"""	19412	protein-coding gene	gene with protein product		607070				12629521, 23891469	Standard	NM_015896		Approved	BLU, CILD22	uc003dag.1	O75800	OTTHUMG00000156874	ENST00000231749.3:c.1084A>T	3.37:g.50379278T>A	ENSP00000231749:p.Ser362Cys	Somatic	91	0		WXS	Illumina GAIIx	Phase_I	68	5	NM_015896	0	0	2	2	0	A6NK41|B3KU54|O14570|O75801|Q53FE6|Q8N4R6|Q8NDN6	Missense_Mutation	SNP	ENST00000231749.3	37	CCDS2825.1	.	.	.	.	.	.	.	.	.	.	T	17.50	3.405233	0.62288	.	.	ENSG00000004838	ENST00000231749;ENST00000360165	.	.	.	5.11	5.11	0.69529	.	0.215521	0.56097	D	0.000025	T	0.65811	0.2727	M	0.63428	1.95	0.41426	D	0.987833	D;D	0.61697	0.99;0.958	P;P	0.55923	0.787;0.467	T	0.70033	-0.4983	9	0.72032	D	0.01	-10.6523	10.1736	0.42924	0.1488:0.0:0.0:0.8512	.	357;362	O75800-2;O75800	.;ZMY10_HUMAN	C	362;357	.	ENSP00000231749:S362C	S	-	1	0	ZMYND10	50354282	1.000000	0.71417	1.000000	0.80357	0.468000	0.32798	4.955000	0.63638	1.931000	0.55961	0.379000	0.24179	AGC	.		0.607	ZMYND10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000346376.1	NM_015896	
PDHB	5162	broad.mit.edu	37	3	58413810	58413810	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr3:58413810G>T	ENST00000302746.6	-	10	1073	c.1031C>A	c.(1030-1032)cCt>cAt	p.P344H	RP11-802O23.3_ENST00000607214.1_RNA|PDHB_ENST00000485460.1_Missense_Mutation_p.P326H|PDHB_ENST00000474765.1_3'UTR	NM_000925.3|NM_001173468.1	NP_000916.2|NP_001166939.1	P11177	ODPB_HUMAN	pyruvate dehydrogenase (lipoamide) beta	344			P -> S (in PDHBD; dbSNP:rs28933391). {ECO:0000269|PubMed:15138885}.		acetyl-CoA biosynthetic process from pyruvate (GO:0006086)|cellular metabolic process (GO:0044237)|glucose metabolic process (GO:0006006)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|pyruvate dehydrogenase complex (GO:0045254)	pyruvate dehydrogenase (acetyl-transferring) activity (GO:0004739)|pyruvate dehydrogenase activity (GO:0004738)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(1)|ovary(1)	9				BRCA - Breast invasive adenocarcinoma(55;0.000179)|Kidney(10;0.00231)|KIRC - Kidney renal clear cell carcinoma(10;0.00258)|OV - Ovarian serous cystadenocarcinoma(275;0.187)	Pyruvic acid(DB00119)	TTTGACCTGAGGTATAGAGTT	0.383																																					p.P344H		.											.	PDHB-91	0			c.C1031A						.						69.0	66.0	67.0					3																	58413810		2203	4300	6503	SO:0001583	missense	5162	exon10			ACCTGAGGTATAG		CCDS2890.1, CCDS54602.1	3p21.1-p14.2	1995-12-20			ENSG00000168291	ENSG00000168291	1.2.4.1		8808	protein-coding gene	gene with protein product		179060					Standard	NR_033384		Approved		uc003dkf.4	P11177	OTTHUMG00000159157	ENST00000302746.6:c.1031C>A	3.37:g.58413810G>T	ENSP00000307241:p.Pro344His	Somatic	111	0		WXS	Illumina GAIIx	Phase_I	90	4	NM_000925	0	0	77	77	0	B2R7L0|B4DDD7|Q6FH45|Q9BQ27|Q9UFK3	Missense_Mutation	SNP	ENST00000302746.6	37	CCDS2890.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.348054	0.82132	.	.	ENSG00000168291	ENST00000302746;ENST00000383714;ENST00000485460	D;D;D	0.91792	-2.91;-2.91;-2.91	6.16	5.29	0.74685	Transketolase, C-terminal (1);Transketolase, C-terminal/Pyruvate-ferredoxin oxidoreductase, domain II (1);Transketolase-like, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.97942	0.9323	H	0.99090	4.425	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;0.999	D	0.99478	1.0947	10	0.87932	D	0	-12.4922	15.5347	0.75993	0.0656:0.0:0.9344:0.0	.	326;326;344	B4DDD7;P11177-2;P11177	.;.;ODPB_HUMAN	H	344;326;326	ENSP00000307241:P344H;ENSP00000373220:P326H;ENSP00000417267:P326H	ENSP00000307241:P344H	P	-	2	0	PDHB	58388850	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	9.434000	0.97515	1.631000	0.50456	0.650000	0.86243	CCT	.		0.383	PDHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353558.1		
MORC1	27136	broad.mit.edu	37	3	108819313	108819313	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr3:108819313G>A	ENST00000483760.1	-	5	308	c.265C>T	c.(265-267)Cgg>Tgg	p.R89W	MORC1_ENST00000232603.5_Missense_Mutation_p.R89W|MORC1-AS1_ENST00000480826.1_RNA					MORC family CW-type zinc finger 1									p.R89W(1)		breast(7)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(47)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	105						GTTGACAGCCGTTTTTTGGAT	0.403																																					p.R89W		.											.	MORC1-98	1	Substitution - Missense(1)	prostate(1)	c.C265T						.						185.0	184.0	184.0					3																	108819313		2203	4300	6503	SO:0001583	missense	27136	exon5			ACAGCCGTTTTTT	AF084946	CCDS2955.1	3q13	2011-10-26	2005-06-15	2005-06-15	ENSG00000114487	ENSG00000114487			7198	protein-coding gene	gene with protein product	"""cancer/testis antigen 33"""	603205	"""microrchidia (mouse) homolog"", ""microrchidia homolog (mouse)"""	MORC		10369865	Standard	NM_014429		Approved	ZCW6, CT33	uc003dxl.3	Q86VD1	OTTHUMG00000159209	ENST00000483760.1:c.265C>T	3.37:g.108819313G>A	ENSP00000417282:p.Arg89Trp	Somatic	159	0		WXS	Illumina GAIIx	Phase_I	168	5	NM_014429	0	0	0	0	0		Missense_Mutation	SNP	ENST00000483760.1	37		.	.	.	.	.	.	.	.	.	.	G	18.06	3.538834	0.65085	.	.	ENSG00000114487	ENST00000232603;ENST00000483760	D;D	0.95272	-3.66;-3.66	5.32	4.45	0.53987	ATPase-like, ATP-binding domain (3);	0.312347	0.23631	N	0.046123	D	0.97748	0.9261	H	0.95437	3.67	0.34499	D	0.705873	D;D	0.89917	1.0;0.998	D;D	0.69824	0.966;0.93	D	0.99964	1.1808	10	0.87932	D	0	-3.4591	11.061	0.47946	0.0:0.0:0.6625:0.3375	.	89;89	E7ERX1;Q86VD1	.;MORC1_HUMAN	W	89	ENSP00000232603:R89W;ENSP00000417282:R89W	ENSP00000232603:R89W	R	-	1	2	MORC1	110302003	1.000000	0.71417	0.959000	0.39883	0.937000	0.57800	2.525000	0.45598	1.479000	0.48272	-0.152000	0.13540	CGG	.		0.403	MORC1-002	NOVEL	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000353844.1		
EIF2A	83939	ucsc.edu;bcgsc.ca	37	3	150280445	150280445	+	Missense_Mutation	SNP	C	C	G	rs1132979	byFrequency	TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr3:150280445C>G	ENST00000460851.1	+	4	399	c.290C>G	c.(289-291)aCt>aGt	p.T97S	EIF2A_ENST00000273435.5_Missense_Mutation_p.T92S|EIF2A_ENST00000487799.1_Missense_Mutation_p.T72S|EIF2A_ENST00000406576.3_Missense_Mutation_p.T97S|SERP1_ENST00000479209.1_Intron			Q9BY44	EIF2A_HUMAN	eukaryotic translation initiation factor 2A, 65kDa	97			T -> S (in dbSNP:rs1132979). {ECO:0000269|PubMed:12133843, ECO:0000269|PubMed:14702039, ECO:0000269|Ref.3, ECO:0000269|Ref.4, ECO:0000269|Ref.6}.		positive regulation of signal transduction (GO:0009967)|protein phosphorylation (GO:0006468)|regulation of translation (GO:0006417)|ribosome assembly (GO:0042255)|SREBP signaling pathway (GO:0032933)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|eukaryotic translation initiation factor 2 complex (GO:0005850)|extracellular space (GO:0005615)	ribosome binding (GO:0043022)|translation initiation factor activity (GO:0003743)|tRNA binding (GO:0000049)	p.T72S(1)		cervix(1)|endometrium(2)|kidney(1)|lung(3)	7		Melanoma(1037;0.0575)	LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			CAGCCTTACACTAGTAAGTAT	0.403													C|||	1774	0.354233	0.1611	0.3631	5008	,	,		16648	0.4861		0.3588	False		,,,				2504	0.4683				p.T97S		.											.	EIF2A-22	1	Substitution - Missense(1)	stomach(1)	c.C290G						.	C	SER/THR	631,3103		45,541,1281	67.0	61.0	63.0		290	5.9	1.0	3	dbSNP_86	63	2865,5335		508,1849,1743	yes	missense	EIF2A	NM_032025.3	58	553,2390,3024	GG,GC,CC		34.939,16.8988,29.2945	benign	97/586	150280445	3496,8438	1867	4100	5967	SO:0001583	missense	83939	exon4			CTTACACTAGTAA	AF212241	CCDS46935.1	3q25.1	2011-01-19	2006-01-24		ENSG00000144895	ENSG00000144895			3254	protein-coding gene	gene with protein product		609234				12133843, 1620067	Standard	NM_032025		Approved	EIF-2A	uc003eya.3	Q9BY44	OTTHUMG00000159775	ENST00000460851.1:c.290C>G	3.37:g.150280445C>G	ENSP00000417229:p.Thr97Ser	Somatic	69	0		WXS	Illumina GAIIx	Phase_I	63	6	NM_032025	0	0	1	1	0	A8MPS6|B4DF96|B4DQ14|D3DNI9|Q5QTR2|Q7Z4E9|Q8NFM1|Q96EW9|Q96K81	Missense_Mutation	SNP	ENST00000460851.1	37	CCDS46935.1	797	0.3649267399267399	90	0.18292682926829268	141	0.38950276243093923	287	0.5017482517482518	279	0.36807387862796836	C	13.40	2.226881	0.39399	0.168988	0.34939	ENSG00000144895	ENST00000487799;ENST00000460851;ENST00000406576;ENST00000482093;ENST00000273435	T;T;T;T;T	0.54071	0.9;0.9;0.59;0.9;0.9	5.86	5.86	0.93980	WD40/YVTN repeat-like-containing domain (1);	0.266752	0.40222	N	0.001157	T	0.00012	0.0000	N	0.05012	-0.13	0.09310	P	1.0	B;B;B	0.13145	0.007;0.001;0.004	B;B;B	0.12156	0.007;0.002;0.003	T	0.43228	-0.9404	9	0.10902	T	0.67	-6.8954	20.1894	0.98226	0.0:1.0:0.0:0.0	rs1132979;rs2049228;rs3194341;rs11537792;rs16862740;rs17418293;rs52804311;rs1132979	97;72;97	B4DF96;B4DQ14;Q9BY44	.;.;EIF2A_HUMAN	S	72;97;97;97;92	ENSP00000420537:T72S;ENSP00000417229:T97S;ENSP00000385292:T97S;ENSP00000418698:T97S;ENSP00000273435:T92S	ENSP00000273435:T92S	T	+	2	0	EIF2A	151763135	0.999000	0.42202	1.000000	0.80357	0.933000	0.57130	2.755000	0.47540	2.781000	0.95711	0.591000	0.81541	ACT	C|0.634;G|0.366		0.403	EIF2A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000357259.2	NM_032025	
RTP1	132112	broad.mit.edu	37	3	186917498	186917498	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr3:186917498C>A	ENST00000312295.4	+	2	462	c.432C>A	c.(430-432)agC>agA	p.S144R	RP11-208N14.4_ENST00000356133.3_RNA	NM_153708.2	NP_714919.2	P59025	RTP1_HUMAN	receptor (chemosensory) transporter protein 1	144					protein insertion into membrane (GO:0051205)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	olfactory receptor binding (GO:0031849)			breast(2)|endometrium(4)|large_intestine(5)|lung(6)|ovary(3)|skin(2)	22	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;5.56e-18)	GBM - Glioblastoma multiforme(93;0.0269)		ACGAGTCCAGCATGCTGGAGG	0.672																																					p.S144R		.											.	RTP1-155	0			c.C432A						.						26.0	27.0	27.0					3																	186917498		2202	4293	6495	SO:0001583	missense	132112	exon2			GTCCAGCATGCTG	BC034744	CCDS3287.2	3q27.3	2014-02-20	2006-11-21		ENSG00000175077	ENSG00000175077		"""Receptor transporter proteins"""	28580	protein-coding gene	gene with protein product	"""receptor transporting protein 1"", ""zinc finger, 3CxxC-type 1"""	609137	"""receptor transporter protein 1"""			16271481, 15550249, 16720576	Standard	NM_153708		Approved	MGC35450, Z3CXXC1	uc003frg.3	P59025	OTTHUMG00000149886	ENST00000312295.4:c.432C>A	3.37:g.186917498C>A	ENSP00000311712:p.Ser144Arg	Somatic	82	1		WXS	Illumina GAIIx	Phase_I	289	8	NM_153708	0	0	0	0	0		Missense_Mutation	SNP	ENST00000312295.4	37	CCDS3287.2	.	.	.	.	.	.	.	.	.	.	C	17.36	3.369295	0.61624	.	.	ENSG00000175077	ENST00000312295	T	0.21734	1.99	5.7	3.9	0.45041	.	0.377447	0.36893	N	0.002344	T	0.29256	0.0728	L	0.38531	1.155	0.27486	N	0.952422	D	0.71674	0.998	D	0.68483	0.958	T	0.05852	-1.0860	10	0.32370	T	0.25	.	7.1566	0.25641	0.1695:0.7444:0.0:0.0861	.	144	P59025	RTP1_HUMAN	R	144	ENSP00000311712:S144R	ENSP00000311712:S144R	S	+	3	2	RTP1	188400192	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.059000	0.30517	0.758000	0.33059	0.561000	0.74099	AGC	.		0.672	RTP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313731.2	NM_153708	
MUC4	4585	bcgsc.ca	37	3	195506692	195506692	+	Missense_Mutation	SNP	C	C	G	rs142466346	byFrequency	TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr3:195506692C>G	ENST00000463781.3	-	2	12218	c.11759G>C	c.(11758-11760)cGt>cCt	p.R3920P	MUC4_ENST00000475231.1_Missense_Mutation_p.R3920P|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GACAGGAAGACGGGTGGTGTC	0.587													.|||	9	0.00179712	0.0061	0.0	5008	,	,		10824	0.001		0.0	False		,,,				2504	0.0				p.R3920P		.											.	MUC4-90	0			c.G11759C						.						28.0	27.0	27.0					3																	195506692		542	1108	1650	SO:0001583	missense	4585	exon2			GGAAGACGGGTGG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11759G>C	3.37:g.195506692C>G	ENSP00000417498:p.Arg3920Pro	Somatic	319	10		WXS	Illumina GAIIx	Phase_I	96	19	NM_018406	0	0	0	0	0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	N	4.848	0.157714	0.09236	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.33654	1.42;1.4	.	.	.	.	.	.	.	.	T	0.16128	0.0388	N	0.08118	0	0.19945	N	0.99994	P	0.48350	0.909	P	0.44561	0.453	T	0.13602	-1.0503	7	.	.	.	.	5.4844	0.16741	0.0:0.652:0.348:1.0E-4	.	3792	E7ESK3	.	P	3920	ENSP00000417498:R3920P;ENSP00000420243:R3920P	.	R	-	2	0	MUC4	196991471	.	.	0.011000	0.14972	0.011000	0.07611	.	.	-2.387000	0.00589	-2.332000	0.00249	CGT	C|0.903;T|0.097		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	bcgsc.ca	37	3	195506704	195506704	+	Missense_Mutation	SNP	T	T	C	rs201760283	byFrequency	TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr3:195506704T>C	ENST00000463781.3	-	2	12206	c.11747A>G	c.(11746-11748)gAt>gGt	p.D3916G	MUC4_ENST00000475231.1_Missense_Mutation_p.D3916G|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGTGGTGTCATCTGTGGAAGC	0.587													.|||	22	0.00439297	0.0045	0.0029	5008	,	,		10246	0.0079		0.002	False		,,,				2504	0.0041				p.D3916G		.											.	MUC4-90	0			c.A11747G						.						27.0	26.0	26.0					3																	195506704		541	1106	1647	SO:0001583	missense	4585	exon2			GTGTCATCTGTGG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11747A>G	3.37:g.195506704T>C	ENSP00000417498:p.Asp3916Gly	Somatic	312	9		WXS	Illumina GAIIx	Phase_I	93	19	NM_018406	0	0	0	0	0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	N	7.034	0.561270	0.13498	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.34072	1.48;1.38	.	.	.	.	.	.	.	.	T	0.11750	0.0286	N	0.08118	0	0.20074	N	0.999938	.	.	.	.	.	.	T	0.17471	-1.0368	4	.	.	.	.	.	.	.	.	3788	E7ESK3	.	G	3916	ENSP00000417498:D3916G;ENSP00000420243:D3916G	.	D	-	2	0	MUC4	196991483	.	.	0.004000	0.12327	0.004000	0.04260	.	.	-2.094000	0.00854	-2.075000	0.00382	GAT	.		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	bcgsc.ca	37	3	195506712	195506712	+	Silent	SNP	A	A	T	rs199930420		TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr3:195506712A>T	ENST00000463781.3	-	2	12198	c.11739T>A	c.(11737-11739)gcT>gcA	p.A3913A	MUC4_ENST00000475231.1_Silent_p.A3913A|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CATCTGTGGAAGCTGAGGAAG	0.587																																					p.A3913A		.											.	MUC4-90	0			c.T11739A						.						8.0	8.0	8.0					3																	195506712		940	1743	2683	SO:0001819	synonymous_variant	4585	exon2			TGTGGAAGCTGAG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11739T>A	3.37:g.195506712A>T		Somatic	308	13		WXS	Illumina GAIIx	Phase_I	100	25	NM_018406	0	0	0	0	0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																			.		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
FAM184B	27146	hgsc.bcm.edu	37	4	17643848	17643848	+	Missense_Mutation	SNP	G	G	A	rs2286771	byFrequency	TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr4:17643848G>A	ENST00000265018.3	-	13	2562	c.2350C>T	c.(2350-2352)Cgg>Tgg	p.R784W		NM_015688.1	NP_056503.1	Q9ULE4	F184B_HUMAN	family with sequence similarity 184, member B	784				R -> W (in Ref. 1; BAA86590). {ECO:0000305}.						NS(1)|central_nervous_system(1)|endometrium(1)|prostate(1)	4						GGGCCGCCCCGCTCCTGAGGA	0.701													G|||	2697	0.538538	0.1725	0.6599	5008	,	,		10215	0.8522		0.6233	False		,,,				2504	0.5368				p.R784W		.											.	FAM184B-23	0			c.C2350T						.						1.0	2.0	2.0					4																	17643848		374	1044	1418	SO:0001583	missense	27146	exon13			CGCCCCGCTCCTG		CCDS47033.1	4p16	2009-04-22			ENSG00000047662	ENSG00000047662			29235	protein-coding gene	gene with protein product						10574462	Standard	NM_015688		Approved	KIAA1276	uc003gpm.4	Q9ULE4	OTTHUMG00000160287	ENST00000265018.3:c.2350C>T	4.37:g.17643848G>A	ENSP00000265018:p.Arg784Trp	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_015688	0	0	0	0	0		Missense_Mutation	SNP	ENST00000265018.3	37	CCDS47033.1	1272	0.5824175824175825	75	0.1524390243902439	232	0.6408839779005525	493	0.8618881118881119	472	0.6226912928759895	G	13.83	2.354233	0.41700	.	.	ENSG00000047662	ENST00000265018	T	0.34072	1.38	3.29	-3.67	0.04476	.	3.541600	0.00901	N	0.002342	T	0.00012	0.0000	N	0.14661	0.345	0.80722	P	0.0	D	0.56968	0.978	B	0.40741	0.339	T	0.48547	-0.9026	9	0.72032	D	0.01	2.0681	6.7491	0.23477	0.107:0.2547:0.5506:0.0877	rs2286771;rs58699512;rs2286771	784	Q9ULE4	F184B_HUMAN	W	784	ENSP00000265018:R784W	ENSP00000265018:R784W	R	-	1	2	FAM184B	17252946	0.000000	0.05858	0.000000	0.03702	0.516000	0.34256	-0.323000	0.07997	-1.014000	0.03379	-0.369000	0.07265	CGG	G|0.440;A|0.560		0.701	FAM184B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360137.1	NM_015688	
RBPJ	3516	bcgsc.ca	37	4	26417136	26417136	+	Silent	SNP	T	T	C	rs2270226	byFrequency	TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr4:26417136T>C	ENST00000361572.6	+	4	428	c.234T>C	c.(232-234)agT>agC	p.S78S	RBPJ_ENST00000342295.1_Silent_p.S78S|RBPJ_ENST00000345843.3_Silent_p.S63S|RBPJ_ENST00000511401.1_3'UTR|RBPJ_ENST00000504907.1_Silent_p.S64S|RBPJ_ENST00000355476.3_Silent_p.S64S|RBPJ_ENST00000342320.4_Silent_p.S64S|RBPJ_ENST00000507561.1_Silent_p.S43S|RBPJ_ENST00000348160.4_Silent_p.S65S			Q06330	SUH_HUMAN	recombination signal binding protein for immunoglobulin kappa J region	78					angiogenesis (GO:0001525)|arterial endothelial cell fate commitment (GO:0060844)|atrioventricular canal development (GO:0036302)|auditory receptor cell fate commitment (GO:0009912)|B cell differentiation (GO:0030183)|blood vessel endothelial cell fate specification (GO:0097101)|blood vessel lumenization (GO:0072554)|blood vessel remodeling (GO:0001974)|cardiac left ventricle morphogenesis (GO:0003214)|Clara cell differentiation (GO:0060486)|defense response to bacterium (GO:0042742)|DNA recombination (GO:0006310)|dorsal aorta morphogenesis (GO:0035912)|endocardium morphogenesis (GO:0003160)|epidermal cell fate specification (GO:0009957)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|gene expression (GO:0010467)|hair follicle maturation (GO:0048820)|humoral immune response (GO:0006959)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|labyrinthine layer blood vessel development (GO:0060716)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ossification (GO:0030279)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|outflow tract morphogenesis (GO:0003151)|pituitary gland development (GO:0021983)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of canonical Wnt signaling pathway involved in cardiac muscle cell fate commitment (GO:1901297)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation involved in heart morphogenesis (GO:2000138)|positive regulation of ephrin receptor signaling pathway (GO:1901189)|positive regulation of ERBB signaling pathway (GO:1901186)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription of Notch receptor target (GO:0007221)|regulation of timing of cell differentiation (GO:0048505)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|sebaceous gland development (GO:0048733)|secondary heart field specification (GO:0003139)|somatic stem cell maintenance (GO:0035019)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cytoplasm (GO:0005737)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|recombinase activity (GO:0000150)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(2)|kidney(3)|large_intestine(5)|lung(4)|ovary(1)	15		Breast(46;0.0503)				TTATGGGCAGTGGATGGAAGA	0.358													T|||	2563	0.511781	0.3328	0.683	5008	,	,		16222	0.5308		0.5606	False		,,,				2504	0.5624				p.S78S		.											.	RBPJ-659	0			c.T234C						.	T	,,,	1638,2768	484.4+/-360.0	295,1048,860	82.0	89.0	87.0		234,195,189,192	2.8	1.0	4	dbSNP_100	87	4832,3768	610.4+/-395.7	1347,2138,815	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	RBPJ	NM_005349.2,NM_015874.3,NM_203283.1,NM_203284.1	,,,	1642,3186,1675	CC,CT,TT		43.814,37.1766,49.7463	,,,	78/501,65/488,63/486,64/487	26417136	6470,6536	2203	4300	6503	SO:0001819	synonymous_variant	3516	exon5			GGGCAGTGGATGG	L07872	CCDS3436.1, CCDS3437.1, CCDS33969.1, CCDS43219.1	4p15.2	2013-10-18	2007-02-26	2007-02-26	ENSG00000168214	ENSG00000168214			5724	protein-coding gene	gene with protein product	"""suppressor of hairless homolog (Drosophila)"""	147183	"""recombining binding protein suppressor of hairless (Drosophila)"""	IGKJRB1, RBPSUH		8406481, 9290259	Standard	NM_005349		Approved	SUH, IGKJRB, RBPJK, KBF2, RBP-J, CBF1	uc003gsb.2	Q06330	OTTHUMG00000097793	ENST00000361572.6:c.234T>C	4.37:g.26417136T>C		Somatic	217	2		WXS	Illumina GAIIx	Phase_I	243	9	NM_005349	0	0	1	1	0	B4DY22|Q5XKH9|Q6P1N3	Silent	SNP	ENST00000361572.6	37	CCDS3437.1																																																																																			T|0.487;C|0.513		0.358	RBPJ-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000215046.2	NM_015874	
DSPP	1834	bcgsc.ca	37	4	88536550	88536550	+	Silent	SNP	T	T	C	rs111215872|rs111456637	byFrequency	TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr4:88536550T>C	ENST00000282478.7	+	4	2769	c.2736T>C	c.(2734-2736)agT>agC	p.S912S	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Silent_p.S912S			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	912	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)	p.S912S(1)		breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gcaacagcagtgacagcagtg	0.488													T|||	1014	0.202476	0.1982	0.2637	5008	,	,		33910	0.1111		0.2972	False		,,,				2504	0.1616				p.S912S		.											.	DSPP-90	1	Substitution - coding silent(1)	stomach(1)	c.T2736C						.			276,2946		18,240,1353	65.0	93.0	83.0		2736	0.4	0.9	4	dbSNP_134	83	1274,4674		128,1018,1828	no	coding-synonymous	DSPP	NM_014208.3		146,1258,3181	CC,CT,TT		21.419,8.5661,16.9029		912/1302	88536550	1550,7620	1611	2974	4585	SO:0001819	synonymous_variant	1834	exon5			CAGCAGTGACAGC	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.2736T>C	4.37:g.88536550T>C		Somatic	743	8		WXS	Illumina GAIIx	Phase_I	733	21	NM_014208	0	0	0	0	0	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	37	CCDS43248.1																																																																																			.		0.488	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
IRX4	50805	hgsc.bcm.edu	37	5	1882129	1882129	+	Silent	SNP	T	T	G	rs2232374	byFrequency	TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr5:1882129T>G	ENST00000505790.1	-	3	546	c.90A>C	c.(88-90)ggA>ggC	p.G30G	CTD-2194D22.3_ENST00000506335.1_RNA|IRX4_ENST00000513692.1_Silent_p.G30G|IRX4_ENST00000505938.1_5'Flank|IRX4_ENST00000231357.2_Silent_p.G30G	NM_001278634.1	NP_001265563.1	P78413	IRX4_HUMAN	iroquois homeobox 4	30					establishment of organ orientation (GO:0048561)|heart development (GO:0007507)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|lung(7)|ovary(1)|prostate(1)	10				GBM - Glioblastoma multiforme(108;0.242)		GCGTGCGGCCTCCGGACTCGC	0.741													N|||	1389	0.277356	0.2821	0.3141	5008	,	,		10764	0.3313		0.2177	False		,,,				2504	0.2505				p.G30G		.											.	IRX4-226	0			c.A90C						.			440,2456		29,382,1037	2.0	2.0	2.0		90	-2.3	0.0	5	dbSNP_98	2	967,5425		81,805,2310	no	coding-synonymous	IRX4	NM_016358.2		110,1187,3347	GG,GT,TT		15.1283,15.1934,15.1486		30/520	1882129	1407,7881	1448	3196	4644	SO:0001819	synonymous_variant	50805	exon2			GCGGCCTCCGGAC	AF124733	CCDS3867.1, CCDS75225.1	5p15.33	2011-06-20	2007-07-13		ENSG00000113430	ENSG00000113430		"""Homeoboxes / TALE class"""	6129	protein-coding gene	gene with protein product		606199	"""iroquois homeobox protein 4"""			10625552	Standard	NM_016358		Approved		uc003jcz.2	P78413	OTTHUMG00000090411	ENST00000505790.1:c.90A>C	5.37:g.1882129T>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	24	8	NM_016358	0	0	0	0	0	B2RMW5|D3DTC5|H1AFL0|H1AFL1|Q2NL64|Q9UHR2	Silent	SNP	ENST00000505790.1	37	CCDS3867.1																																																																																			T|0.735;G|0.265		0.741	IRX4-004	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365500.1	NM_016358	
DAB2	1601	broad.mit.edu	37	5	39376905	39376905	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr5:39376905G>T	ENST00000320816.6	-	12	2451	c.1984C>A	c.(1984-1986)Cag>Aag	p.Q662K	DAB2_ENST00000509337.1_Missense_Mutation_p.Q641K|DAB2_ENST00000545653.1_Missense_Mutation_p.Q641K|DAB2_ENST00000339788.6_Missense_Mutation_p.Q444K	NM_001343.3	NP_001334.2	P98082	DAB2_HUMAN	Dab, mitogen-responsive phosphoprotein, homolog 2 (Drosophila)	662	Required for interaction with MYO6. {ECO:0000250}.|Sufficient for interaction with GRB2. {ECO:0000250}.				activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|cell morphogenesis involved in differentiation (GO:0000904)|cell proliferation (GO:0008283)|cellular response to transforming growth factor beta stimulus (GO:0071560)|clathrin coat assembly (GO:0048268)|endoderm development (GO:0007492)|excretion (GO:0007588)|in utero embryonic development (GO:0001701)|leading edge cell differentiation (GO:0035026)|membrane organization (GO:0061024)|myeloid cell differentiation (GO:0030099)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of protein binding (GO:0032091)|negative regulation of protein localization to plasma membrane (GO:1903077)|negative regulation of transcription, DNA-templated (GO:0045892)|pinocytosis (GO:0006907)|positive regulation of cell migration (GO:0030335)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of early endosome to late endosome transport (GO:2000643)|positive regulation of endocytosis (GO:0045807)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of integrin-mediated signaling pathway (GO:2001046)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of receptor recycling (GO:0001921)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|Wnt signaling pathway (GO:0016055)	apical plasma membrane (GO:0016324)|clathrin coat of coated pit (GO:0030132)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	cargo receptor activity (GO:0038024)|clathrin adaptor activity (GO:0035615)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein C-terminus binding (GO:0008022)|SMAD binding (GO:0046332)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(5)|large_intestine(9)|lung(19)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	47	all_lung(31;0.000197)		Epithelial(62;0.137)			GCAGGTGGCTGCCGCAGTTGG	0.507											OREG0016586	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q662K		.											.	DAB2-227	0			c.C1984A						.						47.0	47.0	47.0					5																	39376905		2203	4300	6503	SO:0001583	missense	1601	exon12			GTGGCTGCCGCAG	U53446	CCDS34149.1, CCDS58946.1	5p13.1	2013-10-03	2013-03-08		ENSG00000153071	ENSG00000153071			2662	protein-coding gene	gene with protein product		601236	"""disabled (Drosophila) homolog 2 (mitogen-responsive phosphoprotein)"", ""disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)"""			8660969, 9620555	Standard	NM_001343		Approved	DOC-2	uc003jlx.3	P98082	OTTHUMG00000162043	ENST00000320816.6:c.1984C>A	5.37:g.39376905G>T	ENSP00000313391:p.Gln662Lys	Somatic	74	4	885	WXS	Illumina GAIIx	Phase_I	85	5	NM_001343	0	1	13	15	1	A6NES5|Q13598|Q9BTY0|Q9UK04	Missense_Mutation	SNP	ENST00000320816.6	37	CCDS34149.1	.	.	.	.	.	.	.	.	.	.	G	7.176	0.588622	0.13812	.	.	ENSG00000153071	ENST00000320816;ENST00000339788;ENST00000545653;ENST00000509337	T;T;T;T	0.28666	1.6;1.64;1.64;1.64	5.09	5.09	0.68999	.	0.154694	0.56097	D	0.000033	T	0.15435	0.0372	N	0.11284	0.12	0.37718	D	0.924829	B;B	0.11235	0.004;0.004	B;B	0.14023	0.004;0.01	T	0.14200	-1.0481	10	0.10111	T	0.7	-5.8562	11.8313	0.52297	0.0:0.0:0.6996:0.3004	.	662;641	P98082;P98082-3	DAB2_HUMAN;.	K	662;444;641;641	ENSP00000313391:Q662K;ENSP00000345508:Q444K;ENSP00000439919:Q641K;ENSP00000426245:Q641K	ENSP00000313391:Q662K	Q	-	1	0	DAB2	39412662	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.482000	0.73613	2.366000	0.80165	0.655000	0.94253	CAG	.		0.507	DAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367014.1	NM_001343	
JAKMIP2	9832	broad.mit.edu	37	5	147011063	147011064	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr5:147011063_147011064delTC	ENST00000265272.5	-	14	2254_2255	c.1787_1788delGA	c.(1786-1788)agafs	p.R597fs	JAKMIP2_ENST00000507386.1_Frame_Shift_Del_p.R576fs|JAKMIP2_ENST00000333010.6_Frame_Shift_Del_p.R555fs	NM_001270941.1|NM_014790.4	NP_001257870.1|NP_055605.2	Q96AA8	JKIP2_HUMAN	janus kinase and microtubule interacting protein 2	597						Golgi apparatus (GO:0005794)		p.E595fs*17(1)		NS(1)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(22)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAGGGGATCGTCTCTCTCTCTC	0.371																																					p.596_596del		.											.	JAKMIP2-154	1	Deletion - Frameshift(1)	breast(1)	c.1787_1788del						.																																			SO:0001589	frameshift_variant	9832	exon14			GGATCGTCTCTCT	AB011127	CCDS4285.1, CCDS59495.1, CCDS64284.1, CCDS75352.1	5q32	2009-08-13	2009-08-13		ENSG00000176049	ENSG00000176049			29067	protein-coding gene	gene with protein product		611197				9628581	Standard	NM_001270941		Approved	JAMIP2, KIAA0555	uc010jgo.2	Q96AA8	OTTHUMG00000129731	ENST00000265272.5:c.1787_1788delGA	5.37:g.147011073_147011074delTC	ENSP00000265272:p.Arg597fs	Somatic	65	0		WXS	Illumina GAIIx	Phase_I	112	7	NM_001270941	0	0	0	0	0	A4ZZA7|A8K5G5|B4DSG0|G5E9Y0|O60302|Q548S1	Frame_Shift_Del	DEL	ENST00000265272.5	37	CCDS4285.1																																																																																			.		0.371	JAKMIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251941.1	NM_014790	
GABRA1	2554	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	161277848	161277848	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr5:161277848T>A	ENST00000428797.2	+	3	387	c.32T>A	c.(31-33)cTt>cAt	p.L11H	GABRA1_ENST00000444819.1_Missense_Mutation_p.L11H|GABRA1_ENST00000393943.4_Missense_Mutation_p.L11H|GABRA1_ENST00000437025.2_Missense_Mutation_p.L11H|GABRA1_ENST00000420560.1_Missense_Mutation_p.L11H|GABRA1_ENST00000023897.6_Missense_Mutation_p.L11H	NM_001127643.1	NP_001121115.1	P14867	GBRA1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 1	11					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|drug binding (GO:0008144)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|endometrium(2)|kidney(3)|large_intestine(4)|liver(1)|lung(22)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(1)	42	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.228)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethanol(DB00898)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methohexital(DB00474)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Prazepam(DB01588)|Primidone(DB00794)|Progabide(DB00837)|Propofol(DB00818)|Quazepam(DB01589)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiamylal(DB01154)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zaleplon(DB00962)|Zolpidem(DB00425)|Zopiclone(DB01198)	TCTGACTGTCTTTGGGCCTGG	0.413																																					p.L11H		.											.	GABRA1-93	0			c.T32A						.						112.0	106.0	108.0					5																	161277848		2203	4300	6503	SO:0001583	missense	2554	exon2			ACTGTCTTTGGGC		CCDS4357.1	5q34	2012-06-22			ENSG00000022355	ENSG00000022355		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4075	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 1"""	137160				1330891	Standard	NM_000806		Approved	EJM5	uc003lyx.4	P14867	OTTHUMG00000163586	ENST00000428797.2:c.32T>A	5.37:g.161277848T>A	ENSP00000393097:p.Leu11His	Somatic	65	0		WXS	Illumina GAIIx	Phase_I	137	56	NM_001127644	0	0	0	0	0	D3DQK6|Q8N629	Missense_Mutation	SNP	ENST00000428797.2	37	CCDS4357.1	.	.	.	.	.	.	.	.	.	.	T	14.92	2.679305	0.47886	.	.	ENSG00000022355	ENST00000023897;ENST00000428797;ENST00000393943;ENST00000437025;ENST00000521339;ENST00000420560;ENST00000522651;ENST00000444819;ENST00000519621	T;T;T;T;T;T;T;T;T	0.80994	-1.44;-1.44;-1.44;-1.44;-0.74;-1.44;-0.74;-1.44;-0.71	5.41	5.41	0.78517	.	0.077428	0.52532	D	0.000071	T	0.73729	0.3624	N	0.19112	0.55	0.43259	D	0.995194	P	0.49862	0.929	P	0.46543	0.52	T	0.78388	-0.2223	10	0.72032	D	0.01	.	14.0345	0.64636	0.0:0.0:0.0:1.0	.	11	P14867	GBRA1_HUMAN	H	11;11;11;11;17;11;11;11;11	ENSP00000023897:L11H;ENSP00000393097:L11H;ENSP00000377517:L11H;ENSP00000415441:L11H;ENSP00000430895:L17H;ENSP00000408041:L11H;ENSP00000430507:L11H;ENSP00000414232:L11H;ENSP00000430435:L11H	ENSP00000023897:L11H	L	+	2	0	GABRA1	161210426	1.000000	0.71417	0.999000	0.59377	0.970000	0.65996	5.076000	0.64413	2.063000	0.61619	0.528000	0.53228	CTT	.		0.413	GABRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252702.2	NM_000806.5	
ZFP62	643836	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	180275938	180275938	+	Missense_Mutation	SNP	A	A	T			TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr5:180275938A>T	ENST00000502412.1	-	2	2614	c.2557T>A	c.(2557-2559)Tca>Aca	p.S853T	ZFP62_ENST00000506377.1_Intron|ZFP62_ENST00000512132.1_Missense_Mutation_p.S820T|ZFP62_ENST00000359141.6_Missense_Mutation_p.S793T	NM_001172638.1	NP_001166109.1	Q8NB50	ZFP62_HUMAN	ZFP62 zinc finger protein	853					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|endometrium(2)|pancreas(1)	4	all_cancers(89;4.01e-05)|all_epithelial(37;4.69e-06)|Renal(175;0.000159)|Lung NSC(126;0.0027)|all_lung(126;0.00469)|Breast(19;0.114)	all_cancers(40;0.00336)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)|all_lung(500;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GTGAGATTTGATCTGATATTA	0.393																																					p.S853T		.											.	.	0			c.T2557A						.						156.0	122.0	132.0					5																	180275938		692	1591	2283	SO:0001583	missense	643836	exon2			GATTTGATCTGAT	AK002206	CCDS47357.1, CCDS47357.2, CCDS54955.1	5q35.3	2013-01-08	2012-11-27			ENSG00000196670		"""Zinc fingers, C2H2-type"""	23241	protein-coding gene	gene with protein product		610281	"""zinc finger protein 62 homolog (mouse)"", ""zinc finger protein 62"""			8808410	Standard	NM_152283		Approved	FLJ34231, ZET, ZNF755	uc011dhf.2	Q8NB50		ENST00000502412.1:c.2557T>A	5.37:g.180275938A>T	ENSP00000423820:p.Ser853Thr	Somatic	135	0		WXS	Illumina GAIIx	Phase_I	194	80	NM_001172638	0	0	1	1	0	B4DIP6|B4E0N3|B5MDX6|B7ZVZ2|B9EIP6|E9PFT8|J3QTA9	Missense_Mutation	SNP	ENST00000502412.1	37	CCDS54955.1	.	.	.	.	.	.	.	.	.	.	A	9.915	1.210571	0.22289	.	.	ENSG00000196670	ENST00000512132;ENST00000359141;ENST00000502412;ENST00000405851	T;T;T	0.07688	3.17;3.17;3.17	4.56	4.56	0.56223	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.08537	0.0212	N	0.08118	0	0.21878	N	0.999496	D	0.57257	0.979	P	0.51777	0.679	T	0.32771	-0.9894	9	0.49607	T	0.09	.	12.5321	0.56122	1.0:0.0:0.0:0.0	.	853	Q8NB50	ZFP62_HUMAN	T	820;793;853;451	ENSP00000426193:S820T;ENSP00000352053:S793T;ENSP00000423820:S853T	ENSP00000352053:S793T	S	-	1	0	ZFP62	180208544	0.000000	0.05858	1.000000	0.80357	0.165000	0.22458	1.003000	0.29809	2.272000	0.75746	0.460000	0.39030	TCA	.		0.393	ZFP62-002	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368386.2	NM_152283	
PPP1R3G	648791	hgsc.bcm.edu	37	6	5086070	5086070	+	Silent	SNP	A	A	G	rs667752		TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr6:5086070A>G	ENST00000405617.2	+	1	351	c.351A>G	c.(349-351)gcA>gcG	p.A117A		NM_001145115.1	NP_001138587.1	B7ZBB8	PP13G_HUMAN	protein phosphatase 1, regulatory subunit 3G	117					glucose homeostasis (GO:0042593)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of glycogen biosynthetic process (GO:0045725)	cytoplasm (GO:0005737)	glycogen binding (GO:2001069)			kidney(2)	2						CGGAGGACGCACAGCTCGGCC	0.692													G|||	5008	1.0	1.0	1.0	5008	,	,		12505	1.0		1.0	False		,,,				2504	1.0				p.A117A		.											.	PPP1R3G-136	0			c.A351G						.						1.0	2.0	2.0					6																	5086070		400	1062	1462	SO:0001819	synonymous_variant	648791	exon1			GGACGCACAGCTC		CCDS47366.1	6p25.1	2012-04-17	2011-10-04		ENSG00000219607	ENSG00000219607		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14945	protein-coding gene	gene with protein product			"""protein phosphatase 1, regulatory (inhibitor) subunit 3G"""			11948623	Standard	NM_001145115		Approved		uc011dia.1	B7ZBB8	OTTHUMG00000014172	ENST00000405617.2:c.351A>G	6.37:g.5086070A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_001145115	0	0	0	0	0		Silent	SNP	ENST00000405617.2	37	CCDS47366.1																																																																																			A|0.006;G|0.994		0.692	PPP1R3G-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039740.3	NM_001145115	
PNPLA1	285848	bcgsc.ca	37	6	36275458	36275458	+	Missense_Mutation	SNP	T	T	C	rs4713956	byFrequency	TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr6:36275458T>C	ENST00000394571.2	+	8	1564	c.1564T>C	c.(1564-1566)Tcg>Ccg	p.S522P	PNPLA1_ENST00000312917.5_Missense_Mutation_p.S436P|PNPLA1_ENST00000388715.3_Missense_Mutation_p.S427P	NM_001145717.1	NP_001139189.2	Q8N8W4	PLPL1_HUMAN	patatin-like phospholipase domain containing 1	522			S -> P (in dbSNP:rs4713956). {ECO:0000269|PubMed:15489334}.		lipid catabolic process (GO:0016042)	cytoplasm (GO:0005737)	hydrolase activity (GO:0016787)			breast(1)|kidney(1)|large_intestine(4)|lung(9)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)	22						CCCAAGACATTCGGGATCCAA	0.473													C|||	3247	0.648363	0.7375	0.6643	5008	,	,		21355	0.6091		0.6352	False		,,,				2504	0.5706				p.S522P		.											.	PNPLA1-137	0			c.T1564C						.	C	PRO/SER,PRO/SER,PRO/SER	3180,1226	424.9+/-340.6	1131,918,154	96.0	87.0	90.0		1306,1564,1279	2.5	0.0	6	dbSNP_111	90	5415,3185	480.7+/-370.5	1731,1953,616	yes	missense,missense,missense	PNPLA1	NM_001145716.1,NM_001145717.1,NM_173676.2	74,74,74	2862,2871,770	CC,CT,TT		37.0349,27.8257,33.9151	benign,benign,benign	436/447,522/533,427/438	36275458	8595,4411	2203	4300	6503	SO:0001583	missense	285848	exon8			AGACATTCGGGAT		CCDS34438.1, CCDS47416.1, CCDS54997.1	6p21.31	2009-01-12			ENSG00000180316	ENSG00000180316		"""Patatin-like phospholipase domain containing"""	21246	protein-coding gene	gene with protein product		612121				16799181, 19029121	Standard	NM_001145717		Approved	FLJ38755, dJ50J22.1	uc010jwf.2	Q8N8W4	OTTHUMG00000014590	ENST00000394571.2:c.1564T>C	6.37:g.36275458T>C	ENSP00000378072:p.Ser522Pro	Somatic	256	3		WXS	Illumina GAIIx	Phase_I	236	7	NM_001145717	0	0	0	0	0	A3RMU3|J3JS20|Q2A6N1|Q3SY95|Q3SY96|Q5R3L2	Missense_Mutation	SNP	ENST00000394571.2	37	CCDS54997.1	1392	0.6373626373626373	360	0.7317073170731707	241	0.6657458563535912	318	0.5559440559440559	473	0.6240105540897097	C	0.235	-1.017690	0.02078	0.721743	0.629651	ENSG00000180316	ENST00000388715;ENST00000312917;ENST00000457797;ENST00000394571	T;T;T;T	0.26373	1.97;1.97;1.74;1.74	5.34	2.53	0.30540	.	1.098950	0.07033	N	0.828792	T	0.01523	0.0049	N	0.01168	-0.975	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.41858	-0.9485	9	0.02654	T	1	-0.0037	2.7662	0.05321	0.146:0.5497:0.1415:0.1629	rs4713956;rs52811349;rs56418349;rs60329487;rs4713956	522;436	Q8N8W4;Q8N8W4-3	PLPL1_HUMAN;.	P	427;436;523;522	ENSP00000373367:S427P;ENSP00000321116:S436P;ENSP00000391868:S523P;ENSP00000378072:S522P	ENSP00000321116:S436P	S	+	1	0	PNPLA1	36383436	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.419000	0.21247	-0.019000	0.14055	-0.825000	0.03093	TCG	C|0.644;N|0.000		0.473	PNPLA1-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_173676	
KCNK17	89822	hgsc.bcm.edu	37	6	39282036	39282036	+	Missense_Mutation	SNP	T	T	C	rs10947804	byFrequency	TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr6:39282036T>C	ENST00000373231.4	-	1	293	c.61A>G	c.(61-63)Agc>Ggc	p.S21G	KCNK17_ENST00000453413.2_Missense_Mutation_p.S21G	NM_031460.3	NP_113648.2	Q96T54	KCNKH_HUMAN	potassium channel, subfamily K, member 17	21			S -> G (in dbSNP:rs10947804). {ECO:0000269|PubMed:11248242, ECO:0000269|PubMed:15489334}.		potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(2)	14						AGCACGGTGCTGGGCACCGCG	0.761													T|||	2917	0.582468	0.8858	0.4553	5008	,	,		12417	0.4673		0.4851	False		,,,				2504	0.4816				p.S21G		.											.	KCNK17-227	0			c.A61G						.	T	GLY/SER,GLY/SER	3100,536		1364,372,82	3.0	4.0	3.0		61,61	2.1	0.0	6	dbSNP_120	3	4061,3263		1251,1559,852	yes	missense,missense	KCNK17	NM_001135111.1,NM_031460.3	56,56	2615,1931,934	CC,CT,TT		44.5522,14.7415,34.6624	benign,benign	21/272,21/333	39282036	7161,3799	1818	3662	5480	SO:0001583	missense	89822	exon1			CGGTGCTGGGCAC	AF358910	CCDS4842.1, CCDS47419.1	6p21	2012-03-07			ENSG00000124780	ENSG00000124780		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	14465	protein-coding gene	gene with protein product		607370				16382106	Standard	NM_031460		Approved	K2p17.1, TALK-2, TALK2, TASK4, TASK-4	uc003ooo.3	Q96T54	OTTHUMG00000014646	ENST00000373231.4:c.61A>G	6.37:g.39282036T>C	ENSP00000362328:p.Ser21Gly	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	11	10	NM_001135111	0	0	0	0	0	E9PB46|Q5TCF4|Q8TAW4|Q9BXD1|Q9H592	Missense_Mutation	SNP	ENST00000373231.4	37	CCDS4842.1	1214	0.5558608058608059	431	0.8760162601626016	173	0.47790055248618785	244	0.42657342657342656	366	0.48284960422163586	T	8.033	0.762256	0.15914	0.852585	0.554478	ENSG00000124780	ENST00000373231;ENST00000453413	T;T	0.56776	0.44;0.44	4.06	2.09	0.27110	.	1.425750	0.04586	N	0.395947	T	0.14184	0.0343	N	0.17082	0.46	0.80722	P	0.0	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	T	0.09122	-1.0689	9	0.21014	T	0.42	.	5.3388	0.15973	0.0:0.5516:0.0:0.4484	rs10947804;rs17845776;rs17858736;rs60349641	21;21	E9PB46;Q96T54	.;KCNKH_HUMAN	G	21	ENSP00000362328:S21G;ENSP00000401271:S21G	ENSP00000362328:S21G	S	-	1	0	KCNK17	39390014	0.000000	0.05858	0.003000	0.11579	0.032000	0.12392	-0.229000	0.09098	0.383000	0.24910	0.459000	0.35465	AGC	T|0.441;C|0.559		0.761	KCNK17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040453.2	NM_031460	
PEX6	5190	hgsc.bcm.edu	37	6	42946490	42946490	+	Silent	SNP	C	C	A	rs9462858	byFrequency	TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr6:42946490C>A	ENST00000304611.8	-	1	468	c.399G>T	c.(397-399)gtG>gtT	p.V133V	PEX6_ENST00000244546.4_Silent_p.V133V	NM_000287.3	NP_000278.3	Q13608	PEX6_HUMAN	peroxisomal biogenesis factor 6	133					ATP catabolic process (GO:0006200)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix, translocation (GO:0016561)|protein stabilization (GO:0050821)|protein targeting to peroxisome (GO:0006625)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)			NS(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(3)	15			all cancers(41;0.00235)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.0562)			GCGGTCCGGGCACTGGGAGGG	0.746													C|||	1662	0.331869	0.3691	0.3516	5008	,	,		10923	0.1002		0.4612	False		,,,				2504	0.3732				p.V133V		.											.	PEX6-91	0			c.G399T						.	C		1002,2080		214,574,753	2.0	3.0	3.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	399	2.1	0.9	6	dbSNP_119	3	2653,4001		636,1381,1310	no	coding-synonymous	PEX6	NM_000287.3		850,1955,2063	AA,AC,CC		39.8708,32.5114,37.5411		133/981	42946490	3655,6081	1541	3327	4868	SO:0001819	synonymous_variant	5190	exon1			TCCGGGCACTGGG	U56602	CCDS4877.1	6p22-p11	2010-04-21			ENSG00000124587	ENSG00000124587		"""ATPases / AAA-type"""	8859	protein-coding gene	gene with protein product		601498				8670792	Standard	NM_000287		Approved	PXAAA1, PAF-2	uc003otf.3	Q13608	OTTHUMG00000014713	ENST00000304611.8:c.399G>T	6.37:g.42946490C>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_000287	0	0	0	2	2	Q5T8W1|Q8WYQ0|Q8WYQ1|Q8WYQ2|Q99476	Silent	SNP	ENST00000304611.8	37	CCDS4877.1																																																																																			C|0.673;A|0.327		0.746	PEX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040569.1	NM_000287	
RIMS1	22999	broad.mit.edu;bcgsc.ca	37	6	73100417	73100417	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr6:73100417A>G	ENST00000521978.1	+	30	4484	c.4484A>G	c.(4483-4485)aAc>aGc	p.N1495S	RIMS1_ENST00000425662.2_Missense_Mutation_p.N563S|RIMS1_ENST00000517960.1_Missense_Mutation_p.N1278S|RIMS1_ENST00000431478.2_3'UTR|RIMS1_ENST00000264839.7_Missense_Mutation_p.N1344S|RIMS1_ENST00000538414.1_Missense_Mutation_p.N301S|RIMS1_ENST00000522291.1_Missense_Mutation_p.N1094S|RIMS1_ENST00000518273.1_Missense_Mutation_p.N1174S|RIMS1_ENST00000520567.1_Missense_Mutation_p.N1145S|RIMS1_ENST00000401910.3_Missense_Mutation_p.N815S|RIMS1_ENST00000523963.1_Missense_Mutation_p.N620S|RIMS1_ENST00000414192.2_Missense_Mutation_p.N22S|RIMS1_ENST00000491071.2_Missense_Mutation_p.N1318S|RIMS1_ENST00000517827.1_Missense_Mutation_p.N629S|RIMS1_ENST00000348717.5_Missense_Mutation_p.N1278S	NM_014989.5	NP_055804.2	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	1495					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|glutamate secretion (GO:0014047)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|neurotransmitter secretion (GO:0007269)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|protein complex assembly (GO:0006461)|regulated secretory pathway (GO:0045055)|regulation of catalytic activity (GO:0050790)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neurotransmitter secretion (GO:0046928)|response to stimulus (GO:0050896)|secretion (GO:0046903)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|visual perception (GO:0007601)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)|small GTPase regulator activity (GO:0005083)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(25)|liver(4)|lung(35)|ovary(9)|pancreas(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	102		all_epithelial(107;0.179)|all_hematologic(105;0.212)				GGCAGCATCAACAGTTACAGC	0.473																																					p.N1495S		.											.	RIMS1-144	0			c.A4484G						.						73.0	76.0	75.0					6																	73100417		2072	4224	6296	SO:0001583	missense	22999	exon30			GCATCAACAGTTA	AB002338	CCDS47449.1, CCDS55029.1, CCDS55030.1, CCDS55031.1, CCDS55032.1, CCDS55033.1	6q12-q13	2008-10-16	2002-06-12	2002-06-14	ENSG00000079841	ENSG00000079841			17282	protein-coding gene	gene with protein product	"""Rab3-interacting molecule"""	606629	"""RAB3 interacting protein 2"""	RAB3IP2, CORD7		9205841, 11438518	Standard	NM_001168407		Approved	RIM, KIAA0340, RIM1	uc003pga.4	Q86UR5	OTTHUMG00000015009	ENST00000521978.1:c.4484A>G	6.37:g.73100417A>G	ENSP00000428417:p.Asn1495Ser	Somatic	190	0		WXS	Illumina GAIIx	Phase_I	184	9	NM_014989	0	0	0	0	0	A7MBN6|B7Z2M0|B7Z2Q9|B7Z3S3|B7Z6S2|E7EX08|E9PCB7|E9PCZ1|E9PF48|E9PHF5|E9PHR1|O15048|Q5JY21|Q5JY25|Q5SZK1|Q8TDY9|Q8TDZ5|Q9HBA1|Q9HBA2|Q9HBA3|Q9HBA4|Q9HBA5|Q9HBA6	Missense_Mutation	SNP	ENST00000521978.1	37	CCDS47449.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	25.5|25.5	4.646121|4.646121	0.87958|0.87958	.|.	.|.	ENSG00000079841|ENSG00000079841	ENST00000491071;ENST00000350827;ENST00000352008;ENST00000348717;ENST00000349908;ENST00000346609;ENST00000264839;ENST00000517960;ENST00000518273;ENST00000520567;ENST00000522291;ENST00000521978;ENST00000401910;ENST00000523963;ENST00000425662;ENST00000453976;ENST00000517827;ENST00000370420;ENST00000538414;ENST00000414192|ENST00000522211	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T|.	0.19250|.	2.34;2.57;2.52;2.57;2.65;2.66;2.65;2.49;2.58;2.63;2.65;2.36;2.64;2.16;2.17;2.25|.	5.64|5.64	5.64|5.64	0.86602|0.86602	.|.	0.081298|.	0.50627|.	D|.	0.000117|.	T|T	0.68742|0.68742	0.3034|0.3034	M|M	0.76328|0.76328	2.33|2.33	0.58432|0.58432	D|D	0.999995|0.999995	B;B;P;P;D;D;P;B;D;P;D;D;D|.	0.89917|.	0.224;0.366;0.943;0.955;0.994;1.0;0.58;0.391;0.992;0.856;0.982;0.978;0.982|.	B;B;P;P;D;D;B;B;P;P;D;P;D|.	0.85130|.	0.223;0.347;0.695;0.766;0.991;0.997;0.245;0.222;0.867;0.474;0.952;0.761;0.952|.	T|T	0.70487|0.70487	-0.4858|-0.4858	10|5	0.34782|.	T|.	0.22|.	-23.1089|-23.1089	15.8608|15.8608	0.79019|0.79019	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	119;301;629;620;1344;815;1094;398;1174;1278;571;1318;1495|.	B7Z6K9;B7Z7W2;B7Z3S3;E9PHF5;E9PHR1;E9PF48;E7EX08;Q5JY22;E7ERQ1;E7ENC2;Q5JY21;C9JNW6;Q86UR5|.	.;.;.;.;.;.;.;.;.;.;.;.;RIMS1_HUMAN|.	S|A	1318;1344;1318;1278;1174;1094;1344;1278;1174;1145;1094;1495;815;620;563;660;629;543;301;22|413	ENSP00000430101:N1318S;ENSP00000275037:N1278S;ENSP00000264839:N1344S;ENSP00000429959:N1278S;ENSP00000430408:N1174S;ENSP00000430502:N1145S;ENSP00000430932:N1094S;ENSP00000428417:N1495S;ENSP00000385649:N815S;ENSP00000428328:N620S;ENSP00000411235:N563S;ENSP00000389503:N660S;ENSP00000428367:N629S;ENSP00000359448:N543S;ENSP00000439730:N301S;ENSP00000402273:N22S|.	ENSP00000264839:N1344S|.	N|T	+|+	2|1	0|0	RIMS1|RIMS1	73157138|73157138	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.960000|0.960000	0.62799|0.62799	9.339000|9.339000	0.96797|0.96797	2.142000|2.142000	0.66516|0.66516	0.460000|0.460000	0.39030|0.39030	AAC|ACA	.		0.473	RIMS1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374968.1		
USP42	84132	hgsc.bcm.edu	37	7	6193521	6193521	+	Missense_Mutation	SNP	G	G	C	rs61729726	byFrequency	TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr7:6193521G>C	ENST00000306177.5	+	15	2494	c.2336G>C	c.(2335-2337)cGc>cCc	p.R779P		NM_032172.2	NP_115548.1	Q9H9J4	UBP42_HUMAN	ubiquitin specific peptidase 42	779	Pro-rich.				cell differentiation (GO:0030154)|protein deubiquitination (GO:0016579)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(2)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	35		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.108)|OV - Ovarian serous cystadenocarcinoma(56;5.77e-14)		CCGCCGCCCCGCGATCCCGGC	0.756													C|||	2895	0.578075	0.8638	0.4121	5008	,	,		10724	0.7331		0.3082	False		,,,				2504	0.4274				p.R779P		.											.	USP42-659	0			c.G2336C						.	C	PRO/ARG	2157,1125		751,655,235	4.0	6.0	5.0		2336	2.6	0.0	7	dbSNP_129	5	1843,5693		290,1263,2215	no	missense	USP42	NM_032172.2	103	1041,1918,2450	CC,CG,GG		24.4559,34.2779,36.9754	benign	779/1317	6193521	4000,6818	1641	3768	5409	SO:0001583	missense	84132	exon15			CGCCCCGCGATCC	AK022759	CCDS47535.1	7p22.2	2005-08-08	2005-08-08		ENSG00000106346	ENSG00000106346		"""Ubiquitin-specific peptidases"""	20068	protein-coding gene	gene with protein product			"""ubiquitin specific protease 42"""			12838346	Standard	NM_032172		Approved	FLJ12697	uc011jwp.2	Q9H9J4	OTTHUMG00000151888	ENST00000306177.5:c.2336G>C	7.37:g.6193521G>C	ENSP00000301962:p.Arg779Pro	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	22	16	NM_032172	0	0	0	0	0	A2RUE3|B5MDA5|Q0VIN8|Q3C166|Q6P9B4	Missense_Mutation	SNP	ENST00000306177.5	37	CCDS47535.1	1188	0.5439560439560439	401	0.8150406504065041	130	0.35911602209944754	440	0.7692307692307693	217	0.2862796833773087	C	10.95	1.494372	0.26774	0.657221	0.244559	ENSG00000106346	ENST00000306177;ENST00000426246	T;T	0.14266	2.52;2.93	5.46	2.59	0.31030	.	0.841331	0.10600	N	0.655737	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.09164	-1.0687	9	0.28530	T	0.3	.	2.8136	0.05448	0.1458:0.5508:0.1414:0.162	rs61729726	779;779	Q9H9J4-2;Q9H9J4	.;UBP42_HUMAN	P	779;625	ENSP00000301962:R779P;ENSP00000408217:R625P	ENSP00000301962:R779P	R	+	2	0	USP42	6160046	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.469000	0.22067	0.265000	0.21872	-0.120000	0.15030	CGC	G|0.456;C|0.544		0.756	USP42-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324262.3	XM_166526	
SP8	221833	hgsc.bcm.edu	37	7	20824956	20824956	+	Silent	SNP	C	C	G	rs201180283		TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr7:20824956C>G	ENST00000361443.4	-	3	663	c.426G>C	c.(424-426)ggG>ggC	p.G142G	SP8_ENST00000418710.2_Silent_p.G160G	NM_198956.2	NP_945194.1	Q8IXZ3	SP8_HUMAN	Sp8 transcription factor	142					dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|proximal/distal pattern formation (GO:0009954)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|large_intestine(2)|lung(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	8						cgccgccgcccccgccgccgc	0.741																																					p.G160G		.											.	SP8-91	0			c.G480C						.						2.0	2.0	2.0					7																	20824956		542	1367	1909	SO:0001819	synonymous_variant	221833	exon2			GCCGCCCCCGCCG		CCDS5372.1, CCDS43555.1	7p21.2	2013-01-08			ENSG00000164651	ENSG00000164651		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	19196	protein-coding gene	gene with protein product		608306					Standard	NM_182700		Approved		uc003suz.3	Q8IXZ3	OTTHUMG00000094788	ENST00000361443.4:c.426G>C	7.37:g.20824956C>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	17	7	NM_182700	0	0	0	1	1	Q7Z615|Q7Z616|Q96MJ1	Silent	SNP	ENST00000361443.4	37	CCDS5372.1																																																																																			.		0.741	SP8-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326904.2		
GARS	2617	hgsc.bcm.edu	37	7	30634661	30634661	+	Missense_Mutation	SNP	C	C	G	rs1049402	byFrequency	TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr7:30634661C>G	ENST00000389266.3	+	1	365	c.124C>G	c.(124-126)Ccc>Gcc	p.P42A	AC005154.6_ENST00000579174.1_RNA|AC005154.6_ENST00000583664.1_RNA|AC005154.6_ENST00000584372.1_RNA|AC005154.6_ENST00000578994.1_RNA|AC005154.6_ENST00000582549.1_RNA|AC005154.6_ENST00000584199.1_RNA|AC005154.6_ENST00000581665.1_RNA|AC005154.6_ENST00000580440.1_RNA	NM_002047.2	NP_002038.2	P41250	SYG_HUMAN	glycyl-tRNA synthetase	42			P -> A (in dbSNP:rs1049402). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:7753621, ECO:0000269|PubMed:7961834, ECO:0000269|PubMed:7962006}.		cell death (GO:0008219)|diadenosine tetraphosphate biosynthetic process (GO:0015966)|gene expression (GO:0010467)|glycyl-tRNA aminoacylation (GO:0006426)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|secretory granule (GO:0030141)	ATP binding (GO:0005524)|glycine-tRNA ligase activity (GO:0004820)|protein dimerization activity (GO:0046983)	p.P42fs*20(1)		breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|skin(3)|urinary_tract(1)	24					Glycine(DB00145)	GGCCTCCTGCCCCCCGATCTC	0.736													G|||	3252	0.649361	0.5219	0.7147	5008	,	,		13746	0.6677		0.7634	False		,,,				2504	0.6391				p.P42A		.											.	GARS-91	1	Insertion - Frameshift(1)	large_intestine(1)	c.C124G						.	G	ALA/PRO	2445,1427		776,893,267	5.0	8.0	7.0		124	-6.6	0.0	7	dbSNP_86	7	6367,1671		2577,1213,229	no	missense	GARS	NM_002047.2	27	3353,2106,496	GG,GC,CC		20.7888,36.8543,26.0118	benign	42/740	30634661	8812,3098	1936	4019	5955	SO:0001583	missense	2617	exon1			TCCTGCCCCCCGA	AK074524	CCDS43564.1	7p15	2014-09-17	2004-02-13		ENSG00000106105	ENSG00000106105	6.1.1.14	"""Aminoacyl tRNA synthetases / Class II"""	4162	protein-coding gene	gene with protein product	"""glycine tRNA ligase"""	600287	"""Charcot-Marie-Tooth neuropathy 2D"""	CMT2D		8595897, 8872480	Standard	NM_002047		Approved	GlyRS, DSMAV, SMAD1	uc003tbm.3	P41250	OTTHUMG00000152769	ENST00000389266.3:c.124C>G	7.37:g.30634661C>G	ENSP00000373918:p.Pro42Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	16	16	NM_002047	0	0	0	9	9	B3KQA2|B4DIA0|Q969Y1	Missense_Mutation	SNP	ENST00000389266.3	37	CCDS43564.1	1456	0.6666666666666666	278	0.5650406504065041	268	0.7403314917127072	337	0.5891608391608392	573	0.7559366754617414	G	0.005	-2.164835	0.00318	0.631457	0.792112	ENSG00000106105	ENST00000389266	T	0.80393	-1.37	3.31	-6.63	0.01807	.	1.037800	0.07609	N	0.925137	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.13575	-1.0504	9	0.08179	T	0.78	.	5.5596	0.17135	0.0726:0.2689:0.1197:0.5389	rs1049402;rs3189564;rs11553500;rs17856223;rs17856227;rs1049402	42	P41250	SYG_HUMAN	A	42	ENSP00000373918:P42A	ENSP00000373918:P42A	P	+	1	0	GARS	30601186	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	-0.671000	0.05250	-2.551000	0.00479	-0.744000	0.03518	CCC	C|0.329;G|0.671		0.736	GARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327735.1	NM_002047	
GLI3	2737	hgsc.bcm.edu	37	7	42005678	42005678	+	Missense_Mutation	SNP	G	G	A	rs929387	byFrequency	TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr7:42005678G>A	ENST00000395925.3	-	15	3077	c.2993C>T	c.(2992-2994)cCg>cTg	p.P998L	GLI3_ENST00000479210.1_5'UTR	NM_000168.5	NP_000159.3	P10071	GLI3_HUMAN	GLI family zinc finger 3	998			P -> L (in dbSNP:rs929387). {ECO:0000269|PubMed:10441342, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:2118997}.		anterior semicircular canal development (GO:0060873)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye morphogenesis (GO:0048593)|cell differentiation involved in kidney development (GO:0061005)|cerebral cortex radial glia guided migration (GO:0021801)|developmental growth (GO:0048589)|embryonic digestive tract development (GO:0048566)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain radial glial cell differentiation (GO:0021861)|frontal suture morphogenesis (GO:0060364)|heart development (GO:0007507)|hindgut morphogenesis (GO:0007442)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|lambdoid suture morphogenesis (GO:0060366)|lateral ganglionic eminence cell proliferation (GO:0022018)|lateral semicircular canal development (GO:0060875)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|mammary gland specification (GO:0060594)|melanocyte differentiation (GO:0030318)|metanephros development (GO:0001656)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative thymic T cell selection (GO:0045060)|nose morphogenesis (GO:0043585)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte differentiation (GO:0048709)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein processing (GO:0016485)|proximal/distal pattern formation (GO:0009954)|response to estrogen (GO:0043627)|sagittal suture morphogenesis (GO:0060367)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)|T cell differentiation in thymus (GO:0033077)|thymocyte apoptotic process (GO:0070242)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|primary cilium (GO:0072372)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|biliary_tract(1)|breast(4)|central_nervous_system(2)|endometrium(12)|kidney(7)|large_intestine(25)|lung(49)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	112						GCCGTGGCCCGGCGCATCGTG	0.746									Pallister-Hall syndrome;Greig Cephalopolysyndactyly				G|||	2111	0.421526	0.1619	0.4424	5008	,	,		11700	0.7688		0.3161	False		,,,				2504	0.5082				p.P998L		.											.	GLI3-1149	0			c.C2993T						.	G	LEU/PRO	654,2960		69,516,1222	4.0	5.0	5.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	2993	3.8	0.2	7	dbSNP_86	5	2170,5232		331,1508,1862	no	missense	GLI3	NM_000168.5	98	400,2024,3084	AA,AG,GG		29.3164,18.0963,25.6354	benign	998/1581	42005678	2824,8192	1807	3701	5508	SO:0001583	missense	2737	exon15	Familial Cancer Database	;	TGGCCCGGCGCAT		CCDS5465.1	7p13	2013-01-25	2009-03-05		ENSG00000106571	ENSG00000106571		"""Zinc fingers, C2H2-type"""	4319	protein-coding gene	gene with protein product	"""zinc finger protein GLI3"", ""oncogene GLI3"", ""DNA-binding protein"""	165240	"""Greig cephalopolysyndactyly syndrome"", ""GLI-Kruppel family member GLI3"", ""glioma-associated oncogene family zinc finger 3"""	GCPS, PHS		2118997	Standard	NM_000168		Approved	PAP-A, PAPA, PAPA1, PAPB, ACLS, PPDIV	uc011kbh.2	P10071	OTTHUMG00000023630	ENST00000395925.3:c.2993C>T	7.37:g.42005678G>A	ENSP00000379258:p.Pro998Leu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	5	NM_000168	0	0	0	0	0	A4D1W1|O75219|Q17RW4|Q75MT0|Q75MU9|Q9UDT5|Q9UJ39	Missense_Mutation	SNP	ENST00000395925.3	37	CCDS5465.1	917	0.4198717948717949	75	0.1524390243902439	153	0.42265193370165743	451	0.7884615384615384	238	0.31398416886543534	G	1.729	-0.494582	0.04322	0.180963	0.293164	ENSG00000106571	ENST00000395925	T	0.15256	2.44	4.98	3.83	0.44106	.	0.327528	0.33217	N	0.005158	T	0.00012	0.0000	N	0.05554	-0.025	0.09310	P	0.9999999999224007	B	0.06786	0.001	B	0.04013	0.001	T	0.16247	-1.0409	9	0.17369	T	0.5	.	5.4162	0.16376	0.7624:0.0:0.0842:0.1533	rs929387;rs929387	998	P10071	GLI3_HUMAN	L	998	ENSP00000379258:P998L	ENSP00000379258:P998L	P	-	2	0	GLI3	41972203	1.000000	0.71417	0.171000	0.22900	0.021000	0.10359	4.758000	0.62220	0.733000	0.32492	-0.471000	0.05019	CCG	G|0.565;A|0.435		0.746	GLI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250806.3	NM_000168	
NOM1	64434	hgsc.bcm.edu	37	7	156742501	156742501	+	Missense_Mutation	SNP	C	C	G	rs6969990	byFrequency	TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr7:156742501C>G	ENST00000275820.3	+	1	85	c.70C>G	c.(70-72)Cgc>Ggc	p.R24G		NM_138400.1	NP_612409.1	Q5C9Z4	NOM1_HUMAN	nucleolar protein with MIF4G domain 1	24	Necessary for nucleolar localization and for targeting PPP1CA to the nucleolus.		R -> G (in dbSNP:rs6969990).			nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(4)|large_intestine(9)|lung(7)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	31	Ovarian(565;0.218)	all_hematologic(28;0.0749)	OV - Ovarian serous cystadenocarcinoma(82;0.00301)	UCEC - Uterine corpus endometrioid carcinoma (81;0.169)		CCGCATGAAGCGCAGAggcgg	0.721													.|||	1013	0.202276	0.2042	0.2392	5008	,	,		7202	0.2778		0.1511	False		,,,				2504	0.1483				p.R24G		.											.	NOM1-90	0			c.C70G						.	C	GLY/ARG	460,2914		22,416,1249	3.0	4.0	3.0		70	4.4	0.0	7	dbSNP_116	3	715,6171		26,663,2754	no	missense	NOM1	NM_138400.1	125	48,1079,4003	GG,GC,CC		10.3834,13.6337,11.4522	probably-damaging	24/861	156742501	1175,9085	1687	3443	5130	SO:0001583	missense	64434	exon1			ATGAAGCGCAGAG	AF107455	CCDS34787.1	7q36.3	2014-06-13	2005-03-30	2005-03-30	ENSG00000146909	ENSG00000146909			13244	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 113"""	611269	"""chromosome 7 open reading frame 3"""	C7orf3		10329000	Standard	XM_005249560		Approved	SGD1, PPP1R113	uc003wmy.3	Q5C9Z4	OTTHUMG00000152639	ENST00000275820.3:c.70C>G	7.37:g.156742501C>G	ENSP00000275820:p.Arg24Gly	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	27	13	NM_138400	0	0	0	1	1	Q96I08	Missense_Mutation	SNP	ENST00000275820.3	37	CCDS34787.1	459	0.21016483516483517	100	0.2032520325203252	69	0.19060773480662985	164	0.2867132867132867	126	0.1662269129287599	C	17.33	3.362797	0.61403	0.136337	0.103834	ENSG00000146909	ENST00000275820	T	0.13307	2.6	4.36	4.36	0.52297	.	1.850510	0.03172	N	0.170899	T	0.00012	0.0000	L	0.27053	0.805	0.58432	P	9.99999999995449E-6	D	0.64830	0.994	P	0.54924	0.764	T	0.39603	-0.9606	9	0.87932	D	0	-1.3828	15.9395	0.79743	0.0:1.0:0.0:0.0	rs6969990;rs6969990	24	Q5C9Z4	NOM1_HUMAN	G	24	ENSP00000275820:R24G	ENSP00000275820:R24G	R	+	1	0	NOM1	156435262	0.939000	0.31865	0.023000	0.16930	0.179000	0.23085	3.589000	0.53972	1.979000	0.57680	0.306000	0.20318	CGC	C|0.663;G|0.337		0.721	NOM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327098.1	NM_138400	
PCMTD1	115294	bcgsc.ca	37	8	52733121	52733121	+	Silent	SNP	G	G	A			TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr8:52733121G>A	ENST00000360540.5	-	7	1270	c.864C>T	c.(862-864)taC>taT	p.Y288Y	PCMTD1_ENST00000522514.1_Silent_p.Y288Y|PCMTD1_ENST00000544451.1_Silent_p.Y212Y|PCMTD1_ENST00000519559.1_5'UTR	NM_052937.2	NP_443169.2	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1	288						cytoplasm (GO:0005737)	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity (GO:0004719)			NS(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(17)|prostate(2)|skin(8)|soft_tissue(1)	37		Lung NSC(129;0.0795)|all_lung(136;0.144)				CCACAAATACGTAAGTGTTAA	0.388																																					p.Y288Y		.											.	PCMTD1-68	0			c.C864T						.						192.0	190.0	191.0					8																	52733121		2203	4300	6503	SO:0001819	synonymous_variant	115294	exon6			AAATACGTAAGTG		CCDS6148.1, CCDS69480.1	8q11.23	2010-08-05			ENSG00000168300	ENSG00000168300			30483	protein-coding gene	gene with protein product							Standard	XM_005251146		Approved	FLJ10883	uc003xqx.4	Q96MG8	OTTHUMG00000164246	ENST00000360540.5:c.864C>T	8.37:g.52733121G>A		Somatic	225	4		WXS	Illumina GAIIx	Phase_I	227	11	NM_052937	0	0	15	15	0	Q96FK9	Silent	SNP	ENST00000360540.5	37	CCDS6148.1																																																																																			G|0.999;A|0.001		0.388	PCMTD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377909.2	NM_052937	
PCMTD1	115294	bcgsc.ca	37	8	52733143	52733143	+	Missense_Mutation	SNP	A	A	G	rs111785933		TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr8:52733143A>G	ENST00000360540.5	-	7	1248	c.842T>C	c.(841-843)gTt>gCt	p.V281A	PCMTD1_ENST00000522514.1_Missense_Mutation_p.V281A|PCMTD1_ENST00000544451.1_Missense_Mutation_p.V205A|PCMTD1_ENST00000519559.1_5'UTR	NM_052937.2	NP_443169.2	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1	281						cytoplasm (GO:0005737)	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity (GO:0004719)			NS(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(17)|prostate(2)|skin(8)|soft_tissue(1)	37		Lung NSC(129;0.0795)|all_lung(136;0.144)				TCTCTGTTTAACTCTCTTTCT	0.393																																					p.V281A		.											.	PCMTD1-68	0			c.T842C						.						172.0	174.0	174.0					8																	52733143		2203	4300	6503	SO:0001583	missense	115294	exon6			TGTTTAACTCTCT		CCDS6148.1, CCDS69480.1	8q11.23	2010-08-05			ENSG00000168300	ENSG00000168300			30483	protein-coding gene	gene with protein product							Standard	XM_005251146		Approved	FLJ10883	uc003xqx.4	Q96MG8	OTTHUMG00000164246	ENST00000360540.5:c.842T>C	8.37:g.52733143A>G	ENSP00000353739:p.Val281Ala	Somatic	239	4		WXS	Illumina GAIIx	Phase_I	239	13	NM_052937	0	0	4	4	0	Q96FK9	Missense_Mutation	SNP	ENST00000360540.5	37	CCDS6148.1	.	.	.	.	.	.	.	.	.	.	A	4.043	0.005592	0.07866	.	.	ENSG00000168300	ENST00000360540;ENST00000544451;ENST00000522514	T;T;T	0.46063	0.88;0.88;0.88	5.97	4.75	0.60458	.	0.260164	0.36972	N	0.002316	T	0.32556	0.0833	L	0.42245	1.32	0.29355	N	0.865105	B;B;B	0.18863	0.009;0.008;0.031	B;B;B	0.18263	0.015;0.005;0.021	T	0.15780	-1.0425	10	0.15066	T	0.55	-33.7683	11.4736	0.50284	0.6809:0.3191:0.0:0.0	.	151;205;281	B4E2B4;F5H1M8;Q96MG8	.;.;PCMD1_HUMAN	A	281;205;281	ENSP00000353739:V281A;ENSP00000444026:V205A;ENSP00000428099:V281A	ENSP00000353739:V281A	V	-	2	0	PCMTD1	52895696	1.000000	0.71417	0.992000	0.48379	0.981000	0.71138	5.794000	0.69067	2.281000	0.76405	0.533000	0.62120	GTT	A|0.500;G|0.500		0.393	PCMTD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377909.2	NM_052937	
BHLHE22	27319	hgsc.bcm.edu	37	8	65493532	65493532	+	Missense_Mutation	SNP	T	T	A	rs62519835	byFrequency	TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr8:65493532T>A	ENST00000321870.1	+	1	719	c.185T>A	c.(184-186)cTg>cAg	p.L62Q	RP11-21C4.1_ENST00000517909.1_RNA	NM_152414.4	NP_689627.1	Q8NFJ8	BHE22_HUMAN	basic helix-loop-helix family, member e22	62					anterior commissure morphogenesis (GO:0021960)|cerebral cortex regionalization (GO:0021796)|corpus callosum morphogenesis (GO:0021540)|corticospinal tract morphogenesis (GO:0021957)|negative regulation of transcription, DNA-templated (GO:0045892)|retinal bipolar neuron differentiation (GO:0060040)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.L62Q(1)		NS(1)|central_nervous_system(1)|lung(1)|prostate(1)|skin(1)	5						TCGTCGCCCCTGGGCTGCTTC	0.776													T|||	233	0.0465256	0.0053	0.0706	5008	,	,		6928	0.004		0.1481	False		,,,				2504	0.0245				p.L62Q	Colon(113;104 1586 2865 9855 18065)	.											.	BHLHE22-90	1	Substitution - Missense(1)	NS(1)	c.T185A						.	T	GLN/LEU	38,3528		0,38,1745	4.0	5.0	4.0		185	2.0	1.0	8	dbSNP_129	4	573,6683		11,551,3066	no	missense	BHLHE22	NM_152414.4	113	11,589,4811	AA,AT,TT		7.8969,1.0656,5.6459	probably-damaging	62/382	65493532	611,10211	1783	3628	5411	SO:0001583	missense	27319	exon1			CGCCCCTGGGCTG	U80755	CCDS6179.1	8q12.1	2009-01-12	2009-01-12	2009-01-12		ENSG00000180828		"""Basic helix-loop-helix proteins"""	11963	protein-coding gene	gene with protein product		613483	"""trinucleotide repeat containing 20"", ""basic helix-loop-helix domain containing, class B, 5"""	TNRC20, BHLHB5		9225980, 12213201, 18557763	Standard	NM_152414		Approved	CAGL85, Beta3, bHLHe22	uc003xvi.3	Q8NFJ8		ENST00000321870.1:c.185T>A	8.37:g.65493532T>A	ENSP00000318799:p.Leu62Gln	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	27	17	NM_152414	0	0	0	0	0		Missense_Mutation	SNP	ENST00000321870.1	37	CCDS6179.1	139	0.06364468864468864	5	0.01016260162601626	24	0.06629834254143646	1	0.0017482517482517483	109	0.1437994722955145	T	14.21	2.468289	0.43839	0.010656	0.078969	ENSG00000180828	ENST00000321870	D	0.97888	-4.59	3.18	1.96	0.26148	.	0.107189	0.40144	U	0.001175	T	0.10252	0.0251	N	0.24115	0.695	0.35078	P	0.23685	B	0.34015	0.435	B	0.31337	0.128	T	0.66941	-0.5796	9	0.54805	T	0.06	-9.9523	5.2123	0.15325	0.0:0.1025:0.1827:0.7148	rs62519835	62	Q8NFJ8	BHE22_HUMAN	Q	62	ENSP00000318799:L62Q	ENSP00000318799:L62Q	L	+	2	0	BHLHE22	65656086	0.992000	0.36948	1.000000	0.80357	0.982000	0.71751	2.935000	0.48963	0.410000	0.25675	0.374000	0.22700	CTG	T|0.935;A|0.065		0.776	BHLHE22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378549.1	NM_152414	
CRH	1392	hgsc.bcm.edu	37	8	67089425	67089425	+	Silent	SNP	T	T	G	rs6159	byFrequency	TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr8:67089425T>G	ENST00000276571.3	-	2	734	c.288A>C	c.(286-288)ggA>ggC	p.G96G		NM_000756.2	NP_000747.1	P06850	CRF_HUMAN	corticotropin releasing hormone	96					adrenal gland development (GO:0030325)|associative learning (GO:0008306)|cellular response to cocaine (GO:0071314)|cellular response to dexamethasone stimulus (GO:0071549)|diterpenoid metabolic process (GO:0016101)|feeding behavior (GO:0007631)|female pregnancy (GO:0007565)|ferulate metabolic process (GO:0033494)|glucocorticoid biosynthetic process (GO:0006704)|hormone-mediated apoptotic signaling pathway (GO:0008628)|hypothalamus development (GO:0021854)|inflammatory response (GO:0006954)|ion homeostasis (GO:0050801)|learning or memory (GO:0007611)|locomotory exploration behavior (GO:0035641)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|lung development (GO:0030324)|negative regulation of blood pressure (GO:0045776)|negative regulation of cell death (GO:0060548)|negative regulation of circadian sleep/wake cycle, REM sleep (GO:0042322)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of gene expression (GO:0010629)|negative regulation of glucagon secretion (GO:0070093)|negative regulation of luteinizing hormone secretion (GO:0033685)|negative regulation of norepinephrine secretion (GO:0010700)|parturition (GO:0007567)|positive regulation of behavioral fear response (GO:2000987)|positive regulation of calcium ion import (GO:0090280)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cell death (GO:0010942)|positive regulation of cell proliferation (GO:0008284)|positive regulation of circadian sleep/wake cycle, wakefulness (GO:0010841)|positive regulation of corticosterone secretion (GO:2000854)|positive regulation of corticotropin secretion (GO:0051461)|positive regulation of cortisol secretion (GO:0051464)|positive regulation of digestive system process (GO:0060456)|positive regulation of gene expression (GO:0010628)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of protein phosphorylation (GO:0001934)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of serotonin secretion (GO:0014062)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to ether (GO:0045472)|response to immobilization stress (GO:0035902)|response to pain (GO:0048265)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, dopaminergic (GO:0001963)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|perikaryon (GO:0043204)|varicosity (GO:0043196)	hormone activity (GO:0005179)|neuropeptide hormone activity (GO:0005184)|receptor binding (GO:0005102)			breast(1)|endometrium(1)|lung(2)|urinary_tract(1)	5		all_cancers(86;2.58e-06)|all_epithelial(80;6.27e-09)|all_lung(136;0.000414)|Lung NSC(129;0.0011)	Epithelial(68;0.0136)|all cancers(69;0.0507)|BRCA - Breast invasive adenocarcinoma(89;0.0628)|OV - Ovarian serous cystadenocarcinoma(28;0.0904)		Corticotropin(DB01285)	TGCCGCTGCCTCCGGCGAGGA	0.701											OREG0018805	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	1938	0.386981	0.7557	0.3646	5008	,	,		12753	0.3433		0.1392	False		,,,				2504	0.2045				p.G96G		.											.	CRH-90	0			c.A288C						.	G		1011,1897		182,647,625	2.0	3.0	3.0		288	-2.7	0.0	8	dbSNP_52	3	578,6556		47,484,3036	no	coding-synonymous	CRH	NM_000756.2		229,1131,3661	GG,GT,TT		8.102,34.7662,15.8235		96/197	67089425	1589,8453	1454	3567	5021	SO:0001819	synonymous_variant	1392	exon2			GCTGCCTCCGGCG		CCDS6188.1	8q13	2013-02-25				ENSG00000147571		"""Endogenous ligands"""	2355	protein-coding gene	gene with protein product	"""corticotropin-releasing factor"", ""corticoliberin"""	122560					Standard	NM_000756		Approved	CRF	uc003xvy.2	P06850		ENST00000276571.3:c.288A>C	8.37:g.67089425T>G		Somatic	1	0	1096	WXS	Illumina GAIIx	Phase_I	36	14	NM_000756	0	0	0	0	0	B3KQS4	Silent	SNP	ENST00000276571.3	37	CCDS6188.1																																																																																			T|0.642;G|0.358		0.701	CRH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378926.1	NM_000756	
TRPA1	8989	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	72967768	72967768	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr8:72967768C>T	ENST00000262209.4	-	12	1639	c.1432G>A	c.(1432-1434)Ggt>Agt	p.G478S	RP11-383H13.1_ENST00000457356.4_3'UTR	NM_007332.2	NP_015628.2	O75762	TRPA1_HUMAN	transient receptor potential cation channel, subfamily A, member 1	478					calcium ion transmembrane transport (GO:0070588)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to pain (GO:0048265)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium bundle (GO:0032421)	calcium channel activity (GO:0005262)|channel activity (GO:0015267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(26)|lung(44)|ovary(4)|prostate(6)|stomach(1)	98			Epithelial(68;0.223)		Menthol(DB00825)	TGAAGGTCACCTTCATTCAGA	0.413																																					p.G478S		.											.	TRPA1-230	0			c.G1432A						.						97.0	95.0	96.0					8																	72967768		2203	4299	6502	SO:0001583	missense	8989	exon12			GGTCACCTTCATT	Y10601	CCDS34908.1	8q13	2013-01-10	2003-11-20	2003-11-20	ENSG00000104321	ENSG00000104321		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	497	protein-coding gene	gene with protein product		604775	"""ankyrin-like with transmembrane domains 1"""	ANKTM1		16382100	Standard	NM_007332		Approved		uc003xza.3	O75762	OTTHUMG00000164516	ENST00000262209.4:c.1432G>A	8.37:g.72967768C>T	ENSP00000262209:p.Gly478Ser	Somatic	345	0		WXS	Illumina GAIIx	Phase_I	557	225	NM_007332	0	0	0	1	1	A6NIN6	Missense_Mutation	SNP	ENST00000262209.4	37	CCDS34908.1	.	.	.	.	.	.	.	.	.	.	C	19.66	3.869903	0.72065	.	.	ENSG00000104321	ENST00000523582;ENST00000262209	T;T	0.63580	-0.05;-0.05	5.27	5.27	0.74061	Ankyrin repeat-containing domain (4);	0.047511	0.85682	D	0.000000	T	0.75737	0.3890	M	0.64997	1.995	0.58432	D	0.999996	D	0.89917	1.0	D	0.97110	1.0	T	0.69870	-0.5028	10	0.13470	T	0.59	-17.376	18.8668	0.92294	0.0:1.0:0.0:0.0	.	478	O75762	TRPA1_HUMAN	S	330;478	ENSP00000428151:G330S;ENSP00000262209:G478S	ENSP00000262209:G478S	G	-	1	0	TRPA1	73130322	1.000000	0.71417	1.000000	0.80357	0.874000	0.50279	7.187000	0.77730	2.452000	0.82932	0.557000	0.71058	GGT	.		0.413	TRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379079.2	NM_007332	
MAL2	114569	hgsc.bcm.edu	37	8	120220776	120220776	+	Splice_Site	DEL	G	G	-	rs398009582|rs71302978		TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr8:120220776delG	ENST00000276681.6	+	1	167	c.65delG	c.(64-66)cgg>cg	p.R22fs	MAL2_ENST00000521748.1_3'UTR	NM_052886.2	NP_443118.1	Q969L2	MAL2_HUMAN	mal, T-cell differentiation protein 2 (gene/pseudogene)	22						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)						all_cancers(13;1.91e-26)|Lung NSC(37;8.61e-08)|Ovarian(258;0.018)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.000967)			CCGCCGCCCCGGGGTCACCCT	0.771													GGG|GGGG|GGG|insertion	5008	1.0	1.0	1.0	5008	,	,		6681	1.0		1.0	False		,,,				2504	1.0				.		.											.	.	0			c.64+1G>-						.			1571,11		785,1,5	1.0	1.0	1.0			0.7	0.8	8	dbSNP_130	1	4116,22		2057,2,10	no	frameshift	MAL2	NM_052886.2		2842,3,15	A1A1,A1R,RR		0.5317,0.6953,0.5769			120220776	5687,33	184	483	667	SO:0001630	splice_region_variant	114569	exon1			CGCCCCGGGGTCA	AL117612	CCDS75780.1	8q23	2011-01-26	2011-01-26			ENSG00000147676			13634	protein-coding gene	gene with protein product	"""MAL proteolipid protein 2"""	609684				11549320	Standard	NM_052886		Approved		uc003yop.3	Q969L2		ENST00000276681.6:c.66+1G>-	8.37:g.120220776delG		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	12	12	NM_052886	0	0	0	0	0	B2R520|Q6ZMD9	Splice_Site	DEL	ENST00000276681.6	37																																																																																				.		0.771	MAL2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052886	Frame_Shift_Del
CYP11B1	1584	bcgsc.ca	37	8	143957192	143957192	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr8:143957192C>T	ENST00000292427.4	-	6	1089	c.1057G>A	c.(1057-1059)Gaa>Aaa	p.E353K	CYP11B1_ENST00000377675.3_Missense_Mutation_p.E424K|CYP11B1_ENST00000517471.1_Missense_Mutation_p.E353K	NM_000497.3	NP_000488.3	P15538	C11B1_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 1	353					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|glucocorticoid biosynthetic process (GO:0006704)|glucose homeostasis (GO:0042593)|immune response (GO:0006955)|mineralocorticoid biosynthetic process (GO:0006705)|regulation of blood pressure (GO:0008217)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)			central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|lung(36)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	67	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Cimetidine(DB00501)|Clotrimazole(DB00257)|Etomidate(DB00292)|Fluconazole(DB00196)|Hydrocortisone(DB00741)|Ketoconazole(DB01026)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Miconazole(DB01110)|Mitotane(DB00648)|Phenytoin(DB00252)|Spironolactone(DB00421)	TGGGGATGTTCACTGATGCTG	0.667									Familial Hyperaldosteronism type I																												p.E353K		.											.	CYP11B1-94	0			c.G1057A						.						77.0	79.0	78.0					8																	143957192		2203	4300	6503	SO:0001583	missense	1584	exon6	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	GATGTTCACTGAT	D16153	CCDS6392.1, CCDS34953.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000160882	ENSG00000160882	1.14.15.4	"""Cytochrome P450s"""	2591	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	610613	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 1"""	CYP11B		1303253	Standard	XM_005250807		Approved	P450C11, FHI, CPN1	uc003yxi.3	P15538	OTTHUMG00000164637	ENST00000292427.4:c.1057G>A	8.37:g.143957192C>T	ENSP00000292427:p.Glu353Lys	Somatic	200	3		WXS	Illumina GAIIx	Phase_I	415	152	NM_000497	1	2	1344	3005	1658	Q14095|Q4VAQ8|Q4VAQ9|Q9UML2	Missense_Mutation	SNP	ENST00000292427.4	37	CCDS6392.1	.	.	.	.	.	.	.	.	.	.	.	13.77	2.335864	0.41398	.	.	ENSG00000160882	ENST00000519285;ENST00000292427;ENST00000517471;ENST00000377675	T;T;T;T	0.74632	-0.86;-0.4;-0.4;-0.4	4.42	4.42	0.53409	.	0.456447	0.18385	N	0.142855	T	0.73434	0.3586	L	0.49778	1.585	0.09310	N	1	P;P;P;P;P	0.51653	0.891;0.605;0.605;0.918;0.947	P;P;P;P;P	0.56960	0.602;0.665;0.665;0.601;0.81	T	0.62478	-0.6846	10	0.06365	T	0.9	.	8.6999	0.34318	0.0:0.8929:0.0:0.1071	.	424;353;353;353;69	Q4VAR0;Q8TDD0;Q4VAQ9;P15538;Q8N9P8	.;.;.;C11B1_HUMAN;.	K	8;353;353;424	ENSP00000430144:E8K;ENSP00000292427:E353K;ENSP00000428043:E353K;ENSP00000366903:E424K	ENSP00000292427:E353K	E	-	1	0	CYP11B1	143954194	0.001000	0.12720	0.003000	0.11579	0.086000	0.17979	0.432000	0.21461	2.169000	0.68431	0.555000	0.69702	GAA	.		0.667	CYP11B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379475.2		
ZNF696	79943	hgsc.bcm.edu	37	8	144378868	144378868	+	Silent	SNP	A	A	G	rs7386259	byFrequency	TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr8:144378868A>G	ENST00000330143.3	+	3	1432	c.1023A>G	c.(1021-1023)cgA>cgG	p.R341R		NM_030895.2	NP_112157.2	Q9H7X3	ZN696_HUMAN	zinc finger protein 696	341					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	8	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)			GGCACCAGCGACTCCACACGG	0.726													G|||	4505	0.899561	0.9425	0.9179	5008	,	,		11520	0.8403		0.8608	False		,,,				2504	0.9294				p.R341R		.											.	ZNF696-90	0			c.A1023G						.	G		3773,275		1771,231,22	5.0	5.0	5.0		1023	-0.3	0.0	8	dbSNP_116	5	6735,1261		2843,1049,106	no	coding-synonymous	ZNF696	NM_030895.2		4614,1280,128	GG,GA,AA		15.7704,6.7935,12.7532		341/375	144378868	10508,1536	2024	3998	6022	SO:0001819	synonymous_variant	79943	exon3			CCAGCGACTCCAC	AK024191	CCDS6399.1	8q24.3	2013-01-08				ENSG00000185730		"""Zinc fingers, C2H2-type"""	25872	protein-coding gene	gene with protein product							Standard	NM_030895		Approved	FLJ14129	uc003yxy.4	Q9H7X3		ENST00000330143.3:c.1023A>G	8.37:g.144378868A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_030895	0	0	0	0	0	A0AVE2	Silent	SNP	ENST00000330143.3	37	CCDS6399.1																																																																																			A|0.118;G|0.882		0.726	ZNF696-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381164.2	NM_030895	
ZNF517	340385	hgsc.bcm.edu	37	8	146033347	146033347	+	Missense_Mutation	SNP	T	T	C	rs2976653	byFrequency	TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr8:146033347T>C	ENST00000531720.1	+	4	1091	c.1046T>C	c.(1045-1047)gTg>gCg	p.V349A	ZNF517_ENST00000526178.1_Intron|ZNF517_ENST00000359971.3_Missense_Mutation_p.V349A|ZNF517_ENST00000525105.1_Intron			Q6ZMY9	ZN517_HUMAN	zinc finger protein 517	349				V -> A (in Ref. 1; BAD18586). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(2)|lung(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_cancers(97;1.03e-11)|all_epithelial(106;6.69e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;5.47e-39)|OV - Ovarian serous cystadenocarcinoma(54;6.38e-39)|all cancers(56;5.47e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)			GACGGCGGCGTGGGGCAGGGC	0.746													C|||	4981	0.994609	1.0	1.0	5008	,	,		12856	1.0		0.994	False		,,,				2504	0.9785				p.V349A		.											.	ZNF517-90	0			c.T1046C						.	C	ALA/VAL	3411,3		1704,3,0	3.0	5.0	4.0		1046	-0.8	0.0	8	dbSNP_101	4	7050,46		3502,46,0	no	missense	ZNF517	NM_213605.2	64	5206,49,0	CC,CT,TT		0.6483,0.0879,0.4662	benign	349/493	146033347	10461,49	1707	3548	5255	SO:0001583	missense	340385	exon5			GCGGCGTGGGGCA	AK096527	CCDS6434.1	8q24.3	2013-01-08				ENSG00000197363		"""Zinc fingers, C2H2-type"", ""-"""	27984	protein-coding gene	gene with protein product							Standard	NM_213605		Approved		uc003zed.1	Q6ZMY9		ENST00000531720.1:c.1046T>C	8.37:g.146033347T>C	ENSP00000436103:p.Val349Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	16	16	NM_213605	0	0	0	1	1		Missense_Mutation	SNP	ENST00000531720.1	37	CCDS6434.1	2179|2179	0.9977106227106227|0.9977106227106227	492|492	1.0|1.0	362|362	1.0|1.0	572|572	1.0|1.0	753|753	0.9934036939313984|0.9934036939313984	C|C	0.021|0.021	-1.418607|-1.418607	0.01136|0.01136	0.999121|0.999121	0.993517|0.993517	ENSG00000197363|ENSG00000197363	ENST00000359971;ENST00000531720|ENST00000529429	T;T|.	0.05319|.	3.46;3.46|.	2.17|2.17	-0.838|-0.838	0.10762|0.10762	.|.	.|.	.|.	.|.	.|.	T|T	0.00012|0.00012	0.0000|0.0000	L|L	0.35644|0.35644	1.08|1.08	0.80722|0.80722	P|P	0.0|0.0	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|T	0.21449|0.21449	-1.0245|-1.0245	8|4	0.59425|.	D|.	0.04|.	.|.	0.241|0.241	0.00192|0.00192	0.362:0.2246:0.2135:0.1999|0.362:0.2246:0.2135:0.1999	rs2976653;rs59817342|rs2976653;rs59817342	349|.	Q6ZMY9|.	ZN517_HUMAN|.	A|R	349|316	ENSP00000353058:V349A;ENSP00000436103:V349A|.	ENSP00000353058:V349A|.	V|W	+|+	2|1	0|0	ZNF517|ZNF517	146004151|146004151	0.001000|0.001000	0.12720|0.12720	0.002000|0.002000	0.10522|0.10522	0.004000|0.004000	0.04260|0.04260	-0.400000|-0.400000	0.07241|0.07241	-0.612000|-0.612000	0.05701|0.05701	-1.157000|-1.157000	0.01802|0.01802	GTG|TGG	G|0.992;C|0.006		0.746	ZNF517-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382642.1	XM_291261	
ERMP1	79956	hgsc.bcm.edu	37	9	5832928	5832928	+	Missense_Mutation	SNP	G	G	C	rs13283149	byFrequency	TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr9:5832928G>C	ENST00000339450.5	-	1	189	c.100C>G	c.(100-102)Cga>Gga	p.R34G	ERMP1_ENST00000381506.3_5'Flank|ERMP1_ENST00000214893.5_5'Flank	NM_024896.2	NP_079172.2	Q7Z2K6	ERMP1_HUMAN	endoplasmic reticulum metallopeptidase 1	34						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			endometrium(2)|kidney(1)|large_intestine(9)|lung(4)|ovary(1)|prostate(2)|skin(1)	20		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00115)|Lung(218;0.111)		TCCTGCGCTCGGGCCTCCCTC	0.761													G|||	55	0.0109824	0.0	0.0086	5008	,	,		10754	0.0		0.0159	False		,,,				2504	0.0337				p.R34G		.											.	ERMP1-69	0			c.C100G						.	G	GLY/ARG	10,3136		0,10,1563	4.0	5.0	4.0		100	-1.2	0.1	9	dbSNP_121	4	98,7004		0,98,3453	no	missense	ERMP1	NM_024896.2	125	0,108,5016	CC,CG,GG		1.3799,0.3179,1.0539	benign	34/905	5832928	108,10140	1573	3551	5124	SO:0001583	missense	79956	exon1			GCGCTCGGGCCTC	AB058718	CCDS34983.1	9p24	2008-02-05	2007-07-05	2007-07-05	ENSG00000099219	ENSG00000099219			23703	protein-coding gene	gene with protein product	"""Felix-ina"""	611156	"""KIAA1815"""	KIAA1815		11347906	Standard	XM_005251587		Approved	FLJ23309, FXNA	uc003zjm.1	Q7Z2K6	OTTHUMG00000019508	ENST00000339450.5:c.100C>G	9.37:g.5832928G>C	ENSP00000340427:p.Arg34Gly	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_024896	0	0	0	0	0	B2RNA4|B3KSB1|Q8N5T5|Q9H5M1	Missense_Mutation	SNP	ENST00000339450.5	37	CCDS34983.1	27	0.012362637362637362	7	0.014227642276422764	7	0.019337016574585635	0	0.0	13	0.017150395778364115	G	2.887	-0.230467	0.05983	0.003179	0.013799	ENSG00000099219	ENST00000339450	T	0.42513	0.97	3.94	-1.25	0.09405	.	2.895070	0.01605	N	0.022244	T	0.11281	0.0275	N	0.08118	0	0.20196	N	0.999921	B;B	0.09022	0.002;0.002	B;B	0.08055	0.003;0.002	T	0.08764	-1.0706	10	0.23302	T	0.38	3.6025	4.9111	0.13821	0.361:0.1662:0.4729:0.0	rs13283149	34;34	E7ER77;Q7Z2K6	.;ERMP1_HUMAN	G	34	ENSP00000340427:R34G	ENSP00000340427:R34G	R	-	1	2	ERMP1	5822928	0.011000	0.17503	0.145000	0.22337	0.021000	0.10359	0.179000	0.16840	-0.098000	0.12285	0.313000	0.20887	CGA	G|0.987;C|0.013		0.761	ERMP1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354877.1	NM_024896	
GADD45G	10912	hgsc.bcm.edu;bcgsc.ca	37	9	92220669	92220669	+	Frame_Shift_Del	DEL	C	C	-			TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr9:92220669delC	ENST00000252506.6	+	3	352	c.243delC	c.(241-243)atcfs	p.I81fs	GADD45G_ENST00000375769.1_Frame_Shift_Del_p.I63fs|GADD45G_ENST00000494726.1_Intron	NM_006705.3	NP_006696.1	O95257	GA45G_HUMAN	growth arrest and DNA-damage-inducible, gamma	81	Homodimerization.				activation of MAPKK activity (GO:0000186)|activation of MAPKKK activity (GO:0000185)|apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|negative regulation of protein kinase activity (GO:0006469)|positive regulation of apoptotic process (GO:0043065)|positive regulation of JNK cascade (GO:0046330)|positive regulation of p38MAPK cascade (GO:1900745)|regulation of cell cycle (GO:0051726)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				lung(2)	2						TTACGCTGATCCAGGCTTTCT	0.657																																					p.I81fs	Colon(131;320 2336 18973 23919)	.											.	GADD45G-514	0			c.243delC						.						76.0	59.0	65.0					9																	92220669		2203	4300	6503	SO:0001589	frameshift_variant	10912	exon3			GCTGATCCAGGCT	D83023	CCDS6686.1	9q22.1-q22.2	2008-07-21			ENSG00000130222	ENSG00000130222			4097	protein-coding gene	gene with protein product	"""gadd-related protein, 17 kD"", ""growth arrest and DNA-damage-inducible gamma"""	604949				9827804, 10496071	Standard	NM_006705		Approved	DDIT2, GADD45gamma, GRP17, CR6	uc004aqq.3	O95257	OTTHUMG00000020187	ENST00000252506.6:c.243delC	9.37:g.92220669delC	ENSP00000252506:p.Ile81fs	Somatic	105	2		WXS	Illumina GAIIx	Phase_I	143	89	NM_006705	0	0	0	0	0	Q5VZ87|Q9C076	Frame_Shift_Del	DEL	ENST00000252506.6	37	CCDS6686.1																																																																																			.		0.657	GADD45G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053000.1	NM_006705	
PPAPDC3	84814	ucsc.edu;bcgsc.ca	37	9	134183503	134183503	+	Silent	SNP	T	T	C	rs2986606	byFrequency	TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr9:134183503T>C	ENST00000372264.3	+	2	949	c.645T>C	c.(643-645)cgT>cgC	p.R215R		NM_032728.3	NP_116117.3	Q8NBV4	PPAC3_HUMAN	phosphatidic acid phosphatase type 2 domain containing 3	215					negative regulation of myotube differentiation (GO:0010832)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)	hydrolase activity (GO:0016787)			breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(9)|skin(1)	16	all_hematologic(7;0.0119)			OV - Ovarian serous cystadenocarcinoma(145;1.22e-05)|Epithelial(140;0.000173)		TGCCCCTGCGTGTGCTGCTGG	0.682													C|||	3182	0.635383	0.4448	0.6513	5008	,	,		15596	0.7312		0.7416	False		,,,				2504	0.6738				p.R215R		.											.	PPAPDC3-153	0			c.T645C						.	C		2204,2200	588.0+/-386.8	560,1084,558	71.0	62.0	65.0		645	-6.4	0.1	9	dbSNP_101	65	6479,2117	361.5+/-332.4	2457,1565,276	no	coding-synonymous	PPAPDC3	NM_032728.3		3017,2649,834	CC,CT,TT		24.6277,49.9546,33.2077		215/272	134183503	8683,4317	2202	4298	6500	SO:0001819	synonymous_variant	84814	exon2			CCTGCGTGTGCTG	AK027568	CCDS6942.1	9q34.2-q34.3	2008-02-26	2005-07-15	2005-07-15	ENSG00000160539	ENSG00000160539			28174	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 67"""	C9orf67		12958361	Standard	NM_032728		Approved	MGC12921, FLJ14662, NET39	uc004cal.2	Q8NBV4	OTTHUMG00000020822	ENST00000372264.3:c.645T>C	9.37:g.134183503T>C		Somatic	15	1		WXS	Illumina GAIIx	Phase_I	77	69	NM_032728	0	0	0	1	1	Q5T6P0|Q96SS7|Q9BRC3	Silent	SNP	ENST00000372264.3	37	CCDS6942.1																																																																																			T|0.343;C|0.657		0.682	PPAPDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054724.1	NM_032728	
USP26	83844	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	132159761	132159761	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chrX:132159761C>G	ENST00000511190.1	-	6	2957	c.2488G>C	c.(2488-2490)Gtc>Ctc	p.V830L	USP26_ENST00000370832.1_Missense_Mutation_p.V830L|USP26_ENST00000406273.1_Missense_Mutation_p.V830L	NM_031907.1	NP_114113.1	Q9BXU7	UBP26_HUMAN	ubiquitin specific peptidase 26	830	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(11)|liver(2)|lung(18)|ovary(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(3)	60	Acute lymphoblastic leukemia(192;0.000127)					AGATGGCTGACAACACTAATG	0.383																																					p.V830L	NSCLC(104;342 1621 36940 47097 52632)	.											.	USP26-661	0			c.G2488C						.						161.0	144.0	150.0					X																	132159761		2203	4300	6503	SO:0001583	missense	83844	exon1			GGCTGACAACACT	AF285593	CCDS14635.1	Xq26.2	2012-07-13	2005-08-08		ENSG00000134588	ENSG00000134588	3.4.19.12	"""Ubiquitin-specific peptidases"""	13485	protein-coding gene	gene with protein product		300309	"""ubiquitin specific protease 26"""			12838346	Standard	NM_031907		Approved		uc011mvf.2	Q9BXU7	OTTHUMG00000022429	ENST00000511190.1:c.2488G>C	X.37:g.132159761C>G	ENSP00000423390:p.Val830Leu	Somatic	46	0		WXS	Illumina GAIIx	Phase_I	34	33	NM_031907	0	0	0	0	0	B9WRT6|Q5H9H4	Missense_Mutation	SNP	ENST00000511190.1	37	CCDS14635.1	.	.	.	.	.	.	.	.	.	.	C	16.12	3.031956	0.54790	.	.	ENSG00000134588	ENST00000370832;ENST00000511190;ENST00000406273	T;T;T	0.76578	-1.03;-1.03;-1.03	3.91	-7.81	0.01210	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2, conserved site (1);Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.905234	0.09000	N	0.863172	T	0.73976	0.3656	M	0.72894	2.215	0.18873	N	0.999987	P	0.50156	0.932	P	0.48982	0.597	T	0.68051	-0.5511	10	0.54805	T	0.06	-0.4759	4.3268	0.11045	0.1044:0.2093:0.1029:0.5833	.	830	Q9BXU7	UBP26_HUMAN	L	830	ENSP00000359869:V830L;ENSP00000423390:V830L;ENSP00000384360:V830L	ENSP00000359869:V830L	V	-	1	0	USP26	131987427	0.519000	0.26242	0.008000	0.14137	0.462000	0.32619	0.092000	0.15066	-2.354000	0.00614	0.513000	0.50165	GTC	.		0.383	USP26-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359441.1	NM_031907	
Unknown	0	bcgsc.ca	37	Y	21154569	21154569	+	IGR	SNP	A	A	G	rs17855271		TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chrY:21154569A>G								TTTY14 (114455 upstream) : RNU6-255P (26299 downstream)																							GCCCCAGCCCAAGCCTGGCCA	0.612																																					p.L9L		.											.	.	0			c.T27C						.																																			SO:0001628	intergenic_variant	100133941	exon1			CAGCCCAAGCCTG																													Y.37:g.21154569A>G		Somatic	53	1		WXS	Illumina GAIIx	Phase_I	38	15	NM_013230	0	0	0	0	0		Silent	SNP		37																																																																																				.	0	0.612								
TTTY14	83869	bcgsc.ca;mdanderson.org	37	Y	21154603	21154603	+	IGR	SNP	A	A	C	rs79788321		TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chrY:21154603A>C								TTTY14 (114489 upstream) : RNU6-255P (26265 downstream)																							CATGTCCCCTACGTCGGTGCG	0.662																																					.		.											.	.	0			.						.																																			SO:0001628	intergenic_variant	100133941	.			TCCCCTACGTCGG																													Y.37:g.21154603A>C		Somatic	33	1		WXS	Illumina GAIIx	Phase_I	49	27	.	0	0	0	0	0		RNA	SNP		37																																																																																				.	0	0.662								
PAQR4	124222	broad.mit.edu	37	16	3019781	3019782	+	Frame_Shift_Ins	INS	-	-	C	rs144682481		TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr16:3019781_3019782insC	ENST00000318782.8	+	1	536_537	c.106_107insC	c.(106-108)tcgfs	p.S36fs	PAQR4_ENST00000572687.1_Frame_Shift_Ins_p.S36fs|PKMYT1_ENST00000571102.1_Intron|PKMYT1_ENST00000431515.2_Intron|PAQR4_ENST00000576565.1_Intron|PAQR4_ENST00000574988.1_5'Flank|PAQR4_ENST00000293978.8_Frame_Shift_Ins_p.S36fs	NM_001284513.1|NM_152341.3	NP_001271442.1|NP_689554.2	Q8N4S7	PAQR4_HUMAN	progestin and adipoQ receptor family member IV	36						integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	8						CAGCAGCGGCTCGGGCTGCCTG	0.698																																					p.S36fs		.											.	PAQR4-68	0			c.106_107insC						.																																			SO:0001589	frameshift_variant	124222	exon1			AGCGGCTCGGGCT		CCDS10485.1, CCDS66911.1, CCDS66912.1, CCDS73814.1	16p13	2008-05-02			ENSG00000162073	ENSG00000162073			26386	protein-coding gene	gene with protein product		614578				12477932	Standard	XM_005255112		Approved	FLJ30002	uc002csj.4	Q8N4S7	OTTHUMG00000128977	ENST00000318782.8:c.107dupC	16.37:g.3019782_3019782dupC	ENSP00000321804:p.Ser36fs	Somatic	42	0		WXS	Illumina GAIIx	Phase_I	258	9	NM_152341	0	0	0	0	0	A8K5Q8|D3DUA2|D3DUA3|Q8NAS6|Q96NW1	Frame_Shift_Ins	INS	ENST00000318782.8	37	CCDS10485.1																																																																																			.		0.698	PAQR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250966.1	NM_152341	
NEFH	4744	broad.mit.edu	37	22	29885622	29885623	+	In_Frame_Ins	INS	-	-	AGGAAG	rs267607534|rs267607535		TCGA-OR-A5K1-01A-11D-A29I-10	TCGA-OR-A5K1-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	06ecca59-8149-4951-a159-c0a2f7a82b3b	e201d5c0-195f-4c38-8093-ec220ce49d0b	g.chr22:29885622_29885623insAGGAAG	ENST00000310624.6	+	4	2026_2027	c.1993_1994insAGGAAG	c.(1993-1995)aag>aAGGAAGag	p.665_666insEE		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	671	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						GTCCCCTGAGAAGGCCAAGTCC	0.579																																					p.K665delinsKEE		.											.	NEFH-90	0			c.1993_1994insAGGAAG						.																																			SO:0001652	inframe_insertion	4744	exon4			CCTGAGAAGGCCA		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	Exception_encountered	22.37:g.29885622_29885623insAGGAAG	ENSP00000311997:p.Lys665_Ala666insGluGlu	Somatic	326	0		WXS	Illumina GAIIx	Phase_I	291	7	NM_021076	0	0	0	0	0	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	In_Frame_Ins	INS	ENST00000310624.6	37	CCDS13858.1																																																																																			.		0.579	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
