#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CCDC27	148870	hgsc.bcm.edu	37	1	3683112	3683112	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr1:3683112G>T	ENST00000294600.2	+	9	1550	c.1466G>T	c.(1465-1467)cGa>cTa	p.R489L		NM_152492.2	NP_689705.2	Q2M243	CCD27_HUMAN	coiled-coil domain containing 27	489										breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(2)|lung(17)|prostate(1)|skin(2)|urinary_tract(2)	36	all_cancers(77;0.0385)|Ovarian(185;0.0634)|Lung NSC(156;0.21)|all_lung(157;0.218)	all_epithelial(116;5.52e-17)|all_lung(118;1.04e-06)|Lung NSC(185;0.000214)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Lung SC(97;0.0367)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.127)		Epithelial(90;1.11e-38)|OV - Ovarian serous cystadenocarcinoma(86;1.35e-22)|GBM - Glioblastoma multiforme(42;3.46e-16)|Colorectal(212;1.17e-05)|COAD - Colon adenocarcinoma(227;5.76e-05)|Kidney(185;0.00036)|BRCA - Breast invasive adenocarcinoma(365;0.000696)|KIRC - Kidney renal clear cell carcinoma(229;0.00558)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.203)		TCCAACCTCCGAGAAGATAAG	0.502																																					p.R489L		.											.	CCDC27-91	0			c.G1466T						.						70.0	68.0	69.0					1																	3683112		2202	4300	6502	SO:0001583	missense	148870	exon9			ACCTCCGAGAAGA		CCDS50.1	1p36.32	2008-02-05			ENSG00000162592	ENSG00000162592			26546	protein-coding gene	gene with protein product							Standard	NM_152492		Approved	FLJ32825	uc001akv.2	Q2M243	OTTHUMG00000003504	ENST00000294600.2:c.1466G>T	1.37:g.3683112G>T	ENSP00000294600:p.Arg489Leu	Somatic	87	0		WXS	Illumina GAIIx	Phase_I	60	4	NM_152492	0	0	0	0	0	Q5TBV3|Q96M50	Missense_Mutation	SNP	ENST00000294600.2	37	CCDS50.1	.	.	.	.	.	.	.	.	.	.	G	17.29	3.352580	0.61293	.	.	ENSG00000162592	ENST00000294600	T	0.32753	1.44	5.09	5.09	0.68999	.	0.000000	0.51477	D	0.000093	T	0.45155	0.1328	L	0.36672	1.1	0.43924	D	0.996572	D	0.89917	1.0	D	0.87578	0.998	T	0.34950	-0.9808	10	0.52906	T	0.07	-24.5281	13.9664	0.64211	0.0:0.0:1.0:0.0	.	489	Q2M243	CCD27_HUMAN	L	489	ENSP00000294600:R489L	ENSP00000294600:R489L	R	+	2	0	CCDC27	3672972	1.000000	0.71417	0.918000	0.36340	0.585000	0.36419	4.987000	0.63857	2.341000	0.79615	0.591000	0.81541	CGA	.		0.502	CCDC27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009740.1	NM_152492	
HNRNPCL1	343069	hgsc.bcm.edu;bcgsc.ca	37	1	12907358	12907358	+	Missense_Mutation	SNP	T	T	C	rs74587302|rs559905244	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr1:12907358T>C	ENST00000317869.6	-	2	1010	c.785A>G	c.(784-786)cAg>cGg	p.Q262R		NM_001013631.1|NM_001136561.2|NM_001146181.1	NP_001013653.1|NP_001130033.2|NP_001139653.1	O60812	HNRC1_HUMAN	heterogeneous nuclear ribonucleoprotein C-like 1	262						nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|stomach(2)	29						GTCATCCCCCTGATCTTCATT	0.498																																					p.Q262R		.											.	HNRNPCL1-68	0			c.A785G						.						143.0	157.0	152.0					1																	12907358		2203	4300	6503	SO:0001583	missense	343069	exon2			TCCCCCTGATCTT	BC002696	CCDS30591.1	1p36.21	2013-02-12		2008-04-18	ENSG00000179172	ENSG00000179172		"""RNA binding motif (RRM) containing"""	29295	protein-coding gene	gene with protein product				HNRPCL1			Standard	NM_001013631		Approved			O60812	OTTHUMG00000001931	ENST00000317869.6:c.785A>G	1.37:g.12907358T>C	ENSP00000365370:p.Gln262Arg	Somatic	77	1		WXS	Illumina GAIIx	Phase_I	119	9	NM_001013631	0	0	0	0	0	B2RP44	Missense_Mutation	SNP	ENST00000317869.6	37	CCDS30591.1	.	.	.	.	.	.	.	.	.	.	.	0.006	-2.089806	0.00367	.	.	ENSG00000179172	ENST00000317869	T	0.09445	2.98	0.343	-0.686	0.11324	.	2.239460	0.02976	N	0.145045	T	0.04724	0.0128	N	0.02830	-0.485	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.33650	-0.9860	10	0.33940	T	0.23	.	3.9448	0.09344	0.0:0.3889:0.0:0.6111	.	262	O60812	HNRCL_HUMAN	R	262	ENSP00000365370:Q262R	ENSP00000365370:Q262R	Q	-	2	0	HNRNPCL1	12829945	0.213000	0.23551	0.005000	0.12908	0.003000	0.03518	0.096000	0.15147	-0.605000	0.05753	-0.620000	0.04034	CAG	.		0.498	HNRNPCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005462.1	NM_001013631	
OPRD1	4985	hgsc.bcm.edu	37	1	29138975	29138975	+	Missense_Mutation	SNP	G	G	T	rs1042114	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr1:29138975G>T	ENST00000234961.2	+	1	322	c.80G>T	c.(79-81)tGc>tTc	p.C27F		NM_000911.3	NP_000902.3	P41143	OPRD_HUMAN	opioid receptor, delta 1	27			C -> F (improved maturation and increased expression at the cell surface; dbSNP:rs1042114). {ECO:0000269|PubMed:10982041, ECO:0000269|PubMed:8201839, ECO:0000269|Ref.4}.		adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adult locomotory behavior (GO:0008344)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|cellular response to toxic substance (GO:0097237)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|immune response (GO:0006955)|negative regulation of gene expression (GO:0010629)|negative regulation of protein oligomerization (GO:0032460)|neuropeptide signaling pathway (GO:0007218)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein import into nucleus, translocation (GO:0000060)|regulation of calcium ion transport (GO:0051924)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of sensory perception of pain (GO:0051930)	axon terminus (GO:0043679)|cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	enkephalin receptor activity (GO:0038046)|opioid receptor activity (GO:0004985)			breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15		Colorectal(325;3.46e-05)|Lung NSC(340;0.000947)|all_lung(284;0.00131)|Renal(390;0.00758)|Breast(348;0.00765)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;1.29e-07)|COAD - Colon adenocarcinoma(152;7.51e-06)|STAD - Stomach adenocarcinoma(196;0.00306)|BRCA - Breast invasive adenocarcinoma(304;0.0241)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)	Alvimopan(DB06274)|Amitriptyline(DB00321)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diphenoxylate(DB01081)|Fentanyl(DB00813)|Heroin(DB01452)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levorphanol(DB00854)|Loperamide(DB00836)|Methadone(DB00333)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	CCTAGCGCCTGCCCCAGCGCT	0.771													T|||	4730	0.944489	0.9796	0.9193	5008	,	,		9147	1.0		0.8678	False		,,,				2504	0.9366				p.C27F		.											.	OPRD1-69	0			c.G80T						.	T	PHE/CYS	3689,115		1788,113,1	4.0	6.0	5.0	http://www.ncbi.nlm.nih.gov/omim/103780,165195|http://omim.org/entry/165195|http://omim.org/entry/103780	80	2.9	1.0	1	dbSNP_86	5	6762,846		2982,798,24	no	missense	OPRD1	NM_000911.3	205	4770,911,25	TT,TG,GG		11.1199,3.0231,8.421	benign	27/373	29138975	10451,961	1902	3804	5706	SO:0001583	missense	4985	exon1			GCGCCTGCCCCAG	U10504	CCDS329.1	1p36.1-p34.3	2012-08-08			ENSG00000116329	ENSG00000116329		"""GPCR / Class A : Opioid receptors"""	8153	protein-coding gene	gene with protein product		165195				8415697	Standard	NM_000911		Approved		uc001brf.1	P41143	OTTHUMG00000003646	ENST00000234961.2:c.80G>T	1.37:g.29138975G>T	ENSP00000234961:p.Cys27Phe	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	4	NM_000911	0	0	0	0	0	B5B0B8	Missense_Mutation	SNP	ENST00000234961.2	37	CCDS329.1	2035	0.9317765567765568	474	0.9634146341463414	331	0.914364640883978	572	1.0	658	0.8680738786279684	T	0.016	-1.513433	0.00975	0.969769	0.888801	ENSG00000116329	ENST00000234961;ENST00000536280	T	0.67698	-0.28	4.0	2.89	0.33648	.	1.802200	0.02327	N	0.073605	T	0.00012	0.0000	N	0.01874	-0.695	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.41342	-0.9514	9	0.09338	T	0.73	.	3.8109	0.08796	0.0:0.1144:0.2238:0.6618	rs1042114;rs59349662;rs1042114	27	P41143	OPRD_HUMAN	F	27	ENSP00000234961:C27F	ENSP00000234961:C27F	C	+	2	0	OPRD1	29011562	0.002000	0.14202	0.992000	0.48379	0.116000	0.19942	0.521000	0.22893	0.713000	0.32060	-0.694000	0.03704	TGC	G|0.061;T|0.939		0.771	OPRD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010330.1	NM_000911	
DLGAP3	58512	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	35365799	35365799	+	Missense_Mutation	SNP	C	C	T	rs140339373		TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr1:35365799C>T	ENST00000373347.1	-	4	1451	c.1183G>A	c.(1183-1185)Ggc>Agc	p.G395S	DLGAP3_ENST00000235180.4_Missense_Mutation_p.G395S			O95886	DLGP3_HUMAN	discs, large (Drosophila) homolog-associated protein 3	395					cell-cell signaling (GO:0007267)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)	beta-amyloid binding (GO:0001540)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(23)|ovary(4)|prostate(3)|skin(3)|urinary_tract(1)	46		Myeloproliferative disorder(586;0.0393)				ATGTAGCTGCCGCTCCGCATC	0.642													C|||	1	0.000199681	0.0	0.0	5008	,	,		17563	0.001		0.0	False		,,,				2504	0.0				p.G395S		.											.	DLGAP3-71	0			c.G1183A						.						100.0	99.0	99.0					1																	35365799		2203	4300	6503	SO:0001583	missense	58512	exon2			AGCTGCCGCTCCG	AF131778	CCDS30670.1	1p35.3-p34.1	2008-02-05			ENSG00000116544	ENSG00000116544			30368	protein-coding gene	gene with protein product		611413				8619474, 9110174	Standard	NM_001080418		Approved	SAPAP3, DAP3	uc001byc.3	O95886	OTTHUMG00000004049	ENST00000373347.1:c.1183G>A	1.37:g.35365799C>T	ENSP00000362444:p.Gly395Ser	Somatic	98	0		WXS	Illumina GAIIx	Phase_I	147	49	NM_001080418	0	0	1	4	3	Q5TDD5|Q9H3X7	Missense_Mutation	SNP	ENST00000373347.1	37	CCDS30670.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	32	5.112117	0.94339	.	.	ENSG00000116544	ENST00000373347;ENST00000235180;ENST00000542913	T;T	0.23348	1.91;1.91	4.44	4.44	0.53790	.	0.053869	0.85682	D	0.000000	T	0.45558	0.1348	L	0.50333	1.59	0.80722	D	1	D	0.89917	1.0	D	0.71656	0.974	T	0.44877	-0.9299	10	0.62326	D	0.03	-16.0822	17.2399	0.87010	0.0:1.0:0.0:0.0	.	395	O95886	DLGP3_HUMAN	S	395;395;78	ENSP00000362444:G395S;ENSP00000235180:G395S	ENSP00000235180:G395S	G	-	1	0	DLGAP3	35138386	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.584000	0.82572	2.296000	0.77279	0.313000	0.20887	GGC	C|0.999;T|0.000		0.642	DLGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011554.1	NM_021234	
THRAP3	9967	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	36767183	36767183	+	Silent	SNP	C	C	T			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr1:36767183C>T	ENST00000354618.5	+	11	2756	c.2532C>T	c.(2530-2532)ggC>ggT	p.G844G	THRAP3_ENST00000469141.2_Silent_p.G844G	NM_005119.3	NP_005110.2	Q9Y2W1	TR150_HUMAN	thyroid hormone receptor associated protein 3	844	Required for mRNA decay activity.				androgen receptor signaling pathway (GO:0030521)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|mRNA processing (GO:0006397)|mRNA stabilization (GO:0048255)|nuclear-transcribed mRNA catabolic process (GO:0000956)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|phosphoprotein binding (GO:0051219)|poly(A) RNA binding (GO:0044822)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(12)|ovary(5)|stomach(1)	37		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				GAGGCTGGGGCAGAGGCAACT	0.468			T	USP6	aneurysmal bone cysts																																p.G844G	Pancreas(129;785 1795 20938 23278 32581)	.		Dom	yes		1	1p34.3	9967	thyroid hormone receptor associated protein 3 (TRAP150)		M	.	THRAP3-663	0			c.C2532T						.						69.0	72.0	71.0					1																	36767183		2203	4300	6503	SO:0001819	synonymous_variant	9967	exon11			CTGGGGCAGAGGC	AF117756	CCDS405.1	1p34.3	2008-02-05			ENSG00000054118	ENSG00000054118			22964	protein-coding gene	gene with protein product		603809					Standard	NM_005119		Approved	TRAP150	uc001cae.4	Q9Y2W1	OTTHUMG00000007866	ENST00000354618.5:c.2532C>T	1.37:g.36767183C>T		Somatic	120	0		WXS	Illumina GAIIx	Phase_I	71	23	NM_005119	0	0	13	22	9	D3DPS5|Q5VTK6	Silent	SNP	ENST00000354618.5	37	CCDS405.1																																																																																			.		0.468	THRAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021688.2	NM_005119	
C1orf141	400757	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	67591497	67591497	+	Silent	SNP	G	G	C			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr1:67591497G>C	ENST00000371007.2	-	4	280	c.171C>G	c.(169-171)tcC>tcG	p.S57S	C1orf141_ENST00000371006.1_Silent_p.S57S|C1orf141_ENST00000544837.1_Silent_p.S57S	NM_001276351.1	NP_001263280.1	Q5JVX7	CA141_HUMAN	chromosome 1 open reading frame 141	57										NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(8)|ovary(1)|skin(1)	18						CCTTAGACGCGGATGTAGCAA	0.358																																					p.S57S		.											.	C1orf141-91	0			c.C171G						.						221.0	210.0	213.0					1																	67591497		2203	4300	6503	SO:0001819	synonymous_variant	400757	exon4			AGACGCGGATGTA	BC090886	CCDS30745.1, CCDS72804.1	1p31.2	2012-07-23			ENSG00000203963	ENSG00000203963			32044	protein-coding gene	gene with protein product							Standard	NM_001276351		Approved		uc001ddm.2	Q5JVX7	OTTHUMG00000009406	ENST00000371007.2:c.171C>G	1.37:g.67591497G>C		Somatic	74	0		WXS	Illumina GAIIx	Phase_I	83	19	NM_001276352	0	0	0	0	0	Q0P5P5|Q5JVX5	Silent	SNP	ENST00000371007.2	37	CCDS30745.1																																																																																			.		0.358	C1orf141-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026096.2	NM_001013674	
CDC7	8317	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	91979529	91979529	+	Missense_Mutation	SNP	C	C	A	rs371099029		TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr1:91979529C>A	ENST00000428239.1	+	8	1106	c.847C>A	c.(847-849)Cag>Aag	p.Q283K	CDC7_ENST00000430031.2_Missense_Mutation_p.Q255K|CDC7_ENST00000234626.6_Missense_Mutation_p.Q283K	NM_001134420.1	NP_001127892.1	O00311	CDC7_HUMAN	cell division cycle 7	283	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle phase transition (GO:0044770)|cell division (GO:0051301)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|positive regulation of cell proliferation (GO:0008284)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|stomach(2)	23		all_lung(203;0.0165)|Lung NSC(277;0.0562)		all cancers(265;0.00108)|Epithelial(280;0.0184)|KIRC - Kidney renal clear cell carcinoma(1967;0.124)		CCTTTCTGTCCAGCGCTCTGT	0.393																																					p.Q283K		.											.	CDC7-1125	0			c.C847A						.						135.0	130.0	132.0					1																	91979529		2203	4300	6503	SO:0001583	missense	8317	exon8			TCTGTCCAGCGCT	AF015592	CCDS734.1	1p22	2013-01-17	2013-01-17	2003-07-23	ENSG00000097046	ENSG00000097046			1745	protein-coding gene	gene with protein product		603311	"""CDC7 (cell division cycle 7, S. cerevisiae, homolog)-like 1"", ""CDC7 cell division cycle 7 (S. cerevisiae)"", ""cell division cycle 7 (S. cerevisiae)"", ""cell division cycle 7 homolog (S. cerevisiae)"""	CDC7L1		9405610, 9250678	Standard	NM_003503		Approved	Hsk1, huCdc7, HsCdc7	uc001dof.3	O00311	OTTHUMG00000047810	ENST00000428239.1:c.847C>A	1.37:g.91979529C>A	ENSP00000393139:p.Gln283Lys	Somatic	56	0		WXS	Illumina GAIIx	Phase_I	67	30	NM_003503	0	0	1	1	0	D3DT31|O00558|Q5T5U5	Missense_Mutation	SNP	ENST00000428239.1	37	CCDS734.1	.	.	.	.	.	.	.	.	.	.	C	14.58	2.577310	0.45902	.	.	ENSG00000097046	ENST00000430031;ENST00000234626;ENST00000428239	T;T;T	0.47528	0.84;0.99;0.99	5.91	5.91	0.95273	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.114318	0.64402	D	0.000013	T	0.31451	0.0797	N	0.17838	0.53	0.50467	D	0.999872	P;D	0.54772	0.932;0.968	P;P	0.50970	0.573;0.655	T	0.03898	-1.0994	10	0.10902	T	0.67	-7.2494	20.2956	0.98549	0.0:1.0:0.0:0.0	.	255;283	B7Z5H7;O00311	.;CDC7_HUMAN	K	255;283;283	ENSP00000407477:Q255K;ENSP00000234626:Q283K;ENSP00000393139:Q283K	ENSP00000234626:Q283K	Q	+	1	0	CDC7	91752117	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.677000	0.68142	2.805000	0.96524	0.460000	0.39030	CAG	.		0.393	CDC7-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027928.1	NM_003503	
NOTCH2	4853	hgsc.bcm.edu	37	1	120612006	120612006	+	Silent	SNP	G	G	A	rs4021006	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr1:120612006G>A	ENST00000256646.2	-	1	234	c.15C>T	c.(13-15)cgC>cgT	p.R5R		NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	5					apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)			breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		GCAGAGCGGGGCGCAGGGCGG	0.761			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome				g|||	1973	0.39397	0.2632	0.4049	5008	,	,		21911	0.4315		0.4423	False		,,,				2504	0.4744				p.R5R		.		Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	.	NOTCH2-1441	0			c.C15T						.						6.0	8.0	8.0					1																	120612006		1838	3882	5720	SO:0001819	synonymous_variant	4853	exon1	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	AGCGGGGCGCAGG	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.15C>T	1.37:g.120612006G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_024408	0	0	2	2	0	Q5T3X7|Q99734|Q9H240	Silent	SNP	ENST00000256646.2	37	CCDS908.1	.	.	.	.	.	.	.	.	.	.	G	9.758	1.169358	0.21621	.	.	ENSG00000134250	ENST00000538680	.	.	.	2.9	1.95	0.26073	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.0819	0.14661	0.1818:0.0:0.8182:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NOTCH2	120413529	0.988000	0.35896	0.959000	0.39883	0.588000	0.36517	1.074000	0.30703	0.543000	0.28864	0.184000	0.17185	.	G|0.500;A|0.500		0.761	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033679.1	NM_024408	
NBPF9	400818	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	144821919	144821919	+	Splice_Site	SNP	A	A	G			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr1:144821919A>G	ENST00000468645.1	+	7	859		c.e7-1		NBPF9_ENST00000338347.4_Splice_Site|NBPF9_ENST00000281815.8_Splice_Site|NBPF9_ENST00000440491.2_Splice_Site			Q3BBW0	NBPF9_HUMAN	neuroblastoma breakpoint family, member 9							cytoplasm (GO:0005737)				NS(2)|prostate(1)	3						CTGGCTCATCAGGAATCTGCA	0.488																																					.		.											.	.	0			c.1636-2A>G						.																																			SO:0001630	splice_region_variant	400818	exon13			CTCATCAGGAATC		CCDS72895.1, CCDS72896.1	1q21.1	2013-01-17			ENSG00000168614	ENSG00000269713		"""neuroblastoma breakpoint family"""	31991	protein-coding gene	gene with protein product		613999				16079250	Standard	NM_001037675		Approved	AE01		Q3BBW0	OTTHUMG00000013845	ENST00000468645.1:c.860-1A>G	1.37:g.144821919A>G		Somatic	158	0		WXS	Illumina GAIIx	Phase_I	135	42	NM_001037675	0	0	0	0	0		Splice_Site	SNP	ENST00000468645.1	37		.	.	.	.	.	.	.	.	.	.	.	4.827	0.153714	0.09185	.	.	ENSG00000168614	ENST00000338347;ENST00000440491;ENST00000375552	.	.	.	0.714	-0.624	0.11552	.	.	.	.	.	.	.	.	.	.	.	0.20307	N	0.999919	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	-1	.	.	.	+	.	.	NBPF9	143533276	0.000000	0.05858	0.001000	0.08648	0.384000	0.30261	-0.708000	0.05035	-0.238000	0.09724	0.156000	0.16432	.	.		0.488	NBPF9-002	KNOWN	not_best_in_genome_evidence|basic	processed_transcript	protein_coding	OTTHUMT00000038846.1	NM_001037675	Intron
NBPF10	100132406	hgsc.bcm.edu	37	1	145299738	145299738	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr1:145299738C>T	ENST00000342960.5	+	6	822	c.787C>T	c.(787-789)Ccc>Tcc	p.P263S	NBPF10_ENST00000369339.3_Intron|NBPF10_ENST00000369338.1_5'UTR|RP11-458D21.5_ENST00000468030.1_3'UTR	NM_001039703.4	NP_001034792.4	Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	263						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		AGTCCCTGGCCCCACCTCTTC	0.493																																					p.P263S		.											.	.	0			c.C787T						.																																			SO:0001583	missense	100132406	exon6			CCTGGCCCCACCT	BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000342960.5:c.787C>T	1.37:g.145299738C>T	ENSP00000345684:p.Pro263Ser	Somatic	68	0		WXS	Illumina GAIIx	Phase_I	78	4	NM_001039703	0	0	0	0	0	Q5RHC0|Q9NWN6	Missense_Mutation	SNP	ENST00000342960.5	37	CCDS53355.1	.	.	.	.	.	.	.	.	.	.	.	0.016	-1.523508	0.00959	.	.	ENSG00000163386	ENST00000448873;ENST00000342960	T	0.03242	4.0	0.63	-1.26	0.09376	.	.	.	.	.	T	0.00384	0.0012	N	0.03115	-0.41	0.09310	N	1	.	.	.	.	.	.	T	0.43893	-0.9363	6	0.26408	T	0.33	.	.	.	.	.	.	.	.	S	188;263	ENSP00000345684:P263S	ENSP00000345684:P263S	P	+	1	0	NBPF10	144011095	0.003000	0.15002	0.000000	0.03702	0.001000	0.01503	-1.823000	0.01710	-1.742000	0.01342	-2.439000	0.00212	CCC	.		0.493	NBPF10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001039703	
NBPF14	25832	bcgsc.ca	37	1	148010972	148010972	+	Silent	SNP	A	A	G			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr1:148010972A>G	ENST00000369219.1	-	14	1666	c.1650T>C	c.(1648-1650)tgT>tgC	p.C550C				Q5TI25	NBPFE_HUMAN	neuroblastoma breakpoint family, member 14	550	NBPF 6. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)				NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(23)|ovary(2)|pancreas(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	42	all_hematologic(923;0.032)					TCAGTTCAAGACAACCTGAAG	0.488																																					p.C550C		.											.	NBPF14-91	0			c.T1650C						.						2.0	2.0	2.0					1																	148010972		557	1411	1968	SO:0001819	synonymous_variant	25832	exon14			TTCAAGACAACCT	AK092351		1q21.1	2013-01-17			ENSG00000122497			"""neuroblastoma breakpoint family"""	25232	protein-coding gene	gene with protein product		614003				8619474, 9110174, 16079250	Standard	NM_015383		Approved	DJ328E19.C1.1	uc021owp.2	Q5TI25	OTTHUMG00000013900	ENST00000369219.1:c.1650T>C	1.37:g.148010972A>G		Somatic	1081	61		WXS	Illumina GAIIx	Phase_I	1538	97	NM_015383	0	0	6	6	0	Q5TI23|Q8IX76|Q9UJI9	Silent	SNP	ENST00000369219.1	37		.	.	.	.	.	.	.	.	.	.	-	0.647	-0.811135	0.02798	.	.	ENSG00000122497	ENST00000310701	.	.	.	.	.	.	.	.	.	.	.	T	0.08714	0.0216	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	T	0.36480	-0.9746	2	.	.	.	.	.	.	.	.	.	.	.	A	556	.	.	V	-	2	0	NBPF14	146477596	0.960000	0.32886	0.003000	0.11579	0.003000	0.03518	-0.165000	0.09968	-0.568000	0.06038	-0.564000	0.04169	GTC	.		0.488	NBPF14-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_015383	
SPRR3	6707	broad.mit.edu	37	1	152975659	152975682	+	In_Frame_Del	DEL	GAGCCAGGCTGTACCAAGGTCCCT	GAGCCAGGCTGTACCAAGGTCCCT	-	rs568163793|rs553429466|rs74134624	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr1:152975659_152975682delGAGCCAGGCTGTACCAAGGTCCCT	ENST00000295367.4	+	2	205_228	c.163_186delGAGCCAGGCTGTACCAAGGTCCCT	c.(163-186)gagccaggctgtaccaaggtccctdel	p.EPGCTKVP95del	SPRR3_ENST00000542696.1_In_Frame_Del_p.EPGCTKVP87del|SPRR3_ENST00000331860.3_In_Frame_Del_p.EPGCTKVP95del	NM_001097589.1	NP_001091058.1	Q9UBC9	SPRR3_HUMAN	small proline-rich protein 3	95	14 X 8 AA approximate tandem repeats.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	structural molecule activity (GO:0005198)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	11	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			AAAGATTCCAGAGCCAGGCTGTACCAAGGTCCCTGAGCCAGGCT	0.562																																					p.55_62del		.											.	SPRR3-45	0			c.163_186del						.		,	2036,1952		740,556,698					,	-1.4	0.0		dbSNP_130	70	3135,4775		852,1431,1672	no	coding,coding	SPRR3	NM_005416.2,NM_001097589.1	,	1592,1987,2370	A1A1,A1R,RR		39.6334,48.9468,43.4611	,	,		5171,6727				SO:0001651	inframe_deletion	6707	exon2			ATTCCAGAGCCAG	AY118269	CCDS1033.1	1q21-q22	2008-02-05			ENSG00000163209	ENSG00000163209			11268	protein-coding gene	gene with protein product		182271				8325635	Standard	NM_005416		Approved		uc001faz.4	Q9UBC9	OTTHUMG00000013872	ENST00000295367.4:c.163_186delGAGCCAGGCTGTACCAAGGTCCCT	1.37:g.152975659_152975682delGAGCCAGGCTGTACCAAGGTCCCT	ENSP00000295367:p.Glu95_Pro102del	Somatic	139	0		WXS	Illumina GAIIx	Phase_I	203	70	NM_001097589	0	0	0	0	0	A5YKK8|B2R4G8|D3DV32|O75597|Q4ZGI7|Q5T525|Q8NET7|Q9UDG3	In_Frame_Del	DEL	ENST00000295367.4	37	CCDS1033.1																																																																																			.		0.562	SPRR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000038910.1	NM_005416	
ARHGEF2	9181	broad.mit.edu	37	1	155920822	155920822	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr1:155920822C>A	ENST00000361247.4	-	20	2600	c.2501G>T	c.(2500-2502)aGc>aTc	p.S834I	ARHGEF2_ENST00000313695.7_Missense_Mutation_p.S806I|ARHGEF2_ENST00000462460.2_Missense_Mutation_p.S879I|ARHGEF2_ENST00000313667.4_Missense_Mutation_p.S833I|ARHGEF2_ENST00000368316.1_Missense_Mutation_p.S806I|ARHGEF2_ENST00000368315.4_Missense_Mutation_p.S835I|ARHGEF2_ENST00000477754.2_Intron	NM_001162383.1|NM_001162384.1	NP_001155855.1|NP_001155856.1	Q92974	ARHG2_HUMAN	Rho/Rac guanine nucleotide exchange factor (GEF) 2	834					actin filament organization (GO:0007015)|apoptotic signaling pathway (GO:0097190)|cell morphogenesis (GO:0000902)|cellular hyperosmotic response (GO:0071474)|cellular response to muramyl dipeptide (GO:0071225)|cellular response to tumor necrosis factor (GO:0071356)|establishment of mitotic spindle orientation (GO:0000132)|innate immune response (GO:0045087)|intracellular protein transport (GO:0006886)|mitotic nuclear division (GO:0007067)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of intrinsic apoptotic signaling pathway in response to osmotic stress (GO:1902219)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of necroptotic process (GO:0060546)|negative regulation of neurogenesis (GO:0050768)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cell proliferation (GO:0042127)|regulation of Rho protein signal transduction (GO:0035023)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)|vesicle (GO:0031982)	microtubule binding (GO:0008017)|Rac GTPase binding (GO:0048365)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho GTPase binding (GO:0017048)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(4)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(6)|lung(15)|ovary(1)|skin(2)	40	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					GGCCTCCAGGCTGCCAGCTTC	0.697																																					p.S834I	Melanoma(178;35 2768 6610 28839)	.											.	ARHGEF2-228	0			c.G2501T						.						9.0	10.0	10.0					1																	155920822		2176	4255	6431	SO:0001583	missense	9181	exon20			TCCAGGCTGCCAG	AB014551	CCDS1125.1, CCDS53375.1, CCDS53376.1	1q21-q22	2013-01-10	2009-06-12		ENSG00000116584	ENSG00000116584		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	682	protein-coding gene	gene with protein product		607560	"""rho/rac guanine nucleotide exchange factor (GEF) 2"""			9857026, 9734811	Standard	NM_004723		Approved	LFP40, GEF-H1, KIAA0651, P40	uc001fmt.2	Q92974	OTTHUMG00000017464	ENST00000361247.4:c.2501G>T	1.37:g.155920822C>A	ENSP00000354837:p.Ser834Ile	Somatic	19	0		WXS	Illumina GAIIx	Phase_I	88	9	NM_001162383	0	0	1	1	0	D3DVA6|O75142|Q15079|Q5VY92|Q8TDA3|Q8WUG4|Q9H023	Missense_Mutation	SNP	ENST00000361247.4	37	CCDS53376.1	.	.	.	.	.	.	.	.	.	.	C	13.74	2.327982	0.41197	.	.	ENSG00000116584	ENST00000313695;ENST00000361247;ENST00000368315;ENST00000368316;ENST00000313667	T;T;T;T;T	0.21734	1.99;1.99;1.99;1.99;1.99	5.12	4.21	0.49690	.	0.241334	0.30410	N	0.009689	T	0.03348	0.0097	N	0.08118	0	0.26838	N	0.968441	B;B;B;B	0.18968	0.019;0.019;0.032;0.019	B;B;B;B	0.21360	0.015;0.015;0.034;0.025	T	0.30937	-0.9961	10	0.40728	T	0.16	-16.2426	6.4132	0.21702	0.1802:0.7287:0.0:0.0911	.	878;834;833;835	D3DVA5;Q92974;Q92974-2;Q5VY93	.;ARHG2_HUMAN;.;.	I	806;834;835;806;833	ENSP00000315325:S806I;ENSP00000354837:S834I;ENSP00000357298:S835I;ENSP00000357299:S806I;ENSP00000314787:S833I	ENSP00000314787:S833I	S	-	2	0	ARHGEF2	154187446	0.006000	0.16342	1.000000	0.80357	0.991000	0.79684	0.259000	0.18405	1.393000	0.46605	0.655000	0.94253	AGC	.		0.697	ARHGEF2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046204.2	NM_004723	
APOA2	336	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	161192812	161192812	+	Silent	SNP	C	C	T	rs557256114		TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr1:161192812C>T	ENST00000367990.3	-	3	138	c.81G>A	c.(79-81)gaG>gaA	p.E27E	APOA2_ENST00000463812.1_5'UTR|APOA2_ENST00000470459.2_Silent_p.E27E|APOA2_ENST00000464492.1_Silent_p.E60E|TOMM40L_ENST00000367988.3_5'Flank|APOA2_ENST00000491350.1_Intron|APOA2_ENST00000468465.1_Intron	NM_001643.1	NP_001634.1	P02652	APOA2_HUMAN	apolipoprotein A-II	27					acute inflammatory response (GO:0002526)|cellular lipid metabolic process (GO:0044255)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|diacylglycerol catabolic process (GO:0046340)|high-density lipoprotein particle assembly (GO:0034380)|high-density lipoprotein particle clearance (GO:0034384)|high-density lipoprotein particle remodeling (GO:0034375)|lipoprotein metabolic process (GO:0042157)|low-density lipoprotein particle remodeling (GO:0034374)|negative regulation of cholesterol import (GO:0060621)|negative regulation of cholesterol transport (GO:0032375)|negative regulation of cholesterol transporter activity (GO:0060695)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of lipase activity (GO:0060192)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of very-low-density lipoprotein particle remodeling (GO:0010903)|organ regeneration (GO:0031100)|peptidyl-methionine modification (GO:0018206)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid catabolic process (GO:0009395)|phospholipid efflux (GO:0033700)|phototransduction, visible light (GO:0007603)|positive regulation of catalytic activity (GO:0043085)|positive regulation of cholesterol esterification (GO:0010873)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of lipid catabolic process (GO:0050996)|protein folding (GO:0006457)|protein oxidation (GO:0018158)|regulation of intestinal cholesterol absorption (GO:0030300)|regulation of protein stability (GO:0031647)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to glucocorticoid (GO:0051384)|response to glucose (GO:0009749)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)|triglyceride-rich lipoprotein particle remodeling (GO:0034370)|viral process (GO:0016032)	blood microparticle (GO:0072562)|chylomicron (GO:0042627)|cytosol (GO:0005829)|early endosome (GO:0005769)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)|spherical high-density lipoprotein particle (GO:0034366)|very-low-density lipoprotein particle (GO:0034361)	apolipoprotein receptor binding (GO:0034190)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|high-density lipoprotein particle binding (GO:0008035)|high-density lipoprotein particle receptor binding (GO:0070653)|lipase inhibitor activity (GO:0055102)|lipid binding (GO:0008289)|lipid transporter activity (GO:0005319)|phosphatidylcholine binding (GO:0031210)|phosphatidylcholine-sterol O-acyltransferase activator activity (GO:0060228)|phospholipid binding (GO:0005543)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			endometrium(1)|large_intestine(1)|lung(2)|skin(2)	6	all_cancers(52;1.86e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00376)			CCACACATGGCTCCTTTGCCT	0.547													C|||	1	0.000199681	0.0	0.0	5008	,	,		14485	0.0		0.0	False		,,,				2504	0.001				p.E27E		.											.	APOA2-91	0			c.G81A						.						108.0	101.0	104.0					1																	161192812		2203	4300	6503	SO:0001819	synonymous_variant	336	exon3			ACATGGCTCCTTT		CCDS1226.1	1q23.3	2013-01-24			ENSG00000158874	ENSG00000158874		"""Apolipoproteins"""	601	protein-coding gene	gene with protein product		107670				2415515	Standard	NM_001643		Approved		uc001fzc.1	P02652	OTTHUMG00000034346	ENST00000367990.3:c.81G>A	1.37:g.161192812C>T		Somatic	100	0		WXS	Illumina GAIIx	Phase_I	145	48	NM_001643	0	0	0	0	0	B2R524	Silent	SNP	ENST00000367990.3	37	CCDS1226.1																																																																																			.		0.547	APOA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083037.1	NM_001643	
IER5	51278	hgsc.bcm.edu	37	1	181058313	181058313	+	Missense_Mutation	SNP	G	G	A	rs3747955	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr1:181058313G>A	ENST00000367577.4	+	1	676	c.275G>A	c.(274-276)cGt>cAt	p.R92H	RP11-309G3.3_ENST00000606938.1_lincRNA	NM_016545.4	NP_057629.2	Q5VY09	IER5_HUMAN	immediate early response 5	92			R -> H (in dbSNP:rs3747955). {ECO:0000269|PubMed:15498874}.							lung(1)|ovary(1)|pancreas(1)|urinary_tract(1)	4						cccgccgcTCGTGCCTCTTGG	0.801													G|||	2220	0.443291	0.2489	0.4452	5008	,	,		6443	0.6002		0.3777	False		,,,				2504	0.6104				p.R92H		.											.	IER5-227	0			c.G275A						.	G	HIS/ARG	975,3037		142,691,1173	5.0	6.0	6.0		275	-1.2	0.0	1	dbSNP_107	6	2425,5403		398,1629,1887	no	missense	IER5	NM_016545.4	29	540,2320,3060	AA,AG,GG		30.9785,24.3021,28.7162	benign	92/328	181058313	3400,8440	2006	3914	5920	SO:0001583	missense	51278	exon1			CCGCTCGTGCCTC	BC000128	CCDS1343.1	1q25.3	2008-02-05			ENSG00000162783	ENSG00000162783			5393	protein-coding gene	gene with protein product		607177				10049588, 11102586	Standard	NM_016545		Approved		uc001got.4	Q5VY09	OTTHUMG00000035178	ENST00000367577.4:c.275G>A	1.37:g.181058313G>A	ENSP00000356549:p.Arg92His	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	8	6	NM_016545	0	0	0	1	1	B2RBV3|Q8WY68|Q9NY49|Q9NZP9	Missense_Mutation	SNP	ENST00000367577.4	37	CCDS1343.1	943	0.4317765567765568	134	0.27235772357723576	158	0.43646408839779005	358	0.6258741258741258	293	0.3865435356200528	G	2.870	-0.234111	0.05983	0.243021	0.309785	ENSG00000162783	ENST00000367577;ENST00000545568	T	0.10668	2.85	3.62	-1.18	0.09617	.	0.978663	0.08289	U	0.968738	T	0.00012	0.0000	L	0.40543	1.245	0.80722	P	0.0	B	0.15719	0.014	B	0.14578	0.011	T	0.36407	-0.9749	9	0.15066	T	0.55	.	7.4605	0.27291	0.1106:0.5642:0.3252:0.0	rs3747955	92	Q5VY09	IER5_HUMAN	H	92	ENSP00000356549:R92H	ENSP00000356549:R92H	R	+	2	0	IER5	179324936	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	0.173000	0.16724	-0.337000	0.08426	0.297000	0.19635	CGT	G|0.568;A|0.432		0.801	IER5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085142.1	NM_016545	
RGSL1	353299	broad.mit.edu	37	1	182496829	182496829	+	Missense_Mutation	SNP	A	A	G	rs7535533	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr1:182496829A>G	ENST00000294854.8	+	11	2067	c.2047A>G	c.(2047-2049)Ata>Gta	p.I683V	RGSL1_ENST00000456971.2_3'UTR|RGSL1_ENST00000542961.1_Missense_Mutation_p.I718V	NM_001137669.1	NP_001131141.1	A5PLK6	RGSL_HUMAN	regulator of G-protein signaling like 1	683	RGS.			I -> V (in Ref. 6; BC121032/BC121033). {ECO:0000305}.	termination of G-protein coupled receptor signaling pathway (GO:0038032)	integral component of membrane (GO:0016021)				central_nervous_system(2)|skin(4)	6						GAAGATCAGTATAGAGACCAA	0.418													A|||	1563	0.312101	0.1914	0.2435	5008	,	,		20402	0.4315		0.3877	False		,,,				2504	0.3231				p.I683V	Ovarian(71;11 616 11292 12944 18021 32289 33994 41738 46526)	.											.	RGSL1-226	0			c.A2047G						.	A	VAL/ILE	306,1078		39,228,425	98.0	84.0	88.0		2047	0.7	0.0	1	dbSNP_116	88	1180,2002		213,754,624	yes	missense	RGSL1	NM_001137669.1	29	252,982,1049	GG,GA,AA		37.0836,22.1098,32.5449	benign	683/1077	182496829	1486,3080	692	1591	2283	SO:0001583	missense	353299	exon11			ATCAGTATAGAGA	AF510428	CCDS58049.1	1q25	2013-04-02	2007-08-14		ENSG00000121446	ENSG00000121446			18636	protein-coding gene	gene with protein product		611012	"""regulator of G-protein signalling like 1"", ""regulator of G-protein signaling like 2"", ""regulator of G-protein signalling like 2"""	RGSL2		12801632	Standard	NM_001137669		Approved		uc009wxw.3	A5PLK6	OTTHUMG00000035217	ENST00000294854.8:c.2047A>G	1.37:g.182496829A>G	ENSP00000457748:p.Ile683Val	Somatic	93	0		WXS	Illumina GAIIx	Phase_I	113	4	NM_001137669	0	0	0	0	0	A2A2Z0|A6PVM2|A6PVM3|Q0VAJ4|Q0VAJ5|Q6ZRL0|Q86UV0|Q9H084	Missense_Mutation	SNP	ENST00000294854.8	37	CCDS58049.1																																																																																			A|0.662;G|0.338		0.418	RGSL1-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320710.3	NM_181572	
HSD11B1	3290	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	209905838	209905838	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr1:209905838G>T	ENST00000367028.2	+	6	744	c.575G>T	c.(574-576)gGg>gTg	p.G192V	HSD11B1_ENST00000261465.1_Missense_Mutation_p.G192V|HSD11B1_ENST00000367027.3_Missense_Mutation_p.G192V	NM_001206741.1	NP_001193670.1	P28845	DHI1_HUMAN	hydroxysteroid (11-beta) dehydrogenase 1	192					glucocorticoid biosynthetic process (GO:0006704)|lung development (GO:0030324)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	11-beta-hydroxysteroid dehydrogenase (NADP+) activity (GO:0070524)|11-beta-hydroxysteroid dehydrogenase [NAD(P)] activity (GO:0003845)			breast(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(9)	16				OV - Ovarian serous cystadenocarcinoma(81;1.04e-55)|Epithelial(68;1.57e-52)|all cancers(67;1.83e-46)|Colorectal(1306;0.115)	Prednisone(DB00635)	GCTTTGGATGGGTTCTTCTCC	0.423																																					p.G192V		.											.	HSD11B1-153	0			c.G575T						.						201.0	176.0	185.0					1																	209905838		2203	4300	6503	SO:0001583	missense	3290	exon5			TGGATGGGTTCTT	BC012593	CCDS1489.1	1q32-q41	2011-09-20			ENSG00000117594	ENSG00000117594	1.1.1.146	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	5208	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 26C, member 1"""	600713		HSD11B, HSD11		1885595, 19027726	Standard	NM_005525		Approved	SDR26C1	uc001hhk.3	P28845	OTTHUMG00000036481	ENST00000367028.2:c.575G>T	1.37:g.209905838G>T	ENSP00000355995:p.Gly192Val	Somatic	174	0		WXS	Illumina GAIIx	Phase_I	212	75	NM_005525	0	0	5	10	5	B2R9Z1|D3DT89	Missense_Mutation	SNP	ENST00000367028.2	37	CCDS1489.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.120689	0.77323	.	.	ENSG00000117594	ENST00000367028;ENST00000261465;ENST00000367027	D;D;D	0.88818	-2.43;-2.43;-2.43	5.45	5.45	0.79879	Short-chain dehydrogenase/reductase, conserved site (1);NAD(P)-binding domain (1);	0.104184	0.64402	D	0.000003	D	0.94647	0.8274	M	0.85630	2.765	0.80722	D	1	D	0.89917	1.0	D	0.69142	0.962	D	0.95159	0.8280	10	0.72032	D	0.01	.	16.2046	0.82114	0.0:0.0:1.0:0.0	.	192	P28845	DHI1_HUMAN	V	192	ENSP00000355995:G192V;ENSP00000261465:G192V;ENSP00000355994:G192V	ENSP00000261465:G192V	G	+	2	0	HSD11B1	207972461	1.000000	0.71417	0.992000	0.48379	0.997000	0.91878	5.228000	0.65310	2.555000	0.86185	0.557000	0.71058	GGG	.		0.423	HSD11B1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088743.2	NM_005525	
DNAH14	127602	broad.mit.edu	37	1	225528183	225528183	+	Missense_Mutation	SNP	C	C	A	rs377250670|rs3856145	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr1:225528183C>A	ENST00000445597.2	+	47	7770	c.7770C>A	c.(7768-7770)gaC>gaA	p.D2590E	DNAH14_ENST00000439375.2_Missense_Mutation_p.D3393E|DNAH14_ENST00000430092.1_Missense_Mutation_p.D3393E			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14	2590					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						CAGAAATAGACAACCCCCATT	0.318													C|||	2653	0.529752	0.643	0.4697	5008	,	,		17622	0.5089		0.4046	False		,,,				2504	0.5695				p.D3393E		.											.	DNAH14-23	0			c.C10179A						.	C	GLU/ASP	846,538		270,306,116	113.0	99.0	103.0		10179	0.7	1.0	1	dbSNP_108	103	1403,1779		323,757,511	yes	missense	DNAH14	NM_001373.1	45	593,1063,627	AA,AC,CC		44.0918,38.8728,49.2554	possibly-damaging	3393/4516	225528183	2249,2317	692	1591	2283	SO:0001583	missense	127602	exon67			AATAGACAACCCC	U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.7770C>A	1.37:g.225528183C>A	ENSP00000409472:p.Asp2590Glu	Somatic	197	0		WXS	Illumina GAIIx	Phase_I	170	6	NM_001373	0	0	0	0	0	A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Missense_Mutation	SNP	ENST00000445597.2	37		1057	0.483974358974359	305	0.6199186991869918	165	0.4558011049723757	281	0.49125874125874125	306	0.40369393139841686	C	13.41	2.229518	0.39399	0.611272	0.440918	ENSG00000185842	ENST00000445597;ENST00000430092;ENST00000439375	T;T;T	0.21191	2.02;2.02;2.02	5.22	0.724	0.18236	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.09310	P	0.99999999854566	B	0.31817	0.341	B	0.32762	0.152	T	0.33214	-0.9877	7	0.32370	T	0.25	.	1.4675	0.02408	0.2894:0.3987:0.141:0.1709	rs3856145;rs52794541;rs58846503;rs3856145	3393	Q0VDD8-4	.	E	2590;3393;3393	ENSP00000409472:D2590E;ENSP00000414402:D3393E;ENSP00000392061:D3393E	ENSP00000414402:D3393E	D	+	3	2	DNAH14	223594806	1.000000	0.71417	0.981000	0.43875	0.977000	0.68977	0.462000	0.21956	-0.062000	0.13088	0.508000	0.49915	GAC	C|0.498;A|0.500		0.318	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000331217.3	XM_059166	
PCNXL2	80003	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	233122169	233122169	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr1:233122169G>A	ENST00000258229.9	-	33	6143	c.5909C>T	c.(5908-5910)tCc>tTc	p.S1970F	PCNXL2_ENST00000344698.2_Missense_Mutation_p.S622F	NM_014801.3	NP_055616.3	A6NKB5	PCX2_HUMAN	pecanex-like 2 (Drosophila)	1970	Ser-rich.					integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(7)|large_intestine(19)|lung(30)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86		all_cancers(173;0.0347)|Prostate(94;0.137)				CACTGAGGTGGACGTCTGGAG	0.662																																					p.S1970F		.											.	PCNXL2-91	0			c.C5909T						.						20.0	27.0	25.0					1																	233122169		2055	4187	6242	SO:0001583	missense	80003	exon33			GAGGTGGACGTCT	AK055374	CCDS44335.1	1q42.2	2008-02-05	2001-11-28		ENSG00000135749	ENSG00000135749			8736	protein-coding gene	gene with protein product			"""pecanex (Drosophila)-like 2"""			12477932	Standard	NM_014801		Approved	KIAA0435, FLJ11383	uc001hvl.2	A6NKB5	OTTHUMG00000037824	ENST00000258229.9:c.5909C>T	1.37:g.233122169G>A	ENSP00000258229:p.Ser1970Phe	Somatic	68	0		WXS	Illumina GAIIx	Phase_I	128	8	NM_014801	0	0	0	0	0	O43162|Q5T9Z8|Q5TDF1|Q8TEP4|Q96HP9|Q9HAL8	Missense_Mutation	SNP	ENST00000258229.9	37	CCDS44335.1	.	.	.	.	.	.	.	.	.	.	G	12.96	2.093041	0.36952	.	.	ENSG00000135749	ENST00000344698;ENST00000258229	T;T	0.31769	1.48;2.56	5.85	5.85	0.93711	.	0.136154	0.51477	D	0.000099	T	0.29684	0.0741	L	0.50919	1.6	0.80722	D	1	B;B	0.26672	0.156;0.028	B;B	0.21546	0.035;0.027	T	0.03784	-1.1004	10	0.52906	T	0.07	.	13.3805	0.60764	0.0715:0.0:0.9285:0.0	.	1970;622	A6NKB5;A6NKB5-3	PCX2_HUMAN;.	F	622;1970	ENSP00000340759:S622F;ENSP00000258229:S1970F	ENSP00000258229:S1970F	S	-	2	0	PCNXL2	231188792	1.000000	0.71417	0.938000	0.37757	0.188000	0.23474	6.647000	0.74354	2.771000	0.95319	0.561000	0.74099	TCC	.		0.662	PCNXL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092480.3	NM_014801	
ARID4B	51742	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	235345012	235345012	+	Silent	SNP	A	A	C			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr1:235345012A>C	ENST00000264183.3	-	20	3719	c.3222T>G	c.(3220-3222)gtT>gtG	p.V1074V	ARID4B_ENST00000349213.3_Silent_p.V988V|ARID4B_ENST00000366603.2_Silent_p.V1074V|ARID4B_ENST00000494543.1_5'UTR	NM_016374.5	NP_057458.4	Q4LE39	ARI4B_HUMAN	AT rich interactive domain 4B (RBP1-like)	1074					histone H3-K9 trimethylation (GO:0036124)|histone H4-K20 trimethylation (GO:0034773)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|large_intestine(2)|lung(1)|ovary(2)	8	Ovarian(103;0.0473)|Breast(184;0.23)	all_cancers(173;0.000782)|Prostate(94;0.0132)|all_epithelial(177;0.0808)|Lung SC(1967;0.24)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)			GCTCCCCAGCAACACTATCCA	0.483																																					p.V1074V		.											.	ARID4B-228	0			c.T3222G						.						112.0	94.0	100.0					1																	235345012		2203	4300	6503	SO:0001819	synonymous_variant	51742	exon20			CCCAGCAACACTA	AF214114	CCDS31060.1, CCDS31061.1	1q42.1-q43	2013-02-07	2006-11-08	2004-01-30	ENSG00000054267	ENSG00000054267		"""-"""	15550	protein-coding gene	gene with protein product		609696	"""retinoblastoma binding protein 1-like 1"", ""AT rich interactive domain 4B (RBP1- like)"""	RBP1L1		11481388	Standard	NM_016374		Approved	BCAA, BRCAA1, SAP180	uc001hwq.3	Q4LE39	OTTHUMG00000039621	ENST00000264183.3:c.3222T>G	1.37:g.235345012A>C		Somatic	104	0		WXS	Illumina GAIIx	Phase_I	88	24	NM_016374	0	0	1	1	0	A1L465|Q3MHV4|Q5HY99|Q5T2C2|Q5T2C3|Q5T2C4|Q5T2C5|Q5T2C6|Q6P600|Q86UX1|Q86WR4|Q9H915|Q9NYU3|Q9NZB6|Q9NZG4|Q9P2W4|Q9UF62|Q9Y6E1	Silent	SNP	ENST00000264183.3	37	CCDS31061.1	.	.	.	.	.	.	.	.	.	.	A	4.083	0.013417	0.07912	.	.	ENSG00000054267	ENST00000444620	.	.	.	5.17	-6.28	0.02020	.	.	.	.	.	T	0.38295	0.1035	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.41142	-0.9525	4	.	.	.	-13.1614	3.331	0.07084	0.3427:0.3508:0.2191:0.0875	.	.	.	.	W	474	.	.	L	-	2	0	ARID4B	233411635	0.028000	0.19301	0.017000	0.16124	0.989000	0.77384	-0.640000	0.05440	-1.052000	0.03222	0.477000	0.44152	TTG	.		0.483	ARID4B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095566.3	NM_016374	
OR2M5	127059	bcgsc.ca	37	1	248309356	248309356	+	Missense_Mutation	SNP	A	A	G	rs73141283	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr1:248309356A>G	ENST00000366476.1	+	1	907	c.907A>G	c.(907-909)Aaa>Gaa	p.K303E		NM_001004690.1	NP_001004690.1	A3KFT3	OR2M5_HUMAN	olfactory receptor, family 2, subfamily M, member 5	303						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(5)|kidney(2)|large_intestine(7)|liver(1)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	49	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0388)			AGCACTCAGGAAAGTGTTAGG	0.453													a|||	273	0.0545128	0.0575	0.0187	5008	,	,		17595	0.0754		0.0646	False		,,,				2504	0.044				p.K303E		.											.	OR2M5-71	0			c.A907G						.	A	GLU/LYS	248,4158	123.3+/-160.7	10,228,1965	61.0	57.0	58.0		907	2.7	0.1	1	dbSNP_130	58	457,8143	109.4+/-169.9	19,419,3862	yes	missense	OR2M5	NM_001004690.1	56	29,647,5827	GG,GA,AA		5.314,5.6287,5.4206	possibly-damaging	303/313	248309356	705,12301	2203	4300	6503	SO:0001583	missense	127059	exon1			CTCAGGAAAGTGT		CCDS31105.1	1q44	2012-08-09		2004-03-10	ENSG00000162727	ENSG00000162727		"""GPCR / Class A : Olfactory receptors"""	19576	protein-coding gene	gene with protein product				OR2M5P			Standard	NM_001004690		Approved		uc010pze.2	A3KFT3	OTTHUMG00000040447	ENST00000366476.1:c.907A>G	1.37:g.248309356A>G	ENSP00000355432:p.Lys303Glu	Somatic	151	0		WXS	Illumina GAIIx	Phase_I	195	7	NM_001004690	0	0	0	0	0		Missense_Mutation	SNP	ENST00000366476.1	37	CCDS31105.1	140	0.0641025641025641	30	0.06097560975609756	8	0.022099447513812154	57	0.09965034965034965	45	0.059366754617414245	a	12.30	1.896938	0.33535	0.056287	0.05314	ENSG00000162727	ENST00000366476	T	0.40476	1.03	2.65	2.65	0.31530	.	.	.	.	.	T	0.01558	0.0050	M	0.82923	2.615	0.80722	P	0.0	B	0.14805	0.011	B	0.18871	0.023	T	0.29119	-1.0022	8	0.87932	D	0	.	8.6949	0.34289	1.0:0.0:0.0:0.0	.	303	A3KFT3	OR2M5_HUMAN	E	303	ENSP00000355432:K303E	ENSP00000355432:K303E	K	+	1	0	OR2M5	246375979	0.003000	0.15002	0.066000	0.19879	0.030000	0.12068	1.499000	0.35671	0.948000	0.37687	0.317000	0.21355	AAA	A|0.942;G|0.058		0.453	OR2M5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097343.1	NM_001004690	
GPRIN2	9721	hgsc.bcm.edu	37	10	47000217	47000217	+	Missense_Mutation	SNP	G	G	A	rs72780221	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr10:47000217G>A	ENST00000374317.1	+	3	1610	c.1337G>A	c.(1336-1338)cGc>cAc	p.R446H	GPRIN2_ENST00000374314.4_Missense_Mutation_p.R446H	NM_014696.3	NP_055511.2	O60269	GRIN2_HUMAN	G protein regulated inducer of neurite outgrowth 2	446								p.R446H(1)		breast(2)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)	18						TCCCTGCGGCGCCCCAGCTGC	0.716																																					p.R446H		.											.	GPRIN2-90	1	Substitution - Missense(1)	prostate(1)	c.G1337A						.						8.0	9.0	9.0					10																	47000217		2121	4098	6219	SO:0001583	missense	9721	exon3			TGCGGCGCCCCAG	BC011672	CCDS73101.1	10q11.22	2006-08-24	2006-08-24	2006-08-24	ENSG00000204175	ENSG00000204175			23730	protein-coding gene	gene with protein product		611240	"""KIAA0514"""	KIAA0514		9628581	Standard	NM_014696		Approved	MGC15171	uc001jec.3	O60269	OTTHUMG00000018107	ENST00000374317.1:c.1337G>A	10.37:g.47000217G>A	ENSP00000363436:p.Arg446His	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	13	4	NM_014696	0	0	0	0	0	Q5SVF0	Missense_Mutation	SNP	ENST00000374317.1	37	CCDS31192.1	220	0.10073260073260074	86	0.17479674796747968	30	0.08287292817679558	25	0.043706293706293704	79	0.10422163588390501	G	13.52	2.261176	0.39995	.	.	ENSG00000204175	ENST00000374317;ENST00000374314	T;T	0.26223	1.75;1.75	5.11	3.2	0.36748	.	0.744361	0.10758	N	0.637492	T	0.00073	0.0002	L	0.49350	1.555	0.09310	N	1	B	0.24533	0.105	B	0.17433	0.018	T	0.22243	-1.0222	10	0.34782	T	0.22	-0.7153	5.5226	0.16941	0.1777:0.1655:0.6568:0.0	.	446	O60269	GRIN2_HUMAN	H	446	ENSP00000363436:R446H;ENSP00000363433:R446H	ENSP00000363433:R446H	R	+	2	0	GPRIN2	46420223	0.000000	0.05858	0.420000	0.26596	0.986000	0.74619	0.143000	0.16115	0.639000	0.30564	0.561000	0.74099	CGC	G|0.901;A|0.099		0.716	GPRIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047836.1	NM_014696	
CDH23	64072	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	73466729	73466729	+	Missense_Mutation	SNP	G	G	A	rs370107953	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr10:73466729G>A	ENST00000224721.6	+	25	3049	c.3044G>A	c.(3043-3045)cGc>cAc	p.R1015H	CDH23_ENST00000299366.7_Missense_Mutation_p.R1055H	NM_022124.5	NP_071407.4	Q9H251	CAD23_HUMAN	cadherin-related 23	1010	Cadherin 10. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cytosolic calcium ion homeostasis (GO:0051480)|equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(6)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(27)|lung(49)|ovary(3)|pancreas(1)|prostate(7)|stomach(7)|upper_aerodigestive_tract(3)	133						GACGTGCCACGCGAGTTCCGG	0.652													G|||	2	0.000399361	0.0	0.0014	5008	,	,		19528	0.0		0.001	False		,,,				2504	0.0				p.R1010H		.											.	CDH23-563	0			c.G3029A						.	G	HIS/ARG,HIS/ARG,HIS/ARG	0,4320		0,0,2160	45.0	56.0	52.0		3029,3029,3029	5.3	0.3	10		52	3,8507		0,3,4252	no	missense,missense,missense	CDH23	NM_001171930.1,NM_001171931.1,NM_022124.5	29,29,29	0,3,6412	AA,AG,GG		0.0353,0.0,0.0234	probably-damaging,probably-damaging,probably-damaging	1010/1382,1010/1062,1010/3355	73466729	3,12827	2160	4255	6415	SO:0001583	missense	64072	exon25			TGCCACGCGAGTT	AY010111	CCDS53540.1, CCDS73146.1	10q22.1	2014-08-08	2010-01-25		ENSG00000107736	ENSG00000107736		"""Cadherins / Cadherin-related"""	13733	protein-coding gene	gene with protein product	"""cadherin-related family member 23"""	605516	"""cadherin related 23"", ""cadherin-like 23"""	DFNB12, USH1D		11090341	Standard	NM_022124		Approved	CDHR23	uc001jrx.4	Q9H251	OTTHUMG00000019347	ENST00000224721.6:c.3044G>A	10.37:g.73466729G>A	ENSP00000224721:p.Arg1015His	Somatic	325	0		WXS	Illumina GAIIx	Phase_I	600	136	NM_022124	0	0	0	0	0	C4IXS9|F6U049|Q5QGS1|Q5QGS2|Q5QGS5|Q5QGS6|Q5XKN2|Q6UWW1|Q96JL3|Q9H4K9	Missense_Mutation	SNP	ENST00000224721.6	37		.	.	.	.	.	.	.	.	.	.	G	19.91	3.914173	0.72983	0.0	3.53E-4	ENSG00000107736	ENST00000398860;ENST00000398855;ENST00000398828;ENST00000299366;ENST00000224721;ENST00000442677	.	.	.	5.28	5.28	0.74379	Cadherin (3);Cadherin-like (1);	0.000000	0.64402	D	0.000002	T	0.76076	0.3937	L	0.52266	1.64	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.998	D;D;D	0.87578	0.986;0.998;0.992	T	0.77696	-0.2491	9	0.66056	D	0.02	.	18.9173	0.92510	0.0:0.0:1.0:0.0	.	1010;1013;1010	Q6P152;G3XCN8;Q9H251	.;.;CAD23_HUMAN	H	1015;1010;1010;1013;1013;527	.	ENSP00000224721:R1015H	R	+	2	0	CDH23	73136735	1.000000	0.71417	0.273000	0.24645	0.147000	0.21601	9.827000	0.99397	2.468000	0.83385	0.561000	0.74099	CGC	.		0.652	CDH23-001	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051227.4	NM_052836	
ZNF503	84858	hgsc.bcm.edu	37	10	77159791	77159791	+	Nonsense_Mutation	SNP	G	G	T			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr10:77159791G>T	ENST00000372524.4	-	2	1143	c.657C>A	c.(655-657)tgC>tgA	p.C219*	RP11-399K21.11_ENST00000418818.2_lincRNA|ZNF503-AS2_ENST00000486015.1_RNA|ZNF503_ENST00000535216.1_Nonsense_Mutation_p.C219*|ZNF503-AS2_ENST00000466942.2_RNA	NM_032772.4	NP_116161.2	Q96F45	ZN503_HUMAN	zinc finger protein 503	219	Gly-rich.				G1 to G0 transition involved in cell differentiation (GO:0070315)|negative regulation of cell proliferation (GO:0008285)|negative regulation of gene expression (GO:0010629)|neural precursor cell proliferation (GO:0061351)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			lung(4)|ovary(1)|skin(1)	6	all_cancers(46;0.105)|all_epithelial(25;0.00449)|Prostate(51;0.0112)|Ovarian(15;0.088)					TGAATGGCTGGCAGGTGGCGC	0.751																																					p.C219X		.											.	ZNF503-91	0			c.C657A						.						6.0	7.0	7.0					10																	77159791		1999	3938	5937	SO:0001587	stop_gained	84858	exon2			TGGCTGGCAGGTG	AK127647	CCDS7350.1	10q22.3	2011-02-09			ENSG00000165655	ENSG00000165655		"""Zinc fingers, C2H2-type"""	23589	protein-coding gene	gene with protein product		613902				12477932	Standard	NM_032772		Approved	FLJ45745, MGC2555	uc001jxg.3	Q96F45	OTTHUMG00000018526	ENST00000372524.4:c.657C>A	10.37:g.77159791G>T	ENSP00000361602:p.Cys219*	Somatic	7	0		WXS	Illumina GAIIx	Phase_I	61	4	NM_032772	0	0	3	3	0	Q8NAC5|Q96E25|Q96IJ0	Nonsense_Mutation	SNP	ENST00000372524.4	37	CCDS7350.1	.	.	.	.	.	.	.	.	.	.	G	39	7.434716	0.98282	.	.	ENSG00000165655	ENST00000372524;ENST00000535216;ENST00000372516	.	.	.	4.33	4.33	0.51752	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05351	T	0.99	-11.3267	17.0205	0.86432	0.0:0.0:1.0:0.0	.	.	.	.	X	219	.	ENSP00000361594:C219X	C	-	3	2	ZNF503	76829797	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.779000	0.75057	2.223000	0.72356	0.549000	0.68633	TGC	.		0.751	ZNF503-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048826.1	NM_032772	
NEURL1	9148	hgsc.bcm.edu	37	10	105344756	105344756	+	Silent	SNP	T	T	C	rs2236209	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr10:105344756T>C	ENST00000369780.4	+	4	1522	c.1113T>C	c.(1111-1113)ccT>ccC	p.P371P	NEURL_ENST00000369777.2_Silent_p.P354P	NM_004210.4	NP_004201.3	O76050	NEUL1_HUMAN		371	NHR 2. {ECO:0000255|PROSITE- ProRule:PRU00400}.				brain development (GO:0007420)|cellular response to amino acid stimulus (GO:0071230)|lactation (GO:0007595)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Notch signaling pathway (GO:0045746)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse maturation (GO:0090129)|protein monoubiquitination (GO:0006513)|skeletal muscle tissue development (GO:0007519)|sperm axoneme assembly (GO:0007288)|sperm motility (GO:0030317)	apical dendrite (GO:0097440)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ligase activity (GO:0016874)|translation factor activity, non-nucleic acid binding (GO:0045183)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(4)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	17				Epithelial(162;2.12e-09)|all cancers(201;6.99e-08)|BRCA - Breast invasive adenocarcinoma(275;0.125)		CCGACCTGCCTTTCAGCCCTG	0.731													C|||	2650	0.529153	0.3964	0.5173	5008	,	,		11202	0.6478		0.5378	False		,,,				2504	0.5859				p.P371P		.											.	NEURL-226	0			c.T1113C						.	C		1415,2517		309,797,860	6.0	5.0	5.0		1113	2.7	1.0	10	dbSNP_98	5	3978,3894		1122,1734,1080	no	coding-synonymous	NEURL	NM_004210.4		1431,2531,1940	CC,CT,TT		49.4665,35.9868,45.6879		371/575	105344756	5393,6411	1966	3936	5902	SO:0001819	synonymous_variant	9148	exon4			CCTGCCTTTCAGC																												ENST00000369780.4:c.1113T>C	10.37:g.105344756T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	3	3	NM_004210	0	0	0	0	0	Q5TDR2|Q5TDR3|Q8TAN0|Q9H463	Silent	SNP	ENST00000369780.4	37	CCDS7551.1																																																																																			T|0.455;C|0.545		0.731	NEURL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050170.1		
PTPRE	5791	broad.mit.edu;bcgsc.ca	37	10	129871714	129871714	+	Silent	SNP	G	G	A	rs376614299		TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr10:129871714G>A	ENST00000254667.3	+	17	1857	c.1578G>A	c.(1576-1578)acG>acA	p.T526T	PTPRE_ENST00000419012.2_Silent_p.T526T|PTPRE_ENST00000306042.5_Silent_p.T468T	NM_006504.4	NP_006495.1	P23469	PTPRE_HUMAN	protein tyrosine phosphatase, receptor type, E	526	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				negative regulation of insulin receptor signaling pathway (GO:0046627)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of mast cell activation (GO:0033003)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	22		all_epithelial(44;1.66e-05)|all_lung(145;0.00456)|Lung NSC(174;0.0066)|all_neural(114;0.0936)|Colorectal(57;0.141)|Breast(234;0.166)|Melanoma(40;0.203)			Alendronate(DB00630)	TGATGCTGACGGAGGTGCAGG	0.592																																					p.T526T	Colon(52;977 1184 20575 41685)	.											.	PTPRE-227	0			c.G1578A						.	G	,	0,4406		0,0,2203	100.0	85.0	90.0		1578,1404	-9.5	0.0	10		90	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	PTPRE	NM_006504.4,NM_130435.3	,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	526/701,468/643	129871714	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	5791	exon17			GCTGACGGAGGTG	AF406557	CCDS7657.1, CCDS7658.1	10q26	2011-06-09			ENSG00000132334	ENSG00000132334		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9669	protein-coding gene	gene with protein product		600926				8595895	Standard	NM_130435		Approved	PTPE	uc001lkb.3	P23469	OTTHUMG00000019254	ENST00000254667.3:c.1578G>A	10.37:g.129871714G>A		Somatic	249	0		WXS	Illumina GAIIx	Phase_I	275	11	NM_006504	0	0	5	5	0	Q13345|Q5VWH3|Q5VWH4|Q96KQ6	Silent	SNP	ENST00000254667.3	37	CCDS7657.1																																																																																			.		0.592	PTPRE-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050990.1		
PWWP2B	170394	hgsc.bcm.edu	37	10	134218296	134218296	+	Missense_Mutation	SNP	C	C	G	rs10747057	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr10:134218296C>G	ENST00000305233.5	+	2	351	c.292C>G	c.(292-294)Cgc>Ggc	p.R98G	PWWP2B_ENST00000368609.4_Missense_Mutation_p.R98G	NM_138499.3	NP_612508.3	Q6NUJ5	PWP2B_HUMAN	PWWP domain containing 2B	98	Pro-rich.		R -> G (in dbSNP:rs10747057). {ECO:0000269|PubMed:15489334}.							central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(5)|urinary_tract(1)	9		all_cancers(35;6.69e-12)|all_epithelial(44;1.55e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Breast(234;0.106)|Colorectal(31;0.109)|Melanoma(40;0.123)|Glioma(114;0.203)|all_hematologic(284;0.224)		OV - Ovarian serous cystadenocarcinoma(35;7.49e-05)|Epithelial(32;0.00016)|all cancers(32;0.000186)		CGAGACCACCCGCCCCGAGCC	0.756													G|||	2967	0.592452	0.7065	0.5461	5008	,	,		5878	0.6954		0.4563	False		,,,				2504	0.5051				p.R98G		.											.	PWWP2B-90	0			c.C292G						.	G	GLY/ARG,GLY/ARG	2822,1070		1079,664,203	6.0	9.0	8.0		292,292	2.8	0.0	10	dbSNP_120	8	3931,3905		1096,1739,1083	no	missense,missense	PWWP2B	NM_001098637.1,NM_138499.3	125,125	2175,2403,1286	GG,GC,CC		49.8341,27.4923,42.4198	benign,benign	98/500,98/591	134218296	6753,4975	1946	3918	5864	SO:0001583	missense	170394	exon2			ACCACCCGCCCCG	AK128663	CCDS7667.2	10q26.3	2009-06-03	2007-10-22	2007-10-22	ENSG00000171813	ENSG00000171813			25150	protein-coding gene	gene with protein product			"""PWWP domain containing 2"""	PWWP2			Standard	NM_001098637		Approved	bA432J24.1, FLJ46823	uc001lll.4	Q6NUJ5	OTTHUMG00000019286	ENST00000305233.5:c.292C>G	10.37:g.134218296C>G	ENSP00000306324:p.Arg98Gly	Somatic	1	1		WXS	Illumina GAIIx	Phase_I	6	6	NM_001098637	0	0	0	16	16	A6NM90|B5MDQ1|H9KV61|Q5SZI0|Q6ZQX5|Q96F43	Missense_Mutation	SNP	ENST00000305233.5	37	CCDS7667.2	1241	0.5682234432234432	337	0.6849593495934959	177	0.4889502762430939	394	0.6888111888111889	333	0.4393139841688654	G	0.032	-1.327586	0.01309	0.725077	0.501659	ENSG00000171813	ENST00000305233;ENST00000368609	T;T	0.54675	0.56;1.56	2.77	2.77	0.32553	.	1.934230	0.03132	N	0.165319	T	0.00012	0.0000	N	0.02539	-0.55	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.44003	-0.9356	9	0.23302	T	0.38	0.1321	1.7392	0.02948	0.1217:0.2122:0.4474:0.2187	rs10747057;rs57970936	98	Q6NUJ5	PWP2B_HUMAN	G	98	ENSP00000306324:R98G;ENSP00000357598:R98G	ENSP00000306324:R98G	R	+	1	0	PWWP2B	134068286	0.000000	0.05858	0.002000	0.10522	0.003000	0.03518	-1.230000	0.02942	0.744000	0.32741	-0.224000	0.12420	CGC	C|0.431;G|0.569		0.756	PWWP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051075.3	NM_138499	
KNDC1	85442	hgsc.bcm.edu	37	10	135000148	135000148	+	Silent	SNP	T	T	C	rs3810965	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr10:135000148T>C	ENST00000304613.3	+	6	1317	c.1296T>C	c.(1294-1296)gcT>gcC	p.A432A	KNDC1_ENST00000368571.2_Silent_p.A367A|KNDC1_ENST00000368572.2_Silent_p.A432A			Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND) containing 1	432					cerebellar granule cell differentiation (GO:0021707)|positive regulation of protein phosphorylation (GO:0001934)|regulation of dendrite morphogenesis (GO:0048814)|small GTPase mediated signal transduction (GO:0007264)	dendrite (GO:0030425)|guanyl-nucleotide exchange factor complex (GO:0032045)|neuronal cell body (GO:0043025)	protein serine/threonine kinase activity (GO:0004674)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			NS(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(27)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	60		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		CAGAAGGAGCTAGGCAGCTGG	0.667													c|||	2087	0.416733	0.118	0.3847	5008	,	,		13870	0.5764		0.4354	False		,,,				2504	0.6595				p.A432A		.											.	KNDC1-229	0			c.T1296C						.			719,3683		63,593,1545	26.0	32.0	30.0		1296	-4.2	0.0	10	dbSNP_107	30	3956,4636		925,2106,1265	no	coding-synonymous	KNDC1	NM_152643.6		988,2699,2810	CC,CT,TT		46.0428,16.3335,35.9781		432/1750	135000148	4675,8319	2201	4296	6497	SO:0001819	synonymous_variant	85442	exon6			AGGAGCTAGGCAG	AK074179	CCDS7674.1	10q26.3	2004-09-14	2004-04-07		ENSG00000171798	ENSG00000171798			29374	protein-coding gene	gene with protein product			"""RasGEF domain family, member 2"""	RASGEF2, C10orf23		11214970	Standard	NM_152643		Approved	KIAA1768, bB439H18.3, FLJ25027	uc001llz.1	Q76NI1	OTTHUMG00000019303	ENST00000304613.3:c.1296T>C	10.37:g.135000148T>C		Somatic	6	1		WXS	Illumina GAIIx	Phase_I	9	5	NM_152643	0	0	6	6	0	B0QZC5|Q5T233|Q6ZNH8|Q8TEE5|Q96LV7|Q9C095	Silent	SNP	ENST00000304613.3	37	CCDS7674.1																																																																																			T|0.607;C|0.393		0.667	KNDC1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000277044.3	NM_152643	
MUC2	4583	hgsc.bcm.edu	37	11	1093014	1093014	+	Silent	SNP	C	C	G			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr11:1093014C>G	ENST00000441003.2	+	30	4860	c.4833C>G	c.(4831-4833)acC>acG	p.T1611T	MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000359061.5_Intron	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	ccatcaccaccaccactacgg	0.622																																					p.T1611T		.											.	MUC2-90	0			c.C4833G						.						66.0	110.0	94.0					11																	1093014		1826	3408	5234	SO:0001819	synonymous_variant	4583	exon30			CACCACCACCACT	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4833C>G	11.37:g.1093014C>G		Somatic	106	2		WXS	Illumina GAIIx	Phase_I	148	11	NM_002457	0	0	0	0	0	Q14878	Silent	SNP	ENST00000441003.2	37																																																																																				.		0.622	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MUC2	4583	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	1093298	1093298	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr11:1093298C>T	ENST00000441003.2	+	30	5144	c.5117C>T	c.(5116-5118)aCg>aTg	p.T1706M	MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000359061.5_Missense_Mutation_p.T1673M	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	accaccactacggtgacccca	0.637																																					p.T1706M		.											.	MUC2-90	0			c.C5117T						.						116.0	163.0	146.0					11																	1093298		1884	3471	5355	SO:0001583	missense	4583	exon30			CCACTACGGTGAC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5117C>T	11.37:g.1093298C>T	ENSP00000415183:p.Thr1706Met	Somatic	117	1		WXS	Illumina GAIIx	Phase_I	139	16	NM_002457	0	0	0	0	0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	3.981	-0.006376	0.07773	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.10763	2.84;3.0	1.45	1.45	0.22620	.	28.057100	0.02299	U	0.070964	T	0.07908	0.0198	.	.	.	0.09310	N	1	D	0.62365	0.991	B	0.37451	0.25	T	0.31779	-0.9931	9	0.42905	T	0.14	.	6.2785	0.20993	0.0:1.0:0.0:0.0	.	1706	E7EUV1	.	M	1706;1673	ENSP00000415183:T1706M;ENSP00000351956:T1673M	ENSP00000351956:T1673M	T	+	2	0	MUC2	1083298	0.000000	0.05858	0.001000	0.08648	0.029000	0.11900	0.616000	0.24344	0.794000	0.33899	0.184000	0.17185	ACG	.		0.637	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MUC2	4583	hgsc.bcm.edu	37	11	1093344	1093344	+	Silent	SNP	G	G	T			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr11:1093344G>T	ENST00000441003.2	+	30	5190	c.5163G>T	c.(5161-5163)ccG>ccT	p.P1721P	MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_Silent_p.P9P|MUC2_ENST00000359061.5_Silent_p.P1688P	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.P1688P(1)|p.P1721P(1)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	ccccaaccccgacacccatct	0.642																																					p.P1721P		.											.	MUC2-90	2	Substitution - coding silent(2)	lung(2)	c.G5163T						.						231.0	269.0	256.0					11																	1093344		1975	3757	5732	SO:0001819	synonymous_variant	4583	exon30			AACCCCGACACCC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5163G>T	11.37:g.1093344G>T		Somatic	141	2		WXS	Illumina GAIIx	Phase_I	153	11	NM_002457	0	0	0	0	0	Q14878	Silent	SNP	ENST00000441003.2	37																																																																																				.		0.642	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MUC5B	727897	hgsc.bcm.edu;bcgsc.ca	37	11	1253980	1253980	+	Missense_Mutation	SNP	A	A	G	rs202127660		TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr11:1253980A>G	ENST00000529681.1	+	17	2103	c.2045A>G	c.(2044-2046)gAc>gGc	p.D682G	MUC5B_ENST00000447027.1_Missense_Mutation_p.D685G	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	682					cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CAGCTCAGCGACTGGAGGGAC	0.682																																					p.D682G		.											.	.	0			c.A2045G						.						21.0	24.0	23.0					11																	1253980		2116	4228	6344	SO:0001583	missense	727897	exon17			TCAGCGACTGGAG	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.2045A>G	11.37:g.1253980A>G	ENSP00000436812:p.Asp682Gly	Somatic	55	0		WXS	Illumina GAIIx	Phase_I	159	13	NM_002458	0	0	0	0	0	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	A	7.541	0.660740	0.14645	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.76060	-0.99;-0.99	4.6	2.72	0.32119	Uncharacterised domain, cysteine-rich (2);	.	.	.	.	T	0.50103	0.1596	N	0.02960	-0.455	0.24874	N	0.992269	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.45920	-0.9228	9	0.87932	D	0	.	8.6635	0.34108	0.2416:0.0:0.7584:0.0	.	682;1341;685	Q9HC84;A7Y9J9;E9PBJ0	MUC5B_HUMAN;.;.	G	682;685;683;718	ENSP00000436812:D682G;ENSP00000415793:D685G	ENSP00000343037:D683G	D	+	2	0	MUC5B	1210556	0.999000	0.42202	0.632000	0.29296	0.070000	0.16714	2.607000	0.46300	0.373000	0.24621	-1.983000	0.00453	GAC	.		0.682	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
MUC5B	727897	hgsc.bcm.edu	37	11	1266716	1266716	+	Missense_Mutation	SNP	T	T	C	rs200243273	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr11:1266716T>C	ENST00000529681.1	+	31	8664	c.8606T>C	c.(8605-8607)aTg>aCg	p.M2869T	MUC5B_ENST00000447027.1_Missense_Mutation_p.M2872T|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	2869	7 X Cys-rich subdomain repeats.|Thr-rich.			Missing (in Ref. 6; AAB61398). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GTGGTGACCATGGGCTGTGAG	0.657													-|||	1477	0.294928	0.2284	0.2752	5008	,	,		10473	0.4812		0.2266	False		,,,				2504	0.2771				p.M2869T		.											.	.	0			c.T8606C						.						43.0	51.0	49.0					11																	1266716		1683	3765	5448	SO:0001583	missense	727897	exon31			TGACCATGGGCTG	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.8606T>C	11.37:g.1266716T>C	ENSP00000436812:p.Met2869Thr	Somatic	16	2		WXS	Illumina GAIIx	Phase_I	36	15	NM_002458	0	0	0	0	0	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	-	1.479	-0.557829	0.03967	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.15718	2.4;2.59	1.67	-1.74	0.08056	.	.	.	.	.	T	0.05686	0.0149	N	0.02539	-0.55	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.29882	-0.9997	8	0.87932	D	0	.	3.4419	0.07466	0.1749:0.468:0.0:0.3571	rs2860626;rs2943499;rs2943524;rs3965637	3452;2872	A7Y9J9;E9PBJ0	.;.	T	2869;2872;2841;2829	ENSP00000436812:M2869T;ENSP00000415793:M2872T	ENSP00000343037:M2841T	M	+	2	0	MUC5B	1223292	0.003000	0.15002	0.000000	0.03702	0.007000	0.05969	0.117000	0.15583	-1.035000	0.03291	-0.471000	0.05019	ATG	C|1.000;|0.000		0.657	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
CHRNA10	57053	hgsc.bcm.edu	37	11	3688801	3688801	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr11:3688801G>A	ENST00000250699.2	-	4	627	c.556C>T	c.(556-558)Ccg>Tcg	p.P186S	Y_RNA_ENST00000363331.1_RNA|CHRNA10_ENST00000534359.1_Silent_p.G3G|CHRNA10_ENST00000493827.2_5'Flank	NM_020402.2	NP_065135.2	Q9GZZ6	ACH10_HUMAN	cholinergic receptor, nicotinic, alpha 10 (neuronal)	186					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|inner ear morphogenesis (GO:0042472)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of cell proliferation (GO:0042127)|synaptic transmission, cholinergic (GO:0007271)	axon (GO:0030424)|cell junction (GO:0030054)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perikaryon (GO:0043204)|postsynaptic membrane (GO:0045211)	acetylcholine-activated cation-selective channel activity (GO:0004889)|calcium channel activity (GO:0005262)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|lung(3)|ovary(1)	7		Medulloblastoma(188;0.0075)|Breast(177;0.0164)|all_neural(188;0.0577)		BRCA - Breast invasive adenocarcinoma(625;0.0344)|LUSC - Lung squamous cell carcinoma(625;0.192)	Chloroprocaine(DB01161)|Galantamine(DB00674)|Methadone(DB00333)|Nicotine(DB00184)|Pentolinium(DB01090)|Succinylcholine(DB00202)|Trimethaphan(DB01116)	GCGCCGCGCGGCCGCACATCC	0.716																																					p.P186S	Melanoma(153;17 1869 2949 7120 36888)	.											.	CHRNA10-91	0			c.C556T						.						8.0	7.0	7.0					11																	3688801		2041	4023	6064	SO:0001583	missense	57053	exon4			CGCGCGGCCGCAC	AF199235	CCDS7745.1	11p15.5	2012-02-11	2012-02-07		ENSG00000129749	ENSG00000129749		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	13800	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 10 (neuronal)"""	606372	"""cholinergic receptor, nicotinic, alpha polypeptide 10"""				Standard	NM_020402		Approved		uc001lyf.3	Q9GZZ6	OTTHUMG00000011844	ENST00000250699.2:c.556C>T	11.37:g.3688801G>A	ENSP00000250699:p.Pro186Ser	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	11	5	NM_020402	0	0	0	0	0		Missense_Mutation	SNP	ENST00000250699.2	37	CCDS7745.1	.	.	.	.	.	.	.	.	.	.	G	3.708	-0.060207	0.07317	.	.	ENSG00000129749	ENST00000250699	T	0.78481	-1.18	4.68	1.62	0.23740	Neurotransmitter-gated ion-channel ligand-binding (3);	0.508000	0.18124	N	0.150967	T	0.63628	0.2527	N	0.25992	0.78	0.36726	D	0.881466	B	0.15930	0.015	B	0.17979	0.02	T	0.57545	-0.7793	10	0.42905	T	0.14	.	9.3311	0.38023	0.0:0.1404:0.569:0.2906	.	186	Q9GZZ6	ACH10_HUMAN	S	186	ENSP00000250699:P186S	ENSP00000250699:P186S	P	-	1	0	CHRNA10	3645377	0.001000	0.12720	0.892000	0.35008	0.986000	0.74619	0.232000	0.17891	0.159000	0.19401	0.462000	0.41574	CCG	.		0.716	CHRNA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032763.2		
DGKZ	8525	hgsc.bcm.edu	37	11	46387868	46387868	+	Missense_Mutation	SNP	A	A	G	rs1317826	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr11:46387868A>G	ENST00000454345.1	+	2	187	c.62A>G	c.(61-63)cAg>cGg	p.Q21R	DGKZ_ENST00000525434.1_3'UTR|DGKZ_ENST00000527911.1_Intron|DGKZ_ENST00000395574.3_Intron|DGKZ_ENST00000543978.1_Intron|DGKZ_ENST00000421244.2_Intron|DGKZ_ENST00000528615.1_Intron|DGKZ_ENST00000456247.2_Intron|DGKZ_ENST00000318201.8_Intron|DGKZ_ENST00000343674.6_Intron|DGKZ_ENST00000532868.2_Intron	NM_001105540.1	NP_001099010.1	Q13574	DGKZ_HUMAN	diacylglycerol kinase, zeta	21			Q -> R (in dbSNP:rs1317826). {ECO:0000269|PubMed:9159104}.		blood coagulation (GO:0007596)|cell migration (GO:0016477)|intracellular signal transduction (GO:0035556)|lipid phosphorylation (GO:0046834)|mitotic G1 DNA damage checkpoint (GO:0031571)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of Ras protein signal transduction (GO:0046580)|phosphorylation (GO:0016310)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|enzyme inhibitor activity (GO:0004857)|lipid kinase activity (GO:0001727)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|protein C-terminus binding (GO:0008022)			central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(12)|pancreas(1)|prostate(1)|skin(1)	25				GBM - Glioblastoma multiforme(35;0.0259)|Lung(87;0.141)		GAGGGGCAGCAGCGGCCCAGC	0.701													G|||	2181	0.435503	0.9107	0.2493	5008	,	,		13838	0.1458		0.3111	False		,,,				2504	0.3517				p.Q21R		.											.	DGKZ-676	0			c.A62G						.	G	ARG/GLN,,,,,,	2682,930		1027,628,151	8.0	9.0	9.0		62,,,,,,	4.5	1.0	11	dbSNP_88	9	2229,5713		386,1457,2128	yes	missense,intron,intron,intron,intron,intron,intron	DGKZ	NM_001105540.1,NM_001199266.1,NM_001199267.1,NM_001199268.1,NM_003646.3,NM_201532.2,NM_201533.3	43,,,,,,	1413,2085,2279	GG,GA,AA		28.066,25.7475,42.5048	benign,,,,,,	21/1118,,,,,,	46387868	4911,6643	1806	3971	5777	SO:0001583	missense	8525	exon2			GGCAGCAGCGGCC	U51477	CCDS7918.1, CCDS41640.1, CCDS44579.1, CCDS44580.1, CCDS55757.1, CCDS55758.1, CCDS55759.1, CCDS44579.2	11p11.2	2010-11-24	2010-11-24		ENSG00000149091	ENSG00000149091	2.7.1.107		2857	protein-coding gene	gene with protein product		601441	"""diacylglycerol kinase, zeta 104kDa"""			8626588	Standard	NM_003646		Approved	DAGK5, hDGKzeta, DGK-ZETA, DAGK6	uc001ncn.1	Q13574	OTTHUMG00000166437	ENST00000454345.1:c.62A>G	11.37:g.46387868A>G	ENSP00000412178:p.Gln21Arg	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	2	2	NM_001105540	0	0	0	0	0	B7Z2M9|B7Z6M3|E9PPW4|F6UCU9|G3V0F6|J3KNJ6|O00542|Q6ZVG7|Q8IVW9	Missense_Mutation	SNP	ENST00000454345.1	37	CCDS41640.1	872	0.3992673992673993	446	0.9065040650406504	95	0.26243093922651933	97	0.16958041958041958	234	0.3087071240105541	G	2.360	-0.346808	0.05208	0.742525	0.28066	ENSG00000149091	ENST00000454345	T	0.64260	-0.09	4.53	4.53	0.55603	.	0.291635	0.22594	N	0.058046	T	0.00012	0.0000	N	0.02916	-0.46	0.09310	P	1.0	B	0.02656	0.0	B	0.01281	0.0	T	0.40961	-0.9535	9	0.02654	T	1	.	13.0604	0.59003	0.0784:0.0:0.9216:0.0	rs1317826	21	Q13574	DGKZ_HUMAN	R	21	ENSP00000412178:Q21R	ENSP00000412178:Q21R	Q	+	2	0	DGKZ	46344444	1.000000	0.71417	0.991000	0.47740	0.097000	0.18754	3.832000	0.55783	1.049000	0.40321	-0.213000	0.12676	CAG	A|0.608;G|0.392		0.701	DGKZ-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000389772.1	NM_001105540	
FOLH1	2346	bcgsc.ca	37	11	49197416	49197416	+	Silent	SNP	A	A	G	rs144950409	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr11:49197416A>G	ENST00000256999.2	-	8	1274	c.1014T>C	c.(1012-1014)tcT>tcC	p.S338S	FOLH1_ENST00000343844.4_Silent_p.S30S|FOLH1_ENST00000533034.1_Silent_p.S323S|FOLH1_ENST00000525629.1_5'UTR|FOLH1_ENST00000356696.3_Silent_p.S338S|FOLH1_ENST00000340334.7_Silent_p.S323S	NM_004476.1	NP_004467.1	Q04609	FOLH1_HUMAN	folate hydrolase (prostate-specific membrane antigen) 1	338	NAALADase.				folic acid-containing compound metabolic process (GO:0006760)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(34)|ovary(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	60					Capromab(DB00089)	TTAACTGTGTAGAAAAGTTTC	0.363													A|||	705	0.140775	0.0477	0.1441	5008	,	,		16671	0.1548		0.0895	False		,,,				2504	0.3027				p.S338S		.											.	FOLH1-579	0			c.T1014C						.	A	,,,,	214,4188	131.0+/-167.6	5,204,1992	71.0	71.0	71.0		1014,969,969,90,1014	2.0	1.0	11	dbSNP_134	71	781,7815	183.6+/-231.8	38,705,3555	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	FOLH1	NM_001014986.1,NM_001193471.1,NM_001193472.1,NM_001193473.1,NM_004476.1	,,,,	43,909,5547	GG,GA,AA		9.0856,4.8614,7.655	,,,,	338/720,323/736,323/705,30/443,338/751	49197416	995,12003	2201	4298	6499	SO:0001819	synonymous_variant	2346	exon8			CTGTGTAGAAAAG	M99487	CCDS7946.1, CCDS31493.1, CCDS53626.1, CCDS53627.1, CCDS53628.1	11p11.2	2011-07-22			ENSG00000086205	ENSG00000086205	3.4.17.21		3788	protein-coding gene	gene with protein product	"""glutamate carboxylase II"", ""glutamate carboxypeptidase II"""	600934		FOLH		9838072	Standard	NM_001193472		Approved	PSM, PSMA, NAALAD1, NAALAdase, GCP2, GCPII	uc001ngy.3	Q04609	OTTHUMG00000166625	ENST00000256999.2:c.1014T>C	11.37:g.49197416A>G		Somatic	63	0		WXS	Illumina GAIIx	Phase_I	54	5	NM_004476	0	0	0	0	0	A4UU12|A9CB79|B7Z312|B7Z343|D3DQS5|E9PDX8|O43748|Q16305|Q541A4|Q8TAY3|Q9NP15|Q9NYE2|Q9P1P8	Silent	SNP	ENST00000256999.2	37	CCDS7946.1																																																																																			A|0.914;G|0.086		0.363	FOLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390896.1	NM_004476	
PATL1	219988	hgsc.bcm.edu;bcgsc.ca	37	11	59406653	59406653	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr11:59406653A>G	ENST00000300146.9	-	18	2243	c.2159T>C	c.(2158-2160)aTg>aCg	p.M720T	AP000442.1_ENST00000531311.1_RNA|AP000442.1_ENST00000531108.1_RNA	NM_152716.2	NP_689929.2	Q86TB9	PATL1_HUMAN	protein associated with topoisomerase II homolog 1 (yeast)	720	Involved in nuclear spleckles localization.|Region C.				cytoplasmic mRNA processing body assembly (GO:0033962)|deadenylation-dependent decapping of nuclear-transcribed mRNA (GO:0000290)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(2)|lung(5)|ovary(1)|prostate(2)	11						TCGTGTTGCCATGAACATCAC	0.433																																					p.M720T		.											.	PATL1-1	0			c.T2159C						.						77.0	74.0	75.0					11																	59406653		1908	4118	6026	SO:0001583	missense	219988	exon18			GTTGCCATGAACA	AK094193	CCDS44613.1	11q12.1	2012-06-07	2007-10-18		ENSG00000166889	ENSG00000166889			26721	protein-coding gene	gene with protein product		614660				17936923	Standard	NM_152716		Approved	FLJ36874, Pat1b	uc001noe.4	Q86TB9	OTTHUMG00000167423	ENST00000300146.9:c.2159T>C	11.37:g.59406653A>G	ENSP00000300146:p.Met720Thr	Somatic	68	0		WXS	Illumina GAIIx	Phase_I	67	4	NM_152716	0	0	7	7	0	B3KXT9|Q2TA86|Q6P166|Q8N9M6|Q8NI63	Missense_Mutation	SNP	ENST00000300146.9	37	CCDS44613.1	.	.	.	.	.	.	.	.	.	.	A	7.392	0.630882	0.14322	.	.	ENSG00000166889	ENST00000300146;ENST00000428532	T	0.41758	0.99	5.91	4.79	0.61399	.	0.326071	0.40222	N	0.001144	T	0.22044	0.0531	N	0.08118	0	0.34183	D	0.671138	B	0.15719	0.014	B	0.30029	0.11	T	0.26121	-1.0112	10	0.14252	T	0.57	-3.2284	6.8736	0.24135	0.7957:0.0:0.0709:0.1334	.	720	Q86TB9	PATL1_HUMAN	T	720;653	ENSP00000300146:M720T	ENSP00000300146:M720T	M	-	2	0	PATL1	59163229	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.429000	0.44758	1.070000	0.40811	0.533000	0.62120	ATG	.		0.433	PATL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394559.1	NM_152716	
KAT5	10524	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	65479768	65479768	+	Intron	SNP	G	G	A			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr11:65479768G>A	ENST00000377046.3	+	1	284				KAT5_ENST00000341318.4_Silent_p.G10G|KAT5_ENST00000352980.4_Intron|KAT5_ENST00000534650.1_5'Flank|KAT5_ENST00000530446.1_Silent_p.G10G	NM_006388.3	NP_006379.2	Q92993	KAT5_HUMAN	K(lysine) acetyltransferase 5						androgen receptor signaling pathway (GO:0030521)|cellular response to estradiol stimulus (GO:0071392)|chromatin organization (GO:0006325)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|double-strand break repair (GO:0006302)|histone acetylation (GO:0016573)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of growth (GO:0040008)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytosol (GO:0005829)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Piccolo NuA4 histone acetyltransferase complex (GO:0032777)|Swr1 complex (GO:0000812)|transcription factor complex (GO:0005667)	androgen receptor binding (GO:0050681)|histone acetyltransferase activity (GO:0004402)|metal ion binding (GO:0046872)|repressing transcription factor binding (GO:0070491)|transcription coactivator activity (GO:0003713)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(9)	21						CGGTGCCCGGGGCGGGGCGGA	0.721																																					p.G10G		.											.	KAT5-90	0			c.G30A						.						11.0	13.0	12.0					11																	65479768		2120	4181	6301	SO:0001627	intron_variant	10524	exon1			GCCCGGGGCGGGG	U74667	CCDS8109.1, CCDS8110.1, CCDS31610.1, CCDS55771.1	11q13	2013-01-10	2008-07-04	2008-07-04	ENSG00000172977	ENSG00000172977		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"""	5275	protein-coding gene	gene with protein product	"""Tat interacting protein, 60kDa"", ""K-acetyltransferase 5"""	601409	"""HIV-1 Tat interactive protein, 60kDa"""	HTATIP		8607265	Standard	NM_006388		Approved	TIP60, PLIP, cPLA2, HTATIP1, ESA1, ZC2HC5	uc001ofk.3	Q92993	OTTHUMG00000166617	ENST00000377046.3:c.12+18G>A	11.37:g.65479768G>A		Somatic	28	0		WXS	Illumina GAIIx	Phase_I	82	32	NM_182710	0	0	1	2	1	B4E3C7|C9JL99|O95624|Q13430|Q17RW5|Q561W3|Q6GSE8|Q9BWK7	Silent	SNP	ENST00000377046.3	37	CCDS31610.1																																																																																			.		0.721	KAT5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390866.2	NM_006388	
CHRDL2	25884	bcgsc.ca	37	11	74413872	74413872	+	Silent	SNP	A	A	G	rs34528207	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr11:74413872A>G	ENST00000376332.3	-	9	1583	c.1087T>C	c.(1087-1089)Ttg>Ctg	p.L363L	CHRDL2_ENST00000534159.1_5'UTR|CHRDL2_ENST00000263671.5_Silent_p.L363L	NM_001278473.1	NP_001265402.1	Q6WN34	CRDL2_HUMAN	chordin-like 2	363					cartilage development (GO:0051216)|cell differentiation (GO:0030154)|ossification (GO:0001503)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)				endometrium(1)|kidney(1)|large_intestine(6)|lung(4)|prostate(1)|skin(2)	15	Hepatocellular(1;0.098)					ATCTCCACCAAGTCCGAGGCC	0.642											OREG0021223	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	1465	0.292532	0.3835	0.1268	5008	,	,		16956	0.3264		0.1332	False		,,,				2504	0.4162				p.L363L		.											.	CHRDL2-90	0			c.T1087C						.	G		1425,2975	683.6+/-404.3	225,975,1000	112.0	109.0	110.0		1087	3.1	1.0	11	dbSNP_126	110	1180,7406	764.1+/-407.6	70,1040,3183	no	coding-synonymous	CHRDL2	NM_015424.3		295,2015,4183	GG,GA,AA		13.7433,32.3864,20.0601		363/452	74413872	2605,10381	2200	4293	6493	SO:0001819	synonymous_variant	25884	exon9			CCACCAAGTCCGA	AL110168	CCDS8234.1, CCDS60893.1	11q13.4	2013-09-20			ENSG00000054938	ENSG00000054938			24168	protein-coding gene	gene with protein product		613127				12853144, 12975309	Standard	NM_015424		Approved	BNF1	uc001ovh.3	Q6WN34	OTTHUMG00000165623	ENST00000376332.3:c.1087T>C	11.37:g.74413872A>G		Somatic	83	0	1152	WXS	Illumina GAIIx	Phase_I	123	6	NM_015424	0	0	0	0	0	A5PKU9|Q6WN30|Q6WN31|Q6WN32|Q7Z5J3	Silent	SNP	ENST00000376332.3	37																																																																																				A|0.791;G|0.209		0.642	CHRDL2-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000385391.1		
CNTN5	53942	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	99942557	99942557	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr11:99942557A>C	ENST00000524871.1	+	12	1710	c.1420A>C	c.(1420-1422)Aag>Cag	p.K474Q	CNTN5_ENST00000279463.3_Missense_Mutation_p.K474Q|CNTN5_ENST00000527185.1_Missense_Mutation_p.K474Q|CNTN5_ENST00000418526.2_Missense_Mutation_p.K400Q|CNTN5_ENST00000528682.1_Missense_Mutation_p.K474Q	NM_014361.3	NP_055176.1	O94779	CNTN5_HUMAN	contactin 5	474	Ig-like C2-type 4.				cell adhesion (GO:0007155)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(12)|lung(38)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	81		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		TGCTGAGCTGAAGATTCTAGG	0.348																																					p.K474Q		.											.	CNTN5-366	0			c.A1420C						.						102.0	95.0	97.0					11																	99942557		1855	4117	5972	SO:0001583	missense	53942	exon11			GAGCTGAAGATTC	AB013802	CCDS53696.1, CCDS53697.1, CCDS58168.1	11q22.1	2013-02-11			ENSG00000149972	ENSG00000149972		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2175	protein-coding gene	gene with protein product		607219					Standard	NM_014361		Approved	NB-2, hNB-2	uc021qpb.1	O94779	OTTHUMG00000167579	ENST00000524871.1:c.1420A>C	11.37:g.99942557A>C	ENSP00000435637:p.Lys474Gln	Somatic	75	0		WXS	Illumina GAIIx	Phase_I	74	20	NM_001243270	0	0	0	0	0	A1L4P0|B7ZM07|E9PKE8|O94780|Q49AF3	Missense_Mutation	SNP	ENST00000524871.1	37	CCDS53696.1	.	.	.	.	.	.	.	.	.	.	A	18.73	3.687224	0.68157	.	.	ENSG00000149972	ENST00000527185;ENST00000528682;ENST00000524871;ENST00000418526;ENST00000279463	T;T;T;T;T	0.67171	-0.25;-0.25;-0.25;-0.25;-0.25	5.48	5.48	0.80851	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.090742	0.85682	D	0.000000	T	0.65291	0.2677	L	0.27944	0.81	0.58432	D	0.999994	B;B;B	0.27450	0.179;0.089;0.179	B;B;B	0.42692	0.395;0.223;0.395	T	0.67284	-0.5709	10	0.62326	D	0.03	.	14.7595	0.69596	1.0:0.0:0.0:0.0	.	474;400;474	E9PKE8;O94779-2;O94779	.;.;CNTN5_HUMAN	Q	474;474;474;400;474	ENSP00000433575:K474Q;ENSP00000436185:K474Q;ENSP00000435637:K474Q;ENSP00000393229:K400Q;ENSP00000279463:K474Q	ENSP00000279463:K474Q	K	+	1	0	CNTN5	99447767	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.040000	0.76551	2.081000	0.62600	0.533000	0.62120	AAG	.		0.348	CNTN5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395148.2	NM_014361	
TULP3	7289	bcgsc.ca	37	12	3046802	3046802	+	Silent	SNP	A	A	G	rs33973716	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr12:3046802A>G	ENST00000448120.2	+	9	981	c.930A>G	c.(928-930)acA>acG	p.T310T	TULP3_ENST00000397132.2_Silent_p.T310T	NM_003324.4	NP_003315.2	O75386	TULP3_HUMAN	tubby like protein 3	310					anterior/posterior pattern specification (GO:0009952)|bone development (GO:0060348)|brain development (GO:0007420)|bronchus morphogenesis (GO:0060434)|central nervous system neuron differentiation (GO:0021953)|embryonic camera-type eye development (GO:0031076)|embryonic digit morphogenesis (GO:0042733)|embryonic neurocranium morphogenesis (GO:0048702)|G-protein coupled receptor signaling pathway (GO:0007186)|ganglion development (GO:0061548)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|negative regulation of smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021914)|neural tube closure (GO:0001843)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of transcription, DNA-templated (GO:0006355)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	axoneme (GO:0005930)|ciliary base (GO:0097546)|cilium (GO:0005929)|extracellular region (GO:0005576)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	enzyme binding (GO:0019899)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein complex binding (GO:0032403)			endometrium(1)|large_intestine(4)|lung(13)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22			OV - Ovarian serous cystadenocarcinoma(31;0.000818)			TCCAGGAAACAAACGTACTTG	0.378													a|||	1108	0.221246	0.2163	0.1801	5008	,	,		18091	0.2083		0.2048	False		,,,				2504	0.2873				p.T310T		.											.	TULP3-226	0			c.A930G						.		,	899,3505	341.8+/-306.9	91,717,1394	48.0	44.0	45.0		930,930	-1.2	1.0	12	dbSNP_126	45	1784,6816	319.9+/-314.4	168,1448,2684	no	coding-synonymous,coding-synonymous	TULP3	NM_001160408.1,NM_003324.4	,	259,2165,4078	GG,GA,AA		20.7442,20.4133,20.6321	,	310/502,310/443	3046802	2683,10321	2202	4300	6502	SO:0001819	synonymous_variant	7289	exon9			GGAAACAAACGTA	AF045583	CCDS8519.1, CCDS53737.1	12p13	2014-02-21			ENSG00000078246	ENSG00000078246		"""Intraflagellar transport homologs"""	12425	protein-coding gene	gene with protein product		604730				9828123	Standard	NM_003324		Approved	TUBL3	uc001qlj.2	O75386	OTTHUMG00000168152	ENST00000448120.2:c.930A>G	12.37:g.3046802A>G		Somatic	219	1		WXS	Illumina GAIIx	Phase_I	257	8	NM_003324	0	0	0	0	0	B3KNB7|B7Z6A2|D3DUQ4|F8WBZ9|Q8N5B0	Silent	SNP	ENST00000448120.2	37	CCDS8519.1																																																																																			A|0.796;G|0.204		0.378	TULP3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000398468.1	NM_003324	
IAPP	3375	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	21526316	21526316	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr12:21526316A>C	ENST00000240652.3	+	2	167	c.31A>C	c.(31-33)Att>Ctt	p.I11L	SLCO1A2_ENST00000307378.6_Intron|IAPP_ENST00000542023.1_Missense_Mutation_p.I11L|IAPP_ENST00000539393.1_Missense_Mutation_p.I11L|SLCO1A2_ENST00000537524.1_Intron|SLCO1A2_ENST00000473830.1_Intron	NM_000415.2	NP_000406.1	P10997	IAPP_HUMAN	islet amyloid polypeptide	11					apoptotic process (GO:0006915)|cell-cell signaling (GO:0007267)|eating behavior (GO:0042755)|endocrine pancreas development (GO:0031018)|negative regulation of bone resorption (GO:0045779)|negative regulation of cell differentiation (GO:0045596)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)	identical protein binding (GO:0042802)|receptor binding (GO:0005102)			lung(3)	3						AGTATTTCTCATTGTGCTCTC	0.358																																					p.I11L		.											.	IAPP-90	0			c.A31C						.						150.0	140.0	143.0					12																	21526316		2203	4300	6503	SO:0001583	missense	3375	exon2			TTTCTCATTGTGC		CCDS8688.1	12p12.1	2013-02-25			ENSG00000121351	ENSG00000121351		"""Endogenous ligands"""	5329	protein-coding gene	gene with protein product	"""amylin"""	147940					Standard	NM_000415		Approved	AMYLIN, DAP, IAP	uc001rev.3	P10997	OTTHUMG00000169128	ENST00000240652.3:c.31A>C	12.37:g.21526316A>C	ENSP00000240652:p.Ile11Leu	Somatic	56	0		WXS	Illumina GAIIx	Phase_I	77	10	NM_000415	0	0	0	0	0	Q0ZD87|Q14598	Missense_Mutation	SNP	ENST00000240652.3	37	CCDS8688.1	.	.	.	.	.	.	.	.	.	.	A	0.415	-0.911025	0.02434	.	.	ENSG00000121351	ENST00000539393;ENST00000240652;ENST00000542023;ENST00000537593	T;T;T	0.76186	-0.99;-0.99;-1.0	5.77	-1.99	0.07457	.	0.724312	0.13182	N	0.407402	T	0.52500	0.1738	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.32640	-0.9899	9	0.19147	T	0.46	-0.6687	8.3358	0.32213	0.3841:0.4757:0.1401:0.0	.	11	P10997	IAPP_HUMAN	L	11	ENSP00000437357:I11L;ENSP00000240652:I11L;ENSP00000445980:I11L	ENSP00000240652:I11L	I	+	1	0	IAPP	21417583	0.473000	0.25878	0.000000	0.03702	0.015000	0.08874	0.532000	0.23067	-0.336000	0.08438	-0.313000	0.08912	ATT	.		0.358	IAPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402356.1	NM_000415	
TUBA1C	84790	ucsc.edu	37	12	49666152	49666152	+	Silent	SNP	G	G	A	rs199599214	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr12:49666152G>A	ENST00000301072.6	+	4	767	c.492G>A	c.(490-492)aaG>aaA	p.K164K	RP11-161H23.5_ENST00000550468.2_RNA|TUBA1C_ENST00000541364.1_Silent_p.K234K	NM_032704.3	NP_116093.1	Q9BQE3	TBA1C_HUMAN	tubulin, alpha 1c	164					'de novo' posttranslational protein folding (GO:0051084)|cell division (GO:0051301)|cellular protein metabolic process (GO:0044267)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasmic microtubule (GO:0005881)|microtubule (GO:0005874)|nucleus (GO:0005634)|vesicle (GO:0031982)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.K164K(1)		endometrium(1)|large_intestine(3)|liver(1)|lung(7)|skin(1)	13						ATGGCAAGAAGTCCAAGCTGG	0.547																																					p.K164K		.											.	TUBA1C-90	1	Substitution - coding silent(1)	large_intestine(1)	c.G492A						.						56.0	58.0	57.0					12																	49666152		2203	4300	6503	SO:0001819	synonymous_variant	84790	exon4			CAAGAAGTCCAAG	BC004949	CCDS8782.1	12q13.12	2007-03-16	2007-02-12	2007-02-12		ENSG00000167553		"""Tubulins"""	20768	protein-coding gene	gene with protein product			"""tubulin, alpha 6"""	TUBA6		7821789	Standard	NM_032704		Approved	MGC14580, MGC10851, bcm948	uc001rtt.1	Q9BQE3		ENST00000301072.6:c.492G>A	12.37:g.49666152G>A		Somatic	252	9		WXS	Illumina GAIIx	Phase_I	277	13	NM_032704	0	0	257	367	110		Silent	SNP	ENST00000301072.6	37	CCDS8782.1																																																																																			G|0.998;A|0.002		0.547	TUBA1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404424.1	NM_032704	
SCN8A	6334	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	52159524	52159524	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr12:52159524G>T	ENST00000354534.6	+	16	2792	c.2614G>T	c.(2614-2616)Gtg>Ttg	p.V872L	SCN8A_ENST00000545061.1_Missense_Mutation_p.V872L|SCN8A_ENST00000550891.1_Missense_Mutation_p.V872L	NM_001177984.2|NM_014191.3	NP_001171455.1|NP_055006.1	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha subunit	872					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|membrane depolarization during action potential (GO:0086010)|muscle organ development (GO:0007517)|myelination (GO:0042552)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|neuronal action potential (GO:0019228)|peripheral nervous system development (GO:0007422)|response to toxic substance (GO:0009636)|sensory perception of sound (GO:0007605)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	ATP binding (GO:0005524)|voltage-gated sodium channel activity (GO:0005248)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55				BRCA - Breast invasive adenocarcinoma(357;0.181)	Valproic Acid(DB00313)	TGGAAATTCAGTGGGTGCCCT	0.443																																					p.V872L		.											.	SCN8A-29	0			c.G2614T						.						59.0	62.0	61.0					12																	52159524		2079	4262	6341	SO:0001583	missense	6334	exon16			AATTCAGTGGGTG	AB027567	CCDS44891.1, CCDS53794.1	12q13.1	2012-02-26	2007-01-23			ENSG00000196876		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10596	protein-coding gene	gene with protein product		600702	"""sodium channel, voltage gated, type VIII, alpha polypeptide"""	MED		7670495, 9828131, 16382098	Standard	NM_014191		Approved	Nav1.6, NaCh6, PN4, CerIII	uc001ryw.4	Q9UQD0		ENST00000354534.6:c.2614G>T	12.37:g.52159524G>T	ENSP00000346534:p.Val872Leu	Somatic	60	0		WXS	Illumina GAIIx	Phase_I	91	18	NM_014191	0	0	0	0	0	B9VWG8|O95788|Q9NYX2|Q9UPB2	Missense_Mutation	SNP	ENST00000354534.6	37	CCDS44891.1	.	.	.	.	.	.	.	.	.	.	G	28.5	4.927062	0.92389	.	.	ENSG00000196876	ENST00000550891;ENST00000354534;ENST00000545061;ENST00000355133;ENST00000357961	D;D;D;D	0.98437	-4.93;-4.93;-4.93;-4.93	4.45	4.45	0.53987	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.96972	0.9011	N	0.05124	-0.11	0.80722	D	1	P;P;D	0.65815	0.905;0.902;0.995	P;D;D	0.67382	0.517;0.927;0.951	D	0.97938	1.0324	10	0.54805	T	0.06	.	18.4112	0.90552	0.0:0.0:1.0:0.0	.	872;872;872	F8VWM7;F8VRN5;Q9UQD0	.;.;SCN8A_HUMAN	L	872;872;872;872;785	ENSP00000448415:V872L;ENSP00000346534:V872L;ENSP00000440360:V872L;ENSP00000347255:V872L	ENSP00000346534:V872L	V	+	1	0	SCN8A	50445791	1.000000	0.71417	0.999000	0.59377	0.985000	0.73830	9.657000	0.98554	2.763000	0.94921	0.563000	0.77884	GTG	.		0.443	SCN8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404372.3	NM_014191	
PDE1B	5153	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	54967209	54967209	+	Silent	SNP	T	T	C			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr12:54967209T>C	ENST00000243052.3	+	9	1343	c.907T>C	c.(907-909)Ttg>Ctg	p.L303L	PDE1B_ENST00000550620.1_Silent_p.L283L|PDE1B_ENST00000538346.1_Silent_p.L262L|PDE1B_ENST00000394277.3_3'UTR	NM_000924.3	NP_000915.1	Q01064	PDE1B_HUMAN	phosphodiesterase 1B, calmodulin-dependent	303	Catalytic. {ECO:0000250}.				activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cGMP catabolic process (GO:0046069)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|monocyte differentiation (GO:0030224)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of dopamine metabolic process (GO:0042053)|regulation of neurotransmitter levels (GO:0001505)|response to amphetamine (GO:0001975)|serotonin metabolic process (GO:0042428)|signal transduction (GO:0007165)|visual learning (GO:0008542)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|calcium- and calmodulin-regulated 3',5'-cyclic-GMP phosphodiesterase activity (GO:0048101)|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)			endometrium(1)|kidney(3)|large_intestine(4)|lung(16)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(4)	31					Bepridil(DB01244)|Caffeine(DB00201)|Felodipine(DB01023)|Nicardipine(DB00622)	TGTTTTCCGATTGATGCAGGA	0.468																																					p.L303L		.											.	PDE1B-92	0			c.T907C						.						154.0	135.0	141.0					12																	54967209		2203	4300	6503	SO:0001819	synonymous_variant	5153	exon9			TTCCGATTGATGC	U56976	CCDS8882.1, CCDS53800.1, CCDS73477.1	12q13	2008-03-18				ENSG00000123360	3.1.4.17	"""Phosphodiesterases"""	8775	protein-coding gene	gene with protein product		171891		PDES1B		8855339, 9419816	Standard	NM_000924		Approved		uc001sgd.2	Q01064	OTTHUMG00000169844	ENST00000243052.3:c.907T>C	12.37:g.54967209T>C		Somatic	191	0		WXS	Illumina GAIIx	Phase_I	328	65	NM_000924	0	0	3	3	0	Q92825|Q96KP3	Silent	SNP	ENST00000243052.3	37	CCDS8882.1																																																																																			.		0.468	PDE1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406203.1		
METTL7B	196410	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	56075903	56075903	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr12:56075903T>A	ENST00000394252.3	+	1	574	c.365T>A	c.(364-366)tTt>tAt	p.F122Y		NM_152637.2	NP_689850.2	Q6UX53	MET7B_HUMAN	methyltransferase like 7B	122							methyltransferase activity (GO:0008168)			kidney(1)|large_intestine(1)|lung(4)	6						TATGAGCGGTTTGTGGTGGCT	0.572																																					p.F122Y		.											.	METTL7B-514	0			c.T365A						.						91.0	80.0	84.0					12																	56075903		2203	4300	6503	SO:0001583	missense	196410	exon1			AGCGGTTTGTGGT		CCDS8887.2	12q13.2	2012-06-12			ENSG00000170439	ENSG00000170439			28276	protein-coding gene	gene with protein product	"""associated with lipid droplets 1"""					17004324	Standard	NM_152637		Approved	MGC17301, ALDI	uc010spr.2	Q6UX53	OTTHUMG00000152665	ENST00000394252.3:c.365T>A	12.37:g.56075903T>A	ENSP00000377796:p.Phe122Tyr	Somatic	59	0		WXS	Illumina GAIIx	Phase_I	108	12	NM_152637	0	0	1	1	0	A8K247|Q8WUI1	Missense_Mutation	SNP	ENST00000394252.3	37	CCDS8887.2	.	.	.	.	.	.	.	.	.	.	T	18.48	3.634033	0.67130	.	.	ENSG00000170439	ENST00000394252	T	0.10960	2.82	4.96	4.96	0.65561	Methyltransferase type 11 (1);	0.053059	0.85682	D	0.000000	T	0.19685	0.0473	L	0.42744	1.35	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.04216	-1.0968	10	0.02654	T	1	-0.1374	12.6648	0.56835	0.0:0.0:0.0:1.0	.	122	Q6UX53	MET7B_HUMAN	Y	122	ENSP00000377796:F122Y	ENSP00000377796:F122Y	F	+	2	0	METTL7B	54362170	1.000000	0.71417	0.986000	0.45419	0.178000	0.23041	5.343000	0.65976	2.076000	0.62316	0.533000	0.62120	TTT	.		0.572	METTL7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327271.1	NM_152637	
OTOGL	283310	hgsc.bcm.edu;bcgsc.ca	37	12	80648862	80648862	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr12:80648862A>G	ENST00000547103.1	+	15	1463	c.1457A>G	c.(1456-1458)gAt>gGt	p.D486G	OTOGL_ENST00000458043.2_Missense_Mutation_p.D486G			Q3ZCN5	OTOGL_HUMAN	otogelin-like	486	VWFD 2. {ECO:0000255|PROSITE- ProRule:PRU00580}.				L-arabinose metabolic process (GO:0046373)	extracellular region (GO:0005576)	alpha-L-arabinofuranosidase activity (GO:0046556)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(14)|prostate(1)	23						ACAACTTTTGATGGTCGACAT	0.373																																					p.D486G		.											.	.	0			c.A1457G						.						95.0	78.0	83.0					12																	80648862		1803	4030	5833	SO:0001583	missense	283310	exon15			CTTTTGATGGTCG	AK096852		12q21.31	2011-02-11	2011-02-11	2011-02-11	ENSG00000165899	ENSG00000165899			26901	protein-coding gene	gene with protein product		614925	"""chromosome 12 open reading frame 64"""	C12orf64			Standard	NM_173591		Approved	FLJ90579	uc001szd.3	Q3ZCN5	OTTHUMG00000150509	ENST00000547103.1:c.1457A>G	12.37:g.80648862A>G	ENSP00000447211:p.Asp486Gly	Somatic	44	0		WXS	Illumina GAIIx	Phase_I	71	4	NM_173591	0	0	0	0	0	F8W0C3|Q495U8|Q8N8G5|Q8NC28	Missense_Mutation	SNP	ENST00000547103.1	37		.	.	.	.	.	.	.	.	.	.	A	23.8	4.460881	0.84317	.	.	ENSG00000165899	ENST00000547103;ENST00000458043	T;T	0.78707	-1.2;-1.2	5.37	5.37	0.77165	.	.	.	.	.	D	0.91030	0.7178	H	0.94808	3.585	0.80722	D	1	.	.	.	.	.	.	D	0.93528	0.6867	7	0.87932	D	0	.	15.3632	0.74499	1.0:0.0:0.0:0.0	.	.	.	.	G	486	ENSP00000447211:D486G;ENSP00000400895:D486G	ENSP00000400895:D486G	D	+	2	0	OTOGL	79172993	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.673000	0.91186	2.030000	0.59900	0.528000	0.53228	GAT	.		0.373	OTOGL-001	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000407438.1	NM_173591	
ATP2B1	490	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	90018032	90018032	+	Silent	SNP	A	A	T			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr12:90018032A>T	ENST00000428670.3	-	9	1728	c.1272T>A	c.(1270-1272)gtT>gtA	p.V424V	ATP2B1_ENST00000359142.3_Silent_p.V424V|ATP2B1_ENST00000393164.2_Silent_p.V167V|ATP2B1_ENST00000348959.3_Silent_p.V424V|ATP2B1_ENST00000261173.2_Silent_p.V424V			P20020	AT2B1_HUMAN	ATPase, Ca++ transporting, plasma membrane 1	424					blood coagulation (GO:0007596)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(13)|lung(15)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	45						CTAAAACTGTAACTCCAATAA	0.398																																					p.V424V		.											.	ATP2B1-516	0			c.T1272A						.						84.0	77.0	79.0					12																	90018032		2203	4300	6503	SO:0001819	synonymous_variant	490	exon8			AACTGTAACTCCA	J04027	CCDS9035.1, CCDS41817.1	12q21.33	2010-04-20			ENSG00000070961	ENSG00000070961	3.6.3.8	"""ATPases / P-type"""	814	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 1"""	108731				1674727	Standard	NM_001682		Approved	PMCA1	uc001tbh.3	P20020		ENST00000428670.3:c.1272T>A	12.37:g.90018032A>T		Somatic	183	1		WXS	Illumina GAIIx	Phase_I	286	68	NM_001001323	0	0	0	0	0	Q12992|Q12993|Q13819|Q13820|Q13821|Q16504|Q93082	Silent	SNP	ENST00000428670.3	37	CCDS9035.1																																																																																			.		0.398	ATP2B1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406653.1	NM_001682	
BTBD11	121551	hgsc.bcm.edu	37	12	107713511	107713511	+	Missense_Mutation	SNP	G	G	C	rs961498	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr12:107713511G>C	ENST00000280758.5	+	1	1322	c.794G>C	c.(793-795)gGg>gCg	p.G265A	BTBD11_ENST00000420571.2_Missense_Mutation_p.G265A|BTBD11_ENST00000490090.2_Missense_Mutation_p.G265A	NM_001018072.1	NP_001018082.1	A6QL63	BTBDB_HUMAN	BTB (POZ) domain containing 11	265						integral component of membrane (GO:0016021)				NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(18)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	53						AGTGGCCCTGGGTCAGGCTCG	0.751													G|||	1975	0.394369	0.2194	0.4539	5008	,	,		9398	0.4127		0.492	False		,,,				2504	0.4693				p.G265A		.											.	BTBD11-93	0			c.G794C						.	G	ALA/GLY	786,2720		135,516,1102	5.0	3.0	3.0		794	4.2	0.1	12	dbSNP_86	3	2882,3822		730,1422,1200	no	missense	BTBD11	NM_001018072.1	60	865,1938,2302	CC,CG,GG		42.9893,22.4187,35.9256	benign	265/1105	107713511	3668,6542	1753	3352	5105	SO:0001583	missense	121551	exon1			GCCCTGGGTCAGG	AK091276	CCDS31893.1, CCDS41827.1	12q24.11	2013-10-02			ENSG00000151136	ENSG00000151136		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	23844	protein-coding gene	gene with protein product							Standard	XM_005268645		Approved	FLJ33957, ABTB2B	uc001tmk.1	A6QL63	OTTHUMG00000150413	ENST00000280758.5:c.794G>C	12.37:g.107713511G>C	ENSP00000280758:p.Gly265Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	3	NM_001018072	0	0	0	0	0	A4FU41|B3KXG3|C9J019|C9JK80|E9PHS4|Q3ZTQ4|Q52M89|Q6ZV99|Q8N245	Missense_Mutation	SNP	ENST00000280758.5	37	CCDS31893.1	899	0.4116300366300366	119	0.241869918699187	158	0.43646408839779005	241	0.42132867132867136	381	0.5026385224274407	G	11.75	1.731449	0.30684	0.224187	0.429893	ENSG00000151136	ENST00000280758;ENST00000420571;ENST00000490090	T;T;T	0.33865	1.39;1.48;1.43	4.15	4.15	0.48705	Histone-fold (1);	0.272599	0.26478	N	0.024144	T	0.00012	0.0000	L	0.52905	1.665	0.09310	P	1.0	B;B;B	0.28971	0.229;0.088;0.143	B;B;B	0.29176	0.099;0.017;0.061	T	0.47898	-0.9081	9	0.54805	T	0.06	.	13.8733	0.63634	0.0:0.0:1.0:0.0	rs961498	265;265;265	A6QL63-2;A6QL63;A6QL63-3	.;BTBDB_HUMAN;.	A	265	ENSP00000280758:G265A;ENSP00000413889:G265A;ENSP00000447319:G265A	ENSP00000280758:G265A	G	+	2	0	BTBD11	106237641	0.973000	0.33851	0.080000	0.20451	0.808000	0.45660	2.685000	0.46959	2.308000	0.77769	0.549000	0.68633	GGG	G|0.588;C|0.412		0.751	BTBD11-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318003.1	NM_152322	
PITPNM2	57605	hgsc.bcm.edu	37	12	123470761	123470761	+	Missense_Mutation	SNP	C	C	T	rs368519330		TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr12:123470761C>T	ENST00000542749.1	-	24	3926	c.3863G>A	c.(3862-3864)cGc>cAc	p.R1288H	PITPNM2_ENST00000320201.4_Missense_Mutation_p.R1288H|PITPNM2_ENST00000280562.5_Missense_Mutation_p.R1282H|PITPNM2_ENST00000392428.1_Missense_Mutation_p.R1009H			Q9BZ72	PITM2_HUMAN	phosphatidylinositol transfer protein, membrane-associated 2	1288					metabolic process (GO:0008152)|transport (GO:0006810)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	calcium ion binding (GO:0005509)|lipid binding (GO:0008289)			NS(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	39	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.55e-05)|Epithelial(86;8.43e-05)|BRCA - Breast invasive adenocarcinoma(302;0.123)		GTTCCGGGAGCGCAGAAAGTC	0.736																																					p.R1288H		.											.	PITPNM2-228	0			c.G3863A						.	C	HIS/ARG	0,4212		0,0,2106	6.0	7.0	7.0		3863	4.8	1.0	12		7	5,8249		0,5,4122	no	missense	PITPNM2	NM_020845.2	29	0,5,6228	TT,TC,CC		0.0606,0.0,0.0401	probably-damaging	1288/1350	123470761	5,12461	2106	4127	6233	SO:0001583	missense	57605	exon25			CGGGAGCGCAGAA	AF334585	CCDS9242.1, CCDS73543.1	12q24.31	2008-02-05				ENSG00000090975			21044	protein-coding gene	gene with protein product		608920				10022914	Standard	XM_005253582		Approved	RDGBA2, RDGB2, NIR3	uc001uej.1	Q9BZ72		ENST00000542749.1:c.3863G>A	12.37:g.123470761C>T	ENSP00000437611:p.Arg1288His	Somatic	3	1		WXS	Illumina GAIIx	Phase_I	45	26	NM_020845	0	0	0	0	0	Q9P271	Missense_Mutation	SNP	ENST00000542749.1	37	CCDS9242.1	.	.	.	.	.	.	.	.	.	.	C	33	5.265238	0.95399	0.0	6.06E-4	ENSG00000090975	ENST00000280562;ENST00000320201;ENST00000392428;ENST00000542749	T;T;T;T	0.52983	0.96;0.97;0.64;0.97	4.8	4.8	0.61643	.	0.000000	0.85682	D	0.000000	T	0.70657	0.3249	M	0.79123	2.44	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.996	T	0.74592	-0.3614	10	0.72032	D	0.01	-37.8792	18.4084	0.90542	0.0:1.0:0.0:0.0	.	1282;1288	Q9BZ72-2;Q9BZ72	.;PITM2_HUMAN	H	1282;1288;1009;1288	ENSP00000280562:R1282H;ENSP00000322218:R1288H;ENSP00000376223:R1009H;ENSP00000437611:R1288H	ENSP00000280562:R1282H	R	-	2	0	PITPNM2	122036714	1.000000	0.71417	1.000000	0.80357	0.857000	0.48899	7.556000	0.82233	2.664000	0.90586	0.561000	0.74099	CGC	.		0.736	PITPNM2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401342.1	NM_020845	
C12orf65	91574	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	123741386	123741386	+	Missense_Mutation	SNP	G	G	C	rs573747271	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr12:123741386G>C	ENST00000253233.1	+	3	953	c.309G>C	c.(307-309)caG>caC	p.Q103H	RP11-282O18.3_ENST00000541002.3_RNA|C12orf65_ENST00000366329.2_Missense_Mutation_p.Q103H|RP11-282O18.3_ENST00000542427.2_RNA|RP11-282O18.3_ENST00000543217.2_RNA|RP11-282O18.3_ENST00000544890.1_RNA|C12orf65_ENST00000429587.2_Missense_Mutation_p.Q103H	NM_152269.4	NP_689482.1	Q9H3J6	CL065_HUMAN	chromosome 12 open reading frame 65	103	GGQ domain. {ECO:0000250}.				cell death (GO:0008219)	mitochondrion (GO:0005739)	translation release factor activity (GO:0003747)			endometrium(1)|large_intestine(1)|lung(1)|prostate(1)	4	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000595)|Epithelial(86;0.00199)		CAGTTGATCAGAACAGAAAGC	0.373																																					p.Q103H		.											.	C12orf65-90	0			c.G309C						.						55.0	58.0	57.0					12																	123741386		2203	4300	6503	SO:0001583	missense	91574	exon3			TGATCAGAACAGA	AK095982	CCDS9244.1	12q24.31	2013-01-07			ENSG00000130921	ENSG00000130921			26784	protein-coding gene	gene with protein product		613541				20598281, 22688947, 23188110	Standard	NM_152269		Approved	FLJ38663, SPG55	uc001uen.3	Q9H3J6	OTTHUMG00000168852	ENST00000253233.1:c.309G>C	12.37:g.123741386G>C	ENSP00000253233:p.Gln103His	Somatic	104	0		WXS	Illumina GAIIx	Phase_I	98	10	NM_001194995	1	0	28	32	3	Q8WUC6	Missense_Mutation	SNP	ENST00000253233.1	37	CCDS9244.1	.	.	.	.	.	.	.	.	.	.	G	13.81	2.347438	0.41599	.	.	ENSG00000130921	ENST00000253233;ENST00000366329;ENST00000543139;ENST00000429587	T;T;T;T	0.13089	2.62;2.62;2.62;2.62	5.86	-8.63	0.00878	Peptide chain release factor class I/class II (1);	0.435148	0.27345	N	0.019788	T	0.16811	0.0404	M	0.85197	2.74	0.23773	N	0.996887	B	0.21452	0.056	B	0.24269	0.052	T	0.16630	-1.0396	10	0.87932	D	0	-8.9987	13.744	0.62863	0.237:0.1078:0.6552:0.0	.	103	Q9H3J6	CL065_HUMAN	H	103	ENSP00000253233:Q103H;ENSP00000390647:Q103H;ENSP00000444843:Q103H;ENSP00000391513:Q103H	ENSP00000253233:Q103H	Q	+	3	2	C12orf65	122307339	0.035000	0.19736	0.323000	0.25347	0.988000	0.76386	-0.454000	0.06770	-1.694000	0.01425	-0.313000	0.08912	CAG	.		0.373	C12orf65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401375.1	NM_152269	
POLE	5426	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	133249853	133249853	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr12:133249853G>C	ENST00000320574.5	-	14	1413	c.1370C>G	c.(1369-1371)aCg>aGg	p.T457R	POLE_ENST00000535270.1_Missense_Mutation_p.T430R	NM_006231.2	NP_006222.2	Q07864	DPOE1_HUMAN	polymerase (DNA directed), epsilon, catalytic subunit	457					base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA synthesis involved in DNA repair (GO:0000731)|G1/S transition of mitotic cell cycle (GO:0000082)|in utero embryonic development (GO:0001701)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	cytoplasm (GO:0005737)|epsilon DNA polymerase complex (GO:0008622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|nucleotide binding (GO:0000166)|zinc ion binding (GO:0008270)			NS(2)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(41)|ovary(3)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	89	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)	Cladribine(DB00242)	CACAGAATACGTGGCCAGAGT	0.522								DNA polymerases (catalytic subunits)																													p.T457R		.											.	POLE-233	0			c.C1370G						.						169.0	143.0	152.0					12																	133249853		2203	4300	6503	SO:0001583	missense	5426	exon14			GAATACGTGGCCA		CCDS9278.1	12q24.3	2014-09-17	2012-05-18		ENSG00000177084	ENSG00000177084		"""DNA polymerases"""	9177	protein-coding gene	gene with protein product	"""DNA polymerase epsilon catalytic subunit A"""	174762	"""polymerase (DNA directed), epsilon"""			8020968	Standard	NM_006231		Approved	POLE1	uc001uks.1	Q07864	OTTHUMG00000168045	ENST00000320574.5:c.1370C>G	12.37:g.133249853G>C	ENSP00000322570:p.Thr457Arg	Somatic	176	1		WXS	Illumina GAIIx	Phase_I	299	56	NM_006231	0	0	0	0	0	Q13533|Q86VH9	Missense_Mutation	SNP	ENST00000320574.5	37	CCDS9278.1	.	.	.	.	.	.	.	.	.	.	G	19.73	3.881450	0.72294	.	.	ENSG00000177084	ENST00000320574;ENST00000455752;ENST00000535270;ENST00000539006;ENST00000376577;ENST00000535934	T;T;T;T	0.39056	4.97;4.97;4.97;1.1	5.37	5.37	0.77165	Ribonuclease H-like (1);	0.000000	0.85682	D	0.000000	T	0.45657	0.1353	N	0.17082	0.46	0.80722	D	1	P;P	0.51240	0.943;0.822	P;B	0.55455	0.776;0.401	T	0.50197	-0.8856	10	0.62326	D	0.03	.	19.0945	0.93244	0.0:0.0:1.0:0.0	.	430;457	F5H1D6;Q07864	.;DPOE1_HUMAN	R	457;468;430;237;392;75	ENSP00000322570:T457R;ENSP00000406383:T468R;ENSP00000445753:T430R;ENSP00000442519:T237R	ENSP00000322570:T457R	T	-	2	0	POLE	131759926	1.000000	0.71417	0.988000	0.46212	0.220000	0.24768	9.807000	0.99171	2.524000	0.85096	0.313000	0.20887	ACG	.		0.522	POLE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397689.2	NM_006231	
ENOX1	55068	ucsc.edu	37	13	43935562	43935562	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr13:43935562G>T	ENST00000261488.6	-	6	812	c.235C>A	c.(235-237)Cca>Aca	p.P79T	ENOX1_ENST00000412891.1_Missense_Mutation_p.P79T|ENOX1_ENST00000482207.1_5'Flank|ENOX1_ENST00000540032.1_5'Flank	NM_001242863.1|NM_017993.3	NP_001229792.1|NP_060463.2	Q8TC92	ENOX1_HUMAN	ecto-NOX disulfide-thiol exchanger 1	79					rhythmic process (GO:0048511)	extracellular region (GO:0005576)|plasma membrane (GO:0005886)	nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|oxidoreductase activity (GO:0016491)			breast(1)|endometrium(3)|large_intestine(7)|lung(18)|pancreas(2)|prostate(1)|skin(1)|urinary_tract(1)	34		Lung NSC(96;0.000518)|Prostate(109;0.0233)|Hepatocellular(98;0.0268)|Lung SC(185;0.0367)|Breast(139;0.0406)		GBM - Glioblastoma multiforme(144;0.00333)|BRCA - Breast invasive adenocarcinoma(63;0.172)		TTGAGGCTTGGATCAAAGCCT	0.433																																					p.P79T		.											.	ENOX1-92	0			c.C235A						.						82.0	89.0	87.0					13																	43935562		2203	4300	6503	SO:0001583	missense	55068	exon6			GGCTTGGATCAAA	EF432052	CCDS9389.1	13q14.11	2013-02-12			ENSG00000120658	ENSG00000120658		"""RNA binding motif (RRM) containing"""	25474	protein-coding gene	gene with protein product		610914				11360993	Standard	NM_001127615		Approved	FLJ10094, PIG38, CNOX, cCNOX	uc001uza.4	Q8TC92	OTTHUMG00000016818	ENST00000261488.6:c.235C>A	13.37:g.43935562G>T	ENSP00000261488:p.Pro79Thr	Somatic	25	0		WXS	Illumina GAIIx	Phase_I	45	4	NM_017993	0	0	0	0	0	A4GU15|A6NMH9|B7Z5K1|Q2TU81|Q5VT11|Q9NWE0	Missense_Mutation	SNP	ENST00000261488.6	37	CCDS9389.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.107114	0.77096	.	.	ENSG00000120658	ENST00000261488;ENST00000412891	T;T	0.56611	0.45;0.45	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.70962	0.3284	L	0.58101	1.795	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.72510	-0.4271	10	0.72032	D	0.01	-21.7609	19.4346	0.94786	0.0:0.0:1.0:0.0	.	79	Q8TC92	ENOX1_HUMAN	T	79	ENSP00000261488:P79T;ENSP00000415054:P79T	ENSP00000261488:P79T	P	-	1	0	ENOX1	42833562	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.471000	0.97696	2.605000	0.88082	0.655000	0.94253	CCA	.		0.433	ENOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044717.2	NM_017993	
TMTC4	84899	broad.mit.edu	37	13	101316489	101316489	+	Silent	SNP	G	G	A			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr13:101316489G>A	ENST00000376234.3	-	3	453	c.264C>T	c.(262-264)acC>acT	p.T88T	TMTC4_ENST00000342624.5_Silent_p.T107T|TMTC4_ENST00000328767.5_Intron	NM_001079669.1	NP_001073137.1	Q5T4D3	TMTC4_HUMAN	transmembrane and tetratricopeptide repeat containing 4	88						integral component of membrane (GO:0016021)				breast(3)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(14)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					AAGTCAGGACGGTGAGAGGCC	0.567																																					p.T107T		.											.	TMTC4-155	0			c.C321T						.						64.0	72.0	69.0					13																	101316489		2015	4175	6190	SO:0001819	synonymous_variant	84899	exon4			CAGGACGGTGAGA		CCDS9497.2, CCDS41904.1, CCDS66575.1	13q32.3	2013-01-10	2006-01-06		ENSG00000125247	ENSG00000125247		"""Tetratricopeptide (TTC) repeat domain containing"""	25904	protein-coding gene	gene with protein product							Standard	XM_005254082		Approved	FLJ14624, FLJ22153	uc001vot.3	Q5T4D3	OTTHUMG00000017289	ENST00000376234.3:c.264C>T	13.37:g.101316489G>A		Somatic	74	0		WXS	Illumina GAIIx	Phase_I	72	3	NM_032813	0	0	1	1	0	A6NLI7|B7Z666|Q5T4D4|Q5T4D5|Q5T4D6|Q8WV63|Q96SU8	Silent	SNP	ENST00000376234.3	37	CCDS41904.1																																																																																			.		0.567	TMTC4-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045649.2	NM_032813	
ING1	3621	hgsc.bcm.edu	37	13	111368316	111368316	+	Silent	SNP	C	C	T	rs9555726	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr13:111368316C>T	ENST00000375774.3	+	1	988	c.526C>T	c.(526-528)Ctg>Ttg	p.L176L	ING1_ENST00000333219.7_Intron|CARS2_ENST00000535398.1_5'Flank|ING1_ENST00000338450.7_Intron|ING1_ENST00000375775.3_Intron|ING1_ENST00000464141.1_Intron	NM_005537.4	NP_005528.3	Q9UK53	ING1_HUMAN	inhibitor of growth family, member 1	176					cell cycle (GO:0007049)|chromatin modification (GO:0016568)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell death (GO:0010941)	nucleus (GO:0005634)	methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(6)|lung(1)|ovary(1)	12	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.188)			GGCCGCATCTCTGCTGACCCG	0.706													C|||	2912	0.58147	0.23	0.6816	5008	,	,		11066	0.7252		0.6909	False		,,,				2504	0.7249				p.L176L		.											.	ING1-515	0			c.C526T						.	C	,,,	1347,2085		295,757,664	14.0	24.0	21.0		526,,,	-5.6	0.0	13	dbSNP_119	21	5238,1736		2020,1198,269	no	coding-synonymous,intron,intron,intron	ING1	NM_005537.3,NM_198217.1,NM_198218.1,NM_198219.1	,,,	2315,1955,933	TT,TC,CC		24.8925,39.2483,36.7192	,,,	176/423,,,	111368316	6585,3821	1716	3487	5203	SO:0001819	synonymous_variant	3621	exon1			GCATCTCTGCTGA		CCDS9515.1, CCDS9516.1, CCDS9517.1, CCDS9518.1	13q34	2013-01-28			ENSG00000153487	ENSG00000153487		"""Zinc fingers, PHD-type"""	6062	protein-coding gene	gene with protein product	"""inhibitor of growth 1"", ""tumor suppressor ING1"", ""growth inhibitor ING1"", ""growth inhibitory protein ING1"""	601566				8944021, 9186514	Standard	NM_198219		Approved	p33ING1, p33ING1b, p24ING1c, p33, p47, p47ING1a	uc001vri.3	Q9UK53	OTTHUMG00000017346	ENST00000375774.3:c.526C>T	13.37:g.111368316C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_005537	0	0	0	2	2	O00532|O43658|Q53ZR3|Q5T9G8|Q5T9G9|Q5T9H0|Q5T9H1|Q9H007|Q9HD98|Q9HD99|Q9NS83|Q9P0U6|Q9UBC6|Q9UIJ1|Q9UIJ2|Q9UIJ3|Q9UIJ4|Q9UK52	Silent	SNP	ENST00000375774.3	37	CCDS9517.1																																																																																			C|0.372;T|0.628		0.706	ING1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000045770.2	NM_005537	
PROZ	8858	broad.mit.edu	37	13	113814406	113814406	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr13:113814406T>G	ENST00000375547.2	+	2	156	c.149T>G	c.(148-150)tTc>tGc	p.F50C	PROZ_ENST00000342783.4_Missense_Mutation_p.F72C	NM_003891.2	NP_003882.1	P22891	PROZ_HUMAN	protein Z, vitamin K-dependent plasma glycoprotein	50	Gla. {ECO:0000255|PROSITE- ProRule:PRU00463}.				blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|peptidyl-glutamic acid carboxylation (GO:0017187)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)			NS(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(4)|prostate(2)|skin(2)	16	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.216)	all cancers(43;0.104)		Menadione(DB00170)	GAAGAACTCTTCGAGGGAAAC	0.458																																					p.F72C		.											.	PROZ-90	0			c.T215G						.						119.0	133.0	128.0					13																	113814406		2203	4300	6503	SO:0001583	missense	8858	exon3			AACTCTTCGAGGG	M55670	CCDS9531.1, CCDS58300.1	13q34	2008-07-18			ENSG00000126231	ENSG00000126231			9460	protein-coding gene	gene with protein product		176895				2244898, 2403355	Standard	NM_001256134		Approved	PZ	uc010agr.2	P22891	OTTHUMG00000017376	ENST00000375547.2:c.149T>G	13.37:g.113814406T>G	ENSP00000364697:p.Phe50Cys	Somatic	36	0		WXS	Illumina GAIIx	Phase_I	12	2	NM_001256134	0	0	0	0	0	A6NMB4|Q15213|Q5JVF5|Q5JVF6	Missense_Mutation	SNP	ENST00000375547.2	37	CCDS9531.1	.	.	.	.	.	.	.	.	.	.	T	12.05	1.822016	0.32237	.	.	ENSG00000126231	ENST00000375547;ENST00000342783	D;D	0.99098	-5.42;-5.42	4.0	4.0	0.46444	Gamma-carboxyglutamic acid-rich (GLA) domain (5);Coagulation factor, subgroup, Gla domain (1);	0.323859	0.24742	U	0.035965	D	0.98629	0.9541	L	0.50333	1.59	0.09310	N	1	D;D	0.71674	0.998;0.997	D;D	0.66351	0.927;0.943	D	0.95350	0.8446	10	0.87932	D	0	.	11.1563	0.48489	0.0:0.0:0.0:1.0	.	72;50	P22891-2;P22891	.;PROZ_HUMAN	C	50;72	ENSP00000364697:F50C;ENSP00000344458:F72C	ENSP00000344458:F72C	F	+	2	0	PROZ	112862407	0.989000	0.36119	0.015000	0.15790	0.319000	0.28217	4.990000	0.63876	1.429000	0.47314	0.260000	0.18958	TTC	.		0.458	PROZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000045845.1	NM_003891	
OR4K5	79317	hgsc.bcm.edu	37	14	20389714	20389714	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr14:20389714G>T	ENST00000315915.4	+	1	974	c.949G>T	c.(949-951)Gta>Tta	p.V317L		NM_001005483.1	NP_001005483.1	Q8NGD3	OR4K5_HUMAN	olfactory receptor, family 4, subfamily K, member 5	317						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(6)|liver(1)|lung(27)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	47	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		AATGTCACTAGTAGTGAGAAC	0.353																																					p.V317L		.											.	OR4K5-70	0			c.G949T						.						73.0	84.0	80.0					14																	20389714		2190	4297	6487	SO:0001583	missense	79317	exon1			TCACTAGTAGTGA	BK004355	CCDS32024.1	14q11.22	2012-08-09				ENSG00000176281		"""GPCR / Class A : Olfactory receptors"""	14745	protein-coding gene	gene with protein product						14983052	Standard	NM_001005483		Approved		uc010tkw.2	Q8NGD3		ENST00000315915.4:c.949G>T	14.37:g.20389714G>T	ENSP00000319511:p.Val317Leu	Somatic	78	0		WXS	Illumina GAIIx	Phase_I	61	4	NM_001005483	0	0	0	0	0	Q6IFA7	Missense_Mutation	SNP	ENST00000315915.4	37	CCDS32024.1	.	.	.	.	.	.	.	.	.	.	.	0.496	-0.873150	0.02570	.	.	ENSG00000176281	ENST00000315915	T	0.36699	1.24	3.86	0.984	0.19773	.	0.634620	0.13035	N	0.418959	T	0.17323	0.0416	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.19321	-1.0309	10	0.39692	T	0.17	.	7.4398	0.27176	0.3207:0.0:0.6793:0.0	.	317	Q8NGD3	OR4K5_HUMAN	L	317	ENSP00000319511:V317L	ENSP00000319511:V317L	V	+	1	0	OR4K5	19459554	0.001000	0.12720	0.004000	0.12327	0.001000	0.01503	0.770000	0.26618	0.412000	0.25729	-0.142000	0.14014	GTA	.		0.353	OR4K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409867.1	NM_001005483	
DNAAF2	55172	hgsc.bcm.edu	37	14	50100683	50100683	+	Silent	SNP	C	C	G	rs2985686	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr14:50100683C>G	ENST00000298292.8	-	1	1265	c.1185G>C	c.(1183-1185)gcG>gcC	p.A395A	DNAAF2_ENST00000406043.3_Silent_p.A395A	NM_018139.2	NP_060609.2	Q9NVR5	KTU_HUMAN	dynein, axonemal, assembly factor 2	395					axonemal dynein complex assembly (GO:0070286)|bacterial-type flagellum-dependent cell motility (GO:0071973)|cilium-dependent cell motility (GO:0060285)|response to retinoic acid (GO:0032526)	cytoplasm (GO:0005737)				kidney(1)|lung(4)	5						CTCCGTCCTCCGCGCGACTCC	0.781													G|||	2800	0.559105	0.6702	0.6715	5008	,	,		11594	0.1736		0.7604	False		,,,				2504	0.5194				p.A395A		.											.	.	0			c.G1185C						.						1.0	1.0	1.0					14																	50100683		917	2082	2999	SO:0001819	synonymous_variant	55172	exon1			GTCCTCCGCGCGA	AK001425	CCDS9691.2, CCDS45100.1	14q21.3	2012-05-03	2011-06-09	2011-06-09	ENSG00000165506	ENSG00000165506			20188	protein-coding gene	gene with protein product	"""kintoun"""	612517	"""chromosome 14 open reading frame 104"""	C14orf104			Standard	NM_001083908		Approved	FLJ10563, KTU, PF13, CILD10	uc001wws.4	Q9NVR5	OTTHUMG00000152331	ENST00000298292.8:c.1185G>C	14.37:g.50100683C>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	2	2	NM_018139	0	0	0	0	0	B9WS54|C0JAP7|Q86TR1|Q86TY8|Q969Z5	Silent	SNP	ENST00000298292.8	37	CCDS9691.2																																																																																			C|0.569;G|0.431		0.781	DNAAF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276813.1		
RDH12	145226	broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	68191943	68191943	+	Silent	SNP	C	C	T			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr14:68191943C>T	ENST00000551171.1	+	5	639	c.315C>T	c.(313-315)atC>atT	p.I105I	RDH12_ENST00000267502.3_Silent_p.I105I|RDH12_ENST00000539142.1_Silent_p.I105I	NM_152443.2	NP_689656.2	Q96NR8	RDH12_HUMAN	retinol dehydrogenase 12 (all-trans/9-cis/11-cis)	105					photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|visual perception (GO:0007601)	intracellular (GO:0005622)|photoreceptor inner segment membrane (GO:0060342)	retinol dehydrogenase activity (GO:0004745)			large_intestine(3)|lung(3)|ovary(1)|prostate(1)|skin(4)	12				all cancers(60;0.000704)|OV - Ovarian serous cystadenocarcinoma(108;0.00161)|BRCA - Breast invasive adenocarcinoma(234;0.00953)	Vitamin A(DB00162)	CCAAATCTATCCGAGCCTTTG	0.527																																					p.I105I		.											.	RDH12-91	0			c.C315T						.						95.0	90.0	92.0					14																	68191943		2203	4300	6503	SO:0001819	synonymous_variant	145226	exon5			ATCTATCCGAGCC	AK054835	CCDS9787.1	14q24.1	2013-02-14	2006-05-09		ENSG00000139988	ENSG00000139988	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	19977	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 7C, member 2"""	608830	"""retinol dehydrogenase 12 (all-trans and 9-cis)"""			12226107, 19027726	Standard	NM_152443		Approved	FLJ30273, SDR7C2, LCA13, RP53	uc001xjz.4	Q96NR8		ENST00000551171.1:c.315C>T	14.37:g.68191943C>T		Somatic	144	2		WXS	Illumina GAIIx	Phase_I	166	41	NM_152443	0	0	0	0	0	B2RDA2|Q8TAW6	Silent	SNP	ENST00000551171.1	37	CCDS9787.1																																																																																			.		0.527	RDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406918.1		
RDH12	145226	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	68191958	68191958	+	Silent	SNP	G	G	A			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr14:68191958G>A	ENST00000551171.1	+	5	654	c.330G>A	c.(328-330)gaG>gaA	p.E110E	RDH12_ENST00000267502.3_Silent_p.E110E|RDH12_ENST00000539142.1_Silent_p.E110E	NM_152443.2	NP_689656.2	Q96NR8	RDH12_HUMAN	retinol dehydrogenase 12 (all-trans/9-cis/11-cis)	110					photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|visual perception (GO:0007601)	intracellular (GO:0005622)|photoreceptor inner segment membrane (GO:0060342)	retinol dehydrogenase activity (GO:0004745)			large_intestine(3)|lung(3)|ovary(1)|prostate(1)|skin(4)	12				all cancers(60;0.000704)|OV - Ovarian serous cystadenocarcinoma(108;0.00161)|BRCA - Breast invasive adenocarcinoma(234;0.00953)	Vitamin A(DB00162)	CCTTTGCTGAGGGCTTTCTGG	0.522																																					p.E110E		.											.	RDH12-91	0			c.G330A						.						80.0	75.0	77.0					14																	68191958		2203	4300	6503	SO:0001819	synonymous_variant	145226	exon5			TGCTGAGGGCTTT	AK054835	CCDS9787.1	14q24.1	2013-02-14	2006-05-09		ENSG00000139988	ENSG00000139988	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	19977	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 7C, member 2"""	608830	"""retinol dehydrogenase 12 (all-trans and 9-cis)"""			12226107, 19027726	Standard	NM_152443		Approved	FLJ30273, SDR7C2, LCA13, RP53	uc001xjz.4	Q96NR8		ENST00000551171.1:c.330G>A	14.37:g.68191958G>A		Somatic	145	1		WXS	Illumina GAIIx	Phase_I	170	40	NM_152443	0	0	0	0	0	B2RDA2|Q8TAW6	Silent	SNP	ENST00000551171.1	37	CCDS9787.1																																																																																			.		0.522	RDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406918.1		
IRF2BPL	64207	hgsc.bcm.edu	37	14	77493809	77493809	+	Silent	SNP	C	C	T	rs61991638		TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr14:77493809C>T	ENST00000238647.3	-	1	1225	c.327G>A	c.(325-327)caG>caA	p.Q109Q		NM_024496.3	NP_078772.1	Q9H1B7	I2BPL_HUMAN	interferon regulatory factor 2 binding protein-like	109	Poly-Gln.				development of secondary female sexual characteristics (GO:0046543)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	extracellular space (GO:0005615)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	11						gctgctgctgctgctgttgct	0.687																																					p.Q109Q		.											.	IRF2BPL-90	0			c.G327A						.						2.0	2.0	2.0					14																	77493809		1179	2145	3324	SO:0001819	synonymous_variant	64207	exon1			CTGCTGCTGCTGT	AJ277365	CCDS9854.1	14q24.3	2011-02-23	2011-02-23	2011-02-23	ENSG00000119669	ENSG00000119669			14282	protein-coding gene	gene with protein product	"""enhanced at puberty 1"""	611720	"""chromosome 14 open reading frame 4"""	C14orf4		11095982, 17627301	Standard	NM_024496		Approved	EAP1, KIAA1865	uc001xsy.4	Q9H1B7		ENST00000238647.3:c.327G>A	14.37:g.77493809C>T		Somatic	5	0		WXS	Illumina GAIIx	Phase_I	25	5	NM_024496	0	0	5	5	0	Q8NDQ2|Q96JG2|Q9H3I7	Silent	SNP	ENST00000238647.3	37	CCDS9854.1																																																																																			C|0.978;T|0.022		0.687	IRF2BPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414298.1	NM_024496	
C14orf159	80017	broad.mit.edu	37	14	91633636	91633636	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr14:91633636G>T	ENST00000523771.1	+	4	774	c.171G>T	c.(169-171)caG>caT	p.Q57H	C14orf159_ENST00000522322.1_Missense_Mutation_p.Q57H|C14orf159_ENST00000521077.2_Missense_Mutation_p.Q57H|C14orf159_ENST00000517877.1_Missense_Mutation_p.Q57H|C14orf159_ENST00000525393.2_Intron|C14orf159_ENST00000523816.1_Missense_Mutation_p.Q57H|C14orf159_ENST00000298858.4_Missense_Mutation_p.Q57H|C14orf159_ENST00000428926.2_Missense_Mutation_p.Q57H|C14orf159_ENST00000518665.2_Missense_Mutation_p.Q57H|C14orf159_ENST00000518868.1_Missense_Mutation_p.Q57H|C14orf159_ENST00000520328.1_Missense_Mutation_p.Q57H|C14orf159_ENST00000256324.10_Missense_Mutation_p.Q57H|C14orf159_ENST00000519019.1_Missense_Mutation_p.Q57H|C14orf159_ENST00000412671.2_Missense_Mutation_p.Q57H			Q7Z3D6	CN159_HUMAN	chromosome 14 open reading frame 159	57						mitochondrion (GO:0005739)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	21		all_cancers(154;0.0191)|all_epithelial(191;0.241)		Epithelial(152;0.141)|OV - Ovarian serous cystadenocarcinoma(161;0.207)		GATTCTGCCAGGTCAACACTG	0.557																																					p.Q57H		.											.	C14orf159-92	0			c.G171T						.						111.0	105.0	107.0					14																	91633636		2203	4300	6503	SO:0001583	missense	80017	exon6			CTGCCAGGTCAAC	AK097294	CCDS32141.1, CCDS41979.1, CCDS45150.1, CCDS66693.1, CCDS73677.1	14q32.11	2012-09-26			ENSG00000133943	ENSG00000133943			20498	protein-coding gene	gene with protein product							Standard	NM_001102367		Approved	FLJ39975	uc001xze.2	Q7Z3D6	OTTHUMG00000164980	ENST00000523771.1:c.171G>T	14.37:g.91633636G>T	ENSP00000429655:p.Gln57His	Somatic	72	0		WXS	Illumina GAIIx	Phase_I	117	4	NM_001102366	0	0	23	23	0	B3KUI7|Q86SW3|Q86SX8|Q86SX9|Q86T08|Q86TV5|Q96GW5|Q9H7G0|Q9H8Y9|Q9H9W6	Missense_Mutation	SNP	ENST00000523771.1	37	CCDS32141.1	.	.	.	.	.	.	.	.	.	.	G	16.99	3.273437	0.59649	.	.	ENSG00000133943	ENST00000521334;ENST00000522837;ENST00000518871;ENST00000298858;ENST00000520328;ENST00000256324;ENST00000522170;ENST00000519950;ENST00000523879;ENST00000521077;ENST00000518665;ENST00000518868;ENST00000519019;ENST00000523816;ENST00000517518;ENST00000428926;ENST00000517362;ENST00000523894;ENST00000522322;ENST00000523771;ENST00000521064;ENST00000412671;ENST00000517877	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.32753	1.44;1.44;1.44;1.44;1.44;1.44;1.44;1.44;1.44;1.44;1.44;1.44;1.44;1.44;1.44;1.44;1.44;1.44;1.44;1.44;1.44;1.44;1.44	5.12	3.29	0.37713	.	0.142736	0.45867	D	0.000334	T	0.45296	0.1335	L	0.59436	1.845	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;0.999;0.999;1.0;1.0;1.0	D;P;P;D;P;D	0.76575	0.988;0.753;0.888;0.925;0.875;0.948	T	0.21586	-1.0241	10	0.35671	T	0.21	.	7.5476	0.27777	0.269:0.0:0.731:0.0	.	57;57;57;57;57;57	Q7Z3D6-6;Q7Z3D6;B3KVU6;Q7Z3D6-5;Q7Z3D6-2;Q7Z3D6-3	.;CN159_HUMAN;.;.;.;.	H	57	ENSP00000430022:Q57H;ENSP00000427971:Q57H;ENSP00000429189:Q57H;ENSP00000298858:Q57H;ENSP00000429453:Q57H;ENSP00000256324:Q57H;ENSP00000430666:Q57H;ENSP00000428296:Q57H;ENSP00000428122:Q57H;ENSP00000430137:Q57H;ENSP00000429098:Q57H;ENSP00000428263:Q57H;ENSP00000430318:Q57H;ENSP00000428974:Q57H;ENSP00000428652:Q57H;ENSP00000404343:Q57H;ENSP00000429806:Q57H;ENSP00000429459:Q57H;ENSP00000427953:Q57H;ENSP00000429655:Q57H;ENSP00000429392:Q57H;ENSP00000404196:Q57H;ENSP00000429949:Q57H	ENSP00000256324:Q57H	Q	+	3	2	C14orf159	90703389	1.000000	0.71417	0.992000	0.48379	0.965000	0.64279	0.481000	0.22260	0.556000	0.29098	0.561000	0.74099	CAG	.		0.557	C14orf159-014	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381273.1	NM_024952	
TRMT61A	115708	broad.mit.edu	37	14	104001019	104001019	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr14:104001019G>T	ENST00000389749.4	+	4	838	c.731G>T	c.(730-732)aGc>aTc	p.S244I		NM_152307.2	NP_689520.2	Q96FX7	TRM61_HUMAN	tRNA methyltransferase 61 homolog A (S. cerevisiae)	244						nucleus (GO:0005634)|tRNA (m1A) methyltransferase complex (GO:0031515)	tRNA (adenine-N1-)-methyltransferase activity (GO:0016429)			skin(1)	1						CGCACTGTCAGCCTGCCACCG	0.697																																					p.S244I		.											.	TRMT61A-90	0			c.G731T						.						15.0	22.0	20.0					14																	104001019		2135	4223	6358	SO:0001583	missense	115708	exon4			CTGTCAGCCTGCC	AK097771	CCDS41994.1	14q32	2009-01-09	2009-01-09	2009-01-09		ENSG00000166166			23790	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 172"""	C14orf172		16043508	Standard	NM_152307		Approved	FLJ40452, GCD14, Gcd14p, hTRM61	uc010aws.3	Q96FX7		ENST00000389749.4:c.731G>T	14.37:g.104001019G>T	ENSP00000374399:p.Ser244Ile	Somatic	29	0		WXS	Illumina GAIIx	Phase_I	100	5	NM_152307	0	0	1	1	0	A6NN78|Q8N7Q9	Missense_Mutation	SNP	ENST00000389749.4	37	CCDS41994.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.78|11.78	1.740375|1.740375	0.30865|0.30865	.|.	.|.	ENSG00000166166|ENSG00000166166	ENST00000299202|ENST00000389749;ENST00000299201	.|T	.|0.45668	.|0.89	4.67|4.67	3.63|3.63	0.41609|0.41609	.|.	.|0.658034	.|0.15514	.|N	.|0.258391	T|T	0.26774|0.26774	0.0655|0.0655	N|N	0.20483|0.20483	0.58|0.58	0.41995|0.41995	D|D	0.990869|0.990869	.|B	.|0.24132	.|0.098	.|B	.|0.23716	.|0.048	T|T	0.11179|0.11179	-1.0598|-1.0598	5|10	.|0.42905	.|T	.|0.14	-4.0183|-4.0183	8.2926|8.2926	0.31967|0.31967	0.2251:0.0:0.7749:0.0|0.2251:0.0:0.7749:0.0	.|.	.|244	.|Q96FX7	.|TRM61_HUMAN	S|I	146|244	.|ENSP00000374399:S244I	.|ENSP00000299201:S244I	A|S	+|+	1|2	0|0	TRMT61A|TRMT61A	103070772|103070772	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.671000|0.671000	0.39405|0.39405	2.535000|2.535000	0.45685|0.45685	2.140000|2.140000	0.66376|0.66376	0.313000|0.313000	0.20887|0.20887	GCC|AGC	.		0.697	TRMT61A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414988.1	NM_152307	
AHNAK2	113146	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	105413351	105413351	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr14:105413351A>G	ENST00000333244.5	-	7	8556	c.8437T>C	c.(8437-8439)Ttc>Ctc	p.F2813L	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2813						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GGCATTTTGAACTTGCTGTCT	0.612																																					p.F2813L		.											.	AHNAK2-47	0			c.T8437C						.						248.0	267.0	261.0					14																	105413351		1967	4152	6119	SO:0001583	missense	113146	exon7			TTTTGAACTTGCT	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.8437T>C	14.37:g.105413351A>G	ENSP00000353114:p.Phe2813Leu	Somatic	254	0		WXS	Illumina GAIIx	Phase_I	394	92	NM_138420	0	0	0	0	0	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	a	0.334	-0.954141	0.02285	.	.	ENSG00000185567	ENST00000333244	T	0.01629	4.72	3.24	0.469	0.16741	.	.	.	.	.	T	0.01092	0.0036	N	0.25094	0.71	0.24192	N	0.995548	B	0.30146	0.27	B	0.25291	0.059	T	0.45411	-0.9263	9	0.07030	T	0.85	.	4.3653	0.11222	0.7222:0.0:0.1047:0.1731	.	2813	Q8IVF2	AHNK2_HUMAN	L	2813	ENSP00000353114:F2813L	ENSP00000353114:F2813L	F	-	1	0	AHNAK2	104484396	0.000000	0.05858	0.999000	0.59377	0.097000	0.18754	-0.606000	0.05654	0.183000	0.20059	0.254000	0.18369	TTC	.		0.612	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
APBA2	321	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	29346191	29346191	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr15:29346191A>G	ENST00000558402.1	+	5	703	c.104A>G	c.(103-105)gAg>gGg	p.E35G	APBA2_ENST00000558259.1_Missense_Mutation_p.E35G|APBA2_ENST00000558330.1_Missense_Mutation_p.E35G|APBA2_ENST00000561069.1_Missense_Mutation_p.E35G|APBA2_ENST00000411764.1_Missense_Mutation_p.E35G			Q99767	APBA2_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 2	35					in utero embryonic development (GO:0001701)|locomotory behavior (GO:0007626)|multicellular organism growth (GO:0035264)|nervous system development (GO:0007399)|protein transport (GO:0015031)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)	beta-amyloid binding (GO:0001540)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|liver(2)|lung(33)|stomach(1)|urinary_tract(1)	59		all_lung(180;1.73e-12)|Breast(32;2.89e-05)|Colorectal(260;0.234)		all cancers(64;7.44e-11)|Epithelial(43;5.74e-10)|GBM - Glioblastoma multiforme(186;0.026)|BRCA - Breast invasive adenocarcinoma(123;0.0286)|Lung(196;0.24)		GAGGACATGGAGCTGCCCTTG	0.677																																					p.E35G		.											.	APBA2-90	0			c.A104G						.						46.0	52.0	50.0					15																	29346191		2203	4300	6503	SO:0001583	missense	321	exon3			ACATGGAGCTGCC	AB014719	CCDS10022.1, CCDS45197.1	15q11-q12	2008-07-18	2008-07-18		ENSG00000034053	ENSG00000034053			579	protein-coding gene	gene with protein product		602712	"""X11-like"", ""amyloid beta (A4) precursor protein-binding, family A, member 2 (X11-like)"""	X11L, MINT2		8955346	Standard	NM_005503		Approved	D15S1518E, LIN-10, MGC:14091, HsT16821	uc001zck.3	Q99767	OTTHUMG00000129255	ENST00000558402.1:c.104A>G	15.37:g.29346191A>G	ENSP00000453293:p.Glu35Gly	Somatic	251	0		WXS	Illumina GAIIx	Phase_I	299	61	NM_005503	0	0	0	0	0	E9PGI4|O60571|Q5XKC0	Missense_Mutation	SNP	ENST00000558402.1	37	CCDS10022.1	.	.	.	.	.	.	.	.	.	.	A	11.85	1.762649	0.31228	.	.	ENSG00000034053	ENST00000411764;ENST00000219865	T	0.48522	0.81	5.06	3.95	0.45737	.	0.433894	0.23413	N	0.048452	T	0.45337	0.1337	M	0.62723	1.935	0.37647	D	0.922266	P;P;P	0.40909	0.732;0.682;0.682	B;B;B	0.40199	0.322;0.255;0.255	T	0.51601	-0.8685	10	0.56958	D	0.05	.	9.6476	0.39877	0.9179:0.0:0.0821:0.0	.	35;35;35	Q5XKC0;E9PGI4;Q99767	.;.;APBA2_HUMAN	G	35	ENSP00000409312:E35G	ENSP00000219865:E35G	E	+	2	0	APBA2	27133483	1.000000	0.71417	0.888000	0.34837	0.015000	0.08874	3.654000	0.54453	0.771000	0.33359	0.528000	0.53228	GAG	.		0.677	APBA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251362.3	NM_005503	
FMN1	342184	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	33358778	33358778	+	Intron	SNP	C	C	G			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr15:33358778C>G	ENST00000559047.1	-	3	2043				FMN1_ENST00000334528.9_Missense_Mutation_p.E436D|FMN1_ENST00000558197.1_Missense_Mutation_p.E436D|FMN1_ENST00000559150.1_Intron|FMN1_ENST00000561249.1_Intron			Q68DA7	FMN1_HUMAN	formin 1						actin nucleation (GO:0045010)	actin filament (GO:0005884)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|upper_aerodigestive_tract(3)	29		all_lung(180;1.14e-07)		all cancers(64;3.05e-15)|Epithelial(43;1.67e-10)|GBM - Glioblastoma multiforme(186;4.95e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0262)		CTCTTAGCGACTCCTTCTCAT	0.483																																					p.E436D		.											.	FMN1-23	0			c.G1308C						.						53.0	54.0	53.0					15																	33358778		1966	4164	6130	SO:0001627	intron_variant	342184	exon1			TAGCGACTCCTTC	AH002864	CCDS45209.1, CCDS61581.1, CCDS61582.1	15q13.3	2013-06-13	2005-01-20	2005-01-22	ENSG00000248905	ENSG00000248905			3768	protein-coding gene	gene with protein product	"""limb deformity protein"""	136535	"""formin (limb deformity)"""	LD, FMN		1673046	Standard	NM_001277313		Approved	DKFZP686C2281, FLJ45135, MGC125288, MGC125289	uc031qrh.1	Q68DA7	OTTHUMG00000172201	ENST00000559047.1:c.2044-1503G>C	15.37:g.33358778C>G		Somatic	95	0		WXS	Illumina GAIIx	Phase_I	117	32	NM_001103184	0	0	0	0	0	Q3B7I6|Q3ZAR4|Q6ZSY1	Missense_Mutation	SNP	ENST00000559047.1	37		.	.	.	.	.	.	.	.	.	.	C	14.99	2.701101	0.48307	.	.	ENSG00000248905	ENST00000334528	T	0.58358	0.34	5.96	3.06	0.35304	.	0.269242	0.41823	D	0.000805	T	0.55924	0.1951	.	.	.	.	.	.	D;P	0.59767	0.986;0.859	P;P	0.56474	0.799;0.569	T	0.63800	-0.6555	8	0.39692	T	0.17	.	5.3405	0.15981	0.1331:0.5968:0.0:0.2702	.	436;436	Q68DA7-3;Q68DA7-5	.;.	D	436	ENSP00000333950:E436D	ENSP00000333950:E436D	E	-	3	2	FMN1	31146070	0.989000	0.36119	1.000000	0.80357	0.984000	0.73092	0.241000	0.18065	0.846000	0.35142	0.655000	0.94253	GAG	.		0.483	FMN1-005	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000417414.1	NM_001103184	
PHGR1	644844	hgsc.bcm.edu	37	15	40648339	40648339	+	Silent	SNP	C	C	T			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr15:40648339C>T	ENST00000448599.2	+	4	140	c.84C>T	c.(82-84)ggC>ggT	p.G28G	DISP2_ENST00000267889.3_5'Flank	NM_001145643.1	NP_001139115.1	C9JFL3	PHGR1_HUMAN	proline/histidine/glycine-rich 1	28	Gly-rich.																CTGGCCATGGCCCAGGGCCCT	0.706																																					p.G28G		.											.	.	0			c.C84T						.						2.0	3.0	3.0					15																	40648339		622	1472	2094	SO:0001819	synonymous_variant	644844	exon3			CCATGGCCCAGGG		CCDS45225.1	15q15.1	2009-10-08				ENSG00000233041			37226	protein-coding gene	gene with protein product							Standard	NM_001145643		Approved		uc010uco.2	C9JFL3		ENST00000448599.2:c.84C>T	15.37:g.40648339C>T		Somatic	10	0		WXS	Illumina GAIIx	Phase_I	25	3	NM_001145643	0	0	0	0	0		Silent	SNP	ENST00000448599.2	37	CCDS45225.1																																																																																			.		0.706	PHGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418450.1	NM_001145643	
PHGR1	644844	hgsc.bcm.edu	37	15	40648372	40648372	+	Silent	SNP	T	T	C	rs12900982		TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr15:40648372T>C	ENST00000448599.2	+	4	173	c.117T>C	c.(115-117)ggT>ggC	p.G39G	DISP2_ENST00000267889.3_5'Flank	NM_001145643.1	NP_001139115.1	C9JFL3	PHGR1_HUMAN	proline/histidine/glycine-rich 1	39	Gly-rich.																CCCACCATGGTCCAGGGCCCT	0.776																																					p.G39G		.											.	.	0			c.T117C						.						1.0	2.0	2.0					15																	40648372		356	1106	1462	SO:0001819	synonymous_variant	644844	exon3			CCATGGTCCAGGG		CCDS45225.1	15q15.1	2009-10-08				ENSG00000233041			37226	protein-coding gene	gene with protein product							Standard	NM_001145643		Approved		uc010uco.2	C9JFL3		ENST00000448599.2:c.117T>C	15.37:g.40648372T>C		Somatic	2	1		WXS	Illumina GAIIx	Phase_I	11	2	NM_001145643	0	0	0	0	0		Silent	SNP	ENST00000448599.2	37	CCDS45225.1																																																																																			T|0.839;C|0.161		0.776	PHGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418450.1	NM_001145643	
KBTBD13	390594	hgsc.bcm.edu	37	15	65369531	65369531	+	Silent	SNP	G	G	T	rs2946642	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr15:65369531G>T	ENST00000432196.2	+	1	378	c.378G>T	c.(376-378)gcG>gcT	p.A126A	RASL12_ENST00000434605.2_5'Flank	NM_001101362.2	NP_001094832.1	C9JR72	KBTBD_HUMAN	kelch repeat and BTB (POZ) domain containing 13	126					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				lung(1)|prostate(1)|skin(1)	3						ACAGTGCCGCGCTCTTCATCT	0.716													G|||	2512	0.501597	0.531	0.5403	5008	,	,		9855	0.7302		0.3877	False		,,,				2504	0.316				p.A126A		.											.	.	0			c.G378T						.	G		1399,1573		380,639,467	2.0	2.0	2.0		378	-0.2	1.0	15	dbSNP_101	2	2035,4139		455,1125,1507	no	coding-synonymous	KBTBD13	NM_001101362.2		835,1764,1974	TT,TG,GG		32.9608,47.0727,37.5465		126/459	65369531	3434,5712	1486	3087	4573	SO:0001819	synonymous_variant	390594	exon1			TGCCGCGCTCTTC		CCDS45281.1	15q22.31	2014-09-17			ENSG00000234438	ENSG00000234438		"""BTB/POZ domain containing"""	37227	protein-coding gene	gene with protein product	"""nemaline myopathy type 6"""	613727				21109227, 22542517	Standard	NM_001101362		Approved	hCG_1645727, NEM6	uc010uis.2	C9JR72		ENST00000432196.2:c.378G>T	15.37:g.65369531G>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_001101362	0	0	0	0	0		Silent	SNP	ENST00000432196.2	37	CCDS45281.1																																																																																			G|0.479;T|0.521		0.716	KBTBD13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418468.2	NM_001101362	
ACAN	176	hgsc.bcm.edu	37	15	89400097	89400097	+	Missense_Mutation	SNP	T	T	G	rs377697360		TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr15:89400097T>G	ENST00000561243.1	+	11	4281	c.4281T>G	c.(4279-4281)gaT>gaG	p.D1427E	ACAN_ENST00000559004.1_Missense_Mutation_p.D1427E|ACAN_ENST00000352105.7_Missense_Mutation_p.D1427E|ACAN_ENST00000439576.2_Missense_Mutation_p.D1427E			P16112	PGCA_HUMAN	aggrecan	1428	29 X 19 AA approximate tandem repeats of E-[IVDG]-[LV]-[EV]-[GTI]-[STA]-[ATV]- [SP]-[GA]-[VIFAD]-[GEDL]-[DE]-[LVI]-[SG]- [GERK]-[LV]-P-S-G.|CS-1.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|extracellular matrix structural constituent (GO:0005201)|hyaluronic acid binding (GO:0005540)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(15)|liver(2)|lung(40)|ovary(2)|prostate(5)|skin(5)|stomach(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	93	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			CTGGAGTAGATGAGATCAGTG	0.512																																					p.D1427E		.											.	ACAN-25	0			c.T4281G						.																																			SO:0001583	missense	176	exon12			AGTAGATGAGATC	M55172	CCDS53970.1, CCDS53971.1	15q26.1	2013-05-07	2007-02-16	2007-02-16	ENSG00000157766	ENSG00000157766		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	319	protein-coding gene	gene with protein product	"""aggrecan proteoglycan"""	155760	"""chondroitin sulfate proteoglycan 1"", ""aggrecan 1"""	MSK16, CSPG1, AGC1		1985970	Standard	NM_013227		Approved	CSPGCP	uc010upo.1	P16112	OTTHUMG00000171989	ENST00000561243.1:c.4281T>G	15.37:g.89400097T>G	ENSP00000453342:p.Asp1427Glu	Somatic	41	0		WXS	Illumina GAIIx	Phase_I	38	3	NM_001135	0	0	0	0	0	Q13650|Q9UCD3|Q9UCP4|Q9UCP5|Q9UDE0	Missense_Mutation	SNP	ENST00000561243.1	37	CCDS53970.1	.	.	.	.	.	.	.	.	.	.	-	0.015	-1.561620	0.00903	.	.	ENSG00000157766	ENST00000439576;ENST00000352105;ENST00000268134	D;D	0.92348	-3.02;-3.02	3.16	-6.33	0.01988	.	0.924765	0.08745	N	0.899932	T	0.55097	0.1899	N	0.00066	-2.3	0.09310	N	1	B;B	0.15719	0.014;0.007	B;B	0.14023	0.01;0.005	T	0.62539	-0.6833	10	0.02654	T	1	.	1.3242	0.02122	0.3237:0.1069:0.3528:0.2166	.	1427;1427	E7ENV9;E7EX88	.;.	E	1427;1427;1313	ENSP00000387356:D1427E;ENSP00000341615:D1427E	ENSP00000268134:D1313E	D	+	3	2	ACAN	87201101	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-12.125000	0.00002	-2.194000	0.00753	-3.029000	0.00073	GAT	.		0.512	ACAN-006	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416267.2	NM_001135	
ACAN	176	hgsc.bcm.edu	37	15	89400100	89400100	+	Missense_Mutation	SNP	G	G	C	rs537253113	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr15:89400100G>C	ENST00000561243.1	+	11	4284	c.4284G>C	c.(4282-4284)gaG>gaC	p.E1428D	ACAN_ENST00000559004.1_Missense_Mutation_p.E1428D|ACAN_ENST00000352105.7_Missense_Mutation_p.E1428D|ACAN_ENST00000439576.2_Missense_Mutation_p.E1428D			P16112	PGCA_HUMAN	aggrecan	1429	29 X 19 AA approximate tandem repeats of E-[IVDG]-[LV]-[EV]-[GTI]-[STA]-[ATV]- [SP]-[GA]-[VIFAD]-[GEDL]-[DE]-[LVI]-[SG]- [GERK]-[LV]-P-S-G.|CS-1.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|extracellular matrix structural constituent (GO:0005201)|hyaluronic acid binding (GO:0005540)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(15)|liver(2)|lung(40)|ovary(2)|prostate(5)|skin(5)|stomach(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	93	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			GAGTAGATGAGATCAGTGGGC	0.517													-|||	2	0.000399361	0.0	0.0	5008	,	,		16994	0.0		0.002	False		,,,				2504	0.0				p.E1428D		.											.	ACAN-25	0			c.G4284C						.						147.0	148.0	148.0					15																	89400100		1849	4086	5935	SO:0001583	missense	176	exon12			AGATGAGATCAGT	M55172	CCDS53970.1, CCDS53971.1	15q26.1	2013-05-07	2007-02-16	2007-02-16	ENSG00000157766	ENSG00000157766		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	319	protein-coding gene	gene with protein product	"""aggrecan proteoglycan"""	155760	"""chondroitin sulfate proteoglycan 1"", ""aggrecan 1"""	MSK16, CSPG1, AGC1		1985970	Standard	NM_013227		Approved	CSPGCP	uc010upo.1	P16112	OTTHUMG00000171989	ENST00000561243.1:c.4284G>C	15.37:g.89400100G>C	ENSP00000453342:p.Glu1428Asp	Somatic	40	0		WXS	Illumina GAIIx	Phase_I	38	3	NM_001135	0	0	0	0	0	Q13650|Q9UCD3|Q9UCP4|Q9UCP5|Q9UDE0	Missense_Mutation	SNP	ENST00000561243.1	37	CCDS53970.1	.	.	.	.	.	.	.	.	.	.	-	0.500	-0.871439	0.02570	.	.	ENSG00000157766	ENST00000439576;ENST00000352105;ENST00000268134	D;D	0.91945	-2.94;-2.94	3.0	-6.0	0.02206	.	0.488201	0.15307	N	0.269317	T	0.59824	0.2222	N	0.00162	-1.95	0.09310	N	1	B;B	0.13145	0.007;0.007	B;B	0.15870	0.014;0.008	T	0.66232	-0.5975	10	0.02654	T	1	.	7.6123	0.28137	0.1173:0.2143:0.5836:0.0848	.	1428;1428	E7ENV9;E7EX88	.;.	D	1428;1428;1314	ENSP00000387356:E1428D;ENSP00000341615:E1428D	ENSP00000268134:E1314D	E	+	3	2	ACAN	87201104	0.011000	0.17503	0.000000	0.03702	0.006000	0.05464	-1.495000	0.02294	-2.159000	0.00787	-0.689000	0.03729	GAG	.		0.517	ACAN-006	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416267.2	NM_001135	
ARRDC4	91947	hgsc.bcm.edu	37	15	98504326	98504326	+	Missense_Mutation	SNP	A	A	G	rs12101554	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr15:98504326A>G	ENST00000268042.6	+	1	399	c.235A>G	c.(235-237)Acc>Gcc	p.T79A	ARRDC4_ENST00000538249.1_Intron	NM_183376.2	NP_899232.2	Q8NCT1	ARRD4_HUMAN	arrestin domain containing 4	79			T -> A (in dbSNP:rs12101554). {ECO:0000269|PubMed:15489334}.		positive regulation of ubiquitin-protein transferase activity (GO:0051443)	endosome (GO:0005768)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|skin(3)	16	Melanoma(26;0.00539)|Lung NSC(78;0.0125)|all_lung(78;0.0222)		OV - Ovarian serous cystadenocarcinoma(32;0.0417)			CTCGGCCAGCACCGCGGCCCT	0.786													g|||	3817	0.762181	0.5976	0.7118	5008	,	,		7745	0.88		0.7485	False		,,,				2504	0.9131				p.T79A		.											.	ARRDC4-90	0			c.A235G						.		ALA/THR	934,448		327,280,84	1.0	1.0	1.0		235	0.8	0.0	15	dbSNP_120	1	2287,687		920,447,120	no	missense	ARRDC4	NM_183376.2	58	1247,727,204	GG,GA,AA		23.1002,32.4168,26.056	benign	79/419	98504326	3221,1135	691	1487	2178	SO:0001583	missense	91947	exon1			GCCAGCACCGCGG	BC028704	CCDS10377.1	15q26.2	2005-08-16			ENSG00000140450	ENSG00000140450			28087	protein-coding gene	gene with protein product						12477932	Standard	NM_183376		Approved	FLJ36045	uc010bom.3	Q8NCT1	OTTHUMG00000149849	ENST00000268042.6:c.235A>G	15.37:g.98504326A>G	ENSP00000268042:p.Thr79Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_183376	0	0	0	0	0	Q6NSI9	Missense_Mutation	SNP	ENST00000268042.6	37	CCDS10377.1	1613	0.7385531135531136	289	0.5873983739837398	255	0.7044198895027625	512	0.8951048951048951	557	0.7348284960422163	g	3.442	-0.113882	0.06881	0.675832	0.768998	ENSG00000140450	ENST00000268042	T	0.07567	3.18	4.08	0.777	0.18538	Immunoglobulin E-set (1);Arrestin-like, N-terminal (1);	.	.	.	.	T	0.00012	0.0000	N	0.19112	0.55	0.46222	P	0.0010670000000000401	B	0.02656	0.0	B	0.01281	0.0	T	0.39522	-0.9610	8	0.02654	T	1	-4.3851	2.5111	0.04657	0.2812:0.0:0.3307:0.3881	rs12101554;rs17845860;rs17858835;rs57152335	79	Q8NCT1	ARRD4_HUMAN	A	79	ENSP00000268042:T79A	ENSP00000268042:T79A	T	+	1	0	ARRDC4	96305330	0.005000	0.15991	0.001000	0.08648	0.003000	0.03518	-0.193000	0.09573	0.288000	0.22398	-0.370000	0.07254	ACC	A|0.263;G|0.737		0.786	ARRDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313535.1	NM_183376	
PKD1	5310	broad.mit.edu	37	16	2140477	2140477	+	Silent	SNP	G	G	A	rs199674888		TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr16:2140477G>A	ENST00000262304.4	-	45	12461	c.12253C>T	c.(12253-12255)Ctg>Ttg	p.L4085L	RP11-304L19.1_ENST00000570072.1_RNA|PKD1_ENST00000423118.1_Silent_p.L4084L|MIR1225_ENST00000408729.1_RNA	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	4085					anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)	p.L4085M(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						ACACACAGCAGGGGTGACAGG	0.672													g|||	1	0.000199681	0.0	0.0	5008	,	,		16802	0.0		0.001	False		,,,				2504	0.0				p.L4085L		.											.	PKD1-91	1	Substitution - Missense(1)	kidney(1)	c.C12253T						.		,	0,4366		0,0,2183	22.0	27.0	25.0		12250,12253	-0.8	0.1	16		25	1,8577		0,1,4288	no	coding-synonymous,coding-synonymous	PKD1	NM_000296.3,NM_001009944.2	,	0,1,6471	AA,AG,GG		0.0117,0.0,0.0077	,	4084/4303,4085/4304	2140477	1,12943	2183	4289	6472	SO:0001819	synonymous_variant	5310	exon45			ACAGCAGGGGTGA	L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.12253C>T	16.37:g.2140477G>A		Somatic	95	0		WXS	Illumina GAIIx	Phase_I	109	4	NM_001009944	0	0	18	18	0	Q15140|Q15141	Silent	SNP	ENST00000262304.4	37	CCDS32369.1																																																																																			G|0.999;A|0.000		0.672	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341688.1		
PKD1	5310	hgsc.bcm.edu	37	16	2167874	2167874	+	Silent	SNP	G	G	A	rs199685642	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr16:2167874G>A	ENST00000262304.4	-	5	1327	c.1119C>T	c.(1117-1119)ctC>ctT	p.L373L	PKD1_ENST00000423118.1_Silent_p.L373L|RP11-304L19.2_ENST00000562027.1_RNA	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	373					anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						TGCTGAGGTCGAGGCTCTCGT	0.701													g|||	4729	0.944289	0.9924	0.915	5008	,	,		16871	0.999		0.832	False		,,,				2504	0.9591				p.L373L		.											.	PKD1-91	0			c.C1119T						.						1.0	1.0	1.0					16																	2167874		218	660	878	SO:0001819	synonymous_variant	5310	exon5			GAGGTCGAGGCTC	L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.1119C>T	16.37:g.2167874G>A		Somatic	7	2		WXS	Illumina GAIIx	Phase_I	14	6	NM_000296	0	0	4	4	0	Q15140|Q15141	Silent	SNP	ENST00000262304.4	37	CCDS32369.1																																																																																			A|1.000;|0.000		0.701	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341688.1		
BRICD5	283870	bcgsc.ca	37	16	2260567	2260567	+	Missense_Mutation	SNP	C	C	T	rs26857	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr16:2260567C>T	ENST00000562360.1	-	2	135	c.136G>A	c.(136-138)Gtt>Att	p.V46I	BRICD5_ENST00000328540.3_Missense_Mutation_p.V46I|BRICD5_ENST00000566018.1_Missense_Mutation_p.V46I|RP11-304L19.8_ENST00000561544.1_lincRNA			Q6PL45	BRID5_HUMAN	BRICHOS domain containing 5	46			V -> I (in dbSNP:rs26857). {ECO:0000269|PubMed:15489334, ECO:0000269|Ref.1}.			integral component of membrane (GO:0016021)		p.V46I(1)									CCAGCCACAACCCCCACAGCG	0.662													C|||	2582	0.515575	0.497	0.4841	5008	,	,		16452	0.6032		0.4702	False		,,,				2504	0.5194				p.V46I		.											.	.	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	c.G136A						.	C	ILE/VAL	2185,2205		554,1077,564	22.0	27.0	25.0		136	1.2	0.0	16	dbSNP_76	25	4030,4558		965,2100,1229	yes	missense	C16orf79	NM_182563.3	29	1519,3177,1793	TT,TC,CC		46.9259,49.7722,47.8887	benign	46/229	2260567	6215,6763	2195	4294	6489	SO:0001583	missense	283870	exon2			CCACAACCCCCAC	BC039154	CCDS10463.1	16p13.3	2012-10-10	2012-10-10	2012-10-10	ENSG00000182685	ENSG00000182685		"""BRICHOS domain containing"""	28309	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 79"""	C16orf79		12477932	Standard	NM_182563		Approved	MGC21830	uc002cpi.2	Q6PL45	OTTHUMG00000128831	ENST00000562360.1:c.136G>A	16.37:g.2260567C>T	ENSP00000455052:p.Val46Ile	Somatic	177	1		WXS	Illumina GAIIx	Phase_I	225	7	NM_182563	0	0	2	2	0	C9J7K2|Q8IXU9	Missense_Mutation	SNP	ENST00000562360.1	37	CCDS10463.1	1127	0.5160256410256411	252	0.5121951219512195	168	0.46408839779005523	349	0.6101398601398601	358	0.47229551451187335	C	0.024	-1.388868	0.01185	0.497722	0.469259	ENSG00000182685	ENST00000328540	T	0.24151	1.87	5.48	1.17	0.20885	.	0.645519	0.15632	N	0.252357	T	0.00012	0.0000	N	0.03608	-0.345	0.80722	P	0.0	B;B	0.11235	0.004;0.003	B;B	0.13407	0.002;0.009	T	0.43845	-0.9366	9	0.05525	T	0.97	-1.5005	4.4636	0.11678	0.0:0.5028:0.1556:0.3417	rs26857;rs1640774;rs4018449;rs12931243;rs17853879;rs59033835;rs26857	46;46	Q6PL45;Q6PL45-2	CP079_HUMAN;.	I	46	ENSP00000332389:V46I	ENSP00000332389:V46I	V	-	1	0	C16orf79	2200568	0.000000	0.05858	0.003000	0.11579	0.011000	0.07611	0.241000	0.18065	0.298000	0.22638	-0.137000	0.14449	GTT	C|0.523;T|0.477		0.662	BRICD5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000435091.1	NM_182563	
BRICD5	283870	bcgsc.ca	37	16	2260612	2260612	+	Missense_Mutation	SNP	T	T	C	rs26856	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr16:2260612T>C	ENST00000562360.1	-	2	90	c.91A>G	c.(91-93)Agc>Ggc	p.S31G	BRICD5_ENST00000328540.3_Missense_Mutation_p.S31G|BRICD5_ENST00000566018.1_Missense_Mutation_p.S31G|RP11-304L19.8_ENST00000561544.1_lincRNA			Q6PL45	BRID5_HUMAN	BRICHOS domain containing 5	31			S -> G (in dbSNP:rs26856). {ECO:0000269|PubMed:15489334, ECO:0000269|Ref.1}.			integral component of membrane (GO:0016021)											aggagcagGCTCACGGCTCTC	0.657													C|||	3169	0.632788	0.6157	0.6671	5008	,	,		16560	0.6042		0.6998	False		,,,				2504	0.592				p.S31G		.											.	.	0			c.A91G						.	C	GLY/SER	2816,1566		911,994,286	18.0	22.0	21.0		91	2.6	0.0	16	dbSNP_76	21	6103,2489		2200,1703,393	yes	missense	C16orf79	NM_182563.3	56	3111,2697,679	CC,CT,TT		28.9688,35.7371,31.2548	benign	31/229	2260612	8919,4055	2191	4296	6487	SO:0001583	missense	283870	exon2			GCAGGCTCACGGC	BC039154	CCDS10463.1	16p13.3	2012-10-10	2012-10-10	2012-10-10	ENSG00000182685	ENSG00000182685		"""BRICHOS domain containing"""	28309	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 79"""	C16orf79		12477932	Standard	NM_182563		Approved	MGC21830	uc002cpi.2	Q6PL45	OTTHUMG00000128831	ENST00000562360.1:c.91A>G	16.37:g.2260612T>C	ENSP00000455052:p.Ser31Gly	Somatic	92	1		WXS	Illumina GAIIx	Phase_I	103	5	NM_182563	0	0	13	13	0	C9J7K2|Q8IXU9	Missense_Mutation	SNP	ENST00000562360.1	37	CCDS10463.1	1465	0.6707875457875457	316	0.6422764227642277	241	0.6657458563535912	364	0.6363636363636364	544	0.7176781002638523	C	0.011	-1.709638	0.00712	0.642629	0.710312	ENSG00000182685	ENST00000328540	T	0.22134	1.97	5.69	2.61	0.31194	.	0.248793	0.33253	N	0.005113	T	0.00012	0.0000	N	0.01729	-0.75	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.40001	-0.9586	9	0.02654	T	1	-23.0366	4.9257	0.13892	0.1462:0.6122:0.0:0.2416	rs26856;rs567764;rs12917649;rs17857175;rs59500558	31;31	Q6PL45;Q6PL45-2	CP079_HUMAN;.	G	31	ENSP00000332389:S31G	ENSP00000332389:S31G	S	-	1	0	C16orf79	2200613	0.000000	0.05858	0.005000	0.12908	0.001000	0.01503	0.270000	0.18607	0.338000	0.23692	-0.119000	0.15052	AGC	T|0.324;C|0.676		0.657	BRICD5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000435091.1	NM_182563	
C16orf90	646174	broad.mit.edu	37	16	3544636	3544636	+	Silent	SNP	A	A	C			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr16:3544636A>C	ENST00000437192.3	-	2	290	c.288T>G	c.(286-288)ccT>ccG	p.P96P	LA16c-306E5.3_ENST00000574423.2_RNA	NM_001080524.1	NP_001073993.1	A8MZG2	CP090_HUMAN	chromosome 16 open reading frame 90	86										large_intestine(1)	1						CTGTGCCCTCAGGCTGTGGCA	0.692																																					p.P96P		.											.	.	0			c.T288G						.						13.0	14.0	14.0					16																	3544636		1848	4027	5875	SO:0001819	synonymous_variant	646174	exon2			GCCCTCAGGCTGT		CCDS45397.1	16p13.3	2009-01-29			ENSG00000215131	ENSG00000215131			34455	protein-coding gene	gene with protein product							Standard	NM_001080524		Approved	LOC646174	uc002cvi.3	A8MZG2	OTTHUMG00000154627	ENST00000437192.3:c.288T>G	16.37:g.3544636A>C		Somatic	51	1		WXS	Illumina GAIIx	Phase_I	78	3	NM_001080524	0	0	0	0	0		Silent	SNP	ENST00000437192.3	37	CCDS45397.1	.	.	.	.	.	.	.	.	.	.	A	0.915	-0.717789	0.03182	.	.	ENSG00000215131	ENST00000399645	.	.	.	5.7	-5.37	0.02681	.	.	.	.	.	.	.	.	.	.	.	0.24823	N	0.992571	.	.	.	.	.	.	.	.	.	.	.	.	.	-8.5994	8.4536	0.32886	0.556:0.1056:0.3385:0.0	.	.	.	.	G	105	.	.	X	-	1	0	C16orf90	3484637	0.000000	0.05858	0.049000	0.19019	0.907000	0.53573	-0.627000	0.05521	-1.070000	0.03149	-0.376000	0.06991	TGA	.		0.692	C16orf90-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346319.2	NM_001080524	
TRAP1	10131	broad.mit.edu	37	16	3722703	3722703	+	Missense_Mutation	SNP	C	C	T	rs148180859	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr16:3722703C>T	ENST00000246957.5	-	10	1251	c.1163G>A	c.(1162-1164)cGa>cAa	p.R388Q	TRAP1_ENST00000575671.1_Missense_Mutation_p.R179Q|TRAP1_ENST00000573872.1_Intron|TRAP1_ENST00000538171.1_Missense_Mutation_p.R335Q	NM_016292.2	NP_057376.2	Q12931	TRAP1_HUMAN	TNF receptor-associated protein 1	388					chaperone-mediated protein folding (GO:0061077)|negative regulation of cellular respiration (GO:1901856)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|regulation of reactive oxygen species metabolic process (GO:2000377)|response to stress (GO:0006950)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|tumor necrosis factor receptor binding (GO:0005164)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19		Ovarian(90;0.0261)				CAGCGTACCTCGGATGAAGCG	0.637																																					p.R388Q		.											.	TRAP1-226	0			c.G1163A						.	C	GLN/ARG	0,4390	2.1+/-5.4	0,0,2195	113.0	78.0	90.0		1163	5.3	1.0	16	dbSNP_134	90	6,8594	4.3+/-15.6	0,6,4294	yes	missense	TRAP1	NM_016292.2	43	0,6,6489	TT,TC,CC		0.0698,0.0,0.0462	probably-damaging	388/705	3722703	6,12984	2195	4300	6495	SO:0001583	missense	10131	exon10			GTACCTCGGATGA	AF154108	CCDS10508.1, CCDS61824.1	16p13.3	2011-09-02			ENSG00000126602	ENSG00000126602		"""Heat shock proteins / HSPC"""	16264	protein-coding gene	gene with protein product		606219				10652318, 7876093	Standard	NM_016292		Approved	HSP75, HSP90L	uc002cvt.4	Q12931	OTTHUMG00000129427	ENST00000246957.5:c.1163G>A	16.37:g.3722703C>T	ENSP00000246957:p.Arg388Gln	Somatic	82	1		WXS	Illumina GAIIx	Phase_I	142	5	NM_016292	0	0	0	0	0	B4DR68|D3DUC8|F5H897|O43642|O75235|Q9UHL5	Missense_Mutation	SNP	ENST00000246957.5	37	CCDS10508.1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.574950	0.86542	0.0	6.98E-4	ENSG00000126602	ENST00000246957;ENST00000538171	T;T	0.09911	2.93;2.93	5.35	5.35	0.76521	Ribosomal protein S5 domain 2-type fold (1);	0.000000	0.85682	D	0.000000	T	0.23926	0.0579	M	0.76727	2.345	0.80722	D	1	P;P	0.42941	0.756;0.794	B;P	0.46659	0.388;0.523	T	0.00581	-1.1660	10	0.52906	T	0.07	-19.8289	18.3915	0.90485	0.0:1.0:0.0:0.0	.	335;388	F5H897;Q12931	.;TRAP1_HUMAN	Q	388;335	ENSP00000246957:R388Q;ENSP00000442070:R335Q	ENSP00000246957:R388Q	R	-	2	0	TRAP1	3662704	1.000000	0.71417	0.975000	0.42487	0.215000	0.24574	5.675000	0.68123	2.665000	0.90641	0.491000	0.48974	CGA	C|1.000;T|0.000		0.637	TRAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251586.2	NM_016292	
CLEC19A	728276	broad.mit.edu;bcgsc.ca	37	16	19310092	19310092	+	Silent	SNP	T	T	C	rs1548450	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr16:19310092T>C	ENST00000465414.1	+	2	259	c.186T>C	c.(184-186)gcT>gcC	p.A62A	CLEC19A_ENST00000493231.1_Silent_p.A62A			Q6UXS0	CL19A_HUMAN	C-type lectin domain family 19, member A	62	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.					extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)										AGACCTGGGCTGAGGCCGACC	0.582													T|||	2340	0.467252	0.6815	0.3415	5008	,	,		15617	0.5099		0.2962	False		,,,				2504	0.3988				p.A62A		.											.	.	0			c.T186C						.																																			SO:0001819	synonymous_variant	728276	exon2			CTGGGCTGAGGCC			16p12.3	2013-01-07			ENSG00000261210	ENSG00000261210		"""C-type lectin domain containing"""	34522	protein-coding gene	gene with protein product							Standard	NM_001256720		Approved		uc031qvg.1	Q6UXS0	OTTHUMG00000177218	ENST00000465414.1:c.186T>C	16.37:g.19310092T>C		Somatic	73	0		WXS	Illumina GAIIx	Phase_I	102	5	NM_001256720	0	0	0	0	0	Q0VF32	Silent	SNP	ENST00000465414.1	37																																																																																				T|0.565;C|0.435		0.582	CLEC19A-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000254277.2	NM_00125672	
DNAH3	55567	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	21060895	21060895	+	Frame_Shift_Del	DEL	T	T	-			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr16:21060895delT	ENST00000261383.3	-	31	4455	c.4456delA	c.(4456-4458)atcfs	p.I1486fs	DNAH3_ENST00000415178.1_Frame_Shift_Del_p.I1486fs	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	1486	AAA 1. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		GTTACCTCGATCCTGTTGAAC	0.502																																					p.I1486fs		.											.	DNAH3-167	0			c.4456delA						.						86.0	76.0	79.0					16																	21060895		2201	4300	6501	SO:0001589	frameshift_variant	55567	exon31			CCTCGATCCTGTT	U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.4456delA	16.37:g.21060895delT	ENSP00000261383:p.Ile1486fs	Somatic	85	0		WXS	Illumina GAIIx	Phase_I	96	15	NM_017539	0	0	0	0	0	O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Frame_Shift_Del	DEL	ENST00000261383.3	37	CCDS10594.1																																																																																			.		0.502	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	NM_017539	
SEZ6L2	26470	hgsc.bcm.edu	37	16	29908433	29908433	+	Missense_Mutation	SNP	C	C	G	rs11649499	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr16:29908433C>G	ENST00000308713.5	-	3	748	c.221G>C	c.(220-222)cGg>cCg	p.R74P	SEZ6L2_ENST00000562159.1_5'UTR|SEZ6L2_ENST00000350527.3_Intron|SEZ6L2_ENST00000537485.1_Missense_Mutation_p.R30P|SEZ6L2_ENST00000346932.5_Missense_Mutation_p.R74P	NM_001114099.2|NM_201575.3	NP_001107571.1|NP_963869.2	Q6UXD5	SE6L2_HUMAN	seizure related 6 homolog (mouse)-like 2	74	Pro-rich.		R -> P (in dbSNP:rs11649499). {ECO:0000269|PubMed:12975309, ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						CGTGGGGTCCCGATCAGATCC	0.667													G|||	3761	0.750998	0.9932	0.7464	5008	,	,		9668	0.6052		0.827	False		,,,				2504	0.499				p.R74P		.											.	SEZ6L2-92	0			c.G221C						.	G	,PRO/ARG,,PRO/ARG	4084,194		1951,182,6	7.0	10.0	9.0		,221,,221	2.8	1.0	16	dbSNP_120	9	7159,1331		3016,1127,102	yes	intron,missense,intron,missense	SEZ6L2	NM_001114099.2,NM_001114100.2,NM_012410.3,NM_201575.3	,103,,103	4967,1309,108	GG,GC,CC		15.6773,4.5348,11.9439	,benign,,benign	,74/810,,74/911	29908433	11243,1525	2139	4245	6384	SO:0001583	missense	26470	exon3			GGGTCCCGATCAG	AY358404	CCDS10658.1, CCDS10659.1, CCDS45458.1, CCDS58447.1, CCDS73865.1	16p12.1	2008-02-05			ENSG00000174938	ENSG00000174938			30844	protein-coding gene	gene with protein product	"""type I transmembrane receptor (seizure related protein)"""					12975309	Standard	NM_012410		Approved	PSK-1, FLJ90517	uc010vec.2	Q6UXD5	OTTHUMG00000132112	ENST00000308713.5:c.221G>C	16.37:g.29908433C>G	ENSP00000312550:p.Arg74Pro	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_001243332	0	0	0	0	0	B7Z1N0|F5H293|H7BXQ6|Q9BW82|Q9UJ45|Q9UJ46|Q9UJ47	Missense_Mutation	SNP	ENST00000308713.5	37	CCDS10659.1	1718	0.7866300366300366	484	0.983739837398374	282	0.7790055248618785	322	0.5629370629370629	630	0.8311345646437994	G	0.009	-1.806021	0.00606	0.954652	0.843227	ENSG00000174938	ENST00000308713;ENST00000346932;ENST00000537485	T;T;T	0.45276	0.9;0.9;0.9	5.17	2.85	0.33270	.	0.128667	0.35436	N	0.003211	T	0.00012	0.0000	N	0.03608	-0.345	0.50632	P	1.1099999999997223E-4	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.30621	-0.9972	8	.	.	.	.	7.5026	0.27526	0.1787:0.1431:0.6783:0.0	rs11649499;rs60390109;rs11649499	30;74	F5H293;Q6UXD5	.;SE6L2_HUMAN	P	74;74;30	ENSP00000312550:R74P;ENSP00000319215:R74P;ENSP00000439412:R30P	.	R	-	2	0	SEZ6L2	29815934	0.685000	0.27652	1.000000	0.80357	0.050000	0.14768	0.504000	0.22626	0.600000	0.29862	-0.998000	0.02512	CGG	C|0.218;G|0.782		0.667	SEZ6L2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255154.2	NM_012410	
MTSS1L	92154	broad.mit.edu	37	16	70698201	70698201	+	Silent	SNP	C	C	A			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr16:70698201C>A	ENST00000338779.6	-	15	1897	c.1623G>T	c.(1621-1623)ggG>ggT	p.G541G	FLJ00418_ENST00000597002.1_5'UTR	NM_138383.2	NP_612392.1	Q765P7	MTSSL_HUMAN	metastasis suppressor 1-like	541					filopodium assembly (GO:0046847)|signal transduction (GO:0007165)					breast(1)|central_nervous_system(2)|endometrium(1)|liver(1)|lung(1)|skin(1)	7						CGGTGGGCAGCCCAGCAGTGG	0.711																																					p.G541G		.											.	MTSS1L-68	0			c.G1623T						.						22.0	24.0	24.0					16																	70698201		2188	4278	6466	SO:0001819	synonymous_variant	92154	exon15			GGGCAGCCCAGCA		CCDS32476.1	16q22.1	2008-12-16				ENSG00000132613			25094	protein-coding gene	gene with protein product	"""actin-bundling protein with BAIAP2 homology"""					12477932	Standard	XM_006721335		Approved	ABBA-1, LOC92154	uc002ezj.3	Q765P7		ENST00000338779.6:c.1623G>T	16.37:g.70698201C>A		Somatic	40	1		WXS	Illumina GAIIx	Phase_I	66	10	NM_138383	0	0	7	7	0	A6NJI7|Q9BUA8	Silent	SNP	ENST00000338779.6	37	CCDS32476.1																																																																																			.		0.711	MTSS1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434927.3	NM_138383	
PKD1L2	114780	bcgsc.ca	37	16	81199553	81199553	+	RNA	SNP	G	G	T	rs386792883		TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr16:81199553G>T	ENST00000525539.1	-	0	3108				PKD1L2_ENST00000533478.1_RNA	NM_052892.3	NP_443124.3	Q7Z442	PK1L2_HUMAN	polycystic kidney disease 1-like 2						ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						CGAAGCAGCCGCAGCACTGTG	0.567																																					.		.											.	PKD1L2-92	0			.						.						21.0	22.0	22.0					16																	81199553		2056	4205	6261			114780	.			GCAGCCGCAGCAC	AY164483	CCDS61998.1, CCDS61999.1	16q23.2	2014-09-11			ENSG00000166473	ENSG00000166473			21715	protein-coding gene	gene with protein product		607894				12782129	Standard	NM_052892		Approved	KIAA1879	uc002fgf.1	Q7Z442	OTTHUMG00000166126		16.37:g.81199553G>T		Somatic	49	0		WXS	Illumina GAIIx	Phase_I	50	4	.	0	0	0	0	0	Q6UEE1|Q6ZN46|Q6ZSP2|Q8N1H9|Q96CL2|Q96Q08	RNA	SNP	ENST00000525539.1	37																																																																																				.		0.567	PKD1L2-001	KNOWN	non_canonical_polymorphism|basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000387972.2		
GAS8	2622	ucsc.edu	37	16	90095597	90095597	+	Intron	SNP	T	T	C	rs61118444|rs71137702	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr16:90095597T>C	ENST00000268699.4	+	2	212				C16orf3_ENST00000408886.2_Missense_Mutation_p.I52V|GAS8_ENST00000540721.1_Intron|GAS8_ENST00000536122.1_Intron	NM_001481.2	NP_001472.1	O95995	GAS8_HUMAN	growth arrest-specific 8						cellular protein localization (GO:0034613)|negative regulation of cell proliferation (GO:0008285)|sperm motility (GO:0030317)	Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile cilium (GO:0031514)				endometrium(3)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	14		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.029)		gggcaggctatggggcagcct	0.662													t|||	2317	0.46266	0.3767	0.4611	5008	,	,		15322	0.63		0.3757	False		,,,				2504	0.4969				p.I52V		.											.	C16orf3-90	0			c.A154G						.						20.0	23.0	22.0					16																	90095597		2197	4299	6496	SO:0001627	intron_variant	750	exon1			AGGCTATGGGGCA	AF050079	CCDS10992.1, CCDS67101.1, CCDS73932.1	16q24.3	2014-07-18	2003-01-16	2003-01-17	ENSG00000141013	ENSG00000141013			4166	protein-coding gene	gene with protein product		605178	"""growth arrest-specific 11"""	GAS11		9790751	Standard	NM_001481		Approved		uc002fqi.1	O95995	OTTHUMG00000138988	ENST00000268699.4:c.90+1467T>C	16.37:g.90095597T>C		Somatic	54	1		WXS	Illumina GAIIx	Phase_I	88	12	NM_001214	0	0	0	0	0	B2RCT1|B7Z4U1|G3V1L5|Q2M234	Missense_Mutation	SNP	ENST00000268699.4	37	CCDS10992.1	.	.	.	.	.	.	.	.	.	.	t	0.096	-1.158920	0.01686	.	.	ENSG00000221819	ENST00000408886	T	0.47177	0.85	.	.	.	.	.	.	.	.	T	0.17408	0.0418	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.14117	-1.0484	5	.	.	.	.	.	.	.	rs61118444;rs62640378	60	O95177	CP003_HUMAN	V	52	ENSP00000386218:I52V	.	I	-	1	0	C16orf3	88623098	0.005000	0.15991	0.000000	0.03702	0.009000	0.06853	-2.049000	0.01405	-2.579000	0.00463	-1.976000	0.00459	ATA	T|0.361;C|0.639		0.662	GAS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000272877.2		
MINK1	50488	hgsc.bcm.edu	37	17	4793052	4793052	+	Silent	SNP	C	C	T	rs2277681	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr17:4793052C>T	ENST00000355280.6	+	13	1537	c.1341C>T	c.(1339-1341)cgC>cgT	p.R447R	MINK1_ENST00000347992.7_Silent_p.R447R|MINK1_ENST00000453408.3_Silent_p.R447R	NM_001024937.3|NM_015716.4|NM_153827.4	NP_001020108.1|NP_056531.1|NP_722549.2			misshapen-like kinase 1											central_nervous_system(2)|large_intestine(1)|lung(1)|skin(1)|stomach(1)	6						agGCGGAGCGCGAGCAGGTAG	0.746													C|||	255	0.0509185	0.0257	0.0576	5008	,	,		6705	0.0595		0.0954	False		,,,				2504	0.0256				p.R447R		.											.	MINK1-943	0			c.C1341T						.	C	,,,	86,3598		2,82,1758	4.0	9.0	7.0		1341,1341,1341,1341	-6.7	0.9	17	dbSNP_100	7	519,7015		19,481,3267	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	MINK1	NM_001024937.3,NM_015716.4,NM_153827.4,NM_170663.4	,,,	21,563,5025	TT,TC,CC		6.8888,2.3344,5.3931	,,,	447/1313,447/1296,447/1333,447/1304	4793052	605,10613	1842	3767	5609	SO:0001819	synonymous_variant	50488	exon13			GGAGCGCGAGCAG	AY775058	CCDS45588.1, CCDS45589.1, CCDS45590.1	17p13.2	2011-04-14	2010-06-24		ENSG00000141503	ENSG00000141503			17565	protein-coding gene	gene with protein product	"""misshapen/NIK-related kinase"""	609426	"""misshapen-like kinase 1 (zebrafish)"""			10708748, 12087176	Standard	NM_015716		Approved	B55, MINK, ZC3, MAP4K6, YSK2	uc010vsl.2	Q8N4C8		ENST00000355280.6:c.1341C>T	17.37:g.4793052C>T		Somatic	1	1		WXS	Illumina GAIIx	Phase_I	34	31	NM_170663	0	0	0	1	1		Silent	SNP	ENST00000355280.6	37	CCDS45588.1																																																																																			C|0.925;T|0.075		0.746	MINK1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439801.1	NM_015716	
C17orf59	54785	ucsc.edu	37	17	8092694	8092694	+	Silent	SNP	T	T	G	rs8531	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr17:8092694T>G	ENST00000389017.4	-	1	870	c.765A>C	c.(763-765)ccA>ccC	p.P255P	MIR3676_ENST00000579470.1_RNA	NM_017622.2	NP_060092.2	Q96GS4	CQ059_HUMAN	chromosome 17 open reading frame 59	255	Pro-rich.									large_intestine(2)|lung(3)|urinary_tract(1)	6						CGGGGTCGATTGGGGGAATGG	0.716													G|||	3008	0.600639	0.6029	0.4971	5008	,	,		14381	0.2887		0.827	False		,,,				2504	0.7597				p.P255P		.											.	C17orf59-90	0			c.A765C						.	G		2924,1468		981,962,253	12.0	13.0	13.0		765	2.3	1.0	17	dbSNP_52	13	7050,1534		2940,1170,182	no	coding-synonymous	C17orf59	NM_017622.2		3921,2132,435	GG,GT,TT		17.8705,33.4244,23.135		255/358	8092694	9974,3002	2196	4292	6488	SO:0001819	synonymous_variant	54785	exon1			GTCGATTGGGGGA	BC018880	CCDS11133.2	17p13.1	2005-12-16			ENSG00000196544	ENSG00000196544			25939	protein-coding gene	gene with protein product						12477932	Standard	NM_017622		Approved	FLJ20014	uc010vut.2	Q96GS4	OTTHUMG00000153930	ENST00000389017.4:c.765A>C	17.37:g.8092694T>G		Somatic	11	0		WXS	Illumina GAIIx	Phase_I	46	18	NM_017622	0	0	6	8	2	Q53HS4|Q9NXW8	Silent	SNP	ENST00000389017.4	37	CCDS11133.2																																																																																			T|0.356;G|0.644		0.716	C17orf59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333072.1	NM_017622	
SUPT6H	6830	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	27022538	27022538	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr17:27022538G>C	ENST00000314616.6	+	29	4226	c.3943G>C	c.(3943-3945)Gac>Cac	p.D1315H	SUPT6H_ENST00000347486.4_Missense_Mutation_p.D1315H	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)	1315					chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					GCAGGAGGAGGACATGAAGCG	0.562																																					p.D1315H		.											.	SUPT6H-93	0			c.G3943C						.						93.0	78.0	83.0					17																	27022538		2203	4300	6503	SO:0001583	missense	6830	exon29			GAGGAGGACATGA	U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85		ENST00000314616.6:c.3943G>C	17.37:g.27022538G>C	ENSP00000319104:p.Asp1315His	Somatic	237	0		WXS	Illumina GAIIx	Phase_I	194	73	NM_003170	0	0	10	20	10	A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Missense_Mutation	SNP	ENST00000314616.6	37	CCDS32596.1	.	.	.	.	.	.	.	.	.	.	G	28.7	4.939123	0.92526	.	.	ENSG00000109111	ENST00000314616	.	.	.	5.79	5.79	0.91817	.	0.044016	0.85682	D	0.000000	T	0.62877	0.2464	L	0.49778	1.585	0.80722	D	1	P	0.47910	0.902	P	0.47430	0.547	T	0.63305	-0.6667	9	0.52906	T	0.07	-25.1453	20.0345	0.97552	0.0:0.0:1.0:0.0	.	1315	Q7KZ85	SPT6H_HUMAN	H	1315	.	ENSP00000319104:D1315H	D	+	1	0	SUPT6H	24046665	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.355000	0.97087	2.733000	0.93635	0.650000	0.86243	GAC	.		0.562	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446422.2	NM_003170	
MYO19	80179	ucsc.edu;bcgsc.ca	37	17	34854393	34854393	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr17:34854393G>T	ENST00000431794.3	-	25	2996	c.2474C>A	c.(2473-2475)gCc>gAc	p.A825D	ZNHIT3_ENST00000588253.1_3'UTR|MYO19_ENST00000268852.9_Missense_Mutation_p.A625D	NM_001163735.1	NP_001157207.1	Q96H55	MYO19_HUMAN	myosin XIX	825						cytoplasm (GO:0005737)|mitochondrial outer membrane (GO:0005741)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			endometrium(6)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|urinary_tract(1)	20		Breast(25;0.00957)|Ovarian(249;0.17)	Kidney(155;0.104)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		AGCAAGGCAGGCCATTCTGAT	0.438																																					p.A825D		.											.	MYO19-23	0			c.C2474A						.						41.0	40.0	40.0					17																	34854393		1934	4131	6065	SO:0001583	missense	80179	exon26			AGGCAGGCCATTC	BC008900	CCDS45654.1, CCDS54112.1, CCDS59283.1	17q12	2014-08-12	2007-09-26	2007-09-26	ENSG00000278259	ENSG00000278259		"""Myosins / Myosin superfamily : Class XIX"""	26234	protein-coding gene	gene with protein product			"""myosin head domain containing 1"""	MYOHD1		17877792, 19932026	Standard	NM_001033580		Approved	FLJ22865	uc010wcy.2	Q96H55	OTTHUMG00000188437	ENST00000431794.3:c.2474C>A	17.37:g.34854393G>T	ENSP00000409936:p.Ala825Asp	Somatic	52	0		WXS	Illumina GAIIx	Phase_I	35	4	NM_001163735	0	0	1	1	0	Q59GS4|Q9H5X2	Missense_Mutation	SNP	ENST00000431794.3	37	CCDS54112.1	.	.	.	.	.	.	.	.	.	.	G	7.972	0.749221	0.15710	.	.	ENSG00000141140	ENST00000431794;ENST00000268852	T;T	0.72942	-0.7;-0.7	5.8	4.78	0.61160	.	0.172442	0.27604	N	0.018626	T	0.58977	0.2160	N	0.25890	0.77	0.80722	D	1	B;B	0.15930	0.002;0.015	B;B	0.16722	0.003;0.016	T	0.59037	-0.7529	10	0.87932	D	0	.	13.0726	0.59070	0.0:0.0:0.8068:0.1932	.	825;625	Q96H55;Q96H55-4	MYO19_HUMAN;.	D	825;625	ENSP00000409936:A825D;ENSP00000268852:A625D	ENSP00000268852:A625D	A	-	2	0	MYO19	31928506	1.000000	0.71417	1.000000	0.80357	0.661000	0.39034	2.144000	0.42197	2.764000	0.94973	0.485000	0.47835	GCC	.		0.438	MYO19-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451074.1	NM_025109	
KRT17	3872	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	39780504	39780504	+	Silent	SNP	G	G	T			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr17:39780504G>T	ENST00000311208.8	-	1	325	c.258C>A	c.(256-258)gcC>gcA	p.A86A	KRT42P_ENST00000438131.1_RNA|JUP_ENST00000540235.1_Intron	NM_000422.2	NP_000413.1	Q04695	K1C17_HUMAN	keratin 17	86	Coil 1A.|Rod.				epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinization (GO:0031424)|morphogenesis of an epithelium (GO:0002009)|positive regulation of cell growth (GO:0030307)|positive regulation of hair follicle development (GO:0051798)|positive regulation of translation (GO:0045727)|signal transduction (GO:0007165)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	MHC class II protein binding (GO:0042289)|MHC class II receptor activity (GO:0032395)|structural constituent of cytoskeleton (GO:0005200)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|skin(1)	12		Breast(137;0.000307)				TCTGCATGGTGGCCTTCTCAC	0.607																																					p.A86A	Pancreas(92;1242 2086 39193 50508)	.											.	KRT17-92	0			c.C258A						.						80.0	83.0	82.0					17																	39780504		2203	4300	6503	SO:0001819	synonymous_variant	3872	exon1			CATGGTGGCCTTC	X62571	CCDS11402.1	17q21.2	2014-06-12			ENSG00000128422	ENSG00000128422		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6427	protein-coding gene	gene with protein product		148069		PCHC1		7539673, 1281771, 16831889	Standard	NM_000422		Approved		uc002hxh.2	Q04695	OTTHUMG00000133505	ENST00000311208.8:c.258C>A	17.37:g.39780504G>T		Somatic	385	1		WXS	Illumina GAIIx	Phase_I	371	19	NM_000422	0	0	0	0	0	A5Z1M9|A5Z1N0|A5Z1N1|A5Z1N2|A6NDV6|A6NKQ2|Q6IP98|Q8N1P6	Silent	SNP	ENST00000311208.8	37	CCDS11402.1																																																																																			.		0.607	KRT17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257460.1	NM_000422	
JUP	3728	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	39913762	39913762	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr17:39913762G>A	ENST00000393931.3	-	12	2069	c.1951C>T	c.(1951-1953)Cgc>Tgc	p.R651C	JUP_ENST00000393930.1_Missense_Mutation_p.R651C|JUP_ENST00000310706.5_Missense_Mutation_p.R651C|JUP_ENST00000540235.1_Intron	NM_002230.2	NP_002221.1	P14923	PLAK_HUMAN	junction plakoglobin	651	Interaction with DSC1.				adherens junction organization (GO:0034332)|atrioventricular valve morphogenesis (GO:0003181)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell-cell junction organization (GO:0045216)|cellular response to indole-3-methanol (GO:0071681)|cytoskeletal anchoring at plasma membrane (GO:0007016)|desmosome assembly (GO:0002159)|detection of mechanical stimulus (GO:0050982)|ectoderm development (GO:0007398)|endothelial cell-cell adhesion (GO:0071603)|establishment of protein localization to plasma membrane (GO:0090002)|gastrulation (GO:0007369)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of Wnt signaling pathway involved in heart development (GO:0003308)|nervous system development (GO:0007399)|oocyte development (GO:0048599)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein heterooligomerization (GO:0051291)|regulation of cell proliferation (GO:0042127)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|skin development (GO:0043588)|ventricular cardiac muscle cell action potential (GO:0086005)	actin cytoskeleton (GO:0015629)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|gamma-catenin-TCF7L2 complex (GO:0071665)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|cadherin binding (GO:0045296)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|structural constituent of cell wall (GO:0005199)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)	23		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.233)	BRCA - Breast invasive adenocarcinoma(366;0.15)		TCGGAGATGCGGAACAGGACG	0.622																																					p.R651C	Colon(16;42 520 6044 17852 28530)	.											.	JUP-479	0			c.C1951T						.						91.0	90.0	90.0					17																	39913762		2203	4300	6503	SO:0001583	missense	3728	exon12			AGATGCGGAACAG	AF233882	CCDS11407.1	17q21	2014-09-17	2004-08-09		ENSG00000173801	ENSG00000173801		"""Armadillo repeat containing"""	6207	protein-coding gene	gene with protein product		173325	"""catenin (cadherin-associated protein), gamma 80kDa"""	CTNNG		1889810, 7604000	Standard	NM_021991		Approved	DP3, PDGB, PKGB, DPIII	uc002hxs.2	P14923	OTTHUMG00000133494	ENST00000393931.3:c.1951C>T	17.37:g.39913762G>A	ENSP00000377508:p.Arg651Cys	Somatic	281	0		WXS	Illumina GAIIx	Phase_I	346	30	NM_021991	0	0	8	8	0	Q15093|Q15151|Q7L3S5|Q86W21|Q9BWC4|Q9HCX9	Missense_Mutation	SNP	ENST00000393931.3	37	CCDS11407.1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.783159	0.90282	.	.	ENSG00000173801	ENST00000393930;ENST00000310706;ENST00000393931	T;T;T	0.66099	-0.19;-0.19;-0.19	4.98	4.98	0.66077	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.76190	0.3953	L	0.58354	1.805	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.77768	-0.2464	10	0.62326	D	0.03	-30.0662	17.0053	0.86391	0.0:0.0:1.0:0.0	.	651	P14923	PLAK_HUMAN	C	651	ENSP00000377507:R651C;ENSP00000311113:R651C;ENSP00000377508:R651C	ENSP00000311113:R651C	R	-	1	0	JUP	37167288	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	5.224000	0.65288	2.595000	0.87683	0.561000	0.74099	CGC	.		0.622	JUP-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257406.1		
ASB16	92591	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	42255661	42255661	+	Missense_Mutation	SNP	G	G	C	rs199556388	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr17:42255661G>C	ENST00000293414.1	+	5	1349	c.1265G>C	c.(1264-1266)cGg>cCg	p.R422P	ASB16-AS1_ENST00000588785.1_RNA|ASB16-AS1_ENST00000591166.1_RNA|ASB16-AS1_ENST00000592897.1_RNA|ASB16-AS1_ENST00000585457.1_RNA	NM_080863.4	NP_543139.4	Q96NS5	ASB16_HUMAN	ankyrin repeat and SOCS box containing 16	422	SOCS box. {ECO:0000255|PROSITE- ProRule:PRU00194}.				intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(2)|liver(2)|lung(2)|prostate(1)	14		Breast(137;0.00765)|Prostate(33;0.0313)		BRCA - Breast invasive adenocarcinoma(366;0.114)		GTGCGCGCTCGGTTGGGAAGC	0.677																																					p.R422P		.											.	ASB16-227	0			c.G1265C						.						28.0	27.0	28.0					17																	42255661		2203	4300	6503	SO:0001583	missense	92591	exon5			GCGCTCGGTTGGG	AK054727	CCDS11478.1	17q21.31	2013-01-10	2011-01-25		ENSG00000161664	ENSG00000161664		"""Ankyrin repeat domain containing"""	19768	protein-coding gene	gene with protein product		615056	"""ankyrin repeat and SOCS box-containing 16"""			12076535	Standard	NM_080863		Approved	FLJ30165	uc002ifl.1	Q96NS5	OTTHUMG00000181809	ENST00000293414.1:c.1265G>C	17.37:g.42255661G>C	ENSP00000293414:p.Arg422Pro	Somatic	30	0		WXS	Illumina GAIIx	Phase_I	79	25	NM_080863	0	0	0	0	0	B2RBC0|Q8WXK0	Missense_Mutation	SNP	ENST00000293414.1	37	CCDS11478.1	.	.	.	.	.	.	.	.	.	.	g	9.295	1.051554	0.19827	.	.	ENSG00000161664	ENST00000293414	T	0.44482	0.92	5.36	0.526	0.17078	SOCS protein, C-terminal (3);	0.791393	0.11871	N	0.521482	T	0.31451	0.0797	L	0.27053	0.805	0.09310	N	1	P	0.35821	0.523	B	0.43052	0.406	T	0.25710	-1.0124	10	0.33940	T	0.23	-18.6349	5.3866	0.16222	0.649:0.0:0.2269:0.1241	.	422	Q96NS5	ASB16_HUMAN	P	422	ENSP00000293414:R422P	ENSP00000293414:R422P	R	+	2	0	ASB16	39611187	0.000000	0.05858	0.815000	0.32552	0.367000	0.29736	0.840000	0.27600	0.165000	0.19558	-1.163000	0.01768	CGG	G|0.999;A|0.001		0.677	ASB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457703.1		
FOXJ1	2302	hgsc.bcm.edu	37	17	74133974	74133974	+	Silent	SNP	C	C	T	rs894542	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr17:74133974C>T	ENST00000322957.6	-	3	1080	c.726G>A	c.(724-726)acG>acA	p.T242T	RNF157-AS1_ENST00000590137.1_RNA|RNF157-AS1_ENST00000585542.1_RNA	NM_001454.3	NP_001445.2	Q92949	FOXJ1_HUMAN	forkhead box J1	242					actin cytoskeleton organization (GO:0030036)|activation of Rho GTPase activity (GO:0032862)|brain development (GO:0007420)|central tolerance induction (GO:0002508)|cilium assembly (GO:0042384)|epithelium development (GO:0060429)|establishment of apical/basal cell polarity (GO:0035089)|glomerular parietal epithelial cell development (GO:0072016)|humoral immune response (GO:0006959)|left/right pattern formation (GO:0060972)|leukocyte migration (GO:0050900)|lung epithelium development (GO:0060428)|metanephric part of ureteric bud development (GO:0035502)|negative regulation of B cell activation (GO:0050869)|negative regulation of germinal center formation (GO:0002635)|negative regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002924)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of T cell differentiation in thymus (GO:0033085)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|pattern specification process (GO:0007389)|positive regulation of central B cell tolerance induction (GO:0002897)|positive regulation of lung ciliated cell differentiation (GO:1901248)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			large_intestine(1)|liver(1)|pancreas(1)|skin(1)	4			LUSC - Lung squamous cell carcinoma(166;0.187)			CGGTATTCACCGTCAGCGGCC	0.716													C|||	385	0.076877	0.0431	0.134	5008	,	,		12954	0.0347		0.1103	False		,,,				2504	0.091				p.T242T		.											.	FOXJ1-227	0			c.G726A						.	C		156,3988		3,150,1919	4.0	6.0	5.0		726	1.5	1.0	17	dbSNP_86	5	700,7392		28,644,3374	no	coding-synonymous	FOXJ1	NM_001454.3		31,794,5293	TT,TC,CC		8.6505,3.7645,6.9958		242/422	74133974	856,11380	2072	4046	6118	SO:0001819	synonymous_variant	2302	exon3			ATTCACCGTCAGC	X99349	CCDS32739.1	17q25.1	2008-05-14				ENSG00000129654		"""Forkhead boxes"""	3816	protein-coding gene	gene with protein product		602291		FKHL13		9073514, 16518568	Standard	NM_001454		Approved	HFH-4, HFH4	uc002jqx.3	Q92949		ENST00000322957.6:c.726G>A	17.37:g.74133974C>T		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	5	4	NM_001454	0	0	0	0	0	O00630	Silent	SNP	ENST00000322957.6	37	CCDS32739.1																																																																																			C|0.925;T|0.075		0.716	FOXJ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449856.1	NM_001454	
ACTG1	71	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	79478286	79478286	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr17:79478286C>G	ENST00000575842.1	-	3	1156	c.730G>C	c.(730-732)Gat>Cat	p.D244H	ACTG1_ENST00000331925.2_Missense_Mutation_p.D244H|ACTG1_ENST00000575087.1_Missense_Mutation_p.D244H|ACTG1_ENST00000573283.1_Missense_Mutation_p.D244H|AC139149.1_ENST00000584254.1_RNA|RP13-766D20.2_ENST00000430912.1_RNA			P63261	ACTG_HUMAN	actin, gamma 1	244					adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|platelet aggregation (GO:0070527)|retina homeostasis (GO:0001895)|sarcomere organization (GO:0045214)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|membrane (GO:0016020)|myofibril (GO:0030016)|nucleus (GO:0005634)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|lung(8)|ovary(2)|prostate(5)|urinary_tract(1)	29	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0547)			ACCTGGCCATCGGGCAGCTCG	0.587																																					p.D244H		.											.	ACTG1-91	0			c.G730C						.						62.0	65.0	64.0					17																	79478286		2203	4300	6503	SO:0001583	missense	71	exon4			GGCCATCGGGCAG		CCDS11782.1	17q25	2010-04-23	2004-05-19		ENSG00000184009	ENSG00000184009			144	protein-coding gene	gene with protein product		102560	"""deafness, autosomal dominant 20; deafness, autosomal dominant 26"""	ACTG, DFNA20, DFNA26		14684684	Standard	NM_001614		Approved		uc002kal.2	P63261		ENST00000575842.1:c.730G>C	17.37:g.79478286C>G	ENSP00000458162:p.Asp244His	Somatic	289	0		WXS	Illumina GAIIx	Phase_I	366	85	NM_001614	0	0	659	877	218	A8K7C2|P02571|P14104|P99022|Q5U032|Q96E67	Missense_Mutation	SNP	ENST00000575842.1	37	CCDS11782.1	.	.	.	.	.	.	.	.	.	.	c	14.04	2.417663	0.42918	.	.	ENSG00000184009	ENST00000331925;ENST00000447294	D	0.97941	-4.62	4.56	4.56	0.56223	.	0.000000	0.85682	D	0.000000	D	0.98852	0.9612	H	0.98802	4.335	0.58432	D	0.999999	B	0.33748	0.423	B	0.42798	0.398	D	0.99937	1.1374	10	0.87932	D	0	.	16.2178	0.82239	0.0:1.0:0.0:0.0	.	244	P63261	ACTG_HUMAN	H	244;202	ENSP00000331514:D244H	ENSP00000331514:D244H	D	-	1	0	ACTG1	77092881	1.000000	0.71417	0.116000	0.21606	0.418000	0.31294	7.396000	0.79891	2.116000	0.64780	0.553000	0.69018	GAT	.		0.587	ACTG1-012	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439935.2	NM_001614	
TXNDC2	84203	hgsc.bcm.edu	37	18	9886894	9886894	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr18:9886894A>G	ENST00000306084.6	+	2	617	c.418A>G	c.(418-420)Aaa>Gaa	p.K140E	TXNDC2_ENST00000426718.3_3'UTR|TXNDC2_ENST00000357775.5_Missense_Mutation_p.K73E|TXNDC2_ENST00000536353.2_Missense_Mutation_p.K73E	NM_001098529.1	NP_001091999.1	Q86VQ3	TXND2_HUMAN	thioredoxin domain containing 2 (spermatozoa)	140	22 X 15 AA approximate tandem repeat of Q-P-K-X-G-D-I-P-K-S-[PS]-E-[KE]-X-I.				cell differentiation (GO:0030154)|cell redox homeostasis (GO:0045454)|glycerol ether metabolic process (GO:0006662)|multicellular organismal development (GO:0007275)|oxidation-reduction process (GO:0055114)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|motile cilium (GO:0031514)|nucleolus (GO:0005730)|nucleus (GO:0005634)|outer dense fiber (GO:0001520)	nutrient reservoir activity (GO:0045735)|protein disulfide isomerase activity (GO:0003756)|protein disulfide oxidoreductase activity (GO:0015035)|thioredoxin-disulfide reductase activity (GO:0004791)	p.K140E(2)|p.K73E(2)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|skin(7)|urinary_tract(1)	31						GTCCTCAGAAAAAGCCATCCA	0.547																																					p.K140E		.											.	TXNDC2-92	4	Substitution - Missense(4)	urinary_tract(2)|lung(2)	c.A418G						.						133.0	131.0	132.0					18																	9886894		2203	4300	6503	SO:0001583	missense	84203	exon2			TCAGAAAAAGCCA	AF080095	CCDS11846.1, CCDS42414.1	18p11.31-p11.2	2009-03-11	2009-03-11	2007-08-16	ENSG00000168454	ENSG00000168454			16470	protein-coding gene	gene with protein product	"""sperm-specific thioredoxin 1"""					11230166, 11399755	Standard	NM_001098529		Approved	SPTRX1	uc002koi.4	Q86VQ3	OTTHUMG00000131602	ENST00000306084.6:c.418A>G	18.37:g.9886894A>G	ENSP00000304908:p.Lys140Glu	Somatic	151	2		WXS	Illumina GAIIx	Phase_I	94	6	NM_001098529	0	0	0	0	0	A5YM73|Q8N7U4|Q96RX3|Q9H0L8	Missense_Mutation	SNP	ENST00000306084.6	37	CCDS42414.1	.	.	.	.	.	.	.	.	.	.	a	8.625	0.892206	0.17613	.	.	ENSG00000168454	ENST00000536353;ENST00000357775;ENST00000306084;ENST00000426718	T;T;T	0.20069	2.1;2.3;2.3	3.48	-6.96	0.01622	.	1.199930	0.06365	N	0.712409	T	0.12774	0.0310	L	0.35854	1.095	0.09310	N	1	B	0.25048	0.117	B	0.25884	0.064	T	0.32693	-0.9897	9	.	.	.	.	5.8007	0.18412	0.5013:0.2415:0.2572:0.0	.	140	Q86VQ3	TXND2_HUMAN	E	73;73;140;140	ENSP00000437393:K73E;ENSP00000350419:K73E;ENSP00000304908:K140E	.	K	+	1	0	TXNDC2	9876894	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.892000	0.04131	-1.042000	0.03262	-1.380000	0.01176	AAA	A|1.000;G|0.000		0.547	TXNDC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254487.1		
GRP	2922	hgsc.bcm.edu	37	18	56887537	56887537	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr18:56887537G>T	ENST00000256857.2	+	1	138	c.40G>T	c.(40-42)Gtc>Ttc	p.V14F	GRP_ENST00000420468.2_Missense_Mutation_p.V14F|GRP_ENST00000529320.2_Missense_Mutation_p.V14F	NM_001012512.1|NM_002091.3	NP_001012530.1|NP_002082.2	P07492	GRP_HUMAN	gastrin-releasing peptide	14					neuropeptide signaling pathway (GO:0007218)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	neuropeptide hormone activity (GO:0005184)|receptor binding (GO:0005102)			large_intestine(1)|lung(3)	4		Colorectal(73;0.0946)				GCTGGCGCTGGTCCTCTGCCT	0.736																																					p.V14F		.											.	GRP-90	0			c.G40T						.						3.0	5.0	4.0					18																	56887537		1945	3735	5680	SO:0001583	missense	2922	exon1			GCGCTGGTCCTCT		CCDS11971.1, CCDS45877.1, CCDS45878.1	18q21.1-q21.32	2013-02-26			ENSG00000134443	ENSG00000134443		"""Endogenous ligands"""	4605	protein-coding gene	gene with protein product	"""bombesin"", ""neuromedin C"", ""prepro-GRP"""	137260					Standard	NM_002091		Approved		uc002lhv.3	P07492	OTTHUMG00000132760	ENST00000256857.2:c.40G>T	18.37:g.56887537G>T	ENSP00000256857:p.Val14Phe	Somatic	2	1		WXS	Illumina GAIIx	Phase_I	8	6	NM_001012512	0	0	0	0	0	P07491|P81553|Q14454|Q53YA0|Q9BSY7	Missense_Mutation	SNP	ENST00000256857.2	37	CCDS11971.1	.	.	.	.	.	.	.	.	.	.	G	18.80	3.701190	0.68501	.	.	ENSG00000134443	ENST00000256857;ENST00000529320;ENST00000420468	T;T;T	0.50813	0.73;0.78;0.75	4.02	3.12	0.35913	.	0.102221	0.37437	N	0.002085	T	0.53753	0.1816	L	0.34521	1.04	0.27246	N	0.959012	D;D;P	0.76494	0.999;0.998;0.944	D;D;P	0.83275	0.996;0.99;0.563	T	0.44605	-0.9317	10	0.39692	T	0.17	-6.9775	10.8346	0.46679	0.0:0.1928:0.8072:0.0	.	14;14;14	P07492-3;P07492;P07492-2	.;GRP_HUMAN;.	F	14	ENSP00000256857:V14F;ENSP00000434101:V14F;ENSP00000389696:V14F	ENSP00000256857:V14F	V	+	1	0	GRP	55038517	1.000000	0.71417	1.000000	0.80357	0.798000	0.45092	1.443000	0.35057	0.863000	0.35553	0.549000	0.68633	GTC	.		0.736	GRP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256131.2	NM_002091	
RAX	30062	hgsc.bcm.edu	37	18	56936395	56936395	+	Silent	SNP	T	T	C	rs7226481	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr18:56936395T>C	ENST00000334889.3	-	3	1068	c.882A>G	c.(880-882)caA>caG	p.Q294Q	RAX_ENST00000256852.7_3'UTR	NM_013435.2	NP_038463.2	Q9Y2V3	RX_HUMAN	retina and anterior neural fold homeobox	294					camera-type eye development (GO:0043010)|hypothalamus development (GO:0021854)|limb development (GO:0060173)|pattern specification process (GO:0007389)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|visual perception (GO:0007601)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)|prostate(1)	6		Lung NSC(161;0.0804)|Colorectal(73;0.0946)		STAD - Stomach adenocarcinoma(84;0.18)		GCGCGAGAGGTTGCAGGCCGG	0.771													C|||	1143	0.228235	0.2421	0.1671	5008	,	,		8659	0.129		0.3032	False		,,,				2504	0.2781				p.Q294Q	GBM(150;770 1898 17679 24325 37807)	.											.	RAX-90	0			c.A882G						.	C		688,3078		75,538,1270	4.0	6.0	5.0		882	2.2	0.3	18	dbSNP_116	5	1688,5834		233,1222,2306	no	coding-synonymous	RAX	NM_013435.2		308,1760,3576	CC,CT,TT		22.4408,18.2687,21.0489		294/347	56936395	2376,8912	1883	3761	5644	SO:0001819	synonymous_variant	30062	exon3			GAGAGGTTGCAGG	AF115392	CCDS11972.1	18q21.31	2011-06-20			ENSG00000134438	ENSG00000134438		"""Homeoboxes / PRD class"""	18662	protein-coding gene	gene with protein product		601881				10625658, 10766016, 14662654	Standard	NM_013435		Approved	RX	uc002lhx.3	Q9Y2V3	OTTHUMG00000132757	ENST00000334889.3:c.882A>G	18.37:g.56936395T>C		Somatic	1	1		WXS	Illumina GAIIx	Phase_I	3	3	NM_013435	0	0	0	0	0	Q86V11	Silent	SNP	ENST00000334889.3	37	CCDS11972.1																																																																																			T|0.767;C|0.233		0.771	RAX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256128.2		
CBLN2	147381	hgsc.bcm.edu	37	18	70209321	70209321	+	Silent	SNP	C	C	A	rs7237888	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr18:70209321C>A	ENST00000269503.4	-	3	848	c.75G>T	c.(73-75)ccG>ccT	p.P25P	CBLN2_ENST00000585159.1_Silent_p.P25P|CBLN2_ENST00000581073.1_Intron|CBLN2_ENST00000584764.1_Intron|CBLN2_ENST00000583651.1_Intron	NM_182511.3	NP_872317.1	Q8IUK8	CBLN2_HUMAN	cerebellin 2 precursor	25					positive regulation of synapse assembly (GO:0051965)	extracellular space (GO:0005615)				endometrium(2)|lung(15)	17		Esophageal squamous(42;0.131)				CGCAgccgcccggctcgcgca	0.786													C|||	2820	0.563099	0.1868	0.8573	5008	,	,		7947	0.381		0.9304	False		,,,				2504	0.6728				p.P25P		.											.	CBLN2-90	0			c.G75T						.	C		1660,2420		328,1004,708	5.0	7.0	6.0		75	-0.8	1.0	18	dbSNP_116	6	7475,487		3530,415,36	no	coding-synonymous	CBLN2	NM_182511.3		3858,1419,744	AA,AC,CC		6.1166,40.6863,24.1405		25/225	70209321	9135,2907	2040	3981	6021	SO:0001819	synonymous_variant	147381	exon3			GCCGCCCGGCTCG	BC035789	CCDS11999.1	18q22.3	2007-11-19			ENSG00000141668	ENSG00000141668			1544	protein-coding gene	gene with protein product		600433				7877445	Standard	NM_182511		Approved		uc002lkv.2	Q8IUK8	OTTHUMG00000132825	ENST00000269503.4:c.75G>T	18.37:g.70209321C>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_182511	0	0	0	0	0	Q53Z56	Silent	SNP	ENST00000269503.4	37	CCDS11999.1																																																																																			C|0.390;A|0.610		0.786	CBLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256288.1	NM_182511	
TPGS1	91978	hgsc.bcm.edu	37	19	519018	519018	+	Silent	SNP	C	C	T	rs145134429	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr19:519018C>T	ENST00000359315.5	+	2	676	c.468C>T	c.(466-468)gcC>gcT	p.A156A		NM_033513.2	NP_277048.2	Q6ZTW0	TPGS1_HUMAN	tubulin polyglutamylase complex subunit 1	156					adult behavior (GO:0030534)|multicellular organismal development (GO:0007275)|protein polyglutamylation (GO:0018095)|sperm axoneme assembly (GO:0007288)|synaptic transmission (GO:0007268)|vesicle localization (GO:0051648)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|motile cilium (GO:0031514)	tubulin-glutamic acid ligase activity (GO:0070740)										ACGGCCAAGCCCCCGAGGAGG	0.731													c|||	38	0.00758786	0.0053	0.0072	5008	,	,		6691	0.0		0.0129	False		,,,				2504	0.0133				p.A156A		.											.	.	0			c.C468T						.			12,3956		0,12,1972	5.0	8.0	7.0		468	-1.4	1.0	19	dbSNP_134	7	83,7985		0,83,3951	no	coding-synonymous	C19orf20	NM_033513.2		0,95,5923	TT,TC,CC		1.0288,0.3024,0.7893		156/291	519018	95,11941	1984	4034	6018	SO:0001819	synonymous_variant	91978	exon2			CCAAGCCCCCGAG	BC009520	CCDS42454.1	19p13.3	2011-11-23	2011-11-23	2011-11-23	ENSG00000141933	ENSG00000141933			25058	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 20"""	C19orf20		11441184, 12972506	Standard	NM_033513		Approved	GTRGEO22, PGs1	uc002lou.3	Q6ZTW0		ENST00000359315.5:c.468C>T	19.37:g.519018C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	9	NM_033513	0	0	4	21	17	Q96GE2	Silent	SNP	ENST00000359315.5	37	CCDS42454.1																																																																																			C|0.994;T|0.006		0.731	TPGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451887.2	NM_033513	
ABCA7	10347	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	1049413	1049413	+	Silent	SNP	C	C	T			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr19:1049413C>T	ENST00000263094.6	+	18	2760	c.2529C>T	c.(2527-2529)aaC>aaT	p.N843N	ABCA7_ENST00000433129.1_Silent_p.N843N|ABCA7_ENST00000435683.2_Silent_p.N705N	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	843	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)			NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGGCCACAACGGGGCCGGCA	0.711																																					p.N843N		.											.	ABCA7-98	0			c.C2529T						.						28.0	33.0	31.0					19																	1049413		2195	4283	6478	SO:0001819	synonymous_variant	10347	exon18			CCACAACGGGGCC	AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.2529C>T	19.37:g.1049413C>T		Somatic	69	0		WXS	Illumina GAIIx	Phase_I	92	48	NM_019112	0	0	0	0	0	Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Silent	SNP	ENST00000263094.6	37	CCDS12055.1																																																																																			.		0.711	ABCA7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000394993.1	NM_019112	
TCF3	6929	hgsc.bcm.edu	37	19	1619333	1619333	+	Silent	SNP	G	G	A	rs1140828	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr19:1619333G>A	ENST00000262965.5	-	15	1652	c.1308C>T	c.(1306-1308)ggC>ggT	p.G436G	TCF3_ENST00000453954.2_Silent_p.G352G|TCF3_ENST00000395423.3_Silent_p.G385G|RNU6-1223P_ENST00000517124.1_RNA|TCF3_ENST00000588136.1_Silent_p.G436G|TCF3_ENST00000344749.5_Silent_p.G436G	NM_003200.3	NP_003191.1	Q9HCS4	TF7L1_HUMAN	transcription factor 3	0					anterior/posterior axis specification, embryo (GO:0008595)|axial mesoderm morphogenesis (GO:0048319)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|chromatin organization (GO:0006325)|generation of neurons (GO:0048699)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	16		Acute lymphoblastic leukemia(61;5.94e-12)|all_hematologic(61;1.27e-07)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGTGCCGCCCGCCCAGTGACA	0.746			T	"""PBX1, HLF, TFPT"""	pre B-ALL								G|||	1179	0.235423	0.1702	0.2435	5008	,	,		13595	0.2897		0.3032	False		,,,				2504	0.1922				p.G436G		.		Dom	yes		19	19p13.3	6929	transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47)		L	.	TCF3-721	0			c.C1308T						.	G	,	770,3572		79,612,1480	11.0	14.0	13.0		1308,1308	-3.3	0.4	19	dbSNP_86	13	2644,5770		436,1772,1999	no	coding-synonymous,coding-synonymous	TCF3	NM_001136139.2,NM_003200.3	,	515,2384,3479	AA,AG,GG		31.4238,17.7338,26.7639	,	436/652,436/655	1619333	3414,9342	2171	4207	6378	SO:0001819	synonymous_variant	6929	exon15			CCGCCCGCCCAGT	M65214	CCDS12074.1, CCDS45899.1	19p13.3	2014-02-13	2013-02-26		ENSG00000071564	ENSG00000071564		"""Basic helix-loop-helix proteins"""	11633	protein-coding gene	gene with protein product	"""transcription factor E2-alpha"", ""immunoglobulin transcription factor 1"", ""kappa-E2-binding factor"", ""E2A immunoglobulin enhancer-binding factor E12/E47"", ""VDR interacting repressor"""	147141				2308859, 1967983	Standard	NM_003200		Approved	E2A, ITF1, MGC129647, MGC129648, bHLHb21, VDIR, E47	uc002ltt.4	P15923	OTTHUMG00000180031	ENST00000262965.5:c.1308C>T	19.37:g.1619333G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_003200	0	0	1	1	0	Q53R97|Q6PD70|Q9NP00	Silent	SNP	ENST00000262965.5	37	CCDS12074.1																																																																																			G|0.749;A|0.251		0.746	TCF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449367.1	NM_003200	
TCF3	6929	hgsc.bcm.edu	37	19	1619339	1619339	+	Silent	SNP	T	T	C	rs8140	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr19:1619339T>C	ENST00000262965.5	-	15	1646	c.1302A>G	c.(1300-1302)tcA>tcG	p.S434S	TCF3_ENST00000453954.2_Silent_p.S350S|TCF3_ENST00000395423.3_Silent_p.S383S|RNU6-1223P_ENST00000517124.1_RNA|TCF3_ENST00000588136.1_Silent_p.S434S|TCF3_ENST00000344749.5_Silent_p.S434S	NM_003200.3	NP_003191.1	Q9HCS4	TF7L1_HUMAN	transcription factor 3	0					anterior/posterior axis specification, embryo (GO:0008595)|axial mesoderm morphogenesis (GO:0048319)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|chromatin organization (GO:0006325)|generation of neurons (GO:0048699)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	16		Acute lymphoblastic leukemia(61;5.94e-12)|all_hematologic(61;1.27e-07)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCCCGCCCAGTGACATGGGGC	0.746			T	"""PBX1, HLF, TFPT"""	pre B-ALL								C|||	3124	0.623802	0.7723	0.5187	5008	,	,		13680	0.8839		0.3658	False		,,,				2504	0.4949				p.S434S		.		Dom	yes		19	19p13.3	6929	transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47)		L	.	TCF3-721	0			c.A1302G						.	C	,	3016,1346		1071,874,236	11.0	14.0	13.0		1302,1302	-7.1	0.0	19	dbSNP_52	13	3268,5190		653,1962,1614	no	coding-synonymous,coding-synonymous	TCF3	NM_001136139.2,NM_003200.3	,	1724,2836,1850	CC,CT,TT		38.638,30.8574,49.0172	,	434/652,434/655	1619339	6284,6536	2181	4229	6410	SO:0001819	synonymous_variant	6929	exon15			GCCCAGTGACATG	M65214	CCDS12074.1, CCDS45899.1	19p13.3	2014-02-13	2013-02-26		ENSG00000071564	ENSG00000071564		"""Basic helix-loop-helix proteins"""	11633	protein-coding gene	gene with protein product	"""transcription factor E2-alpha"", ""immunoglobulin transcription factor 1"", ""kappa-E2-binding factor"", ""E2A immunoglobulin enhancer-binding factor E12/E47"", ""VDR interacting repressor"""	147141				2308859, 1967983	Standard	NM_003200		Approved	E2A, ITF1, MGC129647, MGC129648, bHLHb21, VDIR, E47	uc002ltt.4	P15923	OTTHUMG00000180031	ENST00000262965.5:c.1302A>G	19.37:g.1619339T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_003200	0	0	2	2	0	Q53R97|Q6PD70|Q9NP00	Silent	SNP	ENST00000262965.5	37	CCDS12074.1																																																																																			T|0.403;C|0.597		0.746	TCF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449367.1	NM_003200	
SEMA6B	10501	broad.mit.edu	37	19	4550277	4550277	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr19:4550277A>C	ENST00000586582.1	-	12	1439	c.1129T>G	c.(1129-1131)Tgc>Ggc	p.C377G	SEMA6B_ENST00000301293.3_Missense_Mutation_p.C377G|SEMA6B_ENST00000586965.1_Missense_Mutation_p.C377G	NM_032108.3	NP_115484.2	Q9H3T3	SEM6B_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6B	377	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			breast(1)|central_nervous_system(2)|large_intestine(4)|lung(11)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0149)|STAD - Stomach adenocarcinoma(1328;0.18)		GCTGCGCAGCACCCGGGCCTG	0.602																																					p.C377G		.											.	SEMA6B-91	0			c.T1129G						.						41.0	41.0	41.0					19																	4550277		2201	4295	6496	SO:0001583	missense	10501	exon12			CGCAGCACCCGGG	AB022433	CCDS12131.1	19p13.3	2008-07-22				ENSG00000167680		"""Semaphorins"""	10739	protein-coding gene	gene with protein product	"""Sema VIb"", ""semaphorin Z"", ""semaphorin VIB"""	608873		SEMAN		9361278	Standard	NM_032108		Approved	semaZ, SEMA-VIB, SEM-SEMA-Y	uc010dud.2	Q9H3T3		ENST00000586582.1:c.1129T>G	19.37:g.4550277A>C	ENSP00000467290:p.Cys377Gly	Somatic	113	11		WXS	Illumina GAIIx	Phase_I	171	22	NM_032108	0	0	0	0	0	A5PKU4|F6IB19|Q9NRK9	Missense_Mutation	SNP	ENST00000586582.1	37	CCDS12131.1	.	.	.	.	.	.	.	.	.	.	.	5.175	0.217910	0.09810	.	.	ENSG00000167680	ENST00000301293;ENST00000301292	T	0.10477	2.87	2.6	2.6	0.31112	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.058685	0.64402	U	0.000002	T	0.08044	0.0201	N	0.25380	0.74	0.38164	D	0.939116	B;B	0.14012	0.003;0.009	B;B	0.18871	0.023;0.018	T	0.16808	-1.0390	10	0.49607	T	0.09	.	10.2642	0.43445	1.0:0.0:0.0:0.0	.	377;377	B4DT36;Q9H3T3	.;SEM6B_HUMAN	G	377	ENSP00000301293:C377G	ENSP00000301292:C377G	C	-	1	0	SEMA6B	4501277	0.973000	0.33851	0.993000	0.49108	0.218000	0.24690	2.537000	0.45702	1.465000	0.48006	0.392000	0.25879	TGC	.		0.602	SEMA6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458656.2	NM_032108	
FUT3	2525	bcgsc.ca	37	19	5843877	5843877	+	Missense_Mutation	SNP	G	G	A	rs28381969	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr19:5843877G>A	ENST00000303225.6	-	3	1608	c.974C>T	c.(973-975)aCg>aTg	p.T325M	FUT3_ENST00000589620.1_Missense_Mutation_p.T325M|FUT3_ENST00000589918.1_Missense_Mutation_p.T325M|FUT3_ENST00000458379.2_Missense_Mutation_p.T325M|FUT3_ENST00000593144.1_5'Flank	NM_000149.3	NP_000140	P21217	FUT3_HUMAN	fucosyltransferase 3 (galactoside 3(4)-L-fucosyltransferase, Lewis blood group)	325			T -> M (in dbSNP:rs28381969). {ECO:0000269|Ref.5}.		cell-cell recognition (GO:0009988)|fucosylation (GO:0036065)|macromolecule glycosylation (GO:0043413)|oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3-galactosyl-N-acetylglucosaminide 4-alpha-L-fucosyltransferase activity (GO:0017060)|alpha-(1->3)-fucosyltransferase activity (GO:0046920)|fucosyltransferase activity (GO:0008417)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|upper_aerodigestive_tract(1)	14						AGGCCGCAGCGTCTCCCGCCA	0.637													G|||	37	0.00738818	0.025	0.0043	5008	,	,		19604	0.001		0.0	False		,,,				2504	0.0				p.T325M	Esophageal Squamous(82;745 1728 24593 44831)	.											.	FUT3-90	0			c.C974T						.						42.0	45.0	44.0					19																	5843877		2203	4300	6503	SO:0001583	missense	2525	exon3			CGCAGCGTCTCCC		CCDS12153.1	19p13.3	2014-07-19	2006-01-12		ENSG00000171124	ENSG00000171124	2.4.1.65	"""CD molecules"", ""Blood group antigens"", ""Fucosyltransferases"""	4014	protein-coding gene	gene with protein product		111100	"""fucosyltransferase 3 (galactoside 3(4)-L-fucosyltransferase, Lewis blood group included)"""	LE		1977660, 1740457	Standard	NM_000149		Approved	CD174	uc002mdk.2	P21217	OTTHUMG00000180614	ENST00000303225.6:c.974C>T	19.37:g.5843877G>A	ENSP00000305603:p.Thr325Met	Somatic	862	218		WXS	Illumina GAIIx	Phase_I	1455	392	NM_001097640	0	0	0	0	0	B5U7U9|B5U7V0|Q32NE7|Q99448|Q99449	Missense_Mutation	SNP	ENST00000303225.6	37	CCDS12153.1	36	0.016483516483516484	18	0.036585365853658534	1	0.0027624309392265192	6	0.01048951048951049	11	0.014511873350923483	G	12.11	1.838692	0.32513	.	.	ENSG00000171124	ENST00000303225;ENST00000458379	T;T	0.24350	1.86;1.86	2.29	1.18	0.20946	.	0.943966	0.08680	N	0.909636	T	0.07413	0.0187	M	0.79805	2.47	0.09310	N	1	P;P;P;P	0.38617	0.64;0.483;0.483;0.483	B;B;B;B	0.36186	0.219;0.148;0.148;0.148	T	0.11494	-1.0585	10	0.37606	T	0.19	.	5.4124	0.16356	0.1897:0.0:0.8103:0.0	rs28381969	325;325;325;325	B3W6H0;A8K737;B3GVC1;P21217	.;.;.;FUT3_HUMAN	M	325	ENSP00000305603:T325M;ENSP00000416443:T325M	ENSP00000305603:T325M	T	-	2	0	FUT3	5794877	0.000000	0.05858	0.620000	0.29132	0.507000	0.33981	-1.150000	0.03178	0.242000	0.21303	0.194000	0.17425	ACG	G|0.992;A|0.008		0.637	FUT3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452204.1	NM_000149	
OR7A5	26659	hgsc.bcm.edu	37	19	14938159	14938159	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr19:14938159T>C	ENST00000322301.3	-	2	982	c.895A>G	c.(895-897)Agg>Ggg	p.R299G	OR7A5_ENST00000601611.1_Intron|OR7A5_ENST00000594432.1_Missense_Mutation_p.R299G			Q15622	OR7A5_HUMAN	olfactory receptor, family 7, subfamily A, member 5	299					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(4)|endometrium(2)|kidney(4)|large_intestine(3)|lung(6)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	26						CCCAGAGCCCTCTTTATGTCT	0.463																																					p.R299G		.											.	OR7A5-90	0			c.A895G						.						83.0	81.0	82.0					19																	14938159		2203	4300	6503	SO:0001583	missense	26659	exon1			GAGCCCTCTTTAT	X64976	CCDS12318.1	19p13.1	2012-08-09	2003-12-09			ENSG00000188269		"""GPCR / Class A : Olfactory receptors"""	8368	protein-coding gene	gene with protein product			"""olfactory receptor, family 7, subfamily A, member 5 pseudogene"""				Standard	XM_006722722		Approved	HTPCR2	uc002mzw.3	Q15622		ENST00000322301.3:c.895A>G	19.37:g.14938159T>C	ENSP00000316955:p.Arg299Gly	Somatic	56	1		WXS	Illumina GAIIx	Phase_I	61	5	NM_017506	0	0	0	0	0	B2R682|Q6IFP1|Q96R96	Missense_Mutation	SNP	ENST00000322301.3	37	CCDS12318.1	.	.	.	.	.	.	.	.	.	.	g	2.393	-0.339434	0.05243	.	.	ENSG00000188269	ENST00000322301	T	0.39056	1.1	3.12	-5.2	0.02823	.	.	.	.	.	T	0.15305	0.0369	N	0.10760	0.04	0.09310	N	1	B	0.06786	0.001	B	0.10450	0.005	T	0.30995	-0.9959	9	0.07990	T	0.79	.	5.2449	0.15490	0.0:0.4143:0.3209:0.2648	.	299	Q15622	OR7A5_HUMAN	G	299	ENSP00000316955:R299G	ENSP00000316955:R299G	R	-	1	2	OR7A5	14799159	0.000000	0.05858	0.002000	0.10522	0.378000	0.30076	-1.822000	0.01711	-1.233000	0.02551	0.102000	0.15555	AGG	.		0.463	OR7A5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466518.1	NM_017506	
OR7A5	26659	hgsc.bcm.edu	37	19	14938184	14938184	+	Silent	SNP	A	A	G	rs200531878		TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr19:14938184A>G	ENST00000322301.3	-	2	957	c.870T>C	c.(868-870)taT>taC	p.Y290Y	OR7A5_ENST00000601611.1_Intron|OR7A5_ENST00000594432.1_Silent_p.Y290Y			Q15622	OR7A5_HUMAN	olfactory receptor, family 7, subfamily A, member 5	290					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Y290Y(2)		breast(1)|central_nervous_system(4)|endometrium(2)|kidney(4)|large_intestine(3)|lung(6)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	26						TCCTCAGACTATAGATAAAGG	0.478																																					p.Y290Y		.											.	OR7A5-90	2	Substitution - coding silent(2)	kidney(2)	c.T870C						.						74.0	72.0	72.0					19																	14938184		2203	4300	6503	SO:0001819	synonymous_variant	26659	exon1			CAGACTATAGATA	X64976	CCDS12318.1	19p13.1	2012-08-09	2003-12-09			ENSG00000188269		"""GPCR / Class A : Olfactory receptors"""	8368	protein-coding gene	gene with protein product			"""olfactory receptor, family 7, subfamily A, member 5 pseudogene"""				Standard	XM_006722722		Approved	HTPCR2	uc002mzw.3	Q15622		ENST00000322301.3:c.870T>C	19.37:g.14938184A>G		Somatic	62	1		WXS	Illumina GAIIx	Phase_I	87	6	NM_017506	0	0	0	0	0	B2R682|Q6IFP1|Q96R96	Silent	SNP	ENST00000322301.3	37	CCDS12318.1																																																																																			A|0.999;G|0.001		0.478	OR7A5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466518.1	NM_017506	
OR7A5	26659	hgsc.bcm.edu	37	19	14938190	14938190	+	Silent	SNP	A	A	G	rs2240561	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr19:14938190A>G	ENST00000322301.3	-	2	951	c.864T>C	c.(862-864)ttT>ttC	p.F288F	OR7A5_ENST00000601611.1_Intron|OR7A5_ENST00000594432.1_Silent_p.F288F			Q15622	OR7A5_HUMAN	olfactory receptor, family 7, subfamily A, member 5	288					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(4)|endometrium(2)|kidney(4)|large_intestine(3)|lung(6)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	26						GACTATAGATAAAGGGGTTCA	0.473																																					p.F288F		.											.	OR7A5-90	0			c.T864C						.						73.0	71.0	71.0					19																	14938190		2203	4300	6503	SO:0001819	synonymous_variant	26659	exon1			ATAGATAAAGGGG	X64976	CCDS12318.1	19p13.1	2012-08-09	2003-12-09			ENSG00000188269		"""GPCR / Class A : Olfactory receptors"""	8368	protein-coding gene	gene with protein product			"""olfactory receptor, family 7, subfamily A, member 5 pseudogene"""				Standard	XM_006722722		Approved	HTPCR2	uc002mzw.3	Q15622		ENST00000322301.3:c.864T>C	19.37:g.14938190A>G		Somatic	70	1		WXS	Illumina GAIIx	Phase_I	97	6	NM_017506	0	0	0	0	0	B2R682|Q6IFP1|Q96R96	Silent	SNP	ENST00000322301.3	37	CCDS12318.1																																																																																			A|0.999;G|0.001		0.473	OR7A5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466518.1	NM_017506	
NOTCH3	4854	bcgsc.ca	37	19	15303225	15303225	+	Silent	SNP	G	G	A	rs3815188	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr19:15303225G>A	ENST00000263388.2	-	3	378	c.303C>T	c.(301-303)acC>acT	p.T101T		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	101	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			AGAATCGGGCGGTGCCAGCCA	0.662													G|||	1122	0.224042	0.2496	0.1599	5008	,	,		15642	0.3899		0.1471	False		,,,				2504	0.1431				p.T101T		.											.	NOTCH3-855	0			c.C303T						.	G		1119,3279		144,831,1224	22.0	21.0	21.0		303	-2.4	0.0	19	dbSNP_107	21	1262,7322		103,1056,3133	no	coding-synonymous	NOTCH3	NM_000435.2		247,1887,4357	AA,AG,GG		14.7018,25.4434,18.3408		101/2322	15303225	2381,10601	2199	4292	6491	SO:0001819	synonymous_variant	4854	exon3			TCGGGCGGTGCCA	U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.303C>T	19.37:g.15303225G>A		Somatic	170	0		WXS	Illumina GAIIx	Phase_I	283	8	NM_000435	0	0	1	1	0	Q9UEB3|Q9UPL3|Q9Y6L8	Silent	SNP	ENST00000263388.2	37	CCDS12326.1																																																																																			G|0.773;A|0.227		0.662	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465714.1	NM_000435	
PGLS	25796	hgsc.bcm.edu	37	19	17622614	17622614	+	Silent	SNP	C	C	T	rs11086075	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr19:17622614C>T	ENST00000252603.2	+	1	177	c.133C>T	c.(133-135)Ctg>Ttg	p.L45L	CTD-3131K8.2_ENST00000596643.1_lincRNA	NM_012088.2	NP_036220.1	O95336	6PGL_HUMAN	6-phosphogluconolactonase	45					carbohydrate metabolic process (GO:0005975)|pentose-phosphate shunt (GO:0006098)|pentose-phosphate shunt, oxidative branch (GO:0009051)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	6-phosphogluconolactonase activity (GO:0017057)|monosaccharide binding (GO:0048029)			endometrium(1)|lung(1)	2						CGCGCTCGGCCTGTCGGGCGG	0.736													C|||	1862	0.371805	0.2496	0.4207	5008	,	,		10575	0.377		0.4851	False		,,,				2504	0.3804				p.L45L		.											.	PGLS-90	0			c.C133T						.	C		662,2504		107,448,1028	2.0	2.0	2.0		133	2.6	1.0	19	dbSNP_120	2	2200,4094		507,1186,1454	no	coding-synonymous	PGLS	NM_012088.2		614,1634,2482	TT,TC,CC		34.9539,20.9097,30.2537		45/259	17622614	2862,6598	1583	3147	4730	SO:0001819	synonymous_variant	25796	exon1			CTCGGCCTGTCGG	AJ243972	CCDS12361.1	19p13.2	2008-02-05				ENSG00000130313	3.1.1.31		8903	protein-coding gene	gene with protein product		604951				10518023	Standard	NM_012088		Approved	6PGL	uc002ngw.3	O95336		ENST00000252603.2:c.133C>T	19.37:g.17622614C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	4	NM_012088	0	0	3	18	15		Silent	SNP	ENST00000252603.2	37	CCDS12361.1																																																																																			C|0.617;T|0.383		0.736	PGLS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464154.1		
ZNF493	284443	hgsc.bcm.edu	37	19	21606692	21606692	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr19:21606692G>T	ENST00000355504.4	+	2	1113	c.847G>T	c.(847-849)Ggc>Tgc	p.G283C	CTD-2561J22.3_ENST00000600810.1_Intron|ZNF493_ENST00000392288.2_Missense_Mutation_p.G411C	NM_175910.6	NP_787106.4	Q6ZR52	ZN493_HUMAN	zinc finger protein 493	283					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	30						TGAAGAATGTGGCAAAGCTTA	0.363																																					p.G411C		.											.	ZNF493-516	0			c.G1231T						.						35.0	38.0	37.0					19																	21606692		2200	4297	6497	SO:0001583	missense	284443	exon4			GAATGTGGCAAAG	AK093823, BC006408, BC022394	CCDS12412.1, CCDS42536.1, CCDS12411.1	19p12	2013-01-08			ENSG00000196268	ENSG00000196268		"""Zinc fingers, C2H2-type"", ""-"""	23708	protein-coding gene	gene with protein product							Standard	NM_001076678		Approved	FLJ36504	uc002npw.3	Q6ZR52	OTTHUMG00000141297	ENST00000355504.4:c.847G>T	19.37:g.21606692G>T	ENSP00000347691:p.Gly283Cys	Somatic	40	0		WXS	Illumina GAIIx	Phase_I	46	4	NM_001076678	0	0	0	0	0	G5E974|Q59GM3|Q6ZSF6|Q8N1Z6|Q8N965|Q9BR99	Missense_Mutation	SNP	ENST00000355504.4	37	CCDS12412.1	.	.	.	.	.	.	.	.	.	.	N	14.16	2.453882	0.43531	.	.	ENSG00000196268	ENST00000392288;ENST00000355504	T;T	0.07908	3.15;3.15	1.03	1.03	0.20045	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.36386	0.0965	H	0.96365	3.81	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.994;0.999	T	0.39643	-0.9604	9	0.87932	D	0	.	8.893	0.35446	0.0:0.0:1.0:0.0	.	283;411	Q6ZR52;Q6ZR52-2	ZN493_HUMAN;.	C	411;283	ENSP00000376110:G411C;ENSP00000347691:G283C	ENSP00000347691:G283C	G	+	1	0	ZNF493	21398532	0.696000	0.27757	0.005000	0.12908	0.005000	0.04900	1.694000	0.37752	0.447000	0.26695	0.454000	0.30748	GGC	.		0.363	ZNF493-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000280563.1	NM_175910	
ZNF493	284443	hgsc.bcm.edu	37	19	21606712	21606712	+	Silent	SNP	T	T	C			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr19:21606712T>C	ENST00000355504.4	+	2	1133	c.867T>C	c.(865-867)tcT>tcC	p.S289S	CTD-2561J22.3_ENST00000600810.1_Intron|ZNF493_ENST00000392288.2_Silent_p.S417S	NM_175910.6	NP_787106.4	Q6ZR52	ZN493_HUMAN	zinc finger protein 493	289					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	30						ATAAGGAGTCTTCACACCTTA	0.348																																					p.S417S		.											.	ZNF493-516	0			c.T1251C						.						34.0	37.0	36.0					19																	21606712		2198	4293	6491	SO:0001819	synonymous_variant	284443	exon4			GGAGTCTTCACAC	AK093823, BC006408, BC022394	CCDS12412.1, CCDS42536.1, CCDS12411.1	19p12	2013-01-08			ENSG00000196268	ENSG00000196268		"""Zinc fingers, C2H2-type"", ""-"""	23708	protein-coding gene	gene with protein product							Standard	NM_001076678		Approved	FLJ36504	uc002npw.3	Q6ZR52	OTTHUMG00000141297	ENST00000355504.4:c.867T>C	19.37:g.21606712T>C		Somatic	28	0		WXS	Illumina GAIIx	Phase_I	41	3	NM_001076678	0	0	0	0	0	G5E974|Q59GM3|Q6ZSF6|Q8N1Z6|Q8N965|Q9BR99	Silent	SNP	ENST00000355504.4	37	CCDS12412.1																																																																																			.		0.348	ZNF493-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000280563.1	NM_175910	
ZNF676	163223	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	22362756	22362756	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr19:22362756G>A	ENST00000397121.2	-	3	2080	c.1763C>T	c.(1762-1764)cCc>cTc	p.P588L		NM_001001411.2	NP_001001411.2	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	588					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(49)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	67		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				ACATTTTTAGGGATTCTCTCC	0.348																																					p.P588L		.											.	ZNF676-90	0			c.C1763T						.						43.0	45.0	44.0					19																	22362756		2034	4212	6246	SO:0001583	missense	163223	exon3			TTTTAGGGATTCT	AK097798	CCDS42539.1	19p12	2013-01-08				ENSG00000196109		"""Zinc fingers, C2H2-type"""	20429	protein-coding gene	gene with protein product							Standard	NM_001001411		Approved		uc002nqs.1	Q8N7Q3		ENST00000397121.2:c.1763C>T	19.37:g.22362756G>A	ENSP00000380310:p.Pro588Leu	Somatic	51	0		WXS	Illumina GAIIx	Phase_I	75	7	NM_001001411	0	0	0	0	0	A8MVX5	Missense_Mutation	SNP	ENST00000397121.2	37	CCDS42539.1	.	.	.	.	.	.	.	.	.	.	.	12.56	1.974252	0.34848	.	.	ENSG00000196109	ENST00000397121	T	0.13901	2.55	0.109	-0.218	0.13142	Zinc finger, C2H2 (1);	.	.	.	.	T	0.20373	0.0490	L	0.48362	1.52	0.09310	N	0.999999	D	0.63880	0.993	P	0.57101	0.813	T	0.16247	-1.0409	9	0.87932	D	0	.	6.3309	0.21269	0.2477:0.0:0.7523:0.0	.	588	Q8N7Q3	ZN676_HUMAN	L	588	ENSP00000380310:P588L	ENSP00000380310:P588L	P	-	2	0	ZNF676	22154596	0.007000	0.16637	0.019000	0.16419	0.019000	0.09904	1.135000	0.31454	-1.122000	0.02945	-1.109000	0.02080	CCC	.		0.348	ZNF676-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464392.1	NM_001001411	
NUDT19	390916	hgsc.bcm.edu	37	19	33183316	33183316	+	Silent	SNP	A	A	G	rs8109823	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr19:33183316A>G	ENST00000397061.3	+	1	450	c.450A>G	c.(448-450)ccA>ccG	p.P150P	CTD-2538C1.2_ENST00000592431.1_lincRNA	NM_001105570.1	NP_001099040.1	A8MXV4	NUD19_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 19	150	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.					mitochondrion (GO:0005739)|peroxisome (GO:0005777)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)|receptor binding (GO:0005102)			endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	8	Esophageal squamous(110;0.137)					CACCAGGCCCAGCACCCGGGC	0.761													A|||	881	0.175919	0.2216	0.0965	5008	,	,		10642	0.2153		0.1779	False		,,,				2504	0.1278				p.P150P		.											.	NUDT19-22	0			c.A450G						.	A		599,3181		35,529,1326	6.0	8.0	7.0		450	-7.1	0.0	19	dbSNP_116	7	1035,7031		77,881,3075	no	coding-synonymous	NUDT19	NM_001105570.1		112,1410,4401	GG,GA,AA		12.8316,15.8466,13.7937		150/376	33183316	1634,10212	1890	4033	5923	SO:0001819	synonymous_variant	390916	exon1			AGGCCCAGCACCC		CCDS42543.1	19q13.11	2011-11-16			ENSG00000213965	ENSG00000213965		"""Nudix motif containing"""	32036	protein-coding gene	gene with protein product							Standard	NM_001105570		Approved	RP2	uc010edf.3	A8MXV4		ENST00000397061.3:c.450A>G	19.37:g.33183316A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	2	NM_001105570	0	0	0	0	0		Silent	SNP	ENST00000397061.3	37	CCDS42543.1																																																																																			A|0.805;G|0.195		0.761	NUDT19-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000450338.3	XM_372723	
CATSPERG	57828	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	38851407	38851407	+	Missense_Mutation	SNP	G	G	A	rs372780505		TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr19:38851407G>A	ENST00000409235.3	+	16	1919	c.1804G>A	c.(1804-1806)Gtc>Atc	p.V602I	CATSPERG_ENST00000410018.1_Missense_Mutation_p.V562I|AC005625.1_ENST00000590304.1_RNA|CATSPERG_ENST00000215069.4_3'UTR	NM_021185.4	NP_067008.3	Q6ZRH7	CTSRG_HUMAN	catsper channel auxiliary subunit gamma	602					cell differentiation (GO:0030154)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|plasma membrane (GO:0005886)|sperm principal piece (GO:0097228)				breast(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(13)|ovary(1)|pancreas(2)|prostate(6)|skin(3)|stomach(1)|urinary_tract(2)	40						GGGCCAGCTGGTCAAGAGGCT	0.607																																					p.V602I		.											.	CATSPERG-92	0			c.G1804A						.						38.0	33.0	35.0					19																	38851407		2203	4300	6503	SO:0001583	missense	57828	exon16			CAGCTGGTCAAGA	AK128220	CCDS12514.2	19q13.1	2014-05-13	2012-02-22	2009-07-17	ENSG00000099338	ENSG00000099338			25243	protein-coding gene	gene with protein product		613452	"""chromosome 19 open reading frame 15"", ""cation channel, sperm-associated, gamma"""	C19orf15		19516020	Standard	NM_021185		Approved	DKFZp434A1022, FLJ46353	uc002oih.4	Q6ZRH7	OTTHUMG00000153223	ENST00000409235.3:c.1804G>A	19.37:g.38851407G>A	ENSP00000386962:p.Val602Ile	Somatic	195	0		WXS	Illumina GAIIx	Phase_I	430	42	NM_021185	0	0	0	0	0	A6NEG6|Q659E1	Missense_Mutation	SNP	ENST00000409235.3	37	CCDS12514.2	.	.	.	.	.	.	.	.	.	.	G	11.60	1.686268	0.29962	.	.	ENSG00000099338	ENST00000410018;ENST00000409235;ENST00000409410	T;T;T	0.32023	1.91;1.91;1.47	4.67	-1.53	0.08611	.	0.971401	0.08428	N	0.947318	T	0.18045	0.0433	L	0.34521	1.04	0.23440	N	0.997674	B;B	0.15930	0.015;0.009	B;B	0.20184	0.028;0.022	T	0.35748	-0.9776	10	0.12766	T	0.61	-25.0376	4.3986	0.11376	0.3791:0.1606:0.4603:0.0	.	602;562	Q6ZRH7;B8ZZI7	CTSRG_HUMAN;.	I	562;602;602	ENSP00000387057:V562I;ENSP00000386962:V602I;ENSP00000386950:V602I	ENSP00000386962:V602I	V	+	1	0	CATSPERG	43543247	0.897000	0.30589	0.154000	0.22540	0.121000	0.20230	-0.019000	0.12546	-0.006000	0.14370	0.467000	0.42956	GTC	.		0.607	CATSPERG-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000330204.1	NM_021185	
RINL	126432	hgsc.bcm.edu	37	19	39360720	39360720	+	Missense_Mutation	SNP	G	G	A	rs8110393	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr19:39360720G>A	ENST00000591812.1	-	9	1291	c.1205C>T	c.(1204-1206)cCc>cTc	p.P402L	RINL_ENST00000598904.1_Missense_Mutation_p.P288L|CTC-360G5.6_ENST00000593830.1_RNA|RINL_ENST00000340740.3_Missense_Mutation_p.P288L|RINL_ENST00000602238.1_5'Flank			Q6ZS11	RINL_HUMAN	Ras and Rab interactor-like	402	VPS9. {ECO:0000255|PROSITE- ProRule:PRU00550}.		P -> L (in dbSNP:rs8110393).		endocytosis (GO:0006897)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)	actin cytoskeleton (GO:0015629)|cytoplasmic vesicle (GO:0031410)|ruffle (GO:0001726)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(3)|kidney(4)|large_intestine(2)|lung(4)|pancreas(1)|skin(1)|urinary_tract(2)	17						GGCGGGGGCGGGGCTCTGCCC	0.781													G|||	3477	0.694289	0.9289	0.6153	5008	,	,		10275	0.7619		0.4642	False		,,,				2504	0.6002				p.P402L		.											.	RINL-91	0			c.C1205T						.	G	LEU/PRO,LEU/PRO	3328,464		1489,350,57	4.0	4.0	4.0		1205,863	3.5	1.0	19	dbSNP_116	4	4059,3433		1245,1569,932	no	missense,missense	RINL	NM_001195833.1,NM_198445.3	98,98	2734,1919,989	AA,AG,GG		45.8222,12.2363,34.5356	probably-damaging,probably-damaging	402/567,288/453	39360720	7387,3897	1896	3746	5642	SO:0001583	missense	126432	exon9			GGGGCGGGGCTCT	AK127808	CCDS12522.1, CCDS59386.1	19q13.2	2010-07-13			ENSG00000187994	ENSG00000187994			24795	protein-coding gene	gene with protein product							Standard	NM_001195833		Approved	FLJ45909	uc010xuo.2	Q6ZS11		ENST00000591812.1:c.1205C>T	19.37:g.39360720G>A	ENSP00000467107:p.Pro402Leu	Somatic	1	1		WXS	Illumina GAIIx	Phase_I	2	2	NM_001195833	0	0	0	0	0	B4DPG5	Missense_Mutation	SNP	ENST00000591812.1	37	CCDS59386.1	1421	0.6506410256410257	458	0.9308943089430894	225	0.6215469613259669	401	0.701048951048951	337	0.4445910290237467	G	17.17	3.320891	0.60634	0.877637	0.541778	ENSG00000187994	ENST00000340740;ENST00000536520	T	0.28454	1.61	4.57	3.53	0.40419	Vacuolar sorting protein 9 (1);	0.269737	0.35235	N	0.003350	T	0.00012	0.0000	M	0.67700	2.07	0.21553	P	0.999649277	B;B	0.21225	0.053;0.053	B;B	0.22152	0.038;0.038	T	0.17776	-1.0358	9	0.72032	D	0.01	-26.0247	8.5759	0.33598	0.1063:0.0:0.8937:0.0	rs8110393;rs61482706	402;288	B4DPG5;Q6ZS11	.;RINL_HUMAN	L	288	ENSP00000340369:P288L	ENSP00000340369:P288L	P	-	2	0	RINL	44052560	1.000000	0.71417	0.987000	0.45799	0.313000	0.28021	4.771000	0.62318	1.273000	0.44346	0.407000	0.27541	CCC	G|0.349;A|0.651		0.781	RINL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460433.1	NM_198445	
ATP1A3	478	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	42486218	42486218	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr19:42486218T>G	ENST00000302102.5	-	9	1184	c.1034A>C	c.(1033-1035)aAc>aCc	p.N345T	ATP1A3_ENST00000545399.1_Missense_Mutation_p.N358T|ATP1A3_ENST00000602133.1_Missense_Mutation_p.N315T|ATP1A3_ENST00000543770.1_Missense_Mutation_p.N356T	NM_152296.4	NP_689509.1	P13637	AT1A3_HUMAN	ATPase, Na+/K+ transporting, alpha 3 polypeptide	345					adult locomotory behavior (GO:0008344)|ATP biosynthetic process (GO:0006754)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|memory (GO:0007613)|potassium ion import (GO:0010107)|response to drug (GO:0042493)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)|visual learning (GO:0008542)	axon (GO:0030424)|dendritic spine head (GO:0044327)|dendritic spine neck (GO:0044326)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|myelin sheath (GO:0043209)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)|synapse (GO:0045202)|vesicle (GO:0031982)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(19)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	52						caccaggcagttcttccGGGC	0.597																																					p.N358T		.											.	ATP1A3-92	0			c.A1073C						.						137.0	125.0	129.0					19																	42486218		2203	4300	6503	SO:0001583	missense	478	exon9			AGGCAGTTCTTCC		CCDS12594.1, CCDS58663.1, CCDS58664.1	19q13.2	2012-10-22			ENSG00000105409	ENSG00000105409	3.6.3.9	"""ATPases / P-type"""	801	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-3"", ""sodium pump subunit alpha-3"", ""sodium-potassium ATPase catalytic subunit alpha-3"""	182350	"""dystonia 12"""	DYT12		17282997	Standard	NM_152296		Approved		uc002osh.4	P13637	OTTHUMG00000137384	ENST00000302102.5:c.1034A>C	19.37:g.42486218T>G	ENSP00000302397:p.Asn345Thr	Somatic	305	0		WXS	Illumina GAIIx	Phase_I	546	29	NM_001256214	0	0	5	6	1	B7Z2T0|B7Z401|F5H6J6|Q16732|Q16735|Q969K5	Missense_Mutation	SNP	ENST00000302102.5	37	CCDS12594.1	.	.	.	.	.	.	.	.	.	.	T	21.9	4.222088	0.79464	.	.	ENSG00000105409	ENST00000302102;ENST00000441343;ENST00000545399;ENST00000368080;ENST00000535899;ENST00000543770	D;D;D;D	0.90620	-2.7;-2.7;-2.7;-2.7	4.21	4.21	0.49690	ATPase, P-type, ATPase-associated domain (1);	0.000000	0.85682	D	0.000000	D	0.97179	0.9078	H	0.99516	4.605	0.80722	D	1	D;D;D;D	0.65815	0.994;0.991;0.995;0.993	D;D;D;D	0.68943	0.958;0.934;0.955;0.961	D	0.97622	1.0136	10	0.87932	D	0	.	11.5777	0.50873	0.0:0.0:0.0:1.0	.	358;356;345;345	B7Z2T0;F5H6J6;E9PC51;P13637	.;.;.;AT1A3_HUMAN	T	345;345;358;315;89;356	ENSP00000302397:N345T;ENSP00000411503:N345T;ENSP00000444688:N358T;ENSP00000437577:N356T	ENSP00000302397:N345T	N	-	2	0	ATP1A3	47178058	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.841000	0.86834	1.910000	0.55303	0.459000	0.35465	AAC	.		0.597	ATP1A3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268107.1	NM_152296	
ERCC2	2068	hgsc.bcm.edu	37	19	45867259	45867259	+	Missense_Mutation	SNP	C	C	T	rs1799793	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr19:45867259C>T	ENST00000391945.4	-	10	1011	c.934G>A	c.(934-936)Gac>Aac	p.D312N	ERCC2_ENST00000221481.6_3'UTR|ERCC2_ENST00000485403.2_Missense_Mutation_p.D288N|ERCC2_ENST00000391940.4_Missense_Mutation_p.D288N|ERCC2_ENST00000391944.3_Missense_Mutation_p.D234N	NM_000400.3	NP_000391.1	P18074	ERCC2_HUMAN	excision repair cross-complementation group 2	312			D -> N (in dbSNP:rs1799793). {ECO:0000269|PubMed:11245433, ECO:0000269|PubMed:11470747, ECO:0000269|PubMed:11709541, ECO:0000269|Ref.3}.		7-methylguanosine mRNA capping (GO:0006370)|aging (GO:0007568)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|central nervous system myelin formation (GO:0032289)|chromosome segregation (GO:0007059)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)|embryonic cleavage (GO:0040016)|erythrocyte maturation (GO:0043249)|extracellular matrix organization (GO:0030198)|gene expression (GO:0010467)|hair cell differentiation (GO:0035315)|hair follicle maturation (GO:0048820)|hematopoietic stem cell differentiation (GO:0060218)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision (GO:0033683)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral transcription (GO:0050434)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to hypoxia (GO:0001666)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|spinal cord development (GO:0021510)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)|viral process (GO:0016032)	cytoplasm (GO:0005737)|holo TFIIH complex (GO:0005675)|MMXD complex (GO:0071817)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	4 iron, 4 sulfur cluster binding (GO:0051539)|5'-3' DNA helicase activity (GO:0043139)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			large_intestine(4)|lung(2)|ovary(1)|pancreas(1)|stomach(1)	9		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		AGCACTTCGTCGGGCAGCACG	0.746			"""Mis, N, F, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum				C|||	974	0.194489	0.0734	0.1988	5008	,	,		10423	0.0496		0.3588	False		,,,				2504	0.3354				p.D312N		.	yes	Rec		Xeroderma pigmentosum (D)	19	19q13.2-q13.3	2068	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 (xeroderma pigmentosum D)"""		E	.	ERCC2-848	0			c.G934A	GRCh37	CM015299	ERCC2	M	rs1799793	.	C	ASN/ASP,ASN/ASP	387,3577		30,327,1625	5.0	8.0	7.0		934,862	5.2	0.5	19	dbSNP_89	7	2507,5397		444,1619,1889	no	missense,missense	ERCC2	NM_000400.3,NM_001130867.1	23,23	474,1946,3514	TT,TC,CC		31.7181,9.7629,24.3849	benign,benign	312/761,288/406	45867259	2894,8974	1982	3952	5934	SO:0001583	missense	2068	exon10	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	CTTCGTCGGGCAG		CCDS33049.1, CCDS46112.1	19q13.3	2014-09-17	2014-03-07		ENSG00000104884	ENSG00000104884	3.6.4.12	"""General transcription factor IIH complex subunits"""	3434	protein-coding gene	gene with protein product	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 protein"", ""TFIIH basal transcription factor complex helicase XPB subunit"""	126340	"""xeroderma pigmentosum complementary group D"", ""excision repair cross-complementing rodent repair deficiency, complementation group 2"""	XPD		8413672, 2184031	Standard	NM_000400		Approved	MAG, EM9, MGC102762, MGC126218, MGC126219, TFIIH	uc002pbj.2	P18074	OTTHUMG00000048190	ENST00000391945.4:c.934G>A	19.37:g.45867259C>T	ENSP00000375809:p.Asp312Asn	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	8	4	NM_000400	0	0	3	7	4	Q2TB78|Q2YDY2|Q7KZU6|Q8N721	Missense_Mutation	SNP	ENST00000391945.4	37	CCDS33049.1	423	0.1936813186813187	34	0.06910569105691057	70	0.19337016574585636	38	0.06643356643356643	281	0.370712401055409	C	20.0	3.930510	0.73327	0.097629	0.317181	ENSG00000104884	ENST00000391941;ENST00000391942;ENST00000391945;ENST00000391944;ENST00000391940	T;T;T	0.64438	-0.1;-0.1;-0.1	5.15	5.15	0.70609	Domain of unknown function DUF1227 (1);	0.000000	0.85682	D	0.000000	T	0.00012	0.0000	L	0.46947	1.48	0.09310	P	1.0	B;P;B	0.34639	0.065;0.461;0.053	B;B;B	0.35353	0.059;0.201;0.051	T	0.28267	-1.0049	9	0.33940	T	0.23	-30.0006	16.1268	0.81402	0.0:1.0:0.0:0.0	rs1799793;rs3916814;rs58989209;rs1799793	234;288;312	E7EVE9;Q7KZU6;P18074	.;.;ERCC2_HUMAN	N	262;288;312;234;288	ENSP00000375809:D312N;ENSP00000375808:D234N;ENSP00000375804:D288N	ENSP00000375804:D288N	D	-	1	0	ERCC2	50559099	1.000000	0.71417	0.523000	0.27875	0.865000	0.49528	7.192000	0.77771	2.388000	0.81334	0.561000	0.74099	GAC	C|0.804;T|0.196		0.746	ERCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109626.2	NM_000400	
ZC3H4	23211	hgsc.bcm.edu;ucsc.edu	37	19	47575243	47575243	+	Silent	SNP	T	T	A	rs392366		TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr19:47575243T>A	ENST00000253048.5	-	13	1975	c.1938A>T	c.(1936-1938)gcA>gcT	p.A646A	ZC3H4_ENST00000594019.1_Intron	NM_015168.1	NP_055983.1	Q9UPT8	ZC3H4_HUMAN	zinc finger CCCH-type containing 4	646	Pro-rich.						metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(13)|ovary(4)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)	41		all_cancers(25;3.3e-08)|all_epithelial(76;2.28e-06)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|all_neural(266;0.026)|Ovarian(192;0.0392)|Breast(70;0.0889)		OV - Ovarian serous cystadenocarcinoma(262;5.76e-05)|all cancers(93;7.69e-05)|Epithelial(262;0.00354)|GBM - Glioblastoma multiforme(486;0.0372)		cgtgcatgtctgcgtgcatgt	0.662																																					p.A646A		.											.	ZC3H4-74	0			c.A1938T						.	C		1,4247		0,1,2123	31.0	36.0	34.0		1938	-10.4	0.0	19	dbSNP_80	34	6,8510		0,6,4252	no	coding-synonymous	ZC3H4	NM_015168.1		0,7,6375	AA,AT,TT		0.0705,0.0235,0.0548		646/1304	47575243	7,12757	2124	4258	6382	SO:0001819	synonymous_variant	23211	exon13			CATGTCTGCGTGC	AB028987	CCDS42582.1	19q13.33	2012-07-05	2007-10-18	2007-10-18		ENSG00000130749		"""Zinc fingers, CCCH-type domain containing"""	17808	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 7"""	C19orf7			Standard	NM_015168		Approved	KIAA1064	uc002pga.4	Q9UPT8		ENST00000253048.5:c.1938A>T	19.37:g.47575243T>A		Somatic	68	0		WXS	Illumina GAIIx	Phase_I	91	33	NM_015168	0	0	3	3	0	Q9Y420	Silent	SNP	ENST00000253048.5	37	CCDS42582.1																																																																																			A|0.000;G|0.000;T|1.000		0.662	ZC3H4-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466667.1		
ZC3H4	23211	hgsc.bcm.edu;ucsc.edu	37	19	47575245	47575245	+	Missense_Mutation	SNP	C	C	G	rs381976		TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr19:47575245C>G	ENST00000253048.5	-	13	1973	c.1936G>C	c.(1936-1938)Gca>Cca	p.A646P	ZC3H4_ENST00000594019.1_Intron	NM_015168.1	NP_055983.1	Q9UPT8	ZC3H4_HUMAN	zinc finger CCCH-type containing 4	646	Pro-rich.						metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(13)|ovary(4)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)	41		all_cancers(25;3.3e-08)|all_epithelial(76;2.28e-06)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|all_neural(266;0.026)|Ovarian(192;0.0392)|Breast(70;0.0889)		OV - Ovarian serous cystadenocarcinoma(262;5.76e-05)|all cancers(93;7.69e-05)|Epithelial(262;0.00354)|GBM - Glioblastoma multiforme(486;0.0372)		tgcatgtctgcgtgcatgtca	0.662																																					p.A646P		.											.	ZC3H4-74	0			c.G1936C						.						31.0	35.0	34.0					19																	47575245		2118	4259	6377	SO:0001583	missense	23211	exon13			TGTCTGCGTGCAT	AB028987	CCDS42582.1	19q13.33	2012-07-05	2007-10-18	2007-10-18		ENSG00000130749		"""Zinc fingers, CCCH-type domain containing"""	17808	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 7"""	C19orf7			Standard	NM_015168		Approved	KIAA1064	uc002pga.4	Q9UPT8		ENST00000253048.5:c.1936G>C	19.37:g.47575245C>G	ENSP00000253048:p.Ala646Pro	Somatic	71	0		WXS	Illumina GAIIx	Phase_I	92	31	NM_015168	0	0	2	2	0	Q9Y420	Missense_Mutation	SNP	ENST00000253048.5	37	CCDS42582.1	.	.	.	.	.	.	.	.	.	.	G	1.939	-0.444005	0.04604	.	.	ENSG00000130749	ENST00000253048	T	0.17528	2.27	5.21	5.21	0.72293	.	0.405917	0.24076	N	0.041773	T	0.08044	0.0201	N	0.08118	0	0.09310	N	0.999993	B	0.02656	0.0	B	0.01281	0.0	T	0.32877	-0.9890	10	0.02654	T	1	.	13.2185	0.59873	0.0:0.1603:0.8397:0.0	rs381976;rs381976	646	Q9UPT8	ZC3H4_HUMAN	P	646	ENSP00000253048:A646P	ENSP00000253048:A646P	A	-	1	0	ZC3H4	52267085	1.000000	0.71417	0.916000	0.36221	0.011000	0.07611	4.019000	0.57181	1.200000	0.43188	-0.132000	0.14878	GCA	C|1.000;|0.000		0.662	ZC3H4-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466667.1		
ZC3H4	23211	hgsc.bcm.edu	37	19	47575255	47575255	+	Silent	SNP	A	A	C	rs73943611	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr19:47575255A>C	ENST00000253048.5	-	13	1963	c.1926T>G	c.(1924-1926)ccT>ccG	p.P642P	ZC3H4_ENST00000594019.1_Intron	NM_015168.1	NP_055983.1	Q9UPT8	ZC3H4_HUMAN	zinc finger CCCH-type containing 4	642	Pro-rich.						metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(13)|ovary(4)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)	41		all_cancers(25;3.3e-08)|all_epithelial(76;2.28e-06)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|all_neural(266;0.026)|Ovarian(192;0.0392)|Breast(70;0.0889)		OV - Ovarian serous cystadenocarcinoma(262;5.76e-05)|all cancers(93;7.69e-05)|Epithelial(262;0.00354)|GBM - Glioblastoma multiforme(486;0.0372)		cgtgcatgtcagggtgcatgt	0.662													a|||	4	0.000798722	0.0008	0.0043	5008	,	,		20539	0.0		0.0	False		,,,				2504	0.0				p.P642P		.											.	ZC3H4-74	0			c.T1926G						.						32.0	36.0	35.0					19																	47575255		2112	4250	6362	SO:0001819	synonymous_variant	23211	exon13			CATGTCAGGGTGC	AB028987	CCDS42582.1	19q13.33	2012-07-05	2007-10-18	2007-10-18		ENSG00000130749		"""Zinc fingers, CCCH-type domain containing"""	17808	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 7"""	C19orf7			Standard	NM_015168		Approved	KIAA1064	uc002pga.4	Q9UPT8		ENST00000253048.5:c.1926T>G	19.37:g.47575255A>C		Somatic	74	0		WXS	Illumina GAIIx	Phase_I	95	21	NM_015168	0	0	1	1	0	Q9Y420	Silent	SNP	ENST00000253048.5	37	CCDS42582.1																																																																																			A|0.996;C|0.000;T|0.003		0.662	ZC3H4-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466667.1		
ZC3H4	23211	hgsc.bcm.edu	37	19	47575267	47575267	+	Silent	SNP	C	C	G	rs200656728		TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr19:47575267C>G	ENST00000253048.5	-	13	1951	c.1914G>C	c.(1912-1914)ccG>ccC	p.P638P	ZC3H4_ENST00000594019.1_Intron	NM_015168.1	NP_055983.1	Q9UPT8	ZC3H4_HUMAN	zinc finger CCCH-type containing 4	638	Pro-rich.						metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(13)|ovary(4)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)	41		all_cancers(25;3.3e-08)|all_epithelial(76;2.28e-06)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|all_neural(266;0.026)|Ovarian(192;0.0392)|Breast(70;0.0889)		OV - Ovarian serous cystadenocarcinoma(262;5.76e-05)|all cancers(93;7.69e-05)|Epithelial(262;0.00354)|GBM - Glioblastoma multiforme(486;0.0372)		ggtgcatgtccgggtgcatgt	0.667																																					p.P638P		.											.	ZC3H4-74	0			c.G1914C						.						34.0	38.0	36.0					19																	47575267		2110	4239	6349	SO:0001819	synonymous_variant	23211	exon13			CATGTCCGGGTGC	AB028987	CCDS42582.1	19q13.33	2012-07-05	2007-10-18	2007-10-18		ENSG00000130749		"""Zinc fingers, CCCH-type domain containing"""	17808	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 7"""	C19orf7			Standard	NM_015168		Approved	KIAA1064	uc002pga.4	Q9UPT8		ENST00000253048.5:c.1914G>C	19.37:g.47575267C>G		Somatic	75	0		WXS	Illumina GAIIx	Phase_I	100	16	NM_015168	0	0	1	1	0	Q9Y420	Silent	SNP	ENST00000253048.5	37	CCDS42582.1																																																																																			C|1.000;A|0.000		0.667	ZC3H4-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466667.1		
GRIN2D	2906	hgsc.bcm.edu	37	19	48945880	48945880	+	Silent	SNP	T	T	C	rs62130268	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr19:48945880T>C	ENST00000263269.3	+	13	2785	c.2697T>C	c.(2695-2697)gcT>gcC	p.A899A		NM_000836.2	NP_000827.2	O15399	NMDE4_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2D	899					adult locomotory behavior (GO:0008344)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|regulation of sensory perception of pain (GO:0051930)|signal transduction (GO:0007165)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)			autonomic_ganglia(1)|breast(6)|endometrium(2)|large_intestine(9)|lung(12)|ovary(5)|pancreas(1)|prostate(1)	37		all_epithelial(76;1.11e-06)|all_lung(116;5.79e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		all cancers(93;0.00014)|OV - Ovarian serous cystadenocarcinoma(262;0.000233)|Epithelial(262;0.0112)|GBM - Glioblastoma multiforme(486;0.0161)	Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GCTGCAGCGCTGAGGCCGCCC	0.781													c|||	3742	0.747204	0.6188	0.8545	5008	,	,		4716	0.6548		0.8887	False		,,,				2504	0.7945				p.A899A		.											.	GRIN2D-156	0			c.T2697C						.			1689,437		638,413,12	1.0	1.0	1.0		2697	-3.3	1.0	19	dbSNP_129	1	3712,202		1757,198,2	no	coding-synonymous	GRIN2D	NM_000836.2		2395,611,14	CC,CT,TT		5.161,20.555,10.5795		899/1337	48945880	5401,639	1063	1957	3020	SO:0001819	synonymous_variant	2906	exon13			CAGCGCTGAGGCC	U77783	CCDS12719.1	19q13.33	2012-08-29			ENSG00000105464	ENSG00000105464		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4588	protein-coding gene	gene with protein product	"""N-methyl-d-aspartate receptor subunit 2D"""	602717		NMDAR2D		9480759, 9418891	Standard	NM_000836		Approved	GluN2D, EB11, NR2D	uc002pjc.4	O15399		ENST00000263269.3:c.2697T>C	19.37:g.48945880T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_000836	0	0	0	0	0		Silent	SNP	ENST00000263269.3	37	CCDS12719.1																																																																																			T|0.245;C|0.755		0.781	GRIN2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466121.1		
RASIP1	54922	hgsc.bcm.edu	37	19	49232226	49232226	+	Missense_Mutation	SNP	G	G	A	rs2287922	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr19:49232226G>A	ENST00000222145.4	-	5	2005	c.1801C>T	c.(1801-1803)Cgc>Tgc	p.R601C	RASIP1_ENST00000594232.1_5'Flank	NM_017805.2	NP_060275.2	Q5U651	RAIN_HUMAN	Ras interacting protein 1	601	Dilute. {ECO:0000255|PROSITE- ProRule:PRU00503}.		R -> C (in dbSNP:rs2287922). {ECO:0000269|PubMed:15031288}.		angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|negative regulation of autophagy (GO:0010507)|regulation of Rho GTPase activity (GO:0032319)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	Golgi apparatus (GO:0005794)				central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(7)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	21		all_lung(116;4.89e-06)|all_epithelial(76;7.04e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;9.98e-05)|all cancers(93;0.000272)|Epithelial(262;0.0155)|GBM - Glioblastoma multiforme(486;0.0222)		CGGGCCAGGCGGCCCAGCAGT	0.731													G|||	1076	0.214856	0.1157	0.2997	5008	,	,		8786	0.0198		0.4791	False		,,,				2504	0.2178				p.R601C		.											.	RASIP1-228	0			c.C1801T						.	G	CYS/ARG	456,2624		82,292,1166	2.0	3.0	3.0		1801	4.2	1.0	19	dbSNP_100	3	2661,3381		645,1371,1005	yes	missense	RASIP1	NM_017805.2	180	727,1663,2171	AA,AG,GG		44.0417,14.8052,34.1701	probably-damaging	601/964	49232226	3117,6005	1540	3021	4561	SO:0001583	missense	54922	exon5			CCAGGCGGCCCAG	BC028614	CCDS12731.1	19q13.33	2008-02-05				ENSG00000105538			24716	protein-coding gene	gene with protein product		609623				15031288	Standard	NM_017805		Approved	FLJ20401, RAIN	uc002pki.3	Q5U651		ENST00000222145.4:c.1801C>T	19.37:g.49232226G>A	ENSP00000222145:p.Arg601Cys	Somatic	1	1		WXS	Illumina GAIIx	Phase_I	5	5	NM_017805	0	0	0	1	1	Q6U676	Missense_Mutation	SNP	ENST00000222145.4	37	CCDS12731.1	571	0.26144688644688646	65	0.13211382113821138	127	0.35082872928176795	21	0.03671328671328671	358	0.47229551451187335	G	17.28	3.350878	0.61183	0.148052	0.440417	ENSG00000105538	ENST00000222145	T	0.27557	1.66	4.17	4.17	0.49024	Dilute (1);	0.331247	0.23983	N	0.042644	T	0.00012	0.0000	L	0.39898	1.24	0.22701	P	0.99883638	D	0.76494	0.999	P	0.54590	0.756	T	0.48328	-0.9045	9	0.66056	D	0.02	-0.9078	9.7493	0.40466	0.0:0.0:0.7933:0.2067	rs2287922	601	Q5U651	RAIN_HUMAN	C	601	ENSP00000222145:R601C	ENSP00000222145:R601C	R	-	1	0	RASIP1	53924038	1.000000	0.71417	1.000000	0.80357	0.642000	0.38348	3.181000	0.50903	2.023000	0.59567	0.462000	0.41574	CGC	G|0.738;A|0.262		0.731	RASIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466185.1	NM_017805	
ADM5	199800	broad.mit.edu	37	19	50193643	50193643	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr19:50193643G>T	ENST00000420022.3	+	2	1529	c.355G>T	c.(355-357)Ggc>Tgc	p.G119C	CPT1C_ENST00000392518.4_5'Flank|CPT1C_ENST00000323446.5_5'Flank|CPT1C_ENST00000598293.1_5'Flank|CTB-33G10.6_ENST00000596472.1_RNA|CPT1C_ENST00000405931.2_5'Flank|CPT1C_ENST00000354199.5_5'Flank	NM_001101340.1	NP_001094810.1	C9JUS6	ADM5_HUMAN	adrenomedullin 5 (putative)	119						extracellular region (GO:0005576)											tcccctcctcggcttcagttt	0.642																																					p.G119C		.											.	.	0			c.G355T						.						39.0	47.0	44.0					19																	50193643		1365	2829	4194	SO:0001583	missense	199800	exon2			CTCCTCGGCTTCA	BC032764	CCDS46146.1	19q13.33	2012-12-07	2012-12-07	2012-10-29	ENSG00000224420	ENSG00000224420			27293	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 76"", ""adrenomedullin 5 homolog (pig)"""	C19orf76		18434369	Standard	NM_001101340		Approved	AM5	uc002pph.2	C9JUS6		ENST00000420022.3:c.355G>T	19.37:g.50193643G>T	ENSP00000393631:p.Gly119Cys	Somatic	151	0		WXS	Illumina GAIIx	Phase_I	378	12	NM_001101340	0	0	0	0	0		Missense_Mutation	SNP	ENST00000420022.3	37	CCDS46146.1	.	.	.	.	.	.	.	.	.	.	G	10.45	1.352599	0.24512	.	.	ENSG00000224420	ENST00000420022	.	.	.	1.91	-1.72	0.08107	.	.	.	.	.	T	0.25791	0.0628	N	0.08118	0	0.09310	N	1	D	0.89917	1.0	D	0.68353	0.957	T	0.14090	-1.0485	8	0.87932	D	0	.	2.8148	0.05453	0.3315:0.2476:0.421:0.0	.	119	C9JUS6	ADM5_HUMAN	C	119	.	ENSP00000393631:G119C	G	+	1	0	C19orf76	54885455	0.000000	0.05858	0.001000	0.08648	0.213000	0.24496	-0.191000	0.09601	-0.335000	0.08451	0.561000	0.74099	GGC	.		0.642	ADM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465777.1	NM_001101340	
ASPDH	554235	hgsc.bcm.edu	37	19	51015404	51015404	+	Missense_Mutation	SNP	T	T	C	rs12977172	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr19:51015404T>C	ENST00000389208.4	-	6	858	c.797A>G	c.(796-798)cAg>cGg	p.Q266R	ASPDH_ENST00000376916.3_Missense_Mutation_p.Q161R|JOSD2_ENST00000601423.1_5'Flank|ASPDH_ENST00000597030.1_5'Flank|JOSD2_ENST00000598418.1_5'Flank|JOSD2_ENST00000391815.3_5'Flank|JOSD2_ENST00000595669.1_5'Flank	NM_001114598.1	NP_001108070.1	A6ND91	ASPD_HUMAN	aspartate dehydrogenase domain containing	266			Q -> R (in dbSNP:rs12977172). {ECO:0000269|PubMed:15489334, ECO:0000269|Ref.1}.		NAD biosynthetic process (GO:0009435)|NADP catabolic process (GO:0006742)		aspartate dehydrogenase activity (GO:0033735)|NADP binding (GO:0050661)			endometrium(1)|large_intestine(1)|lung(1)	3						CAGGAGGCTCTGCCAGAAGGC	0.706													C|||	3986	0.795927	0.9728	0.7781	5008	,	,		10864	0.7143		0.6849	False		,,,				2504	0.7679				p.Q266R		.											.	ASPDH-90	0			c.A797G						.	C	ARG/GLN,ARG/GLN	3799,331		1771,257,37	6.0	9.0	8.0		482,797	1.9	1.0	19	dbSNP_121	8	5527,2593		1919,1689,452	no	missense,missense	ASPDH	NM_001024656.2,NM_001114598.1	43,43	3690,1946,489	CC,CT,TT		31.9335,8.0145,23.8694	benign,benign	161/179,266/284	51015404	9326,2924	2065	4060	6125	SO:0001583	missense	554235	exon6			AGGCTCTGCCAGA		CCDS33082.1, CCDS46153.1	19q13.33	2012-10-02			ENSG00000204653	ENSG00000204653			33856	protein-coding gene	gene with protein product							Standard	NM_001024656		Approved		uc010enz.3	A6ND91		ENST00000389208.4:c.797A>G	19.37:g.51015404T>C	ENSP00000373860:p.Gln266Arg	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	5	NM_001114598	0	0	0	0	0	Q6NZ37	Missense_Mutation	SNP	ENST00000389208.4	37	CCDS46153.1	1681	0.7696886446886447	481	0.9776422764227642	273	0.7541436464088398	412	0.7202797202797203	515	0.679419525065963	C	3.606	-0.080592	0.07141	0.919855	0.680665	ENSG00000204653	ENST00000376916;ENST00000389208	T;T	0.39997	1.05;1.05	2.95	1.88	0.25563	Aspartate dehydrogenase (1);	1.158050	0.06646	N	0.761872	T	0.00012	0.0000	N	0.01705	-0.755	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.30794	-0.9966	9	0.06099	T	0.92	-1.7519	4.8935	0.13738	0.0:0.6813:0.0:0.3187	rs12977172	266;161	A6ND91;A6ND91-2	ASPD_HUMAN;.	R	161;266	ENSP00000366114:Q161R;ENSP00000373860:Q266R	ENSP00000366114:Q161R	Q	-	2	0	ASPDH	55707216	0.916000	0.31088	0.989000	0.46669	0.553000	0.35397	0.171000	0.16685	0.125000	0.18397	-0.355000	0.07637	CAG	T|0.228;C|0.772		0.706	ASPDH-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464861.1	NM_001024656	
KLK10	5655	ucsc.edu	37	19	51520487	51520487	+	Missense_Mutation	SNP	A	A	C	rs3745535	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr19:51520487A>C	ENST00000309958.3	-	3	366	c.148T>G	c.(148-150)Tcc>Gcc	p.S50A	CTC-518B2.12_ENST00000596286.1_RNA|KLK10_ENST00000391805.1_Missense_Mutation_p.S50A|KLK10_ENST00000358789.3_Missense_Mutation_p.S50A	NM_002776.4	NP_002767.2	O43240	KLK10_HUMAN	kallikrein-related peptidase 10	50	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.		S -> A (in dbSNP:rs3745535). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:8764136, ECO:0000269|PubMed:9647736}.		cell cycle (GO:0007049)	extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)	13		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00328)|GBM - Glioblastoma multiforme(134;0.00885)		GCGCACGGGGAGCCATAGGCT	0.667											OREG0025646	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	C|||	3477	0.694289	0.9811	0.6772	5008	,	,		13846	0.6548		0.6213	False		,,,				2504	0.4346				p.S50A		.											.	KLK10-650	0			c.T148G						.	C	ALA/SER,ALA/SER,ALA/SER	4053,343		1865,323,10	13.0	16.0	15.0		148,148,148	-2.8	0.0	19	dbSNP_107	15	5503,3077		1812,1879,599	yes	missense,missense,missense	KLK10	NM_001077500.1,NM_002776.4,NM_145888.2	99,99,99	3677,2202,609	CC,CA,AA		35.8625,7.8025,26.3564	benign,benign,benign	50/277,50/277,50/277	51520487	9556,3420	2198	4290	6488	SO:0001583	missense	5655	exon3			ACGGGGAGCCATA	AF024605	CCDS12817.1	19q13	2011-03-07	2006-10-27			ENSG00000129451		"""Kallikreins"""	6358	protein-coding gene	gene with protein product		602673	"""kallikrein 10"""	PRSSL1		8764136, 9533035, 16800724, 16800723, 10675891	Standard	NM_145888		Approved	NES1	uc002pva.3	O43240		ENST00000309958.3:c.148T>G	19.37:g.51520487A>C	ENSP00000311746:p.Ser50Ala	Somatic	15	0	978	WXS	Illumina GAIIx	Phase_I	140	20	NM_145888	0	0	0	0	0	A6NC12|Q53YL3|Q99920|Q9GZW9	Missense_Mutation	SNP	ENST00000309958.3	37	CCDS12817.1	1543	0.7065018315018315	471	0.9573170731707317	246	0.6795580110497238	355	0.6206293706293706	471	0.6213720316622692	N	3.474	-0.107412	0.06924	0.921975	0.641375	ENSG00000129451	ENST00000391805;ENST00000309958;ENST00000358789	D;D;D	0.88741	-2.42;-2.42;-2.42	4.11	-2.83	0.05769	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	T	0.00012	0.0000	L	0.35854	1.095	0.80722	P	0.0	B	0.02656	0.0	B	0.08055	0.003	T	0.34054	-0.9844	8	0.15066	T	0.55	.	4.8825	0.13686	0.1624:0.2641:0.0:0.5735	rs3745535;rs17728200;rs17856072;rs59150705;rs3745535	50	O43240	KLK10_HUMAN	A	50	ENSP00000375681:S50A;ENSP00000311746:S50A;ENSP00000351640:S50A	ENSP00000311746:S50A	S	-	1	0	KLK10	56212299	0.000000	0.05858	0.000000	0.03702	0.063000	0.16089	-1.050000	0.03510	-0.576000	0.05974	-1.392000	0.01152	TCC	A|0.266;C|0.734		0.667	KLK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464337.2	NM_002776	
KLK12	43849	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	51532678	51532678	+	Silent	SNP	G	G	T			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr19:51532678G>T	ENST00000525263.1	-	5	746	c.627C>A	c.(625-627)gtC>gtA	p.V209V	KLK11_ENST00000391804.3_5'Flank|KLK11_ENST00000594768.1_5'Flank|KLK11_ENST00000594458.1_5'Flank|KLK11_ENST00000319720.7_5'Flank|KLK12_ENST00000250352.11_Silent_p.V99V|CTC-518B2.9_ENST00000594910.1_RNA|KLK12_ENST00000319590.4_Silent_p.V209V|KLK11_ENST00000453757.3_5'Flank|KLK12_ENST00000529888.1_3'UTR|KLK11_ENST00000600362.1_5'Flank|KLK12_ENST00000250351.4_Silent_p.V209V			Q9UKR0	KLK12_HUMAN	kallikrein-related peptidase 12	209	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				proteolysis (GO:0006508)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			endometrium(1)|large_intestine(4)|lung(3)|ovary(1)|skin(1)|stomach(1)|urinary_tract(1)	12		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00328)|GBM - Glioblastoma multiforme(134;0.00399)		GACCTTGAAGGACTCCCCCAC	0.547																																					p.V209V		.											.	KLK12-227	0			c.C627A						.						63.0	67.0	66.0					19																	51532678		2203	4300	6503	SO:0001819	synonymous_variant	43849	exon6			TTGAAGGACTCCC		CCDS12820.1, CCDS12821.1, CCDS54298.1	19q13.33	2008-02-05	2006-10-27		ENSG00000186474	ENSG00000186474		"""Kallikreins"""	6360	protein-coding gene	gene with protein product		605539	"""kallikrein 12"""			16800724, 16800723	Standard	NM_019598		Approved	KLK-L5	uc002pvh.1	Q9UKR0	OTTHUMG00000165806	ENST00000525263.1:c.627C>A	19.37:g.51532678G>T		Somatic	71	0		WXS	Illumina GAIIx	Phase_I	83	39	NM_019598	0	0	0	0	0	Q9UKR1|Q9UKR2	Silent	SNP	ENST00000525263.1	37	CCDS12821.1																																																																																			.		0.547	KLK12-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000386288.1	NM_019598	
ZNF765	91661	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	53912284	53912284	+	Silent	SNP	A	A	G			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr19:53912284A>G	ENST00000396408.3	+	4	1593	c.1476A>G	c.(1474-1476)aaA>aaG	p.K492K	ZNF765_ENST00000594030.1_Intron	NM_001040185.1	NP_001035275.1	Q7L2R6	ZN765_HUMAN	zinc finger protein 765	492					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|lung(3)	4				GBM - Glioblastoma multiforme(134;0.00379)		CTGGACAGAAACCTTACAAAT	0.388																																					p.K492K		.											.	ZNF765-69	0			c.A1476G						.						64.0	68.0	66.0					19																	53912284		2200	4300	6500	SO:0001819	synonymous_variant	91661	exon4			ACAGAAACCTTAC	BC017357	CCDS46171.1	19q13.41	2013-01-08				ENSG00000196417		"""Zinc fingers, C2H2-type"", ""-"""	25092	protein-coding gene	gene with protein product						12477932	Standard	XR_430215		Approved		uc002qbm.3	Q7L2R6		ENST00000396408.3:c.1476A>G	19.37:g.53912284A>G		Somatic	126	0		WXS	Illumina GAIIx	Phase_I	166	33	NM_001040185	0	0	0	0	0	A8MYG0|B4DF18|B7ZAI5|B9EIL1|Q9BV49	Silent	SNP	ENST00000396408.3	37	CCDS46171.1																																																																																			.		0.388	ZNF765-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371603.1	NM_138372	
ZFP36L2	678	hgsc.bcm.edu	37	2	43452793	43452793	+	Silent	SNP	C	C	G	rs77160973	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr2:43452793C>G	ENST00000282388.3	-	2	443	c.150G>C	c.(148-150)ccG>ccC	p.P50P	THADA_ENST00000330266.7_Intron	NM_006887.4	NP_008818.3	P47974	TISD_HUMAN	ZFP36 ring finger protein-like 2	50					cell proliferation (GO:0008283)|definitive hemopoiesis (GO:0060216)|hemopoiesis (GO:0030097)|mRNA catabolic process (GO:0006402)|negative regulation of stem cell differentiation (GO:2000737)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	AU-rich element binding (GO:0017091)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|mRNA 3'-UTR AU-rich region binding (GO:0035925)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	15		Acute lymphoblastic leukemia(82;0.00323)|all_hematologic(82;0.00824)				GGAGGAATCCCGGCGCGAAGC	0.692													C|||	128	0.0255591	0.0023	0.0259	5008	,	,		12353	0.001		0.0577	False		,,,				2504	0.0491				p.P50P		.											.	ZFP36L2-226	0			c.G150C						.	C		59,4289		0,59,2115	8.0	10.0	10.0		150	1.9	1.0	2	dbSNP_132	10	487,8043		16,455,3794	no	coding-synonymous	ZFP36L2	NM_006887.4		16,514,5909	GG,GC,CC		5.7093,1.3569,4.2398		50/495	43452793	546,12332	2174	4265	6439	SO:0001819	synonymous_variant	678	exon2			GAATCCCGGCGCG	X78992	CCDS1811.1	2p22.3-p21	2012-11-27	2012-11-27	2001-11-23	ENSG00000152518	ENSG00000152518		"""RING-type (C3HC4) zinc fingers"""	1108	protein-coding gene	gene with protein product		612053	"""zinc finger protein 36, C3H type-like 1"", ""zinc finger protein 36, C3H type-like 2"""	BRF2		7835719, 8545129, 14981510, 17172869	Standard	NM_006887		Approved	ERF2, RNF162C, TIS11D	uc002rsv.4	P47974	OTTHUMG00000128642	ENST00000282388.3:c.150G>C	2.37:g.43452793C>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	6	NM_006887	0	0	0	2	2	Q53TB4|Q9BSJ3	Silent	SNP	ENST00000282388.3	37	CCDS1811.1																																																																																			C|0.971;G|0.029		0.692	ZFP36L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250513.2	NM_006887	
NRXN1	9378	hgsc.bcm.edu	37	2	51255344	51255344	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr2:51255344C>A	ENST00000406316.2	-	2	1544	c.68G>T	c.(67-69)tGc>tTc	p.C23F	NRXN1_ENST00000406859.3_Missense_Mutation_p.C23F|NRXN1_ENST00000401669.2_Missense_Mutation_p.C23F|NRXN1_ENST00000405472.3_Missense_Mutation_p.C23F|NRXN1_ENST00000402717.3_Missense_Mutation_p.C23F|NRXN1_ENST00000405581.1_Missense_Mutation_p.C23F|NRXN1_ENST00000404971.1_Missense_Mutation_p.C23F	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	23					adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			CTCCGCCCAGCAGCCCAGGAG	0.716																																					p.C23F		.											.	NRXN1-92	0			c.G68T						.						4.0	5.0	5.0					2																	51255344		1869	4046	5915	SO:0001583	missense	9378	exon2			GCCCAGCAGCCCA	AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.68G>T	2.37:g.51255344C>A	ENSP00000384311:p.Cys23Phe	Somatic	3	0		WXS	Illumina GAIIx	Phase_I	33	16	NM_004801	0	0	0	0	0	A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Missense_Mutation	SNP	ENST00000406316.2	37	CCDS54360.1	.	.	.	.	.	.	.	.	.	.	C	17.85	3.489305	0.64074	.	.	ENSG00000179915	ENST00000404971;ENST00000406316;ENST00000405472;ENST00000401669;ENST00000536085;ENST00000402717;ENST00000406859;ENST00000405581	T;T;T;T;T;T;T	0.78924	-1.22;-1.22;-1.22;-1.22;-1.22;-1.22;-1.22	5.05	5.05	0.67936	.	0.370606	0.15113	U	0.279834	T	0.76905	0.4053	L	0.59436	1.845	0.45035	D	0.998054	D;D;B	0.54207	0.965;0.965;0.063	P;P;B	0.44811	0.461;0.461;0.006	T	0.73883	-0.3842	10	0.13470	T	0.59	.	18.4092	0.90545	0.0:1.0:0.0:0.0	.	23;23;23	Q9ULB1-3;F8WB18;Q9ULB1	.;.;NRX1A_HUMAN	F	23	ENSP00000385142:C23F;ENSP00000384311:C23F;ENSP00000434015:C23F;ENSP00000385017:C23F;ENSP00000385434:C23F;ENSP00000385681:C23F;ENSP00000385310:C23F	ENSP00000385017:C23F	C	-	2	0	NRXN1	51108848	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.343000	0.79319	2.340000	0.79590	0.514000	0.50259	TGC	.		0.716	NRXN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325291.2		
CNTNAP5	129684	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	125660522	125660522	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr2:125660522C>G	ENST00000431078.1	+	22	3861	c.3497C>G	c.(3496-3498)tCt>tGt	p.S1166C		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	1166	Laminin G-like 4. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		GGATGCATGTCTTCCGTCCAG	0.483																																					p.S1166C		.											.	CNTNAP5-524	0			c.C3497G						.						66.0	67.0	66.0					2																	125660522		2054	4221	6275	SO:0001583	missense	129684	exon22			GCATGTCTTCCGT	AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.3497C>G	2.37:g.125660522C>G	ENSP00000399013:p.Ser1166Cys	Somatic	161	0		WXS	Illumina GAIIx	Phase_I	164	77	NM_130773	0	0	0	0	0	Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Missense_Mutation	SNP	ENST00000431078.1	37	CCDS46401.1	.	.	.	.	.	.	.	.	.	.	C	15.25	2.779241	0.49891	.	.	ENSG00000155052	ENST00000431078	T	0.79653	-1.29	5.5	5.5	0.81552	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.48767	D	0.000176	D	0.91126	0.7206	M	0.88775	2.98	0.53688	D	0.999971	D	0.71674	0.998	D	0.66847	0.947	D	0.92519	0.6023	10	0.87932	D	0	.	18.4001	0.90513	0.0:1.0:0.0:0.0	.	1166	Q8WYK1	CNTP5_HUMAN	C	1166	ENSP00000399013:S1166C	ENSP00000399013:S1166C	S	+	2	0	CNTNAP5	125376992	1.000000	0.71417	0.997000	0.53966	0.009000	0.06853	5.850000	0.69473	2.597000	0.87782	0.655000	0.94253	TCT	.		0.483	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330864.3		
HS6ST1	9394	hgsc.bcm.edu	37	2	129076016	129076016	+	Missense_Mutation	SNP	C	C	G	rs201154532	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr2:129076016C>G	ENST00000259241.6	-	1	135	c.122G>C	c.(121-123)aGc>aCc	p.S41T	HS6ST1_ENST00000494089.1_5'UTR	NM_004807.2	NP_004798.3	O60243	H6ST1_HUMAN	heparan sulfate 6-O-sulfotransferase 1	41					angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)|labyrinthine layer blood vessel development (GO:0060716)|lung alveolus development (GO:0048286)|neuron development (GO:0048666)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)	heparan sulfate 6-O-sulfotransferase activity (GO:0017095)|sulfotransferase activity (GO:0008146)			endometrium(3)|liver(1)|lung(7)|pancreas(1)|prostate(2)|skin(1)	15	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.117)		cgcgcccAGGCTCAGTCCTGG	0.682													C|||	125	0.0249601	0.0061	0.0173	5008	,	,		7315	0.004		0.0537	False		,,,				2504	0.0481				p.S41T		.											.	HS6ST1-91	0			c.G122C						.						6.0	8.0	7.0					2																	129076016		1754	3929	5683	SO:0001583	missense	9394	exon1			CCCAGGCTCAGTC	AB006179	CCDS42748.1	2q21	2010-03-19		2002-08-23	ENSG00000136720	ENSG00000136720		"""Sulfotransferases, membrane-bound"""	5201	protein-coding gene	gene with protein product		604846		HS6ST		9535912	Standard	NM_004807		Approved		uc002tpt.4	O60243	OTTHUMG00000153542	ENST00000259241.6:c.122G>C	2.37:g.129076016C>G	ENSP00000259241:p.Ser41Thr	Somatic	1	1		WXS	Illumina GAIIx	Phase_I	5	4	NM_004807	0	0	0	0	0	B4DEP2|B4DJ29|Q53SL2|Q9BVI1	Missense_Mutation	SNP	ENST00000259241.6	37	CCDS42748.1	.	.	.	.	.	.	.	.	.	.	c	11.05	1.525451	0.27299	.	.	ENSG00000136720	ENST00000259241	D	0.82711	-1.64	3.16	3.16	0.36331	.	0.115571	0.64402	U	0.000008	T	0.63534	0.2519	N	0.14661	0.345	0.37192	D	0.903994	B	0.26002	0.139	B	0.19946	0.027	T	0.59563	-0.7431	9	.	.	.	.	6.0589	0.19826	0.0:0.8538:0.0:0.1462	.	41	O60243	H6ST1_HUMAN	T	41	ENSP00000259241:S41T	.	S	-	2	0	HS6ST1	128792486	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	2.610000	0.46325	1.600000	0.50102	0.313000	0.20887	AGC	.		0.682	HS6ST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331572.1	NM_004807	
CTLA4	1493	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	204735648	204735648	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr2:204735648A>G	ENST00000302823.3	+	2	606	c.449A>G	c.(448-450)tAt>tGt	p.Y150C	CTLA4_ENST00000487393.1_Intron|CTLA4_ENST00000295854.6_Missense_Mutation_p.Y150C|CTLA4_ENST00000427473.2_Missense_Mutation_p.Y113C|CTLA4_ENST00000472206.1_Intron	NM_005214.4	NP_005205.2	P16410	CTLA4_HUMAN	cytotoxic T-lymphocyte-associated protein 4	150	Homodimerization.				B cell receptor signaling pathway (GO:0050853)|cellular response to DNA damage stimulus (GO:0006974)|immune response (GO:0006955)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of immune response (GO:0050777)|negative regulation of regulatory T cell differentiation (GO:0045590)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of apoptotic process (GO:0043065)|T cell costimulation (GO:0031295)	clathrin-coated endocytic vesicle (GO:0045334)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)				large_intestine(4)|lung(4)|skin(1)	9					Ipilimumab(DB06186)	ACCCAGATTTATGTAATTGGT	0.473																																					p.Y150C		.											.	CTLA4-90	0			c.A449G						.						55.0	53.0	54.0					2																	204735648		2203	4300	6503	SO:0001583	missense	1493	exon2			AGATTTATGTAAT		CCDS2362.1, CCDS42803.1	2q33	2014-02-03			ENSG00000163599	ENSG00000163599		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	2505	protein-coding gene	gene with protein product		123890	"""celiac disease 3"", ""insulin-dependent diabetes mellitus 12"""	CELIAC3, IDDM12		3220103, 8817351	Standard	NM_005214		Approved	CD152, CD, GSE, CD28, ICOS	uc002vak.2	P16410	OTTHUMG00000132877	ENST00000302823.3:c.449A>G	2.37:g.204735648A>G	ENSP00000303939:p.Tyr150Cys	Somatic	105	0		WXS	Illumina GAIIx	Phase_I	181	11	NM_005214	0	0	0	0	0	A0N1S0|E9PDH0|O95653|Q0PP65|Q52MC1|Q53TD5|Q5S005|Q8WXJ1|Q96P43|Q9UKN9	Missense_Mutation	SNP	ENST00000302823.3	37	CCDS2362.1	.	.	.	.	.	.	.	.	.	.	A	12.54	1.968096	0.34754	.	.	ENSG00000163599	ENST00000302823;ENST00000295854;ENST00000427473	T;T;T	0.42513	0.97;0.97;0.97	5.34	4.14	0.48551	Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	0.137686	0.49916	D	0.000121	T	0.62575	0.2439	M	0.77820	2.39	0.51767	D	0.999932	D;D	0.89917	0.999;1.0	D;D	0.77557	0.986;0.99	T	0.64681	-0.6350	10	0.87932	D	0	-8.3732	10.3742	0.44073	0.8359:0.0:0.0:0.1641	.	150;150	Q8TDA6;P16410	.;CTLA4_HUMAN	C	150;150;113	ENSP00000303939:Y150C;ENSP00000295854:Y150C;ENSP00000409707:Y113C	ENSP00000295854:Y150C	Y	+	2	0	CTLA4	204443893	1.000000	0.71417	1.000000	0.80357	0.086000	0.17979	2.491000	0.45303	0.793000	0.33875	0.533000	0.62120	TAT	.		0.473	CTLA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256365.1	NM_005214	
ALPP	250	hgsc.bcm.edu	37	2	233246432	233246432	+	Missense_Mutation	SNP	G	G	C	rs377067025		TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr2:233246432G>C	ENST00000392027.2	+	11	1804	c.1535G>C	c.(1534-1536)cGg>cCg	p.R512P	AC068134.8_ENST00000439072.1_RNA|AC068134.8_ENST00000441266.1_RNA	NM_001632.3	NP_001623.3	P05187	PPB1_HUMAN	alkaline phosphatase, placental	512					dephosphorylation (GO:0016311)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alkaline phosphatase activity (GO:0004035)|magnesium ion binding (GO:0000287)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(1)|endometrium(1)|kidney(4)|large_intestine(2)|liver(1)|lung(10)|ovary(2)	22		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)		CACCCGGGGCGGTCCGTGGTC	0.731																																					p.R512P		.											.	ALPP-91	0			c.G1535C						.	C	PRO/ARG	4,4306		0,4,2151	10.0	12.0	11.0		1535	-3.2	0.0	2		11	2,8428		0,2,4213	no	missense	ALPP	NM_001632.3	103	0,6,6364	CC,CG,GG		0.0237,0.0928,0.0471	benign	512/536	233246432	6,12734	2155	4215	6370	SO:0001583	missense	250	exon11			CGGGGCGGTCCGT	M14169	CCDS2490.1	2q37.1	2010-06-24	2010-06-24		ENSG00000163283	ENSG00000163283	3.1.3.1		439	protein-coding gene	gene with protein product	"""Regan isozyme"""	171800	"""alkaline phosphatase, placental (Regan isozyme)"""			3001717, 3461452	Standard	XM_005246439		Approved		uc002vsq.3	P05187	OTTHUMG00000133255	ENST00000392027.2:c.1535G>C	2.37:g.233246432G>C	ENSP00000375881:p.Arg512Pro	Somatic	5	1		WXS	Illumina GAIIx	Phase_I	8	2	NM_001632	0	0	0	0	0	P05188|P06861|Q53S78|Q96DB7	Missense_Mutation	SNP	ENST00000392027.2	37	CCDS2490.1	.	.	.	.	.	.	.	.	.	.	C	0.776	-0.764141	0.02996	9.28E-4	2.37E-4	ENSG00000163283	ENST00000392027	D	0.95622	-3.76	1.63	-3.25	0.05079	.	1.313690	0.05099	N	0.486674	D	0.86698	0.5995	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.66504	-0.5907	10	0.27082	T	0.32	.	2.7199	0.05198	0.1138:0.3839:0.2785:0.2239	.	512	P05187	PPB1_HUMAN	P	512	ENSP00000375881:R512P	ENSP00000375881:R512P	R	+	2	0	ALPP	232954676	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.757000	0.04772	-4.810000	0.00031	-4.083000	0.00012	CGG	.		0.731	ALPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257032.3	NM_001632	
SIRPB2	284759	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	1456854	1456854	+	Silent	SNP	T	T	A			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr20:1456854T>A	ENST00000359801.3	-	5	1023	c.987A>T	c.(985-987)gcA>gcT	p.A329A	SIRPB2_ENST00000444444.2_Silent_p.A231A|SIRPB2_ENST00000608747.1_5'Flank	NM_001122962.1	NP_001116434.1	Q9P1W8	SIRPG_HUMAN	signal-regulatory protein beta 2	363	Ig-like C1-type 2.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell activation (GO:0050870)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						TCATGGCTCCTGCTGGGCCTG	0.602																																					p.A329A		.											.	SIRPB2-226	0			c.A987T						.						141.0	123.0	128.0					20																	1456854		1568	3582	5150	SO:0001819	synonymous_variant	284759	exon5			GGCTCCTGCTGGG	AL109658	CCDS42849.1, CCDS46570.1	20p13	2013-01-11	2006-02-03	2006-02-03	ENSG00000196209	ENSG00000196209		"""Signal-regulatory proteins"", ""Immunoglobulin superfamily / V-set domain containing"""	16247	protein-coding gene	gene with protein product			"""protein tyrosine phosphatase, non-receptor type 1-like"", ""protein tyrosine phosphatase, non-receptor type substrate 1-like 3"""	PTPN1L, PTPNS1L3		16339511	Standard	NM_001122962		Approved	dJ776F14.2	uc002wfg.2	Q5JXA9	OTTHUMG00000031670	ENST00000359801.3:c.987A>T	20.37:g.1456854T>A		Somatic	154	0		WXS	Illumina GAIIx	Phase_I	215	61	NM_001122962	0	0	0	0	0	B1AKP6|Q5D051|Q5JV25|Q5MKL4|Q8WWA5|Q9NQK8	Silent	SNP	ENST00000359801.3	37	CCDS42849.1																																																																																			.		0.602	SIRPB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077544.1	NM_178459	
SLC4A11	83959	bcgsc.ca	37	20	3211402	3211402	+	Missense_Mutation	SNP	C	C	T	rs376120280		TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr20:3211402C>T	ENST00000380056.3	-	10	1353	c.1306G>A	c.(1306-1308)Gcg>Acg	p.A436T	SLC4A11_ENST00000380059.3_Missense_Mutation_p.A463T|SLC4A11_ENST00000539553.2_Missense_Mutation_p.A420T|SLC4A11_ENST00000488544.1_5'Flank	NM_032034.3	NP_114423.1	Q8NBS3	S4A11_HUMAN	solute carrier family 4, sodium borate transporter, member 11	436	Membrane (bicarbonate transporter).				bicarbonate transport (GO:0015701)|borate transmembrane transport (GO:0035445)|borate transport (GO:0046713)|cellular cation homeostasis (GO:0030003)|fluid transport (GO:0042044)|proton transport (GO:0015992)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	bicarbonate transmembrane transporter activity (GO:0015106)|borate transmembrane transporter activity (GO:0046715)|hydrogen ion channel activity (GO:0015252)|inorganic anion exchanger activity (GO:0005452)|protein dimerization activity (GO:0046983)|sodium channel activity (GO:0005272)|symporter activity (GO:0015293)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(1)|lung(16)|ovary(2)|prostate(4)|soft_tissue(1)|urinary_tract(1)	40						GCCAGGGGCGCGGTGGTCAGC	0.682																																					p.A463T	NSCLC(190;922 2139 10266 10292 38692)	.											.	SLC4A11-91	0			c.G1387A						.	C	THR/ALA,THR/ALA,THR/ALA	0,4406		0,0,2203	39.0	47.0	44.0		1258,1387,1306	4.2	0.9	20		44	2,8598	2.2+/-6.3	0,2,4298	no	missense,missense,missense	SLC4A11	NM_001174089.1,NM_001174090.1,NM_032034.3	58,58,58	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	probably-damaging,probably-damaging,probably-damaging	420/876,463/919,436/892	3211402	2,13004	2203	4300	6503	SO:0001583	missense	83959	exon11			GGGGCGCGGTGGT	AF336127	CCDS13052.1, CCDS54445.1, CCDS54446.1	20p13	2014-02-14	2007-08-03		ENSG00000088836	ENSG00000088836		"""Solute carriers"""	16438	protein-coding gene	gene with protein product		610206	"""corneal endothelial dystrophy 2 (autosomal recessive)"", ""solute carrier family 4, sodium bicarbonate transporter-like, member 11"", ""corneal dystrophy and perceptive deafness 1"""	CHED2, CDPD1		10843999, 11302728, 16767101	Standard	NM_001174089		Approved	dJ794I6.2, BTR1, NaBC1, FECD4	uc010zqe.2	Q8NBS3	OTTHUMG00000031740	ENST00000380056.3:c.1306G>A	20.37:g.3211402C>T	ENSP00000369396:p.Ala436Thr	Somatic	102	2		WXS	Illumina GAIIx	Phase_I	155	30	NM_001174090	0	0	0	0	0	B4DKC8|B4DKX9|G3V1M3|Q2TB62|Q2TB63|Q9BXF4|Q9NTW9	Missense_Mutation	SNP	ENST00000380056.3	37	CCDS13052.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.108371	0.77096	0.0	2.33E-4	ENSG00000088836	ENST00000380059;ENST00000380056;ENST00000539553	T;T;T	0.78816	-1.21;-1.21;-1.21	5.12	4.17	0.49024	Bicarbonate transporter, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.79516	0.4459	M	0.85373	2.75	0.80722	D	1	P;P;P	0.48016	0.883;0.904;0.904	B;B;B	0.42112	0.258;0.376;0.376	D	0.83901	0.0290	10	0.72032	D	0.01	.	11.9396	0.52892	0.0:0.9141:0.0:0.0859	.	420;463;436	G3V1M3;B4DKC8;Q8NBS3	.;.;S4A11_HUMAN	T	463;436;420	ENSP00000369399:A463T;ENSP00000369396:A436T;ENSP00000441370:A420T	ENSP00000369396:A436T	A	-	1	0	SLC4A11	3159402	1.000000	0.71417	0.895000	0.35142	0.986000	0.74619	4.612000	0.61169	2.384000	0.81235	0.563000	0.77884	GCG	.		0.682	SLC4A11-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000077728.1		
FAM182B	728882	ucsc.edu	37	20	25755562	25755562	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr20:25755562A>C	ENST00000376403.1	-	3	772	c.394T>G	c.(394-396)Tgg>Ggg	p.W132G	FAM182B_ENST00000478164.1_Intron|FAM182B_ENST00000376404.2_Intron			Q5T319	F182B_HUMAN	family with sequence similarity 182, member B	132										lung(1)	1						TCCTGGGACCACTCCGGCCCC	0.716																																					.		.											.	.	0			.						.																																			SO:0001583	missense	728882	.			GGGACCACTCCGG			20p11.1	2010-07-14			ENSG00000175170	ENSG00000175170			34503	pseudogene	pseudogene							Standard	NR_027061		Approved			Q5T319	OTTHUMG00000032136	ENST00000376403.1:c.394T>G	20.37:g.25755562A>C	ENSP00000365585:p.Trp132Gly	Somatic	27	0		WXS	Illumina GAIIx	Phase_I	101	16	.	0	0	0	0	0	Q4G0Q1	RNA	SNP	ENST00000376403.1	37		.	.	.	.	.	.	.	.	.	.	.	0.433	-0.902472	0.02453	.	.	ENSG00000175170	ENST00000376403	.	.	.	.	.	.	.	.	.	.	.	T	0.39036	0.1063	.	.	.	0.09310	N	0.999997	.	.	.	.	.	.	T	0.39210	-0.9625	3	0.87932	D	0	.	.	.	.	.	.	.	.	G	132	.	ENSP00000365585:W132G	W	-	1	0	FAM182B	25703562	0.019000	0.18553	0.149000	0.22428	0.150000	0.21749	-1.161000	0.03144	0.056000	0.16144	0.055000	0.15244	TGG	.		0.716	FAM182B-003	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000078463.2	NR_026714	
ACTR5	79913	hgsc.bcm.edu	37	20	37377139	37377139	+	Silent	SNP	C	C	T	rs2254105	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr20:37377139C>T	ENST00000243903.4	+	1	55	c.18C>T	c.(16-18)ttC>ttT	p.F6F		NM_024855.3	NP_079131.3	Q9H9F9	ARP5_HUMAN	ARP5 actin-related protein 5 homolog (yeast)	6					DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|UV-damage excision repair (GO:0070914)	cytoplasm (GO:0005737)|Ino80 complex (GO:0031011)|nucleus (GO:0005634)				kidney(2)|large_intestine(2)|liver(1)|lung(5)|skin(2)	12		Myeloproliferative disorder(115;0.00878)				CGAACGTGTTCCCGTTCCGCG	0.756													C|||	1227	0.245008	0.205	0.2334	5008	,	,		10427	0.2679		0.2565	False		,,,				2504	0.272				p.F6F		.											.	ACTR5-90	0			c.C18T						.						3.0	4.0	4.0					20																	37377139		1470	2633	4103	SO:0001819	synonymous_variant	79913	exon1			CGTGTTCCCGTTC	AK022847	CCDS13308.1	20q12	2011-07-06	2001-11-28		ENSG00000101442	ENSG00000101442		"""INO80 complex subunits"""	14671	protein-coding gene	gene with protein product	"""INO80 complex subunit M"""		"""ARP5 (actin-related protein 5, yeast) homolog"""			16230350	Standard	NM_024855		Approved	FLJ12785, Arp5, INO80M	uc002xjd.2	Q9H9F9	OTTHUMG00000032456	ENST00000243903.4:c.18C>T	20.37:g.37377139C>T		Somatic	2	1		WXS	Illumina GAIIx	Phase_I	6	4	NM_024855	0	0	0	0	0	Q86WF7|Q8IUY5|Q8N724|Q9BRN0|Q9BVB7	Silent	SNP	ENST00000243903.4	37	CCDS13308.1																																																																																			C|0.769;T|0.231		0.756	ACTR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079205.2	NM_024855	
SLC9A8	23315	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	48494522	48494523	+	Frame_Shift_Del	DEL	AT	AT	-			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	AT	AT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr20:48494522_48494523delAT	ENST00000361573.2	+	12	1122_1123	c.1080_1081delAT	c.(1078-1083)acatgtfs	p.C361fs	SLC9A8_ENST00000539601.1_Frame_Shift_Del_p.C142fs|SLC9A8_ENST00000541138.1_Frame_Shift_Del_p.C61fs|SLC9A8_ENST00000417961.1_Frame_Shift_Del_p.C377fs			Q9Y2E8	SL9A8_HUMAN	solute carrier family 9, subfamily A (NHE8, cation proton antiporter 8), member 8	361					ion transport (GO:0006811)|regulation of intracellular pH (GO:0051453)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	potassium:proton antiporter activity (GO:0015386)|sodium:proton antiporter activity (GO:0015385)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	30			BRCA - Breast invasive adenocarcinoma(9;3.91e-07)			TTTCAGAAACATGTGTGTTTGC	0.332																																					p.376_377del		.											.	SLC9A8-91	0			c.1128_1129del						.																																			SO:0001589	frameshift_variant	23315	exon12			AGAAACATGTGTG	AB023156	CCDS13421.1, CCDS58774.1	20q13.13	2013-05-22	2012-03-22		ENSG00000197818	ENSG00000197818		"""Solute carriers"""	20728	protein-coding gene	gene with protein product		612730	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 8"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 8"""			12409279	Standard	NM_001260491		Approved	KIAA0939, NHE8	uc002xuv.2	Q9Y2E8	OTTHUMG00000032710	ENST00000361573.2:c.1080_1081delAT	20.37:g.48494522_48494523delAT	ENSP00000354966:p.Cys361fs	Somatic	82	0		WXS	Illumina GAIIx	Phase_I	70	13	NM_001260491	0	0	0	0	0	B4DTQ8|Q2M1U9|Q68CZ8|Q9BX15|Q9Y507	Frame_Shift_Del	DEL	ENST00000361573.2	37	CCDS13421.1																																																																																			.		0.332	SLC9A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106483.3	XM_030524	
POTEH	23784	hgsc.bcm.edu	37	22	16287622	16287622	+	Silent	SNP	A	A	G	rs200785274	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr22:16287622A>G	ENST00000343518.6	-	1	315	c.264T>C	c.(262-264)gaT>gaC	p.D88D		NM_001136213.1	NP_001129685.1	Q6S545	POTEH_HUMAN	POTE ankyrin domain family, member H	88										NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(20)|ovary(1)|skin(7)|urinary_tract(2)	37						TCATAGCAGAATCGTCGTGGT	0.607													A|||	8	0.00159744	0.0023	0.0	5008	,	,		27509	0.001		0.001	False		,,,				2504	0.0031				p.D88D		.											.	POTEH-1	0			c.T264C						.						58.0	68.0	64.0					22																	16287622		1819	3495	5314	SO:0001819	synonymous_variant	23784	exon1			AGCAGAATCGTCG	AY462874	CCDS74808.1	22q11.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000198062	ENSG00000198062		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	133	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 7"""	608913	"""actin, beta-like 1"", ""ANKRD26-like family C, member 3"""	ACTBL1, A26C3		10591208, 15276201, 21439273	Standard	NM_001136213		Approved	POTE22, CT104.7	uc010gqp.2	Q6S545	OTTHUMG00000140314	ENST00000343518.6:c.264T>C	22.37:g.16287622A>G		Somatic	24	2		WXS	Illumina GAIIx	Phase_I	42	14	NM_001136213	0	0	0	0	0	A2CEK4|A6NCI1|A9Z1W0	Silent	SNP	ENST00000343518.6	37	CCDS46658.1																																																																																			A|0.957;G|0.044		0.607	POTEH-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276918.4	NM_001136213	
MICAL3	57553	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	18293575	18293575	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr22:18293575C>T	ENST00000441493.2	-	28	5802	c.5450G>A	c.(5449-5451)aGa>aAa	p.R1817K	XXbac-B461K10.4_ENST00000476405.1_RNA|MICAL3_ENST00000580469.1_5'UTR	NM_015241.2	NP_056056.2	Q7RTP6	MICA3_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 3	1817					actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|exocytosis (GO:0006887)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4		all_epithelial(15;0.198)		Lung(27;0.0427)		CGTGTAGGTTCTTGGCTGGAG	0.612																																					p.R1817K		.											.	MICAL3-68	0			c.G5450A						.						70.0	72.0	71.0					22																	18293575		2163	4274	6437	SO:0001583	missense	57553	exon28			TAGGTTCTTGGCT	AB037785	CCDS46659.1, CCDS46660.1, CCDS46661.1	22q11.21	2013-03-26	2013-03-26		ENSG00000243156	ENSG00000243156			24694	protein-coding gene	gene with protein product		608882				12110185	Standard	NM_015241		Approved	KIAA0819	uc002zng.4	Q7RTP6	OTTHUMG00000150067	ENST00000441493.2:c.5450G>A	22.37:g.18293575C>T	ENSP00000416015:p.Arg1817Lys	Somatic	164	0		WXS	Illumina GAIIx	Phase_I	264	76	NM_015241	0	0	0	0	0	B2RXJ5|E9PEF0|O94909|Q5U4P4|Q6ICK4|Q96DF2|Q9P2I3	Missense_Mutation	SNP	ENST00000441493.2	37	CCDS46659.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.09|16.09	3.024305|3.024305	0.54683|0.54683	.|.	.|.	ENSG00000093100|ENSG00000093100	ENST00000252134|ENST00000441493	.|T	.|0.61742	.|0.08	4.96|4.96	4.96|4.96	0.65561|0.65561	.|.	.|0.229263	.|0.36200	.|N	.|0.002727	T|T	0.38026|0.38026	0.1025|0.1025	N|N	0.14661|0.14661	0.345|0.345	0.80722|0.80722	D|D	1|1	.|B	.|0.12013	.|0.005	.|B	.|0.08055	.|0.003	T|T	0.21075|0.21075	-1.0256|-1.0256	5|9	.|.	.|.	.|.	.|.	12.6462|12.6462	0.56735|0.56735	0.0:0.9204:0.0:0.0796|0.0:0.9204:0.0:0.0796	.|.	.|1817	.|Q7RTP6	.|MICA3_HUMAN	K|K	799|1817	.|ENSP00000416015:R1817K	.|.	E|R	-|-	1|2	0|0	XXbac-B461K10.4|XXbac-B461K10.4	16673575|16673575	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	3.827000|3.827000	0.55745|0.55745	2.293000|2.293000	0.77203|0.77203	0.462000|0.462000	0.41574|0.41574	GAA|AGA	.		0.612	MICAL3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447351.1		
MICAL3	57553	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	18304242	18304242	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr22:18304242G>A	ENST00000441493.2	-	25	3834	c.3482C>T	c.(3481-3483)cCc>cTc	p.P1161L		NM_015241.2	NP_056056.2	Q7RTP6	MICA3_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 3	1161	Pro-rich.				actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|exocytosis (GO:0006887)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4		all_epithelial(15;0.198)		Lung(27;0.0427)		TGATTCCTGGGGAGACCGGAT	0.572																																					p.P1161L		.											.	MICAL3-68	0			c.C3482T						.						34.0	36.0	36.0					22																	18304242		1839	4000	5839	SO:0001583	missense	57553	exon25			TCCTGGGGAGACC	AB037785	CCDS46659.1, CCDS46660.1, CCDS46661.1	22q11.21	2013-03-26	2013-03-26		ENSG00000243156	ENSG00000243156			24694	protein-coding gene	gene with protein product		608882				12110185	Standard	NM_015241		Approved	KIAA0819	uc002zng.4	Q7RTP6	OTTHUMG00000150067	ENST00000441493.2:c.3482C>T	22.37:g.18304242G>A	ENSP00000416015:p.Pro1161Leu	Somatic	57	0		WXS	Illumina GAIIx	Phase_I	59	14	NM_015241	0	0	0	2	2	B2RXJ5|E9PEF0|O94909|Q5U4P4|Q6ICK4|Q96DF2|Q9P2I3	Missense_Mutation	SNP	ENST00000441493.2	37	CCDS46659.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	1.960|1.960	-0.439029|-0.439029	0.04636|0.04636	.|.	.|.	ENSG00000093100|ENSG00000093100	ENST00000441493|ENST00000252134	T|.	0.64438|.	-0.1|.	4.43|4.43	3.39|3.39	0.38822|0.38822	.|.	.|.	.|.	.|.	.|.	T|T	0.31888|0.31888	0.0811|0.0811	N|N	0.25144|0.25144	0.715|0.715	0.19775|0.19775	N|N	0.99995|0.99995	B|.	0.06786|.	0.001|.	B|.	0.06405|.	0.002|.	T|T	0.14062|0.14062	-1.0486|-1.0486	9|6	0.52906|0.33141	T|T	0.07|0.24	.|.	8.8595|8.8595	0.35249|0.35249	0.1119:0.0:0.8881:0.0|0.1119:0.0:0.8881:0.0	.|.	1161|.	Q7RTP6|.	MICA3_HUMAN|.	L|S	1161|143	ENSP00000416015:P1161L|.	ENSP00000416015:P1161L|ENSP00000252134:P143S	P|P	-|-	2|1	0|0	XXbac-B461K10.4|XXbac-B461K10.4	16684242|16684242	0.884000|0.884000	0.30299|0.30299	0.020000|0.020000	0.16555|0.16555	0.002000|0.002000	0.02628|0.02628	2.382000|2.382000	0.44345|0.44345	2.180000|2.180000	0.69256|0.69256	0.561000|0.561000	0.74099|0.74099	CCC|CCC	.		0.572	MICAL3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447351.1		
PI4KA	5297	hgsc.bcm.edu;bcgsc.ca	37	22	21150496	21150496	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr22:21150496G>C	ENST00000572273.1	-	18	2271	c.2041C>G	c.(2041-2043)Cag>Gag	p.Q681E	PI4KA_ENST00000255882.6_Missense_Mutation_p.Q739E|PI4KA_ENST00000466162.1_5'Flank			P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase, catalytic, alpha	681					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi-associated vesicle membrane (GO:0030660)|membrane (GO:0016020)|plasma membrane (GO:0005886)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)			breast(3)|endometrium(8)|kidney(9)|large_intestine(19)|lung(29)|ovary(1)|pancreas(1)|prostate(3)|salivary_gland(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	79	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)			AGCCCCAGCTGCACAAACAAC	0.592																																					p.Q739E	GBM(136;1332 1831 3115 23601 50806)	.											.	PI4KA-454	0			c.C2215G						.						94.0	68.0	77.0					22																	21150496		2203	4300	6503	SO:0001583	missense	5297	exon18			CCAGCTGCACAAA	L36151	CCDS33603.1, CCDS33603.2	22q11.21	2011-05-25	2007-08-14	2007-08-02	ENSG00000241973	ENSG00000241973			8983	protein-coding gene	gene with protein product		600286		PIK4CA		7961848, 8662589	Standard	NM_002650		Approved	PI4K-ALPHA, pi4K230	uc002zsz.5	P42356	OTTHUMG00000167440	ENST00000572273.1:c.2041C>G	22.37:g.21150496G>C	ENSP00000458238:p.Gln681Glu	Somatic	212	0		WXS	Illumina GAIIx	Phase_I	187	14	NM_058004	0	0	1	1	0	Q7Z625|Q9UPG2	Missense_Mutation	SNP	ENST00000572273.1	37		.	.	.	.	.	.	.	.	.	.	G	26.4	4.731242	0.89390	.	.	ENSG00000241973	ENST00000255882	T	0.41758	0.99	4.62	4.62	0.57501	.	0.000000	0.85682	D	0.000000	T	0.61862	0.2381	M	0.64567	1.98	0.80722	D	1	D	0.71674	0.998	D	0.68353	0.957	T	0.65788	-0.6083	10	0.66056	D	0.02	-22.058	17.6482	0.88154	0.0:0.0:1.0:0.0	.	681	P42356	PI4KA_HUMAN	E	681	ENSP00000255882:Q681E	ENSP00000255882:Q681E	Q	-	1	0	PI4KA	19480496	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	9.586000	0.98226	2.402000	0.81655	0.591000	0.81541	CAG	.		0.592	PI4KA-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_058004	
PIWIL3	440822	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	25115501	25115501	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr22:25115501C>T	ENST00000332271.5	-	21	3003	c.2587G>A	c.(2587-2589)Gtg>Atg	p.V863M	PIWIL3_ENST00000532537.2_5'UTR|PIWIL3_ENST00000533313.1_Missense_Mutation_p.V745M|PIWIL3_ENST00000527701.1_Missense_Mutation_p.V745M	NM_001008496.3|NM_001255975.1	NP_001008496.2|NP_001242904.1	Q7Z3Z3	PIWL3_HUMAN	piwi-like RNA-mediated gene silencing 3	863	Piwi. {ECO:0000255|PROSITE- ProRule:PRU00150}.				cell differentiation (GO:0030154)|gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)	RNA binding (GO:0003723)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(14)|lung(15)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	50						GACTGCCCCACGAGGTAAGCC	0.453																																					p.V863M		.											.	PIWIL3-93	0			c.G2587A						.						126.0	114.0	118.0					22																	25115501		2203	4300	6503	SO:0001583	missense	440822	exon21			GCCCCACGAGGTA	AB079368	CCDS33623.1	22q11.23	2013-02-15	2013-02-15		ENSG00000184571	ENSG00000184571		"""Argonaute/PIWI family"""	18443	protein-coding gene	gene with protein product		610314	"""piwi-like 3 (Drosophila)"""			12906857	Standard	NM_001008496		Approved	HIWI3	uc003abd.2	Q7Z3Z3	OTTHUMG00000150788	ENST00000332271.5:c.2587G>A	22.37:g.25115501C>T	ENSP00000330031:p.Val863Met	Somatic	223	0		WXS	Illumina GAIIx	Phase_I	272	90	NM_001008496	0	0	0	0	0		Missense_Mutation	SNP	ENST00000332271.5	37	CCDS33623.1	.	.	.	.	.	.	.	.	.	.	C	15.25	2.779077	0.49891	.	.	ENSG00000184571	ENST00000332271;ENST00000533313;ENST00000527701	T;T;T	0.32753	1.44;1.44;1.44	3.14	3.14	0.36123	Stem cell self-renewal protein Piwi (3);Ribonuclease H-like (1);	0.000000	0.64402	D	0.000004	T	0.59155	0.2173	M	0.88570	2.965	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.993;0.999	T	0.68469	-0.5400	10	0.87932	D	0	-10.2155	12.5371	0.56147	0.0:1.0:0.0:0.0	.	745;854;863	E9PIP6;B4DYF7;Q7Z3Z3	.;.;PIWL3_HUMAN	M	863;745;745	ENSP00000330031:V863M;ENSP00000431843:V745M;ENSP00000435718:V745M	ENSP00000330031:V863M	V	-	1	0	PIWIL3	23445501	1.000000	0.71417	0.809000	0.32408	0.022000	0.10575	6.136000	0.71703	2.082000	0.62665	0.555000	0.69702	GTG	.		0.453	PIWIL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320084.2	NM_001008496	
NEFH	4744	ucsc.edu	37	22	29885564	29885564	+	Silent	SNP	A	A	G	rs202065964|rs371230849		TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr22:29885564A>G	ENST00000310624.6	+	4	1968	c.1935A>G	c.(1933-1935)gaA>gaG	p.E645E		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	645	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						CGAAGGAGGAAGCAAAGTCCC	0.562																																					p.E645E		.											.	NEFH-90	0			c.A1935G						.						83.0	89.0	87.0					22																	29885564		2203	4300	6503	SO:0001819	synonymous_variant	4744	exon4			GGAGGAAGCAAAG		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1935A>G	22.37:g.29885564A>G		Somatic	142	0		WXS	Illumina GAIIx	Phase_I	54	13	NM_021076	0	0	3	3	0	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Silent	SNP	ENST00000310624.6	37	CCDS13858.1																																																																																			.		0.562	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
NEFH	4744	hgsc.bcm.edu	37	22	29885594	29885594	+	Silent	SNP	A	A	T	rs79235463|rs200984527|rs267607533	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr22:29885594A>T	ENST00000310624.6	+	4	1998	c.1965A>T	c.(1963-1965)ccA>ccT	p.P655P		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	661	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						CCAAGTCCCCAGAGAAGGAAG	0.552																																					p.P655P		.											.	NEFH-90	0			c.A1965T						.						83.0	92.0	89.0					22																	29885594		2203	4300	6503	SO:0001819	synonymous_variant	4744	exon4			GTCCCCAGAGAAG		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1965A>T	22.37:g.29885594A>T		Somatic	247	0		WXS	Illumina GAIIx	Phase_I	96	13	NM_021076	0	0	5	5	0	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Silent	SNP	ENST00000310624.6	37	CCDS13858.1																																																																																			A|0.500;T|0.500		0.552	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
NEFH	4744	bcgsc.ca	37	22	29885670	29885693	+	In_Frame_Del	DEL	AAGTCCCCAGTGAAGGCAGAAGCA	AAGTCCCCAGTGAAGGCAGAAGCA	-	rs200302220|rs113936045		TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	AAGTCCCCAGTGAAGGCAGAAGCA	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr22:29885670_29885693delAAGTCCCCAGTGAAGGCAGAAGCA	ENST00000310624.6	+	4	2074_2097	c.2041_2064delAAGTCCCCAGTGAAGGCAGAAGCA	c.(2041-2064)aagtccccagtgaaggcagaagcadel	p.KSPVKAEA681del		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	687	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.A686E(1)		cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						TGAGAAGGCCAAGTCCCCAGTGAAGGCAGAAGCAAAGTCCCCTG	0.571																																					p.681_688del		.											.	NEFH-90	1	Substitution - Missense(1)	endometrium(1)	c.2041_2064del						.																																			SO:0001651	inframe_deletion	4744	exon4			AAGGCCAAGTCCC		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.2041_2064delAAGTCCCCAGTGAAGGCAGAAGCA	22.37:g.29885670_29885693delAAGTCCCCAGTGAAGGCAGAAGCA	ENSP00000311997:p.Lys681_Ala688del	Somatic	463	0		WXS	Illumina GAIIx	Phase_I	252	21	NM_021076	0	0	0	0	0	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	In_Frame_Del	DEL	ENST00000310624.6	37	CCDS13858.1																																																																																			.		0.571	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
NEFH	4744	bcgsc.ca	37	22	29885722	29885722	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr22:29885722T>A	ENST00000310624.6	+	4	2126	c.2093T>A	c.(2092-2094)gTg>gAg	p.V698E		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	704	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						AAGTCCCCAGTGAAGGAAGAA	0.552																																					p.V698E		.											.	NEFH-90	0			c.T2093A						.						66.0	70.0	68.0					22																	29885722		2193	4274	6467	SO:0001583	missense	4744	exon4			CCCCAGTGAAGGA		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.2093T>A	22.37:g.29885722T>A	ENSP00000311997:p.Val698Glu	Somatic	532	1		WXS	Illumina GAIIx	Phase_I	205	16	NM_021076	0	0	35	35	0	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Missense_Mutation	SNP	ENST00000310624.6	37	CCDS13858.1	.	.	.	.	.	.	.	.	.	.	T	6.362	0.434952	0.12045	.	.	ENSG00000100285	ENST00000328842;ENST00000310624	D	0.82711	-1.64	4.37	-2.71	0.05986	.	0.514922	0.16469	N	0.213074	T	0.76983	0.4064	L	0.46614	1.455	0.09310	N	1	P	0.39282	0.666	P	0.44394	0.448	T	0.69815	-0.5043	10	0.87932	D	0	.	6.5863	0.22622	0.639:0.1533:0.0:0.2077	.	704	P12036	NFH_HUMAN	E	698	ENSP00000311997:V698E	ENSP00000311997:V698E	V	+	2	0	NEFH	28215722	0.000000	0.05858	0.056000	0.19401	0.172000	0.22775	-0.695000	0.05109	-0.993000	0.03467	-0.472000	0.04984	GTG	.		0.552	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
NEFH	4744	bcgsc.ca	37	22	29885732	29885732	+	Silent	SNP	A	A	G			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr22:29885732A>G	ENST00000310624.6	+	4	2136	c.2103A>G	c.(2101-2103)gaA>gaG	p.E701E		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	707	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						TGAAGGAAGAAGCAAAGTCCC	0.562																																					p.E701E		.											.	NEFH-90	0			c.A2103G						.						67.0	72.0	70.0					22																	29885732		2160	4233	6393	SO:0001819	synonymous_variant	4744	exon4			GGAAGAAGCAAAG		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.2103A>G	22.37:g.29885732A>G		Somatic	531	1		WXS	Illumina GAIIx	Phase_I	197	12	NM_021076	0	0	10	10	0	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Silent	SNP	ENST00000310624.6	37	CCDS13858.1																																																																																			.		0.562	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
NEFH	4744	bcgsc.ca	37	22	29885735	29885735	+	Silent	SNP	A	A	C			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr22:29885735A>C	ENST00000310624.6	+	4	2139	c.2106A>C	c.(2104-2106)gcA>gcC	p.A702A		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	708	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						AGGAAGAAGCAAAGTCCCCTG	0.557																																					p.A702A		.											.	NEFH-90	0			c.A2106C						.						66.0	70.0	69.0					22																	29885735		2119	4173	6292	SO:0001819	synonymous_variant	4744	exon4			AGAAGCAAAGTCC		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.2106A>C	22.37:g.29885735A>C		Somatic	528	2		WXS	Illumina GAIIx	Phase_I	194	15	NM_021076	0	0	10	10	0	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Silent	SNP	ENST00000310624.6	37	CCDS13858.1																																																																																			.		0.557	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
TRIOBP	11078	hgsc.bcm.edu	37	22	38122462	38122462	+	Missense_Mutation	SNP	A	A	G	rs739138	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr22:38122462A>G	ENST00000406386.3	+	7	4154	c.3899A>G	c.(3898-3900)cAc>cGc	p.H1300R		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	1300			H -> R (in dbSNP:rs739138).		actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					GGCCGCACCCACAGCCCTGGC	0.741													G|||	3010	0.601038	0.1944	0.5836	5008	,	,		13399	0.8859		0.7157	False		,,,				2504	0.7515				p.H1300R		.											.	TRIOBP-136	0			c.A3899G						.	G	ARG/HIS	1221,2235		265,691,772	4.0	6.0	5.0		3899	3.9	1.0	22	dbSNP_86	5	5694,1808		2238,1218,295	yes	missense	TRIOBP	NM_001039141.2	29	2503,1909,1067	GG,GA,AA		24.1002,35.3299,36.8954	benign	1300/2366	38122462	6915,4043	1728	3751	5479	SO:0001583	missense	11078	exon7			GCACCCACAGCCC	AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.3899A>G	22.37:g.38122462A>G	ENSP00000384312:p.His1300Arg	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_001039141	0	0	0	0	0	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Missense_Mutation	SNP	ENST00000406386.3	37	CCDS43015.1	1409	0.6451465201465202	110	0.22357723577235772	222	0.6132596685082873	531	0.9283216783216783	546	0.7203166226912929	G	12.86	2.065195	0.36470	0.353299	0.758998	ENSG00000100106	ENST00000406386;ENST00000417174	T	0.11063	2.81	4.93	3.9	0.45041	.	.	.	.	.	T	0.00012	0.0000	N	0.01576	-0.805	0.09310	P	0.999999999370294	B	0.02656	0.0	B	0.01281	0.0	T	0.29671	-1.0004	8	0.02654	T	1	.	4.383	0.11304	0.2555:0.0:0.5874:0.1571	rs739138	1300	Q9H2D6	TARA_HUMAN	R	1300	ENSP00000384312:H1300R	ENSP00000384312:H1300R	H	+	2	0	TRIOBP	36452408	1.000000	0.71417	1.000000	0.80357	0.841000	0.47740	1.338000	0.33873	0.503000	0.28060	-0.366000	0.07423	CAC	A|0.354;G|0.646		0.741	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319439.2		
ODF3B	440836	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	50969456	50969456	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr22:50969456C>G	ENST00000428989.2	-	4	449	c.450G>C	c.(448-450)ttG>ttC	p.L150F	TYMP_ENST00000252029.3_5'Flank|TYMP_ENST00000395681.1_5'Flank|ODF3B_ENST00000329363.4_Missense_Mutation_p.L150F|ODF3B_ENST00000401779.1_Missense_Mutation_p.G127R|ODF3B_ENST00000403326.1_Missense_Mutation_p.L82F|TYMP_ENST00000395678.3_5'Flank|TYMP_ENST00000395680.1_5'Flank|ODF3B_ENST00000405135.1_Missense_Mutation_p.G166R			A8MYP8	ODF3B_HUMAN	outer dense fiber of sperm tails 3B	150										lung(2)	2						CGCGCGGACCCAAGAGCGAGG	0.692																																					p.L150F		.											.	ODF3B-68	0			c.G450C						.						13.0	16.0	15.0					22																	50969456		1915	4114	6029	SO:0001583	missense	440836	exon5			CGGACCCAAGAGC		CCDS43039.1	22q13.33	2008-10-24			ENSG00000177989	ENSG00000177989			34388	protein-coding gene	gene with protein product							Standard	NM_001014440		Approved		uc003bmh.2	A8MYP8	OTTHUMG00000150334	ENST00000428989.2:c.450G>C	22.37:g.50969456C>G	ENSP00000390712:p.Leu150Phe	Somatic	127	0		WXS	Illumina GAIIx	Phase_I	169	65	NM_001014440	0	0	3	4	1	A0PK18	Missense_Mutation	SNP	ENST00000428989.2	37	CCDS43039.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.95|10.95	1.496312|1.496312	0.26861|0.26861	.|.	.|.	ENSG00000177989|ENSG00000177989	ENST00000401779;ENST00000405135|ENST00000329363;ENST00000403326;ENST00000428989	T|T;T;T	0.49432|0.36878	0.78|1.23;1.28;1.23	4.69|4.69	2.42|2.42	0.29668|0.29668	.|.	.|.	.|.	.|.	.|.	T|T	0.27278|0.27278	0.0669|0.0669	L|L	0.45228|0.45228	1.405|1.405	0.30747|0.30747	N|N	0.745495|0.745495	P|B	0.35107|0.20052	0.484|0.041	B|B	0.33254|0.23419	0.16|0.046	T|T	0.22941|0.22941	-1.0202|-1.0202	9|9	0.87932|0.20046	D|T	0|0.44	-0.6009|-0.6009	6.9831|6.9831	0.24713|0.24713	0.1868:0.6058:0.2075:0.0|0.1868:0.6058:0.2075:0.0	.|.	127|150	B5MD02|A8MYP8	.|ODF3B_HUMAN	R|F	127;166|150;82;150	ENSP00000384012:G166R|ENSP00000382804:L150F;ENSP00000385123:L82F;ENSP00000390712:L150F	ENSP00000384310:G127R|ENSP00000382804:L150F	G|L	-|-	1|3	0|2	ODF3B|ODF3B	49316322|49316322	0.983000|0.983000	0.35010|0.35010	0.883000|0.883000	0.34634|0.34634	0.209000|0.209000	0.24338|0.24338	0.416000|0.416000	0.21198|0.21198	1.159000|1.159000	0.42565|0.42565	0.462000|0.462000	0.41574|0.41574	GGG|TTG	.		0.692	ODF3B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317626.2		
ATP2B2	491	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	10491213	10491213	+	Silent	SNP	G	G	C			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr3:10491213G>C	ENST00000352432.4	-	1	84	c.15C>G	c.(13-15)acC>acG	p.T5T	ATP2B2_ENST00000343816.4_Silent_p.T5T|ATP2B2_ENST00000397077.1_Silent_p.T5T|ATP2B2_ENST00000383800.4_Silent_p.T5T|ATP2B2_ENST00000360273.2_Silent_p.T5T			Q01814	AT2B2_HUMAN	ATPase, Ca++ transporting, plasma membrane 2	5					auditory receptor cell stereocilium organization (GO:0060088)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cerebellar granule cell differentiation (GO:0021707)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|cochlea development (GO:0090102)|cytosolic calcium ion homeostasis (GO:0051480)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotion (GO:0040011)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|organelle organization (GO:0006996)|otolith mineralization (GO:0045299)|positive regulation of calcium ion transport (GO:0051928)|regulation of cell size (GO:0008361)|regulation of synaptic plasticity (GO:0048167)|sensory perception of sound (GO:0007605)|serotonin metabolic process (GO:0042428)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cilium (GO:0005929)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-dependent ATPase activity (GO:0030899)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|large_intestine(19)|lung(29)|ovary(5)|prostate(2)|skin(4)|stomach(2)|urinary_tract(2)	74						AGTCGCTGTTGGTCATGTCAC	0.602																																					p.T5T	Ovarian(125;1619 1709 15675 19819 38835)	.											.	ATP2B2-95	0			c.C15G						.						136.0	118.0	124.0					3																	10491213		2203	4300	6503	SO:0001819	synonymous_variant	491	exon2			GCTGTTGGTCATG	X63575	CCDS2601.1, CCDS33701.1	3p25.3	2010-04-20	2001-12-04		ENSG00000157087	ENSG00000157087	3.6.3.8	"""ATPases / P-type"""	815	protein-coding gene	gene with protein product	"""plasma membrane Ca2+ pump 2"", ""plasma membrane calcium-transporting ATPase 2"""	108733				1313367	Standard	NM_001001331		Approved	PMCA2	uc003bvt.3	Q01814	OTTHUMG00000128679	ENST00000352432.4:c.15C>G	3.37:g.10491213G>C		Somatic	129	0		WXS	Illumina GAIIx	Phase_I	146	45	NM_001683	0	0	0	0	0	O00766|Q12994|Q16818	Silent	SNP	ENST00000352432.4	37	CCDS33701.1																																																																																			.		0.602	ATP2B2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250576.2	NM_001683	
GOLGA4	2803	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	37388682	37388682	+	Splice_Site	SNP	A	A	T			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr3:37388682A>T	ENST00000361924.2	+	21	6846		c.e21-1		GOLGA4_ENST00000444882.1_Intron|GOLGA4_ENST00000356847.4_Splice_Site	NM_002078.4	NP_002069.2	Q13439	GOGA4_HUMAN	golgin A4						Golgi to plasma membrane protein transport (GO:0043001)|protein targeting to Golgi (GO:0000042)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	GTPase binding (GO:0051020)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(6)|kidney(2)|large_intestine(17)|liver(2)|lung(16)|ovary(4)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						TTTATTTGGCAGGTGGCAATT	0.338																																					.		.											.	GOLGA4-93	0			c.6518-2A>T						.						128.0	128.0	128.0					3																	37388682		2203	4300	6503	SO:0001630	splice_region_variant	2803	exon21			TTTGGCAGGTGGC	U31906	CCDS2666.1, CCDS54564.1	3p22-p21.3	2010-02-12	2010-02-12		ENSG00000144674	ENSG00000144674			4427	protein-coding gene	gene with protein product	"""golgin 245"""	602509	"""golgi autoantigen, golgin subfamily a, 4"""			8626529	Standard	NM_002078		Approved	GOLG, GCP2, p230, golgin-240	uc003cgw.3	Q13439	OTTHUMG00000130799	ENST00000361924.2:c.6473-1A>T	3.37:g.37388682A>T		Somatic	61	0		WXS	Illumina GAIIx	Phase_I	65	13	NM_001172713	0	0	0	0	0	F8W8Q7|Q13270|Q13654|Q14436|Q59EW8	Splice_Site	SNP	ENST00000361924.2	37	CCDS2666.1	.	.	.	.	.	.	.	.	.	.	A	17.69	3.451921	0.63290	.	.	ENSG00000144674	ENST00000361924;ENST00000356847;ENST00000437131	.	.	.	5.42	5.42	0.78866	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.4464	0.67352	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GOLGA4	37363686	1.000000	0.71417	1.000000	0.80357	0.657000	0.38888	5.853000	0.69496	2.055000	0.61198	0.454000	0.30748	.	.		0.338	GOLGA4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253339.2	NM_002078	Intron
VILL	50853	broad.mit.edu	37	3	38040537	38040537	+	Silent	SNP	G	G	A	rs199499422	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr3:38040537G>A	ENST00000283713.6	+	10	1343	c.1077G>A	c.(1075-1077)ggG>ggA	p.G359G	VILL_ENST00000465644.1_Silent_p.G77G|VILL_ENST00000383759.2_Silent_p.G359G			O15195	VILL_HUMAN	villin-like	359					actin filament capping (GO:0051693)|cytoskeleton organization (GO:0007010)	actin cytoskeleton (GO:0015629)	structural constituent of cytoskeleton (GO:0005200)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(3)|stomach(3)|urinary_tract(2)	28				KIRC - Kidney renal clear cell carcinoma(284;0.0525)|Kidney(284;0.0661)		AGCTCGGCGGGAGGGGTGAGC	0.726													G|||	37	0.00738818	0.0015	0.0043	5008	,	,		3947	0.0		0.0159	False		,,,				2504	0.0164				p.G359G		.											.	VILL-90	0			c.G1077A						.	G		8,4126		0,8,2059	7.0	8.0	8.0		1077	-1.2	0.0	3		8	128,7976		0,128,3924	no	coding-synonymous	VILL	NM_015873.3		0,136,5983	AA,AG,GG		1.5795,0.1935,1.1113		359/857	38040537	136,12102	2067	4052	6119	SO:0001819	synonymous_variant	50853	exon9			CGGCGGGAGGGGT		CCDS2670.2	3p21	2004-07-28			ENSG00000136059	ENSG00000136059			30906	protein-coding gene	gene with protein product						9179494	Standard	XM_005265191		Approved		uc003chl.3	O15195	OTTHUMG00000130814	ENST00000283713.6:c.1077G>A	3.37:g.38040537G>A		Somatic	28	0		WXS	Illumina GAIIx	Phase_I	36	14	NM_015873	0	0	0	0	0	A8MZP1|Q9BT80|Q9BWH7	Silent	SNP	ENST00000283713.6	37	CCDS2670.2																																																																																			G|0.995;A|0.005		0.726	VILL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253360.3	NM_015873	
CCR3	1232	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	46307366	46307366	+	Silent	SNP	G	G	C			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr3:46307366G>C	ENST00000357422.2	+	4	1260	c.717G>C	c.(715-717)cgG>cgC	p.R239R	CCR3_ENST00000541018.1_Silent_p.R239R|CCR3_ENST00000395942.2_Silent_p.R239R|CCR3_ENST00000395940.2_Silent_p.R239R|CCR3_ENST00000545097.1_Silent_p.R260R			P51677	CCR3_HUMAN	chemokine (C-C motif) receptor 3	239					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cell adhesion (GO:0007155)|cellular defense response (GO:0006968)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|inflammatory response (GO:0006954)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of endothelial cell proliferation (GO:0001938)|viral process (GO:0016032)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|chemokine receptor activity (GO:0004950)	p.R239R(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|ovary(3)|urinary_tract(1)	18				BRCA - Breast invasive adenocarcinoma(193;0.00119)|KIRC - Kidney renal clear cell carcinoma(197;0.0183)|Kidney(197;0.0216)		AGGCCATCCGGCTCATTTTTG	0.448																																					p.R260R		.											.	CCR3-660	1	Substitution - coding silent(1)	large_intestine(1)	c.G780C						.						75.0	74.0	74.0					3																	46307366		2203	4300	6503	SO:0001819	synonymous_variant	1232	exon3			CATCCGGCTCATT	AF247361	CCDS2738.1, CCDS54574.1	3p21.3	2012-08-08			ENSG00000183625	ENSG00000183625		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1604	protein-coding gene	gene with protein product		601268		CMKBR3			Standard	NM_178328		Approved	CC-CKR-3, CKR3, CD193	uc003cpk.2	P51677	OTTHUMG00000133484	ENST00000357422.2:c.717G>C	3.37:g.46307366G>C		Somatic	63	0		WXS	Illumina GAIIx	Phase_I	64	14	NM_178328	0	0	0	0	0	B3KVQ1|F5GWL6|Q15748|Q2YDB9|Q86WD2|Q8TDP6|Q9ULY8	Silent	SNP	ENST00000357422.2	37	CCDS2738.1																																																																																			.		0.448	CCR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257380.2		
FLNB	2317	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	58128391	58128391	+	Silent	SNP	C	C	G			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr3:58128391C>G	ENST00000295956.4	+	31	5361	c.5196C>G	c.(5194-5196)gcC>gcG	p.A1732A	FLNB_ENST00000358537.3_Silent_p.A1708A|FLNB_ENST00000419752.2_Silent_p.A1552A|FLNB_ENST00000348383.5_Silent_p.A1732A|FLNB_ENST00000357272.4_Silent_p.A1732A|FLNB_ENST00000493452.1_Silent_p.A1539A|FLNB_ENST00000429972.2_Silent_p.A1721A|FLNB_ENST00000490882.1_Silent_p.A1763A	NM_001457.3	NP_001448.2	O75369	FLNB_HUMAN	filamin B, beta	1732					actin cytoskeleton organization (GO:0030036)|cell differentiation (GO:0030154)|cytokine-mediated signaling pathway (GO:0019221)|cytoskeletal anchoring at plasma membrane (GO:0007016)|signal transduction (GO:0007165)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	actin binding (GO:0003779)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)	p.A1732A(1)|p.A1763A(1)		NS(1)|breast(13)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(23)|liver(2)|lung(38)|ovary(6)|prostate(3)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(5)	120				BRCA - Breast invasive adenocarcinoma(55;0.000335)|KIRC - Kidney renal clear cell carcinoma(284;0.0726)|Kidney(284;0.0898)		CCGAAGAGGCCTATGTCCCAG	0.512																																					p.A1763A		.											.	FLNB-593	2	Substitution - coding silent(2)	kidney(2)	c.C5289G						.						134.0	116.0	122.0					3																	58128391		2203	4300	6503	SO:0001819	synonymous_variant	2317	exon32			AGAGGCCTATGTC	AF043045	CCDS2885.1, CCDS54599.1, CCDS54600.1, CCDS54601.1	3p14.3	2011-02-11	2009-07-23		ENSG00000136068	ENSG00000136068			3755	protein-coding gene	gene with protein product	"""actin binding protein 278"""	603381	"""filamin B, beta (actin binding protein 278)"", ""Larsen syndrome 1 (autosomal dominant)"""	FLN1L, LRS1		8327473, 10449914, 14991055, 16801345	Standard	NM_001457		Approved	TAP, TABP, ABP-278, FH1	uc010hne.2	O75369	OTTHUMG00000159158	ENST00000295956.4:c.5196C>G	3.37:g.58128391C>G		Somatic	105	1		WXS	Illumina GAIIx	Phase_I	180	37	NM_001164317	0	0	3	5	2	B2ZZ83|B2ZZ84|B2ZZ85|C9JKE6|C9JMC4|Q13706|Q59EC2|Q60FE7|Q6MZJ1|Q8WXS9|Q8WXT0|Q8WXT1|Q8WXT2|Q8WXT3|Q9NRB5|Q9NT26|Q9UEV9	Silent	SNP	ENST00000295956.4	37	CCDS2885.1																																																																																			.		0.512	FLNB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000353569.1	NM_001457	
PROK2	60675	hgsc.bcm.edu	37	3	71834120	71834120	+	Silent	SNP	G	G	C	rs372623686	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr3:71834120G>C	ENST00000295619.3	-	1	92	c.84C>G	c.(82-84)gcC>gcG	p.A28A	PROK2_ENST00000353065.3_Silent_p.A28A	NM_001126128.1	NP_001119600.1	Q9HC23	PROK2_HUMAN	prokineticin 2	28					activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|cell proliferation (GO:0008283)|chemotaxis (GO:0006935)|circadian rhythm (GO:0007623)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|negative regulation of apoptotic process (GO:0043066)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of smooth muscle contraction (GO:0045987)|sensory perception of pain (GO:0019233)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)	G-protein coupled receptor binding (GO:0001664)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	6		Prostate(10;0.00899)		BRCA - Breast invasive adenocarcinoma(55;1.89e-05)|Epithelial(33;0.000173)|LUSC - Lung squamous cell carcinoma(21;0.00168)|Lung(16;0.00306)		CGGTGATCACGGCGGCGTCCC	0.736													G|||	2	0.000399361	0.0	0.0014	5008	,	,		9049	0.0		0.0	False		,,,				2504	0.001				p.A28A		.											.	PROK2-90	0			c.C84G						.	G	,	0,3078		0,0,1539	3.0	4.0	4.0		84,84	-1.8	1.0	3		4	7,6135		0,7,3064	no	coding-synonymous,coding-synonymous	PROK2	NM_001126128.1,NM_021935.3	,	0,7,4603	CC,CG,GG		0.114,0.0,0.0759	,	28/130,28/109	71834120	7,9213	1539	3071	4610	SO:0001819	synonymous_variant	60675	exon1			GATCACGGCGGCG	AF333025	CCDS2916.1, CCDS46868.1	3p21.1	2013-02-28			ENSG00000163421	ENSG00000163421		"""Endogenous ligands"""	18455	protein-coding gene	gene with protein product	"""protein Bv8 homolog"""	607002				11054548, 11259612	Standard	NM_021935		Approved	PK2, BV8, MIT1, KAL4	uc003dpa.4	Q9HC23	OTTHUMG00000158809	ENST00000295619.3:c.84C>G	3.37:g.71834120G>C		Somatic	2	1		WXS	Illumina GAIIx	Phase_I	9	4	NM_001126128	0	0	0	0	0	Q53Z79|Q6ISR0	Silent	SNP	ENST00000295619.3	37	CCDS46868.1																																																																																			.		0.736	PROK2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000352302.1	NM_001126128	
CLSTN2	64084	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	140277631	140277631	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr3:140277631T>C	ENST00000458420.3	+	12	2163	c.1973T>C	c.(1972-1974)cTc>cCc	p.L658P		NM_022131.2	NP_071414.2	Q9H4D0	CSTN2_HUMAN	calsyntenin 2	658					homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|liver(1)|lung(42)|pancreas(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	87						GGAGTGACCCTCTTCCCTGAT	0.587										HNSCC(16;0.037)																											p.L658P	GBM(45;858 913 3709 36904 37282)	.											.	CLSTN2-157	0			c.T1973C						.						61.0	60.0	60.0					3																	140277631		2203	4300	6503	SO:0001583	missense	64084	exon12			TGACCCTCTTCCC	AJ278018	CCDS3112.1	3q23	2011-07-01			ENSG00000158258	ENSG00000158258		"""Cadherins / Cadherin-related"""	17448	protein-coding gene	gene with protein product	"""cadherin-related family member 13"""	611323				12498782	Standard	NM_022131		Approved	CSTN2, CS2, FLJ39113, CDHR13	uc003etn.3	Q9H4D0	OTTHUMG00000160139	ENST00000458420.3:c.1973T>C	3.37:g.140277631T>C	ENSP00000402460:p.Leu658Pro	Somatic	89	1		WXS	Illumina GAIIx	Phase_I	112	30	NM_022131	0	0	1	1	0	B2RCW5|D3DNF4|Q3SX54|Q3ZB76|Q5UE56|Q96HZ2|Q9BSS0	Missense_Mutation	SNP	ENST00000458420.3	37	CCDS3112.1	.	.	.	.	.	.	.	.	.	.	T	11.10	1.539442	0.27475	.	.	ENSG00000158258	ENST00000458420	T	0.37235	1.21	5.41	5.41	0.78517	.	0.122857	0.56097	D	0.000035	T	0.32675	0.0837	L	0.52364	1.645	0.80722	D	1	B	0.25521	0.128	B	0.23275	0.045	T	0.08289	-1.0729	9	.	.	.	-14.8958	13.4138	0.60958	0.0:0.0:0.0:1.0	.	658	Q9H4D0	CSTN2_HUMAN	P	658	ENSP00000402460:L658P	.	L	+	2	0	CLSTN2	141760321	1.000000	0.71417	0.994000	0.49952	0.365000	0.29674	5.097000	0.64542	2.059000	0.61396	0.528000	0.53228	CTC	.		0.587	CLSTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359393.3	NM_022131	
TSC22D2	9819	hgsc.bcm.edu	37	3	150128392	150128392	+	Missense_Mutation	SNP	G	G	A	rs879634	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr3:150128392G>A	ENST00000361875.3	+	1	2271	c.1255G>A	c.(1255-1257)Gct>Act	p.A419T	TSC22D2_ENST00000361136.2_Missense_Mutation_p.A419T	NM_014779.2	NP_055594.1	O75157	T22D2_HUMAN	TSC22 domain family, member 2	419			A -> T (in dbSNP:rs879634).		response to osmotic stress (GO:0006970)		sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	18			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			CGGCCAGAATGCTTCCTCGGT	0.771													G|||	952	0.190096	0.2224	0.1657	5008	,	,		13018	0.0407		0.2724	False		,,,				2504	0.2331				p.A419T		.											.	TSC22D2-91	0			c.G1255A						.	G	THR/ALA	435,2751		29,377,1187	2.0	3.0	3.0		1255	1.5	0.0	3	dbSNP_86	3	1458,5444		170,1118,2163	yes	missense	TSC22D2	NM_014779.2	58	199,1495,3350	AA,AG,GG		21.1243,13.6535,18.7649	benign	419/781	150128392	1893,8195	1593	3451	5044	SO:0001583	missense	9819	exon1			CAGAATGCTTCCT	AB014569	CCDS3149.1	3q25.1	2005-03-01			ENSG00000196428	ENSG00000196428			29095	protein-coding gene	gene with protein product						9734811	Standard	NM_014779		Approved	KIAA0669, TILZ4a, TILZ4b, TILZ4c	uc003exv.3	O75157	OTTHUMG00000159744	ENST00000361875.3:c.1255G>A	3.37:g.150128392G>A	ENSP00000354543:p.Ala419Thr	Somatic	4	2		WXS	Illumina GAIIx	Phase_I	10	4	NM_014779	0	0	0	0	0	D3DNI5|Q6PI50|Q9H2Z6|Q9H2Z7|Q9H2Z8	Missense_Mutation	SNP	ENST00000361875.3	37	CCDS3149.1	433	0.19826007326007325	126	0.25609756097560976	72	0.19889502762430938	23	0.04020979020979021	212	0.2796833773087071	G	1.438	-0.568481	0.03910	0.136535	0.211243	ENSG00000196428	ENST00000361875;ENST00000361136	T;T	0.30182	1.54;1.54	3.57	1.47	0.22746	.	0.687211	0.12935	N	0.427041	T	0.00012	0.0000	N	0.19112	0.55	0.80722	P	0.0	B;B	0.10296	0.003;0.001	B;B	0.09377	0.004;0.002	T	0.33599	-0.9862	9	0.51188	T	0.08	.	6.993	0.24765	0.0:0.4503:0.379:0.1707	rs879634;rs3749399;rs58335631	419;419	O75157-2;O75157	.;T22D2_HUMAN	T	419	ENSP00000354543:A419T;ENSP00000354893:A419T	ENSP00000354893:A419T	A	+	1	0	TSC22D2	151611082	0.002000	0.14202	0.001000	0.08648	0.002000	0.02628	0.305000	0.19254	0.805000	0.34159	0.557000	0.71058	GCT	G|0.797;A|0.203		0.771	TSC22D2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000357123.2	NM_014779	
SEC62	7095	ucsc.edu	37	3	169700673	169700673	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr3:169700673G>A	ENST00000337002.4	+	4	488	c.430G>A	c.(430-432)Gat>Aat	p.D144N	SEC62_ENST00000480708.1_Missense_Mutation_p.D144N|SEC62-AS1_ENST00000479626.1_RNA	NM_003262.3	NP_003253.1	Q99442	SEC62_HUMAN	SEC62 homolog (S. cerevisiae)	144					cotranslational protein targeting to membrane (GO:0006613)|posttranslational protein targeting to membrane (GO:0006620)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|rough endoplasmic reticulum (GO:0005791)	protein transporter activity (GO:0008565)|receptor activity (GO:0004872)			NS(1)|endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|skin(1)	9						gaaaaaaaaagatggtgaaaa	0.289																																					p.D144N		.											.	SEC62-69	0			c.G430A						.						20.0	23.0	22.0					3																	169700673		2061	4208	6269	SO:0001583	missense	7095	exon4			AAAAAAGATGGTG	D87127	CCDS3210.1	3q26.2	2008-04-22	2008-04-22	2008-04-22	ENSG00000008952	ENSG00000008952			11846	protein-coding gene	gene with protein product		602173	"""translocation protein 1"""	TLOC1		9020021, 10799540	Standard	NM_003262		Approved	Dtrp1, HTP1	uc003fgh.3	Q99442	OTTHUMG00000158753	ENST00000337002.4:c.430G>A	3.37:g.169700673G>A	ENSP00000337688:p.Asp144Asn	Somatic	31	0		WXS	Illumina GAIIx	Phase_I	20	2	NM_003262	0	0	27	36	9	D3DNQ0|O00682|O00729	Missense_Mutation	SNP	ENST00000337002.4	37	CCDS3210.1	.	.	.	.	.	.	.	.	.	.	G	18.09	3.546577	0.65198	.	.	ENSG00000008952	ENST00000337002;ENST00000480708	D;D	0.83163	-1.69;-1.69	5.42	5.42	0.78866	Winged helix-turn-helix transcription repressor DNA-binding (1);	0.422619	0.28465	N	0.015260	T	0.76863	0.4047	L	0.46157	1.445	0.50813	D	0.999892	P	0.37914	0.611	B	0.35240	0.198	T	0.73646	-0.3917	10	0.15499	T	0.54	-6.1389	15.8813	0.79207	0.0:0.0:0.864:0.136	.	144	Q99442	SEC62_HUMAN	N	144	ENSP00000337688:D144N;ENSP00000420331:D144N	ENSP00000337688:D144N	D	+	1	0	SEC62	171183367	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.561000	0.53770	2.700000	0.92200	0.585000	0.79938	GAT	.		0.289	SEC62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352043.1		
FAM157A	728262	hgsc.bcm.edu	37	3	197880164	197880164	+	lincRNA	SNP	G	G	A			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr3:197880164G>A	ENST00000437428.2	+	0	44							C9JC47	F157A_HUMAN	family with sequence similarity 157, member A											NS(1)|skin(1)	2						agcagcagcagcagcagcaAC	0.527																																					p.Q81Q		.											.	.	0			c.G243A						.						3.0	6.0	5.0					3																	197880164		474	1113	1587			728262	exon2			GCAGCAGCAGCAG			3q29	2013-01-30			ENSG00000236438	ENSG00000236438			34079	other	unknown							Standard	NM_001145248		Approved		uc011bup.1	C9JC47			3.37:g.197880164G>A		Somatic	334	0		WXS	Illumina GAIIx	Phase_I	435	38	NM_001145248	0	0	0	0	0		Silent	SNP	ENST00000437428.2	37																																																																																				.		0.527	FAM157A-001	KNOWN	not_best_in_genome_evidence|mRNA_end_NF|basic	lincRNA	lincRNA	OTTHUMT00000340078.2	NM_001145248	
FAM157A	728262	hgsc.bcm.edu	37	3	197880166	197880166	+	lincRNA	SNP	A	A	T			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr3:197880166A>T	ENST00000437428.2	+	0	46							C9JC47	F157A_HUMAN	family with sequence similarity 157, member A											NS(1)|skin(1)	2						cagcagcagcagcagcaACTG	0.532																																					p.Q82L		.											.	.	0			c.A245T						.						2.0	6.0	5.0					3																	197880166		422	1075	1497			728262	exon2			AGCAGCAGCAGCA			3q29	2013-01-30			ENSG00000236438	ENSG00000236438			34079	other	unknown							Standard	NM_001145248		Approved		uc011bup.1	C9JC47			3.37:g.197880166A>T		Somatic	353	0		WXS	Illumina GAIIx	Phase_I	454	32	NM_001145248	0	0	0	0	0		Missense_Mutation	SNP	ENST00000437428.2	37		.	.	.	.	.	.	.	.	.	.	.	0.065	-1.214570	0.01555	.	.	ENSG00000236438	ENST00000431569	.	.	.	.	.	.	.	.	.	.	.	T	0.15305	0.0369	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.29243	-1.0018	5	.	.	.	.	.	.	.	.	82	C9JC47	F157A_HUMAN	L	82	.	.	Q	+	2	0	FAM157A	199364563	0.006000	0.16342	0.003000	0.11579	0.003000	0.03518	0.140000	0.16056	0.056000	0.16144	0.055000	0.15244	CAG	.		0.532	FAM157A-001	KNOWN	not_best_in_genome_evidence|mRNA_end_NF|basic	lincRNA	lincRNA	OTTHUMT00000340078.2	NM_001145248	
CRIPAK	285464	hgsc.bcm.edu	37	4	1388755	1388755	+	Silent	SNP	C	C	G	rs373946226	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr4:1388755C>G	ENST00000324803.4	+	1	3416	c.456C>G	c.(454-456)ccC>ccG	p.P152P		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	152					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			CACACGTGCCCATGCGGAGTG	0.697													N|||	566	0.113019	0.0772	0.1657	5008	,	,		16075	0.0139		0.1441	False		,,,				2504	0.1943				p.P152P		.											.	CRIPAK-90	0			c.C456G						.						75.0	67.0	69.0					4																	1388755		2201	4282	6483	SO:0001819	synonymous_variant	285464	exon1			CGTGCCCATGCGG	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.456C>G	4.37:g.1388755C>G		Somatic	6	2		WXS	Illumina GAIIx	Phase_I	24	9	NM_175918	0	0	4	7	3	Q8NB03	Silent	SNP	ENST00000324803.4	37	CCDS3349.1	.	.	.	.	.	.	.	.	.	.	-	3.606	-0.080629	0.07141	.	.	ENSG00000179979	ENST00000382944	.	.	.	0.948	-1.9	0.07665	.	.	.	.	.	T	0.13713	0.0332	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.26643	-1.0097	5	0.12430	T	0.62	.	2.6602	0.05024	0.0:0.3324:0.2607:0.407	.	.	.	.	D	136	.	ENSP00000372402:H136D	H	+	1	0	CRIPAK	1378755	0.000000	0.05858	0.001000	0.08648	0.018000	0.09664	-4.277000	0.00261	-0.599000	0.05798	-1.737000	0.00689	CAT	C|0.960;G|0.040		0.697	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
FAM193A	8603	broad.mit.edu	37	4	2641522	2641522	+	Nonsense_Mutation	SNP	G	G	T			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr4:2641522G>T	ENST00000324666.5	+	4	577	c.226G>T	c.(226-228)Gaa>Taa	p.E76*	FAM193A_ENST00000502458.1_Nonsense_Mutation_p.E76*|FAM193A_ENST00000545951.1_Nonsense_Mutation_p.E76*|FAM193A_ENST00000505311.1_Nonsense_Mutation_p.E76*|FAM193A_ENST00000382839.3_Nonsense_Mutation_p.E76*	NM_001256666.1	NP_001243595.1	P78312	F193A_HUMAN	family with sequence similarity 193, member A	76										NS(2)|breast(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(12)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	40						ACACCTGTTTGAAAATCTGGT	0.408																																					p.E76X		.											.	FAM193A-93	0			c.G226T						.						93.0	84.0	87.0					4																	2641522		2203	4300	6503	SO:0001587	stop_gained	8603	exon4			CTGTTTGAAAATC	AB000459	CCDS33943.1, CCDS58874.1, CCDS58875.1, CCDS58876.1	4p16.3	2009-09-04	2009-09-04	2009-09-04					16822	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 8"""	C4orf8		9734812	Standard	NR_046335		Approved	RES4-22	uc010ick.3	P78312		ENST00000324666.5:c.226G>T	4.37:g.2641522G>T	ENSP00000324587:p.Glu76*	Somatic	109	0		WXS	Illumina GAIIx	Phase_I	93	4	NM_003704	0	0	0	0	0	B7ZM85|B9EGR0|E9PFA1|O43607|P78311|P78313|Q9UEG8	Nonsense_Mutation	SNP	ENST00000324666.5	37	CCDS58875.1	.	.	.	.	.	.	.	.	.	.	G	39	7.856853	0.98528	.	.	ENSG00000125386	ENST00000382839;ENST00000324666;ENST00000545951;ENST00000502458	.	.	.	4.74	4.74	0.60224	.	0.054323	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	-16.7659	14.5747	0.68238	0.0:0.1466:0.8533:0.0	.	.	.	.	X	76	.	ENSP00000324587:E76X	E	+	1	0	FAM193A	2611320	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.754000	0.68743	2.618000	0.88619	0.563000	0.77884	GAA	.		0.408	FAM193A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000360903.1	NM_003704	
SLIT2	9353	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	20270474	20270474	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr4:20270474T>C	ENST00000504154.1	+	4	617	c.365T>C	c.(364-366)cTg>cCg	p.L122P	SLIT2_ENST00000503823.1_Missense_Mutation_p.L122P|SLIT2_ENST00000273739.5_Missense_Mutation_p.L122P|SLIT2_ENST00000503837.1_Missense_Mutation_p.L122P	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)	122					apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to heparin (GO:0071504)|cellular response to hormone stimulus (GO:0032870)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|corticospinal neuron axon guidance through spinal cord (GO:0021972)|dorsal/ventral axon guidance (GO:0033563)|in utero embryonic development (GO:0001701)|induction of negative chemotaxis (GO:0050929)|mammary duct terminal end bud growth (GO:0060763)|metanephros development (GO:0001656)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of axon extension (GO:0030517)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of gene expression (GO:0010629)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of leukocyte chemotaxis (GO:0002689)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|negative regulation of small GTPase mediated signal transduction (GO:0051058)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of vascular permeability (GO:0043116)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|response to cortisol (GO:0051414)|retinal ganglion cell axon guidance (GO:0031290)|Roundabout signaling pathway (GO:0035385)|single organismal cell-cell adhesion (GO:0016337)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chemorepellent activity (GO:0045499)|GTPase inhibitor activity (GO:0005095)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|laminin-1 binding (GO:0043237)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|Roundabout binding (GO:0048495)			NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116						CCTGAGTTGCTGTTTCTTGGG	0.358																																					p.L122P		.											.	SLIT2-521	0			c.T365C						.						154.0	144.0	148.0					4																	20270474		2203	4299	6502	SO:0001583	missense	9353	exon4			AGTTGCTGTTTCT	AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147			11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3		9813312, 18269211	Standard	XM_005248211		Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	ENST00000504154.1:c.365T>C	4.37:g.20270474T>C	ENSP00000422591:p.Leu122Pro	Somatic	72	0		WXS	Illumina GAIIx	Phase_I	72	25	NM_004787	0	0	0	0	0	B7ZLR5|O95710|Q17RU3|Q9Y5Q7	Missense_Mutation	SNP	ENST00000504154.1	37	CCDS3426.1	.	.	.	.	.	.	.	.	.	.	T	19.70	3.876489	0.72180	.	.	ENSG00000145147	ENST00000503823;ENST00000504154;ENST00000273739;ENST00000382173;ENST00000503837;ENST00000508824	D;D;D;D;T	0.83075	-1.65;-1.68;-1.58;-1.63;0.27	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	D	0.89952	0.6864	M	0.75615	2.305	0.80722	D	1	D;D	0.62365	0.991;0.981	P;P	0.61874	0.867;0.895	D	0.90705	0.4623	10	0.62326	D	0.03	.	16.3941	0.83550	0.0:0.0:0.0:1.0	.	122;122	O94813-3;O94813	.;SLIT2_HUMAN	P	122;122;122;122;122;83	ENSP00000427548:L122P;ENSP00000422591:L122P;ENSP00000273739:L122P;ENSP00000422261:L122P;ENSP00000426356:L83P	ENSP00000273739:L122P	L	+	2	0	SLIT2	19879572	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.800000	0.69108	2.272000	0.75746	0.523000	0.50628	CTG	.		0.358	SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250396.2		
ZAR1	326340	hgsc.bcm.edu	37	4	48492434	48492434	+	Missense_Mutation	SNP	G	G	C	rs10008444	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr4:48492434G>C	ENST00000327939.4	+	1	166	c.126G>C	c.(124-126)caG>caC	p.Q42H		NM_175619.1	NP_783318.1	Q86SH2	ZAR1_HUMAN	zygote arrest 1	42					multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)				endometrium(1)|large_intestine(4)	5						GCTGGCAGCAGCGCGGCAGGG	0.756													C|||	4938	0.986022	0.9493	0.9957	5008	,	,		9261	1.0		1.0	False		,,,				2504	1.0				p.Q42H		.											.	ZAR1-90	0			c.G126C						.	C	HIS/GLN	2851,89		1381,89,0	2.0	3.0	3.0		126	-0.2	0.0	4	dbSNP_119	3	6474,0		3237,0,0	no	missense	ZAR1	NM_175619.1	24	4618,89,0	CC,CG,GG		0.0,3.0272,0.9454	benign	42/425	48492434	9325,89	1470	3237	4707	SO:0001583	missense	326340	exon1			GCAGCAGCGCGGC	AY193890	CCDS3483.1	4p11	2014-02-20			ENSG00000182223	ENSG00000182223			20436	protein-coding gene	gene with protein product	"""zinc finger, 3CxxC-type 6"""	607520				12539046	Standard	NM_175619		Approved	Z3CXXC6	uc003gyd.3	Q86SH2	OTTHUMG00000102093	ENST00000327939.4:c.126G>C	4.37:g.48492434G>C	ENSP00000329803:p.Gln42His	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_175619	0	0	0	0	0		Missense_Mutation	SNP	ENST00000327939.4	37	CCDS3483.1	2130	0.9752747252747253	449	0.9126016260162602	359	0.9917127071823204	565	0.9877622377622378	757	0.9986807387862797	C	0.021	-1.426522	0.01117	0.969728	1.0	ENSG00000182223	ENST00000327939	.	.	.	4.09	-0.185	0.13276	.	0.811302	0.10779	N	0.635071	T	0.00012	0.0000	N	0.03608	-0.345	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.22103	-1.0226	8	0.14252	T	0.57	-31.571	6.2995	0.21105	0.0:0.2927:0.4307:0.2766	rs10008444;rs58304706	42	Q86SH2	ZAR1_HUMAN	H	42	.	ENSP00000329803:Q42H	Q	+	3	2	ZAR1	48187191	0.000000	0.05858	0.000000	0.03702	0.070000	0.16714	0.053000	0.14184	-0.405000	0.07599	-0.676000	0.03789	CAG	G|0.025;C|0.975		0.756	ZAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219927.3		
CWH43	80157	broad.mit.edu	37	4	48993967	48993967	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr4:48993967G>T	ENST00000226432.4	+	4	554	c.371G>T	c.(370-372)tGg>tTg	p.W124L	CWH43_ENST00000513409.1_Missense_Mutation_p.W97L	NM_025087.2	NP_079363.2	Q9H720	PG2IP_HUMAN	cell wall biogenesis 43 C-terminal homolog (S. cerevisiae)	124					GPI anchor biosynthetic process (GO:0006506)	integral component of membrane (GO:0016021)				cervix(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(26)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	43						CTCAGAATTTGGGGATTCATT	0.343																																					p.W124L		.											.	CWH43-93	0			c.G371T						.						186.0	167.0	173.0					4																	48993967		2202	4300	6502	SO:0001583	missense	80157	exon4			GAATTTGGGGATT		CCDS3486.1, CCDS68697.1	4p12-p11	2010-09-21			ENSG00000109182	ENSG00000109182			26133	protein-coding gene	gene with protein product						17714445, 17761529	Standard	NM_025087		Approved	FLJ21511, CWH43-C	uc003gyv.3	Q9H720	OTTHUMG00000128627	ENST00000226432.4:c.371G>T	4.37:g.48993967G>T	ENSP00000226432:p.Trp124Leu	Somatic	142	0		WXS	Illumina GAIIx	Phase_I	99	5	NM_025087	0	0	0	0	0	B2RPD7	Missense_Mutation	SNP	ENST00000226432.4	37	CCDS3486.1	.	.	.	.	.	.	.	.	.	.	G	13.90	2.373860	0.42105	.	.	ENSG00000109182	ENST00000226432;ENST00000513409	T;T	0.39229	1.65;1.09	5.42	5.42	0.78866	.	0.111715	0.41294	D	0.000920	T	0.63426	0.2510	M	0.67953	2.075	0.46654	D	0.999149	D	0.89917	1.0	D	0.80764	0.994	T	0.60556	-0.7240	9	.	.	.	.	17.5756	0.87947	0.0:0.0:1.0:0.0	.	124	Q9H720	PG2IP_HUMAN	L	124;97	ENSP00000226432:W124L;ENSP00000422802:W97L	.	W	+	2	0	CWH43	48688724	1.000000	0.71417	1.000000	0.80357	0.202000	0.24057	6.162000	0.71874	2.826000	0.97356	0.491000	0.48974	TGG	.		0.343	CWH43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250496.2	NM_025087	
NOA1	84273	hgsc.bcm.edu	37	4	57843114	57843114	+	Missense_Mutation	SNP	C	C	G	rs200929636	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr4:57843114C>G	ENST00000264230.4	-	1	1875	c.638G>C	c.(637-639)gGc>gCc	p.G213A	POLR2B_ENST00000431623.2_5'Flank|POLR2B_ENST00000314595.5_5'Flank|POLR2B_ENST00000441246.2_5'Flank|POLR2B_ENST00000381227.1_5'Flank	NM_032313.2	NP_115689.1	Q8NC60	NOA1_HUMAN	nitric oxide associated 1	213	CP-type G. {ECO:0000255|PROSITE- ProRule:PRU01058}.				apoptotic process (GO:0006915)|GTP catabolic process (GO:0006184)|mitochondrial translation (GO:0032543)|regulation of cell death (GO:0010941)|regulation of cellular respiration (GO:0043457)|ribosome biogenesis (GO:0042254)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)										CAGGGAGGGGCCGGGCCGCCG	0.721													C|||	32	0.00638978	0.0008	0.0058	5008	,	,		13241	0.0		0.0209	False		,,,				2504	0.0061				p.G213A		.											.	.	0			c.G638C						.	C	ALA/GLY	9,4275		0,9,2133	14.0	20.0	18.0		638	4.5	0.9	4		18	108,8306		3,102,4102	yes	missense	C4orf14	NM_032313.2	60	3,111,6235	GG,GC,CC		1.2836,0.2101,0.9214	benign	213/699	57843114	117,12581	2142	4207	6349	SO:0001583	missense	84273	exon1			GAGGGGCCGGGCC	AK098215	CCDS3510.1	4q12	2013-05-24	2011-10-19	2011-10-19	ENSG00000084092	ENSG00000084092			28473	protein-coding gene	gene with protein product	"""nitric oxide synthase, mitochondrial (putative)"", ""mitochondrial GTPase 3 homolog (S. cerevisiae)"""	614919	"""chromosome 4 open reading frame 14"""	C4orf14		16380119, 2118999, 21771794, 22447445	Standard	NM_032313		Approved	MGC3232, hAtNOS1, hNOA1, MTG3	uc003hck.3	Q8NC60	OTTHUMG00000128773	ENST00000264230.4:c.638G>C	4.37:g.57843114C>G	ENSP00000264230:p.Gly213Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	5	NM_032313	0	0	1	3	2	Q8N7L6|Q9BSQ9	Missense_Mutation	SNP	ENST00000264230.4	37	CCDS3510.1	22	0.010073260073260074	0	0.0	3	0.008287292817679558	0	0.0	19	0.025065963060686015	C	5.130	0.209587	0.09757	0.002101	0.012836	ENSG00000084092	ENST00000264230	T	0.30714	1.52	5.37	4.52	0.55395	.	0.552805	0.19767	N	0.106538	T	0.07503	0.0189	L	0.42245	1.32	0.42985	D	0.99447	B	0.34015	0.435	B	0.24974	0.057	T	0.03910	-1.0993	10	0.24483	T	0.36	.	8.4767	0.33018	0.0:0.8142:0.0:0.1858	.	213	Q8NC60	CD014_HUMAN	A	213	ENSP00000264230:G213A	ENSP00000264230:G213A	G	-	2	0	C4orf14	57537871	0.004000	0.15560	0.940000	0.37924	0.132000	0.20833	0.973000	0.29422	1.206000	0.43276	0.555000	0.69702	GGC	C|0.989;G|0.011		0.721	NOA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250694.2	NM_032313	
DSPP	1834	bcgsc.ca	37	4	88537126	88537126	+	Silent	SNP	C	C	T			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr4:88537126C>T	ENST00000282478.7	+	4	3345	c.3312C>T	c.(3310-3312)gaC>gaT	p.D1104D	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Silent_p.D1104D			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1104	Asp/Ser-rich.			Missing (in Ref. 1; AAF42472 and 3; AAD16120). {ECO:0000305}.	biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		acagcagcgacagcagcgata	0.542																																					p.D1104D		.											.	DSPP-90	0			c.C3312T						.						13.0	18.0	17.0					4																	88537126		1133	2209	3342	SO:0001819	synonymous_variant	1834	exon5			CAGCGACAGCAGC	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3312C>T	4.37:g.88537126C>T		Somatic	683	9		WXS	Illumina GAIIx	Phase_I	806	35	NM_014208	0	0	0	0	0	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	37	CCDS43248.1																																																																																			.		0.542	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
PIK3R1	5295	hgsc.bcm.edu	37	5	67522734	67522734	+	Silent	SNP	T	T	C			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr5:67522734T>C	ENST00000521381.1	+	2	847	c.231T>C	c.(229-231)atT>atC	p.I77I	PIK3R1_ENST00000396611.1_Silent_p.I77I|PIK3R1_ENST00000274335.5_Silent_p.I77I|PIK3R1_ENST00000521657.1_Silent_p.I77I	NM_181523.2	NP_852664.1	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1 (alpha)	77	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|cellular response to UV (GO:0034644)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|growth hormone receptor signaling pathway (GO:0060396)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|leukocyte migration (GO:0050900)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of osteoclast differentiation (GO:0045671)|neurotrophin TRK receptor signaling pathway (GO:0048011)|NFAT protein import into nucleus (GO:0051531)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of glucose import (GO:0046326)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|protein phosphorylation (GO:0006468)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|membrane (GO:0016020)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	ErbB-3 class receptor binding (GO:0043125)|insulin binding (GO:0043559)|insulin receptor binding (GO:0005158)|insulin receptor substrate binding (GO:0043560)|insulin-like growth factor receptor binding (GO:0005159)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatidylinositol 3-kinase binding (GO:0043548)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)	p.0?(1)		breast(12)|central_nervous_system(31)|cervix(1)|endometrium(68)|haematopoietic_and_lymphoid_tissue(5)|kidney(1)|large_intestine(32)|lung(10)|ovary(9)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	178		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoprenaline(DB01064)	TAGAATATATTGGAAGGAAAA	0.493			"""Mis, F, O"""		"""gliobastoma, ovarian, colorectal"""					TCGA GBM(4;<1E-08)																											p.I77I		.		Rec	yes		5	5q13.1	5295	"""phosphoinositide-3-kinase, regulatory subunit 1 (alpha)"""		"""E, O"""	.	PIK3R1-4332	1	Whole gene deletion(1)	large_intestine(1)	c.T231C						.						46.0	57.0	53.0					5																	67522734		2203	4300	6503	SO:0001819	synonymous_variant	5295	exon2			ATATATTGGAAGG	M61906	CCDS3993.1, CCDS3994.1, CCDS3995.1, CCDS56374.1	5q13.1	2014-09-17	2008-02-04		ENSG00000145675	ENSG00000145675		"""SH2 domain containing"""	8979	protein-coding gene	gene with protein product		171833				1314371, 18387942	Standard	NM_181524		Approved	GRB1, p85-ALPHA, p85	uc003jva.3	P27986	OTTHUMG00000131251	ENST00000521381.1:c.231T>C	5.37:g.67522734T>C		Somatic	98	0		WXS	Illumina GAIIx	Phase_I	52	3	NM_181523	0	0	0	0	0	B3KT19|D3DWA0|E7EX19|Q15747|Q4VBZ7|Q53EM6|Q8IXA2|Q8N1C5	Silent	SNP	ENST00000521381.1	37	CCDS3993.1																																																																																			.		0.493	PIK3R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254013.2	NM_181504	
GFM2	84340	ucsc.edu;bcgsc.ca	37	5	74037386	74037386	+	Missense_Mutation	SNP	T	T	A	rs16872235	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr5:74037386T>A	ENST00000296805.3	-	11	1355	c.898A>T	c.(898-900)Agt>Tgt	p.S300C	GFM2_ENST00000509430.1_Missense_Mutation_p.S300C|GFM2_ENST00000427854.2_Missense_Mutation_p.S300C|GFM2_ENST00000345239.2_Missense_Mutation_p.S300C	NM_032380.3	NP_115756.2			G elongation factor, mitochondrial 2											breast(2)|endometrium(2)|large_intestine(4)|lung(5)|prostate(1)	14		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Breast(144;0.231)		OV - Ovarian serous cystadenocarcinoma(47;1.86e-56)		AAATTCTCACTAAATTCTTCT	0.289													T|||	543	0.108427	0.1732	0.1066	5008	,	,		15709	0.0208		0.1382	False		,,,				2504	0.0818				p.S300C		.											.	GFM2-90	0			c.A898T						.	T	CYS/SER,CYS/SER,CYS/SER	798,3594	289.8+/-280.6	65,668,1463	44.0	46.0	46.0		898,898,898	5.9	1.0	5	dbSNP_123	46	1051,7519	206.1+/-248.3	63,925,3297	yes	missense,missense,missense	GFM2	NM_032380.3,NM_170681.1,NM_170691.1	112,112,112	128,1593,4760	AA,AT,TT		12.2637,18.1694,14.2648	possibly-damaging,possibly-damaging,possibly-damaging	300/780,300/514,300/733	74037386	1849,11113	2196	4285	6481	SO:0001583	missense	84340	exon11			TCTCACTAAATTC	AF111808	CCDS4023.1, CCDS4024.1, CCDS47232.1	5q13	2008-02-05			ENSG00000164347	ENSG00000164347			29682	protein-coding gene	gene with protein product		606544				11735030	Standard	NM_001281302		Approved	EFG2, FLJ21661	uc003kdh.1	Q969S9	OTTHUMG00000102058	ENST00000296805.3:c.898A>T	5.37:g.74037386T>A	ENSP00000296805:p.Ser300Cys	Somatic	62	0		WXS	Illumina GAIIx	Phase_I	47	8	NM_032380	0	0	7	7	0		Missense_Mutation	SNP	ENST00000296805.3	37	CCDS4023.1	233	0.10668498168498168	87	0.17682926829268292	45	0.12430939226519337	14	0.024475524475524476	87	0.11477572559366754	T	18.66	3.671118	0.67814	0.181694	0.122637	ENSG00000164347	ENST00000296805;ENST00000345239;ENST00000546082;ENST00000509430;ENST00000427854;ENST00000509097	T;T;T;T;T	0.74421	-0.02;0.11;-0.02;-0.84;-0.14	5.88	5.88	0.94601	Protein synthesis factor, GTP-binding (1);	0.074495	0.85682	D	0.000000	T	0.00552	0.0018	L	0.39898	1.24	0.18873	P	0.9999851399	D;D;D;D;D	0.71674	0.998;0.99;0.996;0.997;0.992	P;P;P;D;P	0.64144	0.893;0.849;0.849;0.922;0.907	T	0.14282	-1.0478	9	0.87932	D	0	-20.6679	16.2868	0.82725	0.0:0.0:0.0:1.0	rs16872235;rs16872235	300;300;300;300;300	F5H687;Q969S9-3;Q969S9-5;Q969S9-2;Q969S9	.;.;.;.;RRF2M_HUMAN	C	300;300;300;300;300;258	ENSP00000296805:S300C;ENSP00000296804:S300C;ENSP00000427004:S300C;ENSP00000405808:S300C;ENSP00000421717:S258C	ENSP00000296805:S300C	S	-	1	0	GFM2	74073142	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.039000	0.57325	2.244000	0.73946	0.460000	0.39030	AGT	T|0.878;A|0.122		0.289	GFM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219860.2	NM_032380	
C5orf56	441108	bcgsc.ca	37	5	131805735	131805735	+	Missense_Mutation	SNP	C	C	T	rs2706379	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr5:131805735C>T	ENST00000407797.1	+	4	215	c.92C>T	c.(91-93)cCg>cTg	p.P31L	AC116366.6_ENST00000443093.2_RNA|Y_RNA_ENST00000365663.1_RNA|C5orf56_ENST00000378953.4_Intron			Q8N8D9	CE056_HUMAN	chromosome 5 open reading frame 56	0										breast(1)|endometrium(1)|large_intestine(1)|lung(3)	6						TCTCTAGCCCCGAACAGCACA	0.423											OREG0003459	type=REGULATORY REGION|Gene=AL713721|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	C|||	1515	0.302516	0.3169	0.1628	5008	,	,		20492	0.3651		0.2097	False		,,,				2504	0.4131				.		.											.	C5orf56-90	0			.						.																																			SO:0001583	missense	441108	.			TAGCCCCGAACAG	BC130299		5q31.1	2009-04-20			ENSG00000197536	ENSG00000197536			33838	protein-coding gene	gene with protein product							Standard	NR_045116		Approved		uc010jds.2	Q8N8D9	OTTHUMG00000059493	ENST00000407797.1:c.92C>T	5.37:g.131805735C>T	ENSP00000385513:p.Pro31Leu	Somatic	283	4	1590	WXS	Illumina GAIIx	Phase_I	276	11	.	0	0	1	1	0	A1L3V9|A6NKA0	RNA	SNP	ENST00000407797.1	37		564	0.25824175824175827	131	0.266260162601626	62	0.1712707182320442	214	0.3741258741258741	157	0.20712401055408972	C	4.951	0.176710	0.09443	.	.	ENSG00000197536	ENST00000407797	.	.	.	3.18	-0.595	0.11660	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.37384	-0.9708	4	0.87932	D	0	.	5.7561	0.18174	0.0:0.3934:0.0:0.6066	rs2706379;rs17772170;rs59549813;rs2706379	.	.	.	L	31	.	ENSP00000385513:P31L	P	+	2	0	C5orf56	131833634	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.510000	0.06328	-0.089000	0.12484	-0.238000	0.12139	CCG	C|0.735;T|0.265		0.423	C5orf56-005	PUTATIVE	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000132333.2	NM_001013717	
PCDHB2	56133	broad.mit.edu	37	5	140476411	140476411	+	Silent	SNP	A	A	C			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr5:140476411A>C	ENST00000194155.4	+	1	2185	c.2037A>C	c.(2035-2037)gcA>gcC	p.A679A		NM_018936.2	NP_061759.1	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2	679					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.A679A(1)		NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(22)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGGAGGCGGCACCGGCCCAGG	0.687																																					p.A679A		.											.	PCDHB2-96	1	Substitution - coding silent(1)	lung(1)	c.A2037C						.						65.0	67.0	66.0					5																	140476411		2178	4247	6425	SO:0001819	synonymous_variant	56133	exon1			GGCGGCACCGGCC	AF152495	CCDS4244.1	5q31	2010-01-26			ENSG00000112852	ENSG00000112852		"""Cadherins / Protocadherins : Clustered"""	8687	other	protocadherin		606328				10380929	Standard	NM_018936		Approved	PCDH-BETA2	uc003lil.3	Q9Y5E7	OTTHUMG00000129606	ENST00000194155.4:c.2037A>C	5.37:g.140476411A>C		Somatic	42	0		WXS	Illumina GAIIx	Phase_I	177	5	NM_018936	0	0	5	5	0	Q4KMU1	Silent	SNP	ENST00000194155.4	37	CCDS4244.1																																																																																			.		0.687	PCDHB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251801.2	NM_018936	
PCDHB6	56130	hgsc.bcm.edu	37	5	140531592	140531592	+	Missense_Mutation	SNP	C	C	T	rs55834559	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr5:140531592C>T	ENST00000231136.1	+	1	1754	c.1754C>T	c.(1753-1755)aCc>aTc	p.T585I	PCDHB6_ENST00000543635.1_Missense_Mutation_p.T449I	NM_018939.2	NP_061762.1	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6	585	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			cervix(1)|endometrium(14)|kidney(6)|large_intestine(16)|liver(1)|lung(33)|ovary(1)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	84			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TACCTGGTGACCAAGGTGGTG	0.701													C|||	1343	0.268171	0.0136	0.3141	5008	,	,		14093	0.5308		0.2416	False		,,,				2504	0.3364				p.T585I		.											.	PCDHB6-91	0			c.C1754T						.						12.0	16.0	15.0					5																	140531592		1705	3628	5333	SO:0001583	missense	56130	exon1			TGGTGACCAAGGT	AF152499	CCDS4248.1	5q31	2010-01-26			ENSG00000113211	ENSG00000113211		"""Cadherins / Protocadherins : Clustered"""	8691	other	protocadherin		606332				10380929	Standard	NM_018939		Approved	PCDH-BETA6	uc003lir.3	Q9Y5E3	OTTHUMG00000129623	ENST00000231136.1:c.1754C>T	5.37:g.140531592C>T	ENSP00000231136:p.Thr585Ile	Somatic	8	1		WXS	Illumina GAIIx	Phase_I	36	9	NM_018939	0	0	45	47	2	B2R8R9	Missense_Mutation	SNP	ENST00000231136.1	37	CCDS4248.1	556	0.25457875457875456	7	0.014227642276422764	92	0.2541436464088398	287	0.5017482517482518	170	0.22427440633245382	C	16.68	3.191021	0.58017	.	.	ENSG00000113211	ENST00000543635;ENST00000231136	T;T	0.50548	0.74;0.74	4.19	-0.0448	0.13853	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.00012	0.0000	M	0.78223	2.4	0.38185	P	0.06025199999999997	P	0.38535	0.635	P	0.44811	0.461	T	0.49072	-0.8977	8	0.87932	D	0	.	15.6841	0.77396	0.0:0.4604:0.5396:0.0	rs55834559	585	Q9Y5E3	PCDB6_HUMAN	I	449;585	ENSP00000438466:T449I;ENSP00000231136:T585I	ENSP00000231136:T585I	T	+	2	0	PCDHB6	140511776	0.002000	0.14202	0.990000	0.47175	0.992000	0.81027	0.755000	0.26405	-0.274000	0.09232	-0.314000	0.08810	ACC	C|0.966;T|0.034		0.701	PCDHB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251818.2	NM_018939	
PCDHB16	57717	hgsc.bcm.edu	37	5	140564048	140564048	+	Missense_Mutation	SNP	G	G	C	rs17844664	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr5:140564048G>C	ENST00000361016.2	+	1	3069	c.1914G>C	c.(1912-1914)caG>caC	p.Q638H		NM_020957.1	NP_066008.1	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16	638	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.			Q -> H (in Ref. 3; BAB13447). {ECO:0000305}.	calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(10)|kidney(3)|large_intestine(14)|lung(29)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|urinary_tract(1)	69			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CAGCCAAGCAGAGGCTGGTGG	0.697													C|||	1305	0.260583	0.0129	0.3012	5008	,	,		14481	0.5308		0.2306	False		,,,				2504	0.319				p.Q638H		.											.	PCDHB16-92	0			c.G1914C						.						25.0	27.0	26.0					5																	140564048		2066	4006	6072	SO:0001583	missense	57717	exon1			CAAGCAGAGGCTG	AF217757	CCDS4251.1	5q31	2014-04-11			ENSG00000196963			"""Cadherins / Protocadherins : Clustered"""	14546	other	protocadherin	"""cadherin ME1"", ""protocadherin-3x"", ""PCDHbeta 16"""	606345				11230163, 11322959	Standard	NM_020957		Approved	PCDHB8a, PCDH3X, KIAA1621, PCDH-BETA16, ME1	uc003liv.3	Q9NRJ7	OTTHUMG00000188325	ENST00000361016.2:c.1914G>C	5.37:g.140564048G>C	ENSP00000354293:p.Gln638His	Somatic	5	2		WXS	Illumina GAIIx	Phase_I	49	14	NM_020957	0	0	7	8	1	B3KPK5|Q8IYD5|Q96SE9|Q9HCF1	Missense_Mutation	SNP	ENST00000361016.2	37	CCDS4251.1	568	0.2600732600732601	8	0.016260162601626018	88	0.2430939226519337	303	0.5297202797202797	169	0.22295514511873352	N	0.015	-1.544803	0.00934	.	.	ENSG00000196963	ENST00000361016	T	0.49720	0.77	3.96	-0.91	0.10511	Cadherin (4);Cadherin-like (1);	0.450223	0.16567	N	0.208799	T	0.00012	0.0000	N	0.16016	0.355	0.80722	P	0.0	B	0.02656	0.0	B	0.04013	0.001	T	0.43491	-0.9388	9	0.06494	T	0.89	.	14.0885	0.64975	0.0:0.2676:0.6494:0.0829	rs17844664	638	Q9NRJ7	PCDBG_HUMAN	H	638	ENSP00000354293:Q638H	ENSP00000354293:Q638H	Q	+	3	2	PCDHB16	140544232	0.000000	0.05858	0.332000	0.25469	0.298000	0.27526	-1.785000	0.01767	-0.483000	0.06772	-0.702000	0.03669	CAG	.		0.697	PCDHB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251800.1	NM_020957	
PCDHB10	56126	hgsc.bcm.edu	37	5	140573844	140573844	+	Silent	SNP	C	C	T			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr5:140573844C>T	ENST00000239446.4	+	1	1903	c.1719C>T	c.(1717-1719)acC>acT	p.T573T		NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10	573	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGCCCTGCACCGAGCTGGTGC	0.711																																					p.T573T		.											.	PCDHB10-92	0			c.C1719T						.						7.0	10.0	9.0					5																	140573844		1626	3527	5153	SO:0001819	synonymous_variant	56126	exon1			CTGCACCGAGCTG	AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626	ENST00000239446.4:c.1719C>T	5.37:g.140573844C>T		Somatic	3	0		WXS	Illumina GAIIx	Phase_I	13	5	NM_018930	0	0	29	36	7	Q96T99	Silent	SNP	ENST00000239446.4	37	CCDS4252.1																																																																																			.		0.711	PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251821.1	NM_018930	
GLRA1	2741	broad.mit.edu	37	5	151202503	151202503	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr5:151202503G>A	ENST00000455880.2	-	9	1391	c.1105C>T	c.(1105-1107)Cgc>Tgc	p.R369C	GLRA1_ENST00000274576.4_Missense_Mutation_p.R361C|GLRA1_ENST00000545569.1_Missense_Mutation_p.R278C			P23415	GLRA1_HUMAN	glycine receptor, alpha 1	369					acrosome reaction (GO:0007340)|action potential (GO:0001508)|adult walking behavior (GO:0007628)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|muscle contraction (GO:0006936)|negative regulation of transmission of nerve impulse (GO:0051970)|neuromuscular process controlling posture (GO:0050884)|neuropeptide signaling pathway (GO:0007218)|positive regulation of acrosome reaction (GO:2000344)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of membrane potential (GO:0042391)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|righting reflex (GO:0060013)|startle response (GO:0001964)|synaptic transmission, glycinergic (GO:0060012)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|external side of plasma membrane (GO:0009897)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glycine-gated chloride channel activity (GO:0016934)|glycine binding (GO:0016594)|taurine binding (GO:0030977)|transmitter-gated ion channel activity (GO:0022824)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	23		all_hematologic(541;0.0341)|Medulloblastoma(196;0.0912)	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Ethanol(DB00898)|Ginkgo biloba(DB01381)|Glycine(DB00145)|Halothane(DB01159)|Isoflurane(DB00753)|Lindane(DB00431)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	AAGTTAAAGCGGCCTTCTCCA	0.557																																					p.R369C		.											.	GLRA1-91	0			c.C1105T						.						63.0	60.0	61.0					5																	151202503		2203	4300	6503	SO:0001583	missense	2741	exon9			TAAAGCGGCCTTC		CCDS4320.1, CCDS54942.1	5q33.1	2012-02-07	2008-01-24		ENSG00000145888	ENSG00000145888		"""Ligand-gated ion channels / Glycine receptors"""	4326	protein-coding gene	gene with protein product	"""startle disease/hyperekplexia"", ""stiff person syndrome"""	138491	"""glycine receptor, alpha 1 (startle disease/hyperekplexia)"""	STHE		1355335, 8298642	Standard	NM_000171		Approved		uc003lut.3	P23415	OTTHUMG00000130121	ENST00000455880.2:c.1105C>T	5.37:g.151202503G>A	ENSP00000411593:p.Arg369Cys	Somatic	48	0		WXS	Illumina GAIIx	Phase_I	56	4	NM_001146040	0	0	0	0	0	B2R6T3|Q14C77|Q6DJV9	Missense_Mutation	SNP	ENST00000455880.2	37	CCDS54942.1	.	.	.	.	.	.	.	.	.	.	G	15.99	2.996641	0.54147	.	.	ENSG00000145888	ENST00000274576;ENST00000455880;ENST00000545569	D;D;D	0.84442	-1.85;-1.85;-1.85	4.9	3.93	0.45458	Neurotransmitter-gated ion-channel transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.89629	0.6770	L	0.54323	1.7	0.58432	D	0.999997	D;D;D	0.76494	0.998;0.999;0.997	D;D;P	0.67900	0.954;0.932;0.857	D	0.90461	0.4446	10	0.56958	D	0.05	.	16.0341	0.80608	0.0:0.0:0.8249:0.1751	.	369;278;361	P23415;Q14C71;P23415-2	GLRA1_HUMAN;.;.	C	361;369;278	ENSP00000274576:R361C;ENSP00000411593:R369C;ENSP00000445913:R278C	ENSP00000274576:R361C	R	-	1	0	GLRA1	151182696	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	2.508000	0.45450	2.243000	0.73865	0.467000	0.42956	CGC	.		0.557	GLRA1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000373959.1		
ZFP2	80108	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	5	178359644	178359644	+	Missense_Mutation	SNP	G	G	A	rs189472573	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr5:178359644G>A	ENST00000361362.2	+	5	1860	c.1330G>A	c.(1330-1332)Gga>Aga	p.G444R	ZFP2_ENST00000523286.1_Missense_Mutation_p.G444R|ZFP2_ENST00000503510.2_Missense_Mutation_p.G444R|ZFP2_ENST00000520301.1_Missense_Mutation_p.G444R	NM_030613.2	NP_085116.2	Q6ZN57	ZFP2_HUMAN	ZFP2 zinc finger protein	444					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|kidney(1)|large_intestine(7)|liver(1)|lung(2)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	20	all_cancers(89;0.000639)|all_epithelial(37;0.000109)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.00655)|GBM - Glioblastoma multiforme(465;0.0302)|OV - Ovarian serous cystadenocarcinoma(192;0.0615)|Epithelial(171;0.111)		TAATGAATGCGGAAAAGCCTT	0.418													G|||	2	0.000399361	0.0	0.0029	5008	,	,		20093	0.0		0.0	False		,,,				2504	0.0				p.G444R		.											.	ZFP2-93	0			c.G1330A						.						65.0	66.0	66.0					5																	178359644		2203	4300	6503	SO:0001583	missense	80108	exon5			GAATGCGGAAAAG	AK025281	CCDS4440.1	5q35.3	2013-01-08	2012-11-27		ENSG00000198939	ENSG00000198939		"""Zinc fingers, C2H2-type"""	26138	protein-coding gene	gene with protein product			"""zinc finger protein 2 homolog (mouse)"""				Standard	NM_030613		Approved	FLJ21628, ZNF751	uc003mjn.1	Q6ZN57	OTTHUMG00000130885	ENST00000361362.2:c.1330G>A	5.37:g.178359644G>A	ENSP00000354453:p.Gly444Arg	Somatic	63	0		WXS	Illumina GAIIx	Phase_I	64	6	NM_030613	0	0	2	2	0	A5PLN5|B7ZM23|Q9H6Z6	Missense_Mutation	SNP	ENST00000361362.2	37	CCDS4440.1	3	0.0013736263736263737	0	0.0	3	0.008287292817679558	0	0.0	0	0.0	g	17.61	3.431409	0.62844	.	.	ENSG00000198939	ENST00000361362;ENST00000520301;ENST00000523286;ENST00000503510	T;T;T;T	0.03524	3.9;3.9;3.9;3.9	4.66	4.66	0.58398	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.31897	N	0.006890	T	0.14013	0.0339	M	0.83953	2.67	0.37502	D	0.916796	D	0.89917	1.0	D	0.85130	0.997	T	0.01805	-1.1270	10	0.54805	T	0.06	-9.0419	15.0856	0.72148	0.0:0.0:1.0:0.0	.	444	Q6ZN57	ZFP2_HUMAN	R	444	ENSP00000354453:G444R;ENSP00000430980:G444R;ENSP00000430531:G444R;ENSP00000438114:G444R	ENSP00000354453:G444R	G	+	1	0	ZFP2	178292250	1.000000	0.71417	1.000000	0.80357	0.842000	0.47809	2.278000	0.43426	2.392000	0.81423	0.655000	0.94253	GGA	G|0.999;A|0.001		0.418	ZFP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253470.2	NM_030613	
FOXC1	2296	hgsc.bcm.edu	37	6	1611345	1611345	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr6:1611345G>T	ENST00000380874.2	+	1	665	c.665G>T	c.(664-666)cGc>cTc	p.R222L		NM_001453.2	NP_001444.2	Q12948	FOXC1_HUMAN	forkhead box C1	222					artery morphogenesis (GO:0048844)|blood vessel remodeling (GO:0001974)|brain development (GO:0007420)|camera-type eye development (GO:0043010)|cardiac muscle cell proliferation (GO:0060038)|collagen fibril organization (GO:0030199)|embryonic heart tube development (GO:0035050)|eye development (GO:0001654)|germ cell migration (GO:0008354)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|lacrimal gland development (GO:0032808)|lymph vessel development (GO:0001945)|negative regulation of apoptotic process involved in outflow tract morphogenesis (GO:1902257)|negative regulation of mitotic cell cycle (GO:0045930)|neural crest cell development (GO:0014032)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|ovarian follicle development (GO:0001541)|paraxial mesoderm formation (GO:0048341)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of blood vessel size (GO:0050880)|regulation of organ growth (GO:0046620)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system development (GO:0001501)|somitogenesis (GO:0001756)|ureteric bud development (GO:0001657)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(1)	8	Ovarian(93;0.0733)	all_cancers(2;4.45e-07)|all_epithelial(2;4.33e-05)|all_lung(73;0.0713)|all_hematologic(90;0.0895)		Epithelial(2;0.0904)|OV - Ovarian serous cystadenocarcinoma(45;0.095)|all cancers(2;0.168)		CCGCCCGTGCGCATCCAGGAC	0.811																																					p.R222L	Pancreas(133;719 1821 3197 26645 35015)	.											.	FOXC1-227	0			c.G665T						.						2.0	2.0	2.0					6																	1611345		998	2424	3422	SO:0001583	missense	2296	exon1			CCGTGCGCATCCA	AF048693	CCDS4473.1	6p25	2008-04-10			ENSG00000054598	ENSG00000054598		"""Forkhead boxes"""	3800	protein-coding gene	gene with protein product		601090		FKHL7, IRID1		7957066, 9620769	Standard	NM_001453		Approved	FREAC3, ARA, IGDA, IHG1	uc003mtp.3	Q12948	OTTHUMG00000016182	ENST00000380874.2:c.665G>T	6.37:g.1611345G>T	ENSP00000370256:p.Arg222Leu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	3	3	NM_001453	0	0	0	0	0	Q86UP7|Q9BYM1|Q9NUE5|Q9UDD0|Q9UP06	Missense_Mutation	SNP	ENST00000380874.2	37	CCDS4473.1	.	.	.	.	.	.	.	.	.	.	g	18.99	3.739466	0.69304	.	.	ENSG00000054598	ENST00000380874	D	0.92545	-3.06	3.76	2.79	0.32731	.	0.456577	0.13691	U	0.369513	D	0.87947	0.6306	L	0.43923	1.385	0.51767	D	0.999932	P	0.52842	0.956	P	0.49276	0.605	D	0.87460	0.2407	10	0.59425	D	0.04	.	12.3689	0.55244	0.0:0.2883:0.7117:0.0	.	222	Q12948	FOXC1_HUMAN	L	222	ENSP00000370256:R222L	ENSP00000370256:R222L	R	+	2	0	FOXC1	1556344	0.001000	0.12720	1.000000	0.80357	0.945000	0.59286	0.785000	0.26830	1.647000	0.50633	0.503000	0.49774	CGC	.		0.811	FOXC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043450.1		
TRIM38	10475	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	25967015	25967015	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr6:25967015C>G	ENST00000357085.3	+	3	741	c.265C>G	c.(265-267)Caa>Gaa	p.Q89E	TRIM38_ENST00000349458.3_Missense_Mutation_p.Q89E	NM_006355.3	NP_006346.1	O00635	TRI38_HUMAN	tripartite motif containing 38	89					negative regulation of defense response to virus (GO:0050687)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of viral entry into host cell (GO:0046598)|positive regulation of viral genome replication (GO:0045070)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|regulation of interferon-beta production (GO:0032648)|signal transduction (GO:0007165)	intracellular (GO:0005622)	signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(2)	23						AGAGACGGATCAAGAAATGTC	0.557																																					p.Q89E		.											.	TRIM38-226	0			c.C265G						.						61.0	58.0	59.0					6																	25967015		2203	4300	6503	SO:0001583	missense	10475	exon3			ACGGATCAAGAAA	U90547	CCDS4568.1	6p21.3	2011-04-20	2011-01-25	2002-06-07	ENSG00000112343	ENSG00000112343		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10059	protein-coding gene	gene with protein product			"""ring finger protein 15"", ""tripartite motif-containing 38"""	RNF15			Standard	XR_241880		Approved	RORET	uc003nfm.4	O00635	OTTHUMG00000014414	ENST00000357085.3:c.265C>G	6.37:g.25967015C>G	ENSP00000349596:p.Gln89Glu	Somatic	172	0		WXS	Illumina GAIIx	Phase_I	290	56	NM_006355	0	0	0	1	1	B2R862	Missense_Mutation	SNP	ENST00000357085.3	37	CCDS4568.1	.	.	.	.	.	.	.	.	.	.	c	7.908	0.735837	0.15574	.	.	ENSG00000112343	ENST00000540262;ENST00000349458;ENST00000357085	T;T;T	0.39997	1.05;1.05;1.05	4.37	0.184	0.15086	Zinc finger, B-box (3);	1.985980	0.02431	N	0.083617	T	0.09555	0.0235	L	0.33189	0.99	0.09310	N	1	B;B	0.16396	0.017;0.017	B;B	0.22880	0.042;0.042	T	0.05801	-1.0863	10	0.06625	T	0.88	.	4.2249	0.10575	0.1446:0.6008:0.1419:0.1127	.	89;89	B2R862;O00635	.;TRI38_HUMAN	E	89	ENSP00000443976:Q89E;ENSP00000230099:Q89E;ENSP00000349596:Q89E	ENSP00000230099:Q89E	Q	+	1	0	TRIM38	26074994	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-0.638000	0.05452	0.021000	0.15133	-0.291000	0.09656	CAA	.		0.557	TRIM38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040076.2		
C6orf10	10665	bcgsc.ca	37	6	32307382	32307382	+	Missense_Mutation	SNP	G	G	A	rs1033500	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr6:32307382G>A	ENST00000447241.2	-	10	555	c.383C>T	c.(382-384)cCt>cTt	p.P128L	C6orf10_ENST00000375007.4_Missense_Mutation_p.P126L|C6orf10_ENST00000375015.4_Missense_Mutation_p.P112L|C6orf10_ENST00000533191.1_Missense_Mutation_p.P112L|C6orf10_ENST00000527965.1_Missense_Mutation_p.P105L|C6orf10_ENST00000442822.2_Missense_Mutation_p.P105L	NM_006781.3	NP_006772.3	Q5SRN2	CF010_HUMAN	chromosome 6 open reading frame 10	128			P -> L (in dbSNP:rs1033500). {ECO:0000269|PubMed:14574404, ECO:0000269|PubMed:15489334}.			integral component of membrane (GO:0016021)|nucleus (GO:0005634)				cervix(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(12)|ovary(1)|skin(1)	25						CTTACAAGGAGGTTCTTCAGT	0.289													G|||	1637	0.326877	0.1354	0.4957	5008	,	,		18144	0.3601		0.3748	False		,,,				2504	0.3824				.		.											.	C6orf10-91	0			.						.	G	LEU/PRO	533,2489		56,421,1034	153.0	178.0	169.0		383	-0.4	0.0	6	dbSNP_86	169	2143,3275		427,1289,993	yes	missense	C6orf10	NM_006781.3	98	483,1710,2027	AA,AG,GG		39.5533,17.6373,31.7062	possibly-damaging	128/564	32307382	2676,5764	1511	2709	4220	SO:0001583	missense	10665	.			CAAGGAGGTTCTT	U60665	CCDS34422.1, CCDS69082.1, CCDS75430.1	6p21.32	2012-11-20			ENSG00000204296	ENSG00000204296			13922	protein-coding gene	gene with protein product	"""testis specific basic protein"""					10803852	Standard	XM_005248810		Approved	TSBP	uc021yvs.1	Q5SRN2	OTTHUMG00000031107	ENST00000447241.2:c.383C>T	6.37:g.32307382G>A	ENSP00000415517:p.Pro128Leu	Somatic	165	2		WXS	Illumina GAIIx	Phase_I	121	5	.	0	0	0	0	0	A2BET1|A2BET2|A6NME2|B0S7R2|B0S7R3|E9PMB1|Q5SPI9|Q5SPJ0|Q5SPK9|Q5SPL0|Q5SRN3|Q5TG25|Q5TG26|Q8N4B6	Missense_Mutation	SNP	ENST00000447241.2	37	CCDS34422.1	738	0.33791208791208793	56	0.11382113821138211	163	0.45027624309392267	230	0.4020979020979021	289	0.3812664907651715	G	5.755	0.323770	0.10900	0.176373	0.395533	ENSG00000204296	ENST00000442822;ENST00000447241;ENST00000375015;ENST00000533191;ENST00000527965;ENST00000375007;ENST00000375002;ENST00000305725;ENST00000532023	T;T;T;T;T;T;T	0.04809	3.55;3.55;3.55;3.55;3.55;3.55;3.55	3.69	-0.452	0.12205	.	.	.	.	.	T	0.01320	0.0043	L	0.47716	1.5	0.80722	P	0.0	B;P	0.39157	0.025;0.662	B;B	0.35510	0.012;0.204	T	0.46219	-0.9207	8	0.48119	T	0.1	0.0163	2.6546	0.05008	0.1061:0.3305:0.388:0.1754	rs1033500;rs4121722;rs17855580;rs52812849;rs59799665;rs1033500	112;128	E9PMB1;Q5SRN2	.;CF010_HUMAN	L	105;128;112;112;105;126;112;111;116	ENSP00000411164:P105L;ENSP00000415517:P128L;ENSP00000364155:P112L;ENSP00000431199:P112L;ENSP00000435103:P105L;ENSP00000364146:P126L;ENSP00000432814:P116L	ENSP00000303292:P111L	P	-	2	0	C6orf10	32415360	0.077000	0.21312	0.003000	0.11579	0.012000	0.07955	0.079000	0.14782	-0.105000	0.12132	0.543000	0.68304	CCT	G|0.526;T|0.075		0.289	C6orf10-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076178.4	NM_006781	
TREML2	79865	hgsc.bcm.edu	37	6	41166119	41166119	+	Missense_Mutation	SNP	T	T	C	rs76984414		TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr6:41166119T>C	ENST00000483722.1	-	2	289	c.104A>G	c.(103-105)gAg>gGg	p.E35G		NM_024807.2	NP_079083.2	Q5T2D2	TRML2_HUMAN	triggering receptor expressed on myeloid cells-like 2	35	Ig-like V-type.				T cell activation (GO:0042110)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			breast(1)|central_nervous_system(1)|large_intestine(1)|lung(13)|ovary(1)|prostate(1)	18	Ovarian(28;0.0418)|Colorectal(47;0.196)					AGACAGAGTCTCCCCTTCAAG	0.498																																					p.E35G		.											.	TREML2-91	0			c.A104G						.						132.0	135.0	134.0					6																	41166119		2203	4300	6503	SO:0001583	missense	79865	exon2			AGAGTCTCCCCTT	AK023755	CCDS4853.1, CCDS4853.2	6p21.1	2013-01-11	2004-04-14	2004-04-16	ENSG00000112195	ENSG00000112195		"""Immunoglobulin superfamily / V-set domain containing"""	21092	protein-coding gene	gene with protein product	"""TREM-like transcript 2"""	609715	"""chromosome 6 open reading frame 76"""	C6orf76		12645956	Standard	NM_024807		Approved	FLJ13693, TLT2, dJ238O23.1	uc010jxm.1	Q5T2D2	OTTHUMG00000016349	ENST00000483722.1:c.104A>G	6.37:g.41166119T>C	ENSP00000418767:p.Glu35Gly	Somatic	87	1		WXS	Illumina GAIIx	Phase_I	95	4	NM_024807	0	0	0	0	0	Q08AP8|Q08AP9|Q8IWY0|Q9H8E9	Missense_Mutation	SNP	ENST00000483722.1	37	CCDS4853.2	.	.	.	.	.	.	.	.	.	.	.	7.815	0.716447	0.15306	.	.	ENSG00000112195	ENST00000483722	T	0.20598	2.06	4.75	3.58	0.41010	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.462226	0.19397	N	0.115265	T	0.05410	0.0143	L	0.33245	0.995	0.26220	N	0.979173	B	0.14438	0.01	B	0.12156	0.007	T	0.37596	-0.9699	10	0.29301	T	0.29	-14.8097	9.5481	0.39293	0.0:0.0923:0.0:0.9077	.	35	Q5T2D2	TRML2_HUMAN	G	35	ENSP00000418767:E35G	ENSP00000418767:E35G	E	-	2	0	TREML2	41274097	1.000000	0.71417	0.999000	0.59377	0.017000	0.09413	1.360000	0.34125	0.283000	0.22279	-1.195000	0.01675	GAG	.		0.498	TREML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043756.3	NM_024807	
EEF1A1	1915	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	74228419	74228421	+	Splice_Site	DEL	ACC	ACC	-			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	ACC	ACC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr6:74228419_74228421delACC	ENST00000316292.9	-	4	1763_1764	c.772_773delGGT	c.(772-774)ggt>t	p.G258del	EEF1A1_ENST00000491404.1_Intron|EEF1A1_ENST00000331523.2_Splice_Site_p.G258del|EEF1A1_ENST00000309268.6_Splice_Site_p.G258del	NM_001402.5	NP_001393.1	P68104	EF1A1_HUMAN	eukaryotic translation elongation factor 1 alpha 1	258					cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|translation elongation factor activity (GO:0003746)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(6)|prostate(2)|skin(3)	18						CAGCCAACTTACCACCAATTTTG	0.443											OREG0003895	type=REGULATORY REGION|Gene=D16891|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.258_258del		.											.	EEF1A1-226	0			c.772_772del						.																																			SO:0001630	splice_region_variant	1915	exon5			CAACTTACCACCA	BC019669	CCDS4980.1	6q14.1	2010-06-30	2004-11-19		ENSG00000156508	ENSG00000156508			3189	protein-coding gene	gene with protein product		130590	"""leukocyte receptor cluster (LRC) member 7"""	EF1A, EEF1A, LENG7		8812466, 10941842	Standard	NM_001402		Approved	EE1A1	uc003phj.3	P68104	OTTHUMG00000015031	ENST00000316292.9:c.772+1GGT>-	6.37:g.74228422_74228424delACC		Somatic	173	0	1151	WXS	Illumina GAIIx	Phase_I	186	48	NM_001402	0	0	0	0	0	P04719|P04720|Q6IQ15	Frame_Shift_Del	DEL	ENST00000316292.9	37	CCDS4980.1																																																																																			.		0.443	EEF1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041210.2	NM_001402	In_Frame_Del
POU3F2	5454	hgsc.bcm.edu	37	6	99283376	99283376	+	Silent	SNP	T	T	G	rs195860	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr6:99283376T>G	ENST00000328345.5	+	1	797	c.627T>G	c.(625-627)ggT>ggG	p.G209G		NM_005604.3	NP_005595.2	P20265	PO3F2_HUMAN	POU class 3 homeobox 2	209					astrocyte development (GO:0014002)|cellular response to organic substance (GO:0071310)|cerebral cortex radially oriented cell migration (GO:0021799)|epidermis development (GO:0008544)|forebrain ventricular zone progenitor cell division (GO:0021869)|hypothalamus cell differentiation (GO:0021979)|myelination in peripheral nervous system (GO:0022011)|neurohypophysis development (GO:0021985)|neuron differentiation (GO:0030182)|positive regulation of cell proliferation (GO:0008284)|positive regulation of multicellular organism growth (GO:0040018)|regulation of axonogenesis (GO:0050770)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	identical protein binding (GO:0042802)|RNA polymerase II transcription coactivator activity (GO:0001105)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|large_intestine(3)|lung(5)	10		all_cancers(76;1.56e-06)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00893)|Colorectal(196;0.069)|Lung NSC(302;0.197)		BRCA - Breast invasive adenocarcinoma(108;0.0355)		AGCCGGCCGGTCTGCACCACC	0.736													G|||	4460	0.890575	0.8994	0.9121	5008	,	,		6412	0.9544		0.8598	False		,,,				2504	0.8292				p.G209G		.											.	POU3F2-90	0			c.T627G						.	G		3186,306		1453,280,13	4.0	4.0	4.0		627	3.1	1.0	6	dbSNP_79	4	6282,930		2738,806,62	no	coding-synonymous	POU3F2	NM_005604.2		4191,1086,75	GG,GT,TT		12.8952,8.7629,11.5471		209/444	99283376	9468,1236	1746	3606	5352	SO:0001819	synonymous_variant	5454	exon1			GGCCGGTCTGCAC	Z11933	CCDS5040.1	6q16.2	2011-06-20	2007-07-13		ENSG00000184486	ENSG00000184486		"""Homeoboxes / POU class"""	9215	protein-coding gene	gene with protein product		600494	"""POU domain class 3, transcription factor 2"""	OTF7		8441633	Standard	NM_005604		Approved	POUF3, BRN2, OCT7	uc003ppe.3	P20265	OTTHUMG00000015258	ENST00000328345.5:c.627T>G	6.37:g.99283376T>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	3	NM_005604	0	0	0	0	0	Q14960|Q86V54|Q9UJL0	Silent	SNP	ENST00000328345.5	37	CCDS5040.1																																																																																			T|0.089;G|0.911		0.736	POU3F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041586.2		
CTGF	1490	hgsc.bcm.edu	37	6	132271980	132271980	+	Silent	SNP	T	T	G	rs6934749		TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr6:132271980T>G	ENST00000367976.3	-	2	419	c.219A>C	c.(217-219)ccA>ccC	p.P73P	RP11-69I8.3_ENST00000435287.1_RNA	NM_001901.2	NP_001892	P29279	CTGF_HUMAN	connective tissue growth factor	73	IGFBP N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00653}.				angiogenesis (GO:0001525)|cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular lipid metabolic process (GO:0044255)|chondrocyte proliferation (GO:0035988)|cytosolic calcium ion transport (GO:0060401)|DNA replication (GO:0006260)|epidermis development (GO:0008544)|extracellular matrix constituent secretion (GO:0070278)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of gene expression (GO:0010629)|organ senescence (GO:0010260)|ossification (GO:0001503)|positive regulation of cardiac muscle contraction (GO:0060452)|positive regulation of cell activation (GO:0050867)|positive regulation of cell death (GO:0010942)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of G0 to G1 transition (GO:0070318)|positive regulation of gene expression (GO:0010628)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|reactive oxygen species metabolic process (GO:0072593)|regulation of cell growth (GO:0001558)|regulation of chondrocyte differentiation (GO:0032330)|response to amino acid (GO:0043200)|response to anoxia (GO:0034059)|response to estradiol (GO:0032355)|response to fatty acid (GO:0070542)|response to glucose (GO:0009749)|response to mineralocorticoid (GO:0051385)|response to peptide hormone (GO:0043434)|response to wounding (GO:0009611)|small molecule metabolic process (GO:0044281)|tissue homeostasis (GO:0001894)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell cortex (GO:0005938)|cis-Golgi network (GO:0005801)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|insulin-like growth factor binding (GO:0005520)			breast(1)|endometrium(6)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)	13	Breast(56;0.0602)			GBM - Glioblastoma multiforme(226;0.015)|OV - Ovarian serous cystadenocarcinoma(155;0.0169)		GCGGGTCGCATGGGTCGCGCT	0.716													G|||	5008	1.0	1.0	1.0	5008	,	,		7576	1.0		1.0	False		,,,				2504	1.0				p.P73P	Esophageal Squamous(127;510 1660 12817 24400 38449)	.											.	CTGF-90	0			c.A219C						.						6.0	8.0	7.0					6																	132271980		2100	4127	6227	SO:0001819	synonymous_variant	1490	exon2			GTCGCATGGGTCG	X78947	CCDS5151.1	6q23.2	2008-02-05			ENSG00000118523	ENSG00000118523			2500	protein-coding gene	gene with protein product		121009				1654338	Standard	NM_001901		Approved	IGFBP8, CCN2	uc003qcz.3	P29279	OTTHUMG00000015573	ENST00000367976.3:c.219A>C	6.37:g.132271980T>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	3	3	NM_001901	0	0	0	0	0	E1P578|Q6LCY0|Q96A79|Q96QX2|Q9UDL6	Silent	SNP	ENST00000367976.3	37	CCDS5151.1																																																																																			T|0.000;G|1.000		0.716	CTGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042239.2	NM_001901	
MAP7	9053	hgsc.bcm.edu	37	6	136682172	136682172	+	Missense_Mutation	SNP	G	G	A	rs2076190	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr6:136682172G>A	ENST00000354570.3	-	12	2082	c.1672C>T	c.(1672-1674)Cgg>Tgg	p.R558W	MAP7_ENST00000454590.1_Missense_Mutation_p.R580W|MAP7_ENST00000544465.1_Missense_Mutation_p.R543W|MAP7_ENST00000438100.2_Missense_Mutation_p.R543W|MAP7_ENST00000432797.2_Missense_Mutation_p.R412W	NM_001198616.1|NM_001198617.1|NM_001198619.1|NM_003980.4	NP_001185545.1|NP_001185546.1|NP_001185548.1|NP_003971.1	Q14244	MAP7_HUMAN	microtubule-associated protein 7	558			R -> W (in dbSNP:rs2076190). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|establishment or maintenance of cell polarity (GO:0007163)|fertilization (GO:0009566)|germ cell development (GO:0007281)|glycosphingolipid metabolic process (GO:0006687)|homeostasis of number of cells (GO:0048872)|Leydig cell differentiation (GO:0033327)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|nucleus organization (GO:0006997)|organ growth (GO:0035265)|protein localization to plasma membrane (GO:0072659)|response to osmotic stress (GO:0006970)|response to retinoic acid (GO:0032526)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)|structural molecule activity (GO:0005198)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(11)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00199)|OV - Ovarian serous cystadenocarcinoma(155;0.00643)		GCCTCCTCCCGCTCGCGCAGC	0.761													G|||	3864	0.771565	0.7156	0.8026	5008	,	,		9294	0.6736		0.8459	False		,,,				2504	0.8497				p.R588W		.											.	MAP7-90	0			c.C1762T						.	G	TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG	3211,1131		1187,837,147	7.0	8.0	8.0		1738,1762,1627,1738,1627,1561,1390,1234,1234,1672	2.8	1.0	6	dbSNP_96	8	7130,1264		3035,1060,102	no	missense,missense,missense,missense,missense,missense,missense,missense,missense,missense	MAP7	NM_001198608.1,NM_001198609.1,NM_001198611.1,NM_001198614.1,NM_001198615.1,NM_001198616.1,NM_001198617.1,NM_001198618.1,NM_001198619.1,NM_003980.4	101,101,101,101,101,101,101,101,101,101	4222,1897,249	AA,AG,GG		15.0584,26.0479,18.805	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	580/772,588/780,543/735,580/772,543/735,521/713,464/656,412/604,412/604,558/750	136682172	10341,2395	2171	4197	6368	SO:0001583	missense	9053	exon12			CCTCCCGCTCGCG	X73882	CCDS5178.1, CCDS56452.1, CCDS56453.1, CCDS56454.1, CCDS56455.1, CCDS75527.1, CCDS75528.1, CCDS75529.1	6q23.2	2008-07-28			ENSG00000135525	ENSG00000135525			6869	protein-coding gene	gene with protein product		604108				8408219	Standard	NM_003980		Approved	E-MAP-115	uc011edg.2	Q14244	OTTHUMG00000015646	ENST00000354570.3:c.1672C>T	6.37:g.136682172G>A	ENSP00000346581:p.Arg558Trp	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	13	10	NM_001198609	0	0	0	2	2	B7Z290|B7Z400|B7Z5S7|B7Z9U7|C9JPS0|E9PCP3|F5H1E2|Q7Z6S0|Q8TAU5|Q9NY82|Q9NY83	Missense_Mutation	SNP	ENST00000354570.3	37	CCDS5178.1	1644	0.7527472527472527	337	0.6849593495934959	282	0.7790055248618785	382	0.6678321678321678	643	0.8482849604221636	G	14.45	2.539239	0.45176	0.739521	0.849416	ENSG00000135525	ENST00000354570;ENST00000454590;ENST00000544465;ENST00000438100;ENST00000432797;ENST00000345567	T;T;T;T;T	0.26067	1.76;1.76;1.76;1.76;1.76	4.89	2.78	0.32641	.	0.296091	0.22491	N	0.059376	T	0.35189	0.0923	M	0.82517	2.595	0.26264	P	0.9785292	D;D;D;D;D;D	0.76494	0.995;0.994;0.995;0.999;0.998;0.998	P;P;P;P;P;P	0.60886	0.751;0.636;0.751;0.809;0.809;0.88	T	0.38779	-0.9645	9	0.52906	T	0.07	-5.3629	10.9226	0.47174	0.0:0.0:0.3457:0.6543	rs2076190;rs2230172;rs6928528	543;543;580;464;521;558	B7Z290;F5H1E2;E9PCP3;F8W783;Q14244-2;Q14244	.;.;.;.;.;MAP7_HUMAN	W	558;580;543;543;412;464	ENSP00000346581:R558W;ENSP00000414712:R580W;ENSP00000445737:R543W;ENSP00000400790:R543W;ENSP00000414879:R412W	ENSP00000344217:R464W	R	-	1	2	MAP7	136723865	0.441000	0.25626	0.960000	0.40013	0.620000	0.37586	1.543000	0.36147	0.988000	0.38734	0.555000	0.69702	CGG	G|0.243;A|0.757		0.761	MAP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042382.2	NM_003980	
NHSL1	57224	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	138753527	138753527	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr6:138753527G>A	ENST00000427025.2	-	5	2595	c.1967C>T	c.(1966-1968)tCc>tTc	p.S656F	MIR3145_ENST00000580727.1_RNA|NHSL1_ENST00000343505.5_Missense_Mutation_p.S652F	NM_020464.1	NP_065197.1	Q5SYE7	NHSL1_HUMAN	NHS-like 1	656										breast(2)|endometrium(4)|kidney(1)	7						CTGGTAATTGGACCGGTCCCC	0.507																																					p.S656F		.											.	NHSL1-68	0			c.C1967T						.						202.0	177.0	184.0					6																	138753527		692	1591	2283	SO:0001583	missense	57224	exon5			TAATTGGACCGGT	AB037778	CCDS47487.1, CCDS55063.1	6q23.3	2009-02-18	2004-10-07	2004-10-07	ENSG00000135540	ENSG00000135540			21021	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 63"""	C6orf63			Standard	NM_001144060		Approved	bA43P8.1, KIAA1357	uc011edp.2	Q5SYE7	OTTHUMG00000016321	ENST00000427025.2:c.1967C>T	6.37:g.138753527G>A	ENSP00000394546:p.Ser656Phe	Somatic	29	0		WXS	Illumina GAIIx	Phase_I	23	13	NM_020464	0	0	0	0	0	Q3ZCS5|Q5SYE8|Q9P2J0	Missense_Mutation	SNP	ENST00000427025.2	37	CCDS55063.1	.	.	.	.	.	.	.	.	.	.	G	9.559	1.118000	0.20877	.	.	ENSG00000135540	ENST00000427025;ENST00000343505	T;T	0.39056	1.1;1.58	5.0	4.12	0.48240	.	1.125910	0.06526	N	0.740529	T	0.25680	0.0625	L	0.47716	1.5	0.09310	N	1	P;P	0.40398	0.716;0.716	B;B	0.37144	0.242;0.242	T	0.25606	-1.0127	10	0.66056	D	0.02	0.0102	14.2736	0.66166	0.0759:0.0:0.9241:0.0	.	652;656	E2QRJ1;Q5SYE7	.;NHSL1_HUMAN	F	656;652	ENSP00000394546:S656F;ENSP00000344672:S652F	ENSP00000344672:S652F	S	-	2	0	NHSL1	138795220	0.218000	0.23608	0.009000	0.14445	0.020000	0.10135	2.969000	0.49232	2.472000	0.83506	0.655000	0.94253	TCC	.		0.507	NHSL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043700.2	XM_050421	
ADGB	79747	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	147022084	147022084	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr6:147022084G>T	ENST00000397944.3	+	13	1661	c.1585G>T	c.(1585-1587)Gtg>Ttg	p.V529L	ADGB_ENST00000367493.3_5'UTR	NM_024694.3	NP_078970.3	Q8N7X0	ADGB_HUMAN	androglobin	529					oxygen transport (GO:0015671)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)			breast(1)|endometrium(2)|kidney(2)	5						TAGGCATTTTGTGCGCTCCTT	0.348																																					p.V529L		.											.	.	0			c.G1585T						.						241.0	223.0	229.0					6																	147022084		692	1591	2283	SO:0001583	missense	79747	exon13			CATTTTGTGCGCT	AK026774		6q24.2	2012-02-03	2012-02-03	2012-02-03	ENSG00000118492	ENSG00000118492			21212	protein-coding gene	gene with protein product		614630	"""chromosome 6 open reading frame 103"""	C6orf103		22115833	Standard	NM_024694		Approved	FLJ23121, dJ408K24.1	uc010khx.3	Q8N7X0	OTTHUMG00000015758	ENST00000397944.3:c.1585G>T	6.37:g.147022084G>T	ENSP00000381036:p.Val529Leu	Somatic	67	0		WXS	Illumina GAIIx	Phase_I	67	10	NM_024694	0	0	0	0	0	Q5T402|Q5T904|Q5T905	Missense_Mutation	SNP	ENST00000397944.3	37		.	.	.	.	.	.	.	.	.	.	G	5.071	0.198671	0.09652	.	.	ENSG00000118492	ENST00000397944	T	0.30448	1.53	4.21	0.461	0.16689	Peptidase C2, calpain, catalytic domain (1);	0.962925	0.08592	N	0.922838	T	0.10423	0.0255	L	0.57536	1.79	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.34354	-0.9832	10	0.34782	T	0.22	-13.3897	4.1989	0.10457	0.3859:0.1676:0.4465:0.0	.	529	Q8N7X0	CAN7L_HUMAN	L	529	ENSP00000381036:V529L	ENSP00000381036:V529L	V	+	1	0	C6orf103	147063777	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	0.148000	0.16224	0.059000	0.16252	-0.216000	0.12614	GTG	.		0.348	ADGB-009	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376350.2	NM_024694	
IPCEF1	26034	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	154533922	154533922	+	Silent	SNP	A	A	T			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr6:154533922A>T	ENST00000265198.4	-	9	671	c.516T>A	c.(514-516)gcT>gcA	p.A172A	OPRM1_ENST00000337049.4_Intron|IPCEF1_ENST00000367220.4_Silent_p.A173A|IPCEF1_ENST00000422970.2_Silent_p.A173A|IPCEF1_ENST00000519344.1_Silent_p.A144A|IPCEF1_ENST00000519091.1_5'UTR	NM_001130700.1|NM_015553.2	NP_001124172.1|NP_056368.1	Q8WWN9	ICEF1_HUMAN	interaction protein for cytohesin exchange factors 1	172					oxidation-reduction process (GO:0055114)|oxygen transport (GO:0015671)|positive regulation of GTP catabolic process (GO:0033126)|response to oxidative stress (GO:0006979)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	oxygen transporter activity (GO:0005344)|peroxidase activity (GO:0004601)			breast(1)|central_nervous_system(2)|endometrium(3)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	12						GAGTCTGGGAAGCGTGAGGAG	0.408																																					p.A173A		.											.	IPCEF1-90	0			c.T519A						.						163.0	147.0	152.0					6																	154533922		2203	4300	6503	SO:0001819	synonymous_variant	26034	exon10			CTGGGAAGCGTGA	AB007863	CCDS5245.1, CCDS47509.1	6q25.2	2013-01-10			ENSG00000074706	ENSG00000074706		"""Pleckstrin homology (PH) domain containing"""	21204	protein-coding gene	gene with protein product	"""phosphoinositide binding protein PIP3-E"""					11804589, 19756519	Standard	NM_001130699		Approved	PIP3-E, KIAA0403	uc021zhc.1	Q8WWN9	OTTHUMG00000015872	ENST00000265198.4:c.516T>A	6.37:g.154533922A>T		Somatic	103	0		WXS	Illumina GAIIx	Phase_I	138	12	NM_001130699	0	0	0	0	0	A8K1K2|B7ZL78|B7ZL80|O43153|Q5HYL8	Silent	SNP	ENST00000265198.4	37	CCDS5245.1																																																																																			.		0.408	IPCEF1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000042789.2	NM_001130699	
ARID1B	57492	hgsc.bcm.edu	37	6	157099362	157099362	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr6:157099362T>A	ENST00000350026.5	+	1	300	c.299T>A	c.(298-300)cTc>cAc	p.L100H	ARID1B_ENST00000275248.4_Missense_Mutation_p.L42H|RP11-230C9.3_ENST00000604792.1_RNA|RP11-230C9.2_ENST00000603191.1_lincRNA|ARID1B_ENST00000367148.1_Missense_Mutation_p.L100H|ARID1B_ENST00000346085.5_Missense_Mutation_p.L100H|MIR4466_ENST00000606121.1_RNA	NM_017519.2	NP_059989.2	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	100	His-rich.				chromatin-mediated maintenance of transcription (GO:0048096)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			NS(2)|breast(5)|central_nervous_system(4)|endometrium(12)|kidney(4)|large_intestine(11)|lung(30)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(3)	81		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		gcccaccacctccaccaccac	0.637																																					p.L100H		.											.	ARID1B-154	0			c.T299A						.						10.0	17.0	15.0					6																	157099362		1859	3596	5455	SO:0001583	missense	57492	exon1			ACCACCTCCACCA	AF521671	CCDS5251.1, CCDS5251.2, CCDS55072.1	6q25.3	2014-09-17			ENSG00000049618	ENSG00000049618		"""-"""	18040	protein-coding gene	gene with protein product		614556					Standard	NM_017519		Approved	KIAA1235, ELD/OSA1, p250R, BAF250b, DAN15, 6A3-5	uc003qqo.3	Q8NFD5	OTTHUMG00000015890	ENST00000350026.5:c.299T>A	6.37:g.157099362T>A	ENSP00000055163:p.Leu100His	Somatic	15	0		WXS	Illumina GAIIx	Phase_I	49	4	NM_017519	0	0	0	0	0	Q5JRD1|Q5VYC4|Q8IZY8|Q8TEV0|Q8TF02|Q99491|Q9ULI5	Missense_Mutation	SNP	ENST00000350026.5	37	CCDS5251.2	.	.	.	.	.	.	.	.	.	.	t	7.657	0.684140	0.14907	.	.	ENSG00000049618	ENST00000346085;ENST00000350026;ENST00000367148;ENST00000275248	T;T;T;T	0.75821	1.18;1.18;1.18;-0.97	2.48	0.998	0.19857	.	.	.	.	.	T	0.26557	0.0649	N	0.17082	0.46	0.23421	N	0.997716	P;P;P	0.43352	0.704;0.804;0.688	B;B;B	0.29440	0.047;0.102;0.102	T	0.28996	-1.0026	9	0.87932	D	0	.	0.197	0.00141	0.2086:0.2495:0.2129:0.329	.	100;100;42	Q8NFD5;Q8NFD5-2;G3XAA0	ARI1B_HUMAN;.;.	H	100;100;100;42	ENSP00000344546:L100H;ENSP00000055163:L100H;ENSP00000356116:L100H;ENSP00000275248:L42H	ENSP00000275248:L42H	L	+	2	0	ARID1B	157141054	0.981000	0.34729	0.995000	0.50966	0.981000	0.71138	0.013000	0.13310	0.890000	0.36211	0.312000	0.20444	CTC	.		0.637	ARID1B-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000372723.1	NM_020732	
PRR18	285800	hgsc.bcm.edu	37	6	166720806	166720806	+	Silent	SNP	G	G	C	rs911203	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr6:166720806G>C	ENST00000322583.3	-	1	1065	c.825C>G	c.(823-825)tcC>tcG	p.S275S		NM_175922.3	NP_787118.2	Q8N4B5	PRR18_HUMAN	proline rich 18	275										haematopoietic_and_lymphoid_tissue(2)|lung(1)	3		Breast(66;2.35e-05)|Ovarian(120;0.0606)|Prostate(117;0.0959)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-19)|BRCA - Breast invasive adenocarcinoma(81;4.45e-06)|GBM - Glioblastoma multiforme(31;7.96e-05)		cggcagccgcggACTCCACGC	0.741													C|||	3992	0.797125	0.8525	0.6196	5008	,	,		7867	0.9206		0.7465	False		,,,				2504	0.773				p.S275S		.											.	PRR18-514	0			c.C825G						.	C		3541,683		1503,535,74	7.0	7.0	7.0		825	2.4	1.0	6	dbSNP_86	7	6180,2074		2355,1470,302	no	coding-synonymous	PRR18	NM_175922.3		3858,2005,376	CC,CG,GG		25.1272,16.1695,22.0949		275/296	166720806	9721,2757	2112	4127	6239	SO:0001819	synonymous_variant	285800	exon1			AGCCGCGGACTCC	BC034775	CCDS5291.1	6q27	2009-01-27	2009-01-27						28574	protein-coding gene	gene with protein product			"""proline rich region 18"""			12477932	Standard	NM_175922		Approved	MGC35308	uc003quw.1	Q8N4B5		ENST00000322583.3:c.825C>G	6.37:g.166720806G>C		Somatic	1	1		WXS	Illumina GAIIx	Phase_I	2	2	NM_175922	0	0	0	0	0		Silent	SNP	ENST00000322583.3	37	CCDS5291.1																																																																																			G|0.796;C|0.204		0.741	PRR18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392563.3	NM_175922	
TBP	6908	hgsc.bcm.edu	37	6	170871004	170871004	+	Silent	SNP	G	G	A			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr6:170871004G>A	ENST00000392092.2	+	3	459	c.180G>A	c.(178-180)caG>caA	p.Q60Q	TBP_ENST00000540980.1_Silent_p.Q40Q|TBP_ENST00000230354.6_Silent_p.Q60Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	60	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		Ggcagcagcagcaacaacaac	0.542																																					p.Q60Q		.											.	TBP-91	0			c.G180A						.						43.0	45.0	44.0					6																	170871004		2203	4300	6503	SO:0001819	synonymous_variant	6908	exon3			GCAGCAGCAACAA	M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.180G>A	6.37:g.170871004G>A		Somatic	61	2		WXS	Illumina GAIIx	Phase_I	87	5	NM_003194	0	0	5	5	0	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	ENST00000392092.2	37	CCDS5315.1																																																																																			.		0.542	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043271.2	NM_003194	
TBP	6908	hgsc.bcm.edu	37	6	170871016	170871016	+	Silent	SNP	G	G	A	rs542031948		TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr6:170871016G>A	ENST00000392092.2	+	3	471	c.192G>A	c.(190-192)caG>caA	p.Q64Q	TBP_ENST00000540980.1_Silent_p.Q44Q|TBP_ENST00000230354.6_Silent_p.Q64Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	64	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		aacaacaacagcagcagcagc	0.557													G|||	1	0.000199681	0.0008	0.0	5008	,	,		14897	0.0		0.0	False		,,,				2504	0.0				p.Q64Q		.											.	TBP-91	0			c.G192A						.						31.0	35.0	33.0					6																	170871016		2202	4292	6494	SO:0001819	synonymous_variant	6908	exon3			ACAACAGCAGCAG	M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.192G>A	6.37:g.170871016G>A		Somatic	57	0		WXS	Illumina GAIIx	Phase_I	94	9	NM_003194	0	0	3	3	0	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	ENST00000392092.2	37	CCDS5315.1																																																																																			.		0.557	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043271.2	NM_003194	
EIF3B	8662	hgsc.bcm.edu	37	7	2394991	2394991	+	Silent	SNP	C	C	T	rs11551167	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr7:2394991C>T	ENST00000360876.4	+	1	491	c.435C>T	c.(433-435)aaC>aaT	p.N145N	EIF3B_ENST00000397011.2_Silent_p.N145N	NM_001037283.1	NP_001032360.1			eukaryotic translation initiation factor 3, subunit B											breast(2)|endometrium(4)|kidney(2)|large_intestine(3)|lung(11)|ovary(1)|skin(1)	24		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0833)|OV - Ovarian serous cystadenocarcinoma(56;7.76e-14)		CGCTGGAGAACGGCGACGCGG	0.756													C|||	1173	0.234225	0.0847	0.1513	5008	,	,		9860	0.2808		0.2704	False		,,,				2504	0.41				p.N145N		.											.	EIF3B-68	0			c.C435T						.	C	,	311,3057		24,263,1397	4.0	4.0	4.0		435,435	0.5	1.0	7	dbSNP_120	4	1454,5336		174,1106,2115	no	coding-synonymous,coding-synonymous	EIF3B	NM_001037283.1,NM_003751.3	,	198,1369,3512	TT,TC,CC		21.4138,9.234,17.3755	,	145/815,145/815	2394991	1765,8393	1684	3395	5079	SO:0001819	synonymous_variant	8662	exon1			GGAGAACGGCGAC	U62583	CCDS5332.1	7p22	2013-02-12	2007-07-27	2007-07-27	ENSG00000106263	ENSG00000106263		"""RNA binding motif (RRM) containing"""	3280	protein-coding gene	gene with protein product		603917	"""eukaryotic translation initiation factor 3, subunit 9 eta, 116kDa"""	EIF3S9		8995410	Standard	NM_001037283		Approved	PRT1, eIF3b	uc003sly.3	P55884	OTTHUMG00000022839	ENST00000360876.4:c.435C>T	7.37:g.2394991C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	4	NM_001037283	0	0	4	7	3		Silent	SNP	ENST00000360876.4	37	CCDS5332.1																																																																																			C|0.787;T|0.213		0.756	EIF3B-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207006.1		
TNRC18	84629	broad.mit.edu	37	7	5352548	5352548	+	Silent	SNP	T	T	G	rs112615228		TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr7:5352548T>G	ENST00000430969.1	-	27	8322	c.7974A>C	c.(7972-7974)tcA>tcC	p.S2658S	TNRC18_ENST00000399537.4_Silent_p.S2658S	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	2658	Ser-rich.						chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		aggaggaggatgaggacgagg	0.617																																					p.S2658S		.											.	TNRC18-46	0			c.A7974C						.						7.0	7.0	7.0					7																	5352548		1528	3528	5056	SO:0001819	synonymous_variant	84629	exon27			GGAGGATGAGGAC	U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.7974A>C	7.37:g.5352548T>G		Somatic	43	0		WXS	Illumina GAIIx	Phase_I	85	3	NM_001080495	0	0	0	0	0	A8MX41|Q96JH1|Q96K91	Silent	SNP	ENST00000430969.1	37	CCDS47534.1	.	.	.	.	.	.	.	.	.	.	N	0.011	-1.737644	0.00681	.	.	ENSG00000182095	ENST00000399544	.	.	.	.	.	.	.	.	.	.	.	T	0.63379	0.2506	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.63655	-0.6588	3	0.87932	D	0	.	.	.	.	.	.	.	.	P	1171	.	ENSP00000382459:H1171P	H	-	2	0	TNRC18	5319074	0.757000	0.28394	0.042000	0.18584	0.026000	0.11368	0.000000	0.12993	0.000000	0.14550	0.000000	0.15137	CAT	T|0.500;A|0.500		0.617	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
SP8	221833	hgsc.bcm.edu	37	7	20824953	20824953	+	Silent	SNP	G	G	C			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr7:20824953G>C	ENST00000361443.4	-	3	666	c.429C>G	c.(427-429)ggC>ggG	p.G143G	SP8_ENST00000418710.2_Silent_p.G161G	NM_198956.2	NP_945194.1	Q8IXZ3	SP8_HUMAN	Sp8 transcription factor	143					dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|proximal/distal pattern formation (GO:0009954)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|large_intestine(2)|lung(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	8						cgccgccgccgcccccgccgc	0.736																																					p.G161G		.											.	SP8-91	0			c.C483G						.						2.0	2.0	2.0					7																	20824953		584	1454	2038	SO:0001819	synonymous_variant	221833	exon2			GCCGCCGCCCCCG		CCDS5372.1, CCDS43555.1	7p21.2	2013-01-08			ENSG00000164651	ENSG00000164651		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	19196	protein-coding gene	gene with protein product		608306					Standard	NM_182700		Approved		uc003suz.3	Q8IXZ3	OTTHUMG00000094788	ENST00000361443.4:c.429C>G	7.37:g.20824953G>C		Somatic	5	0		WXS	Illumina GAIIx	Phase_I	12	3	NM_182700	0	0	0	0	0	Q7Z615|Q7Z616|Q96MJ1	Silent	SNP	ENST00000361443.4	37	CCDS5372.1																																																																																			.		0.736	SP8-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326904.2		
GLI3	2737	hgsc.bcm.edu	37	7	42005678	42005678	+	Missense_Mutation	SNP	G	G	A	rs929387	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr7:42005678G>A	ENST00000395925.3	-	15	3077	c.2993C>T	c.(2992-2994)cCg>cTg	p.P998L	GLI3_ENST00000479210.1_5'UTR	NM_000168.5	NP_000159.3	P10071	GLI3_HUMAN	GLI family zinc finger 3	998			P -> L (in dbSNP:rs929387). {ECO:0000269|PubMed:10441342, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:2118997}.		anterior semicircular canal development (GO:0060873)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye morphogenesis (GO:0048593)|cell differentiation involved in kidney development (GO:0061005)|cerebral cortex radial glia guided migration (GO:0021801)|developmental growth (GO:0048589)|embryonic digestive tract development (GO:0048566)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain radial glial cell differentiation (GO:0021861)|frontal suture morphogenesis (GO:0060364)|heart development (GO:0007507)|hindgut morphogenesis (GO:0007442)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|lambdoid suture morphogenesis (GO:0060366)|lateral ganglionic eminence cell proliferation (GO:0022018)|lateral semicircular canal development (GO:0060875)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|mammary gland specification (GO:0060594)|melanocyte differentiation (GO:0030318)|metanephros development (GO:0001656)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative thymic T cell selection (GO:0045060)|nose morphogenesis (GO:0043585)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte differentiation (GO:0048709)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein processing (GO:0016485)|proximal/distal pattern formation (GO:0009954)|response to estrogen (GO:0043627)|sagittal suture morphogenesis (GO:0060367)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)|T cell differentiation in thymus (GO:0033077)|thymocyte apoptotic process (GO:0070242)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|primary cilium (GO:0072372)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|biliary_tract(1)|breast(4)|central_nervous_system(2)|endometrium(12)|kidney(7)|large_intestine(25)|lung(49)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	112						GCCGTGGCCCGGCGCATCGTG	0.746									Pallister-Hall syndrome;Greig Cephalopolysyndactyly				G|||	2111	0.421526	0.1619	0.4424	5008	,	,		11700	0.7688		0.3161	False		,,,				2504	0.5082				p.P998L		.											.	GLI3-1149	0			c.C2993T						.	G	LEU/PRO	654,2960		69,516,1222	4.0	5.0	5.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	2993	3.8	0.2	7	dbSNP_86	5	2170,5232		331,1508,1862	no	missense	GLI3	NM_000168.5	98	400,2024,3084	AA,AG,GG		29.3164,18.0963,25.6354	benign	998/1581	42005678	2824,8192	1807	3701	5508	SO:0001583	missense	2737	exon15	Familial Cancer Database	;	TGGCCCGGCGCAT		CCDS5465.1	7p13	2013-01-25	2009-03-05		ENSG00000106571	ENSG00000106571		"""Zinc fingers, C2H2-type"""	4319	protein-coding gene	gene with protein product	"""zinc finger protein GLI3"", ""oncogene GLI3"", ""DNA-binding protein"""	165240	"""Greig cephalopolysyndactyly syndrome"", ""GLI-Kruppel family member GLI3"", ""glioma-associated oncogene family zinc finger 3"""	GCPS, PHS		2118997	Standard	NM_000168		Approved	PAP-A, PAPA, PAPA1, PAPB, ACLS, PPDIV	uc011kbh.2	P10071	OTTHUMG00000023630	ENST00000395925.3:c.2993C>T	7.37:g.42005678G>A	ENSP00000379258:p.Pro998Leu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	3	2	NM_000168	0	0	0	0	0	A4D1W1|O75219|Q17RW4|Q75MT0|Q75MU9|Q9UDT5|Q9UJ39	Missense_Mutation	SNP	ENST00000395925.3	37	CCDS5465.1	917	0.4198717948717949	75	0.1524390243902439	153	0.42265193370165743	451	0.7884615384615384	238	0.31398416886543534	G	1.729	-0.494582	0.04322	0.180963	0.293164	ENSG00000106571	ENST00000395925	T	0.15256	2.44	4.98	3.83	0.44106	.	0.327528	0.33217	N	0.005158	T	0.00012	0.0000	N	0.05554	-0.025	0.09310	P	0.9999999999224007	B	0.06786	0.001	B	0.04013	0.001	T	0.16247	-1.0409	9	0.17369	T	0.5	.	5.4162	0.16376	0.7624:0.0:0.0842:0.1533	rs929387;rs929387	998	P10071	GLI3_HUMAN	L	998	ENSP00000379258:P998L	ENSP00000379258:P998L	P	-	2	0	GLI3	41972203	1.000000	0.71417	0.171000	0.22900	0.021000	0.10359	4.758000	0.62220	0.733000	0.32492	-0.471000	0.05019	CCG	G|0.565;A|0.435		0.746	GLI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250806.3	NM_000168	
RAMP3	10268	hgsc.bcm.edu	37	7	45197433	45197433	+	Silent	SNP	G	G	A	rs67477213	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr7:45197433G>A	ENST00000242249.4	+	1	44	c.6G>A	c.(4-6)gaG>gaA	p.E2E	RAMP3_ENST00000496212.1_Silent_p.E2E|RAMP3_ENST00000481345.1_Silent_p.E2E	NM_005856.2	NP_005847.1	O60896	RAMP3_HUMAN	receptor (G protein-coupled) activity modifying protein 3	2					calcium ion transport (GO:0006816)|cellular response to estradiol stimulus (GO:0071392)|G-protein coupled receptor signaling pathway involved in heart process (GO:0086103)|intracellular protein transport (GO:0006886)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of receptor recycling (GO:0001921)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|receptor internalization (GO:0031623)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	coreceptor activity (GO:0015026)|protein transporter activity (GO:0008565)|receptor activity (GO:0004872)			breast(1)|endometrium(1)|large_intestine(4)|lung(4)|stomach(1)	11					Pramlintide(DB01278)	CAGCCATGGAGACTGGAGCGC	0.771													G|||	1244	0.248403	0.4947	0.1657	5008	,	,		7876	0.0159		0.2276	False		,,,				2504	0.2352				p.E2E		.											.	RAMP3-90	0			c.G6A						.	G		1194,2386		196,802,792	3.0	3.0	3.0		6	2.0	0.0	7	dbSNP_130	3	1312,6004		141,1030,2487	no	coding-synonymous	RAMP3	NM_005856.2		337,1832,3279	AA,AG,GG		17.9333,33.352,22.9993		2/149	45197433	2506,8390	1790	3658	5448	SO:0001819	synonymous_variant	10268	exon1			CATGGAGACTGGA	AJ001016	CCDS5503.1	7p13-p12	2006-11-21	2006-11-21		ENSG00000122679	ENSG00000122679		"""Receptor (G protein-coupled) activity modifying proteins"""	9845	protein-coding gene	gene with protein product		605155	"""receptor activity modifying protein 3"", ""receptor (calcitonin) activity modifying protein 3"""				Standard	NM_005856		Approved		uc003tnb.3	O60896	OTTHUMG00000023729	ENST00000242249.4:c.6G>A	7.37:g.45197433G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	11	3	NM_005856	0	0	4	7	3	Q7Z2Y1	Silent	SNP	ENST00000242249.4	37	CCDS5503.1																																																																																			G|0.760;A|0.240		0.771	RAMP3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251343.1	NM_005856	
CALD1	800	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	134644847	134644847	+	Silent	SNP	A	A	G			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr7:134644847A>G	ENST00000361675.2	+	12	2413	c.2184A>G	c.(2182-2184)gcA>gcG	p.A728A	CALD1_ENST00000543443.1_Silent_p.A478A|CALD1_ENST00000424922.1_Silent_p.A467A|CALD1_ENST00000393118.2_Silent_p.A493A|CALD1_ENST00000466704.1_3'UTR|CALD1_ENST00000361388.2_Silent_p.A499A|CALD1_ENST00000422748.1_Silent_p.A498A|CALD1_ENST00000361901.2_Silent_p.A473A|CALD1_ENST00000417172.1_Silent_p.A473A|CALD1_ENST00000495522.1_Silent_p.A492A			Q05682	CALD1_HUMAN	caldesmon 1	728					cellular component movement (GO:0006928)|muscle contraction (GO:0006936)	actin cap (GO:0030478)|actin cytoskeleton (GO:0015629)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|calmodulin binding (GO:0005516)|tropomyosin binding (GO:0005523)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(15)|lung(10)	43						CCACTGCAGCAGGCACACCAA	0.443																																					p.A728A		.											.	CALD1-226	0			c.A2184G						.						123.0	105.0	111.0					7																	134644847		2203	4300	6503	SO:0001819	synonymous_variant	800	exon12			TGCAGCAGGCACA	M64110	CCDS5834.1, CCDS5835.1, CCDS5836.1, CCDS47716.1, CCDS47717.1, CCDS5836.2	7q33	2007-04-23			ENSG00000122786	ENSG00000122786			1441	protein-coding gene	gene with protein product		114213				1885618	Standard	NM_004342		Approved	CDM, H-CAD, L-CAD	uc003vrz.3	Q05682	OTTHUMG00000155407	ENST00000361675.2:c.2184A>G	7.37:g.134644847A>G		Somatic	185	0		WXS	Illumina GAIIx	Phase_I	224	43	NM_033138	0	0	4	4	0	A8K0X1|Q13978|Q13979|Q14741|Q14742|Q9UD91	Silent	SNP	ENST00000361675.2	37	CCDS5835.1																																																																																			.		0.443	CALD1-005	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339939.1	NM_033138	
KIAA1549	57670	bcgsc.ca	37	7	138602432	138602432	+	Missense_Mutation	SNP	G	G	C	rs61734132	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr7:138602432G>C	ENST00000422774.1	-	2	1988	c.1940C>G	c.(1939-1941)tCt>tGt	p.S647C	KIAA1549_ENST00000440172.1_Missense_Mutation_p.S647C|KIAA1549_ENST00000242365.4_Missense_Mutation_p.S597C			Q9HCM3	K1549_HUMAN	KIAA1549	647	Ser-rich.					integral component of membrane (GO:0016021)			KIAA1549/BRAF(703)	large_intestine(4)|pancreas(1)|upper_aerodigestive_tract(2)	7						CAGAGACAGAGACGCAGGTGC	0.498			O	BRAF	pilocytic astrocytoma								G|||	266	0.053115	0.0257	0.0245	5008	,	,		20591	0.0		0.0706	False		,,,				2504	0.1472				p.S647C	NSCLC(119;1534 1718 44213 46230 50068)	.		Dom	yes		7	7q34	57670	KIAA1549		O	.	KIAA1549-369	0			c.C1940G						.	G	CYS/SER,CYS/SER	114,3822		0,114,1854	33.0	36.0	35.0		1940,1940	1.1	0.0	7	dbSNP_129	35	574,7742		25,524,3609	yes	missense,missense	KIAA1549	NM_001164665.1,NM_020910.2	112,112	25,638,5463	CC,CG,GG		6.9024,2.8963,5.6154	possibly-damaging,possibly-damaging	647/1951,647/1935	138602432	688,11564	1968	4158	6126	SO:0001583	missense	57670	exon2			GACAGAGACGCAG		CCDS47723.1, CCDS47723.2, CCDS56513.1	7q34	2009-10-09			ENSG00000122778	ENSG00000122778			22219	protein-coding gene	gene with protein product		613344					Standard	NM_020910		Approved		uc011kql.2	Q9HCM3	OTTHUMG00000157214	ENST00000422774.1:c.1940C>G	7.37:g.138602432G>C	ENSP00000416040:p.Ser647Cys	Somatic	92	1		WXS	Illumina GAIIx	Phase_I	67	4	NM_020910	0	0	0	0	0	B6HY55|B6HY56|B6HY58|B6HY60|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q5BJD6|Q8IY15|Q9H0M3	Missense_Mutation	SNP	ENST00000422774.1	37	CCDS56513.1	69	0.03159340659340659	7	0.014227642276422764	11	0.03038674033149171	0	0.0	51	0.06728232189973615	G	13.82	2.350317	0.41599	0.028963	0.069024	ENSG00000122778	ENST00000440172;ENST00000242365;ENST00000422774	T;T;T	0.26660	1.72;1.73;1.73	4.25	1.11	0.20524	.	0.852017	0.10173	N	0.706894	T	0.02193	0.0068	N	0.24115	0.695	0.09310	N	1	D;D	0.65815	0.992;0.995	P;P	0.58873	0.707;0.847	T	0.08827	-1.0703	10	0.54805	T	0.06	.	7.3179	0.26511	0.3422:0.0:0.6578:0.0	rs61734132	647;647	Q9HCM3;Q9HCM3-2	K1549_HUMAN;.	C	647;597;647	ENSP00000406661:S647C;ENSP00000242365:S597C;ENSP00000416040:S647C	ENSP00000242365:S597C	S	-	2	0	KIAA1549	138252972	0.002000	0.14202	0.001000	0.08648	0.009000	0.06853	0.901000	0.28445	0.427000	0.26145	0.591000	0.81541	TCT	G|0.937;C|0.063		0.498	KIAA1549-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348092.1		
GBX1	2636	hgsc.bcm.edu	37	7	150864240	150864240	+	Silent	SNP	G	G	C	rs13241978	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr7:150864240G>C	ENST00000297537.4	-	1	395	c.396C>G	c.(394-396)gcC>gcG	p.A132A	GBX1_ENST00000475831.1_5'UTR	NM_001098834.1	NP_001092304.1	Q14549	GBX1_HUMAN	gastrulation brain homeobox 1	132	Ala-rich.|Pro-rich.				adult walking behavior (GO:0007628)|neuron fate commitment (GO:0048663)|proprioception (GO:0019230)|regulation of transcription, DNA-templated (GO:0006355)|sensory neuron axon guidance (GO:0097374)|spinal cord motor neuron differentiation (GO:0021522)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			large_intestine(1)|lung(5)|skin(1)	7			OV - Ovarian serous cystadenocarcinoma(82;0.00989)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TGTTTCGggcggcagtggcgg	0.751													G|||	1447	0.288938	0.3971	0.3069	5008	,	,		9229	0.3433		0.2217	False		,,,				2504	0.1431				p.A132A		.											.	GBX1-68	0			c.C396G						.	G		1127,2329		197,733,798	7.0	10.0	9.0		396	0.2	0.0	7	dbSNP_121	9	1736,6108		240,1256,2426	no	coding-synonymous	GBX1	NM_001098834.1		437,1989,3224	CC,CG,GG		22.1316,32.61,25.3363		132/364	150864240	2863,8437	1728	3922	5650	SO:0001819	synonymous_variant	2636	exon1			TCGGGCGGCAGTG	L11239	CCDS43682.1	7q36.1	2012-03-09	2005-12-22		ENSG00000164900	ENSG00000164900		"""Homeoboxes / ANTP class : HOXL subclass"""	4185	protein-coding gene	gene with protein product		603354	"""gastrulation brain homeo box 1"""			7903253	Standard	NM_001098834		Approved		uc011kvg.2	Q14549	OTTHUMG00000158751	ENST00000297537.4:c.396C>G	7.37:g.150864240G>C		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_001098834	0	0	0	0	0		Silent	SNP	ENST00000297537.4	37	CCDS43682.1																																																																																			G|0.699;C|0.301		0.751	GBX1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352029.1		
MSR1	4481	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	16032762	16032762	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr8:16032762C>T	ENST00000262101.5	-	3	272	c.151G>A	c.(151-153)Gct>Act	p.A51T	MSR1_ENST00000445506.2_Missense_Mutation_p.A69T|MSR1_ENST00000381998.4_Missense_Mutation_p.A51T|MSR1_ENST00000355282.2_Missense_Mutation_p.A51T|MSR1_ENST00000350896.3_Missense_Mutation_p.A51T|MSR1_ENST00000536385.1_Intron			P21757	MSRE_HUMAN	macrophage scavenger receptor 1	51					cholesterol transport (GO:0030301)|lipoprotein transport (GO:0042953)|plasma lipoprotein particle clearance (GO:0034381)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|receptor-mediated endocytosis (GO:0006898)	collagen trimer (GO:0005581)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|plasma membrane (GO:0005886)	low-density lipoprotein particle binding (GO:0030169)|scavenger receptor activity (GO:0005044)			haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(7)|lung(14)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	37				Colorectal(111;0.00475)|COAD - Colon adenocarcinoma(73;0.0164)		ATCAGTGCAGCTTTGAAGGAC	0.413																																					p.A51T		.											.	MSR1-91	0			c.G151A						.						159.0	153.0	155.0					8																	16032762		2203	4300	6503	SO:0001583	missense	4481	exon3			GTGCAGCTTTGAA	D13263	CCDS5995.1, CCDS5996.1, CCDS5997.1	8p22	2006-02-22			ENSG00000038945	ENSG00000038945		"""CD molecules"""	7376	protein-coding gene	gene with protein product		153622				2251254	Standard	NM_138715		Approved	SCARA1, CD204	uc003wwz.3	P21757	OTTHUMG00000094809	ENST00000262101.5:c.151G>A	8.37:g.16032762C>T	ENSP00000262101:p.Ala51Thr	Somatic	124	1		WXS	Illumina GAIIx	Phase_I	113	31	NM_138715	0	0	1	1	0	D3DSP3|O60505|P21759|Q45F10	Missense_Mutation	SNP	ENST00000262101.5	37	CCDS5995.1	.	.	.	.	.	.	.	.	.	.	C	13.12	2.141206	0.37825	.	.	ENSG00000038945	ENST00000350896;ENST00000262101;ENST00000445506;ENST00000355282;ENST00000381998;ENST00000518960	D;D;D;D;D;T	0.90261	-2.28;-2.04;-2.03;-2.28;-2.64;1.33	5.34	-1.29	0.09288	Macrophage scavenger receptor (1);	0.767730	0.11909	N	0.517875	D	0.83353	0.5236	L	0.42245	1.32	0.09310	N	1	B;B;B;B	0.26081	0.01;0.041;0.141;0.01	B;B;B;B	0.22753	0.007;0.016;0.041;0.007	T	0.67321	-0.5700	10	0.21014	T	0.42	.	8.6678	0.34132	0.0:0.3701:0.0:0.6299	.	69;51;51;51	B4DDJ5;P21757-2;P21757-3;P21757	.;.;.;MSRE_HUMAN	T	51;51;69;51;51;51	ENSP00000262100:A51T;ENSP00000262101:A51T;ENSP00000405453:A69T;ENSP00000347430:A51T;ENSP00000371428:A51T;ENSP00000427905:A51T	ENSP00000262101:A51T	A	-	1	0	MSR1	16077133	0.011000	0.17503	0.295000	0.24960	0.968000	0.65278	-1.210000	0.02999	-0.114000	0.11936	0.650000	0.86243	GCT	.		0.413	MSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211627.2		
PXDNL	137902	hgsc.bcm.edu	37	8	52321843	52321843	+	Missense_Mutation	SNP	G	G	C	rs11992240	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr8:52321843G>C	ENST00000356297.4	-	17	2441	c.2341C>G	c.(2341-2343)Cgg>Ggg	p.R781G	PXDNL_ENST00000543296.1_Missense_Mutation_p.R781G	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	781				R -> G (in Ref. 4; BAD18663). {ECO:0000305}.	hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				GCGACCAGCCGGGGCGGCGGG	0.746													G|||	704	0.140575	0.1241	0.0735	5008	,	,		8329	0.2768		0.0895	False		,,,				2504	0.1227				p.R781G		.											.	PXDNL-70	0			c.C2341G						.	G	GLY/ARG	295,2709		13,269,1220	4.0	4.0	4.0		2341	2.4	0.1	8	dbSNP_120	4	438,6260		13,412,2924	no	missense	PXDNL	NM_144651.4	125	26,681,4144	CC,CG,GG		6.5393,9.8202,7.5551	probably-damaging	781/1464	52321843	733,8969	1502	3349	4851	SO:0001583	missense	137902	exon17			CCAGCCGGGGCGG		CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.2341C>G	8.37:g.52321843G>C	ENSP00000348645:p.Arg781Gly	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	6	NM_144651	0	0	0	0	0	B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Missense_Mutation	SNP	ENST00000356297.4	37	CCDS47855.1	333	0.15247252747252749	81	0.16463414634146342	29	0.08011049723756906	152	0.26573426573426573	71	0.09366754617414248	G	14.76	2.632963	0.47049	0.098202	0.065393	ENSG00000147485	ENST00000356297;ENST00000543296	T;T	0.72505	-0.66;-0.66	3.62	2.44	0.29823	.	.	.	.	.	T	0.00073	0.0002	H	0.99104	4.43	0.37278	P	0.09228000000000003	D	0.89917	1.0	D	0.97110	1.0	T	0.07849	-1.0751	8	0.87932	D	0	.	8.0524	0.30585	0.0:0.0:0.4354:0.5646	rs11992240	781	A1KZ92	PXDNL_HUMAN	G	781	ENSP00000348645:R781G;ENSP00000444865:R781G	ENSP00000348645:R781G	R	-	1	2	PXDNL	52484396	0.660000	0.27420	0.096000	0.21009	0.007000	0.05969	0.459000	0.21908	0.396000	0.25283	-0.516000	0.04426	CGG	G|0.840;C|0.160		0.746	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377905.1	NM_144651	
FZD6	8323	bcgsc.ca	37	8	104343686	104343686	+	Silent	SNP	G	G	A	rs1053917	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr8:104343686G>A	ENST00000358755.4	+	7	2387	c.2070G>A	c.(2068-2070)ccG>ccA	p.P690P	FZD6_ENST00000540287.1_Silent_p.P385P|FZD6_ENST00000523739.1_Silent_p.P658P|FZD6_ENST00000522566.1_Silent_p.P690P	NM_001164616.1|NM_003506.3	NP_001158088.1|NP_003497.2	O60353	FZD6_HUMAN	frizzled class receptor 6	690					angiogenesis (GO:0001525)|axonogenesis (GO:0007409)|cell proliferation in midbrain (GO:0033278)|embryonic nail plate morphogenesis (GO:0035880)|establishment of planar polarity (GO:0001736)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|hair follicle development (GO:0001942)|inner ear morphogenesis (GO:0042472)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|neural tube closure (GO:0001843)|non-canonical Wnt signaling pathway (GO:0035567)|platelet activation (GO:0030168)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	apical part of cell (GO:0045177)|apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|ubiquitin protein ligase binding (GO:0031625)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(8)|prostate(1)|skin(1)|urinary_tract(1)	24			OV - Ovarian serous cystadenocarcinoma(57;2.86e-05)|STAD - Stomach adenocarcinoma(118;0.197)			TTGTTCACCCGGTTTCAGGAG	0.458													g|||	2193	0.437899	0.2829	0.5043	5008	,	,		18114	0.627		0.4493	False		,,,				2504	0.3937				p.P690P		.											.	FZD6-658	0			c.G2070A						.	A	,,	1291,3115	436.4+/-344.6	174,943,1086	115.0	108.0	110.0		2070,1974,2070	-11.4	0.0	8	dbSNP_86	110	3992,4608	552.9+/-386.2	940,2112,1248	no	coding-synonymous,coding-synonymous,coding-synonymous	FZD6	NM_001164615.1,NM_001164616.1,NM_003506.3	,,	1114,3055,2334	AA,AG,GG		46.4186,29.301,40.6197	,,	690/707,658/675,690/707	104343686	5283,7723	2203	4300	6503	SO:0001819	synonymous_variant	8323	exon7			TCACCCGGTTTCA	AB012911	CCDS6298.1, CCDS55268.1	8q22.3-q23.1	2014-01-29	2014-01-29		ENSG00000164930	ENSG00000164930		"""GPCR / Class F : Frizzled receptors"""	4044	protein-coding gene	gene with protein product		603409	"""frizzled (Drosophila) homolog 6"", ""frizzled homolog 6 (Drosophila)"", ""frizzled 6, seven transmembrane spanning receptor"", ""frizzled family receptor 6"""			9480858, 14747478	Standard	NM_003506		Approved	Hfz6	uc003ylh.3	O60353	OTTHUMG00000164840	ENST00000358755.4:c.2070G>A	8.37:g.104343686G>A		Somatic	116	0		WXS	Illumina GAIIx	Phase_I	113	6	NM_003506	0	0	2	2	0	B4DRN0|Q6N0A5|Q6P9C3|Q8WXR9	Silent	SNP	ENST00000358755.4	37	CCDS6298.1																																																																																			G|0.585;A|0.415		0.458	FZD6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380560.1	NM_003506	
ATAD2	29028	hgsc.bcm.edu	37	8	124382159	124382167	+	In_Frame_Del	DEL	TCATCATCA	TCATCATCA	-	rs374184884|rs202042646|rs569952795|rs374075349|rs149531312|rs138100797|rs200740522	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	TCATCATCA	TCATCATCA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr8:124382159_124382167delTCATCATCA	ENST00000287394.5	-	7	932_940	c.825_833delTGATGATGA	c.(823-834)gatgatgatgaa>gaa	p.DDD275del	ATAD2_ENST00000521903.1_De_novo_Start_InFrame|ATAD2_ENST00000534257.1_5'Flank	NM_014109.3	NP_054828.2	Q6PL18	ATAD2_HUMAN	ATPase family, AAA domain containing 2	275	Asp-rich.				ATP catabolic process (GO:0006200)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|lung(16)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	48	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			ttcatcatcttcatcatcatcatcatcat	0.378																																					p.275_278del		.											.	ATAD2-92	0			c.825_833del						.																																			SO:0001651	inframe_deletion	29028	exon7			TCATCTTCATCAT	BC019909	CCDS6343.1	8q24.13	2014-01-21		2007-02-08	ENSG00000156802	ENSG00000156802		"""ATPases / AAA-type"""	30123	protein-coding gene	gene with protein product		611941				12477932	Standard	NM_014109		Approved	PRO2000, DKFZp667N1320, MGC5254, MGC29843, CT137	uc003yqh.4	Q6PL18	OTTHUMG00000165090	ENST00000287394.5:c.825_833delTGATGATGA	8.37:g.124382168_124382176delTCATCATCA	ENSP00000287394:p.Asp275_Asp277del	Somatic	61	0		WXS	Illumina GAIIx	Phase_I	82	21	NM_014109	0	0	0	0	0	Q14CR1|Q658P2|Q68CQ0|Q6PJV6|Q8N890|Q9UHS5	In_Frame_Del	DEL	ENST00000287394.5	37	CCDS6343.1																																																																																			-|0.250;CAT|0.500;CATCAT|0.250		0.378	ATAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381766.2	NM_014109	
ZFAT	57623	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	135622778	135622778	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr8:135622778C>A	ENST00000377838.3	-	4	743	c.569G>T	c.(568-570)aGa>aTa	p.R190I	ZFAT_ENST00000429442.2_Missense_Mutation_p.R178I|ZFAT_ENST00000523399.1_Intron|ZFAT_ENST00000520727.1_Missense_Mutation_p.R178I|ZFAT_ENST00000520356.1_Missense_Mutation_p.R178I|ZFAT_ENST00000520214.1_Missense_Mutation_p.R178I	NM_001174157.1|NM_020863.3	NP_001167628.1|NP_065914.2	Q9P243	ZFAT_HUMAN	zinc finger and AT hook domain containing	190					hematopoietic progenitor cell differentiation (GO:0002244)|spongiotrophoblast layer development (GO:0060712)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(10)|kidney(9)|large_intestine(8)|lung(16)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	all_epithelial(106;8.26e-19)|Lung NSC(106;3.47e-07)|all_lung(105;1.39e-06)|Ovarian(258;0.0102)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0432)			AGAAAGCTGTCTGGCCTCCTT	0.473																																					p.R190I		.											.	ZFAT-90	0			c.G569T						.						113.0	111.0	112.0					8																	135622778		1944	4119	6063	SO:0001583	missense	57623	exon4			AGCTGTCTGGCCT	BC025423	CCDS43768.1, CCDS47924.1, CCDS43768.2, CCDS55275.1, CCDS55276.1	8q24.23	2008-06-05	2008-01-25	2008-01-25	ENSG00000066827	ENSG00000066827		"""Zinc fingers, C2H2-type"""	19899	protein-coding gene	gene with protein product		610931	"""zinc finger protein 406"""	ZNF406, ZFAT1		10819331, 18329245	Standard	NM_020863		Approved	KIAA1485	uc003yup.3	Q9P243	OTTHUMG00000164321	ENST00000377838.3:c.569G>T	8.37:g.135622778C>A	ENSP00000367069:p.Arg190Ile	Somatic	151	0		WXS	Illumina GAIIx	Phase_I	157	12	NM_020863	0	0	0	0	0	B7ZL15|E9PER3|Q3MIM5|Q6PJ01|Q75PJ6|Q75PJ7|Q75PJ9|Q86X64	Missense_Mutation	SNP	ENST00000377838.3	37	CCDS47924.1	.	.	.	.	.	.	.	.	.	.	C	11.20	1.568527	0.28003	.	.	ENSG00000066827	ENST00000520356;ENST00000520727;ENST00000429442;ENST00000377838;ENST00000520214;ENST00000318135;ENST00000398946;ENST00000522257	T;T;T;T;T;T	0.45276	3.02;2.95;2.96;2.95;2.95;0.9	5.36	-0.835	0.10775	.	0.643270	0.15692	N	0.249364	T	0.18173	0.0436	N	0.08118	0	0.09310	N	1	B;B;B	0.21381	0.055;0.001;0.002	B;B;B	0.15870	0.014;0.002;0.002	T	0.20042	-1.0287	10	0.23302	T	0.38	-4.508	7.9309	0.29901	0.1102:0.2852:0.5268:0.0778	.	178;178;190	E9PBN4;Q9P243-3;Q9P243	.;.;ZFAT_HUMAN	I	178;178;178;190;178;178;178;128	ENSP00000427879:R178I;ENSP00000427831:R178I;ENSP00000394501:R178I;ENSP00000367069:R190I;ENSP00000428483:R178I;ENSP00000429983:R128I	ENSP00000326997:R178I	R	-	2	0	ZFAT	135691960	0.001000	0.12720	0.050000	0.19076	0.792000	0.44763	1.019000	0.30014	-0.044000	0.13491	0.655000	0.94253	AGA	.		0.473	ZFAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378272.1	NM_001029939	
ZNF696	79943	hgsc.bcm.edu	37	8	144378868	144378868	+	Silent	SNP	A	A	G	rs7386259	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr8:144378868A>G	ENST00000330143.3	+	3	1432	c.1023A>G	c.(1021-1023)cgA>cgG	p.R341R		NM_030895.2	NP_112157.2	Q9H7X3	ZN696_HUMAN	zinc finger protein 696	341					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	8	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)			GGCACCAGCGACTCCACACGG	0.726													G|||	4505	0.899561	0.9425	0.9179	5008	,	,		11520	0.8403		0.8608	False		,,,				2504	0.9294				p.R341R		.											.	ZNF696-90	0			c.A1023G						.	G		3773,275		1771,231,22	5.0	5.0	5.0		1023	-0.3	0.0	8	dbSNP_116	5	6735,1261		2843,1049,106	no	coding-synonymous	ZNF696	NM_030895.2		4614,1280,128	GG,GA,AA		15.7704,6.7935,12.7532		341/375	144378868	10508,1536	2024	3998	6022	SO:0001819	synonymous_variant	79943	exon3			CCAGCGACTCCAC	AK024191	CCDS6399.1	8q24.3	2013-01-08				ENSG00000185730		"""Zinc fingers, C2H2-type"""	25872	protein-coding gene	gene with protein product							Standard	NM_030895		Approved	FLJ14129	uc003yxy.4	Q9H7X3		ENST00000330143.3:c.1023A>G	8.37:g.144378868A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	3	3	NM_030895	0	0	0	0	0	A0AVE2	Silent	SNP	ENST00000330143.3	37	CCDS6399.1																																																																																			A|0.118;G|0.882		0.726	ZNF696-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381164.2	NM_030895	
PLEC	5339	hgsc.bcm.edu	37	8	144990528	144990528	+	Silent	SNP	A	A	G	rs7014582	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr8:144990528A>G	ENST00000322810.4	-	32	14041	c.13872T>C	c.(13870-13872)gcT>gcC	p.A4624A	PLEC_ENST00000354589.3_Silent_p.A4487A|PLEC_ENST00000436759.2_Silent_p.A4514A|PLEC_ENST00000398774.2_Silent_p.A4455A|PLEC_ENST00000354958.2_Silent_p.A4465A|PLEC_ENST00000527096.1_Silent_p.A4510A|PLEC_ENST00000345136.3_Silent_p.A4487A|PLEC_ENST00000357649.2_Silent_p.A4491A|PLEC_ENST00000356346.3_Silent_p.A4473A	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	4624	Globular 2.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						TGCGGGAGCCAGCGGTAGAGC	0.716													G|||	2389	0.477037	0.8979	0.3746	5008	,	,		8857	0.1508		0.4404	False		,,,				2504	0.3548				p.A4624A		.											.	PLEC-141	0			c.T13872C						.	G	,,,,,,,	2833,621		1197,439,91	12.0	16.0	15.0		13542,13419,13395,13872,13365,13461,13473,13461	-8.1	0.0	8	dbSNP_116	15	3324,4610		785,1754,1428	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	,,,,,,,	1982,2193,1519	GG,GA,AA		41.8956,17.9792,45.9343	,,,,,,,	4514/4575,4473/4534,4465/4526,4624/4685,4455/4516,4487/4548,4491/4552,4487/4548	144990528	6157,5231	1727	3967	5694	SO:0001819	synonymous_variant	5339	exon32			GGAGCCAGCGGTA	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.13872T>C	8.37:g.144990528A>G		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	12	6	NM_201380	0	0	13	30	17	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																			A|0.536;G|0.464		0.716	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
PLEC	5339	hgsc.bcm.edu	37	8	144998190	144998190	+	Silent	SNP	A	A	G	rs2857829	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr8:144998190A>G	ENST00000322810.4	-	31	6487	c.6318T>C	c.(6316-6318)gcT>gcC	p.A2106A	PLEC_ENST00000354589.3_Silent_p.A1969A|PLEC_ENST00000436759.2_Silent_p.A1996A|PLEC_ENST00000398774.2_Silent_p.A1937A|PLEC_ENST00000354958.2_Silent_p.A1947A|PLEC_ENST00000527096.1_Silent_p.A1992A|PLEC_ENST00000345136.3_Silent_p.A1969A|PLEC_ENST00000357649.2_Silent_p.A1973A|PLEC_ENST00000356346.3_Silent_p.A1955A	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	2106	Central fibrous rod domain.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						GCTGCCTCGCAGCCTCCAGCT	0.746													a|||	1156	0.230831	0.028	0.2968	5008	,	,		12955	0.1429		0.4274	False		,,,				2504	0.3466				p.A2106A		.											.	PLEC-141	0			c.T6318C						.	G	,,,,,,,	343,3813		21,301,1756	7.0	8.0	8.0		5988,5865,5841,6318,5811,5907,5919,5907	-8.1	0.0	8	dbSNP_100	8	3082,5166		620,1842,1662	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	,,,,,,,	641,2143,3418	GG,GA,AA		37.3666,8.2531,27.6121	,,,,,,,	1996/4575,1955/4534,1947/4526,2106/4685,1937/4516,1969/4548,1973/4552,1969/4548	144998190	3425,8979	2078	4124	6202	SO:0001819	synonymous_variant	5339	exon31			CCTCGCAGCCTCC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.6318T>C	8.37:g.144998190A>G		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	11	6	NM_201380	0	0	1	1	0	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																			A|0.738;G|0.262		0.746	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
PLEC	5339	hgsc.bcm.edu	37	8	144999417	144999417	+	Silent	SNP	C	C	T	rs55836855	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr8:144999417C>T	ENST00000322810.4	-	31	5260	c.5091G>A	c.(5089-5091)gcG>gcA	p.A1697A	PLEC_ENST00000354589.3_Silent_p.A1560A|PLEC_ENST00000436759.2_Silent_p.A1587A|PLEC_ENST00000398774.2_Silent_p.A1528A|PLEC_ENST00000354958.2_Silent_p.A1538A|PLEC_ENST00000527096.1_Silent_p.A1583A|PLEC_ENST00000345136.3_Silent_p.A1560A|PLEC_ENST00000357649.2_Silent_p.A1564A|PLEC_ENST00000356346.3_Silent_p.A1546A	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	1697	Central fibrous rod domain.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						GTACCTGCCGCGCTCGCTCCA	0.741													C|||	1156	0.230831	0.028	0.2954	5008	,	,		8861	0.1429		0.4274	False		,,,				2504	0.3476				p.A1697A		.											.	PLEC-141	0			c.G5091A						.	C	,,,,,,,	258,3112		16,226,1443	6.0	7.0	7.0		4761,4638,4614,5091,4584,4680,4692,4680	-9.4	0.1	8	dbSNP_129	7	2520,4470		444,1632,1419	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	,,,,,,,	460,1858,2862	TT,TC,CC		36.0515,7.6558,26.8147	,,,,,,,	1587/4575,1546/4534,1538/4526,1697/4685,1528/4516,1560/4548,1564/4552,1560/4548	144999417	2778,7582	1685	3495	5180	SO:0001819	synonymous_variant	5339	exon31			CTGCCGCGCTCGC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.5091G>A	8.37:g.144999417C>T		Somatic	1	1		WXS	Illumina GAIIx	Phase_I	9	6	NM_201380	0	0	0	1	1	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																			C|0.731;T|0.269		0.741	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
PLEC	5339	hgsc.bcm.edu	37	8	145001784	145001784	+	Silent	SNP	A	A	G	rs3135109	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr8:145001784A>G	ENST00000322810.4	-	27	4130	c.3961T>C	c.(3961-3963)Ttg>Ctg	p.L1321L	PLEC_ENST00000354589.3_Silent_p.L1184L|PLEC_ENST00000436759.2_Silent_p.L1211L|PLEC_ENST00000398774.2_Silent_p.L1152L|PLEC_ENST00000354958.2_Silent_p.L1162L|PLEC_ENST00000527096.1_Silent_p.L1207L|PLEC_ENST00000345136.3_Silent_p.L1184L|PLEC_ENST00000357649.2_Silent_p.L1188L|PLEC_ENST00000356346.3_Silent_p.L1170L	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	1321	Globular 1.		L -> V (in dbSNP:rs3135109). {ECO:0000269|PubMed:8698233}.		apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CGCTCAAGCAACTGGGCGACC	0.716													G|||	1156	0.230831	0.028	0.2954	5008	,	,		12494	0.1429		0.4274	False		,,,				2504	0.3476				p.L1321L		.											.	PLEC-141	0			c.T3961C						.	G	,,,,,,,	296,3620		20,256,1682	5.0	6.0	6.0		3631,3508,3484,3961,3454,3550,3562,3550	4.4	0.9	8	dbSNP_103	6	2835,5065		532,1771,1647	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	,,,,,,,	552,2027,3329	GG,GA,AA		35.8861,7.5587,26.498	,,,,,,,	1211/4575,1170/4534,1162/4526,1321/4685,1152/4516,1184/4548,1188/4552,1184/4548	145001784	3131,8685	1958	3950	5908	SO:0001819	synonymous_variant	5339	exon27			CAAGCAACTGGGC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.3961T>C	8.37:g.145001784A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	2	NM_201380	0	0	1	3	2	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																			G|0.246;A|0.754		0.716	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
ERMP1	79956	hgsc.bcm.edu	37	9	5832728	5832728	+	Silent	SNP	G	G	C	rs1131727	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr9:5832728G>C	ENST00000339450.5	-	1	389	c.300C>G	c.(298-300)gcC>gcG	p.A100A	ERMP1_ENST00000214893.5_5'UTR|ERMP1_ENST00000381506.3_5'Flank	NM_024896.2	NP_079172.2	Q7Z2K6	ERMP1_HUMAN	endoplasmic reticulum metallopeptidase 1	100						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			endometrium(2)|kidney(1)|large_intestine(9)|lung(4)|ovary(1)|prostate(2)|skin(1)	20		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00115)|Lung(218;0.111)		GGTGTCCAGCGGCCCCGCGTA	0.741													G|||	2021	0.403554	0.1309	0.428	5008	,	,		3601	0.7093		0.34	False		,,,				2504	0.5051				p.A100A		.											.	ERMP1-69	0			c.C300G						.						4.0	3.0	3.0					9																	5832728		1620	3326	4946	SO:0001819	synonymous_variant	79956	exon1			TCCAGCGGCCCCG	AB058718	CCDS34983.1	9p24	2008-02-05	2007-07-05	2007-07-05	ENSG00000099219	ENSG00000099219			23703	protein-coding gene	gene with protein product	"""Felix-ina"""	611156	"""KIAA1815"""	KIAA1815		11347906	Standard	XM_005251587		Approved	FLJ23309, FXNA	uc003zjm.1	Q7Z2K6	OTTHUMG00000019508	ENST00000339450.5:c.300C>G	9.37:g.5832728G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	13	7	NM_024896	0	0	0	0	0	B2RNA4|B3KSB1|Q8N5T5|Q9H5M1	Silent	SNP	ENST00000339450.5	37	CCDS34983.1																																																																																			G|0.572;C|0.428		0.741	ERMP1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354877.1	NM_024896	
FBP2	8789	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	97355868	97355868	+	Silent	SNP	C	C	T	rs370129734		TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr9:97355868C>T	ENST00000375337.3	-	1	207	c.141G>A	c.(139-141)tcG>tcA	p.S47S		NM_003837.2	NP_003828.2	O00757	F16P2_HUMAN	fructose-1,6-bisphosphatase 2	47					carbohydrate metabolic process (GO:0005975)|fructose metabolic process (GO:0006000)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|small molecule metabolic process (GO:0044281)	cell junction (GO:0030054)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	fructose 1,6-bisphosphate 1-phosphatase activity (GO:0042132)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(3)|lung(5)	9		Acute lymphoblastic leukemia(62;0.136)				TGCGCACAGCCGAGGAGATGG	0.647													C|||	1	0.000199681	0.0	0.0	5008	,	,		17119	0.0		0.0	False		,,,				2504	0.001				p.S47S		.											.	FBP2-226	0			c.G141A						.	C		1,4405	2.1+/-5.4	0,1,2202	88.0	72.0	78.0		141	-10.2	0.3	9		78	0,8600		0,0,4300	no	coding-synonymous	FBP2	NM_003837.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		47/340	97355868	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	8789	exon1			CACAGCCGAGGAG	Y10812	CCDS6711.1	9q22.3	2012-08-13			ENSG00000130957	ENSG00000130957	3.1.3.11		3607	protein-coding gene	gene with protein product		603027				9678974	Standard	NM_003837		Approved		uc004auv.3	O00757	OTTHUMG00000020269	ENST00000375337.3:c.141G>A	9.37:g.97355868C>T		Somatic	156	1		WXS	Illumina GAIIx	Phase_I	310	44	NM_003837	0	0	0	0	0	Q17R39|Q6FI53	Silent	SNP	ENST00000375337.3	37	CCDS6711.1																																																																																			.		0.647	FBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053189.1	NM_003837	
PAEP	5047	broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	138457640	138457640	+	Missense_Mutation	SNP	G	G	A	rs143616209|rs537242473	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr9:138457640G>A	ENST00000479141.1	+	6	580	c.536G>A	c.(535-537)cGt>cAt	p.R179H	PAEP_ENST00000371766.2_Missense_Mutation_p.R179H|PAEP_ENST00000277508.5_Missense_Mutation_p.R179H	NM_002571.2	NP_002562.2	P09466	PAEP_HUMAN	progestagen-associated endometrial protein	179					multicellular organismal development (GO:0007275)|transport (GO:0006810)	extracellular region (GO:0005576)	small molecule binding (GO:0036094)			cervix(1)|endometrium(1)|lung(1)|prostate(1)|skin(1)|stomach(1)	6				OV - Ovarian serous cystadenocarcinoma(145;3.39e-07)|Epithelial(140;1.11e-06)|all cancers(34;2.04e-05)		GAGCCGTGCCGTTTCTAGGTG	0.617													.|||	4	0.000798722	0.0	0.0	5008	,	,		18967	0.001		0.003	False		,,,				2504	0.0				p.R179H		.											.	PAEP-68	0			c.G536A						.	G	HIS/ARG,HIS/ARG	7,4399	12.9+/-30.5	0,7,2196	172.0	172.0	172.0		536,536	-1.9	0.0	9	dbSNP_134	172	36,8564	24.6+/-71.5	0,36,4264	yes	missense,missense	PAEP	NM_001018049.1,NM_002571.2	29,29	0,43,6460	AA,AG,GG		0.4186,0.1589,0.3306	benign,benign	179/181,179/181	138457640	43,12963	2203	4300	6503	SO:0001583	missense	5047	exon6			CGTGCCGTTTCTA		CCDS35173.1	9q34	2011-11-15	2008-07-31		ENSG00000122133	ENSG00000122133		"""Lipocalins"""	8573	protein-coding gene	gene with protein product	"""glycodelin-A"", ""glycodelin-S"", ""glycodelin-F"", ""progesterone-associated endometrial protein"", ""glycodelin"", ""PP14 protein (placental protein 14)"", ""pregnancy-associated endometrial alpha-2-globulin"", ""alpha uterine protein"""	173310				3320533, 2016092	Standard	XM_005263405		Approved	PEP, PP14, GdA, GdS, GdF, PAEG, GD, MGC138509, MGC142288	uc004cgd.1	P09466	OTTHUMG00000020914	ENST00000479141.1:c.536G>A	9.37:g.138457640G>A	ENSP00000417898:p.Arg179His	Somatic	132	0		WXS	Illumina GAIIx	Phase_I	247	41	NM_002571	0	0	0	0	0	Q5T6T1|Q9UG92	Missense_Mutation	SNP	ENST00000479141.1	37	CCDS35173.1	4	0.0018315018315018315	0	0.0	0	0.0	1	0.0017482517482517483	3	0.00395778364116095	G	0.193	-1.051438	0.01981	0.001589	0.004186	ENSG00000122133	ENST00000479141;ENST00000371767;ENST00000371766;ENST00000277508;ENST00000418284	T;T;T;T	0.58358	1.76;1.76;1.76;0.34	0.967	-1.93	0.07594	Calycin-like (1);Calycin (1);	.	.	.	.	T	0.29288	0.0729	L	0.34521	1.04	0.09310	N	1	B;B;B	0.28850	0.0;0.004;0.225	B;B;B	0.20184	0.0;0.0;0.028	T	0.14172	-1.0482	9	0.17369	T	0.5	.	0.7307	0.00956	0.2411:0.2017:0.3564:0.2008	.	157;142;179	P09466-2;A6XNE0;P09466	.;.;PAEP_HUMAN	H	179;144;179;179;131	ENSP00000417898:R179H;ENSP00000360831:R179H;ENSP00000277508:R179H;ENSP00000401933:R131H	ENSP00000277508:R179H	R	+	2	0	PAEP	137597461	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-1.215000	0.02985	-3.000000	0.00276	-1.857000	0.00563	CGT	G|0.997;A|0.003		0.617	PAEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055010.1	NM_001018049	
INPP5E	56623	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	139324136	139324136	+	Silent	SNP	G	G	A	rs201735585		TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr9:139324136G>A	ENST00000371712.3	-	10	2328	c.1926C>T	c.(1924-1926)tcC>tcT	p.S642S		NM_019892.4	NP_063945.2	Q10713	MPPA_HUMAN	inositol polyphosphate-5-phosphatase, 72 kDa	0					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)|proteolysis (GO:0006508)	extracellular space (GO:0005615)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			NS(1)|endometrium(1)|lung(4)|skin(3)	9		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;8.36e-06)|Epithelial(140;1.4e-05)		TTCAAGAAACGGAGCAGATGG	0.468																																					p.S642S		.											.	INPP5E-227	0			c.C1926T						.						248.0	232.0	237.0					9																	139324136		2203	4300	6503	SO:0001819	synonymous_variant	56623	exon10			AGAAACGGAGCAG	AF187891	CCDS7000.1	9q34.3	2011-02-11			ENSG00000148384	ENSG00000148384			21474	protein-coding gene	gene with protein product		613037	"""Joubert syndrome 1"""	JBTS1		10764818, 10577920, 19668216	Standard	NM_019892		Approved	PPI5PIV, CORS1	uc004cho.3	Q9NRR6	OTTHUMG00000020927	ENST00000371712.3:c.1926C>T	9.37:g.139324136G>A		Somatic	114	0		WXS	Illumina GAIIx	Phase_I	209	41	NM_019892	0	0	12	14	2	B4DKL3|E7ET61|Q16639|Q5SXM9|Q8N513	Silent	SNP	ENST00000371712.3	37	CCDS7000.1																																																																																			G|0.999;A|0.000		0.468	INPP5E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055058.1	NM_019892	
NOXA1	10811	hgsc.bcm.edu	37	9	140317999	140317999	+	Missense_Mutation	SNP	C	C	G	rs112864733	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr9:140317999C>G	ENST00000341349.2	+	1	198	c.18C>G	c.(16-18)gaC>gaG	p.D6E	EXD3_ENST00000475006.1_5'Flank|EXD3_ENST00000342129.4_5'Flank|EXD3_ENST00000340951.4_5'Flank|NOXA1_ENST00000392815.2_Missense_Mutation_p.D6E|snoU13_ENST00000606918.1_RNA|EXD3_ENST00000465160.2_5'Flank|EXD3_ENST00000479452.1_5'Flank	NM_001256067.1|NM_006647.1	NP_001242996.1|NP_006638.1	Q86UR1	NOXA1_HUMAN	NADPH oxidase activator 1	6	Mediates interaction with RAC1.				positive regulation of catalytic activity (GO:0043085)|regulation of hydrogen peroxide metabolic process (GO:0010310)|regulation of respiratory burst (GO:0060263)|superoxide metabolic process (GO:0006801)	cytoplasm (GO:0005737)|NADPH oxidase complex (GO:0043020)	enzyme binding (GO:0019899)|Rac GTPase binding (GO:0048365)|SH3 domain binding (GO:0017124)|superoxide-generating NADPH oxidase activator activity (GO:0016176)			cervix(1)|large_intestine(2)|lung(2)|skin(3)|upper_aerodigestive_tract(1)	9	all_cancers(76;0.0926)			OV - Ovarian serous cystadenocarcinoma(145;0.000238)|Epithelial(140;0.000982)		CTCTGGGGGACCTGGTGCGCG	0.811													c|||	278	0.0555112	0.0401	0.049	5008	,	,		6061	0.005		0.1213	False		,,,				2504	0.0654				p.D6E		.											.	NOXA1-90	0			c.C18G						.		GLU/ASP	116,3312		1,114,1599	4.0	5.0	5.0		18	-2.8	0.8	9	dbSNP_132	5	595,6781		18,559,3111	no	missense	NOXA1	NM_006647.1	45	19,673,4710	GG,GC,CC		8.0667,3.3839,6.5809	probably-damaging	6/484	140317999	711,10093	1714	3688	5402	SO:0001583	missense	10811	exon1			GGGGGACCTGGTG	AF039697	CCDS7042.1, CCDS59157.1	9q34.3	2013-09-20	2002-12-09	2002-12-13	ENSG00000188747	ENSG00000188747			10668	protein-coding gene	gene with protein product		611255	"""serologically defined colon cancer antigen 31"""	SDCCAG31		9610721	Standard	NM_001256067		Approved	NY-CO-31, FLJ25475	uc004cmu.3	Q86UR1	OTTHUMG00000131781	ENST00000341349.2:c.18C>G	9.37:g.140317999C>G	ENSP00000342848:p.Asp6Glu	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	3	3	NM_006647	0	0	0	0	0	O60533|Q29VU9|Q29VV0|Q2TAM1|Q8IUS3	Missense_Mutation	SNP	ENST00000341349.2	37	CCDS7042.1	143	0.06547619047619048	20	0.04065040650406504	22	0.06077348066298342	4	0.006993006993006993	97	0.1279683377308707	c	14.61	2.587081	0.46110	0.033839	0.080667	ENSG00000188747	ENST00000341349;ENST00000392815	D;D	0.86627	-1.91;-2.15	4.24	-2.81	0.05805	.	0.176261	0.47455	D	0.000234	T	0.02230	0.0069	L	0.27053	0.805	0.58432	P	2.9999999999752447E-6	P;B;B	0.48230	0.907;0.24;0.201	P;B;B	0.48795	0.59;0.05;0.094	T	0.64118	-0.6482	9	0.02654	T	1	.	5.957	0.19279	0.0:0.3375:0.4365:0.2261	.	6;6;6	Q86UR1-3;Q86UR1;Q86UR1-2	.;NOXA1_HUMAN;.	E	6	ENSP00000342848:D6E;ENSP00000376562:D6E	ENSP00000342848:D6E	D	+	3	2	NOXA1	139437820	0.486000	0.25980	0.844000	0.33320	0.587000	0.36485	-0.046000	0.11983	-0.407000	0.07576	0.387000	0.25754	GAC	C|0.934;G|0.066		0.811	NOXA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254713.1		
AKAP17A	8227	hgsc.bcm.edu	37	X	1720322	1720322	+	Silent	SNP	G	G	A			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chrX:1720322G>A	ENST00000313871.3	+	5	2119	c.1923G>A	c.(1921-1923)ccG>ccA	p.P641P		NM_005088.2	NP_005079.2	Q02040	AK17A_HUMAN	A kinase (PRKA) anchor protein 17A	641	Arg-rich.				B cell activation (GO:0042113)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|signal transduction (GO:0007165)	nuclear speck (GO:0016607)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein kinase A binding (GO:0051018)			breast(2)|endometrium(5)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)	26						GCACGAGCCCGGACCACACCC	0.731													g|||	19	0.00379393	0.0008	0.0029	5008	,	,		12797	0.0		0.0129	False		,,,				2504	0.0031				p.P641P		.											.	AKAP17A-40	0			c.G1923A						.		,	16,4318		0,16,2151	13.0	21.0	18.0		,1923	-2.8	0.3	X	dbSNP_134	18	167,8337		1,165,4086	no	intron,coding-synonymous	ASMT,AKAP17A	NM_004043.2,NM_005088.2	,	1,181,6237	AA,AG,GG		1.9638,0.3692,1.4255	,	,641/696	1720322	183,12655	2167	4252	6419	SO:0001819	synonymous_variant	8227	exon5			GAGCCCGGACCAC	L03426	CCDS14116.1	Xp22.33 and Yp11.32	2010-09-08	2010-09-08	2010-09-08	ENSG00000197976	ENSG00000197976		"""Pseudoautosomal regions / PAR1"", ""A-kinase anchor proteins"""	18783	protein-coding gene	gene with protein product		312095, 465000	"""chromosome X and Y open reading frame 3"", ""splicing factor, arginine/serine-rich 17A"""	CXYorf3, SFRS17A		9736779, 1438229, 19840947	Standard	NR_027383		Approved	XE7, XE7Y, DXYS155E, MGC39904, 721P, CCDC133	uc004cqa.3	Q02040	OTTHUMG00000021063	ENST00000313871.3:c.1923G>A	X.37:g.1720322G>A		Somatic	4	0		WXS	Illumina GAIIx	Phase_I	20	14	NM_005088	0	0	3	12	9	Q02832|Q2TB98|Q5JQ74|Q5JQ76|Q8N6U9	Silent	SNP	ENST00000313871.3	37	CCDS14116.1																																																																																			G|0.992;A|0.008		0.731	AKAP17A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055609.2	NM_005088	
STS	412	broad.mit.edu;bcgsc.ca	37	X	7252144	7252144	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chrX:7252144G>C	ENST00000217961.4	+	9	1594	c.1374G>C	c.(1372-1374)caG>caC	p.Q458H		NM_000351.4	NP_000342.2	P08842	STS_HUMAN	steroid sulfatase (microsomal), isozyme S	458					cellular protein metabolic process (GO:0044267)|epidermis development (GO:0008544)|female pregnancy (GO:0007565)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|steroid catabolic process (GO:0006706)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|steryl-sulfatase activity (GO:0004773)|sulfuric ester hydrolase activity (GO:0008484)			NS(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(10)|prostate(2)|skin(1)	27		Colorectal(8;0.0136)|Medulloblastoma(8;0.184)			Norelgestromin(DB06713)	GGCACCCTCAGAACAGTGAGT	0.478									Ichthyosis																												p.Q458H		.											.	STS-130	0			c.G1374C						.						130.0	112.0	118.0					X																	7252144		2203	4299	6502	SO:0001583	missense	412	exon9	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	CCCTCAGAACAGT	M16505	CCDS14127.1	Xp22.32	2013-06-10	2007-07-19		ENSG00000101846	ENSG00000101846	3.1.6.2	"""Arylsulfatase family"""	11425	protein-coding gene	gene with protein product	"""arylsulfatase C"""	300747	"""steroid sulfatase (microsomal), arylsulfatase C, isozyme S"""	ARSC1			Standard	NM_000351		Approved	ARSC	uc004cry.4	P08842	OTTHUMG00000021102	ENST00000217961.4:c.1374G>C	X.37:g.7252144G>C	ENSP00000217961:p.Gln458His	Somatic	204	1		WXS	Illumina GAIIx	Phase_I	356	10	NM_000351	0	0	0	0	0	B2RA47	Missense_Mutation	SNP	ENST00000217961.4	37	CCDS14127.1	.	.	.	.	.	.	.	.	.	.	G	7.255	0.603946	0.14002	.	.	ENSG00000101846	ENST00000217961	D	0.93547	-3.24	3.95	-7.31	0.01441	Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	1.580150	0.03872	N	0.275696	T	0.81763	0.4891	N	0.03115	-0.41	0.09310	N	0.999996	B	0.06786	0.001	B	0.08055	0.003	T	0.73525	-0.3955	10	0.59425	D	0.04	.	7.6432	0.28305	0.3717:0.5133:0.115:0.0	.	458	P08842	STS_HUMAN	H	458	ENSP00000217961:Q458H	ENSP00000217961:Q458H	Q	+	3	2	STS	7262144	0.000000	0.05858	0.001000	0.08648	0.546000	0.35178	-1.391000	0.02525	-2.117000	0.00829	-1.211000	0.01629	CAG	.		0.478	STS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055686.1	NM_000351	
DCAF8L2	347442	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	27765556	27765556	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chrX:27765556C>A	ENST00000451261.2	+	5	943	c.544C>A	c.(544-546)Ctg>Atg	p.L182M		NM_001136533.1	NP_001130005.1	P0C7V8	DC8L2_HUMAN	DDB1 and CUL4 associated factor 8-like 2	182										central_nervous_system(1)|endometrium(9)|kidney(3)|lung(7)|pancreas(1)|skin(3)	24						GACATCTGCCCTGCCCCGACC	0.612																																					p.L182M		.											.	DCAF8L2-42	0			c.C544A						.						53.0	47.0	49.0					X																	27765556		692	1591	2283	SO:0001583	missense	347442	exon1			TCTGCCCTGCCCC		CCDS59162.1	Xp22.11	2013-01-09	2009-07-17	2009-07-17		ENSG00000189186		"""WD repeat domain containing"""	31811	protein-coding gene	gene with protein product			"""WD repeat domain 42C"""	WDR42C			Standard	NM_001136533		Approved		uc011mjy.2	P0C7V8		ENST00000451261.2:c.544C>A	X.37:g.27765556C>A	ENSP00000462745:p.Leu182Met	Somatic	320	1		WXS	Illumina GAIIx	Phase_I	476	29	NM_001136533	0	0	0	0	0	B2RXH9|J3KT06	Missense_Mutation	SNP	ENST00000451261.2	37	CCDS59162.1																																																																																			.		0.612	DCAF8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056143.4	XM_293354	
GATA1	2623	broad.mit.edu;bcgsc.ca	37	X	48652250	48652250	+	Silent	SNP	C	C	T			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chrX:48652250C>T	ENST00000376670.3	+	6	1032	c.921C>T	c.(919-921)cgC>cgT	p.R307R	GATA1_ENST00000376665.3_Intron	NM_002049.3	NP_002040.1	P15976	GATA1_HUMAN	GATA binding protein 1 (globin transcription factor 1)	307					basophil differentiation (GO:0030221)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|cellular response to thyroid hormone stimulus (GO:0097067)|dendritic cell differentiation (GO:0097028)|embryonic hemopoiesis (GO:0035162)|eosinophil differentiation (GO:0030222)|eosinophil fate commitment (GO:0035854)|erythrocyte development (GO:0048821)|erythrocyte differentiation (GO:0030218)|in utero embryonic development (GO:0001701)|male gonad development (GO:0008584)|megakaryocyte differentiation (GO:0030219)|negative regulation of apoptotic process (GO:0043066)|negative regulation of bone mineralization (GO:0030502)|negative regulation of cell proliferation (GO:0008285)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of definitive erythrocyte differentiation (GO:0010724)|regulation of glycoprotein biosynthetic process (GO:0010559)|transcription from RNA polymerase II promoter (GO:0006366)|transcriptional activation by promoter-enhancer looping (GO:0071733)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	C2H2 zinc finger domain binding (GO:0070742)|chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|enhancer sequence-specific DNA binding (GO:0001158)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(259)|large_intestine(8)|lung(9)|prostate(1)	283						CTCGAAACCGCAAGGCATCTG	0.587			"""Mis, F"""		megakaryoblastic leukemia of Downs Syndrome																																p.R307R	Pancreas(9;429 505 11287 29617)	.		Dom	yes		X	Xp11.23	2623	GATA binding protein 1 (globin transcription factor 1)		L	.	GATA1-1315	0			c.C921T						.						30.0	28.0	28.0					X																	48652250		2203	4298	6501	SO:0001819	synonymous_variant	2623	exon6			AAACCGCAAGGCA	X17254	CCDS14305.1	Xp11.23	2014-09-17	2001-11-28		ENSG00000102145	ENSG00000102145		"""GATA zinc finger domain containing"""	4170	protein-coding gene	gene with protein product	"""nuclear factor, erythroid 1"""	305371	"""GATA-binding protein 1 (globin transcription factor 1)"""	GF1		1999341	Standard	NM_002049		Approved	ERYF1, NFE1, GATA-1, NF-E1	uc004dkq.4	P15976	OTTHUMG00000021504	ENST00000376670.3:c.921C>T	X.37:g.48652250C>T		Somatic	173	1		WXS	Illumina GAIIx	Phase_I	224	7	NM_002049	0	0	0	0	0	Q96GB8	Silent	SNP	ENST00000376670.3	37	CCDS14305.1	.	.	.	.	.	.	.	.	.	.	c	9.466	1.094494	0.20471	.	.	ENSG00000102145	ENST00000447551	.	.	.	3.94	3.02	0.34903	.	.	.	.	.	T	0.57080	0.2029	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54098	-0.8344	4	.	.	.	-7.541	8.3582	0.32342	0.3878:0.6122:0.0:0.0	.	.	.	.	V	72	.	.	A	+	2	0	GATA1	48537194	0.929000	0.31497	1.000000	0.80357	0.946000	0.59487	0.032000	0.13732	1.812000	0.52913	0.365000	0.22127	GCA	.		0.587	GATA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056517.1	NM_002049	
DGAT2L6	347516	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	69424885	69424885	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chrX:69424885C>A	ENST00000333026.3	+	7	1043	c.943C>A	c.(943-945)Ctg>Atg	p.L315M		NM_198512.1	NP_940914.1	Q6ZPD8	DG2L6_HUMAN	diacylglycerol O-acyltransferase 2-like 6	315					lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	transferase activity, transferring acyl groups other than amino-acyl groups (GO:0016747)			breast(1)|endometrium(2)|large_intestine(3)|lung(5)|ovary(1)	12						CATCAGTGCCCTGCGCAAGCT	0.468																																					p.L315M		.											.	DGAT2L6-131	0			c.C943A						.						91.0	71.0	78.0					X																	69424885		2203	4300	6503	SO:0001583	missense	347516	exon7			AGTGCCCTGCGCA	AK129500	CCDS14397.1	Xq13.1	2008-02-05			ENSG00000184210	ENSG00000184210			23250	protein-coding gene	gene with protein product		300926				15671038	Standard	NM_198512		Approved	DC3, FLJ25989	uc004dxx.1	Q6ZPD8	OTTHUMG00000021774	ENST00000333026.3:c.943C>A	X.37:g.69424885C>A	ENSP00000328036:p.Leu315Met	Somatic	179	1		WXS	Illumina GAIIx	Phase_I	264	38	NM_198512	0	0	0	0	0	Q6IEE2	Missense_Mutation	SNP	ENST00000333026.3	37	CCDS14397.1	.	.	.	.	.	.	.	.	.	.	C	16.06	3.016849	0.54576	.	.	ENSG00000184210	ENST00000333026	D	0.93604	-3.25	4.74	2.97	0.34412	.	0.000000	0.51477	D	0.000089	D	0.96999	0.9020	H	0.94658	3.565	0.50632	D	0.999886	D	0.89917	1.0	D	0.87578	0.998	D	0.95660	0.8714	10	0.87932	D	0	-13.5109	8.0147	0.30374	0.0:0.7955:0.0:0.2045	.	315	Q6ZPD8	DG2L6_HUMAN	M	315	ENSP00000328036:L315M	ENSP00000328036:L315M	L	+	1	2	DGAT2L6	69341610	0.738000	0.28186	0.849000	0.33467	0.599000	0.36880	1.150000	0.31639	0.445000	0.26639	0.600000	0.82982	CTG	.		0.468	DGAT2L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057067.1	NM_198512	
RPS6KA6	27330	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	83372103	83372103	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chrX:83372103C>A	ENST00000262752.2	-	11	921	c.914G>T	c.(913-915)aGg>aTg	p.R305M	RPS6KA6_ENST00000543399.1_Missense_Mutation_p.R305M	NM_014496.4	NP_055311.1	Q9UK32	KS6A6_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 6	305	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|central nervous system development (GO:0007417)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|negative regulation of embryonic development (GO:0045992)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of mesoderm development (GO:2000381)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(26)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	46						GAATAACATCCTTAGAAGACT	0.323																																					p.R305M		.											.	RPS6KA6-615	0			c.G914T						.						52.0	49.0	50.0					X																	83372103		2200	4297	6497	SO:0001583	missense	27330	exon11			AACATCCTTAGAA	AF184965	CCDS14451.1	Xq21.1	2011-04-05	2002-08-29		ENSG00000072133	ENSG00000072133			10435	protein-coding gene	gene with protein product		300303	"""ribosomal protein S6 kinase, 90kD, polypeptide 6"""			10644430	Standard	NM_014496		Approved	RSK4	uc004eej.2	Q9UK32	OTTHUMG00000021923	ENST00000262752.2:c.914G>T	X.37:g.83372103C>A	ENSP00000262752:p.Arg305Met	Somatic	179	0		WXS	Illumina GAIIx	Phase_I	163	52	NM_014496	0	0	0	0	0	B2R854|B7ZL90|Q6FHX2|Q8WX28|Q9H4S6	Missense_Mutation	SNP	ENST00000262752.2	37	CCDS14451.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.262029	0.80358	.	.	ENSG00000072133	ENST00000262752;ENST00000543399	T;T	0.54071	0.59;0.59	4.79	4.79	0.61399	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.55909	0.1950	L	0.46819	1.47	0.80722	D	1	P;P	0.34615	0.459;0.459	B;B	0.42625	0.369;0.393	T	0.61554	-0.7039	10	0.72032	D	0.01	.	17.3025	0.87186	0.0:1.0:0.0:0.0	.	305;305	B7ZL90;Q9UK32	.;KS6A6_HUMAN	M	305	ENSP00000262752:R305M;ENSP00000440830:R305M	ENSP00000262752:R305M	R	-	2	0	RPS6KA6	83258759	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.552000	0.82192	2.097000	0.63578	0.600000	0.82982	AGG	.		0.323	RPS6KA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057372.1	NM_014496	
PLXNB3	5365	hgsc.bcm.edu;mdanderson.org	37	X	153032899	153032899	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chrX:153032899G>A	ENST00000361971.5	+	3	731	c.617G>A	c.(616-618)cGc>cAc	p.R206H	PLXNB3_ENST00000538776.1_Intron|U52111.14_ENST00000416854.1_RNA|PLXNB3_ENST00000538543.1_Intron|PLXNB3_ENST00000538282.1_Intron|PLXNB3_ENST00000538966.1_Missense_Mutation_p.R229H|U52111.14_ENST00000434284.1_RNA	NM_005393.2	NP_005384.2	Q9ULL4	PLXB3_HUMAN	plexin B3	206	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|cell chemotaxis (GO:0060326)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|negative regulation of GTPase activity (GO:0034260)|negative regulation of lamellipodium assembly (GO:0010593)|positive chemotaxis (GO:0050918)|positive regulation of endothelial cell proliferation (GO:0001938)|semaphorin-plexin signaling pathway (GO:0071526)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)			central_nervous_system(1)|endometrium(7)|large_intestine(2)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	32	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					CTGGCCATCCGCCAGCTGGCC	0.711																																					p.R229H		.											.	PLXNB3-130	0			c.G686A						.						11.0	10.0	10.0					X																	153032899		2165	4252	6417	SO:0001583	missense	5365	exon4			CCATCCGCCAGCT	AF149019	CCDS14729.1, CCDS55536.1	Xq28	2008-02-05			ENSG00000198753	ENSG00000198753		"""Plexins"""	9105	protein-coding gene	gene with protein product		300214		PLXN6		10520995	Standard	NM_005393		Approved	PLEXR, PLEXB3	uc010nuk.2	Q9ULL4	OTTHUMG00000024217	ENST00000361971.5:c.617G>A	X.37:g.153032899G>A	ENSP00000355378:p.Arg206His	Somatic	9	0		WXS	Illumina GAIIx	Phase_I	45	17	NM_001163257	0	0	0	0	0	B7Z3E6|F5H773|Q9HDA4	Missense_Mutation	SNP	ENST00000361971.5	37	CCDS14729.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.241086	0.79912	.	.	ENSG00000198753	ENST00000538966;ENST00000361971	T;T	0.59364	0.27;0.27	4.79	4.79	0.61399	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	3.024290	0.01515	N	0.018102	D	0.83681	0.5307	M	0.89095	3.005	0.44595	D	0.997567	D;D	0.89917	1.0;1.0	D;D	0.97110	0.993;1.0	T	0.66842	-0.5821	10	0.87932	D	0	.	15.7471	0.77955	0.0:0.0:1.0:0.0	.	229;206	F5H773;Q9ULL4	.;PLXB3_HUMAN	H	229;206	ENSP00000442736:R229H;ENSP00000355378:R206H	ENSP00000355378:R206H	R	+	2	0	PLXNB3	152686093	1.000000	0.71417	0.990000	0.47175	0.735000	0.41995	6.917000	0.75782	1.961000	0.56991	0.468000	0.43344	CGC	.		0.711	PLXNB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061063.1		
ARHGAP4	393	broad.mit.edu	37	X	153187251	153187251	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chrX:153187251G>T	ENST00000350060.5	-	2	120	c.79C>A	c.(79-81)Cag>Aag	p.Q27K	ARHGAP4_ENST00000393721.1_Missense_Mutation_p.Q27K|ARHGAP4_ENST00000370028.3_Missense_Mutation_p.Q27K|ARHGAP4_ENST00000370016.1_Missense_Mutation_p.Q27K|ARHGAP4_ENST00000537206.1_Missense_Mutation_p.Q4K	NM_001666.4	NP_001657.3	P98171	RHG04_HUMAN	Rho GTPase activating protein 4	27	FCH. {ECO:0000255|PROSITE- ProRule:PRU00083}.				apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|negative regulation of axon extension (GO:0030517)|negative regulation of fibroblast migration (GO:0010764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of signal transduction (GO:0009967)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)	Rho GTPase activator activity (GO:0005100)|SH3/SH2 adaptor activity (GO:0005070)			central_nervous_system(2)|endometrium(2)|large_intestine(1)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	14	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TCGCTCAGCTGCCAGCGCATC	0.692																																					p.Q27K		.											.	ARHGAP4-227	0			c.C79A						.																																			SO:0001583	missense	393	exon2			TCAGCTGCCAGCG	X78817	CCDS14736.1, CCDS55540.1	Xq28	2010-02-09			ENSG00000089820	ENSG00000089820		"""Rho GTPase activating proteins"""	674	protein-coding gene	gene with protein product	"""Rho-GAP hematopoietic protein C1"""	300023				8570618	Standard	NM_001666		Approved	KIAA0131, C1, p115, RhoGAP4, SrGAP4	uc004fjk.2	P98171	OTTHUMG00000024226	ENST00000350060.5:c.79C>A	X.37:g.153187251G>T	ENSP00000203786:p.Gln27Lys	Somatic	12	0		WXS	Illumina GAIIx	Phase_I	37	4	NM_001666	0	0	0	0	0	Q14144|Q86UY3	Missense_Mutation	SNP	ENST00000350060.5	37	CCDS14736.1	.	.	.	.	.	.	.	.	.	.	G	29.8	5.033601	0.93575	.	.	ENSG00000089820	ENST00000393721;ENST00000370028;ENST00000350060;ENST00000370016;ENST00000537206;ENST00000442262;ENST00000422091	T;T;T;T;T;T;T	0.43294	2.28;0.95;0.95;0.95;0.95;0.95;0.95	4.95	4.95	0.65309	Fps/Fes/Fer/CIP4 homology (3);	0.000000	0.42053	D	0.000776	T	0.64316	0.2587	M	0.72894	2.215	0.58432	D	0.999999	D;D	0.76494	0.999;0.999	D;D	0.91635	0.999;0.999	T	0.67741	-0.5592	10	0.59425	D	0.04	.	16.3521	0.83215	0.0:0.0:1.0:0.0	.	27;27	Q86UY3;P98171	.;RHG04_HUMAN	K	27;27;27;27;4;4;4	ENSP00000377322:Q27K;ENSP00000359045:Q27K;ENSP00000203786:Q27K;ENSP00000359033:Q27K;ENSP00000444169:Q4K;ENSP00000398259:Q4K;ENSP00000413782:Q4K	ENSP00000203786:Q27K	Q	-	1	0	ARHGAP4	152840445	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.397000	0.79903	2.203000	0.70933	0.436000	0.28706	CAG	.		0.692	ARHGAP4-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061119.1	NM_001666	
TPSD1	23430	hgsc.bcm.edu	37	16	1306346	1306347	+	Missense_Mutation	DNP	CG	CG	GC	rs2005937|rs3865205	byFrequency	TCGA-OR-A5K2-01A-11D-A29I-10	TCGA-OR-A5K2-10B-01D-A29L-10	CG	CG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	66aec7c2-3fce-47b6-939c-a8593e81b426	f1b3d772-79b9-406b-aa04-27a086489524	g.chr16:1306346_1306347CG>GC	ENST00000211076.3	+	1	213_214	c.65_66CG>GC	c.(64-66)cCG>cGC	p.P22R	TPSD1_ENST00000397534.2_Missense_Mutation_p.P15R|RP11-616M22.5_ENST00000566997.1_RNA	NM_012217.2	NP_036349.1	Q9BZJ3	TRYD_HUMAN	tryptase delta 1	22			P -> R (in dbSNP:rs3865205). {ECO:0000269|PubMed:9920877}.			extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)	20		Hepatocellular(780;0.00369)				CTGGCGAGCCCGGCCTACGTGG	0.723																																					p.P22R		.											.	TPSD1-90	0			c.G66C						.																																			SO:0001583	missense	23430	exon1			GAGCCCGGCCTAC	AF206664	CCDS10432.1	16p13.3	2008-07-29			ENSG00000095917	ENSG00000095917	3.4.21.59		14118	protein-coding gene	gene with protein product	"""mMCP-7-like II"", ""mMCP-7-like I"", ""MMCP-7-LIKE-2"""	609272				9920877	Standard	NM_012217		Approved		uc002clb.1	Q9BZJ3	OTTHUMG00000128511	Exception_encountered	16.37:g.1306346_1306347delinsGC	ENSP00000211076:p.Pro22Arg	Somatic	15	0		WXS	Illumina GAIIx	Phase_I	123	0	NM_012217	0	0	0	0	0	O95824|Q8TDI6|Q96L36|Q96RZ5|Q9H2Y6|Q9UQI8	Missense_Mutation	DNP	ENST00000211076.3	37	CCDS10432.1																																																																																			.		0.723	TPSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250320.2		
