#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SKI	6497	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	2235335	2235335	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr1:2235335C>T	ENST00000378536.4	+	4	1340	c.1268C>T	c.(1267-1269)cCg>cTg	p.P423L		NM_003036.3	NP_003027.1	P12755	SKI_HUMAN	SKI proto-oncogene	423					anterior/posterior axis specification (GO:0009948)|BMP signaling pathway (GO:0030509)|bone morphogenesis (GO:0060349)|camera-type eye development (GO:0043010)|camera-type eye morphogenesis (GO:0048593)|cell motility (GO:0048870)|cell proliferation (GO:0008283)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|gene expression (GO:0010467)|lens morphogenesis in camera-type eye (GO:0002089)|myelination in peripheral nervous system (GO:0022011)|myotube differentiation (GO:0014902)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell proliferation (GO:0008285)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of Schwann cell proliferation (GO:0010626)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neural tube closure (GO:0001843)|nose morphogenesis (GO:0043585)|olfactory bulb development (GO:0021772)|palate development (GO:0060021)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|protein homotrimerization (GO:0070207)|regulation of apoptotic process (GO:0042981)|retina development in camera-type eye (GO:0060041)|skeletal muscle fiber development (GO:0048741)|SMAD protein signal transduction (GO:0060395)|somatic stem cell maintenance (GO:0035019)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase inhibitor activity (GO:0046811)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)|repressing transcription factor binding (GO:0070491)|SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(2)|lung(5)|prostate(1)|stomach(1)	10	all_cancers(77;0.000139)|all_epithelial(69;4.45e-05)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)			Epithelial(90;2.14e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.72e-29)|GBM - Glioblastoma multiforme(42;2.45e-08)|Colorectal(212;5.33e-05)|COAD - Colon adenocarcinoma(227;0.000228)|Kidney(185;0.00268)|BRCA - Breast invasive adenocarcinoma(365;0.00471)|STAD - Stomach adenocarcinoma(132;0.0147)|KIRC - Kidney renal clear cell carcinoma(229;0.0385)|Lung(427;0.207)		GCCCTCGCACCGCCGGCCCAG	0.692																																					p.P423L	Ovarian(177;144 1678 13697 20086 27838 40755)	.											.	SKI-838	0			c.C1268T						.						13.0	17.0	16.0					1																	2235335		2173	4274	6447	SO:0001583	missense	6497	exon4			TCGCACCGCCGGC	X15218	CCDS39.1	1p36.33	2014-06-25	2014-06-25		ENSG00000157933	ENSG00000157933		"""SKI transcriptional corepressors"""	10896	protein-coding gene	gene with protein product		164780	"""v-ski avian sarcoma viral oncogene homolog"""			2762147	Standard	NM_003036		Approved		uc001aja.4	P12755	OTTHUMG00000001407	ENST00000378536.4:c.1268C>T	1.37:g.2235335C>T	ENSP00000367797:p.Pro423Leu	Somatic	83	0		WXS	Illumina GAIIx	Phase_I	95	86	NM_003036	0	0	2	8	6	Q5SYT7	Missense_Mutation	SNP	ENST00000378536.4	37	CCDS39.1	.	.	.	.	.	.	.	.	.	.	C	29.6	5.023233	0.93462	.	.	ENSG00000157933	ENST00000378536	D	0.96011	-3.88	4.61	4.61	0.57282	.	0.058905	0.64402	D	0.000002	D	0.96463	0.8846	L	0.59436	1.845	0.80722	D	1	D	0.89917	1.0	P	0.60117	0.869	D	0.96644	0.9476	10	0.54805	T	0.06	-18.8991	16.7915	0.85590	0.0:1.0:0.0:0.0	.	423	P12755	SKI_HUMAN	L	423	ENSP00000367797:P423L	ENSP00000367797:P423L	P	+	2	0	SKI	2225195	1.000000	0.71417	0.144000	0.22314	0.742000	0.42306	7.216000	0.77974	2.264000	0.75181	0.561000	0.74099	CCG	.		0.692	SKI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004070.1	NM_003036	
PRDM16	63976	hgsc.bcm.edu	37	1	3329263	3329263	+	Silent	SNP	C	C	T	rs115226069	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr1:3329263C>T	ENST00000270722.5	+	9	2551	c.2502C>T	c.(2500-2502)ggC>ggT	p.G834G	PRDM16_ENST00000442529.2_Silent_p.G834G|PRDM16_ENST00000441472.2_Silent_p.G834G|PRDM16_ENST00000378391.2_Silent_p.G834G|PRDM16_ENST00000511072.1_Silent_p.G835G|PRDM16_ENST00000514189.1_Silent_p.G835G|PRDM16_ENST00000512462.1_3'UTR|PRDM16_ENST00000378398.3_Silent_p.G835G			Q9HAZ2	PRD16_HUMAN	PR domain containing 16	834	Interaction with CTBP1 and CTBP2. {ECO:0000250}.|Mediates interaction with SKI and regulation of TGF-beta signaling.				brown fat cell differentiation (GO:0050873)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neurogenesis (GO:0022008)|palate development (GO:0060021)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular respiration (GO:0043457)|somatic stem cell maintenance (GO:0035019)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)			breast(4)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(7)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(3)	59	all_cancers(77;0.00208)|all_epithelial(69;0.000732)|Ovarian(185;0.0634)|Lung NSC(156;0.109)|all_lung(157;0.111)	all_epithelial(116;2.03e-21)|all_lung(118;7.55e-09)|Lung NSC(185;1.28e-06)|Breast(487;0.000792)|Renal(390;0.00137)|Hepatocellular(190;0.00515)|Myeloproliferative disorder(586;0.0267)|Ovarian(437;0.0365)|Lung SC(97;0.114)|Medulloblastoma(700;0.134)		Epithelial(90;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.99e-20)|GBM - Glioblastoma multiforme(42;3.72e-11)|Colorectal(212;0.000425)|BRCA - Breast invasive adenocarcinoma(365;0.000946)|COAD - Colon adenocarcinoma(227;0.000968)|Kidney(185;0.00155)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0175)|Lung(427;0.137)		GCAAGCTGGGCGCCGGCGAGG	0.716			T	EVI1	"""MDS, AML"""								C|||	269	0.0537141	0.1271	0.013	5008	,	,		11401	0.0089		0.0119	False		,,,				2504	0.0726				p.G834G		.		Dom	yes		1	1p36.23-p33	63976	PR domain containing 16		L	.	PRDM16-660	0			c.C2502T						.	C	,	303,3017		7,289,1364	5.0	8.0	7.0		2502,2502	-5.2	0.0	1	dbSNP_132	7	113,7173		0,113,3530	no	coding-synonymous,coding-synonymous	PRDM16	NM_022114.3,NM_199454.2	,	7,402,4894	TT,TC,CC		1.5509,9.1265,3.9223	,	834/1277,834/1258	3329263	416,10190	1660	3643	5303	SO:0001819	synonymous_variant	63976	exon9			GCTGGGCGCCGGC	AF294278	CCDS41236.1, CCDS44048.1, CCDS41236.2, CCDS44048.2	1p36.23-p33	2013-01-08			ENSG00000142611	ENSG00000142611		"""Zinc fingers, C2H2-type"""	14000	protein-coding gene	gene with protein product	"""MDS1/EVI1-like"", ""PR-domain zinc finger protein 16"", ""transcription factor MEL1"""	605557				11050005	Standard	NM_199454		Approved	MEL1, PFM13, KIAA1675, MGC166915	uc001akf.3	Q9HAZ2	OTTHUMG00000000581	ENST00000270722.5:c.2502C>T	1.37:g.3329263C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	31	28	NM_022114	0	0	0	0	0	A6NHQ8|B1AJP7|B1AJP8|B1AJP9|B1WB48|Q8WYJ9|Q9C0I8	Silent	SNP	ENST00000270722.5	37	CCDS41236.2																																																																																			C|0.969;T|0.031		0.716	PRDM16-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000001382.3	NM_022114	
PTCHD2	57540	broad.mit.edu;bcgsc.ca	37	1	11589895	11589895	+	Missense_Mutation	SNP	C	C	T	rs201439934	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr1:11589895C>T	ENST00000294484.6	+	15	3119	c.2981C>T	c.(2980-2982)aCg>aTg	p.T994M	PTCHD2_ENST00000389575.3_Missense_Mutation_p.T994M	NM_020780.1	NP_065831.1	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	994					cholesterol homeostasis (GO:0042632)|regulation of lipid transport (GO:0032368)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	hedgehog receptor activity (GO:0008158)			NS(3)|breast(2)|endometrium(9)|kidney(4)|large_intestine(5)|lung(34)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	76	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		TGCGTGAACACGGGCTGCGGG	0.637													C|||	6	0.00119808	0.0	0.0014	5008	,	,		16957	0.0		0.0	False		,,,				2504	0.0051				p.T994M		.											.	PTCHD2-209	0			c.C2981T						.	C	MET/THR	0,3970		0,0,1985	60.0	71.0	67.0		2981	5.0	1.0	1		67	2,8294		0,2,4146	yes	missense	PTCHD2	NM_020780.1	81	0,2,6131	TT,TC,CC		0.0241,0.0,0.0163	benign	994/1393	11589895	2,12264	1985	4148	6133	SO:0001583	missense	57540	exon15			TGAACACGGGCTG	AB037758	CCDS41247.1	1p36.22	2010-02-17			ENSG00000204624	ENSG00000204624			29251	protein-coding gene	gene with protein product		611251				15738394	Standard	NM_020780		Approved	KIAA1337, DISP3	uc001ash.4	Q9P2K9	OTTHUMG00000002074	ENST00000294484.6:c.2981C>T	1.37:g.11589895C>T	ENSP00000294484:p.Thr994Met	Somatic	224	0		WXS	Illumina GAIIx	Phase_I	145	7	NM_020780	0	0	0	0	0	Q5VTU9|Q9UJD6	Missense_Mutation	SNP	ENST00000294484.6	37	CCDS41247.1	.	.	.	.	.	.	.	.	.	.	C	10.93	1.489329	0.26686	0.0	2.41E-4	ENSG00000204624	ENST00000294484;ENST00000389575	D;D	0.90133	-2.62;-2.62	4.97	4.97	0.65823	.	0.224806	0.37219	N	0.002190	T	0.77928	0.4204	N	0.08118	0	0.35268	D	0.780215	B	0.31968	0.349	B	0.15870	0.014	T	0.82542	-0.0405	10	0.51188	T	0.08	-17.3543	11.0104	0.47659	0.0:0.9105:0.0:0.0895	.	994	Q9P2K9	PTHD2_HUMAN	M	994	ENSP00000294484:T994M;ENSP00000374226:T994M	ENSP00000294484:T994M	T	+	2	0	PTCHD2	11512482	0.674000	0.27549	0.958000	0.39756	0.544000	0.35116	2.372000	0.44257	2.304000	0.77564	0.561000	0.74099	ACG	C|0.999;T|0.001		0.637	PTCHD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000005770.2	XM_052561	
FBXO6	26270	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	11728807	11728807	+	Missense_Mutation	SNP	G	G	A	rs146139993		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr1:11728807G>A	ENST00000376753.4	+	2	227	c.92G>A	c.(91-93)cGc>cAc	p.R31H		NM_018438.5	NP_060908.1	Q9NRD1	FBX6_HUMAN	F-box protein 6	31	F-box. {ECO:0000255|PROSITE- ProRule:PRU00080}.				DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|glycoprotein catabolic process (GO:0006516)|proteolysis (GO:0006508)|response to unfolded protein (GO:0006986)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)	carbohydrate binding (GO:0030246)|glycoprotein binding (GO:0001948)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|large_intestine(1)|lung(1)|ovary(1)|upper_aerodigestive_tract(2)	6	Ovarian(185;0.249)	Lung NSC(185;4.15e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.25e-06)|COAD - Colon adenocarcinoma(227;0.000251)|BRCA - Breast invasive adenocarcinoma(304;0.000297)|Kidney(185;0.000747)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00727)|READ - Rectum adenocarcinoma(331;0.0649)		GTGCCCGCCCGCCAGCTGCTG	0.632													.|||	1	0.000199681	0.0	0.0	5008	,	,		17702	0.0		0.0	False		,,,				2504	0.001				p.R31H	NSCLC(54;506 1562 46490 51389)	.											.	FBXO6-226	0			c.G92A						.	G	HIS/ARG	0,4406		0,0,2203	36.0	41.0	39.0		92	2.2	0.9	1	dbSNP_134	39	2,8590	2.2+/-6.3	0,2,4294	no	missense	FBXO6	NM_018438.5	29	0,2,6497	AA,AG,GG		0.0233,0.0,0.0154	possibly-damaging	31/294	11728807	2,12996	2203	4296	6499	SO:0001583	missense	26270	exon2			CCGCCCGCCAGCT	AF129536	CCDS133.1	1p36.22	2008-05-14	2004-06-15		ENSG00000116663	ENSG00000116663		"""F-boxes /  ""other"""""	13585	protein-coding gene	gene with protein product		605647	"""F-box only protein 6"""			10531035, 10945468	Standard	NM_018438		Approved	FBX6, FBG2, FBS2, Fbx6b	uc001aso.3	Q9NRD1	OTTHUMG00000002229	ENST00000376753.4:c.92G>A	1.37:g.11728807G>A	ENSP00000365944:p.Arg31His	Somatic	201	2		WXS	Illumina GAIIx	Phase_I	164	143	NM_018438	0	0	31	45	14	B1AK42|B2RC88|Q9UKT3	Missense_Mutation	SNP	ENST00000376753.4	37	CCDS133.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.151|8.151	0.787461|0.787461	0.16258|0.16258	0.0|0.0	2.33E-4|2.33E-4	ENSG00000116663|ENSG00000116663	ENST00000449067|ENST00000376753	.|T	.|0.45276	.|0.9	5.15|5.15	2.2|2.2	0.27929|0.27929	.|F-box domain, cyclin-like (2);F-box domain, Skp2-like (1);	.|0.434175	.|0.26959	.|N	.|0.021630	T|T	0.38427|0.38427	0.1040|0.1040	M|M	0.74647|0.74647	2.275|2.275	0.32950|0.32950	D|D	0.519642|0.519642	.|P	.|0.39157	.|0.662	.|B	.|0.37888	.|0.26	T|T	0.47484|0.47484	-0.9114|-0.9114	5|10	.|0.37606	.|T	.|0.19	-11.0719|-11.0719	6.1893|6.1893	0.20516|0.20516	0.1721:0.1589:0.669:0.0|0.1721:0.1589:0.669:0.0	.|.	.|31	.|Q9NRD1	.|FBX6_HUMAN	T|H	19|31	.|ENSP00000365944:R31H	.|ENSP00000365944:R31H	A|R	+|+	1|2	0|0	FBXO6|FBXO6	11651394|11651394	1.000000|1.000000	0.71417|0.71417	0.931000|0.931000	0.37212|0.37212	0.098000|0.098000	0.18820|0.18820	2.715000|2.715000	0.47210|0.47210	0.268000|0.268000	0.21939|0.21939	-0.142000|-0.142000	0.14014|0.14014	GCC|CGC	G|1.000;A|0.000		0.632	FBXO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006332.1	NM_018438	
MFN2	9927	broad.mit.edu	37	1	12069759	12069759	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr1:12069759T>C	ENST00000235329.5	+	18	2502	c.2180T>C	c.(2179-2181)cTt>cCt	p.L727P	MFN2_ENST00000444836.1_Missense_Mutation_p.L727P	NM_014874.3	NP_055689.1	O95140	MFN2_HUMAN	mitofusin 2	727					apoptotic process (GO:0006915)|autophagy (GO:0006914)|blastocyst formation (GO:0001825)|blood coagulation (GO:0007596)|camera-type eye morphogenesis (GO:0048593)|mitochondrial fusion (GO:0008053)|mitochondrial membrane organization (GO:0007006)|mitochondrion localization (GO:0051646)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of smooth muscle cell proliferation (GO:0048662)|protein localization to pre-autophagosomal structure (GO:0034497)|protein targeting to mitochondrion (GO:0006626)|response to unfolded protein (GO:0006986)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intrinsic component of mitochondrial outer membrane (GO:0031306)|microtubule cytoskeleton (GO:0015630)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|ubiquitin protein ligase binding (GO:0031625)			endometrium(4)|kidney(1)|large_intestine(4)|liver(2)|lung(3)|ovary(1)|pancreas(1)|prostate(2)|skin(2)	20	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;7.25e-06)|COAD - Colon adenocarcinoma(227;0.000302)|BRCA - Breast invasive adenocarcinoma(304;0.000329)|Kidney(185;0.000896)|KIRC - Kidney renal clear cell carcinoma(229;0.00274)|STAD - Stomach adenocarcinoma(313;0.00773)|READ - Rectum adenocarcinoma(331;0.0656)		CTTGACTCACTTCAGAGCAAA	0.572																																					p.L727P		.											.	MFN2-91	0			c.T2180C						.						71.0	71.0	71.0					1																	12069759		2203	4300	6503	SO:0001583	missense	9927	exon18			ACTCACTTCAGAG	AF036536	CCDS30587.1	1p36.22	2014-09-17			ENSG00000116688	ENSG00000116688			16877	protein-coding gene	gene with protein product		608507				12499352, 11181170	Standard	NM_014874		Approved	CPRP1, KIAA0214, MARF, CMT2A2	uc009vni.3	O95140	OTTHUMG00000002392	ENST00000235329.5:c.2180T>C	1.37:g.12069759T>C	ENSP00000235329:p.Leu727Pro	Somatic	133	0		WXS	Illumina GAIIx	Phase_I	93	3	NM_014874	0	0	45	45	0	A8K1B3|O95572|Q5JXC3|Q5JXC4|Q9H131|Q9NSX8	Missense_Mutation	SNP	ENST00000235329.5	37	CCDS30587.1	.	.	.	.	.	.	.	.	.	.	T	23.7	4.447694	0.84101	.	.	ENSG00000116688	ENST00000444836;ENST00000235329	D;D	0.96885	-4.16;-4.16	5.55	5.55	0.83447	Fzo/mitofusin HR2 domain (1);	0.000000	0.64402	D	0.000001	D	0.96741	0.8936	L	0.40543	1.245	0.80722	D	1	D	0.69078	0.997	D	0.71656	0.974	D	0.97089	0.9789	10	0.56958	D	0.05	-17.9384	15.0317	0.71713	0.0:0.0:0.0:1.0	.	727	O95140	MFN2_HUMAN	P	727	ENSP00000416338:L727P;ENSP00000235329:L727P	ENSP00000235329:L727P	L	+	2	0	MFN2	11992346	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	7.525000	0.81892	2.333000	0.79357	0.533000	0.62120	CTT	.		0.572	MFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006859.2	NM_014874	
FHAD1	114827	ucsc.edu;bcgsc.ca;mdanderson.org	37	1	15701119	15701119	+	Missense_Mutation	SNP	G	G	A	rs551415115		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr1:15701119G>A	ENST00000375998.4	+	25	3503	c.3503G>A	c.(3502-3504)cGc>cAc	p.R1168H	FHAD1_ENST00000375999.3_Missense_Mutation_p.R1168H|FHAD1_ENST00000314740.8_Missense_Mutation_p.R421H|FHAD1_ENST00000417793.1_Missense_Mutation_p.R1132H|FHAD1_ENST00000471347.1_3'UTR|FHAD1_ENST00000358897.4_Missense_Mutation_p.R1168H			B1AJZ9	FHAD1_HUMAN	forkhead-associated (FHA) phosphopeptide binding domain 1	1168										skin(1)|stomach(1)	2						GAGAAGGCGCGCTCACCAGGT	0.547																																					p.R1168H		.											.	FHAD1-69	0			c.G3503A						.						46.0	43.0	44.0					1																	15701119		692	1591	2283	SO:0001583	missense	114827	exon26			AGGCGCGCTCACC	AK093300		1p36.21	2012-04-19			ENSG00000142621	ENSG00000142621			29408	protein-coding gene	gene with protein product						11572484	Standard	NM_052929		Approved	KIAA1937	uc001awb.2	B1AJZ9	OTTHUMG00000002088	ENST00000375998.4:c.3503G>A	1.37:g.15701119G>A	ENSP00000365166:p.Arg1168His	Somatic	220	2		WXS	Illumina GAIIx	Phase_I	152	135	NM_052929	0	0	0	0	0	Q0P6F5|Q8N8D3|Q8N9T6|Q8NA05	Missense_Mutation	SNP	ENST00000375998.4	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.04|10.04	1.241801|1.241801	0.22711|0.22711	.|.	.|.	ENSG00000142621|ENSG00000142621	ENST00000444385|ENST00000358897;ENST00000417793;ENST00000375999;ENST00000375998;ENST00000529606;ENST00000314740;ENST00000314668	.|T;T;T;T;T;T;T	.|0.49432	.|0.79;0.79;0.78;0.79;0.82;0.81;0.82	5.54|5.54	-2.29|-2.29	0.06805|0.06805	.|.	.|.	.|.	.|.	.|.	T|T	0.29190|0.29190	0.0726|0.0726	L|L	0.34521|0.34521	1.04|1.04	0.09310|0.09310	N|N	1|1	.|B;B	.|0.12013	.|0.001;0.005	.|B;B	.|0.06405	.|0.002;0.001	T|T	0.18241|0.18241	-1.0343|-1.0343	5|9	.|0.42905	.|T	.|0.14	.|.	2.5555|2.5555	0.04759|0.04759	0.3661:0.1146:0.4029:0.1165|0.3661:0.1146:0.4029:0.1165	.|.	.|421;1168	.|B7WPP2;B1AJZ9	.|.;FHAD1_HUMAN	T|H	487|1168;1132;1168;1168;439;421;403	.|ENSP00000351770:R1168H;ENSP00000407615:R1132H;ENSP00000365167:R1168H;ENSP00000365166:R1168H;ENSP00000434909:R439H;ENSP00000322979:R421H;ENSP00000318812:R403H	.|ENSP00000318812:R403H	A|R	+|+	1|2	0|0	FHAD1|FHAD1	15573706|15573706	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	-0.412000|-0.412000	0.07132|0.07132	-0.640000|-0.640000	0.05495|0.05495	-0.813000|-0.813000	0.03139|0.03139	GCT|CGC	.		0.547	FHAD1-026	PUTATIVE	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000393400.2	NM_052929	
CASP9	842	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	15820441	15820441	+	Silent	SNP	G	G	A	rs149161953		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr1:15820441G>A	ENST00000333868.5	-	8	1198	c.1104C>T	c.(1102-1104)gaC>gaT	p.D368D	CASP9_ENST00000348549.5_Silent_p.D218D|CASP9_ENST00000546424.1_Silent_p.D368D|CASP9_ENST00000375890.4_Silent_p.D285D	NM_001229.3	NP_001220.2	P55211	CASP9_HUMAN	caspase 9, apoptosis-related cysteine peptidase	368					activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|aging (GO:0007568)|apoptotic process (GO:0006915)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell apoptotic process (GO:0034349)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet formation (GO:0030220)|positive regulation of apoptotic process (GO:0043065)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of apoptotic process (GO:0042981)|regulation of response to DNA damage stimulus (GO:2001020)|response to antibiotic (GO:0046677)|response to cobalt ion (GO:0032025)|response to estradiol (GO:0032355)|response to lipopolysaccharide (GO:0032496)|signal transduction in response to DNA damage (GO:0042770)	apoptosome (GO:0043293)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|enzyme activator activity (GO:0008047)|peptidase activity (GO:0008233)|protein kinase binding (GO:0019901)|SH3 domain binding (GO:0017124)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|stomach(1)	18		Breast(348;0.000207)|all_lung(284;0.000211)|Colorectal(325;0.000259)|Lung NSC(340;0.000269)|Renal(390;0.000518)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;8.49e-07)|COAD - Colon adenocarcinoma(227;4.36e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00013)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00763)|READ - Rectum adenocarcinoma(331;0.0655)		CAAAGATGTCGTCCAGGGTCT	0.597													G|||	1	0.000199681	0.0	0.0	5008	,	,		17884	0.001		0.0	False		,,,				2504	0.0				p.D368D		.											.	CASP9-1083	0			c.C1104T						.						72.0	53.0	60.0					1																	15820441		2203	4300	6503	SO:0001819	synonymous_variant	842	exon8			GATGTCGTCCAGG	U60521	CCDS158.1, CCDS159.1, CCDS159.2, CCDS59995.1	1p36.21	2012-04-17	2005-08-17		ENSG00000132906	ENSG00000132906		"""Caspases"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1511	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 56"""	602234	"""caspase 9, apoptosis-related cysteine protease"""			8663294, 9390557	Standard	NM_001229		Approved	MCH6, ICE-LAP6, APAF-3, PPP1R56	uc001awn.4	P55211	OTTHUMG00000002256	ENST00000333868.5:c.1104C>T	1.37:g.15820441G>A		Somatic	49	0		WXS	Illumina GAIIx	Phase_I	47	42	NM_001229	0	0	1	10	9	B4E1A3|O95348|Q53Y70|Q5JRU9|Q5UGI1|Q92852|Q9BQ62|Q9UEQ3|Q9UIJ8	Silent	SNP	ENST00000333868.5	37	CCDS158.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	0.024	-1.387722	0.01194	.	.	ENSG00000132906	ENST00000424908	.	.	.	5.7	-2.64	0.06114	.	.	.	.	.	.	.	.	.	.	.	0.33981	D	0.647932	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.361	0.49644	0.6271:0.0:0.3729:0.0	.	.	.	.	X	150	.	.	R	-	1	2	CASP9	15693028	0.001000	0.12720	0.021000	0.16686	0.041000	0.13682	-0.321000	0.08018	-0.356000	0.08187	-0.136000	0.14681	CGA	G|0.999;A|0.000		0.597	CASP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006438.1	NM_032996	
UBR4	23352	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	19479813	19479813	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr1:19479813G>A	ENST00000375254.3	-	46	6841	c.6814C>T	c.(6814-6816)Cgc>Tgc	p.R2272C	UBR4_ENST00000375217.2_Missense_Mutation_p.R2272C|UBR4_ENST00000375226.2_Missense_Mutation_p.R2272C|UBR4_ENST00000375267.2_Missense_Mutation_p.R2272C	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	2272					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		GCTGTTTTGCGCTTTCGAACA	0.502																																					p.R2272C		.											.	UBR4-612	0			c.C6814T						.						150.0	124.0	133.0					1																	19479813		2203	4300	6503	SO:0001583	missense	23352	exon46			TTTTGCGCTTTCG	AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.6814C>T	1.37:g.19479813G>A	ENSP00000364403:p.Arg2272Cys	Somatic	179	0		WXS	Illumina GAIIx	Phase_I	106	99	NM_020765	0	0	0	2	2	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Missense_Mutation	SNP	ENST00000375254.3	37	CCDS189.1	.	.	.	.	.	.	.	.	.	.	G	27.6	4.847887	0.91277	.	.	ENSG00000127481	ENST00000375254;ENST00000375267;ENST00000375217;ENST00000375226;ENST00000417040;ENST00000419533	T;T;T;T;T	0.15256	2.44;2.44;2.44;2.44;2.44	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	T	0.33235	0.0856	L	0.34521	1.04	0.80722	D	1	D;D	0.89917	0.998;1.0	P;D	0.74023	0.9;0.982	T	0.05131	-1.0904	10	0.87932	D	0	.	18.78	0.91928	0.0:0.0:1.0:0.0	.	2273;2272	Q5T4S7-5;Q5T4S7	.;UBR4_HUMAN	C	2272;2272;2272;2272;982;1489	ENSP00000364403:R2272C;ENSP00000364416:R2272C;ENSP00000364365:R2272C;ENSP00000364374:R2272C;ENSP00000404897:R982C	ENSP00000364365:R2272C	R	-	1	0	UBR4	19352400	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	9.019000	0.93662	2.672000	0.90937	0.591000	0.81541	CGC	.		0.502	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007085.1	NM_020765	
WNT4	54361	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	22446583	22446583	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr1:22446583C>T	ENST00000290167.6	-	5	1059	c.1016G>A	c.(1015-1017)cGg>cAg	p.R339Q	WNT4_ENST00000542383.1_Missense_Mutation_p.R284Q	NM_030761.4	NP_110388.2	P56705	WNT4_HUMAN	wingless-type MMTV integration site family, member 4	339					adrenal gland development (GO:0030325)|androgen biosynthetic process (GO:0006702)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|cell fate commitment (GO:0045165)|cellular response to starvation (GO:0009267)|cellular response to transforming growth factor beta stimulus (GO:0071560)|embryonic epithelial tube formation (GO:0001838)|epithelial to mesenchymal transition (GO:0001837)|establishment of protein localization to plasma membrane (GO:0090002)|female gonad development (GO:0008585)|female sex determination (GO:0030237)|immature T cell proliferation in thymus (GO:0033080)|kidney development (GO:0001822)|liver development (GO:0001889)|male gonad development (GO:0008584)|mammary gland epithelium development (GO:0061180)|mesenchymal to epithelial transition (GO:0060231)|metanephric mesenchymal cell differentiation (GO:0072162)|metanephric nephron morphogenesis (GO:0072273)|metanephric tubule formation (GO:0072174)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell differentiation (GO:0045596)|negative regulation of cell migration (GO:0030336)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of gene expression (GO:0010629)|negative regulation of male gonad development (GO:2000019)|negative regulation of steroid biosynthetic process (GO:0010894)|negative regulation of testicular blood vessel morphogenesis (GO:0061369)|negative regulation of testosterone biosynthetic process (GO:2000225)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of wound healing (GO:0061045)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway via MAPK cascade (GO:0038030)|oocyte development (GO:0048599)|paramesonephric duct development (GO:0061205)|positive regulation of aldosterone biosynthetic process (GO:0032349)|positive regulation of bone mineralization (GO:0030501)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of cortisol biosynthetic process (GO:2000066)|positive regulation of dermatome development (GO:0061184)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of meiosis (GO:0045836)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription, DNA-templated (GO:0045893)|protein palmitoylation (GO:0018345)|regulation of cell-cell adhesion (GO:0022407)|renal vesicle formation (GO:0072033)|renal vesicle induction (GO:0072034)|smooth muscle cell differentiation (GO:0051145)|somatotropin secreting cell differentiation (GO:0060126)|tertiary branching involved in mammary gland duct morphogenesis (GO:0060748)|thyroid-stimulating hormone-secreting cell differentiation (GO:0060129)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)|transcription corepressor activity (GO:0003714)			breast(1)|endometrium(1)|large_intestine(2)|lung(1)|ovary(1)|prostate(2)	8		Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;6.55e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;9.02e-26)|Colorectal(126;1.71e-07)|COAD - Colon adenocarcinoma(152;1.17e-05)|GBM - Glioblastoma multiforme(114;2.01e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000568)|KIRC - Kidney renal clear cell carcinoma(1967;0.00277)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.138)		CTGGCACTGCCGGCACTTGAC	0.637																																					p.R339Q		.											.	WNT4-524	0			c.G1016A						.						34.0	33.0	33.0					1																	22446583		2203	4300	6503	SO:0001583	missense	54361	exon5			CACTGCCGGCACT	AL031281	CCDS223.1	1p36.23-p35.1	2013-02-28			ENSG00000162552	ENSG00000162552		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12783	protein-coding gene	gene with protein product		603490				8168088	Standard	NM_030761		Approved	WNT-4	uc001bfs.4	P56705	OTTHUMG00000002894	ENST00000290167.6:c.1016G>A	1.37:g.22446583C>T	ENSP00000290167:p.Arg339Gln	Somatic	79	0		WXS	Illumina GAIIx	Phase_I	85	78	NM_030761	0	0	0	0	0	B4DJF9|Q5TZQ0|Q96T81|Q9BXF5|Q9H1J8|Q9UJM2	Missense_Mutation	SNP	ENST00000290167.6	37	CCDS223.1	.	.	.	.	.	.	.	.	.	.	c	5.859	0.342641	0.11069	.	.	ENSG00000162552	ENST00000290167;ENST00000542383	T;T	0.75154	-0.91;-0.91	4.16	4.16	0.48862	.	0.118609	0.53938	D	0.000055	T	0.41305	0.1153	N	0.01219	-0.95	0.34214	D	0.67465	B	0.13145	0.007	B	0.09377	0.004	T	0.48581	-0.9023	10	0.25106	T	0.35	.	6.5041	0.22186	0.0:0.8001:0.0:0.1999	.	339	P56705	WNT4_HUMAN	Q	339;284	ENSP00000290167:R339Q;ENSP00000441033:R284Q	ENSP00000290167:R339Q	R	-	2	0	WNT4	22319170	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	3.975000	0.56859	2.312000	0.78011	0.450000	0.29827	CGG	.		0.637	WNT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008088.2		
PIGV	55650	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	27121404	27121404	+	Silent	SNP	G	G	A	rs147229452	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr1:27121404G>A	ENST00000374145.1	+	3	1561	c.879G>A	c.(877-879)ccG>ccA	p.P293P	PIGV_ENST00000078527.4_Silent_p.P293P|PIGV_ENST00000449950.2_Silent_p.P65P	NM_001202554.1	NP_001189483.1	Q9NUD9	PIGV_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class V	293					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	mannosyltransferase activity (GO:0000030)			NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(2)	14		all_cancers(24;3.93e-26)|all_epithelial(13;3.96e-23)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.26e-54)|Epithelial(14;2.85e-53)|OV - Ovarian serous cystadenocarcinoma(117;1.91e-30)|Colorectal(126;1.31e-09)|COAD - Colon adenocarcinoma(152;3.45e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000504)|STAD - Stomach adenocarcinoma(196;0.000588)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|GBM - Glioblastoma multiforme(114;0.0222)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.153)|LUSC - Lung squamous cell carcinoma(448;0.227)		GAAATGAACCGCCTTGGTGCT	0.498													g|||	3	0.000599042	0.0023	0.0	5008	,	,		21025	0.0		0.0	False		,,,				2504	0.0				p.P293P		.											.	PIGV-91	0			c.G879A						.		,	2,4404	6.2+/-15.9	0,2,2201	218.0	224.0	222.0		879,879	-10.6	0.1	1	dbSNP_134	222	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	PIGV	NM_001202554.1,NM_017837.3	,	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	,	293/494,293/494	27121404	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	55650	exon3			TGAACCGCCTTGG	AK000484	CCDS287.1	1p36.11	2013-02-26	2006-06-28		ENSG00000060642	ENSG00000060642		"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"", ""Phosphatidylinositol glycan anchor biosynthesis"""	26031	protein-coding gene	gene with protein product	"""GPI mannosyltransferase 2"", ""dol-P-Man dependent GPI mannosyltransferase"""	610274	"""phosphatidylinositol glycan, class V"""			15623507	Standard	NM_017837		Approved	FLJ20477	uc001bmz.3	Q9NUD9	OTTHUMG00000004005	ENST00000374145.1:c.879G>A	1.37:g.27121404G>A		Somatic	213	0		WXS	Illumina GAIIx	Phase_I	181	167	NM_001202554	0	1	0	10	9	D3DPL2|Q5JYG7|Q5JYG8|Q5JYG9|Q9NX26	Silent	SNP	ENST00000374145.1	37	CCDS287.1																																																																																			G|1.000;A|0.000		0.498	PIGV-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011441.1	NM_017837	
WASF2	10163	broad.mit.edu;bcgsc.ca	37	1	27736229	27736229	+	Silent	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr1:27736229G>A	ENST00000430629.2	-	8	1511	c.1296C>T	c.(1294-1296)gcC>gcT	p.A432A	WASF2_ENST00000536657.1_Intron	NM_001201404.1|NM_006990.3	NP_001188333.1|NP_008921.1	Q9Y6W5	WASF2_HUMAN	WAS protein family, member 2	432					actin cytoskeleton organization (GO:0030036)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of lamellipodium assembly (GO:0010592)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|SCAR complex (GO:0031209)	actin binding (GO:0003779)|protein complex binding (GO:0032403)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	18		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0446)|OV - Ovarian serous cystadenocarcinoma(117;2.46e-25)|Colorectal(126;1.7e-08)|COAD - Colon adenocarcinoma(152;2e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00139)|KIRC - Kidney renal clear cell carcinoma(1967;0.00204)|STAD - Stomach adenocarcinoma(196;0.00325)|READ - Rectum adenocarcinoma(331;0.0481)		CATCGCTCACGGCAGGCAAGG	0.582																																					p.A432A		.											.	WASF2-228	0			c.C1296T						.						81.0	77.0	78.0					1																	27736229		2203	4300	6503	SO:0001819	synonymous_variant	10163	exon8			GCTCACGGCAGGC	AB026542	CCDS304.1, CCDS55582.1	1p36.11	2011-05-10			ENSG00000158195	ENSG00000158195			12733	protein-coding gene	gene with protein product		605875				10381382	Standard	NM_006990		Approved	WAVE2, SCAR2	uc001bof.2	Q9Y6W5	OTTHUMG00000003393	ENST00000430629.2:c.1296C>T	1.37:g.27736229G>A		Somatic	337	0		WXS	Illumina GAIIx	Phase_I	176	7	NM_006990	0	0	38	39	1	B4DZN0|O60794|Q9UDY7	Silent	SNP	ENST00000430629.2	37	CCDS304.1																																																																																			.		0.582	WASF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009516.1	NM_006990	
EIF3I	8668	broad.mit.edu	37	1	32694136	32694136	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr1:32694136C>T	ENST00000373586.1	+	7	637	c.565C>T	c.(565-567)Cgg>Tgg	p.R189W	EIF3I_ENST00000471486.1_3'UTR	NM_003757.2	NP_003748.1			eukaryotic translation initiation factor 3, subunit I											breast(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	12		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.212)				GGAGCACTCCCGGCAGATCAA	0.542																																					p.R189W	Colon(102;1138 2140 2180 17876)	.											.	EIF3I-69	0			c.C565T						.						154.0	132.0	140.0					1																	32694136		2203	4300	6503	SO:0001583	missense	8668	exon7			CACTCCCGGCAGA	U39067	CCDS357.1	1p34.1	2013-01-10	2007-07-27	2007-07-27	ENSG00000084623	ENSG00000084623		"""WD repeat domain containing"""	3272	protein-coding gene	gene with protein product		603911	"""eukaryotic translation initiation factor 3, subunit 2 beta, 36kDa"""	EIF3S2		7566156, 8995409	Standard	NM_003757		Approved	TRIP-1, eIF3-beta, eIF3-p36, eIF3i	uc009vuc.3	Q13347	OTTHUMG00000007364	ENST00000373586.1:c.565C>T	1.37:g.32694136C>T	ENSP00000362688:p.Arg189Trp	Somatic	217	0		WXS	Illumina GAIIx	Phase_I	137	4	NM_003757	0	0	219	219	0		Missense_Mutation	SNP	ENST00000373586.1	37	CCDS357.1	.	.	.	.	.	.	.	.	.	.	C	18.53	3.644066	0.67244	.	.	ENSG00000084623	ENST00000373586	T	0.60672	0.17	4.51	2.47	0.30058	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.100261	0.64402	D	0.000008	T	0.56016	0.1957	L	0.43598	1.365	0.38840	D	0.956036	P	0.38300	0.626	P	0.49140	0.601	T	0.59369	-0.7467	10	0.66056	D	0.02	-21.0433	7.1508	0.25610	0.3026:0.5986:0.0:0.0989	.	189	Q13347	EIF3I_HUMAN	W	189	ENSP00000362688:R189W	ENSP00000362688:R189W	R	+	1	2	EIF3I	32466723	0.999000	0.42202	0.995000	0.50966	0.977000	0.68977	2.853000	0.48317	1.025000	0.39708	0.462000	0.41574	CGG	.		0.542	EIF3I-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019282.2	NM_003757	
HDAC1	3065	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	32792571	32792571	+	Silent	SNP	G	G	A	rs571782325		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr1:32792571G>A	ENST00000373548.3	+	5	471	c.387G>A	c.(385-387)acG>acA	p.T129T	HDAC1_ENST00000373541.2_5'UTR	NM_004964.2	NP_004955.2	Q13547	HDAC1_HUMAN	histone deacetylase 1	129	Histone deacetylase.				ATP-dependent chromatin remodeling (GO:0043044)|blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|chromatin remodeling (GO:0006338)|circadian regulation of gene expression (GO:0032922)|embryonic digit morphogenesis (GO:0042733)|epidermal cell differentiation (GO:0009913)|eyelid development in camera-type eye (GO:0061029)|fungiform papilla formation (GO:0061198)|gene expression (GO:0010467)|hair follicle placode formation (GO:0060789)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|mitotic cell cycle (GO:0000278)|negative regulation by host of viral transcription (GO:0043922)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell cycle (GO:0045786)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of cell proliferation (GO:0008284)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein deacetylation (GO:0006476)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone deacetylase complex (GO:0000118)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)|Sin3 complex (GO:0016580)	activating transcription factor binding (GO:0033613)|core promoter binding (GO:0001047)|deacetylase activity (GO:0019213)|enzyme binding (GO:0019899)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein deacetylase activity (GO:0033558)|repressing transcription factor binding (GO:0070491)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			NS(1)|breast(3)|endometrium(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	18		Breast(348;0.000523)|Lung NSC(340;0.000992)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Lung SC(1967;0.113)		KIRC - Kidney renal clear cell carcinoma(1967;0.138)	Vorinostat(DB02546)	AGCAGCAGACGGACATCGCTG	0.517																																					p.T129T		.											.	HDAC1-659	0			c.G387A						.						111.0	102.0	105.0					1																	32792571		2203	4300	6503	SO:0001819	synonymous_variant	3065	exon5			GCAGACGGACATC	D50405	CCDS360.1	1p34	2008-02-05			ENSG00000116478	ENSG00000116478			4852	protein-coding gene	gene with protein product		601241		RPD3L1		8602529	Standard	NM_004964		Approved	HD1, GON-10	uc001bvb.1	Q13547	OTTHUMG00000007529	ENST00000373548.3:c.387G>A	1.37:g.32792571G>A		Somatic	138	0		WXS	Illumina GAIIx	Phase_I	76	68	NM_004964	0	0	1	84	83	Q92534	Silent	SNP	ENST00000373548.3	37	CCDS360.1																																																																																			.		0.517	HDAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019815.3	NM_004964	
AGO3	192669	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	36437637	36437637	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr1:36437637G>A	ENST00000373191.4	+	4	674	c.325G>A	c.(325-327)Gtt>Att	p.V109I	AGO3_ENST00000324350.5_Missense_Mutation_p.V109I|AGO3_ENST00000246314.6_5'UTR|AGO3_ENST00000397828.2_Missense_Mutation_p.V109I	NM_024852.3	NP_079128.2	Q9H9G7	AGO3_HUMAN	argonaute RISC catalytic component 3	109					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA catabolic process (GO:0006402)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of stem cell proliferation (GO:0072091)	cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|RISC complex (GO:0016442)	miRNA binding (GO:0035198)|poly(A) RNA binding (GO:0044822)										AGATTTAGACGTTACTTTACC	0.358																																					p.V109I		.											.	.	0			c.G325A						.						89.0	82.0	85.0					1																	36437637		2203	4300	6503	SO:0001583	missense	192669	exon4			TTAGACGTTACTT	AB046787	CCDS399.1, CCDS400.1	1p34	2013-06-03	2013-02-15	2013-02-15	ENSG00000126070	ENSG00000126070		"""Argonaute/PIWI family"""	18421	protein-coding gene	gene with protein product	"""argonaute 3"""	607355	"""eukaryotic translation initiation factor 2C, 3"""	EIF2C3		12906857	Standard	NM_024852		Approved	hAGO3, FLJ12765	uc001bzp.3	Q9H9G7	OTTHUMG00000184172	ENST00000373191.4:c.325G>A	1.37:g.36437637G>A	ENSP00000362287:p.Val109Ile	Somatic	234	0		WXS	Illumina GAIIx	Phase_I	124	111	NM_024852	0	0	0	0	0	B1ALI0|Q5TA55|Q9H1U6	Missense_Mutation	SNP	ENST00000373191.4	37	CCDS399.1	.	.	.	.	.	.	.	.	.	.	G	29.8	5.039538	0.93630	.	.	ENSG00000126070	ENST00000324350;ENST00000373191;ENST00000397828	T	0.10288	2.89	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	T	0.12603	0.0306	L	0.46885	1.475	0.80722	D	1	B;P	0.44241	0.291;0.829	B;B	0.37508	0.086;0.252	T	0.04115	-1.0976	10	0.36615	T	0.2	-9.1634	19.3404	0.94339	0.0:0.0:1.0:0.0	.	109;109	Q9H9G7;Q5TA56	AGO3_HUMAN;.	I	109	ENSP00000362287:V109I	ENSP00000317425:V109I	V	+	1	0	EIF2C3	36210224	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.813000	0.99286	2.631000	0.89168	0.467000	0.42956	GTT	.		0.358	AGO3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019831.4	NM_024852	
SMAP2	64744	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	40872411	40872411	+	5'UTR	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr1:40872411C>T	ENST00000539317.1	+	0	60					NM_001198980.1	NP_001185909.1	Q8WU79	SMAP2_HUMAN	small ArfGAP2						regulation of ARF GTPase activity (GO:0032312)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			central_nervous_system(3)|kidney(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(2)|upper_aerodigestive_tract(1)	24	Lung NSC(20;1.56e-05)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;1.04e-17)			TTCACAGGGCCGCGATGGGCC	0.433																																					p.P36L		.											.	SMAP2-68	0			c.C107T						.						78.0	79.0	79.0					1																	40872411		2203	4300	6503	SO:0001623	5_prime_UTR_variant	64744	exon2			CAGGGCCGCGATG	AL137764	CCDS451.1, CCDS55592.1, CCDS55593.1, CCDS72763.1	1p35.3-p34.1	2008-09-22	2008-09-05	2008-01-09	ENSG00000084070	ENSG00000084070		"""ADP-ribosylation factor GTPase activating proteins"""	25082	protein-coding gene	gene with protein product			"""stromal membrane-associated protein 1-like"", ""stromal membrane-associated GTPase-activating protein 2"""	SMAP1L		16571680	Standard	NM_001198978		Approved		uc001cfj.3	Q8WU79	OTTHUMG00000007301	ENST00000539317.1:c.-134C>T	1.37:g.40872411C>T		Somatic	81	0		WXS	Illumina GAIIx	Phase_I	64	62	NM_022733	0	0	0	0	0	B2R7T1|B7Z5B5|B7Z8V2|D3DPV2|Q5QPL2|Q96C93|Q9NST2|Q9UJL8	Missense_Mutation	SNP	ENST00000539317.1	37	CCDS55593.1	.	.	.	.	.	.	.	.	.	.	C	34	5.391838	0.95988	.	.	ENSG00000084070	ENST00000435168;ENST00000372718;ENST00000372708	T;T	0.69306	-0.39;-0.39	6.06	6.06	0.98353	.	0.045333	0.85682	D	0.000000	D	0.89543	0.6745	H	0.98388	4.22	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.92832	0.6281	10	0.87932	D	0	-10.9891	18.1147	0.89549	0.0:1.0:0.0:0.0	.	6;36	Q8WU79-2;Q8WU79	.;SMAP2_HUMAN	L	36;36;6	ENSP00000361803:P36L;ENSP00000361793:P6L	ENSP00000361793:P6L	P	+	2	0	SMAP2	40644998	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	7.818000	0.86416	2.882000	0.98803	0.655000	0.94253	CCG	.		0.433	SMAP2-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_022733	
CDC20	991	bcgsc.ca	37	1	43826794	43826794	+	Missense_Mutation	SNP	G	G	A	rs1801456	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr1:43826794G>A	ENST00000372462.1	+	8	1284	c.1081G>A	c.(1081-1083)Gta>Ata	p.V361I	ELOVL1_ENST00000470769.1_5'Flank|RP1-92O14.3_ENST00000424948.1_RNA|CDC20_ENST00000310955.6_Missense_Mutation_p.V361I			Q12834	CDC20_HUMAN	cell division cycle 20	361					activation of anaphase-promoting complex activity (GO:0051488)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell cycle (GO:0007049)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of cell proliferation (GO:0008284)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic plasticity (GO:0031915)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein ubiquitination (GO:0016567)|regulation of dendrite development (GO:0050773)|regulation of meiosis (GO:0040020)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)|spindle (GO:0005819)	enzyme binding (GO:0019899)|protein C-terminus binding (GO:0008022)			endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)	15	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				CATCTAGGCCGTAGCATGGTG	0.557													G|||	23	0.00459265	0.0	0.0014	5008	,	,		20763	0.0		0.004	False		,,,				2504	0.0184				p.V361I	Esophageal Squamous(137;1154 1759 10362 10401 46925)	.											.	CDC20-227	0			c.G1081A						.	G	ILE/VAL	9,4397	15.5+/-35.6	0,9,2194	74.0	68.0	70.0		1081	5.6	1.0	1	dbSNP_89	70	72,8528	42.2+/-99.7	0,72,4228	yes	missense	CDC20	NM_001255.2	29	0,81,6422	AA,AG,GG		0.8372,0.2043,0.6228	benign	361/500	43826794	81,12925	2203	4300	6503	SO:0001583	missense	991	exon9			TAGGCCGTAGCAT	U05340	CCDS484.1	1p34.1	2013-01-17	2013-01-17		ENSG00000117399	ENSG00000117399		"""WD repeat domain containing"""	1723	protein-coding gene	gene with protein product		603618	"""CDC20 (cell division cycle 20, S. cerevisiae, homolog)"", ""CDC20 cell division cycle 20 homolog (S. cerevisiae)"", ""cell division cycle 20 homolog (S. cerevisiae)"""			7513050, 9353311	Standard	NM_001255		Approved	p55CDC, CDC20A	uc001cix.3	Q12834	OTTHUMG00000007420	ENST00000372462.1:c.1081G>A	1.37:g.43826794G>A	ENSP00000361540:p.Val361Ile	Somatic	93	0		WXS	Illumina GAIIx	Phase_I	72	6	NM_001255	0	0	0	0	0	B2R6Z6|D3DPJ1|Q5JUY4|Q9BW56|Q9UQI9	Missense_Mutation	SNP	ENST00000372462.1	37	CCDS484.1	5	0.0022893772893772895	0	0.0	1	0.0027624309392265192	0	0.0	4	0.005277044854881266	G	14.00	2.404364	0.42613	0.002043	0.008372	ENSG00000117399	ENST00000437896;ENST00000310955;ENST00000372462	T;T	0.61040	0.14;0.14	5.64	5.64	0.86602	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.056219	0.64402	D	0.000001	T	0.39091	0.1065	N	0.21508	0.67	0.51482	D	0.999924	B	0.29232	0.238	B	0.28784	0.094	T	0.29027	-1.0025	10	0.31617	T	0.26	-9.4945	19.6871	0.95984	0.0:0.0:1.0:0.0	rs1801456;rs41269543	361	Q12834	CDC20_HUMAN	I	337;361;361	ENSP00000308450:V361I;ENSP00000361540:V361I	ENSP00000308450:V361I	V	+	1	0	CDC20	43599381	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	2.838000	0.48199	2.663000	0.90544	0.561000	0.74099	GTA	G|0.996;A|0.004		0.557	CDC20-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019488.1	NM_001255	
PTPRF	5792	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	44057523	44057523	+	Silent	SNP	G	G	A	rs529058684	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr1:44057523G>A	ENST00000359947.4	+	10	1912	c.1572G>A	c.(1570-1572)tcG>tcA	p.S524S	PTPRF_ENST00000438120.1_Silent_p.S524S|PTPRF_ENST00000422171.2_5'UTR|PTPRF_ENST00000372413.3_Silent_p.S524S|PTPRF_ENST00000372414.3_Silent_p.S524S	NM_002840.3	NP_002831.2	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F	524	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|negative regulation of receptor binding (GO:1900121)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	heparin binding (GO:0008201)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(2)|breast(4)|central_nervous_system(3)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(24)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)	72	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				AGGTGGAGTCGGACACCAGGA	0.642													G|||	2	0.000399361	0.0	0.0	5008	,	,		17654	0.0		0.0	False		,,,				2504	0.002				p.S524S		.											.	PTPRF-232	0			c.G1572A						.						37.0	33.0	35.0					1																	44057523		2203	4300	6503	SO:0001819	synonymous_variant	5792	exon10			GGAGTCGGACACC	Y00815	CCDS489.2, CCDS490.2	1p34	2013-02-11			ENSG00000142949	ENSG00000142949		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9670	protein-coding gene	gene with protein product		179590		LAR		7558042	Standard	NM_130440		Approved		uc001cjr.3	P10586	OTTHUMG00000007501	ENST00000359947.4:c.1572G>A	1.37:g.44057523G>A		Somatic	254	0		WXS	Illumina GAIIx	Phase_I	138	40	NM_002840	0	0	2	3	1	D3DPX6|D3DPX7|Q5T021|Q5T022|Q5W9G2|Q86WS0	Silent	SNP	ENST00000359947.4	37	CCDS489.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.695|8.695	0.908260|0.908260	0.17833|0.17833	.|.	.|.	ENSG00000142949|ENSG00000142949	ENST00000412568;ENST00000414879|ENST00000429895	.|.	.|.	.|.	4.95|4.95	-9.91|-9.91	0.00458|0.00458	.|.	.|.	.|.	.|.	.|.	T|T	0.41465|0.41465	0.1160|0.1160	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.50154|0.50154	-0.8861|-0.8861	4|4	.|.	.|.	.|.	.|.	4.6794|4.6794	0.12727|0.12727	0.5716:0.1986:0.1041:0.1257|0.5716:0.1986:0.1041:0.1257	.|.	.|.	.|.	.|.	R|Q	192;49|181	.|.	.|.	G|R	+|+	1|2	0|0	PTPRF|PTPRF	43830110|43830110	0.000000|0.000000	0.05858|0.05858	0.020000|0.020000	0.16555|0.16555	0.862000|0.862000	0.49288|0.49288	-3.381000|-3.381000	0.00491|0.00491	-3.101000|-3.101000	0.00244|0.00244	-0.471000|-0.471000	0.05019|0.05019	GGA|CGG	.		0.642	PTPRF-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000019710.1		
DNTTIP2	30836	broad.mit.edu;bcgsc.ca	37	1	94342201	94342201	+	Silent	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr1:94342201C>T	ENST00000436063.2	-	2	1347	c.1290G>A	c.(1288-1290)gcG>gcA	p.A430A	DNTTIP2_ENST00000460191.1_5'UTR	NM_014597.4	NP_055412.2	Q5QJE6	TDIF2_HUMAN	deoxynucleotidyltransferase, terminal, interacting protein 2	430			A -> V (in dbSNP:rs35650636).		regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.A430A(1)		NS(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(15)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	38		all_lung(203;0.0111)|Lung NSC(277;0.0347)		all cancers(265;0.00679)|GBM - Glioblastoma multiforme(16;0.0278)|Epithelial(280;0.128)		ATGTGTTGGGCGCAGACGTGT	0.393																																					p.A430A		.											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1290A						.						229.0	220.0	223.0					1																	94342201		1972	4163	6135	SO:0001819	synonymous_variant	30836	exon2			GTTGGGCGCAGAC	AY394925	CCDS44174.1	1p22.1	2008-02-05			ENSG00000067334	ENSG00000067334			24013	protein-coding gene	gene with protein product	"""acidic 82 kDa protein mRNA"""	611199				15047147	Standard	NM_014597		Approved	HSU15552, ERBP, TdIF2	uc001dqf.3	Q5QJE6	OTTHUMG00000010268	ENST00000436063.2:c.1290G>A	1.37:g.94342201C>T		Somatic	430	0		WXS	Illumina GAIIx	Phase_I	264	10	NM_014597	0	0	24	25	1	Q12987|Q53H59|Q5TFJ4|Q6TLI0|Q76MJ8|Q86WX9	Silent	SNP	ENST00000436063.2	37	CCDS44174.1																																																																																			.		0.393	DNTTIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028317.2	NM_014597	
BCL9	607	bcgsc.ca	37	1	147092112	147092112	+	Silent	SNP	G	G	A	rs61754125	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr1:147092112G>A	ENST00000234739.3	+	8	2891	c.2151G>A	c.(2149-2151)aaG>aaA	p.K717K		NM_004326.2	NP_004317.2	O00512	BCL9_HUMAN	B-cell CLL/lymphoma 9	717	Pro-rich.				canonical Wnt signaling pathway (GO:0060070)|myotube differentiation involved in skeletal muscle regeneration (GO:0014908)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)				breast(1)|large_intestine(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	7	all_hematologic(923;0.115)					GTGGGATGAAGGGAGATGTCA	0.517			T	"""IGH@, IGL@"""	B-ALL								G|||	91	0.0181709	0.0	0.0231	5008	,	,		18880	0.0		0.0288	False		,,,				2504	0.047				p.K717K		.		Dom	yes		1	1q21	607	B-cell CLL/lymphoma 9		L	.	BCL9-707	0			c.G2151A						.	G		34,4372	39.2+/-71.8	0,34,2169	48.0	49.0	49.0		2151	3.2	1.0	1	dbSNP_129	49	308,8292	108.2+/-168.9	4,300,3996	no	coding-synonymous	BCL9	NM_004326.2		4,334,6165	AA,AG,GG		3.5814,0.7717,2.6296		717/1427	147092112	342,12664	2203	4300	6503	SO:0001819	synonymous_variant	607	exon8			GATGAAGGGAGAT	Y13620	CCDS30833.1	1q21	2008-02-05			ENSG00000116128	ENSG00000116128			1008	protein-coding gene	gene with protein product		602597				9490669	Standard	NM_004326		Approved		uc001epq.3	O00512	OTTHUMG00000014031	ENST00000234739.3:c.2151G>A	1.37:g.147092112G>A		Somatic	115	1		WXS	Illumina GAIIx	Phase_I	98	6	NM_004326	0	0	12	12	0	Q5T489	Silent	SNP	ENST00000234739.3	37	CCDS30833.1																																																																																			G|0.978;A|0.022		0.517	BCL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039468.1	NM_004326	
OTUD7B	56957	broad.mit.edu	37	1	149939226	149939226	+	Silent	SNP	T	T	C			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr1:149939226T>C	ENST00000369135.4	-	4	789	c.495A>G	c.(493-495)gaA>gaG	p.E165E	OTUD7B_ENST00000479905.1_5'UTR	NM_020205.2	NP_064590.2	Q6GQQ9	OTU7B_HUMAN	OTU deubiquitinase 7B	165	TRAF-binding.				mucosal immune response (GO:0002385)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of protein localization to nucleus (GO:1900181)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)|DNA binding (GO:0003677)|Lys48-specific deubiquitinase activity (GO:1990380)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			breast(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(18)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39	Breast(34;0.0009)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.247)			GACCTGCCTGTTCCAAGGCAA	0.532																																					p.E165E		.											.	OTUD7B-502	0			c.A495G						.						61.0	60.0	60.0					1																	149939226		2033	4198	6231	SO:0001819	synonymous_variant	56957	exon4			TGCCTGTTCCAAG	AJ293573	CCDS72903.1	1q21.2	2014-02-24	2014-02-24	2006-07-07	ENSG00000163113	ENSG00000264522		"""OTU domain containing"""	16683	protein-coding gene	gene with protein product		611748	"""zinc finger, A20 domain containing 1"", ""OTU domain containing 7B"""	ZA20D1		11463333, 23827681	Standard	NM_020205		Approved	CEZANNE	uc001etn.3	Q6GQQ9	OTTHUMG00000012291	ENST00000369135.4:c.495A>G	1.37:g.149939226T>C		Somatic	188	0		WXS	Illumina GAIIx	Phase_I	114	3	NM_020205	0	0	0	0	0	B7Z643|D3DUZ8|Q5SZ60|Q8WWA7|Q9NQ53|Q9UFF4	Silent	SNP	ENST00000369135.4	37	CCDS41389.1																																																																																			.		0.532	OTUD7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034146.3	NM_020205	
RPTN	126638	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	152128689	152128689	+	Missense_Mutation	SNP	C	C	T	rs201025925		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr1:152128689C>T	ENST00000316073.3	-	3	950	c.886G>A	c.(886-888)Ggt>Agt	p.G296S		NM_001122965.1	NP_001116437.1	Q6XPR3	RPTN_HUMAN	repetin	296	Gln-rich.					cornified envelope (GO:0001533)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|endometrium(14)|kidney(2)|large_intestine(1)|lung(32)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	59						TCCGTCTGACCGTAGTGGGAA	0.498													C|||	1	0.000199681	0.0008	0.0	5008	,	,		22400	0.0		0.0	False		,,,				2504	0.0				p.G296S		.											.	RPTN-68	0			c.G886A						.						597.0	514.0	540.0					1																	152128689		1568	3582	5150	SO:0001583	missense	126638	exon3			TCTGACCGTAGTG	AK096436	CCDS41397.1	1q21.3	2013-01-10			ENSG00000215853	ENSG00000215853		"""EF-hand domain containing"""	26809	protein-coding gene	gene with protein product		613259				15854042	Standard	NM_001122965		Approved	FLJ39117	uc001ezs.1	Q6XPR3	OTTHUMG00000154095	ENST00000316073.3:c.886G>A	1.37:g.152128689C>T	ENSP00000317895:p.Gly296Ser	Somatic	206	0		WXS	Illumina GAIIx	Phase_I	165	142	NM_001122965	0	0	0	0	0	B7ZBZ3	Missense_Mutation	SNP	ENST00000316073.3	37	CCDS41397.1	3	0.0013736263736263737	3	0.006097560975609756	0	0.0	0	0.0	0	0.0	C	16.30	3.083172	0.55861	.	.	ENSG00000215853	ENST00000316073	T	0.12984	2.63	4.73	-0.515	0.11954	.	.	.	.	.	T	0.07098	0.0180	L	0.33792	1.035	0.09310	N	1	D	0.65815	0.995	P	0.54140	0.743	T	0.25398	-1.0133	9	0.49607	T	0.09	-8.2231	8.1514	0.31143	0.0:0.4582:0.0:0.5418	.	296	Q6XPR3	RPTN_HUMAN	S	296	ENSP00000317895:G296S	ENSP00000317895:G296S	G	-	1	0	RPTN	150395313	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-0.770000	0.04705	0.098000	0.17522	-0.409000	0.06214	GGT	C|0.999;T|0.001		0.498	RPTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333867.1	XM_371312	
FLG	2312	broad.mit.edu;bcgsc.ca	37	1	152286155	152286155	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr1:152286155C>T	ENST00000368799.1	-	3	1242	c.1207G>A	c.(1207-1209)Ggg>Agg	p.G403R	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	403	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GAAGCTTGCCCGCGCCCAGTG	0.562									Ichthyosis																												p.G403R		.											.	FLG-106	0			c.G1207A						.						240.0	244.0	243.0					1																	152286155		2203	4300	6503	SO:0001583	missense	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	CTTGCCCGCGCCC	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.1207G>A	1.37:g.152286155C>T	ENSP00000357789:p.Gly403Arg	Somatic	186	0		WXS	Illumina GAIIx	Phase_I	148	6	NM_002016	0	0	0	0	0	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	-	11.65	1.702544	0.30232	.	.	ENSG00000143631	ENST00000368799	T	0.04015	3.73	4.17	0.0271	0.14153	.	.	.	.	.	T	0.03915	0.0110	L	0.41824	1.3	0.09310	N	1	D	0.69078	0.997	D	0.73708	0.981	T	0.35025	-0.9805	9	0.46703	T	0.11	.	3.9384	0.09316	0.0:0.5099:0.1784:0.3117	.	403	P20930	FILA_HUMAN	R	403	ENSP00000357789:G403R	ENSP00000357789:G403R	G	-	1	0	FLG	150552779	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.689000	0.05144	-0.081000	0.12662	0.499000	0.49734	GGG	.		0.562	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
CLK2	1196	broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	155238573	155238573	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr1:155238573C>T	ENST00000368361.4	-	4	728	c.413G>A	c.(412-414)cGg>cAg	p.R138Q	CLK2_ENST00000355560.4_Missense_Mutation_p.R136Q|CLK2_ENST00000497188.1_5'UTR|CLK2_ENST00000361168.5_Missense_Mutation_p.R137Q|CLK2_ENST00000536801.1_Missense_Mutation_p.R138Q			P49760	CLK2_HUMAN	CDC-like kinase 2	138					negative regulation of gluconeogenesis (GO:0045721)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of RNA splicing (GO:0043484)|response to ionizing radiation (GO:0010212)|response to retinoic acid (GO:0032526)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			endometrium(4)|lung(12)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	22	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			CTTGGCTCTCCGGCTGCTGTG	0.652								Other conserved DNA damage response genes																													p.R137Q		.											.	CLK2-333	0			c.G410A						.						89.0	73.0	78.0					1																	155238573		2203	4300	6503	SO:0001583	missense	1196	exon4			GCTCTCCGGCTGC	L29218	CCDS1107.1, CCDS72939.1	1q21	2008-05-02			ENSG00000176444	ENSG00000176444		"""CDC-like kinases"""	2069	protein-coding gene	gene with protein product		602989				7990150, 9856501	Standard	XM_005244876		Approved	clk2	uc001fjw.3	P49760	OTTHUMG00000035873	ENST00000368361.4:c.413G>A	1.37:g.155238573C>T	ENSP00000357345:p.Arg138Gln	Somatic	68	1		WXS	Illumina GAIIx	Phase_I	51	42	NM_003993	0	0	0	4	4	B1AVS9|B5MBX6|Q96CQ0	Missense_Mutation	SNP	ENST00000368361.4	37		.	.	.	.	.	.	.	.	.	.	.	15.75	2.924870	0.52759	.	.	ENSG00000176444	ENST00000361168;ENST00000368361;ENST00000355560;ENST00000536801	T;T;T;T	0.53640	0.62;0.61;0.62;0.61	4.86	3.95	0.45737	.	0.112117	0.56097	D	0.000022	T	0.23451	0.0567	L	0.50333	1.59	0.52501	D	0.999958	B;B	0.29085	0.095;0.232	B;B	0.14023	0.002;0.01	T	0.08743	-1.0707	10	0.34782	T	0.22	.	12.4111	0.55468	0.0:0.9175:0.0:0.0825	.	138;137	P49760;P49760-3	CLK2_HUMAN;.	Q	137;138;136;138	ENSP00000354856:R137Q;ENSP00000357345:R138Q;ENSP00000347759:R136Q;ENSP00000441023:R138Q	ENSP00000347759:R136Q	R	-	2	0	CLK2	153505197	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.822000	0.62686	1.413000	0.46997	0.655000	0.94253	CGG	.		0.652	CLK2-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000087391.1	NM_003993	
ASH1L	55870	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	155348172	155348172	+	Missense_Mutation	SNP	C	C	T	rs368443129		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr1:155348172C>T	ENST00000368346.3	-	10	6886	c.6247G>A	c.(6247-6249)Gtt>Att	p.V2083I	ASH1L_ENST00000392403.3_Missense_Mutation_p.V2078I			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)	2083	Catalytic domain.				cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			TTGACATCAACGTAGACATCT	0.408																																					p.V2078I		.											.	ASH1L-234	0			c.G6232A						.	C	ILE/VAL	0,4406		0,0,2203	147.0	143.0	145.0		6232	6.2	1.0	1		145	1,8599	1.2+/-3.3	0,1,4299	no	missense	ASH1L	NM_018489.2	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	2078/2965	155348172	1,13005	2203	4300	6503	SO:0001583	missense	55870	exon10			CATCAACGTAGAC	AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011	ENST00000368346.3:c.6247G>A	1.37:g.155348172C>T	ENSP00000357330:p.Val2083Ile	Somatic	138	0		WXS	Illumina GAIIx	Phase_I	93	7	NM_018489	0	0	0	0	0	Q59GP1|Q5T714|Q5T715|Q9P2C7	Missense_Mutation	SNP	ENST00000368346.3	37		.	.	.	.	.	.	.	.	.	.	C	22.6	4.311204	0.81358	0.0	1.16E-4	ENSG00000116539	ENST00000368346;ENST00000392403	T;T	0.80393	-1.37;-1.37	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	D	0.85141	0.5629	L	0.47078	1.49	0.80722	D	1	D;D	0.69078	0.994;0.997	P;D	0.67231	0.893;0.95	D	0.83901	0.0290	10	0.54805	T	0.06	.	20.4745	0.99168	0.0:1.0:0.0:0.0	.	2083;2078	Q9NR48;Q9NR48-2	ASH1L_HUMAN;.	I	2083;2078	ENSP00000357330:V2083I;ENSP00000376204:V2078I	ENSP00000357330:V2083I	V	-	1	0	ASH1L	153614796	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.818000	0.86416	2.941000	0.99782	0.655000	0.94253	GTT	.		0.408	ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000039400.1	NM_018489	
PEAR1	375033	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	156882744	156882744	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr1:156882744C>T	ENST00000338302.3	+	19	2617	c.2392C>T	c.(2392-2394)Cgc>Tgc	p.R798C	PEAR1_ENST00000292357.7_Missense_Mutation_p.R798C			Q5VY43	PEAR1_HUMAN	platelet endothelial aggregation receptor 1	798					recognition of apoptotic cell (GO:0043654)	integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)				breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(6)|lung(22)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)	43	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CAGCAGCGGGCGCCTGGACGG	0.617																																					p.R798C		.											.	PEAR1-71	0			c.C2392T						.						66.0	65.0	65.0					1																	156882744		2203	4300	6503	SO:0001583	missense	375033	exon18			AGCGGGCGCCTGG	AK098809	CCDS30892.1	1q23.1	2008-02-05	2007-10-25	2007-10-25	ENSG00000187800	ENSG00000187800			33631	protein-coding gene	gene with protein product		610278	"""multiple EGF-like-domains 12"""	MEGF12		15851471	Standard	NM_001080471		Approved	JEDI, FLJ00193	uc001fqj.1	Q5VY43	OTTHUMG00000041293	ENST00000338302.3:c.2392C>T	1.37:g.156882744C>T	ENSP00000344465:p.Arg798Cys	Somatic	148	0		WXS	Illumina GAIIx	Phase_I	96	90	NM_001080471	0	0	0	0	0	Q8TEK2	Missense_Mutation	SNP	ENST00000338302.3	37	CCDS30892.1	.	.	.	.	.	.	.	.	.	.	C	16.46	3.128298	0.56721	.	.	ENSG00000187800	ENST00000338302;ENST00000292357	D;D	0.90620	-2.7;-2.7	5.23	4.31	0.51392	.	0.419192	0.17965	N	0.156045	D	0.89444	0.6717	M	0.73962	2.25	0.53005	D	0.999961	D	0.76494	0.999	P	0.50791	0.65	D	0.88078	0.2805	10	0.38643	T	0.18	.	12.7139	0.57103	0.1761:0.8239:0.0:0.0	.	798	Q5VY43	PEAR1_HUMAN	C	798	ENSP00000344465:R798C;ENSP00000292357:R798C	ENSP00000292357:R798C	R	+	1	0	PEAR1	155149368	0.349000	0.24870	0.351000	0.25721	0.076000	0.17211	1.278000	0.33179	1.394000	0.46624	0.563000	0.77884	CGC	.		0.617	PEAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098937.2	NM_001080471	
COPA	1314	broad.mit.edu	37	1	160265920	160265920	+	Silent	SNP	T	T	C			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr1:160265920T>C	ENST00000241704.7	-	22	2512	c.2283A>G	c.(2281-2283)acA>acG	p.T761T	COPA_ENST00000368069.3_Silent_p.T770T	NM_001098398.1|NM_004371.3	NP_001091868.1|NP_004362.2	P53621	COPA_HUMAN	coatomer protein complex, subunit alpha	761					COPI coating of Golgi vesicle (GO:0048205)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|pancreatic juice secretion (GO:0030157)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(2)|lung(25)|ovary(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(2)	46	all_cancers(52;8.15e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			GGGTAGCAGCTGTGAGATAGG	0.448																																					p.T770T		.											.	COPA-92	0			c.A2310G						.						105.0	103.0	104.0					1																	160265920		2203	4300	6503	SO:0001819	synonymous_variant	1314	exon22			AGCAGCTGTGAGA	U24105	CCDS1202.1, CCDS41424.1	1q23.2	2014-01-30			ENSG00000122218	ENSG00000122218		"""WD repeat domain containing"", ""Endogenous ligands"""	2230	protein-coding gene	gene with protein product	"""proxenin"", ""xenin"""	601924				8647451	Standard	NM_004371		Approved	HEP-COP	uc001fvv.4	P53621	OTTHUMG00000033111	ENST00000241704.7:c.2283A>G	1.37:g.160265920T>C		Somatic	133	0		WXS	Illumina GAIIx	Phase_I	95	5	NM_001098398	0	0	38	38	0	Q5T201|Q8IXZ9	Silent	SNP	ENST00000241704.7	37	CCDS1202.1																																																																																			.		0.448	COPA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080638.1	NM_004371	
POU2F1	5451	ucsc.edu;bcgsc.ca;mdanderson.org	37	1	167343435	167343435	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr1:167343435G>A	ENST00000541643.3	+	7	586	c.424G>A	c.(424-426)Gcc>Acc	p.A142T	POU2F1_ENST00000367866.2_Missense_Mutation_p.A165T|POU2F1_ENST00000367862.5_Missense_Mutation_p.A154T|POU2F1_ENST00000367865.1_3'UTR|POU2F1_ENST00000452019.1_Missense_Mutation_p.A142T|POU2F1_ENST00000429375.2_Intron|POU2F1_ENST00000420254.3_Missense_Mutation_p.A142T			P14859	PO2F1_HUMAN	POU class 2 homeobox 1	142					gene expression (GO:0010467)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(3)|liver(2)|lung(7)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	30						GCAGCACTCCGCCAGCCAGCA	0.602																																					p.A165T		.											.	POU2F1-579	0			c.G493A						.						21.0	22.0	22.0					1																	167343435		2201	4300	6501	SO:0001583	missense	5451	exon6			CACTCCGCCAGCC	BC001664	CCDS1259.1, CCDS1259.2, CCDS55655.1, CCDS55656.1	1q24.2	2011-06-20	2007-07-13		ENSG00000143190	ENSG00000143190		"""Homeoboxes / POU class"""	9212	protein-coding gene	gene with protein product		164175	"""POU domain class 2, transcription factor 1"""	OTF1		1887216	Standard	NM_002697		Approved	OCT1	uc001gee.3	P14859	OTTHUMG00000034436	ENST00000541643.3:c.424G>A	1.37:g.167343435G>A	ENSP00000441285:p.Ala142Thr	Somatic	195	1		WXS	Illumina GAIIx	Phase_I	152	63	NM_002697	0	0	0	0	0	B1AL91|B1AL93|B4E029|J3KP77|Q5TBT7|Q6PK46|Q8NEU9|Q9BPV1	Missense_Mutation	SNP	ENST00000541643.3	37		.	.	.	.	.	.	.	.	.	.	G	25.1	4.607356	0.87157	.	.	ENSG00000143190	ENST00000367866;ENST00000452019;ENST00000492850;ENST00000367865;ENST00000420254;ENST00000541643;ENST00000367862;ENST00000443275	T;T;T;T;T;T;T	0.77098	-1.07;-1.07;-1.07;-1.07;-1.07;-1.07;-1.07	5.8	5.8	0.92144	.	2.994580	0.01147	N	0.006336	D	0.86932	0.6052	L	0.55990	1.75	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.80764	0.99;0.99;0.994;0.978	T	0.73962	-0.3817	10	0.72032	D	0.01	.	20.0589	0.97667	0.0:0.0:1.0:0.0	.	142;154;140;142	P14859-4;P14859-2;P14859-3;P14859	.;.;.;PO2F1_HUMAN	T	165;142;19;140;142;142;154;50	ENSP00000356840:A165T;ENSP00000391523:A142T;ENSP00000356839:A140T;ENSP00000414660:A142T;ENSP00000441285:A142T;ENSP00000356836:A154T;ENSP00000415993:A50T	ENSP00000356836:A154T	A	+	1	0	POU2F1	165610059	1.000000	0.71417	0.981000	0.43875	0.797000	0.45037	9.434000	0.97515	2.732000	0.93576	0.650000	0.86243	GCC	.		0.602	POU2F1-203	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_002697	
KIFAP3	22920	ucsc.edu;bcgsc.ca	37	1	169951997	169951997	+	Silent	SNP	C	C	T	rs33943686	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr1:169951997C>T	ENST00000361580.2	-	14	1745	c.1518G>A	c.(1516-1518)ggG>ggA	p.G506G	KIFAP3_ENST00000367767.1_Silent_p.G462G|KIFAP3_ENST00000540905.1_Silent_p.G208G|KIFAP3_ENST00000538366.1_Silent_p.G428G|KIFAP3_ENST00000367765.1_Silent_p.G466G	NM_014970.3	NP_055785.2	Q92845	KIFA3_HUMAN	kinesin-associated protein 3	506					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|membrane organization (GO:0061024)|microtubule-based movement (GO:0007018)|microtubule-based process (GO:0007017)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|plus-end-directed vesicle transport along microtubule (GO:0072383)|positive regulation of calcium-dependent cell-cell adhesion (GO:0046587)|protein complex assembly (GO:0006461)|protein localization (GO:0008104)|signal transduction (GO:0007165)	centrosome (GO:0005813)|condensed nuclear chromosome (GO:0000794)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|intraciliary transport particle (GO:0030990)|kinesin II complex (GO:0016939)|microtubule cytoskeleton (GO:0015630)	kinesin binding (GO:0019894)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(18)|prostate(2)|skin(3)|urinary_tract(2)	35	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					CTGCAAGGTCCCCAACATAAT	0.313													C|||	1372	0.273962	0.087	0.2867	5008	,	,		13409	0.503		0.326	False		,,,				2504	0.228				p.G506G		.											.	KIFAP3-91	0			c.G1518A						.	C	,,,	484,3922	208.8+/-229.8	34,416,1753	52.0	50.0	51.0		1284,1386,1398,1518	1.3	1.0	1	dbSNP_126	51	2759,5837	424.4+/-354.6	484,1791,2023	yes	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	KIFAP3	NM_001204514.1,NM_001204516.1,NM_001204517.1,NM_014970.3	,,,	518,2207,3776	TT,TC,CC		32.0963,10.985,24.9423	,,,	428/715,462/749,466/753,506/793	169951997	3243,9759	2203	4298	6501	SO:0001819	synonymous_variant	22920	exon14			AAGGTCCCCAACA	U59919	CCDS1288.1, CCDS55659.1, CCDS55660.1, CCDS55661.1	1q24.2	2012-09-20			ENSG00000075945	ENSG00000075945			17060	protein-coding gene	gene with protein product	"""Smg GDS"""	601836				8900189	Standard	NM_014970		Approved	SMAP, KAP3, FLA3, KAP-1	uc001ggv.3	Q92845	OTTHUMG00000035947	ENST00000361580.2:c.1518G>A	1.37:g.169951997C>T		Somatic	62	0		WXS	Illumina GAIIx	Phase_I	47	5	NM_014970	0	0	0	0	0	B1AKU4|B1AKU5|B2RDL1|B7Z8A3|F5H591|Q8NHU7|Q9H416	Silent	SNP	ENST00000361580.2	37	CCDS1288.1																																																																																			C|0.728;T|0.272		0.313	KIFAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087568.1	NM_014970	
PRRC2C	23215	broad.mit.edu;bcgsc.ca	37	1	171506485	171506485	+	Nonsense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr1:171506485C>T	ENST00000338920.4	+	15	2608	c.2371C>T	c.(2371-2373)Cga>Tga	p.R791*	PRRC2C_ENST00000392078.3_Nonsense_Mutation_p.R793*|PRRC2C_ENST00000426496.2_Nonsense_Mutation_p.R791*|PRRC2C_ENST00000367742.3_Nonsense_Mutation_p.R793*	NM_015172.3	NP_055987.2	Q9Y520	PRC2C_HUMAN	proline-rich coiled-coil 2C	791					hematopoietic progenitor cell differentiation (GO:0002244)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)										GCATATAGCTCGATCTGCAAG	0.463																																					p.R791X		.											.	.	0			c.C2371T						.						69.0	59.0	62.0					1																	171506485		2202	4300	6502	SO:0001587	stop_gained	23215	exon15			ATAGCTCGATCTG	AL096857	CCDS1296.2	1q24.3	2012-07-18	2010-12-09	2010-12-09	ENSG00000117523	ENSG00000117523			24903	protein-coding gene	gene with protein product			"""BAT2 domain containing 1"", ""HLA-B associated transcript 2-like 2"""	BAT2D1, BAT2L2		10470851, 12443540	Standard	NM_015172		Approved	KIAA1096, XTP2	uc010pmg.2	Q9Y520	OTTHUMG00000034665	ENST00000338920.4:c.2371C>T	1.37:g.171506485C>T	ENSP00000343629:p.Arg791*	Somatic	172	0		WXS	Illumina GAIIx	Phase_I	126	6	NM_015172	0	0	10	11	1	Q05DM8|Q49A39|Q6PD54|Q9H2N2|Q9HA05|Q9NSM8|Q9NXL3|Q9UF29|Q9UPQ6	Nonsense_Mutation	SNP	ENST00000338920.4	37	CCDS1296.2	.	.	.	.	.	.	.	.	.	.	C	42	9.586797	0.99213	.	.	ENSG00000117523	ENST00000392078;ENST00000451306;ENST00000426496;ENST00000367742;ENST00000338920;ENST00000392080;ENST00000483654	.	.	.	5.3	3.37	0.38596	.	0.000000	0.39341	N	0.001381	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.20519	T	0.43	.	14.4833	0.67597	0.2667:0.7333:0.0:0.0	.	.	.	.	X	793;792;791;793;791;548;550	.	ENSP00000343629:R791X	R	+	1	2	PRRC2C	169773109	1.000000	0.71417	0.978000	0.43139	0.951000	0.60555	2.341000	0.43983	0.581000	0.29539	0.650000	0.86243	CGA	.		0.463	PRRC2C-010	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000314826.4	NM_015172	
RC3H1	149041	broad.mit.edu	37	1	173912683	173912683	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr1:173912683G>A	ENST00000367696.2	-	18	3383	c.3032C>T	c.(3031-3033)cCg>cTg	p.P1011L	RC3H1_ENST00000367694.2_Missense_Mutation_p.P1002L|RC3H1_ENST00000258349.4_Missense_Mutation_p.P1011L			Q5TC82	RC3H1_HUMAN	ring finger and CCCH-type domains 1	1011					B cell homeostasis (GO:0001782)|cytoplasmic mRNA processing body assembly (GO:0033962)|lymph node development (GO:0048535)|negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of germinal center formation (GO:0002635)|negative regulation of T-helper cell differentiation (GO:0045623)|nuclear-transcribed mRNA catabolic process (GO:0000956)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|posttranscriptional regulation of gene expression (GO:0010608)|protein ubiquitination (GO:0016567)|regulation of germinal center formation (GO:0002634)|regulation of mRNA stability (GO:0043488)|regulation of T cell receptor signaling pathway (GO:0050856)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)|T cell proliferation (GO:0042098)|T follicular helper cell differentiation (GO:0061470)	cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)	mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(20)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	50						TGGAGGTGGCGGTGGTGGGGG	0.547																																					p.P1011L		.											.	RC3H1-92	0			c.C3032T						.						122.0	111.0	115.0					1																	173912683		2203	4300	6503	SO:0001583	missense	149041	exon17			GGTGGCGGTGGTG	AK093501	CCDS30940.1, CCDS72987.1	1q25.1	2013-01-18	2010-09-15		ENSG00000135870	ENSG00000135870		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, CCCH-type domain containing"""	29434	protein-coding gene	gene with protein product	"""KIAA2025 protein"""	609424	"""ring finger and CCCH-type zinc finger domains 1"""			15917799	Standard	XM_005244918		Approved	KIAA2025, roquin, RP5-1198E17.5, RNF198	uc001gju.4	Q5TC82	OTTHUMG00000037275	ENST00000367696.2:c.3032C>T	1.37:g.173912683G>A	ENSP00000356669:p.Pro1011Leu	Somatic	141	0		WXS	Illumina GAIIx	Phase_I	114	5	NM_172071	0	0	0	0	0	B3KVK1|Q5W180|Q5W181|Q8IVE6|Q8N9V1	Missense_Mutation	SNP	ENST00000367696.2	37	CCDS30940.1	.	.	.	.	.	.	.	.	.	.	G	9.306	1.054286	0.19907	.	.	ENSG00000135870	ENST00000367696;ENST00000258349;ENST00000367694	T;T;T	0.41758	0.99;0.99;1.01	5.17	4.24	0.50183	.	0.358987	0.32161	N	0.006492	T	0.15522	0.0374	L	0.36672	1.1	0.40147	D	0.976905	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.0;0.0;0.001;0.0	T	0.05517	-1.0880	10	0.44086	T	0.13	-0.2201	7.1663	0.25693	0.0875:0.0:0.7431:0.1694	.	1011;1002;1002;1011	B9EGU6;B7ZMB3;Q5TC82-2;Q5TC82	.;.;.;RC3H1_HUMAN	L	1011;1011;1002	ENSP00000356669:P1011L;ENSP00000258349:P1011L;ENSP00000356667:P1002L	ENSP00000258349:P1011L	P	-	2	0	RC3H1	172179306	1.000000	0.71417	0.068000	0.19968	0.176000	0.22953	3.472000	0.53114	1.138000	0.42230	0.655000	0.94253	CCG	.		0.547	RC3H1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090733.2	NM_172071	
ASTN1	460	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	176833494	176833494	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr1:176833494C>T	ENST00000367654.3	-	23	4046	c.3835G>A	c.(3835-3837)Gac>Aac	p.D1279N	ASTN1_ENST00000361833.2_Missense_Mutation_p.D1271N|ASTN1_ENST00000367657.3_Intron	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	1279					locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)				NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						TTCCTGAGGTCCCGGCTGAGC	0.587																																					p.D1271N		.											.	ASTN1-319	0			c.G3811A						.						115.0	111.0	112.0					1																	176833494		2203	4300	6503	SO:0001583	missense	460	exon23			TGAGGTCCCGGCT	AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.3835G>A	1.37:g.176833494C>T	ENSP00000356626:p.Asp1279Asn	Somatic	124	1		WXS	Illumina GAIIx	Phase_I	74	71	NM_004319	0	0	0	1	1	A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Missense_Mutation	SNP	ENST00000367654.3	37		.	.	.	.	.	.	.	.	.	.	C	34	5.299254	0.95574	.	.	ENSG00000152092	ENST00000361833;ENST00000367654	T;T	0.14144	2.54;2.53	4.61	4.61	0.57282	.	0.000000	0.85682	D	0.000000	T	0.27967	0.0689	L	0.32530	0.975	0.80722	D	1	D	0.67145	0.996	D	0.73708	0.981	T	0.04454	-1.0950	10	0.87932	D	0	-23.7671	17.4153	0.87498	0.0:1.0:0.0:0.0	.	1271	O14525-2	.	N	1271;1279	ENSP00000354536:D1271N;ENSP00000356626:D1279N	ENSP00000354536:D1271N	D	-	1	0	ASTN1	175100117	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.037000	0.76531	2.282000	0.76494	0.555000	0.69702	GAC	.		0.587	ASTN1-201	KNOWN	basic	protein_coding	protein_coding		NM_004319	
ZNF648	127665	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	182025773	182025773	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr1:182025773G>A	ENST00000339948.3	-	2	1580	c.1373C>T	c.(1372-1374)gCg>gTg	p.A458V		NM_001009992.1	NP_001009992.1	Q5T619	ZN648_HUMAN	zinc finger protein 648	458					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(7)|large_intestine(10)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	40						CGAGGGCTGCGCGAAGGCCAC	0.662																																					p.A458V	NSCLC(71;908 1374 5429 20458 35642)	.											.	ZNF648-91	0			c.C1373T						.						35.0	33.0	33.0					1																	182025773		2199	4300	6499	SO:0001583	missense	127665	exon2			GGCTGCGCGAAGG	AK128654	CCDS30952.1	1q25.3	2013-01-08			ENSG00000179930	ENSG00000179930		"""Zinc fingers, C2H2-type"""	18190	protein-coding gene	gene with protein product							Standard	NM_001009992		Approved	FLJ46813	uc001goz.3	Q5T619	OTTHUMG00000037302	ENST00000339948.3:c.1373C>T	1.37:g.182025773G>A	ENSP00000344129:p.Ala458Val	Somatic	66	0		WXS	Illumina GAIIx	Phase_I	114	23	NM_001009992	0	0	0	0	0	B2RP16	Missense_Mutation	SNP	ENST00000339948.3	37	CCDS30952.1	.	.	.	.	.	.	.	.	.	.	G	13.66	2.303590	0.40795	.	.	ENSG00000179930	ENST00000339948	T	0.17854	2.25	2.77	1.79	0.24919	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.12689	0.0308	L	0.39326	1.205	0.32881	D	0.510567	B	0.28055	0.199	B	0.23150	0.044	T	0.11891	-1.0569	9	0.49607	T	0.09	.	7.1829	0.25782	0.0:0.0:0.5171:0.4829	.	458	Q5T619	ZN648_HUMAN	V	458	ENSP00000344129:A458V	ENSP00000344129:A458V	A	-	2	0	ZNF648	180292396	0.000000	0.05858	0.999000	0.59377	0.984000	0.73092	-0.168000	0.09925	0.661000	0.30985	0.655000	0.94253	GCG	.		0.662	ZNF648-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090794.1	XM_060597	
HMCN1	83872	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	185956660	185956660	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr1:185956660C>T	ENST00000271588.4	+	20	3261	c.3032C>T	c.(3031-3033)tCt>tTt	p.S1011F	HMCN1_ENST00000485744.1_3'UTR|HMCN1_ENST00000367492.2_Missense_Mutation_p.S1011F	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	1011	Ig-like C2-type 7.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						CCCAAACCGTCTGTCATCTGG	0.443																																					p.S1011F		.											.	HMCN1-113	0			c.C3032T						.						158.0	160.0	159.0					1																	185956660		2203	4300	6503	SO:0001583	missense	83872	exon20			AACCGTCTGTCAT	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.3032C>T	1.37:g.185956660C>T	ENSP00000271588:p.Ser1011Phe	Somatic	93	0		WXS	Illumina GAIIx	Phase_I	66	55	NM_031935	0	0	0	0	0	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	C	12.58	1.982045	0.34942	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.69806	-0.43;-0.43	5.33	5.33	0.75918	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.305511	0.35378	N	0.003248	T	0.80783	0.4689	M	0.64567	1.98	0.09310	N	0.999993	P;D	0.76494	0.897;0.999	P;D	0.83275	0.847;0.996	T	0.73783	-0.3874	10	0.56958	D	0.05	.	19.0253	0.92930	0.0:1.0:0.0:0.0	.	395;1011	Q96RW7-3;Q96RW7	.;HMCN1_HUMAN	F	1011	ENSP00000271588:S1011F;ENSP00000356462:S1011F	ENSP00000271588:S1011F	S	+	2	0	HMCN1	184223283	0.918000	0.31147	0.019000	0.16419	0.061000	0.15899	4.573000	0.60893	2.501000	0.84356	0.655000	0.94253	TCT	.		0.443	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
CFH	3075	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	1	196659281	196659281	+	Silent	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr1:196659281C>T	ENST00000359637.2	+	8	1118	c.1056C>T	c.(1054-1056)tgC>tgT	p.C352C	CFH_ENST00000367429.4_Silent_p.C416C|CFH_ENST00000439155.2_Silent_p.C416C			P08603	CFAH_HUMAN	complement factor H	416	Sushi 6. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)			NS(3)|breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(24)|lung(33)|ovary(1)|prostate(5)|skin(9)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	101						ACGTTGCCTGCCATCCTGGCT	0.413																																					p.C416C		.											.	CFH-566	0			c.C1248T						.						98.0	84.0	89.0					1																	196659281		2203	4300	6503	SO:0001819	synonymous_variant	3075	exon9			TGCCTGCCATCCT	Y00716	CCDS1385.1	1q32	2014-09-17	2004-08-09	2004-08-12	ENSG00000000971	ENSG00000000971		"""Complement system"""	4883	protein-coding gene	gene with protein product	"""beta-1H"", ""H factor 2 (complement)"", ""age-related maculopathy susceptibility 1"""	134370	"""H factor 1 (complement)"""	HF, HF1, HF2		2889480, 2963625	Standard	NM_000186		Approved	HUS, FHL1, ARMS1, ARMD4	uc001gtj.4	P08603	OTTHUMG00000035607	ENST00000359637.2:c.1056C>T	1.37:g.196659281C>T		Somatic	646	2		WXS	Illumina GAIIx	Phase_I	432	151	NM_001014975	0	0	1	1	0	A5PL14|P78435|Q14570|Q2TAZ5|Q38G77|Q5TFM3|Q8N708|Q9NU86	Silent	SNP	ENST00000359637.2	37																																																																																				.		0.413	CFH-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000087502.1	NM_000186	
ASPM	259266	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	197060024	197060024	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr1:197060024G>A	ENST00000367409.4	-	23	9848	c.9592C>T	c.(9592-9594)Cgt>Tgt	p.R3198C	ASPM_ENST00000367408.1_Missense_Mutation_p.R863C|ASPM_ENST00000294732.7_Missense_Mutation_p.R1613C	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	3198	IQ 38. {ECO:0000255|PROSITE- ProRule:PRU00116}.				developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)				breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						TGCTTTTTACGGAGGAGAAAA	0.358																																					p.R3198C		.											.	ASPM-615	0			c.C9592T						.						100.0	98.0	99.0					1																	197060024		2203	4299	6502	SO:0001583	missense	259266	exon23			TTTTACGGAGGAG	AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.9592C>T	1.37:g.197060024G>A	ENSP00000356379:p.Arg3198Cys	Somatic	40	0		WXS	Illumina GAIIx	Phase_I	47	15	NM_018136	0	0	0	2	2	Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Missense_Mutation	SNP	ENST00000367409.4	37	CCDS1389.1	.	.	.	.	.	.	.	.	.	.	G	5.516	0.280132	0.10458	.	.	ENSG00000066279	ENST00000367409;ENST00000294732;ENST00000367408;ENST00000367406	T;T;T	0.77358	-1.09;-1.09;0.97	5.05	-4.84	0.03151	.	0.619767	0.15813	N	0.243367	T	0.60064	0.2240	L	0.34521	1.04	0.09310	N	1	B;B;B	0.25809	0.013;0.007;0.135	B;B;B	0.25987	0.003;0.005;0.065	T	0.50189	-0.8857	10	0.56958	D	0.05	.	6.2894	0.21051	0.5254:0.0:0.2646:0.21	.	1184;1613;3198	E7EQ84;Q4G1H1;Q8IZT6	.;.;ASPM_HUMAN	C	3198;1613;863;1184	ENSP00000356379:R3198C;ENSP00000294732:R1613C;ENSP00000356378:R863C	ENSP00000294732:R1613C	R	-	1	0	ASPM	195326647	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	-0.221000	0.09202	-0.772000	0.04602	-0.339000	0.08088	CGT	.		0.358	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000088256.1	NM_018136	
KCNH1	3756	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	210856743	210856743	+	Silent	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr1:210856743C>T	ENST00000271751.4	-	11	2877	c.2850G>A	c.(2848-2850)caG>caA	p.Q950Q	KCNH1_ENST00000367007.4_Silent_p.Q923Q			O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 1	950	CAD (involved in subunit assembly). {ECO:0000250}.				myoblast fusion (GO:0007520)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|phosphorelay sensor kinase activity (GO:0000155)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|lung(35)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)		TCTCAGAGAGCTGTTTCTCAA	0.498																																					p.Q950Q		.											.	KCNH1-94	0			c.G2850A						.						96.0	85.0	89.0					1																	210856743		2203	4300	6503	SO:0001819	synonymous_variant	3756	exon11			AGAGAGCTGTTTC	AJ001366	CCDS1496.1, CCDS31015.1	1q32.2	2012-07-05			ENSG00000143473	ENSG00000143473		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6250	protein-coding gene	gene with protein product		603305				9738473, 16382104	Standard	NM_172362		Approved	Kv10.1, eag, h-eag, eag1	uc001hib.2	O95259	OTTHUMG00000036309	ENST00000271751.4:c.2850G>A	1.37:g.210856743C>T		Somatic	161	0		WXS	Illumina GAIIx	Phase_I	87	33	NM_172362	0	0	0	0	0	B1AQ26|O76035|Q14CL3	Silent	SNP	ENST00000271751.4	37	CCDS1496.1																																																																																			.		0.498	KCNH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088332.1	NM_002238	
USH2A	7399	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	216373375	216373375	+	Missense_Mutation	SNP	C	C	G	rs372843685		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr1:216373375C>G	ENST00000307340.3	-	17	3791	c.3405G>C	c.(3403-3405)agG>agC	p.R1135S	USH2A_ENST00000366942.3_Missense_Mutation_p.R1135S|RP5-1099E6.3_ENST00000420867.1_RNA|USH2A_ENST00000366943.2_Missense_Mutation_p.R1135S	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	1135	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CAGCTACACTCCTTGTTGAAC	0.393										HNSCC(13;0.011)																											p.R1135S		.											.	USH2A-115	0			c.G3405C						.	C	SER/ARG,SER/ARG	0,4406		0,0,2203	94.0	92.0	92.0		3405,3405	0.6	0.3	1		92	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	USH2A	NM_007123.5,NM_206933.2	110,110	0,1,6502	GG,GC,CC		0.0116,0.0,0.0077	benign,benign	1135/1547,1135/5203	216373375	1,13005	2203	4300	6503	SO:0001583	missense	7399	exon17			TACACTCCTTGTT	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.3405G>C	1.37:g.216373375C>G	ENSP00000305941:p.Arg1135Ser	Somatic	154	0		WXS	Illumina GAIIx	Phase_I	110	104	NM_206933	0	0	0	0	0	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	C	8.780	0.927961	0.18056	0.0	1.16E-4	ENSG00000042781	ENST00000307340;ENST00000366943;ENST00000366942	D;T;T	0.84370	-1.84;0.68;0.68	6.02	0.613	0.17597	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.131273	0.33792	N	0.004547	T	0.66858	0.2832	N	0.21282	0.65	0.34162	D	0.668739	B;B	0.26708	0.046;0.157	B;B	0.21708	0.036;0.031	T	0.57441	-0.7811	10	0.09084	T	0.74	.	5.1828	0.15169	0.1519:0.2957:0.0:0.5524	.	1135;1135	O75445-2;O75445	.;USH2A_HUMAN	S	1135	ENSP00000305941:R1135S;ENSP00000355910:R1135S;ENSP00000355909:R1135S	ENSP00000305941:R1135S	R	-	3	2	USH2A	214439998	0.872000	0.30054	0.260000	0.24451	0.528000	0.34623	0.221000	0.17680	0.062000	0.16340	-0.136000	0.14681	AGG	.		0.393	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
DISP1	84976	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	223116579	223116579	+	Silent	SNP	G	G	A	rs143316612	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr1:223116579G>A	ENST00000284476.6	+	2	578	c.414G>A	c.(412-414)acG>acA	p.T138T	DISP1_ENST00000360254.2_Silent_p.T138T|DISP1_ENST00000495684.1_Intron	NM_032890.3	NP_116279.2	Q96F81	DISP1_HUMAN	dispatched homolog 1 (Drosophila)	138					determination of left/right symmetry (GO:0007368)|diaphragm development (GO:0060539)|dorsal/ventral pattern formation (GO:0009953)|embryonic pattern specification (GO:0009880)|patched ligand maturation (GO:0007225)|peptide transport (GO:0015833)|protein homotrimerization (GO:0070207)|regulation of protein secretion (GO:0050708)|smoothened signaling pathway (GO:0007224)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	hedgehog receptor activity (GO:0008158)|peptide transporter activity (GO:0015197)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(20)|lung(25)|prostate(4)|skin(1)|stomach(1)|urinary_tract(5)	69				GBM - Glioblastoma multiforme(131;0.102)		ATCAGACTACGTGCTGTCTTC	0.522													G|||	5	0.000998403	0.0008	0.0029	5008	,	,		23312	0.0		0.002	False		,,,				2504	0.0				p.T138T		.											.	DISP1-68	0			c.G414A						.	G		3,4403	6.2+/-15.9	0,3,2200	153.0	111.0	125.0		414	2.7	1.0	1	dbSNP_134	125	23,8577	16.6+/-54.9	0,23,4277	no	coding-synonymous	DISP1	NM_032890.3		0,26,6477	AA,AG,GG		0.2674,0.0681,0.1999		138/1525	223116579	26,12980	2203	4300	6503	SO:0001819	synonymous_variant	84976	exon4			GACTACGTGCTGT	AK056569	CCDS1536.1	1q42.12	2008-02-05			ENSG00000154309	ENSG00000154309			19711	protein-coding gene	gene with protein product		607502				10619433	Standard	NM_032890		Approved	DISPA, MGC13130, DKFZP434I0428, MGC16796	uc001hnu.2	Q96F81	OTTHUMG00000037893	ENST00000284476.6:c.414G>A	1.37:g.223116579G>A		Somatic	290	1		WXS	Illumina GAIIx	Phase_I	213	186	NM_032890	0	0	0	3	3	Q8N7C2|Q96I92|Q9H698|Q9H8H9|Q9UFA2	Silent	SNP	ENST00000284476.6	37	CCDS1536.1																																																																																			G|0.998;A|0.002		0.522	DISP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092512.1	NM_032890	
OBSCN	84033	bcgsc.ca;mdanderson.org	37	1	228503565	228503565	+	Missense_Mutation	SNP	C	C	T	rs574344246	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr1:228503565C>T	ENST00000422127.1	+	50	13074	c.13030C>T	c.(13030-13032)Cgg>Tgg	p.R4344W	OBSCN_ENST00000570156.2_Missense_Mutation_p.R5301W|OBSCN_ENST00000366709.4_Missense_Mutation_p.R1463W|OBSCN_ENST00000366707.4_Missense_Mutation_p.R1978W|OBSCN_ENST00000284548.11_Missense_Mutation_p.R4344W	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	4344	Ig-like 45.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CACGGTGGTGCGGGGGCTGGA	0.667													C|||	2	0.000399361	0.0	0.0029	5008	,	,		14188	0.0		0.0	False		,,,				2504	0.0				p.R5301W		.											.	OBSCN-403	0			c.C15901T						.						16.0	21.0	19.0					1																	228503565		2069	4180	6249	SO:0001583	missense	84033	exon61			GTGGTGCGGGGGC	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.13030C>T	1.37:g.228503565C>T	ENSP00000409493:p.Arg4344Trp	Somatic	45	1		WXS	Illumina GAIIx	Phase_I	64	53	NM_001271223	0	0	0	2	2	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	C	18.30	3.593337	0.66219	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709	T;T;T;T	0.04862	3.54;3.54;3.54;3.54	4.89	3.96	0.45880	Immunoglobulin-like fold (1);	0.449855	0.19305	N	0.117541	T	0.17323	0.0416	L	0.55834	1.745	0.34506	D	0.706531	D;D	0.89917	0.998;1.0	P;P	0.59424	0.661;0.857	T	0.16482	-1.0401	10	0.72032	D	0.01	.	14.2356	0.65925	0.1571:0.8429:0.0:0.0	.	4344;4344	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	W	4344;4344;1978;1463	ENSP00000284548:R4344W;ENSP00000409493:R4344W;ENSP00000355668:R1978W;ENSP00000355670:R1463W	ENSP00000284548:R4344W	R	+	1	2	OBSCN	226570188	1.000000	0.71417	0.753000	0.31225	0.129000	0.20672	4.727000	0.61993	1.026000	0.39733	0.313000	0.20887	CGG	.		0.667	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
OBSCN	84033	hgsc.bcm.edu	37	1	228504669	228504669	+	Silent	SNP	G	G	A	rs61825302	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr1:228504669G>A	ENST00000422127.1	+	51	13589	c.13545G>A	c.(13543-13545)gcG>gcA	p.A4515A	OBSCN_ENST00000570156.2_Silent_p.A5472A|OBSCN_ENST00000366709.4_Silent_p.A1634A|OBSCN_ENST00000366707.4_Silent_p.A2149A|OBSCN_ENST00000284548.11_Silent_p.A4515A	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	4515	Ig-like 46.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				TGGCCTCTGCGCGGCTCACCG	0.731													g|||	729	0.145567	0.1218	0.2349	5008	,	,		13931	0.1518		0.159	False		,,,				2504	0.0941				p.A5472A		.											.	OBSCN-403	0			c.G16416A						.		,	507,3253		36,435,1409	5.0	6.0	6.0		13545,13545	-6.2	0.0	1	dbSNP_129	6	1105,6501		71,963,2769	no	coding-synonymous,coding-synonymous	OBSCN	NM_001098623.1,NM_052843.2	,	107,1398,4178	AA,AG,GG		14.528,13.484,14.1827	,	4515/7969,4515/6621	228504669	1612,9754	1880	3803	5683	SO:0001819	synonymous_variant	84033	exon62			CTCTGCGCGGCTC	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.13545G>A	1.37:g.228504669G>A		Somatic	4	0		WXS	Illumina GAIIx	Phase_I	30	29	NM_001271223	0	0	0	0	0	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Silent	SNP	ENST00000422127.1	37	CCDS58065.1																																																																																			G|0.841;A|0.159		0.731	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
ZBTB18	10472	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	244218382	244218382	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr1:244218382C>T	ENST00000358704.4	+	2	1455	c.1306C>T	c.(1306-1308)Cgc>Tgc	p.R436C		NM_001278196.1|NM_006352.4|NM_205768.2	NP_001265125.1|NP_006343.2|NP_991331.1	Q99592	ZBT18_HUMAN	zinc finger and BTB domain containing 18	427					cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|hippocampus development (GO:0021766)|homeostasis of number of cells (GO:0048872)|in utero embryonic development (GO:0001701)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron development (GO:0048666)|regulation of cell division (GO:0051302)|skeletal muscle tissue development (GO:0007519)|transcription, DNA-templated (GO:0006351)	intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)										CACCCTCAAGCGCCACGAGAG	0.632																																					p.R436C		.											.	.	0			c.C1306T						.						71.0	73.0	72.0					1																	244218382		2203	4300	6503	SO:0001583	missense	10472	exon2			CTCAAGCGCCACG	U38896	CCDS1622.1	1q44	2013-09-19	2013-01-09	2013-01-09	ENSG00000179456	ENSG00000179456		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	13030	protein-coding gene	gene with protein product		608433	"""zinc finger protein 238"""	ZNF238		9568537, 9013868	Standard	NM_205768		Approved	C2H2-171, TAZ-1, RP58	uc031psv.1	Q99592	OTTHUMG00000040013	ENST00000358704.4:c.1306C>T	1.37:g.244218382C>T	ENSP00000351539:p.Arg436Cys	Somatic	324	0		WXS	Illumina GAIIx	Phase_I	184	167	NM_205768	0	0	3	12	9	A8K5U3|Q13397|Q5VU40|Q8N463|Q9UD99	Missense_Mutation	SNP	ENST00000358704.4	37	CCDS1622.1	.	.	.	.	.	.	.	.	.	.	C	18.67	3.674634	0.67928	.	.	ENSG00000179456	ENST00000366538;ENST00000358704	T	0.07800	3.16	5.68	5.68	0.88126	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.32526	0.0832	M	0.76170	2.325	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.994	T	0.01409	-1.1362	10	0.87932	D	0	.	19.7964	0.96487	0.0:1.0:0.0:0.0	.	427;436	Q99592;Q99592-2	ZN238_HUMAN;.	C	436	ENSP00000351539:R436C	ENSP00000351539:R436C	R	+	1	0	ZNF238	242285005	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	4.963000	0.63694	2.702000	0.92279	0.655000	0.94253	CGC	.		0.632	ZBTB18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096513.2	NM_205768	
OR2T2	401992	bcgsc.ca	37	1	248616705	248616711	+	Frame_Shift_Del	DEL	TGCTGCG	TGCTGCG	-	rs199823862|rs372931983		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	TGCTGCG	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr1:248616705_248616711delTGCTGCG	ENST00000342927.3	+	1	629_635	c.607_613delTGCTGCG	c.(607-615)tgctgcgtgfs	p.CCV203fs		NM_001004136.1	NP_001004136.1	Q6IF00	OR2T2_HUMAN	olfactory receptor, family 2, subfamily T, member 2	203						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(21)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	37	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GATGTATGCCTGCTGCGTGCTGATGCT	0.527																																					p.203_205del		.											.	OR2T2-23	0			c.607_613del						.			51,3755		2,47,1854						-2.5	0.6			76	261,7371		12,237,3567	no	frameshift	OR2T2	NM_001004136.1		14,284,5421	A1A1,A1R,RR		3.4198,1.34,2.7277				312,11126				SO:0001589	frameshift_variant	401992	exon1			TATGCCTGCTGCG	BK004462	CCDS31116.1	1q44	2012-08-09	2002-11-13	2002-11-15	ENSG00000196240	ENSG00000196240		"""GPCR / Class A : Olfactory receptors"""	14725	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily T, member 2 pseudogene"""	OR2T2P		14983052	Standard	NM_001004136		Approved		uc001iek.1	Q6IF00	OTTHUMG00000040480	ENST00000342927.3:c.607_613delTGCTGCG	1.37:g.248616705_248616711delTGCTGCG	ENSP00000343062:p.Cys203fs	Somatic	613	3		WXS	Illumina GAIIx	Phase_I	361	12	NM_001004136	0	0	0	0	0	B2RNM1|B9EH01	Frame_Shift_Del	DEL	ENST00000342927.3	37	CCDS31116.1																																																																																			.		0.527	OR2T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097421.1	NM_001004136	
ITIH5	80760	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	7608357	7608357	+	Silent	SNP	G	G	A	rs561325808		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr10:7608357G>A	ENST00000256861.6	-	13	2241	c.2163C>T	c.(2161-2163)aaC>aaT	p.N721N	ITIH5_ENST00000298441.6_Silent_p.N507N|ITIH5_ENST00000397146.2_Intron|ITIH5_ENST00000446830.2_Silent_p.N503N	NM_030569.6	NP_085046.5	Q86UX2	ITIH5_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 5	721					hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|kidney(6)|large_intestine(21)|lung(25)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(3)	75						TTAACTCTCCGTTCACTGTGA	0.507													G|||	1	0.000199681	0.0	0.0	5008	,	,		17193	0.001		0.0	False		,,,				2504	0.0				p.N721N		.											.	ITIH5-92	0			c.C2163T						.						59.0	60.0	60.0					10																	7608357		2203	4300	6503	SO:0001819	synonymous_variant	80760	exon13			CTCTCCGTTCACT			10p14	2011-10-26	2011-10-26		ENSG00000123243	ENSG00000123243			21449	protein-coding gene	gene with protein product		609783	"""inter-alpha (globulin) inhibitor H5"""			14744536	Standard	NM_001001851		Approved	MGC10848	uc021pmv.1	Q86UX2	OTTHUMG00000017635	ENST00000256861.6:c.2163C>T	10.37:g.7608357G>A		Somatic	98	0		WXS	Illumina GAIIx	Phase_I	82	71	NM_030569	0	0	0	0	0	Q5T664|Q5T665|Q5T666|Q6AI60|Q6UXB7|Q8TF48|Q8WYV2|Q96K70	Silent	SNP	ENST00000256861.6	37																																																																																				.		0.507	ITIH5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000046688.1	NM_030569	
DHTKD1	55526	ucsc.edu;bcgsc.ca	37	10	12142210	12142210	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr10:12142210C>G	ENST00000263035.4	+	9	1767	c.1705C>G	c.(1705-1707)Cta>Gta	p.L569V		NM_018706.5	NP_061176	Q96HY7	DHTK1_HUMAN	dehydrogenase E1 and transketolase domain containing 1	569					cell death (GO:0008219)|generation of precursor metabolites and energy (GO:0006091)|glycolytic process (GO:0006096)|hematopoietic progenitor cell differentiation (GO:0002244)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)	oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(1)	44		Renal(717;0.228)	BRCA - Breast invasive adenocarcinoma(52;0.188)			CGGAATCAAGCTAGACTGGGC	0.388																																					p.L569V		.											.	DHTKD1-515	0			c.C1705G						.						141.0	156.0	151.0					10																	12142210		2203	4300	6503	SO:0001583	missense	55526	exon9			ATCAAGCTAGACT	BC002477	CCDS7087.1	10p14	2003-11-24			ENSG00000181192	ENSG00000181192			23537	protein-coding gene	gene with protein product		614984				10997877	Standard	NM_018706		Approved	KIAA1630, MGC3090, DKFZP762M115	uc001ild.5	Q96HY7	OTTHUMG00000017677	ENST00000263035.4:c.1705C>G	10.37:g.12142210C>G	ENSP00000263035:p.Leu569Val	Somatic	36	0		WXS	Illumina GAIIx	Phase_I	38	4	NM_018706	0	0	17	17	0	Q68CU5|Q9BUM8|Q9HCE2	Missense_Mutation	SNP	ENST00000263035.4	37	CCDS7087.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	5.069|5.069	0.198334|0.198334	0.09652|0.09652	.|.	.|.	ENSG00000181192|ENSG00000181192	ENST00000448829|ENST00000263035	.|D	.|0.91464	.|-2.85	5.39|5.39	-0.147|-0.147	0.13428|0.13428	.|Transketolase-like, pyrimidine-binding domain (2);	.|0.070600	.|0.64402	.|N	.|0.000020	T|T	0.79227|0.79227	0.4410|0.4410	N|N	0.13235|0.13235	0.315|0.315	0.48830|0.48830	D|D	0.999719|0.999719	.|B	.|0.12013	.|0.005	.|B	.|0.20955	.|0.032	T|T	0.63139|0.63139	-0.6704|-0.6704	5|10	.|0.44086	.|T	.|0.13	-5.88|-5.88	7.3469|7.3469	0.26668|0.26668	0.0:0.4784:0.1351:0.3865|0.0:0.4784:0.1351:0.3865	.|.	.|569	.|Q96HY7	.|DHTK1_HUMAN	G|V	120|569	.|ENSP00000263035:L569V	.|ENSP00000263035:L569V	A|L	+|+	2|1	0|2	DHTKD1|DHTKD1	12182216|12182216	0.997000|0.997000	0.39634|0.39634	0.751000|0.751000	0.31187|0.31187	0.302000|0.302000	0.27658|0.27658	0.370000|0.370000	0.20433|0.20433	-0.270000|-0.270000	0.09285|0.09285	0.484000|0.484000	0.47621|0.47621	GCT|CTA	.		0.388	DHTKD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046777.1	NM_018706	
MLLT10	8028	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	21971185	21971185	+	Splice_Site	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr10:21971185C>T	ENST00000307729.7	+	13	1876	c.1698C>T	c.(1696-1698)aaC>aaT	p.N566N	MLLT10_ENST00000446906.2_Splice_Site_p.N566N|MLLT10_ENST00000377072.3_Splice_Site_p.N566N|MLLT10_ENST00000377059.3_Splice_Site_p.N566N			P55197	AF10_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10	566	DNA-binding.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6						CAATACACAACGGTAAGTTTT	0.348			T	"""MLL, PICALM, CDK6"""	AL																																p.N566N		.		Dom	yes		10	10p12	8028	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 (AF10)"""		L	.	MLLT10-658	0			c.C1698T						.						151.0	134.0	140.0					10																	21971185		2203	4298	6501	SO:0001630	splice_region_variant	8028	exon12			ACACAACGGTAAG	U13948	CCDS7135.1, CCDS55706.1, CCDS55707.1, CCDS55708.1	10p12	2013-01-28	2001-11-28		ENSG00000078403	ENSG00000078403		"""Zinc fingers, PHD-type"""	16063	protein-coding gene	gene with protein product		602409	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 10"""			7888665	Standard	NM_004641		Approved	AF10	uc021pny.1	P55197	OTTHUMG00000017799	ENST00000307729.7:c.1699+1C>T	10.37:g.21971185C>T		Somatic	39	0		WXS	Illumina GAIIx	Phase_I	38	33	NM_001195626	0	0	0	0	0	B1ANA8|Q5JT37|Q5VX90|Q66K63	Silent	SNP	ENST00000307729.7	37	CCDS55708.1																																																																																			.		0.348	MLLT10-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047136.1		Silent
KIAA1217	56243	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	24832505	24832505	+	Missense_Mutation	SNP	G	G	A	rs372909784		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr10:24832505G>A	ENST00000376454.3	+	19	4336	c.4306G>A	c.(4306-4308)Gtg>Atg	p.V1436M	KIAA1217_ENST00000458595.1_Intron|KIAA1217_ENST00000307544.6_Intron|KIAA1217_ENST00000376462.1_Intron|KIAA1217_ENST00000396446.1_Intron|KIAA1217_ENST00000376452.3_Intron|KIAA1217_ENST00000396445.1_Intron|KIAA1217_ENST00000376451.2_Missense_Mutation_p.V1119M	NM_019590.3	NP_062536.2	Q5T5P2	SKT_HUMAN	KIAA1217	1436					embryonic skeletal system development (GO:0048706)	cytoplasm (GO:0005737)				breast(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(19)|lung(19)|ovary(5)|prostate(3)|skin(3)|urinary_tract(1)	70						GGATCCAGTCGTGTGCCTGGA	0.453																																					p.V1436M		.											.	KIAA1217-98	0			c.G4306A						.	G	,,MET/VAL	0,4406		0,0,2203	76.0	69.0	71.0		,,4306	3.6	1.0	10		71	2,8598	2.2+/-6.3	0,2,4298	no	intron,intron,missense	KIAA1217	NM_001098500.1,NM_001098501.1,NM_019590.3	,,21	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	,,probably-damaging	,,1436/1944	24832505	2,13004	2203	4300	6503	SO:0001583	missense	56243	exon19			CCAGTCGTGTGCC	BX640796	CCDS31165.1, CCDS41496.1, CCDS60501.1, CCDS60502.1, CCDS60504.1, CCDS60505.1	10p12.31	2009-09-16			ENSG00000120549	ENSG00000120549			25428	protein-coding gene	gene with protein product	"""sickle tail"""					10574462	Standard	XM_005252500		Approved	DKFZP761L0424, SKT	uc001iru.4	Q5T5P2	OTTHUMG00000017824	ENST00000376454.3:c.4306G>A	10.37:g.24832505G>A	ENSP00000365637:p.Val1436Met	Somatic	204	0		WXS	Illumina GAIIx	Phase_I	135	125	NM_019590	0	0	1	10	9	A5LHW9|A6NLF3|A6PVQ5|A6PVQ6|A6PVQ7|B9EGK4|Q4KMG4|Q5T5P3|Q5T7H3|Q6MZZ6|Q6ZUI4|Q8WV45|Q9NSR2|Q9ULK3	Missense_Mutation	SNP	ENST00000376454.3	37	CCDS31165.1	.	.	.	.	.	.	.	.	.	.	G	14.88	2.666198	0.47677	0.0	2.33E-4	ENSG00000120549	ENST00000442879;ENST00000376454;ENST00000450158;ENST00000376451	T;T	0.35421	1.74;1.31	5.53	3.64	0.41730	.	0.194583	0.34178	N	0.004184	T	0.54431	0.1858	M	0.62723	1.935	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.958	D;D;B	0.91635	0.999;0.999;0.351	T	0.54576	-0.8273	10	0.72032	D	0.01	.	10.9453	0.47297	0.0704:0.1306:0.7989:0.0	.	1119;1119;1436	C9JRK3;Q5T5P2-3;Q5T5P2	.;.;SKT_HUMAN	M	1119;1436;1119;1119	ENSP00000365637:V1436M;ENSP00000365634:V1119M	ENSP00000365634:V1119M	V	+	1	0	KIAA1217	24872511	0.999000	0.42202	0.983000	0.44433	0.088000	0.18126	3.171000	0.50824	0.672000	0.31204	0.561000	0.74099	GTG	.		0.453	KIAA1217-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047223.2	NM_019590	
KIAA1462	57608	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	30315257	30315257	+	Silent	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr10:30315257G>A	ENST00000375377.1	-	3	3921	c.3820C>T	c.(3820-3822)Ctg>Ttg	p.L1274L		NM_020848.2	NP_065899.1	Q9P266	JCAD_HUMAN	KIAA1462	1274					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)				breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(23)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	75						CTGAAGCTCAGGACTCTCATC	0.597																																					p.L1274L		.											.	KIAA1462-72	0			c.C3820T						.						51.0	49.0	50.0					10																	30315257		1957	4142	6099	SO:0001819	synonymous_variant	57608	exon3			AGCTCAGGACTCT	AB040895	CCDS41500.1	10p12.1	2013-04-23			ENSG00000165757	ENSG00000165757			29283	protein-coding gene	gene with protein product	"""junctional protein associated with coronary artery disease"""	614398				10819331, 21884682	Standard	NM_020848		Approved	JCAD	uc001iux.3	Q9P266	OTTHUMG00000017885	ENST00000375377.1:c.3820C>T	10.37:g.30315257G>A		Somatic	53	0		WXS	Illumina GAIIx	Phase_I	43	40	NM_020848	0	0	1	2	1	Q5HYA7|Q5T992|Q86WZ9|Q9BYJ2	Silent	SNP	ENST00000375377.1	37	CCDS41500.1																																																																																			.		0.597	KIAA1462-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047409.1	NM_020848	
PARD3	56288	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	34400183	34400183	+	Missense_Mutation	SNP	G	G	A	rs565005004		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr10:34400183G>A	ENST00000374789.3	-	25	4310	c.3985C>T	c.(3985-3987)Cgg>Tgg	p.R1329W	PARD3_ENST00000545693.1_Missense_Mutation_p.R1313W|PARD3_ENST00000374788.3_Missense_Mutation_p.R1326W|PARD3_ENST00000545260.1_Missense_Mutation_p.R1239W|PARD3_ENST00000374790.3_Missense_Mutation_p.R1269W|PARD3_ENST00000346874.4_Missense_Mutation_p.R1292W|PARD3_ENST00000374794.3_Missense_Mutation_p.R1217W|PARD3_ENST00000350537.4_Missense_Mutation_p.R1283W	NM_019619.3	NP_062565.2	Q8TEW0	PARD3_HUMAN	par-3 family cell polarity regulator	1329					apical constriction (GO:0003383)|asymmetric cell division (GO:0008356)|axonogenesis (GO:0007409)|cell cycle (GO:0007049)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|centrosome localization (GO:0051642)|establishment of epithelial cell polarity (GO:0090162)|establishment or maintenance of cell polarity (GO:0007163)|microtubule cytoskeleton organization (GO:0000226)|myelination in peripheral nervous system (GO:0022011)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|positive regulation of myelination (GO:0031643)|protein complex assembly (GO:0006461)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein targeting to membrane (GO:0006612)|regulation of actin filament-based process (GO:0032970)|regulation of cellular localization (GO:0060341)|tight junction assembly (GO:0070830)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing, spreading of cells (GO:0044319)	apical part of cell (GO:0045177)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|internode region of axon (GO:0033269)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|tight junction (GO:0005923)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	63		Breast(68;0.0707)				ACATCTTGCCGGAAGGGCCCC	0.577													G|||	1	0.000199681	0.0	0.0	5008	,	,		17821	0.0		0.0	False		,,,				2504	0.001				p.R1329W		.											.	PARD3-92	0			c.C3985T						.						47.0	50.0	49.0					10																	34400183		2203	4300	6503	SO:0001583	missense	56288	exon25			CTTGCCGGAAGGG	AF252293	CCDS7178.1, CCDS53509.1, CCDS53510.1, CCDS53511.1, CCDS53512.1, CCDS53513.1, CCDS53514.1, CCDS53515.1, CCDS53516.1	10p11.22	2014-06-13	2013-08-28		ENSG00000148498	ENSG00000148498			16051	protein-coding gene	gene with protein product	"""atypical PKC isotype-specific interacting protein"", ""par-3 family cell polarity regulator alpha"", ""protein phosphatase 1, regulatory subunit 118"""	606745	"""par-3 (partitioning defective 3, C.elegans) homolog"", ""par-3 partitioning defective 3 homolog (C. elegans)"""			10934474	Standard	NM_001184790		Approved	PAR3, PARD3A, Bazooka, Baz, ASIP, PPP1R118	uc010qej.2	Q8TEW0	OTTHUMG00000017948	ENST00000374789.3:c.3985C>T	10.37:g.34400183G>A	ENSP00000363921:p.Arg1329Trp	Somatic	66	0		WXS	Illumina GAIIx	Phase_I	64	58	NM_019619	0	0	0	8	8	F5H5T0|Q5T2U1|Q5VUA2|Q5VUA3|Q5VWV0|Q5VWV1|Q5VWV3|Q5VWV4|Q5VWV5|Q6IQ47|Q8TCZ9|Q8TEW1|Q8TEW2|Q8TEW3|Q96K28|Q96RM6|Q96RM7|Q9BY57|Q9BY58|Q9HC48|Q9NWL4|Q9NYE6	Missense_Mutation	SNP	ENST00000374789.3	37	CCDS7178.1	.	.	.	.	.	.	.	.	.	.	G	18.19	3.569609	0.65765	.	.	ENSG00000148498	ENST00000545693;ENST00000545260;ENST00000374789;ENST00000374788;ENST00000346874;ENST00000374794;ENST00000350537;ENST00000374790	T;T;T;T;T;T;T;T	0.35973	1.8;1.63;1.89;1.89;1.41;1.28;1.63;1.82	6.17	4.32	0.51571	.	0.000000	0.85682	D	0.000000	T	0.49304	0.1549	L	0.32530	0.975	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.91635	0.999;0.999;0.999;0.999;0.999;0.999;0.999;0.997	T	0.51741	-0.8667	10	0.87932	D	0	.	14.6594	0.68858	0.0:0.0:0.4628:0.5372	.	1217;1239;1246;1283;1313;1292;1326;1329	Q8TEW0-5;Q8TEW0-3;Q8TEW0-7;Q8TEW0-6;F5H5T0;Q8TEW0-4;Q8TEW0-2;Q8TEW0	.;.;.;.;.;.;.;PARD3_HUMAN	W	1313;1239;1329;1326;1292;1217;1283;1269	ENSP00000443147:R1313W;ENSP00000440857:R1239W;ENSP00000363921:R1329W;ENSP00000363920:R1326W;ENSP00000340591:R1292W;ENSP00000363926:R1217W;ENSP00000311986:R1283W;ENSP00000363922:R1269W	ENSP00000340591:R1292W	R	-	1	2	PARD3	34440189	1.000000	0.71417	1.000000	0.80357	0.880000	0.50808	1.616000	0.36933	0.936000	0.37367	-0.122000	0.15005	CGG	.		0.577	PARD3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047527.1	NM_019619	
FZD8	8325	broad.mit.edu	37	10	35929442	35929442	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr10:35929442A>G	ENST00000374694.1	-	1	920	c.916T>C	c.(916-918)Ttc>Ctc	p.F306L	MIR4683_ENST00000579659.1_RNA	NM_031866.2	NP_114072.1	Q9H461	FZD8_HUMAN	frizzled class receptor 8	306					axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|gonad development (GO:0008406)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|T cell differentiation in thymus (GO:0033077)|vasculature development (GO:0001944)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|ubiquitin protein ligase binding (GO:0031625)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(3)|prostate(1)|urinary_tract(1)	11						GGGTACTTGAAGCGCTCCATG	0.632																																					p.F306L		.											.	FZD8-612	0			c.T916C						.						36.0	38.0	38.0					10																	35929442		2203	4300	6503	SO:0001583	missense	8325	exon1			ACTTGAAGCGCTC	AB043703	CCDS7192.1	10p11.2	2014-01-29	2014-01-29		ENSG00000177283	ENSG00000177283		"""GPCR / Class F : Frizzled receptors"""	4046	protein-coding gene	gene with protein product		606146	"""frizzled (Drosophila) homolog 8"", ""frizzled homolog 8 (Drosophila)"", ""frizzled 8, seven transmembrane spanning receptor"", ""frizzled family receptor 8"""			11295046	Standard	NM_031866		Approved		uc001iyz.1	Q9H461	OTTHUMG00000017956	ENST00000374694.1:c.916T>C	10.37:g.35929442A>G	ENSP00000363826:p.Phe306Leu	Somatic	166	0		WXS	Illumina GAIIx	Phase_I	130	5	NM_031866	0	0	1	1	0		Missense_Mutation	SNP	ENST00000374694.1	37	CCDS7192.1	.	.	.	.	.	.	.	.	.	.	A	15.77	2.931612	0.52866	.	.	ENSG00000177283	ENST00000374694	D	0.84589	-1.87	3.08	1.91	0.25777	GPCR, family 2-like (1);	0.149852	0.43747	U	0.000521	D	0.92202	0.7527	M	0.92738	3.34	0.50313	D	0.99986	D	0.76494	0.999	D	0.73380	0.98	D	0.90381	0.4388	10	0.87932	D	0	.	7.1818	0.25776	0.881:0.0:0.119:0.0	.	306	Q9H461	FZD8_HUMAN	L	306	ENSP00000363826:F306L	ENSP00000363826:F306L	F	-	1	0	FZD8	35969448	1.000000	0.71417	0.994000	0.49952	0.442000	0.32017	5.899000	0.69846	0.379000	0.24794	0.240000	0.17902	TTC	.		0.632	FZD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047575.2	NM_031866	
BMS1	9790	broad.mit.edu	37	10	43291975	43291975	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr10:43291975G>A	ENST00000374518.5	+	10	1346	c.1283G>A	c.(1282-1284)cGt>cAt	p.R428H		NM_014753.3	NP_055568.3	Q14692	BMS1_HUMAN	BMS1 ribosome biogenesis factor	428					ribosome assembly (GO:0042255)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(23)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						GGTCGAATGCGTCGGAAAGCC	0.383																																					p.R428H		.											.	BMS1-93	0			c.G1283A						.						131.0	122.0	125.0					10																	43291975		2203	4300	6503	SO:0001583	missense	9790	exon10			GAATGCGTCGGAA	BC043345	CCDS7199.1	10q11.21	2013-05-01	2013-05-01	2007-03-20	ENSG00000165733	ENSG00000165733			23505	protein-coding gene	gene with protein product		611448	"""BMS1-like, ribosome assembly protein (yeast)"", ""BMS1 homolog, ribosome assembly protein (yeast)"""	BMS1L		11779832	Standard	NM_014753		Approved	KIAA0187	uc001jaj.3	Q14692	OTTHUMG00000018020	ENST00000374518.5:c.1283G>A	10.37:g.43291975G>A	ENSP00000363642:p.Arg428His	Somatic	600	2		WXS	Illumina GAIIx	Phase_I	430	11	NM_014753	0	0	8	8	0	Q5QPT5|Q86XJ9	Missense_Mutation	SNP	ENST00000374518.5	37	CCDS7199.1	.	.	.	.	.	.	.	.	.	.	g	15.81	2.943926	0.53079	.	.	ENSG00000165733	ENST00000374518	T	0.10382	2.88	4.71	3.81	0.43845	.	0.000000	0.85682	D	0.000000	T	0.24198	0.0586	L	0.46885	1.475	0.39031	D	0.959943	D	0.89917	1.0	D	0.80764	0.994	T	0.01819	-1.1267	10	0.35671	T	0.21	.	13.3943	0.60840	0.0778:0.0:0.9222:0.0	.	428	Q14692	BMS1_HUMAN	H	428	ENSP00000363642:R428H	ENSP00000363642:R428H	R	+	2	0	BMS1	42611981	1.000000	0.71417	1.000000	0.80357	0.161000	0.22273	5.773000	0.68898	1.106000	0.41623	-0.233000	0.12211	CGT	.		0.383	BMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047690.2	NM_014753	
GDF10	2662	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	48428896	48428896	+	Silent	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr10:48428896C>T	ENST00000224605.2	-	2	1255	c.990G>A	c.(988-990)gcG>gcA	p.A330A		NM_004962.3	NP_004953.1	P55107	BMP3B_HUMAN	growth differentiation factor 10	330					fat cell differentiation (GO:0045444)|growth (GO:0040007)|skeletal system development (GO:0001501)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular space (GO:0005615)	growth factor activity (GO:0008083)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(20)|skin(1)	31						GGGGTTTCAGCGCCCGGAAGG	0.672																																					p.A330A		.											.	GDF10-650	0			c.G990A						.						31.0	31.0	31.0					10																	48428896		2203	4300	6503	SO:0001819	synonymous_variant	2662	exon2			TTTCAGCGCCCGG	L42113	CCDS73117.1	10q11.22	2014-04-10			ENSG00000107623	ENSG00000266524		"""Endogenous ligands"""	4215	protein-coding gene	gene with protein product		601361				8679252	Standard	NM_004962		Approved	BMP-3b	uc001jfb.3	P55107	OTTHUMG00000188319	ENST00000224605.2:c.990G>A	10.37:g.48428896C>T		Somatic	60	0		WXS	Illumina GAIIx	Phase_I	67	64	NM_004962	0	0	0	1	1	Q5VSQ8|Q9UCX6	Silent	SNP	ENST00000224605.2	37	CCDS7220.1																																																																																			.		0.672	GDF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047884.1	NM_004962	
JMJD1C	221037	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	64975209	64975209	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr10:64975209A>G	ENST00000399262.2	-	7	1047	c.829T>C	c.(829-831)Tat>Cat	p.Y277H	JMJD1C_ENST00000399251.1_Missense_Mutation_p.Y58H|JMJD1C_ENST00000402544.1_Missense_Mutation_p.Y58H|JMJD1C_ENST00000542921.1_Missense_Mutation_p.Y95H|JMJD1C_ENST00000489372.2_5'UTR	NM_032776.1	NP_116165.1	Q15652	JHD2C_HUMAN	jumonji domain containing 1C	277					blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleoplasm (GO:0005654)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)|thyroid hormone receptor binding (GO:0046966)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(9)|lung(27)|ovary(6)|prostate(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	77	Prostate(12;0.0119)|all_hematologic(501;0.191)					GCACGTGTATAATGGCTCTAA	0.378																																					p.Y277H		.											.	JMJD1C-275	0			c.T829C						.						210.0	181.0	190.0					10																	64975209		1902	4121	6023	SO:0001583	missense	221037	exon7			GTGTATAATGGCT	L40411	CCDS41532.1, CCDS60538.1	10q22.1	2011-05-25	2004-03-31	2004-04-01	ENSG00000171988	ENSG00000171988			12313	protein-coding gene	gene with protein product		604503	"""thyroid hormone receptor interactor 8"""	TRIP8		7776974	Standard	XM_005269624		Approved	DKFZp761F0118, KIAA1380, FLJ14374	uc001jmn.3	Q15652	OTTHUMG00000018311	ENST00000399262.2:c.829T>C	10.37:g.64975209A>G	ENSP00000382204:p.Tyr277His	Somatic	76	0		WXS	Illumina GAIIx	Phase_I	59	53	NM_032776	0	0	0	0	0	A0T124|Q5SQZ8|Q5SQZ9|Q5SR00|Q7Z3E7|Q8N3U0|Q96KB9|Q9P2G7	Missense_Mutation	SNP	ENST00000399262.2	37	CCDS41532.1	.	.	.	.	.	.	.	.	.	.	A	17.58	3.424025	0.62733	.	.	ENSG00000171988	ENST00000399262;ENST00000402544;ENST00000399251;ENST00000542921	T;T;T;T	0.14266	2.52;2.52;2.52;2.52	5.6	5.6	0.85130	.	0.082597	0.49916	U	0.000122	T	0.30008	0.0751	L	0.60455	1.87	0.58432	D	0.999996	B;D	0.64830	0.361;0.994	B;P	0.58077	0.076;0.832	T	0.01256	-1.1404	10	0.62326	D	0.03	-11.3013	15.7859	0.78304	1.0:0.0:0.0:0.0	.	277;95	Q15652;A0T124	JHD2C_HUMAN;.	H	277;58;58;95	ENSP00000382204:Y277H;ENSP00000384990:Y58H;ENSP00000382195:Y58H;ENSP00000444682:Y95H	ENSP00000382195:Y58H	Y	-	1	0	JMJD1C	64645215	1.000000	0.71417	1.000000	0.80357	0.845000	0.48019	8.371000	0.90123	2.140000	0.66376	0.533000	0.62120	TAT	.		0.378	JMJD1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048249.2	NM_004241	
MICU1	10367	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	74235015	74235015	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr10:74235015C>T	ENST00000361114.5	-	8	872	c.776G>A	c.(775-777)cGc>cAc	p.R259H	MICU1_ENST00000401998.3_Missense_Mutation_p.R259H|MICU1_ENST00000398763.4_Missense_Mutation_p.R61H|MICU1_ENST00000398761.4_Missense_Mutation_p.R261H|MICU1_ENST00000418483.2_Missense_Mutation_p.R61H	NM_001195518.1|NM_006077.3	NP_001182447.1|NP_006068.2	Q9BPX6	MICU1_HUMAN	mitochondrial calcium uptake 1	259					calcium ion import (GO:0070509)|calcium ion transmembrane import into mitochondrion (GO:0036444)|defense response (GO:0006952)|mitochondrial calcium ion homeostasis (GO:0051560)|mitochondrial calcium ion transport (GO:0006851)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|protein homooligomerization (GO:0051260)	calcium channel complex (GO:0034704)|integral component of mitochondrial membrane (GO:0032592)|intracellular (GO:0005622)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|uniplex complex (GO:1990246)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)										ATCTCTGTGGCGCATACCCAT	0.443																																					p.R259H		.											.	.	0			c.G776A						.						77.0	75.0	75.0					10																	74235015		1976	4156	6132	SO:0001583	missense	10367	exon8			CTGTGGCGCATAC	Y17711	CCDS55714.1, CCDS55715.1	10q22.1	2013-01-10	2011-06-23	2011-06-23	ENSG00000107745	ENSG00000107745		"""EF-hand domain containing"""	1530	protein-coding gene	gene with protein product		605084	"""calcium binding atopy-related autoantigen 1"""	CBARA1		9806765, 20693986	Standard	NM_006077		Approved	CALC, EFHA3, FLJ12684	uc001jtb.2	Q9BPX6	OTTHUMG00000018437	ENST00000361114.5:c.776G>A	10.37:g.74235015C>T	ENSP00000354415:p.Arg259His	Somatic	188	0		WXS	Illumina GAIIx	Phase_I	136	129	NM_001195518	0	0	1	55	54	A8MV96|B3KN20|B4DJH9|B4DPI1|B5MBY3|D3YTJ3|O75785|Q9H9N6|Q9UFX0	Missense_Mutation	SNP	ENST00000361114.5	37	CCDS55715.1	.	.	.	.	.	.	.	.	.	.	C	36	5.607482	0.96626	.	.	ENSG00000107745	ENST00000361114;ENST00000398761;ENST00000401998;ENST00000418483;ENST00000398763	T;T;T;T;T	0.66280	1.99;-0.2;1.99;0.8;0.53	5.4	5.4	0.78164	.	0.061112	0.64402	D	0.000003	T	0.81621	0.4861	M	0.82323	2.585	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.998;0.993	T	0.82940	-0.0208	10	0.52906	T	0.07	.	19.1817	0.93627	0.0:1.0:0.0:0.0	.	61;61;259	Q9BPX6-4;Q9BPX6-5;Q9BPX6	.;.;MICU1_HUMAN	H	259;261;259;61;61	ENSP00000354415:R259H;ENSP00000381745:R261H;ENSP00000384068:R259H;ENSP00000402470:R61H;ENSP00000381747:R61H	ENSP00000354415:R259H	R	-	2	0	MICU1	73905021	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.792000	0.85828	2.528000	0.85240	0.650000	0.86243	CGC	.		0.443	MICU1-002	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048586.1	NM_006077	
GRID1	2894	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	87379740	87379740	+	Silent	SNP	G	G	A	rs543588600		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr10:87379740G>A	ENST00000327946.7	-	14	2329	c.2244C>T	c.(2242-2244)taC>taT	p.Y748Y	GRID1_ENST00000536331.1_Silent_p.Y319Y	NM_017551.2	NP_060021.1	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	748					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|social behavior (GO:0035176)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|ionotropic glutamate receptor complex (GO:0008328)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(46)|ovary(5)|prostate(4)|skin(5)|stomach(4)|upper_aerodigestive_tract(5)	106						TCAGGGCTGCGTATTCCACCA	0.572										Multiple Myeloma(13;0.14)			G|||	1	0.000199681	0.0008	0.0	5008	,	,		21823	0.0		0.0	False		,,,				2504	0.0				p.Y748Y		.											.	GRID1-142	0			c.C2244T						.						135.0	96.0	109.0					10																	87379740		2203	4300	6503	SO:0001819	synonymous_variant	2894	exon14			GGCTGCGTATTCC	AB033046	CCDS31236.1	10q22	2012-08-29			ENSG00000182771	ENSG00000182771		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4575	protein-coding gene	gene with protein product		610659					Standard	NM_017551		Approved	GluD1, KIAA1220	uc001kdl.1	Q9ULK0	OTTHUMG00000018650	ENST00000327946.7:c.2244C>T	10.37:g.87379740G>A		Somatic	298	2		WXS	Illumina GAIIx	Phase_I	194	166	NM_017551	0	0	0	8	8	B3KXD5|B7Z7L0|Q8IXT3	Silent	SNP	ENST00000327946.7	37	CCDS31236.1																																																																																			.		0.572	GRID1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049148.3	XM_043613	
MMRN2	79812	hgsc.bcm.edu	37	10	88702603	88702603	+	Silent	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr10:88702603G>A	ENST00000372027.5	-	6	2259	c.1938C>T	c.(1936-1938)agC>agT	p.S646S	MMRN2_ENST00000488950.1_5'Flank	NM_024756.2	NP_079032.2	Q9H8L6	MMRN2_HUMAN	multimerin 2	646					angiogenesis (GO:0001525)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|kidney(1)|large_intestine(6)|lung(7)|prostate(2)|skin(1)|stomach(1)	19						CCTGCAGCCCGCTAGCGGCGT	0.731																																					p.S646S		.											.	MMRN2-153	0			c.C1938T						.						8.0	8.0	8.0					10																	88702603		2138	4209	6347	SO:0001819	synonymous_variant	79812	exon6			CAGCCCGCTAGCG	AK023527	CCDS7379.1	10q23.31	2004-03-10	2004-03-02	2004-03-02	ENSG00000173269	ENSG00000173269		"""EMI domain containing"""	19888	protein-coding gene	gene with protein product		608925	"""elastin microfibril interfacer 3"""	EMILIN3		11559704	Standard	NM_024756		Approved	EndoGlyx-1, FLJ13465	uc001kea.3	Q9H8L6	OTTHUMG00000018663	ENST00000372027.5:c.1938C>T	10.37:g.88702603G>A		Somatic	2	0		WXS	Illumina GAIIx	Phase_I	8	7	NM_024756	0	0	3	55	52	Q504V7|Q6P2N2	Silent	SNP	ENST00000372027.5	37	CCDS7379.1																																																																																			.		0.731	MMRN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049179.2	NM_024756	
MYOF	26509	broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	95103662	95103662	+	Missense_Mutation	SNP	C	C	T	rs201449564	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr10:95103662C>T	ENST00000359263.4	-	38	4276	c.4277G>A	c.(4276-4278)cGg>cAg	p.R1426Q	MYOF_ENST00000358334.5_Missense_Mutation_p.R1413Q|MYOF_ENST00000371501.4_Missense_Mutation_p.R1426Q|MYOF_ENST00000371502.4_Missense_Mutation_p.R1426Q	NM_013451.3	NP_038479.1	Q9NZM1	MYOF_HUMAN	myoferlin	1426					blood circulation (GO:0008015)|cellular response to heat (GO:0034605)|muscle contraction (GO:0006936)|plasma membrane repair (GO:0001778)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)	caveola (GO:0005901)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	phospholipid binding (GO:0005543)			NS(2)|autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(7)|large_intestine(15)|lung(14)|ovary(4)|prostate(4)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						AACGATGTCCCGGCATGGTGG	0.428													C|||	4	0.000798722	0.003	0.0	5008	,	,		20763	0.0		0.0	False		,,,				2504	0.0				p.R1426Q		.											.	MYOF-93	0			c.G4277A						.	C	GLN/ARG,GLN/ARG	5,3873		0,5,1934	120.0	118.0	119.0		4277,4238	3.9	1.0	10		119	0,8252		0,0,4126	yes	missense,missense	MYOF	NM_013451.3,NM_133337.2	43,43	0,5,6060	TT,TC,CC		0.0,0.1289,0.0412	benign,benign	1426/2062,1413/2049	95103662	5,12125	1939	4126	6065	SO:0001583	missense	26509	exon38			ATGTCCCGGCATG	AB033033	CCDS41550.1, CCDS41551.1	10q24	2014-06-27	2008-11-26	2008-11-26	ENSG00000138119	ENSG00000138119			3656	protein-coding gene	gene with protein product	"""fer-1-like family member 3"""	604603	"""fer-1 (C.elegans)-like 3 (myoferlin)"", ""fer-1-like 3, myoferlin (C. elegans)"""	FER1L3		10607832, 10995573, 17702744	Standard	NM_013451		Approved	KIAA1207	uc001kin.3	Q9NZM1	OTTHUMG00000018772	ENST00000359263.4:c.4277G>A	10.37:g.95103662C>T	ENSP00000352208:p.Arg1426Gln	Somatic	91	1		WXS	Illumina GAIIx	Phase_I	67	62	NM_013451	0	0	1	7	6	B3KQN5|Q5VWW2|Q5VWW3|Q5VWW4|Q5VWW5|Q7Z642|Q8IWH0|Q9HBU3|Q9NZM0|Q9ULL3|Q9Y4U4	Missense_Mutation	SNP	ENST00000359263.4	37	CCDS41551.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	C	9.983	1.228661	0.22542	0.001289	0.0	ENSG00000138119	ENST00000358334;ENST00000359263;ENST00000371501;ENST00000371502	D;D;D;D	0.82803	-1.65;-1.65;-1.65;-1.65	5.71	3.86	0.44501	.	0.666605	0.15162	N	0.277089	T	0.72187	0.3429	L	0.34521	1.04	0.36593	D	0.874229	B;B	0.09022	0.002;0.002	B;B	0.08055	0.003;0.001	T	0.64676	-0.6351	10	0.18710	T	0.47	-8.5205	9.1438	0.36919	0.0:0.7535:0.0:0.2465	.	1413;1426	Q9NZM1-6;Q9NZM1	.;MYOF_HUMAN	Q	1413;1426;1426;1426	ENSP00000351094:R1413Q;ENSP00000352208:R1426Q;ENSP00000360556:R1426Q;ENSP00000360557:R1426Q	ENSP00000351094:R1413Q	R	-	2	0	MYOF	95093652	0.990000	0.36364	0.987000	0.45799	0.553000	0.35397	0.343000	0.19944	0.766000	0.33244	0.655000	0.94253	CGG	C|1.000;T|0.000		0.428	MYOF-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049423.2	NM_013451	
XPNPEP1	7511	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	111633162	111633162	+	Missense_Mutation	SNP	C	C	T	rs201456347		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr10:111633162C>T	ENST00000502935.1	-	16	1534	c.1415G>A	c.(1414-1416)cGg>cAg	p.R472Q	XPNPEP1_ENST00000369680.4_Missense_Mutation_p.R429Q|XPNPEP1_ENST00000369683.1_Missense_Mutation_p.R358Q|XPNPEP1_ENST00000322238.8_Missense_Mutation_p.R448Q					X-prolyl aminopeptidase (aminopeptidase P) 1, soluble											endometrium(2)|kidney(9)|large_intestine(4)|lung(9)|ovary(3)|pancreas(2)|skin(1)|urinary_tract(1)	31		Breast(234;0.174)		Epithelial(162;1.64e-05)|all cancers(201;0.000564)|BRCA - Breast invasive adenocarcinoma(275;0.0721)		ATGCATTGTCCGCGTCACATC	0.438																																					p.R472Q		.											.	XPNPEP1-94	0			c.G1415A						.						169.0	150.0	157.0					10																	111633162		2203	4300	6503	SO:0001583	missense	7511	exon16			ATTGTCCGCGTCA		CCDS7560.1, CCDS7560.2, CCDS53576.1	10q25.3	2006-01-16	2002-07-17		ENSG00000108039	ENSG00000108039	3.4.11.9		12822	protein-coding gene	gene with protein product		602443	"""X-prolyl aminopeptidase (aminopeptidase P)-like"""	XPNPEP, XPNPEPL1, XPNPEPL			Standard	NM_020383		Approved		uc001kyp.2	Q9NQW7	OTTHUMG00000019029	ENST00000502935.1:c.1415G>A	10.37:g.111633162C>T	ENSP00000421566:p.Arg472Gln	Somatic	222	0		WXS	Illumina GAIIx	Phase_I	146	129	NM_020383	0	0	1	33	32		Missense_Mutation	SNP	ENST00000502935.1	37	CCDS7560.2	.	.	.	.	.	.	.	.	.	.	C	36	5.623871	0.96660	.	.	ENSG00000108039	ENST00000502935;ENST00000369683;ENST00000322238;ENST00000369680	D;D;D;D	0.83419	-1.72;-1.72;-1.72;-1.72	5.82	5.82	0.92795	Peptidase M24, structural domain (3);	0.000000	0.85682	D	0.000000	D	0.96364	0.8814	H	0.99971	5.125	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98393	1.0564	10	0.87932	D	0	-15.4577	18.2796	0.90094	0.0:1.0:0.0:0.0	.	472;429	G5E9Y2;Q9NQW7	.;XPP1_HUMAN	Q	472;358;448;429	ENSP00000421566:R472Q;ENSP00000358697:R358Q;ENSP00000324011:R448Q;ENSP00000358694:R429Q	ENSP00000324011:R448Q	R	-	2	0	XPNPEP1	111623152	1.000000	0.71417	0.998000	0.56505	0.837000	0.47467	7.506000	0.81665	2.752000	0.94435	0.655000	0.94253	CGG	C|0.999;T|0.001		0.438	XPNPEP1-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000050264.2		
C10orf85	404216	bcgsc.ca	37	10	122359040	122359040	+	3'UTR	SNP	A	A	G	rs11594669	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr10:122359040A>G	ENST00000369071.2	+	0	1320									chromosome 10 open reading frame 85																		acaaagagggacagagaggtt	0.507													A|||	1189	0.23742	0.1127	0.2435	5008	,	,		18934	0.2093		0.3171	False		,,,				2504	0.3487				.		.											.	.	0			.						.																																			SO:0001624	3_prime_UTR_variant	100847064	.			AGAGGGACAGAGA	AK094721		10q26.12	2013-09-20			ENSG00000177234	ENSG00000177234			31365	protein-coding gene	gene with protein product							Standard	NR_103717		Approved	FLJ37402, Em:AC023282.2		Q8N1V8	OTTHUMG00000019167	ENST00000369071.2:c.*831A>G	10.37:g.122359040A>G		Somatic	146	1		WXS	Illumina GAIIx	Phase_I	114	6	.	0	0	0	0	0		RNA	SNP	ENST00000369071.2	37																																																																																				A|0.765;G|0.235		0.507	C10orf85-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050700.1		
DMBT1	1755	ucsc.edu	37	10	124339362	124339362	+	Missense_Mutation	SNP	T	T	A	rs202149132	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr10:124339362T>A	ENST00000338354.3	+	10	1054	c.948T>A	c.(946-948)aaT>aaA	p.N316K	DMBT1_ENST00000368955.3_Missense_Mutation_p.N316K|DMBT1_ENST00000368956.2_Missense_Mutation_p.N316K|DMBT1_ENST00000344338.3_Missense_Mutation_p.N316K|DMBT1_ENST00000368909.3_Missense_Mutation_p.N316K|DMBT1_ENST00000330163.4_Missense_Mutation_p.N316K|DMBT1_ENST00000359586.6_Intron			Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1	316	SRCR 2. {ECO:0000255|PROSITE- ProRule:PRU00196}.				defense response to virus (GO:0051607)|epithelial cell differentiation (GO:0030855)|induction of bacterial agglutination (GO:0043152)|innate immune response (GO:0045087)|inner cell mass cell proliferation (GO:0001833)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of epithelial cell differentiation (GO:0030858)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|phagocytic vesicle membrane (GO:0030670)|proteinaceous extracellular matrix (GO:0005578)|zymogen granule membrane (GO:0042589)	calcium-dependent protein binding (GO:0048306)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|zymogen binding (GO:0035375)			breast(2)|central_nervous_system(7)|cervix(3)|endometrium(8)|kidney(1)|large_intestine(1)|lung(46)|prostate(1)|urinary_tract(3)	72		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				GCCCCCACAATGGCTGGCTCA	0.582													T|||	102	0.0203674	0.0197	0.013	5008	,	,		19464	0.0		0.0189	False		,,,				2504	0.0491				p.N316K	Ovarian(182;93 2026 18125 22222 38972)	.											.	DMBT1-494	0			c.T948A						.						82.0	81.0	82.0					10																	124339362		1911	4136	6047	SO:0001583	missense	1755	exon10			CCACAATGGCTGG		CCDS44490.1, CCDS44491.1, CCDS44492.1	10q25.3-q26.1	2008-08-01			ENSG00000187908	ENSG00000187908			2926	protein-coding gene	gene with protein product		601969				9288095, 17548659	Standard	NM_004406		Approved	GP340, muclin	uc001lgk.1	Q9UGM3	OTTHUMG00000019185	ENST00000338354.3:c.948T>A	10.37:g.124339362T>A	ENSP00000342210:p.Asn316Lys	Somatic	225	7		WXS	Illumina GAIIx	Phase_I	148	37	NM_007329	0	0	0	0	0	A6NDG4|A6NDJ5|A8E4R5|B1ARE7|B1ARE8|B1ARE9|B1ARF0|B7Z8Y2|F8WEF7|Q59EX0|Q5JR26|Q6MZN4|Q96DU4|Q9UGM2|Q9UJ57|Q9UKJ4|Q9Y211|Q9Y4V9	Missense_Mutation	SNP	ENST00000338354.3	37		.	.	.	.	.	.	.	.	.	.	T	0.549	-0.850127	0.02651	.	.	ENSG00000187908	ENST00000338354;ENST00000368915;ENST00000341278;ENST00000368953;ENST00000339871;ENST00000368942;ENST00000327438;ENST00000344338;ENST00000339712;ENST00000330163;ENST00000368909;ENST00000368955;ENST00000368956	T;T;T;T;T;T	0.43688	0.94;0.94;0.94;0.94;0.94;0.94	3.85	-7.69	0.01263	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	.	.	.	.	T	0.43033	0.1229	L	0.61387	1.9	0.09310	N	0.999999	P;P;B;D;P	0.65815	0.768;0.935;0.12;0.995;0.889	B;P;B;P;P	0.59357	0.264;0.503;0.01;0.856;0.769	T	0.32508	-0.9904	9	0.07175	T	0.84	.	6.8329	0.23921	0.2549:0.1658:0.0:0.5793	.	316;316;316;316;316	Q9UGM3-4;Q9UGM3-6;Q9UGM3-2;Q9UGM3-3;Q9UGM3	.;.;.;.;DMBT1_HUMAN	K	316	ENSP00000342210:N316K;ENSP00000343175:N316K;ENSP00000327747:N316K;ENSP00000357905:N316K;ENSP00000357951:N316K;ENSP00000357952:N316K	ENSP00000331522:N316K	N	+	3	2	DMBT1	124329352	0.000000	0.05858	0.000000	0.03702	0.154000	0.21943	-10.493000	0.00006	-3.599000	0.00134	-0.495000	0.04643	AAT	T|0.994;A|0.006		0.582	DMBT1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050792.2	NM_004406	
C10orf120	399814	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	124458908	124458908	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr10:124458908C>T	ENST00000329446.4	-	2	228	c.197G>A	c.(196-198)aGa>aAa	p.R66K		NM_001010912.1	NP_001010912.1	Q5SQS8	CJ120_HUMAN	chromosome 10 open reading frame 120	66										endometrium(1)|kidney(1)|large_intestine(6)|lung(9)|skin(2)|stomach(1)|urinary_tract(1)	21		all_neural(114;0.169)|Glioma(114;0.222)				TGGGTCTGATCTGTAGAATTT	0.488																																					p.R66K		.											.	C10orf120-91	0			c.G197A						.						66.0	69.0	68.0					10																	124458908		2203	4300	6503	SO:0001583	missense	399814	exon2			TCTGATCTGTAGA		CCDS31302.1	10q26.13	2012-06-12			ENSG00000183559	ENSG00000183559			25707	protein-coding gene	gene with protein product							Standard	NM_001010912		Approved	bA318C4.1	uc001lgn.3	Q5SQS8	OTTHUMG00000019187	ENST00000329446.4:c.197G>A	10.37:g.124458908C>T	ENSP00000331012:p.Arg66Lys	Somatic	79	0		WXS	Illumina GAIIx	Phase_I	65	18	NM_001010912	0	0	0	0	0	B2RU17	Missense_Mutation	SNP	ENST00000329446.4	37	CCDS31302.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	0.007|0.007	-2.016810|-2.016810	0.00418|0.00418	.|.	.|.	ENSG00000183559|ENSG00000183559	ENST00000432000|ENST00000329446	.|T	.|0.26810	.|1.71	4.83|4.83	-1.64|-1.64	0.08318|0.08318	.|.	.|0.941678	.|0.08887	.|N	.|0.879168	T|T	0.03871|0.03871	0.0109|0.0109	N|N	0.00170|0.00170	-1.935|-1.935	0.09310|0.09310	N|N	1|1	.|B	.|0.06786	.|0.001	.|B	.|0.04013	.|0.001	T|T	0.40627|0.40627	-0.9553|-0.9553	5|10	.|0.02654	.|T	.|1	-5.9687|-5.9687	4.8314|4.8314	0.13441|0.13441	0.0:0.3216:0.3683:0.3101|0.0:0.3216:0.3683:0.3101	.|.	.|66	.|Q5SQS8	.|CJ120_HUMAN	N|K	59|66	.|ENSP00000331012:R66K	.|ENSP00000331012:R66K	D|R	-|-	1|2	0|0	C10orf120|C10orf120	124448898|124448898	0.003000|0.003000	0.15002|0.15002	0.038000|0.038000	0.18304|0.18304	0.015000|0.015000	0.08874|0.08874	-0.062000|-0.062000	0.11674|0.11674	-0.151000|-0.151000	0.11176|0.11176	-0.219000|-0.219000	0.12488|0.12488	GAT|AGA	.		0.488	C10orf120-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050803.1	NM_001010912	
MUC6	4588	bcgsc.ca	37	11	1016835	1016835	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr11:1016835A>G	ENST00000421673.2	-	31	6016	c.5966T>C	c.(5965-5967)tTc>tCc	p.F1989S		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1989	Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)	p.F1989Y(2)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGTGGTCTGGAAGGATGTTGC	0.567																																					p.F1989S		.											.	MUC6-23	2	Substitution - Missense(2)	lung(2)	c.T5966C						.						1541.0	1526.0	1531.0					11																	1016835		2203	4299	6502	SO:0001583	missense	4588	exon31			GTCTGGAAGGATG	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5966T>C	11.37:g.1016835A>G	ENSP00000406861:p.Phe1989Ser	Somatic	2745	54		WXS	Illumina GAIIx	Phase_I	1490	59	NM_005961	0	0	0	0	0	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	A	12.65	2.002866	0.35320	.	.	ENSG00000184956	ENST00000421673	T	0.18657	2.2	3.08	-0.788	0.10939	.	.	.	.	.	T	0.12390	0.0301	L	0.38531	1.155	0.09310	N	1	B	0.15930	0.015	B	0.14578	0.011	T	0.41106	-0.9527	9	0.07644	T	0.81	.	6.7728	0.23602	0.4725:0.0:0.5275:0.0	.	1989	Q6W4X9	MUC6_HUMAN	S	1989	ENSP00000406861:F1989S	ENSP00000406861:F1989S	F	-	2	0	MUC6	1006835	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-0.386000	0.07370	-0.019000	0.14055	0.254000	0.18369	TTC	.		0.567	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
TRIM5	85363	broad.mit.edu	37	11	5701024	5701024	+	Silent	SNP	C	C	T	rs148054117	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr11:5701024C>T	ENST00000380034.3	-	2	640	c.384G>A	c.(382-384)acG>acA	p.T128T	TRIM5_ENST00000483835.1_5'UTR|TRIM5_ENST00000305836.5_Silent_p.T128T|TRIM5_ENST00000396855.3_Silent_p.T128T|TRIM5_ENST00000380027.1_Silent_p.T128T|TRIM5_ENST00000396847.3_Silent_p.T128T|TRIM5_ENST00000396853.4_Silent_p.T128T	NM_033034.2|NM_033092.2	NP_149023.2|NP_149083.2	Q9C035	TRIM5_HUMAN	tripartite motif containing 5	128					activation of innate immune response (GO:0002218)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein K63-linked ubiquitination (GO:0070534)|protein trimerization (GO:0070206)|regulation of lipopolysaccharide-mediated signaling pathway (GO:0031664)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|signaling pattern recognition receptor activity (GO:0008329)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	21		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)|Lung NSC(207;0.138)|all_lung(207;0.221)		Epithelial(150;7.21e-09)|BRCA - Breast invasive adenocarcinoma(625;0.139)		CTGTGAGGAACGTGTGGTGAC	0.532																																					p.T128T		.											.	TRIM5-227	0			c.G384A						.	C	,,	1,4401	4.2+/-10.8	0,1,2200	132.0	115.0	121.0		384,384,384	-8.1	0.0	11	dbSNP_134	121	0,8594		0,0,4297	no	coding-synonymous,coding-synonymous,coding-synonymous	TRIM5	NM_033034.2,NM_033092.2,NM_033093.2	,,	0,1,6497	TT,TC,CC		0.0,0.0227,0.0077	,,	128/494,128/348,128/327	5701024	1,12995	2201	4297	6498	SO:0001819	synonymous_variant	85363	exon2			GAGGAACGTGTGG	AF220025	CCDS31392.1, CCDS31393.1, CCDS31394.1	11p15	2014-06-03	2011-01-25		ENSG00000132256	ENSG00000132256		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16276	protein-coding gene	gene with protein product	"""tripartite motif protein TRIM5"", ""tripartite motif protein TRIM"""	608487	"""tripartite motif-containing 5"""			11331580	Standard	NM_033034		Approved	RNF88, TRIM5alpha	uc001mbm.2	Q9C035	OTTHUMG00000066893	ENST00000380034.3:c.384G>A	11.37:g.5701024C>T		Somatic	169	0		WXS	Illumina GAIIx	Phase_I	126	5	NM_033093	0	0	8	10	2	A6NGQ1|A8WFA8|D3DQS8|D3DQS9|G3GJY1|Q2MLV4|Q2MLV8|Q2MLV9|Q2MLW1|Q2MLW3|Q2MLW4|Q2MLW6|Q2MLW7|Q2MLX1|Q2MLX2|Q2MLX3|Q2MLX5|Q2MLY3|Q2MLY4|Q2V6Q6|Q6GX26|Q8WU46|Q96SR5|Q9C031|Q9C032|Q9C033|Q9C034	Silent	SNP	ENST00000380034.3	37	CCDS31393.1	.	.	.	.	.	.	.	.	.	.	C	0.017	-1.503660	0.00992	2.27E-4	0.0	ENSG00000132256	ENST00000438025	.	.	.	4.07	-8.15	0.01065	.	.	.	.	.	T	0.16727	0.0402	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.04737	-1.0930	4	.	.	.	.	2.4418	0.04496	0.2479:0.3834:0.1652:0.2036	.	.	.	.	H	5	.	.	R	-	2	0	TRIM5	5657600	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-4.877000	0.00175	-4.271000	0.00060	-4.755000	0.00003	CGT	C|1.000;T|0.000		0.532	TRIM5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000143360.3	NM_033034	
NRIP3	56675	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	9009807	9009807	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr11:9009807C>T	ENST00000309166.3	-	2	310	c.197G>A	c.(196-198)aGg>aAg	p.R66K	NRIP3_ENST00000531090.1_Missense_Mutation_p.R66K	NM_020645.2	NP_065696.1	Q9NQ35	NRIP3_HUMAN	nuclear receptor interacting protein 3	66							aspartic-type endopeptidase activity (GO:0004190)			large_intestine(1)|lung(4)|skin(1)|stomach(1)	7				Epithelial(150;4.77e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0241)		CATGAGGCGCCTCTGCAGAAT	0.512																																					p.R66K		.											.	NRIP3-186	0			c.G197A						.						87.0	84.0	85.0					11																	9009807		2201	4296	6497	SO:0001583	missense	56675	exon2			AGGCGCCTCTGCA	AJ400877	CCDS31422.1	11p15.3	2008-02-05	2003-09-03	2003-09-05	ENSG00000175352	ENSG00000175352			1167	protein-coding gene	gene with protein product		613125	"""chromosome 11 open reading frame 14"""	C11orf14		11528127	Standard	NM_020645		Approved		uc001mhg.2	Q9NQ35	OTTHUMG00000165680	ENST00000309166.3:c.197G>A	11.37:g.9009807C>T	ENSP00000310205:p.Arg66Lys	Somatic	127	0		WXS	Illumina GAIIx	Phase_I	99	88	NM_020645	0	0	0	1	1	Q86WD9	Missense_Mutation	SNP	ENST00000309166.3	37	CCDS31422.1	.	.	.	.	.	.	.	.	.	.	C	17.85	3.490471	0.64074	.	.	ENSG00000175352	ENST00000309166;ENST00000531090;ENST00000525100	T	0.52295	0.67	5.94	5.01	0.66863	.	0.048179	0.85682	D	0.000000	T	0.42449	0.1203	M	0.65498	2.005	0.34632	D	0.719693	B	0.12013	0.005	B	0.14023	0.01	T	0.49457	-0.8938	10	0.15499	T	0.54	-21.7151	9.347	0.38115	0.1468:0.7781:0.0:0.0751	.	66	Q9NQ35	NRIP3_HUMAN	K	66;66;59	ENSP00000310205:R66K	ENSP00000310205:R66K	R	-	2	0	NRIP3	8966383	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.561000	0.45905	1.475000	0.48197	0.655000	0.94253	AGG	.		0.512	NRIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385774.1	NM_020645	
MICAL2	9645	bcgsc.ca	37	11	12265542	12265542	+	Silent	SNP	A	A	G	rs2270511	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr11:12265542A>G	ENST00000256194.4	+	21	2955	c.2667A>G	c.(2665-2667)ctA>ctG	p.L889L	MICAL2_ENST00000379612.3_Intron|MICAL2_ENST00000527546.1_Intron|MICAL2_ENST00000537344.1_Intron|MICAL2_ENST00000342902.5_Silent_p.L889L	NM_001282663.1|NM_014632.2	NP_001269592.1|NP_055447.1	O94851	MICA2_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 2	889					actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|heart development (GO:0007507)|heart looping (GO:0001947)|oxidation-reduction process (GO:0055114)|positive regulation of transcription via serum response element binding (GO:0010735)|sulfur oxidation (GO:0019417)	nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|NADPH:sulfur oxidoreductase activity (GO:0043914)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	47				Epithelial(150;0.00552)		AGAATAAACTACTCTCTAAAG	0.483													A|||	1047	0.209065	0.1551	0.2651	5008	,	,		20969	0.2103		0.168	False		,,,				2504	0.2832				p.L889L		.											.	MICAL2-92	0			c.A2667G						.	A		794,3608	317.7+/-295.3	73,648,1480	316.0	275.0	289.0		2667	-10.5	0.4	11	dbSNP_100	289	1318,7270	259.5+/-282.7	98,1122,3074	no	coding-synonymous	MICAL2	NM_014632.2		171,1770,4554	GG,GA,AA		15.347,18.0373,16.2587		889/1125	12265542	2112,10878	2201	4294	6495	SO:0001819	synonymous_variant	9645	exon21			TAAACTACTCTCT	AB018293	CCDS7809.1, CCDS60726.1, CCDS60727.1, CCDS60728.1	11p15.3	2014-08-12	2013-03-26		ENSG00000133816	ENSG00000133816			24693	protein-coding gene	gene with protein product		608881				12110185	Standard	XM_005253249		Approved	KIAA0750	uc001mjz.3	O94851	OTTHUMG00000165744	ENST00000256194.4:c.2667A>G	11.37:g.12265542A>G		Somatic	136	0		WXS	Illumina GAIIx	Phase_I	114	5	NM_014632	0	0	0	0	0	B4DGZ0|B7Z849|D3DQW5|G3XAC8|Q5KTR3|Q5KTR4|Q7Z3A8	Silent	SNP	ENST00000256194.4	37	CCDS7809.1																																																																																			A|0.826;G|0.174		0.483	MICAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385993.1	NM_014632	
PLEKHA7	144100	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	16838355	16838355	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr11:16838355C>T	ENST00000355661.3	-	11	1868	c.1858G>A	c.(1858-1860)Gct>Act	p.A620T	PLEKHA7_ENST00000532079.1_Intron|PLEKHA7_ENST00000531066.1_Missense_Mutation_p.A620T|PLEKHA7_ENST00000448080.2_Missense_Mutation_p.A620T			Q6IQ23	PKHA7_HUMAN	pleckstrin homology domain containing, family A member 7	620	Interaction with CTNND1.				epithelial cell-cell adhesion (GO:0090136)|zonula adherens maintenance (GO:0045218)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|zonula adherens (GO:0005915)	delta-catenin binding (GO:0070097)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(13)|ovary(1)|prostate(2)|skin(7)|urinary_tract(1)	37						ACCTTGACAGCGTGGCCCCGT	0.592																																					p.A620T		.											.	PLEKHA7-227	0			c.G1858A						.						51.0	48.0	49.0					11																	16838355		2195	4286	6481	SO:0001583	missense	144100	exon11			TGACAGCGTGGCC	BC033239	CCDS31434.1	11p15	2013-01-10			ENSG00000166689	ENSG00000166689		"""Pleckstrin homology (PH) domain containing"""	27049	protein-coding gene	gene with protein product		612686				12477932	Standard	NM_175058		Approved	DKFZp686M22243	uc001mmo.3	Q6IQ23	OTTHUMG00000165954	ENST00000355661.3:c.1858G>A	11.37:g.16838355C>T	ENSP00000347883:p.Ala620Thr	Somatic	139	0		WXS	Illumina GAIIx	Phase_I	70	63	NM_175058	0	0	0	0	0	B4DK33|B4DWC3|Q86VZ7	Missense_Mutation	SNP	ENST00000355661.3	37	CCDS31434.1	.	.	.	.	.	.	.	.	.	.	C	0.273	-0.991565	0.02162	.	.	ENSG00000166689	ENST00000531066;ENST00000355661;ENST00000448080	T;T;T	0.31769	1.48;1.48;1.48	4.95	-6.78	0.01721	.	1.042540	0.07464	N	0.901074	T	0.16557	0.0398	L	0.31294	0.92	0.09310	N	1	B;B;B;B	0.11235	0.002;0.002;0.004;0.004	B;B;B;B	0.09377	0.001;0.002;0.001;0.004	T	0.41142	-0.9525	10	0.08381	T	0.77	-0.0017	10.2044	0.43105	0.0:0.3361:0.0928:0.5711	.	194;620;620;620	Q6IQ23-3;E9PKC0;Q6IQ23;Q6IQ23-2	.;.;PKHA7_HUMAN;.	T	620	ENSP00000435389:A620T;ENSP00000347883:A620T;ENSP00000416895:A620T	ENSP00000347883:A620T	A	-	1	0	PLEKHA7	16794931	0.000000	0.05858	0.000000	0.03702	0.532000	0.34746	-1.430000	0.02434	-1.280000	0.02402	0.563000	0.77884	GCT	.		0.592	PLEKHA7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000387242.2	NM_175058	
MRGPRX4	117196	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	18195449	18195449	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr11:18195449G>A	ENST00000314254.3	+	1	1066	c.646G>A	c.(646-648)Gtg>Atg	p.V216M	RP11-113D6.6_ENST00000527671.1_Intron	NM_054032.3	NP_473373.2	Q96LA9	MRGX4_HUMAN	MAS-related GPR, member X4	216						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(18)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32						CAGGCTGTACGTGACCATCCT	0.547																																					p.V216M		.											.	MRGPRX4-91	0			c.G646A						.						113.0	103.0	106.0					11																	18195449		2199	4293	6492	SO:0001583	missense	117196	exon1			CTGTACGTGACCA	AY042216	CCDS7831.1	11p15.1	2013-10-10			ENSG00000179817	ENSG00000179817		"""GPCR / Class A : Orphans"""	17617	protein-coding gene	gene with protein product		607230				11551509	Standard	NM_054032		Approved	MRGX4	uc001mnv.1	Q96LA9	OTTHUMG00000166442	ENST00000314254.3:c.646G>A	11.37:g.18195449G>A	ENSP00000314042:p.Val216Met	Somatic	89	1		WXS	Illumina GAIIx	Phase_I	68	63	NM_054032	0	0	0	0	0	Q3KNU3|Q3KNU4|Q502W0|Q8TDD6|Q8TDD7	Missense_Mutation	SNP	ENST00000314254.3	37	CCDS7831.1	.	.	.	.	.	.	.	.	.	.	G	12.23	1.875523	0.33162	.	.	ENSG00000179817	ENST00000314254	T	0.38077	1.16	2.85	-2.8	0.05823	GPCR, rhodopsin-like superfamily (1);	1.247870	0.05482	N	0.554946	T	0.61350	0.2340	M	0.89840	3.065	0.09310	N	1	D	0.71674	0.998	D	0.64410	0.925	T	0.57323	-0.7831	10	0.66056	D	0.02	.	8.1354	0.31052	0.0:0.4517:0.3952:0.1531	.	216	Q96LA9	MRGX4_HUMAN	M	216	ENSP00000314042:V216M	ENSP00000314042:V216M	V	+	1	0	MRGPRX4	18152025	0.000000	0.05858	0.004000	0.12327	0.107000	0.19398	-0.481000	0.06552	-0.249000	0.09569	-1.151000	0.01829	GTG	.		0.547	MRGPRX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389788.1	NM_054032	
KIAA1549L	25758	bcgsc.ca	37	11	33564163	33564163	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr11:33564163T>C	ENST00000321505.4	+	1	343	c.163T>C	c.(163-165)Tcc>Ccc	p.S55P	KIAA1549L_ENST00000389726.3_Missense_Mutation_p.S55P|KIAA1549L_ENST00000265654.5_Missense_Mutation_p.S55P			Q6ZVL6	K154L_HUMAN	KIAA1549-like	55						integral component of membrane (GO:0016021)											GGCAGAACTGTCCCATCCGTC	0.552																																					p.S55P		.											.	.	0			c.T163C						.						98.0	99.0	99.0					11																	33564163		1939	4140	6079	SO:0001583	missense	25758	exon1			GAACTGTCCCATC	U10991	CCDS44565.1, CCDS44565.2	11p13	2012-08-09	2012-08-09	2012-08-09	ENSG00000110427	ENSG00000110427			24836	protein-coding gene	gene with protein product		612297	"""chromosome 11 open reading frame 69"", ""chromosome 11 open reading frame 41"""	C11orf69, C11orf41			Standard	NM_012194		Approved	G2, MGC34830	uc021qfs.1	Q6ZVL6	OTTHUMG00000150410	ENST00000321505.4:c.163T>C	11.37:g.33564163T>C	ENSP00000315295:p.Ser55Pro	Somatic	107	0		WXS	Illumina GAIIx	Phase_I	91	5	NM_012194	0	0	0	0	0	B0QYU0	Missense_Mutation	SNP	ENST00000321505.4	37	CCDS44565.2	.	.	.	.	.	.	.	.	.	.	T	1.429	-0.570802	0.03910	.	.	ENSG00000110427	ENST00000321505;ENST00000389726;ENST00000265654	.	.	.	4.62	-2.09	0.07232	.	.	.	.	.	T	0.14960	0.0361	N	0.19112	0.55	0.09310	N	1	B;B	0.09022	0.001;0.002	B;B	0.08055	0.001;0.003	T	0.33266	-0.9875	8	0.02654	T	1	.	3.6366	0.08151	0.093:0.1163:0.2312:0.5596	.	55;55	E9PAT2;Q6ZVL6-2	.;.	P	55	.	ENSP00000265654:S55P	S	+	1	0	C11orf41	33520739	0.000000	0.05858	0.004000	0.12327	0.019000	0.09904	-0.257000	0.08745	0.022000	0.15160	-0.396000	0.06452	TCC	.		0.552	KIAA1549L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317998.1	NM_012194	
FNBP4	23360	hgsc.bcm.edu	37	11	47788731	47788731	+	Missense_Mutation	SNP	G	G	C	rs112054219	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr11:47788731G>C	ENST00000263773.5	-	1	122	c.110C>G	c.(109-111)aCt>aGt	p.T37S	FNBP4_ENST00000534003.1_5'UTR	NM_015308.2	NP_056123.2	Q8N3X1	FNBP4_HUMAN	formin binding protein 4	37						nucleus (GO:0005634)				NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(12)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	44						GTCCGGCTCAGTGTCGGGTTC	0.766													G|||	33	0.00658946	0.0023	0.0043	5008	,	,		11411	0.0		0.0149	False		,,,				2504	0.0123				p.T37S		.											.	FNBP4-91	0			c.C110G						.	G	SER/THR	6,2810		0,6,1402	3.0	4.0	4.0		110	1.8	0.0	11	dbSNP_132	4	103,6601		0,103,3249	no	missense	FNBP4	NM_015308.2	58	0,109,4651	CC,CG,GG		1.5364,0.2131,1.145	benign	37/1018	47788731	109,9411	1408	3352	4760	SO:0001583	missense	23360	exon1			GGCTCAGTGTCGG	BC037404	CCDS41644.1	11q12.1	2008-02-05			ENSG00000109920	ENSG00000109920			19752	protein-coding gene	gene with protein product		615265				10231032	Standard	NM_015308		Approved	KIAA1014	uc009ylv.3	Q8N3X1	OTTHUMG00000166533	ENST00000263773.5:c.110C>G	11.37:g.47788731G>C	ENSP00000263773:p.Thr37Ser	Somatic	4	0		WXS	Illumina GAIIx	Phase_I	9	7	NM_015308	0	0	0	1	1	Q9H985|Q9NT81|Q9Y2L7	Missense_Mutation	SNP	ENST00000263773.5	37	CCDS41644.1	.	.	.	.	.	.	.	.	.	.	G	12.63	1.995333	0.35226	0.002131	0.015364	ENSG00000109920	ENST00000263773	T	0.28069	1.63	4.69	1.84	0.25277	.	1.223540	0.05727	N	0.598842	T	0.09642	0.0237	N	0.24115	0.695	0.09310	N	1	B	0.13594	0.008	B	0.16722	0.016	T	0.25572	-1.0128	10	0.11485	T	0.65	1.2154	5.9545	0.19265	0.18:0.1624:0.6575:0.0	.	37	Q8N3X1	FNBP4_HUMAN	S	37	ENSP00000263773:T37S	ENSP00000263773:T37S	T	-	2	0	FNBP4	47745307	0.012000	0.17670	0.005000	0.12908	0.020000	0.10135	0.414000	0.21164	0.716000	0.32124	-0.127000	0.14921	ACT	.		0.766	FNBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390237.3		
TRIM51	84767	bcgsc.ca	37	11	55656479	55656479	+	Splice_Site	SNP	T	T	G			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr11:55656479T>G	ENST00000449290.2	+	5	853		c.e5+2		TRIM51_ENST00000244891.3_Splice_Site	NM_032681.3	NP_116070.2	Q9BSJ1	TRI51_HUMAN	tripartite motif-containing 51							intracellular (GO:0005622)	zinc ion binding (GO:0008270)										ATTACACAGGTGAGTGCACAC	0.368																																					.		.											.	.	0			c.761+2T>G						.						56.0	59.0	58.0					11																	55656479		2201	4296	6497	SO:0001630	splice_region_variant	84767	exon5			CACAGGTGAGTGC	BC005014		11p11	2013-01-09	2012-05-18	2012-05-18	ENSG00000124900	ENSG00000124900		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19023	protein-coding gene	gene with protein product			"""SPRY domain containing 5"""	SPRYD5			Standard	NM_032681		Approved	TRIM51A	uc010rip.2	Q9BSJ1	OTTHUMG00000156437	ENST00000449290.2:c.761+2T>G	11.37:g.55656479T>G		Somatic	145	5		WXS	Illumina GAIIx	Phase_I	137	17	NM_032681	0	0	0	0	0	A6NMG2	Splice_Site	SNP	ENST00000449290.2	37		.	.	.	.	.	.	.	.	.	.	.	2.979	-0.210641	0.06140	.	.	ENSG00000124900	ENST00000449290;ENST00000244891	.	.	.	0.698	0.698	0.18087	.	.	.	.	.	.	.	.	.	.	.	0.20196	N	0.999924	.	.	.	.	.	.	.	.	.	.	.	.	.	.	3.7712	0.08642	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	SPRYD5	55413055	0.046000	0.20272	0.006000	0.13384	0.013000	0.08279	0.189000	0.17037	0.595000	0.29777	0.307000	0.20424	.	.		0.368	TRIM51-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000391522.1	NM_032681	Intron
SMTNL1	219537	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	57313434	57313434	+	Missense_Mutation	SNP	G	G	A	rs531246829		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr11:57313434G>A	ENST00000399154.2	+	5	887	c.887G>A	c.(886-888)cGc>cAc	p.R296H	SMTNL1_ENST00000457912.1_Missense_Mutation_p.R351H|SMTNL1_ENST00000527972.1_Missense_Mutation_p.R333H			A8MU46	SMTL1_HUMAN	smoothelin-like 1	296					negative regulation of vasodilation (GO:0045908)|positive regulation of vasoconstriction (GO:0045907)	contractile fiber (GO:0043292)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(2)|large_intestine(1)|lung(4)|ovary(1)	8						GCACCAGAGCGCAGGGTATCA	0.642													G|||	1	0.000199681	0.0	0.0	5008	,	,		12694	0.0		0.001	False		,,,				2504	0.0				p.R333H		.											.	SMTNL1-23	0			c.G998A						.						32.0	36.0	35.0					11																	57313434		1885	4105	5990	SO:0001583	missense	219537	exon4			CAGAGCGCAGGGT	BX116227		11q12.1	2006-02-02				ENSG00000214872			32394	protein-coding gene	gene with protein product	"""calponin homology-associated smooth muscle protein"""	613664				15327999	Standard	NM_001105565		Approved	CHASM	uc021qjh.1	A8MU46		ENST00000399154.2:c.887G>A	11.37:g.57313434G>A	ENSP00000382108:p.Arg296His	Somatic	173	1		WXS	Illumina GAIIx	Phase_I	128	58	NM_001105565	0	0	0	0	0		Missense_Mutation	SNP	ENST00000399154.2	37		.	.	.	.	.	.	.	.	.	.	G	14.77	2.633521	0.47049	.	.	ENSG00000214872	ENST00000457912;ENST00000527972;ENST00000399154	T;T;T	0.04049	3.72;3.72;3.72	4.98	3.02	0.34903	.	0.299613	0.18371	U	0.143269	T	0.03477	0.0100	L	0.34521	1.04	0.28527	N	0.912774	P	0.51240	0.943	B	0.35727	0.209	T	0.34229	-0.9837	10	0.72032	D	0.01	-9.8848	8.1617	0.31202	0.0905:0.1629:0.7466:0.0	.	351	C9J621	.	H	351;333;296	ENSP00000406485:R351H;ENSP00000432651:R333H;ENSP00000382108:R296H	ENSP00000382108:R296H	R	+	2	0	SMTNL1	57070010	0.876000	0.30132	1.000000	0.80357	0.966000	0.64601	0.253000	0.18296	2.591000	0.87537	0.655000	0.94253	CGC	.		0.642	SMTNL1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		XM_166203	
C11orf95	65998	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	63531283	63531283	+	lincRNA	SNP	G	G	A	rs370217341	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr11:63531283G>A	ENST00000433688.1	-	0	1662							C9JLR9	CK095_HUMAN	chromosome 11 open reading frame 95																		CGTCCTCTTCGTCCTCCTCTT	0.736													G|||	2	0.000399361	0.0	0.0014	5008	,	,		7717	0.0		0.001	False		,,,				2504	0.0				p.D548D		.											.	.	0			c.C1644T						.																																					65998	exon5			CTCTTCGTCCTCC	BC000572, AK096306		11q13	2011-11-24			ENSG00000188070	ENSG00000188070			28449	protein-coding gene	gene with protein product		615699				20607705	Standard	NM_001144936		Approved	MGC3032	uc010rmv.2	C9JLR9			11.37:g.63531283G>A		Somatic	42	0		WXS	Illumina GAIIx	Phase_I	11	10	NM_001144936	0	0	0	13	13	A6NLS7|Q3C1V4	Silent	SNP	ENST00000433688.1	37																																																																																				.		0.736	C11orf95-201	KNOWN	basic	lincRNA	lincRNA		NM_001144936	
RCOR2	283248	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	63679516	63679516	+	Nonsense_Mutation	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr11:63679516G>A	ENST00000301459.4	-	12	1780	c.1393C>T	c.(1393-1395)Cga>Tga	p.R465*	RCOR2_ENST00000473926.2_5'UTR	NM_173587.3	NP_775858.2	Q8IZ40	RCOR2_HUMAN	REST corepressor 2	465	Pro-rich.				negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			kidney(2)|large_intestine(3)|liver(1)|lung(5)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	17						GGTGGCTGTCGGAGCAGAGTG	0.741																																					p.R465X		.											.	RCOR2-92	0			c.C1393T						.						4.0	5.0	4.0					11																	63679516		1674	3342	5016	SO:0001587	stop_gained	283248	exon12			GCTGTCGGAGCAG	BC010608	CCDS8052.1	11q13.1	2008-02-05			ENSG00000167771	ENSG00000167771			27455	protein-coding gene	gene with protein product						12477932	Standard	NM_173587		Approved		uc001nyc.3	Q8IZ40	OTTHUMG00000150472	ENST00000301459.4:c.1393C>T	11.37:g.63679516G>A	ENSP00000301459:p.Arg465*	Somatic	18	0		WXS	Illumina GAIIx	Phase_I	10	10	NM_173587	0	0	0	3	3	Q96FP3	Nonsense_Mutation	SNP	ENST00000301459.4	37	CCDS8052.1	.	.	.	.	.	.	.	.	.	.	G	41	8.679022	0.98912	.	.	ENSG00000167771	ENST00000301459	.	.	.	4.69	3.76	0.43208	.	0.068043	0.56097	D	0.000031	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.4058	0.60913	0.0:0.0:0.841:0.1589	.	.	.	.	X	465	.	ENSP00000301459:R465X	R	-	1	2	RCOR2	63436092	0.999000	0.42202	0.911000	0.35937	0.974000	0.67602	3.530000	0.53539	1.317000	0.45149	0.499000	0.49734	CGA	.		0.741	RCOR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318233.1	NM_173587	
RPS6KA4	8986	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	64127716	64127716	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr11:64127716C>T	ENST00000334205.4	+	3	274	c.209C>T	c.(208-210)gCg>gTg	p.A70V	RPS6KA4_ENST00000528057.1_Missense_Mutation_p.A70V|RPS6KA4_ENST00000294261.4_Missense_Mutation_p.A70V	NM_003942.2	NP_003933.1	O75676	KS6A4_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 4	70	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|histone H3-S10 phosphorylation (GO:0043987)|histone H3-S28 phosphorylation (GO:0043988)|histone phosphorylation (GO:0016572)|inflammatory response (GO:0006954)|interleukin-1-mediated signaling pathway (GO:0070498)|intracellular signal transduction (GO:0035556)|negative regulation of cytokine production (GO:0001818)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone phosphorylation (GO:0033129)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|mitogen-activated protein kinase p38 binding (GO:0048273)|protein serine/threonine kinase activity (GO:0004674)|ribosomal protein S6 kinase activity (GO:0004711)			breast(1)|endometrium(3)|lung(7)|ovary(1)|prostate(1)	13						CTGCGCAAGGCGGCGCTGGTG	0.697																																					p.A70V		.											.	RPS6KA4-1036	0			c.C209T						.						10.0	9.0	10.0					11																	64127716		2010	3970	5980	SO:0001583	missense	8986	exon3			GCAAGGCGGCGCT	AJ010119	CCDS8073.1, CCDS73313.1	11q11-q13	2011-04-05	2002-08-29		ENSG00000162302	ENSG00000162302			10433	protein-coding gene	gene with protein product		603606	"""ribosomal protein S6 kinase, 90kD, polypeptide 4"""			9792677, 9687510	Standard	XM_005274379		Approved	RSK-B, MSK2	uc001oae.3	O75676	OTTHUMG00000046094	ENST00000334205.4:c.209C>T	11.37:g.64127716C>T	ENSP00000333896:p.Ala70Val	Somatic	32	0		WXS	Illumina GAIIx	Phase_I	48	40	NM_001006944	0	0	0	8	8	A8K7Z8|O75585|Q53ES8	Missense_Mutation	SNP	ENST00000334205.4	37	CCDS8073.1	.	.	.	.	.	.	.	.	.	.	c	14.18	2.459640	0.43736	.	.	ENSG00000162302	ENST00000528057;ENST00000334205;ENST00000294261;ENST00000530504	T;T;T;T	0.64991	-0.13;-0.13;-0.13;-0.13	4.08	3.06	0.35304	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.148717	0.42548	D	0.000686	T	0.67896	0.2942	L	0.51914	1.62	0.39286	D	0.964659	D;D;D;D	0.89917	0.988;0.999;1.0;1.0	B;P;D;D	0.69307	0.402;0.708;0.963;0.953	T	0.70714	-0.4796	10	0.87932	D	0	.	6.4245	0.21762	0.2044:0.597:0.1986:0.0	.	70;70;70;70	G3XAA9;E9PJN1;O75676;O75676-2	.;.;KS6A4_HUMAN;.	V	70;70;70;54	ENSP00000435580:A70V;ENSP00000333896:A70V;ENSP00000294261:A70V;ENSP00000432945:A54V	ENSP00000294261:A70V	A	+	2	0	RPS6KA4	63884292	1.000000	0.71417	0.993000	0.49108	0.111000	0.19643	4.440000	0.59975	2.228000	0.72767	0.563000	0.77884	GCG	.		0.697	RPS6KA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106246.2	NM_003942	
MIR192	406967	broad.mit.edu	37	11	64658676	64658676	+	lincRNA	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr11:64658676G>A	ENST00000601517.1	-	0	0				MIR192_ENST00000384915.1_RNA|MIR194-2_ENST00000384864.1_lincRNA																							GAGAGCACTGGCTGTCAATTC	0.637																																					.		.											.	.	0			.						.						19.0	21.0	20.0					11																	64658676		1548	3541	5089			406967	.			GCACTGGCTGTCA																													11.37:g.64658676G>A		Somatic	78	0		WXS	Illumina GAIIx	Phase_I	50	5	.	0	0	0	0	0		RNA	SNP	ENST00000601517.1	37																																																																																				.		0.637	RP11-665N17.4-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000464673.1		
GAL3ST3	89792	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	65810719	65810719	+	Silent	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr11:65810719G>A	ENST00000312006.4	-	3	836	c.555C>T	c.(553-555)cgC>cgT	p.R185R	GAL3ST3_ENST00000527878.1_Silent_p.R185R	NM_033036.2	NP_149025.1	Q96A11	G3ST3_HUMAN	galactose-3-O-sulfotransferase 3	185					monosaccharide metabolic process (GO:0005996)|oligosaccharide metabolic process (GO:0009311)|poly-N-acetyllactosamine metabolic process (GO:0030309)|proteoglycan biosynthetic process (GO:0030166)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|carbohydrate binding (GO:0030246)|galactose 3-O-sulfotransferase activity (GO:0050694)|galactosylceramide sulfotransferase activity (GO:0001733)|proteoglycan sulfotransferase activity (GO:0050698)			kidney(1)|lung(9)|ovary(2)|skin(2)	14						CCTCGGGCGCGCGCAGGAAGG	0.682																																					p.R185R		.											.	GAL3ST3-91	0			c.C555T						.						34.0	37.0	36.0					11																	65810719		2201	4293	6494	SO:0001819	synonymous_variant	89792	exon3			GGGCGCGCGCAGG	AY026481	CCDS8128.1	11q13.1	2014-08-12			ENSG00000175229	ENSG00000175229		"""Sulfotransferases, membrane-bound"""	24144	protein-coding gene	gene with protein product		608234				11323440, 11356829	Standard	NM_033036		Approved	GAL3ST2	uc001ogw.3	Q96A11	OTTHUMG00000166667	ENST00000312006.4:c.555C>T	11.37:g.65810719G>A		Somatic	42	0		WXS	Illumina GAIIx	Phase_I	108	57	NM_033036	0	0	0	0	0	Q14D05	Silent	SNP	ENST00000312006.4	37	CCDS8128.1																																																																																			.		0.682	GAL3ST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391052.1	NM_033036	
SPTBN2	6712	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	66483354	66483354	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr11:66483354G>A	ENST00000533211.1	-	4	587	c.256C>T	c.(256-258)Cgg>Tgg	p.R86W	SPTBN2_ENST00000529997.1_Missense_Mutation_p.R86W|SPTBN2_ENST00000309996.2_Missense_Mutation_p.R86W|RN7SL12P_ENST00000473849.2_RNA			O15020	SPTN2_HUMAN	spectrin, beta, non-erythrocytic 2	86	Actin-binding.|CH 1. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin filament capping (GO:0051693)|adult behavior (GO:0030534)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|cell death (GO:0008219)|cerebellar Purkinje cell layer morphogenesis (GO:0021692)|multicellular organism growth (GO:0035264)|synapse assembly (GO:0007416)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|spectrin (GO:0008091)	actin binding (GO:0003779)|phospholipid binding (GO:0005543)|structural constituent of cytoskeleton (GO:0005200)			autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(15)|liver(1)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	74						CGTCCGTCCCGGAGGTCGCTG	0.597																																					p.R86W		.											.	SPTBN2-155	0			c.C256T						.						79.0	64.0	69.0					11																	66483354		2200	4295	6495	SO:0001583	missense	6712	exon3			CGTCCCGGAGGTC	AB008567, AF026487, AF026488, AF079569	CCDS8150.1	11q13.2	2013-01-10			ENSG00000173898	ENSG00000173898		"""Pleckstrin homology (PH) domain containing"""	11276	protein-coding gene	gene with protein product		604985	"""spinocerebellar ataxia 5"""	SCA5		9826670, 16429157	Standard	NM_006946		Approved		uc001ojd.3	O15020	OTTHUMG00000167262	ENST00000533211.1:c.256C>T	11.37:g.66483354G>A	ENSP00000432568:p.Arg86Trp	Somatic	152	0		WXS	Illumina GAIIx	Phase_I	114	54	NM_006946	0	0	0	3	3	O14872|O14873	Missense_Mutation	SNP	ENST00000533211.1	37	CCDS8150.1	.	.	.	.	.	.	.	.	.	.	G	33	5.202037	0.94997	.	.	ENSG00000173898	ENST00000533211;ENST00000309996;ENST00000529997;ENST00000443262;ENST00000527010	T;T;T;T	0.62232	0.04;0.04;0.04;0.04	5.04	5.04	0.67666	Calponin homology domain (5);	0.000000	0.85682	D	0.000000	D	0.84506	0.5487	M	0.93978	3.48	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.88576	0.3133	10	0.87932	D	0	.	17.3198	0.87232	0.0:0.0:1.0:0.0	.	86	O15020	SPTN2_HUMAN	W	86	ENSP00000432568:R86W;ENSP00000311489:R86W;ENSP00000433593:R86W;ENSP00000433631:R86W	ENSP00000311489:R86W	R	-	1	2	SPTBN2	66239930	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.431000	0.52814	2.611000	0.88343	0.561000	0.74099	CGG	.		0.597	SPTBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393892.2	NM_006946	
PIWIL4	143689	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	94340769	94340769	+	Silent	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr11:94340769C>T	ENST00000299001.6	+	14	2014	c.1803C>T	c.(1801-1803)tgC>tgT	p.C601C	RP11-867G2.8_ENST00000536540.1_RNA|RP11-867G2.8_ENST00000537874.1_RNA	NM_152431.2	NP_689644.2	Q7Z3Z4	PIWL4_HUMAN	piwi-like RNA-mediated gene silencing 4	601	Piwi. {ECO:0000255|PROSITE- ProRule:PRU00150}.				cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|P granule (GO:0043186)|piP-body (GO:0071547)	piRNA binding (GO:0034584)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(10)|prostate(1)|skin(1)|urinary_tract(2)	30		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				AGATGACTTGCAAGCTCGGAG	0.438																																					p.C601C		.											.	PIWIL4-91	0			c.C1803T						.						75.0	72.0	73.0					11																	94340769		2201	4298	6499	SO:0001819	synonymous_variant	143689	exon14			GACTTGCAAGCTC	AB079366	CCDS31656.1	11q12	2013-02-15	2013-02-15			ENSG00000134627		"""Argonaute/PIWI family"""	18444	protein-coding gene	gene with protein product		610315	"""piwi-like 4 (Drosophila)"""			12906857	Standard	NM_152431		Approved	FLJ36156, HIWI2, Miwi2	uc001pfa.3	Q7Z3Z4		ENST00000299001.6:c.1803C>T	11.37:g.94340769C>T		Somatic	60	1		WXS	Illumina GAIIx	Phase_I	46	41	NM_152431	0	0	0	0	0	B4DEG5|Q68CZ4|Q8N8G9|Q8N9V8|Q8NEH2	Silent	SNP	ENST00000299001.6	37	CCDS31656.1																																																																																			.		0.438	PIWIL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396388.1	NM_152431	
ATM	472	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	108098418	108098418	+	Nonsense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr11:108098418C>T	ENST00000452508.2	+	3	256	c.67C>T	c.(67-69)Cga>Tga	p.R23*	Y_RNA_ENST00000384240.1_RNA|ATM_ENST00000278616.4_Nonsense_Mutation_p.R23*			Q13315	ATM_HUMAN	ATM serine/threonine kinase	23			R -> Q (in a colorectal adenocarcinoma sample; somatic mutation). {ECO:0000269|PubMed:17344846}.		brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	AGCTACAGAACGAAAGGTAGT	0.323			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																											p.R23X		.	yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	.	ATM-3419	0			c.C67T	GRCh37	CM024724	ATM	M		.						128.0	127.0	128.0					11																	108098418		2201	4297	6498	SO:0001587	stop_gained	472	exon2	Familial Cancer Database	AT, Louis-Bar syndrome	ACAGAACGAAAGG	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.67C>T	11.37:g.108098418C>T	ENSP00000388058:p.Arg23*	Somatic	212	0		WXS	Illumina GAIIx	Phase_I	119	110	NM_000051	0	0	0	0	0	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Nonsense_Mutation	SNP	ENST00000452508.2	37	CCDS31669.1	.	.	.	.	.	.	.	.	.	.	C	34	5.306151	0.95629	.	.	ENSG00000149311	ENST00000527805;ENST00000278616;ENST00000527891;ENST00000532931;ENST00000452508	.	.	.	5.29	4.37	0.52481	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.5295	0.61613	0.2822:0.7177:0.0:0.0	.	.	.	.	X	23	.	ENSP00000278616:R23X	R	+	1	2	ATM	107603628	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.397000	0.44477	1.338000	0.45544	0.563000	0.77884	CGA	.		0.323	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389938.1	NM_000051	
SORL1	6653	ucsc.edu;bcgsc.ca	37	11	121458770	121458770	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr11:121458770C>T	ENST00000260197.7	+	28	3985	c.3856C>T	c.(3856-3858)Cgc>Tgc	p.R1286C	SORL1_ENST00000532694.1_Missense_Mutation_p.R132C|SORL1_ENST00000525532.1_Missense_Mutation_p.R230C|SORL1_ENST00000527934.1_5'Flank|SORL1_ENST00000534286.1_Missense_Mutation_p.R196C	NM_003105.5	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor, L(DLR class) A repeats containing	1286	LDL-receptor class A 6. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell death (GO:0008219)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|negative regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902960)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of neurofibrillary tangle assembly (GO:1902997)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron death (GO:1901215)|negative regulation of protein binding (GO:0032091)|negative regulation of protein oligomerization (GO:0032460)|negative regulation of tau-protein kinase activity (GO:1902948)|positive regulation of choline O-acetyltransferase activity (GO:1902771)|positive regulation of early endosome to recycling endosome transport (GO:1902955)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|positive regulation of protein localization to early endosome (GO:1902966)|post-Golgi vesicle-mediated transport (GO:0006892)|protein maturation (GO:0051604)|protein retention in Golgi apparatus (GO:0045053)|protein targeting (GO:0006605)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|receptor-mediated endocytosis (GO:0006898)|regulation of smooth muscle cell migration (GO:0014910)|signal transduction (GO:0007165)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|nuclear envelope lumen (GO:0005641)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)|beta-amyloid binding (GO:0001540)|low-density lipoprotein particle binding (GO:0030169)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(2)|lung(34)|ovary(5)|pancreas(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(2)	91		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)		GTGTAAGAACCGCCAGCAGTG	0.587																																					p.R1286C		.											.	SORL1-228	0			c.C3856T						.						128.0	105.0	113.0					11																	121458770		2203	4299	6502	SO:0001583	missense	6653	exon28			AAGAACCGCCAGC	Y08110	CCDS8436.1	11q23.2-q24.4	2014-06-05	2011-01-25		ENSG00000137642	ENSG00000137642		"""Fibronectin type III domain containing"""	11185	protein-coding gene	gene with protein product	"""LDLR relative with 11 ligand-binding repeats"""	602005	"""chromosome 11 open reading frame 32"", ""sortilin-related receptor, L(DLR class) A repeats-containing"""	C11orf32		9157966, 8940146	Standard	NM_003105		Approved	gp250, LR11, LRP9, SorLA, SorLA-1	uc001pxx.3	Q92673	OTTHUMG00000166057	ENST00000260197.7:c.3856C>T	11.37:g.121458770C>T	ENSP00000260197:p.Arg1286Cys	Somatic	109	2		WXS	Illumina GAIIx	Phase_I	53	19	NM_003105	0	0	2	4	2	B2RNX7|Q92856	Missense_Mutation	SNP	ENST00000260197.7	37	CCDS8436.1	.	.	.	.	.	.	.	.	.	.	C	18.24	3.581092	0.65992	.	.	ENSG00000137642	ENST00000260197;ENST00000525532;ENST00000532694;ENST00000534286	D;D;D;D	0.95821	-3.82;-3.82;-3.82;-3.82	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	D	0.96552	0.8875	M	0.73430	2.235	0.80722	D	1	D	0.76494	0.999	P	0.56042	0.79	D	0.96408	0.9302	10	0.56958	D	0.05	.	14.3277	0.66530	0.1481:0.8519:0.0:0.0	.	1286	Q92673	SORL_HUMAN	C	1286;230;132;196	ENSP00000260197:R1286C;ENSP00000434634:R230C;ENSP00000432131:R132C;ENSP00000436447:R196C	ENSP00000260197:R1286C	R	+	1	0	SORL1	120963980	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.390000	0.59646	2.595000	0.87683	0.655000	0.94253	CGC	.		0.587	SORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387626.2	NM_003105	
CACNA2D4	93589	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	1906598	1906598	+	Silent	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr12:1906598G>A	ENST00000382722.5	-	35	3461	c.3099C>T	c.(3097-3099)tgC>tgT	p.C1033C	CACNA2D4_ENST00000586184.1_Silent_p.C1033C|CACNA2D4_ENST00000585708.1_Silent_p.C969C|CACNA2D4_ENST00000588077.1_Silent_p.C969C|CACNA2D4_ENST00000538027.2_Silent_p.C178C|CACNA2D4_ENST00000587995.1_Silent_p.C1008C|CACNA2D4_ENST00000538450.1_Silent_p.C163C	NM_172364.4	NP_758952.4	Q7Z3S7	CA2D4_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 4	1033					calcium ion transmembrane transport (GO:0070588)|detection of light stimulus involved in visual perception (GO:0050908)	voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			endometrium(3)|kidney(2)|large_intestine(1)|liver(1)|lung(27)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	39	Ovarian(42;0.107)	Myeloproliferative disorder(1001;0.206)	OV - Ovarian serous cystadenocarcinoma(31;0.00113)	Kidney(2;0.0205)|KIRC - Kidney renal clear cell carcinoma(2;0.0451)		GGCAGGGCCCGCACTCCACGA	0.706																																					p.C1033C	Colon(2;101 179 21030 23310 28141)	.											.	CACNA2D4-23	0			c.C3099T						.						21.0	24.0	23.0					12																	1906598		1897	4083	5980	SO:0001819	synonymous_variant	93589	exon35			GGGCCCGCACTCC	AF516695	CCDS44785.1	12p13.33	2003-03-05			ENSG00000151062	ENSG00000151062		"""Calcium channel subunits"""	20202	protein-coding gene	gene with protein product		608171				12181424	Standard	NM_172364		Approved		uc021qsx.1	Q7Z3S7	OTTHUMG00000168111	ENST00000382722.5:c.3099C>T	12.37:g.1906598G>A		Somatic	25	0		WXS	Illumina GAIIx	Phase_I	30	21	NM_172364	0	0	0	0	0	Q7Z3S8|Q86XZ5|Q8IZS9	Silent	SNP	ENST00000382722.5	37	CCDS44785.1																																																																																			.		0.706	CACNA2D4-001	KNOWN	non_canonical_U12|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000398230.2		
NRIP2	83714	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	2937196	2937196	+	Missense_Mutation	SNP	A	A	G	rs200104814		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr12:2937196A>G	ENST00000337508.4	-	4	636	c.596T>C	c.(595-597)cTa>cCa	p.L199P	ITFG2_ENST00000542548.1_Intron	NM_031474.2	NP_113662.1	Q9BQI9	NRIP2_HUMAN	nuclear receptor interacting protein 2	199					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	aspartic-type endopeptidase activity (GO:0004190)			central_nervous_system(1)|endometrium(2)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	12			OV - Ovarian serous cystadenocarcinoma(31;0.000818)			TGAGGCTTTTAGGACCCTTTT	0.592																																					p.L199P		.											.	NRIP2-187	0			c.T596C						.						50.0	54.0	53.0					12																	2937196		2203	4300	6503	SO:0001583	missense	83714	exon4			GCTTTTAGGACCC	AK054740	CCDS8514.1	12p13.33	2008-02-05			ENSG00000053702	ENSG00000053702			23078	protein-coding gene	gene with protein product						11230166	Standard	NM_031474		Approved	DKFZP761G1913	uc001qlc.3	Q9BQI9	OTTHUMG00000130616	ENST00000337508.4:c.596T>C	12.37:g.2937196A>G	ENSP00000337501:p.Leu199Pro	Somatic	38	0		WXS	Illumina GAIIx	Phase_I	38	12	NM_031474	0	0	3	3	0	A2RRE3|B4DV61	Missense_Mutation	SNP	ENST00000337508.4	37	CCDS8514.1	.	.	.	.	.	.	.	.	.	.	A	2.147	-0.395420	0.04899	.	.	ENSG00000053702	ENST00000337508;ENST00000546074;ENST00000542990	T	0.53640	0.61	4.15	2.36	0.29203	Peptidase aspartic (1);Peptidase aspartic, eukaryotic predicted (1);	0.791843	0.10815	N	0.631179	T	0.36082	0.0954	L	0.41027	1.25	0.28377	N	0.919732	B	0.09022	0.002	B	0.12156	0.007	T	0.31833	-0.9929	10	0.48119	T	0.1	-3.516	4.966	0.14091	0.7729:0.0:0.2271:0.0	.	199	Q9BQI9	NRIP2_HUMAN	P	199;188;149	ENSP00000337501:L199P	ENSP00000337501:L199P	L	-	2	0	NRIP2	2807457	0.035000	0.19736	0.101000	0.21167	0.215000	0.24574	0.446000	0.21694	0.329000	0.23460	0.402000	0.26972	CTA	A|0.999;G|0.001		0.592	NRIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253090.4	NM_031474	
CD9	928	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	6342621	6342621	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr12:6342621C>T	ENST00000382518.1	+	5	753	c.317C>T	c.(316-318)gCg>gTg	p.A106V	CD9_ENST00000009180.4_Missense_Mutation_p.A106V|Y_RNA_ENST00000365448.1_RNA|CD9_ENST00000382515.2_Missense_Mutation_p.A37V|CD9_ENST00000481267.1_3'UTR			P21926	CD9_HUMAN	CD9 molecule	106					blood coagulation (GO:0007596)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular component movement (GO:0006928)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|negative regulation of cell proliferation (GO:0008285)|oligodendrocyte development (GO:0014003)|paranodal junction assembly (GO:0030913)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|response to water deprivation (GO:0009414)|single fertilization (GO:0007338)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)|vesicle (GO:0031982)				endometrium(2)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|skin(1)|stomach(1)	8						GAAATAGCTGCGGCCATCTGG	0.542																																					p.A106V		.											.	CD9-91	0			c.C317T						.						127.0	112.0	117.0					12																	6342621		2203	4300	6503	SO:0001583	missense	928	exon4			TAGCTGCGGCCAT	M38690	CCDS8540.1	12p13	2013-02-14	2006-03-28		ENSG00000010278	ENSG00000010278		"""CD molecules"", ""Tetraspanins"""	1709	protein-coding gene	gene with protein product	"""motility related protein-1"""	143030	"""CD9 antigen (p24)"""	MIC3		6198179	Standard	NM_001769		Approved	BA2, P24, TSPAN29, MRP-1	uc001qnq.2	P21926	OTTHUMG00000044400	ENST00000382518.1:c.317C>T	12.37:g.6342621C>T	ENSP00000371958:p.Ala106Val	Somatic	144	0		WXS	Illumina GAIIx	Phase_I	193	98	NM_001769	0	0	136	265	129	D3DUQ9|Q5J7W6|Q96ES4	Missense_Mutation	SNP	ENST00000382518.1	37	CCDS8540.1	.	.	.	.	.	.	.	.	.	.	C	19.26	3.792863	0.70452	.	.	ENSG00000010278	ENST00000382518;ENST00000536586;ENST00000382519;ENST00000425469;ENST00000543424;ENST00000009180;ENST00000382515	T;T;T;T;T	0.79845	-1.31;-1.31;-1.31;-1.31;-1.31	5.87	5.87	0.94306	.	0.043935	0.85682	D	0.000000	D	0.86908	0.6046	M	0.69248	2.105	0.80722	D	1	D;P	0.62365	0.991;0.772	P;P	0.58721	0.844;0.537	D	0.85563	0.1229	10	0.40728	T	0.16	.	17.6998	0.88291	0.0:1.0:0.0:0.0	.	106;106	B4DK09;P21926	.;CD9_HUMAN	V	106;106;129;106;19;106;37	ENSP00000371958:A106V;ENSP00000440985:A106V;ENSP00000371959:A129V;ENSP00000009180:A106V;ENSP00000371955:A37V	ENSP00000009180:A106V	A	+	2	0	CD9	6212882	0.999000	0.42202	0.351000	0.25721	0.059000	0.15707	4.183000	0.58317	2.785000	0.95823	0.655000	0.94253	GCG	.		0.542	CD9-004	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103348.1		
GPR19	2842	broad.mit.edu	37	12	12814274	12814274	+	Frame_Shift_Del	DEL	T	T	-			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr12:12814274delT	ENST00000540510.1	-	2	1301	c.1109delA	c.(1108-1110)aacfs	p.N370fs	GPR19_ENST00000332427.2_Frame_Shift_Del_p.N370fs			P46093	GPR4_HUMAN	G protein-coupled receptor 19	332					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	17		Prostate(47;0.0802)		BRCA - Breast invasive adenocarcinoma(232;0.048)		GCCAACGTAGTTTTTTTTGGC	0.398																																					p.N370fs		.											.	GPR19-91	0			c.1109delA						.						195.0	181.0	186.0					12																	12814274		2203	4300	6503	SO:0001589	frameshift_variant	2842	exon4			ACGTAGTTTTTTT		CCDS8652.1	12p12.3	2014-01-30				ENSG00000183150		"""GPCR / Class A : Orphans"""	4473	protein-coding gene	gene with protein product		602927					Standard	NM_006143		Approved		uc001raq.2	Q15760		ENST00000540510.1:c.1109delA	12.37:g.12814274delT	ENSP00000441832:p.Asn370fs	Somatic	117	0		WXS	Illumina GAIIx	Phase_I	186	6	NM_006143	0	0	0	0	0	A8K3T3|B0M0K1|Q6NWM4	Frame_Shift_Del	DEL	ENST00000540510.1	37	CCDS8652.1																																																																																			.		0.398	GPR19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400662.1	NM_006143	
ABCC9	10060	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	21962829	21962829	+	Silent	SNP	A	A	G			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr12:21962829A>G	ENST00000261201.4	-	35	4271	c.4272T>C	c.(4270-4272)atT>atC	p.I1424I	ABCC9_ENST00000261200.4_Silent_p.I1424I|ABCC9_ENST00000345162.2_Silent_p.I1388I	NM_005691.2	NP_005682.2	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 9	1424	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				defense response to virus (GO:0051607)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	ATP-sensitive potassium channel complex (GO:0008282)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcomere (GO:0030017)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|sulfonylurea receptor activity (GO:0008281)|transporter activity (GO:0005215)			NS(2)|breast(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|lung(56)|ovary(4)|pancreas(1)|prostate(4)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(5)	118					Adenosine triphosphate(DB00171)|Glyburide(DB01016)	TCAGCTGAGCAATTTCTAAGG	0.323																																					p.I1424I		.											.	ABCC9-96	0			c.T4272C						.						98.0	101.0	100.0					12																	21962829		2203	4300	6503	SO:0001819	synonymous_variant	10060	exon35			CTGAGCAATTTCT	AF061323	CCDS8693.1, CCDS8694.1	12p12.1	2014-09-17			ENSG00000069431	ENSG00000069431		"""ATP binding cassette transporters / subfamily C"""	60	protein-coding gene	gene with protein product	"""sulfonylurea receptor 2"""	601439				9457174, 15034580	Standard	NM_020297		Approved	SUR2, CMD1O	uc001rfh.3	O60706	OTTHUMG00000169094	ENST00000261201.4:c.4272T>C	12.37:g.21962829A>G		Somatic	18	0		WXS	Illumina GAIIx	Phase_I	35	14	NM_005691	0	0	1	1	0	O60707	Silent	SNP	ENST00000261201.4	37	CCDS8694.1																																																																																			.		0.323	ABCC9-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402230.1	NM_005691	
ITPR2	3709	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	26493203	26493203	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr12:26493203C>T	ENST00000381340.3	-	56	8332	c.7916G>A	c.(7915-7917)gGc>gAc	p.G2639D	RP11-513G19.1_ENST00000535324.1_RNA	NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	2639					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)		ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	CTCACTGTCGCCTTCATTGCT	0.488																																					p.G2639D		.											.	ITPR2-542	0			c.G7916A						.						67.0	66.0	67.0					12																	26493203		1979	4203	6182	SO:0001583	missense	3709	exon56			CTGTCGCCTTCAT	D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.7916G>A	12.37:g.26493203C>T	ENSP00000370744:p.Gly2639Asp	Somatic	110	0		WXS	Illumina GAIIx	Phase_I	145	56	NM_002223	0	0	10	22	12	O94773	Missense_Mutation	SNP	ENST00000381340.3	37	CCDS41764.1	.	.	.	.	.	.	.	.	.	.	C	17.91	3.503922	0.64410	.	.	ENSG00000123104	ENST00000381340	T	0.39997	1.05	5.58	5.58	0.84498	.	0.191717	0.45126	D	0.000385	T	0.48114	0.1482	L	0.36672	1.1	0.80722	D	1	P	0.46277	0.875	P	0.56823	0.807	T	0.12708	-1.0537	10	0.16896	T	0.51	.	15.4488	0.75257	0.0:0.8619:0.1381:0.0	.	2639	Q14571	ITPR2_HUMAN	D	2639	ENSP00000370744:G2639D	ENSP00000370744:G2639D	G	-	2	0	ITPR2	26384470	0.993000	0.37304	0.638000	0.29380	0.901000	0.52897	3.095000	0.50235	2.793000	0.96121	0.655000	0.94253	GGC	.		0.488	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402732.1	NM_002223	
ITPR2	3709	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	26784944	26784944	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr12:26784944T>C	ENST00000381340.3	-	22	3205	c.2789A>G	c.(2788-2790)cAg>cGg	p.Q930R	ITPR2_ENST00000545902.1_5'Flank|RP11-666F17.1_ENST00000414098.2_RNA	NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	930					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)		ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	GAGTACCATCTGGGTCATCAT	0.547																																					p.Q930R		.											.	ITPR2-542	0			c.A2789G						.						124.0	128.0	126.0					12																	26784944		2069	4212	6281	SO:0001583	missense	3709	exon22			ACCATCTGGGTCA	D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.2789A>G	12.37:g.26784944T>C	ENSP00000370744:p.Gln930Arg	Somatic	139	0		WXS	Illumina GAIIx	Phase_I	141	58	NM_002223	0	0	0	0	0	O94773	Missense_Mutation	SNP	ENST00000381340.3	37	CCDS41764.1	.	.	.	.	.	.	.	.	.	.	T	16.27	3.075253	0.55646	.	.	ENSG00000123104	ENST00000381340	D	0.91351	-2.83	5.07	5.07	0.68467	.	0.185393	0.49916	N	0.000135	D	0.86990	0.6066	L	0.42245	1.32	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.83267	-0.0045	10	0.40728	T	0.16	.	14.9902	0.71381	0.0:0.0:0.0:1.0	.	930	Q14571	ITPR2_HUMAN	R	930	ENSP00000370744:Q930R	ENSP00000370744:Q930R	Q	-	2	0	ITPR2	26676211	1.000000	0.71417	0.999000	0.59377	0.999000	0.98932	7.314000	0.78988	2.139000	0.66308	0.533000	0.62120	CAG	.		0.547	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402732.1	NM_002223	
PLEKHA8P1	51054	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	45567092	45567092	+	RNA	SNP	C	C	T	rs145353585	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr12:45567092C>T	ENST00000256692.5	-	0	1593					NR_037144.1		O95397	PKHA9_HUMAN	pleckstrin homology domain containing, family A member 8 pseudogene 1							cytoplasm (GO:0005737)	glycolipid binding (GO:0051861)|glycolipid transporter activity (GO:0017089)			breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(10)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						ACGGTTAACGCGGCCACAAAA	0.502																																					.		.											.	PLEKHA8P1-226	0			.						.	C		1,4405	2.1+/-5.4	0,1,2202	103.0	97.0	99.0			-0.7	0.0	12	dbSNP_134	99	1,8599	1.2+/-3.3	0,1,4299	no	intergenic				0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154			45567092	2,13004	2203	4300	6503			51054	.			TTAACGCGGCCAC	AF103731		12q12	2010-11-24	2010-11-24	2010-11-24	ENSG00000134297	ENSG00000134297			30222	pseudogene	pseudogene	"""putative glycolipid transfer protein"""		"""pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 9"""	PLEKHA9		12477932	Standard	NR_037144		Approved	FLJ14156	uc001rom.2	O95397			12.37:g.45567092C>T		Somatic	210	0		WXS	Illumina GAIIx	Phase_I	282	116	.	0	0	2	2	0		RNA	SNP	ENST00000256692.5	37																																																																																				C|1.000;T|0.000		0.502	PLEKHA8P1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000404814.1	NR_037144	
KMT2D	8085	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	49420173	49420173	+	Silent	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr12:49420173C>T	ENST00000301067.7	-	48	15575	c.15576G>A	c.(15574-15576)ctG>ctA	p.L5192L		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	5192	FYR N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00875}.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										TCTGGTGAGGCAGCAGCTGTC	0.597																																					p.L5192L		.											.	MLL2-612	0			c.G15576A						.						39.0	41.0	40.0					12																	49420173		2139	4229	6368	SO:0001819	synonymous_variant	8085	exon48			GTGAGGCAGCAGC	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.15576G>A	12.37:g.49420173C>T		Somatic	186	0		WXS	Illumina GAIIx	Phase_I	183	86	NM_003482	0	0	18	30	12	O14687	Silent	SNP	ENST00000301067.7	37	CCDS44873.1																																																																																			.		0.597	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
DHH	50846	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	49483720	49483720	+	Silent	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr12:49483720G>A	ENST00000266991.2	-	3	1419	c.1113C>T	c.(1111-1113)ccC>ccT	p.P371P	RP11-386G11.8_ENST00000553174.1_RNA|RP11-386G11.8_ENST00000548030.1_RNA	NM_021044.2	NP_066382.1	O43323	DHH_HUMAN	desert hedgehog	371					cell-cell signaling (GO:0007267)|Leydig cell differentiation (GO:0033327)|male sex determination (GO:0030238)|myelination (GO:0042552)|regulation of steroid biosynthetic process (GO:0050810)|response to estradiol (GO:0032355)|spermatid development (GO:0007286)	extracellular region (GO:0005576)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|peptidase activity (GO:0008233)|zinc ion binding (GO:0008270)			breast(1)|large_intestine(3)|lung(4)	8						CGGCCCCGCCGGGGAGCAGCG	0.652																																					p.P371P		.											.	DHH-710	0			c.C1113T						.						9.0	11.0	11.0					12																	49483720		2196	4286	6482	SO:0001819	synonymous_variant	50846	exon3			CCCGCCGGGGAGC	AB010994	CCDS8779.1	12q13.1	2010-06-24	2010-06-24			ENSG00000139549			2865	protein-coding gene	gene with protein product		605423	"""desert hedgehog (Drosophila) homolog"""			10773676, 10640830	Standard	NM_021044		Approved	HHG-3, MGC35145	uc001rtf.3	O43323	OTTHUMG00000170408	ENST00000266991.2:c.1113C>T	12.37:g.49483720G>A		Somatic	102	0		WXS	Illumina GAIIx	Phase_I	140	65	NM_021044	0	0	9	16	7	Q15794	Silent	SNP	ENST00000266991.2	37	CCDS8779.1																																																																																			.		0.652	DHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408973.1	NM_021044	
DHH	50846	bcgsc.ca	37	12	49483989	49483989	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr12:49483989C>T	ENST00000266991.2	-	3	1150	c.844G>A	c.(844-846)Gcg>Acg	p.A282T	RP11-386G11.8_ENST00000553174.1_RNA|RP11-386G11.8_ENST00000548030.1_RNA	NM_021044.2	NP_066382.1	O43323	DHH_HUMAN	desert hedgehog	282					cell-cell signaling (GO:0007267)|Leydig cell differentiation (GO:0033327)|male sex determination (GO:0030238)|myelination (GO:0042552)|regulation of steroid biosynthetic process (GO:0050810)|response to estradiol (GO:0032355)|spermatid development (GO:0007286)	extracellular region (GO:0005576)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|peptidase activity (GO:0008233)|zinc ion binding (GO:0008270)			breast(1)|large_intestine(3)|lung(4)	8						TCGCCTGGCGCGGGCGCCGGC	0.731																																					p.A282T		.											.	DHH-710	0			c.G844A						.						4.0	5.0	5.0					12																	49483989		2006	3933	5939	SO:0001583	missense	50846	exon3			CTGGCGCGGGCGC	AB010994	CCDS8779.1	12q13.1	2010-06-24	2010-06-24			ENSG00000139549			2865	protein-coding gene	gene with protein product		605423	"""desert hedgehog (Drosophila) homolog"""			10773676, 10640830	Standard	NM_021044		Approved	HHG-3, MGC35145	uc001rtf.3	O43323	OTTHUMG00000170408	ENST00000266991.2:c.844G>A	12.37:g.49483989C>T	ENSP00000266991:p.Ala282Thr	Somatic	49	2		WXS	Illumina GAIIx	Phase_I	121	67	NM_021044	0	0	3	3	0	Q15794	Missense_Mutation	SNP	ENST00000266991.2	37	CCDS8779.1	.	.	.	.	.	.	.	.	.	.	c	2.031	-0.422429	0.04734	.	.	ENSG00000139549	ENST00000266991	D	0.99264	-5.65	4.77	3.88	0.44766	Hedgehog/intein hint, N-terminal (1);Peptidase C46, hedgehog protein, hint region (1);	0.407810	0.26987	N	0.021493	D	0.96109	0.8732	N	0.20483	0.58	0.09310	N	1	B	0.21225	0.053	B	0.17722	0.019	D	0.89849	0.4008	10	0.15066	T	0.55	-10.0559	8.7076	0.34365	0.154:0.7618:0.0:0.0842	.	282	O43323	DHH_HUMAN	T	282	ENSP00000266991:A282T	ENSP00000266991:A282T	A	-	1	0	DHH	47770256	0.090000	0.21635	0.006000	0.13384	0.336000	0.28762	1.082000	0.30803	0.745000	0.32763	-1.447000	0.01057	GCG	.		0.731	DHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408973.1	NM_021044	
TUBA1C	84790	ucsc.edu	37	12	49666152	49666152	+	Silent	SNP	G	G	A	rs199599214	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr12:49666152G>A	ENST00000301072.6	+	4	767	c.492G>A	c.(490-492)aaG>aaA	p.K164K	TUBA1C_ENST00000541364.1_Silent_p.K234K|RP11-161H23.5_ENST00000550468.2_RNA	NM_032704.3	NP_116093.1	Q9BQE3	TBA1C_HUMAN	tubulin, alpha 1c	164					'de novo' posttranslational protein folding (GO:0051084)|cell division (GO:0051301)|cellular protein metabolic process (GO:0044267)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasmic microtubule (GO:0005881)|microtubule (GO:0005874)|nucleus (GO:0005634)|vesicle (GO:0031982)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.K164K(1)		endometrium(1)|large_intestine(3)|liver(1)|lung(7)|skin(1)	13						ATGGCAAGAAGTCCAAGCTGG	0.547																																					p.K164K		.											.	TUBA1C-90	1	Substitution - coding silent(1)	large_intestine(1)	c.G492A						.						56.0	58.0	57.0					12																	49666152		2203	4300	6503	SO:0001819	synonymous_variant	84790	exon4			CAAGAAGTCCAAG	BC004949	CCDS8782.1	12q13.12	2007-03-16	2007-02-12	2007-02-12		ENSG00000167553		"""Tubulins"""	20768	protein-coding gene	gene with protein product			"""tubulin, alpha 6"""	TUBA6		7821789	Standard	NM_032704		Approved	MGC14580, MGC10851, bcm948	uc001rtt.1	Q9BQE3		ENST00000301072.6:c.492G>A	12.37:g.49666152G>A		Somatic	258	10		WXS	Illumina GAIIx	Phase_I	431	24	NM_032704	2	0	729	1222	491		Silent	SNP	ENST00000301072.6	37	CCDS8782.1																																																																																			G|0.998;A|0.002		0.547	TUBA1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404424.1	NM_032704	
KRT7	3855	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	52627326	52627326	+	Silent	SNP	C	C	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr12:52627326C>A	ENST00000331817.5	+	1	429	c.246C>A	c.(244-246)ccC>ccA	p.P82P		NM_005556.3	NP_005547.3	P08729	K2C7_HUMAN	keratin 7	82	Head.				viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|prostate(2)|stomach(1)|urinary_tract(1)	14				BRCA - Breast invasive adenocarcinoma(357;0.105)	Primaquine(DB01087)	ACGCCGACCCCTCCCTCCAGC	0.677																																					p.P82P		.											.	KRT7-90	0			c.C246A						.						33.0	36.0	35.0					12																	52627326		2200	4296	6496	SO:0001819	synonymous_variant	3855	exon1			CGACCCCTCCCTC		CCDS8822.1	12q13.13	2013-01-16			ENSG00000135480	ENSG00000135480		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6445	protein-coding gene	gene with protein product	"""keratin, type II cytoskeletal 7"", ""cytokeratin 7"", ""sarcolectin"", ""keratin, 55K type II cytoskeletal"""	148059				1713141, 16831889	Standard	XR_245927		Approved	K7, CK7, K2C7, SCL	uc001saa.1	P08729	OTTHUMG00000169580	ENST00000331817.5:c.246C>A	12.37:g.52627326C>A		Somatic	90	0		WXS	Illumina GAIIx	Phase_I	142	60	NM_005556	0	0	0	0	0	Q92676|Q9BUD8|Q9Y3R7	Silent	SNP	ENST00000331817.5	37	CCDS8822.1																																																																																			.		0.677	KRT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404897.1	NM_005556	
KRT77	374454	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	53088535	53088535	+	Missense_Mutation	SNP	C	C	T	rs375236986		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr12:53088535C>T	ENST00000341809.3	-	5	983	c.955G>A	c.(955-957)Gtc>Atc	p.V319I	KRT77_ENST00000537195.1_Missense_Mutation_p.V86I|RP11-641A6.3_ENST00000547533.1_RNA	NM_175078.2	NP_778253.2	Q7Z794	K2C1B_HUMAN	keratin 77	319	Linker 12.|Rod.					cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(2)|endometrium(2)|large_intestine(3)|lung(11)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	25						GACAGGATGACGTTGGTGTCG	0.562																																					p.V319I		.											.	KRT77-187	0			c.G955A						.	C	ILE/VAL	0,4406		0,0,2203	153.0	114.0	127.0		955	4.1	1.0	12		127	1,8599	1.2+/-3.3	0,1,4299	no	missense	KRT77	NM_175078.2	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	319/579	53088535	1,13005	2203	4300	6503	SO:0001583	missense	374454	exon5			GGATGACGTTGGT	BK000975	CCDS8837.1	12q13.13	2013-06-25	2006-07-17	2006-07-17	ENSG00000189182	ENSG00000189182		"""-"", ""Intermediate filaments type II, keratins (basic)"""	20411	protein-coding gene	gene with protein product		611158	"""keratin 1B"""	KRT1B		11683385, 16831889	Standard	NM_175078		Approved		uc001saw.3	Q7Z794	OTTHUMG00000169450	ENST00000341809.3:c.955G>A	12.37:g.53088535C>T	ENSP00000342710:p.Val319Ile	Somatic	138	0		WXS	Illumina GAIIx	Phase_I	151	76	NM_175078	0	0	0	0	0	Q7RTS8	Missense_Mutation	SNP	ENST00000341809.3	37	CCDS8837.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.979962	0.74360	0.0	1.16E-4	ENSG00000189182	ENST00000341809;ENST00000537195	D;D	0.89746	-1.6;-2.56	4.94	4.05	0.47172	Filament (1);	.	.	.	.	D	0.93393	0.7893	M	0.78916	2.43	0.28331	N	0.921787	D	0.89917	1.0	D	0.72625	0.978	D	0.87179	0.2226	9	0.59425	D	0.04	.	10.3571	0.43972	0.0:0.838:0.0:0.162	.	319	Q7Z794	K2C1B_HUMAN	I	319;86	ENSP00000342710:V319I;ENSP00000440803:V86I	ENSP00000342710:V319I	V	-	1	0	KRT77	51374802	0.999000	0.42202	0.978000	0.43139	0.858000	0.48976	4.041000	0.57339	1.221000	0.43506	0.555000	0.69702	GTC	.		0.562	KRT77-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404111.1	NM_175078	
ESYT1	23344	broad.mit.edu	37	12	56536719	56536719	+	Splice_Site	SNP	T	T	C			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr12:56536719T>C	ENST00000394048.5	+	27	3251		c.e27+2		ESYT1_ENST00000541590.1_Splice_Site|ESYT1_ENST00000267113.4_Splice_Site	NM_001184796.1|NM_015292.2	NP_001171725.1|NP_056107.1	Q9BSJ8	ESYT1_HUMAN	extended synaptotagmin-like protein 1						lipid transport (GO:0006869)	integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|large_intestine(4)|lung(10)|ovary(5)|prostate(1)|skin(3)|urinary_tract(1)	28						TGGTTGCCGGTGAGACCCCAT	0.557																																					.		.											.	ESYT1-95	0			c.2987+2T>C						.						116.0	110.0	112.0					12																	56536719		2203	4300	6503	SO:0001630	splice_region_variant	23344	exon27			TGCCGGTGAGACC	AK074368	CCDS8904.1, CCDS53801.1	12q13.2	2014-07-02	2009-06-23	2009-06-23		ENSG00000139641		"""Synaptotagmins"""	29534	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member A"""	FAM62A		9872452, 10350628, 17672888	Standard	NM_015292		Approved	MBC2, KIAA0747	uc001sjr.3	Q9BSJ8		ENST00000394048.5:c.2987+2T>C	12.37:g.56536719T>C		Somatic	75	0		WXS	Illumina GAIIx	Phase_I	109	5	NM_015292	0	0	0	0	0	A0FGR7|A8K2S2|O94848|Q6PJN4|Q9H6J1|Q9H6W2|Q9Y416	Splice_Site	SNP	ENST00000394048.5	37	CCDS8904.1	.	.	.	.	.	.	.	.	.	.	T	19.57	3.852146	0.71719	.	.	ENSG00000139641	ENST00000394048;ENST00000402331;ENST00000267113;ENST00000541590	.	.	.	5.22	5.22	0.72569	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.8033	0.52139	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	ESYT1	54822986	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	5.731000	0.68554	2.107000	0.64212	0.459000	0.35465	.	.		0.557	ESYT1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000407906.1	NM_015292	Intron
GPR182	11318	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	57389484	57389484	+	Missense_Mutation	SNP	G	G	A	rs145408449	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr12:57389484G>A	ENST00000300098.1	+	2	710	c.491G>A	c.(490-492)cGt>cAt	p.R164H	HBCBP_ENST00000600202.1_5'Flank|RP11-474N8.5_ENST00000556850.1_RNA	NM_007264.3	NP_009195.1	O15218	GP182_HUMAN	G protein-coupled receptor 182	164					cell surface receptor signaling pathway (GO:0007166)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)			endometrium(3)|large_intestine(3)|lung(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	15						TCCTGGCAGCGTTACCAGCAC	0.607																																					p.R164H		.											.	GPR182-500	0			c.G491A						.	G	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	98.0	84.0	89.0		491	-0.8	0.1	12	dbSNP_134	89	1,8599	1.2+/-3.3	0,1,4299	yes	missense	GPR182	NM_007264.3	29	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	benign	164/405	57389484	2,13004	2203	4300	6503	SO:0001583	missense	11318	exon2			GGCAGCGTTACCA	Y13583	CCDS8927.1	12q13.3	2012-08-21	2007-09-24	2007-09-24		ENSG00000166856		"""GPCR / Class A : Orphans"""	13708	protein-coding gene	gene with protein product		605307	"""adrenomedullin receptor"""	ADMR		9367907, 9535752	Standard	NM_007264		Approved	hrhAMR, G10D, AM-R	uc001smk.3	O15218		ENST00000300098.1:c.491G>A	12.37:g.57389484G>A	ENSP00000300098:p.Arg164His	Somatic	136	0		WXS	Illumina GAIIx	Phase_I	177	14	NM_007264	0	0	0	0	0		Missense_Mutation	SNP	ENST00000300098.1	37	CCDS8927.1	.	.	.	.	.	.	.	.	.	.	G	0.883	-0.728067	0.03135	2.27E-4	1.16E-4	ENSG00000166856	ENST00000300098	T	0.73152	-0.72	4.44	-0.751	0.11076	GPCR, rhodopsin-like superfamily (1);	0.351640	0.30210	N	0.010141	T	0.50701	0.1631	L	0.28192	0.835	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.32981	-0.9886	10	0.48119	T	0.1	.	6.5885	0.22634	0.3871:0.1206:0.4923:0.0	.	164	O15218	GP182_HUMAN	H	164	ENSP00000300098:R164H	ENSP00000300098:R164H	R	+	2	0	GPR182	55675751	0.197000	0.23362	0.084000	0.20598	0.004000	0.04260	0.312000	0.19397	-0.541000	0.06257	-2.069000	0.00389	CGT	G|1.000;A|0.000		0.607	GPR182-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411212.1	NM_007264	
LRP1	4035	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	57581075	57581075	+	Silent	SNP	C	C	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr12:57581075C>A	ENST00000243077.3	+	42	7333	c.6867C>A	c.(6865-6867)gcC>gcA	p.A2289A		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	2289					aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	AAGGCCTGGCCTATCACCGTG	0.642																																					p.A2289A		.											.	LRP1-596	0			c.C6867A						.						79.0	73.0	75.0					12																	57581075		2203	4300	6503	SO:0001819	synonymous_variant	4035	exon42			CCTGGCCTATCAC	X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.6867C>A	12.37:g.57581075C>A		Somatic	209	1		WXS	Illumina GAIIx	Phase_I	269	118	NM_002332	0	0	0	0	0	Q2PP12|Q86SW0|Q8IVG8	Silent	SNP	ENST00000243077.3	37	CCDS8932.1																																																																																			.		0.642	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2	NM_002332	
LRP1	4035	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	57584685	57584685	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr12:57584685C>T	ENST00000243077.3	+	43	7595	c.7129C>T	c.(7129-7131)Cgt>Tgt	p.R2377C		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	2377					aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	GAAGGACATCCGTACCCCCAA	0.602																																					p.R2377C		.											.	LRP1-596	0			c.C7129T						.						104.0	81.0	89.0					12																	57584685		2203	4300	6503	SO:0001583	missense	4035	exon43			GACATCCGTACCC	X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.7129C>T	12.37:g.57584685C>T	ENSP00000243077:p.Arg2377Cys	Somatic	150	0		WXS	Illumina GAIIx	Phase_I	178	28	NM_002332	0	0	1	1	0	Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	ENST00000243077.3	37	CCDS8932.1	.	.	.	.	.	.	.	.	.	.	C	17.01	3.279403	0.59758	.	.	ENSG00000123384	ENST00000243077	D	0.96200	-3.94	4.96	4.96	0.65561	Six-bladed beta-propeller, TolB-like (1);	0.085942	0.47093	D	0.000257	D	0.95118	0.8418	M	0.80332	2.49	0.80722	D	1	P	0.40083	0.702	B	0.38985	0.287	D	0.94704	0.7886	10	0.35671	T	0.21	.	17.1417	0.86755	0.0:1.0:0.0:0.0	.	2377	Q07954	LRP1_HUMAN	C	2377	ENSP00000243077:R2377C	ENSP00000243077:R2377C	R	+	1	0	LRP1	55870952	1.000000	0.71417	1.000000	0.80357	0.176000	0.22953	2.944000	0.49034	2.563000	0.86464	0.542000	0.68232	CGT	.		0.602	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2	NM_002332	
KIF5A	3798	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	57965871	57965871	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr12:57965871G>A	ENST00000455537.2	+	14	1664	c.1390G>A	c.(1390-1392)Gag>Aag	p.E464K	KIF5A_ENST00000286452.5_Missense_Mutation_p.E375K	NM_004984.2	NP_004975.2	Q12840	KIF5A_HUMAN	kinesin family member 5A	464					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|protein localization (GO:0008104)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|liver(1)|lung(32)|ovary(2)|prostate(2)|skin(2)	62						AGGAGACAACGAGAAGGTCCA	0.577																																					p.E464K		.											.	KIF5A-517	0			c.G1390A						.						68.0	61.0	63.0					12																	57965871		2202	4300	6502	SO:0001583	missense	3798	exon14			GACAACGAGAAGG	U06698	CCDS8945.1	12q13.13	2011-07-15	2004-02-13			ENSG00000155980		"""Kinesins"""	6323	protein-coding gene	gene with protein product		602821	"""spastic paraplegia 10 (autosomal dominant)"""	SPG10		9858832, 10441583, 16489470	Standard	NM_004984		Approved	D12S1889, NKHC, MY050	uc001sor.1	Q12840	OTTHUMG00000170143	ENST00000455537.2:c.1390G>A	12.37:g.57965871G>A	ENSP00000408979:p.Glu464Lys	Somatic	172	1		WXS	Illumina GAIIx	Phase_I	229	109	NM_004984	0	0	0	0	0	A6H8M5|Q4LE26	Missense_Mutation	SNP	ENST00000455537.2	37	CCDS8945.1	.	.	.	.	.	.	.	.	.	.	G	30	5.051538	0.93793	.	.	ENSG00000155980	ENST00000455537;ENST00000286452	T;T	0.81163	-1.46;-1.46	4.93	4.93	0.64822	.	0.055440	0.64402	D	0.000001	D	0.82618	0.5076	M	0.71036	2.16	0.58432	D	0.999999	P;D	0.55172	0.838;0.97	B;P	0.46253	0.356;0.509	D	0.84072	0.0380	10	0.46703	T	0.11	.	17.4472	0.87581	0.0:0.0:1.0:0.0	.	375;464	B7Z2M7;Q12840	.;KIF5A_HUMAN	K	464;375	ENSP00000408979:E464K;ENSP00000286452:E375K	ENSP00000286452:E375K	E	+	1	0	KIF5A	56252138	1.000000	0.71417	0.991000	0.47740	0.974000	0.67602	9.657000	0.98554	2.749000	0.94314	0.655000	0.94253	GAG	.		0.577	KIF5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407634.1	NM_004984	
MON2	23041	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	62940761	62940761	+	Missense_Mutation	SNP	G	G	A	rs201327821		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr12:62940761G>A	ENST00000393632.2	+	22	3053	c.2662G>A	c.(2662-2664)Gtg>Atg	p.V888M	MON2_ENST00000393629.2_Missense_Mutation_p.V888M|MON2_ENST00000280379.6_Missense_Mutation_p.V889M|RNU6-399P_ENST00000365164.1_RNA|MON2_ENST00000393630.3_Missense_Mutation_p.V889M|MON2_ENST00000552738.1_Missense_Mutation_p.V865M|MON2_ENST00000546600.1_Missense_Mutation_p.V888M|MON2_ENST00000552115.1_Missense_Mutation_p.V888M	NM_015026.2	NP_055841.2	Q7Z3U7	MON2_HUMAN	MON2 homolog (S. cerevisiae)	888					actin cytoskeleton organization (GO:0030036)|Golgi to endosome transport (GO:0006895)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)	p.V888M(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(15)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	57			BRCA - Breast invasive adenocarcinoma(9;0.218)	GBM - Glioblastoma multiforme(28;0.128)		GTTAGAATGCGTGTTGCAGAT	0.453													G|||	1	0.000199681	0.0	0.0	5008	,	,		13117	0.0		0.001	False		,,,				2504	0.0				p.V888M		.											.	MON2-514	1	Substitution - Missense(1)	endometrium(1)	c.G2662A						.						103.0	95.0	98.0					12																	62940761		2203	4300	6503	SO:0001583	missense	23041	exon22			GAATGCGTGTTGC		CCDS31849.1, CCDS61175.1, CCDS61177.1, CCDS61178.1	12q14.1	2014-08-12	2006-04-04		ENSG00000061987	ENSG00000061987			29177	protein-coding gene	gene with protein product			"""MON2 homolog (yeast)"""			16301316, 24285343	Standard	NM_015026		Approved	KIAA1040	uc001sre.3	Q7Z3U7	OTTHUMG00000169992	ENST00000393632.2:c.2662G>A	12.37:g.62940761G>A	ENSP00000377252:p.Val888Met	Somatic	157	1		WXS	Illumina GAIIx	Phase_I	202	91	NM_015026	0	0	4	10	6	A5D8U7|A7E2Y0|B9EGP5|F8VWA6|F8W1Z6|Q86TA2|Q8N3I5|Q8NAI0|Q8NHE2|Q9UPW1	Missense_Mutation	SNP	ENST00000393632.2	37	CCDS31849.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.275325	0.80580	.	.	ENSG00000061987	ENST00000393632;ENST00000393630;ENST00000280379;ENST00000546600;ENST00000552738;ENST00000393629;ENST00000552115	T;T;T;T;T;T;T	0.65364	-0.15;-0.15;-0.15;-0.15;-0.15;-0.15;1.43	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	T	0.73729	0.3624	L	0.52126	1.63	0.80722	D	1	D;D;D;D	0.69078	0.995;0.997;0.99;0.997	D;P;P;P	0.65323	0.934;0.861;0.846;0.803	T	0.72087	-0.4396	9	.	.	.	-11.4167	18.8374	0.92168	0.0:0.0:1.0:0.0	.	888;865;888;888	B9EGP5;F8VWA6;F8W1Z6;Q7Z3U7-4	.;.;.;.	M	888;889;889;888;865;888;888	ENSP00000377252:V888M;ENSP00000377250:V889M;ENSP00000280379:V889M;ENSP00000447407:V888M;ENSP00000449215:V865M;ENSP00000377249:V888M;ENSP00000446635:V888M	.	V	+	1	0	MON2	61227028	1.000000	0.71417	1.000000	0.80357	0.861000	0.49209	8.058000	0.89460	2.447000	0.82792	0.591000	0.81541	GTG	G|0.999;A|0.001		0.453	MON2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406767.3	NM_015026	
MDM2	4193	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	69210628	69210628	+	Nonsense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr12:69210628C>T	ENST00000350057.5	+	2	118	c.118C>T	c.(118-120)Cga>Tga	p.R40*	MDM2_ENST00000478070.1_Intron|MDM2_ENST00000517852.1_Intron|MDM2_ENST00000428863.2_Intron|MDM2_ENST00000356290.4_Intron|MDM2_ENST00000393410.1_Intron|MDM2_ENST00000258149.5_Nonsense_Mutation_p.R65*|MDM2_ENST00000393412.3_Intron|MDM2_ENST00000462284.1_Nonsense_Mutation_p.R71*|MDM2_ENST00000540827.1_Intron|MDM2_ENST00000258148.7_Nonsense_Mutation_p.R71*|MDM2_ENST00000544561.1_Intron|MDM2_ENST00000348801.2_Intron|MDM2_ENST00000360430.2_Intron|MDM2_ENST00000545204.1_Intron|MDM2_ENST00000393413.3_Intron|MDM2_ENST00000299252.4_Intron			Q00987	MDM2_HUMAN	MDM2 proto-oncogene, E3 ubiquitin protein ligase	65	Necessary for interaction with USP2.|SWIB.				cellular response to acid chemical (GO:0071229)|cellular response to alkaloid (GO:0071312)|cellular response to antibiotic (GO:0071236)|cellular response to estrogen stimulus (GO:0071391)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|cellular response to peptide hormone stimulus (GO:0071375)|cellular response to UV-C (GO:0071494)|cellular response to vitamin B1 (GO:0071301)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|epidermal growth factor receptor signaling pathway (GO:0007173)|establishment of protein localization (GO:0045184)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of protein processing (GO:0010955)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-lysine modification (GO:0018205)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein export from nucleus (GO:0046827)|protein complex assembly (GO:0006461)|protein destabilization (GO:0031648)|protein localization to nucleus (GO:0034504)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of protein catabolic process (GO:0042176)|response to antibiotic (GO:0046677)|response to carbohydrate (GO:0009743)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to ether (GO:0045472)|response to iron ion (GO:0010039)|response to magnesium ion (GO:0032026)|response to morphine (GO:0043278)|synaptic transmission (GO:0007268)|traversing start control point of mitotic cell cycle (GO:0007089)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synapse (GO:0045202)	enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|ligase activity (GO:0016874)|p53 binding (GO:0002039)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(2)|lung(8)|prostate(1)|urinary_tract(1)	19	all_cancers(1;8.46e-121)|all_epithelial(5;3.21e-36)|Lung NSC(4;2.16e-33)|all_lung(4;3.03e-31)|Glioma(1;1.9e-09)|Breast(13;1.59e-06)|all_neural(1;1.03e-05)|Melanoma(1;0.0171)|Renal(347;0.0684)		all cancers(2;8.67e-65)|GBM - Glioblastoma multiforme(2;8.89e-62)|BRCA - Breast invasive adenocarcinoma(5;2.43e-08)|Lung(24;1.5e-05)|LUAD - Lung adenocarcinoma(15;8.5e-05)|STAD - Stomach adenocarcinoma(21;0.00372)|Kidney(9;0.143)			TATGACTAAACGATTATATGA	0.308			A		"""sarcoma, glioma, colorectal, other"""																																p.R71X		.		Dom	yes		12	12q15	4193	Mdm2 p53 binding protein homolog		"""M, O, E, L"""	.	MDM2-1270	0			c.C211T						.						88.0	80.0	83.0					12																	69210628		1805	4075	5880	SO:0001587	stop_gained	4193	exon4			ACTAAACGATTAT		CCDS8986.2, CCDS61189.1	12q13-q14	2014-06-26	2014-06-26		ENSG00000135679	ENSG00000135679			6973	protein-coding gene	gene with protein product		164785	"""mouse double minute 2, human homolog of; p53-binding protein"", ""Mdm2, transformed 3T3 cell double minute 2, p53 binding protein (mouse)"", ""Mdm2 p53 binding protein homolog (mouse)"""			1614537, 16905769	Standard	NM_002392		Approved	HDM2, MGC5370	uc001sui.4	Q00987	OTTHUMG00000142827	ENST00000350057.5:c.118C>T	12.37:g.69210628C>T	ENSP00000266624:p.Arg40*	Somatic	42	0		WXS	Illumina GAIIx	Phase_I	77	26	NM_002392	0	0	1	3	2	A6NL51|A8K2S6|Q13226|Q13297|Q13298|Q13299|Q13300|Q13301|Q53XW0|Q71TW9|Q8WYJ1|Q8WYJ2|Q9UGI3|Q9UMT8	Nonsense_Mutation	SNP	ENST00000350057.5	37		.	.	.	.	.	.	.	.	.	.	C	15.63	2.890503	0.52014	.	.	ENSG00000135679	ENST00000462284;ENST00000258149;ENST00000311440;ENST00000258148;ENST00000539479;ENST00000393415;ENST00000393416;ENST00000350057	.	.	.	5.22	3.26	0.37387	.	0.121099	0.56097	D	0.000029	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-0.9368	9.0821	0.36558	0.1775:0.7423:0.0:0.0802	.	.	.	.	X	71;65;65;71;65;65;96;40	.	.	R	+	1	2	MDM2	67496895	1.000000	0.71417	0.939000	0.37840	0.290000	0.27261	1.241000	0.32743	0.712000	0.32039	0.563000	0.77884	CGA	.		0.308	MDM2-033	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000402665.1	NM_006880	
NAV3	89795	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	78515967	78515967	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr12:78515967C>T	ENST00000397909.2	+	16	4170	c.3997C>T	c.(3997-3999)Cca>Tca	p.P1333S	NAV3_ENST00000266692.7_Intron|NAV3_ENST00000228327.6_Missense_Mutation_p.P1333S|NAV3_ENST00000536525.2_Missense_Mutation_p.P1333S			Q8IVL0	NAV3_HUMAN	neuron navigator 3	1333	Ser-rich.					membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						GGCCTCCAGCCCAGCATCGGT	0.527										HNSCC(70;0.22)																											p.P1333S		.											.	NAV3-279	0			c.C3997T						.						81.0	82.0	81.0					12																	78515967		2022	4179	6201	SO:0001583	missense	89795	exon16			TCCAGCCCAGCAT	AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.3997C>T	12.37:g.78515967C>T	ENSP00000381007:p.Pro1333Ser	Somatic	239	0		WXS	Illumina GAIIx	Phase_I	263	45	NM_014903	0	0	0	0	0	Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	ENST00000397909.2	37		.	.	.	.	.	.	.	.	.	.	C	21.0	4.078411	0.76528	.	.	ENSG00000067798	ENST00000536525;ENST00000397909;ENST00000228327	T;T;T	0.60548	0.18;0.22;0.19	5.96	5.96	0.96718	.	0.000000	0.39985	U	0.001208	T	0.77883	0.4197	M	0.76170	2.325	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.985;0.998;0.998	T	0.76796	-0.2827	10	0.52906	T	0.07	-16.5392	20.4082	0.99013	0.0:1.0:0.0:0.0	.	1333;1333;1333	E7EUC6;Q8IVL0;Q8IVL0-2	.;NAV3_HUMAN;.	S	1333	ENSP00000446132:P1333S;ENSP00000381007:P1333S;ENSP00000228327:P1333S	ENSP00000228327:P1333S	P	+	1	0	NAV3	77040098	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.590000	0.82653	2.814000	0.96858	0.655000	0.94253	CCA	.		0.527	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383	
MGAT4C	25834	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	86377312	86377312	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr12:86377312A>G	ENST00000604798.1	-	7	1488	c.284T>C	c.(283-285)tTa>tCa	p.L95S	MGAT4C_ENST00000393205.2_Missense_Mutation_p.L124S|MGAT4C_ENST00000332156.1_Missense_Mutation_p.L95S|MGAT4C_ENST00000549405.2_Missense_Mutation_p.L95S|MGAT4C_ENST00000548651.1_Missense_Mutation_p.L95S|MGAT4C_ENST00000552435.2_Missense_Mutation_p.L95S|MGAT4C_ENST00000552808.2_Missense_Mutation_p.L95S			Q9UBM8	MGT4C_HUMAN	MGAT4 family, member C	95					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity (GO:0008454)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(17)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	41						CTTTCTTTGTAAAGGTGTGGC	0.308																																					p.L95S		.											.	MGAT4C-93	0			c.T284C						.						110.0	115.0	113.0					12																	86377312		2203	4300	6503	SO:0001583	missense	25834	exon6			CTTTGTAAAGGTG		CCDS9030.1	12q21	2014-07-14	2014-07-14		ENSG00000182050	ENSG00000182050		"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	30871	protein-coding gene	gene with protein product		607385	"""mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme C (putative)"""			10570912	Standard	NM_013244		Approved	HGNT-IV-H	uc001tal.4	Q9UBM8	OTTHUMG00000169846	ENST00000604798.1:c.284T>C	12.37:g.86377312A>G	ENSP00000474896:p.Leu95Ser	Somatic	59	0		WXS	Illumina GAIIx	Phase_I	105	60	NM_013244	0	0	0	0	0	B4DRH2|Q4G199|Q9UIU5	Missense_Mutation	SNP	ENST00000604798.1	37	CCDS9030.1	.	.	.	.	.	.	.	.	.	.	A	15.29	2.788663	0.49997	.	.	ENSG00000182050	ENST00000332156;ENST00000393205;ENST00000549405;ENST00000550460;ENST00000552808;ENST00000548651;ENST00000547225;ENST00000552435	T;T;T;T;T;T	0.42513	0.97;0.97;0.97;0.97;0.97;0.97	5.39	5.39	0.77823	.	0.121525	0.36101	N	0.002782	T	0.35537	0.0935	L	0.49126	1.545	0.44985	D	0.998001	B;B	0.14805	0.011;0.003	B;B	0.15484	0.013;0.006	T	0.22452	-1.0216	10	0.06494	T	0.89	-22.6821	15.4047	0.74868	1.0:0.0:0.0:0.0	.	124;95	B4DRH2;Q9UBM8	.;MGT4C_HUMAN	S	95;124;95;95;95;95;95;95	ENSP00000331664:L95S;ENSP00000376900:L124S;ENSP00000449022:L95S;ENSP00000446647:L95S;ENSP00000447253:L95S;ENSP00000449172:L95S	ENSP00000331664:L95S	L	-	2	0	MGAT4C	84901443	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.962000	0.93254	2.051000	0.60960	0.460000	0.39030	TTA	.		0.308	MGAT4C-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406212.2	NM_013244	
CEP290	80184	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	88479859	88479859	+	Missense_Mutation	SNP	C	C	T	rs576877716		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr12:88479859C>T	ENST00000552810.1	-	34	4737	c.4394G>A	c.(4393-4395)cGa>cAa	p.R1465Q	CEP290_ENST00000309041.7_Missense_Mutation_p.R1467Q|CEP290_ENST00000547691.2_Missense_Mutation_p.R525Q|CEP290_ENST00000397838.3_Missense_Mutation_p.R525Q	NM_025114.3	NP_079390.3	O15078	CE290_HUMAN	centrosomal protein 290kDa	1465					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|G2/M transition of mitotic cell cycle (GO:0000086)|hindbrain development (GO:0030902)|mitotic cell cycle (GO:0000278)|otic vesicle formation (GO:0030916)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephros development (GO:0048793)|protein transport (GO:0015031)|regulation of cAMP metabolic process (GO:0030814)|regulation of establishment of protein localization (GO:0070201)|retina development in camera-type eye (GO:0060041)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|protein complex (GO:0043234)|TCTN-B9D complex (GO:0036038)		p.R1467Q(1)		breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|liver(1)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	73						TAGAATTATTCGAATGTTCTC	0.373													C|||	1	0.000199681	0.0	0.0	5008	,	,		14670	0.0		0.0	False		,,,				2504	0.001				p.R1465Q		.											.	CEP290-96	1	Substitution - Missense(1)	large_intestine(1)	c.G4394A						.						154.0	129.0	137.0					12																	88479859		1809	4062	5871	SO:0001583	missense	80184	exon34			ATTATTCGAATGT	AB002371	CCDS55858.1	12q21.33	2014-09-17				ENSG00000198707			29021	protein-coding gene	gene with protein product	"""Joubert syndrome 5"", ""nephrocystin-6"", ""cancer/testis antigen 87"", ""POC3 centriolar protein homolog (Chlamydomonas)"", ""Meckel syndrome, type 4"""	610142				15474516, 16682973, 16632484	Standard	NM_025114		Approved	KIAA0373, FLJ13615, 3H11Ag, rd16, NPHP6, JBTS5, SLSN6, LCA10, MKS4, BBS14, CT87, POC3	uc001tar.3	O15078		ENST00000552810.1:c.4394G>A	12.37:g.88479859C>T	ENSP00000448012:p.Arg1465Gln	Somatic	82	0		WXS	Illumina GAIIx	Phase_I	107	47	NM_025114	0	0	1	2	1	Q1PSK5|Q66GS8|Q9H2G6|Q9H6Q7|Q9H8I0	Missense_Mutation	SNP	ENST00000552810.1	37	CCDS55858.1	.	.	.	.	.	.	.	.	.	.	C	13.49	2.252652	0.39797	.	.	ENSG00000198707	ENST00000547691;ENST00000552810;ENST00000309041;ENST00000397838	T;T;T;T	0.64260	0.41;-0.09;-0.09;0.41	5.78	4.89	0.63831	.	0.192474	0.47093	N	0.000258	T	0.45296	0.1335	L	0.35854	1.095	0.29182	N	0.876426	B	0.27166	0.17	B	0.16289	0.015	T	0.34079	-0.9843	10	0.11485	T	0.65	.	9.4503	0.38723	0.0:0.777:0.0:0.223	.	1465	O15078	CE290_HUMAN	Q	525;1465;1467;525	ENSP00000446905:R525Q;ENSP00000448012:R1465Q;ENSP00000308021:R1467Q;ENSP00000380938:R525Q	ENSP00000308021:R1467Q	R	-	2	0	CEP290	87003990	0.998000	0.40836	0.999000	0.59377	0.411000	0.31082	0.886000	0.28241	1.422000	0.47177	0.557000	0.71058	CGA	.		0.373	CEP290-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000406344.1	NM_025114	
C12orf42	374470	broad.mit.edu	37	12	103699896	103699896	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr12:103699896T>C	ENST00000378113.2	-	5	712	c.487A>G	c.(487-489)Aac>Gac	p.N163D	C12orf42_ENST00000315192.8_Intron|C12orf42_ENST00000548048.1_Missense_Mutation_p.N96D|C12orf42_ENST00000548883.1_Missense_Mutation_p.N163D|C12orf42_ENST00000548789.1_5'UTR	NM_001099336.1	NP_001092806.1	Q96LP6	CL042_HUMAN	chromosome 12 open reading frame 42	163										NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)	22						AATGAACTGTTCCAAGCCTGC	0.493																																					p.N163D		.											.	C12orf42-91	0			c.A487G						.						75.0	77.0	77.0					12																	103699896		1906	4120	6026	SO:0001583	missense	374470	exon5			AACTGTTCCAAGC	AK058052	CCDS44963.1	12q23.2	2012-05-30			ENSG00000179088	ENSG00000179088			24729	protein-coding gene	gene with protein product							Standard	NM_001099336		Approved	FLJ25323	uc001tjt.2	Q96LP6	OTTHUMG00000169988	ENST00000378113.2:c.487A>G	12.37:g.103699896T>C	ENSP00000367353:p.Asn163Asp	Somatic	61	0		WXS	Illumina GAIIx	Phase_I	103	4	NM_001099336	0	0	0	0	0	Q49A64|Q4G0S2	Missense_Mutation	SNP	ENST00000378113.2	37	CCDS44963.1	.	.	.	.	.	.	.	.	.	.	T	10.48	1.361071	0.24684	.	.	ENSG00000179088	ENST00000548883;ENST00000548048;ENST00000378113;ENST00000552578	T;T;T;T	0.43688	0.94;0.94;0.94;0.94	3.98	2.76	0.32466	.	1.102310	0.07096	N	0.839648	T	0.27063	0.0663	N	0.19112	0.55	0.09310	N	0.999994	B	0.33103	0.397	B	0.33960	0.173	T	0.25257	-1.0137	10	0.21014	T	0.42	-0.0034	5.9902	0.19456	0.0:0.1266:0.0:0.8734	.	163	Q96LP6	CL042_HUMAN	D	163;96;163;163	ENSP00000447908:N163D;ENSP00000449362:N96D;ENSP00000367353:N163D;ENSP00000447795:N163D	ENSP00000367353:N163D	N	-	1	0	C12orf42	102224026	0.318000	0.24598	0.707000	0.30419	0.015000	0.08874	0.797000	0.26999	0.820000	0.34516	0.449000	0.29647	AAC	.		0.493	C12orf42-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406754.1	NM_198521	
ALDH1L2	160428	ucsc.edu;bcgsc.ca	37	12	105464485	105464485	+	Silent	SNP	G	G	A	rs74449999	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr12:105464485G>A	ENST00000258494.9	-	3	431	c.291C>T	c.(289-291)tcC>tcT	p.S97S	RP11-61E11.1_ENST00000547750.1_RNA|ALDH1L2_ENST00000424857.2_Silent_p.S97S	NM_001034173.3	NP_001029345.2	Q3SY69	AL1L2_HUMAN	aldehyde dehydrogenase 1 family, member L2	97	GART.				10-formyltetrahydrofolate catabolic process (GO:0009258)|biosynthetic process (GO:0009058)|one-carbon metabolic process (GO:0006730)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	formyltetrahydrofolate dehydrogenase activity (GO:0016155)|hydroxymethyl-, formyl- and related transferase activity (GO:0016742)|methyltransferase activity (GO:0008168)|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(13)|prostate(2)|skin(3)|stomach(2)	35						CTGCACCCACGGATCTGTAGG	0.483													G|||	59	0.0117812	0.003	0.0144	5008	,	,		17150	0.001		0.0408	False		,,,				2504	0.0031				p.S97S		.											.	ALDH1L2-91	0			c.C291T						.	G		39,4367	44.6+/-78.6	0,39,2164	184.0	148.0	160.0		291	-10.5	0.2	12	dbSNP_132	160	322,8278	114.0+/-174.0	8,306,3986	no	coding-synonymous	ALDH1L2	NM_001034173.3		8,345,6150	AA,AG,GG		3.7442,0.8852,2.7756		97/924	105464485	361,12645	2203	4300	6503	SO:0001819	synonymous_variant	160428	exon3			ACCCACGGATCTG	AK095827	CCDS31891.1	12q23.3	2014-09-11			ENSG00000136010	ENSG00000136010	1.5.1.6	"""Aldehyde dehydrogenases"""	26777	protein-coding gene	gene with protein product	"""mitochondrial 10-formyltetrahydrofolate dehydrogenase"""	613584				20498374	Standard	NM_001034173		Approved	FLJ38508, mtFDH	uc001tlc.3	Q3SY69	OTTHUMG00000169823	ENST00000258494.9:c.291C>T	12.37:g.105464485G>A		Somatic	168	2		WXS	Illumina GAIIx	Phase_I	235	117	NM_001034173	0	0	0	0	0	Q3SY68|Q68D62|Q6AI55|Q8N922	Silent	SNP	ENST00000258494.9	37	CCDS31891.1																																																																																			G|0.976;A|0.024		0.483	ALDH1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406098.1	XM_090294	
PRDM4	11108	ucsc.edu;bcgsc.ca;mdanderson.org	37	12	108145670	108145670	+	Silent	SNP	G	G	A	rs146564582	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr12:108145670G>A	ENST00000228437.5	-	5	1107	c.648C>T	c.(646-648)gaC>gaT	p.D216D	PRDM4_ENST00000547268.1_5'Flank|RP11-864J10.4_ENST00000546714.1_RNA	NM_012406.3	NP_036538.3	Q9UKN5	PRDM4_HUMAN	PR domain containing 4	216					cell proliferation (GO:0008283)|negative regulation of cell cycle (GO:0045786)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|methyltransferase activity (GO:0008168)|zinc ion binding (GO:0008270)			biliary_tract(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|prostate(2)|skin(2)|urinary_tract(1)	20						CTGCAACACCGTCCATCGTAA	0.517													G|||	47	0.00938498	0.031	0.0086	5008	,	,		23703	0.0		0.0	False		,,,				2504	0.0				p.D216D		.											.	PRDM4-154	0			c.C648T						.	G		112,4294	85.3+/-124.0	0,112,2091	144.0	125.0	132.0		648	-11.9	0.4	12	dbSNP_134	132	0,8600		0,0,4300	no	coding-synonymous	PRDM4	NM_012406.3		0,112,6391	AA,AG,GG		0.0,2.542,0.8611		216/802	108145670	112,12894	2203	4300	6503	SO:0001819	synonymous_variant	11108	exon5			AACACCGTCCATC	AF144757	CCDS9115.1	12q23-q24.1	2013-01-08				ENSG00000110851		"""Zinc fingers, C2H2-type"""	9348	protein-coding gene	gene with protein product		605780				10552934	Standard	NM_012406		Approved	PFM1	uc001tmp.3	Q9UKN5	OTTHUMG00000169914	ENST00000228437.5:c.648C>T	12.37:g.108145670G>A		Somatic	115	1		WXS	Illumina GAIIx	Phase_I	157	63	NM_012406	0	0	17	33	16	Q9UFA6	Silent	SNP	ENST00000228437.5	37	CCDS9115.1																																																																																			G|0.993;A|0.007		0.517	PRDM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406546.1	NM_012406	
RNFT2	84900	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	117273985	117273985	+	Splice_Site	SNP	G	G	C			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr12:117273985G>C	ENST00000257575.4	+	10	1331		c.e10-1		RNFT2_ENST00000407967.3_Splice_Site|RNFT2_ENST00000392549.2_Splice_Site|RNFT2_ENST00000551251.1_Splice_Site|RNFT2_ENST00000319176.7_Intron			Q96EX2	RNFT2_HUMAN	ring finger protein, transmembrane 2							integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(1)|urinary_tract(1)	6	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.034)		CTCCCTCAAAGAACTATGGAG	0.597																																					.		.											.	.	0			c.1099-1G>C						.						35.0	29.0	31.0					12																	117273985		2203	4300	6503	SO:0001630	splice_region_variant	84900	exon10			CTCAAAGAACTAT	AK027533	CCDS9180.2, CCDS44987.1	12q24.22	2013-01-09	2008-02-26	2008-02-26	ENSG00000135119	ENSG00000135119		"""RING-type (C3HC4) zinc fingers"""	25905	protein-coding gene	gene with protein product			"""transmembrane protein 118"""	TMEM118		12477932	Standard	NM_032814		Approved	FLJ14627	uc009zwn.3	Q96EX2	OTTHUMG00000150882	ENST00000257575.4:c.1099-1G>C	12.37:g.117273985G>C		Somatic	91	0		WXS	Illumina GAIIx	Phase_I	107	45	NM_001109903	0	0	0	0	0	E9PAM7|Q96SU5	Splice_Site	SNP	ENST00000257575.4	37	CCDS44987.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.242882	0.79912	.	.	ENSG00000135119	ENST00000257575;ENST00000407967;ENST00000392549	.	.	.	5.47	5.47	0.80525	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.3302	0.94283	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RNFT2	115758368	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	9.404000	0.97306	2.572000	0.86782	0.591000	0.81541	.	.		0.597	RNFT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320417.1	NM_032814	Intron
FBXW8	26259	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	117465865	117465865	+	Missense_Mutation	SNP	C	C	T	rs536148392		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr12:117465865C>T	ENST00000309909.5	+	11	1767	c.1685C>T	c.(1684-1686)gCg>gTg	p.A562V	FBXW8_ENST00000455858.2_Missense_Mutation_p.A496V			Q8N3Y1	FBXW8_HUMAN	F-box and WD repeat domain containing 8	562					cell proliferation (GO:0008283)|Golgi organization (GO:0007030)|labyrinthine layer blood vessel development (GO:0060716)|positive regulation of dendrite morphogenesis (GO:0050775)|protein ubiquitination (GO:0016567)|spongiotrophoblast layer development (GO:0060712)	Cul7-RING ubiquitin ligase complex (GO:0031467)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)|SCF ubiquitin ligase complex (GO:0019005)				endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(2)|pancreas(1)|skin(1)|stomach(1)	22	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0353)		TATGAGTTTGCGGTGGACCAG	0.612																																					p.A562V		.											.	FBXW8-229	0			c.C1685T						.						110.0	82.0	91.0					12																	117465865		2203	4300	6503	SO:0001583	missense	26259	exon11			AGTTTGCGGTGGA	AF176707	CCDS9182.1, CCDS44988.1	12q24.23	2013-01-09	2007-02-08	2003-06-13				"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	13597	protein-coding gene	gene with protein product		609073	"""F-box only protein 29"", ""F-box and WD-40 domain protein 8"""	FBXO29		10531035, 10531037	Standard	NM_012174		Approved	FBX29, FBW6, FBW8	uc001twg.1	Q8N3Y1	OTTHUMG00000169329	ENST00000309909.5:c.1685C>T	12.37:g.117465865C>T	ENSP00000310686:p.Ala562Val	Somatic	88	0		WXS	Illumina GAIIx	Phase_I	115	53	NM_153348	0	0	0	0	0	Q9UK95	Missense_Mutation	SNP	ENST00000309909.5	37	CCDS9182.1	.	.	.	.	.	.	.	.	.	.	C	19.24	3.789550	0.70337	.	.	ENSG00000174989	ENST00000309909;ENST00000455858;ENST00000505227	T;T	0.08370	3.1;3.11	4.93	4.93	0.64822	.	0.119114	0.64402	D	0.000014	T	0.09468	0.0233	L	0.57536	1.79	0.42356	D	0.992395	P;P	0.45044	0.745;0.849	B;B	0.32928	0.155;0.118	T	0.13926	-1.0491	10	0.44086	T	0.13	-12.9131	15.9314	0.79663	0.0:1.0:0.0:0.0	.	562;496	Q8N3Y1;Q8N3Y1-2	FBXW8_HUMAN;.	V	562;496;496	ENSP00000310686:A562V;ENSP00000389144:A496V	ENSP00000310686:A562V	A	+	2	0	FBXW8	115950248	0.998000	0.40836	0.806000	0.32338	0.661000	0.39034	5.149000	0.64863	2.271000	0.75665	0.591000	0.81541	GCG	.		0.612	FBXW8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403561.1	NM_012174	
GCN1L1	10985	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	120613993	120613993	+	Missense_Mutation	SNP	G	G	A	rs374086266		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr12:120613993G>A	ENST00000300648.6	-	10	878	c.866C>T	c.(865-867)aCg>aTg	p.T289M		NM_006836.1	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis 1-like 1 (yeast)	289					regulation of translation (GO:0006417)|translation (GO:0006412)	cytoplasm (GO:0005737)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)			NS(2)|breast(2)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(13)|liver(1)|lung(36)|ovary(4)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	94	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GAGGTCAAGCGTCACTGATGC	0.488																																					p.T289M		.											.	GCN1L1-94	0			c.C866T						.						99.0	100.0	100.0					12																	120613993		2045	4204	6249	SO:0001583	missense	10985	exon10			TCAAGCGTCACTG	U77700	CCDS41847.1	12q24.2	2008-07-03	2001-11-28						4199	protein-coding gene	gene with protein product		605614	"""GCN1 (general control of amino-acid synthesis 1, yeast)-like 1"""			9234705	Standard	NM_006836		Approved	KIAA0219, GCN1, GCN1L	uc001txo.3	Q92616	OTTHUMG00000169338	ENST00000300648.6:c.866C>T	12.37:g.120613993G>A	ENSP00000300648:p.Thr289Met	Somatic	121	0		WXS	Illumina GAIIx	Phase_I	154	23	NM_006836	0	0	7	8	1	A8KAY1|O95001|O95651|Q6P2S3|Q86X65|Q8N5I5|Q8WU80|Q99736|Q9UE60	Missense_Mutation	SNP	ENST00000300648.6	37	CCDS41847.1	.	.	.	.	.	.	.	.	.	.	G	17.32	3.360046	0.61403	.	.	ENSG00000089154	ENST00000300648	T	0.04862	3.54	5.71	4.76	0.60689	Armadillo-like helical (1);Armadillo-type fold (1);	0.151105	0.64402	D	0.000017	T	0.07503	0.0189	L	0.40543	1.245	0.47994	D	0.999563	D	0.54772	0.968	B	0.42062	0.374	T	0.08106	-1.0738	10	0.66056	D	0.02	-0.3364	13.816	0.63292	0.0:0.0:0.7365:0.2635	.	289	Q92616	GCN1L_HUMAN	M	289	ENSP00000300648:T289M	ENSP00000300648:T289M	T	-	2	0	GCN1L1	119098376	1.000000	0.71417	0.994000	0.49952	0.983000	0.72400	4.847000	0.62867	2.695000	0.91970	0.563000	0.77884	ACG	.		0.488	GCN1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403592.1		
RHOF	54509	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	122217484	122217484	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr12:122217484G>A	ENST00000267205.2	-	5	1184	c.556C>T	c.(556-558)Cgg>Tgg	p.R186W	TMEM120B_ENST00000449592.2_3'UTR|TMEM120B_ENST00000538055.1_3'UTR|RHOF_ENST00000537265.1_Missense_Mutation_p.R86W	NM_019034.2	NP_061907.2	Q9HBH0	RHOF_HUMAN	ras homolog family member F (in filopodia)	186					actin filament organization (GO:0007015)|GTP catabolic process (GO:0006184)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			large_intestine(1)|lung(1)|ovary(1)	3	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;4.38e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.223)		GCGGCCTCCCGGAAGACGTCC	0.637																																					p.R186W		.											.	RHOF-660	0			c.C556T						.						62.0	64.0	63.0					12																	122217484		2203	4300	6503	SO:0001583	missense	54509	exon5			CCTCCCGGAAGAC	AK000254	CCDS9222.1	12q24.31	2013-09-23	2012-02-27	2004-03-24	ENSG00000139725	ENSG00000139725			15703	protein-coding gene	gene with protein product			"""ras homolog gene family, member F (in filopodia)"""	ARHF		11084341	Standard	NM_019034		Approved	FLJ20247, RIF	uc001ubb.3	Q9HBH0	OTTHUMG00000169077	ENST00000267205.2:c.556C>T	12.37:g.122217484G>A	ENSP00000267205:p.Arg186Trp	Somatic	136	2		WXS	Illumina GAIIx	Phase_I	170	86	NM_019034	0	0	26	48	22	Q8WVB1|Q9NXH6	Missense_Mutation	SNP	ENST00000267205.2	37	CCDS9222.1	.	.	.	.	.	.	.	.	.	.	G	16.55	3.153379	0.57259	.	.	ENSG00000139725	ENST00000267205	T	0.70399	-0.48	4.88	3.96	0.45880	.	0.120997	0.52532	D	0.000063	T	0.80889	0.4710	M	0.67397	2.05	0.48452	D	0.999653	D	0.89917	1.0	D	0.75484	0.986	T	0.81771	-0.0780	10	0.87932	D	0	.	11.1875	0.48666	0.0:0.0:0.6666:0.3334	.	186	Q9HBH0	RHOF_HUMAN	W	186	ENSP00000267205:R186W	ENSP00000267205:R186W	R	-	1	2	RHOF	120701867	0.439000	0.25610	0.985000	0.45067	0.297000	0.27493	0.692000	0.25482	0.978000	0.38470	0.655000	0.94253	CGG	.		0.637	RHOF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402165.1		
SETD1B	23067	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	122261635	122261635	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr12:122261635C>T	ENST00000604567.1	+	12	5218	c.5150C>T	c.(5149-5151)aCg>aTg	p.T1717M	SETD1B_ENST00000267197.5_Missense_Mutation_p.T1674M|SETD1B_ENST00000542440.1_Missense_Mutation_p.T1674M			Q9UPS6	SET1B_HUMAN	SET domain containing 1B	1717					histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone-lysine N-methyltransferase activity (GO:0018024)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|endometrium(6)|kidney(2)|prostate(2)	11						CTTAACGACACGCTCTGGGTC	0.592																																					p.T1674M		.											.	SETD1B-86	0			c.C5021T						.						73.0	55.0	60.0					12																	122261635		692	1591	2283	SO:0001583	missense	23067	exon12			ACGACACGCTCTG	AB028999	CCDS53838.1	12q24.31	2013-02-12			ENSG00000139718	ENSG00000139718		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29187	protein-coding gene	gene with protein product		611055				10470851, 17355966	Standard	NM_015048		Approved	KIAA1076, Set1B, KMT2G	uc001ubi.3	Q9UPS6	OTTHUMG00000169080	ENST00000604567.1:c.5150C>T	12.37:g.122261635C>T	ENSP00000474253:p.Thr1717Met	Somatic	148	0		WXS	Illumina GAIIx	Phase_I	148	21	NM_015048	0	0	8	10	2	F6MFW1	Missense_Mutation	SNP	ENST00000604567.1	37		.	.	.	.	.	.	.	.	.	.	C	13.81	2.347664	0.41599	.	.	ENSG00000139718	ENST00000542440;ENST00000267197	T;T	0.70516	-0.49;-0.49	4.63	4.63	0.57726	COMPASS complex Set1 subunit, N-SET domain (1);	0.000000	0.85682	D	0.000000	D	0.85465	0.5703	M	0.84326	2.69	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.88224	0.2899	10	0.87932	D	0	.	17.8647	0.88792	0.0:1.0:0.0:0.0	.	1674	Q9UPS6	SET1B_HUMAN	M	1674	ENSP00000442924:T1674M;ENSP00000267197:T1674M	ENSP00000267197:T1674M	T	+	2	0	SETD1B	120746018	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	7.811000	0.86092	2.282000	0.76494	0.563000	0.77884	ACG	.		0.592	SETD1B-002	PUTATIVE	non_canonical_U12|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000468264.1	XM_037523	
VPS37B	79720	broad.mit.edu;bcgsc.ca	37	12	123351799	123351799	+	Missense_Mutation	SNP	G	G	A	rs370211610		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr12:123351799G>A	ENST00000267202.2	-	4	1103	c.722C>T	c.(721-723)cCg>cTg	p.P241L	RP11-463O12.3_ENST00000537827.2_lincRNA	NM_024667.2	NP_078943.1	Q9H9H4	VP37B_HUMAN	vacuolar protein sorting 37 homolog B (S. cerevisiae)	241	Pro-rich.				endosomal transport (GO:0016197)|intracellular transport of virus (GO:0075733)|membrane organization (GO:0061024)|protein transport (GO:0015031)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	endosome membrane (GO:0010008)|ESCRT I complex (GO:0000813)|extracellular vesicular exosome (GO:0070062)|midbody (GO:0030496)				breast(1)|central_nervous_system(1)|large_intestine(1)|skin(1)|urinary_tract(1)	5	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;5.08e-05)|Epithelial(86;0.000197)|BRCA - Breast invasive adenocarcinoma(302;0.205)		GGGCAGGGGCGGGCACTGTAA	0.697																																					p.P241L		.											.	VPS37B-90	0			c.C722T						.	G	LEU/PRO	1,4327		0,1,2163	14.0	16.0	15.0		722	4.5	0.8	12		15	0,8450		0,0,4225	no	missense	VPS37B	NM_024667.2	98	0,1,6388	AA,AG,GG		0.0,0.0231,0.0078	probably-damaging	241/286	123351799	1,12777	2164	4225	6389	SO:0001583	missense	79720	exon4			AGGGGCGGGCACT	AK022812	CCDS9239.1	12q24.31	2008-02-05	2006-04-04		ENSG00000139722	ENSG00000139722			25754	protein-coding gene	gene with protein product		610037	"""vacuolar protein sorting 37B (yeast)"""			15218037	Standard	NM_024667		Approved	FLJ12750	uc001udl.3	Q9H9H4	OTTHUMG00000168767	ENST00000267202.2:c.722C>T	12.37:g.123351799G>A	ENSP00000267202:p.Pro241Leu	Somatic	62	1		WXS	Illumina GAIIx	Phase_I	73	45	NM_024667	0	0	3	21	18		Missense_Mutation	SNP	ENST00000267202.2	37	CCDS9239.1	.	.	.	.	.	.	.	.	.	.	G	17.39	3.377866	0.61735	2.31E-4	0.0	ENSG00000139722	ENST00000267202;ENST00000535765	T;T	0.61627	0.09;0.22	5.36	4.47	0.54385	.	0.000000	0.85682	D	0.000000	T	0.55481	0.1923	M	0.74881	2.28	0.80722	D	1	B	0.34255	0.445	B	0.25291	0.059	T	0.61397	-0.7071	10	0.72032	D	0.01	-20.8234	14.0046	0.64456	0.0729:0.0:0.9271:0.0	.	241	Q9H9H4	VP37B_HUMAN	L	241;239	ENSP00000267202:P241L;ENSP00000446075:P239L	ENSP00000267202:P241L	P	-	2	0	VPS37B	121917752	1.000000	0.71417	0.801000	0.32222	0.045000	0.14185	5.331000	0.65905	1.263000	0.44181	-0.136000	0.14681	CCG	.		0.697	VPS37B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400946.1	NM_024667	
RNF17	56163	bcgsc.ca	37	13	25367282	25367282	+	Missense_Mutation	SNP	A	A	C	rs1451568	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr13:25367282A>C	ENST00000255324.5	+	10	1090	c.1038A>C	c.(1036-1038)aaA>aaC	p.K346N	RNF17_ENST00000381921.1_Missense_Mutation_p.K346N|RNF17_ENST00000255325.6_Missense_Mutation_p.K346N|RNF17_ENST00000255326.4_3'UTR	NM_001184993.1|NM_031277.2	NP_001171922.1|NP_112567.2	Q9BXT8	RNF17_HUMAN	ring finger protein 17	346			K -> N (in dbSNP:rs1451568).		multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(15)|ovary(1)|prostate(3)|skin(6)	36		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		TAGAAAAGAAAAAGGTTGACA	0.373													A|||	788	0.157348	0.3411	0.1225	5008	,	,		20747	0.001		0.163	False		,,,				2504	0.089				p.K346N		.											.	RNF17-228	0			c.A1038C						.	A	ASN/LYS,ASN/LYS	1432,2974	465.9+/-354.3	219,994,990	175.0	165.0	168.0		1038,1038	-0.1	0.1	13	dbSNP_88	168	1368,7232	266.5+/-286.8	99,1170,3031	yes	missense,missense	RNF17	NM_001184993.1,NM_031277.2	94,94	318,2164,4021	CC,CA,AA		15.907,32.5011,21.5285	benign,benign	346/1620,346/1624	25367282	2800,10206	2203	4300	6503	SO:0001583	missense	56163	exon10			AAAGAAAAAGGTT	AF285602, AK001907	CCDS9308.2	13q12.13	2013-01-23			ENSG00000132972	ENSG00000132972		"""RING-type (C3HC4) zinc fingers"", ""Tudor domain containing"""	10060	protein-coding gene	gene with protein product	"""spermatogenesis associated 23"""	605793	"""tudor domain containing 4"""	TDRD4		11279525	Standard	NM_001184993		Approved	Mmip-2, SPATA23, FLJ11045	uc001upr.3	Q9BXT8	OTTHUMG00000016589	ENST00000255324.5:c.1038A>C	13.37:g.25367282A>C	ENSP00000255324:p.Lys346Asn	Somatic	123	0		WXS	Illumina GAIIx	Phase_I	105	5	NM_001184993	0	0	0	0	0	Q5T2J9|Q6P1W3|Q9BXT7|Q9NUY9	Missense_Mutation	SNP	ENST00000255324.5	37	CCDS9308.2	329	0.15064102564102563	162	0.32926829268292684	41	0.1132596685082873	0	0.0	126	0.1662269129287599	A	2.686	-0.274285	0.05679	0.325011	0.15907	ENSG00000132972	ENST00000255324;ENST00000381921;ENST00000429047;ENST00000255325;ENST00000255326	T;T;T	0.19105	3.43;3.43;2.17	5.03	-0.125	0.13519	.	0.419347	0.22513	N	0.059069	T	0.00012	0.0000	N	0.19112	0.55	0.80722	P	0.0	B;B	0.30281	0.001;0.275	B;B	0.26202	0.002;0.067	T	0.46470	-0.9189	9	0.31617	T	0.26	-8.7255	0.835	0.01138	0.5005:0.1659:0.1736:0.16	rs1451568;rs52829203;rs61594290;rs1451568	346;346	Q9BXT8;Q9BXT8-2	RNF17_HUMAN;.	N	346;346;205;347;346	ENSP00000255324:K346N;ENSP00000371346:K346N;ENSP00000255325:K347N	ENSP00000255324:K346N	K	+	3	2	RNF17	24265282	0.371000	0.25056	0.084000	0.20598	0.007000	0.05969	0.331000	0.19733	0.416000	0.25844	-1.007000	0.02485	AAA	A|0.801;C|0.199		0.373	RNF17-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044217.1	NM_031994	
SLC7A1	6541	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	30088674	30088674	+	Silent	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr13:30088674C>T	ENST00000380752.5	-	13	2219	c.1833G>A	c.(1831-1833)gcG>gcA	p.A611A	SLC7A1_ENST00000473577.1_5'Flank	NM_003045.4	NP_003036.1	P30825	CTR1_HUMAN	solute carrier family 7 (cationic amino acid transporter, y+ system), member 1	611					amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	arginine transmembrane transporter activity (GO:0015181)			endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|prostate(1)|stomach(1)|urinary_tract(2)	24		Lung SC(185;0.0257)|Breast(139;0.238)		all cancers(112;0.0148)|OV - Ovarian serous cystadenocarcinoma(117;0.0554)|Epithelial(112;0.0875)|GBM - Glioblastoma multiforme(144;0.179)	L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)	CATCCAGGGACGCCTCCTCGC	0.662																																					p.A611A		.											.	SLC7A1-90	0			c.G1833A						.						56.0	44.0	48.0					13																	30088674		2203	4300	6503	SO:0001819	synonymous_variant	6541	exon13			CAGGGACGCCTCC	AF078107	CCDS9333.1	13q12.3	2013-05-22			ENSG00000139514	ENSG00000139514		"""Solute carriers"""	11057	protein-coding gene	gene with protein product	"""ecotropic retroviral receptor"", ""amino acid transporter, cationic 1"""	104615		ERR, ATRC1		1348489	Standard	NM_003045		Approved	CAT-1, HCAT1, REC1L	uc001uso.3	P30825	OTTHUMG00000016658	ENST00000380752.5:c.1833G>A	13.37:g.30088674C>T		Somatic	75	0		WXS	Illumina GAIIx	Phase_I	44	43	NM_003045	0	0	0	8	8	Q5JR50	Silent	SNP	ENST00000380752.5	37	CCDS9333.1																																																																																			.		0.662	SLC7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044337.2	NM_003045	
ARL11	115761	ucsc.edu;bcgsc.ca;mdanderson.org	37	13	50204724	50204724	+	Silent	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr13:50204724C>T	ENST00000282026.1	+	2	476	c.141C>T	c.(139-141)aaC>aaT	p.N47N	ARL11_ENST00000490932.1_Intron	NM_138450.5	NP_612459.1	Q969Q4	ARL11_HUMAN	ADP-ribosylation factor-like 11	47					hematopoietic progenitor cell differentiation (GO:0002244)|small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	GTP binding (GO:0005525)			kidney(1)|large_intestine(4)|ovary(1)	6		Lung NSC(96;2.1e-05)|Breast(56;0.00015)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.119)|Kidney(9;0.169)	GBM - Glioblastoma multiforme(99;1.67e-09)		TTGGTTTCAACGTGGAGCCTC	0.617																																					p.N47N		.											.	ARL11-90	0			c.C141T						.						57.0	57.0	57.0					13																	50204724		2203	4300	6503	SO:0001819	synonymous_variant	115761	exon2			TTTCAACGTGGAG	AF441378	CCDS9419.1	13q14.12	2014-05-09			ENSG00000152213	ENSG00000152213		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	24046	protein-coding gene	gene with protein product		609351				12477932	Standard	NM_138450		Approved	ARLTS1, FLJ33930	uc001vdf.2	Q969Q4	OTTHUMG00000016919	ENST00000282026.1:c.141C>T	13.37:g.50204724C>T		Somatic	201	2		WXS	Illumina GAIIx	Phase_I	163	139	NM_138450	0	0	0	4	4		Silent	SNP	ENST00000282026.1	37	CCDS9419.1																																																																																			.		0.617	ARL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044929.2	NM_138450	
SLC10A2	6555	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	13	103701788	103701788	+	Missense_Mutation	SNP	G	G	A	rs145541774		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr13:103701788G>A	ENST00000245312.3	-	5	1366	c.770C>T	c.(769-771)aCg>aTg	p.T257M		NM_000452.2	NP_000443	Q12908	NTCP2_HUMAN	solute carrier family 10 (sodium/bile acid cotransporter), member 2	257					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|microvillus (GO:0005902)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteasome complex (GO:0000502)	bile acid:sodium symporter activity (GO:0008508)	p.T257M(2)		breast(1)|endometrium(2)|large_intestine(6)|lung(16)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	all_neural(89;0.0662)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)				Aciclovir(DB00787)|Cyclosporine(DB00091)|Ursodeoxycholic acid(DB01586)|Valaciclovir(DB00577)	AAAAGCAACCGTTCGGCACCT	0.408													G|||	1	0.000199681	0.0	0.0014	5008	,	,		16304	0.0		0.0	False		,,,				2504	0.0				p.T257M		.											.	SLC10A2-94	2	Substitution - Missense(2)	urinary_tract(1)|large_intestine(1)	c.C770T						.	G	MET/THR	2,4404	4.2+/-10.8	0,2,2201	96.0	74.0	81.0		770	5.7	0.6	13	dbSNP_134	81	0,8600		0,0,4300	yes	missense	SLC10A2	NM_000452.2	81	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	probably-damaging	257/349	103701788	2,13004	2203	4300	6503	SO:0001583	missense	6555	exon5			GCAACCGTTCGGC	U10417	CCDS9506.1	13q33	2013-07-18	2013-07-18		ENSG00000125255	ENSG00000125255		"""Solute carriers"""	10906	protein-coding gene	gene with protein product		601295		ASBT, ISBT		8661017	Standard	NM_000452		Approved		uc001vpy.4	Q12908	OTTHUMG00000017313	ENST00000245312.3:c.770C>T	13.37:g.103701788G>A	ENSP00000245312:p.Thr257Met	Somatic	137	0		WXS	Illumina GAIIx	Phase_I	97	8	NM_000452	0	0	0	0	0	A1L4F4|Q13839	Missense_Mutation	SNP	ENST00000245312.3	37	CCDS9506.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	18.74	3.687681	0.68157	4.54E-4	0.0	ENSG00000125255	ENST00000245312	T	0.75938	-0.98	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	D	0.89842	0.6832	M	0.91663	3.23	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.91125	0.4933	10	0.87932	D	0	-15.9881	20.181	0.98201	0.0:0.0:1.0:0.0	.	257	Q12908	NTCP2_HUMAN	M	257	ENSP00000245312:T257M	ENSP00000245312:T257M	T	-	2	0	SLC10A2	102499789	1.000000	0.71417	0.563000	0.28383	0.118000	0.20060	9.804000	0.99143	2.840000	0.97914	0.655000	0.94253	ACG	G|1.000;A|0.000		0.408	SLC10A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045716.1		
ATP11A	23250	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	113516786	113516786	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr13:113516786G>A	ENST00000487903.1	+	25	2976	c.2888G>A	c.(2887-2889)cGc>cAc	p.R963H	ATP11A_ENST00000375630.2_Missense_Mutation_p.R963H|ATP11A_ENST00000375645.3_Missense_Mutation_p.R963H|ATP11A_ENST00000283558.8_Missense_Mutation_p.R963H			P98196	AT11A_HUMAN	ATPase, class VI, type 11A	963					phospholipid translocation (GO:0045332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.R963H(1)		NS(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(12)|lung(17)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	51	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.134)|all_epithelial(44;0.141)				CTGCGCTGGCGCGTGTTCATC	0.567																																					p.R963H		.											.	ATP11A-138	1	Substitution - Missense(1)	ovary(1)	c.G2888A						.						157.0	119.0	132.0					13																	113516786		2203	4300	6503	SO:0001583	missense	23250	exon25			GCTGGCGCGTGTT	AB028944	CCDS32011.1	13q34	2010-04-20	2007-09-19		ENSG00000068650	ENSG00000068650	3.6.3.1	"""ATPases / P-type"""	13552	protein-coding gene	gene with protein product	"""potential phospholipid-transporting ATPase IH"", ""phospholipid-translocating ATPase"""	605868	"""ATPase, Class VI, type 11A"""			11015572	Standard	NM_032189		Approved	ATPIH, ATPIS, KIAA1021	uc001vsj.4	P98196	OTTHUMG00000017371	ENST00000487903.1:c.2888G>A	13.37:g.113516786G>A	ENSP00000420387:p.Arg963His	Somatic	161	1		WXS	Illumina GAIIx	Phase_I	106	100	NM_032189	0	0	0	3	3	Q5VXT2	Missense_Mutation	SNP	ENST00000487903.1	37	CCDS32011.1	.	.	.	.	.	.	.	.	.	.	G	16.47	3.131012	0.56828	.	.	ENSG00000068650	ENST00000487903;ENST00000375630;ENST00000375645;ENST00000283558	T;T;T;T	0.40476	1.03;1.03;1.03;1.03	5.21	5.21	0.72293	.	0.057810	0.64402	D	0.000001	T	0.53384	0.1793	M	0.66939	2.045	0.46654	D	0.999142	D;P	0.53745	0.962;0.932	B;P	0.49361	0.416;0.608	T	0.56456	-0.7976	10	0.48119	T	0.1	.	18.774	0.91902	0.0:0.0:1.0:0.0	.	963;963	E9PEJ6;P98196	.;AT11A_HUMAN	H	963	ENSP00000420387:R963H;ENSP00000364781:R963H;ENSP00000364796:R963H;ENSP00000283558:R963H	ENSP00000283558:R963H	R	+	2	0	ATP11A	112564787	1.000000	0.71417	0.952000	0.39060	0.114000	0.19823	5.365000	0.66116	2.415000	0.81967	0.561000	0.74099	CGC	.		0.567	ATP11A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000045834.3	NM_015205	
CHD8	57680	ucsc.edu	37	14	21859130	21859130	+	Silent	SNP	T	T	C			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr14:21859130T>C	ENST00000557364.1	-	37	7421	c.7158A>G	c.(7156-7158)acA>acG	p.T2386T	CHD8_ENST00000399982.2_Silent_p.T2386T|CHD8_ENST00000430710.3_Silent_p.T2107T|SNORD9_ENST00000362566.1_RNA			Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	2386					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|canonical Wnt signaling pathway (GO:0060070)|DNA duplex unwinding (GO:0032508)|in utero embryonic development (GO:0001701)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	MLL1 complex (GO:0071339)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|beta-catenin binding (GO:0008013)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)			NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(33)|ovary(6)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	85	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		TAGAGTTAGCTGTCTGTACTG	0.373																																					p.T2386T		.											.	CHD8-277	0			c.A7158G						.						121.0	109.0	113.0					14																	21859130		1849	4105	5954	SO:0001819	synonymous_variant	57680	exon36			GTTAGCTGTCTGT	AB046784	CCDS45081.1, CCDS53885.1	14q11.2	2008-02-05	2004-06-22	2004-06-23		ENSG00000100888			20153	protein-coding gene	gene with protein product		610528	"""helicase with SNF2 domain 1"""	HELSNF1		10997877	Standard	NM_020920		Approved	KIAA1564, DUPLIN	uc001war.2	Q9HCK8		ENST00000557364.1:c.7158A>G	14.37:g.21859130T>C		Somatic	93	0		WXS	Illumina GAIIx	Phase_I	38	4	NM_001170629	0	0	36	36	0	Q4G0D8|Q68DQ0|Q6DKH9|Q6P440|Q6ZNL7|Q8N3Z9|Q8NCY4|Q8TBR9|Q96F26	Silent	SNP	ENST00000557364.1	37	CCDS53885.1																																																																																			.		0.373	CHD8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410436.1	NM_020920	
IRF9	10379	hgsc.bcm.edu;bcgsc.ca	37	14	24631381	24631381	+	Nonsense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr14:24631381C>T	ENST00000396864.3	+	2	315	c.28C>T	c.(28-30)Cga>Tga	p.R10*	IRF9_ENST00000557894.1_Intron|RP11-468E2.4_ENST00000558468.1_3'UTR	NM_006084.4	NP_006075.3	Q00978	IRF9_HUMAN	interferon regulatory factor 9	10					cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|transcription from RNA polymerase II promoter (GO:0006366)|type I interferon biosynthetic process (GO:0045351)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|kidney(3)|large_intestine(3)|lung(4)|ovary(1)|skin(2)	16				GBM - Glioblastoma multiforme(265;0.00853)		ACGCTGCACCCGAAAACTCCG	0.567																																					p.R10X		.											.	IRF9-69	0			c.C28T						.						109.0	104.0	106.0					14																	24631381		2203	4300	6503	SO:0001587	stop_gained	10379	exon2			TGCACCCGAAAAC	M87503	CCDS9615.1	14q11.2	2007-07-06	2007-07-06	2007-07-06	ENSG00000213928	ENSG00000213928			6131	protein-coding gene	gene with protein product		147574	"""interferon-stimulated transcription factor 3, gamma (48kD)"", ""interferon-stimulated transcription factor 3, gamma 48kDa"""	ISGF3G		1630447, 10199920	Standard	NM_006084		Approved		uc001wmq.3	Q00978	OTTHUMG00000028799	ENST00000396864.3:c.28C>T	14.37:g.24631381C>T	ENSP00000380073:p.Arg10*	Somatic	267	2		WXS	Illumina GAIIx	Phase_I	167	151	NM_006084	0	0	0	24	24	D3DS61	Nonsense_Mutation	SNP	ENST00000396864.3	37	CCDS9615.1	.	.	.	.	.	.	.	.	.	.	C	37	6.321256	0.97471	.	.	ENSG00000213928	ENST00000396864	.	.	.	5.12	4.22	0.49857	.	0.000000	0.64402	U	0.000017	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06757	T	0.87	-8.0552	9.8469	0.41032	0.1577:0.6901:0.1521:0.0	.	.	.	.	X	10	.	ENSP00000380073:R10X	R	+	1	2	IRF9	23701221	0.777000	0.28628	1.000000	0.80357	0.887000	0.51463	1.721000	0.38032	1.377000	0.46286	0.655000	0.94253	CGA	.		0.567	IRF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071927.2		
RPL10L	140801	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	14	47120739	47120739	+	Silent	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr14:47120739G>A	ENST00000298283.3	-	1	289	c.201C>T	c.(199-201)gcC>gcT	p.A67A		NM_080746.2	NP_542784.1	Q96L21	RL10L_HUMAN	ribosomal protein L10-like	67					spermatogenesis (GO:0007283)|translation (GO:0006412)	cytosolic large ribosomal subunit (GO:0022625)|membrane (GO:0016020)|nucleus (GO:0005634)|polysome (GO:0005844)	structural constituent of ribosome (GO:0003735)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(20)|ovary(1)	27						AAATACGGGCGGCCTCCAGGG	0.512																																					p.A67A		.											.	RPL10L-91	0			c.C201T						.						67.0	70.0	69.0					14																	47120739		2203	4300	6503	SO:0001819	synonymous_variant	140801	exon1			ACGGGCGGCCTCC	AB063608	CCDS32071.1	14q21.2	2011-09-15			ENSG00000165496	ENSG00000165496		"""L ribosomal proteins"""	17976	protein-coding gene	gene with protein product						19123937	Standard	NM_080746		Approved		uc001wwg.3	Q96L21	OTTHUMG00000157869	ENST00000298283.3:c.201C>T	14.37:g.47120739G>A		Somatic	126	1		WXS	Illumina GAIIx	Phase_I	93	78	NM_080746	0	0	0	0	0	Q8IUD1	Silent	SNP	ENST00000298283.3	37	CCDS32071.1																																																																																			.		0.512	RPL10L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349819.1		
NID2	22795	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	52478319	52478319	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr14:52478319C>T	ENST00000216286.5	-	17	3502	c.3503G>A	c.(3502-3504)cGt>cAt	p.R1168H	NID2_ENST00000541773.1_Missense_Mutation_p.R1067H	NM_007361.3	NP_031387.3	Q14112	NID2_HUMAN	nidogen 2 (osteonidogen)	1168					basement membrane organization (GO:0071711)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|cell surface (GO:0009986)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)			NS(1)|breast(5)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(40)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	87	Breast(41;0.0639)|all_epithelial(31;0.123)					CAGACCAGCACGGCTGATTGT	0.493																																					p.R1168H		.											.	NID2-158	0			c.G3503A						.						153.0	125.0	134.0					14																	52478319		2203	4300	6503	SO:0001583	missense	22795	exon17			CCAGCACGGCTGA	AB009799	CCDS9706.1	14q22.1	2008-05-14			ENSG00000087303	ENSG00000087303			13389	protein-coding gene	gene with protein product		605399				9733643	Standard	NM_007361		Approved		uc001wzo.3	Q14112	OTTHUMG00000140298	ENST00000216286.5:c.3503G>A	14.37:g.52478319C>T	ENSP00000216286:p.Arg1168His	Somatic	110	0		WXS	Illumina GAIIx	Phase_I	89	70	NM_007361	0	0	2	2	0	A8K6I7|B4DU19|O43710	Missense_Mutation	SNP	ENST00000216286.5	37	CCDS9706.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.383098	0.82792	.	.	ENSG00000087303	ENST00000216286;ENST00000316204;ENST00000541773	T;T	0.34667	1.35;1.35	5.92	5.92	0.95590	Six-bladed beta-propeller, TolB-like (1);	0.093016	0.64402	D	0.000001	T	0.73361	0.3577	H	0.95043	3.615	0.44619	D	0.997598	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.987;0.997;0.993	T	0.79393	-0.1822	10	0.52906	T	0.07	.	19.9157	0.97061	0.0:1.0:0.0:0.0	.	762;1067;1168	E7EPP3;Q14112-2;Q14112	.;.;NID2_HUMAN	H	1168;762;1067	ENSP00000216286:R1168H;ENSP00000443730:R1067H	ENSP00000216286:R1168H	R	-	2	0	NID2	51548069	1.000000	0.71417	0.939000	0.37840	0.145000	0.21501	6.022000	0.70839	2.809000	0.96659	0.655000	0.94253	CGT	.		0.493	NID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276888.1		
DACT1	51339	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	59113818	59113818	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr14:59113818G>A	ENST00000335867.4	+	4	2501	c.2477G>A	c.(2476-2478)cGg>cAg	p.R826Q	DACT1_ENST00000541264.2_Missense_Mutation_p.R545Q|DACT1_ENST00000556859.1_Missense_Mutation_p.R545Q|DACT1_ENST00000395153.3_Missense_Mutation_p.R789Q			Q9NYF0	DACT1_HUMAN	dishevelled-binding antagonist of beta-catenin 1	826					dendrite morphogenesis (GO:0048813)|embryonic hindgut morphogenesis (GO:0048619)|gastrulation with mouth forming second (GO:0001702)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of catenin import into nucleus (GO:0035412)|regulation of protein stability (GO:0031647)|regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000095)|synapse organization (GO:0050808)|Wnt signaling pathway (GO:0016055)	beta-catenin destruction complex (GO:0030877)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|synapse (GO:0045202)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|protein kinase A binding (GO:0051018)|protein kinase C binding (GO:0005080)			endometrium(7)|kidney(3)|large_intestine(11)|lung(27)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	53						CTCCGCTTTCGGTCTGGCTCT	0.423																																					p.R826Q		.											.	DACT1-291	0			c.G2477A						.						113.0	117.0	115.0					14																	59113818		2203	4300	6503	SO:0001583	missense	51339	exon4			GCTTTCGGTCTGG	AF251079	CCDS9736.1, CCDS41961.1	14q22.3	2013-05-15	2013-05-15		ENSG00000165617	ENSG00000165617			17748	protein-coding gene	gene with protein product		607861	"""dapper homolog 1, antagonist of beta-catenin (xenopus)"", ""dapper, antagonist of beta-catenin, homolog 1 (Xenopus laevis)"""			11970895	Standard	NM_001079520		Approved	DAPPER1, THYEX3, HDPR1, DAPPER, FRODO	uc001xdw.3	Q9NYF0	OTTHUMG00000140324	ENST00000335867.4:c.2477G>A	14.37:g.59113818G>A	ENSP00000337439:p.Arg826Gln	Somatic	57	0		WXS	Illumina GAIIx	Phase_I	50	46	NM_016651	0	0	0	0	0	A8MYJ2|Q86TY0	Missense_Mutation	SNP	ENST00000335867.4	37	CCDS9736.1	.	.	.	.	.	.	.	.	.	.	G	15.07	2.725107	0.48833	.	.	ENSG00000165617	ENST00000556859;ENST00000395151;ENST00000395153;ENST00000335867;ENST00000541264	T;T;T;T;T	0.46063	0.88;0.88;0.88;0.88;0.88	5.96	5.96	0.96718	.	0.000000	0.64402	D	0.000001	T	0.55561	0.1928	L	0.35644	1.08	0.47214	D	0.999355	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	T	0.35773	-0.9775	10	0.15066	T	0.55	-19.7697	20.422	0.99049	0.0:0.0:1.0:0.0	.	789;826	A8MYJ2;Q9NYF0	.;DACT1_HUMAN	Q	545;545;789;826;545	ENSP00000451598:R545Q;ENSP00000378581:R545Q;ENSP00000378582:R789Q;ENSP00000337439:R826Q;ENSP00000442850:R545Q	ENSP00000337439:R826Q	R	+	2	0	DACT1	58183571	0.997000	0.39634	0.731000	0.30826	0.919000	0.55068	3.763000	0.55257	2.832000	0.97577	0.655000	0.94253	CGG	.		0.423	DACT1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325515.1	NM_016651	
CCDC175	729665	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	59970693	59970693	+	IGR	SNP	T	T	C			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr14:59970693T>C	ENST00000537690.2	-	0	2616				JKAMP_ENST00000356057.5_Missense_Mutation_p.L288P|RP11-701B16.2_ENST00000554253.1_RNA|JKAMP_ENST00000261247.9_Missense_Mutation_p.L280P|JKAMP_ENST00000425728.2_Missense_Mutation_p.L274P|JKAMP_ENST00000554271.1_Missense_Mutation_p.L294P	NM_001164399.1	NP_001157871.1	P0C221	CC175_HUMAN	coiled-coil domain containing 175																		GATTTGCCCCTTTTGGCTTTG	0.418																																					p.L280P		.											.	JKAMP-67	0			c.T839C						.						135.0	127.0	130.0					14																	59970693		1833	4081	5914	SO:0001628	intergenic_variant	51528	exon7			TGCCCCTTTTGGC		CCDS53898.1	14q23.1	2012-09-24	2012-09-24	2012-09-24	ENSG00000151838	ENSG00000151838			19847	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 38"""	C14orf38			Standard	NM_001164399		Approved		uc021rtw.1	P0C221			14.37:g.59970693T>C		Somatic	129	0		WXS	Illumina GAIIx	Phase_I	108	8	NM_016475	0	0	50	50	0	G3V5J7	Missense_Mutation	SNP	ENST00000537690.2	37	CCDS53898.1	.	.	.	.	.	.	.	.	.	.	T	25.3	4.624848	0.87560	.	.	ENSG00000050130	ENST00000261247;ENST00000425728;ENST00000554271;ENST00000356057	.	.	.	5.84	5.84	0.93424	.	0.062520	0.64402	D	0.000003	T	0.79064	0.4383	M	0.73962	2.25	0.80722	D	1	D;D;D;D;D	0.76494	0.999;0.998;0.998;0.998;0.998	D;D;D;D;D	0.74348	0.983;0.971;0.971;0.971;0.971	T	0.81593	-0.0862	9	0.87932	D	0	-12.0357	16.2167	0.82231	0.0:0.0:0.0:1.0	.	295;294;274;288;280	Q9P055;G3V2M4;Q9P055-3;Q9P055-5;Q9P055-4	JKAMP_HUMAN;.;.;.;.	P	280;274;294;288	.	ENSP00000261247:L280P	L	+	2	0	JKAMP	59040446	1.000000	0.71417	0.967000	0.41034	0.968000	0.65278	7.912000	0.87465	2.231000	0.72958	0.533000	0.62120	CTT	.		0.418	CCDC175-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000471273.1	NM_001164399	
NUMB	8650	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	14	73743997	73743997	+	Silent	SNP	G	G	A	rs578172055	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr14:73743997G>A	ENST00000355058.3	-	13	1523	c.1245C>T	c.(1243-1245)acC>acT	p.T415T	NUMB_ENST00000359560.3_Silent_p.T404T|NUMB_ENST00000454166.4_Silent_p.T269T|NUMB_ENST00000555394.1_Silent_p.T367T|NUMB_ENST00000555738.2_Silent_p.T258T|NUMB_ENST00000544991.3_Silent_p.T220T|NUMB_ENST00000554546.1_Silent_p.T356T|NUMB_ENST00000560335.1_Silent_p.T269T|NUMB_ENST00000555238.1_Silent_p.T415T|NUMB_ENST00000356296.4_Silent_p.T367T|NUMB_ENST00000554521.2_Silent_p.T209T|NUMB_ENST00000557597.1_Silent_p.T404T|NUMB_ENST00000559312.1_Silent_p.T220T|NUMB_ENST00000535282.1_Silent_p.T404T|NUMB_ENST00000556772.1_Silent_p.T271T			P49757	NUMB_HUMAN	numb homolog (Drosophila)	415					adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|lateral ventricle development (GO:0021670)|lung epithelial cell differentiation (GO:0060487)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of protein localization to plasma membrane (GO:1903077)|neuroblast division in subventricular zone (GO:0021849)|Notch signaling pathway (GO:0007219)|positive regulation of cell migration (GO:0030335)|positive regulation of neurogenesis (GO:0050769)|positive regulation of polarized epithelial cell differentiation (GO:0030862)	apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|clathrin-coated vesicle (GO:0030136)|early endosome (GO:0005769)|extrinsic component of plasma membrane (GO:0019897)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(3)|prostate(1)|skin(3)|urinary_tract(1)	28				BRCA - Breast invasive adenocarcinoma(234;0.00471)|OV - Ovarian serous cystadenocarcinoma(108;0.161)		GACCCCACTCGGTCCCTGGAA	0.483													G|||	2	0.000399361	0.0	0.0014	5008	,	,		19826	0.0		0.0	False		,,,				2504	0.001				p.T415T		.											.	NUMB-1062	0			c.C1245T						.						15.0	15.0	15.0					14																	73743997		2172	4238	6410	SO:0001819	synonymous_variant	8650	exon13			CCACTCGGTCCCT	L40393	CCDS9814.1, CCDS32115.1, CCDS32116.1, CCDS55927.1	14q24.3	2011-11-25	2001-11-28			ENSG00000133961			8060	protein-coding gene	gene with protein product		603728	"""numb (Drosophila) homolog"", ""chromosome 14 open reading frame 41"""	C14orf41			Standard	NM_003744		Approved		uc001xny.1	P49757		ENST00000355058.3:c.1245C>T	14.37:g.73743997G>A		Somatic	82	0		WXS	Illumina GAIIx	Phase_I	48	34	NM_001005743	0	0	0	0	0	B1P2N5|B1P2N6|B1P2N7|B1P2N8|B1P2N9|B4E2B1|Q6NUQ7|Q86SY1|Q8WW73|Q9UBG1|Q9UEQ4|Q9UKE8|Q9UKE9|Q9UKF0|Q9UQJ4	Silent	SNP	ENST00000355058.3	37	CCDS32116.1																																																																																			.		0.483	NUMB-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000414416.1		
CCDC88C	440193	broad.mit.edu	37	14	91883084	91883084	+	Silent	SNP	T	T	C			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr14:91883084T>C	ENST00000389857.6	-	2	245	c.159A>G	c.(157-159)caA>caG	p.Q53Q	CCDC88C_ENST00000389856.5_Silent_p.Q45Q|RP11-895M11.3_ENST00000557524.1_lincRNA|CCDC88C_ENST00000553403.1_Silent_p.Q53Q|CCDC88C_ENST00000554165.1_5'UTR	NM_001080414.3	NP_001073883.2	Q9P219	DAPLE_HUMAN	coiled-coil domain containing 88C	53					protein destabilization (GO:0031648)|protein homooligomerization (GO:0051260)|regulation of protein phosphorylation (GO:0001932)|Wnt signaling pathway (GO:0016055)		PDZ domain binding (GO:0030165)|protein self-association (GO:0043621)			central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(6)|pancreas(1)|urinary_tract(1)	24		all_cancers(154;0.0468)				TAACTTACATTTGCAGCATAA	0.468																																					p.Q53Q		.											.	CCDC88C-25	0			c.A159G						.						52.0	49.0	50.0					14																	91883084		1912	4127	6039	SO:0001819	synonymous_variant	440193	exon2			TTACATTTGCAGC		CCDS45151.1	14q32.12	2014-07-30	2007-05-31	2007-05-31		ENSG00000015133			19967	protein-coding gene	gene with protein product	"""Dvl-associating protein with a high frequency of leucine residues"", ""spinocerebellar ataxia 40"""	611204	"""KIAA1509"""	KIAA1509		17185515, 25062847	Standard	NM_001080414		Approved	DAPLE, HkRP2, SCA40	uc010aty.3	Q9P219		ENST00000389857.6:c.159A>G	14.37:g.91883084T>C		Somatic	161	0		WXS	Illumina GAIIx	Phase_I	100	4	NM_001080414	0	0	0	0	0	Q69YK1|Q7L1M2|Q86SX7|Q8IYG8	Silent	SNP	ENST00000389857.6	37	CCDS45151.1																																																																																			.		0.468	CCDC88C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411650.1	XM_029353	
AHNAK2	113146	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	105416412	105416412	+	Silent	SNP	G	G	A	rs187143773	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr14:105416412G>A	ENST00000333244.5	-	7	5495	c.5376C>T	c.(5374-5376)gaC>gaT	p.D1792D	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	1792						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GAGCCTCGACGTCCACCTCCA	0.632													.|||	1	0.000199681	0.0008	0.0	5008	,	,		15613	0.0		0.0	False		,,,				2504	0.0				p.D1792D		.											.	AHNAK2-47	0			c.C5376T						.	G		1,3959		0,1,1979	119.0	141.0	134.0		5376	1.0	0.0	14		134	2,8256		1,0,4128	no	coding-synonymous	AHNAK2	NM_138420.2		1,1,6107	AA,AG,GG		0.0242,0.0253,0.0246		1792/5796	105416412	3,12215	1980	4129	6109	SO:0001819	synonymous_variant	113146	exon7			CTCGACGTCCACC	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.5376C>T	14.37:g.105416412G>A		Somatic	240	3		WXS	Illumina GAIIx	Phase_I	186	161	NM_138420	0	0	0	1	1	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Silent	SNP	ENST00000333244.5	37	CCDS45177.1																																																																																			G|0.999;A|0.001		0.632	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
HERC2P3	283755	ucsc.edu	37	15	20644830	20644830	+	RNA	SNP	T	T	C	rs28718154		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr15:20644830T>C	ENST00000428453.1	-	0	3117							Q9BVR0	HRC23_HUMAN	hect domain and RLD 2 pseudogene 3								metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)	p.M810V(1)		central_nervous_system(1)|endometrium(11)|kidney(2)|large_intestine(1)|lung(14)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	35						AGCTTCTCCATGAGGCATTTC	0.498																																					.		.											.	HERC2P3-92	1	Substitution - Missense(1)	prostate(1)	.						.																																					283755	.			TCTCCATGAGGCA	AF041081		15q11.2	2010-08-02			ENSG00000180229	ENSG00000180229			4871	pseudogene	pseudogene						9730612	Standard	NR_036432		Approved	D15F37S4, LOC283755	uc001ytg.3	Q9BVR0	OTTHUMG00000157175		15.37:g.20644830T>C		Somatic	253	45		WXS	Illumina GAIIx	Phase_I	151	66	.	0	0	8	13	5		RNA	SNP	ENST00000428453.1	37																																																																																				.		0.498	HERC2P3-014	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000347772.2	NG_008269	
CYFIP1	23191	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	22940826	22940826	+	Missense_Mutation	SNP	C	C	T	rs569768747		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr15:22940826C>T	ENST00000313077.7	+	11	1216	c.1091C>T	c.(1090-1092)gCg>gTg	p.A364V	CYFIP1_ENST00000560848.1_Missense_Mutation_p.A364V	NM_014608.2	NP_055423.1			cytoplasmic FMR1 interacting protein 1											endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|liver(1)|lung(14)|ovary(4)|pancreas(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	40		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.22e-06)|Epithelial(43;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00101)		TCGGAGCTGGCGCGCTACAGC	0.592													C|||	1	0.000199681	0.0	0.0	5008	,	,		19752	0.0		0.001	False		,,,				2504	0.0				p.A364V		.											.	CYFIP1-99	0			c.C1091T						.						48.0	38.0	41.0					15																	22940826		2203	4300	6503	SO:0001583	missense	23191	exon11			AGCTGGCGCGCTA	D38549	CCDS73695.1, CCDS73696.1	15q11	2008-07-18			ENSG00000068793	ENSG00000273749			13759	protein-coding gene	gene with protein product	"""selective hybridizing clone"", ""cytoplasmic FMRP interacting protein 1"""	606322				11438699	Standard	XM_005272543		Approved	KIAA0068, P140SRA-1, SHYC	uc001yus.3	Q7L576	OTTHUMG00000129100	ENST00000313077.7:c.1091C>T	15.37:g.22940826C>T	ENSP00000324549:p.Ala364Val	Somatic	249	1		WXS	Illumina GAIIx	Phase_I	150	133	NM_014608	0	0	1	11	10		Missense_Mutation	SNP	ENST00000313077.7	37	CCDS10009.1	.	.	.	.	.	.	.	.	.	.	C	34	5.379668	0.95945	.	.	ENSG00000068793	ENST00000313077;ENST00000412127	T	0.24151	1.87	5.63	5.63	0.86233	.	0.000000	0.64402	D	0.000001	T	0.52853	0.1760	M	0.72118	2.19	0.80722	D	1	D;D	0.89917	1.0;0.999	D;P	0.71184	0.972;0.907	T	0.53865	-0.8378	10	0.87932	D	0	-21.9199	19.6873	0.95984	0.0:1.0:0.0:0.0	.	392;364	E7EQ04;Q7L576	.;CYFP1_HUMAN	V	364;392	ENSP00000324549:A364V	ENSP00000324549:A364V	A	+	2	0	CYFIP1	20492267	1.000000	0.71417	0.962000	0.40283	0.894000	0.52154	7.626000	0.83164	2.664000	0.90586	0.591000	0.81541	GCG	.		0.592	CYFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251136.2	NM_014608	
PGBD4	161779	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	34396376	34396376	+	Silent	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr15:34396376C>T	ENST00000397766.2	+	1	2103	c.1644C>T	c.(1642-1644)taC>taT	p.Y548Y	EMC7_ENST00000532113.1_5'Flank|EMC7_ENST00000256545.4_5'Flank	NM_152595.4	NP_689808.2	Q96DM1	PGBD4_HUMAN	piggyBac transposable element derived 4	548										breast(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|pancreas(1)|prostate(1)	16		all_lung(180;1.76e-08)		all cancers(64;1.22e-17)|GBM - Glioblastoma multiforme(113;1.78e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0242)		GCTCCCAATACGACAAGGATG	0.478																																					p.Y548Y		.											.	PGBD4-90	0			c.C1644T						.						116.0	97.0	104.0					15																	34396376		2201	4298	6499	SO:0001819	synonymous_variant	161779	exon1			CCAATACGACAAG	AK057200	CCDS10033.1	15q13.1	2002-10-25			ENSG00000182405	ENSG00000182405			19401	protein-coding gene	gene with protein product							Standard	NM_152595		Approved	FLJ32638, FLJ37497	uc001zho.3	Q96DM1	OTTHUMG00000129370	ENST00000397766.2:c.1644C>T	15.37:g.34396376C>T		Somatic	94	0		WXS	Illumina GAIIx	Phase_I	51	46	NM_152595	0	0	0	2	2	A1L487|A8K0C6|Q8N9E8	Silent	SNP	ENST00000397766.2	37	CCDS10033.1																																																																																			.		0.478	PGBD4-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000251522.1		
DUOX2	50506	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	45394110	45394110	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr15:45394110G>A	ENST00000603300.1	-	21	2934	c.2732C>T	c.(2731-2733)tCg>tTg	p.S911L	DUOX2_ENST00000389039.6_Missense_Mutation_p.S911L	NM_014080.4	NP_054799.4	Q9NRD8	DUOX2_HUMAN	dual oxidase 2	911	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.				adenohypophysis morphogenesis (GO:0048855)|bone mineralization (GO:0030282)|cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|fertilization (GO:0009566)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|inner ear development (GO:0048839)|multicellular organism growth (GO:0035264)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|response to virus (GO:0009615)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|peroxidase activity (GO:0004601)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(7)|urinary_tract(1)	63		all_cancers(109;3.79e-11)|all_epithelial(112;2.92e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.05e-18)|GBM - Glioblastoma multiforme(94;4.23e-07)|COAD - Colon adenocarcinoma(120;0.0668)|Colorectal(133;0.068)		CTGGAATCCCGACTCCCGGAA	0.572																																					p.S911L		.											.	DUOX2-95	0			c.C2732T						.						105.0	90.0	95.0					15																	45394110		2198	4298	6496	SO:0001583	missense	50506	exon21			AATCCCGACTCCC	AF181972	CCDS10117.1	15q15.3-q21	2013-01-10			ENSG00000140279	ENSG00000140279		"""EF-hand domain containing"""	13273	protein-coding gene	gene with protein product	"""dual oxidase-like domains 2"", ""nicotinamide adenine dinucleotide phosphate oxidase"", ""flavoprotein NADPH oxidase"", ""NADPH thyroid oxidase 2"", ""NADH/NADPH thyroid oxidase p138-tox"", ""NADPH oxidase/peroxidase DUOX2"""	606759				10601291, 10806195	Standard	NM_014080		Approved	P138-TOX, P138(TOX), THOX2, LNOX2	uc010bea.3	Q9NRD8	OTTHUMG00000131355	ENST00000603300.1:c.2732C>T	15.37:g.45394110G>A	ENSP00000475084:p.Ser911Leu	Somatic	305	0		WXS	Illumina GAIIx	Phase_I	192	168	NM_014080	0	0	0	0	0	A8MQ13|D2XI64|Q9NR02|Q9UHF9	Missense_Mutation	SNP	ENST00000603300.1	37	CCDS10117.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.362798	0.82353	.	.	ENSG00000140279	ENST00000389039	.	.	.	5.84	5.84	0.93424	EF-hand-like domain (1);	0.167182	0.52532	D	0.000069	T	0.43433	0.1247	L	0.36672	1.1	0.54753	D	0.999987	P;P	0.42518	0.531;0.782	B;B	0.32928	0.075;0.155	T	0.47368	-0.9123	9	0.54805	T	0.06	-2.7159	19.1261	0.93384	0.0:0.0:1.0:0.0	.	911;473	Q9NRD8;Q59GU9	DUOX2_HUMAN;.	L	911	.	ENSP00000373691:S911L	S	-	2	0	DUOX2	43181402	1.000000	0.71417	0.972000	0.41901	0.958000	0.62258	9.476000	0.97823	2.779000	0.95612	0.655000	0.94253	TCG	.		0.572	DUOX2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_014080	
TLN2	83660	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	63063254	63063289	+	In_Frame_Del	DEL	TGCTGGACCAGACCAAGACTCTCGCAGAGTCTGCCT	TGCTGGACCAGACCAAGACTCTCGCAGAGTCTGCCT	-	rs150770826|rs200255870	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	TGCTGGACCAGACCAAGACTCTCGCAGAGTCTGCCT	TGCTGGACCAGACCAAGACTCTCGCAGAGTCTGCCT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr15:63063254_63063289delTGCTGGACCAGACCAAGACTCTCGCAGAGTCTGCCT	ENST00000561311.1	+	41	5518_5553	c.5288_5323delTGCTGGACCAGACCAAGACTCTCGCAGAGTCTGCCT	c.(5287-5325)gtgctggaccagaccaagactctcgcagagtctgccttg>gtg	p.LDQTKTLAESAL1764del	TLN2_ENST00000306829.6_In_Frame_Del_p.LDQTKTLAESAL1764del|TLN2_ENST00000472902.1_In_Frame_Del_p.LDQTKTLAESAL157del			Q9Y4G6	TLN2_HUMAN	talin 2	1764					cell adhesion (GO:0007155)|cell-cell junction assembly (GO:0007043)|cytoskeletal anchoring at plasma membrane (GO:0007016)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.L1770L(1)		NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99						CAGATGACGGTGCTGGACCAGACCAAGACTCTCGCAGAGTCTGCCTTGCAGATGTT	0.504																																					p.1763_1775del		.											.	TLN2-573	1	Substitution - coding silent(1)	large_intestine(1)	c.5288_5323del						.																																			SO:0001651	inframe_deletion	83660	exon39			TGACGGTGCTGGA	AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914			15447	protein-coding gene	gene with protein product		607349				9205841, 11527381	Standard	NM_015059		Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.5288_5323delTGCTGGACCAGACCAAGACTCTCGCAGAGTCTGCCT	15.37:g.63063254_63063289delTGCTGGACCAGACCAAGACTCTCGCAGAGTCTGCCT	ENSP00000453508:p.Leu1764_Leu1775del	Somatic	143	0		WXS	Illumina GAIIx	Phase_I	69	27	NM_015059	0	0	0	0	0	A6NLB8	In_Frame_Del	DEL	ENST00000561311.1	37	CCDS32261.1																																																																																			.		0.504	TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257878.2		
IGDCC3	9543	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	65622120	65622120	+	Silent	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr15:65622120G>A	ENST00000327987.4	-	12	2192	c.1941C>T	c.(1939-1941)atC>atT	p.I647I	IGDCC3_ENST00000559231.1_5'Flank	NM_004884.3	NP_004875.2	Q8IVU1	IGDC3_HUMAN	immunoglobulin superfamily, DCC subclass, member 3	647					neuromuscular process controlling balance (GO:0050885)	integral component of plasma membrane (GO:0005887)				breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(9)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						AAGTGACCCCGATGTGGATGC	0.647																																					p.I647I		.											.	IGDCC3-93	0			c.C1941T						.						123.0	69.0	87.0					15																	65622120		2201	4299	6500	SO:0001819	synonymous_variant	9543	exon12			GACCCCGATGTGG	AF063936	CCDS10205.1	15q22.3-q23	2013-02-11	2009-01-08	2009-01-08	ENSG00000174498	ENSG00000174498		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9700	protein-coding gene	gene with protein product		604184	"""putative neuronal cell adhesion molecule"""	PUNC		9922388	Standard	NM_004884		Approved	HsT18880	uc002aos.2	Q8IVU1	OTTHUMG00000133137	ENST00000327987.4:c.1941C>T	15.37:g.65622120G>A		Somatic	280	1		WXS	Illumina GAIIx	Phase_I	130	39	NM_004884	0	0	0	0	0	O95215	Silent	SNP	ENST00000327987.4	37	CCDS10205.1																																																																																			.		0.647	IGDCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256826.1	NM_004884	
CYP11A1	1583	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	74632008	74632008	+	Silent	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr15:74632008C>T	ENST00000268053.6	-	6	1231	c.1077G>A	c.(1075-1077)gcG>gcA	p.A359A	CYP11A1_ENST00000419019.2_Silent_p.A201A|CYP11A1_ENST00000358632.4_Silent_p.A201A	NM_000781.2	NP_000772.2	P05108	CP11A_HUMAN	cytochrome P450, family 11, subfamily A, polypeptide 1	359			A -> V (in AICSR; markedly reduced activity). {ECO:0000269|PubMed:16705068}.		biphenyl metabolic process (GO:0018879)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to antibiotic (GO:0071236)|cellular response to cadmium ion (GO:0071276)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to peptide hormone stimulus (GO:0071375)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cellular response to tumor necrosis factor (GO:0071356)|cerebellum development (GO:0021549)|cholesterol metabolic process (GO:0008203)|dibenzo-p-dioxin metabolic process (GO:0018894)|estrogen biosynthetic process (GO:0006703)|fractalkine metabolic process (GO:0050756)|granulosa cell differentiation (GO:0060014)|hippocampus development (GO:0021766)|Leydig cell differentiation (GO:0033327)|maternal process involved in female pregnancy (GO:0060135)|mating behavior (GO:0007617)|phenol-containing compound metabolic process (GO:0018958)|phthalate metabolic process (GO:0018963)|progesterone biosynthetic process (GO:0006701)|response to alkaloid (GO:0043279)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to fungicide (GO:0060992)|response to gamma radiation (GO:0010332)|response to genistein (GO:0033595)|response to hydrogen peroxide (GO:0042542)|response to insecticide (GO:0017085)|response to L-ascorbic acid (GO:0033591)|response to salt stress (GO:0009651)|response to vitamin E (GO:0033197)|Schwann cell differentiation (GO:0014037)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|testosterone biosynthetic process (GO:0061370)|vitamin D metabolic process (GO:0042359)|xenobiotic metabolic process (GO:0006805)	mitochondrial crista (GO:0030061)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|perikaryon (GO:0043204)	cholesterol binding (GO:0015485)|cholesterol monooxygenase (side-chain-cleaving) activity (GO:0008386)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(3)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20					Aminoglutethimide(DB00357)|Cholecalciferol(DB00169)|Clomifene(DB00882)|Clotrimazole(DB00257)|Dexamethasone(DB01234)|Digitoxin(DB01396)|Digoxin(DB00390)|Dinoprostone(DB00917)|Glutethimide(DB01437)|Ketoconazole(DB01026)|Omeprazole(DB00338)|Saquinavir(DB01232)|Terbinafine(DB00857)|Testosterone(DB00624)	CCTGGTGCCGCGCAGCCAAGA	0.602																																					p.A359A	Esophageal Squamous(87;818 1337 4093 9268 37314)	.											.	CYP11A1-92	0			c.G1077A						.						135.0	103.0	113.0					15																	74632008		2197	4296	6493	SO:0001819	synonymous_variant	1583	exon6			GTGCCGCGCAGCC	AK056794	CCDS32291.1, CCDS45303.1	15q23-q24	2010-05-04	2003-01-14	2003-01-17	ENSG00000140459	ENSG00000140459	1.14.15.6	"""Cytochrome P450s"""	2590	protein-coding gene	gene with protein product	"""cholesterol monooxygenase (side-chain-cleaving)"""	118485	"""cytochrome P450, subfamily XIA (cholesterol side chain cleavage)"""	CYP11A			Standard	NM_000781		Approved	P450SCC	uc002axt.2	P05108	OTTHUMG00000150716	ENST00000268053.6:c.1077G>A	15.37:g.74632008C>T		Somatic	149	2		WXS	Illumina GAIIx	Phase_I	80	73	NM_000781	1	1	34	841	805	A8K8D5|B3KPU8|G3XAD7|Q15081|Q16805|Q8N1A7	Silent	SNP	ENST00000268053.6	37	CCDS32291.1																																																																																			.		0.602	CYP11A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319737.1		
CSPG4	1464	broad.mit.edu	37	15	75980201	75980201	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr15:75980201C>T	ENST00000308508.5	-	3	3297	c.3205G>A	c.(3205-3207)Gtg>Atg	p.V1069M		NM_001897.4	NP_001888.2	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4	1069	Gly/Ser-rich (glycosaminoglycan attachment domain).|Interaction with COL5A1. {ECO:0000250}.				activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|intracellular signal transduction (GO:0035556)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|small molecule metabolic process (GO:0044281)|tissue remodeling (GO:0048771)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell projection (GO:0042995)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(3)|liver(2)|lung(18)|ovary(2)|pancreas(2)|prostate(4)|skin(4)	48						TCTACGGCCACGATACTGCCA	0.622																																					p.V1069M		.											.	CSPG4-229	0			c.G3205A						.						62.0	63.0	62.0					15																	75980201		2197	4293	6490	SO:0001583	missense	1464	exon3			CGGCCACGATACT	X96753, AY359468	CCDS10284.1	15q24.2	2010-04-19	2007-02-16		ENSG00000173546	ENSG00000173546		"""Proteoglycans / Cell surface : Other"""	2466	protein-coding gene	gene with protein product	"""melanoma-associated chondroitin sulfate proteoglycan"""	601172	"""chondroitin sulfate proteoglycan 4 (melanoma-associated)"""			8790396, 16407841	Standard	NM_001897		Approved	MCSPG, MEL-CSPG, MSK16, NG2, MCSP, HMW-MAA	uc002baw.3	Q6UVK1	OTTHUMG00000142836	ENST00000308508.5:c.3205G>A	15.37:g.75980201C>T	ENSP00000312506:p.Val1069Met	Somatic	258	1		WXS	Illumina GAIIx	Phase_I	207	6	NM_001897	0	0	0	0	0	D3DW77|Q92675	Missense_Mutation	SNP	ENST00000308508.5	37	CCDS10284.1	.	.	.	.	.	.	.	.	.	.	.	23.5	4.418621	0.83559	.	.	ENSG00000173546	ENST00000308508	T	0.42513	0.97	5.07	5.07	0.68467	.	0.000000	0.64402	D	0.000015	T	0.65739	0.2720	M	0.78456	2.415	0.80722	D	1	D	0.89917	1.0	D	0.74348	0.983	T	0.67499	-0.5655	10	0.45353	T	0.12	.	17.455	0.87604	0.0:1.0:0.0:0.0	.	1069	Q6UVK1	CSPG4_HUMAN	M	1069	ENSP00000312506:V1069M	ENSP00000312506:V1069M	V	-	1	0	CSPG4	73767256	0.995000	0.38212	0.859000	0.33776	0.941000	0.58515	3.298000	0.51818	2.356000	0.79943	0.555000	0.69702	GTG	.		0.622	CSPG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286472.1	NM_001897	
ADAMTS7	11173	bcgsc.ca	37	15	79068601	79068601	+	Silent	SNP	G	G	A	rs189745536	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr15:79068601G>A	ENST00000388820.4	-	11	1845	c.1635C>T	c.(1633-1635)agC>agT	p.S545S	ADAMTS7_ENST00000566303.1_Intron	NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	545	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						TGGACCAGGCGCTCCAGCCAG	0.677													G|||	3	0.000599042	0.0	0.0	5008	,	,		15861	0.002		0.001	False		,,,				2504	0.0				p.S545S		.											.	ADAMTS7-226	0			c.C1635T						.						56.0	66.0	63.0					15																	79068601		2196	4292	6488	SO:0001819	synonymous_variant	11173	exon11			CCAGGCGCTCCAG	AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.1635C>T	15.37:g.79068601G>A		Somatic	207	1		WXS	Illumina GAIIx	Phase_I	191	17	NM_014272	0	0	0	0	0	Q14F51|Q6P7J9	Silent	SNP	ENST00000388820.4	37	CCDS32303.1																																																																																			G|0.999;A|0.001		0.677	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421331.1	NM_014272	
RASGRF1	5923	broad.mit.edu	37	15	79307707	79307707	+	Silent	SNP	A	A	G			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr15:79307707A>G	ENST00000419573.3	-	13	2062	c.1788T>C	c.(1786-1788)ttT>ttC	p.F596F	RASGRF1_ENST00000560334.1_5'UTR|RASGRF1_ENST00000558480.2_Silent_p.F596F	NM_002891.4	NP_002882.3	Q13972	RGRF1_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 1	596					activation of Rac GTPase activity (GO:0032863)|cell proliferation (GO:0008283)|long-term memory (GO:0007616)|neuron projection development (GO:0031175)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of Rac protein signal transduction (GO:0035020)|regulation of Ras protein signal transduction (GO:0046578)|regulation of synaptic plasticity (GO:0048167)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|growth cone (GO:0030426)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(18)|lung(23)|ovary(2)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						AATTTTCTTCAAATGCGTTCA	0.517																																					p.F596F		.											.	RASGRF1-662	0			c.T1788C						.						176.0	144.0	155.0					15																	79307707		2196	4293	6489	SO:0001819	synonymous_variant	5923	exon13			TTCTTCAAATGCG	M91815	CCDS10309.1, CCDS42065.1, CCDS45320.1	15q24	2013-01-10			ENSG00000058335	ENSG00000058335		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9875	protein-coding gene	gene with protein product		606600		GRF1		7684828, 1379731	Standard	NM_153815		Approved	CDC25L, CDC25, GRF55, H-GRF55, GNRP, PP13187	uc002beq.3	Q13972	OTTHUMG00000144172	ENST00000419573.3:c.1788T>C	15.37:g.79307707A>G		Somatic	125	1		WXS	Illumina GAIIx	Phase_I	80	3	NM_001145648	0	0	2	2	0	F8VPA5|H0YKF2|J3KQP9|Q16027	Silent	SNP	ENST00000419573.3	37	CCDS10309.1																																																																																			.		0.517	RASGRF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000291371.3	NM_002891	
RASGRF1	5923	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	79323771	79323771	+	Silent	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr15:79323771G>A	ENST00000419573.3	-	8	1507	c.1233C>T	c.(1231-1233)taC>taT	p.Y411Y	RASGRF1_ENST00000560334.1_5'UTR|RASGRF1_ENST00000558480.2_Silent_p.Y411Y	NM_002891.4	NP_002882.3	Q13972	RGRF1_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 1	411	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				activation of Rac GTPase activity (GO:0032863)|cell proliferation (GO:0008283)|long-term memory (GO:0007616)|neuron projection development (GO:0031175)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of Rac protein signal transduction (GO:0035020)|regulation of Ras protein signal transduction (GO:0046578)|regulation of synaptic plasticity (GO:0048167)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|growth cone (GO:0030426)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(18)|lung(23)|ovary(2)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						TGGACTTGGCGTAGTCCAGGC	0.637																																					p.Y411Y		.											.	RASGRF1-662	0			c.C1233T						.						92.0	71.0	78.0					15																	79323771		2196	4293	6489	SO:0001819	synonymous_variant	5923	exon8			CTTGGCGTAGTCC	M91815	CCDS10309.1, CCDS42065.1, CCDS45320.1	15q24	2013-01-10			ENSG00000058335	ENSG00000058335		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9875	protein-coding gene	gene with protein product		606600		GRF1		7684828, 1379731	Standard	NM_153815		Approved	CDC25L, CDC25, GRF55, H-GRF55, GNRP, PP13187	uc002beq.3	Q13972	OTTHUMG00000144172	ENST00000419573.3:c.1233C>T	15.37:g.79323771G>A		Somatic	164	1		WXS	Illumina GAIIx	Phase_I	86	80	NM_001145648	0	0	0	6	6	F8VPA5|H0YKF2|J3KQP9|Q16027	Silent	SNP	ENST00000419573.3	37	CCDS10309.1																																																																																			.		0.637	RASGRF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000291371.3	NM_002891	
MESDC2	23184	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	81271798	81271798	+	Missense_Mutation	SNP	C	C	T	rs185628590		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr15:81271798C>T	ENST00000261758.4	-	3	553	c.467G>A	c.(466-468)cGt>cAt	p.R156H	MESDC2_ENST00000560244.1_5'Flank	NM_015154.1	NP_055969.1	Q14696	MESD_HUMAN	mesoderm development candidate 2	156	Chaperone domain. {ECO:0000250}.				mesoderm development (GO:0007498)|protein folding (GO:0006457)|protein localization to cell surface (GO:0034394)|Wnt signaling pathway (GO:0016055)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)				cervix(1)|large_intestine(5)|ovary(1)|urinary_tract(1)	8						GAAGATAGCACGGTCTGATCC	0.522													C|||	1	0.000199681	0.0	0.0	5008	,	,		19095	0.0		0.001	False		,,,				2504	0.0				p.R156H		.											.	MESDC2-90	0			c.G467A						.						70.0	66.0	67.0					15																	81271798		2203	4300	6503	SO:0001583	missense	23184	exon3			ATAGCACGGTCTG	D42039	CCDS32308.1	15q13	2008-07-18							13520	protein-coding gene	gene with protein product		607783				7788527, 11247670	Standard	NM_015154		Approved	KIAA0081, BOCA, MESD	uc002bfy.1	Q14696		ENST00000261758.4:c.467G>A	15.37:g.81271798C>T	ENSP00000261758:p.Arg156His	Somatic	127	0		WXS	Illumina GAIIx	Phase_I	71	62	NM_015154	0	0	1	72	71	B4DW84|D3DW96|Q969U1	Missense_Mutation	SNP	ENST00000261758.4	37	CCDS32308.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	28.6	4.937836	0.92526	.	.	ENSG00000117899	ENST00000261758	.	.	.	5.9	4.0	0.46444	.	0.000000	0.85682	D	0.000000	T	0.74512	0.3726	M	0.63169	1.94	0.80722	D	1	D	0.89917	1.0	D	0.73708	0.981	T	0.75986	-0.3124	9	0.87932	D	0	-14.0834	12.065	0.53583	0.0:0.8136:0.1213:0.0651	.	156	Q14696	MESD_HUMAN	H	156	.	ENSP00000261758:R156H	R	-	2	0	MESDC2	79058853	1.000000	0.71417	0.668000	0.29813	0.984000	0.73092	7.480000	0.81109	0.834000	0.34852	0.650000	0.86243	CGT	C|0.999;T|0.000		0.522	MESDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417673.2	NM_015154	
IGF1R	3480	broad.mit.edu	37	15	99442820	99442820	+	Missense_Mutation	SNP	G	G	A	rs148662051		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr15:99442820G>A	ENST00000268035.6	+	5	1828	c.1217G>A	c.(1216-1218)cGc>cAc	p.R406H	IGF1R_ENST00000558762.1_Missense_Mutation_p.R406H	NM_000875.3	NP_000866.1	P08069	IGF1R_HUMAN	insulin-like growth factor 1 receptor	406					axonogenesis (GO:0007409)|brain development (GO:0007420)|epidermis development (GO:0008544)|establishment of cell polarity (GO:0030010)|exocrine pancreas development (GO:0031017)|immune response (GO:0006955)|inactivation of MAPKK activity (GO:0051389)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|male sex determination (GO:0030238)|mammary gland development (GO:0030879)|negative regulation of apoptotic process (GO:0043066)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|peptidyl-tyrosine autophosphorylation (GO:0038083)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of DNA replication (GO:0045740)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of steroid hormone biosynthetic process (GO:0090031)|prostate gland epithelium morphogenesis (GO:0060740)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein tetramerization (GO:0051262)|regulation of JNK cascade (GO:0046328)|response to vitamin E (GO:0033197)|signal transduction (GO:0007165)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|insulin binding (GO:0043559)|insulin receptor binding (GO:0005158)|insulin receptor substrate binding (GO:0043560)|insulin-like growth factor binding (GO:0005520)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor-activated receptor activity (GO:0005010)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)			NS(2)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(13)|lung(20)|ovary(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63	all_cancers(4;4.17e-14)|all_epithelial(3;4.34e-15)|Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		Epithelial(2;1.94e-12)|all cancers(5;6.83e-11)|BRCA - Breast invasive adenocarcinoma(2;2.88e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00261)		"""""""Insulin(DB00071)|Insulin Glargine(DB00047)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	AAAAACCTTCGCCTCATCCTA	0.493																																					p.R406H		.											.	IGF1R-1490	0			c.G1217A						.	G	HIS/ARG	1,4393	2.1+/-5.4	0,1,2196	147.0	146.0	146.0		1217	5.4	1.0	15	dbSNP_134	146	1,8593	1.2+/-3.3	0,1,4296	no	missense	IGF1R	NM_000875.3	29	0,2,6492	AA,AG,GG		0.0116,0.0228,0.0154	benign	406/1368	99442820	2,12986	2197	4297	6494	SO:0001583	missense	3480	exon5			ACCTTCGCCTCAT	M69229	CCDS10378.1, CCDS73785.1	15q26.3	2013-02-11			ENSG00000140443	ENSG00000140443		"""CD molecules"", ""Fibronectin type III domain containing"""	5465	protein-coding gene	gene with protein product		147370				1316909	Standard	XM_006720486		Approved	JTK13, CD221, IGFIR, MGC18216, IGFR	uc002bul.3	P08069	OTTHUMG00000149851	ENST00000268035.6:c.1217G>A	15.37:g.99442820G>A	ENSP00000268035:p.Arg406His	Somatic	154	1		WXS	Illumina GAIIx	Phase_I	102	4	NM_000875	0	0	6	6	0	B1B5Y2|Q14CV2|Q9UCC0	Missense_Mutation	SNP	ENST00000268035.6	37	CCDS10378.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.093354	0.76756	2.28E-4	1.16E-4	ENSG00000140443	ENST00000268035	D	0.84944	-1.92	5.44	5.44	0.79542	EGF receptor, L domain (1);	0.000000	0.64402	D	0.000016	D	0.83202	0.5203	M	0.71920	2.185	0.80722	D	1	P;B	0.40083	0.702;0.233	B;B	0.30179	0.107;0.112	D	0.83701	0.0182	10	0.37606	T	0.19	.	19.6379	0.95744	0.0:0.0:1.0:0.0	.	406;406	C9J5X1;P08069	.;IGF1R_HUMAN	H	406	ENSP00000268035:R406H	ENSP00000268035:R406H	R	+	2	0	IGF1R	97260343	1.000000	0.71417	0.962000	0.40283	0.876000	0.50452	9.813000	0.99286	2.712000	0.92718	0.563000	0.77884	CGC	G|1.000;A|0.000		0.493	IGF1R-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313537.2	NM_000875	
PRR25	388199	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	16	857545	857545	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr16:857545C>T	ENST00000301698.1	+	2	542	c.542C>T	c.(541-543)cCg>cTg	p.P181L		NM_001013638.1	NP_001013660.1	Q96S07	PRR25_HUMAN	proline rich 25	181	Pro-rich.									large_intestine(1)|lung(1)|skin(1)	3						GTGCAGGCGCCGGGCCTGGGC	0.726																																					p.P181L		.											.	PRR25-135	0			c.C542T						.						6.0	7.0	7.0					16																	857545		1351	3245	4596	SO:0001583	missense	388199	exon2			AGGCGCCGGGCCT	BC156145	CCDS45372.1	16p13.3	2009-09-11			ENSG00000167945	ENSG00000167945			37230	protein-coding gene	gene with protein product						11157797	Standard	NM_001013638		Approved	gs64	uc010uut.2	Q96S07		ENST00000301698.1:c.542C>T	16.37:g.857545C>T	ENSP00000301698:p.Pro181Leu	Somatic	12	0		WXS	Illumina GAIIx	Phase_I	31	13	NM_001013638	0	0	0	0	0		Missense_Mutation	SNP	ENST00000301698.1	37	CCDS45372.1	.	.	.	.	.	.	.	.	.	.	C	9.650	1.141203	0.21205	.	.	ENSG00000167945	ENST00000301698	T	0.41400	1.0	0.43	0.43	0.16515	.	.	.	.	.	T	0.41328	0.1154	N	0.14661	0.345	0.09310	N	1	D	0.76494	0.999	D	0.68765	0.96	T	0.27468	-1.0073	8	0.87932	D	0	.	.	.	.	.	181	Q96S07	PRR25_HUMAN	L	181	ENSP00000301698:P181L	ENSP00000301698:P181L	P	+	2	0	PRR25	797546	0.307000	0.24500	0.005000	0.12908	0.036000	0.12997	0.834000	0.27518	0.459000	0.27016	0.462000	0.41574	CCG	.		0.726	PRR25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440563.1	NM_001013638	
CASKIN1	57524	broad.mit.edu	37	16	2235145	2235145	+	Silent	SNP	A	A	C			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr16:2235145A>C	ENST00000343516.6	-	12	1298	c.1206T>G	c.(1204-1206)ggT>ggG	p.G402G	CASKIN1_ENST00000564289.1_5'Flank	NM_020764.3	NP_065815.1	Q8WXD9	CSKI1_HUMAN	CASK interacting protein 1	402	CASK-binding. {ECO:0000250}.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|liver(1)|lung(7)|ovary(4)|prostate(5)|skin(3)	28						GTAGGGCGTGACCCCCGCTGC	0.701																																					p.G402G		.											.	CASKIN1-92	0			c.T1206G						.						18.0	27.0	24.0					16																	2235145		1999	4136	6135	SO:0001819	synonymous_variant	57524	exon12			GGCGTGACCCCCG	AF451977	CCDS42103.1	16p13.3	2013-01-10				ENSG00000167971		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	20879	protein-coding gene	gene with protein product		612184				12040031	Standard	NM_020764		Approved	KIAA1306, ANKS5A	uc010bsg.1	Q8WXD9		ENST00000343516.6:c.1206T>G	16.37:g.2235145A>C		Somatic	48	8		WXS	Illumina GAIIx	Phase_I	107	18	NM_020764	0	0	10	10	0	Q9P2P0	Silent	SNP	ENST00000343516.6	37	CCDS42103.1																																																																																			.		0.701	CASKIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435055.1	NM_020764	
C16orf59	80178	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	2514193	2514193	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr16:2514193G>A	ENST00000361837.4	+	9	1183	c.1118G>A	c.(1117-1119)cGa>cAa	p.R373Q	RP11-715J22.2_ENST00000563775.1_RNA|C16orf59_ENST00000569496.1_Missense_Mutation_p.R373Q|C16orf59_ENST00000483320.1_Missense_Mutation_p.R206Q|C16orf59_ENST00000563531.1_Missense_Mutation_p.R373Q	NM_025108.2	NP_079384.2	Q7L2K0	CP059_HUMAN	chromosome 16 open reading frame 59	373										lung(1)|skin(1)|urinary_tract(1)	3		Ovarian(90;0.17)				CTCAAGCTGCGAGTGGCTGTG	0.642																																					p.R373Q		.											.	C16orf59-90	0			c.G1118A						.						12.0	15.0	14.0					16																	2514193		1956	4121	6077	SO:0001583	missense	80178	exon9			AGCTGCGAGTGGC	AK023971	CCDS10468.2	16p13.3	2008-10-30			ENSG00000162062	ENSG00000162062			25849	protein-coding gene	gene with protein product						12477932	Standard	XM_006720955		Approved	FLJ13909	uc002cqh.3	Q7L2K0	OTTHUMG00000128859	ENST00000361837.4:c.1118G>A	16.37:g.2514193G>A	ENSP00000355022:p.Arg373Gln	Somatic	118	0		WXS	Illumina GAIIx	Phase_I	155	32	NM_025108	0	0	0	1	1	B4DXD7|Q96H61|Q9H872	Missense_Mutation	SNP	ENST00000361837.4	37	CCDS10468.2	.	.	.	.	.	.	.	.	.	.	G	11.12	1.545892	0.27652	.	.	ENSG00000162062	ENST00000361837	T	0.48836	0.8	4.2	2.18	0.27775	.	0.265632	0.27043	N	0.021215	T	0.31389	0.0795	L	0.47190	1.495	0.09310	N	0.999999	P;P;P	0.52061	0.868;0.868;0.95	B;B;B	0.35813	0.211;0.211;0.211	T	0.19614	-1.0300	10	0.36615	T	0.2	-14.3306	7.1564	0.25639	0.1981:0.0:0.8019:0.0	.	373;206;206	Q7L2K0;D3DU95;Q7L2K0-2	CP059_HUMAN;.;.	Q	373	ENSP00000355022:R373Q	ENSP00000355022:R373Q	R	+	2	0	C16orf59	2454194	0.000000	0.05858	0.453000	0.27007	0.451000	0.32288	0.081000	0.14823	0.523000	0.28482	0.561000	0.74099	CGA	.		0.642	C16orf59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250802.3	NM_025108	
PAQR4	124222	broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	3021279	3021279	+	Silent	SNP	C	C	T	rs372876046		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr16:3021279C>T	ENST00000318782.8	+	2	718	c.288C>T	c.(286-288)tcC>tcT	p.S96S	PKMYT1_ENST00000431515.2_Intron|PAQR4_ENST00000293978.8_Silent_p.S57S|PKMYT1_ENST00000571102.1_5'Flank|PAQR4_ENST00000572687.1_Intron|PAQR4_ENST00000576565.1_Silent_p.S29S|PAQR4_ENST00000574988.1_Silent_p.S29S	NM_001284513.1|NM_152341.3	NP_001271442.1|NP_689554.2	Q8N4S7	PAQR4_HUMAN	progestin and adipoQ receptor family member IV	96						integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	8						CTGCAGGCTCCGTGCTCTATC	0.637																																					p.S96S		.											.	PAQR4-68	0			c.C288T						.	C		0,4396		0,0,2198	60.0	60.0	60.0		288	-4.5	1.0	16		60	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	PAQR4	NM_152341.3		0,1,6497	TT,TC,CC		0.0116,0.0,0.0077		96/274	3021279	1,12995	2198	4300	6498	SO:0001819	synonymous_variant	124222	exon2			AGGCTCCGTGCTC		CCDS10485.1, CCDS66911.1, CCDS66912.1, CCDS73814.1	16p13	2008-05-02			ENSG00000162073	ENSG00000162073			26386	protein-coding gene	gene with protein product		614578				12477932	Standard	XM_005255112		Approved	FLJ30002	uc002csj.4	Q8N4S7	OTTHUMG00000128977	ENST00000318782.8:c.288C>T	16.37:g.3021279C>T		Somatic	113	2		WXS	Illumina GAIIx	Phase_I	140	67	NM_152341	0	0	21	29	8	A8K5Q8|D3DUA2|D3DUA3|Q8NAS6|Q96NW1	Silent	SNP	ENST00000318782.8	37	CCDS10485.1																																																																																			.		0.637	PAQR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250966.1	NM_152341	
ZSCAN10	84891	hgsc.bcm.edu;mdanderson.org	37	16	3139112	3139112	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr16:3139112C>T	ENST00000252463.2	-	5	2245	c.2158G>A	c.(2158-2160)Gcc>Acc	p.A720T	RNU1-22P_ENST00000363334.1_RNA|RP11-473M20.9_ENST00000571404.1_lincRNA|ZSCAN10_ENST00000538082.2_Missense_Mutation_p.A638T|ZSCAN10_ENST00000575108.1_Missense_Mutation_p.A381T	NM_032805.1	NP_116194.1	Q96SZ4	ZSC10_HUMAN	zinc finger and SCAN domain containing 10	720					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(3)|endometrium(3)|kidney(1)|lung(8)|ovary(2)|prostate(1)|skin(4)|urinary_tract(1)	24						GTCTCGCGGGCGTGGGTGCGC	0.706																																					p.A720T		.											.	ZSCAN10-227	0			c.G2158A						.						12.0	13.0	12.0					16																	3139112		2155	4263	6418	SO:0001583	missense	84891	exon5			CGCGGGCGTGGGT	AA206569	CCDS10493.1, CCDS61813.1, CCDS61814.1	16p13.3	2013-01-08	2007-02-20	2007-02-20		ENSG00000130182		"""-"", ""Zinc fingers, C2H2-type"""	12997	protein-coding gene	gene with protein product			"""zinc finger protein 206"""	ZNF206		9653642	Standard	NM_032805		Approved		uc002ctv.1	Q96SZ4		ENST00000252463.2:c.2158G>A	16.37:g.3139112C>T	ENSP00000252463:p.Ala720Thr	Somatic	9	0		WXS	Illumina GAIIx	Phase_I	80	30	NM_032805	0	0	0	0	0	B3KQD3|H0YFS6|Q1WWM2	Missense_Mutation	SNP	ENST00000252463.2	37	CCDS10493.1	.	.	.	.	.	.	.	.	.	.	C	6.547	0.469187	0.12461	.	.	ENSG00000130182	ENST00000538082;ENST00000252463	T	0.05996	3.36	4.95	0.247	0.15521	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.395168	0.21710	N	0.070289	T	0.01029	0.0034	N	0.01235	-0.94	0.80722	D	1	B;P;B	0.40360	0.116;0.714;0.377	B;B;B	0.21151	0.016;0.033;0.016	T	0.50947	-0.8767	10	0.02654	T	1	-13.9325	2.9211	0.05770	0.3749:0.3985:0.0:0.2266	.	381;653;720	Q96SZ4-2;Q1WWM2;Q96SZ4	.;.;ZSC10_HUMAN	T	653;720	ENSP00000252463:A720T	ENSP00000252463:A720T	A	-	1	0	ZSCAN10	3079113	0.001000	0.12720	0.904000	0.35570	0.877000	0.50540	-1.330000	0.02675	0.084000	0.17077	0.561000	0.74099	GCC	.		0.706	ZSCAN10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437124.2	NM_032805	
ZNF205	7755	broad.mit.edu	37	16	3169354	3169354	+	Silent	SNP	C	C	T	rs558086377		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr16:3169354C>T	ENST00000382192.3	+	7	898	c.693C>T	c.(691-693)ggC>ggT	p.G231G	ZNF205_ENST00000219091.4_Silent_p.G231G|RP11-473M20.14_ENST00000575139.1_RNA|RP11-473M20.14_ENST00000576490.1_RNA	NM_001278158.1|NM_003456.2	NP_001265087.1|NP_003447.2	O95201	ZN205_HUMAN	zinc finger protein 205	231					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of hydrogen peroxide biosynthetic process (GO:0010729)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	20						TCCAGTGGGGCGTCCCGCAGT	0.692																																					p.G231G		.											.	ZNF205-90	0			c.C693T						.						29.0	26.0	27.0					16																	3169354		2182	4266	6448	SO:0001819	synonymous_variant	7755	exon7			GTGGGGCGTCCCG	AF060865	CCDS10494.2	16p13.3	2013-01-08			ENSG00000122386	ENSG00000122386		"""Zinc fingers, C2H2-type"", ""-"""	12996	protein-coding gene	gene with protein product		603436		ZNF210		9787081	Standard	NM_003456		Approved	Zfp13	uc002cub.3	O95201	OTTHUMG00000148676	ENST00000382192.3:c.693C>T	16.37:g.3169354C>T		Somatic	51	0		WXS	Illumina GAIIx	Phase_I	97	5	NM_003456	0	0	23	25	2	A8MZK0|D3DUB4|Q9BU95	Silent	SNP	ENST00000382192.3	37	CCDS10494.2																																																																																			.		0.692	ZNF205-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309057.1	NM_003456	
ZNF205	7755	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	3170139	3170139	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr16:3170139C>T	ENST00000382192.3	+	7	1683	c.1478C>T	c.(1477-1479)gCg>gTg	p.A493V	ZNF205_ENST00000219091.4_Missense_Mutation_p.A493V|RP11-473M20.14_ENST00000575139.1_RNA|RP11-473M20.14_ENST00000576490.1_RNA	NM_001278158.1|NM_003456.2	NP_001265087.1|NP_003447.2	O95201	ZN205_HUMAN	zinc finger protein 205	493					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of hydrogen peroxide biosynthetic process (GO:0010729)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	20						CACCTCACCGCGCACCAGCGC	0.667																																					p.A493V		.											.	ZNF205-90	0			c.C1478T						.						85.0	75.0	79.0					16																	3170139		2197	4300	6497	SO:0001583	missense	7755	exon7			TCACCGCGCACCA	AF060865	CCDS10494.2	16p13.3	2013-01-08			ENSG00000122386	ENSG00000122386		"""Zinc fingers, C2H2-type"", ""-"""	12996	protein-coding gene	gene with protein product		603436		ZNF210		9787081	Standard	NM_003456		Approved	Zfp13	uc002cub.3	O95201	OTTHUMG00000148676	ENST00000382192.3:c.1478C>T	16.37:g.3170139C>T	ENSP00000371627:p.Ala493Val	Somatic	141	0		WXS	Illumina GAIIx	Phase_I	385	204	NM_003456	0	0	11	18	7	A8MZK0|D3DUB4|Q9BU95	Missense_Mutation	SNP	ENST00000382192.3	37	CCDS10494.2	.	.	.	.	.	.	.	.	.	.	C	12.27	1.888036	0.33348	.	.	ENSG00000122386	ENST00000382192;ENST00000219091	T;T	0.07800	3.16;3.16	5.54	4.53	0.55603	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.145169	0.32301	N	0.006298	T	0.03305	0.0096	N	0.08118	0	0.09310	N	1	P	0.47677	0.899	B	0.33339	0.162	T	0.47837	-0.9086	10	0.25751	T	0.34	-23.7707	10.7766	0.46353	0.3025:0.6975:0.0:0.0	.	493	O95201	ZN205_HUMAN	V	493	ENSP00000371627:A493V;ENSP00000219091:A493V	ENSP00000219091:A493V	A	+	2	0	ZNF205	3110140	0.000000	0.05858	0.455000	0.27031	0.944000	0.59088	-0.050000	0.11904	2.604000	0.88044	0.561000	0.74099	GCG	.		0.667	ZNF205-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309057.1	NM_003456	
ZNF213	7760	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	3191159	3191159	+	Silent	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr16:3191159C>T	ENST00000396878.3	+	6	1666	c.1191C>T	c.(1189-1191)ggC>ggT	p.G397G	ZNF213_ENST00000576416.1_Silent_p.G397G|ZNF213_ENST00000416391.2_Silent_p.G239G|ZNF213_ENST00000574902.1_Silent_p.G397G	NM_001134655.1|NM_004220.2	NP_001128127.1|NP_004211.1	O14771	ZN213_HUMAN	zinc finger protein 213	397					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	16						TACACACGGGCGAGAAGCCTT	0.662																																					p.G397G		.											.	ZNF213-90	0			c.C1191T						.						43.0	42.0	42.0					16																	3191159		2197	4300	6497	SO:0001819	synonymous_variant	7760	exon6			CACGGGCGAGAAG	AF017433	CCDS10495.1	16p13.3	2014-05-13	2007-02-20	2007-02-20	ENSG00000085644	ENSG00000085644		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13005	protein-coding gene	gene with protein product		608387				9653642, 10023065	Standard	NM_004220		Approved	CR53, ZKSCAN21, ZSCAN53	uc010uws.2	O14771	OTTHUMG00000177519	ENST00000396878.3:c.1191C>T	16.37:g.3191159C>T		Somatic	164	0		WXS	Illumina GAIIx	Phase_I	281	114	NM_004220	0	0	11	20	9	A8K1B9|B4DMG6|Q96IS1	Silent	SNP	ENST00000396878.3	37	CCDS10495.1																																																																																			.		0.662	ZNF213-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437334.1	NM_004220	
C16orf96	342346	broad.mit.edu	37	16	4650307	4650307	+	Missense_Mutation	SNP	G	G	A	rs576049742		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr16:4650307G>A	ENST00000444310.4	+	16	3415	c.3415G>A	c.(3415-3417)Gcc>Acc	p.A1139T		NM_001145011.1	NP_001138483.1			chromosome 16 open reading frame 96											NS(1)|breast(1)|endometrium(6)|kidney(1)|skin(3)	12						CGAGGAGCCCGCCAACCCGTG	0.697													G|||	1	0.000199681	0.0	0.0	5008	,	,		6135	0.0		0.0	False		,,,				2504	0.001				p.A1139T		.											.	.	0			c.G3415A						.						17.0	22.0	20.0					16																	4650307		692	1590	2282	SO:0001583	missense	342346	exon16			GAGCCCGCCAACC		CCDS53986.1	16p13.3	2012-10-10			ENSG00000205832	ENSG00000205832			40031	protein-coding gene	gene with protein product							Standard	NM_001145011		Approved		uc010uxn.2	A6NNT2	OTTHUMG00000176519	ENST00000444310.4:c.3415G>A	16.37:g.4650307G>A	ENSP00000415027:p.Ala1139Thr	Somatic	22	0		WXS	Illumina GAIIx	Phase_I	60	4	NM_001145011	0	0	1	1	0		Missense_Mutation	SNP	ENST00000444310.4	37	CCDS53986.1	.	.	.	.	.	.	.	.	.	.	G	9.582	1.123737	0.20959	.	.	ENSG00000205832	ENST00000444310	.	.	.	3.73	-4.67	0.03319	.	.	.	.	.	T	0.09423	0.0232	N	0.03608	-0.345	0.09310	N	1	B	0.28470	0.213	B	0.16722	0.016	T	0.17379	-1.0371	8	0.59425	D	0.04	.	1.6033	0.02679	0.4723:0.1431:0.2398:0.1448	.	1139	A6NNT2	CP096_HUMAN	T	1139	.	ENSP00000415027:A1139T	A	+	1	0	C16orf96	4590308	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-1.054000	0.03496	-0.958000	0.03622	-0.323000	0.08544	GCC	.		0.697	C16orf96-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432384.1	NM_001145011	
ZNF500	26048	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	4802835	4802835	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr16:4802835C>T	ENST00000219478.6	-	6	1284	c.985G>A	c.(985-987)Gaa>Aaa	p.E329K	RP11-127I20.7_ENST00000588099.1_RNA|ZNF500_ENST00000591026.1_5'UTR|ZNF500_ENST00000545009.1_Missense_Mutation_p.E329K			O60304	ZN500_HUMAN	zinc finger protein 500	329					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E329K(1)		endometrium(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	21						TTGCCACATTCGGGGCAGGTG	0.632																																					p.E329K		.											.	ZNF500-93	1	Substitution - Missense(1)	large_intestine(1)	c.G985A						.						98.0	85.0	89.0					16																	4802835		2197	4300	6497	SO:0001583	missense	26048	exon6			CACATTCGGGGCA	AB011129	CCDS32383.1	16p13.3	2013-01-09				ENSG00000103199		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	23716	protein-coding gene	gene with protein product						9628581	Standard	XM_005255243		Approved	ZKSCAN18, KIAA0557, ZSCAN50	uc002cxp.1	O60304		ENST00000219478.6:c.985G>A	16.37:g.4802835C>T	ENSP00000219478:p.Glu329Lys	Somatic	147	0		WXS	Illumina GAIIx	Phase_I	181	82	NM_021646	0	0	3	5	2	A8K6X7|B4DNN9|Q0VAL2|Q96CQ8|Q9BTG0	Missense_Mutation	SNP	ENST00000219478.6	37	CCDS32383.1	.	.	.	.	.	.	.	.	.	.	C	12.50	1.956855	0.34565	.	.	ENSG00000103199	ENST00000545009;ENST00000219478	T;T	0.07327	3.2;3.2	4.07	2.09	0.27110	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.243812	0.21147	N	0.079390	T	0.04227	0.0117	N	0.20357	0.565	0.09310	N	1	B;P	0.36683	0.309;0.565	B;B	0.24155	0.051;0.051	T	0.37979	-0.9682	10	0.49607	T	0.09	.	7.9979	0.30280	0.0:0.791:0.0:0.209	.	329;329	B4DNN9;O60304	.;ZN500_HUMAN	K	329	ENSP00000445714:E329K;ENSP00000219478:E329K	ENSP00000219478:E329K	E	-	1	0	ZNF500	4742836	0.000000	0.05858	0.010000	0.14722	0.184000	0.23303	-0.222000	0.09190	0.217000	0.20800	0.655000	0.94253	GAA	.		0.632	ZNF500-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432461.1	XM_085507	
EARS2	124454	broad.mit.edu	37	16	23546407	23546407	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr16:23546407T>G	ENST00000563459.1	-	4	766	c.760A>C	c.(760-762)Act>Cct	p.T254P	EARS2_ENST00000564501.1_Missense_Mutation_p.T254P|EARS2_ENST00000563232.1_Missense_Mutation_p.T254P|EARS2_ENST00000564987.1_5'UTR|EARS2_ENST00000449606.1_Missense_Mutation_p.T254P			Q5JPH6	SYEM_HUMAN	glutamyl-tRNA synthetase 2, mitochondrial	254					gene expression (GO:0010467)|glutamyl-tRNA aminoacylation (GO:0006424)|tRNA aminoacylation for mitochondrial protein translation (GO:0070127)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|glutamate-tRNA ligase activity (GO:0004818)|glutamate-tRNA(Gln) ligase activity (GO:0050561)|tRNA binding (GO:0000049)			central_nervous_system(1)|endometrium(1)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	8				GBM - Glioblastoma multiforme(48;0.0353)		TGCTTGGCAGTGGAGACGAGC	0.652																																					p.T254P		.											.	EARS2-90	0			c.A760C						.						23.0	29.0	27.0					16																	23546407		2126	4233	6359	SO:0001583	missense	124454	exon4			TGGCAGTGGAGAC	AB075850	CCDS42132.1	16p12.2	2014-05-06	2012-10-26		ENSG00000103356	ENSG00000103356	6.1.1.17	"""Aminoacyl tRNA synthetases / Class I"""	29419	protein-coding gene	gene with protein product	"""glutamate tRNA ligase 2, mitochondrial"""	612799	"""glutamyl-tRNA synthetase 2, mitochondrial (putative)"""			15779907, 19805282, 22492562	Standard	NM_001083614		Approved	KIAA1970, MSE1	uc002dlt.4	Q5JPH6	OTTHUMG00000177018	ENST00000563459.1:c.760A>C	16.37:g.23546407T>G	ENSP00000456467:p.Thr254Pro	Somatic	210	18		WXS	Illumina GAIIx	Phase_I	256	26	NM_001083614	0	0	17	18	1	B3KTT2|D3DWF1|Q86YH3|Q8TF31	Missense_Mutation	SNP	ENST00000563459.1	37	CCDS42132.1	.	.	.	.	.	.	.	.	.	.	T	25.4	4.629374	0.87660	.	.	ENSG00000103356	ENST00000449606;ENST00000341597	T	0.28255	1.62	5.56	5.56	0.83823	Glutamyl/glutaminyl-tRNA synthetase, class Ib, catalytic domain (1);Rossmann-like alpha/beta/alpha sandwich fold (1);	0.047096	0.85682	D	0.000000	T	0.73218	0.3559	H	0.99357	4.53	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.87578	0.98;0.998	D	0.85213	0.1022	10	0.87932	D	0	-5.5876	14.8938	0.70627	0.0:0.0:0.0:1.0	.	254;254	Q86YH3;Q5JPH6	.;SYEM_HUMAN	P	254	ENSP00000395196:T254P	ENSP00000343488:T254P	T	-	1	0	EARS2	23453908	1.000000	0.71417	0.997000	0.53966	0.943000	0.58893	7.659000	0.83766	2.123000	0.65237	0.533000	0.62120	ACT	.		0.652	EARS2-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434844.1	NM_133451	
GTF3C1	2975	broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	27483225	27483225	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr16:27483225C>T	ENST00000356183.4	-	30	4385	c.4370G>A	c.(4369-4371)cGg>cAg	p.R1457Q	GTF3C1_ENST00000561623.1_Missense_Mutation_p.R1457Q	NM_001520.3	NP_001511.2	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide 1, alpha 220kDa	1457					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription (GO:0009304)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|liver(3)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	80						CTTGTACTCCCGATAGAGGCG	0.632																																					p.R1457Q		.											.	GTF3C1-94	0			c.G4370A						.						54.0	47.0	50.0					16																	27483225		2197	4300	6497	SO:0001583	missense	2975	exon30			TACTCCCGATAGA	U06485	CCDS32414.1, CCDS66988.1	16p12	2010-03-23	2002-08-29			ENSG00000077235		"""General transcription factors"""	4664	protein-coding gene	gene with protein product		603246	"""general transcription factor IIIC, polypeptide 1 (alpha subunit, 220kD )"""			8164661, 8127861	Standard	NM_001520		Approved	TFIIIC220	uc002dov.2	Q12789		ENST00000356183.4:c.4370G>A	16.37:g.27483225C>T	ENSP00000348510:p.Arg1457Gln	Somatic	128	2		WXS	Illumina GAIIx	Phase_I	136	61	NM_001520	0	0	26	40	14	B2RP21|Q12838|Q6DKN9|Q9Y4W9	Missense_Mutation	SNP	ENST00000356183.4	37	CCDS32414.1	.	.	.	.	.	.	.	.	.	.	C	15.91	2.973543	0.53720	.	.	ENSG00000077235	ENST00000356183;ENST00000388971	T	0.22336	1.96	5.19	2.2	0.27929	.	0.326183	0.32703	N	0.005742	T	0.14313	0.0346	L	0.33189	0.99	0.33757	D	0.62129	B;B	0.25007	0.088;0.116	B;B	0.16722	0.005;0.016	T	0.12941	-1.0528	10	0.38643	T	0.18	-13.9325	9.4037	0.38449	0.0:0.7011:0.0:0.2989	.	1457;1457	Q12789;Q12789-3	TF3C1_HUMAN;.	Q	1457;1453	ENSP00000348510:R1457Q	ENSP00000348510:R1457Q	R	-	2	0	GTF3C1	27390726	0.846000	0.29590	0.989000	0.46669	0.994000	0.84299	1.627000	0.37050	0.220000	0.20860	0.655000	0.94253	CGG	.		0.632	GTF3C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433856.1	NM_001520	
ZNF785	146540	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	30594258	30594258	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr16:30594258C>T	ENST00000395216.2	-	3	1000	c.841G>A	c.(841-843)Gag>Aag	p.E281K	AC002310.7_ENST00000486926.1_RNA|RP11-146F11.5_ENST00000563540.1_RNA|AC002310.7_ENST00000492040.1_RNA|ZNF785_ENST00000470110.1_Missense_Mutation_p.E266K	NM_152458.6	NP_689671.2	A8K8V0	ZN785_HUMAN	zinc finger protein 785	281					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	9						TAGGGCTTCTCGCCCGTGTGC	0.642																																					p.E281K		.											.	ZNF785-91	0			c.G841A						.						51.0	49.0	49.0					16																	30594258		2197	4300	6497	SO:0001583	missense	146540	exon3			GCTTCTCGCCCGT	BC040642	CCDS10685.1	16p11.2	2013-01-08			ENSG00000197162	ENSG00000197162		"""Zinc fingers, C2H2-type"", ""-"""	26496	protein-coding gene	gene with protein product						10493829	Standard	NM_152458		Approved	FLJ32130	uc002dyu.3	A8K8V0	OTTHUMG00000132398	ENST00000395216.2:c.841G>A	16.37:g.30594258C>T	ENSP00000378642:p.Glu281Lys	Somatic	147	0		WXS	Illumina GAIIx	Phase_I	183	67	NM_152458	0	0	10	17	7	O75701|Q8IW91|Q8WV14|Q96MN0	Missense_Mutation	SNP	ENST00000395216.2	37	CCDS10685.1	.	.	.	.	.	.	.	.	.	.	c	22.5	4.300815	0.81136	.	.	ENSG00000197162	ENST00000470110;ENST00000395222;ENST00000395216	T;T	0.24350	1.86;1.86	4.25	0.0588	0.14329	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.28928	0.0718	L	0.39020	1.185	0.23351	N	0.997855	B;P;B	0.46912	0.2;0.886;0.166	B;P;B	0.53401	0.084;0.725;0.05	T	0.17868	-1.0355	9	0.62326	D	0.03	.	7.9812	0.30185	0.0:0.6424:0.0:0.3576	.	246;281;266	B4DQL1;A8K8V0;A8K8V0-2	.;ZN785_HUMAN;.	K	266;246;281	ENSP00000420340:E266K;ENSP00000378642:E281K	ENSP00000378642:E281K	E	-	1	0	ZNF785	30501759	0.748000	0.28294	0.082000	0.20525	0.815000	0.46073	1.533000	0.36040	-0.094000	0.12374	0.644000	0.83932	GAG	.		0.642	ZNF785-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255529.2	NM_152458	
STX1B	112755	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	31004545	31004545	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr16:31004545C>T	ENST00000215095.5	-	9	923	c.692G>A	c.(691-693)cGc>cAc	p.R231H	STX1B_ENST00000565419.1_Missense_Mutation_p.R231H	NM_052874.3	NP_443106.1	P61266	STX1B_HUMAN	syntaxin 1B	231	t-SNARE coiled-coil homology. {ECO:0000255|PROSITE-ProRule:PRU00202}.				intracellular protein transport (GO:0006886)|neurotransmitter transport (GO:0006836)|regulation of exocytosis (GO:0017157)|regulation of gene expression (GO:0010468)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)			breast(2)|endometrium(1)|large_intestine(5)|lung(5)	13						GTACTCGATGCGGTCAATCAT	0.587																																					p.R231H		.											.	STX1B-90	0			c.G692A						.						142.0	129.0	133.0					16																	31004545		2197	4300	6497	SO:0001583	missense	112755	exon9			TCGATGCGGTCAA	AY028792	CCDS10699.1	16p12-p11	2008-02-05	2007-06-20	2007-06-20	ENSG00000099365	ENSG00000099365			18539	protein-coding gene	gene with protein product		601485	"""syntaxin 1B1"", ""syntaxin 1B2"""	STX1B1, STX1B2			Standard	NM_052874		Approved		uc010cad.2	P61266	OTTHUMG00000132391	ENST00000215095.5:c.692G>A	16.37:g.31004545C>T	ENSP00000215095:p.Arg231His	Somatic	262	0		WXS	Illumina GAIIx	Phase_I	247	108	NM_052874	0	0	0	0	0	Q15531|Q2VPS2	Missense_Mutation	SNP	ENST00000215095.5	37	CCDS10699.1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.571294	0.86542	.	.	ENSG00000099365	ENST00000215095	T	0.27256	1.68	5.0	5.0	0.66597	t-SNARE (1);Syntaxin/epimorphin, conserved site (1);Target SNARE coiled-coil domain (3);	0.000000	0.85682	D	0.000000	T	0.32734	0.0839	M	0.73962	2.25	0.80722	D	1	D;P	0.56746	0.977;0.734	B;B	0.41894	0.369;0.369	T	0.29027	-1.0025	10	0.37606	T	0.19	-13.1055	17.0941	0.86630	0.0:1.0:0.0:0.0	.	231;231	Q2VPS2;P61266	.;STX1B_HUMAN	H	231	ENSP00000215095:R231H	ENSP00000215095:R231H	R	-	2	0	STX1B	30912046	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.487000	0.81328	2.309000	0.77851	0.561000	0.74099	CGC	.		0.587	STX1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255521.2		
PRSS8	5652	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	31143831	31143831	+	Silent	SNP	G	G	A	rs148214625	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr16:31143831G>A	ENST00000317508.6	-	5	887	c.624C>T	c.(622-624)gaC>gaT	p.D208D	RP11-388M20.2_ENST00000563605.1_RNA|PRSS8_ENST00000568261.1_Silent_p.D154D	NM_002773.3	NP_002764.1	Q16651	PRSS8_HUMAN	protease, serine, 8	208	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				positive regulation of sodium ion transport (GO:0010765)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|skin(1)|upper_aerodigestive_tract(1)	8						CAGGCTTGGCGTCGATGTTGT	0.607													G|||	2	0.000399361	0.0	0.0	5008	,	,		19538	0.0		0.002	False		,,,				2504	0.0				p.D208D		.											.	.	0			c.C624T						.	G		1,4247		0,1,2123	103.0	110.0	108.0		624	-6.3	0.0	16	dbSNP_134	108	4,8458		0,4,4227	no	coding-synonymous	PRSS8	NM_002773.3		0,5,6350	AA,AG,GG		0.0473,0.0235,0.0393		208/344	31143831	5,12705	2124	4231	6355	SO:0001819	synonymous_variant	5652	exon5			CTTGGCGTCGATG	U33446	CCDS45469.1	16p11.2	2010-05-07	2007-02-21			ENSG00000052344		"""Serine peptidases / Serine peptidases"""	9491	protein-coding gene	gene with protein product	"""prostasin"""	600823				8838796, 7768952	Standard	NM_002773		Approved		uc002ebc.4	Q16651		ENST00000317508.6:c.624C>T	16.37:g.31143831G>A		Somatic	282	2		WXS	Illumina GAIIx	Phase_I	281	128	NM_002773	0	0	112	114	2	B4DWP2|Q9UCA3	Silent	SNP	ENST00000317508.6	37	CCDS45469.1																																																																																			G|0.999;A|0.001		0.607	PRSS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433536.1	NM_002773	
VPS35	55737	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	46697064	46697064	+	Nonsense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr16:46697064C>T	ENST00000299138.7	-	14	1716	c.1658G>A	c.(1657-1659)tGg>tAg	p.W553*	RP11-93O14.2_ENST00000569353.1_RNA	NM_018206.4	NP_060676.2	Q96QK1	VPS35_HUMAN	vacuolar protein sorting 35 homolog (S. cerevisiae)	553					cell death (GO:0008219)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|retromer complex (GO:0030904)				breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(11)|pancreas(1)|prostate(1)|urinary_tract(1)	23		all_cancers(37;7.65e-05)|all_epithelial(9;0.000154)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)				TTTCTTTTCCCATTTGTCATC	0.323																																					p.W553X		.											.	VPS35-90	0			c.G1658A						.						39.0	39.0	39.0					16																	46697064		2203	4300	6503	SO:0001587	stop_gained	55737	exon14			TTTTCCCATTTGT	AF175265	CCDS10721.1	16q12	2012-06-27	2006-12-19		ENSG00000069329	ENSG00000069329		"""Parkinson disease"""	13487	protein-coding gene	gene with protein product		601501	"""vacuolar protein sorting 35 (yeast homolog)"", ""vacuolar protein sorting 35 (yeast)"""			11112353, 21763482	Standard	NM_018206		Approved	FLJ10752, MEM3, PARK17	uc002eef.4	Q96QK1	OTTHUMG00000132542	ENST00000299138.7:c.1658G>A	16.37:g.46697064C>T	ENSP00000299138:p.Trp553*	Somatic	26	0		WXS	Illumina GAIIx	Phase_I	73	31	NM_018206	0	0	0	0	0	Q561W2|Q9H016|Q9H096|Q9H4P3|Q9H8J0|Q9NRS7|Q9NVG2|Q9NX80|Q9NZK2	Nonsense_Mutation	SNP	ENST00000299138.7	37	CCDS10721.1	.	.	.	.	.	.	.	.	.	.	.	38	6.777574	0.97829	.	.	ENSG00000069329	ENST00000299138;ENST00000541330	.	.	.	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07175	T	0.84	-9.783	19.2823	0.94057	0.0:1.0:0.0:0.0	.	.	.	.	X	553;418	.	ENSP00000299138:W553X	W	-	2	0	VPS35	45254565	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.629000	0.83207	2.554000	0.86153	0.561000	0.74099	TGG	.		0.323	VPS35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255742.3		
PHKB	5257	broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	47644802	47644802	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr16:47644802C>T	ENST00000323584.5	+	14	1453	c.1429C>T	c.(1429-1431)Cgt>Tgt	p.R477C	PHKB_ENST00000455779.1_Missense_Mutation_p.R470C|PHKB_ENST00000566044.1_Missense_Mutation_p.R470C|PHKB_ENST00000299167.8_Missense_Mutation_p.R477C	NM_000293.2	NP_000284.1	Q93100	KPBB_HUMAN	phosphorylase kinase, beta	477					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|liver(1)|lung(18)|ovary(1)|skin(1)	41		all_cancers(37;0.00447)|all_lung(18;0.00616)|Lung NSC(13;0.0418)|Breast(268;0.203)				AAAGGATCAACGTAACGTGAG	0.358																																					p.R477C		.											.	PHKB-154	0			c.C1429T						.						117.0	104.0	109.0					16																	47644802		2201	4300	6501	SO:0001583	missense	5257	exon14			GATCAACGTAACG		CCDS10729.1, CCDS42161.1	16q12-q13	2009-07-10			ENSG00000102893	ENSG00000102893	2.7.11.19		8927	protein-coding gene	gene with protein product		172490					Standard	NM_000293		Approved		uc002eev.4	Q93100	OTTHUMG00000133102	ENST00000323584.5:c.1429C>T	16.37:g.47644802C>T	ENSP00000313504:p.Arg477Cys	Somatic	185	2		WXS	Illumina GAIIx	Phase_I	167	70	NM_000293	0	0	38	75	37	Q8N4T5	Missense_Mutation	SNP	ENST00000323584.5	37	CCDS10729.1	.	.	.	.	.	.	.	.	.	.	C	14.78	2.637895	0.47049	.	.	ENSG00000102893	ENST00000299167;ENST00000455779;ENST00000323584	D;D	0.91521	-2.86;-2.86	4.92	4.92	0.64577	Six-hairpin glycosidase-like (1);Glycoside hydrolase 15-related (1);	0.000000	0.85682	D	0.000000	D	0.93716	0.7992	M	0.77103	2.36	0.80722	D	1	D;D	0.71674	0.991;0.998	P;P	0.58970	0.849;0.738	D	0.93489	0.6834	10	0.45353	T	0.12	-11.8363	13.6642	0.62384	0.0:1.0:0.0:0.0	.	477;470	Q93100;Q93100-4	KPBB_HUMAN;.	C	470;470;477	ENSP00000414345:R470C;ENSP00000313504:R477C	ENSP00000299167:R470C	R	+	1	0	PHKB	46202303	1.000000	0.71417	0.392000	0.26245	0.066000	0.16364	3.363000	0.52321	2.283000	0.76528	0.650000	0.86243	CGT	.		0.358	PHKB-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000430413.1		
CCDC102A	92922	hgsc.bcm.edu	37	16	57562804	57562804	+	Missense_Mutation	SNP	G	G	A	rs12935069		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr16:57562804G>A	ENST00000258214.2	-	2	532	c.286C>T	c.(286-288)Cgg>Tgg	p.R96W		NM_033212.3	NP_149989.2	Q96A19	C102A_HUMAN	coiled-coil domain containing 102A	96				R -> W (in Ref. 2; AAH08285/AAH09941). {ECO:0000305}.						endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)	8						TCCGACCACCGGCGCATGGTC	0.731													A|||	5008	1.0	1.0	1.0	5008	,	,		3757	1.0		1.0	False		,,,				2504	1.0				p.R96W		.											.	CCDC102A-91	0			c.C286T						.						8.0	10.0	9.0					16																	57562804		1834	3717	5551	SO:0001583	missense	92922	exon2			ACCACCGGCGCAT	BC008285	CCDS10784.1	16q13	2008-02-05			ENSG00000135736	ENSG00000135736			28097	protein-coding gene	gene with protein product						12477932	Standard	NM_033212		Approved	MGC10992	uc002elw.3	Q96A19	OTTHUMG00000133472	ENST00000258214.2:c.286C>T	16.37:g.57562804G>A	ENSP00000258214:p.Arg96Trp	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_033212	0	0	0	0	0	Q9BT74	Missense_Mutation	SNP	ENST00000258214.2	37	CCDS10784.1	2180	0.9981684981684982	492	1.0	360	0.994475138121547	570	0.9965034965034965	758	1.0	A	10.17	1.277909	0.23307	.	.	ENSG00000135736	ENST00000258214	T	0.37752	1.18	4.82	4.82	0.62117	.	0.000000	0.64402	N	0.000001	T	0.00012	0.0000	N	0.00049	-2.415	0.40217	P	0.022302999999999962	B	0.02656	0.0	B	0.01281	0.0	T	0.44787	-0.9305	9	0.33141	T	0.24	-23.2491	9.5348	0.39216	0.9152:0.0:0.0848:0.0	rs12935069;rs12935069	96	Q96A19	C102A_HUMAN	W	96	ENSP00000258214:R96W	ENSP00000258214:R96W	R	-	1	2	CCDC102A	56120305	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	6.801000	0.75170	0.698000	0.31739	-0.556000	0.04195	CGG	G|0.001;A|0.999		0.731	CCDC102A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257348.1	NM_033212	
KATNB1	10300	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	57775658	57775658	+	Missense_Mutation	SNP	C	C	T	rs371850267		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr16:57775658C>T	ENST00000379661.3	+	3	492	c.100C>T	c.(100-102)Cgg>Tgg	p.R34W		NM_005886.2	NP_005877.2			katanin p80 (WD repeat containing) subunit B 1											cervix(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	16		all_neural(199;0.223)				AGCCTCCGGGCGGCTGCTGGC	0.652																																					p.R34W		.											.	KATNB1-90	0			c.C100T						.	C	TRP/ARG	0,4396		0,0,2198	49.0	44.0	46.0		100	3.0	1.0	16		46	1,8599	1.2+/-3.3	0,1,4299	no	missense	KATNB1	NM_005886.2	101	0,1,6497	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	34/656	57775658	1,12995	2198	4300	6498	SO:0001583	missense	10300	exon3			TCCGGGCGGCTGC	AF052432	CCDS10788.1	16q12.2	2013-01-09	2003-03-13		ENSG00000140854	ENSG00000140854		"""WD repeat domain containing"""	6217	protein-coding gene	gene with protein product		602703	"""katanin p80 (WD40-containing) subunit B 1"""			9568719	Standard	XM_006721121		Approved		uc002eml.1	Q9BVA0	OTTHUMG00000133467	ENST00000379661.3:c.100C>T	16.37:g.57775658C>T	ENSP00000368982:p.Arg34Trp	Somatic	173	0		WXS	Illumina GAIIx	Phase_I	189	24	NM_005886	0	0	34	44	10		Missense_Mutation	SNP	ENST00000379661.3	37	CCDS10788.1	.	.	.	.	.	.	.	.	.	.	c	24.4	4.523321	0.85600	0.0	1.16E-4	ENSG00000140854	ENST00000379661	T	0.61040	0.14	5.01	3.0	0.34707	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.74450	0.3718	M	0.77313	2.365	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.76435	-0.2960	10	0.87932	D	0	-0.0921	12.73	0.57193	0.2991:0.7009:0.0:0.0	.	34	Q9BVA0	KTNB1_HUMAN	W	34	ENSP00000368982:R34W	ENSP00000368982:R34W	R	+	1	2	KATNB1	56333159	1.000000	0.71417	0.989000	0.46669	0.990000	0.78478	3.786000	0.55431	0.482000	0.27582	0.655000	0.94253	CGG	.		0.652	KATNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257343.3		
CDH16	1014	broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	66944294	66944294	+	Missense_Mutation	SNP	C	C	T	rs565441011		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr16:66944294C>T	ENST00000299752.4	-	15	2229	c.2036G>A	c.(2035-2037)cGc>cAc	p.R679H	CDH16_ENST00000565796.1_Intron|CDH16_ENST00000394055.3_Missense_Mutation_p.R657H|CDH16_ENST00000570262.1_Missense_Mutation_p.R599H|CDH16_ENST00000568632.1_Missense_Mutation_p.R582H	NM_001204744.1|NM_001204745.1|NM_004062.3	NP_001191673.1|NP_001191674.1|NP_004053.1	O75309	CAD16_HUMAN	cadherin 16, KSP-cadherin	679	Ectodomain G.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(3)|large_intestine(10)|lung(15)|ovary(2)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	41		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0877)|Epithelial(162;0.203)		ATGGTCTTGGCGGGGTGTGCA	0.637																																					p.R679H		.											.	CDH16-93	0			c.G2036A						.						106.0	108.0	107.0					16																	66944294		2200	4300	6500	SO:0001583	missense	1014	exon15			TCTTGGCGGGGTG	AF016272	CCDS10823.1, CCDS56002.1, CCDS58471.1, CCDS58472.1	16q22.1	2010-01-26			ENSG00000166589	ENSG00000166589		"""Cadherins / Major cadherins"""	1755	protein-coding gene	gene with protein product		603118				9721215, 7615566	Standard	NM_004062		Approved		uc002eql.3	O75309	OTTHUMG00000137518	ENST00000299752.4:c.2036G>A	16.37:g.66944294C>T	ENSP00000299752:p.Arg679His	Somatic	130	2		WXS	Illumina GAIIx	Phase_I	177	93	NM_004062	0	0	0	0	0	B4DPA8|H3BPD3|Q6UW93	Missense_Mutation	SNP	ENST00000299752.4	37	CCDS10823.1	.	.	.	.	.	.	.	.	.	.	C	15.80	2.939245	0.52972	.	.	ENSG00000166589	ENST00000394055;ENST00000299752;ENST00000544875	T;T	0.56103	0.48;0.48	4.31	4.31	0.51392	.	0.067568	0.56097	D	0.000025	T	0.65790	0.2725	M	0.62723	1.935	0.80722	D	1	D;D;D	0.89917	0.999;0.998;1.0	D;P;D	0.67382	0.951;0.77;0.931	T	0.64812	-0.6319	10	0.40728	T	0.16	-14.5469	12.4598	0.55725	0.0:1.0:0.0:0.0	.	657;679;679	O75309-2;B2R7S8;O75309	.;.;CAD16_HUMAN	H	657;679;643	ENSP00000377619:R657H;ENSP00000299752:R679H	ENSP00000299752:R679H	R	-	2	0	CDH16	65501795	1.000000	0.71417	1.000000	0.80357	0.361000	0.29550	2.968000	0.49224	2.419000	0.82065	0.455000	0.32223	CGC	.		0.637	CDH16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268839.2	NM_004062	
CDH16	1014	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	66946627	66946627	+	Nonsense_Mutation	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr16:66946627G>A	ENST00000299752.4	-	10	1415	c.1222C>T	c.(1222-1224)Cga>Tga	p.R408*	CDH16_ENST00000565796.1_Nonsense_Mutation_p.R408*|CDH16_ENST00000394055.3_Nonsense_Mutation_p.R408*|CDH16_ENST00000570262.1_Nonsense_Mutation_p.R328*|CDH16_ENST00000568632.1_Nonsense_Mutation_p.R311*	NM_001204744.1|NM_001204745.1|NM_004062.3	NP_001191673.1|NP_001191674.1|NP_004053.1	O75309	CAD16_HUMAN	cadherin 16, KSP-cadherin	408	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(3)|large_intestine(10)|lung(15)|ovary(2)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	41		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0877)|Epithelial(162;0.203)		TGGCCTGCTCGGAGTGGGAGC	0.647																																					p.R408X		.											.	CDH16-93	0			c.C1222T						.						58.0	56.0	57.0					16																	66946627		2200	4300	6500	SO:0001587	stop_gained	1014	exon10			CTGCTCGGAGTGG	AF016272	CCDS10823.1, CCDS56002.1, CCDS58471.1, CCDS58472.1	16q22.1	2010-01-26			ENSG00000166589	ENSG00000166589		"""Cadherins / Major cadherins"""	1755	protein-coding gene	gene with protein product		603118				9721215, 7615566	Standard	NM_004062		Approved		uc002eql.3	O75309	OTTHUMG00000137518	ENST00000299752.4:c.1222C>T	16.37:g.66946627G>A	ENSP00000299752:p.Arg408*	Somatic	157	0		WXS	Illumina GAIIx	Phase_I	183	79	NM_004062	0	0	0	0	0	B4DPA8|H3BPD3|Q6UW93	Nonsense_Mutation	SNP	ENST00000299752.4	37	CCDS10823.1	.	.	.	.	.	.	.	.	.	.	G	11.26	1.585003	0.28268	.	.	ENSG00000166589	ENST00000394055;ENST00000299752;ENST00000544875	.	.	.	4.98	2.84	0.33178	.	0.828477	0.10955	N	0.615672	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10111	T	0.7	2.5346	8.7277	0.34480	0.0:0.1629:0.6695:0.1676	.	.	.	.	X	408;408;372	.	ENSP00000299752:R408X	R	-	1	2	CDH16	65504128	0.877000	0.30153	0.039000	0.18376	0.006000	0.05464	1.853000	0.39358	1.213000	0.43380	0.561000	0.74099	CGA	.		0.647	CDH16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268839.2	NM_004062	
ENKD1	84080	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	67697371	67697371	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr16:67697371G>A	ENST00000243878.4	-	6	1153	c.832C>T	c.(832-834)Cgc>Tgc	p.R278C	ACD_ENST00000393919.4_5'Flank|ENKD1_ENST00000602644.1_Missense_Mutation_p.A223V|ENKD1_ENST00000602409.1_5'Flank|ACD_ENST00000219251.8_5'Flank	NM_032140.1	NP_115516.1	Q9H0I2	ENKD1_HUMAN	enkurin domain containing 1	278	Enkurin. {ECO:0000255|PROSITE- ProRule:PRU01000}.					cytoplasmic microtubule (GO:0005881)|microtubule cytoskeleton (GO:0015630)											TCAGGCATGCGCGTGTGGCCT	0.697																																					p.R278C		.											.	.	0			c.C832T						.						36.0	42.0	40.0					16																	67697371		2198	4300	6498	SO:0001583	missense	84080	exon6			GCATGCGCGTGTG	BC008284	CCDS10844.1	16q22.1	2012-10-09	2012-10-09	2012-10-09	ENSG00000124074	ENSG00000124074			25246	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 48"""	C16orf48		11230166	Standard	NM_032140		Approved	DKFZP434A1319	uc002etw.1	Q9H0I2	OTTHUMG00000137550	ENST00000243878.4:c.832C>T	16.37:g.67697371G>A	ENSP00000243878:p.Arg278Cys	Somatic	38	0		WXS	Illumina GAIIx	Phase_I	97	42	NM_032140	0	0	22	52	30	Q6UWD7	Missense_Mutation	SNP	ENST00000243878.4	37	CCDS10844.1	.	.	.	.	.	.	.	.	.	.	g	13.25	2.180441	0.38511	.	.	ENSG00000124074	ENST00000243878	.	.	.	4.72	0.0755	0.14399	.	0.715599	0.13932	N	0.352803	T	0.22085	0.0532	N	0.24115	0.695	0.09310	N	1	D;D	0.64830	0.975;0.994	P;P	0.49953	0.471;0.627	T	0.09952	-1.0651	9	0.38643	T	0.18	-11.4712	3.9607	0.09409	0.2637:0.0:0.3527:0.3836	.	278;160	Q9H0I2;Q9H0I2-2	CP048_HUMAN;.	C	278	.	ENSP00000243878:R278C	R	-	1	0	C16orf48	66254872	0.000000	0.05858	0.162000	0.22713	0.558000	0.35554	0.469000	0.22067	0.218000	0.20820	-0.275000	0.10095	CGC	.		0.697	ENKD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268884.1	NM_032140	
CDH3	1001	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	68732181	68732181	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr16:68732181G>A	ENST00000264012.4	+	16	2912	c.2368G>A	c.(2368-2370)Gcg>Acg	p.A790T	CDH3_ENST00000429102.2_3'UTR|CDH3_ENST00000581171.1_Missense_Mutation_p.A735T	NM_001793.4	NP_001784.2	P22223	CADH3_HUMAN	cadherin 3, type 1, P-cadherin (placental)	790	Ser-rich.				adherens junction organization (GO:0034332)|canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|hair cycle process (GO:0022405)|homophilic cell adhesion (GO:0007156)|keratinization (GO:0031424)|negative regulation of catagen (GO:0051796)|negative regulation of transforming growth factor beta2 production (GO:0032912)|positive regulation of gene expression (GO:0010628)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of melanin biosynthetic process (GO:0048023)|positive regulation of melanosome transport (GO:1902910)|positive regulation of monophenol monooxygenase activity (GO:0032773)|regulation of hair cycle by canonical Wnt signaling pathway (GO:0060901)|response to drug (GO:0042493)|retina homeostasis (GO:0001895)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)|wound healing (GO:0042060)	cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.?(2)|p.A790T(1)		NS(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(4)|ovary(3)|skin(1)|urinary_tract(1)	25		Ovarian(137;0.0564)		OV - Ovarian serous cystadenocarcinoma(108;0.000782)|Epithelial(162;0.0054)|all cancers(182;0.0384)		CTCCGACGCCGCGTCCCTGAG	0.607																																					p.A790T		.											.	CDH3-950	3	Unknown(2)|Substitution - Missense(1)	breast(2)|large_intestine(1)	c.G2368A						.						100.0	99.0	99.0					16																	68732181		2198	4300	6498	SO:0001583	missense	1001	exon16			GACGCCGCGTCCC	X63629	CCDS10868.1	16q22.1	2013-01-08	2001-12-04		ENSG00000062038	ENSG00000062038		"""Cadherins / Major cadherins"""	1762	protein-coding gene	gene with protein product		114021	"""cadherin 3, P-cadherin (placental)"""			1427864	Standard	NM_001793		Approved	CDHP, PCAD	uc002ewf.2	P22223	OTTHUMG00000137560	ENST00000264012.4:c.2368G>A	16.37:g.68732181G>A	ENSP00000264012:p.Ala790Thr	Somatic	143	0		WXS	Illumina GAIIx	Phase_I	221	13	NM_001793	0	0	2	2	0	B2R6F4|Q05DI6	Missense_Mutation	SNP	ENST00000264012.4	37	CCDS10868.1	.	.	.	.	.	.	.	.	.	.	G	14.03	2.414864	0.42817	.	.	ENSG00000062038	ENST00000264012;ENST00000542274	T	0.76709	-1.04	5.51	2.48	0.30137	Cadherin, cytoplasmic domain (1);	0.178051	0.27056	N	0.021147	T	0.60077	0.2241	N	0.20685	0.6	0.39067	D	0.960645	B	0.33637	0.42	B	0.31495	0.131	T	0.57573	-0.7788	10	0.54805	T	0.06	.	7.9203	0.29841	0.1383:0.1342:0.7275:0.0	.	790	P22223	CADH3_HUMAN	T	790;735	ENSP00000264012:A790T	ENSP00000264012:A790T	A	+	1	0	CDH3	67289682	0.946000	0.32159	0.498000	0.27564	0.243000	0.25628	3.120000	0.50430	0.373000	0.24621	-0.794000	0.03295	GCG	.		0.607	CDH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268896.2	NM_001793	
COG8	84342	bcgsc.ca;mdanderson.org	37	16	69373210	69373210	+	Silent	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr16:69373210C>T	ENST00000306875.4	-	1	360	c.246G>A	c.(244-246)ttG>ttA	p.L82L	COG8_ENST00000562081.1_Silent_p.L82L|NIP7_ENST00000254941.6_5'Flank|NIP7_ENST00000569637.2_5'Flank|NIP7_ENST00000254940.5_5'Flank|RP11-343C2.9_ENST00000563634.1_Intron|RP11-343C2.7_ENST00000564737.1_Intron	NM_032382.4	NP_115758.3	Q96MW5	COG8_HUMAN	component of oligomeric golgi complex 8	82					protein transport (GO:0015031)	Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(3)|kidney(1)|large_intestine(2)|ovary(2)|skin(1)	9						TAGCGAAGGCCAAGTCGCGCG	0.721																																					p.L82L		.											.	COG8-91	0			c.G246A						.						12.0	14.0	14.0					16																	69373210		2150	4221	6371	SO:0001819	synonymous_variant	84342	exon1			GAAGGCCAAGTCG	AK025968	CCDS10876.1	16q22.1	2011-05-31			ENSG00000213380	ENSG00000213380		"""Components of oligomeric golgi complex"""	18623	protein-coding gene	gene with protein product		606979				11980916	Standard	NM_032382		Approved	FLJ22315, DOR1	uc002ewy.2	Q96MW5	OTTHUMG00000154277	ENST00000306875.4:c.246G>A	16.37:g.69373210C>T		Somatic	30	1		WXS	Illumina GAIIx	Phase_I	72	38	NM_032382	0	0	3	11	8	Q0VAK2|Q8WVV6|Q9H6F8	Silent	SNP	ENST00000306875.4	37	CCDS10876.1																																																																																			.		0.721	COG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268948.2	NM_032382	
PKD1L3	342372	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	71976623	71976623	+	RNA	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr16:71976623G>A	ENST00000534738.1	-	0	4159							Q7Z443	PK1L3_HUMAN	polycystic kidney disease 1-like 3						cation transport (GO:0006812)|cellular response to acidic pH (GO:0071468)|detection of chemical stimulus involved in sensory perception of sour taste (GO:0001581)|neuropeptide signaling pathway (GO:0007218)|sensory perception of sour taste (GO:0050915)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)			autonomic_ganglia(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|lung(3)|skin(2)	22						AGGTATGGCCGTTATCACAAA	0.498																																					.		.											.	PKD1L3-68	0			.						.						113.0	100.0	104.0					16																	71976623		692	1591	2283			342372	.			ATGGCCGTTATCA	AY164485	CCDS73912.1	16q22.2	2008-02-05				ENSG00000277481			21716	protein-coding gene	gene with protein product		607895				12782129	Standard	NM_181536		Approved		uc010vmm.2	Q7Z443			16.37:g.71976623G>A		Somatic	211	1		WXS	Illumina GAIIx	Phase_I	325	159	.	0	0	0	0	0		RNA	SNP	ENST00000534738.1	37																																																																																				.		0.498	PKD1L3-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000387876.1	NM_181536	
HPR	3250	ucsc.edu;bcgsc.ca	37	16	72108240	72108240	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr16:72108240G>A	ENST00000540303.2	+	3	181	c.149G>A	c.(148-150)cGc>cAc	p.R50H	HPR_ENST00000561690.1_Missense_Mutation_p.R50H|HPR_ENST00000356967.5_Missense_Mutation_p.R50H|HPR_ENST00000228226.8_Missense_Mutation_p.R87H	NM_020995.3	NP_066275.3	P00739	HPTR_HUMAN	haptoglobin-related protein	50	Sushi.					blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|spherical high-density lipoprotein particle (GO:0034366)	hemoglobin binding (GO:0030492)|serine-type endopeptidase activity (GO:0004252)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)|stomach(1)|urinary_tract(2)	20		Ovarian(137;0.125)				CACTTGTTTCGCTACCAGTGT	0.483																																					p.R50H		.											.	HPR-515	0			c.G149A						.						216.0	133.0	160.0					16																	72108240		1966	4141	6107	SO:0001583	missense	3250	exon3			TGTTTCGCTACCA	BC160066	CCDS42193.1	16q22.2	2012-10-03			ENSG00000261701	ENSG00000261701			5156	protein-coding gene	gene with protein product		140210				2987228, 16778136	Standard	NM_020995		Approved		uc002fby.3	P00739	OTTHUMG00000173010	ENST00000540303.2:c.149G>A	16.37:g.72108240G>A	ENSP00000441828:p.Arg50His	Somatic	932	3		WXS	Illumina GAIIx	Phase_I	1231	546	NM_020995	0	0	0	1	1	Q7LE20|Q92658|Q92659|Q9ULB0	Missense_Mutation	SNP	ENST00000540303.2	37	CCDS42193.1	.	.	.	.	.	.	.	.	.	.	G	5.615	0.298255	0.10622	.	.	ENSG00000257017	ENST00000356967;ENST00000540303;ENST00000228226	T;T;T	0.50001	0.76;0.76;0.76	2.4	1.41	0.22369	Complement control module (2);	0.214502	0.30365	N	0.009800	T	0.34745	0.0908	L	0.55743	1.74	0.09310	N	1	B	0.28208	0.203	B	0.20955	0.032	T	0.16276	-1.0408	10	0.36615	T	0.2	.	5.334	0.15947	0.1757:0.0:0.8243:0.0	.	50	P00739	HPTR_HUMAN	H	50;50;87	ENSP00000349451:R50H;ENSP00000441828:R50H;ENSP00000228226:R87H	ENSP00000228226:R87H	R	+	2	0	HP	70665741	0.947000	0.32204	0.028000	0.17463	0.021000	0.10359	1.233000	0.32648	0.331000	0.23511	-1.026000	0.02426	CGC	.		0.483	HPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421696.1	NM_020995	
GLG1	2734	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	74491779	74491779	+	Silent	SNP	G	G	A	rs148460697	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr16:74491779G>A	ENST00000422840.2	-	24	3257	c.3258C>T	c.(3256-3258)cgC>cgT	p.R1086R	GLG1_ENST00000205061.5_Silent_p.R1086R|RNU6-237P_ENST00000515985.1_RNA|GLG1_ENST00000447066.2_Silent_p.R1075R	NM_001145667.1	NP_001139139.1	Q92896	GSLG1_HUMAN	golgi glycoprotein 1	1086					blood coagulation (GO:0007596)|bone morphogenesis (GO:0060349)|leukocyte migration (GO:0050900)|negative regulation of protein processing (GO:0010955)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of chondrocyte differentiation (GO:0032330)	extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(2)|cervix(2)|endometrium(6)|kidney(8)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(1)	57						TACGACGCCCGCGGCCAGGGG	0.517																																					p.R1086R		.											.	GLG1-136	0			c.C3258T						.	G	,,	1,4395	2.1+/-5.4	0,1,2197	132.0	119.0	123.0		3225,3258,3258	-11.6	0.2	16	dbSNP_134	123	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	GLG1	NM_001145666.1,NM_001145667.1,NM_012201.5	,,	0,2,6496	AA,AG,GG		0.0116,0.0227,0.0154	,,	1075/1193,1086/1180,1086/1204	74491779	2,12994	2198	4300	6498	SO:0001819	synonymous_variant	2734	exon24			ACGCCCGCGGCCA		CCDS32485.1, CCDS45526.1, CCDS45527.1	16q22-q23	2010-02-12	2010-02-12			ENSG00000090863			4316	protein-coding gene	gene with protein product		600753	"""golgi apparatus protein 1"""			8530051, 7531823	Standard	NM_012201		Approved	MG-160, ESL-1, CFR-1	uc002fcx.3	Q92896		ENST00000422840.2:c.3258C>T	16.37:g.74491779G>A		Somatic	191	0		WXS	Illumina GAIIx	Phase_I	251	47	NM_001145667	0	0	1	1	0	B7Z8Y4|D3DUJ7|Q13221|Q6P9D1	Silent	SNP	ENST00000422840.2	37	CCDS45527.1																																																																																			G|1.000;A|0.000		0.517	GLG1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000435750.1	NM_012201	
KARS	3735	broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	75665701	75665701	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr16:75665701C>T	ENST00000302445.3	-	8	1007	c.968G>A	c.(967-969)cGg>cAg	p.R323Q	KARS_ENST00000319410.5_Missense_Mutation_p.R351Q|KARS_ENST00000568378.1_Intron	NM_005548.2	NP_005539.1	Q15046	SYK_HUMAN	lysyl-tRNA synthetase	323					cell death (GO:0008219)|diadenosine tetraphosphate biosynthetic process (GO:0015966)|gene expression (GO:0010467)|lysyl-tRNA aminoacylation (GO:0006430)|tRNA aminoacylation for protein translation (GO:0006418)|tRNA processing (GO:0008033)|viral process (GO:0016032)	aminoacyl-tRNA synthetase multienzyme complex (GO:0017101)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|microtubule cytoskeleton (GO:0015630)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	amino acid binding (GO:0016597)|ATP binding (GO:0005524)|lysine-tRNA ligase activity (GO:0004824)|metal ion binding (GO:0046872)|tRNA binding (GO:0000049)			kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	18					L-Lysine(DB00123)	CCCCTCATTCCGGAACTGGCG	0.463																																					p.R351Q		.											.	KARS-92	0			c.G1052A						.						213.0	194.0	201.0					16																	75665701		2198	4300	6498	SO:0001583	missense	3735	exon9			TCATTCCGGAACT	AF285758	CCDS10923.1, CCDS45532.1	16q23.1	2014-09-17			ENSG00000065427	ENSG00000065427	6.1.1.6	"""Aminoacyl tRNA synthetases / Class II"""	6215	protein-coding gene	gene with protein product	"""lysine tRNA ligase"""	601421	"""deafness, autosomal recessive 89"""	DFNB89		8812440, 9278442, 23768514	Standard	NM_005548		Approved	KARS2, KARS1	uc002fer.3	Q15046	OTTHUMG00000137609	ENST00000302445.3:c.968G>A	16.37:g.75665701C>T	ENSP00000303043:p.Arg323Gln	Somatic	206	1		WXS	Illumina GAIIx	Phase_I	234	108	NM_001130089	0	0	101	197	96	A8MSK1|D3DUK4|O14946|Q96J25|Q9HB23	Missense_Mutation	SNP	ENST00000302445.3	37	CCDS10923.1	.	.	.	.	.	.	.	.	.	.	C	36	5.851037	0.97023	.	.	ENSG00000065427	ENST00000319410;ENST00000302445	D;D	0.97404	-4.37;-4.37	6.03	6.03	0.97812	Lysyl-tRNA synthetase, class II, C-terminal (1);Aminoacyl-tRNA synthetase, class II (1);Aminoacyl-tRNA synthetase, class II (D/K/N) (1);	0.000000	0.85682	D	0.000000	D	0.99417	0.9794	H	0.99952	5.035	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.937	D	0.97929	1.0319	10	0.87932	D	0	-18.1097	19.1349	0.93424	0.0:1.0:0.0:0.0	.	351;323	Q15046-2;Q15046	.;SYK_HUMAN	Q	351;323	ENSP00000325448:R351Q;ENSP00000303043:R323Q	ENSP00000303043:R323Q	R	-	2	0	KARS	74223202	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.792000	0.85828	2.861000	0.98227	0.655000	0.94253	CGG	.		0.463	KARS-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000269023.1	NM_005548	
GSE1	23199	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	85699630	85699630	+	Missense_Mutation	SNP	T	T	C	rs17853763		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr16:85699630T>C	ENST00000253458.7	+	13	2983	c.2807T>C	c.(2806-2808)gTt>gCt	p.V936A	GSE1_ENST00000405402.2_Missense_Mutation_p.V832A|GSE1_ENST00000393243.1_Missense_Mutation_p.V863A	NM_014615.2	NP_055430.1	Q14687	GSE1_HUMAN	Gse1 coiled-coil protein	936			V -> A (in dbSNP:rs17853763). {ECO:0000269|PubMed:15489334}.														CCGGTTGGTGTTGCTGCTTCC	0.547																																					p.V936A		.											.	.	0			c.T2807C						.						49.0	53.0	51.0					16																	85699630		2198	4300	6498	SO:0001583	missense	23199	exon13			TTGGTGTTGCTGC	D80004	CCDS10952.1, CCDS45539.1, CCDS62007.1	16q24.1	2012-12-07	2012-12-07	2012-10-02	ENSG00000131149	ENSG00000131149			28979	protein-coding gene	gene with protein product	"""genetic suppressor element 1"""		"""KIAA0182"", ""Gse1 coiled-coil protein homolog (mouse)"""	KIAA0182		8724849, 8786132	Standard	NM_014615		Approved		uc002fix.4	Q14687	OTTHUMG00000137650	ENST00000253458.7:c.2807T>C	16.37:g.85699630T>C	ENSP00000253458:p.Val936Ala	Somatic	78	0		WXS	Illumina GAIIx	Phase_I	145	8	NM_014615	0	0	22	22	0	D3DUM4|Q8IY61|Q96GA4|Q9BW09	Missense_Mutation	SNP	ENST00000253458.7	37	CCDS10952.1	.	.	.	.	.	.	.	.	.	.	T	1.276	-0.611780	0.03690	.	.	ENSG00000131149	ENST00000405402;ENST00000253458;ENST00000393243	T;T;T	0.30182	1.54;1.54;1.54	5.52	2.86	0.33363	.	1.095190	0.06892	N	0.804456	T	0.15478	0.0373	N	0.08118	0	0.09310	N	1	B;P;P;P	0.44241	0.087;0.829;0.829;0.737	B;B;B;B	0.38264	0.033;0.173;0.269;0.138	T	0.10132	-1.0643	10	0.22706	T	0.39	-1.9593	7.712	0.28684	0.0:0.0821:0.1415:0.7764	rs17853763	699;832;863;936	Q59GZ0;Q14687-2;Q14687-3;Q14687	.;.;.;GSE1_HUMAN	A	832;936;863	ENSP00000384839:V832A;ENSP00000253458:V936A;ENSP00000376934:V863A	ENSP00000253458:V936A	V	+	2	0	KIAA0182	84257131	0.049000	0.20398	0.001000	0.08648	0.030000	0.12068	1.745000	0.38278	0.887000	0.36136	0.459000	0.35465	GTT	T|1.000;|0.000		0.547	GSE1-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325527.1	NM_014615	
FOXC2	2303	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	16	86602305	86602305	+	Missense_Mutation	SNP	A	A	G	rs138612549	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr16:86602305A>G	ENST00000320354.4	+	1	1449	c.1364A>G	c.(1363-1365)aAc>aGc	p.N455S	RP11-463O9.5_ENST00000563280.1_RNA	NM_005251.2	NP_005242.1	Q99958	FOXC2_HUMAN	forkhead box C2 (MFH-1, mesenchyme forkhead 1)	455					artery morphogenesis (GO:0048844)|blood vessel remodeling (GO:0001974)|camera-type eye development (GO:0043010)|cardiac muscle cell proliferation (GO:0060038)|collagen fibril organization (GO:0030199)|embryonic heart tube development (GO:0035050)|embryonic viscerocranium morphogenesis (GO:0048703)|glomerular endothelium development (GO:0072011)|glomerular mesangial cell development (GO:0072144)|glomerular visceral epithelial cell differentiation (GO:0072112)|heart development (GO:0007507)|insulin receptor signaling pathway (GO:0008286)|lymphangiogenesis (GO:0001946)|mesoderm development (GO:0007498)|metanephros development (GO:0001656)|negative regulation of apoptotic process involved in outflow tract morphogenesis (GO:1902257)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural crest cell development (GO:0014032)|Notch signaling pathway (GO:0007219)|ossification (GO:0001503)|paraxial mesodermal cell fate commitment (GO:0048343)|patterning of blood vessels (GO:0001569)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vascular wound healing (GO:0035470)|regulation of blood vessel size (GO:0050880)|regulation of organ growth (GO:0046620)|response to hormone (GO:0009725)|somitogenesis (GO:0001756)|ureteric bud development (GO:0001657)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	15						GAGATGTTCAACTCCCACCGG	0.632									Late-onset Hereditary Lymphedema				A|||	10	0.00199681	0.0076	0.0	5008	,	,		10518	0.0		0.0	False		,,,				2504	0.0				p.N455S		.											.	FOXC2-226	0			c.A1364G						.	A	SER/ASN	2,4376		0,2,2187	34.0	35.0	35.0		1364	-3.4	1.0	16	dbSNP_134	35	0,8570		0,0,4285	yes	missense	FOXC2	NM_005251.2	46	0,2,6472	GG,GA,AA		0.0,0.0457,0.0154	benign	455/502	86602305	2,12946	2189	4285	6474	SO:0001583	missense	2303	exon1	Familial Cancer Database	Hereditary Lymphedema type II, Meige Lymphedema	TGTTCAACTCCCA	Y08223	CCDS10958.1	16q24.1	2008-04-10			ENSG00000176692	ENSG00000176692		"""Forkhead boxes"""	3801	protein-coding gene	gene with protein product		602402		FKHL14		9169153, 8674414	Standard	NM_005251		Approved	MFH-1	uc002fjq.3	Q99958	OTTHUMG00000137652	ENST00000320354.4:c.1364A>G	16.37:g.86602305A>G	ENSP00000326371:p.Asn455Ser	Somatic	154	0		WXS	Illumina GAIIx	Phase_I	196	100	NM_005251	0	0	1	1	0	C6KMR9|Q14DA6	Missense_Mutation	SNP	ENST00000320354.4	37	CCDS10958.1	12	0.005494505494505495	12	0.024390243902439025	0	0.0	0	0.0	0	0.0	A	10.99	1.506851	0.26949	4.57E-4	0.0	ENSG00000176692	ENST00000320354	T	0.76186	-1.0	4.35	-3.38	0.04883	.	423.213000	0.00166	N	0.000000	T	0.42743	0.1216	N	0.19112	0.55	0.30142	N	0.803829	B	0.02656	0.0	B	0.01281	0.0	T	0.44329	-0.9335	10	0.59425	D	0.04	.	5.9927	0.19476	0.436:0.2396:0.3245:0.0	.	455	Q99958	FOXC2_HUMAN	S	455	ENSP00000326371:N455S	ENSP00000326371:N455S	N	+	2	0	FOXC2	85159806	1.000000	0.71417	0.976000	0.42696	0.919000	0.55068	1.954000	0.40362	-0.796000	0.04456	0.379000	0.24179	AAC	A|0.998;G|0.002		0.632	FOXC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269104.2	NM_005251	
ANKRD11	29123	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	89346959	89346959	+	Silent	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr16:89346959C>T	ENST00000301030.4	-	9	6451	c.5991G>A	c.(5989-5991)gcG>gcA	p.A1997A	ANKRD11_ENST00000378330.2_Silent_p.A1997A	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	1997	Pro-rich.				bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		GGAGGGGGTCCGCGGGGCAGA	0.701																																					p.A1997A		.											.	ANKRD11-139	0			c.G5991A						.						12.0	15.0	14.0					16																	89346959		2071	4024	6095	SO:0001819	synonymous_variant	29123	exon9			GGGGTCCGCGGGG	AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.5991G>A	16.37:g.89346959C>T		Somatic	29	0		WXS	Illumina GAIIx	Phase_I	70	34	NM_001256183	0	0	7	15	8	Q6NTG1|Q6QMF8	Silent	SNP	ENST00000301030.4	37	CCDS32513.1																																																																																			.		0.701	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430462.3	NM_013275	
SPG7	6687	broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	89611117	89611117	+	Silent	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr16:89611117C>T	ENST00000268704.2	+	10	1401	c.1386C>T	c.(1384-1386)gaC>gaT	p.D462D		NM_003119.2	NP_003110.1	Q9UQ90	SPG7_HUMAN	spastic paraplegia 7 (pure and complicated autosomal recessive)	462					anterograde axon cargo transport (GO:0008089)|cell death (GO:0008219)|mitochondrion organization (GO:0007005)|nervous system development (GO:0007399)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metalloendopeptidase activity (GO:0004222)|peptidase activity (GO:0008233)|unfolded protein binding (GO:0051082)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|ovary(2)|urinary_tract(1)	20		all_hematologic(23;0.00824)|Colorectal(91;0.102)		all cancers(4;1.39e-07)|OV - Ovarian serous cystadenocarcinoma(4;5.64e-06)|BRCA - Breast invasive adenocarcinoma(80;0.015)		ACATTTTGGACGGTGCTCTGA	0.612																																					p.D462D		.											.	SPG7-226	0			c.C1386T						.						160.0	127.0	138.0					16																	89611117		2198	4300	6498	SO:0001819	synonymous_variant	6687	exon10			TTTGGACGGTGCT	Y16610	CCDS10977.1, CCDS10978.1	16q24.3	2010-04-21	2007-04-23		ENSG00000197912	ENSG00000197912		"""ATPases / AAA-type"""	11237	protein-coding gene	gene with protein product	"""paraplegin"""	602783	"""cell matrix adhesion regulator"""	CMAR		9635427, 9634528	Standard	XM_006721264		Approved	CAR, SPG5C	uc002fnj.3	Q9UQ90	OTTHUMG00000138046	ENST00000268704.2:c.1386C>T	16.37:g.89611117C>T		Somatic	200	1		WXS	Illumina GAIIx	Phase_I	283	127	NM_003119	0	0	52	100	48	O75756|Q2TB70|Q58F00|Q96IB0	Silent	SNP	ENST00000268704.2	37	CCDS10977.1																																																																																			.		0.612	SPG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269921.2	NM_003119	
PRPF8	10594	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	1561614	1561614	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr17:1561614C>T	ENST00000572621.1	-	33	5703	c.5438G>A	c.(5437-5439)cGc>cAc	p.R1813H	PRPF8_ENST00000304992.6_Missense_Mutation_p.R1813H			Q6P2Q9	PRP8_HUMAN	pre-mRNA processing factor 8	1813	Involved in interaction with pre-mRNA 5' splice site.|RNase H homology domain.				gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U5 snRNP (GO:0005682)	poly(A) RNA binding (GO:0044822)|U5 snRNA binding (GO:0030623)|U6 snRNA binding (GO:0017070)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(13)|lung(24)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	77				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		CTGCCCTGTGCGTGGGTTGAA	0.527																																					p.R1813H		.											.	PRPF8-525	0			c.G5438A						.						174.0	161.0	165.0					17																	1561614		2203	4300	6503	SO:0001583	missense	10594	exon34			CCTGTGCGTGGGT	AB007510	CCDS11010.1	17p13.3	2013-07-16	2013-06-10		ENSG00000174231	ENSG00000174231			17340	protein-coding gene	gene with protein product		607300	"""PRP8 pre-mRNA processing factor 8 homolog (yeast)"", ""PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae)"""	RP13		11468273, 10411133	Standard	NM_006445		Approved	PRPC8, Prp8, hPrp8, SNRNP220	uc002fte.3	Q6P2Q9	OTTHUMG00000090553	ENST00000572621.1:c.5438G>A	17.37:g.1561614C>T	ENSP00000460348:p.Arg1813His	Somatic	324	0		WXS	Illumina GAIIx	Phase_I	172	161	NM_006445	0	0	1	118	117	O14547|O75965	Missense_Mutation	SNP	ENST00000572621.1	37	CCDS11010.1	.	.	.	.	.	.	.	.	.	.	c	35	5.498706	0.96355	.	.	ENSG00000174231	ENST00000304992;ENST00000540177	T	0.81163	-1.46	6.03	6.03	0.97812	PRP8 domain IV core (1);	0.000000	0.85682	D	0.000000	D	0.90614	0.7057	M	0.81341	2.54	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.88820	0.3298	10	0.41790	T	0.15	.	20.5568	0.99304	0.0:1.0:0.0:0.0	.	1813	Q6P2Q9	PRP8_HUMAN	H	1813;338	ENSP00000304350:R1813H	ENSP00000304350:R1813H	R	-	2	0	PRPF8	1508364	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.792000	0.85828	2.861000	0.98227	0.655000	0.94253	CGC	.		0.527	PRPF8-002	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438412.2		
SGSM2	9905	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	2265553	2265553	+	Silent	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr17:2265553G>A	ENST00000426855.2	+	4	622	c.447G>A	c.(445-447)gcG>gcA	p.A149A	SGSM2_ENST00000574563.1_Silent_p.A149A|SGSM2_ENST00000268989.3_Silent_p.A149A	NM_001098509.1	NP_001091979.1	O43147	SGSM2_HUMAN	small G protein signaling modulator 2	149	RUN. {ECO:0000255|PROSITE- ProRule:PRU00178}.				late endosome to Golgi transport (GO:0034499)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)		Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	20				Colorectal(2;5.15e-05)|READ - Rectum adenocarcinoma(2;0.000115)		AATACCTGGCGGAAAACTGCA	0.617																																					p.A149A		.											.	SGSM2-68	0			c.G447A						.						79.0	81.0	81.0					17																	2265553		2203	4300	6503	SO:0001819	synonymous_variant	9905	exon4			CCTGGCGGAAAAC	BC039204	CCDS32526.1, CCDS45570.1	17p13.3	2013-07-10	2007-08-14	2007-08-14		ENSG00000141258		"""Small G protein signaling modulators"""	29026	protein-coding gene	gene with protein product		611418	"""RUN and TBC1 domain containing 1"""	RUTBC1		9455477, 17509819, 21808068	Standard	NM_014853		Approved	KIAA0397	uc002fum.4	O43147		ENST00000426855.2:c.447G>A	17.37:g.2265553G>A		Somatic	131	0		WXS	Illumina GAIIx	Phase_I	70	66	NM_001098509	0	0	0	0	0	A5LGW2|B4DH69|Q49AC2|Q6ZUY2|Q8IXU4	Silent	SNP	ENST00000426855.2	37	CCDS45570.1																																																																																			.		0.617	SGSM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438186.1	NM_014853	
CLUH	23277	broad.mit.edu	37	17	2598787	2598787	+	Missense_Mutation	SNP	C	C	T	rs368772841		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr17:2598787C>T	ENST00000570628.2	-	14	2413	c.2308G>A	c.(2308-2310)Gtg>Atg	p.V770M	CLUH_ENST00000435359.1_Missense_Mutation_p.V770M|CLUH_ENST00000538975.1_Missense_Mutation_p.V770M			O75153	CLU_HUMAN	clustered mitochondria (cluA/CLU1) homolog	770					intracellular distribution of mitochondria (GO:0048312)	cytoplasm (GO:0005737)											GCCCCGTCCACGGGCAGGACC	0.692													C|||	1	0.000199681	0.0	0.0014	5008	,	,		15753	0.0		0.0	False		,,,				2504	0.0				p.V770M		.											.	.	0			c.G2308A						.						16.0	19.0	18.0					17																	2598787		2147	4243	6390	SO:0001583	missense	23277	exon14			CGTCCACGGGCAG	AB014564	CCDS45572.1	17p13.3	2012-12-18	2012-11-30	2012-11-30	ENSG00000132361	ENSG00000132361			29094	protein-coding gene	gene with protein product			"""KIAA0664"""	KIAA0664			Standard	XM_005256567		Approved	CLU1	uc002fuy.1	O75153	OTTHUMG00000177575	ENST00000570628.2:c.2308G>A	17.37:g.2598787C>T	ENSP00000458986:p.Val770Met	Somatic	53	0		WXS	Illumina GAIIx	Phase_I	59	4	NM_015229	0	0	30	31	1	Q6AHY2|Q6P3X7|Q6ZUG8|Q8N4U7|Q9BTA3|Q9H979	Missense_Mutation	SNP	ENST00000570628.2	37	CCDS45572.1	.	.	.	.	.	.	.	.	.	.	C	0.032	-1.327471	0.01309	.	.	ENSG00000132361	ENST00000435359;ENST00000322335;ENST00000538975	T;T	0.79141	-1.24;-1.24	5.24	3.03	0.35002	.	0.041945	0.85682	N	0.000000	T	0.40119	0.1104	N	0.00633	-1.31	0.27693	N	0.946061	B;B	0.02656	0.0;0.0	B;B	0.08055	0.003;0.003	T	0.43343	-0.9397	10	0.02654	T	1	.	8.6347	0.33941	0.0:0.1565:0.0:0.8435	.	770;771	O75153;C9J6D7	K0664_HUMAN;.	M	770;771;770	ENSP00000388872:V770M;ENSP00000439628:V770M	ENSP00000320468:V771M	V	-	1	0	KIAA0664	2545537	1.000000	0.71417	1.000000	0.80357	0.075000	0.17131	4.860000	0.62961	0.341000	0.23771	-0.458000	0.05436	GTG	.		0.692	CLUH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437807.2	NM_015229	
ATP2A3	489	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	3840801	3840801	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr17:3840801C>T	ENST00000352011.3	-	15	2284	c.2230G>A	c.(2230-2232)Gtg>Atg	p.V744M	ATP2A3_ENST00000397039.1_De_novo_Start_InFrame|ATP2A3_ENST00000397043.3_Missense_Mutation_p.V744M|ATP2A3_ENST00000359983.3_Missense_Mutation_p.V744M|ATP2A3_ENST00000397041.3_Missense_Mutation_p.V744M|ATP2A3_ENST00000397035.3_Missense_Mutation_p.V744M|ATP2A3_ENST00000309890.7_Missense_Mutation_p.V744M			Q93084	AT2A3_HUMAN	ATPase, Ca++ transporting, ubiquitous	744					blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	36				LUAD - Lung adenocarcinoma(1115;0.000692)|Lung(3;0.0766)		ACCGCAGCCACGATGGAGGCA	0.602																																					p.V744M	GBM(32;29 774 15719 37967)	.											.	ATP2A3-156	0			c.G2230A						.						95.0	71.0	79.0					17																	3840801		2203	4300	6503	SO:0001583	missense	489	exon15			CAGCCACGATGGA		CCDS11041.1, CCDS11042.1, CCDS42234.1, CCDS45579.1, CCDS45580.1	17p13.3	2012-10-22			ENSG00000074370	ENSG00000074370	3.6.3.8	"""ATPases / P-type"""	813	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 3"", ""calcium pump 3"""	601929				8809064	Standard	NM_005173		Approved	SERCA3	uc002fwy.2	Q93084		ENST00000352011.3:c.2230G>A	17.37:g.3840801C>T	ENSP00000301387:p.Val744Met	Somatic	314	1		WXS	Illumina GAIIx	Phase_I	144	136	NM_174956	0	0	1	1	0	A8MZG0|D3DTJ8|O60900|O60901|O75501|O75502|Q16115|Q6JHX1|Q8TEX5|Q8TEX6	Missense_Mutation	SNP	ENST00000352011.3	37	CCDS11041.1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.549194	0.86127	.	.	ENSG00000074370	ENST00000397043;ENST00000352011;ENST00000359983;ENST00000397041;ENST00000397045;ENST00000309890;ENST00000397035	D;D;D;D;D;D	0.98400	-4.91;-4.91;-4.91;-4.91;-4.91;-4.91	4.17	4.17	0.49024	HAD-like domain (1);ATPase, P-type,  transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.99318	0.9761	H	0.96996	3.92	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.91635	0.999;0.996;0.991;0.996;0.996;0.996	D	0.98370	1.0553	10	0.87932	D	0	.	16.7406	0.85458	0.0:1.0:0.0:0.0	.	744;744;744;744;744;744	Q93084-4;Q93084-2;Q93084;Q93084-6;G3XAE1;Q93084-3	.;.;AT2A3_HUMAN;.;.;.	M	744	ENSP00000380236:V744M;ENSP00000301387:V744M;ENSP00000353072:V744M;ENSP00000380234:V744M;ENSP00000312577:V744M;ENSP00000380229:V744M	ENSP00000312577:V744M	V	-	1	0	ATP2A3	3787550	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	7.651000	0.83577	2.607000	0.88179	0.563000	0.77884	GTG	.		0.602	ATP2A3-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000438401.1	NM_174953	
AIPL1	23746	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	6329050	6329050	+	Silent	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr17:6329050C>T	ENST00000381129.3	-	6	965	c.885G>A	c.(883-885)ccG>ccA	p.P295P	AIPL1_ENST00000576307.1_Silent_p.P235P|AIPL1_ENST00000575265.1_3'UTR|AIPL1_ENST00000574506.1_Silent_p.P283P|AIPL1_ENST00000576776.1_Silent_p.P271P|AIPL1_ENST00000250087.5_Silent_p.P232P|AIPL1_ENST00000570466.1_Silent_p.P273P	NM_001033055.1|NM_014336.3	NP_001028227.1|NP_055151.3	Q9NZN9	AIPL1_HUMAN	aryl hydrocarbon receptor interacting protein-like 1	295					negative regulation of apoptotic process (GO:0043066)|phototransduction, visible light (GO:0007603)|protein farnesylation (GO:0018343)|protein folding (GO:0006457)|regulation of cGMP metabolic process (GO:0030823)|retina homeostasis (GO:0001895)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|photoreceptor inner segment (GO:0001917)	farnesylated protein binding (GO:0001918)|unfolded protein binding (GO:0051082)			NS(1)|kidney(1)|large_intestine(2)|liver(1)|lung(5)|ovary(1)|skin(1)	12				COAD - Colon adenocarcinoma(228;0.141)		TCTGCATGGACGGCTCCAGCT	0.662																																					p.P295P		.											.	AIPL1-90	0			c.G885A						.						38.0	36.0	37.0					17																	6329050		2203	4300	6503	SO:0001819	synonymous_variant	23746	exon6			CATGGACGGCTCC	AF148864	CCDS11075.1, CCDS32539.1, CCDS32540.1, CCDS67130.1, CCDS67131.1, CCDS67132.1, CCDS67133.1	17p13.1	2013-01-08	2001-11-29		ENSG00000129221	ENSG00000129221			359	protein-coding gene	gene with protein product		604392	"""aryl hydrocarbon receptor-interacting protein-like 1"""	LCA4		10615133, 14555765, 15365173	Standard	NM_001285402		Approved		uc002gcp.3	Q9NZN9	OTTHUMG00000102043	ENST00000381129.3:c.885G>A	17.37:g.6329050C>T		Somatic	76	1		WXS	Illumina GAIIx	Phase_I	60	56	NM_014336	0	0	0	0	0	D3DTM4|Q659W3|Q659W4|Q6ZZB6|Q8N6A0|Q9H873|Q9NS10	Silent	SNP	ENST00000381129.3	37	CCDS11075.1																																																																																			.		0.662	AIPL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000219828.3	NM_014336	
KIAA0753	9851	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	6528100	6528100	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr17:6528100C>T	ENST00000361413.3	-	4	1158	c.800G>A	c.(799-801)cGa>cAa	p.R267Q	KIAA0753_ENST00000542606.1_Intron|KIAA0753_ENST00000572370.1_5'UTR	NM_014804.2	NP_055619.2	Q2KHM9	K0753_HUMAN	KIAA0753	267						centrosome (GO:0005813)|cytoplasm (GO:0005737)				endometrium(4)|large_intestine(11)|lung(5)|prostate(4)	24				COAD - Colon adenocarcinoma(228;0.157)		GTAGAGCATTCGGGCAGAGCG	0.458																																					p.R267Q		.											.	KIAA0753-90	0			c.G800A						.						50.0	51.0	50.0					17																	6528100		2016	4174	6190	SO:0001583	missense	9851	exon4			AGCATTCGGGCAG		CCDS42247.1	17p13.1	2014-04-04			ENSG00000198920	ENSG00000198920			29110	protein-coding gene	gene with protein product						24613305	Standard	NM_014804		Approved		uc002gde.4	Q2KHM9	OTTHUMG00000177928	ENST00000361413.3:c.800G>A	17.37:g.6528100C>T	ENSP00000355250:p.Arg267Gln	Somatic	87	1		WXS	Illumina GAIIx	Phase_I	62	58	NM_014804	0	0	0	0	0	A8KA11|B7Z479|O94853|Q05D97|Q2KHN0|Q9UG45	Missense_Mutation	SNP	ENST00000361413.3	37	CCDS42247.1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.647095	0.87958	.	.	ENSG00000198920	ENST00000361413	T	0.10192	2.9	5.2	4.17	0.49024	.	0.136711	0.50627	D	0.000115	T	0.29716	0.0742	M	0.69823	2.125	0.80722	D	1	D	0.89917	1.0	D	0.72338	0.977	T	0.00722	-1.1594	10	0.44086	T	0.13	-13.3315	13.5877	0.61942	0.1553:0.8447:0.0:0.0	.	267	Q2KHM9	K0753_HUMAN	Q	267	ENSP00000355250:R267Q	ENSP00000355250:R267Q	R	-	2	0	KIAA0753	6468824	0.989000	0.36119	0.989000	0.46669	0.998000	0.95712	2.747000	0.47475	2.608000	0.88229	0.650000	0.86243	CGA	.		0.458	KIAA0753-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439769.3	NM_014804	
TP53	7157	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	7574017	7574017	+	Missense_Mutation	SNP	C	C	T	rs121912664		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr17:7574017C>T	ENST00000269305.4	-	10	1199	c.1010G>A	c.(1009-1011)cGc>cAc	p.R337H	TP53_ENST00000445888.2_Missense_Mutation_p.R337H|TP53_ENST00000420246.2_3'UTR|TP53_ENST00000413465.2_Intron|TP53_ENST00000455263.2_3'UTR|TP53_ENST00000359597.4_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	337	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.|Interaction with HIPK2.|Oligomerization.		R -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:9452042}.|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:11481490}.|R -> L (in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R337L(15)|p.0?(8)|p.R337H(4)|p.I332fs*5(1)|p.?(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CATCTCGAAGCGCTCACGCCC	0.527		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.R337H	Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	.	TP53-70225	29	Substitution - Missense(19)|Whole gene deletion(8)|Unknown(1)|Deletion - Frameshift(1)	lung(8)|liver(8)|bone(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|central_nervous_system(2)|stomach(1)|breast(1)	c.G1010A	GRCh37	CM012663	TP53	M	rs121912664	.						57.0	45.0	49.0					17																	7574017		2203	4300	6503	SO:0001583	missense	7157	exon10	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	TCGAAGCGCTCAC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.1010G>A	17.37:g.7574017C>T	ENSP00000269305:p.Arg337His	Somatic	162	1		WXS	Illumina GAIIx	Phase_I	97	91	NM_000546	0	0	0	6	6	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	14.54	2.565214	0.45694	.	.	ENSG00000141510	ENST00000269305;ENST00000445888;ENST00000396473	D;D	0.95171	-3.63;-3.63	5.43	3.45	0.39498	p53, tetramerisation domain (3);	0.000000	0.85682	D	0.000000	D	0.95063	0.8401	M	0.73598	2.24	0.40311	D	0.97871	D	0.53462	0.96	P	0.53146	0.719	D	0.94086	0.7348	10	0.62326	D	0.03	-7.3279	9.8868	0.41266	0.0:0.8331:0.0:0.1669	.	337	P04637	P53_HUMAN	H	337;337;326	ENSP00000269305:R337H;ENSP00000391478:R337H	ENSP00000269305:R337H	R	-	2	0	TP53	7514742	0.593000	0.26840	0.008000	0.14137	0.280000	0.26924	0.875000	0.28079	0.671000	0.31185	0.561000	0.74099	CGC	.		0.527	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
KDM6B	23135	bcgsc.ca	37	17	7751926	7751926	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr17:7751926G>T	ENST00000448097.2	+	11	2651	c.2320G>T	c.(2320-2322)Gcc>Tcc	p.A774S	KDM6B_ENST00000254846.5_Missense_Mutation_p.A774S			O15054	KDM6B_HUMAN	lysine (K)-specific demethylase 6B	774	Pro-rich.				cardiac muscle cell differentiation (GO:0055007)|cellular response to hydrogen peroxide (GO:0070301)|endothelial cell differentiation (GO:0045446)|inflammatory response (GO:0006954)|mesodermal cell differentiation (GO:0048333)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(3)|lung(18)|ovary(1)|pancreas(1)|skin(5)	37						Gccaccaccagccctaccacc	0.662																																					p.A774S		.											.	KDM6B-205	0			c.G2320T						.						59.0	61.0	60.0					17																	7751926		2176	4272	6448	SO:0001583	missense	23135	exon11			CCACCAGCCCTAC	AB002344	CCDS32552.1	17p13.1	2011-07-01	2009-04-17	2009-04-17		ENSG00000132510		"""Chromatin-modifying enzymes / K-demethylases"""	29012	protein-coding gene	gene with protein product		611577	"""jumonji domain containing 3"", ""jumonji domain containing 3, histone lysine demethylase"""	JMJD3		10662545, 9205841	Standard	NM_001080424		Approved	KIAA0346	uc002giw.1	O15054		ENST00000448097.2:c.2320G>T	17.37:g.7751926G>T	ENSP00000412513:p.Ala774Ser	Somatic	38	0		WXS	Illumina GAIIx	Phase_I	23	4	NM_001080424	0	0	1	1	0	C9IZ40|Q96G33	Missense_Mutation	SNP	ENST00000448097.2	37		.	.	.	.	.	.	.	.	.	.	G	11.64	1.699531	0.30142	.	.	ENSG00000132510	ENST00000254846;ENST00000448097	T;T	0.10192	2.9;2.9	4.66	3.68	0.42216	.	0.331340	0.24745	N	0.035960	T	0.07773	0.0195	N	0.14661	0.345	0.24481	N	0.99435	B;B	0.25609	0.01;0.13	B;B	0.28709	0.019;0.093	T	0.29397	-1.0013	10	0.33940	T	0.23	-2.3867	14.0285	0.64601	0.0:0.153:0.847:0.0	.	774;774	O15054;O15054-1	KDM6B_HUMAN;.	S	774	ENSP00000254846:A774S;ENSP00000412513:A774S	ENSP00000254846:A774S	A	+	1	0	KDM6B	7692651	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.532000	0.67154	1.308000	0.44962	0.561000	0.74099	GCC	.		0.662	KDM6B-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000440248.1	XM_043272	
LRRC48	83450	ucsc.edu;bcgsc.ca	37	17	17900841	17900841	+	Missense_Mutation	SNP	C	C	T	rs565211645		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr17:17900841C>T	ENST00000399187.1	+	9	1110	c.892C>T	c.(892-894)Cgg>Tgg	p.R298W	LRRC48_ENST00000399182.1_Missense_Mutation_p.R298W|LRRC48_ENST00000584166.1_Missense_Mutation_p.R298W|LRRC48_ENST00000313838.8_Missense_Mutation_p.R298W|LRRC48_ENST00000411504.2_Missense_Mutation_p.R298W	NM_031294.3	NP_112584.3	Q9H069	LRC48_HUMAN	leucine rich repeat containing 48	298						cytoplasm (GO:0005737)				breast(1)|large_intestine(2)|lung(2)|pancreas(1)|urinary_tract(1)	7	all_neural(463;0.228)					GCAGGAGAAGCGGAAAACAGA	0.483													C|||	1	0.000199681	0.0008	0.0	5008	,	,		24275	0.0		0.0	False		,,,				2504	0.0				p.R298W		.											.	LRRC48-46	0			c.C892T						.						91.0	88.0	89.0					17																	17900841		2075	4214	6289	SO:0001583	missense	83450	exon9			GAGAAGCGGAAAA	AK093317	CCDS45622.1, CCDS45623.1	17p11.2	2014-07-18			ENSG00000171962	ENSG00000171962			25384	protein-coding gene	gene with protein product						11997338, 23354437	Standard	NM_001130090		Approved	DKFZP586M1120	uc021trk.1	Q9H069	OTTHUMG00000059355	ENST00000399187.1:c.892C>T	17.37:g.17900841C>T	ENSP00000382140:p.Arg298Trp	Somatic	299	3		WXS	Illumina GAIIx	Phase_I	209	186	NM_031294	0	0	0	0	0	A8KAE6|Q86SF9|Q86W73|Q8IWG0	Missense_Mutation	SNP	ENST00000399187.1	37	CCDS45622.1	.	.	.	.	.	.	.	.	.	.	C	14.53	2.562093	0.45590	.	.	ENSG00000171962	ENST00000313838;ENST00000448396;ENST00000411504;ENST00000399184;ENST00000399187;ENST00000399182;ENST00000399185	T;T;T;T	0.56941	0.43;0.43;0.43;0.43	4.56	-1.21	0.09524	.	0.000000	0.85682	D	0.000000	T	0.42877	0.1222	L	0.58583	1.82	0.80722	D	1	P;P	0.47409	0.895;0.866	B;B	0.40940	0.144;0.344	T	0.42430	-0.9452	10	0.66056	D	0.02	-30.4086	8.2505	0.31715	0.4336:0.4845:0.0:0.0819	.	298;298	Q9H069;Q9H069-2	LRC48_HUMAN;.	W	298	ENSP00000326870:R298W;ENSP00000394020:R298W;ENSP00000382140:R298W;ENSP00000382136:R298W	ENSP00000326870:R298W	R	+	1	2	LRRC48	17841566	0.998000	0.40836	0.990000	0.47175	0.916000	0.54674	0.289000	0.18957	0.073000	0.16731	-0.254000	0.11334	CGG	.		0.483	LRRC48-001	KNOWN	non_canonical_conserved|non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131945.3	NM_031294	
EVPLL	645027	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	18286644	18286644	+	Silent	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr17:18286644C>T	ENST00000399134.4	+	8	1090	c.732C>T	c.(730-732)gaC>gaT	p.D244D	RP1-37N7.1_ENST00000579352.1_RNA	NM_001145127.1	NP_001138599.1	A8MZ36	EVPLL_HUMAN	envoplakin-like	244										NS(1)|endometrium(1)|large_intestine(1)|lung(2)	5						TGGAGGAGGACGGCAAGCGCA	0.701																																					p.D244D		.											.	.	0			c.C732T						.						30.0	37.0	35.0					17																	18286644		691	1591	2282	SO:0001819	synonymous_variant	645027	exon8			GGAGGACGGCAAG		CCDS45626.1	17p11.2	2009-08-25			ENSG00000214860	ENSG00000214860			35236	protein-coding gene	gene with protein product							Standard	NM_001145127		Approved		uc002gte.3	A8MZ36	OTTHUMG00000059095	ENST00000399134.4:c.732C>T	17.37:g.18286644C>T		Somatic	60	0		WXS	Illumina GAIIx	Phase_I	45	44	NM_001145127	0	0	0	0	0	B4DPD4	Silent	SNP	ENST00000399134.4	37	CCDS45626.1																																																																																			.		0.701	EVPLL-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000130836.2	NM_001145127	
MYO18A	399687	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	27419408	27419408	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr17:27419408C>T	ENST00000527372.1	-	34	5320	c.5140G>A	c.(5140-5142)Gaa>Aaa	p.E1714K	TIAF1_ENST00000408971.2_5'Flank|MYO18A_ENST00000354329.4_Missense_Mutation_p.E1714K|MYO18A_ENST00000529578.1_5'Flank|MYO18A_ENST00000533112.1_Missense_Mutation_p.E1677K|MYO18A_ENST00000531253.1_Missense_Mutation_p.E1714K	NM_078471.3	NP_510880.2	Q92614	MY18A_HUMAN	myosin XVIIIA	1714					actomyosin structure organization (GO:0031032)|cell migration (GO:0016477)|DNA metabolic process (GO:0006259)|Golgi organization (GO:0007030)|Golgi vesicle budding (GO:0048194)|negative regulation of apoptotic process (GO:0043066)|positive regulation of protein secretion (GO:0050714)	actomyosin (GO:0042641)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|myosin complex (GO:0016459)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(6)|kidney(6)|lung(20)|urinary_tract(2)	36			Epithelial(11;4.97e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000221)|all cancers(11;0.000234)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			TGCAGGTCTTCGATCTCCACC	0.617																																					p.E1714K	Esophageal Squamous(182;472 2015 7001 15270 22562)	.											.	MYO18A-22	0			c.G5140A						.						52.0	58.0	56.0					17																	27419408		2203	4296	6499	SO:0001583	missense	399687	exon34			GGTCTTCGATCTC	D86970	CCDS45641.1, CCDS45642.1	17q11.2	2011-09-27			ENSG00000196535	ENSG00000196535		"""Myosins / Myosin superfamily : Class XVIII"""	31104	protein-coding gene	gene with protein product		610067				12761286	Standard	NM_078471		Approved	KIAA0216, MysPDZ	uc002hdt.1	Q92614	OTTHUMG00000166360	ENST00000527372.1:c.5140G>A	17.37:g.27419408C>T	ENSP00000437073:p.Glu1714Lys	Somatic	120	0		WXS	Illumina GAIIx	Phase_I	66	57	NM_078471	0	0	0	9	9	Q5H9U3|Q5W9F9|Q5W9G1|Q8IXP8	Missense_Mutation	SNP	ENST00000527372.1	37	CCDS45642.1	.	.	.	.	.	.	.	.	.	.	C	36	5.647871	0.96714	.	.	ENSG00000196535	ENST00000354329;ENST00000359450;ENST00000533112;ENST00000531253;ENST00000527372;ENST00000529799;ENST00000540575;ENST00000458428	T;D;T;T	0.88818	-1.16;-2.43;-1.16;-1.16	5.2	5.2	0.72013	Myosin tail (1);	0.000000	0.85682	D	0.000000	D	0.94703	0.8291	M	0.80183	2.485	0.52501	D	0.999958	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.80764	0.994;0.994;0.994;0.949	D	0.95047	0.8183	10	0.72032	D	0.01	.	18.722	0.91698	0.0:1.0:0.0:0.0	.	1317;1677;1714;1714	F8W6Y3;Q92614-3;Q92614-4;Q92614	.;.;.;MY18A_HUMAN	K	1714;1677;1677;1714;1714;610;610;1317	ENSP00000346291:E1714K;ENSP00000435932:E1677K;ENSP00000434228:E1714K;ENSP00000437073:E1714K	ENSP00000346291:E1714K	E	-	1	0	MYO18A	24443534	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.259000	0.78381	2.604000	0.88044	0.591000	0.81541	GAA	.		0.617	MYO18A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389396.1	NM_078471	
PIP4K2B	8396	ucsc.edu	37	17	36936800	36936800	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr17:36936800G>A	ENST00000269554.3	-	4	892	c.412C>T	c.(412-414)Cgt>Tgt	p.R138C	PIP4K2B_ENST00000311500.6_5'UTR	NM_003559.4	NP_003550.1	P78356	PI42B_HUMAN	phosphatidylinositol-5-phosphate 4-kinase, type II, beta	138	PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.				cell surface receptor signaling pathway (GO:0007166)|intracellular signal transduction (GO:0035556)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|1-phosphatidylinositol-5-phosphate 4-kinase activity (GO:0016309)|ATP binding (GO:0005524)|receptor signaling protein activity (GO:0005057)			endometrium(3)|kidney(2)|large_intestine(4)|liver(1)|lung(8)|ovary(1)	19						GTGAGGAAACGCGTGCCACAC	0.552																																					p.R138C		.											.	PIP4K2B-266	0			c.C412T						.						106.0	94.0	98.0					17																	36936800		2203	4300	6503	SO:0001583	missense	8396	exon4			GGAAACGCGTGCC	U85245	CCDS11329.1	17q21.2	2007-08-14	2007-08-14	2007-08-14		ENSG00000276293	2.7.1.149		8998	protein-coding gene	gene with protein product		603261	"""phosphatidylinositol-4-phosphate 5-kinase, type II, beta"""	PIP5K2B		9038203, 14691457, 9367159	Standard	NM_003559		Approved	PIP5KIIB, PIP5KIIbeta	uc002hqs.3	P78356		ENST00000269554.3:c.412C>T	17.37:g.36936800G>A	ENSP00000269554:p.Arg138Cys	Somatic	136	0		WXS	Illumina GAIIx	Phase_I	106	4	NM_003559	0	0	20	22	2	Q5U0E8|Q8TBP2	Missense_Mutation	SNP	ENST00000269554.3	37	CCDS11329.1	.	.	.	.	.	.	.	.	.	.	G	32	5.177070	0.94846	.	.	ENSG00000141720	ENST00000269554;ENST00000311500	T	0.36340	1.26	5.41	4.43	0.53597	Phosphatidylinositol-4-phosphate 5-kinase, core (2);Phosphatidylinositol-4-phosphate 5-kinase, core, subgroup (1);	0.000000	0.85682	D	0.000000	T	0.58538	0.2129	M	0.76170	2.325	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.999	P;D;D	0.68621	0.885;0.922;0.959	T	0.64058	-0.6496	10	0.66056	D	0.02	-12.5303	14.1696	0.65500	0.0:0.0:0.849:0.151	.	138;138;138	C9JMM2;P78356-2;P78356	.;.;PI42B_HUMAN	C	138	ENSP00000269554:R138C	ENSP00000269554:R138C	R	-	1	0	PIP4K2B	34190326	1.000000	0.71417	0.602000	0.28890	0.998000	0.95712	6.108000	0.71522	1.485000	0.48380	0.561000	0.74099	CGT	.		0.552	PIP4K2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256791.1	NM_003559	
KRT12	3859	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	39018841	39018841	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr17:39018841C>T	ENST00000251643.4	-	7	1386	c.1363G>A	c.(1363-1365)Gca>Aca	p.A455T	RP5-1110E20.1_ENST00000579136.1_RNA	NM_000223.3	NP_000214.1	Q99456	K1C12_HUMAN	keratin 12	455	Tail.				visual perception (GO:0007601)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(5)|ovary(2)|upper_aerodigestive_tract(2)	15		Breast(137;0.000301)			Griseofulvin(DB00400)	GTTGACTGTGCTTGTGATTTG	0.368																																					p.A455T		.											.	KRT12-91	0			c.G1363A						.						157.0	147.0	150.0					17																	39018841		2203	4300	6503	SO:0001583	missense	3859	exon7			ACTGTGCTTGTGA		CCDS11378.1	17q21.2	2013-06-20	2008-08-01		ENSG00000187242	ENSG00000187242		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6414	protein-coding gene	gene with protein product	"""Meesmann corneal dystrophy"""	601687				9171831, 16831889	Standard	NM_000223		Approved	K12	uc002hvk.2	Q99456	OTTHUMG00000133369	ENST00000251643.4:c.1363G>A	17.37:g.39018841C>T	ENSP00000251643:p.Ala455Thr	Somatic	129	0		WXS	Illumina GAIIx	Phase_I	78	73	NM_000223	0	0	0	0	0	B2R9E0	Missense_Mutation	SNP	ENST00000251643.4	37	CCDS11378.1	.	.	.	.	.	.	.	.	.	.	C	12.08	1.830535	0.32329	.	.	ENSG00000187242	ENST00000251643	D	0.81908	-1.55	4.71	0.079	0.14414	.	0.419376	0.20328	N	0.094499	T	0.49966	0.1588	N	0.01352	-0.895	0.23528	N	0.997488	B	0.18610	0.029	B	0.15052	0.012	T	0.46707	-0.9172	10	0.12103	T	0.63	.	4.7832	0.13213	0.0:0.3844:0.2736:0.342	.	455	Q99456	K1C12_HUMAN	T	455	ENSP00000251643:A455T	ENSP00000251643:A455T	A	-	1	0	KRT12	36272367	0.342000	0.24809	0.838000	0.33150	0.990000	0.78478	-0.288000	0.08377	-0.006000	0.14370	0.555000	0.69702	GCA	.		0.368	KRT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257214.2	NM_000223	
KRT32	3882	bcgsc.ca	37	17	39619193	39619193	+	Missense_Mutation	SNP	C	C	T	rs11078993	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr17:39619193C>T	ENST00000225899.3	-	6	1209	c.1106G>A	c.(1105-1107)cGg>cAg	p.R369Q		NM_002278.3	NP_002269.3	Q14532	K1H2_HUMAN	keratin 32	369	Coil 2.|Rod.				epidermis development (GO:0008544)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)	p.R369Q(1)		central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Breast(137;0.000812)				CAGGTCAGCCCGGATCTCAGC	0.642													C|||	597	0.119209	0.053	0.1931	5008	,	,		17508	0.2073		0.0467	False		,,,				2504	0.1401				p.R369Q		.											.	KRT32-90	1	Substitution - Missense(1)	stomach(1)	c.G1106A						.	C	GLN/ARG	272,4134	153.3+/-186.9	9,254,1940	76.0	74.0	75.0		1106	4.0	0.8	17	dbSNP_120	75	416,8184	130.3+/-188.3	20,376,3904	no	missense	KRT32	NM_002278.3	43	29,630,5844	TT,TC,CC		4.8372,6.1734,5.2899	probably-damaging	369/449	39619193	688,12318	2203	4300	6503	SO:0001583	missense	3882	exon6			TCAGCCCGGATCT	X90761	CCDS11393.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000108759	ENSG00000108759		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6449	protein-coding gene	gene with protein product	"""hard keratin type I"""	602760	"""keratin, hair, acidic, 2"""	KRTHA2		7556444, 8823373, 16831889	Standard	NM_002278		Approved	Ha-2	uc002hwr.3	Q14532	OTTHUMG00000133430	ENST00000225899.3:c.1106G>A	17.37:g.39619193C>T	ENSP00000225899:p.Arg369Gln	Somatic	154	0		WXS	Illumina GAIIx	Phase_I	119	7	NM_002278	0	0	0	0	0		Missense_Mutation	SNP	ENST00000225899.3	37	CCDS11393.1	227	0.10393772893772894	21	0.042682926829268296	66	0.18232044198895028	105	0.18356643356643357	35	0.04617414248021108	C	18.59	3.656817	0.67586	0.061734	0.048372	ENSG00000108759	ENST00000225899	D	0.91124	-2.79	4.98	4.0	0.46444	Filament (1);	0.000000	0.38436	N	0.001695	T	0.04452	0.0122	M	0.88031	2.925	0.25924	P	0.9830841	D	0.89917	1.0	D	0.97110	1.0	T	0.11916	-1.0568	9	0.87932	D	0	.	13.099	0.59210	0.0:0.9211:0.0:0.0789	rs11078993;rs59123042	369	Q14532	K1H2_HUMAN	Q	369	ENSP00000225899:R369Q	ENSP00000225899:R369Q	R	-	2	0	KRT32	36872719	0.997000	0.39634	0.771000	0.31576	0.291000	0.27294	4.973000	0.63763	1.197000	0.43143	0.491000	0.48974	CGG	C|0.935;T|0.065		0.642	KRT32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257293.1	NM_002278	
PTRF	284119	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	40574938	40574938	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr17:40574938T>C	ENST00000357037.5	-	1	597	c.178A>G	c.(178-180)Aaa>Gaa	p.K60E		NM_012232.5	NP_036364.2			polymerase I and transcript release factor											breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|urinary_tract(1)	17		all_cancers(22;0.00146)|Breast(137;0.00116)|all_epithelial(22;0.0134)		BRCA - Breast invasive adenocarcinoma(366;0.193)		CCGATGATTTTGTCCAGGAGG	0.657																																					p.K60E		.											.	PTRF-153	0			c.A178G						.						53.0	46.0	48.0					17																	40574938		2203	4300	6503	SO:0001583	missense	284119	exon1			TGATTTTGTCCAG	AF000421	CCDS11425.1	17q21.31	2011-04-20				ENSG00000177469			9688	protein-coding gene	gene with protein product		603198				9582279	Standard	NM_012232		Approved	cavin-1, CAVIN1	uc002hzo.3	Q6NZI2		ENST00000357037.5:c.178A>G	17.37:g.40574938T>C	ENSP00000349541:p.Lys60Glu	Somatic	191	0		WXS	Illumina GAIIx	Phase_I	137	125	NM_012232	0	0	5	112	107		Missense_Mutation	SNP	ENST00000357037.5	37	CCDS11425.1	.	.	.	.	.	.	.	.	.	.	T	34	5.402701	0.96030	.	.	ENSG00000177469	ENST00000357037	T	0.69926	-0.44	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	T	0.81245	0.4782	M	0.76170	2.325	0.80722	D	1	D;D	0.89917	0.997;1.0	D;D	0.91635	0.989;0.999	D	0.83940	0.0311	10	0.87932	D	0	-12.0638	14.9125	0.70770	0.0:0.0:0.0:1.0	.	60;60	B4DNU9;Q6NZI2	.;PTRF_HUMAN	E	60	ENSP00000349541:K60E	ENSP00000349541:K60E	K	-	1	0	PTRF	37828464	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.927000	0.87577	1.917000	0.55516	0.454000	0.30748	AAA	.		0.657	PTRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449938.1	NM_012232	
HSD17B1	3292	hgsc.bcm.edu	37	17	40706906	40706906	+	Missense_Mutation	SNP	G	G	A	rs605059	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr17:40706906G>A	ENST00000585807.1	+	6	4657	c.937G>A	c.(937-939)Ggt>Agt	p.G313S	RP11-400F19.6_ENST00000590513.1_RNA|HSD17B1_ENST00000225929.5_Missense_Mutation_p.G314S|RP11-400F19.8_ENST00000585572.1_RNA	NM_000413.2	NP_000404.2	P14061	DHB1_HUMAN	hydroxysteroid (17-beta) dehydrogenase 1	313			G -> S (in dbSNP:rs605059). {ECO:0000269|PubMed:1327779, ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:2197970, ECO:0000269|PubMed:2330005, ECO:0000269|PubMed:2779584, ECO:0000269|PubMed:2846351, ECO:0000269|PubMed:8389226, ECO:0000269|Ref.6, ECO:0000269|Ref.9}.		bone development (GO:0060348)|cellular response to metal ion (GO:0071248)|estrogen biosynthetic process (GO:0006703)|estrogen metabolic process (GO:0008210)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)|testosterone biosynthetic process (GO:0061370)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|estradiol 17-beta-dehydrogenase activity (GO:0004303)			NS(1)|endometrium(1)|kidney(1)|lung(2)	5		all_cancers(22;5.59e-08)|all_epithelial(22;7e-07)|Ovarian(249;0.0261)		BRCA - Breast invasive adenocarcinoma(366;0.129)	Equilin(DB02187)	GGCCGGGCGCGGTGCGGTGGG	0.736													A|||	2617	0.522564	0.4849	0.4942	5008	,	,		11834	0.4534		0.5249	False		,,,				2504	0.6626				p.G313S		.											.	HSD17B1-90	0			c.G937A	GRCh37	CM057951	HSD17B1	M	rs605059	.	A	SER/GLY	2209,1645		683,843,401	3.0	5.0	4.0		937	-1.2	0.0	17	dbSNP_83	4	4593,3023		1489,1615,704	no	missense	HSD17B1	NM_000413.2	56	2172,2458,1105	AA,AG,GG		39.6928,42.6829,40.6975	benign	313/329	40706906	6802,4668	1927	3808	5735	SO:0001583	missense	3292	exon6			GGGCGCGGTGCGG		CCDS11428.1	17q11-q21	2011-09-14					1.1.1.62	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	5210	protein-coding gene	gene with protein product	"""Estradiol 17-beta-dehydrogenase-1"", ""short chain dehydrogenase/reductase family 28CE, member 1"""	109684		EDHB17, EDH17B2		2330005, 19027726	Standard	NM_000413		Approved	HSD17, MGC138140, SDR28C1	uc002hzw.3	P14061		ENST00000585807.1:c.937G>A	17.37:g.40706906G>A	ENSP00000466799:p.Gly313Ser	Somatic	4	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_000413	0	0	0	0	0	B3KXS1|Q2M2L8	Missense_Mutation	SNP	ENST00000585807.1	37	CCDS11428.1	1065	0.4876373626373626	249	0.5060975609756098	161	0.4447513812154696	257	0.4493006993006993	398	0.525065963060686	A	1.679	-0.506941	0.04231	0.573171	0.603072	ENSG00000108786	ENST00000225929	.	.	.	0.605	-1.21	0.09524	.	15.510600	0.00792	N	0.001347	T	0.00012	0.0000	N	0.19112	0.55	0.80722	P	0.0	B;B	0.09022	0.002;0.002	B;B	0.01281	0.0;0.0	T	0.49916	-0.8888	7	0.15952	T	0.53	.	.	.	.	rs605059;rs58087383	344;313	B3RFR9;P14061	.;DHB1_HUMAN	S	313	.	ENSP00000225929:G313S	G	+	1	0	HSD17B1	37960432	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.026000	0.03596	-2.560000	0.00474	-1.912000	0.00520	GGT	G|0.505;A|0.495		0.736	HSD17B1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450392.1	NM_000413	
ASB16	92591	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	42254580	42254580	+	Silent	SNP	G	G	A	rs375260670		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr17:42254580G>A	ENST00000293414.1	+	3	1128	c.1044G>A	c.(1042-1044)gcG>gcA	p.A348A	ASB16-AS1_ENST00000588785.1_RNA|ASB16-AS1_ENST00000585457.1_RNA|ASB16-AS1_ENST00000591166.1_RNA|ASB16-AS1_ENST00000592897.1_RNA	NM_080863.4	NP_543139.4	Q96NS5	ASB16_HUMAN	ankyrin repeat and SOCS box containing 16	348					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(2)|liver(2)|lung(2)|prostate(1)	14		Breast(137;0.00765)|Prostate(33;0.0313)		BRCA - Breast invasive adenocarcinoma(366;0.114)		ACTACGGGGCGCAGCCAGTGC	0.687																																					p.A348A		.											.	ASB16-227	0			c.G1044A						.	G	,VAL/ALA	0,3540		0,0,1770	2.0	3.0	3.0		1044,41	-2.5	1.0	17		3	1,7339		0,1,3669	no	coding-synonymous,missense	ASB16,C17orf65	NM_080863.4,NM_178542.3	,64	0,1,5439	AA,AG,GG		0.0136,0.0,0.0092	,benign	348/454,14/194	42254580	1,10879	1770	3670	5440	SO:0001819	synonymous_variant	92591	exon3			CGGGGCGCAGCCA	AK054727	CCDS11478.1	17q21.31	2013-01-10	2011-01-25		ENSG00000161664	ENSG00000161664		"""Ankyrin repeat domain containing"""	19768	protein-coding gene	gene with protein product		615056	"""ankyrin repeat and SOCS box-containing 16"""			12076535	Standard	NM_080863		Approved	FLJ30165	uc002ifl.1	Q96NS5	OTTHUMG00000181809	ENST00000293414.1:c.1044G>A	17.37:g.42254580G>A		Somatic	37	0		WXS	Illumina GAIIx	Phase_I	33	11	NM_080863	0	0	5	6	1	B2RBC0|Q8WXK0	Silent	SNP	ENST00000293414.1	37	CCDS11478.1	.	.	.	.	.	.	.	.	.	.	G	11.65	1.701195	0.30142	0.0	1.36E-4	ENSG00000168597	ENST00000303061	.	.	.	4.95	-2.47	0.06442	.	0.000000	0.85682	D	0.000000	T	0.36635	0.0974	.	.	.	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.11470	-1.0586	8	0.87932	D	0	-17.2706	0.5154	0.00602	0.3987:0.2047:0.131:0.2656	.	14	Q495Z4	CQ065_HUMAN	V	14	.	ENSP00000366342:A14V	A	-	2	0	C17orf65	39610106	0.000000	0.05858	0.964000	0.40570	0.775000	0.43874	-1.181000	0.03085	-0.229000	0.09854	-0.235000	0.12190	GCG	.		0.687	ASB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457703.1		
NGFR	4804	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	47590175	47590175	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr17:47590175C>T	ENST00000172229.3	+	6	1213	c.1088C>T	c.(1087-1089)gCg>gTg	p.A363V	NGFR_ENST00000504201.1_Missense_Mutation_p.A269V|RP5-1029K10.2_ENST00000514506.1_RNA	NM_002507.3	NP_002498.1	P08138	TNR16_HUMAN	nerve growth factor receptor	363	Death. {ECO:0000255|PROSITE- ProRule:PRU00064}.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|central nervous system development (GO:0007417)|circadian regulation of gene expression (GO:0032922)|detection of temperature stimulus (GO:0016048)|glucose homeostasis (GO:0042593)|hair follicle morphogenesis (GO:0031069)|intracellular protein transport (GO:0006886)|membrane protein intracellular domain proteolysis (GO:0031293)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell cycle (GO:0045786)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of hair follicle development (GO:0051799)|nerve development (GO:0021675)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of axonogenesis (GO:0050772)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of odontogenesis of dentin-containing tooth (GO:0042488)|regulation of axonogenesis (GO:0050770)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of glucose import in response to insulin stimulus (GO:2001273)	cell surface (GO:0009986)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|neuronal postsynaptic density (GO:0097481)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	death receptor activity (GO:0005035)|Rab GTPase binding (GO:0017137)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)	17	all_cancers(4;1.45e-13)|Breast(4;6.34e-28)|all_epithelial(4;4.95e-17)					CGGCACCTGGCGGGCGAGCTG	0.682																																					p.A363V		.											.	NGFR-947	0			c.C1088T						.						45.0	52.0	50.0					17																	47590175		2201	4297	6498	SO:0001583	missense	4804	exon6			ACCTGGCGGGCGA	M14764	CCDS11549.1	17q21-q22	2013-05-22	2010-04-28		ENSG00000064300	ENSG00000064300		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	7809	protein-coding gene	gene with protein product	"""low affinity nerve growth factor receptor"", ""TNFR superfamily, member 16"""	162010	"""nerve growth factor receptor (TNFR superfamily, member 16)"""			3022937, 3006050	Standard	NM_002507		Approved	TNFRSF16, CD271, p75NTR	uc002ioz.4	P08138	OTTHUMG00000161495	ENST00000172229.3:c.1088C>T	17.37:g.47590175C>T	ENSP00000172229:p.Ala363Val	Somatic	258	0		WXS	Illumina GAIIx	Phase_I	204	95	NM_002507	0	0	0	0	0	B2R961|B4E096	Missense_Mutation	SNP	ENST00000172229.3	37	CCDS11549.1	.	.	.	.	.	.	.	.	.	.	C	27.8	4.862620	0.91511	.	.	ENSG00000064300	ENST00000172229;ENST00000504201	D;D	0.95171	-3.63;-3.63	4.21	4.21	0.49690	Death (3);DEATH-like (2);	0.062431	0.64402	D	0.000007	D	0.94456	0.8216	M	0.77103	2.36	0.58432	D	0.999998	P	0.52842	0.956	P	0.45881	0.496	D	0.94040	0.7308	10	0.37606	T	0.19	-32.9449	15.4986	0.75677	0.0:1.0:0.0:0.0	.	363	P08138	TNR16_HUMAN	V	363;269	ENSP00000172229:A363V;ENSP00000421731:A269V	ENSP00000172229:A363V	A	+	2	0	NGFR	44945174	1.000000	0.71417	0.924000	0.36721	0.917000	0.54804	5.665000	0.68052	2.160000	0.67779	0.561000	0.74099	GCG	.		0.682	NGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365150.1		
ABCC3	8714	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	48741343	48741343	+	Silent	SNP	G	G	A	rs191057975	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr17:48741343G>A	ENST00000285238.8	+	10	1289	c.1209G>A	c.(1207-1209)gcG>gcA	p.A403A	ABCC3_ENST00000427699.1_Silent_p.A403A	NM_003786.3	NP_003777.2	O15438	MRP3_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 3	403	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33			BRCA - Breast invasive adenocarcinoma(22;3.05e-09)		Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Doxorubicin(DB00997)|Etoposide(DB00773)|Ezetimibe(DB00973)|Fluorouracil(DB00544)|Folic Acid(DB00158)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indomethacin(DB00328)|Lamivudine(DB00709)|Leucovorin(DB00650)|Methotrexate(DB00563)|Metyrapone(DB01011)|Nifedipine(DB01115)|Omeprazole(DB00338)|Phenobarbital(DB01174)|Probenecid(DB01032)|Rifampicin(DB01045)|Sulfinpyrazone(DB01138)|Verapamil(DB00661)|Vincristine(DB00541)	TCAAACGTGCGTCCACTGTGG	0.577													G|||	2	0.000399361	0.0015	0.0	5008	,	,		20747	0.0		0.0	False		,,,				2504	0.0				p.A403A		.											.	ABCC3-93	0			c.G1209A						.	G	,	2,4404	4.2+/-10.8	0,2,2201	151.0	125.0	134.0		1209,1209	0.3	0.8	17		134	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	ABCC3	NM_001144070.1,NM_003786.3	,	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	,	403/573,403/1528	48741343	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	8714	exon10			ACGTGCGTCCACT	Y17151	CCDS32681.1, CCDS45739.1	17q21	2012-03-14			ENSG00000108846	ENSG00000108846		"""ATP binding cassette transporters / subfamily C"""	54	protein-coding gene	gene with protein product	"""canalicular multispecific organic anion transporter 2"""	604323				8894702, 9827529	Standard	NM_003786		Approved	MRP3, cMOAT2, EST90757, MLP2, MOAT-D	uc002isl.3	O15438	OTTHUMG00000162245	ENST00000285238.8:c.1209G>A	17.37:g.48741343G>A		Somatic	298	0		WXS	Illumina GAIIx	Phase_I	104	93	NM_003786	0	0	0	2	2	B2RPA9|D3DTX9|O60265|O60922|O75621|O95078|O95289|O95290|Q86X85|Q9UN52	Silent	SNP	ENST00000285238.8	37	CCDS32681.1																																																																																			G|0.999;A|0.001		0.577	ABCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368083.2	NM_020038	
KIAA0195	9772	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	73484865	73484865	+	Missense_Mutation	SNP	C	C	T	rs377628467		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr17:73484865C>T	ENST00000314256.7	+	7	1032	c.638C>T	c.(637-639)cCg>cTg	p.P213L	KIAA0195_ENST00000583795.1_3'UTR|KIAA0195_ENST00000579208.1_Intron|KIAA0195_ENST00000375248.5_Missense_Mutation_p.P223L	NM_014738.4	NP_055553.3	Q12767	K0195_HUMAN	KIAA0195	213						integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(2)|endometrium(5)|kidney(2)|large_intestine(7)|lung(17)|ovary(5)|skin(2)|stomach(1)|urinary_tract(1)	42	all_cancers(13;3.15e-09)|all_epithelial(9;5.94e-10)|Breast(9;1.85e-09)|all_lung(278;0.246)		all cancers(21;5.01e-07)|Epithelial(20;5e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			GTCCTGGAGCCGGGAGACCTC	0.622																																					p.P213L		.											.	KIAA0195-91	0			c.C638T						.	C	LEU/PRO	1,4405	2.1+/-5.4	0,1,2202	74.0	80.0	78.0		638	5.2	1.0	17		78	0,8600		0,0,4300	no	missense	KIAA0195	NM_014738.4	98	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	213/1357	73484865	1,13005	2203	4300	6503	SO:0001583	missense	9772	exon7			TGGAGCCGGGAGA		CCDS32732.1	17q25.1	2012-03-01			ENSG00000177728	ENSG00000177728			28983	protein-coding gene	gene with protein product						8724849	Standard	NM_014738		Approved	TMEM94	uc002jnz.4	Q12767		ENST00000314256.7:c.638C>T	17.37:g.73484865C>T	ENSP00000313885:p.Pro213Leu	Somatic	57	0		WXS	Illumina GAIIx	Phase_I	49	40	NM_014738	1	0	1	17	15	O75536|Q86XF1	Missense_Mutation	SNP	ENST00000314256.7	37	CCDS32732.1	.	.	.	.	.	.	.	.	.	.	C	17.97	3.518578	0.64634	2.27E-4	0.0	ENSG00000177728	ENST00000314256;ENST00000375248	T;T	0.45276	0.91;0.9	5.23	5.23	0.72850	.	0.057513	0.64402	D	0.000001	T	0.36110	0.0955	L	0.29908	0.895	0.80722	D	1	B;B	0.21309	0.054;0.027	B;B	0.17098	0.017;0.009	T	0.15150	-1.0447	10	0.59425	D	0.04	-28.6168	18.4127	0.90558	0.0:1.0:0.0:0.0	.	223;213	C9JL75;Q12767	.;K0195_HUMAN	L	213;223	ENSP00000313885:P213L;ENSP00000364397:P223L	ENSP00000313885:P213L	P	+	2	0	KIAA0195	70996460	1.000000	0.71417	0.955000	0.39395	0.837000	0.47467	7.388000	0.79795	2.440000	0.82611	0.549000	0.68633	CCG	.		0.622	KIAA0195-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447303.1	NM_014738	
DNAH17	8632	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	76570839	76570839	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr17:76570839T>C	ENST00000585328.1	-	2	425	c.301A>G	c.(301-303)Atc>Gtc	p.I101V	DNAH17_ENST00000389840.5_Missense_Mutation_p.I101V	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	101	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			GTGGGGCTGATGTCGCCGTAA	0.602																																					p.I101V		.											.	DNAH17-142	0			c.A301G						.						121.0	131.0	127.0					17																	76570839		2081	4205	6286	SO:0001583	missense	8632	exon2			GGCTGATGTCGCC	AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.301A>G	17.37:g.76570839T>C	ENSP00000465516:p.Ile101Val	Somatic	220	0		WXS	Illumina GAIIx	Phase_I	140	130	NM_173628	0	0	0	0	0	O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Missense_Mutation	SNP	ENST00000585328.1	37		.	.	.	.	.	.	.	.	.	.	T	5.040	0.193136	0.09599	.	.	ENSG00000187775	ENST00000300671;ENST00000389840	T	0.21191	2.02	5.11	-0.297	0.12820	.	.	.	.	.	T	0.14657	0.0354	N	0.19112	0.55	0.24748	N	0.99299	.	.	.	.	.	.	T	0.31530	-0.9940	7	0.36615	T	0.2	.	9.3951	0.38397	0.1248:0.0:0.5154:0.3598	.	.	.	.	V	101	ENSP00000374490:I101V	ENSP00000300671:I101V	I	-	1	0	DNAH17	74082434	0.861000	0.29849	0.951000	0.38953	0.019000	0.09904	-0.231000	0.09069	-0.394000	0.07727	0.460000	0.39030	ATC	.		0.602	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000318962.2	NM_173628	
PCYT2	5833	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	79865456	79865456	+	Missense_Mutation	SNP	G	G	A	rs544541474		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr17:79865456G>A	ENST00000538936.2	-	6	619	c.511C>T	c.(511-513)Cgg>Tgg	p.R171W	PCYT2_ENST00000570388.1_Missense_Mutation_p.R93W|PCYT2_ENST00000331285.3_Missense_Mutation_p.R93W|PCYT2_ENST00000570391.1_Missense_Mutation_p.R139W|PCYT2_ENST00000571105.1_Missense_Mutation_p.R171W|PCYT2_ENST00000538721.2_Missense_Mutation_p.R171W	NM_001256435.1|NM_002861.3	NP_001243364.1|NP_002852.1	Q99447	PCY2_HUMAN	phosphate cytidylyltransferase 2, ethanolamine	171					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)	ethanolamine-phosphate cytidylyltransferase activity (GO:0004306)			breast(2)|endometrium(1)|lung(4)|ovary(1)	8	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.013)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)		Lamivudine(DB00709)	GCATACTCCCGGTACTCAGAG	0.667													G|||	1	0.000199681	0.0	0.0	5008	,	,		19725	0.0		0.0	False		,,,				2504	0.001				p.R171W		.											.	PCYT2-68	0			c.C511T						.						53.0	39.0	43.0					17																	79865456		2203	4296	6499	SO:0001583	missense	5833	exon6			ACTCCCGGTACTC	D84307	CCDS11791.1, CCDS54178.1, CCDS58610.1, CCDS62364.1	17q25.3	2008-07-18				ENSG00000185813			8756	protein-coding gene	gene with protein product		602679				9083101	Standard	XM_005256386		Approved	ET	uc002kch.2	Q99447		ENST00000538936.2:c.511C>T	17.37:g.79865456G>A	ENSP00000439245:p.Arg171Trp	Somatic	193	1		WXS	Illumina GAIIx	Phase_I	128	112	NM_002861	0	0	0	50	50	B7Z7A5|B7ZAS0|F5H8B1|Q6IBM3|Q96G08	Missense_Mutation	SNP	ENST00000538936.2	37	CCDS11791.1	.	.	.	.	.	.	.	.	.	.	G	17.00	3.277054	0.59758	.	.	ENSG00000185813	ENST00000538721;ENST00000538936;ENST00000331285	.	.	.	4.34	3.33	0.38152	.	0.265315	0.38492	N	0.001672	T	0.51058	0.1652	N	0.22421	0.69	0.45837	D	0.998705	D;D;D;D;D	0.76494	0.994;0.995;0.999;0.997;0.994	P;P;P;P;P	0.57776	0.696;0.586;0.827;0.586;0.613	T	0.54105	-0.8343	9	0.72032	D	0.01	-33.3297	10.5268	0.44954	0.0:0.0:0.8056:0.1944	.	139;139;171;93;171	B7Z4W6;B7ZAS0;F5H8B1;B7Z7A5;Q99447	.;.;.;.;PCY2_HUMAN	W	171;171;93	.	ENSP00000331719:R93W	R	-	1	2	PCYT2	77458748	1.000000	0.71417	1.000000	0.80357	0.452000	0.32318	3.404000	0.52623	0.974000	0.38366	0.561000	0.74099	CGG	.		0.667	PCYT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439939.1	NM_002861	
FASN	2194	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	80039618	80039618	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr17:80039618C>T	ENST00000306749.2	-	37	6483	c.6265G>A	c.(6265-6267)Gcg>Acg	p.A2089T	FASN_ENST00000579758.1_Intron	NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase	2089	Beta-ketoacyl reductase. {ECO:0000250}.				acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	AGGCAGGACGCCATGCGCTGG	0.642																																					p.A2089T	Colon(59;314 1043 11189 28578 32273)	.											.	FASN-90	0			c.G6265A						.						72.0	62.0	66.0					17																	80039618		2202	4299	6501	SO:0001583	missense	2194	exon37			AGGACGCCATGCG	U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.6265G>A	17.37:g.80039618C>T	ENSP00000304592:p.Ala2089Thr	Somatic	200	0		WXS	Illumina GAIIx	Phase_I	115	46	NM_004104	0	0	19	37	18	Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Missense_Mutation	SNP	ENST00000306749.2	37	CCDS11801.1	.	.	.	.	.	.	.	.	.	.	C	0.673	-0.801193	0.02841	.	.	ENSG00000169710	ENST00000306749	T	0.27256	1.68	4.68	-9.37	0.00626	NAD(P)-binding domain (1);	1.178320	0.06020	N	0.651059	T	0.08268	0.0206	N	0.12502	0.225	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.24368	-1.0162	10	0.08381	T	0.77	-5.0685	2.7664	0.05321	0.1832:0.276:0.0842:0.4566	.	2089	P49327	FAS_HUMAN	T	2089	ENSP00000304592:A2089T	ENSP00000304592:A2089T	A	-	1	0	FASN	77632907	0.000000	0.05858	0.001000	0.08648	0.012000	0.07955	-0.592000	0.05747	-1.571000	0.01663	0.313000	0.20887	GCG	.		0.642	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442369.1	NM_004104	
GREB1L	80000	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	18981163	18981163	+	Silent	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr18:18981163G>A	ENST00000580732.2	+	6	966	c.585G>A	c.(583-585)acG>acA	p.T195T	GREB1L_ENST00000431264.1_Silent_p.T195T|GREB1L_ENST00000269218.6_Silent_p.T195T|GREB1L_ENST00000578368.1_3'UTR|GREB1L_ENST00000424526.1_Silent_p.T195T|GREB1L_ENST00000400483.4_Silent_p.T195T|RP11-296E23.1_ENST00000584611.1_RNA			Q9C091	GRB1L_HUMAN	growth regulation by estrogen in breast cancer-like	195						integral component of membrane (GO:0016021)				breast(5)|endometrium(4)|kidney(6)|lung(1)|skin(1)	17						GATATTTCACGGAATTTTCCA	0.418																																					p.T195T		.											.	.	0			c.G585A						.						133.0	105.0	114.0					18																	18981163		692	1591	2283	SO:0001819	synonymous_variant	80000	exon6			TTTCACGGAATTT	AK023749	CCDS45836.1	18q11.2	2009-09-08	2009-09-08	2009-09-08					31042	protein-coding gene	gene with protein product			"""KIAA1772"""	KIAA1772		11214970	Standard	NM_001142966		Approved	FLJ13687, C18orf6	uc010xam.2	Q9C091		ENST00000580732.2:c.585G>A	18.37:g.18981163G>A		Somatic	145	0		WXS	Illumina GAIIx	Phase_I	90	84	NM_001142966	0	0	0	0	0	A4QN17|Q9H8F1	Silent	SNP	ENST00000580732.2	37	CCDS45836.1																																																																																			.		0.418	GREB1L-003	KNOWN	not_organism_supported|upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443782.2	NM_024935	
LAMA3	3909	ucsc.edu;bcgsc.ca	37	18	21456302	21456302	+	Silent	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr18:21456302C>T	ENST00000313654.9	+	39	5284	c.5043C>T	c.(5041-5043)acC>acT	p.T1681T	LAMA3_ENST00000587184.1_Silent_p.T72T|LAMA3_ENST00000269217.6_Silent_p.T72T|LAMA3_ENST00000399516.3_Silent_p.T1681T	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	1681	Domain III A.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					GCTTGTATACCGGACGGTGTG	0.393																																					p.T1681T		.											.	LAMA3-100	0			c.C5043T						.						164.0	138.0	147.0					18																	21456302		2203	4300	6503	SO:0001819	synonymous_variant	3909	exon39			GTATACCGGACGG	L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.5043C>T	18.37:g.21456302C>T		Somatic	221	3		WXS	Illumina GAIIx	Phase_I	169	162	NM_001127717	0	0	0	0	0	B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Silent	SNP	ENST00000313654.9	37	CCDS42419.1																																																																																			.		0.393	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254824.3	NM_000227, NM_198129	
SETBP1	26040	broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	42531274	42531274	+	Missense_Mutation	SNP	G	G	A	rs554003194		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr18:42531274G>A	ENST00000282030.5	+	4	2265	c.1969G>A	c.(1969-1971)Gtg>Atg	p.V657M		NM_015559.2	NP_056374.2	Q9Y6X0	SETBP_HUMAN	SET binding protein 1	657						nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(20)|lung(47)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	104				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		AAAGCTCGGCGTGTTGGATAA	0.453									Schinzel-Giedion syndrome																												p.V657M		.											.	SETBP1-155	0			c.G1969A						.						54.0	47.0	50.0					18																	42531274		2186	4273	6459	SO:0001583	missense	26040	exon4	Familial Cancer Database	SGC, Schinzel-Giedion Midface Retraction syndrome	CTCGGCGTGTTGG	AB022660	CCDS11923.2, CCDS45859.1	18q21.1	2008-08-01			ENSG00000152217	ENSG00000152217			15573	protein-coding gene	gene with protein product		611060				11231286	Standard	NM_015559		Approved	SEB, KIAA0437	uc010dni.3	Q9Y6X0	OTTHUMG00000132613	ENST00000282030.5:c.1969G>A	18.37:g.42531274G>A	ENSP00000282030:p.Val657Met	Somatic	134	2		WXS	Illumina GAIIx	Phase_I	101	43	NM_015559	0	0	0	0	0	A6H8W5|Q6P6C3|Q9UEF3	Missense_Mutation	SNP	ENST00000282030.5	37	CCDS11923.2	.	.	.	.	.	.	.	.	.	.	G	10.62	1.401078	0.25291	.	.	ENSG00000152217	ENST00000282030	T	0.70164	-0.46	6.07	6.07	0.98685	.	0.065250	0.64402	D	0.000011	T	0.49474	0.1559	N	0.19112	0.55	0.37934	D	0.932116	P	0.51653	0.947	B	0.38225	0.268	T	0.57195	-0.7853	10	0.38643	T	0.18	.	13.793	0.63152	0.0696:0.0:0.9304:0.0	.	657	Q9Y6X0	SETBP_HUMAN	M	657	ENSP00000282030:V657M	ENSP00000282030:V657M	V	+	1	0	SETBP1	40785272	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.424000	0.59868	2.890000	0.99128	0.650000	0.86243	GTG	.		0.453	SETBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255854.4	NM_001130110	
TXNL1	9352	broad.mit.edu	37	18	54305668	54305668	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr18:54305668C>T	ENST00000217515.6	-	1	208	c.4G>A	c.(4-6)Gtg>Atg	p.V2M	TXNL1_ENST00000590954.1_Missense_Mutation_p.V2M|TXNL1_ENST00000540155.1_De_novo_Start_InFrame	NM_004786.2	NP_004777.1	O43396	TXNL1_HUMAN	thioredoxin-like 1	2	Thioredoxin.				cell redox homeostasis (GO:0045454)|glycerol ether metabolic process (GO:0006662)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	disulfide oxidoreductase activity (GO:0015036)|protein disulfide oxidoreductase activity (GO:0015035)			endometrium(1)|large_intestine(1)|lung(1)|urinary_tract(1)	4				READ - Rectum adenocarcinoma(59;0.193)|Colorectal(16;0.211)		TTCACCCCCACCATCCTCACA	0.637																																					p.V2M		.											.	TXNL1-90	0			c.G4A						.						18.0	20.0	19.0					18																	54305668		2202	4298	6500	SO:0001583	missense	9352	exon1			CCCCCACCATCCT	AF003938	CCDS11961.1	18q21.31	2011-01-17	2004-05-06	2004-05-07	ENSG00000091164	ENSG00000091164			12436	protein-coding gene	gene with protein product	"""thioredoxin-like, 32kD"""	603049	"""thioredoxin-like, 32kDa"""	TXNL		9473519, 9668102	Standard	NM_004786		Approved	Txl, TRP32	uc002lgg.3	O43396	OTTHUMG00000132722	ENST00000217515.6:c.4G>A	18.37:g.54305668C>T	ENSP00000217515:p.Val2Met	Somatic	59	0		WXS	Illumina GAIIx	Phase_I	45	3	NM_004786	0	0	40	40	0		Missense_Mutation	SNP	ENST00000217515.6	37	CCDS11961.1	.	.	.	.	.	.	.	.	.	.	C	14.97	2.694584	0.48202	.	.	ENSG00000091164	ENST00000217515	T	0.18960	2.18	5.52	4.65	0.58169	.	0.000000	0.85682	D	0.000000	T	0.10465	0.0256	N	0.08118	0	0.80722	D	1	B;B	0.09022	0.002;0.001	B;B	0.09377	0.004;0.002	T	0.15607	-1.0431	10	0.22109	T	0.4	.	10.4866	0.44726	0.0:0.9099:0.0:0.0901	.	2;2	B2R960;O43396	.;TXNL1_HUMAN	M	2	ENSP00000217515:V2M	ENSP00000217515:V2M	V	-	1	0	TXNL1	52456666	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	5.567000	0.67378	1.333000	0.45449	0.462000	0.41574	GTG	.		0.637	TXNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256064.2		
SERPINB8	5271	broad.mit.edu;bcgsc.ca	37	18	61649031	61649031	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr18:61649031G>T	ENST00000397985.2	+	4	639	c.383G>T	c.(382-384)tGc>tTc	p.C128F	SERPINB8_ENST00000542677.1_5'UTR|SERPINB8_ENST00000397988.3_Missense_Mutation_p.C128F|SERPINB8_ENST00000353706.2_Missense_Mutation_p.C128F	NM_001276490.1	NP_001263419.1	P50452	SPB8_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 8	128					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(2)|kidney(1)|large_intestine(4)|lung(9)|skin(1)	17		Esophageal squamous(42;0.129)				ACTGAAGAGTGCAGGAAGCAT	0.413																																					p.C128F		.											.	SERPINB8-226	0			c.G383T						.						196.0	182.0	186.0					18																	61649031		2203	4300	6503	SO:0001583	missense	5271	exon4			AAGAGTGCAGGAA	L40377	CCDS11991.1, CCDS42442.1, CCDS62460.1	18q22.1	2014-02-18	2005-08-18		ENSG00000166401	ENSG00000166401		"""Serine (or cysteine) peptidase inhibitors"""	8952	protein-coding gene	gene with protein product	"""cytoplasmic antiproteinase 2"""	601697	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 8"""	PI8		8530382, 9268635, 24172014	Standard	NM_198833		Approved	CAP2	uc002lju.3	P50452	OTTHUMG00000060596	ENST00000397985.2:c.383G>T	18.37:g.61649031G>T	ENSP00000381072:p.Cys128Phe	Somatic	74	0		WXS	Illumina GAIIx	Phase_I	60	5	NM_001031848	0	0	7	7	0	B4DTW2|Q7Z2V6|Q8N178	Missense_Mutation	SNP	ENST00000397985.2	37	CCDS11991.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.43|16.43	3.122343|3.122343	0.56613|0.56613	.|.	.|.	ENSG00000166401|ENSG00000166401	ENST00000295211|ENST00000397985;ENST00000353706;ENST00000397988;ENST00000441827	.|D;D;D;D	.|0.83992	.|-1.79;-1.79;-1.79;-1.79	5.21|5.21	4.34|4.34	0.51931|0.51931	.|Serpin domain (3);	.|0.360834	.|0.32836	.|N	.|0.005587	D|D	0.83830|0.83830	0.5339|0.5339	L|L	0.60455|0.60455	1.87|1.87	0.80722|0.80722	D|D	1|1	.|P;P	.|0.48230	.|0.84;0.907	.|P;P	.|0.50314	.|0.637;0.637	T|T	0.83117|0.83117	-0.0120|-0.0120	5|9	.|.	.|.	.|.	.|.	12.0488|12.0488	0.53495|0.53495	0.0:0.4672:0.5328:0.0|0.0:0.4672:0.5328:0.0	.|.	.|128;128	.|P50452;Q8N178	.|SPB8_HUMAN;.	S|F	70|128	.|ENSP00000381072:C128F;ENSP00000331368:C128F;ENSP00000381075:C128F;ENSP00000393456:C128F	.|.	A|C	+|+	1|2	0|0	SERPINB8|SERPINB8	59800011|59800011	0.293000|0.293000	0.24371|0.24371	0.895000|0.895000	0.35142|0.35142	0.590000|0.590000	0.36582|0.36582	2.369000|2.369000	0.44231|0.44231	1.423000|1.423000	0.47198|0.47198	0.467000|0.467000	0.42956|0.42956	GCA|TGC	.		0.413	SERPINB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000134014.1	NM_001031848	
MADCAM1	8174	bcgsc.ca	37	19	501714	501714	+	Missense_Mutation	SNP	C	C	A	rs78071082	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr19:501714C>A	ENST00000215637.3	+	4	759	c.713C>A	c.(712-714)cCg>cAg	p.P238Q	MADCAM1_ENST00000587541.1_Missense_Mutation_p.P19Q|MADCAM1_ENST00000346144.4_Intron|AC005775.2_ENST00000592413.1_RNA|MADCAM1_ENST00000382683.4_Intron	NM_130760.2	NP_570116.2	Q13477	MADCA_HUMAN	mucosal vascular addressin cell adhesion molecule 1	238	5.5 X 8 AA tandem repeats of [PS]-P-D-T- T-S-[QP]-E.|Mucin-like.				aging (GO:0007568)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|embryo development (GO:0009790)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|immune response (GO:0006955)|integrin-mediated signaling pathway (GO:0007229)|keratinocyte differentiation (GO:0030216)|leukocyte tethering or rolling (GO:0050901)|positive regulation of leukocyte migration (GO:0002687)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	integrin binding involved in cell-matrix adhesion (GO:0098640)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(4)|prostate(1)|skin(2)	10		all_cancers(10;4.25e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACCACCTCCCCGGAGTCTCCC	0.667																																					p.P238Q		.											.	MADCAM1-90	0			c.C713A						.						27.0	42.0	37.0					19																	501714		2202	4299	6501	SO:0001583	missense	8174	exon4			CCTCCCCGGAGTC	U43628	CCDS12028.1, CCDS12029.1	19p13.3	2013-01-11			ENSG00000099866	ENSG00000099866		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6765	protein-coding gene	gene with protein product	"""mucosal addressin cell adhesion molecule-1"""	102670				9162097, 8609404	Standard	NM_130762		Approved	MACAM1	uc002los.3	Q13477	OTTHUMG00000180548	ENST00000215637.3:c.713C>A	19.37:g.501714C>A	ENSP00000215637:p.Pro238Gln	Somatic	179	3		WXS	Illumina GAIIx	Phase_I	138	8	NM_130760	0	0	0	0	0	A5PKV4|B2RPL9|O60222|O75867|Q5UGI7	Missense_Mutation	SNP	ENST00000215637.3	37	CCDS12028.1	.	.	.	.	.	.	.	.	.	.	c	9.846	1.192318	0.21954	.	.	ENSG00000099866	ENST00000537731;ENST00000542525;ENST00000543297;ENST00000215637	T	0.11495	2.77	3.69	-3.39	0.04868	.	.	.	.	.	T	0.05181	0.0138	N	0.24115	0.695	0.09310	N	1	P	0.45078	0.85	B	0.40134	0.32	T	0.23084	-1.0198	9	0.34782	T	0.22	.	1.1525	0.01789	0.1428:0.3186:0.2805:0.2581	.	238	Q13477	MADCA_HUMAN	Q	262;254;246;238	ENSP00000215637:P238Q	ENSP00000215637:P238Q	P	+	2	0	MADCAM1	452714	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.794000	0.04584	-0.567000	0.06046	-0.145000	0.13849	CCG	A|0.000;C|1.000;T|0.000		0.667	MADCAM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451884.1	NM_130760	
LPPR3	79948	broad.mit.edu	37	19	814548	814548	+	Silent	SNP	G	G	A	rs547023170		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr19:814548G>A	ENST00000520876.3	-	7	795	c.717C>T	c.(715-717)ttC>ttT	p.F239F	LPPR3_ENST00000359894.2_Silent_p.F267F|MIR3187_ENST00000583431.1_RNA	NM_001270366.1	NP_001257295.1	Q6T4P5	LPPR3_HUMAN		239						integral component of membrane (GO:0016021)	phosphatidate phosphatase activity (GO:0008195)										TGGCAAAGGCGAAGACCAGGA	0.652													G|||	1	0.000199681	0.0	0.0	5008	,	,		16283	0.0		0.0	False		,,,				2504	0.001				p.F267F		.											.	.	0			c.C801T						.						59.0	61.0	60.0					19																	814548		2196	4300	6496	SO:0001819	synonymous_variant	0	exon6			AAAGGCGAAGACC																												ENST00000520876.3:c.717C>T	19.37:g.814548G>A		Somatic	86	0		WXS	Illumina GAIIx	Phase_I	55	4	NM_024888	0	0	0	0	0	Q86XQ4|Q96EH1|Q9BQF9|Q9HAJ4	Silent	SNP	ENST00000520876.3	37	CCDS58636.1	.	.	.	.	.	.	.	.	.	.	G	10.49	1.363538	0.24684	.	.	ENSG00000129951	ENST00000517665;ENST00000521445	.	.	.	4.66	-1.19	0.09585	.	.	.	.	.	T	0.55609	0.1931	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51857	-0.8652	4	.	.	.	-22.6326	9.8972	0.41327	0.4513:0.0:0.5487:0.0	.	.	.	.	C	28;189	.	.	R	-	1	0	AC006273.1	765548	0.325000	0.24660	0.998000	0.56505	0.780000	0.44128	-0.366000	0.07563	0.005000	0.14708	-0.378000	0.06908	CGC	.		0.652	LPPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379096.3		
AP3D1	8943	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	2129403	2129403	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr19:2129403T>C	ENST00000345016.5	-	7	877	c.646A>G	c.(646-648)Aag>Gag	p.K216E	AP3D1_ENST00000355272.6_Missense_Mutation_p.K216E|AP3D1_ENST00000590683.1_5'UTR|AP3D1_ENST00000356926.4_Intron|AP3D1_ENST00000350812.6_Intron	NM_003938.6	NP_003929.4	O14617	AP3D1_HUMAN	adaptor-related protein complex 3, delta 1 subunit	216					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|antigen processing and presentation, exogenous lipid antigen via MHC class Ib (GO:0048007)|endosome to melanosome transport (GO:0035646)|eye pigment biosynthetic process (GO:0006726)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|positive regulation of NK T cell differentiation (GO:0051138)|protein localization to membrane (GO:0072657)|protein localization to organelle (GO:0033365)|regulation of sequestering of zinc ion (GO:0061088)|synaptic vesicle membrane organization (GO:0048499)	endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane coat (GO:0030117)|terminal bouton (GO:0043195)	protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(23)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGGTAGTTCTTAGGGTTGCGT	0.562																																					p.K216E		.											.	AP3D1-90	0			c.A646G						.						133.0	136.0	135.0					19																	2129403		1979	4159	6138	SO:0001583	missense	8943	exon7			AGTTCTTAGGGTT	U91930	CCDS42459.1, CCDS58638.1	19p13.3	2014-09-04			ENSG00000065000	ENSG00000065000			568	protein-coding gene	gene with protein product		607246				9151686, 9303295	Standard	NM_003938		Approved	ADTD	uc002lva.4	O14617	OTTHUMG00000180354	ENST00000345016.5:c.646A>G	19.37:g.2129403T>C	ENSP00000344055:p.Lys216Glu	Somatic	306	1		WXS	Illumina GAIIx	Phase_I	213	196	NM_001261826	0	0	2	24	22	O00202|O75262|Q59HF5|Q96G11|Q9H3C6	Missense_Mutation	SNP	ENST00000345016.5	37	CCDS42459.1	.	.	.	.	.	.	.	.	.	.	T	26.7	4.763323	0.89932	.	.	ENSG00000065000	ENST00000345016;ENST00000355272;ENST00000343722	T;T	0.26067	1.76;1.76	4.58	4.58	0.56647	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.52725	0.1752	M	0.82323	2.585	0.80722	D	1	D;D	0.76494	0.986;0.999	P;D	0.75020	0.64;0.985	T	0.60321	-0.7286	10	0.72032	D	0.01	-32.1597	13.4298	0.61049	0.0:0.0:0.0:1.0	.	216;216	O14617-5;O14617	.;AP3D1_HUMAN	E	216	ENSP00000344055:K216E;ENSP00000347416:K216E	ENSP00000341579:K216E	K	-	1	0	AP3D1	2080403	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	7.732000	0.84908	1.828000	0.53243	0.533000	0.62120	AAG	.		0.562	AP3D1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000450912.1		
TJP3	27134	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	3734400	3734400	+	Missense_Mutation	SNP	G	G	A	rs200603772		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr19:3734400G>A	ENST00000541714.2	+	8	1415	c.953G>A	c.(952-954)cGg>cAg	p.R318Q	TJP3_ENST00000382008.3_Missense_Mutation_p.R332Q|TJP3_ENST00000539908.2_Missense_Mutation_p.R282Q|TJP3_ENST00000587686.1_Missense_Mutation_p.R337Q|TJP3_ENST00000589378.1_Missense_Mutation_p.R327Q|TJP3_ENST00000262968.9_Missense_Mutation_p.R351Q	NM_001267560.1	NP_001254489.1	O95049	ZO3_HUMAN	tight junction protein 3	318					regulation of G1/S transition of mitotic cell cycle (GO:2000045)	apical plasma membrane (GO:0016324)|nucleus (GO:0005634)|tight junction (GO:0005923)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	26				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0118)|STAD - Stomach adenocarcinoma(1328;0.18)		CATGCTCAGCGGAGCCCCGAG	0.642																																					p.R327Q		.											.	TJP3-92	0			c.G980A						.						62.0	57.0	58.0					19																	3734400		2203	4300	6503	SO:0001583	missense	27134	exon8			CTCAGCGGAGCCC	AC005954	CCDS32873.1, CCDS32873.2, CCDS59332.1	19p13.3	2012-07-12	2012-07-12			ENSG00000105289			11829	protein-coding gene	gene with protein product	"""zona occludens 3"""	612689					Standard	NM_001267560		Approved	ZO-3	uc010xhu.3	O95049		ENST00000541714.2:c.953G>A	19.37:g.3734400G>A	ENSP00000439278:p.Arg318Gln	Somatic	61	0		WXS	Illumina GAIIx	Phase_I	47	47	NM_001267561	0	0	0	0	0	A6NFP3|B3KR73|B3KXZ0|B4E2W6|F5H2X0|F5H4S9|K7EK22|Q32N01	Missense_Mutation	SNP	ENST00000541714.2	37	CCDS32873.2	.	.	.	.	.	.	.	.	.	.	g	9.641	1.138985	0.21123	.	.	ENSG00000105289	ENST00000541714;ENST00000539908;ENST00000382008;ENST00000262968	T;T;T;T	0.08282	3.13;3.3;3.11;3.21	3.98	-7.96	0.01144	.	2.106650	0.02563	N	0.097033	T	0.04770	0.0129	N	0.14661	0.345	0.09310	N	1	B;B;B;B	0.11235	0.004;0.002;0.002;0.001	B;B;B;B	0.10450	0.004;0.005;0.001;0.003	T	0.34054	-0.9844	10	0.36615	T	0.2	.	7.4745	0.27368	0.646:0.0:0.2248:0.1292	.	337;351;332;318	O95049-3;O95049-2;O95049;F5H2X0	.;.;ZO3_HUMAN;.	Q	318;282;332;351	ENSP00000439278:R318Q;ENSP00000439991:R282Q;ENSP00000371438:R332Q;ENSP00000262968:R351Q	ENSP00000262968:R351Q	R	+	2	0	TJP3	3685400	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-2.832000	0.00743	-1.593000	0.01617	-3.260000	0.00049	CGG	G|0.999;T|0.000		0.642	TJP3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000453434.1		
PLIN3	10226	ucsc.edu	37	19	4852250	4852250	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr19:4852250T>C	ENST00000221957.4	-	5	588	c.412A>G	c.(412-414)Agc>Ggc	p.S138G	PLIN3_ENST00000585479.1_Missense_Mutation_p.S138G|PLIN3_ENST00000592528.1_Missense_Mutation_p.S126G	NM_001164189.1|NM_001164194.1|NM_005817.4	NP_001157661.1|NP_001157666.1|NP_005808.3	O60664	PLIN3_HUMAN	perilipin 3	138					vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)|membrane (GO:0016020)				cervix(1)|endometrium(2)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)	9					Galsulfase(DB01279)|Idursulfase(DB01271)	TCCTTGGCGCTAGACACCATC	0.622											OREG0025175	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S138G		.											.	PLIN3-90	0			c.A412G						.						62.0	54.0	57.0					19																	4852250		2203	4300	6503	SO:0001583	missense	10226	exon5			TGGCGCTAGACAC	AF051314	CCDS12137.1, CCDS59337.1, CCDS59338.1	19p13.3	2009-08-12	2009-08-12	2009-08-12		ENSG00000105355		"""Perilipins"""	16893	protein-coding gene	gene with protein product	"""cargo selection protein (mannose 6 phosphate receptor binding protein)"", ""placental protein 17"", ""MPR-BINDING PROTEIN, 47-KD"""	602702	"""mannose-6-phosphate receptor binding protein 1"""	M6PRBP1		9590177, 6856484, 19638644	Standard	NM_005817		Approved	TIP47, PP17	uc002mbj.2	O60664		ENST00000221957.4:c.412A>G	19.37:g.4852250T>C	ENSP00000221957:p.Ser138Gly	Somatic	67	0	622	WXS	Illumina GAIIx	Phase_I	40	4	NM_001164189	0	0	148	148	0	A8K4Y9|K7EQF4|Q53G77|Q9BS03|Q9UBD7|Q9UP92	Missense_Mutation	SNP	ENST00000221957.4	37	CCDS12137.1	.	.	.	.	.	.	.	.	.	.	T	0.011	-1.707354	0.00719	.	.	ENSG00000105355	ENST00000221957	T	0.01572	4.76	4.19	0.733	0.18289	.	1.646820	0.03021	N	0.150728	T	0.01592	0.0051	L	0.33137	0.985	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.001;0.002	T	0.46830	-0.9163	10	0.02654	T	1	-17.4667	3.9732	0.09462	0.0:0.306:0.1844:0.5097	.	138;138	O60664-3;O60664	.;PLIN3_HUMAN	G	138	ENSP00000221957:S138G	ENSP00000221957:S138G	S	-	1	0	PLIN3	4803250	0.032000	0.19561	0.116000	0.21606	0.208000	0.24298	-0.391000	0.07323	-0.126000	0.11682	0.454000	0.30748	AGC	.		0.622	PLIN3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000450436.1	NM_005817	
KDM4B	23030	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	5143983	5143983	+	Silent	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr19:5143983C>T	ENST00000159111.4	+	19	2774	c.2556C>T	c.(2554-2556)tgC>tgT	p.C852C	KDM4B_ENST00000536461.1_Silent_p.C886C	NM_015015.2	NP_055830	O94953	KDM4B_HUMAN	lysine (K)-specific demethylase 4B	852					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(1)|liver(1)|lung(14)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	32						CCCAGAAATGCGTGTACTGCC	0.652																																					p.C852C		.											.	KDM4B-226	0			c.C2556T						.						74.0	65.0	68.0					19																	5143983		2203	4300	6503	SO:0001819	synonymous_variant	23030	exon19			GAAATGCGTGTAC	AB020683	CCDS12138.1	19p13.3	2013-01-23	2009-04-06	2009-04-06		ENSG00000127663		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	29136	protein-coding gene	gene with protein product	"""tudor domain containing 14B"""	609765	"""jumonji domain containing 2B"""	JMJD2B		10048485, 15138608	Standard	NM_015015		Approved	KIAA0876, TDRD14B	uc002mbq.4	O94953		ENST00000159111.4:c.2556C>T	19.37:g.5143983C>T		Somatic	107	0		WXS	Illumina GAIIx	Phase_I	43	39	NM_015015	0	0	0	0	0	B9EGN8|D6W631|O75274|Q6P3R5|Q9P1V1|Q9UF40	Silent	SNP	ENST00000159111.4	37	CCDS12138.1																																																																																			.		0.652	KDM4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450558.1	NM_015015	
SLC25A23	79085	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	6452332	6452332	+	Silent	SNP	G	G	A	rs148491192		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr19:6452332G>A	ENST00000301454.4	-	8	1168	c.1062C>T	c.(1060-1062)gcC>gcT	p.A354A	SLC25A23_ENST00000334510.5_Silent_p.A354A|SLC25A23_ENST00000414491.2_Intron	NM_024103.2	NP_077008.2	Q9BV35	SCMC3_HUMAN	solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23	354					adenine nucleotide transport (GO:0051503)|cellular response to calcium ion (GO:0071277)|regulation of cellular respiration (GO:0043457)|regulation of oxidative phosphorylation (GO:0002082)|regulation of sequestering of calcium ion (GO:0051282)|transmembrane transport (GO:0055085)|urea homeostasis (GO:0097274)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)	p.A354A(1)		endometrium(3)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|pancreas(1)|skin(1)	17						CCTCGTAGACGGCCAGGTCGA	0.662																																					p.A354A		.											.	SLC25A23-92	1	Substitution - coding silent(1)	large_intestine(1)	c.C1062T						.	G		0,4406		0,0,2203	45.0	36.0	39.0		1062	-2.8	1.0	19	dbSNP_134	39	4,8596	3.7+/-12.6	0,4,4296	no	coding-synonymous	SLC25A23	NM_024103.2		0,4,6499	AA,AG,GG		0.0465,0.0,0.0308		354/469	6452332	4,13002	2203	4300	6503	SO:0001819	synonymous_variant	79085	exon8			GTAGACGGCCAGG	AJ619962	CCDS32882.1	19p13.1	2014-02-06			ENSG00000125648	ENSG00000125648		"""Solute carriers"", ""EF-hand domain containing"""	19375	protein-coding gene	gene with protein product		608746				15123600	Standard	NM_024103		Approved	FLJ30339, MGC2615, APC2	uc002mex.1	Q9BV35	OTTHUMG00000180852	ENST00000301454.4:c.1062C>T	19.37:g.6452332G>A		Somatic	136	0		WXS	Illumina GAIIx	Phase_I	64	64	NM_024103	0	0	0	2	2	B4DGB6|Q4LBC2|Q705K3|Q86Y43|Q8N2N4|Q96NQ4	Silent	SNP	ENST00000301454.4	37	CCDS32882.1																																																																																			G|1.000;A|0.000		0.662	SLC25A23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453325.1	NM_024103	
KANK3	256949	hgsc.bcm.edu	37	19	8399628	8399628	+	Silent	SNP	A	A	G	rs710949	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr19:8399628A>G	ENST00000593649.1	-	3	1148	c.1083T>C	c.(1081-1083)agT>agC	p.S361S	KANK3_ENST00000330915.3_Silent_p.S361S			Q6NY19	KANK3_HUMAN	KN motif and ankyrin repeat domains 3	361										breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|skin(1)|urinary_tract(1)	9						GGTGCTCCAGACTGGCGCGCA	0.766													G|||	3017	0.602436	0.7443	0.6153	5008	,	,		10732	0.4147		0.5984	False		,,,				2504	0.5992				p.S361S		.											.	KANK3-90	0			c.T1083C						.	G		1917,541		783,351,95	1.0	1.0	1.0		1083	3.4	1.0	19	dbSNP_86	1	3649,1585		1364,921,332	no	coding-synonymous	KANK3	NM_198471.2		2147,1272,427	GG,GA,AA		30.2828,22.0098,27.6391		361/822	8399628	5566,2126	1229	2617	3846	SO:0001819	synonymous_variant	256949	exon3			CTCCAGACTGGCG	AK128815	CCDS12199.1	19p13.2	2013-01-10	2008-01-29	2008-01-29		ENSG00000186994		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	24796	protein-coding gene	gene with protein product		614611	"""ankyrin repeat domain 47"""	ANKRD47		17996375, 19554261	Standard	NM_198471		Approved	FLJ46061	uc010dwa.3	Q6NY19		ENST00000593649.1:c.1083T>C	19.37:g.8399628A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	7	NM_198471	0	0	0	0	0	Q6NZI1|Q6ZQR3|Q8IUV2	Silent	SNP	ENST00000593649.1	37																																																																																				A|0.411;G|0.589		0.766	KANK3-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000461379.1	NM_198471	
MUC16	94025	broad.mit.edu	37	19	9076759	9076759	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr19:9076759T>C	ENST00000397910.4	-	3	10890	c.10687A>G	c.(10687-10689)Acc>Gcc	p.T3563A		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	3564	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CTGTCCATGGTACTCATACCC	0.542											OREG0007306	type=TRANSCRIPTION FACTOR BINDING SITE|TFbs=REST|Dataset=NRSF/REST ChIPSeq sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)																									p.T3563A		.											.	MUC16-566	0			c.A10687G						.						205.0	202.0	203.0					19																	9076759		2124	4230	6354	SO:0001583	missense	94025	exon3			CCATGGTACTCAT	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.10687A>G	19.37:g.9076759T>C	ENSP00000381008:p.Thr3563Ala	Somatic	502	1	654	WXS	Illumina GAIIx	Phase_I	346	8	NM_024690	0	0	0	0	0	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	t	5.172	0.217344	0.09810	.	.	ENSG00000181143	ENST00000397910	T	0.02301	4.35	1.76	-0.419	0.12340	.	.	.	.	.	T	0.01558	0.0050	N	0.08118	0	.	.	.	P	0.35456	0.502	B	0.40066	0.318	T	0.45205	-0.9277	8	0.87932	D	0	.	4.1639	0.10298	0.0:0.4139:0.0:0.5861	.	3563	B5ME49	.	A	3563	ENSP00000381008:T3563A	ENSP00000381008:T3563A	T	-	1	0	MUC16	8937759	0.000000	0.05858	0.001000	0.08648	0.042000	0.13812	-0.743000	0.04845	-0.196000	0.10366	0.260000	0.18958	ACC	.		0.542	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
TNPO2	30000	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	12814290	12814290	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr19:12814290C>T	ENST00000592287.1	-	19	2269	c.2161G>A	c.(2161-2163)Gtc>Atc	p.V721I	TNPO2_ENST00000450764.2_Missense_Mutation_p.V721I|TNPO2_ENST00000356861.5_Missense_Mutation_p.V721I|TNPO2_ENST00000588216.1_Missense_Mutation_p.V721I|SNORD41_ENST00000386967.1_RNA|TNPO2_ENST00000425528.1_Missense_Mutation_p.V721I|TNPO2_ENST00000441499.1_Missense_Mutation_p.V721I	NM_001136196.1	NP_001129668.1	O14787	TNPO2_HUMAN	transportin 2	721					intracellular protein transport (GO:0006886)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nuclear localization sequence binding (GO:0008139)			autonomic_ganglia(1)|breast(2)|endometrium(5)|kidney(2)|large_intestine(2)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						TTGTTGCAGACGGAGATGAAC	0.592																																					p.V721I		.											.	TNPO2-227	0			c.G2161A						.						123.0	132.0	129.0					19																	12814290		2035	4197	6232	SO:0001583	missense	30000	exon19			TGCAGACGGAGAT	AF019039	CCDS45991.1, CCDS45992.1	19p13.13	2009-01-12	2009-01-12			ENSG00000105576		"""Importins"""	19998	protein-coding gene	gene with protein product	"""importin 3"", ""karyopherin beta 2b"""	603002				9298975, 12384575	Standard	NM_013433		Approved	IPO3, KPNB2B, FLJ12155, TRN2	uc002muo.3	O14787		ENST00000592287.1:c.2161G>A	19.37:g.12814290C>T	ENSP00000468434:p.Val721Ile	Somatic	245	0		WXS	Illumina GAIIx	Phase_I	135	125	NM_013433	0	0	0	74	74	O14655|Q6IN77	Missense_Mutation	SNP	ENST00000592287.1	37	CCDS45991.1	.	.	.	.	.	.	.	.	.	.	C	34	5.340344	0.95783	.	.	ENSG00000105576	ENST00000536114;ENST00000425528;ENST00000441499;ENST00000450764;ENST00000356861;ENST00000546320	T;T;T;T	0.39406	1.08;1.08;1.08;1.08	5.5	5.5	0.81552	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.67998	0.2953	M	0.88640	2.97	0.80722	D	1	P;D	0.67145	0.839;0.996	P;P	0.59546	0.531;0.859	T	0.74910	-0.3503	10	0.72032	D	0.01	-16.3853	18.1657	0.89724	0.0:1.0:0.0:0.0	.	885;721	Q4LE60;O14787	.;TNPO2_HUMAN	I	885;721;721;721;721;721	ENSP00000407182:V721I;ENSP00000389648:V721I;ENSP00000397379:V721I;ENSP00000349321:V721I	ENSP00000349321:V721I	V	-	1	0	TNPO2	12675290	1.000000	0.71417	0.970000	0.41538	0.874000	0.50279	7.459000	0.80802	2.587000	0.87381	0.655000	0.94253	GTC	.		0.592	TNPO2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000450785.1	NM_013433	
PRDX2	7001	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	12910730	12910730	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr19:12910730C>T	ENST00000301522.2	-	5	582	c.454G>A	c.(454-456)Gtg>Atg	p.V152M	CTD-2659N19.10_ENST00000585496.1_RNA|PRDX2_ENST00000334482.5_Intron	NM_005809.4	NP_005800.3	P32119	PRDX2_HUMAN	peroxiredoxin 2	152	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cellular response to oxidative stress (GO:0034599)|hydrogen peroxide catabolic process (GO:0042744)|negative regulation of apoptotic process (GO:0043066)|negative regulation of neuron apoptotic process (GO:0043524)|regulation of apoptotic process (GO:0042981)|removal of superoxide radicals (GO:0019430)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	antioxidant activity (GO:0016209)|thioredoxin peroxidase activity (GO:0008379)			endometrium(1)|large_intestine(1)|lung(1)|prostate(1)	4						GCCTCATCCACGGAGCGTCCC	0.557																																					p.F152I		.											.	PRDX2-90	0			c.T454A						.						129.0	106.0	114.0					19																	12910730		2203	4300	6503	SO:0001583	missense	7001	exon5			CATCCACGGAGCG		CCDS12281.1	19p13.2	2008-07-17			ENSG00000167815	ENSG00000167815			9353	protein-coding gene	gene with protein product	"""thioredoxin-dependent peroxide reductase 1"", ""thiol-specific antioxidant 1"", ""natural killer-enhancing factor B"", ""thioredoxin peroxidase 1"", ""torin"""	600538		TDPX1		7607688	Standard	NM_005809		Approved	PRP, NKEFB, TSA, PRXII, PRX2, MGC4104	uc002mvd.4	P32119	OTTHUMG00000134285	ENST00000301522.2:c.454G>A	19.37:g.12910730C>T	ENSP00000301522:p.Val152Met	Somatic	191	1		WXS	Illumina GAIIx	Phase_I	117	106	NM_005809	0	1	1	738	736	A8K0C0|P31945|P32118|P35701|Q6FHG4|Q92763|Q9UC23	Missense_Mutation	SNP	ENST00000301522.2	37	CCDS12281.1	.	.	.	.	.	.	.	.	.	.	C	34	5.303332	0.95601	.	.	ENSG00000167815	ENST00000301522	T	0.15834	2.39	5.26	5.26	0.73747	Thioredoxin-like fold (3);	0.000000	0.64402	D	0.000017	T	0.47451	0.1446	M	0.89414	3.03	0.80722	D	1	D	0.89917	1.0	P	0.62560	0.904	T	0.57665	-0.7772	10	0.87932	D	0	-51.3262	17.6211	0.88082	0.0:1.0:0.0:0.0	.	152	P32119	PRDX2_HUMAN	M	152	ENSP00000301522:V152M	ENSP00000301522:V152M	V	-	1	0	PRDX2	12771730	1.000000	0.71417	0.873000	0.34254	0.984000	0.73092	7.423000	0.80229	2.470000	0.83445	0.561000	0.74099	GTG	.		0.557	PRDX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258950.2	NM_005809	
RLN3	117579	broad.mit.edu	37	19	14139168	14139168	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr19:14139168G>T	ENST00000431365.2	+	1	209	c.152G>T	c.(151-153)cGg>cTg	p.R51L	CTB-55O6.4_ENST00000590528.1_RNA|RLN3_ENST00000585987.1_Missense_Mutation_p.R51L	NM_080864.2	NP_543140.1	Q8WXF3	REL3_HUMAN	relaxin 3	51						extracellular region (GO:0005576)				endometrium(1)|lung(4)	5						GGGGGCTCCCGGTGGAGACGA	0.647																																					p.R51L		.											.	RLN3-90	0			c.G152T						.						47.0	51.0	50.0					19																	14139168		2203	4299	6502	SO:0001583	missense	117579	exon1			GCTCCCGGTGGAG	AF447451	CCDS12302.1	19p13.2	2013-02-26	2004-11-15					"""Endogenous ligands"""	17135	protein-coding gene	gene with protein product	"""prorelaxin H3"""	606855	"""relaxin 3 (H3)"""				Standard	NM_080864		Approved	ZINS4, RXN3, H3	uc002mxw.1	Q8WXF3		ENST00000431365.2:c.152G>T	19.37:g.14139168G>T	ENSP00000397415:p.Arg51Leu	Somatic	201	0		WXS	Illumina GAIIx	Phase_I	124	4	NM_080864	0	0	0	0	0	Q6UXW5	Missense_Mutation	SNP	ENST00000431365.2	37	CCDS12302.1	.	.	.	.	.	.	.	.	.	.	G	19.01	3.743280	0.69418	.	.	ENSG00000171136	ENST00000431365	D	0.88277	-2.36	4.57	4.57	0.56435	Insulin-like (4);	0.476404	0.21850	N	0.068184	D	0.94837	0.8332	M	0.84683	2.71	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.95691	0.8740	10	0.87932	D	0	-29.5805	16.1425	0.81536	0.0:0.0:1.0:0.0	.	51;51	B2RU28;Q8WXF3	.;REL3_HUMAN	L	51	ENSP00000397415:R51L	ENSP00000397415:R51L	R	+	2	0	RLN3	14000168	1.000000	0.71417	0.569000	0.28460	0.150000	0.21749	8.346000	0.90060	2.093000	0.63338	0.491000	0.48974	CGG	.		0.647	RLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458529.1		
CYP4F11	57834	broad.mit.edu;bcgsc.ca	37	19	16045121	16045121	+	Missense_Mutation	SNP	C	C	T	rs567208540		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr19:16045121C>T	ENST00000402119.4	-	1	524	c.98G>A	c.(97-99)cGc>cAc	p.R33H	CYP4F11_ENST00000248041.8_Missense_Mutation_p.R33H|CYP4F11_ENST00000326742.8_Missense_Mutation_p.R33H	NM_021187.3	NP_067010.3			cytochrome P450, family 4, subfamily F, polypeptide 11											NS(1)|breast(3)|endometrium(4)|large_intestine(2)|lung(11)|ovary(1)|skin(3)	25						GGCCAGGACGCGGGCCAGGAG	0.652													.|||	1	0.000199681	0.0	0.0	5008	,	,		13453	0.0		0.0	False		,,,				2504	0.001				p.R33H		.											.	CYP4F11-91	0			c.G98A						.						41.0	43.0	42.0					19																	16045121		2203	4300	6503	SO:0001583	missense	57834	exon2			AGGACGCGGGCCA	AF236085	CCDS12337.1	19p13.1	2011-07-29	2003-01-14		ENSG00000171903	ENSG00000171903		"""Cytochrome P450s"""	13265	protein-coding gene	gene with protein product		611517	"""cytochrome P450, subfamily IVF, polypeptide 11"""			10964514, 9068972	Standard	NM_021187		Approved		uc002nbu.2	Q9HBI6		ENST00000402119.4:c.98G>A	19.37:g.16045121C>T	ENSP00000384588:p.Arg33His	Somatic	192	1		WXS	Illumina GAIIx	Phase_I	137	10	NM_001128932	0	0	0	0	0		Missense_Mutation	SNP	ENST00000402119.4	37	CCDS12337.1	.	.	.	.	.	.	.	.	.	.	c	9.112	1.006740	0.19199	.	.	ENSG00000171903	ENST00000402119;ENST00000248041;ENST00000326742	D;D;D	0.91945	-2.94;-2.94;-2.94	2.78	-0.611	0.11601	.	0.720518	0.11664	U	0.541484	D	0.84964	0.5589	L	0.39397	1.21	0.09310	N	1	B;B	0.21071	0.051;0.014	B;B	0.18263	0.021;0.006	T	0.71646	-0.4530	10	0.34782	T	0.22	.	5.0537	0.14522	0.0:0.543:0.0:0.457	.	33;33	F8W978;Q9HBI6	.;CP4FB_HUMAN	H	33	ENSP00000384588:R33H;ENSP00000248041:R33H;ENSP00000319859:R33H	ENSP00000248041:R33H	R	-	2	0	CYP4F11	15906121	0.000000	0.05858	0.089000	0.20774	0.030000	0.12068	-0.158000	0.10070	0.078000	0.16900	-0.683000	0.03753	CGC	.		0.652	CYP4F11-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460385.2	NM_021187	
NR2F6	2063	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	17343368	17343368	+	Silent	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr19:17343368G>A	ENST00000291442.3	-	4	1727	c.1008C>T	c.(1006-1008)acC>acT	p.T336T		NM_005234.3	NP_005225.2	P10588	NR2F6_HUMAN	nuclear receptor subfamily 2, group F, member 6	336	Important for dimerization. {ECO:0000250}.|Ligand-binding. {ECO:0000250}.				detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|entrainment of circadian clock by photoperiod (GO:0043153)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron development (GO:0048666)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|thyroid hormone receptor activity (GO:0004887)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(1)|lung(1)	5						GCACATACTCGGTGAGGGCCA	0.701																																					p.T336T		.											.	NR2F6-186	0			c.C1008T						.						21.0	22.0	21.0					19																	17343368		2202	4299	6501	SO:0001819	synonymous_variant	2063	exon4			ATACTCGGTGAGG	X12794	CCDS12352.1	19p13.11	2013-09-20			ENSG00000160113	ENSG00000160113		"""Nuclear hormone receptors"""	7977	protein-coding gene	gene with protein product		132880		ERBAL2		2905047	Standard	NM_005234		Approved	EAR-2	uc002nfq.3	P10588	OTTHUMG00000182728	ENST00000291442.3:c.1008C>T	19.37:g.17343368G>A		Somatic	26	0		WXS	Illumina GAIIx	Phase_I	31	29	NM_005234	0	0	0	46	46	B2RC68|Q5XGA0|Q6P586|Q9BUE8	Silent	SNP	ENST00000291442.3	37	CCDS12352.1																																																																																			.		0.701	NR2F6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463325.1		
NR2C2AP	126382	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	19313147	19313147	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr19:19313147G>A	ENST00000331552.7	-	4	659	c.296C>T	c.(295-297)tCg>tTg	p.S99L	NR2C2AP_ENST00000544883.1_3'UTR|NR2C2AP_ENST00000538165.2_Missense_Mutation_p.S99L|NR2C2AP_ENST00000420605.3_Missense_Mutation_p.S99L	NM_176880.4	NP_795361.1	Q86WQ0	NR2CA_HUMAN	nuclear receptor 2C2-associated protein	99					cell adhesion (GO:0007155)|gene expression (GO:0010467)|transcription initiation from RNA polymerase II promoter (GO:0006367)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)				breast(1)|cervix(1)|kidney(2)|ovary(1)	5			Epithelial(12;0.00235)			TATCTGAAGCGAGTTGTTGTC	0.537																																					p.S99L		.											.	NR2C2AP-23	0			c.C296T						.						209.0	206.0	207.0					19																	19313147		2203	4300	6503	SO:0001583	missense	126382	exon4			TGAAGCGAGTTGT	AY101377	CCDS32967.1, CCDS74316.1	19p13.11	2008-01-10				ENSG00000184162			30763	protein-coding gene	gene with protein product	"""TR4 orphan receptor associated protein TRA16"""	608719				12486131	Standard	XM_005259740		Approved	TRA16	uc002nlx.3	Q86WQ0		ENST00000331552.7:c.296C>T	19.37:g.19313147G>A	ENSP00000332823:p.Ser99Leu	Somatic	150	0		WXS	Illumina GAIIx	Phase_I	80	69	NM_176880	0	0	0	1	1	A6NGP7|B4DW92	Missense_Mutation	SNP	ENST00000331552.7	37	CCDS32967.1	.	.	.	.	.	.	.	.	.	.	G	19.52	3.843265	0.71488	.	.	ENSG00000184162	ENST00000331552;ENST00000420605	T;T	0.64803	-0.12;-0.12	4.95	4.95	0.65309	Coagulation factor 5/8 C-terminal type domain (1);Galactose-binding domain-like (1);	0.293051	0.32819	N	0.005609	T	0.52773	0.1755	L	0.42245	1.32	0.80722	D	1	P	0.46912	0.886	B	0.38156	0.266	T	0.61267	-0.7097	10	0.72032	D	0.01	-12.8474	13.5646	0.61810	0.0:0.0:1.0:0.0	.	99	Q86WQ0	NR2CA_HUMAN	L	99	ENSP00000332823:S99L;ENSP00000402756:S99L	ENSP00000332823:S99L	S	-	2	0	NR2C2AP	19174147	1.000000	0.71417	0.955000	0.39395	0.921000	0.55340	4.137000	0.58010	2.577000	0.86979	0.462000	0.41574	TCG	.		0.537	NR2C2AP-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402936.4	NM_176880	
CHST8	64377	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	34263477	34263477	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr19:34263477G>A	ENST00000262622.4	+	4	1542	c.784G>A	c.(784-786)Gag>Aag	p.E262K	CHST8_ENST00000438847.3_Missense_Mutation_p.E262K|CHST8_ENST00000434302.1_Missense_Mutation_p.E262K	NM_022467.3	NP_071912.2	Q9H2A9	CHST8_HUMAN	carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 8	262					carbohydrate biosynthetic process (GO:0016051)|central nervous system development (GO:0007417)|hormone biosynthetic process (GO:0042446)|proteoglycan biosynthetic process (GO:0030166)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	N-acetylgalactosamine 4-O-sulfotransferase activity (GO:0001537)			NS(1)|endometrium(3)|kidney(2)|large_intestine(4)|liver(2)|lung(8)|ovary(1)|prostate(1)|skin(5)	27	Esophageal squamous(110;0.162)					CGAGCCCTTCGAGAGGCTGGT	0.617																																					p.E262K		.											.	CHST8-156	0			c.G784A						.						100.0	94.0	96.0					19																	34263477		2203	4300	6503	SO:0001583	missense	64377	exon5			CCCTTCGAGAGGC	AB047801	CCDS12433.1	19q13.1	2008-02-05				ENSG00000124302		"""Sulfotransferases, membrane-bound"""	15993	protein-coding gene	gene with protein product		610190				10988300, 11001942	Standard	NM_001127895		Approved	GALNAC-4-ST1	uc002nut.4	Q9H2A9		ENST00000262622.4:c.784G>A	19.37:g.34263477G>A	ENSP00000262622:p.Glu262Lys	Somatic	218	0		WXS	Illumina GAIIx	Phase_I	139	127	NM_001127895	0	0	0	0	0	Q9H3N2	Missense_Mutation	SNP	ENST00000262622.4	37	CCDS12433.1	.	.	.	.	.	.	.	.	.	.	G	31	5.064948	0.93898	.	.	ENSG00000124302	ENST00000434302;ENST00000438847;ENST00000262622	T;T;T	0.75260	-0.92;-0.92;-0.92	4.87	4.87	0.63330	.	0.000000	0.85682	D	0.000000	D	0.88351	0.6413	M	0.88775	2.98	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90750	0.4656	10	0.72032	D	0.01	-14.9791	16.9921	0.86356	0.0:0.0:1.0:0.0	.	262	Q9H2A9	CHST8_HUMAN	K	262	ENSP00000392604:E262K;ENSP00000393879:E262K;ENSP00000262622:E262K	ENSP00000262622:E262K	E	+	1	0	CHST8	38955317	1.000000	0.71417	1.000000	0.80357	0.863000	0.49368	9.869000	0.99810	2.241000	0.73720	0.297000	0.19635	GAG	.		0.617	CHST8-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451453.1	NM_022467	
RYR1	6261	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	38931501	38931501	+	Silent	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr19:38931501G>A	ENST00000359596.3	+	2	162	c.162G>A	c.(160-162)gcG>gcA	p.A54A	RYR1_ENST00000360985.3_Silent_p.A54A|RYR1_ENST00000355481.4_Silent_p.A54A			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	54					calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	CTAGCAACGCGCAGGTCTGTG	0.637																																					p.A54A		.											.	RYR1-100	0			c.G162A						.						17.0	18.0	18.0					19																	38931501		2199	4288	6487	SO:0001819	synonymous_variant	6261	exon2			CAACGCGCAGGTC	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.162G>A	19.37:g.38931501G>A		Somatic	191	2		WXS	Illumina GAIIx	Phase_I	121	103	NM_001042723	0	0	0	0	0	Q16314|Q16368|Q9NPK1|Q9P1U4	Silent	SNP	ENST00000359596.3	37	CCDS33011.1																																																																																			.		0.637	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1		
FCGBP	8857	broad.mit.edu	37	19	40376473	40376473	+	Missense_Mutation	SNP	G	G	A	rs372938963		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr19:40376473G>A	ENST00000221347.6	-	25	11838	c.11831C>T	c.(11830-11832)gCg>gTg	p.A3944V	FCGBP_ENST00000595713.1_5'Flank	NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	3944	Cys-rich.|TIL 9.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			GCAGGTGTCCGCACAGAGCTC	0.642																																					p.A3944V		.											.	FCGBP-98	0			c.C11831T						.	G	VAL/ALA	1,4333		0,1,2166	9.0	11.0	10.0		11831	3.8	1.0	19		10	0,8486		0,0,4243	no	missense	FCGBP	NM_003890.2	64	0,1,6409	AA,AG,GG		0.0,0.0231,0.0078	probably-damaging	3944/5406	40376473	1,12819	2167	4243	6410	SO:0001583	missense	8857	exon25			GTGTCCGCACAGA	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.11831C>T	19.37:g.40376473G>A	ENSP00000221347:p.Ala3944Val	Somatic	729	1		WXS	Illumina GAIIx	Phase_I	504	18	NM_003890	0	0	1	1	0	O95784	Missense_Mutation	SNP	ENST00000221347.6	37	CCDS12546.1	.	.	.	.	.	.	.	.	.	.	g	16.19	3.053477	0.55218	2.31E-4	0.0	ENSG00000090920	ENST00000221347	D	0.90955	-2.76	3.77	3.77	0.43336	Protease inhibitor I8, cysteine-rich trypsin inhibitor-like (2);	.	.	.	.	D	0.90679	0.7076	L	0.33668	1.02	0.25526	N	0.987321	D	0.76494	0.999	D	0.68765	0.96	T	0.80964	-0.1147	9	0.07482	T	0.82	.	14.7967	0.69884	0.0:0.0:1.0:0.0	.	3944	Q9Y6R7	FCGBP_HUMAN	V	3944	ENSP00000221347:A3944V	ENSP00000221347:A3944V	A	-	2	0	FCGBP	45068313	0.493000	0.26035	0.987000	0.45799	0.171000	0.22731	2.913000	0.48790	1.823000	0.53134	0.306000	0.20318	GCG	.		0.642	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890	
AXL	558	ucsc.edu;bcgsc.ca;mdanderson.org	37	19	41726567	41726567	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr19:41726567G>A	ENST00000301178.4	+	2	302	c.112G>A	c.(112-114)Gtg>Atg	p.V38M	AXL_ENST00000594880.1_3'UTR|CTD-2195B23.3_ENST00000598541.1_RNA|AXL_ENST00000359092.3_Missense_Mutation_p.V38M	NM_001278599.1|NM_021913.3	NP_001265528.1|NP_068713	P30530	UFO_HUMAN	AXL receptor tyrosine kinase	38	Ig-like C2-type 1.|Interaction with GAS6.				apoptotic cell clearance (GO:0043277)|blood vessel remodeling (GO:0001974)|cell maturation (GO:0048469)|cellular response to extracellular stimulus (GO:0031668)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to interferon-alpha (GO:0035457)|cellular response to lipopolysaccharide (GO:0071222)|dendritic cell differentiation (GO:0097028)|enzyme linked receptor protein signaling pathway (GO:0007167)|erythrocyte homeostasis (GO:0034101)|forebrain cell migration (GO:0021885)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|natural killer cell differentiation (GO:0001779)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of lymphocyte activation (GO:0051250)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of tumor necrosis factor production (GO:0032720)|neuron migration (GO:0001764)|organ regeneration (GO:0031100)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phagocytosis (GO:0006909)|platelet activation (GO:0030168)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of protein kinase B signaling (GO:0051897)|protein kinase B signaling (GO:0043491)|secretion by cell (GO:0032940)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|phosphatidylserine binding (GO:0001786)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(9)|lung(12)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)	48						AAGTCCCTTCGTGGGCAACCC	0.622																																					p.V38M		.											.	AXL-1403	0			c.G112A						.						28.0	27.0	28.0					19																	41726567		2199	4291	6490	SO:0001583	missense	558	exon2			CCCTTCGTGGGCA	M76125	CCDS12574.1, CCDS12575.1, CCDS62677.1	19q13.1	2013-02-11				ENSG00000167601	2.7.10.1	"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	905	protein-coding gene	gene with protein product		109135				1656220	Standard	NM_021913		Approved	UFO, JTK11	uc010ehj.3	P30530		ENST00000301178.4:c.112G>A	19.37:g.41726567G>A	ENSP00000301178:p.Val38Met	Somatic	191	2		WXS	Illumina GAIIx	Phase_I	134	129	NM_021913	0	0	0	0	0	Q8N5L2|Q9UD27	Missense_Mutation	SNP	ENST00000301178.4	37	CCDS12575.1	.	.	.	.	.	.	.	.	.	.	G	1.168	-0.641873	0.03531	.	.	ENSG00000167601	ENST00000301178;ENST00000359092	T;T	0.12465	2.68;2.68	4.59	2.37	0.29283	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.114292	0.35466	N	0.003188	T	0.11879	0.0289	L	0.45051	1.395	0.25938	N	0.982909	P;P	0.49559	0.908;0.925	B;B	0.43701	0.204;0.428	T	0.17198	-1.0377	10	0.20046	T	0.44	-8.229	9.5289	0.39182	0.0:0.0:0.6164:0.3836	.	38;38	P30530-2;P30530	.;UFO_HUMAN	M	38	ENSP00000301178:V38M;ENSP00000351995:V38M	ENSP00000301178:V38M	V	+	1	0	AXL	46418407	0.987000	0.35691	0.254000	0.24359	0.002000	0.02628	2.148000	0.42235	0.525000	0.28522	-0.818000	0.03119	GTG	.		0.622	AXL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000463323.2		
TMEM145	284339	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	42821906	42821906	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr19:42821906G>A	ENST00000301204.3	+	12	987	c.946G>A	c.(946-948)Ggc>Agc	p.G316S	TMEM145_ENST00000598766.1_Missense_Mutation_p.G340S	NM_173633.2	NP_775904.2	Q8NBT3	TM145_HUMAN	transmembrane protein 145	316					G-protein coupled receptor signaling pathway (GO:0007186)|response to pheromone (GO:0019236)	integral component of membrane (GO:0016021)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(11)|prostate(4)|skin(1)|urinary_tract(1)	27		Prostate(69;0.00682)				GTCGCCGGCCGGCTACGGGCT	0.572																																					p.G316S		.											.	TMEM145-90	0			c.G946A						.						118.0	96.0	103.0					19																	42821906		2203	4300	6503	SO:0001583	missense	284339	exon12			CCGGCCGGCTACG	AK075286	CCDS12603.1	19q13.2	2008-02-05				ENSG00000167619			26912	protein-coding gene	gene with protein product							Standard	NM_173633		Approved	FLJ90805	uc002otk.1	Q8NBT3		ENST00000301204.3:c.946G>A	19.37:g.42821906G>A	ENSP00000301204:p.Gly316Ser	Somatic	178	0		WXS	Illumina GAIIx	Phase_I	144	8	NM_173633	0	0	0	0	0		Missense_Mutation	SNP	ENST00000301204.3	37	CCDS12603.1	.	.	.	.	.	.	.	.	.	.	G	29.5	5.014437	0.93404	.	.	ENSG00000167619	ENST00000301204	T	0.68479	-0.33	4.22	4.22	0.49857	Rhodopsin-like GPCR transmembrane domain (1);	0.161226	0.37809	N	0.001935	T	0.78966	0.4367	M	0.72894	2.215	0.58432	D	0.999999	D	0.89917	1.0	D	0.71656	0.974	T	0.79120	-0.1934	10	0.39692	T	0.17	-18.0182	14.468	0.67497	0.0:0.0:1.0:0.0	.	316	Q8NBT3	TM145_HUMAN	S	316	ENSP00000301204:G316S	ENSP00000301204:G316S	G	+	1	0	TMEM145	47513746	1.000000	0.71417	0.970000	0.41538	0.966000	0.64601	7.802000	0.85969	2.082000	0.62665	0.591000	0.81541	GGC	.		0.572	TMEM145-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463737.1	NM_173633	
IRGQ	126298	bcgsc.ca	37	19	44096816	44096816	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr19:44096816C>T	ENST00000602269.1	-	2	1419	c.1234G>A	c.(1234-1236)Gct>Act	p.A412T	L34079.2_ENST00000594374.1_Intron|IRGQ_ENST00000601520.1_Intron|IRGQ_ENST00000422989.1_Missense_Mutation_p.A412T			Q8WZA9	IRGQ_HUMAN	immunity-related GTPase family, Q	412	IRG-type G.									endometrium(2)|large_intestine(4)|lung(6)|ovary(2)|pancreas(1)|prostate(3)	18		Prostate(69;0.0199)				CTTAACGCAGCGGCCCGCTCT	0.657																																					p.A412T		.											.	IRGQ-92	0			c.G1234A						.						84.0	85.0	85.0					19																	44096816		2203	4300	6503	SO:0001583	missense	126298	exon3			ACGCAGCGGCCCG	AF322648	CCDS33040.1	19q13.31	2013-07-03	2005-10-31	2005-10-31		ENSG00000167378			24868	protein-coding gene	gene with protein product			"""immunity-related GTPase family, Q1"""	IRGQ1		16277747	Standard	NM_001007561		Approved	FKSG27	uc010eiv.2	Q8WZA9		ENST00000602269.1:c.1234G>A	19.37:g.44096816C>T	ENSP00000472250:p.Ala412Thr	Somatic	95	3		WXS	Illumina GAIIx	Phase_I	51	44	NM_001007561	0	0	0	1	1	B2RNP3	Missense_Mutation	SNP	ENST00000602269.1	37	CCDS33040.1	.	.	.	.	.	.	.	.	.	.	C	8.704	0.910439	0.17833	.	.	ENSG00000167378	ENST00000422989	T	0.57595	0.39	3.55	2.48	0.30137	.	0.642064	0.14734	N	0.301555	T	0.38665	0.1049	L	0.47716	1.5	0.09310	N	1	P	0.43885	0.82	B	0.32762	0.152	T	0.16808	-1.0390	10	0.36615	T	0.2	-27.8122	10.3444	0.43897	0.1977:0.8023:0.0:0.0	.	412	Q8WZA9	IRGQ_HUMAN	T	412	ENSP00000387535:A412T	ENSP00000387535:A412T	A	-	1	0	IRGQ	48788656	0.004000	0.15560	0.001000	0.08648	0.001000	0.01503	1.225000	0.32551	1.038000	0.40049	0.563000	0.77884	GCT	.		0.657	IRGQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463205.1	NM_001007561	
ZNF225	7768	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	44636010	44636010	+	Missense_Mutation	SNP	C	C	T	rs200370101		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr19:44636010C>T	ENST00000262894.6	+	5	1523	c.1243C>T	c.(1243-1245)Cgt>Tgt	p.R415C	ZNF225_ENST00000592780.1_3'UTR|ZNF225_ENST00000590612.1_Missense_Mutation_p.R415C	NM_013362.2	NP_037494.2	Q9UK10	ZN225_HUMAN	zinc finger protein 225	415					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|skin(1)|stomach(1)	16		Prostate(69;0.0352)|all_neural(266;0.202)				AAATTCACAACGTTATTCTCA	0.453													C|||	1	0.000199681	0.0	0.0	5008	,	,		20398	0.001		0.0	False		,,,				2504	0.0				p.R415C		.											.	.	0			c.C1243T						.	C	CYS/ARG	1,4387	2.1+/-5.4	0,1,2193	101.0	106.0	104.0		1243	1.4	0.0	19		104	1,8589	1.2+/-3.3	0,1,4294	yes	missense	ZNF225	NM_013362.2	180	0,2,6487	TT,TC,CC		0.0116,0.0228,0.0154	benign	415/707	44636010	2,12976	2194	4295	6489	SO:0001583	missense	7768	exon5			TCACAACGTTATT	AF187991	CCDS46100.1	19q13.31	2013-01-08				ENSG00000256294		"""Zinc fingers, C2H2-type"", ""-"""	13018	protein-coding gene	gene with protein product							Standard	NM_013362		Approved		uc002oyj.1	Q9UK10		ENST00000262894.6:c.1243C>T	19.37:g.44636010C>T	ENSP00000262894:p.Arg415Cys	Somatic	128	0		WXS	Illumina GAIIx	Phase_I	74	65	NM_013362	0	0	0	1	1	A8K8S2|Q53F12|Q9NS46|Q9UID8	Missense_Mutation	SNP	ENST00000262894.6	37	CCDS46100.1	.	.	.	.	.	.	.	.	.	.	C	9.500	1.102903	0.20632	2.28E-4	1.16E-4	ENSG00000256294	ENST00000262894;ENST00000544184	T	0.15256	2.44	2.43	1.36	0.22044	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.11922	0.0290	N	0.25825	0.765	0.09310	N	1	B	0.17268	0.021	B	0.11329	0.006	T	0.26573	-1.0099	9	0.62326	D	0.03	.	8.0916	0.30803	0.0:0.8668:0.0:0.1332	.	415	Q9UK10	ZN225_HUMAN	C	415;379	ENSP00000262894:R415C	ENSP00000262894:R415C	R	+	1	0	ZNF225	49327850	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-2.017000	0.01445	0.337000	0.23665	0.561000	0.74099	CGT	.		0.453	ZNF225-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460581.1		
APOE	348	hgsc.bcm.edu	37	19	45411941	45411941	+	Missense_Mutation	SNP	T	T	C	rs429358	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr19:45411941T>C	ENST00000252486.4	+	4	499	c.388T>C	c.(388-390)Tgc>Cgc	p.C130R		NM_000041.2	NP_000032.1	P02649	APOE_HUMAN	apolipoprotein E	130	8 X 22 AA approximate tandem repeats.		C -> R (in HLPP3; form E3**, form E4, form E4/3 and some forms E5-type; only form E3** is disease-linked; dbSNP:rs429358). {ECO:0000269|PubMed:11042151, ECO:0000269|PubMed:12966036, ECO:0000269|PubMed:8287539, ECO:0000269|PubMed:9360638}.		aging (GO:0007568)|alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|artery morphogenesis (GO:0048844)|cell death (GO:0008219)|cellular calcium ion homeostasis (GO:0006874)|cellular response to cholesterol (GO:0071397)|cellular response to growth factor stimulus (GO:0071363)|cellular response to interleukin-1 (GO:0071347)|cGMP-mediated signaling (GO:0019934)|cholesterol catabolic process (GO:0006707)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|chylomicron remnant clearance (GO:0034382)|cytoskeleton organization (GO:0007010)|fatty acid homeostasis (GO:0055089)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle assembly (GO:0034380)|high-density lipoprotein particle clearance (GO:0034384)|high-density lipoprotein particle remodeling (GO:0034375)|intracellular transport (GO:0046907)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|long-chain fatty acid transport (GO:0015909)|low-density lipoprotein particle remodeling (GO:0034374)|maintenance of location in cell (GO:0051651)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of blood coagulation (GO:0030195)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cholesterol biosynthetic process (GO:0045541)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of dendritic spine development (GO:0061000)|negative regulation of dendritic spine maintenance (GO:1902951)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of inflammatory response (GO:0050728)|negative regulation of lipid biosynthetic process (GO:0051055)|negative regulation of lipid transport across blood brain barrier (GO:1903001)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron death (GO:1901215)|negative regulation of phospholipid efflux (GO:1902999)|negative regulation of platelet activation (GO:0010544)|negative regulation of postsynaptic membrane organization (GO:1901627)|negative regulation of presynaptic membrane organization (GO:1901630)|nitric oxide mediated signal transduction (GO:0007263)|oligodendrocyte differentiation (GO:0048709)|peripheral nervous system axon regeneration (GO:0014012)|phospholipid efflux (GO:0033700)|phototransduction, visible light (GO:0007603)|positive regulation of axon extension (GO:0045773)|positive regulation of beta-amyloid formation (GO:1902004)|positive regulation of cGMP biosynthetic process (GO:0030828)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of cholesterol esterification (GO:0010873)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of dendritic spine maintenance (GO:1902952)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of lipid transport across blood brain barrier (GO:1903002)|positive regulation of low-density lipoprotein particle receptor catabolic process (GO:0032805)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of neurofibrillary tangle assembly (GO:1902998)|positive regulation of neuron death (GO:1901216)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of phospholipid efflux (GO:1902995)|positive regulation of postsynaptic membrane organization (GO:1901628)|positive regulation of presynaptic membrane organization (GO:1901631)|protein import (GO:0017038)|receptor-mediated endocytosis (GO:0006898)|regulation of axon extension (GO:0030516)|regulation of beta-amyloid clearance (GO:1900221)|regulation of Cdc42 protein signal transduction (GO:0032489)|regulation of neuron death (GO:1901214)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of tau-protein kinase activity (GO:1902947)|response to dietary excess (GO:0002021)|response to ethanol (GO:0045471)|response to insulin (GO:0032868)|response to reactive oxygen species (GO:0000302)|response to retinoic acid (GO:0032526)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|synaptic transmission, cholinergic (GO:0007271)|triglyceride metabolic process (GO:0006641)|vasodilation (GO:0042311)|very-low-density lipoprotein particle clearance (GO:0034447)|very-low-density lipoprotein particle remodeling (GO:0034372)	blood microparticle (GO:0072562)|chylomicron (GO:0042627)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|high-density lipoprotein particle (GO:0034364)|intermediate-density lipoprotein particle (GO:0034363)|late endosome (GO:0005770)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)|vesicle (GO:0031982)	antioxidant activity (GO:0016209)|beta-amyloid binding (GO:0001540)|cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|hydroxyapatite binding (GO:0046848)|identical protein binding (GO:0042802)|lipid binding (GO:0008289)|lipid transporter activity (GO:0005319)|lipoprotein particle binding (GO:0071813)|low-density lipoprotein particle receptor binding (GO:0050750)|metal chelating activity (GO:0046911)|phosphatidylcholine-sterol O-acyltransferase activator activity (GO:0060228)|phospholipid binding (GO:0005543)|protein homodimerization activity (GO:0042803)|tau protein binding (GO:0048156)|very-low-density lipoprotein particle receptor binding (GO:0070326)			large_intestine(1)|lung(2)|prostate(1)	4	Lung NSC(12;0.0018)|all_lung(12;0.00481)	Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00327)|Epithelial(262;0.174)	Human Serum Albumin(DB00062)|Serum albumin iodonated(DB00064)	GGAGGACGTGTGCGGCCGCCT	0.736													c|||	754	0.150559	0.2678	0.1037	5008	,	,		8484	0.0863		0.1551	False		,,,				2504	0.0869				p.C130R		.											.	APOE-90	0			c.T388C	GRCh37	CM900020	APOE	M	rs429358	.	C	ARG/CYS	808,3460		86,636,1412	12.0	12.0	12.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	388	3.0	0.4	19	dbSNP_80	12	961,7261		66,829,3216	no	missense	APOE	NM_000041.2	180	152,1465,4628	CC,CT,TT	http://www.ncbi.nlm.nih.gov/pubmed?term	11.6882,18.9316,14.1633	benign	130/318	45411941	1769,10721	2134	4111	6245	SO:0001583	missense	348	exon4			GACGTGTGCGGCC	K00396	CCDS12647.1	19q13.31	2013-01-24			ENSG00000130203	ENSG00000130203		"""Apolipoproteins"""	613	protein-coding gene	gene with protein product		107741	"""Alzheimer disease 2 (APOE*E4-associated, late onset)"""	AD2		10662539	Standard	NM_000041		Approved		uc002pab.3	P02649	OTTHUMG00000128901	ENST00000252486.4:c.388T>C	19.37:g.45411941T>C	ENSP00000252486:p.Cys130Arg	Somatic	3	0		WXS	Illumina GAIIx	Phase_I	15	13	NM_000041	0	2	3	630	625	B2RC15|C0JYY5|Q9P2S4	Missense_Mutation	SNP	ENST00000252486.4	37	CCDS12647.1	326	0.14926739926739926	128	0.2601626016260163	40	0.11049723756906077	50	0.08741258741258741	108	0.1424802110817942	C	0.007	-1.965077	0.00461	0.189316	0.116882	ENSG00000130203	ENST00000252486;ENST00000446996;ENST00000434152;ENST00000425718	T;T;T	0.81078	-0.24;-1.45;-1.45	5.25	3.02	0.34903	Apolipoprotein/apolipophorin (1);	0.486559	0.18187	N	0.148941	T	0.00012	0.0000	N	0.00289	-1.7	0.80722	P	0.0	B	0.02656	0.0	B	0.04013	0.001	T	0.25641	-1.0126	9	0.02654	T	1	-8.1152	3.0382	0.06129	0.1694:0.5443:0.1863:0.1001	rs429358;rs630496;rs61228756	130	P02649	APOE_HUMAN	R	130;130;175;130	ENSP00000252486:C130R;ENSP00000413135:C130R;ENSP00000410423:C130R	ENSP00000252486:C130R	C	+	1	0	APOE	50103781	0.019000	0.18553	0.404000	0.26397	0.109000	0.19521	0.121000	0.15667	1.239000	0.43787	-0.215000	0.12644	TGC	T|0.861;C|0.139		0.736	APOE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250865.2	NM_000041	
TULP2	7288	ucsc.edu	37	19	49399726	49399726	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr19:49399726G>A	ENST00000221399.3	-	4	316	c.172C>T	c.(172-174)Cgc>Tgc	p.R58C		NM_003323.2	NP_003314.2	O00295	TULP2_HUMAN	tubby like protein 2	58					visual perception (GO:0007601)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	protein complex binding (GO:0032403)			NS(1)|breast(2)|central_nervous_system(2)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)|skin(2)	22		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000259)|all cancers(93;0.000435)|Epithelial(262;0.0221)|GBM - Glioblastoma multiforme(486;0.0234)		AGACAAGAGCGCCAAAGCCAC	0.637																																					p.R58C		.											.	TULP2-93	0			c.C172T						.						45.0	47.0	46.0					19																	49399726		2203	4300	6503	SO:0001583	missense	7288	exon4			AAGAGCGCCAAAG	U82469	CCDS12739.1	19q13.1	2009-08-06			ENSG00000104804	ENSG00000104804			12424	protein-coding gene	gene with protein product	"""cancer/testis antigen 65"""	602309				9096357	Standard	NM_003323		Approved	TUBL2, CT65	uc002pkz.2	O00295	OTTHUMG00000164406	ENST00000221399.3:c.172C>T	19.37:g.49399726G>A	ENSP00000221399:p.Arg58Cys	Somatic	54	0		WXS	Illumina GAIIx	Phase_I	42	4	NM_003323	0	0	0	0	0	Q8TC50	Missense_Mutation	SNP	ENST00000221399.3	37	CCDS12739.1	.	.	.	.	.	.	.	.	.	.	G	17.18	3.323221	0.60634	.	.	ENSG00000104804	ENST00000221399;ENST00000518572;ENST00000522945;ENST00000520977;ENST00000522229	D;T;T;T	0.86562	-2.14;1.52;0.82;0.27	5.03	2.78	0.32641	Tubby, N-terminal (1);	0.678460	0.13857	N	0.357935	D	0.88887	0.6559	L	0.56199	1.76	0.19300	N	0.999977	D	0.76494	0.999	P	0.57324	0.818	T	0.79313	-0.1855	10	0.56958	D	0.05	-1.6322	9.8786	0.41220	0.0:0.1519:0.6906:0.1575	.	58	O00295	TULP2_HUMAN	C	58;58;58;39;14	ENSP00000221399:R58C;ENSP00000428420:R58C;ENSP00000430040:R58C;ENSP00000428535:R39C	ENSP00000221399:R58C	R	-	1	0	TULP2	54091538	0.025000	0.19082	0.008000	0.14137	0.009000	0.06853	0.972000	0.29409	0.574000	0.29417	0.596000	0.82720	CGC	.		0.637	TULP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378633.1	NM_003323	
ZNF473	25888	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	50549939	50549939	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr19:50549939C>T	ENST00000595661.1	+	6	2734	c.2239C>T	c.(2239-2241)Cgc>Tgc	p.R747C	ZNF473_ENST00000270617.3_Missense_Mutation_p.R747C|ZNF473_ENST00000601364.1_Intron|CTD-2126E3.3_ENST00000599914.1_RNA|ZNF473_ENST00000391821.2_Missense_Mutation_p.R747C|CTD-2126E3.3_ENST00000599410.1_RNA|ZNF473_ENST00000445728.3_Missense_Mutation_p.R735C			Q8WTR7	ZN473_HUMAN	zinc finger protein 473	747					gene expression (GO:0010467)|histone mRNA 3'-end processing (GO:0006398)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	Cajal body (GO:0015030)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(9)|liver(2)|lung(12)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	37		all_neural(266;0.0459)|Ovarian(192;0.0728)		GBM - Glioblastoma multiforme(134;0.00111)|OV - Ovarian serous cystadenocarcinoma(262;0.0058)		TGAGCTTGTCCGCCACCAGAG	0.502											OREG0025632	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R747C		.											.	ZNF473-91	0			c.C2239T						.						75.0	79.0	78.0					19																	50549939		2203	4300	6503	SO:0001583	missense	25888	exon5			CTTGTCCGCCACC	AB032967	CCDS33077.1	19q13.33	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	23239	protein-coding gene	gene with protein product						11782445	Standard	NM_015428		Approved	KIAA1141, DKFZP434N043, HZFP100	uc002prn.3	Q8WTR7		ENST00000595661.1:c.2239C>T	19.37:g.50549939C>T	ENSP00000472808:p.Arg747Cys	Somatic	88	0	970	WXS	Illumina GAIIx	Phase_I	76	71	NM_015428	0	0	0	10	10	A8K8T7|Q9ULS9|Q9Y4Q7	Missense_Mutation	SNP	ENST00000595661.1	37	CCDS33077.1	.	.	.	.	.	.	.	.	.	.	C	11.41	1.630116	0.28978	.	.	ENSG00000142528	ENST00000270617;ENST00000391821;ENST00000445728	T;T;T	0.07800	3.16;3.16;3.16	4.23	3.2	0.36748	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.845028	0.09732	N	0.762991	T	0.23171	0.0560	M	0.68317	2.08	0.09310	N	1	D	0.89917	1.0	P	0.61722	0.893	T	0.07028	-1.0794	10	0.54805	T	0.06	-0.7558	10.4737	0.44652	0.0:0.9029:0.0:0.0971	.	747	Q8WTR7	ZN473_HUMAN	C	747;747;735	ENSP00000270617:R747C;ENSP00000375697:R747C;ENSP00000388961:R735C	ENSP00000270617:R747C	R	+	1	0	ZNF473	55241751	0.000000	0.05858	0.259000	0.24435	0.287000	0.27160	0.401000	0.20948	1.372000	0.46190	0.650000	0.86243	CGC	.		0.502	ZNF473-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464833.1	XM_046390	
ASPDH	554235	hgsc.bcm.edu	37	19	51015404	51015404	+	Missense_Mutation	SNP	T	T	C	rs12977172	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr19:51015404T>C	ENST00000389208.4	-	6	858	c.797A>G	c.(796-798)cAg>cGg	p.Q266R	JOSD2_ENST00000598418.1_5'Flank|JOSD2_ENST00000391815.3_5'Flank|JOSD2_ENST00000595669.1_5'Flank|ASPDH_ENST00000376916.3_Missense_Mutation_p.Q161R|JOSD2_ENST00000601423.1_5'Flank|ASPDH_ENST00000597030.1_5'Flank	NM_001114598.1	NP_001108070.1	A6ND91	ASPD_HUMAN	aspartate dehydrogenase domain containing	266			Q -> R (in dbSNP:rs12977172). {ECO:0000269|PubMed:15489334, ECO:0000269|Ref.1}.		NAD biosynthetic process (GO:0009435)|NADP catabolic process (GO:0006742)		aspartate dehydrogenase activity (GO:0033735)|NADP binding (GO:0050661)			endometrium(1)|large_intestine(1)|lung(1)	3						CAGGAGGCTCTGCCAGAAGGC	0.706													C|||	3986	0.795927	0.9728	0.7781	5008	,	,		10864	0.7143		0.6849	False		,,,				2504	0.7679				p.Q266R		.											.	ASPDH-90	0			c.A797G						.	C	ARG/GLN,ARG/GLN	3799,331		1771,257,37	6.0	9.0	8.0		482,797	1.9	1.0	19	dbSNP_121	8	5527,2593		1919,1689,452	no	missense,missense	ASPDH	NM_001024656.2,NM_001114598.1	43,43	3690,1946,489	CC,CT,TT		31.9335,8.0145,23.8694	benign,benign	161/179,266/284	51015404	9326,2924	2065	4060	6125	SO:0001583	missense	554235	exon6			AGGCTCTGCCAGA		CCDS33082.1, CCDS46153.1	19q13.33	2012-10-02			ENSG00000204653	ENSG00000204653			33856	protein-coding gene	gene with protein product							Standard	NM_001024656		Approved		uc010enz.3	A6ND91		ENST00000389208.4:c.797A>G	19.37:g.51015404T>C	ENSP00000373860:p.Gln266Arg	Somatic	7	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_001114598	0	0	0	0	0	Q6NZ37	Missense_Mutation	SNP	ENST00000389208.4	37	CCDS46153.1	1681	0.7696886446886447	481	0.9776422764227642	273	0.7541436464088398	412	0.7202797202797203	515	0.679419525065963	C	3.606	-0.080592	0.07141	0.919855	0.680665	ENSG00000204653	ENST00000376916;ENST00000389208	T;T	0.39997	1.05;1.05	2.95	1.88	0.25563	Aspartate dehydrogenase (1);	1.158050	0.06646	N	0.761872	T	0.00012	0.0000	N	0.01705	-0.755	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.30794	-0.9966	9	0.06099	T	0.92	-1.7519	4.8935	0.13738	0.0:0.6813:0.0:0.3187	rs12977172	266;161	A6ND91;A6ND91-2	ASPD_HUMAN;.	R	161;266	ENSP00000366114:Q161R;ENSP00000373860:Q266R	ENSP00000366114:Q161R	Q	-	2	0	ASPDH	55707216	0.916000	0.31088	0.989000	0.46669	0.553000	0.35397	0.171000	0.16685	0.125000	0.18397	-0.355000	0.07637	CAG	T|0.228;C|0.772		0.706	ASPDH-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464861.1	NM_001024656	
VSIG10L	147645	broad.mit.edu	37	19	51837102	51837102	+	Silent	SNP	T	T	C			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr19:51837102T>C	ENST00000335624.4	-	9	2516	c.2517A>G	c.(2515-2517)tcA>tcG	p.S839S		NM_001163922.1	NP_001157394.1	Q86VR7	VS10L_HUMAN	V-set and immunoglobulin domain containing 10 like	839						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(1)	4						CCAGAGGCCATGAAATCTCCA	0.542																																					p.S839S		.											.	.	0			c.A2517G						.						51.0	51.0	51.0					19																	51837102		692	1591	2283	SO:0001819	synonymous_variant	147645	exon9			AGGCCATGAAATC		CCDS54300.1	19q13.41	2013-01-11				ENSG00000186806		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	27111	protein-coding gene	gene with protein product						12477932	Standard	NM_001163922		Approved		uc002pwf.3	Q86VR7		ENST00000335624.4:c.2517A>G	19.37:g.51837102T>C		Somatic	93	0		WXS	Illumina GAIIx	Phase_I	67	3	NM_001163922	0	0	2	2	0		Silent	SNP	ENST00000335624.4	37	CCDS54300.1																																																																																			.		0.542	VSIG10L-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464535.1	NM_001163922	
TMC4	147798	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	54669182	54669182	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr19:54669182G>A	ENST00000376591.4	-	6	1065	c.934C>T	c.(934-936)Cgc>Tgc	p.R312C	TMC4_ENST00000476013.2_Intron|TMC4_ENST00000416963.1_5'Flank|TMC4_ENST00000301187.4_Missense_Mutation_p.R306C	NM_001145303.1|NM_144686.2	NP_001138775|NP_653287.2	Q7Z404	TMC4_HUMAN	transmembrane channel-like 4	312					ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(2)|endometrium(7)|large_intestine(4)|lung(6)|pancreas(1)|skin(1)|urinary_tract(1)	22	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					ATGCGCTGGCGCAGCCGCACG	0.632																																					p.R312C		.											.	TMC4-91	0			c.C934T						.						44.0	35.0	38.0					19																	54669182		2203	4300	6503	SO:0001583	missense	147798	exon6			GCTGGCGCAGCCG	AY236492	CCDS12882.1, CCDS46174.1	19q13.42	2008-02-05			ENSG00000167608	ENSG00000167608			22998	protein-coding gene	gene with protein product						12812529, 12906855	Standard	XM_005277069		Approved		uc010erf.3	Q7Z404	OTTHUMG00000066485	ENST00000376591.4:c.934C>T	19.37:g.54669182G>A	ENSP00000365776:p.Arg312Cys	Somatic	161	0		WXS	Illumina GAIIx	Phase_I	86	46	NM_001145303	0	0	2	4	2	Q7Z5M3|Q8N5E4|Q8TBS7	Missense_Mutation	SNP	ENST00000376591.4	37	CCDS46174.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.455100	0.84209	.	.	ENSG00000167608	ENST00000301187;ENST00000376591	T;T	0.52754	0.65;0.65	4.8	4.8	0.61643	.	0.058937	0.64402	D	0.000002	T	0.65709	0.2717	M	0.77820	2.39	0.80722	D	1	D;D	0.76494	0.999;0.997	P;P	0.61397	0.796;0.888	T	0.70883	-0.4751	10	0.87932	D	0	-19.4647	13.8098	0.63256	0.0:0.0:1.0:0.0	.	312;306	Q7Z404;Q7Z404-1	TMC4_HUMAN;.	C	306;312	ENSP00000301187:R306C;ENSP00000365776:R312C	ENSP00000301187:R306C	R	-	1	0	TMC4	59360994	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.335000	0.52105	2.418000	0.82041	0.650000	0.86243	CGC	.		0.632	TMC4-011	NOVEL	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000156164.2		
NLRP5	126206	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	56544918	56544918	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr19:56544918G>A	ENST00000390649.3	+	9	2458	c.2458G>A	c.(2458-2460)Gca>Aca	p.A820T		NM_153447.4	NP_703148.4	P59047	NALP5_HUMAN	NLR family, pyrin domain containing 5	820					cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|embryo implantation (GO:0007566)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|neuron death (GO:0070997)|organ morphogenesis (GO:0009887)|regulation of protein stability (GO:0031647)|regulation of RNA stability (GO:0043487)	apical cortex (GO:0045179)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|protein complex (GO:0043234)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|ovary(5)|skin(2)|stomach(4)|upper_aerodigestive_tract(2)	25		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		GTTTAGAAATGCACAGATTAC	0.493																																					p.A820T		.											.	NLRP5-162	0			c.G2458A						.						172.0	171.0	171.0					19																	56544918		1967	4173	6140	SO:0001583	missense	126206	exon9			AGAAATGCACAGA	AY154460	CCDS12938.1	19q13.43	2008-10-30	2006-12-08	2006-12-08	ENSG00000171487	ENSG00000171487		"""Nucleotide-binding domain and leucine rich repeat containing"""	21269	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 5"""	609658	"""NACHT, leucine rich repeat and PYD containing 5"""	NALP5		12563287, 11925379	Standard	NM_153447		Approved	PYPAF8, MATER, PAN11, CLR19.8	uc002qmj.3	P59047	OTTHUMG00000149887	ENST00000390649.3:c.2458G>A	19.37:g.56544918G>A	ENSP00000375063:p.Ala820Thr	Somatic	192	0		WXS	Illumina GAIIx	Phase_I	137	126	NM_153447	0	0	0	0	0	A8MTY4|Q86W29	Missense_Mutation	SNP	ENST00000390649.3	37	CCDS12938.1	.	.	.	.	.	.	.	.	.	.	G	5.735	0.320050	0.10845	.	.	ENSG00000171487	ENST00000390649	T	0.16897	2.31	3.05	-0.582	0.11709	.	0.547996	0.13747	N	0.365530	T	0.14485	0.0350	M	0.69823	2.125	0.09310	N	1	B	0.28998	0.23	B	0.26864	0.074	T	0.22347	-1.0219	10	0.30854	T	0.27	.	2.6193	0.04912	0.2658:0.0:0.5069:0.2273	.	820	P59047	NALP5_HUMAN	T	820	ENSP00000375063:A820T	ENSP00000375063:A820T	A	+	1	0	NLRP5	61236730	0.004000	0.15560	0.000000	0.03702	0.001000	0.01503	1.571000	0.36450	-0.007000	0.14345	-0.156000	0.13503	GCA	.		0.493	NLRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313735.1	NM_153447	
ZNF135	7694	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	58579725	58579725	+	Missense_Mutation	SNP	C	C	T	rs138910447		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr19:58579725C>T	ENST00000313434.5	+	5	1974	c.1873C>T	c.(1873-1875)Cgg>Tgg	p.R625W	ZNF135_ENST00000401053.4_Missense_Mutation_p.R649W|RN7SL526P_ENST00000469492.2_RNA|ZNF135_ENST00000506786.1_Missense_Mutation_p.R583W|ZNF135_ENST00000511556.1_Missense_Mutation_p.R637W|ZNF135_ENST00000359978.6_Intron|ZNF135_ENST00000439855.2_Missense_Mutation_p.R625W	NM_003436.3	NP_003427.3	P52742	ZN135_HUMAN	zinc finger protein 135	625					cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(26)|ovary(1)|skin(1)|urinary_tract(1)	41		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0161)		CACTCAGCACCGGAGGATCCA	0.562																																					p.R649W		.											.	ZNF135-91	0			c.C1945T						.	C	,,TRP/ARG,TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	81.0	76.0	78.0		,,1909,1945	2.3	1.0	19	dbSNP_134	78	0,8600		0,0,4300	no	utr-3,intron,missense,missense	ZNF135	NM_001164529.1,NM_001164530.1,NM_003436.3,NM_007134.1	,,101,101	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,,probably-damaging,probably-damaging	,,637/671,649/683	58579725	1,13005	2203	4300	6503	SO:0001583	missense	7694	exon4			CAGCACCGGAGGA	U09413	CCDS12970.1, CCDS12970.2, CCDS54329.1, CCDS54330.1, CCDS74471.1, CCDS74472.1	19q13.4	2013-01-08	2006-05-12			ENSG00000176293		"""Zinc fingers, C2H2-type"", ""-"""	12919	protein-coding gene	gene with protein product		604077	"""zinc finger protein 61"", ""zinc finger protein 135 (clone pHZ-17)"""	ZNF61, ZNF78L1		7557990, 1505991	Standard	NM_003436		Approved	pHZ-17	uc002qrg.3	P52742		ENST00000313434.5:c.1873C>T	19.37:g.58579725C>T	ENSP00000321406:p.Arg625Trp	Somatic	195	0		WXS	Illumina GAIIx	Phase_I	106	98	NM_007134	0	0	0	4	4	B4DHH9|E9PEV2|F5GYY9|I3L0B3|Q5U5L3|Q8N1I7	Missense_Mutation	SNP	ENST00000313434.5	37		.	.	.	.	.	.	.	.	.	.	C	10.41	1.343634	0.24339	2.27E-4	0.0	ENSG00000176293	ENST00000401053;ENST00000439855;ENST00000313434;ENST00000511556;ENST00000506786	T;T;T;T;T	0.07688	3.17;3.17;3.17;3.17;3.17	3.37	2.29	0.28610	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.20740	0.0499	M	0.63208	1.945	0.23371	N	0.997819	D;D	0.65815	0.99;0.995	P;P	0.60345	0.851;0.873	T	0.03922	-1.0992	9	0.66056	D	0.02	.	10.9215	0.47167	0.1899:0.8101:0.0:0.0	.	637;625	E9PEV2;P52742	.;ZN135_HUMAN	W	649;625;625;637;583	ENSP00000441410:R649W;ENSP00000444828:R625W;ENSP00000321406:R625W;ENSP00000422074:R637W;ENSP00000427691:R583W	ENSP00000321406:R625W	R	+	1	2	ZNF135	63271537	0.001000	0.12720	0.999000	0.59377	0.014000	0.08584	-0.067000	0.11579	0.738000	0.32606	-0.321000	0.08615	CGG	C|1.000;T|0.000		0.562	ZNF135-003	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000361899.2	NM_003436	
ZNF324	25799	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	58982784	58982784	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr19:58982784G>A	ENST00000536459.2	+	4	1634	c.925G>A	c.(925-927)Ggc>Agc	p.G309S	ZNF446_ENST00000596341.1_5'Flank|ZNF324_ENST00000535298.1_Missense_Mutation_p.G86S|ZNF324_ENST00000196482.3_Missense_Mutation_p.G309S			O75467	Z324A_HUMAN	zinc finger protein 324	309					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(1)|lung(2)|prostate(2)|urinary_tract(2)	16		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0164)|Lung(386;0.179)		CATCCACAGCGGCGAGACGCC	0.697																																					p.G309S		.											.	ZNF324-90	0			c.G925A						.						17.0	15.0	16.0					19																	58982784		2131	4177	6308	SO:0001583	missense	25799	exon4			CACAGCGGCGAGA	AF060503	CCDS12981.1	19q13.43	2013-01-08				ENSG00000083812		"""Zinc fingers, C2H2-type"", ""-"""	14096	protein-coding gene	gene with protein product							Standard	NM_014347		Approved	ZF5128, ZNF324A	uc002qsw.2	O75467		ENST00000536459.2:c.925G>A	19.37:g.58982784G>A	ENSP00000444812:p.Gly309Ser	Somatic	158	1		WXS	Illumina GAIIx	Phase_I	304	252	NM_014347	0	0	2	4	2	B3KRX1	Missense_Mutation	SNP	ENST00000536459.2	37	CCDS12981.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.038817	0.75617	.	.	ENSG00000083812	ENST00000196482;ENST00000536459;ENST00000539101;ENST00000535298	T;T;T	0.01279	5.06;5.06;5.06	4.38	4.38	0.52667	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.42682	D	0.000665	T	0.06005	0.0156	L	0.55834	1.745	0.41471	D	0.988103	D	0.64830	0.994	D	0.67103	0.949	T	0.22661	-1.0210	10	0.87932	D	0	.	15.241	0.73471	0.0:0.0:1.0:0.0	.	309	O75467	Z324A_HUMAN	S	309;309;299;86	ENSP00000196482:G309S;ENSP00000444812:G309S;ENSP00000439588:G86S	ENSP00000196482:G309S	G	+	1	0	ZNF324	63674596	0.982000	0.34865	0.475000	0.27278	0.845000	0.48019	1.989000	0.40707	2.365000	0.80145	0.455000	0.32223	GGC	.		0.697	ZNF324-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467044.1	NM_014347	
MZF1	7593	broad.mit.edu	37	19	59082627	59082627	+	Missense_Mutation	SNP	G	G	A	rs199500324	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr19:59082627G>A	ENST00000215057.2	-	2	690	c.130C>T	c.(130-132)Cgc>Tgc	p.R44C	MZF1_ENST00000594234.1_Missense_Mutation_p.R44C|AC016629.8_ENST00000593642.1_RNA|MZF1_ENST00000599369.1_Missense_Mutation_p.R44C|AC016629.8_ENST00000600534.1_RNA|MZF1_ENST00000594108.1_Missense_Mutation_p.R44C|AC016629.8_ENST00000600726.1_RNA	NM_001267033.1|NM_198055.1	NP_001253962.1|NP_932172.1	P28698	MZF1_HUMAN	myeloid zinc finger 1	44	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0443)|all cancers(4;7.92e-14)|Epithelial(4;5.57e-11)|OV - Ovarian serous cystadenocarcinoma(4;1.13e-09)|GBM - Glioblastoma multiforme(193;0.0108)|Lung(386;0.182)		AAACGCAGGCGTGCAGCTTCA	0.652																																					p.R44C		.											.	MZF1-91	0			c.C130T						.	G	CYS/ARG,CYS/ARG	0,4406		0,0,2203	24.0	27.0	26.0		130,130	-0.8	0.0	19		26	1,8599		0,1,4299	no	missense,missense	MZF1	NM_003422.2,NM_198055.1	180,180	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	44/735,44/735	59082627	1,13005	2203	4300	6503	SO:0001583	missense	7593	exon2			GCAGGCGTGCAGC	M58297	CCDS12988.1, CCDS59427.1	19q13.43	2014-08-22	2006-06-15	2006-06-15	ENSG00000099326	ENSG00000099326		"""-"", ""Zinc fingers, C2H2-type"""	13108	protein-coding gene	gene with protein product		194550	"""zinc finger protein 42 (myeloid-specific retinoic acid-responsive)"""	ZNF42		1860835	Standard	NM_198055		Approved	ZSCAN6, MZF1B, MZF-1, Zfp98	uc002qtn.3	P28698	OTTHUMG00000183550	ENST00000215057.2:c.130C>T	19.37:g.59082627G>A	ENSP00000215057:p.Arg44Cys	Somatic	115	0		WXS	Illumina GAIIx	Phase_I	94	4	NM_198055	0	0	12	12	0	M0QXU0|Q7Z729|Q96I71|Q9NRY0|Q9UBW2	Missense_Mutation	SNP	ENST00000215057.2	37	CCDS12988.1	.	.	.	.	.	.	.	.	.	.	.	16.58	3.161721	0.57368	0.0	1.16E-4	ENSG00000099326	ENST00000215057	T	0.08282	3.11	4.35	-0.822	0.10819	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	0.549873	0.15410	N	0.263823	T	0.08626	0.0214	M	0.75884	2.315	0.09310	N	0.999992	B;B	0.21753	0.06;0.005	B;B	0.17433	0.018;0.002	T	0.29119	-1.0022	9	.	.	.	-19.3632	3.0323	0.06110	0.3808:0.0:0.4284:0.1908	.	44;44	Q7Z729;P28698	.;MZF1_HUMAN	C	44	ENSP00000215057:R44C	.	R	-	1	0	MZF1	63774439	0.000000	0.05858	0.006000	0.13384	0.849000	0.48306	0.060000	0.14342	-0.137000	0.11455	0.563000	0.77884	CGC	G|0.999;C|0.000		0.652	MZF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467112.1	NM_198055	
RNF144A	9781	broad.mit.edu	37	2	7164508	7164508	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr2:7164508T>C	ENST00000320892.6	+	7	960	c.518T>C	c.(517-519)tTc>tCc	p.F173S	RNF144A_ENST00000467276.1_3'UTR	NM_014746.3	NP_055561.2	P50876	R144A_HUMAN	ring finger protein 144A	173					protein ubiquitination (GO:0016567)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(15)|ovary(1)|prostate(1)	25	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)	all_cancers(51;0.226)		OV - Ovarian serous cystadenocarcinoma(76;0.195)		AGTGCTGCTTTCAAAATGGAA	0.567																																					p.F173S		.											.	RNF144A-227	0			c.T518C						.						76.0	71.0	73.0					2																	7164508		2203	4300	6503	SO:0001583	missense	9781	exon7			CTGCTTTCAAAAT	D79983	CCDS1657.1	2p25.2	2008-02-05	2007-08-20	2007-08-20	ENSG00000151692	ENSG00000151692		"""RING-type (C3HC4) zinc fingers"""	20457	protein-coding gene	gene with protein product			"""ring finger protein 144"""	RNF144		8724849, 10431818	Standard	NM_014746		Approved	UBCE7IP4, KIAA0161	uc002qys.3	P50876	OTTHUMG00000090353	ENST00000320892.6:c.518T>C	2.37:g.7164508T>C	ENSP00000321330:p.Phe173Ser	Somatic	113	0		WXS	Illumina GAIIx	Phase_I	68	3	NM_014746	0	0	1	1	0	D6W4Y6|Q585H5	Missense_Mutation	SNP	ENST00000320892.6	37	CCDS1657.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.39|12.39	1.922947|1.922947	0.33908|0.33908	.|.	.|.	ENSG00000151692|ENSG00000151692	ENST00000320892;ENST00000427092|ENST00000432850	T|.	0.62941|.	-0.01|.	5.87|5.87	5.87|5.87	0.94306|0.94306	Zinc finger, C6HC-type (1);|.	0.237399|.	0.51477|.	D|.	0.000090|.	T|T	0.39436|0.39436	0.1078|0.1078	N|N	0.13235|0.13235	0.315|0.315	0.41325|0.41325	D|D	0.987203|0.987203	B|.	0.26708|.	0.157|.	B|.	0.39185|.	0.293|.	T|T	0.34279|0.34279	-0.9835|-0.9835	10|5	0.22109|.	T|.	0.4|.	.|.	10.1117|10.1117	0.42565|0.42565	0.2577:0.0:0.0:0.7423|0.2577:0.0:0.0:0.7423	.|.	173|.	P50876|.	R144A_HUMAN|.	S|P	173|169	ENSP00000321330:F173S|.	ENSP00000321330:F173S|.	F|S	+|+	2|1	0|0	RNF144A|RNF144A	7081959|7081959	1.000000|1.000000	0.71417|0.71417	0.579000|0.579000	0.28588|0.28588	0.566000|0.566000	0.35808|0.35808	3.026000|3.026000	0.49689|0.49689	2.248000|2.248000	0.74166|0.74166	0.533000|0.533000	0.62120|0.62120	TTC|TCA	.		0.567	RNF144A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206725.2	NM_014746	
MPV17	4358	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	27535925	27535925	+	Missense_Mutation	SNP	C	C	T	rs397507438|rs140992482		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr2:27535925C>T	ENST00000380044.1	-	3	177	c.122G>A	c.(121-123)cGg>cAg	p.R41Q	MPV17_ENST00000405983.1_Missense_Mutation_p.R56Q|MPV17_ENST00000233545.2_Missense_Mutation_p.R41Q|MPV17_ENST00000403262.2_Missense_Mutation_p.R41Q|MPV17_ENST00000405076.1_Missense_Mutation_p.R41Q|MPV17_ENST00000402722.1_Silent_p.A29A|MPV17_ENST00000357186.6_Intron|MPV17_ENST00000402310.1_Missense_Mutation_p.R41Q	NM_002437.4	NP_002428.1	P39210	MPV17_HUMAN	MpV17 mitochondrial inner membrane protein	41					cellular response to reactive oxygen species (GO:0034614)|glomerular basement membrane development (GO:0032836)|homeostatic process (GO:0042592)|inner ear development (GO:0048839)|mitochondrial genome maintenance (GO:0000002)|reactive oxygen species metabolic process (GO:0072593)|regulation of reactive oxygen species metabolic process (GO:2000377)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)		p.R56L(1)|p.R41L(1)		lung(4)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTGCAGACCCCGCCTCTCCAC	0.592																																					p.R41Q		.											.	MPV17-90	2	Substitution - Missense(2)	lung(2)	c.G122A						.	C	GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	102.0	103.0	103.0		122	3.5	1.0	2	dbSNP_134	103	0,8600		0,0,4300	no	missense	MPV17	NM_002437.4	43	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging	41/177	27535925	1,13005	2203	4300	6503	SO:0001583	missense	4358	exon3			AGACCCCGCCTCT		CCDS1748.1	2p23.3	2008-02-05	2006-05-12		ENSG00000115204	ENSG00000115204			7224	protein-coding gene	gene with protein product	"""glomerulosclerosis"""	137960	"""MpV17 transgene, murine homolog, glomerulosclerosis"""			8281143, 16582910	Standard	XM_005264326		Approved	SYM1	uc002rjs.3	P39210	OTTHUMG00000097074	ENST00000380044.1:c.122G>A	2.37:g.27535925C>T	ENSP00000369383:p.Arg41Gln	Somatic	247	1		WXS	Illumina GAIIx	Phase_I	175	154	NM_002437	0	0	5	15	10	D6W555|Q53SY2|Q96B08	Missense_Mutation	SNP	ENST00000380044.1	37	CCDS1748.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.16|18.16	3.562395|3.562395	0.65538|0.65538	2.27E-4|2.27E-4	0.0|0.0	ENSG00000115204|ENSG00000115204	ENST00000430991|ENST00000402310;ENST00000233545;ENST00000380044;ENST00000405983;ENST00000405076;ENST00000403262;ENST00000428910	.|D;D;D;D;D;D;D	.|0.92099	.|-2.17;-2.59;-2.59;-2.62;-2.97;-2.13;-1.99	5.37|5.37	3.54|3.54	0.40534|0.40534	.|.	.|0.071484	.|0.53938	.|D	.|0.000048	D|D	0.91616|0.91616	0.7351|0.7351	M|M	0.71581|0.71581	2.175|2.175	0.80722|0.80722	D|D	1|1	.|P;D	.|0.57899	.|0.5;0.981	.|B;P	.|0.49637	.|0.109;0.617	D|D	0.89885|0.89885	0.4033|0.4033	5|10	.|0.39692	.|T	.|0.17	.|.	8.5133|8.5133	0.33231|0.33231	0.0:0.821:0.0:0.179|0.0:0.821:0.0:0.179	.|.	.|41;41	.|P39210;B5MC53	.|MPV17_HUMAN;.	R|Q	18|41;41;41;56;41;41;15	.|ENSP00000383955:R41Q;ENSP00000233545:R41Q;ENSP00000369383:R41Q;ENSP00000384586:R56Q;ENSP00000385175:R41Q;ENSP00000385671:R41Q;ENSP00000405235:R15Q	.|ENSP00000233545:R41Q	G|R	-|-	1|2	0|0	MPV17|MPV17	27389429|27389429	0.974000|0.974000	0.33945|0.33945	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	1.978000|1.978000	0.40598|0.40598	1.507000|1.507000	0.48752|0.48752	0.609000|0.609000	0.83330|0.83330	GGG|CGG	C|1.000;T|0.000		0.592	MPV17-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214193.1	NM_002437	
CLIP4	79745	bcgsc.ca	37	2	29366643	29366643	+	Silent	SNP	C	C	T	rs115153920	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr2:29366643C>T	ENST00000320081.5	+	7	972	c.717C>T	c.(715-717)gaC>gaT	p.D239D	CLIP4_ENST00000401617.2_Silent_p.D132D|CLIP4_ENST00000404424.1_Silent_p.D239D|CLIP4_ENST00000401605.1_Silent_p.D239D	NM_024692.4	NP_078968.3	Q8N3C7	CLIP4_HUMAN	CAP-GLY domain containing linker protein family, member 4	239										endometrium(4)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|prostate(1)|skin(1)	26	Acute lymphoblastic leukemia(172;0.155)					AGATGGCTGACGCCGCAGCCA	0.443													C|||	21	0.00419329	0.0151	0.0014	5008	,	,		20132	0.0		0.0	False		,,,				2504	0.0				p.D239D		.											.	CLIP4-91	0			c.C717T						.	C		54,4352	55.5+/-91.7	0,54,2149	103.0	100.0	101.0		717	-0.4	1.0	2	dbSNP_132	101	0,8600		0,0,4300	no	coding-synonymous	CLIP4	NM_024692.4		0,54,6449	TT,TC,CC		0.0,1.2256,0.4152		239/706	29366643	54,12952	2203	4300	6503	SO:0001819	synonymous_variant	79745	exon7			GGCTGACGCCGCA	AK024722	CCDS1770.1, CCDS74502.1	2p23	2013-01-10	2007-01-04	2007-01-04	ENSG00000115295	ENSG00000115295		"""Ankyrin repeat domain containing"""	26108	protein-coding gene	gene with protein product			"""restin-like 2"""	RSNL2			Standard	XM_005264562		Approved	FLJ21069	uc002rmv.3	Q8N3C7	OTTHUMG00000097837	ENST00000320081.5:c.717C>T	2.37:g.29366643C>T		Somatic	271	4		WXS	Illumina GAIIx	Phase_I	175	67	NM_024692	0	0	4	7	3	A0AV10|B2RMQ3|B7Z7N8|Q7Z4U3|Q96BR7|Q96MA5|Q9H7C0	Silent	SNP	ENST00000320081.5	37	CCDS1770.1																																																																																			C|0.995;T|0.005		0.443	CLIP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215123.2	NM_024692	
TMEM247	388946	hgsc.bcm.edu	37	2	46707887	46707887	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr2:46707887A>C	ENST00000434431.1	+	2	461	c.461A>C	c.(460-462)gAg>gCg	p.E154A		NM_001145051.2	NP_001138523.1	A6NEH6	TM247_HUMAN	transmembrane protein 247	154						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)											CTGCAGCAAGAGGCGGCGCCC	0.687																																					p.E154A		.											.	.	0			c.A461C						.						16.0	20.0	19.0					2																	46707887		690	1590	2280	SO:0001583	missense	388946	exon2			AGCAAGAGGCGGC		CCDS56117.1	2p21	2012-04-11			ENSG00000187600	ENSG00000187600			42967	protein-coding gene	gene with protein product							Standard	NM_001145051		Approved		uc010yod.3	A6NEH6	OTTHUMG00000153137	ENST00000434431.1:c.461A>C	2.37:g.46707887A>C	ENSP00000388684:p.Glu154Ala	Somatic	114	0		WXS	Illumina GAIIx	Phase_I	131	21	NM_001145051	0	0	0	0	0		Missense_Mutation	SNP	ENST00000434431.1	37	CCDS56117.1	.	.	.	.	.	.	.	.	.	.	A	4.562	0.104456	0.08731	.	.	ENSG00000187600	ENST00000434431	.	.	.	4.12	1.52	0.23074	.	.	.	.	.	T	0.25531	0.0621	N	0.08118	0	.	.	.	B	0.02656	0.0	B	0.04013	0.001	T	0.18967	-1.0320	7	0.37606	T	0.19	.	8.7168	0.34416	0.6235:0.3765:0.0:0.0	.	154	A6NEH6	YB028_HUMAN	A	154	.	ENSP00000388684:E154A	E	+	2	0	AC018682.6	46561391	0.914000	0.31030	0.027000	0.17364	0.000000	0.00434	2.075000	0.41538	0.127000	0.18452	-0.461000	0.05368	GAG	.		0.687	TMEM247-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329726.1	NM_001145051	
MSH6	2956	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	48026605	48026605	+	Nonsense_Mutation	SNP	C	C	T	rs587779212		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr2:48026605C>T	ENST00000234420.5	+	4	1635	c.1483C>T	c.(1483-1485)Cga>Tga	p.R495*	MSH6_ENST00000538136.1_Nonsense_Mutation_p.R193*|FBXO11_ENST00000405808.1_Intron|MSH6_ENST00000540021.1_Nonsense_Mutation_p.R365*	NM_000179.2	NP_000170.1	P52701	MSH6_HUMAN	mutS homolog 6	495					ATP catabolic process (GO:0006200)|determination of adult lifespan (GO:0008340)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|isotype switching (GO:0045190)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|response to UV (GO:0009411)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|MutSalpha complex (GO:0032301)|nuclear chromatin (GO:0000790)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|guanine/thymine mispair binding (GO:0032137)|methylated histone binding (GO:0035064)|mismatched DNA binding (GO:0030983)	p.R495*(2)|p.0?(2)		breast(8)|central_nervous_system(29)|cervix(1)|endometrium(32)|haematopoietic_and_lymphoid_tissue(12)|kidney(2)|large_intestine(75)|lung(25)|ovary(3)|prostate(3)|skin(10)|stomach(22)|thyroid(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	229		Acute lymphoblastic leukemia(82;0.0299)|all_hematologic(82;0.0358)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			GATGGAGGCACGATGTAGAAA	0.458			"""Mis, N, F, S"""		colorectal	"""colorectal, endometrial, ovarian"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																												p.R495X		.	yes	Rec	yes	Hereditary non-polyposis colorectal cancer	2	2p16	2956	mutS homolog 6 (E. coli)		E	.	MSH6-3014	4	Substitution - Nonsense(2)|Whole gene deletion(2)	haematopoietic_and_lymphoid_tissue(4)	c.C1483T						.						91.0	83.0	86.0					2																	48026605		2203	4300	6503	SO:0001587	stop_gained	2956	exon4	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	GAGGCACGATGTA	U54777	CCDS1836.1, CCDS62906.1, CCDS62907.1	2p16	2014-09-17	2013-09-12		ENSG00000116062	ENSG00000116062			7329	protein-coding gene	gene with protein product		600678	"""mutS (E. coli) homolog 6"", ""mutS homolog 6 (E. coli)"""	GTBP		7604266	Standard	NM_000179		Approved		uc002rwd.4	P52701	OTTHUMG00000129129	ENST00000234420.5:c.1483C>T	2.37:g.48026605C>T	ENSP00000234420:p.Arg495*	Somatic	258	0		WXS	Illumina GAIIx	Phase_I	165	151	NM_000179	0	0	0	2	2	B4DF41|B4E3I4|F5H2F9|O43706|O43917|Q8TCX4|Q9BTB5	Nonsense_Mutation	SNP	ENST00000234420.5	37	CCDS1836.1	.	.	.	.	.	.	.	.	.	.	C	41	8.994209	0.99029	.	.	ENSG00000116062	ENST00000234420;ENST00000544857;ENST00000540021;ENST00000538136	.	.	.	5.35	1.2	0.21068	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.1781	14.8717	0.70462	0.5242:0.4758:0.0:0.0	.	.	.	.	X	495;493;365;193	.	ENSP00000234420:R495X	R	+	1	2	MSH6	47880109	0.982000	0.34865	0.731000	0.30826	0.903000	0.53119	2.587000	0.46128	-0.070000	0.12908	0.650000	0.86243	CGA	.		0.458	MSH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251180.4	NM_000179	
PSME4	23198	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	2	54159045	54159045	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr2:54159045G>T	ENST00000404125.1	-	10	1298	c.1243C>A	c.(1243-1245)Cta>Ata	p.L415I	PSME4_ENST00000421748.2_Intron	NM_014614.2	NP_055429.2	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator subunit 4	415					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)|spermatoproteasome complex (GO:1990111)	lysine-acetylated histone binding (GO:0070577)|peptidase activator activity (GO:0016504)			breast(5)|endometrium(8)|kidney(1)|large_intestine(11)|lung(26)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(2)	60			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			GCTGCTTCTAGACTACCGGTT	0.453																																					p.L415I		.											.	PSME4-275	0			c.C1243A						.						82.0	77.0	79.0					2																	54159045		2203	4300	6503	SO:0001583	missense	23198	exon10			CTTCTAGACTACC	D38521	CCDS33197.2	2p16.1	2003-04-14			ENSG00000068878	ENSG00000068878		"""Proteasome (prosome, macropain) subunits"""	20635	protein-coding gene	gene with protein product		607705				7584044, 12093752	Standard	NM_014614		Approved	PA200, KIAA0077	uc002rxp.2	Q14997	OTTHUMG00000151852	ENST00000404125.1:c.1243C>A	2.37:g.54159045G>T	ENSP00000384211:p.Leu415Ile	Somatic	261	2		WXS	Illumina GAIIx	Phase_I	164	147	NM_014614	0	0	0	1	1	Q1XBG4|Q1XBG5|Q1XBG6|Q2M1Z0|Q6IPR2|Q86XF8	Missense_Mutation	SNP	ENST00000404125.1	37	CCDS33197.2	.	.	.	.	.	.	.	.	.	.	G	13.62	2.292005	0.40594	.	.	ENSG00000068878	ENST00000404125	T	0.05258	3.47	5.62	2.67	0.31697	.	0.000000	0.85682	D	0.000000	T	0.03564	0.0102	N	0.14661	0.345	0.80722	D	1	B	0.20988	0.05	B	0.12837	0.008	T	0.50224	-0.8853	10	0.22706	T	0.39	.	8.0894	0.30793	0.2936:0.0:0.7064:0.0	.	415	Q14997	PSME4_HUMAN	I	415	ENSP00000384211:L415I	ENSP00000374643:L415I	L	-	1	2	PSME4	54012549	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.980000	0.56895	0.302000	0.22762	-0.201000	0.12746	CTA	.		0.453	PSME4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324163.1	XM_040158	
GMCL1	64395	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	70096886	70096886	+	Silent	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr2:70096886C>T	ENST00000282570.3	+	12	1505	c.1254C>T	c.(1252-1254)ttC>ttT	p.F418F		NM_178439.3	NP_848526.1	Q96IK5	GMCL1_HUMAN	germ cell-less, spermatogenesis associated 1	418					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)	nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)				endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	15						ACTTCGGCTTCGACCTACTTG	0.373																																					p.F418F		.											.	GMCL1-93	0			c.C1254T						.						148.0	133.0	138.0					2																	70096886		2203	4300	6503	SO:0001819	synonymous_variant	64395	exon12			CGGCTTCGACCTA	AK023119	CCDS1895.1	2p13.3	2013-01-09	2012-08-20		ENSG00000087338	ENSG00000087338		"""BTB/POZ domain containing"""	23843	protein-coding gene	gene with protein product	"""spermatogenesis associated 29"""		"""germ cell-less homolog 1 (Drosophila)"""				Standard	NM_178439		Approved	FLJ13057, BTBD13, GCL1, SPATA29	uc002sfu.3	Q96IK5	OTTHUMG00000129643	ENST00000282570.3:c.1254C>T	2.37:g.70096886C>T		Somatic	84	1		WXS	Illumina GAIIx	Phase_I	70	66	NM_178439	0	0	0	12	12	Q9H826|Q9H8V7|Q9H927	Silent	SNP	ENST00000282570.3	37	CCDS1895.1																																																																																			.		0.373	GMCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251841.2	NM_178439	
PCBP1	5093	broad.mit.edu	37	2	70315210	70315210	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr2:70315210T>A	ENST00000303577.5	+	1	626	c.335T>A	c.(334-336)cTg>cAg	p.L112Q	PCBP1-AS1_ENST00000366234.3_RNA|PCBP1-AS1_ENST00000419963.1_RNA|PCBP1-AS1_ENST00000423402.1_RNA|PCBP1-AS1_ENST00000435880.2_RNA|PCBP1-AS1_ENST00000457076.1_RNA|PCBP1-AS1_ENST00000439892.1_RNA|PCBP1-AS1_ENST00000418308.1_RNA|PCBP1-AS1_ENST00000413069.1_RNA|PCBP1-AS1_ENST00000425601.1_RNA|PCBP1-AS1_ENST00000449178.1_RNA|PCBP1-AS1_ENST00000415742.1_RNA|PCBP1-AS1_ENST00000415222.1_RNA|PCBP1-AS1_ENST00000442040.1_RNA|PCBP1-AS1_ENST00000596028.1_RNA|PCBP1-AS1_ENST00000413791.1_RNA|PCBP1-AS1_ENST00000457770.1_RNA|PCBP1-AS1_ENST00000413436.1_RNA|PCBP1-AS1_ENST00000411429.1_RNA|PCBP1-AS1_ENST00000420309.1_RNA|PCBP1-AS1_ENST00000596573.1_RNA|PCBP1-AS1_ENST00000422515.1_RNA|PCBP1-AS1_ENST00000452431.1_RNA|PCBP1-AS1_ENST00000434781.1_RNA|PCBP1-AS1_ENST00000599673.1_RNA|PCBP1-AS1_ENST00000456161.1_RNA|AC016700.2_ENST00000455541.1_lincRNA|PCBP1-AS1_ENST00000418564.1_RNA|PCBP1-AS1_ENST00000421843.1_RNA|PCBP1-AS1_ENST00000444410.1_RNA|PCBP1-AS1_ENST00000609075.1_RNA|PCBP1-AS1_ENST00000610168.1_RNA|PCBP1-AS1_ENST00000437456.1_RNA|PCBP1-AS1_ENST00000416395.1_RNA|PCBP1-AS1_ENST00000421255.1_RNA|PCBP1-AS1_ENST00000594548.1_RNA|PCBP1-AS1_ENST00000458686.1_RNA|PCBP1-AS1_ENST00000601396.1_RNA|PCBP1-AS1_ENST00000437019.1_RNA|PCBP1-AS1_ENST00000415060.2_RNA|PCBP1-AS1_ENST00000429599.2_RNA|PCBP1-AS1_ENST00000416068.1_RNA|PCBP1-AS1_ENST00000432604.1_RNA|PCBP1-AS1_ENST00000596665.1_RNA|PCBP1-AS1_ENST00000458698.2_RNA|PCBP1-AS1_ENST00000444320.1_RNA|PCBP1-AS1_ENST00000439670.2_RNA|PCBP1-AS1_ENST00000595459.1_RNA|PCBP1-AS1_ENST00000425333.1_RNA	NM_006196.3	NP_006187.2	Q15365	PCBP1_HUMAN	poly(rC) binding protein 1	112	KH 2. {ECO:0000255|PROSITE- ProRule:PRU00117}.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			endometrium(2)|kidney(1)|large_intestine(6)|lung(2)|skin(1)	12						TGCGGCTCCCTGATTGGGAAA	0.652																																					p.L112Q	Colon(85;1146 1307 3484 18706 25380)	.											.	PCBP1-226	0			c.T335A						.						50.0	62.0	57.0					2																	70315210		2200	4296	6496	SO:0001583	missense	5093	exon1			GCTCCCTGATTGG		CCDS1898.1	2p13-p12	2013-07-16	2001-11-28		ENSG00000169564	ENSG00000169564			8647	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein E1"""	601209	"""poly(rC)-binding protein 1"""			8833161	Standard	NM_006196		Approved	HNRPE1, hnRNP-E1, HNRPX, hnRNP-X	uc002sgf.3	Q15365	OTTHUMG00000129645	ENST00000303577.5:c.335T>A	2.37:g.70315210T>A	ENSP00000305556:p.Leu112Gln	Somatic	101	0		WXS	Illumina GAIIx	Phase_I	89	5	NM_006196	0	0	253	253	0	Q13157|Q14975	Missense_Mutation	SNP	ENST00000303577.5	37	CCDS1898.1	.	.	.	.	.	.	.	.	.	.	T	17.69	3.450675	0.63290	.	.	ENSG00000169564	ENST00000303577	T	0.38240	1.15	4.03	2.86	0.33363	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.000000	0.64402	U	0.000003	T	0.66509	0.2796	H	0.95365	3.66	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.70726	-0.4793	10	0.87932	D	0	.	8.1045	0.30877	0.0:0.0995:0.0:0.9004	.	112	Q15365	PCBP1_HUMAN	Q	112	ENSP00000305556:L112Q	ENSP00000305556:L112Q	L	+	2	0	PCBP1	70168714	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.604000	0.82830	0.894000	0.36317	0.397000	0.26171	CTG	.		0.652	PCBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251844.1	NM_006196	
DNAH6	1768	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	84899458	84899458	+	Silent	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr2:84899458G>A	ENST00000237449.6	+	39	6470	c.6462G>A	c.(6460-6462)ccG>ccA	p.P2154P	DNAH6_ENST00000389394.3_Silent_p.P2154P|DNAH6_ENST00000398278.2_Silent_p.P2154P|DNAH6_ENST00000602588.1_Silent_p.P175P			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	2154	AAA 3. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						TAGGAGCACCGGGAAACAAAC	0.373																																					p.P2154P		.											.	DNAH6-69	0			c.G6462A						.						91.0	81.0	84.0					2																	84899458		692	1591	2283	SO:0001819	synonymous_variant	1768	exon40			AGCACCGGGAAAC	U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.6462G>A	2.37:g.84899458G>A		Somatic	51	0		WXS	Illumina GAIIx	Phase_I	45	37	NM_001370	0	0	0	0	0	A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Silent	SNP	ENST00000237449.6	37	CCDS46348.1																																																																																			.		0.373	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328537.2	NM_001370	
MRPS5	64969	ucsc.edu	37	2	95766639	95766639	+	Splice_Site	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr2:95766639C>T	ENST00000272418.2	-	9	1019	c.811G>A	c.(811-813)Gca>Aca	p.A271T		NM_031902.3	NP_114108.1	P82675	RT05_HUMAN	mitochondrial ribosomal protein S5	271	S5 DRBM. {ECO:0000255|PROSITE- ProRule:PRU00268}.				translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	20						CTGTTCTTTGCCTGAAAGGAA	0.269																																					p.A271T		.											.	MRPS5-92	0			c.G811A						.						97.0	95.0	96.0					2																	95766639		2202	4300	6502	SO:0001630	splice_region_variant	64969	exon9			TCTTTGCCTGAAA	AB049940	CCDS2010.1	2p11.2-q11.2	2012-09-13			ENSG00000144029	ENSG00000144029		"""Mitochondrial ribosomal proteins / small subunits"""	14498	protein-coding gene	gene with protein product	"""mitochondrial 28S ribosomal protein S5"""	611972					Standard	NM_031902		Approved	MRP-S5, S5mt	uc002sub.3	P82675	OTTHUMG00000130394	ENST00000272418.2:c.811-1G>A	2.37:g.95766639C>T		Somatic	61	0		WXS	Illumina GAIIx	Phase_I	43	4	NM_031902	0	0	0	0	0	Q4ZFY5|Q96LJ6|Q9BWI4|Q9BYC4	Missense_Mutation	SNP	ENST00000272418.2	37	CCDS2010.1	.	.	.	.	.	.	.	.	.	.	C	29.9	5.041781	0.93685	.	.	ENSG00000144029	ENST00000272418	.	.	.	5.68	5.68	0.88126	Ribosomal protein S5, N-terminal (2);Double-stranded RNA-binding-like (1);	0.000000	0.85682	D	0.000000	D	0.90133	0.6917	H	0.97635	4.045	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.92988	0.6412	9	0.87932	D	0	-17.1672	17.6445	0.88145	0.0:1.0:0.0:0.0	.	271	P82675	RT05_HUMAN	T	271	.	ENSP00000272418:A271T	A	-	1	0	MRPS5	95130366	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	6.686000	0.74548	2.838000	0.97847	0.591000	0.81541	GCA	.		0.269	MRPS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252772.1	NM_031902	Missense_Mutation
INPP4A	3631	broad.mit.edu	37	2	99155995	99155995	+	Silent	SNP	C	C	T	rs376566589		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr2:99155995C>T	ENST00000523221.1	+	8	675	c.675C>T	c.(673-675)ttC>ttT	p.F225F	INPP4A_ENST00000074304.5_Silent_p.F225F|INPP4A_ENST00000545415.1_Silent_p.F225F|INPP4A_ENST00000409463.1_Intron|INPP4A_ENST00000409016.4_Silent_p.F225F|INPP4A_ENST00000409540.3_Silent_p.F225F|INPP4A_ENST00000409851.3_Silent_p.F225F			Q96PE3	INP4A_HUMAN	inositol polyphosphate-4-phosphatase, type I, 107kDa	225					inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity (GO:0016316)|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity (GO:0034597)			breast(1)|endometrium(9)|kidney(2)|large_intestine(5)|lung(16)|ovary(2)|prostate(4)|upper_aerodigestive_tract(4)	43						CCTCAGTGTTCGGTGGTGCCA	0.597													C|||	1	0.000199681	0.0	0.0014	5008	,	,		6712	0.0		0.0	False		,,,				2504	0.0				p.F225F		.											.	INPP4A-227	0			c.C675T						.	C	,,,	3,4127		0,3,2062	127.0	121.0	123.0		675,675,675,675	-9.4	0.1	2		123	2,8406		0,2,4202	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	INPP4A	NM_001134224.1,NM_001134225.1,NM_001566.2,NM_004027.2	,,,	0,5,6264	TT,TC,CC		0.0238,0.0726,0.0399	,,,	225/978,225/973,225/955,225/939	99155995	5,12533	2065	4204	6269	SO:0001819	synonymous_variant	3631	exon10			AGTGTTCGGTGGT	U26398	CCDS46369.1, CCDS46370.1, CCDS46371.1, CCDS46372.1	2q11.2	2008-05-27	2002-08-29		ENSG00000040933	ENSG00000040933			6074	protein-coding gene	gene with protein product		600916	"""inositol polyphosphate-4-phosphatase, type I, 107kD"""	INPP4		7608176, 9295334	Standard	NM_004027		Approved		uc002syy.3	Q96PE3	OTTHUMG00000153106	ENST00000523221.1:c.675C>T	2.37:g.99155995C>T		Somatic	189	0		WXS	Illumina GAIIx	Phase_I	119	5	NM_004027	0	0	0	0	0	O15326|Q13187|Q53TD8|Q8TC02	Silent	SNP	ENST00000523221.1	37	CCDS46369.1																																																																																			.		0.597	INPP4A-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376095.1	NM_001566	
BCL2L11	10018	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	111921764	111921764	+	Nonsense_Mutation	SNP	C	C	T	rs138706378	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr2:111921764C>T	ENST00000393256.3	+	4	826	c.553C>T	c.(553-555)Cga>Tga	p.R185*	BCL2L11_ENST00000308659.8_Nonsense_Mutation_p.R125*	NM_001204106.1|NM_006538.4|NM_138621.4|NM_138627.3	NP_001191035.1|NP_006529.1|NP_619527.1|NP_619533.1	O43521	B2L11_HUMAN	BCL2-like 11 (apoptosis facilitator)	185					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|apoptotic signaling pathway (GO:0097190)|B cell apoptotic process (GO:0001783)|B cell homeostasis (GO:0001782)|brain development (GO:0007420)|cell-matrix adhesion (GO:0007160)|cellular process regulating host cell cycle in response to virus (GO:0060154)|developmental pigmentation (GO:0048066)|ear development (GO:0043583)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|kidney development (GO:0001822)|male gonad development (GO:0008584)|mammary gland development (GO:0030879)|myeloid cell homeostasis (GO:0002262)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic process by virus (GO:0060139)|positive regulation of cell cycle (GO:0045787)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902110)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of protein homooligomerization (GO:0032464)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|post-embryonic organ morphogenesis (GO:0048563)|regulation of developmental pigmentation (GO:0048070)|regulation of organ growth (GO:0046620)|response to endoplasmic reticulum stress (GO:0034976)|spermatogenesis (GO:0007283)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)|thymocyte apoptotic process (GO:0070242)|thymus development (GO:0048538)|tube formation (GO:0035148)	BIM-BCL-2 complex (GO:0097141)|BIM-BCL-xl complex (GO:0097140)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|mitochondrial outer membrane (GO:0005741)				endometrium(4)|large_intestine(3)|lung(2)|prostate(2)	11						GGTTATCTTACGACTGTTACG	0.433																																					p.R185X		.											.	BCL2L11-1083	0			c.C553T						.						137.0	117.0	124.0					2																	111921764		2203	4300	6503	SO:0001587	stop_gained	10018	exon4			ATCTTACGACTGT	AF032458	CCDS2089.1, CCDS2092.1, CCDS42731.1, CCDS56131.1, CCDS56132.1, CCDS56133.1, CCDS56134.1, CCDS56135.1, CCDS56136.1, CCDS74560.1, CCDS74561.1, CCDS74559.1	2q13	2014-09-17			ENSG00000153094	ENSG00000153094			994	protein-coding gene	gene with protein product		603827				9731710, 9430630	Standard	NM_006538		Approved	BOD, BimL, BimEL, BimS, BIM	uc002tgv.1	O43521	OTTHUMG00000131256	ENST00000393256.3:c.553C>T	2.37:g.111921764C>T	ENSP00000376943:p.Arg185*	Somatic	131	0		WXS	Illumina GAIIx	Phase_I	113	99	NM_138621	0	0	0	2	2	A8K2W2|O43522|Q0MSE7|Q0MSE8|Q0MSE9|Q53R28|Q6JTU6|Q6T851|Q6TE14|Q6TE15|Q6TE16|Q6V402|Q8WYL6|Q8WYL7|Q8WYL8|Q8WYL9|Q8WYM0|Q8WYM1	Nonsense_Mutation	SNP	ENST00000393256.3	37	CCDS2089.1	.	.	.	.	.	.	.	.	.	.	C	37	6.219749	0.97385	.	.	ENSG00000153094	ENST00000308659;ENST00000393256	.	.	.	5.48	5.48	0.80851	.	0.242208	0.29515	N	0.011939	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.15	18.2781	0.90089	0.0:1.0:0.0:0.0	.	.	.	.	X	125;185	.	ENSP00000309226:R125X	R	+	1	2	BCL2L11	111638235	1.000000	0.71417	0.938000	0.37757	0.963000	0.63663	3.410000	0.52664	2.744000	0.94065	0.563000	0.77884	CGA	C|0.999;G|0.001		0.433	BCL2L11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254022.3		
IL1RN	3557	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	113885278	113885278	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr2:113885278G>A	ENST00000409930.3	+	1	141	c.77G>A	c.(76-78)cGa>cAa	p.R26Q	IL1RN_ENST00000354115.2_Missense_Mutation_p.R8Q|IL1RN_ENST00000409052.1_5'UTR|IL1RN_ENST00000259206.5_Missense_Mutation_p.R29Q|IL1RN_ENST00000361779.3_5'UTR	NM_173842.2	NP_776214.1	P18510	IL1RA_HUMAN	interleukin 1 receptor antagonist	26					acute-phase response (GO:0006953)|carboxylic acid metabolic process (GO:0019752)|chronic inflammatory response to antigenic stimulus (GO:0002439)|female pregnancy (GO:0007565)|fever generation (GO:0001660)|immune response (GO:0006955)|insulin secretion (GO:0030073)|lipid metabolic process (GO:0006629)|memory (GO:0007613)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell migration (GO:0030336)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of glutamate secretion (GO:0014050)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of interleukin-1-mediated signaling pathway (GO:2000660)|negative regulation of membrane potential (GO:0045837)|positive regulation of JUN kinase activity (GO:0043507)|response to drug (GO:0042493)|response to glucocorticoid (GO:0051384)|response to interleukin-4 (GO:0070670)|response to lipopolysaccharide (GO:0032496)|response to organonitrogen compound (GO:0010243)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	interleukin-1 receptor antagonist activity (GO:0005152)|interleukin-1 receptor binding (GO:0005149)|interleukin-1 Type I receptor antagonist activity (GO:0045352)|interleukin-1 Type II receptor antagonist activity (GO:0045353)|interleukin-1, Type I receptor binding (GO:0005150)|interleukin-1, Type II receptor binding (GO:0005151)			breast(1)|large_intestine(2)|lung(4)|ovary(1)|skin(2)	10					Rilonacept(DB06372)	ACGATCTGCCGACCCTCTGGG	0.532									Lichen Sclerosis et Atrophicus, Familial Clustering of																												p.R29Q		.											.	IL1RN-92	0			c.G86A						.						78.0	74.0	76.0					2																	113885278		2203	4300	6503	SO:0001583	missense	3557	exon3	Familial Cancer Database	Lichen Sclerosis, Familial	TCTGCCGACCCTC	M55646	CCDS2113.1, CCDS2114.1, CCDS2115.1, CCDS46396.1	2q14.2	2014-09-17			ENSG00000136689	ENSG00000136689		"""Interleukins and interleukin receptors"", ""Endogenous ligands"""	6000	protein-coding gene	gene with protein product	"""interleukin-1 receptor antagonist protein"", ""intracellular interleukin-1 receptor antagonist"""	147679				1386337, 8432529	Standard	NM_000577		Approved	IL1RA, ICIL-1RA, IL1F3, IRAP, IL-1RN, MGC10430	uc002tjb.3	P18510	OTTHUMG00000131341	ENST00000409930.3:c.77G>A	2.37:g.113885278G>A	ENSP00000387173:p.Arg26Gln	Somatic	62	1		WXS	Illumina GAIIx	Phase_I	57	50	NM_173841	0	0	0	0	0	A8K4G1|Q14628|Q53SC2|Q7RTZ4|Q96GD6|Q9UPC0	Missense_Mutation	SNP	ENST00000409930.3	37	CCDS46396.1	.	.	.	.	.	.	.	.	.	.	G	5.282	0.237423	0.10023	.	.	ENSG00000136689	ENST00000259206;ENST00000354115;ENST00000409930	T;T;T	0.40756	1.02;1.06;1.1	5.24	-4.11	0.03928	.	0.804273	0.12013	N	0.507674	T	0.22898	0.0553	L	0.44542	1.39	0.09310	N	1	P;P;B	0.35700	0.516;0.497;0.305	B;B;B	0.24848	0.025;0.056;0.017	T	0.11690	-1.0577	10	0.29301	T	0.29	-7.5346	5.5542	0.17107	0.4463:0.0:0.4058:0.1479	.	26;8;29	P18510;P18510-2;Q53SC2	IL1RA_HUMAN;.;.	Q	29;8;26	ENSP00000259206:R29Q;ENSP00000329072:R8Q;ENSP00000387173:R26Q	ENSP00000259206:R29Q	R	+	2	0	IL1RN	113601749	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.195000	0.09546	-0.483000	0.06772	-0.137000	0.14449	CGA	.		0.532	IL1RN-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330802.1	NM_173841	
NCKAP5	344148	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	133541906	133541906	+	Silent	SNP	A	A	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr2:133541906A>T	ENST00000409261.1	-	14	2851	c.2478T>A	c.(2476-2478)ccT>ccA	p.P826P	NCKAP5_ENST00000409213.1_Intron|NCKAP5_ENST00000317721.6_Silent_p.P826P|NCKAP5_ENST00000473859.1_5'Flank|NCKAP5_ENST00000405974.3_Intron	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	826										NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						GGCCAGATGAAGGGAGTAGTG	0.473																																					p.P826P		.											.	.	0			c.T2478A						.						161.0	163.0	163.0					2																	133541906		1906	4122	6028	SO:0001819	synonymous_variant	344148	exon14			AGATGAAGGGAGT	AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.2478T>A	2.37:g.133541906A>T		Somatic	157	1		WXS	Illumina GAIIx	Phase_I	116	111	NM_207363	0	0	0	1	1	B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Silent	SNP	ENST00000409261.1	37	CCDS46418.1																																																																																			.		0.473	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331663.1	NM_207481	
DLX1	1745	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	172951487	172951487	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr2:172951487T>C	ENST00000361725.4	+	2	871	c.419T>C	c.(418-420)tTg>tCg	p.L140S	DLX1_ENST00000341900.6_Intron	NM_178120.4	NP_835221.2	P56177	DLX1_HUMAN	distal-less homeobox 1	140					cerebral cortex GABAergic interneuron fate commitment (GO:0021893)|embryonic skeletal system development (GO:0048706)|hippocampus development (GO:0021766)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis of dentin-containing tooth (GO:0042475)|proximal/distal pattern formation (GO:0009954)|regulation of transcription from RNA polymerase II promoter involved in forebrain neuron fate commitment (GO:0021882)|subpallium development (GO:0021544)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|lung(4)|prostate(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.216)			AGTTTGCAGTTGCAGGCTTTG	0.552																																					p.L140S		.											.	DLX1-90	0			c.T419C						.						158.0	168.0	165.0					2																	172951487		2203	4300	6503	SO:0001583	missense	1745	exon2			TGCAGTTGCAGGC	BC013010	CCDS2247.2, CCDS33328.1	2q31.1	2011-06-20	2005-12-22		ENSG00000144355	ENSG00000144355		"""Homeoboxes / ANTP class : NKL subclass"""	2914	protein-coding gene	gene with protein product		600029	"""distal-less homeo box 1"""			7907794	Standard	NM_001038493		Approved		uc002uhl.3	P56177	OTTHUMG00000073951	ENST00000361725.4:c.419T>C	2.37:g.172951487T>C	ENSP00000354478:p.Leu140Ser	Somatic	149	0		WXS	Illumina GAIIx	Phase_I	107	97	NM_178120	0	0	0	0	0	D3DPD7|Q53ZU4|Q7Z724|Q8IYB2	Missense_Mutation	SNP	ENST00000361725.4	37	CCDS2247.2	.	.	.	.	.	.	.	.	.	.	T	19.27	3.795252	0.70452	.	.	ENSG00000144355	ENST00000361609;ENST00000469444;ENST00000361725	D;D;D	0.97303	-4.33;-4.33;-4.33	5.41	5.41	0.78517	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.98604	0.9533	M	0.88105	2.93	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.97110	0.967;1.0	D	0.99790	1.1031	10	0.87932	D	0	-13.6176	15.7277	0.77774	0.0:0.0:0.0:1.0	.	140;140	F8VXJ2;P56177	.;DLX1_HUMAN	S	140	ENSP00000354865:L140S;ENSP00000448827:L140S;ENSP00000354478:L140S	ENSP00000354865:L140S	L	+	2	0	DLX1	172659733	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.961000	0.87903	2.169000	0.68431	0.459000	0.35465	TTG	.		0.552	DLX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405916.1	XM_087198	
TTN	7273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	179592882	179592882	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr2:179592882T>C	ENST00000591111.1	-	65	18942	c.18718A>G	c.(18718-18720)Aat>Gat	p.N6240D	TTN_ENST00000589042.1_Missense_Mutation_p.N6557D|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000342992.6_Missense_Mutation_p.N5313D|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Intron|RP11-171I2.1_ENST00000590024.1_RNA			Q8WZ42	TITIN_HUMAN	titin	13017	Ig-like 43.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCTGCTACATTTGACACTTTG	0.373																																					p.N6557D		.											.	TTN-636	0			c.A19669G						.						57.0	56.0	56.0					2																	179592882		1942	4155	6097	SO:0001583	missense	7273	exon67			CTACATTTGACAC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.18718A>G	2.37:g.179592882T>C	ENSP00000465570:p.Asn6240Asp	Somatic	119	0		WXS	Illumina GAIIx	Phase_I	98	92	NM_001267550	0	0	0	0	0	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	T	13.21	2.168261	0.38315	.	.	ENSG00000155657	ENST00000342992	T	0.59224	0.28	5.77	5.77	0.91146	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.85712	0.5760	H	0.98295	4.195	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	D	0.91298	0.5064	9	0.87932	D	0	.	16.3892	0.83528	0.0:0.0:0.0:1.0	.	6240	Q8WZ42	TITIN_HUMAN	D	5313	ENSP00000343764:N5313D	ENSP00000343764:N5313D	N	-	1	0	TTN	179301127	1.000000	0.71417	0.962000	0.40283	0.987000	0.75469	7.841000	0.86834	2.330000	0.79161	0.477000	0.44152	AAT	.		0.373	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
COL5A2	1290	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	189948711	189948711	+	Splice_Site	SNP	G	G	A	rs540573303		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr2:189948711G>A	ENST00000374866.3	-	12	1125	c.851C>T	c.(850-852)cCg>cTg	p.P284L		NM_000393.3	NP_000384.2	P05997	CO5A2_HUMAN	collagen, type V, alpha 2	284					axon guidance (GO:0007411)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|negative regulation of endodermal cell differentiation (GO:1903225)|skeletal system development (GO:0001501)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)			NS(3)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(53)|ovary(3)|prostate(2)|skin(6)|urinary_tract(3)	95			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			TAAACTTACCGGAGATCCTGC	0.353													G|||	1	0.000199681	0.0	0.0	5008	,	,		16978	0.001		0.0	False		,,,				2504	0.0				p.P284L		.											.	COL5A2-92	0			c.C851T						.						91.0	89.0	89.0					2																	189948711		2203	4300	6503	SO:0001630	splice_region_variant	1290	exon12			CTTACCGGAGATC	Y14690	CCDS33350.1	2q14-q32	2014-09-17			ENSG00000204262	ENSG00000204262		"""Collagens"""	2210	protein-coding gene	gene with protein product	"""AB collagen"""	120190				1572660	Standard	NM_000393		Approved		uc002uqk.3	P05997	OTTHUMG00000149842	ENST00000374866.3:c.852+1C>T	2.37:g.189948711G>A		Somatic	42	1		WXS	Illumina GAIIx	Phase_I	35	34	NM_000393	0	0	0	0	0	P78440|Q13908|Q53WR4|Q59GR4|Q6LDJ5|Q7KZ55|Q86XF6|Q96QB0|Q96QB3	Missense_Mutation	SNP	ENST00000374866.3	37	CCDS33350.1	.	.	.	.	.	.	.	.	.	.	G	18.88	3.717646	0.68844	.	.	ENSG00000204262	ENST00000374866;ENST00000452536	D	0.96685	-4.09	5.31	4.44	0.53790	.	0.124826	0.36338	N	0.002644	D	0.97142	0.9066	M	0.63169	1.94	0.80722	D	1	B;D	0.89917	0.382;1.0	B;D	0.76575	0.043;0.988	D	0.96626	0.9463	9	.	.	.	.	11.4688	0.50254	0.084:0.0:0.916:0.0	.	101;284	Q5PR22;P05997	.;CO5A2_HUMAN	L	284;101	ENSP00000364000:P284L	.	P	-	2	0	COL5A2	189656956	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	2.890000	0.48609	1.474000	0.48178	-0.143000	0.13931	CCG	.		0.353	COL5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313523.1	NM_000393	Missense_Mutation
MFSD6	54842	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	191301884	191301884	+	Missense_Mutation	SNP	G	G	A	rs554501896		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr2:191301884G>A	ENST00000392328.1	+	3	1453	c.1129G>A	c.(1129-1131)Gtt>Att	p.V377I	MFSD6_ENST00000281416.7_Missense_Mutation_p.V377I	NM_017694.3	NP_060164.3	Q6ZSS7	MFSD6_HUMAN	major facilitator superfamily domain containing 6	377					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)|skin(3)|stomach(1)	23						CGTCTTCGGCGTTCTCATGAC	0.512													G|||	1	0.000199681	0.0008	0.0	5008	,	,		23425	0.0		0.0	False		,,,				2504	0.0				p.V377I		.											.	MFSD6-92	0			c.G1129A						.						83.0	70.0	74.0					2																	191301884		2203	4300	6503	SO:0001583	missense	54842	exon3			TTCGGCGTTCTCA		CCDS2306.1	2q32.2	2008-10-29			ENSG00000151690	ENSG00000151690			24711	protein-coding gene	gene with protein product		613476					Standard	NM_017694		Approved	FLJ20160	uc002urz.2	Q6ZSS7	OTTHUMG00000132671	ENST00000392328.1:c.1129G>A	2.37:g.191301884G>A	ENSP00000376141:p.Val377Ile	Somatic	221	0		WXS	Illumina GAIIx	Phase_I	159	131	NM_017694	0	0	2	28	26	D3KSZ4|Q86TH2|Q9NXM3	Missense_Mutation	SNP	ENST00000392328.1	37	CCDS2306.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.376776	0.82682	.	.	ENSG00000151690	ENST00000392328;ENST00000281416	T;T	0.80304	-1.36;-1.36	6.16	6.16	0.99307	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	D	0.83031	0.5166	N	0.24115	0.695	0.80722	D	1	D	0.65815	0.995	D	0.62955	0.909	T	0.81564	-0.0875	10	0.38643	T	0.18	-28.433	19.848	0.96722	0.0:0.0:1.0:0.0	.	377	Q6ZSS7	MFSD6_HUMAN	I	377	ENSP00000376141:V377I;ENSP00000281416:V377I	ENSP00000281416:V377I	V	+	1	0	MFSD6	191010129	1.000000	0.71417	0.933000	0.37362	0.839000	0.47603	9.869000	0.99810	2.937000	0.99478	0.650000	0.86243	GTT	.		0.512	MFSD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255931.1		
SLC4A11	83959	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	3210042	3210042	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr20:3210042G>A	ENST00000380056.3	-	14	1894	c.1847C>T	c.(1846-1848)gCg>gTg	p.A616V	SLC4A11_ENST00000539553.2_Missense_Mutation_p.A600V|SLC4A11_ENST00000488544.1_5'UTR|SLC4A11_ENST00000380059.3_Missense_Mutation_p.A643V	NM_032034.3	NP_114423.1	Q8NBS3	S4A11_HUMAN	solute carrier family 4, sodium borate transporter, member 11	616	Membrane (bicarbonate transporter).				bicarbonate transport (GO:0015701)|borate transmembrane transport (GO:0035445)|borate transport (GO:0046713)|cellular cation homeostasis (GO:0030003)|fluid transport (GO:0042044)|proton transport (GO:0015992)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	bicarbonate transmembrane transporter activity (GO:0015106)|borate transmembrane transporter activity (GO:0046715)|hydrogen ion channel activity (GO:0015252)|inorganic anion exchanger activity (GO:0005452)|protein dimerization activity (GO:0046983)|sodium channel activity (GO:0005272)|symporter activity (GO:0015293)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(1)|lung(16)|ovary(2)|prostate(4)|soft_tissue(1)|urinary_tract(1)	40						GGCGAGCACCGCGATGGGCAG	0.672																																					p.A643V	NSCLC(190;922 2139 10266 10292 38692)	.											.	SLC4A11-91	0			c.C1928T						.						70.0	66.0	68.0					20																	3210042		2203	4300	6503	SO:0001583	missense	83959	exon15			AGCACCGCGATGG	AF336127	CCDS13052.1, CCDS54445.1, CCDS54446.1	20p13	2014-02-14	2007-08-03		ENSG00000088836	ENSG00000088836		"""Solute carriers"""	16438	protein-coding gene	gene with protein product		610206	"""corneal endothelial dystrophy 2 (autosomal recessive)"", ""solute carrier family 4, sodium bicarbonate transporter-like, member 11"", ""corneal dystrophy and perceptive deafness 1"""	CHED2, CDPD1		10843999, 11302728, 16767101	Standard	NM_001174089		Approved	dJ794I6.2, BTR1, NaBC1, FECD4	uc010zqe.2	Q8NBS3	OTTHUMG00000031740	ENST00000380056.3:c.1847C>T	20.37:g.3210042G>A	ENSP00000369396:p.Ala616Val	Somatic	135	0		WXS	Illumina GAIIx	Phase_I	127	27	NM_001174090	0	0	1	1	0	B4DKC8|B4DKX9|G3V1M3|Q2TB62|Q2TB63|Q9BXF4|Q9NTW9	Missense_Mutation	SNP	ENST00000380056.3	37	CCDS13052.1	.	.	.	.	.	.	.	.	.	.	G	18.61	3.661944	0.67700	.	.	ENSG00000088836	ENST00000380059;ENST00000380056;ENST00000539553	D;D;D	0.81579	-1.51;-1.51;-1.51	5.14	5.14	0.70334	Bicarbonate transporter, C-terminal (1);	0.384688	0.26784	N	0.022505	T	0.77955	0.4208	L	0.48877	1.53	0.48632	D	0.999686	P;P;P	0.45827	0.611;0.867;0.778	B;B;B	0.40901	0.167;0.338;0.343	T	0.81797	-0.0768	10	0.72032	D	0.01	.	18.5979	0.91235	0.0:0.0:1.0:0.0	.	600;643;616	G3V1M3;B4DKC8;Q8NBS3	.;.;S4A11_HUMAN	V	643;616;600	ENSP00000369399:A643V;ENSP00000369396:A616V;ENSP00000441370:A600V	ENSP00000369396:A616V	A	-	2	0	SLC4A11	3158042	1.000000	0.71417	0.481000	0.27354	0.641000	0.38312	9.807000	0.99171	2.378000	0.81104	0.462000	0.41574	GCG	.		0.672	SLC4A11-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000077728.1		
ADAM33	80332	hgsc.bcm.edu	37	20	3654433	3654433	+	Silent	SNP	C	C	T	rs2271511	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr20:3654433C>T	ENST00000356518.2	-	9	1105	c.864G>A	c.(862-864)ggG>ggA	p.G288G	ADAM33_ENST00000379861.4_Silent_p.G288G|ADAM33_ENST00000350009.2_Silent_p.G288G|ADAM33_ENST00000466620.1_5'Flank	NM_025220.2	NP_079496.1	Q9BZ11	ADA33_HUMAN	ADAM metallopeptidase domain 33	288	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				proteolysis (GO:0006508)	integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|skin(3)	29						GCGCCCACAGCCCCCGGCGCC	0.771													C|||	1379	0.275359	0.4319	0.1354	5008	,	,		9169	0.2212		0.1869	False		,,,				2504	0.3098				p.G288G		.											.	ADAM33-291	0			c.G864A						.	C	,	1271,2579		236,799,890	4.0	5.0	4.0		864,864	-0.6	0.0	20	dbSNP_100	4	1108,6216		89,930,2643	no	coding-synonymous,coding-synonymous	ADAM33	NM_025220.2,NM_153202.1	,	325,1729,3533	TT,TC,CC		15.1283,33.013,21.2905	,	288/814,288/788	3654433	2379,8795	1925	3662	5587	SO:0001819	synonymous_variant	80332	exon9			CCACAGCCCCCGG	AL117415, AB055891	CCDS13058.1, CCDS63219.1	20p13	2010-04-06	2005-08-18		ENSG00000149451	ENSG00000149451		"""ADAM metallopeptidase domain containing"""	15478	protein-coding gene	gene with protein product		607114	"""a disintegrin and metalloproteinase domain 33"", ""chromosome 20 open reading frame 153"""	C20orf153		11814695	Standard	XM_005260843		Approved	DKFZp434K0521, dJ964F7.1	uc002wit.3	Q9BZ11	OTTHUMG00000031758	ENST00000356518.2:c.864G>A	20.37:g.3654433C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	5	NM_025220	0	0	0	0	0	A0A1K6|Q5JT75|Q5JT76|Q8N0W6	Silent	SNP	ENST00000356518.2	37	CCDS13058.1																																																																																			C|0.751;T|0.249		0.771	ADAM33-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000077763.2	NM_025220	
SIGLEC1	6614	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	3673211	3673211	+	Silent	SNP	G	G	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr20:3673211G>T	ENST00000344754.4	-	15	3986	c.3987C>A	c.(3985-3987)gcC>gcA	p.A1329A	SIGLEC1_ENST00000202578.4_Silent_p.A1329A	NM_023068.3	NP_075556.1	Q9BZZ2	SN_HUMAN	sialic acid binding Ig-like lectin 1, sialoadhesin	1329	Ig-like C2-type 13.				cell-matrix adhesion (GO:0007160)|endocytosis (GO:0006897)|inflammatory response (GO:0006954)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of T cell apoptotic process (GO:0070234)|single organismal cell-cell adhesion (GO:0016337)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|liver(2)|lung(24)|ovary(3)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)	70						GGGTGCCCTGGGCATCCTGGG	0.672																																					p.A1329A		.											.	SIGLEC1-167	0			c.C3987A						.						19.0	21.0	20.0					20																	3673211		2202	4300	6502	SO:0001819	synonymous_variant	6614	exon15			GCCCTGGGCATCC	AF230073	CCDS13060.1	20p13	2013-01-29	2006-01-19	2006-01-19	ENSG00000088827	ENSG00000088827		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	11127	protein-coding gene	gene with protein product		600751	"""sialoadhesin"""	SN		8530048	Standard	XM_006723610		Approved	SIGLEC-1, CD169, FLJ00051, FLJ00055, FLJ00073, FLJ32150, dJ1009E24.1, sialoadhesin	uc002wja.3	Q9BZZ2	OTTHUMG00000031757	ENST00000344754.4:c.3987C>A	20.37:g.3673211G>T		Somatic	69	0		WXS	Illumina GAIIx	Phase_I	56	23	NM_023068	0	0	0	0	0	Q96DL4|Q9GZS5|Q9H1H6|Q9H1H7|Q9H7L7	Silent	SNP	ENST00000344754.4	37	CCDS13060.1	.	.	.	.	.	.	.	.	.	.	G	2.506	-0.314006	0.05422	.	.	ENSG00000088827	ENST00000419548	.	.	.	5.8	-2.14	0.07123	.	.	.	.	.	T	0.43100	0.1232	.	.	.	0.41875	D	0.99029	.	.	.	.	.	.	T	0.29305	-1.0016	4	.	.	.	.	4.3565	0.11181	0.2579:0.0:0.367:0.375	.	.	.	.	T	143	.	.	P	-	1	0	SIGLEC1	3621211	0.004000	0.15560	0.760000	0.31359	0.281000	0.26958	-0.134000	0.10436	-0.654000	0.05394	-0.169000	0.13324	CCA	.		0.672	SIGLEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077761.2	NM_023068	
PLCB1	23236	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	8609053	8609053	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr20:8609053T>G	ENST00000338037.6	+	4	386	c.359T>G	c.(358-360)gTg>gGg	p.V120G	PLCB1_ENST00000378641.3_Missense_Mutation_p.V120G|PLCB1_ENST00000378637.2_Missense_Mutation_p.V120G	NM_015192.2	NP_056007.1	Q9NQ66	PLCB1_HUMAN	phospholipase C, beta 1 (phosphoinositide-specific)	120					activation of meiosis involved in egg activation (GO:0060466)|cerebral cortex development (GO:0021987)|fat cell differentiation (GO:0045444)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G2/M transition of mitotic cell cycle (GO:0000086)|glutamate receptor signaling pathway (GO:0007215)|inositol phosphate metabolic process (GO:0043647)|insulin-like growth factor receptor signaling pathway (GO:0048009)|interleukin-1-mediated signaling pathway (GO:0070498)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-15-mediated signaling pathway (GO:0035723)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|memory (GO:0007613)|negative regulation of monocyte extravasation (GO:2000438)|negative regulation of transcription, DNA-templated (GO:0045892)|phosphatidylinositol metabolic process (GO:0046488)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of CD24 biosynthetic process (GO:2000560)|positive regulation of developmental growth (GO:0048639)|positive regulation of embryonic development (GO:0040019)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of GTPase activity (GO:0043547)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of JNK cascade (GO:0046330)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fertilization (GO:0080154)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|phosphatidylinositol phospholipase C activity (GO:0004435)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)|signal transducer activity (GO:0004871)			NS(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(11)|liver(2)|lung(41)|ovary(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	95						TTGAATCTCGTGGCTTTCCAA	0.478																																					p.F120C		.											.	PLCB1-297	0			c.T359G						.						131.0	115.0	120.0					20																	8609053		2203	4300	6503	SO:0001583	missense	23236	exon4			ATCTCGTGGCTTT	AB011153	CCDS13102.1, CCDS13103.1	20p12	2008-03-18			ENSG00000182621	ENSG00000182621	3.1.4.11		15917	protein-coding gene	gene with protein product		607120				10760467, 11118617	Standard	NM_015192		Approved	KIAA0581, PLC-I, PLC154	uc002wnb.4	Q9NQ66	OTTHUMG00000031849	ENST00000338037.6:c.359T>G	20.37:g.8609053T>G	ENSP00000338185:p.Val120Gly	Somatic	181	0		WXS	Illumina GAIIx	Phase_I	219	83	NM_015192	0	0	2	2	0	D3DW12|D3DW13|O60325|Q17RQ6|Q5TFF7|Q5TGC9|Q8IV93|Q9BQW2|Q9H4H2|Q9H8H5|Q9NQ65|Q9NQH9|Q9NTH4|Q9UJP6|Q9UM26	Missense_Mutation	SNP	ENST00000338037.6	37	CCDS13102.1	.	.	.	.	.	.	.	.	.	.	T	20.4	3.982977	0.74474	.	.	ENSG00000182621	ENST00000378641;ENST00000338037;ENST00000378637;ENST00000404098;ENST00000441163;ENST00000535719	T;T;T;T	0.52754	0.65;0.65;0.65;0.65	6.17	6.17	0.99709	.	0.092218	0.85682	D	0.000000	T	0.68550	0.3013	M	0.73962	2.25	0.80722	D	1	P;P;P;D	0.76494	0.858;0.607;0.89;0.999	P;B;P;D	0.68943	0.493;0.124;0.547;0.961	T	0.71961	-0.4434	10	0.87932	D	0	.	15.8048	0.78491	0.0:0.0:0.0:1.0	.	19;120;120;119	B4DRC6;Q9NQ66;Q9NQ66-2;B1AK73	.;PLCB1_HUMAN;.;.	G	120;120;120;119;40;40	ENSP00000367908:V120G;ENSP00000338185:V120G;ENSP00000367904:V120G;ENSP00000384001:V119G	ENSP00000338185:V120G	V	+	2	0	PLCB1	8557053	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	6.388000	0.73195	2.371000	0.80710	0.533000	0.62120	GTG	.		0.478	PLCB1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077938.3		
ISM1	140862	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	13269302	13269302	+	Silent	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr20:13269302G>A	ENST00000262487.4	+	4	765	c.759G>A	c.(757-759)tcG>tcA	p.S253S	TASP1_ENST00000539805.1_Intron	NM_080826.1	NP_543016.1	B1AKI9	ISM1_HUMAN	isthmin 1, angiogenesis inhibitor	253	TSP type-1. {ECO:0000255|PROSITE- ProRule:PRU00210}.					extracellular region (GO:0005576)		p.C248fs*22(1)		NS(1)|autonomic_ganglia(1)|endometrium(1)|large_intestine(8)|lung(5)|urinary_tract(1)	17						CAACAGAATCGAGGACCTGTG	0.517																																					p.S253S		.											.	ISM1-68	1	Deletion - Frameshift(1)	NS(1)	c.G759A						.						81.0	87.0	85.0					20																	13269302		2009	4189	6198	SO:0001819	synonymous_variant	140862	exon4			AGAATCGAGGACC	AL133463	CCDS46579.1	20p12.1	2013-05-15	2013-05-15	2008-12-23	ENSG00000101230	ENSG00000101230			16213	protein-coding gene	gene with protein product		615793	"""chromosome 20 open reading frame 82"", ""isthmin 1 homolog (zebrafish)"""	C20orf82			Standard	NM_080826		Approved	bA149I18.1	uc010gce.1	B1AKI9		ENST00000262487.4:c.759G>A	20.37:g.13269302G>A		Somatic	153	0		WXS	Illumina GAIIx	Phase_I	233	104	NM_080826	0	0	6	9	3	Q8WVH9	Silent	SNP	ENST00000262487.4	37	CCDS46579.1																																																																																			.		0.517	ISM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078039.2		
RRBP1	6238	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	17622479	17622479	+	Missense_Mutation	SNP	G	G	A	rs146531264		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr20:17622479G>A	ENST00000377813.1	-	5	2450	c.2147C>T	c.(2146-2148)gCg>gTg	p.A716V	RRBP1_ENST00000377807.2_Missense_Mutation_p.A283V|RRBP1_ENST00000455029.2_Missense_Mutation_p.A57V|RRBP1_ENST00000246043.4_Missense_Mutation_p.A716V|RRBP1_ENST00000360807.4_Missense_Mutation_p.A283V			Q9P2E9	RRBP1_HUMAN	ribosome binding protein 1	716					osteoblast differentiation (GO:0001649)|protein transport (GO:0015031)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|receptor activity (GO:0004872)	p.L275_V285delLLATEQEDAAV(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|prostate(6)	28						GGCGACAGCCGCATCTTCCTG	0.572													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19926	0.0		0.0	False		,,,				2504	0.0				p.A283V		.											.	RRBP1-92	1	Deletion - In frame(1)	breast(1)	c.C848T						.	G	VAL/ALA,VAL/ALA	0,4406		0,0,2203	142.0	124.0	130.0		848,848	6.1	0.2	20	dbSNP_134	130	3,8597	3.0+/-9.4	0,3,4297	yes	missense,missense	RRBP1	NM_001042576.1,NM_004587.2	64,64	0,3,6500	AA,AG,GG		0.0349,0.0,0.0231	possibly-damaging,possibly-damaging	283/978,283/978	17622479	3,13003	2203	4300	6503	SO:0001583	missense	6238	exon5			ACAGCCGCATCTT	AB037819	CCDS13128.1	20p12	2012-12-07	2012-12-07		ENSG00000125844	ENSG00000125844			10448	protein-coding gene	gene with protein product		601418	"""ribosome binding protein 1 (dog 180kD homolog)"", ""ribosome binding protein 1 homolog 180kDa (dog)"""			8812507	Standard	NM_001042576		Approved	ES/130, hES	uc002wpw.1	Q9P2E9	OTTHUMG00000031945	ENST00000377813.1:c.2147C>T	20.37:g.17622479G>A	ENSP00000367044:p.Ala716Val	Somatic	142	0		WXS	Illumina GAIIx	Phase_I	151	14	NM_004587	1	0	279	304	24	A2A2S6|A6NCN6|O75300|O75301|Q5W165|Q96SB2|Q9BWP1|Q9H476	Missense_Mutation	SNP	ENST00000377813.1	37		2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	G	16.98	3.270336	0.59540	0.0	3.49E-4	ENSG00000125844	ENST00000360807;ENST00000377813;ENST00000377807;ENST00000246043;ENST00000455029	T;T;T;T;T	0.20881	2.04;2.04;2.04;2.04;2.04	6.08	6.08	0.98989	.	0.000000	0.37348	N	0.002138	T	0.37732	0.1014	M	0.64170	1.965	0.58432	D	0.999999	D	0.58620	0.983	P	0.52957	0.714	T	0.00809	-1.1557	10	0.35671	T	0.21	-25.9779	19.6516	0.95815	0.0:0.0:1.0:0.0	.	283	Q9P2E9-3	.	V	283;716;283;716;57	ENSP00000354045:A283V;ENSP00000367044:A716V;ENSP00000367038:A283V;ENSP00000246043:A716V;ENSP00000401206:A57V	ENSP00000246043:A716V	A	-	2	0	RRBP1	17570479	1.000000	0.71417	0.245000	0.24217	0.382000	0.30200	5.124000	0.64709	2.894000	0.99253	0.655000	0.94253	GCG	G|0.999;A|0.001		0.572	RRBP1-002	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000078125.1	NM_001042576	
RBBP9	10741	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	18471080	18471080	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr20:18471080G>A	ENST00000337227.4	-	4	368	c.293C>T	c.(292-294)gCg>gTg	p.A98V	RBBP9_ENST00000493184.1_Intron	NM_006606.2	NP_006597.2	O75884	RBBP9_HUMAN	retinoblastoma binding protein 9	98					regulation of cell proliferation (GO:0042127)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleus (GO:0005634)	hydrolase activity (GO:0016787)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|prostate(1)	9						TGATGTGTACGCAGACACTAA	0.408																																					p.A98V		.											.	RBBP9-227	0			c.C293T						.						158.0	140.0	146.0					20																	18471080		2203	4300	6503	SO:0001583	missense	10741	exon4			GTGTACGCAGACA	AF039564	CCDS13136.1	20p11.2	2008-08-01	2001-11-28		ENSG00000089050	ENSG00000089050			9892	protein-coding gene	gene with protein product		602908	"""retinoblastoma-binding protein 9"""			9697699, 10449909	Standard	NM_006606		Approved	Bog	uc002wqy.3	O75884	OTTHUMG00000031972	ENST00000337227.4:c.293C>T	20.37:g.18471080G>A	ENSP00000336866:p.Ala98Val	Somatic	223	0		WXS	Illumina GAIIx	Phase_I	248	116	NM_006606	0	0	7	16	9	D3DW31|Q5JPH9|Q9H1D8	Missense_Mutation	SNP	ENST00000337227.4	37	CCDS13136.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.350862	0.82132	.	.	ENSG00000089050	ENST00000337227;ENST00000339848	.	.	.	5.26	4.32	0.51571	.	0.000000	0.64402	D	0.000001	T	0.76615	0.4012	M	0.79614	2.46	0.45676	D	0.998592	D	0.89917	1.0	D	0.72625	0.978	T	0.77032	-0.2738	9	0.41790	T	0.15	-9.6629	11.6719	0.51406	0.0851:0.0:0.9149:0.0	.	98	O75884	RBBP9_HUMAN	V	98	.	ENSP00000336866:A98V	A	-	2	0	RBBP9	18419080	1.000000	0.71417	0.983000	0.44433	0.986000	0.74619	6.413000	0.73308	1.455000	0.47813	0.655000	0.94253	GCG	.		0.408	RBBP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078175.1	NM_006606	
CST9	128822	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	23586287	23586287	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr20:23586287C>T	ENST00000376971.3	-	1	226	c.215G>A	c.(214-216)cGc>cAc	p.R72H		NM_001008693.2	NP_001008693.2	Q5W186	CST9_HUMAN	cystatin 9 (testatin)	72						extracellular region (GO:0005576)	cysteine-type endopeptidase inhibitor activity (GO:0004869)			central_nervous_system(2)|large_intestine(4)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	12	Colorectal(13;0.0993)					ACTCAGGACGCGCAACAGCCT	0.522																																					p.R72H		.											.	CST9-91	0			c.G215A						.						242.0	181.0	202.0					20																	23586287		2203	4300	6503	SO:0001583	missense	128822	exon1			AGGACGCGCAACA	AF494536	CCDS33450.1	20p11.21	2012-08-14			ENSG00000173335	ENSG00000173335			13261	protein-coding gene	gene with protein product						20565543	Standard	NM_001008693		Approved	CLM, CTES7A	uc002wtl.3	Q5W186	OTTHUMG00000032076	ENST00000376971.3:c.215G>A	20.37:g.23586287C>T	ENSP00000366170:p.Arg72His	Somatic	182	1		WXS	Illumina GAIIx	Phase_I	253	107	NM_001008693	0	0	0	0	0	B2RP76|Q8TD53	Missense_Mutation	SNP	ENST00000376971.3	37	CCDS33450.1	.	.	.	.	.	.	.	.	.	.	C	3.096	-0.185722	0.06340	.	.	ENSG00000173335	ENST00000376971	T	0.28666	1.6	2.84	-2.67	0.06059	Proteinase inhibitor I25, cystatin (1);	0.955581	0.08516	N	0.934168	T	0.13586	0.0329	N	0.05230	-0.09	0.09310	N	1	B	0.18310	0.027	B	0.16722	0.016	T	0.28870	-1.0030	10	0.34782	T	0.22	.	7.6809	0.28513	0.0:0.3501:0.0:0.6499	.	72	Q5W186	CST9_HUMAN	H	72	ENSP00000366170:R72H	ENSP00000366170:R72H	R	-	2	0	CST9	23534287	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.816000	0.04477	-0.646000	0.05452	-0.966000	0.02617	CGC	.		0.522	CST9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078341.1	NM_001008693.1	
NCOA6	23054	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	33329666	33329666	+	Missense_Mutation	SNP	G	G	A	rs373923954		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr20:33329666G>A	ENST00000374796.2	-	12	6964	c.4394C>T	c.(4393-4395)tCg>tTg	p.S1465L	NCOA6_ENST00000359003.2_Missense_Mutation_p.S1465L			Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	1465					brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-templated transcription, initiation (GO:0006352)|glucocorticoid receptor signaling pathway (GO:0042921)|heart development (GO:0007507)|intracellular estrogen receptor signaling pathway (GO:0030520)|labyrinthine layer blood vessel development (GO:0060716)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)	histone methyltransferase complex (GO:0035097)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(8)|large_intestine(16)|lung(37)|ovary(4)|prostate(5)|skin(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	107						GTTAGGATCCGAAGGCTGCCC	0.438																																					p.S1465L		.											.	NCOA6-292	0			c.C4394T						.	G	,LEU/SER	2,4404	4.2+/-10.8	0,2,2201	106.0	99.0	101.0		,4394	-8.2	0.0	20		101	0,8600		0,0,4300	no	intron,missense	NCOA6	NM_001242539.1,NM_014071.3	,145	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	,benign	,1465/2064	33329666	2,13004	2203	4300	6503	SO:0001583	missense	23054	exon11			GGATCCGAAGGCT	AF128458	CCDS13241.1, CCDS74720.1	20q11	2008-08-01			ENSG00000198646	ENSG00000198646			15936	protein-coding gene	gene with protein product	"""nuclear receptor coactivator RAP250"", ""activating signal cointegrator-2"", ""peroxisome proliferator-activated receptor interacting protein"""	605299				8724849, 8263591	Standard	NM_014071		Approved	KIAA0181, RAP250, ASC2, AIB3, PRIP, TRBP, NRC	uc002xaw.3	Q14686	OTTHUMG00000032311	ENST00000374796.2:c.4394C>T	20.37:g.33329666G>A	ENSP00000363929:p.Ser1465Leu	Somatic	175	1		WXS	Illumina GAIIx	Phase_I	212	113	NM_014071	0	0	24	49	25	A6NLF1|B2RMN5|E1P5P7|Q9NTZ9|Q9UH74|Q9UK86	Missense_Mutation	SNP	ENST00000374796.2	37	CCDS13241.1	.	.	.	.	.	.	.	.	.	.	G	0.067	-1.210694	0.01555	4.54E-4	0.0	ENSG00000198646	ENST00000374796;ENST00000359003	T;T	0.19394	2.15;2.15	5.23	-8.2	0.01045	.	0.910059	0.09333	N	0.816631	T	0.07052	0.0179	N	0.02539	-0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.45906	-0.9229	10	0.02654	T	1	8.7943	19.44	0.94815	0.8756:0.0:0.1244:0.0	.	1465	Q14686	NCOA6_HUMAN	L	1465	ENSP00000363929:S1465L;ENSP00000351894:S1465L	ENSP00000351894:S1465L	S	-	2	0	NCOA6	32793327	0.000000	0.05858	0.004000	0.12327	0.991000	0.79684	-0.885000	0.04161	-1.927000	0.01060	-0.216000	0.12614	TCG	.		0.438	NCOA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078811.2	NM_014071	
ACTR5	79913	hgsc.bcm.edu	37	20	37377139	37377139	+	Silent	SNP	C	C	T	rs2254105	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr20:37377139C>T	ENST00000243903.4	+	1	55	c.18C>T	c.(16-18)ttC>ttT	p.F6F		NM_024855.3	NP_079131.3	Q9H9F9	ARP5_HUMAN	ARP5 actin-related protein 5 homolog (yeast)	6					DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|UV-damage excision repair (GO:0070914)	cytoplasm (GO:0005737)|Ino80 complex (GO:0031011)|nucleus (GO:0005634)				kidney(2)|large_intestine(2)|liver(1)|lung(5)|skin(2)	12		Myeloproliferative disorder(115;0.00878)				CGAACGTGTTCCCGTTCCGCG	0.756													C|||	1227	0.245008	0.205	0.2334	5008	,	,		10427	0.2679		0.2565	False		,,,				2504	0.272				p.F6F		.											.	ACTR5-90	0			c.C18T						.						3.0	4.0	4.0					20																	37377139		1470	2633	4103	SO:0001819	synonymous_variant	79913	exon1			CGTGTTCCCGTTC	AK022847	CCDS13308.1	20q12	2011-07-06	2001-11-28		ENSG00000101442	ENSG00000101442		"""INO80 complex subunits"""	14671	protein-coding gene	gene with protein product	"""INO80 complex subunit M"""		"""ARP5 (actin-related protein 5, yeast) homolog"""			16230350	Standard	NM_024855		Approved	FLJ12785, Arp5, INO80M	uc002xjd.2	Q9H9F9	OTTHUMG00000032456	ENST00000243903.4:c.18C>T	20.37:g.37377139C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	24	13	NM_024855	0	0	0	1	1	Q86WF7|Q8IUY5|Q8N724|Q9BRN0|Q9BVB7	Silent	SNP	ENST00000243903.4	37	CCDS13308.1																																																																																			C|0.769;T|0.231		0.756	ACTR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079205.2	NM_024855	
ADA	100	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	43251246	43251246	+	Silent	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr20:43251246C>T	ENST00000372874.4	-	9	962	c.828G>A	c.(826-828)acG>acA	p.T276T	ADA_ENST00000464097.1_5'UTR|PKIG_ENST00000372887.1_Intron|ADA_ENST00000537820.1_Silent_p.T252T|PKIG_ENST00000372882.3_Intron	NM_000022.2	NP_000013.2	P00813	ADA_HUMAN	adenosine deaminase	276					adenosine catabolic process (GO:0006154)|aging (GO:0007568)|cell adhesion (GO:0007155)|dATP catabolic process (GO:0046061)|deoxyadenosine catabolic process (GO:0006157)|embryonic digestive tract development (GO:0048566)|germinal center B cell differentiation (GO:0002314)|histamine secretion (GO:0001821)|hypoxanthine salvage (GO:0043103)|inosine biosynthetic process (GO:0046103)|liver development (GO:0001889)|lung alveolus development (GO:0048286)|negative regulation of adenosine receptor signaling pathway (GO:0060169)|negative regulation of circadian sleep/wake cycle, non-REM sleep (GO:0042323)|negative regulation of inflammatory response (GO:0050728)|negative regulation of leukocyte migration (GO:0002686)|negative regulation of mature B cell apoptotic process (GO:0002906)|negative regulation of mucus secretion (GO:0070256)|negative regulation of penile erection (GO:0060407)|negative regulation of thymocyte apoptotic process (GO:0070244)|nucleobase-containing small molecule metabolic process (GO:0055086)|Peyer's patch development (GO:0048541)|placenta development (GO:0001890)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of germinal center formation (GO:0002636)|positive regulation of heart rate (GO:0010460)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of T cell differentiation in thymus (GO:0033089)|positive regulation of T cell receptor signaling pathway (GO:0050862)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide salvage (GO:0032261)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|purine-containing compound salvage (GO:0043101)|regulation of cell-cell adhesion mediated by integrin (GO:0033632)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to hypoxia (GO:0001666)|response to morphine (GO:0043278)|response to vitamin E (GO:0033197)|small molecule metabolic process (GO:0044281)|T cell activation (GO:0042110)|trophectodermal cell differentiation (GO:0001829)|xanthine biosynthetic process (GO:0046111)	cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite cytoplasm (GO:0032839)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|lysosome (GO:0005764)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	adenosine deaminase activity (GO:0004000)|purine nucleoside binding (GO:0001883)|zinc ion binding (GO:0008270)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|ovary(1)|pancreas(2)|prostate(3)|skin(2)|urinary_tract(1)	18		all_lung(126;1.24e-07)|Lung NSC(126;1.94e-07)|Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)		Adenosine(DB00640)|Dipyridamole(DB00975)|Edetic Acid(DB00974)|Nelarabine(DB01280)|Pentostatin(DB00552)|Theophylline(DB00277)|Vidarabine(DB00194)	CTGCATGCTCCGTGTCCGGCT	0.582									Adenosine Deaminase Deficiency																												p.T276T		.											.	ADA-653	0			c.G828A						.						59.0	56.0	57.0					20																	43251246		2203	4300	6503	SO:0001819	synonymous_variant	100	exon9	Familial Cancer Database	Severe Combined Immunodeficiency (SCID) due to ADA-deficiency	ATGCTCCGTGTCC	X02994	CCDS13335.1	20q13.12	2014-09-17			ENSG00000196839	ENSG00000196839	3.5.4.4		186	protein-coding gene	gene with protein product		608958				6198240, 6090454	Standard	NM_000022		Approved		uc002xmj.3	P00813	OTTHUMG00000033081	ENST00000372874.4:c.828G>A	20.37:g.43251246C>T		Somatic	155	0		WXS	Illumina GAIIx	Phase_I	199	84	NM_000022	0	0	5	7	2	Q53F92|Q6LA59	Silent	SNP	ENST00000372874.4	37	CCDS13335.1																																																																																			.		0.582	ADA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080509.2	NM_000022	
ZBP1	81030	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	56186832	56186832	+	Silent	SNP	G	G	A	rs370372910		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr20:56186832G>A	ENST00000371173.3	-	6	1002	c.825C>T	c.(823-825)caC>caT	p.H275H	ZBP1_ENST00000395822.3_Silent_p.H200H|ZBP1_ENST00000340462.4_Silent_p.H252H|ZBP1_ENST00000343535.4_Silent_p.H275H	NM_001160417.1|NM_030776.2	NP_001153889.1|NP_110403.2	Q9H171	ZBP1_HUMAN	Z-DNA binding protein 1	275					innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded RNA adenosine deaminase activity (GO:0003726)|left-handed Z-DNA binding (GO:0003692)|RNA binding (GO:0003723)	p.H275H(1)		large_intestine(11)|lung(8)|ovary(4)|prostate(1)|skin(2)|urinary_tract(1)	27	Lung NSC(12;0.000545)|all_lung(29;0.00195)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;7.87e-13)|Epithelial(14;3.26e-09)|all cancers(14;3.62e-08)			ACGGGACGCCGTGGAGCCTCA	0.657																																					p.H275H		.											.	ZBP1-228	1	Substitution - coding silent(1)	prostate(1)	c.C825T						.	G	,,	0,4406		0,0,2203	33.0	35.0	34.0		822,600,825	0.9	0.0	20		34	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	ZBP1	NM_001160417.1,NM_001160418.1,NM_030776.2	,,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,,	274/429,200/355,275/430	56186832	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	81030	exon6			GACGCCGTGGAGC	AJ300575	CCDS13461.1, CCDS54477.1, CCDS54478.1	20q13.31	2009-08-21	2002-07-25	2002-07-26	ENSG00000124256	ENSG00000124256			16176	protein-coding gene	gene with protein product	"""DNA-dependent activator of IRFs"""	606750	"""chromosome 20 open reading frame 183"""	C20orf183		11842111	Standard	NM_030776		Approved	dJ718J7.3, DLM1, DLM-1, DAI	uc002xyo.3	Q9H171	OTTHUMG00000032824	ENST00000371173.3:c.825C>T	20.37:g.56186832G>A		Somatic	86	0		WXS	Illumina GAIIx	Phase_I	136	26	NM_030776	0	0	0	0	0	A2A2F7|B3KVA1|F5GYT1|Q5JY39|Q9BYW4	Silent	SNP	ENST00000371173.3	37	CCDS13461.1																																																																																			.		0.657	ZBP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079849.1	NM_030776	
SLMO2	51012	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	57611597	57611597	+	Missense_Mutation	SNP	C	C	T	rs377376798		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr20:57611597C>T	ENST00000355937.4	-	5	572	c.394G>A	c.(394-396)Gtg>Atg	p.V132M	SLMO2_ENST00000371033.5_Missense_Mutation_p.V102M	NM_016045.2	NP_057129.2	Q9Y3B1	SLMO2_HUMAN	slowmo homolog 2 (Drosophila)	132	PRELI/MSF1. {ECO:0000255|PROSITE- ProRule:PRU00158}.				phospholipid transport (GO:0015914)	mitochondrial intermembrane space (GO:0005758)	phosphatidic acid transporter activity (GO:1990050)			endometrium(1)|lung(2)|skin(2)	5	all_lung(29;0.00711)		Colorectal(105;0.109)			ACTCCTTTCACGGTAATTATG	0.373																																					p.V132M		.											.	SLMO2-45	0			c.G394A						.	C	MET/VAL	0,3802		0,0,1901	125.0	112.0	116.0		394	5.1	1.0	20		116	1,8267		0,1,4133	no	missense	SLMO2	NM_016045.2	21	0,1,6034	TT,TC,CC		0.0121,0.0,0.0083	probably-damaging	132/195	57611597	1,12069	1901	4134	6035	SO:0001583	missense	51012	exon5			CTTTCACGGTAAT	AF151865	CCDS42893.1, CCDS58783.1	20q13.32	2008-10-22	2007-02-06	2007-02-06	ENSG00000101166	ENSG00000101166			15892	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 45"""	C20orf45			Standard	NM_016045		Approved	dJ543J19.5, PRELID3B	uc002yam.3	Q9Y3B1	OTTHUMG00000032856	ENST00000355937.4:c.394G>A	20.37:g.57611597C>T	ENSP00000348206:p.Val132Met	Somatic	158	0		WXS	Illumina GAIIx	Phase_I	236	105	NM_016045	0	0	28	50	22	E1P5I8|Q5JX17|Q9NUL0	Missense_Mutation	SNP	ENST00000355937.4	37	CCDS42893.1	.	.	.	.	.	.	.	.	.	.	C	26.7	4.766137	0.90020	0.0	1.21E-4	ENSG00000101166	ENST00000355937;ENST00000371033	T;T	0.21361	2.01;2.01	5.14	5.14	0.70334	PRELI/MSF1 (2);	0.000000	0.85682	D	0.000000	T	0.55970	0.1954	H	0.94183	3.505	0.80722	D	1	D;D	0.76494	0.997;0.999	P;P	0.60886	0.828;0.88	T	0.70267	-0.4919	10	0.62326	D	0.03	-6.4964	17.5833	0.87973	0.0:1.0:0.0:0.0	.	102;132	Q5JX17;Q9Y3B1	.;SLMO2_HUMAN	M	132;102	ENSP00000348206:V132M;ENSP00000360072:V102M	ENSP00000348206:V132M	V	-	1	0	SLMO2	57044992	1.000000	0.71417	0.990000	0.47175	0.975000	0.68041	7.421000	0.80204	2.389000	0.81357	0.655000	0.94253	GTG	.		0.373	SLMO2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079897.2	NM_016045	
SYCP2	10388	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	58452496	58452496	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr20:58452496C>T	ENST00000357552.3	-	33	3319	c.3094G>A	c.(3094-3096)Gaa>Aaa	p.E1032K	SYCP2_ENST00000371001.2_Missense_Mutation_p.E1032K			Q9BX26	SYCP2_HUMAN	synaptonemal complex protein 2	1032					female meiotic division (GO:0007143)|fertilization (GO:0009566)|male genitalia morphogenesis (GO:0048808)|male meiosis (GO:0007140)|negative regulation of apoptotic process (GO:0043066)|synaptonemal complex assembly (GO:0007130)	lateral element (GO:0000800)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	DNA binding (GO:0003677)			NS(4)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(14)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)			CACTCTGATTCTGAATTTGAG	0.308																																					p.E1032K		.											.	SYCP2-525	0			c.G3094A						.						54.0	56.0	55.0					20																	58452496		2201	4296	6497	SO:0001583	missense	10388	exon32			CTGATTCTGAATT	Y08982	CCDS13482.1	20q13.33	2007-07-02			ENSG00000196074	ENSG00000196074			11490	protein-coding gene	gene with protein product		604105				10341103, 9592139	Standard	NM_014258		Approved	SCP2	uc002yaz.3	Q9BX26	OTTHUMG00000032872	ENST00000357552.3:c.3094G>A	20.37:g.58452496C>T	ENSP00000350162:p.Glu1032Lys	Somatic	22	0		WXS	Illumina GAIIx	Phase_I	43	20	NM_014258	0	0	2	4	2	A2RUE5|O75763|Q5JX11|Q9NTX8|Q9UG27	Missense_Mutation	SNP	ENST00000357552.3	37	CCDS13482.1	.	.	.	.	.	.	.	.	.	.	C	27.4	4.828506	0.90955	.	.	ENSG00000196074	ENST00000371001;ENST00000357552	T;T	0.39787	1.06;1.06	5.57	5.57	0.84162	.	0.169621	0.41712	D	0.000832	T	0.62282	0.2415	M	0.66939	2.045	0.37865	D	0.929864	D	0.71674	0.998	D	0.72338	0.977	T	0.66771	-0.5839	10	0.56958	D	0.05	-13.2622	15.0506	0.71865	0.0:1.0:0.0:0.0	.	1032	Q9BX26	SYCP2_HUMAN	K	1032	ENSP00000360040:E1032K;ENSP00000350162:E1032K	ENSP00000350162:E1032K	E	-	1	0	SYCP2	57885891	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.347000	0.59373	2.636000	0.89361	0.491000	0.48974	GAA	.		0.308	SYCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079930.3	NM_014258	
CDH4	1002	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	60348149	60348149	+	Missense_Mutation	SNP	G	G	A	rs143400273	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr20:60348149G>A	ENST00000360469.5	+	4	575	c.487G>A	c.(487-489)Ggg>Agg	p.G163R	CDH4_ENST00000543233.1_Missense_Mutation_p.G89R	NM_001794.3	NP_001785.2	P55283	CADH4_HUMAN	cadherin 4, type 1, R-cadherin (retinal)	163					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(2)|lung(25)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			GAACGCCAACGGGCTGAGGCG	0.657													G|||	4	0.000798722	0.003	0.0	5008	,	,		14364	0.0		0.0	False		,,,				2504	0.0				p.G163R		.											.	CDH4-282	0			c.G487A						.	G	ARG/GLY	7,4399	11.4+/-27.6	0,7,2196	30.0	28.0	29.0		487	4.8	0.4	20	dbSNP_134	29	0,8600		0,0,4300	yes	missense	CDH4	NM_001794.2	125	0,7,6496	AA,AG,GG		0.0,0.1589,0.0538	probably-damaging	163/917	60348149	7,12999	2203	4300	6503	SO:0001583	missense	1002	exon4			GCCAACGGGCTGA	L34059	CCDS13488.1, CCDS58784.1	20q13.3	2010-01-26			ENSG00000179242	ENSG00000179242		"""Cadherins / Major cadherins"""	1763	protein-coding gene	gene with protein product	"""R-Cadherin"""	603006				10191097, 10516427	Standard	NM_001794		Approved		uc002ybn.2	P55283	OTTHUMG00000032890	ENST00000360469.5:c.487G>A	20.37:g.60348149G>A	ENSP00000353656:p.Gly163Arg	Somatic	124	0		WXS	Illumina GAIIx	Phase_I	298	145	NM_001794	0	0	5	9	4	B3KWB8|G3V1P8|Q2M208|Q5VZ44|Q9BZ05	Missense_Mutation	SNP	ENST00000360469.5	37	CCDS13488.1	3	0.0013736263736263737	3	0.006097560975609756	0	0.0	0	0.0	0	0.0	G	13.82	2.351726	0.41700	0.001589	0.0	ENSG00000179242	ENST00000360469;ENST00000536643;ENST00000543233	T;T	0.61158	0.13;0.13	4.84	4.84	0.62591	Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.49932	0.1586	N	0.08118	0	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.59815	-0.7383	9	.	.	.	.	17.9449	0.89036	0.0:0.0:1.0:0.0	.	163	P55283	CADH4_HUMAN	R	163;71;89	ENSP00000353656:G163R;ENSP00000443301:G89R	.	G	+	1	0	CDH4	59781544	1.000000	0.71417	0.363000	0.25875	0.018000	0.09664	7.080000	0.76837	2.221000	0.72209	0.655000	0.94253	GGG	G|0.999;A|0.001		0.657	CDH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079965.2	NM_001794	
LAMA5	3911	broad.mit.edu;bcgsc.ca	37	20	60891828	60891828	+	Splice_Site	SNP	G	G	A	rs571233072		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr20:60891828G>A	ENST00000252999.3	-	57	7721	c.7655C>T	c.(7654-7656)aCg>aTg	p.T2552M		NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	2552	Domain II and I.				angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			CCGCACCACCGTCTGTGGATG	0.687													.|||	1	0.000199681	0.0	0.0014	5008	,	,		18198	0.0		0.0	False		,,,				2504	0.0				p.T2552M		.											.	LAMA5-93	0			c.C7655T						.						19.0	16.0	17.0					20																	60891828		2173	4271	6444	SO:0001630	splice_region_variant	3911	exon57			ACCACCGTCTGTG	AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.7654-1C>T	20.37:g.60891828G>A		Somatic	113	1		WXS	Illumina GAIIx	Phase_I	155	8	NM_005560	0	0	1	1	0	Q8TDF8|Q8WZA7|Q9H1P1	Missense_Mutation	SNP	ENST00000252999.3	37	CCDS33502.1	.	.	.	.	.	.	.	.	.	.	g	9.679	1.148742	0.21288	.	.	ENSG00000130702	ENST00000252999	T	0.20463	2.07	3.79	-3.7	0.04437	.	0.748580	0.12809	N	0.437339	T	0.08582	0.0213	N	0.10809	0.05	0.09310	N	1	B	0.18610	0.029	B	0.06405	0.002	T	0.35325	-0.9793	10	0.21014	T	0.42	.	9.1278	0.36826	0.735:0.0:0.265:0.0	.	2552	O15230	LAMA5_HUMAN	M	2552	ENSP00000252999:T2552M	ENSP00000252999:T2552M	T	-	2	0	LAMA5	60325223	0.004000	0.15560	0.001000	0.08648	0.223000	0.24884	-0.026000	0.12392	-0.583000	0.05921	0.306000	0.20318	ACG	.		0.687	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080014.2	NM_005560	Missense_Mutation
RTEL1	51750	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	62297419	62297419	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr20:62297419G>A	ENST00000360203.5	+	7	926	c.601G>A	c.(601-603)Gga>Aga	p.G201R	RTEL1_ENST00000508582.2_Missense_Mutation_p.G225R|RTEL1_ENST00000370018.3_Missense_Mutation_p.G201R|RTEL1-TNFRSF6B_ENST00000482936.1_Missense_Mutation_p.G201R|RTEL1_ENST00000318100.4_Missense_Mutation_p.G201R					regulator of telomere elongation helicase 1											NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_cancers(38;6.47e-12)|all_epithelial(29;3.75e-13)		Epithelial(9;1.25e-09)|all cancers(9;5.13e-09)|BRCA - Breast invasive adenocarcinoma(10;7.26e-05)|OV - Ovarian serous cystadenocarcinoma(5;0.00223)|Colorectal(105;0.107)			GGTCAAGAGCGGAAGCAAGCA	0.582																																					p.G225R		.											.	RTEL1-44	0			c.G673A						.						79.0	63.0	69.0					20																	62297419		2203	4300	6503	SO:0001583	missense	51750	exon7			AAGAGCGGAAGCA	AB029011	CCDS13530.2, CCDS13531.1, CCDS13530.3, CCDS63331.1, CCDS74751.1	20q13.3	2012-06-27	2004-10-29	2004-10-29	ENSG00000258366	ENSG00000258366			15888	protein-coding gene	gene with protein product		608833	"""chromosome 20 open reading frame 41"""	C20orf41		10655513, 15210109	Standard	NM_016434		Approved	bK3184A7.3, NHL, DKFZP434C013, KIAA1088, RTEL	uc011abd.2	Q9NZ71	OTTHUMG00000032992	ENST00000360203.5:c.601G>A	20.37:g.62297419G>A	ENSP00000353332:p.Gly201Arg	Somatic	101	0		WXS	Illumina GAIIx	Phase_I	145	65	NM_032957	0	0	0	0	0		Missense_Mutation	SNP	ENST00000360203.5	37		.	.	.	.	.	.	.	.	.	.	G	26.2	4.716027	0.89205	.	.	ENSG00000258366	ENST00000370018;ENST00000318100;ENST00000508582;ENST00000360203;ENST00000356810	T;T;T;T;T	0.73681	-0.77;-0.77;-0.77;-0.77;-0.77	5.09	5.09	0.68999	DEAD2 (1);Helicase-like, DEXD box c2 type (1);Helicase, superfamily 1/2, ATP-binding domain, DinG/Rad3-type (1);	0.000000	0.85682	D	0.000000	D	0.91358	0.7274	H	0.98048	4.135	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;1.0;0.999	D	0.94323	0.7555	10	0.87932	D	0	-35.8507	15.9896	0.80193	0.0:0.0:1.0:0.0	.	225;225;201;201	Q9NZ71-7;D6RBA3;Q9NZ71;Q9NZ71-6	.;.;RTEL1_HUMAN;.	R	201;201;225;201;251	ENSP00000359035:G201R;ENSP00000322287:G201R;ENSP00000424307:G225R;ENSP00000353332:G201R;ENSP00000349265:G251R	ENSP00000349265:G251R	G	+	1	0	AL353715.1	61767863	1.000000	0.71417	0.390000	0.26220	0.974000	0.67602	7.927000	0.87577	2.518000	0.84900	0.561000	0.74099	GGA	.		0.582	RTEL1-011	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000289781.1	NM_032957	
RTEL1	51750	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	62309673	62309673	+	Silent	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr20:62309673C>T	ENST00000360203.5	+	12	1336	c.1011C>T	c.(1009-1011)gaC>gaT	p.D337D	RTEL1_ENST00000508582.2_Silent_p.D361D|RTEL1_ENST00000370018.3_Silent_p.D337D|RTEL1-TNFRSF6B_ENST00000482936.1_Silent_p.D337D|RTEL1_ENST00000318100.4_Silent_p.D337D					regulator of telomere elongation helicase 1											NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_cancers(38;6.47e-12)|all_epithelial(29;3.75e-13)		Epithelial(9;1.25e-09)|all cancers(9;5.13e-09)|BRCA - Breast invasive adenocarcinoma(10;7.26e-05)|OV - Ovarian serous cystadenocarcinoma(5;0.00223)|Colorectal(105;0.107)			TGCCTGGAGACGACAGCGGTG	0.662																																					p.D361D		.											.	RTEL1-44	0			c.C1083T						.						40.0	39.0	39.0					20																	62309673		2203	4300	6503	SO:0001819	synonymous_variant	51750	exon12			TGGAGACGACAGC	AB029011	CCDS13530.2, CCDS13531.1, CCDS13530.3, CCDS63331.1, CCDS74751.1	20q13.3	2012-06-27	2004-10-29	2004-10-29	ENSG00000258366	ENSG00000258366			15888	protein-coding gene	gene with protein product		608833	"""chromosome 20 open reading frame 41"""	C20orf41		10655513, 15210109	Standard	NM_016434		Approved	bK3184A7.3, NHL, DKFZP434C013, KIAA1088, RTEL	uc011abd.2	Q9NZ71	OTTHUMG00000032992	ENST00000360203.5:c.1011C>T	20.37:g.62309673C>T		Somatic	80	0		WXS	Illumina GAIIx	Phase_I	113	37	NM_032957	0	0	9	19	10		Silent	SNP	ENST00000360203.5	37																																																																																				.		0.662	RTEL1-011	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000289781.1	NM_032957	
GRIK1	2897	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	31062246	31062246	+	Missense_Mutation	SNP	C	C	T	rs142436130		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr21:31062246C>T	ENST00000399907.1	-	3	757	c.346G>A	c.(346-348)Gtc>Atc	p.V116I	GRIK1_ENST00000389125.3_Missense_Mutation_p.V116I|GRIK1_ENST00000309434.7_Missense_Mutation_p.V116I|GRIK1_ENST00000399913.1_Missense_Mutation_p.V116I|GRIK1_ENST00000389124.2_Missense_Mutation_p.V116I|GRIK1_ENST00000327783.4_Missense_Mutation_p.V116I|GRIK1_ENST00000535441.1_Missense_Mutation_p.V116I|GRIK1_ENST00000472429.1_5'UTR|GRIK1_ENST00000399914.1_Missense_Mutation_p.V116I|GRIK1_ENST00000399909.1_Missense_Mutation_p.V116I	NM_000830.3	NP_000821.1	P39086	GRIK1_HUMAN	glutamate receptor, ionotropic, kainate 1	116					adult behavior (GO:0030534)|behavioral response to pain (GO:0048266)|central nervous system development (GO:0007417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|nervous system development (GO:0007399)|positive regulation of gamma-aminobutyric acid secretion (GO:0014054)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(18)|ovary(1)|prostate(4)|skin(1)|stomach(1)|urinary_tract(1)	45					Topiramate(DB00273)	ACAGCACTGACGGAGGAGCTA	0.537																																					p.V116I		.											.	GRIK1-137	0			c.G346A						.	C	ILE/VAL,ILE/VAL	0,4406		0,0,2203	94.0	87.0	89.0		346,346	5.2	1.0	21	dbSNP_134	89	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense	GRIK1	NM_000830.3,NM_175611.2	29,29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging	116/919,116/906	31062246	1,13005	2203	4300	6503	SO:0001583	missense	2897	exon3			CACTGACGGAGGA		CCDS33530.1, CCDS42913.1	21q22	2012-08-29			ENSG00000171189	ENSG00000171189		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4579	protein-coding gene	gene with protein product		138245		GLUR5		8468067	Standard	XM_005260942		Approved	GluK1	uc002yno.1	P39086	OTTHUMG00000078879	ENST00000399907.1:c.346G>A	21.37:g.31062246C>T	ENSP00000382791:p.Val116Ile	Somatic	163	0		WXS	Illumina GAIIx	Phase_I	114	14	NM_175611	0	0	0	0	0	Q13001|Q86SU9	Missense_Mutation	SNP	ENST00000399907.1	37	CCDS42913.1	.	.	.	.	.	.	.	.	.	.	C	26.7	4.762681	0.89932	0.0	1.16E-4	ENSG00000171189	ENST00000327783;ENST00000389125;ENST00000399913;ENST00000399914;ENST00000535441;ENST00000541508;ENST00000389124;ENST00000399907;ENST00000399909;ENST00000309434	D;D;D;D;D;D;D;D;D	0.83075	-1.68;-1.68;-1.68;-1.68;-1.68;-1.68;-1.68;-1.68;-1.68	5.17	5.17	0.71159	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	T	0.79741	0.4498	L	0.36672	1.1	0.80722	D	1	P;P;P;P;P	0.45957	0.761;0.869;0.869;0.869;0.842	B;B;B;B;B	0.42959	0.403;0.403;0.403;0.403;0.281	T	0.82084	-0.0632	10	0.56958	D	0.05	.	18.468	0.90762	0.0:1.0:0.0:0.0	.	116;116;116;116;116	E7EPY9;E9PD61;B7Z3V7;P39086;P39086-2	.;.;.;GRIK1_HUMAN;.	I	116;116;116;116;116;60;116;116;116;116	ENSP00000327687:V116I;ENSP00000373777:V116I;ENSP00000382797:V116I;ENSP00000382798:V116I;ENSP00000446326:V116I;ENSP00000373776:V116I;ENSP00000382791:V116I;ENSP00000382793:V116I;ENSP00000311646:V116I	ENSP00000311646:V116I	V	-	1	0	GRIK1	29984117	1.000000	0.71417	0.980000	0.43619	0.989000	0.77384	5.553000	0.67287	2.671000	0.90904	0.655000	0.94253	GTC	C|1.000;T|0.000		0.537	GRIK1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000171979.1		
RRP1B	23076	ucsc.edu;bcgsc.ca	37	21	45107797	45107797	+	Silent	SNP	G	G	A	rs143773984		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr21:45107797G>A	ENST00000340648.4	+	13	1659	c.1542G>A	c.(1540-1542)ccG>ccA	p.P514P		NM_015056.2	NP_055871.1	Q14684	RRP1B_HUMAN	ribosomal RNA processing 1B	514					negative regulation of phosphatase activity (GO:0010923)|rRNA processing (GO:0006364)	cytosol (GO:0005829)|euchromatin (GO:0000791)|heterochromatin (GO:0000792)|nucleolus (GO:0005730)|nucleus (GO:0005634)|preribosome, small subunit precursor (GO:0030688)	poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(3)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(1)	21				STAD - Stomach adenocarcinoma(101;0.178)		GAGGGTCCCCGACAGGTGGAG	0.607													G|||	1	0.000199681	0.0008	0.0	5008	,	,		15780	0.0		0.0	False		,,,				2504	0.0				p.P514P		.											.	RRP1B-91	0			c.G1542A						.	G		4,4396		0,4,2196	42.0	42.0	42.0		1542	-9.9	0.0	21	dbSNP_134	42	0,8594		0,0,4297	no	coding-synonymous	RRP1B	NM_015056.2		0,4,6493	AA,AG,GG		0.0,0.0909,0.0308		514/759	45107797	4,12990	2200	4297	6497	SO:0001819	synonymous_variant	23076	exon13			GTCCCCGACAGGT	AK124620	CCDS33577.1	21q22.3	2014-06-13	2013-07-02	2007-03-26	ENSG00000160208	ENSG00000160208			23818	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 136"""	610654	"""KIAA0179"", ""ribosomal RNA processing 1 homolog B (S. cerevisiae)"""	KIAA0179			Standard	NM_015056		Approved	Nnp1, RRP1, PPP1R136	uc002zdk.3	Q14684	OTTHUMG00000086872	ENST00000340648.4:c.1542G>A	21.37:g.45107797G>A		Somatic	175	2		WXS	Illumina GAIIx	Phase_I	105	94	NM_015056	0	0	0	7	7	Q8TBZ4	Silent	SNP	ENST00000340648.4	37	CCDS33577.1																																																																																			G|1.000;A|0.000		0.607	RRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195651.1	NM_015056	
COL6A2	1292	broad.mit.edu;bcgsc.ca	37	21	47539706	47539706	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr21:47539706G>A	ENST00000300527.4	+	15	1378	c.1274G>A	c.(1273-1275)cGc>cAc	p.R425H	COL6A2_ENST00000357838.4_Missense_Mutation_p.R425H|COL6A2_ENST00000310645.5_Missense_Mutation_p.R425H|COL6A2_ENST00000409416.1_Missense_Mutation_p.R425H|COL6A2_ENST00000397763.1_Missense_Mutation_p.R425H	NM_001849.3	NP_001840.3	P12110	CO6A2_HUMAN	collagen, type VI, alpha 2	425	Triple-helical region.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|protein heterotrimerization (GO:0070208)|response to glucose (GO:0009749)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)				NS(1)|breast(1)|central_nervous_system(7)|endometrium(7)|kidney(5)|liver(1)|lung(15)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	43	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		CTGCAGGGGCGCAGGGGAGAC	0.692																																					p.R425H		.											.	COL6A2-515	0			c.G1274A						.						17.0	19.0	18.0					21																	47539706		2147	4233	6380	SO:0001583	missense	1292	exon15			AGGGGCGCAGGGG	M20777	CCDS13728.1, CCDS13729.1, CCDS13730.1	21q22.3	2014-09-17			ENSG00000142173	ENSG00000142173		"""Collagens"""	2212	protein-coding gene	gene with protein product		120240					Standard	NM_001849		Approved		uc002zia.1	P12110	OTTHUMG00000090489	ENST00000300527.4:c.1274G>A	21.37:g.47539706G>A	ENSP00000300527:p.Arg425His	Somatic	167	0		WXS	Illumina GAIIx	Phase_I	121	6	NM_058175	0	0	0	0	0	Q13909|Q13910|Q13911|Q14048|Q14049|Q16259|Q16597|Q6P0Q1|Q9UML3|Q9Y4S8	Missense_Mutation	SNP	ENST00000300527.4	37	CCDS13728.1	.	.	.	.	.	.	.	.	.	.	G	17.13	3.310984	0.60414	.	.	ENSG00000142173	ENST00000300527;ENST00000357838;ENST00000310645;ENST00000409416;ENST00000397763	D;D;D;D;D	0.94232	-3.38;-3.38;-3.38;-3.38;-3.38	4.86	4.86	0.63082	.	0.000000	0.85682	D	0.000000	D	0.94039	0.8090	L	0.31926	0.97	0.53005	D	0.999968	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.71870	0.969;0.975;0.948	D	0.93981	0.7258	10	0.45353	T	0.12	-23.3445	15.1594	0.72771	0.0:0.0:1.0:0.0	.	425;425;425	P12110;P12110-2;P12110-3	CO6A2_HUMAN;.;.	H	425	ENSP00000300527:R425H;ENSP00000350497:R425H;ENSP00000312529:R425H;ENSP00000387115:R425H;ENSP00000380870:R425H	ENSP00000300527:R425H	R	+	2	0	COL6A2	46364134	0.985000	0.35326	1.000000	0.80357	0.969000	0.65631	4.237000	0.58681	2.239000	0.73571	0.591000	0.81541	CGC	.		0.692	COL6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206971.1		
PCNT	5116	broad.mit.edu	37	21	47831434	47831434	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr21:47831434C>A	ENST00000359568.5	+	28	5554	c.5447C>A	c.(5446-5448)gCc>gAc	p.A1816D	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	1816					brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)				NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					CACAGCCAGGCCCTGGAGGCC	0.706																																					p.A1816D		.											.	PCNT-141	0			c.C5447A						.						8.0	11.0	10.0					21																	47831434		2125	4213	6338	SO:0001583	missense	5116	exon28			GCCAGGCCCTGGA	AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.5447C>A	21.37:g.47831434C>A	ENSP00000352572:p.Ala1816Asp	Somatic	20	1		WXS	Illumina GAIIx	Phase_I	35	9	NM_006031	0	0	3	4	1	O43152|Q7Z7C9	Missense_Mutation	SNP	ENST00000359568.5	37	CCDS33592.1	.	.	.	.	.	.	.	.	.	.	C	18.21	3.574208	0.65878	.	.	ENSG00000160299	ENST00000359568	T	0.01572	4.76	5.79	3.8	0.43715	.	0.000000	0.32190	N	0.006460	T	0.04272	0.0118	L	0.34521	1.04	0.09310	N	0.999999	D;D	0.76494	0.999;0.999	D;D	0.69479	0.964;0.922	T	0.51156	-0.8741	10	0.18710	T	0.47	.	12.1547	0.54070	0.2978:0.7022:0.0:0.0	.	1698;1816	O95613-2;O95613	.;PCNT_HUMAN	D	1816	ENSP00000352572:A1816D	ENSP00000352572:A1816D	A	+	2	0	PCNT	46655862	0.477000	0.25909	1.000000	0.80357	0.855000	0.48748	0.786000	0.26844	2.739000	0.93911	0.563000	0.77884	GCC	.		0.706	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207336.1	NM_006031	
TUBA8	51807	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	18609364	18609364	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr22:18609364G>A	ENST00000330423.3	+	4	692	c.619G>A	c.(619-621)Gaa>Aaa	p.E207K	TUBA8_ENST00000316027.6_Missense_Mutation_p.E141K	NM_018943.2	NP_061816.1	Q9NY65	TBA8_HUMAN	tubulin, alpha 8	207					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)	14						GGTGGACAACGAAGCCATCTA	0.532																																					p.E207K		.											.	TUBA8-90	0			c.G619A						.						175.0	152.0	160.0					22																	18609364		2203	4300	6503	SO:0001583	missense	51807	exon4			GACAACGAAGCCA	AJ245922	CCDS13751.1, CCDS54495.1	22q11	2005-06-11			ENSG00000183785	ENSG00000183785		"""Tubulins"""	12410	protein-coding gene	gene with protein product		605742		TUBAL2		10772959, 10591208	Standard	NM_001193414		Approved		uc002znv.2	Q9NY65	OTTHUMG00000150097	ENST00000330423.3:c.619G>A	22.37:g.18609364G>A	ENSP00000333326:p.Glu207Lys	Somatic	281	0		WXS	Illumina GAIIx	Phase_I	144	123	NM_018943	0	0	0	2	2	B2RCX2|B3KPW9|B4DWG3|Q2M3N4	Missense_Mutation	SNP	ENST00000330423.3	37	CCDS13751.1	.	.	.	.	.	.	.	.	.	.	.	21.5	4.162025	0.78226	.	.	ENSG00000183785	ENST00000316027;ENST00000330423;ENST00000416740	T;T;T	0.70631	-0.5;-0.5;-0.5	5.67	5.67	0.87782	Tubulin/FtsZ, GTPase domain (4);	0.049921	0.85682	D	0.000000	D	0.88976	0.6584	H	0.95187	3.635	0.80722	D	1	P;D;D	0.89917	0.911;0.995;1.0	B;P;D	0.67900	0.256;0.684;0.954	D	0.91554	0.5259	10	0.87932	D	0	.	19.1191	0.93355	0.0:0.0:1.0:0.0	.	141;231;207	B3KPW9;C9J2C0;Q9NY65	.;.;TBA8_HUMAN	K	141;207;231	ENSP00000318575:E141K;ENSP00000333326:E207K;ENSP00000412646:E231K	ENSP00000318575:E141K	E	+	1	0	TUBA8	16989364	1.000000	0.71417	0.769000	0.31535	0.989000	0.77384	9.869000	0.99810	2.837000	0.97791	0.655000	0.94253	GAA	.		0.532	TUBA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316232.3	NM_018943	
DGCR8	54487	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	20073745	20073745	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr22:20073745A>G	ENST00000351989.3	+	2	688	c.259A>G	c.(259-261)Ata>Gta	p.I87V	DGCR8_ENST00000407755.1_Missense_Mutation_p.I87V|DGCR8_ENST00000383024.2_Missense_Mutation_p.I87V|MIR3618_ENST00000580330.1_RNA|MIR1306_ENST00000408439.1_RNA	NM_022720.6	NP_073557.3	Q8WYQ5	DGCR8_HUMAN	DGCR8 microprocessor complex subunit	87	Necessary for interaction with NCL.|Necessary for nuclear localization and retention.				gene expression (GO:0010467)|primary miRNA processing (GO:0031053)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)			NS(2)|breast(1)|endometrium(5)|large_intestine(5)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	22	Colorectal(54;0.0993)					CCGCCTCCTCATAGACCCGAA	0.572																																					p.I87V		.											.	DGCR8-90	0			c.A259G						.						54.0	58.0	57.0					22																	20073745		2203	4300	6503	SO:0001583	missense	54487	exon2			CTCCTCATAGACC	AF165527, AB050770	CCDS13773.1, CCDS54501.1	22q11.2	2013-05-02	2013-05-02		ENSG00000128191	ENSG00000128191			2847	protein-coding gene	gene with protein product		609030	"""chromosome 22 open reading frame 12"", ""DiGeorge syndrome critical region gene 8"""	C22orf12		21454614	Standard	NM_001190326		Approved	DGCRK6, Gy1, pasha	uc002zri.3	Q8WYQ5	OTTHUMG00000150503	ENST00000351989.3:c.259A>G	22.37:g.20073745A>G	ENSP00000263209:p.Ile87Val	Somatic	111	0		WXS	Illumina GAIIx	Phase_I	84	12	NM_001190326	0	0	3	3	0	B2R8G1|Q6DCB2|Q6MZE9|Q6Y2L0|Q96G39|Q96GP8|Q9H6L8|Q9H6T7|Q9NRW2	Missense_Mutation	SNP	ENST00000351989.3	37	CCDS13773.1	.	.	.	.	.	.	.	.	.	.	A	10.76	1.441510	0.25900	.	.	ENSG00000128191	ENST00000351989;ENST00000383024;ENST00000457069;ENST00000407755	T;T;T	0.30448	1.54;1.53;1.53	5.42	4.39	0.52855	.	0.230615	0.51477	N	0.000091	T	0.17323	0.0416	N	0.19112	0.55	0.31193	N	0.700677	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.0	T	0.10337	-1.0634	10	0.30854	T	0.27	-7.2701	6.3156	0.21188	0.7572:0.1595:0.0832:0.0	.	87;87	Q8WYQ5-3;Q8WYQ5	.;DGCR8_HUMAN	V	87	ENSP00000263209:I87V;ENSP00000372488:I87V;ENSP00000384726:I87V	ENSP00000263209:I87V	I	+	1	0	DGCR8	18453745	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.046000	0.30354	1.097000	0.41459	0.402000	0.26972	ATA	.		0.572	DGCR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318654.1		
PIWIL3	440822	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	25150089	25150089	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr22:25150089C>T	ENST00000332271.5	-	8	1285	c.869G>A	c.(868-870)cGa>cAa	p.R290Q	PIWIL3_ENST00000532537.2_5'UTR|PIWIL3_ENST00000533313.1_Missense_Mutation_p.R181Q|PIWIL3_ENST00000527701.1_Missense_Mutation_p.R181Q	NM_001008496.3|NM_001255975.1	NP_001008496.2|NP_001242904.1	Q7Z3Z3	PIWL3_HUMAN	piwi-like RNA-mediated gene silencing 3	290	PAZ. {ECO:0000255|PROSITE- ProRule:PRU00142}.				cell differentiation (GO:0030154)|gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)	RNA binding (GO:0003723)	p.R290P(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(14)|lung(15)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	50						AGTTTCTATTCGGAGCAGTTT	0.403																																					p.R290Q		.											.	PIWIL3-93	1	Substitution - Missense(1)	ovary(1)	c.G869A						.						124.0	122.0	123.0					22																	25150089		2203	4300	6503	SO:0001583	missense	440822	exon8			TCTATTCGGAGCA	AB079368	CCDS33623.1	22q11.23	2013-02-15	2013-02-15		ENSG00000184571	ENSG00000184571		"""Argonaute/PIWI family"""	18443	protein-coding gene	gene with protein product		610314	"""piwi-like 3 (Drosophila)"""			12906857	Standard	NM_001008496		Approved	HIWI3	uc003abd.2	Q7Z3Z3	OTTHUMG00000150788	ENST00000332271.5:c.869G>A	22.37:g.25150089C>T	ENSP00000330031:p.Arg290Gln	Somatic	114	1		WXS	Illumina GAIIx	Phase_I	104	96	NM_001008496	0	0	0	0	0		Missense_Mutation	SNP	ENST00000332271.5	37	CCDS33623.1	.	.	.	.	.	.	.	.	.	.	C	11.57	1.677197	0.29783	.	.	ENSG00000184571	ENST00000332271;ENST00000533313;ENST00000527701	T;T;T	0.15487	2.42;2.42;2.42	2.42	0.293	0.15742	Argonaute/Dicer protein, PAZ (1);	0.000000	0.64402	U	0.000001	T	0.39200	0.1069	M	0.87180	2.865	0.20403	N	0.999903	D;D;D	0.89917	1.0;0.994;0.999	D;P;P	0.91635	0.999;0.821;0.883	T	0.11108	-1.0601	10	0.72032	D	0.01	-3.4131	6.187	0.20503	0.0:0.7142:0.0:0.2858	.	181;290;290	E9PIP6;B4DYF7;Q7Z3Z3	.;.;PIWL3_HUMAN	Q	290;181;181	ENSP00000330031:R290Q;ENSP00000431843:R181Q;ENSP00000435718:R181Q	ENSP00000330031:R290Q	R	-	2	0	PIWIL3	23480089	0.910000	0.30920	0.009000	0.14445	0.073000	0.16967	1.356000	0.34079	0.138000	0.18790	0.462000	0.41574	CGA	.		0.403	PIWIL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320084.2	NM_001008496	
SFI1	9814	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	31971289	31971289	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr22:31971289G>A	ENST00000400288.2	+	10	1100	c.995G>A	c.(994-996)cGg>cAg	p.R332Q	SFI1_ENST00000432498.1_Missense_Mutation_p.R332Q|SFI1_ENST00000400289.1_Missense_Mutation_p.R250Q|SFI1_ENST00000443011.1_Missense_Mutation_p.R179Q|SFI1_ENST00000414585.1_Missense_Mutation_p.R179Q|SFI1_ENST00000443326.1_Missense_Mutation_p.R250Q|SFI1_ENST00000540643.1_Missense_Mutation_p.R308Q	NM_001007467.2	NP_001007468.1	A8K8P3	SFI1_HUMAN	Sfi1 homolog, spindle assembly associated (yeast)	332					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)			NS(2)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(3)|upper_aerodigestive_tract(3)	38						GCCTGGGAGCGGAGGGAGAGC	0.532																																					p.R332Q		.											.	SFI1-90	0			c.G995A						.						60.0	67.0	65.0					22																	31971289		2024	4188	6212	SO:0001583	missense	9814	exon10			GGGAGCGGAGGGA	AB011114	CCDS43004.1, CCDS43005.1, CCDS58803.1, CCDS58804.1	22q12.2	2014-06-13			ENSG00000198089	ENSG00000198089			29064	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 139"""	612765				14504268	Standard	NM_001007467		Approved	KIAA0542, PISD, PPP1R139	uc003ale.4	A8K8P3	OTTHUMG00000030249	ENST00000400288.2:c.995G>A	22.37:g.31971289G>A	ENSP00000383145:p.Arg332Gln	Somatic	136	0		WXS	Illumina GAIIx	Phase_I	119	28	NM_001007467	0	0	2	2	0	A1L373|A1L387|A2A2L2|B1AKL9|B5MDB7|B7Z1V6|B7Z8G3|B7ZBE2|B7ZBE3|O60289|Q2TAN8|Q5W1B5|Q86TK0|Q8N4U8|Q8N8C1|Q8WU14	Missense_Mutation	SNP	ENST00000400288.2	37	CCDS43004.1	.	.	.	.	.	.	.	.	.	.	G	3.209	-0.161975	0.06502	.	.	ENSG00000198089	ENST00000432498;ENST00000540643;ENST00000443326;ENST00000421060;ENST00000414585;ENST00000443011;ENST00000400289;ENST00000400288	T;T;T;T;T;T;T	0.10099	3.08;3.06;2.93;2.92;2.91;2.93;3.13	5.49	-3.85	0.04243	.	1.571600	0.02984	N	0.146079	T	0.05823	0.0152	N	0.08118	0	0.09310	N	1	B;B;B;B;B;B	0.30021	0.002;0.002;0.001;0.003;0.003;0.265	B;B;B;B;B;B	0.26864	0.004;0.007;0.005;0.004;0.003;0.074	T	0.32640	-0.9899	10	0.20046	T	0.44	.	11.6008	0.51001	0.5934:0.0:0.4066:0.0	.	308;250;250;332;332;308	A8K8P3-9;A8K8P3-10;A8K8P3-3;A8K8P3-2;A8K8P3;A8K8P3-5	.;.;.;.;SFI1_HUMAN;.	Q	332;308;250;308;179;179;250;332	ENSP00000402679:R332Q;ENSP00000443025:R308Q;ENSP00000416469:R250Q;ENSP00000397148:R179Q;ENSP00000401199:R179Q;ENSP00000383146:R250Q;ENSP00000383145:R332Q	ENSP00000383145:R332Q	R	+	2	0	SFI1	30301289	0.082000	0.21442	0.001000	0.08648	0.008000	0.06430	-0.302000	0.08221	-0.741000	0.04797	-2.048000	0.00412	CGG	.		0.532	SFI1-023	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337180.3	NM_014775	
TRIOBP	11078	broad.mit.edu	37	22	38121765	38121765	+	Nonsense_Mutation	SNP	C	C	T	rs118204030		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr22:38121765C>T	ENST00000406386.3	+	7	3457	c.3202C>T	c.(3202-3204)Cga>Tga	p.R1068*		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	1068					actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					CATTGGACACCGAGATGCCCC	0.652																																					p.R1068X		.											.	TRIOBP-136	0			c.C3202T	GRCh37	CD060673|CM067725	TRIOBP	D|M	rs118204030	.						54.0	59.0	57.0					22																	38121765		1874	4082	5956	SO:0001587	stop_gained	11078	exon7			GGACACCGAGATG	AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.3202C>T	22.37:g.38121765C>T	ENSP00000384312:p.Arg1068*	Somatic	49	1		WXS	Illumina GAIIx	Phase_I	43	8	NM_001039141	0	0	0	0	0	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Nonsense_Mutation	SNP	ENST00000406386.3	37	CCDS43015.1	.	.	.	.	.	.	.	.	.	.	C	39	7.805609	0.98498	.	.	ENSG00000100106	ENST00000406386;ENST00000417174	.	.	.	4.67	3.63	0.41609	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.0314	0.42103	0.2013:0.7987:0.0:0.0	.	.	.	.	X	1068	.	ENSP00000384312:R1068X	R	+	1	2	TRIOBP	36451711	1.000000	0.71417	0.994000	0.49952	0.448000	0.32197	2.267000	0.43329	1.173000	0.42796	-0.556000	0.04195	CGA	.		0.652	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319439.2		
PPP6R2	9701	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	50845169	50845169	+	Silent	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr22:50845169C>T	ENST00000216061.5	+	5	649	c.279C>T	c.(277-279)agC>agT	p.S93S	PPP6R2_ENST00000395744.3_Silent_p.S93S|PPP6R2_ENST00000359139.3_Silent_p.S93S|PPP6R2_ENST00000395741.3_Silent_p.S93S			O75170	PP6R2_HUMAN	protein phosphatase 6, regulatory subunit 2	93						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)				NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|liver(1)|lung(6)|ovary(2)|skin(1)|urinary_tract(1)	22						CGCAGATCAGCGACCGCCTCG	0.537																																					p.S93S		.											.	PPP6R2-92	0			c.C279T						.						173.0	167.0	169.0					22																	50845169		2203	4300	6503	SO:0001819	synonymous_variant	9701	exon4			GATCAGCGACCGC	AB014585	CCDS33681.1, CCDS56235.1, CCDS56236.1, CCDS74881.1	22q13.33	2012-04-17	2010-06-28	2010-06-28	ENSG00000100239	ENSG00000100239		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	19253	protein-coding gene	gene with protein product		610877	"""KIAA0685"", ""SAPS domain family, member 2"""	KIAA0685, SAPS2		16769727	Standard	NM_014678		Approved	dJ579N16.1, SAP190	uc003blc.3	O75170	OTTHUMG00000150199	ENST00000216061.5:c.279C>T	22.37:g.50845169C>T		Somatic	92	0		WXS	Illumina GAIIx	Phase_I	48	18	NM_001242898	0	0	10	17	7	A6PVG3|B7Z7T3|Q5U5P3|Q7Z2L2|Q7Z5G5|Q7Z731|Q9UGB9	Silent	SNP	ENST00000216061.5	37																																																																																				.		0.537	PPP6R2-004	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000316809.1	NM_014678	
CNTN6	27255	broad.mit.edu	37	3	1415404	1415404	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr3:1415404A>G	ENST00000446702.2	+	15	2530	c.1903A>G	c.(1903-1905)Act>Gct	p.T635A	CNTN6_ENST00000539053.1_Missense_Mutation_p.T563A|CNTN6_ENST00000350110.2_Missense_Mutation_p.T635A			Q9UQ52	CNTN6_HUMAN	contactin 6	635	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|Notch signaling pathway (GO:0007219)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(34)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		TACTATTCAGACTCGGACACC	0.388																																					p.T635A		.											.	CNTN6-345	0			c.A1903G						.						73.0	76.0	75.0					3																	1415404		2203	4300	6503	SO:0001583	missense	27255	exon15			ATTCAGACTCGGA	AB003592	CCDS2557.1	3p26-p25	2013-02-11			ENSG00000134115	ENSG00000134115		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	2176	protein-coding gene	gene with protein product	"""neural adhesion molecule"""	607220				9486763	Standard	NM_014461		Approved	NB-3	uc003bpa.3	Q9UQ52	OTTHUMG00000119030	ENST00000446702.2:c.1903A>G	3.37:g.1415404A>G	ENSP00000407822:p.Thr635Ala	Somatic	244	0		WXS	Illumina GAIIx	Phase_I	201	5	NM_014461	0	0	0	0	0	Q2KHM2	Missense_Mutation	SNP	ENST00000446702.2	37	CCDS2557.1	.	.	.	.	.	.	.	.	.	.	A	2.181	-0.387610	0.04932	.	.	ENSG00000134115	ENST00000446702;ENST00000539053;ENST00000350110	T;T;T	0.56444	0.46;0.46;0.46	4.77	2.52	0.30459	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.236189	0.29342	N	0.012428	T	0.18425	0.0442	N	0.01235	-0.94	0.33736	D	0.618852	B	0.06786	0.001	B	0.08055	0.003	T	0.13899	-1.0492	10	0.12103	T	0.63	.	6.1226	0.20161	0.6358:0.0:0.3642:0.0	.	635	Q9UQ52	CNTN6_HUMAN	A	635;563;635	ENSP00000407822:T635A;ENSP00000442791:T563A;ENSP00000341882:T635A	ENSP00000341882:T635A	T	+	1	0	CNTN6	1390404	1.000000	0.71417	0.774000	0.31636	0.980000	0.70556	3.921000	0.56454	0.343000	0.23821	0.482000	0.46254	ACT	.		0.388	CNTN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239235.2	NM_014461	
NUP210	23225	bcgsc.ca	37	3	13368892	13368892	+	Silent	SNP	G	G	A	rs2271509	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr3:13368892G>A	ENST00000254508.5	-	32	4414	c.4332C>T	c.(4330-4332)tgC>tgT	p.C1444C		NM_024923.2	NP_079199.2	Q8TEM1	PO210_HUMAN	nucleoporin 210kDa	1444					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|liver(1)|lung(16)|ovary(7)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	66	all_neural(104;0.187)					TGCGGACAACGCAGGTGTTGT	0.612													G|||	1985	0.396366	0.4592	0.3775	5008	,	,		19707	0.3016		0.4891	False		,,,				2504	0.3272				p.C1444C		.											.	NUP210-256	0			c.C4332T						.	G		2074,2332	564.7+/-381.5	474,1126,603	53.0	41.0	45.0		4332	1.7	0.1	3	dbSNP_100	45	4402,4198	577.9+/-390.6	1134,2134,1032	no	coding-synonymous	NUP210	NM_024923.2		1608,3260,1635	AA,AG,GG		48.814,47.0722,49.7924		1444/1888	13368892	6476,6530	2203	4300	6503	SO:0001819	synonymous_variant	23225	exon32			GACAACGCAGGTG	AB020713	CCDS33704.1	3p25	2008-02-05			ENSG00000132182	ENSG00000132182			30052	protein-coding gene	gene with protein product		607703				2184032, 7504063	Standard	NM_024923		Approved	GP210, POM210, FLJ22389, KIAA0906	uc003bxv.1	Q8TEM1	OTTHUMG00000157268	ENST00000254508.5:c.4332C>T	3.37:g.13368892G>A		Somatic	265	2		WXS	Illumina GAIIx	Phase_I	209	7	NM_024923	0	0	9	9	0	A6NN56|O94980|Q6NXG6|Q8NBJ1|Q9H6C8|Q9UFP3	Silent	SNP	ENST00000254508.5	37	CCDS33704.1																																																																																			G|0.541;A|0.459		0.612	NUP210-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340085.1	NM_024923	
C3orf20	84077	ucsc.edu;bcgsc.ca	37	3	14724408	14724408	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr3:14724408C>T	ENST00000253697.3	+	3	640	c.188C>T	c.(187-189)cCg>cTg	p.P63L	C3orf20_ENST00000412910.1_Intron|C3orf20_ENST00000435614.1_Intron	NM_032137.4	NP_115513.4	Q8ND61	CC020_HUMAN	chromosome 3 open reading frame 20	63						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(13)|lung(11)|ovary(4)|skin(2)	40						GTGCCTACCCCGTCCGACATC	0.537																																					p.P63L		.											.	C3orf20-94	0			c.C188T						.						118.0	117.0	118.0					3																	14724408		2203	4300	6503	SO:0001583	missense	84077	exon3			CTACCCCGTCCGA	AL136781	CCDS33706.1, CCDS54555.1	3p25.1	2011-01-25			ENSG00000131379	ENSG00000131379			25320	protein-coding gene	gene with protein product						11230166	Standard	NM_032137		Approved	DKFZP434N1817	uc003byy.3	Q8ND61	OTTHUMG00000155545	ENST00000253697.3:c.188C>T	3.37:g.14724408C>T	ENSP00000253697:p.Pro63Leu	Somatic	187	2		WXS	Illumina GAIIx	Phase_I	130	124	NM_032137	0	0	0	0	0	Q7L0U6|Q8NCP2|Q9H0I7	Missense_Mutation	SNP	ENST00000253697.3	37	CCDS33706.1	.	.	.	.	.	.	.	.	.	.	C	13.90	2.375355	0.42105	.	.	ENSG00000131379	ENST00000253697	T	0.06933	3.24	5.28	4.38	0.52667	.	1.053900	0.07482	N	0.904118	T	0.07773	0.0195	L	0.29908	0.895	0.18873	N	0.999989	D	0.54397	0.966	B	0.40534	0.332	T	0.33137	-0.9880	10	0.72032	D	0.01	-4.8664	7.3407	0.26635	0.0:0.738:0.1722:0.0898	.	63	Q8ND61	CC020_HUMAN	L	63	ENSP00000253697:P63L	ENSP00000253697:P63L	P	+	2	0	C3orf20	14699412	0.001000	0.12720	0.004000	0.12327	0.027000	0.11550	1.068000	0.30629	1.183000	0.42943	0.591000	0.81541	CCG	.		0.537	C3orf20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340586.1	NM_032137	
SUSD5	26032	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	33216542	33216542	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr3:33216542G>A	ENST00000309558.3	-	4	851	c.434C>T	c.(433-435)tCg>tTg	p.S145L		NM_015551.1	NP_056366.1	O60279	SUSD5_HUMAN	sushi domain containing 5	145	Sushi. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	hyaluronic acid binding (GO:0005540)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24						GTGTGGGAACGAAGGCGGGTC	0.547																																					p.S145L		.											.	SUSD5-24	0			c.C434T						.						60.0	66.0	64.0					3																	33216542		1998	4161	6159	SO:0001583	missense	26032	exon4			GGGAACGAAGGCG	AB011099	CCDS46787.1	3p23	2014-02-12	2006-01-13		ENSG00000173705	ENSG00000173705			29061	protein-coding gene	gene with protein product							Standard	NM_015551		Approved	KIAA0527	uc003cfo.1	O60279	OTTHUMG00000155829	ENST00000309558.3:c.434C>T	3.37:g.33216542G>A	ENSP00000308727:p.Ser145Leu	Somatic	168	0		WXS	Illumina GAIIx	Phase_I	119	103	NM_015551	0	0	0	1	1		Missense_Mutation	SNP	ENST00000309558.3	37	CCDS46787.1	.	.	.	.	.	.	.	.	.	.	G	25.7	4.664620	0.88251	.	.	ENSG00000173705	ENST00000309558	T	0.65916	-0.18	5.72	4.8	0.61643	C-type lectin fold (1);Complement control module (2);Sushi/SCR/CCP (3);	0.206160	0.42548	D	0.000697	T	0.65502	0.2697	L	0.27053	0.805	0.47819	D	0.999521	D	0.76494	0.999	P	0.61275	0.886	T	0.69105	-0.5233	10	0.87932	D	0	-8.4353	14.5751	0.68240	0.0:0.1454:0.8546:0.0	.	145	O60279	SUSD5_HUMAN	L	145	ENSP00000308727:S145L	ENSP00000308727:S145L	S	-	2	0	SUSD5	33191546	1.000000	0.71417	0.809000	0.32408	0.855000	0.48748	5.956000	0.70315	2.706000	0.92434	0.561000	0.74099	TCG	.		0.547	SUSD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341902.1	XM_171054	
TRANK1	9881	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	36873092	36873092	+	Missense_Mutation	SNP	C	C	T	rs200132397		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr3:36873092C>T	ENST00000429976.2	-	21	8097	c.7850G>A	c.(7849-7851)cGt>cAt	p.R2617H	TRANK1_ENST00000301807.6_Missense_Mutation_p.R2067H|TRANK1_ENST00000428977.2_Missense_Mutation_p.R2067H	NM_014831.2	NP_055646.2	O15050	TRNK1_HUMAN	tetratricopeptide repeat and ankyrin repeat containing 1	2617							ATP binding (GO:0005524)|hydrolase activity (GO:0016787)			NS(2)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(20)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	73						ATAGAGGCCACGGACTATGGA	0.547													C|||	1	0.000199681	0.0008	0.0	5008	,	,		20077	0.0		0.0	False		,,,				2504	0.0				p.R2617H		.											.	TRANK1-24	0			c.G7850A						.	C	HIS/ARG	3,3979		0,3,1988	57.0	61.0	60.0		7850	-0.4	0.0	3		60	1,8317		0,1,4158	yes	missense	TRANK1	NM_014831.2	29	0,4,6146	TT,TC,CC		0.012,0.0753,0.0325	probably-damaging	2617/2926	36873092	4,12296	1991	4159	6150	SO:0001583	missense	9881	exon21			AGGCCACGGACTA	AK096678	CCDS46789.1, CCDS46789.2	3p22.2	2013-01-11			ENSG00000168016	ENSG00000168016		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29011	protein-coding gene	gene with protein product	"""lupus brain antigen 1"", ""KIAA0342"""					9205841	Standard	NM_014831		Approved	LBA1, KIAA0342	uc003cgj.3	O15050	OTTHUMG00000155848	ENST00000429976.2:c.7850G>A	3.37:g.36873092C>T	ENSP00000416168:p.Arg2617His	Somatic	248	2		WXS	Illumina GAIIx	Phase_I	177	161	NM_014831	0	0	0	4	4	Q8N8K0	Missense_Mutation	SNP	ENST00000429976.2	37	CCDS46789.2	.	.	.	.	.	.	.	.	.	.	C	11.97	1.798210	0.31777	7.53E-4	1.2E-4	ENSG00000168016	ENST00000428977;ENST00000429976;ENST00000301807	T;T;T	0.44482	0.92;1.35;0.92	5.6	-0.385	0.12470	.	0.344590	0.24810	N	0.035418	T	0.39627	0.1085	M	0.69823	2.125	0.09310	N	1	B	0.17268	0.021	B	0.12156	0.007	T	0.45600	-0.9250	10	0.87932	D	0	.	11.0595	0.47940	0.0:0.622:0.0:0.378	.	2617	O15050	TRNK1_HUMAN	H	2067;2617;2067	ENSP00000416826:R2067H;ENSP00000416168:R2617H;ENSP00000301807:R2067H	ENSP00000301807:R2067H	R	-	2	0	TRANK1	36848096	0.006000	0.16342	0.003000	0.11579	0.710000	0.40934	0.480000	0.22244	-0.056000	0.13221	0.561000	0.74099	CGT	.		0.547	TRANK1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_014831	
DLEC1	9940	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	38080909	38080909	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr3:38080909C>T	ENST00000308059.6	+	1	214	c.193C>T	c.(193-195)Cgc>Tgc	p.R65C	DLEC1_ENST00000346219.3_Missense_Mutation_p.R65C|DLEC1_ENST00000452631.2_Missense_Mutation_p.R65C					deleted in lung and esophageal cancer 1											NS(1)|breast(3)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(3)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	51				KIRC - Kidney renal clear cell carcinoma(284;0.0664)|Kidney(284;0.0827)		CCGGCCCCGCCGCCTCACGCA	0.677																																					p.R65C		.											.	DLEC1-161	0			c.C193T						.						36.0	43.0	41.0					3																	38080909		1995	4175	6170	SO:0001583	missense	9940	exon1			CCCCGCCGCCTCA	AB020522	CCDS2672.2	3p21.3	2014-07-31			ENSG00000008226	ENSG00000008226			2899	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 81"""	604050				10213508	Standard	XM_005265630		Approved	DLC1, CFAP81	uc003chp.1	Q9Y238	OTTHUMG00000131085	ENST00000308059.6:c.193C>T	3.37:g.38080909C>T	ENSP00000308597:p.Arg65Cys	Somatic	118	0		WXS	Illumina GAIIx	Phase_I	168	156	NM_007337	0	0	0	0	0		Missense_Mutation	SNP	ENST00000308059.6	37	CCDS2672.2	.	.	.	.	.	.	.	.	.	.	C	17.71	3.457613	0.63401	.	.	ENSG00000008226	ENST00000308059;ENST00000346219;ENST00000452631	T;T;T	0.07567	3.22;3.18;3.45	5.7	1.69	0.24217	.	0.000000	0.36740	N	0.002438	T	0.14657	0.0354	L	0.50333	1.59	0.09310	N	1	D;D;D	0.76494	0.999;0.999;0.999	P;P;P	0.60886	0.88;0.88;0.88	T	0.05484	-1.0882	10	0.66056	D	0.02	-7.7957	4.6724	0.12696	0.3015:0.5337:0.0:0.1648	.	65;65;65	F8W6T4;Q9Y238-3;Q9Y238	.;.;DLEC1_HUMAN	C	65	ENSP00000308597:R65C;ENSP00000315914:R65C;ENSP00000410427:R65C	ENSP00000308597:R65C	R	+	1	0	DLEC1	38055913	0.012000	0.17670	0.045000	0.18777	0.022000	0.10575	0.126000	0.15769	0.318000	0.23185	0.609000	0.83330	CGC	.		0.677	DLEC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253745.3	NM_007337	
RPL14	9045	bcgsc.ca	37	3	40503520	40503520	+	Missense_Mutation	SNP	A	A	G	rs147295890|rs369485042|rs200018880|rs57354599|rs111899316	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr3:40503520A>G	ENST00000396203.2	+	6	577	c.445A>G	c.(445-447)Act>Gct	p.T149A	RPL14_ENST00000338970.6_Missense_Mutation_p.T149A|RPL14_ENST00000416518.1_3'UTR	NM_001034996.2	NP_001030168.1	P50914	RL14_HUMAN	ribosomal protein L14	149					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|ribosomal large subunit biogenesis (GO:0042273)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)								KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		TACTAAGGGTActgctgctgc	0.473																																					p.T149A		.											.	RPL14-90	0			c.A445G						.						12.0	14.0	14.0					3																	40503520		2137	4163	6300	SO:0001583	missense	9045	exon6			AAGGGTACTGCTG	D87735	CCDS33739.1, CCDS43070.1	3p22-p21.2	2008-07-18			ENSG00000188846	ENSG00000188846		"""L ribosomal proteins"""	10305	protein-coding gene	gene with protein product	"""CAG-ISL 7"", ""60S ribosomal protein L14"""					9480843	Standard	NM_003973		Approved	L14, hRL14, RL14, CTG-B33	uc003ckg.4	P50914	OTTHUMG00000156046	ENST00000396203.2:c.445A>G	3.37:g.40503520A>G	ENSP00000379506:p.Thr149Ala	Somatic	64	0		WXS	Illumina GAIIx	Phase_I	58	7	NM_003973	0	1	388	389	0	Q45RF0|Q53G20|Q8TBD5|Q8WUT0|Q92579|Q96GR0|Q9BSB8|Q9BW65|Q9BYF6	Missense_Mutation	SNP	ENST00000396203.2	37	CCDS43070.1	.	.	.	.	.	.	.	.	.	.	A	0.019	-1.452618	0.01080	.	.	ENSG00000188846	ENST00000338970;ENST00000396203	T;T	0.40476	1.03;1.03	4.36	1.47	0.22746	.	1.204380	0.06373	N	0.713829	T	0.10380	0.0254	N	0.00260	-1.75	0.09310	N	0.999999	.	.	.	.	.	.	T	0.31110	-0.9955	8	0.02654	T	1	.	7.0458	0.25044	0.3279:0.0:0.6721:0.0	.	149	P50914	RL14_HUMAN	A	149	ENSP00000345156:T149A;ENSP00000379506:T149A	ENSP00000345156:T149A	T	+	1	0	RPL14	40478524	0.002000	0.14202	0.202000	0.23494	0.365000	0.29674	0.035000	0.13797	0.400000	0.25396	-0.250000	0.11733	ACT	A|0.962;G|0.038		0.473	RPL14-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342889.2	NM_003973	
PTPN23	25930	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	47453643	47453643	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr3:47453643A>G	ENST00000265562.4	+	22	4210	c.4133A>G	c.(4132-4134)tAc>tGc	p.Y1378C	PTPN23_ENST00000431726.1_Missense_Mutation_p.Y1252C	NM_015466.2	NP_056281.1	Q9H3S7	PTN23_HUMAN	protein tyrosine phosphatase, non-receptor type 23	1378	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cilium morphogenesis (GO:0060271)|negative regulation of epithelial cell migration (GO:0010633)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of adherens junction organization (GO:1903393)|positive regulation of early endosome to late endosome transport (GO:2000643)|positive regulation of homophilic cell adhesion (GO:1903387)|protein transport (GO:0015031)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|central_nervous_system(1)|large_intestine(5)|lung(7)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	23				BRCA - Breast invasive adenocarcinoma(193;0.000271)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		CACGCACATTACCTGCATCAG	0.622																																					p.Y1378C		.											.	PTPN23-227	0			c.A4133G						.						55.0	52.0	53.0					3																	47453643		2203	4300	6503	SO:0001583	missense	25930	exon22			CACATTACCTGCA	AB025194	CCDS2754.1	3p21.3	2011-06-09			ENSG00000076201	ENSG00000076201		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	14406	protein-coding gene	gene with protein product		606584				11095967	Standard	NM_015466		Approved	DKFZP564F0923, KIAA1471, HD-PTP	uc003crf.1	Q9H3S7	OTTHUMG00000133520	ENST00000265562.4:c.4133A>G	3.37:g.47453643A>G	ENSP00000265562:p.Tyr1378Cys	Somatic	139	0		WXS	Illumina GAIIx	Phase_I	113	102	NM_015466	0	0	3	22	19	A8K0D7|Q7KZF8|Q8N6Z5|Q9BSR5|Q9P257|Q9UG03|Q9UMZ4	Missense_Mutation	SNP	ENST00000265562.4	37	CCDS2754.1	.	.	.	.	.	.	.	.	.	.	A	14.95	2.688717	0.48097	.	.	ENSG00000076201	ENST00000265562	D	0.83419	-1.72	4.22	1.56	0.23342	Protein-tyrosine phosphatase, receptor/non-receptor type (3);Protein-tyrosine/Dual-specificity phosphatase (1);	0.260060	0.32244	N	0.006372	T	0.74884	0.3775	L	0.52126	1.63	0.48901	D	0.999721	B	0.12013	0.005	B	0.20384	0.029	T	0.68484	-0.5396	10	0.56958	D	0.05	-6.4884	5.9704	0.19349	0.7426:0.1646:0.0928:0.0	.	1378	Q9H3S7	PTN23_HUMAN	C	1378	ENSP00000265562:Y1378C	ENSP00000265562:Y1378C	Y	+	2	0	PTPN23	47428647	1.000000	0.71417	0.966000	0.40874	0.801000	0.45260	2.580000	0.46068	0.587000	0.29643	0.460000	0.39030	TAC	.		0.622	PTPN23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257492.2	NM_015466	
AMT	275	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	49459642	49459642	+	Silent	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr3:49459642C>T	ENST00000273588.3	-	2	455	c.153G>A	c.(151-153)gcG>gcA	p.A51A	AMT_ENST00000546031.1_Intron|NICN1-AS1_ENST00000424915.1_RNA|AMT_ENST00000458307.2_Silent_p.A51A|AMT_ENST00000476226.1_5'UTR|AMT_ENST00000395338.2_Silent_p.A51A|NICN1_ENST00000422593.1_5'Flank|AMT_ENST00000538581.1_Intron	NM_000481.3	NP_000472.2	P48728	GCST_HUMAN	aminomethyltransferase	51					glycine catabolic process (GO:0006546)	mitochondrion (GO:0005739)	aminomethyltransferase activity (GO:0004047)|transaminase activity (GO:0008483)			endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	6				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)	Tetrahydrofolic acid(DB00116)	AACCCGCAAACGCCACCATTT	0.627																																					p.A51A		.											.	AMT-91	0			c.G153A						.						109.0	113.0	112.0					3																	49459642		2203	4300	6503	SO:0001819	synonymous_variant	275	exon2			CGCAAACGCCACC	D13811	CCDS2797.1, CCDS54583.1, CCDS54584.1, CCDS54585.1	3p21.2-p21.1	2014-09-17	2006-05-22		ENSG00000145020	ENSG00000145020	2.1.2.10		473	protein-coding gene	gene with protein product	"""glycine cleavage system protein T"""	238310	"""aminomethyltransferase (glycine cleavage system protein T)"""			1993704, 8188235	Standard	NM_000481		Approved	GCST, NKH	uc003cww.3	P48728	OTTHUMG00000156847	ENST00000273588.3:c.153G>A	3.37:g.49459642C>T		Somatic	238	1		WXS	Illumina GAIIx	Phase_I	128	112	NM_001164712	0	0	0	1	1	A8K3I5|B4DE61|B4DJQ0|E9PBG1|Q96IG6	Silent	SNP	ENST00000273588.3	37	CCDS2797.1	.	.	.	.	.	.	.	.	.	.	C	3.545	-0.092921	0.07053	.	.	ENSG00000145020	ENST00000427987	.	.	.	5.07	-5.57	0.02521	.	.	.	.	.	T	0.39145	0.1067	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.38607	-0.9653	4	.	.	.	-17.6642	3.9189	0.09234	0.1047:0.2768:0.1036:0.5149	.	.	.	.	I	49	.	.	V	-	1	0	AMT	49434646	0.000000	0.05858	0.009000	0.14445	0.038000	0.13279	-2.758000	0.00787	-1.009000	0.03400	0.655000	0.94253	GTT	.		0.627	AMT-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346216.2	NM_000481	
SEMA3F	6405	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	50211681	50211681	+	Silent	SNP	C	C	T	rs200273983		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr3:50211681C>T	ENST00000002829.3	+	5	838	c.354C>T	c.(352-354)ttC>ttT	p.F118F	SEMA3F_ENST00000413852.1_Silent_p.F50F|SEMA3F_ENST00000434342.1_Silent_p.F118F|MIR566_ENST00000385187.1_RNA	NM_004186.3	NP_004177.3	Q13275	SEM3F_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F	118	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branchiomotor neuron axon guidance (GO:0021785)|facial nerve structural organization (GO:0021612)|negative regulation of axon extension involved in axon guidance (GO:0048843)|nerve development (GO:0021675)|neural crest cell migration (GO:0001755)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sympathetic ganglion development (GO:0061549)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	extracellular space (GO:0005615)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|receptor activity (GO:0004872)			central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|skin(2)	17				BRCA - Breast invasive adenocarcinoma(193;0.00013)|KIRC - Kidney renal clear cell carcinoma(197;0.00599)|Kidney(197;0.00688)		GTGGGAACTTCGTCAGGCTCA	0.647																																					p.F118F		.											.	SEMA3F-279	0			c.C354T						.	C		0,4406		0,0,2203	71.0	68.0	69.0		354	3.6	1.0	3		69	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	SEMA3F	NM_004186.3		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		118/786	50211681	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	6405	exon5			GAACTTCGTCAGG	U33920	CCDS2811.1	3p21.3	2013-01-11			ENSG00000001617	ENSG00000001617		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10728	protein-coding gene	gene with protein product	"""sema IV"""	601124				8786119, 8649831	Standard	NM_004186		Approved	SEMAK, Sema4	uc003cyj.3	Q13275	OTTHUMG00000156806	ENST00000002829.3:c.354C>T	3.37:g.50211681C>T		Somatic	367	1		WXS	Illumina GAIIx	Phase_I	240	210	NM_004186	0	0	5	6	1	C9JQ85|Q13274|Q13372|Q15704|Q6GTR4	Silent	SNP	ENST00000002829.3	37	CCDS2811.1																																																																																			C|0.999;T|0.001		0.647	SEMA3F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345929.1	NM_004186	
DNAH1	25981	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	52425313	52425313	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr3:52425313A>G	ENST00000420323.2	+	62	10121	c.9860A>G	c.(9859-9861)gAc>gGc	p.D3287G		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	3352	AAA 5. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		GAGGAGCTAGACCCAGCCCTG	0.627																																					p.D3287G		.											.	DNAH1-67	0			c.A9860G						.						28.0	32.0	31.0					3																	52425313		2162	4251	6413	SO:0001583	missense	25981	exon62			AGCTAGACCCAGC	U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.9860A>G	3.37:g.52425313A>G	ENSP00000401514:p.Asp3287Gly	Somatic	253	1		WXS	Illumina GAIIx	Phase_I	145	131	NM_015512	0	0	0	6	6	B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Missense_Mutation	SNP	ENST00000420323.2	37	CCDS46842.1	.	.	.	.	.	.	.	.	.	.	A	16.45	3.126612	0.56721	.	.	ENSG00000114841	ENST00000420323;ENST00000273600	T	0.34072	1.38	4.57	4.57	0.56435	.	0.000000	0.64402	D	0.000003	T	0.75686	0.3883	H	0.99197	4.465	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.993	D	0.86269	0.1660	10	0.87932	D	0	.	14.109	0.65111	1.0:0.0:0.0:0.0	.	3287;3352	C9JXH6;Q9P2D7-2	.;.	G	3287;40	ENSP00000401514:D3287G	ENSP00000273600:D40G	D	+	2	0	DNAH1	52400353	1.000000	0.71417	0.974000	0.42286	0.037000	0.13140	9.025000	0.93694	1.931000	0.55961	0.533000	0.62120	GAC	.		0.627	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350816.1	NM_015512	
NISCH	11188	broad.mit.edu	37	3	52522397	52522397	+	Silent	SNP	G	G	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr3:52522397G>T	ENST00000479054.1	+	17	2961	c.2889G>T	c.(2887-2889)cgG>cgT	p.R963R	NISCH_ENST00000345716.4_Silent_p.R963R			Q9Y2I1	NISCH_HUMAN	nischarin	963					actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|glucose metabolic process (GO:0006006)|negative regulation of cell migration (GO:0030336)|norepinephrine secretion (GO:0048243)|Rac protein signal transduction (GO:0016601)|regulation of blood pressure (GO:0008217)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)|plasma membrane (GO:0005886)	G-protein coupled amine receptor activity (GO:0008227)|identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)			NS(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(9)|ovary(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	33				BRCA - Breast invasive adenocarcinoma(193;1.93e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)|OV - Ovarian serous cystadenocarcinoma(275;0.0577)	Tizanidine(DB00697)	CCCAGCCTCGGGGCGCCTTTG	0.637																																					p.R963R		.											.	NISCH-93	0			c.G2889T						.						66.0	69.0	68.0					3																	52522397		2203	4300	6503	SO:0001819	synonymous_variant	11188	exon16			GCCTCGGGGCGCC	AF082516	CCDS33767.1, CCDS63651.1, CCDS63652.1	3p21.1	2008-07-18			ENSG00000010322	ENSG00000010322			18006	protein-coding gene	gene with protein product	"""imidazoline receptor candidate"", ""I-1 receptor candidate protein"", ""imidazoline receptor antisera selected"""	615507				11912194, 10882231	Standard	NM_007184		Approved	KIAA0975, I-1, IRAS	uc003ded.4	Q9Y2I1	OTTHUMG00000158571	ENST00000479054.1:c.2889G>T	3.37:g.52522397G>T		Somatic	161	0		WXS	Illumina GAIIx	Phase_I	112	4	NM_007184	0	0	33	33	0	C9J245|Q6PGP3|Q6PIB4|Q7L8M3|Q7Z2X6|Q9UES6|Q9UEU4|Q9UFW3	Silent	SNP	ENST00000479054.1	37	CCDS33767.1																																																																																			.		0.637	NISCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351357.1	NM_007184	
STAB1	23166	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	52536666	52536666	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr3:52536666G>A	ENST00000321725.6	+	6	582	c.506G>A	c.(505-507)gGa>gAa	p.G169E		NM_015136.2	NP_055951.2	Q9NY15	STAB1_HUMAN	stabilin 1	169	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076, ECO:0000305}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|oxidation-reduction process (GO:0055114)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|protein disulfide oxidoreductase activity (GO:0015035)|scavenger receptor activity (GO:0005044)			breast(4)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(13)|liver(1)|lung(27)|ovary(1)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	76				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		TGTGTGCACGGAGTGTGCAAC	0.612																																					p.G169E		.											.	STAB1-139	0			c.G506A						.						101.0	84.0	90.0					3																	52536666		2203	4300	6503	SO:0001583	missense	23166	exon6			TGCACGGAGTGTG	AJ275213	CCDS33768.1	3p21.31	2008-07-18			ENSG00000010327	ENSG00000010327			18628	protein-coding gene	gene with protein product	"""MS-1 antigen"", ""fasciclin egf-like, laminin-type egf-like, and link domain-containing scavenger receptor-1"", ""common lymphatic endothelial and vascular endothelial receptor-1"""	608560				11829752, 12077138	Standard	XM_005264973		Approved	KIAA0246, STAB-1, FEEL-1, CLEVER-1, FELE-1, FEX1	uc003dej.3	Q9NY15	OTTHUMG00000158574	ENST00000321725.6:c.506G>A	3.37:g.52536666G>A	ENSP00000312946:p.Gly169Glu	Somatic	145	0		WXS	Illumina GAIIx	Phase_I	115	99	NM_015136	0	0	0	0	0	A7E297|Q8IUH0|Q8IUH1|Q93072	Missense_Mutation	SNP	ENST00000321725.6	37	CCDS33768.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.936395	0.73442	.	.	ENSG00000010327	ENST00000321725	T	0.55588	0.51	4.47	4.47	0.54385	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.64402	D	0.000001	T	0.77974	0.4211	M	0.94063	3.49	0.45733	D	0.998637	D;D	0.89917	1.0;1.0	D;D	0.79108	0.991;0.992	D	0.83866	0.0271	10	0.87932	D	0	.	13.025	0.58810	0.0:0.0:1.0:0.0	.	169;169	Q9NY15;Q9NY15-2	STAB1_HUMAN;.	E	169	ENSP00000312946:G169E	ENSP00000312946:G169E	G	+	2	0	STAB1	52511706	1.000000	0.71417	0.174000	0.22961	0.125000	0.20455	6.767000	0.74975	2.210000	0.71456	0.561000	0.74099	GGA	.		0.612	STAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351380.2	NM_015136	
STAB1	23166	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	52553340	52553340	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr3:52553340G>A	ENST00000321725.6	+	49	5171	c.5095G>A	c.(5095-5097)Ggc>Agc	p.G1699S		NM_015136.2	NP_055951.2	Q9NY15	STAB1_HUMAN	stabilin 1	1699	FAS1 5. {ECO:0000255|PROSITE- ProRule:PRU00082, ECO:0000305}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|oxidation-reduction process (GO:0055114)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|protein disulfide oxidoreductase activity (GO:0015035)|scavenger receptor activity (GO:0005044)			breast(4)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(13)|liver(1)|lung(27)|ovary(1)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	76				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		GGCCGTGAACGGCATCCTGCA	0.642																																					p.G1699S		.											.	STAB1-139	0			c.G5095A						.						127.0	128.0	128.0					3																	52553340		2203	4299	6502	SO:0001583	missense	23166	exon49			GTGAACGGCATCC	AJ275213	CCDS33768.1	3p21.31	2008-07-18			ENSG00000010327	ENSG00000010327			18628	protein-coding gene	gene with protein product	"""MS-1 antigen"", ""fasciclin egf-like, laminin-type egf-like, and link domain-containing scavenger receptor-1"", ""common lymphatic endothelial and vascular endothelial receptor-1"""	608560				11829752, 12077138	Standard	XM_005264973		Approved	KIAA0246, STAB-1, FEEL-1, CLEVER-1, FELE-1, FEX1	uc003dej.3	Q9NY15	OTTHUMG00000158574	ENST00000321725.6:c.5095G>A	3.37:g.52553340G>A	ENSP00000312946:p.Gly1699Ser	Somatic	243	0		WXS	Illumina GAIIx	Phase_I	161	152	NM_015136	0	0	4	4	0	A7E297|Q8IUH0|Q8IUH1|Q93072	Missense_Mutation	SNP	ENST00000321725.6	37	CCDS33768.1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.540033	0.85917	.	.	ENSG00000010327	ENST00000321725	D	0.93811	-3.29	5.5	5.5	0.81552	FAS1 domain (5);	0.000000	0.85682	D	0.000000	D	0.97123	0.9060	M	0.87900	2.915	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.97700	1.0184	10	0.87932	D	0	.	17.5833	0.87973	0.0:0.0:1.0:0.0	.	1699	Q9NY15	STAB1_HUMAN	S	1699	ENSP00000312946:G1699S	ENSP00000312946:G1699S	G	+	1	0	STAB1	52528380	1.000000	0.71417	0.687000	0.30102	0.002000	0.02628	4.596000	0.61055	2.574000	0.86865	0.655000	0.94253	GGC	.		0.642	STAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351380.2	NM_015136	
ITIH1	3697	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	52820426	52820426	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr3:52820426C>T	ENST00000273283.2	+	13	1733	c.1709C>T	c.(1708-1710)aCc>aTc	p.T570I	ITIH1_ENST00000537050.1_Missense_Mutation_p.T282I|ITIH1_ENST00000540715.1_Missense_Mutation_p.T428I|ITIH1_ENST00000405128.3_5'Flank|ITIH1_ENST00000542827.1_Missense_Mutation_p.T570I	NM_002215.3	NP_002206.2	P19827	ITIH1_HUMAN	inter-alpha-trypsin inhibitor heavy chain 1	570	Hyaluronan-binding.				hyaluronan metabolic process (GO:0030212)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(16)|lung(18)|ovary(4)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	52				BRCA - Breast invasive adenocarcinoma(193;7.04e-05)|Kidney(197;0.000659)|KIRC - Kidney renal clear cell carcinoma(197;0.000795)|OV - Ovarian serous cystadenocarcinoma(275;0.0498)		GCCTACCTCACCATCCAGGAG	0.632																																					p.T570I		.											.	ITIH1-93	0			c.C1709T						.						29.0	24.0	26.0					3																	52820426		2201	4295	6496	SO:0001583	missense	3697	exon13			ACCTCACCATCCA		CCDS2864.1, CCDS54595.1	3p21.1	2011-10-26	2011-10-26		ENSG00000055957	ENSG00000055957			6166	protein-coding gene	gene with protein product		147270	"""inter-alpha (globulin) inhibitor, H1 polypeptide"""			1385302, 10100603	Standard	NM_002215		Approved	H1P, IATIH, ITIH	uc003dfs.3	P19827	OTTHUMG00000150312	ENST00000273283.2:c.1709C>T	3.37:g.52820426C>T	ENSP00000273283:p.Thr570Ile	Somatic	300	0		WXS	Illumina GAIIx	Phase_I	184	177	NM_002215	0	0	0	0	0	A8K9N5|B2RAH9|B7Z558|B7Z8C0|F5H165|F5H7Y8|P78455|Q01746|Q562G1	Missense_Mutation	SNP	ENST00000273283.2	37	CCDS2864.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.710258	0.89018	.	.	ENSG00000055957	ENST00000542827;ENST00000273283;ENST00000540715;ENST00000537050;ENST00000428133	T;T;T;T;T	0.61274	0.12;0.12;0.12;0.12;0.12	4.78	4.78	0.61160	.	0.000000	0.85682	D	0.000000	T	0.81307	0.4795	M	0.92219	3.285	0.49798	D	0.999821	D;P;D	0.89917	1.0;0.911;1.0	D;P;D	0.97110	1.0;0.609;0.998	D	0.86123	0.1570	10	0.87932	D	0	-37.2167	15.7613	0.78082	0.0:1.0:0.0:0.0	.	428;171;570	F5H165;Q9P1C5;P19827	.;.;ITIH1_HUMAN	I	570;570;428;282;123	ENSP00000442584:T570I;ENSP00000273283:T570I;ENSP00000443973:T428I;ENSP00000443847:T282I;ENSP00000395836:T123I	ENSP00000273283:T570I	T	+	2	0	ITIH1	52795466	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.041000	0.76558	2.480000	0.83734	0.462000	0.41574	ACC	.		0.632	ITIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317522.1	NM_002215	
PRICKLE2	166336	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	64085464	64085464	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr3:64085464G>A	ENST00000295902.6	-	8	2383	c.1798C>T	c.(1798-1800)Cgg>Tgg	p.R600W	PRICKLE2_ENST00000564377.1_Missense_Mutation_p.R656W|RP11-129B22.1_ENST00000482609.1_RNA|PRICKLE2-AS1_ENST00000476308.1_RNA|PRICKLE2-AS1_ENST00000460946.1_RNA	NM_198859.3	NP_942559.1	Q7Z3G6	PRIC2_HUMAN	prickle homolog 2 (Drosophila)	600					establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|neuron projection development (GO:0031175)	apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|large_intestine(9)|liver(1)|lung(10)|ovary(4)|prostate(2)|skin(2)|stomach(1)	32		Lung NSC(201;0.136)		BRCA - Breast invasive adenocarcinoma(55;0.000971)|KIRC - Kidney renal clear cell carcinoma(15;0.00443)|Kidney(15;0.00497)		TCTGCGCTCCGGAACTGCATG	0.547																																					p.R600W		.											.	PRICKLE2-95	0			c.C1798T						.						133.0	132.0	132.0					3																	64085464		2203	4300	6503	SO:0001583	missense	166336	exon8			CGCTCCGGAACTG	AK127839	CCDS2902.1	3p14.3	2006-09-12	2006-09-12		ENSG00000163637	ENSG00000163637			20340	protein-coding gene	gene with protein product		608501	"""prickle-like 2 (Drosophila)"""			12525887	Standard	NM_198859		Approved	DKFZp686D143	uc003dmf.3	Q7Z3G6	OTTHUMG00000158789	ENST00000295902.6:c.1798C>T	3.37:g.64085464G>A	ENSP00000295902:p.Arg600Trp	Somatic	228	0		WXS	Illumina GAIIx	Phase_I	138	123	NM_198859	0	0	0	1	1	Q0VF44	Missense_Mutation	SNP	ENST00000295902.6	37	CCDS2902.1	.	.	.	.	.	.	.	.	.	.	G	16.78	3.218452	0.58560	.	.	ENSG00000163637	ENST00000295902	D	0.87334	-2.24	5.62	2.73	0.32206	.	0.000000	0.64402	D	0.000003	D	0.89203	0.6648	M	0.62723	1.935	0.48511	D	0.999668	D	0.61697	0.99	P	0.52881	0.712	D	0.88984	0.3410	10	0.87932	D	0	-33.3037	14.8286	0.70132	0.0:0.0:0.4936:0.5064	.	600	Q7Z3G6	PRIC2_HUMAN	W	600	ENSP00000295902:R600W	ENSP00000295902:R600W	R	-	1	2	PRICKLE2	64060504	1.000000	0.71417	0.997000	0.53966	0.976000	0.68499	3.083000	0.50136	0.265000	0.21872	-0.282000	0.10007	CGG	.		0.547	PRICKLE2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352219.1	NM_198859	
FILIP1L	11259	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	99643213	99643213	+	Nonsense_Mutation	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr3:99643213G>A	ENST00000354552.3	-	4	936	c.466C>T	c.(466-468)Cga>Tga	p.R156*	FILIP1L_ENST00000331335.5_Nonsense_Mutation_p.R156*|CMSS1_ENST00000496116.1_Intron|CMSS1_ENST00000421999.2_Intron|FILIP1L_ENST00000398326.2_Nonsense_Mutation_p.R156*	NM_182909.2	NP_878913.2	Q4L180	FIL1L_HUMAN	filamin A interacting protein 1-like	156						cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	35						CCCAGGATTCGTCTGTAAGAT	0.363																																					p.R156X		.											.	FILIP1L-45	0			c.C466T						.						205.0	188.0	193.0					3																	99643213		1829	4081	5910	SO:0001587	stop_gained	11259	exon4			GGATTCGTCTGTA		CCDS43117.1, CCDS43118.1, CCDS43119.1, CCDS63700.1, CCDS74969.1	3q12.1	2011-10-21			ENSG00000168386	ENSG00000168386			24589	protein-coding gene	gene with protein product	"""downregulated in ovarian cancer 1"", ""GPBP-interacting protein of 130 kDa"""	612993				8314147, 15935955, 21832087	Standard	NM_001282793		Approved	DOC-1, GIP130	uc003dtm.3	Q4L180	OTTHUMG00000159055	ENST00000354552.3:c.466C>T	3.37:g.99643213G>A	ENSP00000346560:p.Arg156*	Somatic	124	0		WXS	Illumina GAIIx	Phase_I	95	81	NM_182909	0	0	0	0	0	B2CNV7|B2CNV8|Q13597|Q2YDY5|Q6KFX5|Q6KFX6|Q6KFX7|Q8IUM3|Q8N6Z0	Nonsense_Mutation	SNP	ENST00000354552.3	37	CCDS43117.1	.	.	.	.	.	.	.	.	.	.	G	39	7.566144	0.98361	.	.	ENSG00000168386	ENST00000354552;ENST00000331335;ENST00000398326	.	.	.	5.5	4.61	0.57282	.	0.643413	0.12837	N	0.435166	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-2.9477	13.6844	0.62506	0.0:0.0:0.6048:0.3952	.	.	.	.	X	156	.	ENSP00000327880:R156X	R	-	1	2	FILIP1L	101125903	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	2.225000	0.42954	1.302000	0.44855	0.585000	0.79938	CGA	.		0.363	FILIP1L-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000353069.1	NM_014890	
MYH15	22989	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	108174589	108174589	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr3:108174589G>C	ENST00000273353.3	-	21	2372	c.2316C>G	c.(2314-2316)atC>atG	p.I772M	MYH15_ENST00000495753.2_5'Flank	NM_014981.1	NP_055796.1	Q9Y2K3	MYH15_HUMAN	myosin, heavy chain 15	772	Actin-binding. {ECO:0000250}.|Myosin motor.					cytoplasm (GO:0005737)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(3)|central_nervous_system(2)|cervix(4)|endometrium(10)|kidney(4)|large_intestine(14)|lung(47)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	105						TTACCTTAGTGATTCCAAATC	0.423																																					p.I772M		.											.	MYH15-73	0			c.C2316G						.						191.0	181.0	184.0					3																	108174589		1848	4100	5948	SO:0001583	missense	22989	exon21			CTTAGTGATTCCA	AB023217	CCDS43127.1	3q13	2011-09-27	2006-09-29		ENSG00000144821	ENSG00000144821		"""Myosins / Myosin superfamily : Class II"""	31073	protein-coding gene	gene with protein product		609929	"""myosin, heavy polypeptide 15"""			15014174, 15042088	Standard	NM_014981		Approved	KIAA1000	uc003dxa.1	Q9Y2K3	OTTHUMG00000159226	ENST00000273353.3:c.2316C>G	3.37:g.108174589G>C	ENSP00000273353:p.Ile772Met	Somatic	122	0		WXS	Illumina GAIIx	Phase_I	90	84	NM_014981	0	0	0	0	0		Missense_Mutation	SNP	ENST00000273353.3	37	CCDS43127.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.052825	0.75960	.	.	ENSG00000144821	ENST00000273353	D	0.87334	-2.24	6.06	4.25	0.50352	Myosin head, motor domain (2);	.	.	.	.	D	0.89451	0.6719	L	0.52126	1.63	0.24930	N	0.991921	P	0.52463	0.953	P	0.57425	0.82	T	0.81963	-0.0692	9	0.87932	D	0	.	11.8306	0.52293	0.1921:0.0:0.8079:0.0	.	772	Q9Y2K3	MYH15_HUMAN	M	772	ENSP00000273353:I772M	ENSP00000273353:I772M	I	-	3	3	MYH15	109657279	1.000000	0.71417	0.515000	0.27774	0.996000	0.88848	2.816000	0.48026	1.551000	0.49450	0.655000	0.94253	ATC	.		0.423	MYH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353935.1	XM_036988	
ZBTB20	26137	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	114070578	114070578	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr3:114070578C>T	ENST00000474710.1	-	4	525	c.347G>A	c.(346-348)cGc>cAc	p.R116H	ZBTB20_ENST00000393785.2_Missense_Mutation_p.R43H|ZBTB20_ENST00000471418.1_Missense_Mutation_p.R43H|ZBTB20-AS1_ENST00000467304.1_RNA|ZBTB20_ENST00000462705.1_Missense_Mutation_p.R43H|ZBTB20-AS1_ENST00000496219.1_RNA|ZBTB20_ENST00000464560.1_Missense_Mutation_p.R43H|ZBTB20_ENST00000481632.1_Missense_Mutation_p.R43H|ZBTB20_ENST00000357258.3_Missense_Mutation_p.R43H|ZBTB20-AS1_ENST00000475939.1_RNA	NM_001164342.1	NP_001157814.1	Q9HC78	ZBT20_HUMAN	zinc finger and BTB domain containing 20	116	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.					nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(1)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	48				LUSC - Lung squamous cell carcinoma(41;0.0581)|Lung(219;0.191)		GCGGTGTGCGCGCAGCATGCT	0.617																																					p.R116H	NSCLC(69;748 1344 9802 11203 30933)	.											.	ZBTB20-95	0			c.G347A						.						49.0	47.0	48.0					3																	114070578		2203	4300	6503	SO:0001583	missense	26137	exon4			TGTGCGCGCAGCA	AF139460	CCDS2981.1, CCDS54626.1	3q13.2	2013-01-08	2004-07-16	2004-07-16	ENSG00000181722	ENSG00000181722		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	13503	protein-coding gene	gene with protein product		606025	"""zinc finger protein 288"""	ZNF288		10965110, 11352661	Standard	XM_005247339		Approved	ODA-8S, DKFZp566F123, DPZF	uc003ebi.3	Q9HC78	OTTHUMG00000159366	ENST00000474710.1:c.347G>A	3.37:g.114070578C>T	ENSP00000419153:p.Arg116His	Somatic	236	0		WXS	Illumina GAIIx	Phase_I	166	149	NM_001164342	0	0	0	0	0	Q63HP6|Q8N6R5|Q9Y410	Missense_Mutation	SNP	ENST00000474710.1	37	CCDS54626.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.331262	0.81690	.	.	ENSG00000181722	ENST00000462705;ENST00000393785;ENST00000481632;ENST00000471418;ENST00000474710;ENST00000357258;ENST00000464560;ENST00000470311	T;T;T;T;T;T;T;T	0.67345	-0.26;-0.26;-0.26;-0.26;-0.26;-0.26;-0.26;-0.26	5.98	5.1	0.69264	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.057005	0.64402	D	0.000001	T	0.76828	0.4042	L	0.45285	1.41	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.79605	-0.1734	10	0.87932	D	0	.	16.5644	0.84575	0.1317:0.8683:0.0:0.0	.	116	Q9HC78	ZBT20_HUMAN	H	43;43;43;43;116;43;43;43	ENSP00000420324:R43H;ENSP00000377375:R43H;ENSP00000418092:R43H;ENSP00000419902:R43H;ENSP00000419153:R116H;ENSP00000349803:R43H;ENSP00000417307:R43H;ENSP00000420684:R43H	ENSP00000349803:R43H	R	-	2	0	ZBTB20	115553268	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	1.516000	0.48900	0.650000	0.86243	CGC	.		0.617	ZBTB20-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354951.1	NM_015642	
SLC12A8	84561	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	124854609	124854609	+	Missense_Mutation	SNP	A	A	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr3:124854609A>T	ENST00000393469.4	-	5	689	c.640T>A	c.(640-642)Tat>Aat	p.Y214N	SLC12A8_ENST00000469902.1_Missense_Mutation_p.Y214N|SLC12A8_ENST00000314584.7_5'UTR|SLC12A8_ENST00000423114.2_Missense_Mutation_p.Y243N	NM_001195483.1	NP_001182412	A0AV02	S12A8_HUMAN	solute carrier family 12, member 8	214					potassium ion transport (GO:0006813)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			endometrium(2)|kidney(2)|lung(12)	16						TCGGGTGAATATCCAATGAAA	0.448																																					p.Y214N		.											.	SLC12A8-22	0			c.T640A						.						60.0	62.0	62.0					3																	124854609		1970	4153	6123	SO:0001583	missense	84561	exon6			GTGAATATCCAAT		CCDS43143.1	3q21.2	2013-07-18	2013-07-18		ENSG00000221955	ENSG00000221955		"""Solute carriers"""	15595	protein-coding gene	gene with protein product	"""solute carrier family 12 (sodium/potassium/chloride transporters), member 8"", ""cation-chloride cotransporter 9"""	611316				11863360	Standard	NM_024628		Approved	CCC9	uc003ehv.4	A0AV02	OTTHUMG00000159483	ENST00000393469.4:c.640T>A	3.37:g.124854609A>T	ENSP00000377112:p.Tyr214Asn	Somatic	140	0		WXS	Illumina GAIIx	Phase_I	87	79	NM_024628	0	0	0	1	1	C9JJJ2|Q68D04|Q6I9Z2|Q6P4C0|Q7Z3A6|Q86WK0|Q8NFX9|Q8WUI3|Q96RF9|Q9H5P9	Missense_Mutation	SNP	ENST00000393469.4	37	CCDS43143.1	.	.	.	.	.	.	.	.	.	.	a	20.6	4.018211	0.75275	.	.	ENSG00000221955	ENST00000393469;ENST00000423114;ENST00000469902;ENST00000479826	D;D;D;D	0.98762	-5.12;-5.12;-5.12;-5.12	5.14	5.14	0.70334	Amino acid permease domain (1);	.	.	.	.	D	0.99177	0.9715	M	0.89715	3.055	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.97110	1.0;0.99;0.996	D	0.99349	1.0914	9	0.72032	D	0.01	.	12.5891	0.56434	1.0:0.0:0.0:0.0	.	106;243;214	B5MDT1;A0AV02-2;A0AV02	.;.;S12A8_HUMAN	N	214;243;214;96	ENSP00000377112:Y214N;ENSP00000404243:Y243N;ENSP00000418783:Y214N;ENSP00000420197:Y96N	ENSP00000377112:Y214N	Y	-	1	0	SLC12A8	126337299	1.000000	0.71417	0.956000	0.39512	0.868000	0.49771	7.709000	0.84645	2.151000	0.67156	0.449000	0.29647	TAT	.		0.448	SLC12A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355711.4	NM_024628	
COL6A5	256076	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	130124438	130124438	+	Nonsense_Mutation	SNP	C	C	T	rs573787224		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr3:130124438C>T	ENST00000432398.2	+	14	4782	c.4288C>T	c.(4288-4290)Cga>Tga	p.R1430*	COL6A5_ENST00000265379.6_Nonsense_Mutation_p.R1430*	NM_153264.5	NP_694996.5	A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	1430	Triple-helical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						TTAGGGAGTACGAGGAGACAC	0.478																																					p.R1430X		.											.	.	0			c.C4288T						.						116.0	107.0	110.0					3																	130124438		692	1591	2283	SO:0001587	stop_gained	256076	exon14			GGAGTACGAGGAG	AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000432398.2:c.4288C>T	3.37:g.130124438C>T	ENSP00000390895:p.Arg1430*	Somatic	309	1		WXS	Illumina GAIIx	Phase_I	159	138	NM_153264	0	0	0	0	0	A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	Nonsense_Mutation	SNP	ENST00000432398.2	37		.	.	.	.	.	.	.	.	.	.	C	45	11.817692	0.99606	.	.	ENSG00000172752	ENST00000432398;ENST00000265379	.	.	.	5.58	2.31	0.28768	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.4192	0.60987	0.4129:0.5871:0.0:0.0	.	.	.	.	X	1430	.	ENSP00000265379:R1430X	R	+	1	2	COL6A5	131607128	0.510000	0.26171	0.525000	0.27900	0.178000	0.23041	0.728000	0.26013	0.648000	0.30732	0.555000	0.69702	CGA	.		0.478	COL6A5-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_153264	
ARMC8	25852	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	137942520	137942520	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr3:137942520G>A	ENST00000469044.1	+	5	651	c.380G>A	c.(379-381)cGa>cAa	p.R127Q	ARMC8_ENST00000489213.1_Missense_Mutation_p.R85Q|ARMC8_ENST00000538260.1_Missense_Mutation_p.R127Q|ARMC8_ENST00000470821.1_Missense_Mutation_p.R127Q|ARMC8_ENST00000481646.1_Missense_Mutation_p.R113Q|ARMC8_ENST00000393058.3_Missense_Mutation_p.R117Q|ARMC8_ENST00000461822.1_Missense_Mutation_p.R127Q|ARMC8_ENST00000491704.1_Missense_Mutation_p.R85Q|ARMC8_ENST00000358441.2_Missense_Mutation_p.R113Q|ARMC8_ENST00000485396.1_Missense_Mutation_p.R85Q|ARMC8_ENST00000471453.1_Missense_Mutation_p.R113Q	NM_001267041.1|NM_001267042.1	NP_001253970.1|NP_001253971.1	Q8IUR7	ARMC8_HUMAN	armadillo repeat containing 8	127										endometrium(2)|kidney(1)|large_intestine(7)|lung(5)|upper_aerodigestive_tract(1)	16						GCTTGCCTCCGATGCCTGCGT	0.413																																					p.R127Q		.											.	ARMC8-90	0			c.G380A						.						108.0	102.0	104.0					3																	137942520		2203	4300	6503	SO:0001583	missense	25852	exon5			GCCTCCGATGCCT		CCDS3098.1, CCDS54646.1, CCDS58853.1, CCDS58854.1, CCDS75020.1	3q22	2013-02-14			ENSG00000114098	ENSG00000114098		"""Armadillo repeat containing"""	24999	protein-coding gene	gene with protein product	"""GID complex subunit 5, VID28 homolog (S. cerevisiae)"""					11042152	Standard	NM_014154		Approved	HSPC056, DKFZP434A043, GID5, VID28	uc003esa.2	Q8IUR7	OTTHUMG00000159821	ENST00000469044.1:c.380G>A	3.37:g.137942520G>A	ENSP00000419413:p.Arg127Gln	Somatic	73	1		WXS	Illumina GAIIx	Phase_I	51	39	NM_001267041	0	0	0	9	9	A8K0L2|B7Z441|B7Z453|D3DNE6|F5GWK4|Q6PIL2|Q96D19|Q96HZ5|Q9NV02|Q9NV94|Q9Y4R9	Missense_Mutation	SNP	ENST00000469044.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.6|27.6	4.847353|4.847353	0.91277|0.91277	.|.	.|.	ENSG00000114098|ENSG00000114098	ENST00000469860|ENST00000481646;ENST00000469044;ENST00000491704;ENST00000461600;ENST00000466749;ENST00000358441;ENST00000489213;ENST00000461822;ENST00000485396;ENST00000471453;ENST00000470821;ENST00000471709;ENST00000538260;ENST00000393058	.|T;T;T;T;T;T;T;T;T;T;T;T;T;T	.|0.32272	.|1.46;1.46;1.46;1.46;1.46;1.46;1.46;1.46;1.46;1.46;1.46;1.46;1.46;1.46	5.9|5.9	5.03|5.03	0.67393|0.67393	.|Armadillo-like helical (1);Armadillo-type fold (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.51736|0.51736	0.1692|0.1692	M|M	0.65498|0.65498	2.005|2.005	0.58432|0.58432	D|D	0.999999|0.999999	.|D;D;D;D;D;D;D	.|0.89917	.|1.0;0.999;1.0;0.994;1.0;0.998;1.0	.|D;D;D;D;D;D;D	.|0.79108	.|0.927;0.984;0.973;0.921;0.984;0.986;0.992	T|T	0.50651|0.50651	-0.8803|-0.8803	5|10	.|0.41790	.|T	.|0.15	-20.8022|-20.8022	12.8169|12.8169	0.57671|0.57671	0.0787:0.0:0.9213:0.0|0.0787:0.0:0.9213:0.0	.|.	.|85;127;127;127;113;127;113	.|B7Z637;B7Z441;F5GWK4;Q8IUR7;Q8IUR7-2;G5E9V6;Q8IUR7-6	.|.;.;.;ARMC8_HUMAN;.;.;.	N|Q	15|113;127;85;127;85;113;85;127;85;113;127;127;127;117	.|ENSP00000420333:R113Q;ENSP00000419413:R127Q;ENSP00000417304:R85Q;ENSP00000418074:R127Q;ENSP00000417699:R85Q;ENSP00000351221:R113Q;ENSP00000418412:R85Q;ENSP00000420706:R127Q;ENSP00000417049:R85Q;ENSP00000420440:R113Q;ENSP00000418405:R127Q;ENSP00000420719:R127Q;ENSP00000441592:R127Q;ENSP00000376778:R117Q	.|ENSP00000351221:R113Q	D|R	+|+	1|2	0|0	ARMC8|ARMC8	139425210|139425210	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.953000|0.953000	0.61014|0.61014	9.835000|9.835000	0.99442|0.99442	1.515000|1.515000	0.48885|0.48885	-0.142000|-0.142000	0.14014|0.14014	GAT|CGA	.		0.413	ARMC8-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000357560.1	NM_015396	
PLS1	5357	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	142408558	142408558	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr3:142408558T>A	ENST00000337777.3	+	10	1293	c.1080T>A	c.(1078-1080)aaT>aaA	p.N360K	PLS1_ENST00000457734.2_Missense_Mutation_p.N360K|PLS1_ENST00000497002.1_Missense_Mutation_p.N360K	NM_002670.2	NP_002661.2	Q14651	PLSI_HUMAN	plastin 1	360	Actin-binding 1.|CH 2. {ECO:0000255|PROSITE- ProRule:PRU00044}.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|skin(1)|stomach(1)	27						TTTCAGGCAATCCTAAACTTA	0.413																																					p.N360K		.											.	PLS1-91	0			c.T1080A						.						120.0	112.0	114.0					3																	142408558		2203	4300	6503	SO:0001583	missense	5357	exon10			AGGCAATCCTAAA	L20826	CCDS3125.1	3q23	2013-01-10	2010-02-10		ENSG00000120756	ENSG00000120756		"""EF-hand domain containing"""	9090	protein-coding gene	gene with protein product		602734	"""plastin 1 (I isoform)"""			8139549	Standard	NM_002670		Approved	I-plastin, Plastin-1	uc003euz.3	Q14651	OTTHUMG00000159292	ENST00000337777.3:c.1080T>A	3.37:g.142408558T>A	ENSP00000336831:p.Asn360Lys	Somatic	90	0		WXS	Illumina GAIIx	Phase_I	61	57	NM_001172312	0	0	0	0	0	A8K2Q1|D3DNG3|Q8NEG6	Missense_Mutation	SNP	ENST00000337777.3	37	CCDS3125.1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.092401	0.76756	.	.	ENSG00000120756	ENST00000457734;ENST00000337777;ENST00000497002	D;D;D	0.95518	-3.73;-3.73;-3.73	5.63	1.5	0.22942	Calponin homology domain (5);	0.000000	0.85682	D	0.000000	D	0.97176	0.9077	M	0.87328	2.875	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95550	0.8620	10	0.54805	T	0.06	-22.6394	8.1542	0.31158	0.0:0.4504:0.0:0.5496	.	360	Q14651	PLSI_HUMAN	K	360	ENSP00000387890:N360K;ENSP00000336831:N360K;ENSP00000418700:N360K	ENSP00000336831:N360K	N	+	3	2	PLS1	143891248	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.095000	0.41729	0.274000	0.22072	0.533000	0.62120	AAT	.		0.413	PLS1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354435.1	NM_002670	
TNIK	23043	ucsc.edu;bcgsc.ca	37	3	170789054	170789054	+	Nonsense_Mutation	SNP	A	A	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr3:170789054A>T	ENST00000436636.2	-	29	3851	c.3507T>A	c.(3505-3507)taT>taA	p.Y1169*	TNIK_ENST00000284483.8_Nonsense_Mutation_p.Y1161*|TNIK_ENST00000357327.5_Nonsense_Mutation_p.Y1140*|TNIK_ENST00000460047.1_Nonsense_Mutation_p.Y1106*|TNIK_ENST00000488470.1_Nonsense_Mutation_p.Y1114*|TNIK_ENST00000470834.1_Nonsense_Mutation_p.Y1132*|TNIK_ENST00000538048.1_Nonsense_Mutation_p.Y1121*|TNIK_ENST00000369326.5_Nonsense_Mutation_p.Y1147*|TNIK_ENST00000475336.1_Nonsense_Mutation_p.Y1077*|TNIK_ENST00000341852.6_Nonsense_Mutation_p.Y1085*	NM_015028.2	NP_055843.1	Q9UKE5	TNIK_HUMAN	TRAF2 and NCK interacting kinase	1169	CNH. {ECO:0000255|PROSITE- ProRule:PRU00795}.				actin cytoskeleton reorganization (GO:0031532)|activation of JNKK activity (GO:0007256)|cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of dendrite morphogenesis (GO:0048814)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(22)|ovary(5)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(2)	62	all_cancers(22;2.55e-19)|all_lung(20;2.22e-14)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)			GAGCCCAAGCATATATTTCCA	0.308																																					p.Y1169X		.											.	TNIK-550	0			c.T3507A						.						74.0	69.0	71.0					3																	170789054		1812	4067	5879	SO:0001587	stop_gained	23043	exon29			CCAAGCATATATT	AF172264	CCDS46956.1, CCDS54673.1, CCDS54674.1, CCDS54675.1, CCDS54676.1, CCDS54677.1, CCDS54678.1, CCDS54679.1	3q26.31	2008-01-23			ENSG00000154310	ENSG00000154310			30765	protein-coding gene	gene with protein product		610005				9628581, 10521462	Standard	NR_027767		Approved	KIAA0551	uc003fhh.2	Q9UKE5	OTTHUMG00000159036	ENST00000436636.2:c.3507T>A	3.37:g.170789054A>T	ENSP00000399511:p.Tyr1169*	Somatic	44	0		WXS	Illumina GAIIx	Phase_I	36	4	NM_015028	0	0	0	0	0	A7E2A3|A8K4U1|D3DNQ6|O60298|Q8WUY7|Q9UKD8|Q9UKD9|Q9UKE0|Q9UKE1|Q9UKE2|Q9UKE3|Q9UKE4	Nonsense_Mutation	SNP	ENST00000436636.2	37	CCDS46956.1	.	.	.	.	.	.	.	.	.	.	A	42	9.478230	0.99183	.	.	ENSG00000154310	ENST00000436636;ENST00000369326;ENST00000538048;ENST00000341852;ENST00000284483;ENST00000475336;ENST00000357327;ENST00000460047;ENST00000488470;ENST00000470834	.	.	.	5.89	0.569	0.17340	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.2243	0.48875	0.6222:0.0:0.3778:0.0	.	.	.	.	X	1169;1147;1121;1085;1161;1077;1140;1106;1114;1132	.	ENSP00000284483:Y1161X	Y	-	3	2	TNIK	172271748	0.999000	0.42202	0.988000	0.46212	0.977000	0.68977	0.777000	0.26718	-0.115000	0.11915	0.482000	0.46254	TAT	.		0.308	TNIK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000352973.2	XM_039796	
MAEA	10296	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	1305792	1305792	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr4:1305792G>A	ENST00000303400.4	+	2	158	c.95G>A	c.(94-96)cGc>cAc	p.R32H	MAEA_ENST00000452175.2_Missense_Mutation_p.R21H|MAEA_ENST00000514708.1_Missense_Mutation_p.R32H|MAEA_ENST00000505839.1_5'UTR|MAEA_ENST00000510794.1_Missense_Mutation_p.R31H|MAEA_ENST00000505177.2_Missense_Mutation_p.R32H|MAEA_ENST00000264750.6_Missense_Mutation_p.R32H	NM_001017405.1	NP_001017405.1	Q7L5Y9	MAEA_HUMAN	macrophage erythroblast attacher	32	Extracellular and involved in cell to cell contact.			R -> C (in Ref. 1; AAP74806). {ECO:0000305}.	cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell division (GO:0051301)|cytoskeleton organization (GO:0007010)|enucleate erythrocyte development (GO:0048822)|erythrocyte maturation (GO:0043249)|negative regulation of myeloid cell apoptotic process (GO:0033033)|regulation of mitotic cell cycle (GO:0007346)	actomyosin contractile ring (GO:0005826)|cytoskeleton (GO:0005856)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(2)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(2)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	18			OV - Ovarian serous cystadenocarcinoma(23;0.0201)		WF10(DB05389)	CTGAACAAACGCTTTCGCGCC	0.642																																					p.R32H		.											.	MAEA-91	0			c.G95A						.						75.0	58.0	64.0					4																	1305792		2203	4300	6503	SO:0001583	missense	10296	exon2			ACAAACGCTTTCG	AF084928	CCDS33936.1, CCDS33937.1, CCDS75090.1	4p16.3	2012-07-20			ENSG00000090316	ENSG00000090316			13731	protein-coding gene	gene with protein product	"""GID complex subunit 9, FYV10 homolog (S. cerevisiae)"""	606801				9763581	Standard	XM_005272243		Approved	EMP, GID9	uc003gda.3	Q7L5Y9	OTTHUMG00000160169	ENST00000303400.4:c.95G>A	4.37:g.1305792G>A	ENSP00000302830:p.Arg32His	Somatic	375	2		WXS	Illumina GAIIx	Phase_I	392	178	NM_005882	0	0	15	36	21	O95285|Q5JB54|Q6ZRD6|Q9BQ11|Q9H9V6|Q9H9Z4|Q9NW84	Missense_Mutation	SNP	ENST00000303400.4	37	CCDS33936.1	.	.	.	.	.	.	.	.	.	.	G	27.0	4.793789	0.90453	.	.	ENSG00000090316	ENST00000303400;ENST00000505177;ENST00000503653;ENST00000264750;ENST00000382947;ENST00000539495;ENST00000502558;ENST00000452175;ENST00000514708;ENST00000510794	T;T;T;T;T;T;T;T	0.47528	0.9;0.88;0.84;0.89;0.87;0.88;0.87;0.9	5.95	4.21	0.49690	.	0.000000	0.85682	D	0.000000	T	0.66519	0.2797	M	0.77616	2.38	0.38499	D	0.948175	D;D;D;P;D;D	0.89917	1.0;1.0;0.999;0.549;0.998;0.998	P;D;D;B;D;P	0.69142	0.875;0.962;0.941;0.129;0.941;0.899	T	0.72364	-0.4316	10	0.51188	T	0.08	.	12.8671	0.57946	0.1339:0.0:0.8661:0.0	.	31;32;32;32;32;32	B4DVN3;E7ESC7;Q7L5Y9-2;D6RIB6;Q7L5Y9-3;Q7L5Y9	.;.;.;.;.;MAEA_HUMAN	H	32;32;32;32;32;32;32;21;32;31	ENSP00000302830:R32H;ENSP00000422215:R32H;ENSP00000421644:R32H;ENSP00000264750:R32H;ENSP00000426903:R32H;ENSP00000411415:R21H;ENSP00000427512:R32H;ENSP00000426807:R31H	ENSP00000264750:R32H	R	+	2	0	MAEA	1295792	1.000000	0.71417	1.000000	0.80357	0.682000	0.39822	7.639000	0.83342	1.514000	0.48869	0.655000	0.94253	CGC	.		0.642	MAEA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359511.1	NM_005882	
CRIPAK	285464	bcgsc.ca	37	4	1388817	1388817	+	Missense_Mutation	SNP	C	C	G	rs200606324	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr4:1388817C>G	ENST00000324803.4	+	1	3478	c.518C>G	c.(517-519)cCa>cGa	p.P173R		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	173					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			CACACGTGCCCATGTGGAGTG	0.677													N|||	940	0.1877	0.3328	0.1398	5008	,	,		18475	0.0992		0.0378	False		,,,				2504	0.271				p.P173R		.											.	CRIPAK-90	0			c.C518G						.						192.0	130.0	151.0					4																	1388817		2194	4201	6395	SO:0001583	missense	285464	exon1			CGTGCCCATGTGG	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.518C>G	4.37:g.1388817C>G	ENSP00000323978:p.Pro173Arg	Somatic	74	1		WXS	Illumina GAIIx	Phase_I	193	35	NM_175918	0	0	50	51	1	Q8NB03	Missense_Mutation	SNP	ENST00000324803.4	37	CCDS3349.1	.	.	.	.	.	.	.	.	.	.	c	1.909	-0.451230	0.04572	.	.	ENSG00000179979	ENST00000324803	T	0.19250	2.16	1.25	0.276	0.15663	Post-SET domain (1);	.	.	.	.	T	0.08358	0.0208	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.40079	-0.9582	9	0.17369	T	0.5	.	4.4738	0.11726	0.0:0.5796:0.2425:0.1779	.	173	Q8N1N5	CRPAK_HUMAN	R	173	ENSP00000323978:P173R	ENSP00000323978:P173R	P	+	2	0	CRIPAK	1378817	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.368000	0.07543	-0.338000	0.08413	-1.976000	0.00459	CCA	CATGT|0.500;GACGC|0.500		0.677	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
CRIPAK	285464	bcgsc.ca	37	4	1388819	1388819	+	Missense_Mutation	SNP	T	T	C	rs144797159	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr4:1388819T>C	ENST00000324803.4	+	1	3480	c.520T>C	c.(520-522)Tgt>Cgt	p.C174R		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	174					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			CACGTGCCCATGTGGAGTGCC	0.677													N|||	940	0.1877	0.3328	0.1398	5008	,	,		17297	0.0992		0.0378	False		,,,				2504	0.271				p.C174R		.											.	CRIPAK-90	0			c.T520C						.						191.0	130.0	151.0					4																	1388819		2194	4196	6390	SO:0001583	missense	285464	exon1			TGCCCATGTGGAG	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.520T>C	4.37:g.1388819T>C	ENSP00000323978:p.Cys174Arg	Somatic	80	1		WXS	Illumina GAIIx	Phase_I	195	31	NM_175918	0	0	46	46	0	Q8NB03	Missense_Mutation	SNP	ENST00000324803.4	37	CCDS3349.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	t|t	2.950|2.950	-0.216975|-0.216975	0.06101|0.06101	.|.	.|.	ENSG00000179979|ENSG00000179979	ENST00000324803|ENST00000382944	T|.	0.29142|.	1.58|.	1.25|1.25	-0.146|-0.146	0.13432|0.13432	Post-SET domain (1);|.	.|.	.|.	.|.	.|.	T|T	0.15825|0.15825	0.0381|0.0381	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B|.	0.20052|.	0.041|.	B|.	0.11329|.	0.006|.	T|T	0.24977|0.24977	-1.0145|-1.0145	9|6	0.66056|0.27082	D|T	0.02|0.32	.|.	4.6847|4.6847	0.12752|0.12752	0.0:0.2124:0.0:0.7876|0.0:0.2124:0.0:0.7876	.|.	174|.	Q8N1N5|.	CRPAK_HUMAN|.	R|T	174|157	ENSP00000323978:C174R|.	ENSP00000323978:C174R|ENSP00000372402:M157T	C|M	+|+	1|2	0|0	CRIPAK|CRIPAK	1378819|1378819	0.000000|0.000000	0.05858|0.05858	0.003000|0.003000	0.11579|0.11579	0.014000|0.014000	0.08584|0.08584	-0.160000|-0.160000	0.10041|0.10041	-0.013000|-0.013000	0.14199|0.14199	0.102000|0.102000	0.15555|0.15555	TGT|ATG	T|0.950;C|0.050		0.677	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
LETM1	3954	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	1836604	1836604	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr4:1836604C>T	ENST00000302787.2	-	5	1140	c.844G>A	c.(844-846)Gcc>Acc	p.A282T		NM_012318.2	NP_036450.1	O95202	LETM1_HUMAN	leucine zipper-EF-hand containing transmembrane protein 1	282	LETM1.				cristae formation (GO:0042407)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(2)|large_intestine(3)|lung(3)|prostate(1)|urinary_tract(1)	13			all cancers(2;0.00756)|OV - Ovarian serous cystadenocarcinoma(23;0.00989)|Epithelial(3;0.0141)			TCTTTGGTGGCGCTGCCCTTG	0.547																																					p.A282T		.											.	LETM1-90	0			c.G844A						.						131.0	114.0	120.0					4																	1836604		2203	4300	6503	SO:0001583	missense	3954	exon5			TGGTGGCGCTGCC	AF061025	CCDS3355.1	4p16.3	2013-01-10			ENSG00000168924	ENSG00000168924		"""EF-hand domain containing"""	6556	protein-coding gene	gene with protein product	"""Mdm38 homolog (yeast)"""	604407				10486213	Standard	NM_012318		Approved		uc003gdv.3	O95202	OTTHUMG00000121149	ENST00000302787.2:c.844G>A	4.37:g.1836604C>T	ENSP00000305653:p.Ala282Thr	Somatic	163	0		WXS	Illumina GAIIx	Phase_I	163	71	NM_012318	0	0	17	26	9	B4DED2|Q9UF65	Missense_Mutation	SNP	ENST00000302787.2	37	CCDS3355.1	.	.	.	.	.	.	.	.	.	.	c	21.9	4.222550	0.79464	.	.	ENSG00000168924	ENST00000302787;ENST00000417150	T	0.45276	0.9	5.2	5.2	0.72013	LETM1-like (1);	0.221262	0.41294	D	0.000910	T	0.41236	0.1150	N	0.19112	0.55	0.43010	D	0.994545	D;P;D	0.61080	0.989;0.954;0.979	P;B;P	0.52758	0.708;0.285;0.59	T	0.16100	-1.0414	10	0.20519	T	0.43	-22.7535	18.7392	0.91767	0.0:1.0:0.0:0.0	.	282;242;282	O95202-3;O95202-2;O95202	.;.;LETM1_HUMAN	T	282;242	ENSP00000305653:A282T	ENSP00000305653:A282T	A	-	1	0	LETM1	1806402	1.000000	0.71417	0.937000	0.37676	0.983000	0.72400	7.229000	0.78088	2.433000	0.82419	0.486000	0.48141	GCC	.		0.547	LETM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241634.1		
DOK7	285489	broad.mit.edu	37	4	3494664	3494664	+	Silent	SNP	A	A	C			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr4:3494664A>C	ENST00000340083.5	+	7	1016	c.951A>C	c.(949-951)ccA>ccC	p.P317P	DOK7_ENST00000389653.2_Silent_p.P317P|DOK7_ENST00000507039.1_3'UTR|DOK7_ENST00000512714.1_3'UTR	NM_173660.4	NP_775931.3	Q18PE1	DOK7_HUMAN	docking protein 7	317	Ser-rich.				neuromuscular junction development (GO:0007528)|positive regulation of protein tyrosine kinase activity (GO:0061098)|receptor clustering (GO:0043113)	cell junction (GO:0030054)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)|protein kinase binding (GO:0019901)			kidney(1)|large_intestine(1)|skin(2)|upper_aerodigestive_tract(1)	5				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		CCTCAAGGCCACCCCCCAAGC	0.692																																					p.P317P		.											.	DOK7-91	0			c.A951C						.						7.0	8.0	7.0					4																	3494664		2122	4167	6289	SO:0001819	synonymous_variant	285489	exon7			AAGGCCACCCCCC	AK091037	CCDS3370.2, CCDS54717.1	4p16.2	2014-09-17	2006-08-24	2006-08-24	ENSG00000175920	ENSG00000175920			26594	protein-coding gene	gene with protein product		610285	"""chromosome 4 open reading frame 25"""	C4orf25		16794080	Standard	NM_173660		Approved	FLJ33718, FLJ39137, Dok-7	uc003ghd.3	Q18PE1	OTTHUMG00000122087	ENST00000340083.5:c.951A>C	4.37:g.3494664A>C		Somatic	28	2		WXS	Illumina GAIIx	Phase_I	116	23	NM_173660	0	0	0	0	0	A2A499|A2RRD4|E9PB56|Q6P6A6|Q86XG5|Q8N2J3|Q8NBC1	Silent	SNP	ENST00000340083.5	37	CCDS3370.2																																																																																			.		0.692	DOK7-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000313538.1	NM_173660	
STX18	53407	broad.mit.edu	37	4	4461210	4461210	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr4:4461210T>C	ENST00000306200.2	-	3	304	c.241A>G	c.(241-243)Acc>Gcc	p.T81A	STX18_ENST00000505286.1_Missense_Mutation_p.T81A	NM_016930.2	NP_058626.1	Q9P2W9	STX18_HUMAN	syntaxin 18	81					ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)	5				UCEC - Uterine corpus endometrioid carcinoma (64;0.0534)		TCAGACAtggtatggctaaaa	0.453																																					p.T81A		.											.	STX18-90	0			c.A241G						.						190.0	174.0	179.0					4																	4461210		2203	4300	6503	SO:0001583	missense	53407	exon3			ACATGGTATGGCT	AB028741	CCDS3377.1	4p16.3-p16.2	2013-09-23			ENSG00000168818	ENSG00000168818			15942	protein-coding gene	gene with protein product		606046				10788491	Standard	NM_016930		Approved	Ufe1	uc003gic.3	Q9P2W9	OTTHUMG00000090331	ENST00000306200.2:c.241A>G	4.37:g.4461210T>C	ENSP00000305810:p.Thr81Ala	Somatic	144	0		WXS	Illumina GAIIx	Phase_I	216	5	NM_016930	0	0	0	0	0	Q596L3|Q5TZP5	Missense_Mutation	SNP	ENST00000306200.2	37	CCDS3377.1	.	.	.	.	.	.	.	.	.	.	T	6.624	0.483563	0.12581	.	.	ENSG00000168818	ENST00000505286;ENST00000306200	T;T	0.29142	1.58;1.58	5.07	1.09	0.20402	SNARE-complex protein Syntaxin-18 N-terminal (1);	0.498830	0.24037	N	0.042127	T	0.15089	0.0364	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.26430	-1.0103	10	0.19590	T	0.45	-18.1783	9.1215	0.36791	0.0:0.4048:0.0:0.5952	.	81	Q9P2W9	STX18_HUMAN	A	81	ENSP00000426648:T81A;ENSP00000305810:T81A	ENSP00000305810:T81A	T	-	1	0	STX18	4512111	0.335000	0.24748	0.727000	0.30756	0.646000	0.38490	0.276000	0.18716	-0.029000	0.13827	0.418000	0.28097	ACC	.		0.453	STX18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206696.1		
EVC	2121	bcgsc.ca	37	4	5800494	5800494	+	Missense_Mutation	SNP	G	G	A	rs2279252	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr4:5800494G>A	ENST00000264956.6	+	15	2463	c.2279G>A	c.(2278-2280)cGg>cAg	p.R760Q	EVC_ENST00000515113.1_3'UTR|EVC_ENST00000382674.2_Missense_Mutation_p.R760Q	NM_153717.2	NP_714928.1	P57679	EVC_HUMAN	Ellis van Creveld syndrome	760			R -> Q (in dbSNP:rs2279252). {ECO:0000269|PubMed:10700184}.		cartilage development (GO:0051216)|endochondral bone growth (GO:0003416)|muscle organ development (GO:0007517)|positive regulation of smoothened signaling pathway (GO:0045880)|skeletal system development (GO:0001501)|smoothened signaling pathway (GO:0007224)	ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|endometrium(2)|large_intestine(10)|lung(11)|ovary(1)|skin(1)|stomach(1)	28		Myeloproliferative disorder(84;0.117)				ACCAAGAGCCGGGCCAAGGAC	0.632													G|||	138	0.0275559	0.0008	0.0231	5008	,	,		19605	0.0556		0.0119	False		,,,				2504	0.0542				p.R760Q		.											.	EVC-92	0			c.G2279A						.	G	GLN/ARG	11,4351		0,11,2170	23.0	20.0	21.0		2279	4.2	1.0	4	dbSNP_100	21	121,8417		1,119,4149	yes	missense	EVC	NM_153717.2	43	1,130,6319	AA,AG,GG		1.4172,0.2522,1.0233	probably-damaging	760/993	5800494	132,12768	2181	4269	6450	SO:0001583	missense	2121	exon15			AGAGCCGGGCCAA	AF216184	CCDS3383.1	4p16	2008-07-03			ENSG00000072840	ENSG00000072840			3497	protein-coding gene	gene with protein product		604831				10700184	Standard	NM_153717		Approved	DWF-1	uc003gil.1	P57679	OTTHUMG00000090427	ENST00000264956.6:c.2279G>A	4.37:g.5800494G>A	ENSP00000264956:p.Arg760Gln	Somatic	372	4		WXS	Illumina GAIIx	Phase_I	520	207	NM_153717	0	0	0	0	0		Missense_Mutation	SNP	ENST00000264956.6	37	CCDS3383.1	51	0.023351648351648352	0	0.0	8	0.022099447513812154	31	0.05419580419580419	12	0.0158311345646438	G	9.827	1.187415	0.21870	0.002522	0.014172	ENSG00000072840	ENST00000264956;ENST00000382674	T;T	0.52754	0.65;0.65	5.08	4.22	0.49857	.	0.389162	0.26331	N	0.024982	T	0.09113	0.0225	M	0.62723	1.935	0.33377	D	0.574385	P	0.50272	0.933	B	0.44044	0.439	T	0.30794	-0.9966	10	0.11794	T	0.64	.	6.9767	0.24679	0.0917:0.0:0.7384:0.1699	rs2279252;rs52809221;rs2279252	760	P57679	EVC_HUMAN	Q	760	ENSP00000264956:R760Q;ENSP00000372120:R760Q	ENSP00000264956:R760Q	R	+	2	0	EVC	5851395	0.590000	0.26815	0.984000	0.44739	0.594000	0.36715	2.223000	0.42936	2.355000	0.79922	0.561000	0.74099	CGG	G|0.980;A|0.020		0.632	EVC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206859.1		
SOD3	6649	hgsc.bcm.edu	37	4	24801354	24801354	+	Silent	SNP	C	C	T	rs8192291	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr4:24801354C>T	ENST00000382120.3	+	2	416	c.211C>T	c.(211-213)Ctg>Ttg	p.L71L		NM_003102.2	NP_003093.2	P08294	SODE_HUMAN	superoxide dismutase 3, extracellular	71					removal of superoxide radicals (GO:0019430)|response to copper ion (GO:0046688)|response to hypoxia (GO:0001666)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	copper ion binding (GO:0005507)|heparin binding (GO:0008201)|superoxide dismutase activity (GO:0004784)|zinc ion binding (GO:0008270)			prostate(1)|urinary_tract(1)	2		Breast(46;0.0503)				GTCGGCCACGCTGGACGCCGC	0.726													C|||	994	0.198482	0.0968	0.1585	5008	,	,		11823	0.3512		0.2028	False		,,,				2504	0.2025				p.L71L		.											.	SOD3-90	0			c.C211T						.	C		341,3293		12,317,1488	4.0	5.0	5.0		211	0.7	0.0	4	dbSNP_117	5	1103,6325		63,977,2674	no	coding-synonymous	SOD3	NM_003102.2		75,1294,4162	TT,TC,CC		14.8492,9.3836,13.0537		71/241	24801354	1444,9618	1817	3714	5531	SO:0001819	synonymous_variant	6649	exon2			GCCACGCTGGACG		CCDS3430.1	4p15.2	2012-09-20			ENSG00000109610	ENSG00000109610	1.15.1.1		11181	protein-coding gene	gene with protein product		185490					Standard	NM_003102		Approved	EC-SOD	uc003gqz.3	P08294	OTTHUMG00000128565	ENST00000382120.3:c.211C>T	4.37:g.24801354C>T		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	25	12	NM_003102	0	0	3	3	0	Q5U781|Q6FHA2	Silent	SNP	ENST00000382120.3	37	CCDS3430.1																																																																																			C|0.777;T|0.223		0.726	SOD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250416.1		
ANAPC4	29945	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	25419944	25419944	+	Silent	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr4:25419944C>T	ENST00000315368.3	+	29	2509	c.2367C>T	c.(2365-2367)gcC>gcT	p.A789A	ANAPC4_ENST00000510092.1_Silent_p.A790A	NM_013367.2	NP_037499.2	Q9UJX5	APC4_HUMAN	anaphase promoting complex subunit 4	789					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(2)	27		Breast(46;0.0503)				CTGGTGCTGCCGCTTTAGCTC	0.438																																					p.A789A		.											.	ANAPC4-293	0			c.C2367T						.						79.0	84.0	82.0					4																	25419944		2203	4300	6503	SO:0001819	synonymous_variant	29945	exon29			TGCTGCCGCTTTA	AF191338	CCDS3434.1, CCDS68684.1	4p15.31	2011-06-15			ENSG00000053900	ENSG00000053900		"""Anaphase promoting complex subunits"""	19990	protein-coding gene	gene with protein product		606947				6180011	Standard	NM_013367		Approved	APC4	uc003gro.3	Q9UJX5	OTTHUMG00000097753	ENST00000315368.3:c.2367C>T	4.37:g.25419944C>T		Somatic	104	0		WXS	Illumina GAIIx	Phase_I	162	66	NM_013367	0	0	12	25	13	A8K8H1|E9PCR4|Q6PCC6|Q9NSH6	Silent	SNP	ENST00000315368.3	37	CCDS3434.1																																																																																			.		0.438	ANAPC4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000214986.1	NM_013367	
SRP72	6731	bcgsc.ca;mdanderson.org	37	4	57350950	57350950	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr4:57350950G>A	ENST00000342756.5	+	10	1727	c.1006G>A	c.(1006-1008)Gag>Aag	p.E336K	SRP72_ENST00000510663.1_Missense_Mutation_p.E275K	NM_006947.3	NP_008878.3	O76094	SRP72_HUMAN	signal recognition particle 72kDa	336					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|response to drug (GO:0042493)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|signal recognition particle, endoplasmic reticulum targeting (GO:0005786)	7S RNA binding (GO:0008312)|poly(A) RNA binding (GO:0044822)|signal recognition particle binding (GO:0005047)			breast(2)|endometrium(4)|kidney(1)|large_intestine(4)|liver(2)|lung(7)|ovary(2)	22	Glioma(25;0.08)|all_neural(26;0.101)					CCAAAGTCCCGAGCATCTCTT	0.413																																					p.E336K		.											.	SRP72-116	0			c.G1006A						.						113.0	106.0	108.0					4																	57350950		2203	4300	6503	SO:0001583	missense	6731	exon10			AGTCCCGAGCATC	AF069765	CCDS3506.1, CCDS58898.1	4q11	2013-01-10	2002-08-29		ENSG00000174780	ENSG00000174780		"""Tetratricopeptide (TTC) repeat domain containing"""	11303	protein-coding gene	gene with protein product		602122	"""signal recognition particle 72kD"""			9224693, 9857079	Standard	NM_006947		Approved		uc003hbv.3	O76094	OTTHUMG00000128843	ENST00000342756.5:c.1006G>A	4.37:g.57350950G>A	ENSP00000342181:p.Glu336Lys	Somatic	51	1		WXS	Illumina GAIIx	Phase_I	72	36	NM_006947	0	0	21	37	16	G5E9Z8|Q7Z3C0	Missense_Mutation	SNP	ENST00000342756.5	37	CCDS3506.1	.	.	.	.	.	.	.	.	.	.	G	14.23	2.473826	0.43942	.	.	ENSG00000174780	ENST00000342756;ENST00000537129;ENST00000510663;ENST00000505314	T;T	0.76186	-1.0;1.21	5.62	5.62	0.85841	.	0.383379	0.33144	N	0.005233	T	0.61937	0.2387	L	0.36672	1.1	0.39784	D	0.972333	P;B;B	0.38370	0.628;0.005;0.389	B;B;B	0.26693	0.072;0.004;0.023	T	0.63924	-0.6527	10	0.27082	T	0.32	.	17.1395	0.86749	0.0:0.0:1.0:0.0	.	275;336;336	G5E9Z8;Q86X80;O76094	.;.;SRP72_HUMAN	K	336;281;275;97	ENSP00000342181:E336K;ENSP00000424576:E275K	ENSP00000342181:E336K	E	+	1	0	SRP72	57045707	1.000000	0.71417	0.996000	0.52242	0.995000	0.86356	5.323000	0.65858	2.630000	0.89119	0.655000	0.94253	GAG	.		0.413	SRP72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250782.7		
PF4	5196	broad.mit.edu;bcgsc.ca	37	4	74847662	74847662	+	Silent	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr4:74847662G>A	ENST00000296029.3	-	1	179	c.9C>T	c.(7-9)tcC>tcT	p.S3S		NM_002619.3	NP_002610.1	P02776	PLF4_HUMAN	platelet factor 4	3					blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|leukocyte chemotaxis (GO:0030595)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cytolysis (GO:0045918)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of megakaryocyte differentiation (GO:0045653)|negative regulation of MHC class II biosynthetic process (GO:0045347)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cAMP metabolic process (GO:0030816)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of gene expression (GO:0010628)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cell proliferation (GO:0042127)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|platelet alpha granule lumen (GO:0031093)	chemokine activity (GO:0008009)|CXCR3 chemokine receptor binding (GO:0048248)|heparin binding (GO:0008201)			kidney(1)|lung(1)	2	Breast(15;0.00136)		all cancers(17;0.0034)|Lung(101;0.196)		Drotrecogin alfa(DB00055)	ACCCGGCTGCGGAGCTCATGC	0.657																																					p.S3S		.											.	PF4-90	0			c.C9T						.						13.0	16.0	15.0					4																	74847662		1839	3391	5230	SO:0001819	synonymous_variant	5196	exon1			GGCTGCGGAGCTC	M25897	CCDS3562.1	4q12-q21	2012-10-02	2008-08-29		ENSG00000163737	ENSG00000163737			8861	protein-coding gene	gene with protein product	"""chemokine (C-X-C motif) ligand 4"""	173460	"""platelet factor 4"""			3622011	Standard	NM_002619		Approved	SCYB4, CXCL4	uc003hhi.3	P02776	OTTHUMG00000130009	ENST00000296029.3:c.9C>T	4.37:g.74847662G>A		Somatic	325	0		WXS	Illumina GAIIx	Phase_I	427	11	NM_002619	0	0	0	0	0	Q53X61|Q9UC64|Q9UC65	Silent	SNP	ENST00000296029.3	37	CCDS3562.1																																																																																			.		0.657	PF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252282.1		
FRAS1	80144	broad.mit.edu	37	4	79393383	79393383	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr4:79393383C>A	ENST00000264895.6	+	52	7861	c.7421C>A	c.(7420-7422)aCc>aAc	p.T2474N		NM_025074.6	NP_079350.5	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	2474					cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						GACCCAGACACCGAGGACGCG	0.512																																					p.T2474N		.											.	FRAS1-68	0			c.C7421A						.						62.0	65.0	64.0					4																	79393383		2004	4168	6172	SO:0001583	missense	80144	exon52			CAGACACCGAGGA	AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000264895.6:c.7421C>A	4.37:g.79393383C>A	ENSP00000264895:p.Thr2474Asn	Somatic	217	0		WXS	Illumina GAIIx	Phase_I	310	7	NM_025074	0	0	0	0	0	A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Missense_Mutation	SNP	ENST00000264895.6	37	CCDS54771.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.93|16.93	3.257903|3.257903	0.59321|0.59321	.|.	.|.	ENSG00000138759|ENSG00000138759	ENST00000512123|ENST00000264895	.|T	.|0.43294	.|0.95	5.09|5.09	5.09|5.09	0.68999|0.68999	.|.	.|0.112204	.|0.64402	.|D	.|0.000013	T|T	0.66096|0.66096	0.2755|0.2755	M|M	0.75447|0.75447	2.3|2.3	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.73708	.|0.981	T|T	0.69873|0.69873	-0.5027|-0.5027	5|10	.|0.87932	.|D	.|0	.|.	18.698|18.698	0.91610|0.91610	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|2474	.|E9PHH6	.|.	Q|N	702|2474	.|ENSP00000264895:T2474N	.|ENSP00000264895:T2474N	H|T	+|+	3|2	2|0	FRAS1|FRAS1	79612407|79612407	1.000000|1.000000	0.71417|0.71417	0.949000|0.949000	0.38748|0.38748	0.061000|0.061000	0.15899|0.15899	7.542000|7.542000	0.82095|0.82095	2.625000|2.625000	0.88918|0.88918	0.655000|0.655000	0.94253|0.94253	CAC|ACC	.		0.512	FRAS1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
COL25A1	84570	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	109810390	109810390	+	Missense_Mutation	SNP	C	C	T	rs542832525		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr4:109810390C>T	ENST00000399132.1	-	18	1492	c.962G>A	c.(961-963)cGt>cAt	p.R321H	COL25A1_ENST00000399127.1_Missense_Mutation_p.R317H|COL25A1_ENST00000399126.1_Missense_Mutation_p.R321H	NM_198721.2	NP_942014.1			collagen, type XXV, alpha 1											NS(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(19)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	49		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000173)		TTGCCCTGGACGACCAGATTC	0.383													C|||	1	0.000199681	0.0	0.0	5008	,	,		17522	0.0		0.0	False		,,,				2504	0.001				p.R321H		.											.	COL25A1-92	0			c.G962A						.						159.0	160.0	160.0					4																	109810390		1846	4087	5933	SO:0001583	missense	84570	exon17			CCTGGACGACCAG	AF293340	CCDS43258.1, CCDS43259.1, CCDS58922.1	4q25	2013-01-16			ENSG00000188517	ENSG00000188517		"""Collagens"""	18603	protein-coding gene	gene with protein product		610004				11927537	Standard	NM_001256074		Approved		uc003hze.2	Q9BXS0	OTTHUMG00000150039	ENST00000399132.1:c.962G>A	4.37:g.109810390C>T	ENSP00000382083:p.Arg321His	Somatic	67	0		WXS	Illumina GAIIx	Phase_I	100	42	NM_198721	0	0	0	0	0		Missense_Mutation	SNP	ENST00000399132.1	37	CCDS43258.1	.	.	.	.	.	.	.	.	.	.	C	12.39	1.925081	0.34002	.	.	ENSG00000188517	ENST00000399132;ENST00000333642;ENST00000401873;ENST00000399127;ENST00000399126;ENST00000443653	T;T;T	0.23754	1.89;1.89;1.89	5.64	4.8	0.61643	.	0.067490	0.64402	D	0.000012	T	0.30324	0.0761	L	0.45422	1.42	0.37651	D	0.922417	P;D	0.59767	0.584;0.986	B;P	0.49853	0.054;0.624	T	0.14868	-1.0457	9	.	.	.	-6.6948	13.6859	0.62515	0.0:0.9257:0.0:0.0743	.	321;321	Q9BXS0-2;Q9BXS0	.;COPA1_HUMAN	H	321;323;317;317;321;251	ENSP00000382083:R321H;ENSP00000382078:R317H;ENSP00000382077:R321H	.	R	-	2	0	COL25A1	110029839	1.000000	0.71417	0.998000	0.56505	0.891000	0.51852	4.171000	0.58236	1.391000	0.46566	-0.266000	0.10368	CGT	.		0.383	COL25A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315938.2	NM_032518	
LARP7	51574	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	113570694	113570694	+	Silent	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr4:113570694C>T	ENST00000344442.5	+	9	1424	c.1146C>T	c.(1144-1146)agC>agT	p.S382S	MIR302B_ENST00000509938.1_RNA|MIR302C_ENST00000362232.1_RNA|MIR367_ENST00000362299.1_RNA|LARP7_ENST00000509061.1_Silent_p.S389S|MIR302A_ENST00000385192.1_RNA|LARP7_ENST00000324052.6_Silent_p.S382S|MIR302B_ENST00000505215.1_RNA|MIR302B_ENST00000510655.1_RNA|MIR302B_ENST00000362188.1_RNA|MIR302D_ENST00000362275.1_RNA	NM_016648.3	NP_057732.2	Q4G0J3	LARP7_HUMAN	La ribonucleoprotein domain family, member 7	382					RNA processing (GO:0006396)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(2)|lung(8)|ovary(4)|skin(1)	17		Ovarian(17;0.0443)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000603)		CTTGTAGGAGCGAATGGATGG	0.318																																					p.S389S		.											.	LARP7-93	0			c.C1167T						.						28.0	27.0	28.0					4																	113570694		2202	4294	6496	SO:0001819	synonymous_variant	51574	exon11			TAGGAGCGAATGG	AF068284	CCDS3701.2, CCDS58924.1	4q25	2013-02-12			ENSG00000174720	ENSG00000174720		"""La ribonucleoprotein domain containing"", ""RNA binding motif (RRM) containing"""	24912	protein-coding gene	gene with protein product	"""P-TEFb-interaction protein for 7SK stability"""	612026				18191186, 18249148, 18281698, 22865833, 22488152	Standard	NM_016648		Approved	HDCMA18P, PIP7S, DKFZP564K112	uc003ibb.4	Q4G0J3	OTTHUMG00000132909	ENST00000344442.5:c.1146C>T	4.37:g.113570694C>T		Somatic	175	0		WXS	Illumina GAIIx	Phase_I	261	26	NM_001267039	0	0	0	0	0	B2ZHN6|Q3B7A9|Q9P1S7|Q9Y3Z8	Silent	SNP	ENST00000344442.5	37	CCDS3701.2	.	.	.	.	.	.	.	.	.	.	C	11.79	1.743840	0.30865	.	.	ENSG00000174720	ENST00000511529	.	.	.	5.46	-6.07	0.02158	.	.	.	.	.	T	0.52821	0.1758	.	.	.	0.50632	D	0.999889	.	.	.	.	.	.	T	0.55218	-0.8175	4	.	.	.	-0.8882	10.6906	0.45869	0.1839:0.0839:0.0:0.7322	.	.	.	.	V	176	.	.	A	+	2	0	LARP7	113790143	0.000000	0.05858	0.002000	0.10522	0.886000	0.51366	-1.250000	0.02885	-1.549000	0.01710	-0.218000	0.12543	GCG	.		0.318	LARP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256417.2	NM_016648	
FABP2	2169	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	120240719	120240719	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr4:120240719C>T	ENST00000274024.3	-	3	607	c.320G>A	c.(319-321)cGa>cAa	p.R107Q		NM_000134.3	NP_000125.2	P12104	FABPI_HUMAN	fatty acid binding protein 2, intestinal	107					digestion (GO:0007586)	cytoplasm (GO:0005737)	fatty acid binding (GO:0005504)|transporter activity (GO:0005215)	p.R107I(1)		breast(1)|large_intestine(4)|lung(1)|ovary(1)|pancreas(1)	8					Estradiol(DB00783)|Ibuprofen(DB01050)|Sulfinpyrazone(DB01138)	TATAATTTCTCGGACAGTATT	0.333																																					p.R107Q		.											.	FABP2-91	1	Substitution - Missense(1)	lung(1)	c.G320A						.						130.0	122.0	125.0					4																	120240719		2203	4300	6503	SO:0001583	missense	2169	exon3			ATTTCTCGGACAG	J03465	CCDS3712.1	4q28-q31	2013-03-01			ENSG00000145384	ENSG00000145384		"""Fatty acid binding protein family"""	3556	protein-coding gene	gene with protein product		134640					Standard	NM_000134		Approved	I-FABP	uc003icw.3	P12104	OTTHUMG00000132972	ENST00000274024.3:c.320G>A	4.37:g.120240719C>T	ENSP00000274024:p.Arg107Gln	Somatic	63	0		WXS	Illumina GAIIx	Phase_I	76	29	NM_000134	0	0	7	35	28	Q2NKJ1	Missense_Mutation	SNP	ENST00000274024.3	37	CCDS3712.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.703210	0.88924	.	.	ENSG00000145384	ENST00000274024	T	0.08984	3.03	5.31	4.46	0.54185	Calycin-like (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	0.104185	0.64402	N	0.000004	T	0.15739	0.0379	M	0.68593	2.085	0.80722	D	1	D	0.56521	0.976	P	0.47102	0.537	T	0.01360	-1.1375	10	0.72032	D	0.01	.	13.965	0.64202	0.0:0.9252:0.0:0.0748	.	107	P12104	FABPI_HUMAN	Q	107	ENSP00000274024:R107Q	ENSP00000274024:R107Q	R	-	2	0	FABP2	120460167	1.000000	0.71417	0.953000	0.39169	0.808000	0.45660	3.220000	0.51207	1.224000	0.43551	0.650000	0.86243	CGA	.		0.333	FABP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256531.1	NM_000134	
IRF2	3660	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	185340688	185340688	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr4:185340688G>A	ENST00000393593.3	-	3	329	c.122C>T	c.(121-123)gCg>gTg	p.A41V	IRF2_ENST00000512020.1_5'UTR	NM_002199.3	NP_002190.2	P14316	IRF2_HUMAN	interferon regulatory factor 2	41					blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A41V(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(3)|ovary(2)|prostate(1)|skin(3)|stomach(1)|urinary_tract(2)	22		all_lung(41;7.86e-14)|Lung NSC(41;1.87e-13)|Colorectal(36;0.00146)|Hepatocellular(41;0.00826)|Renal(120;0.00992)|Prostate(90;0.0115)|all_neural(102;0.0573)|all_hematologic(60;0.0592)		all cancers(43;3.94e-27)|Epithelial(43;5.3e-24)|OV - Ovarian serous cystadenocarcinoma(60;1.06e-10)|Colorectal(24;7.98e-07)|STAD - Stomach adenocarcinoma(60;3.95e-05)|GBM - Glioblastoma multiforme(59;8.3e-05)|COAD - Colon adenocarcinoma(29;0.000106)|BRCA - Breast invasive adenocarcinoma(30;0.000311)|LUSC - Lung squamous cell carcinoma(40;0.0128)|READ - Rectum adenocarcinoma(43;0.0419)		ATGTCTAGCCGCATGCATCCA	0.423																																					p.A41V		.											.	IRF2-91	1	Substitution - Missense(1)	large_intestine(1)	c.C122T						.						108.0	109.0	109.0					4																	185340688		2203	4300	6503	SO:0001583	missense	3660	exon3			CTAGCCGCATGCA		CCDS3835.1	4q34.1-q35.1	2008-07-29				ENSG00000168310			6117	protein-coding gene	gene with protein product		147576				2475256	Standard	NM_002199		Approved		uc003iwf.4	P14316		ENST00000393593.3:c.122C>T	4.37:g.185340688G>A	ENSP00000377218:p.Ala41Val	Somatic	67	0		WXS	Illumina GAIIx	Phase_I	85	35	NM_002199	0	0	19	33	14	D6RCK5|H0Y8S3|Q6IAS7|Q96B99	Missense_Mutation	SNP	ENST00000393593.3	37	CCDS3835.1	.	.	.	.	.	.	.	.	.	.	G	32	5.135806	0.94517	.	.	ENSG00000168310	ENST00000393593;ENST00000507523;ENST00000510814;ENST00000506230;ENST00000505316	D;D;D;D	0.98044	-4.68;-4.68;-4.68;-4.68	4.99	4.99	0.66335	Interferon regulatory factor, conserved site (1);Winged helix-turn-helix transcription repressor DNA-binding (1);Interferon regulatory factor DNA-binding domain (4);	0.000000	0.85682	D	0.000000	D	0.98855	0.9613	M	0.87180	2.865	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99785	1.1029	10	0.87932	D	0	-9.6502	18.4742	0.90786	0.0:0.0:1.0:0.0	.	41	P14316	IRF2_HUMAN	V	41	ENSP00000377218:A41V;ENSP00000427204:A41V;ENSP00000424552:A41V;ENSP00000422860:A41V	ENSP00000377218:A41V	A	-	2	0	IRF2	185577682	1.000000	0.71417	0.957000	0.39632	0.942000	0.58702	9.645000	0.98471	2.581000	0.87130	0.655000	0.94253	GCG	.		0.423	IRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361393.1		
FAT1	2195	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	187629666	187629666	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr4:187629666G>T	ENST00000441802.2	-	2	1525	c.1316C>A	c.(1315-1317)aCa>aAa	p.T439K		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	439	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						GTCACTTGTTGTTACTTCAAG	0.403										HNSCC(5;0.00058)																											p.T439K	Colon(197;1040 2055 4143 4984 49344)	.											.	FAT1-34	0			c.C1316A						.						200.0	197.0	198.0					4																	187629666		1883	4121	6004	SO:0001583	missense	2195	exon2			CTTGTTGTTACTT	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.1316C>A	4.37:g.187629666G>T	ENSP00000406229:p.Thr439Lys	Somatic	114	0		WXS	Illumina GAIIx	Phase_I	186	95	NM_005245	0	0	0	0	0		Missense_Mutation	SNP	ENST00000441802.2	37	CCDS47177.1	.	.	.	.	.	.	.	.	.	.	G	3.661	-0.069557	0.07228	.	.	ENSG00000083857	ENST00000441802;ENST00000260147;ENST00000509647	D;T	0.82803	-1.65;0.12	5.35	4.51	0.55191	Cadherin (3);Cadherin-like (1);	0.240198	0.44902	D	0.000416	T	0.69513	0.3119	L	0.38692	1.165	0.23950	N	0.996379	B	0.30511	0.282	B	0.32465	0.146	T	0.56384	-0.7988	10	0.06099	T	0.92	.	5.8932	0.18925	0.3104:0.0:0.6896:0.0	.	439	Q14517	FAT1_HUMAN	K	439	ENSP00000406229:T439K;ENSP00000423736:T439K	ENSP00000260147:T439K	T	-	2	0	FAT1	187866660	0.981000	0.34729	0.205000	0.23548	0.724000	0.41520	3.177000	0.50871	1.490000	0.48466	0.561000	0.74099	ACA	.		0.403	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245	
LRRC14B	389257	hgsc.bcm.edu	37	5	191992	191992	+	Silent	SNP	G	G	A	rs34710524	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr5:191992G>A	ENST00000328278.3	+	1	367	c.339G>A	c.(337-339)acG>acA	p.T113T		NM_001080478.1	NP_001073947.1	A6NHZ5	LR14B_HUMAN	leucine rich repeat containing 14B	113										endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|skin(1)|upper_aerodigestive_tract(2)	10						CTGACCTCACGGGCATCCGAG	0.741													G|||	110	0.0219649	0.0023	0.0346	5008	,	,		13465	0.0		0.0746	False		,,,				2504	0.0082				p.T113T		.											.	LRRC14B-69	0			c.G339A						.	G		35,2869		0,35,1417	2.0	3.0	2.0		339	-10.1	0.0	5	dbSNP_126	2	366,5908		2,362,2773	no	coding-synonymous	LRRC14B	NM_001080478.1		2,397,4190	AA,AG,GG		5.8336,1.2052,4.3691		113/515	191992	401,8777	1452	3137	4589	SO:0001819	synonymous_variant	389257	exon1			CCTCACGGGCATC		CCDS47184.1	5p15.33	2010-02-17			ENSG00000185028	ENSG00000185028			37268	protein-coding gene	gene with protein product							Standard	NM_001080478		Approved		uc003jal.1	A6NHZ5	OTTHUMG00000161578	ENST00000328278.3:c.339G>A	5.37:g.191992G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	7	NM_001080478	0	0	0	0	0		Silent	SNP	ENST00000328278.3	37	CCDS47184.1																																																																																			G|0.975;A|0.025		0.741	LRRC14B-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000365393.2	NM_001080478	
EXOC3	11336	broad.mit.edu	37	5	466881	466881	+	Silent	SNP	C	C	T	rs568176788		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr5:466881C>T	ENST00000512944.1	+	13	2295	c.2106C>T	c.(2104-2106)gaC>gaT	p.D702D	EXOC3_ENST00000315013.5_Silent_p.D702D|CTD-2228K2.5_ENST00000510714.1_Intron	NM_007277.4	NP_009208.2	O60645	EXOC3_HUMAN	exocyst complex component 3	713					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|protein transport (GO:0015031)	exocyst (GO:0000145)|secretory granule membrane (GO:0030667)				breast(2)|cervix(1)|endometrium(4)|large_intestine(1)|lung(13)|ovary(1)|urinary_tract(1)	23		Ovarian(839;0.0563)	Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)			TGCGTGGGGACGCCAGCCGTG	0.642													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16766	0.0		0.0	False		,,,				2504	0.0				p.D702D		.											.	EXOC3-90	0			c.C2106T						.						41.0	50.0	47.0					5																	466881		2188	4281	6469	SO:0001819	synonymous_variant	11336	exon13			TGGGGACGCCAGC	BC034427	CCDS54830.1	5p15.33	2013-01-22	2005-11-01	2005-11-01	ENSG00000180104	ENSG00000180104			30378	protein-coding gene	gene with protein product		608186	"""SEC6-like 1 (S. cerevisiae)"""	SEC6L1		8619474	Standard	XM_005248238		Approved	Sec6p	uc003jba.3	O60645	OTTHUMG00000162205	ENST00000512944.1:c.2106C>T	5.37:g.466881C>T		Somatic	409	0		WXS	Illumina GAIIx	Phase_I	447	8	NM_007277	0	0	60	63	3	Q6P2E8|Q8TEN6|Q8WUW0|Q96DI4	Silent	SNP	ENST00000512944.1	37	CCDS54830.1																																																																																			.		0.642	EXOC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367882.1	NM_007277	
SLC12A7	10723	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	1089183	1089183	+	Missense_Mutation	SNP	C	C	T	rs372645005		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr5:1089183C>T	ENST00000264930.5	-	4	446	c.403G>A	c.(403-405)Gtc>Atc	p.V135I		NM_006598.2	NP_006589.2	Q9Y666	S12A7_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 7	135					cell volume homeostasis (GO:0006884)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion transport (GO:0006813)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	32	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)	AAGAGGATGACGCCCAGGATG	0.642													C|||	1	0.000199681	0.0008	0.0	5008	,	,		17555	0.0		0.0	False		,,,				2504	0.0				p.V135I		.											.	SLC12A7-138	0			c.G403A						.	C	ILE/VAL	1,4403	2.1+/-5.4	0,1,2201	180.0	147.0	158.0		403	3.6	1.0	5		158	0,8600		0,0,4300	no	missense	SLC12A7	NM_006598.2	29	0,1,6501	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	135/1084	1089183	1,13003	2202	4300	6502	SO:0001583	missense	10723	exon4			GGATGACGCCCAG	AF105365	CCDS34129.1	5p15	2013-07-18	2013-07-18		ENSG00000113504	ENSG00000113504		"""Solute carriers"""	10915	protein-coding gene	gene with protein product		604879				10347194	Standard	NM_006598		Approved	KCC4, DKFZP434F076	uc003jbu.3	Q9Y666	OTTHUMG00000161931	ENST00000264930.5:c.403G>A	5.37:g.1089183C>T	ENSP00000264930:p.Val135Ile	Somatic	206	1		WXS	Illumina GAIIx	Phase_I	267	131	NM_006598	0	0	0	1	1	A6NDS8|Q4G0F3|Q96I81|Q9H7I3|Q9H7I7|Q9UFW2	Missense_Mutation	SNP	ENST00000264930.5	37	CCDS34129.1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.781911	0.90282	2.27E-4	0.0	ENSG00000113504	ENST00000264930;ENST00000343658	D	0.98633	-5.04	3.61	3.61	0.41365	Amino acid permease domain (1);	0.000000	0.85682	D	0.000000	D	0.98611	0.9535	M	0.62266	1.93	0.58432	D	0.999999	D	0.76494	0.999	D	0.68039	0.955	D	0.98693	1.0697	10	0.49607	T	0.09	.	14.1755	0.65539	0.0:1.0:0.0:0.0	.	135	Q9Y666	S12A7_HUMAN	I	135	ENSP00000264930:V135I	ENSP00000264930:V135I	V	-	1	0	SLC12A7	1142183	1.000000	0.71417	0.964000	0.40570	0.982000	0.71751	6.945000	0.75947	1.739000	0.51704	0.561000	0.74099	GTC	.		0.642	SLC12A7-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366446.2	NM_006598	
PARP8	79668	ucsc.edu;bcgsc.ca;mdanderson.org	37	5	50090917	50090917	+	Missense_Mutation	SNP	G	G	A	rs201467874		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr5:50090917G>A	ENST00000281631.5	+	12	1252	c.1094G>A	c.(1093-1095)cGt>cAt	p.R365H	PARP8_ENST00000503750.2_Missense_Mutation_p.R365H|PARP8_ENST00000505697.2_Missense_Mutation_p.R365H|PARP8_ENST00000514067.2_Missense_Mutation_p.R365H|PARP8_ENST00000511363.2_3'UTR|PARP8_ENST00000505554.1_Missense_Mutation_p.R344H|PARP8_ENST00000514342.2_Missense_Mutation_p.R118H	NM_001178056.1|NM_024615.3	NP_001171527.1|NP_078891.2	Q8N3A8	PARP8_HUMAN	poly (ADP-ribose) polymerase family, member 8	365						intracellular (GO:0005622)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|lung(23)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Lung NSC(810;0.0305)|Breast(144;0.222)				CTTTTGAACCGTCCTTGCCCT	0.498													G|||	1	0.000199681	0.0	0.0	5008	,	,		21220	0.001		0.0	False		,,,				2504	0.0				p.R365H		.											.	PARP8-586	0			c.G1094A						.						117.0	111.0	113.0					5																	50090917		2203	4300	6503	SO:0001583	missense	79668	exon12			TGAACCGTCCTTG	AL834477	CCDS3954.1, CCDS54849.1	5q11.2	2010-02-16			ENSG00000151883	ENSG00000151883		"""Poly (ADP-ribose) polymerases"""	26124	protein-coding gene	gene with protein product						15273990	Standard	NM_001178055		Approved	FLJ21308, pART16	uc003joo.3	Q8N3A8	OTTHUMG00000096969	ENST00000281631.5:c.1094G>A	5.37:g.50090917G>A	ENSP00000281631:p.Arg365His	Somatic	227	2		WXS	Illumina GAIIx	Phase_I	302	143	NM_001178056	1	0	20	38	17	Q3KRB7|Q6DHZ1|Q9H754	Missense_Mutation	SNP	ENST00000281631.5	37	CCDS3954.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	16.57	3.158909	0.57368	.	.	ENSG00000151883	ENST00000505697;ENST00000503750;ENST00000514342;ENST00000281631;ENST00000514067;ENST00000505554;ENST00000503561;ENST00000423185	.	.	.	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	T	0.46190	0.1380	L	0.38175	1.15	0.53005	D	0.999966	B;B;B	0.21688	0.004;0.059;0.002	B;B;B	0.12837	0.002;0.008;0.001	T	0.33059	-0.9883	8	.	.	.	-11.4003	13.6257	0.62163	0.0747:0.0:0.9253:0.0	.	257;365;365	B4DQ81;Q8N3A8-2;Q8N3A8	.;.;PARP8_HUMAN	H	365;365;118;365;365;344;118;118	.	.	R	+	2	0	PARP8	50126674	0.992000	0.36948	0.998000	0.56505	0.983000	0.72400	3.997000	0.57016	2.605000	0.88082	0.655000	0.94253	CGT	G|0.999;A|0.000		0.498	PARP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214035.3	NM_024615	
SNX18	112574	hgsc.bcm.edu	37	5	53814052	53814052	+	Silent	SNP	T	T	C	rs2548615	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr5:53814052T>C	ENST00000326277.3	+	1	460	c.270T>C	c.(268-270)ccT>ccC	p.P90P	SNX18_ENST00000381410.4_Silent_p.P90P|SNX18_ENST00000343017.6_Silent_p.P90P	NM_052870.2	NP_443102.2	Q96RF0	SNX18_HUMAN	sorting nexin 18	90					cleavage furrow formation (GO:0036089)|endocytosis (GO:0006897)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|positive regulation of GTPase activity (GO:0043547)	cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			endometrium(3)|kidney(1)|large_intestine(3)|lung(6)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)	18		Lung NSC(810;3.46e-05)|Breast(144;0.102)				AGCCCCTGCCTGTCGCGCCCC	0.791													N|||	4953	0.989018	0.9728	0.9942	5008	,	,		9287	1.0		0.9901	False		,,,				2504	0.9949				p.P90P		.											.	SNX18-226	0			c.T270C						.	C	,,	1635,19		808,19,0	1.0	2.0	2.0		270,270,270	-2.1	0.2	5	dbSNP_100	2	4035,67		1984,67,0	no	coding-synonymous,coding-synonymous,coding-synonymous	SNX18	NM_001102575.1,NM_001145427.1,NM_052870.2	,,	2792,86,0	CC,CT,TT		1.6333,1.1487,1.4941	,,	90/625,90/592,90/629	53814052	5670,86	827	2051	2878	SO:0001819	synonymous_variant	112574	exon1			CCTGCCTGTCGCG	AF395536	CCDS3962.1, CCDS43317.1, CCDS54851.1	5q11.2	2010-05-12	2008-03-11	2008-03-11	ENSG00000178996	ENSG00000178996		"""Sorting nexins"""	19245	protein-coding gene	gene with protein product			"""sorting nexin associated golgi protein 1"""	SNAG1		16782399, 17761170	Standard	NM_052870		Approved	SH3PX2, SH3PXD3B	uc003jpi.4	Q96RF0	OTTHUMG00000096994	ENST00000326277.3:c.270T>C	5.37:g.53814052T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_052870	0	0	0	0	0	B4E2B3|H7BXX3|Q05BB3|Q0VG02	Silent	SNP	ENST00000326277.3	37	CCDS3962.1																																																																																			G|0.979;C|0.003		0.791	SNX18-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000214072.2		
SGTB	54557	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	65000123	65000123	+	Silent	SNP	T	T	G			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr5:65000123T>G	ENST00000381007.4	-	5	592	c.357A>C	c.(355-357)gcA>gcC	p.A119A		NM_019072.2	NP_061945.1	Q96EQ0	SGTB_HUMAN	small glutamine-rich tetratricopeptide repeat (TPR)-containing, beta	119										large_intestine(3)|lung(3)|skin(3)	9		Lung NSC(167;3.24e-06)|Prostate(74;0.0138)|Ovarian(174;0.0545)|Breast(144;0.174)|Colorectal(97;0.234)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0657)|Lung(70;0.00487)		AATAGTAAACTGCATTATTGG	0.338																																					p.A119A		.											.	SGTB-90	0			c.A357C						.						140.0	130.0	133.0					5																	65000123		2203	4300	6503	SO:0001819	synonymous_variant	54557	exon5			GTAAACTGCATTA	AK096321	CCDS3988.1	5q12.3	2013-01-10			ENSG00000197860	ENSG00000197860		"""Tetratricopeptide (TTC) repeat domain containing"""	23567	protein-coding gene	gene with protein product						12477932	Standard	XM_005248548		Approved	Sgt2, FLJ39002	uc003jud.3	Q96EQ0	OTTHUMG00000097801	ENST00000381007.4:c.357A>C	5.37:g.65000123T>G		Somatic	59	0		WXS	Illumina GAIIx	Phase_I	86	43	NM_019072	0	0	0	0	0		Silent	SNP	ENST00000381007.4	37	CCDS3988.1																																																																																			.		0.338	SGTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215057.2	NM_019072	
GCNT4	51301	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	74325230	74325230	+	Silent	SNP	C	C	T	rs148761969	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr5:74325230C>T	ENST00000322348.4	-	1	1494	c.633G>A	c.(631-633)tcG>tcA	p.S211S		NM_016591.2	NP_057675.1	Q9P109	GCNT4_HUMAN	glucosaminyl (N-acetyl) transferase 4, core 2	211					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|homeostasis of number of cells (GO:0048872)|inter-male aggressive behavior (GO:0002121)|kidney morphogenesis (GO:0060993)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)|thyroid hormone metabolic process (GO:0042403)|tissue morphogenesis (GO:0048729)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase activity (GO:0003829)|N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity (GO:0008109)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|ovary(2)|skin(1)|stomach(2)	19		all_lung(232;0.0131)|Lung NSC(167;0.0282)|Ovarian(174;0.0798)		OV - Ovarian serous cystadenocarcinoma(47;8.44e-57)		TCAGAAGGTCCGACAAGCAAT	0.388																																					p.S211S		.											.	GCNT4-93	0			c.G633A						.	C		2,4400		0,2,2199	75.0	78.0	77.0		633	-2.2	1.0	5	dbSNP_134	77	0,8600		0,0,4300	no	coding-synonymous	GCNT4	NM_016591.2		0,2,6499	TT,TC,CC		0.0,0.0454,0.0154		211/454	74325230	2,13000	2201	4300	6501	SO:0001819	synonymous_variant	51301	exon1			AAGGTCCGACAAG	AF132035	CCDS4026.1	5q12	2013-02-25	2010-03-16		ENSG00000176928	ENSG00000176928	2.4.1.102	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	17973	protein-coding gene	gene with protein product	"""core 2 beta-1,6-N-acetylglucosaminyltransferase 3"", ""beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase 4"""		"""glucosaminyl (N-acetyl) transferase 4, core 2 (beta-1,6-N-acetylglucosaminyltransferase)"""			10753916	Standard	NM_016591		Approved	C2GNT3	uc003kdn.3	Q9P109	OTTHUMG00000131272	ENST00000322348.4:c.633G>A	5.37:g.74325230C>T		Somatic	82	0		WXS	Illumina GAIIx	Phase_I	137	74	NM_016591	0	0	2	3	1		Silent	SNP	ENST00000322348.4	37	CCDS4026.1																																																																																			C|0.999;T|0.001		0.388	GCNT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254040.1	NM_016591	
ARSB	411	ucsc.edu;bcgsc.ca;mdanderson.org	37	5	78076460	78076460	+	Silent	SNP	C	C	T	rs35757003	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr5:78076460C>T	ENST00000264914.4	-	8	1898	c.1362G>A	c.(1360-1362)ccG>ccA	p.P454P		NM_000046.3	NP_000037.2	P15848	ARSB_HUMAN	arylsulfatase B	454					autophagy (GO:0006914)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|central nervous system development (GO:0007417)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|glycosphingolipid metabolic process (GO:0006687)|lysosomal transport (GO:0007041)|lysosome organization (GO:0007040)|post-translational protein modification (GO:0043687)|response to estrogen (GO:0043627)|response to methylmercury (GO:0051597)|response to nutrient (GO:0007584)|response to pH (GO:0009268)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|rough endoplasmic reticulum (GO:0005791)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)|N-acetylgalactosamine-4-sulfatase activity (GO:0003943)			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		all_lung(232;0.000637)|Lung NSC(167;0.00173)|Ovarian(174;0.0105)|Prostate(461;0.192)		OV - Ovarian serous cystadenocarcinoma(54;4.24e-44)|Epithelial(54;3.12e-39)|all cancers(79;3.02e-34)		TGTATTGAGACGGTGGAGGGA	0.473													C|||	281	0.0561102	0.2057	0.0101	5008	,	,		21095	0.0		0.0	False		,,,				2504	0.002				p.P454P	Melanoma(169;563 1968 25780 26156 52266)	.											.	ARSB-91	0			c.G1362A						.	C		707,3699	293.6+/-282.7	54,599,1550	78.0	76.0	77.0		1362	-11.2	0.0	5	dbSNP_126	77	6,8594	3.7+/-12.6	0,6,4294	no	coding-synonymous	ARSB	NM_000046.3		54,605,5844	TT,TC,CC		0.0698,16.0463,5.4821		454/534	78076460	713,12293	2203	4300	6503	SO:0001819	synonymous_variant	411	exon8			TTGAGACGGTGGA	M32373	CCDS4043.1, CCDS43334.1	5q14.1	2013-02-14			ENSG00000113273	ENSG00000113273	3.1.6.1	"""Arylsulfatase family"""	714	protein-coding gene	gene with protein product		611542				2303452	Standard	NM_000046		Approved		uc003kfq.3	P15848	OTTHUMG00000108129	ENST00000264914.4:c.1362G>A	5.37:g.78076460C>T		Somatic	113	0		WXS	Illumina GAIIx	Phase_I	177	68	NM_000046	0	0	3	4	1	B2RC20|Q8N322|Q9UDI9	Silent	SNP	ENST00000264914.4	37	CCDS4043.1																																																																																			C|0.951;T|0.049		0.473	ARSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226932.2	NM_000046	
CKMT2	1160	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	80548557	80548557	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr5:80548557G>A	ENST00000424301.2	+	4	434	c.196G>A	c.(196-198)Gag>Aag	p.E66K	CKMT2_ENST00000254035.4_Missense_Mutation_p.E66K|CKMT2-AS1_ENST00000500148.2_RNA|CKMT2_ENST00000437669.1_Missense_Mutation_p.E66K|CKMT2-AS1_ENST00000511495.1_RNA|CKMT2-AS1_ENST00000505295.1_RNA|CKMT2-AS1_ENST00000501927.2_RNA|CKMT2-AS1_ENST00000503483.2_RNA|CKMT2-AS1_ENST00000512287.1_RNA|CKMT2-AS1_ENST00000502041.2_RNA	NM_001825.2	NP_001816.2	P17540	KCRS_HUMAN	creatine kinase, mitochondrial 2 (sarcomeric)	66	Phosphagen kinase N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00842}.				cellular nitrogen compound metabolic process (GO:0034641)|creatine metabolic process (GO:0006600)|muscle contraction (GO:0006936)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|creatine kinase activity (GO:0004111)			breast(2)|cervix(1)|endometrium(2)|large_intestine(7)|lung(4)|urinary_tract(1)	17		Lung NSC(167;0.00475)|all_lung(232;0.00502)|Ovarian(174;0.0336)		OV - Ovarian serous cystadenocarcinoma(54;2.29e-44)|Epithelial(54;1.05e-38)|all cancers(79;4.15e-34)	Creatine(DB00148)	CTGCATGGCCGAGTGCCTCAC	0.622																																					p.E66K		.											.	CKMT2-90	0			c.G196A						.						105.0	90.0	95.0					5																	80548557		2203	4300	6503	SO:0001583	missense	1160	exon4			ATGGCCGAGTGCC		CCDS4053.1	5q14.1	2013-09-20			ENSG00000131730	ENSG00000131730	2.7.3.2		1996	protein-coding gene	gene with protein product		123295				2324105	Standard	NM_001825		Approved	SMTCK	uc003khd.4	P17540	OTTHUMG00000119013	ENST00000424301.2:c.196G>A	5.37:g.80548557G>A	ENSP00000404203:p.Glu66Lys	Somatic	239	0		WXS	Illumina GAIIx	Phase_I	293	127	NM_001825	0	0	1	6	5	Q6ICS8|Q8N1E1	Missense_Mutation	SNP	ENST00000424301.2	37	CCDS4053.1	.	.	.	.	.	.	.	.	.	.	G	6.897	0.534949	0.13188	.	.	ENSG00000131730	ENST00000254035;ENST00000511719;ENST00000437669;ENST00000424301;ENST00000505060	T;T;T;T;T	0.57107	0.42;0.42;0.42;0.42;0.42	6.04	5.16	0.70880	ATP:guanido phosphotransferase, N-terminal (4);	0.287868	0.41712	D	0.000823	T	0.13372	0.0324	N	0.00101	-2.135	0.38776	D	0.954667	B	0.06786	0.001	B	0.06405	0.002	T	0.44513	-0.9323	10	0.02654	T	1	-13.8907	11.8265	0.52269	0.134:0.0:0.866:0.0	.	66	P17540	KCRS_HUMAN	K	66	ENSP00000254035:E66K;ENSP00000423264:E66K;ENSP00000410289:E66K;ENSP00000404203:E66K;ENSP00000427635:E66K	ENSP00000254035:E66K	E	+	1	0	CKMT2	80584313	0.329000	0.24696	0.977000	0.42913	0.932000	0.56968	1.087000	0.30865	2.873000	0.98535	0.561000	0.74099	GAG	.		0.622	CKMT2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369600.1	NM_001825	
HAPLN1	1404	bcgsc.ca	37	5	82937410	82937410	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr5:82937410G>A	ENST00000274341.4	-	5	1820	c.970C>T	c.(970-972)Cgc>Tgc	p.R324C		NM_001884.3	NP_001875.1	P10915	HPLN1_HUMAN	hyaluronan and proteoglycan link protein 1	324	Link 2. {ECO:0000255|PROSITE- ProRule:PRU00323}.				cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	hyaluronic acid binding (GO:0005540)			breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|liver(1)|lung(15)|ovary(1)|prostate(1)|skin(1)	34		Lung NSC(167;0.0484)|all_lung(232;0.0522)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;7.82e-42)|Epithelial(54;5.88e-35)|all cancers(79;1.14e-29)	Hyaluronan(DB08818)	GGACTGCAGCGCCTTCTTGGC	0.532																																					p.R324C		.											.	HAPLN1-580	0			c.C970T						.						107.0	113.0	111.0					5																	82937410		2203	4300	6503	SO:0001583	missense	1404	exon5			TGCAGCGCCTTCT		CCDS4061.1	5q14.3	2013-01-11	2004-03-16	2004-03-17	ENSG00000145681	ENSG00000145681		"""Immunoglobulin superfamily / V-set domain containing"""	2380	protein-coding gene	gene with protein product	"""Cartilage link protein"", ""hyaluronan and proteoglycan link protein 1"""	115435	"""cartilage linking protein 1"""	CRTL1		2286376, 2320422	Standard	NM_001884		Approved		uc003kin.3	P10915	OTTHUMG00000119045	ENST00000274341.4:c.970C>T	5.37:g.82937410G>A	ENSP00000274341:p.Arg324Cys	Somatic	242	3		WXS	Illumina GAIIx	Phase_I	373	169	NM_001884	0	0	0	0	0	B2R9A9	Missense_Mutation	SNP	ENST00000274341.4	37	CCDS4061.1	.	.	.	.	.	.	.	.	.	.	G	13.37	2.215621	0.39102	.	.	ENSG00000145681	ENST00000274341	T	0.31769	1.48	5.22	5.22	0.72569	C-type lectin fold (1);Link (4);C-type lectin-like (1);	0.000000	0.85682	D	0.000000	T	0.60077	0.2241	M	0.80982	2.52	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	T	0.65228	-0.6219	10	0.87932	D	0	.	19.1617	0.93535	0.0:0.0:1.0:0.0	.	324	P10915	HPLN1_HUMAN	C	324	ENSP00000274341:R324C	ENSP00000274341:R324C	R	-	1	0	HAPLN1	82973166	0.997000	0.39634	1.000000	0.80357	0.169000	0.22640	2.513000	0.45494	2.581000	0.87130	0.655000	0.94253	CGC	.		0.532	HAPLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239256.2	NM_001884	
LMNB1	4001	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	126154661	126154661	+	Silent	SNP	T	T	C			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr5:126154661T>C	ENST00000261366.5	+	6	1348	c.987T>C	c.(985-987)gcT>gcC	p.A329A	LMNB1_ENST00000395354.1_Silent_p.A329A|LMNB1_ENST00000460265.1_3'UTR	NM_001198557.1|NM_005573.3	NP_001185486.1|NP_005564.1	P20700	LMNB1_HUMAN	lamin B1	329	Coil 2.|Rod.				apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	lamin filament (GO:0005638)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear inner membrane (GO:0005637)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16		all_cancers(142;0.103)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.033)|OV - Ovarian serous cystadenocarcinoma(64;0.0398)|all cancers(49;0.0903)		ACTTGCTTGCTAAAGAAAAAG	0.403																																					p.A329A		.											.	LMNB1-226	0			c.T987C						.						108.0	110.0	109.0					5																	126154661		2203	4300	6503	SO:0001819	synonymous_variant	4001	exon6			GCTTGCTAAAGAA	L37737	CCDS4140.1	5q23.2	2013-01-16			ENSG00000113368	ENSG00000113368		"""Intermediate filaments type V, lamins"""	6637	protein-coding gene	gene with protein product		150340				7557986, 8838815	Standard	NM_005573		Approved		uc003kud.2	P20700	OTTHUMG00000128969	ENST00000261366.5:c.987T>C	5.37:g.126154661T>C		Somatic	257	1		WXS	Illumina GAIIx	Phase_I	362	172	NM_005573	0	0	18	25	7	B2R6J6|Q3SYN7|Q96EI6	Silent	SNP	ENST00000261366.5	37	CCDS4140.1																																																																																			.		0.403	LMNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250956.2	NM_005573	
SOWAHA	134548	hgsc.bcm.edu	37	5	132149684	132149684	+	Missense_Mutation	SNP	G	G	C	rs40274	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr5:132149684G>C	ENST00000378693.2	+	1	652	c.371G>C	c.(370-372)cGg>cCg	p.R124P		NM_175873.4	NP_787069.3	Q2M3V2	SWAHA_HUMAN	sosondowah ankyrin repeat domain family member A	124	Pro-rich.		R -> P (in dbSNP:rs40274).														CCCTTGGTCCGGGTGCCGCGG	0.776																																					p.R124P		.											.	.	0			c.G371C						.	C	PRO/ARG	2599,13		1293,13,0	2.0	3.0	3.0		371	-0.3	0.0	5	dbSNP_76	3	6177,193		2993,191,1	no	missense	ANKRD43	NM_175873.4	103	4286,204,1	CC,CG,GG		3.0298,0.4977,2.2935	benign	124/550	132149684	8776,206	1306	3185	4491	SO:0001583	missense	134548	exon1			TGGTCCGGGTGCC	AK090823	CCDS43361.1	5q23.3	2013-01-10	2012-01-12	2012-01-12	ENSG00000198944	ENSG00000198944		"""Ankyrin repeat domain containing"""	27033	protein-coding gene	gene with protein product			"""ankyrin repeat domain 43"""	ANKRD43		22234889	Standard	NM_175873		Approved		uc003kxw.3	Q2M3V2	OTTHUMG00000059844	ENST00000378693.2:c.371G>C	5.37:g.132149684G>C	ENSP00000367965:p.Arg124Pro	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_175873	0	0	0	0	0	Q8NAE7	Missense_Mutation	SNP	ENST00000378693.2	37	CCDS43361.1	2142	0.9807692307692307	482	0.9796747967479674	357	0.9861878453038674	562	0.9825174825174825	741	0.9775725593667546	c	9.833	1.188835	0.21954	0.995023	0.969702	ENSG00000198944	ENST00000378693	T	0.38077	1.16	4.27	-0.265	0.12946	.	2.345400	0.02245	N	0.066177	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.36261	-0.9755	9	0.30078	T	0.28	-5.2019	3.6102	0.08057	0.2245:0.4439:0.2467:0.085	rs40274	124	Q2M3V2	ANR43_HUMAN	P	124	ENSP00000367965:R124P	ENSP00000367965:R124P	R	+	2	0	ANKRD43	132177583	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.768000	0.01794	-0.003000	0.14444	-3.153000	0.00058	CGG	G|0.980;C|0.020		0.776	SOWAHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133062.1	NM_175873	
PCDHB11	56125	ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140581614	140581614	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr5:140581614C>T	ENST00000354757.3	+	1	2267	c.2267C>T	c.(2266-2268)aCg>aTg	p.T756M	PCDHB11_ENST00000536699.1_Missense_Mutation_p.T391M	NM_018931.2	NP_061754.1	Q9Y5F2	PCDBB_HUMAN	protocadherin beta 11	756					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(23)|ovary(4)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GTGTGTCTGACGGGAGGTTCC	0.527																																					p.T756M		.											.	PCDHB11-96	0			c.C2267T						.						119.0	133.0	128.0					5																	140581614		2203	4300	6503	SO:0001583	missense	56125	exon1			GTCTGACGGGAGG	AF152490	CCDS4253.1	5q31	2010-01-26			ENSG00000197479	ENSG00000197479		"""Cadherins / Protocadherins : Clustered"""	8682	other	protocadherin	"""cadherin ME2"""	606337				10380929	Standard	NM_018931		Approved	PCDH-BETA11, ME2	uc003liy.3	Q9Y5F2	OTTHUMG00000129618	ENST00000354757.3:c.2267C>T	5.37:g.140581614C>T	ENSP00000346802:p.Thr756Met	Somatic	197	2		WXS	Illumina GAIIx	Phase_I	304	121	NM_018931	0	0	1	1	0	B4DSF7|Q2M223	Missense_Mutation	SNP	ENST00000354757.3	37	CCDS4253.1	.	.	.	.	.	.	.	.	.	.	C	9.259	1.042639	0.19748	.	.	ENSG00000197479	ENST00000536699;ENST00000354757	T;T	0.17854	2.25;2.25	2.77	-1.56	0.08532	.	.	.	.	.	T	0.17916	0.0430	M	0.73372	2.23	0.09310	N	1	B	0.21520	0.057	B	0.22601	0.04	T	0.30475	-0.9977	9	0.52906	T	0.07	.	6.5443	0.22397	0.0:0.5802:0.231:0.1888	.	756	Q9Y5F2	PCDBB_HUMAN	M	391;756	ENSP00000440344:T391M;ENSP00000346802:T756M	ENSP00000346802:T756M	T	+	2	0	PCDHB11	140561798	0.000000	0.05858	0.001000	0.08648	0.051000	0.14879	-1.257000	0.02866	-0.247000	0.09597	0.549000	0.68633	ACG	.		0.527	PCDHB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251813.1	NM_018931	
TCOF1	6949	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	149755751	149755751	+	Missense_Mutation	SNP	G	G	A	rs146735293	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr5:149755751G>A	ENST00000504761.2	+	13	2000	c.2000G>A	c.(1999-2001)cGg>cAg	p.R667Q	TCOF1_ENST00000513346.1_Missense_Mutation_p.R667Q|TCOF1_ENST00000445265.2_Missense_Mutation_p.R590Q|TCOF1_ENST00000439160.2_Missense_Mutation_p.R667Q|TCOF1_ENST00000394269.3_Missense_Mutation_p.R667Q|TCOF1_ENST00000323668.7_Missense_Mutation_p.R590Q|TCOF1_ENST00000377797.3_Missense_Mutation_p.R667Q|TCOF1_ENST00000451292.1_Missense_Mutation_p.R667Q			Q13428	TCOF_HUMAN	Treacher Collins-Franceschetti syndrome 1	667					skeletal system development (GO:0001501)|transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:0042790)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transporter activity (GO:0005215)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(8)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	35		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CAAGCCCCCCGGAAAGCAGGA	0.582																																					p.R667Q		.											.	TCOF1-155	0			c.G2000A						.	G	GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG	4,4402	8.1+/-20.4	0,4,2199	112.0	129.0	123.0		1769,2000,2000,2000,1769,2000	4.1	0.3	5	dbSNP_134	123	6,8594	4.3+/-15.6	0,6,4294	yes	missense,missense,missense,missense,missense,missense	TCOF1	NM_000356.3,NM_001008657.2,NM_001135243.1,NM_001135244.1,NM_001135245.1,NM_001195141.1	43,43,43,43,43,43	0,10,6493	AA,AG,GG		0.0698,0.0908,0.0769	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	590/1412,667/959,667/1489,667/1452,590/1413,667/1451	149755751	10,12996	2203	4300	6503	SO:0001583	missense	6949	exon13			CCCCCCGGAAAGC		CCDS4306.1, CCDS47305.1, CCDS47306.1, CCDS47307.1, CCDS54936.1	5q32	2014-06-18			ENSG00000070814	ENSG00000070814			11654	protein-coding gene	gene with protein product		606847				1765376	Standard	NM_001008657		Approved	treacle, TCS	uc003lry.3	Q13428	OTTHUMG00000130081	ENST00000504761.2:c.2000G>A	5.37:g.149755751G>A	ENSP00000421655:p.Arg667Gln	Somatic	115	1		WXS	Illumina GAIIx	Phase_I	213	112	NM_001135243	0	0	13	26	13	A0JLU0|B4E111|Q6SC72|Q7Z5W9|Q96A52|Q99408|Q99860	Missense_Mutation	SNP	ENST00000504761.2	37	CCDS54936.1	.	.	.	.	.	.	.	.	.	.	G	15.71	2.914618	0.52546	9.08E-4	6.98E-4	ENSG00000070814	ENST00000451292;ENST00000377797;ENST00000445265;ENST00000323668;ENST00000439160;ENST00000394269;ENST00000427724;ENST00000504761;ENST00000513346	T;T;T;T;T;T;T;T;T	0.64991	-0.13;-0.13;-0.13;-0.13;-0.13;-0.13;-0.13;-0.13;-0.13	4.99	4.12	0.48240	Treacher Collins syndrome, treacle (1);	1.924210	0.02647	N	0.105976	T	0.72946	0.3524	L	0.54323	1.7	0.22017	N	0.999419	D;P;P;P;D;P;P	0.69078	0.986;0.789;0.789;0.789;0.997;0.789;0.919	P;B;B;B;P;B;B	0.60415	0.59;0.142;0.142;0.142;0.874;0.142;0.196	T	0.52704	-0.8540	10	0.21540	T	0.41	1.3964	9.695	0.40152	0.0977:0.0:0.9023:0.0	.	176;667;590;667;667;590;667	B4DRA2;Q13428-7;Q13428-2;Q13428-6;Q13428;Q13428-8;Q13428-5	.;.;.;.;TCOF_HUMAN;.;.	Q	667;667;590;590;667;667;667;667;667	ENSP00000400939:R667Q;ENSP00000367028:R667Q;ENSP00000409944:R590Q;ENSP00000325223:R590Q;ENSP00000406888:R667Q;ENSP00000377811:R667Q;ENSP00000390717:R667Q;ENSP00000421655:R667Q;ENSP00000427484:R667Q	ENSP00000325223:R590Q	R	+	2	0	TCOF1	149735944	0.981000	0.34729	0.296000	0.24974	0.022000	0.10575	1.759000	0.38420	1.223000	0.43536	-0.258000	0.10820	CGG	G|0.998;A|0.002		0.582	TCOF1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000380552.1	NM_001008656	
RNF145	153830	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	158595954	158595954	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr5:158595954C>T	ENST00000424310.2	-	8	1407	c.1048G>A	c.(1048-1050)Gta>Ata	p.V350I	RNF145_ENST00000518802.1_Missense_Mutation_p.V380I|RNF145_ENST00000519865.1_Missense_Mutation_p.V350I|RNF145_ENST00000274542.2_Missense_Mutation_p.V378I|RNF145_ENST00000521606.2_Missense_Mutation_p.V367I|RNF145_ENST00000520638.1_Missense_Mutation_p.V364I	NM_001199383.1	NP_001186312.1	Q96MT1	RN145_HUMAN	ring finger protein 145	350						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			endometrium(7)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	30	Renal(175;0.00196)	Medulloblastoma(196;0.0523)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			ATAGAAGCTACGACAATGAAA	0.408																																					p.V380I		.											.	RNF145-525	0			c.G1138A						.						118.0	117.0	117.0					5																	158595954		2203	4300	6503	SO:0001583	missense	153830	exon8			AAGCTACGACAAT	BC042684	CCDS4344.1, CCDS56390.1, CCDS56391.1, CCDS56392.1, CCDS56393.1	5q33.3	2013-01-09			ENSG00000145860	ENSG00000145860		"""RING-type (C3HC4) zinc fingers"""	20853	protein-coding gene	gene with protein product							Standard	NM_001199380		Approved	FLJ31951	uc003lxo.2	Q96MT1	OTTHUMG00000130306	ENST00000424310.2:c.1048G>A	5.37:g.158595954C>T	ENSP00000409064:p.Val350Ile	Somatic	382	0		WXS	Illumina GAIIx	Phase_I	516	222	NM_001199380	0	0	24	40	16	B7Z903|B7Z949|E7EVI7|Q8IVP7	Missense_Mutation	SNP	ENST00000424310.2	37	CCDS56390.1	.	.	.	.	.	.	.	.	.	.	C	16.41	3.115532	0.56505	.	.	ENSG00000145860	ENST00000274542;ENST00000519865;ENST00000424310;ENST00000521606;ENST00000413445;ENST00000518802;ENST00000535312;ENST00000520638	T;T;T;T;T;T;T	0.77877	-1.13;-1.12;-1.12;-1.13;-1.13;-1.13;-1.13	5.08	5.08	0.68730	.	0.000000	0.85682	D	0.000000	T	0.71550	0.3353	L	0.43152	1.355	0.80722	D	1	P;P;P;P;P	0.50369	0.922;0.922;0.922;0.934;0.904	B;B;B;B;B	0.40782	0.234;0.234;0.34;0.28;0.23	T	0.70085	-0.4969	10	0.21014	T	0.42	-14.435	18.836	0.92162	0.0:1.0:0.0:0.0	.	367;364;380;350;378	B7Z949;B7Z903;E7EVI7;Q96MT1;Q96MT1-2	.;.;.;RN145_HUMAN;.	I	378;350;350;366;367;380;350;364	ENSP00000274542:V378I;ENSP00000430397:V350I;ENSP00000409064:V350I;ENSP00000430753:V366I;ENSP00000445115:V367I;ENSP00000430955:V380I;ENSP00000429071:V364I	ENSP00000274542:V378I	V	-	1	0	RNF145	158528532	1.000000	0.71417	0.114000	0.21550	0.681000	0.39784	7.776000	0.85560	2.516000	0.84829	0.585000	0.79938	GTA	.		0.408	RNF145-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374048.1	NM_144726	
GABRB2	2561	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	160757958	160757958	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr5:160757958G>A	ENST00000393959.1	-	8	1008	c.1009C>T	c.(1009-1011)Cgc>Tgc	p.R337C	GABRB2_ENST00000274547.2_Missense_Mutation_p.R337C|GABRB2_ENST00000517547.1_Missense_Mutation_p.R177C|GABRB2_ENST00000353437.6_Missense_Mutation_p.R337C|GABRB2_ENST00000520240.1_Missense_Mutation_p.R337C|GABRB2_ENST00000517901.1_Missense_Mutation_p.R274C			P47870	GBRB2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta 2	337					cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|cochlea development (GO:0090102)|gamma-aminobutyric acid signaling pathway (GO:0007214)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|GABA-A receptor complex (GO:1902711)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|GABA-A receptor activity (GO:0004890)|inhibitory extracellular ligand-gated ion channel activity (GO:0005237)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|liver(1)|lung(9)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	26	Renal(175;0.00259)	Medulloblastoma(196;0.021)|all_neural(177;0.0463)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Fospropofol(DB06716)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	TTCTTTTGGCGTTGGGGCCCC	0.512																																					p.R337C		.											.	GABRB2-91	0			c.C1009T						.						97.0	101.0	100.0					5																	160757958		2203	4300	6503	SO:0001583	missense	2561	exon9			TTTGGCGTTGGGG		CCDS4354.1, CCDS4355.1	5q34	2012-06-22			ENSG00000145864	ENSG00000145864		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4082	protein-coding gene	gene with protein product	"""GABA(A) receptor, beta 2"""	600232				7851879	Standard	NM_000813		Approved		uc003lys.1	P47870	OTTHUMG00000130349	ENST00000393959.1:c.1009C>T	5.37:g.160757958G>A	ENSP00000377531:p.Arg337Cys	Somatic	107	0		WXS	Illumina GAIIx	Phase_I	209	89	NM_021911	0	0	2	3	1	A8K115|A8K1A0|D1LYT0|D1LYT1|Q16323|Q4FZB2	Missense_Mutation	SNP	ENST00000393959.1	37	CCDS4355.1	.	.	.	.	.	.	.	.	.	.	G	17.37	3.372399	0.61624	.	.	ENSG00000145864	ENST00000393959;ENST00000274547;ENST00000353437;ENST00000520240;ENST00000517901;ENST00000517547	D;D;D;D;D;D	0.86627	-2.15;-2.15;-2.15;-2.15;-2.15;-2.15	5.26	4.38	0.52667	Neurotransmitter-gated ion-channel transmembrane domain (2);	1.242340	0.05302	N	0.523087	D	0.92325	0.7565	L	0.49126	1.545	0.80722	D	1	D;B;B;D	0.89917	1.0;0.065;0.014;0.998	D;B;B;P	0.69307	0.963;0.056;0.032;0.84	T	0.82802	-0.0277	10	0.72032	D	0.01	.	14.1894	0.65628	0.0729:0.0:0.9271:0.0	.	177;274;337;337	B7Z279;E7EV50;P47870;P47870-1	.;.;GBRB2_HUMAN;.	C	337;337;337;337;274;177	ENSP00000377531:R337C;ENSP00000274547:R337C;ENSP00000274546:R337C;ENSP00000429320:R337C;ENSP00000430532:R274C;ENSP00000429750:R177C	ENSP00000274547:R337C	R	-	1	0	GABRB2	160690536	1.000000	0.71417	0.998000	0.56505	0.981000	0.71138	4.592000	0.61027	1.195000	0.43115	0.563000	0.77884	CGC	.		0.512	GABRB2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252704.1		
TENM2	57451	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	167674406	167674406	+	Silent	SNP	C	C	T	rs369031454		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr5:167674406C>T	ENST00000518659.1	+	27	6501	c.6462C>T	c.(6460-6462)ttC>ttT	p.F2154F	TENM2_ENST00000520394.1_Silent_p.F1915F|TENM2_ENST00000519204.1_Silent_p.F2033F|TENM2_ENST00000545108.1_Silent_p.F2153F|TENM2_ENST00000403607.2_Silent_p.F1978F	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	2154					axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)										GCAAACACTTCGACACCCATG	0.493																																					p.F2145F		.											.	.	0			c.C6435T						.						119.0	116.0	117.0					5																	167674406		2039	4187	6226	SO:0001819	synonymous_variant	57451	exon27			ACACTTCGACACC	AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.6462C>T	5.37:g.167674406C>T		Somatic	123	1		WXS	Illumina GAIIx	Phase_I	191	85	NM_001122679	0	0	0	0	0	Q9ULU2	Silent	SNP	ENST00000518659.1	37																																																																																				.		0.493	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376096.1	NM_001122679	
UNC5A	90249	broad.mit.edu;bcgsc.ca	37	5	176305512	176305512	+	Missense_Mutation	SNP	C	C	T	rs371754063		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr5:176305512C>T	ENST00000329542.4	+	13	2330	c.2056C>T	c.(2056-2058)Cgg>Tgg	p.R686W	UNC5A_ENST00000261961.3_Missense_Mutation_p.R646W	NM_133369.2	NP_588610.2	Q6ZN44	UNC5A_HUMAN	unc-5 homolog A (C. elegans)	686					anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|positive regulation of apoptotic process (GO:0043065)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(4)|kidney(3)|large_intestine(2)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	34	all_cancers(89;0.000119)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TGGCACGCAGCGGTACTTGCA	0.622																																					p.R686W		.											.	UNC5A-91	0			c.C2056T						.	C	TRP/ARG	0,4406		0,0,2203	105.0	85.0	92.0		2056	5.7	1.0	5		92	1,8599	1.2+/-3.3	0,1,4299	no	missense	UNC5A	NM_133369.2	101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	686/843	176305512	1,13005	2203	4300	6503	SO:0001583	missense	90249	exon13			ACGCAGCGGTACT	AB075856	CCDS34299.1	5q35.3	2013-01-11	2001-11-28		ENSG00000113763	ENSG00000113763		"""Immunoglobulin superfamily / I-set domain containing"""	12567	protein-coding gene	gene with protein product		607869	"""unc5 (C.elegans homolog) a"""				Standard	XM_006714927		Approved	KIAA1976, UNC5H1	uc003mey.3	Q6ZN44	OTTHUMG00000163225	ENST00000329542.4:c.2056C>T	5.37:g.176305512C>T	ENSP00000332737:p.Arg686Trp	Somatic	364	1		WXS	Illumina GAIIx	Phase_I	464	35	NM_133369	0	0	0	0	0	B2RXE6|Q8TF26|Q96GP4	Missense_Mutation	SNP	ENST00000329542.4	37	CCDS34299.1	.	.	.	.	.	.	.	.	.	.	C	17.77	3.472252	0.63737	0.0	1.16E-4	ENSG00000113763	ENST00000329542;ENST00000261961	T;T	0.51071	0.72;1.06	5.7	5.7	0.88788	.	0.214766	0.41294	D	0.000917	T	0.55130	0.1901	L	0.60455	1.87	0.24745	N	0.993017	D	0.59767	0.986	P	0.48571	0.582	T	0.56013	-0.8049	10	0.72032	D	0.01	-15.3696	18.4114	0.90552	0.0:1.0:0.0:0.0	.	686	Q6ZN44	UNC5A_HUMAN	W	686;646	ENSP00000332737:R686W;ENSP00000261961:R646W	ENSP00000261961:R646W	R	+	1	2	UNC5A	176238118	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	2.436000	0.44819	2.698000	0.92095	0.491000	0.48974	CGG	.		0.622	UNC5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372166.1	XM_030300	
PDLIM7	9260	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	176916510	176916510	+	Silent	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr5:176916510C>T	ENST00000355841.2	-	9	819	c.753G>A	c.(751-753)acG>acA	p.T251T	PDLIM7_ENST00000393551.1_Missense_Mutation_p.A231T|PDLIM7_ENST00000356618.4_Missense_Mutation_p.A231T|PDLIM7_ENST00000359895.2_Silent_p.T217T	NM_005451.3	NP_005442.2	Q9NR12	PDLI7_HUMAN	PDZ and LIM domain 7 (enigma)	251					actin cytoskeleton organization (GO:0030036)|cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|positive regulation of osteoblast differentiation (GO:0045669)|receptor-mediated endocytosis (GO:0006898)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|ruffle (GO:0001726)|stress fiber (GO:0001725)	zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)|urinary_tract(1)	10	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GCGGCGTGGGCGTGGCCGGCT	0.692																																					p.T251T		.											.	PDLIM7-153	0			c.G753A						.						20.0	25.0	23.0					5																	176916510		2197	4297	6494	SO:0001819	synonymous_variant	9260	exon9			CGTGGGCGTGGCC	BC001093	CCDS4422.1, CCDS4423.1, CCDS4424.1	5q35.3	2008-02-05			ENSG00000196923	ENSG00000196923			22958	protein-coding gene	gene with protein product		605903				11874232	Standard	NM_005451		Approved	ENIGMA	uc003mhc.1	Q9NR12	OTTHUMG00000130853	ENST00000355841.2:c.753G>A	5.37:g.176916510C>T		Somatic	97	0		WXS	Illumina GAIIx	Phase_I	231	118	NM_005451	0	0	0	0	0	Q14250|Q5XG82|Q6NVZ5|Q96C91|Q9BXB8|Q9BXB9	Silent	SNP	ENST00000355841.2	37	CCDS4422.1	.	.	.	.	.	.	.	.	.	.	C	17.06	3.292359	0.59976	.	.	ENSG00000196923	ENST00000356618;ENST00000393551	T;T	0.14766	2.48;2.48	5.23	-5.06	0.02946	.	.	.	.	.	T	0.06645	0.0170	.	.	.	0.23483	N	0.99758	B	0.10296	0.003	B	0.06405	0.002	T	0.42949	-0.9421	7	.	.	.	.	8.6662	0.34123	0.0:0.2911:0.3591:0.3498	.	231	Q9NR12-4	.	T	231	ENSP00000349030:A231T;ENSP00000377182:A231T	.	A	-	1	0	PDLIM7	176849116	0.002000	0.14202	0.966000	0.40874	0.975000	0.68041	-1.409000	0.02483	-0.842000	0.04195	0.555000	0.69702	GCC	.		0.692	PDLIM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253423.1	NM_005451	
FAM193B	54540	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	176951844	176951844	+	Silent	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr5:176951844C>T	ENST00000514747.1	-	6	1686	c.1638G>A	c.(1636-1638)acG>acA	p.T546T	FAM193B_ENST00000508298.1_5'Flank|FAM193B_ENST00000443375.2_Silent_p.T513T|FAM193B_ENST00000329540.5_Silent_p.T172T	NM_001190946.1	NP_001177875.1	Q96PV7	F193B_HUMAN	family with sequence similarity 193, member B	626						cytoplasm (GO:0005737)|nucleus (GO:0005634)				kidney(1)|large_intestine(3)	4						GAGCTTGTAACGTGTGGTTCT	0.622																																					p.T546T		.											.	.	0			c.G1638A						.						20.0	21.0	21.0					5																	176951844		1974	4147	6121	SO:0001819	synonymous_variant	54540	exon6			TTGTAACGTGTGG		CCDS54954.1	5q35	2010-02-17			ENSG00000146067	ENSG00000146067			25524	protein-coding gene	gene with protein product		615813				11572484	Standard	NR_024019		Approved	KIAA1931, FLJ10404	uc003mhu.3	Q96PV7	OTTHUMG00000163396	ENST00000514747.1:c.1638G>A	5.37:g.176951844C>T		Somatic	47	0		WXS	Illumina GAIIx	Phase_I	102	40	NM_001190946	0	0	17	31	14	E9PET5|Q9NW00	Silent	SNP	ENST00000514747.1	37	CCDS54954.1	.	.	.	.	.	.	.	.	.	.	C	8.767	0.924896	0.18056	.	.	ENSG00000146067	ENST00000524677	.	.	.	4.96	0.856	0.19019	.	.	.	.	.	T	0.56046	0.1959	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.48937	-0.8990	4	.	.	.	-0.8771	8.9026	0.35503	0.0:0.5964:0.0:0.4036	.	.	.	.	I	232	.	.	V	-	1	0	FAM193B	176884450	0.000000	0.05858	0.994000	0.49952	0.981000	0.71138	-0.785000	0.04628	0.270000	0.21984	0.561000	0.74099	GTT	.		0.622	FAM193B-003	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373121.1	NM_019057	
B4GALT7	11285	broad.mit.edu	37	5	177034387	177034387	+	Silent	SNP	G	G	A	rs140848441	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr5:177034387G>A	ENST00000029410.5	+	3	609	c.498G>A	c.(496-498)ctG>ctA	p.L166L		NM_007255.2	NP_009186.1	Q9UBV7	B4GT7_HUMAN	xylosylprotein beta 1,4-galactosyltransferase, polypeptide 7	166					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|chondroitin sulfate metabolic process (GO:0030204)|extracellular fibril organization (GO:0043206)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|negative regulation of fibroblast proliferation (GO:0048147)|protein N-linked glycosylation (GO:0006487)|proteoglycan metabolic process (GO:0006029)|small molecule metabolic process (GO:0044281)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|galactosyltransferase activity (GO:0008378)|manganese ion binding (GO:0030145)|xylosylprotein 4-beta-galactosyltransferase activity (GO:0046525)			endometrium(2)|large_intestine(1)|lung(1)|pancreas(1)|skin(1)|urinary_tract(1)	7	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			ACGTTGACCTGCTCCCTCTCA	0.607											OREG0017092	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	g|||	2	0.000399361	0.0008	0.0	5008	,	,		20849	0.0		0.001	False		,,,				2504	0.0				p.L166L		.											.	B4GALT7-91	0			c.G498A						.			0,4406		0,0,2203	125.0	88.0	100.0		498	4.3	1.0	5	dbSNP_134	100	3,8597	3.0+/-9.4	0,3,4297	no	coding-synonymous	B4GALT7	NM_007255.2		0,3,6500	AA,AG,GG		0.0349,0.0,0.0231		166/328	177034387	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	11285	exon3			TGACCTGCTCCCT	AB028600	CCDS4429.1	5q35.1-q35.3	2013-02-19	2012-07-18		ENSG00000027847	ENSG00000027847		"""Beta 4-glycosyltransferases"""	930	protein-coding gene	gene with protein product	"""galactosyltransferase I"""	604327				10438455, 10473568	Standard	NM_007255		Approved	XGALT-1, beta4Gal-T7	uc003mhy.3	Q9UBV7	OTTHUMG00000130851	ENST00000029410.5:c.498G>A	5.37:g.177034387G>A		Somatic	183	0	1935	WXS	Illumina GAIIx	Phase_I	241	5	NM_007255	0	0	41	41	0	B3KN39|Q9UHN2	Silent	SNP	ENST00000029410.5	37	CCDS4429.1																																																																																			G|0.999;A|0.001		0.607	B4GALT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253421.1	NM_007255	
MAML1	9794	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	179193193	179193193	+	Silent	SNP	C	C	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr5:179193193C>A	ENST00000292599.3	+	2	1445	c.1182C>A	c.(1180-1182)tcC>tcA	p.S394S	MAML1_ENST00000503050.1_3'UTR	NM_014757.4	NP_055572.1			mastermind-like 1 (Drosophila)											central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(16)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	36	all_cancers(89;0.000197)|all_epithelial(37;6.7e-05)|Renal(175;0.000159)|Lung NSC(126;0.00121)|all_lung(126;0.00218)	all_cancers(40;0.0308)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CAGAGCTGTCCTCTGCCCACC	0.652																																					p.S394S		.											.	MAML1-848	0			c.C1182A						.						43.0	48.0	46.0					5																	179193193		2203	4300	6503	SO:0001819	synonymous_variant	9794	exon2			GCTGTCCTCTGCC	D83785	CCDS34315.1	5q35	2008-07-18	2001-11-28			ENSG00000161021			13632	protein-coding gene	gene with protein product	"""mastermind homolog"""	605424	"""mastermind (drosophila)-like 1"""			11101851, 11390662	Standard	NM_014757		Approved	KIAA0200, Mam-1	uc003mkm.3	Q92585		ENST00000292599.3:c.1182C>A	5.37:g.179193193C>A		Somatic	80	0		WXS	Illumina GAIIx	Phase_I	130	64	NM_014757	0	0	15	22	7		Silent	SNP	ENST00000292599.3	37	CCDS34315.1																																																																																			.		0.652	MAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372316.2	NM_014757	
FLT4	2324	broad.mit.edu	37	5	180051011	180051011	+	Missense_Mutation	SNP	G	G	A	rs146167161	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr5:180051011G>A	ENST00000261937.6	-	11	1550	c.1472C>T	c.(1471-1473)gCg>gTg	p.A491V	FLT4_ENST00000393347.3_Missense_Mutation_p.A491V|FLT4_ENST00000502649.1_Missense_Mutation_p.A491V|FLT4_ENST00000424276.2_5'UTR	NM_182925.4	NP_891555.2	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4	491	Ig-like C2-type 5.				blood vessel morphogenesis (GO:0048514)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|lymph vessel development (GO:0001945)|lymphangiogenesis (GO:0001946)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation vascular endothelial growth factor production (GO:0010575)|protein autophosphorylation (GO:0046777)|regulation of blood vessel remodeling (GO:0060312)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(6)|large_intestine(5)|liver(2)|lung(37)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	CGTGGTCACCGCCCTCCAGTC	0.637																																					p.A491V	Colon(97;1075 1466 27033 27547 35871)	.											.	FLT4-1490	0			c.C1472T						.	G	VAL/ALA,VAL/ALA	5,4401	9.9+/-24.2	0,5,2198	79.0	65.0	70.0		1472,1472	2.2	1.0	5	dbSNP_134	70	0,8600		0,0,4300	yes	missense,missense	FLT4	NM_002020.4,NM_182925.4	64,64	0,5,6498	AA,AG,GG		0.0,0.1135,0.0384	benign,benign	491/1299,491/1364	180051011	5,13001	2203	4300	6503	SO:0001583	missense	2324	exon11			GTCACCGCCCTCC	X68203	CCDS4457.1, CCDS43412.1	5q34-q35	2013-01-29			ENSG00000037280	ENSG00000037280	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3767	protein-coding gene	gene with protein product		136352				1319394	Standard	NM_002020		Approved	VEGFR3, PCL	uc003mlz.4	P35916	OTTHUMG00000130931	ENST00000261937.6:c.1472C>T	5.37:g.180051011G>A	ENSP00000261937:p.Ala491Val	Somatic	172	0		WXS	Illumina GAIIx	Phase_I	236	8	NM_182925	0	0	1	1	0	A8K6L4|B5A926|Q16067|Q86W07|Q86W08	Missense_Mutation	SNP	ENST00000261937.6	37	CCDS4457.1	.	.	.	.	.	.	.	.	.	.	G	7.552	0.662898	0.14710	0.001135	0.0	ENSG00000037280	ENST00000261937;ENST00000393347;ENST00000502649;ENST00000376868	D;D;D	0.94000	-3.33;-3.33;-3.33	4.72	2.24	0.28232	Immunoglobulin subtype (1);Immunoglobulin-like (1);	.	.	.	.	T	0.76666	0.4019	N	0.01352	-0.895	0.25061	N	0.99106	P;B;B;B	0.45569	0.861;0.003;0.0;0.0	B;B;B;B	0.35312	0.2;0.002;0.002;0.002	T	0.70898	-0.4747	9	0.29301	T	0.29	.	8.2106	0.31481	0.1307:0.0:0.1422:0.7271	.	491;301;491;491	P35916-3;E9PFB0;E9PD35;P35916	.;.;.;VGFR3_HUMAN	V	491;491;491;301	ENSP00000261937:A491V;ENSP00000377016:A491V;ENSP00000426057:A491V	ENSP00000261937:A491V	A	-	2	0	FLT4	179983617	1.000000	0.71417	0.977000	0.42913	0.001000	0.01503	3.322000	0.52007	0.269000	0.21961	-1.566000	0.00877	GCG	G|0.999;A|0.001		0.637	FLT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253527.4		
JARID2	3720	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	15501341	15501341	+	Missense_Mutation	SNP	C	C	T	rs548954910		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr6:15501341C>T	ENST00000341776.2	+	8	2393	c.2149C>T	c.(2149-2151)Cgg>Tgg	p.R717W	JARID2_ENST00000397311.3_Missense_Mutation_p.R545W|JARID2_ENST00000541660.1_Missense_Mutation_p.R679W	NM_004973.3	NP_004964.2	Q92833	JARD2_HUMAN	jumonji, AT rich interactive domain 2	717					central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|liver development (GO:0001889)|negative regulation of cell proliferation (GO:0008285)|negative regulation of histone methylation (GO:0031061)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K9 methylation (GO:0051574)|spleen development (GO:0048536)|stem cell differentiation (GO:0048863)|thymus development (GO:0048538)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(5)|stomach(1)	59	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)				AGAGGAGCACCGGCGGCTGGA	0.637													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16638	0.0		0.0	False		,,,				2504	0.0				p.R717W		.											.	JARID2-228	0			c.C2149T						.						64.0	76.0	72.0					6																	15501341		2203	4300	6503	SO:0001583	missense	3720	exon8			GAGCACCGGCGGC	U57592	CCDS4533.1, CCDS58996.1	6p24-p23	2008-02-05	2006-10-06	2004-01-30	ENSG00000008083	ENSG00000008083			6196	protein-coding gene	gene with protein product		601594	"""jumonji (mouse) homolog"", ""Jumonji, AT rich interactive domain 2"""	JMJ		8894700	Standard	NM_001267040		Approved		uc003nbj.4	Q92833	OTTHUMG00000014293	ENST00000341776.2:c.2149C>T	6.37:g.15501341C>T	ENSP00000341280:p.Arg717Trp	Somatic	245	2		WXS	Illumina GAIIx	Phase_I	190	176	NM_004973	0	0	1	1	0	A8K9Z6|B7Z5S5|B7Z8L0|Q5U5L5|Q86X63	Missense_Mutation	SNP	ENST00000341776.2	37	CCDS4533.1	.	.	.	.	.	.	.	.	.	.	C	19.59	3.855772	0.71834	.	.	ENSG00000008083	ENST00000341776;ENST00000397311;ENST00000541660	D;D;D	0.89270	-1.85;-1.85;-2.49	5.05	5.05	0.67936	.	0.249386	0.36409	N	0.002616	D	0.85234	0.5650	N	0.22421	0.69	0.36778	D	0.884166	D;D	0.67145	0.996;0.974	P;P	0.60236	0.871;0.59	D	0.88375	0.2997	10	0.72032	D	0.01	-12.152	11.7371	0.51771	0.3035:0.6965:0.0:0.0	.	679;717	F5H590;Q92833	.;JARD2_HUMAN	W	717;545;679	ENSP00000341280:R717W;ENSP00000380478:R545W;ENSP00000444623:R679W	ENSP00000341280:R717W	R	+	1	2	JARID2	15609320	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.058000	0.49939	2.339000	0.79563	0.561000	0.74099	CGG	.		0.637	JARID2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039926.1	NM_004973	
ALDH5A1	7915	broad.mit.edu	37	6	24533862	24533862	+	Silent	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr6:24533862C>T	ENST00000357578.3	+	10	1675	c.1530C>T	c.(1528-1530)tcC>tcT	p.S510S	ALDH5A1_ENST00000348925.2_Silent_p.S523S|ALDH5A1_ENST00000491546.1_Silent_p.S482S|ALDH5A1_ENST00000546278.1_Silent_p.S422S	NM_001080.3	NP_001071.1	P51649	SSDH_HUMAN	aldehyde dehydrogenase 5 family, member A1	510					acetate metabolic process (GO:0006083)|central nervous system development (GO:0007417)|galactosylceramide metabolic process (GO:0006681)|gamma-aminobutyric acid catabolic process (GO:0009450)|glucose metabolic process (GO:0006006)|glucosylceramide metabolic process (GO:0006678)|glutamate metabolic process (GO:0006536)|glutamine metabolic process (GO:0006541)|glutathione metabolic process (GO:0006749)|glycerophospholipid metabolic process (GO:0006650)|neurotransmitter catabolic process (GO:0042135)|neurotransmitter secretion (GO:0007269)|post-embryonic development (GO:0009791)|protein homotetramerization (GO:0051289)|respiratory electron transport chain (GO:0022904)|short-chain fatty acid metabolic process (GO:0046459)|succinate metabolic process (GO:0006105)|synaptic transmission (GO:0007268)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	protein homodimerization activity (GO:0042803)|succinate-semialdehyde dehydrogenase (NAD+) activity (GO:0004777)|succinate-semialdehyde dehydrogenase [NAD(P)+] activity (GO:0009013)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(7)|skin(2)|urinary_tract(1)	20					Chlormerodrin(DB00534)|Succinic acid(DB00139)|Valproic Acid(DB00313)	TGAAGCAGTCCGGCCTTGGGC	0.498																																					p.S523S		.											.	ALDH5A1-90	0			c.C1569T						.						148.0	145.0	146.0					6																	24533862		2203	4300	6503	SO:0001819	synonymous_variant	7915	exon11			GCAGTCCGGCCTT	L34820	CCDS4555.1, CCDS4556.1	6p22	2013-06-03	2008-07-31		ENSG00000112294	ENSG00000112294	1.2.1.24	"""Aldehyde dehydrogenases"""	408	protein-coding gene	gene with protein product	"""succinate-semialdehyde dehydrogenase"""	610045				7814412, 9059628	Standard	NM_001080		Approved	SSADH, SSDH	uc003nef.3	P51649	OTTHUMG00000014356	ENST00000357578.3:c.1530C>T	6.37:g.24533862C>T		Somatic	177	0		WXS	Illumina GAIIx	Phase_I	155	6	NM_170740	0	0	11	11	0	B2RD26|G5E949|Q546H9|Q8N3W6	Silent	SNP	ENST00000357578.3	37	CCDS4555.1																																																																																			.		0.498	ALDH5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040007.2		
GPANK1	7918	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	31630341	31630341	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr6:31630341G>A	ENST00000375906.1	-	4	1457	c.773C>T	c.(772-774)cCg>cTg	p.P258L	GPANK1_ENST00000375893.2_Missense_Mutation_p.P258L|GPANK1_ENST00000375900.4_Missense_Mutation_p.P258L|C6orf47_ENST00000375911.1_5'Flank|CSNK2B_ENST00000375885.4_5'Flank|Y_RNA_ENST00000364337.1_RNA|GPANK1_ENST00000375895.2_Missense_Mutation_p.P258L|GPANK1_ENST00000375896.4_Missense_Mutation_p.P258L|C6orf47-AS1_ENST00000422049.1_RNA	NM_001199237.1	NP_001186166.1	O95872	GPAN1_HUMAN	G patch domain and ankyrin repeats 1	258	G-patch. {ECO:0000255|PROSITE- ProRule:PRU00092}.						nucleic acid binding (GO:0003676)			central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(7)	12						TTTGAAGCCCGGGCTGGAGAT	0.642																																					p.P258L		.											.	GPANK1-91	0			c.C773T						.						40.0	49.0	46.0					6																	31630341		1511	2708	4219	SO:0001583	missense	7918	exon4			AAGCCCGGGCTGG		CCDS4711.1	6p21.3	2013-01-28	2010-11-24	2010-11-24	ENSG00000204438	ENSG00000204438		"""Ankyrin repeat domain containing"", ""G patch domain containing"""	13920	protein-coding gene	gene with protein product	"""G patch domain containing 10"", ""ankyrin repeat domain 59"""	142610	"""HLA-B associated transcript 4"""	BAT4		2911734, 2813433	Standard	NM_001199237		Approved	G5, D6S54E, GPATCH10, ANKRD59	uc021yuu.1	O95872	OTTHUMG00000031174	ENST00000375906.1:c.773C>T	6.37:g.31630341G>A	ENSP00000365071:p.Pro258Leu	Somatic	92	0		WXS	Illumina GAIIx	Phase_I	76	65	NM_001199238	0	0	2	34	32	A6NG25|B0UXA2|Q5SQ49	Missense_Mutation	SNP	ENST00000375906.1	37	CCDS4711.1	.	.	.	.	.	.	.	.	.	.	G	15.65	2.897081	0.52121	.	.	ENSG00000204438	ENST00000375906;ENST00000375896;ENST00000375893;ENST00000375895;ENST00000375900	T;T;T;T;T	0.26518	1.73;1.73;1.73;1.73;1.73	4.85	4.85	0.62838	D111/G-patch (3);	0.283792	0.33534	N	0.004812	T	0.13286	0.0322	N	0.14661	0.345	0.47547	D	0.999458	D	0.58268	0.982	P	0.50490	0.642	T	0.04870	-1.0921	10	0.27785	T	0.31	-24.5289	15.4974	0.75666	0.0:0.0:1.0:0.0	.	258	O95872	GPAN1_HUMAN	L	258	ENSP00000365071:P258L;ENSP00000365060:P258L;ENSP00000365057:P258L;ENSP00000365059:P258L;ENSP00000365065:P258L	ENSP00000365057:P258L	P	-	2	0	GPANK1	31738320	1.000000	0.71417	1.000000	0.80357	0.382000	0.30200	3.394000	0.52551	2.519000	0.84933	0.655000	0.94253	CCG	.		0.642	GPANK1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000144445.2	NM_033177	
C2	717	broad.mit.edu	37	6	31895915	31895915	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr6:31895915G>A	ENST00000299367.5	+	2	506	c.230G>A	c.(229-231)cGg>cAg	p.R77Q	C2_ENST00000418949.2_Missense_Mutation_p.R77Q|CFB_ENST00000456570.1_Missense_Mutation_p.R77Q|C2_ENST00000469372.1_Intron|CFB_ENST00000477310.1_Missense_Mutation_p.R77Q|C2_ENST00000452323.2_Intron|CFB_ENST00000556679.1_Missense_Mutation_p.R77Q|C2_ENST00000442278.2_Intron	NM_000063.4	NP_000054.2	P06681	CO2_HUMAN	complement component 2	77	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|positive regulation of apoptotic cell clearance (GO:2000427)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(12)|ovary(1)|skin(2)|urinary_tract(2)	27		Ovarian(999;0.00965)		LUAD - Lung adenocarcinoma(999;0.247)		GGAGCCACCCGGTCTCTGTCT	0.622																																					p.R77Q		.											.	C2-92	0			c.G230A						.						14.0	15.0	15.0					6																	31895915		2198	4296	6494	SO:0001583	missense	717	exon2			CCACCCGGTCTCT		CCDS4728.1, CCDS54991.1, CCDS56416.1, CCDS75427.1, CCDS75428.1	6p21.3	2014-09-17			ENSG00000166278	ENSG00000166278		"""Complement system"""	1248	protein-coding gene	gene with protein product		613927					Standard	NM_001145903		Approved		uc011hbs.1	P06681	OTTHUMG00000031190	ENST00000299367.5:c.230G>A	6.37:g.31895915G>A	ENSP00000299367:p.Arg77Gln	Somatic	33	0		WXS	Illumina GAIIx	Phase_I	28	3	NM_000063	0	0	0	0	0	B4DPF3|B4DV20|E9PFN7|O19694|Q13904	Missense_Mutation	SNP	ENST00000299367.5	37	CCDS4728.1	.	.	.	.	.	.	.	.	.	.	G	17.15	3.315510	0.60524	.	.	ENSG00000166278;ENSG00000166278;ENSG00000166278;ENSG00000166278;ENSG00000243649;ENSG00000244255;ENSG00000244255	ENST00000413154;ENST00000299367;ENST00000447952;ENST00000418949;ENST00000556679;ENST00000456570;ENST00000477310	T;D;T;T;D;D;D	0.82081	1.43;-1.5;1.2;1.24;-1.57;-1.57;-1.53	5.22	-1.45	0.08828	Complement control module (2);Sushi/SCR/CCP (1);	0.222643	0.23108	N	0.051834	T	0.40619	0.1124	.	.	.	0.09310	N	1	B;B;B	0.25312	0.041;0.041;0.123	B;B;B	0.12837	0.006;0.006;0.008	T	0.30327	-0.9982	9	0.22706	T	0.39	-9.8824	1.9286	0.03322	0.2367:0.2409:0.3994:0.123	.	77;77;77	B4E1Z4;P06681;Q8N6L6	.;CO2_HUMAN;.	Q	77	ENSP00000403325:R77Q;ENSP00000299367:R77Q;ENSP00000391354:R77Q;ENSP00000406190:R77Q;ENSP00000451848:R77Q;ENSP00000410815:R77Q;ENSP00000418996:R77Q	ENSP00000299367:R77Q	R	+	2	0	CFB;C2;XXbac-BPG116M5.17	32003894	0.000000	0.05858	0.004000	0.12327	0.522000	0.34438	-0.553000	0.06012	0.032000	0.15435	0.655000	0.94253	CGG	.		0.622	C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076379.9		
HLA-DQB1	3119	bcgsc.ca	37	6	32632770	32632770	+	Missense_Mutation	SNP	A	A	G	rs551086568		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr6:32632770A>G	ENST00000399084.1	-	3	362	c.184T>C	c.(184-186)Tac>Cac	p.Y62H	HLA-DQB1_ENST00000374943.4_Missense_Mutation_p.Y62H|HLA-DQB1_ENST00000399079.3_Missense_Mutation_p.Y62H|HLA-DQB1_ENST00000434651.2_Missense_Mutation_p.Y62H|HLA-DQB1_ENST00000399082.3_Intron|XXbac-BPG254F23.6_ENST00000443574.1_RNA			P01920	DQB1_HUMAN	major histocompatibility complex, class II, DQ beta 1	62	Beta-1.		Y -> H (in allele DQB1*05:01, allele DQB1*05:02, allele DQB1*05:03, allele DQB1*05:05, allele DQB1*06:03, allele DQB1*06:04, allele DQB1*06:07, allele DQB1*06:08, allele DQB1*06:14, allele DQB1*06:17, allele DQB1*06:21, allele DQB1*06:25, allele DQB1*06:27, allele DQB1*06:28, allele DQB1*06:30, allele DQB1*06:31, allele DQB1*06:32, allele DQB1*06:34, allele DQB1*06:36, allele DQB1*06:38 and allele DQB1*06:39).|Y -> S (in allele DQB1*02:01, allele DQB1*02:02, allele DQB1*02:03, allele DQB1*02:04 and allele DQB1*02:05).		antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|humoral immune response mediated by circulating immunoglobulin (GO:0002455)|immune response (GO:0006955)|immunoglobulin production involved in immunoglobulin mediated immune response (GO:0002381)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	MHC class II receptor activity (GO:0032395)|peptide antigen binding (GO:0042605)			breast(1)|large_intestine(1)|lung(1)|pancreas(1)	4					"""""""Insulin(DB00071)"""	TTATAGATGTATCTGGTCACA	0.612									T-cell Lymphoma, (Cutaneous) , Familial Clustering of;Sjgren syndrome;Melanoma, Familial Clustering of;ACTH-independent macronodular adrenal hyperplasia																												p.Y62H	Esophageal Squamous(151;720 1825 15000 40336 43415)	.											.	HLA-DQB1-22	0			c.T184C						.	A	HIS/TYR	1073,3123		281,511,1306	32.0	33.0	33.0		184	-0.1	0.0	6	dbSNP_86	33	2407,5957		687,1033,2462	yes	missense	HLA-DQB1	NM_002123.4	83	968,1544,3768	GG,GA,AA		28.7781,25.572,27.707	benign	62/262	32632770	3480,9080	2098	4182	6280	SO:0001583	missense	3119	exon2	Familial Cancer Database	incl.: Mycosis Fungoides, Sezary syndrome, Adult T-cell Lymphoma;Sjogren syndrome; ;AIMAH, Cushing disease, Adrenal, Familial	AGATGTATCTGGT		CCDS43451.1, CCDS59006.1	6p21.3	2013-01-11			ENSG00000179344	ENSG00000179344		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4944	protein-coding gene	gene with protein product		604305		HLA-DQB			Standard	NM_001243962		Approved	IDDM1, CELIAC1	uc031snw.1	P01920	OTTHUMG00000031124	ENST00000399084.1:c.184T>C	6.37:g.32632770A>G	ENSP00000382034:p.Tyr62His	Somatic	264	1		WXS	Illumina GAIIx	Phase_I	232	8	NM_002123	0	0	6	6	0	A1KR27|A2RPH3|A4Q9R4|A4USG2|A4USG5|A6N8I7|A9YQA0|B0S7Y7|B1A0K6|B1GXI3|B3VLT3|B5BLN7|B7VU69|C0MQ34|C0MQ35|C8ZL52|C8ZLJ8|C8ZLJ9|C9DRQ3|O19708|O19713|O19724|O62861|O78046|O78221|O78223|O98034|O98201|P01917|P01918|P01919|P03992|P05537|P79482|P79526|P79544|P79551|Q08GC8|Q09035|Q0E4V9|Q1M312|Q29731|Q29877|Q29884|Q29915|Q29966|Q2P9N3|Q2QK85|Q30061|Q30075|Q30076|Q30080|Q30081|Q30082|Q30083|Q30084|Q30089|Q30095|Q31633|Q38I47|Q45UE3|Q4QZB5|Q53I44|Q564J6|Q5G841|Q5ISH1|Q5ISH3|Q5W1E1|Q5Y7G8|Q643R4|Q6B9X1|Q70VH8|Q7YP69|Q8HWH0|Q8MH58|Q8SNB4|Q8SND1|Q8SP70|Q8WMA3|Q9BD17|Q9MYH2|Q9TPA9|Q9XRY6|Q9XRY7|Q9XRZ2	Missense_Mutation	SNP	ENST00000399084.1	37	CCDS43451.1	602	0.27564102564102566	143	0.29065040650406504	105	0.2900552486187845	108	0.1888111888111888	246	0.3245382585751979	.	2.199	-0.383452	0.04966	0.25572	0.287781	ENSG00000179344	ENST00000399079;ENST00000374943;ENST00000434651;ENST00000399084	T;T;T;T	0.00327	8.09;8.09;8.09;8.09	3.91	-0.0624	0.13780	.	0.800219	0.11126	U	0.596956	T	0.00073	0.0002	L	0.47016	1.485	0.80722	P	0.0	B;B;B;B	0.21520	0.057;0.006;0.002;0.002	B;B;B;B	0.30179	0.112;0.029;0.029;0.019	T	0.08006	-1.0743	9	0.39692	T	0.17	.	4.3567	0.11181	0.6308:0.1709:0.1983:0.0	rs1049069;rs3189148;rs9274404;rs12722119;rs16868409;rs28588809	72;62;27;62	Q59F80;A2AAZ0;A2VCT9;Q5Y7D6	.;.;.;.	H	62	ENSP00000382029:Y62H;ENSP00000364080:Y62H;ENSP00000407332:Y62H;ENSP00000382034:Y62H	ENSP00000364080:Y62H	Y	-	1	0	HLA-DQB1	32740748	0.000000	0.05858	0.009000	0.14445	0.002000	0.02628	-0.539000	0.06113	-0.159000	0.11021	-0.902000	0.02854	TAC	T|0.524;G|0.096;C|0.174;A|0.206		0.612	HLA-DQB1-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276127.1	NM_002123	
TREML2	79865	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	41165918	41165918	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr6:41165918C>T	ENST00000483722.1	-	2	490	c.305G>A	c.(304-306)cGa>cAa	p.R102Q		NM_024807.2	NP_079083.2	Q5T2D2	TRML2_HUMAN	triggering receptor expressed on myeloid cells-like 2	102	Ig-like V-type.				T cell activation (GO:0042110)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			breast(1)|central_nervous_system(1)|large_intestine(1)|lung(13)|ovary(1)|prostate(1)	18	Ovarian(28;0.0418)|Colorectal(47;0.196)					GCACCAGTATCGGCCTGAGTC	0.617																																					p.R102Q		.											.	TREML2-91	0			c.G305A						.																																			SO:0001583	missense	79865	exon2			CAGTATCGGCCTG	AK023755	CCDS4853.1, CCDS4853.2	6p21.1	2013-01-11	2004-04-14	2004-04-16	ENSG00000112195	ENSG00000112195		"""Immunoglobulin superfamily / V-set domain containing"""	21092	protein-coding gene	gene with protein product	"""TREM-like transcript 2"""	609715	"""chromosome 6 open reading frame 76"""	C6orf76		12645956	Standard	NM_024807		Approved	FLJ13693, TLT2, dJ238O23.1	uc010jxm.1	Q5T2D2	OTTHUMG00000016349	ENST00000483722.1:c.305G>A	6.37:g.41165918C>T	ENSP00000418767:p.Arg102Gln	Somatic	121	1		WXS	Illumina GAIIx	Phase_I	61	41	NM_024807	0	0	0	0	0	Q08AP8|Q08AP9|Q8IWY0|Q9H8E9	Missense_Mutation	SNP	ENST00000483722.1	37	CCDS4853.2	.	.	.	.	.	.	.	.	.	.	.	14.61	2.587260	0.46110	.	.	ENSG00000112195	ENST00000483722	T	0.65732	-0.17	4.75	2.54	0.30619	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.531902	0.15016	N	0.285286	T	0.53077	0.1774	L	0.50993	1.605	0.09310	N	1	D	0.89917	1.0	D	0.73380	0.98	T	0.32534	-0.9903	10	0.25106	T	0.35	-16.2612	5.4267	0.16429	0.0:0.7115:0.0:0.2885	.	102	Q5T2D2	TRML2_HUMAN	Q	102	ENSP00000418767:R102Q	ENSP00000418767:R102Q	R	-	2	0	TREML2	41273896	0.004000	0.15560	0.290000	0.24890	0.527000	0.34593	0.139000	0.16036	1.136000	0.42199	-0.222000	0.12452	CGA	.		0.617	TREML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043756.3	NM_024807	
PEX6	5190	hgsc.bcm.edu	37	6	42946490	42946490	+	Silent	SNP	C	C	A	rs9462858	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr6:42946490C>A	ENST00000304611.8	-	1	468	c.399G>T	c.(397-399)gtG>gtT	p.V133V	PEX6_ENST00000244546.4_Silent_p.V133V	NM_000287.3	NP_000278.3	Q13608	PEX6_HUMAN	peroxisomal biogenesis factor 6	133					ATP catabolic process (GO:0006200)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix, translocation (GO:0016561)|protein stabilization (GO:0050821)|protein targeting to peroxisome (GO:0006625)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)			NS(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(3)	15			all cancers(41;0.00235)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.0562)			GCGGTCCGGGCACTGGGAGGG	0.746													C|||	1662	0.331869	0.3691	0.3516	5008	,	,		10923	0.1002		0.4612	False		,,,				2504	0.3732				p.V133V		.											.	PEX6-91	0			c.G399T						.	C		1002,2080		214,574,753	2.0	3.0	3.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	399	2.1	0.9	6	dbSNP_119	3	2653,4001		636,1381,1310	no	coding-synonymous	PEX6	NM_000287.3		850,1955,2063	AA,AC,CC		39.8708,32.5114,37.5411		133/981	42946490	3655,6081	1541	3327	4868	SO:0001819	synonymous_variant	5190	exon1			TCCGGGCACTGGG	U56602	CCDS4877.1	6p22-p11	2010-04-21			ENSG00000124587	ENSG00000124587		"""ATPases / AAA-type"""	8859	protein-coding gene	gene with protein product		601498				8670792	Standard	NM_000287		Approved	PXAAA1, PAF-2	uc003otf.3	Q13608	OTTHUMG00000014713	ENST00000304611.8:c.399G>T	6.37:g.42946490C>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	10	NM_000287	0	0	0	11	11	Q5T8W1|Q8WYQ0|Q8WYQ1|Q8WYQ2|Q99476	Silent	SNP	ENST00000304611.8	37	CCDS4877.1																																																																																			C|0.673;A|0.327		0.746	PEX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040569.1	NM_000287	
SLC35B2	347734	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	44222512	44222512	+	Silent	SNP	G	G	A	rs146186426		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr6:44222512G>A	ENST00000393812.3	-	4	1373	c.1230C>T	c.(1228-1230)taC>taT	p.Y410Y	SLC35B2_ENST00000393810.1_3'UTR|SLC35B2_ENST00000495706.1_5'UTR|SLC35B2_ENST00000537814.1_Silent_p.Y277Y|MIR4647_ENST00000583964.1_RNA|SLC35B2_ENST00000538577.1_Silent_p.Y317Y	NM_178148.2	NP_835361.1	Q8TB61	S35B2_HUMAN	solute carrier family 35 (adenosine 3'-phospho 5'-phosphosulfate transporter), member B2	410					3'-phospho-5'-adenylyl sulfate transmembrane transport (GO:1902559)|3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|3'-phosphoadenosine 5'-phosphosulfate transport (GO:0046963)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|xenobiotic metabolic process (GO:0006805)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3'-phosphoadenosine 5'-phosphosulfate transmembrane transporter activity (GO:0046964)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(2)|kidney(3)|large_intestine(2)|lung(4)|ovary(2)|urinary_tract(1)	15	all_cancers(18;2e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			GGCCCCGCGCGTAGACTCTGA	0.582													g|||	1	0.000199681	0.0	0.0	5008	,	,		18082	0.001		0.0	False		,,,				2504	0.0				p.Y410Y		.											.	SLC35B2-91	0			c.C1230T						.	G		0,4406		0,0,2203	89.0	91.0	91.0		1230	-6.1	0.9	6	dbSNP_134	91	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	SLC35B2	NM_178148.2		0,2,6501	AA,AG,GG		0.0233,0.0,0.0154		410/433	44222512	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	347734	exon4			CCGCGCGTAGACT	AK075456	CCDS34462.1, CCDS69127.1, CCDS75462.1, CCDS75463.1	6p12.1-p11.21	2013-07-17	2013-07-17		ENSG00000157593	ENSG00000157593		"""Solute carriers"""	16872	protein-coding gene	gene with protein product		610788	"""solute carrier family 35, member B2"""				Standard	NM_001286517		Approved	UGTrel4	uc003oxd.3	Q8TB61	OTTHUMG00000014760	ENST00000393812.3:c.1230C>T	6.37:g.44222512G>A		Somatic	140	0		WXS	Illumina GAIIx	Phase_I	113	103	NM_178148	0	0	1	109	108	B4DDU9|F5H7Y9|Q2VY06|Q53GA3|Q5T9W1|Q5T9W2|Q7Z2G3|Q8NBK6|Q96AR6	Silent	SNP	ENST00000393812.3	37	CCDS34462.1																																																																																			G|1.000;A|0.000		0.582	SLC35B2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040724.2		
BEND3	57673	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	107390834	107390834	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr6:107390834G>A	ENST00000369042.1	-	4	1751	c.1561C>T	c.(1561-1563)Cgg>Tgg	p.R521W	BEND3_ENST00000429433.2_Missense_Mutation_p.R521W			Q5T5X7	BEND3_HUMAN	BEN domain containing 3	521										central_nervous_system(1)|cervix(2)|endometrium(3)|large_intestine(7)|lung(10)|ovary(4)|prostate(3)	30						CGACCCGGCCGCTCGCCCTCG	0.642																																					p.R521W		.											.	BEND3-71	0			c.C1561T						.						22.0	22.0	22.0					6																	107390834		2203	4298	6501	SO:0001583	missense	57673	exon5			CCGGCCGCTCGCC	AB046773	CCDS34507.1	6q21	2012-11-22	2008-10-03	2008-10-03	ENSG00000178409	ENSG00000178409		"""BEN domain containing"""	23040	protein-coding gene	gene with protein product			"""KIAA1553"""	KIAA1553			Standard	NM_001080450		Approved		uc003prs.2	Q5T5X7	OTTHUMG00000015308	ENST00000369042.1:c.1561C>T	6.37:g.107390834G>A	ENSP00000358038:p.Arg521Trp	Somatic	64	0		WXS	Illumina GAIIx	Phase_I	28	25	NM_001080450	0	0	0	2	2	A2RRH2|Q9HCL9	Missense_Mutation	SNP	ENST00000369042.1	37	CCDS34507.1	.	.	.	.	.	.	.	.	.	.	G	12.49	1.954560	0.34471	.	.	ENSG00000178409	ENST00000369042;ENST00000429433	.	.	.	5.06	3.17	0.36434	.	0.119716	0.53938	D	0.000049	T	0.41926	0.1180	N	0.19112	0.55	0.36713	D	0.880757	D	0.76494	0.999	P	0.60541	0.876	T	0.52830	-0.8523	9	0.87932	D	0	-41.6253	12.8775	0.57998	0.0:0.0:0.4895:0.5105	.	521	Q5T5X7	BEND3_HUMAN	W	521	.	ENSP00000358038:R521W	R	-	1	2	BEND3	107497527	1.000000	0.71417	0.999000	0.59377	0.243000	0.25628	4.307000	0.59123	1.331000	0.45412	0.561000	0.74099	CGG	.		0.642	BEND3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041686.1	NM_020913	
TULP4	56995	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	158900783	158900783	+	Splice_Site	SNP	C	C	T	rs372249713		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr6:158900783C>T	ENST00000367097.3	+	7	2384	c.1027C>T	c.(1027-1029)Cgc>Tgc	p.R343C	TULP4_ENST00000367094.2_Splice_Site_p.R343C	NM_020245.4	NP_064630.2	Q9NRJ4	TULP4_HUMAN	tubby like protein 4	343					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|response to nutrient (GO:0007584)	cytoplasm (GO:0005737)	sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(7)|kidney(2)|large_intestine(15)|lung(17)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Breast(66;0.000781)|Ovarian(120;0.0308)|Lung SC(201;0.164)|Prostate(117;0.171)		OV - Ovarian serous cystadenocarcinoma(65;1.64e-18)|BRCA - Breast invasive adenocarcinoma(81;2.67e-05)		TTCCTGCCAGCGCCCCATCAT	0.527																																					p.R343C		.											.	TULP4-91	0			c.C1027T						.	C	CYS/ARG,CYS/ARG	0,4406		0,0,2203	50.0	46.0	48.0		1027,1027	5.6	1.0	6		48	1,8599	1.2+/-3.3	0,1,4299	no	missense-near-splice,missense-near-splice	TULP4	NM_001007466.1,NM_020245.3	180,180	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	343/679,343/1544	158900783	1,13005	2203	4300	6503	SO:0001630	splice_region_variant	56995	exon7			TGCCAGCGCCCCA		CCDS34561.1, CCDS34562.1	6q25-q26	2013-01-10			ENSG00000130338	ENSG00000130338		"""WD repeat domain containing"""	15530	protein-coding gene	gene with protein product						11595174	Standard	NM_020245		Approved	TUSP, KIAA1397	uc003qrf.3	Q9NRJ4	OTTHUMG00000015910	ENST00000367097.3:c.1027-1C>T	6.37:g.158900783C>T		Somatic	106	0		WXS	Illumina GAIIx	Phase_I	56	52	NM_020245	0	0	0	0	0	Q5T3M2|Q5T3M3|Q9HD22|Q9P2F0	Missense_Mutation	SNP	ENST00000367097.3	37	CCDS34561.1	.	.	.	.	.	.	.	.	.	.	C	15.25	2.779279	0.49891	0.0	1.16E-4	ENSG00000130338	ENST00000367097;ENST00000367094	T;T	0.17528	2.27;2.27	5.63	5.63	0.86233	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.175606	0.48286	D	0.000199	T	0.10252	0.0251	M	0.62723	1.935	0.80722	D	1	B;B;B	0.15473	0.01;0.003;0.013	B;B;B	0.12156	0.003;0.002;0.007	T	0.04229	-1.0967	9	.	.	.	-8.2657	13.9093	0.63857	0.0:0.9273:0.0:0.0727	.	343;343;343	B4E202;Q9NRJ4-2;Q9NRJ4	.;.;TULP4_HUMAN	C	343	ENSP00000356064:R343C;ENSP00000356061:R343C	.	R	+	1	0	TULP4	158820771	1.000000	0.71417	1.000000	0.80357	0.771000	0.43674	3.461000	0.53035	2.651000	0.90000	0.561000	0.74099	CGC	.		0.527	TULP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042869.1	NM_020245	Missense_Mutation
HEATR2	54919	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	780485	780485	+	Silent	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr7:780485C>T	ENST00000297440.6	+	3	830	c.810C>T	c.(808-810)ggC>ggT	p.G270G	HEATR2_ENST00000438961.1_3'UTR|HEATR2_ENST00000313147.5_Silent_p.G270G	NM_017802.3	NP_060272.3	Q86Y56	HEAT2_HUMAN	HEAT repeat containing 2	270						cytoplasm (GO:0005737)				breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(2)|prostate(4)|skin(1)	22		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0182)|Epithelial(4;5.48e-17)|OV - Ovarian serous cystadenocarcinoma(56;1.95e-16)|all cancers(6;2.98e-14)		CCGTGGTGGGCGGCTGGCTGC	0.642																																					p.G270G		.											.	HEATR2-69	0			c.C810T						.						157.0	150.0	152.0					7																	780485		2203	4300	6503	SO:0001819	synonymous_variant	54919	exon3			GGTGGGCGGCTGG	AL832914, AK000404, NM_017802, AK056233	CCDS34580.1	7p22.3	2014-05-06	2006-05-19		ENSG00000164818	ENSG00000164818			26013	protein-coding gene	gene with protein product		614864				23040496	Standard	NM_017802		Approved	FLJ20397, FLJ31671, FLJ39381, FLJ25564, CILD18	uc010krz.1	Q86Y56	OTTHUMG00000151416	ENST00000297440.6:c.810C>T	7.37:g.780485C>T		Somatic	147	0		WXS	Illumina GAIIx	Phase_I	105	80	NM_017802	0	0	1	7	6	Q69YL1|Q96FI9|Q9NX75	Silent	SNP	ENST00000297440.6	37	CCDS34580.1	.	.	.	.	.	.	.	.	.	.	C	0.786	-0.760600	0.02996	.	.	ENSG00000164818	ENST00000437419;ENST00000440747	.	.	.	4.72	-6.4	0.01944	.	.	.	.	.	T	0.38401	0.1039	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.39502	-0.9611	4	.	.	.	-50.8142	3.6135	0.08069	0.2434:0.3755:0.2888:0.0923	.	.	.	.	W	43;72	.	.	R	+	1	2	HEATR2	747011	0.557000	0.26546	0.396000	0.26296	0.044000	0.14063	-0.296000	0.08287	-1.328000	0.02261	-1.157000	0.01802	CGG	.		0.642	HEATR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322542.1	NM_017802	
SDK1	221935	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	4169611	4169611	+	Silent	SNP	G	G	A	rs537498277		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr7:4169611G>A	ENST00000404826.2	+	27	4150	c.4011G>A	c.(4009-4011)tcG>tcA	p.S1337S	SDK1_ENST00000389531.3_Silent_p.S1337S	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	1337	Fibronectin type-III 7. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		ACACGCAGTCGGCCCTGCTGG	0.647																																					p.S1337S		.											.	SDK1-138	0			c.G4011A						.						56.0	53.0	54.0					7																	4169611		2203	4299	6502	SO:0001819	synonymous_variant	221935	exon27			GCAGTCGGCCCTG	AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.4011G>A	7.37:g.4169611G>A		Somatic	116	0		WXS	Illumina GAIIx	Phase_I	92	86	NM_152744	0	0	0	0	0	Q8TEN9|Q8TEP5|Q96N44	Silent	SNP	ENST00000404826.2	37	CCDS34590.1																																																																																			.		0.647	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323702.1	NM_152744	
PMS2	5395	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	6042243	6042243	+	Silent	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr7:6042243G>A	ENST00000265849.7	-	5	483	c.378C>T	c.(376-378)caC>caT	p.H126H	PMS2_ENST00000382321.4_Silent_p.H126H|PMS2_ENST00000469652.1_Intron|PMS2_ENST00000406569.3_Silent_p.H126H|PMS2_ENST00000441476.2_Silent_p.H20H|Y_RNA_ENST00000365120.1_RNA	NM_000535.5	NP_000526	P54278	PMS2_HUMAN	PMS2 postmeiotic segregation increased 2 (S. cerevisiae)	126					ATP catabolic process (GO:0006200)|mismatch repair (GO:0006298)|response to drug (GO:0042493)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|MutLalpha complex (GO:0032389)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|single base insertion or deletion binding (GO:0032138)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(6)|kidney(2)|large_intestine(11)|lung(13)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;4.39e-15)		TCGCCGATGCGTGGCAGGTAG	0.517			"""Mis, N, F"""			"""colorectal, endometrial, ovarian, medulloblastoma, glioma"""		Direct reversal of damage;Mismatch excision repair (MMR)	Turcot syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																												p.H126H		.	yes	Rec		"""Hereditary non-polyposis colorectal cancer, Turcot syndrome"""	7	7p22	5395	PMS2 postmeiotic segregation increased 2 (S. cerevisiae)		E	.	PMS2-1083	0			c.C378T						.						116.0	115.0	115.0					7																	6042243		2203	4300	6503	SO:0001819	synonymous_variant	5395	exon5	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	CGATGCGTGGCAG		CCDS5343.1	7p22.1	2014-09-17	2001-11-28		ENSG00000122512	ENSG00000122512			9122	protein-coding gene	gene with protein product		600259	"""postmeiotic segregation increased (S. cerevisiae) 2"""	PMSL2		8072530	Standard	NM_000535		Approved	H_DJ0042M02.9, HNPCC4	uc003spl.3	P54278	OTTHUMG00000023135	ENST00000265849.7:c.378C>T	7.37:g.6042243G>A		Somatic	107	1		WXS	Illumina GAIIx	Phase_I	72	8	NM_000535	0	0	13	13	0	B2R610|Q52LH6|Q5FBW9|Q5FBX1|Q5FBX2|Q75MR2	Silent	SNP	ENST00000265849.7	37	CCDS5343.1																																																																																			.		0.517	PMS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207353.3	NM_000535	
C7orf26	79034	broad.mit.edu	37	7	6639759	6639759	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr7:6639759G>A	ENST00000344417.5	+	4	1147	c.880G>A	c.(880-882)Gtc>Atc	p.V294I	C7orf26_ENST00000359073.5_Splice_Site_p.V197I|C7orf26_ENST00000472693.1_3'UTR	NM_024067.2	NP_076972.2	Q96N11	CG026_HUMAN	chromosome 7 open reading frame 26	294										endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|skin(1)	11		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)		CCACCTCAGCGTCCTGCAAGT	0.577																																					p.V294I		.											.	C7orf26-91	0			c.G880A						.						64.0	51.0	55.0					7																	6639759		2203	4300	6503	SO:0001583	missense	79034	exon4			CTCAGCGTCCTGC	BC005121	CCDS5353.1	7p22.1	2011-11-24			ENSG00000146576	ENSG00000146576			21702	protein-coding gene	gene with protein product							Standard	NM_024067		Approved	MGC2718	uc003sqo.1	Q96N11	OTTHUMG00000125517	ENST00000344417.5:c.880G>A	7.37:g.6639759G>A	ENSP00000340220:p.Val294Ile	Somatic	136	0		WXS	Illumina GAIIx	Phase_I	105	4	NM_024067	0	0	16	16	0	Q9BQ43	Missense_Mutation	SNP	ENST00000344417.5	37	CCDS5353.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.39|18.39	3.613155|3.613155	0.66672|0.66672	.|.	.|.	ENSG00000146576|ENSG00000146576	ENST00000445375|ENST00000344417;ENST00000359073	.|T;T	.|0.39592	.|1.07;1.15	5.08|5.08	4.2|4.2	0.49525|0.49525	.|.	.|0.053882	.|0.85682	.|D	.|0.000000	T|T	0.27967|0.27967	0.0689|0.0689	L|L	0.36672|0.36672	1.1|1.1	0.29997|0.29997	N|N	0.816338|0.816338	.|B;B	.|0.22983	.|0.078;0.078	.|B;B	.|0.17098	.|0.012;0.017	T|T	0.18085|0.18085	-1.0348|-1.0348	5|10	.|0.12766	.|T	.|0.61	-38.8368|-38.8368	8.505|8.505	0.33181|0.33181	0.1805:0.0:0.8195:0.0|0.1805:0.0:0.8195:0.0	.|.	.|197;294	.|Q96N11-2;Q96N11	.|.;CG026_HUMAN	H|I	31|294;197	.|ENSP00000340220:V294I;ENSP00000351974:V197I	.|ENSP00000340220:V294I	R|V	+|+	2|1	0|0	C7orf26|C7orf26	6606284|6606284	1.000000|1.000000	0.71417|0.71417	0.982000|0.982000	0.44146|0.44146	0.655000|0.655000	0.38815|0.38815	4.654000|4.654000	0.61469|0.61469	1.462000|1.462000	0.47948|0.47948	0.555000|0.555000	0.69702|0.69702	CGT|GTC	.		0.577	C7orf26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246844.2	NM_024067	
HECW1	23072	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	43351432	43351432	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr7:43351432G>A	ENST00000395891.2	+	4	703	c.98G>A	c.(97-99)cGc>cAc	p.R33H	HECW1_ENST00000453890.1_Missense_Mutation_p.R33H	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1	33					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						CAGAGCCGACGCCGGTGCAAG	0.607																																					p.R33H		.											.	HECW1-669	0			c.G98A						.						52.0	59.0	57.0					7																	43351432		1950	4134	6084	SO:0001583	missense	23072	exon4			GCCGACGCCGGTG	AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.98G>A	7.37:g.43351432G>A	ENSP00000379228:p.Arg33His	Somatic	97	0		WXS	Illumina GAIIx	Phase_I	84	8	NM_015052	0	0	0	0	0	A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Missense_Mutation	SNP	ENST00000395891.2	37	CCDS5469.2	.	.	.	.	.	.	.	.	.	.	G	33	5.196408	0.94960	.	.	ENSG00000002746	ENST00000395891;ENST00000453890;ENST00000265522	T;T	0.35605	1.3;1.3	5.96	5.96	0.96718	.	0.183297	0.48767	D	0.000161	T	0.57607	0.2065	M	0.66939	2.045	0.58432	D	0.999992	D;D;D	0.71674	0.998;0.998;0.994	P;P;P	0.58970	0.849;0.77;0.656	T	0.56111	-0.8033	10	0.59425	D	0.04	.	20.3928	0.98949	0.0:0.0:1.0:0.0	.	33;65;33	B4DH42;B3KR18;Q76N89	.;.;HECW1_HUMAN	H	33;33;32	ENSP00000379228:R33H;ENSP00000407774:R33H	ENSP00000265522:R32H	R	+	2	0	HECW1	43317957	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.140000	0.77322	2.813000	0.96785	0.655000	0.94253	CGC	.		0.607	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250893.2	NM_015052	
PHKG1	5260	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	56149873	56149873	+	Silent	SNP	G	G	A	rs544129411	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr7:56149873G>A	ENST00000297373.2	-	7	815	c.621C>T	c.(619-621)taC>taT	p.Y207Y	PHKG1_ENST00000452681.2_Silent_p.Y239Y|PHKG1_ENST00000489604.1_5'Flank|PHKG1_ENST00000537360.1_Silent_p.Y153Y	NM_001258460.1|NM_006213.4	NP_001245389.1|NP_006204.1	Q16816	PHKG1_HUMAN	phosphorylase kinase, gamma 1 (muscle)	207	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)	ATP binding (GO:0005524)|phosphorylase kinase activity (GO:0004689)|tau-protein kinase activity (GO:0050321)			endometrium(1)|large_intestine(1)|lung(5)	7	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			CCTCTTTCCCGTAGCCCGGGT	0.637													G|||	2	0.000399361	0.0	0.0	5008	,	,		17889	0.0		0.0	False		,,,				2504	0.002				p.Y239Y	Melanoma(184;580 2064 5329 24177 35303)	.											.	PHKG1-424	0			c.C717T						.						85.0	81.0	83.0					7																	56149873		2203	4300	6503	SO:0001819	synonymous_variant	5260	exon8			TTTCCCGTAGCCC	X80590	CCDS5525.1, CCDS59057.1	7p11.2	2009-07-10			ENSG00000164776	ENSG00000164776	2.7.11.19		8930	protein-coding gene	gene with protein product		172470		PHKG		8530014	Standard	NM_001258459		Approved		uc011kdb.2	Q16816	OTTHUMG00000023869	ENST00000297373.2:c.621C>T	7.37:g.56149873G>A		Somatic	119	0		WXS	Illumina GAIIx	Phase_I	73	63	NM_001258459	0	0	0	4	4	B7Z1D0|F5H2S1|Q75LP5	Silent	SNP	ENST00000297373.2	37	CCDS5525.1																																																																																			.		0.637	PHKG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251587.1	NM_006213	
GTPBP10	85865	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	89982177	89982177	+	Silent	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr7:89982177C>T	ENST00000222511.6	+	2	147	c.81C>T	c.(79-81)tcC>tcT	p.S27S	GTPBP10_ENST00000257659.8_Silent_p.S27S	NM_033107.3	NP_149098.2	A4D1E9	GTPBA_HUMAN	GTP-binding protein 10 (putative)	27					ribosome biogenesis (GO:0042254)	chromosome (GO:0005694)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|magnesium ion binding (GO:0000287)|poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(2)|large_intestine(3)|lung(4)	10						GGGGAGGATCCGGTGGAATGG	0.388											OREG0003797	type=REGULATORY REGION|Gene=BC021573|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.S27S		.											.	GTPBP10-68	0			c.C81T						.						166.0	162.0	163.0					7																	89982177		2203	4300	6503	SO:0001819	synonymous_variant	85865	exon2			AGGATCCGGTGGA		CCDS5617.1, CCDS43614.1	7q21.13	2006-08-15			ENSG00000105793	ENSG00000105793			25106	protein-coding gene	gene with protein product		610920				12477932	Standard	NM_001042717		Approved	DKFZP686A10121, FLJ38242	uc003ukm.2	A4D1E9	OTTHUMG00000023655	ENST00000222511.6:c.81C>T	7.37:g.89982177C>T		Somatic	165	2	1271	WXS	Illumina GAIIx	Phase_I	102	94	NM_001042717	0	0	0	1	1	B4DFY6|Q3B7A6|Q5H9V2|Q8IXG8|Q8N982|Q8WU16|Q9BSP1|Q9Y6T6	Silent	SNP	ENST00000222511.6	37	CCDS5617.1																																																																																			.		0.388	GTPBP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059976.3	NM_033107	
TSC22D4	81628	bcgsc.ca	37	7	100064719	100064719	+	Silent	SNP	A	A	G	rs7806537	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr7:100064719A>G	ENST00000300181.2	-	5	1805	c.1051T>C	c.(1051-1053)Ttg>Ctg	p.L351L	TSC22D4_ENST00000496728.1_Intron|C7orf61_ENST00000332375.3_5'Flank|TSC22D4_ENST00000393991.1_Silent_p.L112L	NM_030935.3	NP_112197.1	Q9Y3Q8	T22D4_HUMAN	TSC22 domain family, member 4	351	Leucine-zipper.				negative regulation of transcription, DNA-templated (GO:0045892)|response to osmotic stress (GO:0006970)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|kidney(1)|large_intestine(1)|lung(2)|skin(1)|urinary_tract(1)	8	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CGCTCCGCCAATTCCCGGATC	0.692													G|||	1684	0.336262	0.4478	0.2651	5008	,	,		16634	0.0972		0.3956	False		,,,				2504	0.4213				p.L351L		.											.	TSC22D4-220	0			c.T1051C						.	G		1922,2484	624.6+/-394.4	428,1066,709	50.0	51.0	51.0		1051	3.3	1.0	7	dbSNP_116	51	3333,5267	643.3+/-399.9	640,2053,1607	no	coding-synonymous	TSC22D4	NM_030935.3		1068,3119,2316	GG,GA,AA		38.7558,43.6223,40.4044		351/396	100064719	5255,7751	2203	4300	6503	SO:0001819	synonymous_variant	81628	exon5			CCGCCAATTCCCG	BC010406	CCDS5695.1	7p21-p15	2010-04-30			ENSG00000166925	ENSG00000166925			21696	protein-coding gene	gene with protein product		611914					Standard	NM_030935		Approved	THG-1, TILZ2	uc003uva.3	Q9Y3Q8	OTTHUMG00000150233	ENST00000300181.2:c.1051T>C	7.37:g.100064719A>G		Somatic	119	0		WXS	Illumina GAIIx	Phase_I	93	5	NM_030935	0	0	425	425	0	A4D2C3|A8MWR6|D6W5V9	Silent	SNP	ENST00000300181.2	37	CCDS5695.1																																																																																			A|0.644;G|0.356		0.692	TSC22D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316970.1	NM_030935	
DOCK4	9732	broad.mit.edu	37	7	111629088	111629088	+	Missense_Mutation	SNP	C	C	T	rs200422451		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr7:111629088C>T	ENST00000437633.1	-	6	702	c.446G>A	c.(445-447)cGg>cAg	p.R149Q	DOCK4_ENST00000428084.1_Missense_Mutation_p.R149Q|DOCK4_ENST00000476846.1_5'UTR	NM_014705.3	NP_055520.3	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4	149					cell chemotaxis (GO:0060326)|positive regulation of Rac GTPase activity (GO:0032855)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|stereocilium (GO:0032420)|stereocilium bundle (GO:0032421)	guanyl-nucleotide exchange factor activity (GO:0005085)|PDZ domain binding (GO:0030165)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)|receptor tyrosine kinase binding (GO:0030971)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(13)|lung(31)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(4)	72		Acute lymphoblastic leukemia(1;0.0441)				CCAGTCAAGCCGGGCAGTAAT	0.562													C|||	1	0.000199681	0.0	0.0	5008	,	,		17153	0.0		0.001	False		,,,				2504	0.0				p.R149Q		.											.	DOCK4-26	0			c.G446A						.						60.0	61.0	61.0					7																	111629088		2058	4187	6245	SO:0001583	missense	9732	exon6			TCAAGCCGGGCAG		CCDS47688.1	7q31.1	2007-08-07			ENSG00000128512	ENSG00000128512			19192	protein-coding gene	gene with protein product		607679				12432077, 12628187	Standard	XM_006716188		Approved	FLJ34238, KIAA0716	uc003vfx.3	Q8N1I0	OTTHUMG00000155077	ENST00000437633.1:c.446G>A	7.37:g.111629088C>T	ENSP00000404179:p.Arg149Gln	Somatic	177	1		WXS	Illumina GAIIx	Phase_I	117	4	NM_014705	0	0	0	0	0	O14584|O94824|Q8NB45	Missense_Mutation	SNP	ENST00000437633.1	37	CCDS47688.1	1|1	4.578754578754579E-4|4.578754578754579E-4	0|0	0.0|0.0	0|0	0.0|0.0	0|0	0.0|0.0	1|1	0.0013192612137203166|0.0013192612137203166	C|C	33|33	5.278894|5.278894	0.95489|0.95489	.|.	.|.	ENSG00000128512|ENSG00000128512	ENST00000445943|ENST00000352877;ENST00000428084;ENST00000437633;ENST00000342288;ENST00000544250	.|T;T	.|0.02916	.|4.11;4.11	5.76|5.76	5.76|5.76	0.90799|0.90799	.|.	.|0.051904	.|0.85682	.|D	.|0.000000	T|T	0.06600|0.06600	0.0169|0.0169	M|M	0.63428|0.63428	1.95|1.95	0.80722|0.80722	D|D	1|1	.|B;P;P;P	.|0.48503	.|0.452;0.911;0.821;0.821	.|B;B;B;B	.|0.43225	.|0.109;0.298;0.412;0.298	T|T	0.36237|0.36237	-0.9756|-0.9756	5|10	.|0.34782	.|T	.|0.22	.|.	18.9739|18.9739	0.92728|0.92728	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|149;149;149;149	.|A4D0S8;Q149N6;Q149N5;Q8N1I0	.|.;.;.;DOCK4_HUMAN	S|Q	137|137;149;149;137;148	.|ENSP00000410746:R149Q;ENSP00000404179:R149Q	.|ENSP00000345432:R137Q	G|R	-|-	1|2	0|0	DOCK4|DOCK4	111416324|111416324	1.000000|1.000000	0.71417|0.71417	0.895000|0.895000	0.35142|0.35142	0.707000|0.707000	0.40811|0.40811	7.768000|7.768000	0.85345|0.85345	2.706000|2.706000	0.92434|0.92434	0.655000|0.655000	0.94253|0.94253	GGC|CGG	C|0.999;T|0.000		0.562	DOCK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338369.4	NM_014705	
PLXNA4	91584	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	131913155	131913155	+	Missense_Mutation	SNP	G	G	A	rs374091023		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr7:131913155G>A	ENST00000359827.3	-	6	2640	c.1678C>T	c.(1678-1680)Cgg>Tgg	p.R560W	PLXNA4_ENST00000321063.4_Missense_Mutation_p.R560W			Q9HCM2	PLXA4_HUMAN	plexin A4	560					anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						ACCGTCAGCCGGACACACTGC	0.587																																					p.R560W		.											.	PLXNA4-91	0			c.C1678T						.	G	TRP/ARG	0,3982		0,0,1991	82.0	87.0	85.0		1678	5.0	1.0	7		85	1,8337		0,1,4168	no	missense	PLXNA4	NM_020911.1	101	0,1,6159	AA,AG,GG		0.012,0.0,0.0081	probably-damaging	560/1895	131913155	1,12319	1991	4169	6160	SO:0001583	missense	91584	exon6			TCAGCCGGACACA	AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.1678C>T	7.37:g.131913155G>A	ENSP00000352882:p.Arg560Trp	Somatic	219	1		WXS	Illumina GAIIx	Phase_I	129	115	NM_020911	0	0	0	1	1	A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Missense_Mutation	SNP	ENST00000359827.3	37	CCDS43646.1	.	.	.	.	.	.	.	.	.	.	G	28.8	4.947924	0.92593	0.0	1.2E-4	ENSG00000221866	ENST00000321063;ENST00000359827	T;T	0.22945	1.93;1.93	5.91	5.01	0.66863	.	0.000000	0.85682	D	0.000000	T	0.31827	0.0809	L	0.34521	1.04	0.80722	D	1	D	0.71674	0.998	P	0.51657	0.676	T	0.07790	-1.0754	10	0.66056	D	0.02	.	16.3156	0.82923	0.0:0.0:0.8667:0.1333	.	560	Q9HCM2	PLXA4_HUMAN	W	560	ENSP00000323194:R560W;ENSP00000352882:R560W	ENSP00000323194:R560W	R	-	1	2	PLXNA4	131563695	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	3.637000	0.54324	1.457000	0.47850	0.655000	0.94253	CGG	.		0.587	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338422.2	NM_181775	
KMT2C	58508	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	151864452	151864452	+	Missense_Mutation	SNP	G	G	A	rs145072739		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr7:151864452G>A	ENST00000262189.6	-	42	9747	c.9529C>T	c.(9529-9531)Cgt>Tgt	p.R3177C	KMT2C_ENST00000355193.2_Missense_Mutation_p.R3177C	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	3177	Gln-rich.				histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										TACTGCTTACGCTGTGAATCA	0.353																																					p.R3177C		.											.	MLL3-1398	0			c.C9529T						.	G	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	65.0	65.0	65.0		9529	4.9	1.0	7	dbSNP_134	65	0,8600		0,0,4300	no	missense	MLL3	NM_170606.2	180	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	3177/4912	151864452	1,13005	2203	4300	6503	SO:0001583	missense	58508	exon42			GCTTACGCTGTGA	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.9529C>T	7.37:g.151864452G>A	ENSP00000262189:p.Arg3177Cys	Somatic	35	0		WXS	Illumina GAIIx	Phase_I	31	30	NM_170606	0	0	0	0	0	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	CCDS5931.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.87|10.87	1.471469|1.471469	0.26423|0.26423	2.27E-4|2.27E-4	0.0|0.0	ENSG00000055609|ENSG00000055609	ENST00000360104|ENST00000262189;ENST00000355193	.|D;D	.|0.85339	.|-1.96;-1.97	5.83|5.83	4.88|4.88	0.63580|0.63580	.|.	.|0.000000	.|0.42821	.|D	.|0.000652	D|D	0.90813|0.90813	0.7115|0.7115	M|M	0.67953|0.67953	2.075|2.075	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.83275	.|0.995;0.996;0.95	D|D	0.91189|0.91189	0.4982|0.4982	5|10	.|0.87932	.|D	.|0	.|.	13.631|13.631	0.62196|0.62196	0.0:0.0:0.7379:0.2621|0.0:0.0:0.7379:0.2621	.|.	.|3177;2238;3177	.|Q8NEZ4;Q8NEZ4-2;Q8NEZ4-3	.|MLL3_HUMAN;.;.	V|C	682|3177	.|ENSP00000262189:R3177C;ENSP00000347325:R3177C	.|ENSP00000262189:R3177C	A|R	-|-	2|1	0|0	MLL3|MLL3	151495385|151495385	0.998000|0.998000	0.40836|0.40836	0.982000|0.982000	0.44146|0.44146	0.583000|0.583000	0.36354|0.36354	2.734000|2.734000	0.47368|0.47368	2.761000|2.761000	0.94854|0.94854	0.650000|0.650000	0.86243|0.86243	GCG|CGT	G|1.000;A|0.000		0.353	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
SGK223	157285	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	8185743	8185743	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr8:8185743G>A	ENST00000520004.1	-	5	2813	c.2549C>T	c.(2548-2550)tCg>tTg	p.S850L	SGK223_ENST00000330777.4_Missense_Mutation_p.S850L			Q86YV5	SG223_HUMAN		852							ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)										GTTGGTTTCCGAGTGGCTTAG	0.572																																					p.S850L	GBM(34;731 755 10259 33573 33867)	.											.	.	0			c.C2549T						.						162.0	174.0	170.0					8																	8185743		2000	4157	6157	SO:0001583	missense	0	exon4			GTTTCCGAGTGGC																												ENST00000520004.1:c.2549C>T	8.37:g.8185743G>A	ENSP00000428054:p.Ser850Leu	Somatic	133	0		WXS	Illumina GAIIx	Phase_I	142	58	NM_001080826	0	0	2	2	0	Q8N3N5	Missense_Mutation	SNP	ENST00000520004.1	37	CCDS43706.1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.707372	0.89018	.	.	ENSG00000182319	ENST00000330777;ENST00000520004	T;T	0.63255	-0.03;-0.03	4.97	4.97	0.65823	.	0.413857	0.21567	N	0.072474	T	0.77061	0.4075	L	0.56769	1.78	0.58432	D	0.999997	D	0.89917	1.0	D	0.83275	0.996	T	0.78516	-0.2174	10	0.87932	D	0	.	17.7673	0.88482	0.0:0.0:1.0:0.0	.	850	Q86YV5	SG223_HUMAN	L	850	ENSP00000330930:S850L;ENSP00000428054:S850L	ENSP00000330930:S850L	S	-	2	0	AC068353.1	8223153	1.000000	0.71417	0.970000	0.41538	0.873000	0.50193	8.835000	0.92100	2.751000	0.94390	0.563000	0.77884	TCG	.		0.572	SGK223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374864.1		
SOX7	83595	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	8	10583913	10583913	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr8:10583913C>T	ENST00000304501.1	-	2	580	c.502G>A	c.(502-504)Ggc>Agc	p.G168S	SOX7_ENST00000553390.1_Missense_Mutation_p.G220S|CTD-2135J3.3_ENST00000506149.2_RNA|SOX7_ENST00000554914.1_Missense_Mutation_p.G220S	NM_031439.2	NP_113627.1	Q9BT81	SOX7_HUMAN	SRY (sex determining region Y)-box 7	168					endoderm formation (GO:0001706)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|regulation of canonical Wnt signaling pathway (GO:0060828)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	20				COAD - Colon adenocarcinoma(149;0.0732)		AGGGCAGTGCCGGGGGAGTAC	0.726																																					p.G168S		.											.	SOX7-522	0			c.G502A						.						16.0	17.0	16.0					8																	10583913		2201	4289	6490	SO:0001583	missense	83595	exon2			CAGTGCCGGGGGA	AJ409320	CCDS5977.1	8p22	2013-01-25			ENSG00000171056	ENSG00000171056		"""SRY (sex determining region Y)-boxes"""	18196	protein-coding gene	gene with protein product		612202				11691915	Standard	NM_031439		Approved		uc003wtf.3	Q9BT81	OTTHUMG00000090585	ENST00000304501.1:c.502G>A	8.37:g.10583913C>T	ENSP00000301921:p.Gly168Ser	Somatic	13	0		WXS	Illumina GAIIx	Phase_I	75	39	NM_031439	0	0	0	0	0	B4DKV0|Q53YD0	Missense_Mutation	SNP	ENST00000304501.1	37	CCDS5977.1	.	.	.	.	.	.	.	.	.	.	C	6.120	0.390414	0.11581	.	.	ENSG00000171056;ENSG00000171056;ENSG00000258724	ENST00000304501;ENST00000553390;ENST00000554914	D;D;D	0.99519	-5.12;-6.07;-6.07	4.42	1.6	0.23607	.	0.517672	0.21800	N	0.068924	D	0.96611	0.8894	N	0.24115	0.695	0.09310	N	1	B;B	0.12013	0.003;0.005	B;B	0.08055	0.003;0.003	D	0.92643	0.6126	10	0.23302	T	0.38	.	6.661	0.23014	0.0:0.5395:0.2938:0.1667	.	220;168	B4DKV0;Q9BT81	.;SOX7_HUMAN	S	168;220;220	ENSP00000301921:G168S;ENSP00000452017:G220S;ENSP00000451145:G220S	ENSP00000346908:G220S	G	-	1	0	SOX7;CTD-2135J3.4	10621323	0.000000	0.05858	0.000000	0.03702	0.388000	0.30384	-0.035000	0.12205	0.127000	0.18452	-1.036000	0.02392	GGC	.		0.726	SOX7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207131.1		
DLC1	10395	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	12950218	12950218	+	Missense_Mutation	SNP	C	C	T	rs370207065		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr8:12950218C>T	ENST00000276297.4	-	13	4052	c.3643G>A	c.(3643-3645)Gta>Ata	p.V1215I	DLC1_ENST00000510318.1_5'UTR|DLC1_ENST00000520226.1_Missense_Mutation_p.V704I|DLC1_ENST00000512044.2_Missense_Mutation_p.V812I|DLC1_ENST00000358919.2_Missense_Mutation_p.V778I	NM_182643.2	NP_872584.2	Q96QB1	RHG07_HUMAN	DLC1 Rho GTPase activating protein	1215	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				actin cytoskeleton organization (GO:0030036)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|focal adhesion assembly (GO:0048041)|forebrain development (GO:0030900)|heart morphogenesis (GO:0003007)|hindbrain morphogenesis (GO:0021575)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neural tube closure (GO:0001843)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	lipid binding (GO:0008289)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)			NS(2)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(39)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	110						TTTTCTTTTACGGCTGCTGTG	0.557																																					p.V1215I		.											.	DLC1-657	0			c.G3643A						.	C	ILE/VAL,ILE/VAL,ILE/VAL	0,4406		0,0,2203	118.0	101.0	107.0		2110,2332,3643	5.0	0.1	8		107	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	DLC1	NM_001164271.1,NM_006094.4,NM_182643.2	29,29,29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging,possibly-damaging	704/1018,778/1092,1215/1529	12950218	1,13005	2203	4300	6503	SO:0001583	missense	10395	exon13			CTTTTACGGCTGC	AF035119	CCDS5989.1, CCDS5990.1, CCDS5991.1, CCDS5991.2, CCDS55201.1	8p22	2014-06-20	2014-06-20		ENSG00000164741	ENSG00000164741		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	2897	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 12"""	604258	"""deleted in liver cancer 1"""			9605766, 11214970	Standard	NM_182643		Approved	HP, ARHGAP7, STARD12, DLC-1, p122-RhoGAP	uc003wwm.2	Q96QB1	OTTHUMG00000090825	ENST00000276297.4:c.3643G>A	8.37:g.12950218C>T	ENSP00000276297:p.Val1215Ile	Somatic	203	0		WXS	Illumina GAIIx	Phase_I	226	112	NM_182643	0	0	3	5	2	B4DR10|B8PTI0|E9PDZ8|E9PF76|E9PGY9|O14868|O43199|Q7Z5R8|Q86UC6|Q9C0E0|Q9H7A2	Missense_Mutation	SNP	ENST00000276297.4	37	CCDS5989.1	.	.	.	.	.	.	.	.	.	.	C	33	5.247913	0.95305	0.0	1.16E-4	ENSG00000164741	ENST00000276297;ENST00000358919;ENST00000510318;ENST00000512044;ENST00000520226	T;T;T;T	0.18810	2.19;2.19;2.19;2.19	4.97	4.97	0.65823	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	T	0.46014	0.1371	M	0.62088	1.915	0.80722	D	1	P;D;D	0.71674	0.932;0.998;0.977	B;D;P	0.79108	0.428;0.992;0.777	T	0.39210	-0.9625	10	0.72032	D	0.01	.	18.8136	0.92068	0.0:1.0:0.0:0.0	.	1215;812;778	Q96QB1;E9PDZ8;Q96QB1-1	RHG07_HUMAN;.;.	I	1215;778;154;812;704	ENSP00000276297:V1215I;ENSP00000351797:V778I;ENSP00000422595:V812I;ENSP00000428028:V704I	ENSP00000276297:V1215I	V	-	1	0	DLC1	12994589	1.000000	0.71417	0.110000	0.21437	0.849000	0.48306	5.860000	0.69546	2.765000	0.95021	0.650000	0.86243	GTA	.		0.557	DLC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207632.2	NM_182643, NM_006094	
MTUS1	57509	broad.mit.edu;bcgsc.ca	37	8	17611345	17611345	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr8:17611345T>C	ENST00000262102.6	-	2	2196	c.1972A>G	c.(1972-1974)Aac>Gac	p.N658D	MTUS1_ENST00000519263.1_Missense_Mutation_p.N658D|MTUS1_ENST00000381862.3_Missense_Mutation_p.N658D|MTUS1_ENST00000381869.3_Missense_Mutation_p.N658D	NM_001001924.2	NP_001001924.1	Q9ULD2	MTUS1_HUMAN	microtubule associated tumor suppressor 1	658					cellular response to peptide hormone stimulus (GO:0071375)|regulation of macrophage chemotaxis (GO:0010758)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(14)|lung(8)|ovary(1)|skin(2)|urinary_tract(1)	36				Colorectal(111;0.0778)		CTATCAATGTTGGGAACATAG	0.398																																					p.N658D		.											.	MTUS1-92	0			c.A1972G						.						150.0	132.0	138.0					8																	17611345		1860	4087	5947	SO:0001583	missense	57509	exon2			CAATGTTGGGAAC	AL096842	CCDS43716.1, CCDS43717.1, CCDS43718.1, CCDS43719.1, CCDS55204.1	8p22	2013-01-17	2009-10-20		ENSG00000129422	ENSG00000129422			29789	protein-coding gene	gene with protein product	"""AT2 receptor-interacting protein"", ""AT2R binding protein"", ""mitochondrial tumor suppressor gene 1"""	609589	"""mitochondrial tumor suppressor 1"""			10574462, 12692079	Standard	NM_001001931		Approved	MTSG1, KIAA1288, DKFZp586D1519, FLJ14295, ATIP1, MP44, ATBP, ICIS	uc003wxv.3	Q9ULD2	OTTHUMG00000163756	ENST00000262102.6:c.1972A>G	8.37:g.17611345T>C	ENSP00000262102:p.Asn658Asp	Somatic	176	0		WXS	Illumina GAIIx	Phase_I	212	8	NM_001001924	0	0	16	16	0	A8K135|B2RBJ6|B3KWJ9|B4DH03|B9EGA1|D3DSP8|Q63HJ6|Q659F4|Q6PK49|Q6URW7|Q8N4M6|Q8WTT9|Q9H7T2	Missense_Mutation	SNP	ENST00000262102.6	37	CCDS43717.1	.	.	.	.	.	.	.	.	.	.	T	1.334	-0.596030	0.03771	.	.	ENSG00000129422	ENST00000381869;ENST00000262102;ENST00000519263;ENST00000381862	T;T;T;T	0.37584	2.85;1.19;2.85;1.94	4.08	-7.78	0.01223	.	0.852307	0.09758	N	0.759688	T	0.22282	0.0537	N	0.24115	0.695	0.09310	N	1	B;B;B	0.29301	0.241;0.096;0.184	B;B;B	0.31290	0.127;0.049;0.098	T	0.19811	-1.0294	10	0.40728	T	0.16	-0.2059	13.2364	0.59971	0.0:0.0642:0.5696:0.3662	.	658;658;658	Q9ULD2-5;Q9ULD2-2;Q9ULD2	.;.;MTUS1_HUMAN	D	658	ENSP00000371293:N658D;ENSP00000262102:N658D;ENSP00000430167:N658D;ENSP00000371286:N658D	ENSP00000262102:N658D	N	-	1	0	MTUS1	17655625	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.031000	0.13710	-2.098000	0.00850	-1.255000	0.01485	AAC	.		0.398	MTUS1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000375247.1	XM_372031	
SH2D4A	63898	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	19221709	19221709	+	Missense_Mutation	SNP	G	G	A	rs552781847		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr8:19221709G>A	ENST00000265807.3	+	7	1244	c.833G>A	c.(832-834)cGt>cAt	p.R278H	SH2D4A_ENST00000519207.1_Missense_Mutation_p.R278H|SH2D4A_ENST00000518040.1_Missense_Mutation_p.R233H	NM_001174160.1|NM_022071.3	NP_001167631.1|NP_071354.2	Q9H788	SH24A_HUMAN	SH2 domain containing 4A	278					negative regulation of phosphatase activity (GO:0010923)	cytoplasm (GO:0005737)	phosphatase binding (GO:0019902)			endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|stomach(1)	16				Colorectal(111;0.0732)		AGCCCCTTGCGTGTTCCGCAG	0.532																																					p.R278H		.											.	SH2D4A-90	0			c.G833A						.						83.0	82.0	82.0					8																	19221709		2203	4300	6503	SO:0001583	missense	63898	exon7			CCTTGCGTGTTCC	AY190323	CCDS6009.1, CCDS55206.1	8p21	2013-02-14			ENSG00000104611	ENSG00000104611		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""SH2 domain containing"""	26102	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 38"""	614968					Standard	NM_022071		Approved	FLJ20967, SH2A, PPP1R38	uc003wzc.3	Q9H788	OTTHUMG00000097005	ENST00000265807.3:c.833G>A	8.37:g.19221709G>A	ENSP00000265807:p.Arg278His	Somatic	85	0		WXS	Illumina GAIIx	Phase_I	121	60	NM_022071	0	0	9	13	4	B4DDR1|Q5XKC1|Q6NXE9|Q86YM2|Q96C88|Q9H7F7	Missense_Mutation	SNP	ENST00000265807.3	37	CCDS6009.1	.	.	.	.	.	.	.	.	.	.	G	11.50	1.657677	0.29425	.	.	ENSG00000104611	ENST00000265807;ENST00000518040;ENST00000519207	T;T;T	0.12039	2.72;2.72;2.72	5.17	0.836	0.18891	.	1.096820	0.06789	N	0.786720	T	0.06600	0.0169	N	0.04508	-0.205	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.01281	0.0;0.0	T	0.39333	-0.9619	10	0.46703	T	0.11	.	5.4941	0.16793	0.1945:0.3116:0.4938:0.0	.	233;278	B4DDR1;Q9H788	.;SH24A_HUMAN	H	278;233;278	ENSP00000265807:R278H;ENSP00000429482:R233H;ENSP00000428684:R278H	ENSP00000265807:R278H	R	+	2	0	SH2D4A	19265989	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.232000	0.17891	-0.139000	0.11414	-0.244000	0.11960	CGT	.		0.532	SH2D4A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214094.1	NM_022071	
ENTPD4	9583	broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	23302032	23302032	+	Missense_Mutation	SNP	G	G	A	rs200123530		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr8:23302032G>A	ENST00000358689.4	-	5	735	c.500C>T	c.(499-501)gCa>gTa	p.A167V	ENTPD4_ENST00000417069.2_Missense_Mutation_p.A167V|ENTPD4_ENST00000356206.6_Missense_Mutation_p.A167V	NM_001128930.2|NM_004901.4	NP_001122402.1|NP_004892.1	Q9Y227	ENTP4_HUMAN	ectonucleoside triphosphate diphosphohydrolase 4	167					UDP catabolic process (GO:0006256)	cytoplasmic vesicle (GO:0031410)|integral component of Golgi membrane (GO:0030173)|intracellular membrane-bounded organelle (GO:0043231)	uridine-diphosphatase activity (GO:0045134)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	25		Prostate(55;0.114)		Colorectal(74;0.0161)|COAD - Colon adenocarcinoma(73;0.0649)		TTTGTGTTTTGCCCGTGGCAC	0.488																																					p.A167V		.											.	ENTPD4-92	0			c.C500T						.						128.0	127.0	127.0					8																	23302032		2203	4300	6503	SO:0001583	missense	9583	exon5			TGTTTTGCCCGTG	AJ131358	CCDS6041.1, CCDS47827.1	8p21.3	2014-05-16	2004-09-22	2004-09-22	ENSG00000197217	ENSG00000197217			14573	protein-coding gene	gene with protein product		607577	"""lysosomal apyrase-like 1"""	LYSAL1		10393803, 9205841	Standard	NM_001128930		Approved	LALP70, LAP70, KIAA0392, NTPDase-4, UDPase	uc003xdl.3	Q9Y227	OTTHUMG00000097852	ENST00000358689.4:c.500C>T	8.37:g.23302032G>A	ENSP00000351520:p.Ala167Val	Somatic	101	1		WXS	Illumina GAIIx	Phase_I	134	70	NM_004901	0	0	10	13	3	D3DSS3|O15092	Missense_Mutation	SNP	ENST00000358689.4	37	CCDS6041.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.53|15.53	2.861461|2.861461	0.51482|0.51482	.|.	.|.	ENSG00000197217|ENSG00000197217	ENST00000356206;ENST00000358689;ENST00000417069|ENST00000519839	T;T;T|.	0.11604|.	2.76;2.76;2.76|.	5.6|5.6	4.72|4.72	0.59763|0.59763	.|.	0.475846|.	0.23964|.	N|.	0.042833|.	T|.	0.56645|.	0.1999|.	L|L	0.52905|0.52905	1.665|1.665	0.32261|0.32261	N|N	0.570166|0.570166	B;B;B;B|.	0.23990|.	0.04;0.095;0.032;0.04|.	B;B;B;B|.	0.33121|.	0.102;0.158;0.062;0.102|.	T|.	0.64334|.	-0.6432|.	10|.	0.36615|.	T|.	0.2|.	-6.6607|-6.6607	12.4239|12.4239	0.55536|0.55536	0.0:0.0:0.6945:0.3055|0.0:0.0:0.6945:0.3055	.|.	167;167;167;167|.	B4DU21;Q8NE73;Q9Y227-2;Q9Y227|.	.;.;.;ENTP4_HUMAN|.	V|X	167|42	ENSP00000348536:A167V;ENSP00000351520:A167V;ENSP00000408573:A167V|.	ENSP00000348536:A167V|.	A|Q	-|-	2|1	0|0	ENTPD4|ENTPD4	23357977|23357977	0.133000|0.133000	0.22466|0.22466	0.998000|0.998000	0.56505|0.56505	0.997000|0.997000	0.91878|0.91878	1.281000|1.281000	0.33214|0.33214	1.331000|1.331000	0.45412|0.45412	0.563000|0.563000	0.77884|0.77884	GCA|CAA	G|0.999;T|0.000		0.488	ENTPD4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000215142.1	NM_004901	
UBE2V2	7336	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	48955657	48955657	+	Silent	SNP	C	C	T	rs545217661		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr8:48955657C>T	ENST00000523111.2	+	2	136	c.81C>T	c.(79-81)ggC>ggT	p.G27G	UBE2V2_ENST00000521346.1_5'UTR|UBE2V2_ENST00000517630.1_5'UTR|UBE2V2_ENST00000520809.1_5'UTR	NM_003350.2	NP_003341.1	Q15819	UB2V2_HUMAN	ubiquitin-conjugating enzyme E2 variant 2	27					cell proliferation (GO:0008283)|DNA double-strand break processing (GO:0000729)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of DNA repair (GO:0045739)|positive regulation of neuron projection development (GO:0010976)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of synapse assembly (GO:0051965)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|regulation of DNA repair (GO:0006282)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|UBC13-MMS2 complex (GO:0031372)	acid-amino acid ligase activity (GO:0016881)	p.G27G(1)		large_intestine(1)|lung(2)	3		all_cancers(86;0.026)|all_epithelial(80;0.000748)|Lung NSC(129;0.00171)|all_lung(136;0.00196)				AAGGAGTAGGCGACGGTACAG	0.408								Rad6 pathway					C|||	1	0.000199681	0.0008	0.0	5008	,	,		15610	0.0		0.0	False		,,,				2504	0.0				p.G27G		.											.	UBE2V2-659	1	Substitution - coding silent(1)	large_intestine(1)	c.C81T						.						140.0	138.0	139.0					8																	48955657		1934	4130	6064	SO:0001819	synonymous_variant	7336	exon2			AGTAGGCGACGGT	X98091	CCDS43738.1	8q11.21	2008-02-05			ENSG00000169139	ENSG00000169139		"""Ubiquitin-conjugating enzymes E2"""	12495	protein-coding gene	gene with protein product		603001				9418904, 9199207	Standard	NM_003350		Approved	UEV-2, DDVit-1, EDPF-1, MMS2	uc003xqm.3	Q15819	OTTHUMG00000164206	ENST00000523111.2:c.81C>T	8.37:g.48955657C>T		Somatic	148	0		WXS	Illumina GAIIx	Phase_I	191	13	NM_003350	0	0	37	38	1		Silent	SNP	ENST00000523111.2	37	CCDS43738.1	.	.	.	.	.	.	.	.	.	.	C	9.516	1.107102	0.20714	.	.	ENSG00000169139	ENST00000324746	.	.	.	5.76	-0.24	0.13047	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-10.6929	5.0844	0.14675	0.2352:0.2558:0.0:0.509	.	.	.	.	X	23	.	.	R	+	1	2	UBE2V2	49118210	0.061000	0.20836	0.996000	0.52242	0.992000	0.81027	-0.848000	0.04326	-0.111000	0.12001	-0.140000	0.14226	CGA	.		0.408	UBE2V2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377808.3	NM_003350	
YTHDF3	253943	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	64099263	64099263	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr8:64099263G>A	ENST00000539294.1	+	4	1007	c.691G>A	c.(691-693)Gca>Aca	p.A231T	YTHDF3_ENST00000521674.1_3'UTR|YTHDF3_ENST00000542911.2_Missense_Mutation_p.A42T|YTHDF3_ENST00000517371.1_Intron	NM_001277817.1|NM_001277818.1|NM_152758.4	NP_001264746.1|NP_001264747.1|NP_689971.4	Q7Z739	YTHD3_HUMAN	YTH domain family, member 3	232							N6-methyladenosine-containing RNA binding (GO:1990247)|poly(A) RNA binding (GO:0044822)					Breast(64;0.0716)	all_cancers(86;0.169)|Lung NSC(129;0.0324)|all_lung(136;0.0593)|all_epithelial(80;0.146)	BRCA - Breast invasive adenocarcinoma(89;0.161)			TAGCAGTGCAGCACCTAAACC	0.512																																					.		.											.	.	0			.						.						92.0	98.0	96.0					8																	64099263		2069	4210	6279	SO:0001583	missense	253943	.			AGTGCAGCACCTA	BC052970	CCDS75747.1, CCDS75748.1, CCDS75749.1	8q12.3	2013-06-07	2004-11-16		ENSG00000185728	ENSG00000185728			26465	protein-coding gene	gene with protein product			"""YTH domain family 3"""			12477932	Standard	NM_152758		Approved	FLJ31657	uc003xuz.4	Q7Z739	OTTHUMG00000164369	ENST00000539294.1:c.691G>A	8.37:g.64099263G>A	ENSP00000473496:p.Ala231Thr	Somatic	182	0		WXS	Illumina GAIIx	Phase_I	240	126	.	0	0	5	16	11	B3KXL4|Q63Z37|Q659A3	Missense_Mutation	SNP	ENST00000539294.1	37																																																																																				.		0.512	YTHDF3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_152758	
PREX2	80243	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	68939483	68939483	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr8:68939483G>T	ENST00000288368.4	+	5	745	c.468G>T	c.(466-468)aaG>aaT	p.K156N	PREX2_ENST00000529398.1_3'UTR	NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	156	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)	p.K156K(2)		NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						GAGGACGGAAGAACACAGATG	0.353																																					p.K156N		.											.	PREX2-390	2	Substitution - coding silent(2)	skin(2)	c.G468T						.						140.0	133.0	135.0					8																	68939483		2203	4300	6503	SO:0001583	missense	80243	exon5			ACGGAAGAACACA	AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.468G>T	8.37:g.68939483G>T	ENSP00000288368:p.Lys156Asn	Somatic	143	0		WXS	Illumina GAIIx	Phase_I	205	96	NM_025170	0	0	0	0	0	B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Missense_Mutation	SNP	ENST00000288368.4	37	CCDS6201.1	.	.	.	.	.	.	.	.	.	.	G	19.38	3.816090	0.70912	.	.	ENSG00000046889	ENST00000288368;ENST00000396539;ENST00000354677	T	0.63096	-0.02	5.66	3.84	0.44239	Dbl homology (DH) domain (5);	0.050966	0.85682	N	0.000000	T	0.71771	0.3379	L	0.52126	1.63	0.58432	D	0.999998	D;D;P	0.89917	1.0;0.999;0.916	D;D;P	0.97110	1.0;0.99;0.756	T	0.71444	-0.4591	10	0.56958	D	0.05	.	10.8022	0.46495	0.0678:0.0:0.8006:0.1316	.	156;156;156	Q70Z35-2;Q70Z35;Q70Z35-3	.;PREX2_HUMAN;.	N	156	ENSP00000288368:K156N	ENSP00000288368:K156N	K	+	3	2	PREX2	69102037	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.507000	0.53371	0.825000	0.34637	0.655000	0.94253	AAG	.		0.353	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378620.1	NM_025170	
OSR2	116039	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	99961683	99961683	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr8:99961683C>T	ENST00000297565.4	+	2	999	c.503C>T	c.(502-504)aCg>aTg	p.T168M	OSR2_ENST00000435298.2_Missense_Mutation_p.T168M|OSR2_ENST00000523368.1_Missense_Mutation_p.T168M|OSR2_ENST00000522510.1_Missense_Mutation_p.T168M|OSR2_ENST00000457907.2_Missense_Mutation_p.T289M	NM_001142462.1	NP_001135934.1	Q8N2R0	OSR2_HUMAN	odd-skipped related transciption factor 2	168					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|chondrocyte differentiation (GO:0002062)|embryo development (GO:0009790)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic skeletal joint development (GO:0072498)|embryonic skeletal joint morphogenesis (GO:0060272)|embryonic skeletal limb joint morphogenesis (GO:0036023)|embryonic skeletal system morphogenesis (GO:0048704)|eyelid development in camera-type eye (GO:0061029)|head development (GO:0060322)|mesonephros development (GO:0001823)|metanephros development (GO:0001656)|middle ear morphogenesis (GO:0042474)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis (GO:0042476)|osteoblast proliferation (GO:0033687)|palate development (GO:0060021)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gastrulation (GO:2000543)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephros development (GO:0048793)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(14)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	Breast(36;4.14e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.0136)			CCCTCCAAAACGAAAAAAGAG	0.527																																					p.T168M		.											.	OSR2-1	0			c.C503T						.						156.0	162.0	160.0					8																	99961683		1943	4157	6100	SO:0001583	missense	116039	exon2			CCAAAACGAAAAA	AY038072	CCDS47901.1, CCDS47902.1, CCDS69520.1	8q22.2	2013-10-17	2013-10-17			ENSG00000164920		"""Zinc fingers, C2H2-type"""	15830	protein-coding gene	gene with protein product		611297	"""odd-skipped related 2 (Drosophila)"""				Standard	XM_005250779		Approved	FLJ90037	uc003yir.3	Q8N2R0		ENST00000297565.4:c.503C>T	8.37:g.99961683C>T	ENSP00000297565:p.Thr168Met	Somatic	182	1		WXS	Illumina GAIIx	Phase_I	285	138	NM_053001	0	0	15	26	11	A8K626|B4E3B7|Q96AM6|Q96LB6|Q96LB7	Missense_Mutation	SNP	ENST00000297565.4	37	CCDS47901.1	.	.	.	.	.	.	.	.	.	.	C	19.94	3.919411	0.73098	.	.	ENSG00000164920	ENST00000523368;ENST00000297565;ENST00000435298;ENST00000522510;ENST00000457907;ENST00000520951;ENST00000518199	T;T;T;T;T;T;T	0.11712	2.75;2.75;2.75;2.75;2.75;2.75;2.75	4.35	4.35	0.52113	.	0.051443	0.85682	D	0.000000	T	0.26448	0.0646	L	0.50333	1.59	0.80722	D	1	D;D;D;D	0.76494	0.999;0.998;0.999;0.994	D;P;D;D	0.66351	0.943;0.856;0.943;0.943	T	0.00509	-1.1698	9	.	.	.	-14.761	18.1763	0.89762	0.0:1.0:0.0:0.0	.	289;168;168;168	B4E3B7;E5RH04;Q8N2R0;Q8N2R0-2	.;.;OSR2_HUMAN;.	M	168;168;168;168;289;221;168	ENSP00000430041:T168M;ENSP00000297565:T168M;ENSP00000402862:T168M;ENSP00000430780:T168M;ENSP00000414657:T289M;ENSP00000430074:T221M;ENSP00000429910:T168M	.	T	+	2	0	OSR2	100030859	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.809000	0.69172	2.722000	0.93159	0.655000	0.94253	ACG	.		0.527	OSR2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000379505.1	NM_053001	
RIMS2	9699	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	105263855	105263855	+	Missense_Mutation	SNP	G	G	A	rs200286153		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr8:105263855G>A	ENST00000436393.2	+	28	4152	c.3911G>A	c.(3910-3912)cGc>cAc	p.R1304H	RIMS2_ENST00000339750.2_Missense_Mutation_p.R222H|RIMS2_ENST00000507740.1_Missense_Mutation_p.R1100H|RIMS2_ENST00000262231.10_Missense_Mutation_p.R1125H|RIMS2_ENST00000406091.3_Missense_Mutation_p.R1286H			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	1348	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			GATTATGGCCGCATGGATCAC	0.378										HNSCC(12;0.0054)																											p.R1286H		.											.	RIMS2-279	0			c.G3857A						.						129.0	128.0	128.0					8																	105263855		1895	4148	6043	SO:0001583	missense	9699	exon24			ATGGCCGCATGGA	AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.3911G>A	8.37:g.105263855G>A	ENSP00000390665:p.Arg1304His	Somatic	98	1		WXS	Illumina GAIIx	Phase_I	150	60	NM_001100117	1	0	5	9	3	B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Missense_Mutation	SNP	ENST00000436393.2	37		.	.	.	.	.	.	.	.	.	.	G	21.3	4.134573	0.77662	.	.	ENSG00000176406	ENST00000329869;ENST00000406091;ENST00000402998;ENST00000262231;ENST00000507740;ENST00000436393;ENST00000523362;ENST00000339750	T;T;T;T;T;T	0.70631	-0.5;-0.5;-0.5;-0.5;-0.5;-0.5	5.64	5.64	0.86602	.	.	.	.	.	D	0.88020	0.6325	M	0.91818	3.245	0.80722	D	1	D;D;D;D	0.76494	0.999;0.997;0.997;0.999	D;D;D;D	0.75020	0.984;0.978;0.978;0.985	D	0.90084	0.4172	9	0.87932	D	0	.	19.6939	0.96016	0.0:0.0:1.0:0.0	.	1304;1125;1100;1286	D6RA03;Q9UQ26-1;Q9UQ26-3;F8WD47	.;.;.;.	H	1323;1286;1348;1125;1100;1304;222;222	ENSP00000384892:R1286H;ENSP00000262231:R1125H;ENSP00000423559:R1100H;ENSP00000390665:R1304H;ENSP00000428478:R222H;ENSP00000342051:R222H	ENSP00000262231:R1125H	R	+	2	0	RIMS2	105333031	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.857000	0.99534	2.660000	0.90430	0.655000	0.94253	CGC	G|1.000;T|0.000		0.378	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000367217.1	NM_001100117	
UTP23	84294	bcgsc.ca	37	8	117778849	117778849	+	Missense_Mutation	SNP	A	A	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr8:117778849A>T	ENST00000309822.2	+	1	108	c.7A>T	c.(7-9)Atc>Ttc	p.I3F	EIF3H_ENST00000276682.4_5'Flank|UTP23_ENST00000517820.1_Missense_Mutation_p.I3F|UTP23_ENST00000357148.3_Missense_Mutation_p.I3F	NM_032334.2	NP_115710.2	Q9BRU9	UTP23_HUMAN	UTP23, small subunit (SSU) processome component, homolog (yeast)	3					rRNA processing (GO:0006364)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|urinary_tract(1)	12						AGGCATGAAGATCACAAGGCA	0.577											OREG0018934	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.I3F		.											.	UTP23-226	0			c.A7T						.						49.0	48.0	49.0					8																	117778849		2203	4300	6503	SO:0001583	missense	84294	exon1			ATGAAGATCACAA		CCDS6320.1	8q24.11	2008-06-12	2008-06-12	2008-06-12		ENSG00000147679			28224	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 53"""	C8orf53		16769905	Standard	NM_032334		Approved	MGC14595	uc003yoc.3	Q9BRU9		ENST00000309822.2:c.7A>T	8.37:g.117778849A>T	ENSP00000308332:p.Ile3Phe	Somatic	296	5	1483	WXS	Illumina GAIIx	Phase_I	376	173	NM_032334	0	0	5	10	5	B2RE25|Q96NJ8	Missense_Mutation	SNP	ENST00000309822.2	37	CCDS6320.1	.	.	.	.	.	.	.	.	.	.	A	25.2	4.612589	0.87258	.	.	ENSG00000147679	ENST00000309822;ENST00000357148;ENST00000517814;ENST00000517820	T	0.23754	1.89	5.54	5.54	0.83059	.	0.047226	0.85682	D	0.000000	T	0.41328	0.1154	M	0.62723	1.935	0.80722	D	1	D	0.59767	0.986	P	0.56916	0.809	T	0.31081	-0.9956	10	0.72032	D	0.01	-21.4445	11.7143	0.51643	0.9298:0.0:0.0702:0.0	.	3	Q9BRU9	UTP23_HUMAN	F	3	ENSP00000308332:I3F	ENSP00000308332:I3F	I	+	1	0	UTP23	117848030	1.000000	0.71417	1.000000	0.80357	0.813000	0.45954	3.337000	0.52120	2.323000	0.78572	0.528000	0.53228	ATC	.		0.577	UTP23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381173.1	NM_032334	
C8orf31	286122	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	144126154	144126154	+	Missense_Mutation	SNP	G	G	A	rs74447754	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr8:144126154G>A	ENST00000395172.1	+	4	627	c.275G>A	c.(274-276)cGa>cAa	p.R92Q	C8orf31_ENST00000517653.1_3'UTR	NM_173687.2	NP_775958.1	Q8N9H6	CH031_HUMAN	chromosome 8 open reading frame 31	92										breast(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)	10	all_cancers(97;1.89e-10)|all_epithelial(106;8.73e-09)|Lung NSC(106;0.000161)|all_lung(105;0.000447)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)					GAAGGGGCACGAGACCACGCT	0.637													a|||	43	0.00858626	0.031	0.0029	5008	,	,		15192	0.0		0.0	False		,,,				2504	0.0				p.R92Q		.											.	C8orf31-91	0			c.G275A						.		GLN/ARG	101,4305	816.3+/-416.2	0,101,2102	80.0	71.0	74.0		275	-1.5	0.0	8	dbSNP_131	74	0,8600		0,0,4300	yes	missense	C8orf31	NM_173687.2	43	0,101,6402	AA,AG,GG		0.0,2.2923,0.7766	benign	92/133	144126154	101,12905	2203	4300	6503	SO:0001583	missense	286122	exon4			GGGCACGAGACCA		CCDS6395.1	8q24.3	2012-04-11			ENSG00000177335	ENSG00000177335			26731	protein-coding gene	gene with protein product							Standard	NM_173687		Approved	FLJ37131	uc003yxp.1	Q8N9H6	OTTHUMG00000164771	ENST00000395172.1:c.275G>A	8.37:g.144126154G>A	ENSP00000378601:p.Arg92Gln	Somatic	127	0		WXS	Illumina GAIIx	Phase_I	152	74	NM_173687	0	0	12	27	15	Q6GMU7	Missense_Mutation	SNP	ENST00000395172.1	37	CCDS6395.1	27	0.012362637362637362	26	0.052845528455284556	1	0.0027624309392265192	0	0.0	0	0.0	a	5.710	0.315597	0.10789	0.022923	0.0	ENSG00000177335	ENST00000395172	T	0.55930	0.49	1.77	-1.48	0.08745	.	.	.	.	.	T	0.04679	0.0127	N	0.08118	0	0.09310	N	1	B	0.21452	0.056	B	0.06405	0.002	T	0.07673	-1.0760	9	0.87932	D	0	.	5.3594	0.16079	0.4961:0.0:0.5039:0.0	.	92	Q8N9H6	CH031_HUMAN	Q	92	ENSP00000378601:R92Q	ENSP00000378601:R92Q	R	+	2	0	C8orf31	144197529	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.921000	0.01569	-0.435000	0.07264	-0.309000	0.09137	CGA	G|0.990;A|0.010		0.637	C8orf31-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380167.1	NM_173687	
ZNF696	79943	hgsc.bcm.edu	37	8	144378868	144378868	+	Silent	SNP	A	A	G	rs7386259	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr8:144378868A>G	ENST00000330143.3	+	3	1432	c.1023A>G	c.(1021-1023)cgA>cgG	p.R341R		NM_030895.2	NP_112157.2	Q9H7X3	ZN696_HUMAN	zinc finger protein 696	341					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	8	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)			GGCACCAGCGACTCCACACGG	0.726													G|||	4505	0.899561	0.9425	0.9179	5008	,	,		11520	0.8403		0.8608	False		,,,				2504	0.9294				p.R341R		.											.	ZNF696-90	0			c.A1023G						.	G		3773,275		1771,231,22	5.0	5.0	5.0		1023	-0.3	0.0	8	dbSNP_116	5	6735,1261		2843,1049,106	no	coding-synonymous	ZNF696	NM_030895.2		4614,1280,128	GG,GA,AA		15.7704,6.7935,12.7532		341/375	144378868	10508,1536	2024	3998	6022	SO:0001819	synonymous_variant	79943	exon3			CCAGCGACTCCAC	AK024191	CCDS6399.1	8q24.3	2013-01-08				ENSG00000185730		"""Zinc fingers, C2H2-type"""	25872	protein-coding gene	gene with protein product							Standard	NM_030895		Approved	FLJ14129	uc003yxy.4	Q9H7X3		ENST00000330143.3:c.1023A>G	8.37:g.144378868A>G		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_030895	0	0	0	9	9	A0AVE2	Silent	SNP	ENST00000330143.3	37	CCDS6399.1																																																																																			A|0.118;G|0.882		0.726	ZNF696-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381164.2	NM_030895	
EPPK1	83481	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	144940488	144940488	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr8:144940488C>T	ENST00000525985.1	-	2	7005	c.6934G>A	c.(6934-6936)Gac>Aac	p.D2312N				P58107	EPIPL_HUMAN	epiplakin 1	2312						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			GTGTAGGGGTCGGTGTAGCCG	0.701																																					p.D2312N		.											.	EPPK1-25	0			c.G6934A						.						172.0	170.0	171.0					8																	144940488		2180	4264	6444	SO:0001583	missense	83481	exon1			AGGGGTCGGTGTA	AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.6934G>A	8.37:g.144940488C>T	ENSP00000436337:p.Asp2312Asn	Somatic	229	0		WXS	Illumina GAIIx	Phase_I	452	36	NM_031308	0	0	0	0	0	Q76E58|Q9NSU9	Missense_Mutation	SNP	ENST00000525985.1	37		.	.	.	.	.	.	.	.	.	.	C	24.9	4.582034	0.86748	.	.	ENSG00000227184	ENST00000525985	T	0.74209	-0.82	4.63	4.63	0.57726	.	.	.	.	.	D	0.85995	0.5827	M	0.80183	2.485	0.48830	D	0.999713	D	0.89917	1.0	D	0.83275	0.996	D	0.86955	0.2088	9	0.51188	T	0.08	.	15.1031	0.72299	0.0:1.0:0.0:0.0	.	2312	E9PPU0	.	N	2312	ENSP00000436337:D2312N	ENSP00000436337:D2312N	D	-	1	0	EPPK1	145012476	0.994000	0.37717	1.000000	0.80357	0.997000	0.91878	3.179000	0.50887	2.416000	0.81992	0.586000	0.80456	GAC	.		0.701	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382675.1	NM_031308	
EPPK1	83481	hgsc.bcm.edu	37	8	144940621	144940621	+	Silent	SNP	C	C	T	rs201634698		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr8:144940621C>T	ENST00000525985.1	-	2	6872	c.6801G>A	c.(6799-6801)gcG>gcA	p.A2267A				P58107	EPIPL_HUMAN	epiplakin 1	2267						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			AGCCGGTGGCCGCCTGCGCCT	0.716																																					p.A2267A		.											.	EPPK1-25	0			c.G6801A						.	C		2,4298		0,2,2148	35.0	35.0	35.0		6801	-0.9	1.0	8		35	39,8441		0,39,4201	no	coding-synonymous	EPPK1	NM_031308.1		0,41,6349	TT,TC,CC		0.4599,0.0465,0.3208		2267/2420	144940621	41,12739	2150	4240	6390	SO:0001819	synonymous_variant	83481	exon1			GGTGGCCGCCTGC	AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.6801G>A	8.37:g.144940621C>T		Somatic	3	0		WXS	Illumina GAIIx	Phase_I	40	12	NM_031308	0	0	0	0	0	Q76E58|Q9NSU9	Silent	SNP	ENST00000525985.1	37																																																																																				C|0.998;T|0.002		0.716	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382675.1	NM_031308	
EPPK1	83481	broad.mit.edu	37	8	144942188	144942188	+	Missense_Mutation	SNP	C	C	T	rs187594766	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr8:144942188C>T	ENST00000525985.1	-	2	5305	c.5234G>A	c.(5233-5235)cGc>cAc	p.R1745H				P58107	EPIPL_HUMAN	epiplakin 1	1745						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CTCCACACAGCGCTCCAGAAG	0.562													C|||	2	0.000399361	0.0	0.0	5008	,	,		17648	0.001		0.0	False		,,,				2504	0.001				p.R1745H		.											.	EPPK1-25	0			c.G5234A						.						105.0	108.0	107.0					8																	144942188		2029	4173	6202	SO:0001583	missense	83481	exon1			ACACAGCGCTCCA	AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.5234G>A	8.37:g.144942188C>T	ENSP00000436337:p.Arg1745His	Somatic	212	1		WXS	Illumina GAIIx	Phase_I	310	9	NM_031308	0	0	0	0	0	Q76E58|Q9NSU9	Missense_Mutation	SNP	ENST00000525985.1	37		2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	C	29.9	5.041346	0.93685	.	.	ENSG00000227184	ENST00000525985	T	0.71817	-0.6	5.1	5.1	0.69264	.	.	.	.	.	D	0.84822	0.5557	M	0.84082	2.675	0.40112	D	0.976498	D	0.89917	1.0	D	0.83275	0.996	D	0.86220	0.1630	9	0.51188	T	0.08	.	16.0335	0.80603	0.0:1.0:0.0:0.0	.	1745	E9PPU0	.	H	1745	ENSP00000436337:R1745H	ENSP00000436337:R1745H	R	-	2	0	EPPK1	145014176	1.000000	0.71417	1.000000	0.80357	0.826000	0.46750	7.520000	0.81821	2.648000	0.89879	0.585000	0.79938	CGC	C|0.999;T|0.001		0.562	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382675.1	NM_031308	
PLEC	5339	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	144994967	144994967	+	Nonsense_Mutation	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr8:144994967G>A	ENST00000322810.4	-	32	9602	c.9433C>T	c.(9433-9435)Cga>Tga	p.R3145*	PLEC_ENST00000436759.2_Nonsense_Mutation_p.R3035*|PLEC_ENST00000527096.1_Nonsense_Mutation_p.R3031*|PLEC_ENST00000354958.2_Nonsense_Mutation_p.R2986*|PLEC_ENST00000354589.3_Nonsense_Mutation_p.R3008*|PLEC_ENST00000345136.3_Nonsense_Mutation_p.R3008*|PLEC_ENST00000357649.2_Nonsense_Mutation_p.R3012*|PLEC_ENST00000398774.2_Nonsense_Mutation_p.R2976*|PLEC_ENST00000356346.3_Nonsense_Mutation_p.R2994*	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	3145	Globular 2.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						GCTACGTCTCGCACAGAGCGC	0.672																																					p.R3145X		.											.	PLEC-141	0			c.C9433T						.						23.0	28.0	26.0					8																	144994967		2059	4161	6220	SO:0001587	stop_gained	5339	exon32			CGTCTCGCACAGA	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.9433C>T	8.37:g.144994967G>A	ENSP00000323856:p.Arg3145*	Somatic	83	0		WXS	Illumina GAIIx	Phase_I	164	82	NM_201380	0	0	20	41	21	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Nonsense_Mutation	SNP	ENST00000322810.4	37	CCDS43772.1	.	.	.	.	.	.	.	.	.	.	G	49	15.932324	0.99849	.	.	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096	.	.	.	4.46	4.46	0.54185	.	0.205916	0.30809	U	0.008830	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.168	0.31239	0.0:0.1703:0.6544:0.1754	.	.	.	.	X	3008;3012;3008;2976;3145;2986;2994;3035;3031	.	ENSP00000323856:R3145X	R	-	1	2	PLEC	145066955	0.237000	0.23815	0.776000	0.31678	0.221000	0.24807	2.795000	0.47861	2.196000	0.70406	0.448000	0.29417	CGA	.		0.672	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
PLEC	5339	hgsc.bcm.edu	37	8	144998169	144998169	+	Silent	SNP	C	C	T	rs1140522	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr8:144998169C>T	ENST00000322810.4	-	31	6508	c.6339G>A	c.(6337-6339)gcG>gcA	p.A2113A	PLEC_ENST00000436759.2_Silent_p.A2003A|PLEC_ENST00000527096.1_Silent_p.A1999A|PLEC_ENST00000354958.2_Silent_p.A1954A|PLEC_ENST00000354589.3_Silent_p.A1976A|PLEC_ENST00000345136.3_Silent_p.A1976A|PLEC_ENST00000357649.2_Silent_p.A1980A|PLEC_ENST00000398774.2_Silent_p.A1944A|PLEC_ENST00000356346.3_Silent_p.A1962A	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	2113	Central fibrous rod domain.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CCTCCTCCGCCGCCAGCTGCC	0.741													C|||	1156	0.230831	0.028	0.2968	5008	,	,		12421	0.1429		0.4274	False		,,,				2504	0.3466				p.A2113A		.											.	PLEC-141	0			c.G6339A						.	C	,,,,,,,	297,3657		19,259,1699	5.0	7.0	6.0		6009,5886,5862,6339,5832,5928,5940,5928	-8.9	0.0	8	dbSNP_86	6	2901,4993		551,1799,1597	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	,,,,,,,	570,2058,3296	TT,TC,CC		36.7494,7.5114,26.9919	,,,,,,,	2003/4575,1962/4534,1954/4526,2113/4685,1944/4516,1976/4548,1980/4552,1976/4548	144998169	3198,8650	1977	3947	5924	SO:0001819	synonymous_variant	5339	exon31			CTCCGCCGCCAGC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.6339G>A	8.37:g.144998169C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	14	14	NM_201380	0	0	0	7	7	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																			C|0.740;T|0.260		0.741	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
PLEC	5339	hgsc.bcm.edu	37	8	145001784	145001784	+	Silent	SNP	A	A	G	rs3135109	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr8:145001784A>G	ENST00000322810.4	-	27	4130	c.3961T>C	c.(3961-3963)Ttg>Ctg	p.L1321L	PLEC_ENST00000436759.2_Silent_p.L1211L|PLEC_ENST00000527096.1_Silent_p.L1207L|PLEC_ENST00000354958.2_Silent_p.L1162L|PLEC_ENST00000354589.3_Silent_p.L1184L|PLEC_ENST00000345136.3_Silent_p.L1184L|PLEC_ENST00000357649.2_Silent_p.L1188L|PLEC_ENST00000398774.2_Silent_p.L1152L|PLEC_ENST00000356346.3_Silent_p.L1170L	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	1321	Globular 1.		L -> V (in dbSNP:rs3135109). {ECO:0000269|PubMed:8698233}.		apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CGCTCAAGCAACTGGGCGACC	0.716													G|||	1156	0.230831	0.028	0.2954	5008	,	,		12494	0.1429		0.4274	False		,,,				2504	0.3476				p.L1321L		.											.	PLEC-141	0			c.T3961C						.	G	,,,,,,,	296,3620		20,256,1682	5.0	6.0	6.0		3631,3508,3484,3961,3454,3550,3562,3550	4.4	0.9	8	dbSNP_103	6	2835,5065		532,1771,1647	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	,,,,,,,	552,2027,3329	GG,GA,AA		35.8861,7.5587,26.498	,,,,,,,	1211/4575,1170/4534,1162/4526,1321/4685,1152/4516,1184/4548,1188/4552,1184/4548	145001784	3131,8685	1958	3950	5908	SO:0001819	synonymous_variant	5339	exon27			CAAGCAACTGGGC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.3961T>C	8.37:g.145001784A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_201380	1	0	0	23	22	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																			G|0.246;A|0.754		0.716	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
MFSD3	113655	bcgsc.ca	37	8	145738769	145738769	+	IGR	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr8:145738769G>A	ENST00000301327.4	+	0	1548				CTD-2517M22.17_ENST00000580385.1_RNA|RECQL4_ENST00000532237.1_5'UTR|RECQL4_ENST00000428558.2_Splice_Site	NM_138431.1	NP_612440.1	Q96ES6	MFSD3_HUMAN	major facilitator superfamily domain containing 3						transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				central_nervous_system(2)|endometrium(1)|kidney(1)|lung(4)	8	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			CCACCACCCGGCAACTGGCCC	0.682																																					p.R766W		.											.	RECQL4-1083	0			c.C2296T						.						15.0	20.0	19.0					8																	145738769		2079	4204	6283	SO:0001628	intergenic_variant	9401	exon14			CACCCGGCAACTG		CCDS6431.1	8q24.3	2005-11-17			ENSG00000167700	ENSG00000167700			25157	protein-coding gene	gene with protein product							Standard	NM_138431		Approved		uc003zdi.1	Q96ES6	OTTHUMG00000165177		8.37:g.145738769G>A		Somatic	104	0		WXS	Illumina GAIIx	Phase_I	218	101	NM_004260	0	0	0	0	0		Missense_Mutation	SNP	ENST00000301327.4	37	CCDS6431.1																																																																																			.		0.682	MFSD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382478.2	NM_138431	
LRRC14	9684	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	145745151	145745151	+	Silent	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr8:145745151G>A	ENST00000292524.1	+	2	188	c.42G>A	c.(40-42)caG>caA	p.Q14Q	RECQL4_ENST00000532237.1_5'Flank|LRRC14_ENST00000529022.1_Silent_p.Q14Q|RECQL4_ENST00000428558.2_5'Flank	NM_001272036.1|NM_014665.2	NP_001258965.1|NP_055480.1	Q15048	LRC14_HUMAN	leucine rich repeat containing 14	14										endometrium(1)|lung(3)|prostate(1)	5	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			AGGTGCTGCAGTGCCAGCCAG	0.632																																					p.Q14Q		.											.	LRRC14-90	0			c.G42A						.						33.0	32.0	32.0					8																	145745151		2201	4300	6501	SO:0001819	synonymous_variant	9684	exon3			GCTGCAGTGCCAG	BC011377	CCDS6432.1	8q24.3	2012-08-20			ENSG00000160959	ENSG00000160959			20419	protein-coding gene	gene with protein product						7584026	Standard	NM_001272036		Approved	KIAA0014, LRRC14A	uc003zdk.3	Q15048	OTTHUMG00000165179	ENST00000292524.1:c.42G>A	8.37:g.145745151G>A		Somatic	183	0		WXS	Illumina GAIIx	Phase_I	198	105	NM_001272036	0	0	7	14	7	A8K0A8|D3DWM8	Silent	SNP	ENST00000292524.1	37	CCDS6432.1																																																																																			.		0.632	LRRC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382494.1	NM_014665	
ZNF517	340385	hgsc.bcm.edu	37	8	146033347	146033347	+	Missense_Mutation	SNP	T	T	C	rs2976653	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr8:146033347T>C	ENST00000531720.1	+	4	1091	c.1046T>C	c.(1045-1047)gTg>gCg	p.V349A	ZNF517_ENST00000359971.3_Missense_Mutation_p.V349A|ZNF517_ENST00000525105.1_Intron|ZNF517_ENST00000526178.1_Intron			Q6ZMY9	ZN517_HUMAN	zinc finger protein 517	349				V -> A (in Ref. 1; BAD18586). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(2)|lung(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_cancers(97;1.03e-11)|all_epithelial(106;6.69e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;5.47e-39)|OV - Ovarian serous cystadenocarcinoma(54;6.38e-39)|all cancers(56;5.47e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)			GACGGCGGCGTGGGGCAGGGC	0.746													C|||	4981	0.994609	1.0	1.0	5008	,	,		12856	1.0		0.994	False		,,,				2504	0.9785				p.V349A		.											.	ZNF517-90	0			c.T1046C						.	C	ALA/VAL	3411,3		1704,3,0	3.0	5.0	4.0		1046	-0.8	0.0	8	dbSNP_101	4	7050,46		3502,46,0	no	missense	ZNF517	NM_213605.2	64	5206,49,0	CC,CT,TT		0.6483,0.0879,0.4662	benign	349/493	146033347	10461,49	1707	3548	5255	SO:0001583	missense	340385	exon5			GCGGCGTGGGGCA	AK096527	CCDS6434.1	8q24.3	2013-01-08				ENSG00000197363		"""Zinc fingers, C2H2-type"", ""-"""	27984	protein-coding gene	gene with protein product							Standard	NM_213605		Approved		uc003zed.1	Q6ZMY9		ENST00000531720.1:c.1046T>C	8.37:g.146033347T>C	ENSP00000436103:p.Val349Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	15	15	NM_213605	0	0	0	6	6		Missense_Mutation	SNP	ENST00000531720.1	37	CCDS6434.1	2179|2179	0.9977106227106227|0.9977106227106227	492|492	1.0|1.0	362|362	1.0|1.0	572|572	1.0|1.0	753|753	0.9934036939313984|0.9934036939313984	C|C	0.021|0.021	-1.418607|-1.418607	0.01136|0.01136	0.999121|0.999121	0.993517|0.993517	ENSG00000197363|ENSG00000197363	ENST00000359971;ENST00000531720|ENST00000529429	T;T|.	0.05319|.	3.46;3.46|.	2.17|2.17	-0.838|-0.838	0.10762|0.10762	.|.	.|.	.|.	.|.	.|.	T|T	0.00012|0.00012	0.0000|0.0000	L|L	0.35644|0.35644	1.08|1.08	0.80722|0.80722	P|P	0.0|0.0	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|T	0.21449|0.21449	-1.0245|-1.0245	8|4	0.59425|.	D|.	0.04|.	.|.	0.241|0.241	0.00192|0.00192	0.362:0.2246:0.2135:0.1999|0.362:0.2246:0.2135:0.1999	rs2976653;rs59817342|rs2976653;rs59817342	349|.	Q6ZMY9|.	ZN517_HUMAN|.	A|R	349|316	ENSP00000353058:V349A;ENSP00000436103:V349A|.	ENSP00000353058:V349A|.	V|W	+|+	2|1	0|0	ZNF517|ZNF517	146004151|146004151	0.001000|0.001000	0.12720|0.12720	0.002000|0.002000	0.10522|0.10522	0.004000|0.004000	0.04260|0.04260	-0.400000|-0.400000	0.07241|0.07241	-0.612000|-0.612000	0.05701|0.05701	-1.157000|-1.157000	0.01802|0.01802	GTG|TGG	G|0.992;C|0.006		0.746	ZNF517-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382642.1	XM_291261	
Unknown	0	bcgsc.ca	37	9	14810	14810	+	IGR	SNP	C	C	G	rs71509922	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr9:14810C>G								None (None upstream) : MIR1302-2 (12846 downstream)																							GAGCCCCCTACGATTCCCAGT	0.642																																					p.S465S		.											.	.	0			c.G1395C						.						6.0	9.0	8.0					9																	14810		1371	3648	5019	SO:0001628	intergenic_variant	100287171	exon11			CCCCTACGATTCC																													9.37:g.14810C>G		Somatic	274	15		WXS	Illumina GAIIx	Phase_I	413	155	NM_182905	1	1	371	3549	3176		Silent	SNP		37																																																																																				C|0.750;G|0.250	0	0.642								
Unknown	0	hgsc.bcm.edu	37	9	14858	14858	+	IGR	SNP	C	C	G	rs563083426		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr9:14858C>G								None (None upstream) : MIR1302-2 (12798 downstream)																							GCTGCGGTGGCGGCAAAGGAG	0.647																																					p.P449P		.											.	.	0			c.G1347C						.						9.0	15.0	13.0					9																	14858		1489	3719	5208	SO:0001628	intergenic_variant	100287171	exon11			CGGTGGCGGCAAA																													9.37:g.14858C>G		Somatic	250	0		WXS	Illumina GAIIx	Phase_I	366	63	NM_182905	0	0	15	15	0		Silent	SNP		37																																																																																				.	0	0.647								
SMARCA2	6595	broad.mit.edu	37	9	2088608	2088608	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr9:2088608G>A	ENST00000382203.1	+	19	3087	c.2878G>A	c.(2878-2880)Gaa>Aaa	p.E960K	SMARCA2_ENST00000382194.1_Missense_Mutation_p.E960K|SMARCA2_ENST00000349721.2_Missense_Mutation_p.E960K|SMARCA2_ENST00000357248.2_Missense_Mutation_p.E960K			P51531	SMCA2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2	960					aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|chromatin remodeling (GO:0006338)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		CCAGCTTCCCGAAAAAGTATG	0.363																																					p.E960K		.											.	SMARCA2-653	0			c.G2878A						.						85.0	98.0	94.0					9																	2088608		2203	4300	6503	SO:0001583	missense	6595	exon19			CTTCCCGAAAAAG	D26155	CCDS34977.1, CCDS34978.1, CCDS75807.1, CCDS75808.1	9p24.3	2008-11-11	2006-11-09		ENSG00000080503	ENSG00000080503			11098	protein-coding gene	gene with protein product		600014		SNF2L2		8012116	Standard	NM_003070		Approved	BAF190, hSNF2a, hBRM, Sth1p, SNF2LA, BRM, SNF2, SWI2	uc003zhc.3	P51531	OTTHUMG00000019445	ENST00000382203.1:c.2878G>A	9.37:g.2088608G>A	ENSP00000371638:p.Glu960Lys	Somatic	116	0		WXS	Illumina GAIIx	Phase_I	104	5	NM_139045	0	0	0	0	0	B1ALG3|B1ALG4|D3DRH4|D3DRH5	Missense_Mutation	SNP	ENST00000382203.1	37	CCDS34977.1	.	.	.	.	.	.	.	.	.	.	G	33	5.230428	0.95207	.	.	ENSG00000080503	ENST00000349721;ENST00000357248;ENST00000382203;ENST00000382194	T;T;T;T	0.76186	-1.0;-1.0;-1.0;-1.0	5.43	5.43	0.79202	SNF2-related (1);	0.000000	0.85682	D	0.000000	T	0.78464	0.4287	N	0.17474	0.49	0.80722	D	1	D;D;D	0.76494	0.974;0.999;0.999	P;D;D	0.79784	0.862;0.988;0.993	T	0.82084	-0.0632	10	0.72032	D	0.01	-22.7481	19.2492	0.93917	0.0:0.0:1.0:0.0	.	561;960;960	B4DK35;P51531-2;P51531	.;.;SMCA2_HUMAN	K	960	ENSP00000265773:E960K;ENSP00000349788:E960K;ENSP00000371638:E960K;ENSP00000371629:E960K	ENSP00000265773:E960K	E	+	1	0	SMARCA2	2078608	1.000000	0.71417	0.998000	0.56505	0.988000	0.76386	9.748000	0.98867	2.563000	0.86464	0.655000	0.94253	GAA	.		0.363	SMARCA2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000051505.1	NM_003070	
TESK1	7016	bcgsc.ca	37	9	35609536	35609536	+	Missense_Mutation	SNP	C	C	T	rs567466527		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr9:35609536C>T	ENST00000336395.5	+	10	1928	c.1678C>T	c.(1678-1680)Cgg>Tgg	p.R560W	TESK1_ENST00000498522.1_3'UTR|MIR4667_ENST00000578933.1_RNA|CD72_ENST00000490239.1_5'Flank|CD72_ENST00000396757.1_3'UTR	NM_006285.2	NP_006276.2	Q15569	TESK1_HUMAN	testis-specific kinase 1	560					cell junction assembly (GO:0034329)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	27			Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			TTCAGCTCCCCGGGAGCCCGA	0.716																																					p.R560W		.											.	TESK1-641	0			c.C1678T						.						33.0	41.0	38.0					9																	35609536		2195	4295	6490	SO:0001583	missense	7016	exon10			GCTCCCCGGGAGC	D50863	CCDS6580.1	9p13	2010-04-27			ENSG00000107140	ENSG00000107140	2.7.12.1		11731	protein-coding gene	gene with protein product	"""testis-specific kinase-1"", ""testis specific kinase-1"""	601782				8537404	Standard	NM_006285		Approved		uc003zxa.3	Q15569	OTTHUMG00000019863	ENST00000336395.5:c.1678C>T	9.37:g.35609536C>T	ENSP00000338127:p.Arg560Trp	Somatic	28	1		WXS	Illumina GAIIx	Phase_I	44	40	NM_006285	0	0	1	22	21	Q8IXZ8	Missense_Mutation	SNP	ENST00000336395.5	37	CCDS6580.1	.	.	.	.	.	.	.	.	.	.	C	16.62	3.175086	0.57692	.	.	ENSG00000107140	ENST00000535770;ENST00000336395	T	0.75821	-0.97	5.06	3.08	0.35506	.	0.000000	0.39407	N	0.001379	T	0.62134	0.2403	N	0.19112	0.55	0.80722	D	1	D;D	0.63880	0.993;0.989	P;B	0.50352	0.638;0.332	T	0.63193	-0.6692	10	0.72032	D	0.01	-10.7723	3.5751	0.07932	0.2929:0.4781:0.1456:0.0834	.	478;560	B4DQQ3;Q15569	.;TESK1_HUMAN	W	91;560	ENSP00000338127:R560W	ENSP00000338127:R560W	R	+	1	2	TESK1	35599536	0.494000	0.26043	1.000000	0.80357	0.976000	0.68499	0.824000	0.27379	1.073000	0.40885	0.563000	0.77884	CGG	.		0.716	TESK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052314.1	NM_006285	
FBXO10	26267	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	9	37516027	37516027	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr9:37516027C>T	ENST00000432825.2	-	10	2618	c.2570G>A	c.(2569-2571)cGt>cAt	p.R857H	FBXO10_ENST00000541829.1_Missense_Mutation_p.R382H|RP11-613M10.8_ENST00000544475.1_5'UTR	NM_012166.2	NP_036298.2	Q9UK96	FBX10_HUMAN	F-box protein 10	857					apoptotic process (GO:0006915)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of apoptotic process (GO:0042981)	cytoplasm (GO:0005737)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(5)|large_intestine(11)|lung(15)|prostate(1)|upper_aerodigestive_tract(1)	34				GBM - Glioblastoma multiforme(29;0.0107)		GGCCTTGGCACGGCCCCGCAC	0.537																																					p.R857H		.											.	FBXO10-637	0			c.G2570A						.						183.0	156.0	165.0					9																	37516027		1917	4126	6043	SO:0001583	missense	26267	exon10			TTGGCACGGCCCC	AF174598	CCDS47966.1	9p13.1	2014-01-29	2004-06-15		ENSG00000147912	ENSG00000147912		"""F-boxes /  ""other"""""	13589	protein-coding gene	gene with protein product		609092	"""F-box only protein 10"""			10531035, 10531037, 19300908	Standard	NM_012166		Approved	FBX10	uc004aab.3	Q9UK96	OTTHUMG00000019926	ENST00000432825.2:c.2570G>A	9.37:g.37516027C>T	ENSP00000403802:p.Arg857His	Somatic	161	0		WXS	Illumina GAIIx	Phase_I	122	109	NM_012166	0	0	1	5	4	Q08AL3|Q08AL4|Q5JRT8|Q9UKC3	Missense_Mutation	SNP	ENST00000432825.2	37	CCDS47966.1	.	.	.	.	.	.	.	.	.	.	C	12.49	1.954316	0.34471	.	.	ENSG00000147912	ENST00000432825;ENST00000541829	T;T	0.80304	-1.36;-1.36	5.43	2.2	0.27929	Pectin lyase fold/virulence factor (1);Pectin lyase fold (1);	0.382752	0.29159	N	0.012977	T	0.50292	0.1607	N	0.03608	-0.345	0.25439	N	0.98812	B;B;B	0.06786	0.0;0.001;0.001	B;B;B	0.04013	0.001;0.001;0.001	T	0.29274	-1.0017	10	0.12103	T	0.63	-11.7144	2.6817	0.05095	0.2072:0.3887:0.0:0.4041	.	736;382;857	Q59F51;Q08AL4;Q9UK96	.;.;FBX10_HUMAN	H	857;382	ENSP00000403802:R857H;ENSP00000441307:R382H	ENSP00000403802:R857H	R	-	2	0	FBXO10	37506027	0.637000	0.27216	0.758000	0.31321	0.747000	0.42532	0.951000	0.29135	0.678000	0.31325	0.511000	0.50034	CGT	.		0.537	FBXO10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052472.3		
ANXA1	301	broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	75774284	75774284	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr9:75774284G>A	ENST00000376911.1	+	3	1097	c.215G>A	c.(214-216)cGa>cAa	p.R72Q	ANXA1_ENST00000257497.6_Missense_Mutation_p.R72Q			P04083	ANXA1_HUMAN	annexin A1	72					alpha-beta T cell differentiation (GO:0046632)|arachidonic acid secretion (GO:0050482)|cell surface receptor signaling pathway (GO:0007166)|cellular component movement (GO:0006928)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to hydrogen peroxide (GO:0070301)|endocrine pancreas development (GO:0031018)|estrous cycle phase (GO:0060206)|gliogenesis (GO:0042063)|hepatocyte differentiation (GO:0070365)|inflammatory response (GO:0006954)|insulin secretion (GO:0030073)|keratinocyte differentiation (GO:0030216)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of apoptotic process (GO:0043066)|negative regulation of catalytic activity (GO:0043086)|negative regulation of interleukin-8 secretion (GO:2000483)|neutrophil clearance (GO:0097350)|neutrophil homeostasis (GO:0001780)|peptide cross-linking (GO:0018149)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of neutrophil apoptotic process (GO:0033031)|positive regulation of prostaglandin biosynthetic process (GO:0031394)|positive regulation of vesicle fusion (GO:0031340)|regulation of cell proliferation (GO:0042127)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to interleukin-1 (GO:0070555)|response to peptide hormone (GO:0043434)|response to X-ray (GO:0010165)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cilium (GO:0005929)|cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|phospholipase A2 inhibitor activity (GO:0019834)|phospholipid binding (GO:0005543)|protein binding, bridging (GO:0030674)|receptor binding (GO:0005102)|structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(1)|large_intestine(1)|lung(5)	8		all_epithelial(88;2.54e-11)		OV - Ovarian serous cystadenocarcinoma(323;2.82e-06)|GBM - Glioblastoma multiforme(74;0.0325)	Amcinonide(DB00288)|Dexamethasone(DB01234)|Hydrocortisone(DB00741)	CTAACTAAGCGAAACAATGCA	0.363																																					p.R72Q		.											.	ANXA1-650	0			c.G215A						.						167.0	154.0	158.0					9																	75774284		2203	4300	6503	SO:0001583	missense	301	exon4			CTAAGCGAAACAA	X05908	CCDS6645.1	9q21.13	2013-02-25			ENSG00000135046	ENSG00000135046		"""Annexins"", ""Endogenous ligands"""	533	protein-coding gene	gene with protein product		151690		ANX1, LPC1		2936963	Standard	NM_000700		Approved		uc004ajf.1	P04083	OTTHUMG00000020016	ENST00000376911.1:c.215G>A	9.37:g.75774284G>A	ENSP00000366109:p.Arg72Gln	Somatic	194	2		WXS	Illumina GAIIx	Phase_I	81	75	NM_000700	0	0	6	124	118		Missense_Mutation	SNP	ENST00000376911.1	37	CCDS6645.1	.	.	.	.	.	.	.	.	.	.	G	36	5.746851	0.96882	.	.	ENSG00000135046	ENST00000257497;ENST00000456643;ENST00000415424;ENST00000376911	T;T;T;T	0.12672	2.66;2.66;2.66;2.66	5.63	5.63	0.86233	Annexin repeat, conserved site (1);	0.000000	0.85682	D	0.000000	T	0.55049	0.1896	H	0.97540	4.025	0.80722	D	1	D	0.71674	0.998	D	0.66847	0.947	T	0.71695	-0.4515	10	0.87932	D	0	.	20.0401	0.97581	0.0:0.0:1.0:0.0	.	72	P04083	ANXA1_HUMAN	Q	72;83;72;72	ENSP00000257497:R72Q;ENSP00000412489:R83Q;ENSP00000414013:R72Q;ENSP00000366109:R72Q	ENSP00000257497:R72Q	R	+	2	0	ANXA1	74964104	1.000000	0.71417	0.997000	0.53966	0.975000	0.68041	8.834000	0.92094	2.805000	0.96524	0.655000	0.94253	CGA	.		0.363	ANXA1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052665.1	NM_000700	
SPATA31E1	286234	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	90503505	90503505	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr9:90503505G>A	ENST00000325643.5	+	4	4169	c.4103G>A	c.(4102-4104)cGt>cAt	p.R1368H		NM_178828.4	NP_849150.3	Q6ZUB1	S31E1_HUMAN	SPATA31 subfamily E, member 1	1368					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											CACCAAGAACGTAGCAGAGAG	0.592																																					p.R1368H		.											.	.	0			c.G4103A						.						81.0	70.0	74.0					9																	90503505		2203	4300	6503	SO:0001583	missense	286234	exon4			AAGAACGTAGCAG	AK093185	CCDS6676.1	9q22.1-q22.2	2012-10-12	2012-10-12	2012-10-12	ENSG00000177992	ENSG00000177992			26672	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 79"", ""family with sequence similarity 75, member E1"""	C9orf79, FAM75E1			Standard	NM_178828		Approved	FLJ35866	uc004app.4	Q6ZUB1	OTTHUMG00000020157	ENST00000325643.5:c.4103G>A	9.37:g.90503505G>A	ENSP00000322640:p.Arg1368His	Somatic	155	0		WXS	Illumina GAIIx	Phase_I	113	100	NM_178828	0	0	0	0	0	B2RPB1|Q5SQC9|Q8NA41|Q8ND27	Missense_Mutation	SNP	ENST00000325643.5	37	CCDS6676.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	6.344|6.344	0.431505|0.431505	0.12045|0.12045	.|.	.|.	ENSG00000177992|ENSG00000177992	ENST00000325643|ENST00000539327	T|.	0.02974|.	4.09|.	2.47|2.47	1.31|1.31	0.21738|0.21738	.|.	1.651390|.	0.03689|.	N|.	0.246736|.	T|T	0.08313|0.08313	0.0207|0.0207	N|N	0.01352|0.01352	-0.895|-0.895	0.09310|0.09310	N|N	1|1	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|T	0.35822|0.35822	-0.9773|-0.9773	10|6	0.06757|0.11794	T|T	0.87|0.64	.|.	4.2597|4.2597	0.10735|0.10735	0.8292:0.0:0.1708:0.0|0.8292:0.0:0.1708:0.0	.|.	1368|.	Q6ZUB1|.	CI079_HUMAN|.	H|I	1368|583	ENSP00000322640:R1368H|.	ENSP00000322640:R1368H|ENSP00000443171:V583I	R|V	+|+	2|1	0|0	C9orf79|C9orf79	89693325|89693325	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	-0.296000|-0.296000	0.08287|0.08287	0.385000|0.385000	0.24970|0.24970	-0.238000|-0.238000	0.12139|0.12139	CGT|GTA	.		0.592	SPATA31E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052954.2	NM_178828	
GABBR2	9568	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	101258725	101258725	+	Silent	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr9:101258725G>A	ENST00000259455.2	-	4	1161	c.702C>T	c.(700-702)aaC>aaT	p.N234N	GABBR2_ENST00000477471.1_5'UTR	NM_005458.7	NP_005449.5	O75899	GABR2_HUMAN	gamma-aminobutyric acid (GABA) B receptor, 2	234					G-protein coupled receptor signaling pathway (GO:0007186)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|G-protein coupled receptor heterodimeric complex (GO:0038039)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled GABA receptor activity (GO:0004965)	p.N234N(1)	NOTCH1_ENST00000277541/GABBR2(2)	breast(4)|endometrium(4)|large_intestine(12)|lung(21)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	49		Acute lymphoblastic leukemia(62;0.0527)			Baclofen(DB00181)	TACAGGGATCGTTGGAGAAGC	0.522																																					p.N234N		.											.	GABBR2-518	1	Substitution - coding silent(1)	endometrium(1)	c.C702T						.						168.0	146.0	154.0					9																	101258725		2203	4300	6503	SO:0001819	synonymous_variant	9568	exon4			GGGATCGTTGGAG	AF069755	CCDS6736.1	9q22.1-q22.3	2012-08-29	2006-02-16	2006-02-16	ENSG00000136928	ENSG00000136928		"""GABA receptors"", ""GPCR / Class C : GABA(B) receptors"""	4507	protein-coding gene	gene with protein product		607340	"""G protein-coupled receptor 51"""	GPR51		10087195	Standard	NM_005458		Approved	HG20, GABABR2, GPRC3B	uc004ays.3	O75899	OTTHUMG00000020345	ENST00000259455.2:c.702C>T	9.37:g.101258725G>A		Somatic	154	1		WXS	Illumina GAIIx	Phase_I	105	98	NM_005458	0	0	0	0	0	O75974|O75975|Q5VXZ2|Q8WX04|Q9P1R2|Q9UNR1|Q9UNS9	Silent	SNP	ENST00000259455.2	37	CCDS6736.1																																																																																			.		0.522	GABBR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053373.1		
GPR144	347088	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	127239354	127239354	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr9:127239354G>A	ENST00000334810.1	+	20	2867	c.2867G>A	c.(2866-2868)cGt>cAt	p.R956H				Q7Z7M1	GP144_HUMAN	G protein-coupled receptor 144	956					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(3)	4						AGCACCCCCCGTCACCCTCTG	0.657																																					p.R956H		.											.	.	0			c.G2867A						.						90.0	92.0	92.0					9																	127239354		692	1591	2283	SO:0001583	missense	347088	exon20			CCCCCCGTCACCC	AY278562		9q34.11	2014-08-08			ENSG00000180264	ENSG00000180264		"""-"", ""GPCR / Class B : Orphans"""	18651	protein-coding gene	gene with protein product							Standard	XM_006710216		Approved	PGR24	uc010mwn.3	Q7Z7M1	OTTHUMG00000020652	ENST00000334810.1:c.2867G>A	9.37:g.127239354G>A	ENSP00000335156:p.Arg956His	Somatic	19	0		WXS	Illumina GAIIx	Phase_I	14	11	NM_001161808	0	0	0	0	0	Q86SL4|Q8NH12	Missense_Mutation	SNP	ENST00000334810.1	37	CCDS48016.1	.	.	.	.	.	.	.	.	.	.	G	2.855	-0.237470	0.05944	.	.	ENSG00000180264	ENST00000334810	T	0.54479	0.57	2.12	-4.24	0.03777	.	.	.	.	.	T	0.21550	0.0519	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.04737	-1.0930	9	0.40728	T	0.16	.	1.6396	0.02750	0.1504:0.3374:0.2943:0.2178	.	956	Q7Z7M1	GP144_HUMAN	H	956	ENSP00000335156:R956H	ENSP00000335156:R956H	R	+	2	0	GPR144	126279175	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	-0.404000	0.07205	-3.991000	0.00084	-0.689000	0.03729	CGT	.		0.657	GPR144-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054026.2	NM_182611	
SEC16A	9919	broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	139354235	139354235	+	Missense_Mutation	SNP	G	G	A	rs367852678		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr9:139354235G>A	ENST00000371706.3	-	13	4664	c.4631C>T	c.(4630-4632)aCg>aTg	p.T1544M	SEC16A_ENST00000313050.7_Missense_Mutation_p.T1722M|SEC16A_ENST00000431893.2_Missense_Mutation_p.T1544M|SEC16A_ENST00000290037.6_Missense_Mutation_p.T1544M			O15027	SC16A_HUMAN	SEC16 homolog A (S. cerevisiae)	1544					COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|protein transport (GO:0015031)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)				breast(1)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(15)|lung(14)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Myeloproliferative disorder(178;0.0511)		Epithelial(140;2.9e-06)|OV - Ovarian serous cystadenocarcinoma(145;5.88e-06)		GGTAGCCATCGTCCTGGACTC	0.592																																					p.T1722M		.											.	.	0			c.C5165T						.	G	MET/THR	1,4137		0,1,2068	54.0	56.0	56.0		5165	5.6	0.9	9		56	0,8434		0,0,4217	no	missense	SEC16A	NM_014866.1	81	0,1,6285	AA,AG,GG		0.0,0.0242,0.0080	probably-damaging	1722/2358	139354235	1,12571	2069	4217	6286	SO:0001583	missense	9919	exon15			GCCATCGTCCTGG	AK074565	CCDS55351.1, CCDS75936.1	9q34.3	2007-06-20	2007-06-20	2007-06-20	ENSG00000148396	ENSG00000148396			29006	protein-coding gene	gene with protein product		612854	"""KIAA0310"""	KIAA0310		9205841	Standard	NM_014866		Approved	p250	uc004chx.3	O15027	OTTHUMG00000020932	ENST00000371706.3:c.4631C>T	9.37:g.139354235G>A	ENSP00000360771:p.Thr1544Met	Somatic	94	1		WXS	Illumina GAIIx	Phase_I	47	41	NM_014866	0	0	0	8	8	A1YCA4|Q4G0D7|Q5SXP0|Q5SXP1|Q8N347|Q96HP1	Missense_Mutation	SNP	ENST00000371706.3	37		.	.	.	.	.	.	.	.	.	.	G	23.7	4.445793	0.84101	2.42E-4	0.0	ENSG00000148396	ENST00000313050;ENST00000277537;ENST00000453963;ENST00000371706;ENST00000290037;ENST00000431893;ENST00000404925	T;T;T;T;T;T	0.50277	1.71;0.75;1.32;1.71;1.71;1.71	5.55	5.55	0.83447	.	0.146393	0.64402	D	0.000008	T	0.64962	0.2646	L	0.50333	1.59	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.74674	0.984;0.978;0.97;0.98	T	0.66476	-0.5914	10	0.87932	D	0	-10.2204	18.4844	0.90823	0.0:0.0:1.0:0.0	.	1722;1544;1544;1112	F1T0I1;O15027-5;O15027-4;A4QN19	.;.;.;.	M	1722;116;444;1544;1544;1544;1112	ENSP00000325827:T1722M;ENSP00000277537:T116M;ENSP00000403525:T444M;ENSP00000360771:T1544M;ENSP00000290037:T1544M;ENSP00000387583:T1544M	ENSP00000277537:T116M	T	-	2	0	SEC16A	138474056	1.000000	0.71417	0.892000	0.35008	0.611000	0.37282	9.716000	0.98752	2.611000	0.88343	0.561000	0.74099	ACG	.		0.592	SEC16A-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000055077.1	XM_088459	
C9orf172	389813	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	9	139739046	139739046	+	Silent	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr9:139739046C>T	ENST00000436881.1	+	1	180	c.180C>T	c.(178-180)gaC>gaT	p.D60D		NM_001080482.2	NP_001073951.2	C9J069	CI172_HUMAN	chromosome 9 open reading frame 172	60										endometrium(2)|large_intestine(1)|lung(6)	9						AGGCGCTGGACGGGCCGGCCA	0.746																																					p.D60D		.											.	.	0			c.C180T						.						5.0	6.0	6.0					9																	139739046		1829	4022	5851	SO:0001819	synonymous_variant	389813	exon1			GCTGGACGGGCCG		CCDS48059.1	9q34.3	2012-04-03			ENSG00000232434	ENSG00000232434			37284	protein-coding gene	gene with protein product							Standard	NM_001080482		Approved		uc011meh.2	C9J069		ENST00000436881.1:c.180C>T	9.37:g.139739046C>T		Somatic	17	0		WXS	Illumina GAIIx	Phase_I	34	30	NM_001080482	0	0	0	3	3		Silent	SNP	ENST00000436881.1	37	CCDS48059.1																																																																																			.		0.746	C9orf172-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001080482	
MXRA5	25878	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	X	3228791	3228791	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chrX:3228791C>T	ENST00000217939.6	-	7	7607	c.7453G>A	c.(7453-7455)Gtt>Att	p.V2485I		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	2485	Ig-like C2-type 9.					extracellular vesicular exosome (GO:0070062)				NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				GCTGGCAGAACCACACCCTCG	0.572																																					p.V2485I		.											.	MXRA5-136	0			c.G7453A						.						52.0	37.0	42.0					X																	3228791		2203	4299	6502	SO:0001583	missense	25878	exon7			GCAGAACCACACC	AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.7453G>A	X.37:g.3228791C>T	ENSP00000217939:p.Val2485Ile	Somatic	398	2		WXS	Illumina GAIIx	Phase_I	558	314	NM_015419	0	0	0	0	0	Q6P1M7|Q9Y3Y8	Missense_Mutation	SNP	ENST00000217939.6	37	CCDS14124.1	.	.	.	.	.	.	.	.	.	.	C	0.010	-1.774168	0.00640	.	.	ENSG00000101825	ENST00000381114;ENST00000217939	T	0.67523	-0.27	3.86	-0.983	0.10263	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.246451	0.20911	U	0.083472	T	0.35307	0.0927	N	0.17248	0.465	0.26221	N	0.979154	B	0.30406	0.278	B	0.25614	0.062	T	0.38564	-0.9655	10	0.05351	T	0.99	.	4.9591	0.14057	0.0:0.2985:0.1571:0.5444	.	2485	Q9NR99	MXRA5_HUMAN	I	2485	ENSP00000217939:V2485I	ENSP00000217939:V2485I	V	-	1	0	MXRA5	3238791	0.075000	0.21258	0.001000	0.08648	0.002000	0.02628	0.066000	0.14489	-0.219000	0.10003	-0.196000	0.12772	GTT	.		0.572	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055655.2	NM_015419	
CA5BP1	340591	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	15720909	15720909	+	RNA	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chrX:15720909C>T	ENST00000380334.2	+	0	326							Q8WTZ4	CA5BL_HUMAN	carbonic anhydrase VB pseudogene 1							mitochondrion (GO:0005739)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)										CCGCAGATTTCGGAAACTTCT	0.572																																					.		.											.	CA5BP1-108	0			.						.																																					340591	.			AGATTTCGGAAAC	BC021816		Xp22.2	2012-11-02	2011-02-07	2011-02-07	ENSG00000186312	ENSG00000186312			29544	pseudogene	pseudogene	"""similar to carbonic anhydrase VB, mitochondrial precursor"", ""carbonic dehydratase"""		"""carbonic anhydrase VB-like"", ""carbonic anhydrase VB pseudogene"""	CA5BL, CA5BP		12477932	Standard	NR_026551		Approved	PRO2325	uc011mir.1	Q8WTZ4	OTTHUMG00000021182		X.37:g.15720909C>T		Somatic	118	0		WXS	Illumina GAIIx	Phase_I	181	77	.	0	0	5	6	1	A6NEZ4	RNA	SNP	ENST00000380334.2	37																																																																																				.		0.572	CA5BP1-005	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000055884.3	NR_026551	
CDKL5	6792	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	18525233	18525233	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chrX:18525233T>G	ENST00000379989.3	+	3	302	c.17T>G	c.(16-18)aTt>aGt	p.I6S	CDKL5_ENST00000379996.3_Missense_Mutation_p.I6S	NM_001037343.1	NP_001032420.1	O76039	CDKL5_HUMAN	cyclin-dependent kinase-like 5	6					neuron migration (GO:0001764)|positive regulation of axon extension (GO:0045773)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of Rac GTPase activity (GO:0032855)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of dendrite development (GO:0050773)	cytoplasm (GO:0005737)|dendrite cytoplasm (GO:0032839)|dendritic growth cone (GO:0044294)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|kinase activity (GO:0016301)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rac GTPase binding (GO:0048365)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(4)|skin(5)|stomach(1)	44	Hepatocellular(33;0.183)					ATTCCTAACATTGGTAATGTG	0.378																																					p.I6S		.											.	CDKL5-838	0			c.T17G						.						255.0	210.0	225.0					X																	18525233		2203	4300	6503	SO:0001583	missense	6792	exon2			CTAACATTGGTAA	Y15057	CCDS14186.1	Xp22	2011-11-04	2002-11-26	2002-11-29	ENSG00000008086	ENSG00000008086		"""Cyclin-dependent kinases"""	11411	protein-coding gene	gene with protein product		300203	"""serine/threonine kinase 9"""	STK9		9721213, 16935860	Standard	XM_005274584		Approved	EIEE2	uc004cym.3	O76039	OTTHUMG00000021214	ENST00000379989.3:c.17T>G	X.37:g.18525233T>G	ENSP00000369325:p.Ile6Ser	Somatic	201	0		WXS	Illumina GAIIx	Phase_I	277	134	NM_003159	0	0	0	0	0	G9B9X4|Q14198|Q5H985|Q8IYC7|Q9UJL6	Missense_Mutation	SNP	ENST00000379989.3	37	CCDS14186.1	.	.	.	.	.	.	.	.	.	.	T	19.42	3.825100	0.71143	.	.	ENSG00000008086	ENST00000379996;ENST00000379989	T;T	0.71579	-0.58;-0.58	5.41	5.41	0.78517	Protein kinase-like domain (1);	0.116928	0.56097	D	0.000028	T	0.64371	0.2592	N	0.08118	0	0.41396	D	0.987641	D	0.67145	0.996	P	0.54544	0.755	T	0.73097	-0.4090	10	0.72032	D	0.01	-17.7337	14.525	0.67881	0.0:0.0:0.0:1.0	.	6	O76039	CDKL5_HUMAN	S	6	ENSP00000369332:I6S;ENSP00000369325:I6S	ENSP00000369325:I6S	I	+	2	0	CDKL5	18435154	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.115000	0.77110	1.810000	0.52873	0.481000	0.45027	ATT	.		0.378	CDKL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055945.2	NM_003159	
NYX	60506	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	41333840	41333840	+	Silent	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chrX:41333840C>T	ENST00000342595.2	+	2	1590	c.1134C>T	c.(1132-1134)ttC>ttT	p.F378F	NYX_ENST00000378220.1_Silent_p.F378F	NM_022567.2	NP_072089.1	Q9GZU5	NYX_HUMAN	nyctalopin	378	LRRCT.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(11)|upper_aerodigestive_tract(1)	17						AGGTGACCTTCGGGCGCTCCT	0.701																																					p.F378F		.											.	NYX-108	0			c.C1134T						.						15.0	16.0	15.0					X																	41333840		2191	4276	6467	SO:0001819	synonymous_variant	60506	exon2			GACCTTCGGGCGC	AF254868	CCDS14256.1	Xp11.4	2014-01-28			ENSG00000188937	ENSG00000188937			8082	protein-coding gene	gene with protein product		300278		CSNB1, CSNB4		11062471, 11062472	Standard	NM_022567		Approved	CLRP, CSNB1A	uc004dfh.2	Q9GZU5	OTTHUMG00000021370	ENST00000342595.2:c.1134C>T	X.37:g.41333840C>T		Somatic	65	0		WXS	Illumina GAIIx	Phase_I	210	113	NM_022567	0	0	0	0	0	D3DWC0|Q2M1S4|Q5H983|Q9H4J0	Silent	SNP	ENST00000342595.2	37	CCDS14256.1																																																																																			.		0.701	NYX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056256.1	NM_022567	
CXorf36	79742	broad.mit.edu	37	X	45017131	45017131	+	Silent	SNP	G	G	T	rs374071629		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chrX:45017131G>T	ENST00000398000.2	-	3	575	c.501C>A	c.(499-501)ggC>ggA	p.G167G	CXorf36_ENST00000477281.1_Intron	NM_176819.3	NP_789789.2	Q9H7Y0	DIA1R_HUMAN	chromosome X open reading frame 36	167						extracellular region (GO:0005576)		p.G167G(1)		endometrium(1)|large_intestine(2)|lung(4)	7						GGCTGGCCAGGCCCTACGCGC	0.677																																					p.G167G		.											.	CXorf36-130	1	Substitution - coding silent(1)	endometrium(1)	c.C501A						.						10.0	9.0	9.0					X																	45017131		1467	3370	4837	SO:0001819	synonymous_variant	79742	exon3			GGCCAGGCCCTAC	AF289581	CCDS14266.1, CCDS48096.1	Xp11.3-p11.23	2012-08-03			ENSG00000147113	ENSG00000147113			25866	protein-coding gene	gene with protein product						11944989, 21283809	Standard	NM_176819		Approved	FLJ14103, DIA1R	uc004dgg.2	Q9H7Y0	OTTHUMG00000021403	ENST00000398000.2:c.501C>A	X.37:g.45017131G>T		Somatic	43	2		WXS	Illumina GAIIx	Phase_I	120	9	NM_176819	0	0	0	0	0	A8MUU5|B2RPN7|Q6UWJ5	Silent	SNP	ENST00000398000.2	37	CCDS48096.1																																																																																			.		0.677	CXorf36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056333.2	NM_024689	
RBM10	8241	broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	47039883	47039883	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chrX:47039883C>T	ENST00000377604.3	+	12	1968	c.1226C>T	c.(1225-1227)gCg>gTg	p.A409V	RBM10_ENST00000478410.1_3'UTR|RBM10_ENST00000329236.7_Missense_Mutation_p.A331V|RBM10_ENST00000345781.6_Missense_Mutation_p.A332V	NM_001204467.1|NM_001204468.1|NM_005676.4	NP_001191396.1|NP_001191397.1|NP_005667.2	P98175	RBM10_HUMAN	RNA binding motif protein 10	409					3'-UTR-mediated mRNA stabilization (GO:0070935)|mRNA processing (GO:0006397)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	48						GCCATTGCTGCGGCCCAGTGG	0.597																																					p.A474V	Melanoma(171;120 2705 19495 39241)	.											.	RBM10-626	0			c.C1421T						.						41.0	33.0	36.0					X																	47039883		2203	4300	6503	SO:0001583	missense	8241	exon12			TTGCTGCGGCCCA	U35373	CCDS14274.1, CCDS56600.1, CCDS75969.1	Xp11.3	2014-06-09			ENSG00000182872	ENSG00000182872		"""Zinc fingers, RAN-binding domain containing"", ""G patch domain containing"", ""RNA binding motif (RRM) containing"""	9896	protein-coding gene	gene with protein product		300080				8590280, 8808293	Standard	NM_005676		Approved	DXS8237E, KIAA0122, GPATC9, ZRANB5, GPATCH9	uc004dhi.3	P98175	OTTHUMG00000021432	ENST00000377604.3:c.1226C>T	X.37:g.47039883C>T	ENSP00000366829:p.Ala409Val	Somatic	323	1		WXS	Illumina GAIIx	Phase_I	368	74	NM_001204468	0	0	15	27	12	C4AM81|Q14136|Q5JRR2|Q9BTE4|Q9BTX0|Q9NTB1	Missense_Mutation	SNP	ENST00000377604.3	37	CCDS14274.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.213786	0.79352	.	.	ENSG00000182872	ENST00000377604;ENST00000329236;ENST00000345781	T;T;T	0.28895	2.29;1.59;1.94	3.05	3.05	0.35203	.	0.154328	0.41823	D	0.000803	T	0.48822	0.1521	M	0.62723	1.935	0.44247	D	0.997097	D;D;D;D;D	0.89917	1.0;1.0;1.0;0.999;1.0	D;D;D;D;D	0.91635	0.997;0.998;0.999;0.991;0.998	T	0.47898	-0.9081	10	0.48119	T	0.1	-9.8024	11.2352	0.48936	0.0:1.0:0.0:0.0	.	332;474;408;331;409	P98175-3;Q7Z3D7;P98175-2;P98175-4;P98175	.;.;.;.;RBM10_HUMAN	V	409;331;332	ENSP00000366829:A409V;ENSP00000328848:A331V;ENSP00000329659:A332V	ENSP00000328848:A331V	A	+	2	0	RBM10	46924827	1.000000	0.71417	0.965000	0.40720	0.990000	0.78478	7.536000	0.82023	1.778000	0.52293	0.597000	0.82753	GCG	.		0.597	RBM10-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056381.1	NM_005676	
GATA1	2623	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	48649679	48649679	+	Missense_Mutation	SNP	G	G	A	rs150572851	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chrX:48649679G>A	ENST00000376670.3	+	2	274	c.163G>A	c.(163-165)Gct>Act	p.A55T	GATA1_ENST00000376665.3_Missense_Mutation_p.A55T	NM_002049.3	NP_002040.1	P15976	GATA1_HUMAN	GATA binding protein 1 (globin transcription factor 1)	55					basophil differentiation (GO:0030221)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|cellular response to thyroid hormone stimulus (GO:0097067)|dendritic cell differentiation (GO:0097028)|embryonic hemopoiesis (GO:0035162)|eosinophil differentiation (GO:0030222)|eosinophil fate commitment (GO:0035854)|erythrocyte development (GO:0048821)|erythrocyte differentiation (GO:0030218)|in utero embryonic development (GO:0001701)|male gonad development (GO:0008584)|megakaryocyte differentiation (GO:0030219)|negative regulation of apoptotic process (GO:0043066)|negative regulation of bone mineralization (GO:0030502)|negative regulation of cell proliferation (GO:0008285)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of definitive erythrocyte differentiation (GO:0010724)|regulation of glycoprotein biosynthetic process (GO:0010559)|transcription from RNA polymerase II promoter (GO:0006366)|transcriptional activation by promoter-enhancer looping (GO:0071733)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	C2H2 zinc finger domain binding (GO:0070742)|chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|enhancer sequence-specific DNA binding (GO:0001158)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)	p.M1fs(7)|p.D42_D74>(3)|p.A53fs*7(3)|p.T48fs*11(2)|p.T54fs*85(1)|p.T52fs*8(1)|p.S47fs*9(1)|p.T54fs*8(1)|p.S51fs*72(1)|p.T54fs*15(1)|p.P50fs*6(1)		breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(259)|large_intestine(8)|lung(9)|prostate(1)	283						CACAGCCACCGCTGCAGCTGC	0.607			"""Mis, F"""		megakaryoblastic leukemia of Downs Syndrome								G|||	1	0.000264901	0.0	0.0	3775	,	,		12135	0.0		0.0	False		,,,				2504	0.001				p.A55T	Pancreas(9;429 505 11287 29617)	.		Dom	yes		X	Xp11.23	2623	GATA binding protein 1 (globin transcription factor 1)		L	.	GATA1-1315	22	Deletion - Frameshift(16)|Complex - frameshift(3)|Complex - deletion inframe(3)	haematopoietic_and_lymphoid_tissue(22)	c.G163A						.		THR/ALA	1,3832		0,1,0,1631,569	24.0	17.0	19.0		163	1.4	0.0	X	dbSNP_134	19	3,6715		0,2,1,2424,1865	yes	missense	GATA1	NM_002049.3	58	0,3,1,4055,2434	AA,AG,A,GG,G		0.0447,0.0261,0.0379	benign	55/414	48649679	4,10547	2201	4292	6493	SO:0001583	missense	2623	exon2			GCCACCGCTGCAG	X17254	CCDS14305.1	Xp11.23	2014-09-17	2001-11-28		ENSG00000102145	ENSG00000102145		"""GATA zinc finger domain containing"""	4170	protein-coding gene	gene with protein product	"""nuclear factor, erythroid 1"""	305371	"""GATA-binding protein 1 (globin transcription factor 1)"""	GF1		1999341	Standard	NM_002049		Approved	ERYF1, NFE1, GATA-1, NF-E1	uc004dkq.4	P15976	OTTHUMG00000021504	ENST00000376670.3:c.163G>A	X.37:g.48649679G>A	ENSP00000365858:p.Ala55Thr	Somatic	134	1		WXS	Illumina GAIIx	Phase_I	160	82	NM_002049	0	0	5	5	0	Q96GB8	Missense_Mutation	SNP	ENST00000376670.3	37	CCDS14305.1	.	.	.	.	.	.	.	.	.	.	g	12.53	1.966240	0.34659	2.61E-4	4.47E-4	ENSG00000102145	ENST00000376670;ENST00000376665	D;D	0.97811	-4.55;-4.35	3.3	1.38	0.22167	.	0.368082	0.23652	U	0.045909	D	0.90772	0.7103	N	0.19112	0.55	0.09310	N	1	D	0.63880	0.993	B	0.38296	0.27	D	0.86258	0.1653	10	0.27082	T	0.32	-1.6267	3.8243	0.08848	0.1536:0.2531:0.5933:0.0	.	55	P15976	GATA1_HUMAN	T	55	ENSP00000365858:A55T;ENSP00000365853:A55T	ENSP00000365853:A55T	A	+	1	0	GATA1	48534623	0.063000	0.20901	0.016000	0.15963	0.199000	0.23934	1.081000	0.30791	0.379000	0.24794	0.165000	0.16767	GCT	G|0.999;A|0.001		0.607	GATA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056517.1	NM_002049	
TSPYL2	64061	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	53112257	53112257	+	Missense_Mutation	SNP	C	C	T	rs192279149		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chrX:53112257C>T	ENST00000375442.4	+	1	709	c.577C>T	c.(577-579)Cgg>Tgg	p.R193W		NM_022117.3	NP_071400.1	Q9H2G4	TSYL2_HUMAN	TSPY-like 2	193	Arg-rich.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cell cycle (GO:0007049)|cellular protein metabolic process (GO:0044267)|chromatin modification (GO:0016568)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|negative regulation of DNA replication (GO:0008156)|nucleosome assembly (GO:0006334)|regulation of protein kinase activity (GO:0045859)|regulation of signal transduction (GO:0009966)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	rDNA binding (GO:0000182)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(1)	19						gcggcggcggcggaggaggaa	0.572																																					p.R193W		.											.	TSPYL2-130	0			c.C577T						.						33.0	23.0	27.0					X																	53112257		2202	4297	6499	SO:0001583	missense	64061	exon1			CGGCGGCGGAGGA	AF273046	CCDS14350.1	Xp11	2014-06-09			ENSG00000184205	ENSG00000184205			24358	protein-coding gene	gene with protein product		300564				11318608, 11395479	Standard	NM_022117		Approved	SE20-4, HRIHFB2216, CTCL, DENTT, CDA1, CINAP, TSPX	uc004drw.3	Q9H2G4	OTTHUMG00000021597	ENST00000375442.4:c.577C>T	X.37:g.53112257C>T	ENSP00000364591:p.Arg193Trp	Somatic	385	1		WXS	Illumina GAIIx	Phase_I	481	230	NM_022117	0	0	32	32	0	O94799|Q96DG7|Q9BZW6	Missense_Mutation	SNP	ENST00000375442.4	37	CCDS14350.1	.	.	.	.	.	.	.	.	.	.	c	14.76	2.631668	0.46944	.	.	ENSG00000184205	ENST00000375442	T	0.24538	1.85	3.99	2.75	0.32379	.	0.147317	0.31859	N	0.006945	T	0.34948	0.0915	L	0.44542	1.39	0.24107	N	0.995852	D;D	0.76494	0.999;0.999	P;P	0.62089	0.898;0.898	T	0.12656	-1.0539	10	0.87932	D	0	-17.228	7.81	0.29226	0.5873:0.4127:0.0:0.0	.	193;193	Q9H2G4;A8K8U7	TSYL2_HUMAN;.	W	193	ENSP00000364591:R193W	ENSP00000364591:R193W	R	+	1	2	TSPYL2	53128982	0.982000	0.34865	0.961000	0.40146	0.438000	0.31896	0.289000	0.18957	0.060000	0.16281	-0.444000	0.05651	CGG	C|0.999;A|0.001		0.572	TSPYL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056718.1	NM_022117	
TRO	7216	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	54951477	54951477	+	Silent	SNP	A	A	G			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chrX:54951477A>G	ENST00000173898.7	+	6	1573	c.1461A>G	c.(1459-1461)gaA>gaG	p.E487E	TRO_ENST00000375041.2_Silent_p.E90E|TRO_ENST00000319167.8_Silent_p.E487E|SNORA11_ENST00000408823.1_RNA|TRO_ENST00000420798.2_Silent_p.E18E|TRO_ENST00000484031.1_3'UTR|TRO_ENST00000399736.1_Silent_p.E90E|TRO_ENST00000375022.4_Silent_p.E487E	NM_001039705.2	NP_001034794.1	Q12816	TROP_HUMAN	trophinin	487	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.				embryo implantation (GO:0007566)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|skin(2)|urinary_tract(1)	37						AAATCATTGAACGAGCAAGCT	0.488																																					p.E487E		.											.	TRO-131	0			c.A1461G						.						59.0	53.0	55.0					X																	54951477		2147	4246	6393	SO:0001819	synonymous_variant	7216	exon6			CATTGAACGAGCA	U04811	CCDS43958.1, CCDS43959.1, CCDS59527.1, CCDS59528.1, CCDS59529.1	Xp11.22-p11.21	2008-02-05			ENSG00000067445	ENSG00000067445			12326	protein-coding gene	gene with protein product		300132				9533028, 11454705	Standard	NM_001039705		Approved	MAGE-D3, KIAA1114, MAGED3	uc004dtq.4	Q12816	OTTHUMG00000021640	ENST00000173898.7:c.1461A>G	X.37:g.54951477A>G		Somatic	598	2		WXS	Illumina GAIIx	Phase_I	672	302	NM_016157	0	0	0	8	8	B1AKE9|B1AKF1|F5GY27|Q96SX2|Q9NU89|Q9UPN8	Silent	SNP	ENST00000173898.7	37	CCDS43959.1																																																																																			.		0.488	TRO-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056837.3	NM_016157	
FAM155B	27112	broad.mit.edu;bcgsc.ca	37	X	68749609	68749609	+	Missense_Mutation	SNP	G	G	A	rs201655694		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chrX:68749609G>A	ENST00000252338.4	+	3	1271	c.1229G>A	c.(1228-1230)cGt>cAt	p.R410H		NM_015686.2	NP_056501.2	O75949	F155B_HUMAN	family with sequence similarity 155, member B	411						integral component of membrane (GO:0016021)		p.R410H(1)		autonomic_ganglia(1)|breast(2)|endometrium(4)|large_intestine(2)|lung(4)|ovary(2)|pancreas(1)	16						CCCCCAGGCCGTGTCAGCAAC	0.612													G|||	0	0.0	0.0	0.0	3775	,	,		10246	0.0		0.0	False		,,,				2504	0.0				p.R410H		.											.	FAM155B-131	1	Substitution - Missense(1)	endometrium(1)	c.G1229A						.	G	HIS/ARG	2,3833		0,1,1,1631,570	167.0	113.0	132.0		1229	0.0	0.0	X		132	0,6728		0,0,0,2428,1872	yes	missense	FAM155B	NM_015686.2	29	0,1,1,4059,2442	AA,AG,A,GG,G		0.0,0.0522,0.0189	benign	410/473	68749609	2,10561	2203	4300	6503	SO:0001583	missense	27112	exon3			CAGGCCGTGTCAG	AF087142	CCDS35317.1	Xq13.1	2008-04-15	2008-04-15	2008-04-15	ENSG00000130054	ENSG00000130054			30701	protein-coding gene	gene with protein product			"""transmembrane protein 28"", ""chromosome X open reading frame 63"""	TMEM28, CXorf63			Standard	NM_015686		Approved	TED	uc004dxk.3	O75949	OTTHUMG00000021756	ENST00000252338.4:c.1229G>A	X.37:g.68749609G>A	ENSP00000252338:p.Arg410His	Somatic	177	0		WXS	Illumina GAIIx	Phase_I	209	8	NM_015686	0	0	1	1	0	B1ALV6|B9EGK1|D3DVU1	Missense_Mutation	SNP	ENST00000252338.4	37	CCDS35317.1	1	6.027727546714888E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	0.040	-1.290641	0.01387	5.22E-4	0.0	ENSG00000130054	ENST00000252338	T	0.47869	0.83	3.01	0.0232	0.14136	.	1.012260	0.07931	N	0.977539	T	0.22399	0.0540	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.18681	-1.0329	10	0.23302	T	0.38	-0.6888	2.7348	0.05237	0.4491:0.0:0.336:0.2149	.	410	O75949-2	.	H	410	ENSP00000252338:R410H	ENSP00000252338:R410H	R	+	2	0	FAM155B	68666334	0.000000	0.05858	0.002000	0.10522	0.010000	0.07245	-0.723000	0.04952	-0.114000	0.11936	0.476000	0.43555	CGT	G|0.999;A|0.001		0.612	FAM155B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057037.1	NM_015686	
PDZD11	51248	broad.mit.edu;bcgsc.ca	37	X	69508314	69508314	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chrX:69508314C>T	ENST00000239666.4	-	3	269	c.137G>A	c.(136-138)cGa>cAa	p.R46Q	KIF4A_ENST00000374403.3_5'Flank|PDZD11_ENST00000473667.1_5'UTR|PDZD11_ENST00000374454.1_Missense_Mutation_p.R46Q|KIF4A_ENST00000374388.3_5'Flank	NM_016484.4	NP_057568.1	Q5EBL8	PDZ11_HUMAN	PDZ domain containing 11	46						basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)	protein C-terminus binding (GO:0008022)			breast(1)|endometrium(2)|large_intestine(3)|lung(3)	9						TGTGATGGTTCGGGGCAGAAA	0.483																																					p.R46Q		.											.	PDZD11-130	0			c.G137A						.						121.0	97.0	105.0					X																	69508314		2203	4300	6503	SO:0001583	missense	51248	exon3			ATGGTTCGGGGCA	AF151061	CCDS14400.1	Xq13.1	2008-02-05		2006-01-24	ENSG00000120509	ENSG00000120509			28034	protein-coding gene	gene with protein product		300632		PDZK11		11042152, 12975309	Standard	NM_016484		Approved		uc004dyd.1	Q5EBL8	OTTHUMG00000021771	ENST00000239666.4:c.137G>A	X.37:g.69508314C>T	ENSP00000239666:p.Arg46Gln	Somatic	457	2		WXS	Illumina GAIIx	Phase_I	613	20	NM_016484	0	1	182	196	13	D3DVU3|Q6UWE1|Q9P0Q1	Missense_Mutation	SNP	ENST00000239666.4	37	CCDS14400.1	.	.	.	.	.	.	.	.	.	.	C	17.57	3.423087	0.62733	.	.	ENSG00000120509	ENST00000239666;ENST00000374454	T;T	0.19250	2.16;2.16	5.03	5.03	0.67393	PDZ/DHR/GLGF (1);	0.000000	0.85682	D	0.000000	T	0.32376	0.0827	N	0.19112	0.55	0.80722	D	1	D;B	0.76494	0.999;0.016	D;B	0.77557	0.99;0.001	T	0.15607	-1.0431	10	0.59425	D	0.04	.	16.4143	0.83729	0.0:1.0:0.0:0.0	.	77;46	Q5EBL8-2;Q5EBL8	.;PDZ11_HUMAN	Q	46	ENSP00000239666:R46Q;ENSP00000363578:R46Q	ENSP00000239666:R46Q	R	-	2	0	PDZD11	69425039	1.000000	0.71417	0.982000	0.44146	0.952000	0.60782	6.804000	0.75186	2.336000	0.79503	0.600000	0.82982	CGA	.		0.483	PDZD11-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057060.1	NM_016484	
TCEAL2	140597	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	101382400	101382400	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chrX:101382400G>T	ENST00000372780.1	+	3	817	c.598G>T	c.(598-600)Gac>Tac	p.D200Y	TCEAL2_ENST00000329035.2_Missense_Mutation_p.D200Y	NM_080390.3	NP_525129.1	Q9H3H9	TCAL2_HUMAN	transcription elongation factor A (SII)-like 2	200					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				NS(1)|biliary_tract(1)|breast(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)	11						AAATTTACAGGACCCCTTCTA	0.488																																					p.D200Y		.											.	TCEAL2-130	0			c.G598T						.						88.0	93.0	91.0					X																	101382400		2202	4298	6500	SO:0001583	missense	140597	exon3			TTACAGGACCCCT	AF325115	CCDS14496.1	Xq22.1-q22.3	2014-03-21			ENSG00000184905	ENSG00000184905			29818	protein-coding gene	gene with protein product						16221301	Standard	NM_080390		Approved	my048, MY0876G05, WEX1	uc004eip.3	Q9H3H9	OTTHUMG00000022048	ENST00000372780.1:c.598G>T	X.37:g.101382400G>T	ENSP00000361866:p.Asp200Tyr	Somatic	106	0		WXS	Illumina GAIIx	Phase_I	233	99	NM_080390	0	0	0	0	0	B2R5C7	Missense_Mutation	SNP	ENST00000372780.1	37	CCDS14496.1	.	.	.	.	.	.	.	.	.	.	G	17.88	3.496896	0.64186	.	.	ENSG00000184905	ENST00000372780;ENST00000329035	T;T	0.11495	2.77;2.77	3.35	2.49	0.30216	.	0.442567	0.19140	N	0.121712	T	0.25568	0.0622	M	0.72894	2.215	0.09310	N	1	D	0.89917	1.0	D	0.74674	0.984	T	0.02909	-1.1095	10	0.66056	D	0.02	.	5.6324	0.17518	0.1543:0.0:0.8457:0.0	.	200	Q9H3H9	TCAL2_HUMAN	Y	200	ENSP00000361866:D200Y;ENSP00000332359:D200Y	ENSP00000332359:D200Y	D	+	1	0	TCEAL2	101269056	0.797000	0.28877	0.059000	0.19551	0.973000	0.67179	1.367000	0.34204	0.796000	0.33947	0.594000	0.82650	GAC	.		0.488	TCEAL2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057605.1	NM_080390	
COL4A5	1287	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	107812000	107812000	+	Silent	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chrX:107812000C>T	ENST00000361603.2	+	6	577	c.333C>T	c.(331-333)ggC>ggT	p.G111G	COL4A5_ENST00000328300.6_Silent_p.G111G	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5	111	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						GAATGCCAGGCCACGATGGGG	0.398									Alport syndrome with Diffuse Leiomyomatosis																												p.G111G		.											.	COL4A5-133	0			c.C333T						.						96.0	93.0	94.0					X																	107812000		2203	4300	6503	SO:0001819	synonymous_variant	1287	exon6	Familial Cancer Database		GCCAGGCCACGAT	M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.333C>T	X.37:g.107812000C>T		Somatic	212	0		WXS	Illumina GAIIx	Phase_I	387	194	NM_000495	0	0	0	0	0	Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Silent	SNP	ENST00000361603.2	37	CCDS14543.1																																																																																			.		0.398	COL4A5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057880.2		
RBMXL3	139804	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	X	114425196	114425196	+	Missense_Mutation	SNP	G	G	A	rs386827028|rs12399211		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chrX:114425196G>A	ENST00000424776.3	+	1	1234	c.1192G>A	c.(1192-1194)Gac>Aac	p.D398N	LRCH2_ENST00000317135.8_Intron|LRCH2_ENST00000538422.1_Intron	NM_001145346.1	NP_001138818.1	Q8N7X1	RMXL3_HUMAN	RNA binding motif protein, X-linked-like 3	398	Gly-rich.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(13)|kidney(2)|skin(1)	16						CCGCTCGCCCGACGCCCACAG	0.627																																					p.D398N		.											.	.	0			c.G1192A						.																																			SO:0001583	missense	139804	exon1			TCGCCCGACGCCC	AK097568	CCDS55478.1	Xq23	2013-02-12	2009-03-24	2009-03-24	ENSG00000175718	ENSG00000175718		"""RNA binding motif (RRM) containing"""	26859	protein-coding gene	gene with protein product			"""chromosome X open reading frame 55"""	CXorf55			Standard	NM_001145346		Approved	FLJ40249	uc011mte.1	Q8N7X1	OTTHUMG00000022230	ENST00000424776.3:c.1192G>A	X.37:g.114425196G>A	ENSP00000417451:p.Asp398Asn	Somatic	55	0		WXS	Illumina GAIIx	Phase_I	423	266	NM_001145346	0	0	0	0	0	B4DXC0	Missense_Mutation	SNP	ENST00000424776.3	37	CCDS55478.1	856	0.5159734779987944	181	0.42890995260663506	151	0.4870967741935484	216	0.4268774703557312	298	0.473015873015873	G	13.89	2.371776	0.42003	.	.	ENSG00000175718	ENST00000424776	T	0.05996	3.36	0.341	0.341	0.15991	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	D	0.67145	0.996	P	0.57468	0.821	T	0.48647	-0.9017	8	0.87932	D	0	.	2.8111	0.05442	0.4108:0.0:0.5892:0.0	rs12399211	398	Q8N7X1	RMXL3_HUMAN	N	398	ENSP00000417451:D398N	ENSP00000417451:D398N	D	+	1	0	RBMXL3	114331452	0.003000	0.15002	0.002000	0.10522	0.077000	0.17291	0.196000	0.17176	0.424000	0.26061	0.124000	0.15798	GAC	G|0.483;A|0.517		0.627	RBMXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057968.3	NM_001145346	
RBMXL3	139804	hgsc.bcm.edu;ucsc.edu	37	X	114425210	114425210	+	Silent	SNP	G	G	A	rs12399213		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chrX:114425210G>A	ENST00000424776.3	+	1	1248	c.1206G>A	c.(1204-1206)ggG>ggA	p.G402G	LRCH2_ENST00000317135.8_Intron|LRCH2_ENST00000538422.1_Intron	NM_001145346.1	NP_001138818.1	Q8N7X1	RMXL3_HUMAN	RNA binding motif protein, X-linked-like 3	402	Gly-rich.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(13)|kidney(2)|skin(1)	16						CCCACAGCGGGGGCCGCAACA	0.647																																					p.G402G		.											.	.	0			c.G1206A						.																																			SO:0001819	synonymous_variant	139804	exon1			CAGCGGGGGCCGC	AK097568	CCDS55478.1	Xq23	2013-02-12	2009-03-24	2009-03-24	ENSG00000175718	ENSG00000175718		"""RNA binding motif (RRM) containing"""	26859	protein-coding gene	gene with protein product			"""chromosome X open reading frame 55"""	CXorf55			Standard	NM_001145346		Approved	FLJ40249	uc011mte.1	Q8N7X1	OTTHUMG00000022230	ENST00000424776.3:c.1206G>A	X.37:g.114425210G>A		Somatic	71	0		WXS	Illumina GAIIx	Phase_I	367	157	NM_001145346	0	0	0	0	0	B4DXC0	Silent	SNP	ENST00000424776.3	37	CCDS55478.1																																																																																			G|0.607;A|0.393		0.647	RBMXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057968.3	NM_001145346	
SLC6A14	11254	broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	115582608	115582608	+	Splice_Site	SNP	T	T	C			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chrX:115582608T>C	ENST00000371900.4	+	8	1020	c.932T>C	c.(931-933)gTa>gCa	p.V311A		NM_007231.3	NP_009162.1	Q9UN76	S6A14_HUMAN	solute carrier family 6 (amino acid transporter), member 14	311					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)|transport (GO:0006810)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	amino acid transmembrane transporter activity (GO:0015171)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	23					L-Proline(DB00172)|Valaciclovir(DB00577)|Valganciclovir(DB01610)	CTCTTATAGGTATGGAAAGAT	0.284																																					p.V311A		.											.	SLC6A14-133	0			c.T932C						.						81.0	70.0	74.0					X																	115582608		2203	4300	6503	SO:0001630	splice_region_variant	11254	exon8			TATAGGTATGGAA	AF151978	CCDS14570.1	Xq23	2013-05-22			ENSG00000087916	ENSG00000268104		"""Solute carriers"""	11047	protein-coding gene	gene with protein product		300444	"""solute carrier family 6 (neurotransmitter transporter), member 14"""			10446133	Standard	NM_007231		Approved		uc004eqi.3	Q9UN76	OTTHUMG00000022245	ENST00000371900.4:c.931-1T>C	X.37:g.115582608T>C		Somatic	57	1		WXS	Illumina GAIIx	Phase_I	87	39	NM_007231	0	0	0	0	0	Q5H942	Missense_Mutation	SNP	ENST00000371900.4	37	CCDS14570.1	.	.	.	.	.	.	.	.	.	.	T	18.82	3.704831	0.68615	.	.	ENSG00000087916	ENST00000371900	D	0.82711	-1.64	5.34	5.34	0.76211	.	0.057662	0.64402	D	0.000002	D	0.90055	0.6894	M	0.84433	2.695	0.51767	D	0.999933	D	0.59767	0.986	P	0.60173	0.87	D	0.91409	0.5149	10	0.87932	D	0	.	12.0975	0.53763	0.0:0.0:0.0:1.0	.	311	Q9UN76	S6A14_HUMAN	A	311	ENSP00000360967:V311A	ENSP00000360967:V311A	V	+	2	0	SLC6A14	115496636	1.000000	0.71417	0.968000	0.41197	0.682000	0.39822	7.672000	0.83956	1.760000	0.52011	0.441000	0.28932	GTA	.		0.284	SLC6A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057986.1		Missense_Mutation
RPL39	6170	broad.mit.edu	37	X	118923904	118923904	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chrX:118923904T>A	ENST00000361575.3	-	2	140	c.74A>T	c.(73-75)cAg>cTg	p.Q25L	SNORA69_ENST00000383895.1_RNA|RPL39_ENST00000468844.1_5'UTR	NM_001000.2	NP_000991.1	P62891	RL39_HUMAN	ribosomal protein L39	25					antibacterial humoral response (GO:0019731)|cellular protein metabolic process (GO:0044267)|defense response to Gram-positive bacterium (GO:0050830)|gene expression (GO:0010467)|innate immune response in mucosa (GO:0002227)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular space (GO:0005615)	RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			endometrium(1)|large_intestine(2)	3						CCGAATCCACTGGGGAATGGG	0.413																																					p.K25I		.											.	RPL39-130	0			c.A74T						.						106.0	92.0	97.0					X																	118923904		2203	4300	6503	SO:0001583	missense	6170	exon2			ATCCACTGGGGAA		CCDS14586.1	Xq24	2013-03-11			ENSG00000198918	ENSG00000198918		"""L ribosomal proteins"""	10350	protein-coding gene	gene with protein product		300899	"""ribosomal protein L39 pseudogene 42"""	RPL39P42		8764829	Standard	NM_001000		Approved	L39	uc004erx.2	P62891	OTTHUMG00000022278	ENST00000361575.3:c.74A>T	X.37:g.118923904T>A	ENSP00000355315:p.Gln25Leu	Somatic	47	0		WXS	Illumina GAIIx	Phase_I	111	5	NM_001000	2	0	2278	2280	0	P02404|P39025|Q9BYF2	Missense_Mutation	SNP	ENST00000361575.3	37	CCDS14586.1	.	.	.	.	.	.	.	.	.	.	T	17.25	3.342333	0.61073	.	.	ENSG00000198918	ENST00000361575	.	.	.	4.75	4.75	0.60458	Ribosomal protein L39e domain (2);	0.000000	0.56097	D	0.000028	T	0.58366	0.2117	.	.	.	0.80722	D	1	B	0.18013	0.025	B	0.29862	0.108	T	0.59537	-0.7436	8	0.72032	D	0.01	.	12.3075	0.54910	0.0:0.0:0.0:1.0	.	25	P62891	RL39_HUMAN	L	25	.	ENSP00000355315:Q25L	Q	-	2	0	RPL39	118807932	1.000000	0.71417	0.957000	0.39632	0.899000	0.52679	7.223000	0.78033	1.577000	0.49804	0.242000	0.17961	CAG	.		0.413	RPL39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058047.1	NM_001000	
BCORL1	63035	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	129190051	129190051	+	Silent	SNP	C	C	T			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chrX:129190051C>T	ENST00000218147.7	+	13	5273	c.5076C>T	c.(5074-5076)taC>taT	p.Y1692Y	BCORL1_ENST00000540052.1_Silent_p.Y1692Y|BCORL1_ENST00000359304.2_Silent_p.Y1562Y|BCORL1_ENST00000303743.5_Silent_p.Y1766Y			Q5H9F3	BCORL_HUMAN	BCL6 corepressor-like 1	1692					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|liver(3)|lung(30)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	75						TGGTGCGGTACGAGCCAGACC	0.607																																					p.Y1692Y		.											.	BCORL1-294	0			c.C5076T						.						39.0	38.0	38.0					X																	129190051		2203	4300	6503	SO:0001819	synonymous_variant	63035	exon12			GCGGTACGAGCCA	AL136450	CCDS14616.1	Xq25-q26.1	2014-09-17	2010-06-10		ENSG00000085185	ENSG00000085185		"""Ankyrin repeat domain containing"""	25657	protein-coding gene	gene with protein product		300688	"""chromosome X open reading frame 10"", ""BCL6 co-repressor-like 1"""	CXorf10			Standard	NM_021946		Approved	FLJ11362	uc022cdu.1	Q5H9F3	OTTHUMG00000022379	ENST00000218147.7:c.5076C>T	X.37:g.129190051C>T		Somatic	121	0		WXS	Illumina GAIIx	Phase_I	199	82	NM_021946	0	0	1	3	2	B5MDQ8|Q5H9F2|Q5H9F4|Q6ZVE0|Q8TEN3|Q9Y528	Silent	SNP	ENST00000218147.7	37	CCDS14616.1																																																																																			.		0.607	BCORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058223.1	NM_021946	
MAMLD1	10046	broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	149639048	149639048	+	Silent	SNP	C	C	T	rs375892884		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chrX:149639048C>T	ENST00000370401.2	+	4	1513	c.1203C>T	c.(1201-1203)ccC>ccT	p.P401P	MAMLD1_ENST00000432680.2_Silent_p.P376P|MAMLD1_ENST00000426613.2_Silent_p.P376P|MAMLD1_ENST00000455522.2_5'Flank|MAMLD1_ENST00000262858.5_Silent_p.P401P			Q13495	MAMD1_HUMAN	mastermind-like domain containing 1	401					male gonad development (GO:0008584)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(3)|large_intestine(12)|lung(14)|ovary(1)|prostate(2)	37	Acute lymphoblastic leukemia(192;6.56e-05)					CCCTGGGGCCCGCCATGCCCT	0.592													C|||	1	0.000264901	0.0008	0.0	3775	,	,		14177	0.0		0.0	False		,,,				2504	0.0				p.P401P		.											.	MAMLD1-130	0			c.C1203T						.	C	,,	0,3835		0,0,1632,571	103.0	98.0	100.0		1128,1128,1203	-0.9	0.0	X		100	1,6727		0,1,2427,1872	no	coding-synonymous,coding-synonymous,coding-synonymous	MAMLD1	NM_001177465.1,NM_001177466.1,NM_005491.3	,,	0,1,4059,2443	TT,TC,CC,C		0.0149,0.0,0.0095	,,	376/999,376/750,401/775	149639048	1,10562	2203	4300	6503	SO:0001819	synonymous_variant	10046	exon3			GGGGCCCGCCATG	U46023	CCDS14693.2, CCDS55525.1, CCDS55526.1	Xq28	2008-02-05	2008-01-03	2008-01-03	ENSG00000013619	ENSG00000013619			2568	protein-coding gene	gene with protein product		300120	"""chromosome X open reading frame 6"""	CXorf6		9169146, 17086185, 18162467	Standard	NM_001177465		Approved	CG1, F18	uc011mxu.2	Q13495	OTTHUMG00000024157	ENST00000370401.2:c.1203C>T	X.37:g.149639048C>T		Somatic	131	1		WXS	Illumina GAIIx	Phase_I	191	83	NM_005491	0	0	23	23	0	B2RCQ4|B4DG93|B9EGA5	Silent	SNP	ENST00000370401.2	37	CCDS14693.2																																																																																			.		0.592	MAMLD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000060844.2	NM_005491	
HAUS7	55559	broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	152735950	152735950	+	Silent	SNP	G	G	A			TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chrX:152735950G>A	ENST00000370211.4	-	1	139	c.96C>T	c.(94-96)agC>agT	p.S32S	TREX2_ENST00000334497.2_5'UTR|TREX2_ENST00000338525.2_5'UTR|TREX2_ENST00000370232.1_5'UTR|HAUS7_ENST00000370210.1_Silent_p.S22S|HAUS7_ENST00000370212.3_Silent_p.S32S|TREX2_ENST00000330912.2_5'UTR|HAUS7_ENST00000421080.2_5'UTR	NM_017518.7	NP_059988.3	Q99871	HAUS7_HUMAN	HAUS augmin-like complex, subunit 7	32					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	thioesterase binding (GO:0031996)			endometrium(1)|kidney(3)|large_intestine(1)|lung(10)|prostate(1)|skin(3)	19						TGGACACGCTGCTGTCGCCCT	0.726																																					p.S32S		.											.	HAUS7-90	0			c.C96T						.						29.0	22.0	25.0					X																	152735950		2194	4294	6488	SO:0001819	synonymous_variant	55559	exon1			CACGCTGCTGTCG	AF267739	CCDS35438.1	Xq28	2011-10-24	2009-04-20	2009-04-20		ENSG00000213397		"""HAUS augmin-like complex subunits"""	32979	protein-coding gene	gene with protein product	"""UCH37 interacting protein 1"", ""26S proteasome-associated UCH interacting protein 1"""	300540	"""UCHL5 interacting protein"""	UCHL5IP		11163772, 16395595, 19427217	Standard	NM_017518		Approved	UIP1	uc004fho.2	Q99871		ENST00000370211.4:c.96C>T	X.37:g.152735950G>A		Somatic	177	1		WXS	Illumina GAIIx	Phase_I	338	151	NM_017518	0	0	24	24	0	B4DUH6|D3DWT9|Q96HS8|Q9NP54|Q9UFH9	Silent	SNP	ENST00000370211.4	37	CCDS35438.1																																																																																			.		0.726	HAUS7-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000060963.2	NM_017518	
FLNA	2316	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	153588004	153588004	+	Silent	SNP	G	G	A	rs373659455		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chrX:153588004G>A	ENST00000369850.3	-	24	4226	c.3990C>T	c.(3988-3990)tcC>tcT	p.S1330S	FLNA_ENST00000344736.4_Silent_p.S1330S|FLNA_ENST00000360319.4_Silent_p.S1330S|FLNA_ENST00000422373.1_Silent_p.S1330S|FLNA_ENST00000369856.3_5'Flank	NM_001110556.1	NP_001104026.1	P21333	FLNA_HUMAN	filamin A, alpha	1330					actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|blood coagulation (GO:0007596)|cell junction assembly (GO:0034329)|cilium assembly (GO:0042384)|cytoplasmic sequestering of protein (GO:0051220)|early endosome to late endosome transport (GO:0045022)|epithelial to mesenchymal transition (GO:0001837)|establishment of protein localization (GO:0045184)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription factor import into nucleus (GO:0042993)|protein localization to cell surface (GO:0034394)|protein stabilization (GO:0050821)|receptor clustering (GO:0043113)|spindle assembly involved in mitosis (GO:0090307)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical dendrite (GO:0097440)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|Myb complex (GO:0031523)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|Fc-gamma receptor I complex binding (GO:0034988)|glycoprotein binding (GO:0001948)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|Rac GTPase binding (GO:0048365)|Ral GTPase binding (GO:0017160)|Rho GTPase binding (GO:0017048)|signal transducer activity (GO:0004871)|small GTPase binding (GO:0031267)|transcription factor binding (GO:0008134)			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					TCACGTCCACGGAGTGCAGTC	0.721													.|||	1	0.000264901	0.0008	0.0	3775	,	,		10228	0.0		0.0	False		,,,				2504	0.0				p.S1330S		.											.	FLNA-599	0			c.C3990T						.	G	,	0,3535		0,0,1484,567	39.0	42.0	41.0		3990,3990	-2.6	1.0	X		41	1,6520		0,1,2361,1797	no	coding-synonymous,coding-synonymous	FLNA	NM_001110556.1,NM_001456.3	,	0,1,3845,2364	AA,AG,GG,G		0.0153,0.0,0.0099	,	1330/2648,1330/2640	153588004	1,10055	2051	4159	6210	SO:0001819	synonymous_variant	2316	exon24			GTCCACGGAGTGC	X70082	CCDS44021.1, CCDS48194.1	Xq28	2009-07-23	2009-07-23		ENSG00000196924	ENSG00000196924			3754	protein-coding gene	gene with protein product	"""actin binding protein 280"""	300017	"""filamin A, alpha (actin binding protein 280)"""	FLN1, FLN, OPD2, OPD1		8406501, 12612583	Standard	NM_001456		Approved	ABP-280	uc004fkk.2	P21333	OTTHUMG00000022712	ENST00000369850.3:c.3990C>T	X.37:g.153588004G>A		Somatic	85	0		WXS	Illumina GAIIx	Phase_I	133	71	NM_001456	0	0	0	0	0	E9KL45|Q5HY53|Q5HY55|Q8NF52	Silent	SNP	ENST00000369850.3	37	CCDS48194.1																																																																																			.		0.721	FLNA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058942.3		
GPT2	84706	broad.mit.edu	37	16	46934689	46934690	+	Frame_Shift_Ins	INS	-	-	G	rs114467444	byFrequency	TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr16:46934689_46934690insG	ENST00000340124.4	+	4	541_542	c.429_430insG	c.(430-432)gggfs	p.G144fs	GPT2_ENST00000440783.2_Frame_Shift_Ins_p.G44fs	NM_133443.2	NP_597700.1	Q8TD30	ALAT2_HUMAN	glutamic pyruvate transaminase (alanine aminotransferase) 2	144					2-oxoglutarate metabolic process (GO:0006103)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|L-alanine catabolic process (GO:0042853)|L-alanine metabolic process (GO:0042851)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	L-alanine:2-oxoglutarate aminotransferase activity (GO:0004021)|pyridoxal phosphate binding (GO:0030170)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(2)	23		all_cancers(37;0.0276)|all_epithelial(9;0.0498)|all_lung(18;0.0522)			L-Alanine(DB00160)|Phenelzine(DB00780)	AGGCTTGTGGCGGGAACAGCCT	0.629																																					p.G143fs		.											.	GPT2-92	0			c.429_430insG						.																																			SO:0001589	frameshift_variant	84706	exon4			TTGTGGCGGGAAC		CCDS10725.1, CCDS45478.1	16q12.1	2008-02-05			ENSG00000166123	ENSG00000166123	2.6.1.2		18062	protein-coding gene	gene with protein product		138210					Standard	NM_133443		Approved	ALT2	uc002eel.3	Q8TD30	OTTHUMG00000132541	ENST00000340124.4:c.432dupG	16.37:g.46934692_46934692dupG	ENSP00000345282:p.Gly144fs	Somatic	105	0		WXS	Illumina GAIIx	Phase_I	166	9	NM_133443	0	0	0	0	0	Q8N9E2	Frame_Shift_Ins	INS	ENST00000340124.4	37	CCDS10725.1																																																																																			.		0.629	GPT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255741.2		
TMEM247	388946	hgsc.bcm.edu	37	2	46707883	46707884	+	Frame_Shift_Ins	INS	-	-	GG	rs201742486		TCGA-OR-A5K4-01A-11D-A29I-10	TCGA-OR-A5K4-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	451372e2-860f-4f7e-bf09-d42201a0717f	624bb1d5-633e-47a5-87f5-a3e4799fc621	g.chr2:46707883_46707884insGG	ENST00000434431.1	+	2	457_458	c.457_458insGG	c.(457-459)caafs	p.Q153fs		NM_001145051.2	NP_001138523.1	A6NEH6	TM247_HUMAN	transmembrane protein 247	153						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)											GCAGCTGCAGCAAGAGGCGGCG	0.678																																					p.Q153fs		.											.	.	0			c.457_458insGG						.																																			SO:0001589	frameshift_variant	388946	exon2			CTGCAGCAAGAGG		CCDS56117.1	2p21	2012-04-11			ENSG00000187600	ENSG00000187600			42967	protein-coding gene	gene with protein product							Standard	NM_001145051		Approved		uc010yod.3	A6NEH6	OTTHUMG00000153137	Exception_encountered	2.37:g.46707883_46707884insGG	ENSP00000388684:p.Gln153fs	Somatic	130	0		WXS	Illumina GAIIx	Phase_I	142	0	NM_001145051	0	0	0	0	0		Frame_Shift_Ins	INS	ENST00000434431.1	37	CCDS56117.1																																																																																			.		0.678	TMEM247-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329726.1	NM_001145051	
