#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
NOL9	79707	hgsc.bcm.edu	37	1	6614391	6614391	+	Missense_Mutation	SNP	A	A	C	rs6693391	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr1:6614391A>C	ENST00000377705.5	-	1	204	c.172T>G	c.(172-174)Tcc>Gcc	p.S58A	TAS1R1_ENST00000333172.6_5'Flank|TAS1R1_ENST00000351136.3_5'Flank|TAS1R1_ENST00000328191.4_5'Flank	NM_024654.4	NP_078930	Q5SY16	NOL9_HUMAN	nucleolar protein 9	58			S -> A (in dbSNP:rs6693391). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		maturation of 5.8S rRNA (GO:0000460)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|polynucleotide 5'-hydroxyl-kinase activity (GO:0051731)|RNA binding (GO:0003723)			central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|skin(2)|urinary_tract(1)	19	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;2.46e-35)|all_epithelial(116;1.41e-22)|all_lung(118;7.59e-07)|Lung NSC(185;4.28e-06)|Colorectal(325;4.52e-05)|Breast(487;0.000353)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.47e-07)|COAD - Colon adenocarcinoma(227;1.47e-05)|Kidney(185;5.27e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000971)|BRCA - Breast invasive adenocarcinoma(365;0.00113)|STAD - Stomach adenocarcinoma(132;0.0017)|READ - Rectum adenocarcinoma(331;0.0649)		TCCACGCCGGACGCCTGGGCT	0.781													C|||	4789	0.95627	0.8722	0.9841	5008	,	,		9026	0.9692		0.995	False		,,,				2504	0.9969				p.S58A		.											.	NOL9-515	0			c.T172G						.	C	ALA/SER	2196,260		975,246,7	2.0	3.0	3.0		172	3.0	0.2	1	dbSNP_116	3	4875,25		2425,25,0	no	missense	NOL9	NM_024654.4	99	3400,271,7	CC,CA,AA		0.5102,10.5863,3.8744	benign	58/703	6614391	7071,285	1228	2450	3678	SO:0001583	missense	79707	exon1			CGCCGGACGCCTG	AK091284	CCDS80.1	1p36.31	2012-05-02			ENSG00000162408	ENSG00000162408			26265	protein-coding gene	gene with protein product	"""polynucleotide 5'-kinase"""					21063389	Standard	NM_024654		Approved	FLJ23323, NET6, Grc3	uc001ans.3	Q5SY16	OTTHUMG00000000904	ENST00000377705.5:c.172T>G	1.37:g.6614391A>C	ENSP00000366934:p.Ser58Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_024654	0	0	0	0	0	Q2NL84|Q4VBY3|Q6P472|Q7L4D6|Q96EE0|Q9H5L4	Missense_Mutation	SNP	ENST00000377705.5	37	CCDS80.1	2092	0.9578754578754579	421	0.8556910569105691	355	0.9806629834254144	562	0.9825174825174825	754	0.9947229551451188	C	0.416	-0.910621	0.02434	0.894137	0.994898	ENSG00000162408	ENST00000377705	T	0.15718	2.4	4.0	3.05	0.35203	.	0.361559	0.20066	N	0.099972	T	0.00012	0.0000	N	0.01576	-0.805	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.37798	-0.9690	9	0.02654	T	1	-12.1681	8.8998	0.35487	0.424:0.576:0.0:0.0	rs6693391;rs56691058	58	Q5SY16	NOL9_HUMAN	A	58	ENSP00000366934:S58A	ENSP00000366934:S58A	S	-	1	0	NOL9	6536978	0.795000	0.28851	0.220000	0.23810	0.044000	0.14063	0.592000	0.23984	0.422000	0.26005	-0.285000	0.09966	TCC	A|0.047;C|0.953		0.781	NOL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002625.1	NM_024654	
TNFRSF1B	7133	broad.mit.edu	37	1	12262126	12262126	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr1:12262126G>T	ENST00000376259.3	+	9	1092	c.1003G>T	c.(1003-1005)Gcc>Tcc	p.A335S	TNFRSF1B_ENST00000492361.1_3'UTR	NM_001066.2	NP_001057.1	P20333	TNR1B_HUMAN	tumor necrosis factor receptor superfamily, member 1B	335					aging (GO:0007568)|cellular response to growth factor stimulus (GO:0071363)|cellular response to lipopolysaccharide (GO:0071222)|extrinsic apoptotic signaling pathway (GO:0097191)|immune response (GO:0006955)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of inflammatory response (GO:0050728)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|RNA destabilization (GO:0050779)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|varicosity (GO:0043196)	tumor necrosis factor-activated receptor activity (GO:0005031)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|liver(1)|lung(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10	Ovarian(185;0.249)	Lung NSC(185;8.72e-05)|all_lung(284;9.92e-05)|Renal(390;0.000147)|Colorectal(325;0.000584)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|Colorectal(212;5.52e-07)|COAD - Colon adenocarcinoma(227;0.000345)|BRCA - Breast invasive adenocarcinoma(304;0.000353)|Kidney(185;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00302)|STAD - Stomach adenocarcinoma(313;0.00815)|READ - Rectum adenocarcinoma(331;0.0284)	Etanercept(DB00005)	GGAGAGCTCGGCCAGTGCGTT	0.706																																					p.A335S		.											.	TNFRSF1B-1085	0			c.G1003T						.						11.0	14.0	13.0					1																	12262126		2194	4288	6482	SO:0001583	missense	7133	exon9			AGCTCGGCCAGTG	M32315	CCDS145.1	1p36.22	2008-02-05			ENSG00000028137	ENSG00000028137		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11917	protein-coding gene	gene with protein product		191191		TNFR2		2158863, 8702885	Standard	NM_001066		Approved	TNFBR, TNFR80, TNF-R75, TNF-R-II, p75, CD120b	uc001att.3	P20333	OTTHUMG00000001829	ENST00000376259.3:c.1003G>T	1.37:g.12262126G>T	ENSP00000365435:p.Ala335Ser	Somatic	46	1		WXS	Illumina GAIIx	Phase_I	62	5	NM_001066	0	0	7	8	1	B1AJZ3|Q16042|Q6YI29|Q9UIH1	Missense_Mutation	SNP	ENST00000376259.3	37	CCDS145.1	.	.	.	.	.	.	.	.	.	.	G	14.08	2.428595	0.43122	.	.	ENSG00000028137	ENST00000376259	D	0.87029	-2.2	4.76	2.74	0.32292	.	2.391520	0.01257	N	0.009056	D	0.85839	0.5790	M	0.67953	2.075	0.09310	N	0.999997	P	0.42908	0.793	B	0.38842	0.283	T	0.70718	-0.4795	10	0.32370	T	0.25	-19.0182	7.1672	0.25698	0.1003:0.1731:0.7265:0.0	.	335	P20333	TNR1B_HUMAN	S	335	ENSP00000365435:A335S	ENSP00000365435:A335S	A	+	1	0	TNFRSF1B	12184713	0.448000	0.25681	0.930000	0.37139	0.708000	0.40852	1.783000	0.38664	1.123000	0.41961	0.561000	0.74099	GCC	.		0.706	TNFRSF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005133.1	NM_001066	
OPRD1	4985	hgsc.bcm.edu	37	1	29138975	29138975	+	Missense_Mutation	SNP	G	G	T	rs1042114	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr1:29138975G>T	ENST00000234961.2	+	1	322	c.80G>T	c.(79-81)tGc>tTc	p.C27F		NM_000911.3	NP_000902.3	P41143	OPRD_HUMAN	opioid receptor, delta 1	27			C -> F (improved maturation and increased expression at the cell surface; dbSNP:rs1042114). {ECO:0000269|PubMed:10982041, ECO:0000269|PubMed:8201839, ECO:0000269|Ref.4}.		adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adult locomotory behavior (GO:0008344)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|cellular response to toxic substance (GO:0097237)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|immune response (GO:0006955)|negative regulation of gene expression (GO:0010629)|negative regulation of protein oligomerization (GO:0032460)|neuropeptide signaling pathway (GO:0007218)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein import into nucleus, translocation (GO:0000060)|regulation of calcium ion transport (GO:0051924)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of sensory perception of pain (GO:0051930)	axon terminus (GO:0043679)|cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	enkephalin receptor activity (GO:0038046)|opioid receptor activity (GO:0004985)			breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15		Colorectal(325;3.46e-05)|Lung NSC(340;0.000947)|all_lung(284;0.00131)|Renal(390;0.00758)|Breast(348;0.00765)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;1.29e-07)|COAD - Colon adenocarcinoma(152;7.51e-06)|STAD - Stomach adenocarcinoma(196;0.00306)|BRCA - Breast invasive adenocarcinoma(304;0.0241)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)	Alvimopan(DB06274)|Amitriptyline(DB00321)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diphenoxylate(DB01081)|Fentanyl(DB00813)|Heroin(DB01452)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levorphanol(DB00854)|Loperamide(DB00836)|Methadone(DB00333)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	CCTAGCGCCTGCCCCAGCGCT	0.771													T|||	4730	0.944489	0.9796	0.9193	5008	,	,		9147	1.0		0.8678	False		,,,				2504	0.9366				p.C27F		.											.	OPRD1-69	0			c.G80T						.	T	PHE/CYS	3689,115		1788,113,1	4.0	6.0	5.0	http://www.ncbi.nlm.nih.gov/omim/103780,165195|http://omim.org/entry/165195|http://omim.org/entry/103780	80	2.9	1.0	1	dbSNP_86	5	6762,846		2982,798,24	no	missense	OPRD1	NM_000911.3	205	4770,911,25	TT,TG,GG		11.1199,3.0231,8.421	benign	27/373	29138975	10451,961	1902	3804	5706	SO:0001583	missense	4985	exon1			GCGCCTGCCCCAG	U10504	CCDS329.1	1p36.1-p34.3	2012-08-08			ENSG00000116329	ENSG00000116329		"""GPCR / Class A : Opioid receptors"""	8153	protein-coding gene	gene with protein product		165195				8415697	Standard	NM_000911		Approved		uc001brf.1	P41143	OTTHUMG00000003646	ENST00000234961.2:c.80G>T	1.37:g.29138975G>T	ENSP00000234961:p.Cys27Phe	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_000911	0	0	0	0	0	B5B0B8	Missense_Mutation	SNP	ENST00000234961.2	37	CCDS329.1	2035	0.9317765567765568	474	0.9634146341463414	331	0.914364640883978	572	1.0	658	0.8680738786279684	T	0.016	-1.513433	0.00975	0.969769	0.888801	ENSG00000116329	ENST00000234961;ENST00000536280	T	0.67698	-0.28	4.0	2.89	0.33648	.	1.802200	0.02327	N	0.073605	T	0.00012	0.0000	N	0.01874	-0.695	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.41342	-0.9514	9	0.09338	T	0.73	.	3.8109	0.08796	0.0:0.1144:0.2238:0.6618	rs1042114;rs59349662;rs1042114	27	P41143	OPRD_HUMAN	F	27	ENSP00000234961:C27F	ENSP00000234961:C27F	C	+	2	0	OPRD1	29011562	0.002000	0.14202	0.992000	0.48379	0.116000	0.19942	0.521000	0.22893	0.713000	0.32060	-0.694000	0.03704	TGC	G|0.061;T|0.939		0.771	OPRD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010330.1	NM_000911	
TCTEX1D4	343521	hgsc.bcm.edu	37	1	45271828	45271828	+	Silent	SNP	T	T	C	rs17885815	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr1:45271828T>C	ENST00000339355.2	-	1	519	c.513A>G	c.(511-513)gtA>gtG	p.V171V	BTBD19_ENST00000450269.1_5'Flank|BTBD19_ENST00000409335.2_5'Flank|TCTEX1D4_ENST00000372200.1_Silent_p.V171V|BTBD19_ENST00000453418.1_5'Flank			Q5JR98	TC1D4_HUMAN	Tctex1 domain containing 4	171						acrosomal vesicle (GO:0001669)|axoneme (GO:0005930)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)	protein phosphatase 1 binding (GO:0008157)			pancreas(1)	1	Acute lymphoblastic leukemia(166;0.155)					CCACACTGCATACCAGCTTGT	0.716													C|||	682	0.136182	0.0764	0.1427	5008	,	,		11465	0.1647		0.1759	False		,,,				2504	0.1421				p.V171V		.											.	TCTEX1D4-91	0			c.A513G						.	C		415,3851		26,363,1744	6.0	9.0	8.0		513	5.5	1.0	1	dbSNP_124	8	1263,7055		105,1053,3001	no	coding-synonymous	TCTEX1D4	NM_001013632.2		131,1416,4745	CC,CT,TT		15.1839,9.7281,13.3344		171/222	45271828	1678,10906	2133	4159	6292	SO:0001819	synonymous_variant	343521	exon2			ACTGCATACCAGC	BC092499	CCDS30699.1	1p34.1	2007-12-17				ENSG00000188396			32315	protein-coding gene	gene with protein product	"""novel Tctex-1 family domain-containing protein"""	611713				12477932	Standard	XM_006710614		Approved		uc001cmp.3	Q5JR98		ENST00000339355.2:c.513A>G	1.37:g.45271828T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	5	NM_001013632	0	0	0	0	0		Silent	SNP	ENST00000339355.2	37	CCDS30699.1																																																																																			T|0.859;C|0.141		0.716	TCTEX1D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023733.1	NM_001013632	
FOXD3	27022	hgsc.bcm.edu	37	1	63788951	63788951	+	Silent	SNP	C	C	A	rs2274187	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr1:63788951C>A	ENST00000371116.2	+	1	222	c.222C>A	c.(220-222)ccC>ccA	p.P74P	RP4-792G4.2_ENST00000449386.1_RNA|RP4-792G4.2_ENST00000418244.1_RNA|RP4-792G4.2_ENST00000426393.1_RNA|RP4-792G4.2_ENST00000427268.1_RNA|RP4-792G4.2_ENST00000431294.1_RNA	NM_012183.2	NP_036315.1	Q9UJU5	FOXD3_HUMAN	forkhead box D3	74					embryonic placenta development (GO:0001892)|in utero embryonic development (GO:0001701)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|trophectodermal cell differentiation (GO:0001829)	nuclear chromatin (GO:0000790)	double-stranded DNA binding (GO:0003690)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|lung(2)|upper_aerodigestive_tract(1)	5						CTCAGCCGCCCCACCAGCAGC	0.781													c|||	590	0.117812	0.0136	0.1873	5008	,	,		7772	0.1617		0.1829	False		,,,				2504	0.0971				p.P74P	Pancreas(68;276 1750 11966 31252)	.											.	FOXD3-226	0			c.C222A						.						3.0	5.0	4.0					1																	63788951		1601	3141	4742	SO:0001819	synonymous_variant	27022	exon1			GCCGCCCCACCAG	AF197560	CCDS624.1	1p31.3	2008-04-10			ENSG00000187140	ENSG00000187140		"""Forkhead boxes"""	3804	protein-coding gene	gene with protein product		611539				8499623	Standard	NM_012183		Approved	Genesis, HFH2	uc001dax.2	Q9UJU5	OTTHUMG00000009141	ENST00000371116.2:c.222C>A	1.37:g.63788951C>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_012183	0	0	0	0	0	Q9BYM2|Q9UDD1	Silent	SNP	ENST00000371116.2	37	CCDS624.1																																																																																			C|0.842;A|0.158		0.781	FOXD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025331.1		
WDR78	79819	hgsc.bcm.edu	37	1	67370954	67370954	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr1:67370954G>T	ENST00000371026.3	-	2	330	c.275C>A	c.(274-276)tCc>tAc	p.S92Y	WDR78_ENST00000431318.1_5'UTR|WDR78_ENST00000488333.1_Missense_Mutation_p.S20Y|WDR78_ENST00000371023.3_Missense_Mutation_p.S92Y|WDR78_ENST00000371022.3_Missense_Mutation_p.S92Y	NM_024763.4	NP_079039.4	Q5VTH9	WDR78_HUMAN	WD repeat domain 78	92					hematopoietic progenitor cell differentiation (GO:0002244)					NS(1)|endometrium(3)|kidney(6)|large_intestine(6)|lung(10)|ovary(3)|skin(3)	32						CACGGTTTTGGACACAGCCAT	0.358																																					p.S92Y		.											.	WDR78-92	0			c.C275A						.						175.0	169.0	171.0					1																	67370954		2203	4300	6503	SO:0001583	missense	79819	exon2			GTTTTGGACACAG	BX648840	CCDS635.1, CCDS44157.1	1p31.2	2014-02-21	2013-02-19	2013-02-19	ENSG00000152763	ENSG00000152763		"""WD repeat domain containing"""	26252	protein-coding gene	gene with protein product						21953912	Standard	NM_207014		Approved	DIC4, FLJ23129	uc001dcx.3	Q5VTH9	OTTHUMG00000009165	ENST00000371026.3:c.275C>A	1.37:g.67370954G>T	ENSP00000360065:p.Ser92Tyr	Somatic	128	0		WXS	Illumina GAIIx	Phase_I	59	4	NM_207014	0	0	1	1	0	A8K9W5|B5MDT3|H7BY80|Q5VTI0|Q8N5G5|Q9H5R9|Q9UF44	Missense_Mutation	SNP	ENST00000371026.3	37	CCDS635.1	.	.	.	.	.	.	.	.	.	.	G	16.14	3.039864	0.55003	.	.	ENSG00000152763	ENST00000371026;ENST00000371023;ENST00000371022;ENST00000488333	T;T;T	0.60299	0.2;1.92;1.16	3.99	3.99	0.46301	.	0.675716	0.13988	N	0.349035	T	0.66228	0.2768	M	0.63428	1.95	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.972;0.972	T	0.67581	-0.5634	10	0.87932	D	0	-19.7258	11.9076	0.52721	0.0:0.0:1.0:0.0	.	92;92;92	Q5TAD8;A0AVI9;Q5VTH9	.;.;WDR78_HUMAN	Y	92;92;92;20	ENSP00000360065:S92Y;ENSP00000360062:S92Y;ENSP00000360061:S92Y	ENSP00000360061:S92Y	S	-	2	0	WDR78	67143542	0.959000	0.32827	0.557000	0.28306	0.022000	0.10575	3.620000	0.54203	2.508000	0.84585	0.555000	0.69702	TCC	.		0.358	WDR78-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025404.1	NM_024763	
SRSF11	9295	broad.mit.edu;bcgsc.ca	37	1	70716183	70716183	+	Silent	SNP	A	A	C	rs41287904	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr1:70716183A>C	ENST00000370950.3	+	12	1336	c.1254A>C	c.(1252-1254)gtA>gtC	p.V418V	SRSF11_ENST00000405432.1_Silent_p.V418V|SRSF11_ENST00000370949.1_Silent_p.V358V|SRSF11_ENST00000484162.1_3'UTR|SRSF11_ENST00000370951.1_Silent_p.V418V			Q05519	SRS11_HUMAN	serine/arginine-rich splicing factor 11	418					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			large_intestine(3)|ovary(2)|skin(1)	6						ATAAAGATGTAAAAGTATGTT	0.308													A|||	3	0.000599042	0.0	0.0	5008	,	,		18884	0.0		0.003	False		,,,				2504	0.0				p.V418V		.											.	SRSF11-227	0			c.A1254C						.	A	,	6,4400	6.2+/-15.9	0,6,2197	88.0	96.0	94.0		1254,1254	-5.6	1.0	1	dbSNP_127	94	45,8551	26.8+/-75.7	0,45,4253	no	coding-synonymous,coding-synonymous	SRSF11	NM_001190987.1,NM_004768.3	,	0,51,6450	CC,CA,AA		0.5235,0.1362,0.3922	,	418/484,418/485	70716183	51,12951	2203	4298	6501	SO:0001819	synonymous_variant	9295	exon12			AGATGTAAAAGTA	M74002	CCDS647.1, CCDS53332.1	1p31.1	2013-02-12	2010-06-22	2010-06-22	ENSG00000116754	ENSG00000116754		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10782	protein-coding gene	gene with protein product	"""SR splicing factor 11"""	602010	"""splicing factor, arginine/serine-rich 11"""	SFRS11		1896467, 20516191	Standard	NM_004768		Approved	p54, NET2	uc001des.3	Q05519	OTTHUMG00000009342	ENST00000370950.3:c.1254A>C	1.37:g.70716183A>C		Somatic	113	0		WXS	Illumina GAIIx	Phase_I	60	5	NM_004768	0	0	0	0	0	Q5T758|Q8IWE6	Silent	SNP	ENST00000370950.3	37	CCDS647.1																																																																																			A|0.997;C|0.003		0.308	SRSF11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000025889.1	NM_004768	
NR5A2	2494	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	200008804	200008804	+	Missense_Mutation	SNP	G	G	C	rs377663705		TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr1:200008804G>C	ENST00000367362.3	+	2	329	c.83G>C	c.(82-84)cGa>cCa	p.R28P	NR5A2_ENST00000544748.1_5'Flank|NR5A2_ENST00000236914.3_Intron	NM_001276464.1|NM_205860.1	NP_001263393.1|NP_995582.1	O00482	NR5A2_HUMAN	nuclear receptor subfamily 5, group A, member 2	28					bile acid metabolic process (GO:0008206)|cholesterol homeostasis (GO:0042632)|embryo development (GO:0009790)|endocrine pancreas development (GO:0031018)|gene expression (GO:0010467)|homeostatic process (GO:0042592)|intracellular receptor signaling pathway (GO:0030522)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral genome replication (GO:0045070)|regulation of cell proliferation (GO:0042127)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|phospholipid binding (GO:0005543)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(15)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	31	Prostate(682;0.19)					CTTCCGGACCGACACGGATCC	0.657																																					p.C28S	Melanoma(179;1138 2773 15678 26136)	.											.	NR5A2-227	0			c.G83C						.						52.0	60.0	57.0					1																	200008804		2203	4300	6503	SO:0001583	missense	2494	exon2			CGGACCGACACGG	U93553	CCDS1400.1, CCDS1401.1, CCDS60383.1	1q32.11	2013-01-16			ENSG00000116833	ENSG00000116833		"""Nuclear hormone receptors"""	7984	protein-coding gene	gene with protein product	"""liver receptor homolog-1"""	604453		FTF		9858833, 7680097	Standard	NM_205860		Approved	FTZ-F1beta, hB1F, LRH-1, FTZ-F1, hB1F-2, B1F2	uc001gvb.4	O00482	OTTHUMG00000035635	ENST00000367362.3:c.83G>C	1.37:g.200008804G>C	ENSP00000356331:p.Arg28Pro	Somatic	115	0		WXS	Illumina GAIIx	Phase_I	178	19	NM_205860	0	0	0	0	0	B4E2P3|O95642|Q147U3	Missense_Mutation	SNP	ENST00000367362.3	37	CCDS1401.1	.	.	.	.	.	.	.	.	.	.	G	11.09	1.537066	0.27475	.	.	ENSG00000116833	ENST00000367362;ENST00000542116	D	0.93811	-3.29	5.02	4.09	0.47781	.	0.569224	0.14329	N	0.326478	D	0.85965	0.5820	N	0.14661	0.345	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.77943	-0.2398	9	.	.	.	.	12.8692	0.57955	0.0:0.1635:0.8365:0.0	.	28	O00482	NR5A2_HUMAN	P	28;52	ENSP00000356331:R28P	.	R	+	2	0	NR5A2	198275427	0.989000	0.36119	0.387000	0.26183	0.120000	0.20174	1.970000	0.40520	1.062000	0.40625	-0.182000	0.12963	CGA	.		0.657	NR5A2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086497.2		
C1orf106	55765	hgsc.bcm.edu	37	1	200880978	200880978	+	Missense_Mutation	SNP	C	C	T	rs296520	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr1:200880978C>T	ENST00000367342.4	+	9	1812	c.1612C>T	c.(1612-1614)Cgc>Tgc	p.R538C	C1orf106_ENST00000413687.2_Missense_Mutation_p.R453C	NM_018265.3	NP_060735.3	Q3KP66	CA106_HUMAN	chromosome 1 open reading frame 106	538			R -> C (in dbSNP:rs296520). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.							endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(2)	21						GTGGGAGCTGCGCCGCGCAGC	0.736													T|||	3966	0.791933	0.6089	0.8213	5008	,	,		12017	0.997		0.7256	False		,,,				2504	0.8753				p.R552C		.											.	C1orf106-93	0			c.C1654T						.	T	CYS/ARG,CYS/ARG	2547,1503		890,767,368	5.0	7.0	6.0		1357,1612	0.8	0.0	1	dbSNP_79	6	5587,2355		2124,1339,508	no	missense,missense	C1orf106	NM_001142569.2,NM_018265.3	180,180	3014,2106,876	TT,TC,CC		29.6525,37.1111,32.1714	benign,benign	453/579,538/664	200880978	8134,3858	2025	3971	5996	SO:0001583	missense	55765	exon9			GAGCTGCGCCGCG	AK001763	CCDS44292.1	1q32.1	2011-02-15			ENSG00000163362	ENSG00000163362			25599	protein-coding gene	gene with protein product						14702039	Standard	NM_018265		Approved	FLJ10901	uc001gvo.4	Q3KP66	OTTHUMG00000035789	ENST00000367342.4:c.1612C>T	1.37:g.200880978C>T	ENSP00000356311:p.Arg538Cys	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	36	18	NM_018265	0	0	0	0	0	B4E1K9|E9PFY0|Q9NV65|Q9NVI0	Missense_Mutation	SNP	ENST00000367342.4	37		1677	0.7678571428571429	261	0.5304878048780488	285	0.787292817679558	569	0.9947552447552448	562	0.741424802110818	T	0.366	-0.936884	0.02340	0.628889	0.703475	ENSG00000163362	ENST00000367342;ENST00000413687	T;T	0.28454	1.61;1.61	3.39	0.759	0.18438	.	0.912041	0.09365	N	0.812206	T	0.00012	0.0000	N	0.01576	-0.805	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.16188	-1.0411	9	0.29301	T	0.29	-23.0614	3.796	0.08740	0.0:0.2241:0.1856:0.5903	rs296520;rs7519373;rs56757010	538	Q3KP66	CA106_HUMAN	C	538;453	ENSP00000356311:R538C;ENSP00000392105:R453C	ENSP00000356311:R538C	R	+	1	0	C1orf106	199147601	0.004000	0.15560	0.002000	0.10522	0.007000	0.05969	-0.731000	0.04909	-0.124000	0.11724	-0.381000	0.06696	CGC	C|0.242;T|0.758		0.736	C1orf106-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000087057.2	NM_018265	
RHOU	58480	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	228879456	228879456	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr1:228879456C>A	ENST00000366691.3	+	3	1412	c.746C>A	c.(745-747)tCc>tAc	p.S249Y		NM_021205.5	NP_067028.1			ras homolog family member U											breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)|stomach(1)	13	Breast(184;0.162)	Prostate(94;0.183)				CTCTCCAAGTCCTGGTGGAAG	0.433																																					p.S249Y		.											.	RHOU-659	0			c.C746A						.						65.0	71.0	69.0					1																	228879456		2203	4300	6503	SO:0001583	missense	58480	exon3			CCAAGTCCTGGTG		CCDS1575.1	1q42.11-q42.3	2012-02-27	2012-02-27	2004-03-24	ENSG00000116574	ENSG00000116574			17794	protein-coding gene	gene with protein product	"""Ryu GTPase"", ""Wnt-1 responsive Cdc42 homolog"", ""2310026M05Rik"", ""GTP-binding protein like 1"", ""CDC42-like GTPase"", ""GTP-binding protein SB128"", ""ras-like gene family member U"""	606366	"""ras homolog gene family, member U"""	ARHU		11459829	Standard	NM_021205		Approved	WRCH-1, DJ646B12.2, FLJ10616, WRCH1, CDC42L1, hG28K, fJ646B12.2	uc001htf.3	Q7L0Q8	OTTHUMG00000037919	ENST00000366691.3:c.746C>A	1.37:g.228879456C>A	ENSP00000355652:p.Ser249Tyr	Somatic	181	0		WXS	Illumina GAIIx	Phase_I	192	81	NM_021205	0	0	22	46	24		Missense_Mutation	SNP	ENST00000366691.3	37	CCDS1575.1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.599361	0.87055	.	.	ENSG00000116574	ENST00000366691	T	0.68765	-0.35	4.95	4.95	0.65309	.	0.110299	0.64402	D	0.000005	T	0.69593	0.3128	L	0.43152	1.355	0.58432	D	0.999994	P	0.51057	0.941	P	0.52159	0.691	T	0.73461	-0.3975	10	0.87932	D	0	.	15.6948	0.77488	0.0:1.0:0.0:0.0	.	249	Q7L0Q8	RHOU_HUMAN	Y	249	ENSP00000355652:S249Y	ENSP00000355652:S249Y	S	+	2	0	RHOU	226946079	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.589000	0.82641	2.557000	0.86248	0.655000	0.94253	TCC	.		0.433	RHOU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092555.1	NM_021205	
IRF2BP2	359948	hgsc.bcm.edu	37	1	234745009	234745009	+	Missense_Mutation	SNP	A	A	G	rs7545855	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr1:234745009A>G	ENST00000366609.3	-	1	262	c.232T>C	c.(232-234)Tcg>Ccg	p.S78P	IRF2BP2_ENST00000491430.1_5'Flank|IRF2BP2_ENST00000366610.3_Missense_Mutation_p.S78P|RP4-781K5.2_ENST00000436039.1_RNA	NM_182972.2	NP_892017.2	Q7Z5L9	I2BP2_HUMAN	interferon regulatory factor 2 binding protein 2	78					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	11	Ovarian(103;0.0303)	all_cancers(173;0.0236)|Prostate(94;0.0115)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)|Epithelial(3;6.2e-05)			GCGGCGGCCGAGGCCGCGGCG	0.776													G|||	3024	0.603834	0.8729	0.549	5008	,	,		4430	0.2679		0.7734	False		,,,				2504	0.4509				p.S78P		.											.	IRF2BP2-90	0			c.T232C						.						1.0	1.0	1.0					1																	234745009		821	1921	2742	SO:0001583	missense	359948	exon1			CGGCCGAGGCCGC	AY278023	CCDS1602.1, CCDS41475.1	1q42.3	2008-02-05			ENSG00000168264	ENSG00000168264			21729	protein-coding gene	gene with protein product		615332				12799427	Standard	NM_182972		Approved	IRF-2BP2	uc001hwg.3	Q7Z5L9	OTTHUMG00000037981	ENST00000366609.3:c.232T>C	1.37:g.234745009A>G	ENSP00000355568:p.Ser78Pro	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	10	NM_182972	0	0	0	0	0	B1AM35|B1AM36|Q6P083|Q7Z5L8|Q8N351|Q8WUH8	Missense_Mutation	SNP	ENST00000366609.3	37	CCDS1602.1	1348	0.6172161172161172	403	0.8191056910569106	204	0.56353591160221	177	0.3094405594405594	564	0.7440633245382586	G	0.003	-2.470482	0.00167	.	.	ENSG00000168264	ENST00000366610;ENST00000366609	T;T	0.31510	1.49;1.51	2.56	0.223	0.15292	.	0.798061	0.10979	N	0.612909	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.31110	-0.9955	9	0.07813	T	0.8	.	4.7903	0.13245	0.3855:0.1782:0.4362:0.0	rs7545855	78;78	Q7Z5L9;Q7Z5L9-2	I2BP2_HUMAN;.	P	78	ENSP00000355569:S78P;ENSP00000355568:S78P	ENSP00000355568:S78P	S	-	1	0	IRF2BP2	232811632	0.056000	0.20664	0.000000	0.03702	0.004000	0.04260	0.684000	0.25364	-0.115000	0.11915	-0.817000	0.03123	TCG	A|0.383;G|0.617		0.776	IRF2BP2-002	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000092705.1	NM_182972	
C10orf113	387638	hgsc.bcm.edu	37	10	21435342	21435342	+	Missense_Mutation	SNP	A	A	T	rs200339723|rs45546236|rs72102767	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr10:21435342A>T	ENST00000534331.1	-	1	146	c.96T>A	c.(94-96)agT>agA	p.S32R	C10orf113_ENST00000529198.1_Missense_Mutation_p.S32R|C10orf113_ENST00000377118.4_Missense_Mutation_p.S22R|NEBL_ENST00000417816.2_Intron	NM_001010896.2	NP_001010896.2	Q5VZT2	CJ113_HUMAN	chromosome 10 open reading frame 113	32										endometrium(1)|large_intestine(1)|lung(1)|ovary(3)|pancreas(1)	7						AAGCACAAACACTCTCTCTCA	0.393																																					p.S32R		.											.	C10orf113-93	0			c.T96A						.						132.0	124.0	127.0					10																	21435342		2166	4241	6407	SO:0001583	missense	387638	exon1			ACAAACACTCTCT		CCDS31162.1, CCDS31162.2, CCDS53496.1	10p12.31	2012-06-12			ENSG00000204683	ENSG00000204683			31447	protein-coding gene	gene with protein product							Standard	NM_001010896		Approved	bA165O3.1	uc001iqm.3	Q5VZT2	OTTHUMG00000017786	ENST00000534331.1:c.96T>A	10.37:g.21435342A>T	ENSP00000433646:p.Ser32Arg	Somatic	128	0		WXS	Illumina GAIIx	Phase_I	115	5	NM_001177483	0	0	0	0	0	B9EIM9|E9PRX7	Missense_Mutation	SNP	ENST00000534331.1	37	CCDS31162.2	.	.	.	.	.	.	.	.	.	.	A	8.577	0.881499	0.17467	.	.	ENSG00000204683	ENST00000534331;ENST00000529198;ENST00000377118	T;T	0.38240	1.15;1.15	2.84	1.66	0.24008	.	.	.	.	.	T	0.17959	0.0431	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.10450	0.005	T	0.21381	-1.0247	9	0.87932	D	0	0.0029	4.9873	0.14196	0.7329:0.0:0.0:0.2671	.	32	Q5VZT2	CJ113_HUMAN	R	32;32;22	ENSP00000433646:S32R;ENSP00000366322:S22R	ENSP00000366322:S22R	S	-	3	2	C10orf113	21475348	0.023000	0.18921	0.002000	0.10522	0.010000	0.07245	1.150000	0.31639	0.221000	0.20879	0.533000	0.62120	AGT	.		0.393	C10orf113-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047108.3	NM_001010896	
ARMC4	55130	ucsc.edu	37	10	28250635	28250635	+	Silent	SNP	A	A	C	rs202113129	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr10:28250635A>C	ENST00000305242.5	-	10	1340	c.1248T>G	c.(1246-1248)gcT>gcG	p.A416A	ARMC4_ENST00000537576.1_Silent_p.A108A|ARMC4_ENST00000480504.1_5'UTR|ARMC4_ENST00000239715.3_Silent_p.A273A|ARMC4_ENST00000545014.1_5'UTR	NM_018076.2	NP_060546.2	Q5T2S8	ARMC4_HUMAN	armadillo repeat containing 4	416					cell projection organization (GO:0030030)|cilium movement (GO:0003341)|left/right axis specification (GO:0070986)|outer dynein arm assembly (GO:0036158)|ventricular system development (GO:0021591)	axoneme (GO:0005930)|ciliary base (GO:0097546)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)				NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(17)|liver(1)|lung(17)|ovary(5)|prostate(3)|skin(8)|stomach(2)|urinary_tract(3)	75						CAATCTTTTCAGCACTCTTCC	0.453																																					p.A416A		.											.	ARMC4-96	0			c.T1248G						.						65.0	58.0	61.0					10																	28250635		2203	4297	6500	SO:0001819	synonymous_variant	55130	exon10			CTTTTCAGCACTC	AL136859	CCDS7157.1	10p12.1-p11.23	2014-02-03			ENSG00000169126	ENSG00000169126		"""Armadillo repeat containing"""	25583	protein-coding gene	gene with protein product		615408				11230166	Standard	XM_005252485		Approved	FLJ10817, FLJ10376, DKFZP434P1735, CILD23	uc001itz.3	Q5T2S8	OTTHUMG00000017867	ENST00000305242.5:c.1248T>G	10.37:g.28250635A>C		Somatic	49	2		WXS	Illumina GAIIx	Phase_I	79	10	NM_018076	0	0	0	0	0	A8K906|B7Z7I1|Q9H0C0	Silent	SNP	ENST00000305242.5	37	CCDS7157.1																																																																																			.		0.453	ARMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047339.1	NM_018076	
GPRIN2	9721	hgsc.bcm.edu	37	10	47000217	47000217	+	Missense_Mutation	SNP	G	G	A	rs72780221	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr10:47000217G>A	ENST00000374317.1	+	3	1610	c.1337G>A	c.(1336-1338)cGc>cAc	p.R446H	GPRIN2_ENST00000374314.4_Missense_Mutation_p.R446H	NM_014696.3	NP_055511.2	O60269	GRIN2_HUMAN	G protein regulated inducer of neurite outgrowth 2	446								p.R446H(1)		breast(2)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)	18						TCCCTGCGGCGCCCCAGCTGC	0.716																																					p.R446H		.											.	GPRIN2-90	1	Substitution - Missense(1)	prostate(1)	c.G1337A						.						8.0	9.0	9.0					10																	47000217		2121	4098	6219	SO:0001583	missense	9721	exon3			TGCGGCGCCCCAG	BC011672	CCDS73101.1	10q11.22	2006-08-24	2006-08-24	2006-08-24	ENSG00000204175	ENSG00000204175			23730	protein-coding gene	gene with protein product		611240	"""KIAA0514"""	KIAA0514		9628581	Standard	NM_014696		Approved	MGC15171	uc001jec.3	O60269	OTTHUMG00000018107	ENST00000374317.1:c.1337G>A	10.37:g.47000217G>A	ENSP00000363436:p.Arg446His	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	22	11	NM_014696	0	0	0	0	0	Q5SVF0	Missense_Mutation	SNP	ENST00000374317.1	37	CCDS31192.1	220	0.10073260073260074	86	0.17479674796747968	30	0.08287292817679558	25	0.043706293706293704	79	0.10422163588390501	G	13.52	2.261176	0.39995	.	.	ENSG00000204175	ENST00000374317;ENST00000374314	T;T	0.26223	1.75;1.75	5.11	3.2	0.36748	.	0.744361	0.10758	N	0.637492	T	0.00073	0.0002	L	0.49350	1.555	0.09310	N	1	B	0.24533	0.105	B	0.17433	0.018	T	0.22243	-1.0222	10	0.34782	T	0.22	-0.7153	5.5226	0.16941	0.1777:0.1655:0.6568:0.0	.	446	O60269	GRIN2_HUMAN	H	446	ENSP00000363436:R446H;ENSP00000363433:R446H	ENSP00000363433:R446H	R	+	2	0	GPRIN2	46420223	0.000000	0.05858	0.420000	0.26596	0.986000	0.74619	0.143000	0.16115	0.639000	0.30564	0.561000	0.74099	CGC	G|0.901;A|0.099		0.716	GPRIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047836.1	NM_014696	
TAF5	6877	hgsc.bcm.edu	37	10	105128134	105128134	+	Missense_Mutation	SNP	T	T	G	rs10883859	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr10:105128134T>G	ENST00000369839.3	+	1	411	c.388T>G	c.(388-390)Tcc>Gcc	p.S130A	TAF5_ENST00000351396.4_Missense_Mutation_p.S130A	NM_006951.3	NP_008882.2	Q15542	TAF5_HUMAN	TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 100kDa	130			S -> A (in dbSNP:rs10883859). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:8758937, ECO:0000269|PubMed:9045704, ECO:0000269|Ref.5}.		chromatin modification (GO:0016568)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	protein dimerization activity (GO:0046983)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)	15		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;1.83e-09)|all cancers(201;1.4e-08)|BRCA - Breast invasive adenocarcinoma(275;0.198)		AGTGGCGGGCTCCGGAGCCCC	0.741													T|||	1553	0.310104	0.1952	0.4078	5008	,	,		9029	0.4206		0.329	False		,,,				2504	0.2628				p.S130A		.											.	TAF5-92	0			c.T388G						.	T	ALA/SER	635,2955		63,509,1223	3.0	5.0	4.0		388	1.9	1.0	10	dbSNP_120	4	2122,5176		327,1468,1854	no	missense	TAF5	NM_006951.3	99	390,1977,3077	GG,GT,TT		29.0765,17.688,25.3215	benign	130/801	105128134	2757,8131	1795	3649	5444	SO:0001583	missense	6877	exon1			GCGGGCTCCGGAG	X95525	CCDS7547.1	10q24-q25.2	2013-01-10	2002-08-29	2001-12-07	ENSG00000148835	ENSG00000148835		"""WD repeat domain containing"""	11539	protein-coding gene	gene with protein product		601787	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, D, 100kD"""	TAF2D		8884287, 8942982	Standard	NM_006951		Approved	TAFII100	uc001kwv.3	Q15542	OTTHUMG00000018985	ENST00000369839.3:c.388T>G	10.37:g.105128134T>G	ENSP00000358854:p.Ser130Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	5	NM_006951	0	0	0	0	0	A8K5B4|B2RMR0|B7ZKJ6|Q53EM4|Q5SYD5|Q86UZ7|Q9Y4K5	Missense_Mutation	SNP	ENST00000369839.3	37	CCDS7547.1	821	0.3759157509157509	127	0.258130081300813	150	0.4143646408839779	277	0.48426573426573427	267	0.35224274406332456	T	12.78	2.040311	0.35989	0.17688	0.290765	ENSG00000148835	ENST00000369839;ENST00000351396	T;T	0.55930	0.73;0.49	4.45	1.88	0.25563	.	0.435426	0.24978	N	0.034100	T	0.00012	0.0000	N	0.04508	-0.205	0.41867	P	0.009742999999999946	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.46373	-0.9196	9	0.09338	T	0.73	-0.0936	6.2404	0.20787	0.1492:0.0:0.2595:0.5913	rs10883859	130;130	Q15542-2;Q15542	.;TAF5_HUMAN	A	130	ENSP00000358854:S130A;ENSP00000311024:S130A	ENSP00000311024:S130A	S	+	1	0	TAF5	105118124	0.988000	0.35896	1.000000	0.80357	0.948000	0.59901	0.932000	0.28884	0.814000	0.34374	0.459000	0.35465	TCC	T|0.623;G|0.377		0.741	TAF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050144.1		
SMC3	9126	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	112350315	112350315	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr10:112350315T>G	ENST00000361804.4	+	16	1781	c.1655T>G	c.(1654-1656)gTc>gGc	p.V552G		NM_005445.3	NP_005436.1	Q9UQE7	SMC3_HUMAN	structural maintenance of chromosomes 3	552	Flexible hinge.				DNA repair (GO:0006281)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid cohesion (GO:0007064)|mitotic spindle organization (GO:0007052)|negative regulation of DNA endoreduplication (GO:0032876)|regulation of DNA replication (GO:0006275)|signal transduction (GO:0007165)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	basement membrane (GO:0005604)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cohesin core heterodimer (GO:0008280)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear matrix (GO:0016363)|nuclear meiotic cohesin complex (GO:0034991)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|dynein binding (GO:0045502)|microtubule motor activity (GO:0003777)|protein heterodimerization activity (GO:0046982)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(5)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)		TGCGTGGAAGTCACTGCTGGA	0.343																																					p.V552G		.											.	SMC3-92	0			c.T1655G						.						101.0	100.0	100.0					10																	112350315		2203	4300	6503	SO:0001583	missense	9126	exon16			TGGAAGTCACTGC	AF020043	CCDS31285.1	10q25	2014-09-17	2006-07-06	2006-07-06	ENSG00000108055	ENSG00000108055		"""Structural maintenance of chromosomes proteins"", ""Proteoglycans / Extracellular Matrix : Other"""	2468	protein-coding gene	gene with protein product	"""bamacan proteoglycan"""	606062	"""chondroitin sulfate proteoglycan 6 (bamacan)"""	CSPG6		9506951, 10358101	Standard	NM_005445		Approved	HCAP, BAM, SMC3L1, bamacan	uc001kze.3	Q9UQE7	OTTHUMG00000019042	ENST00000361804.4:c.1655T>G	10.37:g.112350315T>G	ENSP00000354720:p.Val552Gly	Somatic	203	0		WXS	Illumina GAIIx	Phase_I	188	80	NM_005445	0	0	2	9	7	A8K156|O60464|Q5T482	Missense_Mutation	SNP	ENST00000361804.4	37	CCDS31285.1	.	.	.	.	.	.	.	.	.	.	T	22.8	4.337034	0.81801	.	.	ENSG00000108055	ENST00000361804	D	0.87256	-2.23	5.91	5.91	0.95273	SMCs flexible hinge (3);RecF/RecN/SMC (1);	0.000000	0.85682	D	0.000000	D	0.94561	0.8248	M	0.91406	3.205	0.80722	D	1	D	0.76494	0.999	D	0.65443	0.935	D	0.95553	0.8622	10	0.87932	D	0	.	16.3483	0.83171	0.0:0.0:0.0:1.0	.	552	Q9UQE7	SMC3_HUMAN	G	552	ENSP00000354720:V552G	ENSP00000354720:V552G	V	+	2	0	SMC3	112340305	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.698000	0.84413	2.254000	0.74563	0.533000	0.62120	GTC	.		0.343	SMC3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050337.1	NM_005445	
PDCD4	27250	ucsc.edu	37	10	112657841	112657841	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr10:112657841T>C	ENST00000280154.7	+	12	1679	c.1405T>C	c.(1405-1407)Tac>Cac	p.Y469H	MIR4680_ENST00000580906.1_RNA|BBIP1_ENST00000605265.1_5'Flank|PDCD4_ENST00000393104.2_Missense_Mutation_p.Y458H	NM_001199492.1|NM_014456.4	NP_001186421.1|NP_055271.2	Q53EL6	PDCD4_HUMAN	programmed cell death 4 (neoplastic transformation inhibitor)	469					apoptotic process (GO:0006915)|cell aging (GO:0007569)|negative regulation of cell cycle (GO:0045786)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of transcription, DNA-templated (GO:0045892)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	RNA binding (GO:0003723)			breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	13		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.000526)|all cancers(201;0.00794)|BRCA - Breast invasive adenocarcinoma(275;0.125)		ACCAGAGAGCTACTGAATATA	0.313																																					p.Y469H	Ovarian(115;1498 1603 9363 40056 40885)	.											.	PDCD4-291	0			c.T1405C						.						83.0	87.0	86.0					10																	112657841		2203	4300	6503	SO:0001583	missense	27250	exon12			GAGAGCTACTGAA	U83908	CCDS7567.1, CCDS44478.1	10q24	2008-08-01			ENSG00000150593	ENSG00000150593			8763	protein-coding gene	gene with protein product	"""nuclear antigen H731"""	608610				9759869	Standard	NM_014456		Approved	H731	uc001kzh.3	Q53EL6	OTTHUMG00000019048	ENST00000280154.7:c.1405T>C	10.37:g.112657841T>C	ENSP00000280154:p.Tyr469His	Somatic	26	1		WXS	Illumina GAIIx	Phase_I	40	4	NM_014456	0	0	38	38	0	B2RCV4|B5ME91|O15501|Q5VZS6|Q6PJI5|Q8TAR5|Q99834	Missense_Mutation	SNP	ENST00000280154.7	37	CCDS7567.1	.	.	.	.	.	.	.	.	.	.	T	16.89	3.246270	0.59103	.	.	ENSG00000150593	ENST00000280154;ENST00000393104	T;T	0.37752	1.18;1.22	6.02	6.02	0.97574	.	0.111526	0.64402	D	0.000005	T	0.38081	0.1027	L	0.57536	1.79	0.58432	D	0.999999	B;B;B	0.33549	0.417;0.417;0.417	B;B;B	0.31442	0.13;0.13;0.13	T	0.21211	-1.0252	10	0.52906	T	0.07	-12.3101	16.542	0.84395	0.0:0.0:0.0:1.0	.	455;469;458	B4DKX4;Q53EL6;B5ME91	.;PDCD4_HUMAN;.	H	469;458	ENSP00000280154:Y469H;ENSP00000376816:Y458H	ENSP00000280154:Y469H	Y	+	1	0	PDCD4	112647831	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.995000	0.76257	2.304000	0.77564	0.528000	0.53228	TAC	.		0.313	PDCD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050361.1	NM_014456	
MUC6	4588	bcgsc.ca	37	11	1016835	1016835	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr11:1016835A>G	ENST00000421673.2	-	31	6016	c.5966T>C	c.(5965-5967)tTc>tCc	p.F1989S		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1989	Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)	p.F1989Y(2)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGTGGTCTGGAAGGATGTTGC	0.567																																					p.F1989S		.											.	MUC6-23	2	Substitution - Missense(2)	lung(2)	c.T5966C						.						1541.0	1526.0	1531.0					11																	1016835		2203	4299	6502	SO:0001583	missense	4588	exon31			GTCTGGAAGGATG	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5966T>C	11.37:g.1016835A>G	ENSP00000406861:p.Phe1989Ser	Somatic	2499	39		WXS	Illumina GAIIx	Phase_I	1573	60	NM_005961	0	0	1	1	0	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	A	12.65	2.002866	0.35320	.	.	ENSG00000184956	ENST00000421673	T	0.18657	2.2	3.08	-0.788	0.10939	.	.	.	.	.	T	0.12390	0.0301	L	0.38531	1.155	0.09310	N	1	B	0.15930	0.015	B	0.14578	0.011	T	0.41106	-0.9527	9	0.07644	T	0.81	.	6.7728	0.23602	0.4725:0.0:0.5275:0.0	.	1989	Q6W4X9	MUC6_HUMAN	S	1989	ENSP00000406861:F1989S	ENSP00000406861:F1989S	F	-	2	0	MUC6	1006835	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-0.386000	0.07370	-0.019000	0.14055	0.254000	0.18369	TTC	.		0.567	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
SYT8	90019	hgsc.bcm.edu	37	11	1858572	1858572	+	Missense_Mutation	SNP	C	C	T	rs2292474	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr11:1858572C>T	ENST00000381968.3	+	9	1245	c.1117C>T	c.(1117-1119)Cgg>Tgg	p.R373W	TNNI2_ENST00000381906.1_5'Flank|SYT8_ENST00000535046.1_3'UTR|TNNI2_ENST00000381911.1_5'Flank|SYT8_ENST00000341958.3_Missense_Mutation_p.R359W|TNNI2_ENST00000381905.3_5'Flank|TNNI2_ENST00000252898.7_5'Flank	NM_138567.3	NP_612634	Q8NBV8	SYT8_HUMAN	synaptotagmin VIII	373					acrosome reaction (GO:0007340)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	transporter activity (GO:0005215)			breast(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	6		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		CATTGCCCAGCGGCACCCCCT	0.731													T|||	1928	0.384984	0.1679	0.415	5008	,	,		13483	0.378		0.498	False		,,,				2504	0.5481				p.R373W		.											.	SYT8-91	0			c.C1117T						.	T	TRP/ARG	906,3442		119,668,1387	12.0	14.0	14.0		1117	2.7	1.0	11	dbSNP_100	14	4072,4398		1026,2020,1189	no	missense	SYT8	NM_138567.3	101	1145,2688,2576	TT,TC,CC		48.0756,20.8372,38.836	benign	373/402	1858572	4978,7840	2174	4235	6409	SO:0001583	missense	90019	exon9			GCCCAGCGGCACC	AL137708	CCDS7726.2	11p15.5	2013-01-21			ENSG00000149043	ENSG00000149043		"""Synaptotagmins"""	19264	protein-coding gene	gene with protein product		607719				7791877	Standard	XM_005253216		Approved	DKFZp434K0322	uc001lue.1	Q8NBV8	OTTHUMG00000009026	ENST00000381968.3:c.1117C>T	11.37:g.1858572C>T	ENSP00000371394:p.Arg373Trp	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	24	24	NM_138567	0	0	0	0	0	A6NFJ4|Q9NSV9	Missense_Mutation	SNP	ENST00000381968.3	37	CCDS7726.2	855|855	0.3914835164835165|0.3914835164835165	84|84	0.17073170731707318|0.17073170731707318	163|163	0.45027624309392267|0.45027624309392267	226|226	0.3951048951048951|0.3951048951048951	382|382	0.503957783641161|0.503957783641161	t|t	1.107|1.107	-0.659353|-0.659353	0.03454|0.03454	0.208372|0.208372	0.480756|0.480756	ENSG00000149043|ENSG00000149043	ENST00000381978|ENST00000381968;ENST00000341958	.|T;T	.|0.03951	.|3.77;3.75	3.85|3.85	2.68|2.68	0.31781|0.31781	.|.	.|.	.|.	.|.	.|.	T|T	0.00012|0.00012	0.0000|0.0000	N|N	0.00005|0.00005	-3.275|-3.275	0.09310|0.09310	P|P	1.0|1.0	.|B;B	.|0.02656	.|0.0;0.0	.|B;B	.|0.01281	.|0.0;0.0	T|T	0.41928|0.41928	-0.9481|-0.9481	4|8	.|0.02654	.|T	.|1	.|.	8.5203|8.5203	0.33270|0.33270	0.0:0.1655:0.0:0.8345|0.0:0.1655:0.0:0.8345	rs2292474|rs2292474	.|373;359	.|Q8NBV8;A6NCR4	.|SYT8_HUMAN;.	V|W	371|373;359	.|ENSP00000371394:R373W;ENSP00000343691:R359W	.|ENSP00000343691:R359W	A|R	+|+	2|1	0|2	SYT8|SYT8	1815148|1815148	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.293000|0.293000	0.27360|0.27360	3.304000|3.304000	0.51866|0.51866	0.174000|0.174000	0.19809|0.19809	-0.665000|-0.665000	0.03846|0.03846	GCG|CGG	C|0.602;T|0.398		0.731	SYT8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000025013.4		
WT1	7490	hgsc.bcm.edu	37	11	32456694	32456694	+	Silent	SNP	C	C	A	rs2234582	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr11:32456694C>A	ENST00000332351.3	-	1	482	c.198G>T	c.(196-198)ccG>ccT	p.P66P	WT1-AS_ENST00000459866.1_RNA|WT1-AS_ENST00000426618.2_RNA|WT1-AS_ENST00000494911.1_RNA|WT1-AS_ENST00000395900.1_RNA|WT1-AS_ENST00000525436.1_RNA|WT1_ENST00000448076.3_Silent_p.P66P|WT1-AS_ENST00000478367.1_RNA	NM_024424.3|NM_024426.4	NP_077742.2|NP_077744	P19544	WT1_HUMAN	Wilms tumor 1	0	Pro-rich.				adrenal cortex formation (GO:0035802)|adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye development (GO:0043010)|cardiac muscle cell fate commitment (GO:0060923)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|diaphragm development (GO:0060539)|epithelial cell differentiation (GO:0030855)|germ cell development (GO:0007281)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|gonad development (GO:0008406)|heart development (GO:0007507)|kidney development (GO:0001822)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|mesenchymal to epithelial transition (GO:0060231)|metanephric epithelium development (GO:0072207)|metanephric mesenchyme development (GO:0072075)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of female gonad development (GO:2000195)|negative regulation of metanephric glomerular mesangial cell proliferation (GO:0072302)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of heart growth (GO:0060421)|positive regulation of male gonad development (GO:2000020)|positive regulation of metanephric ureteric bud development (GO:2001076)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior mesonephric tubule development (GO:0072166)|regulation of organ formation (GO:0003156)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|sex determination (GO:0007530)|thorax and anterior abdomen determination (GO:0007356)|tissue development (GO:0009888)|ureteric bud development (GO:0001657)|vasculogenesis (GO:0001570)|visceral serous pericardium development (GO:0061032)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)		EWSR1/WT1(234)	NS(1)|haematopoietic_and_lymphoid_tissue(348)|kidney(149)|large_intestine(9)|lung(20)|peritoneum(1)|pleura(2)|skin(2)|upper_aerodigestive_tract(1)	533	Breast(20;0.247)		OV - Ovarian serous cystadenocarcinoma(30;0.128)			CCATTTGCTGCGGCTCAGACC	0.761			"""D, Mis, N, F, S"""	EWSR1	"""Wilms, desmoplastic small round cell tumor"""	Wilms			Wilms' tumor-Aniridia-ambiguous Genitals-mental Retardation;Frasier syndrome;Familial Wilms' tumor;Denys-Drash syndrome				C|||	1511	0.301717	0.6604	0.1556	5008	,	,		5831	0.0675		0.1839	False		,,,				2504	0.2832				p.P66P		.	yes	Rec	yes	"""Denys-Drash syndrome, Frasier syndrome, Familial Wilms tumor"""	11	11p13	7490	Wilms tumour 1 gene		O	.	WT1-6891	0			c.G198T						.	C	,,	1567,1733		420,727,503	2.0	3.0	3.0		198,198,198	1.2	0.0	11	dbSNP_98	3	1360,5576		235,890,2343	no	coding-synonymous,coding-synonymous,coding-synonymous	WT1	NM_000378.4,NM_024424.3,NM_024426.4	,,	655,1617,2846	AA,AC,CC		19.6078,47.4848,28.5952	,,	66/498,66/515,66/518	32456694	2927,7309	1650	3468	5118	SO:0001819	synonymous_variant	7490	exon1	Familial Cancer Database	WAGR syndrome; ; ;incl.: Early Onset Nephrotic Syndrome-WT1 associated	TTGCTGCGGCTCA		CCDS7878.2, CCDS44561.1, CCDS44562.1, CCDS55750.1, CCDS55751.1	11p13	2014-09-17			ENSG00000184937	ENSG00000184937		"""Zinc fingers, C2H2-type"""	12796	protein-coding gene	gene with protein product		607102		GUD		14681303	Standard	NM_024424		Approved	WAGR, WIT-2, AWT1	uc001mtn.2	P19544	OTTHUMG00000039556	ENST00000332351.3:c.198G>T	11.37:g.32456694C>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_024424	0	0	0	0	0	A8K6S1|B3KSA5|Q15881|Q16256|Q16575|Q4VXV4|Q4VXV5|Q4VXV6|Q8IYZ5	Silent	SNP	ENST00000332351.3	37	CCDS7878.2																																																																																			C|0.748;A|0.252		0.761	WT1-001	KNOWN	non_ATG_start|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000095436.2	NM_000378	
NRXN2	9379	hgsc.bcm.edu	37	11	64480641	64480641	+	Silent	SNP	G	G	A	rs2518907	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr11:64480641G>A	ENST00000377551.1	-	1	742	c.531C>T	c.(529-531)ggC>ggT	p.G177G	NRXN2_ENST00000265459.6_Silent_p.G177G|NRXN2_ENST00000377559.3_Silent_p.G177G|NRXN2_ENST00000409571.1_Silent_p.G177G			Q9P2S2	NRX2A_HUMAN	neurexin 2	177	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|gephyrin clustering (GO:0097116)|neuroligin clustering (GO:0097118)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	calcium channel regulator activity (GO:0005246)|cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|neuroligin family protein binding (GO:0097109)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	71						TGGCCAAGAGGCCGCGGAAGG	0.756													G|||	2672	0.533546	0.2216	0.5403	5008	,	,		8112	0.5407		0.7604	False		,,,				2504	0.7096				p.G177G		.											.	NRXN2-232	0			c.C531T						.	G	,	1316,1684		331,654,515	2.0	2.0	2.0		531,531	1.3	1.0	11	dbSNP_100	2	4949,1205		2080,789,208	no	coding-synonymous,coding-synonymous	NRXN2	NM_015080.3,NM_138732.2	,	2411,1443,723	AA,AG,GG		19.5808,43.8667,31.56	,	177/1713,177/1643	64480641	6265,2889	1500	3077	4577	SO:0001819	synonymous_variant	9379	exon2			CAAGAGGCCGCGG		CCDS8077.1, CCDS31597.1, CCDS8078.1	11q13	2008-07-18			ENSG00000110076	ENSG00000110076			8009	protein-coding gene	gene with protein product	"""neurexin II"""	600566				1621094	Standard	NM_015080		Approved		uc021qkw.1	P58401	OTTHUMG00000045214	ENST00000377551.1:c.531C>T	11.37:g.64480641G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_138732	0	0	0	0	0	A7E2C1|Q9Y2D6	Silent	SNP	ENST00000377551.1	37	CCDS8077.1																																																																																			G|0.449;A|0.551		0.756	NRXN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104967.3	NM_015080	
MEN1	4221	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	64573212	64573216	+	Frame_Shift_Del	DEL	GATCT	GATCT	-	rs147331514|rs267607234	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	GATCT	GATCT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr11:64573212_64573216delGATCT	ENST00000337652.1	-	8	1594_1598	c.1091_1095delAGATC	c.(1090-1095)gagatcfs	p.EI364fs	MAP4K2_ENST00000377350.3_5'Flank|MEN1_ENST00000377313.1_Frame_Shift_Del_p.EI364fs|MAP4K2_ENST00000294066.2_5'Flank|MEN1_ENST00000377326.3_Frame_Shift_Del_p.EI359fs|MEN1_ENST00000315422.4_Frame_Shift_Del_p.EI359fs|MEN1_ENST00000443283.1_Frame_Shift_Del_p.EI364fs|MEN1_ENST00000312049.6_Frame_Shift_Del_p.EI359fs|MEN1_ENST00000478548.1_5'UTR|MEN1_ENST00000377316.2_Frame_Shift_Del_p.EI359fs|MEN1_ENST00000394376.1_Frame_Shift_Del_p.EI364fs|MAP4K2_ENST00000468062.1_5'Flank|MEN1_ENST00000394374.2_Frame_Shift_Del_p.EI364fs|MEN1_ENST00000377321.1_Frame_Shift_Del_p.EI324fs	NM_130803.2	NP_570715	O00255	MEN1_HUMAN	multiple endocrine neoplasia I	364	Interaction with FANCD2.		E -> K (in MEN1). {ECO:0000269|PubMed:9740255}.		brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|DNA repair (GO:0006281)|embryonic skeletal system morphogenesis (GO:0048704)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|histone lysine methylation (GO:0034968)|leukocyte homeostasis (GO:0001776)|MAPK cascade (GO:0000165)|maternal process involved in female pregnancy (GO:0060135)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of JNK cascade (GO:0046329)|negative regulation of organ growth (GO:0046621)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of telomerase activity (GO:0051974)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast development (GO:0002076)|osteoblast fate commitment (GO:0002051)|palate development (GO:0060021)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell division (GO:0051781)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of histone methylation (GO:0031062)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of activin receptor signaling pathway (GO:0032925)|response to gamma radiation (GO:0010332)|response to UV (GO:0009411)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	chromatin (GO:0000785)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone methyltransferase complex (GO:0035097)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|four-way junction DNA binding (GO:0000400)|protein binding, bridging (GO:0030674)|protein N-terminus binding (GO:0047485)|R-SMAD binding (GO:0070412)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)|Y-form DNA binding (GO:0000403)			NS(7)|adrenal_gland(5)|breast(2)|central_nervous_system(5)|endometrium(1)|gastrointestinal_tract_(site_indeterminate)(15)|large_intestine(2)|lung(21)|ovary(1)|pancreas(64)|parathyroid(181)|pituitary(7)|prostate(4)|retroperitoneum(1)|skin(1)|small_intestine(13)|soft_tissue(4)|stomach(1)|thymus(2)	337						ACTCCTTGTAGATCTCCTCGTCTTC	0.61			"""D, Mis, N, F, S"""		"""parathyroid tumors, Pancreatic neuroendocrine tumors"""	"""parathyroid adenoma, pituitary adenoma, pancreatic islet cell, carcinoid"""			Multiple Endocrine Neoplasia, type 1;Hyperparathyroidism, Familial Isolated																												p.364_365del	Esophageal Squamous(1;83 158 15500 18603 18803 29295)	.	yes	Rec	yes	Multiple Endocrine Neoplasia Type 1	11	11q13	4221	multiple endocrine neoplasia type 1 gene		E	.	MEN1-3017	0			c.1091_1095del	GRCh37	CD982770	MEN1	D		.																																			SO:0001589	frameshift_variant	4221	exon8	Familial Cancer Database	MEN1, Wermer disease;FIHP, FIHPT, HRPT1, Familial Isolated Primary Hyperparathyroidism	CTTGTAGATCTCC	U93236	CCDS8083.1, CCDS31600.1	11q13	2014-09-17			ENSG00000133895	ENSG00000133895			7010	protein-coding gene	gene with protein product	"""menin"""	613733					Standard	NM_130799		Approved		uc001obn.3	O00255	OTTHUMG00000045366	ENST00000337652.1:c.1091_1095delAGATC	11.37:g.64573212_64573216delGATCT	ENSP00000337088:p.Glu364fs	Somatic	210	0		WXS	Illumina GAIIx	Phase_I	89	61	NM_130800	0	0	0	0	0	A5HBC6|A5HBC7|A5HBC8|A5HBC9|A5HBD0|A5HBD1|A5HBD2|O00632|Q9BUF0|Q9BUK2	Frame_Shift_Del	DEL	ENST00000337652.1	37	CCDS8083.1																																																																																			.		0.610	MEN1-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000143881.1		
SF3B2	10992	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	65826803	65826803	+	Silent	SNP	C	C	T	rs143148362	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr11:65826803C>T	ENST00000322535.6	+	11	1363	c.1314C>T	c.(1312-1314)gaC>gaT	p.D438D	SF3B2_ENST00000528302.1_Silent_p.D421D	NM_006842.2	NP_006833.2	Q13435	SF3B2_HUMAN	splicing factor 3b, subunit 2, 145kDa	438					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	poly(A) RNA binding (GO:0044822)			breast(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|liver(2)|lung(14)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	41						GCAGTGATGACGAGCAGGTCA	0.552																																					p.D438D		.											.	SF3B2-92	0			c.C1314T						.	C		1,4401	2.1+/-5.4	0,1,2200	55.0	48.0	50.0		1314	-10.1	0.0	11	dbSNP_134	50	5,8585	4.3+/-15.6	0,5,4290	no	coding-synonymous	SF3B2	NM_006842.2		0,6,6490	TT,TC,CC		0.0582,0.0227,0.0462		438/896	65826803	6,12986	2201	4295	6496	SO:0001819	synonymous_variant	10992	exon11			TGATGACGAGCAG	U41371	CCDS31612.1	11q13	2010-07-21	2002-08-29		ENSG00000087365	ENSG00000087365			10769	protein-coding gene	gene with protein product		605591	"""splicing factor 3b, subunit 2, 145kD"""			8566756	Standard	XM_005273726		Approved	SAP145, SF3b1, Cus1, SF3b145	uc001ogy.1	Q13435	OTTHUMG00000166751	ENST00000322535.6:c.1314C>T	11.37:g.65826803C>T		Somatic	213	1		WXS	Illumina GAIIx	Phase_I	145	118	NM_006842	0	0	0	0	0	A8K485|B4DT19|Q7L4T5|Q7Z627|Q969K1|Q96CM6|Q9BWD2	Silent	SNP	ENST00000322535.6	37	CCDS31612.1																																																																																			C|0.999;T|0.001		0.552	SF3B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391352.2		
YIF1A	10897	broad.mit.edu	37	11	66055601	66055601	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr11:66055601G>T	ENST00000376901.4	-	2	378	c.194C>A	c.(193-195)gCc>gAc	p.A65D	YIF1A_ENST00000526497.1_5'Flank|YIF1A_ENST00000359461.6_Missense_Mutation_p.A65D|YIF1A_ENST00000471387.2_Intron|YIF1A_ENST00000496746.1_5'Flank	NM_020470.2	NP_065203.2	O95070	YIF1A_HUMAN	Yip1 interacting factor homolog A (S. cerevisiae)	65					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|microtubule organizing center (GO:0005815)				endometrium(1)|large_intestine(1)|lung(3)|prostate(1)|skin(2)|stomach(1)	9						GCTGCCATAGGCCATAGCCAC	0.617																																					p.A65D		.											.	YIF1A-90	0			c.C194A						.						134.0	134.0	134.0					11																	66055601		2200	4295	6495	SO:0001583	missense	10897	exon2			CCATAGGCCATAG	AF004876	CCDS8132.1, CCDS73325.1	11q13	2009-01-05	2005-06-07	2005-06-07	ENSG00000174851	ENSG00000174851			16688	protein-coding gene	gene with protein product		611484	"""Yip1 interacting factor homolog (S. cerevisiae)"""	YIF1		8824393, 10970842, 18718466	Standard	NM_020470		Approved	YIF1P, 54TM, FinGER7	uc001ohk.4	O95070	OTTHUMG00000102079	ENST00000376901.4:c.194C>A	11.37:g.66055601G>T	ENSP00000366098:p.Ala65Asp	Somatic	195	1		WXS	Illumina GAIIx	Phase_I	105	3	NM_020470	0	0	73	73	0	A6NM00|Q96G83|Q9BVD0	Missense_Mutation	SNP	ENST00000376901.4	37	CCDS8132.1	.	.	.	.	.	.	.	.	.	.	G	32	5.181496	0.94885	.	.	ENSG00000174851	ENST00000359461;ENST00000376901;ENST00000376904;ENST00000431556;ENST00000528575	T;T;T;T	0.46063	0.89;0.9;0.88;0.88	5.96	5.96	0.96718	.	0.109676	0.64402	D	0.000007	T	0.63873	0.2548	M	0.81802	2.56	0.44085	D	0.996848	D;P	0.55385	0.971;0.891	P;P	0.57009	0.811;0.628	T	0.63761	-0.6564	10	0.48119	T	0.1	-10.9234	19.1685	0.93567	0.0:0.0:1.0:0.0	.	65;65	E9PIZ0;O95070	.;YIF1A_HUMAN	D	65	ENSP00000352437:A65D;ENSP00000366098:A65D;ENSP00000401953:A65D;ENSP00000431935:A65D	ENSP00000352437:A65D	A	-	2	0	YIF1A	65812177	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.370000	0.66144	2.830000	0.97506	0.655000	0.94253	GCC	.		0.617	YIF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219903.3	NM_020470	
IQSEC3	440073	hgsc.bcm.edu	37	12	248155	248155	+	Silent	SNP	C	C	T	rs55923022	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr12:248155C>T	ENST00000538872.1	+	4	1744	c.1626C>T	c.(1624-1626)gcC>gcT	p.A542A	IQSEC3_ENST00000326261.4_Silent_p.A542A|IQSEC3_ENST00000382841.2_Silent_p.A239A|RP11-598F7.4_ENST00000508953.2_RNA|RP11-598F7.4_ENST00000505893.2_RNA			Q9UPP2	IQEC3_HUMAN	IQ motif and Sec7 domain 3	542					actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|inhibitory synapse (GO:0060077)|postsynaptic membrane (GO:0045211)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)	p.A542A(1)|p.A239A(1)		central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(18)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_cancers(10;0.016)|all_lung(10;0.0222)|all_epithelial(11;0.0262)|Lung NSC(10;0.031)		OV - Ovarian serous cystadenocarcinoma(31;0.00456)	LUAD - Lung adenocarcinoma(1;0.172)|Lung(1;0.179)		AAGCCCCCGCCGTGGGCCGGG	0.746													T|||	657	0.13119	0.2882	0.0908	5008	,	,		10438	0.0258		0.0974	False		,,,				2504	0.091				p.A542A		.											.	IQSEC3-560	2	Substitution - coding silent(2)	prostate(2)	c.C1626T						.						4.0	5.0	4.0					12																	248155		1929	3805	5734	SO:0001819	synonymous_variant	440073	exon4			CCCCGCCGTGGGC	AB029033	CCDS31725.1, CCDS53728.1	12p13.33	2014-03-18			ENSG00000120645	ENSG00000120645			29193	protein-coding gene	gene with protein product		612118				10470851	Standard	NM_001170738		Approved	KIAA1110, MGC30156	uc001qhw.2	Q9UPP2	OTTHUMG00000167975	ENST00000538872.1:c.1626C>T	12.37:g.248155C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	15	9	NM_001170738	0	0	0	0	0	A6NIF2|A6NKV9|Q8TB43	Silent	SNP	ENST00000538872.1	37	CCDS53728.1																																																																																			C|0.880;T|0.120		0.746	IQSEC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397382.3	XM_495902	
PKP2	5318	hgsc.bcm.edu	37	12	33049590	33049590	+	Missense_Mutation	SNP	C	C	T	rs143004808	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr12:33049590C>T	ENST00000070846.6	-	1	100	c.76G>A	c.(76-78)Gac>Aac	p.D26N	PKP2_ENST00000546741.1_5'Flank|PKP2_ENST00000340811.4_Missense_Mutation_p.D26N	NM_004572.3	NP_004563.2	Q99959	PKP2_HUMAN	plakophilin 2	26			D -> N (associated with increased susceptibility to arrhythmogenic right ventricular cardiomyopathy; dbSNP:rs143004808). {ECO:0000269|PubMed:19955750, ECO:0000269|PubMed:20031617}.		adherens junction maintenance (GO:0034334)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential (GO:0086001)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cell-cell signaling involved in cardiac conduction (GO:0086019)|desmosome assembly (GO:0002159)|gap junction assembly (GO:0016264)|heart development (GO:0007507)|intermediate filament bundle assembly (GO:0045110)|lipid homeostasis (GO:0055088)|maintenance of organ identity (GO:0048496)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|positive regulation of sodium ion transport (GO:0010765)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of tight junction assembly (GO:2000810)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	adherens junction (GO:0005912)|cell junction (GO:0030054)|cell-cell junction (GO:0005911)|desmosome (GO:0030057)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intermediate filament binding (GO:0019215)|ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|protein kinase C binding (GO:0005080)|sodium channel regulator activity (GO:0017080)			NS(1)|breast(2)|endometrium(1)|kidney(9)|large_intestine(8)|lung(21)|ovary(1)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	50	Lung NSC(5;9.35e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)					CTGGAGCTGTCCAGTTGTCCC	0.716													C|||	15	0.00299521	0.0008	0.0014	5008	,	,		8671	0.0		0.0109	False		,,,				2504	0.002				p.D26N		.											.	PKP2-92	0			c.G76A	GRCh37	CM061172	PKP2	M	rs143004808	.	C	ASN/ASP,ASN/ASP	4,4140		0,4,2068	7.0	7.0	7.0		76,76	4.1	1.0	12	dbSNP_134	7	56,8144		0,56,4044	no	missense,missense	PKP2	NM_001005242.2,NM_004572.3	23,23	0,60,6112	TT,TC,CC		0.6829,0.0965,0.4861	possibly-damaging,possibly-damaging	26/838,26/882	33049590	60,12284	2072	4100	6172	SO:0001583	missense	5318	exon1			AGCTGTCCAGTTG	X97675	CCDS8731.1, CCDS31771.1	12p11	2014-09-17				ENSG00000057294		"""Armadillo repeat containing"""	9024	protein-coding gene	gene with protein product		602861				8922383	Standard	NM_001005242		Approved		uc001rlj.4	Q99959	OTTHUMG00000169500	ENST00000070846.6:c.76G>A	12.37:g.33049590C>T	ENSP00000070846:p.Asp26Asn	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	31	12	NM_004572	0	0	0	0	0	A0AV37|B8QFA1|B8QGS6|B8QGS7|D3DUW9|Q4VC01|Q99960	Missense_Mutation	SNP	ENST00000070846.6	37	CCDS8731.1	6	0.0027472527472527475	0	0.0	0	0.0	0	0.0	6	0.0079155672823219	C	33	5.290752	0.95546	9.65E-4	0.006829	ENSG00000057294	ENST00000340811;ENST00000070846;ENST00000537278	D;D	0.83591	-1.74;-1.72	4.07	4.07	0.47477	.	0.127072	0.34802	N	0.003678	T	0.79822	0.4512	L	0.29908	0.895	0.47659	D	0.999482	D;D;D	0.63046	0.992;0.986;0.986	P;P;P	0.60415	0.874;0.751;0.859	D	0.83985	0.0334	10	0.54805	T	0.06	-24.6581	15.4098	0.74908	0.0:1.0:0.0:0.0	.	26;26;26	Q99959-2;A0AV37;Q99959	.;.;PKP2_HUMAN	N	26	ENSP00000342800:D26N;ENSP00000070846:D26N	ENSP00000070846:D26N	D	-	1	0	PKP2	32940857	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.560000	0.53763	2.081000	0.62600	0.491000	0.48974	GAC	C|0.997;T|0.003		0.716	PKP2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000404449.1	NM_004572	
DBX2	440097	hgsc.bcm.edu	37	12	45444516	45444516	+	Silent	SNP	G	G	A	rs139910495	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr12:45444516G>A	ENST00000332700.6	-	1	366	c.195C>T	c.(193-195)gcC>gcT	p.A65A	RP11-478B9.1_ENST00000548424.1_RNA	NM_001004329.2	NP_001004329.2	Q6ZNG2	DBX2_HUMAN	developing brain homeobox 2	65					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(3)|kidney(1)|large_intestine(3)|lung(9)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	22	Lung SC(27;0.192)	Lung NSC(34;0.142)		GBM - Glioblastoma multiforme(48;0.0515)		CGGTGGCCAGGGCGGTCGCCG	0.731													G|||	296	0.0591054	0.0197	0.0461	5008	,	,		9417	0.1964		0.007	False		,,,				2504	0.0337				p.A65A		.											.	DBX2-90	0			c.C195T						.	G		31,2581		0,31,1275	2.0	2.0	2.0		195	-5.4	0.0	12	dbSNP_134	2	69,5705		0,69,2818	no	coding-synonymous	DBX2	NM_001004329.2		0,100,4093	AA,AG,GG		1.195,1.1868,1.1925		65/340	45444516	100,8286	1306	2887	4193	SO:0001819	synonymous_variant	440097	exon1			GGCCAGGGCGGTC		CCDS31781.1	12q12	2011-06-20				ENSG00000185610		"""Homeoboxes / ANTP class : NKL subclass"""	33186	protein-coding gene	gene with protein product						11239429	Standard	NM_001004329		Approved	FLJ16139	uc001rok.1	Q6ZNG2	OTTHUMG00000169559	ENST00000332700.6:c.195C>T	12.37:g.45444516G>A		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	11	7	NM_001004329	0	0	0	0	0		Silent	SNP	ENST00000332700.6	37	CCDS31781.1																																																																																			G|0.930;A|0.070		0.731	DBX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404810.1	NM_001004329	
KRT7	3855	hgsc.bcm.edu	37	12	52627215	52627215	+	Silent	SNP	A	A	G	rs7308888	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr12:52627215A>G	ENST00000331817.5	+	1	318	c.135A>G	c.(133-135)tcA>tcG	p.S45S		NM_005556.3	NP_005547.3	P08729	K2C7_HUMAN	keratin 7	45	Head.				viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|prostate(2)|stomach(1)|urinary_tract(1)	14				BRCA - Breast invasive adenocarcinoma(357;0.105)	Primaquine(DB01087)	TCGGCGCCTCACGGCCGCGCG	0.771													g|||	4451	0.888778	0.9781	0.8473	5008	,	,		10346	0.9048		0.8191	False		,,,				2504	0.8528				p.S45S		.											.	KRT7-90	0			c.A135G						.			3161,173		1496,169,2	4.0	6.0	5.0		135	-5.3	0.0	12	dbSNP_116	5	5763,1251		2369,1025,113	no	coding-synonymous	KRT7	NM_005556.3		3865,1194,115	GG,GA,AA		17.8358,5.189,13.7611		45/470	52627215	8924,1424	1667	3507	5174	SO:0001819	synonymous_variant	3855	exon1			CGCCTCACGGCCG		CCDS8822.1	12q13.13	2013-01-16			ENSG00000135480	ENSG00000135480		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6445	protein-coding gene	gene with protein product	"""keratin, type II cytoskeletal 7"", ""cytokeratin 7"", ""sarcolectin"", ""keratin, 55K type II cytoskeletal"""	148059				1713141, 16831889	Standard	XR_245927		Approved	K7, CK7, K2C7, SCL	uc001saa.1	P08729	OTTHUMG00000169580	ENST00000331817.5:c.135A>G	12.37:g.52627215A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_005556	0	0	0	0	0	Q92676|Q9BUD8|Q9Y3R7	Silent	SNP	ENST00000331817.5	37	CCDS8822.1																																																																																			A|0.133;G|0.867		0.771	KRT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404897.1	NM_005556	
AMDHD1	144193	hgsc.bcm.edu	37	12	96337183	96337183	+	Missense_Mutation	SNP	A	A	G	rs7955450	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr12:96337183A>G	ENST00000266736.2	+	1	113	c.7A>G	c.(7-9)Agc>Ggc	p.S3G	CCDC38_ENST00000344280.3_5'Flank|CCDC38_ENST00000546386.1_5'Flank|CCDC38_ENST00000549752.1_5'Flank	NM_152435.2	NP_689648.2	Q96NU7	HUTI_HUMAN	amidohydrolase domain containing 1	3			S -> G (in dbSNP:rs7955450). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15221005, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:16541075}.		cellular nitrogen compound metabolic process (GO:0034641)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	imidazolonepropionase activity (GO:0050480)|metal ion binding (GO:0046872)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|skin(1)	22						CGACATGGCAAGCGGCCACAG	0.736													G|||	3598	0.71845	0.702	0.6888	5008	,	,		10480	0.9554		0.6004	False		,,,				2504	0.6391				p.S3G		.											.	AMDHD1-90	0			c.A7G						.						2.0	3.0	3.0					12																	96337183		1177	2379	3556	SO:0001583	missense	144193	exon1			ATGGCAAGCGGCC	AB075878	CCDS9057.1	12q23.1	2006-02-02				ENSG00000139344			28577	protein-coding gene	gene with protein product							Standard	NM_152435		Approved	MGC35366	uc001tel.2	Q96NU7	OTTHUMG00000170353	ENST00000266736.2:c.7A>G	12.37:g.96337183A>G	ENSP00000266736:p.Ser3Gly	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	17	17	NM_152435	0	0	0	1	1	A8K463|Q68CI8	Missense_Mutation	SNP	ENST00000266736.2	37	CCDS9057.1	1561	0.7147435897435898	348	0.7073170731707317	233	0.643646408839779	540	0.9440559440559441	440	0.5804749340369393	G	5.553	0.286982	0.10513	.	.	ENSG00000139344	ENST00000266736	T	0.30714	1.52	4.39	-8.69	0.00855	.	0.734274	0.13810	N	0.361153	T	0.00012	0.0000	N	0.01576	-0.805	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.28427	-1.0044	9	0.21540	T	0.41	.	1.8829	0.03231	0.44:0.0902:0.1959:0.2739	rs7955450;rs17856824;rs58541549;rs7955450	3	Q96NU7	HUTI_HUMAN	G	3	ENSP00000266736:S3G	ENSP00000266736:S3G	S	+	1	0	AMDHD1	94861314	0.000000	0.05858	0.000000	0.03702	0.134000	0.20937	-0.592000	0.05747	-2.316000	0.00645	-1.140000	0.01884	AGC	A|0.273;G|0.727		0.736	AMDHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408640.1	NM_152435	
SCARB1	949	broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	125279751	125279751	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr12:125279751C>T	ENST00000415380.2	-	9	1317	c.1192G>A	c.(1192-1194)Gca>Aca	p.A398T	SCARB1_ENST00000544327.1_Missense_Mutation_p.A344T|SCARB1_ENST00000540495.1_Missense_Mutation_p.A361T|SCARB1_ENST00000339570.5_Missense_Mutation_p.A398T|SCARB1_ENST00000535005.1_5'UTR|SCARB1_ENST00000261693.6_Missense_Mutation_p.A398T|SCARB1_ENST00000376788.1_Missense_Mutation_p.A298T|SCARB1_ENST00000541205.1_Missense_Mutation_p.A357T|SCARB1_ENST00000546215.1_Missense_Mutation_p.A398T			Q8WTV0	SCRB1_HUMAN	scavenger receptor class B, member 1	398					adhesion of symbiont to host (GO:0044406)|androgen biosynthetic process (GO:0006702)|blood vessel endothelial cell migration (GO:0043534)|cell adhesion (GO:0007155)|cholesterol catabolic process (GO:0006707)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol import (GO:0070508)|detection of lipopolysaccharide (GO:0032497)|endothelial cell proliferation (GO:0001935)|high-density lipoprotein particle clearance (GO:0034384)|high-density lipoprotein particle remodeling (GO:0034375)|lipopolysaccharide transport (GO:0015920)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|lipoprotein metabolic process (GO:0042157)|low-density lipoprotein particle clearance (GO:0034383)|phospholipid transport (GO:0015914)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of triglyceride biosynthetic process (GO:0010867)|receptor-mediated endocytosis (GO:0006898)|recognition of apoptotic cell (GO:0043654)|regulation of phagocytosis (GO:0050764)|regulation of phosphatidylcholine catabolic process (GO:0010899)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|triglyceride homeostasis (GO:0070328)|viral process (GO:0016032)|wound healing (GO:0042060)	caveola (GO:0005901)|cell surface (GO:0009986)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|apolipoprotein A-I binding (GO:0034186)|apolipoprotein binding (GO:0034185)|high-density lipoprotein particle binding (GO:0008035)|high-density lipoprotein particle receptor activity (GO:0070506)|lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|low-density lipoprotein particle binding (GO:0030169)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(7)|prostate(1)	17	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000116)|Epithelial(86;0.000415)|all cancers(50;0.00395)	Phosphatidylserine(DB00144)	CCAATGCCTGCGACAGATTTC	0.567																																					p.A398T		.											.	SCARB1-226	0			c.G1192A						.						159.0	142.0	148.0					12																	125279751		2203	4300	6503	SO:0001583	missense	949	exon9			TGCCTGCGACAGA	Z22555	CCDS9259.1, CCDS45008.1	12q24.32	2008-08-05	2002-09-06	2002-09-06	ENSG00000073060	ENSG00000073060			1664	protein-coding gene	gene with protein product		601040	"""CD36 antigen (collagen type I receptor, thrombospondin receptor)-like 1"""	CD36L1		7689561	Standard	NM_001082959		Approved	SRB1, CLA-1, CLA1, SR-BI	uc001ugm.4	Q8WTV0	OTTHUMG00000168544	ENST00000415380.2:c.1192G>A	12.37:g.125279751C>T	ENSP00000414979:p.Ala398Thr	Somatic	123	2		WXS	Illumina GAIIx	Phase_I	146	64	NM_005505	0	0	1	2	1	F8W8N0|Q14016|Q52LZ5|Q6KFX4	Missense_Mutation	SNP	ENST00000415380.2	37		.	.	.	.	.	.	.	.	.	.	C	2.975	-0.211495	0.06140	.	.	ENSG00000073060	ENST00000339570;ENST00000415380;ENST00000261693;ENST00000376788;ENST00000546215;ENST00000541205;ENST00000544327;ENST00000540495	T;T;T;T;T;T;T;T	0.71817	-0.6;-0.6;-0.6;-0.6;-0.6;-0.6;-0.6;-0.6	4.28	-4.76	0.03229	.	0.943145	0.08953	N	0.869781	T	0.40473	0.1118	N	0.17474	0.49	0.09310	N	1	P;B;P;P;P;B	0.45827	0.867;0.279;0.867;0.867;0.737;0.441	B;B;B;B;B;B	0.34418	0.182;0.084;0.182;0.182;0.08;0.05	T	0.42344	-0.9457	10	0.22706	T	0.39	-1.4596	4.7426	0.13022	0.1947:0.0851:0.5383:0.1819	.	357;398;398;398;398;398	B3KW46;B7ZKQ9;B4E3I1;Q8WTV0;F8W8N0;Q8WTV0-2	.;.;.;SCRB1_HUMAN;.;.	T	398;398;398;298;398;357;344;361	ENSP00000343795:A398T;ENSP00000414979:A398T;ENSP00000261693:A398T;ENSP00000365984:A298T;ENSP00000442862:A398T;ENSP00000446107:A357T;ENSP00000444851:A344T;ENSP00000443286:A361T	ENSP00000261693:A398T	A	-	1	0	SCARB1	123845704	0.005000	0.15991	0.000000	0.03702	0.061000	0.15899	0.140000	0.16056	-0.432000	0.07297	-0.674000	0.03794	GCA	.		0.567	SCARB1-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000400165.1	NM_005505	
PUS1	80324	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	132426223	132426223	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr12:132426223G>A	ENST00000376649.3	+	5	1431	c.931G>A	c.(931-933)Gag>Aag	p.E311K	PUS1_ENST00000440818.2_Missense_Mutation_p.E283K|PUS1_ENST00000443358.2_Missense_Mutation_p.E283K|PUS1_ENST00000542167.2_Missense_Mutation_p.E258K|PUS1_ENST00000535067.1_Intron	NM_025215.5	NP_079491.2	Q9Y606	TRUA_HUMAN	pseudouridylate synthase 1	311					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|tRNA pseudouridine synthesis (GO:0031119)	mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|transcription factor complex (GO:0005667)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|poly(A) RNA binding (GO:0044822)|pseudouridine synthase activity (GO:0009982)|pseudouridylate synthase activity (GO:0004730)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|skin(1)	11	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.05e-08)|Epithelial(86;2.51e-07)|all cancers(50;2.94e-07)		TTATGCCCCTGAGAGCGTGCT	0.612																																					p.E311K	Esophageal Squamous(102;671 2009 17384 45666)	.											.	PUS1-577	0			c.G931A						.						118.0	118.0	118.0					12																	132426223		2203	4300	6503	SO:0001583	missense	80324	exon5			GCCCCTGAGAGCG	AF116238	CCDS9275.2, CCDS31928.1	12q24	2004-05-17			ENSG00000177192	ENSG00000177192			15508	protein-coding gene	gene with protein product		608109				10094309	Standard	NM_001002019		Approved		uc001ujf.3	Q9Y606	OTTHUMG00000128507	ENST00000376649.3:c.931G>A	12.37:g.132426223G>A	ENSP00000365837:p.Glu311Lys	Somatic	206	0		WXS	Illumina GAIIx	Phase_I	236	109	NM_025215	0	0	17	28	11	A8K877|B3KQC1|Q8WYT2|Q9BU44	Missense_Mutation	SNP	ENST00000376649.3	37	CCDS9275.2	.	.	.	.	.	.	.	.	.	.	G	11.01	1.513661	0.27123	.	.	ENSG00000177192	ENST00000443358;ENST00000376649;ENST00000322060;ENST00000440818;ENST00000542167	T;T;T;T;T	0.53423	0.62;0.62;0.62;0.62;0.62	5.17	4.21	0.49690	Pseudouridine synthase I, TruA, C-terminal (1);Pseudouridine synthase, catalytic domain (1);Pseudouridine synthase I, TruA, alpha/beta domain (1);	0.046289	0.85682	D	0.000000	T	0.28400	0.0702	N	0.20881	0.62	0.48901	D	0.999728	B;B	0.29341	0.203;0.242	B;B	0.29353	0.053;0.101	T	0.06679	-1.0813	10	0.10636	T	0.68	-7.7566	8.7727	0.34742	0.0795:0.1524:0.7682:0.0	.	258;311	F5H1S9;Q9Y606	.;TRUA_HUMAN	K	283;311;283;283;258	ENSP00000392451:E283K;ENSP00000365837:E311K;ENSP00000324726:E283K;ENSP00000400032:E283K;ENSP00000438948:E258K	ENSP00000324726:E283K	E	+	1	0	PUS1	130992176	1.000000	0.71417	0.381000	0.26106	0.016000	0.09150	6.743000	0.74848	2.405000	0.81733	0.491000	0.48974	GAG	.		0.612	PUS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250313.2	NM_025215	
MEDAG	84935	hgsc.bcm.edu	37	13	31480827	31480827	+	Missense_Mutation	SNP	A	A	G	rs9531945	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr13:31480827A>G	ENST00000380482.4	+	1	500	c.175A>G	c.(175-177)Agg>Ggg	p.R59G	TEX26-AS1_ENST00000590344.1_RNA|TEX26-AS1_ENST00000590721.1_RNA|TEX26-AS1_ENST00000593246.1_RNA|TEX26-AS1_ENST00000588726.1_RNA|TEX26-AS1_ENST00000592950.1_RNA|TEX26-AS1_ENST00000585870.1_RNA	NM_032849.3	NP_116238	Q5VYS4	MEDAG_HUMAN	mesenteric estrogen-dependent adipogenesis	59			R -> G (in dbSNP:rs9531945). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		positive regulation of fat cell differentiation (GO:0045600)	cytoplasm (GO:0005737)											CGTGGTGGCCAggcccgggga	0.726													G|||	4890	0.976438	0.913	0.9957	5008	,	,		11722	1.0		1.0	False		,,,				2504	1.0				p.R59G		.											.	.	0			c.A175G						.	G	GLY/ARG	2883,187		1349,185,1	3.0	4.0	4.0		175	3.2	0.0	13	dbSNP_119	4	6648,4		3322,4,0	no	missense	C13orf33	NM_032849.3	125	4671,189,1	GG,GA,AA		0.0601,6.0912,1.9646	benign	59/304	31480827	9531,191	1535	3326	4861	SO:0001583	missense	84935	exon1			GTGGCCAGGCCCG	AB055407	CCDS9338.1	13q12.3	2013-10-11	2012-09-26	2012-09-26	ENSG00000102802	ENSG00000102802			25926	protein-coding gene	gene with protein product	"""mesenteric estrogen-dependent adipose 4"", ""activated in W/Wv mouse stomach 3 homolog"""		"""chromosome 13 open reading frame 33"""	C13orf33		22510272	Standard	NM_032849		Approved	FLJ14834, AWMS3, MEDA-4	uc001uth.4	Q5VYS4	OTTHUMG00000016679	ENST00000380482.4:c.175A>G	13.37:g.31480827A>G	ENSP00000369849:p.Arg59Gly	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_032849	0	0	0	0	0	Q8IXF1|Q96K26|Q96NC8	Missense_Mutation	SNP	ENST00000380482.4	37	CCDS9338.1	2123	0.9720695970695971	437	0.8882113821138211	361	0.9972375690607734	567	0.9912587412587412	758	1.0	G	0.006	-2.044123	0.00398	0.939088	0.999399	ENSG00000102802	ENST00000380482	T	0.40225	1.04	4.92	3.15	0.36227	.	0.260438	0.31495	N	0.007559	T	0.00012	0.0000	N	0.02539	-0.55	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.42616	-0.9441	9	0.02654	T	1	-3.5214	6.5331	0.22338	0.1691:0.1474:0.6836:0.0	rs9531945;rs17857210;rs57016010;rs9531945	59	Q5VYS4	CM033_HUMAN	G	59	ENSP00000369849:R59G	ENSP00000369849:R59G	R	+	1	2	C13orf33	30378827	0.386000	0.25180	0.001000	0.08648	0.005000	0.04900	2.086000	0.41643	0.132000	0.18615	-1.032000	0.02404	AGG	A|0.219;G|0.781		0.726	MEDAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044375.1	NM_032849	
POSTN	10631	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	38148740	38148740	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr13:38148740T>G	ENST00000379747.4	-	17	2175	c.2058A>C	c.(2056-2058)gaA>gaC	p.E686D	POSTN_ENST00000379743.4_Intron|POSTN_ENST00000541481.1_Intron|POSTN_ENST00000379742.4_Intron|POSTN_ENST00000379749.4_Missense_Mutation_p.E686D|POSTN_ENST00000541179.1_Intron	NM_006475.2	NP_006466.2	Q15063	POSTN_HUMAN	periostin, osteoblast specific factor	686					cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of Notch signaling pathway (GO:0008593)|skeletal system development (GO:0001501)|tissue development (GO:0009888)	proteinaceous extracellular matrix (GO:0005578)|trans-Golgi network (GO:0005802)	heparin binding (GO:0008201)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(16)|lung(22)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	59		Lung NSC(96;2.09e-05)|Prostate(109;0.0513)|Breast(139;0.0538)|Lung SC(185;0.0743)		all cancers(112;2.48e-08)|Epithelial(112;2.78e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000853)|BRCA - Breast invasive adenocarcinoma(63;0.013)|GBM - Glioblastoma multiforme(144;0.0154)		GAAGACTGCCTTCAATCACTT	0.284																																					p.E686D		.											.	POSTN-516	0			c.A2058C						.						65.0	62.0	63.0					13																	38148740		2199	4286	6485	SO:0001583	missense	10631	exon17			ACTGCCTTCAATC	D13665	CCDS9364.1, CCDS45034.1, CCDS53864.1, CCDS66530.1, CCDS66531.1	13q13.3	2008-02-05			ENSG00000133110	ENSG00000133110			16953	protein-coding gene	gene with protein product		608777				8363580, 12235007	Standard	NM_006475		Approved	OSF-2, PN, periostin	uc001uwo.4	Q15063	OTTHUMG00000016751	ENST00000379747.4:c.2058A>C	13.37:g.38148740T>G	ENSP00000369071:p.Glu686Asp	Somatic	39	0		WXS	Illumina GAIIx	Phase_I	33	20	NM_006475	0	0	0	0	0	B1ALD8|C0IMJ1|C0IMJ2|C0IMJ4|D2KRH7|F5H628|Q15064|Q29XZ0|Q3KPJ5|Q5VSY5|Q8IZF9	Missense_Mutation	SNP	ENST00000379747.4	37	CCDS9364.1	.	.	.	.	.	.	.	.	.	.	T	15.26	2.780184	0.49891	.	.	ENSG00000133110	ENST00000379749;ENST00000379747	D;D	0.91237	-2.81;-2.81	5.38	5.38	0.77491	.	0.147951	0.42053	D	0.000769	D	0.86802	0.6020	L	0.43152	1.355	0.80722	D	1	B	0.19445	0.036	B	0.22152	0.038	T	0.82627	-0.0364	10	0.29301	T	0.29	-13.5129	13.9217	0.63935	0.0:0.0:0.0:1.0	.	686	Q15063	POSTN_HUMAN	D	686	ENSP00000369073:E686D;ENSP00000369071:E686D	ENSP00000369071:E686D	E	-	3	2	POSTN	37046740	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	3.709000	0.54853	2.144000	0.66660	0.528000	0.53228	GAA	.		0.284	POSTN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044566.2	NM_006475	
DLEU7	220107	hgsc.bcm.edu	37	13	51417535	51417535	+	Missense_Mutation	SNP	G	G	A	rs898861	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr13:51417535G>A	ENST00000504404.1	-	1	297	c.248C>T	c.(247-249)gCg>gTg	p.A83V	DLEU7-AS1_ENST00000413510.2_RNA|DLEU7_ENST00000400393.3_Missense_Mutation_p.A83V			Q6UYE1	LEU7_HUMAN	deleted in lymphocytic leukemia, 7	83			A -> V (in dbSNP:rs898861). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.										Acute lymphoblastic leukemia(7;1.03e-07)|Lung NSC(96;0.000818)|Breast(56;0.00122)|Prostate(109;0.0047)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;3.25e-08)		TGGGGAGTTCGCCCGCGCCGC	0.811													G|||	885	0.176717	0.0968	0.1888	5008	,	,		8444	0.2917		0.1988	False		,,,				2504	0.135				p.A83V		.											.	.	0			c.C248T						.	G	VAL/ALA	212,2568		7,198,1185	2.0	3.0	3.0		248	1.8	0.0	13	dbSNP_86	3	970,5336		43,884,2226	yes	missense	DLEU7	NM_198989.2	64	50,1082,3411	AA,AG,GG		15.3822,7.6259,13.009	possibly-damaging	83/161	51417535	1182,7904	1390	3153	4543	SO:0001583	missense	220107	exon1			GAGTTCGCCCGCG	AK126830	CCDS53869.1	13q14.3	2005-02-22			ENSG00000186047	ENSG00000186047			17567	protein-coding gene	gene with protein product						14706829	Standard	NM_198989		Approved	FLJ44882	uc001vex.2	Q6UYE1	OTTHUMG00000016936	ENST00000504404.1:c.248C>T	13.37:g.51417535G>A	ENSP00000427177:p.Ala83Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	6	NM_198989	0	0	0	0	0	Q2M2E4|Q6ZT82	Missense_Mutation	SNP	ENST00000504404.1	37		458	0.2097069597069597	57	0.11585365853658537	67	0.1850828729281768	188	0.32867132867132864	146	0.19261213720316622	G	11.22	1.574237	0.28092	0.076259	0.153822	ENSG00000186047	ENST00000400393;ENST00000504404;ENST00000335465	T;T	0.49139	0.79;0.82	2.72	1.81	0.25067	.	0.342483	0.19746	U	0.107012	T	0.00012	0.0000	L	0.34521	1.04	0.80722	P	0.0	B;B	0.28026	0.198;0.198	B;B	0.25506	0.061;0.061	T	0.32587	-0.9901	9	0.07175	T	0.84	.	5.0335	0.14423	0.0:0.2383:0.5179:0.2437	rs898861;rs12869977	83;83	Q6UYE1;Q6UYE1-2	LEU7_HUMAN;.	V	83;83;36	ENSP00000420976:A83V;ENSP00000427177:A83V	ENSP00000439677:A36V	A	-	2	0	DLEU7	50315536	0.000000	0.05858	0.004000	0.12327	0.001000	0.01503	0.065000	0.14466	0.650000	0.30769	0.491000	0.48974	GCG	G|0.789;A|0.211		0.811	DLEU7-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000045005.2	NM_198989	
IRS2	8660	hgsc.bcm.edu	37	13	110435728	110435728	+	Silent	SNP	C	C	G	rs75172981	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr13:110435728C>G	ENST00000375856.3	-	1	3187	c.2673G>C	c.(2671-2673)acG>acC	p.T891T		NM_003749.2	NP_003740.2	Q9Y4H2	IRS2_HUMAN	insulin receptor substrate 2	891					brain development (GO:0007420)|cell proliferation (GO:0008283)|cellular response to glucose stimulus (GO:0071333)|cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipid homeostasis (GO:0055088)|mammary gland development (GO:0030879)|negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of kinase activity (GO:0033673)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin secretion (GO:0032024)|positive regulation of mesenchymal cell proliferation (GO:0002053)|regulation of lipid metabolic process (GO:0019216)|response to glucose (GO:0009749)|signal transduction (GO:0007165)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)			kidney(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	19	all_cancers(4;7.57e-15)|all_epithelial(4;5.91e-09)|all_lung(23;7.64e-07)|Lung NSC(43;0.000183)|Colorectal(4;0.00159)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0155)	Breast(118;0.159)	all cancers(43;0.00815)|BRCA - Breast invasive adenocarcinoma(86;0.11)|Epithelial(84;0.127)|GBM - Glioblastoma multiforme(44;0.147)			GGGACAGGCGCGTGGGCCTCA	0.721													.|||	135	0.0269569	0.0023	0.0663	5008	,	,		7040	0.0367		0.0278	False		,,,				2504	0.0215				p.T891T	Melanoma(100;613 2409 40847)	.											.	IRS2-1334	0			c.G2673C						.	C		15,4041		0,15,2013	4.0	5.0	4.0		2673	-1.7	1.0	13	dbSNP_131	4	205,7881		2,201,3840	no	coding-synonymous	IRS2	NM_003749.2		2,216,5853	GG,GC,CC		2.5352,0.3698,1.8119		891/1339	110435728	220,11922	2028	4043	6071	SO:0001819	synonymous_variant	8660	exon1			CAGGCGCGTGGGC	AB000732	CCDS9510.1	13q34	2013-01-10			ENSG00000185950	ENSG00000185950		"""Pleckstrin homology (PH) domain containing"""	6126	protein-coding gene	gene with protein product		600797				9312143	Standard	NM_003749		Approved		uc001vqv.3	Q9Y4H2	OTTHUMG00000017338	ENST00000375856.3:c.2673G>C	13.37:g.110435728C>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	6	NM_003749	0	0	1	2	1	Q96RR2|Q9BZG0|Q9Y6I5	Silent	SNP	ENST00000375856.3	37	CCDS9510.1																																																																																			C|0.970;G|0.030		0.721	IRS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045755.1	NM_003749	
ING1	3621	hgsc.bcm.edu	37	13	111368316	111368316	+	Silent	SNP	C	C	T	rs9555726	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr13:111368316C>T	ENST00000375774.3	+	1	988	c.526C>T	c.(526-528)Ctg>Ttg	p.L176L	ING1_ENST00000464141.1_Intron|CARS2_ENST00000535398.1_5'Flank|ING1_ENST00000333219.7_Intron|ING1_ENST00000375775.3_Intron|ING1_ENST00000338450.7_Intron	NM_005537.4	NP_005528.3	Q9UK53	ING1_HUMAN	inhibitor of growth family, member 1	176					cell cycle (GO:0007049)|chromatin modification (GO:0016568)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell death (GO:0010941)	nucleus (GO:0005634)	methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(6)|lung(1)|ovary(1)	12	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.188)			GGCCGCATCTCTGCTGACCCG	0.706													C|||	2912	0.58147	0.23	0.6816	5008	,	,		11066	0.7252		0.6909	False		,,,				2504	0.7249				p.L176L		.											.	ING1-515	0			c.C526T						.	C	,,,	1347,2085		295,757,664	14.0	24.0	21.0		526,,,	-5.6	0.0	13	dbSNP_119	21	5238,1736		2020,1198,269	no	coding-synonymous,intron,intron,intron	ING1	NM_005537.3,NM_198217.1,NM_198218.1,NM_198219.1	,,,	2315,1955,933	TT,TC,CC		24.8925,39.2483,36.7192	,,,	176/423,,,	111368316	6585,3821	1716	3487	5203	SO:0001819	synonymous_variant	3621	exon1			GCATCTCTGCTGA		CCDS9515.1, CCDS9516.1, CCDS9517.1, CCDS9518.1	13q34	2013-01-28			ENSG00000153487	ENSG00000153487		"""Zinc fingers, PHD-type"""	6062	protein-coding gene	gene with protein product	"""inhibitor of growth 1"", ""tumor suppressor ING1"", ""growth inhibitor ING1"", ""growth inhibitory protein ING1"""	601566				8944021, 9186514	Standard	NM_198219		Approved	p33ING1, p33ING1b, p24ING1c, p33, p47, p47ING1a	uc001vri.3	Q9UK53	OTTHUMG00000017346	ENST00000375774.3:c.526C>T	13.37:g.111368316C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	11	6	NM_005537	0	0	2	2	0	O00532|O43658|Q53ZR3|Q5T9G8|Q5T9G9|Q5T9H0|Q5T9H1|Q9H007|Q9HD98|Q9HD99|Q9NS83|Q9P0U6|Q9UBC6|Q9UIJ1|Q9UIJ2|Q9UIJ3|Q9UIJ4|Q9UK52	Silent	SNP	ENST00000375774.3	37	CCDS9517.1																																																																																			C|0.372;T|0.628		0.706	ING1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000045770.2	NM_005537	
UPF3A	65110	broad.mit.edu	37	13	115047559	115047559	+	Silent	SNP	C	C	T			TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr13:115047559C>T	ENST00000375299.3	+	2	327	c.271C>T	c.(271-273)Ctg>Ttg	p.L91L	UPF3A_ENST00000351487.5_Silent_p.L91L	NM_023011.3	NP_075387.1	Q9H1J1	REN3A_HUMAN	UPF3 regulator of nonsense transcripts homolog A (yeast)	91	Required for interaction with UPF2.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA transport (GO:0051028)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nucleocytoplasmic transport (GO:0006913)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.L91L(8)		autonomic_ganglia(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	16	Lung NSC(43;0.00299)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0191)|all_epithelial(44;0.00716)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.238)	BRCA - Breast invasive adenocarcinoma(86;0.0886)	OV - Ovarian serous cystadenocarcinoma(48;0.195)|Epithelial(10;0.2)		GCTGCGCCCGCTGCCAGCACA	0.731																																					p.L91L		.											.	UPF3A-91	8	Substitution - coding silent(8)	lung(2)|prostate(2)|kidney(2)|central_nervous_system(2)	c.C271T						.						4.0	4.0	4.0					13																	115047559		1902	3804	5706	SO:0001819	synonymous_variant	65110	exon2			CGCCCGCTGCCAG	AF318575	CCDS9543.1, CCDS9544.1	13q34	2010-04-30			ENSG00000169062	ENSG00000169062			20332	protein-coding gene	gene with protein product		605530				11113196, 11163187	Standard	NM_023011		Approved	RENT3A, UPF3, HUPF3A	uc001vup.3	Q9H1J1	OTTHUMG00000017403	ENST00000375299.3:c.271C>T	13.37:g.115047559C>T		Somatic	27	0		WXS	Illumina GAIIx	Phase_I	89	8	NM_080687	0	0	12	12	0	A2A366|Q5T8C3|Q5T8C9|Q7Z6N3|Q86YK1|Q9BZI8	Silent	SNP	ENST00000375299.3	37	CCDS9543.1																																																																																			.		0.731	UPF3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045968.2		
ARHGEF40	55701	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	21544607	21544607	+	Nonsense_Mutation	SNP	C	C	T			TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr14:21544607C>T	ENST00000298694.4	+	6	1955	c.1828C>T	c.(1828-1830)Caa>Taa	p.Q610*	ARHGEF40_ENST00000298693.3_Nonsense_Mutation_p.Q610*			Q8TER5	ARH40_HUMAN	Rho guanine nucleotide exchange factor (GEF) 40	610						cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			large_intestine(4)|ovary(3)|upper_aerodigestive_tract(2)	9						TGCCTTGAGCCAACTTCAGGT	0.582																																					p.Q610X		.											.	ARHGEF40-228	0			c.C1828T						.						71.0	63.0	65.0					14																	21544607		2203	4300	6503	SO:0001587	stop_gained	55701	exon6			TTGAGCCAACTTC		CCDS32041.1	14q11.2	2012-07-24			ENSG00000165801	ENSG00000165801		"""Rho guanine nucleotide exchange factors"""	25516	protein-coding gene	gene with protein product		610018				16143467	Standard	NM_001278529		Approved	solo, FLJ10357	uc001vzp.3	Q8TER5		ENST00000298694.4:c.1828C>T	14.37:g.21544607C>T	ENSP00000298694:p.Gln610*	Somatic	72	0		WXS	Illumina GAIIx	Phase_I	79	33	NM_018071	0	0	0	0	0	A5PL07|Q9BWP5|Q9H7L6|Q9NTF9|Q9NW24	Nonsense_Mutation	SNP	ENST00000298694.4	37	CCDS32041.1	.	.	.	.	.	.	.	.	.	.	C	36	5.897820	0.97081	.	.	ENSG00000165801	ENST00000298694;ENST00000298693	.	.	.	5.52	4.61	0.57282	.	0.308254	0.23532	N	0.047168	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05959	T	0.93	.	10.8547	0.46792	0.0:0.7545:0.2455:0.0	.	.	.	.	X	610	.	ENSP00000298693:Q610X	Q	+	1	0	ARHGEF40	20614447	0.998000	0.40836	1.000000	0.80357	0.632000	0.37999	1.102000	0.31050	2.599000	0.87857	0.561000	0.74099	CAA	.		0.582	ARHGEF40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413122.1		
SYNE3	161176	broad.mit.edu	37	14	95923568	95923568	+	Silent	SNP	G	G	T			TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr14:95923568G>T	ENST00000334258.5	-	4	749	c.735C>A	c.(733-735)ggC>ggA	p.G245G	SYNE3_ENST00000557275.1_Silent_p.G245G|SYNE3_ENST00000554873.1_5'Flank|SYNE3_ENST00000553340.1_Silent_p.G245G	NM_152592.3	NP_689805.3	Q6ZMZ3	SYNE3_HUMAN	spectrin repeat containing, nuclear envelope family member 3	245					cytoskeletal anchoring at nuclear membrane (GO:0090286)|cytoskeleton organization (GO:0007010)|establishment of protein localization to membrane (GO:0090150)|regulation of cell shape (GO:0008360)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear outer membrane (GO:0005640)|SUN-KASH complex (GO:0034993)	actin filament binding (GO:0051015)			breast(1)|endometrium(2)|lung(25)	28						GCCCCAGGCAGCCATTCACCT	0.612																																					p.G245G		.											.	.	0			c.C735A						.						178.0	134.0	149.0					14																	95923568		2203	4300	6503	SO:0001819	synonymous_variant	161176	exon4			CAGGCAGCCATTC	AK098471	CCDS9935.1	14q32.13	2012-05-31	2012-05-31	2012-05-31	ENSG00000176438	ENSG00000176438			19861	protein-coding gene	gene with protein product		610861	"""chromosome 14 open reading frame 49"""	C14orf49			Standard	NM_152592		Approved	FLJ25605, NET53, Nesprin-3, Nesp3	uc001yei.4	Q6ZMZ3	OTTHUMG00000171632	ENST00000334258.5:c.735C>A	14.37:g.95923568G>T		Somatic	171	2		WXS	Illumina GAIIx	Phase_I	193	9	NM_152592	0	0	0	0	0	A6H8H3|Q86SX5|Q8N7G8	Silent	SNP	ENST00000334258.5	37	CCDS9935.1																																																																																			.		0.612	SYNE3-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420529.2	NM_152592	
HHIPL1	84439	hgsc.bcm.edu	37	14	100141689	100141689	+	Missense_Mutation	SNP	T	T	C	rs7158073	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr14:100141689T>C	ENST00000330710.5	+	9	2173	c.2075T>C	c.(2074-2076)gTg>gCg	p.V692A		NM_001127258.1	NP_001120730.1	Q96JK4	HIPL1_HUMAN	HHIP-like 1	692	SRCR. {ECO:0000255|PROSITE- ProRule:PRU00196}.		V -> A (in dbSNP:rs7158073).		carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)|membrane (GO:0016020)	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)|scavenger receptor activity (GO:0005044)			breast(1)|endometrium(2)|large_intestine(2)|lung(8)|skin(2)	15		Melanoma(154;0.128)				GAGGTGTTCGTGGGCGGACGC	0.746													T|||	2585	0.516174	0.3933	0.536	5008	,	,		7828	0.6131		0.5676	False		,,,				2504	0.5153				p.V692A		.											.	HHIPL1-70	0			c.T2075C						.	T	ALA/VAL	503,863		120,263,300	7.0	9.0	8.0		2075	-3.8	0.0	14	dbSNP_116	8	1711,1441		496,719,361	no	missense	HHIPL1	NM_001127258.1	64	616,982,661	CC,CT,TT		45.717,36.8228,49.004	benign	692/783	100141689	2214,2304	683	1576	2259	SO:0001583	missense	84439	exon9			TGTTCGTGGGCGG	AB058725	CCDS9953.1, CCDS45162.1	14q32	2008-01-16	2008-01-16	2008-01-16		ENSG00000182218			19710	protein-coding gene	gene with protein product			"""KIAA1822"""	KIAA1822			Standard	NM_032425		Approved		uc010avs.3	Q96JK4		ENST00000330710.5:c.2075T>C	14.37:g.100141689T>C	ENSP00000330601:p.Val692Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	15	15	NM_001127258	0	0	0	0	0	A2RUF8|B2RN09|Q6UXX2	Missense_Mutation	SNP	ENST00000330710.5	37	CCDS45162.1	1146	0.5247252747252747	201	0.40853658536585363	196	0.5414364640883977	347	0.6066433566433567	402	0.5303430079155673	T	4.106	0.017676	0.07959	0.368228	0.54283	ENSG00000182218	ENST00000330710	T	0.28895	1.59	4.74	-3.78	0.04333	Speract/scavenger receptor (3);Speract/scavenger receptor-related (2);	.	.	.	.	T	0.00012	0.0000	N	0.17872	0.535	0.80722	P	0.0	B	0.02656	0.0	B	0.08055	0.003	T	0.47459	-0.9116	8	0.16420	T	0.52	.	1.8306	0.03130	0.1251:0.2661:0.1277:0.4811	rs7158073;rs57071746;rs7158073	692	Q96JK4	HIPL1_HUMAN	A	692	ENSP00000330601:V692A	ENSP00000330601:V692A	V	+	2	0	HHIPL1	99211442	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.153000	0.16323	-0.525000	0.06391	-0.468000	0.05107	GTG	T|0.478;C|0.522		0.746	HHIPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413811.1	XM_041566	
CKB	1152	hgsc.bcm.edu	37	14	103988180	103988180	+	Silent	SNP	G	G	T	rs1136165	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr14:103988180G>T	ENST00000348956.2	-	4	813	c.456C>A	c.(454-456)cgC>cgA	p.R152R		NM_001823.4	NP_001814.2	P12277	KCRB_HUMAN	creatine kinase, brain	152	Phosphagen kinase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00843}.				cellular chloride ion homeostasis (GO:0030644)|cellular nitrogen compound metabolic process (GO:0034641)|creatine metabolic process (GO:0006600)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|creatine kinase activity (GO:0004111)			lung(2)|prostate(1)	3		Melanoma(154;0.155)	Epithelial(46;0.14)		Creatine(DB00148)	TCTCGATGGCGCGGCGCTCCC	0.756													G|||	3294	0.657748	0.5416	0.7349	5008	,	,		7060	0.8264		0.6233	False		,,,				2504	0.6217				p.R152R	Esophageal Squamous(186;2492 2823 49929 50127)	.											.	CKB-115	0			c.C456A						.	G		1738,1164		574,590,287	3.0	4.0	3.0		456	-0.0	1.0	14	dbSNP_86	3	4002,2154		1387,1228,463	no	coding-synonymous	CKB	NM_001823.3		1961,1818,750	TT,TG,GG		34.9903,40.1103,36.6306		152/382	103988180	5740,3318	1451	3078	4529	SO:0001819	synonymous_variant	1152	exon4			GATGGCGCGGCGC		CCDS9981.1	14q32.32	2012-10-02			ENSG00000166165	ENSG00000166165	2.7.3.2		1991	protein-coding gene	gene with protein product		123280		CKBB			Standard	NM_001823		Approved		uc001ynf.2	P12277	OTTHUMG00000171786	ENST00000348956.2:c.456C>A	14.37:g.103988180G>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_001823	0	0	8	25	17	A8K236|B2R5R4|Q2LE07|Q6FG40|Q9UC66	Silent	SNP	ENST00000348956.2	37	CCDS9981.1	1462	0.6694139194139194	285	0.5792682926829268	250	0.6906077348066298	460	0.8041958041958042	467	0.6160949868073878	G	13.11	2.138272	0.37728	0.598897	0.650097	ENSG00000166165	ENST00000428256	.	.	.	4.64	-0.0349	0.13894	.	0.000000	0.85682	D	0.000000	T	0.00012	0.0000	.	.	.	0.09310	P	0.9999999999999624	.	.	.	.	.	.	T	0.17592	-1.0364	5	0.41790	T	0.15	-18.9304	4.9837	0.14180	0.3841:0.2745:0.3414:0.0	rs1136165;rs2227867;rs2765044;rs3179077;rs3199393;rs17366340;rs17423634;rs17849441;rs17850309;rs17850603;rs17851735;rs17851741;rs17857802	.	.	.	S	118	.	ENSP00000395515:R118S	R	-	1	0	CKB	103057933	0.001000	0.12720	0.999000	0.59377	0.996000	0.88848	-2.081000	0.01367	0.066000	0.16515	0.449000	0.29647	CGC	G|0.327;T|0.673		0.756	CKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415111.1		
SPTBN5	51332	ucsc.edu;bcgsc.ca	37	15	42173312	42173312	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr15:42173312G>C	ENST00000320955.6	-	13	2805	c.2578C>G	c.(2578-2580)Cct>Gct	p.P860A		NM_016642.2	NP_057726.4	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	860					actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi organization (GO:0007030)|lysosomal transport (GO:0007041)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|photoreceptor disc membrane (GO:0097381)|spectrin (GO:0008091)	actin binding (GO:0003779)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|kinesin binding (GO:0019894)|myosin tail binding (GO:0032029)|protein self-association (GO:0043621)|spectrin binding (GO:0030507)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(6)|lung(18)|ovary(5)|prostate(8)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	62		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		TCAAAGTCAGGGTCAGGCTCA	0.577																																					p.P825A		.											.	SPTBN5-91	0			c.C2473G						.						60.0	65.0	63.0					15																	42173312		2034	4192	6226	SO:0001583	missense	51332	exon13			AGTCAGGGTCAGG	AF233523	CCDS61599.1	15q21	2010-08-17			ENSG00000137877	ENSG00000137877			15680	protein-coding gene	gene with protein product	"""beta V spectrin"""	605916				10764729	Standard	NM_016642		Approved	HUSPECV, BSPECV, HUBSPECV	uc001zos.4	Q9NRC6		ENST00000320955.6:c.2578C>G	15.37:g.42173312G>C	ENSP00000317790:p.Pro860Ala	Somatic	167	3		WXS	Illumina GAIIx	Phase_I	218	102	NM_016642	0	0	0	0	0		Missense_Mutation	SNP	ENST00000320955.6	37		.	.	.	.	.	.	.	.	.	.	.	7.462	0.644953	0.14451	.	.	ENSG00000137877	ENST00000320955	T	0.71698	-0.59	4.73	0.605	0.17553	.	0.634319	0.14520	N	0.314535	T	0.46483	0.1395	L	0.32530	0.975	0.09310	N	1	B	0.34015	0.435	B	0.24974	0.057	T	0.33954	-0.9848	10	0.07482	T	0.82	.	5.0453	0.14480	0.1894:0.3305:0.4801:0.0	.	860	Q9NRC6	SPTN5_HUMAN	A	860	ENSP00000317790:P860A	ENSP00000317790:P860A	P	-	1	0	SPTBN5	39960604	0.127000	0.22367	0.009000	0.14445	0.023000	0.10783	0.139000	0.16036	-0.166000	0.10890	-0.379000	0.06801	CCT	.		0.577	SPTBN5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000420237.1	NM_016642	
LACTB	114294	hgsc.bcm.edu	37	15	63414083	63414083	+	Missense_Mutation	SNP	A	A	C	rs34317102	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr15:63414083A>C	ENST00000261893.4	+	1	85	c.13A>C	c.(13-15)Atg>Ctg	p.M5L	LACTB_ENST00000413507.2_Missense_Mutation_p.M5L	NM_032857.3	NP_116246.2	P83111	LACTB_HUMAN	lactamase, beta	5				M -> L (in Ref. 1 and 2). {ECO:0000305}.		cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	hydrolase activity (GO:0016787)			NS(1)|breast(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)|stomach(1)	12						GTACCGGCTCATGTCAGCAGT	0.751													C|||	3981	0.794928	0.6725	0.8256	5008	,	,		8367	0.997		0.7316	False		,,,				2504	0.7955				p.M5L	Melanoma(85;443 1381 6215 27308 35583)	.											.	LACTB-90	0			c.A13C						.	C	LEU/MET,LEU/MET	1936,668		733,470,99	4.0	4.0	4.0		13,13	3.1	1.0	15	dbSNP_126	4	4375,1183		1737,901,141	yes	missense,missense	LACTB	NM_032857.3,NM_171846.2	15,15	2470,1371,240	CC,CA,AA		21.2846,25.6528,22.6783	benign,benign	5/548,5/374	63414083	6311,1851	1302	2779	4081	SO:0001583	missense	114294	exon1			CGGCTCATGTCAG	AK027808	CCDS10182.1, CCDS45275.1	15q22.1	2012-11-14	2001-12-12	2001-12-14	ENSG00000103642	ENSG00000103642		"""Mitochondrial ribosomal proteins / large subunits"""	16468	protein-coding gene	gene with protein product		608440	"""mitochondrial ribosomal protein L56"""	MRPL56		11707067	Standard	NM_032857		Approved	FLJ14902	uc002alw.3	P83111	OTTHUMG00000132807	ENST00000261893.4:c.13A>C	15.37:g.63414083A>C	ENSP00000261893:p.Met5Leu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	17	4	NM_171846	0	0	1	2	1	P83096	Missense_Mutation	SNP	ENST00000261893.4	37	CCDS10182.1	1713	0.7843406593406593	304	0.6178861788617886	287	0.7928176795580111	568	0.993006993006993	554	0.7308707124010554	C	0.674	-0.800779	0.02841	0.743472	0.787154	ENSG00000103642	ENST00000261893;ENST00000413507	T	0.33216	1.42	3.1	3.1	0.35709	.	0.592824	0.14749	N	0.300689	T	0.00012	0.0000	N	0.02539	-0.55	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.37842	-0.9688	9	0.02654	T	1	0.0321	7.626	0.28212	0.2541:0.7459:0.0:0.0	rs34317102	5	P83111	LACTB_HUMAN	L	5	ENSP00000261893:M5L	ENSP00000261893:M5L	M	+	1	0	LACTB	61201136	0.994000	0.37717	0.956000	0.39512	0.117000	0.20001	0.346000	0.19997	0.640000	0.30582	-0.677000	0.03784	ATG	A|0.226;C|0.774		0.751	LACTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256224.1	NM_032857	
KBTBD13	390594	hgsc.bcm.edu	37	15	65369365	65369365	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr15:65369365C>T	ENST00000432196.2	+	1	212	c.212C>T	c.(211-213)gCg>gTg	p.A71V	RASL12_ENST00000434605.2_5'Flank	NM_001101362.2	NP_001094832.1	C9JR72	KBTBD_HUMAN	kelch repeat and BTB (POZ) domain containing 13	71	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				lung(1)|prostate(1)|skin(1)	3						GACCGGCCGGCGCTGGCGGCG	0.741																																					p.A71V		.											.	.	0			c.C212T						.						2.0	2.0	2.0					15																	65369365		1198	2806	4004	SO:0001583	missense	390594	exon1			GGCCGGCGCTGGC		CCDS45281.1	15q22.31	2014-09-17			ENSG00000234438	ENSG00000234438		"""BTB/POZ domain containing"""	37227	protein-coding gene	gene with protein product	"""nemaline myopathy type 6"""	613727				21109227, 22542517	Standard	NM_001101362		Approved	hCG_1645727, NEM6	uc010uis.2	C9JR72		ENST00000432196.2:c.212C>T	15.37:g.65369365C>T	ENSP00000388723:p.Ala71Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	4	NM_001101362	0	0	0	0	0		Missense_Mutation	SNP	ENST00000432196.2	37	CCDS45281.1	.	.	.	.	.	.	.	.	.	.	C	8.061	0.768187	0.15983	.	.	ENSG00000234438	ENST00000432196	T	0.67698	-0.28	4.6	3.66	0.41972	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	.	.	.	.	T	0.44030	0.1274	N	0.15975	0.35	0.09310	N	0.999998	B	0.29531	0.247	B	0.26770	0.073	T	0.24012	-1.0172	9	0.30078	T	0.28	.	5.069	0.14596	0.1753:0.6574:0.0:0.1673	.	71	C9JR72	KBTBD_HUMAN	V	71	ENSP00000388723:A71V	ENSP00000388723:A71V	A	+	2	0	KBTBD13	63156418	0.003000	0.15002	0.971000	0.41717	0.448000	0.32197	1.032000	0.30178	1.124000	0.41980	0.650000	0.86243	GCG	.		0.741	KBTBD13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418468.2	NM_001101362	
ARRDC4	91947	hgsc.bcm.edu	37	15	98504326	98504326	+	Missense_Mutation	SNP	A	A	G	rs12101554	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr15:98504326A>G	ENST00000268042.6	+	1	399	c.235A>G	c.(235-237)Acc>Gcc	p.T79A	ARRDC4_ENST00000538249.1_Intron	NM_183376.2	NP_899232.2	Q8NCT1	ARRD4_HUMAN	arrestin domain containing 4	79			T -> A (in dbSNP:rs12101554). {ECO:0000269|PubMed:15489334}.		positive regulation of ubiquitin-protein transferase activity (GO:0051443)	endosome (GO:0005768)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|skin(3)	16	Melanoma(26;0.00539)|Lung NSC(78;0.0125)|all_lung(78;0.0222)		OV - Ovarian serous cystadenocarcinoma(32;0.0417)			CTCGGCCAGCACCGCGGCCCT	0.786													g|||	3817	0.762181	0.5976	0.7118	5008	,	,		7745	0.88		0.7485	False		,,,				2504	0.9131				p.T79A		.											.	ARRDC4-90	0			c.A235G						.		ALA/THR	934,448		327,280,84	1.0	1.0	1.0		235	0.8	0.0	15	dbSNP_120	1	2287,687		920,447,120	no	missense	ARRDC4	NM_183376.2	58	1247,727,204	GG,GA,AA		23.1002,32.4168,26.056	benign	79/419	98504326	3221,1135	691	1487	2178	SO:0001583	missense	91947	exon1			GCCAGCACCGCGG	BC028704	CCDS10377.1	15q26.2	2005-08-16			ENSG00000140450	ENSG00000140450			28087	protein-coding gene	gene with protein product						12477932	Standard	NM_183376		Approved	FLJ36045	uc010bom.3	Q8NCT1	OTTHUMG00000149849	ENST00000268042.6:c.235A>G	15.37:g.98504326A>G	ENSP00000268042:p.Thr79Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	12	12	NM_183376	0	0	0	1	1	Q6NSI9	Missense_Mutation	SNP	ENST00000268042.6	37	CCDS10377.1	1613	0.7385531135531136	289	0.5873983739837398	255	0.7044198895027625	512	0.8951048951048951	557	0.7348284960422163	g	3.442	-0.113882	0.06881	0.675832	0.768998	ENSG00000140450	ENST00000268042	T	0.07567	3.18	4.08	0.777	0.18538	Immunoglobulin E-set (1);Arrestin-like, N-terminal (1);	.	.	.	.	T	0.00012	0.0000	N	0.19112	0.55	0.46222	P	0.0010670000000000401	B	0.02656	0.0	B	0.01281	0.0	T	0.39522	-0.9610	8	0.02654	T	1	-4.3851	2.5111	0.04657	0.2812:0.0:0.3307:0.3881	rs12101554;rs17845860;rs17858835;rs57152335	79	Q8NCT1	ARRD4_HUMAN	A	79	ENSP00000268042:T79A	ENSP00000268042:T79A	T	+	1	0	ARRDC4	96305330	0.005000	0.15991	0.001000	0.08648	0.003000	0.03518	-0.193000	0.09573	0.288000	0.22398	-0.370000	0.07254	ACC	A|0.263;G|0.737		0.786	ARRDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313535.1	NM_183376	
EME2	197342	hgsc.bcm.edu	37	16	1823444	1823444	+	Silent	SNP	C	C	G	rs761065	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr16:1823444C>G	ENST00000568449.1	+	1	237	c.216C>G	c.(214-216)gtC>gtG	p.V72V	NME3_ENST00000219302.3_5'Flank|NME3_ENST00000563498.1_5'Flank|EME2_ENST00000307394.7_Silent_p.V72V|MRPS34_ENST00000177742.3_5'Flank|MRPS34_ENST00000397375.2_5'Flank	NM_001257370.1	NP_001244299.1	A4GXA9	EME2_HUMAN	essential meiotic structure-specific endonuclease subunit 2	72					DNA recombination (GO:0006310)|DNA repair (GO:0006281)	nucleus (GO:0005634)	DNA binding (GO:0003677)|endonuclease activity (GO:0004519)			central_nervous_system(1)|kidney(2)|lung(5)|pancreas(1)	9						CGGAGCAGGTCCTGAAGCGCC	0.746								Direct reversal of damage;Homologous recombination					C|||	1683	0.336062	0.0915	0.4885	5008	,	,		9781	0.2808		0.5666	False		,,,				2504	0.3783				p.V72V		.											.	EME2-229	0			c.C216G						.	C		457,2833		68,321,1256	4.0	5.0	5.0		216	-5.9	0.0	16	dbSNP_86	5	3986,3362		1200,1586,888	no	coding-synonymous	EME2	NM_001010865.1		1268,1907,2144	GG,GC,CC		45.7539,13.8906,41.7654		72/445	1823444	4443,6195	1645	3674	5319	SO:0001819	synonymous_variant	197342	exon1			GCAGGTCCTGAAG	AK074080	CCDS58404.1	16p13.3	2013-07-03	2013-07-03			ENSG00000197774			27289	protein-coding gene	gene with protein product	"""SLX2 structure-specific endonuclease subunit homolog B (S. cerevisiae)"""	610886	"""essential meiotic endonuclease 1 homolog 2 (S. pombe)"""			12721304	Standard	NM_001257370		Approved	FLJ00151, SLX2B	uc010brw.1	A4GXA9		ENST00000568449.1:c.216C>G	16.37:g.1823444C>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	14	8	NM_001257370	0	0	0	0	0	Q8TEP2|Q96RY3	Silent	SNP	ENST00000568449.1	37	CCDS58404.1																																																																																			C|0.615;G|0.385		0.746	EME2-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000433185.2	NM_001010865	
CASKIN1	57524	hgsc.bcm.edu	37	16	2230855	2230855	+	Silent	SNP	C	C	T	rs560740767		TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr16:2230855C>T	ENST00000343516.6	-	18	2606	c.2514G>A	c.(2512-2514)caG>caA	p.Q838Q	CASKIN1_ENST00000564289.1_5'Flank	NM_020764.3	NP_065815.1	Q8WXD9	CSKI1_HUMAN	CASK interacting protein 1	838	Pro-rich.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|liver(1)|lung(7)|ovary(4)|prostate(5)|skin(3)	28						CCTCCACGGGCTGGGGCAGCA	0.766													C|||	1	0.000199681	0.0	0.0	5008	,	,		9699	0.0		0.001	False		,,,				2504	0.0				p.Q838Q		.											.	CASKIN1-92	0			c.G2514A						.						3.0	4.0	4.0					16																	2230855		1644	3609	5253	SO:0001819	synonymous_variant	57524	exon18			CACGGGCTGGGGC	AF451977	CCDS42103.1	16p13.3	2013-01-10				ENSG00000167971		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	20879	protein-coding gene	gene with protein product		612184				12040031	Standard	NM_020764		Approved	KIAA1306, ANKS5A	uc010bsg.1	Q8WXD9		ENST00000343516.6:c.2514G>A	16.37:g.2230855C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	12	8	NM_020764	0	0	0	0	0	Q9P2P0	Silent	SNP	ENST00000343516.6	37	CCDS42103.1																																																																																			.		0.766	CASKIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435055.1	NM_020764	
ZSCAN10	84891	hgsc.bcm.edu	37	16	3139879	3139879	+	Missense_Mutation	SNP	C	C	T	rs565330138		TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr16:3139879C>T	ENST00000252463.2	-	5	1478	c.1391G>A	c.(1390-1392)cGg>cAg	p.R464Q	ZSCAN10_ENST00000575108.1_Missense_Mutation_p.R125Q|ZSCAN10_ENST00000538082.2_Missense_Mutation_p.R382Q|RP11-473M20.9_ENST00000571404.1_lincRNA	NM_032805.1	NP_116194.1	Q96SZ4	ZSC10_HUMAN	zinc finger and SCAN domain containing 10	464					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(3)|endometrium(3)|kidney(1)|lung(8)|ovary(2)|prostate(1)|skin(4)|urinary_tract(1)	24						GAAGGGCCTCCGGTCGGAGTC	0.741													C|||	1	0.000199681	0.0	0.0	5008	,	,		14272	0.0		0.001	False		,,,				2504	0.0				p.R464Q		.											.	ZSCAN10-227	0			c.G1391A						.																																			SO:0001583	missense	84891	exon5			GGCCTCCGGTCGG	AA206569	CCDS10493.1, CCDS61813.1, CCDS61814.1	16p13.3	2013-01-08	2007-02-20	2007-02-20		ENSG00000130182		"""-"", ""Zinc fingers, C2H2-type"""	12997	protein-coding gene	gene with protein product			"""zinc finger protein 206"""	ZNF206		9653642	Standard	NM_032805		Approved		uc002ctv.1	Q96SZ4		ENST00000252463.2:c.1391G>A	16.37:g.3139879C>T	ENSP00000252463:p.Arg464Gln	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	23	11	NM_032805	0	0	0	0	0	B3KQD3|H0YFS6|Q1WWM2	Missense_Mutation	SNP	ENST00000252463.2	37	CCDS10493.1	.	.	.	.	.	.	.	.	.	.	C	5.592	0.293923	0.10567	.	.	ENSG00000130182	ENST00000538082;ENST00000252463	T	0.08008	3.14	5.34	-5.18	0.02840	.	1.545570	0.03859	N	0.273647	T	0.02929	0.0087	N	0.03154	-0.405	0.09310	N	1	B;B;B	0.31837	0.043;0.342;0.089	B;B;B	0.16722	0.009;0.016;0.003	T	0.40001	-0.9586	10	0.66056	D	0.02	-2.2059	4.5176	0.11943	0.3655:0.175:0.0:0.4594	.	125;397;464	Q96SZ4-2;Q1WWM2;Q96SZ4	.;.;ZSC10_HUMAN	Q	397;464	ENSP00000252463:R464Q	ENSP00000252463:R464Q	R	-	2	0	ZSCAN10	3079880	.	.	0.000000	0.03702	0.002000	0.02628	.	.	-0.504000	0.06577	-0.219000	0.12488	CGG	.		0.741	ZSCAN10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437124.2	NM_032805	
MEFV	4210	hgsc.bcm.edu	37	16	3304573	3304573	+	Silent	SNP	G	G	T	rs224223	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr16:3304573G>T	ENST00000219596.1	-	2	534	c.495C>A	c.(493-495)gcC>gcA	p.A165A	MEFV_ENST00000541159.1_Intron|MEFV_ENST00000339854.4_Intron|MEFV_ENST00000536379.1_Intron	NM_000243.2	NP_000234.1	O15553	MEFV_HUMAN	Mediterranean fever	165					inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of macrophage inflammatory protein 1 alpha production (GO:0071641)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity (GO:2001056)	cell projection (GO:0042995)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)	p.A165A(2)		NS(2)|biliary_tract(1)|breast(5)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(3)|prostate(1)|skin(6)	50						GGCCCTCCGAGGCCTTCTCTC	0.766													G|||	1935	0.386382	0.528	0.5965	5008	,	,		10896	0.1667		0.4732	False		,,,				2504	0.183				p.A165A		.											.	MEFV-228	2	Substitution - coding silent(2)	prostate(2)	c.C495A						.	G	,	2112,2188		580,952,618	7.0	7.0	7.0		495,	2.9	0.0	16	dbSNP_79	7	3826,4590		964,1898,1346	no	coding-synonymous,intron	MEFV	NM_000243.2,NM_001198536.1	,	1544,2850,1964	TT,TG,GG		45.461,49.1163,46.6971	,	165/782,	3304573	5938,6778	2150	4208	6358	SO:0001819	synonymous_variant	4210	exon2			CTCCGAGGCCTTC	AF018080	CCDS10498.1, CCDS55981.1	16p13.3	2014-09-17			ENSG00000103313	ENSG00000103313		"""Tripartite motif containing / Tripartite motif containing"""	6998	protein-coding gene	gene with protein product	"""pyrin"""	608107		MEF		9288094	Standard	NM_000243		Approved	FMF, TRIM20	uc002cun.1	O15553	OTTHUMG00000129324	ENST00000219596.1:c.495C>A	16.37:g.3304573G>T		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	11	7	NM_000243	0	0	0	0	0	D3DUC0|F5H0Q3|Q3MJ84|Q96PN4|Q96PN5	Silent	SNP	ENST00000219596.1	37	CCDS10498.1																																																																																			G|0.570;T|0.430		0.766	MEFV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251464.1	NM_000243	
NPIPB5	100132247	broad.mit.edu	37	16	22545865	22545865	+	Missense_Mutation	SNP	G	G	C	rs202011711	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr16:22545865G>C	ENST00000517539.1	+	8	1636	c.1561G>C	c.(1561-1563)Gcc>Ccc	p.A521P	NPIPB5_ENST00000415654.1_3'UTR|NPIPB5_ENST00000424340.1_Missense_Mutation_p.A521P			A8MRT5	NPIB5_HUMAN	nuclear pore complex interacting protein family, member B5	521	Pro-rich.					integral component of membrane (GO:0016021)											TCAGCTCACTGCCCTTCCACC	0.567																																					p.A521P		.											.	.	0			c.G1561C						.						15.0	10.0	11.0					16																	22545865		690	1587	2277	SO:0001583	missense	0	exon7			CTCACTGCCCTTC		CCDS45443.1	16p12.2	2013-06-11			ENSG00000243716	ENSG00000243716			37233	protein-coding gene	gene with protein product							Standard	NM_001135865		Approved			A8MRT5	OTTHUMG00000163573	ENST00000517539.1:c.1561G>C	16.37:g.22545865G>C	ENSP00000430633:p.Ala521Pro	Somatic	55	1		WXS	Illumina GAIIx	Phase_I	64	3	NM_001135865	1	0	23	1195	1171	B4DK13	Missense_Mutation	SNP	ENST00000517539.1	37	CCDS45443.1	.	.	.	.	.	.	.	.	.	.	.	0.575	-0.839534	0.02692	.	.	ENSG00000243716	ENST00000415833;ENST00000424340;ENST00000342168;ENST00000503072;ENST00000517539;ENST00000528249;ENST00000344223	T;T;T;T	0.18338	2.32;2.22;2.22;2.32	.	.	.	.	.	.	.	.	T	0.03136	0.0092	N	0.01352	-0.895	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.08055	0.001;0.003	T	0.28618	-1.0038	7	0.08381	T	0.77	.	.	.	.	.	521;521	F5GWX0;A8MRT5	.;K220L_HUMAN	P	521;521;521;399;521;521;502	ENSP00000445388:A521P;ENSP00000440703:A521P;ENSP00000430633:A521P;ENSP00000431553:A521P	ENSP00000441680:A521P	A	+	1	0	RP11-368J21.2	22453366	.	.	0.003000	0.11579	0.003000	0.03518	.	.	-2.321000	0.00641	-2.362000	0.00238	GCC	G|0.984;C|0.016		0.567	NPIPB5-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374343.2	NM_001135865	
IRX3	79191	hgsc.bcm.edu	37	16	54318528	54318528	+	Missense_Mutation	SNP	A	A	G	rs1450355	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr16:54318528A>G	ENST00000329734.3	-	2	1977	c.1265T>C	c.(1264-1266)cTg>cCg	p.L422P		NM_024336.2	NP_077312.2	P78415	IRX3_HUMAN	iroquois homeobox 3	422	Pro-rich.		L -> P (in dbSNP:rs1450355). {ECO:0000269|PubMed:15489334}.		mesoderm development (GO:0007498)|metanephros development (GO:0001656)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of neuron differentiation (GO:0045666)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)|transcription, DNA-templated (GO:0006351)	axon (GO:0030424)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|soft_tissue(1)|urinary_tract(1)	14						GAGCGGGTGCAGGCGGGGGCC	0.776													g|||	4851	0.96865	0.888	0.987	5008	,	,		8017	1.0		1.0	False		,,,				2504	1.0				p.L422P	GBM(143;1830 1866 4487 4646 37383)	.											.	IRX3-90	0			c.T1265C						.	T	PRO/LEU	1678,102		788,102,0	1.0	2.0	2.0		1265	2.5	1.0	16	dbSNP_88	2	4195,3		2096,3,0	no	missense	IRX3	NM_024336.2	98	2884,105,0	GG,GA,AA		0.0715,5.7303,1.7564	benign	422/502	54318528	5873,105	890	2099	2989	SO:0001583	missense	79191	exon2			GGGTGCAGGCGGG	U90308	CCDS10750.1	16q12.2	2011-06-20	2007-07-13		ENSG00000177508	ENSG00000177508		"""Homeoboxes / TALE class"""	14360	protein-coding gene	gene with protein product		612985					Standard	NM_024336		Approved	IRX-1	uc002eht.1	P78415	OTTHUMG00000133200	ENST00000329734.3:c.1265T>C	16.37:g.54318528A>G	ENSP00000331608:p.Leu422Pro	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	10	NM_024336	0	0	0	0	0	Q7Z4A4|Q7Z4A5|Q8IVC6	Missense_Mutation	SNP	ENST00000329734.3	37	CCDS10750.1	2108	0.9652014652014652	433	0.8800813008130082	354	0.9779005524861878	567	0.9912587412587412	754	0.9947229551451188	g	5.642	0.303067	0.10678	0.942697	0.999285	ENSG00000177508	ENST00000329734	T	0.54279	0.58	4.4	2.45	0.29901	.	0.652897	0.14990	N	0.286760	T	0.00012	0.0000	N	0.01352	-0.895	0.29914	P	0.82336	B	0.02656	0.0	B	0.01281	0.0	T	0.21861	-1.0233	9	0.33940	T	0.23	-4.0049	5.143	0.14969	0.1733:0.0:0.6627:0.164	rs1450355;rs17852160;rs60836119	422	P78415	IRX3_HUMAN	P	422	ENSP00000331608:L422P	ENSP00000331608:L422P	L	-	2	0	IRX3	52876029	1.000000	0.71417	0.984000	0.44739	0.000000	0.00434	1.455000	0.35190	0.155000	0.19261	-1.528000	0.00924	CTG	T|0.035;G|0.004		0.776	IRX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256910.2		
WWOX	51741	broad.mit.edu	37	16	78133685	78133685	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr16:78133685C>G	ENST00000566780.1	+	1	376	c.10C>G	c.(10-12)Ctg>Gtg	p.L4V	WWOX_ENST00000355860.3_Missense_Mutation_p.L4V|WWOX_ENST00000408984.3_Missense_Mutation_p.L4V|WWOX_ENST00000406884.2_Missense_Mutation_p.L4V|WWOX_ENST00000569818.1_Missense_Mutation_p.L4V|WWOX_ENST00000402655.2_Missense_Mutation_p.L4V|WWOX_ENST00000539474.2_Missense_Mutation_p.L4V	NM_016373.2	NP_057457.1	Q9NZC7	WWOX_HUMAN	WW domain containing oxidoreductase	4					cellular response to transforming growth factor beta stimulus (GO:0071560)|extrinsic apoptotic signaling pathway (GO:0097191)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of Wnt signaling pathway (GO:0030178)|osteoblast differentiation (GO:0001649)|oxidation-reduction process (GO:0055114)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal system morphogenesis (GO:0048705)|steroid metabolic process (GO:0008202)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	coenzyme binding (GO:0050662)|cofactor binding (GO:0048037)|enzyme binding (GO:0019899)|oxidoreductase activity (GO:0016491)|protein dimerization activity (GO:0046983)			large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)	7		all_cancers(2;1.97e-181)|all_epithelial(2;3.85e-160)|all_lung(2;2.03e-39)|Lung NSC(2;7.16e-35)|Colorectal(2;6.96e-21)|all_hematologic(2;1.13e-16)|Melanoma(2;5.16e-06)|all_neural(2;8.84e-06)|Renal(2;5.26e-05)|Medulloblastoma(2;0.00498)|Breast(2;0.00631)|Lung SC(2;0.0261)|Prostate(104;0.167)		UCEC - Uterine corpus endometrioid carcinoma (2;0.012)|Epithelial(1;2.65e-39)|all cancers(1;3.26e-34)|STAD - Stomach adenocarcinoma(1;5.1e-20)|COAD - Colon adenocarcinoma(1;1.04e-11)|Colorectal(1;3.4e-11)|OV - Ovarian serous cystadenocarcinoma(1;1.01e-10)|BRCA - Breast invasive adenocarcinoma(1;0.00196)|Kidney(780;0.232)		CATGGCAGCGCTGCGCTACGC	0.672											OREG0023952	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L4V		.											.	WWOX-90	0			c.C10G						.						15.0	18.0	17.0					16																	78133685		2157	4254	6411	SO:0001583	missense	51741	exon1			GCAGCGCTGCGCT	AF187015	CCDS42196.1, CCDS42197.1	16q23.3-q24.1	2012-08-15	2002-01-14		ENSG00000186153	ENSG00000186153	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	12799	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 41C, member 1"""	605131	"""WW domain-containing oxidoreductase"""			10786676, 10861292, 19027726	Standard	XR_243411		Approved	FOR, WOX1, SDR41C1	uc002ffk.3	Q9NZC7	OTTHUMG00000176851	ENST00000566780.1:c.10C>G	16.37:g.78133685C>G	ENSP00000457230:p.Leu4Val	Somatic	27	0	1181	WXS	Illumina GAIIx	Phase_I	113	4	NM_130791	0	0	2	2	0	A8K323|Q5MYT5|Q96KM3|Q96RF2|Q9BTT8|Q9NPC9|Q9NRF4|Q9NRF5|Q9NRF6|Q9NRK1|Q9NZC5	Missense_Mutation	SNP	ENST00000566780.1	37	CCDS42196.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.462057	0.84425	.	.	ENSG00000186153	ENST00000408984;ENST00000355860;ENST00000402655;ENST00000406884;ENST00000539474	T;T;T;D;T	0.82711	-1.27;-1.4;1.21;-1.64;1.27	5.11	3.02	0.34903	.	0.000000	0.64402	D	0.000004	T	0.81814	0.4902	N	0.14661	0.345	0.42707	D	0.993632	P;D;D;D;D	0.69078	0.955;0.996;0.997;0.996;0.974	P;D;D;D;D	0.75484	0.79;0.986;0.978;0.986;0.953	T	0.82112	-0.0618	10	0.41790	T	0.15	.	12.4133	0.55480	0.0:0.8421:0.0:0.1579	.	4;4;4;4;4	Q9NZC7-6;Q9NZC7-5;Q9NZC7;Q9NZC7-3;Q9NZC7-4	.;.;WWOX_HUMAN;.;.	V	4	ENSP00000386161:L4V;ENSP00000348119:L4V;ENSP00000384238:L4V;ENSP00000384495:L4V;ENSP00000445210:L4V	ENSP00000348119:L4V	L	+	1	2	WWOX	76691186	0.999000	0.42202	0.958000	0.39756	0.806000	0.45545	3.360000	0.52299	1.380000	0.46344	0.561000	0.74099	CTG	.		0.672	WWOX-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434328.1		
GLTPD2	388323	hgsc.bcm.edu	37	17	4693342	4693342	+	Missense_Mutation	SNP	C	C	A	rs35910358	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr17:4693342C>A	ENST00000331264.7	+	4	680	c.627C>A	c.(625-627)gaC>gaA	p.D209E		NM_001014985.2	NP_001014985	A6NH11	GLTD2_HUMAN	glycolipid transfer protein domain containing 2	209				D -> E (in Ref. 2; AAI50537). {ECO:0000305}.		cytoplasm (GO:0005737)	glycolipid binding (GO:0051861)|glycolipid transporter activity (GO:0017089)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)	4						GAGGCCCGGACGCGGGCGTGC	0.761													C|||	4904	0.979233	0.9228	1.0	5008	,	,		11019	1.0		0.998	False		,,,				2504	1.0				p.D209E		.											.	GLTPD2-68	0			c.C627A						.	C	GLU/ASP	2706,78		1314,78,0	2.0	2.0	2.0		627	0.2	0.1	17	dbSNP_126	2	6028,0		3014,0,0	no	missense	GLTPD2	NM_001014985.2	45	4328,78,0	AA,AC,CC		0.0,2.8017,0.8852	benign	209/292	4693342	8734,78	1392	3014	4406	SO:0001583	missense	388323	exon4			CCCGGACGCGGGC	BC029290	CCDS32534.1	17p13.2	2007-12-19				ENSG00000182327			33756	protein-coding gene	gene with protein product							Standard	NM_001014985		Approved		uc002fza.2	A6NH11		ENST00000331264.7:c.627C>A	17.37:g.4693342C>A	ENSP00000328070:p.Asp209Glu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	15	15	NM_001014985	0	0	0	0	0	A7E2T2	Missense_Mutation	SNP	ENST00000331264.7	37	CCDS32534.1	2151	0.9848901098901099	466	0.9471544715447154	362	1.0	572	1.0	751	0.9907651715039578	C	9.155	1.017148	0.19355	0.971983	1.0	ENSG00000182327	ENST00000331264	.	.	.	4.58	0.162	0.14981	Glycolipid transfer protein domain (3);	.	.	.	.	T	0.00012	0.0000	L	0.41027	1.25	0.80722	P	0.0	B	0.22080	0.064	B	0.31614	0.133	T	0.34650	-0.9820	7	0.12103	T	0.63	-20.1635	5.889	0.18897	0.0:0.5269:0.298:0.1751	rs35910358	209	A6NH11	GLTD2_HUMAN	E	209	.	ENSP00000328070:D209E	D	+	3	2	GLTPD2	4640082	0.004000	0.15560	0.082000	0.20525	0.081000	0.17604	0.011000	0.13264	-0.068000	0.12953	0.555000	0.69702	GAC	C|0.015;A|0.985		0.761	GLTPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439781.1	NM_001014985	
RNF222	643904	hgsc.bcm.edu	37	17	8296383	8296383	+	Missense_Mutation	SNP	C	C	T	rs12601362	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr17:8296383C>T	ENST00000399398.2	-	3	705	c.397G>A	c.(397-399)Gcc>Acc	p.A133T	RNF222_ENST00000344001.3_Missense_Mutation_p.A133T	NM_001146684.2	NP_001140156.1	A6NCQ9	RN222_HUMAN	ring finger protein 222	133						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			breast(1)	1						GGGAGCTGGGCGCTctggccc	0.721													C|||	918	0.183307	0.118	0.1657	5008	,	,		14126	0.1954		0.2346	False		,,,				2504	0.2188				p.A133T		.											.	RNF222-68	0			c.G397A						.	C	THR/ALA	123,941		12,99,421	2.0	4.0	3.0		397	-3.4	0.0	17	dbSNP_120	3	556,2088		72,412,838	no	missense	RNF222	NM_001146684.2	58	84,511,1259	TT,TC,CC		21.0287,11.5602,18.3118	benign	133/221	8296383	679,3029	532	1322	1854	SO:0001583	missense	643904	exon3			GCTGGGCGCTCTG		CCDS45608.1	17p13.1	2013-01-09			ENSG00000189051	ENSG00000189051		"""RING-type (C3HC4) zinc fingers"""	34517	protein-coding gene	gene with protein product							Standard	NM_001146684		Approved		uc010vuy.1	A6NCQ9	OTTHUMG00000132049	ENST00000399398.2:c.397G>A	17.37:g.8296383C>T	ENSP00000382330:p.Ala133Thr	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	15	11	NM_001146684	0	0	0	0	0		Missense_Mutation	SNP	ENST00000399398.2	37	CCDS45608.1	416	0.19047619047619047	69	0.1402439024390244	68	0.1878453038674033	102	0.17832167832167833	177	0.23350923482849603	C	2.546	-0.305162	0.05495	0.115602	0.210287	ENSG00000189051	ENST00000344001;ENST00000399398	.	.	.	4.22	-3.43	0.04810	.	1.112540	0.06977	N	0.819153	T	0.00012	0.0000	N	0.14661	0.345	0.80722	P	0.0	B	0.06786	0.001	B	0.01281	0.0	T	0.34254	-0.9836	8	0.52906	T	0.07	-18.9555	2.2125	0.03951	0.1223:0.447:0.1198:0.3109	rs12601362	133	A6NCQ9	RN222_HUMAN	T	133	.	ENSP00000343799:A133T	A	-	1	0	RNF222	8237108	0.001000	0.12720	0.000000	0.03702	0.224000	0.24922	-0.068000	0.11561	-0.331000	0.08501	0.549000	0.68633	GCC	C|0.808;T|0.192		0.721	RNF222-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255072.2	NM_001146684.2	
MYO18A	399687	broad.mit.edu	37	17	27437604	27437604	+	Silent	SNP	G	G	T			TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr17:27437604G>T	ENST00000527372.1	-	18	3117	c.2937C>A	c.(2935-2937)ggC>ggA	p.G979G	MYO18A_ENST00000354329.4_Silent_p.G979G|MYO18A_ENST00000533112.1_Silent_p.G979G|MYO18A_ENST00000531253.1_Silent_p.G979G	NM_078471.3	NP_510880.2	Q92614	MY18A_HUMAN	myosin XVIIIA	979	Myosin motor.				actomyosin structure organization (GO:0031032)|cell migration (GO:0016477)|DNA metabolic process (GO:0006259)|Golgi organization (GO:0007030)|Golgi vesicle budding (GO:0048194)|negative regulation of apoptotic process (GO:0043066)|positive regulation of protein secretion (GO:0050714)	actomyosin (GO:0042641)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|myosin complex (GO:0016459)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)	p.G979G(2)		NS(1)|cervix(1)|endometrium(6)|kidney(6)|lung(20)|urinary_tract(2)	36			Epithelial(11;4.97e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000221)|all cancers(11;0.000234)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			CCGTGGCACTGCCTGCGCGGC	0.627																																					p.G979G	Esophageal Squamous(182;472 2015 7001 15270 22562)	.											.	MYO18A-22	2	Substitution - coding silent(2)	endometrium(2)	c.C2937A						.						39.0	43.0	42.0					17																	27437604		1981	4171	6152	SO:0001819	synonymous_variant	399687	exon18			GGCACTGCCTGCG	D86970	CCDS45641.1, CCDS45642.1	17q11.2	2011-09-27			ENSG00000196535	ENSG00000196535		"""Myosins / Myosin superfamily : Class XVIII"""	31104	protein-coding gene	gene with protein product		610067				12761286	Standard	NM_078471		Approved	KIAA0216, MysPDZ	uc002hdt.1	Q92614	OTTHUMG00000166360	ENST00000527372.1:c.2937C>A	17.37:g.27437604G>T		Somatic	14	0		WXS	Illumina GAIIx	Phase_I	58	8	NM_078471	0	0	1	1	0	Q5H9U3|Q5W9F9|Q5W9G1|Q8IXP8	Silent	SNP	ENST00000527372.1	37	CCDS45642.1																																																																																			.		0.627	MYO18A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389396.1	NM_078471	
IGFBP4	3487	hgsc.bcm.edu	37	17	38600092	38600092	+	Silent	SNP	G	G	A	rs598892	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr17:38600092G>A	ENST00000269593.4	+	1	380	c.105G>A	c.(103-105)ctG>ctA	p.L35L	IGFBP4_ENST00000542955.1_Intron	NM_001552.2	NP_001543.2	P22692	IBP4_HUMAN	insulin-like growth factor binding protein 4	35	IGFBP N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00653}.				cell proliferation (GO:0008283)|cellular protein metabolic process (GO:0044267)|DNA metabolic process (GO:0006259)|inflammatory response (GO:0006954)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of MAPK cascade (GO:0043410)|regulation of cell growth (GO:0001558)|regulation of glucose metabolic process (GO:0010906)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|type B pancreatic cell proliferation (GO:0044342)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|endometrium(1)|kidney(1)|large_intestine(2)	5		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(5;5.91e-05)			AGGAGAAGCTGGCGCGCTGCC	0.771													G|||	1792	0.357827	0.0386	0.5	5008	,	,		9796	0.4752		0.3946	False		,,,				2504	0.5297				p.L35L	GBM(160;940 3581 26177)	.											.	IGFBP4-522	0			c.G105A						.	G		266,3270		24,218,1526	3.0	3.0	3.0		105	4.0	1.0	17	dbSNP_83	3	2267,4893		352,1563,1665	no	coding-synonymous	IGFBP4	NM_001552.2		376,1781,3191	AA,AG,GG		31.662,7.5226,23.6818		35/259	38600092	2533,8163	1768	3580	5348	SO:0001819	synonymous_variant	3487	exon1			GAAGCTGGCGCGC	M38177	CCDS11367.1	17q21.2	2014-09-16	2001-11-28		ENSG00000141753	ENSG00000141753			5473	protein-coding gene	gene with protein product	"""IGF-binding protein 4"""	146733	"""insulin-like growth factor-binding protein 4"""			1707125, 1704481	Standard	NM_001552		Approved	IBP4, BP-4, HT29-IGFBP, IGFBP-4	uc002hus.3	P22692	OTTHUMG00000133326	ENST00000269593.4:c.105G>A	17.37:g.38600092G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	14	14	NM_001552	0	0	0	0	0	A0N9W2|B4E351|Q5U012|Q9UCL6	Silent	SNP	ENST00000269593.4	37	CCDS11367.1																																																																																			G|0.645;A|0.355		0.771	IGFBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257134.1	NM_001552	
BZRAP1	9256	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	56399729	56399729	+	Silent	SNP	C	C	T			TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr17:56399729C>T	ENST00000343736.4	-	10	1525	c.1362G>A	c.(1360-1362)gaG>gaA	p.E454E	BZRAP1_ENST00000268893.6_Silent_p.E394E|BZRAP1_ENST00000355701.3_Silent_p.E454E			O95153	RIMB1_HUMAN	benzodiazepine receptor (peripheral) associated protein 1	454						cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	benzodiazepine receptor binding (GO:0030156)			cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CCTGTTCATGCTCCACCTCCA	0.627																																					p.E454E		.											.	BZRAP1-229	0			c.G1362A						.						49.0	51.0	50.0					17																	56399729		2203	4300	6503	SO:0001819	synonymous_variant	9256	exon10			TTCATGCTCCACC	AB014512	CCDS11605.1, CCDS45742.1	17q22-q23	2014-01-09	2014-01-09						16831	protein-coding gene	gene with protein product		610764				9734811, 9915832	Standard	NM_004758		Approved	PRAX-1, KIAA0612, RIM-BP1, RIMBP1	uc002ivx.5	O95153		ENST00000343736.4:c.1362G>A	17.37:g.56399729C>T		Somatic	48	0		WXS	Illumina GAIIx	Phase_I	95	21	NM_004758	0	0	4	4	0	O75111|Q8N5W3	Silent	SNP	ENST00000343736.4	37	CCDS11605.1																																																																																			.		0.627	BZRAP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443980.1	NM_004758	
STRADA	92335	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	61787883	61787883	+	Silent	SNP	G	G	A			TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr17:61787883G>A	ENST00000336174.6	-	8	661	c.549C>T	c.(547-549)ctC>ctT	p.L183L	STRADA_ENST00000245865.5_Silent_p.L125L|STRADA_ENST00000392950.4_Silent_p.L146L|STRADA_ENST00000580039.1_5'UTR|STRADA_ENST00000579340.1_Silent_p.L125L|STRADA_ENST00000447001.3_Silent_p.L139L|RP11-51F16.8_ENST00000580553.1_Intron|STRADA_ENST00000375840.4_Silent_p.L125L|STRADA_ENST00000582137.1_Silent_p.L154L	NM_001003787.2	NP_001003787.1	Q7RTN6	STRAA_HUMAN	STE20-related kinase adaptor alpha	183	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of protein kinase activity (GO:0032147)|cell cycle arrest (GO:0007050)|insulin receptor signaling pathway (GO:0008286)|protein export from nucleus (GO:0006611)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinase binding (GO:0019900)|protein kinase activator activity (GO:0030295)|transferase activity, transferring phosphorus-containing groups (GO:0016772)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|liver(1)|lung(2)|ovary(1)|prostate(2)	13						GGATGTAGTCGAGGGCCTTCA	0.507																																					p.L183L		.											.	STRADA-547	0			c.C549T						.						110.0	90.0	97.0					17																	61787883		2203	4300	6503	SO:0001819	synonymous_variant	92335	exon8			GTAGTCGAGGGCC	AF308302	CCDS11642.1, CCDS32703.1, CCDS42367.1, CCDS54156.1, CCDS58585.1	17q23.3	2014-09-04			ENSG00000266173	ENSG00000266173			30172	protein-coding gene	gene with protein product	"""STE20-like pseudokinase"""	608626				12805220, 17921699	Standard	NM_153335		Approved	NY-BR-96, LYK5, Stlk, STRAD	uc002jbm.3	Q7RTN6	OTTHUMG00000178908	ENST00000336174.6:c.549C>T	17.37:g.61787883G>A		Somatic	209	0		WXS	Illumina GAIIx	Phase_I	309	79	NM_001003787	0	0	3	3	0	B4DDE3|B4DW17|J3KTC9|Q5JPI2|Q7Z4K9|Q8NC31|Q8NCF1|Q9H272	Silent	SNP	ENST00000336174.6	37	CCDS32703.1																																																																																			.		0.507	STRADA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443894.1		
BIRC5	332	broad.mit.edu	37	17	76219637	76219637	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr17:76219637G>T	ENST00000374948.2	+	3	366	c.313G>T	c.(313-315)Gcc>Tcc	p.A105S	BIRC5_ENST00000350051.3_3'UTR|BIRC5_ENST00000589892.1_3'UTR|AC087645.1_ENST00000600484.1_Missense_Mutation_p.P215T|BIRC5_ENST00000301633.4_3'UTR	NM_001012270.1	NP_001012270.1	O15392	BIRC5_HUMAN	baculoviral IAP repeat containing 5	0					apoptotic process (GO:0006915)|cell division (GO:0051301)|chromosome segregation (GO:0007059)|cytokinesis (GO:0000910)|establishment of chromosome localization (GO:0051303)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|positive regulation of exit from mitosis (GO:0031536)|positive regulation of mitotic cell cycle (GO:0045931)|protein complex localization (GO:0031503)|protein phosphorylation (GO:0006468)|spindle checkpoint (GO:0031577)|transcription, DNA-templated (GO:0006351)	centriole (GO:0005814)|chromosome passenger complex (GO:0032133)|chromosome, centromeric region (GO:0000775)|condensed chromosome kinetochore (GO:0000777)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|interphase microtubule organizing center (GO:0031021)|microtubule (GO:0005874)|midbody (GO:0030496)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	chaperone binding (GO:0051087)|cobalt ion binding (GO:0050897)|cofactor binding (GO:0048037)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|microtubule binding (GO:0008017)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|Ran GTPase binding (GO:0008536)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			kidney(1)|urinary_tract(1)	2			BRCA - Breast invasive adenocarcinoma(99;0.00269)|OV - Ovarian serous cystadenocarcinoma(97;0.153)			ATGGATTGAGGCCTCTGGCCG	0.547																																					p.A105S		.											.	BIRC5-1083	0			c.G313T						.						42.0	46.0	45.0					17																	76219637		2203	4300	6503	SO:0001583	missense	332	exon3			ATTGAGGCCTCTG	U75285	CCDS11755.1, CCDS32751.1, CCDS32752.1	17q25.3	2013-01-17	2011-01-25		ENSG00000089685	ENSG00000089685		"""Baculoviral IAP repeat containing"""	593	protein-coding gene	gene with protein product	"""survivin variant 3 alpha"""	603352	"""apoptosis inhibitor 4"", ""baculoviral IAP repeat-containing 5"""	API4		8106347, 7947793	Standard	XR_243654		Approved	EPR-1, survivin	uc002jvf.3	O15392		ENST00000374948.2:c.313G>T	17.37:g.76219637G>T	ENSP00000364086:p.Ala105Ser	Somatic	41	0		WXS	Illumina GAIIx	Phase_I	21	4	NM_001012270	0	0	5	5	0	A2SUH6|B2R4R1|Q2I3N8|Q4VGX0|Q53F61|Q5MGC6|Q6FHL2|Q75SP2|Q9P2W8	Missense_Mutation	SNP	ENST00000374948.2	37	CCDS32751.1	.	.	.	.	.	.	.	.	.	.	G	13.68	2.308792	0.40895	.	.	ENSG00000089685	ENST00000374948	T	0.74106	-0.81	3.9	-2.12	0.07165	.	.	.	.	.	T	0.48607	0.1509	.	.	.	0.09310	N	0.999997	B	0.17268	0.021	B	0.14023	0.01	T	0.26155	-1.0111	8	0.17369	T	0.5	.	2.0941	0.03664	0.1217:0.1569:0.4343:0.2871	.	105	O15392-3	.	S	105	ENSP00000364086:A105S	ENSP00000364086:A105S	A	+	1	0	BIRC5	73731232	0.000000	0.05858	0.010000	0.14722	0.148000	0.21650	-0.930000	0.03972	-0.125000	0.11703	0.655000	0.94253	GCC	.		0.547	BIRC5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000437232.2	NM_001168	
NPTX1	4884	hgsc.bcm.edu	37	17	78449948	78449948	+	Missense_Mutation	SNP	C	C	T	rs144443274	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr17:78449948C>T	ENST00000306773.4	-	1	456	c.299G>A	c.(298-300)gGc>gAc	p.G100D	NPTX1_ENST00000575212.1_Intron	NM_002522.3	NP_002513.2	Q15818	NPTX1_HUMAN	neuronal pentraxin I	100					axonogenesis involved in innervation (GO:0060385)|cellular response to glucose stimulus (GO:0071333)|cellular response to potassium ion (GO:0035865)|central nervous system development (GO:0007417)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mitochondrial transport (GO:0006839)|synaptic transmission (GO:0007268)|transport (GO:0006810)	cytoplasmic vesicle (GO:0031410)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			kidney(1)|large_intestine(2)|liver(1)|lung(4)|prostate(2)|upper_aerodigestive_tract(1)	11	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0487)			ccgggcctcgccggcTCCGGG	0.721													C|||	393	0.0784744	0.0091	0.098	5008	,	,		6949	0.0238		0.173	False		,,,				2504	0.1176				p.G100D		.											.	NPTX1-90	0			c.G299A						.	C	ASP/GLY	146,4108		4,138,1985	11.0	15.0	14.0		299	2.1	1.0	17	dbSNP_134	14	1445,6809		128,1189,2810	no	missense	NPTX1	NM_002522.3	94	132,1327,4795	TT,TC,CC		17.5067,3.4321,12.7199	benign	100/433	78449948	1591,10917	2127	4127	6254	SO:0001583	missense	4884	exon1			GCCTCGCCGGCTC	U61849	CCDS32762.1	17q25.3	2008-05-14				ENSG00000171246			7952	protein-coding gene	gene with protein product		602367				8884281	Standard	NM_002522		Approved		uc002jyp.1	Q15818		ENST00000306773.4:c.299G>A	17.37:g.78449948C>T	ENSP00000307549:p.Gly100Asp	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	22	8	NM_002522	0	0	0	0	0	B3KXH3|Q5FWE6	Missense_Mutation	SNP	ENST00000306773.4	37	CCDS32762.1	196	0.08974358974358974	6	0.012195121951219513	42	0.11602209944751381	10	0.017482517482517484	138	0.1820580474934037	C	14.35	2.508706	0.44660	0.034321	0.175067	ENSG00000171246	ENST00000306773	T	0.10382	2.88	3.44	2.11	0.27256	.	0.738536	0.13049	N	0.417861	T	0.00012	0.0000	N	0.14661	0.345	0.34958	P	0.24807100000000004	P	0.43287	0.802	B	0.35413	0.202	T	0.37174	-0.9717	9	0.15066	T	0.55	-13.6643	4.112	0.10063	0.0:0.5355:0.2155:0.249	.	100	Q15818	NPTX1_HUMAN	D	100	ENSP00000307549:G100D	ENSP00000307549:G100D	G	-	2	0	NPTX1	76064543	0.996000	0.38824	0.994000	0.49952	0.971000	0.66376	1.864000	0.39469	1.482000	0.48325	0.484000	0.47621	GGC	C|0.910;T|0.090		0.721	NPTX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438051.1		
FASN	2194	hgsc.bcm.edu	37	17	80043739	80043739	+	Silent	SNP	A	A	G	rs2229422	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr17:80043739A>G	ENST00000306749.2	-	23	3959	c.3741T>C	c.(3739-3741)gcT>gcC	p.A1247A	FASN_ENST00000579758.1_5'Flank	NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase	1247					acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	GACCGTGGCCAGCCAGCACCT	0.662													.|||	1182	0.236022	0.1997	0.2032	5008	,	,		16566	0.2877		0.3121	False		,,,				2504	0.1769				p.A1247A	Colon(59;314 1043 11189 28578 32273)	.											.	FASN-90	0			c.T3741C						.	A		966,3322		118,730,1296	9.0	9.0	9.0		3741	-6.6	0.1	17	dbSNP_98	9	2628,5830		429,1770,2030	no	coding-synonymous	FASN	NM_004104.4		547,2500,3326	GG,GA,AA		31.0712,22.528,28.1971		1247/2512	80043739	3594,9152	2144	4229	6373	SO:0001819	synonymous_variant	2194	exon23			GTGGCCAGCCAGC	U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.3741T>C	17.37:g.80043739A>G		Somatic	2	0		WXS	Illumina GAIIx	Phase_I	28	19	NM_004104	0	0	0	0	0	Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Silent	SNP	ENST00000306749.2	37	CCDS11801.1																																																																																			T|0.697;G|0.014;C|0.242;A|0.047		0.662	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442369.1	NM_004104	
SALL3	27164	hgsc.bcm.edu	37	18	76753768	76753768	+	Missense_Mutation	SNP	C	C	G	rs2447437	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr18:76753768C>G	ENST00000537592.2	+	2	1777	c.1777C>G	c.(1777-1779)Ctc>Gtc	p.L593V	SALL3_ENST00000536229.3_Missense_Mutation_p.L460V|SALL3_ENST00000575389.2_Missense_Mutation_p.L593V	NM_171999.3	NP_741996.2	Q9BXA9	SALL3_HUMAN	spalt-like transcription factor 3	593			L -> V (in dbSNP:rs2447437). {ECO:0000269|Ref.1}.		forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|negative regulation of smoothened signaling pathway (GO:0045879)|olfactory bulb interneuron development (GO:0021891)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L593V(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(40)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		CGGGCCGCCCCTCACTAAAGC	0.731													C|||	3973	0.793331	0.5825	0.8444	5008	,	,		9900	0.9226		0.8648	False		,,,				2504	0.8354				p.L593V		.											.	SALL3-155	1	Substitution - Missense(1)	prostate(1)	c.C1777G						.	C	VAL/LEU	2422,1000		875,672,164	3.0	4.0	4.0		1777	5.2	0.2	18	dbSNP_100	4	6372,926		2808,756,85	yes	missense	SALL3	NM_171999.2	32	3683,1428,249	GG,GC,CC		12.6884,29.2227,17.9664	benign	593/1301	76753768	8794,1926	1711	3649	5360	SO:0001583	missense	27164	exon2			CCGCCCCTCACTA	AJ007421	CCDS12013.1	18q23	2013-10-17	2013-10-17		ENSG00000256463	ENSG00000256463		"""Zinc fingers, C2H2-type"""	10527	protein-coding gene	gene with protein product		605079	"""sal (Drosophila)-like 3"", ""sal-like 3 (Drosophila)"""			10610715	Standard	NM_171999		Approved	ZNF796	uc002lmt.3	Q9BXA9	OTTHUMG00000132896	ENST00000537592.2:c.1777C>G	18.37:g.76753768C>G	ENSP00000441823:p.Leu593Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	7	NM_171999	0	0	0	0	0	Q9UGH1	Missense_Mutation	SNP	ENST00000537592.2	37	CCDS12013.1	1724	0.7893772893772893	287	0.5833333333333334	299	0.8259668508287292	511	0.8933566433566433	627	0.8271767810026385	C	0.073	-1.197989	0.01594	0.707773	0.873116	ENSG00000256463	ENST00000537592;ENST00000536229;ENST00000543056	T	0.08984	3.03	5.2	5.2	0.72013	.	0.464067	0.17974	N	0.155779	T	0.00012	0.0000	L	0.35288	1.05	0.80722	P	0.0	B;B	0.15473	0.013;0.006	B;B	0.18561	0.022;0.002	T	0.36237	-0.9756	9	0.14656	T	0.56	-21.7235	10.231	0.43256	0.2471:0.6277:0.1252:0.0	rs2447437	325;593	F5GXY4;Q9BXA9	.;SALL3_HUMAN	V	593;593;325	ENSP00000441823:L593V	ENSP00000299466:L593V	L	+	1	0	SALL3	74854756	0.002000	0.14202	0.157000	0.22605	0.006000	0.05464	0.292000	0.19011	2.584000	0.87258	0.563000	0.77884	CTC	C|0.780;G|0.220		0.731	SALL3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256397.1	NM_171999	
ATP9B	374868	hgsc.bcm.edu	37	18	76829525	76829525	+	Missense_Mutation	SNP	A	A	G	rs4078115	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr18:76829525A>G	ENST00000426216.2	+	1	132	c.115A>G	c.(115-117)Agc>Ggc	p.S39G	ATP9B_ENST00000307671.7_Missense_Mutation_p.S39G|ATP9B_ENST00000591464.1_3'UTR|ATP9B_ENST00000458297.2_5'UTR|ATP9B_ENST00000586722.1_Missense_Mutation_p.S39G	NM_198531.3	NP_940933.3	O43861	ATP9B_HUMAN	ATPase, class II, type 9B	39			S -> G (in dbSNP:rs4078115). {ECO:0000269|PubMed:15489334}.		establishment of protein localization to Golgi (GO:0072600)|phospholipid translocation (GO:0045332)	integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(3)|prostate(1)|skin(2)|stomach(1)	38		Esophageal squamous(42;0.018)|Melanoma(33;0.0964)|Prostate(75;0.171)		OV - Ovarian serous cystadenocarcinoma(15;1.44e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0405)		CGACCGGCACAGCAGGTAACC	0.771													a|||	1574	0.314297	0.2277	0.2046	5008	,	,		9814	0.4494		0.2565	False		,,,				2504	0.4294				p.S39G		.											.	ATP9B-93	0			c.A115G						.		GLY/SER	504,2920		44,416,1252	3.0	4.0	4.0		115	-0.3	1.0	18	dbSNP_108	4	1215,5401		129,957,2222	no	missense	ATP9B	NM_198531.3	56	173,1373,3474	GG,GA,AA		18.3646,14.7196,17.1215	benign	39/1148	76829525	1719,8321	1712	3308	5020	SO:0001583	missense	374868	exon1			CGGCACAGCAGGT	R51412	CCDS12014.1	18q23	2010-04-20	2007-09-19		ENSG00000166377	ENSG00000166377		"""ATPases / P-type"""	13541	protein-coding gene	gene with protein product		614446	"""ATPase, Class II, type 9B"""			9548971, 11015572	Standard	NM_198531		Approved	ATPIIB	uc002lmx.3	O43861	OTTHUMG00000132898	ENST00000426216.2:c.115A>G	18.37:g.76829525A>G	ENSP00000398076:p.Ser39Gly	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	6	NM_198531	0	0	0	0	0	O60872|Q08AD8|Q08AD9	Missense_Mutation	SNP	ENST00000426216.2	37	CCDS12014.1	670	0.3067765567765568	104	0.21138211382113822	83	0.2292817679558011	281	0.49125874125874125	202	0.26649076517150394	a	7.584	0.669300	0.14776	0.147196	0.183646	ENSG00000166377	ENST00000426216;ENST00000307671	T;T	0.56103	0.48;0.48	2.56	-0.308	0.12773	.	1.710450	0.03865	N	0.274617	T	0.00012	0.0000	N	0.03608	-0.345	0.09310	P	0.99999999821082	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.41016	-0.9532	9	0.23302	T	0.38	.	4.8264	0.13417	0.5235:0.0:0.4765:0.0	rs4078115;rs4327119	39;39;39	O43861;O43861-2;B4DJ94	ATP9B_HUMAN;.;.	G	39	ENSP00000398076:S39G;ENSP00000304500:S39G	ENSP00000304500:S39G	S	+	1	0	ATP9B	74930513	1.000000	0.71417	0.996000	0.52242	0.256000	0.26092	1.165000	0.31822	-0.197000	0.10350	-0.465000	0.05216	AGC	A|0.693;G|0.307		0.771	ATP9B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256402.3	NM_198531	
ARID3A	1820	hgsc.bcm.edu	37	19	929753	929753	+	Silent	SNP	A	A	G	rs1799595	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr19:929753A>G	ENST00000263620.3	+	2	552	c.225A>G	c.(223-225)ccA>ccG	p.P75P	AC005391.2_ENST00000585647.1_RNA	NM_005224.2	NP_005215.1	Q99856	ARI3A_HUMAN	AT rich interactive domain 3A (BRIGHT-like)	75						cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|ovary(1)	10		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGGACACCCAGCCAGCCCCG	0.751													t|||	4428	0.884185	0.9062	0.804	5008	,	,		8534	0.998		0.836	False		,,,				2504	0.8436				p.P75P	Pancreas(29;54 1022 32760 50921)	.											.	ARID3A-90	0			c.A225G						.	G		3389,305		1555,279,13	4.0	5.0	5.0		225	-6.8	0.0	19	dbSNP_89	5	6619,1123		2834,951,86	no	coding-synonymous	ARID3A	NM_005224.2		4389,1230,99	GG,GA,AA		14.5053,8.2566,12.4869		75/594	929753	10008,1428	1847	3871	5718	SO:0001819	synonymous_variant	1820	exon2			ACACCCAGCCAGC	U88047	CCDS12050.1	19p13.3	2013-02-07	2006-11-08	2004-01-30		ENSG00000116017		"""-"""	3031	protein-coding gene	gene with protein product		603265	"""dead ringer-like 1 (Drosophila)"", ""AT rich interactive domain 3A (BRIGHT- like)"""	DRIL1		9722953	Standard	NM_005224		Approved	BRIGHT	uc002lql.3	Q99856		ENST00000263620.3:c.225A>G	19.37:g.929753A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_005224	0	0	0	1	1	Q5I858|Q6P9C6|Q8IZA7|Q8N4Z3	Silent	SNP	ENST00000263620.3	37	CCDS12050.1																																																																																			A|0.114;G|0.886		0.751	ARID3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458219.1	NM_005224	
ABCA7	10347	hgsc.bcm.edu	37	19	1065044	1065044	+	Silent	SNP	C	C	T	rs4147935	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr19:1065044C>T	ENST00000263094.6	+	46	6390	c.6159C>T	c.(6157-6159)ggC>ggT	p.G2053G	ABCA7_ENST00000433129.1_Silent_p.G2053G|HMHA1_ENST00000586866.1_5'Flank|HMHA1_ENST00000536472.1_5'Flank|HMHA1_ENST00000313093.2_5'Flank|ABCA7_ENST00000435683.2_Silent_p.G1915G|HMHA1_ENST00000590214.1_5'Flank|HMHA1_ENST00000539243.2_5'Flank	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	2053					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)			NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CACATGGAGGCCGCCTGCGCT	0.736																																					p.G2053G		.											.	ABCA7-98	0			c.C6159T						.	C		327,3757		20,287,1735	5.0	6.0	6.0		6159	1.5	0.8	19	dbSNP_110	6	2858,5242		553,1752,1745	no	coding-synonymous	ABCA7	NM_019112.3		573,2039,3480	TT,TC,CC		35.284,8.0069,26.1408		2053/2147	1065044	3185,8999	2042	4050	6092	SO:0001819	synonymous_variant	10347	exon46			TGGAGGCCGCCTG	AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.6159C>T	19.37:g.1065044C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	17	10	NM_019112	0	0	3	5	2	Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Silent	SNP	ENST00000263094.6	37	CCDS12055.1																																																																																			C|0.766;T|0.234		0.736	ABCA7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000394993.1	NM_019112	
APC2	10297	hgsc.bcm.edu	37	19	1457006	1457006	+	Missense_Mutation	SNP	C	C	T	rs201709261	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr19:1457006C>T	ENST00000535453.1	+	8	2684	c.971C>T	c.(970-972)aCc>aTc	p.T324I	APC2_ENST00000238483.4_Intron|APC2_ENST00000233607.2_Missense_Mutation_p.T324I|CTB-25B13.12_ENST00000588225.1_RNA			P02655	APOC2_HUMAN	adenomatosis polyposis coli 2	0					cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|chylomicron remnant clearance (GO:0034382)|chylomicron remodeling (GO:0034371)|high-density lipoprotein particle clearance (GO:0034384)|lipid catabolic process (GO:0016042)|lipoprotein metabolic process (GO:0042157)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cholesterol transport (GO:0032375)|negative regulation of lipid metabolic process (GO:0045833)|negative regulation of receptor-mediated endocytosis (GO:0048261)|negative regulation of very-low-density lipoprotein particle clearance (GO:0010916)|phospholipid efflux (GO:0033700)|phototransduction, visible light (GO:0007603)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of phospholipid catabolic process (GO:0060697)|positive regulation of triglyceride catabolic process (GO:0010898)|positive regulation of very-low-density lipoprotein particle remodeling (GO:0010902)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|triglyceride homeostasis (GO:0070328)|triglyceride-rich lipoprotein particle remodeling (GO:0034370)|very-low-density lipoprotein particle remodeling (GO:0034372)	chylomicron (GO:0042627)|early endosome (GO:0005769)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate-density lipoprotein particle (GO:0034363)|low-density lipoprotein particle (GO:0034362)|spherical high-density lipoprotein particle (GO:0034366)|very-low-density lipoprotein particle (GO:0034361)	lipase inhibitor activity (GO:0055102)|lipid binding (GO:0008289)|lipoprotein lipase activator activity (GO:0060230)|phospholipase activator activity (GO:0016004)|phospholipase binding (GO:0043274)|protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|kidney(4)|large_intestine(2)|lung(5)|pancreas(1)|skin(2)	18		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTCCACGGCACCGAggccgcg	0.736													C|||	10	0.00199681	0.0	0.0058	5008	,	,		12964	0.0		0.003	False		,,,				2504	0.0031				p.T324I		.											.	APC2-290	0			c.C971T						.						2.0	3.0	2.0					19																	1457006		1667	3348	5015	SO:0001583	missense	10297	exon9			ACGGCACCGAGGC		CCDS12068.1	19p13.3	2013-02-14			ENSG00000115266	ENSG00000115266		"""Armadillo repeat containing"""	24036	protein-coding gene	gene with protein product	"""adenomatous polyposis coli like"""	612034				9823329, 10021369	Standard	XM_005259475		Approved	APCL	uc002lsr.1	O95996		ENST00000535453.1:c.971C>T	19.37:g.1457006C>T	ENSP00000442954:p.Thr324Ile	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	5	NM_005883	0	0	0	0	0	C0JYY4|Q9BS39|Q9UDE3|Q9UNK3	Missense_Mutation	SNP	ENST00000535453.1	37	CCDS12068.1	.	.	.	.	.	.	.	.	.	.	C	6.779	0.512614	0.12944	.	.	ENSG00000115266	ENST00000233607;ENST00000535453	T;T	0.65549	-0.16;-0.16	4.58	3.55	0.40652	Armadillo-type fold (1);	0.963572	0.08549	N	0.929260	T	0.42314	0.1197	N	0.08118	0	0.20563	N	0.999886	B;B	0.24426	0.103;0.063	B;B	0.22601	0.04;0.018	T	0.32375	-0.9909	10	0.48119	T	0.1	-3.901	8.4811	0.33043	0.0:0.8932:0.0:0.1068	.	323;324	O95996-3;O95996	.;APC2_HUMAN	I	324	ENSP00000233607:T324I;ENSP00000442954:T324I	ENSP00000233607:T324I	T	+	2	0	APC2	1408006	0.000000	0.05858	0.011000	0.14972	0.001000	0.01503	-0.001000	0.12947	1.150000	0.42419	-0.258000	0.10820	ACC	.		0.736	APC2-004	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449539.2	NM_005883	
TCF3	6929	hgsc.bcm.edu	37	19	1619333	1619333	+	Silent	SNP	G	G	A	rs1140828	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr19:1619333G>A	ENST00000262965.5	-	15	1652	c.1308C>T	c.(1306-1308)ggC>ggT	p.G436G	TCF3_ENST00000588136.1_Silent_p.G436G|TCF3_ENST00000395423.3_Silent_p.G385G|TCF3_ENST00000344749.5_Silent_p.G436G|TCF3_ENST00000453954.2_Silent_p.G352G|RNU6-1223P_ENST00000517124.1_RNA	NM_003200.3	NP_003191.1	Q9HCS4	TF7L1_HUMAN	transcription factor 3	0					anterior/posterior axis specification, embryo (GO:0008595)|axial mesoderm morphogenesis (GO:0048319)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|chromatin organization (GO:0006325)|generation of neurons (GO:0048699)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	16		Acute lymphoblastic leukemia(61;5.94e-12)|all_hematologic(61;1.27e-07)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGTGCCGCCCGCCCAGTGACA	0.746			T	"""PBX1, HLF, TFPT"""	pre B-ALL								G|||	1179	0.235423	0.1702	0.2435	5008	,	,		13595	0.2897		0.3032	False		,,,				2504	0.1922				p.G436G		.		Dom	yes		19	19p13.3	6929	transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47)		L	.	TCF3-721	0			c.C1308T						.	G	,	770,3572		79,612,1480	11.0	14.0	13.0		1308,1308	-3.3	0.4	19	dbSNP_86	13	2644,5770		436,1772,1999	no	coding-synonymous,coding-synonymous	TCF3	NM_001136139.2,NM_003200.3	,	515,2384,3479	AA,AG,GG		31.4238,17.7338,26.7639	,	436/652,436/655	1619333	3414,9342	2171	4207	6378	SO:0001819	synonymous_variant	6929	exon15			CCGCCCGCCCAGT	M65214	CCDS12074.1, CCDS45899.1	19p13.3	2014-02-13	2013-02-26		ENSG00000071564	ENSG00000071564		"""Basic helix-loop-helix proteins"""	11633	protein-coding gene	gene with protein product	"""transcription factor E2-alpha"", ""immunoglobulin transcription factor 1"", ""kappa-E2-binding factor"", ""E2A immunoglobulin enhancer-binding factor E12/E47"", ""VDR interacting repressor"""	147141				2308859, 1967983	Standard	NM_003200		Approved	E2A, ITF1, MGC129647, MGC129648, bHLHb21, VDIR, E47	uc002ltt.4	P15923	OTTHUMG00000180031	ENST00000262965.5:c.1308C>T	19.37:g.1619333G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	11	10	NM_003200	0	0	0	0	0	Q53R97|Q6PD70|Q9NP00	Silent	SNP	ENST00000262965.5	37	CCDS12074.1																																																																																			G|0.749;A|0.251		0.746	TCF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449367.1	NM_003200	
TCF3	6929	hgsc.bcm.edu	37	19	1619339	1619339	+	Silent	SNP	T	T	C	rs8140	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr19:1619339T>C	ENST00000262965.5	-	15	1646	c.1302A>G	c.(1300-1302)tcA>tcG	p.S434S	TCF3_ENST00000588136.1_Silent_p.S434S|TCF3_ENST00000395423.3_Silent_p.S383S|TCF3_ENST00000344749.5_Silent_p.S434S|TCF3_ENST00000453954.2_Silent_p.S350S|RNU6-1223P_ENST00000517124.1_RNA	NM_003200.3	NP_003191.1	Q9HCS4	TF7L1_HUMAN	transcription factor 3	0					anterior/posterior axis specification, embryo (GO:0008595)|axial mesoderm morphogenesis (GO:0048319)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|chromatin organization (GO:0006325)|generation of neurons (GO:0048699)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	16		Acute lymphoblastic leukemia(61;5.94e-12)|all_hematologic(61;1.27e-07)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCCCGCCCAGTGACATGGGGC	0.746			T	"""PBX1, HLF, TFPT"""	pre B-ALL								C|||	3124	0.623802	0.7723	0.5187	5008	,	,		13680	0.8839		0.3658	False		,,,				2504	0.4949				p.S434S		.		Dom	yes		19	19p13.3	6929	transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47)		L	.	TCF3-721	0			c.A1302G						.	C	,	3016,1346		1071,874,236	11.0	14.0	13.0		1302,1302	-7.1	0.0	19	dbSNP_52	13	3268,5190		653,1962,1614	no	coding-synonymous,coding-synonymous	TCF3	NM_001136139.2,NM_003200.3	,	1724,2836,1850	CC,CT,TT		38.638,30.8574,49.0172	,	434/652,434/655	1619339	6284,6536	2181	4229	6410	SO:0001819	synonymous_variant	6929	exon15			GCCCAGTGACATG	M65214	CCDS12074.1, CCDS45899.1	19p13.3	2014-02-13	2013-02-26		ENSG00000071564	ENSG00000071564		"""Basic helix-loop-helix proteins"""	11633	protein-coding gene	gene with protein product	"""transcription factor E2-alpha"", ""immunoglobulin transcription factor 1"", ""kappa-E2-binding factor"", ""E2A immunoglobulin enhancer-binding factor E12/E47"", ""VDR interacting repressor"""	147141				2308859, 1967983	Standard	NM_003200		Approved	E2A, ITF1, MGC129647, MGC129648, bHLHb21, VDIR, E47	uc002ltt.4	P15923	OTTHUMG00000180031	ENST00000262965.5:c.1302A>G	19.37:g.1619339T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	13	12	NM_003200	0	0	0	0	0	Q53R97|Q6PD70|Q9NP00	Silent	SNP	ENST00000262965.5	37	CCDS12074.1																																																																																			T|0.403;C|0.597		0.746	TCF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449367.1	NM_003200	
TBXA2R	6915	hgsc.bcm.edu	37	19	3600198	3600198	+	Silent	SNP	C	C	T	rs5748	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr19:3600198C>T	ENST00000375190.4	-	2	828	c.435G>A	c.(433-435)tcG>tcA	p.S145S	TBXA2R_ENST00000589966.1_Intron|TBXA2R_ENST00000587717.1_5'Flank|TBXA2R_ENST00000411851.3_Silent_p.S145S	NM_001060.5|NM_201636.2	NP_001051.1|NP_963998.2	P21731	TA2R_HUMAN	thromboxane A2 receptor	145					blood coagulation (GO:0007596)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood pressure (GO:0045777)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of GTPase activity (GO:0043547)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of vasoconstriction (GO:0045907)|response to drug (GO:0042493)|response to lipopolysaccharide (GO:0032496)|response to nutrient (GO:0007584)|second-messenger-mediated signaling (GO:0019932)|thromboxane A2 signaling pathway (GO:0038193)	acrosomal vesicle (GO:0001669)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|thromboxane A2 receptor activity (GO:0004961)			kidney(1)|lung(2)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	8		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00253)|STAD - Stomach adenocarcinoma(1328;0.18)	Ridogrel(DB01207)	CGCGGCGCTGCGAGGCGACCG	0.741													C|||	269	0.0537141	0.0038	0.0317	5008	,	,		9194	0.0585		0.0656	False		,,,				2504	0.1196				p.S145S		.											.	TBXA2R-90	0			c.G435A						.						6.0	8.0	7.0					19																	3600198		1689	3788	5477	SO:0001819	synonymous_variant	6915	exon2			GCGCTGCGAGGCG		CCDS42467.1, CCDS54198.1	19p13.3	2014-09-17						"""GPCR / Class A : Prostanoid receptors"""	11608	protein-coding gene	gene with protein product		188070				1825698	Standard	NM_001060		Approved		uc021umv.1	P21731		ENST00000375190.4:c.435G>A	19.37:g.3600198C>T		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	16	11	NM_201636	0	0	0	1	1	O75228|Q6DK52|Q9UCY1|Q9UCY2	Silent	SNP	ENST00000375190.4	37	CCDS42467.1																																																																																			T|0.045;C|0.955		0.741	TBXA2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453081.2		
CACTIN	58509	bcgsc.ca	37	19	3611972	3611972	+	Silent	SNP	G	G	A	rs2158935	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr19:3611972G>A	ENST00000429344.2	-	10	2278	c.2226C>T	c.(2224-2226)aaC>aaT	p.N742N	CACTIN_ENST00000221899.3_Silent_p.N674N|CACTIN-AS1_ENST00000592274.1_RNA|CACTIN_ENST00000248420.5_Silent_p.N742N	NM_001080543.1	NP_001074012.1	Q8WUQ7	CATIN_HUMAN	cactin, spliceosome C complex subunit	742					cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to tumor necrosis factor (GO:0071356)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|multicellular organismal development (GO:0007275)|negative regulation of interferon-beta production (GO:0032688)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)										GGAAGATGCCGTTGGCAAACT	0.637													G|||	2169	0.433107	0.3033	0.6066	5008	,	,		18889	0.3313		0.5805	False		,,,				2504	0.4387				p.N742N		.											.	.	0			c.C2226T						.	G	,	1459,2595		245,969,813	62.0	72.0	69.0		2226,2226	-3.2	1.0	19	dbSNP_96	69	4755,3579		1343,2069,755	no	coding-synonymous,coding-synonymous	C19orf29	NM_001080543.1,NM_021231.1	,	1588,3038,1568	AA,AG,GG		42.9446,35.9891,49.8386	,	742/759,742/759	3611972	6214,6174	2027	4167	6194	SO:0001819	synonymous_variant	58509	exon10			GATGCCGTTGGCA	BC019848	CCDS45920.1	19p13.3	2012-06-08	2012-06-08	2012-06-08	ENSG00000105298	ENSG00000105298			29938	protein-coding gene	gene with protein product	"""NY REN 24 antigen"", ""functional spliceosome-associated protein c"", ""cactin homolog (Drosophila)"""		"""chromosome 19 open reading frame 29"""	C19orf29		8619474, 9110174, 21429463, 20829348	Standard	NM_001080543		Approved	NY-REN-24, fSAPc, cactin	uc002lyh.3	Q8WUQ7		ENST00000429344.2:c.2226C>T	19.37:g.3611972G>A		Somatic	137	0		WXS	Illumina GAIIx	Phase_I	160	6	NM_021231	0	0	8	8	0	A6NNA9|A9UL12|O75229|Q7LE08|Q9BTA6|Q9Y5A4	Silent	SNP	ENST00000429344.2	37	CCDS45920.1	1005	0.46016483516483514	155	0.3150406504065041	220	0.6077348066298343	189	0.3304195804195804	441	0.5817941952506597	G	13.87	2.366515	0.41902	0.359891	0.570554	ENSG00000226800	ENST00000447295	.	.	.	4.3	-3.21	0.05140	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.09310	P	0.999999999882838	.	.	.	.	.	.	T	0.43556	-0.9384	4	0.09338	T	0.73	.	6.3668	0.21459	0.6301:0.1558:0.2141:0.0	rs2158935;rs58676824;rs2158935	.	.	.	I	82	.	ENSP00000412459:V82I	V	+	1	0	C19orf29OS	3562972	0.043000	0.20138	0.988000	0.46212	0.980000	0.70556	-0.748000	0.04818	-0.334000	0.08463	0.637000	0.83480	GTT	G|0.545;A|0.455		0.637	CACTIN-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000457370.2		
CCDC105	126402	hgsc.bcm.edu	37	19	15133926	15133926	+	Missense_Mutation	SNP	C	C	A	rs8112667	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr19:15133926C>A	ENST00000292574.3	+	7	1577	c.1495C>A	c.(1495-1497)Ccc>Acc	p.P499T		NM_173482.2	NP_775753.2	Q8IYK2	CC105_HUMAN	coiled-coil domain containing 105	499			P -> T (in dbSNP:rs8112667).			extracellular vesicular exosome (GO:0070062)				NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(4)|skin(2)	23						CAGCGCGGACCCCTAGTGACC	0.716													c|||	1705	0.340455	0.1929	0.438	5008	,	,		11943	0.5208		0.2326	False		,,,				2504	0.3957				p.P499T		.											.	CCDC105-91	0			c.C1495A						.		THR/PRO	868,3356		95,678,1339	7.0	9.0	8.0		1495	-6.6	0.0	19	dbSNP_116	8	1799,6519		206,1387,2566	yes	missense	CCDC105	NM_173482.2	38	301,2065,3905	AA,AC,CC		21.6278,20.5492,21.2646	benign	499/500	15133926	2667,9875	2112	4159	6271	SO:0001583	missense	126402	exon7			GCGGACCCCTAGT	AK097684	CCDS12322.1	19p13.12	2008-02-05				ENSG00000160994			26866	protein-coding gene	gene with protein product						12477932	Standard	NM_173482		Approved	FLJ40365	uc002nae.2	Q8IYK2		ENST00000292574.3:c.1495C>A	19.37:g.15133926C>A	ENSP00000292574:p.Pro499Thr	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	23	11	NM_173482	0	0	0	0	0	Q8N7T5|Q8NDL5	Missense_Mutation	SNP	ENST00000292574.3	37	CCDS12322.1	718	0.32875457875457875	102	0.2073170731707317	139	0.3839779005524862	297	0.5192307692307693	180	0.23746701846965698	c	12.70	2.017064	0.35606	0.205492	0.216278	ENSG00000160994	ENST00000292574	T	0.15139	2.45	3.29	-6.58	0.01836	.	1.321340	0.05609	N	0.577760	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.44528	-0.9322	9	0.87932	D	0	.	0.9387	0.01351	0.3527:0.1586:0.3022:0.1865	rs8112667;rs59368867;rs8112667	499	Q8IYK2	CC105_HUMAN	T	499	ENSP00000292574:P499T	ENSP00000292574:P499T	P	+	1	0	CCDC105	14994926	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.281000	0.00528	-1.857000	0.01159	-1.528000	0.00924	CCC	C|0.671;A|0.329		0.716	CCDC105-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466293.1	NM_173482	
NR2F6	2063	hgsc.bcm.edu	37	19	17346441	17346441	+	Silent	SNP	A	A	T	rs146497684	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr19:17346441A>T	ENST00000291442.3	-	3	1526	c.807T>A	c.(805-807)ccT>ccA	p.P269P		NM_005234.3	NP_005225.2	P10588	NR2F6_HUMAN	nuclear receptor subfamily 2, group F, member 6	269	Ligand-binding. {ECO:0000250}.				detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|entrainment of circadian clock by photoperiod (GO:0043153)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron development (GO:0048666)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|thyroid hormone receptor activity (GO:0004887)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(1)|lung(1)	5						CGGCGGCCATAGGCGCGGCGT	0.731													A|||	59	0.0117812	0.0015	0.0231	5008	,	,		10659	0.0		0.0328	False		,,,				2504	0.0082				p.P269P		.											.	NR2F6-186	0			c.T807A						.	A		13,3163		0,13,1575	3.0	3.0	3.0		807	3.6	1.0	19	dbSNP_134	3	173,6395		0,173,3111	no	coding-synonymous	NR2F6	NM_005234.3		0,186,4686	TT,TA,AA		2.634,0.4093,1.9089		269/405	17346441	186,9558	1588	3284	4872	SO:0001819	synonymous_variant	2063	exon3			GGCCATAGGCGCG	X12794	CCDS12352.1	19p13.11	2013-09-20			ENSG00000160113	ENSG00000160113		"""Nuclear hormone receptors"""	7977	protein-coding gene	gene with protein product		132880		ERBAL2		2905047	Standard	NM_005234		Approved	EAR-2	uc002nfq.3	P10588	OTTHUMG00000182728	ENST00000291442.3:c.807T>A	19.37:g.17346441A>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	19	8	NM_005234	0	0	4	7	3	B2RC68|Q5XGA0|Q6P586|Q9BUE8	Silent	SNP	ENST00000291442.3	37	CCDS12352.1																																																																																			A|0.983;T|0.016		0.731	NR2F6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463325.1		
GDF15	9518	bcgsc.ca	37	19	18497024	18497024	+	Missense_Mutation	SNP	G	G	C	rs1059519	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr19:18497024G>C	ENST00000252809.3	+	1	57	c.25G>C	c.(25-27)Gtg>Ctg	p.V9L	MIR3189_ENST00000578735.1_RNA	NM_004864.2	NP_004855.2	Q99988	GDF15_HUMAN	growth differentiation factor 15	9			V -> L (in dbSNP:rs1059519). {ECO:0000269|PubMed:9326641, ECO:0000269|PubMed:9348093, ECO:0000269|PubMed:9593718, ECO:0000269|Ref.5}.		cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cytokine activity (GO:0005125)	p.V9L(1)		kidney(2)|large_intestine(1)|liver(1)|lung(5)|prostate(2)|skin(1)	12						ACTCAGGACGGTGAATGGCTC	0.647													C|||	3566	0.712061	0.8215	0.7017	5008	,	,		13295	0.6835		0.675	False		,,,				2504	0.6391				p.V9L		.											.	GDF15-650	1	Substitution - Missense(1)	skin(1)	c.G25C						.	C	LEU/VAL	3467,939	354.4+/-312.6	1367,733,103	50.0	52.0	51.0		25	-1.7	0.0	19	dbSNP_86	51	5670,2930	455.5+/-363.8	1867,1936,497	yes	missense	GDF15	NM_004864.2	32	3234,2669,600	CC,CG,GG		34.0698,21.3118,29.7478	benign	9/309	18497024	9137,3869	2203	4300	6503	SO:0001583	missense	9518	exon1			AGGACGGTGAATG	BC008962	CCDS12376.1	19p13.11	2008-05-14				ENSG00000130513			30142	protein-coding gene	gene with protein product	"""prostate differentiation factor"""	605312				11895857, 9593718	Standard	NM_004864		Approved	PLAB, MIC-1, PDF, MIC1, NAG-1, PTGFB	uc002niv.2	Q99988		ENST00000252809.3:c.25G>C	19.37:g.18497024G>C	ENSP00000252809:p.Val9Leu	Somatic	125	0		WXS	Illumina GAIIx	Phase_I	164	7	NM_004864	0	0	14	14	0	O14629|P78360|Q9BWA0|Q9NRT0	Missense_Mutation	SNP	ENST00000252809.3	37	CCDS12376.1	1580	0.7234432234432234	402	0.8170731707317073	262	0.7237569060773481	397	0.6940559440559441	519	0.6846965699208444	C	1.154	-0.645698	0.03531	0.786882	0.659302	ENSG00000130513	ENST00000252809	D	0.81908	-1.55	3.56	-1.7	0.08159	.	2.072990	0.03063	N	0.156134	T	0.00012	0.0000	N	0.03608	-0.345	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.40289	-0.9571	9	0.24483	T	0.36	1.3119	1.2396	0.01960	0.1628:0.3099:0.3193:0.2079	rs1059519;rs3170464;rs3746178;rs17526133;rs17655460;rs61009832;rs1059519	9	Q99988	GDF15_HUMAN	L	9	ENSP00000252809:V9L	ENSP00000252809:V9L	V	+	1	0	GDF15	18358024	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.408000	0.07169	-0.515000	0.06479	-0.647000	0.03941	GTG	G|0.399;C|0.601		0.647	GDF15-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466340.2	NM_004864	
ZNF99	7652	bcgsc.ca	37	19	22941591	22941591	+	Missense_Mutation	SNP	A	A	T	rs62119159	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr19:22941591A>T	ENST00000596209.1	-	4	1210	c.1120T>A	c.(1120-1122)Tgc>Agc	p.C374S	ZNF99_ENST00000397104.3_Missense_Mutation_p.C283S	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99	374					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.C283S(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				GCTTTGCCGCATTCTTCATAT	0.363													A|||	448	0.0894569	0.0681	0.0879	5008	,	,		19708	0.0933		0.0934	False		,,,				2504	0.1115				p.C374S		.											.	ZNF99-24	1	Substitution - Missense(1)	stomach(1)	c.T1120A						.	A	SER/CYS	265,3805		9,247,1779	87.0	94.0	92.0		847	1.1	0.0	19	dbSNP_129	92	767,7637		39,689,3474	no	missense	ZNF99	NM_001080409.2	112	48,936,5253	TT,TA,AA		9.1266,6.5111,8.2732	probably-damaging	283/912	22941591	1032,11442	2035	4202	6237	SO:0001583	missense	7652	exon4			TGCCGCATTCTTC	BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4		ENST00000596209.1:c.1120T>A	19.37:g.22941591A>T	ENSP00000472969:p.Cys374Ser	Somatic	46	0		WXS	Illumina GAIIx	Phase_I	24	4	NM_001080409	0	0	0	0	0	M0R335	Missense_Mutation	SNP	ENST00000596209.1	37	CCDS59369.1	191	0.08745421245421245	35	0.07113821138211382	39	0.10773480662983426	52	0.09090909090909091	65	0.08575197889182058	N	9.311	1.055510	0.19907	0.065111	0.091266	ENSG00000213973	ENST00000397104	D	0.85861	-2.04	1.12	1.12	0.20585	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.31167	0.0788	H	0.96996	3.92	0.33547	P	0.40431799999999996	D	0.89917	1.0	D	0.97110	1.0	T	0.72394	-0.4307	8	0.72032	D	0.01	.	5.689	0.17819	1.0:0.0:0.0:0.0	rs62119159	283	A8MXY4	ZNF99_HUMAN	S	283	ENSP00000380293:C283S	ENSP00000380293:C283S	C	-	1	0	ZNF99	22733431	0.899000	0.30636	0.032000	0.17829	0.031000	0.12232	4.564000	0.60830	0.465000	0.27167	0.325000	0.21440	TGC	A|0.911;T|0.089		0.363	ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000464591.1	XM_065124	
NUDT19	390916	hgsc.bcm.edu	37	19	33183352	33183352	+	Silent	SNP	G	G	C	rs61732600	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr19:33183352G>C	ENST00000397061.3	+	1	486	c.486G>C	c.(484-486)ccG>ccC	p.P162P	CTD-2538C1.2_ENST00000592431.1_lincRNA	NM_001105570.1	NP_001099040.1	A8MXV4	NUD19_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 19	162	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.					mitochondrion (GO:0005739)|peroxisome (GO:0005777)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)|receptor binding (GO:0005102)			endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	8	Esophageal squamous(110;0.137)					AGCCACCGCCGGGCCTGGCCT	0.751													G|||	1109	0.221446	0.1498	0.245	5008	,	,		11161	0.249		0.3062	False		,,,				2504	0.1861				p.P162P		.											.	NUDT19-22	0			c.G486C						.	G		469,2861		40,389,1236	4.0	5.0	5.0		486	-9.6	0.0	19	dbSNP_129	5	1887,5465		292,1303,2081	no	coding-synonymous	NUDT19	NM_001105570.1		332,1692,3317	CC,CG,GG		25.6665,14.0841,22.0558		162/376	33183352	2356,8326	1665	3676	5341	SO:0001819	synonymous_variant	390916	exon1			ACCGCCGGGCCTG		CCDS42543.1	19q13.11	2011-11-16			ENSG00000213965	ENSG00000213965		"""Nudix motif containing"""	32036	protein-coding gene	gene with protein product							Standard	NM_001105570		Approved	RP2	uc010edf.3	A8MXV4		ENST00000397061.3:c.486G>C	19.37:g.33183352G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	13	7	NM_001105570	0	0	0	0	0		Silent	SNP	ENST00000397061.3	37	CCDS42543.1																																																																																			G|0.743;C|0.257		0.751	NUDT19-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000450338.3	XM_372723	
MAP3K10	4294	hgsc.bcm.edu	37	19	40720079	40720079	+	Silent	SNP	C	C	T	rs3746005	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr19:40720079C>T	ENST00000253055.3	+	9	2781	c.2493C>T	c.(2491-2493)gaC>gaT	p.D831D		NM_002446.3	NP_002437.2	Q02779	M3K10_HUMAN	mitogen-activated protein kinase kinase kinase 10	831					activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|JNK cascade (GO:0007254)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of apoptotic process (GO:0043065)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|protein autophosphorylation (GO:0046777)|signal transduction (GO:0007165)|smoothened signaling pathway (GO:0007224)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|bHLH transcription factor binding (GO:0043425)|JUN kinase kinase kinase activity (GO:0004706)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription corepressor activity (GO:0003714)			NS(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	24						CGCCATCGGACGGGGCGCTGG	0.716													C|||	3754	0.749601	0.7753	0.7392	5008	,	,		8943	0.6974		0.7485	False		,,,				2504	0.7771				p.D831D		.											.	MAP3K10-981	0			c.C2493T						.	C		2775,495		1188,399,48	2.0	3.0	3.0		2493	-3.8	0.9	19	dbSNP_107	3	5211,1383		2065,1081,151	no	coding-synonymous	MAP3K10	NM_002446.3		3253,1480,199	TT,TC,CC		20.9736,15.1376,19.0389		831/955	40720079	7986,1878	1635	3297	4932	SO:0001819	synonymous_variant	4294	exon9			ATCGGACGGGGCG	X90846	CCDS12549.1	19q13.2	2014-08-12			ENSG00000130758		2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6849	protein-coding gene	gene with protein product	"""MKN28 kinase"", ""mixed lineage kinase 2"", ""MKN28 derived nonreceptor_type serine/threonine kinase"""	600137		MLK2		8536694, 7731697	Standard	NM_002446		Approved	MST, MEKK10	uc002ona.3	Q02779	OTTHUMG00000182591	ENST00000253055.3:c.2493C>T	19.37:g.40720079C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_002446	0	0	0	1	1	Q12761|Q14871	Silent	SNP	ENST00000253055.3	37	CCDS12549.1																																																																																			C|0.260;T|0.740		0.716	MAP3K10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462552.1	NM_002446	
CEACAM20	125931	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	45028106	45028106	+	RNA	SNP	G	G	A			TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr19:45028106G>A	ENST00000454753.1	-	0	663							Q6UY09	CEA20_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 20							integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|prostate(1)	15		Prostate(69;0.0352)				TCCTCCCGCTGGACAATGAGA	0.532																																					p.Q129X		.											.	CEACAM20-67	0			c.C385T						.						74.0	73.0	73.0					19																	45028106		2084	4228	6312			125931	exon3			CCCGCTGGACAAT	AY358129	CCDS74390.1, CCDS74391.1, CCDS74392.1, CCDS74393.1	19q13.31	2013-01-30			ENSG00000176395	ENSG00000273777		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	24879	protein-coding gene	gene with protein product						12975309	Standard	NM_001102600		Approved	UNQ9366	uc010ejo.1	Q6UY09	OTTHUMG00000151532		19.37:g.45028106G>A		Somatic	386	0		WXS	Illumina GAIIx	Phase_I	466	192	NM_001102600	0	0	0	0	0		Nonsense_Mutation	SNP	ENST00000454753.1	37																																																																																				.		0.532	CEACAM20-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000323032.1	NM_198444	
ERCC2	2068	hgsc.bcm.edu	37	19	45867259	45867259	+	Missense_Mutation	SNP	C	C	T	rs1799793	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr19:45867259C>T	ENST00000391945.4	-	10	1011	c.934G>A	c.(934-936)Gac>Aac	p.D312N	ERCC2_ENST00000485403.2_Missense_Mutation_p.D288N|ERCC2_ENST00000391940.4_Missense_Mutation_p.D288N|ERCC2_ENST00000221481.6_3'UTR|ERCC2_ENST00000391944.3_Missense_Mutation_p.D234N	NM_000400.3	NP_000391.1	P18074	ERCC2_HUMAN	excision repair cross-complementation group 2	312			D -> N (in dbSNP:rs1799793). {ECO:0000269|PubMed:11245433, ECO:0000269|PubMed:11470747, ECO:0000269|PubMed:11709541, ECO:0000269|Ref.3}.		7-methylguanosine mRNA capping (GO:0006370)|aging (GO:0007568)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|central nervous system myelin formation (GO:0032289)|chromosome segregation (GO:0007059)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)|embryonic cleavage (GO:0040016)|erythrocyte maturation (GO:0043249)|extracellular matrix organization (GO:0030198)|gene expression (GO:0010467)|hair cell differentiation (GO:0035315)|hair follicle maturation (GO:0048820)|hematopoietic stem cell differentiation (GO:0060218)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision (GO:0033683)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral transcription (GO:0050434)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to hypoxia (GO:0001666)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|spinal cord development (GO:0021510)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)|viral process (GO:0016032)	cytoplasm (GO:0005737)|holo TFIIH complex (GO:0005675)|MMXD complex (GO:0071817)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	4 iron, 4 sulfur cluster binding (GO:0051539)|5'-3' DNA helicase activity (GO:0043139)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			large_intestine(4)|lung(2)|ovary(1)|pancreas(1)|stomach(1)	9		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		AGCACTTCGTCGGGCAGCACG	0.746			"""Mis, N, F, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum				C|||	974	0.194489	0.0734	0.1988	5008	,	,		10423	0.0496		0.3588	False		,,,				2504	0.3354				p.D312N		.	yes	Rec		Xeroderma pigmentosum (D)	19	19q13.2-q13.3	2068	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 (xeroderma pigmentosum D)"""		E	.	ERCC2-848	0			c.G934A	GRCh37	CM015299	ERCC2	M	rs1799793	.	C	ASN/ASP,ASN/ASP	387,3577		30,327,1625	5.0	8.0	7.0		934,862	5.2	0.5	19	dbSNP_89	7	2507,5397		444,1619,1889	no	missense,missense	ERCC2	NM_000400.3,NM_001130867.1	23,23	474,1946,3514	TT,TC,CC		31.7181,9.7629,24.3849	benign,benign	312/761,288/406	45867259	2894,8974	1982	3952	5934	SO:0001583	missense	2068	exon10	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	CTTCGTCGGGCAG		CCDS33049.1, CCDS46112.1	19q13.3	2014-09-17	2014-03-07		ENSG00000104884	ENSG00000104884	3.6.4.12	"""General transcription factor IIH complex subunits"""	3434	protein-coding gene	gene with protein product	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 protein"", ""TFIIH basal transcription factor complex helicase XPB subunit"""	126340	"""xeroderma pigmentosum complementary group D"", ""excision repair cross-complementing rodent repair deficiency, complementation group 2"""	XPD		8413672, 2184031	Standard	NM_000400		Approved	MAG, EM9, MGC102762, MGC126218, MGC126219, TFIIH	uc002pbj.2	P18074	OTTHUMG00000048190	ENST00000391945.4:c.934G>A	19.37:g.45867259C>T	ENSP00000375809:p.Asp312Asn	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	20	8	NM_000400	0	0	8	18	10	Q2TB78|Q2YDY2|Q7KZU6|Q8N721	Missense_Mutation	SNP	ENST00000391945.4	37	CCDS33049.1	423	0.1936813186813187	34	0.06910569105691057	70	0.19337016574585636	38	0.06643356643356643	281	0.370712401055409	C	20.0	3.930510	0.73327	0.097629	0.317181	ENSG00000104884	ENST00000391941;ENST00000391942;ENST00000391945;ENST00000391944;ENST00000391940	T;T;T	0.64438	-0.1;-0.1;-0.1	5.15	5.15	0.70609	Domain of unknown function DUF1227 (1);	0.000000	0.85682	D	0.000000	T	0.00012	0.0000	L	0.46947	1.48	0.09310	P	1.0	B;P;B	0.34639	0.065;0.461;0.053	B;B;B	0.35353	0.059;0.201;0.051	T	0.28267	-1.0049	9	0.33940	T	0.23	-30.0006	16.1268	0.81402	0.0:1.0:0.0:0.0	rs1799793;rs3916814;rs58989209;rs1799793	234;288;312	E7EVE9;Q7KZU6;P18074	.;.;ERCC2_HUMAN	N	262;288;312;234;288	ENSP00000375809:D312N;ENSP00000375808:D234N;ENSP00000375804:D288N	ENSP00000375804:D288N	D	-	1	0	ERCC2	50559099	1.000000	0.71417	0.523000	0.27875	0.865000	0.49528	7.192000	0.77771	2.388000	0.81334	0.561000	0.74099	GAC	C|0.804;T|0.196		0.746	ERCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109626.2	NM_000400	
INAFM1	255783	hgsc.bcm.edu	37	19	47778412	47778412	+	Missense_Mutation	SNP	G	G	T	rs1055218	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr19:47778412G>T	ENST00000552360.2	+	1	271	c.236G>T	c.(235-237)cGc>cTc	p.R79L		NM_178511.5	NP_848606.3														skin(1)	1						TGTGCTGCCCGCCCGGGCGTG	0.776													G|||	1999	0.399161	0.3162	0.3876	5008	,	,		5503	0.5942		0.331	False		,,,				2504	0.3885				p.R79L		.											.	.	0			c.G236T						.						6.0	6.0	6.0					19																	47778412		676	1545	2221	SO:0001583	missense	255783	exon1			CTGCCCGCCCGGG																												ENST00000552360.2:c.236G>T	19.37:g.47778412G>T	ENSP00000447679:p.Arg79Leu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	5	NM_178511	0	0	0	0	0		Missense_Mutation	SNP	ENST00000552360.2	37	CCDS46131.1	909	0.41620879120879123	179	0.3638211382113821	137	0.3784530386740331	319	0.5576923076923077	274	0.36147757255936674	G	5.764	0.325396	0.10900	.	.	ENSG00000257704;ENSG00000232427	ENST00000552360;ENST00000422073	.	.	.	2.47	-0.147	0.13428	.	.	.	.	.	T	0.00012	0.0000	N	0.22421	0.69	0.80722	P	0.0	P	0.35307	0.494	B	0.20184	0.028	T	0.45862	-0.9232	7	0.35671	T	0.21	.	3.1104	0.06356	0.1831:0.2892:0.5277:0.0	rs1055218;rs3195715;rs17418921;rs57061764	79	C9JVW0	PRR24_HUMAN	L	132;79	.	ENSP00000447679:R132L	R	+	2	0	PRR24;AC008532.1	52470252	0.002000	0.14202	0.007000	0.13788	0.039000	0.13416	-0.171000	0.09883	0.370000	0.24538	0.456000	0.33151	CGC	G|0.585;T|0.415		0.776	PRR24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407505.2		
GRIN2D	2906	hgsc.bcm.edu	37	19	48945880	48945880	+	Silent	SNP	T	T	C	rs62130268	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr19:48945880T>C	ENST00000263269.3	+	13	2785	c.2697T>C	c.(2695-2697)gcT>gcC	p.A899A		NM_000836.2	NP_000827.2	O15399	NMDE4_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2D	899					adult locomotory behavior (GO:0008344)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|regulation of sensory perception of pain (GO:0051930)|signal transduction (GO:0007165)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)			autonomic_ganglia(1)|breast(6)|endometrium(2)|large_intestine(9)|lung(12)|ovary(5)|pancreas(1)|prostate(1)	37		all_epithelial(76;1.11e-06)|all_lung(116;5.79e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		all cancers(93;0.00014)|OV - Ovarian serous cystadenocarcinoma(262;0.000233)|Epithelial(262;0.0112)|GBM - Glioblastoma multiforme(486;0.0161)	Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GCTGCAGCGCTGAGGCCGCCC	0.781													c|||	3742	0.747204	0.6188	0.8545	5008	,	,		4716	0.6548		0.8887	False		,,,				2504	0.7945				p.A899A		.											.	GRIN2D-156	0			c.T2697C						.			1689,437		638,413,12	1.0	1.0	1.0		2697	-3.3	1.0	19	dbSNP_129	1	3712,202		1757,198,2	no	coding-synonymous	GRIN2D	NM_000836.2		2395,611,14	CC,CT,TT		5.161,20.555,10.5795		899/1337	48945880	5401,639	1063	1957	3020	SO:0001819	synonymous_variant	2906	exon13			CAGCGCTGAGGCC	U77783	CCDS12719.1	19q13.33	2012-08-29			ENSG00000105464	ENSG00000105464		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4588	protein-coding gene	gene with protein product	"""N-methyl-d-aspartate receptor subunit 2D"""	602717		NMDAR2D		9480759, 9418891	Standard	NM_000836		Approved	GluN2D, EB11, NR2D	uc002pjc.4	O15399		ENST00000263269.3:c.2697T>C	19.37:g.48945880T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_000836	0	0	0	0	0		Silent	SNP	ENST00000263269.3	37	CCDS12719.1																																																																																			T|0.245;C|0.755		0.781	GRIN2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466121.1		
PTH2	113091	broad.mit.edu	37	19	49926533	49926533	+	Missense_Mutation	SNP	G	G	C	rs200733272|rs371950649	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr19:49926533G>C	ENST00000270631.1	-	1	165	c.64C>G	c.(64-66)Ctg>Gtg	p.L22V	CTD-3148I10.1_ENST00000576655.1_5'Flank	NM_178449.3	NP_848544.1	Q96A98	TIP39_HUMAN	parathyroid hormone 2	22					neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)		p.L22V(2)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|skin(1)	6				OV - Ovarian serous cystadenocarcinoma(262;0.0015)|GBM - Glioblastoma multiforme(486;0.044)|Lung(386;0.0785)|LUSC - Lung squamous cell carcinoma(496;0.0836)		GGCACCACcagcagcagcagc	0.692													g|||	17	0.00339457	0.003	0.0043	5008	,	,		11369	0.004		0.002	False		,,,				2504	0.0041				p.L22V		.											.	PTH2-22	2	Substitution - Missense(2)	endometrium(2)	c.C64G						.		VAL/LEU	12,4376		0,12,2182	12.0	16.0	14.0		64	3.3	0.0	19		14	11,8561		0,11,4275	no	missense	PTH2	NM_178449.3	32	0,23,6457	CC,CG,GG		0.1283,0.2735,0.1775	possibly-damaging	22/101	49926533	23,12937	2194	4286	6480	SO:0001583	missense	113091	exon1			CCACCAGCAGCAG	AY037555	CCDS12763.1	19q13.33	2013-02-28				ENSG00000142538		"""Endogenous ligands"""	30828	protein-coding gene	gene with protein product	"""tuberoinfundibular 39 residues"""	608386				11861531	Standard	NM_178449		Approved	TIP39	uc002pnn.1	Q96A98		ENST00000270631.1:c.64C>G	19.37:g.49926533G>C	ENSP00000270631:p.Leu22Val	Somatic	19	0		WXS	Illumina GAIIx	Phase_I	62	4	NM_178449	0	0	0	0	0	Q96DJ4	Missense_Mutation	SNP	ENST00000270631.1	37	CCDS12763.1	.	.	.	.	.	.	.	.	.	.	g	6.292	0.421904	0.11928	0.002735	0.001283	ENSG00000142538	ENST00000270631	.	.	.	4.3	3.26	0.37387	.	0.489236	0.15528	U	0.257640	T	0.26521	0.0648	L	0.27053	0.805	0.09310	N	1	P	0.46142	0.873	B	0.39419	0.299	T	0.08066	-1.0740	9	0.87932	D	0	-7.2733	12.3672	0.55234	0.0:0.1717:0.8283:0.0	.	22	Q96A98	TIP39_HUMAN	V	22	.	ENSP00000270631:L22V	L	-	1	2	PTH2	54618345	0.088000	0.21588	0.012000	0.15200	0.011000	0.07611	-0.504000	0.06375	0.947000	0.37659	-0.370000	0.07254	CTG	.		0.692	PTH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465366.1	NM_178449	
TSKS	60385	hgsc.bcm.edu	37	19	50249905	50249905	+	Missense_Mutation	SNP	T	T	C	rs57733064	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr19:50249905T>C	ENST00000246801.3	-	6	896	c.814A>G	c.(814-816)Agc>Ggc	p.S272G	TSKS_ENST00000358830.3_Missense_Mutation_p.S72G	NM_021733.1	NP_068379.1	Q9UJT2	TSKS_HUMAN	testis-specific serine kinase substrate	272				S -> G (in Ref. 2; AAL60464). {ECO:0000305}.	negative regulation of phosphatase activity (GO:0010923)	centriole (GO:0005814)	protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(12)|liver(1)|lung(9)|prostate(3)|skin(3)	38		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00153)|GBM - Glioblastoma multiforme(134;0.0145)		GGGCCCAGGCTGTTCCAGGAG	0.726													C|||	485	0.096845	0.1581	0.0403	5008	,	,		12470	0.123		0.0487	False		,,,				2504	0.0767				p.S272G		.											.	TSKS-154	0			c.A814G						.	C	GLY/SER	574,3796		28,518,1639	12.0	13.0	13.0		814	-0.3	0.5	19	dbSNP_129	13	398,8132		12,374,3879	yes	missense	TSKS	NM_021733.1	56	40,892,5518	CC,CT,TT		4.6659,13.135,7.5349	benign	272/593	50249905	972,11928	2185	4265	6450	SO:0001583	missense	60385	exon6			CCAGGCTGTTCCA	BC058862	CCDS12780.1	19q13.3	2014-06-13							30719	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 161"""	608253				11444856, 18495105	Standard	NM_021733		Approved	TSSKS, PPP1R161	uc002ppm.3	Q9UJT2		ENST00000246801.3:c.814A>G	19.37:g.50249905T>C	ENSP00000246801:p.Ser272Gly	Somatic	3	0		WXS	Illumina GAIIx	Phase_I	14	7	NM_021733	0	0	0	0	0	Q8WXJ0	Missense_Mutation	SNP	ENST00000246801.3	37	CCDS12780.1	193	0.08836996336996338	72	0.14634146341463414	18	0.049723756906077346	69	0.12062937062937062	34	0.044854881266490766	C	0.009	-1.811839	0.00600	0.13135	0.046659	ENSG00000126467	ENST00000246801;ENST00000358830	T;T	0.28255	1.62;1.62	4.56	-0.316	0.12743	.	0.341445	0.21371	N	0.075624	T	0.00039	0.0001	N	0.03608	-0.345	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.29119	-1.0022	9	0.11182	T	0.66	-14.028	2.784	0.05369	0.3313:0.3626:0.0:0.3061	rs57733064	272	Q9UJT2	TSKS_HUMAN	G	272;72	ENSP00000246801:S272G;ENSP00000351691:S72G	ENSP00000246801:S272G	S	-	1	0	TSKS	54941717	0.071000	0.21146	0.461000	0.27105	0.004000	0.04260	0.561000	0.23515	-0.051000	0.13334	-2.598000	0.00163	AGC	T|0.911;C|0.089		0.726	TSKS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465795.1	NM_021733	
ASPDH	554235	hgsc.bcm.edu	37	19	51015404	51015404	+	Missense_Mutation	SNP	T	T	C	rs12977172	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr19:51015404T>C	ENST00000389208.4	-	6	858	c.797A>G	c.(796-798)cAg>cGg	p.Q266R	JOSD2_ENST00000391815.3_5'Flank|JOSD2_ENST00000598418.1_5'Flank|JOSD2_ENST00000595669.1_5'Flank|ASPDH_ENST00000376916.3_Missense_Mutation_p.Q161R|ASPDH_ENST00000597030.1_5'Flank|JOSD2_ENST00000601423.1_5'Flank	NM_001114598.1	NP_001108070.1	A6ND91	ASPD_HUMAN	aspartate dehydrogenase domain containing	266			Q -> R (in dbSNP:rs12977172). {ECO:0000269|PubMed:15489334, ECO:0000269|Ref.1}.		NAD biosynthetic process (GO:0009435)|NADP catabolic process (GO:0006742)		aspartate dehydrogenase activity (GO:0033735)|NADP binding (GO:0050661)			endometrium(1)|large_intestine(1)|lung(1)	3						CAGGAGGCTCTGCCAGAAGGC	0.706													C|||	3986	0.795927	0.9728	0.7781	5008	,	,		10864	0.7143		0.6849	False		,,,				2504	0.7679				p.Q266R		.											.	ASPDH-90	0			c.A797G						.	C	ARG/GLN,ARG/GLN	3799,331		1771,257,37	6.0	9.0	8.0		482,797	1.9	1.0	19	dbSNP_121	8	5527,2593		1919,1689,452	no	missense,missense	ASPDH	NM_001024656.2,NM_001114598.1	43,43	3690,1946,489	CC,CT,TT		31.9335,8.0145,23.8694	benign,benign	161/179,266/284	51015404	9326,2924	2065	4060	6125	SO:0001583	missense	554235	exon6			AGGCTCTGCCAGA		CCDS33082.1, CCDS46153.1	19q13.33	2012-10-02			ENSG00000204653	ENSG00000204653			33856	protein-coding gene	gene with protein product							Standard	NM_001024656		Approved		uc010enz.3	A6ND91		ENST00000389208.4:c.797A>G	19.37:g.51015404T>C	ENSP00000373860:p.Gln266Arg	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	8	NM_001114598	0	0	0	0	0	Q6NZ37	Missense_Mutation	SNP	ENST00000389208.4	37	CCDS46153.1	1681	0.7696886446886447	481	0.9776422764227642	273	0.7541436464088398	412	0.7202797202797203	515	0.679419525065963	C	3.606	-0.080592	0.07141	0.919855	0.680665	ENSG00000204653	ENST00000376916;ENST00000389208	T;T	0.39997	1.05;1.05	2.95	1.88	0.25563	Aspartate dehydrogenase (1);	1.158050	0.06646	N	0.761872	T	0.00012	0.0000	N	0.01705	-0.755	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.30794	-0.9966	9	0.06099	T	0.92	-1.7519	4.8935	0.13738	0.0:0.6813:0.0:0.3187	rs12977172	266;161	A6ND91;A6ND91-2	ASPD_HUMAN;.	R	161;266	ENSP00000366114:Q161R;ENSP00000373860:Q266R	ENSP00000366114:Q161R	Q	-	2	0	ASPDH	55707216	0.916000	0.31088	0.989000	0.46669	0.553000	0.35397	0.171000	0.16685	0.125000	0.18397	-0.355000	0.07637	CAG	T|0.228;C|0.772		0.706	ASPDH-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464861.1	NM_001024656	
SSC5D	284297	hgsc.bcm.edu	37	19	56000755	56000755	+	Silent	SNP	C	C	T			TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr19:56000755C>T	ENST00000389623.6	+	3	110	c.87C>T	c.(85-87)tgC>tgT	p.C29C	SSC5D_ENST00000587166.1_Silent_p.C29C	NM_001144950.1	NP_001138422.1	A1L4H1	SRCRL_HUMAN	scavenger receptor cysteine rich family, 5 domains	29	SRCR 1. {ECO:0000255|PROSITE- ProRule:PRU00196}.				defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterial lipoprotein (GO:0042494)|innate immune response (GO:0045087)|multicellular organismal development (GO:0007275)|negative regulation of interleukin-8 secretion (GO:2000483)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|intracellular (GO:0005622)|membrane (GO:0016020)	extracellular matrix binding (GO:0050840)|fibronectin binding (GO:0001968)|laminin binding (GO:0043236)|scavenger receptor activity (GO:0005044)			NS(1)|breast(1)|skin(2)	4						CCCATGGGTGCGCTGGCCGCC	0.726																																					p.C29C		.											.	.	0			c.C87T						.						2.0	4.0	3.0					19																	56000755		561	1357	1918	SO:0001819	synonymous_variant	284297	exon3			TGGGTGCGCTGGC		CCDS46196.1, CCDS59424.1	19q13.42	2014-07-09	2014-07-09		ENSG00000179954	ENSG00000179954			26641	protein-coding gene	gene with protein product	"""soluble scavenger with 5 domains"""		"""scavenger receptor cysteine rich domain containing (5 domains)"""			19535143	Standard	NM_001144950		Approved	FLJ35258	uc002qlg.4	A1L4H1		ENST00000389623.6:c.87C>T	19.37:g.56000755C>T		Somatic	3	0		WXS	Illumina GAIIx	Phase_I	51	28	NM_001195267	0	0	0	0	0	B5MDQ5|C7S7T9|C7S7U0|K7EP70	Silent	SNP	ENST00000389623.6	37	CCDS46196.1																																																																																			.		0.726	SSC5D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453345.2	XM_001718392	
ZNF787	126208	hgsc.bcm.edu	37	19	56599438	56599440	+	In_Frame_Del	DEL	TCG	TCG	-	rs5828672|rs71696054	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	TCG	TCG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr19:56599438_56599440delTCG	ENST00000270459.3	-	3	1219_1221	c.1101_1103delCGA	c.(1099-1104)gacgag>gag	p.D367del		NM_001002836.2	NP_001002836	Q6DD87	ZN787_HUMAN	zinc finger protein 787	367					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|lung(2)|pancreas(1)	5		Colorectal(82;3.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0559)		GCCCGCGGCCTCGTCGTCGTCGT	0.778														4509	0.900359	0.9939	0.732	5008	,	,		3238	0.7252		0.9821	False		,,,				2504	0.9898				p.367_368del		.											.	ZNF787-69	0			c.1101_1103del						.																																			SO:0001651	inframe_deletion	126208	exon3			GCGGCCTCGTCGT	BC077728, AF000560	CCDS42634.1	19q13.42	2013-01-08				ENSG00000142409		"""Zinc fingers, C2H2-type"""	26998	protein-coding gene	gene with protein product							Standard	NM_001002836		Approved		uc010eth.1	Q6DD87		ENST00000270459.3:c.1101_1103delCGA	19.37:g.56599447_56599449delTCG	ENSP00000270459:p.Asp367del	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	18	16	NM_001002836	0	0	0	0	0	O00455	In_Frame_Del	DEL	ENST00000270459.3	37	CCDS42634.1																																																																																			.		0.778	ZNF787-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457498.1	NM_001002836	
ZSCAN1	284312	hgsc.bcm.edu	37	19	58549354	58549354	+	Silent	SNP	C	C	T	rs113374422	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr19:58549354C>T	ENST00000282326.1	+	3	397	c.150C>T	c.(148-150)agC>agT	p.S50S	ZSCAN1_ENST00000391700.1_Silent_p.S50S|ZSCAN1_ENST00000601162.1_Silent_p.S50S	NM_182572.3	NP_872378.3	Q8NBB4	ZSCA1_HUMAN	zinc finger and SCAN domain containing 1	50	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	48		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)		ACGTGGCGAGCGGGCCGCACC	0.706													C|||	83	0.0165735	0.0038	0.0187	5008	,	,		10978	0.0		0.0586	False		,,,				2504	0.0061				p.S50S		.											.	ZSCAN1-92	0			c.C150T						.	C		34,4340		0,34,2153	14.0	16.0	15.0		150	-3.9	0.0	19	dbSNP_132	15	319,8239		2,315,3962	no	coding-synonymous	ZSCAN1	NM_182572.3		2,349,6115	TT,TC,CC		3.7275,0.7773,2.7297		50/409	58549354	353,12579	2187	4279	6466	SO:0001819	synonymous_variant	284312	exon3			GGCGAGCGGGCCG	AK091098	CCDS12969.1	19q13.43	2013-06-13	2004-04-21		ENSG00000152467	ENSG00000152467		"""-"", ""Zinc fingers, C2H2-type"""	23712	protein-coding gene	gene with protein product			"""zinc finger with SCAN domain 1"""			12477932	Standard	NM_182572		Approved	FLJ33779, ZNF915	uc002qrc.1	Q8NBB4	OTTHUMG00000183381	ENST00000282326.1:c.150C>T	19.37:g.58549354C>T		Somatic	2	0		WXS	Illumina GAIIx	Phase_I	92	42	NM_182572	0	0	0	0	0	Q3B798|Q6WLH8|Q86WS8	Silent	SNP	ENST00000282326.1	37	CCDS12969.1																																																																																			C|0.975;T|0.025		0.706	ZSCAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466427.1	NM_182572	
TPO	7173	hgsc.bcm.edu	37	2	1481231	1481231	+	Missense_Mutation	SNP	G	G	C	rs2175977	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr2:1481231G>C	ENST00000345913.4	+	8	1284	c.1193G>C	c.(1192-1194)aGc>aCc	p.S398T	TPO_ENST00000346956.3_Missense_Mutation_p.S398T|TPO_ENST00000329066.4_Missense_Mutation_p.S398T|TPO_ENST00000382201.3_Missense_Mutation_p.S398T|TPO_ENST00000497517.2_Intron|TPO_ENST00000382198.1_Intron|TPO_ENST00000349624.3_Intron|TPO_ENST00000337415.3_Missense_Mutation_p.S398T	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	398			S -> T (in dbSNP:rs2175977). {ECO:0000269|PubMed:7550241}.		cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	GGCCGCGCCAGCGAGGTCCCC	0.761													G|||	3557	0.710264	0.8185	0.6571	5008	,	,		9157	0.7758		0.6034	False		,,,				2504	0.6442				p.S398T		.											.	TPO-332	0			c.G1193C						.	G	THR/SER,THR/SER,THR/SER,THR/SER,THR/SER,	2498,394		1072,354,20	2.0	2.0	2.0		1193,1193,1193,1193,1193,	4.1	1.0	2	dbSNP_96	2	4199,1477		1511,1177,150	no	missense,missense,missense,missense,missense,intron	TPO	NM_000547.5,NM_001206744.1,NM_001206745.1,NM_175719.3,NM_175721.3,NM_175722.3	58,58,58,58,58,	2583,1531,170	CC,CG,GG		26.0218,13.6238,21.8371	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,	398/934,398/934,398/877,398/877,398/890,	1481231	6697,1871	1446	2838	4284	SO:0001583	missense	7173	exon8			GCGCCAGCGAGGT		CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.1193G>C	2.37:g.1481231G>C	ENSP00000318820:p.Ser398Thr	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	25	25	NM_175719	0	0	0	0	0	P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Missense_Mutation	SNP	ENST00000345913.4	37	CCDS1643.1	1512|1512	0.6923076923076923|0.6923076923076923	388|388	0.7886178861788617|0.7886178861788617	227|227	0.6270718232044199|0.6270718232044199	438|438	0.7657342657342657|0.7657342657342657	459|459	0.6055408970976254|0.6055408970976254	G|G	18.72|18.72	3.683431|3.683431	0.68157|0.68157	0.863762|0.863762	0.739782|0.739782	ENSG00000115705|ENSG00000115705	ENST00000536482|ENST00000337415;ENST00000345913;ENST00000346956;ENST00000329066;ENST00000382201;ENST00000422464	.|T;T;T;T;T;T	.|0.73897	.|-0.79;-0.79;-0.79;-0.79;-0.79;-0.79	4.99|4.99	4.08|4.08	0.47627|0.47627	.|.	.|0.142496	.|0.64402	.|N	.|0.000004	T|T	0.00012|0.00012	0.0000|0.0000	M|M	0.62723|0.62723	1.935|1.935	0.09310|0.09310	P|P	1.0|1.0	.|D;D;D	.|0.76494	.|0.998;0.998;0.999	.|D;D;D	.|0.69654	.|0.956;0.94;0.965	T|T	0.30060|0.30060	-0.9991|-0.9991	5|9	0.48119|0.56958	T|D	0.1|0.05	-48.0867|-48.0867	8.6411|8.6411	0.33978|0.33978	0.08:0.1541:0.7659:0.0|0.08:0.1541:0.7659:0.0	rs2175977|rs2175977	.|398;398;398	.|P07202-4;P07202-2;P07202	.|.;.;PERT_HUMAN	H|T	81|398;398;398;398;398;327	.|ENSP00000337263:S398T;ENSP00000318820:S398T;ENSP00000263886:S398T;ENSP00000329869:S398T;ENSP00000371636:S398T;ENSP00000405788:S327T	ENSP00000439133:Q81H|ENSP00000329869:S398T	Q|S	+|+	3|2	2|0	TPO|TPO	1460238|1460238	0.956000|0.956000	0.32656|0.32656	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	1.297000|1.297000	0.33400|0.33400	1.031000|1.031000	0.39867|0.39867	0.460000|0.460000	0.39030|0.39030	CAG|AGC	G|0.301;C|0.699		0.761	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206594.2	NM_000547	
PXDN	7837	hgsc.bcm.edu	37	2	1748117	1748117	+	Silent	SNP	C	C	G	rs140134102	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr2:1748117C>G	ENST00000252804.4	-	1	161	c.111G>C	c.(109-111)ccG>ccC	p.P37P		NM_012293.1	NP_036425.1	Q92626	PXDN_HUMAN	peroxidasin homolog (Drosophila)	37	LRRNT.				extracellular matrix organization (GO:0030198)|hydrogen peroxide catabolic process (GO:0042744)|immune response (GO:0006955)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|oxidation-reduction process (GO:0055114)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heme binding (GO:0020037)|interleukin-1 receptor antagonist activity (GO:0005152)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(24)|lung(48)|ovary(3)|pancreas(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	112	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		GGCAGCGGCTCGGACACCCTG	0.741													C|||	40	0.00798722	0.0008	0.0029	5008	,	,		5766	0.0		0.0169	False		,,,				2504	0.0204				p.P37P		.											.	PXDN-166	0			c.G111C						.	C		3,2193		0,3,1095	2.0	3.0	3.0		111	0.2	0.9	2	dbSNP_134	3	44,4352		0,44,2154	no	coding-synonymous	PXDN	NM_012293.1		0,47,3249	GG,GC,CC		1.0009,0.1366,0.713		37/1480	1748117	47,6545	1098	2198	3296	SO:0001819	synonymous_variant	7837	exon1			GCGGCTCGGACAC	AF200348	CCDS46221.1	2p25.3	2013-01-11			ENSG00000130508	ENSG00000130508		"""Immunoglobulin superfamily / I-set domain containing"""	14966	protein-coding gene	gene with protein product		605158				10441517, 9039502	Standard	XM_005264707		Approved	KIAA0230, PRG2, MG50, D2S448, D2S448E, PXN	uc002qxa.3	Q92626	OTTHUMG00000059697	ENST00000252804.4:c.111G>C	2.37:g.1748117C>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	13	7	NM_012293	0	0	0	0	0	A8QM65|D6W4Y0|Q4KMG2	Silent	SNP	ENST00000252804.4	37	CCDS46221.1	73	0.033424908424908424	38	0.07723577235772358	5	0.013812154696132596	8	0.013986013986013986	22	0.029023746701846966	C	7.645	0.681689	0.14907	0.001366	0.010009	ENSG00000130508	ENST00000433670	.	.	.	3.27	0.21	0.15231	.	.	.	.	.	T	0.05181	0.0138	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.02263	-1.1186	4	.	.	.	-15.6545	6.8475	0.23996	0.0:0.3866:0.3554:0.2579	.	.	.	.	P	33	.	.	R	-	2	0	PXDN	1727124	0.988000	0.35896	0.940000	0.37924	0.474000	0.32979	0.122000	0.15687	-0.317000	0.08677	-0.450000	0.05554	CGA	C|0.967;G|0.033		0.741	PXDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322505.1	XM_056455	
CMPK2	129607	hgsc.bcm.edu	37	2	7005369	7005369	+	Silent	SNP	A	A	G	rs11678810	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr2:7005369A>G	ENST00000256722.5	-	1	458	c.459T>C	c.(457-459)tgT>tgC	p.C153C	CMPK2_ENST00000478738.1_Intron|CMPK2_ENST00000458098.1_Silent_p.C153C|CMPK2_ENST00000404168.1_Silent_p.C153C	NM_207315.3	NP_997198.2	Q5EBM0	CMPK2_HUMAN	cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial	153					cellular response to lipopolysaccharide (GO:0071222)|dTDP biosynthetic process (GO:0006233)|dUDP biosynthetic process (GO:0006227)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cytidylate kinase activity (GO:0004127)|nucleoside diphosphate kinase activity (GO:0004550)|thymidylate kinase activity (GO:0004798)|UMP kinase activity (GO:0033862)			large_intestine(1)|lung(13)|prostate(1)|upper_aerodigestive_tract(1)	16	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					GTGCCTCCTGACAGGCGCCCA	0.741													G|||	4998	0.998003	0.9924	1.0	5008	,	,		10694	1.0		1.0	False		,,,				2504	1.0				p.C153C		.											.	CMPK2-68	0			c.T459C						.	G		3605,39		1783,39,0	3.0	4.0	4.0		459	1.6	0.0	2	dbSNP_120	4	7874,0		3937,0,0	no	coding-synonymous	CMPK2	NM_207315.2		5720,39,0	GG,GA,AA		0.0,1.0703,0.3386		153/450	7005369	11479,39	1822	3937	5759	SO:0001819	synonymous_variant	129607	exon1			CTCCTGACAGGCG		CCDS42648.1, CCDS58695.1, CCDS58696.1	2p25.2	2008-01-25			ENSG00000134326	ENSG00000134326	2.7.4.14		27015	protein-coding gene	gene with protein product	"""cytidylate kinase 2"""	611787				17999954	Standard	NM_207315		Approved	TYKi, UMP-CMPK2	uc002qyo.4	Q5EBM0	OTTHUMG00000151629	ENST00000256722.5:c.459T>C	2.37:g.7005369A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_001256478	0	0	0	0	0	A2RUB0|A5D8T2|B7ZM18|Q6ZRU2|Q96AL8	Silent	SNP	ENST00000256722.5	37	CCDS42648.1																																																																																			A|0.003;G|0.997		0.741	CMPK2-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323339.2	NM_207315	
NBAS	51594	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	15607887	15607887	+	Missense_Mutation	SNP	T	T	C	rs186337430	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr2:15607887T>C	ENST00000281513.5	-	18	1944	c.1919A>G	c.(1918-1920)tAt>tGt	p.Y640C	NBAS_ENST00000441750.1_Missense_Mutation_p.Y640C	NM_015909.3	NP_056993.2	A2RRP1	NBAS_HUMAN	neuroblastoma amplified sequence	640					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	cytoplasm (GO:0005737)|membrane (GO:0016020)				NS(4)|breast(4)|central_nervous_system(3)|endometrium(6)|kidney(5)|large_intestine(12)|liver(1)|lung(54)|ovary(2)|pancreas(3)|prostate(9)|skin(6)|stomach(3)	112						AAGCTCTTCATAGGAGATACT	0.338																																					p.Y640C		.											.	NBAS-94	0			c.A1919G						.						100.0	96.0	97.0					2																	15607887		2202	4300	6502	SO:0001583	missense	51594	exon18			TCTTCATAGGAGA	BC051792	CCDS1685.1	2p24.3	2009-02-23			ENSG00000151779	ENSG00000151779			15625	protein-coding gene	gene with protein product		608025				9926938, 12706883	Standard	NM_015909		Approved	NAG	uc002rcc.2	A2RRP1	OTTHUMG00000121153	ENST00000281513.5:c.1919A>G	2.37:g.15607887T>C	ENSP00000281513:p.Tyr640Cys	Somatic	135	0		WXS	Illumina GAIIx	Phase_I	112	59	NM_015909	0	0	0	2	2	O95790|Q2VPJ7|Q53TK6|Q86V39|Q8NFY8|Q9Y3W5	Missense_Mutation	SNP	ENST00000281513.5	37	CCDS1685.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	T	11.06	1.528102	0.27299	.	.	ENSG00000151779	ENST00000441750;ENST00000281513	T;T	0.10860	2.83;2.98	5.8	3.39	0.38822	.	0.059981	0.64402	N	0.000001	T	0.25680	0.0625	M	0.67953	2.075	0.27720	N	0.945168	D	0.89917	1.0	D	0.68192	0.956	T	0.04825	-1.0924	10	0.87932	D	0	.	7.6322	0.28247	0.1259:0.0679:0.0:0.8062	.	640	A2RRP1	NBAS_HUMAN	C	640	ENSP00000413201:Y640C;ENSP00000281513:Y640C	ENSP00000281513:Y640C	Y	-	2	0	NBAS	15525338	1.000000	0.71417	0.984000	0.44739	0.248000	0.25809	5.097000	0.64542	0.439000	0.26476	0.528000	0.53228	TAT	T|0.999;C|0.000		0.338	NBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241638.1	NM_015909	
ARHGEF33	100271715	hgsc.bcm.edu	37	2	39187519	39187519	+	Silent	SNP	A	A	G	rs958412	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr2:39187519A>G	ENST00000536934.1	+	14	2158	c.2073A>G	c.(2071-2073)aaA>aaG	p.K691K	ARHGEF33_ENST00000409978.1_Silent_p.K691K|ARHGEF33_ENST00000398800.4_Silent_p.K691K|AC019171.1_ENST00000601251.1_5'Flank			A8MVX0	ARG33_HUMAN	Rho guanine nucleotide exchange factor (GEF) 33	691							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(3)|pancreas(1)|prostate(1)	5						GCGCCTACAAACTGGAGGCGG	0.746													G|||	4508	0.90016	0.9523	0.9481	5008	,	,		7469	0.8403		0.9354	False		,,,				2504	0.8211				p.K691K		.											.	ARHGEF33-46	0			c.A2073G						.						1.0	1.0	1.0					2																	39187519		286	830	1116	SO:0001819	synonymous_variant	100271715	exon14			CTACAAACTGGAG		CCDS46263.1, CCDS46263.2	2p22.1	2012-07-24			ENSG00000214694	ENSG00000214694		"""Rho guanine nucleotide exchange factors"""	37252	protein-coding gene	gene with protein product							Standard	NM_001145451		Approved		uc021vgd.1	A8MVX0	OTTHUMG00000153540	ENST00000536934.1:c.2073A>G	2.37:g.39187519A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_001145451	0	0	0	0	0	J3KPX2	Silent	SNP	ENST00000536934.1	37																																																																																				A|0.086;G|0.914		0.746	ARHGEF33-202	KNOWN	basic	protein_coding	protein_coding		NM_001145451	
LONRF2	164832	hgsc.bcm.edu	37	2	100938481	100938481	+	Missense_Mutation	SNP	C	C	G	rs74177696	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr2:100938481C>G	ENST00000393437.3	-	1	714	c.75G>C	c.(73-75)caG>caC	p.Q25H		NM_198461.3	NP_940863.3	Q1L5Z9	LONF2_HUMAN	LON peptidase N-terminal domain and ring finger 2	25							ATP-dependent peptidase activity (GO:0004176)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	34						CCTCTAAGCGCTGGGCGATCG	0.756													c|||	1977	0.394768	0.1225	0.4597	5008	,	,		5596	0.7212		0.4861	False		,,,				2504	0.2863				p.Q25H		.											.	LONRF2-154	0			c.G75C						.						3.0	3.0	3.0					2																	100938481		905	2065	2970	SO:0001583	missense	164832	exon1			TAAGCGCTGGGCG	AK127206	CCDS2046.2	2q11.2	2013-01-09			ENSG00000170500	ENSG00000170500		"""RING-type (C3HC4) zinc fingers"""	24788	protein-coding gene	gene with protein product							Standard	NM_198461		Approved	FLJ45273, RNF192	uc002tal.4	Q1L5Z9	OTTHUMG00000130668	ENST00000393437.3:c.75G>C	2.37:g.100938481C>G	ENSP00000377086:p.Gln25His	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	5	NM_198461	0	0	0	0	0	B9A006|Q6ZSR4	Missense_Mutation	SNP	ENST00000393437.3	37	CCDS2046.2	1003	0.4592490842490842	60	0.12195121951219512	161	0.4447513812154696	415	0.7255244755244755	367	0.4841688654353562	C	9.334	1.061304	0.19987	.	.	ENSG00000170500	ENST00000393437	D	0.83837	-1.77	2.7	1.8	0.24995	.	0.253832	0.22536	U	0.058792	T	0.00012	0.0000	N	0.22421	0.69	0.54753	P	1.2000000000012001E-5	P	0.39964	0.697	B	0.32465	0.146	T	0.46830	-0.9163	9	0.46703	T	0.11	.	7.0577	0.25109	0.197:0.6118:0.1912:0.0	.	25	Q1L5Z9	LONF2_HUMAN	H	25	ENSP00000377086:Q25H	ENSP00000377086:Q25H	Q	-	3	2	LONRF2	100304913	0.256000	0.24012	0.001000	0.08648	0.015000	0.08874	-0.229000	0.09098	0.466000	0.27193	-1.098000	0.02139	CAG	C|0.540;G|0.460		0.756	LONRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253161.2	NM_198461	
C1QL2	165257	hgsc.bcm.edu	37	2	119915509	119915509	+	Silent	SNP	G	G	T	rs1317848	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr2:119915509G>T	ENST00000272520.3	-	1	956	c.337C>A	c.(337-339)Cgg>Agg	p.R113R		NM_182528.3	NP_872334.2	Q7Z5L3	C1QL2_HUMAN	complement component 1, q subcomponent-like 2	113	Collagen-like.				protein oligomerization (GO:0051259)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)				NS(1)|endometrium(1)|large_intestine(3)|pancreas(1)|prostate(1)	7						AGCCCGGGCCGCCCCGAGTCG	0.796										HNSCC(49;0.14)			G|||	1430	0.285543	0.0938	0.1859	5008	,	,		8271	0.5982		0.2565	False		,,,				2504	0.3231				p.R113R		.											.	C1QL2-91	0			c.C337A						.	G		209,1941		13,183,879	2.0	2.0	2.0		337	-3.2	0.6	2	dbSNP_88	2	955,4379		99,757,1811	no	coding-synonymous	C1QL2	NM_182528.3		112,940,2690	TT,TG,GG		17.904,9.7209,15.5532		113/288	119915509	1164,6320	1075	2667	3742	SO:0001819	synonymous_variant	165257	exon1			CGGGCCGCCCCGA	AF525315	CCDS42737.1	2q14.2	2009-05-20			ENSG00000144119	ENSG00000144119			24181	protein-coding gene	gene with protein product	"""C1q and tumor necrosis factor related protein 10"""	614330				18783346	Standard	NM_182528		Approved	CTRP10, C1QTNF10	uc002tlo.2	Q7Z5L3	OTTHUMG00000153271	ENST00000272520.3:c.337C>A	2.37:g.119915509G>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	5	NM_182528	0	0	0	0	0		Silent	SNP	ENST00000272520.3	37	CCDS42737.1																																																																																			G|0.681;T|0.319		0.796	C1QL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330527.2	NM_182528	
LYPD1	116372	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	133425989	133425989	+	Silent	SNP	C	C	T			TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr2:133425989C>T	ENST00000397463.2	-	2	446	c.174G>A	c.(172-174)gtG>gtA	p.V58V	AC010974.3_ENST00000450509.1_RNA|LYPD1_ENST00000345008.6_Silent_p.V6V	NM_144586.5	NP_653187.3	Q8N2G4	LYPD1_HUMAN	LY6/PLAUR domain containing 1	58	UPAR/Ly6.					anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				lung(2)	2						TTTGCTCCATCACTTCTTTCT	0.537																																					p.V58V		.											.	LYPD1-90	0			c.G174A						.						82.0	89.0	87.0					2																	133425989		1992	4153	6145	SO:0001819	synonymous_variant	116372	exon2			CTCCATCACTTCT	AK075487	CCDS42759.1, CCDS46416.1	2q21.2	2008-02-05		2005-08-30	ENSG00000150551	ENSG00000150551			28431	protein-coding gene	gene with protein product		610450		LYPDC1		12477932	Standard	NM_144586		Approved	MGC29643	uc002ttn.3	Q8N2G4	OTTHUMG00000153609	ENST00000397463.2:c.174G>A	2.37:g.133425989C>T		Somatic	114	0		WXS	Illumina GAIIx	Phase_I	97	11	NM_144586	0	0	0	0	0	H7BXW6|Q6ZP52|Q6ZWI4|Q96AC2	Silent	SNP	ENST00000397463.2	37	CCDS42759.1																																																																																			.		0.537	LYPD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331821.1	NM_144586	
ZEB2	9839	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	145187558	145187558	+	Nonsense_Mutation	SNP	C	C	A			TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr2:145187558C>A	ENST00000558170.2	-	3	1293	c.109G>T	c.(109-111)Gaa>Taa	p.E37*	ZEB2_ENST00000539609.3_Nonsense_Mutation_p.E37*|ZEB2_ENST00000303660.4_Nonsense_Mutation_p.E37*|ZEB2_ENST00000409487.3_Nonsense_Mutation_p.E37*	NM_014795.3	NP_055610.1	O60315	ZEB2_HUMAN	zinc finger E-box binding homeobox 2	37					cell proliferation in forebrain (GO:0021846)|developmental pigmentation (GO:0048066)|hippocampus development (GO:0021766)|melanocyte migration (GO:0097324)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of melanin biosynthetic process (GO:0048023)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of melanosome organization (GO:1903056)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|phosphatase regulator activity (GO:0019208)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(7)|kidney(6)|large_intestine(23)|lung(45)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	107				BRCA - Breast invasive adenocarcinoma(221;0.112)		TCATCTGTTTCAGAACCTGTG	0.473																																					p.E37X	Melanoma(33;1235 1264 5755 16332)	.											.	ZEB2-297	0			c.G109T						.						118.0	91.0	100.0					2																	145187558		2203	4300	6503	SO:0001587	stop_gained	9839	exon3			CTGTTTCAGAACC	AB011141	CCDS2186.1, CCDS54403.1	2q22.3	2013-01-08	2007-02-15	2007-02-15	ENSG00000169554	ENSG00000169554		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	14881	protein-coding gene	gene with protein product	"""SMAD interacting protein 1"""	605802	"""zinc finger homeobox 1b"""	ZFHX1B			Standard	NM_014795		Approved	KIAA0569, SIP-1, SIP1	uc002tvu.3	O60315	OTTHUMG00000131834	ENST00000558170.2:c.109G>T	2.37:g.145187558C>A	ENSP00000454157:p.Glu37*	Somatic	109	0		WXS	Illumina GAIIx	Phase_I	104	13	NM_001171653	0	0	1	1	0	A0JP09|B7Z2P2|F5H814|Q9UED1	Nonsense_Mutation	SNP	ENST00000558170.2	37	CCDS2186.1	.	.	.	.	.	.	.	.	.	.	C	37	6.619197	0.97709	.	.	ENSG00000169554	ENST00000392860;ENST00000539609;ENST00000303660;ENST00000409487;ENST00000427902;ENST00000392861;ENST00000409211;ENST00000435831;ENST00000444559	.	.	.	5.9	5.9	0.94986	.	0.050021	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-13.0998	20.2787	0.98501	0.0:1.0:0.0:0.0	.	.	.	.	X	32;37;37;37;37;37;37;37;37	.	ENSP00000302501:E37X	E	-	1	0	ZEB2	144904028	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	7.378000	0.79679	2.798000	0.96311	0.650000	0.86243	GAA	.		0.473	ZEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254778.5	NM_014795	
IKZF2	22807	broad.mit.edu;bcgsc.ca	37	2	213872463	213872463	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr2:213872463C>T	ENST00000434687.1	-	9	1511	c.1202G>A	c.(1201-1203)aGc>aAc	p.S401N	IKZF2_ENST00000374319.4_Missense_Mutation_p.S375N|IKZF2_ENST00000374327.4_Missense_Mutation_p.S256N|IKZF2_ENST00000421754.2_Missense_Mutation_p.S327N|IKZF2_ENST00000451136.2_Missense_Mutation_p.S329N|IKZF2_ENST00000342002.2_Missense_Mutation_p.S407N|IKZF2_ENST00000457361.1_Missense_Mutation_p.S401N|AC079610.1_ENST00000415387.1_RNA|IKZF2_ENST00000413091.3_3'UTR			Q9UKS7	IKZF2_HUMAN	IKAROS family zinc finger 2 (Helios)	401					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(7)|lung(7)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Esophageal squamous(248;0.0559)|Renal(323;0.218)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;2.97e-07)|all cancers(144;1.53e-05)|LUSC - Lung squamous cell carcinoma(224;0.00599)|Lung(261;0.00792)		GCAGCTATTGCTGGGAGAGGC	0.507																																					p.S401N		.											.	IKZF2-226	0			c.G1202A						.						136.0	136.0	136.0					2																	213872463		2203	4300	6503	SO:0001583	missense	22807	exon8			CTATTGCTGGGAG	AF130863	CCDS2395.1, CCDS46507.1	2q13.1	2013-01-08	2006-08-25	2006-08-25	ENSG00000030419	ENSG00000030419		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	13177	protein-coding gene	gene with protein product		606234	"""zinc finger protein, subfamily 1A, 2 (Helios)"""	ZNFN1A2		9512513, 9560339	Standard	NM_001079526		Approved	Helios	uc002vem.3	Q9UKS7	OTTHUMG00000133005	ENST00000434687.1:c.1202G>A	2.37:g.213872463C>T	ENSP00000412869:p.Ser401Asn	Somatic	163	1		WXS	Illumina GAIIx	Phase_I	174	7	NM_016260	0	0	0	0	0	Q53YJ5|Q6PQC5|Q6PQC6|Q6PQC7|Q6PQC8|Q6PQD0|Q6PQD1|Q8N6S1	Missense_Mutation	SNP	ENST00000434687.1	37	CCDS2395.1	.	.	.	.	.	.	.	.	.	.	C	13.82	2.352676	0.41700	.	.	ENSG00000030419	ENST00000457361;ENST00000342002;ENST00000434687;ENST00000374319;ENST00000451136;ENST00000421754;ENST00000374327;ENST00000542010	T;T;T;T;T;T;T	0.15834	3.14;3.11;3.14;3.18;3.08;3.16;2.39	6.11	6.11	0.99139	.	0.000000	0.85682	D	0.000000	T	0.36166	0.0957	L	0.55103	1.725	0.80722	D	1	D;P;D;B;P	0.61697	0.981;0.873;0.99;0.373;0.839	P;P;P;B;B	0.61003	0.598;0.517;0.882;0.169;0.367	T	0.00210	-1.1916	10	0.25751	T	0.34	-8.9521	20.7342	0.99715	0.0:1.0:0.0:0.0	.	329;327;256;375;401	C9JCG7;C9JTM9;F5H8M1;Q9UKS7-2;Q9UKS7	.;.;.;.;IKZF2_HUMAN	N	401;407;401;375;329;327;256;105	ENSP00000410447:S401N;ENSP00000342876:S407N;ENSP00000412869:S401N;ENSP00000363439:S375N;ENSP00000395203:S329N;ENSP00000399574:S327N;ENSP00000363447:S256N	ENSP00000342876:S407N	S	-	2	0	IKZF2	213580708	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.625000	0.83145	2.906000	0.99361	0.655000	0.94253	AGC	.		0.507	IKZF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256593.3	NM_016260	
WNT6	7475	hgsc.bcm.edu	37	2	219736369	219736369	+	Missense_Mutation	SNP	C	C	G	rs141494427	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr2:219736369C>G	ENST00000233948.3	+	3	681	c.464C>G	c.(463-465)cCt>cGt	p.P155R	WNT6_ENST00000486233.1_3'UTR	NM_006522.3	NP_006513.1	Q9Y6F9	WNT6_HUMAN	wingless-type MMTV integration site family, member 6	155					axis specification (GO:0009798)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell fate commitment (GO:0045165)|cellular response to retinoic acid (GO:0071300)|cornea development in camera-type eye (GO:0061303)|epithelial-mesenchymal cell signaling (GO:0060684)|nephron tubule formation (GO:0072079)|neuron differentiation (GO:0030182)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of gene expression (GO:0010628)|positive regulation of tooth mineralization (GO:0070172)|positive regulation of transcription, DNA-templated (GO:0045893)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)			large_intestine(1)|ovary(2)|skin(1)	4		Renal(207;0.0474)		Epithelial(149;4.53e-07)|all cancers(144;9.3e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		cccggaccccctggccccgcg	0.761													c|||	107	0.0213658	0.0023	0.0288	5008	,	,		8321	0.0		0.0567	False		,,,				2504	0.0276				p.P155R		.											.	WNT6-564	0			c.C464G						.		ARG/PRO	38,3612		0,38,1787	4.0	5.0	4.0		464	3.9	0.2	2	dbSNP_134	4	476,7284		14,448,3418	no	missense	WNT6	NM_006522.3	103	14,486,5205	GG,GC,CC		6.134,1.0411,4.5048	benign	155/366	219736369	514,10896	1825	3880	5705	SO:0001583	missense	7475	exon3			GACCCCCTGGCCC	AF079522	CCDS2425.1	2q35	2008-05-23			ENSG00000115596	ENSG00000115596		"""Wingless-type MMTV integration sites"""	12785	protein-coding gene	gene with protein product		604663				10343101, 11350055	Standard	NM_006522		Approved		uc002vjc.1	Q9Y6F9	OTTHUMG00000133082	ENST00000233948.3:c.464C>G	2.37:g.219736369C>G	ENSP00000233948:p.Pro155Arg	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	35	19	NM_006522	0	0	0	0	0	Q9H1J6|Q9H238	Missense_Mutation	SNP	ENST00000233948.3	37	CCDS2425.1	45	0.020604395604395604	4	0.008130081300813009	10	0.027624309392265192	0	0.0	31	0.040897097625329816	c	6.907	0.536999	0.13188	0.010411	0.06134	ENSG00000115596	ENST00000233948	T	0.75938	-0.98	4.78	3.89	0.44902	.	1.674380	0.03472	N	0.213773	T	0.16041	0.0386	L	0.31752	0.955	0.28984	N	0.888468	B	0.18166	0.026	B	0.14023	0.01	T	0.39820	-0.9595	10	0.07813	T	0.8	.	7.9555	0.30040	0.0:0.8895:0.0:0.1105	.	155	Q9Y6F9	WNT6_HUMAN	R	155	ENSP00000233948:P155R	ENSP00000233948:P155R	P	+	2	0	WNT6	219444613	0.430000	0.25538	0.190000	0.23270	0.537000	0.34900	-0.229000	0.09098	2.208000	0.71279	0.486000	0.48141	CCT	C|0.979;G|0.021		0.761	WNT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256727.2	NM_006522	
PRR21	643905	hgsc.bcm.edu	37	2	240982362	240982362	+	Missense_Mutation	SNP	G	G	A	rs532390647|rs151246209	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr2:240982362G>A	ENST00000408934.1	-	1	37	c.38C>T	c.(37-39)cCc>cTc	p.P13L		NM_001080835.1	NP_001074304.1	Q8WXC7	PRR21_HUMAN	proline rich 21	13								p.P13L(2)		NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(5)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)	29						GTGGATGAAGGGCCGTGGATG	0.567																																					p.P13L		.											.	PRR21-70	2	Substitution - Missense(2)	lung(2)	c.C38T						.						88.0	75.0	80.0					2																	240982362		2196	4292	6488	SO:0001583	missense	643905	exon1			ATGAAGGGCCGTG	AF453950	CCDS33417.1	2q37.3	2009-04-20			ENSG00000221961	ENSG00000221961			33866	protein-coding gene	gene with protein product							Standard	NM_001080835		Approved		uc010zod.2	Q8WXC7	OTTHUMG00000159174	ENST00000408934.1:c.38C>T	2.37:g.240982362G>A	ENSP00000386166:p.Pro13Leu	Somatic	157	0		WXS	Illumina GAIIx	Phase_I	157	9	NM_001080835	0	0	0	0	0		Missense_Mutation	SNP	ENST00000408934.1	37	CCDS33417.1	22	0.010073260073260074	1	0.0020325203252032522	1	0.0027624309392265192	2	0.0034965034965034965	18	0.023746701846965697	g	0.006	-2.070625	0.00379	.	.	ENSG00000221961	ENST00000408934;ENST00000486799	T;T	0.41065	1.01;1.01	0.483	-0.803	0.10886	.	.	.	.	.	T	0.07052	0.0179	N	0.08118	0	0.09310	N	1	B	0.30068	0.267	B	0.18561	0.022	T	0.18555	-1.0333	9	0.07175	T	0.84	.	4.4839	0.11780	0.3665:0.0:0.6335:0.0	.	13	Q8WXC7	PRR21_HUMAN	L	13	ENSP00000386166:P13L;ENSP00000418240:P13L	ENSP00000386166:P13L	P	-	2	0	PRR21	240631035	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.182000	0.09726	-0.423000	0.07394	-0.438000	0.05819	CCC	G|0.991;A|0.009		0.567	PRR21-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001080835	
PASK	23178	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	242077469	242077469	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr2:242077469G>T	ENST00000405260.1	-	6	1473	c.775C>A	c.(775-777)Cat>Aat	p.H259N	PASK_ENST00000234040.4_Missense_Mutation_p.H259N|PASK_ENST00000358649.4_Missense_Mutation_p.H259N|PASK_ENST00000539818.1_Missense_Mutation_p.H43N|PASK_ENST00000544142.1_Missense_Mutation_p.H73N|PASK_ENST00000403638.3_Missense_Mutation_p.H259N	NM_001252120.1	NP_001239049.1	Q96RG2	PASK_HUMAN	PAS domain containing serine/threonine kinase	259					negative regulation of glycogen biosynthetic process (GO:0045719)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of energy homeostasis (GO:2000505)|regulation of glucagon secretion (GO:0070092)|regulation of respiratory gaseous exchange (GO:0043576)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|lung(20)|ovary(4)|prostate(4)|skin(1)|stomach(1)|urinary_tract(2)	53		all_cancers(19;4.46e-39)|all_epithelial(40;1.34e-17)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00481)|Lung NSC(271;0.017)|Ovarian(221;0.0228)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.34e-31)|all cancers(36;1e-28)|OV - Ovarian serous cystadenocarcinoma(60;3.53e-14)|Kidney(56;4.31e-09)|KIRC - Kidney renal clear cell carcinoma(57;4.35e-08)|BRCA - Breast invasive adenocarcinoma(100;5.64e-06)|Lung(119;0.000596)|LUSC - Lung squamous cell carcinoma(224;0.00481)|Colorectal(34;0.014)|COAD - Colon adenocarcinoma(134;0.0968)		CCGTGAAGATGAGCAAAGAGA	0.522																																					p.H259N		.											.	PASK-536	0			c.C775A						.						139.0	109.0	119.0					2																	242077469		2203	4300	6503	SO:0001583	missense	23178	exon6			GAAGATGAGCAAA	U79240	CCDS2545.1, CCDS58758.1, CCDS58759.1	2q37.3	2008-05-23			ENSG00000115687	ENSG00000115687			17270	protein-coding gene	gene with protein product		607505				11688972, 11459942, 15148392	Standard	NM_001252119		Approved	PASKIN, KIAA0135, STK37	uc010fzl.2	Q96RG2	OTTHUMG00000133392	ENST00000405260.1:c.775C>A	2.37:g.242077469G>T	ENSP00000384016:p.His259Asn	Somatic	203	2		WXS	Illumina GAIIx	Phase_I	181	64	NM_015148	0	0	0	0	0	G5E9F1|Q05BE4|Q68DY3|Q6GSJ5|Q86XH6|Q99763|Q9UFR7	Missense_Mutation	SNP	ENST00000405260.1	37	CCDS2545.1	.	.	.	.	.	.	.	.	.	.	G	13.99	2.402232	0.42613	.	.	ENSG00000115687	ENST00000234040;ENST00000544142;ENST00000405260;ENST00000358649;ENST00000539818;ENST00000403638;ENST00000415234	T;T;T;T;T;T;T	0.68765	1.04;-0.35;1.04;1.04;1.04;1.04;-0.35	4.91	4.91	0.64330	.	0.256021	0.27349	N	0.019762	T	0.72763	0.3501	M	0.69823	2.125	0.25805	N	0.98447	P;P;D;P	0.55172	0.933;0.844;0.97;0.89	P;P;P;P	0.49829	0.623;0.583;0.616;0.474	T	0.70070	-0.4973	10	0.62326	D	0.03	.	15.002	0.71479	0.0:0.0:1.0:0.0	.	73;259;259;259	F5GYW7;Q96RG2-2;G5E9F1;Q96RG2	.;.;.;PASK_HUMAN	N	259;73;259;259;43;259;43	ENSP00000234040:H259N;ENSP00000441374:H73N;ENSP00000384016:H259N;ENSP00000351475:H259N;ENSP00000443083:H43N;ENSP00000384438:H259N;ENSP00000400734:H43N	ENSP00000234040:H259N	H	-	1	0	PASK	241726142	0.963000	0.33076	0.276000	0.24689	0.089000	0.18198	3.916000	0.56416	2.247000	0.74100	0.650000	0.86243	CAT	.		0.522	PASK-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000323753.1	NM_015148	
ZCCHC3	85364	hgsc.bcm.edu	37	20	278515	278515	+	Silent	SNP	T	T	C	rs2223665	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr20:278515T>C	ENST00000382352.3	+	1	779	c.288T>C	c.(286-288)gaT>gaC	p.D96D		NM_033089.6	NP_149080	Q9NUD5	ZCHC3_HUMAN	zinc finger, CCHC domain containing 3	96							poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(1)|lung(3)|prostate(2)	8		all_cancers(10;0.000209)|Lung NSC(37;0.0417)|all_lung(30;0.0713)|all_epithelial(17;0.0748)|Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.149)			GCCGCGGGGATCCGAAGGGCC	0.776													C|||	2949	0.588858	0.6974	0.6643	5008	,	,		6571	0.375		0.6064	False		,,,				2504	0.591				p.D96D		.											.	ZCCHC3-90	0			c.T288C						.						1.0	1.0	1.0					20																	278515		303	859	1162	SO:0001819	synonymous_variant	85364	exon1			CGGGGATCCGAAG	AL034548	CCDS42844.1	20p13-p12.2	2014-04-10	2004-07-14	2004-07-14	ENSG00000177764	ENSG00000247315		"""Zinc fingers, CCHC domain containing"""	16230	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 99"""	C20orf99			Standard	NM_033089		Approved	dJ1103G7.7	uc002wdf.3	Q9NUD5	OTTHUMG00000188280	ENST00000382352.3:c.288T>C	20.37:g.278515T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_033089	0	0	0	0	0	Q3B7J3|Q6NT79	Silent	SNP	ENST00000382352.3	37	CCDS42844.1																																																																																			T|0.454;C|0.546		0.776	ZCCHC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077447.1		
TCF15	6939	hgsc.bcm.edu	37	20	590456	590456	+	Silent	SNP	A	A	G	rs282164	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr20:590456A>G	ENST00000246080.3	-	1	586	c.426T>C	c.(424-426)cgT>cgC	p.R142R		NM_004609.3	NP_004600.2	Q12870	TCF15_HUMAN	transcription factor 15 (basic helix-loop-helix)	142					death (GO:0016265)|ear development (GO:0043583)|eating behavior (GO:0042755)|establishment of epithelial cell apical/basal polarity (GO:0045198)|mesenchymal to epithelial transition (GO:0060231)|mesoderm development (GO:0007498)|muscle organ morphogenesis (GO:0048644)|neuromuscular process controlling posture (GO:0050884)|paraxial mesoderm development (GO:0048339)|post-anal tail morphogenesis (GO:0036342)|regulation of gene expression involved in extracellular matrix organization (GO:1901311)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|respiratory system process (GO:0003016)|skeletal system morphogenesis (GO:0048705)|skin development (GO:0043588)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|lung(2)|prostate(1)	4		Breast(17;0.231)				TGCCCGCGGCACGGAAGCACG	0.736													g|||	4317	0.862021	0.7413	0.9035	5008	,	,		6474	0.998		0.8072	False		,,,				2504	0.9121				p.R142R		.											.	TCF15-90	0			c.T426C						.			3211,1033		1232,747,143	7.0	8.0	8.0		426	-9.0	0.0	20	dbSNP_79	8	6663,1669		2708,1247,211	no	coding-synonymous	TCF15	NM_004609.3		3940,1994,354	GG,GA,AA		20.0312,24.3402,21.4854		142/200	590456	9874,2702	2122	4166	6288	SO:0001819	synonymous_variant	6939	exon1			CGCGGCACGGAAG		CCDS33432.1	20p13	2013-05-21			ENSG00000125878	ENSG00000125878		"""Basic helix-loop-helix proteins"""	11627	protein-coding gene	gene with protein product		601010				8825648, 8041747	Standard	NM_004609		Approved	EC2, PARAXIS, bHLHa40	uc002wdz.3	Q12870	OTTHUMG00000031640	ENST00000246080.3:c.426T>C	20.37:g.590456A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	13	12	NM_004609	0	0	0	0	0	Q9NQQ1	Silent	SNP	ENST00000246080.3	37	CCDS33432.1																																																																																			A|0.165;G|0.835		0.736	TCF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077475.2	NM_004609	
GFRA4	64096	hgsc.bcm.edu	37	20	3641868	3641868	+	Missense_Mutation	SNP	A	A	T	rs146579049	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr20:3641868A>T	ENST00000319242.3	-	2	114	c.115T>A	c.(115-117)Tgc>Agc	p.C39S	GFRA4_ENST00000290417.2_Missense_Mutation_p.C39S			Q9GZZ7	GFRA4_HUMAN	GDNF family receptor alpha 4	39					negative regulation of ossification (GO:0030279)	anchored component of membrane (GO:0031225)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	glial cell-derived neurotrophic factor receptor activity (GO:0016167)			large_intestine(1)|lung(2)	3						AAACGCTGGCACCGCGCGTCC	0.746													A|||	46	0.0091853	0.0008	0.062	5008	,	,		10332	0.0		0.002	False		,,,				2504	0.0				p.C39S		.											.	GFRA4-90	0			c.T115A						.	A	SER/CYS,SER/CYS	0,3228		0,0,1614	3.0	2.0	2.0		115,115	4.2	1.0	20	dbSNP_134	2	6,5988		0,6,2991	yes	missense,missense	GFRA4	NM_022139.3,NM_145762.2	112,112	0,6,4605	TT,TA,AA		0.1001,0.0,0.0651	probably-damaging,probably-damaging	39/270,39/300	3641868	6,9216	1614	2997	4611	SO:0001583	missense	64096	exon2			GCTGGCACCGCGC	AF253318	CCDS13055.1, CCDS13056.1	20p13-p12	2008-07-16			ENSG00000125861	ENSG00000125861			13821	protein-coding gene	gene with protein product	"""persephin receptor"""					10958791, 15225646	Standard	XM_005260793		Approved		uc002win.3	Q9GZZ7	OTTHUMG00000031748	ENST00000319242.3:c.115T>A	20.37:g.3641868A>T	ENSP00000313423:p.Cys39Ser	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	19	9	NM_022139	0	0	0	0	0	Q5JT74|Q9H191|Q9H192	Missense_Mutation	SNP	ENST00000319242.3	37	CCDS13056.1	32	0.014652014652014652	1	0.0020325203252032522	29	0.08011049723756906	0	0.0	2	0.002638522427440633	A	18.29	3.591386	0.66219	0.0	0.001001	ENSG00000125861	ENST00000290417;ENST00000319242	D;D	0.94330	-3.4;-3.4	4.22	4.22	0.49857	GDNF/GAS1 (2);	0.000000	0.85682	D	0.000000	T	0.71048	0.3294	M	0.82323	2.585	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.998	T	0.78836	-0.2047	10	0.87932	D	0	-23.7974	13.1261	0.59356	1.0:0.0:0.0:0.0	.	39;39;39	Q9GZZ7-3;Q9GZZ7;Q9GZZ7-2	.;GFRA4_HUMAN;.	S	39	ENSP00000290417:C39S;ENSP00000313423:C39S	ENSP00000290417:C39S	C	-	1	0	GFRA4	3589868	1.000000	0.71417	0.963000	0.40424	0.079000	0.17450	8.911000	0.92721	1.775000	0.52247	0.454000	0.30748	TGC	A|0.985;T|0.015		0.746	GFRA4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077744.1	NM_145762	
FRG1B	284802	broad.mit.edu;bcgsc.ca	37	20	29625895	29625895	+	Missense_Mutation	SNP	G	G	A	rs76435412	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr20:29625895G>A	ENST00000278882.3	+	5	519	c.139G>A	c.(139-141)Gga>Aga	p.G47R	FRG1B_ENST00000439954.2_Missense_Mutation_p.G52R|FRG1B_ENST00000358464.4_Missense_Mutation_p.G47R			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	47										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						ATCTGGCTATGGAAAATATCT	0.343																																					.		.											.	FRG1B-22	0			.						.																																			SO:0001583	missense	284802	.			GGCTATGGAAAAT			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.139G>A	20.37:g.29625895G>A	ENSP00000278882:p.Gly47Arg	Somatic	67	0		WXS	Illumina GAIIx	Phase_I	63	5	.	0	0	19	19	0	C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	g	11.07	1.529986	0.27387	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.59502	0.26	1.68	1.68	0.24146	.	0.000000	0.85682	D	0.000000	T	0.53690	0.1812	.	.	.	0.58432	D	0.999996	P	0.36412	0.552	B	0.41894	0.369	T	0.59820	-0.7382	9	0.87932	D	0	.	9.3557	0.38164	0.0:0.0:1.0:0.0	.	52	F5H5R5	.	R	47;52;47	ENSP00000408863:G52R	ENSP00000278882:G47R	G	+	1	0	FRG1B	28239556	1.000000	0.71417	1.000000	0.80357	0.038000	0.13279	8.114000	0.89570	1.250000	0.43966	0.184000	0.17185	GGA	G|0.800;A|0.200		0.343	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
DUSP15	128853	hgsc.bcm.edu	37	20	30449325	30449325	+	Intron	SNP	C	C	G	rs947310	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr20:30449325C>G	ENST00000278979.3	-	6	503				DUSP15_ENST00000398083.1_Missense_Mutation_p.V94L|DUSP15_ENST00000493115.1_5'Flank|DUSP15_ENST00000339738.5_Missense_Mutation_p.V197L|DUSP15_ENST00000375966.4_Missense_Mutation_p.V194L|DUSP15_ENST00000398084.2_Missense_Mutation_p.V94L|DUSP15_ENST00000486996.1_Missense_Mutation_p.V94L			Q9H1R2	DUS15_HUMAN	dual specificity phosphatase 15						positive regulation of JNK cascade (GO:0046330)|protein dephosphorylation (GO:0006470)|regulation of cell proliferation (GO:0042127)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			large_intestine(1)|lung(4)|pancreas(1)|stomach(1)	7			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			AGGCGCTGCACGGTTCCCTCG	0.746													G|||	1767	0.352835	0.7625	0.3458	5008	,	,		10036	0.004		0.4066	False		,,,				2504	0.1084				p.V197L		.											.	DUSP15-227	0			c.G589C						.	G	LEU/VAL,LEU/VAL,LEU/VAL	2270,1484		747,776,354	3.0	5.0	4.0		280,589,280	1.3	1.0	20	dbSNP_86	4	2513,5053		543,1427,1813	no	missense,missense,missense	DUSP15	NM_001012644.1,NM_080611.3,NM_177991.1	32,32,32	1290,2203,2167	GG,GC,CC		33.2144,39.5312,42.2527	benign,benign,benign	94/133,197/236,94/133	30449325	4783,6537	1877	3783	5660	SO:0001627	intron_variant	128853	exon7			GCTGCACGGTTCC		CCDS13193.1, CCDS42862.1	20q11.21	2011-06-09	2005-03-09		ENSG00000149599	ENSG00000149599		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	16236	protein-coding gene	gene with protein product			"""dual specificity phosphatase-like 15"""			15138252	Standard	NM_080611		Approved	bA243J16.6, VHY	uc002wwx.1	Q9H1R2	OTTHUMG00000032182	ENST00000278979.3:c.426+1048G>C	20.37:g.30449325C>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	4	NM_080611	0	0	0	0	0	A6NH79|A8MVC8|Q5QP62|Q5QP63|Q5QP65|Q6PGN7|Q8N826|Q9BX24	Missense_Mutation	SNP	ENST00000278979.3	37		795	0.364010989010989	359	0.7296747967479674	129	0.356353591160221	3	0.005244755244755245	304	0.40105540897097625	G	2.098	-0.406724	0.04832	0.604688	0.332144	ENSG00000149599	ENST00000398084;ENST00000339738;ENST00000486996;ENST00000375966;ENST00000398083	T;T;T;T;T	0.39787	1.06;3.96;1.06;3.96;1.06	3.38	1.28	0.21552	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.53688	P	2.1000000000048757E-5	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.39840	-0.9594	7	0.07990	T	0.79	.	4.2732	0.10796	0.2356:0.362:0.4024:0.0	rs947310;rs17857463;rs947310	197;94	Q9H1R2-3;A8MVC8	.;.	L	94;197;94;194;94	ENSP00000381158:V94L;ENSP00000341658:V197L;ENSP00000419818:V94L;ENSP00000365133:V194L;ENSP00000381157:V94L	ENSP00000341658:V197L	V	-	1	0	DUSP15	29912986	0.998000	0.40836	0.994000	0.49952	0.596000	0.36781	0.214000	0.17541	-0.127000	0.11661	-1.248000	0.01517	GTG	C|0.639;G|0.361		0.746	DUSP15-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000078555.3	NM_080611	
COL18A1	80781	hgsc.bcm.edu	37	21	46929360	46929360	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr21:46929360C>T	ENST00000359759.4	+	38	4606	c.4585C>T	c.(4585-4587)Cgg>Tgg	p.R1529W	COL18A1_ENST00000400337.2_Missense_Mutation_p.R1114W|COL18A1_ENST00000355480.5_Missense_Mutation_p.R1294W|SLC19A1_ENST00000468508.1_5'Flank|SLC19A1_ENST00000567670.1_Intron			P39060	COIA1_HUMAN	collagen, type XVIII, alpha 1	1529	Nonhelical region 11 (NC11).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endothelial cell morphogenesis (GO:0001886)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|response to drug (GO:0042493)|response to hydrostatic pressure (GO:0051599)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		CCCCACCGCGCGGCCCTGGCG	0.736																																					p.R1291W		.											.	COL18A1-90	0			c.C3871T						.						2.0	4.0	4.0					21																	46929360		1527	3464	4991	SO:0001583	missense	80781	exon39			ACCGCGCGGCCCT		CCDS42971.1, CCDS42972.1	21q22.3	2013-01-16			ENSG00000182871	ENSG00000182871		"""Collagens"""	2195	protein-coding gene	gene with protein product	"""endostatin"""	120328	"""Knobloch syndrome, type 1"""	KNO		8188291, 8776601, 10942434, 17546652	Standard	NM_130445		Approved	KS, KNO1	uc002zhi.3	P39060	OTTHUMG00000090407	ENST00000359759.4:c.4585C>T	21.37:g.46929360C>T	ENSP00000352798:p.Arg1529Trp	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	32	13	NM_030582	0	0	37	87	50	A8MVI4|Q58EX6|Q6RZ39|Q6RZ40|Q6RZ41|Q8N4S4|Q8WXI5|Q96T70|Q9UK38|Q9Y6Q7|Q9Y6Q8	Missense_Mutation	SNP	ENST00000359759.4	37		.	.	.	.	.	.	.	.	.	.	C	10.09	1.255576	0.22965	.	.	ENSG00000182871	ENST00000400337;ENST00000400347;ENST00000355480;ENST00000359759;ENST00000539645;ENST00000342220	T;T;T;T	0.48522	0.81;0.81;0.81;0.81	4.28	2.04	0.26737	Collagenase NC10/endostatin (1);	1.043770	0.07520	N	0.910370	T	0.64778	0.2629	M	0.72118	2.19	0.37197	D	0.90418	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.77004	0.989;0.957;0.987;0.977	T	0.58607	-0.7607	10	0.54805	T	0.06	.	6.4881	0.22099	0.3638:0.5391:0.0:0.0971	.	1529;1111;1294;1114	P39060;D3DSM4;P39060-1;P39060-2	COIA1_HUMAN;.;.;.	W	1114;1114;1294;1529;1529;462	ENSP00000383191:R1114W;ENSP00000347665:R1294W;ENSP00000352798:R1529W;ENSP00000339118:R462W	ENSP00000339118:R462W	R	+	1	2	COL18A1	45753788	0.000000	0.05858	0.280000	0.24747	0.029000	0.11900	0.011000	0.13264	0.389000	0.25086	-1.781000	0.00649	CGG	.		0.736	COL18A1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000206827.1		
SCARF2	91179	hgsc.bcm.edu	37	22	20780091	20780091	+	Silent	SNP	C	C	G	rs759610		TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr22:20780091C>G	ENST00000266214.5	-	11	2291	c.2187G>C	c.(2185-2187)ccG>ccC	p.P729P	SCARF2_ENST00000405555.3_Silent_p.P724P	NM_153334.4	NP_699165.2	Q96GP6	SREC2_HUMAN	scavenger receptor class F, member 2	729	Pro-rich.				cell adhesion (GO:0007155)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|skin(2)	10	Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			CGGGCAGCCCCGGGGGGCGCG	0.781																																					p.P729P		.											.	SCARF2-341	0			c.G2187C						.	G	,	3110,60		1525,60,0	4.0	5.0	4.0		2187,2172	-6.8	0.1	22	dbSNP_86	4	5974,118		2928,118,0	no	coding-synonymous,coding-synonymous	SCARF2	NM_153334.4,NM_182895.2	,	4453,178,0	GG,GC,CC		1.937,1.8927,1.9218	,	729/871,724/866	20780091	9084,178	1585	3046	4631	SO:0001819	synonymous_variant	91179	exon11			CAGCCCCGGGGGG	AF522196	CCDS13779.1, CCDS46666.1	22q11.21	2011-10-10			ENSG00000244486	ENSG00000244486			19869	protein-coding gene	gene with protein product		613619				12154095	Standard	XM_006724364		Approved	SREC-II, SREC2, HUMZD58C02	uc002zsk.2	Q96GP6	OTTHUMG00000150779	ENST00000266214.5:c.2187G>C	22.37:g.20780091C>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_153334	0	0	0	0	0	E5RFB8|Q58A83|Q8IXF3|Q9BW74	Silent	SNP	ENST00000266214.5	37	CCDS13779.1																																																																																			C|0.138;G|0.862		0.781	SCARF2-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320047.1		
SCARF2	91179	hgsc.bcm.edu	37	22	20780097	20780097	+	Silent	SNP	G	G	C	rs759609		TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr22:20780097G>C	ENST00000266214.5	-	11	2285	c.2181C>G	c.(2179-2181)cgC>cgG	p.R727R	SCARF2_ENST00000405555.3_Silent_p.R722R	NM_153334.4	NP_699165.2	Q96GP6	SREC2_HUMAN	scavenger receptor class F, member 2	727	Pro-rich.				cell adhesion (GO:0007155)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|skin(2)	10	Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			GCCCCGGGGGGCGCGGCGTTG	0.781																																					p.R727R		.											.	SCARF2-341	0			c.C2181G						.	C	,	3271,119		1585,101,9	5.0	5.0	5.0		2181,2166	-5.3	0.0	22	dbSNP_86	5	6306,190		3060,186,2	no	coding-synonymous,coding-synonymous	SCARF2	NM_153334.4,NM_182895.2	,	4645,287,11	CC,CG,GG		2.9249,3.5103,3.1256	,	727/871,722/866	20780097	9577,309	1695	3248	4943	SO:0001819	synonymous_variant	91179	exon11			CGGGGGGCGCGGC	AF522196	CCDS13779.1, CCDS46666.1	22q11.21	2011-10-10			ENSG00000244486	ENSG00000244486			19869	protein-coding gene	gene with protein product		613619				12154095	Standard	XM_006724364		Approved	SREC-II, SREC2, HUMZD58C02	uc002zsk.2	Q96GP6	OTTHUMG00000150779	ENST00000266214.5:c.2181C>G	22.37:g.20780097G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_153334	0	0	0	0	0	E5RFB8|Q58A83|Q8IXF3|Q9BW74	Silent	SNP	ENST00000266214.5	37	CCDS13779.1																																																																																			G|0.826;C|0.174		0.781	SCARF2-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320047.1		
POM121L1P	25812	broad.mit.edu	37	22	22985653	22985653	+	RNA	SNP	A	A	G			TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr22:22985653A>G	ENST00000402027.1	-	0	1291					NR_024591.1		Q3SYA9	P12L1_HUMAN	POM121 transmembrane nucleoporin-like 1, pseudogene																		GCAGATGCTAAGGGGGCCAGT	0.592																																					.		.											.	.	0			.						.																																					25812	.			ATGCTAAGGGGGC			22q11.22	2013-10-11	2012-03-13	2009-01-15	ENSG00000183169	ENSG00000183169			16439	pseudogene	pseudogene	"""POM121-like 2"""		"""POM121 membrane glycoprotein-like 1 (rat)"", ""POM121 membrane glycoprotein-like 1, pseudogene"""	POM121L1		9074928	Standard	NR_024591		Approved		uc011ait.1	Q3SYA9	OTTHUMG00000151169		22.37:g.22985653A>G		Somatic	10	0		WXS	Illumina GAIIx	Phase_I	11	3	.	0	0	0	4	4		RNA	SNP	ENST00000402027.1	37																																																																																				.		0.592	POM121L1P-002	KNOWN	basic|exp_conf	processed_transcript	pseudogene	OTTHUMT00000468457.1	NR_024591	
NEFH	4744	ucsc.edu	37	22	29885564	29885564	+	Silent	SNP	A	A	G	rs202065964|rs371230849		TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr22:29885564A>G	ENST00000310624.6	+	4	1968	c.1935A>G	c.(1933-1935)gaA>gaG	p.E645E		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	645	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						CGAAGGAGGAAGCAAAGTCCC	0.562																																					p.E645E		.											.	NEFH-90	0			c.A1935G						.						83.0	89.0	87.0					22																	29885564		2203	4300	6503	SO:0001819	synonymous_variant	4744	exon4			GGAGGAAGCAAAG		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1935A>G	22.37:g.29885564A>G		Somatic	168	1		WXS	Illumina GAIIx	Phase_I	179	47	NM_021076	0	0	10	10	0	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Silent	SNP	ENST00000310624.6	37	CCDS13858.1																																																																																			.		0.562	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
NEFH	4744	hgsc.bcm.edu;ucsc.edu	37	22	29885594	29885594	+	Silent	SNP	A	A	T	rs79235463|rs200984527|rs267607533	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr22:29885594A>T	ENST00000310624.6	+	4	1998	c.1965A>T	c.(1963-1965)ccA>ccT	p.P655P		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	661	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						CCAAGTCCCCAGAGAAGGAAG	0.552																																					p.P655P		.											.	NEFH-90	0			c.A1965T						.						83.0	92.0	89.0					22																	29885594		2203	4300	6503	SO:0001819	synonymous_variant	4744	exon4			GTCCCCAGAGAAG		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1965A>T	22.37:g.29885594A>T		Somatic	257	0		WXS	Illumina GAIIx	Phase_I	247	57	NM_021076	0	0	4	4	0	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Silent	SNP	ENST00000310624.6	37	CCDS13858.1																																																																																			A|0.500;T|0.500		0.552	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
NEFH	4744	broad.mit.edu	37	22	29885599	29885604	+	In_Frame_Del	DEL	AGGAAG	AGGAAG	-	rs267607534|rs373980795|rs267607533|rs149571560|rs200984527|rs370803228		TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr22:29885599_29885604delAGGAAG	ENST00000310624.6	+	4	2003_2008	c.1970_1975delAGGAAG	c.(1969-1977)aaggaagag>aag	p.EE658del		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	664	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						TCCCCAGAGAAGGAAGAGGCCAAGTC	0.558																																					p.657_659del		.											.	NEFH-90	0			c.1970_1975del						.																																			SO:0001651	inframe_deletion	4744	exon4			CAGAGAAGGAAGA		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1970_1975delAGGAAG	22.37:g.29885599_29885604delAGGAAG	ENSP00000311997:p.Glu658_Glu659del	Somatic	276	0		WXS	Illumina GAIIx	Phase_I	265	24	NM_021076	0	0	0	0	0	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	In_Frame_Del	DEL	ENST00000310624.6	37	CCDS13858.1																																																																																			.		0.558	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
TOM1	10043	broad.mit.edu	37	22	35734776	35734776	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr22:35734776G>T	ENST00000449058.2	+	12	1344	c.1219G>T	c.(1219-1221)Ggc>Tgc	p.G407C	TOM1_ENST00000411850.1_Missense_Mutation_p.G407C|TOM1_ENST00000382034.5_3'UTR|TOM1_ENST00000436462.2_Missense_Mutation_p.G369C|TOM1_ENST00000425375.1_Missense_Mutation_p.G362C|TOM1_ENST00000447733.1_Missense_Mutation_p.G374C	NM_005488.2	NP_005479.1	O60784	TOM1_HUMAN	target of myb1 (chicken)	407					endocytosis (GO:0006897)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	clathrin binding (GO:0030276)			NS(1)|breast(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(3)|prostate(2)	19						GCAGAGCACTGGCGCGGTAAG	0.642																																					p.G407C		.											.	TOM1-91	0			c.G1219T						.						21.0	18.0	19.0					22																	35734776		2186	4293	6479	SO:0001583	missense	10043	exon12			AGCACTGGCGCGG	AJ006973	CCDS13913.1, CCDS46696.1, CCDS46697.1, CCDS46698.1	22q13.1	2011-01-31	2001-11-28		ENSG00000100284	ENSG00000100284			11982	protein-coding gene	gene with protein product		604700	"""target of myb1 (chicken) homolog"""			10329004, 15047686	Standard	NM_005488		Approved		uc003anp.3	O60784	OTTHUMG00000150958	ENST00000449058.2:c.1219G>T	22.37:g.35734776G>T	ENSP00000394466:p.Gly407Cys	Somatic	19	0		WXS	Illumina GAIIx	Phase_I	35	3	NM_001135732	0	0	1	1	0	B4DEL9|B4DNA1|Q5TIJ6|Q86X74	Missense_Mutation	SNP	ENST00000449058.2	37	CCDS13913.1	.	.	.	.	.	.	.	.	.	.	G	19.94	3.919993	0.73098	.	.	ENSG00000100284	ENST00000447733;ENST00000449058;ENST00000411850;ENST00000425375;ENST00000412456;ENST00000451197;ENST00000436462	T;T;T;T;T	0.26810	1.72;1.73;1.72;1.71;1.71	5.23	4.21	0.49690	.	0.899723	0.09327	N	0.817463	T	0.52092	0.1713	M	0.76002	2.32	0.80722	D	1	P;D;D;D;B	0.76494	0.911;0.999;0.96;0.997;0.128	P;D;P;D;B	0.67725	0.694;0.936;0.67;0.953;0.087	T	0.42015	-0.9476	10	0.72032	D	0.01	-2.9363	13.6491	0.62299	0.0749:0.0:0.9251:0.0	.	362;369;416;407;407	O60784-3;E7EPD0;B4DKQ5;O60784-2;O60784	.;.;.;.;TOM1_HUMAN	C	374;407;407;362;144;416;369	ENSP00000398876:G374C;ENSP00000394466:G407C;ENSP00000413697:G407C;ENSP00000394924:G362C;ENSP00000402556:G369C	ENSP00000413697:G407C	G	+	1	0	TOM1	34064776	1.000000	0.71417	0.191000	0.23289	0.969000	0.65631	3.028000	0.49705	1.200000	0.43188	0.655000	0.94253	GGC	.		0.642	TOM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000320641.1	NM_005488	
TRIOBP	11078	hgsc.bcm.edu	37	22	38122462	38122462	+	Missense_Mutation	SNP	A	A	G	rs739138	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr22:38122462A>G	ENST00000406386.3	+	7	4154	c.3899A>G	c.(3898-3900)cAc>cGc	p.H1300R		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	1300			H -> R (in dbSNP:rs739138).		actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					GGCCGCACCCACAGCCCTGGC	0.741													G|||	3010	0.601038	0.1944	0.5836	5008	,	,		13399	0.8859		0.7157	False		,,,				2504	0.7515				p.H1300R		.											.	TRIOBP-136	0			c.A3899G						.	G	ARG/HIS	1221,2235		265,691,772	4.0	6.0	5.0		3899	3.9	1.0	22	dbSNP_86	5	5694,1808		2238,1218,295	yes	missense	TRIOBP	NM_001039141.2	29	2503,1909,1067	GG,GA,AA		24.1002,35.3299,36.8954	benign	1300/2366	38122462	6915,4043	1728	3751	5479	SO:0001583	missense	11078	exon7			GCACCCACAGCCC	AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.3899A>G	22.37:g.38122462A>G	ENSP00000384312:p.His1300Arg	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	31	11	NM_001039141	0	0	0	0	0	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Missense_Mutation	SNP	ENST00000406386.3	37	CCDS43015.1	1409	0.6451465201465202	110	0.22357723577235772	222	0.6132596685082873	531	0.9283216783216783	546	0.7203166226912929	G	12.86	2.065195	0.36470	0.353299	0.758998	ENSG00000100106	ENST00000406386;ENST00000417174	T	0.11063	2.81	4.93	3.9	0.45041	.	.	.	.	.	T	0.00012	0.0000	N	0.01576	-0.805	0.09310	P	0.999999999370294	B	0.02656	0.0	B	0.01281	0.0	T	0.29671	-1.0004	8	0.02654	T	1	.	4.383	0.11304	0.2555:0.0:0.5874:0.1571	rs739138	1300	Q9H2D6	TARA_HUMAN	R	1300	ENSP00000384312:H1300R	ENSP00000384312:H1300R	H	+	2	0	TRIOBP	36452408	1.000000	0.71417	1.000000	0.80357	0.841000	0.47740	1.338000	0.33873	0.503000	0.28060	-0.366000	0.07423	CAC	A|0.354;G|0.646		0.741	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319439.2		
CTNNB1	1499	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	41266117	41266139	+	Frame_Shift_Del	DEL	TGCCACTACCACAGCTCCTTCTC	TGCCACTACCACAGCTCCTTCTC	-	rs121913412|rs121913413|rs121913407|rs121913409		TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	TGCCACTACCACAGCTCCTTCTC	TGCCACTACCACAGCTCCTTCTC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr3:41266117_41266139delTGCCACTACCACAGCTCCTTCTC	ENST00000349496.5	+	3	394_416	c.114_136delTGCCACTACCACAGCTCCTTCTC	c.(112-138)ggtgccactaccacagctccttctctgfs	p.ATTTAPSL39fs	CTNNB1_ENST00000396185.3_Frame_Shift_Del_p.ATTTAPSL39fs|CTNNB1_ENST00000453024.1_Frame_Shift_Del_p.ATTTAPSL32fs|CTNNB1_ENST00000405570.1_Frame_Shift_Del_p.ATTTAPSL39fs|CTNNB1_ENST00000396183.3_Frame_Shift_Del_p.ATTTAPSL39fs	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	39					adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.T41A(550)|p.S45F(384)|p.S45P(168)|p.T41I(74)|p.S45del(54)|p.A5_A80del(53)|p.S45C(19)|p.S45Y(17)|p.S45A(11)|p.T40I(11)|p.A5_A80>D(7)|p.A5_Q143del(7)|p.T41N(6)|p.T41S(6)|p.T41P(6)|p.T42R(5)|p.Q28_H134del(5)|p.A43V(5)|p.P44A(5)|p.G38P(4)|p.A43T(4)|p.?(4)|p.P44S(4)|p.T42I(3)|p.W25_I140del(3)|p.V22_G38del(3)|p.T42fs*7(3)|p.T3_A126del(2)|p.M5_N141>D(2)|p.S45_S47>C(2)|p.D32_S47del(2)|p.P44_S45del(2)|p.T41T(2)|p.T40T(2)|p.A43P(2)|p.A5_Y142>D(2)|p.A5fs*7(2)|p.T42_A43insSS(2)|p.L10_N141del(2)|p.A39T(2)|p.P44L(2)|p.A39G(2)|p.S37_G48>C(1)|p.Q28_Q61del(1)|p.A20_N141del(1)|p.D11_Y142>H(1)|p.H24_G38del(1)|p.Y30_A97del(1)|p.T40_L46del(1)|p.Q28_A43del(1)|p.E15_I140>V(1)|p.H24_M131del(1)|p.G38_A39del(1)|p.P44del(1)|p.A13_R151del(1)|p.M1_A87del(1)|p.L46_S47del(1)|p.P44_N51del(1)|p.V22_T102del(1)|p.S45fs*2(1)|p.S23_A39del(1)|p.T42T(1)|p.S45E(1)|p.T42S(1)|p.A21_A80del(1)|p.P16_K133del(1)|p.S45T(1)|p.S45S(1)|p.T42A(1)|p.A39_T42del(1)|p.I35_K170del(1)|p.L46V(1)|p.M14_S45del(1)|p.T42_G48del(1)|p.P44_S45insAP(1)|p.S45_G48del(1)|p.T42_K49>Q(1)|p.S45_D58del(1)|p.V22_S71>A(1)|p.A20_A80del(1)|p.A5_T59del(1)|p.M1_V173del(1)|p.T40S(1)|p.M8_A80del(1)|p.T40A(1)|p.Y30_T40del(1)|p.S37_G38>W(1)|p.A5_Q143>E(1)|p.H36_E53>L(1)|p.Y30_A80del(1)|p.A43del(1)|p.S45_L46del(1)|p.S37_A39>S(1)|p.T41_N51del(1)|p.A5_T40del(1)|p.A5_E54del(1)|p.I35_T41del(1)|p.V22_Y64del(1)|p.A20_S111del(1)|p.A39A(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		TCCATTCTGGTGCCACTACCACAGCTCCTTCTCTGAGTGGTAA	0.493	S45F(HCC15_LUNG)|S45F(LS180_LARGE_INTESTINE)|T41A(CCK81_LARGE_INTESTINE)	15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.38_46del	Colon(6;3 56 14213 18255)	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	.	CTNNB1-24361	1509	Substitution - Missense(1297)|Deletion - In frame(167)|Complex - deletion inframe(22)|Unknown(7)|Substitution - coding silent(7)|Deletion - Frameshift(6)|Insertion - In frame(3)	soft_tissue(676)|liver(303)|large_intestine(149)|kidney(110)|endometrium(61)|adrenal_gland(36)|pituitary(28)|thyroid(21)|skin(18)|biliary_tract(17)|ovary(16)|haematopoietic_and_lymphoid_tissue(16)|stomach(15)|prostate(9)|lung(7)|pancreas(6)|bone(5)|central_nervous_system(4)|small_intestine(4)|cervix(3)|breast(2)|upper_aerodigestive_tract(1)|urinary_tract(1)|salivary_gland(1)	c.114_136del						.																																			SO:0001589	frameshift_variant	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	TTCTGGTGCCACT	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.114_136delTGCCACTACCACAGCTCCTTCTC	3.37:g.41266117_41266139delTGCCACTACCACAGCTCCTTCTC	ENSP00000344456:p.Ala39fs	Somatic	208	0		WXS	Illumina GAIIx	Phase_I	183	21	NM_001098209	0	0	0	0	0	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Frame_Shift_Del	DEL	ENST00000349496.5	37	CCDS2694.1																																																																																			.		0.493	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
IP6K2	51447	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	48726082	48726082	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr3:48726082T>C	ENST00000328631.5	-	6	1128	c.905A>G	c.(904-906)gAa>gGa	p.E302G	NCKIPSD_ENST00000294129.2_5'Flank|NCKIPSD_ENST00000341520.4_5'Flank|NCKIPSD_ENST00000416649.2_5'Flank	NM_001005909.2|NM_016291.3	NP_001005909.1|NP_057375.2	Q9UHH9	IP6K2_HUMAN	inositol hexakisphosphate kinase 2	302					cytokine-mediated signaling pathway (GO:0019221)|inositol phosphate metabolic process (GO:0043647)|negative regulation of cell growth (GO:0030308)|phosphate ion transport (GO:0006817)|phosphatidylinositol phosphorylation (GO:0046854)|positive regulation of apoptotic process (GO:0043065)|small molecule metabolic process (GO:0044281)|type I interferon signaling pathway (GO:0060337)	intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			biliary_tract(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)	15						GCCCAGGAGTTCACGGCGCAG	0.542																																					p.E302G		.											.	IP6K2-265	0			c.A905G						.						109.0	97.0	101.0					3																	48726082		2203	4300	6503	SO:0001583	missense	51447	exon6			AGGAGTTCACGGC	AF177145	CCDS2777.1, CCDS33752.1, CCDS54579.1, CCDS54580.1, CCDS54581.1	3p21.31	2009-01-05	2009-01-05	2008-12-22	ENSG00000068745	ENSG00000068745			17313	protein-coding gene	gene with protein product		606992	"""inositol hexaphosphate kinase 2"""	IHPK2		10574768	Standard	NM_016291		Approved		uc003cup.3	Q9UHH9	OTTHUMG00000133543	ENST00000328631.5:c.905A>G	3.37:g.48726082T>C	ENSP00000331103:p.Glu302Gly	Somatic	249	0		WXS	Illumina GAIIx	Phase_I	253	40	NM_016291	0	0	45	48	3	A8K3B1|B4E3G6|G8JLL6|Q6P0N8|Q9BSZ6|Q9BUW3|Q9H4P7|Q9NT63|Q9UFU6	Missense_Mutation	SNP	ENST00000328631.5	37	CCDS2777.1	.	.	.	.	.	.	.	.	.	.	T	23.7	4.443524	0.83993	.	.	ENSG00000068745	ENST00000328631	T	0.18016	2.24	5.75	4.58	0.56647	.	0.000000	0.85682	D	0.000000	T	0.37999	0.1024	M	0.63843	1.955	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.11867	-1.0570	10	0.72032	D	0.01	-3.7393	12.2563	0.54625	0.1274:0.0:0.0:0.8726	.	302	Q9UHH9	IP6K2_HUMAN	G	302	ENSP00000331103:E302G	ENSP00000331103:E302G	E	-	2	0	IP6K2	48701086	1.000000	0.71417	0.996000	0.52242	0.997000	0.91878	8.040000	0.89188	0.995000	0.38917	0.533000	0.62120	GAA	.		0.542	IP6K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257521.2	NM_016291	
LRIG1	26018	hgsc.bcm.edu	37	3	66550756	66550756	+	Missense_Mutation	SNP	G	G	C	rs1403625	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr3:66550756G>C	ENST00000273261.3	-	1	600	c.76C>G	c.(76-78)Ctt>Gtt	p.L26V	LRIG1_ENST00000383703.3_Missense_Mutation_p.L26V	NM_015541.2	NP_056356.2	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like domains 1	26				LLL -> VLV (in Ref. 1; AAK62357 and 3; AAH71561). {ECO:0000305}.	innervation (GO:0060384)|otolith morphogenesis (GO:0032474)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)				NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(4)|stomach(4)|urinary_tract(1)	42		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		TCCAGCCGAAGCAAAAGCAGC	0.761													g|||	3605	0.719848	0.1808	0.8833	5008	,	,		8093	0.8284		0.9732	False		,,,				2504	0.9601				p.L26V		.											.	LRIG1-230	0			c.C76G						.		VAL/LEU	1298,1386		255,788,299	3.0	4.0	4.0		76	2.9	0.5	3	dbSNP_88	4	5191,89		2555,81,4	yes	missense	LRIG1	NM_015541.2	32	2810,869,303	CC,CG,GG		1.6856,48.3607,18.5208	benign	26/1094	66550756	6489,1475	1342	2640	3982	SO:0001583	missense	26018	exon1			GCCGAAGCAAAAG	AB050468	CCDS33783.1	3p14	2013-01-14			ENSG00000144749	ENSG00000144749		"""Immunoglobulin superfamily / I-set domain containing"""	17360	protein-coding gene	gene with protein product	"""ortholog of mouse integral membrane glycoprotein LIG-1"", ""leucine-rich repeat protein LRIG1"""	608868				11414704, 12234026	Standard	NM_015541		Approved	LIG-1, DKFZP586O1624, LIG1	uc003dmx.3	Q96JA1	OTTHUMG00000158727	ENST00000273261.3:c.76C>G	3.37:g.66550756G>C	ENSP00000273261:p.Leu26Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	11	11	NM_015541	0	0	0	0	0	Q6IQ51|Q96CF9|Q9BYB8|Q9UFI4	Missense_Mutation	SNP	ENST00000273261.3	37	CCDS33783.1	1666	0.7628205128205128	118	0.23983739837398374	325	0.8977900552486188	489	0.8548951048951049	734	0.9683377308707124	g	6.572	0.473779	0.12521	0.483607	0.983144	ENSG00000144749	ENST00000273261;ENST00000383703	T;T	0.67345	-0.26;-0.13	3.84	2.93	0.34026	.	0.847359	0.09512	U	0.792175	T	0.00012	0.0000	N	0.19112	0.55	0.80722	P	0.0	P;P	0.44139	0.827;0.484	B;B	0.37731	0.257;0.096	T	0.48854	-0.8998	9	0.23302	T	0.38	.	8.6883	0.34251	0.1185:0.0:0.8815:0.0	rs1403625;rs13083628	26;26	Q96JA1-2;Q96JA1	.;LRIG1_HUMAN	V	26	ENSP00000273261:L26V;ENSP00000373208:L26V	ENSP00000273261:L26V	L	-	1	0	LRIG1	66633446	.	.	0.520000	0.27837	0.020000	0.10135	.	.	1.845000	0.53610	0.472000	0.43445	CTT	G|0.237;C|0.763		0.761	LRIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351930.1	NM_015541	
LRIG1	26018	hgsc.bcm.edu	37	3	66550762	66550762	+	Missense_Mutation	SNP	G	G	C	rs1403626	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr3:66550762G>C	ENST00000273261.3	-	1	594	c.70C>G	c.(70-72)Ctt>Gtt	p.L24V	LRIG1_ENST00000383703.3_Missense_Mutation_p.L24V	NM_015541.2	NP_056356.2	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like domains 1	24			L -> V (in dbSNP:rs1403626).	LLL -> VLV (in Ref. 1; AAK62357 and 3; AAH71561). {ECO:0000305}.	innervation (GO:0060384)|otolith morphogenesis (GO:0032474)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)				NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(4)|stomach(4)|urinary_tract(1)	42		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		CGAAGCAAAAGCAGCCAGAGA	0.766													g|||	3605	0.719848	0.1808	0.8833	5008	,	,		8368	0.8284		0.9732	False		,,,				2504	0.9601				p.L24V		.											.	LRIG1-230	0			c.C70G						.		VAL/LEU	1309,1447		265,779,334	3.0	4.0	4.0		70	3.1	0.5	3	dbSNP_88	4	5325,93		2620,85,4	no	missense	LRIG1	NM_015541.2	32	2885,864,338	CC,CG,GG		1.7165,47.4964,18.8402	benign	24/1094	66550762	6634,1540	1378	2709	4087	SO:0001583	missense	26018	exon1			GCAAAAGCAGCCA	AB050468	CCDS33783.1	3p14	2013-01-14			ENSG00000144749	ENSG00000144749		"""Immunoglobulin superfamily / I-set domain containing"""	17360	protein-coding gene	gene with protein product	"""ortholog of mouse integral membrane glycoprotein LIG-1"", ""leucine-rich repeat protein LRIG1"""	608868				11414704, 12234026	Standard	NM_015541		Approved	LIG-1, DKFZP586O1624, LIG1	uc003dmx.3	Q96JA1	OTTHUMG00000158727	ENST00000273261.3:c.70C>G	3.37:g.66550762G>C	ENSP00000273261:p.Leu24Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	15	15	NM_015541	0	0	0	0	0	Q6IQ51|Q96CF9|Q9BYB8|Q9UFI4	Missense_Mutation	SNP	ENST00000273261.3	37	CCDS33783.1	1670	0.7646520146520146	119	0.241869918699187	326	0.9005524861878453	488	0.8531468531468531	737	0.9722955145118733	g	9.592	1.126319	0.20959	0.474964	0.982835	ENSG00000144749	ENST00000273261;ENST00000383703	T;T	0.68765	-0.35;-0.2	3.11	3.11	0.35812	.	0.429988	0.15146	U	0.278020	T	0.00012	0.0000	N	0.19112	0.55	0.39998	P	0.024872000000000005	P;B	0.36282	0.546;0.282	B;B	0.32465	0.146;0.069	T	0.40572	-0.9556	9	0.23891	T	0.37	.	12.0321	0.53403	0.0:0.0:1.0:0.0	rs1403626;rs13083630;rs1403626	24;24	Q96JA1-2;Q96JA1	.;LRIG1_HUMAN	V	24	ENSP00000273261:L24V;ENSP00000373208:L24V	ENSP00000273261:L24V	L	-	1	0	LRIG1	66633452	.	.	0.546000	0.28166	0.017000	0.09413	.	.	1.734000	0.51633	0.472000	0.43445	CTT	G|0.252;C|0.748		0.766	LRIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351930.1	NM_015541	
ATR	545	bcgsc.ca	37	3	142278201	142278201	+	Missense_Mutation	SNP	T	T	C	rs200491706		TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr3:142278201T>C	ENST00000350721.4	-	7	1745	c.1624A>G	c.(1624-1626)Aaa>Gaa	p.K542E	ATR_ENST00000383101.3_Missense_Mutation_p.K478E	NM_001184.3	NP_001175.2	Q13535	ATR_HUMAN	ATR serine/threonine kinase	542					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of DNA replication (GO:0008156)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|protein autophosphorylation (GO:0046777)|regulation of protein binding (GO:0043393)|replicative senescence (GO:0090399)|response to drug (GO:0042493)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|XY body (GO:0001741)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MutLalpha complex binding (GO:0032405)|MutSalpha complex binding (GO:0032407)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(10)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|liver(2)|lung(45)|ovary(3)|skin(10)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(4)	122						TTAAGCACTTTTGTGTAAAAA	0.363								Other conserved DNA damage response genes																													p.K542E		.											.	ATR-1139	0			c.A1624G						.	T	GLU/LYS	0,4406		0,0,2203	100.0	98.0	99.0		1624	4.9	1.0	3		99	2,8598	2.2+/-6.3	0,2,4298	yes	missense	ATR	NM_001184.3	56	0,2,6501	CC,CT,TT		0.0233,0.0,0.0154	benign	542/2645	142278201	2,13004	2203	4300	6503	SO:0001583	missense	545	exon7			GCACTTTTGTGTA	U76308	CCDS3124.1	3q23	2014-06-17	2014-06-17		ENSG00000175054	ENSG00000175054			882	protein-coding gene	gene with protein product	"""MEC1, mitosis entry checkpoint 1, homolog (S. cerevisiae)"""	601215	"""ataxia telangiectasia and Rad3 related"""			8978690, 8610130	Standard	NM_001184		Approved	FRP1, SCKL, SCKL1, MEC1	uc003eux.4	Q13535	OTTHUMG00000159234	ENST00000350721.4:c.1624A>G	3.37:g.142278201T>C	ENSP00000343741:p.Lys542Glu	Somatic	121	2		WXS	Illumina GAIIx	Phase_I	144	6	NM_001184	0	0	0	0	0	Q59HB2|Q7KYL3|Q93051|Q9BXK4	Missense_Mutation	SNP	ENST00000350721.4	37	CCDS3124.1	.	.	.	.	.	.	.	.	.	.	T	16.89	3.247582	0.59103	0.0	2.33E-4	ENSG00000175054	ENST00000350721;ENST00000383101;ENST00000515149	T;T	0.03580	3.92;3.88	6.07	4.92	0.64577	Armadillo-type fold (1);	0.212871	0.48286	N	0.000182	T	0.03564	0.0102	N	0.24115	0.695	0.32636	N	0.521314	B	0.20887	0.049	B	0.22386	0.039	T	0.09143	-1.0688	10	0.54805	T	0.06	-12.4993	10.7915	0.46436	0.0:0.0713:0.0:0.9287	.	542	Q13535	ATR_HUMAN	E	542;478;159	ENSP00000343741:K542E;ENSP00000372581:K478E	ENSP00000343741:K542E	K	-	1	0	ATR	143760891	1.000000	0.71417	0.966000	0.40874	0.944000	0.59088	2.688000	0.46984	1.114000	0.41781	0.533000	0.62120	AAA	.		0.363	ATR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353995.2	NM_001184	
DHX36	170506	hgsc.bcm.edu	37	3	153994065	153994065	+	Silent	SNP	G	G	T			TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr3:153994065G>T	ENST00000496811.1	-	25	3002	c.2922C>A	c.(2920-2922)tcC>tcA	p.S974S	DHX36_ENST00000308361.6_Silent_p.S945S|DHX36_ENST00000329463.5_Silent_p.S960S|DHX36_ENST00000544526.1_Silent_p.S960S	NM_020865.2	NP_065916.2	Q9H2U1	DHX36_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 36	974					ATP catabolic process (GO:0006200)|innate immune response (GO:0045087)|ossification (GO:0001503)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|RNA secondary structure unwinding (GO:0010501)|transcription, DNA-templated (GO:0006351)	chromosome, telomeric region (GO:0000781)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|core promoter binding (GO:0001047)|DNA-dependent ATPase activity (GO:0008094)|double-stranded RNA binding (GO:0003725)|G-quadruplex DNA binding (GO:0051880)|G-quadruplex RNA binding (GO:0002151)|histone deacetylase binding (GO:0042826)|poly(A) RNA binding (GO:0044822)|transcription regulatory region DNA binding (GO:0044212)			endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(7)|lung(11)|prostate(2)|skin(1)|urinary_tract(1)	35			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			CACAGTCTCTGGATTTAGTGT	0.393																																					p.S974S		.											.	DHX36-226	0			c.C2922A						.						144.0	137.0	139.0					3																	153994065		2203	4300	6503	SO:0001819	synonymous_variant	170506	exon25			GTCTCTGGATTTA	AF217190	CCDS3171.1, CCDS54657.1	3q25.2	2012-09-20	2003-06-13	2003-06-20	ENSG00000174953	ENSG00000174953		"""DEAH-boxes"""	14410	protein-coding gene	gene with protein product		612767	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 36"""	DDX36			Standard	NM_020865		Approved	MLEL1, KIAA1488	uc003ezy.4	Q9H2U1	OTTHUMG00000159109	ENST00000496811.1:c.2922C>A	3.37:g.153994065G>T		Somatic	134	0		WXS	Illumina GAIIx	Phase_I	100	5	NM_020865	0	0	28	28	0	B2RB00|Q70JU3|Q8IYE5|Q9P240	Silent	SNP	ENST00000496811.1	37	CCDS3171.1																																																																																			.		0.393	DHX36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353349.1	NM_020865	
CRIPAK	285464	hgsc.bcm.edu	37	4	1388755	1388755	+	Silent	SNP	C	C	G	rs373946226	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr4:1388755C>G	ENST00000324803.4	+	1	3416	c.456C>G	c.(454-456)ccC>ccG	p.P152P		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	152					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			CACACGTGCCCATGCGGAGTG	0.697													N|||	566	0.113019	0.0772	0.1657	5008	,	,		16075	0.0139		0.1441	False		,,,				2504	0.1943				p.P152P		.											.	CRIPAK-90	0			c.C456G						.						75.0	67.0	69.0					4																	1388755		2201	4282	6483	SO:0001819	synonymous_variant	285464	exon1			CGTGCCCATGCGG	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.456C>G	4.37:g.1388755C>G		Somatic	2	0		WXS	Illumina GAIIx	Phase_I	128	7	NM_175918	0	0	11	24	13	Q8NB03	Silent	SNP	ENST00000324803.4	37	CCDS3349.1	.	.	.	.	.	.	.	.	.	.	-	3.606	-0.080629	0.07141	.	.	ENSG00000179979	ENST00000382944	.	.	.	0.948	-1.9	0.07665	.	.	.	.	.	T	0.13713	0.0332	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.26643	-1.0097	5	0.12430	T	0.62	.	2.6602	0.05024	0.0:0.3324:0.2607:0.407	.	.	.	.	D	136	.	ENSP00000372402:H136D	H	+	1	0	CRIPAK	1378755	0.000000	0.05858	0.001000	0.08648	0.018000	0.09664	-4.277000	0.00261	-0.599000	0.05798	-1.737000	0.00689	CAT	C|0.960;G|0.040		0.697	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
TNIP2	79155	hgsc.bcm.edu	37	4	2757800	2757800	+	Missense_Mutation	SNP	G	G	C	rs74548850	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr4:2757800G>C	ENST00000315423.7	-	1	303	c.217C>G	c.(217-219)Cgc>Ggc	p.R73G	TNIP2_ENST00000503235.1_Missense_Mutation_p.R73G|TNIP2_ENST00000510267.1_5'UTR	NM_024309.3	NP_077285.3			TNFAIP3 interacting protein 2											breast(2)|central_nervous_system(1)|large_intestine(4)|lung(6)|prostate(1)	14				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		TCCCGGAAGCGCGCAACCTGC	0.756													G|||	210	0.0419329	0.025	0.0447	5008	,	,		6355	0.0288		0.0408	False		,,,				2504	0.0777				p.R73G		.											.	TNIP2-90	0			c.C217G						.	G	GLY/ARG	60,3592		0,60,1766	5.0	7.0	6.0		217	2.8	1.0	4	dbSNP_131	6	267,7455		4,259,3598	no	missense	TNIP2	NM_024309.3	125	4,319,5364	CC,CG,GG		3.4577,1.6429,2.875	probably-damaging	73/430	2757800	327,11047	1826	3861	5687	SO:0001583	missense	79155	exon1			GGAAGCGCGCAAC	BC002740	CCDS3362.1, CCDS54714.1, CCDS75093.1	4p16.3	2008-08-01			ENSG00000168884	ENSG00000168884			19118	protein-coding gene	gene with protein product		610669				11390377, 12933576	Standard	NM_024309		Approved	ABIN-2, MGC4289, KLIP, FLIP1	uc003gfg.2	Q8NFZ5	OTTHUMG00000090267	ENST00000315423.7:c.217C>G	4.37:g.2757800G>C	ENSP00000321203:p.Arg73Gly	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	23	10	NM_024309	0	0	1	1	0		Missense_Mutation	SNP	ENST00000315423.7	37	CCDS3362.1	94	0.04304029304029304	17	0.034552845528455285	18	0.049723756906077346	18	0.03146853146853147	41	0.05408970976253298	G	19.51	3.841781	0.71488	0.016429	0.034577	ENSG00000168884	ENST00000315423;ENST00000503235	T;T	0.48522	0.82;0.81	3.62	2.75	0.32379	.	0.480578	0.20050	N	0.100314	T	0.14399	0.0348	M	0.65975	2.015	0.27856	N	0.940558	D;P	0.62365	0.991;0.481	P;B	0.52217	0.693;0.071	T	0.11299	-1.0593	10	0.23302	T	0.38	-8.2753	9.2129	0.37328	0.0:0.0:0.7823:0.2177	.	73;73	D6RGJ2;Q8NFZ5	.;TNIP2_HUMAN	G	73	ENSP00000321203:R73G;ENSP00000426314:R73G	ENSP00000321203:R73G	R	-	1	0	TNIP2	2727598	0.882000	0.30256	1.000000	0.80357	0.927000	0.56198	1.083000	0.30815	0.689000	0.31550	0.498000	0.49722	CGC	G|0.957;C|0.043		0.756	TNIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206589.5	NM_024309	
OTOP1	133060	broad.mit.edu	37	4	4228274	4228282	+	In_Frame_Del	DEL	CCACAGCAG	CCACAGCAG	-	rs75328065|rs199840382|rs111245977|rs377667898|rs200554408|rs201436152	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr4:4228274_4228282delCCACAGCAG	ENST00000296358.4	-	1	334_342	c.310_318delCTGCTGTGG	c.(310-318)ctgctgtggdel	p.LLW104del		NM_177998.1	NP_819056.1	Q7RTM1	OTOP1_HUMAN	otopetrin 1	104					biomineral tissue development (GO:0031214)|detection of gravity (GO:0009590)|inner ear morphogenesis (GO:0042472)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)		p.L104_W106delLLW(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|liver(4)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		ACCACAGCATCCACAGCAGCTGCAGCAGC	0.727																																					p.104_106del		.											.	OTOP1-92	1	Deletion - In frame(1)	upper_aerodigestive_tract(1)	c.310_318del						.																																			SO:0001651	inframe_deletion	133060	exon1			CAGCATCCACAGC	BK000653	CCDS3372.1	4p16.2	2008-02-05			ENSG00000163982	ENSG00000163982			19656	protein-coding gene	gene with protein product		607806				12651873	Standard	NM_177998		Approved		uc003ghp.1	Q7RTM1	OTTHUMG00000090301	ENST00000296358.4:c.310_318delCTGCTGTGG	4.37:g.4228274_4228282delCCACAGCAG	ENSP00000296358:p.Leu104_Trp106del	Somatic	5	0		WXS	Illumina GAIIx	Phase_I	111	12	NM_177998	0	0	0	0	0	A1L476	In_Frame_Del	DEL	ENST00000296358.4	37	CCDS3372.1																																																																																			.		0.727	OTOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206661.2	NM_177998	
CRMP1	1400	hgsc.bcm.edu	37	4	5894586	5894586	+	Silent	SNP	G	G	A	rs143304363	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr4:5894586G>A	ENST00000324989.7	-	1	199	c.111C>T	c.(109-111)gcC>gcT	p.A37A	CRMP1_ENST00000512574.1_5'Flank	NM_001014809.1	NP_001014809.1	Q14194	DPYL1_HUMAN	collapsin response mediator protein 1	0					axon guidance (GO:0007411)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|pyrimidine nucleobase catabolic process (GO:0006208)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			NS(1)|cervix(2)|endometrium(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	36				Colorectal(103;0.0721)		CCTCCACCGCGGCGAACATGC	0.756													G|||	277	0.0553115	0.0076	0.0461	5008	,	,		4031	0.0437		0.0805	False		,,,				2504	0.1125				p.A37A		.											.	CRMP1-92	0			c.C111T						.	G		56,3324		2,52,1636	4.0	4.0	4.0		111	0.2	1.0	4	dbSNP_134	4	409,6095		9,391,2852	no	coding-synonymous	CRMP1	NM_001014809.1		11,443,4488	AA,AG,GG		6.2884,1.6568,4.7046		37/687	5894586	465,9419	1690	3252	4942	SO:0001819	synonymous_variant	1400	exon1			CACCGCGGCGAAC	D78012	CCDS33950.1, CCDS43207.1, CCDS75102.1	4p16.1	2008-05-15			ENSG00000072832	ENSG00000072832			2365	protein-coding gene	gene with protein product		602462				8973361	Standard	XM_005247940		Approved	DRP-1, DPYSL1	uc003gis.3	Q14194	OTTHUMG00000125489	ENST00000324989.7:c.111C>T	4.37:g.5894586G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	26	15	NM_001014809	0	0	0	0	0	A0EJG6|Q13024|Q4W5F1|Q96TC8	Silent	SNP	ENST00000324989.7	37	CCDS33950.1																																																																																			G|0.946;A|0.054		0.756	CRMP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000246814.2	NM_001313	
RBM47	54502	hgsc.bcm.edu	37	4	40440854	40440854	+	Silent	SNP	G	G	C	rs1052153	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr4:40440854G>C	ENST00000381793.2	-	3	453	c.57C>G	c.(55-57)tcC>tcG	p.S19S	RBM47_ENST00000514014.1_Intron|RBM47_ENST00000381795.6_Silent_p.S19S|RBM47_ENST00000295971.7_Silent_p.S19S|RBM47_ENST00000515809.1_Intron|RBM47_ENST00000319592.4_Silent_p.S19S			A0AV96	RBM47_HUMAN	RNA binding motif protein 47	19					hematopoietic progenitor cell differentiation (GO:0002244)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(5)|endometrium(1)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	29						GCACCTTGGCGGAGGACCCGG	0.662													C|||	4016	0.801917	0.6808	0.8588	5008	,	,		14653	0.7679		0.8837	False		,,,				2504	0.8763				p.S19S		.											.	RBM47-25	0			c.C57G						.	C	,	3111,1133		1151,809,162	8.0	9.0	9.0		57,57	-7.6	0.0	4	dbSNP_86	9	7487,919		3358,771,74	no	coding-synonymous,coding-synonymous	RBM47	NM_001098634.1,NM_019027.3	,	4509,1580,236	CC,CG,GG		10.9327,26.6965,16.2213	,	19/594,19/525	40440854	10598,2052	2122	4203	6325	SO:0001819	synonymous_variant	54502	exon4			CTTGGCGGAGGAC	AK000280	CCDS3460.1, CCDS43223.1	4p14	2013-02-12			ENSG00000163694	ENSG00000163694		"""RNA binding motif (RRM) containing"""	30358	protein-coding gene	gene with protein product							Standard	NM_019027		Approved	FLJ20273, NET18	uc003gvc.2	A0AV96	OTTHUMG00000128598	ENST00000381793.2:c.57C>G	4.37:g.40440854G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_001098634	0	0	0	2	2	A0PJK2|B5MED4|Q8NI52|Q8NI53|Q9NXG3	Silent	SNP	ENST00000381793.2	37	CCDS43223.1																																																																																			G|0.794;C|0.206		0.662	RBM47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250456.2	NM_019027	
ZAR1	326340	hgsc.bcm.edu	37	4	48492434	48492434	+	Missense_Mutation	SNP	G	G	C	rs10008444	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr4:48492434G>C	ENST00000327939.4	+	1	166	c.126G>C	c.(124-126)caG>caC	p.Q42H		NM_175619.1	NP_783318.1	Q86SH2	ZAR1_HUMAN	zygote arrest 1	42					multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)				endometrium(1)|large_intestine(4)	5						GCTGGCAGCAGCGCGGCAGGG	0.756													C|||	4938	0.986022	0.9493	0.9957	5008	,	,		9261	1.0		1.0	False		,,,				2504	1.0				p.Q42H		.											.	ZAR1-90	0			c.G126C						.	C	HIS/GLN	2851,89		1381,89,0	2.0	3.0	3.0		126	-0.2	0.0	4	dbSNP_119	3	6474,0		3237,0,0	no	missense	ZAR1	NM_175619.1	24	4618,89,0	CC,CG,GG		0.0,3.0272,0.9454	benign	42/425	48492434	9325,89	1470	3237	4707	SO:0001583	missense	326340	exon1			GCAGCAGCGCGGC	AY193890	CCDS3483.1	4p11	2014-02-20			ENSG00000182223	ENSG00000182223			20436	protein-coding gene	gene with protein product	"""zinc finger, 3CxxC-type 6"""	607520				12539046	Standard	NM_175619		Approved	Z3CXXC6	uc003gyd.3	Q86SH2	OTTHUMG00000102093	ENST00000327939.4:c.126G>C	4.37:g.48492434G>C	ENSP00000329803:p.Gln42His	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	16	16	NM_175619	0	0	0	0	0		Missense_Mutation	SNP	ENST00000327939.4	37	CCDS3483.1	2130	0.9752747252747253	449	0.9126016260162602	359	0.9917127071823204	565	0.9877622377622378	757	0.9986807387862797	C	0.021	-1.426522	0.01117	0.969728	1.0	ENSG00000182223	ENST00000327939	.	.	.	4.09	-0.185	0.13276	.	0.811302	0.10779	N	0.635071	T	0.00012	0.0000	N	0.03608	-0.345	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.22103	-1.0226	8	0.14252	T	0.57	-31.571	6.2995	0.21105	0.0:0.2927:0.4307:0.2766	rs10008444;rs58304706	42	Q86SH2	ZAR1_HUMAN	H	42	.	ENSP00000329803:Q42H	Q	+	3	2	ZAR1	48187191	0.000000	0.05858	0.000000	0.03702	0.070000	0.16714	0.053000	0.14184	-0.405000	0.07599	-0.676000	0.03789	CAG	G|0.025;C|0.975		0.756	ZAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219927.3		
NMU	10874	hgsc.bcm.edu	37	4	56502307	56502307	+	Missense_Mutation	SNP	G	G	T	rs3828555	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr4:56502307G>T	ENST00000264218.3	-	1	158	c.53C>A	c.(52-54)gCg>gAg	p.A18E	NMU_ENST00000511469.1_Missense_Mutation_p.A18E|NMU_ENST00000515325.1_Intron|NMU_ENST00000505262.1_Missense_Mutation_p.A18E|NMU_ENST00000507338.1_Missense_Mutation_p.A18E	NM_006681.2	NP_006672.1	P48645	NMU_HUMAN	neuromedin U	18					digestion (GO:0007586)|eating behavior (GO:0042755)|G-protein coupled receptor signaling pathway (GO:0007186)|gastric acid secretion (GO:0001696)|neuropeptide signaling pathway (GO:0007218)|photoperiodism (GO:0009648)|positive regulation of hormone secretion (GO:0046887)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of synaptic transmission (GO:0050806)|regulation of smooth muscle contraction (GO:0006940)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|terminal bouton (GO:0043195)	receptor binding (GO:0005102)			lung(3)|ovary(1)|urinary_tract(1)	5	Lung NSC(11;0.00256)|all_epithelial(27;0.075)|Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.103)	LUSC - Lung squamous cell carcinoma(4;6.72e-08)|Lung(4;6.22e-07)|Epithelial(7;0.00559)	LUSC - Lung squamous cell carcinoma(721;0.0115)		cGGGGACGCCGCGGCCACCTG	0.761													G|||	730	0.145767	0.0764	0.2003	5008	,	,		10197	0.3343		0.0199	False		,,,				2504	0.136				p.A18E		.											.	NMU-650	0			c.C53A						.	G	GLU/ALA	168,3058		3,162,1448	5.0	7.0	6.0		53	0.1	0.0	4	dbSNP_107	6	138,5846		0,138,2854	no	missense	NMU	NM_006681.2	107	3,300,4302	TT,TG,GG		2.3061,5.2077,3.3225	probably-damaging	18/175	56502307	306,8904	1613	2992	4605	SO:0001583	missense	10874	exon1			GACGCCGCGGCCA	X76029	CCDS3501.1, CCDS75125.1	4q12	2013-02-26			ENSG00000109255	ENSG00000109255		"""Endogenous ligands"""	7859	protein-coding gene	gene with protein product	"""prepro-NMU"""	605103				7619205	Standard	XM_005265713		Approved		uc003hbc.3	P48645	OTTHUMG00000102161	ENST00000264218.3:c.53C>A	4.37:g.56502307G>T	ENSP00000264218:p.Ala18Glu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	15	15	NM_006681	0	0	0	0	0		Missense_Mutation	SNP	ENST00000264218.3	37	CCDS3501.1	315	0.14423076923076922	55	0.11178861788617886	55	0.15193370165745856	187	0.3269230769230769	18	0.023746701846965697	G	17.40	3.379938	0.61845	0.052077	0.023061	ENSG00000109255	ENST00000511469;ENST00000264218;ENST00000505262;ENST00000541393;ENST00000507338	T;T;T;T	0.35973	1.28;1.42;1.4;1.39	2.89	0.0796	0.14417	.	1.355690	0.05554	U	0.568010	T	0.00012	0.0000	N	0.22421	0.69	0.80722	P	0.0	P	0.38827	0.649	B	0.37015	0.239	T	0.31110	-0.9955	9	0.62326	D	0.03	-4.4644	5.3309	0.15932	0.4241:0.0:0.5759:0.0	rs3828555	18	P48645	NMU_HUMAN	E	18	ENSP00000422399:A18E;ENSP00000264218:A18E;ENSP00000424246:A18E;ENSP00000422870:A18E	ENSP00000264218:A18E	A	-	2	0	NMU	56197064	0.000000	0.05858	0.003000	0.11579	0.256000	0.26092	0.190000	0.17057	-0.022000	0.13986	0.195000	0.17529	GCG	G|0.853;T|0.147		0.761	NMU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220006.2		
ODAM	54959	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	71068537	71068537	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr4:71068537G>C	ENST00000396094.2	+	9	761	c.713G>C	c.(712-714)gGa>gCa	p.G238A		NM_017855.3	NP_060325.3	A1E959	ODAM_HUMAN	odontogenic, ameloblast asssociated	238					biomineral tissue development (GO:0031214)|odontogenesis of dentin-containing tooth (GO:0042475)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|fibril (GO:0043205)|nucleus (GO:0005634)				NS(1)|breast(2)|endometrium(2)|large_intestine(2)|lung(8)|ovary(3)|skin(2)	20						GACAGTGCAGGAGTTTTCATG	0.408																																					p.G238A		.											.	ODAM-134	0			c.G713C						.						95.0	87.0	90.0					4																	71068537		2203	4300	6503	SO:0001583	missense	54959	exon9			GTGCAGGAGTTTT	AK000520	CCDS3536.2	4q13.3	2010-11-23			ENSG00000109205	ENSG00000109205			26043	protein-coding gene	gene with protein product		614843				14647039	Standard	NM_017855		Approved	APin, FLJ20513	uc003hfc.3	A1E959	OTTHUMG00000129406	ENST00000396094.2:c.713G>C	4.37:g.71068537G>C	ENSP00000379401:p.Gly238Ala	Somatic	223	0		WXS	Illumina GAIIx	Phase_I	215	85	NM_017855	0	0	0	0	0	Q8WWE5|Q9NWZ9	Missense_Mutation	SNP	ENST00000396094.2	37	CCDS3536.2	.	.	.	.	.	.	.	.	.	.	G	3.286	-0.146049	0.06627	.	.	ENSG00000109205	ENST00000396094;ENST00000510709;ENST00000514097	T;T	0.54479	0.57;0.57	4.95	3.2	0.36748	.	0.254751	0.28393	N	0.015511	T	0.46658	0.1404	L	0.58101	1.795	0.09310	N	1	B	0.32203	0.36	B	0.34385	0.181	T	0.47736	-0.9094	10	0.87932	D	0	-2.2908	6.9257	0.24414	0.094:0.1755:0.7305:0.0	.	238	A1E959	ODAM_HUMAN	A	238;224;175	ENSP00000379401:G238A;ENSP00000426106:G175A	ENSP00000379401:G238A	G	+	2	0	ODAM	71103126	0.996000	0.38824	0.023000	0.16930	0.017000	0.09413	1.843000	0.39259	0.771000	0.33359	0.655000	0.94253	GGA	.		0.408	ODAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251562.1	NM_017855	
ALB	213	bcgsc.ca	37	4	74272352	74272352	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr4:74272352G>T	ENST00000295897.4	+	3	233	c.144G>T	c.(142-144)ttG>ttT	p.L48F	ALB_ENST00000503124.1_5'UTR|ALB_ENST00000415165.2_Intron|ALB_ENST00000509063.1_Missense_Mutation_p.L48F|ALB_ENST00000401494.3_Intron	NM_000477.5	NP_000468.1	Q8TES7	FBF1_HUMAN	albumin	0					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				NS(1)|endometrium(4)|kidney(1)|large_intestine(6)|liver(9)|lung(16)|ovary(3)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	48	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			TCAGGGTGTTGATTGCCTTTG	0.338																																					p.L48F		.											.	ALB-96	0			c.G144T						.						145.0	136.0	139.0					4																	74272352		2203	4300	6503	SO:0001583	missense	213	exon3			GGTGTTGATTGCC	V00494	CCDS3555.1	4q13.3	2008-02-05	2006-06-30	2006-06-30	ENSG00000163631	ENSG00000163631			399	protein-coding gene	gene with protein product		103600				6292049, 6192711	Standard	NM_000477		Approved		uc003hgs.4	P02768	OTTHUMG00000129919	ENST00000295897.4:c.144G>T	4.37:g.74272352G>T	ENSP00000295897:p.Leu48Phe	Somatic	79	0		WXS	Illumina GAIIx	Phase_I	77	5	NM_000477	0	0	0	0	0	B5MEM5|Q96IF6|Q96JG4|Q96MA8	Missense_Mutation	SNP	ENST00000295897.4	37	CCDS3555.1	.	.	.	.	.	.	.	.	.	.	G	11.39	1.626068	0.28978	.	.	ENSG00000163631	ENST00000441319;ENST00000295897;ENST00000329326;ENST00000509063;ENST00000430202	T;T;T	0.78816	-1.21;-1.21;-1.21	5.54	3.81	0.43845	Serum albumin-like (1);Serum albumin, N-terminal (3);	0.298888	0.27966	N	0.017135	D	0.87466	0.6184	M	0.85197	2.74	0.53688	D	0.999976	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.87460	0.2407	10	0.87932	D	0	-11.1718	9.5457	0.39279	0.074:0.0:0.7833:0.1427	.	48;48	A6NBZ8;P02768	.;ALBU_HUMAN	F	50;48;48;48;57	ENSP00000392541:L50F;ENSP00000295897:L48F;ENSP00000422784:L48F	ENSP00000295897:L48F	L	+	3	2	ALB	74491216	0.976000	0.34144	0.173000	0.22940	0.008000	0.06430	2.408000	0.44574	0.892000	0.36259	-0.142000	0.14014	TTG	.		0.338	ALB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252173.3	NM_000477	
FAT4	79633	broad.mit.edu	37	4	126371727	126371727	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr4:126371727G>A	ENST00000394329.3	+	9	9569	c.9556G>A	c.(9556-9558)Gat>Aat	p.D3186N	FAT4_ENST00000335110.5_Missense_Mutation_p.D1484N	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	3186	Cadherin 30. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D3186Y(2)		NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						AAATGTGATTGATGTGAATGA	0.408																																					p.D3186N		.											.	FAT4-108	2	Substitution - Missense(2)	lung(2)	c.G9556A						.						101.0	93.0	96.0					4																	126371727		2203	4300	6503	SO:0001583	missense	79633	exon9			GTGATTGATGTGA	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.9556G>A	4.37:g.126371727G>A	ENSP00000377862:p.Asp3186Asn	Somatic	286	0		WXS	Illumina GAIIx	Phase_I	253	10	NM_024582	0	0	0	0	0	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	37	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	G	19.57	3.853275	0.71719	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	T;T	0.75050	-0.9;-0.9	5.63	5.63	0.86233	Cadherin (3);Cadherin conserved site (1);Cadherin-like (1);	0.000000	0.35320	U	0.003289	D	0.88051	0.6333	M	0.82433	2.59	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.87578	0.998;0.998;0.998	D	0.89077	0.3473	10	0.87932	D	0	.	19.7096	0.96089	0.0:0.0:1.0:0.0	.	1484;3186;3186	Q6V0I7-2;Q6V0I7;Q6V0I7-3	.;FAT4_HUMAN;.	N	3186;1484	ENSP00000377862:D3186N;ENSP00000335169:D1484N	ENSP00000335169:D1484N	D	+	1	0	FAT4	126591177	1.000000	0.71417	0.743000	0.31040	0.447000	0.32167	9.666000	0.98612	2.652000	0.90054	0.655000	0.94253	GAT	.		0.408	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
HPGD	3248	bcgsc.ca	37	4	175443156	175443156	+	Silent	SNP	C	C	T	rs1050145	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr4:175443156C>T	ENST00000296522.6	-	2	602	c.156G>A	c.(154-156)caG>caA	p.Q52Q	HPGD_ENST00000510901.1_5'UTR|HPGD_ENST00000422112.2_Silent_p.Q52Q|HPGD_ENST00000296521.7_Silent_p.Q52Q|HPGD_ENST00000542498.1_Silent_p.Q52Q|HPGD_ENST00000504433.1_Silent_p.Q52Q|HPGD_ENST00000541923.1_5'UTR|RP11-440I14.2_ENST00000515178.1_lincRNA	NM_000860.5|NM_001145816.2|NM_001256301.1|NM_001256307.1	NP_000851.2|NP_001139288.1|NP_001243230.1|NP_001243236.1	P15428	PGDH_HUMAN	hydroxyprostaglandin dehydrogenase 15-(NAD)	52					arachidonic acid metabolic process (GO:0019369)|cyclooxygenase pathway (GO:0019371)|ductus arteriosus closure (GO:0097070)|female pregnancy (GO:0007565)|lipoxin metabolic process (GO:2001300)|lipoxygenase pathway (GO:0019372)|negative regulation of cell cycle (GO:0045786)|ovulation (GO:0030728)|parturition (GO:0007567)|prostaglandin metabolic process (GO:0006693)|small molecule metabolic process (GO:0044281)|thrombin receptor signaling pathway (GO:0070493)|transforming growth factor beta receptor signaling pathway (GO:0007179)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	15-hydroxyprostaglandin dehydrogenase (NAD+) activity (GO:0016404)|catalytic activity (GO:0003824)|NAD binding (GO:0051287)|NAD+ binding (GO:0070403)|prostaglandin E receptor activity (GO:0004957)|protein homodimerization activity (GO:0042803)	p.Q52Q(1)		kidney(1)|lung(3)|prostate(3)	7		Prostate(90;0.00763)|Melanoma(52;0.0179)|Renal(120;0.0376)|Breast(14;0.0991)|all_hematologic(60;0.124)|all_neural(102;0.196)		all cancers(43;2.6e-18)|Epithelial(43;4.19e-16)|OV - Ovarian serous cystadenocarcinoma(60;5.23e-09)|GBM - Glioblastoma multiforme(59;0.00176)|STAD - Stomach adenocarcinoma(60;0.00299)|LUSC - Lung squamous cell carcinoma(193;0.0253)		GAGGTTCAAACTGCTCATCCA	0.522													T|||	1699	0.339257	0.261	0.3213	5008	,	,		18302	0.4554		0.4066	False		,,,				2504	0.2689				p.Q52Q		.											.	HPGD-90	1	Substitution - coding silent(1)	prostate(1)	c.G156A						.	T	,	1196,3210	710.0+/-407.8	166,864,1173	171.0	165.0	167.0		156,156	1.4	1.0	4	dbSNP_86	167	3690,4910	620.8+/-397.1	793,2104,1403	no	coding-synonymous,coding-synonymous	HPGD	NM_000860.4,NM_001145816.1	,	959,2968,2576	TT,TC,CC		42.907,27.1448,37.5673	,	52/267,52/179	175443156	4886,8120	2203	4300	6503	SO:0001819	synonymous_variant	3248	exon2			TTCAAACTGCTCA		CCDS3821.1, CCDS54821.1, CCDS58933.1, CCDS58934.1, CCDS58935.1	4q34-q35	2011-09-14			ENSG00000164120	ENSG00000164120	1.1.1.141	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	5154	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 36C, member 1"""	601688				19027726	Standard	NM_000860		Approved	SDR36C1	uc003itu.3	P15428	OTTHUMG00000160772	ENST00000296522.6:c.156G>A	4.37:g.175443156C>T		Somatic	117	0		WXS	Illumina GAIIx	Phase_I	121	8	NM_000860	0	0	18	18	0	B4DTA4|B4DU74|B4DV57|D3DP43|E7EV11|O00749|Q06F08|Q12998	Silent	SNP	ENST00000296522.6	37	CCDS3821.1																																																																																			C|0.628;T|0.372		0.522	HPGD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362228.3		
NSUN2	54888	hgsc.bcm.edu	37	5	6633042	6633042	+	Silent	SNP	C	C	T	rs10062086	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr5:6633042C>T	ENST00000264670.6	-	1	362	c.51G>A	c.(49-51)gaG>gaA	p.E17E	NSUN2_ENST00000506139.1_Silent_p.E17E|SRD5A1_ENST00000274192.5_5'Flank|SRD5A1_ENST00000537411.1_5'Flank|NSUN2_ENST00000539938.1_5'UTR|SRD5A1_ENST00000538824.1_5'Flank	NM_017755.5	NP_060225.4	Q08J23	NSUN2_HUMAN	NOP2/Sun RNA methyltransferase family, member 2	17					mitotic nuclear division (GO:0007067)|tRNA methylation (GO:0030488)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|tRNA (cytosine-5-)-methyltransferase activity (GO:0016428)|tRNA binding (GO:0000049)			breast(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(23)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	41						CCTCCGCGTCCTCCGGCCGCT	0.781													C|||	1385	0.276558	0.2829	0.3905	5008	,	,		9693	0.1587		0.3917	False		,,,				2504	0.1902				p.E17E		.											.	NSUN2-91	0			c.G51A						.						2.0	3.0	2.0					5																	6633042		1293	2804	4097	SO:0001819	synonymous_variant	54888	exon1			CGCGTCCTCCGGC	AK000310	CCDS3869.1, CCDS54832.1	5p15.32	2014-01-31	2012-06-12		ENSG00000037474	ENSG00000037474		"""NOP2/Sun domain containing"""	25994	protein-coding gene	gene with protein product	"""tRNA methyltransferase 4 homolog (S. cerevisiae)"", ""Myc-induced SUN-domain-containing protein"""	610916	"""NOL1/NOP2/Sun domain family, member 2"", ""NOP2/Sun domain family, member 2"", ""mental retardation, non-syndromic, autosomal recessive, 5"""	MRT5		17071714, 22541559	Standard	NM_017755		Approved	FLJ20303, TRM4, Misu	uc003jdu.3	Q08J23	OTTHUMG00000090455	ENST00000264670.6:c.51G>A	5.37:g.6633042C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	8	NM_017755	0	0	1	1	0	A8K529|B2RNR4|B3KP09|B4DQW2|G3V1R4|Q9BVN4|Q9H858|Q9NXD9	Silent	SNP	ENST00000264670.6	37	CCDS3869.1																																																																																			C|0.687;T|0.313		0.781	NSUN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206902.1	NM_017755	
IQGAP2	10788	bcgsc.ca	37	5	75948601	75948601	+	Silent	SNP	G	G	A			TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr5:75948601G>A	ENST00000274364.6	+	18	2418	c.2121G>A	c.(2119-2121)cgG>cgA	p.R707R	IQGAP2_ENST00000396234.3_Silent_p.R203R|IQGAP2_ENST00000502745.1_Silent_p.R203R|IQGAP2_ENST00000379730.3_Silent_p.R209R	NM_006633.2	NP_006624	Q13576	IQGA2_HUMAN	IQ motif containing GTPase activating protein 2	707	IQ 1. {ECO:0000255|PROSITE- ProRule:PRU00116}.				negative regulation of catalytic activity (GO:0043086)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microvillus (GO:0005902)	actin binding (GO:0003779)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Ras GTPase activator activity (GO:0005099)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(23)|ovary(6)|prostate(1)|skin(3)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	68		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)		all cancers(79;1.38e-36)		ATAAACAACGGAAGGAGTATA	0.388																																					p.R707R		.											.	IQGAP2-96	0			c.G2121A						.						125.0	120.0	122.0					5																	75948601		2203	4300	6503	SO:0001819	synonymous_variant	10788	exon18			ACAACGGAAGGAG	U51903	CCDS34188.1, CCDS68897.1, CCDS68898.1, CCDS75262.1	5q	2008-07-18			ENSG00000145703	ENSG00000145703			6111	protein-coding gene	gene with protein product		605401				8756646	Standard	XM_005248409		Approved		uc003kek.3	Q13576	OTTHUMG00000162432	ENST00000274364.6:c.2121G>A	5.37:g.75948601G>A		Somatic	145	0		WXS	Illumina GAIIx	Phase_I	141	6	NM_006633	0	0	9	9	0	A8K4V1|B7Z8A4|J3KR91	Silent	SNP	ENST00000274364.6	37	CCDS34188.1																																																																																			.		0.388	IQGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368877.1	NM_006633	
GPR150	285601	hgsc.bcm.edu	37	5	94956923	94956923	+	Missense_Mutation	SNP	G	G	A	rs201990735		TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr5:94956923G>A	ENST00000380007.2	+	1	1142	c.944G>A	c.(943-945)cGg>cAg	p.R315Q		NM_199243.1	NP_954713.1	Q8NGU9	GP150_HUMAN	G protein-coupled receptor 150	315						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			lung(2)	2		all_cancers(142;0.000462)|all_epithelial(76;2.44e-06)|all_lung(232;0.0318)|Lung NSC(167;0.041)|Ovarian(225;0.051)		all cancers(79;1.82e-16)		TTTGCCGCCCGGCTGGCGGCC	0.731																																					p.R315Q		.											.	GPR150-90	0			c.G944A						.	G	GLN/ARG	1,3691		0,1,1845	3.0	5.0	5.0		944	3.0	1.0	5		5	7,7505		0,7,3749	yes	missense	GPR150	NM_199243.1	43	0,8,5594	AA,AG,GG		0.0932,0.0271,0.0714	possibly-damaging	315/435	94956923	8,11196	1846	3756	5602	SO:0001583	missense	285601	exon1			CCGCCCGGCTGGC	BC030197	CCDS4074.1	5q15	2012-08-21			ENSG00000178015	ENSG00000178015		"""GPCR / Class A : Orphans"""	23628	protein-coding gene	gene with protein product						12679517	Standard	NM_199243		Approved	PGR11	uc003kle.1	Q8NGU9	OTTHUMG00000121170	ENST00000380007.2:c.944G>A	5.37:g.94956923G>A	ENSP00000369344:p.Arg315Gln	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	24	18	NM_199243	0	0	0	0	0		Missense_Mutation	SNP	ENST00000380007.2	37	CCDS4074.1	.	.	.	.	.	.	.	.	.	.	G	9.403	1.078546	0.20227	2.71E-4	9.32E-4	ENSG00000178015	ENST00000380007	T	0.37915	1.17	3.99	3.01	0.34805	GPCR, rhodopsin-like superfamily (1);	0.437819	0.16028	U	0.233013	T	0.10766	0.0263	N	0.12569	0.235	0.33038	D	0.531087	P	0.39181	0.663	B	0.22601	0.04	T	0.22906	-1.0203	10	0.02654	T	1	-13.6371	3.9514	0.09371	0.3367:0.0:0.6633:0.0	.	315	Q8NGU9	GP150_HUMAN	Q	315	ENSP00000369344:R315Q	ENSP00000369344:R315Q	R	+	2	0	GPR150	94982679	1.000000	0.71417	0.995000	0.50966	0.977000	0.68977	3.231000	0.51294	2.057000	0.61298	0.462000	0.41574	CGG	.		0.731	GPR150-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241657.2		
CHSY3	337876	hgsc.bcm.edu	37	5	129240972	129240972	+	Silent	SNP	G	G	C	rs33917	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr5:129240972G>C	ENST00000305031.4	+	1	808	c.450G>C	c.(448-450)ccG>ccC	p.P150P	CTC-575N7.1_ENST00000515569.1_RNA|CTC-575N7.1_ENST00000503616.1_RNA	NM_175856.4	NP_787052.3	Q70JA7	CHSS3_HUMAN	chondroitin sulfate synthase 3	150					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|metal ion binding (GO:0046872)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|urinary_tract(1)	28		all_cancers(142;0.0227)|Breast(839;0.198)|Prostate(80;0.215)|Lung NSC(810;0.239)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.136)		ACGGCCGGCCGGGGAGTAGCC	0.766													G|||	2286	0.45647	0.2254	0.513	5008	,	,		7622	0.5833		0.5368	False		,,,				2504	0.5153				p.P150P		.											.	CHSY3-25	0			c.G450C						.						1.0	2.0	2.0					5																	129240972		822	2140	2962	SO:0001819	synonymous_variant	337876	exon1			CCGGCCGGGGAGT	AB086062	CCDS34223.1	5q13	2013-02-19			ENSG00000198108	ENSG00000198108	2.4.1.175, 2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	24293	protein-coding gene	gene with protein product		609963				12907687	Standard	XM_005271982		Approved	CSS3, CHSY-2	uc003kvd.3	Q70JA7	OTTHUMG00000163043	ENST00000305031.4:c.450G>C	5.37:g.129240972G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	4	NM_175856	0	0	0	0	0	B2RP97|Q76L22|Q86Y52	Silent	SNP	ENST00000305031.4	37	CCDS34223.1																																																																																			G|0.479;C|0.521		0.766	CHSY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371453.1	NM_175856	
PCDHB10	56126	hgsc.bcm.edu	37	5	140573844	140573844	+	Silent	SNP	C	C	T			TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr5:140573844C>T	ENST00000239446.4	+	1	1903	c.1719C>T	c.(1717-1719)acC>acT	p.T573T		NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10	573	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGCCCTGCACCGAGCTGGTGC	0.711																																					p.T573T		.											.	PCDHB10-92	0			c.C1719T						.						7.0	10.0	9.0					5																	140573844		1626	3527	5153	SO:0001819	synonymous_variant	56126	exon1			CTGCACCGAGCTG	AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626	ENST00000239446.4:c.1719C>T	5.37:g.140573844C>T		Somatic	4	0		WXS	Illumina GAIIx	Phase_I	105	39	NM_018930	0	0	12	15	3	Q96T99	Silent	SNP	ENST00000239446.4	37	CCDS4252.1																																																																																			.		0.711	PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251821.1	NM_018930	
ARL10	285598	hgsc.bcm.edu	37	5	175792605	175792605	+	Silent	SNP	G	G	C	rs2303667	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr5:175792605G>C	ENST00000310389.5	+	1	135	c.39G>C	c.(37-39)ctG>ctC	p.L13L	MIR1271_ENST00000408537.1_RNA	NM_173664.4	NP_775935.1	Q8N8L6	ARL10_HUMAN	ADP-ribosylation factor-like 10	13					small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	GTP binding (GO:0005525)			endometrium(2)|lung(1)|ovary(1)	4	all_cancers(89;0.0064)|Renal(175;0.000269)|Lung NSC(126;0.0105)|all_lung(126;0.0168)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	Kidney(146;0.0965)		TGCTGGCGCTGGGCGGCGCCG	0.756													G|||	2787	0.55651	0.5938	0.4928	5008	,	,		9772	0.5556		0.6093	False		,,,				2504	0.498				p.L13L		.											.	ARL10-91	0			c.G39C						.	G		1858,1528		603,652,438	3.0	4.0	3.0		39	3.2	0.8	5	dbSNP_100	3	4085,2705		1416,1253,726	no	coding-synonymous	ARL10	NM_173664.4		2019,1905,1164	CC,CG,GG		39.838,45.127,41.5979		13/245	175792605	5943,4233	1693	3395	5088	SO:0001819	synonymous_variant	285598	exon1			GGCGCTGGGCGGC	BK001673	CCDS4400.1	5q35.3	2014-05-09	2005-11-03	2005-11-03	ENSG00000175414	ENSG00000175414		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	22042	protein-coding gene	gene with protein product			"""ADP-ribosylation factor-like 10A"""	ARL10A			Standard	NM_173664		Approved		uc003mec.1	Q8N8L6	OTTHUMG00000130655	ENST00000310389.5:c.39G>C	5.37:g.175792605G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	9	NM_173664	0	0	0	0	0		Silent	SNP	ENST00000310389.5	37	CCDS4400.1																																																																																			G|0.585;C|0.415		0.756	ARL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253145.2	NM_173664	
PPP1R3G	648791	hgsc.bcm.edu	37	6	5086070	5086070	+	Silent	SNP	A	A	G	rs667752		TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr6:5086070A>G	ENST00000405617.2	+	1	351	c.351A>G	c.(349-351)gcA>gcG	p.A117A		NM_001145115.1	NP_001138587.1	B7ZBB8	PP13G_HUMAN	protein phosphatase 1, regulatory subunit 3G	117					glucose homeostasis (GO:0042593)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of glycogen biosynthetic process (GO:0045725)	cytoplasm (GO:0005737)	glycogen binding (GO:2001069)			kidney(2)	2						CGGAGGACGCACAGCTCGGCC	0.692													G|||	5008	1.0	1.0	1.0	5008	,	,		12505	1.0		1.0	False		,,,				2504	1.0				p.A117A		.											.	PPP1R3G-136	0			c.A351G						.						1.0	2.0	2.0					6																	5086070		400	1062	1462	SO:0001819	synonymous_variant	648791	exon1			GGACGCACAGCTC		CCDS47366.1	6p25.1	2012-04-17	2011-10-04		ENSG00000219607	ENSG00000219607		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14945	protein-coding gene	gene with protein product			"""protein phosphatase 1, regulatory (inhibitor) subunit 3G"""			11948623	Standard	NM_001145115		Approved		uc011dia.1	B7ZBB8	OTTHUMG00000014172	ENST00000405617.2:c.351A>G	6.37:g.5086070A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_001145115	0	0	0	3	3		Silent	SNP	ENST00000405617.2	37	CCDS47366.1																																																																																			A|0.006;G|0.994		0.692	PPP1R3G-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039740.3	NM_001145115	
PPP1R3G	648791	hgsc.bcm.edu	37	6	5086211	5086211	+	Silent	SNP	G	G	C	rs584962		TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr6:5086211G>C	ENST00000405617.2	+	1	492	c.492G>C	c.(490-492)ctG>ctC	p.L164L		NM_001145115.1	NP_001138587.1	B7ZBB8	PP13G_HUMAN	protein phosphatase 1, regulatory subunit 3G	164					glucose homeostasis (GO:0042593)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of glycogen biosynthetic process (GO:0045725)	cytoplasm (GO:0005737)	glycogen binding (GO:2001069)			kidney(2)	2						TCTCGCGCCTGCGAAGCTTCC	0.736													C|||	5008	1.0	1.0	1.0	5008	,	,		12118	1.0		1.0	False		,,,				2504	1.0				p.L164L		.											.	PPP1R3G-136	0			c.G492C						.						1.0	2.0	1.0					6																	5086211		271	872	1143	SO:0001819	synonymous_variant	648791	exon1			GCGCCTGCGAAGC		CCDS47366.1	6p25.1	2012-04-17	2011-10-04		ENSG00000219607	ENSG00000219607		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14945	protein-coding gene	gene with protein product			"""protein phosphatase 1, regulatory (inhibitor) subunit 3G"""			11948623	Standard	NM_001145115		Approved		uc011dia.1	B7ZBB8	OTTHUMG00000014172	ENST00000405617.2:c.492G>C	6.37:g.5086211G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_001145115	0	0	0	6	6		Silent	SNP	ENST00000405617.2	37	CCDS47366.1																																																																																			G|0.000;C|1.000		0.736	PPP1R3G-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039740.3	NM_001145115	
RREB1	6239	hgsc.bcm.edu	37	6	7230680	7230680	+	Missense_Mutation	SNP	G	G	T	rs9502564	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr6:7230680G>T	ENST00000349384.6	+	10	2662	c.2348G>T	c.(2347-2349)gGc>gTc	p.G783V	RREB1_ENST00000379933.3_Missense_Mutation_p.G783V|RREB1_ENST00000379938.2_Missense_Mutation_p.G783V|RREB1_ENST00000334984.6_Missense_Mutation_p.G783V	NM_001003698.3	NP_001003698.1	Q92766	RREB1_HUMAN	ras responsive element binding protein 1	783			G -> V (in dbSNP:rs9502564). {ECO:0000269|PubMed:15067362, ECO:0000269|PubMed:21703425}.		multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|Ras protein signal transduction (GO:0007265)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear body (GO:0016604)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(18)|ovary(5)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)				CTGGGCGGGGGCCACAAGGGC	0.697													G|||	2678	0.534744	0.5333	0.4063	5008	,	,		15583	0.7411		0.2893	False		,,,				2504	0.6677				p.G783V		.											.	RREB1-144	0			c.G2348T						.	G	VAL/GLY,VAL/GLY,VAL/GLY,VAL/GLY	2083,2197		552,979,609	9.0	9.0	9.0		2348,2348,2348,2348	5.3	1.0	6	dbSNP_119	9	2599,5719		488,1623,2048	yes	missense,missense,missense,missense	RREB1	NM_001003698.3,NM_001003699.3,NM_001003700.1,NM_001168344.1	109,109,109,109	1040,2602,2657	TT,TG,GG		31.2455,48.6682,37.1646	benign,benign,benign,benign	783/1688,783/1743,783/1477,783/1688	7230680	4682,7916	2140	4159	6299	SO:0001583	missense	6239	exon10			GCGGGGGCCACAA	U26914	CCDS34335.1, CCDS34336.1, CCDS54963.1	6p25	2013-01-08			ENSG00000124782	ENSG00000124782		"""Zinc fingers, C2H2-type"""	10449	protein-coding gene	gene with protein product	"""hindsight homolog (drosophila)"""	602209				9367691, 18394891	Standard	NM_001003698		Approved	HNT	uc003mxb.3	Q92766	OTTHUMG00000014201	ENST00000349384.6:c.2348G>T	6.37:g.7230680G>T	ENSP00000305560:p.Gly783Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	27	20	NM_001003700	0	0	0	0	0	A2RRF5|E2GM80|E2GM81|O75567|O75568|Q5VYB2|Q6BEP5|Q6BEP6|Q6BEP8|Q86SU2|Q9Y474	Missense_Mutation	SNP	ENST00000349384.6	37	CCDS34336.1	1014	0.4642857142857143	249	0.5060975609756098	148	0.4088397790055249	412	0.7202797202797203	205	0.2704485488126649	G	11.15	1.553554	0.27739	0.486682	0.312455	ENSG00000124782	ENST00000379933;ENST00000379938;ENST00000349384;ENST00000334984	T;T;T;T	0.09163	3.07;3.07;3.07;3.01	5.32	5.32	0.75619	.	0.278837	0.31370	N	0.007766	T	0.02533	0.0077	N	0.14661	0.345	0.21915	P	0.999474401	B;B;B	0.32653	0.161;0.379;0.328	B;B;B	0.35182	0.079;0.197;0.178	T	0.45512	-0.9256	9	0.13108	T	0.6	-17.3998	11.4207	0.49980	0.0:0.0:0.8202:0.1797	rs9502564	783;783;783	Q92766-3;Q92766;Q92766-2	.;RREB1_HUMAN;.	V	783	ENSP00000369265:G783V;ENSP00000369270:G783V;ENSP00000305560:G783V;ENSP00000335574:G783V	ENSP00000335574:G783V	G	+	2	0	RREB1	7175679	1.000000	0.71417	0.996000	0.52242	0.833000	0.47200	5.477000	0.66799	2.760000	0.94817	0.655000	0.94253	GGC	G|0.546;T|0.454		0.697	RREB1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352985.1		
HIST1H4B	8366	broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	26027331	26027331	+	Missense_Mutation	SNP	C	C	G	rs369387838		TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr6:26027331C>G	ENST00000377364.3	-	1	149	c.150G>C	c.(148-150)ttG>ttC	p.L50F		NM_003544.2	NP_003535.1	P62805	H4_HUMAN	histone cluster 1, H4b	50					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)			large_intestine(4)|lung(6)|ovary(2)|upper_aerodigestive_tract(1)	13						CCTCATAAATCAAACCGGAAA	0.562																																					p.L50F		.											.	HIST1H4B-70	0			c.G150C						.						81.0	72.0	75.0					6																	26027331		2203	4300	6503	SO:0001583	missense	8366	exon1			ATAAATCAAACCG	X67081	CCDS4572.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000124529	ENSG00000278705		"""Histones / Replication-dependent"""	4789	protein-coding gene	gene with protein product		602829	"""H4 histone family, member I"", ""histone 1, H4b"""	H4FI		9119399, 12408966	Standard	NM_003544		Approved	H4/I	uc003nfr.3	P62805	OTTHUMG00000014417	ENST00000377364.3:c.150G>C	6.37:g.26027331C>G	ENSP00000366581:p.Leu50Phe	Somatic	187	1		WXS	Illumina GAIIx	Phase_I	217	21	NM_003544	0	0	1	1	0	A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Missense_Mutation	SNP	ENST00000377364.3	37	CCDS4572.1	.	.	.	.	.	.	.	.	.	.	c	9.243	1.038722	0.19669	.	.	ENSG00000124529	ENST00000377364	T	0.67865	-0.29	4.65	-3.15	0.05233	.	0.000000	0.47093	U	0.000255	T	0.46229	0.1382	.	.	.	0.26830	N	0.968603	.	.	.	.	.	.	T	0.56177	-0.8022	7	0.59425	D	0.04	.	8.896	0.35465	0.1961:0.2621:0.5418:0.0	.	.	.	.	F	50	ENSP00000366581:L50F	ENSP00000366581:L50F	L	-	3	2	HIST1H4B	26135310	0.955000	0.32602	0.105000	0.21289	0.000000	0.00434	-0.020000	0.12525	-0.864000	0.04078	-1.104000	0.02111	TTG	.		0.562	HIST1H4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040079.2	NM_003544	
SCUBE3	222663	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	35207577	35207577	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr6:35207577G>A	ENST00000274938.7	+	8	878	c.878G>A	c.(877-879)cGc>cAc	p.R293H	SCUBE3_ENST00000394681.1_Missense_Mutation_p.R309H	NM_152753.2	NP_689966.2			signal peptide, CUB domain, EGF-like 3											breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(12)|lung(11)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	37						CATATTTGCCGCAACACAGTG	0.463																																					p.R293H		.											.	SCUBE3-91	0			c.G878A						.						104.0	99.0	101.0					6																	35207577		2203	4300	6503	SO:0001583	missense	222663	exon8			TTTGCCGCAACAC	AF452494.1	CCDS4800.1	6p21.3	2008-02-05	2004-05-19	2004-05-21		ENSG00000146197			13655	protein-coding gene	gene with protein product		614708	"""CUB domain and EGF-like repeat containing 3"""	CEGF3		12270931	Standard	NM_152753		Approved	FLJ34743	uc003okf.1	Q8IX30		ENST00000274938.7:c.878G>A	6.37:g.35207577G>A	ENSP00000274938:p.Arg293His	Somatic	132	0		WXS	Illumina GAIIx	Phase_I	146	65	NM_152753	0	0	0	0	0		Missense_Mutation	SNP	ENST00000274938.7	37	CCDS4800.1	.	.	.	.	.	.	.	.	.	.	G	34	5.333609	0.95758	.	.	ENSG00000146197	ENST00000394681;ENST00000274938	D;D	0.96396	-4.0;-4.0	5.66	5.66	0.87406	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.96614	0.8895	L	0.33485	1.01	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.994	D	0.97022	0.9744	10	0.56958	D	0.05	.	19.7503	0.96265	0.0:0.0:1.0:0.0	.	309;293	Q8IX30-2;Q8IX30	.;SCUB3_HUMAN	H	309;293	ENSP00000378174:R309H;ENSP00000274938:R293H	ENSP00000274938:R293H	R	+	2	0	SCUBE3	35315555	1.000000	0.71417	1.000000	0.80357	0.872000	0.50106	7.959000	0.87885	2.648000	0.89879	0.655000	0.94253	CGC	.		0.463	SCUBE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040275.1	NM_152753	
SMIM8	57150	hgsc.bcm.edu	37	6	88046858	88046858	+	Missense_Mutation	SNP	G	G	T	rs141864670		TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr6:88046858G>T	ENST00000392863.1	+	3	198	c.109G>T	c.(109-111)Gtg>Ttg	p.V37L	SMIM8_ENST00000608868.1_Missense_Mutation_p.V37L|RP1-102H19.8_ENST00000448282.2_Missense_Mutation_p.V37L|SMIM8_ENST00000229570.5_Missense_Mutation_p.V37L|SMIM8_ENST00000608525.1_Missense_Mutation_p.V37L|SMIM8_ENST00000608353.1_Missense_Mutation_p.V37L	NM_001042493.1	NP_001035958.1	Q96KF7	SMIM8_HUMAN	small integral membrane protein 8	37						integral component of membrane (GO:0016021)											ATTTCGTGCTGTGAATCCAGA	0.423																																					p.V37L		.											.	.	0			c.G109T						.						109.0	110.0	110.0					6																	88046858		2203	4300	6503	SO:0001583	missense	57150	exon3			CGTGCTGTGAATC	AL050201	CCDS34496.1, CCDS75493.1	6q15	2013-06-21	2012-11-20	2012-11-20	ENSG00000111850	ENSG00000111850			21401	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 162"""	C6orf162			Standard	NM_001287445		Approved	DKFZP586E1923, dJ102H19.2	uc003plq.1	Q96KF7	OTTHUMG00000015168	ENST00000392863.1:c.109G>T	6.37:g.88046858G>T	ENSP00000376603:p.Val37Leu	Somatic	43	0		WXS	Illumina GAIIx	Phase_I	40	5	NM_001042493	0	0	7	7	0	B2R4V6|E1P505|Q5TEZ3|Q6NSD2|Q8IZ10	Missense_Mutation	SNP	ENST00000392863.1	37	CCDS34496.1	.	.	.	.	.	.	.	.	.	.	G	14.00	2.405160	0.42613	.	.	ENSG00000111850	ENST00000392863;ENST00000229570	.	.	.	6.03	5.16	0.70880	.	0.057248	0.64402	D	0.000002	T	0.40015	0.1100	.	.	.	0.58432	D	0.999994	B	0.28350	0.208	B	0.30572	0.117	T	0.35699	-0.9778	8	0.29301	T	0.29	-13.2848	15.1117	0.72362	0.0673:0.0:0.9327:0.0	.	37	Q96KF7	CF162_HUMAN	L	37	.	ENSP00000229570:V37L	V	+	1	0	C6orf162	88103577	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.425000	0.59875	1.561000	0.49584	0.655000	0.94253	GTG	G|1.000;A|0.000		0.423	SMIM8-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000472479.2	NM_020425	
CTGF	1490	hgsc.bcm.edu	37	6	132271952	132271952	+	Missense_Mutation	SNP	G	G	C	rs7451102		TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr6:132271952G>C	ENST00000367976.3	-	2	447	c.247C>G	c.(247-249)Cac>Gac	p.H83D	RP11-69I8.3_ENST00000435287.1_RNA	NM_001901.2	NP_001892	P29279	CTGF_HUMAN	connective tissue growth factor	83	IGFBP N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00653}.		H -> D (in dbSNP:rs7451102). {ECO:0000269|PubMed:1293144, ECO:0000269|PubMed:1654338, ECO:0000269|PubMed:9054739, ECO:0000269|Ref.12, ECO:0000269|Ref.4, ECO:0000269|Ref.5, ECO:0000269|Ref.6, ECO:0000269|Ref.7}.		angiogenesis (GO:0001525)|cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular lipid metabolic process (GO:0044255)|chondrocyte proliferation (GO:0035988)|cytosolic calcium ion transport (GO:0060401)|DNA replication (GO:0006260)|epidermis development (GO:0008544)|extracellular matrix constituent secretion (GO:0070278)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of gene expression (GO:0010629)|organ senescence (GO:0010260)|ossification (GO:0001503)|positive regulation of cardiac muscle contraction (GO:0060452)|positive regulation of cell activation (GO:0050867)|positive regulation of cell death (GO:0010942)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of G0 to G1 transition (GO:0070318)|positive regulation of gene expression (GO:0010628)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|reactive oxygen species metabolic process (GO:0072593)|regulation of cell growth (GO:0001558)|regulation of chondrocyte differentiation (GO:0032330)|response to amino acid (GO:0043200)|response to anoxia (GO:0034059)|response to estradiol (GO:0032355)|response to fatty acid (GO:0070542)|response to glucose (GO:0009749)|response to mineralocorticoid (GO:0051385)|response to peptide hormone (GO:0043434)|response to wounding (GO:0009611)|small molecule metabolic process (GO:0044281)|tissue homeostasis (GO:0001894)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell cortex (GO:0005938)|cis-Golgi network (GO:0005801)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|insulin-like growth factor binding (GO:0005520)			breast(1)|endometrium(6)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)	13	Breast(56;0.0602)			GBM - Glioblastoma multiforme(226;0.015)|OV - Ovarian serous cystadenocarcinoma(155;0.0169)		GAGCCGAAGTGACAGAATAGG	0.711													C|||	5007	0.9998	1.0	1.0	5008	,	,		8487	1.0		0.999	False		,,,				2504	1.0				p.H83D	Esophageal Squamous(127;510 1660 12817 24400 38449)	.											.	CTGF-90	0			c.C247G						.						7.0	8.0	7.0					6																	132271952		2119	4187	6306	SO:0001583	missense	1490	exon2			CGAAGTGACAGAA	X78947	CCDS5151.1	6q23.2	2008-02-05			ENSG00000118523	ENSG00000118523			2500	protein-coding gene	gene with protein product		121009				1654338	Standard	NM_001901		Approved	IGFBP8, CCN2	uc003qcz.3	P29279	OTTHUMG00000015573	ENST00000367976.3:c.247C>G	6.37:g.132271952G>C	ENSP00000356954:p.His83Asp	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_001901	0	0	0	0	0	E1P578|Q6LCY0|Q96A79|Q96QX2|Q9UDL6	Missense_Mutation	SNP	ENST00000367976.3	37	CCDS5151.1	2184	1.0	492	1.0	362	1.0	572	1.0	758	1.0	C	8.018	0.758919	0.15846	.	.	ENSG00000118523	ENST00000367976	T	0.62232	0.04	5.28	5.28	0.74379	Insulin-like growth factor-binding protein, IGFBP (2);	0.048665	0.85682	N	0.000000	T	0.06781	0.0173	N	0.00042	-2.475	0.40675	P	0.017750000000000044	B	0.02656	0.0	B	0.01281	0.0	T	0.27739	-1.0065	9	0.02654	T	1	.	15.7931	0.78384	0.0:0.863:0.137:0.0	rs7451102;rs59294435	83	P29279	CTGF_HUMAN	D	83	ENSP00000356954:H83D	ENSP00000356954:H83D	H	-	1	0	CTGF	132313645	1.000000	0.71417	0.923000	0.36655	0.645000	0.38454	4.000000	0.57039	1.236000	0.43740	-0.293000	0.09583	CAC	G|0.000;C|1.000		0.711	CTGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042239.2	NM_001901	
CTGF	1490	hgsc.bcm.edu	37	6	132271959	132271959	+	Silent	SNP	T	T	G	rs12206231		TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr6:132271959T>G	ENST00000367976.3	-	2	440	c.240A>C	c.(238-240)ctA>ctC	p.L80L	RP11-69I8.3_ENST00000435287.1_RNA	NM_001901.2	NP_001892	P29279	CTGF_HUMAN	connective tissue growth factor	80	IGFBP N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00653}.				angiogenesis (GO:0001525)|cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular lipid metabolic process (GO:0044255)|chondrocyte proliferation (GO:0035988)|cytosolic calcium ion transport (GO:0060401)|DNA replication (GO:0006260)|epidermis development (GO:0008544)|extracellular matrix constituent secretion (GO:0070278)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of gene expression (GO:0010629)|organ senescence (GO:0010260)|ossification (GO:0001503)|positive regulation of cardiac muscle contraction (GO:0060452)|positive regulation of cell activation (GO:0050867)|positive regulation of cell death (GO:0010942)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of G0 to G1 transition (GO:0070318)|positive regulation of gene expression (GO:0010628)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|reactive oxygen species metabolic process (GO:0072593)|regulation of cell growth (GO:0001558)|regulation of chondrocyte differentiation (GO:0032330)|response to amino acid (GO:0043200)|response to anoxia (GO:0034059)|response to estradiol (GO:0032355)|response to fatty acid (GO:0070542)|response to glucose (GO:0009749)|response to mineralocorticoid (GO:0051385)|response to peptide hormone (GO:0043434)|response to wounding (GO:0009611)|small molecule metabolic process (GO:0044281)|tissue homeostasis (GO:0001894)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell cortex (GO:0005938)|cis-Golgi network (GO:0005801)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|insulin-like growth factor binding (GO:0005520)			breast(1)|endometrium(6)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)	13	Breast(56;0.0602)			GBM - Glioblastoma multiforme(226;0.015)|OV - Ovarian serous cystadenocarcinoma(155;0.0169)		AGTGACAGAATAGGCCCTTGT	0.701													G|||	5008	1.0	1.0	1.0	5008	,	,		8368	1.0		1.0	False		,,,				2504	1.0				p.L80L	Esophageal Squamous(127;510 1660 12817 24400 38449)	.											.	CTGF-90	0			c.A240C						.						7.0	8.0	7.0					6																	132271959		2127	4192	6319	SO:0001819	synonymous_variant	1490	exon2			ACAGAATAGGCCC	X78947	CCDS5151.1	6q23.2	2008-02-05			ENSG00000118523	ENSG00000118523			2500	protein-coding gene	gene with protein product		121009				1654338	Standard	NM_001901		Approved	IGFBP8, CCN2	uc003qcz.3	P29279	OTTHUMG00000015573	ENST00000367976.3:c.240A>C	6.37:g.132271959T>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_001901	0	0	0	0	0	E1P578|Q6LCY0|Q96A79|Q96QX2|Q9UDL6	Silent	SNP	ENST00000367976.3	37	CCDS5151.1																																																																																			T|0.000;G|1.000		0.701	CTGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042239.2	NM_001901	
MICALL2	79778	hgsc.bcm.edu	37	7	1484572	1484572	+	Silent	SNP	A	A	G	rs10435184	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr7:1484572A>G	ENST00000297508.7	-	6	1309	c.1134T>C	c.(1132-1134)ggT>ggC	p.G378G	MICALL2_ENST00000405088.4_Silent_p.G166G	NM_182924.3	NP_891554.1	Q8IY33	MILK2_HUMAN	MICAL-like 2	378	Mediates targeting to the cell plasma membrane. {ECO:0000250}.|Necessary and sufficient for interaction with actinins. {ECO:0000250}.				actin cytoskeleton reorganization (GO:0031532)|actin filament polymerization (GO:0030041)|endocytic recycling (GO:0032456)|neuron projection development (GO:0031175)|substrate adhesion-dependent cell spreading (GO:0034446)|tight junction assembly (GO:0070830)	cell-cell junction (GO:0005911)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)|stress fiber (GO:0001725)|tight junction (GO:0005923)	actin filament binding (GO:0051015)|filamin binding (GO:0031005)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|lung(8)|ovary(2)|skin(2)	19		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;6.01e-15)		GGGCTCCCCCACCCTGGGGTG	0.716													G|||	4980	0.994409	0.9985	0.9914	5008	,	,		11496	1.0		0.9801	False		,,,				2504	1.0				p.G378G		.											.	MICALL2-90	0			c.T1134C						.			3824,4		1910,4,0	4.0	4.0	4.0		1134	1.5	0.0	7	dbSNP_119	4	7610,92		3759,92,0	yes	coding-synonymous	MICALL2	NM_182924.3		5669,96,0	GG,GA,AA		1.1945,0.1045,0.8326		378/905	1484572	11434,96	1914	3851	5765	SO:0001819	synonymous_variant	79778	exon6			TCCCCCACCCTGG	BC037988	CCDS5324.1	7p22.3	2006-11-24			ENSG00000164877	ENSG00000164877			29672	protein-coding gene	gene with protein product	"""junctional Rab13-binding protein"""					12110185, 16525024	Standard	NM_182924		Approved	MGC46023, FLJ23471, MICAL-L2, JRAB	uc003skj.4	Q8IY33	OTTHUMG00000119021	ENST00000297508.7:c.1134T>C	7.37:g.1484572A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	14	14	NM_182924	0	0	0	14	14	D3YTD2|Q7RTP4|Q7Z655|Q8TEQ4|Q9H5F9	Silent	SNP	ENST00000297508.7	37	CCDS5324.1																																																																																			A|0.009;G|0.991		0.716	MICALL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239223.2	NM_182924	
SP8	221833	broad.mit.edu	37	7	20824941	20824943	+	In_Frame_Del	DEL	GCC	GCC	-	rs372591893	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr7:20824941_20824943delGCC	ENST00000361443.4	-	3	676_678	c.439_441delGGC	c.(439-441)ggcdel	p.G147del	SP8_ENST00000418710.2_In_Frame_Del_p.G165del	NM_198956.2	NP_945194.1	Q8IXZ3	SP8_HUMAN	Sp8 transcription factor	147					dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|proximal/distal pattern formation (GO:0009954)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G165delG(1)|p.G147delG(1)		NS(1)|central_nervous_system(1)|large_intestine(2)|lung(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	8						GCGCGGAGGAgccgccgccgccg	0.729														461	0.0920527	0.0098	0.1124	5008	,	,		5525	0.002		0.2664	False		,,,				2504	0.1022				p.165_165del		.											.	SP8-91	2	Deletion - In frame(2)	central_nervous_system(2)	c.493_495del						.		,	50,654		19,12,321					,	0.5	0.3			2	602,1424		217,168,628	no	coding,coding	SP8	NM_198956.2,NM_182700.4	,	236,180,949	A1A1,A1R,RR		29.7137,7.1023,23.8828	,	,		652,2078				SO:0001651	inframe_deletion	221833	exon2			GGAGGAGCCGCCG		CCDS5372.1, CCDS43555.1	7p21.2	2013-01-08			ENSG00000164651	ENSG00000164651		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	19196	protein-coding gene	gene with protein product		608306					Standard	NM_182700		Approved		uc003suz.3	Q8IXZ3	OTTHUMG00000094788	ENST00000361443.4:c.439_441delGGC	7.37:g.20824950_20824952delGCC	ENSP00000354482:p.Gly147del	Somatic	11	0		WXS	Illumina GAIIx	Phase_I	80	8	NM_182700	0	0	0	0	0	Q7Z615|Q7Z616|Q96MJ1	In_Frame_Del	DEL	ENST00000361443.4	37	CCDS5372.1																																																																																			.		0.729	SP8-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326904.2		
GARS	2617	hgsc.bcm.edu	37	7	30634661	30634661	+	Missense_Mutation	SNP	C	C	G	rs1049402	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr7:30634661C>G	ENST00000389266.3	+	1	365	c.124C>G	c.(124-126)Ccc>Gcc	p.P42A	AC005154.6_ENST00000584199.1_RNA|AC005154.6_ENST00000583664.1_RNA|AC005154.6_ENST00000579174.1_RNA|AC005154.6_ENST00000584372.1_RNA|AC005154.6_ENST00000581665.1_RNA|AC005154.6_ENST00000578994.1_RNA|AC005154.6_ENST00000580440.1_RNA|AC005154.6_ENST00000582549.1_RNA	NM_002047.2	NP_002038.2	P41250	SYG_HUMAN	glycyl-tRNA synthetase	42			P -> A (in dbSNP:rs1049402). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:7753621, ECO:0000269|PubMed:7961834, ECO:0000269|PubMed:7962006}.		cell death (GO:0008219)|diadenosine tetraphosphate biosynthetic process (GO:0015966)|gene expression (GO:0010467)|glycyl-tRNA aminoacylation (GO:0006426)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|secretory granule (GO:0030141)	ATP binding (GO:0005524)|glycine-tRNA ligase activity (GO:0004820)|protein dimerization activity (GO:0046983)	p.P42fs*20(1)		breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|skin(3)|urinary_tract(1)	24					Glycine(DB00145)	GGCCTCCTGCCCCCCGATCTC	0.736													G|||	3252	0.649361	0.5219	0.7147	5008	,	,		13746	0.6677		0.7634	False		,,,				2504	0.6391				p.P42A		.											.	GARS-91	1	Insertion - Frameshift(1)	large_intestine(1)	c.C124G						.	G	ALA/PRO	2445,1427		776,893,267	5.0	8.0	7.0		124	-6.6	0.0	7	dbSNP_86	7	6367,1671		2577,1213,229	no	missense	GARS	NM_002047.2	27	3353,2106,496	GG,GC,CC		20.7888,36.8543,26.0118	benign	42/740	30634661	8812,3098	1936	4019	5955	SO:0001583	missense	2617	exon1			TCCTGCCCCCCGA	AK074524	CCDS43564.1	7p15	2014-09-17	2004-02-13		ENSG00000106105	ENSG00000106105	6.1.1.14	"""Aminoacyl tRNA synthetases / Class II"""	4162	protein-coding gene	gene with protein product	"""glycine tRNA ligase"""	600287	"""Charcot-Marie-Tooth neuropathy 2D"""	CMT2D		8595897, 8872480	Standard	NM_002047		Approved	GlyRS, DSMAV, SMAD1	uc003tbm.3	P41250	OTTHUMG00000152769	ENST00000389266.3:c.124C>G	7.37:g.30634661C>G	ENSP00000373918:p.Pro42Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	23	23	NM_002047	0	0	0	7	7	B3KQA2|B4DIA0|Q969Y1	Missense_Mutation	SNP	ENST00000389266.3	37	CCDS43564.1	1456	0.6666666666666666	278	0.5650406504065041	268	0.7403314917127072	337	0.5891608391608392	573	0.7559366754617414	G	0.005	-2.164835	0.00318	0.631457	0.792112	ENSG00000106105	ENST00000389266	T	0.80393	-1.37	3.31	-6.63	0.01807	.	1.037800	0.07609	N	0.925137	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.13575	-1.0504	9	0.08179	T	0.78	.	5.5596	0.17135	0.0726:0.2689:0.1197:0.5389	rs1049402;rs3189564;rs11553500;rs17856223;rs17856227;rs1049402	42	P41250	SYG_HUMAN	A	42	ENSP00000373918:P42A	ENSP00000373918:P42A	P	+	1	0	GARS	30601186	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	-0.671000	0.05250	-2.551000	0.00479	-0.744000	0.03518	CCC	C|0.329;G|0.671		0.736	GARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327735.1	NM_002047	
CYP3A7	1551	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	99305480	99305480	+	Silent	SNP	G	G	C			TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr7:99305480G>C	ENST00000336374.2	-	12	1373	c.1371C>G	c.(1369-1371)gtC>gtG	p.V457V		NM_000765.3	NP_000756.2	P24462	CP3A7_HUMAN	cytochrome P450, family 3, subfamily A, polypeptide 7	457					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxygen binding (GO:0019825)			autonomic_ganglia(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	32	Lung NSC(181;0.0144)|Esophageal squamous(72;0.0166)|all_lung(186;0.0228)				Alfentanil(DB00802)|Alprazolam(DB00404)|Aminophenazone(DB01424)|Amiodarone(DB01118)|Amlodipine(DB00381)|Aprepitant(DB00673)|Aripiprazole(DB01238)|Astemizole(DB00637)|Atorvastatin(DB01076)|Buprenorphine(DB00921)|Buspirone(DB00490)|Caffeine(DB00201)|Carbamazepine(DB00564)|Chloramphenicol(DB00446)|Chlorphenamine(DB01114)|Cilostazol(DB01166)|Cimetidine(DB00501)|Ciprofloxacin(DB00537)|Cisapride(DB00604)|Clarithromycin(DB01211)|Clotrimazole(DB00257)|Cocaine(DB00907)|Codeine(DB00318)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dapsone(DB00250)|Delavirdine(DB00705)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diazepam(DB00829)|Diltiazem(DB00343)|Docetaxel(DB01248)|Dolutegravir(DB08930)|Domperidone(DB01184)|Eplerenone(DB00700)|Erythromycin(DB00199)|Estradiol(DB00783)|Ethosuximide(DB00593)|Ethylmorphine(DB01466)|Felodipine(DB01023)|Fentanyl(DB00813)|Finasteride(DB01216)|Fluconazole(DB00196)|Fluticasone Propionate(DB00588)|Fluvoxamine(DB00176)|Gestodene(DB06730)|Haloperidol(DB00502)|Hydrocortisone(DB00741)|Ifosfamide(DB01181)|Iloperidone(DB04946)|Imatinib(DB00619)|Imipramine(DB00458)|Indinavir(DB00224)|Irinotecan(DB00762)|Itraconazole(DB01167)|Ketoconazole(DB01026)|Lercanidipine(DB00528)|Levomethadyl Acetate(DB01227)|Lidocaine(DB00281)|Lovastatin(DB00227)|Methadone(DB00333)|Midazolam(DB00683)|Mifepristone(DB00834)|Nateglinide(DB00731)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Nifedipine(DB01115)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Norethindrone(DB00717)|Norfloxacin(DB01059)|Ondansetron(DB00904)|Oxazepam(DB00842)|Oxycodone(DB00497)|Paclitaxel(DB01229)|Phenelzine(DB00780)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pimozide(DB01100)|Praziquantel(DB01058)|Progesterone(DB00396)|Propranolol(DB00571)|Quetiapine(DB01224)|Quinidine(DB00908)|Quinine(DB00468)|Rifampicin(DB01045)|Rifapentine(DB01201)|Risperidone(DB00734)|Ritonavir(DB00503)|Salmeterol(DB00938)|Saquinavir(DB01232)|Sildenafil(DB00203)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sorafenib(DB00398)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tamoxifen(DB00675)|Telithromycin(DB00976)|Temsirolimus(DB06287)|Testosterone(DB00624)|Trazodone(DB00656)|Tretinoin(DB00755)|Triazolam(DB00897)|Verapamil(DB00661)|Vincristine(DB00541)|Voriconazole(DB00582)|Zalcitabine(DB00943)|Zaleplon(DB00962)|Ziprasidone(DB00246)|Zolpidem(DB00425)	GAAGGACTCTGACTAGAGCAA	0.373																																					p.V457V		.											.	CYP3A7-91	0			c.C1371G						.						276.0	246.0	256.0					7																	99305480		2203	4300	6503	SO:0001819	synonymous_variant	1551	exon12			GACTCTGACTAGA	AF315325	CCDS5673.1	7q21-q22.1	2007-12-14	2003-01-14		ENSG00000160870	ENSG00000160870		"""Cytochrome P450s"""	2640	protein-coding gene	gene with protein product		605340	"""cytochrome P450, subfamily IIIA, polypeptide 7"""			2722762	Standard	NM_000765		Approved	CP37, P450-HFLA		P24462	OTTHUMG00000156726	ENST00000336374.2:c.1371C>G	7.37:g.99305480G>C		Somatic	257	0		WXS	Illumina GAIIx	Phase_I	590	36	NM_000765	0	0	1	1	0	A4D288|Q9H241	Silent	SNP	ENST00000336374.2	37	CCDS5673.1																																																																																			.		0.373	CYP3A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345484.1		
CYP3A7	1551	broad.mit.edu;bcgsc.ca	37	7	99305519	99305519	+	Silent	SNP	G	G	A			TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr7:99305519G>A	ENST00000336374.2	-	12	1334	c.1332C>T	c.(1330-1332)ggC>ggT	p.G444G		NM_000765.3	NP_000756.2	P24462	CP3A7_HUMAN	cytochrome P450, family 3, subfamily A, polypeptide 7	444					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxygen binding (GO:0019825)			autonomic_ganglia(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	32	Lung NSC(181;0.0144)|Esophageal squamous(72;0.0166)|all_lung(186;0.0228)				Alfentanil(DB00802)|Alprazolam(DB00404)|Aminophenazone(DB01424)|Amiodarone(DB01118)|Amlodipine(DB00381)|Aprepitant(DB00673)|Aripiprazole(DB01238)|Astemizole(DB00637)|Atorvastatin(DB01076)|Buprenorphine(DB00921)|Buspirone(DB00490)|Caffeine(DB00201)|Carbamazepine(DB00564)|Chloramphenicol(DB00446)|Chlorphenamine(DB01114)|Cilostazol(DB01166)|Cimetidine(DB00501)|Ciprofloxacin(DB00537)|Cisapride(DB00604)|Clarithromycin(DB01211)|Clotrimazole(DB00257)|Cocaine(DB00907)|Codeine(DB00318)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dapsone(DB00250)|Delavirdine(DB00705)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diazepam(DB00829)|Diltiazem(DB00343)|Docetaxel(DB01248)|Dolutegravir(DB08930)|Domperidone(DB01184)|Eplerenone(DB00700)|Erythromycin(DB00199)|Estradiol(DB00783)|Ethosuximide(DB00593)|Ethylmorphine(DB01466)|Felodipine(DB01023)|Fentanyl(DB00813)|Finasteride(DB01216)|Fluconazole(DB00196)|Fluticasone Propionate(DB00588)|Fluvoxamine(DB00176)|Gestodene(DB06730)|Haloperidol(DB00502)|Hydrocortisone(DB00741)|Ifosfamide(DB01181)|Iloperidone(DB04946)|Imatinib(DB00619)|Imipramine(DB00458)|Indinavir(DB00224)|Irinotecan(DB00762)|Itraconazole(DB01167)|Ketoconazole(DB01026)|Lercanidipine(DB00528)|Levomethadyl Acetate(DB01227)|Lidocaine(DB00281)|Lovastatin(DB00227)|Methadone(DB00333)|Midazolam(DB00683)|Mifepristone(DB00834)|Nateglinide(DB00731)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Nifedipine(DB01115)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Norethindrone(DB00717)|Norfloxacin(DB01059)|Ondansetron(DB00904)|Oxazepam(DB00842)|Oxycodone(DB00497)|Paclitaxel(DB01229)|Phenelzine(DB00780)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pimozide(DB01100)|Praziquantel(DB01058)|Progesterone(DB00396)|Propranolol(DB00571)|Quetiapine(DB01224)|Quinidine(DB00908)|Quinine(DB00468)|Rifampicin(DB01045)|Rifapentine(DB01201)|Risperidone(DB00734)|Ritonavir(DB00503)|Salmeterol(DB00938)|Saquinavir(DB01232)|Sildenafil(DB00203)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sorafenib(DB00398)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tamoxifen(DB00675)|Telithromycin(DB00976)|Temsirolimus(DB06287)|Testosterone(DB00624)|Trazodone(DB00656)|Tretinoin(DB00755)|Triazolam(DB00897)|Verapamil(DB00661)|Vincristine(DB00541)|Voriconazole(DB00582)|Zalcitabine(DB00943)|Zaleplon(DB00962)|Ziprasidone(DB00246)|Zolpidem(DB00425)	CAAACCTCATGCCAATGCAGT	0.408																																					p.G444G		.											.	CYP3A7-91	0			c.C1332T						.						351.0	309.0	324.0					7																	99305519		2203	4300	6503	SO:0001819	synonymous_variant	1551	exon12			CCTCATGCCAATG	AF315325	CCDS5673.1	7q21-q22.1	2007-12-14	2003-01-14		ENSG00000160870	ENSG00000160870		"""Cytochrome P450s"""	2640	protein-coding gene	gene with protein product		605340	"""cytochrome P450, subfamily IIIA, polypeptide 7"""			2722762	Standard	NM_000765		Approved	CP37, P450-HFLA		P24462	OTTHUMG00000156726	ENST00000336374.2:c.1332C>T	7.37:g.99305519G>A		Somatic	408	2		WXS	Illumina GAIIx	Phase_I	819	48	NM_000765	0	0	78	78	0	A4D288|Q9H241	Silent	SNP	ENST00000336374.2	37	CCDS5673.1																																																																																			.		0.408	CYP3A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345484.1		
ZNF775	285971	hgsc.bcm.edu	37	7	150094851	150094851	+	Missense_Mutation	SNP	A	A	G	rs13225910	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr7:150094851A>G	ENST00000329630.5	+	3	1389	c.1282A>G	c.(1282-1284)Acg>Gcg	p.T428A		NM_173680.3	NP_775951.2	Q96BV0	ZN775_HUMAN	zinc finger protein 775	428			T -> A (in dbSNP:rs13225910).		regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|liver(1)|lung(7)|skin(1)	11	Ovarian(565;0.183)|Melanoma(164;0.226)		OV - Ovarian serous cystadenocarcinoma(82;0.0173)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GGCCCGGGACACGCTGTGGGG	0.756													G|||	1894	0.378195	0.2814	0.3228	5008	,	,		7213	0.4702		0.4354	False		,,,				2504	0.3947				p.T428A		.											.	ZNF775-90	0			c.A1282G						.	G	ALA/THR	951,2643		177,597,1023	4.0	5.0	4.0		1282	1.2	0.0	7	dbSNP_121	4	2946,4600		676,1594,1503	no	missense	ZNF775	NM_173680.3	58	853,2191,2526	GG,GA,AA		39.0406,26.4608,34.982	benign	428/538	150094851	3897,7243	1797	3773	5570	SO:0001583	missense	285971	exon3			CGGGACACGCTGT	BC038111	CCDS43678.1	7q36.1	2013-01-08			ENSG00000196456	ENSG00000196456		"""Zinc fingers, C2H2-type"""	28501	protein-coding gene	gene with protein product						12477932	Standard	NM_173680		Approved	MGC33584	uc003whf.1	Q96BV0	OTTHUMG00000158324	ENST00000329630.5:c.1282A>G	7.37:g.150094851A>G	ENSP00000330838:p.Thr428Ala	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_173680	0	0	0	0	0	Q8IY24	Missense_Mutation	SNP	ENST00000329630.5	37	CCDS43678.1	922	0.42216117216117216	169	0.3434959349593496	128	0.35359116022099446	298	0.5209790209790209	327	0.4313984168865435	G	0.004	-2.282788	0.00251	0.264608	0.390406	ENSG00000196456	ENST00000329630	T	0.08008	3.14	3.27	1.23	0.21249	.	.	.	.	.	T	0.00012	0.0000	N	0.03608	-0.345	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.35325	-0.9793	7	.	.	.	.	3.7266	0.08477	0.2539:0.2047:0.5414:0.0	rs13225910	428	Q96BV0	ZN775_HUMAN	A	428	ENSP00000330838:T428A	.	T	+	1	0	ZNF775	149725784	0.006000	0.16342	0.000000	0.03702	0.003000	0.03518	0.602000	0.24134	0.141000	0.18875	-0.213000	0.12676	ACG	A|0.578;G|0.422		0.756	ZNF775-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350679.1	NM_173680	
ESYT2	57488	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	158534581	158534581	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr7:158534581G>T	ENST00000251527.5	-	17	1947	c.1882C>A	c.(1882-1884)Cat>Aat	p.H628N	ESYT2_ENST00000435514.2_Missense_Mutation_p.H63N	NM_020728.2	NP_065779.1	A0FGR8	ESYT2_HUMAN	extended synaptotagmin-like protein 2	656					endocytosis (GO:0006897)|lipid transport (GO:0006869)	extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|integral component of plasma membrane (GO:0005887)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|membrane (GO:0016020)|organelle membrane contact site (GO:0044232)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|identical protein binding (GO:0042802)|phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(16)|prostate(2)	32						TTTTCGAGATGGAGCACCTAG	0.443																																					p.H628N		.											.	ESYT2-92	0			c.C1882A						.						65.0	71.0	69.0					7																	158534581		2150	4265	6415	SO:0001583	missense	57488	exon17			CGAGATGGAGCAC	AB033054	CCDS34791.1	7q36.3	2014-07-02	2009-06-23	2009-06-23	ENSG00000117868	ENSG00000117868		"""Synaptotagmins"""	22211	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member B"""	FAM62B		17672888	Standard	NM_020728		Approved	KIAA1228, CHR2SYT	uc003wob.1	A0FGR8	OTTHUMG00000151436	ENST00000251527.5:c.1882C>A	7.37:g.158534581G>T	ENSP00000251527:p.His628Asn	Somatic	106	0		WXS	Illumina GAIIx	Phase_I	57	7	NM_020728	0	0	0	0	0	A4D229|Q69YJ2|Q6UKI4|Q6ZTU0|Q6ZVU1|Q9BQS0|Q9NW47|Q9ULJ2	Missense_Mutation	SNP	ENST00000251527.5	37	CCDS34791.1	.	.	.	.	.	.	.	.	.	.	G	8.576	0.881092	0.17467	.	.	ENSG00000117868	ENST00000251527;ENST00000421679;ENST00000275418;ENST00000435514;ENST00000377650;ENST00000429474	T;T;T	0.70869	-0.52;-0.52;-0.52	5.75	2.57	0.30868	C2 calcium/lipid-binding domain, CaLB (1);	0.846389	0.11150	N	0.594196	T	0.58935	0.2157	L	0.49350	1.555	0.26723	N	0.970739	B;B	0.31817	0.341;0.007	B;B	0.27076	0.076;0.007	T	0.46665	-0.9175	10	0.28530	T	0.3	-16.4344	5.781	0.18306	0.1767:0.0:0.6357:0.1876	.	628;656	A0FGR8-2;A0FGR8	.;ESYT2_HUMAN	N	628;677;619;63;63;452	ENSP00000251527:H628N;ENSP00000275418:H619N;ENSP00000411488:H63N	ENSP00000251527:H628N	H	-	1	0	ESYT2	158227342	1.000000	0.71417	0.836000	0.33094	0.268000	0.26511	3.373000	0.52394	0.616000	0.30141	0.650000	0.86243	CAT	.		0.443	ESYT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322647.1	NM_020728	
MFHAS1	9258	hgsc.bcm.edu	37	8	8750467	8750467	+	Silent	SNP	A	A	G	rs1062988	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr8:8750467A>G	ENST00000276282.6	-	1	688	c.102T>C	c.(100-102)ctT>ctC	p.L34L	RNU6-682P_ENST00000363843.1_RNA	NM_004225.2	NP_004216.2	Q9Y4C4	MFHA1_HUMAN	malignant fibrous histiocytoma amplified sequence 1	34										endometrium(1)|kidney(3)|large_intestine(7)|lung(6)|ovary(1)|prostate(2)|stomach(1)	21		Hepatocellular(245;0.217)		COAD - Colon adenocarcinoma(149;0.124)		cggcggcggTAAGCGTGAGCT	0.741													G|||	814	0.16254	0.3419	0.1196	5008	,	,		8355	0.001		0.1521	False		,,,				2504	0.1278				p.L34L	Melanoma(103;1201 2045 17515 28966)	.											.	MFHAS1-90	0			c.T102C						.	G		875,3021		81,713,1154	4.0	4.0	4.0		102	2.3	1.0	8	dbSNP_86	4	854,6846		52,750,3048	no	coding-synonymous	MFHAS1	NM_004225.2		133,1463,4202	GG,GA,AA		11.0909,22.4589,14.9103		34/1053	8750467	1729,9867	1948	3850	5798	SO:0001819	synonymous_variant	9258	exon1			GGCGGTAAGCGTG	AB016816	CCDS34844.1	8p23.1	2014-03-07			ENSG00000147324	ENSG00000147324			16982	protein-coding gene	gene with protein product	"""leucine rich repeat containing 65"", ""malignant fibrous histiocytoma-amplified sequences with leucine-rich tandem repeats 1"""	605352				9973190	Standard	NM_004225		Approved	MASL1, LRRC65	uc003wsj.1	Q9Y4C4	OTTHUMG00000163676	ENST00000276282.6:c.102T>C	8.37:g.8750467A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	12	12	NM_004225	0	0	0	0	0	Q96CI0	Silent	SNP	ENST00000276282.6	37	CCDS34844.1																																																																																			A|0.857;G|0.143		0.741	MFHAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374724.2	NM_004225	
E2F5	1875	hgsc.bcm.edu	37	8	86089787	86089787	+	Silent	SNP	C	C	G	rs12926	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr8:86089787C>G	ENST00000416274.2	+	1	166	c.132C>G	c.(130-132)gcC>gcG	p.A44A	RP11-219B4.3_ENST00000520129.1_RNA|RP11-219B4.7_ENST00000566000.1_RNA|RP11-219B4.7_ENST00000562577.1_RNA|E2F5_ENST00000418930.2_Silent_p.A44A|E2F5_ENST00000256117.5_Silent_p.A44A	NM_001083588.1|NM_001951.3	NP_001077057.1|NP_001942.2	Q15329	E2F5_HUMAN	E2F transcription factor 5, p130-binding	44					gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			NS(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)	8						TCGGGGGCGCCGGGGGCGGCA	0.751													C|||	2815	0.562101	0.5545	0.549	5008	,	,		6370	0.4157		0.6928	False		,,,				2504	0.5982				p.A44A		.											.	E2F5-415	0			c.C132G						.	C	,	2392,1558		800,792,383	4.0	5.0	5.0		132,132	0.9	0.1	8	dbSNP_52	5	5668,2428		2076,1516,456	no	coding-synonymous,coding-synonymous	E2F5	NM_001083588.1,NM_001951.3	,	2876,2308,839	GG,GC,CC		29.9901,39.443,33.0898	,	44/346,44/347	86089787	8060,3986	1975	4048	6023	SO:0001819	synonymous_variant	1875	exon1			GGGCGCCGGGGGC	X86097	CCDS47885.1, CCDS47886.1, CCDS55254.1	8q21.2	2004-01-29			ENSG00000133740	ENSG00000133740			3119	protein-coding gene	gene with protein product		600967				7892279	Standard	NM_001083588		Approved		uc003ycz.4	Q15329	OTTHUMG00000164785	ENST00000416274.2:c.132C>G	8.37:g.86089787C>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_001083588	0	0	0	0	0	E9PBN9|Q16601|Q92756	Silent	SNP	ENST00000416274.2	37	CCDS47885.1																																																																																			C|0.434;G|0.566		0.751	E2F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000380274.1	NM_001951	
EPPK1	83481	bcgsc.ca	37	8	144940267	144940267	+	Silent	SNP	G	G	A	rs28441354		TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr8:144940267G>A	ENST00000525985.1	-	2	7226	c.7155C>T	c.(7153-7155)ggC>ggT	p.G2385G				P58107	EPIPL_HUMAN	epiplakin 1	2385						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			GGTCGAAGAAGCCCTTGGTGT	0.642																																					p.G2385G		.											.	EPPK1-25	0			c.C7155T						.						274.0	257.0	263.0					8																	144940267		2190	4273	6463	SO:0001819	synonymous_variant	83481	exon1			GAAGAAGCCCTTG	AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.7155C>T	8.37:g.144940267G>A		Somatic	176	1		WXS	Illumina GAIIx	Phase_I	489	34	NM_031308	0	0	0	0	0	Q76E58|Q9NSU9	Silent	SNP	ENST00000525985.1	37																																																																																				G|0.995;A|0.005		0.642	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382675.1	NM_031308	
SHARPIN	81858	hgsc.bcm.edu	37	8	145158503	145158503	+	Silent	SNP	G	G	T	rs11136254	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr8:145158503G>T	ENST00000398712.2	-	1	590	c.154C>A	c.(154-156)Cgg>Agg	p.R52R	SHARPIN_ENST00000533948.1_Intron|MAF1_ENST00000532522.1_5'Flank|MAF1_ENST00000534585.1_5'Flank|MAF1_ENST00000322428.5_5'Flank	NM_030974.3	NP_112236.3	Q9H0F6	SHRPN_HUMAN	SHANK-associated RH domain interactor	52	Self-association. {ECO:0000250}.				apoptotic nuclear changes (GO:0030262)|brain development (GO:0007420)|keratinization (GO:0031424)|mitochondrion organization (GO:0007005)|negative regulation of inflammatory response (GO:0050728)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein homooligomerization (GO:0051260)|protein linear polyubiquitination (GO:0097039)|regulation of CD40 signaling pathway (GO:2000348)|regulation of tumor necrosis factor-mediated signaling pathway (GO:0010803)	cell junction (GO:0030054)|cytosol (GO:0005829)|dendrite (GO:0030425)|LUBAC complex (GO:0071797)|postsynaptic density (GO:0014069)	polyubiquitin binding (GO:0031593)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(1)|lung(2)|ovary(2)	7	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;4.1e-42)|Epithelial(56;1.58e-40)|all cancers(56;6.12e-36)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CGCCCAGGCCGCTCAGGGTCC	0.771													G|||	4431	0.884784	0.6884	0.9366	5008	,	,		10154	0.999		0.9115	False		,,,				2504	0.9683				p.R52R		.											.	SHARPIN-523	0			c.C154A						.	G		1990,374		815,360,7	2.0	2.0	2.0		154	2.7	0.6	8	dbSNP_120	2	5503,323		2593,317,3	no	coding-synonymous	SHARPIN	NM_030974.3		3408,677,10	TT,TG,GG		5.5441,15.8206,8.5104		52/388	145158503	7493,697	1182	2913	4095	SO:0001819	synonymous_variant	81858	exon1			CAGGCCGCTCAGG	AL136816	CCDS43777.1	8q24.3	2005-08-09				ENSG00000179526			25321	protein-coding gene	gene with protein product		611885				11178875, 12753155	Standard	NM_030974		Approved	DKFZP434N1923, SIPL1	uc003zba.3	Q9H0F6		ENST00000398712.2:c.154C>A	8.37:g.145158503G>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	9	NM_030974	0	0	0	26	26	A6NEG3|C0L3L2|D3DWL3|Q8IXF5|Q8IXF6|Q8N2E7|Q8TB25|Q9BUE4	Silent	SNP	ENST00000398712.2	37	CCDS43777.1																																																																																			G|0.108;T|0.892		0.771	SHARPIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382901.1	NM_030974	
ZNF517	340385	hgsc.bcm.edu	37	8	146033347	146033347	+	Missense_Mutation	SNP	T	T	C	rs2976653	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr8:146033347T>C	ENST00000531720.1	+	4	1091	c.1046T>C	c.(1045-1047)gTg>gCg	p.V349A	ZNF517_ENST00000526178.1_Intron|ZNF517_ENST00000359971.3_Missense_Mutation_p.V349A|ZNF517_ENST00000525105.1_Intron			Q6ZMY9	ZN517_HUMAN	zinc finger protein 517	349				V -> A (in Ref. 1; BAD18586). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(2)|lung(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_cancers(97;1.03e-11)|all_epithelial(106;6.69e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;5.47e-39)|OV - Ovarian serous cystadenocarcinoma(54;6.38e-39)|all cancers(56;5.47e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)			GACGGCGGCGTGGGGCAGGGC	0.746													C|||	4981	0.994609	1.0	1.0	5008	,	,		12856	1.0		0.994	False		,,,				2504	0.9785				p.V349A		.											.	ZNF517-90	0			c.T1046C						.	C	ALA/VAL	3411,3		1704,3,0	3.0	5.0	4.0		1046	-0.8	0.0	8	dbSNP_101	4	7050,46		3502,46,0	no	missense	ZNF517	NM_213605.2	64	5206,49,0	CC,CT,TT		0.6483,0.0879,0.4662	benign	349/493	146033347	10461,49	1707	3548	5255	SO:0001583	missense	340385	exon5			GCGGCGTGGGGCA	AK096527	CCDS6434.1	8q24.3	2013-01-08				ENSG00000197363		"""Zinc fingers, C2H2-type"", ""-"""	27984	protein-coding gene	gene with protein product							Standard	NM_213605		Approved		uc003zed.1	Q6ZMY9		ENST00000531720.1:c.1046T>C	8.37:g.146033347T>C	ENSP00000436103:p.Val349Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	20	20	NM_213605	0	0	0	1	1		Missense_Mutation	SNP	ENST00000531720.1	37	CCDS6434.1	2179|2179	0.9977106227106227|0.9977106227106227	492|492	1.0|1.0	362|362	1.0|1.0	572|572	1.0|1.0	753|753	0.9934036939313984|0.9934036939313984	C|C	0.021|0.021	-1.418607|-1.418607	0.01136|0.01136	0.999121|0.999121	0.993517|0.993517	ENSG00000197363|ENSG00000197363	ENST00000359971;ENST00000531720|ENST00000529429	T;T|.	0.05319|.	3.46;3.46|.	2.17|2.17	-0.838|-0.838	0.10762|0.10762	.|.	.|.	.|.	.|.	.|.	T|T	0.00012|0.00012	0.0000|0.0000	L|L	0.35644|0.35644	1.08|1.08	0.80722|0.80722	P|P	0.0|0.0	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|T	0.21449|0.21449	-1.0245|-1.0245	8|4	0.59425|.	D|.	0.04|.	.|.	0.241|0.241	0.00192|0.00192	0.362:0.2246:0.2135:0.1999|0.362:0.2246:0.2135:0.1999	rs2976653;rs59817342|rs2976653;rs59817342	349|.	Q6ZMY9|.	ZN517_HUMAN|.	A|R	349|316	ENSP00000353058:V349A;ENSP00000436103:V349A|.	ENSP00000353058:V349A|.	V|W	+|+	2|1	0|0	ZNF517|ZNF517	146004151|146004151	0.001000|0.001000	0.12720|0.12720	0.002000|0.002000	0.10522|0.10522	0.004000|0.004000	0.04260|0.04260	-0.400000|-0.400000	0.07241|0.07241	-0.612000|-0.612000	0.05701|0.05701	-1.157000|-1.157000	0.01802|0.01802	GTG|TGG	G|0.992;C|0.006		0.746	ZNF517-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382642.1	XM_291261	
GOLM1	51280	bcgsc.ca	37	9	88694179	88694179	+	Silent	SNP	G	G	T	rs3750389	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr9:88694179G>T	ENST00000388712.3	-	2	225	c.57C>A	c.(55-57)gcC>gcA	p.A19A	GOLM1_ENST00000388711.3_Silent_p.A19A|GOLM1_ENST00000257504.6_5'Flank	NM_016548.3	NP_057632.2	Q8NBJ4	GOLM1_HUMAN	golgi membrane protein 1	19					nucleus organization (GO:0006997)|regulation of lipid metabolic process (GO:0019216)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)				breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|liver(1)|lung(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	17						CCACCAGGGCGGCCAGCACGA	0.522													G|||	1492	0.297923	0.3752	0.1484	5008	,	,		16513	0.5615		0.0934	False		,,,				2504	0.2382				p.A19A		.											.	GOLM1-22	0			c.C57A						.	G	,	1520,2886	466.0+/-354.4	248,1024,931	33.0	34.0	34.0		57,57	-10.3	0.9	9	dbSNP_107	34	833,7765	187.2+/-234.5	32,769,3498	no	coding-synonymous,coding-synonymous	GOLM1	NM_016548.3,NM_177937.2	,	280,1793,4429	TT,TG,GG		9.6883,34.4984,18.0944	,	19/402,19/402	88694179	2353,10651	2203	4299	6502	SO:0001819	synonymous_variant	51280	exon2			CAGGGCGGCCAGC	AF236056	CCDS35054.1	9q21.33	2012-12-13	2007-07-30	2007-07-30	ENSG00000135052	ENSG00000135052			15451	protein-coding gene	gene with protein product		606804	"""golgi phosphoprotein 2"", ""chromosome 9 open reading frame 155"""	GOLPH2, C9orf155		10831838, 18953438, 22542941	Standard	NM_016548		Approved	GP73, FLJ23608, bA379P1.3	uc004aol.3	Q8NBJ4	OTTHUMG00000020130	ENST00000388712.3:c.57C>A	9.37:g.88694179G>T		Somatic	79	0		WXS	Illumina GAIIx	Phase_I	92	5	NM_016548	0	0	20	20	0	Q6IAF4|Q9NRB9	Silent	SNP	ENST00000388712.3	37	CCDS35054.1																																																																																			G|0.799;T|0.201		0.522	GOLM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052904.2	NM_177937	
DEC1	50514	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	118162667	118162667	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr9:118162667G>T	ENST00000374016.1	+	6	562	c.43G>T	c.(43-45)Gtg>Ttg	p.V15L		NM_017418.2	NP_059114.1	Q9P2X7	DEC1_HUMAN	deleted in esophageal cancer 1	15					negative regulation of cell proliferation (GO:0008285)					kidney(1)|large_intestine(1)|ovary(1)	3						gaagagcattgtgccagcacc	0.423																																					p.V15L		.											.	DEC1-69	0			c.G43T						.						129.0	116.0	120.0					9																	118162667		2203	4300	6503	SO:0001583	missense	50514	exon6			AGCATTGTGCCAG	AB022761	CCDS6812.1	9q32	2008-02-05			ENSG00000173077	ENSG00000173077			23658	protein-coding gene	gene with protein product		604767				8603412, 10612805	Standard	NM_017418		Approved	CTS9	uc004bjk.1	Q9P2X7	OTTHUMG00000020549	ENST00000374016.1:c.43G>T	9.37:g.118162667G>T	ENSP00000363128:p.Val15Leu	Somatic	106	0		WXS	Illumina GAIIx	Phase_I	107	20	NM_017418	0	0	0	0	0		Missense_Mutation	SNP	ENST00000374016.1	37	CCDS6812.1	.	.	.	.	.	.	.	.	.	.	G	2.070	-0.413368	0.04799	.	.	ENSG00000173077	ENST00000374016	T	0.55760	0.5	0.946	0.946	0.19549	.	.	.	.	.	T	0.34542	0.0901	.	.	.	0.09310	N	1	B	0.31655	0.334	B	0.20384	0.029	T	0.28618	-1.0038	8	0.87932	D	0	.	5.2147	0.15336	0.0:0.0:1.0:0.0	.	15	Q9P2X7	DEC1_HUMAN	L	15	ENSP00000363128:V15L	ENSP00000363128:V15L	V	+	1	0	DEC1	117202488	0.001000	0.12720	0.001000	0.08648	0.002000	0.02628	-0.098000	0.11024	0.801000	0.34066	0.655000	0.94253	GTG	.		0.423	DEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053791.1	NM_017418	
CRB2	286204	hgsc.bcm.edu	37	9	126136139	126136139	+	Missense_Mutation	SNP	C	C	T	rs73571431	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr9:126136139C>T	ENST00000373631.3	+	10	3330	c.3329C>T	c.(3328-3330)aCg>aTg	p.T1110M	CRB2_ENST00000373629.2_Missense_Mutation_p.T778M|CRB2_ENST00000359999.3_Missense_Mutation_p.T1110M	NM_173689.5	NP_775960.4	Q5IJ48	CRUM2_HUMAN	crumbs family member 2	1110	EGF-like 13. {ECO:0000255|PROSITE- ProRule:PRU00076}.		T -> M (in dbSNP:rs73571431). {ECO:0000269|PubMed:15851977}.		cardiovascular system development (GO:0072358)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|mesoderm formation (GO:0001707)|negative regulation of endopeptidase activity (GO:0010951)|notochord formation (GO:0014028)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|somitogenesis (GO:0001756)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)			NS(2)|breast(1)|cervix(1)|endometrium(2)|lung(11)|ovary(1)|prostate(2)|skin(3)	23						CGCTGTCACACGCACCCCGAC	0.771													C|||	530	0.105831	0.1059	0.1873	5008	,	,		9885	0.0764		0.1412	False		,,,				2504	0.0419				p.T1110M		.											.	CRB2-91	0			c.C3329T						.	C	MET/THR	273,2733		10,253,1240	3.0	3.0	3.0		3329	2.8	0.1	9	dbSNP_131	3	523,5481		24,475,2503	no	missense	CRB2	NM_173689.5	81	34,728,3743	TT,TC,CC		8.7109,9.0818,8.8346	possibly-damaging	1110/1286	126136139	796,8214	1503	3002	4505	SO:0001583	missense	286204	exon10			GTCACACGCACCC	AK095783	CCDS6852.2	9q33.2	2014-02-06	2014-02-06		ENSG00000148204	ENSG00000148204			18688	protein-coding gene	gene with protein product		609720	"""crumbs homolog 2 (Drosophila)"""			14767562	Standard	XM_005251934		Approved	FLJ38464, FLJ16786	uc004bnx.1	Q5IJ48	OTTHUMG00000020638	ENST00000373631.3:c.3329C>T	9.37:g.126136139C>T	ENSP00000362734:p.Thr1110Met	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	11	6	NM_173689	0	0	0	0	0	A2A3N4|Q0QD46|Q5JS41|Q5JS43|Q6ZTA9|Q6ZWI6	Missense_Mutation	SNP	ENST00000373631.3	37	CCDS6852.2	272	0.12454212454212454	60	0.12195121951219512	50	0.13812154696132597	56	0.0979020979020979	106	0.13984168865435356	.	6.539	0.467763	0.12402	0.090818	0.087109	ENSG00000148204	ENST00000359999;ENST00000373631;ENST00000373629	D;D;D	0.90732	-2.1;-2.0;-2.72	3.77	2.82	0.32997	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	1.339200	0.05453	N	0.549893	T	0.01976	0.0062	N	0.12746	0.255	0.80722	P	0.0	P;D	0.56521	0.925;0.976	B;B	0.38562	0.101;0.276	T	0.57100	-0.7869	9	0.36615	T	0.2	.	3.1184	0.06382	0.0:0.4522:0.2781:0.2698	.	1110;1110	Q5IJ48;Q5IJ48-2	CRUM2_HUMAN;.	M	1110;1110;778	ENSP00000353092:T1110M;ENSP00000362734:T1110M;ENSP00000362732:T778M	ENSP00000353092:T1110M	T	+	2	0	CRB2	125175960	0.000000	0.05858	0.081000	0.20488	0.039000	0.13416	0.001000	0.13038	1.929000	0.55896	0.455000	0.32223	ACG	C|0.875;T|0.125		0.771	CRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053990.3	NM_173689	
GTPBP6	8225	bcgsc.ca	37	X	229493	229493	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chrX:229493G>A	ENST00000326153.4	-	2	168	c.169C>T	c.(169-171)Cgc>Tgc	p.R57C				O43824	GTPB6_HUMAN	GTP binding protein 6 (putative)	286							GTP binding (GO:0005525)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|lung(3)	7		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				CGCTGCCGGCGGAGCAGGTGC	0.652													G|||	290	0.0579073	0.0552	0.0317	5008	,	,		14638	0.0645		0.0716	False		,,,				2504	0.0593				.		.											.	GTPBP6-40	0			.						.		CYS/ARG	197,3837		7,183,1827	45.0	57.0	53.0		170	-2.7	0.0	X	dbSNP_134	53	563,7727		17,529,3599	no	missense	GTPBP6	NM_012227.2	180	24,712,5426	AA,AG,GG		6.7913,4.8835,6.1668	probably-damaging	286/517	229493	760,11564	2017	4145	6162	SO:0001583	missense	8225	.			GCCGGCGGAGCAG	Y14391	CCDS75943.1	Xp22.33 and Yp11.32	2010-07-28			ENSG00000178605	ENSG00000178605		"""Pseudoautosomal regions / PAR1"""	30189	protein-coding gene	gene with protein product	"""pseudoautosomal GTP binding protein-like"""	300124				9466997	Standard	XM_006724447		Approved	PGPL, FLJ20977	uc004cpe.1	O43824	OTTHUMG00000022694	ENST00000326153.4:c.169C>T	X.37:g.229493G>A	ENSP00000316598:p.Arg57Cys	Somatic	147	2		WXS	Illumina GAIIx	Phase_I	254	7	.	0	0	23	23	0	Q53F77|Q5HYX8	Missense_Mutation	SNP	ENST00000326153.4	37		141|141	0.06456043956043957|0.06456043956043957	28|28	0.056910569105691054|0.056910569105691054	9|9	0.024861878453038673|0.024861878453038673	46|46	0.08041958041958042|0.08041958041958042	58|58	0.07651715039577836|0.07651715039577836	G|G	8.540|8.540	0.873142|0.873142	0.17322|0.17322	0.048835|0.048835	0.067913|0.067913	ENSG00000178605|ENSG00000178605	ENST00000400701|ENST00000326153	.|.	.|.	.|.	1.37|1.37	-2.72|-2.72	0.05968|0.05968	.|.	.|0.225081	.|0.35970	.|N	.|0.002863	T|T	0.05686|0.05686	0.0149|0.0149	.|.	.|.	.|.	.|0.46823	.|D	.|0.999216	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.79108	.|0.992;0.946	T|T	0.39722|0.39722	-0.9600|-0.9600	3|7	.|0.87932	.|D	.|0	-3.4052|-3.4052	2.2725|2.2725	0.04094|0.04094	0.0:0.2616:0.3103:0.428|0.0:0.2616:0.3103:0.428	.|.	.|173;286	.|B4DPB2;O43824	.|.;GTPB6_HUMAN	L|C	56|57	.|.	.|ENSP00000316598:R57C	P|R	-|-	2|1	0|0	GTPBP6|GTPBP6	169493|169493	0.482000|0.482000	0.25948|0.25948	0.001000|0.001000	0.08648|0.08648	0.461000|0.461000	0.32589|0.32589	0.693000|0.693000	0.25497|0.25497	-0.428000|-0.428000	0.07339|0.07339	0.100000|0.100000	0.15512|0.15512	CCG|CGC	G|0.935;A|0.065		0.652	GTPBP6-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_012227	
CXorf28	100129464	bcgsc.ca	37	X	3190396	3190396	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chrX:3190396T>C	ENST00000457435.1	+	2	158	c.145T>C	c.(145-147)Tgg>Cgg	p.W49R	CXorf28_ENST00000420429.2_Missense_Mutation_p.W49R					chromosome X open reading frame 28																		CACACAGCAATGGATACTTAA	0.428																																					.		.											.	CXorf28-40	0			.						.																																			SO:0001583	missense	100129464	.			CAGCAATGGATAC			Xp22.33	2013-01-16			ENSG00000228459	ENSG00000228459			27336	other	unknown							Standard	NR_038428		Approved		uc022bsa.1	A6NGU7	OTTHUMG00000021082	ENST00000457435.1:c.145T>C	X.37:g.3190396T>C	ENSP00000387744:p.Trp49Arg	Somatic	181	2		WXS	Illumina GAIIx	Phase_I	121	48	.	0	0	0	1	1		RNA	SNP	ENST00000457435.1	37		.	.	.	.	.	.	.	.	.	.	T	1.024	-0.683896	0.03353	.	.	ENSG00000228459	ENST00000457435;ENST00000420429	.	.	.	1.03	-2.07	0.07276	.	.	.	.	.	T	0.27241	0.0668	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.32693	-0.9897	5	0.87932	D	0	.	0.2753	0.00237	0.2158:0.2285:0.2999:0.2559	.	.	.	.	R	49	.	ENSP00000397330:W49R	W	+	1	0	CXorf28	3200396	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	-0.803000	0.04540	-1.382000	0.02109	-0.546000	0.04227	TGG	.		0.428	CXorf28-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000055654.1	NR_038428	
BCOR	54880	broad.mit.edu;bcgsc.ca	37	X	39931877	39931877	+	Missense_Mutation	SNP	C	C	G	rs542522950		TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chrX:39931877C>G	ENST00000378444.4	-	4	2950	c.2722G>C	c.(2722-2724)Gat>Cat	p.D908H	BCOR_ENST00000342274.4_Missense_Mutation_p.D908H|BCOR_ENST00000397354.3_Missense_Mutation_p.D908H|BCOR_ENST00000378455.4_Missense_Mutation_p.D908H	NM_001123385.1	NP_001116857.1	Q6W2J9	BCOR_HUMAN	BCL6 corepressor	908					heart development (GO:0007507)|histone H2A monoubiquitination (GO:0035518)|negative regulation of bone mineralization (GO:0030502)|negative regulation of histone H3-K36 methylation (GO:0000415)|negative regulation of histone H3-K4 methylation (GO:0051572)|negative regulation of tooth mineralization (GO:0070171)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis (GO:0042476)|palate development (GO:0060021)|specification of axis polarity (GO:0065001)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	heat shock protein binding (GO:0031072)|histone deacetylase binding (GO:0042826)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(4)|central_nervous_system(11)|cervix(1)|endometrium(24)|eye(6)|haematopoietic_and_lymphoid_tissue(33)|kidney(2)|large_intestine(11)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	126						GCAGGGCCATCGCTCCCCAGA	0.532			"""F, N, S, T"""	RARA	"""retinoblastoma, AML, APL(translocation)"""		oculo-facio-cardio-dental genetic																														p.D908H		.		Rec	yes		X	Xp11.4	54880	BCL6 corepressor	yes		.	BCOR-229	0			c.G2722C						.						75.0	66.0	69.0					X																	39931877		2202	4300	6502	SO:0001583	missense	54880	exon4			GGCCATCGCTCCC	AF317391	CCDS14250.1, CCDS48092.1, CCDS48093.1	Xp11.4	2014-09-17	2010-06-10		ENSG00000183337	ENSG00000183337		"""Ankyrin repeat domain containing"""	20893	protein-coding gene	gene with protein product		300485	"""BCL6 co-repressor"""			10898795	Standard	NM_017745		Approved	FLJ20285, KIAA1575	uc004den.4	Q6W2J9	OTTHUMG00000024100	ENST00000378444.4:c.2722G>C	X.37:g.39931877C>G	ENSP00000367705:p.Asp908His	Somatic	379	0		WXS	Illumina GAIIx	Phase_I	335	14	NM_001123385	0	0	5	5	0	D3DWB3|D3DWB4|Q29RF6|Q6P4B6|Q7Z2K7|Q8TEB4|Q96DB3|Q9H232|Q9H233|Q9HCJ7|Q9NXF2	Missense_Mutation	SNP	ENST00000378444.4	37	CCDS48093.1	.	.	.	.	.	.	.	.	.	.	C	14.99	2.701552	0.48307	.	.	ENSG00000183337	ENST00000378455;ENST00000397354;ENST00000378444;ENST00000342274;ENST00000406200;ENST00000501455	T;T;T;T;T	0.14766	2.48;2.48;2.48;2.48;2.48	5.93	5.93	0.95920	.	.	.	.	.	T	0.26011	0.0634	N	0.24115	0.695	0.49483	D	0.99979	D;D;D;D	0.67145	0.996;0.996;0.989;0.996	D;D;P;D	0.66602	0.945;0.945;0.881;0.945	T	0.02263	-1.1186	9	0.87932	D	0	-16.63	19.2834	0.94061	0.0:1.0:0.0:0.0	.	908;908;908;908	Q6W2J9-3;Q6W2J9-4;Q6W2J9;Q6W2J9-2	.;.;BCOR_HUMAN;.	H	908;908;908;908;908;315	ENSP00000367716:D908H;ENSP00000380512:D908H;ENSP00000367705:D908H;ENSP00000345923:D908H;ENSP00000384485:D908H	ENSP00000345923:D908H	D	-	1	0	BCOR	39816821	1.000000	0.71417	0.517000	0.27799	0.468000	0.32798	5.321000	0.65846	2.506000	0.84524	0.600000	0.82982	GAT	.		0.532	BCOR-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060666.2	NM_017745	
DCAF12L1	139170	hgsc.bcm.edu	37	X	125686536	125686536	+	Missense_Mutation	SNP	T	T	C	rs11095722	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chrX:125686536T>C	ENST00000371126.1	-	1	298	c.56A>G	c.(55-57)gAc>gGc	p.D19G		NM_178470.4	NP_848565.2	Q5VU92	DC121_HUMAN	DDB1 and CUL4 associated factor 12-like 1	19			D -> G (in dbSNP:rs11095722). {ECO:0000269|PubMed:15489334}.							breast(1)|central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(39)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	68						GCTCTCGGCGTCCGCCTCGAC	0.721													C|||	411	0.108874	0.1778	0.0274	3775	,	,		7860	0.0933		0.0308	False		,,,				2504	0.0327				p.D19G		.											.	DCAF12L1-132	0			c.A56G						.	C	GLY/ASP	433,3179		16,305,96,1216,442	17.0	21.0	20.0		56	-2.7	0.0	X	dbSNP_120	20	173,6266		4,109,56,2245,1667	no	missense	DCAF12L1	NM_178470.4	94	20,414,152,3461,2109	CC,CT,C,TT,T		2.6868,11.9878,6.0293	benign	19/464	125686536	606,9445	2075	4081	6156	SO:0001583	missense	139170	exon1			TCGGCGTCCGCCT	BC035674	CCDS14610.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198889	ENSG00000198889		"""WD repeat domain containing"""	29395	protein-coding gene	gene with protein product			"""WD repeat domain 40B"""	WDR40B		12477932	Standard	NM_178470		Approved	KIAA1892L	uc004eul.3	Q5VU92	OTTHUMG00000022353	ENST00000371126.1:c.56A>G	X.37:g.125686536T>C	ENSP00000360167:p.Asp19Gly	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	58	8	NM_178470	0	0	0	0	0	Q8IYK3	Missense_Mutation	SNP	ENST00000371126.1	37	CCDS14610.1	184	0.11091018685955395	68	0.16113744075829384	7	0.019553072625698324	32	0.06015037593984962	19	0.02526595744680851	C	3.898	-0.022629	0.07634	0.119878	0.026868	ENSG00000198889	ENST00000371126	T	0.16196	2.36	3.15	-2.73	0.05950	.	.	.	.	.	T	0.00012	0.0000	N	0.00823	-1.155	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.37079	-0.9721	8	0.15952	T	0.53	.	2.1322	0.03753	0.1362:0.224:0.4212:0.2185	rs11095722;rs17846147;rs17859155	19	Q5VU92	DC121_HUMAN	G	19	ENSP00000360167:D19G	ENSP00000360167:D19G	D	-	2	0	DCAF12L1	125514217	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.002000	0.03686	-1.350000	0.02199	-1.137000	0.01932	GAC	T|0.888;C|0.112		0.721	DCAF12L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058186.1	NM_178470	
PRR21	643905	hgsc.bcm.edu	37	2	240982368	240982369	+	Frame_Shift_Ins	INS	-	-	GATGAAGAGCCGTG			TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr2:240982368_240982369insGATGAAGAGCCGTG	ENST00000408934.1	-	1	30_31	c.31_32insCACGGCTCTTCATC	c.(31-33)ccafs	p.-11fs		NM_001080835.1	NP_001074304.1	Q8WXC7	PRR21_HUMAN	proline rich 21											NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(5)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)	29						GAAGGGCCGTGGATGAAGAGCT	0.574																																					p.P11fs		.											.	PRR21-70	0			c.32_33insCACGGCTCTTCATC						.																																			SO:0001589	frameshift_variant	643905	exon1			GGCCGTGGATGAA	AF453950	CCDS33417.1	2q37.3	2009-04-20			ENSG00000221961	ENSG00000221961			33866	protein-coding gene	gene with protein product							Standard	NM_001080835		Approved		uc010zod.2	Q8WXC7	OTTHUMG00000159174	ENST00000408934.1:c.31_32insCACGGCTCTTCATC	2.37:g.240982368_240982369insGATGAAGAGCCGTG	ENSP00000386166:p.Pro11fs	Somatic	161	0		WXS	Illumina GAIIx	Phase_I	153	37	NM_001080835	0	0	0	0	0		Frame_Shift_Ins	INS	ENST00000408934.1	37	CCDS33417.1																																																																																			.		0.574	PRR21-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001080835	
PCDHB5	26167	hgsc.bcm.edu	37	5	140516736	140516737	+	In_Frame_Ins	INS	-	-	TGG			TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr5:140516736_140516737insTGG	ENST00000231134.5	+	1	1937_1938	c.1720_1721insTGG	c.(1720-1722)ctg>cTGGtg	p.575_576insV		NM_015669.2	NP_056484.1	Q9Y5E4	PCDB5_HUMAN	protocadherin beta 5	575	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(12)|kidney(1)|large_intestine(18)|lung(25)|ovary(3)|prostate(6)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	81			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TTGCACCGAGCTGGTGCCCCGG	0.698																																					p.L574delinsLV		.											.	PCDHB5-95	0			c.1720_1721insTGG						.																																			SO:0001652	inframe_insertion	26167	exon1			ACCGAGCTGGTGC	AF152498	CCDS4247.1	5q31	2010-01-26			ENSG00000113209	ENSG00000113209		"""Cadherins / Protocadherins : Clustered"""	8690	other	protocadherin		606331				10380929	Standard	NM_015669		Approved	DKFZp586B0217, PCDH-BETA5	uc003liq.3	Q9Y5E4	OTTHUMG00000129616	ENST00000231134.5:c.1721_1723dupTGG	5.37:g.140516737_140516739dupTGG	ENSP00000231134:p.Val575_Val575dup	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	64	25	NM_015669	0	0	0	0	0	Q549F4|Q9UFU9	In_Frame_Ins	INS	ENST00000231134.5	37	CCDS4247.1																																																																																			.		0.698	PCDHB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251811.1	NM_015669	
RSBN1L	222194	hgsc.bcm.edu;broad.mit.edu	37	7	77326230	77326231	+	In_Frame_Ins	INS	-	-	GCCGCT			TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr7:77326230_77326231insGCCGCT	ENST00000334955.8	+	1	471_472	c.444_445insGCCGCT	c.(445-447)gcc>GCCGCTgcc	p.149_149A>AAA	RSBN1L-AS1_ENST00000440088.1_lincRNA|RSBN1L_ENST00000445288.1_5'Flank	NM_198467.2	NP_940869.2	Q6PCB5	RSBNL_HUMAN	round spermatid basic protein 1-like	149	Poly-Ala.					nucleus (GO:0005634)				central_nervous_system(1)|endometrium(12)|large_intestine(2)|lung(8)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						CCGCCGCCGCCGCCGCTGCCTC	0.703																																					p.A148delinsAAA		.											.	RSBN1L-91	0			c.444_445insGCCGCT						.																																			SO:0001652	inframe_insertion	222194	exon1			CGCCGCCGCCGCT	AK124517	CCDS43607.1	7q21.11	2004-08-11			ENSG00000187257	ENSG00000187257			24765	protein-coding gene	gene with protein product						12477932	Standard	NM_198467		Approved	FLJ42526, FLJ45813, MGC71764	uc010ldt.1	Q6PCB5	OTTHUMG00000155517	ENST00000334955.8:c.445_450dupGCCGCT	7.37:g.77326231_77326236dupGCCGCT	ENSP00000334040:p.AlaAla151dup	Somatic	14	0		WXS	Illumina GAIIx	Phase_I	49	14	NM_198467	0	0	0	0	0	C9K0P1|Q6ZS58|Q6ZVI9|Q86X48	In_Frame_Ins	INS	ENST00000334955.8	37	CCDS43607.1																																																																																			.		0.703	RSBN1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340455.3	NM_198467	
FZD1	8321	hgsc.bcm.edu	37	7	90894459	90894460	+	In_Frame_Ins	INS	-	-	CCG	rs71292991|rs139480179	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr7:90894459_90894460insCCG	ENST00000287934.2	+	1	677_678	c.264_265insCCG	c.(265-267)ccg>CCGccg	p.89_89P>PP		NM_003505.1	NP_003496.1	Q9UP38	FZD1_HUMAN	frizzled class receptor 1	89	Poly-Pro.				autocrine signaling (GO:0035425)|axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in mesenchymal stem cell differentiation (GO:0044338)|canonical Wnt signaling pathway involved in osteoblast differentiation (GO:0044339)|cell-cell signaling (GO:0007267)|epithelial cell differentiation (GO:0030855)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|hard palate development (GO:0060022)|lung alveolus development (GO:0048286)|membranous septum morphogenesis (GO:0003149)|muscular septum morphogenesis (GO:0003150)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron differentiation (GO:0030182)|outflow tract morphogenesis (GO:0003151)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|response to drug (GO:0042493)|vasculature development (GO:0001944)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	frizzled binding (GO:0005109)|G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|receptor binding (GO:0005102)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.Q88_P89insP(2)|p.Q88_P89insA(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24	all_cancers(62;3.1e-10)|all_epithelial(64;1.66e-08)|Breast(17;0.000635)|Lung NSC(181;0.153)|all_lung(186;0.154)|all_hematologic(106;0.215)		STAD - Stomach adenocarcinoma(171;0.0134)			cggggcAGCAACCGCCGCCGCC	0.743														1874	0.374201	0.4047	0.4625	5008	,	,		10872	0.2986		0.4294	False		,,,				2504	0.2914				p.Q88delinsQP		.											.	FZD1-658	3	Insertion - In frame(3)	breast(2)|liver(1)	c.264_265insCCG						.			1606,5,2563		359,2,886,0,3,837						0.6	1.0		dbSNP_134	11	3182,3,4959		703,0,1776,1,1,1591	no	codingComplex	FZD1	NM_003505.1		1062,2,2662,1,4,2428	A1A1,A1A2,A1R,A2A2,A2R,RR		39.1085,38.5961,38.9349				4788,8,7522				SO:0001652	inframe_insertion	8321	exon1			GCAGCAACCGCCG	AB017363	CCDS5620.1	7q21	2014-01-29	2014-01-29		ENSG00000157240	ENSG00000157240		"""GPCR / Class F : Frizzled receptors"""	4038	protein-coding gene	gene with protein product	"""Wnt receptor"", ""frizzled, Drosophila, homolog of, 1"""	603408	"""frizzled (Drosophila) homolog 1"", ""frizzled homolog 1 (Drosophila)"", ""frizzled 1, seven transmembrane spanning receptor"", ""frizzled family receptor 1"""			9813155	Standard	NM_003505		Approved	DKFZp564G072	uc003ula.3	Q9UP38	OTTHUMG00000023046	ENST00000287934.2:c.274_276dupCCG	7.37:g.90894466_90894468dupCCG	ENSP00000287934:p.Pro93dup	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	51	39	NM_003505	0	0	0	0	0	A4D1E8|O94815|Q549T8	In_Frame_Ins	INS	ENST00000287934.2	37	CCDS5620.1																																																																																			-|0.606;CCG|0.394		0.743	FZD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059367.2	NM_003505	
OBSCN	84033	hgsc.bcm.edu	37	1	228504669	228504670	+	Missense_Mutation	DNP	GC	GC	AT	rs61825302|rs11810627	byFrequency	TCGA-OR-A5K6-01A-11D-A29I-10	TCGA-OR-A5K6-10A-01D-A29L-10	GC	GC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	788cf29b-3505-4a07-b8f4-9c4caee33ad9	4da48703-c30a-4b4a-b8ae-9256618f3300	g.chr1:228504669_228504670GC>AT	ENST00000422127.1	+	51	13589_13590	c.13545_13546GC>AT	c.(13543-13548)gcGCgg>gcATgg	p.R4516W	OBSCN_ENST00000284548.11_Missense_Mutation_p.R4516W|OBSCN_ENST00000570156.2_Missense_Mutation_p.R5473W|OBSCN_ENST00000366709.4_Missense_Mutation_p.R1635W|OBSCN_ENST00000366707.4_Missense_Mutation_p.R2150W	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	4516	Ig-like 46.		R -> W (in dbSNP:rs11810627).		apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				TGGCCTCTGCGCGGCTCACCGT	0.733																																					p.R5228W		.											.	OBSCN-403	0			c.C16417T						.																																			SO:0001583	missense	84033	exon62			TCTGCGCGGCTCA	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	Exception_encountered	1.37:g.228504669_228504670delinsAT	ENSP00000409493:p.Arg4516Trp	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	35	0	NM_001271223	0	0	0	0	0	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	DNP	ENST00000422127.1	37	CCDS58065.1																																																																																			C|0.643;T|0.357		0.733	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
