#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
NOL9	79707	hgsc.bcm.edu	37	1	6614391	6614391	+	Missense_Mutation	SNP	A	A	C	rs6693391	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr1:6614391A>C	ENST00000377705.5	-	1	204	c.172T>G	c.(172-174)Tcc>Gcc	p.S58A	TAS1R1_ENST00000328191.4_5'Flank|TAS1R1_ENST00000351136.3_5'Flank|TAS1R1_ENST00000333172.6_5'Flank	NM_024654.4	NP_078930	Q5SY16	NOL9_HUMAN	nucleolar protein 9	58			S -> A (in dbSNP:rs6693391). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		maturation of 5.8S rRNA (GO:0000460)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|polynucleotide 5'-hydroxyl-kinase activity (GO:0051731)|RNA binding (GO:0003723)			central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|skin(2)|urinary_tract(1)	19	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;2.46e-35)|all_epithelial(116;1.41e-22)|all_lung(118;7.59e-07)|Lung NSC(185;4.28e-06)|Colorectal(325;4.52e-05)|Breast(487;0.000353)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.47e-07)|COAD - Colon adenocarcinoma(227;1.47e-05)|Kidney(185;5.27e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000971)|BRCA - Breast invasive adenocarcinoma(365;0.00113)|STAD - Stomach adenocarcinoma(132;0.0017)|READ - Rectum adenocarcinoma(331;0.0649)		TCCACGCCGGACGCCTGGGCT	0.781													C|||	4789	0.95627	0.8722	0.9841	5008	,	,		9026	0.9692		0.995	False		,,,				2504	0.9969				p.S58A		.											.	NOL9-515	0			c.T172G						.	C	ALA/SER	2196,260		975,246,7	2.0	3.0	3.0		172	3.0	0.2	1	dbSNP_116	3	4875,25		2425,25,0	no	missense	NOL9	NM_024654.4	99	3400,271,7	CC,CA,AA		0.5102,10.5863,3.8744	benign	58/703	6614391	7071,285	1228	2450	3678	SO:0001583	missense	79707	exon1			CGCCGGACGCCTG	AK091284	CCDS80.1	1p36.31	2012-05-02			ENSG00000162408	ENSG00000162408			26265	protein-coding gene	gene with protein product	"""polynucleotide 5'-kinase"""					21063389	Standard	NM_024654		Approved	FLJ23323, NET6, Grc3	uc001ans.3	Q5SY16	OTTHUMG00000000904	ENST00000377705.5:c.172T>G	1.37:g.6614391A>C	ENSP00000366934:p.Ser58Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_024654	0	0	0	0	0	Q2NL84|Q4VBY3|Q6P472|Q7L4D6|Q96EE0|Q9H5L4	Missense_Mutation	SNP	ENST00000377705.5	37	CCDS80.1	2092	0.9578754578754579	421	0.8556910569105691	355	0.9806629834254144	562	0.9825174825174825	754	0.9947229551451188	C	0.416	-0.910621	0.02434	0.894137	0.994898	ENSG00000162408	ENST00000377705	T	0.15718	2.4	4.0	3.05	0.35203	.	0.361559	0.20066	N	0.099972	T	0.00012	0.0000	N	0.01576	-0.805	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.37798	-0.9690	9	0.02654	T	1	-12.1681	8.8998	0.35487	0.424:0.576:0.0:0.0	rs6693391;rs56691058	58	Q5SY16	NOL9_HUMAN	A	58	ENSP00000366934:S58A	ENSP00000366934:S58A	S	-	1	0	NOL9	6536978	0.795000	0.28851	0.220000	0.23810	0.044000	0.14063	0.592000	0.23984	0.422000	0.26005	-0.285000	0.09966	TCC	A|0.047;C|0.953		0.781	NOL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002625.1	NM_024654	
PINK1	65018	hgsc.bcm.edu	37	1	20960230	20960230	+	Silent	SNP	C	C	T	rs45540544|rs45630563|rs45530340	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr1:20960230C>T	ENST00000321556.4	+	1	283	c.189C>T	c.(187-189)ctC>ctT	p.L63L		NM_032409.2	NP_115785.1	Q9BXM7	PINK1_HUMAN	PTEN induced putative kinase 1	63					activation of protein kinase B activity (GO:0032148)|cell death (GO:0008219)|cellular response to hypoxia (GO:0071456)|cellular response to toxic substance (GO:0097237)|intracellular signal transduction (GO:0035556)|mitochondrion degradation (GO:0000422)|mitochondrion organization (GO:0007005)|negative regulation of gene expression (GO:0010629)|negative regulation of hydrogen peroxide-induced neuron intrinsic apoptotic signaling pathway (GO:1903384)|negative regulation of JNK cascade (GO:0046329)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of oxidative stress-induced cell death (GO:1903202)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|negative regulation of oxidative stress-induced neuron death (GO:1903204)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|peptidyl-serine autophosphorylation (GO:0036289)|peptidyl-serine phosphorylation (GO:0018105)|phosphorylation (GO:0016310)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of mitochondrial electron transport, NADH to ubiquinone (GO:1902958)|positive regulation of peptidase activity (GO:0010952)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of synaptic transmission, dopaminergic (GO:0032226)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of mitochondrion degradation (GO:1903146)|regulation of protein complex assembly (GO:0043254)|regulation of protein ubiquitination (GO:0031396)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|TORC2 signaling (GO:0038203)|ubiquitin-dependent protein catabolic process (GO:0006511)	astrocyte projection (GO:0097449)|axon (GO:0030424)|cell body (GO:0044297)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of mitochondrial outer membrane (GO:0031307)|Lewy body (GO:0097413)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|C3HC4-type RING finger domain binding (GO:0055131)|calcium-dependent protein kinase activity (GO:0010857)|kinase activity (GO:0016301)|magnesium ion binding (GO:0000287)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)|protein kinase B binding (GO:0043422)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(4)|ovary(2)	14		all_lung(284;2.72e-05)|Lung NSC(340;2.94e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000147)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(152;1.21e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000146)|Kidney(64;0.000182)|GBM - Glioblastoma multiforme(114;0.000497)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(196;0.00308)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		GGCTCGGGCTCCCTAACCGTC	0.791													C|||	644	0.128594	0.053	0.1571	5008	,	,		6081	0.127		0.1938	False		,,,				2504	0.1452				p.L63L	Esophageal Squamous(145;853 1803 8146 34412 35011)	.											.	PINK1-380	0			c.C189T						.	C		165,3267		4,157,1555	3.0	4.0	3.0		189	0.4	0.9	1	dbSNP_127	3	1114,5976		93,928,2524	no	coding-synonymous	PINK1	NM_032409.2		97,1085,4079	TT,TC,CC		15.7123,4.8077,12.1555		63/582	20960230	1279,9243	1716	3545	5261	SO:0001819	synonymous_variant	65018	exon1			CGGGCTCCCTAAC	AB053323	CCDS211.1	1p36.12	2011-07-21			ENSG00000158828	ENSG00000158828		"""Parkinson disease"""	14581	protein-coding gene	gene with protein product		608309	"""Parkinson disease (autosomal recessive) 6"""	PARK6		11494141, 15349860	Standard	NM_032409		Approved		uc001bdm.3	Q9BXM7	OTTHUMG00000002841	ENST00000321556.4:c.189C>T	1.37:g.20960230C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_032409	0	0	0	2	2	Q8N6T9|Q8NBU3|Q96DE4	Silent	SNP	ENST00000321556.4	37	CCDS211.1																																																																																			C|0.868;T|0.132		0.791	PINK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007954.1	NM_032409	
C1QC	714	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	22973845	22973845	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr1:22973845G>C	ENST00000374639.3	+	3	425	c.307G>C	c.(307-309)Ggc>Cgc	p.G103R	C1QC_ENST00000374637.1_Missense_Mutation_p.G103R|C1QC_ENST00000374640.4_Missense_Mutation_p.G103R	NM_001114101.1	NP_001107573.1	P02747	C1QC_HUMAN	complement component 1, q subcomponent, C chain	103	Collagen-like.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|immune response (GO:0006955)|innate immune response (GO:0045087)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of macrophage differentiation (GO:0045650)	blood microparticle (GO:0072562)|collagen trimer (GO:0005581)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	15		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;6.21e-27)|Colorectal(126;1.5e-07)|COAD - Colon adenocarcinoma(152;1.12e-05)|GBM - Glioblastoma multiforme(114;1.61e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000538)|KIRC - Kidney renal clear cell carcinoma(1967;0.00269)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.196)	Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	CGGCCCCATGGGCATCCCTGG	0.637																																					p.G103R	Ovarian(26;671 750 8290 29071 43278)	.											.	C1QC-90	0			c.G307C						.						49.0	55.0	53.0					1																	22973845		2203	4300	6503	SO:0001583	missense	714	exon3			CCCATGGGCATCC	AK057792	CCDS227.1	1p36.11	2014-09-17	2006-02-09	2006-02-09	ENSG00000159189	ENSG00000159189		"""Complement system"""	1245	protein-coding gene	gene with protein product		120575	"""complement component 1, q subcomponent, gamma polypeptide"""	C1QG		1706597	Standard	NM_001114101		Approved		uc001bga.4	P02747	OTTHUMG00000002891	ENST00000374639.3:c.307G>C	1.37:g.22973845G>C	ENSP00000363770:p.Gly103Arg	Somatic	45	1		WXS	Illumina GAIIx	Phase_I	52	5	NM_001114101	1	0	41	42	0	Q7Z502|Q96DL2|Q96H05	Missense_Mutation	SNP	ENST00000374639.3	37	CCDS227.1	.	.	.	.	.	.	.	.	.	.	G	16.32	3.089682	0.55968	.	.	ENSG00000159189	ENST00000374640;ENST00000374639;ENST00000374637	D;D;D	0.99488	-6.0;-6.0;-6.0	4.94	4.94	0.65067	.	0.000000	0.85682	D	0.000000	D	0.99725	0.9893	H	0.97390	3.995	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97181	0.9851	10	0.66056	D	0.02	.	16.7212	0.85410	0.0:0.0:1.0:0.0	.	103	P02747	C1QC_HUMAN	R	103	ENSP00000363771:G103R;ENSP00000363770:G103R;ENSP00000363768:G103R	ENSP00000363768:G103R	G	+	1	0	C1QC	22846432	1.000000	0.71417	0.078000	0.20375	0.064000	0.16182	6.699000	0.74613	2.280000	0.76307	0.561000	0.74099	GGC	.		0.637	C1QC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008083.1	NM_172369	
CSMD2	114784	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	34099087	34099087	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr1:34099087A>G	ENST00000373380.1	-	11	1974	c.1754T>C	c.(1753-1755)gTg>gCg	p.V585A	CSMD2_ENST00000373388.2_5'UTR|CSMD2_ENST00000373381.4_Missense_Mutation_p.V1712A			Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	1672	CUB 4. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				GTGAACCTCCACCACGTCGTT	0.647											OREG0013348	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.V1672A		.											.	CSMD2-103	0			c.T5015C						.						42.0	29.0	33.0					1																	34099087		2161	4233	6394	SO:0001583	missense	114784	exon32			ACCTCCACCACGT	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373380.1:c.1754T>C	1.37:g.34099087A>G	ENSP00000362478:p.Val585Ala	Somatic	153	0	845	WXS	Illumina GAIIx	Phase_I	180	76	NM_052896	0	0	0	0	0	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	ENST00000373380.1	37		.	.	.	.	.	.	.	.	.	.	A	16.39	3.109588	0.56398	.	.	ENSG00000121904	ENST00000373381;ENST00000373380	T;T	0.27104	1.69;1.69	5.47	5.47	0.80525	CUB (5);	0.074945	0.53938	D	0.000059	T	0.45256	0.1333	M	0.86953	2.85	0.80722	D	1	P;B;B	0.36144	0.539;0.153;0.002	P;B;B	0.46299	0.511;0.086;0.052	T	0.41963	-0.9479	10	0.24483	T	0.36	.	14.7289	0.69365	1.0:0.0:0.0:0.0	.	585;1672;1712	Q7Z408-2;Q7Z408;E7EUA6	.;CSMD2_HUMAN;.	A	1712;585	ENSP00000362479:V1712A;ENSP00000362478:V585A	ENSP00000241312:V1672A	V	-	2	0	CSMD2	33871674	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.335000	0.96500	2.061000	0.61500	0.460000	0.39030	GTG	.		0.647	CSMD2-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000030635.4	NM_052896	
KIF2C	11004	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	45227628	45227628	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr1:45227628C>T	ENST00000372224.4	+	17	1837	c.1724C>T	c.(1723-1725)aCt>aTt	p.T575I	KIF2C_ENST00000372222.3_Missense_Mutation_p.T462I|RP11-269F19.2_ENST00000440985.1_RNA|KIF2C_ENST00000372217.1_Missense_Mutation_p.T521I|RP11-269F19.2_ENST00000428791.1_RNA|KIF2C_ENST00000372218.4_Missense_Mutation_p.T534I	NM_006845.3	NP_006836.2	Q99661	KIF2C_HUMAN	kinesin family member 2C	575	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of chromosome segregation (GO:0051983)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|centromeric DNA binding (GO:0019237)|microtubule motor activity (GO:0003777)|microtubule plus-end binding (GO:0051010)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(16)|ovary(1)|skin(1)|urinary_tract(1)	34	Acute lymphoblastic leukemia(166;0.155)					TGTGAATATACTTTAAACACC	0.512																																					p.T575I		.											.	KIF2C-228	0			c.C1724T						.						144.0	131.0	136.0					1																	45227628		2203	4300	6503	SO:0001583	missense	11004	exon17			AATATACTTTAAA	U63743	CCDS512.1, CCDS72774.1	1p34.1	2014-01-21	2003-01-13	2003-01-17	ENSG00000142945	ENSG00000142945		"""Kinesins"""	6393	protein-coding gene	gene with protein product		604538	"""kinesin-like 6 (mitotic centromere-associated kinesin)"""	KNSL6		9434124	Standard	NM_006845		Approved	MCAK, CT139	uc001cmg.4	Q99661	OTTHUMG00000008416	ENST00000372224.4:c.1724C>T	1.37:g.45227628C>T	ENSP00000361298:p.Thr575Ile	Somatic	170	0		WXS	Illumina GAIIx	Phase_I	153	61	NM_006845	0	0	2	8	6	B3ITR9|Q5JR88|Q6ICU1|Q96C18|Q96HB8|Q9BWV8	Missense_Mutation	SNP	ENST00000372224.4	37	CCDS512.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	32|32	5.169350|5.169350	0.94768|0.94768	.|.	.|.	ENSG00000142945|ENSG00000142945	ENST00000423289|ENST00000372224;ENST00000372218;ENST00000372222;ENST00000372217	.|T;T;T;T	.|0.37058	.|1.22;1.22;1.22;1.22	5.52|5.52	5.52|5.52	0.82312|0.82312	.|Kinesin, motor domain (3);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.75421|0.75421	0.3847|0.3847	H|H	0.97564|0.97564	4.03|4.03	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|0.998;1.0;0.998	.|D;D;D	.|0.75484	.|0.976;0.975;0.986	D|D	0.84295|0.84295	0.0502|0.0502	5|10	.|0.87932	.|D	.|0	.|.	19.7926|19.7926	0.96466|0.96466	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|534;521;575	.|B7Z6Q6;Q99661-2;Q99661	.|.;.;KIF2C_HUMAN	F|I	53|575;534;462;521	.|ENSP00000361298:T575I;ENSP00000361292:T534I;ENSP00000361296:T462I;ENSP00000361291:T521I	.|ENSP00000361291:T521I	L|T	+|+	1|2	0|0	KIF2C|KIF2C	45000215|45000215	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	7.758000|7.758000	0.85224|0.85224	2.761000|2.761000	0.94854|0.94854	0.655000|0.655000	0.94253|0.94253	CTT|ACT	.		0.512	KIF2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023180.1	NM_006845	
TCTEX1D4	343521	hgsc.bcm.edu	37	1	45271828	45271828	+	Silent	SNP	T	T	C	rs17885815	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr1:45271828T>C	ENST00000339355.2	-	1	519	c.513A>G	c.(511-513)gtA>gtG	p.V171V	BTBD19_ENST00000409335.2_5'Flank|BTBD19_ENST00000453418.1_5'Flank|TCTEX1D4_ENST00000372200.1_Silent_p.V171V|BTBD19_ENST00000450269.1_5'Flank			Q5JR98	TC1D4_HUMAN	Tctex1 domain containing 4	171						acrosomal vesicle (GO:0001669)|axoneme (GO:0005930)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)	protein phosphatase 1 binding (GO:0008157)			pancreas(1)	1	Acute lymphoblastic leukemia(166;0.155)					CCACACTGCATACCAGCTTGT	0.716													C|||	682	0.136182	0.0764	0.1427	5008	,	,		11465	0.1647		0.1759	False		,,,				2504	0.1421				p.V171V		.											.	TCTEX1D4-91	0			c.A513G						.	C		415,3851		26,363,1744	6.0	9.0	8.0		513	5.5	1.0	1	dbSNP_124	8	1263,7055		105,1053,3001	no	coding-synonymous	TCTEX1D4	NM_001013632.2		131,1416,4745	CC,CT,TT		15.1839,9.7281,13.3344		171/222	45271828	1678,10906	2133	4159	6292	SO:0001819	synonymous_variant	343521	exon2			ACTGCATACCAGC	BC092499	CCDS30699.1	1p34.1	2007-12-17				ENSG00000188396			32315	protein-coding gene	gene with protein product	"""novel Tctex-1 family domain-containing protein"""	611713				12477932	Standard	XM_006710614		Approved		uc001cmp.3	Q5JR98		ENST00000339355.2:c.513A>G	1.37:g.45271828T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	10	NM_001013632	0	0	0	0	0		Silent	SNP	ENST00000339355.2	37	CCDS30699.1																																																																																			T|0.859;C|0.141		0.716	TCTEX1D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023733.1	NM_001013632	
CYP4A22	284541	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	47611785	47611785	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr1:47611785C>A	ENST00000371891.3	+	11	1355	c.1324C>A	c.(1324-1326)Caa>Aaa	p.Q442K	CYP4A22_ENST00000485117.1_3'UTR|CYP4A22_ENST00000371890.3_Missense_Mutation_p.Q344K|CYP4A22_ENST00000294337.3_Missense_Mutation_p.Q442K|CYP4A22-AS1_ENST00000444042.2_lincRNA	NM_001010969.2	NP_001010969.2	Q5TCH4	CP4AM_HUMAN	cytochrome P450, family 4, subfamily A, polypeptide 22	442						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	alkane 1-monooxygenase activity (GO:0018685)|arachidonic acid omega-hydroxylase activity (GO:0052869)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						GGGTTCTGCTCAACACAGCCA	0.537																																					p.Q442K	Pancreas(88;1240 1470 2099 14214 37557)	.											.	CYP4A22-139	0			c.C1324A						.						301.0	288.0	292.0					1																	47611785		2203	4300	6503	SO:0001583	missense	284541	exon11			TCTGCTCAACACA		CCDS30707.1	1p33	2007-12-14			ENSG00000162365	ENSG00000162365		"""Cytochrome P450s"""	20575	protein-coding gene	gene with protein product		615341					Standard	XM_005270768		Approved		uc001cqv.1	Q5TCH4	OTTHUMG00000007845	ENST00000371891.3:c.1324C>A	1.37:g.47611785C>A	ENSP00000360958:p.Gln442Lys	Somatic	270	0		WXS	Illumina GAIIx	Phase_I	286	36	NM_001010969	0	0	0	0	0	Q5TCH3|Q6JXK7|Q6JXK8|Q9NRM4	Missense_Mutation	SNP	ENST00000371891.3	37	CCDS30707.1	.	.	.	.	.	.	.	.	.	.	c	11.83	1.755271	0.31046	.	.	ENSG00000162365	ENST00000371890;ENST00000371891;ENST00000294337	T;T;T	0.65732	-0.17;-0.17;-0.17	1.59	1.59	0.23543	.	0.351880	0.31051	N	0.008353	T	0.40932	0.1137	N	0.04132	-0.27	0.09310	N	1	B;B	0.32467	0.144;0.372	B;B	0.40009	0.316;0.152	T	0.43294	-0.9400	10	0.87932	D	0	.	8.0539	0.30593	0.0:0.7454:0.2545:0.0	.	344;442	Q5TCH5;Q5TCH4	.;CP4AM_HUMAN	K	344;442;442	ENSP00000360957:Q344K;ENSP00000360958:Q442K;ENSP00000294337:Q442K	ENSP00000294337:Q442K	Q	+	1	0	CYP4A22	47384372	0.000000	0.05858	0.009000	0.14445	0.694000	0.40290	-0.332000	0.07904	1.190000	0.43042	0.194000	0.17425	CAA	.		0.537	CYP4A22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021635.1	XM_208213	
RSBN1	54665	hgsc.bcm.edu	37	1	114354654	114354654	+	Silent	SNP	T	T	C	rs3195954	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr1:114354654T>C	ENST00000261441.5	-	1	444	c.381A>G	c.(379-381)ccA>ccG	p.P127P	RP5-1073O3.2_ENST00000429398.1_RNA|RP5-1073O3.2_ENST00000418238.1_RNA	NM_018364.3	NP_060834.2	Q5VWQ0	RSBN1_HUMAN	round spermatid basic protein 1	127	Pro-rich.					nucleus (GO:0005634)				breast(1)|endometrium(2)|large_intestine(4)|lung(16)|ovary(1)|prostate(3)|urinary_tract(2)	29	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CTGCATTCGTTGGCGGCAGCG	0.746													T|||	610	0.121805	0.0045	0.1311	5008	,	,		11529	0.2282		0.1869	False		,,,				2504	0.0971				p.P127P		.											.	RSBN1-91	0			c.A381G						.	T		149,4053		2,145,1954	13.0	24.0	21.0		381	-4.9	0.5	1	dbSNP_105	21	1412,6854		115,1182,2836	no	coding-synonymous	RSBN1	NM_018364.3		117,1327,4790	CC,CT,TT		17.082,3.5459,12.5201		127/803	114354654	1561,10907	2101	4133	6234	SO:0001819	synonymous_variant	54665	exon1			ATTCGTTGGCGGC	AK002082	CCDS862.1	1p13.1	2008-02-05			ENSG00000081019	ENSG00000081019			25642	protein-coding gene	gene with protein product		615858				12477932	Standard	NM_018364		Approved	FLJ11220, ROSBIN	uc001edq.3	Q5VWQ0	OTTHUMG00000011938	ENST00000261441.5:c.381A>G	1.37:g.114354654T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	16	15	NM_018364	0	0	0	1	1	A8K937|Q6AI21|Q8TC33|Q9HA80|Q9NUP6	Silent	SNP	ENST00000261441.5	37	CCDS862.1																																																																																			T|0.861;C|0.139		0.746	RSBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033022.2	NM_018364	
HMGCS2	3158	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	120295286	120295286	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr1:120295286C>G	ENST00000369406.3	-	8	1355	c.1306G>C	c.(1306-1308)Gac>Cac	p.D436H	HMGCS2_ENST00000544913.2_Missense_Mutation_p.D394H|HMGCS2_ENST00000476640.1_5'Flank	NM_005518.3	NP_005509.1	P54868	HMCS2_HUMAN	3-hydroxy-3-methylglutaryl-CoA synthase 2 (mitochondrial)	436					cellular ketone body metabolic process (GO:0046950)|cellular lipid metabolic process (GO:0044255)|cholesterol biosynthetic process (GO:0006695)|isoprenoid biosynthetic process (GO:0008299)|ketone body biosynthetic process (GO:0046951)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	hydroxymethylglutaryl-CoA synthase activity (GO:0004421)			NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(1)|lung(13)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	28	all_cancers(5;6.38e-10)|all_epithelial(5;1.1e-10)|Melanoma(3;1.93e-05)|Breast(55;0.218)|all_neural(166;0.219)	all_lung(203;1.29e-06)|Lung NSC(69;9.35e-06)|all_epithelial(167;0.00124)		Lung(183;0.0112)|LUSC - Lung squamous cell carcinoma(189;0.0595)		ACCAACTTGTCCAGGGGAGAG	0.473																																					p.D436H		.											.	HMGCS2-92	0			c.G1306C						.						117.0	118.0	118.0					1																	120295286		2203	4300	6503	SO:0001583	missense	3158	exon8			ACTTGTCCAGGGG	BC044217	CCDS905.1, CCDS53353.1	1p13-p12	2014-09-17	2010-04-30		ENSG00000134240	ENSG00000134240			5008	protein-coding gene	gene with protein product		600234	"""3-hydroxy-3-methylglutaryl-Coenzyme A synthase 2 (mitochondrial)"""			7851882, 7893153	Standard	NM_005518		Approved		uc001eid.3	P54868	OTTHUMG00000012101	ENST00000369406.3:c.1306G>C	1.37:g.120295286C>G	ENSP00000358414:p.Asp436His	Somatic	198	0		WXS	Illumina GAIIx	Phase_I	178	24	NM_005518	0	0	0	0	0	B7Z8R3|D3Y5K6|Q5SZU2|Q6IBF4	Missense_Mutation	SNP	ENST00000369406.3	37	CCDS905.1	.	.	.	.	.	.	.	.	.	.	C	15.12	2.739562	0.49045	.	.	ENSG00000134240	ENST00000369406;ENST00000544913	T;T	0.78246	-1.16;-1.16	5.61	5.61	0.85477	Hydroxymethylglutaryl-coenzyme A synthase C-terminal (1);Thiolase-like (1);	0.669267	0.14762	N	0.299918	T	0.63628	0.2527	L	0.35854	1.095	0.53005	D	0.999968	B;B	0.14012	0.003;0.009	B;B	0.17722	0.015;0.019	T	0.57625	-0.7779	10	0.49607	T	0.09	-7.4619	18.572	0.91138	0.0:1.0:0.0:0.0	.	394;436	B7Z8R3;P54868	.;HMCS2_HUMAN	H	436;394	ENSP00000358414:D436H;ENSP00000439495:D394H	ENSP00000358414:D436H	D	-	1	0	HMGCS2	120096809	1.000000	0.71417	0.993000	0.49108	0.615000	0.37417	6.810000	0.75216	2.791000	0.96007	0.655000	0.94253	GAC	.		0.473	HMGCS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033469.2	NM_005518	
THEM4	117145	hgsc.bcm.edu	37	1	151881885	151881885	+	Missense_Mutation	SNP	A	A	C	rs3748805	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr1:151881885A>C	ENST00000368814.3	-	1	399	c.50T>G	c.(49-51)cTg>cGg	p.L17R	THEM4_ENST00000489410.1_Missense_Mutation_p.L17R	NM_053055.4	NP_444283.2	Q5T1C6	THEM4_HUMAN	thioesterase superfamily member 4	17			L -> R (in dbSNP:rs3748805). {ECO:0000269|PubMed:11598301, ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:17013611, ECO:0000269|Ref.4}.		epidermal growth factor receptor signaling pathway (GO:0007173)|fatty acid metabolic process (GO:0006631)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|protein kinase B signaling (GO:0043491)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)	cell projection (GO:0042995)|cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	palmitoyl-CoA hydrolase activity (GO:0016290)			endometrium(1)|large_intestine(4)|lung(3)|urinary_tract(1)	9	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			TACTGGCGGCAGGCACAGAGC	0.741													C|||	4622	0.922923	0.8986	0.9092	5008	,	,		8223	0.9494		0.9155	False		,,,				2504	0.9458				p.L17R		.											.	THEM4-522	0			c.T50G						.						1.0	1.0	1.0					1																	151881885		1068	2473	3541	SO:0001583	missense	117145	exon1			GGCGGCAGGCACA	AJ313515	CCDS1006.1	1q21.3	2008-02-05			ENSG00000159445	ENSG00000159445			17947	protein-coding gene	gene with protein product	"""C-terminal modulator protein"""	606388				11598301	Standard	NM_053055		Approved	CTMP	uc001ezj.2	Q5T1C6	OTTHUMG00000013049	ENST00000368814.3:c.50T>G	1.37:g.151881885A>C	ENSP00000357804:p.Leu17Arg	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_053055	0	0	0	7	7	B2RBX2|Q96KR2	Missense_Mutation	SNP	ENST00000368814.3	37	CCDS1006.1	2023	0.9262820512820513	453	0.9207317073170732	320	0.8839779005524862	545	0.9527972027972028	705	0.9300791556728232	C	0.562	-0.845033	0.02671	.	.	ENSG00000159445	ENST00000368814;ENST00000489410	T;T	0.25579	2.45;1.79	1.92	-0.278	0.12894	.	16.336300	0.02935	N	0.139768	T	0.02455	0.0075	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.21143	-1.0254	9	0.10111	T	0.7	0.3431	0.4569	0.00510	0.2457:0.3181:0.2427:0.1934	rs3748805;rs17855960	17	Q5T1C6	THEM4_HUMAN	R	17	ENSP00000357804:L17R;ENSP00000433304:L17R	ENSP00000357804:L17R	L	-	2	0	THEM4	150148509	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.350000	0.07721	-0.432000	0.07297	-0.358000	0.07595	CTG	T|0.073;G|0.921		0.741	THEM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036615.1	NM_053055	
LOR	4014	hgsc.bcm.edu	37	1	153233578	153233578	+	Silent	SNP	C	C	T	rs1143389	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr1:153233578C>T	ENST00000368742.3	+	2	210	c.153C>T	c.(151-153)tgC>tgT	p.C51C		NM_000427.2	NP_000418.2	P23490	LORI_HUMAN	loricrin	51					keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein binding, bridging (GO:0030674)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			lung(2)	2	all_lung(78;3.35e-32)|Lung NSC(65;1.22e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			gttctggctgcggctactccg	0.796													C|||	1003	0.20028	0.034	0.147	5008	,	,		4886	0.3194		0.1412	False		,,,				2504	0.4008				p.C51C		.											.	LOR-90	0			c.C153T						.	C		83,2085		3,77,1004	2.0	2.0	2.0		153	-7.2	0.0	1	dbSNP_86	2	743,3969		44,655,1657	no	coding-synonymous	LOR	NM_000427.2		47,732,2661	TT,TC,CC		15.7683,3.8284,12.0058		51/313	153233578	826,6054	1084	2356	3440	SO:0001819	synonymous_variant	4014	exon2			TGGCTGCGGCTAC	M61120	CCDS30870.1	1q21	2008-02-05			ENSG00000203782	ENSG00000203782			6663	protein-coding gene	gene with protein product		152445				2007607, 1355480	Standard	NM_000427		Approved		uc001fbm.3	P23490	OTTHUMG00000013938	ENST00000368742.3:c.153C>T	1.37:g.153233578C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_000427	0	0	0	0	0	Q5T869|Q5XKF8	Silent	SNP	ENST00000368742.3	37	CCDS30870.1																																																																																			C|0.818;T|0.182		0.796	LOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039107.1	NM_000427	
LOR	4014	hgsc.bcm.edu	37	1	153233701	153233701	+	Silent	SNP	A	A	C	rs1143390	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr1:153233701A>C	ENST00000368742.3	+	2	333	c.276A>C	c.(274-276)ggA>ggC	p.G92G		NM_000427.2	NP_000418.2	P23490	LORI_HUMAN	loricrin	92					keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein binding, bridging (GO:0030674)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			lung(2)	2	all_lung(78;3.35e-32)|Lung NSC(65;1.22e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			AGTACTCcggaggcggcggct	0.786													a|||	1994	0.398163	0.416	0.3703	5008	,	,		4732	0.3562		0.3797	False		,,,				2504	0.456				p.G92G		.											.	LOR-90	0			c.A276C						.						1.0	1.0	1.0					1																	153233701		392	1110	1502	SO:0001819	synonymous_variant	4014	exon2			CTCCGGAGGCGGC	M61120	CCDS30870.1	1q21	2008-02-05			ENSG00000203782	ENSG00000203782			6663	protein-coding gene	gene with protein product		152445				2007607, 1355480	Standard	NM_000427		Approved		uc001fbm.3	P23490	OTTHUMG00000013938	ENST00000368742.3:c.276A>C	1.37:g.153233701A>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_000427	0	0	0	0	0	Q5T869|Q5XKF8	Silent	SNP	ENST00000368742.3	37	CCDS30870.1																																																																																			A|0.594;C|0.406		0.786	LOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039107.1	NM_000427	
KCNN3	3782	hgsc.bcm.edu	37	1	154842252	154842252	+	Silent	SNP	A	A	C			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr1:154842252A>C	ENST00000271915.4	-	1	504	c.189T>G	c.(187-189)ccT>ccG	p.P63P	KCNN3_ENST00000358505.2_5'Flank	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	63	Gln-rich.|Pro-rich.				potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	gaagctgcggaggctgaggct	0.697																																					p.P63P		.											.	KCNN3-91	0			c.T189G						.						6.0	4.0	5.0					1																	154842252		1986	3918	5904	SO:0001819	synonymous_variant	3782	exon1			CTGCGGAGGCTGA	AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.189T>G	1.37:g.154842252A>C		Somatic	3	0		WXS	Illumina GAIIx	Phase_I	64	7	NM_001204087	0	0	0	0	0	B1ANX0|O43517|Q86VF9|Q8WXG7	Silent	SNP	ENST00000271915.4	37	CCDS30880.1																																																																																			.		0.697	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090688.3	NM_002249	
HCN3	57657	broad.mit.edu	37	1	155257913	155257913	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr1:155257913G>T	ENST00000368358.3	+	8	1992	c.1984G>T	c.(1984-1986)Gct>Tct	p.A662S	HCN3_ENST00000496230.1_3'UTR	NM_020897.2	NP_065948.1	Q9P1Z3	HCN3_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 3	662					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			GCCCGTCCGAGCTGGCCCATG	0.726																																					p.A662S		.											.	HCN3-154	0			c.G1984T						.						15.0	15.0	15.0					1																	155257913		2199	4293	6492	SO:0001583	missense	57657	exon8			GTCCGAGCTGGCC	AB040968	CCDS1108.1	1q21.2	2011-07-05			ENSG00000143630	ENSG00000143630		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	19183	protein-coding gene	gene with protein product		609973				16382102	Standard	NM_020897		Approved	KIAA1535	uc001fjz.2	Q9P1Z3	OTTHUMG00000035872	ENST00000368358.3:c.1984G>T	1.37:g.155257913G>T	ENSP00000357342:p.Ala662Ser	Somatic	23	1		WXS	Illumina GAIIx	Phase_I	114	8	NM_020897	0	0	4	4	0	D3DV90|Q4VX12|Q8N6W6|Q9BWQ2	Missense_Mutation	SNP	ENST00000368358.3	37	CCDS1108.1	.	.	.	.	.	.	.	.	.	.	G	13.38	2.221072	0.39201	.	.	ENSG00000143630	ENST00000368358	D	0.98075	-4.7	4.91	4.91	0.64330	.	0.272209	0.26143	N	0.026085	D	0.88130	0.6354	N	0.24115	0.695	0.26172	N	0.979844	B;B	0.15473	0.002;0.013	B;B	0.08055	0.001;0.003	T	0.72283	-0.4339	10	0.05525	T	0.97	.	13.7751	0.63048	0.0:0.0:1.0:0.0	.	357;662	B7Z5R8;Q9P1Z3	.;HCN3_HUMAN	S	662	ENSP00000357342:A662S	ENSP00000357342:A662S	A	+	1	0	HCN3	153524537	0.991000	0.36638	0.998000	0.56505	0.814000	0.46013	2.484000	0.45242	2.708000	0.92522	0.557000	0.71058	GCT	.		0.726	HCN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087388.1	NM_020897	
CCT3	7203	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	156303393	156303393	+	Silent	SNP	A	A	T			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr1:156303393A>T	ENST00000295688.3	-	5	529	c.249T>A	c.(247-249)atT>atA	p.I83I	CCT3_ENST00000368261.3_Silent_p.I38I|CCT3_ENST00000368256.3_5'UTR|CCT3_ENST00000368259.2_Silent_p.I45I|CCT3_ENST00000472765.2_Silent_p.I38I	NM_005998.4	NP_005989.3	P49368	TCPG_HUMAN	chaperonin containing TCP1, subunit 3 (gamma)	83					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	cell body (GO:0044297)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			endometrium(4)|large_intestine(1)|liver(1)|lung(11)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	22	Hepatocellular(266;0.158)					GGGTCCGGCTAATTTCGATCA	0.413																																					p.I83I		.											.	CCT3-92	0			c.T249A						.						132.0	133.0	132.0					1																	156303393		2203	4300	6503	SO:0001819	synonymous_variant	7203	exon5			CCGGCTAATTTCG	BC008019	CCDS1140.2, CCDS30888.1	1q23	2011-09-02			ENSG00000163468	ENSG00000163468		"""Heat Shock Proteins / Chaperonins"""	1616	protein-coding gene	gene with protein product		600114		TRIC5		8110840	Standard	NM_005998		Approved	Cctg	uc001fol.2	P49368	OTTHUMG00000024061	ENST00000295688.3:c.249T>A	1.37:g.156303393A>T		Somatic	50	0		WXS	Illumina GAIIx	Phase_I	85	26	NM_005998	0	1	338	433	94	A6NE14|Q5SZY1|Q9BR64	Silent	SNP	ENST00000295688.3	37	CCDS1140.2																																																																																			.		0.413	CCT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060602.3	NM_005998	
OLFML2B	25903	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	161954657	161954657	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr1:161954657C>T	ENST00000294794.3	-	7	2011	c.1588G>A	c.(1588-1590)Gta>Ata	p.V530I	OLFML2B_ENST00000367938.1_Missense_Mutation_p.V13I|OLFML2B_ENST00000367940.2_Missense_Mutation_p.V531I	NM_015441.1	NP_056256.1	Q68BL8	OLM2B_HUMAN	olfactomedin-like 2B	530	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				extracellular matrix organization (GO:0030198)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)	p.V530I(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(22)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	48	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.0172)			TAGTTGGTTACGTAAATCCGC	0.532																																					p.V530I		.											.	OLFML2B-69	1	Substitution - Missense(1)	large_intestine(1)	c.G1588A						.						273.0	248.0	256.0					1																	161954657		2203	4300	6503	SO:0001583	missense	25903	exon7			TGGTTACGTAAAT	BX648975	CCDS1236.1, CCDS72966.1	1q23.1	2008-02-05			ENSG00000162745	ENSG00000162745			24558	protein-coding gene	gene with protein product							Standard	XM_005245075		Approved	DKFZP586L151	uc001gbu.3	Q68BL8	OTTHUMG00000024047	ENST00000294794.3:c.1588G>A	1.37:g.161954657C>T	ENSP00000294794:p.Val530Ile	Somatic	298	0		WXS	Illumina GAIIx	Phase_I	394	88	NM_015441	0	0	3	3	0	B7ZA39|Q5VU96|Q6NX46|Q86X11|Q9Y3X6	Missense_Mutation	SNP	ENST00000294794.3	37	CCDS1236.1	.	.	.	.	.	.	.	.	.	.	C	27.9	4.869681	0.91587	.	.	ENSG00000162745	ENST00000294794;ENST00000367940;ENST00000367938	D;D;D	0.91792	-2.91;-2.91;-2.91	4.31	4.31	0.51392	Olfactomedin-like (3);	.	.	.	.	D	0.93245	0.7848	M	0.71581	2.175	0.39480	D	0.967866	D;P	0.59767	0.986;0.891	P;P	0.59012	0.85;0.466	D	0.93426	0.6781	8	0.51188	T	0.08	.	14.3441	0.66649	0.0:1.0:0.0:0.0	.	531;530	F2Z3N3;Q68BL8	.;OLM2B_HUMAN	I	530;531;13	ENSP00000294794:V530I;ENSP00000356917:V531I;ENSP00000356915:V13I	ENSP00000294794:V530I	V	-	1	0	OLFML2B	160221281	1.000000	0.71417	0.679000	0.29978	0.979000	0.70002	7.510000	0.81708	2.232000	0.73038	0.561000	0.74099	GTA	.		0.532	OLFML2B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000060552.2	NM_015441	
SELL	6402	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	169672445	169672445	+	Silent	SNP	G	G	C			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr1:169672445G>C	ENST00000236147.4	-	6	1102	c.942C>G	c.(940-942)acC>acG	p.T314T	SELL_ENST00000463108.1_5'UTR|C1orf112_ENST00000498289.1_Intron	NM_000655.4	NP_000646.2	P14151	LYAM1_HUMAN	selectin L	301	Sushi 2. {ECO:0000255|PROSITE- ProRule:PRU00302}.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)|regulation of immune response (GO:0050776)|response to ATP (GO:0033198)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|glycosphingolipid binding (GO:0043208)|heparin binding (GO:0008201)|protease binding (GO:0002020)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(3)|lung(5)|urinary_tract(1)	15	all_hematologic(923;0.208)					ATTCACAAATGGTTTTCTTCT	0.428																																					p.T314T		.											.	SELL-90	0			c.C942G						.						99.0	90.0	93.0					1																	169672445		1895	4122	6017	SO:0001819	synonymous_variant	6402	exon6			ACAAATGGTTTTC	M25280	CCDS53427.1	1q23-q25	2008-07-31	2008-07-31		ENSG00000188404	ENSG00000188404		"""CD molecules"""	10720	protein-coding gene	gene with protein product		153240	"""lymphocyte adhesion molecule 1"""	LYAM1, LNHR		2664786, 1375831	Standard	NR_029467		Approved	LSEL, LAM1, LAM-1, hLHRc, Leu-8, Lyam-1, PLNHR, CD62L	uc001ggk.3	P14151	OTTHUMG00000034809	ENST00000236147.4:c.942C>G	1.37:g.169672445G>C		Somatic	144	0		WXS	Illumina GAIIx	Phase_I	269	61	NM_000655	0	0	0	0	0	B2R6Q8|P15023|Q9UJ43	Silent	SNP	ENST00000236147.4	37	CCDS53427.1																																																																																			.		0.428	SELL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084233.1	NM_000655	
CEP350	9857	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	179983496	179983496	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr1:179983496G>C	ENST00000367607.3	+	10	2326	c.1908G>C	c.(1906-1908)caG>caC	p.Q636H		NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	636					microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						ACCGGAAGCAGAAGGAAGCCT	0.423																																					p.Q636H		.											.	CEP350-26	0			c.G1908C						.						60.0	57.0	58.0					1																	179983496		2203	4299	6502	SO:0001583	missense	9857	exon10			GAAGCAGAAGGAA	AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.1908G>C	1.37:g.179983496G>C	ENSP00000356579:p.Gln636His	Somatic	139	0		WXS	Illumina GAIIx	Phase_I	228	49	NM_014810	0	0	3	4	1	O75068|Q8TDK3|Q8WY20	Missense_Mutation	SNP	ENST00000367607.3	37	CCDS1336.1	.	.	.	.	.	.	.	.	.	.	G	17.73	3.461700	0.63513	.	.	ENSG00000135837	ENST00000367607	D	0.90620	-2.7	5.44	4.53	0.55603	.	0.000000	0.46442	D	0.000282	D	0.91399	0.7286	L	0.34521	1.04	0.46874	D	0.999232	D;D	0.71674	0.996;0.998	D;D	0.79108	0.976;0.992	D	0.90106	0.4188	9	.	.	.	.	11.9356	0.52872	0.1454:0.0:0.8546:0.0	.	636;636	E7EU22;Q5VT06	.;CE350_HUMAN	H	636	ENSP00000356579:Q636H	.	Q	+	3	2	CEP350	178250119	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	3.444000	0.52914	1.435000	0.47434	0.650000	0.86243	CAG	.		0.423	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085315.2	NM_014810	
PTGS2	5743	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	186646810	186646810	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr1:186646810G>A	ENST00000367468.5	-	5	746	c.610C>T	c.(610-612)Cca>Tca	p.P204S	PTGS2_ENST00000490885.2_5'UTR|RP5-973M2.2_ENST00000608917.1_lincRNA	NM_000963.2	NP_000954.1	P35354	PGH2_HUMAN	prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)	204					anagen (GO:0042640)|angiogenesis (GO:0001525)|arachidonic acid metabolic process (GO:0019369)|bone mineralization (GO:0030282)|brown fat cell differentiation (GO:0050873)|cellular component movement (GO:0006928)|cellular response to ATP (GO:0071318)|cellular response to hypoxia (GO:0071456)|cellular response to mechanical stimulus (GO:0071260)|cellular response to UV (GO:0034644)|cyclooxygenase pathway (GO:0019371)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|inflammatory response (GO:0006954)|learning (GO:0007612)|lipoxygenase pathway (GO:0019372)|maintenance of blood-brain barrier (GO:0035633)|memory (GO:0007613)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of smooth muscle contraction (GO:0045986)|negative regulation of synaptic transmission, dopaminergic (GO:0032227)|ovulation (GO:0030728)|positive regulation of apoptotic process (GO:0043065)|positive regulation of brown fat cell differentiation (GO:0090336)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|positive regulation of fever generation (GO:0031622)|positive regulation of fibroblast growth factor production (GO:0090271)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of platelet-derived growth factor production (GO:0090362)|positive regulation of prostaglandin biosynthetic process (GO:0031394)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of synaptic plasticity (GO:0031915)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transforming growth factor beta production (GO:0071636)|positive regulation of vasoconstriction (GO:0045907)|positive regulation vascular endothelial growth factor production (GO:0010575)|prostaglandin biosynthetic process (GO:0001516)|prostaglandin metabolic process (GO:0006693)|regulation of blood pressure (GO:0008217)|regulation of inflammatory response (GO:0050727)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to fatty acid (GO:0070542)|response to fructose (GO:0009750)|response to glucocorticoid (GO:0051384)|response to lipopolysaccharide (GO:0032496)|response to lithium ion (GO:0010226)|response to manganese ion (GO:0010042)|response to oxidative stress (GO:0006979)|response to tumor necrosis factor (GO:0034612)|response to vitamin D (GO:0033280)|sensory perception of pain (GO:0019233)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|neuron projection (GO:0043005)|nucleus (GO:0005634)|protein complex (GO:0043234)	arachidonate 15-lipoxygenase activity (GO:0050473)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|lipid binding (GO:0008289)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)|prostaglandin-endoperoxide synthase activity (GO:0004666)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	27					Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Aldesleukin(DB00041)|Aminosalicylic Acid(DB00233)|Antipyrine(DB01435)|Antrafenine(DB01419)|Balsalazide(DB01014)|Bromfenac(DB00963)|Bumetanide(DB00887)|Carprofen(DB00821)|Celecoxib(DB00482)|Chlorphenesin(DB00856)|Cisplatin(DB00515)|Clodronate(DB00720)|Dapsone(DB00250)|Desmopressin(DB00035)|Diclofenac(DB00586)|Diflunisal(DB00861)|Dihomo-gamma-linolenic acid(DB00154)|Drospirenone(DB01395)|Etanercept(DB00005)|Etodolac(DB00749)|Etoposide(DB00773)|Etoricoxib(DB01628)|Fenoprofen(DB00573)|Flurbiprofen(DB00712)|Ginseng(DB01404)|Ibuprofen(DB01050)|Icosapent(DB00159)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Ketorolac(DB00465)|Lenalidomide(DB00480)|Lornoxicam(DB06725)|Lumiracoxib(DB01283)|Magnesium salicylate(DB01397)|Meclofenamic acid(DB00939)|Mefenamic acid(DB00784)|Meloxicam(DB00814)|Mesalazine(DB00244)|Nabumetone(DB00461)|Naproxen(DB00788)|Nepafenac(DB06802)|Niflumic Acid(DB04552)|Nonoxynol-9(DB06804)|Oxaprozin(DB00991)|Phenylbutazone(DB00812)|Piroxicam(DB00554)|Pomalidomide(DB08910)|Risedronate(DB00884)|Salicylate-sodium(DB01398)|Salicylic acid(DB00936)|Salsalate(DB01399)|Sulfasalazine(DB00795)|Sulindac(DB00605)|Suprofen(DB00870)|Tafluprost(DB08819)|Tenoxicam(DB00469)|Tetrahydrobiopterin(DB00360)|Thalidomide(DB01041)|Tiaprofenic acid(DB01600)|Tolmetin(DB00500)|Triamcinolone(DB00620)|Trisalicylate-choline(DB01401)	GTGAAAGCTGGCCCTCGCTTA	0.428																																					p.P204S		.											.	PTGS2-227	0			c.C610T						.						107.0	113.0	111.0					1																	186646810		2203	4300	6503	SO:0001583	missense	5743	exon5			AAGCTGGCCCTCG	D28235	CCDS1371.1	1q25.2-q25.3	2008-02-05			ENSG00000073756	ENSG00000073756	1.14.99.1		9605	protein-coding gene	gene with protein product		600262				1380156	Standard	NM_000963		Approved	COX2	uc001gsb.3	P35354	OTTHUMG00000035473	ENST00000367468.5:c.610C>T	1.37:g.186646810G>A	ENSP00000356438:p.Pro204Ser	Somatic	82	0		WXS	Illumina GAIIx	Phase_I	189	59	NM_000963	0	0	0	0	0	A8K802|Q16876	Missense_Mutation	SNP	ENST00000367468.5	37	CCDS1371.1	.	.	.	.	.	.	.	.	.	.	G	18.25	3.582673	0.65992	.	.	ENSG00000073756	ENST00000367468	T	0.71103	-0.54	5.8	5.8	0.92144	.	0.048742	0.85682	D	0.000000	D	0.84786	0.5549	M	0.85945	2.785	0.80722	D	1	D;B	0.71674	0.998;0.305	D;B	0.66979	0.948;0.111	D	0.86205	0.1621	10	0.59425	D	0.04	-14.5745	15.5204	0.75862	0.0:0.1376:0.8624:0.0	.	204;204	Q8IZA9;P35354	.;PGH2_HUMAN	S	204	ENSP00000356438:P204S	ENSP00000356438:P204S	P	-	1	0	PTGS2	184913433	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.323000	0.72891	2.735000	0.93741	0.557000	0.71058	CCA	.		0.428	PTGS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086157.2	NM_000963	
PTPRC	5788	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	198711467	198711467	+	Silent	SNP	C	C	A			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr1:198711467C>A	ENST00000367376.2	+	25	2833	c.2662C>A	c.(2662-2664)Cga>Aga	p.R888R	PTPRC_ENST00000442510.2_Silent_p.R890R|PTPRC_ENST00000594404.1_Silent_p.R727R|PTPRC_ENST00000352140.3_Silent_p.R840R|PTPRC_ENST00000348564.6_Silent_p.R729R	NM_002838.4	NP_002829.3	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	888	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				axon guidance (GO:0007411)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|bone marrow development (GO:0048539)|cell cycle phase transition (GO:0044770)|cell surface receptor signaling pathway (GO:0007166)|defense response to virus (GO:0051607)|dephosphorylation (GO:0016311)|hematopoietic progenitor cell differentiation (GO:0002244)|immunoglobulin biosynthetic process (GO:0002378)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of antigen receptor-mediated signaling pathway (GO:0050857)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of hematopoietic stem cell migration (GO:2000473)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of T cell proliferation (GO:0042102)|protein dephosphorylation (GO:0006470)|regulation of cell cycle (GO:0051726)|release of sequestered calcium ion into cytosol (GO:0051209)|stem cell development (GO:0048864)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(7)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(22)|lung(41)|ovary(4)|pancreas(2)|prostate(1)|skin(13)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	111						CAAGCTAAGGCGACAGAGATG	0.408																																					p.R890R		.											.	PTPRC-295	0			c.C2668A						.						224.0	214.0	218.0					1																	198711467		2203	4300	6503	SO:0001819	synonymous_variant	5788	exon25			CTAAGGCGACAGA	Y00062	CCDS1397.1, CCDS1398.1, CCDS44291.1, CCDS1397.2, CCDS1398.2, CCDS44291.2	1q31-q32	2014-09-17			ENSG00000081237	ENSG00000081237		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9666	protein-coding gene	gene with protein product		151460		CD45		2169617	Standard	NM_001267798		Approved	LCA, T200, GP180	uc001gur.2	P08575	OTTHUMG00000035702	ENST00000367376.2:c.2662C>A	1.37:g.198711467C>A		Somatic	232	0		WXS	Illumina GAIIx	Phase_I	351	76	NM_002838	0	0	0	0	0	A8K7W6|Q16614|Q9H0Y6	Silent	SNP	ENST00000367376.2	37																																																																																				.		0.408	PTPRC-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding			
TRAF3IP3	80342	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	209948701	209948701	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr1:209948701C>A	ENST00000367024.1	+	10	1298	c.782C>A	c.(781-783)tCc>tAc	p.S261Y	TRAF3IP3_ENST00000367023.1_5'UTR|TRAF3IP3_ENST00000367026.3_Missense_Mutation_p.S241Y|TRAF3IP3_ENST00000477431.1_5'UTR|TRAF3IP3_ENST00000400959.3_Missense_Mutation_p.S241Y|TRAF3IP3_ENST00000010338.4_Missense_Mutation_p.S241Y|TRAF3IP3_ENST00000367025.3_Missense_Mutation_p.S261Y			Q9Y228	T3JAM_HUMAN	TRAF3 interacting protein 3	261						integral component of membrane (GO:0016021)				breast(2)|endometrium(1)|large_intestine(8)|lung(15)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32				OV - Ovarian serous cystadenocarcinoma(81;0.045)		CAGAAATACTCCCCTTGGGGA	0.418																																					p.S261Y		.											.	TRAF3IP3-291	0			c.C782A						.						41.0	42.0	42.0					1																	209948701		2203	4300	6503	SO:0001583	missense	80342	exon10			AATACTCCCCTTG		CCDS1490.1, CCDS1490.2, CCDS73023.1	1q32.3-q41	2008-02-05			ENSG00000009790	ENSG00000009790			30766	protein-coding gene	gene with protein product	"""TRAF3 interacting Jun N terminal kinase (JNK) activating modulator"""	608255				14572659	Standard	XR_247044		Approved	T3JAM	uc001hho.3	Q9Y228	OTTHUMG00000036480	ENST00000367024.1:c.782C>A	1.37:g.209948701C>A	ENSP00000355991:p.Ser261Tyr	Somatic	210	2		WXS	Illumina GAIIx	Phase_I	334	88	NM_025228	0	0	0	0	0	A1L464|A6NIU9|Q2YDB5|Q4VY06|Q7Z706	Missense_Mutation	SNP	ENST00000367024.1	37	CCDS1490.2	.	.	.	.	.	.	.	.	.	.	C	16.44	3.123315	0.56613	.	.	ENSG00000009790	ENST00000400959;ENST00000367025;ENST00000458110;ENST00000367026;ENST00000367024;ENST00000010338	T;T;T;T;T	0.78816	-1.21;-1.21;-1.21;-1.21;-1.21	5.3	5.3	0.74995	.	0.167962	0.39834	N	0.001253	D	0.85414	0.5691	M	0.69823	2.125	0.44221	D	0.997055	P;P;P;D	0.59357	0.631;0.919;0.631;0.985	B;P;B;P	0.57468	0.274;0.525;0.392;0.821	D	0.87087	0.2170	10	0.72032	D	0.01	-1.8116	17.5482	0.87869	0.0:1.0:0.0:0.0	.	261;241;261;241	Q9Y228;Q9Y228-2;Q9Y228-3;E2QRE5	T3JAM_HUMAN;.;.;.	Y	241;261;244;241;261;241	ENSP00000383743:S241Y;ENSP00000355992:S261Y;ENSP00000355993:S241Y;ENSP00000355991:S261Y;ENSP00000010338:S241Y	ENSP00000010338:S241Y	S	+	2	0	TRAF3IP3	208015324	0.988000	0.35896	1.000000	0.80357	0.977000	0.68977	4.502000	0.60400	2.477000	0.83638	0.563000	0.77884	TCC	.		0.418	TRAF3IP3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088734.2		
DTL	51514	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	212245552	212245552	+	Nonsense_Mutation	SNP	G	G	A			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr1:212245552G>A	ENST00000366991.4	+	11	1346	c.1032G>A	c.(1030-1032)tgG>tgA	p.W344*	DTL_ENST00000475419.1_3'UTR|DTL_ENST00000542077.1_Nonsense_Mutation_p.W302*	NM_016448.2	NP_057532.2	Q9NZJ0	DTL_HUMAN	denticleless E3 ubiquitin protein ligase homolog (Drosophila)	344					cellular response to DNA damage stimulus (GO:0006974)|DNA replication (GO:0006260)|G2 DNA damage checkpoint (GO:0031572)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|regulation of cell cycle (GO:0051726)|response to UV (GO:0009411)|translesion synthesis (GO:0019985)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|chromosome (GO:0005694)|Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|lung(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23				OV - Ovarian serous cystadenocarcinoma(81;0.00796)|all cancers(67;0.0385)|Epithelial(68;0.102)		CCTACATATGGAAGGTAAGTT	0.388																																					p.W344X		.											.	DTL-22	0			c.G1032A						.						125.0	115.0	118.0					1																	212245552		2203	4300	6503	SO:0001587	stop_gained	51514	exon11			CATATGGAAGGTA	AF195765	CCDS1502.1, CCDS65778.1	1q32	2013-01-10	2012-02-23		ENSG00000143476	ENSG00000143476		"""DDB1 and CUL4 associated factors"", ""WD repeat domain containing"""	30288	protein-coding gene	gene with protein product	"""RA regulated nuclear matrix associated protein"", ""DDB1 and CUL4 associated factor 2"""	610617	"""denticleless homolog (Drosophila)"""			11278750	Standard	NM_001286229		Approved	RAMP, L2DTL, DCAF2	uc009xdc.3	Q9NZJ0	OTTHUMG00000037133	ENST00000366991.4:c.1032G>A	1.37:g.212245552G>A	ENSP00000355958:p.Trp344*	Somatic	122	0		WXS	Illumina GAIIx	Phase_I	173	46	NM_016448	0	0	0	0	0	A8K8H8|D3DT98|Q5VT77|Q96SN0|Q9NW03|Q9NW34|Q9NWM5	Nonsense_Mutation	SNP	ENST00000366991.4	37	CCDS1502.1	.	.	.	.	.	.	.	.	.	.	G	40	8.084420	0.98646	.	.	ENSG00000143476	ENST00000366991;ENST00000542077	.	.	.	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-37.0306	18.0796	0.89438	0.0:0.0:1.0:0.0	.	.	.	.	X	344;302	.	ENSP00000355958:W344X	W	+	3	0	DTL	210312175	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	8.592000	0.90828	2.629000	0.89072	0.557000	0.71058	TGG	.		0.388	DTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090182.1	NM_016448	
EPRS	2058	ucsc.edu;bcgsc.ca;mdanderson.org	37	1	220219731	220219731	+	5'UTR	SNP	C	C	A			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr1:220219731C>A	ENST00000366923.3	-	0	269					NM_004446.2	NP_004437.2	P07814	SYEP_HUMAN	glutamyl-prolyl-tRNA synthetase						cellular response to interferon-gamma (GO:0071346)|gene expression (GO:0010467)|glutamyl-tRNA aminoacylation (GO:0006424)|negative regulation of translation (GO:0017148)|prolyl-tRNA aminoacylation (GO:0006433)|protein complex assembly (GO:0006461)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|GAIT complex (GO:0097452)|membrane (GO:0016020)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|glutamate-tRNA ligase activity (GO:0004818)|proline-tRNA ligase activity (GO:0004827)|RNA stem-loop binding (GO:0035613)			breast(2)|endometrium(11)|kidney(2)|large_intestine(13)|lung(24)|ovary(1)|prostate(3)|skin(2)|stomach(2)|urinary_tract(3)	63				GBM - Glioblastoma multiforme(131;0.0735)	L-Proline(DB00172)	GCGTCGCCATCTCCACCAGTC	0.612																																					.		.											.	EPRS-92	0			.						.						98.0	74.0	82.0					1																	220219731		2203	4300	6503	SO:0001623	5_prime_UTR_variant	2058	.			CGCCATCTCCACC	X54326	CCDS31027.1	1q41	2011-07-01			ENSG00000136628	ENSG00000136628	6.1.1.15, 6.1.1.17	"""Aminoacyl tRNA synthetases / Class I"", ""Aminoacyl tRNA synthetases / Class II"""	3418	protein-coding gene	gene with protein product	"""glutamate tRNA ligase"", ""proline tRNA ligase"""	138295		QPRS, QARS		1988429	Standard	NM_004446		Approved	EARS, PARS, GLUPRORS	uc001hly.1	P07814	OTTHUMG00000037433	ENST00000366923.3:c.-1G>T	1.37:g.220219731C>A		Somatic	125	0		WXS	Illumina GAIIx	Phase_I	300	74	.	0	0	9	14	5	A0AVA9|B9EGH3|Q05BP6|Q05DF8|Q5DSM1|Q5H9S5|Q6PD57|Q86X73	RNA	SNP	ENST00000366923.3	37	CCDS31027.1																																																																																			.		0.612	EPRS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091133.2	NM_004446	
ITPKB	3707	broad.mit.edu	37	1	226924876	226924884	+	In_Frame_Del	DEL	CTGCCGCTG	CTGCCGCTG	-	rs147889095	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr1:226924876_226924884delCTGCCGCTG	ENST00000272117.3	-	1	275_283	c.276_284delCAGCGGCAG	c.(274-285)agcagcggcagt>agt	p.92_95SSGS>S	ITPKB_ENST00000366784.1_In_Frame_Del_p.92_95SSGS>S|ITPKB_ENST00000429204.1_In_Frame_Del_p.92_95SSGS>S			P27987	IP3KB_HUMAN	inositol-trisphosphate 3-kinase B	92					cell surface receptor signaling pathway (GO:0007166)|inositol phosphate metabolic process (GO:0043647)|MAPK cascade (GO:0000165)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of Ras protein signal transduction (GO:0046579)|positive thymic T cell selection (GO:0045059)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(13)|ovary(4)|prostate(1)|skin(1)	30		Prostate(94;0.0773)				GCTCACgctactgccgctgctgccgctgc	0.746														1412	0.281949	0.2428	0.317	5008	,	,		9854	0.2659		0.3141	False		,,,				2504	0.2935				p.92_95del	Colon(84;110 1851 5306 33547)	.											.	ITPKB-230	0			c.276_284del						.			530,2426		156,218,1104						0.6	1.0		dbSNP_120	7	1381,4925		379,623,2151	no	coding	ITPKB	NM_002221.3		535,841,3255	A1A1,A1R,RR		21.8998,17.9296,20.6327				1911,7351				SO:0001651	inframe_deletion	3707	exon2			ACGCTACTGCCGC	AJ242780	CCDS1555.1	1q42.12	2011-04-28	2011-04-28		ENSG00000143772	ENSG00000143772	2.7.1.127		6179	protein-coding gene	gene with protein product		147522	"""inositol 1,4,5-trisphosphate 3-kinase B"""			1654894, 1330886	Standard	NM_002221		Approved	IP3KB, IP3-3KB	uc010pvo.2	P27987	OTTHUMG00000037582	ENST00000272117.3:c.276_284delCAGCGGCAG	1.37:g.226924885_226924893delCTGCCGCTG	ENSP00000272117:p.Ser92_Gly94del	Somatic	6	0		WXS	Illumina GAIIx	Phase_I	59	17	NM_002221	0	0	0	0	0	Q5VWL9|Q5VWM0|Q96BZ2|Q96JS1|Q9UH47	In_Frame_Del	DEL	ENST00000272117.3	37	CCDS1555.1																																																																																			.		0.746	ITPKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091632.1	NM_002221	
OBSCN	84033	hgsc.bcm.edu	37	1	228504670	228504670	+	Missense_Mutation	SNP	C	C	T	rs11810627	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr1:228504670C>T	ENST00000422127.1	+	51	13590	c.13546C>T	c.(13546-13548)Cgg>Tgg	p.R4516W	OBSCN_ENST00000366707.4_Missense_Mutation_p.R2150W|OBSCN_ENST00000284548.11_Missense_Mutation_p.R4516W|OBSCN_ENST00000570156.2_Missense_Mutation_p.R5473W|OBSCN_ENST00000366709.4_Missense_Mutation_p.R1635W	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	4516	Ig-like 46.		R -> W (in dbSNP:rs11810627).		apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GGCCTCTGCGCGGCTCACCGT	0.736													c|||	1654	0.330272	0.2791	0.4006	5008	,	,		13971	0.249		0.4861	False		,,,				2504	0.273				p.R5473W		.											.	OBSCN-403	0			c.C16417T						.		TRP/ARG,TRP/ARG	923,2833		165,593,1120	5.0	6.0	6.0		13546,13546	-1.0	0.0	1	dbSNP_120	6	3333,4245		861,1611,1317	yes	missense,missense	OBSCN	NM_001098623.1,NM_052843.2	101,101	1026,2204,2437	TT,TC,CC		43.9826,24.574,37.5507	probably-damaging,probably-damaging	4516/7969,4516/6621	228504670	4256,7078	1878	3789	5667	SO:0001583	missense	84033	exon62			TCTGCGCGGCTCA	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.13546C>T	1.37:g.228504670C>T	ENSP00000409493:p.Arg4516Trp	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	37	20	NM_001271223	0	0	0	0	0	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	CCDS58065.1	774	0.3543956043956044	137	0.2784552845528455	144	0.39779005524861877	134	0.23426573426573427	359	0.4736147757255937	c	11.94	1.787178	0.31593	0.24574	0.439826	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709	T;T;T;T	0.77098	-1.07;-1.07;0.2;0.2	5.41	-0.971	0.10303	Immunoglobulin subtype (1);Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.167607	0.36519	N	0.002550	T	0.00012	0.0000	L	0.41824	1.3	0.50632	P	1.1499999999997623E-4	B;B	0.22541	0.071;0.067	B;B	0.12156	0.007;0.007	T	0.42275	-0.9461	9	0.45353	T	0.12	.	10.3619	0.43998	0.6084:0.317:0.0:0.0747	rs11810627	4516;4516	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	W	4516;4516;2150;1635	ENSP00000284548:R4516W;ENSP00000409493:R4516W;ENSP00000355668:R2150W;ENSP00000355670:R1635W	ENSP00000284548:R4516W	R	+	1	2	OBSCN	226571293	0.968000	0.33430	0.013000	0.15412	0.016000	0.09150	2.032000	0.41127	-0.028000	0.13850	0.550000	0.68814	CGG	C|0.643;T|0.357		0.736	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
OR2T33	391195	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	248437020	248437020	+	Missense_Mutation	SNP	C	C	T	rs138653777		TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr1:248437020C>T	ENST00000318021.2	-	1	118	c.97G>A	c.(97-99)Gtt>Att	p.V33I		NM_001004695.1	NP_001004695.1	Q8NG76	O2T33_HUMAN	olfactory receptor, family 2, subfamily T, member 33	33						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V33I(1)		NS(2)|breast(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(41)|ovary(1)|prostate(1)|skin(4)	67	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			GAGGTCAAAACGATACTCAGA	0.478																																					p.V33I		.											.	OR2T33-114	1	Substitution - Missense(1)	prostate(1)	c.G97A						.	C	ILE/VAL	0,4396		0,0,2198	43.0	44.0	44.0		97	-3.0	0.0	1	dbSNP_134	44	1,8591		0,1,4295	no	missense	OR2T33	NM_001004695.1	29	0,1,6493	TT,TC,CC		0.0116,0.0,0.0077	benign	33/321	248437020	1,12987	2198	4296	6494	SO:0001583	missense	391195	exon1			TCAAAACGATACT		CCDS31109.1	1q44	2012-08-09			ENSG00000177212	ENSG00000177212		"""GPCR / Class A : Olfactory receptors"""	31255	protein-coding gene	gene with protein product							Standard	NM_001004695		Approved		uc010pzi.2	Q8NG76	OTTHUMG00000040458	ENST00000318021.2:c.97G>A	1.37:g.248437020C>T	ENSP00000324687:p.Val33Ile	Somatic	633	2		WXS	Illumina GAIIx	Phase_I	1014	374	NM_001004695	0	0	0	0	0	B2RNN0	Missense_Mutation	SNP	ENST00000318021.2	37	CCDS31109.1	.	.	.	.	.	.	.	.	.	.	-	10.64	1.408033	0.25378	0.0	1.16E-4	ENSG00000177212	ENST00000318021	T	0.02974	4.09	2.7	-2.99	0.05497	.	1.089080	0.07304	U	0.874565	T	0.01765	0.0056	N	0.19112	0.55	0.09310	N	1	P	0.34909	0.475	B	0.26416	0.069	T	0.44997	-0.9291	10	0.87932	D	0	.	4.1255	0.10125	0.5365:0.2124:0.0:0.2511	.	33	Q8NG76	O2T33_HUMAN	I	33	ENSP00000324687:V33I	ENSP00000324687:V33I	V	-	1	0	OR2T33	246503643	0.006000	0.16342	0.000000	0.03702	0.001000	0.01503	1.406000	0.34646	-0.368000	0.08040	0.494000	0.49563	GTT	C|1.000;T|0.000		0.478	OR2T33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097354.1	NM_001004695	
PRKCQ	5588	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	6533734	6533734	+	Missense_Mutation	SNP	A	A	T			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr10:6533734A>T	ENST00000263125.5	-	8	800	c.701T>A	c.(700-702)tTt>tAt	p.F234Y	PRKCQ_ENST00000397176.2_Missense_Mutation_p.F234Y|PRKCQ_ENST00000539722.1_Missense_Mutation_p.F109Y	NM_001282644.1|NM_006257.3	NP_001269573.1|NP_006248.1	Q04759	KPCT_HUMAN	protein kinase C, theta	234					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|Fc-epsilon receptor signaling pathway (GO:0038095)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|membrane protein ectodomain proteolysis (GO:0006509)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of T cell apoptotic process (GO:0070233)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T-helper 17 type immune response (GO:2000318)|positive regulation of T-helper 2 cell activation (GO:2000570)|protein ubiquitination (GO:0016567)|regulation of cell growth (GO:0001558)|regulation of platelet aggregation (GO:0090330)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|regulation of transcription, DNA-templated (GO:0006355)|rhodopsin mediated signaling pathway (GO:0016056)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|immunological synapse (GO:0001772)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(13)|ovary(4)|prostate(1)|skin(4)|stomach(2)	45					Tamoxifen(DB00675)	GTAGACTTTAAATCTGTGTGG	0.488																																					p.F234Y	Ovarian(50;572 1126 10530 25349 30594)	.											.	PRKCQ-1380	0			c.T701A						.						149.0	140.0	143.0					10																	6533734		2203	4300	6503	SO:0001583	missense	5588	exon8			ACTTTAAATCTGT	L07032	CCDS7079.1, CCDS55701.1, CCDS60482.1	10p15	2009-07-10			ENSG00000065675	ENSG00000065675	2.7.11.1		9410	protein-coding gene	gene with protein product		600448				8444877	Standard	NM_001282645		Approved		uc001ijj.2	Q04759	OTTHUMG00000017623	ENST00000263125.5:c.701T>A	10.37:g.6533734A>T	ENSP00000263125:p.Phe234Tyr	Somatic	110	0		WXS	Illumina GAIIx	Phase_I	164	32	NM_006257	0	0	0	0	0	B4DF52|Q14DH6|Q3MJF1|Q64FY5|Q9H508|Q9H549	Missense_Mutation	SNP	ENST00000263125.5	37	CCDS7079.1	.	.	.	.	.	.	.	.	.	.	.	20.8	4.053356	0.75960	.	.	ENSG00000065675	ENST00000263125;ENST00000397176;ENST00000539722	D;D;D	0.95171	-3.63;-3.63;-3.63	5.2	5.2	0.72013	Protein kinase C-like, phorbol ester/diacylglycerol binding (4);	0.000000	0.85682	D	0.000000	D	0.98115	0.9378	H	0.95917	3.74	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.992	D;D;P	0.81914	0.995;0.979;0.887	D	0.99501	1.0953	10	0.87932	D	0	.	15.054	0.71897	1.0:0.0:0.0:0.0	.	109;234;234	B4DF52;Q04759-2;Q04759	.;.;KPCT_HUMAN	Y	234;234;109	ENSP00000263125:F234Y;ENSP00000380361:F234Y;ENSP00000441752:F109Y	ENSP00000263125:F234Y	F	-	2	0	PRKCQ	6573740	1.000000	0.71417	0.992000	0.48379	0.463000	0.32649	9.199000	0.95003	1.949000	0.56562	0.533000	0.62120	TTT	.		0.488	PRKCQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046665.1	NM_006257	
ECHDC3	79746	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	10	11805518	11805518	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr10:11805518C>G	ENST00000379215.4	+	5	1098	c.887C>G	c.(886-888)cCt>cGt	p.P296R	ECHDC3_ENST00000496136.1_3'UTR	NM_024693.4	NP_078969	Q96DC8	ECHD3_HUMAN	enoyl CoA hydratase domain containing 3	296						mitochondrion (GO:0005739)	catalytic activity (GO:0003824)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)	4						AAGAGAAAACCTGTCTGGTCA	0.662																																					p.P296R		.											.	ECHDC3-90	0			c.C887G						.						19.0	18.0	18.0					10																	11805518		2201	4296	6497	SO:0001583	missense	79746	exon5			GAAAACCTGTCTG	AF275677	CCDS7084.1	10p14	2010-04-30	2010-04-30		ENSG00000134463	ENSG00000134463			23489	protein-coding gene	gene with protein product			"""enoyl Coenzyme A hydratase domain containing 3"""			12477932	Standard	NM_024693		Approved	FLJ20909	uc001ikw.4	Q96DC8	OTTHUMG00000017675	ENST00000379215.4:c.887C>G	10.37:g.11805518C>G	ENSP00000368517:p.Pro296Arg	Somatic	10	0		WXS	Illumina GAIIx	Phase_I	16	8	NM_024693	0	0	0	0	0	Q53HR9|Q5W0J7|Q8WYY8|Q9BVL8|Q9H7G4	Missense_Mutation	SNP	ENST00000379215.4	37	CCDS7084.1	.	.	.	.	.	.	.	.	.	.	C	16.91	3.252508	0.59212	.	.	ENSG00000134463	ENST00000379215	T	0.58358	0.34	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	D	0.86531	0.5955	H	0.99825	4.815	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.92626	0.6112	10	0.87932	D	0	.	18.8741	0.92328	0.0:1.0:0.0:0.0	.	296	Q96DC8	ECHD3_HUMAN	R	296	ENSP00000368517:P296R	ENSP00000368517:P296R	P	+	2	0	ECHDC3	11845524	1.000000	0.71417	0.271000	0.24616	0.014000	0.08584	7.398000	0.79919	2.706000	0.92434	0.561000	0.74099	CCT	.		0.662	ECHDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046771.1	NM_024693	
LYZL1	84569	ucsc.edu;bcgsc.ca	37	10	29581490	29581490	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr10:29581490C>G	ENST00000375500.3	+	3	377	c.320C>G	c.(319-321)gCc>gGc	p.A107G		NM_032517.4	NP_115906.3	Q6UWQ5	LYZL1_HUMAN	lysozyme-like 1	61					cell wall macromolecule catabolic process (GO:0016998)	extracellular region (GO:0005576)	lysozyme activity (GO:0003796)			central_nervous_system(1)|cervix(2)|large_intestine(2)|lung(5)|skin(1)	11		Breast(68;0.203)				AACACCACAGCCCAGACGGTC	0.542																																					p.A107G		.											.	LYZL1-90	0			c.C320G						.						123.0	98.0	106.0					10																	29581490		2203	4300	6503	SO:0001583	missense	84569	exon3			CCACAGCCCAGAC		CCDS31174.1	10p12.1	2004-08-02			ENSG00000120563	ENSG00000120563	3.2.1.1		30502	protein-coding gene	gene with protein product						12477932	Standard	XM_005252627		Approved	MGC33408, LYC2	uc001iul.3	Q6UWQ5	OTTHUMG00000017880	ENST00000375500.3:c.320C>G	10.37:g.29581490C>G	ENSP00000364650:p.Ala107Gly	Somatic	260	3		WXS	Illumina GAIIx	Phase_I	376	360	NM_032517	0	0	0	0	0	Q5T921|Q8WW16	Missense_Mutation	SNP	ENST00000375500.3	37	CCDS31174.1	.	.	.	.	.	.	.	.	.	.	C	13.67	2.305695	0.40795	.	.	ENSG00000120563	ENST00000375500	T	0.80214	-1.35	4.4	4.4	0.53042	.	0.472310	0.21075	N	0.080588	D	0.90960	0.7158	M	0.93375	3.41	0.09310	N	0.999996	D	0.63046	0.992	D	0.63877	0.919	D	0.84635	0.0692	10	0.87932	D	0	-18.1265	13.2281	0.59927	0.0:1.0:0.0:0.0	.	107	Q6UWQ5-2	.	G	107	ENSP00000364650:A107G	ENSP00000364650:A107G	A	+	2	0	LYZL1	29621496	0.648000	0.27313	0.023000	0.16930	0.010000	0.07245	1.808000	0.38912	2.390000	0.81377	0.655000	0.94253	GCC	.		0.542	LYZL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047381.1	NM_032517	
GPRIN2	9721	ucsc.edu	37	10	46999601	46999601	+	Missense_Mutation	SNP	G	G	A	rs9422022	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr10:46999601G>A	ENST00000374317.1	+	3	994	c.721G>A	c.(721-723)Gtg>Atg	p.V241M	GPRIN2_ENST00000374314.4_Missense_Mutation_p.V241M	NM_014696.3	NP_055511.2	O60269	GRIN2_HUMAN	G protein regulated inducer of neurite outgrowth 2	241			V -> M (in dbSNP:rs9422022).	VR -> MREVG (in Ref. 1; BAA25440 and 3; AAH11672). {ECO:0000305}.						breast(2)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)	18						CATGAGGGAGGTGAGGGCTGG	0.632													G|||	32	0.00638978	0.0023	0.0014	5008	,	,		31210	0.0139		0.0109	False		,,,				2504	0.0031				p.V241M		.											.	GPRIN2-90	0			c.G721A						.						51.0	53.0	53.0					10																	46999601		2203	4299	6502	SO:0001583	missense	9721	exon3			AGGGAGGTGAGGG	BC011672	CCDS73101.1	10q11.22	2006-08-24	2006-08-24	2006-08-24	ENSG00000204175	ENSG00000204175			23730	protein-coding gene	gene with protein product		611240	"""KIAA0514"""	KIAA0514		9628581	Standard	NM_014696		Approved	MGC15171	uc001jec.3	O60269	OTTHUMG00000018107	ENST00000374317.1:c.721G>A	10.37:g.46999601G>A	ENSP00000363436:p.Val241Met	Somatic	103	0		WXS	Illumina GAIIx	Phase_I	155	23	NM_014696	0	0	0	0	0	Q5SVF0	Missense_Mutation	SNP	ENST00000374317.1	37	CCDS31192.1	786	0.3598901098901099	179	0.3638211382113821	126	0.34806629834254144	219	0.38286713286713286	262	0.34564643799472294	G	3.183	-0.167470	0.06461	.	.	ENSG00000204175	ENST00000374317;ENST00000374314	T;T	0.03496	3.91;3.91	5.12	-1.64	0.08318	.	1.524420	0.04254	N	0.339078	T	0.00012	0.0000	L	0.34521	1.04	0.09310	N	1	B	0.15473	0.013	B	0.09377	0.004	T	0.46978	-0.9152	10	0.27082	T	0.32	0.3266	1.758	0.02986	0.326:0.1295:0.4122:0.1323	rs9422022	241	O60269	GRIN2_HUMAN	M	241	ENSP00000363436:V241M;ENSP00000363433:V241M	ENSP00000363433:V241M	V	+	1	0	GPRIN2	46419607	0.099000	0.21834	0.004000	0.12327	0.003000	0.03518	0.140000	0.16056	-0.217000	0.10033	-0.498000	0.04607	GTG	G|0.639;A|0.361		0.632	GPRIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047836.1	NM_014696	
ERCC6	2074	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	50714007	50714007	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr10:50714007C>A	ENST00000355832.5	-	6	1527	c.1449G>T	c.(1447-1449)gaG>gaT	p.E483D		NM_000124.2	NP_000115.1	Q03468	ERCC6_HUMAN	excision repair cross-complementation group 6	483					activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|photoreceptor cell maintenance (GO:0045494)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of protein tyrosine kinase activity (GO:0061098)|pyrimidine dimer repair (GO:0006290)|regulation of DNA-templated transcription, elongation (GO:0032784)|response to gamma radiation (GO:0010332)|response to oxidative stress (GO:0006979)|response to superoxide (GO:0000303)|response to toxic substance (GO:0009636)|response to UV (GO:0009411)|response to UV-B (GO:0010224)|response to X-ray (GO:0010165)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase II promoter (GO:0006366)|transcription-coupled nucleotide-excision repair (GO:0006283)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|protein N-terminus binding (GO:0047485)|protein tyrosine kinase activator activity (GO:0030296)			breast(5)|central_nervous_system(1)|endometrium(6)|kidney(5)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						CAGAATCGTCCTCCAGCTTCA	0.368								Direct reversal of damage;Nucleotide excision repair (NER)																													p.M483I		.											.	ERCC6-1153	0			c.G1449T						.						153.0	142.0	145.0					10																	50714007		2203	4300	6503	SO:0001583	missense	2074	exon6			ATCGTCCTCCAGC	L04791	CCDS7229.1	10q11	2014-09-17	2014-03-07		ENSG00000225830	ENSG00000225830			3438	protein-coding gene	gene with protein product	"""Cockayne syndrome B protein"""	609413	"""excision repair cross-complementing rodent repair deficiency, complementation group 6"""	CKN2		1339317, 19179336	Standard	NM_000124		Approved	CSB, RAD26, ARMD5	uc001jhs.5	Q03468	OTTHUMG00000018195	ENST00000355832.5:c.1449G>T	10.37:g.50714007C>A	ENSP00000348089:p.Glu483Asp	Somatic	48	0		WXS	Illumina GAIIx	Phase_I	41	13	NM_000124	0	0	0	0	0	D3DX94|Q5W0L9	Missense_Mutation	SNP	ENST00000355832.5	37	CCDS7229.1	.	.	.	.	.	.	.	.	.	.	C	6.825	0.521304	0.13005	.	.	ENSG00000225830	ENST00000355832	D	0.93763	-3.28	5.89	0.791	0.18619	.	.	.	.	.	D	0.85366	0.5680	L	0.29908	0.895	0.80722	D	1	B	0.17465	0.022	B	0.17433	0.018	T	0.71041	-0.4707	9	0.24483	T	0.36	-19.0494	4.8918	0.13731	0.1511:0.4169:0.0:0.4319	.	483	Q03468	ERCC6_HUMAN	D	483	ENSP00000348089:E483D	ENSP00000348089:E483D	E	-	3	2	ERCC6	50384013	0.982000	0.34865	0.384000	0.26145	0.176000	0.22953	0.149000	0.16243	-0.107000	0.12088	-0.302000	0.09304	GAG	.		0.368	ERCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047990.1	NM_000124	
PGBD3	267004	broad.mit.edu;bcgsc.ca	37	10	50723715	50723715	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr10:50723715C>A	ENST00000374127.3	-	2	1647	c.1446G>T	c.(1444-1446)tgG>tgT	p.W482C	PGBD3_ENST00000508005.2_Missense_Mutation_p.W482C|ERCC6-PGBD3_ENST00000515869.1_Missense_Mutation_p.W950C|PGBD3_ENST00000603152.1_Missense_Mutation_p.W950C|ERCC6-PGBD3_ENST00000447839.2_Missense_Mutation_p.W950C|ERCC6_ENST00000355832.5_Intron	NM_170753.2	NP_736609.2	Q8N328	PGBD3_HUMAN	piggyBac transposable element derived 3	482										breast(2)|endometrium(3)|kidney(1)|large_intestine(7)|lung(16)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	33						GGCTTGAATACCATTTCTTTC	0.398																																					p.I482I		.											.	PGBD3-109	0			c.A1446T						.						151.0	142.0	145.0					10																	50723715		2203	4300	6503	SO:0001583	missense	267004	exon2			TGAATACCATTTC	AK074682	CCDS7230.1	10q11	2011-03-24			ENSG00000243251	ENSG00000243251			19400	protein-coding gene	gene with protein product							Standard	NM_170753		Approved	FLJ90201		Q8N328	OTTHUMG00000018193	ENST00000374127.3:c.1446G>T	10.37:g.50723715C>A	ENSP00000363242:p.Trp482Cys	Somatic	55	1		WXS	Illumina GAIIx	Phase_I	62	18	NM_170753	0	0	2	2	0	B3KQC4|Q5W0M0|Q6PIH0	Silent	SNP	ENST00000374127.3	37	CCDS7230.1	.	.	.	.	.	.	.	.	.	.	C	13.64	2.298991	0.40694	.	.	ENSG00000243251;ENSG00000243251;ENSG00000258838;ENSG00000258838	ENST00000374127;ENST00000508005;ENST00000515869;ENST00000447839	T;T;T;T	0.28069	1.63;1.63;1.63;1.63	0.468	-0.558	0.11796	.	.	.	.	.	T	0.49236	0.1545	M	0.74467	2.265	0.35055	D	0.760995	D;D	0.89917	0.997;1.0	D;D	0.97110	0.971;1.0	T	0.56300	-0.8002	8	0.59425	D	0.04	-8.8781	.	.	.	.	950;482	E7EV46;Q8N328	.;PGBD3_HUMAN	C	482;482;950;950	ENSP00000363242:W482C;ENSP00000426963:W482C;ENSP00000423550:W950C;ENSP00000387966:W950C	ENSP00000387966:W950C	W	-	3	0	PGBD3;RP11-123B3.6	50393721	0.994000	0.37717	0.673000	0.29887	0.824000	0.46624	0.777000	0.26718	-0.344000	0.08338	-0.339000	0.08088	TGG	.		0.398	PGBD3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000047988.1		
HECTD2	143279	hgsc.bcm.edu	37	10	93170250	93170250	+	Missense_Mutation	SNP	C	C	G	rs7081569		TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr10:93170250C>G	ENST00000298068.5	+	1	149	c.55C>G	c.(55-57)Ccc>Gcc	p.P19A	HECTD2_ENST00000371681.4_Missense_Mutation_p.P19A|HECTD2_ENST00000446394.1_Missense_Mutation_p.P19A	NM_182765.3	NP_877497	Q5U5R9	HECD2_HUMAN	HECT domain containing E3 ubiquitin protein ligase 2	19			P -> A (in dbSNP:rs7081569). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|endometrium(2)|kidney(4)|large_intestine(10)|lung(7)|skin(1)|urinary_tract(1)	27						GGTGGCGGCGCCCGCGCCTGA	0.761													G|||	5008	1.0	1.0	1.0	5008	,	,		7483	1.0		1.0	False		,,,				2504	1.0				p.P19A	NSCLC(12;376 469 1699 39910 41417)	.											.	HECTD2-658	0			c.C55G						.						2.0	2.0	2.0					10																	93170250		1173	2544	3717	SO:0001583	missense	143279	exon1			GCGGCGCCCGCGC	AK094625	CCDS7414.1, CCDS7415.1, CCDS60591.1	10q23.32	2013-09-20	2012-02-23		ENSG00000165338	ENSG00000165338			26736	protein-coding gene	gene with protein product			"""HECT domain containing 2"""			8619474, 9110174	Standard	NM_001284274		Approved	FLJ37306	uc001khl.2	Q5U5R9	OTTHUMG00000018742	ENST00000298068.5:c.55C>G	10.37:g.93170250C>G	ENSP00000298068:p.Pro19Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_182765	0	0	0	1	1	Q5VZ97|Q5VZ98|Q5VZ99|Q8N1X7|Q8TCP5	Missense_Mutation	SNP	ENST00000298068.5	37	CCDS7414.1	1998	0.9148351648351648	429	0.8719512195121951	335	0.925414364640884	529	0.9248251748251748	705	0.9300791556728232	g	1.760	-0.486925	0.04352	.	.	ENSG00000165338	ENST00000446394;ENST00000371681;ENST00000298068	T;T;T	0.36699	1.5;1.24;1.5	2.37	2.37	0.29283	.	0.964307	0.08409	N	0.950145	T	0.00012	0.0000	N	0.00538	-1.39	0.46241	P	0.001052000000000053	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.32534	-0.9903	9	0.02654	T	1	.	7.1033	0.25351	0.0:0.2826:0.7174:0.0	rs7081569	19;19;19	E7ERR3;Q5U5R9;Q5VZ98	.;HECD2_HUMAN;.	A	19	ENSP00000401023:P19A;ENSP00000360746:P19A;ENSP00000298068:P19A	ENSP00000298068:P19A	P	+	1	0	HECTD2	93160230	0.858000	0.29795	0.231000	0.23993	0.735000	0.41995	-0.544000	0.06077	0.556000	0.29098	-0.370000	0.07254	CCC	C|0.154;G|0.846		0.761	HECTD2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098620.1		
NDUFB8	4714	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	10	102289594	102289594	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr10:102289594C>A	ENST00000299166.4	-	1	27	c.15G>T	c.(13-15)agG>agT	p.R5S	NDUFB8_ENST00000531258.1_Missense_Mutation_p.R5S|NDUFB8_ENST00000557395.1_Missense_Mutation_p.R5S|NDUFB8_ENST00000370320.4_Missense_Mutation_p.R5S|SEC31B_ENST00000535773.1_5'UTR|NDUFB8_ENST00000370322.1_Intron	NM_005004.2	NP_004995.1	O95169	NDUB8_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 8, 19kDa	5					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			endometrium(2)|lung(2)	4		Colorectal(252;0.234)		Epithelial(162;5.68e-10)|all cancers(201;4.05e-08)		AGACCCCGGCCCTGGCCACCG	0.657																																					p.R5S		.											.	NDUFB8-90	0			c.G15T						.						33.0	37.0	36.0					10																	102289594		2203	4300	6503	SO:0001583	missense	4714	exon1			CCCGGCCCTGGCC	AF044958	CCDS7497.1, CCDS65916.1, CCDS65917.1	10q24.31	2011-07-04	2002-08-29		ENSG00000166136	ENSG00000166136		"""Mitochondrial respiratory chain complex / Complex I"""	7703	protein-coding gene	gene with protein product	"""complex I ASHI subunit"""	602140	"""NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 8 (19kD, ASHI)"""			9763676	Standard	NM_001284368		Approved	ASHI, CI-ASHI	uc001kri.1	O95169	OTTHUMG00000019346	ENST00000299166.4:c.15G>T	10.37:g.102289594C>A	ENSP00000299166:p.Arg5Ser	Somatic	90	0		WXS	Illumina GAIIx	Phase_I	188	118	NM_005004	1	0	109	271	161	A8K0L4|Q5W143|Q5W144|Q5W145|Q9UG53|Q9UJR4|Q9UQF3	Missense_Mutation	SNP	ENST00000299166.4	37	CCDS7497.1	.	.	.	.	.	.	.	.	.	.	C	10.94	1.491783	0.26774	.	.	ENSG00000166136	ENST00000531258;ENST00000299166;ENST00000370320	.	.	.	5.04	0.706	0.18133	.	0.532595	0.17898	N	0.158289	T	0.18882	0.0453	N	0.24115	0.695	0.18873	N	0.999986	B	0.24823	0.112	B	0.25140	0.058	T	0.11867	-1.0570	9	0.33940	T	0.23	-7.7757	2.7302	0.05225	0.2523:0.4982:0.1233:0.1263	.	5	O95169	NDUB8_HUMAN	S	5	.	ENSP00000299166:R5S	R	-	3	2	NDUFB8	102279584	0.000000	0.05858	0.742000	0.31022	0.176000	0.22953	-0.290000	0.08354	0.279000	0.22186	0.462000	0.41574	AGG	.		0.657	NDUFB8-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051225.1	NM_005004	
C10orf95	79946	hgsc.bcm.edu	37	10	104210735	104210735	+	Missense_Mutation	SNP	C	C	A	rs2281878	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr10:104210735C>A	ENST00000239125.1	-	2	327	c.253G>T	c.(253-255)Gct>Tct	p.A85S	RP11-18I14.10_ENST00000494270.2_RNA|RP11-18I14.10_ENST00000492465.2_RNA|RP11-18I14.10_ENST00000473970.2_RNA|RP11-18I14.10_ENST00000594818.1_RNA|RP11-18I14.10_ENST00000596045.1_RNA|RP11-18I14.10_ENST00000596366.1_RNA	NM_024886.1	NP_079162.1	Q9H7T3	CJ095_HUMAN	chromosome 10 open reading frame 95	85	Arg/Pro-rich.									liver(1)	1		Colorectal(252;0.207)		Epithelial(162;8.34e-09)|all cancers(201;1.95e-07)|BRCA - Breast invasive adenocarcinoma(275;0.213)		GCTGCGGAAGCTGTGGGCCTG	0.766													C|||	1422	0.283946	0.2481	0.2147	5008	,	,		8527	0.3661		0.2107	False		,,,				2504	0.3722				p.A85S		.											.	C10orf95-91	0			c.G253T						.	C	SER/ALA	686,2688		69,548,1070	4.0	6.0	5.0		253	0.9	1.0	10	dbSNP_100	5	1301,5815		124,1053,2381	yes	missense	C10orf95	NM_024886.1	99	193,1601,3451	AA,AC,CC		18.2827,20.332,18.9418	possibly-damaging	85/258	104210735	1987,8503	1687	3558	5245	SO:0001583	missense	79946	exon2			CGGAAGCTGTGGG	AK024342	CCDS7534.1	10q24.32	2014-02-19	2014-02-19	2014-02-19	ENSG00000120055	ENSG00000120055			25880	protein-coding gene	gene with protein product							Standard	NM_024886		Approved	FLJ14280	uc001kvo.1	Q9H7T3	OTTHUMG00000018959	ENST00000239125.1:c.253G>T	10.37:g.104210735C>A	ENSP00000239125:p.Ala85Ser	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_024886	0	0	0	2	2	A0AVQ7	Missense_Mutation	SNP	ENST00000239125.1	37	CCDS7534.1	525	0.2403846153846154	101	0.20528455284552846	71	0.19613259668508287	200	0.34965034965034963	153	0.20184696569920843	C	12.47	1.948662	0.34377	0.20332	0.182827	ENSG00000120055	ENST00000239125	.	.	.	4.68	0.951	0.19579	.	0.773948	0.10608	N	0.654824	T	0.00012	0.0000	N	0.08118	0	0.53688	P	2.5000000000052758E-5	B	0.33807	0.426	B	0.32090	0.14	T	0.45891	-0.9230	8	0.33940	T	0.23	-38.6243	6.6233	0.22816	0.0:0.3488:0.0:0.6512	rs2281878	85	Q9H7T3	CJ095_HUMAN	S	85	.	ENSP00000239125:A85S	A	-	1	0	C10orf95	104200725	0.997000	0.39634	0.987000	0.45799	0.038000	0.13279	0.038000	0.13862	0.047000	0.15862	-0.350000	0.07774	GCT	C|0.759;A|0.241		0.766	C10orf95-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050065.1	NM_024886	
C10orf90	118611	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	10	128193343	128193343	+	Silent	SNP	G	G	A			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr10:128193343G>A	ENST00000284694.7	-	3	546	c.426C>T	c.(424-426)atC>atT	p.I142I	C10orf90_ENST00000368674.1_5'UTR|C10orf90_ENST00000392694.1_Silent_p.I95I|C10orf90_ENST00000544758.1_Silent_p.I239I|C10orf90_ENST00000356858.3_Silent_p.I95I|C10orf90_ENST00000454341.1_Silent_p.I142I	NM_001004298.2	NP_001004298.2	Q96M02	CJ090_HUMAN	chromosome 10 open reading frame 90	142	Required for interaction with HDAC1. {ECO:0000250}.				mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of cell growth (GO:0030308)|protein stabilization (GO:0050821)|response to ionizing radiation (GO:0010212)|response to UV (GO:0009411)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|cytoplasm (GO:0005737)				NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(19)|liver(1)|lung(29)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	65		all_epithelial(44;4.51e-05)|all_lung(145;0.0068)|Lung NSC(174;0.0105)|Colorectal(57;0.0848)|all_neural(114;0.0936)|Breast(234;0.203)		COAD - Colon adenocarcinoma(40;0.0442)|Colorectal(40;0.0479)		GTCTGGCCGTGATGGTGATGG	0.682											OREG0020616	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.I142I		.											.	C10orf90-92	0			c.C426T						.						27.0	33.0	31.0					10																	128193343		2186	4283	6469	SO:0001819	synonymous_variant	118611	exon3			GGCCGTGATGGTG	BC034828	CCDS31310.1	10q26.2	2012-05-31			ENSG00000154493	ENSG00000154493			26563	protein-coding gene	gene with protein product	"""fragile-site associated tumor suppressor"""					20843368, 20154723	Standard	NM_001004298		Approved	FLJ32938, bA422P15.2, FATS	uc001ljq.3	Q96M02	OTTHUMG00000019245	ENST00000284694.7:c.426C>T	10.37:g.128193343G>A		Somatic	14	0	1563	WXS	Illumina GAIIx	Phase_I	15	5	NM_001004298	0	0	0	0	0	B9EIQ9|Q5JRP6|Q5T023|Q8NCV5|Q8WU75	Silent	SNP	ENST00000284694.7	37	CCDS31310.1																																																																																			.		0.682	C10orf90-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001004298	
LMNTD2	256329	hgsc.bcm.edu	37	11	556063	556063	+	Missense_Mutation	SNP	C	C	T	rs144614541	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr11:556063C>T	ENST00000329451.3	-	11	1372	c.1310G>A	c.(1309-1311)aGc>aAc	p.S437N	RP11-496I9.1_ENST00000527620.1_RNA|RP11-496I9.1_ENST00000527113.1_RNA	NM_173573.2	NP_775844.2	Q8IXW0	LMTD2_HUMAN		437	LTD.									NS(1)|breast(1)|central_nervous_system(1)|lung(4)|pancreas(1)	8		all_cancers(49;2.16e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;7.18e-28)|Epithelial(43;6.93e-27)|OV - Ovarian serous cystadenocarcinoma(40;6.97e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGGCTCCCGGCTCGAGGACGC	0.796													C|||	127	0.0253594	0.0242	0.0288	5008	,	,		7467	0.001		0.0487	False		,,,				2504	0.0256				p.S437N		.											.	C11orf35-69	0			c.G1310A						.	C	ASN/SER	77,3207		1,75,1566	8.0	11.0	10.0		1310	2.9	0.0	11	dbSNP_134	10	266,6736		7,252,3242	no	missense	C11orf35	NM_173573.2	46	8,327,4808	TT,TC,CC		3.7989,2.3447,3.3346	benign	437/635	556063	343,9943	1642	3501	5143	SO:0001583	missense	256329	exon11			TCCCGGCTCGAGG																												ENST00000329451.3:c.1310G>A	11.37:g.556063C>T	ENSP00000331167:p.Ser437Asn	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_173573	0	0	0	3	3		Missense_Mutation	SNP	ENST00000329451.3	37	CCDS7701.1	69	0.03159340659340659	15	0.03048780487804878	13	0.03591160220994475	0	0.0	41	0.05408970976253298	C	12.87	2.068734	0.36470	0.023447	0.037989	ENSG00000185522	ENST00000329451	D	0.98455	-4.94	3.83	2.91	0.33838	Intermediate filament, C-terminal (1);	0.633514	0.13334	N	0.395698	T	0.76004	0.3927	N	0.08118	0	0.09310	N	1	B	0.17038	0.02	B	0.21917	0.037	T	0.80091	-0.1527	10	0.30078	T	0.28	-8.6787	9.1323	0.36852	0.0:0.8854:0.0:0.1146	.	437	Q8IXW0	CK035_HUMAN	N	437	ENSP00000331167:S437N	ENSP00000331167:S437N	S	-	2	0	C11orf35	546063	0.000000	0.05858	0.027000	0.17364	0.018000	0.09664	0.369000	0.20416	2.143000	0.66587	0.561000	0.74099	AGC	C|0.968;T|0.032		0.796	C11orf35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254973.2		
IRF7	3665	hgsc.bcm.edu	37	11	615103	615103	+	Silent	SNP	G	G	A	rs113083699	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr11:615103G>A	ENST00000397574.2	-	3	546	c.177C>T	c.(175-177)atC>atT	p.I59I	IRF7_ENST00000330243.5_Silent_p.I72I|IRF7_ENST00000525445.1_5'UTR|IRF7_ENST00000397562.3_5'UTR|IRF7_ENST00000348655.6_Silent_p.I59I|IRF7_ENST00000397566.1_Silent_p.I72I|IRF7_ENST00000397570.1_Silent_p.I59I	NM_001572.3	NP_001563.2	Q92985	IRF7_HUMAN	interferon regulatory factor 7	59					cellular response to DNA damage stimulus (GO:0006974)|cytokine-mediated signaling pathway (GO:0019221)|establishment of viral latency (GO:0019043)|immunoglobulin mediated immune response (GO:0016064)|innate immune response (GO:0045087)|interferon-alpha production (GO:0032607)|interferon-beta production (GO:0032608)|interferon-gamma-mediated signaling pathway (GO:0060333)|MDA-5 signaling pathway (GO:0039530)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of macrophage apoptotic process (GO:2000110)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of adaptive immune response (GO:0002819)|regulation of immune response (GO:0050776)|regulation of monocyte differentiation (GO:0045655)|regulation of MyD88-dependent toll-like receptor signaling pathway (GO:0034124)|regulation of MyD88-independent toll-like receptor signaling pathway (GO:0034127)|regulation of type I interferon production (GO:0032479)|response to virus (GO:0009615)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|transcription from RNA polymerase II promoter (GO:0006366)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|type I interferon biosynthetic process (GO:0045351)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)			endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	8		all_cancers(49;1.69e-08)|all_epithelial(84;1.65e-05)|Breast(177;0.000231)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;7.68e-28)|Epithelial(43;7.44e-27)|OV - Ovarian serous cystadenocarcinoma(40;3.53e-21)|BRCA - Breast invasive adenocarcinoma(625;6.96e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CCACCTTGAAGATGCGCGCGT	0.721													G|||	203	0.0405351	0.0772	0.0375	5008	,	,		12225	0.001		0.0527	False		,,,				2504	0.0215				p.I72I		.											.	IRF7-90	0			c.C216T						.	G	,,	153,3775		1,151,1812	5.0	6.0	6.0		177,177,216	3.6	1.0	11	dbSNP_132	6	310,7558		4,302,3628	no	coding-synonymous,coding-synonymous,coding-synonymous	IRF7	NM_001572.3,NM_004029.2,NM_004031.2	,,	5,453,5440	AA,AG,GG		3.94,3.8951,3.9251	,,	59/504,59/475,72/517	615103	463,11333	1964	3934	5898	SO:0001819	synonymous_variant	3665	exon1			CTTGAAGATGCGC	U53830	CCDS7703.1, CCDS7704.1, CCDS7705.1	11p15.5	2005-10-10			ENSG00000185507	ENSG00000185507			6122	protein-coding gene	gene with protein product		605047					Standard	XM_005252906		Approved		uc001lqh.3	Q92985	OTTHUMG00000132019	ENST00000397574.2:c.177C>T	11.37:g.615103G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	13	12	NM_004031	0	0	0	0	0	B9EGL3|O00331|O00332|O00333|O75924|Q9UE79	Silent	SNP	ENST00000397574.2	37	CCDS7703.1																																																																																			G|0.949;A|0.051		0.721	IRF7-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255026.1	NM_001572	
MUC2	4583	bcgsc.ca	37	11	1092884	1092884	+	Missense_Mutation	SNP	C	C	T	rs201415503		TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr11:1092884C>T	ENST00000441003.2	+	30	4730	c.4703C>T	c.(4702-4704)aCg>aTg	p.T1568M	MUC2_ENST00000359061.5_Missense_Mutation_p.T1569M|MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_5'Flank	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.T1569M(2)|p.T1568M(2)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	ACCACCACCACGGTGacccca	0.637																																					p.T1568M		.											.	MUC2-90	4	Substitution - Missense(4)	large_intestine(2)|skin(2)	c.C4703T						.						129.0	172.0	157.0					11																	1092884		1964	3669	5633	SO:0001583	missense	4583	exon30			CCACCACGGTGAC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4703C>T	11.37:g.1092884C>T	ENSP00000415183:p.Thr1568Met	Somatic	179	2		WXS	Illumina GAIIx	Phase_I	247	7	NM_002457	0	0	0	0	0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	2.409	-0.335727	0.05278	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.14893	2.5;2.47	1.63	0.367	0.16140	.	25.055600	0.00797	U	0.001394	T	0.21841	0.0526	.	.	.	0.09310	N	1	D	0.76494	0.999	P	0.48425	0.577	T	0.35301	-0.9794	9	0.45353	T	0.12	.	8.9064	0.35526	0.0:0.7681:0.2319:0.0	.	1568	E7EUV1	.	M	1568;1569	ENSP00000415183:T1568M;ENSP00000351956:T1569M	ENSP00000351956:T1569M	T	+	2	0	MUC2	1082884	0.000000	0.05858	0.002000	0.10522	0.015000	0.08874	0.878000	0.28126	0.945000	0.37605	0.121000	0.15741	ACG	.		0.637	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MUC2	4583	bcgsc.ca	37	11	1093295	1093295	+	Missense_Mutation	SNP	C	C	T	rs200837746|rs200145328		TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr11:1093295C>T	ENST00000441003.2	+	30	5141	c.5114C>T	c.(5113-5115)aCt>aTt	p.T1705I	MUC2_ENST00000359061.5_Missense_Mutation_p.T1672I|MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_5'Flank	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.T1705I(1)|p.T1672I(1)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	accaccaccactacggtgacc	0.642																																					p.T1705I		.											.	MUC2-90	2	Substitution - Missense(2)	large_intestine(2)	c.C5114T						.						113.0	161.0	144.0					11																	1093295		1882	3466	5348	SO:0001583	missense	4583	exon30			CCACCACTACGGT	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5114C>T	11.37:g.1093295C>T	ENSP00000415183:p.Thr1705Ile	Somatic	145	2		WXS	Illumina GAIIx	Phase_I	114	8	NM_002457	0	0	0	0	0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	0.775	-0.764347	0.02996	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.11277	3.02;2.79	1.6	-0.698	0.11280	.	0.547305	0.11728	U	0.535177	T	0.05868	0.0153	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.38457	-0.9660	9	0.34782	T	0.22	.	3.0673	0.06219	0.0:0.5189:0.2842:0.1969	.	1705	E7EUV1	.	I	1705;1672	ENSP00000415183:T1705I;ENSP00000351956:T1672I	ENSP00000351956:T1672I	T	+	2	0	MUC2	1083295	0.002000	0.14202	0.001000	0.08648	0.001000	0.01503	0.065000	0.14466	-0.392000	0.07751	-1.238000	0.01547	ACT	.		0.642	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MUC5B	727897	hgsc.bcm.edu	37	11	1253980	1253980	+	Missense_Mutation	SNP	A	A	G	rs202127660		TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr11:1253980A>G	ENST00000529681.1	+	17	2103	c.2045A>G	c.(2044-2046)gAc>gGc	p.D682G	MUC5B_ENST00000447027.1_Missense_Mutation_p.D685G	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	682					cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CAGCTCAGCGACTGGAGGGAC	0.682																																					p.D682G		.											.	.	0			c.A2045G						.						21.0	24.0	23.0					11																	1253980		2116	4228	6344	SO:0001583	missense	727897	exon17			TCAGCGACTGGAG	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.2045A>G	11.37:g.1253980A>G	ENSP00000436812:p.Asp682Gly	Somatic	32	0		WXS	Illumina GAIIx	Phase_I	143	15	NM_002458	0	0	0	0	0	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	A	7.541	0.660740	0.14645	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.76060	-0.99;-0.99	4.6	2.72	0.32119	Uncharacterised domain, cysteine-rich (2);	.	.	.	.	T	0.50103	0.1596	N	0.02960	-0.455	0.24874	N	0.992269	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.45920	-0.9228	9	0.87932	D	0	.	8.6635	0.34108	0.2416:0.0:0.7584:0.0	.	682;1341;685	Q9HC84;A7Y9J9;E9PBJ0	MUC5B_HUMAN;.;.	G	682;685;683;718	ENSP00000436812:D682G;ENSP00000415793:D685G	ENSP00000343037:D683G	D	+	2	0	MUC5B	1210556	0.999000	0.42202	0.632000	0.29296	0.070000	0.16714	2.607000	0.46300	0.373000	0.24621	-1.983000	0.00453	GAC	.		0.682	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
MUC5B	727897	bcgsc.ca	37	11	1266696	1266696	+	Silent	SNP	A	A	C	rs532138150	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr11:1266696A>C	ENST00000529681.1	+	31	8644	c.8586A>C	c.(8584-8586)ccA>ccC	p.P2862P	MUC5B_ENST00000447027.1_Silent_p.P2865P|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	2862	7 X Cys-rich subdomain repeats.|Thr-rich.			Missing (in Ref. 6; AAB61398). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CATCGGCCCCAATAACCACGG	0.692													-|||	1610	0.321486	0.236	0.3386	5008	,	,		9611	0.497		0.2575	False		,,,				2504	0.3098				p.P2862P		.											.	.	0			c.A8586C						.						54.0	65.0	61.0					11																	1266696		1727	3813	5540	SO:0001819	synonymous_variant	727897	exon31			GGCCCCAATAACC	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.8586A>C	11.37:g.1266696A>C		Somatic	147	2		WXS	Illumina GAIIx	Phase_I	98	84	NM_002458	0	0	0	0	0	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	ENST00000529681.1	37	CCDS44515.2																																																																																			A|0.500;C|0.500		0.692	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
MUC5B	727897	bcgsc.ca	37	11	1266716	1266716	+	Missense_Mutation	SNP	T	T	C	rs200243273	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr11:1266716T>C	ENST00000529681.1	+	31	8664	c.8606T>C	c.(8605-8607)aTg>aCg	p.M2869T	MUC5B_ENST00000447027.1_Missense_Mutation_p.M2872T|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	2869	7 X Cys-rich subdomain repeats.|Thr-rich.			Missing (in Ref. 6; AAB61398). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GTGGTGACCATGGGCTGTGAG	0.657													-|||	1477	0.294928	0.2284	0.2752	5008	,	,		10473	0.4812		0.2266	False		,,,				2504	0.2771				p.M2869T		.											.	.	0			c.T8606C						.						43.0	51.0	49.0					11																	1266716		1683	3765	5448	SO:0001583	missense	727897	exon31			TGACCATGGGCTG	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.8606T>C	11.37:g.1266716T>C	ENSP00000436812:p.Met2869Thr	Somatic	172	0		WXS	Illumina GAIIx	Phase_I	88	41	NM_002458	0	0	0	0	0	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	-	1.479	-0.557829	0.03967	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.15718	2.4;2.59	1.67	-1.74	0.08056	.	.	.	.	.	T	0.05686	0.0149	N	0.02539	-0.55	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.29882	-0.9997	8	0.87932	D	0	.	3.4419	0.07466	0.1749:0.468:0.0:0.3571	rs2860626;rs2943499;rs2943524;rs3965637	3452;2872	A7Y9J9;E9PBJ0	.;.	T	2869;2872;2841;2829	ENSP00000436812:M2869T;ENSP00000415793:M2872T	ENSP00000343037:M2841T	M	+	2	0	MUC5B	1223292	0.003000	0.15002	0.000000	0.03702	0.007000	0.05969	0.117000	0.15583	-1.035000	0.03291	-0.471000	0.05019	ATG	C|1.000;|0.000		0.657	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
MUC5B	727897	bcgsc.ca	37	11	1272245	1272245	+	Missense_Mutation	SNP	C	C	T	rs2943511	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr11:1272245C>T	ENST00000529681.1	+	31	14193	c.14135C>T	c.(14134-14136)aCg>aTg	p.T4712M	MUC5B_ENST00000447027.1_Missense_Mutation_p.T4715M|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	4712	23 X approximate tandem repeats, Ser/Thr- rich.|Thr-rich.		T -> M (in dbSNP:rs2943511). {ECO:0000269|PubMed:9013550}.		cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		ctgaccagcacggccaccaca	0.617													c|||	356	0.0710863	0.0295	0.1138	5008	,	,		18081	0.0496		0.0974	False		,,,				2504	0.092				p.T4712M		.											.	.	0			c.C14135T						.	C	MET/THR	77,4207		2,73,2067	110.0	141.0	131.0		14135	-3.3	0.0	11	dbSNP_101	131	629,7823		39,551,3636	yes	missense	MUC5B	NM_002458.2	81	41,624,5703	TT,TC,CC		7.442,1.7974,5.5433		4712/5763	1272245	706,12030	2142	4226	6368	SO:0001583	missense	727897	exon31			CCAGCACGGCCAC	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.14135C>T	11.37:g.1272245C>T	ENSP00000436812:p.Thr4712Met	Somatic	735	4		WXS	Illumina GAIIx	Phase_I	813	20	NM_002458	0	0	0	0	0	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	154	0.07051282051282051	9	0.018292682926829267	38	0.10497237569060773	43	0.07517482517482517	64	0.08443271767810026	-	2.685	-0.274526	0.05679	0.017974	0.07442	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000535652	T;T	0.19394	2.15;2.33	1.65	-3.31	0.04988	.	.	.	.	.	T	0.00412	0.0013	M	0.75264	2.295	0.80722	P	0.0	D	0.60160	0.987	B	0.35413	0.202	T	0.06023	-1.0850	8	0.87932	D	0	.	2.2239	0.03979	0.177:0.497:0.176:0.1499	rs2943511	4715	E9PBJ0	.	M	4712;4715;4656;485	ENSP00000436812:T4712M;ENSP00000415793:T4715M	ENSP00000343037:T4656M	T	+	2	0	MUC5B	1228821	0.000000	0.05858	0.000000	0.03702	0.080000	0.17528	-5.903000	0.00091	-0.636000	0.05524	0.194000	0.17425	ACG	C|0.930;T|0.070		0.617	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
KRTAP5-5	439915	broad.mit.edu	37	11	1651158	1651169	+	In_Frame_Del	DEL	GGCTGTGGCTCT	GGCTGTGGCTCT	-	rs71454095|rs71454094	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr11:1651158_1651169delGGCTGTGGCTCT	ENST00000399676.2	+	1	126_137	c.88_99delGGCTGTGGCTCT	c.(88-99)ggctgtggctctdel	p.GCGS30del		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	30						keratin filament (GO:0045095)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		cggctgtggaggctgtggctctggctgtgggg	0.708																																					p.30_33del		.											.	KRTAP5-5-23	0			c.88_99del						.			96,3734		5,86,1824						0.1	0.0			33	221,7503		7,207,3648	no	coding	KRTAP5-5	NM_001001480.2		12,293,5472	A1A1,A1R,RR		2.8612,2.5065,2.7436				317,11237				SO:0001651	inframe_deletion	439915	exon1			TGTGGAGGCTGTG	AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	ENST00000399676.2:c.88_99delGGCTGTGGCTCT	11.37:g.1651158_1651169delGGCTGTGGCTCT	ENSP00000382584:p.Gly30_Ser33del	Somatic	19	0		WXS	Illumina GAIIx	Phase_I	149	12	NM_001001480	0	0	0	0	0	A8MWN2	In_Frame_Del	DEL	ENST00000399676.2	37	CCDS41592.1																																																																																			.		0.708	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127919.1		
KRTAP5-5	439915	hgsc.bcm.edu	37	11	1651229	1651229	+	Silent	SNP	G	G	A	rs553119014	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr11:1651229G>A	ENST00000399676.2	+	1	197	c.159G>A	c.(157-159)gcG>gcA	p.A53A		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	53				A -> G (in Ref. 1; BAD20201 and 2; CAF31639). {ECO:0000305}.		keratin filament (GO:0045095)		p.A53A(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		ccggctgtgcgggctgtgggg	0.682													g|||	17	0.00339457	0.0045	0.0014	5008	,	,		5663	0.0		0.005	False		,,,				2504	0.0051				p.A53A		.											.	KRTAP5-5-23	1	Substitution - coding silent(1)	large_intestine(1)	c.G159A						.						35.0	47.0	43.0					11																	1651229		2115	4180	6295	SO:0001819	synonymous_variant	439915	exon1			CTGTGCGGGCTGT	AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	ENST00000399676.2:c.159G>A	11.37:g.1651229G>A		Somatic	60	0		WXS	Illumina GAIIx	Phase_I	115	12	NM_001001480	0	0	0	0	0	A8MWN2	Silent	SNP	ENST00000399676.2	37	CCDS41592.1																																																																																			.		0.682	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127919.1		
MRGPRE	116534	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	3250000	3250000	+	Silent	SNP	G	G	A	rs530383366		TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr11:3250000G>A	ENST00000389832.5	-	2	336	c.30C>T	c.(28-30)caC>caT	p.H10H	MRGPRE_ENST00000436689.2_Silent_p.H9H|AC109309.4_ENST00000418995.2_RNA			Q86SM8	MRGRE_HUMAN	MAS-related GPR, member E	10						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(1)|lung(6)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	19		Medulloblastoma(188;0.00106)|all_epithelial(84;0.00111)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00529)|LUSC - Lung squamous cell carcinoma(625;0.19)		CGGCCCCCACGTGCTGTCCAG	0.662													A|||	1	0.000199681	0.0	0.0	5008	,	,		17735	0.0		0.0	False		,,,				2504	0.001				p.H10H		.											.	MRGPRE-136	0			c.C30T						.						23.0	25.0	24.0					11																	3250000		1962	4140	6102	SO:0001819	synonymous_variant	116534	exon2			CCCCACGTGCTGT	AY255572	CCDS41603.1, CCDS41603.2	11p15.5	2012-08-21	2004-03-25		ENSG00000184350	ENSG00000184350		"""GPCR / Class A : Orphans"""	30694	protein-coding gene	gene with protein product		607232	"""G protein-coupled receptor 167"""	GPR167		11551509	Standard	NM_001039165		Approved	mrgE	uc001lxq.5	Q86SM8	OTTHUMG00000011708	ENST00000389832.5:c.30C>T	11.37:g.3250000G>A		Somatic	41	0		WXS	Illumina GAIIx	Phase_I	60	55	NM_001039165	0	0	0	0	0	Q2M1V7	Silent	SNP	ENST00000389832.5	37																																																																																				.		0.662	MRGPRE-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000032346.5	XM_171536	
OR51A4	401666	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	4967624	4967624	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr11:4967624A>C	ENST00000380373.2	-	1	732	c.707T>G	c.(706-708)cTt>cGt	p.L236R	MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron	NM_001005329.1	NP_001005329.1	Q8NGJ6	O51A4_HUMAN	olfactory receptor, family 51, subfamily A, member 4	236						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(3)|lung(15)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	29		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.22e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		GAGAGCCTTAAGCTGCTCCTT	0.478																																					p.L236R		.											.	OR51A4-71	0			c.T707G						.						135.0	124.0	128.0					11																	4967624		2201	4298	6499	SO:0001583	missense	401666	exon1			GCCTTAAGCTGCT	AB065798	CCDS31367.1	11p15.4	2012-08-09			ENSG00000205497	ENSG00000205497		"""GPCR / Class A : Olfactory receptors"""	14795	protein-coding gene	gene with protein product							Standard	NM_001005329		Approved		uc010qys.2	Q8NGJ6	OTTHUMG00000066614	ENST00000380373.2:c.707T>G	11.37:g.4967624A>C	ENSP00000369731:p.Leu236Arg	Somatic	872	0		WXS	Illumina GAIIx	Phase_I	718	333	NM_001005329	0	0	0	0	0		Missense_Mutation	SNP	ENST00000380373.2	37	CCDS31367.1	.	.	.	.	.	.	.	.	.	.	A	10.58	1.390978	0.25118	.	.	ENSG00000205497	ENST00000380373	T	0.70045	-0.45	3.44	2.27	0.28462	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.74176	0.3682	L	0.58810	1.83	0.09310	N	1	D	0.60575	0.988	D	0.69479	0.964	T	0.60271	-0.7296	9	0.52906	T	0.07	.	6.9696	0.24642	0.6327:0.0:0.0:0.3673	.	236	Q8NGJ6	O51A4_HUMAN	R	236	ENSP00000369731:L236R	ENSP00000369731:L236R	L	-	2	0	OR51A4	4924200	0.003000	0.15002	0.120000	0.21714	0.735000	0.41995	0.800000	0.27042	0.495000	0.27882	0.392000	0.25879	CTT	.		0.478	OR51A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142821.1	NM_001005329	
MICALCL	84953	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	12315183	12315183	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr11:12315183G>C	ENST00000256186.2	+	3	496	c.205G>C	c.(205-207)Gcc>Ccc	p.A69P		NM_032867.2	NP_116256.2	Q6ZW33	MICLK_HUMAN	MICAL C-terminal like	69	Interaction with MAPK1. {ECO:0000250}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)	mitogen-activated protein kinase binding (GO:0051019)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(5)|lung(5)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	30				Epithelial(150;0.00177)		TCGGAGGCGAGCCGTAGCCCA	0.567																																					p.A69P		.											.	MICALCL-91	0			c.G205C						.						139.0	146.0	144.0					11																	12315183		1937	4128	6065	SO:0001583	missense	84953	exon3			AGGCGAGCCGTAG	BK000463	CCDS41620.1	11p15.3	2005-11-01			ENSG00000133808	ENSG00000133808			25933	protein-coding gene	gene with protein product		612355				12110185	Standard	NM_032867		Approved	FLJ14966	uc001mkg.1	Q6ZW33	OTTHUMG00000165777	ENST00000256186.2:c.205G>C	11.37:g.12315183G>C	ENSP00000256186:p.Ala69Pro	Somatic	119	0		WXS	Illumina GAIIx	Phase_I	109	55	NM_032867	0	0	0	0	0	Q7RTP7|Q96JU6	Missense_Mutation	SNP	ENST00000256186.2	37	CCDS41620.1	.	.	.	.	.	.	.	.	.	.	G	13.47	2.246426	0.39697	.	.	ENSG00000133808	ENST00000256186	T	0.07567	3.18	5.71	2.75	0.32379	.	0.324258	0.22323	N	0.061575	T	0.09113	0.0225	L	0.32530	0.975	0.09310	N	1	P	0.43909	0.821	P	0.45681	0.49	T	0.14476	-1.0471	10	0.41790	T	0.15	.	9.9938	0.41887	0.2539:0.0:0.7461:0.0	.	69	Q6ZW33	MICLK_HUMAN	P	69	ENSP00000256186:A69P	ENSP00000256186:A69P	A	+	1	0	MICALCL	12271759	0.025000	0.19082	0.001000	0.08648	0.018000	0.09664	0.982000	0.29539	0.061000	0.16311	-0.797000	0.03246	GCC	.		0.567	MICALCL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386164.1	NM_032867	
KCNK7	10089	broad.mit.edu;bcgsc.ca	37	11	65360508	65360508	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr11:65360508C>T	ENST00000340313.4	-	3	1115	c.892G>A	c.(892-894)Gcc>Acc	p.A298T	KCNK7_ENST00000394217.2_3'UTR|KCNK7_ENST00000394216.2_3'UTR|AP001362.1_ENST00000597463.1_5'Flank|KCNK7_ENST00000342202.4_3'UTR	NM_033347.1	NP_203133.1	Q9Y2U2	KCNK7_HUMAN	potassium channel, subfamily K, member 7	298					potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			endometrium(1)|liver(1)|lung(1)	3						GAAGCTGGGGCCGCGGGCGGC	0.627																																					p.A298T		.											.	KCNK7-90	0			c.G892A						.						31.0	30.0	31.0					11																	65360508		2201	4297	6498	SO:0001583	missense	10089	exon3			CTGGGGCCGCGGG	AF110522	CCDS8106.1, CCDS31608.1, CCDS41673.1	11q13	2012-03-07			ENSG00000173338	ENSG00000173338		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6282	protein-coding gene	gene with protein product		603940				10206991, 11256078, 16382106	Standard	NM_033347		Approved	K2p7.1	uc001oes.3	Q9Y2U2	OTTHUMG00000166528	ENST00000340313.4:c.892G>A	11.37:g.65360508C>T	ENSP00000344820:p.Ala298Thr	Somatic	103	0		WXS	Illumina GAIIx	Phase_I	98	6	NM_033347	0	0	0	0	0	Q3SYI2|Q9Y2U3|Q9Y2U4	Missense_Mutation	SNP	ENST00000340313.4	37	CCDS31608.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.35|13.35	2.211016|2.211016	0.39102|0.39102	.|.	.|.	ENSG00000173338|ENSG00000173338	ENST00000340313|ENST00000530380	T|.	0.10005|.	2.92|.	4.7|4.7	1.42|1.42	0.22433|0.22433	.|.	0.572554|.	0.15630|.	N|.	0.252453|.	T|T	0.15219|0.15219	0.0367|0.0367	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B|.	0.16166|.	0.016|.	B|.	0.12837|.	0.008|.	T|T	0.25813|0.25813	-1.0121|-1.0121	10|5	0.21014|.	T|.	0.42|.	.|.	4.0889|4.0889	0.09960|0.09960	0.0:0.5685:0.1893:0.2422|0.0:0.5685:0.1893:0.2422	.|.	298|.	Q9Y2U2|.	KCNK7_HUMAN|.	T|D	298|62	ENSP00000344820:A298T|.	ENSP00000344820:A298T|.	A|G	-|-	1|2	0|0	KCNK7|KCNK7	65117084|65117084	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.195000|0.195000	0.23768|0.23768	-0.014000|-0.014000	0.12656|0.12656	-0.005000|-0.005000	0.14395|0.14395	0.561000|0.561000	0.74099|0.74099	GCC|GGC	.		0.627	KCNK7-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390206.1	NM_005714	
GAL3ST3	89792	hgsc.bcm.edu	37	11	65810209	65810209	+	Silent	SNP	C	C	T	rs61895584	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr11:65810209C>T	ENST00000312006.4	-	3	1346	c.1065G>A	c.(1063-1065)ccG>ccA	p.P355P	GAL3ST3_ENST00000527878.1_Silent_p.P355P	NM_033036.2	NP_149025.1	Q96A11	G3ST3_HUMAN	galactose-3-O-sulfotransferase 3	355					monosaccharide metabolic process (GO:0005996)|oligosaccharide metabolic process (GO:0009311)|poly-N-acetyllactosamine metabolic process (GO:0030309)|proteoglycan biosynthetic process (GO:0030166)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|carbohydrate binding (GO:0030246)|galactose 3-O-sulfotransferase activity (GO:0050694)|galactosylceramide sulfotransferase activity (GO:0001733)|proteoglycan sulfotransferase activity (GO:0050698)			kidney(1)|lung(9)|ovary(2)|skin(2)	14						TGGGCTGCCACGGCTGCAGCT	0.741													C|||	3763	0.751398	0.5408	0.8746	5008	,	,		7225	0.7649		0.8549	False		,,,				2504	0.8282				p.P355P		.											.	GAL3ST3-91	0			c.G1065A						.	C		1752,666		619,514,76	3.0	2.0	2.0		1065	-9.2	0.7	11	dbSNP_129	2	4565,363		2119,327,18	no	coding-synonymous	GAL3ST3	NM_033036.2		2738,841,94	TT,TC,CC		7.3661,27.5434,14.0076		355/432	65810209	6317,1029	1209	2464	3673	SO:0001819	synonymous_variant	89792	exon3			CTGCCACGGCTGC	AY026481	CCDS8128.1	11q13.1	2014-08-12			ENSG00000175229	ENSG00000175229		"""Sulfotransferases, membrane-bound"""	24144	protein-coding gene	gene with protein product		608234				11323440, 11356829	Standard	NM_033036		Approved	GAL3ST2	uc001ogw.3	Q96A11	OTTHUMG00000166667	ENST00000312006.4:c.1065G>A	11.37:g.65810209C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_033036	0	0	0	0	0	Q14D05	Silent	SNP	ENST00000312006.4	37	CCDS8128.1																																																																																			C|0.233;T|0.767		0.741	GAL3ST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391052.1	NM_033036	
INPPL1	3636	broad.mit.edu	37	11	71949087	71949087	+	Splice_Site	SNP	C	C	A			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr11:71949087C>A	ENST00000298229.2	+	27	3758	c.3554C>A	c.(3553-3555)gCt>gAt	p.A1185D	PHOX2A_ENST00000544057.1_5'Flank|INPPL1_ENST00000538751.1_Splice_Site_p.A943D|INPPL1_ENST00000541756.1_Splice_Site_p.A943D	NM_001567.3	NP_001558.3	O15357	SHIP2_HUMAN	inositol polyphosphate phosphatase-like 1	1185					actin filament organization (GO:0007015)|cell adhesion (GO:0007155)|endochondral ossification (GO:0001958)|endocytosis (GO:0006897)|glucose metabolic process (GO:0006006)|immune system process (GO:0002376)|inositol phosphate metabolic process (GO:0043647)|negative regulation of cell proliferation (GO:0008285)|negative regulation of gene expression (GO:0010629)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|post-embryonic development (GO:0009791)|response to insulin (GO:0032868)|ruffle assembly (GO:0097178)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|SH2 domain binding (GO:0042169)	p.A1185D(2)		breast(2)|endometrium(9)|kidney(1)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	44						TTTCCTTAGGCTCCGTGCCTG	0.657											OREG0021191	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A1185D		.											.	INPPL1-660	2	Substitution - Missense(2)	urinary_tract(1)|prostate(1)	c.C3554A						.						15.0	17.0	17.0					11																	71949087		2197	4291	6488	SO:0001630	splice_region_variant	3636	exon27			CTTAGGCTCCGTG	Y14385	CCDS8213.1	11q23	2013-02-14			ENSG00000165458	ENSG00000165458		"""Sterile alpha motif (SAM) domain containing"", ""SH2 domain containing"""	6080	protein-coding gene	gene with protein product	"""51C protein"""	600829				8530088	Standard	NM_001567		Approved	SHIP2	uc001osf.3	O15357	OTTHUMG00000167879	ENST00000298229.2:c.3553-1C>A	11.37:g.71949087C>A		Somatic	11	0	1133	WXS	Illumina GAIIx	Phase_I	41	9	NM_001567	0	0	0	0	0	B2RTX5|Q13577|Q13578	Missense_Mutation	SNP	ENST00000298229.2	37	CCDS8213.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	12.01|12.01	1.810120|1.810120	0.32053|0.32053	.|.	.|.	ENSG00000165458|ENSG00000165458	ENST00000298229;ENST00000541756;ENST00000538751|ENST00000320683	D;D;D|.	0.96716|.	-2.99;-4.1;-4.1|.	4.69|4.69	2.76|2.76	0.32466|0.32466	.|.	0.083463|.	0.47093|.	D|.	0.000259|.	T|T	0.34600|0.34600	0.0903|0.0903	N|N	0.14661|0.14661	0.345|0.345	0.36357|0.36357	D|D	0.860441|0.860441	P|.	0.44090|.	0.826|.	B|.	0.38655|.	0.278|.	T|T	0.28681|0.28681	-1.0036|-1.0036	10|5	0.44086|.	T|.	0.13|.	.|.	7.041|7.041	0.25021|0.25021	0.0:0.6953:0.1561:0.1486|0.0:0.6953:0.1561:0.1486	.|.	1185|.	O15357|.	SHIP2_HUMAN|.	D|I	1185;943;943|47	ENSP00000298229:A1185D;ENSP00000446360:A943D;ENSP00000444619:A943D|.	ENSP00000298229:A1185D|.	A|L	+|+	2|1	0|0	INPPL1|INPPL1	71626735|71626735	0.671000|0.671000	0.27521|0.27521	1.000000|1.000000	0.80357|0.80357	0.421000|0.421000	0.31385|0.31385	1.197000|1.197000	0.32211|0.32211	1.184000|1.184000	0.42957|0.42957	0.591000|0.591000	0.81541|0.81541	GCT|CTC	.		0.657	INPPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396789.1	NM_001567	Missense_Mutation
FAM181B	220382	hgsc.bcm.edu	37	11	82443696	82443696	+	Frame_Shift_Del	DEL	T	T	-			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr11:82443696delT	ENST00000329203.3	-	1	1210	c.1076delA	c.(1075-1077)gatfs	p.D359fs		NM_175885.3	NP_787081.2	A6NEQ2	F181B_HUMAN	family with sequence similarity 181, member B	359	Pro-rich.									large_intestine(1)|lung(2)|prostate(1)	4						GCCGGGAGAATCCGCAGCGGC	0.721																																					p.D359fs		.											.	FAM181B-135	0			c.1076delA						.						2.0	3.0	2.0					11																	82443696		1295	3055	4350	SO:0001589	frameshift_variant	220382	exon1			GGAGAATCCGCAG	AK095054, BC039262	CCDS31648.1	11q14.1	2011-11-30			ENSG00000182103	ENSG00000182103			28512	protein-coding gene	gene with protein product						12477932	Standard	NM_175885		Approved	LOC220382, MGC33846	uc001ozp.3	A6NEQ2	OTTHUMG00000166869	ENST00000329203.3:c.1076delA	11.37:g.82443696delT	ENSP00000365295:p.Asp359fs	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	13	11	NM_175885	0	0	0	0	0	B2RWP1	Frame_Shift_Del	DEL	ENST00000329203.3	37	CCDS31648.1																																																																																			.		0.721	FAM181B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391626.1	NM_175885	
SYTL2	54843	broad.mit.edu	37	11	85435193	85435193	+	Intron	SNP	C	C	G			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr11:85435193C>G	ENST00000528231.1	-	8	1737				SYTL2_ENST00000524452.1_Intron|SYTL2_ENST00000527523.1_Intron|SYTL2_ENST00000359152.5_Missense_Mutation_p.L1293F|SYTL2_ENST00000316356.4_Intron|SYTL2_ENST00000389960.4_Intron|SYTL2_ENST00000354566.3_Missense_Mutation_p.L769F|SYTL2_ENST00000525423.1_Missense_Mutation_p.L769F	NM_001162951.1|NM_001162953.1	NP_001156423.1|NP_001156425.1	Q9HCH5	SYTL2_HUMAN	synaptotagmin-like 2						exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of mucus secretion (GO:0070257)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|exocytic vesicle (GO:0070382)|extrinsic component of plasma membrane (GO:0019897)|Golgi apparatus (GO:0005794)|melanosome (GO:0042470)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	neurexin family protein binding (GO:0042043)|phosphatase binding (GO:0019902)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(22)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)		ATGCTAGAGTCAATTCAACTT	0.383																																					p.L769F		.											.	SYTL2-137	0			c.G2307C						.						85.0	87.0	86.0					11																	85435193		2203	4299	6502	SO:0001627	intron_variant	54843	exon1			TAGAGTCAATTCA	AJ303364	CCDS31649.1, CCDS31652.1, CCDS41698.1, CCDS53687.1, CCDS53688.1, CCDS53689.1	11q14.1	2014-06-13			ENSG00000137501	ENSG00000137501			15585	protein-coding gene	gene with protein product	"""chromosome 11 synaptotagmin"", ""breast cancer-associated antigen SGA-72M"", ""protein phosphatase 1, regulatory subunit 151"""	612880				10997877	Standard	XM_005274057		Approved	FLJ20163, FLJ21219, KIAA1597, exophilin-4, CHR11SYT, SLP2, SGA72M, MGC102768, PPP1R151	uc001pbb.3	Q9HCH5	OTTHUMG00000166977	ENST00000528231.1:c.1460-3191G>C	11.37:g.85435193C>G		Somatic	75	0		WXS	Illumina GAIIx	Phase_I	41	3	NM_206927	0	0	7	7	0	B3KRS3|B4DJT5|B4DKW3|B4DQ26|B7SA85|B7ZLX6|B7ZLX7|Q2YDA7|Q6TV07|Q6ZN59|Q6ZVC5|Q8ND34|Q96BJ2|Q9H768|Q9NXM1	Missense_Mutation	SNP	ENST00000528231.1	37	CCDS53688.1	.	.	.	.	.	.	.	.	.	.	C	8.932	0.963653	0.18583	.	.	ENSG00000137501	ENST00000359152;ENST00000354566;ENST00000525423;ENST00000530351	T;T;T;T	0.50277	1.38;1.39;1.4;0.75	5.81	4.89	0.63831	.	1.603350	0.03245	N	0.181032	T	0.46132	0.1377	L	0.29908	0.895	0.18873	N	0.999982	P;P;P	0.40211	0.707;0.707;0.707	B;B;B	0.40825	0.341;0.22;0.22	T	0.48305	-0.9047	9	.	.	.	-0.0421	14.2187	0.65809	0.0:0.6515:0.3484:0.0	.	769;769;769	Q9HCH5-11;Q9HCH5-7;Q9HCH5-8	.;.;.	F	1293;769;769;188	ENSP00000352065:L1293F;ENSP00000346576:L769F;ENSP00000432694:L769F;ENSP00000435009:L188F	.	L	-	3	2	SYTL2	85112841	0.010000	0.17322	0.055000	0.19348	0.654000	0.38779	0.827000	0.27421	1.433000	0.47394	0.650000	0.86243	TTG	.		0.383	SYTL2-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000392192.1	NM_206927	
NCAM1	4684	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	113103921	113103921	+	Silent	SNP	C	C	G			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr11:113103921C>G	ENST00000533760.1	+	12	1790	c.1191C>G	c.(1189-1191)gcC>gcG	p.A397A	NCAM1_ENST00000401611.2_Silent_p.A524A|NCAM1_ENST00000397957.4_3'UTR|NCAM1_ENST00000316851.7_Silent_p.A515A	NM_001242608.1	NP_001229537.1	P13591	NCAM1_HUMAN	neural cell adhesion molecule 1	525	Ig-like C2-type 4.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix organization (GO:0030198)|interferon-gamma-mediated signaling pathway (GO:0060333)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)			breast(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(27)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)	49		all_cancers(61;5.82e-19)|all_epithelial(67;6.87e-12)|Melanoma(852;1.99e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;0.00119)|Breast(348;0.0109)|all_neural(223;0.0299)|Medulloblastoma(222;0.0458)|Renal(330;0.198)|Prostate(24;0.207)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.000114)|all cancers(92;0.000467)|OV - Ovarian serous cystadenocarcinoma(223;0.212)		CCAGCACAGCCCAGGTGCAGT	0.547																																					p.A551A		.											.	NCAM1-23	0			c.C1653G						.						68.0	69.0	69.0					11																	113103921		2018	4172	6190	SO:0001819	synonymous_variant	4684	exon15			CACAGCCCAGGTG		CCDS73384.1, CCDS73385.1, CCDS73386.1, CCDS73387.1, CCDS73388.1	11q23.2	2013-02-11			ENSG00000149294	ENSG00000149294		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7656	protein-coding gene	gene with protein product		116930					Standard	NM_000615		Approved	NCAM, CD56	uc021qqp.1	P13591	OTTHUMG00000167196	ENST00000533760.1:c.1191C>G	11.37:g.113103921C>G		Somatic	222	0		WXS	Illumina GAIIx	Phase_I	285	123	NM_001242607	0	0	9	27	18	A8K8T8|P13592|P13593|Q05C58|Q15829|Q16180|Q16209|Q59FL7|Q86X47|Q96CJ3	Silent	SNP	ENST00000533760.1	37																																																																																				.		0.547	NCAM1-003	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000394068.2	NM_000615	
BACE1	23621	hgsc.bcm.edu	37	11	117186506	117186506	+	Silent	SNP	G	G	A	rs28917234	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr11:117186506G>A	ENST00000313005.6	-	1	466	c.6C>T	c.(4-6)gcC>gcT	p.A2A	BACE1_ENST00000428381.2_Silent_p.A2A|BACE1_ENST00000528053.1_Silent_p.A2A|BACE1_ENST00000445823.2_Silent_p.A2A|BACE1_ENST00000513780.1_Silent_p.A2A|BACE1_ENST00000514464.1_5'UTR|AP000892.4_ENST00000504906.1_RNA	NM_012104.4|NM_138971.3|NM_138972.3|NM_138973.3	NP_036236|NP_620427.1|NP_620428.1|NP_620429.1	P56817	BACE1_HUMAN	beta-site APP-cleaving enzyme 1	2					beta-amyloid metabolic process (GO:0050435)|membrane protein ectodomain proteolysis (GO:0006509)|proteolysis (GO:0006508)	axon (GO:0030424)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	aspartic-type endopeptidase activity (GO:0004190)|beta-amyloid binding (GO:0001540)|beta-aspartyl-peptidase activity (GO:0008798)|enzyme binding (GO:0019899)			breast(2)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|prostate(1)	19	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.69e-05)|Epithelial(105;0.000563)|all cancers(92;0.0032)		GCAGGGCTTGGGCCATGGTGG	0.746													G|||	92	0.0183706	0.0023	0.0159	5008	,	,		10280	0.0		0.0378	False		,,,				2504	0.0409				p.A2A		.											.	BACE1-91	0			c.C6T						.	G	,,,	14,2658		0,14,1322	2.0	3.0	3.0		6,6,6,6	0.6	0.9	11	dbSNP_125	3	131,5129		1,129,2500	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	BACE1	NM_012104.4,NM_138971.3,NM_138972.3,NM_138973.3	,,,	1,143,3822	AA,AG,GG		2.4905,0.524,1.828	,,,	2/502,2/458,2/477,2/433	117186506	145,7787	1336	2630	3966	SO:0001819	synonymous_variant	23621	exon1			GGCTTGGGCCATG	AF190725	CCDS8383.1, CCDS44739.1, CCDS44740.1, CCDS44741.1, CCDS55787.1, CCDS55786.1	11q23-q24	2011-07-27	2004-04-02	2004-04-02	ENSG00000186318	ENSG00000186318			933	protein-coding gene	gene with protein product		604252	"""beta-site APP-cleaving enzyme"""	BACE		10531052	Standard	NM_012104		Approved		uc001pqz.3	P56817	OTTHUMG00000160636	ENST00000313005.6:c.6C>T	11.37:g.117186506G>A		Somatic	2	0		WXS	Illumina GAIIx	Phase_I	25	24	NM_138972	0	0	0	8	8	A0M8W7|B0YIU9|E9PE65|H7BXJ9|Q9BYB9|Q9BYC0|Q9BYC1|Q9UJT5|Q9ULS1	Silent	SNP	ENST00000313005.6	37	CCDS8383.1																																																																																			G|0.979;A|0.021		0.746	BACE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361505.1		
BLID	414899	ucsc.edu;bcgsc.ca;mdanderson.org	37	11	121986666	121986666	+	5'UTR	SNP	A	A	T			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr11:121986666A>T	ENST00000560104.1	-	0	257					NM_001001786.2	NP_001001786.2	Q8IZY5	BLID_HUMAN	BH3-like motif containing, cell death inducer						apoptotic process (GO:0006915)	mitochondrion (GO:0005739)				NS(1)|large_intestine(4)|lung(6)|pancreas(1)	12		Breast(109;0.0164)|Medulloblastoma(222;0.0523)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;2.08e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.101)		TCCAAAATTTAACTTCCATTC	0.378											OREG0021435	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									.		.											.	.	0			.						.						22.0	22.0	22.0					11																	121986666		2201	4291	6492	SO:0001623	5_prime_UTR_variant	414899	.			AAATTTAACTTCC	AF303179	CCDS31693.1	11q24.1	2007-06-22				ENSG00000259571			33495	protein-coding gene	gene with protein product	"""breast cancer cell 2"""	608853				15069058, 17220890	Standard	NM_001001786		Approved	BRCC2	uc001pyf.3	Q8IZY5		ENST00000560104.1:c.-36T>A	11.37:g.121986666A>T		Somatic	134	1	1515	WXS	Illumina GAIIx	Phase_I	77	34	.	0	0	0	0	0	A1L416	RNA	SNP	ENST00000560104.1	37	CCDS31693.1																																																																																			.		0.378	BLID-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387656.1	NM_001001786	
FKBP4	2288	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	2910398	2910398	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr12:2910398A>G	ENST00000001008.4	+	9	1335	c.1148A>G	c.(1147-1149)tAc>tGc	p.Y383C	RP4-816N1.7_ENST00000547042.1_RNA|RP4-816N1.6_ENST00000547834.1_RNA	NM_002014.3	NP_002005.1	Q02790	FKBP4_HUMAN	FK506 binding protein 4, 59kDa	383	Interaction with tubulin. {ECO:0000250}.				androgen receptor signaling pathway (GO:0030521)|chaperone-mediated protein folding (GO:0061077)|copper ion transport (GO:0006825)|embryo implantation (GO:0007566)|male sex differentiation (GO:0046661)|negative regulation of microtubule polymerization (GO:0031115)|negative regulation of microtubule polymerization or depolymerization (GO:0031111)|negative regulation of neuron projection development (GO:0010977)|prostate gland development (GO:0030850)|protein complex localization (GO:0031503)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)|steroid hormone receptor complex assembly (GO:0006463)	axonal growth cone (GO:0044295)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|FK506 binding (GO:0005528)|GTP binding (GO:0005525)|heat shock protein binding (GO:0031072)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(3)|prostate(2)|skin(1)	14			OV - Ovarian serous cystadenocarcinoma(31;0.00105)			CTGCAGCTCTACCCCAACAAC	0.587																																					p.Y383C		.											.	FKBP4-226	0			c.A1148G						.						56.0	62.0	60.0					12																	2910398		2203	4300	6503	SO:0001583	missense	2288	exon9			AGCTCTACCCCAA	M88279	CCDS8512.1	12p13.33	2013-01-10	2002-08-29		ENSG00000004478	ENSG00000004478		"""Tetratricopeptide (TTC) repeat domain containing"""	3720	protein-coding gene	gene with protein product		600611	"""FK506-binding protein 4 (59kD)"""			1279700	Standard	NM_002014		Approved	FKBP59, FKBP52	uc001qkz.3	Q02790	OTTHUMG00000090429	ENST00000001008.4:c.1148A>G	12.37:g.2910398A>G	ENSP00000001008:p.Tyr383Cys	Somatic	133	0		WXS	Illumina GAIIx	Phase_I	147	89	NM_002014	0	0	116	298	182	D3DUQ1|Q9UCP1|Q9UCV7	Missense_Mutation	SNP	ENST00000001008.4	37	CCDS8512.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	24.3|24.3	4.521303|4.521303	0.85600|0.85600	.|.	.|.	ENSG00000004478|ENSG00000004478	ENST00000539181|ENST00000001008	.|T	.|0.59364	.|0.27	5.57|5.57	5.57|5.57	0.84162|0.84162	.|Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.65439|0.65439	0.2691|0.2691	L|L	0.29908|0.29908	0.895|0.895	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.70227	.|0.968	T|T	0.69161|0.69161	-0.5218|-0.5218	5|10	.|0.72032	.|D	.|0.01	-17.5704|-17.5704	14.9117|14.9117	0.70761|0.70761	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|383	.|Q02790	.|FKBP4_HUMAN	A|C	19|383	.|ENSP00000001008:Y383C	.|ENSP00000001008:Y383C	T|Y	+|+	1|2	0|0	FKBP4|FKBP4	2780659|2780659	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	8.875000|8.875000	0.92372|0.92372	2.117000|2.117000	0.64856|0.64856	0.459000|0.459000	0.35465|0.35465	ACC|TAC	.		0.587	FKBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206861.1		
KRT7	3855	hgsc.bcm.edu	37	12	52627215	52627215	+	Silent	SNP	A	A	G	rs7308888	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr12:52627215A>G	ENST00000331817.5	+	1	318	c.135A>G	c.(133-135)tcA>tcG	p.S45S		NM_005556.3	NP_005547.3	P08729	K2C7_HUMAN	keratin 7	45	Head.				viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|prostate(2)|stomach(1)|urinary_tract(1)	14				BRCA - Breast invasive adenocarcinoma(357;0.105)	Primaquine(DB01087)	TCGGCGCCTCACGGCCGCGCG	0.771													g|||	4451	0.888778	0.9781	0.8473	5008	,	,		10346	0.9048		0.8191	False		,,,				2504	0.8528				p.S45S		.											.	KRT7-90	0			c.A135G						.			3161,173		1496,169,2	4.0	6.0	5.0		135	-5.3	0.0	12	dbSNP_116	5	5763,1251		2369,1025,113	no	coding-synonymous	KRT7	NM_005556.3		3865,1194,115	GG,GA,AA		17.8358,5.189,13.7611		45/470	52627215	8924,1424	1667	3507	5174	SO:0001819	synonymous_variant	3855	exon1			CGCCTCACGGCCG		CCDS8822.1	12q13.13	2013-01-16			ENSG00000135480	ENSG00000135480		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6445	protein-coding gene	gene with protein product	"""keratin, type II cytoskeletal 7"", ""cytokeratin 7"", ""sarcolectin"", ""keratin, 55K type II cytoskeletal"""	148059				1713141, 16831889	Standard	XR_245927		Approved	K7, CK7, K2C7, SCL	uc001saa.1	P08729	OTTHUMG00000169580	ENST00000331817.5:c.135A>G	12.37:g.52627215A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	16	16	NM_005556	0	0	0	0	0	Q92676|Q9BUD8|Q9Y3R7	Silent	SNP	ENST00000331817.5	37	CCDS8822.1																																																																																			A|0.133;G|0.867		0.771	KRT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404897.1	NM_005556	
CSAD	51380	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	53555170	53555170	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr12:53555170C>T	ENST00000444623.1	-	11	973	c.706G>A	c.(706-708)Gct>Act	p.A236T	CSAD_ENST00000453446.2_Missense_Mutation_p.A236T|CSAD_ENST00000267085.4_Missense_Mutation_p.A263T|RP11-1136G11.8_ENST00000550908.1_lincRNA|CSAD_ENST00000379843.3_Missense_Mutation_p.A89T|CSAD_ENST00000379846.1_Missense_Mutation_p.A89T	NM_001244705.1	NP_001231634.1	Q9Y600	CSAD_HUMAN	cysteine sulfinic acid decarboxylase	236					cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|sulfur amino acid catabolic process (GO:0000098)|sulfur amino acid metabolic process (GO:0000096)|taurine biosynthetic process (GO:0042412)		pyridoxal phosphate binding (GO:0030170)|sulfinoalanine decarboxylase activity (GO:0004782)			kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(4)	14					L-Cysteine(DB00151)	AACGGCACAGCACCCTGTTGC	0.542																																					p.A263T	Ovarian(109;252 1546 16882 28524 44645)	.											.	CSAD-91	0			c.G787A						.						81.0	82.0	82.0					12																	53555170		2203	4300	6503	SO:0001583	missense	51380	exon11			GCACAGCACCCTG	AB044561	CCDS8848.2, CCDS58235.1	12q13.11-q14.3	2008-08-04			ENSG00000139631	ENSG00000139631			18966	protein-coding gene	gene with protein product	"""P-selectin cytoplasmic tail-associated protein"""					15489334	Standard	NM_015989		Approved	PCAP, CSD	uc001sbz.3	Q9Y600	OTTHUMG00000048076	ENST00000444623.1:c.706G>A	12.37:g.53555170C>T	ENSP00000415485:p.Ala236Thr	Somatic	213	0		WXS	Illumina GAIIx	Phase_I	356	99	NM_015989	0	0	0	0	0	A8K0U4|Q4QQH9|Q9UNJ5|Q9Y601	Missense_Mutation	SNP	ENST00000444623.1	37	CCDS58235.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.31|11.31	1.599900|1.599900	0.28534|0.28534	.|.	.|.	ENSG00000139631|ENSG00000139631	ENST00000308926;ENST00000379843;ENST00000267085;ENST00000379846;ENST00000444623;ENST00000398047;ENST00000453446;ENST00000548698|ENST00000379850	T;T;T;T;T;T|.	0.37411|.	1.2;1.2;1.2;1.2;1.2;1.2|.	4.42|4.42	3.5|3.5	0.40072|0.40072	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);|.	0.364166|.	0.30285|.	N|.	0.009963|.	T|T	0.61677|0.61677	0.2366|0.2366	L|L	0.58510|0.58510	1.815|1.815	0.80722|0.80722	D|D	1|1	B;B;B|.	0.26363|.	0.135;0.071;0.147|.	B;B;B|.	0.35114|.	0.196;0.122;0.045|.	T|T	0.59364|0.59364	-0.7468|-0.7468	10|5	0.20046|.	T|.	0.44|.	-6.0583|-6.0583	10.743|10.743	0.46164|0.46164	0.3573:0.6427:0.0:0.0|0.3573:0.6427:0.0:0.0	.|.	263;236;89|.	Q9Y600-3;Q9Y600;Q9Y600-2|.	.;CSAD_HUMAN;.|.	T|Y	325;89;263;89;236;197;236;89|261	ENSP00000369172:A89T;ENSP00000267085:A263T;ENSP00000369175:A89T;ENSP00000415485:A236T;ENSP00000410648:A236T;ENSP00000449373:A89T|.	ENSP00000267085:A263T|.	A|C	-|-	1|2	0|0	CSAD|CSAD	51841437|51841437	0.645000|0.645000	0.27286|0.27286	0.997000|0.997000	0.53966|0.53966	0.969000|0.969000	0.65631|0.65631	1.257000|1.257000	0.32932|0.32932	1.161000|1.161000	0.42604|0.42604	0.555000|0.555000	0.69702|0.69702	GCT|TGC	.		0.542	CSAD-017	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343697.1	NM_015989	
NFE2	4778	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	54686192	54686192	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr12:54686192A>G	ENST00000540264.2	-	2	1597	c.1088T>C	c.(1087-1089)gTg>gCg	p.V363A	NFE2_ENST00000312156.4_Missense_Mutation_p.V363A|RP11-968A15.8_ENST00000553061.1_RNA|NFE2_ENST00000553070.1_Missense_Mutation_p.V363A|NFE2_ENST00000435572.2_Missense_Mutation_p.V363A			Q16621	NFE2_HUMAN	nuclear factor, erythroid 2	363					blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|hemostasis (GO:0007599)|labyrinthine layer blood vessel development (GO:0060716)|multicellular organismal development (GO:0007275)|negative regulation of bone mineralization (GO:0030502)|negative regulation of syncytium formation by plasma membrane fusion (GO:0034242)|nucleosome disassembly (GO:0006337)|positive regulation of peptidyl-lysine acetylation (GO:2000758)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein N-terminus binding (GO:0047485)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|WW domain binding (GO:0050699)			breast(1)|central_nervous_system(1)|large_intestine(5)|lung(7)|upper_aerodigestive_tract(2)	16						CCCCCGGGGCACAAGGAAGAT	0.562																																					p.V363A		.											.	NFE2-226	0			c.T1088C						.						60.0	56.0	58.0					12																	54686192		2203	4300	6503	SO:0001583	missense	4778	exon4			CGGGGCACAAGGA	BC005044	CCDS8876.1	12q13	2013-08-23	2013-08-23			ENSG00000123405		"""basic leucine zipper proteins"""	7780	protein-coding gene	gene with protein product		601490	"""nuclear factor (erythroid-derived 2), 45kD"", ""nuclear factor (erythroid-derived 2), 45kDa"""			8355703	Standard	NM_001136023		Approved	NF-E2	uc001sfr.5	Q16621		ENST00000540264.2:c.1088T>C	12.37:g.54686192A>G	ENSP00000439120:p.Val363Ala	Somatic	177	1		WXS	Illumina GAIIx	Phase_I	259	84	NM_001261461	0	0	0	0	0	Q07720|Q6ICV9	Missense_Mutation	SNP	ENST00000540264.2	37	CCDS8876.1	.	.	.	.	.	.	.	.	.	.	A	18.17	3.564931	0.65651	.	.	ENSG00000123405	ENST00000312156;ENST00000435572;ENST00000540264;ENST00000553070	.	.	.	5.27	4.12	0.48240	.	0.076504	0.51477	D	0.000099	T	0.52677	0.1749	M	0.67569	2.06	0.48762	D	0.999702	P	0.38020	0.615	B	0.36186	0.219	T	0.60495	-0.7252	9	0.87932	D	0	-13.3089	8.8249	0.35050	0.9107:0.0:0.0893:0.0	.	363	Q16621	NFE2_HUMAN	A	363	.	ENSP00000312436:V363A	V	-	2	0	NFE2	52972459	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.531000	0.81973	2.125000	0.65367	0.533000	0.62120	GTG	.		0.562	NFE2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405747.1	NM_006163	
ESYT1	23344	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	56522161	56522161	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr12:56522161C>G	ENST00000394048.5	+	1	322	c.58C>G	c.(58-60)Ccc>Gcc	p.P20A	RP11-603J24.5_ENST00000550947.1_RNA|ESYT1_ENST00000267113.4_Missense_Mutation_p.P20A|ESYT1_ENST00000541590.1_Missense_Mutation_p.P20A|RP11-603J24.5_ENST00000549438.1_RNA	NM_001184796.1|NM_015292.2	NP_001171725.1|NP_056107.1	Q9BSJ8	ESYT1_HUMAN	extended synaptotagmin-like protein 1	20					lipid transport (GO:0006869)	integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|large_intestine(4)|lung(10)|ovary(5)|prostate(1)|skin(3)|urinary_tract(1)	28						GCCCTCTGCTCCCTCCGACCC	0.716																																					p.P20A		.											.	ESYT1-95	0			c.C58G						.						32.0	35.0	34.0					12																	56522161		2202	4299	6501	SO:0001583	missense	23344	exon1			TCTGCTCCCTCCG	AK074368	CCDS8904.1, CCDS53801.1	12q13.2	2014-07-02	2009-06-23	2009-06-23		ENSG00000139641		"""Synaptotagmins"""	29534	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member A"""	FAM62A		9872452, 10350628, 17672888	Standard	NM_015292		Approved	MBC2, KIAA0747	uc001sjr.3	Q9BSJ8		ENST00000394048.5:c.58C>G	12.37:g.56522161C>G	ENSP00000377612:p.Pro20Ala	Somatic	13	0		WXS	Illumina GAIIx	Phase_I	76	17	NM_015292	0	0	43	51	8	A0FGR7|A8K2S2|O94848|Q6PJN4|Q9H6J1|Q9H6W2|Q9Y416	Missense_Mutation	SNP	ENST00000394048.5	37	CCDS8904.1	.	.	.	.	.	.	.	.	.	.	C	15.88	2.963900	0.53507	.	.	ENSG00000139641	ENST00000394048;ENST00000402331;ENST00000267113;ENST00000541590	T;T;T	0.54279	0.59;0.58;0.58	4.05	4.05	0.47172	.	0.759552	0.12343	N	0.477234	T	0.38585	0.1046	N	0.22421	0.69	0.23314	N	0.99793	B;B	0.29590	0.25;0.071	B;B	0.24155	0.051;0.023	T	0.30880	-0.9963	10	0.62326	D	0.03	-6.8876	12.008	0.53270	0.0:1.0:0.0:0.0	.	20;20	Q9BSJ8-2;Q9BSJ8	.;ESYT1_HUMAN	A	20	ENSP00000377612:P20A;ENSP00000267113:P20A;ENSP00000445952:P20A	ENSP00000267113:P20A	P	+	1	0	ESYT1	54808428	0.053000	0.20554	0.335000	0.25508	0.595000	0.36748	1.550000	0.36223	2.552000	0.86080	0.561000	0.74099	CCC	.		0.716	ESYT1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000407906.1	NM_015292	
BAZ2A	11176	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	57005765	57005765	+	Silent	SNP	G	G	A			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr12:57005765G>A	ENST00000551812.1	-	6	1600	c.1407C>T	c.(1405-1407)gtC>gtT	p.V469V	BAZ2A_ENST00000179765.5_Silent_p.V437V|BAZ2A_ENST00000549884.1_Silent_p.V467V|BAZ2A_ENST00000379441.3_Silent_p.V439V	NM_013449.3	NP_038477.2	Q9UIF9	BAZ2A_HUMAN	bromodomain adjacent to zinc finger domain, 2A	469					chromatin remodeling (GO:0006338)|chromatin silencing at rDNA (GO:0000183)|DNA methylation (GO:0006306)|heterochromatin assembly involved in chromatin silencing (GO:0070869)|histone deacetylation (GO:0016575)|histone H3-K9 methylation (GO:0051567)|histone H4 deacetylation (GO:0070933)|histone H4-K20 methylation (GO:0034770)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromatin silencing complex (GO:0005677)|nucleolus (GO:0005730)|rDNA heterochromatin (GO:0033553)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|lysine-acetylated histone binding (GO:0070577)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(15)|urinary_tract(1)	31						AAGCTGGAGAGACCACTGAGA	0.552																																					p.V469V		.											.	BAZ2A-22	0			c.C1407T						.						59.0	65.0	63.0					12																	57005765		1950	4160	6110	SO:0001819	synonymous_variant	11176	exon6			TGGAGAGACCACT	AB032254	CCDS44924.1, CCDS73483.1	12q13.3	2013-01-28				ENSG00000076108		"""Zinc fingers, PHD-type"""	962	protein-coding gene	gene with protein product	"""TTF-I interacting peptide 5"""	605682				10662543, 11532953	Standard	XM_005268596		Approved	KIAA0314, TIP5, WALp3	uc001slq.1	Q9UIF9	OTTHUMG00000170332	ENST00000551812.1:c.1407C>T	12.37:g.57005765G>A		Somatic	108	0		WXS	Illumina GAIIx	Phase_I	359	44	NM_013449	0	0	49	114	65	B3KN66|O00536|O15030|Q68DI8|Q96H26	Silent	SNP	ENST00000551812.1	37	CCDS44924.1	.	.	.	.	.	.	.	.	.	.	G	9.606	1.129925	0.21041	.	.	ENSG00000076108	ENST00000551996	.	.	.	5.09	5.09	0.68999	.	.	.	.	.	T	0.72301	0.3443	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.70285	-0.4914	4	.	.	.	.	16.8048	0.85623	0.0:0.0:1.0:0.0	.	.	.	.	F	117	.	.	S	-	2	0	BAZ2A	55292032	0.998000	0.40836	1.000000	0.80357	0.952000	0.60782	1.098000	0.31000	2.756000	0.94617	0.561000	0.74099	TCT	.		0.552	BAZ2A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408561.1	NM_013449	
SLC16A7	9194	broad.mit.edu;bcgsc.ca	37	12	60165060	60165060	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr12:60165060G>T	ENST00000261187.4	+	3	442	c.278G>T	c.(277-279)gGc>gTc	p.G93V	SLC16A7_ENST00000547379.1_Missense_Mutation_p.G93V|SLC16A7_ENST00000543448.1_5'UTR|SLC16A7_ENST00000552432.1_Missense_Mutation_p.G93V|SLC16A7_ENST00000552024.1_Missense_Mutation_p.G93V	NM_004731.4	NP_004722.2	O60669	MOT2_HUMAN	solute carrier family 16 (monocarboxylate transporter), member 7	93					lactate transmembrane transport (GO:0035873)|pyruvate transmembrane transport (GO:1901475)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	lactate transmembrane transporter activity (GO:0015129)|pyruvate secondary active transmembrane transporter activity (GO:0005477)|pyruvate transmembrane transporter activity (GO:0050833)|secondary active monocarboxylate transmembrane transporter activity (GO:0015355)|symporter activity (GO:0015293)			endometrium(1)|large_intestine(14)|liver(2)|lung(11)|ovary(1)|skin(1)	30				GBM - Glioblastoma multiforme(3;0.0303)	Gamma Hydroxybutyric Acid(DB01440)|Niflumic Acid(DB04552)|Probenecid(DB01032)|Pyruvic acid(DB00119)	ATAGCAGGAGGCTTATTATGC	0.458																																					p.G93V		.											.	SLC16A7-91	0			c.G278T						.						247.0	216.0	227.0					12																	60165060		2203	4300	6503	SO:0001583	missense	9194	exon4			CAGGAGGCTTATT	AF049608	CCDS8961.1	12q14.1	2013-07-18	2013-07-18		ENSG00000118596	ENSG00000118596		"""Solute carriers"""	10928	protein-coding gene	gene with protein product		603654	"""solute carrier family 16 (monocarboxylic acid transporters), member 7"""			9786900	Standard	NM_004731		Approved	MCT2	uc001sqt.4	O60669	OTTHUMG00000169923	ENST00000261187.4:c.278G>T	12.37:g.60165060G>T	ENSP00000261187:p.Gly93Val	Somatic	261	1		WXS	Illumina GAIIx	Phase_I	720	47	NM_001270622	0	0	2	2	0	Q8NEM3|Q9UPB3	Missense_Mutation	SNP	ENST00000261187.4	37	CCDS8961.1	.	.	.	.	.	.	.	.	.	.	G	19.59	3.855274	0.71719	.	.	ENSG00000118596	ENST00000552432;ENST00000547379;ENST00000552024;ENST00000548610;ENST00000261187	T;T;T;T;T	0.52057	0.68;0.68;0.68;0.68;0.68	5.94	5.94	0.96194	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.79464	0.4450	H	0.94886	3.595	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.84162	0.0429	9	.	.	.	.	20.3552	0.98837	0.0:0.0:1.0:0.0	.	93	O60669	MOT2_HUMAN	V	93	ENSP00000449547:G93V;ENSP00000448071:G93V;ENSP00000448742:G93V;ENSP00000446722:G93V;ENSP00000261187:G93V	.	G	+	2	0	SLC16A7	58451327	1.000000	0.71417	0.954000	0.39281	0.111000	0.19643	9.751000	0.98889	2.812000	0.96745	0.557000	0.71058	GGC	.		0.458	SLC16A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406587.1	NM_004731	
AMDHD1	144193	hgsc.bcm.edu	37	12	96337183	96337183	+	Missense_Mutation	SNP	A	A	G	rs7955450	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr12:96337183A>G	ENST00000266736.2	+	1	113	c.7A>G	c.(7-9)Agc>Ggc	p.S3G	CCDC38_ENST00000546386.1_5'Flank|CCDC38_ENST00000344280.3_5'Flank|CCDC38_ENST00000549752.1_5'Flank	NM_152435.2	NP_689648.2	Q96NU7	HUTI_HUMAN	amidohydrolase domain containing 1	3			S -> G (in dbSNP:rs7955450). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15221005, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:16541075}.		cellular nitrogen compound metabolic process (GO:0034641)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	imidazolonepropionase activity (GO:0050480)|metal ion binding (GO:0046872)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|skin(1)	22						CGACATGGCAAGCGGCCACAG	0.736													G|||	3598	0.71845	0.702	0.6888	5008	,	,		10480	0.9554		0.6004	False		,,,				2504	0.6391				p.S3G		.											.	AMDHD1-90	0			c.A7G						.						2.0	3.0	3.0					12																	96337183		1177	2379	3556	SO:0001583	missense	144193	exon1			ATGGCAAGCGGCC	AB075878	CCDS9057.1	12q23.1	2006-02-02				ENSG00000139344			28577	protein-coding gene	gene with protein product							Standard	NM_152435		Approved	MGC35366	uc001tel.2	Q96NU7	OTTHUMG00000170353	ENST00000266736.2:c.7A>G	12.37:g.96337183A>G	ENSP00000266736:p.Ser3Gly	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	19	19	NM_152435	0	0	0	1	1	A8K463|Q68CI8	Missense_Mutation	SNP	ENST00000266736.2	37	CCDS9057.1	1561	0.7147435897435898	348	0.7073170731707317	233	0.643646408839779	540	0.9440559440559441	440	0.5804749340369393	G	5.553	0.286982	0.10513	.	.	ENSG00000139344	ENST00000266736	T	0.30714	1.52	4.39	-8.69	0.00855	.	0.734274	0.13810	N	0.361153	T	0.00012	0.0000	N	0.01576	-0.805	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.28427	-1.0044	9	0.21540	T	0.41	.	1.8829	0.03231	0.44:0.0902:0.1959:0.2739	rs7955450;rs17856824;rs58541549;rs7955450	3	Q96NU7	HUTI_HUMAN	G	3	ENSP00000266736:S3G	ENSP00000266736:S3G	S	+	1	0	AMDHD1	94861314	0.000000	0.05858	0.000000	0.03702	0.134000	0.20937	-0.592000	0.05747	-2.316000	0.00645	-1.140000	0.01884	AGC	A|0.273;G|0.727		0.736	AMDHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408640.1	NM_152435	
AMDHD1	144193	hgsc.bcm.edu	37	12	96337225	96337225	+	Silent	SNP	C	C	T	rs1436121	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr12:96337225C>T	ENST00000266736.2	+	1	155	c.49C>T	c.(49-51)Ctg>Ttg	p.L17L	CCDC38_ENST00000546386.1_5'Flank|CCDC38_ENST00000344280.3_5'Flank|CCDC38_ENST00000549752.1_5'Flank	NM_152435.2	NP_689648.2	Q96NU7	HUTI_HUMAN	amidohydrolase domain containing 1	17					cellular nitrogen compound metabolic process (GO:0034641)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	imidazolonepropionase activity (GO:0050480)|metal ion binding (GO:0046872)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|skin(1)	22						GCAAGTGGTGCTGGTGTGCGC	0.741													C|||	1276	0.254792	0.09	0.1297	5008	,	,		11076	0.4732		0.2445	False		,,,				2504	0.3517				p.L17L		.											.	AMDHD1-90	0			c.C49T						.	C		259,2703		9,241,1231	3.0	4.0	4.0		49	1.4	1.0	12	dbSNP_88	4	983,4553		75,833,1860	no	coding-synonymous	AMDHD1	NM_152435.2		84,1074,3091	TT,TC,CC		17.7565,8.7441,14.6152		17/427	96337225	1242,7256	1481	2768	4249	SO:0001819	synonymous_variant	144193	exon1			GTGGTGCTGGTGT	AB075878	CCDS9057.1	12q23.1	2006-02-02				ENSG00000139344			28577	protein-coding gene	gene with protein product							Standard	NM_152435		Approved	MGC35366	uc001tel.2	Q96NU7	OTTHUMG00000170353	ENST00000266736.2:c.49C>T	12.37:g.96337225C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	27	27	NM_152435	0	0	0	1	1	A8K463|Q68CI8	Silent	SNP	ENST00000266736.2	37	CCDS9057.1																																																																																			C|0.752;T|0.248		0.741	AMDHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408640.1	NM_152435	
FAM109A	144717	hgsc.bcm.edu	37	12	111800827	111800835	+	In_Frame_Del	DEL	GCCACCCCC	GCCACCCCC	-	rs3840795|rs139032867|rs199734407|rs200911236	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	GCCACCCCC	GCCACCCCC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr12:111800827_111800835delGCCACCCCC	ENST00000547838.2	-	2	494_502	c.397_405delGGGGGTGGC	c.(397-405)gggggtggcdel	p.GGG133del	FAM109A_ENST00000450786.2_In_Frame_Del_p.113_116AGVA>A|FAM109A_ENST00000548163.1_In_Frame_Del_p.GGG133del|FAM109A_ENST00000361483.3_In_Frame_Del_p.GGG146del|FAM109A_ENST00000392658.5_In_Frame_Del_p.GGG133del			Q8N4B1	SESQ1_HUMAN	family with sequence similarity 109, member A	133					endosome organization (GO:0007032)|receptor recycling (GO:0001881)|retrograde transport, endosome to Golgi (GO:0042147)	clathrin-coated vesicle (GO:0030136)|early endosome (GO:0005769)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	protein homodimerization activity (GO:0042803)	p.G133M(1)|p.G146_G148delGGG(1)|p.G133_G135delGGG(1)		breast(1)|endometrium(1)|lung(1)|ovary(1)	4						gcagggCCATGCCACCCCCGCCACGTACA	0.732														1710	0.341454	0.233	0.3732	5008	,	,		9526	0.6518		0.2078	False		,,,				2504	0.2832				p.146_148del		.											.	FAM109A-90	3	Deletion - In frame(2)|Substitution - Missense(1)	breast(2)|ovary(1)	c.436_444del						.		,,	674,3090		134,406,1342				http://www.ncbi.nlm.nih.gov/sites/varvu?gene	,,	-4.5	0.0		dbSNP_107	6	1126,6432		186,754,2839	no	coding,coding,coding	FAM109A	NM_144671.4,NM_001177997.1,NM_001177996.1	,,	320,1160,4181	A1A1,A1R,RR		14.8981,17.9065,15.8983	,,	,,		1800,9522				SO:0001651	inframe_deletion	144717	exon4			GGCCATGCCACCC	BC034809	CCDS9152.1, CCDS53833.1	12q24.12	2013-01-10			ENSG00000198324	ENSG00000198324		"""Pleckstrin homology (PH) domain containing"""	26509	protein-coding gene	gene with protein product		614239				12477932	Standard	NM_144671		Approved	FLJ32356	uc009zvu.3	Q8N4B1	OTTHUMG00000169547	ENST00000547838.2:c.397_405delGGGGGTGGC	12.37:g.111800827_111800835delGCCACCCCC	ENSP00000447353:p.Gly133_Gly135del	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	16	14	NM_001177996	0	0	0	0	0	J3KP50|Q6PJL9|Q96MH8	In_Frame_Del	DEL	ENST00000547838.2	37	CCDS9152.1																																																																																			.		0.732	FAM109A-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404768.2	NM_144671	
HECTD4	283450	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	112600907	112600907	+	Silent	SNP	A	A	C			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr12:112600907A>C	ENST00000430131.2	-	74	12938	c.11793T>G	c.(11791-11793)ggT>ggG	p.G3931G	HECTD4_ENST00000549141.1_5'Flank|HECTD4_ENST00000550722.1_Silent_p.G4207G|HECTD4_ENST00000377560.5_Silent_p.G4181G			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	3931	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										CAGTGTCGGGACCCCCATCTT	0.627																																					p.G4219G		.											.	.	0			c.T12657G						.						97.0	108.0	105.0					12																	112600907		2052	4200	6252	SO:0001819	synonymous_variant	283450	exon75			GTCGGGACCCCCA	AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.11793T>G	12.37:g.112600907A>C		Somatic	252	3		WXS	Illumina GAIIx	Phase_I	415	117	NM_001109662	0	0	5	7	2	L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Silent	SNP	ENST00000430131.2	37																																																																																				.		0.627	HECTD4-202	KNOWN	basic	protein_coding	protein_coding		NM_173813	
LINC00173	100287569	ucsc.edu;bcgsc.ca	37	12	116972579	116972579	+	RNA	SNP	A	A	G	rs554254541		TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr12:116972579A>G	ENST00000480237.1	+	0	850					NR_027345.1		Q6ZV60	YL023_HUMAN	long intergenic non-protein coding RNA 173																		AGCACAGGAAAAGGACAAGGG	0.542													A|||	1	0.000199681	0.0008	0.0	5008	,	,		17850	0.0		0.0	False		,,,				2504	0.0				.		.											.	.	0			.						.						128.0	100.0	109.0					12																	116972579		2203	4300	6503			100287569	.			CAGGAAAAGGACA	AC090670, BC038547, BC121822		12q24.22	2012-10-12	2011-08-11	2011-08-11	ENSG00000196668	ENSG00000196668		"""Long non-coding RNAs"""	33791	non-coding RNA	RNA, long non-coding			"""non-protein coding RNA 173"""	NCRNA00173			Standard	NR_027345		Approved	FLJ42957	uc001tvx.1	Q6ZV60	OTTHUMG00000157726		12.37:g.116972579A>G		Somatic	174	3		WXS	Illumina GAIIx	Phase_I	308	182	.	0	0	0	1	1		RNA	SNP	ENST00000480237.1	37																																																																																				.		0.542	LINC00173-002	KNOWN	basic	lincRNA	processed_transcript	OTTHUMT00000349521.1	NR_027345	
FBRSL1	57666	broad.mit.edu;bcgsc.ca	37	12	133158326	133158326	+	Splice_Site	SNP	G	G	C			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr12:133158326G>C	ENST00000434748.2	+	15	3061		c.e15-1		FBRSL1_ENST00000261673.6_Splice_Site	NM_001142641.1	NP_001136113.1	Q9HCM7	FBSL_HUMAN	fibrosin-like 1								poly(A) RNA binding (GO:0044822)			central_nervous_system(2)|endometrium(1)|stomach(1)	4						TGCCCCCACAGACCCTTTCAG	0.687																																					.		.											.	FBRSL1-70	0			c.2042-1G>C						.						12.0	20.0	17.0					12																	133158326		691	1589	2280	SO:0001630	splice_region_variant	57666	exon15			CCCACAGACCCTT		CCDS45010.1	12q24.33	2008-12-09			ENSG00000112787	ENSG00000112787			29308	protein-coding gene	gene with protein product						10997877	Standard	NM_001142641		Approved	KIAA1545	uc001ukf.3	Q9HCM7	OTTHUMG00000167991	ENST00000434748.2:c.2042-1G>C	12.37:g.133158326G>C		Somatic	100	0		WXS	Illumina GAIIx	Phase_I	325	9	NM_001142641	0	0	0	0	0	Q86XQ1	Splice_Site	SNP	ENST00000434748.2	37	CCDS45010.1	.	.	.	.	.	.	.	.	.	.	G	20.5	3.993536	0.74703	.	.	ENSG00000112787	ENST00000434748;ENST00000261673	.	.	.	4.82	4.82	0.62117	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.5588	0.87901	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FBRSL1	131668399	1.000000	0.71417	1.000000	0.80357	0.718000	0.41266	8.866000	0.92307	2.235000	0.73313	0.400000	0.26472	.	.		0.687	FBRSL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397404.2		Intron
ATP8A2	51761	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	26138139	26138139	+	Silent	SNP	C	C	A			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr13:26138139C>A	ENST00000381655.2	+	16	1585	c.1443C>A	c.(1441-1443)ccC>ccA	p.P481P	ATP8A2_ENST00000255283.8_Silent_p.P441P	NM_016529.4	NP_057613.4	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8A, member 2	441					aging (GO:0007568)|axonogenesis (GO:0007409)|detection of light stimulus involved in visual perception (GO:0050908)|eating behavior (GO:0042755)|inner ear morphogenesis (GO:0042472)|involuntary skeletal muscle contraction (GO:0003011)|negative regulation of cell proliferation (GO:0008285)|neurofilament cytoskeleton organization (GO:0060052)|neuromuscular process controlling posture (GO:0050884)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phospholipid translocation (GO:0061092)|response to auditory stimulus (GO:0010996)|retina layer formation (GO:0010842)|skin development (GO:0043588)	cell projection (GO:0042995)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(17)|lung(31)|ovary(4)|skin(3)|stomach(1)|urinary_tract(1)	72		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		TTGATGACCCCAGGCTGTTGA	0.398																																					p.P481P		.											.	ATP8A2-138	0			c.C1443A						.						118.0	110.0	113.0					13																	26138139		1898	4120	6018	SO:0001819	synonymous_variant	51761	exon16			TGACCCCAGGCTG	AL137256	CCDS41873.1	13q12	2010-04-20	2010-03-31		ENSG00000132932	ENSG00000132932	3.6.3.1	"""ATPases / P-type"""	13533	protein-coding gene	gene with protein product		605870	"""ATPase, aminophospholipid transporter-like, Class I, type 8A, member 2"", ""ATPase, aminophospholipid transporter-like, class I, type 8A, member 2"""			11015572, 19778899	Standard	NM_016529		Approved	ATPIB, ML-1	uc001uqk.3	Q9NTI2	OTTHUMG00000016611	ENST00000381655.2:c.1443C>A	13.37:g.26138139C>A		Somatic	78	0		WXS	Illumina GAIIx	Phase_I	92	36	NM_016529	0	0	0	0	0	Q9H527|Q9NPU6|Q9NTL2|Q9NYM3	Silent	SNP	ENST00000381655.2	37	CCDS41873.1																																																																																			.		0.398	ATP8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044236.2	NM_016529	
DCLK1	9201	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	36410236	36410236	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr13:36410236T>C	ENST00000360631.3	-	8	1374	c.1163A>G	c.(1162-1164)gAa>gGa	p.E388G	DCLK1_ENST00000379893.1_Missense_Mutation_p.E81G|DCLK1_ENST00000255448.4_Missense_Mutation_p.E388G			O15075	DCLK1_HUMAN	doublecortin-like kinase 1	388					axon extension (GO:0048675)|central nervous system development (GO:0007417)|central nervous system projection neuron axonogenesis (GO:0021952)|dendrite morphogenesis (GO:0048813)|endosomal transport (GO:0016197)|forebrain development (GO:0030900)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein activity (GO:0005057)			breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(18)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(6)|urinary_tract(1)	64		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)		TTTATATCGTTCTGTTATTGT	0.368																																					p.E388G		.											.	DCLK1-826	0			c.A1163G						.						252.0	236.0	241.0					13																	36410236		2203	4300	6503	SO:0001583	missense	9201	exon8			TATCGTTCTGTTA	AB002367	CCDS9354.1, CCDS55895.1, CCDS73561.1	13q13.3	2008-02-05	2007-04-02	2007-04-02	ENSG00000133083	ENSG00000133083			2700	protein-coding gene	gene with protein product		604742	"""doublecortin and CaM kinase-like 1"""	DCAMKL1		9747029, 10036192	Standard	NM_004734		Approved	KIAA0369, DCLK, DCDC3A	uc001uvf.3	O15075	OTTHUMG00000016729	ENST00000360631.3:c.1163A>G	13.37:g.36410236T>C	ENSP00000353846:p.Glu388Gly	Somatic	158	0		WXS	Illumina GAIIx	Phase_I	128	47	NM_004734	0	0	0	0	0	B7Z3E9|Q5VZY8|Q5VZZ0|Q5VZZ1	Missense_Mutation	SNP	ENST00000360631.3	37		.	.	.	.	.	.	.	.	.	.	T	16.49	3.137710	0.56936	.	.	ENSG00000133083	ENST00000399319;ENST00000255448;ENST00000360631;ENST00000379893;ENST00000539451	T;T;T	0.38401	1.14;1.14;1.14	6.04	6.04	0.98038	.	0.062950	0.64402	D	0.000001	T	0.43964	0.1271	M	0.68593	2.085	0.80722	D	1	B;B;B	0.22146	0.003;0.065;0.002	B;B;B	0.31245	0.008;0.126;0.008	T	0.29671	-1.0004	10	0.44086	T	0.13	.	16.5885	0.84745	0.0:0.0:0.0:1.0	.	81;388;81	O15075-4;O15075-2;O15075-3	.;.;.	G	80;388;388;81;388	ENSP00000255448:E388G;ENSP00000353846:E388G;ENSP00000369223:E81G	ENSP00000255448:E388G	E	-	2	0	DCLK1	35308236	1.000000	0.71417	0.982000	0.44146	0.921000	0.55340	7.593000	0.82686	2.317000	0.78254	0.460000	0.39030	GAA	.		0.368	DCLK1-010	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000044487.1	NM_004734	
MYO16	23026	hgsc.bcm.edu	37	13	109792825	109792825	+	Missense_Mutation	SNP	C	C	T	rs199777754	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr13:109792825C>T	ENST00000357550.2	+	31	4240	c.4199C>T	c.(4198-4200)gCg>gTg	p.A1400V	MYO16_ENST00000356711.2_Missense_Mutation_p.A1400V	NM_001198950.1	NP_001185879.1			myosin XVI											NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			CCCCCGGCGGCGCCTCCGGGT	0.776													C|||	29	0.00579073	0.0015	0.0086	5008	,	,		6517	0.0		0.0179	False		,,,				2504	0.0031				p.A1422V		.											.	MYO16-142	0			c.C4265T						.	C	VAL/ALA,VAL/ALA	6,3528		0,6,1761	3.0	4.0	3.0		4265,4199	-6.2	0.0	13		3	61,7069		0,61,3504	yes	missense,missense	MYO16	NM_001198950.1,NM_015011.1	64,64	0,67,5265	TT,TC,CC		0.8555,0.1698,0.6283	benign,benign	1422/1881,1400/1859	109792825	67,10597	1767	3565	5332	SO:0001583	missense	23026	exon32			CGGCGGCGCCTCC		CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	ENST00000357550.2:c.4199C>T	13.37:g.109792825C>T	ENSP00000350160:p.Ala1400Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_001198950	0	0	0	0	0		Missense_Mutation	SNP	ENST00000357550.2	37	CCDS32008.1	.	.	.	.	.	.	.	.	.	.	C	2.716	-0.267762	0.05754	0.001698	0.008555	ENSG00000041515	ENST00000356711;ENST00000357550	T;T	0.80909	-1.43;-1.43	4.18	-6.23	0.02052	.	1.421560	0.05654	U	0.585757	T	0.44456	0.1294	N	0.08118	0	0.09310	N	0.999997	B	0.22414	0.069	B	0.14578	0.011	T	0.34950	-0.9808	9	.	.	.	.	1.1331	0.01749	0.2674:0.1192:0.1351:0.4783	.	1400	Q9Y6X6	MYO16_HUMAN	V	1400	ENSP00000349145:A1400V;ENSP00000350160:A1400V	.	A	+	2	0	MYO16	108590826	0.972000	0.33761	0.000000	0.03702	0.005000	0.04900	2.028000	0.41088	-0.850000	0.04152	0.313000	0.20887	GCG	.		0.776	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045746.1	NM_015011	
ING1	3621	hgsc.bcm.edu	37	13	111368316	111368316	+	Silent	SNP	C	C	T	rs9555726	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr13:111368316C>T	ENST00000375774.3	+	1	988	c.526C>T	c.(526-528)Ctg>Ttg	p.L176L	ING1_ENST00000375775.3_Intron|ING1_ENST00000333219.7_Intron|CARS2_ENST00000535398.1_5'Flank|ING1_ENST00000464141.1_Intron|ING1_ENST00000338450.7_Intron	NM_005537.4	NP_005528.3	Q9UK53	ING1_HUMAN	inhibitor of growth family, member 1	176					cell cycle (GO:0007049)|chromatin modification (GO:0016568)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell death (GO:0010941)	nucleus (GO:0005634)	methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(6)|lung(1)|ovary(1)	12	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.188)			GGCCGCATCTCTGCTGACCCG	0.706													C|||	2912	0.58147	0.23	0.6816	5008	,	,		11066	0.7252		0.6909	False		,,,				2504	0.7249				p.L176L		.											.	ING1-515	0			c.C526T						.	C	,,,	1347,2085		295,757,664	14.0	24.0	21.0		526,,,	-5.6	0.0	13	dbSNP_119	21	5238,1736		2020,1198,269	no	coding-synonymous,intron,intron,intron	ING1	NM_005537.3,NM_198217.1,NM_198218.1,NM_198219.1	,,,	2315,1955,933	TT,TC,CC		24.8925,39.2483,36.7192	,,,	176/423,,,	111368316	6585,3821	1716	3487	5203	SO:0001819	synonymous_variant	3621	exon1			GCATCTCTGCTGA		CCDS9515.1, CCDS9516.1, CCDS9517.1, CCDS9518.1	13q34	2013-01-28			ENSG00000153487	ENSG00000153487		"""Zinc fingers, PHD-type"""	6062	protein-coding gene	gene with protein product	"""inhibitor of growth 1"", ""tumor suppressor ING1"", ""growth inhibitor ING1"", ""growth inhibitory protein ING1"""	601566				8944021, 9186514	Standard	NM_198219		Approved	p33ING1, p33ING1b, p24ING1c, p33, p47, p47ING1a	uc001vri.3	Q9UK53	OTTHUMG00000017346	ENST00000375774.3:c.526C>T	13.37:g.111368316C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_005537	0	0	0	5	5	O00532|O43658|Q53ZR3|Q5T9G8|Q5T9G9|Q5T9H0|Q5T9H1|Q9H007|Q9HD98|Q9HD99|Q9NS83|Q9P0U6|Q9UBC6|Q9UIJ1|Q9UIJ2|Q9UIJ3|Q9UIJ4|Q9UK52	Silent	SNP	ENST00000375774.3	37	CCDS9517.1																																																																																			C|0.372;T|0.628		0.706	ING1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000045770.2	NM_005537	
DDHD1	80821	hgsc.bcm.edu	37	14	53619681	53619681	+	Missense_Mutation	SNP	C	C	T	rs61985140	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr14:53619681C>T	ENST00000323669.5	-	1	135	c.136G>A	c.(136-138)Ggc>Agc	p.G46S	RP11-547D23.1_ENST00000554235.1_RNA|DDHD1_ENST00000357758.3_Missense_Mutation_p.G46S|AL356020.1_ENST00000584587.1_RNA|DDHD1_ENST00000395606.1_Missense_Mutation_p.G46S	NM_001160148.1	NP_001153620.1	Q8NEL9	DDHD1_HUMAN	DDHD domain containing 1	46					cell death (GO:0008219)|lipid catabolic process (GO:0016042)	cytoplasm (GO:0005737)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(11)|ovary(3)|prostate(1)	25	Breast(41;0.037)					GGGTCCCCGCCGGGCAGGTGC	0.761													C|||	25	0.00499201	0.0015	0.0058	5008	,	,		9768	0.0		0.0149	False		,,,				2504	0.0041				p.G46S		.											.	DDHD1-92	0			c.G136A						.	C	SER/GLY,SER/GLY,SER/GLY	18,4236		0,18,2109	7.0	10.0	9.0		136,136,136	1.6	1.0	14	dbSNP_129	9	138,7980		1,136,3922	no	missense,missense,missense	DDHD1	NM_001160147.1,NM_001160148.1,NM_030637.2	56,56,56	1,154,6031	TT,TC,CC		1.6999,0.4231,1.2609	benign,benign,benign	46/880,46/901,46/873	53619681	156,12216	2127	4059	6186	SO:0001583	missense	80821	exon1			CCCCGCCGGGCAG	AB051492	CCDS9714.1, CCDS53895.1, CCDS53896.1	14q21	2012-11-23			ENSG00000100523	ENSG00000100523			19714	protein-coding gene	gene with protein product	"""phosphatidic acid-preferring phospholipase A1"""	614603	"""spastic paraplegia 28 (autosomal recessive)"""	SPG28		11214970, 20359546	Standard	NM_030637		Approved	KIAA1705, PA-PLA1	uc001xai.3	Q8NEL9	OTTHUMG00000140305	ENST00000323669.5:c.136G>A	14.37:g.53619681C>T	ENSP00000327104:p.Gly46Ser	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	48	37	NM_001160147	0	0	0	1	1	G5E9D1|Q8WVH3|Q96LL2|Q9C0F8	Missense_Mutation	SNP	ENST00000323669.5	37	CCDS53895.1	15	0.006868131868131868	1	0.0020325203252032522	1	0.0027624309392265192	2	0.0034965034965034965	11	0.014511873350923483	C	8.250	0.808901	0.16467	0.004231	0.016999	ENSG00000100523	ENST00000323669;ENST00000395606;ENST00000357758;ENST00000395610	.	.	.	3.55	1.64	0.23874	.	0.341002	0.26297	N	0.025187	T	0.18635	0.0447	L	0.40543	1.245	0.31479	N	0.667402	B;B;B	0.13145	0.007;0.004;0.003	B;B;B	0.06405	0.002;0.002;0.001	T	0.14559	-1.0468	9	0.33141	T	0.24	-0.5603	6.7849	0.23668	0.0:0.5559:0.3402:0.1039	rs61985140	46;46;46	G5E9D1;Q8NEL9;Q8NEL9-2	.;DDHD1_HUMAN;.	S	46	.	ENSP00000327104:G46S	G	-	1	0	DDHD1	52689431	0.000000	0.05858	0.969000	0.41365	0.297000	0.27493	0.385000	0.20685	0.176000	0.19873	-0.479000	0.04858	GGC	C|0.993;T|0.007		0.761	DDHD1-003	KNOWN	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276901.1		
EXD2	55218	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	69704629	69704629	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr14:69704629G>C	ENST00000409018.3	+	8	1758	c.1630G>C	c.(1630-1632)Gct>Cct	p.A544P	EXD2_ENST00000449989.1_Missense_Mutation_p.A419P|EXD2_ENST00000312994.5_Missense_Mutation_p.A544P|EXD2_ENST00000409242.1_Missense_Mutation_p.A419P|EXD2_ENST00000409014.1_Missense_Mutation_p.A419P|RP11-363J20.2_ENST00000556316.1_lincRNA|EXD2_ENST00000409675.1_Missense_Mutation_p.A419P|EXD2_ENST00000409949.1_Missense_Mutation_p.A419P|EXD2_ENST00000492815.1_3'UTR	NM_001193361.1	NP_001180290.1	Q9NVH0	EXD2_HUMAN	exonuclease 3'-5' domain containing 2	544							3'-5' exonuclease activity (GO:0008408)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(1)|large_intestine(2)|liver(1)|lung(7)|prostate(1)|urinary_tract(1)	14						GCTTCAAGAGGCTGCCAGCCT	0.527																																					p.A544P		.											.	.	0			c.G1630C						.						35.0	38.0	37.0					14																	69704629		2202	4300	6502	SO:0001583	missense	55218	exon8			CAAGAGGCTGCCA	AK001600	CCDS9793.1, CCDS53902.1	14q24.1	2009-02-24	2009-02-24	2009-02-24	ENSG00000081177	ENSG00000081177			20217	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 114"", ""exonuclease 3'-5' domain-like 2"""	C14orf114, EXDL2			Standard	NM_018199		Approved	FLJ10738	uc001xkv.3	Q9NVH0	OTTHUMG00000154496	ENST00000409018.3:c.1630G>C	14.37:g.69704629G>C	ENSP00000387331:p.Ala544Pro	Somatic	182	0		WXS	Illumina GAIIx	Phase_I	255	68	NM_001193361	0	0	2	6	4	B4DIH6|G5E947|Q6AWB6|Q8N3D3	Missense_Mutation	SNP	ENST00000409018.3	37	CCDS53902.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.339779	0.81911	.	.	ENSG00000081177	ENST00000409018;ENST00000409014;ENST00000409675;ENST00000409949;ENST00000409242;ENST00000312994;ENST00000449989	T;T;T;T;T;T;T	0.68903	0.02;-0.36;-0.36;-0.36;-0.36;0.02;-0.36	5.52	5.52	0.82312	.	0.044831	0.85682	D	0.000000	D	0.82972	0.5153	M	0.77820	2.39	0.80722	D	1	D;D;D	0.76494	0.999;0.992;0.996	D;D;D	0.78314	0.991;0.923;0.957	D	0.83912	0.0296	10	0.72032	D	0.01	-12.7287	19.6296	0.95694	0.0:0.0:1.0:0.0	.	544;419;419	G5E947;B3KP95;Q9NVH0	.;.;EXD2_HUMAN	P	544;419;419;419;419;544;419	ENSP00000387331:A544P;ENSP00000386915:A419P;ENSP00000386762:A419P;ENSP00000386632:A419P;ENSP00000386839:A419P;ENSP00000313140:A544P;ENSP00000392177:A419P	ENSP00000313140:A544P	A	+	1	0	EXD2	68774382	1.000000	0.71417	1.000000	0.80357	0.595000	0.36748	9.268000	0.95675	2.873000	0.98535	0.563000	0.77884	GCT	.		0.527	EXD2-002	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000335504.1		
ADAM21	8747	ucsc.edu	37	14	70924602	70924602	+	Missense_Mutation	SNP	T	T	G	rs72735759	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr14:70924602T>G	ENST00000603540.1	+	2	644	c.386T>G	c.(385-387)tTt>tGt	p.F129C	RP11-486O13.4_ENST00000556646.1_lincRNA|ADAM21_ENST00000267499.3_Missense_Mutation_p.F129C	NM_003813.3	NP_003804.2	Q9UKJ8	ADA21_HUMAN	ADAM metallopeptidase domain 21	129					binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	axon (GO:0030424)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(10)|lung(10)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	31				all cancers(60;0.00326)|BRCA - Breast invasive adenocarcinoma(234;0.00646)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)		AGTGCTTGTTTTGGGGGCTTT	0.463																																					p.F129C		.											.	ADAM21-92	0			c.T386G						.						84.0	100.0	94.0					14																	70924602		2203	4300	6503	SO:0001583	missense	8747	exon2			CTTGTTTTGGGGG	AF029900	CCDS9804.1	14q24.1	2008-09-05	2005-08-18		ENSG00000139985	ENSG00000139985		"""ADAM metallopeptidase domain containing"""	200	protein-coding gene	gene with protein product		603713	"""a disintegrin and metalloproteinase domain 21"""			9469942	Standard	NM_003813		Approved	ADAM31	uc001xmd.3	Q9UKJ8		ENST00000603540.1:c.386T>G	14.37:g.70924602T>G	ENSP00000474385:p.Phe129Cys	Somatic	85	5		WXS	Illumina GAIIx	Phase_I	74	16	NM_003813	0	0	0	0	0	O43507|Q2VPC6|Q32MR0	Missense_Mutation	SNP	ENST00000603540.1	37	CCDS9804.1	.	.	.	.	.	.	.	.	.	.	T	0.044	-1.273422	0.01421	.	.	ENSG00000139985	ENST00000267499	T	0.01133	5.29	3.76	-7.52	0.01341	Peptidase M12B, propeptide (1);	1.704650	0.03782	U	0.261498	T	0.01523	0.0049	L	0.60067	1.865	0.09310	N	1	B	0.33299	0.407	B	0.37780	0.258	T	0.14924	-1.0455	10	0.46703	T	0.11	.	1.36	0.02189	0.2433:0.3101:0.2623:0.1842	.	129	Q9UKJ8	ADA21_HUMAN	C	129	ENSP00000267499:F129C	ENSP00000267499:F129C	F	+	2	0	ADAM21	69994355	0.000000	0.05858	0.007000	0.13788	0.108000	0.19459	-1.073000	0.03430	-2.633000	0.00433	-0.379000	0.06801	TTT	T|0.837;G|0.164		0.463	ADAM21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413008.3		
ADAM21	8747	ucsc.edu;bcgsc.ca	37	14	70924643	70924643	+	Missense_Mutation	SNP	T	T	C	rs78114303		TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr14:70924643T>C	ENST00000603540.1	+	2	685	c.427T>C	c.(427-429)Tat>Cat	p.Y143H	RP11-486O13.4_ENST00000556646.1_lincRNA|ADAM21_ENST00000267499.3_Missense_Mutation_p.Y143H	NM_003813.3	NP_003804.2	Q9UKJ8	ADA21_HUMAN	ADAM metallopeptidase domain 21	143					binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	axon (GO:0030424)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(10)|lung(10)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	31				all cancers(60;0.00326)|BRCA - Breast invasive adenocarcinoma(234;0.00646)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)		TGGCCTCACTTATGAAATTGA	0.433																																					p.Y143H		.											.	ADAM21-92	0			c.T427C						.						55.0	63.0	60.0					14																	70924643		2203	4300	6503	SO:0001583	missense	8747	exon2			CTCACTTATGAAA	AF029900	CCDS9804.1	14q24.1	2008-09-05	2005-08-18		ENSG00000139985	ENSG00000139985		"""ADAM metallopeptidase domain containing"""	200	protein-coding gene	gene with protein product		603713	"""a disintegrin and metalloproteinase domain 21"""			9469942	Standard	NM_003813		Approved	ADAM31	uc001xmd.3	Q9UKJ8		ENST00000603540.1:c.427T>C	14.37:g.70924643T>C	ENSP00000474385:p.Tyr143His	Somatic	53	1		WXS	Illumina GAIIx	Phase_I	45	11	NM_003813	0	0	0	0	0	O43507|Q2VPC6|Q32MR0	Missense_Mutation	SNP	ENST00000603540.1	37	CCDS9804.1	.	.	.	.	.	.	.	.	.	.	T	8.985	0.976280	0.18736	.	.	ENSG00000139985	ENST00000267499	T	0.15952	2.38	3.76	2.59	0.31030	Peptidase M12B, propeptide (1);	0.000000	0.39146	U	0.001443	T	0.48857	0.1523	H	0.94542	3.55	0.30013	N	0.815021	D	0.76494	0.999	D	0.85130	0.997	T	0.55774	-0.8088	10	0.87932	D	0	.	9.3062	0.37876	0.0:0.088:0.0:0.912	.	143	Q9UKJ8	ADA21_HUMAN	H	143	ENSP00000267499:Y143H	ENSP00000267499:Y143H	Y	+	1	0	ADAM21	69994396	0.998000	0.40836	0.563000	0.28383	0.010000	0.07245	3.395000	0.52558	0.610000	0.30035	-0.385000	0.06624	TAT	T|0.987;C|0.013		0.433	ADAM21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413008.3		
ISM2	145501	hgsc.bcm.edu	37	14	77965094	77965094	+	Silent	SNP	G	G	A	rs12431905	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr14:77965094G>A	ENST00000342219.4	-	1	99	c.43C>T	c.(43-45)Ctg>Ttg	p.L15L	ISM2_ENST00000412904.1_Silent_p.L15L|ISM2_ENST00000493585.1_Silent_p.L15L|ISM2_ENST00000393684.3_5'UTR|ISM2_ENST00000429906.1_Silent_p.L15L	NM_199296.2	NP_954993.1	Q6H9L7	ISM2_HUMAN	isthmin 2	15						extracellular region (GO:0005576)				endometrium(3)|large_intestine(4)|lung(11)|prostate(1)|skin(1)|urinary_tract(1)	21						GCCAGCAGCAGCACGCAGAGG	0.731													G|||	270	0.0539137	0.0061	0.1571	5008	,	,		10603	0.0129		0.0755	False		,,,				2504	0.0654				p.L15L		.											.	ISM2-91	0			c.C43T						.	G	,	51,3145		0,51,1547	3.0	3.0	3.0		43,43	-4.3	0.0	14	dbSNP_120	3	420,5934		10,400,2767	no	coding-synonymous,coding-synonymous	ISM2	NM_182509.3,NM_199296.2	,	10,451,4314	AA,AG,GG		6.61,1.5957,4.9319	,	15/293,15/572	77965094	471,9079	1598	3177	4775	SO:0001819	synonymous_variant	145501	exon1			GCAGCAGCACGCA	AK056709	CCDS9864.1, CCDS45143.1	14q24.3	2013-05-15	2013-05-15	2008-12-23	ENSG00000100593	ENSG00000100593			23176	protein-coding gene	gene with protein product	"""thrombospondin and AMOP containing isthmin-like 1"""	612684	"""thrombospondin, type I domain-containing 3"", ""thrombospondin, type I, domain containing 3"", ""isthmin 2 homolog (zebrafish)"""	THSD3		15194193	Standard	NM_199296		Approved	FLJ32147, TAIL1	uc001xtz.3	Q6H9L7	OTTHUMG00000158563	ENST00000342219.4:c.43C>T	14.37:g.77965094G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	11	7	NM_199296	0	0	0	1	1	A8K6D5|O95432|Q495U5|Q68CN3|Q86TQ7|Q86TW3|Q86TW4|Q8N501|Q8NBL0	Silent	SNP	ENST00000342219.4	37	CCDS9864.1																																																																																			G|0.934;A|0.066		0.731	ISM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000351309.1	NM_182509	
BCL11B	64919	hgsc.bcm.edu	37	14	99641147	99641147	+	Silent	SNP	G	G	A			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr14:99641147G>A	ENST00000357195.3	-	4	2035	c.2026C>T	c.(2026-2028)Ctg>Ttg	p.L676L	BCL11B_ENST00000443726.2_Silent_p.L482L|BCL11B_ENST00000345514.2_Silent_p.L605L	NM_001282237.1|NM_138576.2	NP_001269166.1|NP_612808.1	Q9C0K0	BC11B_HUMAN	B-cell CLL/lymphoma 11B (zinc finger protein)	676					alpha-beta T cell differentiation (GO:0046632)|epithelial cell morphogenesis (GO:0003382)|keratinocyte development (GO:0003334)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|odontogenesis of dentin-containing tooth (GO:0042475)|olfactory bulb axon guidance (GO:0071678)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive T cell selection (GO:0043368)|post-embryonic camera-type eye development (GO:0031077)|regulation of keratinocyte proliferation (GO:0010837)|regulation of lipid metabolic process (GO:0019216)|regulation of neuron differentiation (GO:0045664)|striatal medium spiny neuron differentiation (GO:0021773)|T cell differentiation in thymus (GO:0033077)|T cell receptor V(D)J recombination (GO:0033153)|thymus development (GO:0048538)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(3)|breast(1)|central_nervous_system(9)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(9)|prostate(2)|skin(2)	34		Melanoma(154;0.0866)|all_epithelial(191;0.241)		COAD - Colon adenocarcinoma(157;0.103)		GGGCTGGGCAGCGGCGCGGGC	0.766			T	TLX3	T-ALL																																p.L676L		.		Dom	yes		14	14q32.1	64919	B-cell CLL/lymphoma 11B  (CTIP2)		L	.	BCL11B-1147	0			c.C2026T						.						10.0	10.0	10.0					14																	99641147		2082	4053	6135	SO:0001819	synonymous_variant	64919	exon4			TGGGCAGCGGCGC	AJ404614	CCDS9949.1, CCDS9950.1	14q32	2013-01-08			ENSG00000127152	ENSG00000127152		"""Zinc fingers, C2H2-type"""	13222	protein-coding gene	gene with protein product		606558		ZNF856B		11719382, 16950772	Standard	NM_138576		Approved	CTIP-2, CTIP2, hRIT1-alpha	uc001yga.3	Q9C0K0	OTTHUMG00000028967	ENST00000357195.3:c.2026C>T	14.37:g.99641147G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	25	11	NM_138576	0	0	0	0	0	Q9H162	Silent	SNP	ENST00000357195.3	37	CCDS9950.1																																																																																			.		0.766	BCL11B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000072332.2	NM_138576	
CYP46A1	10858	bcgsc.ca	37	14	100157470	100157470	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr14:100157470C>T	ENST00000261835.3	+	2	276	c.172C>T	c.(172-174)Cgt>Tgt	p.R58C	CYP46A1_ENST00000423126.2_5'UTR|RP11-543C4.3_ENST00000555875.1_lincRNA	NM_006668.1	NP_006659.1	Q9Y6A2	CP46A_HUMAN	cytochrome P450, family 46, subfamily A, polypeptide 1	58					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cholesterol catabolic process (GO:0006707)|nervous system development (GO:0007399)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	cholesterol 24-hydroxylase activity (GO:0033781)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid hydroxylase activity (GO:0008395)			breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(12)|prostate(1)|skin(1)	25		Melanoma(154;0.0866)|all_epithelial(191;0.179)				GGTTGGTGGCCGTGTGCTCCA	0.498																																					p.R58C		.											.	CYP46A1-90	0			c.C172T						.						387.0	304.0	332.0					14																	100157470		2203	4300	6503	SO:0001583	missense	10858	exon2			GGTGGCCGTGTGC	AF094480	CCDS9954.1	14q32.2	2013-05-03	2003-02-14	2003-02-28	ENSG00000036530	ENSG00000036530		"""Cytochrome P450s"""	2641	protein-coding gene	gene with protein product		604087	"""cytochrome P450, subfamily 46 (cholesterol 24-hydroxylase)"""	CYP46		10377398	Standard	NM_006668		Approved		uc001ygo.3	Q9Y6A2	OTTHUMG00000171510	ENST00000261835.3:c.172C>T	14.37:g.100157470C>T	ENSP00000261835:p.Arg58Cys	Somatic	225	2		WXS	Illumina GAIIx	Phase_I	325	12	NM_006668	0	0	0	0	0	B4DHP8|E7EQG9|Q8N2B0	Missense_Mutation	SNP	ENST00000261835.3	37	CCDS9954.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.37|14.37	2.514842|2.514842	0.44763|0.44763	.|.	.|.	ENSG00000036530|ENSG00000036530	ENST00000380228|ENST00000261835	.|T	.|0.69175	.|-0.38	3.62|3.62	3.62|3.62	0.41486|0.41486	.|.	.|0.000000	.|0.34986	.|N	.|0.003528	T|T	0.44350|0.44350	0.1289|0.1289	N|N	0.08118|0.08118	0|0	0.80722|0.80722	D|D	1|1	.|B	.|0.26547	.|0.152	.|B	.|0.23852	.|0.049	T|T	0.47774|0.47774	-0.9091|-0.9091	5|10	.|0.49607	.|T	.|0.09	.|.	11.097|11.097	0.48150|0.48150	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|58	.|Q9Y6A2	.|CP46A_HUMAN	L|C	44|58	.|ENSP00000261835:R58C	.|ENSP00000261835:R58C	P|R	+|+	2|1	0|0	CYP46A1|CYP46A1	99227223|99227223	0.996000|0.996000	0.38824|0.38824	1.000000|1.000000	0.80357|0.80357	0.982000|0.982000	0.71751|0.71751	1.203000|1.203000	0.32284|0.32284	2.319000|2.319000	0.78375|0.78375	0.563000|0.563000	0.77884|0.77884	CCG|CGT	.		0.498	CYP46A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413814.1		
YY1	7528	hgsc.bcm.edu	37	14	100705788	100705790	+	In_Frame_Del	DEL	CCA	CCA	-	rs568477380|rs76675246	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	CCA	CCA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr14:100705788_100705790delCCA	ENST00000262238.4	+	1	467_469	c.207_209delCCA	c.(205-210)ggccac>ggc	p.H80del	RP11-638I2.4_ENST00000554537.1_RNA	NM_003403.3	NP_003394.1	P25490	TYY1_HUMAN	YY1 transcription factor	80	Interaction with the SMAD1/SMAD4 complex.|Poly-His.				anterior/posterior pattern specification (GO:0009952)|camera-type eye morphogenesis (GO:0048593)|cell differentiation (GO:0030154)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|chromosome organization (GO:0051276)|double-strand break repair via homologous recombination (GO:0000724)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to prostaglandin F (GO:0034696)|response to UV-C (GO:0010225)|RNA localization (GO:0006403)|spermatogenesis (GO:0007283)	Ino80 complex (GO:0031011)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|four-way junction DNA binding (GO:0000400)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|large_intestine(1)|liver(2)|lung(1)|prostate(4)|skin(1)	11		Melanoma(154;0.152)				gGCACGCCGGccaccaccaccac	0.724														58	0.0115815	0.0038	0.0072	5008	,	,		10994	0.0		0.0388	False		,,,				2504	0.0092				p.69_70del		.											.	YY1-226	0			c.207_209del						.																																			SO:0001651	inframe_deletion	7528	exon1			CGCCGGCCACCAC	BC020324	CCDS9957.1	14q	2013-01-08			ENSG00000100811	ENSG00000100811		"""INO80 complex subunits"", ""Zinc fingers, C2H2-type"""	12856	protein-coding gene	gene with protein product	"""INO80 complex subunit S"", ""Yin and Yang 1 protein"""	600013				1655281, 7912122	Standard	NM_003403		Approved	NF-E1, DELTA, UCRBP, YIN-YANG-1, INO80S	uc001ygy.2	P25490	OTTHUMG00000150479	ENST00000262238.4:c.207_209delCCA	14.37:g.100705797_100705799delCCA	ENSP00000262238:p.His80del	Somatic	2	1		WXS	Illumina GAIIx	Phase_I	32	23	NM_003403	0	0	0	0	0	Q14935	In_Frame_Del	DEL	ENST00000262238.4	37	CCDS9957.1																																																																																			.		0.724	YY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318277.1	NM_003403	
RTL1	388015	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	101348688	101348688	+	Missense_Mutation	SNP	A	A	T			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr14:101348688A>T	ENST00000534062.1	-	1	2496	c.2438T>A	c.(2437-2439)aTc>aAc	p.I813N	MIR431_ENST00000385266.1_RNA|MIR136_ENST00000385207.1_RNA|MIR432_ENST00000606207.1_RNA|MIR127_ENST00000384876.1_RNA|MIR433_ENST00000384837.1_RNA	NM_001134888.2	NP_001128360.1	A6NKG5	RTL1_HUMAN	retrotransposon-like 1	813					multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)				breast(1)|endometrium(5)|kidney(4)|large_intestine(1)|lung(5)|pancreas(1)|prostate(2)|skin(2)	21						GACGAATTCGATGAAGTTTCG	0.557																																					p.I813N		.											.	RTL1-46	0			c.T2438A						.						128.0	119.0	121.0					14																	101348688		692	1591	2283	SO:0001583	missense	388015	exon1			AATTCGATGAAGT		CCDS53910.1	14q32.2	2012-04-18			ENSG00000254656	ENSG00000254656			14665	protein-coding gene	gene with protein product		611896				16155747, 15854907, 12796779	Standard	NM_001134888		Approved	PEG11, MART1, Mar1	uc010txj.1	A6NKG5	OTTHUMG00000167573	ENST00000534062.1:c.2438T>A	14.37:g.101348688A>T	ENSP00000435342:p.Ile813Asn	Somatic	116	0		WXS	Illumina GAIIx	Phase_I	138	34	NM_001134888	0	0	0	0	0	E9PKS8	Missense_Mutation	SNP	ENST00000534062.1	37	CCDS53910.1	.	.	.	.	.	.	.	.	.	.	A	8.062	0.768305	0.15983	.	.	ENSG00000254656	ENST00000534062	T	0.44482	0.92	3.33	3.33	0.38152	.	1.559340	0.04342	N	0.354286	T	0.45074	0.1324	M	0.64997	1.995	0.09310	N	1	B	0.33379	0.41	B	0.31812	0.136	T	0.45454	-0.9260	10	0.87932	D	0	.	10.3407	0.43877	1.0:0.0:0.0:0.0	.	813	E9PKS8	.	N	813	ENSP00000435342:I813N	ENSP00000435342:I813N	I	-	2	0	RTL1	100418441	0.427000	0.25514	0.002000	0.10522	0.060000	0.15804	6.381000	0.73163	1.771000	0.52183	0.459000	0.35465	ATC	.		0.557	RTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395127.1	NM_001134888	
RTL1	388015	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	101349080	101349080	+	Silent	SNP	G	G	A			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr14:101349080G>A	ENST00000534062.1	-	1	2104	c.2046C>T	c.(2044-2046)acC>acT	p.T682T	MIR431_ENST00000385266.1_RNA|MIR136_ENST00000385207.1_RNA|MIR432_ENST00000606207.1_RNA|MIR127_ENST00000384876.1_RNA|MIR433_ENST00000384837.1_RNA	NM_001134888.2	NP_001128360.1	A6NKG5	RTL1_HUMAN	retrotransposon-like 1	682					multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)				breast(1)|endometrium(5)|kidney(4)|large_intestine(1)|lung(5)|pancreas(1)|prostate(2)|skin(2)	21						ACACATCTTCGGTGCGGTGCC	0.537																																					p.T682T		.											.	RTL1-46	0			c.C2046T						.						132.0	120.0	124.0					14																	101349080		692	1591	2283	SO:0001819	synonymous_variant	388015	exon1			ATCTTCGGTGCGG		CCDS53910.1	14q32.2	2012-04-18			ENSG00000254656	ENSG00000254656			14665	protein-coding gene	gene with protein product		611896				16155747, 15854907, 12796779	Standard	NM_001134888		Approved	PEG11, MART1, Mar1	uc010txj.1	A6NKG5	OTTHUMG00000167573	ENST00000534062.1:c.2046C>T	14.37:g.101349080G>A		Somatic	153	0		WXS	Illumina GAIIx	Phase_I	233	70	NM_001134888	0	0	0	0	0	E9PKS8	Silent	SNP	ENST00000534062.1	37	CCDS53910.1																																																																																			.		0.537	RTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395127.1	NM_001134888	
RYR3	6263	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	34064256	34064256	+	Missense_Mutation	SNP	A	A	T			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr15:34064256A>T	ENST00000389232.4	+	63	9022	c.8952A>T	c.(8950-8952)aaA>aaT	p.K2984N	RYR3_ENST00000415757.3_Missense_Mutation_p.K2984N	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	2984					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		CGCAGATTAAAGGCGTTTCTC	0.453																																					p.K2984N		.											.	RYR3-520	0			c.A8952T						.						95.0	90.0	91.0					15																	34064256		1914	4125	6039	SO:0001583	missense	6263	exon63			GATTAAAGGCGTT		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.8952A>T	15.37:g.34064256A>T	ENSP00000373884:p.Lys2984Asn	Somatic	169	1		WXS	Illumina GAIIx	Phase_I	74	68	NM_001243996	0	0	0	0	0	O15175|Q15412	Missense_Mutation	SNP	ENST00000389232.4	37	CCDS45210.1	.	.	.	.	.	.	.	.	.	.	A	17.75	3.465545	0.63513	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	D;D	0.96913	-4.16;-4.17	5.65	2.11	0.27256	.	0.176452	0.48767	D	0.000172	D	0.96306	0.8795	L	0.51422	1.61	0.38861	D	0.956478	B;D	0.71674	0.42;0.998	B;D	0.67900	0.198;0.954	D	0.94533	0.7738	10	0.45353	T	0.12	.	9.4939	0.38976	0.6573:0.0:0.3427:0.0	.	2984;2984	Q15413-2;Q15413	.;RYR3_HUMAN	N	2984	ENSP00000373884:K2984N;ENSP00000399610:K2984N	ENSP00000354735:K2984N	K	+	3	2	RYR3	31851548	0.995000	0.38212	0.997000	0.53966	0.789000	0.44602	0.378000	0.20569	0.203000	0.20529	0.533000	0.62120	AAA	.		0.453	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1		
LACTB	114294	hgsc.bcm.edu	37	15	63414083	63414083	+	Missense_Mutation	SNP	A	A	C	rs34317102	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr15:63414083A>C	ENST00000261893.4	+	1	85	c.13A>C	c.(13-15)Atg>Ctg	p.M5L	LACTB_ENST00000413507.2_Missense_Mutation_p.M5L	NM_032857.3	NP_116246.2	P83111	LACTB_HUMAN	lactamase, beta	5				M -> L (in Ref. 1 and 2). {ECO:0000305}.		cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	hydrolase activity (GO:0016787)			NS(1)|breast(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)|stomach(1)	12						GTACCGGCTCATGTCAGCAGT	0.751													C|||	3981	0.794928	0.6725	0.8256	5008	,	,		8367	0.997		0.7316	False		,,,				2504	0.7955				p.M5L	Melanoma(85;443 1381 6215 27308 35583)	.											.	LACTB-90	0			c.A13C						.	C	LEU/MET,LEU/MET	1936,668		733,470,99	4.0	4.0	4.0		13,13	3.1	1.0	15	dbSNP_126	4	4375,1183		1737,901,141	yes	missense,missense	LACTB	NM_032857.3,NM_171846.2	15,15	2470,1371,240	CC,CA,AA		21.2846,25.6528,22.6783	benign,benign	5/548,5/374	63414083	6311,1851	1302	2779	4081	SO:0001583	missense	114294	exon1			CGGCTCATGTCAG	AK027808	CCDS10182.1, CCDS45275.1	15q22.1	2012-11-14	2001-12-12	2001-12-14	ENSG00000103642	ENSG00000103642		"""Mitochondrial ribosomal proteins / large subunits"""	16468	protein-coding gene	gene with protein product		608440	"""mitochondrial ribosomal protein L56"""	MRPL56		11707067	Standard	NM_032857		Approved	FLJ14902	uc002alw.3	P83111	OTTHUMG00000132807	ENST00000261893.4:c.13A>C	15.37:g.63414083A>C	ENSP00000261893:p.Met5Leu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_171846	0	0	0	0	0	P83096	Missense_Mutation	SNP	ENST00000261893.4	37	CCDS10182.1	1713	0.7843406593406593	304	0.6178861788617886	287	0.7928176795580111	568	0.993006993006993	554	0.7308707124010554	C	0.674	-0.800779	0.02841	0.743472	0.787154	ENSG00000103642	ENST00000261893;ENST00000413507	T	0.33216	1.42	3.1	3.1	0.35709	.	0.592824	0.14749	N	0.300689	T	0.00012	0.0000	N	0.02539	-0.55	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.37842	-0.9688	9	0.02654	T	1	0.0321	7.626	0.28212	0.2541:0.7459:0.0:0.0	rs34317102	5	P83111	LACTB_HUMAN	L	5	ENSP00000261893:M5L	ENSP00000261893:M5L	M	+	1	0	LACTB	61201136	0.994000	0.37717	0.956000	0.39512	0.117000	0.20001	0.346000	0.19997	0.640000	0.30582	-0.677000	0.03784	ATG	A|0.226;C|0.774		0.751	LACTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256224.1	NM_032857	
SKOR1	390598	hgsc.bcm.edu	37	15	68120014	68120014	+	Silent	SNP	C	C	T	rs62015251	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr15:68120014C>T	ENST00000380035.2	+	2	1906	c.1848C>T	c.(1846-1848)taC>taT	p.Y616Y	SKOR1_ENST00000554054.1_Silent_p.Y588Y|SKOR1_ENST00000554240.1_Silent_p.Y577Y|SKOR1_ENST00000389002.1_Silent_p.Y572Y|SKOR1_ENST00000341418.5_Silent_p.Y556Y			P84550	SKOR1_HUMAN	SKI family transcriptional corepressor 1	616					negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)			endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(7)|urinary_tract(1)	23						GGGAGGCGTACGGCGCGGGGC	0.716													C|||	430	0.0858626	0.0106	0.121	5008	,	,		9530	0.1101		0.1193	False		,,,				2504	0.1033				p.Y556Y		.											.	SKOR1-90	0			c.C1668T						.	C		62,3022		0,62,1480	3.0	4.0	4.0		1716	-1.9	0.1	15	dbSNP_129	4	460,5730		9,442,2644	no	coding-synonymous	SKOR1	NM_001031807.1		9,504,4124	TT,TC,CC		7.4313,2.0104,5.6286		572/922	68120014	522,8752	1542	3095	4637	SO:0001819	synonymous_variant	390598	exon7			GGCGTACGGCGCG		CCDS58374.1	15q23	2011-08-04	2010-06-23	2010-06-23	ENSG00000188779	ENSG00000188779		"""SKI transcriptional corepressors"""	21326	protein-coding gene	gene with protein product	"""transcriptional corepressor CORL1"", ""functional smad suppressing element 15"", ""corepressor for LBX1"""	611273	"""Lbxcor1 homolog (mouse)"""	LBXCOR1		15528197	Standard	NM_001258024		Approved	CORL1, FUSSEL15	uc031qsn.1	P84550		ENST00000380035.2:c.1848C>T	15.37:g.68120014C>T		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	10	8	NM_001258024	0	0	0	0	0	A6NIP4|A6NJY0|Q2VWA5	Silent	SNP	ENST00000380035.2	37																																																																																				C|0.908;T|0.092		0.716	SKOR1-003	KNOWN	not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000410832.1	NM_001031807	
FANCI	55215	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	89790933	89790933	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr15:89790933G>A	ENST00000310775.7	+	2	141	c.55G>A	c.(55-57)Gaa>Aaa	p.E19K	FANCI_ENST00000567996.1_Missense_Mutation_p.E19K|FANCI_ENST00000300027.8_Missense_Mutation_p.E19K|FANCI_ENST00000451393.2_5'UTR	NM_001113378.1	NP_001106849.1	Q9NVI1	FANCI_HUMAN	Fanconi anemia, complementation group I	19					cell cycle (GO:0007049)|DNA repair (GO:0006281)|positive regulation of protein ubiquitination (GO:0031398)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA polymerase binding (GO:0070182)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	Lung NSC(78;0.0472)|all_lung(78;0.089)					CAAACTGCAAGAATTTCTTCA	0.408								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.E19K		.											.	FANCI-92	0			c.G55A						.						115.0	109.0	111.0					15																	89790933		2200	4299	6499	SO:0001583	missense	55215	exon2	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	CTGCAAGAATTTC	BC004277	CCDS10349.2, CCDS45346.1	15q26.1	2014-09-17	2007-05-03	2007-05-03	ENSG00000140525	ENSG00000140525		"""Fanconi anemia, complementation groups"""	25568	protein-coding gene	gene with protein product		611360	"""KIAA1794"""	KIAA1794		14630800, 17460694, 17412408	Standard	NM_001113378		Approved	FLJ10719	uc010bnp.1	Q9NVI1	OTTHUMG00000132993	ENST00000310775.7:c.55G>A	15.37:g.89790933G>A	ENSP00000310842:p.Glu19Lys	Somatic	88	0		WXS	Illumina GAIIx	Phase_I	65	25	NM_001113378	0	0	0	1	1	A4ZVE4|A5YMH4|A6NJZ0|Q96JN1|Q96ST0|Q9BT96	Missense_Mutation	SNP	ENST00000310775.7	37	CCDS45346.1	.	.	.	.	.	.	.	.	.	.	G	11.44	1.638990	0.29157	.	.	ENSG00000140525	ENST00000300027;ENST00000310775;ENST00000447611	T;T;T	0.78595	-1.19;-1.19;-1.19	5.83	1.58	0.23477	.	0.484707	0.20528	N	0.090572	T	0.60379	0.2264	N	0.25144	0.715	0.80722	D	1	B;B	0.09022	0.002;0.0	B;B	0.06405	0.002;0.001	T	0.43245	-0.9403	10	0.27082	T	0.32	-0.7286	8.309	0.32060	0.3332:0.0:0.6668:0.0	.	19;19	Q9NVI1;Q9NVI1-1	FANCI_HUMAN;.	K	19	ENSP00000300027:E19K;ENSP00000310842:E19K;ENSP00000413249:E19K	ENSP00000300027:E19K	E	+	1	0	FANCI	87591937	0.976000	0.34144	0.775000	0.31657	0.910000	0.53928	0.520000	0.22878	0.046000	0.15833	0.561000	0.74099	GAA	.		0.408	FANCI-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421140.1	NM_018193	
KIF7	374654	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	90176983	90176983	+	Silent	SNP	A	A	G			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr15:90176983A>G	ENST00000394412.3	-	12	2602	c.2526T>C	c.(2524-2526)ctT>ctC	p.L842L		NM_198525.2	NP_940927.2	Q2M1P5	KIF7_HUMAN	kinesin family member 7	842					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of smoothened signaling pathway (GO:0045879)|positive regulation of smoothened signaling pathway (GO:0045880)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|kinesin complex (GO:0005871)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(2)|stomach(1)|urinary_tract(1)	25	Lung NSC(78;0.0237)|all_lung(78;0.0478)		BRCA - Breast invasive adenocarcinoma(143;0.128)			TCTCCTCGCGAAGCCGCCTCT	0.662																																					p.L842L		.											.	KIF7-523	0			c.T2526C						.						30.0	30.0	30.0					15																	90176983		2200	4299	6499	SO:0001819	synonymous_variant	374654	exon12			CTCGCGAAGCCGC	AY358384	CCDS32325.2	15q26.1	2011-06-02			ENSG00000166813	ENSG00000166813		"""Kinesins"""	30497	protein-coding gene	gene with protein product		611254				11416179, 15547730	Standard	NM_198525		Approved	JBTS12	uc002bof.2	Q2M1P5	OTTHUMG00000157177	ENST00000394412.3:c.2526T>C	15.37:g.90176983A>G		Somatic	29	0		WXS	Illumina GAIIx	Phase_I	85	36	NM_198525	0	0	2	3	1	Q3SXY0|Q6UXE9|Q8IW72	Silent	SNP	ENST00000394412.3	37	CCDS32325.2																																																																																			.		0.662	KIF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347782.1	NM_198525	
ZNF710	374655	hgsc.bcm.edu	37	15	90610914	90610914	+	Missense_Mutation	SNP	T	T	G	rs201968429	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr15:90610914T>G	ENST00000268154.4	+	2	796	c.545T>G	c.(544-546)cTg>cGg	p.L182R		NM_198526.2	NP_940928.2	Q8N1W2	ZN710_HUMAN	zinc finger protein 710	182	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(1)|ovary(2)|prostate(1)|stomach(1)|urinary_tract(3)	19	Melanoma(11;0.00551)|Lung NSC(78;0.0196)|all_lung(78;0.04)		BRCA - Breast invasive adenocarcinoma(143;0.00769)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.129)			AGGCCGGAGCTGAACGTGGCC	0.706													T|||	7	0.00139776	0.0	0.0014	5008	,	,		14080	0.0		0.006	False		,,,				2504	0.0				p.L182R		.											.	ZNF710-90	0			c.T545G						.	T	ARG/LEU	6,4314		0,6,2154	14.0	18.0	17.0		545	5.0	1.0	15		17	56,8486		1,54,4216	yes	missense	ZNF710	NM_198526.2	102	1,60,6370	GG,GT,TT		0.6556,0.1389,0.482	probably-damaging	182/665	90610914	62,12800	2160	4271	6431	SO:0001583	missense	374655	exon2			CGGAGCTGAACGT	AK094712	CCDS10358.1	15q26.1	2013-01-08			ENSG00000140548	ENSG00000140548		"""Zinc fingers, C2H2-type"""	25352	protein-coding gene	gene with protein product							Standard	XM_005254905		Approved	DKFZp547K1113, FLJ37393, FLJ00306	uc002bov.2	Q8N1W2	OTTHUMG00000149812	ENST00000268154.4:c.545T>G	15.37:g.90610914T>G	ENSP00000268154:p.Leu182Arg	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	23	14	NM_198526	0	0	5	6	1	A0AVS3|Q6ZMK9|Q8NDU0	Missense_Mutation	SNP	ENST00000268154.4	37	CCDS10358.1	4	0.0018315018315018315	0	0.0	0	0.0	0	0.0	4	0.005277044854881266	T	5.635	0.301771	0.10678	0.001389	0.006556	ENSG00000140548	ENST00000268154	T	0.09911	2.93	4.98	4.98	0.66077	.	1.108960	0.06932	N	0.811222	T	0.06280	0.0162	N	0.14661	0.345	0.35099	D	0.765053	B	0.09022	0.002	B	0.06405	0.002	T	0.13098	-1.0522	10	0.42905	T	0.14	-25.2698	12.6713	0.56868	0.0:0.0:0.0:1.0	.	182	Q8N1W2	ZN710_HUMAN	R	182	ENSP00000268154:L182R	ENSP00000268154:L182R	L	+	2	0	ZNF710	88411918	0.000000	0.05858	0.983000	0.44433	0.024000	0.10985	0.474000	0.22148	2.085000	0.62840	0.459000	0.35465	CTG	T|0.998;G|0.002		0.706	ZNF710-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313423.1	NM_198526	
PRR35	146325	hgsc.bcm.edu	37	16	614727	614727	+	Missense_Mutation	SNP	G	G	A	rs200682205	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr16:614727G>A	ENST00000409413.3	+	3	1415	c.1136G>A	c.(1135-1137)gGc>gAc	p.G379D	NHLRC4_ENST00000424439.2_5'Flank|PIGQ_ENST00000409527.2_5'Flank|NHLRC4_ENST00000540585.1_5'Flank	NM_145270.2	NP_660313.1	P0CG20	PRR35_HUMAN		379	Pro-rich.									central_nervous_system(1)|endometrium(1)|lung(5)|ovary(1)|skin(1)|urinary_tract(1)	10						GATCCAGGCGGCCCTGAGACC	0.736													G|||	12	0.00239617	0.0038	0.0043	5008	,	,		9467	0.0		0.003	False		,,,				2504	0.001				p.G379D		.											.	C16orf11-23	0			c.G1136A						.	G	ASP/GLY	11,3203		0,11,1596	3.0	3.0	3.0		1136	-8.8	0.0	16		3	34,7002		1,32,3485	yes	missense	C16orf11	NM_145270.2	94	1,43,5081	AA,AG,GG		0.4832,0.3423,0.439	benign	379/572	614727	45,10205	1607	3518	5125	SO:0001583	missense	146325	exon3			CAGGCGGCCCTGA																												ENST00000409413.3:c.1136G>A	16.37:g.614727G>A	ENSP00000386499:p.Gly379Asp	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	14	8	NM_145270	0	0	0	0	0	B8ZZ27|Q8N233|Q96AX3|Q96S23	Missense_Mutation	SNP	ENST00000409413.3	37	CCDS45365.1	.	.	.	.	.	.	.	.	.	.	G	0.786	-0.760530	0.02996	0.003423	0.004832	ENSG00000161992	ENST00000409413	T	0.07114	3.22	4.85	-8.76	0.00830	.	1.573020	0.04035	N	0.302177	T	0.01905	0.0060	N	0.02142	-0.665	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.38156	-0.9674	10	0.02654	T	1	.	3.3508	0.07151	0.2369:0.107:0.4443:0.2118	.	379	P0CG20	CP011_HUMAN	D	379	ENSP00000386499:G379D	ENSP00000386499:G379D	G	+	2	0	C16orf11	554728	0.000000	0.05858	0.000000	0.03702	0.114000	0.19823	0.553000	0.23391	-1.227000	0.02571	-0.373000	0.07131	GGC	.		0.736	C16orf11-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000333913.1		
EME2	197342	hgsc.bcm.edu	37	16	1823444	1823444	+	Silent	SNP	C	C	G	rs761065	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr16:1823444C>G	ENST00000568449.1	+	1	237	c.216C>G	c.(214-216)gtC>gtG	p.V72V	MRPS34_ENST00000177742.3_5'Flank|EME2_ENST00000307394.7_Silent_p.V72V|MRPS34_ENST00000397375.2_5'Flank|NME3_ENST00000219302.3_5'Flank|NME3_ENST00000563498.1_5'Flank	NM_001257370.1	NP_001244299.1	A4GXA9	EME2_HUMAN	essential meiotic structure-specific endonuclease subunit 2	72					DNA recombination (GO:0006310)|DNA repair (GO:0006281)	nucleus (GO:0005634)	DNA binding (GO:0003677)|endonuclease activity (GO:0004519)			central_nervous_system(1)|kidney(2)|lung(5)|pancreas(1)	9						CGGAGCAGGTCCTGAAGCGCC	0.746								Direct reversal of damage;Homologous recombination					C|||	1683	0.336062	0.0915	0.4885	5008	,	,		9781	0.2808		0.5666	False		,,,				2504	0.3783				p.V72V		.											.	EME2-229	0			c.C216G						.	C		457,2833		68,321,1256	4.0	5.0	5.0		216	-5.9	0.0	16	dbSNP_86	5	3986,3362		1200,1586,888	no	coding-synonymous	EME2	NM_001010865.1		1268,1907,2144	GG,GC,CC		45.7539,13.8906,41.7654		72/445	1823444	4443,6195	1645	3674	5319	SO:0001819	synonymous_variant	197342	exon1			GCAGGTCCTGAAG	AK074080	CCDS58404.1	16p13.3	2013-07-03	2013-07-03			ENSG00000197774			27289	protein-coding gene	gene with protein product	"""SLX2 structure-specific endonuclease subunit homolog B (S. cerevisiae)"""	610886	"""essential meiotic endonuclease 1 homolog 2 (S. pombe)"""			12721304	Standard	NM_001257370		Approved	FLJ00151, SLX2B	uc010brw.1	A4GXA9		ENST00000568449.1:c.216C>G	16.37:g.1823444C>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	10	NM_001257370	0	0	0	0	0	Q8TEP2|Q96RY3	Silent	SNP	ENST00000568449.1	37	CCDS58404.1																																																																																			C|0.615;G|0.385		0.746	EME2-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000433185.2	NM_001010865	
ZNF598	90850	hgsc.bcm.edu	37	16	2059674	2059674	+	Missense_Mutation	SNP	T	T	C	rs71384660		TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr16:2059674T>C	ENST00000431526.1	-	2	88	c.74A>G	c.(73-75)gAa>gGa	p.E25G	ZNF598_ENST00000562103.1_5'UTR|ZNF598_ENST00000563630.1_5'UTR	NM_178167.2	NP_835461.2	Q86UK7	ZN598_HUMAN	zinc finger protein 598	25							poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|lung(7)|skin(1)|urinary_tract(1)	16						GCTCCCGCCTTCCCGCTCAGG	0.766													C|||	5008	1.0	1.0	1.0	5008	,	,		5162	1.0		1.0	False		,,,				2504	1.0				p.E25G		.											.	ZNF598-432	0			c.A74G						.						1.0	2.0	2.0					16																	2059674		1089	2314	3403	SO:0001583	missense	90850	exon2			CCGCCTTCCCGCT	BC029270		16p13.3	2008-05-02				ENSG00000167962		"""Zinc fingers, C2H2-type"""	28079	protein-coding gene	gene with protein product							Standard	NM_178167		Approved	FLJ00086	uc002cof.2	Q86UK7		ENST00000431526.1:c.74A>G	16.37:g.2059674T>C	ENSP00000411409:p.Glu25Gly	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	12	12	NM_178167	0	0	0	6	6	Q8IW49|Q8N3D9|Q96FG3|Q9H7J3	Missense_Mutation	SNP	ENST00000431526.1	37		2168	0.9926739926739927	487	0.9898373983739838	361	0.9972375690607734	568	0.993006993006993	752	0.9920844327176781	N	1.560	-0.537056	0.04082	.	.	ENSG00000167962	ENST00000431526	T	0.77098	-1.07	3.3	3.3	0.37823	.	0.415485	0.23105	N	0.051871	T	0.00012	0.0000	.	.	.	0.48696	P	3.1000000000003247E-4	.	.	.	.	.	.	T	0.34650	-0.9820	6	0.22706	T	0.39	-7.8624	8.393	0.32540	0.0:0.8796:0.0:0.1204	.	.	.	.	G	25	ENSP00000411409:E25G	ENSP00000411409:E25G	E	-	2	0	ZNF598	1999675	1.000000	0.71417	1.000000	0.80357	0.107000	0.19398	0.911000	0.28584	0.691000	0.31592	-0.642000	0.03964	GAA	T|0.007;C|0.993		0.766	ZNF598-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_178167	
SLC9A3R2	9351	hgsc.bcm.edu	37	16	2086500	2086500	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr16:2086500T>C	ENST00000424542.2	+	3	728	c.590T>C	c.(589-591)aTt>aCt	p.I197T	SLC9A3R2_ENST00000563587.1_Missense_Mutation_p.I91T|SLC9A3R2_ENST00000432365.2_Missense_Mutation_p.I197T|SLC9A3R2_ENST00000566198.1_Missense_Mutation_p.I86T|SLC9A3R2_ENST00000565086.1_3'UTR	NM_001130012.2|NM_004785.5	NP_001123484.1|NP_004776.3	Q15599	NHRF2_HUMAN	solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3 regulator 2	197	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|protein complex assembly (GO:0006461)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|phosphatase binding (GO:0019902)|protein C-terminus binding (GO:0008022)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(1)	2						GACCGGCTCATTGAGGTACCG	0.706																																					p.I197T	Ovarian(69;105 1552 17724 23473)	.											.	SLC9A3R2-23	0			c.T590C						.						9.0	11.0	11.0					16																	2086500		1959	4122	6081	SO:0001583	missense	9351	exon3			GGCTCATTGAGGT	AF004900	CCDS45382.1, CCDS45383.1, CCDS58407.1	16p13.3	2014-09-04	2012-03-22		ENSG00000065054	ENSG00000065054			11076	protein-coding gene	gene with protein product		606553	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 3 regulatory factor 2"", ""solute carrier family 9 (sodium/hydrogen exchanger), isoform 3 regulator 2"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 2"""			9054412, 9671706	Standard	NM_001130012		Approved	SIP-1, TKA-1, NHERF-2, E3KARP	uc002coi.3	Q15599	OTTHUMG00000176956	ENST00000424542.2:c.590T>C	16.37:g.2086500T>C	ENSP00000408005:p.Ile197Thr	Somatic	4	0		WXS	Illumina GAIIx	Phase_I	96	27	NM_004785	0	0	0	0	0	D3DU84|D3DU85|H3BSV6|O00272|O00556|Q3KQY7	Missense_Mutation	SNP	ENST00000424542.2	37	CCDS45382.1	.	.	.	.	.	.	.	.	.	.	t	14.37	2.514184	0.44763	.	.	ENSG00000065054	ENST00000424542;ENST00000432365	T;T	0.34072	1.38;1.38	4.7	4.7	0.59300	PDZ/DHR/GLGF (4);	0.269393	0.36134	N	0.002777	T	0.46560	0.1399	L	0.29908	0.895	0.27183	N	0.9606	D;D;D	0.67145	0.996;0.979;0.988	D;P;D	0.70487	0.969;0.876;0.93	T	0.40346	-0.9568	10	0.87932	D	0	-13.1029	13.3598	0.60648	0.0:0.0:0.0:1.0	.	232;197;197	Q6NTG0;D3DU85;Q15599	.;.;NHRF2_HUMAN	T	197	ENSP00000408005:I197T;ENSP00000402857:I197T	ENSP00000408005:I197T	I	+	2	0	SLC9A3R2	2026501	0.959000	0.32827	0.480000	0.27341	0.077000	0.17291	6.171000	0.71926	1.752000	0.51891	0.375000	0.23000	ATT	.		0.706	SLC9A3R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434448.1		
MGRN1	23295	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	4731691	4731691	+	Silent	SNP	C	C	T	rs577424986		TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr16:4731691C>T	ENST00000399577.5	+	13	1365	c.1272C>T	c.(1270-1272)tcC>tcT	p.S424S	MGRN1_ENST00000415496.1_Silent_p.S403S|MGRN1_ENST00000588994.1_Silent_p.S402S|MGRN1_ENST00000262370.7_Silent_p.S424S|MGRN1_ENST00000586183.1_Silent_p.S402S	NM_001142290.2	NP_001135762.1	O60291	MGRN1_HUMAN	mahogunin ring finger 1, E3 ubiquitin protein ligase	424					endosome to lysosome transport (GO:0008333)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	18						ACGGCCTGTCCCAGGCCAGCT	0.662																																					p.S424S		.											.	MGRN1-92	0			c.C1272T						.						34.0	38.0	37.0					16																	4731691		2040	4169	6209	SO:0001819	synonymous_variant	23295	exon13			CCTGTCCCAGGCC	AB011116	CCDS42115.1, CCDS45401.1, CCDS45402.1, CCDS45401.2, CCDS59256.1	16p13	2012-02-23	2012-02-23					"""RING-type (C3HC4) zinc fingers"""	20254	protein-coding gene	gene with protein product		607559	"""mahogunin, ring finger 1"""			9628581	Standard	NM_015246		Approved	KIAA0544, RNF156	uc002cxa.3	O60291		ENST00000399577.5:c.1272C>T	16.37:g.4731691C>T		Somatic	58	0		WXS	Illumina GAIIx	Phase_I	121	73	NM_015246	0	0	17	45	28	A4URL3|A4URL4|Q86W76	Silent	SNP	ENST00000399577.5	37	CCDS45402.1																																																																																			.		0.662	MGRN1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000432060.2		
PDILT	204474	broad.mit.edu	37	16	20410472	20410472	+	Frame_Shift_Del	DEL	C	C	-	rs372343696		TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr16:20410472delC	ENST00000302451.4	-	2	399	c.151delG	c.(151-153)gctfs	p.A51fs		NM_174924.1	NP_777584.1	Q8N807	PDILT_HUMAN	protein disulfide isomerase-like, testis expressed	51					cell migration (GO:0016477)|cell redox homeostasis (GO:0045454)|multicellular organismal development (GO:0007275)|protein folding (GO:0006457)|spermatid development (GO:0007286)	endoplasmic reticulum (GO:0005783)	protein disulfide isomerase activity (GO:0003756)	p.A51T(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(33)|prostate(3)|skin(1)|urinary_tract(1)	61						GTCAGGCCAGCGGGCGTTAGC	0.577																																					p.A51fs		.											.	PDILT-153	1	Substitution - Missense(1)	breast(1)	c.151delG						.						128.0	116.0	120.0					16																	20410472		2203	4300	6503	SO:0001589	frameshift_variant	204474	exon2			GGCCAGCGGGCGT		CCDS10584.1	16p12.3	2011-11-10	2009-02-23		ENSG00000169340	ENSG00000169340		"""Protein disulfide isomerases"""	27338	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 7"", ""protein disulfide isomerase-like protein of the testis"""					15475357	Standard	NM_174924		Approved	PDIA7	uc002dhc.1	Q8N807	OTTHUMG00000131487	ENST00000302451.4:c.151delG	16.37:g.20410472delC	ENSP00000305465:p.Ala51fs	Somatic	174	0		WXS	Illumina GAIIx	Phase_I	287	21	NM_174924	0	0	0	0	0	Q8IVQ5	Frame_Shift_Del	DEL	ENST00000302451.4	37	CCDS10584.1																																																																																			.		0.577	PDILT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254332.1	NM_174924	
PRKCB	5579	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	23847557	23847557	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr16:23847557G>T	ENST00000321728.7	+	1	236	c.61G>T	c.(61-63)Gcc>Tcc	p.A21S	PRKCB_ENST00000303531.7_Missense_Mutation_p.A21S|PRKCB_ENST00000498058.1_Missense_Mutation_p.A21S	NM_212535.2	NP_997700.1	P05771	KPCB_HUMAN	protein kinase C, beta	21					apoptotic process (GO:0006915)|B cell activation (GO:0042113)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|cellular calcium ion homeostasis (GO:0006874)|cellular response to carbohydrate stimulus (GO:0071322)|histone H3-T6 phosphorylation (GO:0035408)|intracellular signal transduction (GO:0035556)|lipoprotein transport (GO:0042953)|negative regulation of glucose transport (GO:0010829)|negative regulation of insulin receptor signaling pathway (GO:0046627)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chromatin binding (GO:0003682)|histone binding (GO:0042393)|histone kinase activity (H3-T6 specific) (GO:0035403)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein kinase C activity (GO:0004697)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			central_nervous_system(3)|large_intestine(1)|lung(2)|ovary(3)	9					Tamoxifen(DB00675)|Vitamin E(DB00163)	CGTGCGCTTCGCCCGCAAAGG	0.697																																					p.A21S		.											.	PRKCB-1530	0			c.G61T						.						57.0	49.0	52.0					16																	23847557		2197	4300	6497	SO:0001583	missense	5579	exon1			CGCTTCGCCCGCA	M13975	CCDS10618.1, CCDS10619.1	16p12	2009-07-10	2008-08-18	2008-08-18	ENSG00000166501	ENSG00000166501	2.7.11.1		9395	protein-coding gene	gene with protein product		176970	"""protein kinase C, beta 1"""	PRKCB2, PKCB, PRKCB1		3658678	Standard	NM_002738		Approved		uc002dme.3	P05771	OTTHUMG00000131615	ENST00000321728.7:c.61G>T	16.37:g.23847557G>T	ENSP00000318315:p.Ala21Ser	Somatic	73	0		WXS	Illumina GAIIx	Phase_I	345	134	NM_212535	0	0	0	0	0	C5IFJ8|D3DWF5|O43744|P05127|Q15138|Q93060|Q9UE49|Q9UE50|Q9UEH8|Q9UJ30|Q9UJ33	Missense_Mutation	SNP	ENST00000321728.7	37	CCDS10618.1	.	.	.	.	.	.	.	.	.	.	g	9.520	1.108124	0.20714	.	.	ENSG00000166501	ENST00000321728;ENST00000303531	D;D	0.82344	-1.6;-1.6	3.71	1.57	0.23409	.	0.159149	0.39475	U	0.001356	T	0.78233	0.4251	M	0.68593	2.085	0.44352	D	0.997248	B;P	0.46784	0.344;0.884	B;B	0.43575	0.15;0.424	T	0.70714	-0.4796	10	0.19590	T	0.45	.	7.7836	0.29078	0.0:0.1791:0.6358:0.185	.	21;21	P05771-2;P05771	.;KPCB_HUMAN	S	21	ENSP00000318315:A21S;ENSP00000305355:A21S	ENSP00000305355:A21S	A	+	1	0	PRKCB	23755058	1.000000	0.71417	0.981000	0.43875	0.007000	0.05969	2.792000	0.47837	0.141000	0.18875	-0.317000	0.08691	GCC	.		0.697	PRKCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254504.2	NM_212535	
CACNG3	10368	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	24268165	24268165	+	Silent	SNP	G	G	A			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr16:24268165G>A	ENST00000005284.3	+	1	1292	c.90G>A	c.(88-90)acG>acA	p.T30T		NM_006539.3	NP_006530.1	O60359	CCG3_HUMAN	calcium channel, voltage-dependent, gamma subunit 3	30					calcium ion transport (GO:0006816)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)	p.T30T(1)		NS(2)|breast(1)|endometrium(4)|kidney(2)|large_intestine(10)|lung(13)|ovary(2)|prostate(4)|skin(2)	40				GBM - Glioblastoma multiforme(48;0.0809)		CAGTGGGCACGGACTACTGGT	0.443																																					p.T30T		.											.	CACNG3-90	1	Substitution - coding silent(1)	endometrium(1)	c.G90A						.						180.0	175.0	177.0					16																	24268165		2197	4300	6497	SO:0001819	synonymous_variant	10368	exon1			GGGCACGGACTAC	AF131911	CCDS10620.1	16p12.1	2008-05-14			ENSG00000006116	ENSG00000006116		"""Calcium channel subunits"""	1407	protein-coding gene	gene with protein product		606403				10221464, 10493829	Standard	NM_006539		Approved		uc002dmf.3	O60359	OTTHUMG00000131651	ENST00000005284.3:c.90G>A	16.37:g.24268165G>A		Somatic	200	0		WXS	Illumina GAIIx	Phase_I	244	62	NM_006539	0	0	0	0	0		Silent	SNP	ENST00000005284.3	37	CCDS10620.1																																																																																			.		0.443	CACNG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254548.1	NM_006539	
ITGAM	3684	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	31288327	31288327	+	Silent	SNP	C	C	T			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr16:31288327C>T	ENST00000287497.8	+	11	1245	c.1170C>T	c.(1168-1170)atC>atT	p.I390I	ITGAM_ENST00000544665.3_Silent_p.I390I			P11215	ITAM_HUMAN	integrin, alpha M (complement component 3 receptor 3 subunit)	390					activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular extravasation (GO:0045123)|ectodermal cell differentiation (GO:0010668)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|microglia development (GO:0014005)|neutrophil chemotaxis (GO:0030593)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integrin complex (GO:0008305)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)			endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(1)|prostate(4)|skin(1)	56						GCACCTTCATCAACATGACCA	0.478																																					p.I390I		.											.	ITGAM-226	0			c.C1170T						.						73.0	67.0	69.0					16																	31288327		1928	4153	6081	SO:0001819	synonymous_variant	3684	exon11			CTTCATCAACATG	J03925	CCDS45470.1, CCDS54004.1	16p11.2	2010-03-23	2006-02-10			ENSG00000169896		"""CD molecules"", ""Complement system"", ""Integrins"""	6149	protein-coding gene	gene with protein product		120980	"""integrin, alpha M (complement component receptor 3, alpha; also known as CD11b (p170), macrophage antigen alpha polypeptide)"""	CR3A, CD11B			Standard	NM_001145808		Approved	MAC-1, CD11b	uc002ebr.3	P11215		ENST00000287497.8:c.1170C>T	16.37:g.31288327C>T		Somatic	127	0		WXS	Illumina GAIIx	Phase_I	161	14	NM_000632	0	0	0	0	0	Q4VAK0|Q4VAK1|Q4VAK2	Silent	SNP	ENST00000287497.8	37	CCDS45470.1																																																																																			.		0.478	ITGAM-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000432816.1	NM_000632	
ABCC11	85320	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	48201459	48201459	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr16:48201459C>G	ENST00000394747.1	-	28	4353	c.4004G>C	c.(4003-4005)cGt>cCt	p.R1335P	ABCC11_ENST00000356608.2_Missense_Mutation_p.R1335P|RP11-3M1.1_ENST00000563906.1_RNA|ABCC11_ENST00000565329.1_5'UTR|ABCC11_ENST00000394748.1_Missense_Mutation_p.R1335P|ABCC11_ENST00000353782.5_Missense_Mutation_p.R1297P	NM_033151.3	NP_149163.2	Q96J66	ABCCB_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 11	1335	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				organic anion transport (GO:0015711)|purine nucleotide transport (GO:0015865)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)|purine nucleotide transmembrane transporter activity (GO:0015216)			breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(3)|prostate(2)|skin(5)|urinary_tract(2)	83		all_cancers(37;0.127)|all_lung(18;0.132)|Breast(268;0.166)			Conjugated Estrogens(DB00286)|Folic Acid(DB00158)|Indomethacin(DB00328)|Methotrexate(DB00563)|Probenecid(DB01032)	AGTGGTGACACGGTGGGCAAT	0.592																																					p.R1335P		.											.	ABCC11-95	0			c.G4004C						.						170.0	129.0	143.0					16																	48201459		2201	4300	6501	SO:0001583	missense	85320	exon28			GTGACACGGTGGG	AF367202	CCDS10732.1, CCDS10733.1	16q12	2012-03-14			ENSG00000121270	ENSG00000121270		"""ATP binding cassette transporters / subfamily C"""	14639	protein-coding gene	gene with protein product		607040				11483364, 11435397	Standard	NM_033151		Approved	MRP8	uc002efg.1	Q96J66	OTTHUMG00000133146	ENST00000394747.1:c.4004G>C	16.37:g.48201459C>G	ENSP00000378230:p.Arg1335Pro	Somatic	272	1		WXS	Illumina GAIIx	Phase_I	446	127	NM_033151	0	0	0	0	0	Q8TDJ0|Q96JA6|Q9BX80	Missense_Mutation	SNP	ENST00000394747.1	37	CCDS10732.1	.	.	.	.	.	.	.	.	.	.	C	15.20	2.762881	0.49574	.	.	ENSG00000121270	ENST00000353782;ENST00000356608;ENST00000394748;ENST00000394747	D;D;D;D	0.84298	-1.83;-1.83;-1.83;-1.83	5.27	4.32	0.51571	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.000000	0.85682	D	0.000000	D	0.95401	0.8507	H	0.99238	4.48	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.993;0.999	D	0.95902	0.8916	10	0.87932	D	0	-16.8758	11.5457	0.50693	0.0:0.9131:0.0:0.0869	.	1297;1335	Q96J66-2;Q96J66	.;ABCCB_HUMAN	P	1297;1335;1335;1335	ENSP00000311326:R1297P;ENSP00000349017:R1335P;ENSP00000378231:R1335P;ENSP00000378230:R1335P	ENSP00000311326:R1297P	R	-	2	0	ABCC11	46758960	1.000000	0.71417	0.107000	0.21349	0.031000	0.12232	4.484000	0.60271	1.231000	0.43661	0.643000	0.83706	CGT	.		0.592	ABCC11-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000429984.1	NM_032583	
CCDC102A	92922	hgsc.bcm.edu	37	16	57562804	57562804	+	Missense_Mutation	SNP	G	G	A	rs12935069		TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr16:57562804G>A	ENST00000258214.2	-	2	532	c.286C>T	c.(286-288)Cgg>Tgg	p.R96W		NM_033212.3	NP_149989.2	Q96A19	C102A_HUMAN	coiled-coil domain containing 102A	96				R -> W (in Ref. 2; AAH08285/AAH09941). {ECO:0000305}.						endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)	8						TCCGACCACCGGCGCATGGTC	0.731													A|||	5008	1.0	1.0	1.0	5008	,	,		3757	1.0		1.0	False		,,,				2504	1.0				p.R96W		.											.	CCDC102A-91	0			c.C286T						.						8.0	10.0	9.0					16																	57562804		1834	3717	5551	SO:0001583	missense	92922	exon2			ACCACCGGCGCAT	BC008285	CCDS10784.1	16q13	2008-02-05			ENSG00000135736	ENSG00000135736			28097	protein-coding gene	gene with protein product						12477932	Standard	NM_033212		Approved	MGC10992	uc002elw.3	Q96A19	OTTHUMG00000133472	ENST00000258214.2:c.286C>T	16.37:g.57562804G>A	ENSP00000258214:p.Arg96Trp	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_033212	0	0	0	0	0	Q9BT74	Missense_Mutation	SNP	ENST00000258214.2	37	CCDS10784.1	2180	0.9981684981684982	492	1.0	360	0.994475138121547	570	0.9965034965034965	758	1.0	A	10.17	1.277909	0.23307	.	.	ENSG00000135736	ENST00000258214	T	0.37752	1.18	4.82	4.82	0.62117	.	0.000000	0.64402	N	0.000001	T	0.00012	0.0000	N	0.00049	-2.415	0.40217	P	0.022302999999999962	B	0.02656	0.0	B	0.01281	0.0	T	0.44787	-0.9305	9	0.33141	T	0.24	-23.2491	9.5348	0.39216	0.9152:0.0:0.0848:0.0	rs12935069;rs12935069	96	Q96A19	C102A_HUMAN	W	96	ENSP00000258214:R96W	ENSP00000258214:R96W	R	-	1	2	CCDC102A	56120305	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	6.801000	0.75170	0.698000	0.31739	-0.556000	0.04195	CGG	G|0.001;A|0.999		0.731	CCDC102A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257348.1	NM_033212	
CNTNAP4	85445	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	76555137	76555137	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr16:76555137G>C	ENST00000476707.1	+	15	2614	c.2475G>C	c.(2473-2475)aaG>aaC	p.K825N	CNTNAP4_ENST00000377504.4_Missense_Mutation_p.K773N|CNTNAP4_ENST00000478060.1_Missense_Mutation_p.K749N|CNTNAP4_ENST00000307431.8_Missense_Mutation_p.K821N|CNTNAP4_ENST00000469589.1_3'UTR			Q9C0A0	CNTP4_HUMAN	contactin associated protein-like 4	822	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)|regulation of grooming behavior (GO:2000821)|regulation of synaptic transmission, dopaminergic (GO:0032225)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|presynaptic membrane (GO:0042734)				breast(4)|central_nervous_system(1)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(33)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	64						TCTTTTTTAAGACAACAGCTT	0.403																																					p.K749N		.											.	CNTNAP4-70	0			c.G2247C						.						235.0	223.0	227.0					16																	76555137		1818	4069	5887	SO:0001583	missense	85445	exon15			TTTTAAGACAACA	AB051550	CCDS10924.1, CCDS10924.2, CCDS73915.1	16q23.1	2008-02-05			ENSG00000152910	ENSG00000152910			18747	protein-coding gene	gene with protein product		610518				12093160	Standard	NM_033401		Approved	CASPR4, KIAA1763	uc010chb.1	Q9C0A0	OTTHUMG00000137617	ENST00000476707.1:c.2475G>C	16.37:g.76555137G>C	ENSP00000417628:p.Lys825Asn	Somatic	32	0		WXS	Illumina GAIIx	Phase_I	35	7	NM_138994	0	0	0	0	0	E9PFZ6|Q86YZ7	Missense_Mutation	SNP	ENST00000476707.1	37		.	.	.	.	.	.	.	.	.	.	G	17.51	3.408521	0.62399	.	.	ENSG00000152910	ENST00000307431;ENST00000377504;ENST00000478060;ENST00000476707	T;T;T;T	0.81415	-1.49;-1.49;-1.49;-1.49	4.99	4.03	0.46877	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.43416	D	0.000563	D	0.87569	0.6210	.	.	.	0.44871	D	0.997883	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.998	D	0.87512	0.2440	9	0.87932	D	0	.	7.7543	0.28915	0.2632:0.0:0.7368:0.0	.	749;825;822	E9PFZ6;E9PDN6;Q9C0A0	.;.;CNTP4_HUMAN	N	821;773;749;825	ENSP00000306893:K821N;ENSP00000439733:K773N;ENSP00000418741:K749N;ENSP00000417628:K825N	ENSP00000306893:K821N	K	+	3	2	CNTNAP4	75112638	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.317000	0.43770	1.337000	0.45525	0.561000	0.74099	AAG	.		0.403	CNTNAP4-005	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000348216.1	NM_033401	
ZFPM1	161882	hgsc.bcm.edu	37	16	88599697	88599705	+	In_Frame_Del	DEL	AGCCTCTGG	AGCCTCTGG	-	rs67873604|rs149145771|rs368520732|rs67322929|rs201915453|rs67712719	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	AGCCTCTGG	AGCCTCTGG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr16:88599697_88599705delAGCCTCTGG	ENST00000319555.3	+	10	1653_1661	c.1331_1339delAGCCTCTGG	c.(1330-1341)gagcctctggcc>gcc	p.EPL444del	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	444				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GCCAGAGCGGAGCCTCTGGCCCAGAATGG	0.746																																					p.444_447del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1331_1339del						.																																			SO:0001651	inframe_deletion	161882	exon10			GAGCGGAGCCTCT	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1331_1339delAGCCTCTGG	16.37:g.88599697_88599705delAGCCTCTGG	ENSP00000326630:p.Glu444_Leu446del	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	16	0	NM_153813	0	0	0	0	0		In_Frame_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.746	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
RPL13	6137	hgsc.bcm.edu	37	16	89627671	89627671	+	Silent	SNP	C	C	T	rs174035	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr16:89627671C>T	ENST00000393099.3	+	2	390	c.141C>T	c.(139-141)gcC>gcT	p.A47A	RPL13_ENST00000311528.5_Silent_p.A47A|RPL13_ENST00000452368.3_Silent_p.A47A|SNORD68_ENST00000363214.1_RNA|RPL13_ENST00000567815.1_Silent_p.A47A	NM_033251.2	NP_150254.1	P26373	RL13_HUMAN	ribosomal protein L13	47					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|cytosolic ribosome (GO:0022626)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			lung(3)|skin(1)|upper_aerodigestive_tract(2)	6		all_hematologic(23;0.0748)		all cancers(4;1.15e-07)|OV - Ovarian serous cystadenocarcinoma(4;7.8e-06)|BRCA - Breast invasive adenocarcinoma(80;0.0139)		GCCGCATCGCCCCGCGCCCCG	0.741													C|||	720	0.14377	0.1256	0.1282	5008	,	,		12083	0.13		0.1839	False		,,,				2504	0.1524				p.A47A		.											.	RPL13-90	0			c.C141T						.	C	,	382,2954		24,334,1310	3.0	4.0	3.0		141,141	0.9	1.0	16	dbSNP_79	3	1125,5851		71,983,2434	no	coding-synonymous,coding-synonymous	RPL13	NM_000977.3,NM_033251.2	,	95,1317,3744	TT,TC,CC		16.1267,11.4508,14.614	,	47/212,47/212	89627671	1507,8805	1668	3488	5156	SO:0001819	synonymous_variant	6137	exon3			CATCGCCCCGCGC	AB007172	CCDS10979.1, CCDS58492.1	16q24.3	2011-04-06			ENSG00000167526	ENSG00000167526		"""L ribosomal proteins"""	10303	protein-coding gene	gene with protein product		113703				9582194	Standard	NM_000977		Approved	D16S444E, BBC1, L13	uc002fnm.2	P26373	OTTHUMG00000133770	ENST00000393099.3:c.141C>T	16.37:g.89627671C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	7	NM_001243131	2	3	1256	2143	882	B4DLX3|F5H1S2|Q3KQT8|Q567Q8|Q9BPX0	Silent	SNP	ENST00000393099.3	37	CCDS10979.1																																																																																			C|0.846;T|0.154		0.741	RPL13-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258294.2	NM_000977	
ZZEF1	23140	hgsc.bcm.edu	37	17	4046101	4046101	+	Missense_Mutation	SNP	A	A	G	rs1454121	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr17:4046101A>G	ENST00000381638.2	-	1	213	c.89T>C	c.(88-90)gTc>gCc	p.V30A	ZZEF1_ENST00000574474.1_5'UTR|CYB5D2_ENST00000575251.1_5'Flank|CYB5D2_ENST00000573984.1_5'Flank|CYB5D2_ENST00000301391.3_5'Flank	NM_015113.3	NP_055928.3	O43149	ZZEF1_HUMAN	zinc finger, ZZ-type with EF-hand domain 1	30			V -> A (in dbSNP:rs1454121). {ECO:0000269|PubMed:14702039}.				calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	84						CGTGCCCGAGACCGCGGCCCA	0.746													A|||	4028	0.804313	0.4781	0.8617	5008	,	,		11055	1.0		0.8529	False		,,,				2504	0.953				p.V30A		.											.	ZZEF1-93	0			c.T89C						.						2.0	2.0	2.0					17																	4046101		1609	3070	4679	SO:0001583	missense	23140	exon1			CCCGAGACCGCGG	BC035319	CCDS11043.1	17p13.3	2013-01-10	2004-11-03		ENSG00000074755	ENSG00000074755		"""Zinc fingers, ZZ-type"", ""EF-hand domain containing"""	29027	protein-coding gene	gene with protein product			"""zinc finger, ZZ-type with EF hand domain 1"""			9455477	Standard	XM_005256560		Approved	KIAA0399, ZZZ4, FLJ10821	uc002fxe.3	O43149	OTTHUMG00000090741	ENST00000381638.2:c.89T>C	17.37:g.4046101A>G	ENSP00000371051:p.Val30Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	9	NM_015113	0	0	0	0	0	A7MBM5|Q6NXG0|Q6ZRA1|Q6ZSF4|Q9NVB9	Missense_Mutation	SNP	ENST00000381638.2	37	CCDS11043.1	1773	0.8118131868131868	254	0.516260162601626	308	0.850828729281768	572	1.0	639	0.8430079155672823	A	12.64	1.999923	0.35320	.	.	ENSG00000074755	ENST00000381638	T	0.18810	2.19	4.8	1.17	0.20885	.	0.614467	0.15724	N	0.247743	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.20107	-1.0285	9	0.33940	T	0.23	-2.2642	0.9962	0.01467	0.1675:0.1675:0.1581:0.5069	rs1454121	30;30	O43149-3;O43149	.;ZZEF1_HUMAN	A	30	ENSP00000371051:V30A	ENSP00000371051:V30A	V	-	2	0	ZZEF1	3992850	0.343000	0.24818	0.021000	0.16686	0.882000	0.50991	0.278000	0.18753	0.760000	0.33108	-0.527000	0.04329	GTC	A|0.188;G|0.812		0.746	ZZEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207480.1	NM_015113	
GLTPD2	388323	hgsc.bcm.edu	37	17	4693342	4693342	+	Missense_Mutation	SNP	C	C	A	rs35910358	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr17:4693342C>A	ENST00000331264.7	+	4	680	c.627C>A	c.(625-627)gaC>gaA	p.D209E		NM_001014985.2	NP_001014985	A6NH11	GLTD2_HUMAN	glycolipid transfer protein domain containing 2	209				D -> E (in Ref. 2; AAI50537). {ECO:0000305}.		cytoplasm (GO:0005737)	glycolipid binding (GO:0051861)|glycolipid transporter activity (GO:0017089)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)	4						GAGGCCCGGACGCGGGCGTGC	0.761													C|||	4904	0.979233	0.9228	1.0	5008	,	,		11019	1.0		0.998	False		,,,				2504	1.0				p.D209E		.											.	GLTPD2-68	0			c.C627A						.	C	GLU/ASP	2706,78		1314,78,0	2.0	2.0	2.0		627	0.2	0.1	17	dbSNP_126	2	6028,0		3014,0,0	no	missense	GLTPD2	NM_001014985.2	45	4328,78,0	AA,AC,CC		0.0,2.8017,0.8852	benign	209/292	4693342	8734,78	1392	3014	4406	SO:0001583	missense	388323	exon4			CCCGGACGCGGGC	BC029290	CCDS32534.1	17p13.2	2007-12-19				ENSG00000182327			33756	protein-coding gene	gene with protein product							Standard	NM_001014985		Approved		uc002fza.2	A6NH11		ENST00000331264.7:c.627C>A	17.37:g.4693342C>A	ENSP00000328070:p.Asp209Glu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_001014985	0	0	0	0	0	A7E2T2	Missense_Mutation	SNP	ENST00000331264.7	37	CCDS32534.1	2151	0.9848901098901099	466	0.9471544715447154	362	1.0	572	1.0	751	0.9907651715039578	C	9.155	1.017148	0.19355	0.971983	1.0	ENSG00000182327	ENST00000331264	.	.	.	4.58	0.162	0.14981	Glycolipid transfer protein domain (3);	.	.	.	.	T	0.00012	0.0000	L	0.41027	1.25	0.80722	P	0.0	B	0.22080	0.064	B	0.31614	0.133	T	0.34650	-0.9820	7	0.12103	T	0.63	-20.1635	5.889	0.18897	0.0:0.5269:0.298:0.1751	rs35910358	209	A6NH11	GLTD2_HUMAN	E	209	.	ENSP00000328070:D209E	D	+	3	2	GLTPD2	4640082	0.004000	0.15560	0.082000	0.20525	0.081000	0.17604	0.011000	0.13264	-0.068000	0.12953	0.555000	0.69702	GAC	C|0.015;A|0.985		0.761	GLTPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439781.1	NM_001014985	
MYH8	4626	bcgsc.ca	37	17	10296486	10296486	+	Silent	SNP	G	G	A	rs33969260	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr17:10296486G>A	ENST00000403437.2	-	36	5302	c.5208C>T	c.(5206-5208)gaC>gaT	p.D1736D	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_002472.2	NP_002463.2	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle, perinatal	1736					ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle contraction (GO:0003009)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|myosin light chain binding (GO:0032027)|structural constituent of muscle (GO:0008307)			NS(3)|breast(8)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(61)|ovary(3)|prostate(3)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	134						GTTGGGAAACGTCATTTTCTA	0.378									Trismus-Pseudocamptodactyly Syndrome with Cardiac Myxoma and Freckling				G|||	478	0.0954473	0.0212	0.1383	5008	,	,		19575	0.002		0.2942	False		,,,				2504	0.0573				p.D1736D		.											.	MYH8-101	0			c.C5208T						.	G		239,4167	140.8+/-176.2	7,225,1971	267.0	240.0	249.0		5208	1.8	1.0	17	dbSNP_126	249	2099,6501	362.3+/-332.7	268,1563,2469	no	coding-synonymous	MYH8	NM_002472.2		275,1788,4440	AA,AG,GG		24.407,5.4244,17.9763		1736/1938	10296486	2338,10668	2203	4300	6503	SO:0001819	synonymous_variant	4626	exon36	Familial Cancer Database	Carney Complex Variant	GGAAACGTCATTT		CCDS11153.1	17p13.1	2013-09-19	2006-09-29		ENSG00000133020	ENSG00000133020		"""Myosins / Myosin superfamily : Class II"""	7578	protein-coding gene	gene with protein product		160741	"""myosin, heavy polypeptide 8, skeletal muscle, perinatal"""			2373371	Standard	NM_002472		Approved	MyHC-peri, MyHC-pn	uc002gmm.2	P13535	OTTHUMG00000130361	ENST00000403437.2:c.5208C>T	17.37:g.10296486G>A		Somatic	143	0		WXS	Illumina GAIIx	Phase_I	96	5	NM_002472	0	0	0	0	0	Q14910	Silent	SNP	ENST00000403437.2	37	CCDS11153.1																																																																																			G|0.826;A|0.174		0.378	MYH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252724.2	NM_002472	
C17orf96	100170841	hgsc.bcm.edu	37	17	36830562	36830562	+	Missense_Mutation	SNP	G	G	C	rs79676758	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr17:36830562G>C	ENST00000325814.5	-	1	625	c.187C>G	c.(187-189)Ctg>Gtg	p.L63V		NM_001130677.1	NP_001124149.1	A6NHQ4	CQ096_HUMAN	chromosome 17 open reading frame 96	63	Pro-rich.				neuron fate commitment (GO:0048663)												CGCGCCGCCAGCTCCCCAGGC	0.766													G|||	965	0.192692	0.2693	0.1239	5008	,	,		11134	0.2004		0.1779	False		,,,				2504	0.1452				p.L63V		.											.	.	0			c.C187G						.						1.0	2.0	2.0					17																	36830562		328	928	1256	SO:0001583	missense	100170841	exon1			CCGCCAGCTCCCC		CCDS45661.1	17q12	2014-04-17			ENSG00000179294	ENSG00000273604			34493	protein-coding gene	gene with protein product	"""proline rich 28"""					24550272	Standard	NM_001130677		Approved	LOC100170841, PRR28	uc010wdq.2	A6NHQ4	OTTHUMG00000188495	ENST00000325814.5:c.187C>G	17.37:g.36830562G>C	ENSP00000317905:p.Leu63Val	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_001130677	0	0	0	2	2		Missense_Mutation	SNP	ENST00000325814.5	37	CCDS45661.1	383	0.17536630036630035	117	0.23780487804878048	48	0.13259668508287292	93	0.16258741258741258	125	0.16490765171503957	G	13.17	2.158099	0.38119	.	.	ENSG00000179294	ENST00000325814	.	.	.	3.48	3.48	0.39840	.	.	.	.	.	T	0.00012	0.0000	N	0.24115	0.695	0.39035	P	0.03997899999999999	P	0.50443	0.935	P	0.46479	0.518	T	0.10847	-1.0612	7	0.87932	D	0	.	10.799	0.46476	0.0:0.0:1.0:0.0	.	63	A6NHQ4	CQ096_HUMAN	V	63	.	ENSP00000317905:L63V	L	-	1	2	C17orf96	34084088	0.995000	0.38212	0.991000	0.47740	0.004000	0.04260	0.513000	0.22770	1.657000	0.50732	0.462000	0.41574	CTG	G|0.824;C|0.176		0.766	C17orf96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255465.2	NM_001130677	
IGFBP4	3487	hgsc.bcm.edu	37	17	38600092	38600092	+	Silent	SNP	G	G	A	rs598892	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr17:38600092G>A	ENST00000269593.4	+	1	380	c.105G>A	c.(103-105)ctG>ctA	p.L35L	IGFBP4_ENST00000542955.1_Intron	NM_001552.2	NP_001543.2	P22692	IBP4_HUMAN	insulin-like growth factor binding protein 4	35	IGFBP N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00653}.				cell proliferation (GO:0008283)|cellular protein metabolic process (GO:0044267)|DNA metabolic process (GO:0006259)|inflammatory response (GO:0006954)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of MAPK cascade (GO:0043410)|regulation of cell growth (GO:0001558)|regulation of glucose metabolic process (GO:0010906)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|type B pancreatic cell proliferation (GO:0044342)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|endometrium(1)|kidney(1)|large_intestine(2)	5		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(5;5.91e-05)			AGGAGAAGCTGGCGCGCTGCC	0.771													G|||	1792	0.357827	0.0386	0.5	5008	,	,		9796	0.4752		0.3946	False		,,,				2504	0.5297				p.L35L	GBM(160;940 3581 26177)	.											.	IGFBP4-522	0			c.G105A						.	G		266,3270		24,218,1526	3.0	3.0	3.0		105	4.0	1.0	17	dbSNP_83	3	2267,4893		352,1563,1665	no	coding-synonymous	IGFBP4	NM_001552.2		376,1781,3191	AA,AG,GG		31.662,7.5226,23.6818		35/259	38600092	2533,8163	1768	3580	5348	SO:0001819	synonymous_variant	3487	exon1			GAAGCTGGCGCGC	M38177	CCDS11367.1	17q21.2	2014-09-16	2001-11-28		ENSG00000141753	ENSG00000141753			5473	protein-coding gene	gene with protein product	"""IGF-binding protein 4"""	146733	"""insulin-like growth factor-binding protein 4"""			1707125, 1704481	Standard	NM_001552		Approved	IBP4, BP-4, HT29-IGFBP, IGFBP-4	uc002hus.3	P22692	OTTHUMG00000133326	ENST00000269593.4:c.105G>A	17.37:g.38600092G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	16	16	NM_001552	0	0	0	1	1	A0N9W2|B4E351|Q5U012|Q9UCL6	Silent	SNP	ENST00000269593.4	37	CCDS11367.1																																																																																			G|0.645;A|0.355		0.771	IGFBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257134.1	NM_001552	
KRTAP4-7	100132476	broad.mit.edu	37	17	39240729	39240729	+	Missense_Mutation	SNP	A	A	G	rs200532954	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr17:39240729A>G	ENST00000391417.4	+	1	271	c.271A>G	c.(271-273)Atg>Gtg	p.M91V		NM_033061.3	NP_149050.3	Q9BYR0	KRA47_HUMAN	keratin associated protein 4-7	116	31 X 5 AA repeats of C-C-[GIKRQVHEML]- [SPTRV]-[STVQRCP].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				NS(1)|endometrium(3)|kidney(1)|lung(1)|prostate(2)|urinary_tract(1)	9						cagctgctgtatgtccagctg	0.677													g|||	366	0.0730831	0.0272	0.0663	5008	,	,		17277	0.1012		0.1431	False		,,,				2504	0.0389				p.M91V		.											.	.	0			c.A271G						.						11.0	17.0	15.0					17																	39240729		684	1582	2266	SO:0001583	missense	100132476	exon1			TGCTGTATGTCCA	AJ406939	CCDS45673.1	17q21.2	2013-06-25			ENSG00000240871	ENSG00000240871		"""Keratin associated proteins"""	18898	protein-coding gene	gene with protein product						11279113	Standard	NM_033061		Approved	KAP4.7	uc010wfn.2	Q9BYR0	OTTHUMG00000133582	ENST00000391417.4:c.271A>G	17.37:g.39240729A>G	ENSP00000375236:p.Met91Val	Somatic	47	0		WXS	Illumina GAIIx	Phase_I	122	14	NM_033061	0	0	0	0	0	A0AVM6|A8MQ08|A8MTL4	Missense_Mutation	SNP	ENST00000391417.4	37	CCDS45673.1	.	.	.	.	.	.	.	.	.	.	.	0.030	-1.342089	0.01277	.	.	ENSG00000240871;ENSG00000212722	ENST00000391417;ENST00000377734	T	0.00567	6.54	3.74	-2.07	0.07276	.	5.393590	0.01146	N	0.006314	T	0.00300	0.0009	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.46679	-0.9174	9	0.05959	T	0.93	.	9.7653	0.40557	0.3807:0.0:0.6193:0.0	.	91	Q9BYR0	KRA47_HUMAN	V	91;82	ENSP00000375236:M91V	ENSP00000375236:M91V	M	+	1	0	KRTAP4-9;KRTAP4-7	36494255	0.000000	0.05858	0.006000	0.13384	0.872000	0.50106	-4.081000	0.00299	-0.949000	0.03663	-0.374000	0.07098	ATG	.		0.677	KRTAP4-7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257686.1		
KRTAP4-6	81871	ucsc.edu	37	17	39296422	39296422	+	Silent	SNP	A	A	G			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr17:39296422A>G	ENST00000345847.4	-	1	317	c.318T>C	c.(316-318)cgT>cgC	p.R106R		NM_030976.1	NP_112238.1	Q9BYQ5	KRA46_HUMAN	keratin associated protein 4-6	106	30 X 5 AA repeats of C-C-[IRQVEL]-[SPTR]- [STVQRCP].					keratin filament (GO:0045095)				endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(1)|prostate(1)|urinary_tract(1)	9						TGCAGCTGGGACGGCAGCAAG	0.652																																					p.R106R		.											.	.	0			c.T318C						.																																			SO:0001819	synonymous_variant	81871	exon1			GCTGGGACGGCAG	AJ406938	CCDS54125.1	17q21.2	2013-06-25			ENSG00000198090	ENSG00000198090		"""Keratin associated proteins"""	18909	protein-coding gene	gene with protein product			"""keratin associated protein 4-15"""	KRTAP4-15			Standard	NM_030976		Approved	KAP4.6, KAP4.15	uc010cxk.2	Q9BYQ5	OTTHUMG00000133634	ENST00000345847.4:c.318T>C	17.37:g.39296422A>G		Somatic	82	1		WXS	Illumina GAIIx	Phase_I	253	42	NM_030976	0	0	0	0	0	Q9BYR1	Silent	SNP	ENST00000345847.4	37	CCDS54125.1																																																																																			.		0.652	KRTAP4-6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257779.1		
CNTD1	124817	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	40957779	40957779	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr17:40957779C>G	ENST00000588408.1	+	4	733	c.457C>G	c.(457-459)Cta>Gta	p.L153V	CNTD1_ENST00000588527.1_Missense_Mutation_p.L70V|CNTD1_ENST00000315066.5_3'UTR	NM_173478.2	NP_775749.2	Q8N815	CNTD1_HUMAN	cyclin N-terminal domain containing 1	153	Cyclin N-terminal.									central_nervous_system(2)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	10		Breast(137;0.00104)		BRCA - Breast invasive adenocarcinoma(366;0.0749)		CCTCCAGGCTCTAGGCTATCT	0.408																																					p.L153V		.											.	CNTD1-90	0			c.C457G						.						122.0	108.0	113.0					17																	40957779		2203	4300	6503	SO:0001583	missense	124817	exon4			CAGGCTCTAGGCT	AK097456	CCDS11440.1	17q21.31	2014-07-03	2006-03-31	2006-03-31	ENSG00000176563	ENSG00000176563			26847	protein-coding gene	gene with protein product			"""cyclin N-terminal domain containing"""	CNTD		24891606	Standard	NM_173478		Approved	FLJ40137	uc002ibm.4	Q8N815		ENST00000588408.1:c.457C>G	17.37:g.40957779C>G	ENSP00000465204:p.Leu153Val	Somatic	87	0		WXS	Illumina GAIIx	Phase_I	60	37	NM_173478	0	0	0	0	0	Q658Q6|Q8NEP1	Missense_Mutation	SNP	ENST00000588408.1	37	CCDS11440.1	.	.	.	.	.	.	.	.	.	.	C	3.900	-0.022137	0.07634	.	.	ENSG00000176563	ENST00000315066	.	.	.	5.78	2.76	0.32466	Cyclin, N-terminal (1);Cyclin-like (2);	0.246207	0.34959	N	0.003552	T	0.25344	0.0616	L	0.46157	1.445	0.22639	N	0.998906	P	0.42296	0.775	B	0.43658	0.426	T	0.17471	-1.0368	9	0.02654	T	1	-5.9324	4.4527	0.11628	0.0:0.4079:0.2899:0.3022	.	153	Q8N815	CNTD1_HUMAN	V	153	.	ENSP00000316647:L153V	L	+	1	2	CNTD1	38211305	0.009000	0.17119	0.887000	0.34795	0.235000	0.25334	0.017000	0.13399	0.804000	0.34136	-0.142000	0.14014	CTA	.		0.408	CNTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452398.1	NM_173478	
AARSD1	80755	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	41105767	41105767	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr17:41105767T>G	ENST00000427569.2	-	10	1017	c.982A>C	c.(982-984)Atc>Ctc	p.I328L	PTGES3L-AARSD1_ENST00000360221.4_Missense_Mutation_p.I441L|PTGES3L-AARSD1_ENST00000409103.1_Missense_Mutation_p.I411L|PTGES3L-AARSD1_ENST00000409399.1_Missense_Mutation_p.I502L|AARSD1_ENST00000416949.1_5'Flank|PTGES3L-AARSD1_ENST00000421990.2_Missense_Mutation_p.I502L	NM_001261434.1	NP_001248363.1	Q9BTE6	AASD1_HUMAN	alanyl-tRNA synthetase domain containing 1	328					alanyl-tRNA aminoacylation (GO:0006419)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	alanine-tRNA ligase activity (GO:0004813)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|Ser-tRNA(Ala) hydrolase activity (GO:0002196)			breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(7)|skin(1)	17		Breast(137;0.00499)		BRCA - Breast invasive adenocarcinoma(366;0.161)		TTGGCAATGATATTCATGAAC	0.512																																					p.I502L		.											.	.	0			c.A1504C						.						167.0	139.0	148.0					17																	41105767		2203	4300	6503	SO:0001583	missense	100885850	exon15			CAATGATATTCAT	BC004172	CCDS11447.1, CCDS45691.1, CCDS58552.1	17q21.31	2012-10-05			ENSG00000266967	ENSG00000266967			28417	protein-coding gene	gene with protein product		613212					Standard	NM_001261434		Approved	MGC2744		Q9BTE6	OTTHUMG00000153515	ENST00000427569.2:c.982A>C	17.37:g.41105767T>G	ENSP00000400870:p.Ile328Leu	Somatic	126	0		WXS	Illumina GAIIx	Phase_I	151	16	NM_001136042	0	0	18	20	2	B4DI73	Missense_Mutation	SNP	ENST00000427569.2	37	CCDS58552.1	.	.	.	.	.	.	.	.	.	.	t	19.32	3.804297	0.70682	.	.	ENSG00000108825	ENST00000360221;ENST00000409399;ENST00000421990;ENST00000427569;ENST00000409103	T;T	0.40476	1.03;1.03	5.36	5.36	0.76844	.	0.120560	0.53938	D	0.000054	T	0.39545	0.1082	L	0.52126	1.63	0.36268	D	0.854963	B;B;B;B	0.12013	0.005;0.002;0.002;0.0	B;B;B;B	0.14023	0.01;0.006;0.008;0.005	T	0.43718	-0.9374	9	0.33141	T	0.24	-25.2486	15.525	0.75898	0.0:0.0:0.0:1.0	.	502;411;459;328	B4DI73;C9J5N1;B3KSP9;Q9BTE6	.;.;.;AASD1_HUMAN	L	441;502;502;328;411	ENSP00000386621:I502L;ENSP00000409924:I502L	ENSP00000353355:I441L	I	-	1	0	AARSD1	38359293	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.817000	0.86213	2.245000	0.73994	0.454000	0.30748	ATC	.		0.512	AARSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467729.1	NM_001261434	
EPN3	55040	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	48614027	48614027	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr17:48614027G>T	ENST00000268933.3	+	2	689	c.110G>T	c.(109-111)aGt>aTt	p.S37I	RP11-94C24.8_ENST00000513017.1_RNA|EPN3_ENST00000537145.1_Intron|EPN3_ENST00000541226.1_Intron	NM_017957.2	NP_060427.2	Q9H201	EPN3_HUMAN	epsin 3	37	ENTH. {ECO:0000255|PROSITE- ProRule:PRU00243}.					clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	lipid binding (GO:0008289)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(1)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	14	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;2.88e-09)			GGCCCCCCTAGTTCGCTCATG	0.607																																					p.S37I		.											.	EPN3-91	0			c.G110T						.						67.0	66.0	66.0					17																	48614027		2203	4300	6503	SO:0001583	missense	55040	exon2			CCCCTAGTTCGCT	AF324241	CCDS11570.1	17q21.33	2008-07-18				ENSG00000049283			18235	protein-coding gene	gene with protein product		607264				10951261, 11359770	Standard	NM_017957		Approved	FLJ20778, MGC129899	uc002ira.4	Q9H201		ENST00000268933.3:c.110G>T	17.37:g.48614027G>T	ENSP00000268933:p.Ser37Ile	Somatic	129	1		WXS	Illumina GAIIx	Phase_I	130	109	NM_017957	0	0	0	0	0	A8K6J3|A8KAB2|Q9BVN6|Q9NWK2	Missense_Mutation	SNP	ENST00000268933.3	37	CCDS11570.1	.	.	.	.	.	.	.	.	.	.	G	17.37	3.371519	0.61624	.	.	ENSG00000049283	ENST00000268933;ENST00000503246;ENST00000514874;ENST00000515126;ENST00000507467;ENST00000411703	T;T;T;T;T	0.45668	0.89;0.89;0.89;0.89;0.89	5.16	5.16	0.70880	Epsin domain, N-terminal (1);ENTH/VHS (2);Epsin-like, N-terminal (2);	0.091506	0.85682	D	0.000000	T	0.68137	0.2968	M	0.87758	2.905	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.74368	-0.3688	10	0.87932	D	0	.	13.9347	0.64017	0.0:0.1525:0.8475:0.0	.	37	Q9H201	EPN3_HUMAN	I	37	ENSP00000268933:S37I;ENSP00000426762:S37I;ENSP00000422682:S37I;ENSP00000422601:S37I;ENSP00000421515:S37I	ENSP00000268933:S37I	S	+	2	0	EPN3	45969026	1.000000	0.71417	1.000000	0.80357	0.371000	0.29859	5.193000	0.65120	2.399000	0.81585	0.462000	0.41574	AGT	.		0.607	EPN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367573.1	NM_017957	
EPN3	55040	bcgsc.ca	37	17	48619272	48619272	+	Silent	SNP	G	G	A	rs111678638	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr17:48619272G>A	ENST00000268933.3	+	10	2232	c.1653G>A	c.(1651-1653)caG>caA	p.Q551Q	EPN3_ENST00000537145.1_Silent_p.Q579Q|EPN3_ENST00000541226.1_3'UTR	NM_017957.2	NP_060427.2	Q9H201	EPN3_HUMAN	epsin 3	551	3 X 3 AA repeats of N-P-F.					clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	lipid binding (GO:0008289)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(1)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	14	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;2.88e-09)			CGCTAAACCAGATGCGCACCG	0.726													G|||	194	0.038738	0.003	0.0418	5008	,	,		11388	0.0188		0.0984	False		,,,				2504	0.044				p.Q551Q		.											.	EPN3-91	0			c.G1653A						.	G		99,4275		4,91,2092	13.0	17.0	16.0		1653	4.2	1.0	17	dbSNP_132	16	864,7700		36,792,3454	no	coding-synonymous	EPN3	NM_017957.2		40,883,5546	AA,AG,GG		10.0887,2.2634,7.4432		551/633	48619272	963,11975	2187	4282	6469	SO:0001819	synonymous_variant	55040	exon10			AAACCAGATGCGC	AF324241	CCDS11570.1	17q21.33	2008-07-18				ENSG00000049283			18235	protein-coding gene	gene with protein product		607264				10951261, 11359770	Standard	NM_017957		Approved	FLJ20778, MGC129899	uc002ira.4	Q9H201		ENST00000268933.3:c.1653G>A	17.37:g.48619272G>A		Somatic	9	0		WXS	Illumina GAIIx	Phase_I	22	22	NM_017957	0	0	0	0	0	A8K6J3|A8KAB2|Q9BVN6|Q9NWK2	Silent	SNP	ENST00000268933.3	37	CCDS11570.1																																																																																			G|0.933;A|0.067		0.726	EPN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367573.1	NM_017957	
EPN3	55040	hgsc.bcm.edu	37	17	48619290	48619290	+	Silent	SNP	G	G	A	rs112657244	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr17:48619290G>A	ENST00000268933.3	+	10	2250	c.1671G>A	c.(1669-1671)ccG>ccA	p.P557P	EPN3_ENST00000537145.1_Silent_p.P585P|EPN3_ENST00000541226.1_3'UTR	NM_017957.2	NP_060427.2	Q9H201	EPN3_HUMAN	epsin 3	557	3 X 3 AA repeats of N-P-F.					clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	lipid binding (GO:0008289)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(1)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	14	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;2.88e-09)			CCGGCTCGCCGGCGCTGGGCC	0.726													G|||	195	0.0389377	0.0038	0.0418	5008	,	,		9711	0.0188		0.0984	False		,,,				2504	0.044				p.P557P		.											.	EPN3-91	0			c.G1671A						.	G		91,4245		4,83,2081	9.0	12.0	11.0		1671	-9.4	0.0	17	dbSNP_132	11	770,7712		27,716,3498	no	coding-synonymous	EPN3	NM_017957.2		31,799,5579	AA,AG,GG		9.078,2.0987,6.7171		557/633	48619290	861,11957	2168	4241	6409	SO:0001819	synonymous_variant	55040	exon10			CTCGCCGGCGCTG	AF324241	CCDS11570.1	17q21.33	2008-07-18				ENSG00000049283			18235	protein-coding gene	gene with protein product		607264				10951261, 11359770	Standard	NM_017957		Approved	FLJ20778, MGC129899	uc002ira.4	Q9H201		ENST00000268933.3:c.1671G>A	17.37:g.48619290G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	13	12	NM_017957	0	0	0	0	0	A8K6J3|A8KAB2|Q9BVN6|Q9NWK2	Silent	SNP	ENST00000268933.3	37	CCDS11570.1																																																																																			G|0.946;A|0.054		0.726	EPN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367573.1	NM_017957	
C17orf70	80233	broad.mit.edu;bcgsc.ca	37	17	79517591	79517591	+	Frame_Shift_Del	DEL	T	T	-			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr17:79517591delT	ENST00000327787.8	-	3	975	c.929delA	c.(928-930)gacfs	p.D310fs	C17orf70_ENST00000537152.1_Frame_Shift_Del_p.D159fs|C17orf70_ENST00000425898.2_5'Flank			Q0VG06	FP100_HUMAN	chromosome 17 open reading frame 70	310					DNA repair (GO:0006281)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|central_nervous_system(1)|endometrium(1)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	19	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0371)			CACCAGGCAGTCACAGTGCAC	0.612																																					p.D310fs		.											.	C17orf70-92	0			c.929delA						.						47.0	49.0	48.0					17																	79517591		2202	4300	6502	SO:0001589	frameshift_variant	80233	exon3			AGGCAGTCACAGT	BC008883	CCDS32765.1, CCDS32765.2	17q25.3	2012-05-30			ENSG00000185504	ENSG00000185504			26171	protein-coding gene	gene with protein product	"""Fanconi anemia-associated protein, 100kDa"""	611301				17396147	Standard	NM_025161		Approved	FLJ22175, FAAP100	uc002kaq.3	Q0VG06	OTTHUMG00000167764	ENST00000327787.8:c.929delA	17.37:g.79517591delT	ENSP00000333283:p.Asp310fs	Somatic	75	0		WXS	Illumina GAIIx	Phase_I	74	9	NM_025161	0	0	0	0	0	A6NNM1|Q8N3F7|Q9BV13|Q9H6K7|Q9H7E8	Frame_Shift_Del	DEL	ENST00000327787.8	37	CCDS32765.2																																																																																			.		0.612	C17orf70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396170.1	NM_025161	
COLEC12	81035	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	346782	346782	+	Silent	SNP	G	G	A	rs370741108		TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr18:346782G>A	ENST00000400256.3	-	5	1047	c.840C>T	c.(838-840)aaC>aaT	p.N280N		NM_130386.2	NP_569057	Q5KU26	COL12_HUMAN	collectin sub-family member 12	280					carbohydrate mediated signaling (GO:0009756)|defense response (GO:0006952)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)|phagocytosis, recognition (GO:0006910)|protein homooligomerization (GO:0051260)|receptor-mediated endocytosis (GO:0006898)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	galactose binding (GO:0005534)|low-density lipoprotein particle binding (GO:0030169)|metal ion binding (GO:0046872)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)			cervix(2)|endometrium(3)|kidney(2)|large_intestine(10)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	46		all_cancers(4;0.0442)|Myeloproliferative disorder(11;0.0426)				CCAGGGTGTCGTTGTTGGCTT	0.507																																					p.N280N		.											.	COLEC12-92	0			c.C840T						.	G		1,4405	2.1+/-5.4	0,1,2202	154.0	127.0	136.0		840	-11.6	0.3	18		136	0,8600		0,0,4300	no	coding-synonymous	COLEC12	NM_130386.2		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		280/743	346782	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	81035	exon5			GGTGTCGTTGTTG	AB038518	CCDS32782.1	18p11.32	2013-09-19			ENSG00000158270	ENSG00000158270		"""Collectins"""	16016	protein-coding gene	gene with protein product		607621				11162630	Standard	NM_130386		Approved	SRCL, CL-P1, SCARA4	uc002kkm.3	Q5KU26	OTTHUMG00000178145	ENST00000400256.3:c.840C>T	18.37:g.346782G>A		Somatic	67	0		WXS	Illumina GAIIx	Phase_I	65	20	NM_130386	0	0	0	0	0	Q6P9F2|Q8TCR2|Q8WZA4|Q9BY85|Q9BYH7	Silent	SNP	ENST00000400256.3	37	CCDS32782.1																																																																																			.		0.507	COLEC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440746.1		
SMAD7	4092	hgsc.bcm.edu	37	18	46476680	46476680	+	Missense_Mutation	SNP	C	C	T	rs144204026	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr18:46476680C>T	ENST00000262158.2	-	1	401	c.115G>A	c.(115-117)Gga>Aga	p.G39R	SMAD7_ENST00000589634.1_Missense_Mutation_p.G39R|SMAD7_ENST00000591805.1_5'Flank	NM_001190821.1|NM_005904.3	NP_001177750.1|NP_005895.1	O15105	SMAD7_HUMAN	SMAD family member 7	39					adherens junction assembly (GO:0034333)|artery morphogenesis (GO:0048844)|BMP signaling pathway (GO:0030509)|cellular protein complex localization (GO:0034629)|cellular response to transforming growth factor beta stimulus (GO:0071560)|gene expression (GO:0010467)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell migration (GO:0030336)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription by competitive promoter binding (GO:0010944)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein stabilization (GO:0050821)|regulation of activin receptor signaling pathway (GO:0032925)|regulation of cardiac muscle contraction (GO:0055117)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|response to laminar fluid shear stress (GO:0034616)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	activin binding (GO:0048185)|beta-catenin binding (GO:0008013)|I-SMAD binding (GO:0070411)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, inhibitory cytoplasmic mediator activity (GO:0030617)|type I transforming growth factor beta receptor binding (GO:0034713)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)	10	Colorectal(1;0.0518)					gccccttctccccgcagctcg	0.746													C|||	11	0.00219649	0.0	0.0014	5008	,	,		8320	0.0		0.008	False		,,,				2504	0.002				p.G39R		.											.	SMAD7-414	0			c.G115A						.	C	ARG/GLY,ARG/GLY	2,3636		0,2,1817	3.0	3.0	3.0		115,115	3.5	1.0	18	dbSNP_134	3	34,7232		0,34,3599	no	missense,missense	SMAD7	NM_001190821.1,NM_005904.3	125,125	0,36,5416	TT,TC,CC		0.4679,0.055,0.3302	probably-damaging,probably-damaging	39/426,39/427	46476680	36,10868	1819	3633	5452	SO:0001583	missense	4092	exon1			CTTCTCCCCGCAG	AF010193	CCDS11936.1, CCDS54186.1, CCDS59317.1	18q21.1	2006-11-06	2006-11-06	2004-05-26	ENSG00000101665	ENSG00000101665		"""SMADs"""	6773	protein-coding gene	gene with protein product		602932	"""MAD, mothers against decapentaplegic homolog 7 (Drosophila)"", ""SMAD, mothers against DPP homolog 7 (Drosophila)"""	MADH8, MADH7		9256479, 9730599	Standard	NM_005904		Approved		uc002ldg.3	O15105	OTTHUMG00000132655	ENST00000262158.2:c.115G>A	18.37:g.46476680C>T	ENSP00000262158:p.Gly39Arg	Somatic	3	0		WXS	Illumina GAIIx	Phase_I	75	50	NM_005904	0	0	2	5	3	B7Z773|K7EQ10|O14740|Q6DK23	Missense_Mutation	SNP	ENST00000262158.2	37	CCDS11936.1	9	0.004120879120879121	0	0.0	1	0.0027624309392265192	0	0.0	8	0.010554089709762533	C	2.594	-0.294537	0.05568	5.5E-4	0.004679	ENSG00000101665	ENST00000262158	T	0.74947	-0.89	3.5	3.5	0.40072	MAD homology, MH1 (1);	0.199276	0.25004	N	0.033892	T	0.49915	0.1585	N	0.19112	0.55	0.46849	D	0.999221	P	0.41041	0.736	B	0.36289	0.221	T	0.60372	-0.7276	10	0.39692	T	0.17	.	14.0774	0.64897	0.0:1.0:0.0:0.0	.	39	O15105	SMAD7_HUMAN	R	39	ENSP00000262158:G39R	ENSP00000262158:G39R	G	-	1	0	SMAD7	44730678	1.000000	0.71417	1.000000	0.80357	0.068000	0.16541	2.857000	0.48349	1.959000	0.56917	0.555000	0.69702	GGA	C|0.996;T|0.004		0.746	SMAD7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255906.1	NM_005904	
SALL3	27164	hgsc.bcm.edu	37	18	76753768	76753768	+	Missense_Mutation	SNP	C	C	G	rs2447437	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr18:76753768C>G	ENST00000537592.2	+	2	1777	c.1777C>G	c.(1777-1779)Ctc>Gtc	p.L593V	SALL3_ENST00000536229.3_Missense_Mutation_p.L460V|SALL3_ENST00000575389.2_Missense_Mutation_p.L593V	NM_171999.3	NP_741996.2	Q9BXA9	SALL3_HUMAN	spalt-like transcription factor 3	593			L -> V (in dbSNP:rs2447437). {ECO:0000269|Ref.1}.		forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|negative regulation of smoothened signaling pathway (GO:0045879)|olfactory bulb interneuron development (GO:0021891)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L593V(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(40)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		CGGGCCGCCCCTCACTAAAGC	0.731													C|||	3973	0.793331	0.5825	0.8444	5008	,	,		9900	0.9226		0.8648	False		,,,				2504	0.8354				p.L593V		.											.	SALL3-155	1	Substitution - Missense(1)	prostate(1)	c.C1777G						.	C	VAL/LEU	2422,1000		875,672,164	3.0	4.0	4.0		1777	5.2	0.2	18	dbSNP_100	4	6372,926		2808,756,85	yes	missense	SALL3	NM_171999.2	32	3683,1428,249	GG,GC,CC		12.6884,29.2227,17.9664	benign	593/1301	76753768	8794,1926	1711	3649	5360	SO:0001583	missense	27164	exon2			CCGCCCCTCACTA	AJ007421	CCDS12013.1	18q23	2013-10-17	2013-10-17		ENSG00000256463	ENSG00000256463		"""Zinc fingers, C2H2-type"""	10527	protein-coding gene	gene with protein product		605079	"""sal (Drosophila)-like 3"", ""sal-like 3 (Drosophila)"""			10610715	Standard	NM_171999		Approved	ZNF796	uc002lmt.3	Q9BXA9	OTTHUMG00000132896	ENST00000537592.2:c.1777C>G	18.37:g.76753768C>G	ENSP00000441823:p.Leu593Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_171999	0	0	0	0	0	Q9UGH1	Missense_Mutation	SNP	ENST00000537592.2	37	CCDS12013.1	1724	0.7893772893772893	287	0.5833333333333334	299	0.8259668508287292	511	0.8933566433566433	627	0.8271767810026385	C	0.073	-1.197989	0.01594	0.707773	0.873116	ENSG00000256463	ENST00000537592;ENST00000536229;ENST00000543056	T	0.08984	3.03	5.2	5.2	0.72013	.	0.464067	0.17974	N	0.155779	T	0.00012	0.0000	L	0.35288	1.05	0.80722	P	0.0	B;B	0.15473	0.013;0.006	B;B	0.18561	0.022;0.002	T	0.36237	-0.9756	9	0.14656	T	0.56	-21.7235	10.231	0.43256	0.2471:0.6277:0.1252:0.0	rs2447437	325;593	F5GXY4;Q9BXA9	.;SALL3_HUMAN	V	593;593;325	ENSP00000441823:L593V	ENSP00000299466:L593V	L	+	1	0	SALL3	74854756	0.002000	0.14202	0.157000	0.22605	0.006000	0.05464	0.292000	0.19011	2.584000	0.87258	0.563000	0.77884	CTC	C|0.780;G|0.220		0.731	SALL3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256397.1	NM_171999	
ARID3A	1820	hgsc.bcm.edu	37	19	929678	929678	+	Silent	SNP	G	G	A	rs3826948	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr19:929678G>A	ENST00000263620.3	+	2	477	c.150G>A	c.(148-150)gaG>gaA	p.E50E	AC005391.2_ENST00000585647.1_RNA	NM_005224.2	NP_005215.1	Q99856	ARI3A_HUMAN	AT rich interactive domain 3A (BRIGHT-like)	50						cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|ovary(1)	10		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GAGAGCCCGAGAGTGCCCGGA	0.766													g|||	2308	0.460863	0.1112	0.487	5008	,	,		7932	0.6756		0.6223	False		,,,				2504	0.5276				p.E50E	Pancreas(29;54 1022 32760 50921)	.											.	ARID3A-90	0			c.G150A						.	G		470,2552		61,348,1102	3.0	4.0	3.0		150	1.1	0.4	19	dbSNP_107	3	3721,3153		1076,1569,792	no	coding-synonymous	ARID3A	NM_005224.2		1137,1917,1894	AA,AG,GG		45.8685,15.5526,42.3504		50/594	929678	4191,5705	1511	3437	4948	SO:0001819	synonymous_variant	1820	exon2			GCCCGAGAGTGCC	U88047	CCDS12050.1	19p13.3	2013-02-07	2006-11-08	2004-01-30		ENSG00000116017		"""-"""	3031	protein-coding gene	gene with protein product		603265	"""dead ringer-like 1 (Drosophila)"", ""AT rich interactive domain 3A (BRIGHT- like)"""	DRIL1		9722953	Standard	NM_005224		Approved	BRIGHT	uc002lql.3	Q99856		ENST00000263620.3:c.150G>A	19.37:g.929678G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_005224	0	0	0	2	2	Q5I858|Q6P9C6|Q8IZA7|Q8N4Z3	Silent	SNP	ENST00000263620.3	37	CCDS12050.1																																																																																			T|0.495;C|0.504		0.766	ARID3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458219.1	NM_005224	
ABCA7	10347	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	19	1046951	1046951	+	Silent	SNP	C	C	T			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr19:1046951C>T	ENST00000263094.6	+	14	2004	c.1773C>T	c.(1771-1773)ctC>ctT	p.L591L	ABCA7_ENST00000533574.1_Intron|ABCA7_ENST00000433129.1_Silent_p.L591L|ABCA7_ENST00000435683.2_Silent_p.L453L	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	591					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)			NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCGCGGTGCTCTGGCTAGGCT	0.697																																					p.L591L		.											.	ABCA7-98	0			c.C1773T						.						18.0	18.0	18.0					19																	1046951		2178	4277	6455	SO:0001819	synonymous_variant	10347	exon14			GGTGCTCTGGCTA	AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.1773C>T	19.37:g.1046951C>T		Somatic	11	0		WXS	Illumina GAIIx	Phase_I	634	89	NM_019112	0	0	3	6	3	Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Silent	SNP	ENST00000263094.6	37	CCDS12055.1																																																																																			.		0.697	ABCA7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000394993.1	NM_019112	
TCF3	6929	hgsc.bcm.edu	37	19	1619339	1619339	+	Silent	SNP	T	T	C	rs8140	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr19:1619339T>C	ENST00000262965.5	-	15	1646	c.1302A>G	c.(1300-1302)tcA>tcG	p.S434S	TCF3_ENST00000395423.3_Silent_p.S383S|TCF3_ENST00000453954.2_Silent_p.S350S|TCF3_ENST00000588136.1_Silent_p.S434S|TCF3_ENST00000344749.5_Silent_p.S434S|RNU6-1223P_ENST00000517124.1_RNA	NM_003200.3	NP_003191.1	Q9HCS4	TF7L1_HUMAN	transcription factor 3	0					anterior/posterior axis specification, embryo (GO:0008595)|axial mesoderm morphogenesis (GO:0048319)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|chromatin organization (GO:0006325)|generation of neurons (GO:0048699)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	16		Acute lymphoblastic leukemia(61;5.94e-12)|all_hematologic(61;1.27e-07)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCCCGCCCAGTGACATGGGGC	0.746			T	"""PBX1, HLF, TFPT"""	pre B-ALL								C|||	3124	0.623802	0.7723	0.5187	5008	,	,		13680	0.8839		0.3658	False		,,,				2504	0.4949				p.S434S		.		Dom	yes		19	19p13.3	6929	transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47)		L	.	TCF3-721	0			c.A1302G						.	C	,	3016,1346		1071,874,236	11.0	14.0	13.0		1302,1302	-7.1	0.0	19	dbSNP_52	13	3268,5190		653,1962,1614	no	coding-synonymous,coding-synonymous	TCF3	NM_001136139.2,NM_003200.3	,	1724,2836,1850	CC,CT,TT		38.638,30.8574,49.0172	,	434/652,434/655	1619339	6284,6536	2181	4229	6410	SO:0001819	synonymous_variant	6929	exon15			GCCCAGTGACATG	M65214	CCDS12074.1, CCDS45899.1	19p13.3	2014-02-13	2013-02-26		ENSG00000071564	ENSG00000071564		"""Basic helix-loop-helix proteins"""	11633	protein-coding gene	gene with protein product	"""transcription factor E2-alpha"", ""immunoglobulin transcription factor 1"", ""kappa-E2-binding factor"", ""E2A immunoglobulin enhancer-binding factor E12/E47"", ""VDR interacting repressor"""	147141				2308859, 1967983	Standard	NM_003200		Approved	E2A, ITF1, MGC129647, MGC129648, bHLHb21, VDIR, E47	uc002ltt.4	P15923	OTTHUMG00000180031	ENST00000262965.5:c.1302A>G	19.37:g.1619339T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	16	6	NM_003200	0	0	38	77	39	Q53R97|Q6PD70|Q9NP00	Silent	SNP	ENST00000262965.5	37	CCDS12074.1																																																																																			T|0.403;C|0.597		0.746	TCF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449367.1	NM_003200	
ANKRD24	170961	hgsc.bcm.edu	37	19	4217956	4217956	+	Silent	SNP	A	A	G	rs6510794	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr19:4217956A>G	ENST00000600132.1	+	18	3075	c.2799A>G	c.(2797-2799)gcA>gcG	p.A933A	ANKRD24_ENST00000262970.5_Silent_p.A1023A|ANKRD24_ENST00000318934.4_Silent_p.A933A	NM_133475.1	NP_597732.1	Q8TF21	ANR24_HUMAN	ankyrin repeat domain 24	933										endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)	21				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0233)|STAD - Stomach adenocarcinoma(1328;0.181)		GGGGCCGGGCAGCCAGTCTGG	0.766													G|||	2256	0.450479	0.5166	0.4164	5008	,	,		6898	0.4692		0.4751	False		,,,				2504	0.3405				p.A933A		.											.	ANKRD24-68	0			c.A2799G						.	G		1357,2019		337,683,668	3.0	6.0	5.0		2799	0.3	1.0	19	dbSNP_116	5	2607,4473		599,1409,1532	no	coding-synonymous	ANKRD24	NM_133475.1		936,2092,2200	GG,GA,AA		36.822,40.1955,37.9112		933/1147	4217956	3964,6492	1688	3540	5228	SO:0001819	synonymous_variant	170961	exon18			CCGGGCAGCCAGT	AB075861	CCDS45925.1	19p13.3	2013-01-10				ENSG00000089847		"""Ankyrin repeat domain containing"""	29424	protein-coding gene	gene with protein product						11853319	Standard	NM_133475		Approved	KIAA1981	uc010dtt.1	Q8TF21		ENST00000600132.1:c.2799A>G	19.37:g.4217956A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	11	4	NM_133475	0	0	0	0	0	O75268|O95781	Silent	SNP	ENST00000600132.1	37	CCDS45925.1																																																																																			A|0.541;G|0.459		0.766	ANKRD24-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458188.1	XM_114000	
RFX2	5990	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	6047473	6047473	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr19:6047473G>A	ENST00000303657.5	-	2	184	c.35C>T	c.(34-36)gCg>gTg	p.A12V	RFX2_ENST00000592546.1_Missense_Mutation_p.A12V|RFX2_ENST00000359161.3_Missense_Mutation_p.A12V	NM_000635.3	NP_000626.2	P48378	RFX2_HUMAN	regulatory factor X, 2 (influences HLA class II expression)	12					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(4)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	21						AGCCACGGACGCTGGCGAATC	0.637											OREG0025192	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A12V	Colon(38;171 817 19800 47433 48051)	.											.	RFX2-156	0			c.C35T						.						21.0	20.0	21.0					19																	6047473		2193	4300	6493	SO:0001583	missense	5990	exon2			ACGGACGCTGGCG		CCDS12157.1, CCDS12158.1	19p13.3	2011-11-23			ENSG00000087903	ENSG00000087903			9983	protein-coding gene	gene with protein product	"""trans-acting regulatory factor 2"", ""DNA binding protein RFX2"", ""HLA class II regulatory factor RFX2"""	142765				1505960	Standard	NM_000635		Approved	FLJ14226	uc002meb.3	P48378		ENST00000303657.5:c.35C>T	19.37:g.6047473G>A	ENSP00000306335:p.Ala12Val	Somatic	18	0	631	WXS	Illumina GAIIx	Phase_I	217	65	NM_134433	0	0	1	1	0	A8K581|B3KNC4|Q6IQ44|Q8SNA2	Missense_Mutation	SNP	ENST00000303657.5	37	CCDS12157.1	.	.	.	.	.	.	.	.	.	.	G	17.27	3.348289	0.61183	.	.	ENSG00000087903	ENST00000303657;ENST00000359161	T;T	0.34275	1.37;1.37	4.81	4.81	0.61882	RFX1 transcription activation region (1);	0.235291	0.41500	D	0.000867	T	0.33118	0.0852	L	0.47716	1.5	0.25463	N	0.987892	P;P	0.36874	0.516;0.572	B;B	0.32677	0.093;0.15	T	0.36696	-0.9737	10	0.62326	D	0.03	-10.7721	16.4655	0.84077	0.0:0.0:1.0:0.0	.	12;12	P48378-2;P48378	.;RFX2_HUMAN	V	12	ENSP00000306335:A12V;ENSP00000352076:A12V	ENSP00000306335:A12V	A	-	2	0	RFX2	5998473	0.987000	0.35691	0.072000	0.20136	0.852000	0.48524	6.825000	0.75293	2.180000	0.69256	0.591000	0.81541	GCG	.		0.637	RFX2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452687.1	NM_000635	
RPS28	6234	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	8386554	8386554	+	Silent	SNP	G	G	C			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr19:8386554G>C	ENST00000600659.2	+	2	85	c.54G>C	c.(52-54)ctG>ctC	p.L18L	NDUFA7_ENST00000301457.2_5'Flank|NDUFA7_ENST00000598884.1_5'Flank	NM_001031.4	NP_001022.1	P62857	RS28_HUMAN	ribosomal protein S28	18					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|ribosomal small subunit biogenesis (GO:0042274)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|small ribosomal subunit (GO:0015935)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)										CCAAGGTCCTGGGCAGGACCG	0.637																																					p.L18L		.											.	RPS28-46	0			c.G54C						.						12.0	14.0	13.0					19																	8386554		1887	4095	5982	SO:0001819	synonymous_variant	6234	exon2			GGTCCTGGGCAGG	D14530	CCDS45953.1	19p13.2	2011-04-06				ENSG00000233927		"""S ribosomal proteins"""	10418	protein-coding gene	gene with protein product	"""40S ribosomal protein S28"""	603685				8415000, 9582194	Standard	NM_001031		Approved	S28	uc002mjn.3	P62857		ENST00000600659.2:c.54G>C	19.37:g.8386554G>C		Somatic	59	0		WXS	Illumina GAIIx	Phase_I	80	33	NM_001031	1	0	1388	2034	645	P25112	Silent	SNP	ENST00000600659.2	37	CCDS45953.1																																																																																			.		0.637	RPS28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461377.3	NM_001031	
KANK3	256949	hgsc.bcm.edu	37	19	8399628	8399628	+	Silent	SNP	A	A	G	rs710949	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr19:8399628A>G	ENST00000593649.1	-	3	1148	c.1083T>C	c.(1081-1083)agT>agC	p.S361S	KANK3_ENST00000330915.3_Silent_p.S361S			Q6NY19	KANK3_HUMAN	KN motif and ankyrin repeat domains 3	361										breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|skin(1)|urinary_tract(1)	9						GGTGCTCCAGACTGGCGCGCA	0.766													G|||	3017	0.602436	0.7443	0.6153	5008	,	,		10732	0.4147		0.5984	False		,,,				2504	0.5992				p.S361S		.											.	KANK3-90	0			c.T1083C						.	G		1917,541		783,351,95	1.0	1.0	1.0		1083	3.4	1.0	19	dbSNP_86	1	3649,1585		1364,921,332	no	coding-synonymous	KANK3	NM_198471.2		2147,1272,427	GG,GA,AA		30.2828,22.0098,27.6391		361/822	8399628	5566,2126	1229	2617	3846	SO:0001819	synonymous_variant	256949	exon3			CTCCAGACTGGCG	AK128815	CCDS12199.1	19p13.2	2013-01-10	2008-01-29	2008-01-29		ENSG00000186994		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	24796	protein-coding gene	gene with protein product		614611	"""ankyrin repeat domain 47"""	ANKRD47		17996375, 19554261	Standard	NM_198471		Approved	FLJ46061	uc010dwa.3	Q6NY19		ENST00000593649.1:c.1083T>C	19.37:g.8399628A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_198471	0	0	0	0	0	Q6NZI1|Q6ZQR3|Q8IUV2	Silent	SNP	ENST00000593649.1	37																																																																																				A|0.411;G|0.589		0.766	KANK3-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000461379.1	NM_198471	
KANK3	256949	hgsc.bcm.edu	37	19	8399635	8399635	+	Missense_Mutation	SNP	C	C	T	rs890853	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr19:8399635C>T	ENST00000593649.1	-	3	1141	c.1076G>A	c.(1075-1077)cGc>cAc	p.R359H	KANK3_ENST00000330915.3_Missense_Mutation_p.R359H			Q6NY19	KANK3_HUMAN	KN motif and ankyrin repeat domains 3	359			R -> H (in dbSNP:rs890853).							breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|skin(1)|urinary_tract(1)	9						CAGACTGGCGCGCAGCAGCTC	0.761													C|||	962	0.192093	0.093	0.3847	5008	,	,		10548	0.2113		0.2545	False		,,,				2504	0.1053				p.R359H		.											.	KANK3-90	0			c.G1076A						.						1.0	1.0	1.0					19																	8399635		1163	2476	3639	SO:0001583	missense	256949	exon3			CTGGCGCGCAGCA	AK128815	CCDS12199.1	19p13.2	2013-01-10	2008-01-29	2008-01-29		ENSG00000186994		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	24796	protein-coding gene	gene with protein product		614611	"""ankyrin repeat domain 47"""	ANKRD47		17996375, 19554261	Standard	NM_198471		Approved	FLJ46061	uc010dwa.3	Q6NY19		ENST00000593649.1:c.1076G>A	19.37:g.8399635C>T	ENSP00000470728:p.Arg359His	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_198471	0	0	0	0	0	Q6NZI1|Q6ZQR3|Q8IUV2	Missense_Mutation	SNP	ENST00000593649.1	37		505	0.23122710622710624	63	0.12804878048780488	131	0.36187845303867405	117	0.20454545454545456	194	0.2559366754617414	C	13.09	2.134512	0.37630	.	.	ENSG00000186994	ENST00000330915	T	0.54071	0.59	4.52	0.959	0.19624	.	.	.	.	.	T	0.00012	0.0000	L	0.29908	0.895	0.53688	P	2.8999999999945736E-5	B	0.16396	0.017	B	0.09377	0.004	T	0.33394	-0.9870	8	0.54805	T	0.06	-23.4019	6.9118	0.24338	0.0:0.5682:0.0:0.4318	rs890853	359	Q6NY19-2	.	H	359	ENSP00000328923:R359H	ENSP00000328923:R359H	R	-	2	0	KANK3	8305635	0.014000	0.17966	0.688000	0.30117	0.060000	0.15804	0.173000	0.16724	0.468000	0.27243	0.297000	0.19635	CGC	C|0.769;T|0.231		0.761	KANK3-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000461379.1	NM_198471	
ZNF846	162993	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	9869036	9869036	+	Silent	SNP	T	T	C			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr19:9869036T>C	ENST00000397902.2	-	6	1130	c.717A>G	c.(715-717)tcA>tcG	p.S239S	ZNF846_ENST00000588267.1_Silent_p.S110S|ZNF846_ENST00000586293.1_3'UTR|ZNF846_ENST00000592859.1_Silent_p.S110S	NM_001077624.1	NP_001071092.1	Q147U1	ZN846_HUMAN	zinc finger protein 846	239					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	22						CTATAAGGTGTGAGGAATTAC	0.378																																					p.S239S		.											.	ZNF846-23	0			c.A717G						.						101.0	108.0	106.0					19																	9869036		2116	4255	6371	SO:0001819	synonymous_variant	162993	exon6			AAGGTGTGAGGAA	AK097652	CCDS42496.1	19p13.2	2013-01-08			ENSG00000196605	ENSG00000196605		"""Zinc fingers, C2H2-type"", ""-"""	27260	protein-coding gene	gene with protein product							Standard	NM_001077624		Approved		uc002mmb.1	Q147U1		ENST00000397902.2:c.717A>G	19.37:g.9869036T>C		Somatic	72	0		WXS	Illumina GAIIx	Phase_I	90	28	NM_001077624	0	0	0	0	0	A8K0H1|B3KUP1	Silent	SNP	ENST00000397902.2	37	CCDS42496.1																																																																																			.		0.378	ZNF846-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450253.1	NM_001077624	
ZNF653	115950	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	11594864	11594864	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr19:11594864G>A	ENST00000293771.5	-	8	1799	c.1663C>T	c.(1663-1665)Ccc>Tcc	p.P555S	CTC-398G3.6_ENST00000585656.1_Intron	NM_138783.3	NP_620138.2	Q96CK0	ZN653_HUMAN	zinc finger protein 653	555					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(3)|large_intestine(2)|lung(8)|prostate(1)|skin(1)	17						CACTGCAGGGGGGTCTCGCCG	0.667																																					p.P555S	Pancreas(83;980 1446 4542 6441 43352)	.											.	ZNF653-90	0			c.C1663T						.						33.0	28.0	30.0					19																	11594864		2174	4274	6448	SO:0001583	missense	115950	exon8			GCAGGGGGGTCTC	AY072704	CCDS12261.1	19p13.2	2013-01-08						"""Zinc fingers, C2H2-type"""	25196	protein-coding gene	gene with protein product		611371				12477932	Standard	NM_138783		Approved	Zip67	uc002mrz.2	Q96CK0		ENST00000293771.5:c.1663C>T	19.37:g.11594864G>A	ENSP00000293771:p.Pro555Ser	Somatic	45	0		WXS	Illumina GAIIx	Phase_I	269	115	NM_138783	0	0	0	0	0	Q96AS7	Missense_Mutation	SNP	ENST00000293771.5	37	CCDS12261.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.269181	0.80469	.	.	ENSG00000161914	ENST00000293771	T	0.16743	2.32	4.76	4.76	0.60689	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.45617	0.1351	M	0.81802	2.56	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.50432	-0.8829	10	0.66056	D	0.02	-18.7482	16.9079	0.86133	0.0:0.0:1.0:0.0	.	555	Q96CK0	ZN653_HUMAN	S	555	ENSP00000293771:P555S	ENSP00000293771:P555S	P	-	1	0	ZNF653	11455864	1.000000	0.71417	0.997000	0.53966	0.425000	0.31504	9.393000	0.97256	2.374000	0.81015	0.305000	0.20034	CCC	.		0.667	ZNF653-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458836.2	NM_138783	
CCDC105	126402	hgsc.bcm.edu	37	19	15133926	15133926	+	Missense_Mutation	SNP	C	C	A	rs8112667	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr19:15133926C>A	ENST00000292574.3	+	7	1577	c.1495C>A	c.(1495-1497)Ccc>Acc	p.P499T		NM_173482.2	NP_775753.2	Q8IYK2	CC105_HUMAN	coiled-coil domain containing 105	499			P -> T (in dbSNP:rs8112667).			extracellular vesicular exosome (GO:0070062)				NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(4)|skin(2)	23						CAGCGCGGACCCCTAGTGACC	0.716													c|||	1705	0.340455	0.1929	0.438	5008	,	,		11943	0.5208		0.2326	False		,,,				2504	0.3957				p.P499T		.											.	CCDC105-91	0			c.C1495A						.		THR/PRO	868,3356		95,678,1339	7.0	9.0	8.0		1495	-6.6	0.0	19	dbSNP_116	8	1799,6519		206,1387,2566	yes	missense	CCDC105	NM_173482.2	38	301,2065,3905	AA,AC,CC		21.6278,20.5492,21.2646	benign	499/500	15133926	2667,9875	2112	4159	6271	SO:0001583	missense	126402	exon7			GCGGACCCCTAGT	AK097684	CCDS12322.1	19p13.12	2008-02-05				ENSG00000160994			26866	protein-coding gene	gene with protein product						12477932	Standard	NM_173482		Approved	FLJ40365	uc002nae.2	Q8IYK2		ENST00000292574.3:c.1495C>A	19.37:g.15133926C>A	ENSP00000292574:p.Pro499Thr	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	15	9	NM_173482	0	0	0	0	0	Q8N7T5|Q8NDL5	Missense_Mutation	SNP	ENST00000292574.3	37	CCDS12322.1	718	0.32875457875457875	102	0.2073170731707317	139	0.3839779005524862	297	0.5192307692307693	180	0.23746701846965698	c	12.70	2.017064	0.35606	0.205492	0.216278	ENSG00000160994	ENST00000292574	T	0.15139	2.45	3.29	-6.58	0.01836	.	1.321340	0.05609	N	0.577760	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.44528	-0.9322	9	0.87932	D	0	.	0.9387	0.01351	0.3527:0.1586:0.3022:0.1865	rs8112667;rs59368867;rs8112667	499	Q8IYK2	CC105_HUMAN	T	499	ENSP00000292574:P499T	ENSP00000292574:P499T	P	+	1	0	CCDC105	14994926	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.281000	0.00528	-1.857000	0.01159	-1.528000	0.00924	CCC	C|0.671;A|0.329		0.716	CCDC105-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466293.1	NM_173482	
AKAP8L	26993	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	15508345	15508345	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr19:15508345T>G	ENST00000397410.5	-	11	1521	c.1391A>C	c.(1390-1392)cAg>cCg	p.Q464P	AKAP8L_ENST00000595465.2_Missense_Mutation_p.Q403P|AKAP8L_ENST00000595879.1_5'UTR	NM_014371.2	NP_055186.2	Q9ULX6	AKP8L_HUMAN	A kinase (PRKA) anchor protein 8-like	464						cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	DEAD/H-box RNA helicase binding (GO:0017151)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(4)|kidney(2)|lung(1)|ovary(1)|prostate(1)|urinary_tract(1)	11						GGTCAGATCCTGGTCTCTGTA	0.547																																					p.Q464P		.											.	AKAP8L-1	0			c.A1391C						.						124.0	120.0	121.0					19																	15508345		1981	4163	6144	SO:0001583	missense	26993	exon11			AGATCCTGGTCTC	BC000713	CCDS46005.1	19p13.12	2013-10-16			ENSG00000011243	ENSG00000011243			29857	protein-coding gene	gene with protein product	"""neighbor of A kinase anchoring protein 95"""	609475				10748171, 10761695	Standard	XM_005259854		Approved	NAKAP95, HAP95	uc002naw.1	Q9ULX6	OTTHUMG00000182446	ENST00000397410.5:c.1391A>C	19.37:g.15508345T>G	ENSP00000380557:p.Gln464Pro	Somatic	133	0		WXS	Illumina GAIIx	Phase_I	580	45	NM_014371	0	0	3	4	1	B4DJ74|B5BU90|O94792|Q96J58|Q9NRQ0|Q9UGM0	Missense_Mutation	SNP	ENST00000397410.5	37	CCDS46005.1	.	.	.	.	.	.	.	.	.	.	t	6.446	0.450446	0.12223	.	.	ENSG00000011243	ENST00000397410	T	0.44482	0.92	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.48804	0.1520	L	0.31207	0.915	0.36671	D	0.878518	D;D	0.71674	0.998;0.998	D;D	0.74023	0.982;0.982	T	0.50197	-0.8856	10	0.19147	T	0.46	-13.9687	13.1575	0.59527	0.0:0.0:0.0:1.0	.	403;464	B4DJ74;Q9ULX6	.;AKP8L_HUMAN	P	464	ENSP00000380557:Q464P	ENSP00000380557:Q464P	Q	-	2	0	AKAP8L	15369345	1.000000	0.71417	0.999000	0.59377	0.876000	0.50452	5.080000	0.64437	1.994000	0.58287	0.454000	0.30748	CAG	.		0.547	AKAP8L-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461301.2	NM_014371	
OR10H5	284433	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	15905273	15905273	+	Missense_Mutation	SNP	C	C	T	rs145808850	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr19:15905273C>T	ENST00000308940.8	+	1	513	c.415C>T	c.(415-417)Cgg>Tgg	p.R139W		NM_001004466.1	NP_001004466.1	Q8NGA6	O10H5_HUMAN	olfactory receptor, family 10, subfamily H, member 5	139						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R139W(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(9)|ovary(1)	20						CATGAGCCTGCGGGGCTGCAC	0.632																																					p.R139W		.											.	OR10H5-69	1	Substitution - Missense(1)	central_nervous_system(1)	c.C415T						.						98.0	84.0	89.0					19																	15905273		2203	4300	6503	SO:0001583	missense	284433	exon1			AGCCTGCGGGGCT	AC011537	CCDS32940.1	19p13.12	2013-09-24			ENSG00000172519	ENSG00000172519		"""GPCR / Class A : Olfactory receptors"""	15389	protein-coding gene	gene with protein product							Standard	NM_001004466		Approved		uc010xos.2	Q8NGA6	OTTHUMG00000182284	ENST00000308940.8:c.415C>T	19.37:g.15905273C>T	ENSP00000310704:p.Arg139Trp	Somatic	342	0		WXS	Illumina GAIIx	Phase_I	1865	215	NM_001004466	0	0	0	0	0	Q6IFJ0|Q96R60	Missense_Mutation	SNP	ENST00000308940.8	37	CCDS32940.1	.	.	.	.	.	.	.	.	.	.	.	9.854	1.194355	0.22037	.	.	ENSG00000172519	ENST00000308940	T	0.42900	0.96	3.25	2.19	0.27852	GPCR, rhodopsin-like superfamily (1);	0.150239	0.31312	N	0.007869	T	0.46852	0.1414	M	0.65498	2.005	0.09310	N	1	D	0.63046	0.992	P	0.52386	0.697	T	0.34825	-0.9813	10	0.59425	D	0.04	.	6.4261	0.21770	0.0:0.8588:0.0:0.1412	.	139	Q8NGA6	O10H5_HUMAN	W	139	ENSP00000310704:R139W	ENSP00000310704:R139W	R	+	1	2	OR10H5	15766273	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-2.657000	0.00853	0.686000	0.31488	0.585000	0.79938	CGG	A|0.001;C|0.999;T|0.000		0.632	OR10H5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460363.1		
CHERP	10523	broad.mit.edu	37	19	16640581	16640583	+	In_Frame_Del	DEL	TGC	TGC	-			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr19:16640581_16640583delTGC	ENST00000198939.6	-	8	1074_1076	c.1038_1040delGCA	c.(1036-1041)cagcaa>caa	p.346_347QQ>Q	CHERP_ENST00000546361.2_In_Frame_Del_p.335_336QQ>Q|CTD-3222D19.2_ENST00000409035.1_Intron					calcium homeostasis endoplasmic reticulum protein											endometrium(3)|kidney(2)|large_intestine(4)|lung(9)|ovary(2)|stomach(1)|urinary_tract(3)	24						ctgctgctgttgctgctgctgct	0.67																																					p.335_336del		.											.	CHERP-92	0			c.1005_1007del						.																																			SO:0001651	inframe_deletion	10523	exon8			TGCTGTTGCTGCT	U94836	CCDS42518.1	19p13.1	2013-01-28				ENSG00000085872		"""G patch domain containing"""	16930	protein-coding gene	gene with protein product						8896557, 10794731	Standard	NM_006387		Approved	ERPROT213-21, DAN16	uc002nei.1	Q8IWX8	OTTHUMG00000169304	ENST00000198939.6:c.1038_1040delGCA	19.37:g.16640590_16640592delTGC	ENSP00000198939:p.Gln352del	Somatic	87	0		WXS	Illumina GAIIx	Phase_I	380	8	NM_006387	0	0	0	0	0		In_Frame_Del	DEL	ENST00000198939.6	37																																																																																				.		0.670	CHERP-003	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000403372.1	NM_006387	
UPF1	5976	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	18943028	18943028	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr19:18943028G>C	ENST00000599848.1	+	1	219	c.10G>C	c.(10-12)Gag>Cag	p.E4Q	UPF1_ENST00000262803.5_Missense_Mutation_p.E4Q			Q92900	RENT1_HUMAN	UPF1 regulator of nonsense transcripts homolog (yeast)	4	Sufficient for interaction with RENT2.				ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|dosage compensation by inactivation of X chromosome (GO:0009048)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of translational termination (GO:0006449)|RNA metabolic process (GO:0016070)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleus (GO:0005634)|supraspliceosomal complex (GO:0044530)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	40						CATGAGCGTGGAGGCGTACGG	0.711																																					p.E4Q		.											.	UPF1-91	0			c.G10C						.						34.0	36.0	35.0					19																	18943028		2203	4300	6503	SO:0001583	missense	5976	exon1			AGCGTGGAGGCGT	AF074016	CCDS12386.1, CCDS74315.1	19p13.2-p13.11	2012-02-29	2006-02-07	2006-02-07	ENSG00000005007	ENSG00000005007			9962	protein-coding gene	gene with protein product	"""UP Frameshift 1"", ""smg-2 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	601430	"""regulator of nonsense transcripts 1"""	RENT1		8855285, 9064659	Standard	XM_005260015		Approved	HUPF1, KIAA0221, NORF1, pNORF1, smg-2	uc002nkf.3	Q92900		ENST00000599848.1:c.10G>C	19.37:g.18943028G>C	ENSP00000470142:p.Glu4Gln	Somatic	69	0		WXS	Illumina GAIIx	Phase_I	181	113	NM_002911	0	0	1	3	2	O00239|O43343|Q86Z25|Q92842	Missense_Mutation	SNP	ENST00000599848.1	37		.	.	.	.	.	.	.	.	.	.	G	14.22	2.469546	0.43839	.	.	ENSG00000005007	ENST00000262803	D	0.90004	-2.6	3.92	2.86	0.33363	.	0.177957	0.47852	U	0.000207	D	0.83482	0.5264	L	0.36672	1.1	0.51767	D	0.999932	B;B	0.21071	0.03;0.051	B;B	0.22753	0.012;0.041	T	0.78738	-0.2087	10	0.59425	D	0.04	-15.4583	12.5255	0.56083	0.0:0.1694:0.8306:0.0	.	4;4	Q92900;Q92900-2	RENT1_HUMAN;.	Q	4	ENSP00000262803:E4Q	ENSP00000262803:E4Q	E	+	1	0	UPF1	18804028	1.000000	0.71417	0.996000	0.52242	0.017000	0.09413	7.249000	0.78278	0.634000	0.30469	0.499000	0.49734	GAG	.		0.711	UPF1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000464684.1	NM_002911	
YJEFN3	374887	broad.mit.edu	37	19	19648155	19648155	+	Missense_Mutation	SNP	C	C	T	rs200289592	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr19:19648155C>T	ENST00000514277.4	+	7	760	c.722C>T	c.(721-723)tCg>tTg	p.S241L	CILP2_ENST00000291495.5_5'Flank|YJEFN3_ENST00000436027.5_Missense_Mutation_p.S191L|CILP2_ENST00000586018.1_5'Flank	NM_198537.3	NP_940939.2	A6XGL0	YJEN3_HUMAN	YjeF N-terminal domain containing 3	241	YjeF N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00719}.									NS(1)|breast(1)|lung(3)	5						GGCAGCGATTCGGAGGACGGG	0.706													C|||	6	0.00119808	0.0008	0.0	5008	,	,		10383	0.0		0.003	False		,,,				2504	0.002				p.S241L		.											.	YJEFN3-90	0			c.C722T						.	C	LEU/SER,LEU/SER	0,3520		0,0,1760	7.0	8.0	8.0		572,722	1.3	0.0	19		8	8,7574		0,8,3783	no	missense,missense	YJEFN3	NM_001190328.1,NM_198537.3	145,145	0,8,5543	TT,TC,CC		0.1055,0.0,0.0721	benign,benign	191/250,241/300	19648155	8,11094	1760	3791	5551	SO:0001583	missense	374887	exon7			GCGATTCGGAGGA		CCDS42530.1, CCDS54236.1	19p13.11	2014-09-11			ENSG00000250067	ENSG00000250067			24785	protein-coding gene	gene with protein product						17533573	Standard	NM_198537		Approved	hYjeF_N3-19p13.11, FLJ44968	uc002nmt.2	A6XGL0	OTTHUMG00000162251	ENST00000514277.4:c.722C>T	19.37:g.19648155C>T	ENSP00000426964:p.Ser241Leu	Somatic	17	1		WXS	Illumina GAIIx	Phase_I	84	46	NM_198537	0	0	2	4	2	A6XGK9|Q4G1C0	Missense_Mutation	SNP	ENST00000514277.4	37	CCDS42530.1	.	.	.	.	.	.	.	.	.	.	C	4.336	0.061723	0.08339	0.0	0.001055	ENSG00000250067	ENST00000397179;ENST00000436027;ENST00000514277;ENST00000510139	T;T	0.42131	0.98;0.98	2.36	1.29	0.21616	YjeF-related protein, N-terminal (5);	0.886510	0.09510	U	0.792464	T	0.23451	0.0567	N	0.12182	0.205	0.09310	N	0.999994	B;P	0.37663	0.049;0.604	B;B	0.35655	0.019;0.207	T	0.13980	-1.0489	10	0.48119	T	0.1	-21.0135	7.0319	0.24972	0.0:0.7158:0.2842:0.0	.	191;241	A6XGL0-2;A6XGL0	.;YJEN3_HUMAN	L	241;191;241;191	ENSP00000398520:S191L;ENSP00000426964:S241L	ENSP00000380364:S241L	S	+	2	0	YJEFN3	19509155	0.000000	0.05858	0.003000	0.11579	0.123000	0.20343	-0.150000	0.10189	0.568000	0.29311	0.306000	0.20318	TCG	.		0.706	YJEFN3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000368157.5	NM_198537	
RGS9BP	388531	hgsc.bcm.edu	37	19	33167455	33167455	+	Missense_Mutation	SNP	G	G	T	rs259290	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr19:33167455G>T	ENST00000334176.3	+	1	1143	c.286G>T	c.(286-288)Gcg>Tcg	p.A96S	ANKRD27_ENST00000587352.1_5'Flank|ANKRD27_ENST00000306065.4_5'Flank	NM_207391.2	NP_997274.2	Q6ZS82	R9BP_HUMAN	regulator of G protein signaling 9 binding protein	96			A -> S (in dbSNP:rs259290). {ECO:0000269|PubMed:14702039}.		detection of light stimulus involved in visual perception (GO:0050908)|negative regulation of signal transduction (GO:0009968)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)	integral component of membrane (GO:0016021)				central_nervous_system(1)|lung(2)	3	Esophageal squamous(110;0.137)					CATGCGACGCGCGCTGGAGCT	0.786													G|||	2178	0.434904	0.3805	0.4856	5008	,	,		10415	0.2579		0.6233	False		,,,				2504	0.4611				p.A96S		.											.	RGS9BP-90	0			c.G286T						.	G	SER/ALA	1584,1384		459,666,359	2.0	2.0	2.0		286	3.5	1.0	19	dbSNP_79	2	4397,1763		1670,1057,353	yes	missense	RGS9BP	NM_207391.2	99	2129,1723,712	TT,TG,GG		28.6201,46.6307,34.4763	possibly-damaging	96/236	33167455	5981,3147	1484	3080	4564	SO:0001583	missense	388531	exon1			CGACGCGCGCTGG	AW302149	CCDS12424.1	19q13.11	2008-02-05	2007-08-14			ENSG00000186326			30304	protein-coding gene	gene with protein product		607814	"""regulator of G protein signalling 9 binding protein"""			12119397, 8889548	Standard	NM_207391		Approved	FLJ45744, PERRS, R9AP, RGS9	uc002ntp.1	Q6ZS82		ENST00000334176.3:c.286G>T	19.37:g.33167455G>T	ENSP00000334134:p.Ala96Ser	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	5	NM_207391	0	0	0	0	0	Q6ZVJ6	Missense_Mutation	SNP	ENST00000334176.3	37	CCDS12424.1	1007	0.4610805860805861	184	0.37398373983739835	188	0.5193370165745856	161	0.28146853146853146	474	0.6253298153034301	G	15.38	2.815844	0.50527	0.533693	0.713799	ENSG00000186326	ENST00000334176	T	0.33654	1.4	4.57	3.5	0.40072	.	0.065802	0.64402	U	0.000009	T	0.00012	0.0000	L	0.28115	0.83	0.20873	P	0.999831543	P	0.52170	0.951	P	0.50352	0.638	T	0.12528	-1.0544	9	0.35671	T	0.21	-21.6697	13.7833	0.63094	0.0:0.0:0.8453:0.1547	rs259290	96	Q6ZS82	R9BP_HUMAN	S	96	ENSP00000334134:A96S	ENSP00000334134:A96S	A	+	1	0	RGS9BP	37859295	1.000000	0.71417	1.000000	0.80357	0.125000	0.20455	4.816000	0.62642	1.092000	0.41356	0.313000	0.20887	GCG	G|0.540;T|0.460		0.786	RGS9BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450337.1	NM_207391	
ZNF607	84775	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	38189550	38189550	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr19:38189550T>C	ENST00000355202.4	-	5	2077	c.1482A>G	c.(1480-1482)atA>atG	p.I494M	ZNF607_ENST00000395835.3_Missense_Mutation_p.I493M|CTD-2528L19.4_ENST00000586606.2_Intron	NM_032689.4	NP_116078.4	Q96SK3	ZN607_HUMAN	zinc finger protein 607	494					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(11)|lung(8)|urinary_tract(1)	27			UCEC - Uterine corpus endometrioid carcinoma (49;0.0775)			CTCTGCGATGTATAGTGAGTT	0.393																																					p.I494M		.											.	ZNF607-90	0			c.A1482G						.						103.0	100.0	101.0					19																	38189550		2203	4300	6503	SO:0001583	missense	84775	exon5			GCGATGTATAGTG	AK127464	CCDS33006.1, CCDS54259.1	19q13.1	2013-01-08				ENSG00000198182		"""Zinc fingers, C2H2-type"", ""-"""	28192	protein-coding gene	gene with protein product						14702039	Standard	NM_032689		Approved	MGC13071, FLJ14802	uc002ohc.2	Q96SK3		ENST00000355202.4:c.1482A>G	19.37:g.38189550T>C	ENSP00000347338:p.Ile494Met	Somatic	95	0		WXS	Illumina GAIIx	Phase_I	133	35	NM_032689	0	0	0	0	0	F5H141|Q6ZMN2|Q6ZMN4|Q96C40	Missense_Mutation	SNP	ENST00000355202.4	37	CCDS33006.1	.	.	.	.	.	.	.	.	.	.	T	6.009	0.370002	0.11352	.	.	ENSG00000198182	ENST00000355202;ENST00000395835	T;T	0.07567	3.18;3.18	2.38	-4.32	0.03688	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03305	0.0096	N	0.12182	0.205	0.09310	N	1	B;B	0.09022	0.0;0.002	B;B	0.14023	0.001;0.01	T	0.41963	-0.9479	9	0.29301	T	0.29	.	0.8617	0.01194	0.1528:0.2136:0.3109:0.3228	.	494;493	Q96SK3;F5H141	ZN607_HUMAN;.	M	494;493	ENSP00000347338:I494M;ENSP00000438015:I493M	ENSP00000347338:I494M	I	-	3	3	ZNF607	42881390	0.000000	0.05858	0.001000	0.08648	0.972000	0.66771	-5.431000	0.00123	-1.470000	0.01888	-0.411000	0.06167	ATA	.		0.393	ZNF607-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000459502.2	NM_032689	
CAPN12	147968	hgsc.bcm.edu	37	19	39226927	39226927	+	Missense_Mutation	SNP	T	T	C	rs62120074	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr19:39226927T>C	ENST00000328867.4	-	12	1714	c.1406A>G	c.(1405-1407)cAt>cGt	p.H469R	CAPN12_ENST00000601953.1_Missense_Mutation_p.H320R|CTD-2540F13.2_ENST00000602255.1_RNA	NM_144691.3	NP_653292.2	Q6ZSI9	CAN12_HUMAN	calpain 12	469	Domain III.				proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	20	all_cancers(60;2.87e-05)|Ovarian(47;0.0454)		Lung(45;0.00416)|LUSC - Lung squamous cell carcinoma(53;0.00741)			CAGGAGCGCATGGCTGCGCGG	0.761													t|||	345	0.0688898	0.0567	0.0807	5008	,	,		4289	0.0466		0.0616	False		,,,				2504	0.1074				p.H469R		.											.	CAPN12-91	0			c.A1406G						.		ARG/HIS	65,2227		0,65,1081	2.0	2.0	2.0		1406	2.5	1.0	19	dbSNP_129	2	160,4530		3,154,2188	no	missense	CAPN12	NM_144691.3	29	3,219,3269	CC,CT,TT		3.4115,2.836,3.2226	benign	469/720	39226927	225,6757	1146	2345	3491	SO:0001583	missense	147968	exon12			AGCGCATGGCTGC	BC014027	CCDS12519.1	19q13.2	2014-08-12			ENSG00000182472	ENSG00000182472		"""EF-hand domain containing"""	13249	protein-coding gene	gene with protein product		608839					Standard	NM_144691		Approved		uc002ojd.1	Q6ZSI9	OTTHUMG00000182525	ENST00000328867.4:c.1406A>G	19.37:g.39226927T>C	ENSP00000331636:p.His469Arg	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	4	NM_144691	0	0	0	1	1		Missense_Mutation	SNP	ENST00000328867.4	37	CCDS12519.1	134	0.06135531135531135	27	0.054878048780487805	25	0.06906077348066299	34	0.05944055944055944	48	0.0633245382585752	t	1.176	-0.639525	0.03557	0.02836	0.034115	ENSG00000182472	ENST00000328867	D	0.86627	-2.15	3.59	2.52	0.30459	Peptidase C2, calpain, large subunit, domain III (2);Peptidase C2, calpain, domain III (1);	1.218970	0.05528	N	0.563364	T	0.07413	0.0187	N	0.00073	-2.26	0.20196	N	0.99993	B	0.02656	0.0	B	0.01281	0.0	T	0.52704	-0.8540	10	0.02654	T	1	.	4.7548	0.13078	0.2094:0.6726:0.0:0.118	rs62120074	469	Q6ZSI9	CAN12_HUMAN	R	469	ENSP00000331636:H469R	ENSP00000331636:H469R	H	-	2	0	CAPN12	43918767	0.787000	0.28750	0.978000	0.43139	0.521000	0.34408	1.108000	0.31123	0.313000	0.23062	-0.365000	0.07479	CAT	T|0.939;C|0.061		0.761	CAPN12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462151.1		
APOE	348	hgsc.bcm.edu	37	19	45412079	45412079	+	Missense_Mutation	SNP	C	C	T	rs7412	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr19:45412079C>T	ENST00000252486.4	+	4	637	c.526C>T	c.(526-528)Cgc>Tgc	p.R176C		NM_000041.2	NP_000032.1	P02649	APOE_HUMAN	apolipoprotein E	176	8 X 22 AA approximate tandem repeats.		R -> C (in HLPP3; forms E1 Weisgraber, form E2 and form E3**; dbSNP:rs7412). {ECO:0000269|PubMed:11042151, ECO:0000269|PubMed:12966036, ECO:0000269|PubMed:8287539}.		aging (GO:0007568)|alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|artery morphogenesis (GO:0048844)|cell death (GO:0008219)|cellular calcium ion homeostasis (GO:0006874)|cellular response to cholesterol (GO:0071397)|cellular response to growth factor stimulus (GO:0071363)|cellular response to interleukin-1 (GO:0071347)|cGMP-mediated signaling (GO:0019934)|cholesterol catabolic process (GO:0006707)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|chylomicron remnant clearance (GO:0034382)|cytoskeleton organization (GO:0007010)|fatty acid homeostasis (GO:0055089)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle assembly (GO:0034380)|high-density lipoprotein particle clearance (GO:0034384)|high-density lipoprotein particle remodeling (GO:0034375)|intracellular transport (GO:0046907)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|long-chain fatty acid transport (GO:0015909)|low-density lipoprotein particle remodeling (GO:0034374)|maintenance of location in cell (GO:0051651)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of blood coagulation (GO:0030195)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cholesterol biosynthetic process (GO:0045541)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of dendritic spine development (GO:0061000)|negative regulation of dendritic spine maintenance (GO:1902951)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of inflammatory response (GO:0050728)|negative regulation of lipid biosynthetic process (GO:0051055)|negative regulation of lipid transport across blood brain barrier (GO:1903001)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron death (GO:1901215)|negative regulation of phospholipid efflux (GO:1902999)|negative regulation of platelet activation (GO:0010544)|negative regulation of postsynaptic membrane organization (GO:1901627)|negative regulation of presynaptic membrane organization (GO:1901630)|nitric oxide mediated signal transduction (GO:0007263)|oligodendrocyte differentiation (GO:0048709)|peripheral nervous system axon regeneration (GO:0014012)|phospholipid efflux (GO:0033700)|phototransduction, visible light (GO:0007603)|positive regulation of axon extension (GO:0045773)|positive regulation of beta-amyloid formation (GO:1902004)|positive regulation of cGMP biosynthetic process (GO:0030828)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of cholesterol esterification (GO:0010873)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of dendritic spine maintenance (GO:1902952)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of lipid transport across blood brain barrier (GO:1903002)|positive regulation of low-density lipoprotein particle receptor catabolic process (GO:0032805)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of neurofibrillary tangle assembly (GO:1902998)|positive regulation of neuron death (GO:1901216)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of phospholipid efflux (GO:1902995)|positive regulation of postsynaptic membrane organization (GO:1901628)|positive regulation of presynaptic membrane organization (GO:1901631)|protein import (GO:0017038)|receptor-mediated endocytosis (GO:0006898)|regulation of axon extension (GO:0030516)|regulation of beta-amyloid clearance (GO:1900221)|regulation of Cdc42 protein signal transduction (GO:0032489)|regulation of neuron death (GO:1901214)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of tau-protein kinase activity (GO:1902947)|response to dietary excess (GO:0002021)|response to ethanol (GO:0045471)|response to insulin (GO:0032868)|response to reactive oxygen species (GO:0000302)|response to retinoic acid (GO:0032526)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|synaptic transmission, cholinergic (GO:0007271)|triglyceride metabolic process (GO:0006641)|vasodilation (GO:0042311)|very-low-density lipoprotein particle clearance (GO:0034447)|very-low-density lipoprotein particle remodeling (GO:0034372)	blood microparticle (GO:0072562)|chylomicron (GO:0042627)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|high-density lipoprotein particle (GO:0034364)|intermediate-density lipoprotein particle (GO:0034363)|late endosome (GO:0005770)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)|vesicle (GO:0031982)	antioxidant activity (GO:0016209)|beta-amyloid binding (GO:0001540)|cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|hydroxyapatite binding (GO:0046848)|identical protein binding (GO:0042802)|lipid binding (GO:0008289)|lipid transporter activity (GO:0005319)|lipoprotein particle binding (GO:0071813)|low-density lipoprotein particle receptor binding (GO:0050750)|metal chelating activity (GO:0046911)|phosphatidylcholine-sterol O-acyltransferase activator activity (GO:0060228)|phospholipid binding (GO:0005543)|protein homodimerization activity (GO:0042803)|tau protein binding (GO:0048156)|very-low-density lipoprotein particle receptor binding (GO:0070326)			large_intestine(1)|lung(2)|prostate(1)	4	Lung NSC(12;0.0018)|all_lung(12;0.00481)	Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00327)|Epithelial(262;0.174)	Human Serum Albumin(DB00062)|Serum albumin iodonated(DB00064)	CCTGCAGAAGCGCCTGGCAGT	0.746													c|||	376	0.0750799	0.1029	0.0476	5008	,	,		8311	0.1002		0.0626	False		,,,				2504	0.044				p.R176C		.											.	APOE-90	0			c.C526T	GRCh37	CM860003	APOE	M	rs7412	.	C	CYS/ARG	271,2853		8,255,1299	3.0	3.0	3.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	526	4.1	1.0	19	dbSNP_52	3	356,5976		6,344,2816	yes	missense	APOE	NM_000041.2	180	14,599,4115	TT,TC,CC	http://www.ncbi.nlm.nih.gov/pubmed?term	5.6222,8.6748,6.6307	probably-damaging	176/318	45412079	627,8829	1562	3166	4728	SO:0001583	missense	348	exon4			CAGAAGCGCCTGG	K00396	CCDS12647.1	19q13.31	2013-01-24			ENSG00000130203	ENSG00000130203		"""Apolipoproteins"""	613	protein-coding gene	gene with protein product		107741	"""Alzheimer disease 2 (APOE*E4-associated, late onset)"""	AD2		10662539	Standard	NM_000041		Approved		uc002pab.3	P02649	OTTHUMG00000128901	ENST00000252486.4:c.526C>T	19.37:g.45412079C>T	ENSP00000252486:p.Arg176Cys	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	12	8	NM_000041	1	1	798	3294	2494	B2RC15|C0JYY5|Q9P2S4	Missense_Mutation	SNP	ENST00000252486.4	37	CCDS12647.1	162	0.07417582417582418	46	0.09349593495934959	23	0.06353591160220995	43	0.07517482517482517	50	0.06596306068601583	C	15.82	2.945479	0.53079	0.086748	0.056222	ENSG00000130203	ENST00000252486;ENST00000446996;ENST00000434152;ENST00000425718	T;T;T	0.74947	-0.89;-0.89;-0.89	5.09	4.05	0.47172	Apolipoprotein/apolipophorin (1);	0.000000	0.50627	D	0.000104	T	0.20414	0.0491	M	0.81682	2.555	0.37880	D	0.930361	D	0.89917	1.0	D	0.97110	1.0	T	0.65998	-0.6032	10	0.66056	D	0.02	-7.7588	6.5628	0.22495	0.1808:0.7277:0.0:0.0915	rs7412;rs3200542	176	P02649	APOE_HUMAN	C	176;176;221;176	ENSP00000252486:R176C;ENSP00000413135:R176C;ENSP00000410423:R176C	ENSP00000252486:R176C	R	+	1	0	APOE	50103919	0.986000	0.35501	1.000000	0.80357	0.351000	0.29236	0.344000	0.19962	1.134000	0.42165	0.555000	0.69702	CGC	C|0.933;T|0.067		0.746	APOE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250865.2	NM_000041	
ERCC2	2068	hgsc.bcm.edu	37	19	45867259	45867259	+	Missense_Mutation	SNP	C	C	T	rs1799793	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr19:45867259C>T	ENST00000391945.4	-	10	1011	c.934G>A	c.(934-936)Gac>Aac	p.D312N	ERCC2_ENST00000391940.4_Missense_Mutation_p.D288N|ERCC2_ENST00000391944.3_Missense_Mutation_p.D234N|ERCC2_ENST00000485403.2_Missense_Mutation_p.D288N|ERCC2_ENST00000221481.6_3'UTR	NM_000400.3	NP_000391.1	P18074	ERCC2_HUMAN	excision repair cross-complementation group 2	312			D -> N (in dbSNP:rs1799793). {ECO:0000269|PubMed:11245433, ECO:0000269|PubMed:11470747, ECO:0000269|PubMed:11709541, ECO:0000269|Ref.3}.		7-methylguanosine mRNA capping (GO:0006370)|aging (GO:0007568)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|central nervous system myelin formation (GO:0032289)|chromosome segregation (GO:0007059)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)|embryonic cleavage (GO:0040016)|erythrocyte maturation (GO:0043249)|extracellular matrix organization (GO:0030198)|gene expression (GO:0010467)|hair cell differentiation (GO:0035315)|hair follicle maturation (GO:0048820)|hematopoietic stem cell differentiation (GO:0060218)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision (GO:0033683)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral transcription (GO:0050434)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to hypoxia (GO:0001666)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|spinal cord development (GO:0021510)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)|viral process (GO:0016032)	cytoplasm (GO:0005737)|holo TFIIH complex (GO:0005675)|MMXD complex (GO:0071817)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	4 iron, 4 sulfur cluster binding (GO:0051539)|5'-3' DNA helicase activity (GO:0043139)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			large_intestine(4)|lung(2)|ovary(1)|pancreas(1)|stomach(1)	9		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		AGCACTTCGTCGGGCAGCACG	0.746			"""Mis, N, F, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum				C|||	974	0.194489	0.0734	0.1988	5008	,	,		10423	0.0496		0.3588	False		,,,				2504	0.3354				p.D312N		.	yes	Rec		Xeroderma pigmentosum (D)	19	19q13.2-q13.3	2068	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 (xeroderma pigmentosum D)"""		E	.	ERCC2-848	0			c.G934A	GRCh37	CM015299	ERCC2	M	rs1799793	.	C	ASN/ASP,ASN/ASP	387,3577		30,327,1625	5.0	8.0	7.0		934,862	5.2	0.5	19	dbSNP_89	7	2507,5397		444,1619,1889	no	missense,missense	ERCC2	NM_000400.3,NM_001130867.1	23,23	474,1946,3514	TT,TC,CC		31.7181,9.7629,24.3849	benign,benign	312/761,288/406	45867259	2894,8974	1982	3952	5934	SO:0001583	missense	2068	exon10	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	CTTCGTCGGGCAG		CCDS33049.1, CCDS46112.1	19q13.3	2014-09-17	2014-03-07		ENSG00000104884	ENSG00000104884	3.6.4.12	"""General transcription factor IIH complex subunits"""	3434	protein-coding gene	gene with protein product	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 protein"", ""TFIIH basal transcription factor complex helicase XPB subunit"""	126340	"""xeroderma pigmentosum complementary group D"", ""excision repair cross-complementing rodent repair deficiency, complementation group 2"""	XPD		8413672, 2184031	Standard	NM_000400		Approved	MAG, EM9, MGC102762, MGC126218, MGC126219, TFIIH	uc002pbj.2	P18074	OTTHUMG00000048190	ENST00000391945.4:c.934G>A	19.37:g.45867259C>T	ENSP00000375809:p.Asp312Asn	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	18	18	NM_000400	0	0	0	24	24	Q2TB78|Q2YDY2|Q7KZU6|Q8N721	Missense_Mutation	SNP	ENST00000391945.4	37	CCDS33049.1	423	0.1936813186813187	34	0.06910569105691057	70	0.19337016574585636	38	0.06643356643356643	281	0.370712401055409	C	20.0	3.930510	0.73327	0.097629	0.317181	ENSG00000104884	ENST00000391941;ENST00000391942;ENST00000391945;ENST00000391944;ENST00000391940	T;T;T	0.64438	-0.1;-0.1;-0.1	5.15	5.15	0.70609	Domain of unknown function DUF1227 (1);	0.000000	0.85682	D	0.000000	T	0.00012	0.0000	L	0.46947	1.48	0.09310	P	1.0	B;P;B	0.34639	0.065;0.461;0.053	B;B;B	0.35353	0.059;0.201;0.051	T	0.28267	-1.0049	9	0.33940	T	0.23	-30.0006	16.1268	0.81402	0.0:1.0:0.0:0.0	rs1799793;rs3916814;rs58989209;rs1799793	234;288;312	E7EVE9;Q7KZU6;P18074	.;.;ERCC2_HUMAN	N	262;288;312;234;288	ENSP00000375809:D312N;ENSP00000375808:D234N;ENSP00000375804:D288N	ENSP00000375804:D288N	D	-	1	0	ERCC2	50559099	1.000000	0.71417	0.523000	0.27875	0.865000	0.49528	7.192000	0.77771	2.388000	0.81334	0.561000	0.74099	GAC	C|0.804;T|0.196		0.746	ERCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109626.2	NM_000400	
PTGIR	5739	hgsc.bcm.edu	37	19	47127324	47127324	+	Silent	SNP	C	C	G	rs2229128	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr19:47127324C>G	ENST00000291294.2	-	2	292	c.159G>C	c.(157-159)gtG>gtC	p.V53V	PTGIR_ENST00000594275.1_Intron|PTGIR_ENST00000596260.1_Silent_p.V53V|PTGIR_ENST00000597185.1_Intron|PTGIR_ENST00000598865.1_Intron	NM_000960.3	NP_000951.1	P43119	PI2R_HUMAN	prostaglandin I2 (prostacyclin) receptor (IP)	53					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of GTPase activity (GO:0043547)|response to lipopolysaccharide (GO:0032496)	cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	13		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000327)|all cancers(93;0.000641)|Epithelial(262;0.0174)|GBM - Glioblastoma multiforme(486;0.0331)	Dinoprost Tromethamine(DB01160)|Epoprostenol(DB01240)|Iloprost(DB01088)|Treprostinil(DB00374)	CCAGTCCGGTCACCAGCACCG	0.731													G|||	1139	0.227436	0.1362	0.2133	5008	,	,		13968	0.3313		0.2465	False		,,,				2504	0.2342				p.V53V		.											.	PTGIR-522	0			c.G159C						.	G		523,3103		62,399,1352	3.0	5.0	5.0		159	2.2	1.0	19	dbSNP_98	5	1678,5498		231,1216,2141	no	coding-synonymous	PTGIR	NM_000960.3		293,1615,3493	GG,GC,CC		23.3835,14.4236,20.3759		53/387	47127324	2201,8601	1813	3588	5401	SO:0001819	synonymous_variant	5739	exon2			TCCGGTCACCAGC		CCDS12686.1	19q13.3	2012-08-08				ENSG00000160013		"""GPCR / Class A : Prostanoid receptors"""	9602	protein-coding gene	gene with protein product		600022				7759114	Standard	NM_000960		Approved	IP	uc002pex.3	P43119		ENST00000291294.2:c.159G>C	19.37:g.47127324C>G		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	17	6	NM_000960	0	0	0	0	0		Silent	SNP	ENST00000291294.2	37	CCDS12686.1																																																																																			C|0.254;G|0.746		0.731	PTGIR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466581.1		
SAE1	10055	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	47673134	47673134	+	Silent	SNP	A	A	G			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr19:47673134A>G	ENST00000270225.7	+	6	755	c.687A>G	c.(685-687)gcA>gcG	p.A229A	SAE1_ENST00000540850.1_Silent_p.A55A|SAE1_ENST00000413379.3_Silent_p.A229A|SAE1_ENST00000598840.1_Silent_p.A148A|SAE1_ENST00000392776.3_Silent_p.A229A	NM_005500.2	NP_005491.1	Q9UBE0	SAE1_HUMAN	SUMO1 activating enzyme subunit 1	229					cellular protein metabolic process (GO:0044267)|positive regulation of catalytic activity (GO:0043085)|post-translational protein modification (GO:0043687)|protein sumoylation (GO:0016925)|protein ubiquitination (GO:0016567)|regulation of mitotic cell cycle (GO:0007346)|SMT3-dependent protein catabolic process (GO:0019950)	cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP-dependent protein binding (GO:0043008)|enzyme activator activity (GO:0008047)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|ubiquitin activating enzyme activity (GO:0004839)			endometrium(3)|large_intestine(5)|lung(4)|ovary(1)	13		all_cancers(25;1.13e-05)|all_lung(116;0.000192)|all_epithelial(76;0.000274)|Lung NSC(112;0.000446)|all_neural(266;0.0652)|Ovarian(192;0.15)		all cancers(93;0.00013)|OV - Ovarian serous cystadenocarcinoma(262;0.000146)|Epithelial(262;0.00697)|GBM - Glioblastoma multiforme(486;0.0278)		GTGAGAAAGCAAAGGCTGCTC	0.502																																					p.A229A		.											.	SAE1-227	0			c.A687G						.						147.0	135.0	139.0					19																	47673134		2203	4300	6503	SO:0001819	synonymous_variant	10055	exon6			GAAAGCAAAGGCT	BC018271	CCDS12696.1, CCDS54284.1, CCDS54285.1	19q13.32	2013-09-26				ENSG00000142230		"""Ubiquitin-like modifier activating enzymes"""	30660	protein-coding gene	gene with protein product	"""activator Of sumo 1"""	613294				10187858, 9920803, 10217437	Standard	NM_005500		Approved	AOS1, FLJ3091, Sua1	uc002pgc.3	Q9UBE0		ENST00000270225.7:c.687A>G	19.37:g.47673134A>G		Somatic	106	0		WXS	Illumina GAIIx	Phase_I	164	37	NM_001145714	0	0	107	153	46	B2RDP5|B3KMQ2|F5GXX7|G3XAK6|O95717|Q9P020	Silent	SNP	ENST00000270225.7	37	CCDS12696.1																																																																																			.		0.502	SAE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466775.1	NM_005500	
SLC8A2	6543	hgsc.bcm.edu	37	19	47951116	47951116	+	Silent	SNP	C	C	T			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr19:47951116C>T	ENST00000236877.6	-	4	2108	c.1713G>A	c.(1711-1713)gtG>gtA	p.V571V	SLC8A2_ENST00000542837.1_Silent_p.V327V|SLC8A2_ENST00000601757.1_5'Flank|SLC8A2_ENST00000539381.1_Silent_p.V34V	NM_015063.2	NP_055878.1	Q9UPR5	NAC2_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 2	571	Calx-beta 2.				blood coagulation (GO:0007596)|cell communication (GO:0007154)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium:sodium antiporter activity (GO:0005432)			breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(2)|prostate(2)|skin(5)|stomach(1)	31		all_cancers(25;3.05e-07)|all_lung(116;4.19e-06)|Lung NSC(112;7.16e-06)|all_epithelial(76;7.65e-06)|all_neural(266;0.0652)|Ovarian(192;0.086)|Breast(70;0.173)		OV - Ovarian serous cystadenocarcinoma(262;0.000501)|all cancers(93;0.00058)|Epithelial(262;0.0181)|GBM - Glioblastoma multiforme(486;0.0457)		CCTCGTAGTGCACGCCGCCGC	0.751																																					p.V571V		.											.	SLC8A2-94	0			c.G1713A						.						6.0	6.0	6.0					19																	47951116		2037	3963	6000	SO:0001819	synonymous_variant	6543	exon4			GTAGTGCACGCCG	AB029010	CCDS33065.1	19q13.32	2013-07-15	2008-09-02		ENSG00000118160	ENSG00000118160		"""Solute carriers"""	11069	protein-coding gene	gene with protein product		601901				8021246	Standard	NM_015063		Approved	NCX2, KIAA1087	uc002pgx.3	Q9UPR5	OTTHUMG00000183529	ENST00000236877.6:c.1713G>A	19.37:g.47951116C>T		Somatic	2	0		WXS	Illumina GAIIx	Phase_I	44	18	NM_015063	0	0	0	0	0	B4DYQ9	Silent	SNP	ENST00000236877.6	37	CCDS33065.1																																																																																			.		0.751	SLC8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466997.1		
LRRC4B	94030	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	51022585	51022585	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr19:51022585C>T	ENST00000599957.1	-	3	582	c.385G>A	c.(385-387)Gcc>Acc	p.A129T	LRRC4B_ENST00000389201.3_Missense_Mutation_p.A129T			Q9NT99	LRC4B_HUMAN	leucine rich repeat containing 4B	129					positive regulation of synapse assembly (GO:0051965)	cell junction (GO:0030054)|cerebellar mossy fiber (GO:0044300)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|liver(1)|lung(11)|prostate(4)|skin(1)|urinary_tract(1)	30		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00284)|GBM - Glioblastoma multiforme(134;0.0188)		CCGTTGAAGGCGCCCACCTCG	0.627																																					p.A129T		.											.	LRRC4B-205	0			c.G385A						.						41.0	45.0	43.0					19																	51022585		2178	4290	6468	SO:0001583	missense	94030	exon3			TGAAGGCGCCCAC	BC032460	CCDS42595.1	19q13.33	2014-01-30	2004-06-14	2004-06-16	ENSG00000131409	ENSG00000131409		"""Immunoglobulin superfamily / I-set domain containing"", ""Endogenous ligands"""	25042	protein-coding gene	gene with protein product	"""netrin-G3 ligand"""		"""leucine-rich repeats and immunoglobulin-like domains 4"""	LRIG4		11441184	Standard	NM_001080457		Approved	DKFZp761A179, HSM	uc002pss.3	Q9NT99		ENST00000599957.1:c.385G>A	19.37:g.51022585C>T	ENSP00000471502:p.Ala129Thr	Somatic	84	0		WXS	Illumina GAIIx	Phase_I	224	58	NM_001080457	0	0	0	0	0	Q3ZCQ4|Q58F20	Missense_Mutation	SNP	ENST00000599957.1	37	CCDS42595.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.388117	0.82902	.	.	ENSG00000131409	ENST00000389201;ENST00000535879	D	0.93426	-3.22	3.96	3.96	0.45880	.	0.000000	0.64402	U	0.000010	D	0.94248	0.8153	L	0.37800	1.135	0.58432	D	0.999999	D	0.89917	1.0	D	0.83275	0.996	D	0.94518	0.7724	10	0.62326	D	0.03	.	13.9104	0.63864	0.0:1.0:0.0:0.0	.	129	Q9NT99	LRC4B_HUMAN	T	129	ENSP00000373853:A129T	ENSP00000373853:A129T	A	-	1	0	LRRC4B	55714397	1.000000	0.71417	0.978000	0.43139	0.945000	0.59286	7.645000	0.83430	2.235000	0.73313	0.491000	0.48974	GCC	.		0.627	LRRC4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464907.1	NM_001080457	
TMEM86B	255043	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	55739581	55739581	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr19:55739581G>C	ENST00000327042.4	-	2	798	c.276C>G	c.(274-276)atC>atG	p.I92M	AC010327.2_ENST00000598855.1_3'UTR	NM_173804.4	NP_776165.3	Q8N661	TM86B_HUMAN	transmembrane protein 86B	92					ether lipid metabolic process (GO:0046485)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	alkenylglycerophosphocholine hydrolase activity (GO:0047408)|alkenylglycerophosphoethanolamine hydrolase activity (GO:0047409)			skin(2)	2			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0443)		CTGCCGGCCAGATGAGGCAAG	0.657																																					p.I92M		.											.	TMEM86B-90	0			c.C276G						.						27.0	28.0	27.0					19																	55739581		2202	4300	6502	SO:0001583	missense	255043	exon2			CGGCCAGATGAGG	BC023000	CCDS12920.1	19q13.42	2011-07-12					3.3.2.2, 3.3.2.5		28448	protein-coding gene	gene with protein product						21515882	Standard	NM_173804		Approved	MGC30208	uc002qju.3	Q8N661		ENST00000327042.4:c.276C>G	19.37:g.55739581G>C	ENSP00000321038:p.Ile92Met	Somatic	101	0		WXS	Illumina GAIIx	Phase_I	196	49	NM_173804	0	0	13	16	3		Missense_Mutation	SNP	ENST00000327042.4	37	CCDS12920.1	.	.	.	.	.	.	.	.	.	.	.	11.20	1.568851	0.28003	.	.	ENSG00000180089	ENST00000327042	T	0.21361	2.01	5.4	1.94	0.25998	.	0.429481	0.23764	N	0.044791	T	0.23846	0.0577	L	0.28504	0.86	0.43959	D	0.996634	D	0.69078	0.997	D	0.70487	0.969	T	0.19095	-1.0316	10	0.13108	T	0.6	.	5.59	0.17295	0.0738:0.2587:0.5342:0.1332	.	92	Q8N661	TM86B_HUMAN	M	92	ENSP00000321038:I92M	ENSP00000321038:I92M	I	-	3	3	TMEM86B	60431393	1.000000	0.71417	0.981000	0.43875	0.262000	0.26303	1.592000	0.36676	0.311000	0.23014	0.655000	0.94253	ATC	.		0.657	TMEM86B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452659.1	NM_173804	
ZNF628	89887	hgsc.bcm.edu	37	19	55993260	55993260	+	Missense_Mutation	SNP	A	A	G	rs34864744	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr19:55993260A>G	ENST00000598519.1	+	3	1253	c.700A>G	c.(700-702)Acc>Gcc	p.T234A	ZNF628_ENST00000391718.2_Missense_Mutation_p.T230A			Q5EBL2	ZN628_HUMAN	zinc finger protein 628	234	Pro-rich.			T -> A (in Ref. 2; AAH89449). {ECO:0000305}.	transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(1)|lung(2)	7	Breast(117;0.155)		BRCA - Breast invasive adenocarcinoma(297;0.18)|LUSC - Lung squamous cell carcinoma(43;0.193)	GBM - Glioblastoma multiforme(193;0.0531)		cgccccgggtaccgcctccgc	0.766													N|||	3815	0.761781	0.9387	0.732	5008	,	,		4719	0.4395		0.837	False		,,,				2504	0.7986				p.T234A		.											.	ZNF628-22	0			c.A700G						.						3.0	4.0	4.0					19																	55993260		1771	3509	5280	SO:0001583	missense	89887	exon3			CCGGGTACCGCCT	AF367249	CCDS33116.3	19q13.43	2013-01-08			ENSG00000197483	ENSG00000197483		"""Zinc fingers, C2H2-type"""	28054	protein-coding gene	gene with protein product	"""Zinc finger expressed in Embryonal cells and Certain adult organs"""	610671					Standard	NM_033113		Approved	ZEC, Zfp628	uc002qld.3	Q5EBL2	OTTHUMG00000150396	ENST00000598519.1:c.700A>G	19.37:g.55993260A>G	ENSP00000469591:p.Thr234Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_033113	0	0	0	0	0	Q86X34	Missense_Mutation	SNP	ENST00000598519.1	37	CCDS33116.3	1594	0.7298534798534798	448	0.9105691056910569	272	0.7513812154696132	259	0.4527972027972028	615	0.8113456464379947	.	0.001	-2.964343	0.00049	.	.	ENSG00000197483	ENST00000391718	T	0.08193	3.12	3.0	-0.723	0.11181	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.05852	-1.0860	8	0.25106	T	0.35	0.0335	6.0751	0.19911	0.3452:0.3167:0.3381:0.0	rs34864744	230	Q5EBL2	ZN628_HUMAN	A	230	ENSP00000375598:T230A	ENSP00000375598:T230A	T	+	1	0	ZNF628	60685072	0.324000	0.24652	0.001000	0.08648	0.007000	0.05969	-0.265000	0.08644	-0.261000	0.09405	-2.335000	0.00248	ACC	A|0.270;G|0.730		0.766	ZNF628-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317934.2	XM_058964	
ZFP28	140612	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	57065768	57065768	+	Silent	SNP	T	T	C			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr19:57065768T>C	ENST00000301318.3	+	8	1685	c.1614T>C	c.(1612-1614)tgT>tgC	p.C538C	AC007228.11_ENST00000596587.1_RNA	NM_020828.1	NP_065879.1	Q8NHY6	ZFP28_HUMAN	ZFP28 zinc finger protein	538					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(1)|large_intestine(14)|lung(6)|ovary(1)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	35		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0302)		GTGATGTATGTCACAAATCCT	0.413																																					p.C538C	Ovarian(124;554 1662 19430 21141 52494)	.											.	ZFP28-91	0			c.T1614C						.						60.0	56.0	57.0					19																	57065768		2203	4300	6503	SO:0001819	synonymous_variant	140612	exon8			TGTATGTCACAAA		CCDS12946.1	19q13.43	2013-01-08	2012-11-27			ENSG00000196867		"""Zinc fingers, C2H2-type"", ""-"""	17801	protein-coding gene	gene with protein product			"""zinc finger protein 28 homolog (mouse)"""				Standard	NM_020828		Approved	KIAA1431, mkr5	uc002qnj.3	Q8NHY6		ENST00000301318.3:c.1614T>C	19.37:g.57065768T>C		Somatic	61	0		WXS	Illumina GAIIx	Phase_I	56	8	NM_020828	0	0	8	8	0	A0JNV6|K7ES88|Q8NHU8|Q9BY30|Q9P2B6	Silent	SNP	ENST00000301318.3	37	CCDS12946.1																																																																																			.		0.413	ZFP28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458409.1	NM_020828	
TPO	7173	hgsc.bcm.edu	37	2	1481231	1481231	+	Missense_Mutation	SNP	G	G	C	rs2175977	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr2:1481231G>C	ENST00000345913.4	+	8	1284	c.1193G>C	c.(1192-1194)aGc>aCc	p.S398T	TPO_ENST00000329066.4_Missense_Mutation_p.S398T|TPO_ENST00000382201.3_Missense_Mutation_p.S398T|TPO_ENST00000337415.3_Missense_Mutation_p.S398T|TPO_ENST00000349624.3_Intron|TPO_ENST00000497517.2_Intron|TPO_ENST00000382198.1_Intron|TPO_ENST00000346956.3_Missense_Mutation_p.S398T	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	398			S -> T (in dbSNP:rs2175977). {ECO:0000269|PubMed:7550241}.		cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	GGCCGCGCCAGCGAGGTCCCC	0.761													G|||	3557	0.710264	0.8185	0.6571	5008	,	,		9157	0.7758		0.6034	False		,,,				2504	0.6442				p.S398T		.											.	TPO-332	0			c.G1193C						.	G	THR/SER,THR/SER,THR/SER,THR/SER,THR/SER,	2498,394		1072,354,20	2.0	2.0	2.0		1193,1193,1193,1193,1193,	4.1	1.0	2	dbSNP_96	2	4199,1477		1511,1177,150	no	missense,missense,missense,missense,missense,intron	TPO	NM_000547.5,NM_001206744.1,NM_001206745.1,NM_175719.3,NM_175721.3,NM_175722.3	58,58,58,58,58,	2583,1531,170	CC,CG,GG		26.0218,13.6238,21.8371	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,	398/934,398/934,398/877,398/877,398/890,	1481231	6697,1871	1446	2838	4284	SO:0001583	missense	7173	exon8			GCGCCAGCGAGGT		CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.1193G>C	2.37:g.1481231G>C	ENSP00000318820:p.Ser398Thr	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	9	NM_175719	0	0	0	0	0	P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Missense_Mutation	SNP	ENST00000345913.4	37	CCDS1643.1	1512|1512	0.6923076923076923|0.6923076923076923	388|388	0.7886178861788617|0.7886178861788617	227|227	0.6270718232044199|0.6270718232044199	438|438	0.7657342657342657|0.7657342657342657	459|459	0.6055408970976254|0.6055408970976254	G|G	18.72|18.72	3.683431|3.683431	0.68157|0.68157	0.863762|0.863762	0.739782|0.739782	ENSG00000115705|ENSG00000115705	ENST00000536482|ENST00000337415;ENST00000345913;ENST00000346956;ENST00000329066;ENST00000382201;ENST00000422464	.|T;T;T;T;T;T	.|0.73897	.|-0.79;-0.79;-0.79;-0.79;-0.79;-0.79	4.99|4.99	4.08|4.08	0.47627|0.47627	.|.	.|0.142496	.|0.64402	.|N	.|0.000004	T|T	0.00012|0.00012	0.0000|0.0000	M|M	0.62723|0.62723	1.935|1.935	0.09310|0.09310	P|P	1.0|1.0	.|D;D;D	.|0.76494	.|0.998;0.998;0.999	.|D;D;D	.|0.69654	.|0.956;0.94;0.965	T|T	0.30060|0.30060	-0.9991|-0.9991	5|9	0.48119|0.56958	T|D	0.1|0.05	-48.0867|-48.0867	8.6411|8.6411	0.33978|0.33978	0.08:0.1541:0.7659:0.0|0.08:0.1541:0.7659:0.0	rs2175977|rs2175977	.|398;398;398	.|P07202-4;P07202-2;P07202	.|.;.;PERT_HUMAN	H|T	81|398;398;398;398;398;327	.|ENSP00000337263:S398T;ENSP00000318820:S398T;ENSP00000263886:S398T;ENSP00000329869:S398T;ENSP00000371636:S398T;ENSP00000405788:S327T	ENSP00000439133:Q81H|ENSP00000329869:S398T	Q|S	+|+	3|2	2|0	TPO|TPO	1460238|1460238	0.956000|0.956000	0.32656|0.32656	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	1.297000|1.297000	0.33400|0.33400	1.031000|1.031000	0.39867|0.39867	0.460000|0.460000	0.39030|0.39030	CAG|AGC	G|0.301;C|0.699		0.761	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206594.2	NM_000547	
MYT1L	23040	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	1946895	1946895	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr2:1946895C>T	ENST00000399161.2	-	9	1111	c.364G>A	c.(364-366)Gag>Aag	p.E122K	MYT1L_ENST00000428368.2_Missense_Mutation_p.E122K	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	122	Asp/Glu-rich.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		tcgtcctcctcgtcctcatcc	0.577																																					p.E122K		.											.	MYT1L-95	0			c.G364A						.						87.0	87.0	87.0					2																	1946895		2097	4091	6188	SO:0001583	missense	23040	exon9			CCTCCTCGTCCTC	AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.364G>A	2.37:g.1946895C>T	ENSP00000382114:p.Glu122Lys	Somatic	135	2		WXS	Illumina GAIIx	Phase_I	270	168	NM_015025	0	0	0	0	0	A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Missense_Mutation	SNP	ENST00000399161.2	37		.	.	.	.	.	.	.	.	.	.	C	14.17	2.456125	0.43634	.	.	ENSG00000186487	ENST00000399161;ENST00000428368	T;T	0.45668	0.89;0.89	5.37	5.37	0.77165	.	1.042900	0.07673	U	0.935760	T	0.26955	0.0660	N	0.14661	0.345	0.51012	D	0.999907	P;P	0.38370	0.495;0.628	B;B	0.28232	0.04;0.087	T	0.29610	-1.0006	10	0.08599	T	0.76	-8.1461	18.72	0.91689	0.0:1.0:0.0:0.0	.	122;122	Q9UL68;Q9UL68-4	MYT1L_HUMAN;.	K	122	ENSP00000382114:E122K;ENSP00000396103:E122K	ENSP00000382114:E122K	E	-	1	0	MYT1L	1925902	0.998000	0.40836	0.479000	0.27329	0.131000	0.20780	6.378000	0.73150	2.518000	0.84900	0.563000	0.77884	GAG	.		0.577	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000322493.1	NM_015025	
CMPK2	129607	hgsc.bcm.edu	37	2	7005369	7005369	+	Silent	SNP	A	A	G	rs11678810	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr2:7005369A>G	ENST00000256722.5	-	1	458	c.459T>C	c.(457-459)tgT>tgC	p.C153C	CMPK2_ENST00000478738.1_Intron|CMPK2_ENST00000458098.1_Silent_p.C153C|CMPK2_ENST00000404168.1_Silent_p.C153C	NM_207315.3	NP_997198.2	Q5EBM0	CMPK2_HUMAN	cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial	153					cellular response to lipopolysaccharide (GO:0071222)|dTDP biosynthetic process (GO:0006233)|dUDP biosynthetic process (GO:0006227)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cytidylate kinase activity (GO:0004127)|nucleoside diphosphate kinase activity (GO:0004550)|thymidylate kinase activity (GO:0004798)|UMP kinase activity (GO:0033862)			large_intestine(1)|lung(13)|prostate(1)|upper_aerodigestive_tract(1)	16	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					GTGCCTCCTGACAGGCGCCCA	0.741													G|||	4998	0.998003	0.9924	1.0	5008	,	,		10694	1.0		1.0	False		,,,				2504	1.0				p.C153C		.											.	CMPK2-68	0			c.T459C						.	G		3605,39		1783,39,0	3.0	4.0	4.0		459	1.6	0.0	2	dbSNP_120	4	7874,0		3937,0,0	no	coding-synonymous	CMPK2	NM_207315.2		5720,39,0	GG,GA,AA		0.0,1.0703,0.3386		153/450	7005369	11479,39	1822	3937	5759	SO:0001819	synonymous_variant	129607	exon1			CTCCTGACAGGCG		CCDS42648.1, CCDS58695.1, CCDS58696.1	2p25.2	2008-01-25			ENSG00000134326	ENSG00000134326	2.7.4.14		27015	protein-coding gene	gene with protein product	"""cytidylate kinase 2"""	611787				17999954	Standard	NM_207315		Approved	TYKi, UMP-CMPK2	uc002qyo.4	Q5EBM0	OTTHUMG00000151629	ENST00000256722.5:c.459T>C	2.37:g.7005369A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_001256478	0	0	0	1	1	A2RUB0|A5D8T2|B7ZM18|Q6ZRU2|Q96AL8	Silent	SNP	ENST00000256722.5	37	CCDS42648.1																																																																																			A|0.003;G|0.997		0.741	CMPK2-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323339.2	NM_207315	
RRM2	6241	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	10263878	10263878	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr2:10263878G>A	ENST00000304567.5	+	4	403	c.334G>A	c.(334-336)Gac>Aac	p.D112N	RP11-254F7.4_ENST00000607140.1_lincRNA|RRM2_ENST00000360566.2_Missense_Mutation_p.D172N	NM_001034.3	NP_001025.1	P31350	RIR2_HUMAN	ribonucleotide reductase M2	112					deoxyribonucleoside diphosphate metabolic process (GO:0009186)|deoxyribonucleotide biosynthetic process (GO:0009263)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|protein heterotetramerization (GO:0051290)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|ribonucleoside-diphosphate reductase activity, thioredoxin disulfide as acceptor (GO:0004748)			NS(1)|breast(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(7)|skin(1)	19	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.188)|OV - Ovarian serous cystadenocarcinoma(76;0.221)	Cladribine(DB00242)|Gallium nitrate(DB05260)	CCTCTCCAAGGACATTCAGCA	0.428																																					p.D172N		.											.	RRM2-227	0			c.G514A						.						85.0	91.0	89.0					2																	10263878		2203	4300	6503	SO:0001583	missense	6241	exon4			TCCAAGGACATTC		CCDS1669.1, CCDS54334.1	2p25-p24	2012-10-02	2009-07-10		ENSG00000171848	ENSG00000171848	1.17.4.1		10452	protein-coding gene	gene with protein product		180390	"""ribonucleotide reductase M2 polypeptide"""				Standard	NM_001034		Approved		uc021vdr.1	P31350	OTTHUMG00000090449	ENST00000304567.5:c.334G>A	2.37:g.10263878G>A	ENSP00000302955:p.Asp112Asn	Somatic	77	0		WXS	Illumina GAIIx	Phase_I	77	28	NM_001165931	0	0	67	101	34	B2R9B5|J3KP43|Q5WRU7	Missense_Mutation	SNP	ENST00000304567.5	37	CCDS1669.1	.	.	.	.	.	.	.	.	.	.	G	35	5.451894	0.96205	.	.	ENSG00000171848	ENST00000360566;ENST00000304567;ENST00000474701	D;D;D	0.99532	-6.1;-6.1;-5.86	5.18	5.18	0.71444	Ferritin/ribonucleotide reductase-like (1);Ribonucleotide reductase-related (1);	0.000000	0.85682	D	0.000000	D	0.99862	0.9935	H	0.99752	4.75	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.96170	0.9122	10	0.87932	D	0	-11.1105	18.6964	0.91603	0.0:0.0:1.0:0.0	.	112	P31350	RIR2_HUMAN	N	172;112;62	ENSP00000353770:D172N;ENSP00000302955:D112N;ENSP00000419177:D62N	ENSP00000302955:D112N	D	+	1	0	RRM2	10181329	1.000000	0.71417	1.000000	0.80357	0.783000	0.44284	9.695000	0.98691	2.425000	0.82216	0.561000	0.74099	GAC	.		0.428	RRM2-013	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364902.2		
ASXL2	55252	broad.mit.edu	37	2	25965360	25965360	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr2:25965360G>C	ENST00000435504.4	-	13	4139	c.3846C>G	c.(3844-3846)atC>atG	p.I1282M	ASXL2_ENST00000336112.4_Missense_Mutation_p.I1254M|ASXL2_ENST00000404843.1_Missense_Mutation_p.I765M|ASXL2_ENST00000272341.4_Missense_Mutation_p.I765M			Q76L83	ASXL2_HUMAN	additional sex combs like transcriptional regulator 2	1282					adult heart development (GO:0007512)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of bone mineralization involved in bone maturation (GO:1900159)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of histone H3-K27 trimethylation (GO:1902466)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(7)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(3)	33	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGCTGCTACGGATTGCCTTAC	0.527																																					p.I1282M		.											.	ASXL2-23	0			c.C3846G						.						46.0	47.0	46.0					2																	25965360		1973	4144	6117	SO:0001583	missense	55252	exon12			GCTACGGATTGCC			2p24.1	2014-06-17	2014-06-17		ENSG00000143970	ENSG00000143970			23805	protein-coding gene	gene with protein product		612991	"""additional sex combs like 2 (Drosophila)"""			12888926	Standard	NM_018263		Approved	ASXH2, FLJ10898, KIAA1685	uc002rgs.2	Q76L83	OTTHUMG00000152176	ENST00000435504.4:c.3846C>G	2.37:g.25965360G>C	ENSP00000391447:p.Ile1282Met	Somatic	47	0		WXS	Illumina GAIIx	Phase_I	35	3	NM_018263	0	0	1	1	0	Q53TC9|Q5H9U4|Q76L81|Q86XM1|Q9C0H8|Q9NV67	Missense_Mutation	SNP	ENST00000435504.4	37		.	.	.	.	.	.	.	.	.	.	G	0.021	-1.424269	0.01126	.	.	ENSG00000143970	ENST00000435504;ENST00000336112;ENST00000404843;ENST00000272341	T;T;T;T	0.17691	2.26;2.26;2.26;2.26	6.17	0.699	0.18093	.	0.492945	0.25291	N	0.031740	T	0.06508	0.0167	N	0.03115	-0.41	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	T	0.30446	-0.9978	10	0.46703	T	0.11	-0.0017	7.2115	0.25937	0.0:0.5321:0.1176:0.3504	.	765;1282	Q76L83-2;Q76L83	.;ASXL2_HUMAN	M	1282;1254;765;765	ENSP00000391447:I1282M;ENSP00000337250:I1254M;ENSP00000383920:I765M;ENSP00000272341:I765M	ENSP00000272341:I765M	I	-	3	3	ASXL2	25818864	0.000000	0.05858	0.001000	0.08648	0.427000	0.31564	0.097000	0.15168	0.173000	0.19788	-0.147000	0.13772	ATC	.		0.527	ASXL2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000325593.3	NM_018263	
TMEM247	388946	bcgsc.ca	37	2	46707808	46707808	+	Missense_Mutation	SNP	C	C	G	rs70940616|rs74318890		TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr2:46707808C>G	ENST00000434431.1	+	2	382	c.382C>G	c.(382-384)Cag>Gag	p.Q128E		NM_001145051.2	NP_001138523.1	A6NEH6	TM247_HUMAN	transmembrane protein 247	128						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)											GAACCAGCGGCAGCGGCAGCA	0.662																																					p.Q128E		.											.	.	0			c.C382G						.						30.0	40.0	37.0					2																	46707808		692	1591	2283	SO:0001583	missense	388946	exon2			CAGCGGCAGCGGC		CCDS56117.1	2p21	2012-04-11			ENSG00000187600	ENSG00000187600			42967	protein-coding gene	gene with protein product							Standard	NM_001145051		Approved		uc010yod.3	A6NEH6	OTTHUMG00000153137	ENST00000434431.1:c.382C>G	2.37:g.46707808C>G	ENSP00000388684:p.Gln128Glu	Somatic	217	4		WXS	Illumina GAIIx	Phase_I	596	41	NM_001145051	0	0	0	0	0		Missense_Mutation	SNP	ENST00000434431.1	37	CCDS56117.1	.	.	.	.	.	.	.	.	.	.	C	17.67	3.447093	0.63178	.	.	ENSG00000187600	ENST00000434431	.	.	.	4.76	4.76	0.60689	.	0.000000	0.39475	N	0.001353	T	0.65606	0.2707	L	0.34521	1.04	.	.	.	D	0.56035	0.974	D	0.70487	0.969	T	0.71735	-0.4503	8	0.54805	T	0.06	-28.7409	14.7885	0.69821	0.0:1.0:0.0:0.0	.	128	A6NEH6	YB028_HUMAN	E	128	.	ENSP00000388684:Q128E	Q	+	1	0	AC018682.6	46561312	1.000000	0.71417	1.000000	0.80357	0.569000	0.35902	3.910000	0.56371	2.484000	0.83849	0.563000	0.77884	CAG	G|1.000;|0.000		0.662	TMEM247-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329726.1	NM_001145051	
USP39	10713	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	85872161	85872161	+	Silent	SNP	C	C	T	rs145807458		TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr2:85872161C>T	ENST00000323701.6	+	11	1528	c.1518C>T	c.(1516-1518)gaC>gaT	p.D506D	USP39_ENST00000409470.1_Silent_p.D506D|USP39_ENST00000409025.1_Silent_p.D506D|USP39_ENST00000409766.3_Intron|USP39_ENST00000459775.1_3'UTR|USP39_ENST00000450066.2_Silent_p.D403D	NM_006590.3	NP_006581.2	Q53GS9	SNUT2_HUMAN	ubiquitin specific peptidase 39	506	USP.				cell cycle (GO:0007049)|cell division (GO:0051301)|mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)|ubiquitin-dependent protein catabolic process (GO:0006511)	spliceosomal complex (GO:0005681)	ubiquitinyl hydrolase activity (GO:0036459)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	19						TCGTGCATGACGGCAAGCCCT	0.488																																					p.D506D		.											.	USP39-658	0			c.C1518T						.	C		1,4405	2.1+/-5.4	0,1,2202	117.0	97.0	104.0		1518	-4.1	0.8	2	dbSNP_134	104	0,8600		0,0,4300	no	coding-synonymous	USP39	NM_006590.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		506/566	85872161	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	10713	exon11			GCATGACGGCAAG	AF132955	CCDS33234.1, CCDS58716.1, CCDS58717.1, CCDS74534.1	2p11.2	2009-01-06	2005-08-08		ENSG00000168883	ENSG00000168883		"""Ubiquitin-specific peptidases"""	20071	protein-coding gene	gene with protein product	"""snRNP assembly defective 1 homolog (S.cerevisiae)"", ""small nuclear ribonucleoprotein 65kDa (U4/U6.U5)"""	611594	"""ubiquitin specific protease 39"""			12838346	Standard	NM_006590		Approved	SAD1, CGI-21, SNRNP65	uc002sqg.4	Q53GS9	OTTHUMG00000153090	ENST00000323701.6:c.1518C>T	2.37:g.85872161C>T		Somatic	198	0		WXS	Illumina GAIIx	Phase_I	318	88	NM_001256725	0	0	54	75	21	A8K086|B3KM40|B4DHT4|D6W5L4|G5E9H0|Q6NX47|Q96RK9|Q9BV89|Q9H381|Q9P050|Q9Y310	Silent	SNP	ENST00000323701.6	37	CCDS33234.1																																																																																			C|1.000;T|0.000		0.488	USP39-009	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329892.1	NM_006590	
CD8B	926	hgsc.bcm.edu	37	2	87088964	87088964	+	Silent	SNP	A	A	G	rs62146888	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr2:87088964A>G	ENST00000390655.6	-	1	83	c.25T>C	c.(25-27)Ttg>Ctg	p.L9L	CD8B_ENST00000393761.2_Silent_p.L9L|CD8B_ENST00000349455.3_Silent_p.L9L|CD8B_ENST00000431506.2_Silent_p.L9L|CD8B_ENST00000393759.2_Silent_p.L9L|AC111200.1_ENST00000441646.1_5'Flank|CD8B_ENST00000331469.2_Silent_p.L9L	NM_004931.4	NP_004922.1	P10966	CD8B_HUMAN	CD8b molecule	9					immune response (GO:0006955)|regulation of defense response to virus by virus (GO:0050690)|regulation of immune response (GO:0050776)|T cell activation (GO:0042110)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|viral process (GO:0016032)	early endosome membrane (GO:0031901)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	coreceptor activity (GO:0015026)|MHC class I protein binding (GO:0042288)			NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	13						TGCGCGGCCAAGAGGAGCCAC	0.756													G|||	2559	0.510982	0.6626	0.3862	5008	,	,		7474	0.5427		0.4672	False		,,,				2504	0.407				p.L9L		.											.	CD8B-92	0			c.T25C						.						1.0	1.0	1.0					2																	87088964		543	1520	2063	SO:0001819	synonymous_variant	926	exon1			CGGCCAAGAGGAG		CCDS1994.1, CCDS1995.1, CCDS42708.1, CCDS1997.1, CCDS54376.1	2p12	2013-01-11	2006-03-28	2006-03-09	ENSG00000172116	ENSG00000172116		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1707	protein-coding gene	gene with protein product		186730	"""CD8 antigen, beta polypeptide 1 (p37)"""	CD8B1		1541829	Standard	NM_172213		Approved		uc002srw.3	P10966	OTTHUMG00000130264	ENST00000390655.6:c.25T>C	2.37:g.87088964A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_004931	0	0	0	0	0	P14860|P14861|Q15980|Q496E0|Q496E1|Q496E2|Q9UDB4|Q9UDB5|Q9UDB6|Q9UDB7|Q9UDB8|Q9UDB9|Q9UDC0|Q9UQ55	Silent	SNP	ENST00000390655.6	37	CCDS1997.1																																																																																			A|0.476;G|0.524		0.756	CD8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330402.1	NM_172099	
RANBP2	5903	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	109380404	109380404	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr2:109380404C>T	ENST00000283195.6	+	20	3535	c.3409C>T	c.(3409-3411)Cca>Tca	p.P1137S		NM_006267.4	NP_006258.3	P49792	RBP2_HUMAN	RAN binding protein 2	1137					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of glucokinase activity (GO:0033132)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein sumoylation (GO:0016925)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)	ligase activity (GO:0016874)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|Ran GTPase binding (GO:0008536)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)		RANBP2/ALK(34)	NS(1)|biliary_tract(1)|breast(3)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(21)|large_intestine(19)|lung(51)|pancreas(1)|prostate(8)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	129						TTTCCATGGTCCAGGGAAATC	0.428																																					p.P1137S		.											.	RANBP2-675	0			c.C3409T						.						85.0	86.0	86.0					2																	109380404		2203	4299	6502	SO:0001583	missense	5903	exon20			CATGGTCCAGGGA	D42063	CCDS2079.1	2q13	2013-11-14			ENSG00000153201	ENSG00000153201		"""Tetratricopeptide (TTC) repeat domain containing"""	9848	protein-coding gene	gene with protein product		601181	"""acute necrotizing encephalopathy 1 (autosomal dominant)"""	ANE1		7724562, 19118815	Standard	NM_006267		Approved	NUP358, ADANE	uc002tem.4	P49792	OTTHUMG00000130981	ENST00000283195.6:c.3409C>T	2.37:g.109380404C>T	ENSP00000283195:p.Pro1137Ser	Somatic	195	1		WXS	Illumina GAIIx	Phase_I	219	64	NM_006267	0	0	3	5	2	Q13074|Q15280|Q53TE2|Q59FH7	Missense_Mutation	SNP	ENST00000283195.6	37	CCDS2079.1	.	.	.	.	.	.	.	.	.	.	C	7.326	0.618047	0.14129	.	.	ENSG00000153201	ENST00000283195	T	0.27256	1.68	5.44	2.44	0.29823	.	.	.	.	.	T	0.18215	0.0437	L	0.41236	1.265	0.09310	N	0.999999	B	0.17852	0.024	B	0.13407	0.009	T	0.28808	-1.0032	9	0.19590	T	0.45	-7.0451	6.717	0.23308	0.0:0.5747:0.2781:0.1471	.	1137	P49792	RBP2_HUMAN	S	1137	ENSP00000283195:P1137S	ENSP00000283195:P1137S	P	+	1	0	RANBP2	108746836	0.266000	0.24112	0.997000	0.53966	0.194000	0.23727	0.309000	0.19332	0.633000	0.30452	0.557000	0.71058	CCA	.		0.428	RANBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253594.1	NM_006267	
SOWAHC	65124	hgsc.bcm.edu	37	2	110372192	110372192	+	Silent	SNP	A	A	G	rs6594048		TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr2:110372192A>G	ENST00000356454.3	+	1	282	c.126A>G	c.(124-126)ctA>ctG	p.L42L	SEPT10_ENST00000397714.2_5'Flank|SEPT10_ENST00000334001.6_5'Flank|SEPT10_ENST00000356688.4_5'Flank|SEPT10_ENST00000437928.1_5'Flank|SEPT10_ENST00000397712.2_5'Flank|SEPT10_ENST00000415095.1_5'Flank|SEPT10_ENST00000545389.1_5'Flank	NM_023016.3	NP_075392.2	Q53LP3	SWAHC_HUMAN	sosondowah ankyrin repeat domain family member C	42																	GGGGCGCCCTAGGCGGCGAAC	0.771													G|||	5008	1.0	1.0	1.0	5008	,	,		6158	1.0		1.0	False		,,,				2504	1.0				p.L42L		.											.	.	0			c.A126G						.						1.0	2.0	2.0					2																	110372192		1239	2477	3716	SO:0001819	synonymous_variant	65124	exon1			CGCCCTAGGCGGC	AK023346	CCDS33270.1	2q13	2013-01-10	2012-01-12	2012-01-12	ENSG00000198142	ENSG00000198142		"""Ankyrin repeat domain containing"""	26149	protein-coding gene	gene with protein product			"""ankyrin repeat domain 57"""	C2orf26, ANKRD57		22234889	Standard	NM_023016		Approved	FLJ21870	uc002tfb.3	Q53LP3	OTTHUMG00000153219	ENST00000356454.3:c.126A>G	2.37:g.110372192A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	13	13	NM_023016	0	0	0	1	1	Q8NE15|Q9H6U1	Silent	SNP	ENST00000356454.3	37	CCDS33270.1																																																																																			A|0.029;G|0.971		0.771	SOWAHC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330168.1	NM_023016	
SMPD4	55627	broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	130911319	130911319	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr2:130911319C>T	ENST00000409031.1	-	17	3114	c.1966G>A	c.(1966-1968)Gaa>Aaa	p.E656K	SMPD4_ENST00000443958.2_Missense_Mutation_p.E320K|SMPD4_ENST00000351288.6_Missense_Mutation_p.E627K|SMPD4_ENST00000339679.7_Missense_Mutation_p.E514K|SMPD4_ENST00000453750.1_Missense_Mutation_p.E405K|SMPD4_ENST00000431183.2_Missense_Mutation_p.E554K|SMPD4_ENST00000473720.1_5'Flank|SMPD4_ENST00000426662.2_Missense_Mutation_p.E292K|SMPD4_ENST00000452225.2_Missense_Mutation_p.E397K	NM_017951.4	NP_060421.2	Q9NXE4	NSMA3_HUMAN	sphingomyelin phosphodiesterase 4, neutral membrane (neutral sphingomyelinase-3)	617					cellular response to tumor necrosis factor (GO:0071356)|ceramide biosynthetic process (GO:0046513)|glycerophospholipid catabolic process (GO:0046475)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin catabolic process (GO:0006685)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|trans-Golgi network (GO:0005802)	metal ion binding (GO:0046872)|sphingomyelin phosphodiesterase activity (GO:0004767)|sphingomyelin phosphodiesterase D activity (GO:0050290)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(17)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	29	Colorectal(110;0.1)				Phosphatidylserine(DB00144)	TCCAGGTATTCATCTGTCTTC	0.592																																					p.E656K		.											.	SMPD4-90	0			c.G1966A						.						22.0	26.0	25.0					2																	130911319		2177	4264	6441	SO:0001583	missense	55627	exon17			GGTATTCATCTGT	AF052134	CCDS2156.2, CCDS42751.1, CCDS54398.1	2q21.1	2009-11-06			ENSG00000136699	ENSG00000136699			32949	protein-coding gene	gene with protein product		610457				16517606	Standard	NM_001171083		Approved	FLJ20297, FLJ20756, nSMase-3, KIAA1418, NSMASE3, NET13	uc002tqr.2	Q9NXE4	OTTHUMG00000131624	ENST00000409031.1:c.1966G>A	2.37:g.130911319C>T	ENSP00000386531:p.Glu656Lys	Somatic	424	1		WXS	Illumina GAIIx	Phase_I	478	104	NM_017951	0	0	42	57	15	B4DM23|B4DQ31|B4DRB8|B4DWK7|B4E0L6|E7ESA2|E9PCE6|Q6FI76|Q6P1P7|Q6ZT43|Q9H0M2|Q9NW20|Q9NWL2|Q9P2C9	Missense_Mutation	SNP	ENST00000409031.1	37	CCDS42751.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	15.24|15.24	2.775956|2.775956	0.49786|0.49786	.|.	.|.	ENSG00000136699|ENSG00000136699	ENST00000351288;ENST00000409031;ENST00000431183;ENST00000453750;ENST00000443958;ENST00000339679;ENST00000452225;ENST00000426662;ENST00000457039;ENST00000449159|ENST00000439886	.|.	.|.	.|.	3.91|3.91	3.91|3.91	0.45181|0.45181	.|.	0.052751|.	0.64402|.	D|.	0.000001|.	T|T	0.69079|0.69079	0.3071|0.3071	L|L	0.61036|0.61036	1.89|1.89	0.53005|0.53005	D|D	0.999963|0.999963	B;B;B;B;D;B;B;P;P;B|.	0.67145|.	0.313;0.045;0.08;0.08;0.996;0.05;0.097;0.918;0.587;0.095|.	B;B;B;B;D;B;B;P;B;B|.	0.75484|.	0.156;0.039;0.045;0.045;0.986;0.02;0.061;0.638;0.225;0.058|.	T|T	0.68996|0.68996	-0.5262|-0.5262	9|5	0.41790|.	T|.	0.15|.	.|.	13.4569|13.4569	0.61204|0.61204	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	292;397;554;514;405;588;617;656;663;188|.	B4E0L6;B4DQ31;E7ESA2;B4E0T5;B4DM23;Q9NXE4-2;Q9NXE4;B1PBA3;Q9NXE4-4;Q9NXE4-5|.	.;.;.;.;.;.;NSMA3_HUMAN;.;.;.|.	K|I	627;656;554;405;320;514;397;292;253;166|530	.|.	ENSP00000339721:E514K|.	E|M	-|-	1|3	0|0	SMPD4|SMPD4	130627789|130627789	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.447000|0.447000	0.32167|0.32167	7.215000|7.215000	0.77966|0.77966	1.714000|1.714000	0.51371|0.51371	0.549000|0.549000	0.68633|0.68633	GAA|ATG	.		0.592	SMPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254516.3	NM_017751	
MZT2A	653784	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	132241688	132241688	+	Silent	SNP	G	G	A			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr2:132241688G>A	ENST00000309451.6	-	3	468	c.423C>T	c.(421-423)acC>acT	p.T141T	MZT2A_ENST00000410036.2_5'UTR	NM_001085365.1	NP_001078834.1	Q6P582	MZT2A_HUMAN	mitotic spindle organizing protein 2A	141						centrosome (GO:0005813)|gamma-tubulin ring complex (GO:0008274)|spindle (GO:0005819)				breast(1)|lung(1)	2						TGGGCAGCCTGGTAGCGCTGG	0.652																																					p.T141T		.											.	MZT2A-68	0			c.C423T						.						51.0	63.0	59.0					2																	132241688		2196	4296	6492	SO:0001819	synonymous_variant	653784	exon3			CAGCCTGGTAGCG	BC018206	CCDS42758.1	2q21.1	2013-10-11	2010-07-22	2010-07-22	ENSG00000173272	ENSG00000173272			33187	protein-coding gene	gene with protein product	"""mitotic-spindle organizing protein associated with a ring of gamma-tubulin 2A"""	613449	"""family with sequence similarity 128, member A"""	FAM128A		20360068	Standard	NM_001085365		Approved	MOZART2A	uc002tsw.4	Q6P582	OTTHUMG00000153606	ENST00000309451.6:c.423C>T	2.37:g.132241688G>A		Somatic	161	0		WXS	Illumina GAIIx	Phase_I	333	25	NM_001085365	0	1	653	668	14	Q3SWV8|Q8WVB2	Silent	SNP	ENST00000309451.6	37	CCDS42758.1																																																																																			.		0.652	MZT2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331811.2		
NR4A2	4929	ucsc.edu;bcgsc.ca	37	2	157182673	157182673	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr2:157182673G>C	ENST00000339562.4	-	7	1891	c.1529C>G	c.(1528-1530)gCt>gGt	p.A510G	NR4A2_ENST00000409108.2_Silent_p.G475G|NR4A2_ENST00000426264.1_Missense_Mutation_p.A447G|NR4A2_ENST00000539077.1_Missense_Mutation_p.A521G|NR4A2_ENST00000429376.1_Silent_p.G412G|NR4A2_ENST00000409572.1_Missense_Mutation_p.A510G	NM_006186.3	NP_006177.1	P43354	NR4A2_HUMAN	nuclear receptor subfamily 4, group A, member 2	510					adult locomotory behavior (GO:0008344)|cellular response to extracellular stimulus (GO:0031668)|cellular response to oxidative stress (GO:0034599)|central nervous system projection neuron axonogenesis (GO:0021952)|death (GO:0016265)|dopamine biosynthetic process (GO:0042416)|dopaminergic neuron differentiation (GO:0071542)|gene expression (GO:0010467)|general adaptation syndrome (GO:0051866)|habenula development (GO:0021986)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of neuron apoptotic process (GO:0043524)|neuron maturation (GO:0042551)|neuron migration (GO:0001764)|positive regulation of catalytic activity (GO:0043085)|post-embryonic development (GO:0009791)|regulation of dopamine metabolic process (GO:0042053)|regulation of respiratory gaseous exchange (GO:0043576)|response to amphetamine (GO:0001975)|response to hypoxia (GO:0001666)|response to inorganic substance (GO:0010035)|response to insecticide (GO:0017085)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(3)|endometrium(4)|kidney(1)|large_intestine(7)|lung(15)|ovary(5)|prostate(1)|skin(3)|urinary_tract(1)	40						TGTGACCATAGCCAGGGCAGC	0.507																																					p.A510G		.											.	NR4A2-189	0			c.C1529G						.						61.0	52.0	55.0					2																	157182673		2203	4300	6503	SO:0001583	missense	4929	exon7			ACCATAGCCAGGG	X75918	CCDS2201.1	2q22-q23	2013-01-16			ENSG00000153234	ENSG00000153234		"""Nuclear hormone receptors"""	7981	protein-coding gene	gene with protein product		601828		NURR1		7706727	Standard	NM_006186		Approved	TINUR, NOT, RNR1, HZF-3	uc002tyz.4	P43354	OTTHUMG00000131950	ENST00000339562.4:c.1529C>G	2.37:g.157182673G>C	ENSP00000344479:p.Ala510Gly	Somatic	135	2		WXS	Illumina GAIIx	Phase_I	205	121	NM_006186	0	0	0	0	0	Q16311|Q53RZ2|Q6NXU0	Missense_Mutation	SNP	ENST00000339562.4	37	CCDS2201.1	.	.	.	.	.	.	.	.	.	.	G	13.90	2.373876	0.42105	.	.	ENSG00000153234	ENST00000339562;ENST00000426264;ENST00000409572;ENST00000539077	D;D;D;D	0.96745	-4.11;-4.11;-4.11;-4.11	5.63	5.63	0.86233	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.000000	0.85682	D	0.000000	D	0.93749	0.8002	N	0.24115	0.695	0.80722	D	1	B	0.30146	0.27	B	0.33799	0.17	D	0.91910	0.5539	10	0.87932	D	0	.	20.0396	0.97574	0.0:0.0:1.0:0.0	.	510	P43354	NR4A2_HUMAN	G	510;447;510;521	ENSP00000344479:A510G;ENSP00000389986:A447G;ENSP00000386747:A510G;ENSP00000444925:A521G	ENSP00000344479:A510G	A	-	2	0	NR4A2	156890919	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.420000	0.97426	2.814000	0.96858	0.563000	0.77884	GCT	.		0.507	NR4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254909.2		
SPC25	57405	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	169745769	169745769	+	Silent	SNP	G	G	T			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr2:169745769G>T	ENST00000282074.2	-	3	307	c.166C>A	c.(166-168)Cga>Aga	p.R56R	SPC25_ENST00000472216.2_5'UTR	NM_020675.3	NP_065726.1	Q9HBM1	SPC25_HUMAN	SPC25, NDC80 kinetochore complex component	56	Interaction with the N-terminus of SPBC24.|Interaction with the NDC80-NUF2 subcomplex.				chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)	condensed chromosome kinetochore (GO:0000777)|cytosol (GO:0005829)|Ndc80 complex (GO:0031262)|nucleus (GO:0005634)				central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(3)|urinary_tract(1)	9						TCAACCATTCGTTCTTCTTCC	0.299																																					p.R56R		.											.	SPC25-226	0			c.C166A						.						95.0	93.0	94.0					2																	169745769		2203	4300	6503	SO:0001819	synonymous_variant	57405	exon3			CCATTCGTTCTTC	AF225416	CCDS2229.1	2q31.1	2013-06-05	2013-06-05	2007-03-02	ENSG00000152253	ENSG00000152253			24031	protein-coding gene	gene with protein product		609395	"""spindle pole body component 25 homolog (S. cerevisiae)"", ""SPC25, NDC80 kinetochore complex component, homolog (S. cerevisiae)"""	SPBC25		12477932	Standard	NM_020675		Approved	MGC22228, AD024	uc002uel.3	Q9HBM1	OTTHUMG00000132181	ENST00000282074.2:c.166C>A	2.37:g.169745769G>T		Somatic	49	0		WXS	Illumina GAIIx	Phase_I	44	14	NM_020675	0	0	13	18	5	A8K4X8|D3DPC0	Silent	SNP	ENST00000282074.2	37	CCDS2229.1																																																																																			.		0.299	SPC25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255233.2	NM_020675	
DHRS9	10170	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	169939955	169939955	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr2:169939955G>A	ENST00000327239.4	+	6	1934	c.430G>A	c.(430-432)Gtg>Atg	p.V144M	DHRS9_ENST00000432060.2_Missense_Mutation_p.V204M|DHRS9_ENST00000412271.1_Missense_Mutation_p.V144M|DHRS9_ENST00000428522.1_Missense_Mutation_p.V144M|DHRS9_ENST00000421653.1_5'UTR|DHRS9_ENST00000602501.1_Missense_Mutation_p.V144M|DHRS9_ENST00000436483.2_Missense_Mutation_p.V144M|DHRS9_ENST00000357546.2_Missense_Mutation_p.V144M	NM_005771.4	NP_005762.2	Q9BPW9	DHRS9_HUMAN	dehydrogenase/reductase (SDR family) member 9	144					9-cis-retinoic acid biosynthetic process (GO:0042904)|androgen metabolic process (GO:0008209)|epithelial cell differentiation (GO:0030855)|progesterone metabolic process (GO:0042448)|retinol metabolic process (GO:0042572)	integral component of endoplasmic reticulum membrane (GO:0030176)	alcohol dehydrogenase (NAD) activity (GO:0004022)|racemase and epimerase activity (GO:0016854)|retinol dehydrogenase activity (GO:0004745)|testosterone dehydrogenase (NAD+) activity (GO:0047035)			breast(1)|endometrium(3)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	13						ACTCATCAGTGTGACACTAAA	0.488																																					p.V144M		.											.	DHRS9-90	0			c.G430A						.						150.0	138.0	142.0					2																	169939955		2203	4300	6503	SO:0001583	missense	10170	exon6			ATCAGTGTGACAC	AF067174	CCDS2231.1, CCDS74600.1	2q31.1	2011-09-14			ENSG00000073737	ENSG00000073737		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	16888	protein-coding gene	gene with protein product	"""NADP-dependent retinol dehydrogenase/reductase"", ""3-alpha hydroxysteroid dehydrogenase"", ""retinol dehydrogenase homolog"", ""short chain dehydrogenase/reductase family 9C, member 4"""	612131				11304534, 11294878, 19027726	Standard	NM_001142270		Approved	RDHL, 3alpha-HSD, RETSDR8, RDH15, SDR9C4	uc010zde.2	Q9BPW9	OTTHUMG00000132180	ENST00000327239.4:c.430G>A	2.37:g.169939955G>A	ENSP00000316670:p.Val144Met	Somatic	185	1		WXS	Illumina GAIIx	Phase_I	261	89	NM_005771	0	0	0	0	0	B7Z416|D3DPC1|Q5RKX1|Q9NRA9|Q9NRB0	Missense_Mutation	SNP	ENST00000327239.4	37	CCDS2231.1	.	.	.	.	.	.	.	.	.	.	G	31	5.075185	0.94000	.	.	ENSG00000073737	ENST00000327239;ENST00000357546;ENST00000432060;ENST00000428522;ENST00000436483;ENST00000412271	D;D;D;D;D;D	0.87650	-2.28;-2.28;-2.28;-2.28;-2.28;-2.28	5.93	5.93	0.95920	NAD(P)-binding domain (1);	0.056120	0.64402	D	0.000001	D	0.91583	0.7341	L	0.46947	1.48	0.80722	D	1	D;D	0.76494	0.995;0.999	D;D	0.70935	0.955;0.971	D	0.90593	0.4538	10	0.48119	T	0.1	.	19.949	0.97192	0.0:0.0:1.0:0.0	.	204;144	B7Z416;Q9BPW9	.;DHRS9_HUMAN	M	144;144;204;144;144;144	ENSP00000316670:V144M;ENSP00000350154:V144M;ENSP00000389241:V204M;ENSP00000388564:V144M;ENSP00000407167:V144M;ENSP00000407747:V144M	ENSP00000316670:V144M	V	+	1	0	DHRS9	169648201	1.000000	0.71417	0.972000	0.41901	0.989000	0.77384	4.560000	0.60802	2.826000	0.97356	0.655000	0.94253	GTG	.		0.488	DHRS9-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333612.3	NM_005771	
DNAH7	56171	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	196740469	196740469	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr2:196740469C>G	ENST00000312428.6	-	38	6316	c.6216G>C	c.(6214-6216)tgG>tgC	p.W2072C		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	2072	AAA 3. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						TTAGATCATACCAGTTCCAGT	0.413																																					p.W2072C		.											.	DNAH7-102	0			c.G6216C						.						92.0	86.0	88.0					2																	196740469		1883	4112	5995	SO:0001583	missense	56171	exon38			ATCATACCAGTTC	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.6216G>C	2.37:g.196740469C>G	ENSP00000311273:p.Trp2072Cys	Somatic	196	1		WXS	Illumina GAIIx	Phase_I	241	82	NM_018897	0	0	0	0	0	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	ENST00000312428.6	37	CCDS42794.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.029412	0.75504	.	.	ENSG00000118997	ENST00000312428	T	0.52983	0.64	4.88	4.88	0.63580	ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	T	0.77253	0.4103	M	0.93283	3.4	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.83807	0.0239	10	0.72032	D	0.01	.	17.8218	0.88652	0.0:1.0:0.0:0.0	.	2072	Q8WXX0	DYH7_HUMAN	C	2072	ENSP00000311273:W2072C	ENSP00000311273:W2072C	W	-	3	0	DNAH7	196448714	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	7.361000	0.79497	2.550000	0.86006	0.655000	0.94253	TGG	.		0.413	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3	NM_018897	
ERBB4	2066	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	212589871	212589871	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr2:212589871G>A	ENST00000342788.4	-	6	981	c.671C>T	c.(670-672)cCt>cTt	p.P224L	ERBB4_ENST00000402597.1_Missense_Mutation_p.P224L|ERBB4_ENST00000436443.1_Missense_Mutation_p.P224L|ERBB4_ENST00000484474.1_5'Flank	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	224	Cys-rich.				cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	ACTGACGTAAGGTCCGTAGCA	0.488										TSP Lung(8;0.080)																											p.P224L		.											.	ERBB4-1461	0			c.C671T						.						151.0	133.0	139.0					2																	212589871		2203	4300	6503	SO:0001583	missense	2066	exon6			ACGTAAGGTCCGT	L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.671C>T	2.37:g.212589871G>A	ENSP00000342235:p.Pro224Leu	Somatic	346	0		WXS	Illumina GAIIx	Phase_I	490	122	NM_001042599	0	0	0	0	0	B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Missense_Mutation	SNP	ENST00000342788.4	37	CCDS2394.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.2|24.2	4.504341|4.504341	0.85176|0.85176	.|.	.|.	ENSG00000178568|ENSG00000178568	ENST00000260943|ENST00000342788;ENST00000436443;ENST00000402597	.|T;T;T	.|0.30182	.|1.54;1.54;1.54	5.73|5.73	5.73|5.73	0.89815|0.89815	.|Growth factor, receptor (1);Furin-like cysteine-rich domain (1);	.|0.046546	.|0.85682	.|D	.|0.000000	T|T	0.51719|0.51719	0.1691|0.1691	M|M	0.82323|0.82323	2.585|2.585	0.80722|0.80722	D|D	1|1	.|P;D;P;P;P	.|0.54207	.|0.907;0.965;0.878;0.907;0.924	.|B;P;P;B;P	.|0.52793	.|0.434;0.709;0.662;0.434;0.592	T|T	0.57670|0.57670	-0.7771|-0.7771	5|10	.|0.72032	.|D	.|0.01	.|.	16.1766|16.1766	0.81857|0.81857	0.0:0.1332:0.8668:0.0|0.0:0.1332:0.8668:0.0	.|.	.|224;224;83;224;224	.|Q15303-4;Q15303-2;Q53QS8;Q15303-3;Q15303	.|.;.;.;.;ERBB4_HUMAN	F|L	224|224	.|ENSP00000342235:P224L;ENSP00000403204:P224L;ENSP00000385565:P224L	.|ENSP00000342235:P224L	L|P	-|-	1|2	0|0	ERBB4|ERBB4	212298116|212298116	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.626000|0.626000	0.37791|0.37791	7.925000|7.925000	0.87563|0.87563	2.710000|2.710000	0.92621|0.92621	0.650000|0.650000	0.86243|0.86243	CTT|CCT	.		0.488	ERBB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256597.1	NM_001042599	
MRPL44	65080	bcgsc.ca	37	2	224831581	224831581	+	Splice_Site	SNP	G	G	T			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr2:224831581G>T	ENST00000258383.3	+	4	898	c.829G>T	c.(829-831)Gat>Tat	p.D277Y	AC073641.2_ENST00000425192.1_RNA	NM_022915.3	NP_075066.1	Q9H9J2	RM44_HUMAN	mitochondrial ribosomal protein L44	277	DRBM. {ECO:0000255|PROSITE- ProRule:PRU00266}.				mitochondrial translational elongation (GO:0070125)|RNA processing (GO:0006396)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|ribonuclease III activity (GO:0004525)			breast(1)|central_nervous_system(1)|large_intestine(5)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	13		all_lung(227;0.00679)|Lung NSC(271;0.00855)|Renal(207;0.0112)|all_hematologic(139;0.189)		Epithelial(121;2.51e-10)|all cancers(144;7.89e-08)|Lung(261;0.00705)|LUSC - Lung squamous cell carcinoma(224;0.008)		TCTTTCTAGTGATAAAAAGTT	0.363																																					p.D277Y		.											.	MRPL44-90	0			c.G829T						.						98.0	111.0	106.0					2																	224831581		2203	4300	6503	SO:0001630	splice_region_variant	65080	exon4			TCTAGTGATAAAA	AK022763	CCDS2459.1	2p24.3-p24.1	2012-09-13			ENSG00000135900	ENSG00000135900		"""Mitochondrial ribosomal proteins / large subunits"""	16650	protein-coding gene	gene with protein product	"""39S ribosomal protein L44, mitochondrial"""	611849					Standard	NM_022915		Approved	FLJ12701, FLJ13990	uc002vnr.4	Q9H9J2	OTTHUMG00000133164	ENST00000258383.3:c.828-1G>T	2.37:g.224831581G>T		Somatic	84	0		WXS	Illumina GAIIx	Phase_I	82	5	NM_022915	0	0	0	0	0	Q53S16|Q6IA62|Q9H821	Missense_Mutation	SNP	ENST00000258383.3	37	CCDS2459.1	.	.	.	.	.	.	.	.	.	.	G	18.32	3.598722	0.66332	.	.	ENSG00000135900	ENST00000258383	T	0.55413	0.52	5.78	4.91	0.64330	Double-stranded RNA-binding (1);Double-stranded RNA-binding-like (1);	0.091078	0.64402	D	0.000001	T	0.71668	0.3367	M	0.81497	2.545	0.80722	D	1	D	0.76494	0.999	D	0.68621	0.959	T	0.76099	-0.3083	10	0.87932	D	0	-12.9176	12.6118	0.56556	0.0803:0.0:0.9197:0.0	.	277	Q9H9J2	RM44_HUMAN	Y	277	ENSP00000258383:D277Y	ENSP00000258383:D277Y	D	+	1	0	MRPL44	224539825	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	6.057000	0.71119	1.452000	0.47756	0.591000	0.81541	GAT	.		0.363	MRPL44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256866.2	NM_022915	Missense_Mutation
ITCH	83737	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	33080396	33080396	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr20:33080396C>G	ENST00000262650.6	+	24	2669	c.2533C>G	c.(2533-2535)Ctc>Gtc	p.L845V	ITCH_ENST00000535650.1_Missense_Mutation_p.L694V|ITCH_ENST00000374864.4_Missense_Mutation_p.L804V			Q96J02	ITCH_HUMAN	itchy E3 ubiquitin protein ligase	845	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				apoptotic process (GO:0006915)|defense response to virus (GO:0051607)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of defense response to virus (GO:0050687)|negative regulation of JNK cascade (GO:0046329)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|Notch signaling pathway (GO:0007219)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|protein K29-linked ubiquitination (GO:0035519)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked ubiquitination (GO:0070534)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of cell growth (GO:0001558)|regulation of protein deubiquitination (GO:0090085)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral entry into host cell (GO:0046718)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	CXCR chemokine receptor binding (GO:0045236)|ligase activity (GO:0016874)|ribonucleoprotein complex binding (GO:0043021)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(9)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(13)|skin(1)|upper_aerodigestive_tract(1)	36						ATTTGCTGATCTCATGGGTAT	0.358																																					p.L845V		.											.	ITCH-659	0			c.C2533G						.						118.0	115.0	116.0					20																	33080396		2203	4300	6503	SO:0001583	missense	83737	exon24			GCTGATCTCATGG	AF095745	CCDS13234.1, CCDS58768.1, CCDS58769.1	20q11.22	2014-09-17	2012-02-23		ENSG00000078747	ENSG00000078747			13890	protein-coding gene	gene with protein product		606409	"""itchy (mouse homolog) E3 ubiquitin protein ligase"", ""itchy E3 ubiquitin protein ligase homolog (mouse)"""			11318614	Standard	NM_001257137		Approved	AIP4	uc010geu.2	Q96J02	OTTHUMG00000032300	ENST00000262650.6:c.2533C>G	20.37:g.33080396C>G	ENSP00000262650:p.Leu845Val	Somatic	82	0		WXS	Illumina GAIIx	Phase_I	100	34	NM_001257137	0	0	0	0	0	A6NEW4|B4E234|E1P5P3|F5H217|O43584|Q5QP37|Q5TEL0|Q96F66|Q9BY75|Q9H451|Q9H4U5	Missense_Mutation	SNP	ENST00000262650.6	37	CCDS58768.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.199701	0.79015	.	.	ENSG00000078747	ENST00000374864;ENST00000535650;ENST00000262650	T;T;T	0.65916	-0.18;-0.18;-0.18	5.35	4.41	0.53225	HECT (4);	0.124779	0.53938	D	0.000057	D	0.82834	0.5123	M	0.92649	3.33	0.80722	D	1	D;P;D	0.76494	0.962;0.914;0.999	D;P;D	0.80764	0.963;0.796;0.994	D	0.87261	0.2279	10	0.87932	D	0	.	13.9161	0.63899	0.0:0.9264:0.0:0.0736	.	756;845;804	B4DN85;Q96J02;Q5QP37	.;ITCH_HUMAN;.	V	804;694;845	ENSP00000363998:L804V;ENSP00000445608:L694V;ENSP00000262650:L845V	ENSP00000262650:L845V	L	+	1	0	ITCH	32544057	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.227000	0.58612	1.490000	0.48466	0.650000	0.86243	CTC	.		0.358	ITCH-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000078783.2		
PTPRT	11122	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	40713387	40713387	+	Silent	SNP	G	G	A			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr20:40713387G>A	ENST00000373187.1	-	29	4070	c.4071C>T	c.(4069-4071)gtC>gtT	p.V1357V	PTPRT_ENST00000373198.4_Silent_p.V1376V|PTPRT_ENST00000373193.3_Silent_p.V1360V|PTPRT_ENST00000373201.1_Silent_p.V1347V|PTPRT_ENST00000373190.1_Silent_p.V1356V|PTPRT_ENST00000373184.1_Silent_p.V1367V|PTPRT_ENST00000356100.2_Silent_p.V1366V			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	1357	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)			NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				CCAGTCGTCGGACCACTTTGA	0.597																																					p.V1376V		.											.	PTPRT-664	0			c.C4128T						.						54.0	61.0	58.0					20																	40713387		2035	4171	6206	SO:0001819	synonymous_variant	11122	exon30			TCGTCGGACCACT	AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.4071C>T	20.37:g.40713387G>A		Somatic	219	0		WXS	Illumina GAIIx	Phase_I	348	95	NM_133170	0	0	0	0	0	A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Silent	SNP	ENST00000373187.1	37	CCDS42874.1																																																																																			.		0.597	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000080315.1		
DNTTIP1	116092	hgsc.bcm.edu	37	20	44420682	44420682	+	Silent	SNP	T	T	C	rs2664591	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr20:44420682T>C	ENST00000372622.3	+	1	107	c.39T>C	c.(37-39)ccT>ccC	p.P13P	WFDC3_ENST00000372630.2_5'Flank|WFDC3_ENST00000372632.2_5'Flank|WFDC3_ENST00000243938.4_5'Flank|WFDC3_ENST00000481847.1_5'Flank	NM_052951.2	NP_443183.1	Q9H147	TDIF1_HUMAN	deoxynucleotidyltransferase, terminal, interacting protein 1	13						nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)	9		Myeloproliferative disorder(115;0.0122)				CGCGGGGACCTAGCGGGGCCG	0.746													C|||	3358	0.670527	0.6952	0.7968	5008	,	,		12080	0.6458		0.7058	False		,,,				2504	0.5368				p.P13P		.											.	DNTTIP1-91	0			c.T39C						.	C		2483,791		949,585,103	4.0	6.0	5.0		39	1.1	0.9	20	dbSNP_100	5	5222,1736		1983,1256,240	no	coding-synonymous	DNTTIP1	NM_052951.2		2932,1841,343	CC,CT,TT		24.9497,24.16,24.697		13/330	44420682	7705,2527	1637	3479	5116	SO:0001819	synonymous_variant	116092	exon1			GGGACCTAGCGGG	AB035676	CCDS13369.1	20q13.12	2003-09-10	2003-09-10	2003-09-12	ENSG00000101457	ENSG00000101457			16160	protein-coding gene	gene with protein product	"""novel protein similar to synaptotagmin 1 (SYT1, P65) (isoform 1)"", ""TdT binding protein"""	611388	"""chromosome 20 open reading frame 167"""	C20orf167		11473582	Standard	NM_052951		Approved	dJ447F3.4, Tdif1	uc002xpk.3	Q9H147	OTTHUMG00000032610	ENST00000372622.3:c.39T>C	20.37:g.44420682T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_052951	0	0	0	8	8	B2RA18|Q96DE3|Q9BQP2|Q9H148	Silent	SNP	ENST00000372622.3	37	CCDS13369.1																																																																																			T|0.311;C|0.689		0.746	DNTTIP1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079502.1	NM_052951	
KRTAP11-1	337880	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	32253737	32253737	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr21:32253737C>A	ENST00000332378.4	-	1	137	c.107G>T	c.(106-108)tGc>tTc	p.C36F		NM_175858.2	NP_787054.1	Q8IUC1	KR111_HUMAN	keratin associated protein 11-1	36						keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(12)|pancreas(1)	18						GCCGCCCAGGCAGTCAGCATC	0.567																																					p.C36F		.											.	KRTAP11-1-91	0			c.G107T						.						79.0	75.0	77.0					21																	32253737		2203	4300	6503	SO:0001583	missense	337880	exon1			CCCAGGCAGTCAG	AJ457065	CCDS13608.1	21q22.1	2003-03-11			ENSG00000182591	ENSG00000182591		"""Keratin associated proteins"""	18922	protein-coding gene	gene with protein product		600064				12359730	Standard	NM_175858		Approved	KAP11.1	uc002yov.3	Q8IUC1	OTTHUMG00000057773	ENST00000332378.4:c.107G>T	21.37:g.32253737C>A	ENSP00000330720:p.Cys36Phe	Somatic	185	0		WXS	Illumina GAIIx	Phase_I	353	82	NM_175858	0	0	0	0	0	A1L4I8	Missense_Mutation	SNP	ENST00000332378.4	37	CCDS13608.1	.	.	.	.	.	.	.	.	.	.	C	11.40	1.628593	0.28978	.	.	ENSG00000182591	ENST00000332378	T	0.03152	4.03	5.4	4.51	0.55191	.	0.124777	0.52532	D	0.000076	T	0.09512	0.0234	L	0.48174	1.505	0.41873	D	0.990283	D	0.61080	0.989	D	0.63488	0.915	T	0.18304	-1.0341	10	0.36615	T	0.2	-12.1311	8.0879	0.30784	0.0:0.7557:0.1592:0.0851	.	36	Q8IUC1	KR111_HUMAN	F	36	ENSP00000330720:C36F	ENSP00000330720:C36F	C	-	2	0	KRTAP11-1	31175608	1.000000	0.71417	1.000000	0.80357	0.826000	0.46750	3.433000	0.52834	1.439000	0.47511	0.650000	0.86243	TGC	.		0.567	KRTAP11-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128225.1		
HUNK	30811	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	33371313	33371313	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr21:33371313C>G	ENST00000270112.2	+	11	2321	c.1961C>G	c.(1960-1962)cCc>cGc	p.P654R		NM_014586.1	NP_055401.1	P57058	HUNK_HUMAN	hormonally up-regulated Neu-associated kinase	654					multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|skin(2)|stomach(1)	30						CTGGGGAGCCCCAATTGTGTG	0.577																																					p.P654R		.											.	HUNK-334	0			c.C1961G						.						41.0	44.0	43.0					21																	33371313		2203	4300	6503	SO:0001583	missense	30811	exon11			GGAGCCCCAATTG	AJ271722	CCDS13610.1	21q22.1	2008-06-05	2008-06-05		ENSG00000142149	ENSG00000142149			13326	protein-coding gene	gene with protein product		606532	"""hormonally upregulated Neu-associated kinase"""			10662544, 10830953	Standard	NM_014586		Approved		uc002yph.3	P57058	OTTHUMG00000085019	ENST00000270112.2:c.1961C>G	21.37:g.33371313C>G	ENSP00000270112:p.Pro654Arg	Somatic	43	0		WXS	Illumina GAIIx	Phase_I	39	11	NM_014586	0	0	0	0	0		Missense_Mutation	SNP	ENST00000270112.2	37	CCDS13610.1	.	.	.	.	.	.	.	.	.	.	C	13.87	2.366595	0.41902	.	.	ENSG00000142149	ENST00000270112	T	0.81247	-1.47	4.42	3.54	0.40534	.	0.000000	0.64402	D	0.000001	D	0.82907	0.5139	L	0.29908	0.895	0.58432	D	0.99999	D	0.89917	1.0	D	0.85130	0.997	D	0.84252	0.0478	10	0.87932	D	0	-9.1327	12.379	0.55295	0.0:0.9185:0.0:0.0815	.	654	P57058	HUNK_HUMAN	R	654	ENSP00000270112:P654R	ENSP00000270112:P654R	P	+	2	0	HUNK	32293184	0.998000	0.40836	0.821000	0.32701	0.343000	0.28985	4.882000	0.63121	1.083000	0.41159	-0.229000	0.12294	CCC	.		0.577	HUNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000192782.1	NM_014586	
KCNJ6	3763	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	21	38997475	38997475	+	Nonsense_Mutation	SNP	C	C	A			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr21:38997475C>A	ENST00000609713.1	-	4	1847	c.1258G>T	c.(1258-1260)Gaa>Taa	p.E420*	KCNJ6_ENST00000288309.6_Nonsense_Mutation_p.E420*	NM_002240.3	NP_002231.1	P48051	KCNJ6_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 6	420					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	G-protein activated inward rectifier potassium channel activity (GO:0015467)|inward rectifier potassium channel activity (GO:0005242)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	22					Halothane(DB01159)	ACTTTGGATTCATTCTCCAGG	0.448																																					p.E420X	Pancreas(48;379 1118 2936 19024 28214)	.											.	KCNJ6-91	0			c.G1258T						.						205.0	194.0	198.0					21																	38997475		1891	4118	6009	SO:0001587	stop_gained	3763	exon4			TGGATTCATTCTC	U24660	CCDS42927.1	21q22.1	2011-07-05			ENSG00000157542	ENSG00000157542		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6267	protein-coding gene	gene with protein product		600877		KCNJ7		7796919, 16382105	Standard	NM_002240		Approved	Kir3.2, GIRK2, KATP2, BIR1, hiGIRK2	uc002ywo.3	P48051	OTTHUMG00000086667	ENST00000609713.1:c.1258G>T	21.37:g.38997475C>A	ENSP00000477437:p.Glu420*	Somatic	58	0		WXS	Illumina GAIIx	Phase_I	70	5	NM_002240	0	0	0	0	0	Q3MJ74|Q53WW6	Nonsense_Mutation	SNP	ENST00000609713.1	37	CCDS42927.1	.	.	.	.	.	.	.	.	.	.	C	40	8.204159	0.98704	.	.	ENSG00000157542	ENST00000400482;ENST00000288309	.	.	.	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.44643	D	0.997623	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	19.9915	0.97366	0.0:1.0:0.0:0.0	.	.	.	.	X	420	.	ENSP00000288309:E420X	E	-	1	0	KCNJ6	37919345	1.000000	0.71417	0.996000	0.52242	0.856000	0.48823	7.487000	0.81328	2.723000	0.93209	0.655000	0.94253	GAA	.		0.448	KCNJ6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194828.2	NM_002240	
KRTAP10-9	386676	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	46047395	46047395	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr21:46047395G>A	ENST00000397911.3	+	1	356	c.307G>A	c.(307-309)Gtc>Atc	p.V103I	TSPEAR_ENST00000323084.4_Intron|KRTAP10-9_ENST00000484861.1_Intron	NM_198690.2	NP_941963.2	P60411	KR109_HUMAN	keratin associated protein 10-9	103	25 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				endometrium(1)|kidney(1)|large_intestine(1)|lung(6)	9						ctgcgtgcccgtctgctgcaa	0.657																																					p.V103I		.											.	.	0			c.G307A						.						81.0	97.0	92.0					21																	46047395		2201	4299	6500	SO:0001583	missense	386676	exon1			GTGCCCGTCTGCT	AJ566386	CCDS42961.1	21q22.3	2007-10-05			ENSG00000221837	ENSG00000221837		"""Keratin associated proteins"""	22971	protein-coding gene	gene with protein product				KRTAP18-9			Standard	NM_198690		Approved	KAP10.9, KAP18.9	uc002zfp.4	P60411	OTTHUMG00000057637	ENST00000397911.3:c.307G>A	21.37:g.46047395G>A	ENSP00000381009:p.Val103Ile	Somatic	113	0		WXS	Illumina GAIIx	Phase_I	509	133	NM_198690	0	0	0	0	0	A2RRG1|A6NIR9|Q70LJ1	Missense_Mutation	SNP	ENST00000397911.3	37	CCDS42961.1	.	.	.	.	.	.	.	.	.	.	g	2.993	-0.207654	0.06180	.	.	ENSG00000221837	ENST00000397911	T	0.00711	5.8	3.49	-1.3	0.09259	.	.	.	.	.	T	0.00784	0.0026	L	0.56340	1.77	0.09310	N	1	B	0.24576	0.106	B	0.13407	0.009	T	0.46735	-0.9170	8	.	.	.	.	0.9184	0.01309	0.3311:0.2141:0.3142:0.1406	.	103	P60411	KR109_HUMAN	I	103	ENSP00000381009:V103I	.	V	+	1	0	KRTAP10-9	44871823	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-0.517000	0.06275	-0.761000	0.04670	-0.811000	0.03165	GTC	.		0.657	KRTAP10-9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128040.1		
KRTAP10-10	353333	ucsc.edu	37	21	46057634	46057634	+	Silent	SNP	T	T	C	rs61029972	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr21:46057634T>C	ENST00000380095.1	+	1	362	c.300T>C	c.(298-300)tgT>tgC	p.C100C	TSPEAR_ENST00000323084.4_Intron	NM_181688.1	NP_859016.1	P60014	KR10A_HUMAN	keratin associated protein 10-10	100	15 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				NS(1)|endometrium(2)|kidney(1)|lung(6)|prostate(1)|skin(2)	13						ctgtctgctgtgtgcccgtct	0.632													C|||	539	0.107628	0.2383	0.0591	5008	,	,		18755	0.0109		0.0557	False		,,,				2504	0.1186				p.C100C		.											.	KRTAP10-10-90	0			c.T300C						.						126.0	121.0	123.0					21																	46057634		2203	4298	6501	SO:0001819	synonymous_variant	353333	exon1			CTGCTGTGTGCCC	AJ566387	CCDS33585.1	21q22.3	2006-03-13			ENSG00000221859	ENSG00000221859		"""Keratin associated proteins"""	22972	protein-coding gene	gene with protein product							Standard	NM_181688		Approved	KAP10.10, KAP18.10, KRTAP18-10	uc002zfq.3	P60014	OTTHUMG00000057631	ENST00000380095.1:c.300T>C	21.37:g.46057634T>C		Somatic	137	1		WXS	Illumina GAIIx	Phase_I	346	113	NM_181688	0	0	0	0	0		Silent	SNP	ENST00000380095.1	37	CCDS33585.1																																																																																			T|0.860;C|0.140		0.632	KRTAP10-10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128034.1	NM_181688	
KRTAP10-10	353333	ucsc.edu	37	21	46057640	46057640	+	Silent	SNP	C	C	T	rs78817801		TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr21:46057640C>T	ENST00000380095.1	+	1	368	c.306C>T	c.(304-306)ccC>ccT	p.P102P	TSPEAR_ENST00000323084.4_Intron	NM_181688.1	NP_859016.1	P60014	KR10A_HUMAN	keratin associated protein 10-10	102	15 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				NS(1)|endometrium(2)|kidney(1)|lung(6)|prostate(1)|skin(2)	13						gctgtgtgcccgtctgctgcg	0.622																																					p.P102P		.											.	KRTAP10-10-90	0			c.C306T						.						144.0	131.0	135.0					21																	46057640		2203	4299	6502	SO:0001819	synonymous_variant	353333	exon1			TGTGCCCGTCTGC	AJ566387	CCDS33585.1	21q22.3	2006-03-13			ENSG00000221859	ENSG00000221859		"""Keratin associated proteins"""	22972	protein-coding gene	gene with protein product							Standard	NM_181688		Approved	KAP10.10, KAP18.10, KRTAP18-10	uc002zfq.3	P60014	OTTHUMG00000057631	ENST00000380095.1:c.306C>T	21.37:g.46057640C>T		Somatic	145	0		WXS	Illumina GAIIx	Phase_I	365	71	NM_181688	0	0	0	0	0		Silent	SNP	ENST00000380095.1	37	CCDS33585.1																																																																																			C|0.983;T|0.017		0.622	KRTAP10-10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128034.1	NM_181688	
SCARF2	91179	hgsc.bcm.edu	37	22	20780091	20780091	+	Silent	SNP	C	C	G	rs759610		TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr22:20780091C>G	ENST00000266214.5	-	11	2291	c.2187G>C	c.(2185-2187)ccG>ccC	p.P729P	SCARF2_ENST00000405555.3_Silent_p.P724P	NM_153334.4	NP_699165.2	Q96GP6	SREC2_HUMAN	scavenger receptor class F, member 2	729	Pro-rich.				cell adhesion (GO:0007155)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|skin(2)	10	Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			CGGGCAGCCCCGGGGGGCGCG	0.781																																					p.P729P		.											.	SCARF2-341	0			c.G2187C						.	G	,	3110,60		1525,60,0	4.0	5.0	4.0		2187,2172	-6.8	0.1	22	dbSNP_86	4	5974,118		2928,118,0	no	coding-synonymous,coding-synonymous	SCARF2	NM_153334.4,NM_182895.2	,	4453,178,0	GG,GC,CC		1.937,1.8927,1.9218	,	729/871,724/866	20780091	9084,178	1585	3046	4631	SO:0001819	synonymous_variant	91179	exon11			CAGCCCCGGGGGG	AF522196	CCDS13779.1, CCDS46666.1	22q11.21	2011-10-10			ENSG00000244486	ENSG00000244486			19869	protein-coding gene	gene with protein product		613619				12154095	Standard	XM_006724364		Approved	SREC-II, SREC2, HUMZD58C02	uc002zsk.2	Q96GP6	OTTHUMG00000150779	ENST00000266214.5:c.2187G>C	22.37:g.20780091C>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	9	NM_153334	0	0	0	0	0	E5RFB8|Q58A83|Q8IXF3|Q9BW74	Silent	SNP	ENST00000266214.5	37	CCDS13779.1																																																																																			C|0.138;G|0.862		0.781	SCARF2-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320047.1		
SCARF2	91179	hgsc.bcm.edu	37	22	20780097	20780097	+	Silent	SNP	G	G	C	rs759609		TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr22:20780097G>C	ENST00000266214.5	-	11	2285	c.2181C>G	c.(2179-2181)cgC>cgG	p.R727R	SCARF2_ENST00000405555.3_Silent_p.R722R	NM_153334.4	NP_699165.2	Q96GP6	SREC2_HUMAN	scavenger receptor class F, member 2	727	Pro-rich.				cell adhesion (GO:0007155)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|skin(2)	10	Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			GCCCCGGGGGGCGCGGCGTTG	0.781																																					p.R727R		.											.	SCARF2-341	0			c.C2181G						.	C	,	3271,119		1585,101,9	5.0	5.0	5.0		2181,2166	-5.3	0.0	22	dbSNP_86	5	6306,190		3060,186,2	no	coding-synonymous,coding-synonymous	SCARF2	NM_153334.4,NM_182895.2	,	4645,287,11	CC,CG,GG		2.9249,3.5103,3.1256	,	727/871,722/866	20780097	9577,309	1695	3248	4943	SO:0001819	synonymous_variant	91179	exon11			CGGGGGGCGCGGC	AF522196	CCDS13779.1, CCDS46666.1	22q11.21	2011-10-10			ENSG00000244486	ENSG00000244486			19869	protein-coding gene	gene with protein product		613619				12154095	Standard	XM_006724364		Approved	SREC-II, SREC2, HUMZD58C02	uc002zsk.2	Q96GP6	OTTHUMG00000150779	ENST00000266214.5:c.2181C>G	22.37:g.20780097G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	10	NM_153334	0	0	0	0	0	E5RFB8|Q58A83|Q8IXF3|Q9BW74	Silent	SNP	ENST00000266214.5	37	CCDS13779.1																																																																																			G|0.826;C|0.174		0.781	SCARF2-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320047.1		
LZTR1	8216	broad.mit.edu	37	22	21343966	21344002	+	Splice_Site	DEL	GAGGAGGTGAGGGGCGTGGGGAGCCAGGGCGCAGGTA	GAGGAGGTGAGGGGCGTGGGGAGCCAGGGCGCAGGTA	-	rs138025454|rs4822786|rs372705680|rs544346603|rs7410444|rs398036571|rs541944601|rs550797478|rs59718704	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr22:21343966_21344002delGAGGAGGTGAGGGGCGTGGGGAGCCAGGGCGCAGGTA	ENST00000215739.8	+	7	1005_1010	c.646_651delGAGGAGGTGAGGGGCGTGGGGAGCCAGGGCGCAGGTA	c.(646-651)gaggagdel	p.EE216fs	LZTR1_ENST00000479606.1_3'UTR|LZTR1_ENST00000389355.3_Splice_Site_p.EE197fs	NM_006767.3	NP_006758.2	Q8N653	LZTR1_HUMAN	leucine-zipper-like transcription regulator 1	216					anatomical structure morphogenesis (GO:0009653)|regulation of transcription, DNA-templated (GO:0006355)		sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(13)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)	42	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			CACCTGCTgggaggaggtgaggggcgtggggagccagggcgcaggtagaggaggtga	0.662														897	0.179113	0.1354	0.1859	5008	,	,		20879	0.2907		0.166	False		,,,				2504	0.1319				p.216_217del		.											.	LZTR1-280	0			c.646_651del						.																																			SO:0001630	splice_region_variant	8216	exon7			TGCTGGGAGGAGG	D38496	CCDS33606.1	22q11.21	2013-01-09	2004-12-10		ENSG00000099949	ENSG00000099949		"""BTB/POZ domain containing"""	6742	protein-coding gene	gene with protein product		600574	"""leucine-zipper-like transcriptional regulator 1"""			7633402, 16356934	Standard	NM_006767		Approved	LZTR-1, BTBD29	uc002zto.3	Q8N653	OTTHUMG00000150878	ENST00000215739.8:c.651+1GAGGAGGTGAGGGGCGTGGGGAGCCAGGGCGCAGGTA>-	22.37:g.21343966_21344002delGAGGAGGTGAGGGGCGTGGGGAGCCAGGGCGCAGGTA		Somatic	41	0		WXS	Illumina GAIIx	Phase_I	55	7	NM_006767	0	0	0	0	0	Q14776|Q20WK0	In_Frame_Del	DEL	ENST00000215739.8	37	CCDS33606.1																																																																																			.		0.662	LZTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320387.1	NM_006767	Frame_Shift_Del
BCR	613	hgsc.bcm.edu	37	22	23655084	23655084	+	Silent	SNP	C	C	T	rs11558697	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr22:23655084C>T	ENST00000305877.8	+	20	4084	c.3333C>T	c.(3331-3333)gaC>gaT	p.D1111D	BCR_ENST00000359540.3_Silent_p.D1067D|BCR_ENST00000436990.2_3'UTR	NM_004327.3	NP_004318.3	P11274	BCR_HUMAN	breakpoint cluster region	1111	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				actin cytoskeleton organization (GO:0030036)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of phagocytosis (GO:0050766)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)		BCR/JAK2(6)	central_nervous_system(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	35					Bosutinib(DB06616)|Ponatinib(DB08901)	ATAACAAGGACGTGTCGGTGA	0.582			T	"""ABL1,  FGFR1, JAK2 """	"""CML, ALL, AML"""								.|||	595	0.11881	0.118	0.1643	5008	,	,		25223	0.002		0.2555	False		,,,				2504	0.0675				p.D1111D		.		Dom	yes		22	22q11.21	613	breakpoint cluster region		L	.	BCR-1349	0			c.C3333T						.	C	,	549,3625		32,485,1570	45.0	44.0	45.0		3333,3201	-5.1	1.0	22	dbSNP_120	45	1791,6111		221,1349,2381	no	coding-synonymous,coding-synonymous	BCR	NM_004327.3,NM_021574.2	,	253,1834,3951	TT,TC,CC		22.6651,13.1529,19.3773	,	1111/1272,1067/1228	23655084	2340,9736	2087	3951	6038	SO:0001819	synonymous_variant	613	exon20			CAAGGACGTGTCG		CCDS13806.1, CCDS13807.1	22q11	2013-01-10			ENSG00000186716	ENSG00000186716		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	1014	protein-coding gene	gene with protein product		151410		D22S11, BCR1		1657398, 18070886	Standard	NM_004327		Approved	D22S662, CML, PHL, ALL	uc002zww.3	P11274	OTTHUMG00000150655	ENST00000305877.8:c.3333C>T	22.37:g.23655084C>T		Somatic	2	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_004327	0	0	0	0	0	P78501|Q12842|Q4LE80|Q6NZI3	Silent	SNP	ENST00000305877.8	37	CCDS13806.1																																																																																			.		0.582	BCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075819.1	NM_004327	
MN1	4330	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	28192787	28192787	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr22:28192787C>T	ENST00000302326.4	-	1	4699	c.3745G>A	c.(3745-3747)Gag>Aag	p.E1249K		NM_002430.2	NP_002421.3	Q10571	MN1_HUMAN	meningioma (disrupted in balanced translocation) 1	1249					intramembranous ossification (GO:0001957)					NS(1)|breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	45						TTGGCCTTCTCCCAGGGCGCC	0.622			T	ETV6	"""AML, meningioma"""																																p.E1249K		.		Dom	yes		22	22q13	4330	meningioma (disrupted in balanced translocation) 1		"""L, O"""	.	MN1-993	0			c.G3745A						.						97.0	103.0	101.0					22																	28192787		2117	4216	6333	SO:0001583	missense	4330	exon1			CCTTCTCCCAGGG	X82209	CCDS42998.1	22q12.1	2010-09-29			ENSG00000169184	ENSG00000169184			7180	protein-coding gene	gene with protein product	"""probable tumor suppressor protein MN1"""	156100	"""meningioma chromosome region"""	MGCR		7731706, 12569362	Standard	NM_002430		Approved	MGCR1-PEN, MGCR1	uc003adj.3	Q10571	OTTHUMG00000150975	ENST00000302326.4:c.3745G>A	22.37:g.28192787C>T	ENSP00000304956:p.Glu1249Lys	Somatic	85	0		WXS	Illumina GAIIx	Phase_I	176	71	NM_002430	0	0	2	2	0	A9Z1V9	Missense_Mutation	SNP	ENST00000302326.4	37	CCDS42998.1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.778523	0.90195	.	.	ENSG00000169184	ENST00000302326	T	0.59906	0.23	4.91	4.91	0.64330	.	0.000000	0.85682	D	0.000000	T	0.64034	0.2562	L	0.29908	0.895	0.58432	D	0.999993	D	0.69078	0.997	P	0.61800	0.894	T	0.68693	-0.5341	10	0.72032	D	0.01	-23.0169	17.1755	0.86840	0.0:1.0:0.0:0.0	.	1249	Q10571	MN1_HUMAN	K	1249	ENSP00000304956:E1249K	ENSP00000304956:E1249K	E	-	1	0	MN1	26522787	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	7.249000	0.78278	2.284000	0.76573	0.306000	0.20318	GAG	.		0.622	MN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320737.1	NM_002430	
OSBP2	23762	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	31137254	31137254	+	Missense_Mutation	SNP	A	A	T			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr22:31137254A>T	ENST00000332585.6	+	2	855	c.751A>T	c.(751-753)Agc>Tgc	p.S251C	OSBP2_ENST00000382310.3_Missense_Mutation_p.S251C|OSBP2_ENST00000403222.3_Missense_Mutation_p.S86C|OSBP2_ENST00000407373.1_Missense_Mutation_p.S78C|OSBP2_ENST00000446658.2_Missense_Mutation_p.S251C	NM_001282739.1|NM_001282740.1|NM_001282741.1|NM_001282742.1|NM_030758.3	NP_001269668.1|NP_001269669.1|NP_001269670.1|NP_001269671.1|NP_110385.1	Q969R2	OSBP2_HUMAN	oxysterol binding protein 2	251	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				lipid transport (GO:0006869)	membrane (GO:0016020)	cholesterol binding (GO:0015485)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(2)|lung(6)|ovary(1)|skin(3)|urinary_tract(1)	19						TGGGGCCAGGAGCTACCACCT	0.612																																					p.S251C		.											.	OSBP2-114	0			c.A751T						.						41.0	44.0	43.0					22																	31137254		2043	4179	6222	SO:0001583	missense	23762	exon2			GCCAGGAGCTACC		CCDS43002.1, CCDS63448.1, CCDS63449.1, CCDS63450.1, CCDS63451.1	22q12.2	2013-01-10			ENSG00000184792	ENSG00000184792		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	8504	protein-coding gene	gene with protein product		606729		OSBPL1		10591208, 11278871, 11802775	Standard	NM_001282738		Approved	KIAA1664, ORP-4, ORP4	uc003aiy.1	Q969R2	OTTHUMG00000151153	ENST00000332585.6:c.751A>T	22.37:g.31137254A>T	ENSP00000332576:p.Ser251Cys	Somatic	89	0		WXS	Illumina GAIIx	Phase_I	116	53	NM_030758	0	0	5	6	1	B0QYG1|B4DK24|B4DKE4|B4DTR3|F5H2A3|O60396|Q0VF99|Q8NA37|Q9BY96|Q9BZF0	Missense_Mutation	SNP	ENST00000332585.6	37	CCDS43002.1	.	.	.	.	.	.	.	.	.	.	A	24.1	4.494239	0.85069	.	.	ENSG00000184792	ENST00000438716;ENST00000403222;ENST00000407373;ENST00000332585;ENST00000382310;ENST00000446658	T;T;T;T;T	0.79141	0.89;0.89;-1.24;-1.24;-1.24	5.17	5.17	0.71159	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.165380	0.52532	D	0.000061	D	0.85669	0.5750	M	0.73372	2.23	0.80722	D	1	D;B;B;B;B	0.58970	0.984;0.015;0.015;0.033;0.033	P;B;B;B;B	0.61874	0.895;0.018;0.011;0.11;0.11	D	0.87031	0.2135	10	0.59425	D	0.04	-36.1819	14.6853	0.69044	1.0:0.0:0.0:0.0	.	251;86;78;251;251	B4DFA8;B4DKE4;Q6ZN50;Q0VF99;Q969R2	.;.;.;.;OSBP2_HUMAN	C	86;86;78;251;251;251	ENSP00000384213:S86C;ENSP00000385237:S78C;ENSP00000332576:S251C;ENSP00000371747:S251C;ENSP00000392080:S251C	ENSP00000332576:S251C	S	+	1	0	OSBP2	29467254	1.000000	0.71417	0.997000	0.53966	0.928000	0.56348	9.339000	0.96797	1.952000	0.56665	0.379000	0.24179	AGC	.		0.612	OSBP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321547.2	NM_030758	
UPK3A	7380	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	45681905	45681905	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr22:45681905C>A	ENST00000216211.4	+	2	168	c.136C>A	c.(136-138)Ctc>Atc	p.L46I	UPK3A_ENST00000396082.2_Missense_Mutation_p.L46I	NM_006953.3	NP_008884.1	O75631	UPK3A_HUMAN	uroplakin 3A	46					cell morphogenesis (GO:0000902)|epithelial cell differentiation (GO:0030855)|kidney development (GO:0001822)|potassium ion homeostasis (GO:0055075)|sodium ion homeostasis (GO:0055078)|urea transport (GO:0015840)|urinary bladder development (GO:0060157)|water transport (GO:0006833)	apical plasma membrane (GO:0016324)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				kidney(1)|large_intestine(1)|lung(2)|skin(1)	5		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)		GGAAAAGCCTCTCTGCATGTT	0.572																																					p.L46I		.											.	UPK3A-90	0			c.C136A						.						149.0	109.0	123.0					22																	45681905		2203	4300	6503	SO:0001583	missense	7380	exon2			AAGCCTCTCTGCA	AB010637	CCDS14064.1, CCDS54539.1	22q13.31	2005-11-14	2003-07-29	2003-07-30	ENSG00000100373	ENSG00000100373			12580	protein-coding gene	gene with protein product		611559	"""uroplakin 3"""	UPK3		9818021	Standard	NM_006953		Approved		uc003bfy.3	O75631	OTTHUMG00000151339	ENST00000216211.4:c.136C>A	22.37:g.45681905C>A	ENSP00000216211:p.Leu46Ile	Somatic	188	0		WXS	Illumina GAIIx	Phase_I	208	103	NM_006953	0	0	0	0	0	B0QY25|O60261|Q32N05|Q5TII6	Missense_Mutation	SNP	ENST00000216211.4	37	CCDS14064.1	.	.	.	.	.	.	.	.	.	.	C	18.02	3.530013	0.64860	.	.	ENSG00000100373	ENST00000216211;ENST00000396082	T;D	0.83755	-0.1;-1.76	5.27	4.18	0.49190	.	0.229521	0.37136	N	0.002237	T	0.67702	0.2921	L	0.34521	1.04	0.20926	N	0.999825	P;P	0.38597	0.551;0.639	B;B	0.35727	0.209;0.066	T	0.56613	-0.7950	10	0.22109	T	0.4	-15.2331	3.6404	0.08165	0.2474:0.6084:0.0:0.1442	.	46;46	O75631-2;O75631	.;UPK3A_HUMAN	I	46	ENSP00000216211:L46I;ENSP00000379391:L46I	ENSP00000216211:L46I	L	+	1	0	UPK3A	44060569	0.850000	0.29656	0.918000	0.36340	0.962000	0.63368	1.238000	0.32707	2.435000	0.82474	0.655000	0.94253	CTC	.		0.572	UPK3A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000322276.1	NM_006953	
NGLY1	55768	bcgsc.ca	37	3	25777593	25777593	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr3:25777593G>T	ENST00000280700.5	-	7	1211	c.1051C>A	c.(1051-1053)Cac>Aac	p.H351N	NGLY1_ENST00000422724.2_3'UTR|NGLY1_ENST00000467224.1_5'Flank|NGLY1_ENST00000428257.1_Intron|NGLY1_ENST00000417874.2_Missense_Mutation_p.H309N|NGLY1_ENST00000396649.3_Missense_Mutation_p.H351N	NM_018297.3	NP_060767.2	Q96IV0	NGLY1_HUMAN	N-glycanase 1	351					glycoprotein catabolic process (GO:0006516)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|peptide-N4-(N-acetyl-beta-glucosaminyl)asparagine amidase activity (GO:0000224)			breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|prostate(2)|skin(1)	18						GCATCACAGTGCAGCCACCGC	0.418																																					p.H351N		.											.	NGLY1-135	0			c.C1051A						.						53.0	50.0	51.0					3																	25777593		2203	4300	6503	SO:0001583	missense	55768	exon7			CACAGTGCAGCCA	AF250924	CCDS33719.1, CCDS46777.1, CCDS46778.1, CCDS46779.1	3p23	2006-08-30			ENSG00000151092	ENSG00000151092			17646	protein-coding gene	gene with protein product		610661					Standard	NM_018297		Approved	FLJ11005, PNG1	uc003cdl.3	Q96IV0	OTTHUMG00000155600	ENST00000280700.5:c.1051C>A	3.37:g.25777593G>T	ENSP00000280700:p.His351Asn	Somatic	152	0		WXS	Illumina GAIIx	Phase_I	128	5	NM_018297	0	0	19	19	0	B4DJE9|Q59FB1|Q6PJD8|Q9BVR8|Q9NR70	Missense_Mutation	SNP	ENST00000280700.5	37	CCDS33719.1	.	.	.	.	.	.	.	.	.	.	G	29.7	5.025321	0.93518	.	.	ENSG00000151092	ENST00000280700;ENST00000396649;ENST00000417874	T;T;T	0.21191	2.02;2.02;2.02	5.66	5.66	0.87406	Transglutaminase-like (2);	0.041485	0.85682	D	0.000000	T	0.55401	0.1918	M	0.86343	2.81	0.80722	D	1	D;D;D	0.63046	0.975;0.992;0.983	D;D;D	0.77557	0.96;0.99;0.967	T	0.60500	-0.7251	10	0.87932	D	0	-11.824	20.1253	0.97977	0.0:0.0:1.0:0.0	.	309;351;351	B4DJE9;Q96IV0-3;Q96IV0	.;.;NGLY1_HUMAN	N	351;351;309	ENSP00000280700:H351N;ENSP00000379886:H351N;ENSP00000389888:H309N	ENSP00000280700:H351N	H	-	1	0	NGLY1	25752597	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.799000	0.99117	2.832000	0.97577	0.655000	0.94253	CAC	.		0.418	NGLY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340832.2		
VILL	50853	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	38043315	38043315	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr3:38043315C>A	ENST00000283713.6	+	13	1709	c.1443C>A	c.(1441-1443)ttC>ttA	p.F481L	VILL_ENST00000383759.2_Missense_Mutation_p.F481L|VILL_ENST00000465644.1_Missense_Mutation_p.F199L			O15195	VILL_HUMAN	villin-like	481					actin filament capping (GO:0051693)|cytoskeleton organization (GO:0007010)	actin cytoskeleton (GO:0015629)	structural constituent of cytoskeleton (GO:0005200)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(3)|stomach(3)|urinary_tract(2)	28				KIRC - Kidney renal clear cell carcinoma(284;0.0525)|Kidney(284;0.0661)		CCCCCCACTTCCTCGCCATCT	0.602																																					p.F481L		.											.	VILL-90	0			c.C1443A						.						130.0	110.0	117.0					3																	38043315		2203	4300	6503	SO:0001583	missense	50853	exon12			CCACTTCCTCGCC		CCDS2670.2	3p21	2004-07-28			ENSG00000136059	ENSG00000136059			30906	protein-coding gene	gene with protein product						9179494	Standard	XM_005265191		Approved		uc003chl.3	O15195	OTTHUMG00000130814	ENST00000283713.6:c.1443C>A	3.37:g.38043315C>A	ENSP00000283713:p.Phe481Leu	Somatic	232	1		WXS	Illumina GAIIx	Phase_I	286	112	NM_015873	0	0	0	0	0	A8MZP1|Q9BT80|Q9BWH7	Missense_Mutation	SNP	ENST00000283713.6	37	CCDS2670.2	.	.	.	.	.	.	.	.	.	.	C	15.79	2.937320	0.52972	.	.	ENSG00000136059	ENST00000283713;ENST00000383759;ENST00000356246;ENST00000465644	T;T;T	0.57595	0.39;0.39;0.39	5.05	5.05	0.67936	Gelsolin domain (1);	0.092930	0.85682	N	0.000000	T	0.66538	0.2799	L	0.54965	1.715	0.58432	D	0.999999	B;B	0.32409	0.319;0.37	P;P	0.53062	0.517;0.717	T	0.59273	-0.7485	10	0.20519	T	0.43	-21.8907	18.3625	0.90379	0.0:1.0:0.0:0.0	.	467;481	O15195-2;O15195	.;VILL_HUMAN	L	481;481;467;199	ENSP00000283713:F481L;ENSP00000373266:F481L;ENSP00000422096:F199L	ENSP00000283713:F481L	F	+	3	2	VILL	38018319	1.000000	0.71417	0.999000	0.59377	0.650000	0.38633	4.005000	0.57075	2.520000	0.84964	0.455000	0.32223	TTC	.		0.602	VILL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253360.3	NM_015873	
CTNNB1	1499	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	41266132	41266155	+	In_Frame_Del	DEL	TCCTTCTCTGAGTGGTAAAGGCAA	TCCTTCTCTGAGTGGTAAAGGCAA	-	rs121913407|rs528528236|rs121913409		TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	TCCTTCTCTGAGTGGTAAAGGCAA	TCCTTCTCTGAGTGGTAAAGGCAA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr3:41266132_41266155delTCCTTCTCTGAGTGGTAAAGGCAA	ENST00000349496.5	+	3	409_432	c.129_152delTCCTTCTCTGAGTGGTAAAGGCAA	c.(127-153)gctccttctctgagtggtaaaggcaat>gct	p.PSLSGKGN44del	CTNNB1_ENST00000396183.3_In_Frame_Del_p.PSLSGKGN44del|CTNNB1_ENST00000453024.1_In_Frame_Del_p.PSLSGKGN37del|CTNNB1_ENST00000405570.1_In_Frame_Del_p.PSLSGKGN44del|CTNNB1_ENST00000396185.3_In_Frame_Del_p.PSLSGKGN44del	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	44					adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.S45F(384)|p.S45P(168)|p.S45del(54)|p.A5_A80del(53)|p.S45C(19)|p.S45Y(17)|p.S45A(11)|p.K49R(9)|p.G48D(9)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.P44A(5)|p.?(4)|p.P44S(4)|p.L46L(3)|p.S47N(3)|p.W25_I140del(3)|p.G50D(3)|p.K49*(2)|p.T3_A126del(2)|p.S45_S47>C(2)|p.G48V(2)|p.D32_S47del(2)|p.P44_S45del(2)|p.M5_N141>D(2)|p.S47T(2)|p.P44L(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.A5_Q143>E(1)|p.S37_G48>C(1)|p.A13_R151del(1)|p.H36_E53>L(1)|p.L46V(1)|p.M14_S45del(1)|p.S47G(1)|p.T40_L46del(1)|p.Q28_Q61del(1)|p.T41_N51del(1)|p.M1_A87del(1)|p.S45_L46del(1)|p.A20_N141del(1)|p.D11_Y142>H(1)|p.L46_S47del(1)|p.P44_S45insAP(1)|p.P44_N51del(1)|p.A43del(1)|p.K49E(1)|p.K49K(1)|p.I35_K170del(1)|p.Y30_A97del(1)|p.T42_G48del(1)|p.S45_D58del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.G50S(1)|p.S45fs*2(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.K49L(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.S47C(1)|p.H24_M131del(1)|p.S45E(1)|p.S47R(1)|p.M8_A80del(1)|p.A5_E54del(1)|p.S45T(1)|p.A21_A80del(1)|p.S45S(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.S45_G48del(1)|p.P44del(1)|p.N51S(1)|p.A20_S111del(1)|p.T42_K49>Q(1)|p.Y30_A80del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		CTACCACAGCTCCTTCTCTGAGTGGTAAAGGCAATCCTGAGGAA	0.491	S45F(HCC15_LUNG)|S45F(LS180_LARGE_INTESTINE)	15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.43_51del	Colon(6;3 56 14213 18255)	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	.	CTNNB1-24361	841	Substitution - Missense(648)|Deletion - In frame(157)|Complex - deletion inframe(20)|Unknown(7)|Substitution - coding silent(5)|Substitution - Nonsense(2)|Insertion - In frame(1)|Deletion - Frameshift(1)	soft_tissue(278)|liver(208)|large_intestine(103)|kidney(98)|adrenal_gland(34)|endometrium(24)|thyroid(20)|skin(16)|haematopoietic_and_lymphoid_tissue(13)|stomach(12)|ovary(6)|biliary_tract(5)|pituitary(4)|lung(3)|cervix(3)|central_nervous_system(3)|prostate(3)|pancreas(2)|small_intestine(2)|bone(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	c.129_152del						.																																			SO:0001651	inframe_deletion	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	CACAGCTCCTTCT	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.129_152delTCCTTCTCTGAGTGGTAAAGGCAA	3.37:g.41266132_41266155delTCCTTCTCTGAGTGGTAAAGGCAA	ENSP00000344456:p.Pro44_Asn51del	Somatic	173	0		WXS	Illumina GAIIx	Phase_I	113	15	NM_001098209	0	0	0	0	0	A8K1L7|Q8NEW9|Q8NI94|Q9H391	In_Frame_Del	DEL	ENST00000349496.5	37	CCDS2694.1																																																																																			.		0.491	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
FYCO1	79443	bcgsc.ca	37	3	46007825	46007825	+	Missense_Mutation	SNP	T	T	C	rs71622515|rs13059238	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr3:46007825T>C	ENST00000296137.2	-	8	3206	c.3001A>G	c.(3001-3003)Aac>Gac	p.N1001D	FYCO1_ENST00000535325.1_Missense_Mutation_p.N1001D	NM_024513.3	NP_078789.2	Q9BQS8	FYCO1_HUMAN	FYVE and coiled-coil domain containing 1	1001			N -> D (in dbSNP:rs13059238).		plus-end-directed vesicle transport along microtubule (GO:0072383)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)	metal ion binding (GO:0046872)			NS(4)|breast(3)|central_nervous_system(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(17)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	54				BRCA - Breast invasive adenocarcinoma(193;0.00147)|KIRC - Kidney renal clear cell carcinoma(197;0.0272)|Kidney(197;0.0323)		TTGAGGGTGTTGAGCTCCTGG	0.617													C|||	548	0.109425	0.0189	0.0634	5008	,	,		19562	0.004		0.1233	False		,,,				2504	0.3589				p.N1001D		.											.	FYCO1-91	0			c.A3001G						.	C	ASP/ASN	40,4366	819.4+/-416.4	1,38,2164	95.0	82.0	86.0		3001	2.3	0.2	3	dbSNP_121	86	35,8565	809.3+/-407.2	5,25,4270	no	missense	FYCO1	NM_024513.2	23	6,63,6434	CC,CT,TT		0.407,0.9079,0.5767	benign	1001/1479	46007825	75,12931	2203	4300	6503	SO:0001583	missense	79443	exon8			GGGTGTTGAGCTC	AJ292348	CCDS2734.1	3p21.3	2008-02-05			ENSG00000163820	ENSG00000163820		"""Zinc fingers, FYVE domain containing"""	14673	protein-coding gene	gene with protein product		607182				11896456	Standard	NM_024513		Approved	FLJ13335, ZFYVE7	uc003cpb.5	Q9BQS8	OTTHUMG00000133447	ENST00000296137.2:c.3001A>G	3.37:g.46007825T>C	ENSP00000296137:p.Asn1001Asp	Somatic	91	1		WXS	Illumina GAIIx	Phase_I	149	7	NM_024513	0	0	0	0	0	B7ZKT7|Q3MJE6|Q86T41|Q86TB1|Q8TEF9|Q96IV5|Q9H8P9	Missense_Mutation	SNP	ENST00000296137.2	37	CCDS2734.1	136	0.06227106227106227	10	0.02032520325203252	21	0.058011049723756904	0	0.0	105	0.13852242744063326	C	0.383	-0.927848	0.02377	0.009079	0.00407	ENSG00000163820	ENST00000296137;ENST00000535325	T;T	0.79554	-1.28;-1.28	5.49	2.29	0.28610	.	0.437095	0.25572	N	0.029755	T	0.00468	0.0015	N	0.02916	-0.46	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.04781	-1.0927	9	0.06625	T	0.88	-17.5834	4.0771	0.09909	0.2588:0.4452:0.0:0.296	rs13059238;rs13059238	1001;1001	B7ZKT7;Q9BQS8	.;FYCO1_HUMAN	D	1001	ENSP00000296137:N1001D;ENSP00000441178:N1001D	ENSP00000296137:N1001D	N	-	1	0	FYCO1	45982829	0.017000	0.18338	0.216000	0.23742	0.995000	0.86356	0.889000	0.28282	0.260000	0.21731	-0.119000	0.15052	AAC	GTT|0.500;TTC|0.500		0.617	FYCO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257320.2	NM_024513	
SETD2	29072	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	3	47139519	47139519	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr3:47139519C>G	ENST00000409792.3	-	9	5110	c.5068G>C	c.(5068-5070)Gga>Cga	p.G1690R		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1690	Post-SET. {ECO:0000255|PROSITE- ProRule:PRU00155}.				angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		TTTTCTCCTCCCAGGTAACCC	0.433			"""N, F, S, Mis"""		clear cell renal carcinoma																																p.G1690R		.		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	.	SETD2-1273	0			c.G5068C						.						101.0	88.0	92.0					3																	47139519		2203	4300	6503	SO:0001583	missense	29072	exon9			CTCCTCCCAGGTA	AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.5068G>C	3.37:g.47139519C>G	ENSP00000386759:p.Gly1690Arg	Somatic	54	0		WXS	Illumina GAIIx	Phase_I	36	4	NM_014159	0	0	10	11	1	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Missense_Mutation	SNP	ENST00000409792.3	37	CCDS2749.2	.	.	.	.	.	.	.	.	.	.	C	33	5.283068	0.95489	.	.	ENSG00000181555	ENST00000451092;ENST00000543224;ENST00000409792	D	0.91351	-2.83	5.29	5.29	0.74685	Post-SET domain (2);	0.000000	0.53938	D	0.000059	D	0.95446	0.8521	M	0.78344	2.41	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.95571	0.8638	10	0.87932	D	0	.	19.1238	0.93374	0.0:1.0:0.0:0.0	.	1690;1690	F2Z317;Q9BYW2	.;SETD2_HUMAN	R	1690	ENSP00000386759:G1690R	ENSP00000386759:G1690R	G	-	1	0	SETD2	47114523	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.629000	0.83207	2.752000	0.94435	0.557000	0.71058	GGA	.		0.433	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159	
PDZRN3	23024	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	73437153	73437153	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr3:73437153T>C	ENST00000263666.4	-	8	1598	c.1484A>G	c.(1483-1485)aAc>aGc	p.N495S	PDZRN3_ENST00000535920.1_Missense_Mutation_p.N217S|PDZRN3_ENST00000466348.1_5'UTR|PDZRN3_ENST00000462146.2_Missense_Mutation_p.N152S|PDZRN3_ENST00000466780.1_Missense_Mutation_p.N152S|PDZRN3_ENST00000479530.1_Missense_Mutation_p.N212S	NM_015009.1	NP_055824.1	Q9UPQ7	PZRN3_HUMAN	PDZ domain containing ring finger 3	495	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				neuromuscular junction development (GO:0007528)|protein ubiquitination (GO:0016567)	neuromuscular junction (GO:0031594)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(31)|ovary(4)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)		CAATGAAAAGTTTTTATTTTC	0.433																																					p.N495S		.											.	PDZRN3-232	0			c.A1484G						.						139.0	157.0	151.0					3																	73437153		2203	4300	6503	SO:0001583	missense	23024	exon8			GAAAAGTTTTTAT	AB029018	CCDS33789.1	3p14.1	2013-01-09	2008-08-14		ENSG00000121440	ENSG00000121440		"""RING-type (C3HC4) zinc fingers"""	17704	protein-coding gene	gene with protein product	"""likely ortholog of mouse semaF cytoplasmic domain associated protein 3"""	609729				10470851	Standard	XM_005264718		Approved	KIAA1095, SEMACAP3, LNX3	uc003dpl.1	Q9UPQ7	OTTHUMG00000158865	ENST00000263666.4:c.1484A>G	3.37:g.73437153T>C	ENSP00000263666:p.Asn495Ser	Somatic	23	0		WXS	Illumina GAIIx	Phase_I	14	6	NM_015009	0	0	5	8	3	A7MCZ6|Q8N2N7|Q96CC2|Q9NSQ2	Missense_Mutation	SNP	ENST00000263666.4	37	CCDS33789.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	13.64|13.64	2.298768|2.298768	0.40694|0.40694	.|.	.|.	ENSG00000121440|ENSG00000121440	ENST00000263666;ENST00000535920;ENST00000462146;ENST00000466780;ENST00000479530;ENST00000416926;ENST00000492909|ENST00000494559	T;T;T;T;T;T|.	0.26067|.	1.76;1.76;1.76;1.76;1.76;1.76|.	4.73|4.73	4.73|4.73	0.59995|0.59995	PDZ/DHR/GLGF (3);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.33469|0.33469	0.0864|0.0864	N|N	0.03930|0.03930	-0.32|-0.32	0.58432|0.58432	D|D	0.999998|0.999998	B;P;B;D|.	0.64830|.	0.16;0.84;0.025;0.994|.	B;P;B;D|.	0.73708|.	0.111;0.802;0.021;0.981|.	T|T	0.25047|0.25047	-1.0143|-1.0143	10|5	0.10111|.	T|.	0.7|.	.|.	14.1917|14.1917	0.65641|0.65641	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	217;212;212;495|.	F5H8I9;B7ZAG0;B7Z5X9;Q9UPQ7|.	.;.;.;PZRN3_HUMAN|.	S|A	495;217;152;152;212;495;193|92	ENSP00000263666:N495S;ENSP00000442026:N217S;ENSP00000418168:N152S;ENSP00000418484:N152S;ENSP00000418624:N212S;ENSP00000419250:N193S|.	ENSP00000263666:N495S|.	N|T	-|-	2|1	0|0	PDZRN3|PDZRN3	73519843|73519843	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	3.335000|3.335000	0.52105|0.52105	1.897000|1.897000	0.54924|0.54924	0.533000|0.533000	0.62120|0.62120	AAC|ACT	.		0.433	PDZRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352460.1	XM_041363	
ZPLD1	131368	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	102171934	102171934	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr3:102171934T>C	ENST00000491959.1	+	10	1160	c.278T>C	c.(277-279)aTt>aCt	p.I93T	ZPLD1_ENST00000466937.1_Missense_Mutation_p.I93T|ZPLD1_ENST00000306176.1_Missense_Mutation_p.I109T			Q8TCW7	ZPLD1_HUMAN	zona pellucida-like domain containing 1	93	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.					integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(18)|ovary(2)|skin(3)	35						GCAGTGGTCATTTTTATCATC	0.458																																					p.I109T		.											.	ZPLD1-72	0			c.T326C						.						89.0	81.0	84.0					3																	102171934		2203	4300	6503	SO:0001583	missense	131368	exon3			TGGTCATTTTTAT	AY090780	CCDS2947.1	3q12.3	2009-03-25			ENSG00000170044	ENSG00000170044			27022	protein-coding gene	gene with protein product		615915				18632209	Standard	NM_175056		Approved		uc003dvt.1	Q8TCW7	OTTHUMG00000159229	ENST00000491959.1:c.278T>C	3.37:g.102171934T>C	ENSP00000420265:p.Ile93Thr	Somatic	110	0		WXS	Illumina GAIIx	Phase_I	109	54	NM_175056	0	0	0	0	0	Q49AS1|Q8WU36	Missense_Mutation	SNP	ENST00000491959.1	37		.	.	.	.	.	.	.	.	.	.	T	13.61	2.288275	0.40494	.	.	ENSG00000170044	ENST00000491959;ENST00000306176;ENST00000466937	D;D;D	0.82081	-1.57;-1.57;-1.57	5.99	5.99	0.97316	Zona pellucida sperm-binding protein (3);	0.044854	0.85682	D	0.000000	T	0.80319	0.4601	N	0.22421	0.69	0.80722	D	1	D;B	0.56521	0.976;0.075	P;B	0.54140	0.743;0.022	T	0.76402	-0.2972	10	0.11485	T	0.65	-19.7538	16.4943	0.84223	0.0:0.0:0.0:1.0	.	109;93	Q8TCW7-2;Q8TCW7	.;ZPLD1_HUMAN	T	93;109;93	ENSP00000420265:I93T;ENSP00000307801:I109T;ENSP00000418253:I93T	ENSP00000307801:I109T	I	+	2	0	ZPLD1	103654624	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.605000	0.82844	2.291000	0.77112	0.533000	0.62120	ATT	.		0.458	ZPLD1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000353984.1	NM_175056	
HEG1	57493	bcgsc.ca	37	3	124692689	124692689	+	Silent	SNP	C	C	T	rs2270778	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr3:124692689C>T	ENST00000311127.4	-	16	3949	c.3882G>A	c.(3880-3882)ccG>ccA	p.P1294P		NM_020733.1	NP_065784.1	Q9ULI3	HEG1_HUMAN	heart development protein with EGF-like domains 1	1294					cardiac atrium morphogenesis (GO:0003209)|cell-cell junction assembly (GO:0007043)|endothelial cell morphogenesis (GO:0001886)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|lymph circulation (GO:0003017)|lymph vessel development (GO:0001945)|multicellular organism growth (GO:0035264)|pericardium development (GO:0060039)|post-embryonic development (GO:0009791)|regulation of body fluid levels (GO:0050878)|vasculogenesis (GO:0001570)|venous blood vessel morphogenesis (GO:0048845)|ventricular septum development (GO:0003281)	cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(24)|ovary(2)|urinary_tract(4)	47						ATTCAGCATACGGGGACATTT	0.398													T|||	3528	0.704473	0.8759	0.5994	5008	,	,		19410	0.7827		0.6034	False		,,,				2504	0.5706				p.P1294P		.											.	HEG1-70	0			c.G3882A						.	T		3050,620		1267,516,52	130.0	127.0	128.0		3882	-6.4	0.6	3	dbSNP_100	128	4890,3304		1447,1996,654	no	coding-synonymous	HEG1	NM_020733.1		2714,2512,706	TT,TC,CC		40.3222,16.8937,33.0748		1294/1382	124692689	7940,3924	1835	4097	5932	SO:0001819	synonymous_variant	57493	exon16			AGCATACGGGGAC	AK074987	CCDS46898.1	3q21.2	2013-03-08	2013-03-08		ENSG00000173706	ENSG00000173706			29227	protein-coding gene	gene with protein product	"""heart of glass"""	614182	"""HEG homolog 1 (zebrafish)"""			10574462, 19151727, 23007647	Standard	NM_020733		Approved	KIAA1237, HEG	uc003ehs.4	Q9ULI3	OTTHUMG00000159486	ENST00000311127.4:c.3882G>A	3.37:g.124692689C>T		Somatic	60	0		WXS	Illumina GAIIx	Phase_I	60	6	NM_020733	0	0	6	6	0	Q6NX66|Q8NC40|Q9BSV0	Silent	SNP	ENST00000311127.4	37	CCDS46898.1																																																																																			C|0.292;T|0.708		0.398	HEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355732.2	XM_087386	
BCHE	590	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	165548281	165548281	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr3:165548281A>G	ENST00000264381.3	-	2	707	c.541T>C	c.(541-543)Ttc>Ctc	p.F181L	BCHE_ENST00000540653.1_Intron	NM_000055.2	NP_000046.1	P06276	CHLE_HUMAN	butyrylcholinesterase	181					cellular protein metabolic process (GO:0044267)|choline metabolic process (GO:0019695)|cocaine metabolic process (GO:0050783)|learning (GO:0007612)|negative regulation of cell proliferation (GO:0008285)|negative regulation of synaptic transmission (GO:0050805)|neuroblast differentiation (GO:0014016)|response to alkaloid (GO:0043279)|response to drug (GO:0042493)|response to folic acid (GO:0051593)|response to glucocorticoid (GO:0051384)|synaptic transmission, cholinergic (GO:0007271)	blood microparticle (GO:0072562)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)	acetylcholinesterase activity (GO:0003990)|beta-amyloid binding (GO:0001540)|catalytic activity (GO:0003824)|choline binding (GO:0033265)|cholinesterase activity (GO:0004104)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)			breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(34)|ovary(4)|pancreas(2)|stomach(1)	55					Aclidinium(DB08897)|Ambenonium(DB01122)|Bambuterol(DB01408)|Chloroprocaine(DB01161)|Chlorphenesin(DB00856)|Chlorpromazine(DB00477)|Choline(DB00122)|Cinchocaine(DB00527)|Cisplatin(DB00515)|Clevidipine(DB04920)|Cyclopentolate(DB00979)|Decamethonium(DB01245)|Demecarium(DB00944)|Diethylcarbamazine(DB00711)|Dipivefrin(DB00449)|Doxacurium chloride(DB01135)|Drospirenone(DB01395)|Echothiophate(DB01057)|Edrophonium(DB01010)|Ephedrine(DB01364)|Ethopropazine(DB00392)|Galantamine(DB00674)|Hexafluronium(DB00941)|Irinotecan(DB00762)|Isoflurophate(DB00677)|Malathion(DB00772)|Mefloquine(DB00358)|Mirabegron(DB08893)|Mivacurium(DB01226)|Neostigmine(DB01400)|Nizatidine(DB00585)|Oxybuprocaine(DB00892)|Pancuronium(DB01337)|Pegvisomant(DB00082)|Pentagastrin(DB00183)|Perindopril(DB00790)|Pipecuronium(DB01338)|Pralidoxime(DB00733)|Procainamide(DB01035)|Procaine(DB00721)|Pyridostigmine(DB00545)|Ramipril(DB00178)|Rivastigmine(DB00989)|Succinylcholine(DB00202)|Sulpiride(DB00391)|Terbutaline(DB00871)|Triamcinolone(DB00620)|Triflupromazine(DB00508)|Trimethaphan(DB01116)	AAAGCTAAGAATCCTAGGGCA	0.428																																					p.F181L		.											.	BCHE-94	0			c.T541C						.						61.0	64.0	63.0					3																	165548281		2203	4300	6503	SO:0001583	missense	590	exon2			CTAAGAATCCTAG	M16541	CCDS3198.1	3q26.1-q26.2	2013-07-10			ENSG00000114200	ENSG00000114200	3.1.1.8		983	protein-coding gene	gene with protein product		177400	"""cholinesterase 1"", ""cholinesterase (serum) 2"""	CHE1, CHE2		1769657, 2318303	Standard	NM_000055		Approved	E1	uc003fem.4	P06276	OTTHUMG00000158131	ENST00000264381.3:c.541T>C	3.37:g.165548281A>G	ENSP00000264381:p.Phe181Leu	Somatic	84	0		WXS	Illumina GAIIx	Phase_I	65	36	NM_000055	0	0	16	16	0	A8K7P8	Missense_Mutation	SNP	ENST00000264381.3	37	CCDS3198.1	.	.	.	.	.	.	.	.	.	.	A	23.6	4.432678	0.83776	.	.	ENSG00000114200	ENST00000264381	T	0.80566	-1.39	5.86	5.86	0.93980	Carboxylesterase, type B (1);	0.000000	0.85682	D	0.000000	D	0.92984	0.7767	H	0.96111	3.77	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94978	0.8123	10	0.87932	D	0	.	15.448	0.75248	1.0:0.0:0.0:0.0	.	181	P06276	CHLE_HUMAN	L	181	ENSP00000264381:F181L	ENSP00000264381:F181L	F	-	1	0	BCHE	167030975	1.000000	0.71417	0.999000	0.59377	0.958000	0.62258	8.600000	0.90860	2.240000	0.73641	0.533000	0.62120	TTC	.		0.428	BCHE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350254.1		
ZNF639	51193	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	179051848	179051848	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr3:179051848A>G	ENST00000326361.3	+	7	1541	c.1096A>G	c.(1096-1098)Acc>Gcc	p.T366A	ZNF639_ENST00000484866.1_Missense_Mutation_p.T366A|ZNF639_ENST00000496856.1_Missense_Mutation_p.T366A	NM_016331.1	NP_057415.1	Q9UID6	ZN639_HUMAN	zinc finger protein 639	366					negative regulation by host of viral transcription (GO:0043922)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of cell growth (GO:0030307)|transcription, DNA-templated (GO:0006351)|viral entry into host cell (GO:0046718)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein self-association (GO:0043621)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(10)|urinary_tract(1)	16	all_cancers(143;7.9e-17)|Ovarian(172;0.0172)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;5.78e-26)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0923)			AAGCAAAATTACCTTTGACAA	0.338																																					p.T366A		.											.	ZNF639-90	0			c.A1096G						.						102.0	99.0	100.0					3																	179051848		2203	4300	6503	SO:0001583	missense	51193	exon7			AAAATTACCTTTG	BC020500	CCDS3227.1	3q27.1	2010-03-26			ENSG00000121864	ENSG00000121864		"""Zinc fingers, C2H2-type"""	30950	protein-coding gene	gene with protein product	"""zinc finger amplified in esophageal squamous cell carcinomas 1"""					14522885	Standard	NM_016331		Approved	ANC-2H01, ZASC1	uc003fjr.1	Q9UID6	OTTHUMG00000157439	ENST00000326361.3:c.1096A>G	3.37:g.179051848A>G	ENSP00000325634:p.Thr366Ala	Somatic	231	0		WXS	Illumina GAIIx	Phase_I	139	62	NM_016331	0	0	13	15	2	A9X3Z9|D3DNR3	Missense_Mutation	SNP	ENST00000326361.3	37	CCDS3227.1	.	.	.	.	.	.	.	.	.	.	A	16.88	3.245523	0.59103	.	.	ENSG00000121864	ENST00000496856;ENST00000326361;ENST00000484866	T;T;T	0.03831	3.79;3.79;3.79	5.78	5.78	0.91487	.	0.065938	0.64402	D	0.000013	T	0.04363	0.0120	N	0.14661	0.345	0.34734	D	0.730074	B	0.29378	0.243	B	0.26094	0.066	T	0.39623	-0.9605	10	0.56958	D	0.05	.	16.3971	0.83610	1.0:0.0:0.0:0.0	.	366	Q9UID6	ZN639_HUMAN	A	366	ENSP00000417740:T366A;ENSP00000325634:T366A;ENSP00000418766:T366A	ENSP00000325634:T366A	T	+	1	0	ZNF639	180534542	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	6.287000	0.72671	2.330000	0.79161	0.533000	0.62120	ACC	.		0.338	ZNF639-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348855.1	NM_016331	
MAP3K13	9175	broad.mit.edu	37	3	185190907	185190907	+	Missense_Mutation	SNP	A	A	T			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr3:185190907A>T	ENST00000265026.3	+	11	2122	c.1788A>T	c.(1786-1788)agA>agT	p.R596S	MAP3K13_ENST00000535426.1_Missense_Mutation_p.R452S|MAP3K13_ENST00000446828.1_Missense_Mutation_p.R389S|MAP3K13_ENST00000424227.1_Missense_Mutation_p.R596S|MAP3K13_ENST00000443863.1_Missense_Mutation_p.R452S	NM_004721.4	NP_004712.1			mitogen-activated protein kinase kinase kinase 13											NS(1)|biliary_tract(1)|breast(3)|endometrium(3)|kidney(1)|large_intestine(13)|lung(22)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	54	all_cancers(143;7.21e-11)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)			GGAATAGCAGAGGCAGCCATA	0.532																																					p.R596S		.											.	MAP3K13-548	0			c.A1788T						.						242.0	265.0	257.0					3																	185190907		2203	4300	6503	SO:0001583	missense	9175	exon11			TAGCAGAGGCAGC	BC031677	CCDS3270.1, CCDS56298.1	3q27	2011-06-09			ENSG00000073803	ENSG00000073803		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6852	protein-coding gene	gene with protein product	"""leucine zipper-bearing kinase"""	604915				9353328	Standard	NM_004721		Approved	LZK, MEKK13	uc003fpi.3	O43283	OTTHUMG00000156673	ENST00000265026.3:c.1788A>T	3.37:g.185190907A>T	ENSP00000265026:p.Arg596Ser	Somatic	129	0		WXS	Illumina GAIIx	Phase_I	106	4	NM_004721	0	0	6	6	0		Missense_Mutation	SNP	ENST00000265026.3	37	CCDS3270.1	.	.	.	.	.	.	.	.	.	.	A	15.68	2.905549	0.52333	.	.	ENSG00000073803	ENST00000446828;ENST00000424227;ENST00000443863;ENST00000535426;ENST00000265026	T;T;T;T;T	0.14391	2.51;2.51;2.51;2.51;2.51	5.47	0.349	0.16032	Protein kinase-like domain (1);	0.052653	0.64402	D	0.000001	T	0.05502	0.0145	N	0.14661	0.345	0.43885	D	0.996507	B;B;B	0.33549	0.287;0.417;0.189	B;B;B	0.28011	0.085;0.085;0.039	T	0.48151	-0.9060	10	0.21014	T	0.42	.	5.9622	0.19305	0.6677:0.1277:0.2046:0.0	.	452;389;596	O43283-4;O43283-5;O43283	.;.;M3K13_HUMAN	S	389;596;452;452;596	ENSP00000411483:R389S;ENSP00000399910:R596S;ENSP00000409325:R452S;ENSP00000439257:R452S;ENSP00000265026:R596S	ENSP00000265026:R596S	R	+	3	2	MAP3K13	186673601	0.999000	0.42202	0.993000	0.49108	0.980000	0.70556	0.929000	0.28844	-0.166000	0.10890	-0.379000	0.06801	AGA	.		0.532	MAP3K13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345268.1	NM_004721	
ATP13A4	84239	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	193174877	193174877	+	Silent	SNP	T	T	C			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr3:193174877T>C	ENST00000342695.4	-	16	2149	c.1827A>G	c.(1825-1827)acA>acG	p.T609T	ATP13A4_ENST00000392443.3_Silent_p.T590T	NM_032279.2	NP_115655.2	Q4VNC1	AT134_HUMAN	ATPase type 13A4	609						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(27)|ovary(2)|prostate(3)|skin(11)|upper_aerodigestive_tract(2)	71	all_cancers(143;1.76e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;2.72e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000109)		GGACAATGACTGTCATTCTTT	0.517																																					p.T609T		.											.	ATP13A4-92	0			c.A1827G						.						129.0	112.0	117.0					3																	193174877		2203	4300	6503	SO:0001819	synonymous_variant	84239	exon16			AATGACTGTCATT	AK095277	CCDS3304.2	3q29	2010-04-20			ENSG00000127249	ENSG00000127249		"""ATPases / P-type"""	25422	protein-coding gene	gene with protein product		609556				14702039, 12975309	Standard	XM_005247829		Approved	DKFZp761I1011, FLJ37958	uc003ftd.3	Q4VNC1	OTTHUMG00000074067	ENST00000342695.4:c.1827A>G	3.37:g.193174877T>C		Somatic	161	0		WXS	Illumina GAIIx	Phase_I	161	76	NM_032279	0	0	0	0	0	B7WPC7|Q6UY23|Q8N1Q9|Q9H043	Silent	SNP	ENST00000342695.4	37	CCDS3304.2																																																																																			.		0.517	ATP13A4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157244.4	NM_032279	
MUC4	4585	bcgsc.ca	37	3	195511379	195511379	+	Missense_Mutation	SNP	C	C	T	rs528462079	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr3:195511379C>T	ENST00000463781.3	-	2	7531	c.7072G>A	c.(7072-7074)Gct>Act	p.A2358T	MUC4_ENST00000475231.1_Missense_Mutation_p.A2358T|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACTGAGGAAGCGTCGGTGACA	0.587																																					p.A2358T		.											.	MUC4-90	0			c.G7072A						.						22.0	18.0	20.0					3																	195511379		686	1578	2264	SO:0001583	missense	4585	exon2			AGGAAGCGTCGGT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.7072G>A	3.37:g.195511379C>T	ENSP00000417498:p.Ala2358Thr	Somatic	357	4		WXS	Illumina GAIIx	Phase_I	420	140	NM_018406	0	0	0	0	0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	T	6.589	0.477055	0.12521	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.32023	1.47;1.47	.	.	.	.	.	.	.	.	T	0.10852	0.0265	N	0.08118	0	0.09310	N	1	B	0.26975	0.165	B	0.14578	0.011	T	0.24261	-1.0165	7	.	.	.	.	5.4001	0.16291	0.0:0.7312:0.0:0.2688	.	2358	E7ESK3	.	T	2358	ENSP00000417498:A2358T;ENSP00000420243:A2358T	.	A	-	1	0	MUC4	196995774	0.001000	0.12720	0.001000	0.08648	0.055000	0.15305	-0.954000	0.03873	-1.707000	0.01402	-2.088000	0.00374	GCT	.		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
IDUA	3425	broad.mit.edu	37	4	996204	996204	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr4:996204A>C	ENST00000247933.4	+	8	1208	c.1120A>C	c.(1120-1122)Acc>Ccc	p.T374P	IDUA_ENST00000453894.1_Missense_Mutation_p.T396P|IDUA_ENST00000514224.1_Missense_Mutation_p.T242P	NM_000203.3	NP_000194.2	P35475	IDUA_HUMAN	iduronidase, alpha-L-	374					carbohydrate metabolic process (GO:0005975)|cell morphogenesis (GO:0000902)|chemical homeostasis (GO:0048878)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate catabolic process (GO:0030209)|disaccharide metabolic process (GO:0005984)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|limb morphogenesis (GO:0035108)|lysosome organization (GO:0007040)|skeletal system morphogenesis (GO:0048705)|small molecule metabolic process (GO:0044281)	coated vesicle (GO:0030135)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	L-iduronidase activity (GO:0003940)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	12			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			GGTCAACAACACCCGCCCGCC	0.711																																					p.T374P		.											.	IDUA-91	0			c.A1120C						.						26.0	28.0	27.0					4																	996204		2185	4282	6467	SO:0001583	missense	3425	exon8			AACAACACCCGCC	M74715	CCDS3343.1	4p16.3	2012-10-02			ENSG00000127415	ENSG00000127415	3.2.1.76		5391	protein-coding gene	gene with protein product		252800				1832239	Standard	NM_000203		Approved	MPS1	uc003gby.3	P35475	OTTHUMG00000088901	ENST00000247933.4:c.1120A>C	4.37:g.996204A>C	ENSP00000247933:p.Thr374Pro	Somatic	75	5		WXS	Illumina GAIIx	Phase_I	386	114	NM_000203	0	0	8	9	1	B3KWK6	Missense_Mutation	SNP	ENST00000247933.4	37	CCDS3343.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.117066	0.77323	.	.	ENSG00000127415	ENST00000247933;ENST00000453894;ENST00000514224	D;D;D	0.94280	-3.39;-3.39;-3.39	5.31	5.31	0.75309	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.156849	0.56097	D	0.000026	D	0.96611	0.8894	M	0.86178	2.8	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.995	D	0.96508	0.9376	10	0.46703	T	0.11	-7.29	13.2474	0.60029	1.0:0.0:0.0:0.0	.	396;374	B3KWK6;P35475	.;IDUA_HUMAN	P	374;396;242	ENSP00000247933:T374P;ENSP00000396458:T396P;ENSP00000425081:T242P	ENSP00000247933:T374P	T	+	1	0	IDUA	986204	1.000000	0.71417	0.995000	0.50966	0.426000	0.31534	5.967000	0.70403	2.024000	0.59613	0.454000	0.30748	ACC	.		0.711	IDUA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000201812.1	NM_000203	
CRIPAK	285464	hgsc.bcm.edu	37	4	1388867	1388867	+	Missense_Mutation	SNP	A	A	C	rs76058011	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr4:1388867A>C	ENST00000324803.4	+	1	3528	c.568A>C	c.(568-570)Atc>Ctc	p.I190L		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	190					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			TGCCCGCCTGATCACACGTGC	0.662													N|||	145	0.0289537	0.0174	0.0447	5008	,	,		14453	0.0099		0.0586	False		,,,				2504	0.0225				p.I190L		.											.	CRIPAK-90	0			c.A568C						.						246.0	170.0	197.0					4																	1388867		2172	3827	5999	SO:0001583	missense	285464	exon1			CGCCTGATCACAC	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.568A>C	4.37:g.1388867A>C	ENSP00000323978:p.Ile190Leu	Somatic	44	0		WXS	Illumina GAIIx	Phase_I	383	28	NM_175918	0	0	6	76	70	Q8NB03	Missense_Mutation	SNP	ENST00000324803.4	37	CCDS3349.1	.	.	.	.	.	.	.	.	.	.	-	4.910	0.169067	0.09339	.	.	ENSG00000179979	ENST00000324803	T	0.19394	2.15	1.25	-1.56	0.08532	.	.	.	.	.	T	0.06917	0.0176	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.34004	-0.9846	9	0.10636	T	0.68	.	0.5937	0.00732	0.3976:0.2382:0.1983:0.1659	.	190	Q8N1N5	CRPAK_HUMAN	L	190	ENSP00000323978:I190L	ENSP00000323978:I190L	I	+	1	0	CRIPAK	1378867	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-2.558000	0.00923	-1.849000	0.01171	-2.030000	0.00424	ATC	A|0.994;C|0.006		0.662	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
MSX1	4487	hgsc.bcm.edu	37	4	4861745	4861745	+	Missense_Mutation	SNP	C	C	G	rs36059701	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr4:4861745C>G	ENST00000382723.4	+	1	353	c.119C>G	c.(118-120)gCa>gGa	p.A40G		NM_002448.3	NP_002439.2	P28360	MSX1_HUMAN	msh homeobox 1	40	Poly-Ala.				activation of meiosis (GO:0090427)|anterior/posterior pattern specification (GO:0009952)|BMP signaling pathway involved in heart development (GO:0061312)|bone morphogenesis (GO:0060349)|cartilage morphogenesis (GO:0060536)|cell morphogenesis (GO:0000902)|cellular response to nicotine (GO:0071316)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic nail plate morphogenesis (GO:0035880)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|mammary gland epithelium development (GO:0061180)|mesenchymal cell proliferation (GO:0010463)|midbrain development (GO:0030901)|middle ear morphogenesis (GO:0042474)|muscle organ development (GO:0007517)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of striated muscle cell differentiation (GO:0051154)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|pituitary gland development (GO:0021983)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of intrinsic apoptotic signaling pathway by p53 class mediator (GO:1902255)|positive regulation of mesenchymal cell apoptotic process (GO:2001055)|protein localization to nucleus (GO:0034504)|protein stabilization (GO:0050821)|regulation of odontogenesis (GO:0042481)|signal transduction involved in regulation of gene expression (GO:0023019)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	p53 binding (GO:0002039)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			endometrium(3)|lung(5)|ovary(1)|prostate(1)|urinary_tract(1)	11				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		gcggccACGGCAGCCGCCATG	0.716													C|||	519	0.103634	0.0893	0.1037	5008	,	,		6085	0.0565		0.165	False		,,,				2504	0.1084				p.A40G		.											.	MSX1-90	0			c.C119G	GRCh37	CM045070	MSX1	M	rs36059701	.	C	GLY/ALA	241,2261		15,211,1025	3.0	4.0	4.0		119	2.9	0.4	4	dbSNP_126	4	677,4129		58,561,1784	no	missense	MSX1	NM_002448.3	60	73,772,2809	GG,GC,CC		14.0866,9.6323,12.5616	benign	40/304	4861745	918,6390	1251	2403	3654	SO:0001583	missense	4487	exon1			CCACGGCAGCCGC	M97676	CCDS3378.2	4p16.2	2011-06-20	2006-11-21		ENSG00000163132	ENSG00000163132		"""Homeoboxes / ANTP class : NKL subclass"""	7391	protein-coding gene	gene with protein product		142983	"""msh (Drosophila) homeo box homolog 1 (formerly homeo box 7)"", ""msh homeobox homolog 1 (Drosophila)"""	HOX7		1685479, 1973146	Standard	NM_002448		Approved	HYD1, OFC5	uc003gif.3	P28360	OTTHUMG00000090335	ENST00000382723.4:c.119C>G	4.37:g.4861745C>G	ENSP00000372170:p.Ala40Gly	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	12	4	NM_002448	0	0	0	1	1	A0SZU5|A8K3M1|Q96NY4	Missense_Mutation	SNP	ENST00000382723.4	37	CCDS3378.2	290	0.13278388278388278	53	0.10772357723577236	45	0.12430939226519337	44	0.07692307692307693	148	0.19525065963060687	C	6.955	0.546124	0.13312	0.096323	0.140866	ENSG00000163132	ENST00000382723	D	0.95885	-3.84	4.66	2.92	0.33932	.	0.650131	0.15386	N	0.265060	T	0.00552	0.0018	N	0.24115	0.695	0.51767	P	6.20000000000065E-5	B	0.16166	0.016	B	0.15870	0.014	T	0.44003	-0.9356	9	0.11182	T	0.66	-4.3518	5.025	0.14379	0.1663:0.6515:0.0:0.1822	rs36059701	34	P28360	MSX1_HUMAN	G	40	ENSP00000372170:A40G	ENSP00000372170:A40G	A	+	2	0	MSX1	4912646	0.996000	0.38824	0.367000	0.25926	0.047000	0.14425	0.572000	0.23684	0.390000	0.25115	0.491000	0.48974	GCA	C|0.867;G|0.133		0.716	MSX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206700.3		
ZAR1	326340	hgsc.bcm.edu	37	4	48492769	48492769	+	Missense_Mutation	SNP	A	A	T	rs74929644	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr4:48492769A>T	ENST00000327939.4	+	1	501	c.461A>T	c.(460-462)cAg>cTg	p.Q154L		NM_175619.1	NP_783318.1	Q86SH2	ZAR1_HUMAN	zygote arrest 1	154					multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)				endometrium(1)|large_intestine(4)	5						TTCTCCCAGCAGCCATCCCGT	0.781													A|||	1944	0.388179	0.171	0.572	5008	,	,		7581	0.4454		0.5089	False		,,,				2504	0.3681				p.Q154L		.											.	ZAR1-90	0			c.A461T						.	A	LEU/GLN	483,2381		61,361,1010	4.0	4.0	4.0		461	-6.2	0.0	4	dbSNP_131	4	2428,3758		540,1348,1205	no	missense	ZAR1	NM_175619.1	113	601,1709,2215	TT,TA,AA		39.2499,16.8645,32.1657	benign	154/425	48492769	2911,6139	1432	3093	4525	SO:0001583	missense	326340	exon1			CCCAGCAGCCATC	AY193890	CCDS3483.1	4p11	2014-02-20			ENSG00000182223	ENSG00000182223			20436	protein-coding gene	gene with protein product	"""zinc finger, 3CxxC-type 6"""	607520				12539046	Standard	NM_175619		Approved	Z3CXXC6	uc003gyd.3	Q86SH2	OTTHUMG00000102093	ENST00000327939.4:c.461A>T	4.37:g.48492769A>T	ENSP00000329803:p.Gln154Leu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	4	NM_175619	0	0	0	0	0		Missense_Mutation	SNP	ENST00000327939.4	37	CCDS3483.1	979	0.4482600732600733	95	0.19308943089430894	212	0.585635359116022	288	0.5034965034965035	384	0.5065963060686016	A	12.09	1.834066	0.32421	0.168645	0.392499	ENSG00000182223	ENST00000327939	.	.	.	3.61	-6.17	0.02091	.	.	.	.	.	T	0.00012	0.0000	N	0.19112	0.55	0.80722	P	0.0	B	0.02656	0.0	B	0.04013	0.001	T	0.49194	-0.8965	7	0.25751	T	0.34	.	0.9878	0.01450	0.443:0.2168:0.1793:0.1609	.	154	Q86SH2	ZAR1_HUMAN	L	154	.	ENSP00000329803:Q154L	Q	+	2	0	ZAR1	48187526	0.000000	0.05858	0.002000	0.10522	0.003000	0.03518	-0.738000	0.04871	-0.489000	0.06716	-0.680000	0.03767	CAG	A|0.552;T|0.448		0.781	ZAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219927.3		
UGT2B28	54490	broad.mit.edu	37	4	70156400	70156400	+	Missense_Mutation	SNP	C	C	A	rs557930259	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr4:70156400C>A	ENST00000335568.5	+	5	1183	c.1181C>A	c.(1180-1182)cCa>cAa	p.P394Q	UGT2B28_ENST00000511240.1_Intron	NM_053039.1	NP_444267.1	Q9BY64	UDB28_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B28	394					metabolic process (GO:0008152)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(16)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	31						GTAGGCATTCCATTGTTTTGG	0.463																																					p.P394Q		.											.	UGT2B28-91	0			c.C1181A						.						112.0	112.0	112.0					4																	70156400		2048	4237	6285	SO:0001583	missense	54490	exon5			GCATTCCATTGTT	AF177272	CCDS3528.1, CCDS56330.1	4q13.3	2011-02-09	2005-07-20		ENSG00000135226	ENSG00000135226		"""UDP glucuronosyltransferases"""	13479	protein-coding gene	gene with protein product		606497	"""UDP glycosyltransferase 2 family, polypeptide B28"""			11300766	Standard	NM_053039		Approved		uc003hej.3	Q9BY64	OTTHUMG00000129401	ENST00000335568.5:c.1181C>A	4.37:g.70156400C>A	ENSP00000334276:p.Pro394Gln	Somatic	625	1		WXS	Illumina GAIIx	Phase_I	816	18	NM_053039	0	0	0	0	0	B5BUM0|Q9BY62|Q9BY63	Missense_Mutation	SNP	ENST00000335568.5	37	CCDS3528.1	.	.	.	.	.	.	.	.	.	.	-	10.55	1.382451	0.24944	.	.	ENSG00000135226	ENST00000335568	D	0.90261	-2.64	1.85	1.85	0.25348	.	0.000000	0.64402	U	0.000001	D	0.96611	0.8894	H	0.98507	4.25	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95666	0.8719	10	0.87932	D	0	.	9.3109	0.37903	0.0:1.0:0.0:0.0	.	394	Q9BY64	UDB28_HUMAN	Q	394	ENSP00000334276:P394Q	ENSP00000334276:P394Q	P	+	2	0	UGT2B28	70190989	1.000000	0.71417	0.120000	0.21714	0.014000	0.08584	6.688000	0.74557	1.023000	0.39654	0.184000	0.17185	CCA	.		0.463	UGT2B28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251557.2	NM_053039	
DSPP	1834	bcgsc.ca	37	4	88537171	88537171	+	Silent	SNP	C	C	T			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr4:88537171C>T	ENST00000282478.7	+	4	3390	c.3357C>T	c.(3355-3357)gaC>gaT	p.D1119D	DSPP_ENST00000399271.1_Silent_p.D1119D|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1119	Asp/Ser-rich.			Missing (in Ref. 1; AAF42472 and 3; AAD16120). {ECO:0000305}.	biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		acagcagtgacagcagcaata	0.547																																					p.D1119D		.											.	DSPP-90	0			c.C3357T						.						18.0	23.0	21.0					4																	88537171		1240	2349	3589	SO:0001819	synonymous_variant	1834	exon5			CAGTGACAGCAGC	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3357C>T	4.37:g.88537171C>T		Somatic	641	7		WXS	Illumina GAIIx	Phase_I	1051	32	NM_014208	0	0	0	0	0	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	37	CCDS43248.1																																																																																			.		0.547	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
DSPP	1834	bcgsc.ca	37	4	88537186	88537186	+	Silent	SNP	T	T	C			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr4:88537186T>C	ENST00000282478.7	+	4	3405	c.3372T>C	c.(3370-3372)agT>agC	p.S1124S	DSPP_ENST00000399271.1_Silent_p.S1124S|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1124	Asp/Ser-rich.			Missing (in Ref. 1; AAF42472 and 3; AAD16120). {ECO:0000305}.	biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gcaatagcagtgacagcagtg	0.562																																					p.S1124S		.											.	DSPP-90	0			c.T3372C						.						17.0	22.0	20.0					4																	88537186		1209	2326	3535	SO:0001819	synonymous_variant	1834	exon5			TAGCAGTGACAGC	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3372T>C	4.37:g.88537186T>C		Somatic	647	16		WXS	Illumina GAIIx	Phase_I	1046	78	NM_014208	0	0	0	0	0	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	37	CCDS43248.1																																																																																			.		0.562	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
DSPP	1834	bcgsc.ca	37	4	88537195	88537195	+	Silent	SNP	T	T	C			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr4:88537195T>C	ENST00000282478.7	+	4	3414	c.3381T>C	c.(3379-3381)agT>agC	p.S1127S	DSPP_ENST00000399271.1_Silent_p.S1127S|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1127	Asp/Ser-rich.			Missing (in Ref. 1; AAF42472 and 3; AAD16120). {ECO:0000305}.	biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gtgacagcagtgacagcagcg	0.567																																					p.S1127S		.											.	DSPP-90	0			c.T3381C						.						16.0	22.0	20.0					4																	88537195		1225	2378	3603	SO:0001819	synonymous_variant	1834	exon5			CAGCAGTGACAGC	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3381T>C	4.37:g.88537195T>C		Somatic	636	18		WXS	Illumina GAIIx	Phase_I	1014	68	NM_014208	0	0	0	0	0	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	37	CCDS43248.1																																																																																			.		0.567	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
DSPP	1834	bcgsc.ca	37	4	88537222	88537222	+	Silent	SNP	T	T	C	rs200679221		TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr4:88537222T>C	ENST00000282478.7	+	4	3441	c.3408T>C	c.(3406-3408)agT>agC	p.S1136S	DSPP_ENST00000399271.1_Silent_p.S1136S|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1136	Asp/Ser-rich.			Missing (in Ref. 1; AAF42472 and 3; AAD16120). {ECO:0000305}.	biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gtgatagcagtgacagcagca	0.572																																					p.S1136S		.											.	DSPP-90	0			c.T3408C						.																																			SO:0001819	synonymous_variant	1834	exon5			TAGCAGTGACAGC	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3408T>C	4.37:g.88537222T>C		Somatic	730	5		WXS	Illumina GAIIx	Phase_I	1121	36	NM_014208	0	0	0	0	0	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	37	CCDS43248.1																																																																																			.		0.572	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
C4orf32	132720	hgsc.bcm.edu	37	4	113066831	113066831	+	Missense_Mutation	SNP	G	G	A	rs10002700	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr4:113066831G>A	ENST00000309733.5	+	1	279	c.95G>A	c.(94-96)gGg>gAg	p.G32E		NM_152400.2	NP_689613.1	Q8N8J7	CD032_HUMAN	chromosome 4 open reading frame 32	32				G -> E (in Ref. 1; BAC04841 and 3; AAH22534). {ECO:0000305}.		integral component of membrane (GO:0016021)							Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.00198)		gcagggaccgggtgggatccc	0.806													A|||	5004	0.999201	1.0	1.0	5008	,	,		5782	1.0		0.996	False		,,,				2504	1.0				p.G32E		.											.	C4orf32-90	0			c.G95A						.	A	GLU/GLY	2990,0		1495,0,0	3.0	5.0	4.0		95	2.0	0.1	4	dbSNP_119	4	6170,26		3072,26,0	no	missense	C4orf32	NM_152400.2	98	4567,26,0	AA,AG,GG		0.4196,0.0,0.283	benign	32/133	113066831	9160,26	1495	3098	4593	SO:0001583	missense	132720	exon1			GGACCGGGTGGGA	AK096689	CCDS3695.1	4q25	2008-02-05			ENSG00000174749	ENSG00000174749			26813	protein-coding gene	gene with protein product						12477932	Standard	NM_152400		Approved	FLJ39370	uc003iah.2	Q8N8J7	OTTHUMG00000132851	ENST00000309733.5:c.95G>A	4.37:g.113066831G>A	ENSP00000310182:p.Gly32Glu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_152400	0	0	0	6	6	Q49A91|Q4W5C7|Q8TBF9	Missense_Mutation	SNP	ENST00000309733.5	37	CCDS3695.1	2136	0.978021978021978	469	0.9532520325203252	355	0.9806629834254144	563	0.9842657342657343	749	0.9881266490765171	A	0.015	-1.569980	0.00895	1.0	0.995804	ENSG00000174749	ENST00000309733	T	0.42513	0.97	3.18	2.02	0.26589	.	0.619595	0.14277	N	0.329768	T	0.00012	0.0000	N	0.00538	-1.39	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.32561	-0.9902	9	0.02654	T	1	-1.079	4.6216	0.12455	0.712:0.0:0.288:0.0	rs10002700;rs17845705;rs17858649	32	Q8N8J7	CD032_HUMAN	E	32	ENSP00000310182:G32E	ENSP00000310182:G32E	G	+	2	0	C4orf32	113286280	0.547000	0.26465	0.070000	0.20053	0.008000	0.06430	0.688000	0.25422	0.414000	0.25790	-0.893000	0.02921	GGG	G|0.022;A|0.978		0.806	C4orf32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256325.2	NM_152400	
FGF2	2247	hgsc.bcm.edu	37	4	123748086	123748086	+	Silent	SNP	C	C	T	rs1449683	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr4:123748086C>T	ENST00000264498.3	+	1	224	c.156C>T	c.(154-156)tcC>tcT	p.S52S	AC021205.1_ENST00000517260.1_RNA|FGF2_ENST00000608478.1_5'UTR	NM_002006.4	NP_001997	P09038	FGF2_HUMAN	fibroblast growth factor 2 (basic)	52					activation of MAPK activity (GO:0000187)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemotaxis (GO:0006935)|chondroblast differentiation (GO:0060591)|embryonic morphogenesis (GO:0048598)|epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix organization (GO:0030198)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hyaluronan catabolic process (GO:0030214)|innate immune response (GO:0045087)|inositol phosphate biosynthetic process (GO:0032958)|insulin receptor signaling pathway (GO:0008286)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell death (GO:0060548)|negative regulation of fibroblast migration (GO:0010764)|negative regulation of wound healing (GO:0061045)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|positive chemotaxis (GO:0050918)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell division (GO:0051781)|positive regulation of cell fate specification (GO:0042660)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|release of sequestered calcium ion into cytosol (GO:0051209)|signal transduction (GO:0007165)|wound healing (GO:0042060)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|nucleus (GO:0005634)	chemoattractant activity (GO:0042056)|cytokine activity (GO:0005125)|fibroblast growth factor receptor binding (GO:0005104)|growth factor activity (GO:0008083)|heparin binding (GO:0008201)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)			central_nervous_system(1)|cervix(1)|endometrium(1)|lung(3)|ovary(1)|skin(1)	8					Pentosan Polysulfate(DB00686)|Sirolimus(DB00877)|Sucralfate(DB00364)	GACACCCATCCGTGAACCCCA	0.776													C|||	894	0.178514	0.2958	0.1888	5008	,	,		4940	0.1508		0.1004	False		,,,				2504	0.1217				p.S52S		.											.	FGF2-659	0			c.C156T						.	C		760,3152		45,670,1241	3.0	6.0	5.0		156	0.8	0.0	4	dbSNP_88	5	566,7178		28,510,3334	no	coding-synonymous	FGF2	NM_002006.4		73,1180,4575	TT,TC,CC		7.3089,19.4274,11.3761		52/289	123748086	1326,10330	1956	3872	5828	SO:0001819	synonymous_variant	2247	exon1			CCCATCCGTGAAC	J04513	CCDS34059.1	4q26	2014-01-30			ENSG00000138685	ENSG00000138685		"""Endogenous ligands"""	3676	protein-coding gene	gene with protein product		134920		FGFB		9925931	Standard	NM_002006		Approved		uc003iev.1	P09038	OTTHUMG00000039506	ENST00000264498.3:c.156C>T	4.37:g.123748086C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	19	16	NM_002006	0	0	0	0	0	A4LBB8|O00527|P78443|Q16443|Q5PY50|Q7KZ11|Q7KZ72|Q9UC54|Q9UCS5|Q9UCS6	Silent	SNP	ENST00000264498.3	37	CCDS34059.1																																																																																			C|0.833;T|0.167		0.776	FGF2-001	KNOWN	non_ATG_start|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000095330.3	NM_002006	
FAT4	79633	broad.mit.edu;bcgsc.ca	37	4	126240715	126240715	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr4:126240715G>T	ENST00000394329.3	+	1	3162	c.3149G>T	c.(3148-3150)gGt>gTt	p.G1050V		NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	1050	Cadherin 10. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						TTCCCAGATGGTCAATTGTAT	0.403																																					p.G1050V		.											.	FAT4-108	0			c.G3149T						.						117.0	110.0	112.0					4																	126240715		1865	4100	5965	SO:0001583	missense	79633	exon1			CAGATGGTCAATT	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.3149G>T	4.37:g.126240715G>T	ENSP00000377862:p.Gly1050Val	Somatic	236	0		WXS	Illumina GAIIx	Phase_I	206	8	NM_024582	0	0	0	0	0	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	37	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	G	18.33	3.599441	0.66332	.	.	ENSG00000196159	ENST00000394329	D	0.91464	-2.85	4.56	4.56	0.56223	Cadherin (4);Cadherin-like (1);	0.000000	0.35067	U	0.003467	D	0.97480	0.9175	H	0.99026	4.405	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99529	1.0960	10	0.87932	D	0	.	17.5378	0.87837	0.0:0.0:1.0:0.0	.	1050	Q6V0I7	FAT4_HUMAN	V	1050	ENSP00000377862:G1050V	ENSP00000377862:G1050V	G	+	2	0	FAT4	126460165	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.454000	0.97621	2.354000	0.79902	0.462000	0.41574	GGT	.		0.403	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
FAT4	79633	broad.mit.edu	37	4	126241103	126241103	+	Silent	SNP	C	C	T			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr4:126241103C>T	ENST00000394329.3	+	1	3550	c.3537C>T	c.(3535-3537)gtC>gtT	p.V1179V		NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	1179	Cadherin 11. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						GCTTTACAGTCATAGCAACAG	0.428																																					p.V1179V		.											.	FAT4-108	0			c.C3537T						.						96.0	97.0	97.0					4																	126241103		1936	4132	6068	SO:0001819	synonymous_variant	79633	exon1			TACAGTCATAGCA	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.3537C>T	4.37:g.126241103C>T		Somatic	32	0		WXS	Illumina GAIIx	Phase_I	21	5	NM_024582	0	0	0	0	0	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Silent	SNP	ENST00000394329.3	37	CCDS3732.3																																																																																			.		0.428	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
LRBA	987	bcgsc.ca	37	4	151793903	151793903	+	Missense_Mutation	SNP	T	T	C	rs72719663	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr4:151793903T>C	ENST00000357115.3	-	18	2413	c.2170A>G	c.(2170-2172)Atc>Gtc	p.I724V	LRBA_ENST00000507224.1_Missense_Mutation_p.I724V|LRBA_ENST00000535741.1_Missense_Mutation_p.I724V|LRBA_ENST00000510413.1_Missense_Mutation_p.I724V	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing	724						cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					AGTTTGTAGATAACACTGAAT	0.279													T|||	48	0.00958466	0.0008	0.0173	5008	,	,		13099	0.0		0.0159	False		,,,				2504	0.0194				p.I724V		.											.	LRBA-157	0			c.A2170G						.	T	VAL/ILE,VAL/ILE	26,4380	31.7+/-61.6	0,26,2177	69.0	69.0	69.0		2170,2170	4.6	1.0	4	dbSNP_130	69	263,8337	101.2+/-162.5	3,257,4040	yes	missense,missense	LRBA	NM_001199282.2,NM_006726.4	29,29	3,283,6217	CC,CT,TT		3.0581,0.5901,2.2221	benign,benign	724/2864,724/2864	151793903	289,12717	2203	4300	6503	SO:0001583	missense	987	exon18			TGTAGATAACACT	AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.2170A>G	4.37:g.151793903T>C	ENSP00000349629:p.Ile724Val	Somatic	88	0		WXS	Illumina GAIIx	Phase_I	94	5	NM_006726	0	0	0	0	0	Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	Missense_Mutation	SNP	ENST00000357115.3	37	CCDS3773.1	21	0.009615384615384616	0	0.0	8	0.022099447513812154	0	0.0	13	0.017150395778364115	T	9.446	1.089271	0.20390	0.005901	0.030581	ENSG00000198589	ENST00000535741;ENST00000510413;ENST00000357115;ENST00000507224	T;T;T;T	0.66638	-0.22;-0.22;-0.22;-0.22	5.81	4.6	0.57074	Armadillo-like helical (1);Armadillo-type fold (1);	0.311295	0.30667	N	0.009136	T	0.21145	0.0509	N	0.17312	0.475	0.34945	D	0.750677	B;B	0.06786	0.0;0.001	B;B	0.04013	0.001;0.001	T	0.33777	-0.9855	10	0.24483	T	0.36	.	5.4566	0.16594	0.0:0.1452:0.1555:0.6992	.	724;724	P50851;P50851-2	LRBA_HUMAN;.	V	724	ENSP00000446299:I724V;ENSP00000421552:I724V;ENSP00000349629:I724V;ENSP00000422180:I724V	ENSP00000349629:I724V	I	-	1	0	LRBA	152013353	0.735000	0.28153	1.000000	0.80357	0.981000	0.71138	1.086000	0.30853	0.993000	0.38866	0.477000	0.44152	ATC	T|0.983;C|0.017		0.279	LRBA-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364939.1		
LRRC14B	389257	hgsc.bcm.edu	37	5	191992	191992	+	Silent	SNP	G	G	A	rs34710524	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr5:191992G>A	ENST00000328278.3	+	1	367	c.339G>A	c.(337-339)acG>acA	p.T113T		NM_001080478.1	NP_001073947.1	A6NHZ5	LR14B_HUMAN	leucine rich repeat containing 14B	113										endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|skin(1)|upper_aerodigestive_tract(2)	10						CTGACCTCACGGGCATCCGAG	0.741													G|||	110	0.0219649	0.0023	0.0346	5008	,	,		13465	0.0		0.0746	False		,,,				2504	0.0082				p.T113T		.											.	LRRC14B-69	0			c.G339A						.	G		35,2869		0,35,1417	2.0	3.0	2.0		339	-10.1	0.0	5	dbSNP_126	2	366,5908		2,362,2773	no	coding-synonymous	LRRC14B	NM_001080478.1		2,397,4190	AA,AG,GG		5.8336,1.2052,4.3691		113/515	191992	401,8777	1452	3137	4589	SO:0001819	synonymous_variant	389257	exon1			CCTCACGGGCATC		CCDS47184.1	5p15.33	2010-02-17			ENSG00000185028	ENSG00000185028			37268	protein-coding gene	gene with protein product							Standard	NM_001080478		Approved		uc003jal.1	A6NHZ5	OTTHUMG00000161578	ENST00000328278.3:c.339G>A	5.37:g.191992G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	21	20	NM_001080478	0	0	0	0	0		Silent	SNP	ENST00000328278.3	37	CCDS47184.1																																																																																			G|0.975;A|0.025		0.741	LRRC14B-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000365393.2	NM_001080478	
ZDHHC11	79844	bcgsc.ca	37	5	801252	801252	+	Missense_Mutation	SNP	C	C	T	rs142091140	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr5:801252C>T	ENST00000283441.8	-	12	1592	c.1209G>A	c.(1207-1209)atG>atA	p.M403I	ZDHHC11_ENST00000424784.2_Missense_Mutation_p.M403I|ZDHHC11_ENST00000503758.2_5'UTR	NM_024786.2	NP_079062.1	Q9H8X9	ZDH11_HUMAN	zinc finger, DHHC-type containing 11	403						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)	p.M403I(2)		haematopoietic_and_lymphoid_tissue(1)|liver(1)|lung(10)|pancreas(1)|prostate(5)|skin(2)|urinary_tract(1)	21			Epithelial(17;0.000445)|all cancers(22;0.00176)|OV - Ovarian serous cystadenocarcinoma(19;0.00227)|Lung(60;0.0863)			TGTCAGTTTTCATGGGCTCTG	0.413																																					p.M403I		.											.	ZDHHC11-92	2	Substitution - Missense(2)	prostate(2)	c.G1209A						.	C	ILE/MET	6,4398		0,6,2196	147.0	108.0	121.0		1209	-0.4	0.0	5	dbSNP_134	121	6,8584		0,6,4289	no	missense	ZDHHC11	NM_024786.2	10	0,12,6485	TT,TC,CC		0.0698,0.1362,0.0924	benign	403/413	801252	12,12982	2202	4295	6497	SO:0001583	missense	79844	exon12			AGTTTTCATGGGC	AK023215	CCDS3857.1	5p15.2	2011-02-09			ENSG00000188818	ENSG00000188818		"""Zinc fingers, DHHC-type"""	19158	protein-coding gene	gene with protein product							Standard	NM_024786		Approved	ZNF399, FLJ13153	uc011cma.1	Q9H8X9	OTTHUMG00000090319	ENST00000283441.8:c.1209G>A	5.37:g.801252C>T	ENSP00000283441:p.Met403Ile	Somatic	83	1		WXS	Illumina GAIIx	Phase_I	237	18	NM_024786	0	0	3	3	0	Q6UWR9	Missense_Mutation	SNP	ENST00000283441.8	37	CCDS3857.1	.	.	.	.	.	.	.	.	.	.	N	6.779	0.512644	0.12944	0.001362	6.98E-4	ENSG00000188818	ENST00000424784;ENST00000283441	T;T	0.36520	1.25;1.25	1.57	-0.362	0.12560	.	.	.	.	.	T	0.14098	0.0341	N	0.08118	0	0.09310	N	1	B	0.18968	0.032	B	0.09377	0.004	T	0.29549	-1.0008	9	0.14656	T	0.56	-9.9532	3.9839	0.09507	0.0:0.5594:0.0:0.4406	.	403	Q9H8X9	ZDH11_HUMAN	I	403	ENSP00000397719:M403I;ENSP00000283441:M403I	ENSP00000283441:M403I	M	-	3	0	ZDHHC11	854252	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.366000	0.07563	-0.120000	0.11809	0.384000	0.25694	ATG	C|0.999;T|0.001		0.413	ZDHHC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206681.3	NM_024786	
ADAMTS16	170690	hgsc.bcm.edu	37	5	5140632	5140632	+	Silent	SNP	T	T	C	rs270208	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr5:5140632T>C	ENST00000274181.7	+	1	190	c.52T>C	c.(52-54)Ttg>Ctg	p.L18L	CTD-2297D10.2_ENST00000512155.1_RNA|CTD-2297D10.1_ENST00000514848.1_RNA|ADAMTS16_ENST00000511368.1_Silent_p.L18L	NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	18					branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						GTGGATGCTGTTGGCGCAGGT	0.766													C|||	3127	0.624401	0.6747	0.6571	5008	,	,		8861	0.8065		0.501	False		,,,				2504	0.4724				p.L18L		.											.	ADAMTS16-275	0			c.T52C						.	C		2046,874		775,496,189	2.0	5.0	4.0		52	1.2	1.0	5	dbSNP_79	4	3653,3047		1121,1411,818	no	coding-synonymous	ADAMTS16	NM_139056.2		1896,1907,1007	CC,CT,TT		45.4776,29.9315,40.7588		18/1225	5140632	5699,3921	1460	3350	4810	SO:0001819	synonymous_variant	170690	exon1			ATGCTGTTGGCGC	AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.52T>C	5.37:g.5140632T>C		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_139056	0	0	0	0	0	C6G490|Q8IVE2	Silent	SNP	ENST00000274181.7	37	CCDS43299.1																																																																																			T|0.352;C|0.648		0.766	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365657.1	NM_139056	
TRIO	7204	bcgsc.ca	37	5	14420027	14420027	+	Silent	SNP	A	A	C	rs30612	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr5:14420027A>C	ENST00000344204.4	+	34	5124	c.5100A>C	c.(5098-5100)acA>acC	p.T1700T	TRIO_ENST00000537187.1_Silent_p.T1700T	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	1700	SH3 1. {ECO:0000255|PROSITE- ProRule:PRU00192}.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					TGGTGCGGACAACTGACCGCT	0.607													C|||	4100	0.81869	0.9864	0.8271	5008	,	,		19832	0.6984		0.8757	False		,,,				2504	0.6513				p.T1700T		.											.	TRIO-562	0			c.A5100C						.	C		4244,162	109.1+/-147.4	2041,162,0	50.0	46.0	47.0		5100	4.2	1.0	5	dbSNP_76	47	7409,1191	241.9+/-272.1	3186,1037,77	no	coding-synonymous	TRIO	NM_007118.2		5227,1199,77	CC,CA,AA		13.8488,3.6768,10.4029		1700/3098	14420027	11653,1353	2203	4300	6503	SO:0001819	synonymous_variant	7204	exon34			GCGGACAACTGAC	AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.5100A>C	5.37:g.14420027A>C		Somatic	303	2		WXS	Illumina GAIIx	Phase_I	326	8	NM_007118	0	0	3	3	0	D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Silent	SNP	ENST00000344204.4	37	CCDS3883.1																																																																																			A|0.129;C|0.871		0.607	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253711.2	NM_007118	
C7	730	broad.mit.edu;ucsc.edu	37	5	40959605	40959605	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr5:40959605G>A	ENST00000313164.9	+	12	1903	c.1544G>A	c.(1543-1545)gGg>gAg	p.G515E		NM_000587.2	NP_000578.2	P10643	CO7_HUMAN	complement component 7	515	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cellular sodium ion homeostasis (GO:0006883)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)							Ovarian(839;0.0112)				TGTGTCCAAGGGAAGAAAACA	0.502																																					p.G515E		.											.	C7-22	0			c.G1544A						.						54.0	60.0	58.0					5																	40959605		1897	4108	6005	SO:0001583	missense	730	exon12			TCCAAGGGAAGAA	J03507	CCDS47201.1	5p13.1	2014-09-17			ENSG00000112936	ENSG00000112936		"""Complement system"""	1346	protein-coding gene	gene with protein product		217070					Standard	NM_000587		Approved		uc003jmh.3	P10643	OTTHUMG00000150340	ENST00000313164.9:c.1544G>A	5.37:g.40959605G>A	ENSP00000322061:p.Gly515Glu	Somatic	111	2		WXS	Illumina GAIIx	Phase_I	190	32	NM_000587	0	0	160	238	78	Q6P3T5|Q92489	Missense_Mutation	SNP	ENST00000313164.9	37	CCDS47201.1	.	.	.	.	.	.	.	.	.	.	G	19.57	3.851582	0.71719	.	.	ENSG00000112936	ENST00000313164;ENST00000440677	D	0.83673	-1.75	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	D	0.90300	0.6966	M	0.87038	2.855	0.54753	D	0.999989	D	0.61080	0.989	P	0.60345	0.873	D	0.91296	0.5063	10	0.62326	D	0.03	-15.4759	12.7469	0.57285	0.0793:0.0:0.9207:0.0	.	515	P10643	CO7_HUMAN	E	515;355	ENSP00000322061:G515E	ENSP00000322061:G515E	G	+	2	0	C7	40995362	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	4.110000	0.57831	2.593000	0.87608	0.462000	0.41574	GGG	.		0.502	C7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317680.1		
GPR98	84059	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	89986640	89986640	+	Nonsense_Mutation	SNP	G	G	T			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr5:89986640G>T	ENST00000405460.2	+	31	6829	c.6733G>T	c.(6733-6735)Gag>Tag	p.E2245*		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	2245	Calx-beta 16. {ECO:0000255}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		ACTTATTGTAGAGGAACCTGA	0.403																																					p.E2245X		.											.	GPR98-103	0			c.G6733T						.						44.0	42.0	42.0					5																	89986640		1863	4091	5954	SO:0001587	stop_gained	84059	exon31			ATTGTAGAGGAAC	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.6733G>T	5.37:g.89986640G>T	ENSP00000384582:p.Glu2245*	Somatic	98	0		WXS	Illumina GAIIx	Phase_I	126	41	NM_032119	0	0	0	0	0	O75171|Q8TF58|Q9H0X5|Q9UL61	Nonsense_Mutation	SNP	ENST00000405460.2	37	CCDS47246.1	.	.	.	.	.	.	.	.	.	.	G	49	15.234895	0.99827	.	.	ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000399043	.	.	.	5.99	5.99	0.97316	.	0.088216	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	.	15.9647	0.79961	0.0:0.134:0.866:0.0	.	.	.	.	X	2245	.	ENSP00000296619:E2245X	E	+	1	0	GPR98	90022396	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.801000	0.85960	2.850000	0.98022	0.650000	0.86243	GAG	.		0.403	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119	
SOWAHA	134548	hgsc.bcm.edu	37	5	132149684	132149684	+	Missense_Mutation	SNP	G	G	C	rs40274	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr5:132149684G>C	ENST00000378693.2	+	1	652	c.371G>C	c.(370-372)cGg>cCg	p.R124P		NM_175873.4	NP_787069.3	Q2M3V2	SWAHA_HUMAN	sosondowah ankyrin repeat domain family member A	124	Pro-rich.		R -> P (in dbSNP:rs40274).														CCCTTGGTCCGGGTGCCGCGG	0.776																																					p.R124P		.											.	.	0			c.G371C						.	C	PRO/ARG	2599,13		1293,13,0	2.0	3.0	3.0		371	-0.3	0.0	5	dbSNP_76	3	6177,193		2993,191,1	no	missense	ANKRD43	NM_175873.4	103	4286,204,1	CC,CG,GG		3.0298,0.4977,2.2935	benign	124/550	132149684	8776,206	1306	3185	4491	SO:0001583	missense	134548	exon1			TGGTCCGGGTGCC	AK090823	CCDS43361.1	5q23.3	2013-01-10	2012-01-12	2012-01-12	ENSG00000198944	ENSG00000198944		"""Ankyrin repeat domain containing"""	27033	protein-coding gene	gene with protein product			"""ankyrin repeat domain 43"""	ANKRD43		22234889	Standard	NM_175873		Approved		uc003kxw.3	Q2M3V2	OTTHUMG00000059844	ENST00000378693.2:c.371G>C	5.37:g.132149684G>C	ENSP00000367965:p.Arg124Pro	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_175873	0	0	0	0	0	Q8NAE7	Missense_Mutation	SNP	ENST00000378693.2	37	CCDS43361.1	2142	0.9807692307692307	482	0.9796747967479674	357	0.9861878453038674	562	0.9825174825174825	741	0.9775725593667546	c	9.833	1.188835	0.21954	0.995023	0.969702	ENSG00000198944	ENST00000378693	T	0.38077	1.16	4.27	-0.265	0.12946	.	2.345400	0.02245	N	0.066177	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.36261	-0.9755	9	0.30078	T	0.28	-5.2019	3.6102	0.08057	0.2245:0.4439:0.2467:0.085	rs40274	124	Q2M3V2	ANR43_HUMAN	P	124	ENSP00000367965:R124P	ENSP00000367965:R124P	R	+	2	0	ANKRD43	132177583	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.768000	0.01794	-0.003000	0.14444	-3.153000	0.00058	CGG	G|0.980;C|0.020		0.776	SOWAHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133062.1	NM_175873	
SLC23A1	9963	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	138714364	138714364	+	Silent	SNP	G	G	A			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr5:138714364G>A	ENST00000348729.3	-	10	1129	c.1083C>T	c.(1081-1083)ttC>ttT	p.F361F	SLC23A1_ENST00000503919.1_5'Flank|SLC23A1_ENST00000353963.3_Silent_p.F365F	NM_005847.4	NP_005838	Q9UHI7	S23A1_HUMAN	solute carrier family 23 (ascorbic acid transporter), member 1	361					brain development (GO:0007420)|dehydroascorbic acid transport (GO:0070837)|L-ascorbic acid metabolic process (GO:0019852)|L-ascorbic acid transport (GO:0015882)|lung development (GO:0030324)|nucleobase transport (GO:0015851)|nucleobase-containing compound metabolic process (GO:0006139)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transepithelial L-ascorbic acid transport (GO:0070904)|vitamin metabolic process (GO:0006766)|vitamin transmembrane transport (GO:0035461)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|brush border (GO:0005903)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular organelle (GO:0043229)|membrane (GO:0016020)|plasma membrane (GO:0005886)	dehydroascorbic acid transporter activity (GO:0033300)|L-ascorbate:sodium symporter activity (GO:0008520)|L-ascorbic acid transporter activity (GO:0015229)|nucleobase transmembrane transporter activity (GO:0015205)|sodium ion transmembrane transporter activity (GO:0015081)|sodium-dependent L-ascorbate transmembrane transporter activity (GO:0070890)			biliary_tract(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|liver(2)|lung(5)|ovary(1)	19			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)		Vitamin C(DB00126)	TGCCTTCGGTGAAGATGCCCC	0.592																																					p.F365F		.											.	SLC23A1-90	0			c.C1095T						.						55.0	45.0	49.0					5																	138714364		2203	4299	6502	SO:0001819	synonymous_variant	9963	exon10			TTCGGTGAAGATG	AF058317	CCDS4212.1, CCDS4213.1	5q31.2	2013-07-18	2013-07-18	2003-03-21	ENSG00000170482	ENSG00000170482		"""Solute carriers"""	10974	protein-coding gene	gene with protein product		603790	"""solute carrier family 23 (nucleobase transporters), member 2"""	SLC23A2		9804989, 10331392	Standard	NM_005847		Approved	YSPL3, SVCT1	uc003leg.3	Q9UHI7	OTTHUMG00000129228	ENST00000348729.3:c.1083C>T	5.37:g.138714364G>A		Somatic	157	0		WXS	Illumina GAIIx	Phase_I	239	24	NM_152685	0	0	0	0	0	O95191|Q8WWB6|Q9UGH4|Q9UI39	Silent	SNP	ENST00000348729.3	37	CCDS4212.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.988|9.988	1.230069|1.230069	0.22542|0.22542	.|.	.|.	ENSG00000170482|ENSG00000170482	ENST00000504513|ENST00000453898	.|.	.|.	.|.	4.71|4.71	1.75|1.75	0.24633|0.24633	.|.	.|.	.|.	.|.	.|.	T|T	0.31575|0.31575	0.0801|0.0801	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.04509|0.04509	-1.0946|-1.0946	4|5	.|0.08599	.|T	.|0.76	-8.1865|-8.1865	5.49|5.49	0.16771|0.16771	0.4934:0.0:0.5066:0.0|0.4934:0.0:0.5066:0.0	.|.	.|.	.|.	.|.	Y|L	108|316	.|.	.|ENSP00000406720:S316L	H|S	-|-	1|2	0|0	SLC23A1|SLC23A1	138742263|138742263	1.000000|1.000000	0.71417|0.71417	0.993000|0.993000	0.49108|0.49108	0.968000|0.968000	0.65278|0.65278	1.201000|1.201000	0.32259|0.32259	0.599000|0.599000	0.29845|0.29845	0.561000|0.561000	0.74099|0.74099	CAC|TCA	.		0.592	SLC23A1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000374185.1	NM_152685	
NRG2	9542	hgsc.bcm.edu	37	5	139422602	139422602	+	Missense_Mutation	SNP	C	C	T	rs188534354	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr5:139422602C>T	ENST00000361474.1	-	1	277	c.53G>A	c.(52-54)cGg>cAg	p.R18Q	NRG2_ENST00000358522.3_Missense_Mutation_p.R18Q|NRG2_ENST00000289422.7_Missense_Mutation_p.R18Q|NRG2_ENST00000545385.1_Missense_Mutation_p.R18Q|NRG2_ENST00000289409.4_Missense_Mutation_p.R18Q|NRG2_ENST00000541337.1_Missense_Mutation_p.R18Q|NRG2_ENST00000394770.1_Missense_Mutation_p.R18Q	NM_004883.2	NP_004874.1	O14511	NRG2_HUMAN	neuregulin 2	18					embryo development (GO:0009790)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	25			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			gctgctgcACCGACCCTTCTC	0.701													C|||	11	0.00219649	0.0008	0.0072	5008	,	,		10461	0.0		0.005	False		,,,				2504	0.0				p.R18Q		.											.	NRG2-526	0			c.G53A						.	C	GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG	0,3008		0,0,1504	4.0	5.0	5.0		53,53,53,53,53	-2.4	1.0	5		5	9,6245		0,9,3118	no	missense,missense,missense,missense,missense	NRG2	NM_013983.2,NM_013982.2,NM_013981.3,NM_004883.2,NM_001184935.1	43,43,43,43,43	0,9,4622	TT,TC,CC		0.1439,0.0,0.0972	benign,benign,benign,benign,benign	18/853,18/859,18/845,18/851,18/785	139422602	9,9253	1504	3127	4631	SO:0001583	missense	9542	exon1			CTGCACCGACCCT		CCDS4217.1, CCDS54910.1	5q23-q33	2013-01-11			ENSG00000158458	ENSG00000158458		"""Immunoglobulin superfamily / I-set domain containing"""	7998	protein-coding gene	gene with protein product	"""neural- and thymus-derived activator for ErbB kinases"", ""divergent of neuregulin-1"""	603818				9168114, 9168115	Standard	NM_004883		Approved	Don-1, NTAK, HRG2	uc003lev.2	O14511	OTTHUMG00000129241	ENST00000361474.1:c.53G>A	5.37:g.139422602C>T	ENSP00000354910:p.Arg18Gln	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	22	14	NM_013982	0	0	2	8	6		Missense_Mutation	SNP	ENST00000361474.1	37	CCDS4217.1	16	0.007326007326007326	10	0.02032520325203252	1	0.0027624309392265192	0	0.0	5	0.006596306068601583	C	14.46	2.542008	0.45280	0.0	0.001439	ENSG00000158458	ENST00000541337;ENST00000289422;ENST00000361474;ENST00000446269;ENST00000545385;ENST00000394770;ENST00000289409;ENST00000358522;ENST00000378238	T;T;T;T;T;T;T;T	0.75821	-0.72;-0.76;-0.72;-0.76;-0.97;-0.97;-0.76;-0.97	3.88	-2.44	0.06502	.	.	.	.	.	T	0.39145	0.1067	N	0.08118	0	0.27621	N	0.948338	B;B;B;B	0.23891	0.093;0.056;0.093;0.093	B;B;B;B	0.23275	0.045;0.02;0.045;0.045	T	0.27262	-1.0079	9	0.41790	T	0.15	-5.1631	16.7016	0.85350	0.0:0.3488:0.6512:0.0	.	18;18;18;18	O14511-2;O14511;O14511-4;O14511-3	.;NRG2_HUMAN;.;.	Q	18	ENSP00000444235:R18Q;ENSP00000289422:R18Q;ENSP00000354910:R18Q;ENSP00000438753:R18Q;ENSP00000378251:R18Q;ENSP00000289409:R18Q;ENSP00000351323:R18Q;ENSP00000367483:R18Q	ENSP00000289409:R18Q	R	-	2	0	NRG2	139402786	0.998000	0.40836	0.996000	0.52242	0.989000	0.77384	0.158000	0.16422	-0.236000	0.09753	0.491000	0.48974	CGG	C|0.993;T|0.007		0.701	NRG2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251340.1	NM_013982	
PCDHGA3	56112	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	5	140737208	140737208	+	Intron	SNP	G	G	A			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr5:140737208G>A	ENST00000253812.6	+	1	2424				PCDHGA1_ENST00000517417.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB2_ENST00000522605.1_5'Flank	NM_018916.3|NM_032011.1	NP_061739.2|NP_114400.1	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3						homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCTTATAATAGATCATACCAC	0.333																																					p.R814K		.											.	.	0			c.G2441A						.						33.0	34.0	34.0					5																	140737208		2018	4186	6204	SO:0001627	intron_variant	56111	exon1			ATAATAGATCATA	AF152510	CCDS47290.1, CCDS75329.1	5q31	2010-01-26			ENSG00000254245	ENSG00000254245		"""Cadherins / Protocadherins : Clustered"""	8701	other	protocadherin		606290				10380929	Standard	NM_032011		Approved	PCDH-GAMMA-A3		Q9Y5H0	OTTHUMG00000163680	ENST00000253812.6:c.2424+11184G>A	5.37:g.140737208G>A		Somatic	125	0		WXS	Illumina GAIIx	Phase_I	103	17	NM_032053	0	0	0	0	0	Q9Y5D4	Missense_Mutation	SNP	ENST00000253812.6	37	CCDS47290.1																																																																																			.		0.333	PCDHGA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377017.1	NM_018916	
SLC26A2	1836	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	149360104	149360104	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr5:149360104G>C	ENST00000286298.4	+	3	1216	c.948G>C	c.(946-948)ttG>ttC	p.L316F		NM_000112.3	NP_000103.2	P50443	S26A2_HUMAN	solute carrier family 26 (anion exchanger), member 2	316					3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|ion transport (GO:0006811)|ossification (GO:0001503)|small molecule metabolic process (GO:0044281)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)|xenobiotic metabolic process (GO:0006805)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(1)|prostate(2)|stomach(1)	18			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			TGGTTCTTTTGCCAACCAAAG	0.418																																					p.L316F		.											.	SLC26A2-90	0			c.G948C						.						121.0	113.0	116.0					5																	149360104		2203	4300	6503	SO:0001583	missense	1836	exon3			TCTTTTGCCAACC	U14528	CCDS4300.1	5q31-q34	2014-09-17	2013-07-18		ENSG00000155850	ENSG00000155850		"""Solute carriers"""	10994	protein-coding gene	gene with protein product		606718	"""solute carrier family 26 (sulfate transporter), member 2"""	DTD		7923357	Standard	NM_000112		Approved	DTDST	uc003lrh.3	P50443	OTTHUMG00000130054	ENST00000286298.4:c.948G>C	5.37:g.149360104G>C	ENSP00000286298:p.Leu316Phe	Somatic	83	0		WXS	Illumina GAIIx	Phase_I	108	48	NM_000112	0	0	8	15	7	A8K2U3|B2R6J1|Q6N051	Missense_Mutation	SNP	ENST00000286298.4	37	CCDS4300.1	.	.	.	.	.	.	.	.	.	.	G	13.81	2.347635	0.41599	.	.	ENSG00000155850	ENST00000286298	D	0.94092	-3.35	5.51	3.62	0.41486	Sulphate transporter (1);	0.416682	0.25971	N	0.027135	D	0.91345	0.7270	N	0.26130	0.795	0.29543	N	0.851914	P	0.42620	0.785	P	0.57720	0.826	D	0.85767	0.1353	10	0.46703	T	0.11	.	4.5081	0.11898	0.086:0.2392:0.5512:0.1237	.	316	P50443	S26A2_HUMAN	F	316	ENSP00000286298:L316F	ENSP00000286298:L316F	L	+	3	2	SLC26A2	149340297	1.000000	0.71417	0.995000	0.50966	0.987000	0.75469	0.561000	0.23515	1.321000	0.45227	0.585000	0.79938	TTG	.		0.418	SLC26A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252333.2	NM_000112	
PPP1R3G	648791	hgsc.bcm.edu	37	6	5086070	5086070	+	Silent	SNP	A	A	G	rs667752		TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr6:5086070A>G	ENST00000405617.2	+	1	351	c.351A>G	c.(349-351)gcA>gcG	p.A117A		NM_001145115.1	NP_001138587.1	B7ZBB8	PP13G_HUMAN	protein phosphatase 1, regulatory subunit 3G	117					glucose homeostasis (GO:0042593)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of glycogen biosynthetic process (GO:0045725)	cytoplasm (GO:0005737)	glycogen binding (GO:2001069)			kidney(2)	2						CGGAGGACGCACAGCTCGGCC	0.692													G|||	5008	1.0	1.0	1.0	5008	,	,		12505	1.0		1.0	False		,,,				2504	1.0				p.A117A		.											.	PPP1R3G-136	0			c.A351G						.						1.0	2.0	2.0					6																	5086070		400	1062	1462	SO:0001819	synonymous_variant	648791	exon1			GGACGCACAGCTC		CCDS47366.1	6p25.1	2012-04-17	2011-10-04		ENSG00000219607	ENSG00000219607		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14945	protein-coding gene	gene with protein product			"""protein phosphatase 1, regulatory (inhibitor) subunit 3G"""			11948623	Standard	NM_001145115		Approved		uc011dia.1	B7ZBB8	OTTHUMG00000014172	ENST00000405617.2:c.351A>G	6.37:g.5086070A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	17	17	NM_001145115	0	0	0	26	26		Silent	SNP	ENST00000405617.2	37	CCDS47366.1																																																																																			A|0.006;G|0.994		0.692	PPP1R3G-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039740.3	NM_001145115	
LINC00518	221718	bcgsc.ca	37	6	10430171	10430171	+	lincRNA	SNP	T	T	C	rs303061	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr6:10430171T>C	ENST00000496285.1	-	0	864					NR_027793.1		Q8N0U6	CF218_HUMAN	long intergenic non-protein coding RNA 518									p.Y106C(1)									TGGTAGAAAGTACCAGAGACA	0.463											OREG0017184	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	C|||	1376	0.27476	0.2428	0.183	5008	,	,		20302	0.2966		0.2097	False		,,,				2504	0.4274				.		.											.	.	1	Substitution - Missense(1)	stomach(1)	.						.	C		1012,3394	729.6+/-410.1	109,794,1300	140.0	146.0	144.0			-7.8	0.0	6	dbSNP_79	144	2028,6572	720.9+/-406.3	228,1572,2500	no	intergenic				337,2366,3800	CC,CT,TT		23.5814,22.9687,23.3738			10430171	3040,9966	2203	4300	6503			221718	.			AGAAAGTACCAGA	BC028118		6p24.3	2014-06-18	2011-11-25	2011-11-25	ENSG00000183674	ENSG00000183674		"""Long non-coding RNAs"""	28626	non-coding RNA	RNA, long non-coding			"""chromosome 6 open reading frame 218"""	C6orf218		12477932, 24906614	Standard	NR_027793		Approved	MGC40222	uc003myz.2	Q8N0U6	OTTHUMG00000159175		6.37:g.10430171T>C		Somatic	115	0	664	WXS	Illumina GAIIx	Phase_I	136	6	.	0	0	0	0	0		RNA	SNP	ENST00000496285.1	37																																																																																				T|0.756;C|0.244		0.463	LINC00518-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000353699.1	NR_027793	
HIST1H3H	8357	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	27777856	27777856	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr6:27777856C>G	ENST00000369163.2	+	1	15	c.5C>G	c.(4-6)gCg>gGg	p.A2G	HIST1H2BL_ENST00000377401.2_5'Flank	NM_003536.2	NP_003527.1	P68431	H31_HUMAN	histone cluster 1, H3h	2					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			haematopoietic_and_lymphoid_tissue(1)|lung(4)|ovary(2)|upper_aerodigestive_tract(3)	10						GAAGGCATGGCGCGTACGAAG	0.577																																					p.A2G		.											.	HIST1H3H-45	0			c.C5G						.						40.0	44.0	43.0					6																	27777856		2200	4299	6499	SO:0001583	missense	8357	exon1			GCATGGCGCGTAC	Z83735	CCDS4627.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000203813	ENSG00000278828		"""Histones / Replication-dependent"""	4775	protein-coding gene	gene with protein product		602818	"""H3 histone family, member K"", ""histone 1, H3h"""	H3FK		9439656, 12408966	Standard	NM_003536		Approved	H3/k, H3F1K	uc003njm.3	P68431	OTTHUMG00000014483	ENST00000369163.2:c.5C>G	6.37:g.27777856C>G	ENSP00000358160:p.Ala2Gly	Somatic	80	0		WXS	Illumina GAIIx	Phase_I	240	52	NM_003536	0	0	3	3	0	A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	ENST00000369163.2	37	CCDS4627.1	.	.	.	.	.	.	.	.	.	.	.	14.21	2.468441	0.43839	.	.	ENSG00000203813	ENST00000369163	T	0.50813	0.73	4.18	4.18	0.49190	.	.	.	.	.	T	0.57844	0.2081	.	.	.	0.42331	D	0.992298	.	.	.	.	.	.	T	0.65245	-0.6215	6	0.87932	D	0	.	16.3581	0.83244	0.0:1.0:0.0:0.0	.	.	.	.	G	2	ENSP00000358160:A2G	ENSP00000358160:A2G	A	+	2	0	HIST1H3H	27885835	1.000000	0.71417	0.941000	0.38009	0.006000	0.05464	7.373000	0.79623	2.258000	0.74832	0.655000	0.94253	GCG	.		0.577	HIST1H3H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040151.1	NM_003536	
ABCF1	23	broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	30557635	30557635	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr6:30557635C>T	ENST00000326195.8	+	22	2229	c.2117C>T	c.(2116-2118)aCg>aTg	p.T706M	ABCF1_ENST00000376545.3_Missense_Mutation_p.T668M|ABCF1_ENST00000396515.4_Intron	NM_001025091.1	NP_001020262.1	Q8NE71	ABCF1_HUMAN	ATP-binding cassette, sub-family F (GCN20), member 1	706	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				inflammatory response (GO:0006954)|positive regulation of translation (GO:0045727)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|polysomal ribosome (GO:0042788)|ribosome (GO:0005840)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|poly(A) RNA binding (GO:0044822)|ribosome binding (GO:0043022)|translation activator activity (GO:0008494)|translation factor activity, nucleic acid binding (GO:0008135)			breast(2)|endometrium(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(3)|skin(2)	21						ATGGAGGAGACGCCCACTGAG	0.602																																					p.T706M		.											.	ABCF1-92	0			c.C2117T						.						96.0	104.0	101.0					6																	30557635		1511	2709	4220	SO:0001583	missense	23	exon22			AGGAGACGCCCAC	AF027302	CCDS34380.1, CCDS34381.1	6p21.33	2012-03-14			ENSG00000204574	ENSG00000204574		"""ATP binding cassette transporters / subfamily F"""	70	protein-coding gene	gene with protein product		603429		ABC50		9790762	Standard	NM_001025091		Approved	EST123147	uc003nql.3	Q8NE71	OTTHUMG00000031094	ENST00000326195.8:c.2117C>T	6.37:g.30557635C>T	ENSP00000313603:p.Thr706Met	Somatic	118	1		WXS	Illumina GAIIx	Phase_I	154	47	NM_001025091	0	0	30	61	31	A2BF75|O14897|Q69YP6	Missense_Mutation	SNP	ENST00000326195.8	37	CCDS34380.1	.	.	.	.	.	.	.	.	.	.	c	28.5	4.921841	0.92319	.	.	ENSG00000204574	ENST00000326195;ENST00000376545	D;D	0.95205	-3.64;-3.64	5.94	5.94	0.96194	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.047152	0.85682	D	0.000000	D	0.97467	0.9171	M	0.85373	2.75	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.77004	0.989;0.982	D	0.97607	1.0127	10	0.87932	D	0	-19.5814	19.1419	0.93449	0.0:1.0:0.0:0.0	.	668;706	Q2L6I2;Q8NE71	.;ABCF1_HUMAN	M	706;668	ENSP00000313603:T706M;ENSP00000365728:T668M	ENSP00000313603:T706M	T	+	2	0	ABCF1	30665614	1.000000	0.71417	0.998000	0.56505	0.945000	0.59286	7.067000	0.76741	2.821000	0.97095	0.651000	0.88453	ACG	.		0.602	ABCF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076137.3		
PPP1R18	170954	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	30652252	30652252	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr6:30652252A>G	ENST00000274853.3	-	1	3420	c.1544T>C	c.(1543-1545)cTg>cCg	p.L515P	PPP1R18_ENST00000488324.1_5'UTR|PPP1R18_ENST00000399199.3_Missense_Mutation_p.L515P	NM_133471.3	NP_597728.1	Q6NYC8	PPR18_HUMAN	protein phosphatase 1, regulatory subunit 18	515						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)											GTAGCCCCCCAGAACCAAGAT	0.622																																					p.L515P		.											.	.	0			c.T1544C						.						51.0	55.0	54.0					6																	30652252		1222	2545	3767	SO:0001583	missense	170954	exon2			CCCCCCAGAACCA	AK097089	CCDS43444.1	6p21.3	2012-04-17	2011-10-11	2011-10-11	ENSG00000146112	ENSG00000146112		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29413	protein-coding gene	gene with protein product	"""protein phosphatase 1 F-actin cytoskeleton targeting subunit"""	610990	"""KIAA1949"""	KIAA1949		11853319	Standard	NM_001134870		Approved	phostensin	uc003nra.3	Q6NYC8	OTTHUMG00000031237	ENST00000274853.3:c.1544T>C	6.37:g.30652252A>G	ENSP00000274853:p.Leu515Pro	Somatic	91	0		WXS	Illumina GAIIx	Phase_I	135	9	NM_001134870	1	0	39	42	2	A2AB01|A2AIB8|A4UBI6|A6NCB7|A8MSS7|B7ZCV7|Q68CK8|Q6ZTV1|Q6ZUJ6|Q8NDQ4|Q8TF52|Q9BRL9	Missense_Mutation	SNP	ENST00000274853.3	37	CCDS43444.1	.	.	.	.	.	.	.	.	.	.	A	18.64	3.667445	0.67814	.	.	ENSG00000146112	ENST00000274853;ENST00000399199	T;T	0.27890	1.64;1.64	4.52	4.52	0.55395	.	0.236224	0.27447	N	0.019327	T	0.37183	0.0994	L	0.51422	1.61	0.58432	D	0.999999	D	0.76494	0.999	D	0.74348	0.983	T	0.26780	-1.0093	10	0.72032	D	0.01	-1.1683	11.4972	0.50415	1.0:0.0:0.0:0.0	.	515	Q6NYC8	PPR18_HUMAN	P	515	ENSP00000274853:L515P;ENSP00000382150:L515P	ENSP00000274853:L515P	L	-	2	0	KIAA1949	30760231	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	6.093000	0.71422	1.909000	0.55274	0.533000	0.62120	CTG	.		0.622	PPP1R18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076498.2	NM_133471	
TNXB	7148	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	32023746	32023746	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr6:32023746C>A	ENST00000375244.3	-	24	8550	c.8349G>T	c.(8347-8349)agG>agT	p.R2783S	TNXB_ENST00000375247.2_Missense_Mutation_p.R2783S			P22105	TENX_HUMAN	tenascin XB	2841					actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						TCTCCTCGCCCCTGACACGCA	0.682																																					p.R2783S		.											.	TNXB-90	0			c.G8349T						.						58.0	64.0	62.0					6																	32023746		1261	2546	3807	SO:0001583	missense	7148	exon24			CTCGCCCCTGACA	X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.8349G>T	6.37:g.32023746C>A	ENSP00000364393:p.Arg2783Ser	Somatic	104	2		WXS	Illumina GAIIx	Phase_I	384	116	NM_019105	0	0	0	0	0	P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Missense_Mutation	SNP	ENST00000375244.3	37		.	.	.	.	.	.	.	.	.	.	C	2.826	-0.243789	0.05906	.	.	ENSG00000168477	ENST00000375244;ENST00000375247	T;T	0.03951	3.75;3.75	5.04	1.0	0.19881	.	.	.	.	.	T	0.00608	0.0020	N	0.11427	0.14	0.20307	N	0.999916	B	0.19331	0.035	B	0.22386	0.039	T	0.46034	-0.9220	9	0.07644	T	0.81	.	4.6157	0.12424	0.1464:0.5336:0.0:0.3199	.	2783	P22105-3	.	S	2783	ENSP00000364393:R2783S;ENSP00000364396:R2783S	ENSP00000364393:R2783S	R	-	3	2	TNXB	32131724	0.000000	0.05858	0.871000	0.34182	0.439000	0.31926	-1.604000	0.02076	0.115000	0.18071	0.462000	0.41574	AGG	.		0.682	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000268927.2	NM_019105	
NOTCH4	4855	broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	32166298	32166298	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr6:32166298C>A	ENST00000375023.3	-	26	4794	c.4656G>T	c.(4654-4656)tgG>tgT	p.W1552C	NOTCH4_ENST00000443903.2_5'Flank|GPSM3_ENST00000375043.3_5'Flank	NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4	1552					cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						CACTCAGAGACCAGAGCTGGC	0.587																																					p.W1552C		.											.	NOTCH4-1321	0			c.G4656T						.						83.0	63.0	70.0					6																	32166298		1511	2709	4220	SO:0001583	missense	4855	exon26			CAGAGACCAGAGC		CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.4656G>T	6.37:g.32166298C>A	ENSP00000364163:p.Trp1552Cys	Somatic	93	2		WXS	Illumina GAIIx	Phase_I	132	31	NM_004557	0	0	5	5	0	B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	Missense_Mutation	SNP	ENST00000375023.3	37	CCDS34420.1	.	.	.	.	.	.	.	.	.	.	C	14.70	2.614397	0.46631	.	.	ENSG00000204301	ENST00000375023	D	0.83250	-1.7	5.16	4.28	0.50868	.	0.170807	0.28618	N	0.014702	T	0.77824	0.4188	M	0.86028	2.79	0.80722	D	1	B;B	0.19706	0.038;0.011	B;B	0.23419	0.046;0.01	T	0.80384	-0.1405	10	0.87932	D	0	.	10.982	0.47499	0.1859:0.8141:0.0:0.0	.	1552;1551	Q99466;B0S882	NOTC4_HUMAN;.	C	1552	ENSP00000364163:W1552C	ENSP00000364163:W1552C	W	-	3	0	NOTCH4	32274276	0.987000	0.35691	0.976000	0.42696	0.611000	0.37282	1.909000	0.39917	1.396000	0.46663	0.561000	0.74099	TGG	.		0.587	NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076045.2		
SYNGAP1	8831	broad.mit.edu;bcgsc.ca|hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	33385930	33385931	+	5'Flank	DNP	GC	GC	AG			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	|C	|C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr6:33385930_33385931GC>AG	ENST00000418600.2	+	0	0				SYNGAP1_ENST00000293748.5_5'Flank|CUTA_ENST00000492510.1_5'UTR|CUTA_ENST00000440279.3_5'Flank|CUTA_ENST00000374496.3_5'Flank|CUTA_ENST00000607266.1_5'Flank|CUTA_ENST00000488478.1_5'Flank|CUTA_ENST00000494751.1_5'Flank|CUTA_ENST00000374500.5_Missense_Mutation_p.G11A|CUTA_ENST00000488034.1_5'Flank	NM_006772.2	NP_006763.2	Q96PV0	SYGP1_HUMAN	synaptic Ras GTPase activating protein 1						dendrite development (GO:0016358)|negative regulation of axonogenesis (GO:0050771)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|pattern specification process (GO:0007389)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|receptor clustering (GO:0043113)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of MAPK cascade (GO:0043408)|regulation of synapse structure and activity (GO:0050803)|regulation of synaptic plasticity (GO:0048167)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Rab GTPase activator activity (GO:0005097)|Ras GTPase activator activity (GO:0005099)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(15)|ovary(7)|pancreas(1)|stomach(1)|urinary_tract(1)	43						GACCACCTGCGCCTCCAGAGCC	0.574																																					p.G11G|p.G11A		.											.	CUTA-90	0			c.C33T|c.G32C						.																																			SO:0001631	upstream_gene_variant	51596	exon1			ACCTGCGCCTCCA|CCTGCGCCTCCAG	AB067525	CCDS34434.2	6p21.3	2010-06-25	2010-06-25		ENSG00000197283	ENSG00000197283			11497	protein-coding gene	gene with protein product		603384	"""synaptic Ras GTPase activating protein 1 homolog (rat)"""			9581761, 18323856	Standard	NM_006772		Approved	SYNGAP, RASA5, KIAA1938	uc011dri.2	Q96PV0	OTTHUMG00000031096	Exception_encountered	6.37:g.33385930_33385931delinsAG	Exception_encountered	Somatic	137|138	2|0		WXS	Illumina GAIIx	Phase_I	227|225	19|18	NM_001014433	1|0	2|0	9|7	12|7	0	A2AB17|A2BEL6|A2BEL7|A8MQC4|Q8TCS2|Q9UGE2	Silent|Missense_Mutation	SNP	ENST00000418600.2	37	CCDS34434.2																																																																																			.		0.574	SYNGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076151.4	XM_166407	
PPARD	5467	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	35388052	35388052	+	Silent	SNP	G	G	T			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr6:35388052G>T	ENST00000311565.4	+	5	628	c.279G>T	c.(277-279)ggG>ggT	p.G93G	PPARD_ENST00000360694.3_Silent_p.G93G|PPARD_ENST00000448077.2_Silent_p.G54G|PPARD_ENST00000418635.2_Intron|PPARD_ENST00000444397.1_Silent_p.G93G|PPARD_ENST00000337400.2_Silent_p.G93G|PPARD_ENST00000540939.1_Intron	NM_001171818.1	NP_001165289.1	Q03181	PPARD_HUMAN	peroxisome proliferator-activated receptor delta	93					adipose tissue development (GO:0060612)|anagen (GO:0042640)|apoptotic signaling pathway (GO:0097190)|axon ensheathment (GO:0008366)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cell-substrate adhesion (GO:0031589)|cellular response to hypoxia (GO:0071456)|cholesterol metabolic process (GO:0008203)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|fatty acid beta-oxidation (GO:0006635)|fatty acid catabolic process (GO:0009062)|fatty acid transport (GO:0015908)|gene expression (GO:0010467)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glucose transport (GO:0015758)|heart development (GO:0007507)|intracellular receptor signaling pathway (GO:0030522)|keratinocyte migration (GO:0051546)|keratinocyte proliferation (GO:0043616)|lipid metabolic process (GO:0006629)|mRNA transcription (GO:0009299)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of collagen biosynthetic process (GO:0032966)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of inflammatory response (GO:0050728)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|phospholipid biosynthetic process (GO:0008654)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epidermis development (GO:0045684)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of insulin secretion (GO:0032024)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vasodilation (GO:0045909)|proteoglycan metabolic process (GO:0006029)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to activity (GO:0014823)|response to glucose (GO:0009749)|response to vitamin A (GO:0033189)|transcription initiation from RNA polymerase II promoter (GO:0006367)|vitamin A metabolic process (GO:0006776)|wound healing (GO:0042060)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|drug binding (GO:0008144)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|linoleic acid binding (GO:0070539)|lipid binding (GO:0008289)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(1)|endometrium(1)|large_intestine(4)|liver(2)|lung(9)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	23					Bezafibrate(DB01393)|Icosapent(DB00159)|Sulindac(DB00605)|Treprostinil(DB00374)	CATGTGAGGGGTGCAAGGTAC	0.632																																					p.G93G		.											.	PPARD-187	0			c.G279T						.						79.0	63.0	69.0					6																	35388052		2203	4300	6503	SO:0001819	synonymous_variant	5467	exon5			TGAGGGGTGCAAG	L07592	CCDS4803.1, CCDS4804.1, CCDS54994.1, CCDS54995.1	6p21.2	2013-01-16	2006-10-17		ENSG00000112033	ENSG00000112033		"""Nuclear hormone receptors"""	9235	protein-coding gene	gene with protein product		600409	"""peroxisome proliferative activated receptor, delta"""			1333051	Standard	NM_177435		Approved	NUC1, NUCII, FAAR, NR1C2	uc003okm.3	Q03181	OTTHUMG00000014567	ENST00000311565.4:c.279G>T	6.37:g.35388052G>T		Somatic	54	0		WXS	Illumina GAIIx	Phase_I	91	42	NM_001171818	0	0	0	0	0	A8K6J6|B4E3V3|B6ZGS1|B7Z3W1|E9PE18|Q5D1P0|Q7Z5K0|Q9BUD4	Silent	SNP	ENST00000311565.4	37	CCDS4803.1																																																																																			.		0.632	PPARD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040288.1	NM_006238	
KCNK16	83795	bcgsc.ca	37	6	39282806	39282806	+	Missense_Mutation	SNP	G	G	T	rs11756091	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr6:39282806G>T	ENST00000373229.5	-	6	915	c.902C>A	c.(901-903)cCc>cAc	p.P301H	KCNK16_ENST00000425054.2_3'UTR|KCNK17_ENST00000453413.2_5'Flank|KCNK16_ENST00000507712.1_Missense_Mutation_p.P189H|KCNK16_ENST00000373227.4_Missense_Mutation_p.P254H|KCNK17_ENST00000373231.4_5'Flank	NM_032115.3	NP_115491.1	Q96T55	KCNKG_HUMAN	potassium channel, subfamily K, member 16	301			P -> H (in dbSNP:rs11756091). {ECO:0000269|PubMed:12724142, ECO:0000269|Ref.5}.		potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			large_intestine(1)|lung(7)|ovary(2)|prostate(1)|skin(2)	13						CTTGGATATGGGGAAGTCCTG	0.597													G|||	2926	0.584265	0.8858	0.4597	5008	,	,		17592	0.4663		0.4911	False		,,,				2504	0.4826				p.P301H		.											.	KCNK16-229	0			c.C902A						.	G	,HIS/PRO,HIS/PRO	3665,741	757.0+/-412.7	1522,621,60	154.0	139.0	144.0		,761,902	0.1	0.0	6	dbSNP_120	144	4308,4292	577.2+/-390.5	1085,2138,1077	yes	utr-3,missense,missense	KCNK16	NM_001135105.1,NM_001135107.1,NM_032115.3	,77,77	2607,2759,1137	TT,TG,GG		49.907,16.818,38.6975	,,	,254/263,301/310	39282806	7973,5033	2203	4300	6503	SO:0001583	missense	83795	exon6			GATATGGGGAAGT	AF358909	CCDS4843.1, CCDS47420.1, CCDS47421.1, CCDS47422.1	6p21.2-p21.1	2012-03-07			ENSG00000095981	ENSG00000095981		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	14464	protein-coding gene	gene with protein product		607369				11263999, 16382106	Standard	NM_032115		Approved	K2p16.1, TALK-1, TALK1	uc003ooq.3	Q96T55	OTTHUMG00000014645	ENST00000373229.5:c.902C>A	6.37:g.39282806G>T	ENSP00000362326:p.Pro301His	Somatic	146	0		WXS	Illumina GAIIx	Phase_I	170	7	NM_032115	0	0	0	0	0	B5TJL9|Q2M2N9|Q5TCF3|Q6X6Z3|Q6X6Z4|Q6X6Z5|Q9H591	Missense_Mutation	SNP	ENST00000373229.5	37	CCDS4843.1	1220	0.5586080586080586	431	0.8760162601626016	176	0.4861878453038674	244	0.42657342657342656	369	0.4868073878627968	G	7.249	0.602823	0.13939	0.83182	0.50093	ENSG00000095981	ENST00000373229;ENST00000507712;ENST00000373227	T;T;T	0.21932	2.45;1.98;2.61	2.67	0.0928	0.14474	.	615.362000	0.00166	N	0.000000	T	0.04543	0.0124	N	0.24115	0.695	0.80722	P	0.0	B;B	0.13145	0.007;0.0	B;B	0.04013	0.001;0.0	T	0.34153	-0.9840	9	0.62326	D	0.03	.	2.6835	0.05101	0.5545:0.2757:0.1698:0.0	rs11756091;rs60729146;rs11756091	254;301	Q96T55-5;Q96T55	.;KCNKG_HUMAN	H	301;189;254	ENSP00000362326:P301H;ENSP00000423842:P189H;ENSP00000362324:P254H	ENSP00000362324:P254H	P	-	2	0	KCNK16	39390784	0.000000	0.05858	0.000000	0.03702	0.083000	0.17756	-0.535000	0.06142	0.017000	0.15025	-0.373000	0.07131	CCC	G|0.400;T|0.600		0.597	KCNK16-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000040452.2	NM_032115	
UNC5CL	222643	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	41002645	41002645	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr6:41002645T>G	ENST00000373164.1	-	1	229	c.169A>C	c.(169-171)Acc>Ccc	p.T57P	UNC5CL_ENST00000244565.3_Missense_Mutation_p.T57P|UNC5CL_ENST00000470102.1_5'Flank			Q8IV45	UN5CL_HUMAN	unc-5 homolog C (C. elegans)-like	57					positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of JNK cascade (GO:0046330)|proteolysis (GO:0006508)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	peptidase activity (GO:0008233)			endometrium(1)|kidney(3)|large_intestine(3)|lung(3)|ovary(2)|upper_aerodigestive_tract(1)	13	Ovarian(28;0.0418)|Colorectal(47;0.196)					AGTTGGGGGGTAGGCTGGGAC	0.582																																					p.T57P		.											.	UNC5CL-92	0			c.A169C						.						133.0	120.0	124.0					6																	41002645		2203	4300	6503	SO:0001583	missense	222643	exon2			GGGGGGTAGGCTG	BC035284	CCDS4847.1	6p21.1	2013-10-15			ENSG00000124602	ENSG00000124602			21203	protein-coding gene	gene with protein product	"""ZU5 and death domain containing"""					14769797	Standard	NM_173561		Approved	MGC34763, ZUD	uc003opi.3	Q8IV45	OTTHUMG00000014665	ENST00000373164.1:c.169A>C	6.37:g.41002645T>G	ENSP00000362258:p.Thr57Pro	Somatic	83	2		WXS	Illumina GAIIx	Phase_I	121	30	NM_173561	0	0	1	1	0	Q5TGU1	Missense_Mutation	SNP	ENST00000373164.1	37	CCDS4847.1	.	.	.	.	.	.	.	.	.	.	T	2.525	-0.309755	0.05458	.	.	ENSG00000124602	ENST00000244565;ENST00000373164	T;T	0.14766	2.48;2.48	4.49	-3.08	0.05347	.	2.021940	0.01995	N	0.045847	T	0.02047	0.0064	N	0.24115	0.695	0.09310	N	1	B	0.22604	0.072	B	0.20384	0.029	T	0.38950	-0.9637	10	0.30078	T	0.28	2.3943	0.036	0.00007	0.3041:0.1991:0.1759:0.321	.	57	Q8IV45	UN5CL_HUMAN	P	57	ENSP00000244565:T57P;ENSP00000362258:T57P	ENSP00000244565:T57P	T	-	1	0	UNC5CL	41110623	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.912000	0.04046	-0.314000	0.08716	-0.376000	0.06991	ACC	.		0.582	UNC5CL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040491.1	NM_173561	
RCAN2	10231	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	46214635	46214635	+	Nonsense_Mutation	SNP	C	C	A			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr6:46214635C>A	ENST00000330430.6	-	3	471	c.283G>T	c.(283-285)Gga>Tga	p.G95*	RCAN2_ENST00000306764.7_Nonsense_Mutation_p.G141*|RCAN2_ENST00000371374.1_Nonsense_Mutation_p.G141*|RCAN2_ENST00000405162.1_Nonsense_Mutation_p.G141*	NM_005822.3	NP_005813.2	Q14206	RCAN2_HUMAN	regulator of calcineurin 2	95					calcineurin-NFAT signaling cascade (GO:0033173)|locomotion involved in locomotory behavior (GO:0031987)|response to oxidative stress (GO:0006979)|short-term memory (GO:0007614)		nucleotide binding (GO:0000166)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	8						AGTTTGTCTCCATCTGTCTCT	0.493																																					p.G141X		.											.	RCAN2-90	0			c.G421T						.						76.0	82.0	80.0					6																	46214635		1954	4139	6093	SO:0001587	stop_gained	10231	exon4			TGTCTCCATCTGT	D83407	CCDS43469.1, CCDS59023.1	6p12.3	2008-10-31	2007-06-26	2007-06-26	ENSG00000172348	ENSG00000172348			3041	protein-coding gene	gene with protein product		604876	"""Down syndrome critical region gene 1-like 1"""	DSCR1L1		8662924	Standard	NM_001251973		Approved	ZAKI-4	uc003oyc.2	Q14206	OTTHUMG00000014782	ENST00000330430.6:c.283G>T	6.37:g.46214635C>A	ENSP00000329454:p.Gly95*	Somatic	97	0		WXS	Illumina GAIIx	Phase_I	98	5	NM_001251973	0	0	2	2	0	A6ND07|B3KR46|Q5VWF7|Q5VWF8|Q8N116	Nonsense_Mutation	SNP	ENST00000330430.6	37	CCDS43469.1	.	.	.	.	.	.	.	.	.	.	C	38	6.673242	0.97751	.	.	ENSG00000172348	ENST00000330430;ENST00000371374;ENST00000306764;ENST00000405162	.	.	.	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-0.5568	18.8222	0.92102	0.0:1.0:0.0:0.0	.	.	.	.	X	95;141;141;141	.	ENSP00000305223:G141X	G	-	1	0	RCAN2	46322594	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.628000	0.67791	2.703000	0.92315	0.585000	0.79938	GGA	.		0.493	RCAN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040782.1		
PKHD1	5314	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	51524734	51524734	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr6:51524734T>A	ENST00000371117.3	-	61	10465	c.10190A>T	c.(10189-10191)cAa>cTa	p.Q3397L		NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	3397					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					CATCAGAAATTGGTATGTACA	0.338																																					p.Q3397L		.											.	PKHD1-603	0			c.A10190T						.						46.0	40.0	42.0					6																	51524734		2203	4300	6503	SO:0001583	missense	5314	exon61			AGAAATTGGTATG	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.10190A>T	6.37:g.51524734T>A	ENSP00000360158:p.Gln3397Leu	Somatic	93	0		WXS	Illumina GAIIx	Phase_I	79	30	NM_138694	0	0	0	0	0	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	ENST00000371117.3	37	CCDS4935.1	.	.	.	.	.	.	.	.	.	.	T	3.112	-0.182510	0.06340	.	.	ENSG00000170927	ENST00000371117	D	0.85629	-2.01	5.48	0.865	0.19074	.	0.908841	0.09213	N	0.833000	T	0.47303	0.1438	N	0.08118	0	0.09310	N	1	B	0.14438	0.01	B	0.11329	0.006	T	0.37686	-0.9695	10	0.15499	T	0.54	.	9.5625	0.39378	0.0:0.5065:0.0:0.4935	.	3397	P08F94	PKHD1_HUMAN	L	3397	ENSP00000360158:Q3397L	ENSP00000360158:Q3397L	Q	-	2	0	PKHD1	51632693	0.011000	0.17503	0.112000	0.21494	0.096000	0.18686	-0.056000	0.11787	-0.051000	0.13334	-0.146000	0.13790	CAA	.		0.338	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	
KHDC1L	100129128	broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	73935131	73935131	+	Start_Codon_SNP	SNP	T	T	C			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr6:73935131T>C	ENST00000370388.3	-	1	44	c.1A>G	c.(1-3)Atg>Gtg	p.M1V	RP11-257K9.8_ENST00000423730.3_Silent_p.A103A|KHDC1L_ENST00000471312.1_5'UTR	NM_001126063.2	NP_001119535.1	Q5JSQ8	KHDCL_HUMAN	KH homology domain containing 1-like	1										breast(1)|endometrium(1)|kidney(1)|lung(3)|skin(1)	7						CCCACGGCCATGCTGTGCTCC	0.522																																					p.M1V		.											.	KHDC1L-1	0			c.A1G						.						70.0	63.0	65.0					6																	73935131		692	1591	2283	SO:0001582	initiator_codon_variant	100129128	exon1			CGGCCATGCTGTG	BC004267	CCDS47450.1	6q13	2014-05-15			ENSG00000256980	ENSG00000256980			37274	protein-coding gene	gene with protein product							Standard	NM_001126063		Approved	RP11-257K9.7	uc003pgm.4	Q5JSQ8	OTTHUMG00000132474	ENST00000370388.3:c.1A>G	6.37:g.73935131T>C	ENSP00000359415:p.Met1Val	Somatic	89	1		WXS	Illumina GAIIx	Phase_I	103	27	NM_001126063	0	0	0	0	0	E1P535	Missense_Mutation	SNP	ENST00000370388.3	37	CCDS47450.1	.	.	.	.	.	.	.	.	.	.	T	11.81	1.750708	0.31046	.	.	ENSG00000256980	ENST00000370388	T	0.44881	0.91	1.91	1.91	0.25777	.	.	.	.	.	T	0.28962	0.0719	.	.	.	0.35438	D	0.794604	B	0.34399	0.452	P	0.44623	0.455	T	0.28138	-1.0053	8	0.87932	D	0	.	5.8198	0.18520	0.0:0.0:0.0:1.0	.	1	Q5JSQ8	KHDCL_HUMAN	V	1	ENSP00000359415:M1V	ENSP00000359415:M1V	M	-	1	0	RP11-257K9.7	73991852	0.000000	0.05858	0.005000	0.12908	0.034000	0.12701	-0.059000	0.11731	1.128000	0.42052	0.172000	0.16884	ATG	.		0.522	KHDC1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255640.1	NM_001126063	Missense_Mutation
POU3F2	5454	hgsc.bcm.edu	37	6	99283376	99283376	+	Silent	SNP	T	T	G	rs195860	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr6:99283376T>G	ENST00000328345.5	+	1	797	c.627T>G	c.(625-627)ggT>ggG	p.G209G		NM_005604.3	NP_005595.2	P20265	PO3F2_HUMAN	POU class 3 homeobox 2	209					astrocyte development (GO:0014002)|cellular response to organic substance (GO:0071310)|cerebral cortex radially oriented cell migration (GO:0021799)|epidermis development (GO:0008544)|forebrain ventricular zone progenitor cell division (GO:0021869)|hypothalamus cell differentiation (GO:0021979)|myelination in peripheral nervous system (GO:0022011)|neurohypophysis development (GO:0021985)|neuron differentiation (GO:0030182)|positive regulation of cell proliferation (GO:0008284)|positive regulation of multicellular organism growth (GO:0040018)|regulation of axonogenesis (GO:0050770)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	identical protein binding (GO:0042802)|RNA polymerase II transcription coactivator activity (GO:0001105)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|large_intestine(3)|lung(5)	10		all_cancers(76;1.56e-06)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00893)|Colorectal(196;0.069)|Lung NSC(302;0.197)		BRCA - Breast invasive adenocarcinoma(108;0.0355)		AGCCGGCCGGTCTGCACCACC	0.736													G|||	4460	0.890575	0.8994	0.9121	5008	,	,		6412	0.9544		0.8598	False		,,,				2504	0.8292				p.G209G		.											.	POU3F2-90	0			c.T627G						.	G		3186,306		1453,280,13	4.0	4.0	4.0		627	3.1	1.0	6	dbSNP_79	4	6282,930		2738,806,62	no	coding-synonymous	POU3F2	NM_005604.2		4191,1086,75	GG,GT,TT		12.8952,8.7629,11.5471		209/444	99283376	9468,1236	1746	3606	5352	SO:0001819	synonymous_variant	5454	exon1			GGCCGGTCTGCAC	Z11933	CCDS5040.1	6q16.2	2011-06-20	2007-07-13		ENSG00000184486	ENSG00000184486		"""Homeoboxes / POU class"""	9215	protein-coding gene	gene with protein product		600494	"""POU domain class 3, transcription factor 2"""	OTF7		8441633	Standard	NM_005604		Approved	POUF3, BRN2, OCT7	uc003ppe.3	P20265	OTTHUMG00000015258	ENST00000328345.5:c.627T>G	6.37:g.99283376T>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	22	6	NM_005604	0	0	0	0	0	Q14960|Q86V54|Q9UJL0	Silent	SNP	ENST00000328345.5	37	CCDS5040.1																																																																																			T|0.089;G|0.911		0.736	POU3F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041586.2		
REV3L	5980	hgsc.bcm.edu;bcgsc.ca	37	6	111693904	111693904	+	Frame_Shift_Del	DEL	G	G	-			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr6:111693904delG	ENST00000358835.3	-	14	6108	c.5654delC	c.(5653-5655)ccafs	p.P1885fs	REV3L_ENST00000435970.1_Frame_Shift_Del_p.P1807fs|REV3L_ENST00000368805.1_Frame_Shift_Del_p.P1885fs|REV3L_ENST00000368802.3_Frame_Shift_Del_p.P1885fs			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	1885	Mediates interaction with MAD2L2.				DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		TTCCCTACTTGGGGGGGACAT	0.428								DNA polymerases (catalytic subunits)																													p.P1885fs		.											.	REV3L-294	0			c.5654delC						.						153.0	162.0	159.0					6																	111693904		2203	4300	6503	SO:0001589	frameshift_variant	5980	exon13			CTACTTGGGGGGG	AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.5654delC	6.37:g.111693904delG	ENSP00000351697:p.Pro1885fs	Somatic	110	0		WXS	Illumina GAIIx	Phase_I	127	56	NM_002912	0	0	0	0	0	O43214|Q5TC33	Frame_Shift_Del	DEL	ENST00000358835.3	37	CCDS5091.2																																																																																			.		0.428	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043695.1	NM_002912	
MCM9	254394	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	119252669	119252669	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr6:119252669G>C	ENST00000316316.6	-	2	506	c.220C>G	c.(220-222)Cga>Gga	p.R74G	MCM9_ENST00000316068.3_Missense_Mutation_p.R74G	NM_017696.2	NP_060166.2	Q9NXL9	MCM9_HUMAN	minichromosome maintenance complex component 9	74					cellular response to DNA damage stimulus (GO:0006974)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|female gamete generation (GO:0007292)	MCM8-MCM9 complex (GO:0097362)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		all_cancers(87;0.122)|all_epithelial(87;0.179)		GBM - Glioblastoma multiforme(226;0.0676)|OV - Ovarian serous cystadenocarcinoma(136;0.194)		GCTGACCTTCGCAGTGCACTA	0.433																																					p.R74G		.											.	MCM9-515	0			c.C220G						.						108.0	99.0	102.0					6																	119252669		2203	4300	6503	SO:0001583	missense	254394	exon1			ACCTTCGCAGTGC	BC031658	CCDS5121.1, CCDS56447.1	6q22.31	2009-11-16	2007-04-04	2007-04-04	ENSG00000111877	ENSG00000111877			21484	protein-coding gene	gene with protein product		610098	"""minichromosome maintenance deficient domain containing 1"", ""chromosome 6 open reading frame 61"""	MCMDC1, C6orf61		16226853, 15850810, 16495042	Standard	NM_153255		Approved	MGC35304, dJ329L24.3, FLJ20170	uc021zeh.1	Q9NXL9	OTTHUMG00000015468	ENST00000316316.6:c.220C>G	6.37:g.119252669G>C	ENSP00000314505:p.Arg74Gly	Somatic	189	0		WXS	Illumina GAIIx	Phase_I	181	115	NM_017696	0	0	1	1	0	B4DR30|B9DI77|Q2KHJ0|Q8N5S5|Q9HCV5	Missense_Mutation	SNP	ENST00000316316.6	37	CCDS56447.1	.	.	.	.	.	.	.	.	.	.	G	11.70	1.717419	0.30413	.	.	ENSG00000111877	ENST00000316316;ENST00000316068;ENST00000425154;ENST00000505446	T;T;T;T	0.04454	3.62;3.62;3.62;3.62	5.91	1.6	0.23607	.	.	.	.	.	T	0.02767	0.0083	M	0.69823	2.125	0.20307	N	0.999914	B	0.23990	0.095	B	0.22753	0.041	T	0.41840	-0.9486	9	0.20046	T	0.44	.	16.9837	0.86335	0.0:0.0:0.5588:0.4412	.	74	Q9NXL9-2	.	G	74	ENSP00000314505:R74G;ENSP00000312870:R74G;ENSP00000394776:R74G;ENSP00000426890:R74G	ENSP00000312870:R74G	R	-	1	2	MCM9	119294368	0.995000	0.38212	0.323000	0.25347	0.718000	0.41266	2.607000	0.46300	0.371000	0.24564	0.655000	0.94253	CGA	.		0.433	MCM9-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042005.4	NM_153255	
KIAA1244	57221	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	138531144	138531144	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr6:138531144C>T	ENST00000251691.4	+	4	483	c.317C>T	c.(316-318)tCg>tTg	p.S106L		NM_020340.4	NP_065073.3			KIAA1244											NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(11)|lung(17)|ovary(2)|skin(2)	44	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		GTGACGCCTTCGCTCAACGAG	0.512																																					p.S106L		.											.	KIAA1244-228	0			c.C317T						.						166.0	129.0	141.0					6																	138531144		2203	4300	6503	SO:0001583	missense	57221	exon4			CGCCTTCGCTCAA	AB033070	CCDS5189.2	6q23.3	2012-04-17			ENSG00000112379	ENSG00000112379		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	21213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 33"""		"""chromosome 6 open reading frame 92"""	C6orf92			Standard	NM_020340		Approved	dJ171N11.1, BIG3, PPP1R33	uc003qhu.3	Q5TH69	OTTHUMG00000015670	ENST00000251691.4:c.317C>T	6.37:g.138531144C>T	ENSP00000251691:p.Ser106Leu	Somatic	362	0		WXS	Illumina GAIIx	Phase_I	681	223	NM_020340	0	0	0	0	0		Missense_Mutation	SNP	ENST00000251691.4	37	CCDS5189.2	.	.	.	.	.	.	.	.	.	.	C	17.77	3.471243	0.63625	.	.	ENSG00000112379	ENST00000251691	T	0.19938	2.11	5.71	4.81	0.61882	.	0.418879	0.26800	N	0.022433	T	0.07279	0.0184	L	0.41824	1.3	0.44447	D	0.997374	P	0.39737	0.685	B	0.25405	0.06	T	0.07347	-1.0777	10	0.72032	D	0.01	-21.8816	12.6484	0.56748	0.0:0.9161:0.0:0.0839	.	106	Q5TH69	BIG3_HUMAN	L	106	ENSP00000251691:S106L	ENSP00000251691:S106L	S	+	2	0	KIAA1244	138572837	0.657000	0.27393	0.951000	0.38953	0.995000	0.86356	1.998000	0.40796	1.327000	0.45338	0.555000	0.69702	TCG	.		0.512	KIAA1244-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042425.4	NM_020340	
LRP11	84918	hgsc.bcm.edu	37	6	150184882	150184882	+	Missense_Mutation	SNP	G	G	C	rs9322225	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr6:150184882G>C	ENST00000239367.2	-	1	280	c.275C>G	c.(274-276)cCg>cGg	p.P92R	RP11-244K5.8_ENST00000606915.1_RNA|LRP11_ENST00000367368.2_Missense_Mutation_p.P92R|RP11-244K5.8_ENST00000596229.1_RNA|LRP11_ENST00000546019.1_Intron	NM_032832.5	NP_116221.3	Q86VZ4	LRP11_HUMAN	low density lipoprotein receptor-related protein 11	92			P -> R (in dbSNP:rs9322225). {ECO:0000269|PubMed:15489334}.			integral component of membrane (GO:0016021)				cervix(1)|kidney(5)|large_intestine(1)|lung(1)	8		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;4.56e-12)|GBM - Glioblastoma multiforme(68;0.225)		GCCGCTGCCCGGGCCCGGGCA	0.756													g|||	2394	0.478035	0.3071	0.5101	5008	,	,		7691	0.8224		0.4165	False		,,,				2504	0.3947				p.P92R		.											.	LRP11-90	0			c.C275G						.	G	ARG/PRO	799,1991		151,497,747	2.0	2.0	2.0		275	3.0	0.3	6	dbSNP_119	2	2072,3740		444,1184,1278	yes	missense	LRP11	NM_032832.5	103	595,1681,2025	CC,CG,GG		35.6504,28.638,33.376	possibly-damaging	92/501	150184882	2871,5731	1395	2906	4301	SO:0001583	missense	84918	exon1			CTGCCCGGGCCCG	AK027641	CCDS5220.1	6q24.3	2013-02-27			ENSG00000120256	ENSG00000120256		"""Low density lipoprotein receptors"""	16936	protein-coding gene	gene with protein product							Standard	NM_032832		Approved	bA350J20.3, MANSC3	uc003qng.2	Q86VZ4	OTTHUMG00000015801	ENST00000239367.2:c.275C>G	6.37:g.150184882G>C	ENSP00000239367:p.Pro92Arg	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	10	NM_032832	0	0	0	1	1	Q5VYC0|Q96SN6	Missense_Mutation	SNP	ENST00000239367.2	37	CCDS5220.1	1110	0.5082417582417582	147	0.29878048780487804	188	0.5193370165745856	465	0.8129370629370629	310	0.40897097625329815	G	12.02	1.812850	0.32053	0.28638	0.356504	ENSG00000120256	ENST00000239367;ENST00000367368	T;T	0.20463	2.07;2.07	3.91	2.96	0.34315	Seven cysteines, N-terminal (2);	1.059560	0.07539	N	0.913589	T	0.07279	0.0184	L	0.36672	1.1	0.51767	P	7.00000000000145E-5	B;B	0.25743	0.133;0.012	B;B	0.23150	0.044;0.025	T	0.19484	-1.0304	9	0.19590	T	0.45	-4.154	11.8365	0.52327	0.0:0.1787:0.8213:0.0	rs9322225;rs17846346;rs17859381	92;92	Q5VYB9;Q86VZ4	.;LRP11_HUMAN	R	92	ENSP00000239367:P92R;ENSP00000356338:P92R	ENSP00000239367:P92R	P	-	2	0	LRP11	150226575	0.132000	0.22450	0.342000	0.25602	0.428000	0.31595	0.489000	0.22387	1.900000	0.55004	0.484000	0.47621	CCG	G|0.492;C|0.508		0.756	LRP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042664.1	NM_032832	
KIF25	3834	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	168442715	168442715	+	Missense_Mutation	SNP	G	G	A	rs536727400		TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr6:168442715G>A	ENST00000443060.2	+	8	1104	c.713G>A	c.(712-714)cGc>cAc	p.R238H	KIF25_ENST00000351261.3_Missense_Mutation_p.R238H|KIF25_ENST00000354419.2_Missense_Mutation_p.R238H			Q9UIL4	KIF25_HUMAN	kinesin family member 25	238	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of autophagy (GO:0010507)|organelle organization (GO:0006996)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	29		Breast(66;1.07e-05)|Ovarian(120;0.0728)		Epithelial(4;7.7e-30)|OV - Ovarian serous cystadenocarcinoma(33;5.82e-22)|BRCA - Breast invasive adenocarcinoma(4;1.38e-10)|GBM - Glioblastoma multiforme(31;0.000756)		GGAAGGAGCCGCAGAGCTTCT	0.647													G|||	1	0.000199681	0.0	0.0	5008	,	,		16301	0.001		0.0	False		,,,				2504	0.0				p.R238H		.											.	KIF25-92	0			c.G713A						.						31.0	29.0	30.0					6																	168442715		2122	4155	6277	SO:0001583	missense	3834	exon7			GGAGCCGCAGAGC	AB012722	CCDS5305.1, CCDS43530.1	6q27	2008-02-05	2003-01-09	2003-01-10	ENSG00000125337	ENSG00000125337		"""Kinesins"""	6390	protein-coding gene	gene with protein product		603815	"""kinesin-like 3"""	KNSL3		9925910	Standard	NM_030615		Approved		uc003qwk.1	Q9UIL4	OTTHUMG00000016035	ENST00000443060.2:c.713G>A	6.37:g.168442715G>A	ENSP00000388878:p.Arg238His	Somatic	215	0		WXS	Illumina GAIIx	Phase_I	399	128	NM_030615	0	0	0	0	0	O94775|Q5SZU9	Missense_Mutation	SNP	ENST00000443060.2	37	CCDS5305.1	.	.	.	.	.	.	.	.	.	.	G	3.015	-0.203086	0.06180	.	.	ENSG00000125337	ENST00000443060;ENST00000354419;ENST00000351261	T;T;T	0.74002	-0.8;-0.8;-0.04	1.89	-3.79	0.04320	Kinesin, motor domain (3);	7.429810	0.00166	N	0.000001	T	0.47507	0.1449	L	0.31371	0.925	0.09310	N	1	B;D	0.64830	0.051;0.994	B;P	0.53266	0.011;0.722	T	0.53380	-0.8447	10	0.36615	T	0.2	0.0379	0.7832	0.01044	0.2662:0.3333:0.2294:0.1711	.	238;238	Q9UIL4-2;Q9UIL4	.;KIF25_HUMAN	H	238	ENSP00000388878:R238H;ENSP00000346401:R238H;ENSP00000252688:R238H	ENSP00000252688:R238H	R	+	2	0	KIF25	168185564	0.002000	0.14202	0.000000	0.03702	0.007000	0.05969	0.289000	0.18957	-1.608000	0.01587	0.411000	0.27672	CGC	.		0.647	KIF25-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362509.1		
ABCB5	340273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	20782576	20782576	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr7:20782576G>A	ENST00000404938.2	+	25	3753	c.3101G>A	c.(3100-3102)cGt>cAt	p.R1034H	ABCB5_ENST00000258738.6_Missense_Mutation_p.R589H	NM_001163941.1	NP_001157413.1	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 5	1034	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent (GO:0002485)|antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent (GO:0002489)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|cell differentiation (GO:0030154)|compound eye corneal lens development (GO:0048058)|positive regulation of antigen processing and presentation of peptide antigen via MHC class I (GO:0002591)|regulation of membrane potential (GO:0042391)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|efflux transmembrane transporter activity (GO:0015562)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(1)|pancreas(1)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)	77						TTCATCCTCCGTGGCTTATCC	0.458																																					p.R1034H		.											.	ABCB5-158	0			c.G3101A						.						133.0	125.0	128.0					7																	20782576		2203	4300	6503	SO:0001583	missense	340273	exon25			TCCTCCGTGGCTT	U66692	CCDS5371.1, CCDS55090.1, CCDS55091.1, CCDS55092.1	7p14	2012-03-14			ENSG00000004846	ENSG00000004846		"""ATP binding cassette transporters / subfamily B"""	46	protein-coding gene	gene with protein product	"""P-glycoprotein ABCB5"", ""ATP-binding cassette protein"""	611785				8894702, 12960149	Standard	NM_001163942		Approved	EST422562, ABCB5beta, ABCB5alpha	uc010kuh.3	Q2M3G0	OTTHUMG00000094789	ENST00000404938.2:c.3101G>A	7.37:g.20782576G>A	ENSP00000384881:p.Arg1034His	Somatic	172	0		WXS	Illumina GAIIx	Phase_I	252	98	NM_001163941	0	0	0	0	0	A4D131|A7BKA4|B5MD19|B7WPL1|F8QQP8|F8QQP9|J3KQ04|Q2M3I5|Q5I5Q7|Q5I5Q8|Q6KG50|Q6XFQ5|Q8IXA1	Missense_Mutation	SNP	ENST00000404938.2	37	CCDS55090.1	.	.	.	.	.	.	.	.	.	.	G	8.085	0.773309	0.16051	.	.	ENSG00000004846	ENST00000404938;ENST00000258738	D;D	0.93859	-3.3;-3.3	4.96	-5.46	0.02608	ABC transporter-like (1);	0.768603	0.11418	N	0.566043	T	0.82098	0.4963	N	0.10760	0.04	0.09310	N	1	B;B	0.16166	0.014;0.016	B;B	0.15870	0.009;0.014	T	0.68538	-0.5382	10	0.62326	D	0.03	.	9.4413	0.38670	0.6266:0.0:0.2708:0.1026	.	1034;589	A7BKA4;Q2M3G0	.;ABCB5_HUMAN	H	1034;589	ENSP00000384881:R1034H;ENSP00000258738:R589H	ENSP00000258738:R589H	R	+	2	0	ABCB5	20749101	0.000000	0.05858	0.000000	0.03702	0.025000	0.11179	0.042000	0.13949	-0.791000	0.04486	-0.827000	0.03088	CGT	.		0.458	ABCB5-004	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000326736.2	NM_178559	
NPVF	64111	ucsc.edu;bcgsc.ca	37	7	25267934	25267934	+	Missense_Mutation	SNP	T	T	C	rs877834	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr7:25267934T>C	ENST00000222674.2	-	1	171	c.125A>G	c.(124-126)gAc>gGc	p.D42G		NM_022150.3	NP_071433	Q9HCQ7	NPVF_HUMAN	neuropeptide VF precursor	42			D -> G (in dbSNP:rs877834). {ECO:0000269|PubMed:11951088}.		negative regulation of gonadotropin secretion (GO:0032277)|neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)				cervix(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|urinary_tract(1)	15						AGAATATTTGTCATAATTTTC	0.279													T|||	1238	0.247204	0.0908	0.2594	5008	,	,		18226	0.5129		0.1849	False		,,,				2504	0.2403				p.D42G		.											.	NPVF-91	0			c.A125G						.	T	GLY/ASP	482,3916	217.8+/-236.0	32,418,1749	54.0	60.0	58.0		125	0.3	0.0	7	dbSNP_86	58	1574,7004	291.3+/-300.3	141,1292,2856	yes	missense	NPVF	NM_022150.3	94	173,1710,4605	CC,CT,TT		18.3493,10.9595,15.8446	benign	42/197	25267934	2056,10920	2199	4289	6488	SO:0001583	missense	64111	exon1			TATTTGTCATAAT	AB040290	CCDS5395.1	7p21-p15	2013-02-28	2006-10-06	2006-10-06	ENSG00000105954	ENSG00000105954		"""Endogenous ligands"""	13782	protein-coding gene	gene with protein product	"""RFamide-related peptide precursor"", ""FMRFamide-related peptide precursor"""		"""chromosome 7 open reading frame 9"""	C7orf9		11951088, 11173868	Standard	NM_022150		Approved	RFRP	uc003sxo.3	Q9HCQ7	OTTHUMG00000128509	ENST00000222674.2:c.125A>G	7.37:g.25267934T>C	ENSP00000222674:p.Asp42Gly	Somatic	83	0		WXS	Illumina GAIIx	Phase_I	65	7	NM_022150	0	0	0	0	0	A4D164|Q7LE27|Q96PI9	Missense_Mutation	SNP	ENST00000222674.2	37	CCDS5395.1	572	0.2619047619047619	44	0.08943089430894309	92	0.2541436464088398	293	0.5122377622377622	143	0.18865435356200527	T	8.124	0.781553	0.16120	0.109595	0.183493	ENSG00000105954	ENST00000222674	T	0.30981	1.51	5.57	0.266	0.15617	.	0.473353	0.19711	N	0.107806	T	0.00012	0.0000	L	0.54908	1.71	0.58432	P	1.0000000000287557E-6	B	0.11235	0.004	B	0.11329	0.006	T	0.43310	-0.9399	9	0.35671	T	0.21	-12.9291	4.4368	0.11554	0.0:0.281:0.1623:0.5567	rs877834;rs1130038;rs3177707;rs3188502;rs16873801;rs17412537;rs57473358;rs877834	42	Q9HCQ7	RFRP_HUMAN	G	42	ENSP00000222674:D42G	ENSP00000222674:D42G	D	-	2	0	NPVF	25234459	0.091000	0.21658	0.004000	0.12327	0.871000	0.50021	0.069000	0.14552	0.085000	0.17107	0.528000	0.53228	GAC	C|0.206;N|0.000		0.279	NPVF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250315.1	NM_022150	
NPSR1	387129	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	34698162	34698162	+	Nonsense_Mutation	SNP	C	C	G			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr7:34698162C>G	ENST00000360581.1	+	1	266	c.138C>G	c.(136-138)taC>taG	p.Y46*	AC005493.1_ENST00000399077.1_Intron|NPSR1_ENST00000381542.1_Nonsense_Mutation_p.Y46*|NPSR1_ENST00000531252.1_Nonsense_Mutation_p.Y46*|NPSR1_ENST00000381539.3_Nonsense_Mutation_p.Y46*|NPSR1_ENST00000465305.1_Nonsense_Mutation_p.Y46*|NPSR1_ENST00000381553.3_Nonsense_Mutation_p.Y46*|NPSR1_ENST00000359791.1_Nonsense_Mutation_p.Y46*|NPSR1-AS1_ENST00000419766.1_RNA	NM_207172.1	NP_997055.1	Q6W5P4	NPSR1_HUMAN	neuropeptide S receptor 1	46						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|vasopressin receptor activity (GO:0005000)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(14)|pancreas(1)|skin(7)	31					Halothane(DB01159)	CCTTCTACTACTCCTTTAAGG	0.458																																					p.Y46X		.											.	NPSR1-94	0			c.C138G						.						132.0	127.0	128.0					7																	34698162		2203	4300	6503	SO:0001587	stop_gained	387129	exon1			CTACTACTCCTTT	AY255536	CCDS5443.1, CCDS5444.1, CCDS75579.1, CCDS75580.1, CCDS75581.1	7p14.3	2012-08-08	2006-05-10	2006-05-10	ENSG00000187258	ENSG00000187258		"""GPCR / Class A : Neuropeptide receptors : S"""	23631	protein-coding gene	gene with protein product		608595	"""G protein-coupled receptor 154"""	GPR154		12679517, 15073379	Standard	NM_207173		Approved	PGR14, GPRA	uc003tei.1	Q6W5P4	OTTHUMG00000099383	ENST00000360581.1:c.138C>G	7.37:g.34698162C>G	ENSP00000353788:p.Tyr46*	Somatic	134	1		WXS	Illumina GAIIx	Phase_I	209	56	NM_207172	0	0	0	0	0	A2RTZ4|Q2XP58|Q56H76|Q56H77|Q56H78|Q6JSL4|Q6JSL5|Q6JSL6|Q6JSL7|Q6JSL8|Q6W5P3|Q6ZMB8	Nonsense_Mutation	SNP	ENST00000360581.1	37	CCDS5444.1	.	.	.	.	.	.	.	.	.	.	C	35	5.509603	0.96386	.	.	ENSG00000187258	ENST00000381553;ENST00000465305;ENST00000360581;ENST00000381542;ENST00000359791;ENST00000531252;ENST00000381539	.	.	.	4.53	-1.84	0.07809	.	0.454020	0.18442	N	0.141102	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.8184	1.0424	0.01562	0.1511:0.3432:0.1476:0.3582	.	.	.	.	X	46	.	ENSP00000352839:Y46X	Y	+	3	2	NPSR1	34664687	0.718000	0.27976	0.979000	0.43373	0.981000	0.71138	-0.660000	0.05317	-0.253000	0.09514	-0.766000	0.03442	TAC	.		0.458	NPSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216837.1	NM_207173	
AEBP1	165	broad.mit.edu;bcgsc.ca	37	7	44150789	44150789	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr7:44150789C>A	ENST00000223357.3	+	14	1972	c.1667C>A	c.(1666-1668)gCc>gAc	p.A556D	MIR4649_ENST00000582839.1_RNA|AEBP1_ENST00000450684.2_Missense_Mutation_p.A131D	NM_001129.3	NP_001120.3	Q8IUX7	AEBP1_HUMAN	AE binding protein 1	556	Interaction with MAPK1 and MAPK3. {ECO:0000250}.|Interaction with PTEN. {ECO:0000250}.				cell adhesion (GO:0007155)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(13)|upper_aerodigestive_tract(2)	33						GAGGTGGTGGCCACCGATGAC	0.622																																					p.A556D		.											.	AEBP1-90	0			c.C1667A						.						65.0	63.0	64.0					7																	44150789		2203	4300	6503	SO:0001583	missense	165	exon14			TGGTGGCCACCGA	D86479	CCDS5476.1	7p	2008-07-18	2001-11-28		ENSG00000106624	ENSG00000106624			303	protein-coding gene	gene with protein product	"""aortic carboxypeptidase-like protein"", ""adipocyte enhancer binding protein 1"""	602981	"""AE-binding protein 1"""			8920928	Standard	NM_001129		Approved	ACLP	uc003tkb.4	Q8IUX7	OTTHUMG00000023362	ENST00000223357.3:c.1667C>A	7.37:g.44150789C>A	ENSP00000223357:p.Ala556Asp	Somatic	179	1		WXS	Illumina GAIIx	Phase_I	327	20	NM_001129	0	0	6	6	0	Q14113|Q59ER7|Q6ZSC7|Q7KZ79	Missense_Mutation	SNP	ENST00000223357.3	37	CCDS5476.1	.	.	.	.	.	.	.	.	.	.	C	17.66	3.444161	0.63067	.	.	ENSG00000106624	ENST00000223357;ENST00000450684	D;D	0.95103	-3.61;-3.02	5.51	3.65	0.41850	.	0.481260	0.23866	N	0.043791	D	0.87277	0.6137	N	0.22421	0.69	0.25256	N	0.989638	B;P	0.43352	0.413;0.804	B;B	0.34301	0.098;0.179	T	0.79193	-0.1904	10	0.45353	T	0.12	-19.7903	10.6368	0.45569	0.0:0.7938:0.1333:0.0729	.	131;556	Q8IUX7-2;Q8IUX7	.;AEBP1_HUMAN	D	556;131	ENSP00000223357:A556D;ENSP00000398878:A131D	ENSP00000223357:A556D	A	+	2	0	AEBP1	44117314	0.031000	0.19500	0.994000	0.49952	0.896000	0.52359	3.080000	0.50112	0.653000	0.30826	0.555000	0.69702	GCC	.		0.622	AEBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250993.2	NM_001129	
RAMP3	10268	hgsc.bcm.edu	37	7	45197433	45197433	+	Silent	SNP	G	G	A	rs67477213	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr7:45197433G>A	ENST00000242249.4	+	1	44	c.6G>A	c.(4-6)gaG>gaA	p.E2E	RAMP3_ENST00000496212.1_Silent_p.E2E|RAMP3_ENST00000481345.1_Silent_p.E2E	NM_005856.2	NP_005847.1	O60896	RAMP3_HUMAN	receptor (G protein-coupled) activity modifying protein 3	2					calcium ion transport (GO:0006816)|cellular response to estradiol stimulus (GO:0071392)|G-protein coupled receptor signaling pathway involved in heart process (GO:0086103)|intracellular protein transport (GO:0006886)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of receptor recycling (GO:0001921)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|receptor internalization (GO:0031623)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	coreceptor activity (GO:0015026)|protein transporter activity (GO:0008565)|receptor activity (GO:0004872)			breast(1)|endometrium(1)|large_intestine(4)|lung(4)|stomach(1)	11					Pramlintide(DB01278)	CAGCCATGGAGACTGGAGCGC	0.771													G|||	1244	0.248403	0.4947	0.1657	5008	,	,		7876	0.0159		0.2276	False		,,,				2504	0.2352				p.E2E		.											.	RAMP3-90	0			c.G6A						.	G		1194,2386		196,802,792	3.0	3.0	3.0		6	2.0	0.0	7	dbSNP_130	3	1312,6004		141,1030,2487	no	coding-synonymous	RAMP3	NM_005856.2		337,1832,3279	AA,AG,GG		17.9333,33.352,22.9993		2/149	45197433	2506,8390	1790	3658	5448	SO:0001819	synonymous_variant	10268	exon1			CATGGAGACTGGA	AJ001016	CCDS5503.1	7p13-p12	2006-11-21	2006-11-21		ENSG00000122679	ENSG00000122679		"""Receptor (G protein-coupled) activity modifying proteins"""	9845	protein-coding gene	gene with protein product		605155	"""receptor activity modifying protein 3"", ""receptor (calcitonin) activity modifying protein 3"""				Standard	NM_005856		Approved		uc003tnb.3	O60896	OTTHUMG00000023729	ENST00000242249.4:c.6G>A	7.37:g.45197433G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	26	18	NM_005856	0	0	1	1	0	Q7Z2Y1	Silent	SNP	ENST00000242249.4	37	CCDS5503.1																																																																																			G|0.760;A|0.240		0.771	RAMP3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251343.1	NM_005856	
PTCD1	26024	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	99032679	99032679	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr7:99032679T>A	ENST00000292478.4	-	2	437	c.187A>T	c.(187-189)Acg>Tcg	p.T63S	ATP5J2-PTCD1_ENST00000413834.1_Missense_Mutation_p.T112S|ATP5J2-PTCD1_ENST00000437572.1_5'UTR|PTCD1_ENST00000555673.1_Missense_Mutation_p.T112S|PTCD1_ENST00000485746.1_5'Flank	NM_015545.3	NP_056360.2	O75127	PTCD1_HUMAN	pentatricopeptide repeat domain 1	63					tRNA 3'-end processing (GO:0042780)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|tRNA binding (GO:0000049)			endometrium(5)|large_intestine(3)|lung(16)|ovary(2)|skin(1)	27	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			AGGCTGCCCGTGTTTTCCTGA	0.642																																					p.T112S		.											.	.	0			c.A334T						.						31.0	33.0	32.0					7																	99032679		2203	4300	6503	SO:0001583	missense	100526740	exon3			TGCCCGTGTTTTC	AB014532	CCDS34691.1	7q22.1	2006-01-27				ENSG00000106246			22198	protein-coding gene	gene with protein product		614774					Standard	NM_015545		Approved	KIAA0632		O75127		ENST00000292478.4:c.187A>T	7.37:g.99032679T>A	ENSP00000292478:p.Thr63Ser	Somatic	56	0		WXS	Illumina GAIIx	Phase_I	66	18	NM_001198879	0	0	1	2	1	Q3ZB78|Q66K60|Q9UDV2	Missense_Mutation	SNP	ENST00000292478.4	37	CCDS34691.1	.	.	.	.	.	.	.	.	.	.	T	11.46	1.646156	0.29246	.	.	ENSG00000106246;ENSG00000106246;ENSG00000106246;ENSG00000106246;ENSG00000106246;ENSG00000106246;ENSG00000248919	ENST00000292478;ENST00000555673;ENST00000430982;ENST00000430029;ENST00000419981;ENST00000437572;ENST00000413834	T;T;D;D;D;T;T	0.82893	-0.05;-0.04;-1.63;-1.63;-1.66;-1.14;-0.04	5.84	-0.519	0.11939	.	1.068260	0.07170	N	0.852240	T	0.74974	0.3787	M	0.62723	1.935	0.09310	N	1	B;B	0.16802	0.019;0.011	B;B	0.09377	0.004;0.002	T	0.52990	-0.8501	10	0.10902	T	0.67	-0.1642	4.3356	0.11085	0.15:0.3507:0.0:0.4992	.	112;63	G3V325;O75127	.;PTCD1_HUMAN	S	63;112;63;63;63;63;112	ENSP00000292478:T63S;ENSP00000450995:T112S;ENSP00000390530:T63S;ENSP00000408059:T63S;ENSP00000401600:T63S;ENSP00000410697:T63S;ENSP00000400168:T112S	ENSP00000400168:T112S	T	-	1	0	ATP5J2-PTCD1;PTCD1	98870615	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.269000	0.08596	0.116000	0.18110	0.460000	0.39030	ACG	.		0.642	PTCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336391.1	NM_015545	
MBLAC1	255374	hgsc.bcm.edu	37	7	99725210	99725210	+	Silent	SNP	G	G	T	rs142426754	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr7:99725210G>T	ENST00000398075.2	+	2	591	c.192G>T	c.(190-192)ggG>ggT	p.G64G	RP11-506M12.1_ENST00000494221.1_RNA	NM_203397.1	NP_981942.1	A4D2B0	MBLC1_HUMAN	metallo-beta-lactamase domain containing 1	64							hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|skin(1)	7						CCCCGCGCGGGAGTGGCGGCG	0.786													G|||	71	0.0141773	0.0023	0.0259	5008	,	,		10477	0.004		0.0388	False		,,,				2504	0.0072				p.G64G		.											.	MBLAC1-135	0			c.G192T						.	G		29,3009		0,29,1490	4.0	4.0	4.0		192	3.7	0.0	7	dbSNP_134	4	266,6806		2,262,3272	no	coding-synonymous	MBLAC1	NM_203397.1		2,291,4762	TT,TG,GG		3.7613,0.9546,2.9179		64/267	99725210	295,9815	1519	3536	5055	SO:0001819	synonymous_variant	255374	exon2			GCGCGGGAGTGGC	BC031288	CCDS43620.1	7q22	2014-02-12	2009-04-08		ENSG00000214309	ENSG00000214309			22180	protein-coding gene	gene with protein product							Standard	XM_005250250		Approved	MGC49416	uc003utp.3	A4D2B0	OTTHUMG00000154846	ENST00000398075.2:c.192G>T	7.37:g.99725210G>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	13	12	NM_203397	0	0	0	0	0	Q8N5X8	Silent	SNP	ENST00000398075.2	37	CCDS43620.1																																																																																			G|0.976;T|0.024		0.786	MBLAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337353.1	NM_203397	
RELN	5649	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	103243773	103243773	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr7:103243773C>G	ENST00000428762.1	-	24	3470	c.3311G>C	c.(3310-3312)gGa>gCa	p.G1104A	RELN_ENST00000343529.5_Missense_Mutation_p.G1104A|RELN_ENST00000424685.2_Missense_Mutation_p.G1104A	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	1104					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		CAGAGATGATCCAGAAGAGAT	0.428																																					p.G1104A	NSCLC(146;835 1944 15585 22231 52158)	.											.	RELN-574	0			c.G3311C						.						154.0	132.0	139.0					7																	103243773		2203	4300	6503	SO:0001583	missense	5649	exon24			GATGATCCAGAAG		CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.3311G>C	7.37:g.103243773C>G	ENSP00000392423:p.Gly1104Ala	Somatic	156	0		WXS	Illumina GAIIx	Phase_I	164	44	NM_173054	0	0	4	5	1	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	ENST00000428762.1	37	CCDS47680.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.475605	0.84640	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	T;T;T	0.28895	1.59;1.59;1.59	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	T	0.60907	0.2305	M	0.83384	2.64	0.80722	D	1	P;D	0.76494	0.663;0.999	B;D	0.78314	0.286;0.991	T	0.62515	-0.6838	10	0.45353	T	0.12	.	19.3079	0.94171	0.0:1.0:0.0:0.0	.	1104;1104	P78509-2;P78509	.;RELN_HUMAN	A	1104	ENSP00000392423:G1104A;ENSP00000345694:G1104A;ENSP00000388446:G1104A	ENSP00000345694:G1104A	G	-	2	0	RELN	103031009	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.270000	0.78493	2.550000	0.86006	0.655000	0.94253	GGA	.		0.428	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045	
KIAA1549	57670	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	138601908	138601908	+	Frame_Shift_Del	DEL	C	C	-			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr7:138601908delC	ENST00000422774.1	-	2	2512	c.2464delG	c.(2464-2466)gtgfs	p.V822fs	KIAA1549_ENST00000242365.4_Frame_Shift_Del_p.V772fs|KIAA1549_ENST00000440172.1_Frame_Shift_Del_p.V822fs			Q9HCM3	K1549_HUMAN	KIAA1549	822						integral component of membrane (GO:0016021)			KIAA1549/BRAF(703)	large_intestine(4)|pancreas(1)|upper_aerodigestive_tract(2)	7						AGGACAGACACGTGACCGTCT	0.502			O	BRAF	pilocytic astrocytoma																																p.V822fs	NSCLC(119;1534 1718 44213 46230 50068)	.		Dom	yes		7	7q34	57670	KIAA1549		O	.	KIAA1549-369	0			c.2464delG						.						75.0	78.0	77.0					7																	138601908		2117	4237	6354	SO:0001589	frameshift_variant	57670	exon2			CAGACACGTGACC		CCDS47723.1, CCDS47723.2, CCDS56513.1	7q34	2009-10-09			ENSG00000122778	ENSG00000122778			22219	protein-coding gene	gene with protein product		613344					Standard	NM_020910		Approved		uc011kql.2	Q9HCM3	OTTHUMG00000157214	ENST00000422774.1:c.2464delG	7.37:g.138601908delC	ENSP00000416040:p.Val822fs	Somatic	96	0		WXS	Illumina GAIIx	Phase_I	142	29	NM_020910	0	0	0	0	0	B6HY55|B6HY56|B6HY58|B6HY60|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q5BJD6|Q8IY15|Q9H0M3	Frame_Shift_Del	DEL	ENST00000422774.1	37	CCDS56513.1																																																																																			.		0.502	KIAA1549-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348092.1		
SSPO	23145	bcgsc.ca	37	7	149486382	149486382	+	RNA	SNP	C	C	G	rs2074704	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr7:149486382C>G	ENST00000378016.2	+	0	4358							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			TATCCGTGCCCCCAGGGCTTG	0.672													C|||	299	0.0597045	0.031	0.0519	5008	,	,		16691	0.0933		0.0666	False		,,,				2504	0.0624				p.P1453R		.											.	.	0			c.C4358G						.	C		151,4245		2,147,2049	23.0	27.0	26.0		4362	4.8	0.5	7	dbSNP_96	26	557,8033		28,501,3766	no	coding-notMod3	SSPO	NM_198455.2		30,648,5815	GG,GC,CC		6.4843,3.4349,5.452			149486382	708,12278	2198	4295	6493			23145	exon30			CGTGCCCCCAGGG	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149486382C>G		Somatic	23	1		WXS	Illumina GAIIx	Phase_I	291	112	NM_198455	0	0	0	0	0	Q76B61	Missense_Mutation	SNP	ENST00000378016.2	37																																																																																				C|0.891;G|0.109		0.672	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript			
NOS3	4846	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	150698991	150698991	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr7:150698991G>T	ENST00000484524.1	+	12	1585	c.1585G>T	c.(1585-1587)Ggc>Tgc	p.G529C	NOS3_ENST00000467517.1_Missense_Mutation_p.G529C|NOS3_ENST00000461406.1_Missense_Mutation_p.G323C|NOS3_ENST00000297494.3_Missense_Mutation_p.G529C	NM_001160111.1	NP_001153583.1	P60323	NANO3_HUMAN	nitric oxide synthase 3 (endothelial cell)	0					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic signaling pathway (GO:2001234)|oogenesis (GO:0048477)|regulation of cell cycle (GO:0051726)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(5)|endometrium(1)|kidney(4)|large_intestine(6)|liver(2)|lung(11)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	50	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CTCCGAGACCGGCCGGGCCCA	0.642																																					p.G529C		.											.	NOS3-1011	0			c.G1585T						.						43.0	45.0	44.0					7																	150698991		2203	4300	6503	SO:0001583	missense	4846	exon12			GAGACCGGCCGGG		CCDS5912.1, CCDS55182.1, CCDS55183.1	7q36	2007-02-15			ENSG00000164867	ENSG00000164867	1.14.13.39		7876	protein-coding gene	gene with protein product	"""endothelial nitric oxide synthase"""	163729				1379542	Standard	NM_000603		Approved	ECNOS, eNOS	uc003wif.3	P29474	OTTHUMG00000158343	ENST00000484524.1:c.1585G>T	7.37:g.150698991G>T	ENSP00000420215:p.Gly529Cys	Somatic	191	0		WXS	Illumina GAIIx	Phase_I	263	52	NM_001160111	0	0	1	1	0	Q495E5	Missense_Mutation	SNP	ENST00000484524.1	37	CCDS55182.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.328054	0.81690	.	.	ENSG00000164867	ENST00000297494;ENST00000461406;ENST00000484524;ENST00000467517	D;D;D;D	0.90844	-2.74;-2.74;-2.74;-2.74	4.8	4.8	0.61643	Flavodoxin/nitric oxide synthase (2);	0.000000	0.56097	D	0.000033	D	0.97486	0.9177	H	0.99156	4.45	0.58432	D	0.999999	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	D	0.99075	1.0835	10	0.87932	D	0	-2.0461	15.7394	0.77876	0.0:0.0:1.0:0.0	.	529;529;529;323;529	A0S0A6;E9PFR2;A0S0A8;E7ESA7;P29474	.;.;.;.;NOS3_HUMAN	C	529;323;529;529	ENSP00000297494:G529C;ENSP00000417143:G323C;ENSP00000420215:G529C;ENSP00000420551:G529C	ENSP00000297494:G529C	G	+	1	0	NOS3	150329924	1.000000	0.71417	0.998000	0.56505	0.721000	0.41392	9.261000	0.95576	2.376000	0.81061	0.655000	0.94253	GGC	.		0.642	NOS3-004	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000351550.1	NM_000603	
SLC4A2	6522	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	150771214	150771214	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr7:150771214G>C	ENST00000485713.1	+	17	3664	c.2624G>C	c.(2623-2625)aGa>aCa	p.R875T	SLC4A2_ENST00000310317.5_Missense_Mutation_p.R793T|FASTK_ENST00000489884.1_5'Flank|SLC4A2_ENST00000413384.2_Missense_Mutation_p.R875T|SLC4A2_ENST00000392826.2_Missense_Mutation_p.R866T|SLC4A2_ENST00000461735.1_Missense_Mutation_p.R861T|RP11-148K1.12_ENST00000485974.1_RNA	NM_001199692.1	NP_001186621.1	P04920	B3A2_HUMAN	solute carrier family 4 (anion exchanger), member 2	875	Membrane (anion exchange).				anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|chloride transmembrane transporter activity (GO:0015108)|inorganic anion exchanger activity (GO:0005452)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(2)|lung(14)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	33			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GCCGGGGCAAGACCCACGCTG	0.677																																					p.R875T		.											.	SLC4A2-90	0			c.G2624C						.						28.0	34.0	32.0					7																	150771214		2202	4300	6502	SO:0001583	missense	6522	exon17			GGGCAAGACCCAC		CCDS5917.1, CCDS56520.1, CCDS56521.1	7q36.1	2013-07-19	2013-07-19		ENSG00000164889	ENSG00000164889		"""Solute carriers"""	11028	protein-coding gene	gene with protein product	"""anion exchanger 2 type a"", ""anion exchanger 2 type b1"", ""anion exchanger 2 type b2"""	109280	"""erythrocyte membrane protein band 3-like 1"", ""solute carrier family 4, anion exchanger, member 2 (erythrocyte membrane protein band 3-like 1)"""	EPB3L1, AE2		8434259	Standard	NM_003040		Approved	HKB3, BND3L, NBND3	uc003wit.4	P04920	OTTHUMG00000158443	ENST00000485713.1:c.2624G>C	7.37:g.150771214G>C	ENSP00000419412:p.Arg875Thr	Somatic	78	1		WXS	Illumina GAIIx	Phase_I	183	52	NM_003040	0	0	36	56	20	B2R6T0|B4DIT0|D3DX05|F8W682|Q45EY5|Q969L3	Missense_Mutation	SNP	ENST00000485713.1	37	CCDS5917.1	.	.	.	.	.	.	.	.	.	.	G	1.038	-0.679837	0.03353	.	.	ENSG00000164889	ENST00000485713;ENST00000413384;ENST00000310317;ENST00000392826;ENST00000461735	T;T;T;T;T	0.78126	-1.15;-1.15;-1.15;-1.15;-1.15	5.54	-4.99	0.03010	Bicarbonate transporter, C-terminal (1);	1.995360	0.01812	N	0.033484	T	0.46619	0.1402	N	0.01134	-0.995	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.09377	0.004;0.0;0.001	T	0.50808	-0.8784	10	0.11485	T	0.65	.	9.4883	0.38944	0.6271:0.249:0.1238:0.0	.	866;861;875	F8W682;P04920-2;P04920	.;.;B3A2_HUMAN	T	875;875;793;866;861	ENSP00000419412:R875T;ENSP00000405600:R875T;ENSP00000311402:R793T;ENSP00000376571:R866T;ENSP00000419164:R861T	ENSP00000311402:R793T	R	+	2	0	SLC4A2	150402147	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.186000	0.09670	-0.860000	0.04099	-0.367000	0.07326	AGA	.		0.677	SLC4A2-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000351039.1	NM_003040	
CSMD1	64478	bcgsc.ca	37	8	3072036	3072036	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr8:3072036A>C	ENST00000520002.1	-	31	5408	c.4853T>G	c.(4852-4854)gTg>gGg	p.V1618G	CSMD1_ENST00000537824.1_Missense_Mutation_p.V1617G|CSMD1_ENST00000602557.1_Missense_Mutation_p.V1618G|CSMD1_ENST00000400186.3_Missense_Mutation_p.V1618G|CSMD1_ENST00000542608.1_Missense_Mutation_p.V1617G|CSMD1_ENST00000539096.1_Missense_Mutation_p.V1617G|CSMD1_ENST00000523387.1_5'UTR|CSMD1_ENST00000602723.1_Missense_Mutation_p.V1618G			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	1618	Sushi 9. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		GGAGGGCAGCACTTGGTCCCA	0.468																																					p.V1617G		.											.	CSMD1-86	0			c.T4850G						.						69.0	66.0	67.0					8																	3072036		1981	4159	6140	SO:0001583	missense	64478	exon30			GGCAGCACTTGGT			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.4853T>G	8.37:g.3072036A>C	ENSP00000430733:p.Val1618Gly	Somatic	151	0		WXS	Illumina GAIIx	Phase_I	317	14	NM_033225	0	0	0	0	0	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	0.957|0.957	-0.704506|-0.704506	0.03255|0.03255	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000335551|ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096	.|T;T;T;T;T	.|0.63913	.|-0.07;-0.07;-0.07;-0.07;-0.07	5.53|5.53	-2.94|-2.94	0.05581|0.05581	.|Complement control module (2);Sushi/SCR/CCP (3);	.|0.993842	.|0.08156	.|N	.|0.989189	T|T	0.45216|0.45216	0.1331|0.1331	N|N	0.16368|0.16368	0.405|0.405	0.09310|0.09310	N|N	1|1	.|B;B;B	.|0.16802	.|0.019;0.001;0.0	.|B;B;B	.|0.20577	.|0.03;0.01;0.004	T|T	0.27331|0.27331	-1.0077|-1.0077	5|10	.|0.30078	.|T	.|0.28	.|.	13.911|13.911	0.63866|0.63866	0.4327:0.0:0.5673:0.0|0.4327:0.0:0.5673:0.0	.|.	.|1618;1618;1618	.|E5RIG2;Q96PZ7;Q96PZ7-4	.|.;CSMD1_HUMAN;.	R|G	1097|1618;1618;1480;1617;1617;1617	.|ENSP00000383047:V1618G;ENSP00000430733:V1618G;ENSP00000441462:V1617G;ENSP00000446243:V1617G;ENSP00000441675:V1617G	.|ENSP00000320445:V1480G	S|V	-|-	3|2	2|0	CSMD1|CSMD1	3059443|3059443	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.039000|0.039000	0.13416|0.13416	0.782000|0.782000	0.26788|0.26788	-0.845000|-0.845000	0.04179|0.04179	-0.462000|-0.462000	0.05337|0.05337	AGT|GTG	.		0.468	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
RP1L1	94137	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	10465856	10465856	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr8:10465856C>T	ENST00000382483.3	-	4	5975	c.5752G>A	c.(5752-5754)Gag>Aag	p.E1918K		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	1998	25 X 16 AA approximate tandem repeats of [ED]-[AT]-[PQ]-[ED]-[AVT]-E-[GKE]-[ED]- [AMT]-Q-[EPK]-[EAT]-[TSELP]-[EG]- [EGSQDI]-[AVIE].				cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		CTTTCTGTCTCTGGCTGGGCC	0.607																																					p.E1918K		.											.	RP1L1-139	0			c.G5752A						.						129.0	144.0	139.0					8																	10465856		2014	4165	6179	SO:0001583	missense	94137	exon4			CTGTCTCTGGCTG	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.5752G>A	8.37:g.10465856C>T	ENSP00000371923:p.Glu1918Lys	Somatic	30	0		WXS	Illumina GAIIx	Phase_I	45	8	NM_178857	0	0	0	0	0	Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	ENST00000382483.3	37	CCDS43708.1	.	.	.	.	.	.	.	.	.	.	C	9.993	1.231433	0.22626	.	.	ENSG00000183638	ENST00000382483	T	0.07908	3.15	1.4	1.4	0.22301	.	.	.	.	.	T	0.03695	0.0105	N	0.08118	0	0.09310	N	1	B	0.28233	0.204	B	0.24269	0.052	T	0.45891	-0.9230	9	0.22706	T	0.39	.	6.2459	0.20818	0.2966:0.7034:0.0:0.0	.	1918	A6NKC6	.	K	1918	ENSP00000371923:E1918K	ENSP00000371923:E1918K	E	-	1	0	RP1L1	10503266	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	0.236000	0.17967	0.652000	0.30806	0.484000	0.47621	GAG	.		0.607	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1		
XPO7	23039	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	21845361	21845361	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr8:21845361G>A	ENST00000252512.9	+	15	1880	c.1780G>A	c.(1780-1782)Gga>Aga	p.G594R	XPO7_ENST00000434536.1_Missense_Mutation_p.G603R|XPO7_ENST00000433566.4_Missense_Mutation_p.G595R	NM_015024.4	NP_055839.3	Q9UIA9	XPO7_HUMAN	exportin 7	594					mRNA transport (GO:0051028)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	nuclear export signal receptor activity (GO:0005049)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(2)|lung(12)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				Colorectal(74;0.0187)|COAD - Colon adenocarcinoma(73;0.0724)		CGTCTTCATAGGAAAAATGTA	0.463																																					p.G594R		.											.	XPO7-273	0			c.G1780A						.						101.0	96.0	98.0					8																	21845361		1968	4154	6122	SO:0001583	missense	23039	exon15			TTCATAGGAAAAA	AF064729	CCDS47818.1	8p21	2011-04-13	2003-03-11	2003-03-14	ENSG00000130227	ENSG00000130227		"""Exportins"""	14108	protein-coding gene	gene with protein product		606140	"""RAN binding protein 16"""	RANBP16		11024021, 9872452	Standard	NM_015024		Approved	KIAA0745	uc003xaa.4	Q9UIA9	OTTHUMG00000163789	ENST00000252512.9:c.1780G>A	8.37:g.21845361G>A	ENSP00000252512:p.Gly594Arg	Somatic	173	0		WXS	Illumina GAIIx	Phase_I	257	54	NM_015024	0	0	0	0	0	O94846|Q6PJK9|Q8NEK7	Missense_Mutation	SNP	ENST00000252512.9	37	CCDS47818.1	.	.	.	.	.	.	.	.	.	.	G	5.349	0.249755	0.10130	.	.	ENSG00000130227	ENST00000434536;ENST00000252512;ENST00000433566	T;T;T	0.21361	2.01;2.01;2.01	4.96	4.96	0.65561	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.10852	0.0265	N	0.04203	-0.255	0.80722	D	1	B;B;B	0.06786	0.001;0.0;0.001	B;B;B	0.06405	0.001;0.001;0.002	T	0.15521	-1.0434	10	0.10377	T	0.69	-10.2711	18.1612	0.89708	0.0:0.0:1.0:0.0	.	595;603;594	E7ESC6;E9PEN8;Q9UIA9	.;.;XPO7_HUMAN	R	603;594;595	ENSP00000404853:G603R;ENSP00000252512:G594R;ENSP00000410249:G595R	ENSP00000252512:G594R	G	+	1	0	XPO7	21901307	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.547000	0.98100	2.444000	0.82710	0.563000	0.77884	GGA	.		0.463	XPO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375494.1	NM_015024	
ENTPD4	9583	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	23305367	23305367	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr8:23305367T>C	ENST00000358689.4	-	4	473	c.238A>G	c.(238-240)Aca>Gca	p.T80A	ENTPD4_ENST00000356206.6_Missense_Mutation_p.T80A|ENTPD4_ENST00000417069.2_Missense_Mutation_p.T80A	NM_001128930.2|NM_004901.4	NP_001122402.1|NP_004892.1	Q9Y227	ENTP4_HUMAN	ectonucleoside triphosphate diphosphohydrolase 4	80					UDP catabolic process (GO:0006256)	cytoplasmic vesicle (GO:0031410)|integral component of Golgi membrane (GO:0030173)|intracellular membrane-bounded organelle (GO:0043231)	uridine-diphosphatase activity (GO:0045134)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	25		Prostate(55;0.114)		Colorectal(74;0.0161)|COAD - Colon adenocarcinoma(73;0.0649)		TTGGTGTCTGTAGCTTCAATG	0.438																																					p.T80A		.											.	ENTPD4-92	0			c.A238G						.						218.0	165.0	183.0					8																	23305367		2203	4300	6503	SO:0001583	missense	9583	exon4			TGTCTGTAGCTTC	AJ131358	CCDS6041.1, CCDS47827.1	8p21.3	2014-05-16	2004-09-22	2004-09-22	ENSG00000197217	ENSG00000197217			14573	protein-coding gene	gene with protein product		607577	"""lysosomal apyrase-like 1"""	LYSAL1		10393803, 9205841	Standard	NM_001128930		Approved	LALP70, LAP70, KIAA0392, NTPDase-4, UDPase	uc003xdl.3	Q9Y227	OTTHUMG00000097852	ENST00000358689.4:c.238A>G	8.37:g.23305367T>C	ENSP00000351520:p.Thr80Ala	Somatic	227	1		WXS	Illumina GAIIx	Phase_I	503	106	NM_004901	0	0	5	8	3	D3DSS3|O15092	Missense_Mutation	SNP	ENST00000358689.4	37	CCDS6041.1	.	.	.	.	.	.	.	.	.	.	T	27.4	4.824065	0.90873	.	.	ENSG00000197217	ENST00000356206;ENST00000358689;ENST00000417069;ENST00000518718	T;T;T	0.14893	2.47;2.47;2.47	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	T	0.39835	0.1093	M	0.73962	2.25	0.80722	D	1	D;D;D;D	0.89917	0.989;1.0;1.0;1.0	D;D;D;D	0.91635	0.958;0.999;0.999;0.999	T	0.19257	-1.0311	10	0.17832	T	0.49	-14.244	14.5513	0.68068	0.0:0.0:0.0:1.0	.	80;80;80;80	B4DU21;Q8NE73;Q9Y227-2;Q9Y227	.;.;.;ENTP4_HUMAN	A	80;80;80;46	ENSP00000348536:T80A;ENSP00000351520:T80A;ENSP00000408573:T80A	ENSP00000348536:T80A	T	-	1	0	ENTPD4	23361312	1.000000	0.71417	0.968000	0.41197	0.990000	0.78478	7.632000	0.83247	2.173000	0.68751	0.528000	0.53228	ACA	.		0.438	ENTPD4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000215142.1	NM_004901	
KIF13B	23303	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	29035052	29035052	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr8:29035052G>A	ENST00000524189.1	-	9	802	c.764C>T	c.(763-765)gCt>gTt	p.A255V	KIF13B_ENST00000521515.1_Missense_Mutation_p.A255V	NM_015254.3	NP_056069.2	Q9NQT8	KI13B_HUMAN	kinesin family member 13B	255	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|protein targeting (GO:0006605)|regulation of axonogenesis (GO:0050770)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	axon (GO:0030424)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	14-3-3 protein binding (GO:0071889)|ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)|protein kinase binding (GO:0019901)			endometrium(6)|kidney(1)|lung(20)|urinary_tract(1)	28		Ovarian(32;0.000536)		KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)		TTCACTGCCAGCTAAATCCAC	0.478																																					p.A255V		.											.	KIF13B-22	0			c.C764T						.						143.0	144.0	144.0					8																	29035052		1953	4159	6112	SO:0001583	missense	23303	exon9			CTGCCAGCTAAAT	AB014539	CCDS55217.1	8p21	2008-07-30				ENSG00000197892		"""Kinesins"""	14405	protein-coding gene	gene with protein product		607350				9734811, 10859302, 16864656	Standard	NM_015254		Approved	GAKIN, KIAA0639	uc003xhh.4	Q9NQT8		ENST00000524189.1:c.764C>T	8.37:g.29035052G>A	ENSP00000427900:p.Ala255Val	Somatic	93	0		WXS	Illumina GAIIx	Phase_I	124	26	NM_015254	0	0	7	11	4	B4DGY5|B5MC45|F8VPJ2|O75134|Q9BYJ6	Missense_Mutation	SNP	ENST00000524189.1	37	CCDS55217.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.151287	0.78001	.	.	ENSG00000197892	ENST00000524189;ENST00000521515	D;D	0.95518	-3.73;-3.73	4.95	4.95	0.65309	Kinesin, motor domain (5);Kinesin, motor region, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.98931	0.9637	H	0.99590	4.645	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.996;0.999;0.995	D	0.99164	1.0862	10	0.87932	D	0	.	18.3857	0.90465	0.0:0.0:1.0:0.0	.	241;255;255	C9JK41;Q9NQT8;F8VPJ2	.;KI13B_HUMAN;.	V	255	ENSP00000427900:A255V;ENSP00000429201:A255V	ENSP00000429201:A255V	A	-	2	0	KIF13B	29090971	1.000000	0.71417	0.260000	0.24451	0.299000	0.27559	9.657000	0.98554	2.577000	0.86979	0.462000	0.41574	GCT	.		0.478	KIF13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376878.1		
WRN	7486	bcgsc.ca	37	8	31024654	31024654	+	Missense_Mutation	SNP	T	T	C	rs1346044	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr8:31024654T>C	ENST00000298139.5	+	34	4348	c.4099T>C	c.(4099-4101)Tgt>Cgt	p.C1367R	RP11-363L24.3_ENST00000521252.1_RNA	NM_000553.4	NP_000544.2	Q14191	WRN_HUMAN	Werner syndrome, RecQ helicase-like	1367			C -> R (polymorphism associated with a higher risk of myocardial infarction; dbSNP:rs1346044). {ECO:0000269|PubMed:10069711, ECO:0000269|PubMed:11161804, ECO:0000269|PubMed:9021029, ECO:0000269|Ref.4}.		aging (GO:0007568)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|cell aging (GO:0007569)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to starvation (GO:0009267)|DNA duplex unwinding (GO:0032508)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA replication (GO:0006260)|DNA synthesis involved in DNA repair (GO:0000731)|double-strand break repair (GO:0006302)|multicellular organismal aging (GO:0010259)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleolus to nucleoplasm transport (GO:0032066)|positive regulation of hydrolase activity (GO:0051345)|regulation of apoptotic process (GO:0042981)|regulation of growth rate (GO:0040009)|replication fork processing (GO:0031297)|replicative cell aging (GO:0001302)|response to oxidative stress (GO:0006979)|response to UV-C (GO:0010225)|telomere maintenance (GO:0000723)	centrosome (GO:0005813)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	3'-5' DNA helicase activity (GO:0043138)|3'-5' exonuclease activity (GO:0008408)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|exonuclease activity (GO:0004527)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|Y-form DNA binding (GO:0000403)			central_nervous_system(2)|endometrium(4)|kidney(4)|large_intestine(13)|lung(28)|ovary(3)|skin(3)|upper_aerodigestive_tract(3)	60		Breast(100;0.195)		KIRC - Kidney renal clear cell carcinoma(542;0.147)|Kidney(114;0.176)|Colorectal(111;0.192)		TCAACCTTCATGTGATGTCAA	0.403			"""Mis, N, F, S"""			"""osteosarcoma, meningioma, others"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Werner syndrome				T|||	965	0.192692	0.1475	0.1729	5008	,	,		17332	0.1042		0.2664	False		,,,				2504	0.2832				p.C1367R	Ovarian(18;161 598 2706 14834 27543)	.	yes	Rec		Werner Syndrome	8	8p12-p11.2	7486	Werner syndrome (RECQL2)		"""L, E, M, O"""	.	WRN-1036	0			c.T4099C	GRCh37	CM971591	WRN	M	rs1346044	.	T	ARG/CYS	757,3649	308.8+/-290.8	69,619,1515	120.0	105.0	110.0		4099	2.5	0.1	8	dbSNP_88	110	2200,6400	374.4+/-337.4	301,1598,2401	yes	missense	WRN	NM_000553.4	180	370,2217,3916	CC,CT,TT		25.5814,17.1811,22.7357	possibly-damaging	1367/1433	31024654	2957,10049	2203	4300	6503	SO:0001583	missense	7486	exon34	Familial Cancer Database	WS, Adult Progeria	CCTTCATGTGATG		CCDS6082.1	8p12	2014-09-17	2009-03-19		ENSG00000165392	ENSG00000165392			12791	protein-coding gene	gene with protein product		604611	"""Werner syndrome"""			9288107	Standard	NM_000553		Approved	RECQL2, RECQ3	uc003xio.4	Q14191	OTTHUMG00000163894	ENST00000298139.5:c.4099T>C	8.37:g.31024654T>C	ENSP00000298139:p.Cys1367Arg	Somatic	322	2		WXS	Illumina GAIIx	Phase_I	553	12	NM_000553	0	0	29	29	0	A1KYY9	Missense_Mutation	SNP	ENST00000298139.5	37	CCDS6082.1	400	0.18315018315018314	81	0.16463414634146342	64	0.17679558011049723	56	0.0979020979020979	199	0.262532981530343	T	8.055	0.766747	0.15983	0.171811	0.255814	ENSG00000165392	ENST00000298139	T	0.44083	0.93	4.86	2.45	0.29901	.	0.692798	0.13759	N	0.364736	T	0.00012	0.0000	M	0.70595	2.14	0.27730	P	0.9448488	P	0.41265	0.744	B	0.39068	0.289	T	0.09487	-1.0672	9	0.48119	T	0.1	-0.0497	5.6058	0.17379	0.0:0.1646:0.1451:0.6903	rs1346044;rs2230015;rs17652782;rs17847579;rs52814593;rs58743977;rs1346044	1367	Q14191	WRN_HUMAN	R	1367	ENSP00000298139:C1367R	ENSP00000298139:C1367R	C	+	1	0	WRN	31144196	0.589000	0.26807	0.090000	0.20809	0.295000	0.27426	0.579000	0.23788	0.406000	0.25560	0.533000	0.62120	TGT	T|0.798;C|0.202		0.403	WRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376248.1		
GPR124	25960	hgsc.bcm.edu	37	8	37699516	37699516	+	Silent	SNP	C	C	T	rs7010546	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr8:37699516C>T	ENST00000412232.2	+	19	3673	c.3660C>T	c.(3658-3660)ggC>ggT	p.G1220G	GPR124_ENST00000315215.7_Silent_p.G1003G	NM_032777.9	NP_116166.9	Q96PE1	GP124_HUMAN	G protein-coupled receptor 124	1220					central nervous system development (GO:0007417)|endothelial cell migration (GO:0043542)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuropeptide signaling pathway (GO:0007218)|positive regulation of endothelial cell migration (GO:0010595)|regulation of angiogenesis (GO:0045765)|regulation of chemotaxis (GO:0050920)|regulation of establishment of blood-brain barrier (GO:0090210)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(16)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			GCGAGAGCGGCAGTCTGCACA	0.746													C|||	2324	0.464058	0.3048	0.5144	5008	,	,		7503	0.6716		0.4165	False		,,,				2504	0.4785				p.G1220G		.											.	GPR124-157	0			c.C3660T						.	C		594,1854		106,382,736	2.0	3.0	2.0		3660	3.1	1.0	8	dbSNP_116	2	1524,3502		291,942,1280	no	coding-synonymous	GPR124	NM_032777.9		397,1324,2016	TT,TC,CC		30.3223,24.2647,28.3382		1220/1339	37699516	2118,5356	1224	2513	3737	SO:0001819	synonymous_variant	25960	exon19			GAGCGGCAGTCTG	AB040964	CCDS6097.2	8p11.22	2014-08-08			ENSG00000020181	ENSG00000020181		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17849	protein-coding gene	gene with protein product	"""tumor endothelial marker 5"""	606823				11559528, 12565841	Standard	NM_032777		Approved	TEM5, DKFZp434C211, DKFZp434J0911, KIAA1531, FLJ14390	uc003xkj.3	Q96PE1	OTTHUMG00000156182	ENST00000412232.2:c.3660C>T	8.37:g.37699516C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	15	13	NM_032777	0	0	0	0	0	A6H8W3|D3DSW4|Q8N3R1|Q8TEM3|Q96KB2|Q9P1Z7|Q9UFY4	Silent	SNP	ENST00000412232.2	37	CCDS6097.2	1050	0.4807692307692308	166	0.33739837398373984	169	0.46685082872928174	397	0.6940559440559441	318	0.41952506596306066	C	4.050	0.006880	0.07866	0.242647	0.303223	ENSG00000020181	ENST00000416514	.	.	.	3.95	3.07	0.35406	.	.	.	.	.	.	.	.	.	.	.	0.09310	P	0.9999999999997394	.	.	.	.	.	.	.	.	.	.	0.10111	T	0.7	-18.0593	4.3087	0.10960	0.1378:0.5532:0.2174:0.0916	rs7010546;rs59434562;rs7010546	.	.	.	X	1213	.	ENSP00000405145:Q1213X	Q	+	1	0	GPR124	37818674	0.843000	0.29541	1.000000	0.80357	0.388000	0.30384	-0.114000	0.10757	0.874000	0.35823	0.313000	0.20887	CAG	C|0.479;G|0.000;T|0.520		0.746	GPR124-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343331.2		
KAT6A	7994	ucsc.edu;bcgsc.ca	37	8	41791017	41791017	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr8:41791017C>T	ENST00000396930.3	-	18	5264	c.4721G>A	c.(4720-4722)gGc>gAc	p.G1574D	KAT6A_ENST00000265713.2_Missense_Mutation_p.G1574D|KAT6A_ENST00000406337.1_Missense_Mutation_p.G1574D	NM_001099412.1	NP_001092882.1	Q92794	KAT6A_HUMAN	K(lysine) acetyltransferase 6A	1574	Interaction with PML.|Interaction with RUNX1-2.				aorta morphogenesis (GO:0035909)|cellular senescence (GO:0090398)|chromatin organization (GO:0006325)|DNA packaging (GO:0006323)|embryonic hemopoiesis (GO:0035162)|face morphogenesis (GO:0060325)|heart morphogenesis (GO:0003007)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|myeloid cell differentiation (GO:0030099)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|protein acetylation (GO:0006473)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|PML body (GO:0016605)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)										GATGCTGCCGCCCATCGTGGA	0.592																																					p.G1574D		.											.	.	0			c.G4721A						.						68.0	67.0	68.0					8																	41791017		2203	4300	6503	SO:0001583	missense	7994	exon18			CTGCCGCCCATCG	U47742	CCDS6124.1	8p11	2013-01-28	2011-07-21	2011-07-21	ENSG00000083168	ENSG00000083168		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	13013	protein-coding gene	gene with protein product	"""Monocytic leukemia zinc finger protein"""	601408	"""runt-related transcription factor binding protein 2"", ""MYST histone acetyltransferase (monocytic leukemia) 3"""	ZNF220, RUNXBP2, MYST3		8849440, 8782817	Standard	NM_001099412		Approved	MOZ, ZC2HC6A	uc003xon.4	Q92794	OTTHUMG00000150453	ENST00000396930.3:c.4721G>A	8.37:g.41791017C>T	ENSP00000380136:p.Gly1574Asp	Somatic	175	3		WXS	Illumina GAIIx	Phase_I	338	263	NM_001099412	0	0	3	9	6	Q76L81	Missense_Mutation	SNP	ENST00000396930.3	37	CCDS6124.1	.	.	.	.	.	.	.	.	.	.	C	11.13	1.547107	0.27652	.	.	ENSG00000083168	ENST00000265713;ENST00000406337;ENST00000396930	D;D;D	0.84873	-1.91;-1.91;-1.91	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	D	0.89466	0.6723	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89344	0.3656	10	0.56958	D	0.05	-17.3642	20.3018	0.98617	0.0:1.0:0.0:0.0	.	1574	Q92794	KAT6A_HUMAN	D	1574	ENSP00000265713:G1574D;ENSP00000385888:G1574D;ENSP00000380136:G1574D	ENSP00000265713:G1574D	G	-	2	0	KAT6A	41910174	1.000000	0.71417	0.964000	0.40570	0.208000	0.24298	7.336000	0.79245	2.799000	0.96334	0.650000	0.86243	GGC	.		0.592	KAT6A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318163.1	NM_006766	
RB1CC1	9821	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	53569634	53569634	+	Nonsense_Mutation	SNP	C	C	A			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr8:53569634C>A	ENST00000025008.5	-	15	3278	c.2755G>T	c.(2755-2757)Gaa>Taa	p.E919*	RB1CC1_ENST00000539297.1_Nonsense_Mutation_p.E919*|RB1CC1_ENST00000435644.2_Nonsense_Mutation_p.E919*|RB1CC1_ENST00000521611.1_Intron	NM_014781.4	NP_055596.3	Q8TDY2	RBCC1_HUMAN	RB1-inducible coiled-coil 1	919					autophagic vacuole assembly (GO:0000045)|cell cycle (GO:0007049)|heart development (GO:0007507)|JNK cascade (GO:0007254)|liver development (GO:0001889)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell size (GO:0045793)|positive regulation of protein phosphorylation (GO:0001934)|regulation of autophagy (GO:0010506)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|pre-autophagosomal structure membrane (GO:0034045)|ULK1-ATG13-FIP200 complex (GO:0070969)				NS(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(19)|ovary(8)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	60		all_cancers(86;0.137)|all_epithelial(80;0.00494)|Lung NSC(129;0.011)|all_lung(136;0.023)				GCTTCTTTTTCATGTTTAACC	0.303																																					p.E919X	GBM(180;1701 2102 13475 42023 52570)	.											.	RB1CC1-170	0			c.G2755T						.						71.0	75.0	74.0					8																	53569634		2202	4297	6499	SO:0001587	stop_gained	9821	exon15			CTTTTTCATGTTT	AB059622	CCDS34892.1, CCDS47856.1	8q11	2014-06-13				ENSG00000023287			15574	protein-coding gene	gene with protein product	"""200 kDa FAK family kinase-interacting protein"", ""phosphatase 1, regulatory subunit 131"""	606837				11850849, 7724523, 18443221	Standard	NM_014781		Approved	KIAA0203, Cc1, DRAGOU14, FIP200, ATG17, PPP1R131	uc003xre.4	Q8TDY2		ENST00000025008.5:c.2755G>T	8.37:g.53569634C>A	ENSP00000025008:p.Glu919*	Somatic	33	0		WXS	Illumina GAIIx	Phase_I	37	6	NM_001083617	0	0	20	20	0	Q86YR4|Q8WVU9|Q92601	Nonsense_Mutation	SNP	ENST00000025008.5	37	CCDS34892.1	.	.	.	.	.	.	.	.	.	.	C	41	8.976955	0.99023	.	.	ENSG00000023287	ENST00000025008;ENST00000435644;ENST00000539297	.	.	.	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	-21.9154	20.0149	0.97475	0.0:1.0:0.0:0.0	.	.	.	.	X	919	.	ENSP00000025008:E919X	E	-	1	0	RB1CC1	53732187	1.000000	0.71417	0.999000	0.59377	0.208000	0.24298	7.202000	0.77856	2.793000	0.96121	0.650000	0.86243	GAA	.		0.303	RB1CC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378011.1	NM_014781	
C8orf46	254778	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	67428183	67428183	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr8:67428183G>A	ENST00000305454.3	+	6	937	c.496G>A	c.(496-498)Gaa>Aaa	p.E166K	C8orf46_ENST00000521495.1_3'UTR|C8orf46_ENST00000522977.1_3'UTR	NM_152765.3	NP_689978.2	Q8TAG6	CH046_HUMAN	chromosome 8 open reading frame 46	166										endometrium(1)|large_intestine(1)|lung(1)|prostate(1)|skin(2)	6			Epithelial(68;0.0224)|BRCA - Breast invasive adenocarcinoma(89;0.0508)|all cancers(69;0.0558)|OV - Ovarian serous cystadenocarcinoma(28;0.226)			CCAAGGAGCAGAAGCCTCTCT	0.542																																					p.E166K		.											.	C8orf46-92	0			c.G496A						.						76.0	69.0	72.0					8																	67428183		2203	4300	6503	SO:0001583	missense	254778	exon6			GGAGCAGAAGCCT	BC028400	CCDS6191.2	8q13.1	2005-08-09			ENSG00000169085	ENSG00000169085			28498	protein-coding gene	gene with protein product						12477932	Standard	NM_152765		Approved	MGC33510	uc003xwg.3	Q8TAG6	OTTHUMG00000156998	ENST00000305454.3:c.496G>A	8.37:g.67428183G>A	ENSP00000302260:p.Glu166Lys	Somatic	45	0		WXS	Illumina GAIIx	Phase_I	47	7	NM_152765	0	0	0	0	0	B2RDC3|B4DFU4|C9J814|C9JCS3	Missense_Mutation	SNP	ENST00000305454.3	37	CCDS6191.2	.	.	.	.	.	.	.	.	.	.	G	22.1	4.238809	0.79800	.	.	ENSG00000169085	ENST00000305454	.	.	.	5.13	5.13	0.70059	.	0.000000	0.56097	D	0.000023	T	0.64227	0.2579	L	0.27053	0.805	0.80722	D	1	D	0.67145	0.996	D	0.77557	0.99	T	0.62358	-0.6871	8	.	.	.	-2.8569	16.3656	0.83319	0.0:0.0:1.0:0.0	.	166	Q8TAG6	CH046_HUMAN	K	166	.	.	E	+	1	0	C8orf46	67590737	1.000000	0.71417	0.954000	0.39281	0.521000	0.34408	6.281000	0.72632	2.385000	0.81259	0.563000	0.77884	GAA	.		0.542	C8orf46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347010.1	NM_152765	
RSPO2	340419	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	108970363	108970363	+	Silent	SNP	A	A	G			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr8:108970363A>G	ENST00000276659.5	-	5	1181	c.561T>C	c.(559-561)tgT>tgC	p.C187C	RSPO2_ENST00000517781.1_Silent_p.C123C|RSPO2_ENST00000517939.1_Silent_p.C120C|RSPO2_ENST00000378439.2_Silent_p.C123C	NM_178565.4	NP_848660.3	Q6UXX9	RSPO2_HUMAN	R-spondin 2	187	TSP type-1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				bone mineralization (GO:0030282)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|lung growth (GO:0060437)|osteoblast differentiation (GO:0001649)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|extracellular region (GO:0005576)	heparin binding (GO:0008201)|receptor binding (GO:0005102)		EIF3E/RSPO2(6)	haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	28			OV - Ovarian serous cystadenocarcinoma(57;1.55e-09)			CAATGGTTGGACACAGTATTG	0.433																																					p.C187C		.											.	RSPO2-231	0			c.T561C						.						345.0	291.0	310.0					8																	108970363		2203	4300	6503	SO:0001819	synonymous_variant	340419	exon5			GGTTGGACACAGT	AK123023	CCDS6307.1, CCDS64953.1	8q23.1	2014-01-30	2011-06-29		ENSG00000147655	ENSG00000147655		"""Endogenous ligands"""	28583	protein-coding gene	gene with protein product		610575	"""R-spondin 2 homolog (Xenopus laevis)"""			15469841	Standard	NM_178565		Approved	MGC35555	uc003yms.3	Q6UXX9	OTTHUMG00000164893	ENST00000276659.5:c.561T>C	8.37:g.108970363A>G		Somatic	146	0		WXS	Illumina GAIIx	Phase_I	298	61	NM_178565	0	0	0	0	0	B3KVP0|Q4G0U4|Q8N6X6	Silent	SNP	ENST00000276659.5	37	CCDS6307.1																																																																																			.		0.433	RSPO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380830.1	NM_178565	
AARD	441376	hgsc.bcm.edu	37	8	117950768	117950768	+	Missense_Mutation	SNP	G	G	C	rs16889283	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr8:117950768G>C	ENST00000378279.3	+	1	331	c.286G>C	c.(286-288)Ggc>Cgc	p.G96R		NM_001025357.2	NP_001020528.1	Q4LEZ3	AARD_HUMAN	alanine and arginine rich domain containing protein	96	Ala/Arg-rich.		G -> R (in dbSNP:rs16889283). {ECO:0000269|PubMed:15489334}.		lung development (GO:0030324)												gagctggacgggcgttgaggc	0.766													C|||	1490	0.297524	0.3759	0.33	5008	,	,		10043	0.1885		0.2803	False		,,,				2504	0.2986				p.G96R		.											.	.	0			c.G286C						.	C	ARG/GLY	549,1809		44,461,674	2.0	3.0	2.0		286	2.4	0.5	8	dbSNP_123	2	1138,4124		124,890,1617	no	missense	C8orf85	NM_001025357.2	125	168,1351,2291	CC,CG,GG		21.6268,23.2824,22.1391	benign	96/156	117950768	1687,5933	1179	2631	3810	SO:0001583	missense	441376	exon1			TGGACGGGCGTTG	AB181519, BC140924	CCDS34935.1	8q24.11	2012-04-19	2012-04-19	2012-04-19	ENSG00000205002	ENSG00000205002			33842	protein-coding gene	gene with protein product	"""Alanine and arginine-rich domain-containing protein"""		"""chromosome 8 open reading frame 85"""	C8orf85			Standard	NM_001025357		Approved	LOC441376	uc003yof.3	Q4LEZ3	OTTHUMG00000164961	ENST00000378279.3:c.286G>C	8.37:g.117950768G>C	ENSP00000367528:p.Gly96Arg	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_001025357	0	0	0	8	8	A5PKU8	Missense_Mutation	SNP	ENST00000378279.3	37	CCDS34935.1	615	0.2815934065934066	169	0.3434959349593496	125	0.3453038674033149	113	0.19755244755244755	208	0.27440633245382584	C	0.010	-1.751868	0.00663	0.232824	0.216268	ENSG00000205002	ENST00000378279	T	0.24151	1.87	3.34	2.43	0.29744	.	0.000000	0.40818	N	0.001011	T	0.00012	0.0000	N	0.01352	-0.895	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.46190	-0.9209	9	0.02654	T	1	-2.461	6.0007	0.19519	0.2199:0.5672:0.213:0.0	rs16889283	96	Q4LEZ3	AARD_HUMAN	R	96	ENSP00000367528:G96R	ENSP00000367528:G96R	G	+	1	0	C8orf85	118019949	0.205000	0.23458	0.549000	0.28204	0.028000	0.11728	0.797000	0.26999	0.216000	0.20781	-0.371000	0.07208	GGC	C|0.278;G|0.722		0.766	AARD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381195.1	NM_001025357	
MAL2	114569	hgsc.bcm.edu	37	8	120220776	120220776	+	Splice_Site	DEL	G	G	-	rs398009582|rs71302978		TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr8:120220776delG	ENST00000276681.6	+	1	167	c.65delG	c.(64-66)cgg>cg	p.R22fs	MAL2_ENST00000521748.1_3'UTR	NM_052886.2	NP_443118.1	Q969L2	MAL2_HUMAN	mal, T-cell differentiation protein 2 (gene/pseudogene)	22						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)						all_cancers(13;1.91e-26)|Lung NSC(37;8.61e-08)|Ovarian(258;0.018)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.000967)			CCGCCGCCCCGGGGTCACCCT	0.771													GGG|GGGG|GGG|insertion	5008	1.0	1.0	1.0	5008	,	,		6681	1.0		1.0	False		,,,				2504	1.0				.		.											.	.	0			c.64+1G>-						.			1571,11		785,1,5	1.0	1.0	1.0			0.7	0.8	8	dbSNP_130	1	4116,22		2057,2,10	no	frameshift	MAL2	NM_052886.2		2842,3,15	A1A1,A1R,RR		0.5317,0.6953,0.5769			120220776	5687,33	184	483	667	SO:0001630	splice_region_variant	114569	exon1			CGCCCCGGGGTCA	AL117612	CCDS75780.1	8q23	2011-01-26	2011-01-26			ENSG00000147676			13634	protein-coding gene	gene with protein product	"""MAL proteolipid protein 2"""	609684				11549320	Standard	NM_052886		Approved		uc003yop.3	Q969L2		ENST00000276681.6:c.66+1G>-	8.37:g.120220776delG		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	20	19	NM_052886	0	0	0	0	0	B2R520|Q6ZMD9	Splice_Site	DEL	ENST00000276681.6	37																																																																																				.		0.771	MAL2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052886	Frame_Shift_Del
ZNF696	79943	hgsc.bcm.edu	37	8	144378868	144378868	+	Silent	SNP	A	A	G	rs7386259	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr8:144378868A>G	ENST00000330143.3	+	3	1432	c.1023A>G	c.(1021-1023)cgA>cgG	p.R341R		NM_030895.2	NP_112157.2	Q9H7X3	ZN696_HUMAN	zinc finger protein 696	341					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	8	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)			GGCACCAGCGACTCCACACGG	0.726													G|||	4505	0.899561	0.9425	0.9179	5008	,	,		11520	0.8403		0.8608	False		,,,				2504	0.9294				p.R341R		.											.	ZNF696-90	0			c.A1023G						.	G		3773,275		1771,231,22	5.0	5.0	5.0		1023	-0.3	0.0	8	dbSNP_116	5	6735,1261		2843,1049,106	no	coding-synonymous	ZNF696	NM_030895.2		4614,1280,128	GG,GA,AA		15.7704,6.7935,12.7532		341/375	144378868	10508,1536	2024	3998	6022	SO:0001819	synonymous_variant	79943	exon3			CCAGCGACTCCAC	AK024191	CCDS6399.1	8q24.3	2013-01-08				ENSG00000185730		"""Zinc fingers, C2H2-type"""	25872	protein-coding gene	gene with protein product							Standard	NM_030895		Approved	FLJ14129	uc003yxy.4	Q9H7X3		ENST00000330143.3:c.1023A>G	8.37:g.144378868A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	14	14	NM_030895	0	0	0	6	6	A0AVE2	Silent	SNP	ENST00000330143.3	37	CCDS6399.1																																																																																			A|0.118;G|0.882		0.726	ZNF696-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381164.2	NM_030895	
PLEC	5339	hgsc.bcm.edu	37	8	144998190	144998190	+	Silent	SNP	A	A	G	rs2857829	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr8:144998190A>G	ENST00000322810.4	-	31	6487	c.6318T>C	c.(6316-6318)gcT>gcC	p.A2106A	PLEC_ENST00000354589.3_Silent_p.A1969A|PLEC_ENST00000357649.2_Silent_p.A1973A|PLEC_ENST00000527096.1_Silent_p.A1992A|PLEC_ENST00000398774.2_Silent_p.A1937A|PLEC_ENST00000354958.2_Silent_p.A1947A|PLEC_ENST00000356346.3_Silent_p.A1955A|PLEC_ENST00000436759.2_Silent_p.A1996A|PLEC_ENST00000345136.3_Silent_p.A1969A	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	2106	Central fibrous rod domain.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						GCTGCCTCGCAGCCTCCAGCT	0.746													a|||	1156	0.230831	0.028	0.2968	5008	,	,		12955	0.1429		0.4274	False		,,,				2504	0.3466				p.A2106A		.											.	PLEC-141	0			c.T6318C						.	G	,,,,,,,	343,3813		21,301,1756	7.0	8.0	8.0		5988,5865,5841,6318,5811,5907,5919,5907	-8.1	0.0	8	dbSNP_100	8	3082,5166		620,1842,1662	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	,,,,,,,	641,2143,3418	GG,GA,AA		37.3666,8.2531,27.6121	,,,,,,,	1996/4575,1955/4534,1947/4526,2106/4685,1937/4516,1969/4548,1973/4552,1969/4548	144998190	3425,8979	2078	4124	6202	SO:0001819	synonymous_variant	5339	exon31			CCTCGCAGCCTCC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.6318T>C	8.37:g.144998190A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	33	21	NM_201380	0	0	5	11	6	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																			A|0.738;G|0.262		0.746	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
PLEC	5339	hgsc.bcm.edu	37	8	145001784	145001784	+	Silent	SNP	A	A	G	rs3135109	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr8:145001784A>G	ENST00000322810.4	-	27	4130	c.3961T>C	c.(3961-3963)Ttg>Ctg	p.L1321L	PLEC_ENST00000354589.3_Silent_p.L1184L|PLEC_ENST00000357649.2_Silent_p.L1188L|PLEC_ENST00000527096.1_Silent_p.L1207L|PLEC_ENST00000398774.2_Silent_p.L1152L|PLEC_ENST00000354958.2_Silent_p.L1162L|PLEC_ENST00000356346.3_Silent_p.L1170L|PLEC_ENST00000436759.2_Silent_p.L1211L|PLEC_ENST00000345136.3_Silent_p.L1184L	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	1321	Globular 1.		L -> V (in dbSNP:rs3135109). {ECO:0000269|PubMed:8698233}.		apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CGCTCAAGCAACTGGGCGACC	0.716													G|||	1156	0.230831	0.028	0.2954	5008	,	,		12494	0.1429		0.4274	False		,,,				2504	0.3476				p.L1321L		.											.	PLEC-141	0			c.T3961C						.	G	,,,,,,,	296,3620		20,256,1682	5.0	6.0	6.0		3631,3508,3484,3961,3454,3550,3562,3550	4.4	0.9	8	dbSNP_103	6	2835,5065		532,1771,1647	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	,,,,,,,	552,2027,3329	GG,GA,AA		35.8861,7.5587,26.498	,,,,,,,	1211/4575,1170/4534,1162/4526,1321/4685,1152/4516,1184/4548,1188/4552,1184/4548	145001784	3131,8685	1958	3950	5908	SO:0001819	synonymous_variant	5339	exon27			CAAGCAACTGGGC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.3961T>C	8.37:g.145001784A>G		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	23	16	NM_201380	0	0	12	38	26	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																			G|0.246;A|0.754		0.716	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
SCRT1	83482	hgsc.bcm.edu	37	8	145557497	145557497	+	Missense_Mutation	SNP	A	A	C	rs7013127	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr8:145557497A>C	ENST00000332135.4	-	2	508	c.397T>G	c.(397-399)Tct>Gct	p.S133A		NM_031309.4	NP_112599.2	Q9BWW7	SCRT1_HUMAN	scratch family zinc finger 1	133			S -> A (in dbSNP:rs7013127). {ECO:0000269|Ref.2}.		negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of neuron migration (GO:2001222)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|upper_aerodigestive_tract(1)	3	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.94e-40)|Epithelial(56;1.35e-39)|all cancers(56;1.37e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0441)|Colorectal(110;0.055)			GCGGCGGCAGAGCCGGCATTG	0.776													c|||	4719	0.942292	0.9418	0.9568	5008	,	,		3920	0.9921		0.8956	False		,,,				2504	0.9294				p.S133A		.											.	.	0			c.T397G						.						1.0	1.0	1.0					8																	145557497		634	1472	2106	SO:0001583	missense	83482	exon2			CGGCAGAGCCGGC	BC014675	CCDS6421.1	8q24.3	2013-10-09	2013-10-09		ENSG00000170616	ENSG00000261678		"""Zinc fingers, C2H2-type"""	15950	protein-coding gene	gene with protein product		605858	"""scratch (drosophila homolog) 1, zinc finger protein"", ""scratch homolog 1, zinc finger protein (Drosophila)"""			11274425	Standard	NM_031309		Approved	DKFZp547F072, ZNF898	uc003zbw.1	Q9BWW7	OTTHUMG00000165229	ENST00000332135.4:c.397T>G	8.37:g.145557497A>C	ENSP00000331692:p.Ser133Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	6	NM_031309	0	0	0	0	0	A8MX66|Q96C52	Missense_Mutation	SNP	ENST00000332135.4	37	CCDS6421.1	1975	0.9043040293040293	396	0.8048780487804879	339	0.93646408839779	552	0.965034965034965	688	0.9076517150395779	c	0.007	-1.995963	0.00435	.	.	ENSG00000170616	ENST00000332135	T	0.06933	3.24	0.926	-0.0566	0.13805	.	.	.	.	.	T	0.00012	0.0000	N	0.02539	-0.55	0.58432	P	5.999999999950489E-6	B	0.02656	0.0	B	0.01281	0.0	T	0.33879	-0.9851	8	0.05525	T	0.97	5.8842	6.2142	0.20646	0.3034:0.6966:0.0:0.0	rs7013127	133	Q9BWW7	SCRT1_HUMAN	A	133	ENSP00000331692:S133A	ENSP00000331692:S133A	S	-	1	0	SCRT1	145528305	.	.	0.675000	0.29917	0.381000	0.30169	.	.	-1.712000	0.01393	-3.289000	0.00047	TCT	A|0.096;C|0.904		0.776	SCRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382800.2	NM_031309	
MFSD3	113655	broad.mit.edu;bcgsc.ca	37	8	145736053	145736053	+	Silent	SNP	C	C	A			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr8:145736053C>A	ENST00000301327.4	+	3	1163	c.903C>A	c.(901-903)gtC>gtA	p.V301V	RECQL4_ENST00000532237.1_5'Flank|CTD-2517M22.17_ENST00000580385.1_RNA	NM_138431.1	NP_612440.1	Q96ES6	MFSD3_HUMAN	major facilitator superfamily domain containing 3	301	Leu-rich.				transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				central_nervous_system(2)|endometrium(1)|kidney(1)|lung(4)	8	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			CTGCCTTGGTCTTCCACCTGG	0.647																																					p.V301V		.											.	MFSD3-69	0			c.C903A						.						71.0	78.0	75.0					8																	145736053		2203	4296	6499	SO:0001819	synonymous_variant	113655	exon3			CTTGGTCTTCCAC		CCDS6431.1	8q24.3	2005-11-17			ENSG00000167700	ENSG00000167700			25157	protein-coding gene	gene with protein product							Standard	NM_138431		Approved		uc003zdi.1	Q96ES6	OTTHUMG00000165177	ENST00000301327.4:c.903C>A	8.37:g.145736053C>A		Somatic	44	0		WXS	Illumina GAIIx	Phase_I	74	5	NM_138431	0	0	30	33	3		Silent	SNP	ENST00000301327.4	37	CCDS6431.1																																																																																			.		0.647	MFSD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382478.2	NM_138431	
ZNF517	340385	hgsc.bcm.edu	37	8	146033347	146033347	+	Missense_Mutation	SNP	T	T	C	rs2976653	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr8:146033347T>C	ENST00000531720.1	+	4	1091	c.1046T>C	c.(1045-1047)gTg>gCg	p.V349A	ZNF517_ENST00000525105.1_Intron|ZNF517_ENST00000526178.1_Intron|ZNF517_ENST00000359971.3_Missense_Mutation_p.V349A			Q6ZMY9	ZN517_HUMAN	zinc finger protein 517	349				V -> A (in Ref. 1; BAD18586). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(2)|lung(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_cancers(97;1.03e-11)|all_epithelial(106;6.69e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;5.47e-39)|OV - Ovarian serous cystadenocarcinoma(54;6.38e-39)|all cancers(56;5.47e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)			GACGGCGGCGTGGGGCAGGGC	0.746													C|||	4981	0.994609	1.0	1.0	5008	,	,		12856	1.0		0.994	False		,,,				2504	0.9785				p.V349A		.											.	ZNF517-90	0			c.T1046C						.	C	ALA/VAL	3411,3		1704,3,0	3.0	5.0	4.0		1046	-0.8	0.0	8	dbSNP_101	4	7050,46		3502,46,0	no	missense	ZNF517	NM_213605.2	64	5206,49,0	CC,CT,TT		0.6483,0.0879,0.4662	benign	349/493	146033347	10461,49	1707	3548	5255	SO:0001583	missense	340385	exon5			GCGGCGTGGGGCA	AK096527	CCDS6434.1	8q24.3	2013-01-08				ENSG00000197363		"""Zinc fingers, C2H2-type"", ""-"""	27984	protein-coding gene	gene with protein product							Standard	NM_213605		Approved		uc003zed.1	Q6ZMY9		ENST00000531720.1:c.1046T>C	8.37:g.146033347T>C	ENSP00000436103:p.Val349Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	12	12	NM_213605	0	0	0	2	2		Missense_Mutation	SNP	ENST00000531720.1	37	CCDS6434.1	2179|2179	0.9977106227106227|0.9977106227106227	492|492	1.0|1.0	362|362	1.0|1.0	572|572	1.0|1.0	753|753	0.9934036939313984|0.9934036939313984	C|C	0.021|0.021	-1.418607|-1.418607	0.01136|0.01136	0.999121|0.999121	0.993517|0.993517	ENSG00000197363|ENSG00000197363	ENST00000359971;ENST00000531720|ENST00000529429	T;T|.	0.05319|.	3.46;3.46|.	2.17|2.17	-0.838|-0.838	0.10762|0.10762	.|.	.|.	.|.	.|.	.|.	T|T	0.00012|0.00012	0.0000|0.0000	L|L	0.35644|0.35644	1.08|1.08	0.80722|0.80722	P|P	0.0|0.0	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|T	0.21449|0.21449	-1.0245|-1.0245	8|4	0.59425|.	D|.	0.04|.	.|.	0.241|0.241	0.00192|0.00192	0.362:0.2246:0.2135:0.1999|0.362:0.2246:0.2135:0.1999	rs2976653;rs59817342|rs2976653;rs59817342	349|.	Q6ZMY9|.	ZN517_HUMAN|.	A|R	349|316	ENSP00000353058:V349A;ENSP00000436103:V349A|.	ENSP00000353058:V349A|.	V|W	+|+	2|1	0|0	ZNF517|ZNF517	146004151|146004151	0.001000|0.001000	0.12720|0.12720	0.002000|0.002000	0.10522|0.10522	0.004000|0.004000	0.04260|0.04260	-0.400000|-0.400000	0.07241|0.07241	-0.612000|-0.612000	0.05701|0.05701	-1.157000|-1.157000	0.01802|0.01802	GTG|TGG	G|0.992;C|0.006		0.746	ZNF517-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382642.1	XM_291261	
C9orf66	157983	hgsc.bcm.edu	37	9	214706	214706	+	Missense_Mutation	SNP	G	G	C	rs540473	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr9:214706G>C	ENST00000382387.2	-	1	1187	c.691C>G	c.(691-693)Cga>Gga	p.R231G	DOCK8_ENST00000432829.2_5'Flank|DOCK8_ENST00000453981.1_5'Flank	NM_152569.2	NP_689782.2	Q5T8R8	CI066_HUMAN	chromosome 9 open reading frame 66	231	Arg-rich.		R -> G (in dbSNP:rs540473).							central_nervous_system(1)|cervix(1)|kidney(1)|skin(1)	4	all_lung(41;0.218)	all_cancers(5;2.09e-12)|all_epithelial(5;6.16e-09)|all_lung(10;1.15e-08)|Lung NSC(10;1.91e-08)|Acute lymphoblastic leukemia(5;0.00457)|all_hematologic(5;0.0332)|Breast(48;0.0646)|Prostate(43;0.137)	Kidney(42;0.112)|KIRC - Kidney renal clear cell carcinoma(5;0.157)	all cancers(5;0.000704)|Lung(218;0.00755)|GBM - Glioblastoma multiforme(5;0.0149)|Epithelial(6;0.0154)		CCCCAGTATCGGGAGGCCAGT	0.791													C|||	2724	0.54393	0.4856	0.5504	5008	,	,		9921	0.7401		0.4324	False		,,,				2504	0.5307				p.R231G		.											.	C9orf66-514	0			c.C691G						.	C	GLY/ARG	1470,1990		362,746,622	3.0	4.0	4.0		691	1.7	0.9	9	dbSNP_83	4	2548,4318		590,1368,1475	no	missense	C9orf66	NM_152569.2	125	952,2114,2097	CC,CG,GG		37.1104,42.4855,38.9115	benign	231/296	214706	4018,6308	1730	3433	5163	SO:0001583	missense	157983	exon1			AGTATCGGGAGGC	AK055720	CCDS6439.1	9p24.3	2008-02-05			ENSG00000183784	ENSG00000183784			26436	protein-coding gene	gene with protein product							Standard	NM_152569		Approved	FLJ31158	uc003zge.4	Q5T8R8	OTTHUMG00000021017	ENST00000382387.2:c.691C>G	9.37:g.214706G>C	ENSP00000371824:p.Arg231Gly	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_152569	0	0	0	0	0	Q96NB0	Missense_Mutation	SNP	ENST00000382387.2	37	CCDS6439.1	1127	0.5160256410256411	240	0.4878048780487805	182	0.5027624309392266	387	0.6765734265734266	318	0.41952506596306066	.	6.200	0.405074	0.11754	0.424855	0.371104	ENSG00000183784	ENST00000382387	T	0.22743	1.94	3.91	1.74	0.24563	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.54753	P	1.7000000000044757E-5	B	0.02656	0.0	B	0.01281	0.0	T	0.25813	-1.0121	8	0.87932	D	0	.	11.1247	0.48310	0.0:0.4274:0.5726:0.0	rs540473;rs13292950	231	Q5T8R8	CI066_HUMAN	G	231	ENSP00000371824:R231G	ENSP00000371824:R231G	R	-	1	2	C9orf66	204706	0.960000	0.32886	0.885000	0.34714	0.005000	0.04900	0.456000	0.21859	0.370000	0.24538	-0.335000	0.08231	CGA	G|0.516;C|0.484		0.791	C9orf66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055436.1	NM_152569	
TUSC1	286319	hgsc.bcm.edu	37	9	25678122	25678122	+	Silent	SNP	G	G	C	rs72631814	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr9:25678122G>C	ENST00000358022.3	-	1	734	c.198C>G	c.(196-198)gcC>gcG	p.A66A		NM_001004125.2	NP_001004125.1	Q2TAM9	TUSC1_HUMAN	tumor suppressor candidate 1	66										kidney(1)	1	all_hematologic(1;0.197)	all_neural(3;5.42e-18)|Glioma(3;5.54e-17)		GBM - Glioblastoma multiforme(1;1.51e-108)|Lung(42;2.88e-14)|LUSC - Lung squamous cell carcinoma(38;3.16e-11)		CCGCCAGGTCGGCAAACCGCT	0.776													G|||	885	0.176717	0.1324	0.1772	5008	,	,		7019	0.1151		0.3002	False		,,,				2504	0.1728				p.A66A	Pancreas(19;648 672 25630 30820 31331)	.											.	TUSC1-90	0			c.C198G						.	G		389,3633		24,341,1646	6.0	6.0	6.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	198	0.6	1.0	9	dbSNP_130	6	1826,6086		225,1376,2355	no	coding-synonymous	TUSC1	NM_001004125.2		249,1717,4001	CC,CG,GG		23.0789,9.6718,18.5604		66/213	25678122	2215,9719	2011	3956	5967	SO:0001819	synonymous_variant	286319	exon1			CAGGTCGGCAAAC	AY168647	CCDS34999.1	9p21.2	2014-05-22			ENSG00000198680	ENSG00000198680			31010	protein-coding gene	gene with protein product		610529				15208665	Standard	NM_001004125		Approved	TSG-9	uc003zpx.3	Q2TAM9	OTTHUMG00000159591	ENST00000358022.3:c.198C>G	9.37:g.25678122G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	48	35	NM_001004125	0	0	1	4	3	A0PJ78|Q67GI3|Q86SS1|Q8TAH8	Silent	SNP	ENST00000358022.3	37	CCDS34999.1																																																																																			G|0.807;C|0.193		0.776	TUSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356351.1	NM_001004125	
C9orf41	138199	broad.mit.edu	37	9	77642981	77642983	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr9:77642981_77642983delCTC	ENST00000376834.3	-	1	327_329	c.175_177delGAG	c.(175-177)gagdel	p.E59del	C9orf41_ENST00000376830.3_In_Frame_Del_p.E59del|C9orf41_ENST00000376837.3_In_Frame_Del_p.E59del	NM_152420.1	NP_689633.1	Q8N4J0	CI041_HUMAN	chromosome 9 open reading frame 41	59										endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|skin(1)|urinary_tract(2)	17						GCTCAAGCCTCTCCTCCTCCTCC	0.695																																					p.59_59del		.											.	C9orf41-92	0			c.175_177del						.			112,4060		5,102,1979						-3.0	0.9			14	316,7808		9,298,3755	no	coding	C9orf41	NM_152420.1		14,400,5734	A1A1,A1R,RR		3.8897,2.6846,3.4808				428,11868				SO:0001651	inframe_deletion	138199	exon1			AAGCCTCTCCTCC	AK098661	CCDS6649.1	9q21.31	2012-03-15			ENSG00000156017	ENSG00000156017			23435	protein-coding gene	gene with protein product						12477932	Standard	NM_152420		Approved	FLJ25795	uc004ajq.3	Q8N4J0	OTTHUMG00000020032	ENST00000376834.3:c.175_177delGAG	9.37:g.77642990_77642992delCTC	ENSP00000366030:p.Glu59del	Somatic	67	0		WXS	Illumina GAIIx	Phase_I	316	8	NM_152420	0	0	0	0	0	Q7Z383|Q8N7C5	In_Frame_Del	DEL	ENST00000376834.3	37	CCDS6649.1																																																																																			.		0.695	C9orf41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052703.1	NM_152420	
TLE4	7091	broad.mit.edu	37	9	82267611	82267611	+	Missense_Mutation	SNP	G	G	C	rs41307447	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr9:82267611G>C	ENST00000376552.2	+	7	1512	c.494G>C	c.(493-495)aGc>aCc	p.S165T	TLE4_ENST00000376537.4_Missense_Mutation_p.S165T|TLE4_ENST00000265284.6_Missense_Mutation_p.S140T|TLE4_ENST00000376534.4_5'UTR|TLE4_ENST00000376544.3_Missense_Mutation_p.S165T|TLE4_ENST00000455913.1_3'UTR|TLE4_ENST00000376520.4_Missense_Mutation_p.S165T	NM_007005.3	NP_008936.2	Q04727	TLE4_HUMAN	transducin-like enhancer of split 4	165	Gly/Pro-rich (GP domain).				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|Wnt signaling pathway (GO:0016055)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|transcription corepressor activity (GO:0003714)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	39						CCCATCGGTAGCAGTGCCGGG	0.552													G|||	7	0.00139776	0.0008	0.0	5008	,	,		16241	0.0		0.006	False		,,,				2504	0.0				p.S165T		.											.	TLE4-524	0			c.G494C						.	G	THR/SER	4,3924		0,4,1960	95.0	100.0	98.0		494	6.0	1.0	9	dbSNP_127	98	28,8244		0,28,4108	yes	missense	TLE4	NM_007005.3	58	0,32,6068	CC,CG,GG		0.3385,0.1018,0.2623	benign	165/774	82267611	32,12168	1964	4136	6100	SO:0001583	missense	7091	exon7			TCGGTAGCAGTGC	M99439	CCDS43837.1, CCDS65069.1, CCDS65070.1, CCDS75851.1	9q21.32	2014-03-07	2014-03-07		ENSG00000106829	ENSG00000106829		"""WD repeat domain containing"""	11840	protein-coding gene	gene with protein product		605132	"""transducin-like enhancer of split 4, homolog of Drosophila E(sp1)"", ""transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila)"""			8365415	Standard	XM_005252167		Approved	E(spI), ESG, GRG4	uc004alc.3	Q04727	OTTHUMG00000020072	ENST00000376552.2:c.494G>C	9.37:g.82267611G>C	ENSP00000365735:p.Ser165Thr	Somatic	80	1		WXS	Illumina GAIIx	Phase_I	108	5	NM_007005	0	0	22	22	0	F8W6T6|Q3ZCS1|Q5T1Y2|Q6PCB3|Q9BZ07|Q9BZ08|Q9BZ09|Q9NSL3|Q9ULF9	Missense_Mutation	SNP	ENST00000376552.2	37	CCDS43837.1	6	0.0027472527472527475	1	0.0020325203252032522	0	0.0	0	0.0	5	0.006596306068601583	G	15.79	2.938352	0.52972	0.001018	0.003385	ENSG00000106829	ENST00000376552;ENST00000376544;ENST00000376520;ENST00000399288;ENST00000435650;ENST00000376537;ENST00000265284;ENST00000425506;ENST00000428713;ENST00000490347	T;T;T;T;T;T;T;T;T	0.47528	0.84;0.85;0.92;0.87;0.9;0.96;0.89;1.48;1.7	6.04	6.04	0.98038	.	0.123295	0.64402	D	0.000001	T	0.34978	0.0916	L	0.42744	1.35	0.80722	D	1	B;B;B;B	0.25351	0.002;0.124;0.009;0.0	B;B;B;B	0.20767	0.012;0.031;0.013;0.003	T	0.18618	-1.0331	10	0.17832	T	0.49	-23.693	20.5948	0.99439	0.0:0.0:1.0:0.0	rs41307447	140;165;165;165	F8W6T6;Q04727-2;Q04727-3;Q04727	.;.;.;TLE4_HUMAN	T	165;165;165;179;179;165;140;163;150;35	ENSP00000365735:S165T;ENSP00000365727:S165T;ENSP00000365703:S165T;ENSP00000415423:S179T;ENSP00000365720:S165T;ENSP00000265284:S140T;ENSP00000412567:S163T;ENSP00000409313:S150T;ENSP00000417844:S35T	ENSP00000265284:S140T	S	+	2	0	TLE4	81457431	1.000000	0.71417	0.998000	0.56505	0.691000	0.40173	6.582000	0.74049	2.873000	0.98535	0.563000	0.77884	AGC	G|0.997;C|0.003		0.552	TLE4-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052792.4	XM_212237	
C9orf170	401535	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	89771511	89771511	+	Silent	SNP	G	G	T			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr9:89771511G>T	ENST00000375941.2	+	2	279	c.192G>T	c.(190-192)ctG>ctT	p.L64L		NM_001001709.2	NP_001001709.1	A2RU37	CI170_HUMAN	chromosome 9 open reading frame 170	64										large_intestine(3)|lung(2)|prostate(1)	6						ggaaaaccctgactaatacag	0.383																																					p.L64L		.											.	C9orf170-90	0			c.G192T						.						29.0	28.0	28.0					9																	89771511		2203	4298	6501	SO:0001819	synonymous_variant	401535	exon2			AACCCTGACTAAT	AK127445	CCDS35058.1	9q21.33	2009-02-11			ENSG00000204446	ENSG00000204446			33817	protein-coding gene	gene with protein product							Standard	NM_001001709		Approved	FLJ45537	uc004apa.1	A2RU37	OTTHUMG00000159587	ENST00000375941.2:c.192G>T	9.37:g.89771511G>T		Somatic	85	0		WXS	Illumina GAIIx	Phase_I	78	15	NM_001001709	0	0	0	0	0		Silent	SNP	ENST00000375941.2	37	CCDS35058.1																																																																																			.		0.383	C9orf170-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356346.1	NM_001001709	
GALNT12	79695	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	101589096	101589096	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr9:101589096G>A	ENST00000375011.3	+	3	604	c.604G>A	c.(604-606)Gcc>Acc	p.A202T		NM_024642.4	NP_078918.3	Q8IXK2	GLT12_HUMAN	polypeptide N-acetylgalactosaminyltransferase 12	202	Catalytic subdomain A.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(1)|endometrium(2)|large_intestine(3)|lung(8)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	17		Acute lymphoblastic leukemia(62;0.0559)				CCTGATCCGCGCCAACAAGAG	0.632																																					p.A202T		.											.	GALNT12-92	0			c.G604A						.						36.0	35.0	35.0					9																	101589096		2203	4299	6502	SO:0001583	missense	79695	exon3			ATCCGCGCCAACA	AB078146	CCDS6737.1	9q22.33	2014-03-13	2014-03-13		ENSG00000119514	ENSG00000119514	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	19877	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 12"""	610290	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 12 (GalNAc-T12)"""			12135769	Standard	NM_024642		Approved	GalNAc-T12	uc004ayz.3	Q8IXK2	OTTHUMG00000020348	ENST00000375011.3:c.604G>A	9.37:g.101589096G>A	ENSP00000364150:p.Ala202Thr	Somatic	39	0		WXS	Illumina GAIIx	Phase_I	119	34	NM_024642	0	0	2	3	1	Q5TCF7|Q8NG54|Q96CT9|Q9H771	Missense_Mutation	SNP	ENST00000375011.3	37	CCDS6737.1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.631897	0.87660	.	.	ENSG00000119514	ENST00000375011	T	0.60672	0.17	5.96	5.96	0.96718	Glycosyl transferase, family 2 (1);	0.000000	0.85682	D	0.000000	T	0.50650	0.1628	N	0.02736	-0.51	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.49303	-0.8954	10	0.02654	T	1	.	17.902	0.88907	0.0:0.0:1.0:0.0	.	202	Q8IXK2	GLT12_HUMAN	T	202	ENSP00000364150:A202T	ENSP00000364150:A202T	A	+	1	0	GALNT12	100628917	1.000000	0.71417	0.347000	0.25668	0.705000	0.40729	7.946000	0.87746	2.814000	0.96858	0.655000	0.94253	GCC	.		0.632	GALNT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053382.1	NM_024642	
GRIN3A	116443	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	104449164	104449164	+	Missense_Mutation	SNP	C	C	T	rs145326290		TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr9:104449164C>T	ENST00000361820.3	-	2	1618	c.1018G>A	c.(1018-1020)Gaa>Aaa	p.E340K		NM_133445.2	NP_597702.2	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3A	340					calcium ion transport (GO:0006816)|dendrite development (GO:0016358)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|response to ethanol (GO:0045471)|rhythmic process (GO:0048511)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|identical protein binding (GO:0042802)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|protein phosphatase 2A binding (GO:0051721)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(44)|ovary(4)|pancreas(1)|skin(7)|upper_aerodigestive_tract(1)	80		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Acetylcysteine(DB06151)|Amantadine(DB00915)|Atomoxetine(DB00289)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Gabapentin(DB00996)|Halothane(DB01159)|Ketamine(DB01221)|Ketobemidone(DB06738)|Memantine(DB01043)|Methadone(DB00333)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Procaine(DB00721)|Secobarbital(DB00418)|Tramadol(DB00193)	GTTGTAATTTCGAAAATCCGC	0.517													c|||	1	0.000199681	0.0	0.0	5008	,	,		20775	0.001		0.0	False		,,,				2504	0.0				p.E340K		.											.	GRIN3A-96	0			c.G1018A						.						69.0	68.0	68.0					9																	104449164		2203	4300	6503	SO:0001583	missense	116443	exon2			TAATTTCGAAAAT		CCDS6758.1	9q31.1	2012-08-29			ENSG00000198785	ENSG00000198785		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16767	protein-coding gene	gene with protein product		606650					Standard	NM_133445		Approved	GluN3A	uc004bbp.2	Q8TCU5	OTTHUMG00000020387	ENST00000361820.3:c.1018G>A	9.37:g.104449164C>T	ENSP00000355155:p.Glu340Lys	Somatic	82	0		WXS	Illumina GAIIx	Phase_I	67	16	NM_133445	0	0	0	0	0	B3DLF9|Q5VTR3|Q8TF29|Q8WXI6	Missense_Mutation	SNP	ENST00000361820.3	37	CCDS6758.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	c	13.11	2.139742	0.37728	.	.	ENSG00000198785	ENST00000361820	D	0.84873	-1.91	5.83	3.0	0.34707	.	0.344358	0.27151	N	0.020683	T	0.76499	0.3996	L	0.44542	1.39	0.31129	N	0.707924	B	0.28082	0.2	B	0.25140	0.058	T	0.66093	-0.6009	10	0.10902	T	0.67	.	11.6525	0.51297	0.0:0.7045:0.2327:0.0628	.	340	Q8TCU5	NMD3A_HUMAN	K	340	ENSP00000355155:E340K	ENSP00000355155:E340K	E	-	1	0	GRIN3A	103488985	0.991000	0.36638	0.947000	0.38551	0.815000	0.46073	1.444000	0.35068	0.382000	0.24878	-0.213000	0.12676	GAA	C|0.999;T|0.000		0.517	GRIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053453.1		
CRB2	286204	hgsc.bcm.edu	37	9	126135831	126135831	+	Silent	SNP	T	T	C	rs7848449	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr9:126135831T>C	ENST00000373631.3	+	10	3022	c.3021T>C	c.(3019-3021)gcT>gcC	p.A1007A	CRB2_ENST00000359999.3_Silent_p.A1007A|CRB2_ENST00000373629.2_Silent_p.A675A	NM_173689.5	NP_775960.4	Q5IJ48	CRUM2_HUMAN	crumbs family member 2	1007	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cardiovascular system development (GO:0072358)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|mesoderm formation (GO:0001707)|negative regulation of endopeptidase activity (GO:0010951)|notochord formation (GO:0014028)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|somitogenesis (GO:0001756)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)			NS(2)|breast(1)|cervix(1)|endometrium(2)|lung(11)|ovary(1)|prostate(2)|skin(3)	23						TCCTGCTGGCTGAGAACTTCA	0.766													C|||	691	0.137979	0.2436	0.1383	5008	,	,		8285	0.0556		0.0944	False		,,,				2504	0.1247				p.A1007A		.											.	CRB2-91	0			c.T3021C						.	C		511,2581		46,419,1081	6.0	6.0	6.0		3021	-6.8	0.9	9	dbSNP_116	6	457,5659		17,423,2618	no	coding-synonymous	CRB2	NM_173689.5		63,842,3699	CC,CT,TT		7.4722,16.5265,10.5126		1007/1286	126135831	968,8240	1546	3058	4604	SO:0001819	synonymous_variant	286204	exon10			GCTGGCTGAGAAC	AK095783	CCDS6852.2	9q33.2	2014-02-06	2014-02-06		ENSG00000148204	ENSG00000148204			18688	protein-coding gene	gene with protein product		609720	"""crumbs homolog 2 (Drosophila)"""			14767562	Standard	XM_005251934		Approved	FLJ38464, FLJ16786	uc004bnx.1	Q5IJ48	OTTHUMG00000020638	ENST00000373631.3:c.3021T>C	9.37:g.126135831T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	16	6	NM_173689	0	0	0	0	0	A2A3N4|Q0QD46|Q5JS41|Q5JS43|Q6ZTA9|Q6ZWI6	Silent	SNP	ENST00000373631.3	37	CCDS6852.2																																																																																			T|0.886;C|0.114		0.766	CRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053990.3	NM_173689	
TMEM8C	389827	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	136379902	136379902	+	Nonsense_Mutation	SNP	C	C	T			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr9:136379902C>T	ENST00000339996.3	-	5	623	c.522G>A	c.(520-522)tgG>tgA	p.W174*	TMEM8C_ENST00000413714.1_5'Flank	NM_001080483.2	NP_001073952.1	A6NI61	TMM8C_HUMAN	transmembrane protein 8C	174					muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|plasma membrane fusion (GO:0045026)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|large_intestine(2)|lung(4)	8						AAGTGTAGTCCCAGTCCTGCG	0.647																																					p.W174X		.											.	TMEM8C-68	0			c.G522A						.						88.0	84.0	85.0					9																	136379902		2203	4300	6503	SO:0001587	stop_gained	389827	exon5			GTAGTCCCAGTCC	BX324209	CCDS35170.1	9q34.2	2009-06-19		2009-06-19	ENSG00000187616	ENSG00000187616			33778	protein-coding gene	gene with protein product	"""transmembrane protein 226"""	615345					Standard	NM_001080483		Approved	TMEM226	uc011mdk.2	A6NI61	OTTHUMG00000131685	ENST00000339996.3:c.522G>A	9.37:g.136379902C>T	ENSP00000419712:p.Trp174*	Somatic	68	0		WXS	Illumina GAIIx	Phase_I	103	32	NM_001080483	0	0	0	0	0		Nonsense_Mutation	SNP	ENST00000339996.3	37	CCDS35170.1	.	.	.	.	.	.	.	.	.	.	c	19.66	3.868564	0.72065	.	.	ENSG00000187616	ENST00000339996	.	.	.	3.78	3.78	0.43462	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	-16.0741	14.5513	0.68068	0.0:1.0:0.0:0.0	.	.	.	.	X	174	.	ENSP00000419712:W174X	W	-	3	0	TMEM8C	135369723	1.000000	0.71417	0.993000	0.49108	0.641000	0.38312	7.204000	0.77872	1.825000	0.53177	0.205000	0.17691	TGG	.		0.647	TMEM8C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356200.2	NM_001080483	
LRRC26	389816	hgsc.bcm.edu	37	9	140064315	140064315	+	Missense_Mutation	SNP	C	C	A	rs7019671	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr9:140064315C>A	ENST00000371542.3	-	1	188	c.81G>T	c.(79-81)caG>caT	p.Q27H	MIR3621_ENST00000580529.1_RNA|TMEM210_ENST00000430332.1_5'Flank|RP11-350O14.18_ENST00000568665.1_RNA	NM_001013653.2	NP_001013675.1	Q2I0M4	LRC26_HUMAN	leucine rich repeat containing 26	27				Q -> H (in Ref. 1; ABC79623 and 3; AAI40912). {ECO:0000305}.	ion transport (GO:0006811)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|voltage-gated potassium channel complex (GO:0008076)	potassium channel regulator activity (GO:0015459)					all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.000858)		TGGCCGACACCTGGGCCCAGA	0.766													C|||	1433	0.286142	0.1415	0.3833	5008	,	,		11222	0.1567		0.3857	False		,,,				2504	0.4438				p.Q27H		.											.	LRRC26-22	0			c.G81T						.	C	HIS/GLN	338,2078		47,244,917	2.0	2.0	2.0		81	-5.4	0.0	9	dbSNP_116	2	1741,3449		368,1005,1222	no	missense	LRRC26	NM_001013653.2	24	415,1249,2139	AA,AC,CC		33.5453,13.9901,27.3337	probably-damaging	27/335	140064315	2079,5527	1208	2595	3803	SO:0001583	missense	389816	exon1			CGACACCTGGGCC	DQ355157	CCDS35184.1	9q34.3	2007-06-13			ENSG00000184709	ENSG00000184709			31409	protein-coding gene	gene with protein product		613505					Standard	NM_001013653		Approved	bA350O14.10, OTTHUMG00000020980	uc004clp.2	Q2I0M4	OTTHUMG00000020980	ENST00000371542.3:c.81G>T	9.37:g.140064315C>A	ENSP00000360597:p.Gln27His	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	4	NM_001013653	0	0	0	0	0	B9EIR7|C3RUL3|Q5VSG2	Missense_Mutation	SNP	ENST00000371542.3	37	CCDS35184.1	582	0.2664835164835165	61	0.12398373983739837	140	0.3867403314917127	77	0.1346153846153846	304	0.40105540897097625	C	12.58	1.979230	0.34942	0.139901	0.335453	ENSG00000184709	ENST00000371542	T	0.66280	-0.2	3.5	-5.42	0.02640	.	.	.	.	.	T	0.00012	0.0000	N	0.24115	0.695	0.80722	P	0.0	B	0.10296	0.003	B	0.04013	0.001	T	0.37220	-0.9715	8	0.46703	T	0.11	.	1.2009	0.01884	0.1317:0.2276:0.2613:0.3794	rs7019671	27	Q2I0M4	LRC26_HUMAN	H	27	ENSP00000360597:Q27H	ENSP00000360597:Q27H	Q	-	3	2	LRRC26	139184136	0.000000	0.05858	0.000000	0.03702	0.085000	0.17905	-0.219000	0.09228	-1.024000	0.03338	-0.379000	0.06801	CAG	C|0.733;A|0.267		0.766	LRRC26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055307.1	NM_001013653	
NLGN4X	57502	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	5821337	5821337	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chrX:5821337G>A	ENST00000381095.3	-	5	2009	c.1382C>T	c.(1381-1383)gCg>gTg	p.A461V	NLGN4X_ENST00000381092.1_Missense_Mutation_p.A461V|NLGN4X_ENST00000275857.6_Missense_Mutation_p.A461V|NLGN4X_ENST00000538097.1_Missense_Mutation_p.A461V|NLGN4X_ENST00000381093.2_Missense_Mutation_p.A481V	NM_001282145.1|NM_001282146.1|NM_181332.1	NP_001269074.1|NP_001269075.1|NP_851849.1	Q8N0W4	NLGNX_HUMAN	neuroligin 4, X-linked	461					adult behavior (GO:0030534)|brainstem development (GO:0003360)|cell-cell junction organization (GO:0045216)|cerebellum development (GO:0021549)|learning (GO:0007612)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|neuron cell-cell adhesion (GO:0007158)|neuron differentiation (GO:0030182)|organ growth (GO:0035265)|presynaptic membrane assembly (GO:0097105)|social behavior (GO:0035176)|synapse organization (GO:0050808)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|chloride ion binding (GO:0031404)|neurexin family protein binding (GO:0042043)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)			breast(1)|cervix(2)|endometrium(4)|large_intestine(21)|lung(39)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	81						GCCGTACTGCGCGTGCAGGTC	0.622																																					p.A461V		.											.	NLGN4X-195	0			c.C1382T						.						33.0	31.0	32.0					X																	5821337		2203	4297	6500	SO:0001583	missense	57502	exon5			TACTGCGCGTGCA	AB033086	CCDS14126.1	Xp22.33	2008-02-05	2004-05-21	2004-05-26	ENSG00000146938	ENSG00000146938			14287	protein-coding gene	gene with protein product		300427	"""neuroligin 4"""	NLGN4		10574462	Standard	XM_005274564		Approved	KIAA1260, NLGN, HLNX	uc004crr.3	Q8N0W4	OTTHUMG00000021093	ENST00000381095.3:c.1382C>T	X.37:g.5821337G>A	ENSP00000370485:p.Ala461Val	Somatic	170	0		WXS	Illumina GAIIx	Phase_I	197	99	NM_181332	0	0	0	0	0	Q6UX10|Q9ULG0	Missense_Mutation	SNP	ENST00000381095.3	37	CCDS14126.1	.	.	.	.	.	.	.	.	.	.	G	13.57	2.278032	0.40294	.	.	ENSG00000146938	ENST00000381095;ENST00000381093;ENST00000275857;ENST00000381092;ENST00000538097	T;T;T;T;T	0.68765	-0.35;-0.35;-0.35;-0.35;-0.35	3.93	3.93	0.45458	Carboxylesterase, type B (1);	.	.	.	.	T	0.79464	0.4450	M	0.73753	2.245	0.80722	D	1	D;D;P	0.89917	0.963;1.0;0.949	B;D;B	0.65010	0.418;0.931;0.055	T	0.83035	-0.0160	9	0.87932	D	0	.	14.4947	0.67678	0.0:0.0:1.0:0.0	.	518;461;481	A6NMU8;Q8N0W4;Q8N0W4-2	.;NLGNX_HUMAN;.	V	461;481;461;461;461	ENSP00000370485:A461V;ENSP00000370483:A481V;ENSP00000275857:A461V;ENSP00000370482:A461V;ENSP00000439203:A461V	ENSP00000275857:A461V	A	-	2	0	NLGN4X	5831337	1.000000	0.71417	0.717000	0.30585	0.005000	0.04900	8.442000	0.90317	1.579000	0.49836	0.600000	0.82982	GCG	.		0.622	NLGN4X-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055673.1	NM_020742	
HDHD1	8226	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	7023778	7023778	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chrX:7023778A>C	ENST00000381077.5	-	2	239	c.163T>G	c.(163-165)Tta>Gta	p.L55V	HDHD1_ENST00000498474.2_5'UTR|HDHD1_ENST00000412827.2_Intron|HDHD1_ENST00000424830.2_Missense_Mutation_p.L78V|HDHD1_ENST00000540122.1_Missense_Mutation_p.L55V	NM_001178136.1|NM_012080.4	NP_001171607.1|NP_036212.3	Q08623	HDHD1_HUMAN	haloacid dehalogenase-like hydrolase domain containing 1	55					nucleotide metabolic process (GO:0009117)	extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|phosphatase activity (GO:0016791)			breast(2)|large_intestine(1)|lung(3)	6						GCCGCCTCTAATGCCTTCTTA	0.448																																					p.L78V		.											.	HDHD1-130	0			c.T232G						.						65.0	60.0	61.0					X																	7023778		1883	4103	5986	SO:0001583	missense	8226	exon3			CCTCTAATGCCTT	M86934	CCDS48075.1, CCDS48076.1, CCDS55366.1, CCDS55367.1	Xp22.32	2010-07-21	2010-07-21	2010-07-21	ENSG00000130021	ENSG00000130021			16818	protein-coding gene	gene with protein product		306480	"""family with sequence similarity 16, member A, X-linked"", ""haloacid dehalogenase-like hydrolase domain containing 1A"""	FAM16AX, HDHD1A		1734713, 1284467	Standard	NM_012080		Approved	DXF68S1E, GS1	uc011mhm.1	Q08623	OTTHUMG00000021101	ENST00000381077.5:c.163T>G	X.37:g.7023778A>C	ENSP00000370467:p.Leu55Val	Somatic	253	1		WXS	Illumina GAIIx	Phase_I	173	24	NM_001135565	0	0	2	5	3	B2R7X6|B4DV93|B7Z6Q3|E9PAV8|F5GWZ2|Q53F84|Q96EB8	Missense_Mutation	SNP	ENST00000381077.5	37	CCDS48075.1	.	.	.	.	.	.	.	.	.	.	a	4.104	0.017477	0.07959	.	.	ENSG00000130021	ENST00000381077;ENST00000544385;ENST00000424830;ENST00000540122;ENST00000486446	T;T;T;T	0.05258	3.47;3.47;3.47;3.47	4.01	-6.61	0.01818	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);	0.329251	0.28230	N	0.016108	T	0.04588	0.0125	L	0.45698	1.435	0.09310	N	0.999994	B;B;B;B	0.24675	0.109;0.011;0.014;0.0	B;B;B;B	0.25759	0.038;0.063;0.028;0.009	T	0.23940	-1.0174	10	0.25751	T	0.34	-18.8253	8.4263	0.32731	0.3091:0.0:0.5652:0.1257	.	55;78;55;55	Q08623-3;E9PAV8;E7EVH9;Q08623	.;.;.;HDHD1_HUMAN	V	55;71;78;55;55	ENSP00000370467:L55V;ENSP00000396452:L78V;ENSP00000441208:L55V;ENSP00000430995:L55V	ENSP00000370467:L55V	L	-	1	2	HDHD1	7033778	0.000000	0.05858	0.000000	0.03702	0.247000	0.25773	-0.317000	0.08060	-1.751000	0.01326	-0.444000	0.05651	TTA	.		0.448	HDHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055683.2	NM_012080	
FAM9A	171482	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	8763192	8763192	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chrX:8763192C>A	ENST00000543214.1	-	7	893	c.758G>T	c.(757-759)gGa>gTa	p.G253V	FAM9A_ENST00000381003.3_Missense_Mutation_p.G253V	NM_001171186.1	NP_001164657.1	Q8IZU1	FAM9A_HUMAN	family with sequence similarity 9, member A	253	Glu-rich.|Poly-Gly.					nucleus (GO:0005634)				endometrium(11)|kidney(2)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)	18		Hepatocellular(5;0.219)				tcctcctcctcctccttcttc	0.458																																					p.G253V		.											.	FAM9A-130	0			c.G758T						.						44.0	38.0	40.0					X																	8763192		2193	4280	6473	SO:0001583	missense	171482	exon7			CCTCCTCCTCCTT		CCDS14131.1	Xp22.32	2012-11-29			ENSG00000183304	ENSG00000183304			18403	protein-coding gene	gene with protein product	"""testis expressed 39A"""	300477					Standard	NM_174951		Approved	TEX39A	uc004csg.3	Q8IZU1	OTTHUMG00000021110	ENST00000543214.1:c.758G>T	X.37:g.8763192C>A	ENSP00000440163:p.Gly253Val	Somatic	57	0		WXS	Illumina GAIIx	Phase_I	58	35	NM_174951	0	0	0	0	0	B7ZLH5|Q2M2D1	Missense_Mutation	SNP	ENST00000543214.1	37	CCDS14131.1	.	.	.	.	.	.	.	.	.	.	c	0.231	-1.021239	0.02061	.	.	ENSG00000183304	ENST00000381003;ENST00000543214	.	.	.	0.507	-1.01	0.10169	.	.	.	.	.	T	0.12518	0.0304	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.01281	0.0	T	0.23655	-1.0182	7	0.87932	D	0	.	.	.	.	.	253	Q8IZU1	FAM9A_HUMAN	V	253	.	ENSP00000370391:G253V	G	-	2	0	FAM9A	8723192	0.002000	0.14202	0.000000	0.03702	0.000000	0.00434	-1.395000	0.02516	-2.904000	0.00310	-2.528000	0.00182	GGA	.		0.458	FAM9A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055697.1	NM_174951	
FRMPD4	9758	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	12734821	12734821	+	Missense_Mutation	SNP	C	C	T	rs370344979		TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chrX:12734821C>T	ENST00000380682.1	+	15	2749	c.2243C>T	c.(2242-2244)gCg>gTg	p.A748V		NM_014728.3	NP_055543.2	Q14CM0	FRPD4_HUMAN	FERM and PDZ domain containing 4	748					positive regulation of synapse structural plasticity (GO:0051835)	cytoskeleton (GO:0005856)|dendritic spine (GO:0043197)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			breast(1)|central_nervous_system(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)	22						ACTGATGACGCGGAGGACGAG	0.562																																					p.A748V		.											.	FRMPD4-263	0			c.C2243T						.						115.0	108.0	110.0					X																	12734821		2203	4300	6503	SO:0001583	missense	9758	exon15			ATGACGCGGAGGA	AB002314	CCDS35201.1	Xp22.31	2006-02-09	2006-02-09	2006-02-09	ENSG00000169933	ENSG00000169933			29007	protein-coding gene	gene with protein product		300838	"""PDZ domain containing 10"""	PDZK10, PDZD10		9205841	Standard	NM_014728		Approved	KIAA0316	uc004cuz.2	Q14CM0	OTTHUMG00000021138	ENST00000380682.1:c.2243C>T	X.37:g.12734821C>T	ENSP00000370057:p.Ala748Val	Somatic	108	1		WXS	Illumina GAIIx	Phase_I	178	92	NM_014728	0	0	0	0	0	A8K0X9|O15032	Missense_Mutation	SNP	ENST00000380682.1	37	CCDS35201.1	.	.	.	.	.	.	.	.	.	.	C	7.699	0.692717	0.15039	.	.	ENSG00000169933	ENST00000380682;ENST00000429478;ENST00000304087	T	0.38887	1.11	5.56	2.85	0.33270	.	0.169624	0.51477	N	0.000090	T	0.26048	0.0635	L	0.28192	0.835	0.32554	N	0.53194	B;B	0.23990	0.095;0.095	B;B	0.14023	0.01;0.01	T	0.21211	-1.0252	10	0.33940	T	0.23	.	8.2837	0.31915	0.0:0.6889:0.0:0.3111	.	740;748	B7ZLE1;Q14CM0	.;FRPD4_HUMAN	V	748;739;737	ENSP00000370057:A748V	ENSP00000304583:A737V	A	+	2	0	FRMPD4	12644742	0.975000	0.34042	0.022000	0.16811	0.057000	0.15508	2.411000	0.44600	0.540000	0.28808	-0.881000	0.02953	GCG	.		0.562	FRMPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055771.1	XM_045712	
DMD	1756	broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	31196848	31196848	+	Silent	SNP	C	C	T			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chrX:31196848C>T	ENST00000357033.4	-	70	10367	c.10161G>A	c.(10159-10161)gcG>gcA	p.A3387A	DMD_ENST00000361471.4_Silent_p.A319A|DMD_ENST00000378677.2_Silent_p.A3383A|DMD_ENST00000378680.2_Silent_p.A319A|DMD_ENST00000378707.3_Silent_p.A927A|DMD_ENST00000343523.2_Silent_p.A927A|DMD_ENST00000541735.1_Silent_p.A927A|DMD_ENST00000474231.1_Silent_p.A927A|DMD_ENST00000378723.3_Silent_p.A319A|DMD_ENST00000359836.1_Silent_p.A927A|DMD_ENST00000378702.4_Silent_p.A319A	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	3387	Interaction with SYNM. {ECO:0000250}.				cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				GGGGATGCTTCGCAAAATACC	0.438																																					p.A3387A		.											.	DMD-265	0			c.G10161A						.						193.0	153.0	167.0					X																	31196848		2202	4300	6502	SO:0001819	synonymous_variant	1756	exon70			ATGCTTCGCAAAA	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.10161G>A	X.37:g.31196848C>T		Somatic	260	2		WXS	Illumina GAIIx	Phase_I	139	62	NM_004006	0	0	0	10	10	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Silent	SNP	ENST00000357033.4	37	CCDS14233.1	.	.	.	.	.	.	.	.	.	.	C	9.442	1.088198	0.20390	.	.	ENSG00000198947	ENST00000465285	.	.	.	5.3	4.4	0.53042	.	.	.	.	.	T	0.54287	0.1849	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52510	-0.8566	4	.	.	.	.	5.4673	0.16650	0.0:0.4972:0.3703:0.1325	.	.	.	.	K	1116	.	.	E	-	1	0	DMD	31106769	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.710000	0.54860	2.458000	0.83093	0.600000	0.82982	GAA	.		0.438	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006	
WDR45	11152	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	48935337	48935337	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chrX:48935337C>T	ENST00000376372.3	-	4	381	c.200G>A	c.(199-201)gGc>gAc	p.G67D	WDR45_ENST00000376368.2_Missense_Mutation_p.G67D|WDR45_ENST00000553851.1_Intron|WDR45_ENST00000396681.4_Missense_Mutation_p.G67D|WDR45_ENST00000465431.1_Intron|WDR45_ENST00000322995.8_Missense_Mutation_p.G67D|AF196779.12_ENST00000376358.3_Intron|WDR45_ENST00000473974.1_Missense_Mutation_p.G67D|WDR45_ENST00000485908.1_Intron|WDR45_ENST00000356463.3_Missense_Mutation_p.G67D	NM_001029896.1	NP_001025067.1	Q9Y484	WIPI4_HUMAN	WD repeat domain 45	67					autophagy (GO:0006914)|cell death (GO:0008219)					NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|ovary(1)|skin(1)	19						ACTACCACCGCCCACCAAGGC	0.612																																					p.G67D		.											.	WDR45-131	0			c.G200A						.						50.0	31.0	37.0					X																	48935337		2200	4299	6499	SO:0001583	missense	11152	exon5			CCACCGCCCACCA	BC003037	CCDS14318.1, CCDS35250.1	Xp11.23	2013-06-06	2004-09-02	2004-09-03	ENSG00000196998	ENSG00000196998		"""WD repeat domain containing"""	28912	protein-coding gene	gene with protein product	"""neurodegeneration with brain iron accumulation 5"""	300526	"""WD repeat domain, X-linked 1"""	WDRX1		12477932	Standard	NM_007075		Approved	JM5, WIPI4, NBIA5	uc004dmk.1	Q9Y484	OTTHUMG00000034500	ENST00000376372.3:c.200G>A	X.37:g.48935337C>T	ENSP00000365551:p.Gly67Asp	Somatic	129	0		WXS	Illumina GAIIx	Phase_I	111	59	NM_007075	0	0	0	30	30	A6NGH5|B7WPI2|Q5MNZ5|Q6IBS7|Q6NT94|Q96H03	Missense_Mutation	SNP	ENST00000376372.3	37	CCDS35250.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.240329	0.79912	.	.	ENSG00000196998	ENST00000376372;ENST00000322995;ENST00000356463;ENST00000473974;ENST00000376368;ENST00000396681;ENST00000471338;ENST00000474053;ENST00000419567;ENST00000465382	T;T;T;T;T;T;T;T;T;T	0.55930	0.49;0.49;0.49;0.49;0.49;0.49;2.41;0.49;0.49;0.49	3.81	3.81	0.43845	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.71945	0.3400	M	0.81239	2.535	0.80722	D	1	D;D;D;D;D	0.76494	0.999;0.992;0.995;0.998;0.995	D;P;D;D;P	0.70935	0.95;0.883;0.945;0.971;0.849	T	0.77723	-0.2481	10	0.87932	D	0	-23.0804	14.4896	0.67642	0.0:1.0:0.0:0.0	.	67;67;67;67;67	B4DVH6;C9J471;Q9Y484-2;Q9Y484-3;Q9Y484	.;.;.;.;WIPI4_HUMAN	D	67	ENSP00000365551:G67D;ENSP00000365543:G67D;ENSP00000348848:G67D;ENSP00000417211:G67D;ENSP00000365546:G67D;ENSP00000379913:G67D;ENSP00000418466:G67D;ENSP00000420728:G67D;ENSP00000393640:G67D;ENSP00000420534:G67D	ENSP00000365543:G67D	G	-	2	0	WDR45	48822281	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.059000	0.76684	2.149000	0.67028	0.529000	0.55759	GGC	.		0.612	WDR45-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083418.2	NM_007075	
MAGIX	79917	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	49021301	49021301	+	Missense_Mutation	SNP	A	A	T			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chrX:49021301A>T	ENST00000412696.2	+	4	380	c.380A>T	c.(379-381)gAg>gTg	p.E127V	MAGIX_ENST00000376339.1_Missense_Mutation_p.E68V|MAGIX_ENST00000498742.1_3'UTR|MAGIX_ENST00000425661.2_Intron|MAGIX_ENST00000376338.3_Missense_Mutation_p.E68V	NM_024859.2	NP_079135.3	Q9H6Y5	MAGIX_HUMAN	MAGI family member, X-linked	127	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.																TTCTCTGTGGAGCTGGTTCGC	0.607																																					p.E127V		.											.	MAGIX-108	0			c.A380T						.						87.0	88.0	88.0					X																	49021301		2004	4146	6150	SO:0001583	missense	79917	exon4			CTGTGGAGCTGGT	AK025340	CCDS48106.1, CCDS48107.1, CCDS75976.1	Xp11.23	2014-05-06			ENSG00000017621	ENSG00000269313			30006	protein-coding gene	gene with protein product							Standard	XM_005278065		Approved	PDZX, JM10, FLJ21687	uc010nin.1	Q9H6Y5	OTTHUMG00000188218	ENST00000412696.2:c.380A>T	X.37:g.49021301A>T	ENSP00000387928:p.Glu127Val	Somatic	101	0		WXS	Illumina GAIIx	Phase_I	95	39	NM_024859	0	0	0	0	0	A6XND4|A8MSX9|B7WP26|Q14C81	Missense_Mutation	SNP	ENST00000412696.2	37	CCDS48106.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	17.38|17.38	3.374732|3.374732	0.61735|0.61735	.|.	.|.	ENSG00000017621|ENSG00000017621	ENST00000376339;ENST00000412696;ENST00000376338;ENST00000425285|ENST00000415364	T;T;T;T|.	0.27104|.	1.69;1.69;1.69;1.69|.	4.66|4.66	3.46|3.46	0.39613|0.39613	PDZ/DHR/GLGF (3);|.	0.000000|.	0.43919|.	D|.	0.000503|.	T|T	0.37865|0.37865	0.1019|0.1019	L|L	0.43554|0.43554	1.36|1.36	0.28247|0.28247	N|N	0.925427|0.925427	D;D;D|.	0.89917|.	1.0;0.999;0.999|.	D;D;D|.	0.91635|.	0.999;0.997;0.997|.	T|T	0.25433|0.25433	-1.0132|-1.0132	10|5	0.87932|.	D|.	0|.	-15.7219|-15.7219	7.103|7.103	0.25348|0.25348	0.7963:0.0:0.0:0.2037|0.7963:0.0:0.0:0.2037	.|.	127;68;68|.	Q9H6Y5;Q9H6Y5-3;Q9H6Y5-2|.	MAGIX_HUMAN;.;.|.	V|C	68;127;68;73|96	ENSP00000365517:E68V;ENSP00000387928:E127V;ENSP00000365516:E68V;ENSP00000411713:E73V|.	ENSP00000365516:E68V|.	E|S	+|+	2|1	0|0	MAGIX|MAGIX	48908245|48908245	1.000000|1.000000	0.71417|0.71417	0.204000|0.204000	0.23530|0.23530	0.146000|0.146000	0.21551|0.21551	1.544000|1.544000	0.36158|0.36158	0.684000|0.684000	0.31448|0.31448	0.427000|0.427000	0.28365|0.28365	GAG|AGC	.		0.607	MAGIX-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378832.1	NM_024859	
KIAA2022	340533	broad.mit.edu	37	X	73961529	73961529	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chrX:73961529C>G	ENST00000055682.6	-	3	3474	c.2863G>C	c.(2863-2865)Gat>Cat	p.D955H		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	955					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						AGTTGGGTATCTTGCATGGAG	0.428																																					p.D955H		.											.	KIAA2022-183	0			c.G2863C						.						176.0	151.0	160.0					X																	73961529		2203	4300	6503	SO:0001583	missense	340533	exon3			GGGTATCTTGCAT		CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.2863G>C	X.37:g.73961529C>G	ENSP00000055682:p.Asp955His	Somatic	214	0		WXS	Illumina GAIIx	Phase_I	172	5	NM_001008537	0	0	0	0	0	A7YY87|Q5JUX9|Q8IVE9	Missense_Mutation	SNP	ENST00000055682.6	37	CCDS35337.1	.	.	.	.	.	.	.	.	.	.	C	12.88	2.069885	0.36566	.	.	ENSG00000050030	ENST00000373468;ENST00000055682	T;T	0.36699	1.24;1.24	5.58	4.72	0.59763	.	0.387015	0.30820	N	0.008811	T	0.43144	0.1234	L	0.36672	1.1	0.50171	D	0.999858	D	0.54207	0.965	P	0.55260	0.772	T	0.33163	-0.9879	10	0.56958	D	0.05	-8.3044	13.5585	0.61775	0.0:0.9236:0.0:0.0764	.	955	Q5QGS0	K2022_HUMAN	H	955	ENSP00000362567:D955H;ENSP00000055682:D955H	ENSP00000055682:D955H	D	-	1	0	KIAA2022	73878254	1.000000	0.71417	0.709000	0.30452	0.040000	0.13550	4.635000	0.61332	1.130000	0.42092	0.600000	0.82982	GAT	.		0.428	KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057270.2	NM_001008537	
ARL13A	392509	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	100229150	100229150	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chrX:100229150T>C	ENST00000450049.2	+	3	207	c.94T>C	c.(94-96)Tct>Cct	p.S32P		NM_001162491.1	NP_001155963.1	Q5H913	AR13A_HUMAN	ADP-ribosylation factor-like 13A	32					small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	GTP binding (GO:0005525)			endometrium(1)|ovary(1)	2						CTTGAACAACTCTGGCAAAAC	0.418																																					p.S32P		.											.	ARL13A-131	0			c.T94C						.						87.0	71.0	76.0					X																	100229150		1847	4078	5925	SO:0001583	missense	392509	exon3			AACAACTCTGGCA		CCDS55463.1	Xq22.1	2014-05-09	2005-11-18	2005-11-18	ENSG00000174225	ENSG00000174225		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	31709	protein-coding gene	gene with protein product			"""ADP-ribosylation factor-like 13"""	ARL13			Standard	NM_001162491		Approved		uc011mrf.2	Q5H913	OTTHUMG00000022013	ENST00000450049.2:c.94T>C	X.37:g.100229150T>C	ENSP00000398637:p.Ser32Pro	Somatic	112	0		WXS	Illumina GAIIx	Phase_I	83	7	NM_001162490	0	0	0	0	0	B2RTT6|B4DX50	Missense_Mutation	SNP	ENST00000450049.2	37	CCDS55463.1	.	.	.	.	.	.	.	.	.	.	T	9.928	1.214009	0.22289	.	.	ENSG00000174225	ENST00000450049	T	0.65549	-0.16	3.24	0.556	0.17253	.	0.141185	0.46758	D	0.000279	T	0.76912	0.4054	M	0.88906	2.99	0.09310	N	0.999994	D;D	0.71674	0.998;0.998	D;D	0.75020	0.985;0.985	T	0.66344	-0.5947	10	0.87932	D	0	.	6.7831	0.23657	0.0:0.0:0.4871:0.5129	.	32;32	B2RTT6;Q5H913	.;AR13A_HUMAN	P	32	ENSP00000398637:S32P	ENSP00000398637:S32P	S	+	1	0	ARL13A	100115806	0.717000	0.27966	0.258000	0.24420	0.112000	0.19704	0.808000	0.27154	0.024000	0.15214	0.486000	0.48141	TCT	.		0.418	ARL13A-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000057504.2	XM_373358	
ZMAT1	84460	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	101139313	101139313	+	Silent	SNP	C	C	T			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chrX:101139313C>T	ENST00000372782.3	-	7	1133	c.1086G>A	c.(1084-1086)caG>caA	p.Q362Q	ZMAT1_ENST00000540921.1_Silent_p.Q362Q|ZMAT1_ENST00000494068.1_5'UTR|ZMAT1_ENST00000458570.1_Silent_p.Q191Q	NM_001011657.3	NP_001011657	Q5H9K5	ZMAT1_HUMAN	zinc finger, matrin-type 1	362						nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	22						GTTGGTAGGTCTGGGAAGCCT	0.443																																					p.Q362Q		.											.	ZMAT1-131	0			c.G1086A						.						160.0	143.0	149.0					X																	101139313		2203	4300	6503	SO:0001819	synonymous_variant	84460	exon7			GTAGGTCTGGGAA	Z69304	CCDS35348.1	Xq21	2012-10-05	2010-09-15		ENSG00000166432	ENSG00000166432		"""Zinc fingers, matrin-type"""	29377	protein-coding gene	gene with protein product							Standard	NM_001011657		Approved	KIAA1789	uc011mrl.2	Q5H9K5	OTTHUMG00000022044	ENST00000372782.3:c.1086G>A	X.37:g.101139313C>T		Somatic	149	0		WXS	Illumina GAIIx	Phase_I	133	19	NM_001011657	0	0	1	1	0	Q8NDS3|Q96JN6	Silent	SNP	ENST00000372782.3	37	CCDS35348.1																																																																																			.		0.443	ZMAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057598.1		
MORF4L2	9643	ucsc.edu	37	X	102931750	102931750	+	Nonsense_Mutation	SNP	G	G	T			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chrX:102931750G>T	ENST00000441076.2	-	4	510	c.206C>A	c.(205-207)tCa>tAa	p.S69*	MORF4L2_ENST00000451301.1_Nonsense_Mutation_p.S69*|MORF4L2_ENST00000423833.2_Nonsense_Mutation_p.S69*|MORF4L2_ENST00000422154.2_Nonsense_Mutation_p.S69*|MORF4L2_ENST00000360458.1_Nonsense_Mutation_p.S69*|MORF4L2_ENST00000433176.2_Nonsense_Mutation_p.S69*|MORF4L2_ENST00000492116.1_5'UTR	NM_001142419.1|NM_012286.2	NP_001135891.1|NP_036418.1	Q15014	MO4L2_HUMAN	mortality factor 4 like 2	69					chromatin modification (GO:0016568)|chromatin organization (GO:0006325)|DNA repair (GO:0006281)|positive regulation of striated muscle cell differentiation (GO:0051155)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(7)	13						CACGGATCCTGAAGGGGGGTT	0.562																																					p.S69X		.											.	MORF4L2-130	0			c.C206A						.						64.0	54.0	58.0					X																	102931750		2203	4300	6503	SO:0001587	stop_gained	9643	exon5			GATCCTGAAGGGG	AF100620	CCDS14512.1	Xq22	2010-11-24			ENSG00000123562	ENSG00000123562			16849	protein-coding gene	gene with protein product	"""MORF-related gene X"""	300409				9891081, 7584026	Standard	NM_012286		Approved	KIAA0026, MRGX	uc011msa.2	Q15014	OTTHUMG00000022104	ENST00000441076.2:c.206C>A	X.37:g.102931750G>T	ENSP00000391969:p.Ser69*	Somatic	24	0		WXS	Illumina GAIIx	Phase_I	37	4	NM_001142422	0	0	278	278	0	B3KP92|D3DXA5|Q567V0|Q8J026	Nonsense_Mutation	SNP	ENST00000441076.2	37	CCDS14512.1	.	.	.	.	.	.	.	.	.	.	G	28.2	4.903488	0.92035	.	.	ENSG00000123562	ENST00000360458;ENST00000433176;ENST00000422154;ENST00000451301;ENST00000372619;ENST00000441076;ENST00000423833;ENST00000434230;ENST00000418819;ENST00000442614	.	.	.	4.52	4.52	0.55395	.	0.170067	0.28119	N	0.016527	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06099	T	0.92	-13.0377	11.5361	0.50639	0.0:0.0:1.0:0.0	.	.	.	.	X	69;69;69;69;51;69;69;69;69;69	.	ENSP00000353643:S69X	S	-	2	0	MORF4L2	102818406	0.997000	0.39634	0.985000	0.45067	0.986000	0.74619	3.325000	0.52030	2.496000	0.84212	0.600000	0.82982	TCA	.		0.562	MORF4L2-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057732.1	NM_012286	
PAK3	5063	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	110439738	110439738	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chrX:110439738C>T	ENST00000372010.1	+	17	1764	c.1322C>T	c.(1321-1323)cCa>cTa	p.P441L	PAK3_ENST00000425146.1_Missense_Mutation_p.P426L|PAK3_ENST00000519681.1_Missense_Mutation_p.P447L|PAK3_ENST00000372007.5_Missense_Mutation_p.P426L|PAK3_ENST00000262836.4_Missense_Mutation_p.P441L|PAK3_ENST00000518291.1_Missense_Mutation_p.P462L|PAK3_ENST00000446737.1_Missense_Mutation_p.P426L|PAK3_ENST00000417227.1_Missense_Mutation_p.P447L|PAK3_ENST00000360648.4_Missense_Mutation_p.P462L			O75914	PAK3_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 3	441	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|axonogenesis (GO:0007409)|dendrite development (GO:0016358)|dendritic spine morphogenesis (GO:0060997)|MAPK cascade (GO:0000165)|regulation of actin filament polymerization (GO:0030833)|synapse organization (GO:0050808)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(15)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	41						GTGGGAACCCCATATTGGATG	0.458										TSP Lung(19;0.15)																											p.P462L		.											.	PAK3-1043	0			c.C1385T						.						134.0	126.0	129.0					X																	110439738		2203	4300	6503	SO:0001583	missense	5063	exon14			GAACCCCATATTG	AF068864	CCDS14554.1, CCDS48151.1, CCDS48152.1, CCDS48153.1	Xq22.3	2008-06-17	2008-06-17		ENSG00000077264	ENSG00000077264			8592	protein-coding gene	gene with protein product		300142	"""mental retardation, X-linked 47"", ""p21 (CDKN1A)-activated kinase 3"""	MRX30, MRX47		8826460, 9731525	Standard	NM_002578		Approved	hPAK3, bPAK	uc010npv.1	O75914	OTTHUMG00000022202	ENST00000372010.1:c.1322C>T	X.37:g.110439738C>T	ENSP00000361080:p.Pro441Leu	Somatic	137	0		WXS	Illumina GAIIx	Phase_I	152	60	NM_001128168	0	0	0	0	0	A8K389|B1GX77|B1GX78|B1GX79|Q5JWX1|Q5JWX2|Q7Z2D6|Q7Z2E4|Q7Z3Z8|Q8WWK5|Q8WX23|Q9P0J8	Missense_Mutation	SNP	ENST00000372010.1	37	CCDS48153.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.335488	0.81801	.	.	ENSG00000077264	ENST00000446737;ENST00000425146;ENST00000372010;ENST00000519681;ENST00000372007;ENST00000518291;ENST00000360648;ENST00000417227;ENST00000262836	T;T;T;T;T;T;T;T;T	0.15718	2.4;2.4;2.4;2.4;2.4;2.4;2.4;2.4;2.4	5.23	5.23	0.72850	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.43809	0.1264	M	0.72118	2.19	0.80722	D	1	D;D;D;D;D	0.89917	0.998;1.0;0.999;1.0;0.999	D;D;D;D;D	0.83275	0.977;0.987;0.987;0.996;0.987	T	0.40887	-0.9539	10	0.72032	D	0.01	.	18.0833	0.89449	0.0:1.0:0.0:0.0	.	447;462;441;426;441	O75914-4;O75914-3;O75914;O75914-2;B1GX77	.;.;PAK3_HUMAN;.;.	L	426;426;441;447;426;462;462;447;441	ENSP00000410853:P426L;ENSP00000401982:P426L;ENSP00000361080:P441L;ENSP00000429113:P447L;ENSP00000361077:P426L;ENSP00000428921:P462L;ENSP00000353864:P462L;ENSP00000389172:P447L;ENSP00000262836:P441L	ENSP00000262836:P441L	P	+	2	0	PAK3	110326394	1.000000	0.71417	0.997000	0.53966	0.955000	0.61496	7.471000	0.80985	2.293000	0.77203	0.594000	0.82650	CCA	.		0.458	PAK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057918.1	NM_002578	
WDR44	54521	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	117532433	117532433	+	Splice_Site	SNP	C	C	A			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chrX:117532433C>A	ENST00000254029.3	+	8	1669	c.1274C>A	c.(1273-1275)aCg>aAg	p.T425K	WDR44_ENST00000371822.5_Splice_Site_p.T400K|WDR44_ENST00000371825.3_Splice_Site_p.T425K	NM_019045.4	NP_061918.3	Q5JSH3	WDR44_HUMAN	WD repeat domain 44	425						endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)				breast(4)|endometrium(2)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)	33						AAACAGAAAACGTGAGTTACA	0.353																																					p.T425K		.											.	WDR44-133	0			c.C1274A						.						139.0	117.0	124.0					X																	117532433		2203	4300	6503	SO:0001630	splice_region_variant	54521	exon8			AGAAAACGTGAGT	AK001978	CCDS14572.1, CCDS55482.1, CCDS55483.1	Xq24	2013-01-09			ENSG00000131725	ENSG00000131725		"""WD repeat domain containing"""	30512	protein-coding gene	gene with protein product						12477932	Standard	NM_019045		Approved	DKFZp686L20145, RPH11, RAB11BP	uc004eqn.3	Q5JSH3	OTTHUMG00000022254	ENST00000254029.3:c.1274+1C>A	X.37:g.117532433C>A		Somatic	540	0		WXS	Illumina GAIIx	Phase_I	383	147	NM_001184965	0	0	0	0	0	B4DSE9|F8W913|Q0JS52|Q0JTF3|Q5JSH2|Q6ZSC1|Q7Z365|Q7Z3P6|Q8NAU8|Q8NHU5|Q9NUV4	Missense_Mutation	SNP	ENST00000254029.3	37	CCDS14572.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	35|35	5.461140|5.461140	0.96240|0.96240	.|.	.|.	ENSG00000131725|ENSG00000131725	ENST00000371848|ENST00000371822;ENST00000254029;ENST00000371825	.|T;T;T	.|0.74947	.|-0.89;-0.28;-0.15	5.92|5.92	5.92|5.92	0.95590|0.95590	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.84620|0.84620	0.5512|0.5512	L|L	0.58810|0.58810	1.83|1.83	0.80722|0.80722	D|D	1|1	.|D;P;D;P	.|0.89917	.|0.971;0.946;1.0;0.912	.|P;P;D;P	.|0.97110	.|0.903;0.644;1.0;0.626	D|D	0.84720|0.84720	0.0739|0.0739	5|10	.|0.54805	.|T	.|0.06	-0.1265|-0.1265	18.0906|18.0906	0.89474|0.89474	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|400;425;425;425	.|F8W913;E9PCI7;Q5JSH3-2;Q5JSH3	.|.;.;.;WDR44_HUMAN	K|K	324|400;425;425	.|ENSP00000360887:T400K;ENSP00000254029:T425K;ENSP00000360890:T425K	.|ENSP00000254029:T425K	N|T	+|+	3|2	2|0	WDR44|WDR44	117416461|117416461	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	7.581000|7.581000	0.82535|0.82535	2.495000|2.495000	0.84180|0.84180	0.600000|0.600000	0.82982|0.82982	AAC|ACG	.		0.353	WDR44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058001.1	NM_019045	Missense_Mutation
F9	2158	bcgsc.ca	37	X	138633280	138633280	+	Missense_Mutation	SNP	A	A	G	rs6048	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chrX:138633280A>G	ENST00000218099.2	+	6	587	c.580A>G	c.(580-582)Act>Gct	p.T194A	F9_ENST00000394090.2_Missense_Mutation_p.T156A	NM_000133.3	NP_000124.1	P00740	FA9_HUMAN	coagulation factor IX	194			T -> A (in dbSNP:rs6048). {ECO:0000269|PubMed:10391209, ECO:0000269|PubMed:2994716, ECO:0000269|PubMed:3857619, ECO:0000269|PubMed:6329734}.		blood coagulation (GO:0007596)|blood coagulation, extrinsic pathway (GO:0007598)|blood coagulation, intrinsic pathway (GO:0007597)|cellular protein metabolic process (GO:0044267)|peptidyl-glutamic acid carboxylation (GO:0017187)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)			breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(7)|lung(19)|ovary(1)|skin(1)	35	Acute lymphoblastic leukemia(192;0.000127)				Antihemophilic Factor(DB00025)|Menadione(DB00170)	CCGTGCTGAGACTGTTTTTCC	0.373													A|||	550	0.145695	0.1036	0.1037	3775	,	,		14937	0.001		0.2237	False		,,,				2504	0.1176				p.T194A		.											.	F9-227	0			c.A580G						.	A	ALA/THR	474,3361		17,377,63,1238,508	119.0	104.0	109.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	580	1.2	0.0	X	dbSNP_52	109	2007,4721		228,1013,538,1187,1334	yes	missense	F9	NM_000133.3	58	245,1390,601,2425,1842	GG,GA,G,AA,A		29.8306,12.3598,23.4876	benign	194/462	138633280	2481,8082	2203	4300	6503	SO:0001583	missense	2158	exon6			GCTGAGACTGTTT	M11309	CCDS14666.1	Xq26.3-q27.1	2014-09-17	2008-08-01		ENSG00000101981	ENSG00000101981	3.4.21.22		3551	protein-coding gene	gene with protein product	"""Factor IX"", ""plasma thromboplastic component"", ""Christmas disease"", ""hemophilia B"""	300746					Standard	NM_000133		Approved	FIX	uc004fas.1	P00740	OTTHUMG00000022536	ENST00000218099.2:c.580A>G	X.37:g.138633280A>G	ENSP00000218099:p.Thr194Ala	Somatic	132	0		WXS	Illumina GAIIx	Phase_I	114	5	NM_000133	0	0	0	0	0	A8K9N4|F2RM36|Q5FBE1|Q5JYJ8	Missense_Mutation	SNP	ENST00000218099.2	37	CCDS14666.1	261	0.15732368896925858	32	0.06694560669456066	31	0.09281437125748503	0	0.0	115	0.18138801261829654	A	0.020	-1.437526	0.01098	0.123598	0.298306	ENSG00000101981	ENST00000218099;ENST00000394090	D;D	0.94417	-3.42;-3.42	4.94	1.21	0.21127	.	1.193210	0.05709	N	0.595504	T	0.00039	0.0001	L	0.60455	1.87	0.80722	P	0.0	B;B	0.12013	0.005;0.0	B;B	0.12837	0.008;0.003	T	0.12889	-1.0530	9	0.15499	T	0.54	.	3.6323	0.08137	0.5672:0.0:0.2742:0.1586	rs6048;rs3181844;rs52802349;rs59606308;rs6048	156;194	Q5FBE1;P00740	.;FA9_HUMAN	A	194;156	ENSP00000218099:T194A;ENSP00000377650:T156A	ENSP00000218099:T194A	T	+	1	0	F9	138460946	0.001000	0.12720	0.008000	0.14137	0.151000	0.21798	0.477000	0.22196	-0.118000	0.11851	0.430000	0.28490	ACT	A|0.797;0|0.004		0.373	F9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058557.1		
LDOC1	23641	broad.mit.edu	37	X	140271095	140271095	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chrX:140271095C>A	ENST00000370526.2	-	1	215	c.112G>T	c.(112-114)Gcc>Tcc	p.A38S	LDOC1_ENST00000460721.1_5'UTR	NM_012317.2	NP_036449.1	O95751	LDOC1_HUMAN	leucine zipper, down-regulated in cancer 1	38					negative regulation of cell proliferation (GO:0008285)	nucleus (GO:0005634)				endometrium(6)|large_intestine(1)|lung(6)|ovary(1)	14	Acute lymphoblastic leukemia(192;7.65e-05)					AGCAGGCTGGCCCTCTCGCAC	0.662																																					p.A38S		.											.	LDOC1-130	0			c.G112T						.						25.0	22.0	23.0					X																	140271095		2203	4299	6502	SO:0001583	missense	23641	exon1			GGCTGGCCCTCTC	AB019527	CCDS14672.1	Xq27	2008-02-05			ENSG00000182195	ENSG00000182195			6548	protein-coding gene	gene with protein product		300402		BCUR1		10403563, 15716091, 16093683	Standard	NM_012317		Approved	Mar7, Mart7	uc004fbj.3	O95751	OTTHUMG00000022558	ENST00000370526.2:c.112G>T	X.37:g.140271095C>A	ENSP00000359557:p.Ala38Ser	Somatic	41	1		WXS	Illumina GAIIx	Phase_I	187	17	NM_012317	0	0	0	0	0	Q6IAR6	Missense_Mutation	SNP	ENST00000370526.2	37	CCDS14672.1	.	.	.	.	.	.	.	.	.	.	.	22.5	4.303138	0.81136	.	.	ENSG00000182195	ENST00000370526	T	0.34472	1.36	3.61	3.61	0.41365	.	0.114139	0.36444	N	0.002590	T	0.26304	0.0642	L	0.46157	1.445	0.25161	N	0.990357	B	0.28713	0.22	B	0.23574	0.047	T	0.10965	-1.0607	10	0.14656	T	0.56	-6.8912	9.7936	0.40722	0.0:1.0:0.0:0.0	.	38	O95751	LDOC1_HUMAN	S	38	ENSP00000359557:A38S	ENSP00000359557:A38S	A	-	1	0	LDOC1	140098761	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	3.221000	0.51215	2.060000	0.61445	0.287000	0.19450	GCC	.		0.662	LDOC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058592.1	NM_012317	
TAZ	6901	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	153647890	153647890	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chrX:153647890G>A	ENST00000350743.4	+	5	668	c.379G>A	c.(379-381)Gtc>Atc	p.V127I	TAZ_ENST00000475699.1_Intron|TAZ_ENST00000351413.4_Missense_Mutation_p.V157I|TAZ_ENST00000299328.5_Missense_Mutation_p.V157I|TAZ_ENST00000369776.4_Missense_Mutation_p.V102I|TAZ_ENST00000369790.4_Missense_Mutation_p.V127I	NM_181311.2	NP_851828.1	Q9GZV5	WWTR1_HUMAN	tafazzin	0	WW. {ECO:0000255|PROSITE- ProRule:PRU00224}.				cilium morphogenesis (GO:0060271)|gene expression (GO:0010467)|glomerulus development (GO:0032835)|hippo signaling (GO:0035329)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|osteoblast differentiation (GO:0001649)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)|regulation of SMAD protein import into nucleus (GO:0060390)|regulation of transcription, DNA-templated (GO:0006355)|stem cell division (GO:0017145)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			lung(1)	1	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					AGGAGATGGCGTCTACCAGAA	0.552																																					p.V157I		.											.	TAZ-130	0			c.G469A						.						105.0	84.0	91.0					X																	153647890		2203	4300	6503	SO:0001583	missense	6901	exon6			GATGGCGTCTACC	X92762	CCDS14748.1, CCDS14749.1, CCDS14750.1, CCDS35450.1	Xq28	2014-09-17	2008-07-29		ENSG00000102125	ENSG00000102125			11577	protein-coding gene	gene with protein product	"""Barth syndrome"""	300394	"""endocardial fibroelastosis 2"", ""cardiomyopathy, dilated 3A (X-linked)"""	CMD3A, EFE2, EFE		8042670	Standard	NM_000116		Approved	BTHS, XAP-2, G4.5	uc004fkx.3	Q16635	OTTHUMG00000033190	ENST00000350743.4:c.379G>A	X.37:g.153647890G>A	ENSP00000338891:p.Val127Ile	Somatic	253	0		WXS	Illumina GAIIx	Phase_I	267	109	NM_181312	0	0	2	2	0	D3DNH7|Q8N3P2|Q9Y3W6	Missense_Mutation	SNP	ENST00000350743.4	37	CCDS14749.1	.	.	.	.	.	.	.	.	.	.	G	15.82	2.946168	0.53079	.	.	ENSG00000102125	ENST00000369790;ENST00000299328;ENST00000350743;ENST00000454722;ENST00000351413;ENST00000369776;ENST00000439735	D;D;D;D;D;D;D	0.97378	-4.36;-4.36;-4.36;-4.36;-4.36;-4.36;-3.15	5.41	5.41	0.78517	Phospholipid/glycerol acyltransferase (2);	0.000000	0.64402	U	0.000001	D	0.97595	0.9212	L	0.49699	1.58	0.80722	D	1	P;D;P;D;P;D	0.76494	0.937;0.99;0.935;0.969;0.865;0.999	P;P;P;P;B;D	0.81914	0.528;0.875;0.656;0.507;0.305;0.995	D	0.97687	1.0176	10	0.44086	T	0.13	-0.0133	15.6073	0.76682	0.0:0.0:1.0:0.0	.	175;102;127;127;157;157	A6XNE1;Q96F92;Q16635-7;Q16635-3;Q16635-5;Q16635	.;.;.;.;.;TAZ_HUMAN	I	127;157;127;145;157;102;126	ENSP00000358805:V127I;ENSP00000299328:V157I;ENSP00000338891:V127I;ENSP00000397388:V145I;ENSP00000218246:V157I;ENSP00000358791:V102I;ENSP00000398193:V126I	ENSP00000299328:V157I	V	+	1	0	TAZ	153301084	1.000000	0.71417	0.922000	0.36590	0.755000	0.42902	8.842000	0.92136	2.281000	0.76405	0.431000	0.28591	GTC	.		0.552	TAZ-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080939.1		
FAM163A	148753	broad.mit.edu	37	1	179783093	179783094	+	Frame_Shift_Ins	INS	-	-	G			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr1:179783093_179783094insG	ENST00000341785.4	+	5	669_670	c.273_274insG	c.(274-276)gcgfs	p.A92fs	RP11-12M5.3_ENST00000453051.1_RNA|RP11-12M5.3_ENST00000415218.1_RNA	NM_173509.2	NP_775780.1	Q96GL9	F163A_HUMAN	family with sequence similarity 163, member A	92						integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(4)|lung(6)|ovary(1)|pancreas(1)|prostate(1)	15						GTGGGGTGGCCGCGAGCCACTG	0.668																																					p.A91fs		.											.	FAM163A-91	0			c.273_274insG						.																																			SO:0001589	frameshift_variant	148753	exon5			GGTGGCCGCGAGC	BC009382	CCDS1333.1	1q25.2	2008-06-05	2008-06-05	2008-06-05	ENSG00000143340	ENSG00000143340			28274	protein-coding gene	gene with protein product		611727	"""chromosome 1 open reading frame 76"""	C1orf76		12477932	Standard	NM_173509		Approved	MGC16664	uc001gnj.3	Q96GL9	OTTHUMG00000035262	ENST00000341785.4:c.274dupG	1.37:g.179783094_179783094dupG	ENSP00000354891:p.Ala92fs	Somatic	48	0		WXS	Illumina GAIIx	Phase_I	279	12	NM_173509	0	0	0	0	0	A8K8R7	Frame_Shift_Ins	INS	ENST00000341785.4	37	CCDS1333.1																																																																																			.		0.668	FAM163A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085300.1	NM_173509	
NCOR2	9612	broad.mit.edu	37	12	124824721	124824722	+	In_Frame_Ins	INS	-	-	GCCGCTGCT	rs61519723|rs112797765|rs143952466	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr12:124824721_124824722insGCCGCTGCT	ENST00000405201.1	-	37	5517_5518	c.5517_5518insAGCAGCGGC	c.(5515-5520)ggcggg>ggcAGCAGCGGCggg	p.1838_1839insGSS	NCOR2_ENST00000404621.1_In_Frame_Ins_p.1828_1829insGSS|NCOR2_ENST00000429285.2_In_Frame_Ins_p.1828_1829insGSS|NCOR2_ENST00000404121.2_In_Frame_Ins_p.1399_1400insGSS|NCOR2_ENST00000356219.3_In_Frame_Ins_p.1845_1846insGSS|NCOR2_ENST00000397355.1_In_Frame_Ins_p.1829_1830insGSS			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	1849					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		cccccacccccgccgctgctgc	0.713														4762	0.950879	0.8979	0.9496	5008	,	,		14227	0.9633		0.9672	False		,,,				2504	0.9939				p.G1840delinsSSGG		.											.	NCOR2-229	0			c.5518_5519insAGCAGCGGC						.																																			SO:0001652	inframe_insertion	9612	exon39			CACCCCCGCCGCT	U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.5509_5517dupAGCAGCGGC	12.37:g.124824722_124824730dupGCCGCTGCT	ENSP00000384018:p.Gly1836_Ser1838dup	Somatic	7	0		WXS	Illumina GAIIx	Phase_I	33	8	NM_006312	0	0	0	0	0	O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	In_Frame_Ins	INS	ENST00000405201.1	37	CCDS41858.2																																																																																			.		0.713	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318173.2	NM_006312	
SCAPER	49855	broad.mit.edu	37	15	76998254	76998255	+	Frame_Shift_Ins	INS	-	-	T			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr15:76998254_76998255insT	ENST00000563290.1	-	18	2331_2332	c.2236_2237insA	c.(2236-2238)attfs	p.I746fs	SCAPER_ENST00000324767.7_Frame_Shift_Ins_p.I746fs|SCAPER_ENST00000538941.2_Frame_Shift_Ins_p.I500fs			Q9BY12	SCAPE_HUMAN	S-phase cyclin A-associated protein in the ER	746	Glu-rich.					endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(16)|ovary(2)|prostate(2)|skin(1)|urinary_tract(2)	39						CTTGAGCTGAATTTTTTTCTGT	0.317																																					p.I746fs		.											.	SCAPER-137	0			c.2237_2238insA						.																																			SO:0001589	frameshift_variant	49855	exon17			AGCTGAATTTTTT	AB040887, AF242528	CCDS53961.1, CCDS53962.1	15q24.3	2012-10-05	2009-03-11	2007-08-20	ENSG00000140386	ENSG00000140386		"""Zinc fingers, C2H2-type"""	13081	protein-coding gene	gene with protein product		611611	"""zinc finger protein 291"""	ZNF291		17698606	Standard	NM_020843		Approved	Zfp291	uc002bby.3	Q9BY12	OTTHUMG00000172655	ENST00000563290.1:c.2237dupA	15.37:g.76998261_76998261dupT	ENSP00000454973:p.Ile746fs	Somatic	13	0		WXS	Illumina GAIIx	Phase_I	6	2	NM_020843	0	0	0	0	0	F5H7X8|H3BNR7|Q3B7X7|Q96BS9|Q9H3D8|Q9NT03|Q9P274	Frame_Shift_Ins	INS	ENST00000563290.1	37	CCDS53962.1																																																																																			.		0.317	SCAPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419698.1	NM_020843	
FARSB	10056	hgsc.bcm.edu	37	2	223505606	223505607	+	Frame_Shift_Ins	INS	-	-	TT			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr2:223505606_223505607insTT	ENST00000281828.6	-	4	576_577	c.313_314insAA	c.(313-315)atcfs	p.I105fs	FARSB_ENST00000536361.1_Frame_Shift_Ins_p.I6fs	NM_005687.3	NP_005678.3	Q9NSD9	SYFB_HUMAN	phenylalanyl-tRNA synthetase, beta subunit	105					gene expression (GO:0010467)|phenylalanyl-tRNA aminoacylation (GO:0006432)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|phenylalanine-tRNA ligase activity (GO:0004826)|RNA binding (GO:0003723)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	24		Renal(207;0.0183)		Epithelial(121;3.47e-10)|all cancers(144;1.86e-07)|LUSC - Lung squamous cell carcinoma(224;0.00871)|Lung(261;0.011)	L-Phenylalanine(DB00120)	CAATTTCTGGATTTTTCCATCA	0.267																																					p.I105fs		.											.	FARSB-91	0			c.314_315insAA						.																																			SO:0001589	frameshift_variant	10056	exon4			TTCTGGATTTTTC	AF042346	CCDS2454.1	2q36.2	2011-07-01	2007-02-23	2007-02-23	ENSG00000116120	ENSG00000116120	6.1.1.20	"""Aminoacyl tRNA synthetases / Class II"""	17800	protein-coding gene	gene with protein product	"""phenylalanine tRNA ligase 1, beta, cytoplasmic"""	609690	"""phenylalanyl-tRNA synthetase-like, beta subunit"""	FARSLB		10049785	Standard	NM_005687		Approved	PheHB, FRSB	uc002vne.1	Q9NSD9	OTTHUMG00000133155	ENST00000281828.6:c.312_313dupAA	2.37:g.223505609_223505610dupTT	ENSP00000281828:p.Ile105fs	Somatic	48	2		WXS	Illumina GAIIx	Phase_I	26	14	NM_005687	0	0	0	0	0	B4DFM0|O95708|Q4ZFX1|Q57ZJ5|Q9NZZ6	Frame_Shift_Ins	INS	ENST00000281828.6	37	CCDS2454.1																																																																																			.		0.267	FARSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256855.2	NM_005687	
MCC	4163	broad.mit.edu	37	5	112824048	112824049	+	In_Frame_Ins	INS	-	-	GCC	rs35336557|rs531679771|rs370593160	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr5:112824048_112824049insGCC	ENST00000408903.3	-	1	478_479	c.63_64insGGC	c.(61-66)ggcagc>ggcGGCagc	p.21_22insG		NM_001085377.1	NP_001078846	P23508	CRCM_HUMAN	mutated in colorectal cancers	0					negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			endometrium(4)|kidney(3)|large_intestine(15)|liver(2)|lung(8)|ovary(2)|pancreas(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		all_cancers(142;5.89e-08)|all_epithelial(76;3.57e-11)|all_lung(232;0.000605)|Lung NSC(810;0.000697)|Colorectal(10;0.00146)|Prostate(80;0.00174)|Ovarian(225;0.0175)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(64;2.04e-54)|Epithelial(69;9.69e-49)|all cancers(49;6.25e-44)|COAD - Colon adenocarcinoma(37;0.0432)|Colorectal(14;0.0766)		ctgctgccgctgccgccgccgc	0.738														1663	0.332069	0.0227	0.3487	5008	,	,		8489	0.5208		0.3668	False		,,,				2504	0.5082				p.S22delinsGS		.											.	MCC-69	0			c.64_65insGGC						.																																			SO:0001652	inframe_insertion	4163	exon1			TGCCGCTGCCGCC		CCDS4111.1, CCDS43351.1	5q21-q22	2013-01-10			ENSG00000171444	ENSG00000171444		"""EF-hand domain containing"""	6935	protein-coding gene	gene with protein product		159350				1848370	Standard	NM_002387		Approved		uc003kql.4	P23508	OTTHUMG00000128804	ENST00000408903.3:c.61_63dupGGC	5.37:g.112824055_112824057dupGCC	ENSP00000386227:p.Gly22_Gly23dup	Somatic	7	0		WXS	Illumina GAIIx	Phase_I	42	8	NM_001085377	0	0	0	0	0	D3DT05|Q6ZR04	In_Frame_Ins	INS	ENST00000408903.3	37	CCDS43351.1																																																																																			.		0.738	MCC-003	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370839.1	NM_001085377	
GNB1	2782	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	1720546	1720547	+	Missense_Mutation	DNP	CA	CA	AC	rs552501394|rs151315046		TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	CA	CA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr1:1720546_1720547CA>AC	ENST00000378609.4	-	10	1192_1193	c.861_862TG>GT	c.(859-864)gcTGgg>gcGTgg	p.G288W		NM_001282539.1|NM_002074.3	NP_001269468.1|NP_002065.1	P62873	GBB1_HUMAN	guanine nucleotide binding protein (G protein), beta polypeptide 1	288					adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|blood coagulation (GO:0007596)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|energy reserve metabolic process (GO:0006112)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|GTP catabolic process (GO:0006184)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|Ras protein signal transduction (GO:0007265)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intracellular (GO:0005622)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	GTPase activity (GO:0003924)|GTPase binding (GO:0051020)|protein complex binding (GO:0032403)|signal transducer activity (GO:0004871)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(3)|skin(1)	12	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.62e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;1.14e-35)|OV - Ovarian serous cystadenocarcinoma(86;7.31e-23)|GBM - Glioblastoma multiforme(42;3.1e-07)|COAD - Colon adenocarcinoma(227;0.000323)|Colorectal(212;0.000374)|Kidney(185;0.00392)|BRCA - Breast invasive adenocarcinoma(365;0.00573)|STAD - Stomach adenocarcinoma(132;0.0072)|KIRC - Kidney renal clear cell carcinoma(229;0.0482)|Lung(427;0.236)		TCGTCGTACCCAGCAAGGAGGA	0.569											OREG0012998	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G288W		.											.	GNB1-227	0			c.T861G						.																																			SO:0001583	missense	2782	exon10			GTACCCAGCAAGG	BC004186	CCDS34.1, CCDS72685.1	1p36.33	2013-01-10			ENSG00000078369	ENSG00000078369		"""WD repeat domain containing"""	4396	protein-coding gene	gene with protein product		139380					Standard	NM_002074		Approved		uc001aif.3	P62873	OTTHUMG00000000940	ENST00000378609.4:c.861_862delinsAC	1.37:g.1720546_1720547delinsAC	ENSP00000367872:p.Gly288Trp	Somatic	197	0	598	WXS	Illumina GAIIx	Phase_I	196	0	NM_002074	0	0	0	0	0	B1AJZ7|P04697|P04901|Q1RMY8	Missense_Mutation	DNP	ENST00000378609.4	37	CCDS34.1																																																																																			A|0.999;G|0.001		0.569	GNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002762.3	NM_002074	
SOAT2	8435	hgsc.bcm.edu	37	12	53509339	53509340	+	Silent	DNP	GC	GC	TT	rs34924760|rs3219200|rs3219199	byFrequency	TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	GC	GC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr12:53509339_53509340GC>TT	ENST00000301466.3	+	6	669_670	c.609_610GC>TT	c.(607-612)ctGCta>ctTTta	p.203_204LL>LL		NM_003578.3	NP_003569.1	O75908	SOAT2_HUMAN	sterol O-acyltransferase 2	203					cholesterol efflux (GO:0033344)|cholesterol esterification (GO:0034435)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|intestinal cholesterol absorption (GO:0030299)|macrophage derived foam cell differentiation (GO:0010742)|very-low-density lipoprotein particle assembly (GO:0034379)	brush border (GO:0005903)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	cholesterol binding (GO:0015485)|cholesterol O-acyltransferase activity (GO:0034736)|fatty-acyl-CoA binding (GO:0000062)|transferase activity, transferring acyl groups (GO:0016746)			endometrium(5)|kidney(3)|large_intestine(2)|liver(1)|lung(5)|ovary(1)|skin(1)	18					Hesperetin(DB01094)	GCTGTGCGCTGCTAGCCGCCCA	0.713																																					p.A202A		.											.	SOAT2-91	0			c.C610T						.																																			SO:0001819	synonymous_variant	8435	exon6			GCGCTGCTAGCCG	AF059203	CCDS8847.1	12q13.13	2012-09-20			ENSG00000167780	ENSG00000167780	2.3.1.26		11178	protein-coding gene	gene with protein product		601311				9756920	Standard	NM_003578		Approved	ACAT2	uc001sbv.3	O75908	OTTHUMG00000169774	Exception_encountered	12.37:g.53509339_53509340delinsTT		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	14	7	NM_003578	0	0	0	0	0	F5H7W4|I6L9H9|Q4VB99|Q4VBA1|Q96TD4|Q9UNR2	Silent	DNP	ENST00000301466.3	37	CCDS8847.1																																																																																			C|0.787;T|0.213		0.713	SOAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405817.1		
UGT2A3	79799	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	69817434	69817435	+	Missense_Mutation	DNP	GA	GA	CT			TCGA-OR-A5K9-01A-11D-A29I-10	TCGA-OR-A5K9-11A-11D-A29L-10	GA	GA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	feb3eb04-dedc-49eb-aed6-89df22b5eaff	e8c64ccb-c7ba-449f-aafa-7fcf256ce2e5	g.chr4:69817434_69817435GA>CT	ENST00000251566.4	-	1	74_75	c.44_45TC>AG	c.(43-45)cTC>cAG	p.L15Q	UGT2A3_ENST00000420231.2_5'Flank	NM_024743.3	NP_079019.3	Q6UWM9	UD2A3_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide A3	15					cellular glucuronidation (GO:0052695)	integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			NS(1)|breast(1)|central_nervous_system(1)|kidney(5)|large_intestine(7)|lung(16)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36						CAACACAGAAGAGCTGCAGGAG	0.475																																					p.L15Q		.											.	UGT2A3-92	0			c.T44A						.																																			SO:0001583	missense	79799	exon1			CAGAAGAGCTGCA		CCDS3525.1	4q13.2	2010-12-14			ENSG00000135220	ENSG00000135220		"""UDP glucuronosyltransferases"""	28528	protein-coding gene	gene with protein product							Standard	NM_024743		Approved	FLJ21934	uc003hef.2	Q6UWM9	OTTHUMG00000129408	ENST00000251566.4:c.44_45delinsCT	4.37:g.69817434_69817435delinsCT	ENSP00000251566:p.Leu15Gln	Somatic	59	0		WXS	Illumina GAIIx	Phase_I	91	0	NM_024743	0	0	0	0	0	Q9H6S4	Missense_Mutation	DNP	ENST00000251566.4	37	CCDS3525.1																																																																																			.		0.475	UGT2A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251564.1	NM_024743	
