#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PRAMEF11	440560	ucsc.edu;bcgsc.ca	37	1	12884981	12884981	+	Missense_Mutation	SNP	T	T	C	rs4989318	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr1:12884981T>C	ENST00000535591.1	-	4	1325	c.1130A>G	c.(1129-1131)cAg>cGg	p.Q377R	RP5-845O24.8_ENST00000438401.1_lincRNA	NM_001146344.1	NP_001139816.1	O60813	PRA11_HUMAN	PRAME family member 11	377					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|lung(7)|pancreas(2)|skin(4)|urinary_tract(1)	27						ATAACTTTCCTGCGGGGCAGG	0.507													.|||	76	0.0151757	0.0008	0.0231	5008	,	,		22853	0.003		0.0507	False		,,,				2504	0.0051				p.Q377R		.											.	.	0			c.A1130G						.	C	ARG/GLN	9,1375		0,9,683	96.0	71.0	78.0		1130	-1.2	0.0	1	dbSNP_113	78	165,3015		10,145,1435	no	missense	PRAMEF11	NM_001146344.1	43	10,154,2118	CC,CT,TT		5.1887,0.6503,3.8124	benign	377/437	12884981	174,4390	692	1590	2282	SO:0001583	missense	440560	exon4			CTTTCCTGCGGGG	AL049680	CCDS53268.1	1p36.21	2013-01-17			ENSG00000204513	ENSG00000239810		"""-"""	14086	protein-coding gene	gene with protein product							Standard	XM_006710645		Approved		uc001auk.2	O60813	OTTHUMG00000001929	ENST00000535591.1:c.1130A>G	1.37:g.12884981T>C	ENSP00000439551:p.Gln377Arg	Somatic	272	3		WXS	Illumina GAIIx	Phase_I	36	4	NM_001146344	0	0	0	0	0		Missense_Mutation	SNP	ENST00000535591.1	37	CCDS53268.1	61	0.027930402930402932	1	0.0020325203252032522	12	0.03314917127071823	5	0.008741258741258742	43	0.05672823218997362	.	1.215	-0.628591	0.03610	0.006503	0.051887	ENSG00000204513	ENST00000535591;ENST00000331684;ENST00000437584	T;T	0.56103	0.48;0.48	1.76	-1.18	0.09617	.	0.329023	0.24884	N	0.034831	T	0.02230	0.0069	N	0.04880	-0.145	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.05616	-1.0874	10	0.21540	T	0.41	.	2.7367	0.05242	0.308:0.2838:0.0:0.4082	rs4989318	377	O60813	PRA11_HUMAN	R	377;418;377	ENSP00000439551:Q377R;ENSP00000391839:Q377R	ENSP00000328783:Q418R	Q	-	2	0	PRAMEF11	12807568	0.006000	0.16342	0.000000	0.03702	0.000000	0.00434	-1.124000	0.03260	-1.008000	0.03404	-0.479000	0.04858	CAG	T|0.500;C|0.500		0.507	PRAMEF11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		XM_496341	
LRRC38	126755	broad.mit.edu;bcgsc.ca	37	1	13802437	13802437	+	Silent	SNP	G	G	A	rs3013106	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr1:13802437G>A	ENST00000376085.3	-	2	1216	c.762C>T	c.(760-762)tcC>tcT	p.S254S		NM_001010847.1	NP_001010847.1	Q5VT99	LRC38_HUMAN	leucine rich repeat containing 38	254					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)											CGGCCACACCGGAGAAAATGA	0.582													G|||	1626	0.324681	0.4221	0.2262	5008	,	,		19646	0.3879		0.2505	False		,,,				2504	0.274				p.S254S		.											.	.	0			c.C762T						.																																			SO:0001819	synonymous_variant	126755	exon2			CACACCGGAGAAA	BC016048	CCDS53269.1	1p36.21	2008-02-05			ENSG00000162494	ENSG00000162494			27005	protein-coding gene	gene with protein product		615212				12477932	Standard	NM_001010847		Approved		uc001avb.3	Q5VT99	OTTHUMG00000007918	ENST00000376085.3:c.762C>T	1.37:g.13802437G>A		Somatic	340	2		WXS	Illumina GAIIx	Phase_I	411	10	NM_001010847	0	0	26	26	0	Q96B32	Silent	SNP	ENST00000376085.3	37	CCDS53269.1																																																																																			A|0.323;C|0.008		0.582	LRRC38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021793.1		
SDHB	6390	broad.mit.edu	37	1	17380491	17380491	+	Silent	SNP	G	G	A	rs148738139	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr1:17380491G>A	ENST00000375499.3	-	1	174	c.24C>T	c.(22-24)tcC>tcT	p.S8S	SDHB_ENST00000466613.1_5'UTR	NM_003000.2	NP_002991.2	P21912	SDHB_HUMAN	succinate dehydrogenase complex, subunit B, iron sulfur (Ip)	8					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|succinate metabolic process (GO:0006105)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex II (GO:0005749)|mitochondrion (GO:0005739)	2 iron, 2 sulfur cluster binding (GO:0051537)|3 iron, 4 sulfur cluster binding (GO:0051538)|4 iron, 4 sulfur cluster binding (GO:0051539)|electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|succinate dehydrogenase (ubiquinone) activity (GO:0008177)|ubiquinone binding (GO:0048039)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)	10		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.00054)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0049)|COAD - Colon adenocarcinoma(227;1.18e-05)|BRCA - Breast invasive adenocarcinoma(304;2.41e-05)|Kidney(64;0.000188)|KIRC - Kidney renal clear cell carcinoma(64;0.00273)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0656)|Lung(427;0.19)	Succinic acid(DB00139)	GGCGCCTCAAGGAGAGGGCGA	0.672			"""Mis, N, F"""			"""paraganglioma, pheochromocytoma"""			Familial Paragangliomas;Cowden syndrome;Carney-Stratakis syndrome				G|||	6	0.00119808	0.0	0.0	5008	,	,		13581	0.0		0.006	False		,,,				2504	0.0				p.S8S		.	yes	Rec		Familial paraganglioma	1	1p36.1-p35	6390	"""succinate dehydrogenase complex, subunit B, iron sulfur (Ip)"""		O	.	SDHB-658	0			c.C24T						.	G		6,4398		0,6,2196	18.0	21.0	20.0		24	4.3	1.0	1	dbSNP_134	20	65,8531		1,63,4234	no	coding-synonymous	SDHB	NM_003000.2		1,69,6430	AA,AG,GG		0.7562,0.1362,0.5462		8/281	17380491	71,12929	2202	4298	6500	SO:0001819	synonymous_variant	6390	exon1	Familial Cancer Database	Hereditary Glomus Tumors, Familial Paragangliomas, Hereditary Paragangliomas, type 1-3: PGL1, PGL2, PGL3, incl. Familial Carotid Body Paraganglioma and Sensorineural Hearing Loss;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;Carney-Stratakis dyad, Paraganglioma-Gastric Stromal Sarcoma dyad	CCTCAAGGAGAGG	U17248	CCDS176.1	1p36.1-p35	2014-09-17			ENSG00000117118	ENSG00000117118	1.3.99.1	"""Mitochondrial respiratory chain complex / Complex II"""	10681	protein-coding gene	gene with protein product		185470		SDH1, SDH			Standard	NM_003000		Approved		uc001bae.3	P21912	OTTHUMG00000002289	ENST00000375499.3:c.24C>T	1.37:g.17380491G>A		Somatic	70	0		WXS	Illumina GAIIx	Phase_I	186	5	NM_003000	0	0	0	0	0	B2R545|Q0QEY7|Q9NQ12	Silent	SNP	ENST00000375499.3	37	CCDS176.1																																																																																			G|0.996;A|0.004		0.672	SDHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006603.1	NM_003000	
PADI4	23569	bcgsc.ca	37	1	17660499	17660499	+	Missense_Mutation	SNP	G	G	C	rs874881	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr1:17660499G>C	ENST00000375448.4	+	3	361	c.335G>C	c.(334-336)gGg>gCg	p.G112A	AC004824.2_ENST00000602074.1_Intron|PADI4_ENST00000375453.1_Missense_Mutation_p.G112A	NM_012387.2	NP_036519.2	Q9UM07	PADI4_HUMAN	peptidyl arginine deiminase, type IV	112			G -> A (does not catalytic activity; dbSNP:rs874881). {ECO:0000269|PubMed:10488123, ECO:0000269|PubMed:15489334}.		cellular protein modification process (GO:0006464)|chromatin modification (GO:0016568)|chromatin remodeling (GO:0006338)|histone citrullination (GO:0036414)|histone H3-R26 citrullination (GO:0036413)|innate immune response (GO:0045087)|nucleosome assembly (GO:0006334)|protein citrullination (GO:0018101)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	arginine deiminase activity (GO:0016990)|calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(13)|ovary(2)|skin(2)|urinary_tract(3)	26		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000338)|Lung NSC(340;0.00042)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00537)|BRCA - Breast invasive adenocarcinoma(304;8.54e-06)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(64;0.000223)|KIRC - Kidney renal clear cell carcinoma(64;0.00313)|STAD - Stomach adenocarcinoma(196;0.00707)|READ - Rectum adenocarcinoma(331;0.0689)|Lung(427;0.199)	L-Citrulline(DB00155)	TACCTCACCGGGGTGGGTAAG	0.512													G|||	2614	0.521965	0.4607	0.5403	5008	,	,		17445	0.5585		0.5537	False		,,,				2504	0.5215				p.G112A		.											.	PADI4-70	0			c.G335C						.	G	ALA/GLY	2143,2263	580.0+/-385.0	511,1121,571	92.0	76.0	81.0		335	4.7	0.9	1	dbSNP_86	81	4738,3862	609.5+/-395.5	1295,2148,857	yes	missense	PADI4	NM_012387.2	60	1806,3269,1428	CC,CG,GG		44.907,48.6382,47.0936	benign	112/664	17660499	6881,6125	2203	4300	6503	SO:0001583	missense	23569	exon3			TCACCGGGGTGGG	AB017919	CCDS180.1	1p36.13	2014-06-06	2003-02-12		ENSG00000159339	ENSG00000159339	3.5.3.15	"""Peptidyl arginine deiminases"""	18368	protein-coding gene	gene with protein product		605347	"""peptidyl arginine deiminase, type V"""	PADI5		10488123	Standard	NM_012387		Approved	PAD, PDI5, PDI4	uc001baj.2	Q9UM07	OTTHUMG00000002371	ENST00000375448.4:c.335G>C	1.37:g.17660499G>C	ENSP00000364597:p.Gly112Ala	Somatic	104	1		WXS	Illumina GAIIx	Phase_I	119	5	NM_012387	0	0	0	0	0	A8K392|B2RBW0|Q5VTZ8|Q70SX4	Missense_Mutation	SNP	ENST00000375448.4	37	CCDS180.1	1110	0.5082417582417582	204	0.4146341463414634	185	0.511049723756906	315	0.5506993006993007	406	0.5356200527704486	g	10.46	1.355764	0.24598	0.486382	0.55093	ENSG00000159339	ENST00000375453;ENST00000358829;ENST00000375448	T;T	0.07800	3.16;3.16	4.74	4.74	0.60224	Cupredoxin (1);	0.155963	0.43747	D	0.000534	T	0.00012	0.0000	L	0.42744	1.35	0.31107	P	0.710423	P;P	0.38597	0.639;0.639	B;B	0.34824	0.19;0.19	T	0.20638	-1.0269	9	0.11182	T	0.66	-16.8479	13.6003	0.62015	0.0:0.0:1.0:0.0	rs874881;rs3737763;rs17852289;rs52816356;rs874881	112;112	A8K392;Q9UM07	.;PADI4_HUMAN	A	112	ENSP00000364602:G112A;ENSP00000364597:G112A	ENSP00000351690:G112A	G	+	2	0	PADI4	17533086	0.810000	0.29049	0.885000	0.34714	0.983000	0.72400	3.212000	0.51145	2.339000	0.79563	0.557000	0.71058	GGG	G|0.467;C|0.533		0.512	PADI4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006799.1	NM_012387	
KIF17	57576	bcgsc.ca	37	1	21012575	21012575	+	Silent	SNP	G	G	A	rs479323	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr1:21012575G>A	ENST00000247986.2	-	9	2293	c.1983C>T	c.(1981-1983)ccC>ccT	p.P661P	KIF17_ENST00000375044.1_Silent_p.P561P|KIF17_ENST00000490034.1_5'UTR|KIF17_ENST00000400463.3_Silent_p.P661P			Q9P2E2	KIF17_HUMAN	kinesin family member 17	661					ATP catabolic process (GO:0006200)|cell projection organization (GO:0030030)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|neurogenesis (GO:0022008)|protein complex localization (GO:0031503)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			NS(2)|endometrium(3)|kidney(3)|large_intestine(9)|liver(1)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)		CCTCGGCTTCGGGCCTGGCAT	0.632													G|||	1046	0.208866	0.5794	0.0937	5008	,	,		16132	0.0357		0.0706	False		,,,				2504	0.1104				p.P661P		.											.	KIF17-94	0			c.C1983T						.	G	,	1947,2415		426,1095,660	29.0	29.0	29.0		1983,1983	-7.3	0.0	1	dbSNP_83	29	487,8055		13,461,3797	no	coding-synonymous,coding-synonymous	KIF17	NM_001122819.1,NM_020816.2	,	439,1556,4457	AA,AG,GG		5.7012,44.6355,18.8624	,	661/1029,661/1030	21012575	2434,10470	2181	4271	6452	SO:0001819	synonymous_variant	57576	exon9			GGCTTCGGGCCTG	AB037826	CCDS213.1, CCDS44079.1, CCDS72722.1	1p36.13	2012-08-01			ENSG00000117245	ENSG00000117245		"""Kinesins"""	19167	protein-coding gene	gene with protein product	"""kinesin-like protein KIF17"", ""KIF3-related motor protein"", ""KIF17 variant protein"""	605037				10846156	Standard	XR_241202		Approved	KIAA1405, KIF3X, KIF17B, OSM-3, KLP-2	uc001bdr.4	Q9P2E2	OTTHUMG00000002863	ENST00000247986.2:c.1983C>T	1.37:g.21012575G>A		Somatic	44	0		WXS	Illumina GAIIx	Phase_I	99	5	NM_001122819	0	0	0	0	0	A2A3Q7|A2A3Q8|O95077|Q53YS6|Q5VWA9|Q6GSA8|Q8N411	Silent	SNP	ENST00000247986.2	37	CCDS213.1																																																																																			G|0.793;A|0.207		0.632	KIF17-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276995.1	NM_020816	
HSPG2	3339	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	22180824	22180824	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr1:22180824G>C	ENST00000374695.3	-	50	6380	c.6301C>G	c.(6301-6303)Cgt>Ggt	p.R2101G	HSPG2_ENST00000430507.1_Missense_Mutation_p.R51G	NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	2101	Ig-like C2-type 6.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	AGCCGCAGACGGGAGCCGTGC	0.592																																					p.R2101G		.											.	HSPG2-141	0			c.C6301G						.						15.0	14.0	14.0					1																	22180824		2193	4285	6478	SO:0001583	missense	3339	exon50			GCAGACGGGAGCC	M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.6301C>G	1.37:g.22180824G>C	ENSP00000363827:p.Arg2101Gly	Somatic	49	0		WXS	Illumina GAIIx	Phase_I	53	45	NM_005529	0	0	5	12	7	Q16287|Q5SZI3|Q9H3V5	Missense_Mutation	SNP	ENST00000374695.3	37	CCDS30625.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.112618	0.77210	.	.	ENSG00000142798	ENST00000374695;ENST00000430507	T;T	0.67865	-0.29;-0.29	5.56	4.65	0.58169	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.35096	N	0.003443	T	0.69450	0.3112	L	0.46947	1.48	0.40702	D	0.982495	D;D	0.69078	0.996;0.997	D;P	0.63488	0.915;0.895	T	0.67577	-0.5635	10	0.33141	T	0.24	.	6.4514	0.21906	0.0896:0.0:0.7287:0.1817	.	41;2101	Q59EG0;P98160	.;PGBM_HUMAN	G	2101;51	ENSP00000363827:R2101G;ENSP00000416385:R51G	ENSP00000363827:R2101G	R	-	1	0	HSPG2	22053411	0.717000	0.27966	1.000000	0.80357	0.884000	0.51177	1.158000	0.31737	2.629000	0.89072	0.655000	0.94253	CGT	.		0.592	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007598.1	NM_005529	
ALG6	29929	ucsc.edu;bcgsc.ca	37	1	63885045	63885045	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr1:63885045G>T	ENST00000371108.4	+	12	1297	c.992G>T	c.(991-993)aGc>aTc	p.S331I	ALG6_ENST00000263440.4_Missense_Mutation_p.S333I	NM_013339.3	NP_037471.2	Q9Y672	ALG6_HUMAN	ALG6, alpha-1,3-glucosyltransferase	331					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucosyltransferase activity (GO:0046527)			endometrium(1)|large_intestine(4)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13						TTAAAGGTTAGCTGTGCGCTA	0.284																																					p.S331I		.											.	ALG6-90	0			c.G992T						.						137.0	136.0	136.0					1																	63885045		2202	4285	6487	SO:0001583	missense	29929	exon12			AGGTTAGCTGTGC	AF063604	CCDS30735.1	1p31.3	2013-03-01	2013-03-01		ENSG00000088035	ENSG00000088035	2.4.1.267		23157	protein-coding gene	gene with protein product	"""dolichyl-P-Glc:Man(9)GlcNAc(2)-PP-dolichol alpha- 1->3-glucosyltransferase"""	604566	"""asparagine-linked glycosylation 6 homolog (yeast, alpha-1,3-glucosyltransferase)"", ""asparagine-linked glycosylation 6, alpha-1,3-glucosyltransferase homolog (S. cerevisiae)"""			10359825, 11875054	Standard	NM_013339		Approved		uc021oof.1	Q9Y672	OTTHUMG00000009140	ENST00000371108.4:c.992G>T	1.37:g.63885045G>T	ENSP00000360149:p.Ser331Ile	Somatic	28	0		WXS	Illumina GAIIx	Phase_I	37	4	NM_013339	0	0	0	0	0	B3KMU2|Q5SXR9|Q9H3I0	Missense_Mutation	SNP	ENST00000371108.4	37	CCDS30735.1	.	.	.	.	.	.	.	.	.	.	G	13.11	2.140359	0.37825	.	.	ENSG00000088035	ENST00000371108;ENST00000263440	D;D	0.83914	-1.78;-1.78	5.07	1.94	0.25998	.	0.141030	0.64402	D	0.000003	T	0.58047	0.2095	L	0.39566	1.225	0.40236	D	0.977906	B	0.13594	0.008	B	0.14023	0.01	T	0.48625	-0.9019	10	0.22706	T	0.39	-14.323	9.8236	0.40899	0.0725:0.4078:0.5197:0.0	.	333	A2A2G4	.	I	331;333	ENSP00000360149:S331I;ENSP00000263440:S333I	ENSP00000263440:S333I	S	+	2	0	ALG6	63657633	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.780000	0.38634	0.178000	0.19917	0.563000	0.77884	AGC	.		0.284	ALG6-001	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000025330.2	NM_013339	
KCNN3	3782	bcgsc.ca	37	1	154744852	154744852	+	Silent	SNP	A	A	G	rs1131820	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr1:154744852A>G	ENST00000271915.4	-	3	1362	c.1047T>C	c.(1045-1047)aaT>aaC	p.N349N	KCNN3_ENST00000358505.2_Silent_p.N36N|KCNN3_ENST00000361147.4_Silent_p.N44N	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	354					potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	CATCCGCGCCATTGTCGATCA	0.607													A|||	3902	0.779153	0.593	0.8401	5008	,	,		20790	0.9831		0.7445	False		,,,				2504	0.8129				p.N349N		.											.	KCNN3-91	0			c.T1047C						.	A	,,	2822,1584	664.1+/-401.3	900,1022,281	39.0	35.0	36.0		1047,1047,132	-2.9	1.0	1	dbSNP_86	36	6349,2251	704.3+/-405.4	2322,1705,273	no	coding-synonymous,coding-synonymous,coding-synonymous	KCNN3	NM_001204087.1,NM_002249.5,NM_170782.2	,,	3222,2727,554	GG,GA,AA		26.1744,35.951,29.4864	,,	349/747,349/732,44/427	154744852	9171,3835	2203	4300	6503	SO:0001819	synonymous_variant	3782	exon3			CGCGCCATTGTCG	AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.1047T>C	1.37:g.154744852A>G		Somatic	260	2		WXS	Illumina GAIIx	Phase_I	379	9	NM_001204087	0	0	0	0	0	B1ANX0|O43517|Q86VF9|Q8WXG7	Silent	SNP	ENST00000271915.4	37	CCDS30880.1																																																																																			G|0.746;N|0.000		0.607	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090688.3	NM_002249	
SOAT1	6646	ucsc.edu;bcgsc.ca	37	1	179312752	179312752	+	Silent	SNP	C	C	T	rs10753191	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr1:179312752C>T	ENST00000367619.3	+	10	1112	c.969C>T	c.(967-969)gtC>gtT	p.V323V	SOAT1_ENST00000539888.1_Silent_p.V258V|SOAT1_ENST00000540564.1_Silent_p.V265V|SOAT1_ENST00000535686.1_Silent_p.V59V	NM_003101.5	NP_003092.4	P35610	SOAT1_HUMAN	sterol O-acyltransferase 1	323					cholesterol efflux (GO:0033344)|cholesterol esterification (GO:0034435)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol storage (GO:0010878)|macrophage derived foam cell differentiation (GO:0010742)|positive regulation of amyloid precursor protein biosynthetic process (GO:0042986)|very-low-density lipoprotein particle assembly (GO:0034379)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	cholesterol binding (GO:0015485)|cholesterol O-acyltransferase activity (GO:0034736)|fatty-acyl-CoA binding (GO:0000062)|sterol O-acyltransferase activity (GO:0004772)			central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(10)|prostate(1)|skin(3)|stomach(1)	20					Ezetimibe(DB00973)|Hesperetin(DB01094)	GGGGTTATGTCGCTATGAAGT	0.313													C|||	1315	0.26258	0.3472	0.2882	5008	,	,		16006	0.3542		0.1302	False		,,,				2504	0.1718				p.V323V		.											.	SOAT1-515	0			c.C969T						.	C		1388,3018	446.7+/-348.1	218,952,1033	137.0	135.0	136.0		969	-10.6	0.6	1	dbSNP_120	136	1210,7390	242.9+/-272.7	89,1032,3179	no	coding-synonymous	SOAT1	NM_003101.4		307,1984,4212	TT,TC,CC		14.0698,31.5025,19.9754		323/551	179312752	2598,10408	2203	4300	6503	SO:0001819	synonymous_variant	6646	exon10			TTATGTCGCTATG	L21934	CCDS1330.1, CCDS58047.1, CCDS58048.1	1q25	2008-08-26	2008-08-26		ENSG00000057252	ENSG00000057252	2.3.1.26		11177	protein-coding gene	gene with protein product	"""acyl-Coenzyme A: cholesterol acyltransferase"""	102642	"""sterol O-acyltransferase (acyl-Coenzyme A: cholesterol acyltransferase) 1"""	SOAT, STAT		8407899	Standard	NM_003101		Approved	ACAT	uc001gml.3	P35610	OTTHUMG00000035253	ENST00000367619.3:c.969C>T	1.37:g.179312752C>T		Somatic	45	0		WXS	Illumina GAIIx	Phase_I	47	4	NM_003101	0	0	247	247	0	A6NC40|A8K3P4|A9Z1V7|B4DU95|Q5T0X4|Q8N1E4	Silent	SNP	ENST00000367619.3	37	CCDS1330.1																																																																																			C|0.768;N|0.000		0.313	SOAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085286.2	NM_003101	
IGFN1	91156	bcgsc.ca	37	1	201184275	201184275	+	Silent	SNP	C	C	T	rs2275673	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr1:201184275C>T	ENST00000335211.4	+	14	9118	c.8988C>T	c.(8986-8988)acC>acT	p.T2996T	IGFN1_ENST00000451870.2_Silent_p.T539T|IGFN1_ENST00000295591.8_Silent_p.T156T	NM_001164586.1	NP_001158058.1	Q86VF2	IGFN1_HUMAN	immunoglobulin-like and fibronectin type III domain containing 1	539						nucleus (GO:0005634)|Z disc (GO:0030018)				autonomic_ganglia(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						CCACCCTGACCGTCCAGGGTA	0.582													T|||	1652	0.329872	0.2383	0.3314	5008	,	,		19691	0.3452		0.3509	False		,,,				2504	0.4151				p.T2996T		.											.	IGFN1-71	0			c.C8988T						.	T		1176,3230	710.0+/-407.8	148,880,1175	56.0	45.0	49.0		8988	-6.3	0.0	1	dbSNP_100	49	2885,5715	670.8+/-402.8	495,1895,1910	no	coding-synonymous	IGFN1	NM_001164586.1		643,2775,3085	TT,TC,CC		33.5465,26.6909,31.2241		2996/3709	201184275	4061,8945	2203	4300	6503	SO:0001819	synonymous_variant	91156	exon14			CCTGACCGTCCAG	AY245430	CCDS53455.1	1q32.1	2013-02-11			ENSG00000163395	ENSG00000163395		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	24607	protein-coding gene	gene with protein product							Standard	NM_001164586		Approved	DKFZp434B1231, EEF1A2BP1	uc001gwc.3	Q86VF2	OTTHUMG00000035728	ENST00000335211.4:c.8988C>T	1.37:g.201184275C>T		Somatic	286	0		WXS	Illumina GAIIx	Phase_I	332	10	NM_001164586	0	0	0	0	0	F8WAI1|Q9NT72	Silent	SNP	ENST00000335211.4	37	CCDS53455.1	728	0.3333333333333333	129	0.2621951219512195	116	0.32044198895027626	216	0.3776223776223776	267	0.35224274406332456	T	6.988	0.552422	0.13374	0.266909	0.335465	ENSG00000163395	ENST00000412892	.	.	.	4.65	-6.29	0.02013	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.12502	-1.0545	3	.	.	.	.	10.8458	0.46743	0.0948:0.2532:0.0:0.652	rs2275673;rs59363565;rs2275673	.	.	.	C	414	.	.	R	+	1	0	IGFN1	199450898	0.000000	0.05858	0.001000	0.08648	0.201000	0.24016	-1.251000	0.02882	-2.397000	0.00581	-3.288000	0.00047	CGT	C|0.683;T|0.317		0.582	IGFN1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_178275	
SLC26A9	115019	broad.mit.edu	37	1	205898454	205898454	+	Missense_Mutation	SNP	G	G	A	rs143411715	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr1:205898454G>A	ENST00000367135.3	-	7	861	c.748C>T	c.(748-750)Cac>Tac	p.H250Y	SLC26A9_ENST00000340781.4_Missense_Mutation_p.H250Y|SLC26A9_ENST00000367134.2_Missense_Mutation_p.H250Y	NM_052934.3	NP_443166.1	Q7LBE3	S26A9_HUMAN	solute carrier family 26 (anion exchanger), member 9	250					anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|positive regulation of gene expression (GO:0010628)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	anion:anion antiporter activity (GO:0015301)|ATPase binding (GO:0051117)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride channel activity (GO:0005254)|secondary active sulfate transmembrane transporter activity (GO:0008271)			NS(1)|breast(3)|endometrium(11)|kidney(1)|large_intestine(6)|lung(17)|ovary(1)|skin(7)|urinary_tract(5)	52	Breast(84;0.201)		BRCA - Breast invasive adenocarcinoma(75;0.0458)			ATGTTGGTGTGGGGGAGGTTT	0.542													G|||	2	0.000399361	0.0008	0.0	5008	,	,		19547	0.0		0.001	False		,,,				2504	0.0				p.H250Y		.											.	SLC26A9-92	0			c.C748T						.	G	TYR/HIS,TYR/HIS	0,4406		0,0,2203	150.0	138.0	142.0		748,748	2.6	1.0	1	dbSNP_134	142	10,8590	7.7+/-29.5	0,10,4290	yes	missense,missense	SLC26A9	NM_052934.3,NM_134325.2	83,83	0,10,6493	AA,AG,GG		0.1163,0.0,0.0769	benign,benign	250/792,250/888	205898454	10,12996	2203	4300	6503	SO:0001583	missense	115019	exon7			TGGTGTGGGGGAG	AF331525	CCDS30989.1, CCDS30990.1	1q32.1	2013-07-18	2013-07-18		ENSG00000174502	ENSG00000174502		"""Solute carriers"""	14469	protein-coding gene	gene with protein product	"""anion transporter/exchanger-9"""	608481	"""solute carrier family 26, member 9"""			11834742	Standard	NM_134325		Approved		uc001hdp.3	Q7LBE3	OTTHUMG00000036001	ENST00000367135.3:c.748C>T	1.37:g.205898454G>A	ENSP00000356103:p.His250Tyr	Somatic	77	0		WXS	Illumina GAIIx	Phase_I	67	4	NM_052934	0	0	0	0	0	A7E2V6|B1AVM8|B1AVM9|B7ZKK2|Q96PK9|Q96RN0	Missense_Mutation	SNP	ENST00000367135.3	37	CCDS30990.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	13.84	2.355968	0.41700	0.0	0.001163	ENSG00000174502	ENST00000340781;ENST00000367135;ENST00000367134	D;D;D	0.92699	-3.09;-3.08;-3.09	5.6	2.64	0.31445	Sulphate transporter (1);	0.508000	0.20836	N	0.084792	D	0.86896	0.6043	L	0.47190	1.495	0.09310	N	1	B;P	0.35821	0.301;0.523	B;B	0.32090	0.089;0.14	T	0.78344	-0.2240	10	0.72032	D	0.01	.	8.7235	0.34456	0.0:0.2454:0.3589:0.3957	.	250;250	Q7LBE3;B1AVM8	S26A9_HUMAN;.	Y	250	ENSP00000341682:H250Y;ENSP00000356103:H250Y;ENSP00000356102:H250Y	ENSP00000341682:H250Y	H	-	1	0	SLC26A9	204165077	0.927000	0.31430	0.974000	0.42286	0.996000	0.88848	0.078000	0.14761	0.281000	0.22233	0.561000	0.74099	CAC	G|0.999;A|0.001		0.542	SLC26A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087742.1	NM_052934	
IBA57	200205	broad.mit.edu	37	1	228362441	228362441	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr1:228362441C>A	ENST00000366711.3	+	2	392	c.390C>A	c.(388-390)agC>agA	p.S130R	IBA57_ENST00000484749.1_3'UTR|IBA57_ENST00000546123.1_5'UTR	NM_001010867.2	NP_001010867.1	Q5T440	CAF17_HUMAN	IBA57, iron-sulfur cluster assembly homolog (S. cerevisiae)	130					glycine catabolic process (GO:0006546)|heme biosynthetic process (GO:0006783)	mitochondrion (GO:0005739)	aminomethyltransferase activity (GO:0004047)|poly(A) RNA binding (GO:0044822)	p.S130R(2)		central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(7)|prostate(1)	11						AGTGTGACAGCTCGGTGCAGG	0.662																																					p.S130R		.											.	IBA57-90	2	Substitution - Missense(2)	prostate(1)|central_nervous_system(1)	c.C390A						.						24.0	24.0	24.0					1																	228362441		2199	4296	6495	SO:0001583	missense	200205	exon2			TGACAGCTCGGTG	AK022796	CCDS31046.1	1q42.13	2011-03-11	2011-03-11	2011-03-11	ENSG00000181873	ENSG00000181873			27302	protein-coding gene	gene with protein product	"""iron-sulfur cluster assembly factor for biotin synthase- and aconitase-like mitochondrial proteins, with a mass of 57kDa"""	615316	"""chromosome 1 open reading frame 69"""	C1orf69			Standard	NM_001010867		Approved	FLJ12734	uc001hsl.4	Q5T440	OTTHUMG00000039769	ENST00000366711.3:c.390C>A	1.37:g.228362441C>A	ENSP00000355672:p.Ser130Arg	Somatic	19	2		WXS	Illumina GAIIx	Phase_I	52	10	NM_001010867	0	0	1	1	0		Missense_Mutation	SNP	ENST00000366711.3	37	CCDS31046.1	.	.	.	.	.	.	.	.	.	.	C	7.793	0.711906	0.15306	.	.	ENSG00000181873	ENST00000366711	T	0.75154	-0.91	4.65	0.706	0.18133	Glycine cleavage T-protein, N-terminal (1);	0.591122	0.18565	N	0.137486	T	0.57651	0.2068	N	0.25647	0.755	0.20307	N	0.999915	B	0.12013	0.005	B	0.20384	0.029	T	0.42582	-0.9443	10	0.28530	T	0.3	-8.2527	8.9387	0.35715	0.0:0.6235:0.0:0.3765	.	130	Q5T440	CAF17_HUMAN	R	130	ENSP00000355672:S130R	ENSP00000355672:S130R	S	+	3	2	IBA57	226429064	0.000000	0.05858	0.001000	0.08648	0.127000	0.20565	-0.053000	0.11846	-0.022000	0.13986	0.655000	0.94253	AGC	.		0.662	IBA57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095980.1	NM_001010867	
OBSCN	84033	bcgsc.ca	37	1	228494790	228494790	+	Missense_Mutation	SNP	G	G	A	rs435776	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr1:228494790G>A	ENST00000422127.1	+	45	12159	c.12115G>A	c.(12115-12117)Gga>Aga	p.G4039R	OBSCN_ENST00000570156.2_Missense_Mutation_p.G4996R|OBSCN_ENST00000284548.11_Missense_Mutation_p.G4039R|OBSCN_ENST00000366707.4_Missense_Mutation_p.G1673R|OBSCN_ENST00000366709.4_Missense_Mutation_p.G1158R	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	4039	Ig-like 41.		G -> R (in dbSNP:rs435776).		apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GCTGGTACGCGGAGTGGAGCA	0.642													G|||	1345	0.26857	0.0605	0.3775	5008	,	,		18993	0.249		0.4841	False		,,,				2504	0.271				p.G4996R		.											.	OBSCN-403	0			c.G14986A						.	G	ARG/GLY,ARG/GLY	513,3873		42,429,1722	66.0	79.0	74.0		12115,12115	0.3	0.0	1	dbSNP_80	74	4232,4336		1070,2092,1122	yes	missense,missense	OBSCN	NM_001098623.1,NM_052843.2	125,125	1112,2521,2844	AA,AG,GG		49.3931,11.6963,36.6296	probably-damaging,probably-damaging	4039/7969,4039/6621	228494790	4745,8209	2193	4284	6477	SO:0001583	missense	84033	exon56			GTACGCGGAGTGG	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.12115G>A	1.37:g.228494790G>A	ENSP00000409493:p.Gly4039Arg	Somatic	286	1		WXS	Illumina GAIIx	Phase_I	461	11	NM_001271223	0	0	4	4	0	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	CCDS58065.1	663	0.30357142857142855	35	0.07113821138211382	136	0.3756906077348066	134	0.23426573426573427	358	0.47229551451187335	G	10.99	1.506355	0.26949	0.116963	0.493931	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709	T;T;T;T	0.04654	3.58;3.58;3.58;3.58	5.81	0.336	0.15958	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.527305	0.18679	N	0.134218	T	0.00012	0.0000	L	0.37630	1.12	0.80722	P	0.0	P;B	0.43578	0.811;0.058	B;B	0.34652	0.187;0.012	T	0.34403	-0.9830	9	0.15066	T	0.55	.	7.3643	0.26764	0.325:0.1044:0.5706:0.0	rs435776;rs61021469;rs435776	4039;4039	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	R	4039;4039;1673;1158	ENSP00000284548:G4039R;ENSP00000409493:G4039R;ENSP00000355668:G1673R;ENSP00000355670:G1158R	ENSP00000284548:G4039R	G	+	1	0	OBSCN	226561413	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.390000	0.07332	-0.169000	0.10834	0.462000	0.41574	GGA	G|0.378;T|0.151		0.642	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
OBSCN	84033	hgsc.bcm.edu	37	1	228504669	228504669	+	Silent	SNP	G	G	A	rs61825302	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr1:228504669G>A	ENST00000422127.1	+	51	13589	c.13545G>A	c.(13543-13545)gcG>gcA	p.A4515A	OBSCN_ENST00000570156.2_Silent_p.A5472A|OBSCN_ENST00000284548.11_Silent_p.A4515A|OBSCN_ENST00000366707.4_Silent_p.A2149A|OBSCN_ENST00000366709.4_Silent_p.A1634A	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	4515	Ig-like 46.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				TGGCCTCTGCGCGGCTCACCG	0.731													g|||	729	0.145567	0.1218	0.2349	5008	,	,		13931	0.1518		0.159	False		,,,				2504	0.0941				p.A5472A		.											.	OBSCN-403	0			c.G16416A						.		,	507,3253		36,435,1409	5.0	6.0	6.0		13545,13545	-6.2	0.0	1	dbSNP_129	6	1105,6501		71,963,2769	no	coding-synonymous,coding-synonymous	OBSCN	NM_001098623.1,NM_052843.2	,	107,1398,4178	AA,AG,GG		14.528,13.484,14.1827	,	4515/7969,4515/6621	228504669	1612,9754	1880	3803	5683	SO:0001819	synonymous_variant	84033	exon62			CTCTGCGCGGCTC	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.13545G>A	1.37:g.228504669G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	10	NM_001271223	0	0	0	2	2	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Silent	SNP	ENST00000422127.1	37	CCDS58065.1																																																																																			G|0.841;A|0.159		0.731	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
PGBD5	79605	broad.mit.edu	37	1	230492646	230492646	+	Silent	SNP	T	T	C			TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr1:230492646T>C	ENST00000525115.1	-	2	569	c.546A>G	c.(544-546)caA>caG	p.Q182Q	PGBD5_ENST00000321327.2_Silent_p.Q281Q|PGBD5_ENST00000391860.1_Silent_p.Q136Q			Q8N414	PGBD5_HUMAN	piggyBac transposable element derived 5	182						integral component of membrane (GO:0016021)				biliary_tract(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(8)|lung(6)|ovary(2)|prostate(2)|skin(1)	33	Breast(184;0.0397)	Prostate(94;0.167)		GBM - Glioblastoma multiforme(131;0.201)		TCACCTGGGTTTGGGAAGGCC	0.622																																					p.Q251Q		.											.	PGBD5-93	0			c.A753G						.						67.0	59.0	62.0					1																	230492646		2203	4300	6503	SO:0001819	synonymous_variant	79605	exon2			CTGGGTTTGGGAA	AK021475		1q42.13	2008-02-05			ENSG00000177614	ENSG00000177614			19405	protein-coding gene	gene with protein product							Standard	NM_001258311		Approved	DKFZp761A0620, FLJ11413	uc031psq.1	Q8N414	OTTHUMG00000037759	ENST00000525115.1:c.546A>G	1.37:g.230492646T>C		Somatic	115	0		WXS	Illumina GAIIx	Phase_I	139	6	NM_001258311	0	0	0	0	0	A0PJF3|B9EK58|Q5SR37|Q6PJN2	Silent	SNP	ENST00000525115.1	37																																																																																				.		0.622	PGBD5-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000382617.1	NM_024554	
FMN2	56776	broad.mit.edu	37	1	240255569	240255571	+	In_Frame_Del	DEL	GGC	GGC	-	rs71929261|rs140531536	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr1:240255569_240255571delGGC	ENST00000319653.9	+	1	390_392	c.160_162delGGC	c.(160-162)ggcdel	p.G59del		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	59					cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)	p.G197delG(1)		NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			GGGGGGAgggggcggcggcggcg	0.665														3539	0.706669	0.7821	0.7507	5008	,	,		10143	0.4514		0.7893	False		,,,				2504	0.7515				p.54_54del		.											.	FMN2-145	1	Deletion - In frame(1)	prostate(1)	c.160_162del						.																																			SO:0001651	inframe_deletion	56776	exon1			GGAGGGGGCGGCG	AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.160_162delGGC	1.37:g.240255578_240255580delGGC	ENSP00000318884:p.Gly59del	Somatic	4	0		WXS	Illumina GAIIx	Phase_I	11	5	NM_020066	0	0	0	0	0	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	In_Frame_Del	DEL	ENST00000319653.9	37	CCDS31069.2																																																																																			.		0.665	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2	XM_371352	
MYO3A	53904	bcgsc.ca	37	10	26463130	26463130	+	Missense_Mutation	SNP	C	C	A	rs1999240	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr10:26463130C>A	ENST00000265944.5	+	30	4103	c.3937C>A	c.(3937-3939)Cgt>Agt	p.R1313S	MYO3A_ENST00000543632.1_Intron	NM_017433.4	NP_059129.3	Q8NEV4	MYO3A_HUMAN	myosin IIIA	1313			R -> S (in dbSNP:rs1999240). {ECO:0000269|PubMed:10936054, ECO:0000269|PubMed:12032315, ECO:0000269|PubMed:17344846}.		ATP catabolic process (GO:0006200)|inner ear development (GO:0048839)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|stereocilium bundle tip (GO:0032426)	actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|plus-end directed microfilament motor activity (GO:0060002)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(9)|central_nervous_system(3)|endometrium(9)|kidney(10)|large_intestine(28)|liver(1)|lung(46)|ovary(11)|pancreas(1)|prostate(6)|skin(11)|stomach(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	146						AGTTACCCAGCGTGCACCGAT	0.458													A|||	3010	0.601038	0.5545	0.634	5008	,	,		21700	0.6329		0.6004	False		,,,				2504	0.6084				p.R1313S		.											.	MYO3A-1007	0			c.C3937A						.	A	SER/ARG	2403,2003	559.9+/-380.3	658,1087,458	115.0	122.0	120.0		3937	4.1	0.6	10	dbSNP_92	120	4916,3684	527.3+/-381.1	1417,2082,801	yes	missense	MYO3A	NM_017433.4	110	2075,3169,1259	AA,AC,CC		42.8372,45.4607,43.726	benign	1313/1617	26463130	7319,5687	2203	4300	6503	SO:0001583	missense	53904	exon30			ACCCAGCGTGCAC	AF229172	CCDS7148.1	10p11.1	2011-09-27	2004-05-19		ENSG00000095777	ENSG00000095777		"""Myosins / Myosin superfamily : Class III"""	7601	protein-coding gene	gene with protein product		606808	"""deafness, autosomal recessive 30"""	DFNB30		10936054	Standard	NM_017433		Approved		uc001isn.2	Q8NEV4	OTTHUMG00000017837	ENST00000265944.5:c.3937C>A	10.37:g.26463130C>A	ENSP00000265944:p.Arg1313Ser	Somatic	173	1		WXS	Illumina GAIIx	Phase_I	333	9	NM_017433	0	0	4	4	0	Q4G0X2|Q5VZ28|Q8WX17|Q9NYS8	Missense_Mutation	SNP	ENST00000265944.5	37	CCDS7148.1	1348	0.6172161172161172	286	0.5813008130081301	216	0.5966850828729282	385	0.6730769230769231	461	0.6081794195250659	A	0.007	-1.940455	0.00479	0.545393	0.571628	ENSG00000095777	ENST00000265944	T	0.78246	-1.16	5.22	4.07	0.47477	.	0.302191	0.40302	N	0.001124	T	0.00012	0.0000	N	0.08118	0	0.21553	P	0.999643656	B	0.02656	0.0	B	0.01281	0.0	T	0.46247	-0.9205	9	0.08837	T	0.75	.	8.6585	0.34077	0.4916:0.393:0.0:0.1154	rs1999240;rs3740230;rs17667000;rs52822170;rs57559611;rs1999240	1313	Q8NEV4	MYO3A_HUMAN	S	1313	ENSP00000265944:R1313S	ENSP00000265944:R1313S	R	+	1	0	MYO3A	26503136	0.993000	0.37304	0.583000	0.28640	0.147000	0.21601	3.235000	0.51328	0.300000	0.22699	-0.362000	0.07510	CGT	C|0.401;A|0.599		0.458	MYO3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047259.1	NM_017433	
ZNF485	220992	bcgsc.ca	37	10	44111806	44111806	+	Silent	SNP	G	G	A	rs10899839	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr10:44111806G>A	ENST00000361807.3	+	5	509	c.315G>A	c.(313-315)ctG>ctA	p.L105L	ZNF485_ENST00000374435.3_Silent_p.L105L|ZNF485_ENST00000374437.2_Silent_p.L14L	NM_145312.3	NP_660355.2	Q8NCK3	ZN485_HUMAN	zinc finger protein 485	105					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|skin(1)|urinary_tract(1)	16						CATCTGTTCTGGGAGAGCGAA	0.418													G|||	1519	0.303315	0.534	0.2954	5008	,	,		19252	0.0417		0.2654	False		,,,				2504	0.3057				p.L105L		.											.	ZNF485-90	0			c.G315A						.	G		2271,2135	596.9+/-388.7	596,1079,528	65.0	67.0	66.0		315	2.0	0.0	10	dbSNP_120	66	2579,6021	418.9+/-352.9	393,1793,2114	no	coding-synonymous	ZNF485	NM_145312.3		989,2872,2642	AA,AG,GG		29.9884,48.4567,37.2905		105/442	44111806	4850,8156	2203	4300	6503	SO:0001819	synonymous_variant	220992	exon5			TGTTCTGGGAGAG	AK074679	CCDS7205.2	10q11.21	2013-01-08			ENSG00000198298	ENSG00000198298		"""Zinc fingers, C2H2-type"", ""-"""	23440	protein-coding gene	gene with protein product							Standard	NM_145312		Approved		uc010qfc.2	Q8NCK3	OTTHUMG00000018040	ENST00000361807.3:c.315G>A	10.37:g.44111806G>A		Somatic	175	0		WXS	Illumina GAIIx	Phase_I	257	8	NM_145312	0	0	3	3	0	B4DSE6|Q96CL0	Silent	SNP	ENST00000361807.3	37	CCDS7205.2																																																																																			G|0.681;A|0.319		0.418	ZNF485-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047719.2	NM_145312	
FAM21A	387680	bcgsc.ca	37	10	47915898	47915898	+	Silent	SNP	A	A	G	rs183064568		TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr10:47915898A>G	ENST00000358474.5	+	15	1305	c.1305A>G	c.(1303-1305)aaA>aaG	p.K435K		NM_018232.1	NP_060702.1	Q5SNT6	FA21B_HUMAN		435					retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|WASH complex (GO:0071203)		p.K435K(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	10						CTTCCAGCAAAAATCTCAAGC	0.408																																					p.K435K		.											.	FAM21B-23	1	Substitution - coding silent(1)	stomach(1)	c.A1305G						.						20.0	29.0	26.0					10																	47915898		1759	4018	5777	SO:0001819	synonymous_variant	55747	exon15			CAGCAAAAATCTC																												ENST00000358474.5:c.1305A>G	10.37:g.47915898A>G		Somatic	125	12		WXS	Illumina GAIIx	Phase_I	74	39	NM_018232	0	0	0	1	1		Silent	SNP	ENST00000358474.5	37	CCDS44379.1																																																																																			A|0.375;G|0.625		0.408	FAM21B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047871.2		
CDHR1	92211	broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	85978991	85978991	+	IGR	SNP	C	C	T	rs7895270	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr10:85978991C>T	ENST00000372117.3	+	0	5428				CDHR1_ENST00000332904.3_Silent_p.L733L	NM_033100.2	NP_149091.1	Q96JP9	CDHR1_HUMAN	cadherin-related family member 1						cellular process (GO:0009987)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(21)|ovary(1)|prostate(1)|skin(1)	36						TAATGTGAATCTGTACTCTAG	0.408													C|||	1392	0.277955	0.5227	0.2291	5008	,	,		18558	0.0655		0.2286	False		,,,				2504	0.2515				p.L733L		.											.	CDHR1-91	0			c.C2197T						.																																			SO:0001628	intergenic_variant	92211	exon17			GTGAATCTGTACT	AB053448	CCDS7372.1, CCDS53548.1	10q23.1	2014-01-28	2010-01-25	2010-01-25	ENSG00000148600	ENSG00000148600		"""Cadherins / Cadherin-related"""	14550	protein-coding gene	gene with protein product		609502	"""protocadherin 21"""	PCDH21		11597768	Standard	NM_001171971		Approved	KIAA1775, CORD15, RP65	uc001kcv.3	Q96JP9	OTTHUMG00000018634		10.37:g.85978991C>T		Somatic	36	0		WXS	Illumina GAIIx	Phase_I	46	7	NM_001171971	0	0	0	0	0	Q69YZ8|Q8IXY5	Silent	SNP	ENST00000372117.3	37	CCDS7372.1																																																																																			C|0.735;T|0.265		0.408	CDHR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049111.1	NM_033100	
RRP12	23223	bcgsc.ca	37	10	99155984	99155984	+	Silent	SNP	G	G	A	rs3814553	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr10:99155984G>A	ENST00000370992.4	-	3	555	c.444C>T	c.(442-444)ttC>ttT	p.F148F	RRP12_ENST00000414986.1_Silent_p.F148F|RRP12_ENST00000315563.6_Silent_p.F148F	NM_015179.3	NP_055994.2	Q5JTH9	RRP12_HUMAN	ribosomal RNA processing 12 homolog (S. cerevisiae)	148						integral component of membrane (GO:0016021)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(2)|lung(13)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	37		Colorectal(252;0.162)		Epithelial(162;2.72e-09)|all cancers(201;1.76e-07)		CCAGAGCAGCGAAGTACTCAG	0.572													G|||	2024	0.404153	0.5507	0.3429	5008	,	,		3638	0.3125		0.337	False		,,,				2504	0.4131				p.F148F		.											.	RRP12-92	0			c.C444T						.	G	,	2174,2232	585.8+/-386.3	545,1084,574	141.0	119.0	127.0		444,444	3.7	1.0	10	dbSNP_107	127	2742,5858	437.3+/-358.6	438,1866,1996	no	coding-synonymous,coding-synonymous	RRP12	NM_001145114.1,NM_015179.3	,	983,2950,2570	AA,AG,GG		31.8837,49.3418,37.7979	,	148/1237,148/1298	99155984	4916,8090	2203	4300	6503	SO:0001819	synonymous_variant	23223	exon3			AGCAGCGAAGTAC		CCDS7457.1, CCDS44467.1, CCDS60605.1	10q24.2	2006-11-06	2006-11-06	2006-11-06	ENSG00000052749	ENSG00000052749			29100	protein-coding gene	gene with protein product			"""KIAA0690"""	KIAA0690		9734811	Standard	NM_015179		Approved		uc001knf.3	Q5JTH9	OTTHUMG00000018855	ENST00000370992.4:c.444C>T	10.37:g.99155984G>A		Somatic	112	1		WXS	Illumina GAIIx	Phase_I	140	7	NM_001145114	0	0	0	0	0	B4DK00|E9PCK7|Q5JTH8|Q69YK4|Q96E87|Q9BUH3|Q9Y4C7	Silent	SNP	ENST00000370992.4	37	CCDS7457.1																																																																																			G|0.618;A|0.382		0.572	RRP12-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049699.4	NM_015179	
GSTO2	119391	bcgsc.ca	37	10	106039185	106039185	+	Missense_Mutation	SNP	A	A	G	rs156697	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr10:106039185A>G	ENST00000338595.2	+	5	744	c.424A>G	c.(424-426)Aat>Gat	p.N142D	GSTO2_ENST00000401888.2_Missense_Mutation_p.N142D|GSTO2_ENST00000477078.2_3'UTR|GSTO2_ENST00000369707.2_Missense_Mutation_p.N114D|GSTO2_ENST00000450629.2_Intron|GSTO2_ENST00000429569.2_Intron	NM_183239.1	NP_899062.1	Q9H4Y5	GSTO2_HUMAN	glutathione S-transferase omega 2	142	GST C-terminal.		N -> D (in dbSNP:rs156697). {ECO:0000269|PubMed:12618591}.		cellular response to arsenic-containing substance (GO:0071243)|glutathione derivative biosynthetic process (GO:1901687)|L-ascorbic acid metabolic process (GO:0019852)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	glutathione dehydrogenase (ascorbate) activity (GO:0045174)|glutathione transferase activity (GO:0004364)|methylarsonate reductase activity (GO:0050610)|oxidoreductase activity (GO:0016491)	p.N142D(1)		NS(1)|breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(2)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	11		Colorectal(252;0.178)		Epithelial(162;1.14e-09)|all cancers(201;3.89e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0155)	Glutathione(DB00143)	AGAATGCACTAATCTGAAGGC	0.527													G|||	2207	0.440695	0.8048	0.2752	5008	,	,		21195	0.255		0.3668	False		,,,				2504	0.3333				p.N142D		.											.	GSTO2-91	1	Substitution - Missense(1)	stomach(1)	c.A424G						.	G	,ASP/ASN,,ASP/ASN	3273,1133	405.8+/-333.6	1225,823,155	150.0	132.0	138.0		,340,,424	4.0	0.1	10	dbSNP_79	138	2929,5671	669.5+/-402.7	498,1933,1869	yes	intron,missense,intron,missense	GSTO2	NM_001191013.1,NM_001191014.1,NM_001191015.1,NM_183239.1	,23,,23	1723,2756,2024	GG,GA,AA		34.0581,25.7149,47.6857	,benign,,benign	,114/216,,142/244	106039185	6202,6804	2203	4300	6503	SO:0001583	missense	119391	exon5			TGCACTAATCTGA	AY191318	CCDS7556.1, CCDS53574.1, CCDS53575.1	10q25.1	2012-06-21			ENSG00000065621	ENSG00000065621	2.5.1.18, 1.8.5.1, 1.20.4.2	"""Glutathione S-transferases / Soluble"""	23064	protein-coding gene	gene with protein product		612314				12618591	Standard	NM_001191013		Approved		uc001kyb.3	Q9H4Y5	OTTHUMG00000019006	ENST00000338595.2:c.424A>G	10.37:g.106039185A>G	ENSP00000345023:p.Asn142Asp	Somatic	117	0		WXS	Illumina GAIIx	Phase_I	132	5	NM_183239	0	0	4	4	0	A8K771|B4DJW6|E7ESD6|Q49TW5|Q5GM70|Q5JU15|Q86WP3	Missense_Mutation	SNP	ENST00000338595.2	37	CCDS7556.1	936	0.42857142857142855	399	0.8109756097560976	114	0.3149171270718232	152	0.26573426573426573	271	0.3575197889182058	G	0.500	-0.871174	0.02570	0.742851	0.340581	ENSG00000065621	ENST00000369708;ENST00000338595;ENST00000401888;ENST00000369707	T;T;T	0.12774	2.65;3.17;2.65	5.87	3.96	0.45880	Glutathione S-transferase, C-terminal-like (2);Glutathione S-transferase/chloride channel, C-terminal (1);	0.333001	0.34986	N	0.003530	T	0.00012	0.0000	N	0.01048	-1.04	0.58432	P	1.999999999946489E-6	B	0.02656	0.0	B	0.04013	0.001	T	0.16660	-1.0395	9	0.12103	T	0.63	-7.1748	7.3566	0.26723	0.1496:0.1367:0.7137:0.0	rs156697;rs601755;rs11565111;rs17826262;rs60436392;rs156697	142	Q9H4Y5	GSTO2_HUMAN	D	142;142;142;114	ENSP00000345023:N142D;ENSP00000386011:N142D;ENSP00000358721:N114D	ENSP00000345023:N142D	N	+	1	0	GSTO2	106029175	0.009000	0.17119	0.081000	0.20488	0.253000	0.25986	0.748000	0.26305	0.851000	0.35264	-0.733000	0.03571	AAT	A|0.537;G|0.463		0.527	GSTO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050210.2	NM_183239	
JAKMIP3	282973	bcgsc.ca	37	10	133954011	133954011	+	Silent	SNP	C	C	T	rs2818387	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr10:133954011C>T	ENST00000298622.4	+	9	1539	c.1401C>T	c.(1399-1401)gaC>gaT	p.D467D		NM_001105521.2	NP_001098991.1	Q5VZ66	JKIP3_HUMAN	Janus kinase and microtubule interacting protein 3	467						Golgi apparatus (GO:0005794)				breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(10)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	31		all_cancers(35;5.63e-09)|all_epithelial(44;9.25e-07)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|Colorectal(31;0.0721)|all_neural(114;0.0726)|Breast(234;0.0949)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;0.000104)|Epithelial(32;0.000142)|all cancers(32;0.000185)|BRCA - Breast invasive adenocarcinoma(275;0.224)		TGGAATCCGACGGCTCCTCCG	0.592													C|||	2574	0.513978	0.4584	0.5793	5008	,	,		13772	0.5883		0.4841	False		,,,				2504	0.4969				p.D467D		.											.	JAKMIP3-23	0			c.C1401T						.	C		1813,2195		417,979,608	57.0	66.0	63.0		1401	-5.4	0.0	10	dbSNP_100	63	4080,4234		995,2090,1072	yes	coding-synonymous	JAKMIP3	NM_001105521.2		1412,3069,1680	TT,TC,CC		49.0739,45.2345,47.825		467/845	133954011	5893,6429	2004	4157	6161	SO:0001819	synonymous_variant	282973	exon9			ATCCGACGGCTCC	AL832756	CCDS44494.1	10q26.3	2009-04-23	2009-04-23	2008-01-28	ENSG00000188385	ENSG00000188385			23523	protein-coding gene	gene with protein product	"""neuroendocrine long coiled-coil 2"""	611198	"""chromosome 10 open reading frame 39"", ""chromosome 10 open reading frame 14"""	C10orf39, C10orf14		15277531, 17572408	Standard	NM_001105521		Approved	FLJ37857, NECC2, KIAA4091, bA140A10.5	uc001lkx.4	Q5VZ66	OTTHUMG00000150167	ENST00000298622.4:c.1401C>T	10.37:g.133954011C>T		Somatic	125	0		WXS	Illumina GAIIx	Phase_I	323	11	NM_001105521	0	0	0	0	0	A6PW00|Q69YM6|Q6ZT29	Silent	SNP	ENST00000298622.4	37	CCDS44494.1																																																																																			C|0.497;T|0.503		0.592	JAKMIP3-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051049.3	NM_194303	
CFAP46	54777	broad.mit.edu	37	10	134726621	134726621	+	Silent	SNP	G	G	C	rs4880467	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr10:134726621G>C	ENST00000368586.5	-	18	2362	c.2262C>G	c.(2260-2262)gcC>gcG	p.A754A	TTC40_ENST00000368582.2_Silent_p.A754A	NM_001200049.2	NP_001186978.2														breast(1)|endometrium(5)|lung(19)|urinary_tract(3)	28						TCTGCCGCCCGGCCAGGATCA	0.637													G|||	1435	0.286542	0.264	0.3429	5008	,	,		18941	0.1498		0.34	False		,,,				2504	0.363				p.A754A		.											.	.	0			c.C2262G						.																																			SO:0001819	synonymous_variant	54777	exon18			CCGCCCGGCCAGG																												ENST00000368586.5:c.2262C>G	10.37:g.134726621G>C		Somatic	149	0		WXS	Illumina GAIIx	Phase_I	402	8	NM_001200049	0	0	0	0	0		Silent	SNP	ENST00000368586.5	37	CCDS58101.1																																																																																			G|0.741;C|0.259		0.637	TTC40-001	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000051095.3		
MUC2	4583	broad.mit.edu	37	11	1092947	1092947	+	Missense_Mutation	SNP	C	C	A	rs111219026		TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr11:1092947C>A	ENST00000441003.2	+	30	4793	c.4766C>A	c.(4765-4767)aCc>aAc	p.T1589N	MUC2_ENST00000359061.5_Missense_Mutation_p.T1590N|MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000361558.6_Intron	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.T1589N(2)|p.T1590N(2)|p.T1590I(2)|p.T1589I(2)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	atcaccaccaccactacggtg	0.627																																					p.T1589N		.											.	MUC2-90	8	Substitution - Missense(8)	endometrium(8)	c.C4766A						.						58.0	93.0	81.0					11																	1092947		1850	3386	5236	SO:0001583	missense	4583	exon30			CCACCACCACTAC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4766C>A	11.37:g.1092947C>A	ENSP00000415183:p.Thr1589Asn	Somatic	121	1		WXS	Illumina GAIIx	Phase_I	152	7	NM_002457	0	0	0	0	0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	6.043	0.376346	0.11466	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.14516	2.5;2.84	1.75	1.75	0.24633	.	1.843980	0.03632	U	0.238018	T	0.07863	0.0197	.	.	.	0.09310	N	1	P	0.45986	0.87	B	0.31101	0.124	T	0.33189	-0.9878	9	0.27082	T	0.32	.	8.7142	0.34401	0.0:1.0:0.0:0.0	.	1589	E7EUV1	.	N	1589;1590	ENSP00000415183:T1589N;ENSP00000351956:T1590N	ENSP00000351956:T1590N	T	+	2	0	MUC2	1082947	0.034000	0.19679	0.006000	0.13384	0.170000	0.22686	1.835000	0.39181	1.016000	0.39470	0.121000	0.15741	ACC	.		0.627	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MUC5B	727897	hgsc.bcm.edu	37	11	1253976	1253976	+	Missense_Mutation	SNP	A	A	G	rs76956995		TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr11:1253976A>G	ENST00000529681.1	+	17	2099	c.2041A>G	c.(2041-2043)Agc>Ggc	p.S681G	MUC5B_ENST00000447027.1_Missense_Mutation_p.S684G	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	681					cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CGTACAGCTCAGCGACTGGAG	0.687																																					p.S681G		.											.	.	0			c.A2041G						.						22.0	25.0	24.0					11																	1253976		2121	4235	6356	SO:0001583	missense	727897	exon17			CAGCTCAGCGACT	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.2041A>G	11.37:g.1253976A>G	ENSP00000436812:p.Ser681Gly	Somatic	13	0		WXS	Illumina GAIIx	Phase_I	84	8	NM_002458	0	0	0	0	0	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	A	5.230	0.228008	0.09916	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.76578	-1.03;-1.03	4.6	-7.0	0.01599	Uncharacterised domain, cysteine-rich (2);	.	.	.	.	T	0.70605	0.3243	N	0.25144	0.715	0.09310	N	1	B;D;D	0.59357	0.425;0.985;0.985	B;P;P	0.54499	0.131;0.675;0.754	T	0.69614	-0.5098	9	0.87932	D	0	.	10.9271	0.47197	0.2958:0.5687:0.1355:0.0	.	681;1340;684	Q9HC84;A7Y9J9;E9PBJ0	MUC5B_HUMAN;.;.	G	681;684;682;717	ENSP00000436812:S681G;ENSP00000415793:S684G	ENSP00000343037:S682G	S	+	1	0	MUC5B	1210552	0.000000	0.05858	0.011000	0.14972	0.067000	0.16453	-4.642000	0.00204	-1.098000	0.03038	0.260000	0.18958	AGC	.		0.687	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
MUC5B	727897	hgsc.bcm.edu	37	11	1253980	1253980	+	Missense_Mutation	SNP	A	A	G	rs202127660		TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr11:1253980A>G	ENST00000529681.1	+	17	2103	c.2045A>G	c.(2044-2046)gAc>gGc	p.D682G	MUC5B_ENST00000447027.1_Missense_Mutation_p.D685G	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	682					cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CAGCTCAGCGACTGGAGGGAC	0.682																																					p.D682G		.											.	.	0			c.A2045G						.						21.0	24.0	23.0					11																	1253980		2116	4228	6344	SO:0001583	missense	727897	exon17			TCAGCGACTGGAG	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.2045A>G	11.37:g.1253980A>G	ENSP00000436812:p.Asp682Gly	Somatic	12	0		WXS	Illumina GAIIx	Phase_I	82	6	NM_002458	0	0	0	0	0	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	A	7.541	0.660740	0.14645	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.76060	-0.99;-0.99	4.6	2.72	0.32119	Uncharacterised domain, cysteine-rich (2);	.	.	.	.	T	0.50103	0.1596	N	0.02960	-0.455	0.24874	N	0.992269	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.45920	-0.9228	9	0.87932	D	0	.	8.6635	0.34108	0.2416:0.0:0.7584:0.0	.	682;1341;685	Q9HC84;A7Y9J9;E9PBJ0	MUC5B_HUMAN;.;.	G	682;685;683;718	ENSP00000436812:D682G;ENSP00000415793:D685G	ENSP00000343037:D683G	D	+	2	0	MUC5B	1210556	0.999000	0.42202	0.632000	0.29296	0.070000	0.16714	2.607000	0.46300	0.373000	0.24621	-1.983000	0.00453	GAC	.		0.682	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
MUC5B	727897	hgsc.bcm.edu	37	11	1271223	1271223	+	Silent	SNP	C	C	G			TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr11:1271223C>G	ENST00000529681.1	+	31	13171	c.13113C>G	c.(13111-13113)acC>acG	p.T4371T	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Silent_p.T4374T	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	4371	23 X approximate tandem repeats, Ser/Thr- rich.|Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CGAAGGCCACCACGACAAGGG	0.632																																					p.T4371T		.											.	.	0			c.C13113G						.						101.0	117.0	112.0					11																	1271223		2127	4219	6346	SO:0001819	synonymous_variant	727897	exon31			GGCCACCACGACA	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.13113C>G	11.37:g.1271223C>G		Somatic	296	0		WXS	Illumina GAIIx	Phase_I	400	34	NM_002458	0	0	0	0	0	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	ENST00000529681.1	37	CCDS44515.2																																																																																			.		0.632	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
SYT8	90019	hgsc.bcm.edu	37	11	1858572	1858572	+	Missense_Mutation	SNP	C	C	T	rs2292474	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr11:1858572C>T	ENST00000381968.3	+	9	1245	c.1117C>T	c.(1117-1119)Cgg>Tgg	p.R373W	TNNI2_ENST00000381905.3_5'Flank|TNNI2_ENST00000381906.1_5'Flank|SYT8_ENST00000535046.1_3'UTR|TNNI2_ENST00000381911.1_5'Flank|TNNI2_ENST00000252898.7_5'Flank|SYT8_ENST00000341958.3_Missense_Mutation_p.R359W	NM_138567.3	NP_612634	Q8NBV8	SYT8_HUMAN	synaptotagmin VIII	373					acrosome reaction (GO:0007340)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	transporter activity (GO:0005215)			breast(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	6		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		CATTGCCCAGCGGCACCCCCT	0.731													T|||	1928	0.384984	0.1679	0.415	5008	,	,		13483	0.378		0.498	False		,,,				2504	0.5481				p.R373W		.											.	SYT8-91	0			c.C1117T						.	T	TRP/ARG	906,3442		119,668,1387	12.0	14.0	14.0		1117	2.7	1.0	11	dbSNP_100	14	4072,4398		1026,2020,1189	no	missense	SYT8	NM_138567.3	101	1145,2688,2576	TT,TC,CC		48.0756,20.8372,38.836	benign	373/402	1858572	4978,7840	2174	4235	6409	SO:0001583	missense	90019	exon9			GCCCAGCGGCACC	AL137708	CCDS7726.2	11p15.5	2013-01-21			ENSG00000149043	ENSG00000149043		"""Synaptotagmins"""	19264	protein-coding gene	gene with protein product		607719				7791877	Standard	XM_005253216		Approved	DKFZp434K0322	uc001lue.1	Q8NBV8	OTTHUMG00000009026	ENST00000381968.3:c.1117C>T	11.37:g.1858572C>T	ENSP00000371394:p.Arg373Trp	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_138567	0	0	0	0	0	A6NFJ4|Q9NSV9	Missense_Mutation	SNP	ENST00000381968.3	37	CCDS7726.2	855|855	0.3914835164835165|0.3914835164835165	84|84	0.17073170731707318|0.17073170731707318	163|163	0.45027624309392267|0.45027624309392267	226|226	0.3951048951048951|0.3951048951048951	382|382	0.503957783641161|0.503957783641161	t|t	1.107|1.107	-0.659353|-0.659353	0.03454|0.03454	0.208372|0.208372	0.480756|0.480756	ENSG00000149043|ENSG00000149043	ENST00000381978|ENST00000381968;ENST00000341958	.|T;T	.|0.03951	.|3.77;3.75	3.85|3.85	2.68|2.68	0.31781|0.31781	.|.	.|.	.|.	.|.	.|.	T|T	0.00012|0.00012	0.0000|0.0000	N|N	0.00005|0.00005	-3.275|-3.275	0.09310|0.09310	P|P	1.0|1.0	.|B;B	.|0.02656	.|0.0;0.0	.|B;B	.|0.01281	.|0.0;0.0	T|T	0.41928|0.41928	-0.9481|-0.9481	4|8	.|0.02654	.|T	.|1	.|.	8.5203|8.5203	0.33270|0.33270	0.0:0.1655:0.0:0.8345|0.0:0.1655:0.0:0.8345	rs2292474|rs2292474	.|373;359	.|Q8NBV8;A6NCR4	.|SYT8_HUMAN;.	V|W	371|373;359	.|ENSP00000371394:R373W;ENSP00000343691:R359W	.|ENSP00000343691:R359W	A|R	+|+	2|1	0|2	SYT8|SYT8	1815148|1815148	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.293000|0.293000	0.27360|0.27360	3.304000|3.304000	0.51866|0.51866	0.174000|0.174000	0.19809|0.19809	-0.665000|-0.665000	0.03846|0.03846	GCG|CGG	C|0.602;T|0.398		0.731	SYT8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000025013.4		
OR56A4	120793	bcgsc.ca	37	11	6023818	6023818	+	Silent	SNP	G	G	A	rs10839221	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr11:6023818G>A	ENST00000330728.4	-	1	606	c.561C>T	c.(559-561)taC>taT	p.Y187Y		NM_001005179.2	NP_001005179.2	Q8NGH8	O56A4_HUMAN	olfactory receptor, family 56, subfamily A, member 4	135						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|kidney(4)|large_intestine(5)|lung(17)|ovary(1)|skin(1)|urinary_tract(1)	32		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;7.01e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TGATAGACGGGTATCTCAATG	0.493													.|||	812	0.162141	0.0582	0.1945	5008	,	,		22200	0.0794		0.2684	False		,,,				2504	0.2556				p.Y187Y		.											.	OR56A4-69	0			c.C561T						.	G		477,3925	223.9+/-240.3	29,419,1753	65.0	58.0	60.0		561	-0.6	0.1	11	dbSNP_120	60	2565,6027	417.8+/-352.5	397,1771,2128	no	coding-synonymous	OR56A4	NM_001005179.2		426,2190,3881	AA,AG,GG		29.8534,10.836,23.4108		187/366	6023818	3042,9952	2201	4296	6497	SO:0001819	synonymous_variant	120793	exon1			AGACGGGTATCTC	BK004255	CCDS31404.1	11p15.4	2012-08-09			ENSG00000183389	ENSG00000183389		"""GPCR / Class A : Olfactory receptors"""	14791	protein-coding gene	gene with protein product							Standard	NM_001005179		Approved		uc010qzv.2	Q8NGH8	OTTHUMG00000165376	ENST00000330728.4:c.561C>T	11.37:g.6023818G>A		Somatic	202	2		WXS	Illumina GAIIx	Phase_I	171	8	NM_001005179	0	0	0	0	0	B9EH17	Silent	SNP	ENST00000330728.4	37	CCDS31404.1																																																																																			G|0.801;A|0.199		0.493	OR56A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383756.2	NM_001005179	
OR56A4	120793	ucsc.edu;bcgsc.ca	37	11	6023924	6023924	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr11:6023924C>T	ENST00000330728.4	-	1	500	c.455G>A	c.(454-456)tGc>tAc	p.C152Y		NM_001005179.2	NP_001005179.2	Q8NGH8	O56A4_HUMAN	olfactory receptor, family 56, subfamily A, member 4	100						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|kidney(4)|large_intestine(5)|lung(17)|ovary(1)|skin(1)|urinary_tract(1)	32		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;7.01e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CTGGAGGAAGCAGGCTGGGAA	0.542																																					p.C152Y		.											.	OR56A4-69	0			c.G455A						.						90.0	82.0	85.0					11																	6023924		2201	4296	6497	SO:0001583	missense	120793	exon1			AGGAAGCAGGCTG	BK004255	CCDS31404.1	11p15.4	2012-08-09			ENSG00000183389	ENSG00000183389		"""GPCR / Class A : Olfactory receptors"""	14791	protein-coding gene	gene with protein product							Standard	NM_001005179		Approved		uc010qzv.2	Q8NGH8	OTTHUMG00000165376	ENST00000330728.4:c.455G>A	11.37:g.6023924C>T	ENSP00000328215:p.Cys152Tyr	Somatic	183	2		WXS	Illumina GAIIx	Phase_I	188	163	NM_001005179	0	0	0	0	0	B9EH17	Missense_Mutation	SNP	ENST00000330728.4	37	CCDS31404.1	.	.	.	.	.	.	.	.	.	.	C	14.62	2.588530	0.46110	.	.	ENSG00000183389	ENST00000330728	T	0.00547	6.66	3.34	2.41	0.29592	GPCR, rhodopsin-like superfamily (1);	0.000000	0.36665	U	0.002463	T	0.02342	0.0072	H	0.99498	4.595	0.40952	D	0.984555	P	0.41524	0.753	P	0.44647	0.456	T	0.01363	-1.1374	10	0.87932	D	0	.	9.3546	0.38159	0.0:0.8892:0.0:0.1108	.	100	Q8NGH8	O56A4_HUMAN	Y	152	ENSP00000328215:C152Y	ENSP00000328215:C152Y	C	-	2	0	OR56A4	5980500	1.000000	0.71417	0.989000	0.46669	0.792000	0.44763	4.495000	0.60353	0.724000	0.32296	0.555000	0.69702	TGC	.		0.542	OR56A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383756.2	NM_001005179	
USH1C	10083	bcgsc.ca	37	11	17542439	17542439	+	Silent	SNP	T	T	C	rs2240487	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr11:17542439T>C	ENST00000318024.4	-	14	1296	c.1188A>G	c.(1186-1188)ccA>ccG	p.P396P	USH1C_ENST00000005226.7_Silent_p.P396P|USH1C_ENST00000527020.1_Silent_p.P377P|USH1C_ENST00000527720.1_Silent_p.P365P	NM_005709.3	NP_005700.2	Q9Y6N9	USH1C_HUMAN	Usher syndrome 1C (autosomal recessive, severe)	396					auditory receptor cell differentiation (GO:0042491)|equilibrioception (GO:0050957)|G2/M transition of mitotic cell cycle (GO:0000086)|inner ear morphogenesis (GO:0042472)|parallel actin filament bundle assembly (GO:0030046)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	spectrin binding (GO:0030507)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(9)|lung(25)|ovary(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	48						GAAGGGGTACTGGGTGTACCT	0.517													T|||	2586	0.516374	0.3018	0.6527	5008	,	,		18761	0.6716		0.5338	False		,,,				2504	0.5317				p.P396P		.											.	USH1C-91	0			c.A1188G						.	T	,	1569,2831	490.8+/-361.9	270,1029,901	294.0	274.0	281.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	1188,1188	-10.6	0.0	11	dbSNP_98	281	4976,3610	625.8+/-397.8	1442,2092,759	no	coding-synonymous,coding-synonymous	USH1C	NM_005709.3,NM_153676.3	,	1712,3121,1660	CC,CT,TT		42.0452,35.6591,49.5996	,	396/553,396/900	17542439	6545,6441	2200	4293	6493	SO:0001819	synonymous_variant	10083	exon14			GGGTACTGGGTGT	AB006955	CCDS7825.1, CCDS31438.1, CCDS73265.1	11p14.3	2013-06-19	2004-05-19		ENSG00000006611	ENSG00000006611			12597	protein-coding gene	gene with protein product	"""harmonin"""	605242	"""deafness, autosomal recessive 18"""	DFNB18		10973247, 12107438	Standard	NM_005709		Approved	PDZ73, harmonin, NY-CO-37, NY-CO-38, PDZ-73, AIE-75, PDZD7C	uc001mne.3	Q9Y6N9	OTTHUMG00000166323	ENST00000318024.4:c.1188A>G	11.37:g.17542439T>C		Somatic	216	0		WXS	Illumina GAIIx	Phase_I	173	9	NM_005709	0	0	0	0	0	A8K423|Q7RTU8|Q96B29|Q9UM04|Q9UM17|Q9UPC3	Silent	SNP	ENST00000318024.4	37	CCDS31438.1																																																																																			C|0.518;T|0.482		0.517	USH1C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000389146.1	NM_005709	
EHBP1L1	254102	bcgsc.ca	37	11	65351074	65351074	+	Silent	SNP	G	G	A	rs10896018	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr11:65351074G>A	ENST00000309295.4	+	9	3196	c.2931G>A	c.(2929-2931)gcG>gcA	p.A977A		NM_001099409.1	NP_001092879.1	Q8N3D4	EH1L1_HUMAN	EH domain binding protein 1-like 1	977						membrane (GO:0016020)				central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	23						CCCAGGAAGCGGAGGCTGGGG	0.577													G|||	1391	0.277756	0.0658	0.4524	5008	,	,		15972	0.4504		0.2654	False		,,,				2504	0.2751				p.A977A		.											.	EHBP1L1-69	0			c.G2931A						.	G		362,3338		27,308,1515	15.0	16.0	16.0		2931	1.6	1.0	11	dbSNP_120	16	2334,5852		344,1646,2103	no	coding-synonymous	EHBP1L1	NM_001099409.1		371,1954,3618	AA,AG,GG		28.5121,9.7838,22.6821		977/1524	65351074	2696,9190	1850	4093	5943	SO:0001819	synonymous_variant	254102	exon9			GGAAGCGGAGGCT	AL834433	CCDS44649.1	11q13.1	2008-02-05			ENSG00000173442	ENSG00000173442			30682	protein-coding gene	gene with protein product							Standard	NM_001099409		Approved	DKFZp762C186, TANGERIN	uc001oeo.4	Q8N3D4	OTTHUMG00000166520	ENST00000309295.4:c.2931G>A	11.37:g.65351074G>A		Somatic	67	0		WXS	Illumina GAIIx	Phase_I	62	5	NM_001099409	0	0	1	1	0	Q8TB89|Q9H7M7	Silent	SNP	ENST00000309295.4	37	CCDS44649.1	645	0.29532967032967034	36	0.07317073170731707	152	0.4198895027624309	256	0.44755244755244755	201	0.26517150395778366	G	4.671	0.124677	0.08931	0.097838	0.285121	ENSG00000173442	ENST00000533465	.	.	.	5.41	1.59	0.23543	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.54753	P	1.6000000000016E-5	.	.	.	.	.	.	T	0.47861	-0.9084	3	.	.	.	.	6.7906	0.23697	0.4492:0.465:0.0858:0.0	rs10896018;rs10896018	.	.	.	R	27	.	.	G	+	1	0	EHBP1L1	65107650	0.002000	0.14202	0.994000	0.49952	0.571000	0.35966	0.223000	0.17719	0.017000	0.15025	-0.436000	0.05848	GGA	G|0.706;A|0.294		0.577	EHBP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390145.1	XM_170658	
PRKRIR	5612	hgsc.bcm.edu	37	11	76072085	76072085	+	Missense_Mutation	SNP	C	C	T	rs76214254	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr11:76072085C>T	ENST00000260045.3	-	3	338	c.233G>A	c.(232-234)cGa>cAa	p.R78Q	PRKRIR_ENST00000531878.1_5'UTR	NM_004705.2	NP_004696.2	O43422	P52K_HUMAN	protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor)	78					negative regulation of cell proliferation (GO:0008285)|response to stress (GO:0006950)|signal transduction (GO:0007165)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(3)|large_intestine(4)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	25						TGCATTATCTCGAAGAACTGT	0.308																																					p.R78Q		.											.	PRKRIR-93	0			c.G233A						.						114.0	110.0	112.0					11																	76072085		2200	4292	6492	SO:0001583	missense	5612	exon3			TTATCTCGAAGAA	AF007393	CCDS8243.1	11q13.5	2013-01-25			ENSG00000137492	ENSG00000137492		"""THAP (C2CH-type zinc finger) domain containing"""	9440	protein-coding gene	gene with protein product	"""THAP domain containing 12"""	607374				9447982	Standard	NM_004705		Approved	P52rIPK, DAP4, THAP12	uc001oxh.1	O43422	OTTHUMG00000165280	ENST00000260045.3:c.233G>A	11.37:g.76072085C>T	ENSP00000260045:p.Arg78Gln	Somatic	33	0		WXS	Illumina GAIIx	Phase_I	49	4	NM_004705	0	0	6	6	0	A8K728|Q17RY9|Q8WTW1|Q9Y3Z4	Missense_Mutation	SNP	ENST00000260045.3	37	CCDS8243.1	.	.	.	.	.	.	.	.	.	.	C	18.12	3.552130	0.65311	.	.	ENSG00000137492	ENST00000260045	D	0.96459	-4.02	5.44	5.44	0.79542	Zinc finger, C2CH-type (4);	0.052263	0.85682	D	0.000000	D	0.93035	0.7783	L	0.31526	0.94	0.44899	D	0.997917	B	0.28470	0.213	B	0.20184	0.028	D	0.90113	0.4193	10	0.36615	T	0.2	.	19.6212	0.95656	0.0:1.0:0.0:0.0	.	78	O43422	P52K_HUMAN	Q	78	ENSP00000260045:R78Q	ENSP00000260045:R78Q	R	-	2	0	PRKRIR	75749733	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.216000	0.58540	2.723000	0.93209	0.655000	0.94253	CGA	C|0.999;T|0.001		0.308	PRKRIR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383188.1	NM_004705	
C11orf63	79864	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	122817236	122817236	+	Silent	SNP	G	G	T			TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr11:122817236G>T	ENST00000531316.1	+	5	1757	c.1665G>T	c.(1663-1665)acG>acT	p.T555T	C11orf63_ENST00000227349.2_Silent_p.T555T			Q6NUN7	CK063_HUMAN	chromosome 11 open reading frame 63	555					axoneme assembly (GO:0035082)|brain development (GO:0007420)|cerebrospinal fluid secretion (GO:0033326)|ciliary basal body organization (GO:0032053)					breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(13)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	47		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.018)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.34e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0311)		ACAGCCAGACGGTTAGAGCTT	0.423																																					p.T555T		.											.	C11orf63-93	0			c.G1665T						.						63.0	63.0	63.0					11																	122817236		2202	4298	6500	SO:0001819	synonymous_variant	79864	exon6			CCAGACGGTTAGA	BC068507	CCDS8438.1, CCDS8439.1	11q24.1	2012-05-25			ENSG00000109944	ENSG00000109944			26288	protein-coding gene	gene with protein product						12477932	Standard	NM_024806		Approved	FLJ23554	uc001pym.4	Q6NUN7	OTTHUMG00000166027	ENST00000531316.1:c.1665G>T	11.37:g.122817236G>T		Somatic	113	0		WXS	Illumina GAIIx	Phase_I	99	90	NM_024806	0	0	0	0	0	A8K6G0|Q96GB5|Q9H5D6	Silent	SNP	ENST00000531316.1	37	CCDS8438.1																																																																																			.		0.423	C11orf63-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387511.1	NM_024806	
FOXM1	2305	bcgsc.ca	37	12	2968169	2968169	+	Missense_Mutation	SNP	A	A	G	rs3742076	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr12:2968169A>G	ENST00000359843.3	-	9	1995	c.1927T>C	c.(1927-1929)Tcc>Ccc	p.S643P	FOXM1_ENST00000342628.2_Missense_Mutation_p.S681P|Y_RNA_ENST00000410561.1_RNA|AC005841.1_ENST00000382678.3_5'Flank|ITFG2_ENST00000545509.1_Intron|FOXM1_ENST00000361953.3_Missense_Mutation_p.S628P	NM_021953.3	NP_068772.2	Q08050	FOXM1_HUMAN	forkhead box M1	643			S -> P (in dbSNP:rs3742076). {ECO:0000269|PubMed:15489334, ECO:0000269|Ref.3}.		cell cycle (GO:0007049)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|liver development (GO:0001889)|mitotic cell cycle (GO:0000278)|negative regulation of cell aging (GO:0090344)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|positive regulation of double-strand break repair (GO:2000781)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle (GO:0051726)|regulation of cell cycle arrest (GO:0071156)|regulation of cell growth (GO:0001558)|regulation of cell proliferation (GO:0042127)|regulation of Ras protein signal transduction (GO:0046578)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protein kinase binding (GO:0019901)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(7)|lung(9)|prostate(1)|skin(1)|urinary_tract(3)	24			OV - Ovarian serous cystadenocarcinoma(31;0.000622)			GCACCCTGGGAGGTTTGTACT	0.612													G|||	1541	0.307708	0.5817	0.2723	5008	,	,		16895	0.2341		0.164	False		,,,				2504	0.1861				p.S681P		.											.	FOXM1-227	0			c.T2041C						.	G	PRO/SER,PRO/SER,PRO/SER	2044,2360		575,894,733	50.0	60.0	57.0		1927,2041,1882	3.4	0.0	12	dbSNP_107	57	1186,7414		106,974,3220	yes	missense,missense,missense	FOXM1	NM_021953.3,NM_202002.2,NM_202003.2	74,74,74	681,1868,3953	GG,GA,AA		13.7907,46.4124,24.8385	benign,benign,benign	643/764,681/802,628/749	2968169	3230,9774	2202	4300	6502	SO:0001583	missense	2305	exon10			CCTGGGAGGTTTG	Y12773	CCDS8515.1, CCDS8516.1, CCDS8517.1	12p13	2007-09-18			ENSG00000111206	ENSG00000111206		"""Forkhead boxes"""	3818	protein-coding gene	gene with protein product	"""M-phase phosphoprotein 2"""	602341		FKHL16		9032290, 9441747	Standard	NM_202002		Approved	HFH-11, trident, HNF-3, INS-1, MPP2, MPHOSPH2, TGT3	uc001qlf.3	Q08050	OTTHUMG00000168118	ENST00000359843.3:c.1927T>C	12.37:g.2968169A>G	ENSP00000352901:p.Ser643Pro	Somatic	11	0		WXS	Illumina GAIIx	Phase_I	13	12	NM_202002	0	0	0	22	22	O43258|O43259|O43260|Q4ZGG7|Q9BRL2	Missense_Mutation	SNP	ENST00000359843.3	37	CCDS8515.1	630	0.28846153846153844	274	0.556910569105691	97	0.26795580110497236	148	0.25874125874125875	111	0.14643799472295516	G	0.017	-1.501525	0.01001	0.464124	0.137907	ENSG00000111206	ENST00000342628;ENST00000361953;ENST00000359843	D;D;D	0.91068	-2.71;-2.78;-2.7	4.29	3.4	0.38934	.	0.061535	0.64402	N	0.000004	T	0.00012	0.0000	N	0.00092	-2.175	0.44323	P	0.002797999999999967	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.01281	0.0;0.0;0.0;0.0;0.0	T	0.42275	-0.9461	9	0.06236	T	0.91	.	9.7095	0.40236	0.1686:0.0:0.8314:0.0	rs3742076;rs17856176;rs17856193;rs59442255;rs3742076	627;643;628;643;681	A8K591;Q53Y49;Q08050-2;Q08050;Q08050-3	.;.;.;FOXM1_HUMAN;.	P	681;628;643	ENSP00000342307:S681P;ENSP00000354492:S628P;ENSP00000352901:S643P	ENSP00000342307:S681P	S	-	1	0	FOXM1	2838430	1.000000	0.71417	0.020000	0.16555	0.116000	0.19942	3.722000	0.54948	0.579000	0.29504	-0.215000	0.12644	TCC	A|0.714;G|0.286		0.612	FOXM1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000398272.1	NM_021953	
TAS2R43	259289	bcgsc.ca	37	12	11244126	11244126	+	Missense_Mutation	SNP	G	G	A	rs3759244		TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr12:11244126G>A	ENST00000531678.1	-	1	786	c.703C>T	c.(703-705)Ctc>Ttc	p.L235F	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_176884.2	NP_795365.2	P59537	T2R43_HUMAN	taste receptor, type 2, member 43	235					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			endometrium(1)|ovary(1)|prostate(2)|urinary_tract(1)	5			OV - Ovarian serous cystadenocarcinoma(49;0.0344)	BRCA - Breast invasive adenocarcinoma(232;0.196)		CATAACAAGAGGAAGGAGATC	0.398																																					p.L235F		.											.	TAS2R43-1	0			c.C703T						.						147.0	129.0	135.0					12																	11244126		2181	4253	6434	SO:0001583	missense	259289	exon1			ACAAGAGGAAGGA	AF494237	CCDS53749.1	12p13.2	2012-08-22				ENSG00000255374		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18875	protein-coding gene	gene with protein product		612668				12379855	Standard	NM_176884		Approved	T2R52	uc001qzq.1	P59537		ENST00000531678.1:c.703C>T	12.37:g.11244126G>A	ENSP00000431719:p.Leu235Phe	Somatic	124	5		WXS	Illumina GAIIx	Phase_I	36	18	NM_176884	0	0	0	0	0	P59546|Q645X4	Missense_Mutation	SNP	ENST00000531678.1	37	CCDS53749.1	652	0.29853479853479853	144	0.2926829268292683	133	0.3674033149171271	56	0.0979020979020979	319	0.420844327176781	-	10.07	1.249886	0.22880	.	.	ENSG00000255374	ENST00000531678	T	0.01145	5.27	1.99	-0.439	0.12264	.	.	.	.	.	T	0.00012	0.0000	M	0.83384	2.64	0.80722	P	0.0	P	0.42357	0.777	P	0.51079	0.658	T	0.44390	-0.9331	8	0.59425	D	0.04	.	2.6848	0.05104	0.2155:0.3133:0.4712:0.0	.	235	P59537	T2R43_HUMAN	F	235	ENSP00000431719:L235F	ENSP00000431719:L235F	L	-	1	0	TAS2R43	11135393	0.027000	0.19231	0.019000	0.16419	0.010000	0.07245	0.898000	0.28404	0.156000	0.19299	0.174000	0.16983	CTC	G|0.663;A|0.337		0.398	TAS2R43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383561.1	NM_176884	
TAS2R43	259289	bcgsc.ca	37	12	11244149	11244149	+	Missense_Mutation	SNP	G	G	A	rs73064964	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr12:11244149G>A	ENST00000531678.1	-	1	763	c.680C>T	c.(679-681)gCt>gTt	p.A227V	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_176884.2	NP_795365.2	P59537	T2R43_HUMAN	taste receptor, type 2, member 43	227					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			endometrium(1)|ovary(1)|prostate(2)|urinary_tract(1)	5			OV - Ovarian serous cystadenocarcinoma(49;0.0344)	BRCA - Breast invasive adenocarcinoma(232;0.196)		AGTTTGCAAAGCTTTTATGTG	0.393													.|||	38	0.00758786	0.0008	0.0014	5008	,	,		13007	0.0		0.001	False		,,,				2504	0.0358				p.A227V		.											.	TAS2R43-1	0			c.C680T						.						137.0	119.0	125.0					12																	11244149		2179	4249	6428	SO:0001583	missense	259289	exon1			TGCAAAGCTTTTA	AF494237	CCDS53749.1	12p13.2	2012-08-22				ENSG00000255374		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18875	protein-coding gene	gene with protein product		612668				12379855	Standard	NM_176884		Approved	T2R52	uc001qzq.1	P59537		ENST00000531678.1:c.680C>T	12.37:g.11244149G>A	ENSP00000431719:p.Ala227Val	Somatic	116	5		WXS	Illumina GAIIx	Phase_I	33	19	NM_176884	0	0	0	0	0	P59546|Q645X4	Missense_Mutation	SNP	ENST00000531678.1	37	CCDS53749.1	.	.	.	.	.	.	.	.	.	.	-	9.695	1.152962	0.21371	.	.	ENSG00000255374	ENST00000531678	T	0.01422	4.91	2.01	2.01	0.26516	.	.	.	.	.	T	0.04048	0.0113	M	0.76727	2.345	0.80722	P	0.0	B	0.29301	0.241	B	0.43867	0.434	T	0.01127	-1.1443	8	0.48119	T	0.1	.	7.4028	0.26973	0.0:0.0:1.0:0.0	.	227	P59537	T2R43_HUMAN	V	227	ENSP00000431719:A227V	ENSP00000431719:A227V	A	-	2	0	TAS2R43	11135416	0.007000	0.16637	0.482000	0.27366	0.029000	0.11900	1.072000	0.30678	1.097000	0.41459	0.195000	0.17529	GCT	.		0.393	TAS2R43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383561.1	NM_176884	
TAS2R43	259289	bcgsc.ca	37	12	11244169	11244169	+	Silent	SNP	G	G	A	rs201144595		TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr12:11244169G>A	ENST00000531678.1	-	1	743	c.660C>T	c.(658-660)agC>agT	p.S220S	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_176884.2	NP_795365.2	P59537	T2R43_HUMAN	taste receptor, type 2, member 43	220					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			endometrium(1)|ovary(1)|prostate(2)|urinary_tract(1)	5			OV - Ovarian serous cystadenocarcinoma(49;0.0344)	BRCA - Breast invasive adenocarcinoma(232;0.196)		GGACCTTGGTGCTGGGATCTT	0.398																																					p.S220S		.											.	TAS2R43-1	0			c.C660T						.						130.0	112.0	118.0					12																	11244169		2174	4246	6420	SO:0001819	synonymous_variant	259289	exon1			CTTGGTGCTGGGA	AF494237	CCDS53749.1	12p13.2	2012-08-22				ENSG00000255374		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18875	protein-coding gene	gene with protein product		612668				12379855	Standard	NM_176884		Approved	T2R52	uc001qzq.1	P59537		ENST00000531678.1:c.660C>T	12.37:g.11244169G>A		Somatic	111	4		WXS	Illumina GAIIx	Phase_I	36	19	NM_176884	0	0	0	0	0	P59546|Q645X4	Silent	SNP	ENST00000531678.1	37	CCDS53749.1																																																																																			.		0.398	TAS2R43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383561.1	NM_176884	
TAS2R43	259289	bcgsc.ca	37	12	11244190	11244190	+	Silent	SNP	A	A	G	rs202034865	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr12:11244190A>G	ENST00000531678.1	-	1	722	c.639T>C	c.(637-639)ggT>ggC	p.G213G	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_176884.2	NP_795365.2	P59537	T2R43_HUMAN	taste receptor, type 2, member 43	213					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			endometrium(1)|ovary(1)|prostate(2)|urinary_tract(1)	5			OV - Ovarian serous cystadenocarcinoma(49;0.0344)	BRCA - Breast invasive adenocarcinoma(232;0.196)		GAGATCCTTTACCATGGAGCT	0.408																																					p.G213G		.											.	TAS2R43-1	0			c.T639C						.						123.0	101.0	108.0					12																	11244190		2160	4172	6332	SO:0001819	synonymous_variant	259289	exon1			TCCTTTACCATGG	AF494237	CCDS53749.1	12p13.2	2012-08-22				ENSG00000255374		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18875	protein-coding gene	gene with protein product		612668				12379855	Standard	NM_176884		Approved	T2R52	uc001qzq.1	P59537		ENST00000531678.1:c.639T>C	12.37:g.11244190A>G		Somatic	104	5		WXS	Illumina GAIIx	Phase_I	35	19	NM_176884	0	0	0	0	0	P59546|Q645X4	Silent	SNP	ENST00000531678.1	37	CCDS53749.1																																																																																			A|0.321;G|0.679		0.408	TAS2R43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383561.1	NM_176884	
TAS2R43	259289	bcgsc.ca	37	12	11244687	11244687	+	Missense_Mutation	SNP	G	G	C	rs200922417|rs113197337	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr12:11244687G>C	ENST00000531678.1	-	1	225	c.142C>G	c.(142-144)Ctc>Gtc	p.L48V	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_176884.2	NP_795365.2	P59537	T2R43_HUMAN	taste receptor, type 2, member 43	48					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			endometrium(1)|ovary(1)|prostate(2)|urinary_tract(1)	5			OV - Ovarian serous cystadenocarcinoma(49;0.0344)	BRCA - Breast invasive adenocarcinoma(232;0.196)		AGAGCAGTGAGAATTTGGTCA	0.383																																					p.L48V		.											.	TAS2R43-1	0			c.C142G						.						53.0	48.0	49.0					12																	11244687		2019	4101	6120	SO:0001583	missense	259289	exon1			CAGTGAGAATTTG	AF494237	CCDS53749.1	12p13.2	2012-08-22				ENSG00000255374		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18875	protein-coding gene	gene with protein product		612668				12379855	Standard	NM_176884		Approved	T2R52	uc001qzq.1	P59537		ENST00000531678.1:c.142C>G	12.37:g.11244687G>C	ENSP00000431719:p.Leu48Val	Somatic	73	7		WXS	Illumina GAIIx	Phase_I	26	21	NM_176884	0	0	0	0	0	P59546|Q645X4	Missense_Mutation	SNP	ENST00000531678.1	37	CCDS53749.1	.	.	.	.	.	.	.	.	.	.	-	6.625	0.483814	0.12581	.	.	ENSG00000255374	ENST00000531678	T	0.01484	4.84	1.97	0.973	0.19710	.	.	.	.	.	T	0.06142	0.0159	M	0.90145	3.09	0.80722	P	0.0	B	0.34264	0.446	B	0.43867	0.434	T	0.01048	-1.1469	8	0.56958	D	0.05	.	6.121	0.20154	0.0:0.3247:0.6753:0.0	.	48	P59537	T2R43_HUMAN	V	48	ENSP00000431719:L48V	ENSP00000431719:L48V	L	-	1	0	TAS2R43	11135954	0.601000	0.26907	0.010000	0.14722	0.027000	0.11550	1.075000	0.30716	0.130000	0.18549	0.184000	0.17185	CTC	.		0.383	TAS2R43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383561.1	NM_176884	
PRB4	5545	ucsc.edu	37	12	11461596	11461596	+	Silent	SNP	T	T	G	rs59021567		TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr12:11461596T>G	ENST00000535904.1	-	3	354	c.321A>C	c.(319-321)ggA>ggC	p.G107G	PRB4_ENST00000445719.2_Silent_p.G107G|PRB4_ENST00000279575.1_Silent_p.G107G			P10163	PRB4_HUMAN	proline-rich protein BstNI subfamily 4	128	9.5 X 21 AA tandem repeats of K-P-[EQ]- [GR]-[PR]-[PR]-P-Q-G-G-N-Q-[PS]-[QH]- [RG]-[PT]-P-P-[PH]-P-G.					extracellular region (GO:0005576)				breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|skin(4)|upper_aerodigestive_tract(3)	30						GGGACTGGTTTCCTCCTTGTG	0.612										HNSCC(22;0.051)																											p.G107G		.											.	PRB4-91	0			c.A321C						.						186.0	196.0	192.0					12																	11461596		2203	4298	6501	SO:0001819	synonymous_variant	5545	exon3			CTGGTTTCCTCCT		CCDS8641.1, CCDS58208.1	12p13.2	2012-10-02			ENSG00000230657	ENSG00000230657			9340	protein-coding gene	gene with protein product		180990					Standard	NM_002723		Approved		uc001qzt.4	P10163	OTTHUMG00000169116	ENST00000535904.1:c.321A>C	12.37:g.11461596T>G		Somatic	24	3		WXS	Illumina GAIIx	Phase_I	34	13	NM_001261399	0	0	0	0	0	A1L439|O00600|P02813|P10161|P10162|P81489	Silent	SNP	ENST00000535904.1	37	CCDS8641.1																																																																																			T|0.250;G|0.750		0.612	PRB4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402308.1	NM_002723	
SLCO1B1	10599	bcgsc.ca	37	12	21331549	21331549	+	Missense_Mutation	SNP	T	T	C	rs4149056	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr12:21331549T>C	ENST00000256958.2	+	6	617	c.521T>C	c.(520-522)gTg>gCg	p.V174A		NM_006446.4	NP_006437.3	Q9Y6L6	SO1B1_HUMAN	solute carrier organic anion transporter family, member 1B1	174			V -> A (decreased transport activity; dbSNP:rs4149056). {ECO:0000269|PubMed:11477075, ECO:0000269|PubMed:12130747}.		bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium-independent organic anion transmembrane transporter activity (GO:0015347)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)	70					Acetylcysteine(DB06151)|Aminohippurate(DB00345)|Atorvastatin(DB01076)|Axitinib(DB06626)|Benzylpenicillin(DB01053)|Bezafibrate(DB01393)|Cabazitaxel(DB06772)|Caspofungin(DB00520)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dabrafenib(DB08912)|Dextrothyroxine(DB00509)|Digoxin(DB00390)|Dinoprostone(DB00917)|Eltrombopag(DB06210)|Estradiol(DB00783)|Estrone(DB00655)|Ezetimibe(DB00973)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Gadoxetate(DB08884)|Gemfibrozil(DB01241)|Indinavir(DB00224)|Irinotecan(DB00762)|L-Carnitine(DB00583)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Lovastatin(DB00227)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Nelfinavir(DB00220)|Olmesartan(DB00275)|Ouabain(DB01092)|Pantoprazole(DB00213)|Pazopanib(DB06589)|Penicillamine(DB00859)|Pioglitazone(DB01132)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Quinidine(DB00908)|Repaglinide(DB00912)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Ritonavir(DB00503)|Rosiglitazone(DB00412)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|SIMEPREVIR(DB06290)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sumatriptan(DB00669)|Valsartan(DB00177)|Verapamil(DB00661)	TGGATATATGTGTTCATGGGT	0.343													T|||	439	0.0876597	0.0136	0.134	5008	,	,		15111	0.123		0.161	False		,,,				2504	0.0429				p.V174A		.											.	SLCO1B1-97	0			c.T521C	GRCh37	CM043777	SLCO1B1	M	rs4149056	.	T	ALA/VAL	159,4247	108.6+/-147.0	3,153,2047	144.0	135.0	138.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	521	3.6	0.1	12	dbSNP_110	138	1336,7264	261.4+/-283.8	119,1098,3083	yes	missense	SLCO1B1	NM_006446.4	64	122,1251,5130	CC,CT,TT	http://www.ncbi.nlm.nih.gov/pubmed?term	15.5349,3.6087,11.4947	probably-damaging	174/692	21331549	1495,11511	2203	4300	6503	SO:0001583	missense	10599	exon6			TATATGTGTTCAT		CCDS8685.1	12p12	2013-05-22	2003-11-25	2003-11-26	ENSG00000134538	ENSG00000134538		"""Solute carriers"""	10959	protein-coding gene	gene with protein product		604843	"""solute carrier family 21 (organic anion transporter), member 6"""	SLC21A6		10358072	Standard	NM_006446		Approved	OATP-C, LST-1, OATP1B1	uc001req.4	Q9Y6L6	OTTHUMG00000169047	ENST00000256958.2:c.521T>C	12.37:g.21331549T>C	ENSP00000256958:p.Val174Ala	Somatic	218	2		WXS	Illumina GAIIx	Phase_I	197	6	NM_006446	0	0	0	0	0	B2R7G2|Q29R64|Q9NQ37|Q9UBF3|Q9UH89	Missense_Mutation	SNP	ENST00000256958.2	37	CCDS8685.1	268	0.1227106227106227	13	0.026422764227642278	50	0.13812154696132597	73	0.12762237762237763	132	0.1741424802110818	T	12.39	1.923669	0.34002	0.036087	0.155349	ENSG00000134538	ENST00000256958	T	0.43294	0.95	3.62	3.62	0.41486	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.163062	0.39687	N	0.001300	T	0.00440	0.0014	M	0.92833	3.35	0.54753	P	1.4999999999987246E-5	D	0.89917	1.0	D	0.83275	0.996	T	0.43196	-0.9406	9	0.87932	D	0	.	12.6758	0.56893	0.0:0.0:0.0:1.0	rs4149056;rs52816141;rs60037639;rs4149056	174	Q9Y6L6	SO1B1_HUMAN	A	174	ENSP00000256958:V174A	ENSP00000256958:V174A	V	+	2	0	SLCO1B1	21222816	1.000000	0.71417	0.058000	0.19502	0.015000	0.08874	7.326000	0.79133	1.641000	0.50575	0.260000	0.18958	GTG	T|0.890;C|0.110		0.343	SLCO1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402070.1	NM_006446	
SENP1	29843	bcgsc.ca	37	12	48477416	48477416	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr12:48477416G>T	ENST00000004980.5	-	6	988	c.510C>A	c.(508-510)agC>agA	p.S170R	SENP1_ENST00000448372.1_Missense_Mutation_p.S170R|SENP1_ENST00000547886.1_5'UTR|SENP1_ENST00000339976.6_3'UTR|SENP1_ENST00000549595.1_Missense_Mutation_p.S170R|SENP1_ENST00000551330.1_Missense_Mutation_p.S170R|SENP1_ENST00000549518.1_Missense_Mutation_p.S170R|RNU6-1203P_ENST00000410703.1_RNA			Q9P0U3	SENP1_HUMAN	SUMO1/sentrin specific peptidase 1	170	Ser-rich.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic signaling pathway (GO:0097190)|cellular protein metabolic process (GO:0044267)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-translational protein modification (GO:0043687)|protein desumoylation (GO:0016926)|protein sumoylation (GO:0016925)|proteolysis (GO:0006508)|regulation of definitive erythrocyte differentiation (GO:0010724)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	endopeptidase activity (GO:0004175)|SUMO-specific protease activity (GO:0016929)			large_intestine(3)|lung(1)|pancreas(2)|stomach(1)	7		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)				TTTTCTTGGGGCTCAAAAGAC	0.418																																					p.S170R		.											.	SENP1-660	0			c.C510A						.						115.0	107.0	110.0					12																	48477416		1857	4095	5952	SO:0001583	missense	29843	exon6			CTTGGGGCTCAAA	AF149770	CCDS44868.1, CCDS44868.2	12q13.1	2008-02-05	2005-08-17			ENSG00000079387			17927	protein-coding gene	gene with protein product		612157	"""SUMO1/sentrin specific protease 1"""			10652325, 14563852	Standard	NM_001267595		Approved		uc009zkx.4	Q9P0U3	OTTHUMG00000169896	ENST00000004980.5:c.510C>A	12.37:g.48477416G>T	ENSP00000004980:p.Ser170Arg	Somatic	84	0		WXS	Illumina GAIIx	Phase_I	90	6	NM_001267594	0	0	5	5	0	A8K7P5|Q86XC8	Missense_Mutation	SNP	ENST00000004980.5	37	CCDS44868.2	.	.	.	.	.	.	.	.	.	.	G	18.50	3.637364	0.67130	.	.	ENSG00000079387	ENST00000004980;ENST00000448372;ENST00000551330;ENST00000549595;ENST00000549518	T;T;T;T;T	0.18174	2.23;2.23;2.23;2.23;2.23	4.2	1.39	0.22231	.	0.158254	0.53938	D	0.000056	T	0.24122	0.0584	L	0.27053	0.805	0.80722	D	1	D;D	0.69078	0.995;0.997	D;D	0.78314	0.979;0.991	T	0.01096	-1.1453	10	0.59425	D	0.04	-9.2661	9.4361	0.38639	0.2416:0.0:0.7584:0.0	.	170;170	Q9P0U3;Q9P0U3-2	SENP1_HUMAN;.	R	170	ENSP00000004980:S170R;ENSP00000394791:S170R;ENSP00000446681:S170R;ENSP00000450076:S170R;ENSP00000447328:S170R	ENSP00000004980:S170R	S	-	3	2	SENP1	46763683	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	0.387000	0.20718	0.318000	0.23185	0.655000	0.94253	AGC	.		0.418	SENP1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000406471.1	NM_014554	
KMT2D	8085	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	49445552	49445552	+	Silent	SNP	T	T	G			TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr12:49445552T>G	ENST00000301067.7	-	10	1913	c.1914A>C	c.(1912-1914)ccA>ccC	p.P638P		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	638	15 X 5 AA repeats of S/P-P-P-E/P-E/A.|Pro-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										ATTCTTCAGGTGGTGGGGACA	0.622																																					p.P638P		.											.	MLL2-612	0			c.A1914C						.						52.0	56.0	55.0					12																	49445552		2095	4214	6309	SO:0001819	synonymous_variant	8085	exon10			TTCAGGTGGTGGG	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.1914A>C	12.37:g.49445552T>G		Somatic	39	1		WXS	Illumina GAIIx	Phase_I	22	16	NM_003482	0	0	0	3	3	O14687	Silent	SNP	ENST00000301067.7	37	CCDS44873.1																																																																																			.		0.622	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
SLC35E3	55508	hgsc.bcm.edu;bcgsc.ca	37	12	69153001	69153001	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr12:69153001G>T	ENST00000398004.2	+	4	1009	c.737G>T	c.(736-738)gGg>gTg	p.G246V	SLC35E3_ENST00000538043.1_Intron	NM_018656.2	NP_061126.2	Q7Z769	S35E3_HUMAN	solute carrier family 35, member E3	246						integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	12	Breast(13;2.31e-06)|Renal(347;0.0684)		Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.00372)			TGGATCATTGGGAACACTTCA	0.323																																					p.G246V		.											.	SLC35E3-514	0			c.G737T						.						261.0	243.0	249.0					12																	69153001		1864	4108	5972	SO:0001583	missense	55508	exon4			TCATTGGGAACAC	AF148713, AY358943	CCDS41808.1	12q15	2014-09-04			ENSG00000175782	ENSG00000175782		"""Solute carriers"""	20864	protein-coding gene	gene with protein product						12975309	Standard	XM_005269006		Approved	BLOV1	uc001suh.3	Q7Z769	OTTHUMG00000169282	ENST00000398004.2:c.737G>T	12.37:g.69153001G>T	ENSP00000381089:p.Gly246Val	Somatic	57	0		WXS	Illumina GAIIx	Phase_I	54	4	NM_018656	0	0	8	8	0	A8K0T0|Q0P5Y5|Q9P0V1	Missense_Mutation	SNP	ENST00000398004.2	37	CCDS41808.1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.636799	0.87760	.	.	ENSG00000175782	ENST00000398004	T	0.69435	-0.4	5.55	5.55	0.83447	Domain of unknown function DUF250 (1);	0.000000	0.85682	D	0.000000	D	0.85809	0.5783	M	0.90309	3.105	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	D	0.87318	0.2316	9	.	.	.	-4.4177	19.9048	0.97002	0.0:0.0:1.0:0.0	.	246	Q7Z769	S35E3_HUMAN	V	246	ENSP00000381089:G246V	.	G	+	2	0	SLC35E3	67439268	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	8.847000	0.92166	2.788000	0.95919	0.555000	0.69702	GGG	.		0.323	SLC35E3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403241.1	NM_018656	
DTX1	1840	bcgsc.ca	37	12	113533150	113533150	+	Silent	SNP	C	C	T	rs61758446	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr12:113533150C>T	ENST00000257600.3	+	8	2072	c.1569C>T	c.(1567-1569)ccC>ccT	p.P523P	DTX1_ENST00000547974.1_3'UTR	NM_004416.2	NP_004407.2	Q86Y01	DTX1_HUMAN	deltex 1, E3 ubiquitin ligase	523					cell surface receptor signaling pathway (GO:0007166)|glial cell differentiation (GO:0010001)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of T cell differentiation (GO:0045581)|Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)|regulation of Notch signaling pathway (GO:0008593)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|Notch binding (GO:0005112)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	32						ACCCCAACCCCGGGAAGAAGT	0.597													C|||	132	0.0263578	0.0015	0.0144	5008	,	,		17896	0.0456		0.008	False		,,,				2504	0.0675				p.P523P		.											.	DTX1-659	0			c.C1569T						.	C		17,4389	23.3+/-48.9	0,17,2186	71.0	77.0	75.0		1569	-5.4	0.8	12	dbSNP_129	75	100,8500	53.6+/-114.3	1,98,4201	no	coding-synonymous	DTX1	NM_004416.2		1,115,6387	TT,TC,CC		1.1628,0.3858,0.8996		523/621	113533150	117,12889	2203	4300	6503	SO:0001819	synonymous_variant	1840	exon8			CAACCCCGGGAAG	AF053700	CCDS9164.1	12q24	2014-01-28	2014-01-28			ENSG00000135144			3060	protein-coding gene	gene with protein product		602582	"""deltex homolog 1 (Drosophila)"""			9590294, 12670957	Standard	NM_004416		Approved	hDx-1	uc001tuk.1	Q86Y01	OTTHUMG00000169610	ENST00000257600.3:c.1569C>T	12.37:g.113533150C>T		Somatic	71	1		WXS	Illumina GAIIx	Phase_I	73	4	NM_004416	0	0	0	0	0	O60630|Q9BS04	Silent	SNP	ENST00000257600.3	37	CCDS9164.1																																																																																			C|0.988;T|0.012		0.597	DTX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405045.2		
HCAR1	27198	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	123214708	123214708	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr12:123214708G>C	ENST00000436083.2	-	1	682	c.179C>G	c.(178-180)gCt>gGt	p.A60G	HCAR1_ENST00000432564.1_Missense_Mutation_p.A60G|HCAR1_ENST00000356987.2_Missense_Mutation_p.A60G			Q9BXC0	HCAR1_HUMAN	hydroxycarboxylic acid receptor 1	60					response to estradiol (GO:0032355)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|endometrium(1)|kidney(1)|lung(1)|ovary(1)|pancreas(1)|skin(1)	10						GAGGAAATCAGCCACGGCCAA	0.542																																					p.A60G		.											.	HCAR1-156	0			c.C179G						.						97.0	89.0	91.0					12																	123214708		2203	4300	6503	SO:0001583	missense	27198	exon1			AAATCAGCCACGG	AF411110	CCDS9236.1	12q24.31	2012-08-08	2011-05-30	2011-05-30	ENSG00000196917	ENSG00000196917		"""GPCR / Class A : Hydroxy-carboxylic acid receptors"""	4532	protein-coding gene	gene with protein product	"""lactate receptor 1"""	606923	"""G protein-coupled receptor 104"", ""G protein-coupled receptor 81"""	GPR104, GPR81		11574155, 19047060, 18952058, 21454438	Standard	NM_032554		Approved	HCA1, FKSG80, TA-GPCR, LACR1	uc001ucz.3	Q9BXC0		ENST00000436083.2:c.179C>G	12.37:g.123214708G>C	ENSP00000409980:p.Ala60Gly	Somatic	90	0		WXS	Illumina GAIIx	Phase_I	75	68	NM_032554	0	0	0	0	0	B2R9X4|Q3Y5J3|Q4VBN1|Q6NXU5	Missense_Mutation	SNP	ENST00000436083.2	37	CCDS9236.1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.701134	0.88924	.	.	ENSG00000196917	ENST00000356987;ENST00000432564;ENST00000436083	T;T;T	0.79352	-1.26;-1.26;-1.26	5.42	5.42	0.78866	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000001	D	0.90800	0.7111	M	0.92880	3.355	0.53688	D	0.999979	D	0.89917	1.0	D	0.91635	0.999	D	0.92702	0.6175	10	0.72032	D	0.01	-5.665	16.6994	0.85344	0.0:0.0:1.0:0.0	.	60	Q9BXC0	HCAR1_HUMAN	G	60	ENSP00000349478:A60G;ENSP00000389255:A60G;ENSP00000409980:A60G	ENSP00000349478:A60G	A	-	2	0	HCAR1	121780661	1.000000	0.71417	0.995000	0.50966	0.897000	0.52465	7.725000	0.84808	2.545000	0.85829	0.655000	0.94253	GCT	.		0.542	HCAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401415.1		
XPO4	64328	bcgsc.ca	37	13	21374333	21374333	+	Silent	SNP	A	A	G	rs9579954	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr13:21374333A>G	ENST00000255305.6	-	15	2180	c.2109T>C	c.(2107-2109)acT>acC	p.T703T	XPO4_ENST00000400602.2_Silent_p.T703T			Q9C0E2	XPO4_HUMAN	exportin 4	703					positive regulation of protein export from nucleus (GO:0046827)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(10)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	41		all_cancers(29;5.05e-24)|all_epithelial(30;5.56e-20)|all_lung(29;2.38e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000521)|Epithelial(112;0.000892)|OV - Ovarian serous cystadenocarcinoma(117;0.0148)|Lung(94;0.0189)|LUSC - Lung squamous cell carcinoma(192;0.0548)		GGAGCTGCACAGTGTCATTTG	0.458													A|||	309	0.0617013	0.0242	0.0403	5008	,	,		19337	0.0		0.1382	False		,,,				2504	0.1125				p.T703T		.											.	XPO4-272	0			c.T2109C						.	A		171,3835		4,163,1836	111.0	108.0	109.0		2109	-3.1	0.9	13	dbSNP_119	109	1129,7213		71,987,3113	no	coding-synonymous	XPO4	NM_022459.4		75,1150,4949	GG,GA,AA		13.5339,4.2686,10.528		703/1152	21374333	1300,11048	2003	4171	6174	SO:0001819	synonymous_variant	64328	exon15			CTGCACAGTGTCA	AB051508	CCDS41872.1	13q11	2011-04-13			ENSG00000132953	ENSG00000132953		"""Exportins"""	17796	protein-coding gene	gene with protein product		611449				11214970, 10944119	Standard	NM_022459		Approved	FLJ13046, KIAA1721	uc001unq.4	Q9C0E2	OTTHUMG00000016528	ENST00000255305.6:c.2109T>C	13.37:g.21374333A>G		Somatic	129	0		WXS	Illumina GAIIx	Phase_I	118	5	NM_022459	0	0	3	3	0	Q5VUZ5|Q8N3V6|Q9H934	Silent	SNP	ENST00000255305.6	37	CCDS41872.1																																																																																			A|0.912;G|0.088		0.458	XPO4-001	KNOWN	non_canonical_conserved|non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044096.1	NM_022459	
SLITRK5	26050	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	13	88330510	88330517	+	Frame_Shift_Del	DEL	GCCAGTTC	GCCAGTTC	-			TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	GCCAGTTC	GCCAGTTC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr13:88330510_88330517delGCCAGTTC	ENST00000325089.6	+	2	3086_3093	c.2867_2874delGCCAGTTC	c.(2866-2874)agccagttcfs	p.SQF956fs	SLITRK5_ENST00000400028.3_Frame_Shift_Del_p.SQF715fs	NM_015567.1	NP_056382.1	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5	956					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|cardiovascular system development (GO:0072358)|dendrite morphogenesis (GO:0048813)|grooming behavior (GO:0007625)|response to xenobiotic stimulus (GO:0009410)|skin development (GO:0043588)|striatum development (GO:0021756)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)				breast(1)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(14)|lung(40)|ovary(2)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(4)	81	all_neural(89;0.101)|Medulloblastoma(90;0.163)					ACCACGTTTAGCCAGTTCTAAAAGCAAA	0.399																																					p.956_958del		.											.	SLITRK5-94	0			c.2867_2874del						.																																			SO:0001589	frameshift_variant	26050	exon2			CGTTTAGCCAGTT	AB020725	CCDS9465.1	13q31.1	2004-04-16	2004-01-08		ENSG00000165300	ENSG00000165300			20295	protein-coding gene	gene with protein product		609680	"""leucine rich repeat containing 11"""	LRRC11		10048485, 14557068	Standard	NM_015567		Approved	bA364G4.2, KIAA0918	uc001vln.3	O94991	OTTHUMG00000017167	ENST00000325089.6:c.2867_2874delGCCAGTTC	13.37:g.88330510_88330517delGCCAGTTC	ENSP00000366283:p.Ser956fs	Somatic	47	0		WXS	Illumina GAIIx	Phase_I	17	14	NM_015567	0	0	0	0	0	B3KNB8|B4DSH5|Q5VT81	Frame_Shift_Del	DEL	ENST00000325089.6	37	CCDS9465.1																																																																																			.		0.399	SLITRK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045416.3		
GAS6	2621	hgsc.bcm.edu	37	13	114525009	114525009	+	Missense_Mutation	SNP	C	C	T	rs144262744	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr13:114525009C>T	ENST00000327773.6	-	14	1950	c.1804G>A	c.(1804-1806)Gcg>Acg	p.A602T	GAS6_ENST00000418959.3_Missense_Mutation_p.A303T|GAS6_ENST00000357389.3_Missense_Mutation_p.A645T|GAS6_ENST00000450766.1_Missense_Mutation_p.A329T|GAS6_ENST00000355761.4_Missense_Mutation_p.A548T|GAS6-AS1_ENST00000458001.1_RNA	NM_000820.2	NP_000811.1	Q14393	GAS6_HUMAN	growth arrest-specific 6	645	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				activation of protein kinase B activity (GO:0032148)|apoptotic cell clearance (GO:0043277)|B cell chemotaxis (GO:0035754)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell-substrate adhesion (GO:0031589)|cellular protein metabolic process (GO:0044267)|cellular response to drug (GO:0035690)|cellular response to glucose stimulus (GO:0071333)|cellular response to growth factor stimulus (GO:0071363)|cellular response to interferon-alpha (GO:0035457)|cellular response to starvation (GO:0009267)|cellular response to vitamin K (GO:0071307)|dendritic cell differentiation (GO:0097028)|enzyme linked receptor protein signaling pathway (GO:0007167)|extracellular matrix assembly (GO:0085029)|fusion of virus membrane with host plasma membrane (GO:0019064)|hematopoietic stem cell migration to bone marrow (GO:0097241)|leukocyte migration (GO:0050900)|macrophage cytokine production (GO:0010934)|negative regulation of apoptotic process (GO:0043066)|negative regulation of biomineral tissue development (GO:0070168)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of interleukin-6 secretion (GO:1900165)|negative regulation of oligodendrocyte apoptotic process (GO:1900142)|negative regulation of protein import into nucleus, translocation (GO:0033159)|negative regulation of renal albumin absorption (GO:2000533)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|neuron migration (GO:0001764)|organ regeneration (GO:0031100)|peptidyl-glutamic acid carboxylation (GO:0017187)|peptidyl-serine phosphorylation (GO:0018105)|phagocytosis (GO:0006909)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|positive regulation of dendritic cell chemotaxis (GO:2000510)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of gene expression (GO:0010628)|positive regulation of glomerular filtration (GO:0003104)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of phagocytosis (GO:0050766)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of TOR signaling (GO:0032008)|post-translational protein modification (GO:0043687)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|protein targeting to plasma membrane (GO:0072661)|proteolysis (GO:0006508)|receptor-mediated virion attachment to host cell (GO:0046813)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)|viral entry into host cell (GO:0046718)|viral genome replication (GO:0019079)	cytoplasm (GO:0005737)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|platelet alpha granule lumen (GO:0031093)	binding, bridging (GO:0060090)|calcium ion binding (GO:0005509)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|phosphatidylserine binding (GO:0001786)|protein tyrosine kinase activator activity (GO:0030296)|receptor agonist activity (GO:0048018)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|voltage-gated calcium channel activity (GO:0005245)			central_nervous_system(4)|ovary(1)	5	Lung NSC(43;0.00976)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0176)|all_epithelial(44;0.0104)|all_lung(25;0.0249)|Lung NSC(25;0.0908)|Breast(118;0.188)				TGCAGCTGCGCGGCGCTCACC	0.711																																					p.A602T		.											.	GAS6-650	0			c.G1804A						.	T	THR/ALA,THR/ALA,THR/ALA	0,4334		0,0,2167	19.0	15.0	16.0		1804,985,907	-3.9	0.0	13	dbSNP_134	16	2,8558		0,2,4278	no	missense,missense,missense	GAS6	NM_000820.2,NM_001143945.1,NM_001143946.1	58,58,58	0,2,6445	TT,TC,CC		0.0234,0.0,0.0155	benign,benign,benign	602/679,329/406,303/380	114525009	2,12892	2167	4280	6447	SO:0001583	missense	2621	exon14			GCTGCGCGGCGCT		CCDS45072.1	13q34	2008-07-18			ENSG00000183087	ENSG00000183087			4168	protein-coding gene	gene with protein product	"""AXL stimulatory factor"""	600441		AXLLG		8336730	Standard	NM_000820		Approved	AXSF, FLJ34709, DKFZp666G247	uc001vud.3	Q14393	OTTHUMG00000017395	ENST00000327773.6:c.1804G>A	13.37:g.114525009C>T	ENSP00000331831:p.Ala602Thr	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	80	72	NM_000820	0	1	3	23	19	B3KRQ7|B3KVL4|E9PBL7|Q6IMN1|Q7Z7N3	Missense_Mutation	SNP	ENST00000327773.6	37	CCDS45072.1	.	.	.	.	.	.	.	.	.	.	c	6.045	0.376665	0.11466	0.0	2.34E-4	ENSG00000183087	ENST00000357389;ENST00000355761;ENST00000450766;ENST00000418959;ENST00000327773	T;T;T;T;T	0.78126	-1.15;-1.15;-1.15;-1.15;-1.15	4.7	-3.86	0.04230	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	.	.	.	.	T	0.60508	0.2274	L	0.41824	1.3	0.09310	N	1	B;B;B	0.11235	0.004;0.001;0.0	B;B;B	0.04013	0.001;0.0;0.001	T	0.43048	-0.9415	9	0.15066	T	0.55	-5.6457	5.0976	0.14742	0.3754:0.1833:0.0:0.4413	.	645;329;602	Q14393;B3KVL4;Q14393-2	GAS6_HUMAN;.;.	T	645;548;329;303;602	ENSP00000349962:A645T;ENSP00000348003:A548T;ENSP00000416498:A329T;ENSP00000400117:A303T;ENSP00000331831:A602T	ENSP00000331831:A602T	A	-	1	0	GAS6	113588934	0.000000	0.05858	0.000000	0.03702	0.074000	0.17049	-0.593000	0.05740	-0.459000	0.07013	-0.355000	0.07637	GCG	C|0.999;T|0.001		0.711	GAS6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000045946.2	NM_000820	
ZNF219	51222	hgsc.bcm.edu	37	14	21560706	21560706	+	Silent	SNP	C	C	G	rs370417468|rs1065496	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr14:21560706C>G	ENST00000360947.3	-	3	1161	c.750G>C	c.(748-750)ccG>ccC	p.P250P	ZNF219_ENST00000451119.2_Silent_p.P250P|ZNF219_ENST00000556101.1_5'Flank|ZNF219_ENST00000421093.2_Silent_p.P250P|RP11-998D10.7_ENST00000554733.2_lincRNA	NM_016423.2	NP_057507.2	Q9P2Y4	ZN219_HUMAN	zinc finger protein 219	250					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of neurotransmitter levels (GO:0001505)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histamine receptor activity (GO:0004969)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(1)|lung(1)|ovary(1)|prostate(2)	8	all_cancers(95;0.00185)		OV - Ovarian serous cystadenocarcinoma(11;9.86e-11)|Epithelial(56;1.27e-08)|all cancers(55;6.06e-08)	GBM - Glioblastoma multiforme(265;0.0191)		gttcgggctccggctccggct	0.726											OREG0022565	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	C|||	448	0.0894569	0.1097	0.049	5008	,	,		11470	0.0942		0.0785	False		,,,				2504	0.0971				p.P250P		.											.	ZNF219-90	0			c.G750C						.	C	,,	331,3629		14,303,1663	6.0	7.0	7.0		750,750,750	-8.1	0.1	14	dbSNP_86	7	434,7432		9,416,3508	no	coding-synonymous,coding-synonymous,coding-synonymous	ZNF219	NM_001101672.1,NM_001102454.1,NM_016423.2	,,	23,719,5171	GG,GC,CC		5.5174,8.3586,6.4688	,,	250/723,250/723,250/723	21560706	765,11061	1980	3933	5913	SO:0001819	synonymous_variant	51222	exon3			GGGCTCCGGCTCC	AB015427	CCDS9568.1	14q11	2013-01-08			ENSG00000165804	ENSG00000165804		"""Zinc fingers, C2H2-type"""	13011	protein-coding gene	gene with protein product		605036				10819330	Standard	NM_016423		Approved		uc001vzs.2	Q9P2Y4	OTTHUMG00000029647	ENST00000360947.3:c.750G>C	14.37:g.21560706C>G		Somatic	1	0	749	WXS	Illumina GAIIx	Phase_I	37	21	NM_001102454	1	0	32	79	46	D3DS16|Q53Y57|Q8IYC1|Q9BW28	Silent	SNP	ENST00000360947.3	37	CCDS9568.1																																																																																			C|0.100;G|0.900		0.726	ZNF219-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073931.2		
FAM161B	145483	bcgsc.ca	37	14	74402693	74402693	+	Silent	SNP	C	C	T	rs17182699	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr14:74402693C>T	ENST00000534936.1	-	8	1869	c.1764G>A	c.(1762-1764)cgG>cgA	p.R588R	RP5-1021I20.5_ENST00000555916.1_RNA|FAM161B_ENST00000286544.3_Silent_p.R651R			Q96MY7	F161B_HUMAN	family with sequence similarity 161, member B	588										breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(2)|skin(2)	21						CTTGAACAGCCCGGGTGCCTT	0.468													C|||	219	0.04373	0.0083	0.0648	5008	,	,		18871	0.0		0.1123	False		,,,				2504	0.0511				p.R651R		.											.	FAM161B-91	0			c.G1953A						.	C		96,4310	78.3+/-116.7	2,92,2109	144.0	133.0	137.0		1953	-4.7	0.0	14	dbSNP_123	137	887,7713	199.4+/-243.5	56,775,3469	no	coding-synonymous	FAM161B	NM_152445.2		58,867,5578	TT,TC,CC		10.314,2.1788,7.5581		651/711	74402693	983,12023	2203	4300	6503	SO:0001819	synonymous_variant	145483	exon8			AACAGCCCGGGTG	AA356453	CCDS9822.1, CCDS9822.2	14q24.2	2008-06-05	2008-06-05	2008-06-05		ENSG00000156050			19854	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 44"""	C14orf44			Standard	NM_152445		Approved	FLJ31697	uc001xpd.3	Q96MY7		ENST00000534936.1:c.1764G>A	14.37:g.74402693C>T		Somatic	97	0		WXS	Illumina GAIIx	Phase_I	183	6	NM_152445	0	0	7	7	0	B7Z882|J3KNA2	Silent	SNP	ENST00000534936.1	37		119	0.05448717948717949	1	0.0020325203252032522	29	0.08011049723756906	0	0.0	89	0.11741424802110818	C	3.048	-0.196076	0.06259	0.021788	0.10314	ENSG00000156050	ENST00000556794	.	.	.	4.86	-4.65	0.03339	.	.	.	.	.	T	0.00241	0.0007	.	.	.	0.58432	P	1.999999999946489E-6	.	.	.	.	.	.	T	0.22487	-1.0215	3	.	.	.	20.474	1.6237	0.02719	0.2691:0.1841:0.099:0.4477	rs17182699;rs60311174;rs17182699	.	.	.	S	116	.	.	G	-	1	0	FAM161B	73472446	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.111000	0.01333	-0.712000	0.04988	-0.768000	0.03414	GGC	C|0.935;T|0.065		0.468	FAM161B-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_152445	
PAPOLA	10914	broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	96987355	96987355	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr14:96987355G>T	ENST00000216277.8	+	3	415	c.195G>T	c.(193-195)ttG>ttT	p.L65F	PAPOLA_ENST00000554130.1_3'UTR|PAPOLA_ENST00000557471.1_Missense_Mutation_p.L65F|PAPOLA_ENST00000557320.1_Missense_Mutation_p.L65F|PAPOLA_ENST00000392990.2_Missense_Mutation_p.L65F	NM_032632.4	NP_116021.2	P51003	PAPOA_HUMAN	poly(A) polymerase alpha	65					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA splicing, via spliceosome (GO:0000398)|RNA polyadenylation (GO:0043631)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|polynucleotide adenylyltransferase activity (GO:0004652)|RNA binding (GO:0003723)			breast(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(6)|skin(1)|urinary_tract(1)	21		all_cancers(154;0.0555)|all_epithelial(191;0.149)|Melanoma(154;0.155)		COAD - Colon adenocarcinoma(157;0.213)		TTTTAATTTTGGGAAAACTAA	0.279																																					p.L65F	NSCLC(19;254 734 11908 35501 39234)	.											.	PAPOLA-68	0			c.G195T						.						61.0	72.0	68.0					14																	96987355		2203	4298	6501	SO:0001583	missense	10914	exon3			AATTTTGGGAAAA	X76770	CCDS9946.1, CCDS58334.1, CCDS58335.1	14q32.1-q32.2	2008-02-08				ENSG00000090060	2.7.7.19		14981	protein-coding gene	gene with protein product		605553				8302877, 10429366	Standard	NM_032632		Approved	PAP	uc001yfq.3	P51003		ENST00000216277.8:c.195G>T	14.37:g.96987355G>T	ENSP00000216277:p.Leu65Phe	Somatic	156	1		WXS	Illumina GAIIx	Phase_I	181	81	NM_001252006	0	0	79	167	88	Q86SX4|Q86TV0|Q8IYF5|Q9BVU2	Missense_Mutation	SNP	ENST00000216277.8	37	CCDS9946.1	.	.	.	.	.	.	.	.	.	.	G	19.07	3.755362	0.69648	.	.	ENSG00000090060	ENST00000216277;ENST00000557320;ENST00000546064;ENST00000557471;ENST00000556619;ENST00000392990	.	.	.	5.16	5.16	0.70880	Poly(A) polymerase, central domain (1);	0.074581	0.53938	D	0.000046	D	0.86535	0.5956	M	0.93763	3.455	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;0.997;1.0	D;D;D;D;D	0.71184	0.952;0.972;0.972;0.916;0.972	D	0.90255	0.4296	9	0.87932	D	0	.	18.6458	0.91409	0.0:0.0:1.0:0.0	.	81;81;65;65;81	F5H5I8;B4DYF4;P51003;P51003-2;B4DHB8	.;.;PAPOA_HUMAN;.;.	F	65;65;81;65;79;65	.	ENSP00000216277:L65F	L	+	3	2	PAPOLA	96057108	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.484000	0.53201	2.419000	0.82065	0.484000	0.47621	TTG	.		0.279	PAPOLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413411.2		
CEP170B	283638	broad.mit.edu	37	14	105359440	105359440	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr14:105359440A>C	ENST00000414716.3	+	14	4234	c.4006A>C	c.(4006-4008)Acc>Ccc	p.T1336P	CEP170B_ENST00000556508.1_Missense_Mutation_p.T1301P|CEP170B_ENST00000418279.1_Missense_Mutation_p.T1266P|CEP170B_ENST00000453495.1_Missense_Mutation_p.T1372P	NM_001112726.2	NP_001106197.1	Q9Y4F5	C170B_HUMAN	centrosomal protein 170B	1371						cytoplasm (GO:0005737)|microtubule (GO:0005874)											CATGCCCAGCACCCCCGCCTC	0.687																																					p.T1336P		.											.	.	0			c.A4006C						.						16.0	25.0	22.0					14																	105359440		2084	4203	6287	SO:0001583	missense	283638	exon14			CCCAGCACCCCCG	AB006622	CCDS45175.1, CCDS45176.1, CCDS45176.2	14q32.33	2014-02-20	2012-11-30	2012-11-30	ENSG00000099814	ENSG00000099814			20362	protein-coding gene	gene with protein product	"""Cep170-related"""		"""KIAA0284"""	KIAA0284		23087211	Standard	NM_015005		Approved	FAM68C, Cep170R	uc010axb.4	Q9Y4F5	OTTHUMG00000170763	ENST00000414716.3:c.4006A>C	14.37:g.105359440A>C	ENSP00000404151:p.Thr1336Pro	Somatic	49	6		WXS	Illumina GAIIx	Phase_I	297	46	NM_001112726	0	1	26	30	3	Q2KHR7|Q86TI7	Missense_Mutation	SNP	ENST00000414716.3	37	CCDS45175.1	.	.	.	.	.	.	.	.	.	.	A	18.15	3.559308	0.65538	.	.	ENSG00000099814	ENST00000556508;ENST00000414716;ENST00000453495;ENST00000418279;ENST00000429757	T;T;T;T	0.56103	0.5;0.62;0.48;0.63	4.45	3.25	0.37280	.	0.337000	0.26919	N	0.021828	T	0.57844	0.2081	M	0.71581	2.175	0.36088	D	0.843223	P;P;B	0.43169	0.776;0.8;0.429	P;B;B	0.47626	0.552;0.261;0.326	T	0.67122	-0.5750	10	0.87932	D	0	-24.8257	10.0086	0.41972	0.8482:0.0:0.0:0.1518	.	1336;1371;1266	Q9Y4F5-2;Q9Y4F5;E9PFC1	.;K0284_HUMAN;.	P	1301;1336;1372;1266;4	ENSP00000451249:T1301P;ENSP00000404151:T1336P;ENSP00000407238:T1372P;ENSP00000415006:T1266P	ENSP00000404151:T1336P	T	+	1	0	KIAA0284	104430485	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	4.006000	0.57083	0.527000	0.28560	0.347000	0.21830	ACC	.		0.687	CEP170B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000410289.2	NM_001112726	
AHNAK2	113146	bcgsc.ca	37	14	105410183	105410183	+	Missense_Mutation	SNP	T	T	C	rs10438246	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr14:105410183T>C	ENST00000333244.5	-	7	11724	c.11605A>G	c.(11605-11607)Atg>Gtg	p.M3869V	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3869			M -> V (in dbSNP:rs10438246).			costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			AGGAGTTTCATGTCCACCTGG	0.602													.|||	2784	0.555911	0.643	0.5144	5008	,	,		18090	0.4127		0.5348	False		,,,				2504	0.637				p.M3869V		.											.	AHNAK2-47	0			c.A11605G						.	C	VAL/MET	2678,1266		920,838,214	130.0	137.0	135.0		11605	-2.0	0.0	14	dbSNP_119	135	4528,3782		1252,2024,879	yes	missense	AHNAK2	NM_138420.2	21	2172,2862,1093	CC,CT,TT		45.5114,32.0994,41.1947	benign	3869/5796	105410183	7206,5048	1972	4155	6127	SO:0001583	missense	113146	exon7			GTTTCATGTCCAC	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.11605A>G	14.37:g.105410183T>C	ENSP00000353114:p.Met3869Val	Somatic	209	1		WXS	Illumina GAIIx	Phase_I	423	10	NM_138420	0	0	0	0	0	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	1148	0.5256410256410257	324	0.6585365853658537	200	0.5524861878453039	222	0.3881118881118881	402	0.5303430079155673	t	0.010	-1.780679	0.00634	0.679006	0.544886	ENSG00000185567	ENST00000333244	T	0.00882	5.58	3.67	-2.03	0.07365	.	.	.	.	.	T	0.00012	0.0000	N	0.00985	-1.075	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.01834	-1.1264	8	0.12430	T	0.62	.	6.3549	0.21397	0.0:0.5117:0.1168:0.3714	rs10438246;rs59225031;rs10438246	3869	Q8IVF2	AHNK2_HUMAN	V	3869	ENSP00000353114:M3869V	ENSP00000353114:M3869V	M	-	1	0	AHNAK2	104481228	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.234000	0.00546	-0.909000	0.03852	-2.717000	0.00132	ATG	T|0.456;C|0.544		0.602	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
NPAP1	23742	hgsc.bcm.edu	37	15	24921176	24921176	+	Silent	SNP	C	C	T			TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr15:24921176C>T	ENST00000329468.2	+	1	636	c.162C>T	c.(160-162)aaC>aaT	p.N54N		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	54					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)											TCCGCCGGAACGCCCGTCGCA	0.756																																					p.N54N		.											.	.	0			c.C162T						.						14.0	18.0	16.0					15																	24921176		2156	4227	6383	SO:0001819	synonymous_variant	23742	exon1			CCGGAACGCCCGT	AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.162C>T	15.37:g.24921176C>T		Somatic	2	0		WXS	Illumina GAIIx	Phase_I	36	30	NM_018958	0	0	0	0	0		Silent	SNP	ENST00000329468.2	37	CCDS10015.1																																																																																			.		0.756	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251253.1	NM_018958	
C15orf62	643338	hgsc.bcm.edu	37	15	41062922	41062922	+	Silent	SNP	C	C	T	rs115347345	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr15:41062922C>T	ENST00000344320.6	+	1	764	c.229C>T	c.(229-231)Ctg>Ttg	p.L77L	DNAJC17_ENST00000558727.1_5'Flank|DNAJC17_ENST00000220496.4_Intron	NM_001130448.2	NP_001123920.1	A8K5M9	CO062_HUMAN	chromosome 15 open reading frame 62	77						mitochondrion (GO:0005739)											GGCCACCCTGCTGGCCCCACC	0.677													C|||	346	0.0690895	0.1263	0.0432	5008	,	,		12885	0.0308		0.0219	False		,,,				2504	0.0982				p.L77L		.											.	.	0			c.C229T						.	C	,	141,1243		7,127,558	44.0	58.0	54.0		229,	5.5	1.0	15	dbSNP_132	54	42,3140		0,42,1549	no	coding-synonymous,intron	DNAJC17,C15orf62	NM_001130448.2,NM_018163.2	,	7,169,2107	TT,TC,CC		1.3199,10.1879,4.0079	,	77/176,	41062922	183,4383	692	1591	2283	SO:0001819	synonymous_variant	643338	exon1			ACCCTGCTGGCCC		CCDS45229.1	15q15.1	2008-08-07			ENSG00000188277	ENSG00000188277			34489	protein-coding gene	gene with protein product							Standard	NM_001130448		Approved	LOC643338	uc010bby.3	A8K5M9		ENST00000344320.6:c.229C>T	15.37:g.41062922C>T		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	9	9	NM_001130448	0	0	0	0	0	A6NK01	Silent	SNP	ENST00000344320.6	37	CCDS45229.1																																																																																			C|0.943;T|0.057		0.677	C15orf62-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418995.1	NM_001130448	
LCTL	197021	broad.mit.edu	37	15	66853375	66853375	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr15:66853375C>A	ENST00000341509.5	-	6	805	c.674G>T	c.(673-675)gGc>gTc	p.G225V	LCTL_ENST00000563438.1_5'Flank|LCTL_ENST00000537670.1_Missense_Mutation_p.G52V	NM_207338.2	NP_997221.2	Q6UWM7	LCTL_HUMAN	lactase-like	225					carbohydrate metabolic process (GO:0005975)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)	p.G225V(3)		NS(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						CTTGTACAGGCCGGTGCCGCG	0.602																																					p.G225V		.											.	LCTL-92	3	Substitution - Missense(3)	prostate(2)|kidney(1)	c.G674T						.						64.0	61.0	62.0					15																	66853375		2201	4299	6500	SO:0001583	missense	197021	exon6			TACAGGCCGGTGC	AY358729	CCDS10220.1, CCDS61678.1	15q21.3	2008-02-05			ENSG00000188501	ENSG00000188501			15583	protein-coding gene	gene with protein product	"""klotho gamma"", ""KL lactase phlorizin hydrolase"""					12084582	Standard	NM_207338		Approved	KLPH, FLJ33279, KLG	uc002aqc.3	Q6UWM7	OTTHUMG00000133207	ENST00000341509.5:c.674G>T	15.37:g.66853375C>A	ENSP00000343490:p.Gly225Val	Somatic	57	5		WXS	Illumina GAIIx	Phase_I	76	8	NM_207338	0	0	0	0	0	B3KQY0	Missense_Mutation	SNP	ENST00000341509.5	37	CCDS10220.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.960240	0.74016	.	.	ENSG00000188501	ENST00000537670;ENST00000341509	T;T	0.52754	0.65;1.49	5.38	5.38	0.77491	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	T	0.65544	0.2701	L	0.53617	1.68	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.62969	-0.6741	10	0.44086	T	0.13	-35.5197	18.487	0.90833	0.0:1.0:0.0:0.0	.	225	Q6UWM7	LCTL_HUMAN	V	52;225	ENSP00000445419:G52V;ENSP00000343490:G225V	ENSP00000343490:G225V	G	-	2	0	LCTL	64640429	0.998000	0.40836	0.991000	0.47740	0.630000	0.37929	5.425000	0.66470	2.689000	0.91719	0.655000	0.94253	GGC	.		0.602	LCTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256921.2	NM_207338	
ZNF774	342132	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	90904066	90904066	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr15:90904066G>C	ENST00000354377.3	+	4	1189	c.1003G>C	c.(1003-1005)Gta>Cta	p.V335L	ZNF774_ENST00000379090.5_Intron	NM_001004309.2	NP_001004309.2	Q6NX45	ZN774_HUMAN	zinc finger protein 774	335					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(4)|prostate(1)|stomach(1)	14	Melanoma(11;0.00551)|Lung NSC(78;0.0158)|all_lung(78;0.0331)		BRCA - Breast invasive adenocarcinoma(143;0.0224)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)			TTCTCATTTTGTAGCTCACAT	0.512																																					p.V335L		.											.	ZNF774-90	0			c.G1003C						.						97.0	95.0	96.0					15																	90904066		2199	4298	6497	SO:0001583	missense	342132	exon4			CATTTTGTAGCTC	BC067279	CCDS32330.1	15q26.1	2013-01-08				ENSG00000196391		"""Zinc fingers, C2H2-type"""	33108	protein-coding gene	gene with protein product							Standard	NM_001004309		Approved	MGC75360	uc002bpk.4	Q6NX45		ENST00000354377.3:c.1003G>C	15.37:g.90904066G>C	ENSP00000346348:p.Val335Leu	Somatic	59	0		WXS	Illumina GAIIx	Phase_I	40	4	NM_001004309	0	0	0	0	0	A8K020	Missense_Mutation	SNP	ENST00000354377.3	37	CCDS32330.1	.	.	.	.	.	.	.	.	.	.	G	10.93	1.491096	0.26774	.	.	ENSG00000196391	ENST00000354377	T	0.07216	3.21	5.35	3.47	0.39725	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.32459	N	0.006072	T	0.04861	0.0131	N	0.12527	0.23	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.34004	-0.9846	10	0.44086	T	0.13	.	9.0189	0.36186	0.1781:0.0:0.8219:0.0	.	335	Q6NX45	ZN774_HUMAN	L	335	ENSP00000346348:V335L	ENSP00000346348:V335L	V	+	1	0	ZNF774	88705070	0.000000	0.05858	0.002000	0.10522	0.973000	0.67179	0.011000	0.13264	1.263000	0.44181	0.555000	0.69702	GTA	.		0.512	ZNF774-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418048.1	NM_001004309	
CACNA1H	8912	hgsc.bcm.edu	37	16	1252124	1252124	+	Silent	SNP	G	G	A			TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr16:1252124G>A	ENST00000348261.5	+	9	1922	c.1674G>A	c.(1672-1674)tcG>tcA	p.S558S	CACNA1H_ENST00000565831.1_Silent_p.S558S|CACNA1H_ENST00000358590.4_Silent_p.S558S	NM_021098.2	NP_066921.2	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type, alpha 1H subunit	558					aldosterone biosynthetic process (GO:0032342)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|positive regulation of acrosome reaction (GO:2000344)|regulation of heart contraction (GO:0008016)|regulation of membrane potential (GO:0042391)|transport (GO:0006810)	caveola (GO:0005901)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)			breast(4)|endometrium(5)|kidney(2)|lung(23)	34		Hepatocellular(780;0.00369)			Amiodarone(DB01118)|Bepridil(DB01244)|Cinnarizine(DB00568)|Felodipine(DB01023)|Flunarizine(DB04841)|Isradipine(DB00270)|Nifedipine(DB01115)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Zonisamide(DB00909)	CGCCCCCCTCGCCACCTTCCC	0.721																																					p.S558S		.											.	CACNA1H-67	0			c.G1674A						.						2.0	2.0	2.0					16																	1252124		1236	3053	4289	SO:0001819	synonymous_variant	8912	exon9			CCCCTCGCCACCT	AL031703	CCDS45375.1, CCDS45376.1	16p13.3	2012-03-07	2007-02-16					"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1395	protein-coding gene	gene with protein product		607904				9670923, 16382099	Standard	NM_021098		Approved	Cav3.2	uc002cks.3	O95180		ENST00000348261.5:c.1674G>A	16.37:g.1252124G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	36	17	NM_021098	0	0	3	7	4	B5ME00|F8WFD1|O95802|Q8WWI6|Q96QI6|Q96RZ9|Q9NYY4|Q9NYY5	Silent	SNP	ENST00000348261.5	37	CCDS45375.1																																																																																			.		0.721	CACNA1H-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000421601.1	NM_001005407	
TPSAB1	7177	bcgsc.ca	37	16	1291622	1291622	+	Missense_Mutation	SNP	A	A	G	rs149113013	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr16:1291622A>G	ENST00000338844.3	+	4	454	c.421A>G	c.(421-423)Acc>Gcc	p.T141A	TPSAB1_ENST00000461509.2_Missense_Mutation_p.T148A	NM_003294.3	NP_003285.2	Q15661	TRYB1_HUMAN	tryptase alpha/beta 1	141	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.		T -> A (in dbSNP:rs1800992). {ECO:0000269|PubMed:10898108}.|T -> M (in allele alpha).		defense response (GO:0006952)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			NS(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(4)|skin(1)	10		Hepatocellular(780;0.00369)				CCACACGGTCACCCTGCCCCC	0.662													A|||	1009	0.201478	0.2874	0.2695	5008	,	,		17793	0.1171		0.1918	False		,,,				2504	0.1339				p.T141A		.											.	TPSAB1-22	0			c.A421G						.						30.0	25.0	26.0					16																	1291622		2198	4297	6495	SO:0001583	missense	7177	exon4			ACGGTCACCCTGC	M33494	CCDS10431.1	16p13.3	2009-11-13	2004-10-14	2004-10-15	ENSG00000172236	ENSG00000172236			12019	protein-coding gene	gene with protein product	"""tryptase alpha II"", ""tryptase beta I"", ""tryptase-I"", ""tryptase-II"", ""tryptase-III"""	191080	"""tryptase beta 1"""	TPSB1, TPS1, TPS2		2203827, 9920877	Standard	NM_003294		Approved		uc002ckz.3	Q15661	OTTHUMG00000090467	ENST00000338844.3:c.421A>G	16.37:g.1291622A>G	ENSP00000343577:p.Thr141Ala	Somatic	91	8		WXS	Illumina GAIIx	Phase_I	662	204	NM_003294	0	0	0	0	0	D2E6R9|D2E6S1|P15157|Q15663|Q6B052|Q9H2Y4|Q9H2Y5|Q9UQI1	Missense_Mutation	SNP	ENST00000338844.3	37	CCDS10431.1	448	0.20512820512820512	154	0.3130081300813008	86	0.23756906077348067	75	0.13111888111888112	133	0.17546174142480211	A	0.171	-1.071903	0.01918	.	.	ENSG00000172236	ENST00000338844;ENST00000461509	T;T	0.80994	-1.44;-1.44	3.74	0.17	0.15021	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.872655	0.09671	N	0.771165	T	0.00012	0.0000	N	0.03268	-0.37	0.45477	P	0.0015540000000000553	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.06463	-1.0825	9	0.33141	T	0.24	.	7.8036	0.29189	0.3416:0.0:0.0:0.6584	.	132;141	Q15661-2;Q15661	.;TRYB1_HUMAN	A	141;148	ENSP00000343577:T141A;ENSP00000418247:T148A	ENSP00000343577:T141A	T	+	1	0	TPSAB1	1231623	0.000000	0.05858	0.458000	0.27068	0.169000	0.22640	0.545000	0.23268	0.161000	0.19458	0.392000	0.25879	ACC	G|1.000;|0.000		0.662	TPSAB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000206914.1	NM_003294	
MEFV	4210	hgsc.bcm.edu	37	16	3304463	3304463	+	Missense_Mutation	SNP	C	C	T	rs224222	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr16:3304463C>T	ENST00000219596.1	-	2	644	c.605G>A	c.(604-606)cGg>cAg	p.R202Q	MEFV_ENST00000536379.1_Intron|MEFV_ENST00000339854.4_Intron|MEFV_ENST00000541159.1_Intron	NM_000243.2	NP_000234.1	O15553	MEFV_HUMAN	Mediterranean fever	202			R -> Q (in dbSNP:rs224222). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:9668175}.		inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of macrophage inflammatory protein 1 alpha production (GO:0071641)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity (GO:2001056)	cell projection (GO:0042995)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)			NS(2)|biliary_tract(1)|breast(5)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(3)|prostate(1)|skin(6)	50						TCTGCGCAGCCGGACCTCGGC	0.771													C|||	681	0.135982	0.0363	0.3242	5008	,	,		10819	0.0308		0.2783	False		,,,				2504	0.0992				p.R202Q		.											.	MEFV-228	0			c.G605A	GRCh37	CM044663	MEFV	M	rs224222	.	C	GLN/ARG,	280,4020		7,266,1877	9.0	11.0	10.0		605,	-5.2	0.0	16	dbSNP_79	10	1996,6326		253,1490,2418	no	missense,intron	MEFV	NM_000243.2,NM_001198536.1	43,	260,1756,4295	TT,TC,CC		23.9846,6.5116,18.032	benign,	202/782,	3304463	2276,10346	2150	4161	6311	SO:0001583	missense	4210	exon2			CGCAGCCGGACCT	AF018080	CCDS10498.1, CCDS55981.1	16p13.3	2014-09-17			ENSG00000103313	ENSG00000103313		"""Tripartite motif containing / Tripartite motif containing"""	6998	protein-coding gene	gene with protein product	"""pyrin"""	608107		MEF		9288094	Standard	NM_000243		Approved	FMF, TRIM20	uc002cun.1	O15553	OTTHUMG00000129324	ENST00000219596.1:c.605G>A	16.37:g.3304463C>T	ENSP00000219596:p.Arg202Gln	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	10	NM_000243	0	0	0	0	0	D3DUC0|F5H0Q3|Q3MJ84|Q96PN4|Q96PN5	Missense_Mutation	SNP	ENST00000219596.1	37	CCDS10498.1	367	0.16804029304029305	20	0.04065040650406504	120	0.3314917127071823	18	0.03146853146853147	209	0.2757255936675462	C	1.316	-0.600781	0.03744	0.065116	0.239846	ENSG00000103313	ENST00000545159;ENST00000219596	T	0.62364	0.03	4.79	-5.23	0.02798	.	2.737930	0.01004	N	0.003723	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.09022	0.002	B	0.04013	0.001	T	0.15896	-1.0421	9	0.02654	T	1	-27.8034	1.8616	0.03189	0.114:0.2357:0.2258:0.4246	rs224222	202	O15553	MEFV_HUMAN	Q	202	ENSP00000219596:R202Q	ENSP00000219596:R202Q	R	-	2	0	MEFV	3244464	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.420000	0.01032	-1.150000	0.02840	-2.943000	0.00086	CGG	C|0.816;T|0.184		0.771	MEFV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251464.1	NM_000243	
MEFV	4210	hgsc.bcm.edu	37	16	3304573	3304573	+	Silent	SNP	G	G	T	rs224223	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr16:3304573G>T	ENST00000219596.1	-	2	534	c.495C>A	c.(493-495)gcC>gcA	p.A165A	MEFV_ENST00000536379.1_Intron|MEFV_ENST00000339854.4_Intron|MEFV_ENST00000541159.1_Intron	NM_000243.2	NP_000234.1	O15553	MEFV_HUMAN	Mediterranean fever	165					inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of macrophage inflammatory protein 1 alpha production (GO:0071641)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity (GO:2001056)	cell projection (GO:0042995)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)	p.A165A(2)		NS(2)|biliary_tract(1)|breast(5)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(3)|prostate(1)|skin(6)	50						GGCCCTCCGAGGCCTTCTCTC	0.766													G|||	1935	0.386382	0.528	0.5965	5008	,	,		10896	0.1667		0.4732	False		,,,				2504	0.183				p.A165A		.											.	MEFV-228	2	Substitution - coding silent(2)	prostate(2)	c.C495A						.	G	,	2112,2188		580,952,618	7.0	7.0	7.0		495,	2.9	0.0	16	dbSNP_79	7	3826,4590		964,1898,1346	no	coding-synonymous,intron	MEFV	NM_000243.2,NM_001198536.1	,	1544,2850,1964	TT,TG,GG		45.461,49.1163,46.6971	,	165/782,	3304573	5938,6778	2150	4208	6358	SO:0001819	synonymous_variant	4210	exon2			CTCCGAGGCCTTC	AF018080	CCDS10498.1, CCDS55981.1	16p13.3	2014-09-17			ENSG00000103313	ENSG00000103313		"""Tripartite motif containing / Tripartite motif containing"""	6998	protein-coding gene	gene with protein product	"""pyrin"""	608107		MEF		9288094	Standard	NM_000243		Approved	FMF, TRIM20	uc002cun.1	O15553	OTTHUMG00000129324	ENST00000219596.1:c.495C>A	16.37:g.3304573G>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_000243	0	0	0	0	0	D3DUC0|F5H0Q3|Q3MJ84|Q96PN4|Q96PN5	Silent	SNP	ENST00000219596.1	37	CCDS10498.1																																																																																			G|0.570;T|0.430		0.766	MEFV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251464.1	NM_000243	
SMG1	23049	hgsc.bcm.edu	37	16	18937330	18937330	+	Missense_Mutation	SNP	T	T	C	rs190057031	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr16:18937330T>C	ENST00000446231.2	-	1	446	c.34A>G	c.(34-36)Agc>Ggc	p.S12G	SMG1_ENST00000567737.1_5'UTR|CTD-2288F12.1_ENST00000565782.1_RNA|SMG1_ENST00000389467.3_Missense_Mutation_p.S12G			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	12	Interaction with SMG8 and SMG9.				DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						ccgccgccgctgcTCAGCCGA	0.736													T|||	19	0.00379393	0.0038	0.0072	5008	,	,		9587	0.001		0.006	False		,,,				2504	0.002				p.S12G		.											.	SMG1-1160	0			c.A34G						.						3.0	5.0	4.0					16																	18937330		1189	3103	4292	SO:0001583	missense	23049	exon1			CGCCGCTGCTCAG	AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.34A>G	16.37:g.18937330T>C	ENSP00000402515:p.Ser12Gly	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	47	23	NM_015092	0	0	1	7	6	O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Missense_Mutation	SNP	ENST00000446231.2	37	CCDS45430.1	56	0.02564102564102564	34	0.06910569105691057	10	0.027624309392265192	3	0.005244755244755245	9	0.011873350923482849	t	16.40	3.112756	0.56398	.	.	ENSG00000157106	ENST00000446231;ENST00000389467	T;T	0.01252	5.1;5.1	4.19	4.19	0.49359	.	0.256528	0.31134	N	0.008187	T	0.00144	0.0004	N	0.19112	0.55	0.30658	N	0.754677	B	0.02656	0.0	B	0.01281	0.0	T	0.32348	-0.9910	10	0.72032	D	0.01	.	6.7847	0.23668	0.0:0.1536:0.0:0.8464	.	12	Q96Q15	SMG1_HUMAN	G	12	ENSP00000402515:S12G;ENSP00000374118:S12G	ENSP00000374118:S12G	S	-	1	0	SMG1	18844831	1.000000	0.71417	0.999000	0.59377	0.967000	0.64934	2.875000	0.48491	1.749000	0.51849	0.374000	0.22700	AGC	T|0.974;C|0.026		0.736	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391817.1	NM_015092	
PDILT	204474	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	20384188	20384188	+	Missense_Mutation	SNP	C	C	A	rs193085306		TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr16:20384188C>A	ENST00000302451.4	-	7	1102	c.854G>T	c.(853-855)aGc>aTc	p.S285I		NM_174924.1	NP_777584.1	Q8N807	PDILT_HUMAN	protein disulfide isomerase-like, testis expressed	285					cell migration (GO:0016477)|cell redox homeostasis (GO:0045454)|multicellular organismal development (GO:0007275)|protein folding (GO:0006457)|spermatid development (GO:0007286)	endoplasmic reticulum (GO:0005783)	protein disulfide isomerase activity (GO:0003756)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(33)|prostate(3)|skin(1)|urinary_tract(1)	61						TGACTCGGAGCTTTTGGAGAC	0.428																																					p.S285I		.											.	PDILT-153	0			c.G854T						.						119.0	112.0	114.0					16																	20384188		2203	4300	6503	SO:0001583	missense	204474	exon7			TCGGAGCTTTTGG		CCDS10584.1	16p12.3	2011-11-10	2009-02-23		ENSG00000169340	ENSG00000169340		"""Protein disulfide isomerases"""	27338	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 7"", ""protein disulfide isomerase-like protein of the testis"""					15475357	Standard	NM_174924		Approved	PDIA7	uc002dhc.1	Q8N807	OTTHUMG00000131487	ENST00000302451.4:c.854G>T	16.37:g.20384188C>A	ENSP00000305465:p.Ser285Ile	Somatic	88	0		WXS	Illumina GAIIx	Phase_I	173	78	NM_174924	0	0	0	0	0	Q8IVQ5	Missense_Mutation	SNP	ENST00000302451.4	37	CCDS10584.1	.	.	.	.	.	.	.	.	.	.	C	12.90	2.077631	0.36662	.	.	ENSG00000169340	ENST00000302451	T	0.14640	2.49	5.02	-3.91	0.04168	Thioredoxin-like fold (1);	0.474866	0.27143	N	0.020727	T	0.17280	0.0415	L	0.54323	1.7	0.23126	N	0.998255	D	0.55800	0.973	P	0.54590	0.756	T	0.06356	-1.0831	10	0.72032	D	0.01	.	6.5492	0.22423	0.0:0.2223:0.4044:0.3733	.	285	Q8N807	PDILT_HUMAN	I	285	ENSP00000305465:S285I	ENSP00000305465:S285I	S	-	2	0	PDILT	20291689	0.789000	0.28775	0.063000	0.19743	0.184000	0.23303	-0.366000	0.07563	-0.494000	0.06669	0.563000	0.77884	AGC	C|0.999;T|0.000		0.428	PDILT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254332.1	NM_174924	
SEZ6L2	26470	hgsc.bcm.edu	37	16	29908433	29908433	+	Missense_Mutation	SNP	C	C	G	rs11649499	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr16:29908433C>G	ENST00000308713.5	-	3	748	c.221G>C	c.(220-222)cGg>cCg	p.R74P	SEZ6L2_ENST00000562159.1_5'UTR|SEZ6L2_ENST00000537485.1_Missense_Mutation_p.R30P|SEZ6L2_ENST00000350527.3_Intron|SEZ6L2_ENST00000346932.5_Missense_Mutation_p.R74P	NM_001114099.2|NM_201575.3	NP_001107571.1|NP_963869.2	Q6UXD5	SE6L2_HUMAN	seizure related 6 homolog (mouse)-like 2	74	Pro-rich.		R -> P (in dbSNP:rs11649499). {ECO:0000269|PubMed:12975309, ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						CGTGGGGTCCCGATCAGATCC	0.667													G|||	3761	0.750998	0.9932	0.7464	5008	,	,		9668	0.6052		0.827	False		,,,				2504	0.499				p.R74P		.											.	SEZ6L2-92	0			c.G221C						.	G	,PRO/ARG,,PRO/ARG	4084,194		1951,182,6	7.0	10.0	9.0		,221,,221	2.8	1.0	16	dbSNP_120	9	7159,1331		3016,1127,102	yes	intron,missense,intron,missense	SEZ6L2	NM_001114099.2,NM_001114100.2,NM_012410.3,NM_201575.3	,103,,103	4967,1309,108	GG,GC,CC		15.6773,4.5348,11.9439	,benign,,benign	,74/810,,74/911	29908433	11243,1525	2139	4245	6384	SO:0001583	missense	26470	exon3			GGGTCCCGATCAG	AY358404	CCDS10658.1, CCDS10659.1, CCDS45458.1, CCDS58447.1, CCDS73865.1	16p12.1	2008-02-05			ENSG00000174938	ENSG00000174938			30844	protein-coding gene	gene with protein product	"""type I transmembrane receptor (seizure related protein)"""					12975309	Standard	NM_012410		Approved	PSK-1, FLJ90517	uc010vec.2	Q6UXD5	OTTHUMG00000132112	ENST00000308713.5:c.221G>C	16.37:g.29908433C>G	ENSP00000312550:p.Arg74Pro	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	11	11	NM_001243332	0	0	0	0	0	B7Z1N0|F5H293|H7BXQ6|Q9BW82|Q9UJ45|Q9UJ46|Q9UJ47	Missense_Mutation	SNP	ENST00000308713.5	37	CCDS10659.1	1718	0.7866300366300366	484	0.983739837398374	282	0.7790055248618785	322	0.5629370629370629	630	0.8311345646437994	G	0.009	-1.806021	0.00606	0.954652	0.843227	ENSG00000174938	ENST00000308713;ENST00000346932;ENST00000537485	T;T;T	0.45276	0.9;0.9;0.9	5.17	2.85	0.33270	.	0.128667	0.35436	N	0.003211	T	0.00012	0.0000	N	0.03608	-0.345	0.50632	P	1.1099999999997223E-4	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.30621	-0.9972	8	.	.	.	.	7.5026	0.27526	0.1787:0.1431:0.6783:0.0	rs11649499;rs60390109;rs11649499	30;74	F5H293;Q6UXD5	.;SE6L2_HUMAN	P	74;74;30	ENSP00000312550:R74P;ENSP00000319215:R74P;ENSP00000439412:R30P	.	R	-	2	0	SEZ6L2	29815934	0.685000	0.27652	1.000000	0.80357	0.050000	0.14768	0.504000	0.22626	0.600000	0.29862	-0.998000	0.02512	CGG	C|0.218;G|0.782		0.667	SEZ6L2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255154.2	NM_012410	
FBXL19	54620	hgsc.bcm.edu	37	16	30937068	30937068	+	Missense_Mutation	SNP	C	C	T	rs551914906		TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr16:30937068C>T	ENST00000380310.2	+	2	211	c.53C>T	c.(52-54)aCg>aTg	p.T18M	FBXL19_ENST00000565690.1_5'UTR|FBXL19_ENST00000338343.4_5'UTR|FBXL19-AS1_ENST00000563777.1_RNA|FBXL19_ENST00000471231.2_Intron|FBXL19_ENST00000562319.1_5'UTR	NM_001099784.2	NP_001093254.2	Q6PCT2	FXL19_HUMAN	F-box and leucine-rich repeat protein 19	18					proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)	SCF ubiquitin ligase complex (GO:0019005)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(3)|lung(5)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	16						GCGTTGCTGACGCCCCCAATG	0.736													C|||	1	0.000199681	0.0	0.0	5008	,	,		11368	0.001		0.0	False		,,,				2504	0.0				p.T18M		.											.	FBXL19-661	0			c.C53T						.						2.0	2.0	2.0					16																	30937068		1194	2599	3793	SO:0001583	missense	54620	exon2			TGCTGACGCCCCC	AK127701	CCDS45465.1, CCDS73873.1	16p11.2	2014-02-20			ENSG00000099364	ENSG00000099364		"""F-boxes / Leucine-rich repeats"""	25300	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1C"""	609085					Standard	NM_001099784		Approved	DKFZp434K0410, Fbl19, JHDM1C, CXXC11	uc002eab.2	Q6PCT2	OTTHUMG00000132403	ENST00000380310.2:c.53C>T	16.37:g.30937068C>T	ENSP00000369666:p.Thr18Met	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	18	9	NM_001099784	0	0	0	0	0	A8MT10|Q8N789|Q9NT14	Missense_Mutation	SNP	ENST00000380310.2	37	CCDS45465.1	.	.	.	.	.	.	.	.	.	.	C	26.7	4.759449	0.89932	.	.	ENSG00000099364	ENST00000380310	T	0.18810	2.19	4.65	4.65	0.58169	.	.	.	.	.	T	0.27169	0.0666	N	0.08118	0	0.31783	N	0.630612	D	0.89917	1.0	D	0.78314	0.991	T	0.36335	-0.9752	9	0.72032	D	0.01	.	14.4308	0.67249	0.0:1.0:0.0:0.0	.	18	Q6PCT2	FXL19_HUMAN	M	18	ENSP00000369666:T18M	ENSP00000369666:T18M	T	+	2	0	FBXL19	30844569	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.601000	0.54059	2.123000	0.65237	0.462000	0.41574	ACG	.		0.736	FBXL19-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_019085	
ARMC5	79798	hgsc.bcm.edu	37	16	31476186	31476186	+	Silent	SNP	C	C	G	rs55800131	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr16:31476186C>G	ENST00000563544.1	+	5	2388	c.1842C>G	c.(1840-1842)ctC>ctG	p.L614L	ARMC5_ENST00000408912.3_Silent_p.L709L|ARMC5_ENST00000268314.4_Silent_p.L614L|ARMC5_ENST00000412665.2_Silent_p.L258L|ARMC5_ENST00000457010.2_Silent_p.L614L|ARMC5_ENST00000538189.1_Silent_p.L646L			Q96C12	ARMC5_HUMAN	armadillo repeat containing 5	614										central_nervous_system(1)|endometrium(4)|large_intestine(3)|liver(2)|lung(12)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	28						GGCCCACTCTCCACAGCCGGC	0.697													C|||	165	0.0329473	0.0068	0.0504	5008	,	,		12908	0.0069		0.0845	False		,,,				2504	0.0297				p.L614L		.											.	ARMC5-24	0			c.C1842G						.	C	,	79,4117		0,79,2019	19.0	22.0	21.0		1842,1842	-3.4	0.0	16	dbSNP_129	21	781,7673		36,709,3482	no	coding-synonymous,coding-synonymous	ARMC5	NM_001105247.1,NM_024742.2	,	36,788,5501	GG,GC,CC		9.2382,1.8827,6.7984	,	614/936,614/726	31476186	860,11790	2098	4227	6325	SO:0001819	synonymous_variant	79798	exon4			CACTCTCCACAGC	AY217348	CCDS42155.1, CCDS45472.1, CCDS73874.1	16p11	2013-02-14			ENSG00000140691	ENSG00000140691		"""Armadillo repeat containing"""	25781	protein-coding gene	gene with protein product		615549					Standard	NM_024742		Approved	FLJ13063	uc002ecc.3	Q96C12	OTTHUMG00000176618	ENST00000563544.1:c.1842C>G	16.37:g.31476186C>G		Somatic	2	0		WXS	Illumina GAIIx	Phase_I	12	5	NM_024742	0	0	7	12	5	Q86WM9|Q9H7P8|Q9H925	Silent	SNP	ENST00000563544.1	37	CCDS45472.1																																																																																			C|0.940;G|0.060		0.697	ARMC5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432847.1	NM_024742	
CCDC102A	92922	hgsc.bcm.edu	37	16	57562804	57562804	+	Missense_Mutation	SNP	G	G	A	rs12935069		TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr16:57562804G>A	ENST00000258214.2	-	2	532	c.286C>T	c.(286-288)Cgg>Tgg	p.R96W		NM_033212.3	NP_149989.2	Q96A19	C102A_HUMAN	coiled-coil domain containing 102A	96				R -> W (in Ref. 2; AAH08285/AAH09941). {ECO:0000305}.						endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)	8						TCCGACCACCGGCGCATGGTC	0.731													A|||	5008	1.0	1.0	1.0	5008	,	,		3757	1.0		1.0	False		,,,				2504	1.0				p.R96W		.											.	CCDC102A-91	0			c.C286T						.						8.0	10.0	9.0					16																	57562804		1834	3717	5551	SO:0001583	missense	92922	exon2			ACCACCGGCGCAT	BC008285	CCDS10784.1	16q13	2008-02-05			ENSG00000135736	ENSG00000135736			28097	protein-coding gene	gene with protein product						12477932	Standard	NM_033212		Approved	MGC10992	uc002elw.3	Q96A19	OTTHUMG00000133472	ENST00000258214.2:c.286C>T	16.37:g.57562804G>A	ENSP00000258214:p.Arg96Trp	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_033212	0	0	0	0	0	Q9BT74	Missense_Mutation	SNP	ENST00000258214.2	37	CCDS10784.1	2180	0.9981684981684982	492	1.0	360	0.994475138121547	570	0.9965034965034965	758	1.0	A	10.17	1.277909	0.23307	.	.	ENSG00000135736	ENST00000258214	T	0.37752	1.18	4.82	4.82	0.62117	.	0.000000	0.64402	N	0.000001	T	0.00012	0.0000	N	0.00049	-2.415	0.40217	P	0.022302999999999962	B	0.02656	0.0	B	0.01281	0.0	T	0.44787	-0.9305	9	0.33141	T	0.24	-23.2491	9.5348	0.39216	0.9152:0.0:0.0848:0.0	rs12935069;rs12935069	96	Q96A19	C102A_HUMAN	W	96	ENSP00000258214:R96W	ENSP00000258214:R96W	R	-	1	2	CCDC102A	56120305	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	6.801000	0.75170	0.698000	0.31739	-0.556000	0.04195	CGG	G|0.001;A|0.999		0.731	CCDC102A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257348.1	NM_033212	
EDC4	23644	broad.mit.edu	37	16	67913786	67913788	+	In_Frame_Del	DEL	AGC	AGC	-			TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr16:67913786_67913788delAGC	ENST00000358933.5	+	16	2094_2096	c.1855_1857delAGC	c.(1855-1857)agcdel	p.S629del	AC040162.1_ENST00000408599.1_RNA|CTC-479C5.10_ENST00000572067.1_lincRNA	NM_014329.4	NP_055144.3	Q6P2E9	EDC4_HUMAN	enhancer of mRNA decapping 4	629	Ser-rich.				exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(4)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	41		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)		cagcagcggtagcagcagcagca	0.616																																					p.619_619del		.											.	EDC4-92	0			c.1855_1857del						.																																			SO:0001651	inframe_deletion	23644	exon16			AGCGGTAGCAGCA	U17474	CCDS10849.1	16q22.1	2008-02-05			ENSG00000038358	ENSG00000038358			17157	protein-coding gene	gene with protein product		606030				9067524	Standard	NM_014329		Approved	RCD-8, Ge-1, HEDLS	uc002eur.3	Q6P2E9	OTTHUMG00000137543	ENST00000358933.5:c.1855_1857delAGC	16.37:g.67913795_67913797delAGC	ENSP00000351811:p.Ser629del	Somatic	56	0		WXS	Illumina GAIIx	Phase_I	110	6	NM_014329	0	0	0	0	0	A6NGM1|A8K4T4|Q13025|Q13826|Q6ZR12|Q7Z6H7	In_Frame_Del	DEL	ENST00000358933.5	37	CCDS10849.1																																																																																			.		0.616	EDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268874.2	NM_014329	
ADAMTS18	170692	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	77389876	77389876	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr16:77389876C>A	ENST00000282849.5	-	9	1839	c.1421G>T	c.(1420-1422)tGg>tTg	p.W474L		NM_199355.2	NP_955387.1	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 18	474	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				eye development (GO:0001654)|negative regulation of platelet aggregation (GO:0090331)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(26)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(19)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	118						GCAGGAAGACCATGAAAACAC	0.478																																					p.W474L		.											.	ADAMTS18-1036	0			c.G1421T						.						120.0	104.0	109.0					16																	77389876		2198	4300	6498	SO:0001583	missense	170692	exon9			GAAGACCATGAAA	AJ311903	CCDS10926.1	16q23	2008-07-29	2005-08-19		ENSG00000140873	ENSG00000140873		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17110	protein-coding gene	gene with protein product		607512	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 18"""	ADAMTS21		11867212, 17546048	Standard	NM_199355		Approved		uc002ffc.4	Q8TE60	OTTHUMG00000137619	ENST00000282849.5:c.1421G>T	16.37:g.77389876C>A	ENSP00000282849:p.Trp474Leu	Somatic	114	0		WXS	Illumina GAIIx	Phase_I	172	88	NM_199355	0	0	0	0	0	Q6P4R5|Q6ZWJ9	Missense_Mutation	SNP	ENST00000282849.5	37	CCDS10926.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.110396	0.77210	.	.	ENSG00000140873	ENST00000282849	T	0.10099	2.91	5.19	5.19	0.71726	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.85682	D	0.000000	T	0.46756	0.1409	H	0.94734	3.575	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.60229	-0.7304	10	0.87932	D	0	.	18.2505	0.90000	0.0:1.0:0.0:0.0	.	474;474	Q8TE60-2;Q8TE60	.;ATS18_HUMAN	L	474	ENSP00000282849:W474L	ENSP00000282849:W474L	W	-	2	0	ADAMTS18	75947377	1.000000	0.71417	0.998000	0.56505	0.284000	0.27059	7.609000	0.82925	2.865000	0.98341	0.655000	0.94253	TGG	.		0.478	ADAMTS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269037.1		
GAS8	2622	bcgsc.ca	37	16	90095573	90095573	+	Intron	SNP	C	C	T	rs77382359		TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr16:90095573C>T	ENST00000268699.4	+	2	212				GAS8_ENST00000540721.1_Intron|GAS8_ENST00000536122.1_Intron|C16orf3_ENST00000408886.2_Missense_Mutation_p.V60I	NM_001481.2	NP_001472.1	O95995	GAS8_HUMAN	growth arrest-specific 8						cellular protein localization (GO:0034613)|negative regulation of cell proliferation (GO:0008285)|sperm motility (GO:0030317)	Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile cilium (GO:0031514)				endometrium(3)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	14		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.029)		gggcaggctacggggcagctt	0.672																																					p.V60I		.											.	C16orf3-90	0			c.G178A						.						22.0	20.0	21.0					16																	90095573		2194	4299	6493	SO:0001627	intron_variant	750	exon1			AGGCTACGGGGCA	AF050079	CCDS10992.1, CCDS67101.1, CCDS73932.1	16q24.3	2014-07-18	2003-01-16	2003-01-17	ENSG00000141013	ENSG00000141013			4166	protein-coding gene	gene with protein product		605178	"""growth arrest-specific 11"""	GAS11		9790751	Standard	NM_001481		Approved		uc002fqi.1	O95995	OTTHUMG00000138988	ENST00000268699.4:c.90+1443C>T	16.37:g.90095573C>T		Somatic	33	0		WXS	Illumina GAIIx	Phase_I	59	8	NM_001214	0	0	0	0	0	B2RCT1|B7Z4U1|G3V1L5|Q2M234	Missense_Mutation	SNP	ENST00000268699.4	37	CCDS10992.1	.	.	.	.	.	.	.	.	.	.	c	0.708	-0.788068	0.02884	.	.	ENSG00000221819	ENST00000408886	T	0.47177	0.85	.	.	.	.	.	.	.	.	T	0.22244	0.0536	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.22208	-1.0223	4	.	.	.	.	.	.	.	.	68	O95177	CP003_HUMAN	I	60	ENSP00000386218:V60I	.	V	-	1	0	C16orf3	88623074	0.031000	0.19500	0.015000	0.15790	0.017000	0.09413	0.000000	0.12993	0.000000	0.14550	0.000000	0.15137	GTA	C|0.500;T|0.500		0.672	GAS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000272877.2		
GAS8	2622	ucsc.edu	37	16	90095597	90095597	+	Intron	SNP	T	T	C	rs61118444|rs71137702	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr16:90095597T>C	ENST00000268699.4	+	2	212				GAS8_ENST00000540721.1_Intron|GAS8_ENST00000536122.1_Intron|C16orf3_ENST00000408886.2_Missense_Mutation_p.I52V	NM_001481.2	NP_001472.1	O95995	GAS8_HUMAN	growth arrest-specific 8						cellular protein localization (GO:0034613)|negative regulation of cell proliferation (GO:0008285)|sperm motility (GO:0030317)	Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile cilium (GO:0031514)				endometrium(3)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	14		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.029)		gggcaggctatggggcagcct	0.662													t|||	2317	0.46266	0.3767	0.4611	5008	,	,		15322	0.63		0.3757	False		,,,				2504	0.4969				p.I52V		.											.	C16orf3-90	0			c.A154G						.						20.0	23.0	22.0					16																	90095597		2197	4299	6496	SO:0001627	intron_variant	750	exon1			AGGCTATGGGGCA	AF050079	CCDS10992.1, CCDS67101.1, CCDS73932.1	16q24.3	2014-07-18	2003-01-16	2003-01-17	ENSG00000141013	ENSG00000141013			4166	protein-coding gene	gene with protein product		605178	"""growth arrest-specific 11"""	GAS11		9790751	Standard	NM_001481		Approved		uc002fqi.1	O95995	OTTHUMG00000138988	ENST00000268699.4:c.90+1467T>C	16.37:g.90095597T>C		Somatic	10	0		WXS	Illumina GAIIx	Phase_I	48	14	NM_001214	0	0	0	0	0	B2RCT1|B7Z4U1|G3V1L5|Q2M234	Missense_Mutation	SNP	ENST00000268699.4	37	CCDS10992.1	.	.	.	.	.	.	.	.	.	.	t	0.096	-1.158920	0.01686	.	.	ENSG00000221819	ENST00000408886	T	0.47177	0.85	.	.	.	.	.	.	.	.	T	0.17408	0.0418	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.14117	-1.0484	5	.	.	.	.	.	.	.	rs61118444;rs62640378	60	O95177	CP003_HUMAN	V	52	ENSP00000386218:I52V	.	I	-	1	0	C16orf3	88623098	0.005000	0.15991	0.000000	0.03702	0.009000	0.06853	-2.049000	0.01405	-2.579000	0.00463	-1.976000	0.00459	ATA	T|0.361;C|0.639		0.662	GAS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000272877.2		
OR3A4P	390756	bcgsc.ca	37	17	3213877	3213877	+	RNA	SNP	C	C	A	rs139602609		TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr17:3213877C>A	ENST00000573491.1	-	0	359																											TCATATCCAACGACAGAAGCA	0.552																																					.		.											.	.	0			.						.						129.0	121.0	124.0					17																	3213877		2203	4300	6503			390756	.			ATCCAACGACAGA																													17.37:g.3213877C>A		Somatic	258	5		WXS	Illumina GAIIx	Phase_I	219	188	.	0	0	0	0	0		RNA	SNP	ENST00000573491.1	37																																																																																				C|0.999;T|0.000		0.552	RP11-64J4.2-001	KNOWN	basic	sense_overlapping	sense_overlapping	OTTHUMT00000438371.1		
TP53	7157	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	7574012	7574012	+	Nonsense_Mutation	SNP	C	C	A	rs17882252	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr17:7574012C>A	ENST00000269305.4	-	10	1204	c.1015G>T	c.(1015-1017)Gag>Tag	p.E339*	TP53_ENST00000445888.2_Nonsense_Mutation_p.E339*|TP53_ENST00000359597.4_Intron|TP53_ENST00000420246.2_3'UTR|TP53_ENST00000413465.2_Intron|TP53_ENST00000455263.2_3'UTR	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	339	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.|Interaction with HIPK2.|Oligomerization.		E -> K (in a sporadic cancer; somatic mutation; dbSNP:rs17882252). {ECO:0000269|Ref.12}.|E -> Q (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.E339*(14)|p.0?(8)|p.E339fs*8(2)|p.E339Q(1)|p.?(1)|p.F338fs*6(1)|p.F338_E339>L(1)|p.E339fs*13(1)|p.I332fs*5(1)|p.E339K(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CGGAACATCTCGAAGCGCTCA	0.537		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.E339X	Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	.	TP53-70225	31	Substitution - Nonsense(14)|Whole gene deletion(8)|Insertion - Frameshift(3)|Unknown(2)|Deletion - Frameshift(2)|Substitution - Missense(2)	upper_aerodigestive_tract(5)|breast(5)|liver(4)|bone(4)|large_intestine(3)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(2)|pancreas(2)|stomach(1)|oesophagus(1)|ovary(1)	c.G1015T	GRCh37	CM984588	TP53	M	rs17882252	.						59.0	46.0	51.0					17																	7574012		2203	4300	6503	SO:0001587	stop_gained	7157	exon10	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	ACATCTCGAAGCG	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.1015G>T	17.37:g.7574012C>A	ENSP00000269305:p.Glu339*	Somatic	136	0		WXS	Illumina GAIIx	Phase_I	105	89	NM_000546	0	0	0	3	3	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	35	5.547605	0.96488	.	.	ENSG00000141510	ENST00000269305;ENST00000445888;ENST00000396473	.	.	.	5.43	4.44	0.53790	.	0.053822	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-17.4901	10.1064	0.42535	0.0:0.8944:0.0:0.1056	.	.	.	.	X	339;339;328	.	ENSP00000269305:E339X	E	-	1	0	TP53	7514737	0.991000	0.36638	0.794000	0.32065	0.424000	0.31475	2.924000	0.48876	1.194000	0.43101	0.561000	0.74099	GAG	C|0.994;T|0.006		0.537	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
KCNJ12	3768	ucsc.edu;bcgsc.ca	37	17	21319943	21319943	+	Missense_Mutation	SNP	A	A	G	rs5021699	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr17:21319943A>G	ENST00000583088.1	+	3	2184	c.1289A>G	c.(1288-1290)gAg>gGg	p.E430G	KCNJ12_ENST00000331718.5_Missense_Mutation_p.E430G	NM_021012.4	NP_066292.2	Q14500	KCJ12_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 12	430			E -> G (in dbSNP:rs5021699).		muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|protein homotetramerization (GO:0051289)|regulation of heart contraction (GO:0008016)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|intrinsic component of membrane (GO:0031224)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)			NS(1)|breast(4)|endometrium(4)|kidney(1)|large_intestine(5)|lung(39)|ovary(5)|skin(8)|stomach(3)	70				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)|Yohimbine(DB01392)	TACAGACGGGAGTCAGAGATC	0.701										Prostate(3;0.18)																											p.E430G		.											.	.	0			c.A1289G						.																																			SO:0001583	missense	100134444	exon3			GACGGGAGTCAGA	L36069	CCDS11219.1	17p11.1	2011-07-05	2004-01-13		ENSG00000184185	ENSG00000184185		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6258	protein-coding gene	gene with protein product		602323	"""potassium inwardly-rectifying channel, subfamily J, inhibitor 1"""	KCNJN1		7859381, 12417321, 16382105	Standard	NM_021012		Approved	Kir2.2, Kir2.2v, IRK2, hIRK1	uc021tss.1	Q14500	OTTHUMG00000132039	ENST00000583088.1:c.1289A>G	17.37:g.21319943A>G	ENSP00000463778:p.Glu430Gly	Somatic	22	0		WXS	Illumina GAIIx	Phase_I	59	18	NM_001194958	0	0	0	0	0	O43401|Q15756|Q8NG63	Missense_Mutation	SNP	ENST00000583088.1	37	CCDS11219.1	.	.	.	.	.	.	.	.	.	.	A	17.96	3.515652	0.64634	.	.	ENSG00000184185	ENST00000331718	D	0.90197	-2.63	5.41	5.41	0.78517	.	0.381500	0.26680	N	0.023059	D	0.94699	0.8290	M	0.71581	2.175	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	D	0.94947	0.8096	10	0.59425	D	0.04	.	15.4536	0.75297	1.0:0.0:0.0:0.0	rs5021699	430	Q14500	IRK12_HUMAN	G	430	ENSP00000328150:E430G	ENSP00000328150:E430G	E	+	2	0	KCNJ12	21260536	1.000000	0.71417	0.998000	0.56505	0.519000	0.34347	9.091000	0.94151	2.066000	0.61787	0.528000	0.53228	GAG	A|0.600;G|0.400		0.701	KCNJ12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255060.2	NM_021012	
NOS2	4843	bcgsc.ca	37	17	26089867	26089867	+	Silent	SNP	T	T	C	rs1060826	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr17:26089867T>C	ENST00000313735.6	-	22	2990	c.2757A>G	c.(2755-2757)acA>acG	p.T919T		NM_000625.4	NP_000616.3	P35228	NOS2_HUMAN	nitric oxide synthase 2, inducible	919	FAD-binding FR-type. {ECO:0000255|PROSITE-ProRule:PRU00716}.				arginine catabolic process (GO:0006527)|blood coagulation (GO:0007596)|cellular response to interferon-gamma (GO:0071346)|cellular response to lipopolysaccharide (GO:0071222)|circadian rhythm (GO:0007623)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|inflammatory response (GO:0006954)|innate immune response in mucosa (GO:0002227)|interaction with host (GO:0051701)|negative regulation of blood pressure (GO:0045776)|negative regulation of gene expression (GO:0010629)|negative regulation of protein catabolic process (GO:0042177)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide mediated signal transduction (GO:0007263)|peptidyl-cysteine S-nitrosylation (GO:0018119)|phagosome maturation (GO:0090382)|positive regulation of guanylate cyclase activity (GO:0031284)|positive regulation of killing of cells of other organism (GO:0051712)|positive regulation of leukocyte mediated cytotoxicity (GO:0001912)|positive regulation of vasodilation (GO:0045909)|regulation of cell proliferation (GO:0042127)|regulation of cellular respiration (GO:0043457)|regulation of insulin secretion (GO:0050796)|response to bacterium (GO:0009617)|response to hypoxia (GO:0001666)|superoxide metabolic process (GO:0006801)	cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)	arginine binding (GO:0034618)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|NADPH-hemoprotein reductase activity (GO:0003958)|nitric-oxide synthase activity (GO:0004517)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|tetrahydrobiopterin binding (GO:0034617)			autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(28)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	56					Dexamethasone(DB01234)|Doxorubicin(DB00997)|L-Arginine(DB00125)|L-Citrulline(DB00155)|Miconazole(DB01110)|Triflusal(DB08814)	GGTGGATCTCTGTGGGCGTGT	0.627													.|||	3655	0.729832	0.8041	0.6484	5008	,	,		17935	0.6696		0.6153	False		,,,				2504	0.8671				p.T919T		.											.	NOS2-156	0			c.A2757G						.	C		3346,1018		1294,758,130	21.0	17.0	18.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	2757	-2.6	0.0	17	dbSNP_86	18	5268,3310		1667,1934,688	no	coding-synonymous	NOS2	NM_000625.4		2961,2692,818	CC,CT,TT		38.5871,23.3272,33.4415		919/1154	26089867	8614,4328	2182	4289	6471	SO:0001819	synonymous_variant	4843	exon22			GATCTCTGTGGGC	U20141	CCDS11223.1	17q11.2	2014-06-12	2008-09-16	2008-09-16	ENSG00000007171	ENSG00000007171	1.14.13.39		7873	protein-coding gene	gene with protein product		163730	"""nitric oxide synthase 2A (inducible, hepatocytes)"""	NOS2A		7682706	Standard	NM_000625		Approved	iNOS, NOS, HEP-NOS	uc002gzu.3	P35228	OTTHUMG00000132445	ENST00000313735.6:c.2757A>G	17.37:g.26089867T>C		Somatic	69	0		WXS	Illumina GAIIx	Phase_I	77	5	NM_000625	0	0	0	0	0	A1L3U5|B7ZLY2|O60757|O94994|Q16263|Q16692|Q4TTS5|Q9UD42	Silent	SNP	ENST00000313735.6	37	CCDS11223.1																																																																																			T|0.303;C|0.697		0.627	NOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255597.1	NM_000625	
HEATR9	256957	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	17	34190106	34190106	+	Silent	SNP	G	G	T	rs142219051		TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr17:34190106G>T	ENST00000311880.2	-	8	797	c.649C>A	c.(649-651)Cgg>Agg	p.R217R	C17orf66_ENST00000592980.1_Silent_p.R177R|C17orf66_ENST00000587585.1_5'Flank	NM_152781.2	NP_689994.2	A2RTY3	HEAT9_HUMAN		217					hematopoietic progenitor cell differentiation (GO:0002244)					breast(3)|central_nervous_system(1)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(6)|lung(11)|skin(2)|stomach(4)	38		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0184)		ATGAGAGCCCGGATCACATGC	0.537																																					p.R217R		.											.	C17orf66-155	0			c.C649A						.						132.0	125.0	127.0					17																	34190106		2203	4300	6503	SO:0001819	synonymous_variant	256957	exon8			GAGCCCGGATCAC																												ENST00000311880.2:c.649C>A	17.37:g.34190106G>T		Somatic	42	0		WXS	Illumina GAIIx	Phase_I	44	4	NM_152781	0	0	0	0	0	B4DX21|B4DXA4|B4DXF0|Q8N4R4|Q96M46	Silent	SNP	ENST00000311880.2	37	CCDS11299.1																																																																																			G|1.000;A|0.000		0.537	C17orf66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256487.1		
C17orf96	100170841	hgsc.bcm.edu	37	17	36830562	36830562	+	Missense_Mutation	SNP	G	G	C	rs79676758	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr17:36830562G>C	ENST00000325814.5	-	1	625	c.187C>G	c.(187-189)Ctg>Gtg	p.L63V		NM_001130677.1	NP_001124149.1	A6NHQ4	CQ096_HUMAN	chromosome 17 open reading frame 96	63	Pro-rich.				neuron fate commitment (GO:0048663)												CGCGCCGCCAGCTCCCCAGGC	0.766													G|||	965	0.192692	0.2693	0.1239	5008	,	,		11134	0.2004		0.1779	False		,,,				2504	0.1452				p.L63V		.											.	.	0			c.C187G						.						1.0	2.0	2.0					17																	36830562		328	928	1256	SO:0001583	missense	100170841	exon1			CCGCCAGCTCCCC		CCDS45661.1	17q12	2014-04-17			ENSG00000179294	ENSG00000273604			34493	protein-coding gene	gene with protein product	"""proline rich 28"""					24550272	Standard	NM_001130677		Approved	LOC100170841, PRR28	uc010wdq.2	A6NHQ4	OTTHUMG00000188495	ENST00000325814.5:c.187C>G	17.37:g.36830562G>C	ENSP00000317905:p.Leu63Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	4	NM_001130677	0	0	0	0	0		Missense_Mutation	SNP	ENST00000325814.5	37	CCDS45661.1	383	0.17536630036630035	117	0.23780487804878048	48	0.13259668508287292	93	0.16258741258741258	125	0.16490765171503957	G	13.17	2.158099	0.38119	.	.	ENSG00000179294	ENST00000325814	.	.	.	3.48	3.48	0.39840	.	.	.	.	.	T	0.00012	0.0000	N	0.24115	0.695	0.39035	P	0.03997899999999999	P	0.50443	0.935	P	0.46479	0.518	T	0.10847	-1.0612	7	0.87932	D	0	.	10.799	0.46476	0.0:0.0:1.0:0.0	.	63	A6NHQ4	CQ096_HUMAN	V	63	.	ENSP00000317905:L63V	L	-	1	2	C17orf96	34084088	0.995000	0.38212	0.991000	0.47740	0.004000	0.04260	0.513000	0.22770	1.657000	0.50732	0.462000	0.41574	CTG	G|0.824;C|0.176		0.766	C17orf96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255465.2	NM_001130677	
KRTAP4-8	728224	ucsc.edu	37	17	39254054	39254054	+	Missense_Mutation	SNP	A	A	T	rs76270529		TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr17:39254054A>T	ENST00000333822.4	-	1	339	c.283T>A	c.(283-285)Tgc>Agc	p.C95S		NM_031960.2	NP_114166.1	Q9BYQ9	KRA48_HUMAN	keratin associated protein 4-8	95	25 X 5 AA repeats of C-C-[IKRQVHEC]- [SPRT]-[STCVQPR].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)		p.C95S(4)		endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|prostate(1)	11						ctggagatgcagcagcTAGGG	0.677																																					p.C95S		.											.	.	4	Substitution - Missense(4)	endometrium(3)|kidney(1)	c.T283A						.						7.0	11.0	10.0					17																	39254054		685	1582	2267	SO:0001583	missense	728224	exon1			AGATGCAGCAGCT	AJ406940	CCDS45674.1	17q21.2	2013-06-25			ENSG00000204880	ENSG00000204880		"""Keratin associated proteins"""	17230	protein-coding gene	gene with protein product						11279113	Standard	NM_031960		Approved	KAP4.8	uc010wfo.2	Q9BYQ9	OTTHUMG00000133580	ENST00000333822.4:c.283T>A	17.37:g.39254054A>T	ENSP00000328444:p.Cys95Ser	Somatic	14	0		WXS	Illumina GAIIx	Phase_I	188	24	NM_031960	0	0	0	0	0	A8MSH3	Missense_Mutation	SNP	ENST00000333822.4	37	CCDS45674.1	.	.	.	.	.	.	.	.	.	.	.	15.18	2.755714	0.49362	.	.	ENSG00000204880	ENST00000333822;ENST00000332991	T	0.02280	4.36	3.11	2.01	0.26516	.	0.000000	0.52532	U	0.000067	T	0.04497	0.0123	M	0.83223	2.63	0.25182	N	0.99019	B	0.21606	0.058	B	0.27887	0.084	T	0.21793	-1.0235	10	0.54805	T	0.06	.	6.3859	0.21559	0.8715:0.0:0.1285:0.0	.	95	Q9BYQ9	KRA48_HUMAN	S	95;80	ENSP00000328444:C95S	ENSP00000414561:C80S	C	-	1	0	KRTAP4-8	36507580	0.999000	0.42202	0.393000	0.26258	0.649000	0.38597	3.122000	0.50446	0.404000	0.25506	0.374000	0.22700	TGC	A|0.500;T|0.500		0.677	KRTAP4-8-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257684.1	NM_031960	
KRTAP4-9	100132386	ucsc.edu	37	17	39261693	39261693	+	Missense_Mutation	SNP	A	A	T	rs113059833		TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr17:39261693A>T	ENST00000391415.1	+	1	110	c.53A>T	c.(52-54)gAc>gTc	p.D18V		NM_001146041.1	NP_001139513.1	Q9BYQ8	KRA49_HUMAN	keratin associated protein 4-9	18					aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)		p.D18V(1)		central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|urinary_tract(3)	14						TGCGGCCAAGACCTCTGTCAG	0.627																																					p.D18V		.											.	.	1	Substitution - Missense(1)	endometrium(1)	c.A53T						.						18.0	22.0	21.0					17																	39261693		692	1590	2282	SO:0001583	missense	100132386	exon1			GCCAAGACCTCTG	AJ406941	CCDS54124.1	17q21.2	2013-06-25			ENSG00000212722	ENSG00000212722		"""Keratin associated proteins"""	18910	protein-coding gene	gene with protein product							Standard	NM_001146041		Approved	KAP4.9	uc010wfp.2	Q9BYQ8	OTTHUMG00000133584	ENST00000391415.1:c.53A>T	17.37:g.39261693A>T	ENSP00000375234:p.Asp18Val	Somatic	61	1		WXS	Illumina GAIIx	Phase_I	85	10	NM_001146041	0	0	0	0	0		Missense_Mutation	SNP	ENST00000391415.1	37	CCDS54124.1	.	.	.	.	.	.	.	.	.	.	.	6.082	0.383461	0.11524	.	.	ENSG00000212722	ENST00000391415;ENST00000333994	T	0.32272	1.46	2.51	0.174	0.15040	.	.	.	.	.	T	0.25865	0.0630	M	0.64404	1.975	0.30580	P	0.762648	B	0.17852	0.024	B	0.14023	0.01	T	0.23154	-1.0196	8	0.45353	T	0.12	.	3.5681	0.07907	0.2702:0.2037:0.5261:0.0	.	18	Q9BYQ8	KRA49_HUMAN	V	18	ENSP00000375234:D18V	ENSP00000334461:D18V	D	+	2	0	KRTAP4-9	36515219	0.000000	0.05858	0.388000	0.26195	0.320000	0.28249	0.098000	0.15189	-0.245000	0.09625	0.155000	0.16302	GAC	T|1.000;|0.000		0.627	KRTAP4-9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257688.1	NM_001146041	
KRTAP4-11	653240	broad.mit.edu;bcgsc.ca	37	17	39274087	39274087	+	Missense_Mutation	SNP	G	G	C	rs141357429		TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr17:39274087G>C	ENST00000391413.2	-	1	519	c.481C>G	c.(481-483)Ctg>Gtg	p.L161V		NM_033059.3	NP_149048.2	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	161	27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].					keratin filament (GO:0045095)		p.L161V(1)		endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(8)|prostate(5)|skin(1)	33		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			ACTGGACGCAGGcagcagcag	0.657																																					p.L161V		.											.	.	1	Substitution - Missense(1)	prostate(1)	c.C481G						.						17.0	21.0	20.0					17																	39274087		692	1589	2281	SO:0001583	missense	653240	exon1			GACGCAGGCAGCA	AC025904	CCDS45675.1	17q21.2	2013-06-25			ENSG00000212721	ENSG00000212721		"""Keratin associated proteins"""	18911	protein-coding gene	gene with protein product			"""keratin associated protein 4-14"""	KRTAP4-14			Standard	NM_033059		Approved	KAP4.11, KAP4.14	uc002hvz.3	Q9BYQ6	OTTHUMG00000133586	ENST00000391413.2:c.481C>G	17.37:g.39274087G>C	ENSP00000375232:p.Leu161Val	Somatic	50	0		WXS	Illumina GAIIx	Phase_I	159	26	NM_033059	0	0	0	0	0	A0AUY2	Missense_Mutation	SNP	ENST00000391413.2	37	CCDS45675.1	249	0.11401098901098901	67	0.13617886178861788	40	0.11049723756906077	104	0.18181818181818182	38	0.05013192612137203	.	1.347	-0.592411	0.03799	.	.	ENSG00000212721	ENST00000391413	T	0.00614	6.21	4.35	0.986	0.19784	.	.	.	.	.	T	0.00012	0.0000	L	0.31752	0.955	0.80722	P	0.0	B	0.30068	0.267	B	0.18871	0.023	T	0.19063	-1.0317	8	0.11794	T	0.64	.	5.8913	0.18915	0.1751:0.0:0.6569:0.168	.	161	Q9BYQ6	KR411_HUMAN	V	161	ENSP00000375232:L161V	ENSP00000375232:L161V	L	-	1	2	KRTAP4-11	36527613	0.671000	0.27521	0.912000	0.35992	0.970000	0.65996	0.971000	0.29396	0.348000	0.23949	0.609000	0.83330	CTG	G|0.500;C|0.500		0.657	KRTAP4-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257690.1		
KRTAP4-11	653240	ucsc.edu	37	17	39274291	39274291	+	Missense_Mutation	SNP	T	T	C	rs200214744|rs565505867	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr17:39274291T>C	ENST00000391413.2	-	1	315	c.277A>G	c.(277-279)Atg>Gtg	p.M93V		NM_033059.3	NP_149048.2	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	93	27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].					keratin filament (GO:0045095)		p.M93V(4)		endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(8)|prostate(5)|skin(1)	33		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			TGGCAGCACATAGACTGGCAG	0.662																																					p.M93V		.											.	.	4	Substitution - Missense(4)	endometrium(3)|kidney(1)	c.A277G						.						6.0	10.0	8.0					17																	39274291		651	1556	2207	SO:0001583	missense	653240	exon1			AGCACATAGACTG	AC025904	CCDS45675.1	17q21.2	2013-06-25			ENSG00000212721	ENSG00000212721		"""Keratin associated proteins"""	18911	protein-coding gene	gene with protein product			"""keratin associated protein 4-14"""	KRTAP4-14			Standard	NM_033059		Approved	KAP4.11, KAP4.14	uc002hvz.3	Q9BYQ6	OTTHUMG00000133586	ENST00000391413.2:c.277A>G	17.37:g.39274291T>C	ENSP00000375232:p.Met93Val	Somatic	12	0		WXS	Illumina GAIIx	Phase_I	88	23	NM_033059	0	0	0	0	0	A0AUY2	Missense_Mutation	SNP	ENST00000391413.2	37	CCDS45675.1	.	.	.	.	.	.	.	.	.	.	.	0.073	-1.199029	0.01581	.	.	ENSG00000212721	ENST00000391413	T	0.00580	6.43	4.25	-4.9	0.03094	.	.	.	.	.	T	0.00109	0.0003	N	0.00040	-2.49	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.43097	-0.9412	9	0.02654	T	1	.	0.4739	0.00536	0.3479:0.2455:0.1203:0.2863	.	93	Q9BYQ6	KR411_HUMAN	V	93	ENSP00000375232:M93V	ENSP00000375232:M93V	M	-	1	0	KRTAP4-11	36527817	.	.	0.012000	0.15200	0.010000	0.07245	.	.	-1.319000	0.02286	-1.132000	0.01976	ATG	.		0.662	KRTAP4-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257690.1		
ASPSCR1	79058	hgsc.bcm.edu	37	17	79974915	79974916	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	CT	CT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr17:79974915_79974916delCT	ENST00000306739.4	+	15	1671_1672	c.1574_1575delCT	c.(1573-1575)cctfs	p.P525fs	ASPSCR1_ENST00000582404.1_3'UTR|STRA13_ENST00000583767.1_5'Flank|ASPSCR1_ENST00000580534.1_Frame_Shift_Del_p.P473fs|ASPSCR1_ENST00000306729.7_Frame_Shift_Del_p.P619fs	NM_024083.3	NP_076988.1	Q9BZE9	ASPC1_HUMAN	alveolar soft part sarcoma chromosome region, candidate 1	525					glucose homeostasis (GO:0042593)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|regulation of glucose import (GO:0046324)	cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|vesicle membrane (GO:0012506)			ASPSCR1/TFE3(167)	breast(2)|large_intestine(2)	4	all_neural(118;0.0878)|Ovarian(332;0.12)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0191)			CTGGTCCCCCCTGAGCCCATCC	0.688			T	TFE3	alveolar soft part sarcoma																																p.619_619del		.		Dom	yes		17	17q25	79058	"""alveolar soft part sarcoma chromosome region, candidate 1"""		M	.	ASPSCR1-877	0			c.1856_1857del						.			13,4237		0,13,2112						1.7	0.0			23	4,8234		0,4,4115	no	frameshift	ASPSCR1	NM_024083.2		0,17,6227	A1A1,A1R,RR		0.0486,0.3059,0.1361				17,12471				SO:0001589	frameshift_variant	79058	exon16			TCCCCCCTGAGCC	AF324219	CCDS11796.1, CCDS58611.1	17q25	2011-06-28				ENSG00000169696		"""UBX domain containing"""	13825	protein-coding gene	gene with protein product	"""UBX domain protein 9"""	606236				11244503, 10506710	Standard	NM_024083		Approved	ASPS, ASPL, UBXD9, UBXN9	uc002kcy.3	Q9BZE9		ENST00000306739.4:c.1574_1575delCT	17.37:g.79974915_79974916delCT	ENSP00000302176:p.Pro525fs	Somatic	7	3		WXS	Illumina GAIIx	Phase_I	44	39	NM_001251888	0	0	0	0	0	A8K3K9|Q7Z6N7|Q8WV59|Q96LS5|Q96M40	Frame_Shift_Del	DEL	ENST00000306739.4	37	CCDS11796.1																																																																																			.		0.688	ASPSCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441972.1	NM_024083	
MYL12B	103910	broad.mit.edu;bcgsc.ca	37	18	3277813	3277813	+	Silent	SNP	C	C	A			TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr18:3277813C>A	ENST00000581193.1	+	4	780	c.397C>A	c.(397-399)Cgg>Agg	p.R133R	MYL12B_ENST00000400175.5_Silent_p.R133R|MYL12B_ENST00000237500.5_Silent_p.R133R|MYL12B_ENST00000584539.1_Silent_p.R133R	NM_001144945.1	NP_001138417.1	O14950	ML12B_HUMAN	myosin, light chain 12B, regulatory	133	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				axon guidance (GO:0007411)|muscle contraction (GO:0006936)|regulation of cell shape (GO:0008360)	apical part of cell (GO:0045177)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|myosin II complex (GO:0016460)|stress fiber (GO:0001725)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)			breast(1)|large_intestine(1)|lung(2)	4						CATGGGGGATCGGTTTACAGA	0.443																																					p.R133R		.											.	MYL12B-90	0			c.C397A						.						64.0	57.0	59.0					18																	3277813		2203	4300	6503	SO:0001819	synonymous_variant	103910	exon4			GGGGATCGGTTTA	AY320408	CCDS11831.1	18p11.31	2013-01-10			ENSG00000118680	ENSG00000118680		"""Myosins / Light chain"", ""EF-hand domain containing"""	29827	protein-coding gene	gene with protein product	"""myosin regulatory light chain 2"""	609211				11942626	Standard	NM_033546		Approved	MRLC2	uc002klt.4	O14950	OTTHUMG00000131510	ENST00000581193.1:c.397C>A	18.37:g.3277813C>A		Somatic	223	1		WXS	Illumina GAIIx	Phase_I	236	11	NM_033546	0	0	1461	1467	6	D3DUH6|Q13182|Q7Z5Z4	Silent	SNP	ENST00000581193.1	37	CCDS11831.1																																																																																			.		0.443	MYL12B-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258908.1	NM_033546	
CHST9	83539	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	24497051	24497051	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr18:24497051C>A	ENST00000284224.8	-	6	781	c.504G>T	c.(502-504)tgG>tgT	p.W168C	AQP4-AS1_ENST00000568797.1_RNA|AQP4-AS1_ENST00000582605.1_RNA|CHST9_ENST00000580774.1_3'UTR|AQP4-AS1_ENST00000579964.1_RNA|CHST9_ENST00000581714.1_Missense_Mutation_p.W168C|AQP4-AS1_ENST00000578701.1_RNA	NM_031422.5	NP_113610.2	Q7L1S5	CHST9_HUMAN	carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 9	168					carbohydrate biosynthetic process (GO:0016051)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|hormone biosynthetic process (GO:0042446)|proteoglycan biosynthetic process (GO:0030166)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	N-acetylgalactosamine 4-O-sulfotransferase activity (GO:0001537)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(7)|ovary(2)|pancreas(1)|skin(3)	28	all_lung(6;0.0145)|Ovarian(20;0.124)					CAGTTTTCTTCCATTTATTAT	0.388																																					p.W168C		.											.	CHST9-93	0			c.G504T						.						130.0	123.0	125.0					18																	24497051		1833	4075	5908	SO:0001583	missense	83539	exon6			TTTCTTCCATTTA	AF239821	CCDS42422.1, CCDS58618.1	18q11.2	2011-04-28			ENSG00000154080	ENSG00000154080		"""Sulfotransferases, membrane-bound"""	19898	protein-coding gene	gene with protein product		610191				11139592, 11445554	Standard	NM_031422		Approved	GALNAC4ST-2, GALNAC-4-ST2	uc002kwe.4	Q7L1S5		ENST00000284224.8:c.504G>T	18.37:g.24497051C>A	ENSP00000284224:p.Trp168Cys	Somatic	85	0		WXS	Illumina GAIIx	Phase_I	53	45	NM_031422	0	0	0	0	0	Q6UX69|Q9BXH3|Q9BXH4|Q9BZW9	Missense_Mutation	SNP	ENST00000284224.8	37	CCDS42422.1	.	.	.	.	.	.	.	.	.	.	C	16.49	3.137765	0.56936	.	.	ENSG00000154080	ENST00000284224	T	0.65549	-0.16	6.16	6.16	0.99307	.	0.000000	0.64402	D	0.000003	T	0.73297	0.3569	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	T	0.72606	-0.4242	10	0.59425	D	0.04	-9.9904	20.8598	0.99761	0.0:1.0:0.0:0.0	.	168	Q7L1S5	CHST9_HUMAN	C	168	ENSP00000284224:W168C	ENSP00000284224:W168C	W	-	3	0	CHST9	22751049	1.000000	0.71417	1.000000	0.80357	0.888000	0.51559	6.264000	0.72527	2.937000	0.99478	0.650000	0.86243	TGG	.		0.388	CHST9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446549.1	NM_031422	
ABCA7	10347	hgsc.bcm.edu	37	19	1065044	1065044	+	Silent	SNP	C	C	T	rs4147935	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr19:1065044C>T	ENST00000263094.6	+	46	6390	c.6159C>T	c.(6157-6159)ggC>ggT	p.G2053G	HMHA1_ENST00000586866.1_5'Flank|HMHA1_ENST00000536472.1_5'Flank|ABCA7_ENST00000435683.2_Silent_p.G1915G|HMHA1_ENST00000539243.2_5'Flank|HMHA1_ENST00000313093.2_5'Flank|HMHA1_ENST00000590214.1_5'Flank|ABCA7_ENST00000433129.1_Silent_p.G2053G	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	2053					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)			NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CACATGGAGGCCGCCTGCGCT	0.736																																					p.G2053G		.											.	ABCA7-98	0			c.C6159T						.	C		327,3757		20,287,1735	5.0	6.0	6.0		6159	1.5	0.8	19	dbSNP_110	6	2858,5242		553,1752,1745	no	coding-synonymous	ABCA7	NM_019112.3		573,2039,3480	TT,TC,CC		35.284,8.0069,26.1408		2053/2147	1065044	3185,8999	2042	4050	6092	SO:0001819	synonymous_variant	10347	exon46			TGGAGGCCGCCTG	AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.6159C>T	19.37:g.1065044C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_019112	0	0	0	5	5	Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Silent	SNP	ENST00000263094.6	37	CCDS12055.1																																																																																			C|0.766;T|0.234		0.736	ABCA7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000394993.1	NM_019112	
ZNF77	58492	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	2934196	2934196	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr19:2934196G>C	ENST00000314531.4	-	4	1021	c.929C>G	c.(928-930)tCc>tGc	p.S310C		NM_021217.2	NP_067040.1	Q15935	ZNF77_HUMAN	zinc finger protein 77	310					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|kidney(3)|large_intestine(3)|lung(5)|ovary(1)	17				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|GBM - Glioblastoma multiforme(1328;2.11e-07)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.174)|STAD - Stomach adenocarcinoma(1328;0.18)		ATCTCTAAAGGAGGAGTAACA	0.453																																					p.S310C		.											.	ZNF77-91	0			c.C929G						.						183.0	165.0	171.0					19																	2934196		2203	4300	6503	SO:0001583	missense	58492	exon4			CTAAAGGAGGAGT	X65230	CCDS12099.1	19p13.3	2013-01-08	2006-05-12					"""Zinc fingers, C2H2-type"", ""-"""	13150	protein-coding gene	gene with protein product		194551	"""zinc finger protein 77 (pT1)"""			8478004	Standard	NM_021217		Approved	pT1	uc002lws.4	Q15935		ENST00000314531.4:c.929C>G	19.37:g.2934196G>C	ENSP00000319053:p.Ser310Cys	Somatic	145	0		WXS	Illumina GAIIx	Phase_I	275	115	NM_021217	0	0	2	7	5	Q86XJ3|Q9NPP0	Missense_Mutation	SNP	ENST00000314531.4	37	CCDS12099.1	.	.	.	.	.	.	.	.	.	.	G	12.52	1.961149	0.34565	.	.	ENSG00000175691	ENST00000341064;ENST00000314531	T	0.01059	5.39	2.58	-3.63	0.04529	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03178	0.0093	M	0.67569	2.06	0.09310	N	1	D	0.69078	0.997	P	0.61477	0.889	T	0.18147	-1.0346	9	0.54805	T	0.06	.	5.4072	0.16328	0.1128:0.0:0.4323:0.4548	.	310	Q15935	ZNF77_HUMAN	C	104;310	ENSP00000319053:S310C	ENSP00000319053:S310C	S	-	2	0	ZNF77	2885196	0.000000	0.05858	0.000000	0.03702	0.077000	0.17291	-0.738000	0.04871	-0.596000	0.05821	0.491000	0.48974	TCC	.		0.453	ZNF77-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451924.1	NM_021217	
ANKRD24	170961	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	4216002	4216002	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr19:4216002G>A	ENST00000600132.1	+	16	1501	c.1225G>A	c.(1225-1227)Gta>Ata	p.V409I	ANKRD24_ENST00000595096.1_3'UTR|ANKRD24_ENST00000262970.5_Missense_Mutation_p.V499I|ANKRD24_ENST00000318934.4_Missense_Mutation_p.V409I	NM_133475.1	NP_597732.1	Q8TF21	ANR24_HUMAN	ankyrin repeat domain 24	409										endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)	21				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0233)|STAD - Stomach adenocarcinoma(1328;0.181)		TAGCTATGACGTAACCACCCT	0.652																																					p.V409I		.											.	ANKRD24-68	0			c.G1225A						.						31.0	37.0	35.0					19																	4216002		2044	4176	6220	SO:0001583	missense	170961	exon16			TATGACGTAACCA	AB075861	CCDS45925.1	19p13.3	2013-01-10				ENSG00000089847		"""Ankyrin repeat domain containing"""	29424	protein-coding gene	gene with protein product						11853319	Standard	NM_133475		Approved	KIAA1981	uc010dtt.1	Q8TF21		ENST00000600132.1:c.1225G>A	19.37:g.4216002G>A	ENSP00000471252:p.Val409Ile	Somatic	49	0		WXS	Illumina GAIIx	Phase_I	119	54	NM_133475	0	0	5	5	0	O75268|O95781	Missense_Mutation	SNP	ENST00000600132.1	37	CCDS45925.1	.	.	.	.	.	.	.	.	.	.	g	6.463	0.453598	0.12283	.	.	ENSG00000089847	ENST00000318934;ENST00000262970	T;T	0.34859	1.34;1.39	4.46	4.46	0.54185	.	0.000000	0.29987	U	0.010694	T	0.19127	0.0459	L	0.27053	0.805	0.24684	N	0.993349	P;P	0.51351	0.906;0.944	B;B	0.40506	0.178;0.331	T	0.15578	-1.0432	10	0.05721	T	0.95	-35.0901	8.2914	0.31960	0.1075:0.0:0.8925:0.0	.	409;499	Q8TF21;Q8TF21-2	ANR24_HUMAN;.	I	409;499	ENSP00000321731:V409I;ENSP00000262970:V499I	ENSP00000262970:V499I	V	+	1	0	ANKRD24	4167002	0.996000	0.38824	0.981000	0.43875	0.045000	0.14185	2.931000	0.48932	2.324000	0.78689	0.491000	0.48974	GTA	.		0.652	ANKRD24-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458188.1	XM_114000	
ICAM3	3385	bcgsc.ca	37	19	10450285	10450285	+	Silent	SNP	G	G	A	rs281414	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr19:10450285G>A	ENST00000160262.5	-	1	214	c.6C>T	c.(4-6)gcC>gcT	p.A2A	ICAM3_ENST00000589261.1_5'UTR	NM_002162.3	NP_002153.2	P32942	ICAM3_HUMAN	intercellular adhesion molecule 3	2					extracellular matrix organization (GO:0030198)|regulation of immune response (GO:0050776)|single organismal cell-cell adhesion (GO:0016337)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|upper_aerodigestive_tract(2)	13			OV - Ovarian serous cystadenocarcinoma(20;6.13e-09)|Epithelial(33;9.69e-06)|all cancers(31;2.05e-05)			GTACCATGGTGGCCATTCTGA	0.632													G|||	759	0.151558	0.2632	0.121	5008	,	,		17884	0.0744		0.166	False		,,,				2504	0.0869				p.A2A		.											.	ICAM3-131	0			c.C6T						.	G		1021,3385	368.3+/-318.6	102,817,1284	50.0	46.0	48.0		6	-0.1	0.3	19	dbSNP_79	48	1497,7103	275.7+/-291.9	137,1223,2940	no	coding-synonymous	ICAM3	NM_002162.3		239,2040,4224	AA,AG,GG		17.407,23.1729,19.3603		2/548	10450285	2518,10488	2203	4300	6503	SO:0001819	synonymous_variant	3385	exon1			CATGGTGGCCATT		CCDS12235.1	19p13.3-p13.2	2013-01-11				ENSG00000076662		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5346	protein-coding gene	gene with protein product		146631				1448174	Standard	NM_002162		Approved	CDW50, ICAM-R, CD50	uc002mob.2	P32942		ENST00000160262.5:c.6C>T	19.37:g.10450285G>A		Somatic	33	0		WXS	Illumina GAIIx	Phase_I	80	6	NM_002162	0	0	3	3	0	Q6PD68	Silent	SNP	ENST00000160262.5	37	CCDS12235.1																																																																																			G|0.827;A|0.173		0.632	ICAM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451234.1		
OCEL1	79629	hgsc.bcm.edu	37	19	17337555	17337555	+	Silent	SNP	C	C	A	rs3745163	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr19:17337555C>A	ENST00000215061.4	+	2	167	c.123C>A	c.(121-123)acC>acA	p.T41T	OCEL1_ENST00000601576.1_3'UTR|OCEL1_ENST00000601529.1_Silent_p.T41T|OCEL1_ENST00000597836.1_5'UTR	NM_024578.1	NP_078854.1	Q9H607	OCEL1_HUMAN	occludin/ELL domain containing 1	41	Pro-rich.									central_nervous_system(2)|endometrium(2)|kidney(1)|lung(2)	7						CCCGCAGGACCCGCCCATCAG	0.746													C|||	1146	0.228834	0.1702	0.2522	5008	,	,		10081	0.4018		0.2018	False		,,,				2504	0.1411				p.T41T		.											.	OCEL1-68	0			c.C123A						.	C		573,3093		51,471,1311	4.0	6.0	5.0		123	-3.2	0.0	19	dbSNP_107	5	1379,6017		128,1123,2447	no	coding-synonymous	OCEL1	NM_024578.1		179,1594,3758	AA,AC,CC		18.6452,15.6301,17.646		41/265	17337555	1952,9110	1833	3698	5531	SO:0001819	synonymous_variant	79629	exon2			CAGGACCCGCCCA	BC029361	CCDS12351.1	19p13.11	2008-02-05				ENSG00000099330			26221	protein-coding gene	gene with protein product						12477932	Standard	NM_024578		Approved	FLJ22709	uc002nfp.3	Q9H607		ENST00000215061.4:c.123C>A	19.37:g.17337555C>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	4	NM_024578	0	0	3	15	12		Silent	SNP	ENST00000215061.4	37	CCDS12351.1																																																																																			C|0.734;A|0.266		0.746	OCEL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463307.1	NM_024578	
ZNF546	339327	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	40520223	40520223	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr19:40520223G>T	ENST00000347077.4	+	7	1262	c.1046G>T	c.(1045-1047)aGa>aTa	p.R349I	ZNF546_ENST00000600094.1_Missense_Mutation_p.R323I|ZNF546_ENST00000596894.1_Intron	NM_178544.3	NP_848639.2	Q86UE3	ZN546_HUMAN	zinc finger protein 546	349					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(15)|lung(6)|ovary(3)|skin(2)|upper_aerodigestive_tract(3)	34	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					GAACATCAAAGAATTCATACT	0.383																																					p.R349I		.											.	ZNF546-155	0			c.G1046T						.						81.0	83.0	83.0					19																	40520223		2203	4300	6503	SO:0001583	missense	339327	exon7			ATCAAAGAATTCA	BC045649	CCDS12548.1	19q13.2	2013-01-08				ENSG00000187187		"""Zinc fingers, C2H2-type"", ""-"""	28671	protein-coding gene	gene with protein product				ZNF49		12477932	Standard	XM_005258853		Approved	MGC43537	uc002oms.2	Q86UE3		ENST00000347077.4:c.1046G>T	19.37:g.40520223G>T	ENSP00000339823:p.Arg349Ile	Somatic	75	0		WXS	Illumina GAIIx	Phase_I	160	78	NM_178544	0	0	0	0	0	A8K913	Missense_Mutation	SNP	ENST00000347077.4	37	CCDS12548.1	.	.	.	.	.	.	.	.	.	.	g	15.79	2.937060	0.52972	.	.	ENSG00000187187	ENST00000347077	T	0.24908	1.83	2.57	2.57	0.30868	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.44201	0.1282	M	0.64170	1.965	0.42028	D	0.991012	D;D	0.76494	0.974;0.999	B;D	0.70935	0.248;0.971	T	0.48031	-0.9070	9	0.87932	D	0	.	11.2908	0.49250	0.0:0.0:1.0:0.0	.	323;349	B3KVL3;Q86UE3	.;ZN546_HUMAN	I	349	ENSP00000339823:R349I	ENSP00000339823:R349I	R	+	2	0	ZNF546	45212063	0.000000	0.05858	0.995000	0.50966	0.979000	0.70002	-0.348000	0.07740	1.722000	0.51474	0.655000	0.94253	AGA	.		0.383	ZNF546-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462495.2	NM_178544	
LILRA6	79168	bcgsc.ca	37	19	54746589	54746589	+	Silent	SNP	G	G	A	rs199943671	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr19:54746589G>A	ENST00000396365.2	-	1	51	c.12C>T	c.(10-12)gcC>gcT	p.A4A	LILRA6_ENST00000440558.2_Silent_p.A4A|LILRB3_ENST00000407860.2_Silent_p.A4A|LILRA6_ENST00000245621.5_Silent_p.A4A|LILRA6_ENST00000419410.2_Silent_p.A4A|LILRA6_ENST00000391735.3_Silent_p.A4A|LILRA6_ENST00000270464.5_Silent_p.A4A	NM_024318.2	NP_077294	Q6PI73	LIRA6_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 6	4					immune system process (GO:0002376)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(20)|ovary(3)|skin(2)|urinary_tract(2)	38	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GGGCTGTGAGGGCGGGCGTCA	0.642													.|||	21	0.00419329	0.0	0.0115	5008	,	,		16212	0.0		0.0109	False		,,,				2504	0.002				p.A4A		.											.	LILRA6-24	0			c.C12T						.	G		10,4274		1,8,2133	70.0	65.0	67.0		12	-2.9	0.0	19	dbSNP_134	67	78,8456		10,58,4199	no	coding-synonymous	LILRA6	NM_024318.2		11,66,6332	AA,AG,GG		0.914,0.2334,0.6865		4/482	54746589	88,12730	2142	4267	6409	SO:0001819	synonymous_variant	79168	exon1			TGTGAGGGCGGGC	AF041262	CCDS42610.1	19q13.4	2013-01-11	2005-05-17	2005-05-17	ENSG00000244482	ENSG00000244482		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15495	protein-coding gene	gene with protein product			"""leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 6"""	LILRB6		10941842	Standard	NM_024318		Approved	ILT8, CD85b		Q6PI73	OTTHUMG00000066635	ENST00000396365.2:c.12C>T	19.37:g.54746589G>A		Somatic	206	2		WXS	Illumina GAIIx	Phase_I	487	13	NM_024318	0	0	0	0	0		Silent	SNP	ENST00000396365.2	37	CCDS42610.1																																																																																			G|0.995;A|0.005		0.642	LILRA6-003	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000313725.1	NM_024318	
GP6	51206	hgsc.bcm.edu	37	19	55525497	55525497	+	3'UTR	SNP	A	A	G	rs1671150	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr19:55525497A>G	ENST00000417454.1	-	0	1839				CTC-550B14.7_ENST00000593060.1_RNA|GP6_ENST00000333884.2_3'UTR|GP6_ENST00000310373.3_Missense_Mutation_p.F606L|CTC-550B14.7_ENST00000586845.1_RNA	NM_016363.4	NP_057447	Q9HCN6	GPVI_HUMAN	glycoprotein VI (platelet)						blood coagulation (GO:0007596)|enzyme linked receptor protein signaling pathway (GO:0007167)|leukocyte migration (GO:0050900)|platelet activation (GO:0030168)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|tetraspanin-enriched microdomain (GO:0097197)	collagen binding (GO:0005518)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			NS(2)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19			BRCA - Breast invasive adenocarcinoma(297;0.156)	GBM - Glioblastoma multiforme(193;0.0515)		tttgagacaaagtcaggcttc	0.478													G|||	3639	0.726637	0.5325	0.8242	5008	,	,		18456	0.8125		0.8459	False		,,,				2504	0.7086				p.F606L		.											.	GP6-92	0			c.T1816C						.	G	,LEU/PHE	2061,985		678,705,140	2.0	2.0	2.0		,1816	-0.5	0.0	19	dbSNP_89	2	5295,789		2317,661,64	no	utr-3,missense	GP6	NM_016363.4,NM_001083899.1	,22	2995,1366,204	GG,GA,AA		12.9684,32.3375,19.4304	,benign	,606/621	55525497	7356,1774	1523	3042	4565	SO:0001624	3_prime_UTR_variant	51206	exon8			AGACAAAGTCAGG	AB035073	CCDS42626.1, CCDS46184.1, CCDS58678.1	19q13.4	2013-01-29			ENSG00000088053	ENSG00000088053		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14388	protein-coding gene	gene with protein product		605546				11027634	Standard	NM_001083899		Approved	GPVI	uc002qil.3	Q9HCN6	OTTHUMG00000159709	ENST00000417454.1:c.*792T>C	19.37:g.55525497A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_001083899	0	0	0	0	0	Q9HCN7|Q9UIF2	Missense_Mutation	SNP	ENST00000417454.1	37	CCDS46184.1	1686	0.771978021978022	272	0.5528455284552846	309	0.8535911602209945	471	0.8234265734265734	634	0.8364116094986808	a	0	-2.609384	0.00121	0.676625	0.870316	ENSG00000088053	ENST00000310373	T	0.39592	1.07	0.235	-0.47	0.12131	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.47799	-0.9089	6	0.02654	T	1	.	.	.	.	rs1671150;rs17451417;rs52793608;rs1671150	606	Q9HCN6-3	.	L	606	ENSP00000308782:F606L	ENSP00000308782:F606L	F	-	1	0	GP6	60217309	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	-1.849000	0.01672	-1.921000	0.01068	-1.939000	0.00497	TTT	A|0.233;G|0.767		0.478	GP6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000357006.1		
SSC5D	284297	hgsc.bcm.edu	37	19	56002197	56002197	+	Silent	SNP	C	C	T			TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr19:56002197C>T	ENST00000389623.6	+	6	668	c.645C>T	c.(643-645)caC>caT	p.H215H	SSC5D_ENST00000587166.1_Silent_p.H215H	NM_001144950.1	NP_001138422.1	A1L4H1	SRCRL_HUMAN	scavenger receptor cysteine rich family, 5 domains	215	SRCR 2. {ECO:0000255|PROSITE- ProRule:PRU00196}.				defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterial lipoprotein (GO:0042494)|innate immune response (GO:0045087)|multicellular organismal development (GO:0007275)|negative regulation of interleukin-8 secretion (GO:2000483)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|intracellular (GO:0005622)|membrane (GO:0016020)	extracellular matrix binding (GO:0050840)|fibronectin binding (GO:0001968)|laminin binding (GO:0043236)|scavenger receptor activity (GO:0005044)			NS(1)|breast(1)|skin(2)	4						AGGTCTGGCACGGCGGGCGCT	0.726																																					p.H215H		.											.	.	0			c.C645T						.						3.0	5.0	4.0					19																	56002197		588	1444	2032	SO:0001819	synonymous_variant	284297	exon6			CTGGCACGGCGGG		CCDS46196.1, CCDS59424.1	19q13.42	2014-07-09	2014-07-09		ENSG00000179954	ENSG00000179954			26641	protein-coding gene	gene with protein product	"""soluble scavenger with 5 domains"""		"""scavenger receptor cysteine rich domain containing (5 domains)"""			19535143	Standard	NM_001144950		Approved	FLJ35258	uc002qlg.4	A1L4H1		ENST00000389623.6:c.645C>T	19.37:g.56002197C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	31	23	NM_001195267	0	0	0	0	0	B5MDQ5|C7S7T9|C7S7U0|K7EP70	Silent	SNP	ENST00000389623.6	37	CCDS46196.1																																																																																			.		0.726	SSC5D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453345.2	XM_001718392	
PLEKHH2	130271	ucsc.edu;bcgsc.ca	37	2	43931138	43931138	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr2:43931138G>T	ENST00000282406.4	+	9	1779	c.1669G>T	c.(1669-1671)Gta>Tta	p.V557L		NM_172069.3	NP_742066.2	Q8IVE3	PKHH2_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 2	557					negative regulation of actin filament depolymerization (GO:0030835)	cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	actin binding (GO:0003779)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(24)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	56		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				AATTTATGCTGTAGCCAAATC	0.348																																					p.V557L		.											.	PLEKHH2-92	0			c.G1669T						.						102.0	102.0	102.0					2																	43931138		2203	4300	6503	SO:0001583	missense	130271	exon9			TATGCTGTAGCCA	AB095948	CCDS1812.1	2p22	2013-01-10			ENSG00000152527	ENSG00000152527		"""Pleckstrin homology (PH) domain containing"""	30506	protein-coding gene	gene with protein product		612723					Standard	NM_172069		Approved	KIAA2028, PLEKHH1L	uc010yny.2	Q8IVE3	OTTHUMG00000128657	ENST00000282406.4:c.1669G>T	2.37:g.43931138G>T	ENSP00000282406:p.Val557Leu	Somatic	35	0		WXS	Illumina GAIIx	Phase_I	41	4	NM_172069	0	0	1	1	0	Q5JPJ6|Q6P4Q1|Q8N3Q3	Missense_Mutation	SNP	ENST00000282406.4	37	CCDS1812.1	.	.	.	.	.	.	.	.	.	.	G	16.57	3.159195	0.57368	.	.	ENSG00000152527	ENST00000282406	D	0.81821	-1.54	5.11	5.11	0.69529	.	0.071090	0.56097	D	0.000030	D	0.82761	0.5107	M	0.61703	1.905	0.54753	D	0.999986	P;D	0.57571	0.556;0.98	B;P	0.51806	0.285;0.68	D	0.83671	0.0166	10	0.52906	T	0.07	-21.4834	12.2813	0.54765	0.0786:0.0:0.9214:0.0	.	557;557	Q8IVE3;Q8IVE3-3	PKHH2_HUMAN;.	L	557	ENSP00000282406:V557L	ENSP00000282406:V557L	V	+	1	0	PLEKHH2	43784642	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.000000	0.76290	2.530000	0.85305	0.655000	0.94253	GTA	.		0.348	PLEKHH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250537.1	NM_172069	
TSPYL6	388951	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	54482557	54482557	+	Silent	SNP	G	G	T			TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr2:54482557G>T	ENST00000317802.7	-	1	852	c.732C>A	c.(730-732)atC>atA	p.I244I	ACYP2_ENST00000303536.4_Intron|ACYP2_ENST00000607452.1_Intron|ACYP2_ENST00000394666.3_Intron|ACYP2_ENST00000606865.1_Intron	NM_001003937.2	NP_001003937.2	Q8N831	TSYL6_HUMAN	TSPY-like 6	244					nucleosome assembly (GO:0006334)	nucleus (GO:0005634)				NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(1)|ovary(1)|skin(1)|stomach(2)	20						TATTGCGAATGATGTCATTCC	0.537																																					p.I244I		.											.	TSPYL6-90	0			c.C732A						.						62.0	64.0	64.0					2																	54482557		2117	4258	6375	SO:0001819	synonymous_variant	388951	exon1			GCGAATGATGTCA	AK097417	CCDS42682.1	2p16.3	2007-10-22			ENSG00000178021	ENSG00000178021			14521	protein-coding gene	gene with protein product							Standard	NM_001003937		Approved		uc002rxr.2	Q8N831	OTTHUMG00000151823	ENST00000317802.7:c.732C>A	2.37:g.54482557G>T		Somatic	90	0		WXS	Illumina GAIIx	Phase_I	72	5	NM_001003937	0	0	0	0	0	Q6NUJ3	Silent	SNP	ENST00000317802.7	37	CCDS42682.1																																																																																			.		0.537	TSPYL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324069.3	XM_371494	
SLC1A4	6509	broad.mit.edu	37	2	65217143	65217143	+	Silent	SNP	C	C	A	rs561935539		TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr2:65217143C>A	ENST00000234256.3	+	1	609	c.366C>A	c.(364-366)ggC>ggA	p.G122G	SLC1A4_ENST00000531327.1_Intron|SLC1A4_ENST00000493121.1_Intron	NM_003038.4	NP_003029.2	P43007	SATT_HUMAN	solute carrier family 1 (glutamate/neutral amino acid transporter), member 4	122					amino acid transport (GO:0006865)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|cognition (GO:0050890)|glutamine transport (GO:0006868)|hydroxyproline transport (GO:0034589)|ion transport (GO:0006811)|L-alanine transport (GO:0015808)|L-cystine transport (GO:0015811)|L-serine transport (GO:0015825)|proline transmembrane transport (GO:0035524)|proline transport (GO:0015824)|synaptic transmission, glutamatergic (GO:0035249)|threonine transport (GO:0015826)|transmembrane transport (GO:0055085)	cell surface (GO:0009986)|centrosome (GO:0005813)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intermediate filament (GO:0005882)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)|L-alanine transmembrane transporter activity (GO:0015180)|L-cystine transmembrane transporter activity (GO:0015184)|L-glutamine transmembrane transporter activity (GO:0015186)|L-hydroxyproline transmembrane transporter activity (GO:0034590)|L-proline transmembrane transporter activity (GO:0015193)|L-serine transmembrane transporter activity (GO:0015194)|L-threonine transmembrane transporter activity (GO:0015195)|sodium:dicarboxylate symporter activity (GO:0017153)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|pancreas(1)|prostate(1)|urinary_tract(1)	13					L-Alanine(DB00160)	CCTACTTTGGCCTCACCACAC	0.682																																					p.G122G		.											.	SLC1A4-91	0			c.C366A						.						16.0	18.0	17.0					2																	65217143		2203	4300	6503	SO:0001819	synonymous_variant	6509	exon1			CTTTGGCCTCACC		CCDS1879.1, CCDS54362.1	2p15-p13	2013-05-22			ENSG00000115902	ENSG00000115902		"""Solute carriers"""	10942	protein-coding gene	gene with protein product	"""alanine/serine/cysteine/threonine transporter"""	600229				7896285, 8910405	Standard	NM_003038		Approved	SATT, ASCT1	uc010yqa.2	P43007	OTTHUMG00000129537	ENST00000234256.3:c.366C>A	2.37:g.65217143C>A		Somatic	16	0		WXS	Illumina GAIIx	Phase_I	63	4	NM_003038	0	0	4	5	1	B7Z3C0|D6W5F0	Silent	SNP	ENST00000234256.3	37	CCDS1879.1																																																																																			.		0.682	SLC1A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251726.2	NM_003038	
CAPG	822	bcgsc.ca	37	2	85628745	85628745	+	Silent	SNP	C	C	T	rs2229669	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr2:85628745C>T	ENST00000409921.1	-	4	324	c.258G>A	c.(256-258)acG>acA	p.T86T	CAPG_ENST00000263867.4_Silent_p.T86T|CAPG_ENST00000483659.1_5'UTR|CAPG_ENST00000409670.1_Silent_p.T86T|CAPG_ENST00000409724.1_Silent_p.T86T			Q9BPX3	CND3_HUMAN	capping protein (actin filament), gelsolin-like	0					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(6)	11						CTCCCAGCAGCGTGTTGAGGT	0.642													C|||	265	0.0529153	0.0809	0.0461	5008	,	,		16368	0.006		0.0656	False		,,,				2504	0.0552				p.T86T		.											.	CAPG-204	0			c.G258A						.	C		353,4053	182.2+/-210.1	12,329,1862	52.0	52.0	52.0		258	-0.8	1.0	2	dbSNP_98	52	585,8015	156.4+/-210.3	17,551,3732	no	coding-synonymous	CAPG	NM_001747.2		29,880,5594	TT,TC,CC		6.8023,8.0118,7.2121		86/349	85628745	938,12068	2203	4300	6503	SO:0001819	synonymous_variant	822	exon4			CAGCAGCGTGTTG	M94345	CCDS1974.1, CCDS58715.1	2p11.2	2008-06-04			ENSG00000042493	ENSG00000042493			1474	protein-coding gene	gene with protein product	"""macrophage capping protein"""	153615		AFCP		1322908, 12754261	Standard	NM_001747		Approved	MCP	uc010fgi.2	P40121	OTTHUMG00000130183	ENST00000409921.1:c.258G>A	2.37:g.85628745C>T		Somatic	44	0		WXS	Illumina GAIIx	Phase_I	106	5	NM_001256140	0	0	33	33	0	Q3MJE0|Q96SV9|Q9BUR3|Q9BVY1|Q9H914|Q9H9Z6|Q9HBI9	Silent	SNP	ENST00000409921.1	37	CCDS58715.1																																																																																			C|0.941;T|0.059		0.642	CAPG-004	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000329383.1	NM_001747	
SOWAHC	65124	hgsc.bcm.edu	37	2	110372192	110372192	+	Silent	SNP	A	A	G	rs6594048		TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr2:110372192A>G	ENST00000356454.3	+	1	282	c.126A>G	c.(124-126)ctA>ctG	p.L42L	SEPT10_ENST00000415095.1_5'Flank|SEPT10_ENST00000545389.1_5'Flank|SEPT10_ENST00000397714.2_5'Flank|SEPT10_ENST00000437928.1_5'Flank|SEPT10_ENST00000397712.2_5'Flank|SEPT10_ENST00000356688.4_5'Flank|SEPT10_ENST00000334001.6_5'Flank	NM_023016.3	NP_075392.2	Q53LP3	SWAHC_HUMAN	sosondowah ankyrin repeat domain family member C	42																	GGGGCGCCCTAGGCGGCGAAC	0.771													G|||	5008	1.0	1.0	1.0	5008	,	,		6158	1.0		1.0	False		,,,				2504	1.0				p.L42L		.											.	.	0			c.A126G						.						1.0	2.0	2.0					2																	110372192		1239	2477	3716	SO:0001819	synonymous_variant	65124	exon1			CGCCCTAGGCGGC	AK023346	CCDS33270.1	2q13	2013-01-10	2012-01-12	2012-01-12	ENSG00000198142	ENSG00000198142		"""Ankyrin repeat domain containing"""	26149	protein-coding gene	gene with protein product			"""ankyrin repeat domain 57"""	C2orf26, ANKRD57		22234889	Standard	NM_023016		Approved	FLJ21870	uc002tfb.3	Q53LP3	OTTHUMG00000153219	ENST00000356454.3:c.126A>G	2.37:g.110372192A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_023016	0	0	0	0	0	Q8NE15|Q9H6U1	Silent	SNP	ENST00000356454.3	37	CCDS33270.1																																																																																			A|0.029;G|0.971		0.771	SOWAHC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330168.1	NM_023016	
DYNC1I2	1781	bcgsc.ca	37	2	172585298	172585298	+	Silent	SNP	T	T	C	rs62184168		TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr2:172585298T>C	ENST00000397119.3	+	14	1496	c.1329T>C	c.(1327-1329)gaT>gaC	p.D443D	DYNC1I2_ENST00000358002.6_Silent_p.D435D|DYNC1I2_ENST00000508530.1_Silent_p.D417D|DYNC1I2_ENST00000409773.1_Silent_p.D443D|DYNC1I2_ENST00000409317.1_Silent_p.D437D|DYNC1I2_ENST00000263811.4_Silent_p.D437D|DYNC1I2_ENST00000410079.3_Silent_p.D435D|DYNC1I2_ENST00000409197.1_Silent_p.D417D|DYNC1I2_ENST00000340296.4_Silent_p.D417D|DYNC1I2_ENST00000409453.1_Silent_p.D443D|DYNC1I2_ENST00000534253.2_Silent_p.D443D	NM_001378.1	NP_001369.1	Q13409	DC1I2_HUMAN	dynein, cytoplasmic 1, intermediate chain 2	443					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|G2/M transition of mitotic cell cycle (GO:0000086)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|transport (GO:0006810)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|microtubule (GO:0005874)|vesicle (GO:0031982)	microtubule motor activity (GO:0003777)			breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(2)|ovary(1)	15			OV - Ovarian serous cystadenocarcinoma(117;0.198)			CTGTTGGAGATGTCAACAACT	0.398																																					p.D443D		.											.	DYNC1I2-91	0			c.T1329C						.						67.0	65.0	65.0					2																	172585298		1866	4092	5958	SO:0001819	synonymous_variant	1781	exon14			TGGAGATGTCAAC	AK055491	CCDS46450.1, CCDS63054.1, CCDS63056.1, CCDS63057.1	2q31.1	2013-01-10	2005-11-24	2005-11-24	ENSG00000077380	ENSG00000077380		"""Cytoplasmic dyneins"", ""WD repeat domain containing"""	2964	protein-coding gene	gene with protein product		603331	"""dynein, cytoplasmic, intermediate polypeptide 2"""	DNCI2		10049579, 16260502	Standard	NM_001378		Approved		uc002uha.2	Q13409	OTTHUMG00000154061	ENST00000397119.3:c.1329T>C	2.37:g.172585298T>C		Somatic	322	12		WXS	Illumina GAIIx	Phase_I	355	22	NM_001378	0	0	112	112	0	B7ZA04|D3DPD4|D3DPD5|D3DPD6|Q32LY9|Q53S84|Q5BJF8|Q7Z4X1|Q96NG7|Q96S87|Q9BXZ5|Q9NT58	Silent	SNP	ENST00000397119.3	37	CCDS46450.1																																																																																			T|0.333;C|0.667		0.398	DYNC1I2-001	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333683.2	NM_001378	
SF3B1	23451	bcgsc.ca	37	2	198257795	198257795	+	Silent	SNP	T	T	C	rs4685	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr2:198257795T>C	ENST00000335508.6	-	24	3748	c.3657A>G	c.(3655-3657)gtA>gtG	p.V1219V		NM_012433.2	NP_036565.2	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1, 155kDa	1219					anterior/posterior pattern specification (GO:0009952)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)			NS(35)|breast(10)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(524)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|pancreas(4)|prostate(6)|salivary_gland(1)|skin(4)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	633			OV - Ovarian serous cystadenocarcinoma(117;0.246)			ATGTCTCAAATACATTGGGCC	0.443			Mis		myelodysplastic syndrome								C|||	3598	0.71845	0.8835	0.6311	5008	,	,		18666	0.5218		0.7256	False		,,,				2504	0.7526				p.V1219V		.		Dom	yes		2	2q33.1	23451	"""splicing factor 3b, subunit 1, 155kDa"""		L	.	SF3B1-140	0			c.A3657G						.	C		3679,727	301.5+/-286.9	1539,601,63	119.0	106.0	110.0		3657	3.2	1.0	2	dbSNP_52	110	5893,2707	433.8+/-357.5	2050,1793,457	no	coding-synonymous	SF3B1	NM_012433.2		3589,2394,520	CC,CT,TT		31.4767,16.5002,26.4032		1219/1305	198257795	9572,3434	2203	4300	6503	SO:0001819	synonymous_variant	23451	exon24			CTCAAATACATTG	AF054284	CCDS33356.1, CCDS46479.1	2q33.1	2014-09-17	2002-08-29		ENSG00000115524	ENSG00000115524			10768	protein-coding gene	gene with protein product		605590	"""splicing factor 3b, subunit 1, 155kD"""			9585501	Standard	XM_005246428		Approved	SAP155, SF3b155, PRPF10, Prp10, Hsh155	uc002uue.3	O75533	OTTHUMG00000154447	ENST00000335508.6:c.3657A>G	2.37:g.198257795T>C		Somatic	351	1		WXS	Illumina GAIIx	Phase_I	301	10	NM_012433	0	0	153	153	0	E9PCH3	Silent	SNP	ENST00000335508.6	37	CCDS33356.1	1551	0.7101648351648352	431	0.8760162601626016	230	0.6353591160220995	341	0.5961538461538461	549	0.7242744063324539	C	8.941	0.965705	0.18583	0.834998	0.685233	ENSG00000115524	ENST00000424674	.	.	.	5.39	3.21	0.36854	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.09310	P	1.0	.	.	.	.	.	.	T	0.13335	-1.0513	3	.	.	.	.	9.175	0.37107	0.1222:0.7312:0.0:0.1466	rs4685;rs3184562;rs4685	.	.	.	C	235	.	.	Y	-	2	0	SF3B1	197966040	0.983000	0.35010	1.000000	0.80357	0.986000	0.74619	0.206000	0.17375	0.660000	0.30964	-0.320000	0.08662	TAT	T|0.202;G|0.145;C|0.593;A|0.059		0.443	SF3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335245.2		
SMARCAL1	50485	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	217341854	217341854	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr2:217341854G>A	ENST00000357276.4	+	16	2780	c.2450G>A	c.(2449-2451)cGc>cAc	p.R817H	AC098820.3_ENST00000453157.1_RNA|SMARCAL1_ENST00000358207.5_Missense_Mutation_p.R817H	NM_014140.3	NP_054859.2	Q9NZC9	SMAL1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a-like 1	817	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA metabolic process (GO:0006259)|DNA strand renaturation (GO:0000733)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|replication fork processing (GO:0031297)	nucleus (GO:0005634)|site of double-strand break (GO:0035861)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(10)|liver(1)|lung(15)|ovary(3)|prostate(1)|skin(1)	42		Renal(323;0.0458)		Epithelial(149;9.48e-06)|all cancers(144;0.000621)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0111)		GCTGAGGACCGCGTGCACCGC	0.567									Schimke Immuno-Osseous Dysplasia																												p.R817H		.											.	SMARCAL1-293	0			c.G2450A						.						92.0	73.0	79.0					2																	217341854		2202	4298	6500	SO:0001583	missense	50485	exon16	Familial Cancer Database	SIOD	AGGACCGCGTGCA	AF210833	CCDS2403.1	2q35	2014-09-17			ENSG00000138375	ENSG00000138375			11102	protein-coding gene	gene with protein product	"""HepA-related protein"", ""ATP-driven annealing helicase"""	606622				10713074, 10857751, 18974355	Standard	NM_014140		Approved	HHARP, HARP	uc002vgd.4	Q9NZC9	OTTHUMG00000133055	ENST00000357276.4:c.2450G>A	2.37:g.217341854G>A	ENSP00000349823:p.Arg817His	Somatic	98	0		WXS	Illumina GAIIx	Phase_I	86	76	NM_014140	0	1	1	23	21	A6NEH0|Q53R00|Q96AY1|Q9NXQ5|Q9UFH3|Q9UI93	Missense_Mutation	SNP	ENST00000357276.4	37	CCDS2403.1	.	.	.	.	.	.	.	.	.	.	G	33	5.272349	0.95429	.	.	ENSG00000138375	ENST00000357276;ENST00000358207;ENST00000392128	D;D;D	0.99143	-5.48;-5.48;-5.48	4.71	4.71	0.59529	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.99645	0.9869	H	0.99312	4.51	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97244	0.9893	10	0.87932	D	0	-21.4328	16.8405	0.85967	0.0:0.0:1.0:0.0	.	817	Q9NZC9	SMAL1_HUMAN	H	817;817;659	ENSP00000349823:R817H;ENSP00000350940:R817H;ENSP00000375974:R659H	ENSP00000349823:R817H	R	+	2	0	SMARCAL1	217050099	1.000000	0.71417	0.996000	0.52242	0.947000	0.59692	9.507000	0.97996	2.455000	0.83008	0.655000	0.94253	CGC	.		0.567	SMARCAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256671.2		
TM4SF20	79853	bcgsc.ca	37	2	228243905	228243905	+	Missense_Mutation	SNP	G	G	A	rs7574414	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr2:228243905G>A	ENST00000304568.3	-	1	117	c.80C>T	c.(79-81)gCg>gTg	p.A27V		NM_024795.3	NP_079071.2	Q53R12	T4S20_HUMAN	transmembrane 4 L six family member 20	27			A -> V (in dbSNP:rs7574414). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.A27V(1)		breast(1)|kidney(2)|large_intestine(1)|lung(4)|stomach(2)	10		Renal(207;0.025)|all_lung(227;0.123)|Esophageal squamous(248;0.23)|all_hematologic(139;0.248)		Epithelial(121;3.8e-11)|all cancers(144;2.57e-08)|Lung(261;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0115)		TAGAGGTATCGCATTGAGAAC	0.483													G|||	530	0.105831	0.0068	0.0807	5008	,	,		19698	0.1935		0.1511	False		,,,				2504	0.1207				p.A27V		.											.	TM4SF20-514	1	Substitution - Missense(1)	stomach(1)	c.C80T						.	G	VAL/ALA	115,4291	87.8+/-126.4	0,115,2088	127.0	125.0	126.0		80	1.8	0.0	2	dbSNP_116	126	1209,7391	244.2+/-273.5	81,1047,3172	yes	missense	TM4SF20	NM_024795.3	64	81,1162,5260	AA,AG,GG		14.0581,2.6101,10.1799	benign	27/230	228243905	1324,11682	2203	4300	6503	SO:0001583	missense	79853	exon1			GGTATCGCATTGA	AK026453	CCDS2466.1	2q36.3	2008-02-05			ENSG00000168955	ENSG00000168955			26230	protein-coding gene	gene with protein product		615404				12975309	Standard	NM_024795		Approved	FLJ22800, TCCE518	uc002vpb.2	Q53R12	OTTHUMG00000133187	ENST00000304568.3:c.80C>T	2.37:g.228243905G>A	ENSP00000303028:p.Ala27Val	Somatic	98	0		WXS	Illumina GAIIx	Phase_I	94	5	NM_024795	0	0	0	0	0	B2RP42|Q5U609|Q6UWS1|Q9H5X9	Missense_Mutation	SNP	ENST00000304568.3	37	CCDS2466.1	275	0.1259157509157509	4	0.008130081300813009	32	0.08839779005524862	114	0.1993006993006993	125	0.16490765171503957	G	3.354	-0.131890	0.06753	0.026101	0.140581	ENSG00000168955	ENST00000304568	T	0.26518	1.73	5.77	1.78	0.24846	.	0.883848	0.09827	N	0.750664	T	0.00012	0.0000	L	0.41356	1.27	0.80722	P	0.0	D	0.53462	0.96	B	0.37047	0.24	T	0.10917	-1.0609	9	0.06891	T	0.86	-3.7897	5.2601	0.15567	0.1976:0.3385:0.4638:0.0	rs7574414;rs7574414	27	Q53R12	T4S20_HUMAN	V	27	ENSP00000303028:A27V	ENSP00000303028:A27V	A	-	2	0	TM4SF20	227952149	0.000000	0.05858	0.034000	0.17996	0.029000	0.11900	0.089000	0.15002	0.711000	0.32018	0.591000	0.81541	GCG	G|0.889;A|0.111		0.483	TM4SF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256896.2	NM_024795	
MKKS	8195	bcgsc.ca	37	20	10386013	10386013	+	Missense_Mutation	SNP	C	C	A	rs1545	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr20:10386013C>A	ENST00000347364.3	-	6	2357	c.1595G>T	c.(1594-1596)gGc>gTc	p.G532V	MKKS_ENST00000399054.2_Missense_Mutation_p.G532V	NM_170784.2	NP_740754.1	Q9NPJ1	MKKS_HUMAN	McKusick-Kaufman syndrome	532			G -> V (in dbSNP:rs1545). {ECO:0000269|PubMed:15483080, ECO:0000269|PubMed:15666242, ECO:0000269|PubMed:15770229}.		artery smooth muscle contraction (GO:0014824)|brain morphogenesis (GO:0048854)|cartilage development (GO:0051216)|cerebral cortex development (GO:0021987)|chaperone-mediated protein complex assembly (GO:0051131)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|convergent extension involved in gastrulation (GO:0060027)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|determination of left/right symmetry (GO:0007368)|fat cell differentiation (GO:0045444)|gonad development (GO:0008406)|heart development (GO:0007507)|heart looping (GO:0001947)|hippocampus development (GO:0021766)|intracellular transport (GO:0046907)|melanosome transport (GO:0032402)|negative regulation of appetite by leptin-mediated signaling pathway (GO:0038108)|negative regulation of blood pressure (GO:0045776)|negative regulation of gene expression (GO:0010629)|nonmotile primary cilium assembly (GO:0035058)|photoreceptor cell maintenance (GO:0045494)|pigment granule aggregation in cell center (GO:0051877)|positive regulation of multicellular organism growth (GO:0040018)|protein folding (GO:0006457)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|sensory perception of smell (GO:0007608)|social behavior (GO:0035176)|spermatid development (GO:0007286)|striatum development (GO:0021756)|vasodilation (GO:0042311)|visual perception (GO:0007601)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|motile cilium (GO:0031514)	ATP binding (GO:0005524)|RNA polymerase II repressing transcription factor binding (GO:0001103)|unfolded protein binding (GO:0051082)			kidney(2)|large_intestine(2)|lung(8)|prostate(1)|skin(1)|stomach(2)	16						GCTGGCTGAGCCCACAGCTTC	0.463													C|||	965	0.192692	0.2148	0.1153	5008	,	,		18434	0.256		0.0875	False		,,,				2504	0.2607				p.G532V	Melanoma(79;1979 2212 6640)	.											.	MKKS-90	0			c.G1595T						.	C	VAL/GLY,VAL/GLY	757,3649	309.4+/-291.0	67,623,1513	75.0	70.0	72.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	1595,1595	-1.6	0.0	20	dbSNP_36	72	962,7638	211.4+/-252.0	64,834,3402	yes	missense,missense	MKKS	NM_018848.2,NM_170784.1	109,109	131,1457,4915	AA,AC,CC		11.186,17.1811,13.217	benign,benign	532/571,532/571	10386013	1719,11287	2203	4300	6503	SO:0001583	missense	8195	exon6			GCTGAGCCCACAG	AF221993	CCDS13111.1	20p12	2013-01-08			ENSG00000125863	ENSG00000125863		"""Heat Shock Proteins / Chaperonins"""	7108	protein-coding gene	gene with protein product		604896		BBS6		9467007	Standard	NR_072977		Approved		uc002wnu.2	Q9NPJ1	OTTHUMG00000031868	ENST00000347364.3:c.1595G>T	20.37:g.10386013C>A	ENSP00000246062:p.Gly532Val	Somatic	194	0		WXS	Illumina GAIIx	Phase_I	169	8	NM_170784	0	0	22	22	0	A8K7B0|D3DW18	Missense_Mutation	SNP	ENST00000347364.3	37	CCDS13111.1	378	0.17307692307692307	126	0.25609756097560976	48	0.13259668508287292	134	0.23426573426573427	70	0.09234828496042216	C	8.788	0.929785	0.18131	0.171811	0.11186	ENSG00000125863	ENST00000347364;ENST00000399054	D;D	0.90324	-2.65;-2.65	5.83	-1.62	0.08372	.	1.310880	0.04361	N	0.357467	T	0.00073	0.0002	L	0.57536	1.79	0.51767	P	6.60000000000105E-5	B	0.26120	0.142	B	0.25291	0.059	T	0.22941	-1.0202	9	0.59425	D	0.04	-30.0978	4.7613	0.13110	0.1185:0.1156:0.1189:0.647	rs1545;rs2206657;rs6108551;rs16990979;rs17845867;rs17858842;rs52789776;rs58556060;rs1545	532	Q9NPJ1	MKKS_HUMAN	V	532	ENSP00000246062:G532V;ENSP00000382008:G532V	ENSP00000246062:G532V	G	-	2	0	MKKS	10334013	0.000000	0.05858	0.000000	0.03702	0.478000	0.33099	-0.375000	0.07475	-0.485000	0.06754	0.655000	0.94253	GGC	C|0.839;A|0.161		0.463	MKKS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077991.3		
MKKS	8195	bcgsc.ca	37	20	10386059	10386059	+	Missense_Mutation	SNP	G	G	A	rs1547	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr20:10386059G>A	ENST00000347364.3	-	6	2311	c.1549C>T	c.(1549-1551)Cgt>Tgt	p.R517C	MKKS_ENST00000399054.2_Missense_Mutation_p.R517C	NM_170784.2	NP_740754.1	Q9NPJ1	MKKS_HUMAN	McKusick-Kaufman syndrome	517			R -> C (in dbSNP:rs1547). {ECO:0000269|PubMed:10802661, ECO:0000269|PubMed:15483080, ECO:0000269|PubMed:15666242, ECO:0000269|PubMed:15770229}.		artery smooth muscle contraction (GO:0014824)|brain morphogenesis (GO:0048854)|cartilage development (GO:0051216)|cerebral cortex development (GO:0021987)|chaperone-mediated protein complex assembly (GO:0051131)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|convergent extension involved in gastrulation (GO:0060027)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|determination of left/right symmetry (GO:0007368)|fat cell differentiation (GO:0045444)|gonad development (GO:0008406)|heart development (GO:0007507)|heart looping (GO:0001947)|hippocampus development (GO:0021766)|intracellular transport (GO:0046907)|melanosome transport (GO:0032402)|negative regulation of appetite by leptin-mediated signaling pathway (GO:0038108)|negative regulation of blood pressure (GO:0045776)|negative regulation of gene expression (GO:0010629)|nonmotile primary cilium assembly (GO:0035058)|photoreceptor cell maintenance (GO:0045494)|pigment granule aggregation in cell center (GO:0051877)|positive regulation of multicellular organism growth (GO:0040018)|protein folding (GO:0006457)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|sensory perception of smell (GO:0007608)|social behavior (GO:0035176)|spermatid development (GO:0007286)|striatum development (GO:0021756)|vasodilation (GO:0042311)|visual perception (GO:0007601)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|motile cilium (GO:0031514)	ATP binding (GO:0005524)|RNA polymerase II repressing transcription factor binding (GO:0001103)|unfolded protein binding (GO:0051082)	p.R517C(1)		kidney(2)|large_intestine(2)|lung(8)|prostate(1)|skin(1)|stomach(2)	16						AATGGACGACGTGTGCTTCTT	0.488													G|||	977	0.195088	0.2148	0.1153	5008	,	,		17834	0.2679		0.0875	False		,,,				2504	0.2607				p.R517C	Melanoma(79;1979 2212 6640)	.											.	MKKS-90	1	Substitution - Missense(1)	stomach(1)	c.C1549T						.	G	CYS/ARG,CYS/ARG	757,3649	309.7+/-291.2	67,623,1513	106.0	96.0	100.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	1549,1549	-2.8	0.0	20	dbSNP_36	100	962,7638	211.4+/-252.0	63,836,3401	yes	missense,missense	MKKS	NM_018848.2,NM_170784.1	180,180	130,1459,4914	AA,AG,GG		11.186,17.1811,13.217	benign,benign	517/571,517/571	10386059	1719,11287	2203	4300	6503	SO:0001583	missense	8195	exon6			GACGACGTGTGCT	AF221993	CCDS13111.1	20p12	2013-01-08			ENSG00000125863	ENSG00000125863		"""Heat Shock Proteins / Chaperonins"""	7108	protein-coding gene	gene with protein product		604896		BBS6		9467007	Standard	NR_072977		Approved		uc002wnu.2	Q9NPJ1	OTTHUMG00000031868	ENST00000347364.3:c.1549C>T	20.37:g.10386059G>A	ENSP00000246062:p.Arg517Cys	Somatic	128	1		WXS	Illumina GAIIx	Phase_I	135	7	NM_170784	0	0	24	24	0	A8K7B0|D3DW18	Missense_Mutation	SNP	ENST00000347364.3	37	CCDS13111.1	380	0.17399267399267399	126	0.25609756097560976	48	0.13259668508287292	136	0.23776223776223776	70	0.09234828496042216	G	5.015	0.188427	0.09547	0.171811	0.11186	ENSG00000125863	ENST00000347364;ENST00000399054	D;D	0.86230	-2.09;-2.09	5.77	-2.76	0.05896	.	1.530140	0.02937	N	0.139949	T	0.00039	0.0001	N	0.12182	0.205	0.80722	P	0.0	B	0.02656	0.0	B	0.04013	0.001	T	0.09862	-1.0655	9	0.38643	T	0.18	-32.588	9.4895	0.38951	0.6582:0.1114:0.2304:0.0	rs1547;rs4532003;rs17852624;rs58230487;rs1547	517	Q9NPJ1	MKKS_HUMAN	C	517	ENSP00000246062:R517C;ENSP00000382008:R517C	ENSP00000246062:R517C	R	-	1	0	MKKS	10334059	0.000000	0.05858	0.000000	0.03702	0.024000	0.10985	-0.074000	0.11450	-0.415000	0.07484	-0.150000	0.13652	CGT	G|0.836;A|0.164		0.488	MKKS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077991.3		
SSTR4	6754	bcgsc.ca	37	20	23016970	23016970	+	Missense_Mutation	SNP	T	T	G	rs3746726	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr20:23016970T>G	ENST00000255008.3	+	1	914	c.850T>G	c.(850-852)Ttc>Gtc	p.F284V	RP4-753D10.3_ENST00000440921.1_RNA	NM_001052.2	NP_001043.2	P31391	SSR4_HUMAN	somatostatin receptor 4	284			F -> V (in dbSNP:rs3746726). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:8483934, ECO:0000269|PubMed:8512564, ECO:0000269|Ref.5}.		arachidonic acid metabolic process (GO:0019369)|cell migration (GO:0016477)|cellular response to glucocorticoid stimulus (GO:0071385)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cAMP metabolic process (GO:0030815)|negative regulation of cell proliferation (GO:0008285)|positive regulation of MAPK cascade (GO:0043410)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|upper_aerodigestive_tract(1)	32	Colorectal(13;0.0518)|Lung NSC(19;0.0542)|all_lung(19;0.118)					GCTGAACCTCTTCGTGACCAG	0.557													T|||	1530	0.305511	0.2179	0.281	5008	,	,		18337	0.2351		0.3698	False		,,,				2504	0.4479				p.F284V	Esophageal Squamous(15;850 1104 16640)	.											.	SSTR4-522	0			c.T850G						.	T	VAL/PHE	1031,3375	359.9+/-315.0	134,763,1306	197.0	205.0	202.0		850	3.4	0.5	20	dbSNP_107	202	3321,5279	483.4+/-371.1	672,1977,1651	yes	missense	SSTR4	NM_001052.2	50	806,2740,2957	GG,GT,TT		38.6163,23.3999,33.4615	benign	284/389	23016970	4352,8654	2203	4300	6503	SO:0001583	missense	6754	exon1			AACCTCTTCGTGA		CCDS42856.1	20p11.21	2014-07-11			ENSG00000132671	ENSG00000132671		"""GPCR / Class A : Somatostatin receptors"""	11333	protein-coding gene	gene with protein product		182454				8483934	Standard	NM_001052		Approved		uc002wsr.2	P31391	OTTHUMG00000032054	ENST00000255008.3:c.850T>G	20.37:g.23016970T>G	ENSP00000255008:p.Phe284Val	Somatic	132	0		WXS	Illumina GAIIx	Phase_I	133	6	NM_001052	0	0	0	0	0	Q17RM1|Q17RM3|Q9UIY1	Missense_Mutation	SNP	ENST00000255008.3	37	CCDS42856.1	648	0.2967032967032967	113	0.22967479674796748	112	0.30939226519337015	148	0.25874125874125875	275	0.3627968337730871	T	7.979	0.750733	0.15778	0.233999	0.386163	ENSG00000132671	ENST00000255008	T	0.39406	1.08	3.36	3.36	0.38483	GPCR, rhodopsin-like superfamily (1);	0.090253	0.44483	U	0.000451	T	0.00012	0.0000	L	0.47190	1.495	0.37728	P	0.07484000000000002	B	0.11235	0.004	B	0.17098	0.017	T	0.38373	-0.9664	9	0.02654	T	1	.	6.6396	0.22901	0.0:0.1196:0.0:0.8804	rs3746726;rs60613961;rs3746726	284	P31391	SSR4_HUMAN	V	284	ENSP00000255008:F284V	ENSP00000255008:F284V	F	+	1	0	SSTR4	22964970	0.846000	0.29590	0.479000	0.27329	0.626000	0.37791	1.296000	0.33389	1.384000	0.46424	0.533000	0.62120	TTC	T|0.674;G|0.326		0.557	SSTR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078308.1		
SSTR4	6754	bcgsc.ca	37	20	23017017	23017017	+	Silent	SNP	T	T	C	rs2567609	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr20:23017017T>C	ENST00000255008.3	+	1	961	c.897T>C	c.(895-897)ctT>ctC	p.L299L	RP4-753D10.3_ENST00000440921.1_RNA	NM_001052.2	NP_001043.2	P31391	SSR4_HUMAN	somatostatin receptor 4	299					arachidonic acid metabolic process (GO:0019369)|cell migration (GO:0016477)|cellular response to glucocorticoid stimulus (GO:0071385)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cAMP metabolic process (GO:0030815)|negative regulation of cell proliferation (GO:0008285)|positive regulation of MAPK cascade (GO:0043410)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|upper_aerodigestive_tract(1)	32	Colorectal(13;0.0518)|Lung NSC(19;0.0542)|all_lung(19;0.118)					CCCTTATCCTTAGCTATGCCA	0.572													C|||	2415	0.482228	0.4107	0.4669	5008	,	,		18691	0.5258		0.4294	False		,,,				2504	0.5992				p.L299L	Esophageal Squamous(15;850 1104 16640)	.											.	SSTR4-522	0			c.T897C						.	C		1770,2636	625.8+/-394.6	379,1012,812	199.0	197.0	197.0		897	2.4	1.0	20	dbSNP_100	197	3925,4675	598.8+/-394.0	922,2081,1297	no	coding-synonymous	SSTR4	NM_001052.2		1301,3093,2109	CC,CT,TT		45.6395,40.1725,43.7875		299/389	23017017	5695,7311	2203	4300	6503	SO:0001819	synonymous_variant	6754	exon1			TATCCTTAGCTAT		CCDS42856.1	20p11.21	2014-07-11			ENSG00000132671	ENSG00000132671		"""GPCR / Class A : Somatostatin receptors"""	11333	protein-coding gene	gene with protein product		182454				8483934	Standard	NM_001052		Approved		uc002wsr.2	P31391	OTTHUMG00000032054	ENST00000255008.3:c.897T>C	20.37:g.23017017T>C		Somatic	153	1		WXS	Illumina GAIIx	Phase_I	156	7	NM_001052	0	0	0	0	0	Q17RM1|Q17RM3|Q9UIY1	Silent	SNP	ENST00000255008.3	37	CCDS42856.1																																																																																			T|0.514;C|0.486		0.572	SSTR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078308.1		
SSTR4	6754	bcgsc.ca	37	20	23017044	23017044	+	Silent	SNP	C	C	T	rs3746728	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr20:23017044C>T	ENST00000255008.3	+	1	988	c.924C>T	c.(922-924)ccC>ccT	p.P308P	RP4-753D10.3_ENST00000440921.1_RNA	NM_001052.2	NP_001043.2	P31391	SSR4_HUMAN	somatostatin receptor 4	308					arachidonic acid metabolic process (GO:0019369)|cell migration (GO:0016477)|cellular response to glucocorticoid stimulus (GO:0071385)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cAMP metabolic process (GO:0030815)|negative regulation of cell proliferation (GO:0008285)|positive regulation of MAPK cascade (GO:0043410)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|upper_aerodigestive_tract(1)	32	Colorectal(13;0.0518)|Lung NSC(19;0.0542)|all_lung(19;0.118)					GCGCCAACCCCATTCTCTATG	0.587													C|||	1548	0.309105	0.2315	0.2824	5008	,	,		18308	0.2351		0.3698	False		,,,				2504	0.4468				p.P308P	Esophageal Squamous(15;850 1104 16640)	.											.	SSTR4-522	0			c.C924T						.	C		1076,3328	370.0+/-319.4	145,786,1271	151.0	151.0	151.0		924	2.4	0.9	20	dbSNP_107	151	3312,5286	482.4+/-370.9	670,1972,1657	no	coding-synonymous	SSTR4	NM_001052.2		815,2758,2928	TT,TC,CC		38.5206,24.4323,33.7487		308/389	23017044	4388,8614	2202	4299	6501	SO:0001819	synonymous_variant	6754	exon1			CAACCCCATTCTC		CCDS42856.1	20p11.21	2014-07-11			ENSG00000132671	ENSG00000132671		"""GPCR / Class A : Somatostatin receptors"""	11333	protein-coding gene	gene with protein product		182454				8483934	Standard	NM_001052		Approved		uc002wsr.2	P31391	OTTHUMG00000032054	ENST00000255008.3:c.924C>T	20.37:g.23017044C>T		Somatic	157	1		WXS	Illumina GAIIx	Phase_I	148	7	NM_001052	0	0	0	0	0	Q17RM1|Q17RM3|Q9UIY1	Silent	SNP	ENST00000255008.3	37	CCDS42856.1																																																																																			C|0.669;T|0.331		0.587	SSTR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078308.1		
FRG1B	284802	bcgsc.ca	37	20	29628236	29628236	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr20:29628236G>C	ENST00000278882.3	+	6	618	c.238G>C	c.(238-240)Gct>Cct	p.A80P	FRG1B_ENST00000439954.2_Missense_Mutation_p.A85P|FRG1B_ENST00000358464.4_Missense_Mutation_p.A80P			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	80								p.A80P(8)		endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						GGGGAAAATGGCTTTGTTGGC	0.363																																					.		.											.	FRG1B-22	8	Substitution - Missense(8)	prostate(4)|kidney(4)	.						.																																			SO:0001583	missense	284802	.			AAAATGGCTTTGT			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.238G>C	20.37:g.29628236G>C	ENSP00000278882:p.Ala80Pro	Somatic	842	15		WXS	Illumina GAIIx	Phase_I	1002	53	.	0	0	0	0	0	C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	g	15.73	2.920277	0.52653	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.57595	0.39	2.08	2.08	0.27032	Actin cross-linking (1);	0.052409	0.85682	D	0.000000	T	0.68952	0.3057	.	.	.	0.80722	D	1	D;D	0.64830	0.994;0.988	D;D	0.85130	0.997;0.993	T	0.72766	-0.4194	9	0.87932	D	0	.	10.2211	0.43198	0.0:0.0:1.0:0.0	.	85;80	F5H5R5;Q9BZ01	.;FRG1B_HUMAN	P	80;85;80	ENSP00000408863:A85P	ENSP00000278882:A80P	A	+	1	0	FRG1B	28241897	1.000000	0.71417	1.000000	0.80357	0.334000	0.28698	8.494000	0.90477	1.475000	0.48197	0.423000	0.28283	GCT	.		0.363	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
ACTR5	79913	hgsc.bcm.edu	37	20	37377139	37377139	+	Silent	SNP	C	C	T	rs2254105	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr20:37377139C>T	ENST00000243903.4	+	1	55	c.18C>T	c.(16-18)ttC>ttT	p.F6F		NM_024855.3	NP_079131.3	Q9H9F9	ARP5_HUMAN	ARP5 actin-related protein 5 homolog (yeast)	6					DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|UV-damage excision repair (GO:0070914)	cytoplasm (GO:0005737)|Ino80 complex (GO:0031011)|nucleus (GO:0005634)				kidney(2)|large_intestine(2)|liver(1)|lung(5)|skin(2)	12		Myeloproliferative disorder(115;0.00878)				CGAACGTGTTCCCGTTCCGCG	0.756													C|||	1227	0.245008	0.205	0.2334	5008	,	,		10427	0.2679		0.2565	False		,,,				2504	0.272				p.F6F		.											.	ACTR5-90	0			c.C18T						.						3.0	4.0	4.0					20																	37377139		1470	2633	4103	SO:0001819	synonymous_variant	79913	exon1			CGTGTTCCCGTTC	AK022847	CCDS13308.1	20q12	2011-07-06	2001-11-28		ENSG00000101442	ENSG00000101442		"""INO80 complex subunits"""	14671	protein-coding gene	gene with protein product	"""INO80 complex subunit M"""		"""ARP5 (actin-related protein 5, yeast) homolog"""			16230350	Standard	NM_024855		Approved	FLJ12785, Arp5, INO80M	uc002xjd.2	Q9H9F9	OTTHUMG00000032456	ENST00000243903.4:c.18C>T	20.37:g.37377139C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_024855	0	0	0	0	0	Q86WF7|Q8IUY5|Q8N724|Q9BRN0|Q9BVB7	Silent	SNP	ENST00000243903.4	37	CCDS13308.1																																																																																			C|0.769;T|0.231		0.756	ACTR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079205.2	NM_024855	
OCSTAMP	128506	ucsc.edu;bcgsc.ca	37	20	45170556	45170556	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr20:45170556G>T	ENST00000279028.2	-	3	1071	c.1058C>A	c.(1057-1059)aCt>aAt	p.T353N		NM_080721.1	NP_542452.1	Q9BR26	OCSTP_HUMAN	osteoclast stimulatory transmembrane protein	353					cellular response to estrogen stimulus (GO:0071391)|cellular response to tumor necrosis factor (GO:0071356)|multinuclear osteoclast differentiation (GO:0072674)|positive regulation of macrophage fusion (GO:0034241)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of osteoclast proliferation (GO:0090290)	integral component of membrane (GO:0016021)				breast(1)|endometrium(1)	2						GCCCAGGACAGTGTATGCCAC	0.597																																					p.T353N		.											.	.	0			c.C1058A						.						9.0	11.0	10.0					20																	45170556		692	1590	2282	SO:0001583	missense	128506	exon3			AGGACAGTGTATG	AL034424	CCDS54468.1	20q13.12	2012-03-27	2012-03-27	2012-03-27	ENSG00000149635	ENSG00000149635			16116	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 123"""	C20orf123		18064667	Standard	NM_080721		Approved	dJ257E24.3	uc010zxu.2	Q9BR26	OTTHUMG00000032652	ENST00000279028.2:c.1058C>A	20.37:g.45170556G>T	ENSP00000279028:p.Thr353Asn	Somatic	29	0		WXS	Illumina GAIIx	Phase_I	42	4	NM_080721	0	0	0	0	0		Missense_Mutation	SNP	ENST00000279028.2	37	CCDS54468.1	.	.	.	.	.	.	.	.	.	.	G	12.09	1.834581	0.32421	.	.	ENSG00000149635	ENST00000279028	T	0.30182	1.54	4.73	1.5	0.22942	Dendritic cell-specific transmembrane protein-like (1);	0.579088	0.17371	N	0.176691	T	0.28863	0.0716	L	0.29908	0.895	0.09310	N	1	P	0.52577	0.954	P	0.54706	0.759	T	0.14727	-1.0462	10	0.19590	T	0.45	-11.3162	7.6274	0.28220	0.0:0.3279:0.4895:0.1826	.	353	Q9BR26	CT123_HUMAN	N	353	ENSP00000279028:T353N	ENSP00000279028:T353N	T	-	2	0	C20orf123	44603963	0.677000	0.27577	0.080000	0.20451	0.286000	0.27126	0.688000	0.25422	0.148000	0.19059	0.655000	0.94253	ACT	.		0.597	OCSTAMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079573.2	XM_496476	
SLC9A8	23315	hgsc.bcm.edu	37	20	48429485	48429485	+	Splice_Site	SNP	A	A	C	rs61734269	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr20:48429485A>C	ENST00000361573.2	+	1	68	c.26A>C	c.(25-27)gAg>gCg	p.E9A	SLC9A8_ENST00000541138.1_5'UTR|SLC9A8_ENST00000539601.1_5'UTR|SLC9A8_ENST00000417961.1_Splice_Site_p.E9A			Q9Y2E8	SL9A8_HUMAN	solute carrier family 9, subfamily A (NHE8, cation proton antiporter 8), member 8	9					ion transport (GO:0006811)|regulation of intracellular pH (GO:0051453)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	potassium:proton antiporter activity (GO:0015386)|sodium:proton antiporter activity (GO:0015385)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	30			BRCA - Breast invasive adenocarcinoma(9;3.91e-07)			GCGGAAGAGGAGTGAGTGGGC	0.721													A|||	20	0.00399361	0.0	0.0072	5008	,	,		9939	0.0		0.0149	False		,,,				2504	0.0				p.E9A		.											.	SLC9A8-91	0			c.A26C						.	A	ALA/GLU	8,3162		0,8,1577	22.0	27.0	25.0		26	5.8	1.0	20	dbSNP_129	25	93,5627		0,93,2767	yes	missense-near-splice	SLC9A8	NM_015266.1	107	0,101,4344	CC,CA,AA		1.6259,0.2524,1.1361	benign	9/582	48429485	101,8789	1585	2860	4445	SO:0001630	splice_region_variant	23315	exon1			AAGAGGAGTGAGT	AB023156	CCDS13421.1, CCDS58774.1	20q13.13	2013-05-22	2012-03-22		ENSG00000197818	ENSG00000197818		"""Solute carriers"""	20728	protein-coding gene	gene with protein product		612730	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 8"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 8"""			12409279	Standard	NM_001260491		Approved	KIAA0939, NHE8	uc002xuv.2	Q9Y2E8	OTTHUMG00000032710	ENST00000361573.2:c.26+1A>C	20.37:g.48429485A>C		Somatic	2	0		WXS	Illumina GAIIx	Phase_I	7	5	NM_001260491	0	0	0	0	0	B4DTQ8|Q2M1U9|Q68CZ8|Q9BX15|Q9Y507	Missense_Mutation	SNP	ENST00000361573.2	37	CCDS13421.1	13	0.005952380952380952	0	0.0	4	0.011049723756906077	0	0.0	9	0.011873350923482849	A	18.74	3.689428	0.68271	0.002524	0.016259	ENSG00000197818	ENST00000417961;ENST00000361573	T;T	0.64085	-0.08;-0.08	5.78	5.78	0.91487	.	1.022470	0.07730	N	0.945052	T	0.26195	0.0639	N	0.03608	-0.345	0.80722	D	1	B;B	0.16396	0.017;0.0	B;B	0.18561	0.022;0.0	T	0.05920	-1.0856	10	0.21540	T	0.41	.	12.5619	0.56286	1.0:0.0:0.0:0.0	rs61734269	9;9	Q9Y2E8-2;Q9Y2E8	.;SL9A8_HUMAN	A	9	ENSP00000416418:E9A;ENSP00000354966:E9A	ENSP00000354966:E9A	E	+	2	0	SLC9A8	47862892	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.988000	0.49386	2.224000	0.72417	0.449000	0.29647	GAG	A|0.994;C|0.006		0.721	SLC9A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106483.3	XM_030524	Missense_Mutation
CECR2	27443	bcgsc.ca	37	22	18003341	18003341	+	Silent	SNP	G	G	A	rs73159550	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr22:18003341G>A	ENST00000262608.8	+	8	1029	c.1029G>A	c.(1027-1029)tcG>tcA	p.S343S	CECR2_ENST00000342247.5_Silent_p.S314S|CECR2_ENST00000400573.5_Intron|CECR2_ENST00000400585.2_Intron	NM_031413.3	NP_113601.2	Q9BXF3	CECR2_HUMAN	cat eye syndrome chromosome region, candidate 2	384					apoptotic DNA fragmentation (GO:0006309)|ATP-dependent chromatin remodeling (GO:0043044)|cytokinesis (GO:0000910)|cytoskeleton organization (GO:0007010)|execution phase of apoptosis (GO:0097194)|neural tube development (GO:0021915)|vesicle-mediated transport (GO:0016192)	CERF complex (GO:0090537)|nucleus (GO:0005634)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	59		all_epithelial(15;0.139)		Lung(27;0.146)		CATGTCTGTCGACCAGCCGTC	0.463													G|||	134	0.0267572	0.0756	0.0173	5008	,	,		16668	0.0		0.0199	False		,,,				2504	0.002				.		.											.	CECR2-70	0			.						.	G		279,4035		9,261,1887	56.0	66.0	63.0		1026	0.4	0.0	22	dbSNP_130	63	189,8311		2,185,4063	yes	coding-synonymous	CECR2	NM_031413.3		11,446,5950	AA,AG,GG		2.2235,6.4673,3.6523		342/1443	18003341	468,12346	2157	4250	6407	SO:0001819	synonymous_variant	27443	.			TCTGTCGACCAGC	AF336133		22q11.2	2012-04-19			ENSG00000099954	ENSG00000099954			1840	protein-coding gene	gene with protein product		607576				11381032	Standard	XM_006724077		Approved	KIAA1740	uc002zml.2	Q9BXF3	OTTHUMG00000150072	ENST00000262608.8:c.1029G>A	22.37:g.18003341G>A		Somatic	238	0		WXS	Illumina GAIIx	Phase_I	284	8	.	0	0	0	0	0	A8MS90|A8MX16|Q658Z4|Q96P58|Q9C0C3	Silent	SNP	ENST00000262608.8	37																																																																																				G|0.974;A|0.026		0.463	CECR2-201	KNOWN	basic	protein_coding	protein_coding		NM_031413	
ZDHHC8	29801	hgsc.bcm.edu	37	22	20131121	20131121	+	Silent	SNP	G	G	C	rs145100111	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr22:20131121G>C	ENST00000334554.7	+	10	2109	c.1968G>C	c.(1966-1968)ccG>ccC	p.P656P	ZDHHC8_ENST00000320602.7_Silent_p.P564P|ZDHHC8_ENST00000405930.3_Silent_p.P656P	NM_013373.3	NP_037505.1	Q9ULC8	ZDHC8_HUMAN	zinc finger, DHHC-type containing 8	656					locomotory behavior (GO:0007626)|protein palmitoylation (GO:0018345)	cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(3)|endometrium(1)|kidney(3)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)	20	Colorectal(54;0.0993)					GCAACGCCCCGGGGCCCCGGC	0.716													G|||	15	0.00299521	0.0008	0.0043	5008	,	,		14170	0.0		0.0089	False		,,,				2504	0.002				p.P656P		.											.	ZDHHC8-91	0			c.G1968C						.	G	,	13,4351		0,13,2169	15.0	17.0	16.0		1968,1968	-7.4	0.4	22	dbSNP_134	16	93,8485		0,93,4196	no	coding-synonymous,coding-synonymous	ZDHHC8	NM_001185024.1,NM_013373.3	,	0,106,6365	CC,CG,GG		1.0842,0.2979,0.819	,	656/779,656/766	20131121	106,12836	2182	4289	6471	SO:0001819	synonymous_variant	29801	exon10			CGCCCCGGGGCCC	AB033118	CCDS13776.1, CCDS54502.1	22q11.21	2009-10-06		2003-02-28	ENSG00000099904	ENSG00000099904		"""Zinc fingers, DHHC-type"""	18474	protein-coding gene	gene with protein product		608784				10574462, 15184899	Standard	NM_013373		Approved	ZNF378, KIAA1292	uc002zrr.2	Q9ULC8	OTTHUMG00000150499	ENST00000334554.7:c.1968G>C	22.37:g.20131121G>C		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	22	22	NM_001185024	0	0	0	0	0	Q2TGE9|Q6ICL1|Q6ZNF5|Q7Z6L9	Silent	SNP	ENST00000334554.7	37	CCDS13776.1																																																																																			G|0.993;C|0.007		0.716	ZDHHC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318564.1	NM_013373	
AIFM3	150209	bcgsc.ca	37	22	21327589	21327589	+	Intron	SNP	C	C	T	rs178264	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr22:21327589C>T	ENST00000399167.2	+	3	271				AIFM3_ENST00000399163.2_Intron|AIFM3_ENST00000405089.1_Missense_Mutation_p.P15S|AIFM3_ENST00000440238.2_Intron|AIFM3_ENST00000335375.5_Intron|AIFM3_ENST00000333607.6_Intron	NM_144704.2	NP_653305.1	Q96NN9	AIFM3_HUMAN	apoptosis-inducing factor, mitochondrion-associated, 3						cell redox homeostasis (GO:0045454)|execution phase of apoptosis (GO:0097194)	endoplasmic reticulum (GO:0005783)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	2 iron, 2 sulfur cluster binding (GO:0051537)|flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(5)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	21	all_cancers(11;3.71e-26)|all_epithelial(7;1.59e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0367)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			CGCTGCCTTGCCCACAGTGGA	0.682													C|||	1092	0.218051	0.1551	0.2233	5008	,	,		14411	0.4306		0.1113	False		,,,				2504	0.1902				p.P15S		.											.	AIFM3-280	0			c.C43T						.	C	,SER/PRO,	644,3726		52,540,1593	16.0	15.0	15.0		,43,	-0.5	0.0	22	dbSNP_79	15	1036,7524		77,882,3321	yes	intron,missense,intron	AIFM3	NM_001018060.2,NM_001146288.1,NM_144704.2	,74,	129,1422,4914	TT,TC,CC		12.1028,14.7368,12.993	,,	,15/605,	21327589	1680,11250	2185	4280	6465	SO:0001627	intron_variant	150209	exon3			GCCTTGCCCACAG	AK094844	CCDS13786.1, CCDS33605.1, CCDS54503.1	22q11.21	2007-05-03			ENSG00000183773	ENSG00000183773			26398	protein-coding gene	gene with protein product						15764604	Standard	NM_144704		Approved	AIFL, FLJ30473		Q96NN9	OTTHUMG00000150804	ENST00000399167.2:c.32-7C>T	22.37:g.21327589C>T		Somatic	53	0		WXS	Illumina GAIIx	Phase_I	151	6	NM_001146288	0	0	0	0	0	B7WP37|D3DX37|D3DX38|Q6ZT44|Q8N1V3|Q8N5E0	Missense_Mutation	SNP	ENST00000399167.2	37	CCDS13786.1	526	0.24084249084249085	74	0.15040650406504066	72	0.19889502762430938	276	0.4825174825174825	104	0.13720316622691292	C	8.495	0.862825	0.17178	0.147368	0.121028	ENSG00000183773	ENST00000405089	T	0.44083	0.93	4.91	-0.471	0.12119	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.58432	P	1.999999999946489E-6	B	0.02656	0.0	B	0.01281	0.0	T	0.48328	-0.9045	7	0.25751	T	0.34	.	4.8039	0.13310	0.0:0.4401:0.1597:0.4002	rs178264;rs886154	15	Q96NN9-2	.	S	15	ENSP00000385800:P15S	ENSP00000385800:P15S	P	+	1	0	AIFM3	19657589	0.006000	0.16342	0.001000	0.08648	0.007000	0.05969	0.175000	0.16762	0.089000	0.17243	0.655000	0.94253	CCC	C|0.759;T|0.241		0.682	AIFM3-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000320150.1	NM_144704	
SHANK3	85358	hgsc.bcm.edu	37	22	51159595	51159595	+	Silent	SNP	C	C	T	rs376858991	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr22:51159595C>T	ENST00000414786.2	+	21	3519	c.3292C>T	c.(3292-3294)Ctg>Ttg	p.L1098L	SHANK3_ENST00000262795.3_Silent_p.L1128L|SHANK3_ENST00000445220.2_Silent_p.L1114L			Q9BYB0	SHAN3_HUMAN	SH3 and multiple ankyrin repeat domains 3	1112					adult behavior (GO:0030534)|alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|brain morphogenesis (GO:0048854)|dendritic spine morphogenesis (GO:0060997)|guanylate kinase-associated protein clustering (GO:0097117)|learning (GO:0007612)|MAPK cascade (GO:0000165)|memory (GO:0007613)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of actin filament bundle assembly (GO:0032232)|negative regulation of cell volume (GO:0045794)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of glutamate receptor signaling pathway (GO:1900451)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse structural plasticity (GO:0051835)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density assembly (GO:0097107)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of long term synaptic depression (GO:1900452)|regulation of long-term synaptic potentiation (GO:1900271)|social behavior (GO:0035176)|striatal medium spiny neuron differentiation (GO:0021773)|synapse assembly (GO:0007416)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|neuron spine (GO:0044309)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(5)	8		all_cancers(38;3.75e-11)|all_epithelial(38;1.82e-09)|Breast(42;0.000448)|all_lung(38;0.000665)|Lung NSC(38;0.0104)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		BRCA - Breast invasive adenocarcinoma(115;0.22)		GGCCCTTGCCCTGGCTGCCCG	0.726													C|||	17	0.00339457	0.0	0.0	5008	,	,		9780	0.0		0.001	False		,,,				2504	0.0164				p.L1098L		.											.	SHANK3-69	0			c.C3292T						.	C		0,4002		0,0,2001	8.0	10.0	10.0		3382	3.3	0.8	22		10	14,8218		0,14,4102	no	coding-synonymous	SHANK3	NM_001080420.1		0,14,6103	TT,TC,CC		0.1701,0.0,0.1144		1128/1748	51159595	14,12220	2001	4116	6117	SO:0001819	synonymous_variant	85358	exon21			CTTGCCCTGGCTG	AB051437		22q13.3	2013-11-14			ENSG00000251322	ENSG00000251322		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14294	protein-coding gene	gene with protein product	"""proline rich synapse associated protein 2"", ""shank postsynaptic density protein"""	606230				11258795, 11431708, 10806096, 17173049	Standard	NM_033517		Approved	SPANK-2, prosap2, KIAA1650, PSAP2	uc031ryd.1	Q9BYB0	OTTHUMG00000150169	ENST00000414786.2:c.3292C>T	22.37:g.51159595C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	15	15	NM_033517	0	0	2	7	5	D7UT47|Q8TET3	Silent	SNP	ENST00000414786.2	37																																																																																				.		0.726	SHANK3-001	KNOWN	non_canonical_polymorphism|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000316674.2	NM_001080420	
NISCH	11188	hgsc.bcm.edu	37	3	52492817	52492817	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr3:52492817T>C	ENST00000479054.1	+	4	389	c.317T>C	c.(316-318)gTg>gCg	p.V106A	NISCH_ENST00000345716.4_Missense_Mutation_p.V106A|NISCH_ENST00000420808.2_Missense_Mutation_p.V106A|NISCH_ENST00000488380.1_Missense_Mutation_p.V106A			Q9Y2I1	NISCH_HUMAN	nischarin	106	Necessary for binding to phosphoinositide-3-P; not sufficient for targeting to endosomes.|PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|glucose metabolic process (GO:0006006)|negative regulation of cell migration (GO:0030336)|norepinephrine secretion (GO:0048243)|Rac protein signal transduction (GO:0016601)|regulation of blood pressure (GO:0008217)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)|plasma membrane (GO:0005886)	G-protein coupled amine receptor activity (GO:0008227)|identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)			NS(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(9)|ovary(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	33				BRCA - Breast invasive adenocarcinoma(193;1.93e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)|OV - Ovarian serous cystadenocarcinoma(275;0.0577)	Tizanidine(DB00697)	TTCCCTGGCGTGACCCCCAGA	0.502																																					p.V106A		.											.	NISCH-93	0			c.T317C						.						111.0	109.0	109.0					3																	52492817		2203	4300	6503	SO:0001583	missense	11188	exon3			CTGGCGTGACCCC	AF082516	CCDS33767.1, CCDS63651.1, CCDS63652.1	3p21.1	2008-07-18			ENSG00000010322	ENSG00000010322			18006	protein-coding gene	gene with protein product	"""imidazoline receptor candidate"", ""I-1 receptor candidate protein"", ""imidazoline receptor antisera selected"""	615507				11912194, 10882231	Standard	NM_007184		Approved	KIAA0975, I-1, IRAS	uc003ded.4	Q9Y2I1	OTTHUMG00000158571	ENST00000479054.1:c.317T>C	3.37:g.52492817T>C	ENSP00000418232:p.Val106Ala	Somatic	68	0		WXS	Illumina GAIIx	Phase_I	62	4	NM_001276293	0	0	7	7	0	C9J245|Q6PGP3|Q6PIB4|Q7L8M3|Q7Z2X6|Q9UES6|Q9UEU4|Q9UFW3	Missense_Mutation	SNP	ENST00000479054.1	37	CCDS33767.1	.	.	.	.	.	.	.	.	.	.	T	8.929	0.962974	0.18583	.	.	ENSG00000010322	ENST00000479054;ENST00000345716;ENST00000488380;ENST00000420808	T;T;T;T	0.39056	1.1;1.1;1.1;1.1	5.7	4.56	0.56223	Phox homologous domain (5);	0.316652	0.33813	N	0.004534	T	0.12603	0.0306	N	0.00996	-1.065	0.39186	D	0.962875	B;B	0.19817	0.039;0.001	B;B	0.22386	0.039;0.004	T	0.19289	-1.0310	10	0.10902	T	0.67	-18.6276	5.2901	0.15721	0.0:0.2486:0.0:0.7514	.	106;106	Q9Y2I1;C9J715	NISCH_HUMAN;.	A	106	ENSP00000418232:V106A;ENSP00000339958:V106A;ENSP00000417812:V106A;ENSP00000392484:V106A	ENSP00000339958:V106A	V	+	2	0	NISCH	52467857	1.000000	0.71417	0.977000	0.42913	0.986000	0.74619	2.619000	0.46401	2.185000	0.69588	0.533000	0.62120	GTG	.		0.502	NISCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351357.1	NM_007184	
STAB1	23166	bcgsc.ca	37	3	52556369	52556369	+	Silent	SNP	C	C	T	rs35325270	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr3:52556369C>T	ENST00000321725.6	+	60	6565	c.6489C>T	c.(6487-6489)caC>caT	p.H2163H		NM_015136.2	NP_055951.2	Q9NY15	STAB1_HUMAN	stabilin 1	2163	EGF-like 16. {ECO:0000255|PROSITE- ProRule:PRU00076, ECO:0000305}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|oxidation-reduction process (GO:0055114)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|protein disulfide oxidoreductase activity (GO:0015035)|scavenger receptor activity (GO:0005044)			breast(4)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(13)|liver(1)|lung(27)|ovary(1)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	76				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		GTGAGTGCCACGCAGGCTACG	0.642													C|||	699	0.139577	0.3593	0.1239	5008	,	,		18425	0.0228		0.0905	False		,,,				2504	0.0245				p.H2163H		.											.	STAB1-139	0			c.C6489T						.	C		1456,2950	466.2+/-354.4	244,968,991	66.0	70.0	68.0		6489	-6.9	0.1	3	dbSNP_126	68	698,7902	172.3+/-223.0	34,630,3636	no	coding-synonymous	STAB1	NM_015136.2		278,1598,4627	TT,TC,CC		8.1163,33.0458,16.5616		2163/2571	52556369	2154,10852	2203	4300	6503	SO:0001819	synonymous_variant	23166	exon60			GTGCCACGCAGGC	AJ275213	CCDS33768.1	3p21.31	2008-07-18			ENSG00000010327	ENSG00000010327			18628	protein-coding gene	gene with protein product	"""MS-1 antigen"", ""fasciclin egf-like, laminin-type egf-like, and link domain-containing scavenger receptor-1"", ""common lymphatic endothelial and vascular endothelial receptor-1"""	608560				11829752, 12077138	Standard	XM_005264973		Approved	KIAA0246, STAB-1, FEEL-1, CLEVER-1, FELE-1, FEX1	uc003dej.3	Q9NY15	OTTHUMG00000158574	ENST00000321725.6:c.6489C>T	3.37:g.52556369C>T		Somatic	54	0		WXS	Illumina GAIIx	Phase_I	129	6	NM_015136	0	0	3	4	1	A7E297|Q8IUH0|Q8IUH1|Q93072	Silent	SNP	ENST00000321725.6	37	CCDS33768.1																																																																																			C|0.850;T|0.150		0.642	STAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351380.2	NM_015136	
MYLK	4638	bcgsc.ca	37	3	123452838	123452838	+	Silent	SNP	G	G	A	rs4678047	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr3:123452838G>A	ENST00000475616.1	-	7	1004	c.1005C>T	c.(1003-1005)acC>acT	p.T335T	MYLK_ENST00000359169.1_Silent_p.T335T|MYLK_ENST00000360772.3_Silent_p.T335T|MYLK_ENST00000360304.3_Silent_p.T335T|MYLK_ENST00000346322.5_Silent_p.T335T			Q15746	MYLK_HUMAN	myosin light chain kinase	335					actin filament organization (GO:0007015)|aorta smooth muscle tissue morphogenesis (GO:0060414)|bleb assembly (GO:0032060)|cellular hypotonic response (GO:0071476)|muscle contraction (GO:0006936)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell migration (GO:0030335)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|smooth muscle contraction (GO:0006939)|tonic smooth muscle contraction (GO:0014820)	cell-cell junction (GO:0005911)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|metal ion binding (GO:0046872)|myosin light chain kinase activity (GO:0004687)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(37)|ovary(7)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	113		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)		GAAGGACCGGGGTCTGCGGGG	0.642													G|||	3169	0.632788	0.3623	0.7262	5008	,	,		15445	0.9375		0.6491	False		,,,				2504	0.6012				p.T335T		.											.	MYLK-365	0			c.C1005T						.	G	,,,	1727,2679	507.6+/-366.7	336,1055,812	54.0	59.0	57.0		1005,1005,1005,1005	0.3	0.0	3	dbSNP_111	57	5743,2857	663.9+/-402.1	1923,1897,480	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	MYLK	NM_053025.3,NM_053026.3,NM_053027.3,NM_053028.3	,,,	2259,2952,1292	AA,AG,GG		33.2209,39.1966,42.565	,,,	335/1915,335/1846,335/1864,335/1795	123452838	7470,5536	2203	4300	6503	SO:0001819	synonymous_variant	4638	exon10			GACCGGGGTCTGC	X85337	CCDS3023.1, CCDS43141.1, CCDS46896.1, CCDS46897.1, CCDS58849.1	3q21	2013-02-11	2008-01-23		ENSG00000065534	ENSG00000065534	2.7.11.18	"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7590	protein-coding gene	gene with protein product	"""smooth muscle myosin light chain kinase"""	600922	"""myosin, light polypeptide kinase"""			8575746	Standard	NM_053026		Approved	MLCK, smMLCK, MYLK1, MLCK1	uc003ego.3	Q15746	OTTHUMG00000141304	ENST00000475616.1:c.1005C>T	3.37:g.123452838G>A		Somatic	46	0		WXS	Illumina GAIIx	Phase_I	104	6	NM_053025	0	0	0	0	0	B4DUE3|D3DN97|O95796|O95797|O95798|O95799|Q14844|Q16794|Q17S15|Q3ZCP9|Q5MY99|Q5MYA0|Q6P2N0|Q7Z4J0|Q9C0L5|Q9UBG5|Q9UBY6|Q9UIT9	Silent	SNP	ENST00000475616.1	37	CCDS46896.1																																																																																			A|0.608;G|0.392		0.642	MYLK-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356464.1	NM_053025	
VWA5B2	90113	hgsc.bcm.edu	37	3	183951125	183951125	+	Missense_Mutation	SNP	C	C	A	rs548730521		TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr3:183951125C>A	ENST00000426955.2	+	3	570	c.470C>A	c.(469-471)aCc>aAc	p.T157N	VWA5B2_ENST00000273794.5_5'Flank|EIF2B5_ENST00000444495.1_Intron	NM_138345.1	NP_612354.1	Q8N398	VW5B2_HUMAN	von Willebrand factor A domain containing 5B2	157										breast(3)|endometrium(4)|kidney(1)|lung(1)|prostate(1)|skin(5)	15						ACTGTGCTCACCCCGCTggcc	0.711													C|||	1	0.000199681	0.0	0.0	5008	,	,		13397	0.0		0.0	False		,,,				2504	0.001				p.T157N		.											.	.	0			c.C470A						.						14.0	18.0	17.0					3																	183951125		692	1591	2283	SO:0001583	missense	90113	exon3			TGCTCACCCCGCT		CCDS54686.1	3q27.1	2008-07-25	2008-07-25		ENSG00000145198	ENSG00000145198			25144	protein-coding gene	gene with protein product						15231747	Standard	NM_138345		Approved	DKFZp761K032, LOC90113	uc011bra.2	Q8N398	OTTHUMG00000156820	ENST00000426955.2:c.470C>A	3.37:g.183951125C>A	ENSP00000398688:p.Thr157Asn	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	35	32	NM_138345	0	0	0	20	20	B9EGN7	Missense_Mutation	SNP	ENST00000426955.2	37	CCDS54686.1	.	.	.	.	.	.	.	.	.	.	C	20.1	3.933030	0.73442	.	.	ENSG00000145198	ENST00000426955	T	0.50001	0.76	4.24	4.24	0.50183	.	.	.	.	.	T	0.60958	0.2309	L	0.48642	1.525	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.61158	-0.7119	9	0.48119	T	0.1	-9.3952	14.5222	0.67859	0.0:1.0:0.0:0.0	.	157	B9EGN7	.	N	157	ENSP00000398688:T157N	ENSP00000398688:T157N	T	+	2	0	VWA5B2	185433819	1.000000	0.71417	1.000000	0.80357	0.838000	0.47535	2.706000	0.47135	2.357000	0.79964	0.462000	0.41574	ACC	.		0.711	VWA5B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346004.2	XM_291077	
MUC4	4585	bcgsc.ca	37	3	195506147	195506147	+	Missense_Mutation	SNP	G	G	T	rs200473856	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr3:195506147G>T	ENST00000463781.3	-	2	12763	c.12304C>A	c.(12304-12306)Ctt>Att	p.L4102I	MUC4_ENST00000475231.1_Missense_Mutation_p.L4102I|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACTGAGGAAAGGCTGGTGAGA	0.592																																					p.L4102I		.											.	MUC4-90	0			c.C12304A						.						18.0	10.0	12.0					3																	195506147		567	1388	1955	SO:0001583	missense	4585	exon2			AGGAAAGGCTGGT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12304C>A	3.37:g.195506147G>T	ENSP00000417498:p.Leu4102Ile	Somatic	238	7		WXS	Illumina GAIIx	Phase_I	152	35	NM_018406	0	0	0	0	0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	N	3.571	-0.087540	0.07097	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.31247	1.55;1.5	.	.	.	.	.	.	.	.	T	0.19604	0.0471	N	0.19112	0.55	0.09310	N	1	P	0.34587	0.458	B	0.41691	0.364	T	0.31586	-0.9938	6	.	.	.	.	.	.	.	.	3974	E7ESK3	.	I	4102	ENSP00000417498:L4102I;ENSP00000420243:L4102I	.	L	-	1	0	MUC4	196990926	0.002000	0.14202	0.004000	0.12327	0.022000	0.10575	0.632000	0.24583	-0.417000	0.07461	0.064000	0.15345	CTT	G|0.981;A|0.019		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	bcgsc.ca	37	3	195507237	195507237	+	Silent	SNP	G	G	A	rs199776180|rs74187968		TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr3:195507237G>A	ENST00000463781.3	-	2	11673	c.11214C>T	c.(11212-11214)tcC>tcT	p.S3738S	MUC4_ENST00000475231.1_Silent_p.S3738S|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CGTGACCTGTGGATGCTGAGG	0.577																																					p.S3738S		.											.	MUC4-90	0			c.C11214T						.						29.0	30.0	29.0					3																	195507237		650	1581	2231	SO:0001819	synonymous_variant	4585	exon2			ACCTGTGGATGCT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11214C>T	3.37:g.195507237G>A		Somatic	338	6		WXS	Illumina GAIIx	Phase_I	980	54	NM_018406	0	0	0	0	0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																			.		0.577	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	bcgsc.ca	37	3	195508546	195508546	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr3:195508546G>T	ENST00000463781.3	-	2	10364	c.9905C>A	c.(9904-9906)aCt>aAt	p.T3302N	MUC4_ENST00000475231.1_Missense_Mutation_p.T3302N|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TACTGAGGAAGTCTCGGTGAC	0.562																																					p.T3302N		.											.	MUC4-90	0			c.C9905A						.						24.0	21.0	22.0					3																	195508546		679	1558	2237	SO:0001583	missense	4585	exon2			GAGGAAGTCTCGG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.9905C>A	3.37:g.195508546G>T	ENSP00000417498:p.Thr3302Asn	Somatic	220	2		WXS	Illumina GAIIx	Phase_I	424	26	NM_018406	0	0	0	0	0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	4.624	0.116041	0.08831	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.31510	1.5;1.49	0.743	0.743	0.18347	.	.	.	.	.	T	0.10895	0.0266	N	0.14661	0.345	0.09310	N	1	P	0.47604	0.898	B	0.28784	0.094	T	0.17592	-1.0364	8	.	.	.	.	4.7007	0.12825	0.0:0.0:1.0:0.0	.	3174	E7ESK3	.	N	3302	ENSP00000417498:T3302N;ENSP00000420243:T3302N	.	T	-	2	0	MUC4	196993325	0.000000	0.05858	0.008000	0.14137	0.008000	0.06430	0.036000	0.13819	0.088000	0.17205	0.089000	0.15464	ACT	.		0.562	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	bcgsc.ca	37	3	195511911	195511911	+	Silent	SNP	G	G	A	rs200732241		TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr3:195511911G>A	ENST00000463781.3	-	2	6999	c.6540C>T	c.(6538-6540)acC>acT	p.T2180T	MUC4_ENST00000475231.1_Silent_p.T2180T|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.T2180T(2)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGGAAGTGTCGGTGACAGGAA	0.587																																					p.T2180T		.											.	MUC4-90	2	Substitution - coding silent(2)	endometrium(2)	c.C6540T						.						8.0	14.0	12.0					3																	195511911		633	1518	2151	SO:0001819	synonymous_variant	4585	exon2			AGTGTCGGTGACA	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.6540C>T	3.37:g.195511911G>A		Somatic	600	15		WXS	Illumina GAIIx	Phase_I	1002	89	NM_018406	0	0	0	0	0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																			G|0.998;A|0.002		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	bcgsc.ca	37	3	195511959	195511959	+	Silent	SNP	G	G	A	rs369770584		TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr3:195511959G>A	ENST00000463781.3	-	2	6951	c.6492C>T	c.(6490-6492)acC>acT	p.T2164T	MUC4_ENST00000475231.1_Silent_p.T2164T|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGGAAGTGTCGGTGACAGGAA	0.577																																					p.T2164T		.											.	MUC4-90	0			c.C6492T						.						15.0	15.0	15.0					3																	195511959		676	1556	2232	SO:0001819	synonymous_variant	4585	exon2			AGTGTCGGTGACA	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.6492C>T	3.37:g.195511959G>A		Somatic	493	9		WXS	Illumina GAIIx	Phase_I	711	41	NM_018406	0	0	0	0	0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																			.		0.577	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
CRIPAK	285464	ucsc.edu	37	4	1388848	1388848	+	Silent	SNP	A	A	C	rs74511366	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr4:1388848A>C	ENST00000324803.4	+	1	3509	c.549A>C	c.(547-549)ccA>ccC	p.P183P		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	183					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			CACACGTGCCAACGTGGAGTG	0.667													N|||	112	0.0223642	0.0234	0.0288	5008	,	,		14570	0.001		0.0378	False		,,,				2504	0.0225				p.P183P		.											.	CRIPAK-90	0			c.A549C						.						219.0	152.0	176.0					4																	1388848		2182	3950	6132	SO:0001819	synonymous_variant	285464	exon1			CGTGCCAACGTGG	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.549A>C	4.37:g.1388848A>C		Somatic	11	0		WXS	Illumina GAIIx	Phase_I	231	32	NM_175918	49	0	10	59	0	Q8NB03	Silent	SNP	ENST00000324803.4	37	CCDS3349.1																																																																																			A|0.993;C|0.000;G|0.006		0.667	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
CRIPAK	285464	ucsc.edu	37	4	1388850	1388850	+	Missense_Mutation	SNP	C	C	T	rs78729943	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr4:1388850C>T	ENST00000324803.4	+	1	3511	c.551C>T	c.(550-552)aCg>aTg	p.T184M		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	184					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			CACGTGCCAACGTGGAGTGCC	0.667													N|||	112	0.0223642	0.0234	0.0288	5008	,	,		13476	0.001		0.0378	False		,,,				2504	0.0225				p.T184M		.											.	CRIPAK-90	0			c.C551T						.						219.0	152.0	176.0					4																	1388850		2180	3938	6118	SO:0001583	missense	285464	exon1			TGCCAACGTGGAG	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.551C>T	4.37:g.1388850C>T	ENSP00000323978:p.Thr184Met	Somatic	11	0		WXS	Illumina GAIIx	Phase_I	233	29	NM_175918	0	0	8	8	0	Q8NB03	Missense_Mutation	SNP	ENST00000324803.4	37	CCDS3349.1	.	.	.	.	.	.	.	.	.	.	-	2.068	-0.413800	0.04799	.	.	ENSG00000179979	ENST00000324803	T	0.19532	2.14	1.41	-2.82	0.05787	Post-SET domain (1);	.	.	.	.	T	0.08447	0.0210	N	0.08118	0	0.09310	N	1	B	0.10296	0.003	B	0.01281	0.0	T	0.22277	-1.0221	9	0.29301	T	0.29	.	4.7529	0.13070	0.0:0.3841:0.1667:0.4492	.	184	Q8N1N5	CRPAK_HUMAN	M	184	ENSP00000323978:T184M	ENSP00000323978:T184M	T	+	2	0	CRIPAK	1378850	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.507000	0.06352	-2.573000	0.00466	-2.139000	0.00339	ACG	C|0.500;T|0.500		0.667	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
CRIPAK	285464	hgsc.bcm.edu	37	4	1388867	1388867	+	Missense_Mutation	SNP	A	A	C	rs76058011	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr4:1388867A>C	ENST00000324803.4	+	1	3528	c.568A>C	c.(568-570)Atc>Ctc	p.I190L		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	190					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			TGCCCGCCTGATCACACGTGC	0.662													N|||	145	0.0289537	0.0174	0.0447	5008	,	,		14453	0.0099		0.0586	False		,,,				2504	0.0225				p.I190L		.											.	CRIPAK-90	0			c.A568C						.						246.0	170.0	197.0					4																	1388867		2172	3827	5999	SO:0001583	missense	285464	exon1			CGCCTGATCACAC	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.568A>C	4.37:g.1388867A>C	ENSP00000323978:p.Ile190Leu	Somatic	15	0		WXS	Illumina GAIIx	Phase_I	235	27	NM_175918	0	0	8	96	88	Q8NB03	Missense_Mutation	SNP	ENST00000324803.4	37	CCDS3349.1	.	.	.	.	.	.	.	.	.	.	-	4.910	0.169067	0.09339	.	.	ENSG00000179979	ENST00000324803	T	0.19394	2.15	1.25	-1.56	0.08532	.	.	.	.	.	T	0.06917	0.0176	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.34004	-0.9846	9	0.10636	T	0.68	.	0.5937	0.00732	0.3976:0.2382:0.1983:0.1659	.	190	Q8N1N5	CRPAK_HUMAN	L	190	ENSP00000323978:I190L	ENSP00000323978:I190L	I	+	1	0	CRIPAK	1378867	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-2.558000	0.00923	-1.849000	0.01171	-2.030000	0.00424	ATC	A|0.994;C|0.006		0.662	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
OTOP1	133060	hgsc.bcm.edu	37	4	4228456	4228456	+	Silent	SNP	G	G	T	rs73191872		TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr4:4228456G>T	ENST00000296358.4	-	1	160	c.136C>A	c.(136-138)Cgg>Agg	p.R46R		NM_177998.1	NP_819056.1	Q7RTM1	OTOP1_HUMAN	otopetrin 1	46					biomineral tissue development (GO:0031214)|detection of gravity (GO:0009590)|inner ear morphogenesis (GO:0042472)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|liver(4)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		ACAccgccccgccggggggcc	0.736																																					p.R46R		.											.	OTOP1-92	0			c.C136A						.						4.0	4.0	4.0					4																	4228456		1989	3880	5869	SO:0001819	synonymous_variant	133060	exon1			CGCCCCGCCGGGG	BK000653	CCDS3372.1	4p16.2	2008-02-05			ENSG00000163982	ENSG00000163982			19656	protein-coding gene	gene with protein product		607806				12651873	Standard	NM_177998		Approved		uc003ghp.1	Q7RTM1	OTTHUMG00000090301	ENST00000296358.4:c.136C>A	4.37:g.4228456G>T		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	37	6	NM_177998	0	0	0	0	0	A1L476	Silent	SNP	ENST00000296358.4	37	CCDS3372.1																																																																																			.		0.736	OTOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206661.2	NM_177998	
TBC1D1	23216	hgsc.bcm.edu	37	4	38138932	38138932	+	Silent	SNP	G	G	A			TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr4:38138932G>A	ENST00000261439.4	+	20	3838	c.3483G>A	c.(3481-3483)acG>acA	p.T1161T	TBC1D1_ENST00000508802.1_Silent_p.T1152T|TBC1D1_ENST00000407365.1_3'UTR	NM_001253914.1|NM_001253915.1|NM_015173.3	NP_001240843.1|NP_001240844.1|NP_055988.2	Q86TI0	TBCD1_HUMAN	TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1	1161					membrane organization (GO:0061024)|regulation of protein localization (GO:0032880)	cytosol (GO:0005829)|nucleus (GO:0005634)	Rab GTPase activator activity (GO:0005097)			NS(1)|breast(3)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	36						CTGAGTGCACGCAGCCCGAGC	0.647																																					p.T1161T		.											.	TBC1D1-91	0			c.G3483A						.						20.0	23.0	22.0					4																	38138932		2201	4300	6501	SO:0001819	synonymous_variant	23216	exon20			GTGCACGCAGCCC	AB029031	CCDS33972.1, CCDS58897.1	4p14	2013-07-09			ENSG00000065882	ENSG00000065882			11578	protein-coding gene	gene with protein product		609850				10965142, 18258599	Standard	NM_015173		Approved	TBC, TBC1, KIAA1108	uc003gtb.3	Q86TI0	OTTHUMG00000150302	ENST00000261439.4:c.3483G>A	4.37:g.38138932G>A		Somatic	3	0		WXS	Illumina GAIIx	Phase_I	44	26	NM_015173	1	0	16	43	26	B7Z3D9|E9PGH8|Q96K82|Q9UPP4	Silent	SNP	ENST00000261439.4	37	CCDS33972.1	.	.	.	.	.	.	.	.	.	.	G	5.680	0.309997	0.10733	.	.	ENSG00000065882	ENST00000510573	.	.	.	4.79	-8.67	0.00863	.	.	.	.	.	T	0.13586	0.0329	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.20009	-1.0288	4	.	.	.	5.6588	0.2136	0.00159	0.2284:0.2481:0.2518:0.2717	.	.	.	.	T	849	.	.	A	+	1	0	TBC1D1	37815327	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.647000	0.05397	-1.849000	0.01171	-0.232000	0.12228	GCA	.		0.647	TBC1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317443.2	NM_015173	
MANBA	4126	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	103644191	103644191	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr4:103644191T>C	ENST00000226578.4	-	4	485	c.386A>G	c.(385-387)gAt>gGt	p.D129G	MANBA_ENST00000505239.1_Intron	NM_005908.3	NP_005899.3	O00462	MANBA_HUMAN	mannosidase, beta A, lysosomal	129					cellular protein modification process (GO:0006464)|glycoprotein catabolic process (GO:0006516)|mannan catabolic process (GO:0046355)	intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)	beta-mannosidase activity (GO:0004567)|mannose binding (GO:0005537)			cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(12)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	42		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;4.44e-08)		GTTGGTAATATCAAAGCTCTA	0.433																																					p.D129G		.											.	MANBA-91	0			c.A386G						.						70.0	61.0	64.0					4																	103644191		2203	4300	6503	SO:0001583	missense	4126	exon4			GTAATATCAAAGC		CCDS3658.1	4q24	2013-09-20			ENSG00000109323	ENSG00000109323	3.2.1.25		6831	protein-coding gene	gene with protein product		609489				7876128	Standard	NM_005908		Approved		uc003hwg.3	O00462	OTTHUMG00000131123	ENST00000226578.4:c.386A>G	4.37:g.103644191T>C	ENSP00000226578:p.Asp129Gly	Somatic	78	0		WXS	Illumina GAIIx	Phase_I	120	48	NM_005908	0	0	0	0	0	Q96BC3|Q9NYX9	Missense_Mutation	SNP	ENST00000226578.4	37	CCDS3658.1	.	.	.	.	.	.	.	.	.	.	T	14.37	2.513982	0.44763	.	.	ENSG00000109323	ENST00000226578	D	0.83250	-1.7	4.22	4.22	0.49857	Galactose-binding domain-like (1);Glycoside hydrolase, family 2, N-terminal (1);	0.331422	0.30704	N	0.009041	D	0.91520	0.7322	H	0.96015	3.755	0.80722	D	1	P	0.51933	0.949	P	0.53722	0.733	D	0.93710	0.7023	10	0.62326	D	0.03	.	13.4422	0.61119	0.0:0.0:0.0:1.0	.	129	O00462	MANBA_HUMAN	G	129	ENSP00000226578:D129G	ENSP00000226578:D129G	D	-	2	0	MANBA	103863237	1.000000	0.71417	0.848000	0.33437	0.037000	0.13140	3.580000	0.53907	1.907000	0.55213	0.533000	0.62120	GAT	.		0.433	MANBA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253803.2		
SRD5A1	6715	hgsc.bcm.edu	37	5	6633779	6633779	+	Silent	SNP	C	C	G	rs248793	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr5:6633779C>G	ENST00000274192.5	+	1	324	c.90C>G	c.(88-90)cgC>cgG	p.R30R	SRD5A1_ENST00000504286.1_3'UTR|NSUN2_ENST00000539938.1_5'Flank|SRD5A1_ENST00000538824.1_Missense_Mutation_p.A39G|NSUN2_ENST00000506139.1_5'Flank|NSUN2_ENST00000264670.6_5'Flank|SRD5A1_ENST00000537411.1_Missense_Mutation_p.A39G	NM_001047.2	NP_001038.1	P18405	S5A1_HUMAN	steroid-5-alpha-reductase, alpha polypeptide 1 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 1)	30				Missing (in Ref. 4; AAF14869). {ECO:0000305}.	androgen biosynthetic process (GO:0006702)|cell differentiation (GO:0030154)|sex determination (GO:0007530)|sex differentiation (GO:0007548)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	3-oxo-5-alpha-steroid 4-dehydrogenase activity (GO:0003865)|cholestenone 5-alpha-reductase activity (GO:0047751)|electron carrier activity (GO:0009055)			endometrium(3)|kidney(1)|large_intestine(1)|lung(8)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19					Dutasteride(DB01126)|Finasteride(DB01216)|Levonorgestrel(DB00367)|Spironolactone(DB00421)	TCTTCGCGCGCAATCGTCAGA	0.746													G|||	2833	0.565695	0.6936	0.6816	5008	,	,		9293	0.3899		0.5537	False		,,,				2504	0.5041				p.R30R		.											.	SRD5A1-90	0			c.C90G						.	G		2367,1089		855,657,216	5.0	6.0	5.0		90	0.8	0.0	5	dbSNP_79	5	4176,3144		1277,1622,761	no	coding-synonymous	SRD5A1	NM_001047.2		2132,2279,977	GG,GC,CC		42.9508,31.5104,39.2817		30/260	6633779	6543,4233	1728	3660	5388	SO:0001819	synonymous_variant	6715	exon1			CGCGCGCAATCGT	M32313	CCDS3870.1	5p15.31	2008-02-05			ENSG00000145545	ENSG00000145545	1.3.99.5		11284	protein-coding gene	gene with protein product		184753				1686016	Standard	XR_427663		Approved		uc003jdw.3	P18405	OTTHUMG00000090456	ENST00000274192.5:c.90C>G	5.37:g.6633779C>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	6	NM_001047	0	0	0	4	4	B2R7Q1|Q9UHY4|Q9UP36|Q9UP37	Silent	SNP	ENST00000274192.5	37	CCDS3870.1	1204	0.5512820512820513	332	0.6747967479674797	242	0.6685082872928176	214	0.3741258741258741	416	0.5488126649076517	G	11.09	1.537057	0.27475	0.684896	0.570492	ENSG00000145545	ENST00000537411;ENST00000538824	T	0.23552	1.9	3.76	0.815	0.18763	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.28073	-1.0055	7	0.87932	D	0	-7.7997	5.3187	0.15870	0.1814:0.3179:0.5008:0.0	rs248793;rs1691051;rs17850143;rs17850363;rs57936391	39	F5GXK9	.	G	39	ENSP00000440186:A39G	ENSP00000446275:A39G	A	+	2	0	SRD5A1	6686779	0.019000	0.18553	0.000000	0.03702	0.000000	0.00434	1.407000	0.34657	-0.193000	0.10415	-0.132000	0.14878	GCA	C|0.454;G|0.546		0.746	SRD5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206903.1	NM_001047	
CDH12	1010	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	21752043	21752043	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr5:21752043C>A	ENST00000382254.1	-	15	3274	c.2188G>T	c.(2188-2190)Gcc>Tcc	p.A730S	CDH12_ENST00000522262.1_Missense_Mutation_p.A690S|RP11-804N13.1_ENST00000522350.1_RNA|CDH12_ENST00000504376.2_Missense_Mutation_p.A730S|CDH12_ENST00000521384.1_5'UTR	NM_004061.3	NP_004052.2	P55289	CAD12_HUMAN	cadherin 12, type 2 (N-cadherin 2)	730					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(19)|lung(75)|ovary(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	120						TATGGTGGGGCAGTTGGATCC	0.502										HNSCC(59;0.17)																											p.A730S		.											.	CDH12-92	0			c.G2188T						.						228.0	195.0	206.0					5																	21752043		2203	4300	6503	SO:0001583	missense	1010	exon15			GTGGGGCAGTTGG	L33477	CCDS3890.1	5p14.3	2010-01-26			ENSG00000154162	ENSG00000154162		"""Cadherins / Major cadherins"""	1751	protein-coding gene	gene with protein product		600562				7731968	Standard	NM_004061		Approved	Br-cadherin, CDHB	uc003jgk.2	P55289	OTTHUMG00000090591	ENST00000382254.1:c.2188G>T	5.37:g.21752043C>A	ENSP00000371689:p.Ala730Ser	Somatic	162	1		WXS	Illumina GAIIx	Phase_I	350	131	NM_004061	0	0	0	0	0	B2RBT1|B7Z2U6|Q86UD2	Missense_Mutation	SNP	ENST00000382254.1	37	CCDS3890.1	.	.	.	.	.	.	.	.	.	.	C	16.53	3.149023	0.57151	.	.	ENSG00000154162	ENST00000504376;ENST00000382254;ENST00000522262	T;T;T	0.78816	-1.21;-1.21;-1.21	5.12	5.12	0.69794	Cadherin, cytoplasmic domain (1);	0.050671	0.85682	D	0.000000	D	0.89164	0.6637	M	0.86805	2.84	0.48511	D	0.999669	P;P	0.51351	0.944;0.749	D;B	0.62955	0.909;0.297	D	0.90550	0.4508	10	0.59425	D	0.04	.	18.5514	0.91066	0.0:1.0:0.0:0.0	.	690;730	B7Z2U6;P55289	.;CAD12_HUMAN	S	730;730;690	ENSP00000423577:A730S;ENSP00000371689:A730S;ENSP00000428786:A690S	ENSP00000371689:A730S	A	-	1	0	CDH12	21787800	1.000000	0.71417	0.074000	0.20217	0.573000	0.36030	7.818000	0.86416	2.399000	0.81585	0.467000	0.42956	GCC	.		0.502	CDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207139.1	NM_004061	
GPR98	84059	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	90124769	90124769	+	Missense_Mutation	SNP	G	G	T	rs371947306	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr5:90124769G>T	ENST00000405460.2	+	77	16473	c.16377G>T	c.(16375-16377)caG>caT	p.Q5459H	GPR98_ENST00000425867.2_Missense_Mutation_p.Q1120H	NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	5459	Calx-beta 35. {ECO:0000305|PubMed:11606593}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		AGGTACCACAGGTTGAAGTGT	0.303													G|||	8	0.00159744	0.0	0.0	5008	,	,		14940	0.0		0.0	False		,,,				2504	0.0082				p.Q5459H		.											.	GPR98-103	0			c.G16377T						.						59.0	55.0	56.0					5																	90124769		1824	4086	5910	SO:0001583	missense	84059	exon77			ACCACAGGTTGAA	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.16377G>T	5.37:g.90124769G>T	ENSP00000384582:p.Gln5459His	Somatic	27	0		WXS	Illumina GAIIx	Phase_I	32	22	NM_032119	0	0	0	0	0	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	ENST00000405460.2	37	CCDS47246.1	.	.	.	.	.	.	.	.	.	.	G	9.268	1.045054	0.19748	.	.	ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000425867	T;T	0.27557	1.66;1.66	5.71	-3.65	0.04502	.	0.396269	0.29198	N	0.012854	T	0.17704	0.0425	L	0.47716	1.5	0.24982	N	0.991592	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.11329	0.003;0.002;0.006	T	0.11916	-1.0568	9	.	.	.	.	3.3866	0.07274	0.544:0.1007:0.2571:0.0982	.	1120;5459;1120	E7EML1;Q8WXG9;Q8WXG9-2	.;GPR98_HUMAN;.	H	5459;5459;1120	ENSP00000384582:Q5459H;ENSP00000392618:Q1120H	.	Q	+	3	2	GPR98	90160525	0.440000	0.25618	0.239000	0.24122	0.289000	0.27227	0.002000	0.13061	-0.473000	0.06871	-0.768000	0.03414	CAG	.		0.303	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119	
PCDHB3	56132	ucsc.edu	37	5	140482312	140482312	+	Silent	SNP	A	A	G	rs429364	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr5:140482312A>G	ENST00000231130.2	+	1	2079	c.2079A>G	c.(2077-2079)gcA>gcG	p.A693A	AC005754.7_ENST00000607216.1_RNA	NM_018937.2	NP_061760.1	Q9Y5E6	PCDB3_HUMAN	protocadherin beta 3	693					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	72			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGGTGGTGGCATTGGCCTCGG	0.687																																					p.A693A		.											.	PCDHB3-92	0			c.A2079G						.						92.0	93.0	93.0					5																	140482312		2198	4287	6485	SO:0001819	synonymous_variant	56132	exon1			GGTGGCATTGGCC	AF152496	CCDS4245.1	5q31	2010-01-26			ENSG00000113205	ENSG00000113205		"""Cadherins / Protocadherins : Clustered"""	8688	other	protocadherin		606329				10380929	Standard	NM_018937		Approved	PCDH-BETA3	uc003lio.3	Q9Y5E6	OTTHUMG00000129622	ENST00000231130.2:c.2079A>G	5.37:g.140482312A>G		Somatic	11	0		WXS	Illumina GAIIx	Phase_I	138	37	NM_018937	0	0	20	24	4	B2R8P2	Silent	SNP	ENST00000231130.2	37	CCDS4245.1																																																																																			A|0.977;G|0.023		0.687	PCDHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251817.2	NM_018937	
ATXN1	6310	hgsc.bcm.edu	37	6	16327894	16327894	+	Missense_Mutation	SNP	C	C	A	rs201040133	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr6:16327894C>A	ENST00000244769.4	-	8	1584	c.648G>T	c.(646-648)caG>caT	p.Q216H	ATXN1_ENST00000436367.1_Missense_Mutation_p.Q216H	NM_000332.3	NP_000323.2	P54253	ATX1_HUMAN	ataxin 1	216	Poly-Gln.				adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|nuclear export (GO:0051168)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear inclusion body (GO:0042405)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|protein self-association (GO:0043621)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(11)|lung(12)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)	44	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)				gctgctgctgctgctgctgct	0.662													-|||	41	0.0081869	0.0091	0.0014	5008	,	,		12664	0.0109		0.005	False		,,,				2504	0.0123				p.Q216H		.											.	ATXN1-93	0			c.G648T						.						4.0	8.0	7.0					6																	16327894		1839	3762	5601	SO:0001583	missense	6310	exon7			CTGCTGCTGCTGC	X79204	CCDS34342.1	6p23	2014-09-17	2004-08-12	2004-08-13	ENSG00000124788	ENSG00000124788		"""Ataxins"""	10548	protein-coding gene	gene with protein product		601556	"""spinocerebellar ataxia 1 (olivopontocerebellar ataxia 1, autosomal dominant, ataxin 1)"""	SCA1		1582256	Standard	NM_000332		Approved	D6S504E, ATX1	uc010jpi.3	P54253	OTTHUMG00000014303	ENST00000244769.4:c.648G>T	6.37:g.16327894C>A	ENSP00000244769:p.Gln216His	Somatic	6	0		WXS	Illumina GAIIx	Phase_I	76	6	NM_001128164	0	0	5	5	0	Q17S02|Q9UJG2|Q9Y4J1	Missense_Mutation	SNP	ENST00000244769.4	37	CCDS34342.1	.	.	.	.	.	.	.	.	.	.	-	5.041	0.193181	0.09599	.	.	ENSG00000124788	ENST00000244769;ENST00000450222;ENST00000436367	T;T	0.59906	0.23;0.23	.	.	.	.	.	.	.	.	T	0.13415	0.0325	N	0.08118	0	0.09310	N	1	B	0.28713	0.22	B	0.17979	0.02	T	0.14364	-1.0475	7	0.66056	D	0.02	.	.	.	.	.	216	P54253	ATX1_HUMAN	H	216	ENSP00000244769:Q216H;ENSP00000416360:Q216H	ENSP00000244769:Q216H	Q	-	3	2	ATXN1	16435873	0.005000	0.15991	0.008000	0.14137	0.119000	0.20118	-0.699000	0.05087	0.119000	0.18210	0.121000	0.15741	CAG	.		0.662	ATXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039943.3	NM_000332	
ATXN1	6310	hgsc.bcm.edu	37	6	16327900	16327900	+	Missense_Mutation	SNP	C	C	A	rs200111316		TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr6:16327900C>A	ENST00000244769.4	-	8	1578	c.642G>T	c.(640-642)caG>caT	p.Q214H	ATXN1_ENST00000436367.1_Missense_Mutation_p.Q214H	NM_000332.3	NP_000323.2	P54253	ATX1_HUMAN	ataxin 1	214	Poly-Gln.				adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|nuclear export (GO:0051168)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear inclusion body (GO:0042405)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|protein self-association (GO:0043621)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(11)|lung(12)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)	44	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)				gctgctgctgctgctgctgat	0.667																																					p.Q214H		.											.	ATXN1-93	0			c.G642T						.						4.0	8.0	7.0					6																	16327900		1667	3549	5216	SO:0001583	missense	6310	exon7			CTGCTGCTGCTGC	X79204	CCDS34342.1	6p23	2014-09-17	2004-08-12	2004-08-13	ENSG00000124788	ENSG00000124788		"""Ataxins"""	10548	protein-coding gene	gene with protein product		601556	"""spinocerebellar ataxia 1 (olivopontocerebellar ataxia 1, autosomal dominant, ataxin 1)"""	SCA1		1582256	Standard	NM_000332		Approved	D6S504E, ATX1	uc010jpi.3	P54253	OTTHUMG00000014303	ENST00000244769.4:c.642G>T	6.37:g.16327900C>A	ENSP00000244769:p.Gln214His	Somatic	5	0		WXS	Illumina GAIIx	Phase_I	71	6	NM_001128164	0	0	0	0	0	Q17S02|Q9UJG2|Q9Y4J1	Missense_Mutation	SNP	ENST00000244769.4	37	CCDS34342.1	.	.	.	.	.	.	.	.	.	.	C	4.744	0.138290	0.09083	.	.	ENSG00000124788	ENST00000244769;ENST00000450222;ENST00000436367	T;T	0.51325	0.71;0.71	.	.	.	.	.	.	.	.	T	0.04907	0.0132	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.18587	-1.0332	5	0.21014	T	0.42	.	.	.	.	.	214	P54253	ATX1_HUMAN	H	214	ENSP00000244769:Q214H;ENSP00000416360:Q214H	ENSP00000244769:Q214H	Q	-	3	2	ATXN1	16435879	0.001000	0.12720	0.011000	0.14972	0.070000	0.16714	-0.244000	0.08903	-2.096000	0.00852	-2.162000	0.00326	CAG	.		0.667	ATXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039943.3	NM_000332	
HLA-G	3135	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	29797691	29797691	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr6:29797691T>C	ENST00000360323.6	+	5	1018	c.994T>C	c.(994-996)Tgg>Cgg	p.W332R	HLA-G_ENST00000376818.3_Missense_Mutation_p.W240R|HLA-G_ENST00000428701.1_Missense_Mutation_p.W332R|HLA-G_ENST00000376815.3_Missense_Mutation_p.W148R|HLA-G_ENST00000376828.2_Missense_Mutation_p.W337R			P17693	HLAG_HUMAN	major histocompatibility complex, class I, G	332					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular defense response (GO:0006968)|cytokine-mediated signaling pathway (GO:0019221)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T cell tolerance induction (GO:0002666)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)	early endosome membrane (GO:0031901)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|membrane (GO:0016020)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(4)|ovary(3)|pancreas(1)|prostate(5)|skin(1)	21						TGCTGTGCTGTGGAGAAAGAA	0.572																																					p.W332R		.											.	HLA-G-517	0			c.T994C						.						81.0	73.0	76.0					6																	29797691		2203	4300	6503	SO:0001583	missense	3135	exon6			GTGCTGTGGAGAA		CCDS4668.1	6p21.3	2013-01-11	2007-12-12		ENSG00000204632	ENSG00000204632		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4964	protein-coding gene	gene with protein product	"""b2 microglobulin"""	142871	"""HLA-G histocompatibility antigen, class I, G"""				Standard	NM_002127		Approved		uc003nnw.2	P17693	OTTHUMG00000031157	ENST00000360323.6:c.994T>C	6.37:g.29797691T>C	ENSP00000353472:p.Trp332Arg	Somatic	163	0		WXS	Illumina GAIIx	Phase_I	272	125	NM_002127	0	0	0	0	0		Missense_Mutation	SNP	ENST00000360323.6	37	CCDS4668.1	.	.	.	.	.	.	.	.	.	.	.	10.54	1.377580	0.24944	.	.	ENSG00000204632	ENST00000376828;ENST00000428701;ENST00000360323;ENST00000376818;ENST00000376815	T;T;T;T;T	0.00882	5.84;5.83;5.83;5.58;5.86	2.23	0.95	0.19572	.	0.812952	0.10065	U	0.720441	T	0.01870	0.0059	M	0.82630	2.6	0.09310	N	1	D;D;D;D	0.89917	0.985;1.0;0.985;1.0	B;D;B;D	0.91635	0.432;0.999;0.432;0.998	T	0.46789	-0.9166	10	0.87932	D	0	.	4.3881	0.11327	0.0:0.2051:0.0:0.7949	.	148;337;240;332	Q29897;Q5RJ85;Q31611;P17693	.;.;.;HLAG_HUMAN	R	337;332;332;240;148	ENSP00000366024:W337R;ENSP00000412927:W332R;ENSP00000353472:W332R;ENSP00000366014:W240R;ENSP00000366011:W148R	ENSP00000353472:W332R	W	+	1	0	HLA-G	29905670	0.011000	0.17503	0.025000	0.17156	0.034000	0.12701	-0.174000	0.09839	0.787000	0.33731	0.242000	0.17961	TGG	.		0.572	HLA-G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076286.2	NM_002127	
DDR1	780	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	30866949	30866949	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr6:30866949C>T	ENST00000324771.8	+	20	3166	c.2618C>T	c.(2617-2619)cCg>cTg	p.P873L	DDR1_ENST00000376568.3_Missense_Mutation_p.P873L|DDR1_ENST00000376570.4_Missense_Mutation_p.P836L|DDR1_ENST00000508312.1_Missense_Mutation_p.P854L|DDR1_ENST00000418800.2_Missense_Mutation_p.P836L|DDR1_ENST00000376567.2_Missense_Mutation_p.P836L|DDR1_ENST00000454612.2_Missense_Mutation_p.P836L|DDR1_ENST00000452441.1_Missense_Mutation_p.P873L|DDR1_ENST00000361741.4_Intron|DDR1_ENST00000376575.3_Missense_Mutation_p.P879L|DDR1_ENST00000513240.1_Missense_Mutation_p.P879L|DDR1_ENST00000376569.3_Missense_Mutation_p.P836L|DDR1_ENST00000446312.1_3'UTR			Q08345	DDR1_HUMAN	discoidin domain receptor tyrosine kinase 1	873	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				branching involved in mammary gland duct morphogenesis (GO:0060444)|cell adhesion (GO:0007155)|collagen-activated tyrosine kinase receptor signaling pathway (GO:0038063)|ear development (GO:0043583)|embryo implantation (GO:0007566)|extracellular matrix organization (GO:0030198)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine autophosphorylation (GO:0038083)|protein autophosphorylation (GO:0046777)|regulation of cell growth (GO:0001558)|regulation of cell-matrix adhesion (GO:0001952)|regulation of extracellular matrix disassembly (GO:0010715)|smooth muscle cell migration (GO:0014909)|smooth muscle cell-matrix adhesion (GO:0061302)|wound healing, spreading of cells (GO:0044319)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|collagen binding (GO:0005518)|metal ion binding (GO:0046872)|protein tyrosine kinase collagen receptor activity (GO:0038062)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.P835L(1)|p.P879L(1)		central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(14)|ovary(1)|prostate(1)|skin(1)	29					Imatinib(DB00619)	CTGTCCCGGCCGCCTGCCTGC	0.587																																					p.P879L		.											.	DDR1-1403	2	Substitution - Missense(2)	large_intestine(2)	c.C2636T						.						87.0	89.0	88.0					6																	30866949		2203	4300	6503	SO:0001583	missense	780	exon17			CCCGGCCGCCTGC	X99031	CCDS4690.1, CCDS34385.1, CCDS47396.1, CCDS56411.1, CCDS75419.1	6p21.33	2010-02-17	2008-01-23		ENSG00000204580	ENSG00000204580	2.7.10.1	"""CD molecules"""	2730	protein-coding gene	gene with protein product		600408	"""discoidin domain receptor family, member 1"""	NTRK4, PTK3A, NEP, CAK, EDDR1		7789998	Standard	NM_001954		Approved	RTK6, CD167	uc003nrv.3	Q08345	OTTHUMG00000031236	ENST00000324771.8:c.2618C>T	6.37:g.30866949C>T	ENSP00000318217:p.Pro873Leu	Somatic	102	0		WXS	Illumina GAIIx	Phase_I	198	91	NM_013994	0	0	128	289	161	B5A975|B5A976|B7Z2K0|Q14196|Q16562|Q2L6H3|Q4LE50|Q5ST11|Q5ST12|Q6NSK4|Q9UD35|Q9UD36|Q9UD37|Q9UD86|Q9UDL2	Missense_Mutation	SNP	ENST00000324771.8	37	CCDS34385.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.972256	0.74246	.	.	ENSG00000204580	ENST00000324771;ENST00000418800;ENST00000454612;ENST00000376569;ENST00000376575;ENST00000376570;ENST00000376568;ENST00000452441;ENST00000508312;ENST00000376567;ENST00000513240;ENST00000484556	D;D;D;D;D;D;D;D;D;D;D	0.86366	-2.11;-2.11;-2.11;-2.11;-2.11;-2.11;-2.11;-2.11;-2.11;-2.11;-2.11	5.0	5.0	0.66597	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.93363	0.7884	M	0.87682	2.9	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.993;0.999	D	0.94449	0.7665	10	0.87932	D	0	.	15.8064	0.78517	0.0:1.0:0.0:0.0	.	854;879;873	B7Z2K0;Q08345-5;Q08345	.;.;DDR1_HUMAN	L	873;836;836;836;879;836;873;873;854;836;879;269	ENSP00000318217:P873L;ENSP00000407699:P836L;ENSP00000406091:P836L;ENSP00000365753:P836L;ENSP00000365759:P879L;ENSP00000365754:P836L;ENSP00000365752:P873L;ENSP00000405039:P873L;ENSP00000422442:P854L;ENSP00000365751:P836L;ENSP00000427552:P879L	ENSP00000318217:P873L	P	+	2	0	DDR1	30974928	1.000000	0.71417	0.969000	0.41365	0.940000	0.58332	7.234000	0.78134	2.324000	0.78689	0.467000	0.42956	CCG	.		0.587	DDR1-005	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076494.3	NM_013994	
CYP21A2	1589	broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	32006983	32006983	+	Silent	SNP	C	C	T			TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr6:32006983C>T	ENST00000418967.2	+	3	563	c.405C>T	c.(403-405)tcC>tcT	p.S135S	C4B-AS1_ENST00000415626.1_RNA|CYP21A2_ENST00000435122.2_Silent_p.S105S	NM_000500.7	NP_000491.4	P08686	CP21A_HUMAN	cytochrome P450, family 21, subfamily A, polypeptide 2	134					glucocorticoid biosynthetic process (GO:0006704)|mineralocorticoid biosynthetic process (GO:0006705)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 21-monooxygenase activity (GO:0004509)|steroid binding (GO:0005496)|steroid hydroxylase activity (GO:0008395)			NS(1)|breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	11					Ketoconazole(DB01026)	TCCGTGACTCCATGGAGCCAG	0.632																																					.	Melanoma(174;1669 1998 3915 34700 46447)	.											.	CYP21A2-68	0			.						.						18.0	16.0	17.0					6																	32006983		2202	4294	6496	SO:0001819	synonymous_variant	1589	.			TGACTCCATGGAG	X58906	CCDS4735.1, CCDS47406.1	6p21.3	2014-09-17	2003-01-14		ENSG00000231852	ENSG00000231852	1.14.99.10	"""Cytochrome P450s"""	2600	protein-coding gene	gene with protein product	"""Steroid 21-monooxygenase"""	613815	"""cytochrome P450, subfamily XXIA (steroid 21-hydroxylase, congenital adrenal hyperplasia), polypeptide 2"""	CYP21, CYP21B			Standard	NM_000500		Approved	P450c21B, CA21H, CPS1, CAH1	uc021yvd.1	P08686	OTTHUMG00000031069	ENST00000418967.2:c.405C>T	6.37:g.32006983C>T		Somatic	214	0		WXS	Illumina GAIIx	Phase_I	480	199	.	0	0	832	1524	692	A2BHY6|P04033|Q01204|Q08AG8|Q16749|Q16806|Q5ST44|Q96NU8	Silent	SNP	ENST00000418967.2	37	CCDS4735.1																																																																																			.		0.632	CYP21A2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268768.2	NM_000500	
TNXB	7148	broad.mit.edu	37	6	32063513	32063514	+	Frame_Shift_Del	DEL	AC	AC	-	rs144556766		TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr6:32063513_32063514delAC	ENST00000479795.1	-	3	2256_2257	c.2116_2117delGT	c.(2116-2118)gtafs	p.V706fs	TNXB_ENST00000375244.3_Frame_Shift_Del_p.V706fs|TNXB_ENST00000375247.2_Frame_Shift_Del_p.V706fs			P22105	TENX_HUMAN	tenascin XB	706	EGF-like 18. {ECO:0000255|PROSITE- ProRule:PRU00076}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						GAAGCCCTCTACACACACACAC	0.668																																					p.706_706del		.											.	TNXB-90	0			c.2116_2117del						.																																			SO:0001589	frameshift_variant	7148	exon3			CCCTCTACACACA	X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000479795.1:c.2116_2117delGT	6.37:g.32063523_32063524delAC	ENSP00000418248:p.Val706fs	Somatic	150	0		WXS	Illumina GAIIx	Phase_I	618	11	NM_019105	0	0	0	0	0	P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Frame_Shift_Del	DEL	ENST00000479795.1	37																																																																																				.		0.668	TNXB-007	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000357059.1	NM_019105	
DNAH8	1769	bcgsc.ca	37	6	38800209	38800209	+	Silent	SNP	T	T	C	rs1678729	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr6:38800209T>C	ENST00000359357.3	+	29	3903	c.3649T>C	c.(3649-3651)Ttg>Ctg	p.L1217L	DNAH8_ENST00000441566.1_Silent_p.L1217L|DNAH8_ENST00000449981.2_Silent_p.L1434L			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	1217					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						AGCATATGAATTGGTAATTTA	0.363													T|||	1365	0.272564	0.4259	0.2161	5008	,	,		18954	0.2917		0.1272	False		,,,				2504	0.2352				p.L1434L		.											.	DNAH8-615	0			c.T4300C						.	T		1614,2792	497.2+/-363.8	299,1016,888	109.0	107.0	108.0		4300	-5.7	0.0	6	dbSNP_89	108	1175,7425	238.1+/-269.7	78,1019,3203	no	coding-synonymous	DNAH8	NM_001206927.1		377,2035,4091	CC,CT,TT		13.6628,36.6319,21.4439		1434/4708	38800209	2789,10217	2203	4300	6503	SO:0001819	synonymous_variant	1769	exon31			TATGAATTGGTAA	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.3649T>C	6.37:g.38800209T>C		Somatic	114	1		WXS	Illumina GAIIx	Phase_I	164	6	NM_001206927	0	0	0	0	0	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Silent	SNP	ENST00000359357.3	37																																																																																				T|0.758;C|0.242		0.363	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927	
KCNK17	89822	hgsc.bcm.edu	37	6	39282036	39282036	+	Missense_Mutation	SNP	T	T	C	rs10947804	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr6:39282036T>C	ENST00000373231.4	-	1	293	c.61A>G	c.(61-63)Agc>Ggc	p.S21G	KCNK17_ENST00000453413.2_Missense_Mutation_p.S21G	NM_031460.3	NP_113648.2	Q96T54	KCNKH_HUMAN	potassium channel, subfamily K, member 17	21			S -> G (in dbSNP:rs10947804). {ECO:0000269|PubMed:11248242, ECO:0000269|PubMed:15489334}.		potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(2)	14						AGCACGGTGCTGGGCACCGCG	0.761													T|||	2917	0.582468	0.8858	0.4553	5008	,	,		12417	0.4673		0.4851	False		,,,				2504	0.4816				p.S21G		.											.	KCNK17-227	0			c.A61G						.	T	GLY/SER,GLY/SER	3100,536		1364,372,82	3.0	4.0	3.0		61,61	2.1	0.0	6	dbSNP_120	3	4061,3263		1251,1559,852	yes	missense,missense	KCNK17	NM_001135111.1,NM_031460.3	56,56	2615,1931,934	CC,CT,TT		44.5522,14.7415,34.6624	benign,benign	21/272,21/333	39282036	7161,3799	1818	3662	5480	SO:0001583	missense	89822	exon1			CGGTGCTGGGCAC	AF358910	CCDS4842.1, CCDS47419.1	6p21	2012-03-07			ENSG00000124780	ENSG00000124780		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	14465	protein-coding gene	gene with protein product		607370				16382106	Standard	NM_031460		Approved	K2p17.1, TALK-2, TALK2, TASK4, TASK-4	uc003ooo.3	Q96T54	OTTHUMG00000014646	ENST00000373231.4:c.61A>G	6.37:g.39282036T>C	ENSP00000362328:p.Ser21Gly	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_001135111	0	0	0	0	0	E9PB46|Q5TCF4|Q8TAW4|Q9BXD1|Q9H592	Missense_Mutation	SNP	ENST00000373231.4	37	CCDS4842.1	1214	0.5558608058608059	431	0.8760162601626016	173	0.47790055248618785	244	0.42657342657342656	366	0.48284960422163586	T	8.033	0.762256	0.15914	0.852585	0.554478	ENSG00000124780	ENST00000373231;ENST00000453413	T;T	0.56776	0.44;0.44	4.06	2.09	0.27110	.	1.425750	0.04586	N	0.395947	T	0.14184	0.0343	N	0.17082	0.46	0.80722	P	0.0	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	T	0.09122	-1.0689	9	0.21014	T	0.42	.	5.3388	0.15973	0.0:0.5516:0.0:0.4484	rs10947804;rs17845776;rs17858736;rs60349641	21;21	E9PB46;Q96T54	.;KCNKH_HUMAN	G	21	ENSP00000362328:S21G;ENSP00000401271:S21G	ENSP00000362328:S21G	S	-	1	0	KCNK17	39390014	0.000000	0.05858	0.003000	0.11579	0.032000	0.12392	-0.229000	0.09098	0.383000	0.24910	0.459000	0.35465	AGC	T|0.441;C|0.559		0.761	KCNK17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040453.2	NM_031460	
TMEM151B	441151	hgsc.bcm.edu	37	6	44243154	44243154	+	Silent	SNP	C	C	T	rs12194552	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr6:44243154C>T	ENST00000451188.2	+	3	868	c.591C>T	c.(589-591)cgC>cgT	p.R197R	TMEM151B_ENST00000438774.2_Intron|RP11-444E17.6_ENST00000505802.1_Intron	NM_001137560.1	NP_001131032.1	Q8IW70	T151B_HUMAN	transmembrane protein 151B	197						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)	6						ACCACGAACGCGTCAACACGC	0.726													C|||	140	0.0279553	0.0023	0.036	5008	,	,		12642	0.001		0.0825	False		,,,				2504	0.0286				p.R197R		.											.	.	0			c.C591T						.	C		17,1325		0,17,654	6.0	9.0	9.0		591	-2.1	1.0	6	dbSNP_120	9	223,2889		9,205,1342	no	coding-synonymous	TMEM151B	NM_001137560.1		9,222,1996	TT,TC,CC		7.1658,1.2668,5.3884		197/567	44243154	240,4214	671	1556	2227	SO:0001819	synonymous_variant	441151	exon3			CGAACGCGTCAAC	AK126839	CCDS47437.1	6p21.1	2009-04-17	2007-10-25	2007-10-25	ENSG00000178233	ENSG00000178233			21315	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 137"", ""transmembrane protein 193"""	C6orf137, TMEM193			Standard	NM_001137560		Approved	bA444E17.5	uc003oxh.2	Q8IW70	OTTHUMG00000014765	ENST00000451188.2:c.591C>T	6.37:g.44243154C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	25	12	NM_001137560	0	0	0	0	0	Q5T9V7	Silent	SNP	ENST00000451188.2	37	CCDS47437.1																																																																																			C|0.967;T|0.033		0.726	TMEM151B-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040740.2	NM_001039704	
AIM1	202	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	106968127	106968127	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr6:106968127C>T	ENST00000369066.3	+	2	2307	c.1820C>T	c.(1819-1821)tCt>tTt	p.S607F		NM_001624.2	NP_001615	Q9UMX9	S45A2_HUMAN	absent in melanoma 1	0					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				breast(8)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(7)|large_intestine(13)|lung(20)|ovary(5)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	69	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		AATGAACACTCTCATTGCACA	0.507																																					p.S607F		.											.	AIM1-139	0			c.C1820T						.						83.0	85.0	84.0					6																	106968127		2203	4300	6503	SO:0001583	missense	202	exon2			AACACTCTCATTG	U83115	CCDS34506.1	6q21	2014-01-29			ENSG00000112297	ENSG00000112297			356	protein-coding gene	gene with protein product	"""suppression of tumorigenicity 4"", ""beta-gamma crystallin domain containing 1"""	601797	"""suppression of tumorigenicity 4 (malignant melanoma)"""	ST4		1680551, 12693952	Standard	NM_001624		Approved	CRYBG1	uc003prh.3	Q9Y4K1	OTTHUMG00000015302	ENST00000369066.3:c.1820C>T	6.37:g.106968127C>T	ENSP00000358062:p.Ser607Phe	Somatic	108	0		WXS	Illumina GAIIx	Phase_I	139	51	NM_001624	0	0	1	1	0	Q6P2P0|Q9BTM3	Missense_Mutation	SNP	ENST00000369066.3	37	CCDS34506.1	.	.	.	.	.	.	.	.	.	.	C	12.67	2.007750	0.35415	.	.	ENSG00000112297	ENST00000285105;ENST00000369066	T	0.72505	-0.66	5.44	-8.48	0.00935	.	3.236840	0.00892	N	0.002254	T	0.31263	0.0791	N	0.22421	0.69	0.09310	N	0.999996	B	0.21309	0.054	B	0.21151	0.033	T	0.33292	-0.9874	10	0.48119	T	0.1	.	8.5683	0.33554	0.0:0.3687:0.3832:0.2481	.	607	Q9Y4K1	AIM1_HUMAN	F	1015;607	ENSP00000358062:S607F	ENSP00000285105:S1015F	S	+	2	0	AIM1	107074820	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.434000	0.06939	-1.541000	0.01727	0.655000	0.94253	TCT	.		0.507	AIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041669.1		
AIM1	202	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	106968157	106968157	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr6:106968157C>T	ENST00000369066.3	+	2	2337	c.1850C>T	c.(1849-1851)tCt>tTt	p.S617F		NM_001624.2	NP_001615	Q9UMX9	S45A2_HUMAN	absent in melanoma 1	0					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				breast(8)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(7)|large_intestine(13)|lung(20)|ovary(5)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	69	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		GCGGCAAAATCTGGCCCACAA	0.527																																					p.S617F		.											.	AIM1-139	0			c.C1850T						.						68.0	70.0	70.0					6																	106968157		2203	4300	6503	SO:0001583	missense	202	exon2			CAAAATCTGGCCC	U83115	CCDS34506.1	6q21	2014-01-29			ENSG00000112297	ENSG00000112297			356	protein-coding gene	gene with protein product	"""suppression of tumorigenicity 4"", ""beta-gamma crystallin domain containing 1"""	601797	"""suppression of tumorigenicity 4 (malignant melanoma)"""	ST4		1680551, 12693952	Standard	NM_001624		Approved	CRYBG1	uc003prh.3	Q9Y4K1	OTTHUMG00000015302	ENST00000369066.3:c.1850C>T	6.37:g.106968157C>T	ENSP00000358062:p.Ser617Phe	Somatic	108	0		WXS	Illumina GAIIx	Phase_I	135	53	NM_001624	0	0	1	1	0	Q6P2P0|Q9BTM3	Missense_Mutation	SNP	ENST00000369066.3	37	CCDS34506.1	.	.	.	.	.	.	.	.	.	.	C	16.83	3.230711	0.58777	.	.	ENSG00000112297	ENST00000285105;ENST00000369066	T	0.76186	-1.0	5.96	4.15	0.48705	.	2.237630	0.02003	N	0.046440	T	0.59307	0.2184	L	0.56769	1.78	0.22280	N	0.999238	P	0.45902	0.868	B	0.43052	0.406	T	0.45542	-0.9254	10	0.42905	T	0.14	.	7.3521	0.26697	0.1668:0.7491:0.0:0.0841	.	617	Q9Y4K1	AIM1_HUMAN	F	1025;617	ENSP00000358062:S617F	ENSP00000285105:S1025F	S	+	2	0	AIM1	107074850	0.005000	0.15991	0.001000	0.08648	0.117000	0.20001	1.361000	0.34136	0.815000	0.34398	0.655000	0.94253	TCT	.		0.527	AIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041669.1		
AIM1	202	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	106968170	106968170	+	Silent	SNP	C	C	T			TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr6:106968170C>T	ENST00000369066.3	+	2	2350	c.1863C>T	c.(1861-1863)gtC>gtT	p.V621V		NM_001624.2	NP_001615	Q9UMX9	S45A2_HUMAN	absent in melanoma 1	0					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				breast(8)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(7)|large_intestine(13)|lung(20)|ovary(5)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	69	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		GCCCACAAGTCATACCGCCAG	0.537																																					p.V621V		.											.	AIM1-139	0			c.C1863T						.						66.0	69.0	68.0					6																	106968170		2203	4300	6503	SO:0001819	synonymous_variant	202	exon2			ACAAGTCATACCG	U83115	CCDS34506.1	6q21	2014-01-29			ENSG00000112297	ENSG00000112297			356	protein-coding gene	gene with protein product	"""suppression of tumorigenicity 4"", ""beta-gamma crystallin domain containing 1"""	601797	"""suppression of tumorigenicity 4 (malignant melanoma)"""	ST4		1680551, 12693952	Standard	NM_001624		Approved	CRYBG1	uc003prh.3	Q9Y4K1	OTTHUMG00000015302	ENST00000369066.3:c.1863C>T	6.37:g.106968170C>T		Somatic	106	0		WXS	Illumina GAIIx	Phase_I	136	47	NM_001624	0	0	1	1	0	Q6P2P0|Q9BTM3	Silent	SNP	ENST00000369066.3	37	CCDS34506.1																																																																																			.		0.537	AIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041669.1		
AIM1	202	hgsc.bcm.edu;bcgsc.ca	37	6	106968184	106968184	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr6:106968184C>T	ENST00000369066.3	+	2	2364	c.1877C>T	c.(1876-1878)tCa>tTa	p.S626L		NM_001624.2	NP_001615	Q9UMX9	S45A2_HUMAN	absent in melanoma 1	0					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				breast(8)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(7)|large_intestine(13)|lung(20)|ovary(5)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	69	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		CCGCCAGCATCAGAGAAAACT	0.532																																					p.S626L		.											.	AIM1-139	0			c.C1877T						.						65.0	67.0	66.0					6																	106968184		2203	4300	6503	SO:0001583	missense	202	exon2			CAGCATCAGAGAA	U83115	CCDS34506.1	6q21	2014-01-29			ENSG00000112297	ENSG00000112297			356	protein-coding gene	gene with protein product	"""suppression of tumorigenicity 4"", ""beta-gamma crystallin domain containing 1"""	601797	"""suppression of tumorigenicity 4 (malignant melanoma)"""	ST4		1680551, 12693952	Standard	NM_001624		Approved	CRYBG1	uc003prh.3	Q9Y4K1	OTTHUMG00000015302	ENST00000369066.3:c.1877C>T	6.37:g.106968184C>T	ENSP00000358062:p.Ser626Leu	Somatic	110	0		WXS	Illumina GAIIx	Phase_I	133	46	NM_001624	0	0	0	0	0	Q6P2P0|Q9BTM3	Missense_Mutation	SNP	ENST00000369066.3	37	CCDS34506.1	.	.	.	.	.	.	.	.	.	.	C	10.92	1.487150	0.26686	.	.	ENSG00000112297	ENST00000285105;ENST00000369066	T	0.71934	-0.61	5.96	2.78	0.32641	.	1.623460	0.04018	N	0.299327	T	0.45558	0.1348	L	0.54323	1.7	0.09310	N	0.999993	B	0.06786	0.001	B	0.06405	0.002	T	0.22417	-1.0217	10	0.31617	T	0.26	.	6.6445	0.22927	0.0:0.6697:0.1524:0.1778	.	626	Q9Y4K1	AIM1_HUMAN	L	1034;626	ENSP00000358062:S626L	ENSP00000285105:S1034L	S	+	2	0	AIM1	107074877	0.001000	0.12720	0.001000	0.08648	0.002000	0.02628	0.909000	0.28558	0.848000	0.35191	-0.150000	0.13652	TCA	.		0.532	AIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041669.1		
AIM1	202	hgsc.bcm.edu;bcgsc.ca	37	6	106968204	106968204	+	Nonsense_Mutation	SNP	C	C	T			TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr6:106968204C>T	ENST00000369066.3	+	2	2384	c.1897C>T	c.(1897-1899)Cag>Tag	p.Q633*		NM_001624.2	NP_001615	Q9UMX9	S45A2_HUMAN	absent in melanoma 1	0					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				breast(8)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(7)|large_intestine(13)|lung(20)|ovary(5)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	69	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		TCTGCCTATTCAGGCTCAAAG	0.537																																					p.Q633X		.											.	AIM1-139	0			c.C1897T						.						64.0	65.0	65.0					6																	106968204		2203	4300	6503	SO:0001587	stop_gained	202	exon2			CCTATTCAGGCTC	U83115	CCDS34506.1	6q21	2014-01-29			ENSG00000112297	ENSG00000112297			356	protein-coding gene	gene with protein product	"""suppression of tumorigenicity 4"", ""beta-gamma crystallin domain containing 1"""	601797	"""suppression of tumorigenicity 4 (malignant melanoma)"""	ST4		1680551, 12693952	Standard	NM_001624		Approved	CRYBG1	uc003prh.3	Q9Y4K1	OTTHUMG00000015302	ENST00000369066.3:c.1897C>T	6.37:g.106968204C>T	ENSP00000358062:p.Gln633*	Somatic	121	0		WXS	Illumina GAIIx	Phase_I	147	51	NM_001624	0	0	0	0	0	Q6P2P0|Q9BTM3	Nonsense_Mutation	SNP	ENST00000369066.3	37	CCDS34506.1	.	.	.	.	.	.	.	.	.	.	C	42	9.506017	0.99190	.	.	ENSG00000112297	ENST00000285105;ENST00000369066	.	.	.	5.64	4.75	0.60458	.	0.548978	0.15191	N	0.275567	.	.	.	.	.	.	0.44323	D	0.997205	.	.	.	.	.	.	.	.	.	.	0.22706	T	0.39	.	12.2565	0.54627	0.0:0.8288:0.1712:0.0	.	.	.	.	X	1041;633	.	ENSP00000285105:Q1041X	Q	+	1	0	AIM1	107074897	0.035000	0.19736	0.306000	0.25113	0.019000	0.09904	1.715000	0.37971	1.319000	0.45190	0.561000	0.74099	CAG	.		0.537	AIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041669.1		
AIM1	202	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	106968252	106968252	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr6:106968252C>T	ENST00000369066.3	+	2	2432	c.1945C>T	c.(1945-1947)Ccc>Tcc	p.P649S		NM_001624.2	NP_001615	Q9UMX9	S45A2_HUMAN	absent in melanoma 1	0					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				breast(8)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(7)|large_intestine(13)|lung(20)|ovary(5)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	69	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		TGAATCCAGTCCCACCAACTC	0.517																																					p.P649S		.											.	AIM1-139	0			c.C1945T						.						56.0	55.0	56.0					6																	106968252		2203	4300	6503	SO:0001583	missense	202	exon2			TCCAGTCCCACCA	U83115	CCDS34506.1	6q21	2014-01-29			ENSG00000112297	ENSG00000112297			356	protein-coding gene	gene with protein product	"""suppression of tumorigenicity 4"", ""beta-gamma crystallin domain containing 1"""	601797	"""suppression of tumorigenicity 4 (malignant melanoma)"""	ST4		1680551, 12693952	Standard	NM_001624		Approved	CRYBG1	uc003prh.3	Q9Y4K1	OTTHUMG00000015302	ENST00000369066.3:c.1945C>T	6.37:g.106968252C>T	ENSP00000358062:p.Pro649Ser	Somatic	149	0		WXS	Illumina GAIIx	Phase_I	179	64	NM_001624	0	0	2	2	0	Q6P2P0|Q9BTM3	Missense_Mutation	SNP	ENST00000369066.3	37	CCDS34506.1	.	.	.	.	.	.	.	.	.	.	C	12.35	1.913088	0.33815	.	.	ENSG00000112297	ENST00000285105;ENST00000369066	T	0.73047	-0.71	5.63	1.85	0.25348	.	0.704250	0.11982	N	0.510689	T	0.35219	0.0924	L	0.47716	1.5	0.19300	N	0.99998	B	0.12013	0.005	B	0.12156	0.007	T	0.21518	-1.0243	10	0.20046	T	0.44	.	4.7436	0.13026	0.1436:0.5007:0.2777:0.078	.	649	Q9Y4K1	AIM1_HUMAN	S	1057;649	ENSP00000358062:P649S	ENSP00000285105:P1057S	P	+	1	0	AIM1	107074945	0.000000	0.05858	0.001000	0.08648	0.100000	0.18952	0.316000	0.19469	0.052000	0.16007	0.655000	0.94253	CCC	.		0.517	AIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041669.1		
AIM1	202	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	106968291	106968291	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr6:106968291C>T	ENST00000369066.3	+	2	2471	c.1984C>T	c.(1984-1986)Cct>Tct	p.P662S		NM_001624.2	NP_001615	Q9UMX9	S45A2_HUMAN	absent in melanoma 1	0					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				breast(8)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(7)|large_intestine(13)|lung(20)|ovary(5)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	69	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		CTTAGCCACTCCTCAAAGGCC	0.493																																					p.P662S		.											.	AIM1-139	0			c.C1984T						.						50.0	49.0	49.0					6																	106968291		2203	4300	6503	SO:0001583	missense	202	exon2			GCCACTCCTCAAA	U83115	CCDS34506.1	6q21	2014-01-29			ENSG00000112297	ENSG00000112297			356	protein-coding gene	gene with protein product	"""suppression of tumorigenicity 4"", ""beta-gamma crystallin domain containing 1"""	601797	"""suppression of tumorigenicity 4 (malignant melanoma)"""	ST4		1680551, 12693952	Standard	NM_001624		Approved	CRYBG1	uc003prh.3	Q9Y4K1	OTTHUMG00000015302	ENST00000369066.3:c.1984C>T	6.37:g.106968291C>T	ENSP00000358062:p.Pro662Ser	Somatic	156	0		WXS	Illumina GAIIx	Phase_I	172	61	NM_001624	0	0	1	1	0	Q6P2P0|Q9BTM3	Missense_Mutation	SNP	ENST00000369066.3	37	CCDS34506.1	.	.	.	.	.	.	.	.	.	.	C	10.03	1.237631	0.22711	.	.	ENSG00000112297	ENST00000285105;ENST00000369066	T	0.70869	-0.52	5.76	1.43	0.22495	.	1.246280	0.05794	N	0.610870	T	0.24890	0.0604	L	0.27053	0.805	0.09310	N	0.999998	B	0.26935	0.164	B	0.22601	0.04	T	0.15122	-1.0448	10	0.06891	T	0.86	.	2.9754	0.05936	0.1459:0.5383:0.1423:0.1734	.	662	Q9Y4K1	AIM1_HUMAN	S	1070;662	ENSP00000358062:P662S	ENSP00000285105:P1070S	P	+	1	0	AIM1	107074984	0.000000	0.05858	0.000000	0.03702	0.029000	0.11900	-0.097000	0.11042	0.352000	0.24053	-0.165000	0.13383	CCT	.		0.493	AIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041669.1		
AIM1	202	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	106968355	106968355	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr6:106968355C>T	ENST00000369066.3	+	2	2535	c.2048C>T	c.(2047-2049)tCt>tTt	p.S683F		NM_001624.2	NP_001615	Q9UMX9	S45A2_HUMAN	absent in melanoma 1	0					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				breast(8)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(7)|large_intestine(13)|lung(20)|ovary(5)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	69	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		TTGAACATTTCTGCTGGTAGT	0.423																																					p.S683F		.											.	AIM1-139	0			c.C2048T						.						48.0	51.0	50.0					6																	106968355		2203	4300	6503	SO:0001583	missense	202	exon2			ACATTTCTGCTGG	U83115	CCDS34506.1	6q21	2014-01-29			ENSG00000112297	ENSG00000112297			356	protein-coding gene	gene with protein product	"""suppression of tumorigenicity 4"", ""beta-gamma crystallin domain containing 1"""	601797	"""suppression of tumorigenicity 4 (malignant melanoma)"""	ST4		1680551, 12693952	Standard	NM_001624		Approved	CRYBG1	uc003prh.3	Q9Y4K1	OTTHUMG00000015302	ENST00000369066.3:c.2048C>T	6.37:g.106968355C>T	ENSP00000358062:p.Ser683Phe	Somatic	95	0		WXS	Illumina GAIIx	Phase_I	105	35	NM_001624	0	0	0	0	0	Q6P2P0|Q9BTM3	Missense_Mutation	SNP	ENST00000369066.3	37	CCDS34506.1	.	.	.	.	.	.	.	.	.	.	C	16.11	3.030343	0.54790	.	.	ENSG00000112297	ENST00000285105;ENST00000369066	T	0.79554	-1.28	6.17	6.17	0.99709	.	0.321791	0.26196	N	0.025772	D	0.86900	0.6044	L	0.56769	1.78	0.80722	D	1	D	0.89917	1.0	D	0.65573	0.936	D	0.86369	0.1722	10	0.87932	D	0	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	683	Q9Y4K1	AIM1_HUMAN	F	1091;683	ENSP00000358062:S683F	ENSP00000285105:S1091F	S	+	2	0	AIM1	107075048	1.000000	0.71417	0.981000	0.43875	0.041000	0.13682	2.811000	0.47986	2.941000	0.99782	0.655000	0.94253	TCT	.		0.423	AIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041669.1		
AIM1	202	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	106978066	106978066	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr6:106978066C>T	ENST00000369066.3	+	6	3857	c.3370C>T	c.(3370-3372)Cac>Tac	p.H1124Y		NM_001624.2	NP_001615	Q9UMX9	S45A2_HUMAN	absent in melanoma 1	0					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				breast(8)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(7)|large_intestine(13)|lung(20)|ovary(5)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	69	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		CAGAGTTAGTCACATTGACTT	0.353																																					p.H1124Y		.											.	AIM1-139	0			c.C3370T						.						131.0	124.0	127.0					6																	106978066		2203	4300	6503	SO:0001583	missense	202	exon6			GTTAGTCACATTG	U83115	CCDS34506.1	6q21	2014-01-29			ENSG00000112297	ENSG00000112297			356	protein-coding gene	gene with protein product	"""suppression of tumorigenicity 4"", ""beta-gamma crystallin domain containing 1"""	601797	"""suppression of tumorigenicity 4 (malignant melanoma)"""	ST4		1680551, 12693952	Standard	NM_001624		Approved	CRYBG1	uc003prh.3	Q9Y4K1	OTTHUMG00000015302	ENST00000369066.3:c.3370C>T	6.37:g.106978066C>T	ENSP00000358062:p.His1124Tyr	Somatic	100	0		WXS	Illumina GAIIx	Phase_I	178	85	NM_001624	0	0	0	0	0	Q6P2P0|Q9BTM3	Missense_Mutation	SNP	ENST00000369066.3	37	CCDS34506.1	.	.	.	.	.	.	.	.	.	.	C	15.94	2.981395	0.53827	.	.	ENSG00000112297	ENST00000369066	T	0.74842	-0.88	5.32	5.32	0.75619	Beta/gamma crystallin (3);Gamma-crystallin-related (1);	0.476376	0.26187	N	0.025826	T	0.62792	0.2457	N	0.22421	0.69	0.80722	D	1	B	0.29909	0.261	B	0.40602	0.334	T	0.68930	-0.5279	10	0.87932	D	0	.	19.014	0.92886	0.0:1.0:0.0:0.0	.	1124	Q9Y4K1	AIM1_HUMAN	Y	1124	ENSP00000358062:H1124Y	ENSP00000358062:H1124Y	H	+	1	0	AIM1	107084759	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	4.136000	0.58004	2.486000	0.83907	0.563000	0.77884	CAC	.		0.353	AIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041669.1		
TRAF3IP2	10758	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	111912951	111912951	+	Silent	SNP	G	G	A			TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr6:111912951G>A	ENST00000340026.6	-	3	960	c.366C>T	c.(364-366)gtC>gtT	p.V122V	TRAF3IP2_ENST00000392556.4_5'UTR|TRAF3IP2_ENST00000368761.5_Silent_p.V113V|TRAF3IP2_ENST00000359831.4_Silent_p.V113V|TRAF3IP2-AS1_ENST00000532353.1_RNA			O43734	CIKS_HUMAN	TRAF3 interacting protein 2	122	Mediates interaction with TRAF6.				B cell apoptotic process (GO:0001783)|humoral immune response (GO:0006959)|immunoglobulin secretion (GO:0048305)|intracellular signal transduction (GO:0035556)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)					central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|prostate(1)|urinary_tract(1)	18		all_cancers(87;7.87e-06)|Acute lymphoblastic leukemia(125;3.61e-09)|all_hematologic(75;2.63e-07)|all_epithelial(87;0.0024)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.033)|all cancers(137;0.0412)|Epithelial(106;0.0732)		CAGGCTCGCTGACTGCAGAGC	0.532																																					p.V113V		.											.	TRAF3IP2-228	0			c.C339T						.						41.0	41.0	41.0					6																	111912951		2203	4300	6503	SO:0001819	synonymous_variant	10758	exon2			CTCGCTGACTGCA	AF136405	CCDS5093.1, CCDS55049.1, CCDS55050.1	6q21	2008-09-05	2002-06-20	2005-04-13	ENSG00000056972	ENSG00000056972			1343	protein-coding gene	gene with protein product		607043	"""chromosome 6 open reading frame 5"", ""chromosome 6 open reading frame 2"""	C6orf4, C6orf5, C6orf6, C6orf2		10962033, 10962024	Standard	NR_028338		Approved	DKFZP586G0522, ACT1, CIKS	uc003pvf.4	O43734	OTTHUMG00000015379	ENST00000340026.6:c.366C>T	6.37:g.111912951G>A		Somatic	86	1		WXS	Illumina GAIIx	Phase_I	142	70	NM_147686	0	0	9	13	4	B2RAY9|E1P555|Q5R3A3|Q7Z6Q1|Q7Z6Q2|Q7Z6Q3|Q9H5W2|Q9H6Y3|Q9NS14|Q9UG72	Silent	SNP	ENST00000340026.6	37																																																																																				.		0.532	TRAF3IP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000041841.2		
TCP10	6953	bcgsc.ca	37	6	167789493	167789493	+	Missense_Mutation	SNP	T	T	C	rs3010590	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr6:167789493T>C	ENST00000397829.4	-	6	816	c.649A>G	c.(649-651)Acc>Gcc	p.T217A	TCP10_ENST00000366827.2_Missense_Mutation_p.T217A	NM_004610.3	NP_004601.3	Q12799	TCP10_HUMAN	t-complex 10	244						cytosol (GO:0005829)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(2)|lung(6)	18		Breast(66;1.53e-05)|Ovarian(120;0.024)		OV - Ovarian serous cystadenocarcinoma(33;4.05e-20)|BRCA - Breast invasive adenocarcinoma(81;1.1e-06)|GBM - Glioblastoma multiforme(31;0.0386)		TGCAGCGTGGTGGCCTGGGAA	0.587													N|||	1278	0.255192	0.3434	0.2118	5008	,	,		15348	0.1657		0.2634	False		,,,				2504	0.2505				p.T217A		.											.	TCP10-89	0			c.A649G						.						23.0	28.0	27.0					6																	167789493		1975	4166	6141	SO:0001583	missense	6953	exon6			GCGTGGTGGCCTG	U03399	CCDS43527.1	6q27	2012-09-20	2012-09-20		ENSG00000203690	ENSG00000203690			11656	protein-coding gene	gene with protein product		187020	"""t-complex 10 (a murine tcp homolog)"", ""t-complex 10 (mouse)"", ""t-complex 10 homolog (mouse)"""			8111376	Standard	NM_004610		Approved		uc003qvv.1	Q12799	OTTHUMG00000016026	ENST00000397829.4:c.649A>G	6.37:g.167789493T>C	ENSP00000380929:p.Thr217Ala	Somatic	68	2		WXS	Illumina GAIIx	Phase_I	75	6	NM_004610	0	0	0	0	0	Q5JR60|Q6P4F4	Missense_Mutation	SNP	ENST00000397829.4	37	CCDS43527.1	439	0.20100732600732601	110	0.22357723577235772	72	0.19889502762430938	90	0.15734265734265734	167	0.22031662269129287	C	1.066	-0.671381	0.03403	.	.	ENSG00000203690	ENST00000366827;ENST00000397829	T;T	0.25579	1.79;1.79	1.65	0.695	0.18070	.	.	.	.	.	T	0.02571	0.0078	N	0.02802	-0.49	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.43925	-0.9361	8	0.31617	T	0.26	.	3.9987	0.09570	0.0:0.5352:0.0:0.4648	rs3010590;rs10455986;rs57900456	244;244	Q12799;Q12799-2	TCP10_HUMAN;.	A	217	ENSP00000355792:T217A;ENSP00000380929:T217A	ENSP00000355792:T217A	T	-	1	0	TCP10	167709483	0.001000	0.12720	0.000000	0.03702	0.188000	0.23474	-0.366000	0.07563	-0.117000	0.11872	-0.665000	0.03846	ACC	T|0.760;C|0.240		0.587	TCP10-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000365570.1	NM_004610	
MICALL2	79778	hgsc.bcm.edu	37	7	1484572	1484572	+	Silent	SNP	A	A	G	rs10435184	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr7:1484572A>G	ENST00000297508.7	-	6	1309	c.1134T>C	c.(1132-1134)ggT>ggC	p.G378G	MICALL2_ENST00000405088.4_Silent_p.G166G	NM_182924.3	NP_891554.1	Q8IY33	MILK2_HUMAN	MICAL-like 2	378	Mediates targeting to the cell plasma membrane. {ECO:0000250}.|Necessary and sufficient for interaction with actinins. {ECO:0000250}.				actin cytoskeleton reorganization (GO:0031532)|actin filament polymerization (GO:0030041)|endocytic recycling (GO:0032456)|neuron projection development (GO:0031175)|substrate adhesion-dependent cell spreading (GO:0034446)|tight junction assembly (GO:0070830)	cell-cell junction (GO:0005911)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)|stress fiber (GO:0001725)|tight junction (GO:0005923)	actin filament binding (GO:0051015)|filamin binding (GO:0031005)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|lung(8)|ovary(2)|skin(2)	19		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;6.01e-15)		GGGCTCCCCCACCCTGGGGTG	0.716													G|||	4980	0.994409	0.9985	0.9914	5008	,	,		11496	1.0		0.9801	False		,,,				2504	1.0				p.G378G		.											.	MICALL2-90	0			c.T1134C						.			3824,4		1910,4,0	4.0	4.0	4.0		1134	1.5	0.0	7	dbSNP_119	4	7610,92		3759,92,0	yes	coding-synonymous	MICALL2	NM_182924.3		5669,96,0	GG,GA,AA		1.1945,0.1045,0.8326		378/905	1484572	11434,96	1914	3851	5765	SO:0001819	synonymous_variant	79778	exon6			TCCCCCACCCTGG	BC037988	CCDS5324.1	7p22.3	2006-11-24			ENSG00000164877	ENSG00000164877			29672	protein-coding gene	gene with protein product	"""junctional Rab13-binding protein"""					12110185, 16525024	Standard	NM_182924		Approved	MGC46023, FLJ23471, MICAL-L2, JRAB	uc003skj.4	Q8IY33	OTTHUMG00000119021	ENST00000297508.7:c.1134T>C	7.37:g.1484572A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_182924	0	0	0	6	6	D3YTD2|Q7RTP4|Q7Z655|Q8TEQ4|Q9H5F9	Silent	SNP	ENST00000297508.7	37	CCDS5324.1																																																																																			A|0.009;G|0.991		0.716	MICALL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239223.2	NM_182924	
RADIL	55698	hgsc.bcm.edu	37	7	4874729	4874729	+	Missense_Mutation	SNP	C	C	G	rs144507770	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr7:4874729C>G	ENST00000399583.3	-	4	1112	c.925G>C	c.(925-927)Ggc>Cgc	p.G309R	RADIL_ENST00000538469.1_Missense_Mutation_p.G69R|RADIL_ENST00000536091.1_Missense_Mutation_p.G309R	NM_018059.4	NP_060529.4	Q96JH8	RADIL_HUMAN	Ras association and DIL domains	309					multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)|substrate adhesion-dependent cell spreading (GO:0034446)	microtubule (GO:0005874)				NS(1)|biliary_tract(2)|breast(1)|central_nervous_system(3)|endometrium(2)|large_intestine(2)|lung(22)|pancreas(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;7.41e-15)		GCGGCCTGGCCGCTGTCCGGG	0.711													C|||	60	0.0119808	0.0015	0.0173	5008	,	,		10553	0.0		0.0249	False		,,,				2504	0.0215				p.G309R		.											.	RADIL-994	0			c.G925C						.	C	ARG/GLY	8,3996		0,8,1994	9.0	13.0	12.0		925	-1.8	0.0	7	dbSNP_134	12	168,8110		4,160,3975	yes	missense	RADIL	NM_018059.4	125	4,168,5969	GG,GC,CC		2.0295,0.1998,1.433	possibly-damaging	309/1076	4874729	176,12106	2002	4139	6141	SO:0001583	missense	55698	exon4			CCTGGCCGCTGTC	AB058752	CCDS43544.1	7p22.1	2010-08-27			ENSG00000157927	ENSG00000157927			22226	protein-coding gene	gene with protein product		611491				16051602, 17704304	Standard	NM_018059		Approved	FLJ10324, KIAA1849, RASIP2	uc003snj.1	Q96JH8	OTTHUMG00000151753	ENST00000399583.3:c.925G>C	7.37:g.4874729C>G	ENSP00000382492:p.Gly309Arg	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	57	28	NM_018059	0	0	0	1	1	A4D1Z5|A5YM49|B7ZL20|Q0VFZ9|Q75LH3|Q9BSP5|Q9H0M6|Q9NW43|Q9NWC4	Missense_Mutation	SNP	ENST00000399583.3	37	CCDS43544.1	29	0.013278388278388278	2	0.0040650406504065045	9	0.024861878453038673	0	0.0	18	0.023746701846965697	-	4.272	0.049630	0.08243	0.001998	0.020295	ENSG00000157927	ENST00000399583;ENST00000316919;ENST00000536091;ENST00000538469	T;T;T	0.06068	3.35;3.35;3.35	4.3	-1.83	0.07833	Forkhead-associated (FHA) domain (1);SMAD/FHA domain (1);	1.742530	0.03218	N	0.177080	T	0.02193	0.0068	L	0.40543	1.245	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.39643	-0.9604	10	0.18710	T	0.47	-0.7787	0.4916	0.00565	0.1804:0.2431:0.2692:0.3073	.	309	Q96JH8	RADIL_HUMAN	R	309;280;309;69	ENSP00000382492:G309R;ENSP00000442533:G309R;ENSP00000442966:G69R	ENSP00000320946:G280R	G	-	1	0	RADIL	4841255	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.164000	0.16542	-0.261000	0.09405	-0.759000	0.03464	GGC	C|0.987;G|0.013		0.711	RADIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323769.2	NM_018059	
RADIL	55698	hgsc.bcm.edu	37	7	4876100	4876100	+	Silent	SNP	G	G	A	rs138811640	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr7:4876100G>A	ENST00000399583.3	-	3	859	c.672C>T	c.(670-672)aaC>aaT	p.N224N	RADIL_ENST00000538469.1_De_novo_Start_OutOfFrame|RADIL_ENST00000536091.1_Silent_p.N224N	NM_018059.4	NP_060529.4	Q96JH8	RADIL_HUMAN	Ras association and DIL domains	224					multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)|substrate adhesion-dependent cell spreading (GO:0034446)	microtubule (GO:0005874)		p.N224N(1)		NS(1)|biliary_tract(2)|breast(1)|central_nervous_system(3)|endometrium(2)|large_intestine(2)|lung(22)|pancreas(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;7.41e-15)		CGGGCAGGGCGTTCACTGGGC	0.721													G|||	60	0.0119808	0.0015	0.0173	5008	,	,		12942	0.0		0.0249	False		,,,				2504	0.0215				p.N224N		.											.	RADIL-994	1	Substitution - coding silent(1)	lung(1)	c.C672T						.	G		16,4162		0,16,2073	11.0	18.0	16.0		672	0.3	0.1	7	dbSNP_134	16	205,8153		6,193,3980	no	coding-synonymous	RADIL	NM_018059.4		6,209,6053	AA,AG,GG		2.4527,0.383,1.7629		224/1076	4876100	221,12315	2089	4179	6268	SO:0001819	synonymous_variant	55698	exon3			CAGGGCGTTCACT	AB058752	CCDS43544.1	7p22.1	2010-08-27			ENSG00000157927	ENSG00000157927			22226	protein-coding gene	gene with protein product		611491				16051602, 17704304	Standard	NM_018059		Approved	FLJ10324, KIAA1849, RASIP2	uc003snj.1	Q96JH8	OTTHUMG00000151753	ENST00000399583.3:c.672C>T	7.37:g.4876100G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	26	21	NM_018059	0	0	2	2	0	A4D1Z5|A5YM49|B7ZL20|Q0VFZ9|Q75LH3|Q9BSP5|Q9H0M6|Q9NW43|Q9NWC4	Silent	SNP	ENST00000399583.3	37	CCDS43544.1																																																																																			G|0.987;A|0.013		0.721	RADIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323769.2	NM_018059	
USP42	84132	hgsc.bcm.edu	37	7	6193464	6193464	+	Missense_Mutation	SNP	T	T	G	rs61732616	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr7:6193464T>G	ENST00000306177.5	+	15	2437	c.2279T>G	c.(2278-2280)cTg>cGg	p.L760R		NM_032172.2	NP_115548.1	Q9H9J4	UBP42_HUMAN	ubiquitin specific peptidase 42	760	Pro-rich.				cell differentiation (GO:0030154)|protein deubiquitination (GO:0016579)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(2)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	35		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.108)|OV - Ovarian serous cystadenocarcinoma(56;5.77e-14)		GCCGAATCCCTGGAGGAGCCA	0.716													T|||	1387	0.276957	0.4236	0.1686	5008	,	,		9831	0.4355		0.0895	False		,,,				2504	0.1851				p.L760R		.											.	USP42-659	0			c.T2279G						.	T	ARG/LEU	589,2085		43,503,791	2.0	4.0	3.0		2279	-10.9	0.0	7	dbSNP_129	3	319,6253		13,293,2980	no	missense	USP42	NM_032172.2	102	56,796,3771	GG,GT,TT		4.8539,22.0269,9.8205	benign	760/1317	6193464	908,8338	1337	3286	4623	SO:0001583	missense	84132	exon15			AATCCCTGGAGGA	AK022759	CCDS47535.1	7p22.2	2005-08-08	2005-08-08		ENSG00000106346	ENSG00000106346		"""Ubiquitin-specific peptidases"""	20068	protein-coding gene	gene with protein product			"""ubiquitin specific protease 42"""			12838346	Standard	NM_032172		Approved	FLJ12697	uc011jwp.2	Q9H9J4	OTTHUMG00000151888	ENST00000306177.5:c.2279T>G	7.37:g.6193464T>G	ENSP00000301962:p.Leu760Arg	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	34	14	NM_032172	0	0	4	8	4	A2RUE3|B5MDA5|Q0VIN8|Q3C166|Q6P9B4	Missense_Mutation	SNP	ENST00000306177.5	37	CCDS47535.1	594	0.27197802197802196	198	0.4024390243902439	47	0.1298342541436464	276	0.4825174825174825	73	0.09630606860158311	T	5.448	0.267700	0.10294	0.220269	0.048539	ENSG00000106346	ENST00000306177;ENST00000426246	T;T	0.52983	0.64;0.64	5.46	-10.9	0.00192	.	3.729060	0.00447	N	0.000090	T	0.00012	0.0000	N	0.03608	-0.345	0.80722	P	0.0	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.001;0.002;0.001	T	0.17961	-1.0352	9	0.10111	T	0.7	.	1.9113	0.03287	0.4032:0.2739:0.0844:0.2385	rs61732616	723;760;760	A4D2N7;Q9H9J4-2;Q9H9J4	.;.;UBP42_HUMAN	R	760;606	ENSP00000301962:L760R;ENSP00000408217:L606R	ENSP00000301962:L760R	L	+	2	0	USP42	6159990	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.066000	0.03454	-2.404000	0.00576	-1.216000	0.01612	CTG	T|0.731;G|0.269		0.716	USP42-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324262.3	XM_166526	
REPIN1	29803	hgsc.bcm.edu	37	7	150069548	150069548	+	Silent	SNP	C	C	G	rs187957325	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr7:150069548C>G	ENST00000425389.2	+	1	1296	c.1218C>G	c.(1216-1218)gcC>gcG	p.A406A	REPIN1_ENST00000444957.1_Silent_p.A406A|REPIN1_ENST00000540729.1_Silent_p.A406A|REPIN1_ENST00000479668.1_3'UTR|REPIN1_ENST00000489432.2_Silent_p.A463A|REPIN1_ENST00000397281.2_Silent_p.A406A|RP4-584D14.5_ENST00000488310.1_RNA	NM_014374.3	NP_055189.2	Q9BWE0	REPI1_HUMAN	replication initiator 1	406					DNA replication (GO:0006260)|regulation of fatty acid transport (GO:2000191)|regulation of glucose import in response to insulin stimulus (GO:2001273)	cytosolic ribosome (GO:0022626)|lipid particle (GO:0005811)|nuclear membrane (GO:0031965)|nuclear origin of replication recognition complex (GO:0005664)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(2)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	14	Ovarian(565;0.183)|Melanoma(164;0.226)		OV - Ovarian serous cystadenocarcinoma(82;0.011)			TCACCTGCGCCGAGTGCGGGA	0.721													c|||	73	0.0145767	0.0	0.0014	5008	,	,		10583	0.0308		0.0	False		,,,				2504	0.0419				p.A463A		.											.	REPIN1-69	0			c.C1389G						.	C	,,,	0,3806		0,0,1903	4.0	5.0	5.0		1389,1218,1218,1218	-1.7	0.8	7		5	17,7969		0,17,3976	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	REPIN1	NM_001099695.1,NM_001099696.2,NM_013400.3,NM_014374.3	,,,	0,17,5879	GG,GC,CC		0.2129,0.0,0.1442	,,,	463/625,406/568,406/568,406/568	150069548	17,11775	1903	3993	5896	SO:0001819	synonymous_variant	29803	exon3			CTGCGCCGAGTGC	AF201303	CCDS43677.1, CCDS47745.1	7q36.1	2013-01-08	2003-08-07	2003-08-08				"""Zinc fingers, C2H2-type"""	17922	protein-coding gene	gene with protein product	"""replication initiation region protein (60kD)"", ""zinc finger protein AP4"", ""zinc finger protein 464 (RIP60)"""		"""zinc finger protein 464 (RIP60)"""	ZNF464		10606657	Standard	NM_013400		Approved	RIP60, AP4, H_DJ0584D14.12, Zfp464	uc010lpr.1	Q9BWE0		ENST00000425389.2:c.1218C>G	7.37:g.150069548C>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	20	10	NM_001099695	0	0	21	39	18	C9J3L7|D3DWZ1|Q7LE03|Q9BUZ6|Q9NZH2|Q9UMP5	Silent	SNP	ENST00000425389.2	37	CCDS43677.1																																																																																			C|0.995;G|0.005		0.721	REPIN1-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000376940.1	NM_014374	
CRYGN	155051	hgsc.bcm.edu	37	7	151136989	151136989	+	Silent	SNP	C	C	T	rs116501631	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr7:151136989C>T	ENST00000337323.2	-	1	141	c.15G>A	c.(13-15)tcG>tcA	p.S5S	CRYGN_ENST00000476631.1_Intron|RP4-555L14.4_ENST00000465549.1_RNA|CRYGN_ENST00000491928.1_Silent_p.S5S	NM_144727.1	NP_653328.1	Q8WXF5	CRGN_HUMAN	crystallin, gamma N	5										central_nervous_system(1)|kidney(1)|large_intestine(1)|liver(1)|lung(4)	8			OV - Ovarian serous cystadenocarcinoma(82;0.00358)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TCACCTTCCCCGAGCGCTGCG	0.682													C|||	67	0.0133786	0.0439	0.0072	5008	,	,		12844	0.0		0.004	False		,,,				2504	0.0				p.S5S		.											.	CRYGN-90	0			c.G15A						.	C		159,4215		5,149,2033	26.0	22.0	23.0		15	-6.3	0.2	7	dbSNP_132	23	15,8531		0,15,4258	no	coding-synonymous	CRYGN	NM_144727.1		5,164,6291	TT,TC,CC		0.1755,3.6351,1.3467		5/183	151136989	174,12746	2187	4273	6460	SO:0001819	synonymous_variant	155051	exon1			CTTCCCCGAGCGC	AF445455	CCDS5926.1	7q36.1	2003-02-25			ENSG00000127377	ENSG00000127377			20458	protein-coding gene	gene with protein product		609603					Standard	NM_144727		Approved		uc003wke.3	Q8WXF5	OTTHUMG00000157353	ENST00000337323.2:c.15G>A	7.37:g.151136989C>T		Somatic	3	0		WXS	Illumina GAIIx	Phase_I	47	21	NM_144727	0	0	0	0	0	Q496G6	Silent	SNP	ENST00000337323.2	37	CCDS5926.1																																																																																			C|0.983;T|0.017		0.682	CRYGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348553.1		
FER1L6	654463	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	125109589	125109589	+	Silent	SNP	G	G	A			TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr8:125109589G>A	ENST00000522917.1	+	36	4979	c.4773G>A	c.(4771-4773)agG>agA	p.R1591R	FER1L6-AS2_ENST00000520031.1_RNA|FER1L6_ENST00000399018.1_Silent_p.R1591R	NM_001039112.2	NP_001034201.2	Q2WGJ9	FR1L6_HUMAN	fer-1-like family member 6	1591	C2 6. {ECO:0000255|PROSITE- ProRule:PRU00041}.					integral component of membrane (GO:0016021)		p.R1591R(1)		NS(2)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(18)|liver(1)|lung(49)|ovary(5)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(1)	118	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			TCTCTCCAAGGCGACCCAAAG	0.483																																					p.R1591R		.											.	FER1L6-100	1	Substitution - coding silent(1)	ovary(1)	c.G4773A						.						84.0	80.0	81.0					8																	125109589		1943	4163	6106	SO:0001819	synonymous_variant	654463	exon36			TCCAAGGCGACCC	AB196633	CCDS43767.1	8q24.13	2014-06-27	2014-06-27		ENSG00000214814	ENSG00000214814			28065	protein-coding gene	gene with protein product			"""fer-1-like 6 (C. elegans)"""				Standard	NM_001039112		Approved	C8ORFK23	uc003yqw.3	Q2WGJ9	OTTHUMG00000164998	ENST00000522917.1:c.4773G>A	8.37:g.125109589G>A		Somatic	100	0		WXS	Illumina GAIIx	Phase_I	146	61	NM_001039112	0	0	0	0	0		Silent	SNP	ENST00000522917.1	37	CCDS43767.1																																																																																			.		0.483	FER1L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381400.1	NM_001039112	
TOP1MT	116447	ucsc.edu;bcgsc.ca	37	8	144411548	144411548	+	Missense_Mutation	SNP	C	C	T	rs147714048	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr8:144411548C>T	ENST00000329245.4	-	3	366	c.332G>A	c.(331-333)cGg>cAg	p.R111Q	TOP1MT_ENST00000521193.1_Missense_Mutation_p.R13Q|TOP1MT_ENST00000523676.1_Missense_Mutation_p.R13Q|TOP1MT_ENST00000519148.1_Missense_Mutation_p.R13Q	NM_052963.2	NP_443195.1	Q969P6	TOP1M_HUMAN	topoisomerase (DNA) I, mitochondrial	111					DNA replication (GO:0006260)|DNA topological change (GO:0006265)	chromosome (GO:0005694)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA topoisomerase type I activity (GO:0003917)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)			endometrium(5)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|upper_aerodigestive_tract(2)	23	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)		Irinotecan(DB00762)|Topotecan(DB01030)	GAAGTTCTTCCGGAAAACCTC	0.562													C|||	3	0.000599042	0.0	0.0	5008	,	,		17977	0.002		0.001	False		,,,				2504	0.0				p.R111Q		.											.	TOP1MT-91	0			c.G332A						.	C	GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	183.0	163.0	170.0		332	-3.6	0.0	8	dbSNP_134	170	7,8593	6.4+/-24.3	0,7,4293	yes	missense	TOP1MT	NM_052963.1	43	0,8,6495	TT,TC,CC		0.0814,0.0227,0.0615	possibly-damaging	111/602	144411548	8,12998	2203	4300	6503	SO:0001583	missense	116447	exon3			TTCTTCCGGAAAA	AF349018	CCDS6400.1, CCDS59115.1	8q24.3	2006-04-12				ENSG00000184428			29787	protein-coding gene	gene with protein product		606387				11526219	Standard	NM_052963		Approved		uc003yxz.4	Q969P6		ENST00000329245.4:c.332G>A	8.37:g.144411548C>T	ENSP00000328835:p.Arg111Gln	Somatic	124	3		WXS	Illumina GAIIx	Phase_I	199	67	NM_052963	0	0	8	16	8	B7ZAR5|E7ES89|Q86ST4|Q86V82	Missense_Mutation	SNP	ENST00000329245.4	37	CCDS6400.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	0.021	-1.425500	0.01126	2.27E-4	8.14E-4	ENSG00000184428	ENST00000329245;ENST00000521193;ENST00000519148;ENST00000523676;ENST00000522041;ENST00000519591;ENST00000518007;ENST00000518760;ENST00000520950	T;T;T;T;T;T;T;T;T	0.41065	1.01;1.01;1.01;1.01;1.01;1.01;1.01;1.01;1.01	3.83	-3.64	0.04515	DNA topoisomerase I, domain 1 (1);DNA topoisomerase I, DNA binding, eukaryotic-type (2);	0.506021	0.16234	N	0.223427	T	0.10465	0.0256	N	0.02539	-0.55	0.32400	N	0.552045	B	0.33044	0.395	B	0.18263	0.021	T	0.43972	-0.9358	10	0.02654	T	1	.	9.5598	0.39362	0.0:0.3329:0.0:0.6671	.	111	Q969P6	TOP1M_HUMAN	Q	111;13;13;13;13;13;80;137;13	ENSP00000328835:R111Q;ENSP00000428369:R13Q;ENSP00000429169:R13Q;ENSP00000429181:R13Q;ENSP00000427998:R13Q;ENSP00000429177:R13Q;ENSP00000430209:R80Q;ENSP00000428723:R137Q;ENSP00000430635:R13Q	ENSP00000328835:R111Q	R	-	2	0	TOP1MT	144482923	0.000000	0.05858	0.003000	0.11579	0.084000	0.17831	-0.689000	0.05144	-1.182000	0.02727	-1.162000	0.01777	CGG	C|0.999;T|0.001		0.562	TOP1MT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381247.3	NM_052963	
PLEC	5339	hgsc.bcm.edu	37	8	144992385	144992385	+	Silent	SNP	G	G	A	rs375886231		TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr8:144992385G>A	ENST00000322810.4	-	32	12184	c.12015C>T	c.(12013-12015)gaC>gaT	p.D4005D	PLEC_ENST00000436759.2_Silent_p.D3895D|PLEC_ENST00000527096.1_Silent_p.D3891D|PLEC_ENST00000354589.3_Silent_p.D3868D|PLEC_ENST00000356346.3_Silent_p.D3854D|PLEC_ENST00000354958.2_Silent_p.D3846D|PLEC_ENST00000398774.2_Silent_p.D3836D|PLEC_ENST00000345136.3_Silent_p.D3868D|PLEC_ENST00000357649.2_Silent_p.D3872D	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	4005	Globular 2.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						GGCCGGTGCCGTCGTCACGAC	0.687																																					p.D4005D		.											.	PLEC-141	0			c.C12015T						.	G	,,,,,,,	0,3718		0,0,1859	8.0	11.0	10.0		11685,11562,11538,12015,11508,11604,11616,11604	-5.1	0.0	8		10	1,8001		0,1,4000	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	,,,,,,,	0,1,5859	AA,AG,GG		0.0125,0.0,0.0085	,,,,,,,	3895/4575,3854/4534,3846/4526,4005/4685,3836/4516,3868/4548,3872/4552,3868/4548	144992385	1,11719	1859	4001	5860	SO:0001819	synonymous_variant	5339	exon32			GGTGCCGTCGTCA	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.12015C>T	8.37:g.144992385G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	13	7	NM_201380	0	0	20	35	15	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																			.		0.687	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
ERMP1	79956	hgsc.bcm.edu	37	9	5832728	5832728	+	Silent	SNP	G	G	C	rs1131727	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr9:5832728G>C	ENST00000339450.5	-	1	389	c.300C>G	c.(298-300)gcC>gcG	p.A100A	ERMP1_ENST00000214893.5_5'UTR|ERMP1_ENST00000381506.3_5'Flank	NM_024896.2	NP_079172.2	Q7Z2K6	ERMP1_HUMAN	endoplasmic reticulum metallopeptidase 1	100						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			endometrium(2)|kidney(1)|large_intestine(9)|lung(4)|ovary(1)|prostate(2)|skin(1)	20		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00115)|Lung(218;0.111)		GGTGTCCAGCGGCCCCGCGTA	0.741													G|||	2021	0.403554	0.1309	0.428	5008	,	,		3601	0.7093		0.34	False		,,,				2504	0.5051				p.A100A		.											.	ERMP1-69	0			c.C300G						.						4.0	3.0	3.0					9																	5832728		1620	3326	4946	SO:0001819	synonymous_variant	79956	exon1			TCCAGCGGCCCCG	AB058718	CCDS34983.1	9p24	2008-02-05	2007-07-05	2007-07-05	ENSG00000099219	ENSG00000099219			23703	protein-coding gene	gene with protein product	"""Felix-ina"""	611156	"""KIAA1815"""	KIAA1815		11347906	Standard	XM_005251587		Approved	FLJ23309, FXNA	uc003zjm.1	Q7Z2K6	OTTHUMG00000019508	ENST00000339450.5:c.300C>G	9.37:g.5832728G>C		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	14	14	NM_024896	0	0	0	2	2	B2RNA4|B3KSB1|Q8N5T5|Q9H5M1	Silent	SNP	ENST00000339450.5	37	CCDS34983.1																																																																																			G|0.572;C|0.428		0.741	ERMP1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354877.1	NM_024896	
CCDC171	203238	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	15724809	15724809	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr9:15724809G>T	ENST00000380701.3	+	14	1855	c.1527G>T	c.(1525-1527)gaG>gaT	p.E509D	CCDC171_ENST00000297641.3_Missense_Mutation_p.E509D	NM_173550.2	NP_775821.2	Q6TFL3	CC171_HUMAN	coiled-coil domain containing 171	509																	TTAATAAAGAGTTAAGTCATT	0.403																																					p.E509D		.											.	.	0			c.G1527T						.						126.0	139.0	135.0					9																	15724809		2203	4299	6502	SO:0001583	missense	203238	exon14			TAAAGAGTTAAGT	AY422473	CCDS6481.1	9p22.2	2012-03-26	2012-03-26	2012-03-26	ENSG00000164989	ENSG00000164989			29828	protein-coding gene	gene with protein product	"""myosin tail domain containing protein"""		"""chromosome 9 open reading frame 93"""	C9orf93		14702039	Standard	NM_173550		Approved	FLJ39267, FLJ46740, Em:AL513423.1, bA778P13.1, bA536D16.1	uc003zmd.3	Q6TFL3	OTTHUMG00000019584	ENST00000380701.3:c.1527G>T	9.37:g.15724809G>T	ENSP00000370077:p.Glu509Asp	Somatic	129	0		WXS	Illumina GAIIx	Phase_I	186	69	NM_173550	0	0	0	0	0	B7ZM22|Q5SU58|Q6P1W1|Q6ZR13|Q8N1Z4|Q8N8L3|Q8TBR2	Missense_Mutation	SNP	ENST00000380701.3	37	CCDS6481.1	.	.	.	.	.	.	.	.	.	.	G	17.63	3.437319	0.62955	.	.	ENSG00000164989	ENST00000297641;ENST00000380701	T;T	0.52754	0.65;0.65	5.42	3.6	0.41247	.	0.049284	0.85682	D	0.000000	T	0.53642	0.1809	L	0.29908	0.895	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.998	D;D;D	0.83275	0.996;0.996;0.99	T	0.46898	-0.9158	10	0.32370	T	0.25	-14.6758	12.2393	0.54534	0.1383:0.0:0.8617:0.0	.	517;509;509	B7ZM22;Q6TFL3-3;Q6TFL3	.;.;CI093_HUMAN	D	509	ENSP00000297641:E509D;ENSP00000370077:E509D	ENSP00000297641:E509D	E	+	3	2	C9orf93	15714809	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.784000	0.68990	0.792000	0.33850	-0.157000	0.13467	GAG	.		0.403	CCDC171-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051768.4	NM_173550	
TUSC1	286319	hgsc.bcm.edu	37	9	25678122	25678122	+	Silent	SNP	G	G	C	rs72631814	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr9:25678122G>C	ENST00000358022.3	-	1	734	c.198C>G	c.(196-198)gcC>gcG	p.A66A		NM_001004125.2	NP_001004125.1	Q2TAM9	TUSC1_HUMAN	tumor suppressor candidate 1	66										kidney(1)	1	all_hematologic(1;0.197)	all_neural(3;5.42e-18)|Glioma(3;5.54e-17)		GBM - Glioblastoma multiforme(1;1.51e-108)|Lung(42;2.88e-14)|LUSC - Lung squamous cell carcinoma(38;3.16e-11)		CCGCCAGGTCGGCAAACCGCT	0.776													G|||	885	0.176717	0.1324	0.1772	5008	,	,		7019	0.1151		0.3002	False		,,,				2504	0.1728				p.A66A	Pancreas(19;648 672 25630 30820 31331)	.											.	TUSC1-90	0			c.C198G						.	G		389,3633		24,341,1646	6.0	6.0	6.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	198	0.6	1.0	9	dbSNP_130	6	1826,6086		225,1376,2355	no	coding-synonymous	TUSC1	NM_001004125.2		249,1717,4001	CC,CG,GG		23.0789,9.6718,18.5604		66/213	25678122	2215,9719	2011	3956	5967	SO:0001819	synonymous_variant	286319	exon1			CAGGTCGGCAAAC	AY168647	CCDS34999.1	9p21.2	2014-05-22			ENSG00000198680	ENSG00000198680			31010	protein-coding gene	gene with protein product		610529				15208665	Standard	NM_001004125		Approved	TSG-9	uc003zpx.3	Q2TAM9	OTTHUMG00000159591	ENST00000358022.3:c.198C>G	9.37:g.25678122G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	25	24	NM_001004125	0	0	0	22	22	A0PJ78|Q67GI3|Q86SS1|Q8TAH8	Silent	SNP	ENST00000358022.3	37	CCDS34999.1																																																																																			G|0.807;C|0.193		0.776	TUSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356351.1	NM_001004125	
SEC61B	10952	hgsc.bcm.edu	37	9	101984048	101984048	+	5'Flank	SNP	G	G	C	rs35055733	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr9:101984048G>C	ENST00000223641.4	+	0	0				ALG2_ENST00000476832.1_Silent_p.R43R|ALG2_ENST00000319033.6_5'Flank|SEC61B_ENST00000498603.1_5'Flank	NM_006808.2	NP_006799.1	P60468	SC61B_HUMAN	Sec61 beta subunit						antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|gene expression (GO:0010467)|protein import into nucleus, translocation (GO:0000060)|retrograde protein transport, ER to cytosol (GO:0030970)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum Sec complex (GO:0031205)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	epidermal growth factor binding (GO:0048408)|poly(A) RNA binding (GO:0044822)|ribosome binding (GO:0043022)			kidney(1)|large_intestine(1)	2		Acute lymphoblastic leukemia(62;0.0559)				CGCTACACCCGCGCGCCTGCA	0.711													G|||	44	0.00878594	0.0	0.0101	5008	,	,		12785	0.0		0.0298	False		,,,				2504	0.0072				p.R43R		.											.	ALG2-92	0			c.C129G						.	G		15,4355		1,13,2171	15.0	18.0	17.0		129	2.8	1.0	9	dbSNP_126	17	180,8320		0,180,4070	no	coding-synonymous	ALG2	NM_033087.3		1,193,6241	CC,CG,GG		2.1176,0.3432,1.5152		43/417	101984048	195,12675	2185	4250	6435	SO:0001631	upstream_gene_variant	85365	exon1			ACACCCGCGCGCC	L25085	CCDS6741.1	9q22.32-q31.3	2009-03-19			ENSG00000106803	ENSG00000106803			16993	protein-coding gene	gene with protein product		609214				8107851, 10212142	Standard	NM_006808		Approved		uc004azh.3	P60468	OTTHUMG00000020354		9.37:g.101984048G>C	Exception_encountered	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	17	11	NM_033087	0	0	14	39	25	P38390|P38391|Q6IBC1	Silent	SNP	ENST00000223641.4	37	CCDS6741.1																																																																																			G|0.984;C|0.016		0.711	SEC61B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053391.1	NM_006808	
PPAPDC3	84814	hgsc.bcm.edu	37	9	134183371	134183371	+	Silent	SNP	G	G	A	rs61731644	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr9:134183371G>A	ENST00000372264.3	+	2	817	c.513G>A	c.(511-513)ccG>ccA	p.P171P		NM_032728.3	NP_116117.3	Q8NBV4	PPAC3_HUMAN	phosphatidic acid phosphatase type 2 domain containing 3	171					negative regulation of myotube differentiation (GO:0010832)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)	hydrolase activity (GO:0016787)			breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(9)|skin(1)	16	all_hematologic(7;0.0119)			OV - Ovarian serous cystadenocarcinoma(145;1.22e-05)|Epithelial(140;0.000173)		GGCGCGGCCCGTACGAGACGA	0.682													G|||	25	0.00499201	0.0189	0.0	5008	,	,		15423	0.0		0.0	False		,,,				2504	0.0				p.P171P		.											.	PPAPDC3-153	0			c.G513A						.	G		55,4351	52.9+/-88.7	1,53,2149	47.0	42.0	44.0		513	-9.4	0.1	9	dbSNP_129	44	0,8600		0,0,4300	no	coding-synonymous	PPAPDC3	NM_032728.3		1,53,6449	AA,AG,GG		0.0,1.2483,0.4229		171/272	134183371	55,12951	2203	4300	6503	SO:0001819	synonymous_variant	84814	exon2			CGGCCCGTACGAG	AK027568	CCDS6942.1	9q34.2-q34.3	2008-02-26	2005-07-15	2005-07-15	ENSG00000160539	ENSG00000160539			28174	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 67"""	C9orf67		12958361	Standard	NM_032728		Approved	MGC12921, FLJ14662, NET39	uc004cal.2	Q8NBV4	OTTHUMG00000020822	ENST00000372264.3:c.513G>A	9.37:g.134183371G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	23	12	NM_032728	0	0	0	10	10	Q5T6P0|Q96SS7|Q9BRC3	Silent	SNP	ENST00000372264.3	37	CCDS6942.1																																																																																			G|0.993;A|0.007		0.682	PPAPDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054724.1	NM_032728	
CCDC183	84960	hgsc.bcm.edu	37	9	139694613	139694613	+	Missense_Mutation	SNP	C	C	A	rs35342663	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr9:139694613C>A	ENST00000338005.6	+	4	465	c.430C>A	c.(430-432)Ctg>Atg	p.L144M	RP11-216L13.18_ENST00000471502.1_RNA|KIAA1984_ENST00000371682.3_3'UTR|RP11-216L13.19_ENST00000415992.1_RNA|RP11-216L13.17_ENST00000456614.2_Missense_Mutation_p.L174M	NM_001039374.4	NP_001034463.4	Q5T5S1	CC183_HUMAN		144										biliary_tract(1)|breast(1)|endometrium(1)|kidney(2)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	13	all_cancers(76;0.0882)|all_epithelial(76;0.228)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;9.33e-06)|Epithelial(140;0.000124)		GGAGCTGCGGCTGCTGCAGGT	0.741													C|||	462	0.0922524	0.152	0.0144	5008	,	,		7965	0.1389		0.0219	False		,,,				2504	0.091				p.L144M		.											.	KIAA1984-91	0			c.C430A						.	C	MET/LEU	345,2927		9,327,1300	4.0	4.0	4.0		430	-3.5	0.0	9	dbSNP_126	4	162,7194		2,158,3518	no	missense	KIAA1984	NM_001039374.4	15	11,485,4818	AA,AC,CC		2.2023,10.544,4.7704	benign	144/535	139694613	507,10121	1636	3678	5314	SO:0001583	missense	84960	exon4			CTGCGGCTGCTGC																												ENST00000338005.6:c.430C>A	9.37:g.139694613C>A	ENSP00000338013:p.Leu144Met	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	31	22	NM_001039374	0	0	0	0	0	B2RP89|C9JD38|Q6P2D9|Q8NAI4|Q8TF18	Missense_Mutation	SNP	ENST00000338005.6	37	CCDS43906.1	155	0.07097069597069597	63	0.12804878048780488	6	0.016574585635359115	71	0.12412587412587413	15	0.01978891820580475	C	8.887	0.953003	0.18431	0.10544	0.022023	ENSG00000213213	ENST00000423962;ENST00000338005	T	0.11604	2.76	4.69	-3.55	0.04639	.	1.415250	0.05927	U	0.634446	T	0.00073	0.0002	N	0.21448	0.665	0.80722	P	0.0	B	0.24368	0.102	B	0.23852	0.049	T	0.40098	-0.9581	9	0.45353	T	0.12	-2.6838	3.6184	0.08086	0.384:0.3008:0.0:0.3152	rs35342663;rs59016673;rs62581420	144	Q5T5S1	K1984_HUMAN	M	144	ENSP00000338013:L144M	ENSP00000338013:L144M	L	+	1	2	KIAA1984	138814434	0.000000	0.05858	0.004000	0.12327	0.449000	0.32228	-3.365000	0.00496	-1.346000	0.02211	-0.384000	0.06662	CTG	C|0.928;A|0.072		0.741	KIAA1984-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354899.1		
ARSE	415	bcgsc.ca	37	X	2856155	2856155	+	Missense_Mutation	SNP	C	C	T	rs35143646	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chrX:2856155C>T	ENST00000381134.3	-	9	1336	c.1270G>A	c.(1270-1272)Ggc>Agc	p.G424S	ARSE_ENST00000540563.1_Missense_Mutation_p.G379S|ARSE_ENST00000545496.1_Missense_Mutation_p.G449S	NM_000047.2	NP_000038.2	P51690	ARSE_HUMAN	arylsulfatase E (chondrodysplasia punctata 1)	424			G -> S (in dbSNP:rs35143646). {ECO:0000269|Ref.2}.		cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GGCACCTCGCCGCCCGCCAGC	0.602													C|||	2169	0.57457	0.059	0.415	3775	,	,		11186	0.6786		0.5278	False		,,,				2504	0.6012				p.G424S		.											.	ARSE-131	0			c.G1270A						.	C	SER/GLY	687,3144		65,474,83,1093,484	52.0	55.0	54.0		1270	3.5	0.0	X	dbSNP_126	54	4504,2211		1084,1066,1270,277,591	no	missense	ARSE	NM_000047.2	56	1149,1540,1353,1370,1075	TT,TC,T,CC,C		32.9263,17.9327,49.2225	benign	424/590	2856155	5191,5355	2199	4288	6487	SO:0001583	missense	415	exon9			CCTCGCCGCCCGC	X83573	CCDS14122.1, CCDS75948.1, CCDS75949.1	Xp22.33	2013-02-14			ENSG00000157399	ENSG00000157399		"""Arylsulfatase family"""	719	protein-coding gene	gene with protein product		300180		CDPX, CDPX1		7720070	Standard	NM_000047		Approved		uc004crc.4	P51690	OTTHUMG00000137358	ENST00000381134.3:c.1270G>A	X.37:g.2856155C>T	ENSP00000370526:p.Gly424Ser	Somatic	149	1		WXS	Illumina GAIIx	Phase_I	404	10	NM_000047	0	0	0	0	0	Q53FT2|Q53FU8	Missense_Mutation	SNP	ENST00000381134.3	37	CCDS14122.1	951	0.5732368896925859	22	0.046413502109704644	94	0.3671875	255	0.796875	275	0.5308880308880309	c	10.51	1.369388	0.24771	0.179327	0.670737	ENSG00000157399	ENST00000540563;ENST00000545496;ENST00000381134	D;D;D	0.93859	-3.3;-3.3;-3.3	3.46	3.46	0.39613	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.055865	0.64402	D	0.000001	T	0.00012	0.0000	L	0.56769	1.78	0.22424	P	0.999114817	P;P;P	0.50819	0.931;0.939;0.905	P;B;P	0.46299	0.511;0.41;0.49	T	0.48502	-0.9030	9	0.20519	T	0.43	.	14.3929	0.66991	0.0:1.0:0.0:0.0	rs35143646;rs60405351	379;449;424	F5H324;F5GYY5;P51690	.;.;ARSE_HUMAN	S	379;449;424	ENSP00000438198:G379S;ENSP00000441417:G449S;ENSP00000370526:G424S	ENSP00000370526:G424S	G	-	1	0	ARSE	2866155	1.000000	0.71417	0.017000	0.16124	0.005000	0.04900	6.335000	0.72949	1.355000	0.45865	0.540000	0.68198	GGC	C|0.503;T|0.497		0.602	ARSE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055643.1	NM_000047	
SMC1A	8243	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	53430781	53430781	+	Silent	SNP	G	G	C			TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chrX:53430781G>C	ENST00000322213.4	-	14	2368	c.2241C>G	c.(2239-2241)cgC>cgG	p.R747R		NM_006306.2	NP_006297.2	Q14683	SMC1A_HUMAN	structural maintenance of chromosomes 1A	747					DNA repair (GO:0006281)|gene expression (GO:0010467)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic sister chromatid cohesion (GO:0007064)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle organization (GO:0007052)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of DNA endoreduplication (GO:0032876)|response to radiation (GO:0009314)|RNA splicing (GO:0008380)|signal transduction in response to DNA damage (GO:0042770)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin core heterodimer (GO:0008280)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|meiotic cohesin complex (GO:0030893)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(8)|ovary(5)|upper_aerodigestive_tract(2)	49						TATCATTAATGCGAGGCCCAA	0.493																																					p.R747R		.											.	SMC1A-232	0			c.C2241G						.						138.0	114.0	122.0					X																	53430781		2203	4300	6503	SO:0001819	synonymous_variant	8243	exon14			ATTAATGCGAGGC	S78271	CCDS14352.1, CCDS75985.1	Xp11.22-p11.21	2014-09-17	2006-07-06	2006-07-06	ENSG00000072501	ENSG00000072501		"""Structural maintenance of chromosomes proteins"""	11111	protein-coding gene	gene with protein product		300040	"""SMC1 (structural maintenance of chromosomes 1, yeast)-like 1"", ""SMC1 structural maintenance of chromosomes 1-like 1 (yeast)"""	SMC1L1		7757074	Standard	NM_006306		Approved	DXS423E, KIAA0178, SB1.8, Smcb	uc004dsg.3	Q14683	OTTHUMG00000021614	ENST00000322213.4:c.2241C>G	X.37:g.53430781G>C		Somatic	110	0		WXS	Illumina GAIIx	Phase_I	150	62	NM_006306	1	0	19	45	25	O14995|Q16351|Q2M228	Silent	SNP	ENST00000322213.4	37	CCDS14352.1																																																																																			.		0.493	SMC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056756.2	NM_006306	
BEX2	84707	ucsc.edu;bcgsc.ca	37	X	102564587	102564587	+	Silent	SNP	A	A	G			TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chrX:102564587A>G	ENST00000372677.3	-	3	585	c.318T>C	c.(316-318)caT>caC	p.H106H	BEX2_ENST00000372674.1_Silent_p.H106H|BEX2_ENST00000536889.1_Silent_p.H138H	NM_032621.3	NP_116010.1	Q9BXY8	BEX2_HUMAN	brain expressed X-linked 2	106					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|regulation of apoptotic process (GO:0042981)|regulation of cell cycle (GO:0051726)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|lung(1)|ovary(1)	3						CCCGCAAACTATGACTCAACT	0.498																																					p.H138H		.											.	BEX2-109	0			c.T414C						.						239.0	194.0	210.0					X																	102564587		2203	4298	6501	SO:0001819	synonymous_variant	84707	exon3			CAAACTATGACTC	BC015522	CCDS14505.1, CCDS55467.1	Xq22	2014-03-21			ENSG00000133134	ENSG00000133134			30933	protein-coding gene	gene with protein product		300691				16221301	Standard	NM_001168399		Approved	DJ79P11.1	uc004eka.3	Q9BXY8	OTTHUMG00000022095	ENST00000372677.3:c.318T>C	X.37:g.102564587A>G		Somatic	264	3		WXS	Illumina GAIIx	Phase_I	552	256	NM_001168399	0	0	0	0	0	B2R574|D3DXA2|F5H7H5|Q5JVV9	Silent	SNP	ENST00000372677.3	37	CCDS14505.1																																																																																			.		0.498	BEX2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057702.1	NM_032621	
CT47B1	643311	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	120009056	120009056	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chrX:120009056C>T	ENST00000371311.3	-	1	723	c.469G>A	c.(469-471)Gct>Act	p.A157T		NM_001145718.1	NP_001139190.1	P0C2W7	CT47B_HUMAN	cancer/testis antigen family 47, member B1	157										breast(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|lung(9)|ovary(1)|skin(1)	22						GGCACAGCAGCGTGGGGCCCC	0.657																																					p.A157T		.											.	.	0			c.G469A						.						94.0	86.0	88.0					X																	120009056		692	1590	2282	SO:0001583	missense	643311	exon1			CAGCAGCGTGGGG		CCDS48161.1	Xq24	2014-05-06	2011-03-24		ENSG00000236446	ENSG00000236446			33293	protein-coding gene	gene with protein product	"""cancer/testis CT47 family, member 13"""	300790				16382448	Standard	NM_001145718		Approved	CT47.13	uc011muc.2	P0C2W7	OTTHUMG00000187483	ENST00000371311.3:c.469G>A	X.37:g.120009056C>T	ENSP00000360360:p.Ala157Thr	Somatic	116	0		WXS	Illumina GAIIx	Phase_I	622	255	NM_001145718	0	0	0	0	0	A6NM97	Missense_Mutation	SNP	ENST00000371311.3	37	CCDS48161.1	.	.	.	.	.	.	.	.	.	.	C	8.681	0.905219	0.17760	.	.	ENSG00000236446	ENST00000371311	.	.	.	1.42	-2.78	0.05859	.	.	.	.	.	T	0.29620	0.0739	N	0.14661	0.345	0.09310	N	1	D	0.71674	0.998	D	0.74023	0.982	T	0.14980	-1.0453	8	0.14252	T	0.57	.	2.9167	0.05755	0.3746:0.2521:0.3733:0.0	.	157	P0C2W7	CT47B_HUMAN	T	157	.	ENSP00000360360:A157T	A	-	1	0	CT47B1	119893084	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.279000	0.02807	-0.992000	0.03472	0.171000	0.16805	GCT	.		0.657	CT47B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058121.1	NM_001145718	
MIR205HG	642587	hgsc.bcm.edu	37	1	209605636	209605637	+	lincRNA	INS	-	-	AGC	rs565985624|rs57779889|rs71788170|rs74820836|rs3842530	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr1:209605636_209605637insAGC	ENST00000384891.1	+	0	220					NR_029622.1				MIR205 host gene (non-protein coding)																		gccaccaccgTagcagcagcag	0.564														337	0.0672923	0.23	0.0231	5008	,	,		19679	0.003		0.005	False		,,,				2504	0.0092				p.V84delinsVA		.											.	.	0			c.251_252insAGC						.																																					642587	exon4			CCACCGTAGCAGC			1q32.2	2014-02-12	2011-11-07		ENSG00000230937	ENSG00000230937		"""Long non-coding RNAs"""	43562	non-coding RNA	RNA, long non-coding	"""long intergenic non-protein coding RNA 510"""						Standard	NM_001104548		Approved	LINC00510	uc009xcn.3		OTTHUMG00000036267		1.37:g.209605643_209605645dupAGC		Somatic	21	0		WXS	Illumina GAIIx	Phase_I	66	23	NM_001104548	0	0	0	0	0		In_Frame_Ins	INS	ENST00000384891.1	37																																																																																				.		0.564	MIR205HG-202	KNOWN	basic	miRNA	lincRNA			
LPHN1	22859	broad.mit.edu	37	19	14272185	14272186	+	Frame_Shift_Ins	INS	-	-	C			TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr19:14272185_14272186insC	ENST00000340736.6	-	7	1760_1761	c.1463_1464insG	c.(1462-1464)gtcfs	p.V488fs	LPHN1_ENST00000361434.3_Frame_Shift_Ins_p.V483fs|LPHN1_ENST00000591528.1_5'Flank|CTB-55O6.12_ENST00000588387.1_RNA|CTB-55O6.12_ENST00000592086.1_RNA	NM_001008701.2	NP_001008701.1	O94910	LPHN1_HUMAN	latrophilin 1	488					calcium-mediated signaling using intracellular calcium source (GO:0035584)|G-protein coupled receptor signaling pathway (GO:0007186)|heterophilic cell-cell adhesion (GO:0007157)|neuropeptide signaling pathway (GO:0007218)|positive regulation of synapse maturation (GO:0090129)	axon (GO:0030424)|cell junction (GO:0030054)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|synapse (GO:0045202)	carbohydrate binding (GO:0030246)|cell adhesion molecule binding (GO:0050839)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)			central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(3)|liver(1)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						CCGGCCACTGGACCCGCCGTAC	0.713																																					p.V488fs		.											.	LPHN1-523	0			c.1464_1465insG						.																																			SO:0001589	frameshift_variant	22859	exon7			CCACTGGACCCGC	AB020628	CCDS12307.1, CCDS32928.1	19p13.2	2014-08-08				ENSG00000072071		"""-"", ""GPCR / Class B : Orphans"""	20973	protein-coding gene	gene with protein product						10994649	Standard	NM_014921		Approved	KIAA0821, CIRL1, LEC2	uc010xnn.2	O94910		ENST00000340736.6:c.1463_1464insG	19.37:g.14272185_14272186insC	ENSP00000340688:p.Val488fs	Somatic	7	0		WXS	Illumina GAIIx	Phase_I	112	6	NM_001008701	0	0	0	0	0	Q96IE7|Q9BU07|Q9HAR3	Frame_Shift_Ins	INS	ENST00000340736.6	37	CCDS32928.1																																																																																			.		0.713	LPHN1-001	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000459696.1	NM_014921	
POU2F2	5452	broad.mit.edu	37	19	42596242	42596243	+	Frame_Shift_Ins	INS	-	-	A			TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr19:42596242_42596243insA	ENST00000526816.2	-	13	1393_1394	c.1378_1379insT	c.(1378-1380)tcafs	p.S460fs	POU2F2_ENST00000529952.1_Frame_Shift_Ins_p.S460fs|POU2F2_ENST00000342301.4_Frame_Shift_Ins_p.S460fs|POU2F2_ENST00000529067.1_Frame_Shift_Ins_p.Q399fs|POU2F2_ENST00000560398.1_Frame_Shift_Ins_p.S466fs|POU2F2_ENST00000533720.1_Frame_Shift_Ins_p.S444fs|POU2F2_ENST00000560558.1_Frame_Shift_Ins_p.S405fs|POU2F2_ENST00000389341.5_Frame_Shift_Ins_p.S444fs			P09086	PO2F2_HUMAN	POU class 2 homeobox 2	460					cell maturation (GO:0048469)|humoral immune response (GO:0006959)|immunoglobulin secretion involved in immune response (GO:0002380)|mature B cell differentiation (GO:0002335)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(5)|lung(4)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Prostate(69;0.059)			Dolutegravir(DB08930)	GTTCAGGCCTGACAAGCCGATA	0.653																																					p.S460fs		.											.	POU2F2-227	0			c.1379_1380insT						.																																			SO:0001589	frameshift_variant	5452	exon13			AGGCCTGACAAGC		CCDS33035.1, CCDS56094.1, CCDS56095.1, CCDS58665.1	19q13.2	2011-06-20	2007-07-13					"""Homeoboxes / POU class"""	9213	protein-coding gene	gene with protein product		164176	"""POU domain class 2, transcription factor 2"""	OTF2			Standard	NM_001207026		Approved	OCT2	uc002osp.3	P09086		ENST00000526816.2:c.1379dupT	19.37:g.42596243_42596243dupA	ENSP00000431603:p.Ser460fs	Somatic	41	0		WXS	Illumina GAIIx	Phase_I	126	6	NM_001207025	0	0	0	0	0	Q16648|Q7M4M8|Q9BRS4	Frame_Shift_Ins	INS	ENST00000526816.2	37	CCDS56095.1																																																																																			.		0.653	POU2F2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387329.3		
C21orf58	54058	broad.mit.edu	37	21	47721985	47721986	+	In_Frame_Ins	INS	-	-	TGG	rs144178764|rs112899928|rs35902237|rs71318063	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr21:47721985_47721986insTGG	ENST00000291691.7	-	8	2032_2033	c.896_897insCCA	c.(895-897)cat>caCCAt	p.299_299H>HH	C21orf58_ENST00000397683.1_In_Frame_Ins_p.193_193H>HH|C21orf58_ENST00000397680.1_In_Frame_Ins_p.193_193H>HH|C21orf58_ENST00000397682.3_In_Frame_Ins_p.193_193H>HH|C21orf58_ENST00000397679.1_In_Frame_Ins_p.193_193H>HH|C21orf58_ENST00000472607.1_5'UTR	NM_058180.3	NP_478060.2	P58505	CU058_HUMAN	chromosome 21 open reading frame 58	299	Poly-His.							p.H299_A300insH(3)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|lung(1)|pancreas(1)	9	Breast(49;0.112)			Colorectal(79;0.239)		GCCACACAGCAtggtggtggtg	0.708														1382	0.275958	0.1384	0.4063	5008	,	,		16708	0.3046		0.3091	False		,,,				2504	0.3057				p.H299delinsHH		.											.	C21orf58-91	3	Insertion - In frame(3)	breast(2)|central_nervous_system(1)	c.897_898insCCA						.																																			SO:0001652	inframe_insertion	54058	exon8			CACAGCATGGTGG		CCDS13735.1, CCDS68229.1	21q22.3	2008-07-07			ENSG00000160298	ENSG00000160298			1300	protein-coding gene	gene with protein product							Standard	XM_005261149		Approved		uc002zjf.3	P58505	OTTHUMG00000090634	ENST00000291691.7:c.894_896dupCCA	21.37:g.47721992_47721994dupTGG	ENSP00000291691:p.His299dup	Somatic	4	0		WXS	Illumina GAIIx	Phase_I	41	25	NM_058180	0	0	0	0	0	B3KPI1	In_Frame_Ins	INS	ENST00000291691.7	37	CCDS13735.1																																																																																			-|0.500;TGG|0.500		0.708	C21orf58-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207283.1	NM_058180	
ALG3	10195	hgsc.bcm.edu	37	3	183959652	183959653	+	IGR	INS	-	-	GAGTGGGAACTGACAGCG			TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr3:183959652_183959653insGAGTGGGAACTGACAGCG	ENST00000397676.3	-	0	1528				VWA5B2_ENST00000426955.2_In_Frame_Ins_p.1186_1186E>EWELTAE|MIR1224_ENST00000408193.1_RNA|VWA5B2_ENST00000273794.5_In_Frame_Ins_p.968_968E>EWELTAE|ALG3_ENST00000463495.1_5'Flank|EIF2B5_ENST00000444495.1_Intron	NM_005787.5	NP_005778.1	Q92685	ALG3_HUMAN	ALG3, alpha-1,3- mannosyltransferase						cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	alpha-1,3-mannosyltransferase activity (GO:0000033)|dol-P-Man:Man(5)GlcNAc(2)-PP-Dol alpha-1,3-mannosyltransferase activity (GO:0052925)			kidney(1)|large_intestine(1)|lung(6)|upper_aerodigestive_tract(1)	9	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			CTGCCTTCGACGAGTGGGAACT	0.723																																					p.D1185delinsDEWELTA		.											.	.	0			c.3555_3556insGAGTGGGAACTGACAGCG						.																																			SO:0001628	intergenic_variant	90113	exon19			CTTCGACGAGTGG	BC002839	CCDS46967.1, CCDS46968.1	3q27.3	2013-02-26	2013-02-26		ENSG00000214160	ENSG00000214160	2.4.1.258	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	23056	protein-coding gene	gene with protein product	"""carbohydrate deficient glycoprotein syndrome type IV"", ""dol-P-Man:Man(5)GlcNAc(2)-PP-Dol alpha-1,3-mannosyltransferase"", ""dol-P-Man dependent alpha-1,3- mannosyltransferase"""	608750	"""asparagine-linked glycosylation 3 homolog (yeast, alpha-1,3-mannosyltransferase)"", ""asparagine-linked glycosylation 3, alpha-1,3- mannosyltransferase homolog (S. cerevisiae)"""			1058125	Standard	NM_005787		Approved	NOT56L, Not56, CDGS4, D16Ertd36e	uc003fne.2	Q92685	OTTHUMG00000156823		3.37:g.183959652_183959653insGAGTGGGAACTGACAGCG		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	78	9	NM_138345	0	0	0	0	0	A8JZZ6|Q9BT71	In_Frame_Ins	INS	ENST00000397676.3	37	CCDS46968.1																																																																																			.		0.723	ALG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346033.1	NM_005787	
RADIL	55698	broad.mit.edu	37	7	4843213	4843214	+	In_Frame_Ins	INS	-	-	CTGCCAGGG	rs533343819|rs143909045	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr7:4843213_4843214insCTGCCAGGG	ENST00000399583.3	-	11	2649_2650	c.2462_2463insCCCTGGCAG	c.(2461-2463)agg>agCCCTGGCAGg	p.820_821insSPG	RADIL_ENST00000538469.1_In_Frame_Ins_p.580_581insSPG|RADIL_ENST00000536091.1_3'UTR	NM_018059.4	NP_060529.4	Q96JH8	RADIL_HUMAN	Ras association and DIL domains	820					multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)|substrate adhesion-dependent cell spreading (GO:0034446)	microtubule (GO:0005874)				NS(1)|biliary_tract(2)|breast(1)|central_nervous_system(3)|endometrium(2)|large_intestine(2)|lung(22)|pancreas(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;7.41e-15)		CACTGCCAGGCCTGCCAGGGCT	0.723														259	0.0517173	0.1392	0.0331	5008	,	,		9434	0.0		0.0268	False		,,,				2504	0.0256				p.R821delinsSPGR		.											.	RADIL-994	0			c.2463_2464insCCCTGGCAG						.			353,2333		70,213,1060						-0.9	0.0			9	146,5910		19,108,2901	no	coding	RADIL	NM_018059.4		89,321,3961	A1A1,A1R,RR		2.4108,13.1422,5.7081				499,8243				SO:0001652	inframe_insertion	55698	exon11			GCCAGGCCTGCCA	AB058752	CCDS43544.1	7p22.1	2010-08-27			ENSG00000157927	ENSG00000157927			22226	protein-coding gene	gene with protein product		611491				16051602, 17704304	Standard	NM_018059		Approved	FLJ10324, KIAA1849, RASIP2	uc003snj.1	Q96JH8	OTTHUMG00000151753	ENST00000399583.3:c.2454_2462dupCCCTGGCAG	7.37:g.4843214_4843222dupCTGCCAGGG	ENSP00000382492:p.Ser818_Gly820dup	Somatic	10	0		WXS	Illumina GAIIx	Phase_I	68	15	NM_018059	0	0	0	0	0	A4D1Z5|A5YM49|B7ZL20|Q0VFZ9|Q75LH3|Q9BSP5|Q9H0M6|Q9NW43|Q9NWC4	In_Frame_Ins	INS	ENST00000399583.3	37	CCDS43544.1																																																																																			.		0.723	RADIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323769.2	NM_018059	
LURAP1L	286343	broad.mit.edu	37	9	12775861	12775862	+	In_Frame_Ins	INS	-	-	GGCGGC	rs3833707|rs139315731		TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr9:12775861_12775862insGGCGGC	ENST00000319264.3	+	1	842_843	c.147_148insGGCGGC	c.(148-150)ggc>GGCGGCggc	p.50_50G>GGG	RP11-3L8.3_ENST00000417638.1_RNA|LURAP1L_ENST00000489107.1_3'UTR	NM_203403.1	NP_981948.1	Q8IV03	LUR1L_HUMAN	leucine rich adaptor protein 1-like	53	Gly-rich.							p.G49_G50insGGG(2)|p.G50_G52delGGG(1)									gcggtggtggtggcggcggcgg	0.688																																					p.G49delinsGGG		.											.	.	3	Insertion - In frame(2)|Deletion - In frame(1)	large_intestine(1)|prostate(1)|central_nervous_system(1)	c.147_148insGGCGGC						.																																			SO:0001652	inframe_insertion	286343	exon1			TGGTGGTGGCGGC	AK095824	CCDS6473.1	9p22.3	2012-02-01	2012-02-01	2012-02-01	ENSG00000153714	ENSG00000153714			31452	protein-coding gene	gene with protein product	"""similar to DNA segment, Chr 4, Brigham & Womens Genetics 0951 expressed"""		"""chromosome 9 open reading frame 150"""	C9orf150		12766061	Standard	NM_203403		Approved	MGC46502, FLJ38505, bA3L8.2	uc003zkw.3	Q8IV03	OTTHUMG00000019557	ENST00000319264.3:c.160_165dupGGCGGC	9.37:g.12775862_12775867dupGGCGGC	ENSP00000321026:p.GlyGly54dup	Somatic	5	0		WXS	Illumina GAIIx	Phase_I	61	16	NM_203403	0	0	0	0	0	Q5VZX7|Q8N923|Q8NCG2	In_Frame_Ins	INS	ENST00000319264.3	37	CCDS6473.1																																																																																			.		0.688	LURAP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051730.1	NM_203403	
PRAMEF1	65121	bcgsc.ca	37	1	12855598	12855599	+	Missense_Mutation	DNP	AC	AC	TG	rs201576054|rs200964387	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	AC	AC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr1:12855598_12855599AC>TG	ENST00000332296.7	+	4	981_982	c.878_879AC>TG	c.(877-879)aAC>aTG	p.N293M	PRAMEF1_ENST00000400814.3_Missense_Mutation_p.N48M	NM_023013.2	NP_075389.1	O95521	PRAM1_HUMAN	PRAME family member 1	293					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	35	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		TGCCTCCAGAACCCCTTGGAGA	0.455																																					p.N293M		.											.	PRAMEF1-22	0			c.C879G						.																																			SO:0001583	missense	65121	exon4			CCAGAACCCCTTG	AL049686	CCDS148.1	1p36.21	2013-01-17			ENSG00000116721	ENSG00000116721		"""-"""	28840	protein-coding gene	gene with protein product							Standard	NM_023013		Approved		uc001auj.2	O95521	OTTHUMG00000001928	Exception_encountered	1.37:g.12855598_12855599delinsTG	ENSP00000332134:p.Asn293Met	Somatic	81	0		WXS	Illumina GAIIx	Phase_I	24	0	NM_023013	0	0	0	0	0	Q9UQP2	Missense_Mutation	DNP	ENST00000332296.7	37	CCDS148.1																																																																																			.		0.455	PRAMEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005458.1	NM_023013	
PRAMEF2	65122	bcgsc.ca	37	1	12921087	12921088	+	Missense_Mutation	DNP	AC	AC	TG	rs139022602|rs141834728	byFrequency	TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	AC	AC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr1:12921087_12921088AC>TG	ENST00000240189.2	+	4	965_966	c.878_879AC>TG	c.(877-879)aAC>aTG	p.N293M		NM_023014.1	NP_075390.1	O60811	PRAM2_HUMAN	PRAME family member 2	293					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(22)|prostate(6)|skin(3)|upper_aerodigestive_tract(4)	42	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;2.4e-06)|Kidney(185;4.89e-05)|COAD - Colon adenocarcinoma(227;0.000152)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		TGCCTCCAGAACCCCTTGGAGA	0.46																																					p.N293M		.											.	PRAMEF2-68	0			c.C879G						.																																			SO:0001583	missense	65122	exon4			CCAGAACCCCTTG		CCDS149.1	1p36.21	2013-01-17			ENSG00000120952	ENSG00000120952		"""-"""	28841	protein-coding gene	gene with protein product							Standard	NM_023014		Approved	FLJ43580	uc001aum.1	O60811	OTTHUMG00000001986	Exception_encountered	1.37:g.12921087_12921088delinsTG	ENSP00000240189:p.Asn293Met	Somatic	40	0		WXS	Illumina GAIIx	Phase_I	18	0	NM_023014	0	0	0	0	0		Missense_Mutation	DNP	ENST00000240189.2	37	CCDS149.1																																																																																			C|0.994;G|0.006		0.460	PRAMEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005517.1	NM_023014	
AIM1	202	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	6	106968247	106968248	+	Missense_Mutation	DNP	CC	CC	TT			TCGA-OR-A5KO-01A-11D-A29I-10	TCGA-OR-A5KO-10A-01D-A29L-10	CC	CC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	efc0de29-4b55-469d-90c4-1f45dd50639f	e0418b18-0033-4ac2-abc0-bc7c73abab6f	g.chr6:106968247_106968248CC>TT	ENST00000369066.3	+	2	2427_2428	c.1940_1941CC>TT	c.(1939-1941)tCC>tTT	p.S647F		NM_001624.2	NP_001615	Q9UMX9	S45A2_HUMAN	absent in melanoma 1	0					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				breast(8)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(7)|large_intestine(13)|lung(20)|ovary(5)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	69	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		ATGGCTGAATCCAGTCCCACCA	0.535																																					p.S647F		.											.	AIM1-139	0			c.C1941T						.																																			SO:0001583	missense	202	exon2			TGAATCCAGTCCC	U83115	CCDS34506.1	6q21	2014-01-29			ENSG00000112297	ENSG00000112297			356	protein-coding gene	gene with protein product	"""suppression of tumorigenicity 4"", ""beta-gamma crystallin domain containing 1"""	601797	"""suppression of tumorigenicity 4 (malignant melanoma)"""	ST4		1680551, 12693952	Standard	NM_001624		Approved	CRYBG1	uc003prh.3	Q9Y4K1	OTTHUMG00000015302	Exception_encountered	6.37:g.106968247_106968248delinsTT	ENSP00000358062:p.Ser647Phe	Somatic	147	0		WXS	Illumina GAIIx	Phase_I	174	15	NM_001624	0	0	0	0	0	Q6P2P0|Q9BTM3	Missense_Mutation	DNP	ENST00000369066.3	37	CCDS34506.1																																																																																			.		0.535	AIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041669.1		
