#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
HES3	390992	hgsc.bcm.edu	37	1	6305292	6305292	+	Missense_Mutation	SNP	C	C	A	rs61760836	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr1:6305292C>A	ENST00000377898.3	+	4	351	c.286C>A	c.(286-288)Ccc>Acc	p.P96T		NM_001024598.3	NP_001019769.1	Q5TGS1	HES3_HUMAN	hes family bHLH transcription factor 3	96	Orange.				hindbrain morphogenesis (GO:0021575)|in utero embryonic development (GO:0001701)|midbrain development (GO:0030901)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oculomotor nerve development (GO:0021557)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of timing of neuron differentiation (GO:0060164)|transcription, DNA-templated (GO:0006351)|trochlear nerve development (GO:0021558)	nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription factor binding (GO:0008134)			lung(2)|skin(1)	3	Ovarian(185;0.0634)	all_cancers(23;2.48e-32)|all_epithelial(116;1.14e-17)|all_lung(118;2.85e-06)|all_neural(13;3.68e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;3.77e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00475)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;1.2e-37)|GBM - Glioblastoma multiforme(13;3.2e-29)|OV - Ovarian serous cystadenocarcinoma(86;2.52e-19)|Colorectal(212;1.19e-07)|COAD - Colon adenocarcinoma(227;1.3e-05)|Kidney(185;4.88e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000871)|BRCA - Breast invasive adenocarcinoma(365;0.00105)|STAD - Stomach adenocarcinoma(132;0.00308)|READ - Rectum adenocarcinoma(331;0.0642)|Lung(427;0.241)		CCCCCTGGTGCCCGAGAGCGC	0.751													C|||	2794	0.557907	0.3079	0.755	5008	,	,		7447	0.5615		0.6849	False		,,,				2504	0.6217				p.P96T		.											.	HES3-514	0			c.C286A						.	C	THR/PRO	1430,1518		391,648,435	2.0	3.0	2.0		286	2.4	0.2	1	dbSNP_129	2	4911,1731		1926,1059,336	no	missense	HES3	NM_001024598.3	38	2317,1707,771	AA,AC,CC		26.0614,48.5075,33.879	benign	96/187	6305292	6341,3249	1474	3321	4795	SO:0001583	missense	390992	exon4			CTGGTGCCCGAGA		CCDS41238.1	1p36.31	2013-10-17	2013-10-17		ENSG00000173673	ENSG00000173673		"""Basic helix-loop-helix proteins"""	26226	protein-coding gene	gene with protein product		609971	"""hairy and enhancer of split 3 (Drosophila)"""				Standard	NM_001024598		Approved	bHLHb43	uc009vly.2	Q5TGS1	OTTHUMG00000001271	ENST00000377898.3:c.286C>A	1.37:g.6305292C>A	ENSP00000367130:p.Pro96Thr	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_001024598	0	0	0	0	0	Q5TGS0	Missense_Mutation	SNP	ENST00000377898.3	37	CCDS41238.1	1241	0.5682234432234432	158	0.32113821138211385	254	0.7016574585635359	313	0.5472027972027972	516	0.6807387862796834	C	2.270	-0.367136	0.05069	0.485075	0.739386	ENSG00000173673	ENST00000377898	T	0.29397	1.57	3.31	2.4	0.29515	.	.	.	.	.	T	0.00012	0.0000	N	0.14661	0.345	0.80722	P	0.0	B	0.22003	0.063	B	0.17098	0.017	T	0.30765	-0.9967	8	0.11794	T	0.64	-26.1056	6.4315	0.21798	0.0:0.8639:0.0:0.1361	rs61760836	96	Q5TGS1	HES3_HUMAN	T	96	ENSP00000367130:P96T	ENSP00000367130:P96T	P	+	1	0	HES3	6227879	0.724000	0.28038	0.207000	0.23584	0.040000	0.13550	1.220000	0.32491	0.982000	0.38575	0.289000	0.19496	CCC	C|0.430;A|0.570		0.751	HES3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000003716.3	NM_001024598	
HES3	390992	hgsc.bcm.edu	37	1	6305303	6305303	+	Silent	SNP	C	C	A	rs61760837	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr1:6305303C>A	ENST00000377898.3	+	4	362	c.297C>A	c.(295-297)gcC>gcA	p.A99A		NM_001024598.3	NP_001019769.1	Q5TGS1	HES3_HUMAN	hes family bHLH transcription factor 3	99	Orange.				hindbrain morphogenesis (GO:0021575)|in utero embryonic development (GO:0001701)|midbrain development (GO:0030901)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oculomotor nerve development (GO:0021557)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of timing of neuron differentiation (GO:0060164)|transcription, DNA-templated (GO:0006351)|trochlear nerve development (GO:0021558)	nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription factor binding (GO:0008134)			lung(2)|skin(1)	3	Ovarian(185;0.0634)	all_cancers(23;2.48e-32)|all_epithelial(116;1.14e-17)|all_lung(118;2.85e-06)|all_neural(13;3.68e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;3.77e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00475)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;1.2e-37)|GBM - Glioblastoma multiforme(13;3.2e-29)|OV - Ovarian serous cystadenocarcinoma(86;2.52e-19)|Colorectal(212;1.19e-07)|COAD - Colon adenocarcinoma(227;1.3e-05)|Kidney(185;4.88e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000871)|BRCA - Breast invasive adenocarcinoma(365;0.00105)|STAD - Stomach adenocarcinoma(132;0.00308)|READ - Rectum adenocarcinoma(331;0.0642)|Lung(427;0.241)		CCGAGAGCGCCGCCGGCAGCA	0.771													C|||	2792	0.557508	0.3079	0.7536	5008	,	,		7640	0.5615		0.6839	False		,,,				2504	0.6217				p.A99A		.											.	HES3-514	0			c.C297A						.	C		1446,1378		419,608,385	2.0	3.0	2.0		297	0.2	0.0	1	dbSNP_129	2	4876,1552		1960,956,298	no	coding-synonymous	HES3	NM_001024598.3		2379,1564,683	AA,AC,CC		24.1444,48.796,31.6688		99/187	6305303	6322,2930	1412	3214	4626	SO:0001819	synonymous_variant	390992	exon4			GAGCGCCGCCGGC		CCDS41238.1	1p36.31	2013-10-17	2013-10-17		ENSG00000173673	ENSG00000173673		"""Basic helix-loop-helix proteins"""	26226	protein-coding gene	gene with protein product		609971	"""hairy and enhancer of split 3 (Drosophila)"""				Standard	NM_001024598		Approved	bHLHb43	uc009vly.2	Q5TGS1	OTTHUMG00000001271	ENST00000377898.3:c.297C>A	1.37:g.6305303C>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_001024598	0	0	0	0	0	Q5TGS0	Silent	SNP	ENST00000377898.3	37	CCDS41238.1																																																																																			C|0.438;A|0.562		0.771	HES3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000003716.3	NM_001024598	
FBXO42	54455	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	16580181	16580181	+	Frame_Shift_Del	DEL	G	G	-	rs368997762		TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr1:16580181delG	ENST00000375592.3	-	7	1029	c.813delC	c.(811-813)tccfs	p.S271fs		NM_018994.1	NP_061867.1	Q6P3S6	FBX42_HUMAN	F-box protein 42	271										autonomic_ganglia(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	26		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00475)|all_lung(284;0.00671)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0193)|Colorectal(212;3.16e-07)|COAD - Colon adenocarcinoma(227;1.46e-05)|BRCA - Breast invasive adenocarcinoma(304;4.37e-05)|Kidney(64;0.000246)|KIRC - Kidney renal clear cell carcinoma(64;0.00336)|STAD - Stomach adenocarcinoma(313;0.0139)|READ - Rectum adenocarcinoma(331;0.0693)		TGTTCGGCTTGGACCACGCCC	0.493																																					p.S271fs		.											.	FBXO42-228	0			c.813delC						.						71.0	62.0	65.0					1																	16580181		2203	4300	6503	SO:0001589	frameshift_variant	54455	exon7			CGGCTTGGACCAC	BC063864	CCDS30613.1	1p36.23-p36.11	2008-02-05			ENSG00000037637	ENSG00000037637		"""F-boxes /  ""other"""""	29249	protein-coding gene	gene with protein product		609109				10718198	Standard	XM_006710698		Approved	KIAA1332, Fbx42	uc001ayg.3	Q6P3S6	OTTHUMG00000002218	ENST00000375592.3:c.813delC	1.37:g.16580181delG	ENSP00000364742:p.Ser271fs	Somatic	56	0		WXS	Illumina GAIIx	Phase_I	80	21	NM_018994	0	0	0	0	0	B3KP30|Q5TEU8|Q86XI0|Q8N3N4|Q8N5F8|Q9BRM0|Q9P2L4	Frame_Shift_Del	DEL	ENST00000375592.3	37	CCDS30613.1																																																																																			.		0.493	FBXO42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006285.1		
BRDT	676	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	92446707	92446707	+	Nonsense_Mutation	SNP	T	T	A			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr1:92446707T>A	ENST00000362005.3	+	11	2140	c.1722T>A	c.(1720-1722)tgT>tgA	p.C574*	BRDT_ENST00000370389.2_Nonsense_Mutation_p.C501*|BRDT_ENST00000394530.3_Nonsense_Mutation_p.C528*|BRDT_ENST00000399546.2_Nonsense_Mutation_p.C574*|BRDT_ENST00000402388.1_Nonsense_Mutation_p.C574*	NM_001242805.1	NP_001229734	Q58F21	BRDT_HUMAN	bromodomain, testis-specific	574	NET. {ECO:0000255|PROSITE- ProRule:PRU00857}.				cell differentiation (GO:0030154)|chromatin remodeling (GO:0006338)|histone displacement (GO:0001207)|male meiosis (GO:0007140)|male meiosis I (GO:0007141)|mRNA processing (GO:0006397)|positive regulation of transcription during meiosis (GO:0051039)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone binding (GO:0042393)|lysine-acetylated histone binding (GO:0070577)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(24)|ovary(1)|prostate(4)|skin(2)|stomach(2)|urinary_tract(2)	56		all_lung(203;0.00531)|Lung NSC(277;0.0194)		all cancers(265;0.0228)|Epithelial(280;0.133)		TTTCGGCATGTCTAAGAAAGA	0.343																																					p.C578X		.											.	BRDT-374	0			c.T1734A						.						72.0	76.0	75.0					1																	92446707		2202	4300	6502	SO:0001587	stop_gained	676	exon10			GGCATGTCTAAGA	AF019085	CCDS735.1, CCDS55615.1, CCDS55616.1, CCDS72820.1	1p22.1	2010-12-23			ENSG00000137948	ENSG00000137948			1105	protein-coding gene	gene with protein product	"""cancer/testis antigen 9"""	602144				9367677	Standard	NM_001726		Approved	BRD6, CT9	uc010osz.2	Q58F21	OTTHUMG00000010113	ENST00000362005.3:c.1722T>A	1.37:g.92446707T>A	ENSP00000354568:p.Cys574*	Somatic	62	0		WXS	Illumina GAIIx	Phase_I	57	15	NM_001242806	0	0	0	0	0	A6NF68|B7Z811|B7Z890|B7ZAX7|D3DT32|O14789|Q05DQ4|Q6P5T1|Q7Z4A6|Q8IWI6	Nonsense_Mutation	SNP	ENST00000362005.3	37	CCDS735.1	.	.	.	.	.	.	.	.	.	.	T	41	9.095178	0.99064	.	.	ENSG00000137948	ENST00000362005;ENST00000370389;ENST00000399546;ENST00000394530;ENST00000402388	.	.	.	5.67	1.78	0.24846	.	0.000000	0.64402	D	0.000007	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.5425	8.5219	0.33282	0.0:0.3295:0.0:0.6705	.	.	.	.	X	574;501;574;528;574	.	ENSP00000354568:C574X	C	+	3	2	BRDT	92219295	0.908000	0.30866	0.925000	0.36789	0.049000	0.14656	0.047000	0.14056	0.096000	0.17463	0.477000	0.44152	TGT	.		0.343	BRDT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027980.2	NM_207189	
SLC35A3	23443	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	100483292	100483292	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr1:100483292A>G	ENST00000370155.3	+	7	1200	c.808A>G	c.(808-810)Aaa>Gaa	p.K270E	SLC35A3_ENST00000370156.3_3'UTR|SLC35A3_ENST00000427993.2_Missense_Mutation_p.K270E|SLC35A3_ENST00000370153.1_Missense_Mutation_p.K312E|SLC35A3_ENST00000465289.1_Intron	NM_012243.1	NP_036375.1	Q9Y2D2	S35A3_HUMAN	solute carrier family 35 (UDP-N-acetylglucosamine (UDP-GlcNAc) transporter), member A3	270					transmembrane transport (GO:0055085)|UDP-N-acetylglucosamine metabolic process (GO:0006047)|UDP-N-acetylglucosamine transport (GO:0015788)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	sugar:proton symporter activity (GO:0005351)|UDP-N-acetylglucosamine transmembrane transporter activity (GO:0005462)			biliary_tract(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|urinary_tract(1)	11		all_epithelial(167;0.000686)|all_lung(203;0.0154)|Lung NSC(277;0.0155)		Epithelial(280;0.124)|all cancers(265;0.198)|Lung(183;0.199)		TAATATTTTAAAAGGATTTGC	0.299																																					p.K312E	Ovarian(7;298 356 944 2149 6911)	.											.	SLC35A3-90	0			c.A934G						.						52.0	53.0	53.0					1																	100483292		2202	4286	6488	SO:0001583	missense	23443	exon7			ATTTTAAAAGGAT	AB021981	CCDS762.1, CCDS60204.1, CCDS60205.1	1p21	2013-05-22			ENSG00000117620	ENSG00000117620		"""Solute carriers"""	11023	protein-coding gene	gene with protein product		605632	"""solute carrier family 35 (UDP-N-acetylglucosamine (UDP-GlcNAc) transporter), member 3"""			10393322	Standard	NM_001271685		Approved		uc001dsr.2	Q9Y2D2	OTTHUMG00000010805	ENST00000370155.3:c.808A>G	1.37:g.100483292A>G	ENSP00000359174:p.Lys270Glu	Somatic	143	1		WXS	Illumina GAIIx	Phase_I	127	36	NM_001271685	0	0	0	0	0	A8K3F8|D3DT54|Q68CR2|Q9BSB7	Missense_Mutation	SNP	ENST00000370155.3	37	CCDS762.1	.	.	.	.	.	.	.	.	.	.	A	27.2	4.809663	0.90707	.	.	ENSG00000117620	ENST00000370155;ENST00000427993;ENST00000370153	T;T;T	0.55413	0.52;0.52;0.52	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	T	0.80270	0.4592	H	0.97918	4.105	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.996;0.997	D	0.88020	0.2768	10	0.87932	D	0	-15.6987	15.5683	0.76313	1.0:0.0:0.0:0.0	.	311;270	Q9Y2D2-2;Q9Y2D2	.;S35A3_HUMAN	E	270;270;312	ENSP00000359174:K270E;ENSP00000414947:K270E;ENSP00000359172:K312E	ENSP00000359172:K312E	K	+	1	0	SLC35A3	100255880	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.285000	0.95894	2.143000	0.66587	0.533000	0.62120	AAA	.		0.299	SLC35A3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000029783.1	NM_012243	
PRPF38B	55119	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	109235422	109235425	+	Frame_Shift_Del	DEL	CTTA	CTTA	-			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	CTTA	CTTA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr1:109235422_109235425delCTTA	ENST00000370025.4	+	1	478_481	c.209_212delCTTA	c.(208-213)ccttacfs	p.PY70fs	PRPF38B_ENST00000467302.1_3'UTR|PRPF38B_ENST00000370022.5_Frame_Shift_Del_p.PY70fs|PRPF38B_ENST00000370021.1_5'UTR	NM_018061.2	NP_060531.2	Q5VTL8	PR38B_HUMAN	pre-mRNA processing factor 38B	70					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)			NS(1)|kidney(3)|large_intestine(5)|lung(8)|prostate(1)|skin(1)	19		all_epithelial(167;0.000154)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0149)|Lung(183;0.0888)|COAD - Colon adenocarcinoma(174;0.113)|Epithelial(280;0.161)		CTGTCGTCGCCTTACTTCAAAGTA	0.554																																					p.70_71del		.											.	PRPF38B-90	0			c.209_212del						.																																			SO:0001589	frameshift_variant	55119	exon1			CGTCGCCTTACTT	AL833950	CCDS788.1	1p13.3	2013-10-03	2013-10-03		ENSG00000134186	ENSG00000134186			25512	protein-coding gene	gene with protein product			"""PRP38 pre-mRNA processing factor 38 (yeast) domain containing B"""				Standard	NM_018061		Approved	FLJ10330, NET1	uc001dvv.4	Q5VTL8	OTTHUMG00000010991	ENST00000370025.4:c.209_212delCTTA	1.37:g.109235422_109235425delCTTA	ENSP00000359042:p.Pro70fs	Somatic	206	0		WXS	Illumina GAIIx	Phase_I	379	130	NM_018061	0	0	0	0	0	Q05DD6|Q32Q58|Q5VTL9|Q6PK39|Q7Z6E2|Q86WF3|Q8IWG9|Q9NW40	Frame_Shift_Del	DEL	ENST00000370025.4	37	CCDS788.1																																																																																			.		0.554	PRPF38B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030231.1	NM_018061	
RSBN1	54665	hgsc.bcm.edu	37	1	114354654	114354654	+	Silent	SNP	T	T	C	rs3195954	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr1:114354654T>C	ENST00000261441.5	-	1	444	c.381A>G	c.(379-381)ccA>ccG	p.P127P	RP5-1073O3.2_ENST00000429398.1_RNA|RP5-1073O3.2_ENST00000418238.1_RNA	NM_018364.3	NP_060834.2	Q5VWQ0	RSBN1_HUMAN	round spermatid basic protein 1	127	Pro-rich.					nucleus (GO:0005634)				breast(1)|endometrium(2)|large_intestine(4)|lung(16)|ovary(1)|prostate(3)|urinary_tract(2)	29	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CTGCATTCGTTGGCGGCAGCG	0.746													T|||	610	0.121805	0.0045	0.1311	5008	,	,		11529	0.2282		0.1869	False		,,,				2504	0.0971				p.P127P		.											.	RSBN1-91	0			c.A381G						.	T		149,4053		2,145,1954	13.0	24.0	21.0		381	-4.9	0.5	1	dbSNP_105	21	1412,6854		115,1182,2836	no	coding-synonymous	RSBN1	NM_018364.3		117,1327,4790	CC,CT,TT		17.082,3.5459,12.5201		127/803	114354654	1561,10907	2101	4133	6234	SO:0001819	synonymous_variant	54665	exon1			ATTCGTTGGCGGC	AK002082	CCDS862.1	1p13.1	2008-02-05			ENSG00000081019	ENSG00000081019			25642	protein-coding gene	gene with protein product		615858				12477932	Standard	NM_018364		Approved	FLJ11220, ROSBIN	uc001edq.3	Q5VWQ0	OTTHUMG00000011938	ENST00000261441.5:c.381A>G	1.37:g.114354654T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	32	16	NM_018364	0	0	0	0	0	A8K937|Q6AI21|Q8TC33|Q9HA80|Q9NUP6	Silent	SNP	ENST00000261441.5	37	CCDS862.1																																																																																			T|0.861;C|0.139		0.746	RSBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033022.2	NM_018364	
CA14	23632	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	150232559	150232559	+	Silent	SNP	G	G	T			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr1:150232559G>T	ENST00000369111.4	+	2	1039	c.69G>T	c.(67-69)acG>acT	p.T23T	RP4-790G17.7_ENST00000607002.1_RNA|snoU13_ENST00000458929.1_RNA	NM_012113.1	NP_036245.1	Q9ULX7	CAH14_HUMAN	carbonic anhydrase XIV	23					bicarbonate transport (GO:0015701)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbonate dehydratase activity (GO:0004089)|metal ion binding (GO:0046872)			central_nervous_system(1)|cervix(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(2)|prostate(2)	18	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)		Acetazolamide(DB00819)|Zonisamide(DB00909)	AACACTGGACGTATGAGGGTG	0.592																																					p.T23T		.											.	CA14-91	0			c.G69T						.						127.0	111.0	117.0					1																	150232559		2203	4300	6503	SO:0001819	synonymous_variant	23632	exon2			CTGGACGTATGAG	AB025904	CCDS947.1	1q21	2008-02-05			ENSG00000118298	ENSG00000118298		"""Carbonic anhydrases"""	1372	protein-coding gene	gene with protein product		604832				10512682	Standard	XM_005245059		Approved		uc001etx.3	Q9ULX7	OTTHUMG00000012549	ENST00000369111.4:c.69G>T	1.37:g.150232559G>T		Somatic	192	0		WXS	Illumina GAIIx	Phase_I	220	39	NM_012113	0	0	0	0	0	Q5TB24|Q8NCF4	Silent	SNP	ENST00000369111.4	37	CCDS947.1																																																																																			.		0.592	CA14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000035064.2	NM_012113	
SCAMP3	10067	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	155227427	155227429	+	In_Frame_Del	DEL	AGG	AGG	-	rs375600980		TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	AGG	AGG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr1:155227427_155227429delAGG	ENST00000302631.3	-	6	644_646	c.537_539delCCT	c.(535-540)ctcctg>ctg	p.179_180LL>L	FAM189B_ENST00000472550.1_5'Flank|FAM189B_ENST00000350210.2_5'Flank|SCAMP3_ENST00000472397.1_5'UTR|FAM189B_ENST00000361361.2_5'Flank|FAM189B_ENST00000368368.3_5'Flank|SCAMP3_ENST00000355379.3_In_Frame_Del_p.153_154LL>L	NM_005698.3	NP_005689.2	O14828	SCAM3_HUMAN	secretory carrier membrane protein 3	179					post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)|response to retinoic acid (GO:0032526)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(3)|large_intestine(3)|lung(7)|ovary(4)|urinary_tract(1)	19	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			GAGGAAGTTCAGGAGAAGAGCCA	0.552																																					p.179_180del		.											.	SCAMP3-93	0			c.537_539del						.																																			SO:0001651	inframe_deletion	10067	exon6			AAGTTCAGGAGAA	AF005039	CCDS1105.1, CCDS1106.1	1q21	2013-02-21			ENSG00000116521	ENSG00000116521		"""Secretory carrier membrane proteins"""	10565	protein-coding gene	gene with protein product	"""Propin 1"""	606913		C1orf3		9331372, 9658162	Standard	NM_005698		Approved		uc001fjs.3	O14828	OTTHUMG00000035874	ENST00000302631.3:c.537_539delCCT	1.37:g.155227427_155227429delAGG	ENSP00000307275:p.Leu180del	Somatic	241	0		WXS	Illumina GAIIx	Phase_I	224	34	NM_005698	0	0	0	0	0	A9Z1W6|B1AVS6|O15128|Q96FR8|Q9BPY0	In_Frame_Del	DEL	ENST00000302631.3	37	CCDS1105.1																																																																																			.		0.552	SCAMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087399.1	NM_005698	
C1orf106	55765	hgsc.bcm.edu	37	1	200880978	200880978	+	Missense_Mutation	SNP	C	C	T	rs296520	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr1:200880978C>T	ENST00000367342.4	+	9	1812	c.1612C>T	c.(1612-1614)Cgc>Tgc	p.R538C	C1orf106_ENST00000413687.2_Missense_Mutation_p.R453C	NM_018265.3	NP_060735.3	Q3KP66	CA106_HUMAN	chromosome 1 open reading frame 106	538			R -> C (in dbSNP:rs296520). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.							endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(2)	21						GTGGGAGCTGCGCCGCGCAGC	0.736													T|||	3966	0.791933	0.6089	0.8213	5008	,	,		12017	0.997		0.7256	False		,,,				2504	0.8753				p.R552C		.											.	C1orf106-93	0			c.C1654T						.	T	CYS/ARG,CYS/ARG	2547,1503		890,767,368	5.0	7.0	6.0		1357,1612	0.8	0.0	1	dbSNP_79	6	5587,2355		2124,1339,508	no	missense,missense	C1orf106	NM_001142569.2,NM_018265.3	180,180	3014,2106,876	TT,TC,CC		29.6525,37.1111,32.1714	benign,benign	453/579,538/664	200880978	8134,3858	2025	3971	5996	SO:0001583	missense	55765	exon9			GAGCTGCGCCGCG	AK001763	CCDS44292.1	1q32.1	2011-02-15			ENSG00000163362	ENSG00000163362			25599	protein-coding gene	gene with protein product						14702039	Standard	NM_018265		Approved	FLJ10901	uc001gvo.4	Q3KP66	OTTHUMG00000035789	ENST00000367342.4:c.1612C>T	1.37:g.200880978C>T	ENSP00000356311:p.Arg538Cys	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	26	26	NM_018265	0	0	0	0	0	B4E1K9|E9PFY0|Q9NV65|Q9NVI0	Missense_Mutation	SNP	ENST00000367342.4	37		1677	0.7678571428571429	261	0.5304878048780488	285	0.787292817679558	569	0.9947552447552448	562	0.741424802110818	T	0.366	-0.936884	0.02340	0.628889	0.703475	ENSG00000163362	ENST00000367342;ENST00000413687	T;T	0.28454	1.61;1.61	3.39	0.759	0.18438	.	0.912041	0.09365	N	0.812206	T	0.00012	0.0000	N	0.01576	-0.805	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.16188	-1.0411	9	0.29301	T	0.29	-23.0614	3.796	0.08740	0.0:0.2241:0.1856:0.5903	rs296520;rs7519373;rs56757010	538	Q3KP66	CA106_HUMAN	C	538;453	ENSP00000356311:R538C;ENSP00000392105:R453C	ENSP00000356311:R538C	R	+	1	0	C1orf106	199147601	0.004000	0.15560	0.002000	0.10522	0.007000	0.05969	-0.731000	0.04909	-0.124000	0.11724	-0.381000	0.06696	CGC	C|0.242;T|0.758		0.736	C1orf106-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000087057.2	NM_018265	
TNNT2	7139	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	201338962	201338962	+	Missense_Mutation	SNP	A	A	T			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr1:201338962A>T	ENST00000367320.2	-	5	131	c.79T>A	c.(79-81)Tgg>Agg	p.W27R	TNNT2_ENST00000367315.2_Intron|TNNT2_ENST00000458432.2_Missense_Mutation_p.W29R|TNNT2_ENST00000367318.5_Intron|TNNT2_ENST00000360372.4_Intron|TNNT2_ENST00000509001.1_Intron|TNNT2_ENST00000421663.2_Intron|TNNT2_ENST00000236918.7_Missense_Mutation_p.W22R|TNNT2_ENST00000367317.4_Intron|TNNT2_ENST00000367322.1_Intron	NM_001276346.1	NP_001263275.1	P45379	TNNT2_HUMAN	troponin T type 2 (cardiac)	0					ATP catabolic process (GO:0006200)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|muscle filament sliding (GO:0030049)|negative regulation of ATPase activity (GO:0032780)|positive regulation of ATPase activity (GO:0032781)|regulation of heart contraction (GO:0008016)|regulation of muscle contraction (GO:0006937)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytosol (GO:0005829)|sarcomere (GO:0030017)|striated muscle thin filament (GO:0005865)|troponin complex (GO:0005861)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|tropomyosin binding (GO:0005523)|troponin C binding (GO:0030172)|troponin I binding (GO:0031013)			breast(2)|cervix(1)|endometrium(3)|large_intestine(4)|liver(1)|lung(9)	20						TCCTCTCTCCAGTCCTCCTCT	0.617																																					p.W27R		.											.	TNNT2-90	0			c.T79A						.						138.0	116.0	124.0					1																	201338962		2203	4300	6503	SO:0001583	missense	7139	exon5			CTCTCCAGTCCTC	X74819	CCDS30968.1, CCDS30969.1, CCDS60390.1, CCDS73002.1, CCDS73003.1	1q32	2014-09-17	2005-09-12		ENSG00000118194	ENSG00000118194			11949	protein-coding gene	gene with protein product		191045	"""troponin T2, cardiac"", ""cardiomyopathy, hypertrophic 2"", ""cardiomyopathy, dilated 1D (autosomal dominant)"""	CMH2, CMD1D		8088824, 8205619, 9482583	Standard	NM_001001430		Approved	CMPD2	uc001gwf.4	P45379	OTTHUMG00000035733	ENST00000367320.2:c.79T>A	1.37:g.201338962A>T	ENSP00000356289:p.Trp27Arg	Somatic	111	1		WXS	Illumina GAIIx	Phase_I	170	24	NM_001276345	0	0	0	0	0	A2TDB9|A8K3K6|O60214|Q99596|Q99597|Q9BUF6|Q9UM96	Missense_Mutation	SNP	ENST00000367320.2	37		.	.	.	.	.	.	.	.	.	.	A	13.63	2.295097	0.40594	.	.	ENSG00000118194	ENST00000458432;ENST00000236918;ENST00000367320;ENST00000455702;ENST00000422165	D;D;D;D;D	0.98996	-5.31;-5.31;-5.31;-5.31;-5.31	4.49	3.34	0.38264	.	0.869992	0.10083	N	0.718194	D	0.96213	0.8765	N	0.08118	0	0.80722	D	1	P;P	0.48016	0.904;0.815	P;B	0.45794	0.493;0.248	D	0.92396	0.5925	10	0.56958	D	0.05	-17.1807	9.2311	0.37437	0.8171:0.1829:0.0:0.0	.	27;27	P45379-3;P45379-10	.;.	R	29;22;27;27;22	ENSP00000387874:W29R;ENSP00000236918:W22R;ENSP00000356289:W27R;ENSP00000402238:W27R;ENSP00000395163:W22R	ENSP00000236918:W22R	W	-	1	0	TNNT2	199605585	1.000000	0.71417	1.000000	0.80357	0.829000	0.46940	3.144000	0.50616	0.725000	0.32318	0.459000	0.35465	TGG	.		0.617	TNNT2-003	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000086923.2	NM_000364	
EPHX1	2052	broad.mit.edu;bcgsc.ca	37	1	226032262	226032264	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr1:226032262_226032264delCTC	ENST00000366837.4	+	8	1300_1302	c.1104_1106delCTC	c.(1102-1107)atctcc>atc	p.S370del	RP11-285F7.2_ENST00000424332.1_RNA|EPHX1_ENST00000272167.5_In_Frame_Del_p.S370del	NM_000120.3	NP_000111.1	P07099	HYEP_HUMAN	epoxide hydrolase 1, microsomal (xenobiotic)	370					aromatic compound catabolic process (GO:0019439)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	cis-stilbene-oxide hydrolase activity (GO:0033961)|epoxide hydrolase activity (GO:0004301)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(7)|ovary(3)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	28	Breast(184;0.197)					GCACCATCATCTCCTCCCAGCGC	0.596																																					p.368_369del		.											.	EPHX1-281	0			c.1104_1106del						.																																			SO:0001651	inframe_deletion	2052	exon8			CATCATCTCCTCC	J03518	CCDS1547.1	1q42.1	2009-07-10			ENSG00000143819	ENSG00000143819	3.3.2.9		3401	protein-coding gene	gene with protein product		132810		EPHX		9925921	Standard	NM_000120		Approved		uc001hpk.3	P07099	OTTHUMG00000037743	ENST00000366837.4:c.1104_1106delCTC	1.37:g.226032265_226032267delCTC	ENSP00000355802:p.Ser370del	Somatic	119	0		WXS	Illumina GAIIx	Phase_I	121	15	NM_001136018	0	0	0	0	0	B2R8N0|Q5VTJ6|Q9NP75|Q9NPE7|Q9NQU6|Q9NQU7|Q9NQU8|Q9NQU9|Q9NQV0|Q9NQV1|Q9NQV2	In_Frame_Del	DEL	ENST00000366837.4	37	CCDS1547.1																																																																																			.		0.596	EPHX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092064.1	NM_000120	
IRF2BP2	359948	hgsc.bcm.edu	37	1	234744413	234744413	+	Silent	SNP	C	C	A	rs4636	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr1:234744413C>A	ENST00000366609.3	-	1	858	c.828G>T	c.(826-828)gcG>gcT	p.A276A	IRF2BP2_ENST00000491430.1_5'Flank|RP4-781K5.2_ENST00000436039.1_RNA|IRF2BP2_ENST00000366610.3_Silent_p.A276A	NM_182972.2	NP_892017.2	Q7Z5L9	I2BP2_HUMAN	interferon regulatory factor 2 binding protein 2	276					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	11	Ovarian(103;0.0303)	all_cancers(173;0.0236)|Prostate(94;0.0115)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)|Epithelial(3;6.2e-05)			CGGCCCCGGCCGCGGTGGACA	0.741													C|||	1306	0.260783	0.1619	0.2896	5008	,	,		9433	0.2083		0.4185	False		,,,				2504	0.2658				p.A276A		.											.	IRF2BP2-90	0			c.G828T						.	C	,	599,3223		57,485,1369	4.0	5.0	4.0		828,828	3.5	0.9	1	dbSNP_52	4	2729,5241		513,1703,1769	no	coding-synonymous,coding-synonymous	IRF2BP2	NM_001077397.1,NM_182972.2	,	570,2188,3138	AA,AC,CC		34.2409,15.6724,28.2225	,	276/572,276/588	234744413	3328,8464	1911	3985	5896	SO:0001819	synonymous_variant	359948	exon1			CCCGGCCGCGGTG	AY278023	CCDS1602.1, CCDS41475.1	1q42.3	2008-02-05			ENSG00000168264	ENSG00000168264			21729	protein-coding gene	gene with protein product		615332				12799427	Standard	NM_182972		Approved	IRF-2BP2	uc001hwg.3	Q7Z5L9	OTTHUMG00000037981	ENST00000366609.3:c.828G>T	1.37:g.234744413C>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	5	NM_182972	0	0	0	0	0	B1AM35|B1AM36|Q6P083|Q7Z5L8|Q8N351|Q8WUH8	Silent	SNP	ENST00000366609.3	37	CCDS1602.1																																																																																			C|0.714;A|0.286		0.741	IRF2BP2-002	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000092705.1	NM_182972	
RYR2	6262	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	237580422	237580422	+	Splice_Site	SNP	G	G	A			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr1:237580422G>A	ENST00000366574.2	+	11	1164	c.847G>A	c.(847-849)Gcg>Acg	p.A283T	RYR2_ENST00000542537.1_Splice_Site_p.A267T|RYR2_ENST00000360064.6_Splice_Site_p.A281T	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	283					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GCTAAGAGTTGCGTAAGTAGA	0.448																																					p.A283T		.											.	RYR2-158	0			c.G847A						.						114.0	112.0	112.0					1																	237580422		2056	4222	6278	SO:0001630	splice_region_variant	6262	exon11			AGAGTTGCGTAAG	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.848+1G>A	1.37:g.237580422G>A		Somatic	133	0		WXS	Illumina GAIIx	Phase_I	178	20	NM_001035	0	0	0	0	0	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	G	17.46	3.395773	0.62177	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.87412	-2.25;-2.25;-2.25	5.98	5.98	0.97165	MIR (2);	0.090634	0.44097	D	0.000498	T	0.75700	0.3885	N	0.08118	0	0.80722	D	1	B	0.14438	0.01	B	0.14023	0.01	T	0.70557	-0.4839	10	0.42905	T	0.14	.	13.6254	0.62161	0.0702:0.0:0.9297:0.0	.	283	Q92736	RYR2_HUMAN	T	283;281;267	ENSP00000355533:A283T;ENSP00000353174:A281T;ENSP00000443798:A267T	ENSP00000353174:A281T	A	+	1	0	RYR2	235647045	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	3.776000	0.55356	2.835000	0.97688	0.650000	0.86243	GCG	.		0.448	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	Missense_Mutation
TET1	80312	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	70406351	70406351	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr10:70406351A>C	ENST00000373644.4	+	4	4074	c.3865A>C	c.(3865-3867)Acg>Ccg	p.T1289P		NM_030625.2	NP_085128.2	Q8NFU7	TET1_HUMAN	tet methylcytosine dioxygenase 1	1289					chromatin modification (GO:0016568)|DNA demethylation (GO:0080111)|inner cell mass cell differentiation (GO:0001826)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of DNA methylation (GO:0044030)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	iron ion binding (GO:0005506)|methylcytosine dioxygenase activity (GO:0070579)|structure-specific DNA binding (GO:0043566)|zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(2)|ovary(5)|prostate(1)|upper_aerodigestive_tract(2)	21						GGTACAGTTAACGGTGAATGC	0.453																																					p.T1289P		.											.	TET1-663	0			c.A3865C						.						113.0	100.0	104.0					10																	70406351		2203	4300	6503	SO:0001583	missense	80312	exon4			CAGTTAACGGTGA	AF430147	CCDS7281.1	10q21	2014-02-18	2011-09-30	2008-03-12	ENSG00000138336	ENSG00000138336			29484	protein-coding gene	gene with protein product	"""leukemia-associated protein with a CXXC domain"", ""ten-eleven translocation-1"""	607790	"""CXXC zinc finger 6"", ""tet oncogene 1"""	CXXC6		12124344, 12646957	Standard	NM_030625		Approved	LCX, KIAA1676, bA119F7.1	uc001jok.4	Q8NFU7	OTTHUMG00000018359	ENST00000373644.4:c.3865A>C	10.37:g.70406351A>C	ENSP00000362748:p.Thr1289Pro	Somatic	152	0		WXS	Illumina GAIIx	Phase_I	165	36	NM_030625	0	0	0	0	0	Q5VUP7|Q7Z6B6|Q8TCR1|Q9C0I7	Missense_Mutation	SNP	ENST00000373644.4	37	CCDS7281.1	.	.	.	.	.	.	.	.	.	.	A	13.40	2.226547	0.39300	.	.	ENSG00000138336	ENST00000373644	T	0.08008	3.14	5.25	-3.27	0.05048	.	2.095880	0.01933	N	0.041344	T	0.10208	0.0250	N	0.24115	0.695	0.09310	N	1	D	0.65815	0.995	P	0.56278	0.795	T	0.32428	-0.9907	10	0.20519	T	0.43	.	5.2025	0.15273	0.3847:0.0:0.3846:0.2308	.	1289	Q8NFU7	TET1_HUMAN	P	1289	ENSP00000362748:T1289P	ENSP00000362748:T1289P	T	+	1	0	TET1	70076357	0.000000	0.05858	0.001000	0.08648	0.833000	0.47200	-0.371000	0.07513	-0.222000	0.09958	0.460000	0.39030	ACG	.		0.453	TET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048354.1	NM_030625	
HKDC1	80201	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	71017117	71017117	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr10:71017117A>G	ENST00000354624.5	+	14	2100	c.1967A>G	c.(1966-1968)gAt>gGt	p.D656G	HKDC1_ENST00000395086.2_Missense_Mutation_p.D656G	NM_025130.3	NP_079406	Q2TB90	HKDC1_HUMAN	hexokinase domain containing 1	656	Hexokinase type-1 2.				carbohydrate phosphorylation (GO:0046835)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)	cytosol (GO:0005829)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|mannokinase activity (GO:0019158)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(11)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34						GTCGTGAATGATACAGTGGGG	0.443																																					p.D656G		.											.	HKDC1-95	0			c.A1967G						.						241.0	205.0	217.0					10																	71017117		2203	4300	6503	SO:0001583	missense	80201	exon14			TGAATGATACAGT		CCDS7288.1	10q22.1	2006-10-24			ENSG00000156510	ENSG00000156510			23302	protein-coding gene	gene with protein product						12477932	Standard	NM_025130		Approved	FLJ37767, FLJ22761	uc001jpf.4	Q2TB90	OTTHUMG00000018371	ENST00000354624.5:c.1967A>G	10.37:g.71017117A>G	ENSP00000346643:p.Asp656Gly	Somatic	139	0		WXS	Illumina GAIIx	Phase_I	202	26	NM_025130	0	0	0	0	0	B5MDN9|Q2TB91|Q5VTC7|Q7Z373|Q8WU37|Q96EH2|Q9H5Y9	Missense_Mutation	SNP	ENST00000354624.5	37	CCDS7288.1	.	.	.	.	.	.	.	.	.	.	.	23.5	4.428035	0.83667	.	.	ENSG00000156510	ENST00000354624;ENST00000395087;ENST00000395086	D;D	0.99711	-6.49;-6.49	5.03	5.03	0.67393	Hexokinase, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.99862	0.9935	H	0.99286	4.5	0.54753	D	0.999984	D	0.89917	1.0	D	0.91635	0.999	D	0.96332	0.9244	10	0.87932	D	0	-25.4651	14.913	0.70773	1.0:0.0:0.0:0.0	.	656	Q2TB90	HKDC1_HUMAN	G	656	ENSP00000346643:D656G;ENSP00000378521:D656G	ENSP00000346643:D656G	D	+	2	0	HKDC1	70687123	1.000000	0.71417	1.000000	0.80357	0.861000	0.49209	9.092000	0.94157	2.109000	0.64355	0.454000	0.30748	GAT	.		0.443	HKDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048389.1	NM_025130	
BTAF1	9044	hgsc.bcm.edu	37	10	93726392	93726392	+	Splice_Site	SNP	A	A	G			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr10:93726392A>G	ENST00000265990.6	+	14	1837		c.e14-1		BTAF1_ENST00000471217.1_Splice_Site	NM_003972.2	NP_003963.1	O14981	BTAF1_HUMAN	BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa						negative regulation of chromatin binding (GO:0035562)|negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(2)|urinary_tract(6)	59		Colorectal(252;0.0846)				CTTCTTTATTAGTATTCAGCA	0.358																																					.		.											.	BTAF1-92	0			c.1530-2A>G						.						136.0	126.0	129.0					10																	93726392		2203	4300	6503	SO:0001630	splice_region_variant	9044	exon14			TTTATTAGTATTC	AJ001017	CCDS7419.1	10q22-q23	2013-05-01	2013-05-01		ENSG00000095564	ENSG00000095564			17307	protein-coding gene	gene with protein product	"""Mot1 homolog (S. cerevisiae)"""	605191	"""BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170 kD (Mot1 homolog, S. cerevisiae)"""			9342322, 9488487	Standard	NM_003972		Approved	TAFII170, TAF172, MOT1, TAF-172, TAF(II)170	uc001khr.3	O14981	OTTHUMG00000018752	ENST00000265990.6:c.1530-1A>G	10.37:g.93726392A>G		Somatic	42	0		WXS	Illumina GAIIx	Phase_I	74	4	NM_003972	0	0	0	0	0	B4E0W6|O43578	Splice_Site	SNP	ENST00000265990.6	37	CCDS7419.1	.	.	.	.	.	.	.	.	.	.	A	23.2	4.388772	0.82902	.	.	ENSG00000095564	ENST00000265990	.	.	.	5.57	5.57	0.84162	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.7261	0.77761	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	BTAF1	93716372	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.182000	0.94881	2.122000	0.65172	0.528000	0.53228	.	.		0.358	BTAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049380.4	NM_003972	Intron
NFKB2	4791	hgsc.bcm.edu	37	10	104159196	104159196	+	Silent	SNP	A	A	G	rs4919633	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr10:104159196A>G	ENST00000369966.3	+	13	1519	c.1269A>G	c.(1267-1269)ccA>ccG	p.P423P	NFKB2_ENST00000189444.6_Silent_p.P423P|NFKB2_ENST00000336486.5_3'UTR|NFKB2_ENST00000428099.1_Silent_p.P423P	NM_001077494.2	NP_001070962.1	Q00653	NFKB2_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)	423					extracellular matrix organization (GO:0030198)|follicular dendritic cell differentiation (GO:0002268)|germinal center formation (GO:0002467)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|spleen development (GO:0048536)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	Bcl3/NF-kappaB2 complex (GO:0033257)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(10)|skin(2)	23		Colorectal(252;0.00957)		Epithelial(162;3.4e-08)|all cancers(201;6.41e-07)	Acetylsalicylic acid(DB00945)|Glucosamine(DB01296)	CCGCGGAGCCAAGCGCCCCCT	0.786			T	IGH@	B-NHL								G|||	4942	0.986821	0.9539	0.9942	5008	,	,		10589	1.0		0.999	False		,,,				2504	1.0				p.P423P		.		Dom	yes		10	10q24	4791	nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)		L	.	NFKB2-522	0			c.A1269G						.	G	,,	2876,76		1401,74,1	3.0	5.0	4.0		1269,1269,1269	-4.9	0.0	10	dbSNP_111	4	6622,2		3310,2,0	no	coding-synonymous,coding-synonymous,coding-synonymous	NFKB2	NM_001077493.1,NM_001077494.1,NM_002502.3	,,	4711,76,1	GG,GA,AA		0.0302,2.5745,0.8145	,,	423/900,423/901,423/900	104159196	9498,78	1476	3312	4788	SO:0001819	synonymous_variant	4791	exon13			GGAGCCAAGCGCC	X61498	CCDS41564.1, CCDS41565.1	10q24	2013-01-10			ENSG00000077150	ENSG00000077150		"""Ankyrin repeat domain containing"""	7795	protein-coding gene	gene with protein product		164012				1876189	Standard	XM_005269860		Approved	LYT-10, p52, p105, NF-kB2	uc001kvb.4	Q00653	OTTHUMG00000018962	ENST00000369966.3:c.1269A>G	10.37:g.104159196A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	19	19	NM_001077494	0	0	0	0	0	A8K9D9|D3DR83|Q04860|Q9BU75|Q9H471|Q9H472	Silent	SNP	ENST00000369966.3	37	CCDS41564.1																																																																																			A|0.009;G|0.991		0.786	NFKB2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050080.2		
SORCS3	22986	hgsc.bcm.edu;bcgsc.ca	37	10	106976865	106976865	+	Frame_Shift_Del	DEL	T	T	-			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr10:106976865delT	ENST00000369701.3	+	19	2946	c.2719delT	c.(2719-2721)ttcfs	p.F907fs	SORCS3_ENST00000369699.4_Frame_Shift_Del_p.F193fs	NM_014978.1	NP_055793.1	Q9UPU3	SORC3_HUMAN	sortilin-related VPS10 domain containing receptor 3	907	PKD. {ECO:0000255|PROSITE- ProRule:PRU00151}.				learning (GO:0007612)|memory (GO:0007613)|neuropeptide signaling pathway (GO:0007218)|regulation of long term synaptic depression (GO:1900452)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal postsynaptic density (GO:0097481)	neuropeptide receptor activity (GO:0008188)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(19)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	131		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		AGCTGTCCTCTTCCTGCATGT	0.517																																					p.F907fs	NSCLC(116;1497 1690 7108 13108 14106)	.											.	SORCS3-99	0			c.2719delT						.						164.0	130.0	142.0					10																	106976865		2203	4300	6503	SO:0001589	frameshift_variant	22986	exon19			GTCCTCTTCCTGC	AB028982	CCDS7558.1	10q23-q25	2006-04-12			ENSG00000156395	ENSG00000156395			16699	protein-coding gene	gene with protein product		606285				11499680	Standard	NM_014978		Approved	KIAA1059, SORCS	uc001kyi.1	Q9UPU3	OTTHUMG00000019011	ENST00000369701.3:c.2719delT	10.37:g.106976865delT	ENSP00000358715:p.Phe907fs	Somatic	138	2		WXS	Illumina GAIIx	Phase_I	254	57	NM_014978	0	0	0	0	0	Q5VXF9|Q9NQJ2	Frame_Shift_Del	DEL	ENST00000369701.3	37	CCDS7558.1																																																																																			.		0.517	SORCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050221.1	NM_014978	
SMC3	9126	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	112341738	112341738	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr10:112341738C>T	ENST00000361804.4	+	9	731	c.605C>T	c.(604-606)aCt>aTt	p.T202I	SMC3_ENST00000462899.1_3'UTR	NM_005445.3	NP_005436.1	Q9UQE7	SMC3_HUMAN	structural maintenance of chromosomes 3	202					DNA repair (GO:0006281)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid cohesion (GO:0007064)|mitotic spindle organization (GO:0007052)|negative regulation of DNA endoreduplication (GO:0032876)|regulation of DNA replication (GO:0006275)|signal transduction (GO:0007165)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	basement membrane (GO:0005604)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cohesin core heterodimer (GO:0008280)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear matrix (GO:0016363)|nuclear meiotic cohesin complex (GO:0034991)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|dynein binding (GO:0045502)|microtubule motor activity (GO:0003777)|protein heterodimerization activity (GO:0046982)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(5)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)		AGATTACATACTCTAGAGGAA	0.368																																					p.T202I		.											.	SMC3-92	0			c.C605T						.						99.0	105.0	103.0					10																	112341738		2203	4300	6503	SO:0001583	missense	9126	exon9			TACATACTCTAGA	AF020043	CCDS31285.1	10q25	2014-09-17	2006-07-06	2006-07-06	ENSG00000108055	ENSG00000108055		"""Structural maintenance of chromosomes proteins"", ""Proteoglycans / Extracellular Matrix : Other"""	2468	protein-coding gene	gene with protein product	"""bamacan proteoglycan"""	606062	"""chondroitin sulfate proteoglycan 6 (bamacan)"""	CSPG6		9506951, 10358101	Standard	NM_005445		Approved	HCAP, BAM, SMC3L1, bamacan	uc001kze.3	Q9UQE7	OTTHUMG00000019042	ENST00000361804.4:c.605C>T	10.37:g.112341738C>T	ENSP00000354720:p.Thr202Ile	Somatic	66	0		WXS	Illumina GAIIx	Phase_I	75	13	NM_005445	0	0	0	0	0	A8K156|O60464|Q5T482	Missense_Mutation	SNP	ENST00000361804.4	37	CCDS31285.1	.	.	.	.	.	.	.	.	.	.	C	28.8	4.953060	0.92660	.	.	ENSG00000108055	ENST00000361804	D	0.90504	-2.68	5.51	5.51	0.81932	RecF/RecN/SMC (1);	0.000000	0.85682	D	0.000000	D	0.95739	0.8614	M	0.83603	2.65	0.80722	D	1	D	0.76494	0.999	D	0.74674	0.984	D	0.95990	0.8985	10	0.87932	D	0	.	19.4047	0.94643	0.0:1.0:0.0:0.0	.	202	Q9UQE7	SMC3_HUMAN	I	202	ENSP00000354720:T202I	ENSP00000354720:T202I	T	+	2	0	SMC3	112331728	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.430000	0.80321	2.581000	0.87130	0.591000	0.81541	ACT	.		0.368	SMC3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050337.1	NM_005445	
PWWP2B	170394	hgsc.bcm.edu	37	10	134219045	134219045	+	Silent	SNP	C	C	T	rs11146364	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr10:134219045C>T	ENST00000305233.5	+	2	1100	c.1041C>T	c.(1039-1041)ccC>ccT	p.P347P	PWWP2B_ENST00000368609.4_Silent_p.P347P	NM_138499.3	NP_612508.3	Q6NUJ5	PWP2B_HUMAN	PWWP domain containing 2B	347										central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(5)|urinary_tract(1)	9		all_cancers(35;6.69e-12)|all_epithelial(44;1.55e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Breast(234;0.106)|Colorectal(31;0.109)|Melanoma(40;0.123)|Glioma(114;0.203)|all_hematologic(284;0.224)		OV - Ovarian serous cystadenocarcinoma(35;7.49e-05)|Epithelial(32;0.00016)|all cancers(32;0.000186)		AGCACGAGCCCGTGTACCGGG	0.721													C|||	820	0.163738	0.2027	0.2104	5008	,	,		13504	0.1429		0.1074	False		,,,				2504	0.1575				p.P347P		.											.	PWWP2B-90	0			c.C1041T						.	C	,	636,3612		51,534,1539	16.0	21.0	20.0		1041,1041	-2.7	0.1	10	dbSNP_120	20	704,7662		24,656,3503	yes	coding-synonymous,coding-synonymous	PWWP2B	NM_001098637.1,NM_138499.3	,	75,1190,5042	TT,TC,CC		8.415,14.9718,10.6231	,	347/500,347/591	134219045	1340,11274	2124	4183	6307	SO:0001819	synonymous_variant	170394	exon2			CGAGCCCGTGTAC	AK128663	CCDS7667.2	10q26.3	2009-06-03	2007-10-22	2007-10-22	ENSG00000171813	ENSG00000171813			25150	protein-coding gene	gene with protein product			"""PWWP domain containing 2"""	PWWP2			Standard	NM_001098637		Approved	bA432J24.1, FLJ46823	uc001lll.4	Q6NUJ5	OTTHUMG00000019286	ENST00000305233.5:c.1041C>T	10.37:g.134219045C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	23	9	NM_001098637	0	0	0	0	0	A6NM90|B5MDQ1|H9KV61|Q5SZI0|Q6ZQX5|Q96F43	Silent	SNP	ENST00000305233.5	37	CCDS7667.2																																																																																			C|0.860;T|0.140		0.721	PWWP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051075.3	NM_138499	
KNDC1	85442	bcgsc.ca	37	10	135010635	135010635	+	Missense_Mutation	SNP	G	G	A	rs41317288	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr10:135010635G>A	ENST00000304613.3	+	11	1829	c.1808G>A	c.(1807-1809)tGc>tAc	p.C603Y	KNDC1_ENST00000368572.2_Missense_Mutation_p.C603Y|KNDC1_ENST00000368571.2_Missense_Mutation_p.C538Y			Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND) containing 1	603	KIND 2. {ECO:0000255|PROSITE- ProRule:PRU00709}.				cerebellar granule cell differentiation (GO:0021707)|positive regulation of protein phosphorylation (GO:0001934)|regulation of dendrite morphogenesis (GO:0048814)|small GTPase mediated signal transduction (GO:0007264)	dendrite (GO:0030425)|guanyl-nucleotide exchange factor complex (GO:0032045)|neuronal cell body (GO:0043025)	protein serine/threonine kinase activity (GO:0004674)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			NS(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(27)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	60		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		GCTTCCATCTGCCAGGTGGGC	0.667													G|||	67	0.0133786	0.0023	0.0159	5008	,	,		15352	0.0		0.0318	False		,,,				2504	0.0215				p.C603Y		.											.	KNDC1-229	0			c.G1808A						.	G	TYR/CYS	18,4388	26.2+/-53.5	0,18,2185	57.0	43.0	48.0		1808	3.9	0.2	10	dbSNP_127	48	281,8319	103.3+/-164.5	6,269,4025	yes	missense	KNDC1	NM_152643.6	194	6,287,6210	AA,AG,GG		3.2674,0.4085,2.2989	probably-damaging	603/1750	135010635	299,12707	2203	4300	6503	SO:0001583	missense	85442	exon11			CCATCTGCCAGGT	AK074179	CCDS7674.1	10q26.3	2004-09-14	2004-04-07		ENSG00000171798	ENSG00000171798			29374	protein-coding gene	gene with protein product			"""RasGEF domain family, member 2"""	RASGEF2, C10orf23		11214970	Standard	NM_152643		Approved	KIAA1768, bB439H18.3, FLJ25027	uc001llz.1	Q76NI1	OTTHUMG00000019303	ENST00000304613.3:c.1808G>A	10.37:g.135010635G>A	ENSP00000304437:p.Cys603Tyr	Somatic	162	1		WXS	Illumina GAIIx	Phase_I	332	10	NM_152643	0	0	0	0	0	B0QZC5|Q5T233|Q6ZNH8|Q8TEE5|Q96LV7|Q9C095	Missense_Mutation	SNP	ENST00000304613.3	37	CCDS7674.1	34	0.015567765567765568	2	0.0040650406504065045	8	0.022099447513812154	0	0.0	24	0.0316622691292876	G	8.784	0.929011	0.18131	0.004085	0.032674	ENSG00000171798	ENST00000304613;ENST00000368572;ENST00000368571	T;T;T	0.11604	2.76;2.76;2.76	3.89	3.89	0.44902	KIND (2);	0.532349	0.17961	N	0.156188	T	0.06962	0.0177	L	0.41236	1.265	0.19575	N	0.999961	D;D;D	0.89917	1.0;0.997;0.995	D;D;D	0.76071	0.987;0.98;0.986	T	0.07578	-1.0765	10	0.13108	T	0.6	-20.9533	12.0894	0.53717	0.0:0.0:1.0:0.0	rs41317288	603;538;603	Q76NI1-4;Q76NI1-2;Q76NI1	.;.;VKIND_HUMAN	Y	603;603;538	ENSP00000304437:C603Y;ENSP00000357561:C603Y;ENSP00000357560:C538Y	ENSP00000304437:C603Y	C	+	2	0	KNDC1	134860625	0.012000	0.17670	0.182000	0.23118	0.011000	0.07611	0.954000	0.29175	2.135000	0.66039	0.467000	0.42956	TGC	G|0.981;A|0.019		0.667	KNDC1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000277044.3	NM_152643	
KNDC1	85442	hgsc.bcm.edu	37	10	135012429	135012429	+	Missense_Mutation	SNP	T	T	A	rs386749477|rs3008390	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr10:135012429T>A	ENST00000304613.3	+	14	2438	c.2417T>A	c.(2416-2418)gTt>gAt	p.V806D	KNDC1_ENST00000368572.2_Missense_Mutation_p.V806D|KNDC1_ENST00000368571.2_Missense_Mutation_p.V741D			Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND) containing 1	806	Pro-rich.			V -> D (in Ref. 1; BAD12625). {ECO:0000305}.	cerebellar granule cell differentiation (GO:0021707)|positive regulation of protein phosphorylation (GO:0001934)|regulation of dendrite morphogenesis (GO:0048814)|small GTPase mediated signal transduction (GO:0007264)	dendrite (GO:0030425)|guanyl-nucleotide exchange factor complex (GO:0032045)|neuronal cell body (GO:0043025)	protein serine/threonine kinase activity (GO:0004674)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			NS(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(27)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	60		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		CCACCTGGAGTTGCTTCCGGG	0.746													T|||	2004	0.40016	0.1604	0.3919	5008	,	,		10760	0.5476		0.4195	False		,,,				2504	0.5583				p.V806D		.											.	KNDC1-229	0			c.T2417A						.		ASP/VAL	526,2634		71,384,1125	4.0	5.0	4.0		2417	-1.3	0.0	10	dbSNP_101	4	2723,4467		626,1471,1498	yes	missense	KNDC1	NM_152643.6	152	697,1855,2623	AA,AT,TT		37.872,16.6456,31.3913	benign	806/1750	135012429	3249,7101	1580	3595	5175	SO:0001583	missense	85442	exon14			CTGGAGTTGCTTC	AK074179	CCDS7674.1	10q26.3	2004-09-14	2004-04-07		ENSG00000171798	ENSG00000171798			29374	protein-coding gene	gene with protein product			"""RasGEF domain family, member 2"""	RASGEF2, C10orf23		11214970	Standard	NM_152643		Approved	KIAA1768, bB439H18.3, FLJ25027	uc001llz.1	Q76NI1	OTTHUMG00000019303	ENST00000304613.3:c.2417T>A	10.37:g.135012429T>A	ENSP00000304437:p.Val806Asp	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	19	12	NM_152643	0	0	0	0	0	B0QZC5|Q5T233|Q6ZNH8|Q8TEE5|Q96LV7|Q9C095	Missense_Mutation	SNP	ENST00000304613.3	37	CCDS7674.1	884	0.40476190476190477	86	0.17479674796747968	139	0.3839779005524862	333	0.5821678321678322	326	0.43007915567282323	T	4.682	0.126733	0.08931	0.166456	0.37872	ENSG00000171798	ENST00000304613;ENST00000368572;ENST00000368571	T;T;T	0.18174	2.82;2.82;2.23	3.43	-1.31	0.09230	.	1.661170	0.03733	N	0.253684	T	0.00012	0.0000	L	0.36672	1.1	0.80722	P	0.0	P;P;B	0.45827	0.867;0.531;0.244	B;B;B	0.41271	0.352;0.107;0.05	T	0.45614	-0.9249	9	0.12103	T	0.63	.	3.9153	0.09220	0.0:0.3422:0.3942:0.2636	rs3008390;rs61587518	806;741;806	Q76NI1-4;Q76NI1-2;Q76NI1	.;.;VKIND_HUMAN	D	806;806;741	ENSP00000304437:V806D;ENSP00000357561:V806D;ENSP00000357560:V741D	ENSP00000304437:V806D	V	+	2	0	KNDC1	134862419	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	0.817000	0.27281	-0.241000	0.09681	0.255000	0.18592	GTT	T|0.406;A|0.594		0.746	KNDC1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000277044.3	NM_152643	
SYT8	90019	hgsc.bcm.edu	37	11	1858572	1858572	+	Missense_Mutation	SNP	C	C	T	rs2292474	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr11:1858572C>T	ENST00000381968.3	+	9	1245	c.1117C>T	c.(1117-1119)Cgg>Tgg	p.R373W	TNNI2_ENST00000252898.7_5'Flank|TNNI2_ENST00000381905.3_5'Flank|TNNI2_ENST00000381906.1_5'Flank|SYT8_ENST00000535046.1_3'UTR|TNNI2_ENST00000381911.1_5'Flank|SYT8_ENST00000341958.3_Missense_Mutation_p.R359W	NM_138567.3	NP_612634	Q8NBV8	SYT8_HUMAN	synaptotagmin VIII	373					acrosome reaction (GO:0007340)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	transporter activity (GO:0005215)			breast(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	6		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		CATTGCCCAGCGGCACCCCCT	0.731													T|||	1928	0.384984	0.1679	0.415	5008	,	,		13483	0.378		0.498	False		,,,				2504	0.5481				p.R373W		.											.	SYT8-91	0			c.C1117T						.	T	TRP/ARG	906,3442		119,668,1387	12.0	14.0	14.0		1117	2.7	1.0	11	dbSNP_100	14	4072,4398		1026,2020,1189	no	missense	SYT8	NM_138567.3	101	1145,2688,2576	TT,TC,CC		48.0756,20.8372,38.836	benign	373/402	1858572	4978,7840	2174	4235	6409	SO:0001583	missense	90019	exon9			GCCCAGCGGCACC	AL137708	CCDS7726.2	11p15.5	2013-01-21			ENSG00000149043	ENSG00000149043		"""Synaptotagmins"""	19264	protein-coding gene	gene with protein product		607719				7791877	Standard	XM_005253216		Approved	DKFZp434K0322	uc001lue.1	Q8NBV8	OTTHUMG00000009026	ENST00000381968.3:c.1117C>T	11.37:g.1858572C>T	ENSP00000371394:p.Arg373Trp	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	24	23	NM_138567	0	0	0	0	0	A6NFJ4|Q9NSV9	Missense_Mutation	SNP	ENST00000381968.3	37	CCDS7726.2	855|855	0.3914835164835165|0.3914835164835165	84|84	0.17073170731707318|0.17073170731707318	163|163	0.45027624309392267|0.45027624309392267	226|226	0.3951048951048951|0.3951048951048951	382|382	0.503957783641161|0.503957783641161	t|t	1.107|1.107	-0.659353|-0.659353	0.03454|0.03454	0.208372|0.208372	0.480756|0.480756	ENSG00000149043|ENSG00000149043	ENST00000381978|ENST00000381968;ENST00000341958	.|T;T	.|0.03951	.|3.77;3.75	3.85|3.85	2.68|2.68	0.31781|0.31781	.|.	.|.	.|.	.|.	.|.	T|T	0.00012|0.00012	0.0000|0.0000	N|N	0.00005|0.00005	-3.275|-3.275	0.09310|0.09310	P|P	1.0|1.0	.|B;B	.|0.02656	.|0.0;0.0	.|B;B	.|0.01281	.|0.0;0.0	T|T	0.41928|0.41928	-0.9481|-0.9481	4|8	.|0.02654	.|T	.|1	.|.	8.5203|8.5203	0.33270|0.33270	0.0:0.1655:0.0:0.8345|0.0:0.1655:0.0:0.8345	rs2292474|rs2292474	.|373;359	.|Q8NBV8;A6NCR4	.|SYT8_HUMAN;.	V|W	371|373;359	.|ENSP00000371394:R373W;ENSP00000343691:R359W	.|ENSP00000343691:R359W	A|R	+|+	2|1	0|2	SYT8|SYT8	1815148|1815148	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.293000|0.293000	0.27360|0.27360	3.304000|3.304000	0.51866|0.51866	0.174000|0.174000	0.19809|0.19809	-0.665000|-0.665000	0.03846|0.03846	GCG|CGG	C|0.602;T|0.398		0.731	SYT8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000025013.4		
PRKCDBP	112464	hgsc.bcm.edu	37	11	6341365	6341365	+	Silent	SNP	C	C	T	rs11544764	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr11:6341365C>T	ENST00000303927.3	-	1	512	c.342G>A	c.(340-342)ggG>ggA	p.G114G	PRKCDBP_ENST00000530979.1_Silent_p.G114G	NM_145040.2	NP_659477.2	Q969G5	PRDBP_HUMAN	protein kinase C, delta binding protein	114					cortical actin cytoskeleton organization (GO:0030866)|negative regulation of fermentation (GO:1901003)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)	caveola (GO:0005901)|protein complex (GO:0043234)				large_intestine(3)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	9		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;4.9e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		CCACCAGCAGCCCGTGGTTGG	0.706													C|||	433	0.0864617	0.0416	0.0951	5008	,	,		13993	0.1438		0.1064	False		,,,				2504	0.0613				p.G114G		.											.	PRKCDBP-115	0			c.G342A						.	C		206,4012		7,192,1910	8.0	8.0	8.0		342	2.4	1.0	11	dbSNP_120	8	902,7436		53,796,3320	no	coding-synonymous	PRKCDBP	NM_145040.2		60,988,5230	TT,TC,CC		10.8179,4.8838,8.8245		114/262	6341365	1108,11448	2109	4169	6278	SO:0001819	synonymous_variant	112464	exon1			CAGCAGCCCGTGG	AF339881	CCDS7762.1	11p15.4	2011-04-20			ENSG00000170955	ENSG00000170955			9400	protein-coding gene	gene with protein product	"""sdr-related gene product that binds to c-kinase"""					9054438	Standard	NM_145040		Approved	SRBC, HSRBC, MGC20400, cavin-3, CAVIN3	uc001mcu.1	Q969G5	OTTHUMG00000133378	ENST00000303927.3:c.342G>A	11.37:g.6341365C>T		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_145040	0	0	0	0	0		Silent	SNP	ENST00000303927.3	37	CCDS7762.1																																																																																			C|0.902;T|0.098		0.706	PRKCDBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257228.2	NM_145040	
OR10A4	283297	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	6898684	6898684	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr11:6898684C>G	ENST00000379829.2	+	1	829	c.806C>G	c.(805-807)tCt>tGt	p.S269C		NM_207186.2	NP_997069.2	Q9H209	O10A4_HUMAN	olfactory receptor, family 10, subfamily A, member 4	269					axon guidance (GO:0007411)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S269Y(1)		kidney(1)|large_intestine(2)|liver(2)|lung(20)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	31		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.78e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		AGTGCCTCTTCTGAGAGCAAG	0.512																																					p.S269C		.											.	OR10A4-69	1	Substitution - Missense(1)	lung(1)	c.C806G						.						152.0	133.0	140.0					11																	6898684		2201	4296	6497	SO:0001583	missense	283297	exon1			CCTCTTCTGAGAG	AF209506	CCDS7774.1	11p15.4	2012-08-09	2002-11-13	2004-03-10	ENSG00000170782	ENSG00000170782		"""GPCR / Class A : Olfactory receptors"""	15130	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily A, member 4 pseudogene"""	OR10A4P			Standard	NM_207186		Approved		uc010rat.2	Q9H209	OTTHUMG00000165740	ENST00000379829.2:c.806C>G	11.37:g.6898684C>G	ENSP00000369157:p.Ser269Cys	Somatic	68	1		WXS	Illumina GAIIx	Phase_I	89	19	NM_207186	0	0	0	0	0	B2RNP5|B9EH36|Q96R20	Missense_Mutation	SNP	ENST00000379829.2	37	CCDS7774.1	.	.	.	.	.	.	.	.	.	.	c	11.90	1.776025	0.31411	.	.	ENSG00000170782	ENST00000379829	T	0.00174	8.62	4.22	2.33	0.28932	GPCR, rhodopsin-like superfamily (1);	0.000000	0.44483	D	0.000441	T	0.00356	0.0011	M	0.72118	2.19	0.19775	N	0.999958	P	0.39376	0.67	P	0.54544	0.755	T	0.26883	-1.0090	10	0.72032	D	0.01	.	4.59	0.12302	0.0:0.6213:0.1826:0.196	.	269	Q9H209	O10A4_HUMAN	C	269	ENSP00000369157:S269C	ENSP00000369157:S269C	S	+	2	0	OR10A4	6855260	0.000000	0.05858	0.998000	0.56505	0.558000	0.35554	0.093000	0.15086	0.715000	0.32103	0.651000	0.88453	TCT	.		0.512	OR10A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385985.1	NM_207186	
MRGPRX4	117196	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	18195200	18195200	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr11:18195200C>T	ENST00000314254.3	+	1	817	c.397C>T	c.(397-399)Cgc>Tgc	p.R133C	RP11-113D6.6_ENST00000527671.1_Intron	NM_054032.3	NP_473373.2	Q96LA9	MRGX4_HUMAN	MAS-related GPR, member X4	133						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(18)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32						GTACCGCTGCCGCCGCCCCAC	0.582																																					p.R133C		.											.	MRGPRX4-91	0			c.C397T						.						150.0	145.0	147.0					11																	18195200		2199	4293	6492	SO:0001583	missense	117196	exon1			CGCTGCCGCCGCC	AY042216	CCDS7831.1	11p15.1	2013-10-10			ENSG00000179817	ENSG00000179817		"""GPCR / Class A : Orphans"""	17617	protein-coding gene	gene with protein product		607230				11551509	Standard	NM_054032		Approved	MRGX4	uc001mnv.1	Q96LA9	OTTHUMG00000166442	ENST00000314254.3:c.397C>T	11.37:g.18195200C>T	ENSP00000314042:p.Arg133Cys	Somatic	106	0		WXS	Illumina GAIIx	Phase_I	146	28	NM_054032	0	0	0	0	0	Q3KNU3|Q3KNU4|Q502W0|Q8TDD6|Q8TDD7	Missense_Mutation	SNP	ENST00000314254.3	37	CCDS7831.1	.	.	.	.	.	.	.	.	.	.	C	11.03	1.519642	0.27211	.	.	ENSG00000179817	ENST00000314254	T	0.08370	3.1	2.86	1.91	0.25777	GPCR, rhodopsin-like superfamily (1);	0.860927	0.10112	N	0.714573	T	0.08670	0.0215	M	0.64404	1.975	0.09310	N	1	B	0.34181	0.44	B	0.27715	0.082	T	0.31752	-0.9932	10	0.72032	D	0.01	.	4.1956	0.10441	0.0:0.6143:0.2451:0.1406	.	133	Q96LA9	MRGX4_HUMAN	C	133	ENSP00000314042:R133C	ENSP00000314042:R133C	R	+	1	0	MRGPRX4	18151776	0.000000	0.05858	0.688000	0.30117	0.168000	0.22595	0.142000	0.16096	0.525000	0.28522	0.436000	0.28706	CGC	.		0.582	MRGPRX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389788.1	NM_054032	
GAL3ST3	89792	hgsc.bcm.edu	37	11	65810209	65810209	+	Silent	SNP	C	C	T	rs61895584	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr11:65810209C>T	ENST00000312006.4	-	3	1346	c.1065G>A	c.(1063-1065)ccG>ccA	p.P355P	GAL3ST3_ENST00000527878.1_Silent_p.P355P	NM_033036.2	NP_149025.1	Q96A11	G3ST3_HUMAN	galactose-3-O-sulfotransferase 3	355					monosaccharide metabolic process (GO:0005996)|oligosaccharide metabolic process (GO:0009311)|poly-N-acetyllactosamine metabolic process (GO:0030309)|proteoglycan biosynthetic process (GO:0030166)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|carbohydrate binding (GO:0030246)|galactose 3-O-sulfotransferase activity (GO:0050694)|galactosylceramide sulfotransferase activity (GO:0001733)|proteoglycan sulfotransferase activity (GO:0050698)			kidney(1)|lung(9)|ovary(2)|skin(2)	14						TGGGCTGCCACGGCTGCAGCT	0.741													C|||	3763	0.751398	0.5408	0.8746	5008	,	,		7225	0.7649		0.8549	False		,,,				2504	0.8282				p.P355P		.											.	GAL3ST3-91	0			c.G1065A						.	C		1752,666		619,514,76	3.0	2.0	2.0		1065	-9.2	0.7	11	dbSNP_129	2	4565,363		2119,327,18	no	coding-synonymous	GAL3ST3	NM_033036.2		2738,841,94	TT,TC,CC		7.3661,27.5434,14.0076		355/432	65810209	6317,1029	1209	2464	3673	SO:0001819	synonymous_variant	89792	exon3			CTGCCACGGCTGC	AY026481	CCDS8128.1	11q13.1	2014-08-12			ENSG00000175229	ENSG00000175229		"""Sulfotransferases, membrane-bound"""	24144	protein-coding gene	gene with protein product		608234				11323440, 11356829	Standard	NM_033036		Approved	GAL3ST2	uc001ogw.3	Q96A11	OTTHUMG00000166667	ENST00000312006.4:c.1065G>A	11.37:g.65810209C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	5	NM_033036	0	0	0	0	0	Q14D05	Silent	SNP	ENST00000312006.4	37	CCDS8128.1																																																																																			C|0.233;T|0.767		0.741	GAL3ST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391052.1	NM_033036	
PPP1CA	5499	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	67166486	67166487	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	AG	AG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr11:67166486_67166487delAG	ENST00000376745.4	-	5	819_820	c.671_672delCT	c.(670-672)tctfs	p.S224fs	PPP1CA_ENST00000358239.4_Frame_Shift_Del_p.S180fs|PPP1CA_ENST00000312989.7_Frame_Shift_Del_p.S235fs|PPP1CA_ENST00000532446.1_5'UTR	NM_001008709.1|NM_002708.3	NP_001008709.1|NP_002699.1	P62136	PP1A_HUMAN	protein phosphatase 1, catalytic subunit, alpha isozyme	224					branching morphogenesis of an epithelial tube (GO:0048754)|cell cycle (GO:0007049)|cell division (GO:0051301)|circadian regulation of gene expression (GO:0032922)|entrainment of circadian clock by photoperiod (GO:0043153)|glycogen metabolic process (GO:0005977)|lung development (GO:0030324)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|protein dephosphorylation (GO:0006470)|regulation of circadian rhythm (GO:0042752)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of glycogen catabolic process (GO:0005981)|small molecule metabolic process (GO:0044281)|transforming growth factor beta receptor signaling pathway (GO:0007179)|triglyceride catabolic process (GO:0019433)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|MLL5-L complex (GO:0070688)|nucleus (GO:0005634)|perikaryon (GO:0043204)|protein phosphatase type 1 complex (GO:0000164)|PTW/PP1 phosphatase complex (GO:0072357)	metal ion binding (GO:0046872)|phosphatase activity (GO:0016791)|protein serine/threonine phosphatase activity (GO:0004722)|ribonucleoprotein complex binding (GO:0043021)			breast(1)|lung(2)|pancreas(1)|urinary_tract(3)	7			BRCA - Breast invasive adenocarcinoma(15;8.53e-07)			CAAAGGTAAAAGAGACGCCACG	0.644																																					p.235_235del		.											.	PPP1CA-659	0			c.704_705del						.																																			SO:0001589	frameshift_variant	5499	exon5			GGTAAAAGAGACG		CCDS8160.1, CCDS8161.1, CCDS31618.1	11q13	2013-01-18	2010-03-05			ENSG00000172531	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9281	protein-coding gene	gene with protein product		176875	"""protein phosphatase 1, catalytic subunit, alpha isoform"""	PPP1A			Standard	NM_002708		Approved	PP1A, PP-1A, PP1alpha	uc001oku.1	P62136		ENST00000376745.4:c.671_672delCT	11.37:g.67166488_67166489delAG	ENSP00000365936:p.Ser224fs	Somatic	98	0		WXS	Illumina GAIIx	Phase_I	108	25	NM_001008709	0	0	0	0	0	A6NNR3|B2R908|P08129|P20653|P22802|Q07161	Frame_Shift_Del	DEL	ENST00000376745.4	37	CCDS8160.1																																																																																			.		0.644	PPP1CA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395487.1	NM_002708	
CCDC81	60494	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	86086270	86086270	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr11:86086270C>T	ENST00000445632.2	+	1	337	c.65C>T	c.(64-66)tCg>tTg	p.S22L	CCDC81_ENST00000278487.3_5'UTR|CCDC81_ENST00000354755.1_Missense_Mutation_p.S22L	NM_001156474.1	NP_001149946.1	Q6ZN84	CCD81_HUMAN	coiled-coil domain containing 81	22										kidney(3)|large_intestine(8)|lung(6)|skin(2)|upper_aerodigestive_tract(1)	20		Acute lymphoblastic leukemia(157;5.51e-06)|all_hematologic(158;0.00535)				ACTCTGCCCTCGCTGAGCCAG	0.607																																					p.S22L		.											.	CCDC81-91	0			c.C65T						.						100.0	103.0	102.0					11																	86086270		2202	4299	6501	SO:0001583	missense	60494	exon1			TGCCCTCGCTGAG	AK131331	CCDS8276.1, CCDS53691.1	11q14.2	2006-03-09			ENSG00000149201	ENSG00000149201			26281	protein-coding gene	gene with protein product							Standard	NM_001156474		Approved	FLJ16339, FLJ23514	uc001pbx.2	Q6ZN84	OTTHUMG00000167213	ENST00000445632.2:c.65C>T	11.37:g.86086270C>T	ENSP00000415528:p.Ser22Leu	Somatic	32	0		WXS	Illumina GAIIx	Phase_I	37	11	NM_021827	0	0	0	0	0	A0AVL7|Q53FW3|Q9H5E5	Missense_Mutation	SNP	ENST00000445632.2	37	CCDS53691.1	.	.	.	.	.	.	.	.	.	.	C	16.39	3.108483	0.56291	.	.	ENSG00000149201	ENST00000354755;ENST00000531271;ENST00000445632	T;T	0.45276	0.93;0.9	3.81	-0.673	0.11373	.	1.801380	0.02896	N	0.134776	T	0.35038	0.0918	L	0.40543	1.245	0.20196	N	0.999926	B;B	0.33940	0.067;0.433	B;B	0.37692	0.01;0.256	T	0.15838	-1.0423	9	.	.	.	0.4977	3.5681	0.07907	0.0:0.4297:0.1931:0.3772	.	22;22	Q6ZN84;Q6ZN84-2	CCD81_HUMAN;.	L	22	ENSP00000346800:S22L;ENSP00000415528:S22L	.	S	+	2	0	CCDC81	85763918	0.572000	0.26668	0.205000	0.23548	0.935000	0.57460	0.965000	0.29319	-0.103000	0.12175	0.655000	0.94253	TCG	.		0.607	CCDC81-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393756.1	NM_021827	
ATM	472	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	108123627	108123627	+	Frame_Shift_Del	DEL	G	G	-			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr11:108123627delG	ENST00000452508.2	+	13	2075	c.1886delG	c.(1885-1887)agcfs	p.S629fs	ATM_ENST00000278616.4_Frame_Shift_Del_p.S629fs			Q13315	ATM_HUMAN	ATM serine/threonine kinase	629					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	TTTTTCCAAAGCGTGCCAGAA	0.313			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																											p.S629fs		.	yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	.	ATM-3419	0			c.1886delG						.						90.0	84.0	86.0					11																	108123627		2201	4295	6496	SO:0001589	frameshift_variant	472	exon12	Familial Cancer Database	AT, Louis-Bar syndrome	TCCAAAGCGTGCC	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.1886delG	11.37:g.108123627delG	ENSP00000388058:p.Ser629fs	Somatic	42	0		WXS	Illumina GAIIx	Phase_I	48	17	NM_000051	0	0	0	0	0	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Frame_Shift_Del	DEL	ENST00000452508.2	37	CCDS31669.1																																																																																			.		0.313	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389938.1	NM_000051	
BHLHE41	79365	hgsc.bcm.edu	37	12	26275827	26275827	+	Silent	SNP	C	C	G	rs61754129	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr12:26275827C>G	ENST00000242728.4	-	5	968	c.621G>C	c.(619-621)gcG>gcC	p.A207A	RP11-283G6.3_ENST00000545819.1_RNA|RP11-283G6.3_ENST00000535914.1_RNA	NM_030762.2	NP_110389.1	Q9C0J9	BHE41_HUMAN	basic helix-loop-helix family, member e41	207					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|circadian regulation of gene expression (GO:0032922)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of transcription by competitive promoter binding (GO:0010944)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|organ morphogenesis (GO:0009887)	nucleus (GO:0005634)	bHLH transcription factor binding (GO:0043425)|E-box binding (GO:0070888)|histone deacetylase binding (GO:0042826)|MRF binding (GO:0043426)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|transcription corepressor activity (GO:0003714)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(1)	5						GCTTCTGCCCCGCGCGCTCCA	0.731													C|||	14	0.00279553	0.0	0.0029	5008	,	,		9372	0.0		0.007	False		,,,				2504	0.0051				p.A207A		.											.	BHLHE41-226	0			c.G621C						.	C		3,3713		0,3,1855	4.0	5.0	5.0		621	1.1	0.0	12	dbSNP_129	5	33,7609		0,33,3788	no	coding-synonymous	BHLHE41	NM_030762.2		0,36,5643	GG,GC,CC		0.4318,0.0807,0.317		207/483	26275827	36,11322	1858	3821	5679	SO:0001819	synonymous_variant	79365	exon5			CTGCCCCGCGCGC	AB044088	CCDS8706.1	12p12.1	2011-12-05	2009-01-12	2009-01-12	ENSG00000123095	ENSG00000123095		"""Basic helix-loop-helix proteins"""	16617	protein-coding gene	gene with protein product	"""differentially expressed in chondrocytes 2"", ""Enhancer-of-split and hairy-related protein 1"""	606200	"""basic helix-loop-helix domain containing, class B, 3"""	BHLHB3		11162494, 18557763	Standard	NM_030762		Approved	DEC2, SHARP-1, SHARP1, bHLHe41	uc001rhb.3	Q9C0J9	OTTHUMG00000169174	ENST00000242728.4:c.621G>C	12.37:g.26275827C>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	22	12	NM_030762	0	0	0	0	0	A2I2N8	Silent	SNP	ENST00000242728.4	37	CCDS8706.1																																																																																			.		0.731	BHLHE41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402714.1	NM_030762	
ITPR2	3709	ucsc.edu;bcgsc.ca	37	12	26732987	26732987	+	Silent	SNP	G	G	A	rs2230376	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr12:26732987G>A	ENST00000381340.3	-	33	4898	c.4482C>T	c.(4480-4482)ccC>ccT	p.P1494P		NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	1494					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)		ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	TGTCTGAAAAGGGAGAATTAA	0.363													G|||	935	0.186701	0.0923	0.2248	5008	,	,		16444	0.0744		0.332	False		,,,				2504	0.2536				p.P1494P		.											.	ITPR2-542	0			c.C4482T						.	G		475,3141		30,415,1363	116.0	104.0	108.0		4482	-10.1	0.0	12	dbSNP_98	108	2587,5565		428,1731,1917	no	coding-synonymous	ITPR2	NM_002223.2		458,2146,3280	AA,AG,GG		31.7345,13.1361,26.0197		1494/2702	26732987	3062,8706	1808	4076	5884	SO:0001819	synonymous_variant	3709	exon33			TGAAAAGGGAGAA	D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.4482C>T	12.37:g.26732987G>A		Somatic	20	0		WXS	Illumina GAIIx	Phase_I	25	4	NM_002223	0	0	0	0	0	O94773	Silent	SNP	ENST00000381340.3	37	CCDS41764.1																																																																																			G|0.794;A|0.206		0.363	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402732.1	NM_002223	
KRT78	196374	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	53233007	53233007	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr12:53233007C>T	ENST00000304620.4	-	9	1516	c.1453G>A	c.(1453-1455)Gac>Aac	p.D485N	KRT78_ENST00000359499.4_Missense_Mutation_p.D375N	NM_173352.2	NP_775487.2	Q8N1N4	K2C78_HUMAN	keratin 78	485	Ser-rich.|Tail.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	18						AAAACAGGGTCCTTCCCAGAG	0.572																																					p.D485N		.											.	KRT78-188	0			c.G1453A						.						75.0	69.0	71.0					12																	53233007		2203	4300	6503	SO:0001583	missense	196374	exon9			CAGGGTCCTTCCC	AK096419	CCDS8840.1, CCDS73473.1	12q13.13	2013-06-25			ENSG00000170423	ENSG00000170423		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28926	protein-coding gene	gene with protein product		611159				16831889	Standard	XM_005268695		Approved	K5B	uc001sbc.1	Q8N1N4	OTTHUMG00000169880	ENST00000304620.4:c.1453G>A	12.37:g.53233007C>T	ENSP00000306261:p.Asp485Asn	Somatic	125	0		WXS	Illumina GAIIx	Phase_I	214	38	NM_173352	0	0	0	0	0	A8K4D6|Q5HYM7|Q7RTT2	Missense_Mutation	SNP	ENST00000304620.4	37	CCDS8840.1	.	.	.	.	.	.	.	.	.	.	C	10.15	1.271408	0.23221	.	.	ENSG00000170423	ENST00000359499;ENST00000304620;ENST00000539860	T;T	0.81415	-0.98;-1.49	4.49	1.56	0.23342	.	0.523497	0.14336	N	0.326046	T	0.57740	0.2074	N	0.14661	0.345	0.09310	N	1	B	0.25105	0.118	B	0.17433	0.018	T	0.38394	-0.9663	10	0.17832	T	0.49	.	3.487	0.07624	0.2:0.5817:0.0:0.2183	.	485	Q8N1N4	K2C78_HUMAN	N	375;485;256	ENSP00000352479:D375N;ENSP00000306261:D485N	ENSP00000306261:D485N	D	-	1	0	KRT78	51519274	0.000000	0.05858	0.003000	0.11579	0.008000	0.06430	-0.401000	0.07232	0.219000	0.20840	0.563000	0.77884	GAC	.		0.572	KRT78-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406380.1	NM_173352	
AMHR2	269	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	53822782	53822782	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr12:53822782C>T	ENST00000257863.4	+	7	1035	c.955C>T	c.(955-957)Cgc>Tgc	p.R319C	AMHR2_ENST00000550311.1_Missense_Mutation_p.R319C|AMHR2_ENST00000379791.3_Missense_Mutation_p.R319C	NM_001164690.1|NM_020547.2	NP_001158162.1|NP_065434.1	Q16671	AMHR2_HUMAN	anti-Mullerian hormone receptor, type II	319	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		R -> H (in dbSNP:rs144236183). {ECO:0000269|Ref.4}.		Mullerian duct regression (GO:0001880)|negative regulation of anti-Mullerian hormone signaling pathway (GO:1902613)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	integral component of plasma membrane (GO:0005887)	anti-Mullerian hormone receptor activity (GO:1990272)|ATP binding (GO:0005524)|hormone binding (GO:0042562)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta receptor activity, type II (GO:0005026)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(13)|ovary(2)|skin(2)	34					Adenosine triphosphate(DB00171)	CCATGAGGAGCGCTGGCAGAA	0.562																																					p.R319C		.											.	AMHR2-628	0			c.C955T						.						32.0	26.0	28.0					12																	53822782		2041	3876	5917	SO:0001583	missense	269	exon7			GAGGAGCGCTGGC	AF172932	CCDS8858.1, CCDS53798.1, CCDS55829.1	12q13	2013-03-14							465	protein-coding gene	gene with protein product	"""Muellerian inhibiting substance type II receptor"""	600956				7493017	Standard	NM_001164690		Approved	MISR2, MISRII	uc001scx.2	Q16671	OTTHUMG00000170048	ENST00000257863.4:c.955C>T	12.37:g.53822782C>T	ENSP00000257863:p.Arg319Cys	Somatic	48	0		WXS	Illumina GAIIx	Phase_I	51	10	NM_020547	0	0	0	0	0	A0AVE1|B9EGB7|E9PGD2|F8W1D2|Q13762|Q647K2	Missense_Mutation	SNP	ENST00000257863.4	37	CCDS8858.1	.	.	.	.	.	.	.	.	.	.	C	19.89	3.911793	0.72983	.	.	ENSG00000135409	ENST00000257863;ENST00000550311;ENST00000379791	D;D;D	0.93019	-3.15;-3.15;-3.15	4.61	3.71	0.42584	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.38272	N	0.001748	D	0.91891	0.7433	L	0.32530	0.975	0.44515	D	0.997464	D;D	0.76494	0.998;0.999	P;P	0.57846	0.736;0.828	D	0.91061	0.4885	10	0.87932	D	0	.	7.9789	0.30172	0.0:0.8909:0.0:0.1091	.	319;319	F8W1D2;Q16671	.;AMHR2_HUMAN	C	319	ENSP00000257863:R319C;ENSP00000446661:R319C;ENSP00000369117:R319C	ENSP00000257863:R319C	R	+	1	0	AMHR2	52109049	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	0.951000	0.29135	2.570000	0.86706	0.563000	0.77884	CGC	.		0.562	AMHR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407048.1	NM_020547	
LRIG3	121227	broad.mit.edu	37	12	59284579	59284579	+	Splice_Site	SNP	C	C	A			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr12:59284579C>A	ENST00000320743.3	-	4	670		c.e4-1		LRIG3_ENST00000379141.4_Splice_Site	NM_153377.4	NP_700356.2	Q6UXM1	LRIG3_HUMAN	leucine-rich repeats and immunoglobulin-like domains 3						otolith morphogenesis (GO:0032474)	cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)			LRIG3/ROS1(2)	breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(12)|liver(1)|lung(14)|ovary(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48			GBM - Glioblastoma multiforme(1;1.17e-18)			GTTTCCAGCCCTAGAATTAAA	0.368			T	ROS1	NSCLC																																.		.		Dom	yes		12	12q14.1	121227	leucine-rich repeats and immunoglobulin-like domains 3		E	.	LRIG3-229	0			c.384-1G>T						.						56.0	56.0	56.0					12																	59284579		2203	4300	6503	SO:0001630	splice_region_variant	121227	exon5			CCAGCCCTAGAAT	AY505340	CCDS8960.1, CCDS44933.1	12q13.2	2013-01-11				ENSG00000139263		"""Immunoglobulin superfamily / I-set domain containing"""	30991	protein-coding gene	gene with protein product		608870					Standard	NM_153377		Approved	FLJ90440, KIAA3016	uc001sqr.4	Q6UXM1	OTTHUMG00000169940	ENST00000320743.3:c.384-1G>T	12.37:g.59284579C>A		Somatic	19	0		WXS	Illumina GAIIx	Phase_I	31	3	NM_153377	0	0	0	0	0	Q6UXL7|Q8NC72	Splice_Site	SNP	ENST00000320743.3	37	CCDS8960.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.448040	0.84101	.	.	ENSG00000139263	ENST00000379141;ENST00000320743;ENST00000552267	.	.	.	5.87	5.87	0.94306	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.5827	0.99408	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	LRIG3	57570846	1.000000	0.71417	0.994000	0.49952	0.905000	0.53344	7.413000	0.80104	2.941000	0.99782	0.655000	0.94253	.	.		0.368	LRIG3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406623.1	NM_153377	Intron
LRIG3	121227	hgsc.bcm.edu	37	12	59313936	59313936	+	Silent	SNP	T	T	G	rs61754220	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr12:59313936T>G	ENST00000320743.3	-	1	367	c.81A>C	c.(79-81)tcA>tcC	p.S27S	LRIG3_ENST00000379141.4_5'Flank|RP11-150C16.1_ENST00000547590.1_RNA	NM_153377.4	NP_700356.2	Q6UXM1	LRIG3_HUMAN	leucine-rich repeats and immunoglobulin-like domains 3	27					otolith morphogenesis (GO:0032474)	cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)			LRIG3/ROS1(2)	breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(12)|liver(1)|lung(14)|ovary(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48			GBM - Glioblastoma multiforme(1;1.17e-18)			CGCCGCTGTCTGACCGGCCAG	0.761			T	ROS1	NSCLC								G|||	401	0.0800719	0.0401	0.1686	5008	,	,		9411	0.0446		0.0994	False		,,,				2504	0.0879				p.S27S		.		Dom	yes		12	12q14.1	121227	leucine-rich repeats and immunoglobulin-like domains 3		E	.	LRIG3-229	0			c.A81C						.						2.0	3.0	2.0					12																	59313936		1269	2781	4050	SO:0001819	synonymous_variant	121227	exon1			GCTGTCTGACCGG	AY505340	CCDS8960.1, CCDS44933.1	12q13.2	2013-01-11				ENSG00000139263		"""Immunoglobulin superfamily / I-set domain containing"""	30991	protein-coding gene	gene with protein product		608870					Standard	NM_153377		Approved	FLJ90440, KIAA3016	uc001sqr.4	Q6UXM1	OTTHUMG00000169940	ENST00000320743.3:c.81A>C	12.37:g.59313936T>G		Somatic	3	0		WXS	Illumina GAIIx	Phase_I	23	10	NM_153377	0	0	0	0	0	Q6UXL7|Q8NC72	Silent	SNP	ENST00000320743.3	37	CCDS8960.1																																																																																			T|0.908;G|0.092		0.761	LRIG3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406623.1	NM_153377	
ATXN7L3B	552889	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	74932091	74932092	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	AA	AA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr12:74932091_74932092delAA	ENST00000519948.2	+	1	541_542	c.199_200delAA	c.(199-201)aaafs	p.K67fs	RP11-56G10.2_ENST00000550926.1_RNA	NM_001136262.1	NP_001129734.1	Q96GX2	A7L3B_HUMAN	ataxin 7-like 3B	67																	AGTGGAAGACAAAGGAGCGTGC	0.579																																					p.67_67del		.											.	.	0			c.199_200del						.																																			SO:0001589	frameshift_variant	552889	exon1			GAAGACAAAGGAG		CCDS53815.1	12q21	2013-02-15			ENSG00000253719	ENSG00000253719			37931	protein-coding gene	gene with protein product		615579					Standard	NM_001136262		Approved		uc001sxd.4	Q96GX2	OTTHUMG00000163936	ENST00000519948.2:c.199_200delAA	12.37:g.74932091_74932092delAA	ENSP00000430000:p.Lys67fs	Somatic	91	0		WXS	Illumina GAIIx	Phase_I	151	23	NM_001136262	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000519948.2	37	CCDS53815.1																																																																																			.		0.579	ATXN7L3B-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376473.1	NM_001136262	
NAV3	89795	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	78583826	78583826	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr12:78583826C>A	ENST00000397909.2	+	34	6291	c.6118C>A	c.(6118-6120)Caa>Aaa	p.Q2040K	NAV3_ENST00000266692.7_Missense_Mutation_p.Q1841K|NAV3_ENST00000536525.2_Missense_Mutation_p.Q2018K|NAV3_ENST00000552300.1_3'UTR|NAV3_ENST00000228327.6_Missense_Mutation_p.Q2018K			Q8IVL0	NAV3_HUMAN	neuron navigator 3	2040						membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						ACCAATTACCCAAAGGTACTT	0.353										HNSCC(70;0.22)																											p.Q2018K		.											.	NAV3-279	0			c.C6052A						.						106.0	98.0	101.0					12																	78583826		1918	4153	6071	SO:0001583	missense	89795	exon33			ATTACCCAAAGGT	AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.6118C>A	12.37:g.78583826C>A	ENSP00000381007:p.Gln2040Lys	Somatic	66	0		WXS	Illumina GAIIx	Phase_I	99	8	NM_014903	0	0	0	0	0	Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	ENST00000397909.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	34|34	5.329643|5.329643	0.95733|0.95733	.|.	.|.	ENSG00000067798|ENSG00000067798	ENST00000552895|ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692;ENST00000378640;ENST00000550788	.|D;D;D;D;D	.|0.87571	.|-2.27;-2.27;-2.27;-2.27;-2.27	5.03|5.03	5.03|5.03	0.67393|0.67393	.|.	.|0.000000	.|0.38663	.|U	.|0.001611	D|D	0.93523|0.93523	0.7933|0.7933	M|M	0.79123|0.79123	2.44|2.44	0.80722|0.80722	D|D	1|1	.|D;P;D;D	.|0.76494	.|0.999;0.954;0.997;0.989	.|D;D;D;D	.|0.76575	.|0.988;0.932;0.977;0.969	D|D	0.94123|0.94123	0.7381|0.7381	5|10	.|0.72032	.|D	.|0.01	-7.6278|-7.6278	18.7239|18.7239	0.91705|0.91705	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|2018;1841;2040;2018	.|E7EUC6;Q8IVL0-3;Q8IVL0;Q8IVL0-2	.|.;.;NAV3_HUMAN;.	Q|K	912|2018;2040;2018;1841;632;640	.|ENSP00000446132:Q2018K;ENSP00000381007:Q2040K;ENSP00000228327:Q2018K;ENSP00000266692:Q1841K;ENSP00000448303:Q640K	.|ENSP00000228327:Q2018K	P|Q	+|+	2|1	0|0	NAV3|NAV3	77107957|77107957	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.720000|7.720000	0.84759|0.84759	2.498000|2.498000	0.84270|0.84270	0.655000|0.655000	0.94253|0.94253	CCA|CAA	.		0.353	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383	
NEDD1	121441	broad.mit.edu;bcgsc.ca	37	12	97338562	97338562	+	Missense_Mutation	SNP	C	C	T	rs144294186		TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr12:97338562C>T	ENST00000266742.4	+	13	1982	c.1643C>T	c.(1642-1644)tCc>tTc	p.S548F	NEDD1_ENST00000457368.2_Missense_Mutation_p.S459F|NEDD1_ENST00000557644.1_Missense_Mutation_p.S555F|NEDD1_ENST00000411739.2_Missense_Mutation_p.S459F|NEDD1_ENST00000429527.2_Missense_Mutation_p.S548F	NM_152905.3	NP_690869.1	Q8NHV4	NEDD1_HUMAN	neural precursor cell expressed, developmentally down-regulated 1	548					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	apical part of cell (GO:0045177)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytosol (GO:0005829)|pericentriolar material (GO:0000242)|spindle pole (GO:0000922)				breast(2)|endometrium(1)|kidney(2)|large_intestine(9)|lung(8)	22						ATCAATGGATCCTCAACTCCA	0.353																																					p.S555F		.											.	NEDD1-90	0			c.C1664T						.																																			SO:0001583	missense	121441	exon12			ATGGATCCTCAAC		CCDS9063.1, CCDS44955.1, CCDS44956.1	12q23.1	2013-01-10			ENSG00000139350	ENSG00000139350		"""WD repeat domain containing"""	7723	protein-coding gene	gene with protein product		600372					Standard	NM_001135175		Approved	GCP-WD, TUBGCP7	uc001tev.4	Q8NHV4	OTTHUMG00000170604	ENST00000266742.4:c.1643C>T	12.37:g.97338562C>T	ENSP00000266742:p.Ser548Phe	Somatic	131	0		WXS	Illumina GAIIx	Phase_I	206	9	NM_001135175	0	0	0	0	0	B0AZN0|B4E145|G3V3F1|Q8NA30	Missense_Mutation	SNP	ENST00000266742.4	37	CCDS9063.1	.	.	.	.	.	.	.	.	.	.	C	14.69	2.610374	0.46527	.	.	ENSG00000139350	ENST00000266742;ENST00000429527;ENST00000411739;ENST00000557644;ENST00000457368	T;T;T;T;T	0.50548	0.75;0.75;1.54;0.74;1.54	5.57	5.57	0.84162	.	0.264721	0.44097	D	0.000486	T	0.46268	0.1384	L	0.29908	0.895	0.42298	D	0.992164	P;B	0.36315	0.547;0.412	B;B	0.41088	0.347;0.121	T	0.48864	-0.8997	10	0.72032	D	0.01	.	19.9225	0.97093	0.0:1.0:0.0:0.0	.	555;548	G3V3F1;Q8NHV4	.;NEDD1_HUMAN	F	548;548;459;555;459	ENSP00000266742:S548F;ENSP00000404978:S548F;ENSP00000411307:S459F;ENSP00000451211:S555F;ENSP00000407964:S459F	ENSP00000266742:S548F	S	+	2	0	NEDD1	95862693	1.000000	0.71417	0.984000	0.44739	0.524000	0.34500	2.693000	0.47027	2.780000	0.95670	0.655000	0.94253	TCC	C|1.000;T|0.000		0.353	NEDD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409792.1		
FAM109A	144717	hgsc.bcm.edu	37	12	111800827	111800835	+	In_Frame_Del	DEL	GCCACCCCC	GCCACCCCC	-	rs3840795|rs139032867|rs199734407|rs200911236	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	GCCACCCCC	GCCACCCCC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr12:111800827_111800835delGCCACCCCC	ENST00000547838.2	-	2	494_502	c.397_405delGGGGGTGGC	c.(397-405)gggggtggcdel	p.GGG133del	FAM109A_ENST00000361483.3_In_Frame_Del_p.GGG146del|FAM109A_ENST00000548163.1_In_Frame_Del_p.GGG133del|FAM109A_ENST00000392658.5_In_Frame_Del_p.GGG133del|FAM109A_ENST00000450786.2_In_Frame_Del_p.113_116AGVA>A			Q8N4B1	SESQ1_HUMAN	family with sequence similarity 109, member A	133					endosome organization (GO:0007032)|receptor recycling (GO:0001881)|retrograde transport, endosome to Golgi (GO:0042147)	clathrin-coated vesicle (GO:0030136)|early endosome (GO:0005769)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	protein homodimerization activity (GO:0042803)	p.G133M(1)|p.G146_G148delGGG(1)|p.G133_G135delGGG(1)		breast(1)|endometrium(1)|lung(1)|ovary(1)	4						gcagggCCATGCCACCCCCGCCACGTACA	0.732														1710	0.341454	0.233	0.3732	5008	,	,		9526	0.6518		0.2078	False		,,,				2504	0.2832				p.146_148del		.											.	FAM109A-90	3	Deletion - In frame(2)|Substitution - Missense(1)	breast(2)|ovary(1)	c.436_444del						.		,,	674,3090		134,406,1342				http://www.ncbi.nlm.nih.gov/sites/varvu?gene	,,	-4.5	0.0		dbSNP_107	6	1126,6432		186,754,2839	no	coding,coding,coding	FAM109A	NM_144671.4,NM_001177997.1,NM_001177996.1	,,	320,1160,4181	A1A1,A1R,RR		14.8981,17.9065,15.8983	,,	,,		1800,9522				SO:0001651	inframe_deletion	144717	exon4			GGCCATGCCACCC	BC034809	CCDS9152.1, CCDS53833.1	12q24.12	2013-01-10			ENSG00000198324	ENSG00000198324		"""Pleckstrin homology (PH) domain containing"""	26509	protein-coding gene	gene with protein product		614239				12477932	Standard	NM_144671		Approved	FLJ32356	uc009zvu.3	Q8N4B1	OTTHUMG00000169547	ENST00000547838.2:c.397_405delGGGGGTGGC	12.37:g.111800827_111800835delGCCACCCCC	ENSP00000447353:p.Gly133_Gly135del	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	20	10	NM_001177996	0	0	0	0	0	J3KP50|Q6PJL9|Q96MH8	In_Frame_Del	DEL	ENST00000547838.2	37	CCDS9152.1																																																																																			.		0.732	FAM109A-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404768.2	NM_144671	
RNFT2	84900	hgsc.bcm.edu	37	12	117187907	117187907	+	Silent	SNP	T	T	C	rs111256849	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr12:117187907T>C	ENST00000257575.4	+	4	578	c.345T>C	c.(343-345)caT>caC	p.H115H	RNFT2_ENST00000392549.2_Silent_p.H115H|RNFT2_ENST00000407967.3_Silent_p.H115H|RNFT2_ENST00000319176.7_Silent_p.H115H			Q96EX2	RNFT2_HUMAN	ring finger protein, transmembrane 2	115	His-rich.					integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(1)|urinary_tract(1)	6	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.034)		CCCACCACCATTTCCACCATG	0.746													C|||	1284	0.25639	0.4826	0.1326	5008	,	,		12011	0.1786		0.166	False		,,,				2504	0.2117				p.H115H		.											.	.	0			c.T345C						.	C	,	1295,2539		234,827,856	3.0	4.0	4.0		345,345	3.2	1.0	12	dbSNP_132	4	888,6786		67,754,3016	no	coding-synonymous,coding-synonymous	RNFT2	NM_001109903.1,NM_032814.3	,	301,1581,3872	CC,CT,TT		11.5715,33.7767,18.9694	,	115/445,115/421	117187907	2183,9325	1917	3837	5754	SO:0001819	synonymous_variant	84900	exon4			CCACCATTTCCAC	AK027533	CCDS9180.2, CCDS44987.1	12q24.22	2013-01-09	2008-02-26	2008-02-26	ENSG00000135119	ENSG00000135119		"""RING-type (C3HC4) zinc fingers"""	25905	protein-coding gene	gene with protein product			"""transmembrane protein 118"""	TMEM118		12477932	Standard	NM_032814		Approved	FLJ14627	uc009zwn.3	Q96EX2	OTTHUMG00000150882	ENST00000257575.4:c.345T>C	12.37:g.117187907T>C		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	21	9	NM_001109903	0	0	0	0	0	E9PAM7|Q96SU5	Silent	SNP	ENST00000257575.4	37	CCDS44987.1																																																																																			T|0.767;C|0.233		0.746	RNFT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320417.1	NM_032814	
ATP6V0A2	23545	hgsc.bcm.edu;broad.mit.edu	37	12	124232193	124232196	+	Frame_Shift_Del	DEL	TCTT	TCTT	-			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	TCTT	TCTT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr12:124232193_124232196delTCTT	ENST00000330342.3	+	14	1893_1896	c.1645_1648delTCTT	c.(1645-1650)tctttcfs	p.SF549fs		NM_012463.3	NP_036595.2	Q9Y487	VPP2_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit a2	549					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|immune response (GO:0006955)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	hydrogen ion transmembrane transporter activity (GO:0015078)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|liver(1)|lung(10)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	26	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000224)|Epithelial(86;0.000625)|all cancers(50;0.00775)		TTTTCTAAACTCTTTCAAAATGAA	0.338																																					p.549_550del		.											.	ATP6V0A2-92	0			c.1645_1648del						.																																			SO:0001589	frameshift_variant	23545	exon14			CTAAACTCTTTCA	AF112972	CCDS9254.1	12q24.31	2010-04-21	2006-01-20		ENSG00000185344	ENSG00000185344		"""ATPases / V-type"""	18481	protein-coding gene	gene with protein product	"""infantile malignant osteopetrosis"""	611716	"""infantile malignant osteopetrosis"", ""ATPase, H+ transporting, lysosomal V0 subunit a isoform 2"", ""ATPase, H+ transporting, lysosomal V0 subunit A2"""			2247090, 18157129	Standard	NM_012463		Approved	TJ6, a2, TJ6s, TJ6M, ATP6a2, J6B7, ATP6N1D, Vph1, Stv1	uc001ufr.3	Q9Y487	OTTHUMG00000168723	ENST00000330342.3:c.1645_1648delTCTT	12.37:g.124232193_124232196delTCTT	ENSP00000332247:p.Ser549fs	Somatic	86	0		WXS	Illumina GAIIx	Phase_I	100	9	NM_012463	0	0	0	0	0	A8K026|Q6NUM0	Frame_Shift_Del	DEL	ENST00000330342.3	37	CCDS9254.1																																																																																			.		0.338	ATP6V0A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400765.2	NM_012463	
RIMBP2	23504	hgsc.bcm.edu	37	12	130921471	130921471	+	Silent	SNP	T	T	C	rs2292663	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr12:130921471T>C	ENST00000261655.4	-	10	2134	c.1971A>G	c.(1969-1971)ccA>ccG	p.P657P	RIMBP2_ENST00000535703.1_Silent_p.P565P|RIMBP2_ENST00000536002.1_Silent_p.P565P	NM_015347.4	NP_056162.4	O15034	RIMB2_HUMAN	RIMS binding protein 2	657	Pro-rich.				negative regulation of phosphatase activity (GO:0010923)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|synapse (GO:0045202)				NS(2)|breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(33)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	96	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		CCTGTGGCTGTGGCAGGATGC	0.736													C|||	734	0.146565	0.1657	0.1599	5008	,	,		11830	0.256		0.1054	False		,,,				2504	0.0409				p.P657P		.											.	RIMBP2-142	0			c.A1971G						.	C		577,3799		41,495,1652	12.0	18.0	16.0		1971	-0.1	1.0	12	dbSNP_100	16	861,7691		48,765,3463	no	coding-synonymous	RIMBP2	NM_015347.4		89,1260,5115	CC,CT,TT		10.0678,13.1856,11.1231		657/1053	130921471	1438,11490	2188	4276	6464	SO:0001819	synonymous_variant	23504	exon10			TGGCTGTGGCAGG	AB002316	CCDS31925.1	12q24.33	2014-06-13				ENSG00000060709			30339	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 133"""	611602				10748113	Standard	NM_015347		Approved	KIAA0318, RBP2, MGC15831, RIM-BP2, PPP1R133	uc001uil.2	O15034		ENST00000261655.4:c.1971A>G	12.37:g.130921471T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	60	23	NM_015347	0	0	0	0	0	Q96ID2	Silent	SNP	ENST00000261655.4	37	CCDS31925.1																																																																																			T|0.868;C|0.132		0.736	RIMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399520.1	NM_015347	
ZMYM2	7750	broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	20641036	20641036	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr13:20641036A>G	ENST00000382874.2	+	21	3368	c.3178A>G	c.(3178-3180)Agt>Ggt	p.S1060G	ZMYM2_ENST00000494061.2_3'UTR|ZMYM2_ENST00000382871.2_Missense_Mutation_p.S1060G|ZMYM2_ENST00000382869.3_Missense_Mutation_p.S1060G	NM_001190964.1	NP_001177893.1	Q9UBW7	ZMYM2_HUMAN	zinc finger, MYM-type 2	1060					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|PML body (GO:0016605)	ubiquitin conjugating enzyme binding (GO:0031624)|zinc ion binding (GO:0008270)			large_intestine(3)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	10		all_cancers(29;8.65e-21)|all_epithelial(30;1.04e-18)|all_lung(29;6.75e-18)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;0.000148)|Epithelial(112;0.000249)|OV - Ovarian serous cystadenocarcinoma(117;0.00816)|Lung(94;0.0173)|LUSC - Lung squamous cell carcinoma(192;0.0856)		TCATGATGATAGTTCTGACAA	0.353																																					p.S1060G		.											.	ZMYM2-685	0			c.A3178G						.						116.0	107.0	110.0					13																	20641036		1852	4096	5948	SO:0001583	missense	7750	exon21			GATGATAGTTCTG	AF012126	CCDS45016.1	13q11-q12	2013-01-08	2006-07-13	2006-07-13	ENSG00000121741	ENSG00000121741		"""Zinc fingers, MYM type"""	12989	protein-coding gene	gene with protein product		602221	"""zinc finger protein 198"""	ZNF198		9499416, 9425908	Standard	XM_005266517		Approved	RAMP, FIM, MYM	uc001ums.3	Q9UBW7	OTTHUMG00000016507	ENST00000382874.2:c.3178A>G	13.37:g.20641036A>G	ENSP00000372327:p.Ser1060Gly	Somatic	79	1		WXS	Illumina GAIIx	Phase_I	59	17	NM_001190964	0	0	0	0	0	A6NDG0|A6NI02|O43212|O43434|O60898|Q5W0Q4|Q5W0T3|Q63HP0|Q8NE39|Q9H0V5|Q9H538|Q9UEU2	Missense_Mutation	SNP	ENST00000382874.2	37	CCDS45016.1	.	.	.	.	.	.	.	.	.	.	A	12.79	2.042166	0.35989	.	.	ENSG00000121741	ENST00000382869;ENST00000456228;ENST00000382874;ENST00000382871;ENST00000382870	T	0.20200	2.09	5.06	5.06	0.68205	.	0.327366	0.34879	N	0.003617	T	0.08403	0.0209	N	0.08118	0	0.80722	D	1	P	0.47762	0.9	B	0.35413	0.202	T	0.27673	-1.0067	10	0.22109	T	0.4	-17.483	9.3635	0.38210	0.9199:0.0:0.0801:0.0	.	1060	Q9UBW7	ZMYM2_HUMAN	G	1060;1060;1058;1058;438	ENSP00000372322:S1060G	ENSP00000372322:S1060G	S	+	1	0	ZMYM2	19539036	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.255000	0.65462	1.909000	0.55274	0.374000	0.22700	AGT	.		0.353	ZMYM2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044051.2	NM_003453	
MIPEP	4285	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	24304549	24304549	+	Missense_Mutation	SNP	C	C	G	rs537985967		TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr13:24304549C>G	ENST00000382172.3	-	19	2178	c.2080G>C	c.(2080-2082)Gta>Cta	p.V694L		NM_005932.3	NP_005923	Q99797	MIPEP_HUMAN	mitochondrial intermediate peptidase	694					protein processing involved in protein targeting to mitochondrion (GO:0006627)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|liver(1)|lung(12)|prostate(2)|skin(1)	27		all_cancers(29;1.83e-22)|all_epithelial(30;8.75e-19)|all_lung(29;9.17e-18)|Lung SC(185;0.0225)|Breast(139;0.14)		all cancers(112;0.00389)|Epithelial(112;0.0266)|OV - Ovarian serous cystadenocarcinoma(117;0.0717)|Lung(94;0.207)|GBM - Glioblastoma multiforme(144;0.232)		AGGGCACTTACGAAGTCATCA	0.438																																					p.V694L		.											.	MIPEP-90	0			c.G2080C						.						100.0	85.0	90.0					13																	24304549		2203	4300	6503	SO:0001583	missense	4285	exon19			CACTTACGAAGTC		CCDS9303.1	13q12	2011-01-17			ENSG00000027001	ENSG00000027001	3.4.24.59		7104	protein-coding gene	gene with protein product		602241				9073519	Standard	NM_005932		Approved	MIP	uc001uox.4	Q99797	OTTHUMG00000016573	ENST00000382172.3:c.2080G>C	13.37:g.24304549C>G	ENSP00000371607:p.Val694Leu	Somatic	76	0		WXS	Illumina GAIIx	Phase_I	86	14	NM_005932	0	0	0	0	0	Q5JV15|Q5T9Q9|Q96G65	Missense_Mutation	SNP	ENST00000382172.3	37	CCDS9303.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.981896	0.74474	.	.	ENSG00000027001	ENST00000382172	T	0.05025	3.51	5.42	5.42	0.78866	Neurolysin/Thimet oligopeptidase, domain 2 (1);	0.000000	0.85682	D	0.000000	T	0.12987	0.0315	L	0.53729	1.69	0.49299	D	0.999771	B	0.26744	0.158	B	0.43867	0.434	T	0.04796	-1.0926	10	0.02654	T	1	.	17.9931	0.89175	0.0:1.0:0.0:0.0	.	694	Q99797	MIPEP_HUMAN	L	694	ENSP00000371607:V694L	ENSP00000371607:V694L	V	-	1	0	MIPEP	23202549	1.000000	0.71417	0.685000	0.30070	0.804000	0.45430	6.116000	0.71571	2.541000	0.85698	0.655000	0.94253	GTA	.		0.438	MIPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044169.1		
LINC00283	100874057	broad.mit.edu	37	13	103397238	103397238	+	RNA	DEL	C	C	-			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr13:103397238delC	ENST00000430111.1	+	0	1611									long intergenic non-protein coding RNA 283																		TCTGCCTTTTCCCCTTTACCT	0.433																																					p.E1937fs		.											.	.	0			c.5809delG						.						149.0	110.0	122.0					13																	103397238		692	1590	2282			643677	exon4			CCTTTTCCCCTTT			13q33.1	2012-10-12	2011-08-10	2011-08-10	ENSG00000231633	ENSG00000231633		"""Long non-coding RNAs"""	38809	non-coding RNA	RNA, long non-coding			"""non-protein coding RNA 283"""	NCRNA00283			Standard			Approved				OTTHUMG00000017311		13.37:g.103397238delC		Somatic	65	0		WXS	Illumina GAIIx	Phase_I	60	7	NM_001146197	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000430111.1	37																																																																																				.		0.433	LINC00283-001	KNOWN	not_organism_supported|basic	antisense	antisense	OTTHUMT00000045714.1		
FOXG1	2290	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	29237445	29237445	+	Silent	SNP	C	C	T			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr14:29237445C>T	ENST00000313071.4	+	1	1159	c.960C>T	c.(958-960)cgC>cgT	p.R320R	RP11-966I7.1_ENST00000551395.1_RNA|RP11-966I7.1_ENST00000546560.1_RNA|RP11-966I7.1_ENST00000549487.1_RNA|FOXG1_ENST00000382535.3_Silent_p.R320R	NM_005249.4	NP_005240.3	P55316	FOXG1_HUMAN	forkhead box G1	320				RAGSLYWPMSPFLSLHHPR -> APAPSTGPCRPSCPCTTP (in Ref. 1; CAA52240 and 2; CAA55038). {ECO:0000305}.	aging (GO:0007568)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|dorsal/ventral pattern formation (GO:0009953)|inner ear morphogenesis (GO:0042472)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron fate determination (GO:0048664)|positive regulation of cell cycle (GO:0045787)|positive regulation of neuroblast proliferation (GO:0002052)|pyramidal neuron migration (GO:0021852)|regulation of mitotic cell cycle (GO:0007346)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(23)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(2)	43			LUAD - Lung adenocarcinoma(48;0.011)|Lung(238;0.0575)	GBM - Glioblastoma multiforme(265;0.00413)		ACCACCCCCGCGCCAGCAGCA	0.667																																					p.R320R		.											.	FOXG1-660	0			c.C960T						.						78.0	87.0	84.0					14																	29237445		2203	4300	6503	SO:0001819	synonymous_variant	2290	exon1			CCCCCGCGCCAGC		CCDS9636.1	14q11-q13	2007-10-05	2007-05-16	2007-05-16	ENSG00000176165	ENSG00000176165		"""Forkhead boxes"""	3811	protein-coding gene	gene with protein product		164874	"""forkhead box G1B"", ""forkhead box G1C"", ""forkhead box G1A"""	FKHL2, FOXG1B, FKHL4, FKH2, FKHL1, FOXG1C, FKHL3, FOXG1A		7959731, 17260156	Standard	NM_005249		Approved	HFK2, QIN, BF1, HFK1, HFK3, HBF-3	uc001wqe.4	P55316	OTTHUMG00000140187	ENST00000313071.4:c.960C>T	14.37:g.29237445C>T		Somatic	34	0		WXS	Illumina GAIIx	Phase_I	109	7	NM_005249	0	0	0	0	0	A6NFY2|P55315|Q14488|Q86XT7	Silent	SNP	ENST00000313071.4	37	CCDS9636.1																																																																																			.		0.667	FOXG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276559.3		
PAPLN	89932	broad.mit.edu;bcgsc.ca	37	14	73711367	73711367	+	Silent	SNP	C	C	A	rs377339624		TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr14:73711367C>A	ENST00000554301.1	+	2	233	c.70C>A	c.(70-72)Cgg>Agg	p.R24R	RNU6-419P_ENST00000517030.1_RNA|PAPLN_ENST00000427855.1_Silent_p.R24R|PAPLN_ENST00000555445.1_Silent_p.R24R|PAPLN_ENST00000340738.5_Silent_p.R24R|PAPLN_ENST00000381166.3_Silent_p.R24R|RP4-647C14.2_ENST00000554614.1_RNA			O95428	PPN_HUMAN	papilin, proteoglycan-like sulfated glycoprotein	24						basement membrane (GO:0005604)	metalloendopeptidase activity (GO:0004222)|serine-type endopeptidase inhibitor activity (GO:0004867)|zinc ion binding (GO:0008270)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(11)|ovary(3)|pancreas(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(3)	42				BRCA - Breast invasive adenocarcinoma(234;0.00394)|OV - Ovarian serous cystadenocarcinoma(108;0.0468)		CAAGGTGAGGCGGCAGAGTGA	0.647																																					p.R24R		.											.	PAPLN-70	0			c.C70A						.						16.0	14.0	15.0					14																	73711367		2184	4289	6473	SO:0001819	synonymous_variant	89932	exon3			GTGAGGCGGCAGA	BC042057	CCDS32114.1	14q24.2	2013-01-11				ENSG00000100767		"""Immunoglobulin superfamily / I-set domain containing"""	19262	protein-coding gene	gene with protein product						11076767, 19734141	Standard	NM_173462		Approved	MGC50452	uc001xnw.4	O95428		ENST00000554301.1:c.70C>A	14.37:g.73711367C>A		Somatic	118	0		WXS	Illumina GAIIx	Phase_I	120	5	NM_173462	0	0	0	0	0	B4DES8|B4DGE6|Q659F2|Q6UXJ4|Q6ZNM1|Q6ZUJ0|Q7Z681|Q8IVU0	Silent	SNP	ENST00000554301.1	37																																																																																				.		0.647	PAPLN-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000413182.1	NM_173462	
LGMN	5641	bcgsc.ca	37	14	93170993	93170993	+	Silent	SNP	C	C	T	rs9791	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr14:93170993C>T	ENST00000393218.2	-	14	1588	c.1251G>A	c.(1249-1251)ccG>ccA	p.P417P	LGMN_ENST00000555699.1_Intron|LGMN_ENST00000334869.4_Silent_p.P417P|LGMN_ENST00000557434.1_Silent_p.P360P	NM_001008530.2	NP_001008530.1	Q99538	LGMN_HUMAN	legumain	417					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|innate immune response (GO:0045087)|negative regulation of ERBB signaling pathway (GO:1901185)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of neuron apoptotic process (GO:0043524)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|receptor catabolic process (GO:0032801)|renal system process (GO:0003014)|response to acidic pH (GO:0010447)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|toll-like receptor signaling pathway (GO:0002224)|vitamin D metabolic process (GO:0042359)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)	cysteine-type endopeptidase activity (GO:0004197)|peptidase activity (GO:0008233)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(5)|skin(2)	18		all_cancers(154;0.0706)		COAD - Colon adenocarcinoma(157;0.224)		ACCTGTGAAGCGGATACGGCT	0.473													C|||	1412	0.281949	0.2678	0.5519	5008	,	,		20858	0.0754		0.4245	False		,,,				2504	0.1759				p.P417P		.											.	LGMN-91	0			c.G1251A						.	C	,	1264,3142	432.6+/-343.3	185,894,1124	188.0	179.0	182.0		1251,1251	-10.0	0.0	14	dbSNP_52	182	3540,5060	514.7+/-378.4	722,2096,1482	no	coding-synonymous,coding-synonymous	LGMN	NM_001008530.2,NM_005606.6	,	907,2990,2606	TT,TC,CC		41.1628,28.6882,36.9368	,	417/434,417/434	93170993	4804,8202	2203	4300	6503	SO:0001819	synonymous_variant	5641	exon13			GTGAAGCGGATAC	D55696	CCDS9904.1	14q32.12	2011-04-08		2002-01-18	ENSG00000100600	ENSG00000100600			9472	protein-coding gene	gene with protein product		602620	"""protease, cysteine, 1 (legumain)"""	PRSC1		8893817, 9065484	Standard	NM_001008530		Approved	LGMN1	uc001yaw.3	Q99538		ENST00000393218.2:c.1251G>A	14.37:g.93170993C>T		Somatic	168	0		WXS	Illumina GAIIx	Phase_I	216	9	NM_005606	0	0	0	0	0	O00123|Q86TV2|Q86TV3|Q9BTY1	Silent	SNP	ENST00000393218.2	37	CCDS9904.1																																																																																			C|0.681;T|0.319		0.473	LGMN-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412288.1	NM_005606	
AHNAK2	113146	broad.mit.edu	37	14	105412335	105412335	+	Silent	SNP	C	C	T	rs202104959	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr14:105412335C>T	ENST00000333244.5	-	7	9572	c.9453G>A	c.(9451-9453)ccG>ccA	p.P3151P	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3151						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.P3151P(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CCCCGAACGACGGCATCTTGA	0.602																																					p.P3151P		.											.	AHNAK2-47	1	Substitution - coding silent(1)	endometrium(1)	c.G9453A						.						198.0	138.0	157.0					14																	105412335		1921	4005	5926	SO:0001819	synonymous_variant	113146	exon7			GAACGACGGCATC	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.9453G>A	14.37:g.105412335C>T		Somatic	15	0		WXS	Illumina GAIIx	Phase_I	20	6	NM_138420	0	0	0	0	0	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Silent	SNP	ENST00000333244.5	37	CCDS45177.1																																																																																			C|0.963;T|0.037		0.602	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
UBE3A	7337	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	25616489	25616489	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr15:25616489G>A	ENST00000397954.2	-	4	840	c.841C>T	c.(841-843)Cct>Tct	p.P281S	UBE3A_ENST00000566215.1_Missense_Mutation_p.P258S|UBE3A_ENST00000428984.2_Missense_Mutation_p.P258S|UBE3A_ENST00000232165.3_Missense_Mutation_p.P278S|SNHG14_ENST00000554726.1_RNA|UBE3A_ENST00000438097.1_Missense_Mutation_p.P258S			Q05086	UBE3A_HUMAN	ubiquitin protein ligase E3A	281					androgen receptor signaling pathway (GO:0030521)|brain development (GO:0007420)|ovarian follicle development (GO:0001541)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate gland growth (GO:0060736)|protein autoubiquitination (GO:0051865)|protein K48-linked ubiquitination (GO:0070936)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|proteolysis (GO:0006508)|sperm entry (GO:0035037)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	ligase activity (GO:0016874)|transcription coactivator activity (GO:0003713)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(3)|kidney(1)|large_intestine(14)|lung(13)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	38		all_cancers(20;3.47e-21)|Breast(32;0.00123)		all cancers(64;2.78e-08)|Epithelial(43;8.85e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0155)|Lung(196;0.0616)		AGATAATTAGGATCTCGAGAG	0.358																																					p.P281S		.											.	UBE3A-660	0			c.C841T						.						63.0	61.0	62.0					15																	25616489		2203	4300	6503	SO:0001583	missense	7337	exon7			AATTAGGATCTCG	AF002224	CCDS32177.1, CCDS45191.1, CCDS45192.1	15q11.2	2014-09-17	2008-07-31		ENSG00000114062	ENSG00000114062	6.3.2.19		12496	protein-coding gene	gene with protein product	"""Angelman syndrome"""	601623	"""human papilloma virus E6-associated protein"""	EPVE6AP, HPVE6A		8221889	Standard	NM_130838		Approved	AS, ANCR, E6-AP, FLJ26981	uc001zas.3	Q05086		ENST00000397954.2:c.841C>T	15.37:g.25616489G>A	ENSP00000381045:p.Pro281Ser	Somatic	90	0		WXS	Illumina GAIIx	Phase_I	77	7	NM_000462	0	0	0	0	0	A8K8Z9|P78355|Q93066|Q9UEP4|Q9UEP5|Q9UEP6|Q9UEP7|Q9UEP8|Q9UEP9	Missense_Mutation	SNP	ENST00000397954.2	37	CCDS45192.1	.	.	.	.	.	.	.	.	.	.	G	12.52	1.962910	0.34659	.	.	ENSG00000114062	ENST00000232165;ENST00000356465;ENST00000397954;ENST00000438097;ENST00000428984	T;T;T;T	0.18338	2.22;2.22;2.23;2.23	5.84	4.92	0.64577	.	0.046390	0.85682	D	0.000000	T	0.20007	0.0481	L	0.61218	1.895	0.80722	D	1	B;B	0.30068	0.267;0.006	B;B	0.25987	0.065;0.008	T	0.02646	-1.1129	10	0.20519	T	0.43	.	16.9694	0.86295	0.0:0.1276:0.8724:0.0	.	278;281	Q05086-3;Q05086	.;UBE3A_HUMAN	S	278;278;281;258;258	ENSP00000232165:P278S;ENSP00000381045:P281S;ENSP00000411258:P258S;ENSP00000401265:P258S	ENSP00000232165:P278S	P	-	1	0	UBE3A	23167582	1.000000	0.71417	0.999000	0.59377	0.972000	0.66771	7.991000	0.88244	1.458000	0.47871	0.591000	0.81541	CCT	.		0.358	UBE3A-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000434203.1	NM_000462	
AQR	9716	broad.mit.edu	37	15	35176926	35176926	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr15:35176926G>T	ENST00000156471.5	-	26	3052	c.2827C>A	c.(2827-2829)Cgc>Agc	p.R943S		NM_014691.2	NP_055506.1	O60306	AQR_HUMAN	aquarius intron-binding spliceosomal factor	943					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(10)|lung(18)|ovary(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	57		Lung NSC(122;8.7e-10)|all_lung(180;1.47e-08)		all cancers(64;4.34e-18)|GBM - Glioblastoma multiforme(113;4.59e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0283)		TCTTCCCAGCGAGACATTACC	0.338																																					p.R943S		.											.	AQR-135	0			c.C2827A						.						87.0	82.0	83.0					15																	35176926		1833	4084	5917	SO:0001583	missense	9716	exon26			CCCAGCGAGACAT	AB011132	CCDS42013.1	15q13	2013-09-12	2013-09-12			ENSG00000021776			29513	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 164"""	610548	"""aquarius homolog (mouse)"""			9626505, 16949364	Standard	NM_014691		Approved	KIAA0560, fSAP164, IBP160	uc001ziv.3	O60306		ENST00000156471.5:c.2827C>A	15.37:g.35176926G>T	ENSP00000156471:p.Arg943Ser	Somatic	53	0		WXS	Illumina GAIIx	Phase_I	48	3	NM_014691	0	0	0	0	0	A0JP17|A5YKK3|Q2YDX9|Q6IRU8|Q6PIC8	Missense_Mutation	SNP	ENST00000156471.5	37	CCDS42013.1	.	.	.	.	.	.	.	.	.	.	G	31	5.096761	0.94197	.	.	ENSG00000021776	ENST00000156471;ENST00000543879	D	0.94576	-3.46	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	D	0.97692	0.9243	M	0.88031	2.925	0.80722	D	1	D	0.76494	0.999	D	0.79784	0.993	D	0.96771	0.9568	10	0.35671	T	0.21	-16.4595	20.0586	0.97663	0.0:0.0:1.0:0.0	.	943	O60306	AQR_HUMAN	S	943	ENSP00000156471:R943S	ENSP00000156471:R943S	R	-	1	0	AQR	32964218	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.729000	0.98795	2.741000	0.93983	0.650000	0.86243	CGC	.		0.338	AQR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417526.2	NM_014691	
CALML4	91860	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	68491886	68491886	+	Silent	SNP	G	G	A	rs200702934	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr15:68491886G>A	ENST00000467889.1	-	3	481	c.297C>T	c.(295-297)caC>caT	p.H99H	CALML4_ENST00000395465.3_Intron|CALML4_ENST00000448060.2_Intron|CALML4_ENST00000540479.1_Silent_p.H23H|RP11-315D16.2_ENST00000562767.1_Intron	NM_033429.2	NP_219501.2	Q96GE6	CALL4_HUMAN	calmodulin-like 4	99	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.						calcium ion binding (GO:0005509)			large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	4						CACCTATCCCGTGGGTCTGCA	0.642													G|||	2	0.000399361	0.0	0.0014	5008	,	,		18239	0.0		0.001	False		,,,				2504	0.0				p.H99H		.											.	CALML4-90	0			c.C297T						.	G	,	2,3926		0,2,1962	67.0	74.0	72.0		,297	-0.6	0.1	15		72	18,8282		0,18,4132	yes	intron,coding-synonymous	CALML4	NM_001031733.2,NM_033429.2	,	0,20,6094	AA,AG,GG		0.2169,0.0509,0.1636	,	,99/197	68491886	20,12208	1964	4150	6114	SO:0001819	synonymous_variant	91860	exon3			TATCCCGTGGGTC	AF308287	CCDS10226.2, CCDS42052.1, CCDS66808.1	15q22.31	2013-01-10			ENSG00000129007	ENSG00000129007		"""EF-hand domain containing"""	18445	protein-coding gene	gene with protein product							Standard	NM_033429		Approved	MGC4809, NY-BR-20	uc002arb.3	Q96GE6	OTTHUMG00000133287	ENST00000467889.1:c.297C>T	15.37:g.68491886G>A		Somatic	46	0		WXS	Illumina GAIIx	Phase_I	54	5	NM_033429	0	0	0	0	0	B4DL15|F8W6Y4|Q6MZY3|Q6N048|Q9H286	Silent	SNP	ENST00000467889.1	37	CCDS10226.2																																																																																			G|0.998;A|0.002		0.642	CALML4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257067.3	NM_033429	
FBXO22	26263	broad.mit.edu	37	15	76225142	76225142	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr15:76225142C>A	ENST00000308275.3	+	7	1016	c.911C>A	c.(910-912)gCt>gAt	p.A304D	FBXO22_ENST00000540507.1_Missense_Mutation_p.A200D	NM_147188.2	NP_671717.1	Q8NEZ5	FBX22_HUMAN	F-box protein 22	304					cellular protein modification process (GO:0006464)|cellular response to starvation (GO:0009267)|nucleocytoplasmic transport (GO:0006913)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|protein polyubiquitination (GO:0000209)|regulation of skeletal muscle fiber development (GO:0048742)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	21						ACTGCTGAGGCTGCGATGCAG	0.537																																					p.A304D		.											.	FBXO22-658	0			c.C911A						.						133.0	121.0	125.0					15																	76225142		2197	4294	6491	SO:0001583	missense	26263	exon7			CTGAGGCTGCGAT	AF174602	CCDS10287.1, CCDS45310.1	15q23	2008-10-03	2004-06-15		ENSG00000167196	ENSG00000167196		"""F-boxes /  ""other"""""	13593	protein-coding gene	gene with protein product	"""FIST domain containing 1"""	609096	"""F-box only protein 22"""			10531035, 10531037, 17855421	Standard	NM_147188		Approved	FBX22, FISTC1	uc002bbk.3	Q8NEZ5	OTTHUMG00000142841	ENST00000308275.3:c.911C>A	15.37:g.76225142C>A	ENSP00000307833:p.Ala304Asp	Somatic	104	1		WXS	Illumina GAIIx	Phase_I	102	9	NM_147188	0	0	0	0	0	Q0D2P8|Q6PIL5|Q8IXW3|Q9H824|Q9UKC0	Missense_Mutation	SNP	ENST00000308275.3	37	CCDS10287.1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.592872	0.86953	.	.	ENSG00000167196	ENST00000308275;ENST00000540507	.	.	.	5.52	5.52	0.82312	FIST C domain (1);	0.000000	0.85682	D	0.000000	T	0.78635	0.4314	M	0.66939	2.045	0.80722	D	1	D	0.76494	0.999	D	0.75484	0.986	T	0.79401	-0.1819	9	0.66056	D	0.02	-26.0739	18.7902	0.91971	0.0:1.0:0.0:0.0	.	304	Q8NEZ5	FBX22_HUMAN	D	304;200	.	ENSP00000307833:A304D	A	+	2	0	FBXO22	74012197	0.999000	0.42202	0.966000	0.40874	0.542000	0.35054	4.175000	0.58263	2.752000	0.94435	0.655000	0.94253	GCT	.		0.537	FBXO22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286477.2	NM_147188	
PDIA2	64714	hgsc.bcm.edu	37	16	334685	334685	+	Missense_Mutation	SNP	G	G	A	rs200919010		TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr16:334685G>A	ENST00000219406.6	+	3	451	c.433G>A	c.(433-435)Gag>Aag	p.E145K	PDIA2_ENST00000404312.1_Missense_Mutation_p.E145K	NM_006849.2	NP_006840.2	Q13087	PDIA2_HUMAN	protein disulfide isomerase family A, member 2	145	Thioredoxin 1. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell redox homeostasis (GO:0045454)|peptidyl-proline hydroxylation (GO:0019511)|protein folding (GO:0006457)|protein retention in ER lumen (GO:0006621)|regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902175)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)	protein disulfide isomerase activity (GO:0003756)|steroid binding (GO:0005496)			breast(1)|central_nervous_system(4)|kidney(3)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	17		all_cancers(16;6.71e-07)|all_epithelial(16;1.59e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00769)|all_lung(18;0.0186)				GGGCATTGCCGAGTGGCTGCG	0.716																																					p.E145K		.											.	PDIA2-91	0			c.G433A						.	G	LYS/GLU	2,4234		0,2,2116	11.0	17.0	15.0		433	1.6	0.7	16		15	12,8348		0,12,4168	yes	missense	PDIA2	NM_006849.2	56	0,14,6284	AA,AG,GG		0.1435,0.0472,0.1111	benign	145/526	334685	14,12582	2118	4180	6298	SO:0001583	missense	64714	exon3			ATTGCCGAGTGGC	U19948	CCDS42089.1	16p13.3	2009-11-20	2005-06-29	2005-03-03	ENSG00000185615	ENSG00000185615	5.3.4.1	"""Protein disulfide isomerases"""	14180	protein-coding gene	gene with protein product		608012	"""protein disulfide isomerase, pancreatic"", ""protein disulfide isomerase-associated 2"""	PDIP		8561901	Standard	NM_006849		Approved	PDA2, PDI, PDIR	uc002cgo.1	Q13087	OTTHUMG00000064891	ENST00000219406.6:c.433G>A	16.37:g.334685G>A	ENSP00000219406:p.Glu145Lys	Somatic	3	0		WXS	Illumina GAIIx	Phase_I	33	17	NM_006849	0	0	0	0	0	A6ZJ64|B4DI27|Q2WGM4|Q4TT67|Q6B010|Q96KJ6|Q9BW95	Missense_Mutation	SNP	ENST00000219406.6	37	CCDS42089.1	.	.	.	.	.	.	.	.	.	.	g	0.020	-1.441726	0.01098	4.72E-4	0.001435	ENSG00000185615	ENST00000219406;ENST00000455994;ENST00000404312	T;T	0.40476	1.03;1.03	3.85	1.65	0.23941	Thioredoxin domain (1);Thioredoxin-like fold (3);	0.459039	0.21807	N	0.068825	T	0.13372	0.0324	N	0.02665	-0.54	0.09310	N	1	B	0.17852	0.024	B	0.14023	0.01	T	0.26985	-1.0087	10	0.09843	T	0.71	.	5.2149	0.15336	0.2388:0.1884:0.5728:0.0	.	145	Q13087	PDIA2_HUMAN	K	145;114;145	ENSP00000219406:E145K;ENSP00000384410:E145K	ENSP00000219406:E145K	E	+	1	0	PDIA2	274686	0.017000	0.18338	0.681000	0.30009	0.023000	0.10783	0.986000	0.29590	0.783000	0.33636	0.457000	0.33378	GAG	.		0.716	PDIA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139315.3	NM_006849	
PKD1	5310	hgsc.bcm.edu	37	16	2156447	2156447	+	Silent	SNP	G	G	A	rs2003782	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr16:2156447G>A	ENST00000262304.4	-	18	7649	c.7441C>T	c.(7441-7443)Ctg>Ttg	p.L2481L	PKD1_ENST00000561991.1_5'Flank|PKD1_ENST00000423118.1_Silent_p.L2481L	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	2481	REJ. {ECO:0000255|PROSITE- ProRule:PRU00511}.				anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						ACAGCGCCCAGTGGGAAGAGG	0.716													a|||	1082	0.216054	0.5439	0.1715	5008	,	,		15215	0.0		0.159	False		,,,				2504	0.0859				p.L2481L		.											.	PKD1-91	0			c.C7441T						.		,	1033,1813		192,649,582	3.0	4.0	4.0		7441,7441	0.4	0.0	16	dbSNP_92	4	861,5451		64,733,2359	no	coding-synonymous,coding-synonymous	PKD1	NM_000296.3,NM_001009944.2	,	256,1382,2941	AA,AG,GG		13.6407,36.2966,20.6814	,	2481/4303,2481/4304	2156447	1894,7264	1423	3156	4579	SO:0001819	synonymous_variant	5310	exon18			CGCCCAGTGGGAA	L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.7441C>T	16.37:g.2156447G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	31	16	NM_000296	0	0	0	0	0	Q15140|Q15141	Silent	SNP	ENST00000262304.4	37	CCDS32369.1																																																																																			G|0.793;A|0.207		0.716	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341688.1		
LCMT1	51451	broad.mit.edu	37	16	25143773	25143773	+	Missense_Mutation	SNP	C	C	G	rs367707540		TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr16:25143773C>G	ENST00000399069.3	+	3	411	c.256C>G	c.(256-258)Cgg>Ggg	p.R86G	LCMT1_ENST00000380966.4_Missense_Mutation_p.R86G	NM_016309.2	NP_057393.2	Q9UIC8	LCMT1_HUMAN	leucine carboxyl methyltransferase 1	86					C-terminal protein methylation (GO:0006481)|cellular protein modification process (GO:0006464)|negative regulation of protein complex assembly (GO:0031333)|protein methylation (GO:0006479)|regulation of apoptotic process (GO:0042981)|regulation of glucose metabolic process (GO:0010906)|regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090266)	cytosol (GO:0005829)	protein C-terminal carboxyl O-methyltransferase activity (GO:0003880)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)								GBM - Glioblastoma multiforme(48;0.0336)	L-Leucine(DB00149)	GGCATTTCTACGGAAGACAGA	0.483																																					p.R86G	Colon(200;565 2072 24396 47922 50898)	.											.	LCMT1-22	0			c.C256G						.						127.0	120.0	122.0					16																	25143773		1943	4145	6088	SO:0001583	missense	51451	exon3			TTTCTACGGAAGA	AF037601	CCDS45445.1, CCDS45446.1	16p12.1	2014-08-01			ENSG00000205629	ENSG00000205629			17557	protein-coding gene	gene with protein product	"""protein phosphatase methyltransferase 1"""	610286				10810093	Standard	XM_005255354		Approved	CGI-68, PPMT1	uc002dnx.1	Q9UIC8	OTTHUMG00000177182	ENST00000399069.3:c.256C>G	16.37:g.25143773C>G	ENSP00000382021:p.Arg86Gly	Somatic	116	0		WXS	Illumina GAIIx	Phase_I	111	3	NM_016309	0	0	0	0	0	A6NL89|A8K770|Q53FC5|Q96CI5|Q9H6I9|Q9NTG4|Q9Y378	Missense_Mutation	SNP	ENST00000399069.3	37	CCDS45445.1	.	.	.	.	.	.	.	.	.	.	C	13.49	2.252945	0.39797	.	.	ENSG00000205629	ENST00000399069;ENST00000380966;ENST00000380962	T;T	0.21191	2.02;2.02	5.51	3.43	0.39272	.	0.718048	0.12915	N	0.428603	T	0.18800	0.0451	L	0.38175	1.15	0.42153	D	0.991562	B;B	0.28439	0.185;0.212	B;B	0.36335	0.222;0.22	T	0.09037	-1.0693	10	0.49607	T	0.09	-11.2545	5.9182	0.19067	0.3056:0.5972:0.0:0.0971	.	86;86	Q9UIC8-3;Q9UIC8	.;LCMT1_HUMAN	G	86;86;103	ENSP00000382021:R86G;ENSP00000370353:R86G	ENSP00000370349:R103G	R	+	1	2	LCMT1	25051274	0.953000	0.32496	0.998000	0.56505	0.972000	0.66771	2.293000	0.43558	1.332000	0.45431	0.655000	0.94253	CGG	.		0.483	LCMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435747.4	NM_016309	
SEZ6L2	26470	hgsc.bcm.edu	37	16	29908433	29908433	+	Missense_Mutation	SNP	C	C	G	rs11649499	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr16:29908433C>G	ENST00000308713.5	-	3	748	c.221G>C	c.(220-222)cGg>cCg	p.R74P	SEZ6L2_ENST00000537485.1_Missense_Mutation_p.R30P|SEZ6L2_ENST00000346932.5_Missense_Mutation_p.R74P|SEZ6L2_ENST00000350527.3_Intron|SEZ6L2_ENST00000562159.1_5'UTR	NM_001114099.2|NM_201575.3	NP_001107571.1|NP_963869.2	Q6UXD5	SE6L2_HUMAN	seizure related 6 homolog (mouse)-like 2	74	Pro-rich.		R -> P (in dbSNP:rs11649499). {ECO:0000269|PubMed:12975309, ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						CGTGGGGTCCCGATCAGATCC	0.667													G|||	3761	0.750998	0.9932	0.7464	5008	,	,		9668	0.6052		0.827	False		,,,				2504	0.499				p.R74P		.											.	SEZ6L2-92	0			c.G221C						.	G	,PRO/ARG,,PRO/ARG	4084,194		1951,182,6	7.0	10.0	9.0		,221,,221	2.8	1.0	16	dbSNP_120	9	7159,1331		3016,1127,102	yes	intron,missense,intron,missense	SEZ6L2	NM_001114099.2,NM_001114100.2,NM_012410.3,NM_201575.3	,103,,103	4967,1309,108	GG,GC,CC		15.6773,4.5348,11.9439	,benign,,benign	,74/810,,74/911	29908433	11243,1525	2139	4245	6384	SO:0001583	missense	26470	exon3			GGGTCCCGATCAG	AY358404	CCDS10658.1, CCDS10659.1, CCDS45458.1, CCDS58447.1, CCDS73865.1	16p12.1	2008-02-05			ENSG00000174938	ENSG00000174938			30844	protein-coding gene	gene with protein product	"""type I transmembrane receptor (seizure related protein)"""					12975309	Standard	NM_012410		Approved	PSK-1, FLJ90517	uc010vec.2	Q6UXD5	OTTHUMG00000132112	ENST00000308713.5:c.221G>C	16.37:g.29908433C>G	ENSP00000312550:p.Arg74Pro	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_001243332	0	0	0	0	0	B7Z1N0|F5H293|H7BXQ6|Q9BW82|Q9UJ45|Q9UJ46|Q9UJ47	Missense_Mutation	SNP	ENST00000308713.5	37	CCDS10659.1	1718	0.7866300366300366	484	0.983739837398374	282	0.7790055248618785	322	0.5629370629370629	630	0.8311345646437994	G	0.009	-1.806021	0.00606	0.954652	0.843227	ENSG00000174938	ENST00000308713;ENST00000346932;ENST00000537485	T;T;T	0.45276	0.9;0.9;0.9	5.17	2.85	0.33270	.	0.128667	0.35436	N	0.003211	T	0.00012	0.0000	N	0.03608	-0.345	0.50632	P	1.1099999999997223E-4	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.30621	-0.9972	8	.	.	.	.	7.5026	0.27526	0.1787:0.1431:0.6783:0.0	rs11649499;rs60390109;rs11649499	30;74	F5H293;Q6UXD5	.;SE6L2_HUMAN	P	74;74;30	ENSP00000312550:R74P;ENSP00000319215:R74P;ENSP00000439412:R30P	.	R	-	2	0	SEZ6L2	29815934	0.685000	0.27652	1.000000	0.80357	0.050000	0.14768	0.504000	0.22626	0.600000	0.29862	-0.998000	0.02512	CGG	C|0.218;G|0.782		0.667	SEZ6L2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255154.2	NM_012410	
VPS35	55737	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	46714715	46714715	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr16:46714715G>C	ENST00000299138.7	-	5	432	c.374C>G	c.(373-375)tCc>tGc	p.S125C	VPS35_ENST00000568642.1_5'Flank	NM_018206.4	NP_060676.2	Q96QK1	VPS35_HUMAN	vacuolar protein sorting 35 homolog (S. cerevisiae)	125					cell death (GO:0008219)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|retromer complex (GO:0030904)				breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(11)|pancreas(1)|prostate(1)|urinary_tract(1)	23		all_cancers(37;7.65e-05)|all_epithelial(9;0.000154)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)				ATCCTTCCTGGACTGAGGAAA	0.363																																					p.S125C		.											.	VPS35-90	0			c.C374G						.						60.0	59.0	59.0					16																	46714715		2203	4300	6503	SO:0001583	missense	55737	exon5			TTCCTGGACTGAG	AF175265	CCDS10721.1	16q12	2012-06-27	2006-12-19		ENSG00000069329	ENSG00000069329		"""Parkinson disease"""	13487	protein-coding gene	gene with protein product		601501	"""vacuolar protein sorting 35 (yeast homolog)"", ""vacuolar protein sorting 35 (yeast)"""			11112353, 21763482	Standard	NM_018206		Approved	FLJ10752, MEM3, PARK17	uc002eef.4	Q96QK1	OTTHUMG00000132542	ENST00000299138.7:c.374C>G	16.37:g.46714715G>C	ENSP00000299138:p.Ser125Cys	Somatic	215	0		WXS	Illumina GAIIx	Phase_I	226	24	NM_018206	0	0	0	0	0	Q561W2|Q9H016|Q9H096|Q9H4P3|Q9H8J0|Q9NRS7|Q9NVG2|Q9NX80|Q9NZK2	Missense_Mutation	SNP	ENST00000299138.7	37	CCDS10721.1	.	.	.	.	.	.	.	.	.	.	.	19.20	3.781779	0.70222	.	.	ENSG00000069329	ENST00000299138	T	0.45276	0.9	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.41581	0.1165	L	0.45051	1.395	0.80722	D	1	B	0.17465	0.022	B	0.18871	0.023	T	0.22977	-1.0201	10	0.59425	D	0.04	-8.6636	19.7653	0.96337	0.0:0.0:1.0:0.0	.	125	Q96QK1	VPS35_HUMAN	C	125	ENSP00000299138:S125C	ENSP00000299138:S125C	S	-	2	0	VPS35	45272216	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.805000	0.99149	2.730000	0.93505	0.563000	0.77884	TCC	.		0.363	VPS35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255742.3		
IRX3	79191	hgsc.bcm.edu	37	16	54318528	54318528	+	Missense_Mutation	SNP	A	A	G	rs1450355	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr16:54318528A>G	ENST00000329734.3	-	2	1977	c.1265T>C	c.(1264-1266)cTg>cCg	p.L422P		NM_024336.2	NP_077312.2	P78415	IRX3_HUMAN	iroquois homeobox 3	422	Pro-rich.		L -> P (in dbSNP:rs1450355). {ECO:0000269|PubMed:15489334}.		mesoderm development (GO:0007498)|metanephros development (GO:0001656)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of neuron differentiation (GO:0045666)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)|transcription, DNA-templated (GO:0006351)	axon (GO:0030424)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|soft_tissue(1)|urinary_tract(1)	14						GAGCGGGTGCAGGCGGGGGCC	0.776													g|||	4851	0.96865	0.888	0.987	5008	,	,		8017	1.0		1.0	False		,,,				2504	1.0				p.L422P	GBM(143;1830 1866 4487 4646 37383)	.											.	IRX3-90	0			c.T1265C						.	T	PRO/LEU	1678,102		788,102,0	1.0	2.0	2.0		1265	2.5	1.0	16	dbSNP_88	2	4195,3		2096,3,0	no	missense	IRX3	NM_024336.2	98	2884,105,0	GG,GA,AA		0.0715,5.7303,1.7564	benign	422/502	54318528	5873,105	890	2099	2989	SO:0001583	missense	79191	exon2			GGGTGCAGGCGGG	U90308	CCDS10750.1	16q12.2	2011-06-20	2007-07-13		ENSG00000177508	ENSG00000177508		"""Homeoboxes / TALE class"""	14360	protein-coding gene	gene with protein product		612985					Standard	NM_024336		Approved	IRX-1	uc002eht.1	P78415	OTTHUMG00000133200	ENST00000329734.3:c.1265T>C	16.37:g.54318528A>G	ENSP00000331608:p.Leu422Pro	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_024336	0	0	0	0	0	Q7Z4A4|Q7Z4A5|Q8IVC6	Missense_Mutation	SNP	ENST00000329734.3	37	CCDS10750.1	2108	0.9652014652014652	433	0.8800813008130082	354	0.9779005524861878	567	0.9912587412587412	754	0.9947229551451188	g	5.642	0.303067	0.10678	0.942697	0.999285	ENSG00000177508	ENST00000329734	T	0.54279	0.58	4.4	2.45	0.29901	.	0.652897	0.14990	N	0.286760	T	0.00012	0.0000	N	0.01352	-0.895	0.29914	P	0.82336	B	0.02656	0.0	B	0.01281	0.0	T	0.21861	-1.0233	9	0.33940	T	0.23	-4.0049	5.143	0.14969	0.1733:0.0:0.6627:0.164	rs1450355;rs17852160;rs60836119	422	P78415	IRX3_HUMAN	P	422	ENSP00000331608:L422P	ENSP00000331608:L422P	L	-	2	0	IRX3	52876029	1.000000	0.71417	0.984000	0.44739	0.000000	0.00434	1.455000	0.35190	0.155000	0.19261	-1.528000	0.00924	CTG	T|0.035;G|0.004		0.776	IRX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256910.2		
WWP2	11060	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	69874080	69874080	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr16:69874080T>G	ENST00000359154.2	+	5	493	c.392T>G	c.(391-393)gTt>gGt	p.V131G	WWP2_ENST00000448661.1_Missense_Mutation_p.V131G|WWP2_ENST00000542271.1_Missense_Mutation_p.V15G|WWP2_ENST00000569174.1_Missense_Mutation_p.V131G|WWP2_ENST00000356003.2_Missense_Mutation_p.V131G|WWP2_ENST00000544162.1_3'UTR	NM_001270454.1|NM_007014.4	NP_001257383.1|NP_008945.2	O00308	WWP2_HUMAN	WW domain containing E3 ubiquitin protein ligase 2	131					cellular protein modification process (GO:0006464)|negative regulation of gene expression (GO:0010629)|negative regulation of protein transport (GO:0051224)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transporter activity (GO:0032410)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|protein K63-linked ubiquitination (GO:0070534)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|viral entry into host cell (GO:0046718)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)|ubiquitin-protein transferase activity (GO:0004842)			breast(4)|endometrium(2)|kidney(2)|large_intestine(11)|lung(13)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						AAAGGCAGCGTTGTCTCAGGC	0.547																																					p.V131G		.											.	WWP2-658	0			c.T392G						.						124.0	103.0	110.0					16																	69874080		2198	4300	6498	SO:0001583	missense	11060	exon5			GCAGCGTTGTCTC	BC013645	CCDS10885.1, CCDS58475.1, CCDS58476.1, CCDS58477.1	16q22.1	2008-02-05			ENSG00000198373	ENSG00000198373			16804	protein-coding gene	gene with protein product		602308				9169421, 12167593	Standard	NM_007014		Approved	AIP2	uc002exv.2	O00308	OTTHUMG00000137573	ENST00000359154.2:c.392T>G	16.37:g.69874080T>G	ENSP00000352069:p.Val131Gly	Somatic	112	1		WXS	Illumina GAIIx	Phase_I	114	25	NM_001270454	0	0	0	0	0	A6NEP1|B2R706|B4DTL5|F5H213|H3BRF3|I3RSG8|Q6ZTQ5|Q96CZ2|Q9BWN6	Missense_Mutation	SNP	ENST00000359154.2	37	CCDS10885.1	.	.	.	.	.	.	.	.	.	.	T	18.72	3.683319	0.68157	.	.	ENSG00000198373	ENST00000359154;ENST00000448661;ENST00000356003;ENST00000544162;ENST00000542271	T;T;T;T	0.64438	-0.1;-0.1;-0.1;1.17	5.2	4.06	0.47325	C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	T	0.51873	0.1700	L	0.51422	1.61	0.80722	D	1	B	0.26400	0.148	B	0.19391	0.025	T	0.42224	-0.9464	9	.	.	.	.	9.9384	0.41565	0.0:0.0:0.1711:0.8289	.	131	O00308	WWP2_HUMAN	G	131;131;131;18;15	ENSP00000352069:V131G;ENSP00000396871:V131G;ENSP00000348283:V131G;ENSP00000445616:V15G	.	V	+	2	0	WWP2	68431581	1.000000	0.71417	0.997000	0.53966	0.991000	0.79684	5.274000	0.65569	0.773000	0.33404	0.533000	0.62120	GTT	.		0.547	WWP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268954.1	NM_007014	
ELP5	23587	bcgsc.ca	37	17	7155861	7155861	+	Missense_Mutation	SNP	G	G	A	rs2521988	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr17:7155861G>A	ENST00000396628.2	+	1	257	c.40G>A	c.(40-42)Gag>Aag	p.E14K	CTDNEP1_ENST00000572043.1_5'Flank|ELP5_ENST00000573657.1_Missense_Mutation_p.E14K|ELP5_ENST00000574255.1_Missense_Mutation_p.E14K|ELP5_ENST00000356683.2_Missense_Mutation_p.E14K|RP1-4G17.5_ENST00000577138.1_Intron|CTDNEP1_ENST00000574322.1_5'Flank|ELP5_ENST00000354429.2_Missense_Mutation_p.E14K|CTDNEP1_ENST00000318988.6_5'Flank|CTDNEP1_ENST00000573600.1_5'Flank|ELP5_ENST00000574993.1_Missense_Mutation_p.E14K|ELP5_ENST00000396627.2_Missense_Mutation_p.E14K	NM_203414.1	NP_981959.1	Q8TE02	ELP5_HUMAN	elongator acetyltransferase complex subunit 5	14			E -> K (in dbSNP:rs2521988). {ECO:0000269|Ref.2}.		chromatin organization (GO:0006325)|positive regulation of cell migration (GO:0030335)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Elongator holoenzyme complex (GO:0033588)|nucleus (GO:0005634)											GACCGGACGCGAGTTGGAGAT	0.692													G|||	403	0.0804712	0.0068	0.049	5008	,	,		15804	0.0367		0.1421	False		,,,				2504	0.184				p.E14K		.											.	.	0			c.G40A						.	G	LYS/GLU,LYS/GLU,LYS/GLU,LYS/GLU	121,4285	90.2+/-128.9	3,115,2085	58.0	51.0	53.0		40,40,40,40	-6.9	0.0	17	dbSNP_100	53	1183,7417	238.2+/-269.8	77,1029,3194	yes	missense,missense,missense,missense	C17orf81	NM_015362.3,NM_203413.1,NM_203414.1,NM_203415.1	56,56,56,56	80,1144,5279	AA,AG,GG		13.7558,2.7463,10.0261	benign,benign,benign,benign	14/317,14/280,14/317,14/317	7155861	1304,11702	2203	4300	6503	SO:0001583	missense	23587	exon1			GGACGCGAGTTGG	BC002762	CCDS11094.1, CCDS11095.1	17p13.1	2012-08-14	2012-08-08	2012-08-08	ENSG00000170291	ENSG00000170291		"""Elongator acetyltransferase complex subunits"""	30617	protein-coding gene	gene with protein product	"""dermal papilla derived protein 6"", ""S-phase 2 protein"""	615019	"""chromosome 17 open reading frame 81"""	C17orf81		22854966	Standard	NM_203415		Approved	DERP6	uc002gfi.1	Q8TE02	OTTHUMG00000177974	ENST00000396628.2:c.40G>A	17.37:g.7155861G>A	ENSP00000379869:p.Glu14Lys	Somatic	67	0		WXS	Illumina GAIIx	Phase_I	107	5	NM_203414	0	0	0	0	0	A8K1M5|D3DTN9|Q659B6|Q7Z2T4|Q8TDR9|Q9BUB2|Q9Y2Q4	Missense_Mutation	SNP	ENST00000396628.2	37	CCDS11094.1	161	0.07371794871794872	3	0.006097560975609756	17	0.04696132596685083	25	0.043706293706293704	116	0.15303430079155672	G	0.121	-1.125829	0.01770	0.027463	0.137558	ENSG00000170291	ENST00000354429;ENST00000396628;ENST00000396627;ENST00000356683	T;T;T;T	0.47869	1.49;1.49;1.49;0.83	3.48	-6.95	0.01628	.	4.253690	0.00357	N	0.000026	T	0.00144	0.0004	N	0.19112	0.55	0.80722	P	0.0	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.04178	-1.0971	9	0.30854	T	0.27	40.3597	1.568	0.02608	0.3587:0.327:0.1448:0.1695	rs2521988	14;14;14;14	Q8TE02-2;Q8TE02-3;A8K1M5;Q8TE02	.;.;.;DERP6_HUMAN	K	14	ENSP00000346412:E14K;ENSP00000379869:E14K;ENSP00000379868:E14K;ENSP00000349111:E14K	ENSP00000346412:E14K	E	+	1	0	C17orf81	7096585	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.798000	0.00363	-5.095000	0.00022	-1.040000	0.02373	GAG	G|0.906;A|0.094		0.692	ELP5-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000440111.1	NM_015362	
GSDMA	284110	bcgsc.ca	37	17	38121993	38121993	+	Missense_Mutation	SNP	G	G	A	rs3894194	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr17:38121993G>A	ENST00000301659.4	+	2	171	c.53G>A	c.(52-54)cGa>cAa	p.R18Q		NM_178171.4	NP_835465.2	Q96QA5	GSDMA_HUMAN	gasdermin A	18			R -> Q (in dbSNP:rs3894194).		apoptotic process (GO:0006915)	perinuclear region of cytoplasm (GO:0048471)				NS(1)|endometrium(2)|large_intestine(3)|lung(1)	7						CTAAACCCTCGAGGGGACCTG	0.582													G|||	2158	0.430911	0.2587	0.5043	5008	,	,		18378	0.5397		0.4463	False		,,,				2504	0.4836				p.R18Q		.											.	GSDMA-90	0			c.G53A	GRCh37	CM073116	GSDMA	M	rs3894194	.	G	GLN/ARG	1170,2796		170,830,983	54.0	59.0	58.0	http://www.ncbi.nlm.nih.gov/pubmed?term	53	3.3	1.0	17	dbSNP_108	58	3796,4528		879,2038,1245	yes	missense	GSDMA	NM_178171.4	43	1049,2868,2228	AA,AG,GG	http://www.ncbi.nlm.nih.gov/pubmed?term	45.6031,29.5008,40.4068	benign	18/446	38121993	4966,7324	1983	4162	6145	SO:0001583	missense	284110	exon2			ACCCTCGAGGGGA	AB093591	CCDS45669.1	17q21.2	2008-07-31	2008-07-31	2008-07-31		ENSG00000167914			13311	protein-coding gene	gene with protein product		611218	"""gasdermin"", ""gasdermin 1"""	GSDM, GSDM1		12883658, 15010812, 17350798	Standard	NM_178171		Approved	FLJ39120	uc002htl.1	Q96QA5		ENST00000301659.4:c.53G>A	17.37:g.38121993G>A	ENSP00000301659:p.Arg18Gln	Somatic	91	1		WXS	Illumina GAIIx	Phase_I	104	6	NM_178171	0	0	0	0	0	Q32MC5|Q86VE7|Q8N1M6	Missense_Mutation	SNP	ENST00000301659.4	37	CCDS45669.1	930	0.4258241758241758	130	0.26422764227642276	181	0.5	284	0.4965034965034965	335	0.4419525065963061	G	13.55	2.270656	0.40194	0.295008	0.456031	ENSG00000167914	ENST00000301659	T	0.22743	1.94	5.36	3.34	0.38264	.	0.710982	0.12216	N	0.488832	T	0.00012	0.0000	L	0.49455	1.56	0.38224	P	0.05916500000000002	B	0.16166	0.016	B	0.14023	0.01	T	0.43393	-0.9394	9	0.20046	T	0.44	-4.2602	7.6027	0.28085	0.1926:0.0:0.8074:0.0	rs3894194;rs12948522;rs52814263;rs61411446;rs3894194	18	Q96QA5	GSDMA_HUMAN	Q	18	ENSP00000301659:R18Q	ENSP00000301659:R18Q	R	+	2	0	GSDMA	35375519	0.267000	0.24122	1.000000	0.80357	0.934000	0.57294	0.886000	0.28241	1.245000	0.43885	0.462000	0.41574	CGA	G|0.341;T|0.179		0.582	GSDMA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446847.1	NM_178171	
KRT27	342574	bcgsc.ca	37	17	38936017	38936017	+	Silent	SNP	G	G	T			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr17:38936017G>T	ENST00000301656.3	-	4	821	c.781C>A	c.(781-783)Cga>Aga	p.R261R	KRT27_ENST00000540723.1_5'Flank	NM_181537.3	NP_853515.2			keratin 27											NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(3)|skin(1)|stomach(1)	21		Breast(137;0.000812)				TACTCAGCTCGCATATTGTTC	0.607																																					p.R261R		.											.	KRT27-90	0			c.C781A						.						50.0	50.0	50.0					17																	38936017		2203	4300	6503	SO:0001819	synonymous_variant	342574	exon4			CAGCTCGCATATT	AJ564206	CCDS11375.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000171446	ENSG00000171446		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	30841	protein-coding gene	gene with protein product			"""keratin 25C"""	KRT25C		16831889	Standard	NM_181537		Approved		uc002hvg.3	Q7Z3Y8	OTTHUMG00000133371	ENST00000301656.3:c.781C>A	17.37:g.38936017G>T		Somatic	76	0		WXS	Illumina GAIIx	Phase_I	112	5	NM_181537	0	0	0	0	0		Silent	SNP	ENST00000301656.3	37	CCDS11375.1																																																																																			.		0.607	KRT27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257216.1	NM_181537	
KRTAP4-7	100132476	hgsc.bcm.edu	37	17	39240789	39240803	+	In_Frame_Del	DEL	CGCCCCAGCTGCTGC	CGCCCCAGCTGCTGC	-	rs9894966|rs9894106|rs199957151|rs11650261|rs541163988|rs553572799	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	CGCCCCAGCTGCTGC	CGCCCCAGCTGCTGC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr17:39240789_39240803delCGCCCCAGCTGCTGC	ENST00000391417.4	+	1	331_345	c.331_345delCGCCCCAGCTGCTGC	c.(331-345)cgccccagctgctgcdel	p.RPSCC111del		NM_033061.3	NP_149050.3	Q9BYR0	KRA47_HUMAN	keratin associated protein 4-7	136	31 X 5 AA repeats of C-C-[GIKRQVHEML]- [SPTRV]-[STVQRCP].		Missing. {ECO:0000269|PubMed:15955084}.		aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)		p.R111_C115delRPSCC(1)|p.S113C(1)|p.P112P(1)|p.?(1)		NS(1)|endometrium(3)|kidney(1)|lung(1)|prostate(2)|urinary_tract(1)	9						cacctgctgccgccccagctgctgccgcccctgct	0.66																																					p.111_115del		.											.	.	4	Substitution - Missense(1)|Unknown(1)|Substitution - coding silent(1)|Deletion - In frame(1)	NS(2)|prostate(2)	c.331_345del						.																																			SO:0001651	inframe_deletion	100132476	exon1			TGCTGCCGCCCCA	AJ406939	CCDS45673.1	17q21.2	2013-06-25			ENSG00000240871	ENSG00000240871		"""Keratin associated proteins"""	18898	protein-coding gene	gene with protein product						11279113	Standard	NM_033061		Approved	KAP4.7	uc010wfn.2	Q9BYR0	OTTHUMG00000133582	ENST00000391417.4:c.331_345delCGCCCCAGCTGCTGC	17.37:g.39240789_39240803delCGCCCCAGCTGCTGC	ENSP00000375236:p.Arg111_Cys115del	Somatic	33	0		WXS	Illumina GAIIx	Phase_I	124	0	NM_033061	0	0	0	0	0	A0AVM6|A8MQ08|A8MTL4	In_Frame_Del	DEL	ENST00000391417.4	37	CCDS45673.1																																																																																			.		0.660	KRTAP4-7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257686.1		
C17orf53	78995	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	42225398	42225398	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr17:42225398A>G	ENST00000319977.4	+	3	464	c.227A>G	c.(226-228)gAc>gGc	p.D76G	C17orf53_ENST00000245382.6_Missense_Mutation_p.D76G|C17orf53_ENST00000585683.1_Missense_Mutation_p.D76G	NM_001171251.1|NM_024032.3	NP_001164722.1|NP_076937.2	Q8N3J3	CQ053_HUMAN	chromosome 17 open reading frame 53	76										NS(1)|breast(3)|cervix(1)|kidney(3)|large_intestine(3)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	22		Breast(137;0.0364)|Prostate(33;0.0376)		BRCA - Breast invasive adenocarcinoma(366;0.114)		GGCCTGCCAGACTTGGACCTC	0.612																																					p.D76G		.											.	C17orf53-90	0			c.A227G						.						84.0	71.0	76.0					17																	42225398		2203	4300	6503	SO:0001583	missense	78995	exon3			TGCCAGACTTGGA	AK021656	CCDS11477.1, CCDS59293.1	17q21.31	2012-10-11			ENSG00000125319	ENSG00000125319			28460	protein-coding gene	gene with protein product							Standard	NM_001171251		Approved	MGC3130	uc002ifi.2	Q8N3J3	OTTHUMG00000181808	ENST00000319977.4:c.227A>G	17.37:g.42225398A>G	ENSP00000313500:p.Asp76Gly	Somatic	62	0		WXS	Illumina GAIIx	Phase_I	56	6	NM_001171251	0	0	0	0	0	A8K7A9|Q9BWM9|Q9HAI1	Missense_Mutation	SNP	ENST00000319977.4	37	CCDS11477.1	.	.	.	.	.	.	.	.	.	.	A	9.811	1.183068	0.21870	.	.	ENSG00000125319	ENST00000319977;ENST00000245382;ENST00000253405	T;T	0.44482	0.92;0.92	5.28	2.85	0.33270	.	0.356386	0.24282	N	0.039887	T	0.18215	0.0437	N	0.08118	0	0.09310	N	1	B;B;B	0.14012	0.009;0.002;0.009	B;B;B	0.13407	0.009;0.004;0.009	T	0.20672	-1.0268	10	0.15066	T	0.55	-7.2203	5.7131	0.17945	0.1773:0.6922:0.0:0.1304	.	76;76;76	A8K7A9;Q8N3J3-3;Q8N3J3	.;.;CQ053_HUMAN	G	76	ENSP00000313500:D76G;ENSP00000245382:D76G	ENSP00000245382:D76G	D	+	2	0	C17orf53	39580924	0.006000	0.16342	0.017000	0.16124	0.001000	0.01503	0.671000	0.25172	0.537000	0.28751	-0.302000	0.09304	GAC	.		0.612	C17orf53-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457697.1	NM_024032	
ABCC3	8714	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	48741342	48741342	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr17:48741342C>T	ENST00000285238.8	+	10	1288	c.1208C>T	c.(1207-1209)gCg>gTg	p.A403V	ABCC3_ENST00000427699.1_Missense_Mutation_p.A403V	NM_003786.3	NP_003777.2	O15438	MRP3_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 3	403	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33			BRCA - Breast invasive adenocarcinoma(22;3.05e-09)		Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Doxorubicin(DB00997)|Etoposide(DB00773)|Ezetimibe(DB00973)|Fluorouracil(DB00544)|Folic Acid(DB00158)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indomethacin(DB00328)|Lamivudine(DB00709)|Leucovorin(DB00650)|Methotrexate(DB00563)|Metyrapone(DB01011)|Nifedipine(DB01115)|Omeprazole(DB00338)|Phenobarbital(DB01174)|Probenecid(DB01032)|Rifampicin(DB01045)|Sulfinpyrazone(DB01138)|Verapamil(DB00661)|Vincristine(DB00541)	GTCAAACGTGCGTCCACTGTG	0.582																																					p.A403V		.											.	ABCC3-93	0			c.C1208T						.						150.0	124.0	133.0					17																	48741342		2203	4300	6503	SO:0001583	missense	8714	exon10			AACGTGCGTCCAC	Y17151	CCDS32681.1, CCDS45739.1	17q21	2012-03-14			ENSG00000108846	ENSG00000108846		"""ATP binding cassette transporters / subfamily C"""	54	protein-coding gene	gene with protein product	"""canalicular multispecific organic anion transporter 2"""	604323				8894702, 9827529	Standard	NM_003786		Approved	MRP3, cMOAT2, EST90757, MLP2, MOAT-D	uc002isl.3	O15438	OTTHUMG00000162245	ENST00000285238.8:c.1208C>T	17.37:g.48741342C>T	ENSP00000285238:p.Ala403Val	Somatic	254	0		WXS	Illumina GAIIx	Phase_I	263	86	NM_003786	0	0	0	0	0	B2RPA9|D3DTX9|O60265|O60922|O75621|O95078|O95289|O95290|Q86X85|Q9UN52	Missense_Mutation	SNP	ENST00000285238.8	37	CCDS32681.1	.	.	.	.	.	.	.	.	.	.	C	13.98	2.398496	0.42512	.	.	ENSG00000108846	ENST00000427699;ENST00000285238	D;D	0.92099	-2.97;-2.52	4.71	2.32	0.28847	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.297280	0.31989	N	0.006760	D	0.88481	0.6448	M	0.66439	2.03	0.27346	N	0.956372	P;B	0.38048	0.616;0.411	B;B	0.29524	0.097;0.103	T	0.82688	-0.0333	10	0.72032	D	0.01	-10.888	12.277	0.54741	0.3529:0.6471:0.0:0.0	.	403;403	O15438;O15438-5	MRP3_HUMAN;.	V	403	ENSP00000395160:A403V;ENSP00000285238:A403V	ENSP00000285238:A403V	A	+	2	0	ABCC3	46096341	0.047000	0.20315	0.692000	0.30179	0.510000	0.34073	2.747000	0.47475	0.788000	0.33755	-0.293000	0.09583	GCG	.		0.582	ABCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368083.2	NM_020038	
HEATR6	63897	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	58151224	58151224	+	Silent	SNP	C	C	T			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr17:58151224C>T	ENST00000184956.6	-	3	367	c.351G>A	c.(349-351)ttG>ttA	p.L117L	HEATR6_ENST00000585712.1_5'Flank|HEATR6_ENST00000585976.1_Silent_p.L117L	NM_022070.4	NP_071353.4	Q6AI08	HEAT6_HUMAN	HEAT repeat containing 6	117							poly(A) RNA binding (GO:0044822)			NS(1)|breast(4)|endometrium(5)|kidney(2)|large_intestine(4)|lung(7)|ovary(2)|pancreas(1)|prostate(4)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	44	all_cancers(5;2.25e-13)|Breast(5;4.84e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		BRCA - Breast invasive adenocarcinoma(1;5.93e-19)|Epithelial(12;7.59e-12)|all cancers(12;1.26e-10)			ACAGGAAATCCAAGTGCTGTT	0.388																																					p.L117L		.											.	HEATR6-227	0			c.G351A						.						87.0	86.0	86.0					17																	58151224		2203	4300	6503	SO:0001819	synonymous_variant	63897	exon3			GAAATCCAAGTGC	BX640819	CCDS11623.1	17q23.2	2007-05-01				ENSG00000068097			24076	protein-coding gene	gene with protein product	"""amplified in breast cancer 1"""					12755490	Standard	NM_022070		Approved	ABC1, FLJ22087	uc002iyk.1	Q6AI08		ENST00000184956.6:c.351G>A	17.37:g.58151224C>T		Somatic	197	1		WXS	Illumina GAIIx	Phase_I	177	75	NM_022070	0	0	0	0	0	B3KXP3|Q6MZX1|Q6MZY2|Q8TDM9|Q9H6B3|Q9H6M7	Silent	SNP	ENST00000184956.6	37	CCDS11623.1																																																																																			.		0.388	HEATR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449165.1	NM_022070	
TMEM200C	645369	hgsc.bcm.edu	37	18	5890571	5890571	+	Missense_Mutation	SNP	T	T	C	rs7506026	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr18:5890571T>C	ENST00000581347.2	-	3	2137	c.1492A>G	c.(1492-1494)Agc>Ggc	p.S498G	RP11-945C19.4_ENST00000580845.1_RNA|RP11-945C19.4_ENST00000582939.1_RNA|RP11-945C19.4_ENST00000577694.1_RNA|TMEM200C_ENST00000383490.2_Missense_Mutation_p.S498G			A6NKL6	T200C_HUMAN	transmembrane protein 200C	498	Pro-rich.					integral component of membrane (GO:0016021)				autonomic_ganglia(1)|endometrium(1)|large_intestine(4)|lung(5)|stomach(1)	12						GCCAGAGGGCTGGAGTCCGGG	0.791													T|||	237	0.0473243	0.0847	0.0375	5008	,	,		7356	0.001		0.0775	False		,,,				2504	0.0204				p.S498G		.											.	.	0			c.A1492G						.	T	GLY/SER	155,2477		3,149,1164	3.0	3.0	3.0		1492	-1.2	0.0	18	dbSNP_116	3	267,5869		4,259,2805	no	missense	TMEM200C	NM_001080209.1	56	7,408,3969	CC,CT,TT		4.3514,5.8891,4.813	benign	498/622	5890571	422,8346	1316	3068	4384	SO:0001583	missense	645369	exon1			GAGGGCTGGAGTC		CCDS45825.1	18p11.31	2009-09-08			ENSG00000206432	ENSG00000206432			37208	protein-coding gene	gene with protein product						15722956	Standard	NM_001080209		Approved	TTMA	uc002kmx.1	A6NKL6		ENST00000581347.2:c.1492A>G	18.37:g.5890571T>C	ENSP00000463375:p.Ser498Gly	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	14	8	NM_001080209	0	0	0	0	0		Missense_Mutation	SNP	ENST00000581347.2	37	CCDS45825.1	128	0.05860805860805861	46	0.09349593495934959	17	0.04696132596685083	3	0.005244755244755245	62	0.08179419525065963	T	13.97	2.397165	0.42512	0.058891	0.043514	ENSG00000206432	ENST00000383490	.	.	.	4.37	-1.18	0.09617	.	.	.	.	.	T	0.00496	0.0016	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.22800	-1.0206	8	0.08599	T	0.76	.	4.9842	0.14182	0.1362:0.3204:0.0:0.5434	rs7506026	498	A6NKL6	T200C_HUMAN	G	498	.	ENSP00000372982:S498G	S	-	1	0	TMEM200C	5880571	0.000000	0.05858	0.000000	0.03702	0.066000	0.16364	-0.166000	0.09954	-0.178000	0.10672	0.459000	0.35465	AGC	T|0.941;C|0.059		0.791	TMEM200C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441917.4	NM_001080209	
ANKRD20A5P	440482	ucsc.edu	37	18	14183747	14183747	+	RNA	SNP	T	T	C	rs62085006		TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr18:14183747T>C	ENST00000581935.1	+	0	598							A0PJZ0	A20A5_HUMAN	ankyrin repeat domain 20 family, member A5, pseudogene											lung(3)	3						ACAAAGAAAATAGAACGCCTT	0.353																																					.		.											.	ANKRD20A5P-90	0			.						.						91.0	89.0	90.0					18																	14183747		2203	4300	6503			440482	.			AGAAAATAGAACG	BC022023		18p11.21	2011-06-01	2011-06-01	2011-06-01	ENSG00000186481	ENSG00000186481			33833	pseudogene	pseudogene			"""ankyrin repeat domain 20 family, member A5"""	ANKRD20A5			Standard	NR_040113		Approved	MGC26718	uc010xag.2	A0PJZ0	OTTHUMG00000157172		18.37:g.14183747T>C		Somatic	34	1		WXS	Illumina GAIIx	Phase_I	45	9	.	0	0	0	0	0	Q4G1B6	RNA	SNP	ENST00000581935.1	37																																																																																				.		0.353	ANKRD20A5P-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000442833.1		
ARID3A	1820	hgsc.bcm.edu	37	19	929678	929678	+	Silent	SNP	G	G	A	rs3826948	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr19:929678G>A	ENST00000263620.3	+	2	477	c.150G>A	c.(148-150)gaG>gaA	p.E50E	AC005391.2_ENST00000585647.1_RNA	NM_005224.2	NP_005215.1	Q99856	ARI3A_HUMAN	AT rich interactive domain 3A (BRIGHT-like)	50						cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|ovary(1)	10		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GAGAGCCCGAGAGTGCCCGGA	0.766													g|||	2308	0.460863	0.1112	0.487	5008	,	,		7932	0.6756		0.6223	False		,,,				2504	0.5276				p.E50E	Pancreas(29;54 1022 32760 50921)	.											.	ARID3A-90	0			c.G150A						.	G		470,2552		61,348,1102	3.0	4.0	3.0		150	1.1	0.4	19	dbSNP_107	3	3721,3153		1076,1569,792	no	coding-synonymous	ARID3A	NM_005224.2		1137,1917,1894	AA,AG,GG		45.8685,15.5526,42.3504		50/594	929678	4191,5705	1511	3437	4948	SO:0001819	synonymous_variant	1820	exon2			GCCCGAGAGTGCC	U88047	CCDS12050.1	19p13.3	2013-02-07	2006-11-08	2004-01-30		ENSG00000116017		"""-"""	3031	protein-coding gene	gene with protein product		603265	"""dead ringer-like 1 (Drosophila)"", ""AT rich interactive domain 3A (BRIGHT- like)"""	DRIL1		9722953	Standard	NM_005224		Approved	BRIGHT	uc002lql.3	Q99856		ENST00000263620.3:c.150G>A	19.37:g.929678G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_005224	0	0	0	0	0	Q5I858|Q6P9C6|Q8IZA7|Q8N4Z3	Silent	SNP	ENST00000263620.3	37	CCDS12050.1																																																																																			T|0.495;C|0.504		0.766	ARID3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458219.1	NM_005224	
ARID3A	1820	hgsc.bcm.edu	37	19	929753	929753	+	Silent	SNP	A	A	G	rs1799595	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr19:929753A>G	ENST00000263620.3	+	2	552	c.225A>G	c.(223-225)ccA>ccG	p.P75P	AC005391.2_ENST00000585647.1_RNA	NM_005224.2	NP_005215.1	Q99856	ARI3A_HUMAN	AT rich interactive domain 3A (BRIGHT-like)	75						cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|ovary(1)	10		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGGACACCCAGCCAGCCCCG	0.751													t|||	4428	0.884185	0.9062	0.804	5008	,	,		8534	0.998		0.836	False		,,,				2504	0.8436				p.P75P	Pancreas(29;54 1022 32760 50921)	.											.	ARID3A-90	0			c.A225G						.	G		3389,305		1555,279,13	4.0	5.0	5.0		225	-6.8	0.0	19	dbSNP_89	5	6619,1123		2834,951,86	no	coding-synonymous	ARID3A	NM_005224.2		4389,1230,99	GG,GA,AA		14.5053,8.2566,12.4869		75/594	929753	10008,1428	1847	3871	5718	SO:0001819	synonymous_variant	1820	exon2			ACACCCAGCCAGC	U88047	CCDS12050.1	19p13.3	2013-02-07	2006-11-08	2004-01-30		ENSG00000116017		"""-"""	3031	protein-coding gene	gene with protein product		603265	"""dead ringer-like 1 (Drosophila)"", ""AT rich interactive domain 3A (BRIGHT- like)"""	DRIL1		9722953	Standard	NM_005224		Approved	BRIGHT	uc002lql.3	Q99856		ENST00000263620.3:c.225A>G	19.37:g.929753A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_005224	0	0	0	0	0	Q5I858|Q6P9C6|Q8IZA7|Q8N4Z3	Silent	SNP	ENST00000263620.3	37	CCDS12050.1																																																																																			A|0.114;G|0.886		0.751	ARID3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458219.1	NM_005224	
FZR1	51343	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	3525978	3525978	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr19:3525978T>G	ENST00000395095.3	+	2	182	c.182T>G	c.(181-183)tTc>tGc	p.F61C	FZR1_ENST00000313639.8_Missense_Mutation_p.F61C|FZR1_ENST00000441788.2_Missense_Mutation_p.F61C	NM_001136198.1	NP_001129670.1	Q9UM11	FZR_HUMAN	fizzy/cell division cycle 20 related 1 (Drosophila)	61					activation of anaphase-promoting complex activity (GO:0051488)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|DNA repair (GO:0006281)|G2 DNA damage checkpoint (GO:0031572)|lens fiber cell differentiation (GO:0070306)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of cell aging (GO:0090344)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of meiosis (GO:0040020)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(1)|kidney(4)|liver(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(2)	13				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00253)|STAD - Stomach adenocarcinoma(1328;0.18)		AGCGTGAACTTCCACAGGATT	0.682																																					p.F61C		.											.	FZR1-227	0			c.T182G						.						37.0	37.0	37.0					19																	3525978		2199	4297	6496	SO:0001583	missense	51343	exon2			TGAACTTCCACAG	AF083810	CCDS12109.1, CCDS45916.1, CCDS45917.1	19p13.3	2013-01-10				ENSG00000105325		"""WD repeat domain containing"""	24824	protein-coding gene	gene with protein product		603619				9734353, 11003657	Standard	NM_016263		Approved	HCDH1, CDH1, HCDH, FZR, FZR2, KIAA1242, CDC20C	uc010dtk.2	Q9UM11		ENST00000395095.3:c.182T>G	19.37:g.3525978T>G	ENSP00000378529:p.Phe61Cys	Somatic	65	0		WXS	Illumina GAIIx	Phase_I	121	22	NM_001136197	0	0	0	0	0	O75869|Q86U66|Q96NW8|Q9UI96|Q9ULH8|Q9UM10|Q9UNQ1|Q9Y2T8	Missense_Mutation	SNP	ENST00000395095.3	37	CCDS45916.1	.	.	.	.	.	.	.	.	.	.	T	20.6	4.012218	0.75046	.	.	ENSG00000105325	ENST00000441788;ENST00000395095;ENST00000313639	T;T;T	0.08193	3.12;3.12;3.12	4.66	4.66	0.58398	.	0.000000	0.85682	D	0.000000	T	0.32466	0.0830	M	0.89214	3.015	0.33124	D	0.542256	P;D;D	0.76494	0.68;0.999;0.999	P;D;D	0.76071	0.515;0.987;0.971	T	0.53683	-0.8404	10	0.39692	T	0.17	-56.1808	12.9432	0.58357	0.0:0.0:0.0:1.0	.	61;61;61	Q9UM11;Q9UM11-3;Q9UM11-2	FZR_HUMAN;.;.	C	61	ENSP00000410369:F61C;ENSP00000378529:F61C;ENSP00000321800:F61C	ENSP00000321800:F61C	F	+	2	0	FZR1	3476978	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	6.043000	0.71004	1.731000	0.51592	0.459000	0.35465	TTC	.		0.682	FZR1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452869.2	NM_016263	
ZNF414	84330	hgsc.bcm.edu	37	19	8576670	8576670	+	Silent	SNP	C	C	T	rs7175	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr19:8576670C>T	ENST00000255616.8	-	5	806	c.705G>A	c.(703-705)ccG>ccA	p.P235P	ZNF414_ENST00000393927.4_Silent_p.P235P	NM_032370.2	NP_115746.2	Q96IQ9	ZN414_HUMAN	zinc finger protein 414	235					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			lung(2)	2						GCAGCGGGAACGGCAGGCCCG	0.771													C|||	1010	0.201677	0.2897	0.1686	5008	,	,		8403	0.1746		0.1988	False		,,,				2504	0.137				p.P235P		.											.	ZNF414-90	0			c.G705A						.	C	,	887,3039		132,623,1208	4.0	6.0	5.0		705,705	-2.0	0.0	19	dbSNP_52	5	1238,6388		127,984,2702	no	coding-synonymous,coding-synonymous	ZNF414	NM_001146175.1,NM_032370.2	,	259,1607,3910	TT,TC,CC		16.2339,22.593,18.3951	,	235/391,235/313	8576670	2125,9427	1963	3813	5776	SO:0001819	synonymous_variant	84330	exon5			CGGGAACGGCAGG	AK074191	CCDS12205.1, CCDS54211.1	19p13.2	2008-02-05				ENSG00000133250		"""Zinc fingers, C2H2-type"""	20630	protein-coding gene	gene with protein product							Standard	NM_032370		Approved	MGC15716, Zfp414	uc002mke.4	Q96IQ9		ENST00000255616.8:c.705G>A	19.37:g.8576670C>T		Somatic	4	0		WXS	Illumina GAIIx	Phase_I	12	5	NM_032370	0	0	0	0	0	A8MY94	Silent	SNP	ENST00000255616.8	37	CCDS12205.1																																																																																			C|0.788;T|0.212		0.771	ZNF414-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000460199.2	NM_032370	
DDX39A	10212	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	14520224	14520224	+	Missense_Mutation	SNP	C	C	T	rs188717433		TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr19:14520224C>T	ENST00000242776.4	-	9	1111	c.1010G>A	c.(1009-1011)cGg>cAg	p.R337Q	CTC-548K16.5_ENST00000590626.1_RNA|DDX39A_ENST00000592927.1_5'Flank	NM_005804.3	NP_005795.2	O00148	DX39A_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 39A	337	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(5)|kidney(1)|lung(2)|ovary(1)|pancreas(1)	11						CAGGATCCGCCGCTGGAAATC	0.587													C|||	1	0.000199681	0.0	0.0	5008	,	,		18554	0.001		0.0	False		,,,				2504	0.0				p.R337Q		.											.	DDX39A-226	0			c.G1010A						.						69.0	72.0	71.0					19																	14520224		2203	4300	6503	SO:0001583	missense	10212	exon9			ATCCGCCGCTGGA	U90426	CCDS12308.1	19p13.12	2011-02-08	2011-02-08	2011-02-08	ENSG00000123136	ENSG00000123136		"""DEAD-boxes"""	17821	protein-coding gene	gene with protein product	"""UAP56-related helicase, 49 kDa"""		"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 39"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 39"""	DDX39		7601445	Standard	NM_005804		Approved	DDXL, BAT1L, URH49	uc002myo.3	O00148		ENST00000242776.4:c.1010G>A	19.37:g.14520224C>T	ENSP00000242776:p.Arg337Gln	Somatic	71	0		WXS	Illumina GAIIx	Phase_I	114	29	NM_005804	0	0	0	0	0	Q8N5M0|Q9BVP6|Q9H5W0	Missense_Mutation	SNP	ENST00000242776.4	37	CCDS12308.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	21.7	4.187051	0.78789	.	.	ENSG00000123136	ENST00000451994;ENST00000242776	T	0.04758	3.56	5.14	5.14	0.70334	Helicase, C-terminal (3);	0.052213	0.64402	D	0.000001	T	0.04679	0.0127	N	0.16708	0.43	0.80722	D	1	B	0.17038	0.02	B	0.12156	0.007	T	0.44862	-0.9300	10	0.62326	D	0.03	-26.6292	16.4475	0.83942	0.0:1.0:0.0:0.0	.	337	O00148	DX39A_HUMAN	Q	380;337	ENSP00000242776:R337Q	ENSP00000242776:R337Q	R	-	2	0	DDX39A	14381224	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.086000	0.76885	2.565000	0.86533	0.561000	0.74099	CGG	C|0.999;T|0.000		0.587	DDX39A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459880.1	NM_138998	
GDF1	2657	hgsc.bcm.edu	37	19	18980172	18980172	+	Missense_Mutation	SNP	G	G	A	rs4808863	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr19:18980172G>A	ENST00000247005.6	-	8	1698	c.353C>T	c.(352-354)gCc>gTc	p.A118V	CERS1_ENST00000427170.2_3'UTR			P27539	GDF1_HUMAN	growth differentiation factor 1	118			A -> V (in dbSNP:rs4808863). {ECO:0000269|PubMed:2034669}.		growth (GO:0040007)	extracellular space (GO:0005615)											CGCGGCCGAGGCAGGCTCCGA	0.716													g|||	1171	0.233826	0.0401	0.4986	5008	,	,		5099	0.1687		0.3946	False		,,,				2504	0.2096				p.A118V		.											.	GDF1-226	0			c.C353T						.						2.0	2.0	2.0					19																	18980172		1157	2328	3485	SO:0001583	missense	2657	exon8			GCCGAGGCAGGCT	M62302	CCDS42526.1	19p13.11	2014-01-30			ENSG00000130283	ENSG00000130283		"""Endogenous ligands"""	4214	protein-coding gene	gene with protein product		602880				2034669	Standard	NM_001492		Approved			P27539		ENST00000247005.6:c.353C>T	19.37:g.18980172G>A	ENSP00000247005:p.Ala118Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_001492	0	0	0	0	0	O43344	Missense_Mutation	SNP	ENST00000247005.6	37	CCDS42526.1	621	0.28434065934065933	39	0.07926829268292683	184	0.5082872928176796	110	0.19230769230769232	288	0.37994722955145116	g	11.82	1.752739	0.31046	.	.	ENSG00000130283	ENST00000247005	T	0.78481	-1.18	3.33	0.926	0.19430	.	0.692776	0.14240	U	0.332130	T	0.00012	0.0000	L	0.44542	1.39	0.58432	P	1.0000000000287557E-6	.	.	.	.	.	.	T	0.41805	-0.9488	7	0.16896	T	0.51	.	9.0728	0.36502	0.0:0.4429:0.5571:0.0	rs4808863	.	.	.	V	118	ENSP00000247005:A118V	ENSP00000247005:A118V	A	-	2	0	GDF1	18841172	0.000000	0.05858	0.001000	0.08648	0.008000	0.06430	0.201000	0.17276	-0.047000	0.13423	-0.546000	0.04227	GCC	G|0.715;A|0.285		0.716	GDF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465926.1	NM_001492	
C19orf12	83636	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	30199201	30199201	+	Silent	SNP	G	G	A			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr19:30199201G>A	ENST00000392278.2	-	2	279	c.153C>T	c.(151-153)ttC>ttT	p.F51F	C19orf12_ENST00000392276.1_Intron|C19orf12_ENST00000392275.1_Intron|C19orf12_ENST00000323670.9_Silent_p.F40F|C19orf12_ENST00000592153.1_Silent_p.F40F	NM_001031726.3	NP_001026896.2	Q9NSK7	CS012_HUMAN	chromosome 19 open reading frame 12	51					cell death (GO:0008219)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)						Ovarian(5;0.000567)|Breast(6;0.0203)|Esophageal squamous(110;0.239)		UCEC - Uterine corpus endometrioid carcinoma (4;2.65e-06)|STAD - Stomach adenocarcinoma(5;1.7e-06)|Lung(7;0.0435)|LUAD - Lung adenocarcinoma(5;0.0989)|BRCA - Breast invasive adenocarcinoma(6;0.183)			AACCCCCGACGAAGGCCATGG	0.607																																					p.F51F		.											.	C19orf12-204	0			c.C153T						.						52.0	57.0	56.0					19																	30199201		1897	4101	5998	SO:0001819	synonymous_variant	83636	exon2			CCCGACGAAGGCC	AK057185	CCDS12418.2, CCDS42542.1, CCDS59373.1, CCDS74325.1	19q13.11	2013-07-24			ENSG00000131943	ENSG00000131943			25443	protein-coding gene	gene with protein product	"""neurodegeneration with brain iron accumulation 4"""	614297	"""spastic paraplegia 43 (autosomal recessive)"""	SPG43		21981780, 23857908	Standard	NM_031448		Approved	MGC10922, DKFZP762D096, NBIA4	uc002nsj.3	Q9NSK7	OTTHUMG00000149838	ENST00000392278.2:c.153C>T	19.37:g.30199201G>A		Somatic	43	0		WXS	Illumina GAIIx	Phase_I	85	15	NM_001031726	0	0	0	0	0	B3KQ16|Q0D2Q0|Q6P4C5|Q9BSL7	Silent	SNP	ENST00000392278.2	37	CCDS42542.1																																																																																			.		0.607	C19orf12-003	KNOWN	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000313509.2	NM_031448	
LRP3	4037	hgsc.bcm.edu	37	19	33698018	33698018	+	Missense_Mutation	SNP	C	C	T	rs11539586	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr19:33698018C>T	ENST00000253193.7	+	7	2052	c.1850C>T	c.(1849-1851)gCg>gTg	p.A617V	CTD-2540B15.13_ENST00000609744.1_RNA	NM_002333.3	NP_002324.2	O75074	LRP3_HUMAN	low density lipoprotein receptor-related protein 3	617					receptor-mediated endocytosis (GO:0006898)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)|pancreas(2)	15	Esophageal squamous(110;0.137)					CGGCCGCGGGCGCCCCGAGGC	0.751													c|||	306	0.0611022	0.0598	0.0303	5008	,	,		10346	0.0446		0.0348	False		,,,				2504	0.1288				p.A617V		.											.	LRP3-92	0			c.C1850T						.	T	VAL/ALA	150,3256		0,150,1553	2.0	3.0	3.0		1850	1.1	0.1	19	dbSNP_120	3	222,6744		4,214,3265	no	missense	LRP3	NM_002333.3	64	4,364,4818	TT,TC,CC		3.1869,4.404,3.5866	benign	617/771	33698018	372,10000	1703	3483	5186	SO:0001583	missense	4037	exon7			CGCGGGCGCCCCG	AB009462	CCDS12430.1	19q13.11	2013-05-30			ENSG00000130881	ENSG00000130881		"""Low density lipoprotein receptors"""	6695	protein-coding gene	gene with protein product		603159				9693042, 7959795	Standard	NM_002333		Approved	LRP-3, hLRp105	uc010edh.3	O75074	OTTHUMG00000180343	ENST00000253193.7:c.1850C>T	19.37:g.33698018C>T	ENSP00000253193:p.Ala617Val	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	15	10	NM_002333	0	0	0	0	0	B3KQD6|B4DKF2	Missense_Mutation	SNP	ENST00000253193.7	37	CCDS12430.1	71	0.03250915750915751	23	0.046747967479674794	8	0.022099447513812154	15	0.026223776223776224	25	0.032981530343007916	c	1.581	-0.531531	0.04112	0.04404	0.031869	ENSG00000130881	ENST00000253193	D	0.87256	-2.23	3.32	1.14	0.20703	.	0.411391	0.20707	N	0.087178	T	0.38268	0.1034	L	0.38175	1.15	0.09310	N	1	B;D	0.63880	0.001;0.993	B;B	0.38562	0.001;0.276	T	0.55952	-0.8059	10	0.27785	T	0.31	-5.3016	8.5568	0.33487	0.0:0.7835:0.0:0.2165	rs11539586	617;535	O75074;B7ZAJ9	LRP3_HUMAN;.	V	617	ENSP00000253193:A617V	ENSP00000253193:A617V	A	+	2	0	LRP3	38389858	0.435000	0.25577	0.147000	0.22382	0.046000	0.14306	1.013000	0.29937	0.098000	0.17522	-3.141000	0.00059	GCG	T|0.000;G|0.967		0.751	LRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450842.4		
FBXO17	115290	hgsc.bcm.edu	37	19	39440918	39440918	+	Silent	SNP	T	T	C	rs2304117	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr19:39440918T>C	ENST00000292852.4	-	2	383	c.42A>G	c.(40-42)ccA>ccG	p.P14P	CTC-360G5.8_ENST00000599996.1_5'Flank|FBXO17_ENST00000595329.1_Silent_p.P14P|SARS2_ENST00000448145.2_5'Flank	NM_024907.5	NP_079183.4	Q96EF6	FBX17_HUMAN	F-box protein 17	14						SCF ubiquitin ligase complex (GO:0019005)	glycoprotein binding (GO:0001948)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)	7	all_cancers(60;8.37e-07)|all_lung(34;3.71e-07)|Lung NSC(34;4.17e-07)|all_epithelial(25;1.13e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			GGGCCAGGGATGGGTCCGCCG	0.731													c|||	2378	0.47484	0.3336	0.3746	5008	,	,		11867	0.6796		0.4195	False		,,,				2504	0.5828				p.P23P		.											.	FBXO17-226	0			c.A69G						.		,	1052,2556		213,626,965	3.0	4.0	3.0		42,69	0.5	0.0	19	dbSNP_100	3	2265,4819		496,1273,1773	no	coding-synonymous,coding-synonymous	FBXO17	NM_024907.5,NM_148169.1	,	709,1899,2738	CC,CT,TT		31.9735,29.1574,31.0232	,	14/279,23/288	39440918	3317,7375	1804	3542	5346	SO:0001819	synonymous_variant	115290	exon2			CAGGGATGGGTCC	AF386743	CCDS12526.1	19q13.2	2010-07-02	2004-06-15	2004-06-16		ENSG00000269190		"""F-boxes /  ""other"""""	18754	protein-coding gene	gene with protein product	"""F-box only protein 26"""	609094	"""F-box only protein 17"""	FBXO26			Standard	NM_148169		Approved	FBG4, FLJ25205, MGC9379, FLJ11798, Fbx17		Q96EF6		ENST00000292852.4:c.42A>G	19.37:g.39440918T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	16	16	NM_148169	0	0	0	0	0	Q96LQ4	Silent	SNP	ENST00000292852.4	37	CCDS12526.1																																																																																			T|0.545;C|0.455		0.731	FBXO17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463273.1	NM_024907	
SPTBN4	57731	hgsc.bcm.edu	37	19	41025758	41025758	+	Silent	SNP	G	G	A	rs201389714	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr19:41025758G>A	ENST00000352632.3	+	16	3440	c.3354G>A	c.(3352-3354)ctG>ctA	p.L1118L	SPTBN4_ENST00000344104.3_Silent_p.L1118L|SPTBN4_ENST00000598249.1_Silent_p.L1118L|SPTBN4_ENST00000595535.1_Silent_p.L1118L|SPTBN4_ENST00000338932.3_Silent_p.L1118L			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4	1118					actin filament capping (GO:0051693)|adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cardiac conduction (GO:0061337)|central nervous system projection neuron axonogenesis (GO:0021952)|clustering of voltage-gated sodium channels (GO:0045162)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization to plasma membrane (GO:0090002)|fertilization (GO:0009566)|negative regulation of heart rate (GO:0010459)|positive regulation of multicellular organism growth (GO:0040018)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of sodium ion transport (GO:0002028)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|nuclear matrix (GO:0016363)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|PML body (GO:0016605)|spectrin (GO:0008091)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phosphatase binding (GO:0019902)|phospholipid binding (GO:0005543)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			AGGGGCCCCTGCCCAACAGCC	0.711													G|||	2	0.000399361	0.0	0.0	5008	,	,		8661	0.0		0.002	False		,,,				2504	0.0				p.L1118L		.											.	SPTBN4-94	0			c.G3354A						.						2.0	3.0	2.0					19																	41025758		1543	3106	4649	SO:0001819	synonymous_variant	57731	exon16			GCCCCTGCCCAAC	AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460		"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214				11086001	Standard	NM_020971		Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.3354G>A	19.37:g.41025758G>A		Somatic	2	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_020971	0	0	0	0	0	E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	Silent	SNP	ENST00000352632.3	37	CCDS12559.1																																																																																			G|0.997;A|0.003		0.711	SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462559.2		
NTN5	126147	hgsc.bcm.edu	37	19	49164952	49164952	+	Silent	SNP	A	A	G	rs281392	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr19:49164952A>G	ENST00000270235.4	-	7	1547	c.1452T>C	c.(1450-1452)agT>agC	p.S484S	SEC1P_ENST00000430145.2_RNA	NM_145807.1	NP_665806.1	Q8WTR8	NET5_HUMAN	netrin 5	484						extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|pancreas(1)|prostate(1)	10						CCGGCCTGGGACTGGGTGTGG	0.687													G|||	2669	0.532947	0.351	0.4669	5008	,	,		9559	0.5625		0.6421	False		,,,				2504	0.683				p.S484S		.											.	NTN5-136	0			c.T1452C						.	G		1663,2349		390,883,733	9.0	9.0	9.0		1452	2.2	0.0	19	dbSNP_79	9	5217,2785		1816,1585,600	no	coding-synonymous	NTN5	NM_145807.1		2206,2468,1333	GG,GA,AA		34.8038,41.4506,42.7335		484/490	49164952	6880,5134	2006	4001	6007	SO:0001819	synonymous_variant	126147	exon7			CCTGGGACTGGGT		CCDS33068.1	19q13.33	2013-03-01			ENSG00000142233	ENSG00000142233		"""Netrins"""	25208	protein-coding gene	gene with protein product	"""Netrin-5"""					12477932	Standard	NM_145807		Approved		uc002pkb.3	Q8WTR8		ENST00000270235.4:c.1452T>C	19.37:g.49164952A>G		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	5	4	NM_145807	0	0	0	0	0	Q8N4X9|Q8WU63	Silent	SNP	ENST00000270235.4	37	CCDS33068.1																																																																																			A|0.464;G|0.536		0.687	NTN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466176.1	NM_145807	
SHANK1	50944	broad.mit.edu	37	19	51215270	51215270	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr19:51215270C>A	ENST00000293441.1	-	6	912	c.894G>T	c.(892-894)gaG>gaT	p.E298D	SHANK1_ENST00000359082.3_Missense_Mutation_p.E298D|SHANK1_ENST00000391814.1_Missense_Mutation_p.E298D	NM_016148.2	NP_057232.2	Q9Y566	SHAN1_HUMAN	SH3 and multiple ankyrin repeat domains 1	298					adult behavior (GO:0030534)|associative learning (GO:0008306)|cytoskeletal anchoring at plasma membrane (GO:0007016)|dendritic spine morphogenesis (GO:0060997)|determination of affect (GO:0050894)|habituation (GO:0046959)|long-term memory (GO:0007616)|negative regulation of actin filament bundle assembly (GO:0032232)|neuromuscular process controlling balance (GO:0050885)|olfactory behavior (GO:0042048)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|protein complex assembly (GO:0006461)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|righting reflex (GO:0060013)|social behavior (GO:0035176)|synapse maturation (GO:0060074)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|excitatory synapse (GO:0060076)|intracellular (GO:0005622)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ankyrin repeat binding (GO:0071532)|GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|somatostatin receptor binding (GO:0031877)			breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	64		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)		ACAGGAGCAGCTCGCAGCATC	0.637																																					p.E298D		.											.	SHANK1-153	0			c.G894T						.						69.0	73.0	72.0					19																	51215270		2203	4300	6503	SO:0001583	missense	50944	exon6			GAGCAGCTCGCAG	AF163302	CCDS12799.1	19q13.3	2013-01-10			ENSG00000161681	ENSG00000161681		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15474	protein-coding gene	gene with protein product	"""somatostatin receptor-interacting protein"""	604999				10551867	Standard	NM_016148		Approved	SSTRIP, SPANK-1, synamon	uc002psx.1	Q9Y566	OTTHUMG00000137380	ENST00000293441.1:c.894G>T	19.37:g.51215270C>A	ENSP00000293441:p.Glu298Asp	Somatic	158	1		WXS	Illumina GAIIx	Phase_I	222	9	NM_016148	0	0	0	0	0	A8MXP5|B7WNY6|Q9NYW9	Missense_Mutation	SNP	ENST00000293441.1	37	CCDS12799.1	.	.	.	.	.	.	.	.	.	.	C	13.42	2.232587	0.39498	.	.	ENSG00000161681	ENST00000293441;ENST00000359082;ENST00000391814	T;T;T	0.17528	2.27;2.27;2.27	4.68	3.65	0.41850	Ankyrin repeat-containing domain (3);	0.000000	0.56097	U	0.000022	T	0.25121	0.0610	L	0.31207	0.915	0.50813	D	0.999896	D	0.76494	0.999	D	0.80764	0.994	T	0.02417	-1.1162	10	0.87932	D	0	-19.8045	6.8766	0.24151	0.0:0.7227:0.0:0.2773	.	298	Q9Y566	SHAN1_HUMAN	D	298	ENSP00000293441:E298D;ENSP00000351984:E298D;ENSP00000375690:E298D	ENSP00000293441:E298D	E	-	3	2	SHANK1	55907082	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	1.660000	0.37397	1.116000	0.41820	0.555000	0.69702	GAG	.		0.637	SHANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268071.1	NM_016148	
SIGLEC5	8778	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	52132321	52132321	+	Nonsense_Mutation	SNP	G	G	A			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr19:52132321G>A	ENST00000534261.2	-	5	1108	c.709C>T	c.(709-711)Cag>Tag	p.Q237*	SIGLEC5_ENST00000570106.2_Nonsense_Mutation_p.Q237*|SIGLEC5_ENST00000222107.4_Nonsense_Mutation_p.Q237*|SIGLEC5_ENST00000429354.3_Nonsense_Mutation_p.Q237*|SIGLEC5_ENST00000599649.1_Nonsense_Mutation_p.Q237*			O15389	SIGL5_HUMAN	sialic acid binding Ig-like lectin 5	237	Ig-like C2-type 2.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|large_intestine(4)|lung(9)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	27		all_neural(266;0.0726)		GBM - Glioblastoma multiforme(134;0.00124)|OV - Ovarian serous cystadenocarcinoma(262;0.0218)		GTGATGGTCTGTGGAGCATCT	0.522																																					p.Q237X		.											.	SIGLEC5-92	0			c.C709T						.						188.0	167.0	174.0					19																	52132321		2203	4300	6503	SO:0001587	stop_gained	8778	exon4			TGGTCTGTGGAGC	U71383	CCDS33088.1	19q13.41	2013-01-29			ENSG00000105501	ENSG00000105501		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10874	protein-coding gene	gene with protein product		604200		CD33L2		10343116	Standard	NM_003830		Approved	OB-BP2, SIGLEC-5, CD170	uc002pxe.4	O15389	OTTHUMG00000165510	ENST00000534261.2:c.709C>T	19.37:g.52132321G>A	ENSP00000473238:p.Gln237*	Somatic	114	0		WXS	Illumina GAIIx	Phase_I	197	26	NM_003830	0	0	0	0	0		Nonsense_Mutation	SNP	ENST00000534261.2	37	CCDS33088.1	.	.	.	.	.	.	.	.	.	.	G	36	5.619900	0.96660	.	.	ENSG00000105501	ENST00000222107;ENST00000429354	.	.	.	3.02	-4.87	0.03123	.	2.260180	0.02716	N	0.113454	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.36615	T	0.2	.	2.9636	0.05901	0.1208:0.4302:0.2931:0.1559	.	.	.	.	X	237	.	ENSP00000222107:Q237X	Q	-	1	0	SIGLEC5	56824133	0.000000	0.05858	0.004000	0.12327	0.399000	0.30720	-0.356000	0.07661	-0.793000	0.04475	0.313000	0.20887	CAG	.		0.522	SIGLEC5-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466897.2	NM_003830	
TPO	7173	hgsc.bcm.edu	37	2	1481231	1481231	+	Missense_Mutation	SNP	G	G	C	rs2175977	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr2:1481231G>C	ENST00000345913.4	+	8	1284	c.1193G>C	c.(1192-1194)aGc>aCc	p.S398T	TPO_ENST00000349624.3_Intron|TPO_ENST00000346956.3_Missense_Mutation_p.S398T|TPO_ENST00000329066.4_Missense_Mutation_p.S398T|TPO_ENST00000382201.3_Missense_Mutation_p.S398T|TPO_ENST00000497517.2_Intron|TPO_ENST00000337415.3_Missense_Mutation_p.S398T|TPO_ENST00000382198.1_Intron	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	398			S -> T (in dbSNP:rs2175977). {ECO:0000269|PubMed:7550241}.		cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	GGCCGCGCCAGCGAGGTCCCC	0.761													G|||	3557	0.710264	0.8185	0.6571	5008	,	,		9157	0.7758		0.6034	False		,,,				2504	0.6442				p.S398T		.											.	TPO-332	0			c.G1193C						.	G	THR/SER,THR/SER,THR/SER,THR/SER,THR/SER,	2498,394		1072,354,20	2.0	2.0	2.0		1193,1193,1193,1193,1193,	4.1	1.0	2	dbSNP_96	2	4199,1477		1511,1177,150	no	missense,missense,missense,missense,missense,intron	TPO	NM_000547.5,NM_001206744.1,NM_001206745.1,NM_175719.3,NM_175721.3,NM_175722.3	58,58,58,58,58,	2583,1531,170	CC,CG,GG		26.0218,13.6238,21.8371	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,	398/934,398/934,398/877,398/877,398/890,	1481231	6697,1871	1446	2838	4284	SO:0001583	missense	7173	exon8			GCGCCAGCGAGGT		CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.1193G>C	2.37:g.1481231G>C	ENSP00000318820:p.Ser398Thr	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_175719	0	0	0	0	0	P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Missense_Mutation	SNP	ENST00000345913.4	37	CCDS1643.1	1512|1512	0.6923076923076923|0.6923076923076923	388|388	0.7886178861788617|0.7886178861788617	227|227	0.6270718232044199|0.6270718232044199	438|438	0.7657342657342657|0.7657342657342657	459|459	0.6055408970976254|0.6055408970976254	G|G	18.72|18.72	3.683431|3.683431	0.68157|0.68157	0.863762|0.863762	0.739782|0.739782	ENSG00000115705|ENSG00000115705	ENST00000536482|ENST00000337415;ENST00000345913;ENST00000346956;ENST00000329066;ENST00000382201;ENST00000422464	.|T;T;T;T;T;T	.|0.73897	.|-0.79;-0.79;-0.79;-0.79;-0.79;-0.79	4.99|4.99	4.08|4.08	0.47627|0.47627	.|.	.|0.142496	.|0.64402	.|N	.|0.000004	T|T	0.00012|0.00012	0.0000|0.0000	M|M	0.62723|0.62723	1.935|1.935	0.09310|0.09310	P|P	1.0|1.0	.|D;D;D	.|0.76494	.|0.998;0.998;0.999	.|D;D;D	.|0.69654	.|0.956;0.94;0.965	T|T	0.30060|0.30060	-0.9991|-0.9991	5|9	0.48119|0.56958	T|D	0.1|0.05	-48.0867|-48.0867	8.6411|8.6411	0.33978|0.33978	0.08:0.1541:0.7659:0.0|0.08:0.1541:0.7659:0.0	rs2175977|rs2175977	.|398;398;398	.|P07202-4;P07202-2;P07202	.|.;.;PERT_HUMAN	H|T	81|398;398;398;398;398;327	.|ENSP00000337263:S398T;ENSP00000318820:S398T;ENSP00000263886:S398T;ENSP00000329869:S398T;ENSP00000371636:S398T;ENSP00000405788:S327T	ENSP00000439133:Q81H|ENSP00000329869:S398T	Q|S	+|+	3|2	2|0	TPO|TPO	1460238|1460238	0.956000|0.956000	0.32656|0.32656	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	1.297000|1.297000	0.33400|0.33400	1.031000|1.031000	0.39867|0.39867	0.460000|0.460000	0.39030|0.39030	CAG|AGC	G|0.301;C|0.699		0.761	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206594.2	NM_000547	
XDH	7498	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	31628802	31628802	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr2:31628802G>A	ENST00000379416.3	-	2	119	c.71C>T	c.(70-72)aCa>aTa	p.T24I		NM_000379.3	NP_000370.2	P47989	XDH_HUMAN	xanthine dehydrogenase	24	2Fe-2S ferredoxin-type. {ECO:0000255|PROSITE-ProRule:PRU00465}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|lactation (GO:0007595)|negative regulation of endothelial cell differentiation (GO:0045602)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of gene expression (GO:0010629)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|negative regulation of vasculogenesis (GO:2001213)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of p38MAPK cascade (GO:1900745)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)|xanthine catabolic process (GO:0009115)	cytosol (GO:0005829)|extracellular space (GO:0005615)|peroxisome (GO:0005777)	2 iron, 2 sulfur cluster binding (GO:0051537)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|protein homodimerization activity (GO:0042803)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)|xanthine oxidase activity (GO:0004855)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(31)|ovary(1)|pancreas(1)|prostate(3)|skin(9)|urinary_tract(1)	74	Acute lymphoblastic leukemia(172;0.155)				Aldesleukin(DB00041)|Allopurinol(DB00437)|Azathioprine(DB00993)|Carboplatin(DB00958)|Carvedilol(DB01136)|Chlorphenesin(DB00856)|Cisplatin(DB00515)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Doxorubicin(DB00997)|Flavin adenine dinucleotide(DB03147)|L-Carnitine(DB00583)|Menadione(DB00170)|Mercaptopurine(DB01033)|Nitrofural(DB00336)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Spermine(DB00127)|Trifluoperazine(DB00831)	CAAAAGGGTTGTCTCTGGATC	0.398																																					p.T24I	Colon(66;682 1445 30109 40147)	.											.	XDH-158	0			c.C71T						.						155.0	139.0	144.0					2																	31628802		2203	4300	6503	SO:0001583	missense	7498	exon2			AGGGTTGTCTCTG	D11456	CCDS1775.1	2p23.1	2009-07-10	2003-03-20		ENSG00000158125	ENSG00000158125	1.17.1.4		12805	protein-coding gene	gene with protein product		607633	"""xanthene dehydrogenase"""			8224915	Standard	NM_000379		Approved	XOR, XO	uc002rnv.1	P47989	OTTHUMG00000099385	ENST00000379416.3:c.71C>T	2.37:g.31628802G>A	ENSP00000368727:p.Thr24Ile	Somatic	91	0		WXS	Illumina GAIIx	Phase_I	96	14	NM_000379	0	0	0	0	0	Q16681|Q16712|Q4PJ16	Missense_Mutation	SNP	ENST00000379416.3	37	CCDS1775.1	.	.	.	.	.	.	.	.	.	.	G	10.36	1.327550	0.24080	.	.	ENSG00000158125	ENST00000379416	T	0.27557	1.66	5.77	2.99	0.34606	Xanthine dehydrogenase, small subunit (1);Beta-grasp fold, ferredoxin-type (1);Ferredoxin (3);	0.286479	0.41097	D	0.000951	T	0.30448	0.0765	M	0.72353	2.195	0.37381	D	0.912031	B	0.21452	0.056	B	0.25987	0.065	T	0.14952	-1.0454	10	0.22109	T	0.4	.	8.8358	0.35111	0.2977:0.0:0.7023:0.0	.	24	P47989	XDH_HUMAN	I	24	ENSP00000368727:T24I	ENSP00000368727:T24I	T	-	2	0	XDH	31482306	0.999000	0.42202	0.949000	0.38748	0.958000	0.62258	1.493000	0.35605	0.790000	0.33803	0.462000	0.41574	ACA	.		0.398	XDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216840.1	NM_000379	
CRIM1	51232	broad.mit.edu	37	2	36706642	36706642	+	Missense_Mutation	SNP	C	C	A	rs570331773	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr2:36706642C>A	ENST00000280527.2	+	7	1544	c.1177C>A	c.(1177-1179)Cca>Aca	p.P393T		NM_016441.2	NP_057525.1	Q9NZV1	CRIM1_HUMAN	cysteine rich transmembrane BMP regulator 1 (chordin-like)	393					insulin-like growth factor receptor signaling pathway (GO:0048009)|nervous system development (GO:0007399)|regulation of cell growth (GO:0001558)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	insulin-like growth factor-activated receptor activity (GO:0005010)|PDZ domain binding (GO:0030165)|serine-type endopeptidase inhibitor activity (GO:0004867)			autonomic_ganglia(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(15)|liver(2)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	45		all_hematologic(82;0.131)|Acute lymphoblastic leukemia(82;0.154)				TCATTTAGATCCAGTGTATCC	0.478																																					p.P393T		.											.	CRIM1-118	0			c.C1177A						.						85.0	75.0	78.0					2																	36706642		2203	4300	6503	SO:0001583	missense	51232	exon7			TTAGATCCAGTGT	AF168681	CCDS1783.1	2p21	2010-06-29	2005-07-25		ENSG00000150938	ENSG00000150938			2359	protein-coding gene	gene with protein product		606189	"""cysteine-rich motor neuron 1"""	S52		10642437	Standard	NM_016441		Approved		uc002rpd.3	Q9NZV1	OTTHUMG00000099419	ENST00000280527.2:c.1177C>A	2.37:g.36706642C>A	ENSP00000280527:p.Pro393Thr	Somatic	46	1		WXS	Illumina GAIIx	Phase_I	111	15	NM_016441	0	0	0	0	0	Q2M2G4|Q59GH0|Q7LCQ5|Q9H318	Missense_Mutation	SNP	ENST00000280527.2	37	CCDS1783.1	.	.	.	.	.	.	.	.	.	.	C	17.58	3.424541	0.62733	.	.	ENSG00000150938	ENST00000280527	T	0.63417	-0.04	5.34	5.34	0.76211	.	0.118028	0.64402	D	0.000020	T	0.57140	0.2033	L	0.59436	1.845	0.58432	D	0.999999	P	0.40431	0.717	B	0.35813	0.211	T	0.56171	-0.8023	10	0.15952	T	0.53	-7.9119	18.4035	0.90525	0.0:1.0:0.0:0.0	.	393	Q9NZV1	CRIM1_HUMAN	T	393	ENSP00000280527:P393T	ENSP00000280527:P393T	P	+	1	0	CRIM1	36560146	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	3.958000	0.56737	2.664000	0.90586	0.650000	0.86243	CCA	.		0.478	CRIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216878.2	NM_016441	
CCDC88A	55704	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	55566683	55566683	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr2:55566683G>C	ENST00000436346.1	-	13	2276	c.1435C>G	c.(1435-1437)Ctt>Gtt	p.L479V	AC012358.8_ENST00000594078.1_RNA|CCDC88A_ENST00000336838.6_Missense_Mutation_p.L479V|CCDC88A_ENST00000263630.8_Missense_Mutation_p.L479V|CCDC88A_ENST00000413716.2_Missense_Mutation_p.L479V|AC012358.8_ENST00000608103.1_RNA|AC012358.8_ENST00000600219.1_RNA|AC012358.8_ENST00000599352.1_RNA|AC012358.8_ENST00000599475.1_RNA	NM_001135597.1|NM_001254943.1	NP_001129069.1|NP_001241872.1	Q3V6T2	GRDN_HUMAN	coiled-coil domain containing 88A	479					activation of protein kinase B activity (GO:0032148)|cell migration (GO:0016477)|DNA replication (GO:0006260)|lamellipodium assembly (GO:0030032)|membrane organization (GO:0061024)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell proliferation (GO:0042127)|regulation of DNA replication (GO:0006275)|regulation of neuron projection development (GO:0010975)|regulation of protein phosphorylation (GO:0001932)|TOR signaling (GO:0031929)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|membrane (GO:0016020)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|microtubule binding (GO:0008017)|phosphatidylinositol binding (GO:0035091)|protein homodimerization activity (GO:0042803)|protein kinase B binding (GO:0043422)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(22)|lung(23)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	69						GTAGTCCGAAGCTCTTCTACG	0.378																																					p.L479V		.											.	CCDC88A-94	0			c.C1435G						.						110.0	106.0	108.0					2																	55566683		2203	4300	6503	SO:0001583	missense	55704	exon13			TCCGAAGCTCTTC	AB033038, AF112218	CCDS33203.1, CCDS46288.1, CCDS58710.1	2p16.3	2013-03-13	2007-05-31	2007-05-31	ENSG00000115355	ENSG00000115355			25523	protein-coding gene	gene with protein product	"""Galpha-interacting vesicle-associated protein"", ""Akt-phosphorylation enhancer"", ""girdin"", ""girders of actin filaments"""	609736	"""KIAA1212"""	KIAA1212		15749703, 15753085	Standard	NM_001135597		Approved	FLJ10392, APE, GIV, HkRP1, GRDN	uc002ryv.2	Q3V6T2	OTTHUMG00000151915	ENST00000436346.1:c.1435C>G	2.37:g.55566683G>C	ENSP00000410608:p.Leu479Val	Somatic	38	0		WXS	Illumina GAIIx	Phase_I	53	13	NM_018084	0	0	0	0	0	A1IGE7|B7ZM78|C9JG83|Q53SF1|Q581G3|Q5HYD0|Q7Z339|Q7Z3C5	Missense_Mutation	SNP	ENST00000436346.1	37		.	.	.	.	.	.	.	.	.	.	G	18.04	3.533618	0.64972	.	.	ENSG00000115355	ENST00000336838;ENST00000263630;ENST00000436346;ENST00000413716	T;T;T;T	0.16743	2.32;2.32;2.32;2.32	5.14	5.14	0.70334	.	0.000000	0.42548	U	0.000682	T	0.42653	0.1212	M	0.66939	2.045	0.80722	D	1	P;D;D	0.76494	0.581;0.999;0.999	B;D;D	0.87578	0.341;0.998;0.998	T	0.26538	-1.0100	10	0.52906	T	0.07	-6.7725	18.6018	0.91250	0.0:0.0:1.0:0.0	.	479;479;479	B7ZM78;Q3V6T2-2;Q3V6T2-3	.;.;.	V	479	ENSP00000338728:L479V;ENSP00000263630:L479V;ENSP00000410608:L479V;ENSP00000404431:L479V	ENSP00000263630:L479V	L	-	1	0	CCDC88A	55420187	1.000000	0.71417	1.000000	0.80357	0.758000	0.43043	6.444000	0.73452	2.385000	0.81259	0.585000	0.79938	CTT	.		0.378	CCDC88A-203	KNOWN	basic	protein_coding	protein_coding		NM_017571	
SOWAHC	65124	hgsc.bcm.edu	37	2	110372192	110372192	+	Silent	SNP	A	A	G	rs6594048		TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr2:110372192A>G	ENST00000356454.3	+	1	282	c.126A>G	c.(124-126)ctA>ctG	p.L42L	SEPT10_ENST00000545389.1_5'Flank|SEPT10_ENST00000415095.1_5'Flank|SEPT10_ENST00000437928.1_5'Flank|SEPT10_ENST00000397712.2_5'Flank|SEPT10_ENST00000397714.2_5'Flank|SEPT10_ENST00000356688.4_5'Flank|SEPT10_ENST00000334001.6_5'Flank	NM_023016.3	NP_075392.2	Q53LP3	SWAHC_HUMAN	sosondowah ankyrin repeat domain family member C	42																	GGGGCGCCCTAGGCGGCGAAC	0.771													G|||	5008	1.0	1.0	1.0	5008	,	,		6158	1.0		1.0	False		,,,				2504	1.0				p.L42L		.											.	.	0			c.A126G						.						1.0	2.0	2.0					2																	110372192		1239	2477	3716	SO:0001819	synonymous_variant	65124	exon1			CGCCCTAGGCGGC	AK023346	CCDS33270.1	2q13	2013-01-10	2012-01-12	2012-01-12	ENSG00000198142	ENSG00000198142		"""Ankyrin repeat domain containing"""	26149	protein-coding gene	gene with protein product			"""ankyrin repeat domain 57"""	C2orf26, ANKRD57		22234889	Standard	NM_023016		Approved	FLJ21870	uc002tfb.3	Q53LP3	OTTHUMG00000153219	ENST00000356454.3:c.126A>G	2.37:g.110372192A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	12	11	NM_023016	0	0	0	0	0	Q8NE15|Q9H6U1	Silent	SNP	ENST00000356454.3	37	CCDS33270.1																																																																																			A|0.029;G|0.971		0.771	SOWAHC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330168.1	NM_023016	
ARHGAP15	55843	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	144381828	144381828	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr2:144381828A>G	ENST00000295095.6	+	12	1297	c.1130A>G	c.(1129-1131)gAa>gGa	p.E377G		NM_018460.3	NP_060930.3	Q53QZ3	RHG15_HUMAN	Rho GTPase activating protein 15	377	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				positive regulation of Rac GTPase activity (GO:0032855)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)			endometrium(1)|kidney(5)|large_intestine(8)|liver(2)|lung(15)|ovary(1)|skin(2)	34				BRCA - Breast invasive adenocarcinoma(221;0.151)		CAGTTTGTGGAAGCGATCAGT	0.428																																					p.E377G		.											.	ARHGAP15-653	0			c.A1130G						.						78.0	72.0	74.0					2																	144381828		2203	4300	6503	SO:0001583	missense	55843	exon12			TTGTGGAAGCGAT	AY219338	CCDS2184.1	2q22.2-q22.3	2013-01-10			ENSG00000075884	ENSG00000075884		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	21030	protein-coding gene	gene with protein product		610578				12650940, 11042152	Standard	NM_018460		Approved	BM046	uc002tvm.4	Q53QZ3	OTTHUMG00000131845	ENST00000295095.6:c.1130A>G	2.37:g.144381828A>G	ENSP00000295095:p.Glu377Gly	Somatic	73	0		WXS	Illumina GAIIx	Phase_I	118	13	NM_018460	0	0	0	0	0	Q53R36|Q53RD7|Q53RT6|Q53SX9|Q584N9|Q6PJE6|Q86WP1|Q8IXX1|Q9NRL8|Q9NZ77|Q9NZ91	Missense_Mutation	SNP	ENST00000295095.6	37	CCDS2184.1	.	.	.	.	.	.	.	.	.	.	A	17.02	3.280673	0.59758	.	.	ENSG00000075884	ENST00000295095	T	0.21191	2.02	6.16	6.16	0.99307	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.108918	0.64402	D	0.000008	T	0.30198	0.0757	M	0.67517	2.055	0.58432	D	0.999995	B	0.21452	0.056	B	0.32149	0.141	T	0.03739	-1.1008	10	0.30078	T	0.28	.	16.8061	0.85666	1.0:0.0:0.0:0.0	.	377	Q53QZ3	RHG15_HUMAN	G	377	ENSP00000295095:E377G	ENSP00000295095:E377G	E	+	2	0	ARHGAP15	144098298	1.000000	0.71417	0.998000	0.56505	0.985000	0.73830	5.224000	0.65288	2.367000	0.80283	0.528000	0.53228	GAA	.		0.428	ARHGAP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254793.2	NM_018460	
RESP18	389075	broad.mit.edu	37	2	220197321	220197321	+	Missense_Mutation	SNP	C	C	T	rs2385405	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr2:220197321C>T	ENST00000333527.5	-	2	156	c.157G>A	c.(157-159)Gag>Aag	p.E53K	RESP18_ENST00000392083.1_5'UTR	NM_001007089.3	NP_001007090.3	Q5W5W9	RES18_HUMAN	regulated endocrine-specific protein 18	11					in utero embryonic development (GO:0001701)	extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|perikaryon (GO:0043204)|rough endoplasmic reticulum lumen (GO:0048237)|secretory granule (GO:0030141)				endometrium(1)|prostate(1)	2						TGGAGCCCCTCGGAGCTCCCA	0.692													C|||	2321	0.463458	0.91	0.3285	5008	,	,		13722	0.1845		0.2763	False		,,,				2504	0.4356				p.E53K		.											.	RESP18-90	0			c.G157A						.	C	LYS/GLU	1095,289		445,205,42	13.0	20.0	18.0		157	-3.8	0.0	2	dbSNP_100	18	867,2297		126,615,841	yes	missense	RESP18	NM_001007089.3	56	571,820,883	TT,TC,CC		27.402,20.8815,43.1398	benign	53/229	220197321	1962,2586	692	1582	2274	SO:0001583	missense	389075	exon2			GCCCCTCGGAGCT	AF437883	CCDS33382.2	2q35	2012-12-07	2012-12-07		ENSG00000182698	ENSG00000182698			33762	protein-coding gene	gene with protein product		612721	"""regulated endocrine-specific protein 18 homolog (rat)"""			17951542, 7988462	Standard	NM_001007089		Approved		uc002vlc.4	Q5W5W9	OTTHUMG00000150223	ENST00000333527.5:c.157G>A	2.37:g.220197321C>T	ENSP00000330269:p.Glu53Lys	Somatic	71	0		WXS	Illumina GAIIx	Phase_I	232	6	NM_001007089	0	0	0	0	0	A8MQ49|Q38I23|Q5W5X0	Missense_Mutation	SNP	ENST00000333527.5	37	CCDS33382.2	874	0.4001831501831502	436	0.8861788617886179	147	0.40607734806629836	101	0.17657342657342656	190	0.25065963060686014	C	4.800	0.148690	0.09134	0.791185	0.27402	ENSG00000182698	ENST00000333527	.	.	.	4.22	-3.82	0.04281	.	0.925255	0.08882	N	0.879916	T	0.00012	0.0000	N	0.22421	0.69	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.35025	-0.9805	8	0.15499	T	0.54	.	0.239	0.00190	0.2494:0.2112:0.2723:0.2672	rs2385405;rs2385405	53	Q5W5W9-2	.	K	53	.	ENSP00000330269:E53K	E	-	1	0	RESP18	219905565	0.002000	0.14202	0.000000	0.03702	0.000000	0.00434	0.038000	0.13862	-0.596000	0.05821	-2.788000	0.00116	GAG	C|0.554;T|0.446		0.692	RESP18-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316885.1	NM_001007089	
ZCCHC3	85364	hgsc.bcm.edu	37	20	278515	278515	+	Silent	SNP	T	T	C	rs2223665	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr20:278515T>C	ENST00000382352.3	+	1	779	c.288T>C	c.(286-288)gaT>gaC	p.D96D		NM_033089.6	NP_149080	Q9NUD5	ZCHC3_HUMAN	zinc finger, CCHC domain containing 3	96							poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(1)|lung(3)|prostate(2)	8		all_cancers(10;0.000209)|Lung NSC(37;0.0417)|all_lung(30;0.0713)|all_epithelial(17;0.0748)|Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.149)			GCCGCGGGGATCCGAAGGGCC	0.776													C|||	2949	0.588858	0.6974	0.6643	5008	,	,		6571	0.375		0.6064	False		,,,				2504	0.591				p.D96D		.											.	ZCCHC3-90	0			c.T288C						.						1.0	1.0	1.0					20																	278515		303	859	1162	SO:0001819	synonymous_variant	85364	exon1			CGGGGATCCGAAG	AL034548	CCDS42844.1	20p13-p12.2	2014-04-10	2004-07-14	2004-07-14	ENSG00000177764	ENSG00000247315		"""Zinc fingers, CCHC domain containing"""	16230	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 99"""	C20orf99			Standard	NM_033089		Approved	dJ1103G7.7	uc002wdf.3	Q9NUD5	OTTHUMG00000188280	ENST00000382352.3:c.288T>C	20.37:g.278515T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	5	NM_033089	0	0	0	0	0	Q3B7J3|Q6NT79	Silent	SNP	ENST00000382352.3	37	CCDS42844.1																																																																																			T|0.454;C|0.546		0.776	ZCCHC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077447.1		
RSPO4	343637	bcgsc.ca	37	20	944746	944746	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr20:944746G>T	ENST00000217260.4	-	4	523	c.427C>A	c.(427-429)Ccc>Acc	p.P143T	RSPO4_ENST00000400634.2_Intron	NM_001029871.3	NP_001025042.2	Q2I0M5	RSPO4_HUMAN	R-spondin 4	143	TSP type-1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)	heparin binding (GO:0008201)			endometrium(1)|kidney(1)|large_intestine(2)|lung(3)	7						CCGCCCCAGGGACCCAGTTCA	0.642																																					p.P143T		.											.	RSPO4-90	0			c.C427A						.						15.0	17.0	16.0					20																	944746		1899	4104	6003	SO:0001583	missense	343637	exon4			CCCAGGGACCCAG	AK122609	CCDS42845.1, CCDS42846.1	20p13	2014-01-30	2011-06-29	2005-08-08	ENSG00000101282	ENSG00000101282		"""Endogenous ligands"""	16175	protein-coding gene	gene with protein product		610573	"""chromosome 20 open reading frame 182"", ""R-spondin family, member 4"""	C20orf182		15469841	Standard	NM_001029871		Approved	dJ824F16.3	uc002wej.3	Q2I0M5	OTTHUMG00000031651	ENST00000217260.4:c.427C>A	20.37:g.944746G>T	ENSP00000217260:p.Pro143Thr	Somatic	60	0		WXS	Illumina GAIIx	Phase_I	53	4	NM_001029871	0	0	0	0	0	A2A2I6|Q9UGB2	Missense_Mutation	SNP	ENST00000217260.4	37	CCDS42846.1	.	.	.	.	.	.	.	.	.	.	G	8.423	0.846872	0.17034	.	.	ENSG00000101282	ENST00000217260	T	0.76060	-0.99	3.95	1.91	0.25777	Growth factor, receptor (1);	0.640697	0.14929	N	0.290205	T	0.70037	0.3178	L	0.46157	1.445	0.80722	D	1	P	0.51351	0.944	P	0.47981	0.563	T	0.67296	-0.5706	10	0.62326	D	0.03	-24.5518	7.8519	0.29459	0.094:0.1637:0.7422:0.0	.	143	Q2I0M5	RSPO4_HUMAN	T	143	ENSP00000217260:P143T	ENSP00000217260:P143T	P	-	1	0	RSPO4	892746	1.000000	0.71417	0.972000	0.41901	0.048000	0.14542	3.609000	0.54117	0.427000	0.26145	0.449000	0.29647	CCC	.		0.642	RSPO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077492.3	XM_297816	
ADAM33	80332	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	3652895	3652895	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr20:3652895A>G	ENST00000356518.2	-	14	1724	c.1483T>C	c.(1483-1485)Tgt>Cgt	p.C495R	ADAM33_ENST00000350009.2_Missense_Mutation_p.C495R|ADAM33_ENST00000466620.1_5'UTR|ADAM33_ENST00000379861.4_Missense_Mutation_p.C495R	NM_025220.2	NP_079496.1	Q9BZ11	ADA33_HUMAN	ADAM metallopeptidase domain 33	495	Disintegrin. {ECO:0000255|PROSITE- ProRule:PRU00068}.				proteolysis (GO:0006508)	integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|skin(3)	29						TCTGGGGGACAGTGGGAGGAG	0.662																																					p.C495R		.											.	ADAM33-291	0			c.T1483C						.						71.0	70.0	70.0					20																	3652895		2203	4300	6503	SO:0001583	missense	80332	exon14			GGGGACAGTGGGA	AL117415, AB055891	CCDS13058.1, CCDS63219.1	20p13	2010-04-06	2005-08-18		ENSG00000149451	ENSG00000149451		"""ADAM metallopeptidase domain containing"""	15478	protein-coding gene	gene with protein product		607114	"""a disintegrin and metalloproteinase domain 33"", ""chromosome 20 open reading frame 153"""	C20orf153		11814695	Standard	XM_005260843		Approved	DKFZp434K0521, dJ964F7.1	uc002wit.3	Q9BZ11	OTTHUMG00000031758	ENST00000356518.2:c.1483T>C	20.37:g.3652895A>G	ENSP00000348912:p.Cys495Arg	Somatic	142	0		WXS	Illumina GAIIx	Phase_I	166	39	NM_025220	0	0	0	0	0	A0A1K6|Q5JT75|Q5JT76|Q8N0W6	Missense_Mutation	SNP	ENST00000356518.2	37	CCDS13058.1	.	.	.	.	.	.	.	.	.	.	a	14.50	2.552935	0.45487	.	.	ENSG00000149451	ENST00000356518;ENST00000379861;ENST00000350009;ENST00000439201	T;T;T	0.71461	-0.57;-0.57;-0.57	4.54	4.54	0.55810	Blood coagulation inhibitor, Disintegrin (6);	.	.	.	.	D	0.91181	0.7222	H	0.99811	4.8	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.94291	0.7528	9	0.87932	D	0	.	12.8434	0.57815	1.0:0.0:0.0:0.0	.	495;495;495	Q9BZ11-2;Q9BZ11;A2A2L3	.;ADA33_HUMAN;.	R	495;495;495;375	ENSP00000348912:C495R;ENSP00000369190:C495R;ENSP00000322550:C495R	ENSP00000322550:C495R	C	-	1	0	ADAM33	3600895	1.000000	0.71417	0.843000	0.33291	0.099000	0.18886	8.982000	0.93471	1.910000	0.55303	0.375000	0.23000	TGT	.		0.662	ADAM33-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000077763.2	NM_025220	
ADAM33	80332	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	3652900	3652900	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr20:3652900G>C	ENST00000356518.2	-	14	1719	c.1478C>G	c.(1477-1479)tCc>tGc	p.S493C	ADAM33_ENST00000350009.2_Missense_Mutation_p.S493C|ADAM33_ENST00000466620.1_5'UTR|ADAM33_ENST00000379861.4_Missense_Mutation_p.S493C	NM_025220.2	NP_079496.1	Q9BZ11	ADA33_HUMAN	ADAM metallopeptidase domain 33	493	Disintegrin. {ECO:0000255|PROSITE- ProRule:PRU00068}.				proteolysis (GO:0006508)	integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|skin(3)	29						GGGACAGTGGGAGGAGGTGCC	0.667																																					p.S493C		.											.	ADAM33-291	0			c.C1478G						.						72.0	70.0	71.0					20																	3652900		2203	4300	6503	SO:0001583	missense	80332	exon14			CAGTGGGAGGAGG	AL117415, AB055891	CCDS13058.1, CCDS63219.1	20p13	2010-04-06	2005-08-18		ENSG00000149451	ENSG00000149451		"""ADAM metallopeptidase domain containing"""	15478	protein-coding gene	gene with protein product		607114	"""a disintegrin and metalloproteinase domain 33"", ""chromosome 20 open reading frame 153"""	C20orf153		11814695	Standard	XM_005260843		Approved	DKFZp434K0521, dJ964F7.1	uc002wit.3	Q9BZ11	OTTHUMG00000031758	ENST00000356518.2:c.1478C>G	20.37:g.3652900G>C	ENSP00000348912:p.Ser493Cys	Somatic	145	0		WXS	Illumina GAIIx	Phase_I	168	37	NM_025220	0	0	0	0	0	A0A1K6|Q5JT75|Q5JT76|Q8N0W6	Missense_Mutation	SNP	ENST00000356518.2	37	CCDS13058.1	.	.	.	.	.	.	.	.	.	.	g	15.26	2.780118	0.49891	.	.	ENSG00000149451	ENST00000356518;ENST00000379861;ENST00000350009;ENST00000439201	T;T;T	0.12255	2.7;2.7;2.7	4.54	4.54	0.55810	Blood coagulation inhibitor, Disintegrin (6);	.	.	.	.	T	0.22003	0.0530	L	0.37561	1.115	0.30551	N	0.765446	P;P;P	0.52061	0.939;0.95;0.95	P;P;P	0.52758	0.584;0.708;0.708	T	0.02539	-1.1144	9	0.87932	D	0	.	16.016	0.80441	0.0:0.0:1.0:0.0	.	493;493;493	Q9BZ11-2;Q9BZ11;A2A2L3	.;ADA33_HUMAN;.	C	493;493;493;373	ENSP00000348912:S493C;ENSP00000369190:S493C;ENSP00000322550:S493C	ENSP00000322550:S493C	S	-	2	0	ADAM33	3600900	0.999000	0.42202	0.276000	0.24689	0.042000	0.13812	4.551000	0.60740	2.357000	0.79964	0.457000	0.33378	TCC	.		0.667	ADAM33-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000077763.2	NM_025220	
RBM39	9584	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	34300947	34300947	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr20:34300947C>A	ENST00000253363.6	-	12	1191	c.1168G>T	c.(1168-1170)Gtg>Ttg	p.V390L	RBM39_ENST00000528062.3_Missense_Mutation_p.V368L|RBM39_ENST00000407261.4_Missense_Mutation_p.V233L|RBM39_ENST00000361162.6_Missense_Mutation_p.V390L			Q14498	RBM39_HUMAN	RNA binding motif protein 39	390	Interaction with ESR1 and ESR2. {ECO:0000250}.|Interaction with JUN. {ECO:0000250}.				mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	microtubule cytoskeleton (GO:0015630)|microtubule organizing center (GO:0005815)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35	all_epithelial(2;0.00295)|Lung NSC(9;0.00453)|Breast(12;0.00544)|all_lung(11;0.00676)					CTACCTGCCACAGCACCAAAT	0.363																																					p.V390L		.											.	RBM39-91	0			c.G1168T						.						52.0	50.0	51.0					20																	34300947		2203	4300	6503	SO:0001583	missense	9584	exon12			CTGCCACAGCACC	L10910	CCDS13265.1, CCDS13266.1, CCDS56186.1	20q11.22	2014-07-03	2006-07-11	2006-07-11	ENSG00000131051	ENSG00000131051		"""RNA binding motif (RRM) containing"""	15923	protein-coding gene	gene with protein product	"""coactivator of activating protein-1 and estrogen receptors"", ""functional spliceosome-associated protein 59"""	604739	"""RNA-binding region (RNP1, RRM) containing 2"""	RNPC2		8227358, 15694343, 21551269	Standard	NM_184234		Approved	CC1.3, HCC1, CAPER, fSAP59, CAPERalpha	uc002xeb.3	Q14498	OTTHUMG00000032358	ENST00000253363.6:c.1168G>T	20.37:g.34300947C>A	ENSP00000253363:p.Val390Leu	Somatic	29	0		WXS	Illumina GAIIx	Phase_I	25	9	NM_184234	0	0	0	0	0	A2RRD3|A5D8W2|B0BLV3|E1P5S0|E1P5S1|Q14499	Missense_Mutation	SNP	ENST00000253363.6	37	CCDS13266.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	7.360|7.360	0.624647|0.624647	0.14193|0.14193	.|.	.|.	ENSG00000131051|ENSG00000131051	ENST00000448303|ENST00000253363;ENST00000361162;ENST00000528062;ENST00000407261	.|T;T;T;T	.|0.41065	.|1.01;2.15;1.01;1.01	5.71|5.71	4.76|4.76	0.60689|0.60689	.|.	.|0.167041	.|0.53938	.|D	.|0.000050	T|T	0.27419|0.27419	0.0673|0.0673	N|N	0.25201|0.25201	0.72|0.72	0.41436|0.41436	D|D	0.987892|0.987892	.|B;B;B;B;B	.|0.11235	.|0.004;0.004;0.001;0.001;0.001	.|B;B;B;B;B	.|0.11329	.|0.004;0.004;0.006;0.002;0.002	T|T	0.06899|0.06899	-1.0801|-1.0801	5|10	.|0.07325	.|T	.|0.83	.|.	15.0982|15.0982	0.72253|0.72253	0.0:0.9309:0.0:0.0691|0.0:0.9309:0.0:0.0691	.|.	.|368;368;390;390;366	.|B4DRA0;A2RRD3;Q14498-2;Q14498;B3KWX7	.|.;.;.;RBM39_HUMAN;.	F|L	240|390;390;368;233	.|ENSP00000253363:V390L;ENSP00000354437:V390L;ENSP00000436747:V368L;ENSP00000384541:V233L	.|ENSP00000253363:V390L	C|V	-|-	2|1	0|0	RBM39|RBM39	33764361|33764361	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	4.437000|4.437000	0.59955|0.59955	2.706000|2.706000	0.92434|0.92434	0.650000|0.650000	0.86243|0.86243	TGT|GTG	.		0.363	RBM39-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000078931.2	NM_184237	
SOGA1	140710	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	35422018	35422020	+	In_Frame_Del	DEL	GTT	GTT	-			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	GTT	GTT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr20:35422018_35422020delGTT	ENST00000357779.3	-	14	4077_4079	c.3751_3753delAAC	c.(3751-3753)aacdel	p.N1251del	SOGA1_ENST00000456801.2_In_Frame_Del_p.N1092del|SOGA1_ENST00000237536.4_In_Frame_Del_p.N1489del|SOGA1_ENST00000279034.6_Intron			O94964	SOGA1_HUMAN	suppressor of glucose, autophagy associated 1	1251					insulin receptor signaling pathway (GO:0008286)|negative regulation of gluconeogenesis (GO:0045721)|regulation of autophagy (GO:0010506)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				endometrium(5)|kidney(1)|lung(21)|urinary_tract(1)	28						AGAGTCCATCGTTGATGTTTCTC	0.626																																					p.1489_1489del		.											.	.	0			c.4465_4467del						.																																			SO:0001651	inframe_deletion	140710	exon14			TCCATCGTTGATG	AK126630	CCDS46598.1, CCDS54459.1	20q11.23	2012-03-01	2012-02-27	2012-02-27	ENSG00000149639	ENSG00000149639			16111	protein-coding gene	gene with protein product	"""suppressor of glucose by autophagy"", ""suppressor of glucose from autophagy"""		"""chromosome 20 open reading frame 117"", ""KIAA0889"""	C20orf117, KIAA0889		20813965	Standard	NM_080627		Approved	dJ132F21.1, FLJ44670, SOGA	uc021wcx.1	O94964	OTTHUMG00000032395	ENST00000357779.3:c.3751_3753delAAC	20.37:g.35422018_35422020delGTT	ENSP00000350424:p.Asn1251del	Somatic	80	0		WXS	Illumina GAIIx	Phase_I	68	13	NM_080627	0	0	0	0	0	A6NK10|Q14DB2|Q5JW51|Q6ZTG8	In_Frame_Del	DEL	ENST00000357779.3	37																																																																																				.		0.626	SOGA1-201	KNOWN	basic	protein_coding	protein_coding		NM_199181	
TGM2	7052	broad.mit.edu;bcgsc.ca	37	20	36760743	36760743	+	Splice_Site	SNP	C	C	T	rs150712844		TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr20:36760743C>T	ENST00000361475.2	-	11	1948	c.1775G>A	c.(1774-1776)cGg>cAg	p.R592Q	TGM2_ENST00000536724.1_Splice_Site_p.R532Q|TGM2_ENST00000536701.1_Splice_Site_p.R511Q	NM_004613.2|NM_198951.1	NP_004604.2|NP_945189.1	P21980	TGM2_HUMAN	transglutaminase 2	592					apoptotic cell clearance (GO:0043277)|blood vessel remodeling (GO:0001974)|branching involved in salivary gland morphogenesis (GO:0060445)|isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine (GO:0018153)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein homooligomerization (GO:0051260)|salivary gland cavitation (GO:0060662)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			endometrium(2)|large_intestine(11)|liver(1)|lung(7)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Myeloproliferative disorder(115;0.00878)			L-Glutamine(DB00130)	TGCCCTTACCCGGATCTTGAT	0.622																																					p.R592Q		.											.	TGM2-155	0			c.G1775A						.	C	GLN/ARG	3,4403	6.2+/-15.9	0,3,2200	75.0	78.0	77.0		1775	4.6	1.0	20	dbSNP_134	77	0,8600		0,0,4300	no	missense-near-splice	TGM2	NM_004613.2	43	0,3,6500	TT,TC,CC		0.0,0.0681,0.0231	possibly-damaging	592/688	36760743	3,13003	2203	4300	6503	SO:0001630	splice_region_variant	7052	exon11			CTTACCCGGATCT	M98478	CCDS13302.1	20q12	2013-05-02	2013-05-02		ENSG00000198959	ENSG00000198959	2.3.2.13	"""Transglutaminases"""	11778	protein-coding gene	gene with protein product	"""C polypeptide, protein-glutamine-gamma-glutamyltransferase"""	190196	"""transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase)"""			7912692, 11390390	Standard	NM_004613		Approved	TGC	uc002xhr.3	P21980	OTTHUMG00000032437	ENST00000361475.2:c.1776+1G>A	20.37:g.36760743C>T		Somatic	80	1		WXS	Illumina GAIIx	Phase_I	91	7	NM_004613	0	0	0	0	0	E1P5V9|Q16436|Q6B838|Q9BTN7|Q9UH35	Missense_Mutation	SNP	ENST00000361475.2	37	CCDS13302.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.949459	0.73787	6.81E-4	0.0	ENSG00000198959	ENST00000361475;ENST00000536701;ENST00000536724	T;T;T	0.68181	-0.31;-0.31;-0.31	4.62	4.62	0.57501	Transglutaminase, C-terminal (2);Immunoglobulin-like fold (1);	0.180025	0.46758	N	0.000263	T	0.58090	0.2098	L	0.49778	1.585	0.40923	D	0.984328	D;P;D;P	0.61080	0.986;0.811;0.989;0.811	B;B;B;B	0.42827	0.277;0.133;0.399;0.133	T	0.58142	-0.7688	10	0.25751	T	0.34	-33.6444	10.5332	0.44988	0.0:0.9104:0.0:0.0896	.	532;511;532;592	F5H6P0;B4DIT7;B4DTN7;P21980	.;.;.;TGM2_HUMAN	Q	592;511;532	ENSP00000355330:R592Q;ENSP00000444701:R511Q;ENSP00000437479:R532Q	ENSP00000355330:R592Q	R	-	2	0	TGM2	36194157	1.000000	0.71417	1.000000	0.80357	0.593000	0.36681	4.025000	0.57225	2.287000	0.76781	0.549000	0.68633	CGG	C|1.000;T|0.000		0.622	TGM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079151.2	NM_198951	Missense_Mutation
MAFB	9935	hgsc.bcm.edu	37	20	39317483	39317483	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr20:39317483G>T	ENST00000373313.2	-	1	397	c.8C>A	c.(7-9)gCg>gAg	p.A3E	MAFB_ENST00000396967.1_Missense_Mutation_p.A3E	NM_005461.3	NP_005452.2	Q9Y5Q3	MAFB_HUMAN	v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog B	3					brain segmentation (GO:0035284)|inner ear morphogenesis (GO:0042472)|negative regulation of erythrocyte differentiation (GO:0045647)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|respiratory gaseous exchange (GO:0007585)|rhombomere 5 development (GO:0021571)|rhombomere 6 development (GO:0021572)|segment specification (GO:0007379)|sensory organ development (GO:0007423)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			kidney(1)|large_intestine(1)	2		Myeloproliferative disorder(115;0.00878)				GCTCAGCTCCGCGGCCATCGC	0.687			T	IGH@	MM																																p.A3E		.		Dom	yes		20	20q11.2-q13.1	9935	v-maf musculoaponeurotic fibrosarcoma oncogene homolog B (avian)		L	.	MAFB-846	0			c.C8A						.						18.0	21.0	20.0					20																	39317483		2182	4234	6416	SO:0001583	missense	9935	exon1			AGCTCCGCGGCCA	AF134157	CCDS13311.1	20q11.1-q13.1	2013-07-09	2013-07-09	2001-11-30	ENSG00000204103	ENSG00000204103			6408	protein-coding gene	gene with protein product		608968	"""Kreisler (mouse) maf-related leucine zipper homolog"""	KRML		10444328	Standard	NM_005461		Approved		uc002xji.3	Q9Y5Q3	OTTHUMG00000033052	ENST00000373313.2:c.8C>A	20.37:g.39317483G>T	ENSP00000362410:p.Ala3Glu	Somatic	11	0		WXS	Illumina GAIIx	Phase_I	66	4	NM_005461	0	0	0	0	0	B3KNE1|Q9H1F1	Missense_Mutation	SNP	ENST00000373313.2	37	CCDS13311.1	.	.	.	.	.	.	.	.	.	.	g	14.49	2.550257	0.45383	.	.	ENSG00000204103	ENST00000373313;ENST00000396967	D;D	0.97831	-4.56;-4.56	4.24	3.23	0.37069	.	0.757532	0.11913	N	0.517460	D	0.95868	0.8655	L	0.56769	1.78	0.34618	D	0.718341	P	0.35401	0.499	B	0.34138	0.176	D	0.98419	1.0576	10	0.72032	D	0.01	-11.6413	10.9805	0.47490	0.0:0.4158:0.5842:0.0	.	3	Q9Y5Q3	MAFB_HUMAN	E	3	ENSP00000362410:A3E;ENSP00000380167:A3E	ENSP00000362410:A3E	A	-	2	0	MAFB	38750897	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.628000	0.54259	2.207000	0.71202	0.450000	0.29827	GCG	.		0.687	MAFB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080375.2		
DNTTIP1	116092	hgsc.bcm.edu	37	20	44420682	44420682	+	Silent	SNP	T	T	C	rs2664591	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr20:44420682T>C	ENST00000372622.3	+	1	107	c.39T>C	c.(37-39)ccT>ccC	p.P13P	WFDC3_ENST00000481847.1_5'Flank|WFDC3_ENST00000372630.2_5'Flank|WFDC3_ENST00000372632.2_5'Flank|WFDC3_ENST00000243938.4_5'Flank	NM_052951.2	NP_443183.1	Q9H147	TDIF1_HUMAN	deoxynucleotidyltransferase, terminal, interacting protein 1	13						nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)	9		Myeloproliferative disorder(115;0.0122)				CGCGGGGACCTAGCGGGGCCG	0.746													C|||	3358	0.670527	0.6952	0.7968	5008	,	,		12080	0.6458		0.7058	False		,,,				2504	0.5368				p.P13P		.											.	DNTTIP1-91	0			c.T39C						.	C		2483,791		949,585,103	4.0	6.0	5.0		39	1.1	0.9	20	dbSNP_100	5	5222,1736		1983,1256,240	no	coding-synonymous	DNTTIP1	NM_052951.2		2932,1841,343	CC,CT,TT		24.9497,24.16,24.697		13/330	44420682	7705,2527	1637	3479	5116	SO:0001819	synonymous_variant	116092	exon1			GGGACCTAGCGGG	AB035676	CCDS13369.1	20q13.12	2003-09-10	2003-09-10	2003-09-12	ENSG00000101457	ENSG00000101457			16160	protein-coding gene	gene with protein product	"""novel protein similar to synaptotagmin 1 (SYT1, P65) (isoform 1)"", ""TdT binding protein"""	611388	"""chromosome 20 open reading frame 167"""	C20orf167		11473582	Standard	NM_052951		Approved	dJ447F3.4, Tdif1	uc002xpk.3	Q9H147	OTTHUMG00000032610	ENST00000372622.3:c.39T>C	20.37:g.44420682T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_052951	0	0	0	0	0	B2RA18|Q96DE3|Q9BQP2|Q9H148	Silent	SNP	ENST00000372622.3	37	CCDS13369.1																																																																																			T|0.311;C|0.689		0.746	DNTTIP1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079502.1	NM_052951	
ZMYND8	23613	ucsc.edu	37	20	45867852	45867852	+	Missense_Mutation	SNP	A	A	G	rs2275801	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr20:45867852A>G	ENST00000311275.7	-	15	2508	c.2255T>C	c.(2254-2256)gTg>gCg	p.V752A	ZMYND8_ENST00000468376.2_5'UTR|ZMYND8_ENST00000461685.1_Missense_Mutation_p.V772A|ZMYND8_ENST00000446994.2_Missense_Mutation_p.V689A|ZMYND8_ENST00000360911.3_Missense_Mutation_p.V747A|ZMYND8_ENST00000536340.1_Missense_Mutation_p.V779A|ZMYND8_ENST00000471951.2_Missense_Mutation_p.V772A|ZMYND8_ENST00000355972.4_Missense_Mutation_p.V752A|ZMYND8_ENST00000540497.1_Missense_Mutation_p.V700A|ZMYND8_ENST00000262975.4_Missense_Mutation_p.V752A|ZMYND8_ENST00000352431.2_Missense_Mutation_p.V772A|ZMYND8_ENST00000458360.2_Intron|ZMYND8_ENST00000372023.3_Missense_Mutation_p.V747A|ZMYND8_ENST00000396281.4_Missense_Mutation_p.V752A	NM_001281772.1|NM_001281778.1|NM_001281783.1	NP_001268701.1|NP_001268707.1|NP_001268712.1	Q9ULU4	PKCB1_HUMAN	zinc finger, MYND-type containing 8	752			V -> A (in dbSNP:rs2275801). {ECO:0000269|Ref.3}.		negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	repressing transcription factor binding (GO:0070491)|RNA polymerase II transcription corepressor activity (GO:0001106)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(22)|ovary(1)|prostate(3)|skin(2)|urinary_tract(8)	62			Epithelial(1;0.0289)|all cancers(1;0.0962)|OV - Ovarian serous cystadenocarcinoma(1;0.154)			ATGGCTGCCCACCGTCGTGGA	0.572													G|||	1640	0.327476	0.6399	0.1772	5008	,	,		16000	0.247		0.0557	False		,,,				2504	0.3742				p.V772A		.											.	ZMYND8-252	0			c.T2315C						.	G	ALA/VAL,ALA/VAL,ALA/VAL	2358,2048	539.8+/-375.3	632,1094,477	60.0	75.0	70.0		2315,2315,2240	5.4	0.0	20	dbSNP_100	70	570,8030	771.2+/-407.7	27,516,3757	yes	missense,missense,missense	ZMYND8	NM_012408.3,NM_183047.1,NM_183048.1	64,64,64	659,1610,4234	GG,GA,AA		6.6279,46.4821,22.5127	benign,benign,benign	772/1161,772/1189,747/1136	45867852	2928,10078	2203	4300	6503	SO:0001583	missense	23613	exon15			CTGCCCACCGTCG	U48251	CCDS13404.1, CCDS13405.1, CCDS46613.1, CCDS63300.1, CCDS63301.1, CCDS63304.1, CCDS63306.1, CCDS74738.1	20q13.12	2013-01-28	2007-01-29	2007-01-29	ENSG00000101040	ENSG00000101040		"""Zinc fingers, MYND-type"", ""Zinc fingers, PHD-type"""	9397	protein-coding gene	gene with protein product		615713	"""protein kinase C binding protein 1"""	PRKCBP1			Standard	NM_001281769		Approved	RACK7	uc002xtb.1	Q9ULU4	OTTHUMG00000032667	ENST00000311275.7:c.2255T>C	20.37:g.45867852A>G	ENSP00000312237:p.Val752Ala	Somatic	16	3		WXS	Illumina GAIIx	Phase_I	51	15	NM_183047	0	0	0	0	0	B3KVL2|B7Z2A8|B7Z3E0|B7Z680|B7ZM62|E1P5U5|F5H0X3|H7C0U2|J3KPU3|Q13517|Q2HXV1|Q2HXV2|Q2HXV3|Q2HXV4|Q2HXV7|Q2HXV8|Q2HXV9|Q2HXW0|Q2HXW1|Q2HXW2|Q4JJ94|Q4JJ95|Q5TH09|Q5TH11|Q6MZM1|Q8WXC5|Q9H1F3|Q9H1F4|Q9H1F5|Q9H1L8|Q9H1L9|Q9H2G5|Q9NYN3|Q9UIX6	Missense_Mutation	SNP	ENST00000311275.7	37		555	0.2541208791208791	313	0.6361788617886179	60	0.16574585635359115	146	0.25524475524475526	36	0.047493403693931395	G	0.089	-1.169650	0.01660	0.535179	0.066279	ENSG00000101040	ENST00000360911;ENST00000311275;ENST00000262975;ENST00000471951;ENST00000352431;ENST00000396281;ENST00000536340;ENST00000355972;ENST00000446994;ENST00000461685;ENST00000372023;ENST00000540497	T;T;T;T;T;T;T;T;T;T	0.36520	1.25;1.25;1.25;1.25;1.25;1.25;1.25;1.25;1.25;1.25	5.38	5.38	0.77491	.	0.922586	0.09196	N	0.835269	T	0.00012	0.0000	N	0.00621	-1.32	0.58432	P	1.999999999946489E-6	B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.04013	0.001;0.0;0.0;0.0;0.001;0.001;0.0;0.001;0.0;0.001;0.0;0.0;0.0;0.0;0.0;0.0	T	0.44697	-0.9311	9	0.02654	T	1	-18.1125	11.426	0.50012	0.1451:0.0:0.8549:0.0	rs2275801;rs52806673;rs60735070;rs2275801	779;747;747;727;746;772;752;747;772;772;752;689;747;700;700;752	F5H0X3;Q2HXV7;Q2HXV3;Q5TH11;Q5JV90;Q9ULU4-7;Q9ULU4-9;Q9ULU4-14;Q9ULU4-12;Q9ULU4-13;Q9ULU4;B3KVL2;Q2HXV9;Q2HXV1;Q2HXV4;B7Z2A8	.;.;.;.;.;.;.;.;.;.;PKCB1_HUMAN;.;.;.;.;.	A	747;752;753;773;772;752;779;752;689;772;747;700	ENSP00000354166:V747A;ENSP00000312237:V752A;ENSP00000335537:V772A;ENSP00000379577:V752A;ENSP00000439800:V779A;ENSP00000348246:V752A;ENSP00000396725:V689A;ENSP00000418210:V772A;ENSP00000361093:V747A;ENSP00000443086:V700A	ENSP00000262975:V753A	V	-	2	0	ZMYND8	45301259	0.250000	0.23951	0.029000	0.17559	0.155000	0.21991	3.397000	0.52572	1.274000	0.44362	-0.186000	0.12905	GTG	A|0.741;C|0.002		0.572	ZMYND8-007	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000079596.2	NM_183047	
ZBP1	81030	broad.mit.edu	37	20	56188152	56188152	+	Intron	SNP	C	C	A			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr20:56188152C>A	ENST00000371173.3	-	5	848				ZBP1_ENST00000340462.4_Intron|ZBP1_ENST00000343535.4_Intron|ZBP1_ENST00000541799.1_Missense_Mutation_p.G246V|ZBP1_ENST00000538947.1_5'Flank|ZBP1_ENST00000395822.3_Intron	NM_001160417.1|NM_030776.2	NP_001153889.1|NP_110403.2	Q9H171	ZBP1_HUMAN	Z-DNA binding protein 1						innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded RNA adenosine deaminase activity (GO:0003726)|left-handed Z-DNA binding (GO:0003692)|RNA binding (GO:0003723)			large_intestine(11)|lung(8)|ovary(4)|prostate(1)|skin(2)|urinary_tract(1)	27	Lung NSC(12;0.000545)|all_lung(29;0.00195)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;7.87e-13)|Epithelial(14;3.26e-09)|all cancers(14;3.62e-08)			CTACCCTTTGCCCCCACCCAG	0.612																																					p.G246V		.											.	ZBP1-228	0			c.G737T						.						39.0	35.0	37.0					20																	56188152		692	1591	2283	SO:0001627	intron_variant	81030	exon5			CCTTTGCCCCCAC	AJ300575	CCDS13461.1, CCDS54477.1, CCDS54478.1	20q13.31	2009-08-21	2002-07-25	2002-07-26	ENSG00000124256	ENSG00000124256			16176	protein-coding gene	gene with protein product	"""DNA-dependent activator of IRFs"""	606750	"""chromosome 20 open reading frame 183"""	C20orf183		11842111	Standard	NM_030776		Approved	dJ718J7.3, DLM1, DLM-1, DAI	uc002xyo.3	Q9H171	OTTHUMG00000032824	ENST00000371173.3:c.670+66G>T	20.37:g.56188152C>A		Somatic	28	0		WXS	Illumina GAIIx	Phase_I	22	4	NM_001160419	0	0	0	0	0	A2A2F7|B3KVA1|F5GYT1|Q5JY39|Q9BYW4	Missense_Mutation	SNP	ENST00000371173.3	37	CCDS13461.1	.	.	.	.	.	.	.	.	.	.	C	3.549	-0.092052	0.07053	.	.	ENSG00000124256	ENST00000541799	T	0.13657	2.57	2.73	0.703	0.18116	.	.	.	.	.	T	0.12944	0.0314	N	0.08118	0	0.09310	N	1	D	0.61080	0.989	D	0.64877	0.93	T	0.16305	-1.0407	9	0.87932	D	0	.	3.1902	0.06614	0.2606:0.5919:0.0:0.1475	.	246	F5GYT1	.	V	246	ENSP00000440552:G246V	ENSP00000440552:G246V	G	-	2	0	ZBP1	55621558	0.000000	0.05858	0.015000	0.15790	0.087000	0.18053	-0.070000	0.11523	0.224000	0.20940	0.462000	0.41574	GGC	.		0.612	ZBP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079849.1	NM_030776	
LZTR1	8216	broad.mit.edu	37	22	21343966	21344002	+	Splice_Site	DEL	GAGGAGGTGAGGGGCGTGGGGAGCCAGGGCGCAGGTA	GAGGAGGTGAGGGGCGTGGGGAGCCAGGGCGCAGGTA	-	rs138025454|rs4822786|rs372705680|rs544346603|rs7410444|rs398036571|rs541944601|rs550797478|rs59718704	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr22:21343966_21344002delGAGGAGGTGAGGGGCGTGGGGAGCCAGGGCGCAGGTA	ENST00000215739.8	+	7	1005_1010	c.646_651delGAGGAGGTGAGGGGCGTGGGGAGCCAGGGCGCAGGTA	c.(646-651)gaggagdel	p.EE216fs	LZTR1_ENST00000479606.1_3'UTR|LZTR1_ENST00000389355.3_Splice_Site_p.EE197fs	NM_006767.3	NP_006758.2	Q8N653	LZTR1_HUMAN	leucine-zipper-like transcription regulator 1	216					anatomical structure morphogenesis (GO:0009653)|regulation of transcription, DNA-templated (GO:0006355)		sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(13)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)	42	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			CACCTGCTgggaggaggtgaggggcgtggggagccagggcgcaggtagaggaggtga	0.662														897	0.179113	0.1354	0.1859	5008	,	,		20879	0.2907		0.166	False		,,,				2504	0.1319				p.216_217del		.											.	LZTR1-280	0			c.646_651del						.																																			SO:0001630	splice_region_variant	8216	exon7			TGCTGGGAGGAGG	D38496	CCDS33606.1	22q11.21	2013-01-09	2004-12-10		ENSG00000099949	ENSG00000099949		"""BTB/POZ domain containing"""	6742	protein-coding gene	gene with protein product		600574	"""leucine-zipper-like transcriptional regulator 1"""			7633402, 16356934	Standard	NM_006767		Approved	LZTR-1, BTBD29	uc002zto.3	Q8N653	OTTHUMG00000150878	ENST00000215739.8:c.651+1GAGGAGGTGAGGGGCGTGGGGAGCCAGGGCGCAGGTA>-	22.37:g.21343966_21344002delGAGGAGGTGAGGGGCGTGGGGAGCCAGGGCGCAGGTA		Somatic	37	0		WXS	Illumina GAIIx	Phase_I	36	7	NM_006767	0	0	0	0	0	Q14776|Q20WK0	In_Frame_Del	DEL	ENST00000215739.8	37	CCDS33606.1																																																																																			.		0.662	LZTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320387.1	NM_006767	Frame_Shift_Del
HIC2	23119	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	21800327	21800327	+	Silent	SNP	G	G	A			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr22:21800327G>A	ENST00000443632.2	+	2	1515	c.1143G>A	c.(1141-1143)ggG>ggA	p.G381G	HIC2_ENST00000407598.2_Silent_p.G381G|HIC2_ENST00000407464.2_Silent_p.G381G			Q96JB3	HIC2_HUMAN	hypermethylated in cancer 2	381					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			NS(1)|endometrium(4)|large_intestine(1)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	16	Melanoma(16;0.000465)|Ovarian(15;0.00438)|Colorectal(54;0.0968)	Lung SC(17;0.0262)|all_lung(157;0.205)				TGGCTAGTGGGGCTGGCCCTA	0.677																																					p.G381G	NSCLC(23;437 858 2282 27947 40366)	.											.	HIC2-703	0			c.G1143A						.						6.0	8.0	8.0					22																	21800327		2063	4054	6117	SO:0001819	synonymous_variant	23119	exon3			TAGTGGGGCTGGC	AB028943	CCDS13789.1	22q11.21	2013-01-09			ENSG00000169635	ENSG00000169635		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	18595	protein-coding gene	gene with protein product		607712				11554746	Standard	NM_015094		Approved	KIAA1020, HRG22, ZBTB30, ZNF907	uc002zur.4	Q96JB3	OTTHUMG00000150781	ENST00000443632.2:c.1143G>A	22.37:g.21800327G>A		Somatic	21	0		WXS	Illumina GAIIx	Phase_I	19	5	NM_015094	0	0	0	0	0	Q504T6|Q96KR3|Q9NSM9|Q9UPX9	Silent	SNP	ENST00000443632.2	37	CCDS13789.1																																																																																			.		0.677	HIC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320061.2		
CABIN1	23523	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	24487724	24487724	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr22:24487724A>G	ENST00000398319.2	+	24	4098	c.3713A>G	c.(3712-3714)cAc>cGc	p.H1238R	CABIN1_ENST00000405822.2_Missense_Mutation_p.H1188R|CABIN1_ENST00000263119.5_Missense_Mutation_p.H1238R	NM_001199281.1	NP_001186210.1	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1	1238					cell surface receptor signaling pathway (GO:0007166)|chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of catalytic activity (GO:0043086)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)			breast(2)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(13)|liver(1)|lung(18)|ovary(5)|pancreas(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						CACTACCTGCACGAGGAGGCT	0.632																																					p.H1238R		.											.	CABIN1-94	0			c.A3713G						.						75.0	64.0	68.0					22																	24487724		2203	4300	6503	SO:0001583	missense	23523	exon24			ACCTGCACGAGGA	AF072441	CCDS13823.1, CCDS74830.1	22q11.23	2008-09-16			ENSG00000099991	ENSG00000099991			24187	protein-coding gene	gene with protein product		604251				9655484, 9205841	Standard	NM_001199281		Approved	KIAA0330, PPP3IN	uc002zzi.1	Q9Y6J0	OTTHUMG00000150797	ENST00000398319.2:c.3713A>G	22.37:g.24487724A>G	ENSP00000381364:p.His1238Arg	Somatic	211	0		WXS	Illumina GAIIx	Phase_I	195	38	NM_001199281	0	0	0	0	0	G5E9F3|Q6PHY0|Q9Y460	Missense_Mutation	SNP	ENST00000398319.2	37	CCDS13823.1	.	.	.	.	.	.	.	.	.	.	A	17.49	3.402671	0.62288	.	.	ENSG00000099991	ENST00000263119;ENST00000405822;ENST00000398319	T;T;T	0.30182	1.54;1.54;1.54	5.04	5.04	0.67666	Tetratricopeptide-like helical (1);	0.052924	0.85682	D	0.000000	T	0.33990	0.0882	M	0.63843	1.955	0.80722	D	1	B;B	0.18461	0.028;0.016	B;B	0.18561	0.022;0.01	T	0.18650	-1.0330	10	0.72032	D	0.01	.	14.3245	0.66509	1.0:0.0:0.0:0.0	.	1188;1238	G5E9F3;Q9Y6J0	.;CABIN_HUMAN	R	1238;1188;1238	ENSP00000263119:H1238R;ENSP00000384694:H1188R;ENSP00000381364:H1238R	ENSP00000263119:H1238R	H	+	2	0	CABIN1	22817724	1.000000	0.71417	0.977000	0.42913	0.849000	0.48306	9.233000	0.95337	2.048000	0.60808	0.477000	0.44152	CAC	.		0.632	CABIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320161.2	NM_012295	
SEZ6L	23544	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	26707835	26707835	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr22:26707835G>A	ENST00000248933.6	+	8	1878	c.1783G>A	c.(1783-1785)Gac>Aac	p.D595N	SEZ6L_ENST00000402979.1_Missense_Mutation_p.D368N|SEZ6L_ENST00000404234.3_Missense_Mutation_p.D595N|SEZ6L_ENST00000343706.4_Missense_Mutation_p.D595N|SEZ6L_ENST00000360929.3_Missense_Mutation_p.D595N|SEZ6L_ENST00000403121.1_Missense_Mutation_p.D368N|SEZ6L_ENST00000529632.2_Missense_Mutation_p.D595N			Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like	595	Sushi 2. {ECO:0000255|PROSITE- ProRule:PRU00302}.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)				breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(35)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	80						GTTCACCTGCGACCCCGGCCA	0.562																																					p.D595N		.											.	SEZ6L-95	0			c.G1783A						.						158.0	155.0	156.0					22																	26707835		2203	4300	6503	SO:0001583	missense	23544	exon8			ACCTGCGACCCCG	AL050253	CCDS13833.1, CCDS54508.1, CCDS54510.1, CCDS54511.1, CCDS74837.1	22q12.1	2008-05-14	2001-11-28		ENSG00000100095	ENSG00000100095			10763	protein-coding gene	gene with protein product		607021	"""seizure related gene 6 (mouse)-like"""				Standard	NM_021115		Approved		uc003acb.3	Q9BYH1	OTTHUMG00000150870	ENST00000248933.6:c.1783G>A	22.37:g.26707835G>A	ENSP00000248933:p.Asp595Asn	Somatic	172	0		WXS	Illumina GAIIx	Phase_I	118	33	NM_021115	0	0	0	0	0	A0AUW7|B0QYG4|B0QYG5|B7ZLJ6|G8JLP3|O95917|Q5THY5|Q6IBZ4|Q6UXD4|Q9NUI3|Q9NUI4|Q9NUI5|Q9Y2E1|Q9Y3J6	Missense_Mutation	SNP	ENST00000248933.6	37	CCDS13833.1	.	.	.	.	.	.	.	.	.	.	G	19.62	3.860882	0.71834	.	.	ENSG00000100095	ENST00000404234;ENST00000529632;ENST00000360929;ENST00000248933;ENST00000343706;ENST00000403121;ENST00000402979	T;T;T;T;T;T;T	0.66099	-0.19;-0.19;-0.19;-0.19;-0.19;-0.19;-0.19	4.83	4.83	0.62350	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.64402	D	0.000013	T	0.61825	0.2378	N	0.11313	0.125	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;0.992;0.982;0.996;0.994;0.992;0.992	D;P;P;P;P;P;P	0.91635	0.999;0.599;0.514;0.614;0.614;0.599;0.599	T	0.59685	-0.7408	10	0.17369	T	0.5	.	17.0892	0.86618	0.0:0.0:1.0:0.0	.	595;595;368;595;595;595;595	B7ZLJ8;B7ZLJ6;B0QYH4;Q9BYH1-5;Q9BYH1-4;B0QYG3;Q9BYH1	.;.;.;.;.;.;SE6L1_HUMAN	N	595;595;595;595;595;368;368	ENSP00000384772:D595N;ENSP00000437037:D595N;ENSP00000354185:D595N;ENSP00000248933:D595N;ENSP00000342661:D595N;ENSP00000384838:D368N;ENSP00000384733:D368N	ENSP00000248933:D595N	D	+	1	0	SEZ6L	25037835	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.044000	0.71012	2.498000	0.84270	0.563000	0.77884	GAC	.		0.562	SEZ6L-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320359.3		
NEFH	4744	ucsc.edu	37	22	29885594	29885594	+	Silent	SNP	A	A	T	rs79235463|rs200984527|rs267607533	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr22:29885594A>T	ENST00000310624.6	+	4	1998	c.1965A>T	c.(1963-1965)ccA>ccT	p.P655P		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	661	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						CCAAGTCCCCAGAGAAGGAAG	0.552																																					p.P655P		.											.	NEFH-90	0			c.A1965T						.						83.0	92.0	89.0					22																	29885594		2203	4300	6503	SO:0001819	synonymous_variant	4744	exon4			GTCCCCAGAGAAG		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1965A>T	22.37:g.29885594A>T		Somatic	235	1		WXS	Illumina GAIIx	Phase_I	200	60	NM_021076	0	0	0	0	0	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Silent	SNP	ENST00000310624.6	37	CCDS13858.1																																																																																			A|0.500;T|0.500		0.552	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
NEFH	4744	broad.mit.edu	37	22	29885599	29885604	+	In_Frame_Del	DEL	AGGAAG	AGGAAG	-	rs267607534|rs373980795|rs267607533|rs149571560|rs200984527|rs370803228		TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr22:29885599_29885604delAGGAAG	ENST00000310624.6	+	4	2003_2008	c.1970_1975delAGGAAG	c.(1969-1977)aaggaagag>aag	p.EE658del		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	664	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						TCCCCAGAGAAGGAAGAGGCCAAGTC	0.558																																					p.657_659del		.											.	NEFH-90	0			c.1970_1975del						.																																			SO:0001651	inframe_deletion	4744	exon4			CAGAGAAGGAAGA		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1970_1975delAGGAAG	22.37:g.29885599_29885604delAGGAAG	ENSP00000311997:p.Glu658_Glu659del	Somatic	246	0		WXS	Illumina GAIIx	Phase_I	206	30	NM_021076	0	0	0	0	0	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	In_Frame_Del	DEL	ENST00000310624.6	37	CCDS13858.1																																																																																			.		0.558	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
TOM1	10043	ucsc.edu	37	22	35742925	35742925	+	Silent	SNP	T	T	G	rs743810	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr22:35742925T>G	ENST00000449058.2	+	14	1412	c.1287T>G	c.(1285-1287)ggT>ggG	p.G429G	TOM1_ENST00000447733.1_Silent_p.G396G|TOM1_ENST00000436462.2_Silent_p.G391G|TOM1_ENST00000425375.1_Silent_p.G384G|TOM1_ENST00000382034.5_3'UTR|TOM1_ENST00000411850.1_Silent_p.G429G	NM_005488.2	NP_005479.1	O60784	TOM1_HUMAN	target of myb1 (chicken)	429					endocytosis (GO:0006897)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	clathrin binding (GO:0030276)	p.G429G(1)		NS(1)|breast(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(3)|prostate(2)	19						CTTCCCAGGGTAATGATGCGG	0.662													G|||	1757	0.350839	0.6959	0.3458	5008	,	,		14387	0.12		0.2266	False		,,,				2504	0.2536				p.G429G		.											.	TOM1-91	1	Substitution - coding silent(1)	prostate(1)	c.T1287G						.	G	,,,	2618,1788	523.1+/-371.0	783,1052,368	65.0	73.0	70.0		1188,1152,1287,1287	-3.6	0.0	22	dbSNP_86	70	2064,6536	714.8+/-406.0	236,1592,2472	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	TOM1	NM_001135729.1,NM_001135730.1,NM_001135732.1,NM_005488.2	,,,	1019,2644,2840	GG,GT,TT		24.0,40.581,35.9988	,,,	396/461,384/448,429/494,429/493	35742925	4682,8324	2203	4300	6503	SO:0001819	synonymous_variant	10043	exon14			CCAGGGTAATGAT	AJ006973	CCDS13913.1, CCDS46696.1, CCDS46697.1, CCDS46698.1	22q13.1	2011-01-31	2001-11-28		ENSG00000100284	ENSG00000100284			11982	protein-coding gene	gene with protein product		604700	"""target of myb1 (chicken) homolog"""			10329004, 15047686	Standard	NM_005488		Approved		uc003anp.3	O60784	OTTHUMG00000150958	ENST00000449058.2:c.1287T>G	22.37:g.35742925T>G		Somatic	65	3		WXS	Illumina GAIIx	Phase_I	48	5	NM_001135732	0	0	0	0	0	B4DEL9|B4DNA1|Q5TIJ6|Q86X74	Silent	SNP	ENST00000449058.2	37	CCDS13913.1																																																																																			T|0.655;G|0.345		0.662	TOM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000320641.1	NM_005488	
CARD10	29775	hgsc.bcm.edu	37	22	37915145	37915145	+	Silent	SNP	C	C	T	rs79861380	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr22:37915145C>T	ENST00000403299.1	-	2	279	c.63G>A	c.(61-63)gaG>gaA	p.E21E	CARD10_ENST00000251973.5_Silent_p.E21E			Q9BWT7	CAR10_HUMAN	caspase recruitment domain family, member 10	21					activation of NF-kappaB-inducing kinase activity (GO:0007250)|protein complex assembly (GO:0006461)|regulation of apoptotic process (GO:0042981)	CBM complex (GO:0032449)|cytoplasm (GO:0005737)	receptor signaling complex scaffold activity (GO:0030159)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	17	Melanoma(58;0.0574)					cctcctccgcctcagaccccg	0.756													C|||	295	0.0589058	0.1573	0.0548	5008	,	,		9486	0.0		0.0398	False		,,,				2504	0.0092				p.E21E		.											.	CARD10-662	0			c.G63A						.	C		625,3669		33,559,1555	8.0	9.0	9.0		63	3.9	1.0	22	dbSNP_131	9	324,8168		4,316,3926	no	coding-synonymous	CARD10	NM_014550.3		37,875,5481	TT,TC,CC		3.8154,14.5552,7.4222		21/1033	37915145	949,11837	2147	4246	6393	SO:0001819	synonymous_variant	29775	exon1			CTCCGCCTCAGAC	AF086324	CCDS13948.1	22q13.1	2008-05-22			ENSG00000100065	ENSG00000100065			16422	protein-coding gene	gene with protein product		607209				11259443, 11356195	Standard	NM_014550		Approved	CARMA3, BIMP1	uc003asu.1	Q9BWT7	OTTHUMG00000150592	ENST00000403299.1:c.63G>A	22.37:g.37915145C>T		Somatic	4	0		WXS	Illumina GAIIx	Phase_I	42	6	NM_014550	0	0	0	0	0	Q14CQ8|Q5TFG6|Q8NC81|Q9UGR5|Q9UGR6|Q9Y3H0	Silent	SNP	ENST00000403299.1	37	CCDS13948.1																																																																																			C|0.935;T|0.065		0.756	CARD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318997.1	NM_014550	
TRIOBP	11078	hgsc.bcm.edu	37	22	38122462	38122462	+	Missense_Mutation	SNP	A	A	G	rs739138	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr22:38122462A>G	ENST00000406386.3	+	7	4154	c.3899A>G	c.(3898-3900)cAc>cGc	p.H1300R		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	1300			H -> R (in dbSNP:rs739138).		actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					GGCCGCACCCACAGCCCTGGC	0.741													G|||	3010	0.601038	0.1944	0.5836	5008	,	,		13399	0.8859		0.7157	False		,,,				2504	0.7515				p.H1300R		.											.	TRIOBP-136	0			c.A3899G						.	G	ARG/HIS	1221,2235		265,691,772	4.0	6.0	5.0		3899	3.9	1.0	22	dbSNP_86	5	5694,1808		2238,1218,295	yes	missense	TRIOBP	NM_001039141.2	29	2503,1909,1067	GG,GA,AA		24.1002,35.3299,36.8954	benign	1300/2366	38122462	6915,4043	1728	3751	5479	SO:0001583	missense	11078	exon7			GCACCCACAGCCC	AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.3899A>G	22.37:g.38122462A>G	ENSP00000384312:p.His1300Arg	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	9	NM_001039141	0	0	0	0	0	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Missense_Mutation	SNP	ENST00000406386.3	37	CCDS43015.1	1409	0.6451465201465202	110	0.22357723577235772	222	0.6132596685082873	531	0.9283216783216783	546	0.7203166226912929	G	12.86	2.065195	0.36470	0.353299	0.758998	ENSG00000100106	ENST00000406386;ENST00000417174	T	0.11063	2.81	4.93	3.9	0.45041	.	.	.	.	.	T	0.00012	0.0000	N	0.01576	-0.805	0.09310	P	0.999999999370294	B	0.02656	0.0	B	0.01281	0.0	T	0.29671	-1.0004	8	0.02654	T	1	.	4.383	0.11304	0.2555:0.0:0.5874:0.1571	rs739138	1300	Q9H2D6	TARA_HUMAN	R	1300	ENSP00000384312:H1300R	ENSP00000384312:H1300R	H	+	2	0	TRIOBP	36452408	1.000000	0.71417	1.000000	0.80357	0.841000	0.47740	1.338000	0.33873	0.503000	0.28060	-0.366000	0.07423	CAC	A|0.354;G|0.646		0.741	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319439.2		
CPNE9	151835	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	9754512	9754512	+	Splice_Site	SNP	C	C	T	rs190521882		TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr3:9754512C>T	ENST00000383832.3	+	9	735	c.545C>T	c.(544-546)aCg>aTg	p.T182M	CPNE9_ENST00000383831.3_Splice_Site_p.T182M	NM_153635.2	NP_705899.2	Q8IYJ1	CPNE9_HUMAN	copine family member IX	182	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.T182M(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(2)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	16	Medulloblastoma(99;0.227)					GAGGATGGCACGTGAGTCACT	0.517													C|||	1	0.000199681	0.0	0.0	5008	,	,		20689	0.001		0.0	False		,,,				2504	0.0				.		.											.	CPNE9-70	1	Substitution - Missense(1)	endometrium(1)	.						.						81.0	87.0	85.0					3																	9754512		2162	4297	6459	SO:0001630	splice_region_variant	151835	.			ATGGCACGTGAGT		CCDS2574.2	3p25.3	2008-10-30			ENSG00000144550	ENSG00000144550			24336	protein-coding gene	gene with protein product						9430674	Standard	XM_006712990		Approved	KIAA4217	uc003bsd.3	Q8IYJ1	OTTHUMG00000128418	ENST00000383832.3:c.545+1C>T	3.37:g.9754512C>T		Somatic	108	0		WXS	Illumina GAIIx	Phase_I	79	14	.	0	0	0	0	0	A1L430|A6NDX6|A8MSP8	Splice_Site	SNP	ENST00000383832.3	37	CCDS2574.2	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	26.1	4.704831	0.88924	.	.	ENSG00000144550	ENST00000383832;ENST00000383831	T;T	0.40225	1.04;1.04	5.15	5.15	0.70609	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.056128	0.64402	D	0.000001	T	0.51584	0.1683	L	0.35341	1.055	0.80722	D	1	D	0.71674	0.998	P	0.60173	0.87	T	0.52003	-0.8633	10	0.51188	T	0.08	.	18.2451	0.89982	0.0:1.0:0.0:0.0	.	182	Q8IYJ1	CPNE9_HUMAN	M	182	ENSP00000373343:T182M;ENSP00000373342:T182M	ENSP00000373342:T182M	T	+	2	0	CPNE9	9729512	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.048000	0.71046	2.417000	0.82017	0.655000	0.94253	ACG	C|0.999;T|0.000		0.517	CPNE9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250205.4	NM_001033755	Missense_Mutation
PRRT3	285368	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	9991595	9991596	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	TG	TG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr3:9991595_9991596delTG	ENST00000412055.1	-	2	333_334	c.204_205delCA	c.(202-207)gacagtfs	p.DS68fs	PRRT3-AS1_ENST00000431558.1_RNA|PRRT3_ENST00000411976.2_Frame_Shift_Del_p.DS68fs	NM_207351.3	NP_997234.3	Q5FWE3	PRRT3_HUMAN	proline-rich transmembrane protein 3	68						integral component of membrane (GO:0016021)				NS(2)|breast(1)|endometrium(3)|large_intestine(3)|lung(1)|skin(1)|stomach(2)	13						TTCCTGTGACTGTCAGCTCTGG	0.614																																					p.68_69del		.											.	PRRT3-90	0			c.204_205del						.																																			SO:0001589	frameshift_variant	285368	exon2			TGTGACTGTCAGC	AK090993	CCDS43049.1	3p25.3	2011-10-10			ENSG00000163704	ENSG00000163704		"""Proline-rich transmembrane proteins"""	26591	protein-coding gene	gene with protein product							Standard	NM_207351		Approved	FLJ33674	uc003bul.2	Q5FWE3	OTTHUMG00000155285	ENST00000412055.1:c.204_205delCA	3.37:g.9991595_9991596delTG	ENSP00000392511:p.Asp68fs	Somatic	92	0		WXS	Illumina GAIIx	Phase_I	82	14	NM_207351	0	0	0	0	0	Q49AD0|Q6UXY6|Q8NBC9	Frame_Shift_Del	DEL	ENST00000412055.1	37	CCDS43049.1																																																																																			.		0.614	PRRT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339322.1	NM_207351	
STAB1	23166	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	52554031	52554031	+	Silent	SNP	C	C	T	rs145377358		TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr3:52554031C>T	ENST00000321725.6	+	51	5383	c.5307C>T	c.(5305-5307)gcC>gcT	p.A1769A		NM_015136.2	NP_055951.2	Q9NY15	STAB1_HUMAN	stabilin 1	1769	FAS1 6. {ECO:0000255|PROSITE- ProRule:PRU00082, ECO:0000305}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|oxidation-reduction process (GO:0055114)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|protein disulfide oxidoreductase activity (GO:0015035)|scavenger receptor activity (GO:0005044)			breast(4)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(13)|liver(1)|lung(27)|ovary(1)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	76				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		CCACAGACGCCGCCTTTCGAG	0.627																																					p.A1769A		.											.	STAB1-139	0			c.C5307T						.	C		1,4405	2.1+/-5.4	0,1,2202	52.0	54.0	53.0		5307	-11.3	0.0	3	dbSNP_134	53	0,8598		0,0,4299	no	coding-synonymous	STAB1	NM_015136.2		0,1,6501	TT,TC,CC		0.0,0.0227,0.0077		1769/2571	52554031	1,13003	2203	4299	6502	SO:0001819	synonymous_variant	23166	exon51			AGACGCCGCCTTT	AJ275213	CCDS33768.1	3p21.31	2008-07-18			ENSG00000010327	ENSG00000010327			18628	protein-coding gene	gene with protein product	"""MS-1 antigen"", ""fasciclin egf-like, laminin-type egf-like, and link domain-containing scavenger receptor-1"", ""common lymphatic endothelial and vascular endothelial receptor-1"""	608560				11829752, 12077138	Standard	XM_005264973		Approved	KIAA0246, STAB-1, FEEL-1, CLEVER-1, FELE-1, FEX1	uc003dej.3	Q9NY15	OTTHUMG00000158574	ENST00000321725.6:c.5307C>T	3.37:g.52554031C>T		Somatic	162	0		WXS	Illumina GAIIx	Phase_I	149	26	NM_015136	0	0	0	0	0	A7E297|Q8IUH0|Q8IUH1|Q93072	Silent	SNP	ENST00000321725.6	37	CCDS33768.1																																																																																			C|1.000;T|0.000		0.627	STAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351380.2	NM_015136	
DNAH12	201625	bcgsc.ca	37	3	57494915	57494915	+	Missense_Mutation	SNP	G	G	T	rs115576589	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr3:57494915G>T	ENST00000351747.2	-	6	674	c.494C>A	c.(493-495)cCa>cAa	p.P165Q	DNAH12_ENST00000311202.6_Missense_Mutation_p.P165Q|DNAH12_ENST00000389536.4_Missense_Mutation_p.P165Q	NM_178504.4	NP_848599.3	Q6ZR08	DYH12_HUMAN	dynein, axonemal, heavy chain 12	165	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(4)|lung(7)|pancreas(1)|prostate(1)|skin(1)	25						CGATTTAACTGGTGGTTTCAC	0.313													G|||	23	0.00459265	0.0008	0.0115	5008	,	,		17393	0.0		0.0139	False		,,,				2504	0.0				p.P165Q		.											.	DNAH12-47	0			c.C494A						.	G	GLN/PRO,GLN/PRO	12,4394	19.1+/-41.9	0,12,2191	83.0	85.0	84.0		494,494	2.7	0.8	3	dbSNP_132	84	109,8489	59.5+/-121.1	0,109,4190	yes	missense,missense	DNAH12	NM_178504.4,NM_198564.3	76,76	0,121,6381	TT,TG,GG		1.2677,0.2724,0.9305	probably-damaging,probably-damaging	165/3093,165/458	57494915	121,12883	2203	4299	6502	SO:0001583	missense	201625	exon6			TTAACTGGTGGTT	U53532, AK126276	CCDS33771.1	3p21.1	2009-02-04	2006-09-04		ENSG00000174844	ENSG00000174844		"""Axonemal dyneins"""	2943	protein-coding gene	gene with protein product		603340	"""dynein, axonemal, heavy polypeptide 12"", ""dynein heavy chain domain 2"", ""dynein heavy domain 2"", ""dynein, axonemal, heavy chain 12-like"", ""dynein, axonemal, heavy chain 7-like"""	DNHD2, DNAH12L, DNAH7L		8812413, 8666668	Standard	NM_198564		Approved	DLP12, Dnahc3, HL-19, hdhc3, DHC3, FLJ40427, FLJ44290	uc003dit.2	Q6ZR08	OTTHUMG00000158598	ENST00000351747.2:c.494C>A	3.37:g.57494915G>T	ENSP00000295937:p.Pro165Gln	Somatic	270	0		WXS	Illumina GAIIx	Phase_I	170	6	NM_198564	0	0	0	0	0	A6NGI2|Q6ZTR8|Q8N7R9|Q8WXK2|Q92816	Missense_Mutation	SNP	ENST00000351747.2	37		19	0.0086996336996337	1	0.0020325203252032522	6	0.016574585635359115	0	0.0	12	0.0158311345646438	G	7.794	0.712208	0.15306	0.002724	0.012677	ENSG00000174844	ENST00000351747;ENST00000495027;ENST00000389536;ENST00000311202	T;T;T;T	0.20598	2.21;2.06;3.67;3.12	5.68	2.65	0.31530	.	0.476524	0.18836	N	0.129836	T	0.08935	0.0221	L	0.51422	1.61	0.09310	N	1	B;B	0.27559	0.181;0.047	B;B	0.24701	0.055;0.01	T	0.14035	-1.0487	10	0.24483	T	0.36	.	9.9707	0.41752	0.0:0.1115:0.3122:0.5764	.	165;165	Q6ZR08-4;Q6ZR08	.;DYH12_HUMAN	Q	165	ENSP00000295937:P165Q;ENSP00000418137:P165Q;ENSP00000374187:P165Q;ENSP00000312554:P165Q	ENSP00000312554:P165Q	P	-	2	0	DNAH12	57469955	0.055000	0.20627	0.754000	0.31244	0.998000	0.95712	0.763000	0.26517	0.706000	0.31912	0.585000	0.79938	CCA	G|0.990;T|0.010		0.313	DNAH12-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_178504	
PLXNA1	5361	hgsc.bcm.edu	37	3	126733053	126733053	+	Silent	SNP	C	C	T	rs11719489	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr3:126733053C>T	ENST00000393409.2	+	11	2439	c.2439C>T	c.(2437-2439)cgC>cgT	p.R813R	PLXNA1_ENST00000251772.4_Silent_p.R790R	NM_032242.3	NP_115618.3	Q9UIW2	PLXA1_HUMAN	plexin A1	813					axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|multicellular organismal development (GO:0007275)|regulation of smooth muscle cell migration (GO:0014910)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)			breast(3)|central_nervous_system(5)|endometrium(10)|kidney(5)|large_intestine(4)|lung(32)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	67				GBM - Glioblastoma multiforme(114;0.155)		CGGCCCTGCGCGAGAGCTGCG	0.741													C|||	327	0.0652955	0.0809	0.0793	5008	,	,		11902	0.002		0.1402	False		,,,				2504	0.0225				p.R813R		.											.	PLXNA1-93	0			c.C2439T						.			339,4057		23,293,1882	18.0	21.0	20.0		2439	-4.7	0.9	3	dbSNP_120	20	1112,7424		88,936,3244	no	coding-synonymous	PLXNA1	NM_032242.3		111,1229,5126	TT,TC,CC		13.0272,7.7116,11.2202		813/1897	126733053	1451,11481	2198	4268	6466	SO:0001819	synonymous_variant	5361	exon11			CCTGCGCGAGAGC	X87832	CCDS33847.1, CCDS33847.2	3q21.2	2006-12-19				ENSG00000114554		"""Plexins"""	9099	protein-coding gene	gene with protein product		601055		PLXN1		8570614	Standard	NM_032242		Approved	NOV	uc003ejg.3	Q9UIW2		ENST00000393409.2:c.2439C>T	3.37:g.126733053C>T		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	24	11	NM_032242	0	0	0	0	0		Silent	SNP	ENST00000393409.2	37	CCDS33847.2																																																																																			C|0.900;T|0.100		0.741	PLXNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356451.1	NM_032242	
ALG3	10195	hgsc.bcm.edu	37	3	183959508	183959508	+	IGR	SNP	A	A	C	rs28606531	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr3:183959508A>C	ENST00000397676.3	-	0	1528				VWA5B2_ENST00000426955.2_Silent_p.P1137P|VWA5B2_ENST00000273794.5_Silent_p.P919P|MIR1224_ENST00000408193.1_RNA|ALG3_ENST00000463495.1_5'Flank|EIF2B5_ENST00000444495.1_Intron	NM_005787.5	NP_005778.1	Q92685	ALG3_HUMAN	ALG3, alpha-1,3- mannosyltransferase						cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	alpha-1,3-mannosyltransferase activity (GO:0000033)|dol-P-Man:Man(5)GlcNAc(2)-PP-Dol alpha-1,3-mannosyltransferase activity (GO:0052925)			kidney(1)|large_intestine(1)|lung(6)|upper_aerodigestive_tract(1)	9	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			CTGAGGGGCCAGGCCAGGTGG	0.746													A|||	346	0.0690895	0.0204	0.0735	5008	,	,		13734	0.0079		0.1451	False		,,,				2504	0.1166				p.P1137P		.											.	.	0			c.A3411C						.						3.0	4.0	4.0					3																	183959508		597	1420	2017	SO:0001628	intergenic_variant	90113	exon19			GGGGCCAGGCCAG	BC002839	CCDS46967.1, CCDS46968.1	3q27.3	2013-02-26	2013-02-26		ENSG00000214160	ENSG00000214160	2.4.1.258	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	23056	protein-coding gene	gene with protein product	"""carbohydrate deficient glycoprotein syndrome type IV"", ""dol-P-Man:Man(5)GlcNAc(2)-PP-Dol alpha-1,3-mannosyltransferase"", ""dol-P-Man dependent alpha-1,3- mannosyltransferase"""	608750	"""asparagine-linked glycosylation 3 homolog (yeast, alpha-1,3-mannosyltransferase)"", ""asparagine-linked glycosylation 3, alpha-1,3- mannosyltransferase homolog (S. cerevisiae)"""			1058125	Standard	NM_005787		Approved	NOT56L, Not56, CDGS4, D16Ertd36e	uc003fne.2	Q92685	OTTHUMG00000156823		3.37:g.183959508A>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	13	10	NM_138345	0	0	0	0	0	A8JZZ6|Q9BT71	Silent	SNP	ENST00000397676.3	37	CCDS46968.1																																																																																			A|0.927;C|0.073		0.746	ALG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346033.1	NM_005787	
IDUA	3425	broad.mit.edu	37	4	996204	996204	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr4:996204A>C	ENST00000247933.4	+	8	1208	c.1120A>C	c.(1120-1122)Acc>Ccc	p.T374P	IDUA_ENST00000514224.1_Missense_Mutation_p.T242P|IDUA_ENST00000453894.1_Missense_Mutation_p.T396P	NM_000203.3	NP_000194.2	P35475	IDUA_HUMAN	iduronidase, alpha-L-	374					carbohydrate metabolic process (GO:0005975)|cell morphogenesis (GO:0000902)|chemical homeostasis (GO:0048878)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate catabolic process (GO:0030209)|disaccharide metabolic process (GO:0005984)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|limb morphogenesis (GO:0035108)|lysosome organization (GO:0007040)|skeletal system morphogenesis (GO:0048705)|small molecule metabolic process (GO:0044281)	coated vesicle (GO:0030135)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	L-iduronidase activity (GO:0003940)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	12			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			GGTCAACAACACCCGCCCGCC	0.711																																					p.T374P		.											.	IDUA-91	0			c.A1120C						.						26.0	28.0	27.0					4																	996204		2185	4282	6467	SO:0001583	missense	3425	exon8			AACAACACCCGCC	M74715	CCDS3343.1	4p16.3	2012-10-02			ENSG00000127415	ENSG00000127415	3.2.1.76		5391	protein-coding gene	gene with protein product		252800				1832239	Standard	NM_000203		Approved	MPS1	uc003gby.3	P35475	OTTHUMG00000088901	ENST00000247933.4:c.1120A>C	4.37:g.996204A>C	ENSP00000247933:p.Thr374Pro	Somatic	72	9		WXS	Illumina GAIIx	Phase_I	203	71	NM_000203	0	0	0	0	0	B3KWK6	Missense_Mutation	SNP	ENST00000247933.4	37	CCDS3343.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.117066	0.77323	.	.	ENSG00000127415	ENST00000247933;ENST00000453894;ENST00000514224	D;D;D	0.94280	-3.39;-3.39;-3.39	5.31	5.31	0.75309	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.156849	0.56097	D	0.000026	D	0.96611	0.8894	M	0.86178	2.8	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.995	D	0.96508	0.9376	10	0.46703	T	0.11	-7.29	13.2474	0.60029	1.0:0.0:0.0:0.0	.	396;374	B3KWK6;P35475	.;IDUA_HUMAN	P	374;396;242	ENSP00000247933:T374P;ENSP00000396458:T396P;ENSP00000425081:T242P	ENSP00000247933:T374P	T	+	1	0	IDUA	986204	1.000000	0.71417	0.995000	0.50966	0.426000	0.31534	5.967000	0.70403	2.024000	0.59613	0.454000	0.30748	ACC	.		0.711	IDUA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000201812.1	NM_000203	
PCDH7	5099	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	30726021	30726021	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr4:30726021G>A	ENST00000361762.2	+	1	3985	c.2977G>A	c.(2977-2979)Gca>Aca	p.A993T	PCDH7_ENST00000543491.1_Missense_Mutation_p.A993T	NM_002589.2	NP_002580.2	O60245	PCDH7_HUMAN	protocadherin 7	993					homophilic cell adhesion (GO:0007156)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(8)|liver(1)|lung(26)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	55						TCCTGACCTGGCAAGGCATTA	0.512																																					p.A993T		.											.	PCDH7-229	0			c.G2977A						.						89.0	89.0	89.0					4																	30726021		2203	4300	6503	SO:0001583	missense	5099	exon1			GACCTGGCAAGGC	AB006755	CCDS33971.1, CCDS75116.1	4p15	2014-06-13	2007-02-12			ENSG00000169851		"""Cadherins / Protocadherins : Non-clustered"""	8659	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 120"""	602988	"""BH-protocadherin (brain-heart)"""			9615233	Standard	NM_002589		Approved	BH-Pcdh, PPP1R120	uc021xnd.1	O60245		ENST00000361762.2:c.2977G>A	4.37:g.30726021G>A	ENSP00000355243:p.Ala993Thr	Somatic	84	0		WXS	Illumina GAIIx	Phase_I	105	9	NM_032457	0	0	0	0	0	O60246|O60247|Q4W5C4	Missense_Mutation	SNP	ENST00000361762.2	37	CCDS33971.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.3|20.3	3.967959|3.967959	0.74131|0.74131	.|.	.|.	ENSG00000169851|ENSG00000169851	ENST00000361762;ENST00000543491;ENST00000333135|ENST00000511884	T;T|.	0.40756|.	1.02;1.02|.	5.08|5.08	5.08|5.08	0.68730|0.68730	Protocadherin (1);|.	.|.	.|.	.|.	.|.	T|T	0.76637|0.76637	0.4015|0.4015	M|M	0.74647|0.74647	2.275|2.275	0.58432|0.58432	D|D	0.999998|0.999998	D;D;D|.	0.71674|.	0.997;0.997;0.998|.	D;D;D|.	0.73380|.	0.966;0.966;0.98|.	T|T	0.76211|0.76211	-0.3042|-0.3042	9|5	0.87932|.	D|.	0|.	.|.	18.6577|18.6577	0.91460|0.91460	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	993;946;993|.	F5GWJ1;O60245-3;O60245|.	.;.;PCDH7_HUMAN|.	T|D	993;993;946|682	ENSP00000355243:A993T;ENSP00000441802:A993T|.	ENSP00000330302:A946T|.	A|G	+|+	1|2	0|0	PCDH7|PCDH7	30335119|30335119	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.920000|0.920000	0.55202|0.55202	9.263000|9.263000	0.95617|0.95617	2.648000|2.648000	0.89879|0.89879	0.561000|0.561000	0.74099|0.74099	GCA|GGC	.		0.512	PCDH7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000360366.1	NM_032457, NM_002589	
DTHD1	401124	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	36345151	36345151	+	Nonsense_Mutation	SNP	G	G	A			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr4:36345151G>A	ENST00000456874.2	+	9	2109	c.2051G>A	c.(2050-2052)tGg>tAg	p.W684*	DTHD1_ENST00000357504.3_Nonsense_Mutation_p.W519*|RP11-431M7.2_ENST00000504344.1_RNA|DTHD1_ENST00000507598.1_Nonsense_Mutation_p.W724*|DTHD1_ENST00000503528.1_3'UTR	NM_001170700.2	NP_001164171.1	Q6ZMT9	DTHD1_HUMAN	death domain containing 1	684	Death. {ECO:0000255|PROSITE- ProRule:PRU00064}.				signal transduction (GO:0007165)					breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|stomach(1)	8						TTGCTCCATTGGCTGGCTGAG	0.537																																					p.W684X		.											.	DTHD1-46	0			c.G2051A						.						69.0	69.0	69.0					4																	36345151		692	1591	2283	SO:0001587	stop_gained	401124	exon9			TCCATTGGCTGGC	AK094684	CCDS54754.1	4p14	2009-10-02			ENSG00000197057	ENSG00000197057			37261	protein-coding gene	gene with protein product							Standard	NM_001170700		Approved	FLJ16686	uc021xne.2	Q6ZMT9	OTTHUMG00000160371	ENST00000456874.2:c.2051G>A	4.37:g.36345151G>A	ENSP00000401597:p.Trp684*	Somatic	60	0		WXS	Illumina GAIIx	Phase_I	75	18	NM_001170700	0	0	0	0	0	B2RXK4|B4E2N7	Nonsense_Mutation	SNP	ENST00000456874.2	37	CCDS54754.1	.	.	.	.	.	.	.	.	.	.	G	26.4	4.735939	0.89482	.	.	ENSG00000197057	ENST00000357504;ENST00000507598;ENST00000456874	.	.	.	4.42	4.42	0.53409	.	0.069619	0.64402	D	0.000007	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.4648	17.1981	0.86899	0.0:0.0:1.0:0.0	.	.	.	.	X	519;724;684	.	ENSP00000350103:W519X	W	+	2	0	DTHD1	36021546	1.000000	0.71417	1.000000	0.80357	0.171000	0.22731	6.838000	0.75359	2.304000	0.77564	0.491000	0.48974	TGG	.		0.537	DTHD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001136536	
POLR2B	5431	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	57889711	57889711	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr4:57889711C>A	ENST00000381227.1	+	20	3144	c.2731C>A	c.(2731-2733)Ctc>Atc	p.L911I	POLR2B_ENST00000441246.2_Missense_Mutation_p.L904I|POLR2B_ENST00000314595.5_Missense_Mutation_p.L911I|POLR2B_ENST00000431623.2_Missense_Mutation_p.L836I			P30876	RPB2_HUMAN	polymerase (RNA) II (DNA directed) polypeptide B, 140kDa	911					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|ribonucleoside binding (GO:0032549)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(10)|large_intestine(9)|lung(17)|ovary(2)|prostate(4)|skin(1)	52	Glioma(25;0.08)|all_neural(26;0.181)					TATGGTAACTCTCAATCAGGA	0.373																																					p.L911I		.											.	POLR2B-92	0			c.C2731A						.						92.0	94.0	93.0					4																	57889711		2203	4300	6503	SO:0001583	missense	5431	exon19			GTAACTCTCAATC		CCDS3511.1	4q12	2013-01-21	2002-08-29		ENSG00000047315	ENSG00000047315		"""RNA polymerase subunits"""	9188	protein-coding gene	gene with protein product		180661	"""polymerase (RNA) II (DNA directed) polypeptide B (140kD)"""			1518060, 8034326	Standard	NM_000938		Approved	RPB2	uc003hcl.1	P30876	OTTHUMG00000128771	ENST00000381227.1:c.2731C>A	4.37:g.57889711C>A	ENSP00000370625:p.Leu911Ile	Somatic	74	0		WXS	Illumina GAIIx	Phase_I	78	13	NM_000938	0	0	0	0	0	A8K1A8|Q8IZ61	Missense_Mutation	SNP	ENST00000381227.1	37	CCDS3511.1	.	.	.	.	.	.	.	.	.	.	C	15.29	2.789941	0.50102	.	.	ENSG00000047315	ENST00000381227;ENST00000431623;ENST00000441246;ENST00000314595	T;T;T;T	0.73363	-0.74;-0.74;-0.74;-0.74	6.04	4.31	0.51392	RNA polymerase Rpb2, OB-fold (1);DNA-directed RNA polymerase, subunit 2, domain 6 (1);	0.062472	0.64402	D	0.000003	T	0.50667	0.1629	N	0.02708	-0.52	0.80722	D	1	B;B	0.06786	0.001;0.001	B;B	0.15052	0.012;0.012	T	0.50701	-0.8797	10	0.52906	T	0.07	.	11.2652	0.49106	0.0:0.8046:0.0:0.1954	.	836;911	C9J4M6;P30876	.;RPB2_HUMAN	I	911;836;904;911	ENSP00000370625:L911I;ENSP00000391096:L836I;ENSP00000391452:L904I;ENSP00000312735:L911I	ENSP00000312735:L911I	L	+	1	0	POLR2B	57584468	0.998000	0.40836	0.999000	0.59377	0.985000	0.73830	3.905000	0.56333	1.571000	0.49722	0.563000	0.77884	CTC	.		0.373	POLR2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250692.1	NM_000938	
ADH6	130	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	100131302	100131302	+	Silent	SNP	C	C	T			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr4:100131302C>T	ENST00000237653.7	-	5	888	c.504G>A	c.(502-504)gaG>gaA	p.E168E	ADH6_ENST00000504257.1_5'UTR|RP11-696N14.1_ENST00000506160.1_RNA|ADH6_ENST00000394897.1_Silent_p.E168E|ADH6_ENST00000407820.2_Intron|RP11-696N14.1_ENST00000500358.2_RNA|ADH6_ENST00000394899.2_Silent_p.E168E|RP11-696N14.1_ENST00000506454.1_RNA	NM_000672.3	NP_000663	P28332	ADH6_HUMAN	alcohol dehydrogenase 6 (class V)	168					ethanol oxidation (GO:0006069)|response to ethanol (GO:0045471)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	alcohol dehydrogenase (NAD) activity (GO:0004022)|alcohol dehydrogenase activity, zinc-dependent (GO:0004024)|ethanol binding (GO:0035276)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(2)	20				OV - Ovarian serous cystadenocarcinoma(123;3.58e-08)	Abacavir(DB01048)	GGCATACTTTCTCTAGAGGAG	0.413																																					p.E168E		.											.	ADH6-228	0			c.G504A						.						120.0	117.0	118.0					4																	100131302		2203	4300	6503	SO:0001819	synonymous_variant	130	exon5			TACTTTCTCTAGA	AK092768	CCDS3647.1, CCDS43255.1	4q23	2008-02-05			ENSG00000172955	ENSG00000172955	1.1.1.1	"""Alcohol dehydrogenases"""	255	protein-coding gene	gene with protein product		103735				1881901	Standard	NM_000672		Approved	ADH-5	uc003huo.2	P28332	OTTHUMG00000131024	ENST00000237653.7:c.504G>A	4.37:g.100131302C>T		Somatic	63	0		WXS	Illumina GAIIx	Phase_I	88	17	NM_000672	0	0	0	0	0	B3KS45|Q58F53	Silent	SNP	ENST00000237653.7	37	CCDS3647.1																																																																																			.		0.413	ADH6-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000253665.1	NM_000672	
SLC39A8	64116	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	103180638	103180638	+	IGR	SNP	G	G	C			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr4:103180638G>C	ENST00000394833.2	-	0	3238				SLC39A8_ENST00000424970.2_Missense_Mutation_p.Q434E	NM_001135148.1|NM_022154.5	NP_001128620.1|NP_071437.3	Q9C0K1	S39A8_HUMAN	solute carrier family 39 (zinc transporter), member 8						transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	integral component of membrane (GO:0016021)|organelle membrane (GO:0031090)|plasma membrane (GO:0005886)	metal ion transmembrane transporter activity (GO:0046873)			large_intestine(1)|lung(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	9		Hepatocellular(203;0.217)		all cancers(1;9.78e-10)|OV - Ovarian serous cystadenocarcinoma(123;1.52e-09)|GBM - Glioblastoma multiforme(1;0.000142)		AAATGAAGTTGAGATTTGATG	0.333																																					p.Q434E		.											.	SLC39A8-90	0			c.C1300G						.						212.0	174.0	185.0					4																	103180638		692	1591	2283	SO:0001628	intergenic_variant	64116	exon10			GAAGTTGAGATTT		CCDS3656.1, CCDS47117.1	4q22-q24	2013-05-22			ENSG00000138821	ENSG00000138821		"""Solute carriers"""	20862	protein-coding gene	gene with protein product		608732	"""solute carrier family 39 (metal ion transporter), member 8"""			12504855, 12659941	Standard	NM_001135146		Approved	BIGM103	uc003hwc.2	Q9C0K1	OTTHUMG00000131120		4.37:g.103180638G>C		Somatic	75	0		WXS	Illumina GAIIx	Phase_I	73	19	NM_001135147	0	0	0	0	0	B4E2H3|Q96SM9|Q9BVC0|Q9NSA4	Missense_Mutation	SNP	ENST00000394833.2	37	CCDS3656.1	.	.	.	.	.	.	.	.	.	.	G	5.953	0.359753	0.11239	.	.	ENSG00000138821	ENST00000424970	T	0.68479	-0.33	2.29	-1.83	0.07833	.	.	.	.	.	T	0.44180	0.1281	.	.	.	0.09310	N	1	B	0.12630	0.006	B	0.09377	0.004	T	0.17048	-1.0382	8	0.29301	T	0.29	.	3.8453	0.08933	0.2716:0.3978:0.3306:0.0	.	434	B4E2H3	.	E	434	ENSP00000394548:Q434E	ENSP00000394548:Q434E	Q	-	1	0	SLC39A8	103399661	0.001000	0.12720	0.010000	0.14722	0.069000	0.16628	-1.169000	0.03120	-0.585000	0.05905	-0.676000	0.03789	CAA	.		0.333	SLC39A8-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253798.1	NM_022154	
DCHS2	54798	broad.mit.edu	37	4	155412464	155412464	+	Missense_Mutation	SNP	C	C	T	rs13149269	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr4:155412464C>T	ENST00000339452.1	-	1	404	c.44G>A	c.(43-45)cGg>cAg	p.R15Q	DCHS2_ENST00000456341.2_Missense_Mutation_p.R8Q|DCHS2_ENST00000443500.1_Missense_Mutation_p.R15Q	NM_001142552.1	NP_001136024.1	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	491					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		CGGAGCCCGCCGCTGCTGACG	0.672													C|||	1867	0.372804	0.3502	0.4885	5008	,	,		16047	0.1647		0.4612	False		,,,				2504	0.4448				p.R15Q		.											.	DCHS2-94	0			c.G44A						.						7.0	14.0	12.0					4																	155412464		678	1559	2237	SO:0001583	missense	54798	exon1			GCCCGCCGCTGCT	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000339452.1:c.44G>A	4.37:g.155412464C>T	ENSP00000345062:p.Arg15Gln	Somatic	65	1		WXS	Illumina GAIIx	Phase_I	159	6	NM_001142552	0	0	0	0	0	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	ENST00000339452.1	37	CCDS47150.1	785	0.35943223443223443	177	0.3597560975609756	173	0.47790055248618785	82	0.14335664335664336	353	0.4656992084432718	C	10.79	1.450518	0.26074	.	.	ENSG00000197410	ENST00000339452;ENST00000544161;ENST00000456341;ENST00000443500	T;T;T	0.58506	0.33;0.38;0.39	5.35	-10.7	0.00240	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B;B	0.17268	0.021;0.021	B;B	0.08055	0.003;0.003	T	0.04607	-1.0939	7	0.18710	T	0.47	.	5.0984	0.14747	0.3583:0.1213:0.4102:0.1103	rs13149269;rs17373888	15;15	E9PG03;E9PC11	.;.	Q	15;15;8;15	ENSP00000345062:R15Q;ENSP00000408543:R8Q;ENSP00000395539:R15Q	ENSP00000345062:R15Q	R	-	2	0	DCHS2	155631914	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-4.236000	0.00268	-4.157000	0.00069	-2.548000	0.00178	CGG	C|0.652;N|0.001		0.672	DCHS2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000365282.1	NM_001142552	
DNAH5	1767	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	13792259	13792259	+	Silent	SNP	T	T	C			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr5:13792259T>C	ENST00000265104.4	-	50	8396	c.8292A>G	c.(8290-8292)acA>acG	p.T2764T		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	2764	AAA 3. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					GCACCAATTTTGTCACAGAAT	0.433									Kartagener syndrome																												p.T2764T		.											.	DNAH5-182	0			c.A8292G						.						112.0	109.0	110.0					5																	13792259		2203	4300	6503	SO:0001819	synonymous_variant	1767	exon50	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	CAATTTTGTCACA	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.8292A>G	5.37:g.13792259T>C		Somatic	57	0		WXS	Illumina GAIIx	Phase_I	82	5	NM_001369	0	0	0	0	0	Q92860|Q96L74|Q9H5S7|Q9HCG9	Silent	SNP	ENST00000265104.4	37	CCDS3882.1																																																																																			.		0.433	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
RAI14	26064	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	34823555	34823555	+	Silent	SNP	G	G	A			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr5:34823555G>A	ENST00000265109.3	+	15	1895	c.1608G>A	c.(1606-1608)aaG>aaA	p.K536K	RAI14_ENST00000515799.1_Silent_p.K539K|RAI14_ENST00000512629.1_Silent_p.K507K|RAI14_ENST00000506376.1_Silent_p.K528K|RAI14_ENST00000397449.1_Silent_p.K529K|RAI14_ENST00000428746.2_Silent_p.K536K|RAI14_ENST00000503673.1_Silent_p.K536K	NM_001145522.1|NM_015577.2	NP_001138994.1|NP_056392.2	Q9P0K7	RAI14_HUMAN	retinoic acid induced 14	536						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(19)|lung(22)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	56	all_lung(31;0.000191)					ATGTGCTAAAGCAGGATCTGC	0.403																																					p.K539K		.											.	RAI14-91	0			c.G1617A						.						55.0	53.0	54.0					5																	34823555		2203	4300	6503	SO:0001819	synonymous_variant	26064	exon17			GCTAAAGCAGGAT	AB037755	CCDS34142.1, CCDS54837.1, CCDS54838.1, CCDS54839.1	5p13.3-p13.2	2013-01-10			ENSG00000039560	ENSG00000039560		"""Ankyrin repeat domain containing"""	14873	protein-coding gene	gene with protein product	"""novel retinal pigment epithelial"""	606586				11042181	Standard	NM_015577		Approved	NORPEG, KIAA1334, RAI13, DKFZp564G013	uc011coj.2	Q9P0K7	OTTHUMG00000162019	ENST00000265109.3:c.1608G>A	5.37:g.34823555G>A		Somatic	90	0		WXS	Illumina GAIIx	Phase_I	117	18	NM_001145525	0	0	0	0	0	E9PED3|Q6V1W9|Q7Z5I4|Q7Z733|Q9P2L2|Q9Y3T5	Silent	SNP	ENST00000265109.3	37	CCDS34142.1																																																																																			.		0.403	RAI14-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366786.1	NM_015577	
ADAMTS19	171019	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	128977578	128977578	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr5:128977578C>G	ENST00000274487.4	+	11	1924	c.1779C>G	c.(1777-1779)tgC>tgG	p.C593W	CTC-575N7.1_ENST00000503616.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	593	Disintegrin.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		GATTATGGTGCAAGGTAGAAG	0.388																																					p.C593W		.											.	ADAMTS19-295	0			c.C1779G						.						216.0	181.0	193.0					5																	128977578		2203	4300	6503	SO:0001583	missense	171019	exon11			ATGGTGCAAGGTA	AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.1779C>G	5.37:g.128977578C>G	ENSP00000274487:p.Cys593Trp	Somatic	104	0		WXS	Illumina GAIIx	Phase_I	161	37	NM_133638	0	0	0	0	0		Missense_Mutation	SNP	ENST00000274487.4	37	CCDS4146.1	.	.	.	.	.	.	.	.	.	.	C	15.05	2.717355	0.48622	.	.	ENSG00000145808	ENST00000274487	T	0.68331	-0.32	3.85	1.98	0.26296	.	0.000000	0.64402	D	0.000003	D	0.83667	0.5304	H	0.96365	3.81	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.81711	-0.0808	9	.	.	.	.	5.527	0.16962	0.0:0.4597:0.0:0.5403	.	593	Q8TE59	ATS19_HUMAN	W	593	ENSP00000274487:C593W	.	C	+	3	2	ADAMTS19	129005477	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.822000	0.39052	0.538000	0.28769	0.591000	0.81541	TGC	.		0.388	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250979.2	NM_133638	
SOWAHA	134548	hgsc.bcm.edu	37	5	132149684	132149684	+	Missense_Mutation	SNP	G	G	C	rs40274	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr5:132149684G>C	ENST00000378693.2	+	1	652	c.371G>C	c.(370-372)cGg>cCg	p.R124P		NM_175873.4	NP_787069.3	Q2M3V2	SWAHA_HUMAN	sosondowah ankyrin repeat domain family member A	124	Pro-rich.		R -> P (in dbSNP:rs40274).														CCCTTGGTCCGGGTGCCGCGG	0.776																																					p.R124P		.											.	.	0			c.G371C						.	C	PRO/ARG	2599,13		1293,13,0	2.0	3.0	3.0		371	-0.3	0.0	5	dbSNP_76	3	6177,193		2993,191,1	no	missense	ANKRD43	NM_175873.4	103	4286,204,1	CC,CG,GG		3.0298,0.4977,2.2935	benign	124/550	132149684	8776,206	1306	3185	4491	SO:0001583	missense	134548	exon1			TGGTCCGGGTGCC	AK090823	CCDS43361.1	5q23.3	2013-01-10	2012-01-12	2012-01-12	ENSG00000198944	ENSG00000198944		"""Ankyrin repeat domain containing"""	27033	protein-coding gene	gene with protein product			"""ankyrin repeat domain 43"""	ANKRD43		22234889	Standard	NM_175873		Approved		uc003kxw.3	Q2M3V2	OTTHUMG00000059844	ENST00000378693.2:c.371G>C	5.37:g.132149684G>C	ENSP00000367965:p.Arg124Pro	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_175873	0	0	0	0	0	Q8NAE7	Missense_Mutation	SNP	ENST00000378693.2	37	CCDS43361.1	2142	0.9807692307692307	482	0.9796747967479674	357	0.9861878453038674	562	0.9825174825174825	741	0.9775725593667546	c	9.833	1.188835	0.21954	0.995023	0.969702	ENSG00000198944	ENST00000378693	T	0.38077	1.16	4.27	-0.265	0.12946	.	2.345400	0.02245	N	0.066177	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.36261	-0.9755	9	0.30078	T	0.28	-5.2019	3.6102	0.08057	0.2245:0.4439:0.2467:0.085	rs40274	124	Q2M3V2	ANR43_HUMAN	P	124	ENSP00000367965:R124P	ENSP00000367965:R124P	R	+	2	0	ANKRD43	132177583	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.768000	0.01794	-0.003000	0.14444	-3.153000	0.00058	CGG	G|0.980;C|0.020		0.776	SOWAHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133062.1	NM_175873	
GEMIN5	25929	bcgsc.ca	37	5	154299581	154299581	+	Silent	SNP	A	A	G	rs61758976	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr5:154299581A>G	ENST00000285873.7	-	11	1620	c.1545T>C	c.(1543-1545)ctT>ctC	p.L515L		NM_001252156.1|NM_015465.4	NP_001239085.1|NP_056280.2	Q8TEQ6	GEMI5_HUMAN	gem (nuclear organelle) associated protein 5	515					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|protein complex assembly (GO:0006461)|RNA metabolic process (GO:0016070)|spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)	poly(A) RNA binding (GO:0044822)|snRNA binding (GO:0017069)			breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(10)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			CTTCTCCACTAAGCTTCCAGG	0.413													A|||	15	0.00299521	0.0015	0.0043	5008	,	,		18255	0.0		0.0099	False		,,,				2504	0.0				p.L515L		.											.	GEMIN5-228	0			c.T1545C						.	A		14,4392	22.3+/-47.3	0,14,2189	177.0	150.0	159.0		1545	-9.1	0.8	5	dbSNP_129	159	133,8467	66.7+/-129.0	4,125,4171	no	coding-synonymous	GEMIN5	NM_015465.3		4,139,6360	GG,GA,AA		1.5465,0.3177,1.1302		515/1509	154299581	147,12859	2203	4300	6503	SO:0001819	synonymous_variant	25929	exon11			TCCACTAAGCTTC	AK022748	CCDS4330.1	5q34	2013-01-10			ENSG00000082516	ENSG00000082516		"""WD repeat domain containing"""	20043	protein-coding gene	gene with protein product		607005				11714716	Standard	NM_015465		Approved		uc003lvx.3	Q8TEQ6	OTTHUMG00000130189	ENST00000285873.7:c.1545T>C	5.37:g.154299581A>G		Somatic	129	0		WXS	Illumina GAIIx	Phase_I	164	7	NM_015465	0	0	0	0	0	Q14CV0|Q8WWV4|Q969W4|Q9H9K3|Q9UFI5	Silent	SNP	ENST00000285873.7	37	CCDS4330.1																																																																																			A|0.990;G|0.010		0.413	GEMIN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252507.1		
PPP1R3G	648791	hgsc.bcm.edu	37	6	5086070	5086070	+	Silent	SNP	A	A	G	rs667752		TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr6:5086070A>G	ENST00000405617.2	+	1	351	c.351A>G	c.(349-351)gcA>gcG	p.A117A		NM_001145115.1	NP_001138587.1	B7ZBB8	PP13G_HUMAN	protein phosphatase 1, regulatory subunit 3G	117					glucose homeostasis (GO:0042593)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of glycogen biosynthetic process (GO:0045725)	cytoplasm (GO:0005737)	glycogen binding (GO:2001069)			kidney(2)	2						CGGAGGACGCACAGCTCGGCC	0.692													G|||	5008	1.0	1.0	1.0	5008	,	,		12505	1.0		1.0	False		,,,				2504	1.0				p.A117A		.											.	PPP1R3G-136	0			c.A351G						.						1.0	2.0	2.0					6																	5086070		400	1062	1462	SO:0001819	synonymous_variant	648791	exon1			GGACGCACAGCTC		CCDS47366.1	6p25.1	2012-04-17	2011-10-04		ENSG00000219607	ENSG00000219607		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14945	protein-coding gene	gene with protein product			"""protein phosphatase 1, regulatory (inhibitor) subunit 3G"""			11948623	Standard	NM_001145115		Approved		uc011dia.1	B7ZBB8	OTTHUMG00000014172	ENST00000405617.2:c.351A>G	6.37:g.5086070A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	10	NM_001145115	0	0	0	0	0		Silent	SNP	ENST00000405617.2	37	CCDS47366.1																																																																																			A|0.006;G|0.994		0.692	PPP1R3G-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039740.3	NM_001145115	
RREB1	6239	hgsc.bcm.edu	37	6	7230680	7230680	+	Missense_Mutation	SNP	G	G	T	rs9502564	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr6:7230680G>T	ENST00000349384.6	+	10	2662	c.2348G>T	c.(2347-2349)gGc>gTc	p.G783V	RREB1_ENST00000379938.2_Missense_Mutation_p.G783V|RREB1_ENST00000334984.6_Missense_Mutation_p.G783V|RREB1_ENST00000379933.3_Missense_Mutation_p.G783V	NM_001003698.3	NP_001003698.1	Q92766	RREB1_HUMAN	ras responsive element binding protein 1	783			G -> V (in dbSNP:rs9502564). {ECO:0000269|PubMed:15067362, ECO:0000269|PubMed:21703425}.		multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|Ras protein signal transduction (GO:0007265)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear body (GO:0016604)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(18)|ovary(5)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)				CTGGGCGGGGGCCACAAGGGC	0.697													G|||	2678	0.534744	0.5333	0.4063	5008	,	,		15583	0.7411		0.2893	False		,,,				2504	0.6677				p.G783V		.											.	RREB1-144	0			c.G2348T						.	G	VAL/GLY,VAL/GLY,VAL/GLY,VAL/GLY	2083,2197		552,979,609	9.0	9.0	9.0		2348,2348,2348,2348	5.3	1.0	6	dbSNP_119	9	2599,5719		488,1623,2048	yes	missense,missense,missense,missense	RREB1	NM_001003698.3,NM_001003699.3,NM_001003700.1,NM_001168344.1	109,109,109,109	1040,2602,2657	TT,TG,GG		31.2455,48.6682,37.1646	benign,benign,benign,benign	783/1688,783/1743,783/1477,783/1688	7230680	4682,7916	2140	4159	6299	SO:0001583	missense	6239	exon10			GCGGGGGCCACAA	U26914	CCDS34335.1, CCDS34336.1, CCDS54963.1	6p25	2013-01-08			ENSG00000124782	ENSG00000124782		"""Zinc fingers, C2H2-type"""	10449	protein-coding gene	gene with protein product	"""hindsight homolog (drosophila)"""	602209				9367691, 18394891	Standard	NM_001003698		Approved	HNT	uc003mxb.3	Q92766	OTTHUMG00000014201	ENST00000349384.6:c.2348G>T	6.37:g.7230680G>T	ENSP00000305560:p.Gly783Val	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	16	5	NM_001003700	0	0	0	0	0	A2RRF5|E2GM80|E2GM81|O75567|O75568|Q5VYB2|Q6BEP5|Q6BEP6|Q6BEP8|Q86SU2|Q9Y474	Missense_Mutation	SNP	ENST00000349384.6	37	CCDS34336.1	1014	0.4642857142857143	249	0.5060975609756098	148	0.4088397790055249	412	0.7202797202797203	205	0.2704485488126649	G	11.15	1.553554	0.27739	0.486682	0.312455	ENSG00000124782	ENST00000379933;ENST00000379938;ENST00000349384;ENST00000334984	T;T;T;T	0.09163	3.07;3.07;3.07;3.01	5.32	5.32	0.75619	.	0.278837	0.31370	N	0.007766	T	0.02533	0.0077	N	0.14661	0.345	0.21915	P	0.999474401	B;B;B	0.32653	0.161;0.379;0.328	B;B;B	0.35182	0.079;0.197;0.178	T	0.45512	-0.9256	9	0.13108	T	0.6	-17.3998	11.4207	0.49980	0.0:0.0:0.8202:0.1797	rs9502564	783;783;783	Q92766-3;Q92766;Q92766-2	.;RREB1_HUMAN;.	V	783	ENSP00000369265:G783V;ENSP00000369270:G783V;ENSP00000305560:G783V;ENSP00000335574:G783V	ENSP00000335574:G783V	G	+	2	0	RREB1	7175679	1.000000	0.71417	0.996000	0.52242	0.833000	0.47200	5.477000	0.66799	2.760000	0.94817	0.655000	0.94253	GGC	G|0.546;T|0.454		0.697	RREB1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352985.1		
MAK	4117	broad.mit.edu	37	6	10796402	10796402	+	Silent	SNP	C	C	G			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr6:10796402C>G	ENST00000313243.2	-	9	1354	c.972G>C	c.(970-972)ctG>ctC	p.L324L	MAK_ENST00000538030.1_Silent_p.L324L|SYCP2L_ENST00000543878.1_Intron|RP11-637O19.3_ENST00000480294.1_Intron|MAK_ENST00000474039.1_Silent_p.L324L|MAK_ENST00000354489.2_Silent_p.L324L|MAK_ENST00000536370.1_3'UTR			P20794	MAK_HUMAN	male germ cell-associated kinase	324	Glu/Pro-rich.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|photoreceptor cell maintenance (GO:0045494)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(8)|prostate(1)|skin(1)	22	Breast(50;0.107)|Ovarian(93;0.107)	all_hematologic(90;0.117)				TTATATCCGGCAGAGGCTTAG	0.488																																					p.L324L		.											.	MAK-335	0			c.G972C						.						115.0	117.0	116.0					6																	10796402		2203	4300	6503	SO:0001819	synonymous_variant	4117	exon9			ATCCGGCAGAGGC		CCDS4516.1, CCDS75398.1, CCDS75399.1	6p24.2	2014-01-28			ENSG00000111837	ENSG00000111837			6816	protein-coding gene	gene with protein product		154235				16951154	Standard	NM_005906		Approved	dJ417M14.2, RP62	uc021ylk.1	P20794	OTTHUMG00000014247	ENST00000313243.2:c.972G>C	6.37:g.10796402C>G		Somatic	91	1		WXS	Illumina GAIIx	Phase_I	108	3	NM_005906	0	0	0	0	0	F1T0K6|G1FL29|Q547D0|Q9NUH7	Silent	SNP	ENST00000313243.2	37	CCDS4516.1																																																																																			.		0.488	MAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039841.1	NM_005906	
KIF13A	63971	bcgsc.ca	37	6	17987327	17987327	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr6:17987327G>T	ENST00000259711.6	-	2	209	c.104C>A	c.(103-105)aCg>aAg	p.T35K	KIF13A_ENST00000502704.1_Missense_Mutation_p.T35K|KIF13A_ENST00000378816.5_Missense_Mutation_p.T35K|KIF13A_ENST00000378826.2_Missense_Mutation_p.T35K|KIF13A_ENST00000378843.2_Missense_Mutation_p.T35K|KIF13A_ENST00000378814.5_Missense_Mutation_p.T35K	NM_022113.5	NP_071396.4	Q9H1H9	KI13A_HUMAN	kinesin family member 13A	35	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|cargo loading into vesicle (GO:0035459)|cytokinesis (GO:0000910)|endosome to lysosome transport (GO:0008333)|Golgi to plasma membrane protein transport (GO:0043001)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end-directed vesicle transport along microtubule (GO:0072383)	centrosome (GO:0005813)|endosome membrane (GO:0010008)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|midbody (GO:0030496)|trans-Golgi network membrane (GO:0032588)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(16)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	64	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			GTGCAGGACCGTTTGATTCCC	0.582																																					p.T35K		.											.	KIF13A-137	0			c.C104A						.						140.0	150.0	147.0					6																	17987327		1980	4154	6134	SO:0001583	missense	63971	exon2			AGGACCGTTTGAT	AJ291578	CCDS47380.1, CCDS47381.1, CCDS54967.1, CCDS54968.1, CCDS58998.1	6p23	2008-10-21			ENSG00000137177	ENSG00000137177		"""Kinesins"""	14566	protein-coding gene	gene with protein product		605433				11106728	Standard	NM_022113		Approved	bA500C11.2	uc003ncg.4	Q9H1H9	OTTHUMG00000014313	ENST00000259711.6:c.104C>A	6.37:g.17987327G>T	ENSP00000259711:p.Thr35Lys	Somatic	125	0		WXS	Illumina GAIIx	Phase_I	187	6	NM_001105567	0	0	0	0	0	A0JP21|A0JP22|F2Z382|Q5THQ2|Q5THQ3|Q9H193|Q9H194|Q9H1H8	Missense_Mutation	SNP	ENST00000259711.6	37	CCDS47381.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.503121	0.85176	.	.	ENSG00000137177	ENST00000378814;ENST00000259711;ENST00000378826;ENST00000378843;ENST00000378816;ENST00000502704	D;D;D;D;D;D	0.89343	-2.5;-2.5;-2.5;-2.5;-2.5;-2.5	5.05	2.12	0.27331	Kinesin, motor domain (4);	0.141177	0.44902	D	0.000402	D	0.92090	0.7493	M	0.84683	2.71	0.50813	D	0.99989	D;D;D;D	0.89917	1.0;1.0;0.999;1.0	D;D;D;D	0.81914	0.992;0.995;0.961;0.995	D	0.91625	0.5314	10	0.87932	D	0	.	10.2729	0.43493	0.0:0.1319:0.5945:0.2735	.	35;35;35;35	Q9H1H9-4;Q9H1H9-2;Q9H1H9;Q9H1H9-3	.;.;KI13A_HUMAN;.	K	35	ENSP00000368091:T35K;ENSP00000259711:T35K;ENSP00000368103:T35K;ENSP00000368120:T35K;ENSP00000368093:T35K;ENSP00000425453:T35K	ENSP00000259711:T35K	T	-	2	0	KIF13A	18095306	1.000000	0.71417	0.978000	0.43139	0.995000	0.86356	6.109000	0.71528	0.109000	0.17891	0.561000	0.74099	ACG	.		0.582	KIF13A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039954.4		
HIST1H1A	3024	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	26017333	26017333	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr6:26017333C>T	ENST00000244573.3	-	1	707	c.628G>A	c.(628-630)Gcg>Acg	p.A210T		NM_005325.3	NP_005316.1	Q02539	H11_HUMAN	histone cluster 1, H1a	210					nucleosome assembly (GO:0006334)|spermatogenesis (GO:0007283)	nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleosome (GO:0000786)	chromatin DNA binding (GO:0031490)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|ovary(3)|prostate(1)	13						TTGGGTGCCGCTTTCTTGGGT	0.468																																					p.A210T		.											.	HIST1H1A-92	0			c.G628A						.						112.0	114.0	113.0					6																	26017333		2203	4300	6503	SO:0001583	missense	3024	exon1			GTGCCGCTTTCTT	AF531299	CCDS4569.1	6p22.1	2012-11-16	2006-10-11	2003-02-21	ENSG00000124610	ENSG00000124610		"""Histones / Replication-dependent"""	4715	protein-coding gene	gene with protein product		142709	"""H1 histone family, member 1"", ""histone 1, H1a"""	H1F1		2759094, 12408966	Standard	NM_005325		Approved	H1.1, H1a	uc003nfo.3	Q02539	OTTHUMG00000016413	ENST00000244573.3:c.628G>A	6.37:g.26017333C>T	ENSP00000244573:p.Ala210Thr	Somatic	102	0		WXS	Illumina GAIIx	Phase_I	135	20	NM_005325	0	0	0	0	0	Q3MJ34	Missense_Mutation	SNP	ENST00000244573.3	37	CCDS4569.1	.	.	.	.	.	.	.	.	.	.	N	17.75	3.465276	0.63513	.	.	ENSG00000124610	ENST00000244573	T	0.05139	3.49	4.31	3.44	0.39384	.	0.121394	0.53938	N	0.000047	T	0.01730	0.0055	N	0.12961	0.28	0.58432	D	0.999997	B	0.25390	0.125	B	0.23716	0.048	T	0.46091	-0.9216	10	0.49607	T	0.09	-10.2756	12.1608	0.54103	0.0:0.9144:0.0:0.0856	.	210	Q02539	H11_HUMAN	T	210	ENSP00000244573:A210T	ENSP00000244573:A210T	A	-	1	0	HIST1H1A	26125312	0.683000	0.27633	0.978000	0.43139	0.906000	0.53458	0.488000	0.22371	1.103000	0.41568	0.609000	0.83330	GCG	.		0.468	HIST1H1A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043884.1	NM_005325	
NKAPL	222698	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	28227192	28227192	+	Missense_Mutation	SNP	G	G	A	rs144318583		TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr6:28227192G>A	ENST00000343684.3	+	1	95	c.43G>A	c.(43-45)Ggc>Agc	p.G15S	ZKSCAN4_ENST00000423974.2_5'Flank	NM_001007531.1	NP_001007532.1	Q5M9Q1	NKAPL_HUMAN	NFKB activating protein-like	15										breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	31						GGACATCGTGGGCTCTCGGAG	0.662																																					p.G15S		.											.	NKAPL-70	0			c.G43A						.						32.0	30.0	30.0					6																	28227192		2201	4295	6496	SO:0001583	missense	222698	exon1			ATCGTGGGCTCTC	BC038240	CCDS34353.1	6p21.33	2008-02-05	2007-08-16	2007-08-16	ENSG00000189134	ENSG00000189134			21584	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 194"""	C6orf194			Standard	NM_001007531		Approved	bA424I5.1	uc003nkt.4	Q5M9Q1	OTTHUMG00000014517	ENST00000343684.3:c.43G>A	6.37:g.28227192G>A	ENSP00000345716:p.Gly15Ser	Somatic	133	0		WXS	Illumina GAIIx	Phase_I	194	46	NM_001007531	0	0	0	0	0	Q3MIV1|Q9H4Q7	Missense_Mutation	SNP	ENST00000343684.3	37	CCDS34353.1	.	.	.	.	.	.	.	.	.	.	G	12.10	1.836234	0.32421	.	.	ENSG00000189134	ENST00000343684	T	0.13778	2.56	3.47	-0.641	0.11490	.	2.545070	0.02087	N	0.052873	T	0.02494	0.0076	L	0.28115	0.83	0.09310	N	1	B	0.17465	0.022	B	0.10450	0.005	T	0.39583	-0.9607	10	0.39692	T	0.17	0.7346	0.7958	0.01065	0.2257:0.1851:0.3996:0.1895	.	15	Q5M9Q1	NKAPL_HUMAN	S	15	ENSP00000345716:G15S	ENSP00000345716:G15S	G	+	1	0	NKAPL	28335171	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.254000	0.18314	-0.147000	0.11254	-0.137000	0.14449	GGC	G|1.000;T|0.000		0.662	NKAPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040185.1		
C6orf136	221545	hgsc.bcm.edu	37	6	30615205	30615205	+	Intron	SNP	C	C	T			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr6:30615205C>T	ENST00000376473.5	+	1	231				C6orf136_ENST00000293604.6_Missense_Mutation_p.T66I|C6orf136_ENST00000528347.2_5'Flank|AL662800.2_ENST00000583820.1_RNA|C6orf136_ENST00000493705.1_Intron|C6orf136_ENST00000376471.4_Intron	NM_001109938.2	NP_001103408.1	Q5SQH8	CF136_HUMAN	chromosome 6 open reading frame 136							mitochondrion (GO:0005739)				endometrium(1)|large_intestine(2)|lung(6)|ovary(1)	10						CCCCTTCCCACCTGTGCCCTG	0.741																																					p.T66I		.											.	C6orf136-90	0			c.C197T						.						2.0	3.0	2.0					6																	30615205		428	1180	1608	SO:0001627	intron_variant	221545	exon1			TTCCCACCTGTGC	BC016167	CCDS4684.1, CCDS43443.1, CCDS4684.2, CCDS54979.1	6p21.32	2012-02-06			ENSG00000204564	ENSG00000204564			21301	protein-coding gene	gene with protein product							Standard	NM_001109938		Approved	Em:AB023049.8	uc003nqx.4	Q5SQH8	OTTHUMG00000031221	ENST00000376473.5:c.72+125C>T	6.37:g.30615205C>T		Somatic	1	0		WXS	Illumina GAIIx	Phase_I	17	13	NM_001161376	0	0	0	0	0	A9R9P9|F8VX15|Q5SU01|Q6ZSB7|Q8TB84	Missense_Mutation	SNP	ENST00000376473.5	37	CCDS43443.1	.	.	.	.	.	.	.	.	.	.	c	35	5.498219	0.96355	.	.	ENSG00000204564	ENST00000293604;ENST00000446773	.	.	.	5.06	4.19	0.49359	.	.	.	.	.	T	0.19446	0.0467	N	0.08118	0	0.80722	D	1	P	0.40731	0.728	P	0.44359	0.447	T	0.09037	-1.0693	8	0.87932	D	0	.	8.4514	0.32873	0.0:0.8962:0.0:0.1038	.	66	F8VX15	.	I	66;3	.	ENSP00000293604:T66I	T	+	2	0	C6orf136	30723184	0.005000	0.15991	0.930000	0.37139	0.703000	0.40648	1.536000	0.36072	2.351000	0.79841	0.655000	0.94253	ACC	.		0.741	C6orf136-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076457.4	NM_145029	
KCNK17	89822	hgsc.bcm.edu	37	6	39282036	39282036	+	Missense_Mutation	SNP	T	T	C	rs10947804	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr6:39282036T>C	ENST00000373231.4	-	1	293	c.61A>G	c.(61-63)Agc>Ggc	p.S21G	KCNK17_ENST00000453413.2_Missense_Mutation_p.S21G	NM_031460.3	NP_113648.2	Q96T54	KCNKH_HUMAN	potassium channel, subfamily K, member 17	21			S -> G (in dbSNP:rs10947804). {ECO:0000269|PubMed:11248242, ECO:0000269|PubMed:15489334}.		potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(2)	14						AGCACGGTGCTGGGCACCGCG	0.761													T|||	2917	0.582468	0.8858	0.4553	5008	,	,		12417	0.4673		0.4851	False		,,,				2504	0.4816				p.S21G		.											.	KCNK17-227	0			c.A61G						.	T	GLY/SER,GLY/SER	3100,536		1364,372,82	3.0	4.0	3.0		61,61	2.1	0.0	6	dbSNP_120	3	4061,3263		1251,1559,852	yes	missense,missense	KCNK17	NM_001135111.1,NM_031460.3	56,56	2615,1931,934	CC,CT,TT		44.5522,14.7415,34.6624	benign,benign	21/272,21/333	39282036	7161,3799	1818	3662	5480	SO:0001583	missense	89822	exon1			CGGTGCTGGGCAC	AF358910	CCDS4842.1, CCDS47419.1	6p21	2012-03-07			ENSG00000124780	ENSG00000124780		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	14465	protein-coding gene	gene with protein product		607370				16382106	Standard	NM_031460		Approved	K2p17.1, TALK-2, TALK2, TASK4, TASK-4	uc003ooo.3	Q96T54	OTTHUMG00000014646	ENST00000373231.4:c.61A>G	6.37:g.39282036T>C	ENSP00000362328:p.Ser21Gly	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	15	11	NM_001135111	0	0	0	0	0	E9PB46|Q5TCF4|Q8TAW4|Q9BXD1|Q9H592	Missense_Mutation	SNP	ENST00000373231.4	37	CCDS4842.1	1214	0.5558608058608059	431	0.8760162601626016	173	0.47790055248618785	244	0.42657342657342656	366	0.48284960422163586	T	8.033	0.762256	0.15914	0.852585	0.554478	ENSG00000124780	ENST00000373231;ENST00000453413	T;T	0.56776	0.44;0.44	4.06	2.09	0.27110	.	1.425750	0.04586	N	0.395947	T	0.14184	0.0343	N	0.17082	0.46	0.80722	P	0.0	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	T	0.09122	-1.0689	9	0.21014	T	0.42	.	5.3388	0.15973	0.0:0.5516:0.0:0.4484	rs10947804;rs17845776;rs17858736;rs60349641	21;21	E9PB46;Q96T54	.;KCNKH_HUMAN	G	21	ENSP00000362328:S21G;ENSP00000401271:S21G	ENSP00000362328:S21G	S	-	1	0	KCNK17	39390014	0.000000	0.05858	0.003000	0.11579	0.032000	0.12392	-0.229000	0.09098	0.383000	0.24910	0.459000	0.35465	AGC	T|0.441;C|0.559		0.761	KCNK17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040453.2	NM_031460	
TIAM2	26230	broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	155503406	155503406	+	Silent	SNP	G	G	T			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr6:155503406G>T	ENST00000461783.3	+	15	4027	c.2754G>T	c.(2752-2754)cgG>cgT	p.R918R	TIAM2_ENST00000367174.2_Silent_p.R294R|TIAM2_ENST00000360366.4_Silent_p.R942R|TIAM2_ENST00000456877.2_Silent_p.R230R|TIAM2_ENST00000529824.2_Silent_p.R918R|TIAM2_ENST00000528391.2_Silent_p.R254R|TIAM2_ENST00000318981.5_Silent_p.R918R|TIAM2_ENST00000456144.1_Silent_p.R918R			Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2	918	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				apoptotic signaling pathway (GO:0097190)|cellular lipid metabolic process (GO:0044255)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(20)|lung(21)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	65		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		ATCTCAGCCGGATATTTATAA	0.507																																					p.R918R		.											.	TIAM2-93	0			c.G2754T						.						226.0	206.0	213.0					6																	155503406		2203	4300	6503	SO:0001819	synonymous_variant	26230	exon12			CAGCCGGATATTT		CCDS34558.1, CCDS34559.1	6q25	2013-01-10			ENSG00000146426	ENSG00000146426		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11806	protein-coding gene	gene with protein product		604709				10512681	Standard	NM_012454		Approved	STEF	uc003qqe.3	Q8IVF5	OTTHUMG00000015880	ENST00000461783.3:c.2754G>T	6.37:g.155503406G>T		Somatic	135	1		WXS	Illumina GAIIx	Phase_I	203	48	NM_012454	0	0	0	0	0	B2RP56|C9JZV2|Q6NXN9|Q6ZUP9|Q9UFG6|Q9UKV9|Q9UKW0	Silent	SNP	ENST00000461783.3	37	CCDS34558.1																																																																																			.		0.507	TIAM2-005	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000387980.2	NM_012454	
SP8	221833	hgsc.bcm.edu;broad.mit.edu	37	7	20824941	20824943	+	In_Frame_Del	DEL	GCC	GCC	-	rs372591893	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	GCC	GCC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr7:20824941_20824943delGCC	ENST00000361443.4	-	3	676_678	c.439_441delGGC	c.(439-441)ggcdel	p.G147del	SP8_ENST00000418710.2_In_Frame_Del_p.G165del	NM_198956.2	NP_945194.1	Q8IXZ3	SP8_HUMAN	Sp8 transcription factor	147					dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|proximal/distal pattern formation (GO:0009954)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G165delG(1)|p.G147delG(1)		NS(1)|central_nervous_system(1)|large_intestine(2)|lung(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	8						GCGCGGAGGAgccgccgccgccg	0.729														461	0.0920527	0.0098	0.1124	5008	,	,		5525	0.002		0.2664	False		,,,				2504	0.1022				p.165_165del		.											.	SP8-91	2	Deletion - In frame(2)	central_nervous_system(2)	c.493_495del						.		,	50,654		19,12,321					,	0.5	0.3			2	602,1424		217,168,628	no	coding,coding	SP8	NM_198956.2,NM_182700.4	,	236,180,949	A1A1,A1R,RR		29.7137,7.1023,23.8828	,	,		652,2078				SO:0001651	inframe_deletion	221833	exon2			GGAGGAGCCGCCG		CCDS5372.1, CCDS43555.1	7p21.2	2013-01-08			ENSG00000164651	ENSG00000164651		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	19196	protein-coding gene	gene with protein product		608306					Standard	NM_182700		Approved		uc003suz.3	Q8IXZ3	OTTHUMG00000094788	ENST00000361443.4:c.439_441delGGC	7.37:g.20824950_20824952delGCC	ENSP00000354482:p.Gly147del	Somatic	9	0		WXS	Illumina GAIIx	Phase_I	48	17	NM_182700	0	0	0	0	0	Q7Z615|Q7Z616|Q96MJ1	In_Frame_Del	DEL	ENST00000361443.4	37	CCDS5372.1																																																																																			.		0.729	SP8-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326904.2		
GPNMB	10457	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	23313809	23313809	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr7:23313809T>C	ENST00000381990.2	+	11	1846	c.1685T>C	c.(1684-1686)cTa>cCa	p.L562P	GPNMB_ENST00000478451.1_3'UTR|GPNMB_ENST00000539136.1_Missense_Mutation_p.L451P|GPNMB_ENST00000258733.4_Missense_Mutation_p.L550P|GPNMB_ENST00000453162.2_Missense_Mutation_p.L504P	NM_001005340.1|NM_002510.2	NP_001005340.1|NP_002501.1	Q14956	GPNMB_HUMAN	glycoprotein (transmembrane) nmb	562					bone mineralization (GO:0030282)|cell adhesion (GO:0007155)|negative regulation of cell proliferation (GO:0008285)|osteoblast differentiation (GO:0001649)	cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	heparin binding (GO:0008201)			breast(5)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|liver(2)|lung(17)|ovary(3)|stomach(2)	41			GBM - Glioblastoma multiforme(13;0.154)			AAGGATCCGCTACTCAAAAAC	0.443																																					p.L562P		.											.	GPNMB-580	0			c.T1685C						.						80.0	83.0	82.0					7																	23313809		2203	4300	6503	SO:0001583	missense	10457	exon11			ATCCGCTACTCAA	X76534	CCDS5380.1, CCDS34610.1	7p	2008-07-18			ENSG00000136235	ENSG00000136235			4462	protein-coding gene	gene with protein product	"""transmembrane glycoprotein"", ""glycoprotein NMB"", ""glycoprotein nmb-like protein"", ""osteoactivin"""	604368				7814155	Standard	NM_002510		Approved	NMB, HGFIN	uc003swc.3	Q14956	OTTHUMG00000022811	ENST00000381990.2:c.1685T>C	7.37:g.23313809T>C	ENSP00000371420:p.Leu562Pro	Somatic	51	0		WXS	Illumina GAIIx	Phase_I	44	11	NM_001005340	0	0	0	0	0	A4D155|Q6UVX1|Q8N1A1	Missense_Mutation	SNP	ENST00000381990.2	37	CCDS34610.1	.	.	.	.	.	.	.	.	.	.	T	17.40	3.380394	0.61845	.	.	ENSG00000136235	ENST00000258733;ENST00000435486;ENST00000381990;ENST00000425903;ENST00000539136;ENST00000453162	T;T;T;T	0.31769	1.55;1.5;1.57;1.48	5.93	5.93	0.95920	.	0.000000	0.50627	D	0.000116	T	0.55401	0.1918	M	0.65498	2.005	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;0.999;0.999	T	0.58025	-0.7709	10	0.87932	D	0	-13.7934	16.0444	0.80711	0.0:0.0:0.0:1.0	.	451;504;562;550	F6SKP1;F5GY20;Q14956;Q14956-2	.;.;GPNMB_HUMAN;.	P	550;597;562;445;451;504	ENSP00000258733:L550P;ENSP00000371420:L562P;ENSP00000445266:L451P;ENSP00000405586:L504P	ENSP00000258733:L550P	L	+	2	0	GPNMB	23280334	1.000000	0.71417	0.998000	0.56505	0.373000	0.29922	5.154000	0.64894	2.271000	0.75665	0.459000	0.35465	CTA	.		0.443	GPNMB-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327152.1	NM_001005340	
GARS	2617	hgsc.bcm.edu	37	7	30634661	30634661	+	Missense_Mutation	SNP	C	C	G	rs1049402	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr7:30634661C>G	ENST00000389266.3	+	1	365	c.124C>G	c.(124-126)Ccc>Gcc	p.P42A	AC005154.6_ENST00000582549.1_RNA|AC005154.6_ENST00000584372.1_RNA|AC005154.6_ENST00000579174.1_RNA|AC005154.6_ENST00000578994.1_RNA|AC005154.6_ENST00000581665.1_RNA|AC005154.6_ENST00000583664.1_RNA|AC005154.6_ENST00000584199.1_RNA|AC005154.6_ENST00000580440.1_RNA	NM_002047.2	NP_002038.2	P41250	SYG_HUMAN	glycyl-tRNA synthetase	42			P -> A (in dbSNP:rs1049402). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:7753621, ECO:0000269|PubMed:7961834, ECO:0000269|PubMed:7962006}.		cell death (GO:0008219)|diadenosine tetraphosphate biosynthetic process (GO:0015966)|gene expression (GO:0010467)|glycyl-tRNA aminoacylation (GO:0006426)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|secretory granule (GO:0030141)	ATP binding (GO:0005524)|glycine-tRNA ligase activity (GO:0004820)|protein dimerization activity (GO:0046983)	p.P42fs*20(1)		breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|skin(3)|urinary_tract(1)	24					Glycine(DB00145)	GGCCTCCTGCCCCCCGATCTC	0.736													G|||	3252	0.649361	0.5219	0.7147	5008	,	,		13746	0.6677		0.7634	False		,,,				2504	0.6391				p.P42A		.											.	GARS-91	1	Insertion - Frameshift(1)	large_intestine(1)	c.C124G						.	G	ALA/PRO	2445,1427		776,893,267	5.0	8.0	7.0		124	-6.6	0.0	7	dbSNP_86	7	6367,1671		2577,1213,229	no	missense	GARS	NM_002047.2	27	3353,2106,496	GG,GC,CC		20.7888,36.8543,26.0118	benign	42/740	30634661	8812,3098	1936	4019	5955	SO:0001583	missense	2617	exon1			TCCTGCCCCCCGA	AK074524	CCDS43564.1	7p15	2014-09-17	2004-02-13		ENSG00000106105	ENSG00000106105	6.1.1.14	"""Aminoacyl tRNA synthetases / Class II"""	4162	protein-coding gene	gene with protein product	"""glycine tRNA ligase"""	600287	"""Charcot-Marie-Tooth neuropathy 2D"""	CMT2D		8595897, 8872480	Standard	NM_002047		Approved	GlyRS, DSMAV, SMAD1	uc003tbm.3	P41250	OTTHUMG00000152769	ENST00000389266.3:c.124C>G	7.37:g.30634661C>G	ENSP00000373918:p.Pro42Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_002047	0	0	0	0	0	B3KQA2|B4DIA0|Q969Y1	Missense_Mutation	SNP	ENST00000389266.3	37	CCDS43564.1	1456	0.6666666666666666	278	0.5650406504065041	268	0.7403314917127072	337	0.5891608391608392	573	0.7559366754617414	G	0.005	-2.164835	0.00318	0.631457	0.792112	ENSG00000106105	ENST00000389266	T	0.80393	-1.37	3.31	-6.63	0.01807	.	1.037800	0.07609	N	0.925137	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.13575	-1.0504	9	0.08179	T	0.78	.	5.5596	0.17135	0.0726:0.2689:0.1197:0.5389	rs1049402;rs3189564;rs11553500;rs17856223;rs17856227;rs1049402	42	P41250	SYG_HUMAN	A	42	ENSP00000373918:P42A	ENSP00000373918:P42A	P	+	1	0	GARS	30601186	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	-0.671000	0.05250	-2.551000	0.00479	-0.744000	0.03518	CCC	C|0.329;G|0.671		0.736	GARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327735.1	NM_002047	
FZD9	8326	hgsc.bcm.edu	37	7	72848664	72848664	+	Silent	SNP	C	C	T	rs142125301	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr7:72848664C>T	ENST00000344575.3	+	1	556	c.327C>T	c.(325-327)ccC>ccT	p.P109P		NM_003508.2	NP_003499.1	O00144	FZD9_HUMAN	frizzled class receptor 9	109	FZ. {ECO:0000255|PROSITE- ProRule:PRU00090}.				B cell differentiation (GO:0030183)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|gonad development (GO:0008406)|learning or memory (GO:0007611)|nervous system development (GO:0007399)|neuroblast proliferation (GO:0007405)|vasculature development (GO:0001944)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(4)|prostate(2)|skin(1)	14		Lung NSC(55;0.0659)|all_lung(88;0.152)				CGCCCATTCCCGCCTGCCGGC	0.701													C|||	18	0.00359425	0.0008	0.0216	5008	,	,		6866	0.0		0.002	False		,,,				2504	0.0				p.P109P	Pancreas(144;909 1878 36867 38226 39554)	.											.	FZD9-1082	0			c.C327T						.	C		2,4236		0,2,2117	11.0	9.0	10.0		327	1.8	1.0	7	dbSNP_134	10	6,8352		0,6,4173	no	coding-synonymous	FZD9	NM_003508.2		0,8,6290	TT,TC,CC		0.0718,0.0472,0.0635		109/592	72848664	8,12588	2119	4179	6298	SO:0001819	synonymous_variant	8326	exon1			CATTCCCGCCTGC	U82169	CCDS5548.1	7q11.23	2014-01-29	2014-01-29		ENSG00000188763	ENSG00000188763		"""GPCR / Class F : Frizzled receptors"", ""CD molecules"""	4047	protein-coding gene	gene with protein product		601766	"""frizzled (Drosophila) homolog 9"", ""frizzled homolog 9 (Drosophila)"", ""frizzled 9, seven transmembrane spanning receptor"", ""frizzled family receptor 9"""			9147651, 10198163	Standard	NM_003508		Approved	FZD3, CD349	uc003tyb.3	O00144	OTTHUMG00000023051	ENST00000344575.3:c.327C>T	7.37:g.72848664C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	32	12	NM_003508	0	0	0	0	0		Silent	SNP	ENST00000344575.3	37	CCDS5548.1																																																																																			C|0.998;T|0.002		0.701	FZD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252120.1		
DBF4	10926	broad.mit.edu;bcgsc.ca	37	7	87529633	87529633	+	Frame_Shift_Del	DEL	A	A	-			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr7:87529633delA	ENST00000265728.1	+	9	1282	c.778delA	c.(778-780)agtfs	p.S260fs		NM_006716.3	NP_006707.1	Q9UBU7	DBF4A_HUMAN	DBF4 zinc finger	260					DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|positive regulation of catalytic activity (GO:0043085)	nucleoplasm (GO:0005654)	enzyme activator activity (GO:0008047)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(1)|large_intestine(6)|lung(13)|ovary(1)|skin(3)	28	Esophageal squamous(14;0.00202)	Breast(660;0.0334)				CAAGCCATCTAGTATGCAAAA	0.318																																					p.S260fs		.											.	DBF4-253	0			c.778delA						.						64.0	67.0	66.0					7																	87529633		2202	4294	6496	SO:0001589	frameshift_variant	10926	exon9			CCATCTAGTATGC	AF160876	CCDS5611.1	7q21.3	2014-02-17	2014-02-17		ENSG00000006634	ENSG00000006634		"""Zinc fingers, DBF-type"""	17364	protein-coding gene	gene with protein product	"""activator of S phase kinase"", ""chiffon homolog (Drosophila)"", ""zinc finger, DBF-type containing 1"", ""DBF4 zinc finger A"""	604281	"""DBF4 homolog (S. cerevisiae)"""			10373557, 10517317	Standard	NM_006716		Approved	ASK, chif, ZDBF1, DBF4A	uc003ujf.1	Q9UBU7	OTTHUMG00000131034	ENST00000265728.1:c.778delA	7.37:g.87529633delA	ENSP00000265728:p.Ser260fs	Somatic	95	0		WXS	Illumina GAIIx	Phase_I	94	12	NM_006716	0	0	0	0	0	A4D1D8|A8K954|O75226|Q75MS6|Q75N01|Q9Y2M6	Frame_Shift_Del	DEL	ENST00000265728.1	37	CCDS5611.1																																																																																			.		0.318	DBF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253678.1	NM_006716	
PODXL	5420	hgsc.bcm.edu	37	7	131241030	131241035	+	In_Frame_Del	DEL	GGCGAC	GGCGAC	-	rs11277659|rs547816245|rs532078953	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	GGCGAC	GGCGAC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr7:131241030_131241035delGGCGAC	ENST00000378555.3	-	1	331_336	c.84_89delGTCGCC	c.(82-90)ccgtcgccc>ccc	p.28_30PSP>P	PODXL_ENST00000541194.1_In_Frame_Del_p.28_30PSP>P|PODXL_ENST00000537928.1_In_Frame_Del_p.28_30PSP>P|PODXL_ENST00000322985.9_In_Frame_Del_p.28_30PSP>P|PODXL_ENST00000465001.1_Intron			O00592	PODXL_HUMAN	podocalyxin-like	28					cell adhesion (GO:0007155)|cell migration (GO:0016477)|epithelial tube formation (GO:0072175)|glomerular visceral epithelial cell development (GO:0072015)|leukocyte migration (GO:0050900)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-cell adhesion (GO:0022408)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|regulation of microvillus assembly (GO:0032534)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|slit diaphragm (GO:0036057)		p.P30_S31delPS(2)		NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24	Melanoma(18;0.162)					ATTCTGGGAGggcgacggcgacggcg	0.748																																					p.28_30del		.											.	PODXL-136	2	Deletion - In frame(2)	prostate(2)	c.84_89del						.																																			SO:0001651	inframe_deletion	5420	exon1			TGGGAGGGCGACG		CCDS34755.1, CCDS47714.1	7q32-q33	2008-07-18			ENSG00000128567	ENSG00000128567			9171	protein-coding gene	gene with protein product		602632					Standard	NM_001018111		Approved	PCLP, Gp200, PC	uc003vqx.4	O00592	OTTHUMG00000154918	ENST00000378555.3:c.84_89delGTCGCC	7.37:g.131241036_131241041delGGCGAC	ENSP00000367817:p.Pro30_Ser31del	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	23	11	NM_001018111	0	0	0	0	0	A6NHX8|Q52LZ7|Q53ER6	In_Frame_Del	DEL	ENST00000378555.3	37	CCDS34755.1																																																																																			.		0.748	PODXL-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000337627.2	NM_001018111	
ZNF775	285971	hgsc.bcm.edu	37	7	150094851	150094851	+	Missense_Mutation	SNP	A	A	G	rs13225910	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr7:150094851A>G	ENST00000329630.5	+	3	1389	c.1282A>G	c.(1282-1284)Acg>Gcg	p.T428A		NM_173680.3	NP_775951.2	Q96BV0	ZN775_HUMAN	zinc finger protein 775	428			T -> A (in dbSNP:rs13225910).		regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|liver(1)|lung(7)|skin(1)	11	Ovarian(565;0.183)|Melanoma(164;0.226)		OV - Ovarian serous cystadenocarcinoma(82;0.0173)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GGCCCGGGACACGCTGTGGGG	0.756													G|||	1894	0.378195	0.2814	0.3228	5008	,	,		7213	0.4702		0.4354	False		,,,				2504	0.3947				p.T428A		.											.	ZNF775-90	0			c.A1282G						.	G	ALA/THR	951,2643		177,597,1023	4.0	5.0	4.0		1282	1.2	0.0	7	dbSNP_121	4	2946,4600		676,1594,1503	no	missense	ZNF775	NM_173680.3	58	853,2191,2526	GG,GA,AA		39.0406,26.4608,34.982	benign	428/538	150094851	3897,7243	1797	3773	5570	SO:0001583	missense	285971	exon3			CGGGACACGCTGT	BC038111	CCDS43678.1	7q36.1	2013-01-08			ENSG00000196456	ENSG00000196456		"""Zinc fingers, C2H2-type"""	28501	protein-coding gene	gene with protein product						12477932	Standard	NM_173680		Approved	MGC33584	uc003whf.1	Q96BV0	OTTHUMG00000158324	ENST00000329630.5:c.1282A>G	7.37:g.150094851A>G	ENSP00000330838:p.Thr428Ala	Somatic	2	0		WXS	Illumina GAIIx	Phase_I	9	9	NM_173680	0	0	0	0	0	Q8IY24	Missense_Mutation	SNP	ENST00000329630.5	37	CCDS43678.1	922	0.42216117216117216	169	0.3434959349593496	128	0.35359116022099446	298	0.5209790209790209	327	0.4313984168865435	G	0.004	-2.282788	0.00251	0.264608	0.390406	ENSG00000196456	ENST00000329630	T	0.08008	3.14	3.27	1.23	0.21249	.	.	.	.	.	T	0.00012	0.0000	N	0.03608	-0.345	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.35325	-0.9793	7	.	.	.	.	3.7266	0.08477	0.2539:0.2047:0.5414:0.0	rs13225910	428	Q96BV0	ZN775_HUMAN	A	428	ENSP00000330838:T428A	.	T	+	1	0	ZNF775	149725784	0.006000	0.16342	0.000000	0.03702	0.003000	0.03518	0.602000	0.24134	0.141000	0.18875	-0.213000	0.12676	ACG	A|0.578;G|0.422		0.756	ZNF775-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350679.1	NM_173680	
KMT2C	58508	broad.mit.edu	37	7	151843708	151843709	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr7:151843708_151843709delAG	ENST00000262189.6	-	53	14224_14225	c.14006_14007delCT	c.(14005-14007)tctfs	p.S4669fs	KMT2C_ENST00000355193.2_Frame_Shift_Del_p.S4726fs	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	4669	FYR C-terminal. {ECO:0000255|PROSITE- ProRule:PRU00876}.				histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										GTGCCACTGCAGAGACGGTCAG	0.465											OREG0018460	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.4669_4669del		.											.	MLL3-1398	0			c.14006_14007del						.																																			SO:0001589	frameshift_variant	58508	exon53			CACTGCAGAGACG	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.14006_14007delCT	7.37:g.151843710_151843711delAG	ENSP00000262189:p.Ser4669fs	Somatic	32	0	1743	WXS	Illumina GAIIx	Phase_I	56	9	NM_170606	0	0	0	0	0	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Frame_Shift_Del	DEL	ENST00000262189.6	37	CCDS5931.1																																																																																			.		0.465	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
SLC20A2	6575	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	42317494	42317494	+	Missense_Mutation	SNP	T	T	C	rs142888552		TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr8:42317494T>C	ENST00000342228.3	-	5	902	c.533A>G	c.(532-534)aAt>aGt	p.N178S	SLC20A2_ENST00000520179.1_Missense_Mutation_p.N178S|SLC20A2_ENST00000520262.1_Missense_Mutation_p.N178S	NM_006749.4	NP_006740.1	Q08357	S20A2_HUMAN	solute carrier family 20 (phosphate transporter), member 2	178					ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	inorganic phosphate transmembrane transporter activity (GO:0005315)|receptor activity (GO:0004872)|sodium:phosphate symporter activity (GO:0005436)|virus receptor activity (GO:0001618)			breast(1)|endometrium(6)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|stomach(1)	26	all_lung(13;8.33e-12)|Lung NSC(13;1.41e-10)|Ovarian(28;0.00579)|Prostate(17;0.0119)|Lung SC(25;0.211)	all_lung(54;0.00671)|Lung NSC(58;0.0184)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	BRCA - Breast invasive adenocarcinoma(8;5.73e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00419)|Lung(22;0.0302)|LUSC - Lung squamous cell carcinoma(45;0.0869)			CCGGAGGCCATTGGGAACAGG	0.483													T|||	1	0.000199681	0.0008	0.0	5008	,	,		20080	0.0		0.0	False		,,,				2504	0.0				p.N178S		.											.	SLC20A2-92	0			c.A533G						.	T	SER/ASN	4,4402	8.1+/-20.4	0,4,2199	79.0	70.0	73.0		533	6.0	1.0	8	dbSNP_134	73	0,8600		0,0,4300	yes	missense	SLC20A2	NM_006749.3	46	0,4,6499	CC,CT,TT		0.0,0.0908,0.0308	probably-damaging	178/653	42317494	4,13002	2203	4300	6503	SO:0001583	missense	6575	exon5			AGGCCATTGGGAA		CCDS6132.1	8p11.21	2013-05-22			ENSG00000168575	ENSG00000168575		"""Solute carriers"""	10947	protein-coding gene	gene with protein product		158378		MLVAR, GLVR2		7745689, 16790504	Standard	NM_001257180		Approved	PiT-2, Glvr-2	uc010lxm.4	Q08357	OTTHUMG00000164169	ENST00000342228.3:c.533A>G	8.37:g.42317494T>C	ENSP00000340465:p.Asn178Ser	Somatic	117	0		WXS	Illumina GAIIx	Phase_I	106	27	NM_001257181	0	0	0	0	0		Missense_Mutation	SNP	ENST00000342228.3	37	CCDS6132.1	.	.	.	.	.	.	.	.	.	.	T	16.76	3.211250	0.58343	9.08E-4	0.0	ENSG00000168575	ENST00000342228;ENST00000520262;ENST00000520179	D;D;D	0.90069	-2.61;-2.61;-2.61	5.98	5.98	0.97165	.	0.000000	0.85682	D	0.000000	D	0.91264	0.7246	L	0.49256	1.55	0.80722	D	1	D	0.56287	0.975	D	0.63113	0.911	D	0.88890	0.3345	10	0.21014	T	0.42	-23.5636	14.4016	0.67050	0.0:0.0:0.0:1.0	.	178	Q08357	S20A2_HUMAN	S	178	ENSP00000340465:N178S;ENSP00000429754:N178S;ENSP00000429712:N178S	ENSP00000340465:N178S	N	-	2	0	SLC20A2	42436651	1.000000	0.71417	1.000000	0.80357	0.280000	0.26924	8.036000	0.88901	2.284000	0.76573	0.533000	0.62120	AAT	T|0.999;C|0.001		0.483	SLC20A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377578.1		
MAL2	114569	hgsc.bcm.edu	37	8	120220776	120220776	+	Splice_Site	DEL	G	G	-	rs398009582|rs71302978		TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr8:120220776delG	ENST00000276681.6	+	1	167	c.65delG	c.(64-66)cgg>cg	p.R22fs	MAL2_ENST00000521748.1_3'UTR	NM_052886.2	NP_443118.1	Q969L2	MAL2_HUMAN	mal, T-cell differentiation protein 2 (gene/pseudogene)	22						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)						all_cancers(13;1.91e-26)|Lung NSC(37;8.61e-08)|Ovarian(258;0.018)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.000967)			CCGCCGCCCCGGGGTCACCCT	0.771													GGG|GGGG|GGG|insertion	5008	1.0	1.0	1.0	5008	,	,		6681	1.0		1.0	False		,,,				2504	1.0				.		.											.	.	0			c.64+1G>-						.			1571,11		785,1,5	1.0	1.0	1.0			0.7	0.8	8	dbSNP_130	1	4116,22		2057,2,10	no	frameshift	MAL2	NM_052886.2		2842,3,15	A1A1,A1R,RR		0.5317,0.6953,0.5769			120220776	5687,33	184	483	667	SO:0001630	splice_region_variant	114569	exon1			CGCCCCGGGGTCA	AL117612	CCDS75780.1	8q23	2011-01-26	2011-01-26			ENSG00000147676			13634	protein-coding gene	gene with protein product	"""MAL proteolipid protein 2"""	609684				11549320	Standard	NM_052886		Approved		uc003yop.3	Q969L2		ENST00000276681.6:c.66+1G>-	8.37:g.120220776delG		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	14	14	NM_052886	0	0	0	0	0	B2R520|Q6ZMD9	Splice_Site	DEL	ENST00000276681.6	37																																																																																				.		0.771	MAL2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052886	Frame_Shift_Del
POU5F1B	5462	broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	128428589	128428589	+	Silent	SNP	C	C	T			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr8:128428589C>T	ENST00000465342.2	+	2	1635	c.478C>T	c.(478-480)Ctg>Ttg	p.L160L	CASC8_ENST00000502082.1_RNA|CASC8_ENST00000523825.1_RNA|CASC8_ENST00000501396.1_RNA|POU5F1B_ENST00000391675.1_Silent_p.L160L			Q06416	P5F1B_HUMAN	POU class 5 homeobox 1B	160	POU-specific. {ECO:0000255|PROSITE- ProRule:PRU00530}.			L -> P (in Ref. 5; ADW77417). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(1)|prostate(1)|urinary_tract(1)	3						GAGGATCACCCTGGGATATAC	0.527																																					p.L160L		.											.	.	0			c.C478T						.						44.0	52.0	49.0					8																	128428589		692	1591	2283	SO:0001819	synonymous_variant	5462	exon1			ATCACCCTGGGAT	AF268615	CCDS55274.1	8q24.21	2011-06-20	2009-04-15	2009-04-15	ENSG00000212993	ENSG00000212993		"""Homeoboxes / POU class"""	9223	protein-coding gene	gene with protein product		615739	"""POU domain class 5, transcription factor 1 pseudogene 1"", ""POU class 5 homeobox 1 pseudogene 1"""	OTF3P1, POU5F1P1		1408763	Standard	NM_001159542		Approved	OTF3C	uc003ysf.3	Q06416	OTTHUMG00000157807	ENST00000465342.2:c.478C>T	8.37:g.128428589C>T		Somatic	48	0		WXS	Illumina GAIIx	Phase_I	53	5	NM_001159542	0	0	0	0	0	D5K9S4|D5K9S9|D5K9T0|D5K9T1|D5K9T3|D5K9U3|D5K9U6|D5K9V4|D5K9V6|D5K9W0|D5K9W2|D5K9W7|D5K9X2|D5K9X3|D5K9X5|D5K9X8|D5K9X9|E9LRB1|E9LRB2|E9LRH5|E9LRH6|E9LRH7|E9LRK4|E9LRK5|E9LRK7|E9LRK8|E9LRM7|E9LRM9|E9LRN2|E9LRN4|E9LRN5|E9LRP8|E9LRQ0|E9LRQ2|E9LRQ3|E9LRQ4|E9LRQ5|E9LRS3|Q2VIK6|Q9BZV7|Q9BZV9	Silent	SNP	ENST00000465342.2	37	CCDS55274.1																																																																																			.		0.527	POU5F1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349649.2	NM_001159542	
ZNF696	79943	hgsc.bcm.edu	37	8	144378868	144378868	+	Silent	SNP	A	A	G	rs7386259	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr8:144378868A>G	ENST00000330143.3	+	3	1432	c.1023A>G	c.(1021-1023)cgA>cgG	p.R341R		NM_030895.2	NP_112157.2	Q9H7X3	ZN696_HUMAN	zinc finger protein 696	341					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	8	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)			GGCACCAGCGACTCCACACGG	0.726													G|||	4505	0.899561	0.9425	0.9179	5008	,	,		11520	0.8403		0.8608	False		,,,				2504	0.9294				p.R341R		.											.	ZNF696-90	0			c.A1023G						.	G		3773,275		1771,231,22	5.0	5.0	5.0		1023	-0.3	0.0	8	dbSNP_116	5	6735,1261		2843,1049,106	no	coding-synonymous	ZNF696	NM_030895.2		4614,1280,128	GG,GA,AA		15.7704,6.7935,12.7532		341/375	144378868	10508,1536	2024	3998	6022	SO:0001819	synonymous_variant	79943	exon3			CCAGCGACTCCAC	AK024191	CCDS6399.1	8q24.3	2013-01-08				ENSG00000185730		"""Zinc fingers, C2H2-type"""	25872	protein-coding gene	gene with protein product							Standard	NM_030895		Approved	FLJ14129	uc003yxy.4	Q9H7X3		ENST00000330143.3:c.1023A>G	8.37:g.144378868A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_030895	0	0	0	0	0	A0AVE2	Silent	SNP	ENST00000330143.3	37	CCDS6399.1																																																																																			A|0.118;G|0.882		0.726	ZNF696-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381164.2	NM_030895	
PLEC	5339	hgsc.bcm.edu	37	8	145001588	145001588	+	Missense_Mutation	SNP	C	C	T	rs11136334	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr8:145001588C>T	ENST00000322810.4	-	27	4326	c.4157G>A	c.(4156-4158)cGg>cAg	p.R1386Q	PLEC_ENST00000345136.3_Missense_Mutation_p.R1249Q|PLEC_ENST00000356346.3_Missense_Mutation_p.R1235Q|PLEC_ENST00000527096.1_Missense_Mutation_p.R1272Q|PLEC_ENST00000398774.2_Missense_Mutation_p.R1217Q|PLEC_ENST00000436759.2_Missense_Mutation_p.R1276Q|PLEC_ENST00000357649.2_Missense_Mutation_p.R1253Q|PLEC_ENST00000354958.2_Missense_Mutation_p.R1227Q|PLEC_ENST00000354589.3_Missense_Mutation_p.R1249Q	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	1386	Globular 1.		R -> Q (in dbSNP:rs11136334).		apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CTGCTCCTGCCGCAGCTGCTC	0.736													C|||	1156	0.230831	0.028	0.2954	5008	,	,		13418	0.1429		0.4274	False		,,,				2504	0.3476				p.R1386Q		.											.	PLEC-141	0			c.G4157A						.	C	GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG	388,3674		38,312,1681	12.0	16.0	15.0		3746,3758,3746,3650,4157,3680,3704,3827	-0.7	1.0	8	dbSNP_120	15	3413,4885		747,1919,1483	no	missense,missense,missense,missense,missense,missense,missense,missense	PLEC	NM_201384.1,NM_201383.1,NM_201382.2,NM_201381.1,NM_201380.2,NM_201379.1,NM_201378.2,NM_000445.3	43,43,43,43,43,43,43,43	785,2231,3164	TT,TC,CC		41.1304,9.5519,30.7524	benign,benign,benign,benign,benign,benign,benign,benign	1249/4548,1253/4552,1249/4548,1217/4516,1386/4685,1227/4526,1235/4534,1276/4575	145001588	3801,8559	2031	4149	6180	SO:0001583	missense	5339	exon27			TCCTGCCGCAGCT	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.4157G>A	8.37:g.145001588C>T	ENSP00000323856:p.Arg1386Gln	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	15	7	NM_201380	0	0	0	0	0	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Missense_Mutation	SNP	ENST00000322810.4	37	CCDS43772.1	536	0.2454212454212454	15	0.03048780487804878	108	0.2983425414364641	94	0.16433566433566432	319	0.420844327176781	C	12.61	1.989397	0.35131	0.095519	0.411304	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096	T;T;T;T;T;T;T;T;T	0.34072	1.38;1.38;1.38;1.38;1.38;1.38;1.38;1.38;1.38	5.1	-0.662	0.11413	.	1.260670	0.05768	N	0.606168	T	0.00012	0.0000	N	0.02011	-0.69	0.41093	P	0.014382000000000006	B;B;B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B;B;B	0.01281	0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0	T	0.44605	-0.9317	9	0.19590	T	0.45	.	4.6892	0.12772	0.2556:0.2308:0.0:0.5136	rs11136334	1276;1235;1227;1386;1217;1249;1253;1249	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4	.;.;.;PLEC_HUMAN;.;.;.;.	Q	1249;1253;1249;1217;1386;1227;1235;1276;1272	ENSP00000344848:R1249Q;ENSP00000350277:R1253Q;ENSP00000346602:R1249Q;ENSP00000381756:R1217Q;ENSP00000323856:R1386Q;ENSP00000347044:R1227Q;ENSP00000348702:R1235Q;ENSP00000388180:R1276Q;ENSP00000434583:R1272Q	ENSP00000323856:R1386Q	R	-	2	0	PLEC	145073576	0.001000	0.12720	0.979000	0.43373	0.833000	0.47200	0.002000	0.13061	-0.040000	0.13580	-0.369000	0.07265	CGG	C|0.707;T|0.293		0.736	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
RIC1	57589	broad.mit.edu	37	9	5765734	5765734	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr9:5765734G>T	ENST00000414202.2	+	21	3264	c.3073G>T	c.(3073-3075)Gtt>Ttt	p.V1025F	KIAA1432_ENST00000449720.2_Missense_Mutation_p.V909F|KIAA1432_ENST00000381532.2_Missense_Mutation_p.V946F|KIAA1432_ENST00000251879.6_Missense_Mutation_p.V1025F|KIAA1432_ENST00000418622.3_Missense_Mutation_p.V946F	NM_001206557.1|NM_020829.3	NP_001193486.1|NP_065880.2														breast(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(6)|lung(23)|prostate(1)|upper_aerodigestive_tract(1)	45		Acute lymphoblastic leukemia(23;0.154)		GBM - Glioblastoma multiforme(50;0.000525)|Lung(218;0.122)		AGCTGAAAATGTTCCTGCCAG	0.408																																					p.V1025F		.											.	KIAA1432-90	0			c.G3073T						.						113.0	120.0	118.0					9																	5765734		2203	4300	6503	SO:0001583	missense	57589	exon21			GAAAATGTTCCTG																												ENST00000414202.2:c.3073G>T	9.37:g.5765734G>T	ENSP00000416696:p.Val1025Phe	Somatic	147	2		WXS	Illumina GAIIx	Phase_I	138	7	NM_001135920	0	0	0	0	0		Missense_Mutation	SNP	ENST00000414202.2	37	CCDS34982.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	6.436|6.436	0.448497|0.448497	0.12223|0.12223	.|.	.|.	ENSG00000107036|ENSG00000107036	ENST00000545641|ENST00000251879;ENST00000414202;ENST00000381532;ENST00000418622;ENST00000449720	.|.	.|.	.|.	5.93|5.93	3.97|3.97	0.46021|0.46021	.|.	.|0.310631	.|0.34531	.|N	.|0.003881	T|T	0.29223|0.29223	0.0727|0.0727	N|N	0.08118|0.08118	0|0	0.54753|0.54753	D|D	0.99998|0.99998	.|B;B;B;B	.|0.06786	.|0.0;0.001;0.0;0.001	.|B;B;B;B	.|0.08055	.|0.0;0.001;0.001;0.003	T|T	0.12528|0.12528	-1.0544|-1.0544	5|9	.|0.51188	.|T	.|0.08	-14.9011|-14.9011	7.829|7.829	0.29332|0.29332	0.0:0.2592:0.4921:0.2487|0.0:0.2592:0.4921:0.2487	.|.	.|909;946;1025;1025	.|B7ZM67;B2RN24;Q4ADV7;G5E932	.|.;.;RIC1_HUMAN;.	F|F	916|1025;1025;946;946;909	.|.	.|ENSP00000251879:V1025F	C|V	+|+	2|1	0|0	KIAA1432|KIAA1432	5755734|5755734	0.999000|0.999000	0.42202|0.42202	0.919000|0.919000	0.36401|0.36401	0.501000|0.501000	0.33797|0.33797	0.829000|0.829000	0.27449|0.27449	2.814000|2.814000	0.96858|0.96858	0.563000|0.563000	0.77884|0.77884	TGT|GTT	.		0.408	KIAA1432-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051636.3		
ERMP1	79956	hgsc.bcm.edu	37	9	5832728	5832728	+	Silent	SNP	G	G	C	rs1131727	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr9:5832728G>C	ENST00000339450.5	-	1	389	c.300C>G	c.(298-300)gcC>gcG	p.A100A	ERMP1_ENST00000214893.5_5'UTR|ERMP1_ENST00000381506.3_5'Flank	NM_024896.2	NP_079172.2	Q7Z2K6	ERMP1_HUMAN	endoplasmic reticulum metallopeptidase 1	100						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			endometrium(2)|kidney(1)|large_intestine(9)|lung(4)|ovary(1)|prostate(2)|skin(1)	20		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00115)|Lung(218;0.111)		GGTGTCCAGCGGCCCCGCGTA	0.741													G|||	2021	0.403554	0.1309	0.428	5008	,	,		3601	0.7093		0.34	False		,,,				2504	0.5051				p.A100A		.											.	ERMP1-69	0			c.C300G						.						4.0	3.0	3.0					9																	5832728		1620	3326	4946	SO:0001819	synonymous_variant	79956	exon1			TCCAGCGGCCCCG	AB058718	CCDS34983.1	9p24	2008-02-05	2007-07-05	2007-07-05	ENSG00000099219	ENSG00000099219			23703	protein-coding gene	gene with protein product	"""Felix-ina"""	611156	"""KIAA1815"""	KIAA1815		11347906	Standard	XM_005251587		Approved	FLJ23309, FXNA	uc003zjm.1	Q7Z2K6	OTTHUMG00000019508	ENST00000339450.5:c.300C>G	9.37:g.5832728G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	15	6	NM_024896	0	0	0	0	0	B2RNA4|B3KSB1|Q8N5T5|Q9H5M1	Silent	SNP	ENST00000339450.5	37	CCDS34983.1																																																																																			G|0.572;C|0.428		0.741	ERMP1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354877.1	NM_024896	
ANKRD18B	441459	bcgsc.ca	37	9	33566234	33566234	+	Silent	SNP	C	C	T	rs62559879	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr9:33566234C>T	ENST00000290943.6	+	13	2388	c.2292C>T	c.(2290-2292)gcC>gcT	p.A764A		NM_001244752.1	NP_001231681.1	A2A2Z9	AN18B_HUMAN	ankyrin repeat domain 18B	764										NS(1)|breast(1)|endometrium(2)|lung(1)|prostate(1)|stomach(1)	7						ATCTTATGGCCGAGAAGGAAG	0.328													.|||	799	0.159545	0.0121	0.196	5008	,	,		17645	0.2083		0.2455	False		,,,				2504	0.1943				p.A763A		.											.	.	0			c.C2289T						.																																			SO:0001819	synonymous_variant	441459	exon13			TATGGCCGAGAAG			9p13.3	2013-01-10			ENSG00000230453	ENSG00000230453		"""Ankyrin repeat domain containing"""	23644	protein-coding gene	gene with protein product							Standard	NM_001244752		Approved	bA255A11.3	uc010mjw.2	A2A2Z9	OTTHUMG00000019776	ENST00000290943.6:c.2292C>T	9.37:g.33566234C>T		Somatic	76	0		WXS	Illumina GAIIx	Phase_I	80	5	NM_001244752	0	0	0	0	0		Silent	SNP	ENST00000290943.6	37																																																																																				T|1.000;|0.000		0.328	ANKRD18B-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000313729.2	XM_001718334	
HDHD3	81932	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	116135916	116135916	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr9:116135916G>A	ENST00000238379.5	-	2	1616	c.719C>T	c.(718-720)gCc>gTc	p.A240V	HDHD3_ENST00000485934.1_5'Flank|HDHD3_ENST00000374180.3_Missense_Mutation_p.A240V	NM_031219.2	NP_112496.1	Q9BSH5	HDHD3_HUMAN	haloacid dehalogenase-like hydrolase domain containing 3	240						mitochondrion (GO:0005739)	hydrolase activity (GO:0016787)			large_intestine(2)|liver(1)	3						GCAGTCAAGGGCAGGCAGGAG	0.587																																					p.A240V		.											.	HDHD3-90	0			c.C719T						.						78.0	81.0	80.0					9																	116135916		2203	4300	6503	SO:0001583	missense	81932	exon2			TCAAGGGCAGGCA	AK097067	CCDS6793.1	9q33.1	2006-04-12	2004-08-09	2004-08-12	ENSG00000119431	ENSG00000119431			28171	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 158"""	C9orf158		12477932	Standard	NM_031219		Approved	MGC12904	uc004bhi.1	Q9BSH5	OTTHUMG00000020524	ENST00000238379.5:c.719C>T	9.37:g.116135916G>A	ENSP00000238379:p.Ala240Val	Somatic	53	0		WXS	Illumina GAIIx	Phase_I	58	16	NM_031219	0	0	0	0	0	B2RD47	Missense_Mutation	SNP	ENST00000238379.5	37	CCDS6793.1	.	.	.	.	.	.	.	.	.	.	G	13.70	2.316379	0.40996	.	.	ENSG00000119431	ENST00000238379;ENST00000374180	T;T	0.40756	1.02;1.02	5.74	5.74	0.90152	HAD-like domain (1);	0.509796	0.21282	N	0.077131	T	0.18087	0.0434	N	0.19112	0.55	0.33568	D	0.598207	P	0.38992	0.653	B	0.23852	0.049	T	0.19160	-1.0314	10	0.13108	T	0.6	-17.6322	5.2559	0.15546	0.0768:0.1441:0.6294:0.1496	.	240	Q9BSH5	HDHD3_HUMAN	V	240	ENSP00000238379:A240V;ENSP00000363295:A240V	ENSP00000238379:A240V	A	-	2	0	HDHD3	115175737	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	1.842000	0.39250	2.716000	0.92895	0.650000	0.86243	GCC	.		0.587	HDHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053731.1	NM_031219	
CACNA1B	774	hgsc.bcm.edu	37	9	140917779	140917779	+	Missense_Mutation	SNP	G	G	T	rs7873074	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr9:140917779G>T	ENST00000371372.1	+	19	2729	c.2584G>T	c.(2584-2586)Gcg>Tcg	p.A862S	CACNA1B_ENST00000371363.1_Missense_Mutation_p.A862S|CACNA1B_ENST00000371355.4_Missense_Mutation_p.A863S|CACNA1B_ENST00000371357.1_Missense_Mutation_p.A863S|CACNA1B_ENST00000277549.5_Missense_Mutation_p.A54S|CACNA1B_ENST00000277551.2_Missense_Mutation_p.A862S|CACNA1B_ENST00000371367.5_5'Flank|CACNA1B_ENST00000545473.1_5'Flank	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	862			A -> S (in dbSNP:rs7873074).		calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	CAAGACCCCCGCGGCGGGGGA	0.771													G|||	2138	0.426917	0.7292	0.1383	5008	,	,		8593	0.6339		0.1541	False		,,,				2504	0.2904				p.A862S		.											.	CACNA1B-138	0			c.G2584T						.						1.0	1.0	1.0					9																	140917779		1024	2272	3296	SO:0001583	missense	774	exon19			ACCCCCGCGGCGG	AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.2584G>T	9.37:g.140917779G>T	ENSP00000360423:p.Ala862Ser	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_001243812	0	0	0	0	0	B1AQK5	Missense_Mutation	SNP	ENST00000371372.1	37	CCDS59522.1	871	0.39880952380952384	351	0.7134146341463414	42	0.11602209944751381	361	0.6311188811188811	117	0.15435356200527706	G	2.404	-0.336886	0.05278	.	.	ENSG00000148408	ENST00000371372;ENST00000277551;ENST00000277549;ENST00000371363;ENST00000371357;ENST00000371355	D;D;D;D;D;D	0.96685	-3.87;-3.88;-4.09;-3.88;-3.86;-3.86	2.64	2.64	0.31445	.	607.713000	0.00166	N	0.000000	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	P;P;P	0.41748	0.731;0.761;0.612	B;B;B	0.32149	0.071;0.141;0.081	T	0.48559	-0.9025	9	0.07813	T	0.8	.	8.5047	0.33179	0.0:0.0:1.0:0.0	rs7873074;rs57704776	862;863;862	B1AQK4;B1AQK7;B1AQK6	.;.;.	S	862;862;54;862;863;863	ENSP00000360423:A862S;ENSP00000277551:A862S;ENSP00000277549:A54S;ENSP00000360414:A862S;ENSP00000360408:A863S;ENSP00000360406:A863S	ENSP00000277549:A54S	A	+	1	0	CACNA1B	140037600	0.000000	0.05858	0.012000	0.15200	0.095000	0.18619	-0.158000	0.10070	1.290000	0.44636	0.455000	0.32223	GCG	G|0.601;T|0.399		0.771	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055380.1	NM_000718	
SAT1	6303	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	23803894	23803894	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chrX:23803894C>T	ENST00000379270.4	+	6	616	c.437C>T	c.(436-438)tCt>tTt	p.S146F	SAT1_ENST00000489394.1_3'UTR|RP13-314C10.5_ENST00000366134.2_RNA|SAT1_ENST00000379254.1_Missense_Mutation_p.S118F	NM_002970.2	NP_002961.1	Q9H2B4	S26A1_HUMAN	spermidine/spermine N1-acetyltransferase 1	0					3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|carbohydrate metabolic process (GO:0005975)|chloride transport (GO:0006821)|glycosaminoglycan metabolic process (GO:0030203)|ion transport (GO:0006811)|oxalate transport (GO:0019532)|small molecule metabolic process (GO:0044281)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)|xenobiotic metabolic process (GO:0006805)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	anion:anion antiporter activity (GO:0015301)|chloride transmembrane transporter activity (GO:0015108)|oxalate transmembrane transporter activity (GO:0019531)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)			breast(1)|endometrium(3)|kidney(3)|lung(3)	10						AGAGGTGCTTCTGATCTGTCC	0.453																																					p.S146F		.											.	SAT1-554	0			c.C437T						.						91.0	80.0	84.0					X																	23803894		2203	4300	6503	SO:0001583	missense	6303	exon6			GTGCTTCTGATCT	M55580	CCDS14207.1	Xp22.1	2011-11-16	2006-08-24	2006-08-24	ENSG00000130066	ENSG00000130066	2.3.1.57		10540	protein-coding gene	gene with protein product	"""diamine N-acetyltransferase 1"""	313020	"""spermidine/spermine N1-acetyltransferase"""	SAT		1985966, 1417826	Standard	NM_002970		Approved	SSAT	uc004dau.3	P21673	OTTHUMG00000021256	ENST00000379270.4:c.437C>T	X.37:g.23803894C>T	ENSP00000368572:p.Ser146Phe	Somatic	332	0		WXS	Illumina GAIIx	Phase_I	301	63	NM_002970	0	0	0	0	0	A8K9N2|Q7Z5R3|Q96BK0	Missense_Mutation	SNP	ENST00000379270.4	37	CCDS14207.1	.	.	.	.	.	.	.	.	.	.	C	12.91	2.079029	0.36662	.	.	ENSG00000130066	ENST00000379270;ENST00000379254;ENST00000342463	T;T	0.43688	0.94;0.94	5.81	4.94	0.65067	GCN5-related N-acetyltransferase (GNAT) domain (1);Acyl-CoA N-acyltransferase (2);	0.272836	0.36932	N	0.002324	T	0.48259	0.1490	M	0.66378	2.025	0.53688	D	0.999974	P	0.35328	0.495	B	0.39379	0.298	T	0.49532	-0.8930	10	0.54805	T	0.06	-10.5477	15.8989	0.79356	0.0:0.8681:0.1319:0.0	.	146	P21673	SAT1_HUMAN	F	146;118;174	ENSP00000368572:S146F;ENSP00000368556:S118F	ENSP00000343343:S174F	S	+	2	0	SAT1	23713815	1.000000	0.71417	0.996000	0.52242	0.997000	0.91878	4.747000	0.62141	1.179000	0.42884	0.594000	0.82650	TCT	.		0.453	SAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056056.1	NM_002970	
ZDHHC15	158866	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	74649034	74649034	+	Splice_Site	SNP	C	C	G			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chrX:74649034C>G	ENST00000373367.3	-	7	713		c.e7-1		ZDHHC15_ENST00000541184.1_Splice_Site|ZDHHC15_ENST00000373361.3_Intron	NM_144969.2	NP_659406.1	Q96MV8	ZDH15_HUMAN	zinc finger, DHHC-type containing 15						establishment of protein localization (GO:0045184)|protein palmitoylation (GO:0018345)|synaptic vesicle maturation (GO:0016188)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(3)|large_intestine(5)|liver(1)|lung(11)|ovary(2)|skin(2)	26						GTTATTAACCCTAAAAAAAAA	0.368																																					.		.											.	ZDHHC15-132	0			c.456-1G>C						.						66.0	65.0	66.0					X																	74649034		2202	4300	6502	SO:0001630	splice_region_variant	158866	exon7			TTAACCCTAAAAA	AK056374	CCDS14430.1, CCDS55454.1	Xq13.3	2008-05-02			ENSG00000102383	ENSG00000102383		"""Zinc fingers, DHHC-type"""	20342	protein-coding gene	gene with protein product		300576					Standard	NM_144969		Approved	FLJ31812, MRX91	uc004ecg.3	Q96MV8	OTTHUMG00000021866	ENST00000373367.3:c.483-1G>C	X.37:g.74649034C>G		Somatic	187	0		WXS	Illumina GAIIx	Phase_I	201	31	NM_001146256	0	0	0	0	0	B3KVG7|Q3SY30|Q6UWH3	Splice_Site	SNP	ENST00000373367.3	37	CCDS14430.1	.	.	.	.	.	.	.	.	.	.	C	19.50	3.838863	0.71373	.	.	ENSG00000102383	ENST00000373367;ENST00000541184	.	.	.	4.62	4.62	0.57501	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.758	0.78051	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ZDHHC15	74565759	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	7.075000	0.76798	2.260000	0.74910	0.600000	0.82982	.	.		0.368	ZDHHC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057283.1	NM_144969	Intron
CENPI	2491	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	100400095	100400095	+	Silent	SNP	G	G	A			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chrX:100400095G>A	ENST00000372927.1	+	16	1885	c.1608G>A	c.(1606-1608)ctG>ctA	p.L536L	CENPI_ENST00000218507.5_Silent_p.L536L|CENPI_ENST00000423383.1_Silent_p.L536L	NM_006733.2	NP_006724.2	Q92674	CENPI_HUMAN	centromere protein I	536					CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|nucleosome assembly (GO:0006334)|sex differentiation (GO:0007548)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)				breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(19)|prostate(1)|skin(2)	30						TGTCTAAACTGATCCACTATG	0.398																																					p.L536L		.											.	CENPI-130	0			c.G1608A						.						201.0	172.0	182.0					X																	100400095		2203	4300	6503	SO:0001819	synonymous_variant	2491	exon16			TAAACTGATCCAC	X97249	CCDS14479.1	Xq22.1	2013-11-05	2006-06-15	2006-06-15	ENSG00000102384	ENSG00000102384			3968	protein-coding gene	gene with protein product		300065	"""FSH primary response (LRPR1, rat) homolog 1"", ""FSH primary response (LRPR1 homolog, rat) 1"""	FSHPRH1		16622420	Standard	NM_006733		Approved	LRPR1, CENP-I, Mis6	uc004egx.3	Q92674	OTTHUMG00000022018	ENST00000372927.1:c.1608G>A	X.37:g.100400095G>A		Somatic	141	0		WXS	Illumina GAIIx	Phase_I	98	25	NM_006733	0	0	0	0	0	Q5JWZ9|Q96ED0	Silent	SNP	ENST00000372927.1	37	CCDS14479.1																																																																																			.		0.398	CENPI-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057519.1	NM_006733	
TAF7L	54457	broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	100542523	100542523	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chrX:100542523T>G	ENST00000372907.3	-	2	278	c.267A>C	c.(265-267)gaA>gaC	p.E89D	TAF7L_ENST00000324762.6_Missense_Mutation_p.E3D|TAF7L_ENST00000372905.2_Missense_Mutation_p.E3D|TAF7L_ENST00000356784.1_Missense_Mutation_p.E3D|Y_RNA_ENST00000410271.1_RNA	NM_024885.3	NP_079161.3	Q5H9L4	TAF7L_HUMAN	TAF7-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 50kDa	89					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|transcription factor TFIID complex (GO:0005669)				NS(1)|breast(4)|kidney(4)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	29						CATCCTGGCTTTCACTCATGT	0.388																																					p.E89D	Ovarian(104;431 1530 3210 15406 18594)	.											.	TAF7L-130	0			c.A267C						.						79.0	66.0	71.0					X																	100542523		2203	4300	6503	SO:0001583	missense	54457	exon2			CTGGCTTTCACTC	AF285595	CCDS35347.1, CCDS55466.1	Xq22.1	2009-03-25	2002-08-29	2001-12-07	ENSG00000102387	ENSG00000102387			11548	protein-coding gene	gene with protein product	"""cancer/testis antigen 40"""	300314	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, Q"""	TAF2Q		11279525	Standard	NM_024885		Approved	CT40	uc004ehb.3	Q5H9L4	OTTHUMG00000022021	ENST00000372907.3:c.267A>C	X.37:g.100542523T>G	ENSP00000361998:p.Glu89Asp	Somatic	439	2		WXS	Illumina GAIIx	Phase_I	422	77	NM_024885	0	0	0	0	0	Q5H9L6|Q86XI4|Q9BXU5|Q9H5R0	Missense_Mutation	SNP	ENST00000372907.3	37	CCDS35347.1	.	.	.	.	.	.	.	.	.	.	T	7.994	0.754020	0.15778	.	.	ENSG00000102387	ENST00000372907;ENST00000372905;ENST00000324762;ENST00000356784	T;T;T;T	0.23348	2.52;1.91;1.91;1.91	5.06	1.28	0.21552	.	1.018710	0.07862	N	0.966424	T	0.14184	0.0343	N	0.14661	0.345	0.09310	N	1	B;B	0.19817	0.039;0.016	B;B	0.14023	0.01;0.009	T	0.31223	-0.9951	10	0.87932	D	0	-0.0719	3.5939	0.07998	0.0:0.4528:0.238:0.3093	.	89;3	Q5H9L4;Q5H9L4-3	TAF7L_HUMAN;.	D	89;3;3;3	ENSP00000361998:E89D;ENSP00000361996:E3D;ENSP00000320283:E3D;ENSP00000349235:E3D	ENSP00000320283:E3D	E	-	3	2	TAF7L	100429179	1.000000	0.71417	0.000000	0.03702	0.188000	0.23474	2.246000	0.43142	0.150000	0.19136	0.381000	0.24937	GAA	.		0.388	TAF7L-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057526.2		
NRK	203447	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	105142618	105142618	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chrX:105142618A>G	ENST00000243300.9	+	8	925	c.622A>G	c.(622-624)Aga>Gga	p.R208G	NRK_ENST00000428173.2_Missense_Mutation_p.R208G	NM_198465.2	NP_940867.2	Q7Z2Y5	NRK_HUMAN	Nik related kinase	208	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JNKK activity (GO:0007256)|negative regulation of cell proliferation (GO:0008285)|parturition (GO:0007567)|regulation of spongiotrophoblast cell proliferation (GO:0060721)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(8)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(14)|lung(36)|ovary(3)|prostate(1)|skin(2)	76						AACTAATGGAAGAAGGAATAG	0.408										HNSCC(51;0.14)																											p.R208G		.											.	NRK-630	0			c.A622G						.						107.0	95.0	99.0					X																	105142618		1932	4119	6051	SO:0001583	missense	203447	exon8			AATGGAAGAAGGA	BX538345	CCDS65305.1	Xq22.3	2008-02-05			ENSG00000123572	ENSG00000123572			25391	protein-coding gene	gene with protein product		300791					Standard	NM_198465		Approved	DKFZp686A17109	uc004emd.3	Q7Z2Y5	OTTHUMG00000022143	ENST00000243300.9:c.622A>G	X.37:g.105142618A>G	ENSP00000434830:p.Arg208Gly	Somatic	103	0		WXS	Illumina GAIIx	Phase_I	131	28	NM_198465	0	0	0	0	0	Q32ND6|Q5H9K2|Q6ZMP2	Missense_Mutation	SNP	ENST00000243300.9	37		.	.	.	.	.	.	.	.	.	.	A	15.57	2.871654	0.51695	.	.	ENSG00000123572	ENST00000243300;ENST00000428173	T;T	0.66099	-0.19;-0.19	5.77	3.3	0.37823	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.48767	D	0.000176	T	0.70815	0.3267	L	0.46885	1.475	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.69577	-0.5108	10	0.87932	D	0	.	10.3349	0.43844	0.687:0.313:0.0:0.0	.	208	Q7Z2Y5	NRK_HUMAN	G	208	ENSP00000434830:R208G;ENSP00000438378:R208G	ENSP00000434830:R208G	R	+	1	2	NRK	105029274	0.952000	0.32445	0.998000	0.56505	0.978000	0.69477	1.925000	0.40074	0.266000	0.21894	0.481000	0.45027	AGA	.		0.408	NRK-001	KNOWN	non_canonical_conserved|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000106480.6	NM_198465	
SAGE1	55511	broad.mit.edu;ucsc.edu	37	X	134994108	134994108	+	Silent	SNP	G	G	A			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chrX:134994108G>A	ENST00000370709.3	+	17	2517	c.2517G>A	c.(2515-2517)ggG>ggA	p.G839G	SAGE1_ENST00000324447.3_Silent_p.G839G|SAGE1_ENST00000537770.1_Silent_p.G463G|SAGE1_ENST00000535938.1_Silent_p.G839G			Q9NXZ1	SAGE1_HUMAN	sarcoma antigen 1	839						nucleus (GO:0005634)				breast(5)|endometrium(5)|large_intestine(10)|lung(23)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	55	Acute lymphoblastic leukemia(192;0.000127)					GAAGGTTTGGGCAAAGTAAGT	0.353																																					p.G839G		.											.	SAGE1-133	0			c.G2517A						.						38.0	39.0	39.0					X																	134994108		2199	4294	6493	SO:0001819	synonymous_variant	55511	exon18			GTTTGGGCAAAGT	AJ278111	CCDS14652.1	Xq26	2009-03-25			ENSG00000181433	ENSG00000181433			30369	protein-coding gene	gene with protein product	"""cancer/testis antigen 14"""	300359				10919659	Standard	NM_018666		Approved	SAGE, CT14	uc004ezh.3	Q9NXZ1	OTTHUMG00000022496	ENST00000370709.3:c.2517G>A	X.37:g.134994108G>A		Somatic	62	1		WXS	Illumina GAIIx	Phase_I	66	6	NM_018666	0	0	0	0	0	Q5JNW0	Silent	SNP	ENST00000370709.3	37	CCDS14652.1																																																																																			.		0.353	SAGE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058448.1	NM_018666	
KRTAP10-6	386674	broad.mit.edu	37	21	46012219	46012220	+	In_Frame_Ins	INS	-	-	GGGGCGCAGCAGCTG	rs374776064|rs587611810|rs71199613	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr21:46012219_46012220insGGGGCGCAGCAGCTG	ENST00000400368.1	-	1	166_167	c.146_147insCAGCTGCTGCGCCCC	c.(145-147)ccg>ccCAGCTGCTGCGCCCCg	p.49_49P>PSCCAP	TSPEAR_ENST00000323084.4_Intron	NM_198688.2	NP_941961.2	P60371	KR106_HUMAN	keratin associated protein 10-6	49	29 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(6)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	23						GGCAGGGGGCCGGGGCGCAGCA	0.688														1042	0.208067	0.1188	0.2522	5008	,	,		15055	0.1379		0.3231	False		,,,				2504	0.2515				p.P49delinsPSCCAP		.											.	KRTAP10-6-90	0			c.147_148insCAGCTGCTGCGCCCC						.																																			SO:0001652	inframe_insertion	386674	exon1			GGGGGCCGGGGCG	AB076353	CCDS42959.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000188155	ENSG00000188155		"""Keratin associated proteins"""	20523	protein-coding gene	gene with protein product			"""keratin associated protein 18-6"""	KRTAP18-6			Standard	NM_198688		Approved	KRTAP18.6, KAP18.6, KAP10.6	uc002zfm.3	P60371	OTTHUMG00000057634	ENST00000400368.1:c.146_147insCAGCTGCTGCGCCCC	21.37:g.46012219_46012220insGGGGCGCAGCAGCTG	Exception_encountered	Somatic	21	0		WXS	Illumina GAIIx	Phase_I	90	11	NM_198688	0	0	0	0	0		In_Frame_Ins	INS	ENST00000400368.1	37	CCDS42959.1																																																																																			.		0.688	KRTAP10-6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128037.1	NM_198688	
NEFH	4744	broad.mit.edu	37	22	29885622	29885623	+	In_Frame_Ins	INS	-	-	AGGAAG	rs267607534|rs267607535		TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr22:29885622_29885623insAGGAAG	ENST00000310624.6	+	4	2026_2027	c.1993_1994insAGGAAG	c.(1993-1995)aag>aAGGAAGag	p.665_666insEE		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	671	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						GTCCCCTGAGAAGGCCAAGTCC	0.579																																					p.K665delinsKEE		.											.	NEFH-90	0			c.1993_1994insAGGAAG						.																																			SO:0001652	inframe_insertion	4744	exon4			CCTGAGAAGGCCA		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	Exception_encountered	22.37:g.29885622_29885623insAGGAAG	ENSP00000311997:p.Lys665_Ala666insGluGlu	Somatic	313	0		WXS	Illumina GAIIx	Phase_I	258	9	NM_021076	0	0	0	0	0	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	In_Frame_Ins	INS	ENST00000310624.6	37	CCDS13858.1																																																																																			.		0.579	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
PANX2	56666	broad.mit.edu	37	22	50617594	50617595	+	Frame_Shift_Ins	INS	-	-	C	rs376326556		TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr22:50617594_50617595insC	ENST00000395842.2	+	3	1922_1923	c.1922_1923insC	c.(1921-1926)ggccccfs	p.GP641fs	PANX2_ENST00000159647.5_Intron	NM_052839.3	NP_443071.2	Q96RD6	PANX2_HUMAN	pannexin 2	641					ion transport (GO:0006811)|protein hexamerization (GO:0034214)|response to ischemia (GO:0002931)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|gap junction (GO:0005921)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gap junction hemi-channel activity (GO:0055077)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(1)|skin(1)	7		all_cancers(38;1.14e-10)|all_epithelial(38;2.12e-09)|all_lung(38;7.01e-05)|Breast(42;0.000523)|Lung NSC(38;0.0018)|Ovarian(80;0.0365)|Lung SC(80;0.113)		LUAD - Lung adenocarcinoma(64;0.105)		GAGGACGGGGGCCCCCGCCTGC	0.678																																					p.G641fs		.											.	PANX2-131	0			c.1922_1923insC						.																																			SO:0001589	frameshift_variant	56666	exon3			ACGGGGGCCCCCG		CCDS14085.2, CCDS54544.1	22q13.33	2011-12-05			ENSG00000073150	ENSG00000073150		"""Ion channels / Pannexins"""	8600	protein-coding gene	gene with protein product		608421				14702039, 14597722	Standard	NM_052839		Approved	hPANX2, PX2	uc003bjn.4	Q96RD6	OTTHUMG00000044649	ENST00000395842.2:c.1927dupC	22.37:g.50617599_50617599dupC	ENSP00000379183:p.Gly641fs	Somatic	82	0		WXS	Illumina GAIIx	Phase_I	174	13	NM_052839	0	0	0	0	0	B7Z684|Q96RD5|Q9UGX8	Frame_Shift_Ins	INS	ENST00000395842.2	37	CCDS14085.2																																																																																			.		0.678	PANX2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075010.3	NM_052839	
FZD1	8321	hgsc.bcm.edu	37	7	90894459	90894460	+	In_Frame_Ins	INS	-	-	CCG	rs71292991|rs139480179	byFrequency	TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr7:90894459_90894460insCCG	ENST00000287934.2	+	1	677_678	c.264_265insCCG	c.(265-267)ccg>CCGccg	p.89_89P>PP		NM_003505.1	NP_003496.1	Q9UP38	FZD1_HUMAN	frizzled class receptor 1	89	Poly-Pro.				autocrine signaling (GO:0035425)|axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in mesenchymal stem cell differentiation (GO:0044338)|canonical Wnt signaling pathway involved in osteoblast differentiation (GO:0044339)|cell-cell signaling (GO:0007267)|epithelial cell differentiation (GO:0030855)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|hard palate development (GO:0060022)|lung alveolus development (GO:0048286)|membranous septum morphogenesis (GO:0003149)|muscular septum morphogenesis (GO:0003150)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron differentiation (GO:0030182)|outflow tract morphogenesis (GO:0003151)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|response to drug (GO:0042493)|vasculature development (GO:0001944)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	frizzled binding (GO:0005109)|G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|receptor binding (GO:0005102)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.Q88_P89insP(2)|p.Q88_P89insA(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24	all_cancers(62;3.1e-10)|all_epithelial(64;1.66e-08)|Breast(17;0.000635)|Lung NSC(181;0.153)|all_lung(186;0.154)|all_hematologic(106;0.215)		STAD - Stomach adenocarcinoma(171;0.0134)			cggggcAGCAACCGCCGCCGCC	0.743														1874	0.374201	0.4047	0.4625	5008	,	,		10872	0.2986		0.4294	False		,,,				2504	0.2914				p.Q88delinsQP		.											.	FZD1-658	3	Insertion - In frame(3)	breast(2)|liver(1)	c.264_265insCCG						.			1606,5,2563		359,2,886,0,3,837						0.6	1.0		dbSNP_134	11	3182,3,4959		703,0,1776,1,1,1591	no	codingComplex	FZD1	NM_003505.1		1062,2,2662,1,4,2428	A1A1,A1A2,A1R,A2A2,A2R,RR		39.1085,38.5961,38.9349				4788,8,7522				SO:0001652	inframe_insertion	8321	exon1			GCAGCAACCGCCG	AB017363	CCDS5620.1	7q21	2014-01-29	2014-01-29		ENSG00000157240	ENSG00000157240		"""GPCR / Class F : Frizzled receptors"""	4038	protein-coding gene	gene with protein product	"""Wnt receptor"", ""frizzled, Drosophila, homolog of, 1"""	603408	"""frizzled (Drosophila) homolog 1"", ""frizzled homolog 1 (Drosophila)"", ""frizzled 1, seven transmembrane spanning receptor"", ""frizzled family receptor 1"""			9813155	Standard	NM_003505		Approved	DKFZp564G072	uc003ula.3	Q9UP38	OTTHUMG00000023046	ENST00000287934.2:c.274_276dupCCG	7.37:g.90894466_90894468dupCCG	ENSP00000287934:p.Pro93dup	Somatic	7	2		WXS	Illumina GAIIx	Phase_I	25	16	NM_003505	0	0	0	0	0	A4D1E8|O94815|Q549T8	In_Frame_Ins	INS	ENST00000287934.2	37	CCDS5620.1																																																																																			-|0.606;CCG|0.394		0.743	FZD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059367.2	NM_003505	
TUBAL3	79861	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	5436106	5436107	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	CC	CC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr10:5436106_5436107CC>AA	ENST00000380419.3	-	4	751_752	c.714_715GG>TT	c.(712-717)gtGGtt>gtTTtt	p.V239F	TUBAL3_ENST00000479328.1_Missense_Mutation_p.V199F	NM_024803.2	NP_079079.1	A6NHL2	TBAL3_HUMAN	tubulin, alpha-like 3	239					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|liver(1)|lung(7)|prostate(2)|skin(3)	25						ACCACCTGAACCACCAATCTAT	0.49																																					p.V239F		.											.	TUBAL3-91	0			c.G714T						.																																			SO:0001583	missense	79861	exon4			CTGAACCACCAAT	AK025318	CCDS7066.2, CCDS53491.1	10p15.1	2007-03-15			ENSG00000178462	ENSG00000178462		"""Tubulins"""	23534	protein-coding gene	gene with protein product							Standard	NM_024803		Approved	FLJ21665	uc001ihy.3	A6NHL2	OTTHUMG00000017595	ENST00000380419.3:c.714_715delinsAA	10.37:g.5436106_5436107delinsAA	ENSP00000369784:p.Val239Phe	Somatic	246	0		WXS	Illumina GAIIx	Phase_I	354	16	NM_024803	0	0	0	0	0	B4DKL2|Q4QQJ5|Q9H6Z0	Missense_Mutation	DNP	ENST00000380419.3	37	CCDS7066.2																																																																																			.		0.490	TUBAL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046548.2	NM_024803	
KRTAP4-7	100132476	hgsc.bcm.edu	37	17	39240804	39240805	+	Missense_Mutation	DNP	CG	CG	AT			TCGA-OR-A5KP-01A-11D-A30A-10	TCGA-OR-A5KP-10A-01D-A30A-10	CG	CG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7581f1a-8a04-483a-a296-93bb72f8770d	c7c571ba-879c-4164-a608-bdbeeec0b9ee	g.chr17:39240804_39240805CG>AT	ENST00000391417.4	+	1	346_347	c.346_347CG>AT	c.(346-348)CGc>ATc	p.R116I		NM_033061.3	NP_149050.3	Q9BYR0	KRA47_HUMAN	keratin associated protein 4-7	141	31 X 5 AA repeats of C-C-[GIKRQVHEML]- [SPTRV]-[STVQRCP].		Missing. {ECO:0000269|PubMed:15955084}.		aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				NS(1)|endometrium(3)|kidney(1)|lung(1)|prostate(2)|urinary_tract(1)	9						cagctgctgccgcccctgctgc	0.673																																					p.R116I		.											.	.	0			c.G347T						.																																			SO:0001583	missense	100132476	exon1			GCTGCCGCCCCTG	AJ406939	CCDS45673.1	17q21.2	2013-06-25			ENSG00000240871	ENSG00000240871		"""Keratin associated proteins"""	18898	protein-coding gene	gene with protein product						11279113	Standard	NM_033061		Approved	KAP4.7	uc010wfn.2	Q9BYR0	OTTHUMG00000133582	Exception_encountered	17.37:g.39240804_39240805delinsAT	ENSP00000375236:p.Arg116Ile	Somatic	37	0		WXS	Illumina GAIIx	Phase_I	125	0	NM_033061	0	0	0	0	0	A0AVM6|A8MQ08|A8MTL4	Missense_Mutation	DNP	ENST00000391417.4	37	CCDS45673.1																																																																																			.		0.673	KRTAP4-7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257686.1		
