#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CEP104	9731	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	3732858	3732858	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr1:3732858G>A	ENST00000378230.3	-	21	2972	c.2648C>T	c.(2647-2649)cCg>cTg	p.P883L		NM_014704.3	NP_055519.1	O60308	CE104_HUMAN	centrosomal protein 104kDa	883						centriole (GO:0005814)	glutamate binding (GO:0016595)|glycine binding (GO:0016594)|thienylcyclohexylpiperidine binding (GO:0016596)			breast(2)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(14)|lung(8)|prostate(1)|skin(3)	39						CTGCAGTGCCGGGGCCTTCTG	0.587																																					p.P883L		.											.	CEP104-92	0			c.C2648T						.						48.0	40.0	43.0					1																	3732858		2177	4223	6400	SO:0001583	missense	9731	exon21			AGTGCCGGGGCCT	AB011134	CCDS30571.1	1p36.32	2014-02-20	2011-05-06	2011-05-06	ENSG00000116198	ENSG00000116198			24866	protein-coding gene	gene with protein product	"""glycine, glutamate, thienylcyclohexylpiperidine binding protein"""		"""KIAA0562"""	KIAA0562		7488117, 21399614	Standard	NM_014704		Approved	GlyBP, RP1-286D6.4	uc001aky.2	O60308	OTTHUMG00000003507	ENST00000378230.3:c.2648C>T	1.37:g.3732858G>A	ENSP00000367476:p.Pro883Leu	Somatic	49	0		WXS	Illumina GAIIx	Phase_I	62	15	NM_014704	0	0	7	7	0	Q5JSQ3|Q5SR24|Q5SR25|Q6PKF5|Q86W32|Q86X14	Missense_Mutation	SNP	ENST00000378230.3	37	CCDS30571.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	2.785|2.785	-0.252631|-0.252631	0.05829|0.05829	.|.	.|.	ENSG00000116198|ENSG00000116198	ENST00000378230|ENST00000438539	T|.	0.27557|.	1.66|.	5.02|5.02	-0.333|-0.333	0.12671|0.12671	.|.	0.843249|.	0.10562|.	N|.	0.660209|.	T|T	0.41858|0.41858	0.1177|0.1177	L|L	0.51422|0.51422	1.61|1.61	0.09310|0.09310	N|N	0.999999|0.999999	B|.	0.06786|.	0.001|.	B|.	0.04013|.	0.001|.	T|T	0.38824|0.38824	-0.9643|-0.9643	10|5	0.10902|.	T|.	0.67|.	.|.	10.9616|10.9616	0.47389|0.47389	0.099:0.0:0.7218:0.1792|0.099:0.0:0.7218:0.1792	.|.	883|.	O60308|.	CE104_HUMAN|.	L|W	883|180	ENSP00000367476:P883L|.	ENSP00000367476:P883L|.	P|R	-|-	2|1	0|2	CEP104|CEP104	3722718|3722718	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.114000|0.114000	0.19823|0.19823	0.007000|0.007000	0.13174|0.13174	-0.202000|-0.202000	0.10268|0.10268	-0.397000|-0.397000	0.06425|0.06425	CCG|CGG	.		0.587	CEP104-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009747.3	NM_014704	
CNR2	1269	bcgsc.ca	37	1	24201262	24201262	+	Silent	SNP	A	A	G	rs2502993	byFrequency	TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr1:24201262A>G	ENST00000374472.4	-	2	1007	c.846T>C	c.(844-846)gcT>gcC	p.A282A	CNR2_ENST00000536471.1_Silent_p.A282A	NM_001841.2	NP_001832.1	P34972	CNR2_HUMAN	cannabinoid receptor 2 (macrophage)	282					G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|immune response (GO:0006955)|inflammatory response (GO:0006954)|negative regulation of action potential (GO:0045759)|negative regulation of inflammatory response (GO:0050728)|negative regulation of mast cell activation (GO:0033004)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|response to amphetamine (GO:0001975)|response to lipopolysaccharide (GO:0032496)|sensory perception of pain (GO:0019233)	dendrite (GO:0030425)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	cannabinoid receptor activity (GO:0004949)	p.A282A(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|lung(9)|pancreas(1)|skin(2)|stomach(6)|upper_aerodigestive_tract(2)	26		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Ovarian(437;0.00348)|Breast(348;0.00957)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.32e-24)|Colorectal(126;6.09e-08)|COAD - Colon adenocarcinoma(152;3.33e-06)|GBM - Glioblastoma multiforme(114;2.9e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|KIRC - Kidney renal clear cell carcinoma(1967;0.00359)|STAD - Stomach adenocarcinoma(196;0.0131)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.146)	Dronabinol(DB00470)|Nabilone(DB00486)	TGGAGCAGAAAGCAAAGGCCT	0.572													G|||	3272	0.653355	0.7943	0.6383	5008	,	,		22050	0.502		0.5875	False		,,,				2504	0.6973				p.A282A		.											.	CNR2-228	1	Substitution - coding silent(1)	stomach(1)	c.T846C						.	G		3310,1096	395.8+/-329.8	1261,788,154	92.0	82.0	85.0		846	1.3	1.0	1	dbSNP_100	85	4934,3666	526.1+/-380.9	1402,2130,768	no	coding-synonymous	CNR2	NM_001841.2		2663,2918,922	GG,GA,AA		42.6279,24.8752,36.6139		282/361	24201262	8244,4762	2203	4300	6503	SO:0001819	synonymous_variant	1269	exon2			GCAGAAAGCAAAG	X74328	CCDS245.1	1p	2012-08-08			ENSG00000188822	ENSG00000188822		"""GPCR / Class A : Cannabinoid receptors"""	2160	protein-coding gene	gene with protein product		605051					Standard	NM_001841		Approved	CB2	uc001bif.3	P34972	OTTHUMG00000013892	ENST00000374472.4:c.846T>C	1.37:g.24201262A>G		Somatic	141	1		WXS	Illumina GAIIx	Phase_I	137	5	NM_001841	0	0	0	0	0	C6ES44|Q4VBK8|Q5JRH7|Q6B0G7|Q6NSY0	Silent	SNP	ENST00000374472.4	37	CCDS245.1																																																																																			A|0.359;G|0.641		0.572	CNR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038949.1	NM_001841	
MTF2	22823	broad.mit.edu;bcgsc.ca	37	1	93575975	93575975	+	Missense_Mutation	SNP	C	C	G	rs371292695		TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr1:93575975C>G	ENST00000370298.4	+	2	483	c.194C>G	c.(193-195)aCt>aGt	p.T65S	MTF2_ENST00000540243.1_Intron|MTF2_ENST00000370303.4_Missense_Mutation_p.T65S|MTF2_ENST00000545708.1_5'UTR|MTF2_ENST00000471953.1_3'UTR	NM_001164392.1|NM_007358.3	NP_001157864.1|NP_031384	Q9Y483	MTF2_HUMAN	metal response element binding transcription factor 2	65	Tudor.				chromatin modification (GO:0016568)|negative regulation of histone H3-K27 methylation (GO:0061086)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of histone H3-K27 methylation (GO:0061087)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|segment specification (GO:0007379)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)	cytoplasm (GO:0005737)|ESC/E(Z) complex (GO:0035098)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		all_lung(203;0.00196)|Lung NSC(277;0.00902)|Melanoma(281;0.099)|Ovarian(761;0.109)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00076)|GBM - Glioblastoma multiforme(16;0.00157)|Epithelial(280;0.0886)		TATCTTGGCACTATCAAAAAG	0.328																																					p.T65S		.											.	MTF2-92	0			c.C194G						.	C	,SER/THR,,SER/THR	0,4406		0,0,2203	147.0	148.0	147.0		,194,,194	5.4	1.0	1		147	1,8599	1.2+/-3.3	0,1,4299	no	utr-5,missense,intron,missense	MTF2	NM_001164391.1,NM_001164392.1,NM_001164393.1,NM_007358.3	,58,,58	0,1,6502	GG,GC,CC		0.0116,0.0,0.0077	,possibly-damaging,,possibly-damaging	,65/537,,65/594	93575975	1,13005	2203	4300	6503	SO:0001583	missense	22823	exon2			TTGGCACTATCAA	AJ010014	CCDS742.1, CCDS53340.1, CCDS53341.1	1p22.1	2013-01-28			ENSG00000143033	ENSG00000143033		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	29535	protein-coding gene	gene with protein product	"""polycomb-like 2"", ""tudor domain containing 19A"""	609882				15563832	Standard	NM_007358		Approved	M96, PCL2, TDRD19A	uc009wdj.3	Q9Y483	OTTHUMG00000010161	ENST00000370298.4:c.194C>G	1.37:g.93575975C>G	ENSP00000359321:p.Thr65Ser	Somatic	216	0		WXS	Illumina GAIIx	Phase_I	243	8	NM_001164392	0	0	0	0	0	A6NGQ9|A8K2Q3|B1AKT5|B1AKT6|Q9UES9|Q9UP40	Missense_Mutation	SNP	ENST00000370298.4	37	CCDS742.1	.	.	.	.	.	.	.	.	.	.	C	15.85	2.954032	0.53293	0.0	1.16E-4	ENSG00000143033	ENST00000370298;ENST00000370303	T;T	0.46063	0.88;0.88	5.44	5.44	0.79542	Tudor domain (1);	0.000000	0.85682	D	0.000000	T	0.37598	0.1009	L	0.58810	1.83	0.80722	D	1	B;P	0.42010	0.402;0.768	B;B	0.43386	0.258;0.418	T	0.24693	-1.0153	10	0.46703	T	0.11	-8.3107	19.2694	0.94003	0.0:1.0:0.0:0.0	.	65;65	B1AKT6;Q9Y483	.;MTF2_HUMAN	S	65	ENSP00000359321:T65S;ENSP00000359326:T65S	ENSP00000359321:T65S	T	+	2	0	MTF2	93348563	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.711000	0.84669	2.563000	0.86464	0.557000	0.71058	ACT	.		0.328	MTF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028075.3	NM_007358	
FMO5	2330	broad.mit.edu	37	1	146656097	146656097	+	IGR	SNP	C	C	T	rs72708554	byFrequency	TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr1:146656097C>T	ENST00000254090.4	-	0	2632				RP11-337C18.10_ENST00000606856.1_RNA|RP11-337C18.8_ENST00000606757.1_RNA|RP11-337C18.8_ENST00000607149.1_RNA|FMO5_ENST00000441068.2_Missense_Mutation_p.G457R	NM_001461.2	NP_001452.2	P49326	FMO5_HUMAN	flavin containing monooxygenase 5							endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)			breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(9)|ovary(3)|upper_aerodigestive_tract(1)	25	all_hematologic(923;0.0487)					ccctttattccgggacaattt	0.353													C|||	263	0.052516	0.062	0.0331	5008	,	,		16675	0.0069		0.0427	False		,,,				2504	0.1104				p.G457R		.											.	FMO5-93	0			c.G1369A						.						100.0	88.0	91.0					1																	146656097		692	1591	2283	SO:0001628	intergenic_variant	2330	exon9			TTATTCCGGGACA	Z47553	CCDS926.1, CCDS44209.1, CCDS44210.1	1q21.1	2011-08-04			ENSG00000131781	ENSG00000131781			3773	protein-coding gene	gene with protein product		603957				8786146, 9119381	Standard	NM_001461		Approved		uc001epi.2	P49326	OTTHUMG00000014607		1.37:g.146656097C>T		Somatic	77	1		WXS	Illumina GAIIx	Phase_I	108	4	NM_001144829	0	0	4	4	0	B2RBG1|C9JJD1|Q8IV22	Missense_Mutation	SNP	ENST00000254090.4	37	CCDS926.1	69	0.03159340659340659	27	0.054878048780487805	11	0.03038674033149171	5	0.008741258741258742	26	0.03430079155672823	.	6.198	0.404777	0.11754	.	.	ENSG00000131781	ENST00000441068	T	0.44482	0.92	1.91	0.694	0.18062	.	.	.	.	.	T	0.05593	0.0147	N	0.08118	0	0.09310	N	0.999999	B	0.06786	0.001	B	0.01281	0.0	T	0.40905	-0.9538	9	0.15066	T	0.55	.	3.6634	0.08246	0.0:0.2059:0.0:0.7941	.	457	C9JJD1	.	R	457	ENSP00000416011:G457R	ENSP00000416011:G457R	G	-	1	0	FMO5	145122721	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	-0.031000	0.12287	0.210000	0.20664	-0.416000	0.06073	GGA	C|0.968;T|0.032		0.353	FMO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040373.2	NM_001461	
ACP6	51205	broad.mit.edu	37	1	147142085	147142085	+	Missense_Mutation	SNP	A	A	C	rs201678741		TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr1:147142085A>C	ENST00000369238.6	-	1	533	c.86T>G	c.(85-87)gTg>gGg	p.V29G	ACP6_ENST00000392988.2_Missense_Mutation_p.V29G	NM_016361.3	NP_057445.4	Q9NPH0	PPA6_HUMAN	acid phosphatase 6, lysophosphatidic	29					dephosphorylation (GO:0016311)|lysobisphosphatidic acid metabolic process (GO:2001311)|phospholipid metabolic process (GO:0006644)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	acid phosphatase activity (GO:0003993)|lysophosphatidic acid phosphatase activity (GO:0052642)			breast(1)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(4)|prostate(1)	16	all_hematologic(923;0.0276)					GGCCAGGGCCACCCGCCGCTG	0.657																																					p.V29G		.											.	ACP6-94	0			c.T86G						.						12.0	10.0	11.0					1																	147142085		2053	4027	6080	SO:0001583	missense	51205	exon1			AGGGCCACCCGCC	BC009965	CCDS928.1	1q21	2008-02-05			ENSG00000162836	ENSG00000162836			29609	protein-coding gene	gene with protein product		611471				12010880, 10506173	Standard	NM_016361		Approved	LPAP, ACPL1	uc001epr.2	Q9NPH0	OTTHUMG00000014019	ENST00000369238.6:c.86T>G	1.37:g.147142085A>C	ENSP00000358241:p.Val29Gly	Somatic	35	6		WXS	Illumina GAIIx	Phase_I	96	26	NM_016361	0	0	3	4	1	Q59G61|Q5T490|Q6IAQ3|Q7LG81|Q9UIG6	Missense_Mutation	SNP	ENST00000369238.6	37	CCDS928.1	.	.	.	.	.	.	.	.	.	.	A	13.14	2.149393	0.37923	.	.	ENSG00000162836	ENST00000369238;ENST00000392988	T;T	0.48522	2.65;0.81	5.28	-5.16	0.02857	.	0.609019	0.16327	N	0.219309	T	0.09555	0.0235	L	0.34521	1.04	0.43385	D	0.99549	B;B	0.06786	0.001;0.0	B;B	0.09377	0.004;0.001	T	0.22730	-1.0208	10	0.19147	T	0.46	.	1.0577	0.01593	0.2021:0.3491:0.2212:0.2275	.	29;29	Q9NPH0-2;Q9NPH0	.;PPA6_HUMAN	G	29	ENSP00000358241:V29G;ENSP00000376714:V29G	ENSP00000358241:V29G	V	-	2	0	ACP6	145608709	0.001000	0.12720	0.927000	0.36925	0.947000	0.59692	-0.635000	0.05471	-0.919000	0.03803	-0.460000	0.05396	GTG	.		0.657	ACP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039420.2	NM_016361	
SPRR3	6707	ucsc.edu	37	1	152975715	152975715	+	Silent	SNP	C	C	T	rs28989168	byFrequency	TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr1:152975715C>T	ENST00000295367.4	+	2	261	c.219C>T	c.(217-219)ggC>ggT	p.G73G	SPRR3_ENST00000331860.3_Silent_p.G73G|SPRR3_ENST00000542696.1_Silent_p.G73G	NM_001097589.1	NP_001091058.1	Q9UBC9	SPRR3_HUMAN	small proline-rich protein 3	73	14 X 8 AA approximate tandem repeats.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	structural molecule activity (GO:0005198)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	11	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			CTGAGCCAGGCTGTACCAAGG	0.577													T|||	2	0.000399361	0.0015	0.0	5008	,	,		14904	0.0		0.0	False		,,,				2504	0.0				p.G73G		.											.	SPRR3-45	0			c.C219T						.						42.0	39.0	40.0					1																	152975715		2182	4268	6450	SO:0001819	synonymous_variant	6707	exon2			GCCAGGCTGTACC	AY118269	CCDS1033.1	1q21-q22	2008-02-05			ENSG00000163209	ENSG00000163209			11268	protein-coding gene	gene with protein product		182271				8325635	Standard	NM_005416		Approved		uc001faz.4	Q9UBC9	OTTHUMG00000013872	ENST00000295367.4:c.219C>T	1.37:g.152975715C>T		Somatic	150	0		WXS	Illumina GAIIx	Phase_I	162	29	NM_001097589	0	0	1	2	1	A5YKK8|B2R4G8|D3DV32|O75597|Q4ZGI7|Q5T525|Q8NET7|Q9UDG3	Silent	SNP	ENST00000295367.4	37	CCDS1033.1																																																																																			A|0.000;C|0.697;T|0.303		0.577	SPRR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000038910.1	NM_005416	
SPRR3	6707	ucsc.edu	37	1	152975739	152975739	+	Silent	SNP	T	T	A	rs17851565	byFrequency	TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr1:152975739T>A	ENST00000295367.4	+	2	285	c.243T>A	c.(241-243)ggT>ggA	p.G81G	SPRR3_ENST00000331860.3_Silent_p.G81G|SPRR3_ENST00000542696.1_Silent_p.G81G	NM_001097589.1	NP_001091058.1	Q9UBC9	SPRR3_HUMAN	small proline-rich protein 3	81	14 X 8 AA approximate tandem repeats.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	structural molecule activity (GO:0005198)	p.G81G(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	11	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			CTGAGCCAGGTTGTACCAAGG	0.592																																					p.G81G		.											.	SPRR3-45	1	Substitution - coding silent(1)	prostate(1)	c.T243A						.						61.0	52.0	55.0					1																	152975739		2203	4299	6502	SO:0001819	synonymous_variant	6707	exon2			GCCAGGTTGTACC	AY118269	CCDS1033.1	1q21-q22	2008-02-05			ENSG00000163209	ENSG00000163209			11268	protein-coding gene	gene with protein product		182271				8325635	Standard	NM_005416		Approved		uc001faz.4	Q9UBC9	OTTHUMG00000013872	ENST00000295367.4:c.243T>A	1.37:g.152975739T>A		Somatic	165	1		WXS	Illumina GAIIx	Phase_I	155	16	NM_001097589	1	0	1	2	0	A5YKK8|B2R4G8|D3DV32|O75597|Q4ZGI7|Q5T525|Q8NET7|Q9UDG3	Silent	SNP	ENST00000295367.4	37	CCDS1033.1																																																																																			A|0.010;C|0.001;T|0.988		0.592	SPRR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000038910.1	NM_005416	
LOR	4014	hgsc.bcm.edu	37	1	153233701	153233701	+	Silent	SNP	A	A	C	rs1143390	byFrequency	TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr1:153233701A>C	ENST00000368742.3	+	2	333	c.276A>C	c.(274-276)ggA>ggC	p.G92G		NM_000427.2	NP_000418.2	P23490	LORI_HUMAN	loricrin	92					keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein binding, bridging (GO:0030674)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			lung(2)	2	all_lung(78;3.35e-32)|Lung NSC(65;1.22e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			AGTACTCcggaggcggcggct	0.786													a|||	1994	0.398163	0.416	0.3703	5008	,	,		4732	0.3562		0.3797	False		,,,				2504	0.456				p.G92G		.											.	LOR-90	0			c.A276C						.						1.0	1.0	1.0					1																	153233701		392	1110	1502	SO:0001819	synonymous_variant	4014	exon2			CTCCGGAGGCGGC	M61120	CCDS30870.1	1q21	2008-02-05			ENSG00000203782	ENSG00000203782			6663	protein-coding gene	gene with protein product		152445				2007607, 1355480	Standard	NM_000427		Approved		uc001fbm.3	P23490	OTTHUMG00000013938	ENST00000368742.3:c.276A>C	1.37:g.153233701A>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_000427	0	0	0	0	0	Q5T869|Q5XKF8	Silent	SNP	ENST00000368742.3	37	CCDS30870.1																																																																																			A|0.594;C|0.406		0.786	LOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039107.1	NM_000427	
TNN	63923	broad.mit.edu;bcgsc.ca	37	1	175048704	175048704	+	Silent	SNP	C	C	T			TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr1:175048704C>T	ENST00000239462.4	+	3	758	c.645C>T	c.(643-645)ggC>ggT	p.G215G		NM_022093.1	NP_071376.1	Q9UQP3	TENN_HUMAN	tenascin N	215	EGF-like 2.				axonogenesis (GO:0007409)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|liver(1)|lung(81)|ovary(5)|prostate(6)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	156		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		GCGTGCGCGGCGTGTGCCAGT	0.687																																					p.G215G		.											.	TNN-138	0			c.C645T						.						17.0	13.0	14.0					1																	175048704		2190	4282	6472	SO:0001819	synonymous_variant	63923	exon3			GCGCGGCGTGTGC	AK127044	CCDS30943.1	1q23-q24	2013-02-11			ENSG00000120332	ENSG00000120332		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	22942	protein-coding gene	gene with protein product							Standard	NM_022093		Approved		uc001gkl.1	Q9UQP3	OTTHUMG00000034882	ENST00000239462.4:c.645C>T	1.37:g.175048704C>T		Somatic	48	0		WXS	Illumina GAIIx	Phase_I	132	6	NM_022093	0	0	0	0	0	B9EGP3|Q5R360	Silent	SNP	ENST00000239462.4	37	CCDS30943.1																																																																																			.		0.687	TNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084422.1	XM_040527	
TOR3A	64222	hgsc.bcm.edu	37	1	179051300	179051300	+	Missense_Mutation	SNP	T	T	C	rs2296377	byFrequency	TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr1:179051300T>C	ENST00000367627.3	+	1	789	c.37T>C	c.(37-39)Ttc>Ctc	p.F13L	TOR3A_ENST00000352445.6_Missense_Mutation_p.F13L	NM_022371.3	NP_071766.2	Q9H497	TOR3A_HUMAN	torsin family 3, member A	13			F -> L (in dbSNP:rs2296377). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|Ref.3}.		ATP catabolic process (GO:0006200)|chaperone mediated protein folding requiring cofactor (GO:0051085)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			endometrium(1)|kidney(2)|large_intestine(4)|lung(4)|pancreas(1)|urinary_tract(1)	13						TTGGCTCTTTTTCCTGCTGCT	0.751													C|||	3842	0.767173	0.9879	0.6441	5008	,	,		12722	0.6677		0.7117	False		,,,				2504	0.7157				p.F13L		.											.	TOR3A-90	0			c.T37C						.	C	LEU/PHE	3262,174		1547,168,3	2.0	3.0	3.0		37	-0.8	0.0	1	dbSNP_100	3	5365,1739		2051,1263,238	yes	missense	TOR3A	NM_022371.3	22	3598,1431,241	CC,CT,TT		24.4792,5.064,18.1499	benign	13/398	179051300	8627,1913	1718	3552	5270	SO:0001583	missense	64222	exon1			CTCTTTTTCCTGC	BC001085	CCDS1329.1	1q25.2	2008-02-05	2003-04-02		ENSG00000186283	ENSG00000186283			11997	protein-coding gene	gene with protein product		607555	"""ATP-dependant interferon responsive"""	ADIR		10644435	Standard	NM_022371		Approved	FLJ22345, ADIR2	uc001gmd.3	Q9H497	OTTHUMG00000035077	ENST00000367627.3:c.37T>C	1.37:g.179051300T>C	ENSP00000356599:p.Phe13Leu	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_022371	0	0	0	0	0	B4DSY0|B7ZB65|Q5M7Y7|Q8WVA7|Q8WWM2|Q9H495|Q9H6E7	Missense_Mutation	SNP	ENST00000367627.3	37	CCDS1329.1	1679	0.7687728937728938	484	0.983739837398374	250	0.6906077348066298	393	0.6870629370629371	552	0.7282321899736148	C	0.033	-1.323382	0.01309	0.94936	0.755208	ENSG00000186283	ENST00000367627;ENST00000367625;ENST00000352445	T;T;T	0.35421	1.31;1.4;1.63	0.427	-0.794	0.10918	.	1.274350	0.05916	N	0.632520	T	0.00012	0.0000	N	0.00368	-1.59	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.45906	-0.9229	8	0.02654	T	1	-1.1524	.	.	.	rs2296377;rs17844883;rs17856371;rs17857600;rs17857917;rs17858479;rs59034332;rs2296377	13	Q9H497	TOR3A_HUMAN	L	13	ENSP00000356599:F13L;ENSP00000356597:F13L;ENSP00000335351:F13L	ENSP00000335351:F13L	F	+	1	0	TOR3A	177317923	0.000000	0.05858	0.002000	0.10522	0.004000	0.04260	-1.490000	0.02304	-1.608000	0.01587	-1.610000	0.00802	TTC	T|0.229;C|0.771		0.751	TOR3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084927.1	NM_022371	
C1orf106	55765	hgsc.bcm.edu	37	1	200880978	200880978	+	Missense_Mutation	SNP	C	C	T	rs296520	byFrequency	TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr1:200880978C>T	ENST00000367342.4	+	9	1812	c.1612C>T	c.(1612-1614)Cgc>Tgc	p.R538C	C1orf106_ENST00000413687.2_Missense_Mutation_p.R453C	NM_018265.3	NP_060735.3	Q3KP66	CA106_HUMAN	chromosome 1 open reading frame 106	538			R -> C (in dbSNP:rs296520). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.							endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(2)	21						GTGGGAGCTGCGCCGCGCAGC	0.736													T|||	3966	0.791933	0.6089	0.8213	5008	,	,		12017	0.997		0.7256	False		,,,				2504	0.8753				p.R552C		.											.	C1orf106-93	0			c.C1654T						.	T	CYS/ARG,CYS/ARG	2547,1503		890,767,368	5.0	7.0	6.0		1357,1612	0.8	0.0	1	dbSNP_79	6	5587,2355		2124,1339,508	no	missense,missense	C1orf106	NM_001142569.2,NM_018265.3	180,180	3014,2106,876	TT,TC,CC		29.6525,37.1111,32.1714	benign,benign	453/579,538/664	200880978	8134,3858	2025	3971	5996	SO:0001583	missense	55765	exon9			GAGCTGCGCCGCG	AK001763	CCDS44292.1	1q32.1	2011-02-15			ENSG00000163362	ENSG00000163362			25599	protein-coding gene	gene with protein product						14702039	Standard	NM_018265		Approved	FLJ10901	uc001gvo.4	Q3KP66	OTTHUMG00000035789	ENST00000367342.4:c.1612C>T	1.37:g.200880978C>T	ENSP00000356311:p.Arg538Cys	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	8	8	NM_018265	0	0	0	0	0	B4E1K9|E9PFY0|Q9NV65|Q9NVI0	Missense_Mutation	SNP	ENST00000367342.4	37		1677	0.7678571428571429	261	0.5304878048780488	285	0.787292817679558	569	0.9947552447552448	562	0.741424802110818	T	0.366	-0.936884	0.02340	0.628889	0.703475	ENSG00000163362	ENST00000367342;ENST00000413687	T;T	0.28454	1.61;1.61	3.39	0.759	0.18438	.	0.912041	0.09365	N	0.812206	T	0.00012	0.0000	N	0.01576	-0.805	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.16188	-1.0411	9	0.29301	T	0.29	-23.0614	3.796	0.08740	0.0:0.2241:0.1856:0.5903	rs296520;rs7519373;rs56757010	538	Q3KP66	CA106_HUMAN	C	538;453	ENSP00000356311:R538C;ENSP00000392105:R453C	ENSP00000356311:R538C	R	+	1	0	C1orf106	199147601	0.004000	0.15560	0.002000	0.10522	0.007000	0.05969	-0.731000	0.04909	-0.124000	0.11724	-0.381000	0.06696	CGC	C|0.242;T|0.758		0.736	C1orf106-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000087057.2	NM_018265	
KIAA1804	84451	broad.mit.edu;bcgsc.ca	37	1	233515177	233515177	+	Missense_Mutation	SNP	A	A	T			TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr1:233515177A>T	ENST00000366624.3	+	9	2686	c.2425A>T	c.(2425-2427)Aca>Tca	p.T809S	MLK4_ENST00000366622.1_Missense_Mutation_p.T255S	NM_032435.2	NP_115811.2																					TTCTTTCTCCACAAAGTGCCT	0.582																																					p.T809S		.											.	KIAA1804-523	0			c.A2425T						.						79.0	70.0	73.0					1																	233515177		2203	4300	6503	SO:0001583	missense	0	exon9			TTCTCCACAAAGT																												ENST00000366624.3:c.2425A>T	1.37:g.233515177A>T	ENSP00000355583:p.Thr809Ser	Somatic	159	0		WXS	Illumina GAIIx	Phase_I	196	7	NM_032435	0	0	0	0	0		Missense_Mutation	SNP	ENST00000366624.3	37	CCDS1598.1	.	.	.	.	.	.	.	.	.	.	A	12.89	2.072525	0.36566	.	.	ENSG00000143674	ENST00000366624;ENST00000366622	T;T	0.80909	-1.43;2.34	4.64	4.64	0.57946	.	0.078045	0.49305	D	0.000144	D	0.84151	0.5409	L	0.59436	1.845	0.32282	N	0.567449	D;P	0.63880	0.993;0.799	P;B	0.60886	0.88;0.194	D	0.86507	0.1807	10	0.62326	D	0.03	.	8.8566	0.35231	0.916:0.0:0.084:0.0	.	256;809	Q5TCX8-3;Q5TCX8	.;M3KL4_HUMAN	S	809;255	ENSP00000355583:T809S;ENSP00000355581:T255S	ENSP00000355581:T255S	T	+	1	0	RP5-862P8.2	231581800	1.000000	0.71417	0.973000	0.42090	0.426000	0.31534	3.011000	0.49567	1.937000	0.56155	0.523000	0.50628	ACA	.		0.582	MLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092495.1		
SH3BP5L	80851	hgsc.bcm.edu	37	1	249106348	249106348	+	Silent	SNP	G	G	C	rs202116012	byFrequency	TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr1:249106348G>C	ENST00000366472.5	-	7	2162	c.933C>G	c.(931-933)gcC>gcG	p.A311A	SH3BP5L_ENST00000411742.2_Silent_p.A279A|SH3BP5L_ENST00000475978.1_5'UTR	NM_030645.1	NP_085148.1	Q7L8J4	3BP5L_HUMAN	SH3-binding domain protein 5-like	311										endometrium(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	23	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.19)	OV - Ovarian serous cystadenocarcinoma(106;0.00805)			CCGCACCCTCGGCCCCCTCAA	0.746													G|||	23	0.00459265	0.0008	0.0144	5008	,	,		12601	0.0		0.0119	False		,,,				2504	0.0				p.A311A		.											.	SH3BP5L-90	0			c.C933G						.	G		17,4377		0,17,2180	13.0	16.0	15.0		933	-8.6	0.4	1		15	135,8433		2,131,4151	no	coding-synonymous	SH3BP5L	NM_030645.1		2,148,6331	CC,CG,GG		1.5756,0.3869,1.1727		311/394	249106348	152,12810	2197	4284	6481	SO:0001819	synonymous_variant	80851	exon7			ACCCTCGGCCCCC	AB051507	CCDS31126.1	1q44	2008-02-05			ENSG00000175137	ENSG00000175137			29360	protein-coding gene	gene with protein product							Standard	NM_030645		Approved	KIAA1720	uc001iew.1	Q7L8J4	OTTHUMG00000040389	ENST00000366472.5:c.933C>G	1.37:g.249106348G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	17	4	NM_030645	0	0	7	7	0	B4DQ94|Q96FI5|Q9BQH8|Q9C0E3	Silent	SNP	ENST00000366472.5	37	CCDS31126.1																																																																																			G|0.991;C|0.008		0.746	SH3BP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097140.1	NM_030645	
MCU	90550	hgsc.bcm.edu	37	10	74451963	74451963	+	Silent	SNP	C	C	G			TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr10:74451963C>G	ENST00000373053.3	+	1	75	c.54C>G	c.(52-54)ggC>ggG	p.G18G	MCU_ENST00000536019.1_5'Flank|MCU_ENST00000357157.6_Silent_p.G18G	NM_138357.2	NP_612366.1	Q8NE86	MCU_HUMAN	mitochondrial calcium uniporter	18					calcium ion transmembrane import into mitochondrion (GO:0036444)|calcium-mediated signaling (GO:0019722)|glucose homeostasis (GO:0042593)|mitochondrial calcium ion transport (GO:0006851)|positive regulation of insulin secretion (GO:0032024)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|protein complex oligomerization (GO:0035786)	calcium channel complex (GO:0034704)|integral component of mitochondrial inner membrane (GO:0031305)|mitochondrial inner membrane (GO:0005743)|uniplex complex (GO:1990246)	calcium channel activity (GO:0005262)|uniporter activity (GO:0015292)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|urinary_tract(1)	14						CTCGGggcggcggcggcgggg	0.756																																					p.G18G		.											.	MCU-90	0			c.C54G						.						3.0	3.0	3.0					10																	74451963		1598	3518	5116	SO:0001819	synonymous_variant	90550	exon1			GGGCGGCGGCGGC	BC034235	CCDS7317.1, CCDS59218.1, CCDS59219.1	10q22.2	2011-06-23	2011-06-23	2011-06-23	ENSG00000156026	ENSG00000156026			23526	protein-coding gene	gene with protein product		614197	"""coiled-coil domain containing 109A"""	C10orf42, CCDC109A		21685886, 21685888	Standard	NM_138357		Approved	FLJ46135	uc001jtc.3	Q8NE86	OTTHUMG00000018443	ENST00000373053.3:c.54C>G	10.37:g.74451963C>G		Somatic	3	0		WXS	Illumina GAIIx	Phase_I	14	6	NM_001270679	0	0	0	0	0	B2RDF3|B3KXV7|Q96FL3	Silent	SNP	ENST00000373053.3	37	CCDS7317.1																																																																																			.		0.756	MCU-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048594.1	NM_138357	
MAT1A	4143	bcgsc.ca	37	10	82033594	82033594	+	Silent	SNP	G	G	A	rs2993763	byFrequency	TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr10:82033594G>A	ENST00000372213.3	-	9	1391	c.1131C>T	c.(1129-1131)taC>taT	p.Y377Y	MAT1A_ENST00000485270.1_5'UTR	NM_000429.2	NP_000420.1	Q00266	METK1_HUMAN	methionine adenosyltransferase I, alpha	377					cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|methylation (GO:0032259)|one-carbon metabolic process (GO:0006730)|S-adenosylmethionine biosynthetic process (GO:0006556)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|methionine adenosyltransferase activity (GO:0004478)			endometrium(4)|large_intestine(7)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	26			Colorectal(32;0.229)		L-Methionine(DB00134)|S-Adenosylmethionine(DB00118)	CGAAATGGCCGTAGCATGCTG	0.552													G|||	2939	0.586861	0.7874	0.5187	5008	,	,		17763	0.4861		0.4245	False		,,,				2504	0.635				p.Y377Y		.											.	MAT1A-90	0			c.C1131T						.	G		3186,1220	707.5+/-407.5	1155,876,172	189.0	176.0	180.0		1131	-8.9	0.5	10	dbSNP_101	180	3810,4790	539.6+/-383.6	817,2176,1307	no	coding-synonymous	MAT1A	NM_000429.2		1972,3052,1479	AA,AG,GG		44.3023,27.6895,46.2094		377/396	82033594	6996,6010	2203	4300	6503	SO:0001819	synonymous_variant	4143	exon9			ATGGCCGTAGCAT		CCDS7365.1	10q22	2008-08-01			ENSG00000151224	ENSG00000151224			6903	protein-coding gene	gene with protein product	"""S-adenosylmethionine synthetase"""	610550				8393662	Standard	XM_005269842		Approved	MAT, SAMS, MATA1, SAMS1	uc001kbw.3	Q00266	OTTHUMG00000018613	ENST00000372213.3:c.1131C>T	10.37:g.82033594G>A		Somatic	211	0		WXS	Illumina GAIIx	Phase_I	228	8	NM_000429	0	0	0	0	0	D3DWD5|Q5QP09	Silent	SNP	ENST00000372213.3	37	CCDS7365.1																																																																																			G|0.458;A|0.542		0.552	MAT1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049070.1	NM_000429	
GPAM	57678	broad.mit.edu	37	10	113924347	113924347	+	Nonsense_Mutation	SNP	G	G	A	rs144558318		TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr10:113924347G>A	ENST00000348367.4	-	13	1440	c.1243C>T	c.(1243-1245)Cag>Tag	p.Q415*	GPAM_ENST00000369425.1_Nonsense_Mutation_p.Q415*|GPAM_ENST00000423155.1_Nonsense_Mutation_p.Q415*			Q9HCL2	GPAT1_HUMAN	glycerol-3-phosphate acyltransferase, mitochondrial	415					acyl-CoA metabolic process (GO:0006637)|CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|defense response to virus (GO:0051607)|fatty acid homeostasis (GO:0055089)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|interleukin-2 secretion (GO:0070970)|negative regulation of activation-induced cell death of T cells (GO:0070236)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of multicellular organism growth (GO:0040018)|regulation of cytokine secretion (GO:0050707)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)			breast(2)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31				Epithelial(162;0.0306)|all cancers(201;0.123)		ACCGGTTTCTGACTTTGGCTT	0.368																																					p.Q415X	Ovarian(161;1017 2606 18293 52943)	.											.	GPAM-92	0			c.C1243T						.						64.0	67.0	66.0					10																	113924347		2203	4300	6503	SO:0001587	stop_gained	57678	exon13			GTTTCTGACTTTG	AL832464	CCDS7570.1	10q25.3	2009-07-15			ENSG00000119927	ENSG00000119927			24865	protein-coding gene	gene with protein product	"""glycerol-3-phosphate acyltransferase 1, mitochondrial"""	602395				10997877, 8369314	Standard	NM_020918		Approved	KIAA1560, MGC26846, GPAT1	uc001kzp.3	Q9HCL2	OTTHUMG00000019055	ENST00000348367.4:c.1243C>T	10.37:g.113924347G>A	ENSP00000265276:p.Gln415*	Somatic	56	0		WXS	Illumina GAIIx	Phase_I	79	5	NM_001244949	0	0	0	0	0	Q5VW51|Q86TA3	Nonsense_Mutation	SNP	ENST00000348367.4	37	CCDS7570.1	.	.	.	.	.	.	.	.	.	.	G	39	7.474190	0.98306	.	.	ENSG00000119927	ENST00000348367;ENST00000423155;ENST00000369425	.	.	.	5.25	5.25	0.73442	.	0.244651	0.42420	D	0.000704	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	-9.4255	17.0238	0.86440	0.0:0.0:1.0:0.0	.	.	.	.	X	415	.	ENSP00000265276:Q415X	Q	-	1	0	GPAM	113914337	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	5.342000	0.65970	2.432000	0.82394	0.643000	0.83706	CAG	G|1.000;T|0.000		0.368	GPAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050377.1	NM_020918	
FANK1	92565	hgsc.bcm.edu	37	10	127585221	127585221	+	Nonsense_Mutation	SNP	C	C	T	rs202109621		TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr10:127585221C>T	ENST00000368693.1	+	1	114	c.10C>T	c.(10-12)Cag>Tag	p.Q4*	FANK1_ENST00000368695.1_5'UTR|FANK1_ENST00000449042.2_5'UTR			Q8TC84	FANK1_HUMAN	fibronectin type III and ankyrin repeat domains 1	4						cytoplasm (GO:0005737)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(10)|ovary(1)|urinary_tract(1)	21		all_lung(145;0.00752)|Lung NSC(174;0.0115)|Colorectal(57;0.0847)|all_neural(114;0.0936)				CATGGAGCCCCAGAGTAAGGg	0.756																																					p.Q4X		.											.	FANK1-91	0			c.C10T						.						8.0	12.0	11.0					10																	127585221		2169	4258	6427	SO:0001587	stop_gained	92565	exon1			GAGCCCCAGAGTA	BC024189	CCDS31309.1	10q26.2	2013-02-11	2005-03-01		ENSG00000203780	ENSG00000203780		"""Ankyrin repeat domain containing"", ""Fibronectin type III domain containing"""	23527	protein-coding gene	gene with protein product		611640	"""fibronectin type 3 and ankyrin repeat domains 1"""			12477932	Standard	NM_145235		Approved		uc001ljh.4	Q8TC84	OTTHUMG00000019241	ENST00000368693.1:c.10C>T	10.37:g.127585221C>T	ENSP00000357682:p.Gln4*	Somatic	18	0		WXS	Illumina GAIIx	Phase_I	85	9	NM_145235	0	0	0	0	0	Q6UXY9|Q6X7T6	Nonsense_Mutation	SNP	ENST00000368693.1	37	CCDS31309.1	.	.	.	.	.	.	.	.	.	.	C	32	5.122908	0.94429	.	.	ENSG00000203780	ENST00000368693	.	.	.	2.62	1.68	0.24146	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.11485	T	0.65	.	6.8436	0.23977	0.274:0.726:0.0:0.0	.	.	.	.	X	4	.	ENSP00000357682:Q4X	Q	+	1	0	FANK1	127575211	1.000000	0.71417	0.999000	0.59377	0.552000	0.35366	1.578000	0.36525	0.621000	0.30232	0.462000	0.41574	CAG	.		0.756	FANK1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_145235	
SOX6	55553	broad.mit.edu	37	11	15994582	15994582	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr11:15994582G>T	ENST00000352083.6	-	16	2337	c.2260C>A	c.(2260-2262)Cca>Aca	p.P754T	SOX6_ENST00000527619.1_Missense_Mutation_p.P730T|SOX6_ENST00000316399.6_Missense_Mutation_p.P734T|SOX6_ENST00000528252.1_Missense_Mutation_p.P727T|SOX6_ENST00000396356.3_Missense_Mutation_p.P734T|SOX6_ENST00000528429.1_Missense_Mutation_p.P754T			P35712	SOX6_HUMAN	SRY (sex determining region Y)-box 6	754					astrocyte differentiation (GO:0048708)|cardiac muscle cell differentiation (GO:0055007)|cartilage development (GO:0051216)|cell morphogenesis (GO:0000902)|cellular response to transforming growth factor beta stimulus (GO:0071560)|erythrocyte development (GO:0048821)|gene silencing (GO:0016458)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oligodendrocyte cell fate specification (GO:0021778)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(23)|ovary(3)|pancreas(1)|prostate(2)	43						TGAGGCGATGGTGTGGTAGTT	0.512																																					p.P767T		.											.	SOX6-93	0			c.C2299A						.						118.0	115.0	116.0					11																	15994582		2200	4294	6494	SO:0001583	missense	55553	exon16			GCGATGGTGTGGT	AF309034	CCDS7821.1, CCDS53604.1, CCDS53605.1	11p15.3	2008-02-05						"""SRY (sex determining region Y)-boxes"""	16421	protein-coding gene	gene with protein product		607257				11255018	Standard	NM_033326		Approved		uc001mme.3	P35712		ENST00000352083.6:c.2260C>A	11.37:g.15994582G>T	ENSP00000339876:p.Pro754Thr	Somatic	144	0		WXS	Illumina GAIIx	Phase_I	105	4	NM_001145819	0	0	0	0	0	Q86VX7|Q9BXQ3|Q9BXQ4|Q9BXQ5|Q9H0I8	Missense_Mutation	SNP	ENST00000352083.6	37		.	.	.	.	.	.	.	.	.	.	G	15.23	2.772956	0.49680	.	.	ENSG00000110693	ENST00000316399;ENST00000352083;ENST00000396356;ENST00000528252;ENST00000527619;ENST00000528429	T;T;T;T;T;T	0.53857	0.6;0.6;0.6;0.6;0.6;0.6	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	T	0.74726	0.3754	M	0.75615	2.305	0.80722	D	1	P;D;D	0.89917	0.488;0.991;1.0	B;P;D	0.83275	0.209;0.889;0.996	T	0.75439	-0.3317	10	0.66056	D	0.02	.	20.1634	0.98142	0.0:0.0:1.0:0.0	.	734;754;730	P35712-3;P35712;P35712-2	.;SOX6_HUMAN;.	T	734;754;734;727;730;754	ENSP00000324948:P734T;ENSP00000339876:P754T;ENSP00000379644:P734T;ENSP00000432134:P727T;ENSP00000434455:P730T;ENSP00000433233:P754T	ENSP00000324948:P734T	P	-	1	0	SOX6	15951158	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.476000	0.97823	2.773000	0.95371	0.655000	0.94253	CCA	.		0.512	SOX6-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000386811.1	NM_033326	
TMEM134	80194	broad.mit.edu	37	11	67235051	67235051	+	Nonsense_Mutation	SNP	G	G	A	rs143199541	byFrequency	TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr11:67235051G>A	ENST00000308022.2	-	3	291	c.250C>T	c.(250-252)Cga>Tga	p.R84*	TMEM134_ENST00000452789.2_Intron|TMEM134_ENST00000541059.1_5'Flank|TMEM134_ENST00000393877.3_Nonsense_Mutation_p.R84*	NM_001078651.1|NM_025124.2	NP_001072119.1|NP_079400.1	Q9H6X4	TM134_HUMAN	transmembrane protein 134	84						integral component of membrane (GO:0016021)				endometrium(1)|lung(1)	2						ATGGAAGTTCGGCTGGAATCC	0.637													G|||	14	0.00279553	0.0008	0.0043	5008	,	,		15638	0.0		0.007	False		,,,				2504	0.0031				p.R84X		.											.	TMEM134-90	0			c.C250T						.	G	stop/ARG,,stop/ARG	5,4395	8.1+/-20.4	0,5,2195	49.0	46.0	47.0		250,,250	2.6	0.0	11	dbSNP_134	47	52,8538	31.7+/-84.0	0,52,4243	yes	stop-gained,intron,stop-gained	TMEM134	NM_001078650.1,NM_001078651.1,NM_025124.2	,,	0,57,6438	AA,AG,GG		0.6054,0.1136,0.4388	,,	84/181,,84/196	67235051	57,12933	2200	4295	6495	SO:0001587	stop_gained	80194	exon3			AAGTTCGGCTGGA	AK025402	CCDS8167.1, CCDS41678.1	11q13.2	2006-03-09			ENSG00000172663	ENSG00000172663			26142	protein-coding gene	gene with protein product							Standard	NM_025124		Approved	FLJ21749	uc001olq.2	Q9H6X4	OTTHUMG00000168034	ENST00000308022.2:c.250C>T	11.37:g.67235051G>A	ENSP00000312615:p.Arg84*	Somatic	146	1		WXS	Illumina GAIIx	Phase_I	171	4	NM_025124	0	0	0	0	0	Q08AK4|Q6PJN3	Nonsense_Mutation	SNP	ENST00000308022.2	37	CCDS8167.1	9	0.004120879120879121	1	0.0020325203252032522	3	0.008287292817679558	0	0.0	5	0.006596306068601583	G	15.81	2.943198	0.53079	0.001136	0.006054	ENSG00000172663	ENST00000393877;ENST00000308022	.	.	.	4.47	2.58	0.30949	.	1.527710	0.04580	N	0.394831	.	.	.	.	.	.	0.09310	N	0.999997	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.8826	0.24181	0.2201:0.0:0.7799:0.0	.	.	.	.	X	84	.	ENSP00000312615:R84X	R	-	1	2	TMEM134	66991627	0.605000	0.26941	0.008000	0.14137	0.050000	0.14768	2.426000	0.44731	0.354000	0.24105	0.289000	0.19496	CGA	G|0.997;A|0.003		0.637	TMEM134-020	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398994.1	NM_025124	
KRTAP5-10	387273	bcgsc.ca	37	11	71276951	71276951	+	Silent	SNP	T	T	C	rs76397897	byFrequency	TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr11:71276951T>C	ENST00000398531.1	+	1	343	c.318T>C	c.(316-318)tcT>tcC	p.S106S	KRTAP5-10_ENST00000376536.4_Intron	NM_001012710.1	NP_001012728.1	Q6L8G5	KR510_HUMAN	keratin associated protein 5-10	106	7 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				endometrium(2)|large_intestine(1)|lung(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	12						GCTGTGGTTCTTGTGGGGGCT	0.672																																					p.S106S		.											.	KRTAP5-10-91	0			c.T318C						.						39.0	60.0	53.0					11																	71276951		2166	4268	6434	SO:0001819	synonymous_variant	387273	exon1			TGGTTCTTGTGGG	AB126079	CCDS41684.1	11q13.4	2008-02-05			ENSG00000204572	ENSG00000204572		"""Keratin associated proteins"""	23605	protein-coding gene	gene with protein product						15144888	Standard	NM_001012710		Approved	KRTAP5.10	uc001oqt.1	Q6L8G5	OTTHUMG00000057585	ENST00000398531.1:c.318T>C	11.37:g.71276951T>C		Somatic	47	3		WXS	Illumina GAIIx	Phase_I	72	14	NM_001012710	0	0	0	0	0	B9EHA4	Silent	SNP	ENST00000398531.1	37	CCDS41684.1																																																																																			T|0.991;C|0.009		0.672	KRTAP5-10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000127968.2		
GRM5	2915	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	88386562	88386562	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr11:88386562C>G	ENST00000305447.4	-	3	1070	c.921G>C	c.(919-921)tgG>tgC	p.W307C	GRM5_ENST00000393297.1_Missense_Mutation_p.W307C|GRM5_ENST00000418177.2_Missense_Mutation_p.W307C|GRM5_ENST00000305432.5_Missense_Mutation_p.W307C|GRM5_ENST00000455756.2_Missense_Mutation_p.W307C	NM_001143831.2	NP_001137303.1	P41594	GRM5_HUMAN	glutamate receptor, metabotropic 5	307					activation of MAPKKK activity (GO:0000185)|cognition (GO:0050890)|desensitization of G-protein coupled receptor protein signaling pathway (GO:0002029)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|learning (GO:0007612)|locomotory behavior (GO:0007626)|negative regulation of locomotion (GO:0040013)|phospholipase C-activating G-protein coupled glutamate receptor signaling pathway (GO:0007206)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of transcription, DNA-templated (GO:0006355)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)			NS(1)|breast(5)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(18)|lung(40)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)|Rufinamide(DB06201)	ACCTGTCAGCCCAGCCATCAC	0.418																																					p.W307C		.											.	GRM5-949	0			c.G921C						.						65.0	65.0	65.0					11																	88386562		2201	4299	6500	SO:0001583	missense	2915	exon4			GTCAGCCCAGCCA	D28538	CCDS8283.1, CCDS44694.1	11q14.3	2014-06-12			ENSG00000168959	ENSG00000168959		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4597	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 86"""	604102				7908515	Standard	NM_001143831		Approved	MGLUR5, GPRC1E, mGlu5, PPP1R86	uc001pcq.3	P41594	OTTHUMG00000134306	ENST00000305447.4:c.921G>C	11.37:g.88386562C>G	ENSP00000306138:p.Trp307Cys	Somatic	35	0		WXS	Illumina GAIIx	Phase_I	29	12	NM_000842	0	0	0	0	0	Q6J164	Missense_Mutation	SNP	ENST00000305447.4	37	CCDS44694.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.161589	0.78226	.	.	ENSG00000168959	ENST00000418177;ENST00000455756;ENST00000305432;ENST00000305447;ENST00000393297	D;D;D;D;D	0.88896	-2.44;-2.44;-2.44;-2.44;-2.44	5.88	5.88	0.94601	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.95130	0.8422	M	0.84156	2.68	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.94369	0.7594	9	.	.	.	.	20.2314	0.98350	0.0:1.0:0.0:0.0	.	307;307	P41594-2;P41594	.;GRM5_HUMAN	C	307	ENSP00000402912:W307C;ENSP00000405690:W307C;ENSP00000305905:W307C;ENSP00000306138:W307C;ENSP00000376975:W307C	.	W	-	3	0	GRM5	88026210	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.487000	0.81328	2.789000	0.95967	0.591000	0.81541	TGG	.		0.418	GRM5-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000259226.1	NM_000842	
NCAPD2	9918	bcgsc.ca	37	12	6631169	6631169	+	Silent	SNP	C	C	A	rs917634	byFrequency	TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr12:6631169C>A	ENST00000315579.5	+	15	2719	c.1920C>A	c.(1918-1920)atC>atA	p.I640I	NCAPD2_ENST00000545962.1_Silent_p.I595I	NM_014865.3	NP_055680.3	Q15021	CND1_HUMAN	non-SMC condensin I complex, subunit D2	640					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensed chromosome (GO:0000793)|condensin complex (GO:0000796)|condensin core heterodimer (GO:0000797)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|pronucleus (GO:0045120)	histone binding (GO:0042393)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	48						CCATTGGCATCATCAGCAAGA	0.423													C|||	2662	0.53155	0.5961	0.6225	5008	,	,		17799	0.5704		0.4742	False		,,,				2504	0.3988				p.I640I		.											.	NCAPD2-660	0			c.C1920A						.	C		2566,1840	635.7+/-396.4	758,1050,395	82.0	83.0	83.0		1920	5.0	1.0	12	dbSNP_86	83	3915,4685	547.1+/-385.1	903,2109,1288	no	coding-synonymous	NCAPD2	NM_014865.3		1661,3159,1683	AA,AC,CC		45.5233,41.7612,49.8308		640/1402	6631169	6481,6525	2203	4300	6503	SO:0001819	synonymous_variant	9918	exon15			TGGCATCATCAGC	D63880	CCDS8548.1	12p13.31	2008-02-04			ENSG00000010292	ENSG00000010292			24305	protein-coding gene	gene with protein product	"""chromosome condensation related SMC associated protein 1"""	615638				8590280, 10958694	Standard	NM_014865		Approved	CNAP1, hCAP-D2, CAP-D2, KIAA0159	uc001qoo.2	Q15021	OTTHUMG00000168513	ENST00000315579.5:c.1920C>A	12.37:g.6631169C>A		Somatic	111	0		WXS	Illumina GAIIx	Phase_I	105	5	NM_014865	0	0	2	2	0	D3DUR4|Q8N6U3	Silent	SNP	ENST00000315579.5	37	CCDS8548.1																																																																																			C|0.475;A|0.525		0.423	NCAPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399964.1	NM_014865	
TAS2R30	259293	bcgsc.ca	37	12	11286164	11286164	+	Missense_Mutation	SNP	G	G	A	rs200661425		TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr12:11286164G>A	ENST00000539585.1	-	1	1079	c.680C>T	c.(679-681)gCt>gTt	p.A227V	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_001097643.1	NP_001091112.1	P59541	T2R30_HUMAN	taste receptor, type 2, member 30	227					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)	p.A227V(2)		autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(4)|skin(1)	13						AGTTTGCAAAGCTTTTATGTG	0.418																																					p.A227V		.											.	.	2	Substitution - Missense(2)	autonomic_ganglia(1)|skin(1)	c.C680T						.						198.0	208.0	205.0					12																	11286164		2203	4300	6503	SO:0001583	missense	259293	exon1			TGCAAAGCTTTTA	AX097746, AF494233	CCDS53750.1	12p13.2	2012-08-22				ENSG00000256188		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	19112	protein-coding gene	gene with protein product		613963	"""taste receptor, type 2, member 47"""	TAS2R47			Standard	NM_001097643		Approved	T2R30	uc009zhs.1	P59541		ENST00000539585.1:c.680C>T	12.37:g.11286164G>A	ENSP00000444736:p.Ala227Val	Somatic	228	3		WXS	Illumina GAIIx	Phase_I	271	23	NM_001097643	0	0	0	0	0	Q645X7	Missense_Mutation	SNP	ENST00000539585.1	37	CCDS53750.1	.	.	.	.	.	.	.	.	.	.	-	13.13	2.144355	0.37825	.	.	ENSG00000256188	ENST00000539585	T	0.01422	4.91	2.6	2.6	0.31112	.	.	.	.	.	T	0.03651	0.0104	M	0.70595	2.14	0.09310	N	1	P	0.40250	0.709	P	0.46975	0.533	T	0.27938	-1.0059	9	0.46703	T	0.11	.	8.7017	0.34329	0.0:0.0:1.0:0.0	.	227	P59541	T2R30_HUMAN	V	227	ENSP00000444736:A227V	ENSP00000444736:A227V	A	-	2	0	TAS2R30	11177431	0.677000	0.27577	0.024000	0.17045	0.426000	0.31534	2.697000	0.47060	1.454000	0.47793	0.313000	0.20887	GCT	.		0.418	TAS2R30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400238.1	NM_001097643	
APOLD1	81575	hgsc.bcm.edu	37	12	12939892	12939892	+	Missense_Mutation	SNP	G	G	A	rs4763876	byFrequency	TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr12:12939892G>A	ENST00000326765.6	+	2	216	c.146G>A	c.(145-147)cGg>cAg	p.R49Q	APOLD1_ENST00000356591.4_Missense_Mutation_p.R18Q	NM_001130415.1	NP_001123887.1	Q96LR9	APLD1_HUMAN	apolipoprotein L domain containing 1	49	Arg-rich.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|endothelial cell activation (GO:0042118)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|regulation of endothelial cell differentiation (GO:0045601)|response to hypoxia (GO:0001666)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)			breast(1)|endometrium(1)|large_intestine(1)|lung(1)|ovary(1)	5		Prostate(47;0.0632)		BRCA - Breast invasive adenocarcinoma(232;0.0338)|GBM - Glioblastoma multiforme(207;0.149)		GACGCGCTGCGGCGCTTCCAG	0.771													G|||	290	0.0579073	0.0038	0.1527	5008	,	,		11940	0.0278		0.0736	False		,,,				2504	0.0787				p.R49Q		.											.	APOLD1-91	0			c.G146A						.	G	GLN/ARG,GLN/ARG	17,1923		1,15,954	1.0	1.0	1.0		146,53	4.9	1.0	12	dbSNP_111	1	243,4437		1,241,2098	no	missense,missense	APOLD1	NM_001130415.1,NM_030817.2	43,43	2,256,3052	AA,AG,GG		5.1923,0.8763,3.9275	probably-damaging,probably-damaging	49/280,18/249	12939892	260,6360	970	2340	3310	SO:0001583	missense	81575	exon2			CGCTGCGGCGCTT	AL136783	CCDS8654.1, CCDS44833.1	12p13.2	2006-02-03	2006-01-23		ENSG00000178878	ENSG00000178878			25268	protein-coding gene	gene with protein product		612456				11230166	Standard	NM_030817		Approved	FLJ25138, DKFZP434F0318	uc001rau.4	Q96LR9	OTTHUMG00000153561	ENST00000326765.6:c.146G>A	12.37:g.12939892G>A	ENSP00000324277:p.Arg49Gln	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	10	6	NM_001130415	0	0	0	0	0	Q8IVR2|Q9H0I5	Missense_Mutation	SNP	ENST00000326765.6	37	CCDS44833.1	125	0.05723443223443223	3	0.006097560975609756	45	0.12430939226519337	16	0.027972027972027972	61	0.08047493403693931	G	21.6	4.179961	0.78564	0.008763	0.051923	ENSG00000178878	ENST00000326765;ENST00000356591	T;T	0.01347	4.99;4.99	4.94	4.94	0.65067	.	0.080970	0.50627	U	0.000113	T	0.00039	0.0001	L	0.32530	0.975	0.34201	P	0.32682599999999995	P;P	0.47910	0.82;0.902	B;B	0.42959	0.21;0.403	T	0.55829	-0.8079	9	0.56958	D	0.05	-17.5552	9.1508	0.36962	0.1061:0.0:0.8939:0.0	rs4763876	18;49	A0AVN6;Q96LR9	.;APLD1_HUMAN	Q	49;18	ENSP00000324277:R49Q;ENSP00000348998:R18Q	ENSP00000324277:R49Q	R	+	2	0	APOLD1	12831159	0.996000	0.38824	0.995000	0.50966	0.635000	0.38103	2.225000	0.42954	2.454000	0.82982	0.579000	0.79373	CGG	G|0.943;A|0.057		0.771	APOLD1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000331627.1	NM_030817	
KRT7	3855	hgsc.bcm.edu	37	12	52627215	52627215	+	Silent	SNP	A	A	G	rs7308888	byFrequency	TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr12:52627215A>G	ENST00000331817.5	+	1	318	c.135A>G	c.(133-135)tcA>tcG	p.S45S		NM_005556.3	NP_005547.3	P08729	K2C7_HUMAN	keratin 7	45	Head.				viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|prostate(2)|stomach(1)|urinary_tract(1)	14				BRCA - Breast invasive adenocarcinoma(357;0.105)	Primaquine(DB01087)	TCGGCGCCTCACGGCCGCGCG	0.771													g|||	4451	0.888778	0.9781	0.8473	5008	,	,		10346	0.9048		0.8191	False		,,,				2504	0.8528				p.S45S		.											.	KRT7-90	0			c.A135G						.			3161,173		1496,169,2	4.0	6.0	5.0		135	-5.3	0.0	12	dbSNP_116	5	5763,1251		2369,1025,113	no	coding-synonymous	KRT7	NM_005556.3		3865,1194,115	GG,GA,AA		17.8358,5.189,13.7611		45/470	52627215	8924,1424	1667	3507	5174	SO:0001819	synonymous_variant	3855	exon1			CGCCTCACGGCCG		CCDS8822.1	12q13.13	2013-01-16			ENSG00000135480	ENSG00000135480		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6445	protein-coding gene	gene with protein product	"""keratin, type II cytoskeletal 7"", ""cytokeratin 7"", ""sarcolectin"", ""keratin, 55K type II cytoskeletal"""	148059				1713141, 16831889	Standard	XR_245927		Approved	K7, CK7, K2C7, SCL	uc001saa.1	P08729	OTTHUMG00000169580	ENST00000331817.5:c.135A>G	12.37:g.52627215A>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_005556	0	0	0	0	0	Q92676|Q9BUD8|Q9Y3R7	Silent	SNP	ENST00000331817.5	37	CCDS8822.1																																																																																			A|0.133;G|0.867		0.771	KRT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404897.1	NM_005556	
TMTC2	160335	broad.mit.edu;bcgsc.ca	37	12	83290354	83290354	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr12:83290354C>G	ENST00000321196.3	+	3	2119	c.1412C>G	c.(1411-1413)gCg>gGg	p.A471G	TMTC2_ENST00000548305.1_Missense_Mutation_p.A471G|TMTC2_ENST00000549919.1_Missense_Mutation_p.A465G	NM_152588.1	NP_689801.1	Q8N394	TMTC2_HUMAN	transmembrane and tetratricopeptide repeat containing 2	471					calcium ion homeostasis (GO:0055074)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(7)|lung(13)|ovary(2)|skin(1)|urinary_tract(1)	39						CTCAAGACTGCGATCAGGAAT	0.388																																					p.A471G		.											.	TMTC2-92	0			c.C1412G						.						69.0	65.0	66.0					12																	83290354		2203	4300	6503	SO:0001583	missense	160335	exon3			AGACTGCGATCAG	AK074634	CCDS9025.1	12q21.31	2014-06-09			ENSG00000179104	ENSG00000179104		"""Tetratricopeptide (TTC) repeat domain containing"""	25440	protein-coding gene	gene with protein product		615856				24764305	Standard	NM_152588		Approved	DKFZp762A217	uc001szt.3	Q8N394	OTTHUMG00000169736	ENST00000321196.3:c.1412C>G	12.37:g.83290354C>G	ENSP00000322300:p.Ala471Gly	Somatic	63	0		WXS	Illumina GAIIx	Phase_I	182	9	NM_152588	0	0	0	0	0	B2RCU7|Q8N2K8	Missense_Mutation	SNP	ENST00000321196.3	37	CCDS9025.1	.	.	.	.	.	.	.	.	.	.	C	15.32	2.797419	0.50208	.	.	ENSG00000179104	ENST00000321196;ENST00000548305;ENST00000549919;ENST00000546590	T;T;T	0.61742	0.72;0.08;0.62	5.86	4.06	0.47325	.	0.050788	0.85682	D	0.000000	T	0.47967	0.1474	L	0.46157	1.445	0.35785	D	0.82191	P;B;P	0.36660	0.564;0.137;0.479	B;B;B	0.37346	0.118;0.247;0.159	T	0.55829	-0.8079	10	0.45353	T	0.12	-3.4404	7.1738	0.25732	0.0:0.6373:0.0:0.3627	.	471;226;471	Q8N394;F8VRQ2;F8VSH2	TMTC2_HUMAN;.;.	G	471;471;465;226	ENSP00000322300:A471G;ENSP00000448292:A471G;ENSP00000447609:A465G	ENSP00000322300:A471G	A	+	2	0	TMTC2	81814485	0.992000	0.36948	0.184000	0.23157	0.943000	0.58893	2.528000	0.45624	0.829000	0.34733	0.650000	0.86243	GCG	.		0.388	TMTC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405663.1	NM_152588	
DAO	1610	broad.mit.edu	37	12	109293174	109293174	+	Nonsense_Mutation	SNP	C	C	T			TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr12:109293174C>T	ENST00000228476.3	+	10	1039	c.835C>T	c.(835-837)Cga>Tga	p.R279*	DAO_ENST00000551281.1_Nonsense_Mutation_p.R213*	NM_001917.4	NP_001908.3	P14920	OXDA_HUMAN	D-amino-acid oxidase	279				R -> A (in Ref. 1; CAA31614). {ECO:0000305}.	cellular nitrogen compound metabolic process (GO:0034641)|D-alanine catabolic process (GO:0055130)|D-serine catabolic process (GO:0036088)|D-serine metabolic process (GO:0070178)|dopamine biosynthetic process (GO:0042416)|glyoxylate metabolic process (GO:0046487)|leucine metabolic process (GO:0006551)|proline catabolic process (GO:0006562)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	cofactor binding (GO:0048037)|D-amino-acid oxidase activity (GO:0003884)|FAD binding (GO:0071949)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|prostate(2)|skin(1)	26					Flavin adenine dinucleotide(DB03147)	TATTGGTGAACGAACTGGCTT	0.458																																					p.R279X		.											.	DAO-92	0			c.C835T						.						37.0	33.0	35.0					12																	109293174		2203	4300	6503	SO:0001587	stop_gained	1610	exon10			GGTGAACGAACTG	D11370	CCDS9122.1	12q24.11	2013-09-20			ENSG00000110887	ENSG00000110887	1.4.3.3		2671	protein-coding gene	gene with protein product		124050				1356107, 8182053	Standard	NM_001917		Approved	DAMOX	uc001tnr.4	P14920	OTTHUMG00000169360	ENST00000228476.3:c.835C>T	12.37:g.109293174C>T	ENSP00000228476:p.Arg279*	Somatic	79	1		WXS	Illumina GAIIx	Phase_I	68	5	NM_001917	0	0	0	0	0	B2R7I5|Q16758|Q8N6R2	Nonsense_Mutation	SNP	ENST00000228476.3	37	CCDS9122.1	.	.	.	.	.	.	.	.	.	.	c	12.40	1.925564	0.34002	.	.	ENSG00000110887	ENST00000551281;ENST00000228476;ENST00000547768	.	.	.	5.03	2.48	0.30137	.	0.654660	0.18043	N	0.153528	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.24483	T	0.36	-24.7005	7.3756	0.26827	0.0:0.1939:0.0:0.8061	.	.	.	.	X	213;279;156	.	ENSP00000228476:R279X	R	+	1	2	DAO	107817303	0.467000	0.25831	0.005000	0.12908	0.002000	0.02628	1.577000	0.36515	0.264000	0.21851	-0.507000	0.04495	CGA	.		0.458	DAO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403682.1		
ATXN2	6311	hgsc.bcm.edu	37	12	112036797	112036797	+	Silent	SNP	C	C	T	rs4098854	byFrequency	TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr12:112036797C>T	ENST00000377617.3	-	1	683	c.522G>A	c.(520-522)caG>caA	p.Q174Q	ATXN2_ENST00000542287.2_Intron|ATXN2_ENST00000550104.1_Silent_p.Q174Q|RP11-686G8.2_ENST00000547021.1_RNA|ATXN2_ENST00000389153.4_5'Flank|ATXN2_ENST00000549455.1_5'UTR|ATXN2_ENST00000535949.1_Intron|ATXN2_ENST00000608853.1_Silent_p.Q14Q	NM_002973.3	NP_002964.3	Q99700	ATX2_HUMAN	ataxin 2	174	Poly-Gln.				cell death (GO:0008219)|cerebellar Purkinje cell differentiation (GO:0021702)|cytoplasmic mRNA processing body assembly (GO:0033962)|homeostasis of number of cells (GO:0048872)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of receptor internalization (GO:0002091)|neuromuscular process (GO:0050905)|neuron projection morphogenesis (GO:0048812)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA transport (GO:0050658)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|trans-Golgi network (GO:0005802)	epidermal growth factor receptor binding (GO:0005154)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	37						gctgctgctgctgctgctgct	0.731													C|||	3289	0.656749	0.5734	0.6787	5008	,	,		4944	0.622		0.7167	False		,,,				2504	0.728				p.Q174Q		.											.	ATXN2-136	0			c.G522A						.						1.0	1.0	1.0					12																	112036797		720	1770	2490	SO:0001819	synonymous_variant	6311	exon1			CTGCTGCTGCTGC	U80749	CCDS31902.1	12q23-q24.1	2014-09-17	2004-08-12	2004-08-13	ENSG00000204842	ENSG00000204842		"""Ataxins"""	10555	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 13"""	601517	"""spinocerebellar ataxia 2 (olivopontocerebellar ataxia 2, autosomal dominant, ataxin 2)"""	SCA2, TNRC13		8358438, 9225980	Standard	NM_002973		Approved	ATX2	uc001tsj.3	Q99700	OTTHUMG00000133475	ENST00000377617.3:c.522G>A	12.37:g.112036797C>T		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_002973	0	0	49	50	1	A6NLD4|Q6ZQZ7|Q99493	Silent	SNP	ENST00000377617.3	37	CCDS31902.1																																																																																			C|0.429;T|0.571		0.731	ATXN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257351.3	NM_002973	
RFC3	5983	broad.mit.edu	37	13	34398063	34398063	+	Frame_Shift_Del	DEL	A	A	-			TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr13:34398063delA	ENST00000380071.3	+	3	365	c.235delA	c.(235-237)aaafs	p.K81fs	RFC3_ENST00000434425.1_Frame_Shift_Del_p.K81fs	NM_002915.3	NP_002906.1	P40938	RFC3_HUMAN	replication factor C (activator 1) 3, 38kDa	81					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA synthesis involved in DNA repair (GO:0000731)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|response to organophosphorus (GO:0046683)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	DNA replication factor C complex (GO:0005663)|nucleoplasm (GO:0005654)	DNA clamp loader activity (GO:0003689)			lung(2)|skin(1)	3		Hepatocellular(188;0.0191)|Lung SC(185;0.0548)		all cancers(112;5.09e-06)|Epithelial(112;6.52e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00107)|OV - Ovarian serous cystadenocarcinoma(117;0.0285)|GBM - Glioblastoma multiforme(144;0.123)		GACTCCATCTAAAAAAAAAAT	0.269																																					p.K79fs		.											.	RFC3-227	0			c.235delA						.		,	108,4134		12,84,2025	27.0	30.0	29.0		,	1.9	1.0	13		30	256,7956		39,178,3889	no	frameshift,frameshift	RFC3	NM_181558.2,NM_002915.3	,	51,262,5914	A1A1,A1R,RR		3.1174,2.546,2.9228	,	,	34398063	364,12090	2195	4285	6480	SO:0001589	frameshift_variant	5983	exon3			CCATCTAAAAAAA		CCDS9352.1, CCDS45025.1	13q13.2	2010-04-21	2002-08-29		ENSG00000133119	ENSG00000133119		"""ATPases / AAA-type"""	9971	protein-coding gene	gene with protein product	"""RFC, 38 kD subunit"", ""A1 38 kDa subunit"""	600405	"""replication factor C (activator 1) 3 (38kD)"""			7774928	Standard	NM_002915		Approved	RFC38, MGC5276	uc001uuz.3	P40938	OTTHUMG00000016715	ENST00000380071.3:c.235delA	13.37:g.34398063delA	ENSP00000369411:p.Lys81fs	Somatic	157	0		WXS	Illumina GAIIx	Phase_I	210	9	NM_002915	0	0	0	0	0	C9JU95|O15252|Q5W0E8	Frame_Shift_Del	DEL	ENST00000380071.3	37	CCDS9352.1																																																																																			.		0.269	RFC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044450.2	NM_002915	
COG3	83548	bcgsc.ca	37	13	46103935	46103935	+	Missense_Mutation	SNP	A	A	G	rs2274285	byFrequency	TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr13:46103935A>G	ENST00000349995.5	+	21	2352	c.2240A>G	c.(2239-2241)aAt>aGt	p.N747S		NM_031431.3	NP_113619	Q96JB2	COG3_HUMAN	component of oligomeric golgi complex 3	747			N -> S (in dbSNP:rs2274285). {ECO:0000269|PubMed:11929878}.		ER to Golgi vesicle-mediated transport (GO:0006888)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|protein glycosylation (GO:0006486)|protein localization to organelle (GO:0033365)|protein stabilization (GO:0050821)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein transporter activity (GO:0008565)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(2)|skin(2)|stomach(1)	24		Lung NSC(96;0.000145)|Breast(56;0.000596)|Prostate(109;0.00438)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000124)		GCAAAGGTCAATGACCTTGCG	0.338													A|||	3415	0.681909	0.4357	0.8156	5008	,	,		18459	0.7798		0.7356	False		,,,				2504	0.7638				p.N747S	Ovarian(150;1048 1859 18083 21577 42700)	.											.	COG3-154	0			c.A2240G						.	A	SER/ASN	2181,2225	584.3+/-386.0	550,1081,572	85.0	77.0	80.0		2240	-1.3	0.0	13	dbSNP_100	80	6506,2094	715.9+/-406.1	2476,1554,270	yes	missense	COG3	NM_031431.3	46	3026,2635,842	GG,GA,AA		24.3488,49.5007,33.2078	benign	747/829	46103935	8687,4319	2203	4300	6503	SO:0001583	missense	83548	exon21			AGGTCAATGACCT	AF131829	CCDS9398.1	13q14.11	2008-02-05			ENSG00000136152	ENSG00000136152		"""Components of oligomeric golgi complex"""	18619	protein-coding gene	gene with protein product		606975				11980916	Standard	NM_031431		Approved	SEC34	uc001vak.3	Q96JB2	OTTHUMG00000016855	ENST00000349995.5:c.2240A>G	13.37:g.46103935A>G	ENSP00000258654:p.Asn747Ser	Somatic	64	0		WXS	Illumina GAIIx	Phase_I	74	4	NM_031431	0	0	0	0	0	B2RAW5|Q5VT70|Q8IXX4|Q9BZ92	Missense_Mutation	SNP	ENST00000349995.5	37	CCDS9398.1	1534	0.7023809523809523	229	0.4654471544715447	287	0.7928176795580111	463	0.8094405594405595	555	0.7321899736147758	A	0.013	-1.617769	0.00828	0.495007	0.756512	ENSG00000136152	ENST00000349995	T	0.43688	0.94	5.58	-1.32	0.09201	.	0.352884	0.37809	N	0.001926	T	0.00012	0.0000	L	0.46157	1.445	0.42629	P	0.006630000000000025	B	0.02656	0.0	B	0.01281	0.0	T	0.43032	-0.9416	9	0.07482	T	0.82	0.9648	6.3004	0.21109	0.6382:0.1591:0.2027:0.0	rs2274285;rs52794786;rs58320510;rs2274285	747	Q96JB2	COG3_HUMAN	S	747	ENSP00000258654:N747S	ENSP00000258654:N747S	N	+	2	0	COG3	45001936	1.000000	0.71417	0.010000	0.14722	0.560000	0.35617	2.427000	0.44740	-0.165000	0.10908	-1.022000	0.02435	AAT	A|0.326;G|0.674		0.338	COG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044777.2		
OR10G3	26533	bcgsc.ca	37	14	22038525	22038525	+	Silent	SNP	G	G	T	rs11626693	byFrequency	TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr14:22038525G>T	ENST00000303532.1	-	1	350	c.351C>A	c.(349-351)acC>acA	p.T117T		NM_001005465.1	NP_001005465.1	Q8NGC4	O10G3_HUMAN	olfactory receptor, family 10, subfamily G, member 3	117						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)	15	all_cancers(95;0.000987)			GBM - Glioblastoma multiforme(265;0.0139)		AGGCCATTAGGGTGTAGAGGA	0.527													G|||	1822	0.363818	0.5371	0.2277	5008	,	,		21719	0.2966		0.3072	False		,,,				2504	0.3538				p.T117T		.											.	OR10G3-68	0			c.C351A						.	G		2158,2248	583.6+/-385.9	549,1060,594	58.0	56.0	56.0		351	-3.3	0.1	14	dbSNP_120	56	2429,6171	401.1+/-347.0	347,1735,2218	no	coding-synonymous	OR10G3	NM_001005465.1		896,2795,2812	TT,TG,GG		28.2442,48.9787,35.2683		117/314	22038525	4587,8419	2203	4300	6503	SO:0001819	synonymous_variant	26533	exon1			CATTAGGGTGTAG		CCDS32046.1	14q11.2	2013-09-24			ENSG00000169208	ENSG00000169208		"""GPCR / Class A : Olfactory receptors"""	8171	protein-coding gene	gene with protein product						8188290	Standard	NM_001005465		Approved		uc010tmb.2	Q8NGC4	OTTHUMG00000168886	ENST00000303532.1:c.351C>A	14.37:g.22038525G>T		Somatic	297	1		WXS	Illumina GAIIx	Phase_I	284	8	NM_001005465	0	0	0	0	0	Q6IET7|Q96R77	Silent	SNP	ENST00000303532.1	37	CCDS32046.1																																																																																			G|0.656;T|0.344		0.527	OR10G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401521.1		
CEP128	145508	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	81209499	81209499	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr14:81209499T>C	ENST00000555265.1	-	19	3101	c.2726A>G	c.(2725-2727)aAg>aGg	p.K909R	CEP128_ENST00000281129.3_Missense_Mutation_p.K909R			Q6ZU80	CE128_HUMAN	centrosomal protein 128kDa	909						centriole (GO:0005814)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|spindle pole (GO:0000922)				NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(22)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	51						CTCAGATTCCTTGTTTTCAGT	0.433																																					p.K909R		.											.	CEP128-91	0			c.A2726G						.						115.0	103.0	107.0					14																	81209499		2203	4300	6503	SO:0001583	missense	145508	exon18			GATTCCTTGTTTT	AK056756	CCDS32130.1	14q31.1	2014-02-20	2011-05-06	2011-05-06	ENSG00000100629	ENSG00000100629			20359	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 61"", ""chromosome 14 open reading frame 145"""	C14orf61, C14orf145		21399614	Standard	NM_152446		Approved		uc001xux.2	Q6ZU80		ENST00000555265.1:c.2726A>G	14.37:g.81209499T>C	ENSP00000451162:p.Lys909Arg	Somatic	68	0		WXS	Illumina GAIIx	Phase_I	58	17	NM_152446	0	0	0	0	0	B9EK52|Q86X97|Q96ML4	Missense_Mutation	SNP	ENST00000555265.1	37	CCDS32130.1	.	.	.	.	.	.	.	.	.	.	T	6.064	0.380085	0.11466	.	.	ENSG00000100629	ENST00000281129;ENST00000555265;ENST00000393619;ENST00000554728	T;T	0.32272	1.46;1.46	5.34	4.17	0.49024	.	0.181870	0.39759	N	0.001272	T	0.20495	0.0493	L	0.40543	1.245	0.80722	D	1	B	0.21606	0.058	B	0.23574	0.047	T	0.07158	-1.0787	10	0.14656	T	0.56	.	5.745	0.18114	0.0:0.1479:0.15:0.7022	.	909	Q6ZU80	CE128_HUMAN	R	909;909;909;110	ENSP00000281129:K909R;ENSP00000451162:K909R	ENSP00000281129:K909R	K	-	2	0	CEP128	80279252	1.000000	0.71417	0.997000	0.53966	0.055000	0.15305	1.689000	0.37700	2.150000	0.67090	0.459000	0.35465	AAG	.		0.433	CEP128-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413415.1	NM_152446	
TMOD2	29767	hgsc.bcm.edu;bcgsc.ca	37	15	52073255	52073255	+	Nonsense_Mutation	SNP	G	G	T			TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr15:52073255G>T	ENST00000249700.4	+	6	729	c.508G>T	c.(508-510)Gaa>Taa	p.E170*	TMOD2_ENST00000539962.2_Nonsense_Mutation_p.E126*|TMOD2_ENST00000435126.2_Nonsense_Mutation_p.E170*	NM_001142885.1|NM_014548.3	NP_001136357.1|NP_055363.1	Q9NZR1	TMOD2_HUMAN	tropomodulin 2 (neuronal)	170					learning or memory (GO:0007611)|nervous system development (GO:0007399)|neuron-neuron synaptic transmission (GO:0007270)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|growth cone (GO:0030426)	tropomyosin binding (GO:0005523)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(3)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	16				all cancers(107;0.00435)		TGTCAAAGGTGAAAAAGTAAA	0.363																																					p.E170X		.											.	TMOD2-92	0			c.G508T						.						90.0	83.0	85.0					15																	52073255		2195	4293	6488	SO:0001587	stop_gained	29767	exon6			AAAGGTGAAAAAG	AF177169	CCDS10144.1, CCDS45260.1	15q21.2	2008-05-14			ENSG00000128872	ENSG00000128872			11872	protein-coding gene	gene with protein product		602928				10662549	Standard	NM_014548		Approved	NTMOD	uc002abk.3	Q9NZR1	OTTHUMG00000131805	ENST00000249700.4:c.508G>T	15.37:g.52073255G>T	ENSP00000249700:p.Glu170*	Somatic	83	0		WXS	Illumina GAIIx	Phase_I	60	4	NM_014548	0	0	0	0	0	B4DEW6	Nonsense_Mutation	SNP	ENST00000249700.4	37	CCDS10144.1	.	.	.	.	.	.	.	.	.	.	G	39	7.909071	0.98557	.	.	ENSG00000128872	ENST00000435126;ENST00000249700;ENST00000539962	.	.	.	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.17369	T	0.5	-23.1682	18.8829	0.92364	0.0:0.0:1.0:0.0	.	.	.	.	X	170;170;126	.	ENSP00000249700:E170X	E	+	1	0	TMOD2	49860547	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	9.137000	0.94496	2.705000	0.92388	0.650000	0.86243	GAA	.		0.363	TMOD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254742.2		
KBTBD13	390594	hgsc.bcm.edu	37	15	65369395	65369395	+	Missense_Mutation	SNP	C	C	T	rs2919358	byFrequency	TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr15:65369395C>T	ENST00000432196.2	+	1	242	c.242C>T	c.(241-243)gCc>gTc	p.A81V	RASL12_ENST00000434605.2_5'Flank	NM_001101362.2	NP_001094832.1	C9JR72	KBTBD_HUMAN	kelch repeat and BTB (POZ) domain containing 13	81					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				lung(1)|prostate(1)|skin(1)	3						CTGCTGCAGGCCGTGGAGTGC	0.736													C|||	2613	0.521765	0.6036	0.5447	5008	,	,		9840	0.7312		0.3887	False		,,,				2504	0.316				p.A81V		.											.	.	0			c.C242T						.	C	VAL/ALA	1463,1441		405,653,394	2.0	3.0	2.0		242	4.6	1.0	15	dbSNP_101	2	2172,4110		500,1172,1469	no	missense	KBTBD13	NM_001101362.2	64	905,1825,1863	TT,TC,CC		34.575,49.6212,39.5711	possibly-damaging	81/459	65369395	3635,5551	1452	3141	4593	SO:0001583	missense	390594	exon1			TGCAGGCCGTGGA		CCDS45281.1	15q22.31	2014-09-17			ENSG00000234438	ENSG00000234438		"""BTB/POZ domain containing"""	37227	protein-coding gene	gene with protein product	"""nemaline myopathy type 6"""	613727				21109227, 22542517	Standard	NM_001101362		Approved	hCG_1645727, NEM6	uc010uis.2	C9JR72		ENST00000432196.2:c.242C>T	15.37:g.65369395C>T	ENSP00000388723:p.Ala81Val	Somatic	8	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_001101362	0	0	0	0	0		Missense_Mutation	SNP	ENST00000432196.2	37	CCDS45281.1	1197	0.5480769230769231	302	0.6138211382113821	191	0.5276243093922652	410	0.7167832167832168	294	0.38786279683377306	C	20.9	4.061996	0.76187	0.503788	0.34575	ENSG00000234438	ENST00000432196	T	0.67865	-0.29	4.6	4.6	0.57074	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (2);	.	.	.	.	T	0.00012	0.0000	N	0.21324	0.655	0.22629	P	0.99891774	P	0.47034	0.889	P	0.50896	0.653	T	0.37753	-0.9692	8	0.26408	T	0.33	.	17.2241	0.86964	0.0:1.0:0.0:0.0	rs2919358	81	C9JR72	KBTBD_HUMAN	V	81	ENSP00000388723:A81V	ENSP00000388723:A81V	A	+	2	0	KBTBD13	63156448	1.000000	0.71417	0.996000	0.52242	0.931000	0.56810	7.251000	0.78297	2.390000	0.81377	0.650000	0.86243	GCC	C|0.452;T|0.548		0.736	KBTBD13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418468.2	NM_001101362	
LINS	55180	hgsc.bcm.edu	37	15	101110302	101110302	+	Missense_Mutation	SNP	C	C	G	rs2411837	byFrequency	TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr15:101110302C>G	ENST00000314742.8	-	7	1637	c.1415G>C	c.(1414-1416)aGc>aCc	p.S472T	LINS_ENST00000559149.1_5'Flank	NM_001040616.2	NP_001035706	Q8NG48	LINES_HUMAN	lines homolog (Drosophila)	472			S -> T (in dbSNP:rs2411837).					p.S472T(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|prostate(1)|skin(1)|stomach(4)	21						CTGAGTCAAGCTTTCAGTGGC	0.338													C|||	1276	0.254792	0.115	0.2219	5008	,	,		17645	0.2252		0.4215	False		,,,				2504	0.3262				p.S472T		.											.	LINS-92	1	Substitution - Missense(1)	stomach(1)	c.G1415C						.	C	THR/SER	691,3715	263.8+/-265.7	61,569,1573	56.0	55.0	56.0		1415	1.5	0.0	15	dbSNP_100	56	3716,4882	488.7+/-372.4	815,2086,1398	yes	missense	LINS	NM_001040616.2	58	876,2655,2971	GG,GC,CC		43.2194,15.6832,33.8896	benign	472/758	101110302	4407,8597	2203	4299	6502	SO:0001583	missense	55180	exon7			GTCAAGCTTTCAG	AK095448	CCDS10385.1	15q26.3	2010-09-08	2010-09-08	2010-09-08	ENSG00000140471	ENSG00000140471			30922	protein-coding gene	gene with protein product		610350	"""lines homolog 1 (Drosophila)"""	LINS1		12119551, 8889548	Standard	NM_001040616		Approved	WINS1	uc002bwg.3	Q8NG48	OTTHUMG00000149865	ENST00000314742.8:c.1415G>C	15.37:g.101110302C>G	ENSP00000318423:p.Ser472Thr	Somatic	1	0		WXS	Illumina GAIIx	Phase_I	7	5	NM_001040616	0	0	0	3	3	Q96FW2|Q9NVQ3	Missense_Mutation	SNP	ENST00000314742.8	37	CCDS10385.1	616	0.28205128205128205	69	0.1402439024390244	92	0.2541436464088398	132	0.23076923076923078	323	0.4261213720316623	C	6.256	0.415431	0.11870	0.156832	0.432194	ENSG00000140471	ENST00000314742	T	0.18338	2.22	5.48	1.52	0.23074	.	1.019250	0.07759	N	0.949715	T	0.00012	0.0000	L	0.44542	1.39	0.80722	P	0.0	B	0.32467	0.372	B	0.30316	0.114	T	0.47394	-0.9121	9	0.52906	T	0.07	0.0722	8.2917	0.31960	0.0:0.5925:0.0:0.4075	rs2411837;rs17777920;rs52833524;rs2411837	472	Q8NG48	LINES_HUMAN	T	472	ENSP00000318423:S472T	ENSP00000318423:S472T	S	-	2	0	LINS	98927825	0.000000	0.05858	0.025000	0.17156	0.670000	0.39368	-0.174000	0.09839	0.285000	0.22329	0.655000	0.94253	AGC	C|0.688;G|0.310		0.338	LINS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313592.1	NM_018148	
CCDC102A	92922	hgsc.bcm.edu	37	16	57562804	57562804	+	Missense_Mutation	SNP	G	G	A	rs12935069		TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr16:57562804G>A	ENST00000258214.2	-	2	532	c.286C>T	c.(286-288)Cgg>Tgg	p.R96W		NM_033212.3	NP_149989.2	Q96A19	C102A_HUMAN	coiled-coil domain containing 102A	96				R -> W (in Ref. 2; AAH08285/AAH09941). {ECO:0000305}.						endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)	8						TCCGACCACCGGCGCATGGTC	0.731													A|||	5008	1.0	1.0	1.0	5008	,	,		3757	1.0		1.0	False		,,,				2504	1.0				p.R96W		.											.	CCDC102A-91	0			c.C286T						.						8.0	10.0	9.0					16																	57562804		1834	3717	5551	SO:0001583	missense	92922	exon2			ACCACCGGCGCAT	BC008285	CCDS10784.1	16q13	2008-02-05			ENSG00000135736	ENSG00000135736			28097	protein-coding gene	gene with protein product						12477932	Standard	NM_033212		Approved	MGC10992	uc002elw.3	Q96A19	OTTHUMG00000133472	ENST00000258214.2:c.286C>T	16.37:g.57562804G>A	ENSP00000258214:p.Arg96Trp	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_033212	0	0	0	0	0	Q9BT74	Missense_Mutation	SNP	ENST00000258214.2	37	CCDS10784.1	2180	0.9981684981684982	492	1.0	360	0.994475138121547	570	0.9965034965034965	758	1.0	A	10.17	1.277909	0.23307	.	.	ENSG00000135736	ENST00000258214	T	0.37752	1.18	4.82	4.82	0.62117	.	0.000000	0.64402	N	0.000001	T	0.00012	0.0000	N	0.00049	-2.415	0.40217	P	0.022302999999999962	B	0.02656	0.0	B	0.01281	0.0	T	0.44787	-0.9305	9	0.33141	T	0.24	-23.2491	9.5348	0.39216	0.9152:0.0:0.0848:0.0	rs12935069;rs12935069	96	Q96A19	C102A_HUMAN	W	96	ENSP00000258214:R96W	ENSP00000258214:R96W	R	-	1	2	CCDC102A	56120305	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	6.801000	0.75170	0.698000	0.31739	-0.556000	0.04195	CGG	G|0.001;A|0.999		0.731	CCDC102A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257348.1	NM_033212	
POLR2A	5430	bcgsc.ca	37	17	7412403	7412403	+	Silent	SNP	T	T	C	rs2228133	byFrequency	TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr17:7412403T>C	ENST00000322644.6	+	21	4005	c.3606T>C	c.(3604-3606)ttT>ttC	p.F1202F		NM_000937.4	NP_000928	P24928	RPB1_HUMAN	polymerase (RNA) II (DNA directed) polypeptide A, 220kDa	1202					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA-directed RNA polymerase activity (GO:0003968)|ubiquitin protein ligase binding (GO:0031625)			breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(17)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	50		Prostate(122;0.173)				TGCCTGACTTTGATGTGGCCC	0.542													T|||	553	0.110423	0.0431	0.1859	5008	,	,		18045	0.2183		0.0805	False		,,,				2504	0.0675				p.F1202F		.											.	POLR2A-91	0			c.T3606C						.	T		273,4133	153.3+/-186.9	11,251,1941	137.0	92.0	107.0		3606	-0.4	1.0	17	dbSNP_98	107	605,7995	159.2+/-212.6	23,559,3718	no	coding-synonymous	POLR2A	NM_000937.4		34,810,5659	CC,CT,TT		7.0349,6.1961,6.7507		1202/1971	7412403	878,12128	2203	4300	6503	SO:0001819	synonymous_variant	5430	exon21			TGACTTTGATGTG			17p13.1	2013-01-21	2002-08-29		ENSG00000181222	ENSG00000181222	2.7.7.6	"""RNA polymerase subunits"""	9187	protein-coding gene	gene with protein product	"""DNA-directed RNA polymerase II largest subunit, RNA polymerase II 220 kd subunit"", ""RNA polymerase II subunit B1"""	180660	"""polymerase (RNA) II (DNA directed) polypeptide A (220kD)"""	POLR2			Standard	NM_000937		Approved	POLRA, RPB1	uc002ghf.4	P24928	OTTHUMG00000177594	ENST00000322644.6:c.3606T>C	17.37:g.7412403T>C		Somatic	332	2		WXS	Illumina GAIIx	Phase_I	200	7	NM_000937	0	0	3	3	0	A6NN93|B9EH88|Q6NX41	Silent	SNP	ENST00000322644.6	37	CCDS32548.1																																																																																			T|0.909;C|0.091		0.542	POLR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437967.1	NM_000937	
FOXN1	8456	bcgsc.ca	37	17	26861877	26861877	+	Missense_Mutation	SNP	C	C	T	rs61749867	byFrequency	TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr17:26861877C>T	ENST00000226247.2	+	7	1317	c.1288C>T	c.(1288-1290)Cca>Tca	p.P430S	FOXN1_ENST00000579795.1_Missense_Mutation_p.P430S	NM_003593.2	NP_003584.2	O15353	FOXN1_HUMAN	forkhead box N1	430					defense response (GO:0006952)|epidermis development (GO:0008544)|epithelial cell proliferation (GO:0050673)|hair follicle development (GO:0001942)|keratinocyte differentiation (GO:0030216)|lymphocyte homeostasis (GO:0002260)|nail development (GO:0035878)|organ morphogenesis (GO:0009887)|regulation of T cell differentiation in thymus (GO:0033081)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|thymus development (GO:0048538)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(3)|lung(8)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	Lung NSC(42;0.00431)					CCACCCAGCTCCAGGCCCCAT	0.677													C|||	60	0.0119808	0.0023	0.0072	5008	,	,		15813	0.001		0.0507	False		,,,				2504	0.0				p.P430S		.											.	FOXN1-226	0			c.C1288T						.	C	SER/PRO	37,4369	42.3+/-75.8	1,35,2167	36.0	34.0	34.0		1288	2.3	0.7	17	dbSNP_129	34	346,8254	117.9+/-177.5	11,324,3965	yes	missense	FOXN1	NM_003593.2	74	12,359,6132	TT,TC,CC		4.0233,0.8398,2.9448	benign	430/649	26861877	383,12623	2203	4300	6503	SO:0001583	missense	8456	exon7			CCAGCTCCAGGCC	Y11739	CCDS11232.1	17q11-q12	2014-09-17	2003-06-12	2003-06-13	ENSG00000109101	ENSG00000109101		"""Forkhead boxes"""	12765	protein-coding gene	gene with protein product		600838	"""winged-helix nude"", ""Rowett nude"""	WHN, RONU		9321431	Standard	NM_003593		Approved	FKHL20	uc002hbj.3	O15353	OTTHUMG00000132603	ENST00000226247.2:c.1288C>T	17.37:g.26861877C>T	ENSP00000226247:p.Pro430Ser	Somatic	154	0		WXS	Illumina GAIIx	Phase_I	188	7	NM_003593	0	0	0	0	0	B2R9Q7|O15352	Missense_Mutation	SNP	ENST00000226247.2	37	CCDS11232.1	52	0.023809523809523808	1	0.0020325203252032522	3	0.008287292817679558	1	0.0017482517482517483	47	0.06200527704485488	C	6.967	0.548294	0.13312	0.008398	0.040233	ENSG00000109101	ENST00000226247	D	0.93189	-3.18	4.35	2.31	0.28768	.	0.215145	0.33309	N	0.005058	T	0.39226	0.1070	N	0.08118	0	0.19300	N	0.999979	B	0.02656	0.0	B	0.01281	0.0	T	0.57087	-0.7871	10	0.25751	T	0.34	.	5.3559	0.16061	0.0:0.4583:0.3023:0.2394	rs61749867	430	O15353	FOXN1_HUMAN	S	430	ENSP00000226247:P430S	ENSP00000226247:P430S	P	+	1	0	FOXN1	23886004	0.000000	0.05858	0.734000	0.30879	0.869000	0.49853	-0.500000	0.06405	0.457000	0.26962	0.561000	0.74099	CCA	C|0.971;T|0.029		0.677	FOXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255832.1		
ATP6V0A1	535	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	40666399	40666399	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr17:40666399G>A	ENST00000343619.4	+	21	2464	c.2341G>A	c.(2341-2343)Gcc>Acc	p.A781T	ATP6V0A1_ENST00000546249.1_Missense_Mutation_p.A781T|ATP6V0A1_ENST00000537728.1_Missense_Mutation_p.A732T|ATP6V0A1_ENST00000544137.1_Missense_Mutation_p.A427T|ATP6V0A1_ENST00000393829.2_Missense_Mutation_p.A775T|ATP6V0A1_ENST00000585525.1_Missense_Mutation_p.A738T|RP11-400F19.18_ENST00000591237.1_RNA|MIR5010_ENST00000582846.1_RNA|ATP6V0A1_ENST00000264649.6_Missense_Mutation_p.A782T	NM_001130021.1	NP_001123493.1	Q93050	VPP1_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit a1	781					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	ATPase binding (GO:0051117)|hydrogen ion transmembrane transporter activity (GO:0015078)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(8)|pancreas(1)|prostate(1)|urinary_tract(3)	26		all_cancers(22;1.18e-05)|Breast(137;0.000105)|all_epithelial(22;0.000254)		BRCA - Breast invasive adenocarcinoma(366;0.137)		CTTCTTCACTGCCTTTGCCAC	0.602																																					p.A782T		.											.	ATP6V0A1-91	0			c.G2344A						.						241.0	209.0	219.0					17																	40666399		2203	4300	6503	SO:0001583	missense	535	exon20			TTCACTGCCTTTG	U73006	CCDS11426.1, CCDS45683.1, CCDS45684.1	17q21	2010-04-21	2006-01-20	2002-05-10	ENSG00000033627	ENSG00000033627		"""ATPases / V-type"""	865	protein-coding gene	gene with protein product		192130	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) non-catalytic accessory protein 1A (110/116kD)"", ""ATPase, H+ transporting, lysosomal V0 subunit a isoform 1"", ""ATPase, H+ transporting, lysosomal V0 subunit A1"""	VPP1, ATP6N1, ATP6N1A		7774924	Standard	NM_001130020		Approved	a1, Vph1, Stv1	uc002hzs.3	Q93050		ENST00000343619.4:c.2341G>A	17.37:g.40666399G>A	ENSP00000342951:p.Ala781Thr	Somatic	214	0		WXS	Illumina GAIIx	Phase_I	176	48	NM_001130020	0	0	13	21	8	B7Z3B7|Q8N5G7|Q9NSX0	Missense_Mutation	SNP	ENST00000343619.4	37	CCDS45684.1	.	.	.	.	.	.	.	.	.	.	G	18.86	3.713028	0.68730	.	.	ENSG00000033627	ENST00000343619;ENST00000546249;ENST00000393829;ENST00000264649;ENST00000537728;ENST00000544137	D;D;D;D;D;D	0.86366	-2.11;-2.11;-2.11;-2.11;-2.11;-2.11	4.57	3.6	0.41247	.	0.054064	0.64402	D	0.000001	D	0.92309	0.7560	M	0.89095	3.005	0.51233	D	0.999915	P;P;P;P;P	0.43024	0.798;0.766;0.766;0.794;0.609	P;P;P;B;P	0.54100	0.533;0.533;0.742;0.383;0.502	D	0.92606	0.6095	10	0.54805	T	0.06	-10.315	12.4435	0.55637	0.0811:0.0:0.9189:0.0	.	732;738;782;781;775	B7Z641;B7Z2A9;B7Z3B7;Q93050;Q93050-1	.;.;.;VPP1_HUMAN;.	T	781;781;775;782;732;427	ENSP00000342951:A781T;ENSP00000444676:A781T;ENSP00000377415:A775T;ENSP00000264649:A782T;ENSP00000443991:A732T;ENSP00000446377:A427T	ENSP00000264649:A782T	A	+	1	0	ATP6V0A1	37919925	1.000000	0.71417	0.970000	0.41538	0.760000	0.43138	3.620000	0.54203	1.164000	0.42652	0.561000	0.74099	GCC	.		0.602	ATP6V0A1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450364.1	NM_001130020	
HSD17B1	3292	hgsc.bcm.edu	37	17	40706906	40706906	+	Missense_Mutation	SNP	G	G	A	rs605059	byFrequency	TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr17:40706906G>A	ENST00000585807.1	+	6	4657	c.937G>A	c.(937-939)Ggt>Agt	p.G313S	HSD17B1_ENST00000225929.5_Missense_Mutation_p.G314S|RP11-400F19.8_ENST00000585572.1_RNA|RP11-400F19.6_ENST00000590513.1_RNA	NM_000413.2	NP_000404.2	P14061	DHB1_HUMAN	hydroxysteroid (17-beta) dehydrogenase 1	313			G -> S (in dbSNP:rs605059). {ECO:0000269|PubMed:1327779, ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:2197970, ECO:0000269|PubMed:2330005, ECO:0000269|PubMed:2779584, ECO:0000269|PubMed:2846351, ECO:0000269|PubMed:8389226, ECO:0000269|Ref.6, ECO:0000269|Ref.9}.		bone development (GO:0060348)|cellular response to metal ion (GO:0071248)|estrogen biosynthetic process (GO:0006703)|estrogen metabolic process (GO:0008210)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)|testosterone biosynthetic process (GO:0061370)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|estradiol 17-beta-dehydrogenase activity (GO:0004303)			NS(1)|endometrium(1)|kidney(1)|lung(2)	5		all_cancers(22;5.59e-08)|all_epithelial(22;7e-07)|Ovarian(249;0.0261)		BRCA - Breast invasive adenocarcinoma(366;0.129)	Equilin(DB02187)	GGCCGGGCGCGGTGCGGTGGG	0.736													A|||	2617	0.522564	0.4849	0.4942	5008	,	,		11834	0.4534		0.5249	False		,,,				2504	0.6626				p.G313S		.											.	HSD17B1-90	0			c.G937A	GRCh37	CM057951	HSD17B1	M	rs605059	.	A	SER/GLY	2209,1645		683,843,401	3.0	5.0	4.0		937	-1.2	0.0	17	dbSNP_83	4	4593,3023		1489,1615,704	no	missense	HSD17B1	NM_000413.2	56	2172,2458,1105	AA,AG,GG		39.6928,42.6829,40.6975	benign	313/329	40706906	6802,4668	1927	3808	5735	SO:0001583	missense	3292	exon6			GGGCGCGGTGCGG		CCDS11428.1	17q11-q21	2011-09-14					1.1.1.62	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	5210	protein-coding gene	gene with protein product	"""Estradiol 17-beta-dehydrogenase-1"", ""short chain dehydrogenase/reductase family 28CE, member 1"""	109684		EDHB17, EDH17B2		2330005, 19027726	Standard	NM_000413		Approved	HSD17, MGC138140, SDR28C1	uc002hzw.3	P14061		ENST00000585807.1:c.937G>A	17.37:g.40706906G>A	ENSP00000466799:p.Gly313Ser	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	4	4	NM_000413	0	0	0	0	0	B3KXS1|Q2M2L8	Missense_Mutation	SNP	ENST00000585807.1	37	CCDS11428.1	1065	0.4876373626373626	249	0.5060975609756098	161	0.4447513812154696	257	0.4493006993006993	398	0.525065963060686	A	1.679	-0.506941	0.04231	0.573171	0.603072	ENSG00000108786	ENST00000225929	.	.	.	0.605	-1.21	0.09524	.	15.510600	0.00792	N	0.001347	T	0.00012	0.0000	N	0.19112	0.55	0.80722	P	0.0	B;B	0.09022	0.002;0.002	B;B	0.01281	0.0;0.0	T	0.49916	-0.8888	7	0.15952	T	0.53	.	.	.	.	rs605059;rs58087383	344;313	B3RFR9;P14061	.;DHB1_HUMAN	S	313	.	ENSP00000225929:G313S	G	+	1	0	HSD17B1	37960432	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.026000	0.03596	-2.560000	0.00474	-1.912000	0.00520	GGT	G|0.505;A|0.495		0.736	HSD17B1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450392.1	NM_000413	
IGF2BP1	10642	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	47117325	47117325	+	Missense_Mutation	SNP	C	C	A	rs372137995		TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr17:47117325C>A	ENST00000290341.3	+	7	1024	c.690C>A	c.(688-690)gaC>gaA	p.D230E	IGF2BP1_ENST00000431824.2_Intron	NM_006546.3	NP_006537.3	Q9NZI8	IF2B1_HUMAN	insulin-like growth factor 2 mRNA binding protein 1	230	KH 1. {ECO:0000255|PROSITE- ProRule:PRU00117}.|Necessary for interaction with ELAVL4 and binding to TAU mRNA. {ECO:0000250}.				CRD-mediated mRNA stabilization (GO:0070934)|gene expression (GO:0010467)|mRNA transport (GO:0051028)|negative regulation of translation (GO:0017148)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of mRNA stability involved in response to stress (GO:0010610)	CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|translation regulator activity (GO:0045182)			breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	31						CCAGGATAGACGTGCATAGGA	0.547																																					p.D230E	Esophageal Squamous(198;1041 2123 8248 37119 38268)	.											.	IGF2BP1-226	0			c.C690A						.						109.0	104.0	106.0					17																	47117325		2203	4300	6503	SO:0001583	missense	10642	exon7			GATAGACGTGCAT	AF198254	CCDS11543.1, CCDS54138.1	17q21.32	2013-02-12			ENSG00000159217	ENSG00000159217		"""RNA binding motif (RRM) containing"""	28866	protein-coding gene	gene with protein product	"""IGF II mRNA binding protein 1"""	608288				9891060, 11992722	Standard	NM_001160423		Approved	IMP-1	uc002iom.3	Q9NZI8	OTTHUMG00000161173	ENST00000290341.3:c.690C>A	17.37:g.47117325C>A	ENSP00000290341:p.Asp230Glu	Somatic	132	0		WXS	Illumina GAIIx	Phase_I	81	6	NM_006546	0	0	0	0	0	C9JT33	Missense_Mutation	SNP	ENST00000290341.3	37	CCDS11543.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.100161	0.76983	.	.	ENSG00000159217	ENST00000290341	T	0.31769	1.48	5.65	-2.98	0.05513	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.000000	0.85682	D	0.000000	T	0.41880	0.1178	L	0.59912	1.85	0.80722	D	1	P	0.51449	0.945	P	0.59948	0.866	T	0.42032	-0.9475	10	0.66056	D	0.02	-31.2017	12.2208	0.54433	0.0:0.346:0.0:0.654	.	230	Q9NZI8	IF2B1_HUMAN	E	230	ENSP00000290341:D230E	ENSP00000290341:D230E	D	+	3	2	IGF2BP1	44472324	0.000000	0.05858	0.982000	0.44146	0.989000	0.77384	-1.842000	0.01681	-0.358000	0.08162	-0.122000	0.15005	GAC	.		0.547	IGF2BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364046.1	NM_006546	
TMX3	54495	broad.mit.edu	37	18	66377285	66377285	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr18:66377285C>T	ENST00000299608.2	-	4	554	c.238G>A	c.(238-240)Gga>Aga	p.G80R	TMX3_ENST00000443099.2_Missense_Mutation_p.G80R|TMX3_ENST00000562706.1_Missense_Mutation_p.G80R	NM_019022.3	NP_061895.3	Q96JJ7	TMX3_HUMAN	thioredoxin-related transmembrane protein 3	80	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell redox homeostasis (GO:0045454)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein disulfide isomerase activity (GO:0003756)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|urinary_tract(1)	17						TCCATCTTTCCAACCTTAACT	0.378																																					p.G80R		.											.	TMX3-91	0			c.G238A						.						125.0	114.0	117.0					18																	66377285		2203	4300	6503	SO:0001583	missense	54495	exon4			TCTTTCCAACCTT	BX647846	CCDS32840.1	18q22	2011-10-19	2009-02-23	2009-02-23		ENSG00000166479		"""Protein disulfide isomerases"""	24718	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 13"""		"""thioredoxin domain containing 10"""	TXNDC10		15623505	Standard	NM_019022		Approved	FLJ20793, KIAA1830, PDIA13	uc002lkf.3	Q96JJ7		ENST00000299608.2:c.238G>A	18.37:g.66377285C>T	ENSP00000299608:p.Gly80Arg	Somatic	83	0		WXS	Illumina GAIIx	Phase_I	87	4	NM_019022	0	0	0	0	0	B3KV75|Q52LT7|Q8N5J0|Q9NWJ9	Missense_Mutation	SNP	ENST00000299608.2	37	CCDS32840.1	.	.	.	.	.	.	.	.	.	.	C	28.8	4.953872	0.92660	.	.	ENSG00000166479	ENST00000299608;ENST00000544714;ENST00000443099	T;T;T	0.46063	0.88;3.98;3.98	5.57	5.57	0.84162	Thioredoxin domain (1);Thioredoxin-like fold (3);	0.000000	0.85682	D	0.000000	T	0.71484	0.3345	M	0.89353	3.025	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.999	T	0.77070	-0.2724	10	0.87932	D	0	.	18.1057	0.89519	0.0:1.0:0.0:0.0	.	80;80;80	B4DIE3;Q96JJ7-2;Q96JJ7	.;.;TMX3_HUMAN	R	80	ENSP00000299608:G80R;ENSP00000444954:G80R;ENSP00000402605:G80R	ENSP00000299608:G80R	G	-	1	0	TMX3	64528265	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.719000	0.84751	2.619000	0.88677	0.563000	0.77884	GGA	.		0.378	TMX3-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000420155.1	NM_019022	
CBLN2	147381	hgsc.bcm.edu	37	18	70209321	70209321	+	Silent	SNP	C	C	A	rs7237888	byFrequency	TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr18:70209321C>A	ENST00000269503.4	-	3	848	c.75G>T	c.(73-75)ccG>ccT	p.P25P	CBLN2_ENST00000585159.1_Silent_p.P25P|CBLN2_ENST00000583651.1_Intron|CBLN2_ENST00000581073.1_Intron|CBLN2_ENST00000584764.1_Intron	NM_182511.3	NP_872317.1	Q8IUK8	CBLN2_HUMAN	cerebellin 2 precursor	25					positive regulation of synapse assembly (GO:0051965)	extracellular space (GO:0005615)				endometrium(2)|lung(15)	17		Esophageal squamous(42;0.131)				CGCAgccgcccggctcgcgca	0.786													C|||	2820	0.563099	0.1868	0.8573	5008	,	,		7947	0.381		0.9304	False		,,,				2504	0.6728				p.P25P		.											.	CBLN2-90	0			c.G75T						.	C		1660,2420		328,1004,708	5.0	7.0	6.0		75	-0.8	1.0	18	dbSNP_116	6	7475,487		3530,415,36	no	coding-synonymous	CBLN2	NM_182511.3		3858,1419,744	AA,AC,CC		6.1166,40.6863,24.1405		25/225	70209321	9135,2907	2040	3981	6021	SO:0001819	synonymous_variant	147381	exon3			GCCGCCCGGCTCG	BC035789	CCDS11999.1	18q22.3	2007-11-19			ENSG00000141668	ENSG00000141668			1544	protein-coding gene	gene with protein product		600433				7877445	Standard	NM_182511		Approved		uc002lkv.2	Q8IUK8	OTTHUMG00000132825	ENST00000269503.4:c.75G>T	18.37:g.70209321C>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	7	7	NM_182511	0	0	0	0	0	Q53Z56	Silent	SNP	ENST00000269503.4	37	CCDS11999.1																																																																																			C|0.390;A|0.610		0.786	CBLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256288.1	NM_182511	
MUC16	94025	bcgsc.ca	37	19	9062415	9062415	+	Missense_Mutation	SNP	T	T	G	rs12978757	byFrequency	TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr19:9062415T>G	ENST00000397910.4	-	3	25234	c.25031A>C	c.(25030-25032)gAc>gCc	p.D8344A		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	8346	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AGGCTGCATGTCTTCTGTATC	0.478													G|||	2948	0.588658	0.5507	0.6801	5008	,	,		22695	0.6042		0.5646	False		,,,				2504	0.5838				p.D8344A		.											.	MUC16-566	0			c.A25031C						.	G	ALA/ASP	2329,1863		668,993,435	195.0	189.0	191.0		25031	-5.0	0.0	19	dbSNP_121	191	5173,3285		1590,1993,646	yes	missense	MUC16	NM_024690.2	126	2258,2986,1081	GG,GT,TT		38.839,44.4418,40.6957	benign	8344/14508	9062415	7502,5148	2096	4229	6325	SO:0001583	missense	94025	exon3			TGCATGTCTTCTG	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.25031A>C	19.37:g.9062415T>G	ENSP00000381008:p.Asp8344Ala	Somatic	249	2		WXS	Illumina GAIIx	Phase_I	227	7	NM_024690	0	0	0	0	0	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	1303	0.5966117216117216	260	0.5284552845528455	230	0.6353591160220995	379	0.6625874125874126	434	0.5725593667546174	g	4.255	0.046398	0.08243	0.555582	0.61161	ENSG00000181143	ENST00000397910	T	0.21734	1.99	2.5	-5.0	0.03001	.	.	.	.	.	T	0.00012	0.0000	N	0.01352	-0.895	.	.	.	B	0.02656	0.0	B	0.01281	0.0	T	0.42899	-0.9424	8	0.87932	D	0	.	7.0457	0.25044	0.0:0.2676:0.1932:0.5392	rs12978757;rs52832392;rs61633210;rs12978757	8344	B5ME49	.	A	8344	ENSP00000381008:D8344A	ENSP00000381008:D8344A	D	-	2	0	MUC16	8923415	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.632000	0.05489	-1.816000	0.01221	-1.931000	0.00510	GAC	T|0.401;G|0.599		0.478	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
PRKCSH	5589	hgsc.bcm.edu	37	19	11558367	11558367	+	Silent	SNP	G	G	A			TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr19:11558367G>A	ENST00000589838.1	+	10	963	c.963G>A	c.(961-963)gaG>gaA	p.E321E	PRKCSH_ENST00000587327.1_Silent_p.E321E|PRKCSH_ENST00000591462.1_Silent_p.E321E|PRKCSH_ENST00000412601.1_Silent_p.E321E|PRKCSH_ENST00000592741.1_Silent_p.E321E|PRKCSH_ENST00000252455.2_Silent_p.E321E			P14314	GLU2B_HUMAN	protein kinase C substrate 80K-H	321	Glu-rich (acidic).				cellular protein metabolic process (GO:0044267)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|liver development (GO:0001889)|N-glycan processing (GO:0006491)|negative regulation of neuron projection development (GO:0010977)|nitrogen compound metabolic process (GO:0006807)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein heterooligomerization (GO:0051291)|protein N-linked glycosylation via asparagine (GO:0018279)|renal system development (GO:0072001)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|intracellular (GO:0005622)	calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|phosphoprotein binding (GO:0051219)|protein kinase C binding (GO:0005080)|RNA binding (GO:0003723)	p.E321_E322delEE(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|prostate(3)	19						aggaggaggaggaggaagaag	0.632																																					p.E321E		.											.	PRKCSH-90	1	Deletion - In frame(1)	central_nervous_system(1)	c.G963A						.						28.0	28.0	28.0					19																	11558367		2200	4298	6498	SO:0001819	synonymous_variant	5589	exon11			GGAGGAGGAGGAA		CCDS32911.1, CCDS45977.1, CCDS74286.1	19p13.2	2014-01-30			ENSG00000130175	ENSG00000130175	2.7.11.1	"""EF-hand domain containing"""	9411	protein-coding gene	gene with protein product		177060	"""polycystic liver disease"""	G19P1, PCLD, PLD1		12529853	Standard	NM_002743		Approved		uc002mrt.3	P14314	OTTHUMG00000182029	ENST00000589838.1:c.963G>A	19.37:g.11558367G>A		Somatic	130	0		WXS	Illumina GAIIx	Phase_I	104	8	NM_001001329	0	0	40	40	0	A8K318|Q96BU9|Q96D06|Q9P0W9	Silent	SNP	ENST00000589838.1	37	CCDS32911.1																																																																																			.		0.632	PRKCSH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458817.1		
RFX1	5989	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	14088836	14088836	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr19:14088836C>G	ENST00000254325.4	-	8	1131	c.897G>C	c.(895-897)gaG>gaC	p.E299D		NM_002918.4	NP_002909.4	P22670	RFX1_HUMAN	regulatory factor X, 1 (influences HLA class II expression)	299					immune response (GO:0006955)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(19;6.67e-23)			CATCGCCGCCCTCCACATACT	0.657																																					p.E299D		.											.	RFX1-92	0			c.G897C						.						123.0	111.0	115.0					19																	14088836		2203	4300	6503	SO:0001583	missense	5989	exon8			GCCGCCCTCCACA		CCDS12301.1	19p13.1	2008-07-17				ENSG00000132005			9982	protein-coding gene	gene with protein product	"""trans-acting regulatory factor 1"", ""enhancer factor C"", ""MHC class II regulatory factor RFX"""	600006				1505960, 8289803	Standard	NM_002918		Approved	EF-C	uc002mxv.3	P22670		ENST00000254325.4:c.897G>C	19.37:g.14088836C>G	ENSP00000254325:p.Glu299Asp	Somatic	115	0		WXS	Illumina GAIIx	Phase_I	84	32	NM_002918	0	0	1	1	0		Missense_Mutation	SNP	ENST00000254325.4	37	CCDS12301.1	.	.	.	.	.	.	.	.	.	.	C	19.64	3.865557	0.71949	.	.	ENSG00000132005	ENST00000254325	T	0.52295	0.67	4.71	2.57	0.30868	RFX1 transcription activation region (1);	0.194474	0.45126	D	0.000399	T	0.60996	0.2312	M	0.69523	2.12	0.42239	D	0.99192	D	0.76494	0.999	D	0.87578	0.998	T	0.58825	-0.7568	10	0.37606	T	0.19	-7.3656	7.1625	0.25672	0.0:0.7097:0.0:0.2903	.	299	P22670	RFX1_HUMAN	D	299	ENSP00000254325:E299D	ENSP00000254325:E299D	E	-	3	2	RFX1	13949836	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	1.368000	0.34216	0.969000	0.38237	0.555000	0.69702	GAG	.		0.657	RFX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458510.1	NM_002918	
SLC7A9	11136	bcgsc.ca	37	19	33355069	33355069	+	Silent	SNP	A	A	G	rs12150890	byFrequency	TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr19:33355069A>G	ENST00000023064.4	-	4	602	c.411T>C	c.(409-411)tgT>tgC	p.C137C	RN7SKP22_ENST00000365097.1_RNA|SLC7A9_ENST00000590341.1_Silent_p.C137C|SLC7A9_ENST00000587772.1_Silent_p.C137C	NM_001126335.1|NM_001243036.1|NM_014270.4	NP_001119807.1|NP_001229965.1|NP_055085.1	P82251	BAT1_HUMAN	solute carrier family 7 (amino acid transporter light chain, bo,+ system), member 9	137					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|L-cystine transport (GO:0015811)|leukocyte migration (GO:0050900)|neutral amino acid transport (GO:0015804)|protein complex assembly (GO:0006461)|transmembrane transport (GO:0055085)|transport (GO:0006810)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|L-cystine transmembrane transporter activity (GO:0015184)|neutral amino acid transmembrane transporter activity (GO:0015175)|peptide antigen binding (GO:0042605)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	32	Esophageal squamous(110;0.137)				L-Cystine(DB00138)	AGAAGGGCGCACACACATACT	0.602													G|||	362	0.0722843	0.0129	0.0692	5008	,	,		19763	0.1032		0.1491	False		,,,				2504	0.044				p.C137C	GBM(181;1335 2108 9644 44178 46689)	.											.	SLC7A9-91	0			c.T411C						.	G	,	152,4254	812.2+/-416.1	3,146,2054	109.0	85.0	93.0		411,411	-9.7	0.0	19	dbSNP_120	93	1217,7383	762.1+/-407.6	75,1067,3158	no	coding-synonymous,coding-synonymous	SLC7A9	NM_001126335.1,NM_014270.4	,	78,1213,5212	GG,GA,AA		14.1512,3.4498,10.5259	,	137/488,137/488	33355069	1369,11637	2203	4300	6503	SO:0001819	synonymous_variant	11136	exon4			GGGCGCACACACA	AF141289	CCDS12425.1	19q13.11	2013-07-19	2013-07-19		ENSG00000021488	ENSG00000021488		"""Solute carriers"""	11067	protein-coding gene	gene with protein product		604144		CSNU3		10471498	Standard	NM_014270		Approved		uc021usa.1	P82251	OTTHUMG00000180287	ENST00000023064.4:c.411T>C	19.37:g.33355069A>G		Somatic	179	1		WXS	Illumina GAIIx	Phase_I	118	6	NM_001243036	0	0	0	0	0	B2R9A6	Silent	SNP	ENST00000023064.4	37	CCDS12425.1																																																																																			A|0.901;G|0.099		0.602	SLC7A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450585.1		
SAMD4B	55095	hgsc.bcm.edu;broad.mit.edu	37	19	39871263	39871263	+	Silent	SNP	C	C	G			TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr19:39871263C>G	ENST00000314471.6	+	13	2721	c.1686C>G	c.(1684-1686)ggC>ggG	p.G562G	SAMD4B_ENST00000598913.1_Silent_p.G562G|SAMD4B_ENST00000596368.1_Intron	NM_018028.2	NP_060498.2	Q5PRF9	SMAG2_HUMAN	sterile alpha motif domain containing 4B	562					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			autonomic_ganglia(1)|breast(1)|endometrium(5)|large_intestine(1)|lung(4)|skin(1)|urinary_tract(2)	15	all_cancers(60;2.5e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;6.4e-07)|Ovarian(47;0.0512)		Epithelial(26;9.6e-28)|all cancers(26;9.14e-25)|Lung(45;0.000168)|LUSC - Lung squamous cell carcinoma(53;0.000199)			CCATAGCTGGCTCTGTGGGGA	0.647																																					p.G562G		.											.	SAMD4B-90	0			c.C1686G						.						42.0	41.0	42.0					19																	39871263		2202	4300	6502	SO:0001819	synonymous_variant	55095	exon13			AGCTGGCTCTGTG		CCDS33020.1	19q13.2	2013-01-10				ENSG00000179134		"""Sterile alpha motif (SAM) domain containing"""	25492	protein-coding gene	gene with protein product	"""smaug homolog B (Drosophila)"""					16221671	Standard	XM_005259029		Approved	FLJ10211, MGC99832, SMGB, hSmaug2	uc002olb.3	Q5PRF9		ENST00000314471.6:c.1686C>G	19.37:g.39871263C>G		Somatic	115	0		WXS	Illumina GAIIx	Phase_I	72	4	NM_018028	0	0	5	6	1	A5Z0M6|Q6P194	Silent	SNP	ENST00000314471.6	37	CCDS33020.1																																																																																			.		0.647	SAMD4B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464467.1	NM_018028	
FCGBP	8857	bcgsc.ca	37	19	40406019	40406019	+	Silent	SNP	G	G	A	rs2355719	byFrequency	TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr19:40406019G>A	ENST00000221347.6	-	10	4834	c.4827C>T	c.(4825-4827)tgC>tgT	p.C1609C		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	1609	Cys-rich.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			CATGGCACGTGCACTGCTGCC	0.632													A|||	1308	0.261182	0.1566	0.402	5008	,	,		20345	0.2163		0.3419	False		,,,				2504	0.2658				p.C1609C		.											.	FCGBP-98	0			c.C4827T						.						77.0	55.0	62.0					19																	40406019		2203	4298	6501	SO:0001819	synonymous_variant	8857	exon10			GCACGTGCACTGC	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.4827C>T	19.37:g.40406019G>A		Somatic	307	3		WXS	Illumina GAIIx	Phase_I	180	8	NM_003890	0	0	0	0	0	O95784	Silent	SNP	ENST00000221347.6	37	CCDS12546.1																																																																																			G|0.732;A|0.268		0.632	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890	
CEACAM20	125931	bcgsc.ca	37	19	45016116	45016116	+	RNA	SNP	A	A	G	rs8100718	byFrequency	TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr19:45016116A>G	ENST00000454753.1	-	0	1813							Q6UY09	CEA20_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 20							integral component of membrane (GO:0016021)		p.C511R(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|prostate(1)	15		Prostate(69;0.0352)				GATATATTGCAATACTCAGGA	0.507													A|||	1925	0.384385	0.1679	0.4078	5008	,	,		18720	0.3919		0.4612	False		,,,				2504	0.5736				p.C512R		.											.	CEACAM20-67	1	Substitution - Missense(1)	prostate(1)	c.T1534C						.	A	ARG/CYS,ARG/CYS,ARG/CYS,ARG/CYS	917,3079		106,705,1187	46.0	46.0	46.0		1535,1256,1256,1535	0.9	0.0	19	dbSNP_116	46	4182,4158		1069,2044,1057	yes	missense,missense,missense,missense	CEACAM20	NM_001102597.1,NM_001102598.1,NM_001102599.1,NM_001102600.1	180,180,180,180	1175,2749,2244	GG,GA,AA		49.8561,22.9479,41.3343	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	512/597,419/492,419/504,512/585	45016116	5099,7237	1998	4170	6168			125931	exon10			TATTGCAATACTC	AY358129	CCDS74390.1, CCDS74391.1, CCDS74392.1, CCDS74393.1	19q13.31	2013-01-30			ENSG00000176395	ENSG00000273777		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	24879	protein-coding gene	gene with protein product						12975309	Standard	NM_001102600		Approved	UNQ9366	uc010ejo.1	Q6UY09	OTTHUMG00000151532		19.37:g.45016116A>G		Somatic	198	0		WXS	Illumina GAIIx	Phase_I	136	6	NM_001102600	0	0	0	0	0		Missense_Mutation	SNP	ENST00000454753.1	37																																																																																				A|0.633;G|0.367		0.507	CEACAM20-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000323032.1	NM_198444	
MIR512-2	574459	broad.mit.edu	37	19	54169970	54169970	+	RNA	SNP	G	G	T			TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr19:54169970G>T	ENST00000384912.1	+	0	0				MIR512-1_ENST00000384913.1_RNA	NR_030180.1|NR_030181.1				microRNA 512-2																		GGCACTTTCTGGTGCCAGAAT	0.567																																					.		.											.	.	0			.						.						55.0	53.0	54.0					19																	54169970		1568	3579	5147			574458	.			CTTTCTGGTGCCA			19q13.42	2011-09-12		2008-12-18	ENSG00000207644	ENSG00000207644		"""ncRNAs / Micro RNAs"""	32091	non-coding RNA	RNA, micro				MIRN512-2			Standard	NR_030181		Approved	hsa-mir-512-2	uc021uzj.1				19.37:g.54169970G>T		Somatic	607	1		WXS	Illumina GAIIx	Phase_I	532	46	.	0	0	0	0	0		RNA	SNP	ENST00000384912.1	37																																																																																				.		0.567	MIR512-2-201	KNOWN	basic	miRNA	miRNA		NR_030181	
MIR512-2	574459	bcgsc.ca	37	19	54172454	54172454	+	RNA	SNP	G	G	T			TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr19:54172454G>T	ENST00000384912.1	+	0	44				MIR512-1_ENST00000384913.1_RNA|MIR1323_ENST00000408090.1_RNA	NR_030180.1|NR_030181.1				microRNA 512-2																		GGCACTTTCTGGTGCCAGAAT	0.562																																					.		.											.	.	0			.						.						39.0	37.0	38.0					19																	54172454		1557	3557	5114			574458	.			CTTTCTGGTGCCA			19q13.42	2011-09-12		2008-12-18	ENSG00000207644	ENSG00000207644		"""ncRNAs / Micro RNAs"""	32091	non-coding RNA	RNA, micro				MIRN512-2			Standard	NR_030181		Approved	hsa-mir-512-2	uc021uzj.1				19.37:g.54172454G>T		Somatic	574	0		WXS	Illumina GAIIx	Phase_I	470	85	.	0	0	0	0	0		RNA	SNP	ENST00000384912.1	37																																																																																				.		0.562	MIR512-2-201	KNOWN	basic	miRNA	miRNA		NR_030181	
GTF3C2	2976	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	27560194	27560194	+	Nonsense_Mutation	SNP	G	G	C			TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr2:27560194G>C	ENST00000359541.2	-	7	1473	c.1044C>G	c.(1042-1044)taC>taG	p.Y348*	GTF3C2_ENST00000264720.3_Nonsense_Mutation_p.Y348*|AC109828.1_ENST00000585326.1_RNA|AC109828.1_ENST00000608473.1_RNA|AC109828.1_ENST00000590383.1_RNA|AC109828.1_ENST00000592265.1_RNA|AC109828.1_ENST00000587586.1_RNA|AC109828.1_ENST00000589232.1_RNA|AC109828.1_ENST00000590754.1_RNA|AC109828.1_ENST00000585645.1_RNA|AC109828.1_ENST00000588707.1_RNA|AC109828.1_ENST00000589853.1_RNA|AC109828.1_ENST00000416453.2_RNA			Q8WUA4	TF3C2_HUMAN	general transcription factor IIIC, polypeptide 2, beta 110kDa	348					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	nucleoplasm (GO:0005654)|transcription factor TFIIIC complex (GO:0000127)				central_nervous_system(4)|endometrium(6)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|urinary_tract(2)	38	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCTGGGGCAGGTAGGGAGCGG	0.502																																					p.S348S		.											.	GTF3C2-92	0			c.T1044G						.						49.0	44.0	46.0					2																	27560194		2203	4300	6503	SO:0001587	stop_gained	2976	exon8			GGGCAGGTAGGGA	D13636	CCDS1749.1	2p23.3	2013-01-10	2002-08-29		ENSG00000115207	ENSG00000115207		"""General transcription factors"", ""WD repeat domain containing"""	4665	protein-coding gene	gene with protein product		604883	"""general transcription factor IIIC, polypeptide 2 (beta subunit, 110kD)"""			7729686	Standard	NM_001521		Approved	KIAA0011, TFIIIC110	uc002rjw.2	Q8WUA4	OTTHUMG00000097785	ENST00000359541.2:c.1044C>G	2.37:g.27560194G>C	ENSP00000352536:p.Tyr348*	Somatic	176	0		WXS	Illumina GAIIx	Phase_I	172	54	NM_001521	0	0	2	2	0	D6W557|Q16632|Q9BWI7	Silent	SNP	ENST00000359541.2	37	CCDS1749.1	.	.	.	.	.	.	.	.	.	.	G	39	7.605707	0.98387	.	.	ENSG00000115207	ENST00000359541;ENST00000264720	.	.	.	5.8	3.01	0.34805	.	0.061950	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.1178	9.7697	0.40582	0.217:0.0:0.783:0.0	.	.	.	.	X	348	.	ENSP00000264720:Y348X	Y	-	3	2	GTF3C2	27413698	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	2.579000	0.46059	1.473000	0.48159	0.563000	0.77884	TAC	.		0.502	GTF3C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215028.2		
SCN1A	6323	broad.mit.edu;bcgsc.ca	37	2	166898935	166898935	+	Splice_Site	SNP	C	C	A			TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr2:166898935C>A	ENST00000303395.4	-	12	2043		c.e12-1		AC010127.3_ENST00000595268.1_RNA|AC010127.3_ENST00000599041.1_RNA|AC010127.3_ENST00000595647.1_RNA|SCN1A_ENST00000409050.1_Splice_Site|SCN1A_ENST00000375405.3_Splice_Site|SCN1A_ENST00000423058.2_Splice_Site			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit						adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)			NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TGGTTGTTCCCTGTAAAAAAA	0.368																																					.		.											.	SCN1A-147	0			c.2011-1G>T						.						93.0	91.0	92.0					2																	166898935		2203	4300	6503	SO:0001630	splice_region_variant	6323	exon13			TGTTCCCTGTAAA	AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.2044-1G>T	2.37:g.166898935C>A		Somatic	97	0		WXS	Illumina GAIIx	Phase_I	108	5	NM_006920	0	0	0	0	0	E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Splice_Site	SNP	ENST00000303395.4	37	CCDS54413.1	.	.	.	.	.	.	.	.	.	.	C	14.48	2.547158	0.45383	.	.	ENSG00000144285	ENST00000423058;ENST00000303395;ENST00000375405;ENST00000409050	.	.	.	5.82	5.82	0.92795	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.1092	0.97906	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SCN1A	166607181	1.000000	0.71417	0.998000	0.56505	0.656000	0.38851	5.851000	0.69481	2.745000	0.94114	0.655000	0.94253	.	.		0.368	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102661.1	NM_006920	Intron
EEF1B2	1933	broad.mit.edu	37	2	207025358	207025358	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr2:207025358A>G	ENST00000392222.2	+	2	502	c.127A>G	c.(127-129)Agc>Ggc	p.S43G	EEF1B2_ENST00000236957.5_Missense_Mutation_p.S43G|SNORA41_ENST00000384675.1_RNA|NDUFS1_ENST00000455934.2_5'Flank|NDUFS1_ENST00000449699.1_5'Flank|NDUFS1_ENST00000457011.1_5'Flank|NDUFS1_ENST00000233190.6_5'Flank|NDUFS1_ENST00000432169.1_5'Flank|SNORD51_ENST00000384320.2_RNA|NDUFS1_ENST00000440274.1_5'Flank|EEF1B2_ENST00000392221.1_Missense_Mutation_p.S43G|NDUFS1_ENST00000423725.1_5'Flank	NM_001959.3	NP_001950.1	P24534	EF1B_HUMAN	eukaryotic translation elongation factor 1 beta 2	43	GST C-terminal.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|translation (GO:0006412)|translational elongation (GO:0006414)	cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)	translation elongation factor activity (GO:0003746)	p.S43G(4)		breast(1)|endometrium(5)|kidney(3)|large_intestine(1)|lung(6)	16						AGCCGTGTCCAGCCCACCGCC	0.468																																					p.S43G		.											.	EEF1B2-227	4	Substitution - Missense(4)	endometrium(2)|lung(1)|kidney(1)	c.A127G						.						109.0	99.0	102.0					2																	207025358		2203	4300	6503	SO:0001583	missense	1933	exon3			GTGTCCAGCCCAC	X60489	CCDS2367.1	2q33.3	2011-04-28			ENSG00000114942	ENSG00000114942			3208	protein-coding gene	gene with protein product		600655				8250921	Standard	NM_001959		Approved		uc002vbf.1	P24534	OTTHUMG00000132891	ENST00000392222.2:c.127A>G	2.37:g.207025358A>G	ENSP00000376056:p.Ser43Gly	Somatic	204	2		WXS	Illumina GAIIx	Phase_I	181	4	NM_021121	1	0	451	452	0	A8K795|Q6IBH9	Missense_Mutation	SNP	ENST00000392222.2	37	CCDS2367.1	.	.	.	.	.	.	.	.	.	.	A	0.014	-1.585588	0.00872	.	.	ENSG00000114942	ENST00000236957;ENST00000392221;ENST00000392222;ENST00000445505	T;T;T;T	0.44482	0.92;0.92;0.92;0.92	5.47	0.911	0.19343	Glutathione S-transferase, C-terminal-like (2);	0.442134	0.26800	N	0.022437	T	0.19846	0.0477	N	0.16098	0.37	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.18745	-1.0327	10	0.17832	T	0.49	-2.1703	6.3337	0.21285	0.2348:0.0:0.6384:0.1268	.	43	P24534	EF1B_HUMAN	G	43	ENSP00000236957:S43G;ENSP00000376055:S43G;ENSP00000376056:S43G;ENSP00000407730:S43G	ENSP00000236957:S43G	S	+	1	0	EEF1B2	206733603	0.049000	0.20398	0.145000	0.22337	0.051000	0.14879	0.879000	0.28146	-0.027000	0.13873	-0.252000	0.11476	AGC	.		0.468	EEF1B2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336436.1	NM_001037663	
EEF1B2	1933	broad.mit.edu	37	2	207025366	207025366	+	Silent	SNP	G	G	A			TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr2:207025366G>A	ENST00000392222.2	+	2	510	c.135G>A	c.(133-135)ccG>ccA	p.P45P	EEF1B2_ENST00000236957.5_Silent_p.P45P|SNORA41_ENST00000384675.1_RNA|NDUFS1_ENST00000455934.2_5'Flank|NDUFS1_ENST00000449699.1_5'Flank|NDUFS1_ENST00000457011.1_5'Flank|NDUFS1_ENST00000233190.6_5'Flank|NDUFS1_ENST00000432169.1_5'Flank|SNORD51_ENST00000384320.2_RNA|NDUFS1_ENST00000440274.1_5'Flank|EEF1B2_ENST00000392221.1_Silent_p.P45P|NDUFS1_ENST00000423725.1_5'Flank	NM_001959.3	NP_001950.1	P24534	EF1B_HUMAN	eukaryotic translation elongation factor 1 beta 2	45	GST C-terminal.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|translation (GO:0006412)|translational elongation (GO:0006414)	cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)	translation elongation factor activity (GO:0003746)	p.P45P(5)		breast(1)|endometrium(5)|kidney(3)|large_intestine(1)|lung(6)	16						CCAGCCCACCGCCTGCCGACT	0.448																																					p.P45P		.											.	EEF1B2-227	5	Substitution - coding silent(5)	kidney(2)|endometrium(2)|lung(1)	c.G135A						.						109.0	99.0	102.0					2																	207025366		2203	4300	6503	SO:0001819	synonymous_variant	1933	exon3			CCCACCGCCTGCC	X60489	CCDS2367.1	2q33.3	2011-04-28			ENSG00000114942	ENSG00000114942			3208	protein-coding gene	gene with protein product		600655				8250921	Standard	NM_001959		Approved		uc002vbf.1	P24534	OTTHUMG00000132891	ENST00000392222.2:c.135G>A	2.37:g.207025366G>A		Somatic	204	1		WXS	Illumina GAIIx	Phase_I	192	4	NM_021121	0	0	412	412	0	A8K795|Q6IBH9	Silent	SNP	ENST00000392222.2	37	CCDS2367.1																																																																																			.		0.448	EEF1B2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336436.1	NM_001037663	
TRPM8	79054	broad.mit.edu	37	2	234858625	234858625	+	Silent	SNP	T	T	C			TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr2:234858625T>C	ENST00000324695.4	+	9	1015	c.975T>C	c.(973-975)ccT>ccC	p.P325P	AC005538.5_ENST00000455991.1_RNA|TRPM8_ENST00000433712.2_Silent_p.P13P	NM_024080.4	NP_076985.4	Q7Z2W7	TRPM8_HUMAN	transient receptor potential cation channel, subfamily M, member 8	325					calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|protein homotetramerization (GO:0051289)|protein homotrimerization (GO:0070207)|response to cold (GO:0009409)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)			breast(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(2)|lung(27)|prostate(2)|skin(7)|stomach(2)	66		Breast(86;0.00205)|Renal(207;0.00694)|all_lung(227;0.0129)|Lung NSC(271;0.0408)|all_hematologic(139;0.0753)|Acute lymphoblastic leukemia(138;0.224)		Epithelial(121;1.19e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000139)|Lung(119;0.00758)|LUSC - Lung squamous cell carcinoma(224;0.0108)	Menthol(DB00825)	ATAAAATTCCTTGTGTGGTGG	0.537																																					p.P325P		.											.	TRPM8-94	0			c.T975C						.						73.0	69.0	71.0					2																	234858625		2203	4300	6503	SO:0001819	synonymous_variant	79054	exon9			AATTCCTTGTGTG	AC005538	CCDS33407.1	2q37	2011-12-14			ENSG00000144481	ENSG00000144481		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17961	protein-coding gene	gene with protein product		606678				16382100	Standard	NM_024080		Approved		uc002vvh.3	Q7Z2W7	OTTHUMG00000059129	ENST00000324695.4:c.975T>C	2.37:g.234858625T>C		Somatic	77	0		WXS	Illumina GAIIx	Phase_I	106	8	NM_024080	0	0	0	0	0	A0AVG2|Q3YFM7|Q6QNH9|Q8TAC3|Q8TDX8|Q9BVK1	Silent	SNP	ENST00000324695.4	37	CCDS33407.1																																																																																			.		0.537	TRPM8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131005.4	NM_024080	
AC104809.3	0	broad.mit.edu	37	2	241898824	241898824	+	Missense_Mutation	SNP	A	A	G	rs10169006	byFrequency	TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr2:241898824A>G	ENST00000430980.2	+	18	2732	c.2732A>G	c.(2731-2733)cAg>cGg	p.Q911R	AC104809.4_ENST00000418218.1_RNA|AC104809.4_ENST00000457369.1_RNA																							GAGAGCCTCCAGGACCTAGCG	0.647													N|||	3423	0.683506	0.8442	0.6254	5008	,	,		17497	0.6597		0.6481	False		,,,				2504	0.5685				.		.											.	.	0			.						.																																			SO:0001583	missense	0	.			GCCTCCAGGACCT																												ENST00000430980.2:c.2732A>G	2.37:g.241898824A>G	ENSP00000387851:p.Gln911Arg	Somatic	325	1		WXS	Illumina GAIIx	Phase_I	313	8	.	0	0	0	0	0		RNA	SNP	ENST00000430980.2	37		1539	0.7046703296703297	422	0.8577235772357723	229	0.6325966850828729	382	0.6678321678321678	506	0.6675461741424802	N	8.077	0.771457	0.16051	.	.	ENSG00000226321	ENST00000430980	T	0.38240	1.15	3.39	2.12	0.27331	.	.	.	.	.	T	0.00012	0.0000	N	0.00112	-2.095	.	.	.	.	.	.	.	.	.	T	0.33650	-0.9860	6	0.05351	T	0.99	.	5.7616	0.18203	0.4504:0.0:0.5496:0.0	rs10169006;rs59186516;rs10169006	.	.	.	R	911	ENSP00000387851:Q911R	ENSP00000387851:Q911R	Q	+	2	0	AC104809.3	241547497	0.002000	0.14202	0.006000	0.13384	0.002000	0.02628	0.155000	0.16362	0.560000	0.29169	-0.345000	0.07892	CAG	A|0.288;G|0.712		0.647	AC104809.3-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding			
ZCCHC3	85364	hgsc.bcm.edu	37	20	278515	278515	+	Silent	SNP	T	T	C	rs2223665	byFrequency	TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr20:278515T>C	ENST00000382352.3	+	1	779	c.288T>C	c.(286-288)gaT>gaC	p.D96D		NM_033089.6	NP_149080	Q9NUD5	ZCHC3_HUMAN	zinc finger, CCHC domain containing 3	96							poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(1)|lung(3)|prostate(2)	8		all_cancers(10;0.000209)|Lung NSC(37;0.0417)|all_lung(30;0.0713)|all_epithelial(17;0.0748)|Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.149)			GCCGCGGGGATCCGAAGGGCC	0.776													C|||	2949	0.588858	0.6974	0.6643	5008	,	,		6571	0.375		0.6064	False		,,,				2504	0.591				p.D96D		.											.	ZCCHC3-90	0			c.T288C						.						1.0	1.0	1.0					20																	278515		303	859	1162	SO:0001819	synonymous_variant	85364	exon1			CGGGGATCCGAAG	AL034548	CCDS42844.1	20p13-p12.2	2014-04-10	2004-07-14	2004-07-14	ENSG00000177764	ENSG00000247315		"""Zinc fingers, CCHC domain containing"""	16230	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 99"""	C20orf99			Standard	NM_033089		Approved	dJ1103G7.7	uc002wdf.3	Q9NUD5	OTTHUMG00000188280	ENST00000382352.3:c.288T>C	20.37:g.278515T>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	6	6	NM_033089	0	0	0	0	0	Q3B7J3|Q6NT79	Silent	SNP	ENST00000382352.3	37	CCDS42844.1																																																																																			T|0.454;C|0.546		0.776	ZCCHC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077447.1		
DBNDD2	55861	hgsc.bcm.edu;bcgsc.ca	37	20	44035159	44035159	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr20:44035159A>G	ENST00000372720.3	+	1	299	c.68A>G	c.(67-69)gAc>gGc	p.D23G	DBNDD2_ENST00000372710.3_5'Flank|SYS1-DBNDD2_ENST00000452133.1_Intron|DBNDD2_ENST00000357275.2_Intron|SYS1-DBNDD2_ENST00000475242.1_Intron|DBNDD2_ENST00000372722.3_Intron|TP53TG5_ENST00000494455.1_Intron|DBNDD2_ENST00000360981.4_5'Flank|DBNDD2_ENST00000372717.1_5'Flank|DBNDD2_ENST00000372723.3_Intron|DBNDD2_ENST00000372712.2_5'Flank	NM_018478.3	NP_060948.3	Q9BQY9	DBND2_HUMAN	dysbindin (dystrobrevin binding protein 1) domain containing 2	23					negative regulation of protein kinase activity (GO:0006469)	cytoplasm (GO:0005737)				breast(1)|lung(2)	3		Myeloproliferative disorder(115;0.0122)				GCTGCCTCCGACCGCCGGGCG	0.716																																					p.D23G		.											.	DBNDD2-536	0			c.A68G						.																																			SO:0001583	missense	55861	exon1			CCTCCGACCGCCG	AF220191	CCDS42880.1, CCDS42881.1, CCDS56193.1, CCDS56194.1	20q13.12	2007-07-23	2006-04-04	2006-04-04	ENSG00000244274	ENSG00000244274			15881	protein-coding gene	gene with protein product		611453	"""chromosome 20 open reading frame 35"""	C20orf35			Standard	NM_001048225		Approved	HSMNP1	uc002xof.3	Q9BQY9	OTTHUMG00000032576	ENST00000372720.3:c.68A>G	20.37:g.44035159A>G	ENSP00000361805:p.Asp23Gly	Somatic	54	0		WXS	Illumina GAIIx	Phase_I	61	8	NM_018478	0	0	0	0	0	Q331S6|Q5QPV4|Q5QPV6|Q9BQZ0|Q9BVL1|Q9H1F6|Q9NWZ0|Q9NY07|Q9NZ31	Missense_Mutation	SNP	ENST00000372720.3	37	CCDS56193.1	.	.	.	.	.	.	.	.	.	.	A	3.242	-0.155134	0.06544	.	.	ENSG00000244274	ENST00000372720	T	0.30182	1.54	2.99	-0.0837	0.13693	.	.	.	.	.	T	0.10981	0.0268	N	0.03608	-0.345	0.09310	N	0.999993	.	.	.	.	.	.	T	0.33445	-0.9868	7	0.18710	T	0.47	.	6.2714	0.20956	0.3646:0.0:0.6354:0.0	.	.	.	.	G	23	ENSP00000361805:D23G	ENSP00000361805:D23G	D	+	2	0	DBNDD2	43468573	0.001000	0.12720	0.003000	0.11579	0.086000	0.17979	-0.060000	0.11712	0.023000	0.15187	-0.392000	0.06488	GAC	.		0.716	DBNDD2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000079438.1	NM_018478	
CLDN5	7122	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	19511427	19511427	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr22:19511427C>G	ENST00000406028.1	-	2	1667	c.607G>C	c.(607-609)Gcc>Ccc	p.A203P	CLDN5_ENST00000403084.1_Missense_Mutation_p.A203P|CLDN5_ENST00000413119.2_Missense_Mutation_p.A203P			O00501	CLD5_HUMAN	claudin 5	118					calcium-independent cell-cell adhesion (GO:0016338)|myelination (GO:0042552)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			liver(1)|lung(2)|prostate(1)	4	Colorectal(54;0.0993)					CCCGTGAGGGCCACACGCGCC	0.692																																					p.A203P		.											.	CLDN5-492	0			c.G607C						.						10.0	11.0	10.0					22																	19511427		2180	4274	6454	SO:0001583	missense	7122	exon1			TGAGGGCCACACG	AF000959	CCDS13763.2	22q11.21	2008-08-01	2008-08-01		ENSG00000184113	ENSG00000184113		"""Claudins"""	2047	protein-coding gene	gene with protein product		602101	"""transmembrane protein deleted in velocardiofacial syndrome"""	AWAL, TMVCF		9441748, 9192844	Standard	NM_003277		Approved	CPETRL1, BEC1	uc002zpu.2	O00501	OTTHUMG00000150441	ENST00000406028.1:c.607G>C	22.37:g.19511427C>G	ENSP00000385477:p.Ala203Pro	Somatic	36	0		WXS	Illumina GAIIx	Phase_I	27	10	NM_001130861	0	0	40	40	0	B3KS11|Q53XW2|Q8WUW3	Missense_Mutation	SNP	ENST00000406028.1	37	CCDS13763.2	.	.	.	.	.	.	.	.	.	.	C	18.73	3.686624	0.68157	.	.	ENSG00000184113	ENST00000406028;ENST00000403084;ENST00000413119	D;D;D	0.87729	-2.29;-2.29;-2.29	4.89	4.89	0.63831	.	0.131234	0.50627	D	0.000102	D	0.92851	0.7726	M	0.83483	2.645	0.38055	D	0.935899	D	0.69078	0.997	D	0.67725	0.953	D	0.94523	0.7729	10	0.72032	D	0.01	.	12.8745	0.57982	0.0:0.8364:0.1636:0.0	.	203	D3DX19	.	P	203	ENSP00000385477:A203P;ENSP00000384554:A203P;ENSP00000400612:A203P	ENSP00000384554:A203P	A	-	1	0	CLDN5	17891427	0.057000	0.20700	1.000000	0.80357	0.359000	0.29487	0.909000	0.28558	2.274000	0.75844	0.462000	0.41574	GCC	.		0.692	CLDN5-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318122.3	NM_003277	
SCARF2	91179	hgsc.bcm.edu	37	22	20780097	20780097	+	Silent	SNP	G	G	C	rs759609		TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr22:20780097G>C	ENST00000266214.5	-	11	2285	c.2181C>G	c.(2179-2181)cgC>cgG	p.R727R	SCARF2_ENST00000405555.3_Silent_p.R722R	NM_153334.4	NP_699165.2	Q96GP6	SREC2_HUMAN	scavenger receptor class F, member 2	727	Pro-rich.				cell adhesion (GO:0007155)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|skin(2)	10	Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			GCCCCGGGGGGCGCGGCGTTG	0.781																																					p.R727R		.											.	SCARF2-341	0			c.C2181G						.	C	,	3271,119		1585,101,9	5.0	5.0	5.0		2181,2166	-5.3	0.0	22	dbSNP_86	5	6306,190		3060,186,2	no	coding-synonymous,coding-synonymous	SCARF2	NM_153334.4,NM_182895.2	,	4645,287,11	CC,CG,GG		2.9249,3.5103,3.1256	,	727/871,722/866	20780097	9577,309	1695	3248	4943	SO:0001819	synonymous_variant	91179	exon11			CGGGGGGCGCGGC	AF522196	CCDS13779.1, CCDS46666.1	22q11.21	2011-10-10			ENSG00000244486	ENSG00000244486			19869	protein-coding gene	gene with protein product		613619				12154095	Standard	XM_006724364		Approved	SREC-II, SREC2, HUMZD58C02	uc002zsk.2	Q96GP6	OTTHUMG00000150779	ENST00000266214.5:c.2181C>G	22.37:g.20780097G>C		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	5	5	NM_153334	0	0	0	0	0	E5RFB8|Q58A83|Q8IXF3|Q9BW74	Silent	SNP	ENST00000266214.5	37	CCDS13779.1																																																																																			G|0.826;C|0.174		0.781	SCARF2-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320047.1		
SH3BP1	23616	broad.mit.edu	37	22	38042891	38042891	+	Missense_Mutation	SNP	C	C	T	rs373775839		TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr22:38042891C>T	ENST00000357436.4	+	11	1304	c.991C>T	c.(991-993)Ccc>Tcc	p.P331S	SH3BP1_ENST00000442465.2_Missense_Mutation_p.P331S|Z83844.1_ENST00000456099.1_RNA|SH3BP1_ENST00000336738.5_Missense_Mutation_p.P331S|SH3BP1_ENST00000495174.1_3'UTR|SH3BP1_ENST00000599616.1_Missense_Mutation_p.P267S	NM_018957.3	NP_061830.3	Q9Y3L3	3BP1_HUMAN	SH3-domain binding protein 1	331	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	Melanoma(58;0.0574)					GGCCTCGGACCCCCACAGCCT	0.677																																					p.P331S		.											.	SH3BP1-90	0			c.C991T						.	C	SER/PRO	0,4376		0,0,2188	32.0	23.0	26.0		991	5.7	1.0	22		26	1,8563		0,1,4281	no	missense	SH3BP1	NM_018957.3	74	0,1,6469	TT,TC,CC		0.0117,0.0,0.0077	benign	331/702	38042891	1,12939	2188	4282	6470	SO:0001583	missense	23616	exon11			TCGGACCCCCACA		CCDS13952.2	22q13.1	2011-07-04			ENSG00000100092	ENSG00000100092		"""Rho GTPase activating proteins"""	10824	protein-coding gene	gene with protein product						10591208, 12029088	Standard	NM_018957		Approved	ARHGAP43	uc003ati.3	Q9Y3L3	OTTHUMG00000030996	ENST00000357436.4:c.991C>T	22.37:g.38042891C>T	ENSP00000350018:p.Pro331Ser	Somatic	47	0		WXS	Illumina GAIIx	Phase_I	35	3	NM_018957	0	0	0	0	0	Q5R3N0|Q6IBZ2|Q6ZVL9|Q96HQ5|Q9NSQ9	Missense_Mutation	SNP	ENST00000357436.4	37	CCDS13952.2	.	.	.	.	.	.	.	.	.	.	C	13.44	2.238285	0.39598	0.0	1.17E-4	ENSG00000100092	ENST00000357436;ENST00000336738;ENST00000442465;ENST00000397014	T;T;T	0.17691	2.26;2.26;2.26	5.71	5.71	0.89125	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.099287	0.45126	D	0.000394	T	0.10078	0.0247	L	0.37466	1.105	0.37120	D	0.900781	B;P;B;B;P	0.40398	0.002;0.716;0.064;0.321;0.716	B;B;B;B;B	0.35039	0.018;0.194;0.038;0.194;0.194	T	0.13791	-1.0496	10	0.10111	T	0.7	.	6.667	0.23047	0.0:0.7087:0.1786:0.1127	.	331;245;267;331;245	F5GZA8;E7EUD3;Q6ZT62;Q9Y3L3;Q6ZTJ5	.;.;.;3BP1_HUMAN;.	S	331;331;331;245	ENSP00000350018:P331S;ENSP00000337213:P331S;ENSP00000395126:P331S	ENSP00000337213:P331S	P	+	1	0	SH3BP1	36372837	0.235000	0.23794	0.976000	0.42696	0.901000	0.52897	1.810000	0.38932	2.689000	0.91719	0.655000	0.94253	CCC	.		0.677	SH3BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075884.4	NM_018957	
SLC6A11	6538	bcgsc.ca	37	3	10967739	10967739	+	Silent	SNP	T	T	C	rs2272395	byFrequency	TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr3:10967739T>C	ENST00000254488.2	+	9	1236	c.1170T>C	c.(1168-1170)ccT>ccC	p.P390P		NM_014229.1	NP_055044.1	P48066	S6A11_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 11	390					brain development (GO:0007420)|neurotransmitter secretion (GO:0007269)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter binding (GO:0042165)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(13)|ovary(1)|skin(4)	35				OV - Ovarian serous cystadenocarcinoma(96;0.229)	Clobazam(DB00349)	CCATGATGCCTCTCTCCCCGC	0.627													T|||	1663	0.332069	0.4569	0.3098	5008	,	,		16789	0.1657		0.4642	False		,,,				2504	0.2147				p.P390P		.											.	SLC6A11-132	0			c.T1170C						.	T		2020,2386	561.8+/-380.8	475,1070,658	244.0	249.0	248.0		1170	-6.8	0.2	3	dbSNP_100	248	3788,4812	536.2+/-383.0	844,2100,1356	no	coding-synonymous	SLC6A11	NM_014229.1		1319,3170,2014	CC,CT,TT		44.0465,45.8466,44.6563		390/633	10967739	5808,7198	2203	4300	6503	SO:0001819	synonymous_variant	6538	exon9			GATGCCTCTCTCC	S75989	CCDS2602.1	3p25.3	2013-07-19	2013-07-19		ENSG00000132164	ENSG00000132164		"""Solute carriers"""	11044	protein-coding gene	gene with protein product	"""GABA transporter 3"""	607952	"""solute carrier family 6 (neurotransmitter transporter, GABA), member 11"""			7874447	Standard	NM_014229		Approved	GAT3	uc003bvz.3	P48066	OTTHUMG00000129718	ENST00000254488.2:c.1170T>C	3.37:g.10967739T>C		Somatic	134	1		WXS	Illumina GAIIx	Phase_I	104	5	NM_014229	0	0	0	0	0	B2R6U6|Q8IYC9	Silent	SNP	ENST00000254488.2	37	CCDS2602.1																																																																																			T|0.591;C|0.409		0.627	SLC6A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251927.1	NM_014229	
SLC6A1	6529	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	11072862	11072862	+	Splice_Site	SNP	G	G	T			TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr3:11072862G>T	ENST00000287766.4	+	13	1744		c.e13-1		SLC6A1_ENST00000536032.1_Splice_Site	NM_003042.3	NP_003033.3	P30531	SC6A1_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 1						gamma-aminobutyric acid import (GO:0051939)|learning (GO:0007612)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|neurotransmitter secretion (GO:0007269)|positive regulation of gamma-aminobutyric acid secretion (GO:0014054)|protein homooligomerization (GO:0051260)|response to calcium ion (GO:0051592)|response to cocaine (GO:0042220)|response to estradiol (GO:0032355)|response to lead ion (GO:0010288)|response to purine-containing compound (GO:0014074)|response to sucrose (GO:0009744)|response to toxic substance (GO:0009636)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon (GO:0030424)|cell surface (GO:0009986)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(2)|large_intestine(6)|lung(6)|ovary(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	26		Ovarian(110;0.0392)		OV - Ovarian serous cystadenocarcinoma(96;0.00099)	Clobazam(DB00349)|Tiagabine(DB00906)	TCATCTTGCAGGGGGGTATTT	0.502																																					.		.											.	SLC6A1-92	0			c.1324-1G>T						.						244.0	228.0	234.0					3																	11072862		2203	4300	6503	SO:0001630	splice_region_variant	6529	exon13			CTTGCAGGGGGGT		CCDS2603.1	3p25.3	2013-07-19	2013-07-19		ENSG00000157103	ENSG00000157103		"""Solute carriers"""	11042	protein-coding gene	gene with protein product	"""GABA transporter 1"""	137165	"""solute carrier family 6 (neurotransmitter transporter, GABA), member 1"""			8530094	Standard	NM_003042		Approved	GAT1, GABATR, GABATHG	uc010hdq.3	P30531	OTTHUMG00000044208	ENST00000287766.4:c.1324-1G>T	3.37:g.11072862G>T		Somatic	72	0		WXS	Illumina GAIIx	Phase_I	65	28	NM_003042	0	0	0	0	0	Q8N4K8	Splice_Site	SNP	ENST00000287766.4	37	CCDS2603.1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.005224	0.74932	.	.	ENSG00000157103	ENST00000287766;ENST00000536032	.	.	.	5.49	5.49	0.81192	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.3767	0.94512	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SLC6A1	11047862	1.000000	0.71417	1.000000	0.80357	0.713000	0.41058	9.700000	0.98707	2.587000	0.87381	0.655000	0.94253	.	.		0.502	SLC6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102767.2	NM_003042	Intron
PRICKLE2	166336	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	64133073	64133073	+	Silent	SNP	G	G	A	rs539536335		TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr3:64133073G>A	ENST00000295902.6	-	7	1678	c.1093C>T	c.(1093-1095)Ctg>Ttg	p.L365L	PRICKLE2_ENST00000564377.1_Silent_p.L421L	NM_198859.3	NP_942559.1	Q7Z3G6	PRIC2_HUMAN	prickle homolog 2 (Drosophila)	365					establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|neuron projection development (GO:0031175)	apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|large_intestine(9)|liver(1)|lung(10)|ovary(4)|prostate(2)|skin(2)|stomach(1)	32		Lung NSC(201;0.136)		BRCA - Breast invasive adenocarcinoma(55;0.000971)|KIRC - Kidney renal clear cell carcinoma(15;0.00443)|Kidney(15;0.00497)		TCGGCTGACAGCCGGTTAGAA	0.612																																					p.L365L		.											.	PRICKLE2-95	0			c.C1093T						.						94.0	106.0	102.0					3																	64133073		2203	4300	6503	SO:0001819	synonymous_variant	166336	exon7			CTGACAGCCGGTT	AK127839	CCDS2902.1	3p14.3	2006-09-12	2006-09-12		ENSG00000163637	ENSG00000163637			20340	protein-coding gene	gene with protein product		608501	"""prickle-like 2 (Drosophila)"""			12525887	Standard	NM_198859		Approved	DKFZp686D143	uc003dmf.3	Q7Z3G6	OTTHUMG00000158789	ENST00000295902.6:c.1093C>T	3.37:g.64133073G>A		Somatic	108	0		WXS	Illumina GAIIx	Phase_I	107	30	NM_198859	0	0	0	0	0	Q0VF44	Silent	SNP	ENST00000295902.6	37	CCDS2902.1																																																																																			.		0.612	PRICKLE2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352219.1	NM_198859	
TIPARP	25976	broad.mit.edu	37	3	156395550	156395550	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr3:156395550G>A	ENST00000461166.1	+	2	652	c.64G>A	c.(64-66)Gac>Aac	p.D22N	TIPARP_ENST00000542783.1_Missense_Mutation_p.D22N|TIPARP_ENST00000486483.1_Missense_Mutation_p.D22N|TIPARP_ENST00000295924.7_Missense_Mutation_p.D22N	NM_001184717.1	NP_001171646.1	Q7Z3E1	PARPT_HUMAN	TCDD-inducible poly(ADP-ribose) polymerase	22					androgen metabolic process (GO:0008209)|cellular response to organic cyclic compound (GO:0071407)|estrogen metabolic process (GO:0008210)|face morphogenesis (GO:0060325)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|kidney development (GO:0001822)|multicellular organismal metabolic process (GO:0044236)|negative regulation of gene expression (GO:0010629)|nitrogen compound metabolic process (GO:0006807)|palate development (GO:0060021)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of protein catabolic process (GO:0045732)|post-embryonic development (GO:0009791)|protein ADP-ribosylation (GO:0006471)|skeletal system morphogenesis (GO:0048705)|smooth muscle tissue development (GO:0048745)|vasculogenesis (GO:0001570)	nucleus (GO:0005634)	enhancer binding (GO:0035326)|metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			NS(1)|breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(4)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)	23			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			TCCTCCTGATGACTTTTCATG	0.453																																					p.D22N	Ovarian(171;276 1987 3319 6837 11197)	.											.	TIPARP-523	0			c.G64A						.						97.0	99.0	98.0					3																	156395550		2203	4300	6503	SO:0001583	missense	25976	exon2			CCTGATGACTTTT	BX537965	CCDS3177.1	3q25.31	2011-06-22			ENSG00000163659	ENSG00000163659		"""Poly (ADP-ribose) polymerases"""	23696	protein-coding gene	gene with protein product		612480				12851707	Standard	NM_001184717		Approved	DKFZP434J214, DKFZp686N0351, DDF1, PARP7, PARP-7, PARP-1, pART14, RM1	uc021xgg.1	Q7Z3E1	OTTHUMG00000158646	ENST00000461166.1:c.64G>A	3.37:g.156395550G>A	ENSP00000420612:p.Asp22Asn	Somatic	48	0		WXS	Illumina GAIIx	Phase_I	57	4	NM_015508	0	0	0	0	0	D3DNK6|Q68CY9|Q86VP4|Q9Y4P7	Missense_Mutation	SNP	ENST00000461166.1	37	CCDS3177.1	.	.	.	.	.	.	.	.	.	.	G	11.49	1.653465	0.29425	.	.	ENSG00000163659	ENST00000486483;ENST00000295924;ENST00000461166;ENST00000473702;ENST00000481853;ENST00000542783	T;T;T;T;T;T	0.24538	2.88;2.88;2.88;1.85;2.88;2.88	5.37	4.5	0.54988	.	0.225320	0.44097	N	0.000488	T	0.18383	0.0441	N	0.19112	0.55	0.35570	D	0.805438	B	0.26635	0.155	B	0.26094	0.066	T	0.09818	-1.0657	10	0.49607	T	0.09	.	12.9595	0.58449	0.1427:0.0:0.8573:0.0	.	22	Q7Z3E1	PARPT_HUMAN	N	22	ENSP00000418757:D22N;ENSP00000295924:D22N;ENSP00000420612:D22N;ENSP00000419982:D22N;ENSP00000418829:D22N;ENSP00000438345:D22N	ENSP00000295924:D22N	D	+	1	0	TIPARP	157878244	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	4.668000	0.61568	0.664000	0.31047	-1.151000	0.01829	GAC	.		0.453	TIPARP-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351618.1	NM_015508	
CRMP1	1400	hgsc.bcm.edu	37	4	5894586	5894586	+	Silent	SNP	G	G	A	rs143304363	byFrequency	TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr4:5894586G>A	ENST00000324989.7	-	1	199	c.111C>T	c.(109-111)gcC>gcT	p.A37A	CRMP1_ENST00000512574.1_5'Flank	NM_001014809.1	NP_001014809.1	Q14194	DPYL1_HUMAN	collapsin response mediator protein 1	0					axon guidance (GO:0007411)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|pyrimidine nucleobase catabolic process (GO:0006208)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			NS(1)|cervix(2)|endometrium(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	36				Colorectal(103;0.0721)		CCTCCACCGCGGCGAACATGC	0.756													G|||	277	0.0553115	0.0076	0.0461	5008	,	,		4031	0.0437		0.0805	False		,,,				2504	0.1125				p.A37A		.											.	CRMP1-92	0			c.C111T						.	G		56,3324		2,52,1636	4.0	4.0	4.0		111	0.2	1.0	4	dbSNP_134	4	409,6095		9,391,2852	no	coding-synonymous	CRMP1	NM_001014809.1		11,443,4488	AA,AG,GG		6.2884,1.6568,4.7046		37/687	5894586	465,9419	1690	3252	4942	SO:0001819	synonymous_variant	1400	exon1			CACCGCGGCGAAC	D78012	CCDS33950.1, CCDS43207.1, CCDS75102.1	4p16.1	2008-05-15			ENSG00000072832	ENSG00000072832			2365	protein-coding gene	gene with protein product		602462				8973361	Standard	XM_005247940		Approved	DRP-1, DPYSL1	uc003gis.3	Q14194	OTTHUMG00000125489	ENST00000324989.7:c.111C>T	4.37:g.5894586G>A		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	6	NM_001014809	0	0	0	0	0	A0EJG6|Q13024|Q4W5F1|Q96TC8	Silent	SNP	ENST00000324989.7	37	CCDS33950.1																																																																																			G|0.946;A|0.054		0.756	CRMP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000246814.2	NM_001313	
JAKMIP1	152789	broad.mit.edu	37	4	6087227	6087227	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr4:6087227C>T	ENST00000282924.5	-	4	1239	c.754G>A	c.(754-756)Gag>Aag	p.E252K	JAKMIP1_ENST00000409831.1_Missense_Mutation_p.E252K|JAKMIP1_ENST00000409371.3_Missense_Mutation_p.E87K|JAKMIP1_ENST00000409021.3_Missense_Mutation_p.E252K|JAKMIP1_ENST00000410077.2_Missense_Mutation_p.E87K|JAKMIP1_ENST00000457227.2_5'UTR	NM_144720.3	NP_653321.1	Q96N16	JKIP1_HUMAN	janus kinase and microtubule interacting protein 1	252	Mediates association with microtubules.				cognition (GO:0050890)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|microtubule (GO:0005874)|ribonucleoprotein complex (GO:0030529)	GABA receptor binding (GO:0050811)|RNA binding (GO:0003723)			NS(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						CGCTCGGCCTCCTTGACCTGA	0.612																																					p.E252K		.											.	JAKMIP1-292	0			c.G754A						.						96.0	97.0	97.0					4																	6087227		2203	4300	6503	SO:0001583	missense	152789	exon4			CGGCCTCCTTGAC	AK056126	CCDS3385.1, CCDS47005.1	4p16.1	2013-10-11	2009-08-13		ENSG00000152969	ENSG00000152969			26460	protein-coding gene	gene with protein product		611195				18941173	Standard	NM_144720		Approved	MARLIN1, JAMIP1, Gababrbp, FLJ31564	uc010idb.1	Q96N16	OTTHUMG00000125491	ENST00000282924.5:c.754G>A	4.37:g.6087227C>T	ENSP00000282924:p.Glu252Lys	Somatic	94	0		WXS	Illumina GAIIx	Phase_I	82	3	NM_001099433	0	0	0	0	0	A6H2J2|A6H2J3|A6H2J4|A6H2J5|A8MTK6|B4DHZ8|B8ZZR7|D3DVT0|Q86Y69|Q8N7G3	Missense_Mutation	SNP	ENST00000282924.5	37	CCDS3385.1	.	.	.	.	.	.	.	.	.	.	C	32	5.160830	0.94727	.	.	ENSG00000152969	ENST00000409021;ENST00000409371;ENST00000418227;ENST00000425341;ENST00000429819;ENST00000282924;ENST00000409831;ENST00000410077	T;T;T;T;T	0.51817	0.69;0.69;0.69;0.69;0.69	4.1	4.1	0.47936	.	0.091188	0.45606	D	0.000356	T	0.67720	0.2923	M	0.77820	2.39	0.52099	D	0.999946	D;P;D;D;P	0.67145	0.996;0.952;0.996;0.996;0.952	D;P;D;D;P	0.76071	0.986;0.6;0.987;0.987;0.461	T	0.68918	-0.5282	10	0.35671	T	0.21	.	15.5262	0.75910	0.0:1.0:0.0:0.0	.	87;252;87;252;252	B4DHZ8;F2Z2K5;Q96N16-5;Q96N16-2;Q96N16	.;.;.;.;JKIP1_HUMAN	K	252;87;252;252;144;252;252;87	ENSP00000386711:E252K;ENSP00000387042:E87K;ENSP00000282924:E252K;ENSP00000386925:E252K;ENSP00000386745:E87K	ENSP00000282924:E252K	E	-	1	0	JAKMIP1	6138128	1.000000	0.71417	0.998000	0.56505	0.974000	0.67602	6.864000	0.75494	2.135000	0.66039	0.655000	0.94253	GAG	.		0.612	JAKMIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246816.2	NM_144720	
PROM1	8842	broad.mit.edu	37	4	15995680	15995680	+	Frame_Shift_Del	DEL	T	T	-	rs376676164		TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr4:15995680delT	ENST00000510224.1	-	16	1945	c.1697delA	c.(1696-1698)aatfs	p.N566fs	PROM1_ENST00000447510.2_Frame_Shift_Del_p.N566fs|PROM1_ENST00000543373.1_Frame_Shift_Del_p.N557fs|PROM1_ENST00000508167.1_Frame_Shift_Del_p.N557fs|PROM1_ENST00000540805.1_Frame_Shift_Del_p.N566fs|PROM1_ENST00000505450.1_Frame_Shift_Del_p.N557fs|PROM1_ENST00000539194.1_Frame_Shift_Del_p.N566fs			O43490	PROM1_HUMAN	prominin 1	566					camera-type eye photoreceptor cell differentiation (GO:0060219)|glomerular parietal epithelial cell differentiation (GO:0072139)|glomerular visceral epithelial cell differentiation (GO:0072112)|photoreceptor cell maintenance (GO:0045494)|positive regulation of nephron tubule epithelial cell differentiation (GO:2000768)|retina layer formation (GO:0010842)|retina morphogenesis in camera-type eye (GO:0060042)	apical plasma membrane (GO:0016324)|brush border (GO:0005903)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|vesicle (GO:0031982)	actinin binding (GO:0042805)|cadherin binding (GO:0045296)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(4)|liver(1)|lung(11)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(2)	35						AGTGCCTCTATTTTTTTTGCA	0.428																																					p.N566fs		.											.	PROM1-207	0			c.1697delA						.						189.0	187.0	188.0					4																	15995680		1901	4120	6021	SO:0001589	frameshift_variant	8842	exon15			CCTCTATTTTTTT	AF027208	CCDS47029.1, CCDS54746.1, CCDS54747.1, CCDS54748.1	4p15	2013-06-06	2001-11-28	2003-03-28	ENSG00000007062	ENSG00000007062		"""CD molecules"""	9454	protein-coding gene	gene with protein product		604365	"""prominin (mouse)-like 1"", ""macular dystrophy, retinal 2"", ""Stargardt disease 4 (autosomal dominant)"""	PROML1, MCDR2, STGD4		11467842	Standard	NM_006017		Approved	AC133, CD133, RP41, CORD12	uc003goo.2	O43490	OTTHUMG00000160180	ENST00000510224.1:c.1697delA	4.37:g.15995680delT	ENSP00000426809:p.Asn566fs	Somatic	122	0		WXS	Illumina GAIIx	Phase_I	175	7	NM_006017	0	0	0	0	0	Q6SV49|Q6SV50|Q6SV51|Q6SV52|Q6SV53|Q96EN6	Frame_Shift_Del	DEL	ENST00000510224.1	37	CCDS47029.1																																																																																			.		0.428	PROM1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359595.2	NM_006017	
ALPK1	80216	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	113352982	113352982	+	Frame_Shift_Del	DEL	G	G	-			TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr4:113352982delG	ENST00000458497.1	+	11	2558	c.2279delG	c.(2278-2280)aggfs	p.R760fs	ALPK1_ENST00000504176.2_Frame_Shift_Del_p.R682fs|ALPK1_ENST00000177648.9_Frame_Shift_Del_p.R760fs	NM_001102406.1|NM_025144.3	NP_001095876.1|NP_079420.3	Q96QP1	ALPK1_HUMAN	alpha-kinase 1	760							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(20)|ovary(6)|prostate(2)|urinary_tract(1)	53		Ovarian(17;0.0446)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00325)		GTCAAAGACAGGCAGGGGAAA	0.468																																					p.R760fs		.											.	ALPK1-337	0			c.2279delG						.						61.0	67.0	65.0					4																	113352982		2203	4300	6503	SO:0001589	frameshift_variant	80216	exon11			AAGACAGGCAGGG	AY044164	CCDS3697.1, CCDS58923.1	4q26	2008-02-05			ENSG00000073331	ENSG00000073331			20917	protein-coding gene	gene with protein product	"""lymphocyte alpha-kinase"""	607347				10021370, 10819331	Standard	NM_025144		Approved	Lak, FLJ22670, KIAA1527	uc003ian.4	Q96QP1	OTTHUMG00000132911	ENST00000458497.1:c.2279delG	4.37:g.113352982delG	ENSP00000398048:p.Arg760fs	Somatic	31	0		WXS	Illumina GAIIx	Phase_I	51	16	NM_001102406	0	0	0	0	0	B4E3G1|F5H138|Q68CI9|Q6P9F9|Q6ZNK4|Q9P201	Frame_Shift_Del	DEL	ENST00000458497.1	37	CCDS3697.1																																																																																			.		0.468	ALPK1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256421.2	NM_025144	
IL2	3558	broad.mit.edu	37	4	123374962	123374962	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr4:123374962G>T	ENST00000226730.4	-	3	538	c.254C>A	c.(253-255)cCt>cAt	p.P85H		NM_000586.3	NP_000577.2	P60568	IL2_HUMAN	interleukin 2	85					cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|immune response (GO:0006955)|natural killer cell activation (GO:0030101)|negative regulation of apoptotic process (GO:0043066)|negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of heart contraction (GO:0045822)|negative regulation of inflammatory response (GO:0050728)|negative regulation of lymphocyte proliferation (GO:0050672)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of immunoglobulin secretion (GO:0051024)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of isotype switching to IgG isotypes (GO:0048304)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of tissue remodeling (GO:0034105)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of T cell homeostatic proliferation (GO:0046013)|T cell differentiation (GO:0030217)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	carbohydrate binding (GO:0030246)|cytokine activity (GO:0005125)|glycosphingolipid binding (GO:0043208)|growth factor activity (GO:0008083)|interleukin-2 receptor binding (GO:0005134)|kinase activator activity (GO:0019209)			endometrium(2)|large_intestine(4)|lung(6)|skin(1)	13				LUSC - Lung squamous cell carcinoma(721;0.185)	Pseudoephedrine(DB00852)	TTCCTCCAGAGGTTTGAGTTC	0.363			T	TNFRSF17	intestinal T-cell lymphoma																																p.P85H		.		Dom	yes		4	4q26-q27	3558	interleukin 2		L	.	IL2-659	0			c.C254A						.						132.0	130.0	131.0					4																	123374962		2202	4300	6502	SO:0001583	missense	3558	exon3			TCCAGAGGTTTGA	U25676	CCDS3726.1	4q26-q27	2011-07-14			ENSG00000109471	ENSG00000109471		"""Interleukins and interleukin receptors"""	6001	protein-coding gene	gene with protein product	"""T cell growth factor"""	147680				3260003	Standard	NM_000586		Approved	IL-2, TCGF	uc003ier.3	P60568	OTTHUMG00000133075	ENST00000226730.4:c.254C>A	4.37:g.123374962G>T	ENSP00000226730:p.Pro85His	Somatic	79	0		WXS	Illumina GAIIx	Phase_I	101	4	NM_000586	0	0	0	0	0	P01585	Missense_Mutation	SNP	ENST00000226730.4	37	CCDS3726.1	.	.	.	.	.	.	.	.	.	.	G	15.52	2.857431	0.51376	.	.	ENSG00000109471	ENST00000226730	.	.	.	4.1	2.36	0.29203	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.836879	0.10293	N	0.692116	T	0.61009	0.2313	M	0.69823	2.125	0.32387	N	0.553821	D	0.76494	0.999	D	0.63877	0.919	T	0.62826	-0.6772	9	0.72032	D	0.01	0.002	5.148	0.14994	0.1052:0.0:0.6915:0.2032	.	85	P60568	IL2_HUMAN	H	85	.	ENSP00000226730:P85H	P	-	2	0	IL2	123594412	0.019000	0.18553	0.812000	0.32479	0.983000	0.72400	0.568000	0.23623	0.687000	0.31509	0.460000	0.39030	CCT	.		0.363	IL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256715.2		
SRD5A1	6715	bcgsc.ca	37	5	6652009	6652009	+	Silent	SNP	G	G	A	rs8192186	byFrequency	TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr5:6652009G>A	ENST00000274192.5	+	2	582	c.348G>A	c.(346-348)gcG>gcA	p.A116A	SRD5A1_ENST00000504286.1_3'UTR|SRD5A1_ENST00000538824.1_Intron|SRD5A1_ENST00000537411.1_3'UTR	NM_001047.2	NP_001038.1	P18405	S5A1_HUMAN	steroid-5-alpha-reductase, alpha polypeptide 1 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 1)	116					androgen biosynthetic process (GO:0006702)|cell differentiation (GO:0030154)|sex determination (GO:0007530)|sex differentiation (GO:0007548)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	3-oxo-5-alpha-steroid 4-dehydrogenase activity (GO:0003865)|cholestenone 5-alpha-reductase activity (GO:0047751)|electron carrier activity (GO:0009055)	p.A116A(1)		endometrium(3)|kidney(1)|large_intestine(1)|lung(8)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19					Dutasteride(DB01126)|Finasteride(DB01216)|Levonorgestrel(DB00367)|Spironolactone(DB00421)	CACTGTTGGCGTGTACAATGG	0.413													G|||	1463	0.292133	0.3328	0.3919	5008	,	,		18667	0.1587		0.3897	False		,,,				2504	0.2035				p.A116A		.											.	SRD5A1-90	1	Substitution - coding silent(1)	stomach(1)	c.G348A						.	G		1441,2965	467.7+/-354.9	242,957,1004	178.0	154.0	162.0		348	-11.4	0.0	5	dbSNP_117	162	3219,5381	486.1+/-371.8	610,1999,1691	no	coding-synonymous	SRD5A1	NM_001047.2		852,2956,2695	AA,AG,GG		37.4302,32.7054,35.8296		116/260	6652009	4660,8346	2203	4300	6503	SO:0001819	synonymous_variant	6715	exon2			GTTGGCGTGTACA	M32313	CCDS3870.1	5p15.31	2008-02-05			ENSG00000145545	ENSG00000145545	1.3.99.5		11284	protein-coding gene	gene with protein product		184753				1686016	Standard	XR_427663		Approved		uc003jdw.3	P18405	OTTHUMG00000090456	ENST00000274192.5:c.348G>A	5.37:g.6652009G>A		Somatic	191	0		WXS	Illumina GAIIx	Phase_I	214	7	NM_001047	0	0	2	2	0	B2R7Q1|Q9UHY4|Q9UP36|Q9UP37	Silent	SNP	ENST00000274192.5	37	CCDS3870.1																																																																																			G|0.652;A|0.348		0.413	SRD5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206903.1	NM_001047	
TCERG1	10915	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	145838656	145838656	+	Silent	SNP	G	G	A	rs569890952		TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr5:145838656G>A	ENST00000296702.5	+	4	686	c.648G>A	c.(646-648)caG>caA	p.Q216Q	TCERG1_ENST00000394421.2_Silent_p.Q216Q	NM_006706.3	NP_006697.2	O14776	TCRG1_HUMAN	transcription elongation regulator 1	216	Ala/Gln-rich.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(18)|lung(9)|ovary(2)|prostate(3)|skin(1)	46		Lung NSC(249;0.00188)|all_lung(500;0.00307)|all_neural(839;0.0424)|Breast(839;0.0743)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			cccaggcccaggcccaggccc	0.731																																					p.Q216Q		.											.	TCERG1-92	0			c.G648A						.						10.0	14.0	13.0					5																	145838656		2190	4261	6451	SO:0001819	synonymous_variant	10915	exon4			GGCCCAGGCCCAG	AF017789	CCDS4282.1, CCDS43379.1	5q31	2010-01-25	2002-01-24	2002-01-25	ENSG00000113649	ENSG00000113649			15630	protein-coding gene	gene with protein product	"""transcription factor CA150"", ""co-activator of 150 kDa"", ""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"", ""TATA box-binding protein-associated factor 2S"""	605409	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"""	TAF2S		9315662, 11003711	Standard	XM_005268365		Approved	CA150, Urn1	uc003lob.3	O14776	OTTHUMG00000129683	ENST00000296702.5:c.648G>A	5.37:g.145838656G>A		Somatic	19	0		WXS	Illumina GAIIx	Phase_I	73	19	NM_006706	0	0	0	0	0	Q2NKN2|Q59EA1	Silent	SNP	ENST00000296702.5	37	CCDS4282.1																																																																																			.		0.731	TCERG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251886.1	NM_001040006	
TCERG1	10915	hgsc.bcm.edu	37	5	145838662	145838662	+	Silent	SNP	G	G	A			TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr5:145838662G>A	ENST00000296702.5	+	4	692	c.654G>A	c.(652-654)caG>caA	p.Q218Q	TCERG1_ENST00000394421.2_Silent_p.Q218Q	NM_006706.3	NP_006697.2	O14776	TCRG1_HUMAN	transcription elongation regulator 1	218	Ala/Gln-rich.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(18)|lung(9)|ovary(2)|prostate(3)|skin(1)	46		Lung NSC(249;0.00188)|all_lung(500;0.00307)|all_neural(839;0.0424)|Breast(839;0.0743)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			cccaggcccaggcccaggccc	0.731																																					p.Q218Q		.											.	TCERG1-92	0			c.G654A						.						11.0	15.0	14.0					5																	145838662		2192	4280	6472	SO:0001819	synonymous_variant	10915	exon4			GGCCCAGGCCCAG	AF017789	CCDS4282.1, CCDS43379.1	5q31	2010-01-25	2002-01-24	2002-01-25	ENSG00000113649	ENSG00000113649			15630	protein-coding gene	gene with protein product	"""transcription factor CA150"", ""co-activator of 150 kDa"", ""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"", ""TATA box-binding protein-associated factor 2S"""	605409	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"""	TAF2S		9315662, 11003711	Standard	XM_005268365		Approved	CA150, Urn1	uc003lob.3	O14776	OTTHUMG00000129683	ENST00000296702.5:c.654G>A	5.37:g.145838662G>A		Somatic	22	0		WXS	Illumina GAIIx	Phase_I	76	14	NM_006706	0	0	0	0	0	Q2NKN2|Q59EA1	Silent	SNP	ENST00000296702.5	37	CCDS4282.1																																																																																			.		0.731	TCERG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251886.1	NM_001040006	
SLC36A2	153201	bcgsc.ca	37	5	150723806	150723806	+	Silent	SNP	G	G	A	rs192192	byFrequency	TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr5:150723806G>A	ENST00000335244.4	-	2	316	c.187C>T	c.(187-189)Ctg>Ttg	p.L63L	SLC36A2_ENST00000521967.1_Silent_p.L63L	NM_181776.2	NP_861441.2	Q495M3	S36A2_HUMAN	solute carrier family 36 (proton/amino acid symporter), member 2	63					amino acid transport (GO:0006865)|ion transport (GO:0006811)|proline transmembrane transport (GO:0035524)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glycine transmembrane transporter activity (GO:0015187)|hydrogen:amino acid symporter activity (GO:0005280)|L-alanine transmembrane transporter activity (GO:0015180)|L-proline transmembrane transporter activity (GO:0015193)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(14)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	33		Medulloblastoma(196;0.109)|all_hematologic(541;0.243)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Cycloserine(DB00260)	CCTTTCACCAGGTGAATCAAG	0.557													G|||	3131	0.6252	0.3064	0.6369	5008	,	,		21922	0.9841		0.5348	False		,,,				2504	0.771				p.L63L		.											.	SLC36A2-91	0			c.C187T						.	G		1606,2800	496.4+/-363.5	290,1026,887	99.0	83.0	88.0		187	0.2	1.0	5	dbSNP_79	88	4505,4095	590.4+/-392.7	1165,2175,960	no	coding-synonymous	SLC36A2	NM_181776.2		1455,3201,1847	AA,AG,GG		47.6163,36.4503,46.986		63/484	150723806	6111,6895	2203	4300	6503	SO:0001819	synonymous_variant	153201	exon2			TCACCAGGTGAAT	AY162214	CCDS4315.1	5q33.1	2013-05-22			ENSG00000186335	ENSG00000186335		"""Solute carriers"""	18762	protein-coding gene	gene with protein product		608331				11959859	Standard	NM_181776		Approved	PAT2, tramdorin, TRAMD1	uc003lty.3	Q495M3	OTTHUMG00000130129	ENST00000335244.4:c.187C>T	5.37:g.150723806G>A		Somatic	198	1		WXS	Illumina GAIIx	Phase_I	221	7	NM_181776	0	0	0	0	0	Q495M4|Q495M6|Q6ZWK5|Q7Z6B5	Silent	SNP	ENST00000335244.4	37	CCDS4315.1																																																																																			G|0.470;A|0.530		0.557	SLC36A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252437.1		
DOCK2	1794	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	169482342	169482342	+	Missense_Mutation	SNP	A	A	T			TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr5:169482342A>T	ENST00000256935.8	+	42	4327	c.4247A>T	c.(4246-4248)gAt>gTt	p.D1416V	DOCK2_ENST00000540750.1_Missense_Mutation_p.D477V|DOCK2_ENST00000523351.1_3'UTR|DOCK2_ENST00000520908.1_Missense_Mutation_p.D908V	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1416	DHR-2.|Interaction with CRKL.				actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CCTGTCTTGGATGAACATCCC	0.478																																					p.D1416V		.											.	DOCK2-97	0			c.A4247T						.						92.0	87.0	89.0					5																	169482342		2203	4300	6503	SO:0001583	missense	1794	exon42			TCTTGGATGAACA	BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.4247A>T	5.37:g.169482342A>T	ENSP00000256935:p.Asp1416Val	Somatic	131	0		WXS	Illumina GAIIx	Phase_I	125	9	NM_004946	0	0	1	1	0	Q2M3I0|Q96AK7	Missense_Mutation	SNP	ENST00000256935.8	37	CCDS4371.1	.	.	.	.	.	.	.	.	.	.	A	20.8	4.057488	0.76074	.	.	ENSG00000134516	ENST00000256935;ENST00000520908;ENST00000540750	T;T;T	0.11604	3.4;3.04;2.76	5.07	5.07	0.68467	.	0.055954	0.64402	D	0.000002	T	0.15782	0.0380	M	0.76938	2.355	0.80722	D	1	P;B	0.42039	0.769;0.18	B;B	0.34652	0.187;0.045	T	0.03728	-1.1009	10	0.87932	D	0	.	14.8312	0.70149	1.0:0.0:0.0:0.0	.	908;1416	E7ERW7;Q92608	.;DOCK2_HUMAN	V	1416;908;477	ENSP00000256935:D1416V;ENSP00000429283:D908V;ENSP00000438827:D477V	ENSP00000256935:D1416V	D	+	2	0	DOCK2	169414920	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.572000	0.82409	1.899000	0.54978	0.533000	0.62120	GAT	.		0.478	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	NM_004946	
BTNL3	10917	bcgsc.ca	37	5	180432564	180432564	+	Missense_Mutation	SNP	G	G	T	rs73815153	byFrequency	TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr5:180432564G>T	ENST00000342868.6	+	8	1277	c.1093G>T	c.(1093-1095)Ggg>Tgg	p.G365W	RNU6-1036P_ENST00000383959.1_RNA	NM_197975.2	NP_932079.1	Q6UXE8	BTNL3_HUMAN	butyrophilin-like 3	365	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(1)|lung(10)|prostate(2)|skin(1)	25	all_cancers(89;3.37e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.00211)|all_lung(126;0.00371)|Breast(19;0.114)	all_cancers(40;0.00336)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)|all_lung(500;0.248)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000272)			CGTAGACAGGGGGAAGAACAA	0.478													G|||	492	0.0982428	0.2171	0.0648	5008	,	,		19317	0.0169		0.0517	False		,,,				2504	0.093				p.G365W		.											.	.	0			c.G1093T						.	G	TRP/GLY	846,3534		86,674,1430	181.0	200.0	194.0		1093	-5.4	0.0	5	dbSNP_130	194	428,8140		13,402,3869	yes	missense	BTNL3	NM_197975.2	184	99,1076,5299	TT,TG,GG		4.9953,19.3151,9.8394	possibly-damaging	365/467	180432564	1274,11674	2190	4284	6474	SO:0001583	missense	10917	exon8			GACAGGGGGAAGA	AB020625	CCDS47358.1	5q35	2014-01-14			ENSG00000168903	ENSG00000168903		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	1143	protein-coding gene	gene with protein product	"""butyrophilin-like receptor"""	606192				10429365	Standard	NM_197975		Approved	BTNLR, BTN9.1	uc003mmr.3	Q6UXE8	OTTHUMG00000162091	ENST00000342868.6:c.1093G>T	5.37:g.180432564G>T	ENSP00000341787:p.Gly365Trp	Somatic	285	1		WXS	Illumina GAIIx	Phase_I	254	9	NM_197975	0	0	0	0	0	Q496L7|Q9Y2C7	Missense_Mutation	SNP	ENST00000342868.6	37	CCDS47358.1	169	0.07738095238095238	97	0.19715447154471544	24	0.06629834254143646	11	0.019230769230769232	37	0.048812664907651716	G	5.820	0.335558	0.11013	0.193151	0.049953	ENSG00000168903	ENST00000342868;ENST00000376852	T	0.61627	0.09	3.0	-5.43	0.02632	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	.	.	.	.	T	0.00073	0.0002	L	0.43923	1.385	0.80722	P	0.0	B;P	0.43024	0.001;0.798	B;B	0.40636	0.001;0.335	T	0.04216	-1.0968	8	0.62326	D	0.03	.	7.6868	0.28544	0.3213:0.1436:0.5351:0.0	.	331;365	C9JDC2;Q6UXE8	.;BTNL3_HUMAN	W	365;331	ENSP00000341787:G365W	ENSP00000341787:G365W	G	+	1	0	BTNL3	180365170	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.383000	0.07398	-1.134000	0.02899	-1.373000	0.01185	GGG	G|0.927;T|0.073		0.478	BTNL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367176.2	NM_197975	
ADTRP	84830	bcgsc.ca	37	6	11723636	11723636	+	Missense_Mutation	SNP	C	C	T	rs2076185	byFrequency	TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr6:11723636C>T	ENST00000414691.3	-	5	1014	c.604G>A	c.(604-606)Gtc>Atc	p.V202I	ADTRP_ENST00000379413.2_Missense_Mutation_p.V202I|ADTRP_ENST00000514824.1_5'UTR|ADTRP_ENST00000229583.5_Missense_Mutation_p.V220I	NM_032744.3	NP_116133.1	Q96IZ2	ADTRP_HUMAN	androgen-dependent TFPI-regulating protein	202			V -> I (in dbSNP:rs2076185).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)											GCGATGAAGACGTAGCTGAGA	0.493													C|||	789	0.157548	0.0741	0.0418	5008	,	,		19217	0.4812		0.0368	False		,,,				2504	0.1431				p.V220I		.											.	.	0			c.G658A						.	C	ILE/VAL,ILE/VAL	330,4076	174.8+/-204.3	12,306,1885	200.0	199.0	199.0		658,604	-11.9	0.0	6	dbSNP_96	199	226,8374	93.8+/-155.7	2,222,4076	yes	missense,missense	C6orf105	NM_001143948.1,NM_032744.3	29,29	14,528,5961	TT,TC,CC		2.6279,7.4898,4.275	benign,benign	220/249,202/231	11723636	556,12450	2203	4300	6503	SO:0001583	missense	84830	exon6			TGAAGACGTAGCT	AJ420520	CCDS4521.1, CCDS47374.1	6p24.1	2012-01-30	2012-01-27	2012-01-27	ENSG00000111863	ENSG00000111863			21214	protein-coding gene	gene with protein product	"""androgen-induced 1-like"""	614348	"""chromosome 6 open reading frame 105"""	C6orf105		21868574	Standard	NM_032744		Approved	dJ413H6.1, AIG1L	uc011dip.2	Q96IZ2	OTTHUMG00000014260	ENST00000414691.3:c.604G>A	6.37:g.11723636C>T	ENSP00000404416:p.Val202Ile	Somatic	187	1		WXS	Illumina GAIIx	Phase_I	148	9	NM_001143948	0	0	0	0	0	B2R7T9|B4DV39|Q5THW1	Missense_Mutation	SNP	ENST00000414691.3	37	CCDS4521.1	337	0.1543040293040293	30	0.06097560975609756	10	0.027624309392265192	264	0.46153846153846156	33	0.04353562005277045	C	4.836	0.155405	0.09236	0.074898	0.026279	ENSG00000111863	ENST00000414691;ENST00000229583;ENST00000503285;ENST00000379413	T;T;T;T	0.32023	1.47;1.47;1.47;1.47	5.96	-11.9	0.00025	.	1.141520	0.06148	N	0.673551	T	0.01189	0.0039	N	0.00446	-1.495	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.34354	-0.9832	9	0.08381	T	0.77	-1.3615	5.177	0.15141	0.0967:0.3665:0.3859:0.151	rs2076185;rs52797021;rs56622535;rs59870797;rs2076185	220;202	Q96IZ2-2;Q96IZ2	.;ADTRP_HUMAN	I	202;220;63;202	ENSP00000404416:V202I;ENSP00000229583:V220I;ENSP00000426507:V63I;ENSP00000368723:V202I	ENSP00000229583:V220I	V	-	1	0	C6orf105	11831622	0.000000	0.05858	0.002000	0.10522	0.030000	0.12068	-1.876000	0.01633	-1.553000	0.01702	-0.238000	0.12139	GTC	C|0.890;T|0.110		0.493	ADTRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039864.3	NM_032744	
SKIV2L	6499	broad.mit.edu;bcgsc.ca	37	6	31935101	31935101	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr6:31935101G>A	ENST00000375394.2	+	21	2643	c.2530G>A	c.(2530-2532)Gtg>Atg	p.V844M	SKIV2L_ENST00000544581.1_Missense_Mutation_p.V651M|DXO_ENST00000478221.1_5'Flank	NM_006929.4	NP_008860.4	Q15477	SKIV2_HUMAN	superkiller viralicidic activity 2-like (S. cerevisiae)	844					ATP catabolic process (GO:0006200)	nucleus (GO:0005634)|Ski complex (GO:0055087)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|large_intestine(1)|ovary(1)	4						AGCAGGAAGGGTGGTGGTTGT	0.547																																					p.V844M		.											.	SKIV2L-290	0			c.G2530A						.						148.0	124.0	133.0					6																	31935101		1508	2709	4217	SO:0001583	missense	6499	exon21			GGAAGGGTGGTGG		CCDS4731.1	6p21	2010-02-17	2001-11-28		ENSG00000204351	ENSG00000204351			10898	protein-coding gene	gene with protein product		600478	"""superkiller viralicidic activity 2 (S. cerevisiae homolog)-like"""	SKIV2		7759100, 9799600	Standard	XM_006715168		Approved	HLP, DDX13, SKI2W, 170A	uc003nyn.1	Q15477	OTTHUMG00000031146	ENST00000375394.2:c.2530G>A	6.37:g.31935101G>A	ENSP00000364543:p.Val844Met	Somatic	377	0		WXS	Illumina GAIIx	Phase_I	232	11	NM_006929	0	0	6	7	1	O15005|Q12902|Q15476|Q5ST66	Missense_Mutation	SNP	ENST00000375394.2	37	CCDS4731.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.445494	0.84101	.	.	ENSG00000204351	ENST00000375394;ENST00000433155;ENST00000544581	T;T	0.54866	0.67;0.55	5.13	5.13	0.70059	.	0.062232	0.64402	D	0.000005	T	0.58192	0.2105	L	0.55481	1.735	0.58432	D	0.999995	D	0.76494	0.999	D	0.73708	0.981	T	0.62062	-0.6933	10	0.87932	D	0	-25.3154	11.0036	0.47620	0.0861:0.0:0.9139:0.0	.	844	Q15477	SKIV2_HUMAN	M	844;686;651	ENSP00000364543:V844M;ENSP00000442645:V651M	ENSP00000364543:V844M	V	+	1	0	SKIV2L	32043080	1.000000	0.71417	1.000000	0.80357	0.872000	0.50106	6.458000	0.73509	2.675000	0.91044	0.655000	0.94253	GTG	.		0.547	SKIV2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076264.3		
DST	667	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	56482929	56482929	+	Missense_Mutation	SNP	A	A	T			TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr6:56482929A>T	ENST00000370765.6	-	23	6010	c.5903T>A	c.(5902-5904)aTa>aAa	p.I1968K	DST_ENST00000312431.6_Intron|DST_ENST00000370769.4_Intron|DST_ENST00000421834.2_Intron|DST_ENST00000370788.2_Intron|DST_ENST00000446842.2_Intron|DST_ENST00000361203.3_Intron|DST_ENST00000370754.5_Intron|DST_ENST00000244364.6_Intron	NM_001723.5	NP_001714.1	Q03001	DYST_HUMAN	dystonin	0					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			ATCAAAAGTTATCTGTAACTC	0.433																																					p.I1968K		.											.	DST-523	0			c.T5903A						.						112.0	112.0	112.0					6																	56482929		2203	4300	6503	SO:0001583	missense	667	exon23			AAAGTTATCTGTA	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000370765.6:c.5903T>A	6.37:g.56482929A>T	ENSP00000359801:p.Ile1968Lys	Somatic	88	0		WXS	Illumina GAIIx	Phase_I	134	10	NM_001723	0	0	0	0	0	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	ENST00000370765.6	37	CCDS4959.1	.	.	.	.	.	.	.	.	.	.	A	18.28	3.588416	0.66105	.	.	ENSG00000151914	ENST00000370765	T	0.32753	1.44	5.49	5.49	0.81192	.	.	.	.	.	T	0.11110	0.0271	.	.	.	0.80722	D	1.000000	P	0.50066	0.931	P	0.49192	0.602	T	0.02093	-1.1215	7	0.05833	T	0.94	.	10.7774	0.46358	0.8584:0.0:0.0:0.1416	.	1968	Q03001-3	.	K	1968	ENSP00000359801:I1968K	ENSP00000359801:I1968K	I	-	2	0	DST	56590888	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.169000	0.50809	2.083000	0.62718	0.455000	0.32223	ATA	.		0.433	DST-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000041027.2	NM_001723	
EEF1A1	1915	broad.mit.edu;bcgsc.ca	37	6	74228257	74228257	+	Silent	SNP	G	G	A			TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr6:74228257G>A	ENST00000316292.9	-	5	1840	c.849C>T	c.(847-849)gtC>gtT	p.V283V	EEF1A1_ENST00000491404.1_Intron|EEF1A1_ENST00000331523.2_Silent_p.V283V|EEF1A1_ENST00000309268.6_Silent_p.V283V	NM_001402.5	NP_001393.1	P68104	EF1A1_HUMAN	eukaryotic translation elongation factor 1 alpha 1	283					cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|translation elongation factor activity (GO:0003746)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(6)|prostate(2)|skin(3)	18						TTGTAACGTTGACTGGAGCAA	0.448											OREG0003895	type=REGULATORY REGION|Gene=D16891|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.V283V		.											.	EEF1A1-226	0			c.C849T						.						39.0	38.0	38.0					6																	74228257		2079	4197	6276	SO:0001819	synonymous_variant	1915	exon6			AACGTTGACTGGA	BC019669	CCDS4980.1	6q14.1	2010-06-30	2004-11-19		ENSG00000156508	ENSG00000156508			3189	protein-coding gene	gene with protein product		130590	"""leukocyte receptor cluster (LRC) member 7"""	EF1A, EEF1A, LENG7		8812466, 10941842	Standard	NM_001402		Approved	EE1A1	uc003phj.3	P68104	OTTHUMG00000015031	ENST00000316292.9:c.849C>T	6.37:g.74228257G>A		Somatic	744	1	1151	WXS	Illumina GAIIx	Phase_I	745	17	NM_001402	1	7	6928	7053	117	P04719|P04720|Q6IQ15	Silent	SNP	ENST00000316292.9	37	CCDS4980.1																																																																																			.		0.448	EEF1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041210.2	NM_001402	
IMPG1	3617	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	76633419	76633419	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr6:76633419G>C	ENST00000369950.3	-	16	2437	c.2248C>G	c.(2248-2250)Cca>Gca	p.P750A	IMPG1_ENST00000369963.3_3'UTR	NM_001282368.1|NM_001563.2	NP_001269297.1|NP_001554.2			interphotoreceptor matrix proteoglycan 1											breast(5)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(8)|lung(27)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	63		Acute lymphoblastic leukemia(125;0.0418)|all_hematologic(105;0.222)				GAGTGATCTGGCAACCTACAA	0.294																																					p.P750A	Pancreas(37;839 1141 2599 26037)	.											.	IMPG1-93	0			c.C2248G						.						119.0	107.0	111.0					6																	76633419		2202	4299	6501	SO:0001583	missense	3617	exon16			GATCTGGCAACCT	AF017776	CCDS4985.1, CCDS75483.1	6q14.2-q15	2008-02-05	2004-05-25		ENSG00000112706	ENSG00000112706			6055	protein-coding gene	gene with protein product		602870	"""sialoprotein associated with cones and rods"""	SPACR			Standard	NM_001282368		Approved	IPM150, GP147	uc003pik.1	Q17R60	OTTHUMG00000015063	ENST00000369950.3:c.2248C>G	6.37:g.76633419G>C	ENSP00000358966:p.Pro750Ala	Somatic	32	0		WXS	Illumina GAIIx	Phase_I	26	10	NM_001563	0	0	0	0	0		Missense_Mutation	SNP	ENST00000369950.3	37	CCDS4985.1	.	.	.	.	.	.	.	.	.	.	G	3.878	-0.026481	0.07589	.	.	ENSG00000112706	ENST00000369950;ENST00000369952	T;T	0.20069	2.1;2.25	4.02	2.18	0.27775	.	0.509445	0.15998	N	0.234447	T	0.06096	0.0158	L	0.39898	1.24	0.80722	D	1	B	0.30406	0.278	B	0.24974	0.057	T	0.13176	-1.0519	10	0.52906	T	0.07	.	4.299	0.10915	0.1179:0.0:0.6544:0.2277	.	750	Q17R60	IMPG1_HUMAN	A	750;111	ENSP00000358966:P750A;ENSP00000358968:P111A	ENSP00000358966:P750A	P	-	1	0	IMPG1	76690139	0.784000	0.28713	0.976000	0.42696	0.140000	0.21249	0.187000	0.16998	0.994000	0.38892	-0.188000	0.12872	CCA	.		0.294	IMPG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041288.1	NM_001563	
POU3F2	5454	hgsc.bcm.edu	37	6	99283376	99283376	+	Silent	SNP	T	T	G	rs195860	byFrequency	TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr6:99283376T>G	ENST00000328345.5	+	1	797	c.627T>G	c.(625-627)ggT>ggG	p.G209G		NM_005604.3	NP_005595.2	P20265	PO3F2_HUMAN	POU class 3 homeobox 2	209					astrocyte development (GO:0014002)|cellular response to organic substance (GO:0071310)|cerebral cortex radially oriented cell migration (GO:0021799)|epidermis development (GO:0008544)|forebrain ventricular zone progenitor cell division (GO:0021869)|hypothalamus cell differentiation (GO:0021979)|myelination in peripheral nervous system (GO:0022011)|neurohypophysis development (GO:0021985)|neuron differentiation (GO:0030182)|positive regulation of cell proliferation (GO:0008284)|positive regulation of multicellular organism growth (GO:0040018)|regulation of axonogenesis (GO:0050770)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	identical protein binding (GO:0042802)|RNA polymerase II transcription coactivator activity (GO:0001105)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|large_intestine(3)|lung(5)	10		all_cancers(76;1.56e-06)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00893)|Colorectal(196;0.069)|Lung NSC(302;0.197)		BRCA - Breast invasive adenocarcinoma(108;0.0355)		AGCCGGCCGGTCTGCACCACC	0.736													G|||	4460	0.890575	0.8994	0.9121	5008	,	,		6412	0.9544		0.8598	False		,,,				2504	0.8292				p.G209G		.											.	POU3F2-90	0			c.T627G						.	G		3186,306		1453,280,13	4.0	4.0	4.0		627	3.1	1.0	6	dbSNP_79	4	6282,930		2738,806,62	no	coding-synonymous	POU3F2	NM_005604.2		4191,1086,75	GG,GT,TT		12.8952,8.7629,11.5471		209/444	99283376	9468,1236	1746	3606	5352	SO:0001819	synonymous_variant	5454	exon1			GGCCGGTCTGCAC	Z11933	CCDS5040.1	6q16.2	2011-06-20	2007-07-13		ENSG00000184486	ENSG00000184486		"""Homeoboxes / POU class"""	9215	protein-coding gene	gene with protein product		600494	"""POU domain class 3, transcription factor 2"""	OTF7		8441633	Standard	NM_005604		Approved	POUF3, BRN2, OCT7	uc003ppe.3	P20265	OTTHUMG00000015258	ENST00000328345.5:c.627T>G	6.37:g.99283376T>G		Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	4	NM_005604	0	0	0	0	0	Q14960|Q86V54|Q9UJL0	Silent	SNP	ENST00000328345.5	37	CCDS5040.1																																																																																			T|0.089;G|0.911		0.736	POU3F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041586.2		
TCP10L2	401285	broad.mit.edu	37	6	167592576	167592576	+	Silent	SNP	G	G	A	rs60976240	byFrequency	TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr6:167592576G>A	ENST00000366832.2	+	6	866	c.735G>A	c.(733-735)acG>acA	p.T245T		NM_001145121.1	NP_001138593.1	B9ZVM9	TCP2L_HUMAN	t-complex 10-like 2	245										endometrium(1)|kidney(2)|lung(3)	6						AGGCCGCCACGCTGCAGGAGC	0.582													G|||	3206	0.640176	0.7617	0.6614	5008	,	,		17779	0.5694		0.5984	False		,,,				2504	0.5767				p.T245T		.											.	.	0			c.G735A						.						23.0	28.0	27.0					6																	167592576		692	1591	2283	SO:0001819	synonymous_variant	401285	exon6			CGCCACGCTGCAG		CCDS47514.1	6q27	2012-09-20	2012-09-20		ENSG00000166984	ENSG00000166984			21254	protein-coding gene	gene with protein product			"""t-complex 10-like 2 (mouse)"""				Standard	NM_001145121		Approved	bA517H2.3	uc010kkp.3	B9ZVM9	OTTHUMG00000016014	ENST00000366832.2:c.735G>A	6.37:g.167592576G>A		Somatic	100	2		WXS	Illumina GAIIx	Phase_I	85	4	NM_001145121	0	0	0	0	0		Silent	SNP	ENST00000366832.2	37	CCDS47514.1																																																																																			G|0.425;A|0.575		0.582	TCP10L2-001	NOVEL	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043112.5	XR_040749	
GARS	2617	hgsc.bcm.edu	37	7	30634661	30634661	+	Missense_Mutation	SNP	C	C	G	rs1049402	byFrequency	TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr7:30634661C>G	ENST00000389266.3	+	1	365	c.124C>G	c.(124-126)Ccc>Gcc	p.P42A	AC005154.6_ENST00000582549.1_RNA|AC005154.6_ENST00000579174.1_RNA|AC005154.6_ENST00000580440.1_RNA|AC005154.6_ENST00000583664.1_RNA|AC005154.6_ENST00000584199.1_RNA|AC005154.6_ENST00000581665.1_RNA|AC005154.6_ENST00000578994.1_RNA|AC005154.6_ENST00000584372.1_RNA	NM_002047.2	NP_002038.2	P41250	SYG_HUMAN	glycyl-tRNA synthetase	42			P -> A (in dbSNP:rs1049402). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:7753621, ECO:0000269|PubMed:7961834, ECO:0000269|PubMed:7962006}.		cell death (GO:0008219)|diadenosine tetraphosphate biosynthetic process (GO:0015966)|gene expression (GO:0010467)|glycyl-tRNA aminoacylation (GO:0006426)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|secretory granule (GO:0030141)	ATP binding (GO:0005524)|glycine-tRNA ligase activity (GO:0004820)|protein dimerization activity (GO:0046983)	p.P42fs*20(1)		breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|skin(3)|urinary_tract(1)	24					Glycine(DB00145)	GGCCTCCTGCCCCCCGATCTC	0.736													G|||	3252	0.649361	0.5219	0.7147	5008	,	,		13746	0.6677		0.7634	False		,,,				2504	0.6391				p.P42A		.											.	GARS-91	1	Insertion - Frameshift(1)	large_intestine(1)	c.C124G						.	G	ALA/PRO	2445,1427		776,893,267	5.0	8.0	7.0		124	-6.6	0.0	7	dbSNP_86	7	6367,1671		2577,1213,229	no	missense	GARS	NM_002047.2	27	3353,2106,496	GG,GC,CC		20.7888,36.8543,26.0118	benign	42/740	30634661	8812,3098	1936	4019	5955	SO:0001583	missense	2617	exon1			TCCTGCCCCCCGA	AK074524	CCDS43564.1	7p15	2014-09-17	2004-02-13		ENSG00000106105	ENSG00000106105	6.1.1.14	"""Aminoacyl tRNA synthetases / Class II"""	4162	protein-coding gene	gene with protein product	"""glycine tRNA ligase"""	600287	"""Charcot-Marie-Tooth neuropathy 2D"""	CMT2D		8595897, 8872480	Standard	NM_002047		Approved	GlyRS, DSMAV, SMAD1	uc003tbm.3	P41250	OTTHUMG00000152769	ENST00000389266.3:c.124C>G	7.37:g.30634661C>G	ENSP00000373918:p.Pro42Ala	Somatic	0	0		WXS	Illumina GAIIx	Phase_I	9	9	NM_002047	0	0	0	1	1	B3KQA2|B4DIA0|Q969Y1	Missense_Mutation	SNP	ENST00000389266.3	37	CCDS43564.1	1456	0.6666666666666666	278	0.5650406504065041	268	0.7403314917127072	337	0.5891608391608392	573	0.7559366754617414	G	0.005	-2.164835	0.00318	0.631457	0.792112	ENSG00000106105	ENST00000389266	T	0.80393	-1.37	3.31	-6.63	0.01807	.	1.037800	0.07609	N	0.925137	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.13575	-1.0504	9	0.08179	T	0.78	.	5.5596	0.17135	0.0726:0.2689:0.1197:0.5389	rs1049402;rs3189564;rs11553500;rs17856223;rs17856227;rs1049402	42	P41250	SYG_HUMAN	A	42	ENSP00000373918:P42A	ENSP00000373918:P42A	P	+	1	0	GARS	30601186	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	-0.671000	0.05250	-2.551000	0.00479	-0.744000	0.03518	CCC	C|0.329;G|0.671		0.736	GARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327735.1	NM_002047	
AMPH	273	bcgsc.ca	37	7	38431436	38431436	+	Silent	SNP	C	C	T	rs1058656	byFrequency	TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr7:38431436C>T	ENST00000356264.2	-	19	2006	c.1791G>A	c.(1789-1791)acG>acA	p.T597T	AMPH_ENST00000471913.1_5'Flank|AMPH_ENST00000428293.2_Silent_p.T555T|AMPH_ENST00000325590.5_Silent_p.T555T	NM_001635.3	NP_001626.1	P49418	AMPH_HUMAN	amphiphysin	597					endocytosis (GO:0006897)|learning (GO:0007612)|synaptic transmission (GO:0007268)|synaptic vesicle endocytosis (GO:0048488)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|leading edge membrane (GO:0031256)|synaptic vesicle (GO:0008021)	phospholipid binding (GO:0005543)			breast(1)|endometrium(3)|kidney(3)|large_intestine(12)|liver(3)|lung(27)|ovary(3)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)	62						GTGCAGAAGGCGTGGGCTGAG	0.612													C|||	896	0.178914	0.2322	0.2248	5008	,	,		13855	0.127		0.1759	False		,,,				2504	0.1309				p.T597T		.											.	AMPH-95	0			c.G1791A						.	C	,	948,3458	360.1+/-315.1	99,750,1354	52.0	49.0	50.0		1791,1665	-1.8	0.0	7	dbSNP_86	50	1860,6740	330.3+/-319.2	197,1466,2637	no	coding-synonymous,coding-synonymous	AMPH	NM_001635.3,NM_139316.2	,	296,2216,3991	TT,TC,CC		21.6279,21.5161,21.59	,	597/696,555/654	38431436	2808,10198	2203	4300	6503	SO:0001819	synonymous_variant	273	exon19			AGAAGGCGTGGGC		CCDS5456.1, CCDS47574.1	7p14-p13	2007-06-19	2007-06-19		ENSG00000078053	ENSG00000078053			471	protein-coding gene	gene with protein product		600418	"""amphiphysin (Stiff-Mann syndrome with breast cancer 128kD autoantigen)"", ""amphiphysin (Stiff-Man syndrome with breast cancer 128kDa autoantigen)"""			8245793	Standard	NM_139316		Approved		uc003tgu.3	P49418	OTTHUMG00000023725	ENST00000356264.2:c.1791G>A	7.37:g.38431436C>T		Somatic	56	0		WXS	Illumina GAIIx	Phase_I	65	4	NM_001635	0	0	1	1	0	A4D1X8|A4D1X9|O43538|Q75MJ8|Q75MK5|Q75MM3|Q8N4G0	Silent	SNP	ENST00000356264.2	37	CCDS5456.1	395	0.18086080586080586	105	0.21341463414634146	74	0.20441988950276244	73	0.12762237762237763	143	0.18865435356200527	C	5.413	0.261367	0.10239	0.215161	0.216279	ENSG00000078053	ENST00000441628	.	.	.	5.34	-1.8	0.07907	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.29761	-1.0001	3	.	.	.	0.6258	3.0635	0.06207	0.106:0.3229:0.3573:0.2139	rs1058656;rs3199302;rs11553335;rs56947214	.	.	.	T	480	.	.	A	-	1	0	AMPH	38397961	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	-0.475000	0.06599	-0.035000	0.13691	0.591000	0.81541	GCC	C|0.804;T|0.196		0.612	AMPH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000226953.2	NM_001635	
ANKIB1	54467	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	91974336	91974336	+	Silent	SNP	G	G	A			TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr7:91974336G>A	ENST00000265742.3	+	7	1417	c.1041G>A	c.(1039-1041)gtG>gtA	p.V347V		NM_019004.1	NP_061877.1	Q9P2G1	AKIB1_HUMAN	ankyrin repeat and IBR domain containing 1	347							zinc ion binding (GO:0008270)			cervix(1)|endometrium(7)|kidney(3)|large_intestine(10)|lung(19)|skin(1)	41	all_cancers(62;2.06e-09)|all_epithelial(64;9.24e-09)|Breast(17;0.0034)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		STAD - Stomach adenocarcinoma(171;6.16e-05)|all cancers(6;0.00183)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			AAGACCCTGTGGATATGCCCT	0.393																																					p.V347V		.											.	ANKIB1-432	0			c.G1041A						.						358.0	331.0	339.0					7																	91974336		1899	4131	6030	SO:0001819	synonymous_variant	54467	exon7			CCCTGTGGATATG	AB037807	CCDS47639.1	7q21.3	2013-01-10			ENSG00000001629	ENSG00000001629		"""Ankyrin repeat domain containing"""	22215	protein-coding gene	gene with protein product							Standard	NM_019004		Approved	DKFZP434A0225, KIAA1386	uc003ulw.2	Q9P2G1	OTTHUMG00000155859	ENST00000265742.3:c.1041G>A	7.37:g.91974336G>A		Somatic	175	0		WXS	Illumina GAIIx	Phase_I	179	56	NM_019004	0	0	0	0	0	Q6GMS4|Q6P3S9|Q9NTD7|Q9NW49	Silent	SNP	ENST00000265742.3	37	CCDS47639.1																																																																																			.		0.393	ANKIB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342018.1		
TTC26	79989	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	138872237	138872237	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr7:138872237G>C	ENST00000464848.1	+	17	1585	c.1505G>C	c.(1504-1506)gGt>gCt	p.G502A	TTC26_ENST00000478836.2_Missense_Mutation_p.G395A|TTC26_ENST00000495038.1_Missense_Mutation_p.G371A|TTC26_ENST00000343187.4_Missense_Mutation_p.G471A|TTC26_ENST00000430935.1_Intron			A0AVF1	TTC26_HUMAN	tetratricopeptide repeat domain 26	502					cilium assembly (GO:0042384)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|intraciliary transport particle B (GO:0030992)|primary cilium (GO:0072372)				breast(1)|endometrium(5)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	24						GGCAAACGGGGTGCCTGTGTG	0.453																																					p.G502A		.											.	TTC26-91	0			c.G1505C						.						155.0	152.0	153.0					7																	138872237		2203	4300	6503	SO:0001583	missense	79989	exon17			AACGGGGTGCCTG	AK022633	CCDS5852.1, CCDS55172.1, CCDS55173.1, CCDS75665.1	7q34	2013-01-11			ENSG00000105948	ENSG00000105948		"""Intraflagellar transport homologs"", ""Tetratricopeptide (TTC) repeat domain containing"""	21882	protein-coding gene	gene with protein product							Standard	NM_001144920		Approved	FLJ12571, dyf-13, DYF13	uc003vus.2	A0AVF1	OTTHUMG00000157472	ENST00000464848.1:c.1505G>C	7.37:g.138872237G>C	ENSP00000419279:p.Gly502Ala	Somatic	125	0		WXS	Illumina GAIIx	Phase_I	154	48	NM_024926	0	0	0	1	1	A4D1S3|B7Z5M0|C9J2N7|F8W724|Q9H9S8|Q9NTC0	Missense_Mutation	SNP	ENST00000464848.1	37	CCDS5852.1	.	.	.	.	.	.	.	.	.	.	G	29.0	4.965574	0.92855	.	.	ENSG00000105948	ENST00000495038;ENST00000478836;ENST00000464848;ENST00000343187	T;T;T;T	0.60299	0.23;0.31;0.2;0.32	5.17	5.17	0.71159	.	0.000000	0.85682	D	0.000000	T	0.79511	0.4458	M	0.87758	2.905	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.91635	0.999;0.998;0.996	T	0.81820	-0.0757	10	0.48119	T	0.1	.	17.451	0.87592	0.0:0.0:1.0:0.0	.	371;471;502	B7Z2T3;F8W724;A0AVF1	.;.;TTC26_HUMAN	A	371;395;502;471	ENSP00000418788:G371A;ENSP00000419178:G395A;ENSP00000419279:G502A;ENSP00000339135:G471A	ENSP00000339135:G471A	G	+	2	0	TTC26	138522777	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.521000	0.98029	2.403000	0.81681	0.591000	0.81541	GGT	.		0.453	TTC26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348919.2	NM_024926	
MSR1	4481	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	15967636	15967636	+	Silent	SNP	G	G	C			TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr8:15967636G>C	ENST00000262101.5	-	10	1435	c.1314C>G	c.(1312-1314)gcC>gcG	p.A438A	MSR1_ENST00000350896.3_Silent_p.A375A|MSR1_ENST00000355282.2_Silent_p.A375A|MSR1_ENST00000445506.2_Silent_p.A456A			P21757	MSRE_HUMAN	macrophage scavenger receptor 1	438	SRCR. {ECO:0000255|PROSITE- ProRule:PRU00196}.				cholesterol transport (GO:0030301)|lipoprotein transport (GO:0042953)|plasma lipoprotein particle clearance (GO:0034381)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|receptor-mediated endocytosis (GO:0006898)	collagen trimer (GO:0005581)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|plasma membrane (GO:0005886)	low-density lipoprotein particle binding (GO:0030169)|scavenger receptor activity (GO:0005044)			haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(7)|lung(14)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	37				Colorectal(111;0.00475)|COAD - Colon adenocarcinoma(73;0.0164)		AATGTGAACAGGCTCTTGTCC	0.368																																					p.A438A		.											.	MSR1-91	0			c.C1314G						.						96.0	96.0	96.0					8																	15967636		2203	4300	6503	SO:0001819	synonymous_variant	4481	exon10			TGAACAGGCTCTT	D13263	CCDS5995.1, CCDS5996.1, CCDS5997.1	8p22	2006-02-22			ENSG00000038945	ENSG00000038945		"""CD molecules"""	7376	protein-coding gene	gene with protein product		153622				2251254	Standard	NM_138715		Approved	SCARA1, CD204	uc003wwz.3	P21757	OTTHUMG00000094809	ENST00000262101.5:c.1314C>G	8.37:g.15967636G>C		Somatic	61	0		WXS	Illumina GAIIx	Phase_I	81	25	NM_138715	0	0	1	1	0	D3DSP3|O60505|P21759|Q45F10	Silent	SNP	ENST00000262101.5	37	CCDS5995.1																																																																																			.		0.368	MSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211627.2		
ASAP1	50807	broad.mit.edu	37	8	131172197	131172197	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr8:131172197C>T	ENST00000518721.1	-	12	1150	c.923G>A	c.(922-924)cGg>cAg	p.R308Q	ASAP1_ENST00000357668.1_Missense_Mutation_p.R308Q	NM_001247996.1|NM_018482.3	NP_001234925.1|NP_060952.2	Q9ULH1	ASAP1_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 1	308					cilium morphogenesis (GO:0060271)|regulation of ARF GTPase activity (GO:0032312)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|zinc ion binding (GO:0008270)			breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(22)|ovary(6)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	68						TCCTCCTTGCCGGCTCTGAGA	0.438																																					p.R308Q		.											.	ASAP1-95	0			c.G923A						.						144.0	136.0	139.0					8																	131172197		2203	4300	6503	SO:0001583	missense	50807	exon12			CCTTGCCGGCTCT	AB033075	CCDS6362.1, CCDS75788.1	8q24.1-q24.2	2013-01-11	2008-09-22	2008-09-22	ENSG00000153317	ENSG00000153317		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2720	protein-coding gene	gene with protein product	"""centaurin, beta 4"""	605953	"""development and differentiation enhancing factor 1"""	DDEF1		9819391	Standard	NM_018482		Approved	PAP, KIAA1249, ZG14P, CENTB4	uc003yta.2	Q9ULH1	OTTHUMG00000164772	ENST00000518721.1:c.923G>A	8.37:g.131172197C>T	ENSP00000429900:p.Arg308Gln	Somatic	77	0		WXS	Illumina GAIIx	Phase_I	63	3	NM_018482	0	0	0	0	0	B2RNV3	Missense_Mutation	SNP	ENST00000518721.1	37	CCDS6362.1	.	.	.	.	.	.	.	.	.	.	C	17.63	3.438430	0.62955	.	.	ENSG00000153317	ENST00000343135;ENST00000357668;ENST00000518721;ENST00000524367	T;T;T	0.46063	3.33;3.33;0.88	5.74	5.74	0.90152	.	0.052994	0.85682	D	0.000000	T	0.29190	0.0726	L	0.34521	1.04	0.49687	D	0.999816	B;B;B	0.33494	0.414;0.414;0.335	B;B;B	0.24974	0.038;0.038;0.057	T	0.06267	-1.0836	10	0.38643	T	0.18	.	11.1199	0.48284	0.0:0.9162:0.0:0.0838	.	308;308;311	B2RNV3;Q9ULH1;Q9ULH1-2	.;ASAP1_HUMAN;.	Q	311;308;308;278	ENSP00000350297:R308Q;ENSP00000429900:R308Q;ENSP00000430588:R278Q	ENSP00000344591:R311Q	R	-	2	0	ASAP1	131241379	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	2.820000	0.48057	2.873000	0.98535	0.563000	0.77884	CGG	.		0.438	ASAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380170.1	NM_018482	
ALG2	85365	ucsc.edu	37	9	101980798	101980798	+	Silent	SNP	C	C	T			TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr9:101980798C>T	ENST00000476832.1	-	2	730	c.669G>A	c.(667-669)ggG>ggA	p.G223G	ALG2_ENST00000319033.6_Silent_p.G130G	NM_033087.3	NP_149078.1	O75340	PDCD6_HUMAN	ALG2, alpha-1,3/1,6-mannosyltransferase	0					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|cellular response to heat (GO:0034605)|intracellular protein transport (GO:0006886)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|proteolysis (GO:0006508)|response to calcium ion (GO:0051592)|vascular endothelial growth factor receptor-2 signaling pathway (GO:0036324)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	binding, bridging (GO:0060090)|calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|calcium-dependent protein binding (GO:0048306)|protein dimerization activity (GO:0046983)			breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(11)|ovary(2)|prostate(2)	22		Acute lymphoblastic leukemia(62;0.0559)				GGAATTTTTTCCCCTTGGGGA	0.473																																					p.G223G		.											.	ALG2-92	0			c.G669A						.						107.0	109.0	108.0					9																	101980798		2203	4300	6503	SO:0001819	synonymous_variant	85365	exon2			TTTTTTCCCCTTG	AK027417	CCDS6739.1	9q31.1	2013-02-22	2013-02-22		ENSG00000119523	ENSG00000119523	2.4.1.132, 2.4.1.257	"""Glycosyltransferase group 1 domain containing"""	23159	protein-coding gene	gene with protein product		607905	"""asparagine-linked glycosylation 2 homolog (yeast, alpha-1,3-mannosyltransferase)"", ""asparagine-linked glycosylation 2, alpha-1,3-mannosyltransferase homolog (S. cerevisiae)"""			12684507	Standard	NR_024532		Approved	CDGIi, FLJ14511, hALPG2, NET38	uc004azf.3	Q9H553	OTTHUMG00000020355	ENST00000476832.1:c.669G>A	9.37:g.101980798C>T		Somatic	108	0		WXS	Illumina GAIIx	Phase_I	110	1	NM_033087	0	0	18	19	1	B2RD16|E7ESR3|Q2YDC2|Q5TZS0	Silent	SNP	ENST00000476832.1	37	CCDS6739.1																																																																																			.		0.473	ALG2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215080.1	NM_033087	
ATRX	546	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	76939322	76939322	+	Nonsense_Mutation	SNP	G	G	A			TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chrX:76939322G>A	ENST00000373344.5	-	9	1640	c.1426C>T	c.(1426-1428)Cag>Tag	p.Q476*	ATRX_ENST00000480283.1_5'UTR|ATRX_ENST00000395603.3_Nonsense_Mutation_p.Q438*	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	476					ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						GGAACATTCTGATGCATGTGC	0.373			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																														p.Q476X		.		Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	.	ATRX-248	1	Unknown(1)	bone(1)	c.C1426T						.						196.0	198.0	197.0					X																	76939322		2203	4296	6499	SO:0001587	stop_gained	546	exon9			CATTCTGATGCAT	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.1426C>T	X.37:g.76939322G>A	ENSP00000362441:p.Gln476*	Somatic	56	0		WXS	Illumina GAIIx	Phase_I	62	18	NM_000489	0	0	0	0	0	D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Nonsense_Mutation	SNP	ENST00000373344.5	37	CCDS14434.1	.	.	.	.	.	.	.	.	.	.	g	18.19	3.568864	0.65765	.	.	ENSG00000085224	ENST00000373344;ENST00000395603;ENST00000400862	.	.	.	4.5	4.5	0.54988	.	0.716641	0.12865	U	0.432752	.	.	.	.	.	.	0.24902	N	0.992096	.	.	.	.	.	.	.	.	.	.	0.10377	T	0.69	0.0483	16.6202	0.84928	0.0:0.0:1.0:0.0	.	.	.	.	X	476;438;432	.	ENSP00000362441:Q476X	Q	-	1	0	ATRX	76825978	1.000000	0.71417	0.213000	0.23690	0.079000	0.17450	5.379000	0.66196	1.834000	0.53371	0.509000	0.49947	CAG	.		0.373	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058860.2	NM_000489	
ATP11C	286410	broad.mit.edu;bcgsc.ca	37	X	138886677	138886677	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chrX:138886677T>C	ENST00000327569.3	-	6	615	c.517A>G	c.(517-519)Acc>Gcc	p.T173A	ATP11C_ENST00000370557.1_Missense_Mutation_p.T170A|ATP11C_ENST00000361648.2_Missense_Mutation_p.T173A|ATP11C_ENST00000359686.2_Missense_Mutation_p.T173A|ATP11C_ENST00000370543.1_Missense_Mutation_p.T173A	NM_173694.4	NP_775965	Q8NB49	AT11C_HUMAN	ATPase, class VI, type 11C	173					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|positive regulation of B cell differentiation (GO:0045579)|pre-B cell differentiation (GO:0002329)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(2)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(31)|ovary(5)|prostate(1)|skin(3)	75	Acute lymphoblastic leukemia(192;0.000127)					ACATAACAGGTTCCATCAGTG	0.393																																					p.T173A		.											.	ATP11C-198	0			c.A517G						.						218.0	192.0	201.0					X																	138886677		2203	4300	6503	SO:0001583	missense	286410	exon6			AACAGGTTCCATC	AJ580094	CCDS14668.1, CCDS35410.1	Xq27.1	2011-06-09	2007-09-19		ENSG00000101974	ENSG00000101974		"""ATPases / P-type"""	13554	protein-coding gene	gene with protein product		300516	"""ATPase, Class VI, type 11C"""			11015572	Standard	NM_173694		Approved	ATPIG, ATPIQ	uc004faz.3	Q8NB49	OTTHUMG00000022538	ENST00000327569.3:c.517A>G	X.37:g.138886677T>C	ENSP00000332756:p.Thr173Ala	Somatic	381	1		WXS	Illumina GAIIx	Phase_I	352	10	NM_001010986	0	0	0	0	0	Q5JT69|Q5JT70|Q5JT71|Q5JT72|Q5JT73|Q6ZND5|Q6ZU50|Q6ZUP7|Q70IJ9|Q70IK0|Q8WX24	Missense_Mutation	SNP	ENST00000327569.3	37	CCDS14668.1	.	.	.	.	.	.	.	.	.	.	T	19.22	3.785708	0.70337	.	.	ENSG00000101974	ENST00000370557;ENST00000361648;ENST00000327569;ENST00000370543;ENST00000359686	D;D;D;D;D	0.90444	-2.67;-2.67;-2.67;-2.67;-2.67	4.7	4.7	0.59300	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.000000	0.85682	D	0.000000	D	0.92903	0.7742	L	0.46885	1.475	0.47994	D	0.999565	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.93285	0.6663	10	0.66056	D	0.02	.	12.4973	0.55935	0.0:0.0:0.0:1.0	.	173;173	Q8NB49-3;Q8NB49	.;AT11C_HUMAN	A	170;173;173;173;173	ENSP00000359588:T170A;ENSP00000355165:T173A;ENSP00000332756:T173A;ENSP00000359574:T173A;ENSP00000352715:T173A	ENSP00000332756:T173A	T	-	1	0	ATP11C	138714343	1.000000	0.71417	1.000000	0.80357	0.861000	0.49209	7.816000	0.86201	1.741000	0.51731	0.345000	0.21793	ACC	.		0.393	ATP11C-008	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354945.1	NM_173694	
MACF1	23499	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	39898819	39898820	+	Frame_Shift_Ins	INS	-	-	T			TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr1:39898819_39898820insT	ENST00000372915.3	+	66	17332_17333	c.17245_17246insT	c.(17245-17247)gtafs	p.V5749fs	MACF1_ENST00000567887.1_Frame_Shift_Ins_p.V5890fs|MACF1_ENST00000564288.1_Frame_Shift_Ins_p.V5853fs|MACF1_ENST00000539005.1_Frame_Shift_Ins_p.V3661fs|MACF1_ENST00000361689.2_Frame_Shift_Ins_p.V3791fs|MACF1_ENST00000317713.7_Frame_Shift_Ins_p.V3791fs|MACF1_ENST00000289893.4_Frame_Shift_Ins_p.V4293fs|MACF1_ENST00000545844.1_Frame_Shift_Ins_p.V3791fs			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	5749					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GCAAAAAACTGTATTACAGGTG	0.361																																					p.V3791fs		.											.	MACF1-165	0			c.11371_11372insT						.																																			SO:0001589	frameshift_variant	23499	exon64			AAAACTGTATTAC	AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.17246dupT	1.37:g.39898820_39898820dupT	ENSP00000362006:p.Val5749fs	Somatic	203	0		WXS	Illumina GAIIx	Phase_I	269	83	NM_012090	0	0	0	0	0	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Frame_Shift_Ins	INS	ENST00000372915.3	37																																																																																				.		0.361	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	NM_033044	
KRT2	3849	hgsc.bcm.edu	37	12	53045632	53045633	+	In_Frame_Ins	INS	-	-	GCCTCCAAAGCCGCTGCC	rs182369139		TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr12:53045632_53045633insGCCTCCAAAGCCGCTGCC	ENST00000309680.3	-	1	315_316	c.294_295insGGCAGCGGCTTTGGAGGC	c.(292-297)ggcggc>ggcGGCAGCGGCTTTGGAGGCggc	p.98_99GG>GGSGFGGG		NM_000423.2	NP_000414.2	P35908	K22E_HUMAN	keratin 2	98	Head.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte activation (GO:0032980)|keratinocyte migration (GO:0051546)|keratinocyte proliferation (GO:0043616)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(18)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32				BRCA - Breast invasive adenocarcinoma(357;0.19)		aagctgctgccgcctccaaaac	0.624																																					p.G99delinsGSGFGGG		.											.	KRT2-92	0			c.295_296insGGCAGCGGCTTTGGAGGC						.																																			SO:0001652	inframe_insertion	3849	exon1			TGCTGCCGCCTCC		CCDS8835.1	12q13.13	2013-01-16	2008-08-01	2006-07-17	ENSG00000172867	ENSG00000172867		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6439	protein-coding gene	gene with protein product	"""epidermal ichthyosis bullosa of Siemens"""	600194	"""keratin 2A (epidermal ichthyosis bullosa of Siemens)"""	KRT2A		7524919, 16831889	Standard	NM_000423		Approved	KRTE	uc001sat.3	P35908	OTTHUMG00000169748	ENST00000309680.3:c.294_295insGGCAGCGGCTTTGGAGGC	12.37:g.53045632_53045633insGCCTCCAAAGCCGCTGCC	ENSP00000310861:p.Gly98_Gly99insGlySerGlyPheGlyGly	Somatic	149	0		WXS	Illumina GAIIx	Phase_I	549	190	NM_000423	0	0	0	0	0	Q4VAQ2	In_Frame_Ins	INS	ENST00000309680.3	37	CCDS8835.1																																																																																			.		0.624	KRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405704.1	NM_000423	
PRKAR1A	5573	hgsc.bcm.edu	37	17	66511699	66511700	+	Frame_Shift_Ins	INS	-	-	T			TCGA-OR-A5KT-01A-11D-A29I-10	TCGA-OR-A5KT-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	062c82a9-f4e0-4eb0-adbc-3cb73423050d	35c2cd8b-80ce-4327-a1a3-f3ab82a32ccc	g.chr17:66511699_66511700insT	ENST00000589228.1	+	2	287_288	c.159_160insT	c.(160-162)tttfs	p.F54fs	PRKAR1A_ENST00000588188.2_Frame_Shift_Ins_p.F54fs|PRKAR1A_ENST00000536854.2_Frame_Shift_Ins_p.F54fs|PRKAR1A_ENST00000586397.1_Frame_Shift_Ins_p.F54fs|PRKAR1A_ENST00000358598.2_Frame_Shift_Ins_p.F54fs|PRKAR1A_ENST00000392711.1_Frame_Shift_Ins_p.F54fs	NM_001276289.1|NM_001278433.1	NP_001263218.1|NP_001265362.1	P10644	KAP0_HUMAN	protein kinase, cAMP-dependent, regulatory, type I, alpha	54	Dimerization and phosphorylation.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|blood coagulation (GO:0007596)|cardiac muscle cell proliferation (GO:0060038)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|female meiotic division (GO:0007143)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|mesoderm formation (GO:0001707)|negative regulation of cAMP-dependent protein kinase activity (GO:2000480)|negative regulation of meiosis (GO:0045835)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of insulin secretion (GO:0050796)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|sarcomere organization (GO:0045214)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	AMP-activated protein kinase complex (GO:0031588)|cAMP-dependent protein kinase complex (GO:0005952)|cytosol (GO:0005829)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase inhibitor activity (GO:0004862)|cAMP-dependent protein kinase regulator activity (GO:0008603)|protein kinase A catalytic subunit binding (GO:0034236)|ubiquitin protein ligase binding (GO:0031625)			adrenal_gland(4)|breast(2)|endometrium(1)|kidney(1)|large_intestine(5)|liver(2)|lung(8)|soft_tissue(2)|stomach(2)|testis(1)|thyroid(2)|upper_aerodigestive_tract(1)	31	Breast(10;1.64e-13)					TCAGGGAATACTTTGAGAGGTT	0.401			"""T, Mis, N, F, S"""	RET	papillary thyroid	"""myxoma, endocrine, papillary thyroid"""			Primary Pigmented Nodular Adrenocortical Disease, Familial;Carney Complex;Cardiac Myxomas, Familial Clustering of																												p.Y53fs	Ovarian(167;637 1670 33025 39608 46699 51856)	.	yes	"""Dom, Rec"""	yes	Carney complex	17	17q23-q24	5573	"""protein kinase, cAMP-dependent, regulatory, type I, alpha (tissue specific extinguisher 1)"""		"""E, M"""	.	PRKAR1A-1141	0			c.159_160insT						.																																			SO:0001589	frameshift_variant	5573	exon1	Familial Cancer Database	iPPNAD, PPNAD1, incl. familial micronodular adrenocortical hyperplasia, PPNAD2;Carney syndrome, NAME syndrome, LAMB syndrome, Familial Myxoma syndrome;	GGAATACTTTGAG		CCDS11678.1, CCDS62307.1	17q24.2	2014-09-17	2012-07-31		ENSG00000108946	ENSG00000108946	2.7.11.1		9388	protein-coding gene	gene with protein product	"""Carney complex type 1"""	188830	"""tissue specific extinguisher 1"""	PRKAR1, TSE1		3479018, 10973256	Standard	NM_212471		Approved	CNC1	uc002jhg.4	P10644	OTTHUMG00000180128	ENST00000589228.1:c.162dupT	17.37:g.66511702_66511702dupT	ENSP00000464977:p.Phe54fs	Somatic	78	2		WXS	Illumina GAIIx	Phase_I	173	118	NM_001276290	0	0	0	0	0	K7ER48|Q567S7	Frame_Shift_Ins	INS	ENST00000589228.1	37	CCDS11678.1																																																																																			.		0.401	PRKAR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449884.1		
